UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Biological implications of leukocyte responsiveness to tumour-derived relaxin Figueiredo, Kevin A. 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-199749.pdf [ 18.42MB ]
Metadata
JSON: 831-1.0092919.json
JSON-LD: 831-1.0092919-ld.json
RDF/XML (Pretty): 831-1.0092919-rdf.xml
RDF/JSON: 831-1.0092919-rdf.json
Turtle: 831-1.0092919-turtle.txt
N-Triples: 831-1.0092919-rdf-ntriples.txt
Original Record: 831-1.0092919-source.json
Full Text
831-1.0092919-fulltext.txt
Citation
831-1.0092919.ris

Full Text

BIOLOGICAL IMPLICATIONS OF LEUKOCYTE RESPONSIVENESS TO TUMOUR-DERIVED RELAXIN by Kevin A Figueiredo A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Faculty of Graduate Studies (Genetics) University of British Columbia August 2006 © Kevin A Figueiredo, 2006 A B S T R A C T Leukocytes are critical effectors of inflammation and tumour biology. Chemokine-like factors produced by such inflammatory sites are key mediators of tumour growth that activate leukocytic recruitment and tumour infiltration and suppress immune surveillance. The endocrine peptide hormone, relaxin has been implicated as a regulator of breast and prostate cancer progression. We have shown that relaxin is a regulator of leukocyte biology with properties important in recruitment to sites of inflammation. Our studies demonstrate upregulated relaxin gene expression during neuroendocrine differentiation of the human prostate cancer model, LNCaP. To examine the impact of relaxin on host cells associated with adenocarcinomas, we generated recombinant 6 His-tagged relaxin (RLXH) in a mammalian expression system. This immunoreactive and biologically active relaxin preparation was used to screen a variety of cell types for cAMP responsiveness. Of the cell types screened, none were more responsive to R L X H than the monocyte/macrophage cell line THP-1 and peripheral blood mononuclear cells (PBMC). Our studies indicate that relaxin promotes cell-cell clustering, substrate adhesion, and migratory capacity of mononuclear leukocytes in a relaxin dose-dependent manner proportional to cAMP accumulation. We demonstrate that these biological responses occur through a relaxin receptor LGR7-dependent mechanism likely involving cAMP-dependent regulation of the small GTPase Rapl. Relaxin-stimulated cAMP accumulation was observed to occur primarily in non-adherent cells, and relaxin-stimulated substrate adhesion also resulted in enhanced chemotaxis to monocyte chemoattractant protein-1. We demonstrate for the first time that the classic hormonal role for relaxin as a regulator of epithelial and stromal functions, can now be expanded to include a role in targeting blood cells as a cytokine with chemokine-like properties. In addition, we describe novel roles for relaxin in mediation of macrophage activation states with important implications in the context of tumour-induced inflammation and immunosuppression. n TABLE OF CONTENTS Abstract ii Table of Contents iii List of Tables vi List of Figures vii Abbreviations. ix Preface xi Contribution of Authors xii Acknowledgement xiv CHAPTER 1 - Introduction 1 Relaxin and cancer 2 Relaxin and its relatives 4 Relaxin - a myriad of targets with a myriad of functions 6 Relaxin - a tumour-derived factor capable of affecting malignant progression 9 Relaxin and the leukocyte infiltrate 12 Relaxin - unique functions that benefit phenotype 15 Goals of thesis 16 References 26 CHAPTER 2 - Demonstration of upregulated H2 relaxin mRNA expression during neuroendocrine differentiation of LNCaP prostate cancer cells and production of biologically active mammalian recombinant six histidine tagged H2 relaxin 40 Introduction 41 Materials and Methods 42 Results and Discussion 44 Relaxin is upregulated during neuroendocrine differentiation in LNCaP prostate cancer cells 44 Mammalian recombinant R L X H is biologically active 44 Monocytes are responsive to R L X H 45 References 51 iii CHAPTER 3 - Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism 53 Introduction 54 Materials and Methods 57 Results 61 Relaxin activates adenylate cyclase and stimulates adhesion of non-adherent THP-1 cells 61 Relaxin stimulates substrate adhesion of THP-1 cells 62 Relaxin stimulates migration of THP-1 cells 62 Relaxin augments migration of THP-1 cells towards MCP-1 63 Relaxin activates adenylate cyclase, promotes adhesion and enhances migration of peripheral blood mononuclear cells 65 Short hairpin targeting suppresses LGR7 mRNA and protein levels in THP-1 cells 65 LGR7 is required for relaxin-regulated adenylate cyclase activation in THP-1 cells 67 LGR7 is required for relaxin-regulated migratory potential in THP-1 cells 67 Discussion 68 References 85 CHAPTER 4 - Relaxin promotes Rapl activation and regulates clustering, migration and activation states of mononuclear myelocytic cells 92 Introduction 93 Materials and Methods 95 Results and Discussion 98 Relaxin stimulates Rap-1 activation in monocytes 98 Relaxin enhanced adhesion and migration is time- and substrate-dependent 99 Relaxin augments clustering of monomyelocytic cells 101 Relaxin selectively impairs migration of macrophages capable of nitric oxide production 102 Relaxin alters the activation states of macrophages 103 Conclusion 106 References 120 iv CHAPTER 5 - Conclusion: A model for tumour-derived relaxin mediation of the immune response 124 Characterization of the relaxin molecule as a mediator of immune responses 126 Positive feedback model of relaxin-regulated tumour inflammation 130 Future direction 133 References 139 CHAPTER 6 - Appendix 142 Appendix 6-1 - Nucleotide and amino acid sequence comparisons of human and mouse relaxins and LGR7s 144 Appendix 6-2 - Production of human recombinant six-histidine tagged relaxin H2 (RLXH).. . 150 Appendix 6-3 - Relaxin expression, relaxin receptors and responses in cancer cells 163 Appendix 6-4 - Cloning and expression of LGR7 in HEK293T cells 170 Appendix 6-5 - Cloning and expression of LGR7 shRNA and screening of recombinant THP-1 cells for impaired relaxin-induced cAMP accumulation 176 Appendix 6-6 - Relaxin-regulated responses in other immune cells 182 References 185 LIST OF T A B L E S Table 1.1- Relaxin stimulates cAMP production in target tissues 17 Table 1.2 - Relaxin binding tissues 18 Table 1.3 - Components of the IL-1 system are coordinately regulated by polarization of human macrophages in M l or M2 direction 20 Table 2.1 - Cells tested for cAMP responsiveness to R L X H stimulation 47 Table 6-4.1 - Relaxin receptors and relaxin binding proteins 173 vi LIST OF FIGURES Figure 1.1 - Canadian cancer incidence and mortality rates 21 Figure 1.2 - Progression of prostate cancer over time towards an androgen independent state...22 Figure 1.3 - Relaxin - a unique insulin family member 23 Figure 1.4 - The current understanding of relaxin signalling and potential phenotypic consequences during tumour progression 24 Figure 1.5 - The monocyte/macrophage equilibriums involved in cancer progression 25 Figure 2.1 - Relaxin mRNA expression is upregulated during neuroendocrine differentiation of prostate cancer cells, LNCaP 48 Figure 2.2 - Purification of R L X H from 293T-RLXH conditioned media 49 Figure 2.3 - R L X H induces cAMP accumulation in LGR7-expressing HEK293T cells 50 Figure 3.1 - Relaxin stimulates adenylate cyclase activation and substrate adhesion of THP-1 cells 73 Figure 3.2 - Relaxin stimulates migration of THP-1 cells 75 Figure 3.3 - Relaxin regulates peripheral blood mononuclear cell biology 77 Figure 3.4 - shRNA suppression of LGR7 expression in recombinant THP-1 cells 79 Figure 3.5 - Suppression of LGR7 expression impairs relaxin-induced adenylate cyclase activation and migration of THP-1 cells 81 Figure 3.6 - LGR7 target sequences for design of pHR-CMV-eGFP shRNA constructs used for lentiviral infection of THP-1 cells 83 Figure 4.1 - Relaxin enhances turbulence-induced Rapl activation 107 Figure 4.2 - Relaxin-induced adhesion and migration of THP-1 cells is optimal at 24 h 109 Figure 4.3 - Relaxin stimulates clustering of THP-1 cells I l l Figure 4.4 - Adenylate cyclase and migratory responses of RAW macrophages 113 Figure 4.5 - Relaxin regulates cytokine profiles of macrophages 115 Figure 4.6 - Relaxin regulates activation states of macrophages 118 vii Figure 5.1 - Novel physiological consequences of relaxin stimulation in leukocytes 136 Figure 5.2 - A model for relaxin-mediated immune regulation in the context of inflamed tumour tissue ...137 Figure 6-1.1 - Nucleotide and amino acid sequence comparisons of human and mouse relaxins and LGR7s 144 Figure 6-2.1 - Cloning of R L X H 154 Figure 6-2.2 - HEK293T cells transfected with pcDEF3-eGFP and pcDEF3-RLXH 156 Figure 6-2.3 - Time course analysis of R L X H accumulation in conditioned media of HEK293T cells transfected with pcDEF3-RLXH construct 158 Figure 6-2.4 - R L X H elution profile from 293T-RLXH cells cotransfected with prohormone convertase 1 160 Figure 6-2.5 - Characterization of R L X H 161 Figure 6-3.1 - R L X H expression in LNCaP cells 167 Figure 6-3.2 - Relaxins, receptors and responses in cancer cell lines 168 Figure 6-4.1 - LGR7 expression in HEK 293T cells 174 Figure 6-5.1 - Plasmid constructs used for shRNA 178 Figure 6-5.2 - GFP expression of recombinant THP-1 cells 180 Figure 6-5.3 - Adenylate cyclase responses of recombinant THP-1 cells 181 Figure 6-6.1 - Adenylate cyclase and migratory responses of immune cells 183 V l l l ABBREVIATIONS RLX, relaxin R L X H , six histidine-tagged recombinant human H2 relaxin LGR7, leucine rich repeat G-protein coupled (relaxin) receptor GPCR, G-protein coupled receptor cAMP, cyclic adenosine monophosphate PKA, protein kinase A MCP-1, monocyte chemoattractant protein-1 CCR2, MCP-1 receptor PBMC, peripheral blood mononuclear cells shRNA, short hairpin RNA interference PSA, prostate serum antigen MMP, matrix metalloproteinase NO, nitric oxide NOS, nitric oxide sythetase IGF, insulin growth factor IGFBP, insulin growth factor binding protein RLF, relaxin-like factor EGF, epidermal growth factor VEGF, vascular epidermal growth factor bFGF, basic fibroblast growth factor E C M , extracellular matrix T A M , tumour associated macrophage IL, interleukin IFN, interferon TNF, tumour necrosis factor LPS, lipopolysaccharide 1CAM, intracellular adhesion molecule NE, neuroendocrine ix RBD, Rap binding domain GEF, guanine nucleotide exchange factor Epi, epinephrine FSK, forskolin IBMX, isobutylmethylxanthine TBP, TATA-binding protein Cp, threshold cycle PMA, phorbol 12-myristate 13-acetate PKC, protein kinase C GF109203X, broad spectrum PKC inhibitor PREFACE This thesis has been prepared in accordance with University of British Columbia Faculty of Graduate Studies guidelines for thesis preparation available at http://www.grad.ubc.ca . This thesis has been prepared in a manuscript format as recommended by the Director of the Genetics Graduate Program (http://www.genetics.ubc.ca). Chapter 1 is a literature review of relaxin biology in the context of cancer progression supplemented by references to findings from our lab in subsequent chapters. Chapter 2 is a published manuscript describing upregulation of relaxin during neuroendocrine differentiation of prostate cancer cells and production of human recombinant relaxin. Chapter 3 is a published manuscript describing relaxin-mediated leukocyte adhesion and migration through a relaxin receptor signalling pathway. Chapter 4 is a manuscript in preparation which expands on relaxin signalling in leukocytes and describes relaxin-mediated alteration of macrophage activation states. Chapter 5 is a concluding chapter discussing the broader context of the novel findings in Chapters 2, 3 and 4. Chapters 1 and 5 constitute the basis of a review manuscript in preparation. Chapter 6 includes unpublished novel data and the supplemental or preliminary material which eventually resulted in the manuscript chapters. All chapters contain their own list of references. xi C O N T R I B U T I O N O F A U T H O R S This thesis has been written and compiled by the author of the thesis under the supervision of Dr. Michael E. Cox. All studies were performed at the Prostate Centre, Jack Bell Research Laboratories, Vancouver General Hospital and University of British Columbia. This work was supported by operating grants from the National Cancer Institute of Canada, and fellowship support from the Canadian Prostate Cancer Research Initiative (KAF, JBP), and the Michael Smith Foundation for Health Research (MEC, CCN). Chapter 2 has been published in the Annals of New York Academy of Sciences1. This manuscript was written and compiled by the author of the thesis (first author) with the supervision and assistance of Dr. Michael E. Cox (last author). Experiments required for Figure 2.1 were performed by postdoctoral fellow Jodie Palmer (second author). All other experiments, figures and tables were performed by the author of this thesis under the supervision of the last author. Dr. Alice Mui (third author) and Dr. Colleen Nelson (fourth author) provided valuable advice and critical review of the manuscript. Chapter 3 has been published in the Journal of Biological Chemistry . This manuscript was written and compiled by the author of the thesis (first author) with the supervision and assistance of Dr. Michael E. Cox (last author). All experiments and figures were performed by the author of this thesis under the supervision of the last author. Technical assistance was provided by Elaine Vickers and James Peacock in production of Figures 3.4A and 3.4B respectively. Dr. Alice Mui (second author) and Dr. Colleen Nelson (third author) provided valuable advice and critical review of the manuscript. (1) Figueiredo, K.A., Palmer, J.B., Mui, A.L., Nelson, C.C. & Cox, M.E. Demonstration of Upregulated H2 Relaxin mRNA Expression during Neuroendocrine Differentiation of LNCaP Prostate Cancer Cells and Production of Biologically Active Mammalian Recombinant 6 Histidine-Tagged H2 Relaxin. Ann N Y Acad Sci 1041, 320-7 (2005). (2) Figueiredo, K.A., Mui, A.L., Nelson, C.C. & Cox, M.E. Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism. J Biol Chem 281, 3030-9 (2006). xn Chapter 4 is a manuscript in preparation. This manuscript was written and compiled by the author of the thesis with the supervision and assistance of Dr. Michael E. Cox. Technical advice was provided by Laura Sly and Dr. Alice Mui. All chapters in this thesis are also products of valuable advice from PhD supervisory committee members: Drs. Calvin Roskelley, Gerald Krystal, Alice Mui, Colleen Nelson and Michael E. Cox. xiii ACKNOWLEDGEMENTS Firstly, I thank my supervisor Michael E Cox for his expert advice, guidance and insights in all aspects of this project, as well as his patience with this relaxin' project. I thank him for encouraging me to do better and for his friendship over the years. I thank Colleen Nelson for introducing me to relaxin and for her advice on relaxin biology. I thank Alice Mui for critically reviewing our manuscripts, and I thank her and Gerald Krystal for helping me to understand the importance of the immune system in cancer progression. I thank Calvin Roskelley for his insights on cellular adhesion mechanisms. I thank John Cavanaugh, Jodie Palmer, Elaine Vickers, James Peacock and Robert H Bell for technical assistance, and Megan Levings, Christopher Ong and Laura Sly for helpful discussion. I thank members of the Cox lab group for their insightful comments during our weekly lab meetings, and many other members of the Prostate Centre for their assistance throughout my graduate education. I thank my friends and family for their support and encouragement, especially my mother Maria Figueiredo and my brothers Trevor and Nigel. I thank my father Brian Figueiredo who taught me more than I can say. I dedicate this thesis to my father Brian Figueiredo who passed away unexpectedly in March 2001. xiv CHAPTER 1 Introduction 1 Overview Prostate cancer and breast cancer are the most frequently diagnosed cancers among Canadian men and women (Fig 1.1). Prostate cancer is close behind colorectal cancer as the third leading cause of cancer-related deaths in men, whereas breast cancer is second only to lung cancer as the leading cause of cancer-related deaths among women. Prostate cancer cells express differentiation markers such as prostate serum antigen (PSA) and are dependent on androgen for 1 2 growth ' (Fig 1.2). A subclone of cancer cells emerges under the selective pressure of androgen ablation therapy and these are no longer dependent on androgen for growth or survival. This subclone is responsible for hormone-refractory disease for which effective therapies do not exist. The classic model for prostate cancer progression describes how a single epithelial cell can give rise to histological cancer. After androgen ablation, a few cancer cells are almost invariably able to adapt or were inherently androgen-independent, and these then expand to produce lethal disease. The role of the leukocyte infiltrate is not well understood, and until recently has often been underestimated - an epithelial cancer does not proliferate without the assistance of its microenvironment 3 ' 4 . A tumour must be able to send and respond to signals from stromal and hemopoeitic cells. This thesis describes that one of the ways a tumour may be able to communicate with its microenvironment is through the production and secretion of the relaxin peptide. Relaxin and cancer Relaxin was discovered in the 1920s by Frederick Hisaw, who observed that serum obtained from pregnant guinea pigs could induce widening of the birth canal when infused into nonpregnant animals \ and the factor responsible was later extracted from ovaries during 2 pregnancy 6 . The word 'relaxin' is derived from the word 'relaxation' which is evident in the titles of these original manuscripts 5 ' 6 . Relaxin is classically described to improve blood supply to multiple organs including the uterus, mammary gland, lung and heart1. Relaxin is also known to increase matrix metalloproteinase (MMP) expression resulting in collagen turnover of reproductive tissues and in models of fibrosis, and is responsible for lengthening of the interpubic ligament during delivery 7 - 1 °. Roles for "relaxin-like" peptides in cancer were last reviewed in 2003 ' 1 . While avoiding overlap, the current introductory chapter of this thesis aims to provide a novel perspective of relaxin in the context of cancer progression and the immune response, and focuses solely on the role of the relaxin peptide itself. The current chapter is supplemented by references to novel findings from our lab including relaxin's critical role in regulation of immune responses. A role for relaxin in cancer progression was first suggested 39 years ago by studies indicating that carcinogen-fed rats experienced substantially enhanced mammary tumour growth when co-treated with relaxin several weeks later . More recently, relaxin has been shown to support in vitro growth and invasiveness of breast cancer cells 1 3 " 1 5 , and relaxin stimulates nitric oxide (NO) production in breast cancer cells l 6 , which is correlated with cancer progression (reviewed in 17"19). Relaxin can also induce growth and differentiation in mouse mammary 20 glands . Relaxin immunostaining has been demonstrated in epithelial and myoepithelial cells of normal and cancerous breast cells and significantly higher levels of relaxin staining occur in neoplastic breast tissues as compared to normal breast tissue 2 2 . Relaxin serum levels were positively correlated with breast cancer metastases in women, and breast cancer patients with progressing metastatic disease had higher circulating relaxin levels than those without 23 24 metastases ' . 3 Similarly, relaxin is produced by the normal prostate " and expressed in prostate cancer cell lines LNCaP, DU145 and PC3 3 0 , 3 O u r lab has demonstrated that relaxin expression is upregulated in LNCaP cells undergoing neuroendocrine differentiation and that relaxin can induce modest cAMP responses in LNCaP and PC3 prostate cancer cells 3 2 (Chapter 2). Subsequently, relaxin has been implicated in increased tumour growth and angiogenesis of PC3 prostate cancer xenografts j 3 and in androgen independent growth of an LNCaP cell line with a p53 gain of function mutation 3 4 . The LNCaP tumour model is a well-characterized prostate cancer model that mimics many aspects of the clinical course of human prostate cancer progression both in vitro and in vivo, and is therefore useful for defining molecular mechanisms of prostate cancer progression to androgen independence 3 5 . Together, these studies strongly implicate relaxin in breast and prostate cancer progression. Relaxin and its relatives Relaxin is now classified as an insulin superfamily member closely related to the insulin growth factors (IGFs) (Fig 1.3), which are strongly implicated in progression of a number of malignancies including prostate cancer (reviewed in ). IGFs promote cell cycle progression and inhibition of apoptosis, and their bioavailability is modulated by IGF binding proteins (IGFBP). M . Cox's lab has shown that IGF-1 mediates protection from apoptotic stress and enhances mitotic activity in LNCaP cells in an androgen dependent-manner 3 1 . However, these responses are not dependent on androgens in the androgen-independent lineage-derived cell line C4-2 because they exhibit enhanced IGF-1-mediated phosphorylation and signalling events under androgen-deprived conditions . 4 Each of the insulin superfamily members contains disulfide-bonded A- and B- chains, and the C-chains vary in length (Fig 1.3). Processing of proinsulin and prorelaxin results in removal of these centre peptides, although this C-centre peptide remains intact during processing of the IGFs. In humans, relaxin is encoded by three genes designated HI, H2 and H3 (Appendix 6-1), and this relatively new relaxin subfamily now includes several close relatives LNSL3/RLF, INSL4, INSL5/RIF2 and INSL6/RIF1 9 . Relaxin HI exists only in humans and primates 2 7 , and it is thought to originate from a gene duplication event of relaxin H2 3 8 . Although the prostate is one of the few tissues where relaxin HI is expressed, it is unclear whether it is expressed at sufficient levels to be detected in the blood or prostatic fluid 1 0 . Because sequence analysis demonstrates that relaxin HI is 90% identical to relaxin H2 (Appendix 6-1), these two relaxin isoforms likely have overlapping and redundant functions. Relaxin H3 is able to stimulate the primary relaxin H2 receptor LGR7 (albeit at two-fold reduced levels compared to relaxin H2). Two novel GPCRs, GPCR 135 and 142, have recently been characterized as the primary and exclusive relaxin H3 receptors 3 9 ' 4 0 . Although relaxin H3 itself was only discovered in 2002 4 1 , it is thought to be the ancestral relaxin isoform 4 2 . Relaxin H3 and its receptors are predominantly confined to the brain, and little is known about their signalling mechanism. Relaxin H2 shares 64% sequence identity with mouse relaxin 1 (Appendix 6-1), and it is the functional equivalent to relaxin 1 in non-primates. Because relaxin H2 is responsible for by far most of the diverse and pleiotropic functions of the relaxin peptides, including those currently implicated in cancer progression (reviewed in 7' l 0'") 5 relaxin H2 is the relaxin isoform selected for the studies described in this thesis. Relaxin H2 is often referred to simply as relaxin in this thesis. 5 Relaxin - a myriad of targets with a myriad of functions In spite of the large array of relaxin's biological effects (reviewed in 7 , 1 ° ) , the fundamental signalling pathways remain poorly understood (Fig 1.4). A large part of the controversy surrounding details of relaxin signalling may be due to different relaxin receptors in different cell types and different mechanisms of relaxin action on different cell types. Prior to the discovery of two relaxin-responsive G-protein coupled receptors (GPCRs), LGR7 and LGR8, there was speculation about the existence of a tyrosine kinase receptor for relaxin (Fig 1.4A). Because all other insulin-family member receptors (with the sole exception of IGF-IIR, which also has been characterized as a mannose 6-phosphate receptor and a perforin receptor 4 3' 4 4) are tyrosine kinase receptors, it was suggested that by analogy, relaxin - with such high homology to insulin - would also activate a tyrosine kinase receptor 4 5 ~ 4 8 . This assumption was supported by evidence indicating that tyrosine kinase inhibitors blocked relaxin signalling, and that relaxin could induce tyrosine phosphorylation of a > 200 kD protein postulated to be the receptor 45>46>48 (Appendix 6-4) . Opponents of this theory believed that the relaxin receptor was a GPCR and pointed to the battery of evidence showing that relaxin induces an acute-phase increase in cAMP production in a variety of different cell types and tissues 45>49"64. Unfortunately, there has been no standardization in the way cAMP is measured, and it is often reported in units that are not well defined (Table 1.1). The discovery of LGR7 and LGR8 as relaxin-responsive GPCRs in January 2002 6 5 subdued the dispute, although questions about tyrosine kinase activity remain unaddressed 6 6 . LGR7 has since been classified as the primary relaxin receptor because LGR8 requires relaxin stimulation at a 3.5-fold greater concentration than that required by LGR7 to induce the same cAMP response in vitro 6 5 , and relaxin can interact only weakly, if at all, with 6 LGR8 in vivo . LGR8 is now characterized as the primary receptor for another insulin family member, relaxin-like factor (RLF or INSL3), and so the relevance of LGR8 in relaxin signalling remains to be resolved. Recently, relaxin has been reported to interact with the glucocorticoid /TO receptor and stimulate its nuclear translocation (Fig 1.4A). It has been extensively documented that a tumour cell is able to manipulate its stromal and endothelial environments to enhance its own survival and growth. Critical aspects of prostate tumour progression involve metastasis of the epithelial tumour to a stromal bone environment and induction of angiogenic pathways by regulation of endothelial tissue, as well as regulation of the hemopoeitic microenvironment. Relaxin has been attributed with regulation of several intermediary responses or intracellular signalling events in a variety of cell types. These include cAMP, PKA 4 5 ' 4 9 - 6 4 , MAPK, CREB 6 9 , tyrosine phosphorylation 4 5 ' 7 0 , nitric oxide synthase (NOS) activation l 6 ' 7 1 " 7 8 5 and calcium 36>79~84 (Fig 1.4B). These intermediary signalling events are then implicated in the upregulation of matrix metalloproteinases (MMPs) ' " , epidermal growth factor (EGF) 8 9 , insulin-like growth factor (IGF) 9 0 ' 9 1 , IGF binding proteins 9 2 , guanylyl cyclase activation 1 6 ' 7 3 ' 7 5 and vascular endothelial growth factor (VEGF) 6 9 ' 8 8 ' 9 3 (Fig 1.4C). Studies describing relaxin's effects on hemopoeitic cells are limited; however, in inflammatory wound sites, relaxin also induces V E G F and basic fibroblast growth factor (bFGF) production in macrophages 9 3 . Prevailing questions are whether the ability of tumours to secrete relaxin affects the surrounding stromal and endothelial cells or hemopoietic cells, and whether relaxin can stimulate and/or recruit these cells to produce factors that promote tumour survival and growth. Our lab has demonstrated that relaxin can induce adhesion and a migratory response 9 4 and regulate the activation states of hemopoeitic cells (Chapter 3, 4). This thesis extends the limited 7 studies of relaxin's effects on hemopoeitic cells, and contributes to a broader understanding of the biological implications of this peptide on tumour physiology. One of the few aspects of relaxin biology that is not entirely controversial is the relatively good correlation between general relaxin binding locations and general relaxin functions in a diverse variety of tissues and cell types as shown in Table 1.2. In most of these experiments, large excesses of other insulin family members were unable to displace binding of the labelled relaxin to its receptor suggesting that a distinct receptor for relaxin exists in these cell types. However, the interpretation of these binding experiments is complicated by the interspecies binding differences between ligand and receptor. For example, the relative affinities of human and porcine relaxin for the human relaxin receptor is unclear, although their respective affinities in mice and rats are suggested to not differ 9 5 . There is also the possibility that relaxin is binding to proteins other than its receptor, analogous to IGF binding to insulin growth factor binding proteins (IGFBPs). Although relaxin binding patterns conform well to the pleiotrophic actions of this hormone, the specific cell types involved in this binding, the specific molecular mechanisms that dictate the binding, and the specific effects of relaxin on any of this myriad of potential targets remain unclarified. In addition, there is diversity in the physiological effects of relaxin among species including its role during pregnancy 9 6 ' 9 7 . This thesis will address some of these issues by screening for relaxin responsiveness in a variety of cells normally found within the context of an adenocarcinoma. Specifically, this thesis will focus on the role of relaxin in cells of the immune system in order to clarify molecular mechanisms of relaxin signalling and examine the biological repercussions of this signalling. 8 Relaxin - a tumour-derived factor capable of affecting malignant progression The relaxin hormone is emerging as a putative mediator of tumour progression and these key features required of a tumour-derived factor capable of affecting malignant progression are summarized here (Fig 1.4). For example, relaxin may have a role in cancer progression reminiscent of its classic effects on the female reproductive system including promotion of angiogenesis, cellular growth and collagen remodelling. Relaxin-regulated induction of stromal factors influencing the epithelium and extracellular matrix (ECM) during reproduction is perhaps a microcosm of these influences during breast and prostate cancer progression. Relaxin causes a dramatic increase in the protein-synthesizing machinery of endometrial and ovarian stromal cells 9 8 , and uterine receptivity may be regulated by relaxin-mediated stromal-derived HB-EGF 8 9 . Relaxin can promote trophoblast invasion 9 9 and relaxin-regulated collagen remodeling further contributes to implantation of the zygote 1 0 ° . Therefore, relaxin is sufficient to mediate remodelling of the extracellular matix during mammalian reproduction (Fig 1.4C). Relaxin also promotes growth of reproductive tissues both in vitro and in vivo 1 0 M 0 3 5 and relaxin regulation of the IGF-axis is particularly important in the local control of growth in a number of reproductive tissues 9 1 0 4 - 1 0 6 Relaxin stimulates IGFBP-1 secretion from human decidual cells 1 0 4 and human endometrial stromal cells in vitro 9 2 ' 1 0 5 . Relaxin increases DNA synthesis and cell proliferation of granulosa and theca cells in vitro l 0 6 , and promotes IGF-I secretion from granulosa cells in the pig ovary 9 1 . Relaxin administration in pigs promotes growth l 0 1 " 1 0 3 and increases secretion of uterine IGF-I, IGF-II, IGFBP-2, and IGFBP-3 9 1 . Therefore, relaxin can indirectly mediate growth of the reproductive tract by influencing growth factor production and availability during mammalian reproduction (Fig 1.4C). 9 Uterine growth and remodeling during pregnancy requires a constant supply of additional vasculature, and relaxin stimulation of uterine vascularization has been demonstrated * • 1 0 7 1 0 8 * • histologically ' . Relaxin-induction of uterine blood vessel formation is required for implantation of the embryo. Relaxin may be an important local regulator of uterine angiogenesis by controlling expression of vascular endothelial growth factor (VEGF), an endothelial cell-specific growth factor with essential roles in endometrial vascularization 1 0 9 . For example, relaxin regulates V E G F stimulation of uterine angiogenesis and vascular permeability during implantation "°. Relaxin stimulates the expression of V E G F in glandular epithelial and stromal 88 cells . Relaxin also stimulates V E G F expression in the human endometrial stromal cell line, ESC 6 9 ' 1 1 0 . Relaxin was administered to women as a treatment for sclerosis at 10 times higher dosage than that which occurs during pregnancy, and heavier than usual or irregular menstrual bleeding was reported as the most frequent relaxin-related adverse effect n o . The increased relaxin present in the circulation during pregnancy may also be responsible for up-regulation of nitric oxide (NO) biosynthesis in the uterus 7 6 , thereby contributing to the angiogenic effect. Therefore, relaxin is sufficient to mediate angiogenesis and neovascularization during mammalian reproduction (Fig 1.4C). Relaxin is also a critical regulator of extracellular matrix remodelling and angiogenesis in non-reproductive physiology. Relaxin regulates MMP expression and collagen remodelling in a 85 87 111 113 variety of other cell types and tissues ! " . Relaxin decreases accumulation of collagens in 119 111 human normal and scleroderma fibroblasts , human lung fibroblasts , equine stromal cells 111 85 113 , and in vivo in rodent and murine models . Relaxin can also diminish allergic reactions by inhibiting mast cell degranulation 1 1 4 and impairing fibrosis through MMP-regulated collagen degradation 1 1 5 ' " 6 . Relaxin-induced MMP production enhances invasiveness of breast cancer 10 cells, SK-BR3 and MCF-7 1 5 , and relaxin has been shown to also upregulate MMP production in macrophages " 7 . Upregulation of MMP expression and activity is often detected in many tumour, tissues, likely because they promote invasion and metastasis via degradation of the basement membrane and extracellular matrix (ECM) 1 1 8 " 1 2 0 . Hence relaxin-mediated MMP activity from either the epithelial or hemopoeitic cells will likely provide a path for tumour escape into the bloodstream (Fig 1.4C). Relaxin was also studied as a potential therapeutic agent for ischemic wounds since it was able to induce new blood vessel formation at wound sites 9 3 . Relaxin will induce both V E G F and bFGF in cells collected from wound sites, which often consist of macrophages. THP-1 cells, the monocytic/macrophage cell line, were shown to produce V E G F and bFGF in response to 93 relaxin . Therefore, relaxin may promote wound healing by stimulating angiogenesis and increasing blood supply via the induction of V E G F and bFGF in wound macrophages. Relaxin influences renal hemodynamics and glomerular filtration rate, and it also may have a protective role in heart disease since it stimulates coronary blood flow and new blood vessel formation in 7^121122 123124 myocardium ' . Relaxin has vasodilatory properties ' , modulates the vasoconstrictors, endothelin I and angiotensin II , and myocardial expression of relaxin is correlated with severity of heart disease l 2 5 . In the rat myocardial infarct model, relaxin stimulates angiogenic cytokine expression and blood vessel formation 1 2 2 . Relaxin stimulates increased coronary flow through production of NO 7 2 , and in guinea pig hearts, relaxin counteracts myocardial damage 76 via a NO pathway . NO-mediated mechanisms for promotion of growth, invasion and metastasis include a stimulatory effect on tumour cell invasiveness, promotion of tumour angiogenesis and blood flow, and suppression of host anti-tumour defense (reviewed in l7"19). Interestingly, nitric oxide may be important in relaxin-impaired migratory responses in mast 11 cells 7 1 and platelets 7 3 and the polymorphonuclear leukocytes: neutrophils 7 7 and basophils 7 8 . In this thesis, relaxin-induced production of nitric oxide is shown to be important in impairment of the migratory response of macrophages (Chapter 4). In summary, relaxin-mediated stromal, endothelial and hemopoeitic regulation is required for implantation, for E C M remodelling, for growth of the uterus and for enhanced neovascularization during reproduction. Similar features of relaxin also make it a critical regulator of homeostasis in non-reproductive biology. It is likely that similar physiological consequences will be observed from similar targets in the context of cancer progression (Fig 1.4). Relaxin and the leukocyte infiltrate While the leukocyte infiltrate of cancers is increasingly being appreciated as an essential contributor to tumour growth and progression in almost all adenocarcinomas 4 , our understanding of how their interactions with the tumour create this pro-tumour immunosuppressive microenvironment remains unclear. The leukocyte infiltrate includes predominantly macrophages and T cells, as well as natural-killer cells, B cells, eosinophils and granulocytes 3 ,4>126. The types, concentrations and combinations of cytokines and chemokines secreted by the epithelial tumour and the immune cells themselves determine the number of cells and the composition of the leukocyte infiltrate. Type-2 polarization is the result of the combinatorial influence of multiple cytokines on the local immune cells. This is predominantly characterized by T-helper 2 (Th2) cells which suppress cytotoxic T cell activity l 2 7 , and type-2 macrophages (M2) which also produce immunosuppressive cytokines l 2 8 ' 1 2 9 . 12 The heterogeneity of cells of the mononuclear phagocytic system is a reflection of both their adaptability in responding to an array of microenvironmental cues 1 3 0 and a continuum of maturation/activation states l 3 U 3 2 . The leukocyte infiltrate of tumours contains a large component of cells from one such monocyte/macrophage continuum 3 A 1 2 6 . These tumour-associated macrophages (TAM) are differentiated mature cells that can functionally interact with the tumour cells. Their complex interactions have been described by the "macrophage balance hypothesis" 1 3 3 . T A M can act as both positive and negative regulators of the immune system 1 3 4 ; although the prevailing perspectives favour a role in supporting tumour growth through production of growth factors and suppression of anti-tumour activity /6>'zy. The undifferentiated T A M precursor, the monocyte, is an essential prerequisite to this end. The "countercurrent principle" suggests that tumour-derived chemokines can actively recruit monocytes resulting in extravasation from the blood ] 3 i and digestion of the extracellular matrix, thereby contributing to a pathway for tumour escape and initiation of metastasis 1 3 6 ' 1 3 7 . Our lab has described a novel role for relaxin as a stimulator of leukocyte adhesion and chemomigration 9 4 (Chapter 3) with potential implications for tumour-induced immune cell recruitment. Recently, discrepancies in markers of mouse versus human macrophage activation have been described. For example, Th2 cytokines have been shown to induce Ym-1 expression in murine macrophages, and expression of arginase-1 in response to these cytokines is also established in the murine macrophage literature ' . However, the Th2 cytokine interleukin (IL)-4 is unable to induce Ym-1 and arginase-1 expression in human monocytes 1 4 0 , and although arginase-1 is prevalent in human polymorphonuclear cells, it is simply not expressed in human macrophages 1 4 1 . Raes et al provide a note of caution in that murine and human alternatively activated myeloid cells exhibit distinct differences l 4 ° . Because 13 monocytes/macrophages exist in a spectrum of differentiation and activation states 1 3 i n 2003 S. Gordon argues against the use of M l and M2 categorization 1 4 2 . In 2004, A. Mantovani argues for categorization of macrophages into M l and M2 because of correlation with the established dichotomy of T cells (Thl/Th2) 1 2 7 (Fig 1.5). He subcategorizes S. Gordon's "IL-4 and IL-13-induced alternative macrophages" into the M2a subtype. The large majority of studies in macrophage biology have been performed in mouse cells, so in most reviews the authors often do not distinguish between human and mouse macrophages. The assumption is that the biology will be similar in the two species, however, in macrophages, little evidence of this is provided. Given the recent discrepancies described in markers of alternate activation such as arginase-1 and Y m l 1 4 0 , it may be safer not to make such assumptions. Nonetheless, it is likely that IL-4 and IL-13 can induce alternative, immunosuppressive, tumour-promoting responses in both human and mouse macrophages 1 2 7' l 4 2> 1 4 3. The markers of these responses have not been well characterized in human cells, with the exception of the IL-1 system (Table 1.3). IL-1 (ie IL-1 a and IL-1P) and IL-1 receptor antagonist (IL-lra) are produced in human myeloid cells stimulated with lipopolysaccharide (LPS). IL-4 suppresses IL-113 production and increases expression of IL-lra in these cells 1 4 4 , 1 4 5 . IL-13 which shares the receptor chain IL-4Ra, similarly impairs production of IL-1 and enhances production of IL-lra 146>147. IL-13 treated cells also release the decoy receptor IL-1RII which has 2-fold less avidity for IL-lra than IL-1 p , 4 8 . Furthermore, transcriptional profiling of IL-13 stimulated cells reveals that IL-1RII and IL-lra are upregulated, whereas IL1P-converting enzyme (caspase 1) is downregulated with the resulting decrease in pro-IL-ip processing 1 4 9'. Together these data suggest that activation of the IL-4Ra through IL-4 or IL-13 can induce downregulation of the IL-1 signaling axis and this is correlated with an alternatively activated phenotype in macrophages. Interferon (IFN)-y has 14 opposite effects on IL-1 system regulation and stimulates the classic pathway of activation in macrophages (reviewed in 1 2 8). This thesis describes a role for relaxin in regulation of the differentiation and activation states of macrophages (Chapter 4). A successful tumour is able to recruit leukocytes by secreting diffusible molecular 126 mediator peptides . The secretion of these chemokines establishes a concentration gradient in the extracellular fluid, and the glycosaminoglycans on the endothelial surface are then able to present these molecules to leukocytes in the bloodstream. Subsequent chemokine receptor activation induces an allosteric switch in integrin affinity towards a high-affinity state 1 5 ° . This allows for integrin interaction with intracellular adhesion molecules (ICAM) on the endothelial cell, eventually resulting in trans-endothelial migration of the leukocyte into the inflamed tumour tissue. This tumour-induced extravasation of leukocytes also results in production of MMPs and digestion of the extracellular matrix, thereby contributing to a pathway for tumour escape and initiation of metastasis 1 3 6 ' 1 3 7 . Once at the tumour site, the monocyte will differentiate into a macrophage with either anti-tumour, or pro-tumour immunosuppressive properties. A tumour must be able to induce an inflammatory response to promote angiogenesis and proliferation, but it also must induce an immunosuppressive response in order to attenuate innate immunity (Fig 1.5). A tumour must also be able to retain macrophages in the vicinity to benefit from these immune functions. This thesis outlines a model for tumour-derived relaxin mediation of the immune response at multiple stages during progression. Relaxin - unique functions that benefit phenotype Target cells, and their biochemical responses to a particular hormone, are selected by their unique functions and benefits they bestow on phenotype. Relaxin and LGR7 knockout 15 mice exhibit impaired mammary gland development and parturition in females and impaired prostate growth and testes development in males 2 9 ' 1 5 1 ' l 5 2 s thereby further insinuating severe consequences of relaxin-axis disregulation during breast and prostate cancer progression. Relaxin-responsive cells have been selected for extracellular matrix degradation, cellular growth and angiogenesis during the evolution of female reproductive physiology and during the evolution of several components of normal mammalian biology. Perhaps relaxin-responsive hemopoeitic cells have been selected for chemomigratory responses during normal wound healing and inflammation 8 . Therefore, it is not inconceivable that these same relaxin-responsive cells may be selected for similar responses during the microevolution of metastatic cancer. The elucidation of specific fate commitment and differentiation pathways induced by relaxin in leukocytes, as described in this thesis, may provide molecular targets for selective inhibitors and activators, and hopefully may contribute to improving the prognosis of cancer patients. G O A L S O F THESIS (1) Determine whether neuroendocrine differentiation of prostate cancer cells results in increased expression of relaxin. (2) Determine whether tumour-derived relaxin may act in a paracrine/endocrine manner to influence host cells during disease progression. (3) Determine whether relaxin regulates leukocyte adhesion and chemomigration, and whether it has properties important in leukocyte recruitment to sites of inflammation. (4) Determine signalling pathways of relaxin-mediated effects on leukocyte biology. (5) Determine whether relaxin regulates leukocyte activation and differentiation states. 1 6 Table 1.1 - Relaxin stimulates cAMP production in target tissues (partial list) Relaxin Relaxin-induce c A M P Relaxin Exposure Cell Type Basal c A M P response response dosage Time Ref human monocytic cells (THP-1) - 50% -100% m a x3 1.5-15 nM 30 min 153 human monocytic cells (THP-1) 6 pmol/105 cells 39 pmol/10 5 c e l l s 3 17 nM 20-30 min 45 human monocytic cells (THP-1) 10fmol/105 cells 2 5 - 4 0 0 fmol/10 5 ce l l s ' 3 0.03-1 nM 30 min 51 human endometrial stromal cells (ESC) - 5 0 % - 1 0 0 % max 2 - 5 nM 20 min 153 human endometrial stromal cells (ESC) 0.6 pmol/105 cells 2.3 pmol/10 5 c e l l s 0 17 nM 20-30 min 45 human endometrial stromal cells (ESC) < 1 pmol/104 cells 25 pmol/10 4 cells d 17 nM 30 min 50 human breast adenocarcinoma cells (MCF-7) not determined 5.5 pmol/ confluent well in 24-well plate 0.01 -1 nM 96 h 13 human uterine segment fibroblast f « nmol/10 5 cells ( « nmol/10 5 cells) 0.1 -80 nM 15 min 46 ("no response") human myometrium ~ 4 pmol / min / mg ~ 10 pmol / min / mg e ~ 15 pmol / min / mg ~ 40 pmol / min / mg e 10 nM ? 52 rat muscle ~ 10 pmol / min / mg ~ 25 pmol / min / mg e ~ 24 pmol / min / mg ~ 50 pmol / min / mg e 10 nM 2.5 min 52 mollusc muscle ~ 8 pmol / min / mg ~ 30 pmol / min / mg e ~ 15 pmol / min / mg ~ 45 pmol / min / mg e 10 nM 2.5 min 52 requires 1000 |uM IBMX; requires 1 (iM forskolin and 50 uM IBMX; Requires 50 i^M IBMX; requires 500 u,M IBMX; Requires 1 I JM of the nonhydrolyzable G T P analog, Guanylyl-imidodiphosphate • 4Li (Gpp(NH)p); f Although relaxin could not induce a c A M P response in these cells, it was able to bind to and stimulate tyrosine phosphorylation of a 220 kD protein. 17 Table 1 . 2 - Relaxin Binding Tissues Tissue Cell Type or Region Species Detection Method Ref Known Functions mouse 125l-relaxin (porcine) 154 BRAIN rat human 32P-relaxin H 2 (human) L G R 7 and L G R 8 RTPCR 155 65 control of fluid balance HEART atria rat 32P-relaxin H 2 (human) 156 ionotropic chronotropic vascularization MAMMARY GLANDS epithelial, blood vessels human biotinylated-relaxin (porcine) 157 growth MAMMARY NIPPLES smooth muscle, epithelial, blood vessels, skin human biotinylated-relaxin (porcine) 157 differentiation vascularization OVARY theca, granulosa, luteal, blood vessels pig mouse human biotinylated-relaxin (porcine) 125l-relaxin (porcine) L G R 7 RTPCR 158 154 65 human biotinylated-relaxin (porcine) 157 human 32P-relaxin H 2 67 (human) growth UTERUS smooth muscle, epithelial, blood vessels fibroblast cell line mouse rat 125l-relaxin (porcine) 32P-relaxin H 2 (human) 154 155 vascularization myometrial quiescence rat L G R 7 antibody 65 implantation, maintenance of the embryo human L G R 7 and L G R 8 RTPCR 65 18 Table 1.2 (cont) - Relaxin Binding Tissues Tissue Cell Type or Region Species Detection Method Ref Known Functions CERVIX smooth muscle, epithelial, blood vessels human rat rat biotinylated-relaxin (porcine) 32P-relaxin H2 (human) LGR7 antibody 157 155 65 vascularization growth cervical ripening SYMPHYSIS PUBIS mouse 125l-relaxin (porcine) 154 collagen remodelling FETAL MEMBRANES chorion, decidua human 32P-relaxin H2 (human) 159 degradation of the fetal membrane extracellular matrix IMMUNE SYSTEM THP-1 cell line human 32P-relaxin H2 (human) 51 (see Chapters 3, 4) TESTES Leydig pig human mouse biotinylated-relaxin (porcine) LGR7 and LGR8 RTPCR LGR7 RTPCR 158 65 29 development sperm maturation rats biotinylated -relaxin 160 growth PROSTATE human mouse LGR7 RTPCR LGR7 RTPCR 65 29 development 19 Table 1.3 - Components of the IL-1 system are coordinately regulated by polarization of human macrophages in M1 or M 2 direction receptor signalling IL-1 R decoy IL-1 p converting antagonist receptor accessory receptor IL- enzyme Inducing Agents IL-1a IL-1 p IL-1 ra IL-1R protein 1RII Caspase 1 Ref IL-4 and IL-13 (M2 polarization) • \ 144 \ t 145 \ \ t ^ 147 t 148 t t f * 149 IFN-v ' i l l reviewed in (M1 polarization) f T T f 1 2 8 20 Male Female m PROSTATE Lung Colorectal Bladder Non-Hodgkln'G Lymphoma Kidney Leukemia Melanoma Oral Stomach Pancreas Brain Esophagus Multiple Myeloma Larynx Testis Thyroid Hodgkin's Disease All Other Sites I 49 45 3.1 I 3.1 2.8 It 1.8 I 1.3 1.3 1.3 I 11 i 0.9 0 6 Lung Colorectal PROSTATE Non-Hudgkin's lymphoma pM Pancreas Leukemia Esophagus Bladder Stomach Kidney Rl.lli! Oral Multiple Myeloma Melanoma Larynx Hodgkin's Disease Thyroid Testis AS Otar Sites 20500 New CaP Cases BREAST Uinj Colorectal Body of Uterus Non-Hodgkln's Lymphoma mmmmm *t Thyroid 33 Ovary 3 3 Melanoma ; « Pancreas 24 Leukemia 2 3 Kidney 2 3 Cervix 1 9 Bladder 1 ? Brain 1 S Oral 1 5 Stomach m 14 Multiple Myeloma 1 2 Esophagus 0 5 Hodgkin's Disease 05 Larynx 0 3 Al Other Sites 21600 New BCa Cases 15 20 25 30 Site Lung BREAST Colorectal Pancreas Ovary Non-Hodgkln's Lymphoma Leukoma Stomach Brain Body ot Uterus Multiple Myeloma Kidney Bladder Esophagus Ctrvlx Oral Melanoma Thyroid Larynx Hodgkin's Disease Another Sites 16.1 • 2.9 2.2 2.2 • 18 r ,. • 1.2 I 1 1 1 1.0 0.3 0 3 0.2 5300 B C a Deaths 12.6 Percentage Percentage F igure 1.1 Figure 1.1 Canadian cancer incidence and mortality rates 1 6 1 . Percentage distribution of estimated new cases and deaths of selected cancer sites is shown. 149,000 new cases of cancer and 69,500 deaths from cancer occured in Canada in 2005. Three types of cancer account for at least 50% of new cases in each sex: prostate, lung, and colorectal cancers in males, and breast, lung, and colorectal cancers in females. Relaxin-relevant cancers which are known are highlighted: prostate cancer (CaP) and breast cancer (BCa). 21 Androgen Androgen Independence CO Withdrawal s Androgen Dependence Regression \ Remission/Progression Time F igure 1.2 Figure 1.2 Progression of prostate cancer over time towards an androgen independent state. Prostate cancer manifests itself from precursor lesions (prostatic intraepithelial neoplasia) to androgen dependent carcinoma confined to the prostate. All patients receive non-hormonal primary therapy: surgery or radiation therapy. Patients who fail non-hormonal primary therapy are described as having "locally advanced" and or metastatic disease. Those patients are relegated to androgen withdrawal therapy which stimulates regression and reduces disease burden. Inevitably, a few androgen independent cells will be selected for in this androgen-depleted environment and these give rise to the androgen independent stage for which no effective therapies are available. Stages of prostate cancer progression are correlated with loss of specific chromosome regions and candidate tumor-suppressor genes of the epithelial cancer. Often underestimated and not well understood is the role of the immune response at multiple stages of progression in prostate cancer as well as in other adenocarcinomas. 22 proRelaxin H2 prolnsulin B chain | C chain | X chain prolGF-1 B chain A chain I prolGF-2 B chain A chain Figure 1.3 Figure 1.3 Relaxin - a unique insulin family member. During processing, the C chain centre peptide is removed from prorelaxin and proinsulin, although it remains intact in the IGFs where the D and E chains are removed instead. Relaxin is unique in its structure compared to other insulin family members since it is the only member whose proform is often present in the circulation and retains biological activity. Relaxin also has a unique receptor target since unlike the others which have tyrosine kinase receptors, relaxin is the only member with a GPCR receptor. Additionally, relaxin is unique in its diverse functions as described in the main text. 2 3 Potential Receptors and Binding Proteins: g Intermediary Messengers: / / \ GPCR LGR8. GPCR LGR7. GPCR 142 (JAMP) (TOK) (V) ~^£s PKAj CCREB") (<«APK) (PKCT) Q Cellular Responses: Potential Phenotypic Consequences: Figure 1 . 4 ^ ^ ^ ^ ( ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ CELL SURVIVAL & PROLIFERATION INVASION & METASTASIS ANGIOGENESIS Figure 1.4 The current understanding of relaxin signalling and potential phenotypic consequences during tumour progression. (A) Relaxin (RLX) HI and H2 contain highly similar nucleotide sequences (Appendix 6-1), although R L X H2 is likely the most physiologically relevant. RLX H3 and its receptors have all been discovered in the past few years and little is known about their signalling. The GPCR, LGR7, is the primary receptor for R L X H2, and (B) cAMP production resulting in PKA activation is by far the most well characterized intermediary response. In addition, many other signalling intermediates have been identified in a variety of cell types. (C) These are correlated with diverse cellular responses and phenotypic consequences, again dependent on cell type. Cell-type dependent relaxin-induced regulation of these cellular responses is described in the main text. 24 Inflammatory C C R 2 hi Immunosuppressive monocyte M l M IFNy + L P S Macrophage C C R 2 lo IL-4 + IL-13 M2 TAM - Th2 responses - tumour promotion Figure 1.5 Figure 1.5 The monocyte/macrophage equilibriums involved in cancer progression. Monocytes are often characterized by their expression of high levels of the M C P - 1 receptor, C C R 2 which is required for responsiveness to the archetype monocyte chemoattractant protein. Once a monocyte becomes a macrophage, C C R 2 is no longer required and is often downregulated. A monocyte can be differentiated with the chemical agent P M A , or it can respond directly to the naturally occurring G M - C S F or M - C S F resulting in the M l or M 2 macrophage phenotypes respectively. The M l phenotype is correlated with the T h l response of T cells which is characterized as an inflammatory response classically required for ki l l ing of intracellular pathogens and tumour resistance. The M 2 phenotype is a recently identified alternative pathway correlated with the Th2 response of T cells which is characterized as an immunosuppressive response involved in allergy and tumour promotion. IFNy with or without L P S wi l l stimulate M l differentiation of macrophages, whereas IL-4 and IL-13 are known to deactivate the classic IFNy pathway and drive the macrophage further towards the alternate M 2 phenotype. 25 R E F E R E N C E S (Chapter 1) 1. Craft, N . & Sawyers, C L . Mechanistic concepts in androgen-dependence of prostate cancer. Cancer Metastasis Rev 17, 421 -7 (1998). 2. Nelson, W . G . , De Marzo, A . M . & Isaacs, W . B . Prostate cancer. TV Engl J Med 349, 366-81 (2003). 3. Ba lkwi l l , F. & Mantovani, A . Inflammation and cancer: back to Virchow? Lancet 357, 539-45 (2001). 4. Coussens, L . M . & Werb, Z . Inflammation and cancer. Nature 420, 860-7 (2002). 5. Hisaw, F . L . Experimental relaxation of the pubic ligament of the guinea pig. Proc Soc Exp Biol Med 23, 661-3 (1926). 6. Hisaw, F . L . The corpus luteum hormone I. Experimental relaxation of pelvic ligaments of the guinea pig. Physiol Zool 2, 59-79 (1929). 7. Bani , D . Relaxin: a pleiotropic hormone. Gen Pharmacol 28, 13-22 (1997). 8. Ivell, R. & Einspanier, A . Relaxin peptides are new global players. Trends Endocrinol Metab 13, 343-8 (2002). 9. Bathgate, R . A . , Samuel, C.S. , Burazin, T . C , Gundlach, A . L . & Tregear, G . W . Relaxin: new peptides, receptors and novel actions. Trends Endocrinol Metab 14, 207-13 (2003). 10. Sherwood, O.D. Relaxin's physiological roles and other diverse actions. Endocr Rev 25, 205-34 (2004). 11. Silvertown, J.D., Summerlee, A . J . & Klonisch, T. Relaxin-like peptides in cancer. Int J Cancer 107,513-9 (2003). 12. Plunkett, E.R. & Gammal, E . B . The effect of relaxin upon DMBA- induced mammary cancer in female rats. Br J Cancer 21, 592-600 (1967). 13. Bigazzi , M . , Brandi, M X . , Bani, G . & Sacchi, T . B . Relaxin influences the growth of M C F - 7 breast cancer cells. Mitogenic and antimitogenic action depends on peptide concentration. Cancer 70, 639-43 (1992). 14. Sacchi, T .B. , Bani, D. , Brandi, M . L . , Falchetti, A . & Bigazzi , M . Relaxin influences growth, differentiation and cell-cell adhesion of human breast-cancer cells in culture. Int J Cancer 57, 129-34 (1994). 26 15. Binder, C , Hagemann, T., Husen, B., Schulz, M . & Einspanier, A. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod 8, 789-96 (2002). 16. Bani, D., Masini, E. , Bello, M.G. , Bigazzi, M . & Sacchi, T.B. Relaxin activates the L-arginine-nitric oxide pathway in human breast cancer cells. Cancer Res 55, 5272-5 (1995). 17. Lala, P.K. & Chakraborty, C. Role of nitric oxide in carcinogenesis and tumour progression. Lancet Oncol 2, 149-56 (2001). 18. Lala, P.K. & Orucevic, A. Role of nitric oxide in tumor progression: lessons from experimental tumors. Cancer Metastasis Rev 17, 91-106 (1998). 19. Hussain, S.P., Hofseth, L.J. & Harris, C C . Radical causes of cancer. Nat Rev Cancer 3, 276-85 (2003). 20. Bani, G. & Bigazzi, M . Morphological changes induced in mouse mammary gland by porcine and human relaxin. Acta Anat (Basel) 119, 149-54 (1984). 21. Tashima, L.S., Mazoujian, G. & Bryant-Greenwood, G.D. Human relaxins in normal, benign and neoplastic breast tissue. J Mol Endocrinol 12, 351-64 (1994). 22. Mazoujian, G. & Bryant-Greenwood, G.D. Relaxin in breast tissue. Lancet 335, 298-9 (1990). 23. Binder, C , Binder, L. , Luder, G. & Einspanier, A. High serum concentrations of relaxin correlate with dissemination of breast cancer, in Proceedings from the Third International Congress on Relaxin and Related Peptides, (ed. Tregear, G., Ivell, R., Bathgate, R., Wade, J.D.) 429-435 (Kluwer Academic Publisher, 2000). 24. Binder, C. et al. Elevated Concentrations of Serum Relaxin are Associated with Metastatic Disease in Breast Cancer Patients. Breast Cancer Res Treat 87, 157-66 (2004). 25. Ivell, R., Hunt, N., Khan-Dawood, F. & Dawood, M.Y. Expression of the human relaxin gene in the corpus luteum of the menstrual cycle and in the prostate. Mol Cell Endocrinol 66, 251-5 (1989). 26. Sokol, R.Z., Wang, X.S., Lechago, J., Johnston, P.D. & Swerdloff, R.S. Immunohistochemical localization of relaxin in human prostate. J Histochem Cytochem 37, 1253-5 (1989). 27 27. Hansell, D.J., Bryant-Greenwood, G.D. & Greenwood, F.C. Expression of the human relaxin HI gene in the decidua, trophoblast, and prostate. J Clin Endocrinol Metab 72, 899-904 (1991). 28. Winslow, J.W. et al. Human seminal relaxin is a product of the same gene as human luteal relaxin. Endocrinology 130, 2660-8 (1992). 29. Samuel, C.S., Tian, H., Zhao, L. & Amento, E.P. Relaxin is a key mediator of prostate growth and male reproductive tract development. Lab Invest 83, 1055-67 (2003). 30. Gunnersen, J.M., Roche, P.J., Tregear, G.W. & Crawford, R.J. Characterization of human relaxin gene regulation in the relaxin-expressing human prostate adenocarcinoma cell line LNCaP.FGC. J Mol Endocrinol 15, 153-66 (1995). 31. Brookes, D.E., Zandvliet, D., Watt, F., Russell, P.J. & Molloy, P.L. Relative activity and specificity of promoters from prostate-expressed genes. Prostate 35, 18-26 (1998). 32. Figueiredo, K.A. , Palmer, J.B., Mui, A.L. , Nelson, C.C. & Cox, M.E. Demonstration of Upregulated H2 Relaxin mRNA Expression during Neuroendocrine Differentiation of LNCaP Prostate Cancer Cells and Production of Biologically Active Mammalian Recombinant 6 Histidine-Tagged H2 Relaxin. Ann N YAcad Sci 1041, 320-7 (2005). 33. Silvertown, J.D., Ng, J., Sato, T., Summerlee, A.J. & Medin, J.A. H2 relaxin overexpression increases in vivo prostate xenograft tumor growth and angiogenesis. Int J Cancer (2005). 34. Vinall, R.L. et al. The R273H p53 mutation can facilitate the androgen-independent growth of LNCaP by a mechanism that involves H2 relaxin and its cognate receptor LGR7. Oncogene 25, 2082-93 (2006). 35. Wu, H.C. et al. Derivation of androgen-independent human LNCaP prostatic cancer cell sublines: role of bone stromal cells. Int J Cancer 57, 406-12 (1994). 36. Pollak, M.N., Schernhammer, E.S. & Hankinson, S.E. Insulin-like growth factors and neoplasia. Nat Rev Cancer 4, 505-18 (2004). 37. Krueckl, S.L. et al. Increased insulin-like growth factor I receptor expression and signaling are components of androgen-independent progression in a lineage-derived prostate cancer progression model. Cancer Res 64, 8620-9 (2004). 28 38. Klonisch, T., Froehlich, C , Tetens, F., Fischer, B. & Hombach-Klonisch, S. Molecular remodeling of members of the relaxin family during primate evolution. Mol Biol Evol 18, 393-403 (2001). 39. Liu, C. et al. Identification of relaxin-3/INSL7 as an endogenous ligand for the orphan G-protein-coupled receptor GPCR135. J Biol Chem 278, 50754-64 (2003). 40. Liu, C. et al. Identification of relaxin-3/INSL7 as a ligand for GPCR142. J Biol Chem 278, 50765-70 (2003). 41. Bathgate, R.A. et al. Human relaxin gene 3 (H3) and the equivalent mouse relaxin (M3) gene. Novel members of the relaxin peptide family. J Biol Chem 211, 1148-57 (2002). 42. Wilkinson, T.N., Speed, T.P., Tregear, G.W. & Bathgate, R.A. Evolution of the relaxin-like peptide family. BMC Evol Biol 5, 14 (2005). 43. Nishimoto, I. The IGF-II receptor system: a G protein-linked mechanism. Mol Reprod Dev 35, 398-406; discussion 406-7 (1993). 44. Kiess, W. et al. The insulin-like growth factor-II/mannose-6-phosphate receptor: structure, function and differential expression. Adv Exp Med Biol 343, 175-88 (1993). 45. Bartsch, O., Bartlick, B. & Ivell, R. Relaxin signalling links tyrosine phosphorylation to phosphodiesterase and adenylyl cyclase activity. Mol Hum Reprod 1, 799-809 (2001). 46. Palejwala, S., Stein, D., Wojtczuk, A., Weiss, G. & Goldsmith, L.T. Demonstration of a relaxin receptor and relaxin-stimulated tyrosine phosphorylation in human lower uterine segment fibroblasts. Endocrinology 139, 1208-12 (1998). 47. Ivell, R. Relaxin on the beach. Trends Endocrinol Metab 12, 89-91 (2001). 48. Osheroff, P.L. & King, K.L. Binding and cross-linking of 32P-labeled human relaxin to human uterine cells and primary rat atrial cardiomyocytes. Endocrinology 136, 4377-81 (1995). 49. Sanborn, B.M. et al. Mechanisms regulating oxytocin receptor coupling to phospholipase C in rat and human myometrium. Adv Exp Med Biol 395, 469-79 (1995). 50. Fei, D.T., Gross, M.C. , Lofgren, J.L., Mora-Worms, M . & Chen, A.B. Cyclic AMP response to recombinant human relaxin by cultured human endometrial cells—a specific and high throughput in vitro bioassay. Biochem Biophys Res Commun 170, 214-22 (1990). 29 51. Parsell, D.A., Mak, J.Y., Amento, E.P. & Unemori, E.N. Relaxin binds to and elicits a response from cells of the human monocytic cell line, THP-1. J Biol Chem 271, 27936-41 (1996). 52. Kuznetsova, L., Plesneva, S., Derjabina, N., Omeljaniuk, E. & Pertseva, M . On the mechanism of relaxin action: the involvement of adenylyl cyclase signalling system. Regul Pept 80,33-9(1999). 53. Cronin, M.J., Malaska, T. & Bakhit, C. Human relaxin increases cyclic AMP levels in cultured anterior pituitary cells. Biochem Biophys Res Commun 148, 1246-51 (1987). 54. Kramer, S.M. et al. Increase in cyclic AMP levels by relaxin in newborn rhesus monkey uterus cell culture. In Vitro Cell Dev Biol 26, 647-56 (1990). 55. Hsu, C.J., McCormack, S.M. & Sanborn, B.M. The effect of relaxin on cyclic adenosine 3',5'-monophosphate concentrations in rat myometrial cells in culture. Endocrinology 116, 2029-35 (1985). 56. Meera, P. et al. Relaxin stimulates myometrial calcium-activated potassium channel activity via protein kinase A. Am J Physiol 269, C312-7 (1995). 57. Chen, G.A., Huang, J.R. & Tseng, L. The effect of relaxin on cyclic adenosine 3',5'-monophosphate concentrations in human endometrial glandular epithelial cells. Biol Reprod 39, 519-25 (1988). 58. Tseng, L. Role of relaxin in the decidualization of human endometrial cells, in Progress in Relaxin Research: The Proceedings of the Second International Congress on the Hormone Relaxin, Adelaide, South Australia, 1994 (ed. MacLennan, A.H. , Tregear, G.W. and Bryant-Greenwood, G.D.,) 325-338 (World Scientific Publishing Co, Singapore, 1995). 59. Braddon, S.A. Relaxin-dependent adenosine 6',5'-monophosphate concentration changes in the mouse pubic symphysis. Endocrinology 102, 1292-9 (1978). 60. Sanborn, B.M., Kuo, H.S., Weisbrodt, N.W. & Sherwood, O.D. The interaction of relaxin with the rat uterus. I. Effect on cyclic nucleotide levels and spontaneous contractile activity. Endocrinology 106, 1210-5 (1980). 61. Hughes, S.J., Hollingsworth, M . & Elliott, K.R. The role of a cAMP-dependent pathway in the uterine relaxant action of relaxin in rats. J Reprod Fertil 109, 289-96 (1997). 30 62. Wyatt, T.A. et al. Relaxin stimulates bronchial epithelial cell PKA activation, migration, and ciliary beating. Exp Biol Med (Maywood) 227, 1047-53 (2002). 63. Norstrom, A. & Wiqvist, I. Relaxin-induced changes in adenosine 3',5'-monophosphate levels in the human cervix. Acta Endocrinol (Copenh) 109, 122-5 (1985). 64. Mcllwrath, A., Downing, S.J. & Hollingsworth, M . Relaxin and cAMP in rat uterus in vivo. Biochem Soc Trans 19, 356S (1991). 65. Hsu, S.Y. et al. Activation of orphan receptors by the hormone relaxin. Science 295, 671-4 (2002). 66. Ivell, R., Anand-Ivell, R. & Bartsch, O. Relaxin signaling from natural receptors. Ann N Y Acad Sci 1041, 280-7 (2005). 67. Kumagai, J. et al. INSL3/Leydig insulin-like peptide activates the LGR8 receptor important in testis descent. J Biol Chem 277, 31283-6 (2002). 68. Dschietzig, T., Bartsch, C , Stangl, V., Baumann, G. & Stangl, K. Identification of the pregnancy hormone relaxin as glucocorticoid receptor agonist. Faseb J 18, 1536-8 (2004). 69. Zhang, Q., Liu, S.H., Erikson, M . , Lewis, M . & Unemori, E. Relaxin activates the MAP kinase pathway in human endometrial stromal cells. J Cell Biochem 85, 536-44 (2002). 70. Palejwala, S. et al. Relaxin positively regulates matrix metalloproteinase expression in human lower uterine segment fibroblasts using a tyrosine kinase signaling pathway. Endocrinology 142, 3405-13 (2001). 71. Masini, E. , Bani, D., Bigazzi, M . , Mannaioni, P.F. & Bani-Sacchi, T. Effects of relaxin on mast cells. In vitro and in vivo studies in rats and guinea pigs. J Clin Invest 94, 1974-80(1994). 72. Bani-Sacchi, T., Bigazzi, M . , Bani, D., Mannaioni, P.F. & Masini, E. Relaxin-induced increased coronary flow through stimulation of nitric oxide production. Br J Pharmacol 116, 1589-94(1995). 73. Bani, D., Bigazzi, M . , Masini, E. , Bani, G. & Sacchi, T.B. Relaxin depresses platelet aggregation: in vitro studies on isolated human and rabbit platelets. Lab Invest 73, 709-16 (1995). 31 74. Masini, E. et al. Relaxin counteracts myocardial damage induced by ischemia-reperfusion in isolated guinea pig hearts: evidence for an involvement of nitric oxide. Endocrinology 138, 4713-20 (1997). 75. Bani, D. et al. Relaxin activates the L-arginine-nitric oxide pathway in vascular smooth muscle cells in culture. Hypertension 31, 1240-7 (1998). 76. Bani, D. et al. Relaxin up-regulates the nitric oxide biosynthetic pathway in the mouse uterus: involvement in the inhibition of myometrial contractility. Endocrinology 140, 4434-41 (1999). 77. Masini, E. et al. Relaxin inhibits the activation of human neutrophils: involvement of the nitric oxide pathway. Endocrinology 145, 1106-12 (2004). 78. Bani, D. et al. Inhibitory effects of relaxin on human basophils activated by stimulation of the Fc epsilon receptor. The role of nitric oxide. Int Immunopharmacol 2, 1195-204 (2002). 79. Ginsburg, F.W., Rosenberg, C.R., Schwartz, M . , Colon, J.M. & Goldsmith, L.T. The effect of relaxin on calcium fluxes in the rat uterus. Am J Obstet Gynecol 159, 1395-401 (1988). 80. Young, R.C. Effects of relaxin on calcium concentrations. Am J Obstet Gynecol 162, 605 (1990). 81. Han, X., Habuchi, Y. & Giles, W.R. Relaxin increases heart rate by modulating calcium current in cardiac pacemaker cells. Circ Res 74, 537-41 (1994). 82. Mayerhofer, A. et al. Relaxin triggers calcium transients in human granulosa-lutein cells. Eur J Endocrinol 132, 507-13 (1995). 83. Anwer, K. et al. Calcium-activated K+ channels as modulators of human myometrial contractile activity. Am J Physiol 265, C976-85 (1993). 84. Piedras-Renteria, E.S., Sherwood, O.D. & Best, P.M. Effects of relaxin on rat atrial myocytes. II. Increased calcium influx derived from action potential prolongation. Am J Physiol 272, H1798-803 (1997). 85. Unemori, E.N. et al. Human relaxin decreases collagen accumulation in vivo in two rodent models of fibrosis. J Invest Dermatol 101, 280-5 (1993). 32 86. Qin, X., Garibay-Tupas, J., Chua, P.K., Cachola, L. & Bryant-Greenwood, G.D. An autocrine/paracrine role of human decidual relaxin. I. Interstitial collagenase (matrix metalloproteinase-1) and tissue plasminogen activator. Biol Reprod 56, 800-11 (1997). 87. Qin, X., Chua, P.K., Ohira, R.H. & Bryant-Greenwood, G.D. An autocrine/paracrine role of human decidual relaxin. II. Stromelysin-1 (MMP-3) and tissue inhibitor of matrix metalloproteinase-1 (TIMP-1). Biol Reprod 56, 812-20 (1997). 88. Palejwala, S., Tseng, L. , Wojtczuk, A., Weiss, G. & Goldsmith, L.T. Relaxin gene and protein expression and its regulation of procollagenase and vascular endothelial growth factor in human endometrial cells. Biol Reprod 66, 1743-8 (2002). 89. Lessey, B.A., Gui, Y., Apparao, K.B., Young, S.L. & Mulholland, J. Regulated expression of heparin-binding EGF-like growth factor (HB-EGF) in the human endometrium: a potential paracrine role during implantation. Mol Reprod Dev 62, 446-55 (2002). 90. Ohleth, K . M . & Bagnell, C A . Relaxin-induced deoxyribonucleic acid synthesis in porcine granulosa cells is mediated by insulin-like growth factor-I. Biol Reprod 53, 1286-92 (1995). 91. Ohleth, K . M . , Zhang, Q., Lenhart, J.A., Ryan, P.L. & Bagnell, C A . Trophic effects of relaxin on reproductive tissue: role of the IGF system. Steroids 64, 634-9 (1999). 92. Gao, J.G., Mazella, J. & Tseng, L. Activation of the human IGFBP-1 gene promoter by progestin and relaxin in primary culture of human endometrial stromal cells. Mol Cell Endocrinol 104, 39-46 (1994). 93. Unemori, E.N. et al. Relaxin induces vascular endothelial growth factor expression and angiogenesis selectively at wound sites. Wound Repair Regen 8, 361-70 (2000). 94. Figueiredo, K.A., Mui, A.L. , Nelson, C.C. & Cox, M.E. Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism. J Biol Chem 281, 3030-9 (2006). 95. Zhao, S., Lee, H.Y. & Sherwood, O.D. Porcine and human relaxin bioactivity: bioactivities of porcine relaxin and human relaxin do not differ in mice and rats. Ann N Y Acad Sci 1041, 126-31 (2005). 96. Hayes, E.S. Biology of primate relaxin: a paracrine signal in early pregnancy? Reprod Biol Endocrinol 2, 36 (2004). 33 97. Sherwood, O.D. et al. The physiological effects of relaxin during pregnancy: studies in rats and pigs. OxfRev Reprod Biol 15, 143-89 (1993). 98. Bani, G., Maurizi, M , Bigazzi, M . & Bani Sacchi, T. Effects of relaxin on the endometrial stroma. Studies in mice. Biol Reprod 53, 253-62 (1995). 99. Sunder, S. & Lenton, E.A. Endocrinology of the peri-implantation period. Baillieres Best Pract Res Clin Obstet Gynaecol 14, 789-800 (2000). 100. Stewart, D.R. & VandeVoort, C A . Relaxin secretion by human granulosa cell culture is predictive of in-vitro fertilization-embryo transfer success. Hum Reprod 14, 338-44 (1999). 101. Hall, J.A., Cantley, T . C , Day, B.N. & Anthony, R.V. Uterotropic actions of relaxin in prepubertal gilts. Biol Reprod 42, 769-74 (1990). 102. Hall, J.A., Cantley, T . C , Galvin, J.M., Day, B.N. & Anthony, R.V. Influence of ovarian steroids on relaxin-induced uterine growth in ovariectomized gilts. Endocrinology 130, 3159-66 (1992). 103. Min, G., Hartzog, M.G. , Jennings, R.L., Winn, R.J. & Sherwood, O.D. Evidence that endogenous relaxin promotes growth of the vagina and uterus during pregnancy in gilts. Endocrinology 138, 560-5 (1997). 104. Thraikill, K . M . , Clemmons, D.R., Busby, W.H., Jr. & Handwerger, S. Differential regulation of insulin-like growth factor binding protein secretion from human decidual cells by IGF-I, insulin, and relaxin. J Clin Invest 86, 878-83 (1990). 105. Bell, S .C, Jackson, J.A., Ashmore, J., Zhu, H.H. & Tseng, L. Regulation of insulin-like growth factor-binding protein-1 synthesis and secretion by progestin and relaxin in long term cultures of human endometrial stromal cells. J Clin Endocrinol Metab 72, 1014-24 (1991). 106. Zhang, Q. & Bagnell, C A . Relaxin stimulation of porcine granulosa cell deoxyribonucleic acid synthesis in vitro: interactions with insulin and insulin-like growth factor I. Endocrinology 132, 1643-50 (1993). 107. Vasilenko, P., Mead, J.P. & Weidmann, J.E. Uterine growth-promoting effects of relaxin: a morphometric and histological analysis. Biol Reprod 35, 987-95 (1986). 34 108. Kuenzi, M.J. & Sherwood, O.D. Immunohistochemical localization of specific relaxin-binding cells in the cervix, mammary glands, and nipples of pregnant rats. Endocrinology 136, 1367-73 (1995). 109. Smith, S.K. Angiogenesis, vascular endothelial growth factor and the endometrium. Hum Reprod Update 4, 509-19 (1998). 110. Unemori, E.N. et al. Relaxin stimulates expression of vascular endothelial growth factor in normal human endometrial cells in vitro and is associated with menometrorrhagia in women. Hum Reprod 14, 800-6 (1999). 111. Song, L. , Ryan, P.L., Porter, D.G. & Coomber, B.L. Effects of relaxin on matrix remodeling enzyme activity of cultured equine ovarian stromal cells. Anim Reprod Sci 66, 239-55 (2001). 112. Unemori, E.N. & Amento, E.P. in Progress in Relaxin Research: The Proceedings of the Second International Congress on the Hormone Relaxin, Adelaide, South Australia, 1994 (ed. MacLennan, A.H. , Tregear, G.W. and Bryant-Greenwood, G.D.,) 481 (World Scientific Publishing Co, Singapore, 1995). 113. Unemori, E.N. et al. Relaxin induces an extracellular matrix-degrading phenotype in human lung fibroblasts in vitro and inhibits lung fibrosis in a murine model in vivo. J Clin Invest 98, 2739-45 (1996). 114. Bani, D., Ballati, L., Masini, E. , Bigazzi, M . & Sacchi, T.B. Relaxin counteracts asthma-like reaction induced by inhaled antigen in sensitized guinea pigs. Endocrinology 138, 1909-15 (1997). 115. Kenyon, N.J., Ward, R.W. & Last, J.A. Airway fibrosis in a mouse model of airway inflammation. Toxicol Appl Pharmacol 186, 90-100 (2003). 116. Mookerjee, I. et al. Endogenous relaxin regulates collagen deposition in an animal model of allergic airway disease. Endocrinology 147, 754-61 (2006). 117. Ho, T.Y. & Bagnell, C A . Relaxin induces matrix metalloproteinase-9 through activation of nuclear factor kappa B in human THP-1 cells. Ann N Y Acad Sci 1041, 314-6 (2005). 118. Brummer, O., Athar, S., Riethdorf, L. , Loning, T. & Herbst, H. Matrix-metalloproteinases 1, 2, and 3 and their tissue inhibitors 1 and 2 in benign and malignant breast lesions: an in situ hybridization study. Virchows Arch 435, 566-73 (1999). 35 119. Kugler, A. et al. Expression of metalloproteinase 2 and 9 and their inhibitors in renal cell carcinoma. J Urol 160, 1914-8 (1998). 120. Ramos-DeSimone, N. et al. Activation of matrix metalloproteinase-9 (MMP-9) via a converging plasmin/stromelysin-1 cascade enhances tumor cell invasion. J Biol Chem 274, 13066-76 (1999). 121. Conrad, K.P. & Novak, J. Emerging role of relaxin in renal and cardiovascular function. Am J Physiol Regul Integr Comp Physiol 287, R250-61 (2004). 122. Lewis, M . Systemic relaxin administration stimulates angiogenic cytokine expression and vessel formation in a rat myocardial infart model, in Proceedings from the Third International Congress on Relaxin and Related Peptides, (ed. Tregear, G., Ivell, R., Bathgate, R., Wade, J.D.) 159-167 (Kluwer Academic Publisher, 2000). 123. Fisher, C. et al. Is the pregnancy hormone relaxin also a vasodilator peptide secreted by the heart? Circulation 106, 292-5 (2002). 124. Novak, J., Ramirez, R.J., Gandley, R.E., Sherwood, O.D. & Conrad, K.P. Myogenic reactivity is reduced in small renal arteries isolated from relaxin-treated rats. Am J Physiol Regul Integr Comp Physiol 283, R349-55 (2002). 125. Dschietzig, T. et al. The pregnancy hormone relaxin is a player in human heart failure. FasebJ 15, 2187-95 (2001). 126. Balkwill, F. Cancer and the chemokine network. Nat Rev Cancer 4, 540-50 (2004). 127. Mantovani, A. et al. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25, 677-86 (2004). 128. Mantovani, A., Sozzani, S., Locati, M . , Allavena, P. & Sica, A. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol 23, 549-55 (2002). 129. Pollard, J.W. Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 4, 71-8 (2004). 130. Leenen, P.J. & Campbell, P.A. Heterogeneity of mononuclear phagocytes, in Blood Cell Biochemistry: Macrophages and Related Cells, Vol. 5 (ed. Horton, M.A.) 29-85 (Plenum Press, New York, NY, 1993). 36 131. Dransfield, I., Corcoran, D., Partridge, L.J., Hogg, N. & Burton, D.R. Comparison of human monocytes isolated by elutriation and adherence suggests that heterogeneity may reflect a continuum of maturation/activation states. Immunology 63, 491-8 (1988). 132. Gordon, S. & Taylor, P.R. Monocyte and macrophage heterogeneity. Nat Rev Immunol 5, 953-64 (2005). 133. Sica, A., Saccani, A. & Mantovani, A. Tumor-associated macrophages: a molecular perspective. Int Immunopharmacol 2, 1045-54 (2002). 134. Elgert, K.D., Alleva, D.G. & Mullins, D.W. Tumor-induced immune dysfunction: the macrophage connection. JLeukoc Biol 64, 275-90 (1998). 135. Opdenakker, G. & Van Damme, J. Novel monocyte chemoattractants in cancer, in Chemokines and Cancer (ed. Rollins, B.J.) 51-69 (Humana Press, Totowa, NJ, 1999). 136. Opdenakker, G. & Van Damme, J. Chemotactic factors, passive invasion and metastasis of cancer cells. Immunol Today 13, 463-4 (1992). 137. Opdenakker, G. & Van Damme, J. The countercurrent principle in invasion and metastasis of cancer cells. Recent insights on the roles of chemokines. Int J Dev Biol 48, 519-27 (2004). 138. Welch, J.S. et al. TH2 cytokines and allergic challenge induce Yml expression in macrophages by a STAT6-dependent mechanism. J Biol Chem 277, 42821-9 (2002). 139. Rauh, M J . et al. SHIP represses the generation of alternatively activated macrophages. Immunity 23, 361-74 (2005). 140. Raes, G. et al. Arginase-1 and Yml are markers for murine, but not human, alternatively activated myeloid cells. J Immunol 174, 6561; author reply 6561-2 (2005). 141. Munder, M . et al. Arginase I is constitutively expressed in human granulocytes and participates in fungicidal activity. Blood 105, 2549-56 (2005). 142. Gordon, S. Alternative activation of macrophages. Nat Rev Immunol 3, 23-35 (2003). 143. Ma, J. et al. Regulation of macrophage activation. Cell Mol Life Sci 60, 2334-46 (2003). 144. Dinarello, C A . Interleukin-1 and interleukin-1 antagonism. Blood 77, 1627-52 (1991). 145. Vannier, E. , Miller, L . C & Dinarello, C A . Coordinated antiinflammatory effects of interleukin 4: interleukin 4 suppresses interleukin 1 production but up-regulates gene expression and synthesis of interleukin 1 receptor antagonist. Proc Natl Acad Sci USA 89, 4076-80(1992). 37 146. de Waal Malefyt, R. et al. Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes. Comparison with IL-4 and modulation by IFN-gamma or IL-10. J Immunol 151, 6370-81 (1993). 147. Muzio, M . et al. Interleukin-13 induces the production of interleukin-1 receptor antagonist (IL-lra) and the expression of the mRNA for the intracellular (keratinocyte) form of IL-lra in human myelomonocytic cells. Blood 83, 1738-43 (1994). 148. Colotta, F. et al. Regulated expression and release of the IL-1 decoy receptor in human mononuclear phagocytes. J Immunol 156, 2534-41 (1996). 149. Scotton, C.J. et al. Transcriptional profiling reveals complex regulation of the monocyte IL-1 beta system by IL-13. J Immunol 174, 834-45 (2005). 150. Imhof, B.A. & Aurrand-Lions, M . Adhesion mechanisms regulating the migration of monocytes. Nat Rev Immunol 4, 432-44 (2004). 151. Zhao, L. et al. Mice without a functional relaxin gene are unable to deliver milk to their pups. Endocrinology 140, 445-53 (1999). 152. Krajnc-Franken, M.A. et al. Impaired nipple development and parturition in LGR7 knockout mice. Mol Cell Biol 24, 687-96 (2004). 153. Zarreh-Hoshyari-Khah, R., Bartsch, O., Einspanier, A., Pohnke, Y. & Ivell, R. Bioactivity of recombinant prorelaxin from the marmoset monkey. Regul Pept 97, 139-46 (2001). 154. Yang, S., Rembiesa, B., Bullesbach, E.E. & Schwabe, C. Relaxin receptors in mice: demonstration of ligand binding in symphyseal tissues and uterine membrane fragments. Endocrinology 130, 179-85 (1992). 155. Osheroff, P.L., Ling, V.T. , Vandlen, R.L., Cronin, M.J. & Lofgren, J.A. Preparation of biologically active 32P-labeled human relaxin. Displaceable binding to rat uterus, cervix, and brain. J Biol Chem 265, 9396-401 (1990). 156. Osheroff, P.L., Cronin, M.J. & Lofgren, J.A. Relaxin binding in the rat heart atrium. Proc Natl Acad Sci USAZ9, 2384-8 (1992). 157. Kohsaka, T. et al. Identification of specific relaxin-binding cells in the human female. BiolReprod59, 991-9 (1998). 158. Min, G. & Sherwood, O.D. Localization of specific relaxin-binding cells in the ovary and testis of pigs. Biol Reprod 59, 401-8 (1998). 38 159. Garibay-Tupas, J.L., Maaskant, R.A., Greenwood, F.C. & Bryant-Greenwood, G.D. Characteristics of the binding of 32P-labelled human relaxins to the human fetal membranes. J Endocrinol 145, 441-8 (1995). 160. Hornsby, D.J., Poterski, R.S. & A.J., S. Relaxin expression and binding in the rat prostate, in Proceedings from the Third International Congress on Relaxin and Related Peptides, (ed. Tregear, G., Ivell, R., Bathgate, R., Wade, J.D.) 225-227 (Kluwer Academic Publisher, 2000). 161. Canadian Cancer Society 2005 http://www.cancer.ca. 39 CHAPTER 2 * Demonstration of upregulated H2 relaxin mRNA expression during neuroendocrine differentiation of LNCaP prostate cancer cells and production of biologically active mammalian recombinant six histidine tagged H2 relaxin * A version of Chapter 2 has been published: Figueiredo, K.A., Palmer, J.B., Mui, A.L., Nelson, C.C. & Cox, M.E. Demonstration of Upregulated H2 Relaxin mRNA Expression during Neuroendocrine Differentiation of LNCaP Prostate Cancer Cells and Production of Biologically Active Mammalian Recombinant 6 Histidine-Tagged H2 Relaxin. Ann N Y Acad Sci 1041, 320-7 (2005). 40 O V E R V I E W Relaxin has recently been implicated as a regulator of breast and prostate cancer progression. We have characterized upregulated H2 relaxin gene expression during neuroendocrine differentiation of the human prostate cancer model, LNCaP. In order to examine the impact relaxin may have on host cells associated with prostatic adenocarcinomas, we generated recombinant 6 His-tagged relaxin (RLXH) in a mammalian expression system. This immunoreactive and biologically active relaxin preparation was used to screen a variety of cell types for cAMP responsiveness. Of the cell types screened, none were more responsive to R L X H than the well-characterized monocyte/macrophage cell line, THP-1. INTRODUCTION Prostate cancer and breast cancer are the second leading cause of cancer-related deaths among Canadian men and women.1 Relaxin is potentially a critical regulator of prostate and breast malignant progression based on its ability to influence cell proliferation, neovascularization, tissue remodelling, and cell migration.2 Relaxin is classically described to improve blood supply to multiple organs including the uterus, mammary gland, lung and heart.3 Relaxin is also known to increase matrix metalloprotease expression resulting in collagen turnover of reproductive tissues and in models of fibrosis, and is responsible for lengthening of the interpubic ligament during delivery.3"5 More recently, relaxin has been shown to be produced by breast cancers6 and a prostate cancer model, LNCaP. 7 Relaxin can promote growth of the mammary gland as well as breast cancer cells in vitro and can regulate breast cancer cell migration. " While characterizing the gene expression profile of LNCaP cells undergoing neuroendocrine (NE) differentiation,10 we found that relaxin is upregulated 2-fold in response to 41 this treatment. Since adenocarcinoma-produced relaxin may serve as an autocrine/paracrine factor to influence disease progression, we have generated a recombinant mammalian source of relaxin and used it to screen for potential target host cells that might influence disease progression in response to exposure to relaxin. Of the cell types screened, we have determined that monocyte/macrophage lineage cells typified by THP-1 are the most relaxin-responsive as measured by adenylate cyclase activation. M A T E R I A L S AND M E T H O D S Cell culture: LNCaP cells were obtained from American Tissue Culture Collection (ATCC) and cultured in RPMI and 5% Fetal Bovine Serum (FBS). HEK293T cells (ATCC) were cultured in D M E M and 10% FBS. THP-1 cells (ATCC) were cultured in RPMI and 10% FBS. Primary mouse cultures were prepared from black/6 mice. All other cell lines were obtained from A T C C and cultured according to A T C C guidelines. Transfections were performed using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. Total RNA extraction and Northern Blot analysis: LNCaP cells were serum starved for 24 hours and then NE differentiation was induced by treatment for 7 days with 10 uM epinephrine (Epi) and 2 nM interleukin (IL)-6 as previously described.10 Total RNA was isolated from cells using the RiboPure RNA Isolation Kit (Ambion). RNA was quantitated using a Bioanalyzer (Agilent Technologies). Total RNA (10 pg) was separated using a denaturing 2% formaldehyde/agarose gel, transferred to a nylon membrane and fixed using UV. The full-length relaxin sequence excised from the R L X H plasmid (described below) and the control 18S 32 sequence were labeled with J ZP-dCTP using the Rediprime II random priming system 42 (Amersham) and used to probe the membrane. Probe hybridization was analyzed using a phosphorimager (Typhoon, Amersham). Production and analysis of mammalian recombinant R L X H : A full-length human H2 relaxin cDNA cloned from a LNCaP cDNA library was subcloned into the pcDEF3 mammalian expression vector and engineered to contain a C-terminal 6 His tag. The resulting R L X H plasmid was transfected into HEK293T cells (293T-RLXH) and conditioned media was collected for up to 5 days. Production of R L X H by transfected cells was confirmed by reverse transcriptase PCR as previously described," and anti-histidine (New England Biolabs) and anti-relaxin (Immundiagnostik) immunoblotting. Secreted R L X H was purified from conditioned media by nickel column chromatography using Ni-NTA agarose beads (Qiagen) and eluted with 50 mM NaH 2 P0 4 , 300 mM NaCl, 250 mM imidazole, 0.05% Tween-20, pH 8.0. R L X H purification was tracked by immunoblotting column fractions with an anti-histidine antibody, a relaxin ELISA (Immundiagnostik) and a protein assay (Pierce). Bioactivity was determined by adenylate cyclase activation of HEK293T cells transiently transfected with an LGR7 expression construct generously provided by Dr. A. Hsueh (Stanford University). (Appendix 6-2 and Appendix 6-4) cAMP Assay: Prior to treatment, cells were serum starved overnight and plated at 5 x 105or 1 x 106 cells per well in 24-well plates. Cells were treated with R L X H (0.01 ng/ml or 0.02 ng/ml) or mock in the absence or presence of IBMX (250 uM or 100 uM) for 30 min or 24 h. Adenylate cyclase activation was measured as fmol cAMP with a Biotrak ELISA kit (Amersham) according to manufacturer's instructions. Steady-state cAMP levels were compared by paired t-tests analysis to identify significant differences between the indicated treatments. 43 RESULTS AND DISCUSSION Relaxin is upregulated during neuroendocrine differentiation in LNCaP prostate cancer cells. NE differentiation in prostate cancer is associated with progression towards an androgen independent state. Secretion of mitogenic peptides from prostatic NE cells is thought to contribute to a more aggressive disease by promoting the proliferation of surrounding tumour cells.14'15 M . Cox's lab has previously shown that NE differentiation can be cooperatively enhanced by co-treatment of prostate cancer cells, LNCaP, with Epi and IL-6. 1 0 We found that H2 relaxin mRNA expression is increased approximately 2-fold during microarray analysis of LNCaP cells undergoing N E differentiation (data not shown). This result was confirmed by Northern Blot analysis (Fig 2.1) in which we observed a 1.5-fold increase in relaxin mRNA levels when normalized to 18S ribosomal RNA in NE-differentiated LNCaP cells. In light of reports suggesting that relaxin may be a regulator of prostate and breast cancer progression, this data indicates that relaxin may be a component of the ability of NE differentiation to influence prostate cancer progression. Analysis of relaxins, receptors and responses of LNCaP and other cancer cell lines is described in Appendix 6-3. Mammalian recombinant RLXH is biologically active. A C-terminus 6 His-tagged H2 relaxin expression plasmid was produced and 6 His-tagged recombinant relaxin (RLXH) was overexpressed in HEK293T cells. The C-terminus was chosen because the N-terminal signal peptide gets cleaved off during processing and because based on crystal structure analysis, addition to the C-terminus would not interfere with residues defined as critical for receptor binding on the B-chain interface.16 We chose the HEK293T mammalian expression system to maximize the probability of correct processing of the relaxin peptide. R L X H expression by transfected HEK293T cells was confirmed by reverse transcriptase PCR, immunofluorescence, 44 immunoblots, ELISA and bioassays. R L X H was purified from 293T-RLXH conditioned media by nickel column chromatography. Approximately 80 percent of the isolated R L X H was proteolytically processed based on the ratio of pre and pro-relaxin (18 to 20 kD) to processed relaxin (4 to 6 kD) after immunoblotting with an anti-histidine.antibody (Fig 2.2). Thirty percent of the input R L X H was recovered in the first two imidazole elution fractions. By comparing the relaxin to total protein ratio of the input and eluted fractions, the nickel column chromatography resulted in a 40-fold purification of R L X H . Further details of R L X H production are described in Appendix 6-2. In order to assess the biological activity of the isolated R L X H , we tested its ability to activate adenylate cyclase in HEK293T cells transiently transfected to express the relaxin receptor, LGR7 (Fig 2.3). In the presence of IBMX, RLXH-induced intracellular cAMP accumulation plateaued 30 min after stimulation and remained unchanged 24 h following stimulation. After correcting for basal intracellular cAMP levels in mock stimulated cells, R L X H increased intracellular cAMP levels to 7.5 x 10"6 mol cAMP/cell/M R L X H at 30 min and 8.6 x 10"6 mol cAMP/cell/M relaxin at 24 h following stimulation. This level of adenylate cyclase activation was in excellent agreement with that reported by Hsu and colleagues using a similar assay to characterize LGR7 as a relaxin receptor.12 Further details of cloning and expression of LGR7 in HEK293T cells are described in Appendix 6-4. Monocytes are responsive to R L X H . A variety of cell types were screened for cAMP responsiveness to R L X H (Table 2.1). Selected for the screen were mesodermal, epithelial and hematopoetic cells normally associated with prostatic and breast tumours. Of the cell types screened, few provided a robust adenylate cyclase response to R L X H and none were more responsive than the monocyte/macrophage cell line, THP-1. Since leukocytes are often found at 45 tumour sites,17 we initiated studies to determine if relaxin potentially influences recruitment of monocyte/macrophage cells into tumours. THP-1 is a monocyte/macrophage cell line previously shown to induce a robust cAMP response to relaxin. The adenylate cyclase activation response of THP-1 cells to R L X H (1.3 x 10"6 mol cAMP/cell/ M relaxin) confirms the responsiveness of THP-1 cells to porcine and recombinant human relaxin.18'19 Since these cells are highly responsive to relaxin, they may serve as an excellent model to study relaxin's effects on physiologically relevant monocyte/macrophage populations. CONCLUSIONS In this chapter we have shown for the first time that NE differentiation of LNCaP prostate cancer cells results in upregulation of relaxin mRNA transcript expression and suggest that relaxin may be a critical regulator of disease progression due to influence on surrounding host cells. We describe production of biologically active, recombinant, 6 His-tagged H2 relaxin from a mammalian source and its use to screen a panel of potential paracrine target host cells for biochemical responsiveness. We have also demonstrated that R L X H can induce a robust cAMP response in the monocyte/macrophage cell line, THP-1. The current study provides a basis from which to examine whether relaxin can influence the activity of monocyte cells in the context of tumour progression. 46 Table 2.1 - Cells tested for c A M P res ponsiveness to R L X H stimulation R L X H Mock I B M X R L X H Mock Epithelial Cancer L N C a P 117 # 89 452 63 PC3 2025 1240 M C F - 7 1088 1307 2351 2028 Mesodermal Cancer M G 6 3 194 171 483 477 Fibroblast bone fibroblasts (mouse primary) 191 169 H E K 2 9 3 T 92 172 230 290 Hemopoeitic splenocytes (mouse primary) 38 7 15 32 K562 134 82 136 209 U937 419 390 719 838 RAW264.7 137 173 166 416 HL-60 143 470 Jurkat 258 478 373 690 S K B W 2177 2888 C E M 1471 1887 THP-1 4719 718 7973 1272 * 5 6 5 x 1 0 or 1 x 10 cells were serum starved overnight and treated with R L X H (0.02 ng/ml) or mock in the absence or presence of I B M X (100 uM) for 30 min. # Intracellular c A M P levels were determined by E L I S A and expressed as fmol of c A M P per sample. 47 8 8 I o O *-> < "S £ E o OC i_ i_ o o 0.25 0.20 0.15 0.10 0.05 0.00 RLX Epi/IL-6 Untreated Epi / IL-6 Unt rea ted F igu re 2.1 Figure 2.1 Relaxin ( R L X ) m R N A expression is upregulated during neuroendocrine differentiation of prostate cancer cells, L N C a P . Total R N A (10 ug) from L N C a P cells untreated or stimulated with Epi and I L -6 for 7 days was used to perform Northern blot analysis of relaxin expression. A representative autoradiogram of a Northern blot probed for H 2 relaxin m R N A is shown. Similar results were obtained from three independent experiments. The histogram depicts densitometric quantitation of the relaxin: 18S ribosomal R N A ratio from the 2 L N C a P R N A samples. Values represent means +/- SD of pixels within scan area of blot as determined by Image Quant software (Amersham). 48 Wash Elutions Input FT 1 2 1 2 3 4 &&&&&&&& 45 -30 -20.1 14.3 Precursor Relaxin 6.5 -3.5 -Mature Relaxin Figure 2.2 Figure 2.2 Purification of R L X H from 2 9 3 T - R L X H conditioned media. H E K 2 9 3 T cells (5 x 106) were transfected with 10 \xg p c D E F 3 - R L X H plasmid (lanes labeled R L X H ) or 10 p.g empty pcDEF3 plasmid (lanes labeled mock). After 5 days, conditioned media was collected and R L X H was purified by nickel column chromatography. A representative anti-histidine immunoblot of column fractions collected during purification of R L X H is shown. The upper band (-18-20 kD) is prepro- and prorelaxin, and the immunoreactive proteins centered at ~6 k D represent processed mature R L X H . N o R L X H was detected in the flow through or either of the two wash fractions. Imidazole buffer was used to displace R L X H from the nickel column. A l l detectable R L X H was eluted in the first two fractions. 49 "3 o © o E < o 9 0 0 0 - i 8 0 0 0 -I 7 0 0 0 6 0 0 0 5 0 0 0 4 0 0 0 3 0 0 0 2 0 0 0 1 0 0 0 0 Figure 2.3 RLXH Mock IBMX IBMX 30 min RLXH Mock IBMX IBMX 24 h Figure 2.3 R L X H induces cAMP accumulation in LGR7-expressing HEK293T cells. 293T-LGR7 cells were stimulated for 30 min and 24 h with R L X H (0.01 ng/ml) and IBMX (250 uM), or mock (9 mM imidazole) and IBMX (250 uM) in serum-free media. Intracellular cAMP levels were measured by Biotrak ELISA and expressed as fmol cAMP/5 x 105 cells. Values represent means +/- SD of two independent experiments performed in triplicate. * vs respective mock control, p< 0.001. 50 R E F E R E N C E S (Chapter 2) 1. Canadian Cancer Society 2004 http://www.cancer.ca. 2. Silvertown JD, Summerlee AJ, Klonisch T 2003 Relaxin-like peptides in cancer. Int. J. Cancer 107:513-519 3. Bani D 1997 Relaxin: a pleiotropic hormone. Gen Pharmacol 28:13-22 4. Ivell R, Einspanier A 2002 Relaxin peptides are new global players. Trends Endocrinol Metab 13:343-348 5. Bathgate RA, Samuel CS, Burazin TC et al., 2003 Relaxin: new peptides, receptors and novel actions. Trends Endocrinol Metab 14:207-213 6. Binder C, Binder L, Luder G et al., 2000 High serum concentrations of relaxin correlate with dissemination of breast cancer. In: Tregear G, Ivell R, Bathgate R et al., (eds) Proceedings from the Third International Congress on Relaxin and Related Peptides.Dordrecht: Kluwer Academic Publisher, 429-435 7. Gunnersen JM, Roche PJ, Tregear GW et al., 1995 Characterization of human relaxin gene regulation in the relaxin-expressing human prostate adenocarcinoma cell line LNCaP.FGC. J Mol Endocrinol 15:153-166 8. Bani Sacchi T, Bani D, Brandi M L et al., 1994 Relaxin influences growth, differentiation and cell-cell adhesion of human breast-cancer cells in culture. Int. J. Cancer 57:129-134 9. Binder C, Hagemann T, Husen B et al., 2002 Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod 8:789-796 10. Deeble PD, Murphy JD, Parsons SJ et al., 2001 Interleukin-6 and cyclic AMP-mediated signaling potentiates neuroendocrine differentiation of LNCaP prostate tumor cells. Mol Cell Biol 21:8471-8482 11. Gunnersen JM, Fu P, Roche PJ et al., 1996 Expression of human relaxin genes: characterization of a novel alternatively-spliced human relaxin mRNA species. Mol Cell Endocrinol 118:85-94 12. Hsu SY, Nakabayashi K, Nishi S et al., 2002 Activation of orphan receptors by the hormone relaxin. Science 295:671-674 13. di Sant'Agnese P, Cockett A 1996 Neuroendocrine differentiation in prostatic malignancy. Cancer 78:357-361 51 14. Bonkhoff H, Wernert N, Dhom G et al., 1991 Relation of endocrine-paracrine cells to cell proliferation in normal, hyperplastic, and neoplastic human prostate. Prostate 19:91-98 15. Bonkhoff H 1998 Neuroendocrine cells in benign and malignant prostate tissue: morphogenesis, proliferation, and androgen receptor status. Prostate Suppl. 8:18-22 16. Bullesbach E, Schwabe C 2000 The relaxin receptor-binding site geometry suggests a novel gripping mode of interaction. J Biol Chem 275:35276-35280 17. Balkwill F 2004 Cancer and the chemokine network. Nat Rev Cancer 4:540-550 18. Parsell DA, Mak JY, Amento EP et al., 1996 Relaxin binds to and elicits a response from cells of the human monocytic cell line, THP-1. J Biol Chem 271:27936-27941 19. Bartsch O, Bartlick B, Ivell R 2001 Relaxin signalling links tyrosine phosphorylation to phosphodiesterase and adenylyl cyclase activity. Mol Hum Reprod 7:799-809 52 CHAPTER 3 * Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism * A version of Chapter 3 has been published: Figueiredo, K.A., Mui, A.L., Nelson, C C . & Cox, M.E. Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism. J Biol Chem 281, 3030-9 (2006). 53 O V E R V I E W Leukocytes are critical effectors of inflammation and tumour biology. Chemokine-like factors produced by such inflammatory sites are key mediators of tumour growth that activate leukocytic recruitment and tumour infiltration and suppress immune surveillance. Here we report that the endocrine peptide hormone, relaxin, is a regulator of leukocyte biology with properties important in recruitment to sites of inflammation. This study uses the human monocytic cell line THP-1 and normal human peripheral blood mononuclear cells to define a novel role for relaxin in regulation of leukocyte adhesion and migration. Our studies indicate that relaxin promotes adenylate cyclase activation, substrate adhesion and migratory capacity of mononuclear leukocytes through a relaxin receptor LGR7-dependent mechanism. Relaxin-stimulated cAMP accumulation was observed to occur primarily in non-adherent cells. Relaxin stimulation results in increased substrate adhesion and increased migratory activity of leukocytes. In addition, relaxin-stimulated substrate adhesion resulted in enhanced chemotaxis to monocyte chemoattractant protein-1 (MCP-1). These responses in THP-1 and peripheral blood mononuclear cells are relaxin dose-dependent and proportional to cAMP accumulation. We further demonstrate that LGR7 is critical for mediating these biological responses by use of RNA interference lentiviral short hairpin constructs. In summary, we provide evidence that relaxin is a novel leukocyte stimulatory agent with properties affecting adhesion and chemomigration. INTRODUCTION Complex interactions between tumour cells and the immune system regulate disease progression by stimulating cell proliferation, neovascularization, tissue remodeling and metastasis, or by inhibiting the host's anti-tumour immune response However, the factors 54 produced by tumour cells that affect their immune surveillance remain to be fully elucidated. The insulin-related peptide hormone, relaxin, possesses key features required of a tumour-derived factor capable of affecting malignant progression and its emerging role as a putative mediator of tumour progression has been recently reviewed 2 . In humans, relaxin is encoded by three genes designated HI, H2 and H3, 3 . Functionally, relaxin is classically described to improve blood supply to multiple organs including the uterus, mammary gland, lung and heart 4 . Relaxin is also known to increase matrix metalloproteinase expression resulting in collagen turnover of reproductive tissues and in models of fibrosis, and is responsible for lengthening of the interpubic ligament during delivery 3"5. A role for relaxin in cancer progression was first suggested 38 years ago by studies indicating that carcinogen-fed rats experienced substantially enhanced mammary tumour growth when co-treated with relaxin several weeks later 6 . More recently, relaxin has been shown to support growth and invasiveness of breast cancer cells 7 ' 8 and elevated relaxin serum levels are positively correlated with breast cancer metastases 9 . Relaxin immunostaining has been demonstrated in epithelial and myoepithelial cells of normal and cancerous breast cells 1 0 and significantly higher levels of relaxin staining occur in neoplastic breast tissues as compared to normal breast tissue ". Similarly, relaxin is produced by the normal prostate 1 2 - 1 6 and expressed in prostate cancer cell lines LNCaP, DU145 and PC3 l 7 ' 1 8 . Relaxin has been implicated in increased tumour growth and angiogenesis of PC3 prostate xenografts 1 9 , while we have found that H2 relaxin expression is upregulated in LNCaP cells undergoing neuroendocrine 20 differentiation . Together, these studies strongly implicate relaxin in breast and prostate cancer progression. Relaxin has been attributed with regulation of several intermediary responses or intracellular signalling events in a variety of cell types. These include cAMP, PKA 2 I " 2 7 , MAPK, 55 CPvEB , tyrosine phosphorylation ' , nitric oxide synthase (NOS) activation , and calcium 39 influx . These intermediary signalling events are then implicated in the upregulation of matrix metalloproteinases (MMPs) 2 9 - 4 0 " 4 3 5 epidermal growth factor (EGF) 4 4 , insulin-like growth factor (IGF) 4 5 ' 4 6 , IGF binding proteins 4 7 , vascular endothelial growth factor (VEGF) 2 8 ' 4 3 ' 4 8 and 32 33 35 guanylyl cyclase activation ' ' . In inflammatory wound sites, relaxin also induces V E G F and basic fibroblast growth factor (bFGF) production in macrophages 4 8 . Prevailing questions are whether the ability of tumours to secrete relaxin affects the surrounding stromal and endothelial cells or hematopoietic cells, and whether relaxin can stimulate and/or recruit these cells to produce factors that promote tumour survival and growth. Here, we demonstrate that relaxin activates adenylate cyclase, promotes substrate adhesion and proportionally enhances migratory capacity of mononuclear leukocytes in a relaxin receptor LGR7-dependent mechanism. Relaxin-stimulated cAMP accumulation occurs primarily in non-adherent cells and this responsiveness is lost once the cells have adhered to a substrate. Relaxin alone can promote migration of leukocytes and can also enhance their monocyte chemoattractant protein-1 (MCP-1) migratory response. These enhanced migratory responses may be a result of relaxin-mediated substrate adhesion in these cells. We also describe for the first time that relaxin can dose-dependently stimulate cAMP accumulation in peripheral blood mononuclear cells (PBMC) and that this response is proportional to relaxin-stimulated adhesion and migratory activity. We further demonstrate that LGR7 is critical for mediating these biological responses by use of RNA interference lentiviral short hairpin constructs. These results implicate relaxin as a novel stimulator of leukocyte recruitment. 56 M A T E R I A L S AND M E T H O D S Cell culture - Peripheral blood mononuclear cells (PBMC) were isolated from fresh whole blood obtained from healthy male and female volunteers by density gradient sedimentation in Histopaque (Sigma) according to the manufacturer's instructions. PBMC were washed twice in PBS, resuspended in RPMI (Invitrogen) and used immediately in subsequent assays. THP-1 cells (ATCC) were cultured in RPMI and 10% fetal bovine serum. All THP-1 cell experiments were performed with cells cultured less than 15 passages that were serum-starved overnight prior to treatments. Production of recombinant THP-1 clonal populations - Stably infected THP-1 populations were generated by lentiviral infection, stable integration and expression of short hairpin interfering RNA (shRNA) sequence targeting (LGR7 GenBank accession number NM_021634). shRNA target sequences of LGR7 were selected according to previously established guidelines 4 9 ' 5 0 , complementary oligonucleotides were synthesized, annealed and ligated into the pSHAG-1 vector backbone (Cold Spring Harbor Laboratory) 4 9 . Recombination reactions (Gateway, Invitrogen) were performed to transfer the target sequences into the Gateway-modified pHR-CMV-eGFP lentiviral vector 5 1 . 10 u.g of this recombinant vector was co-transfected with 7.5 u.g the packaging plasmid pCMV-gag-pol (AR8.2) and 2.5 u.g of the V S V - G expressing envelope plasmid pMD.G into HEK293T cells 5 1 - 5 3 using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. Virus-containing conditioned media was collected every 24h for two days, filtered through 2.0 um pores (Millipore), and immediately used to infect THP-1 cells which were subsequently sorted by flow cytometry to obtain eGFP tag expression approaching 100%. Of the six shRNA targets created (Fig 6), two: L7-274 (5 ' -CACCTGAATGTTTGGTCGGTTCTGTGCCAG-3' ) and L7-917 (5'-57 G A T T G A A A A T C T T C C A C C G C T T A T A T T C AA-3') that effectively suppressed LGR7 expression in THP-1 cells are described in these studies. Further details on LGR7 shRNA and production of recombinant THP-1 cells are described in Appendix 6-5. cAMP assays - 5 x 105 cells were treated with 6 His-tagged recombinant human H2 relaxin ( R L X H ) 2 0 at 0, 0.0013 ng/ml, 0.0025 ng/ml, 0.005 ng/ml, 0.01 ng/ml, 0.02 ng/ml or 0.04 ng/ml; or forskolin (FSK, 10 uM) and isobutylmethylxanthine (IBMX, 50 uM) for 30 min. (Relaxin H2 GenBank accession number N M l 34441). To control for the R L X H vehicle, all samples were treated with the volumetric equivalent of the nickel column elution buffer (50 mM NaH 2 P0 4 , 300 mM NaCl, 250 mM imidazole, and 0.05% Tween-20, pH 8.0) as previously described . Non-adhered cells were collected from the media by centrifugation and resuspended in lysis buffer (Biotrak ELISA kit, Amersham). For analysis of the total population cAMP response, the remaining adhered cells were lysed by pooling with the lysis of the corresponding non-adhered cells. For analysis of THP-1 subpopulations, adhered and non-adhered cells were collected as above and passively lysed separately. Adenylate cyclase activation was measured by competitive cAMP ELISA (Biotrak ELISA kit, Amersham) and normalized to cell equivalents by protein content (BCA assay, Pierce) according to manufacturers' instructions and expressed as fmol cAMP / ug cellular protein. Cell adhesion and migration assays - For adhesion assays, 5 x 105 cells were seeded into wells of 24 well tissue culture dishes and left untreated or treated with R L X H (0.02 ng/ml) or phorbol 12-myristate 13-acetate (PMA, 50 ng/ml) and incubated for 24 h at 37°C. Non-adhered cells were removed by decanting and washing the plates three times with RPMI media. For migration assays, 5 x 105 cells were seeded in the upper chamber of 24-well 5 um transwell cell 58 culture inserts (Costar). Cells were treated with R L X H (0.02 ng/ml), GF109203X (2 uM), FSK (10 uM) and/or MCP-1 (10 ng/ml, 25 ng/ml or 50 ng/ml). All samples not treated with R L X H received an equivalent volume of the R L X H vehicle unless otherwise stated. Migration on uncoated transwells was performed for 24 h at 37°C, and migration on laminin-coated transwells was performed for 3 h at 37°C. The number of adhered or migrated cells was determined by CyQuant DNA-binding fluorescence (C-7026, Molecular Probes, Invitrogen) 5 4 . Relative fluorescence was detected at 485 nm excitation and 527 nm emission by plate reading fluorometer (Fluoroskan Accent FL, ThermoLabsystems) and standardized for cell number. Total and percent adhered or migrated cells were calculated for each assay, and pooled results are expressed as adhesion index or migration index respectively normalized to cell number of untreated controls. Real time PCR analysis - LGR7 mRNA expression of parental and shRNA-expressing THP-1 cells was determined from cells under normal culture conditions. Total RNA was isolated using TRIzol Reagent (Invitrogen), DNase-treated (Invitrogen) and used to generate single-stranded cDNAs using Superscript First-Strand Synthesis System (Invitrogen) according to the manufacturer's instructions. RNA (2 u.g) was primed for cDNA synthesis using a random hexamer primer (0.5 ug/ul). The comparative C T method was used to measure LGR7 mRNA levels under different treatment conditions using a GeneAmp 5700 Sequence Detection System and the GeneAmp 5700 SDS software (Applied Biosystems). The LGR7 primers: LGR7-Rfp (5 ' -CCCCTGTGGGAACATCACA-3' ) and LGR7-Rrp (5 ' -GTTGTCCTCATCGGCCTGATT-3'), and probe (5'-VIC C T C C T G C A C T G T A A C G G T G T G G A C G A C T TAMRA-3') were selected using the Primer Express Software vl.5 (Applied Biosystems). The probe was labeled with a Vic /TAMRA quencher/reporter. A region of T A T A binding protein (TBP) cDNA was 59 amplified using control primer/probe kits from Applied Biosystems. Primer verification analysis was performed to ensure the LGR7/TBP primer pairs had equal amplification efficiencies (data not shown). TBP mRNA was unaffected by lentivirus infection or shRNA expression and was therefore deemed a suitable control for normalizing the results to total mRNA levels. The Real-Time PCR reactions were performed using TaqMan Universal PCR Master Mix (Applied Biosystems) such that the LGR7 and TBP baseline C T ranges were 5-22 and 5-20, respectively. The threshold log values used in the LGR7 and TBP analyses were 0.03-0.05. Fluorescence-activated cytometric analysis (FACS) - 5 x 105 live cells suspended in 200 p,l of PBS were stained for cell surface LGR7 expression by incubation with 5 pg/ml of rabbit polyclonal anti-LGR7 antibody (abl2714, Abeam) for 45 min at 4°C. To correct for non-specific IgG background binding to cell surface, a parallel cell aliquot was stained with a rabbit IgG antibody against the intracellular protein, Akt (anti-Akt, 9272, Cell Signaling). After washing with PBS, cells were treated with a 1:200 dilution of donkey anti-rabbit R-phycoerythrin conjugated antibody (1:200, Jackson Immunoresearch) for 30 min at 4°C. Cells were washed twice with PBS, and then immediately analysed on flow cytometer (Epics xl-mcl, Beckman Coulter) with Expo32 software (Beckman Coulter) and WinMDI software (J. Trotter). Statistical analysis - Curve fit analysis was performed using SigmaPlot graphics software (SPSS) for linear regression (Fig 3.2B) or non-linear, one site saturation kinetics (Figs 3.1 A and 3.3A). Statistical analysis was performed with JMPIN statistical discovery software (SAS Institute). Significant differences among treatments were identified by one way analysis of variance, and significant differences between multiple pairs of treatments were identified by multi-sample matched paired t-tests analyses at a threshold of p < 0.05 unless otherwise noted in the figure legends. 60 R E S U L T S Relaxin activates adenylate cyclase and stimulates adhesion of non-adherent THP-1 cells. In order to assess the capacity of relaxin to affect monocyte activity, we have generated 6 70 His-tagged recombinant human H2 relaxin (RLXH) . Bioactivity of this reagent purified by nickel column chromatography was assessed by determining its ability to stimulate adenylate cyclase activity in target cells. We previously demonstrated that R L X H stimulates adenylate * * 20 cyclase activation in LGR7 expressing H E K 293T cells . Here we observed that R L X H stimulates a dose-dependent increase in intracellular cAMP levels in the monocyte/macrophage cell line THP-1 with first order saturation kinetics (r2 = 0.9614). Intracellular cAMP levels were significantly elevated above basal levels by as little as 1.3 pg/ml R L X H and saturated at 9-fold over basal levels (276.9 fmol cAMP / pg protein) with a calculated half-maximal dose of 6.8 (±1.8) pg/ml R L X H 30 min after stimulation (Fig 3.1A). These results are consistent with 7 1 7 7 ~)A previous observations for relaxin-mediated adenylate cyclase activation of THP-1 cells ' ' and confirm that R L X H is a biologically active relaxin source. THP-1 cells in culture are in equilibrium between adherent and non-adherent cells which may represent phenotypic differences with respect to differentiation or activation state and relaxin-responsiveness. We therefore assessed potential differences in adenylate cyclase activation by R L X H in adherent and non-adherent populations. Although the non-adherent THP-1 monocyte populations accounted for 65 percent of the total cell number, they were responsible for 85 percent of the cAMP response to R L X H (Fig 3.IB). This comparison suggests that non-adherent THP-1 cells respond preferentially to relaxin and that this relaxin-induced adenylate cyclase response may be attenuated upon substrate adhesion. 61 Relaxin stimulates substrate adhesion of THP-1 cells. While the ability of THP-1 cells to respond to relaxin through activation of adenylate cyclase and other signalling pathways has been well characterized 21>22'24>28>485 a n y physiological consequence of relaxin stimulation has remained undetermined. Based on the above observation, we speculated that relaxin may promote substrate adhesion of non-adherent monocytic cells. To examine whether relaxin can promote adhesion of monocytes to tissue culture plastic, untreated THP-1 cells were compared to cells treated with either R L X H or PMA, an agent well known to promote THP-1 adhesion and macrophage differentiation 5 5 . In a temporal analysis comparing the number of adherent cells in untreated and RLXH-stimulated THP-1 cultures, no significant difference in cell adhesion was observed prior to 8 h. At 24 h R L X H induced a 1.5-fold increase in THP-1 adhesion above basal levels (from 30% to 45%), while PMA stimulated the expected robust adhesion of 80 percent of the monocytic population (Fig 3.1 C), These results indicate that relaxin has the previously uncharacterized property of stimulating monocyte substrate adhesion. Relaxin stimulates migration of THP-1 cells. We reasoned that an increased ability of monocytes to adhere to surfaces may promote or enhance migratory capacity through transwells in Boyden-chamber based assays 5 6 ' 5 7 . Temporal analysis of THP-1 migration using a transwell migration assay showed no difference in RLXH-induced migratory kinetics prior to 8 h of stimulation, but an increased number of migrated cells could be observed at longer times which was optimal at 24 h after stimulation (1.5-fold, Fig 3.2A). In order to determine whether R L X H can induce directional migration, a checkerboard analysis was performed in which THP-1 cells seeded in the upper chamber were exposed to R L X H in either the lower or upper chamber, or in both chambers (Fig 3.2A). At 24 h after treatment, THP-1 cell migration into the lower chamber was significantly increased in all three R L X H treatment conditions. THP-1 cells exposed to the 62 greatest concentration of R L X H (0.02 ng/ml in both chambers) demonstrated an increased propensity to migrate to the lower chamber (30% of the seeded population) - 1.5 fold greater than the untreated control (20%). Similarly, migration of cells exposed to R L X H (0.02 ng/ml) when added to only the upper (27%) or lower chamber (25%) was enhanced over untreated controls, but were indistinguishable from one another. Cells exposed to R L X H added to only the lower chamber, exhibited a reduced migratory capacity, compared to cells exposed to R L X H in both chambers, likely because of the reduced initial local concentration of R L X H when it is sourced further away from the seeding location. These data demonstrate that although relaxin alone cannot induce directional (chemotactic) migration, it is capable of promoting dose-dependent chemomigration proportional to its capacity to induce cAMP accumulation and adhesion. Relaxin augments migration of THP-1 cells towards MCP-1. Because of the numerous reports demonstrating relaxin induced activation of the adenylate cyclase signalling in multiple 21 27 cell types " , we assessed whether this pathway was important in mediating the R L X H -stimulated migratory response in THP-1 cells. We determined that relaxin-induced migration can be replicated by addition of the adenylate cyclase activator, FSK and that relaxin-induced migration is unaffected by the broad spectrum protein kinase C inhibitor, GF109203X (Fig 3.2A). This suggests that relaxin likely induces chemomigration through a cAMP-dependent and PKC-independent pathway. The archetype monocyte chemoattractant protein-1 (MCP-1) 5 8 - 6 0 was added to the lower chamber to confirm the chemotactic responsiveness of THP-1 cells (Fig 3.2A). At 24 h, MCP-1 increased migration of THP-1 cells into the lower chamber almost 3-fold, such that 50 percent of the cells had migrated into the lower chamber. Intriguingly, we also observed that MCP-1 chemotaxis was significantly enhanced when R L X H was added to both 63 chambers. In the presence of R L X H , MCP-1 chemoattraction was increased to almost 4-fold over basal levels, such that 75 percent of THP-1 cells had migrated into the lower chamber. This RLXH-induced augmentation of MCP-1 chemotaxis was precisely mimicked when MCP-1 treated cells were co-stimulated with forksolin (Fig 3.2A). These results indicate that relaxin-induced adenylate cyclase activation provides an important alternative pathway to enhance monocyte responsiveness to the PKC-dependent MCP-1 chemotactic response 6 I ' 6 2 . In order to further investigate the capacity of relaxin to augment MCP-1-mediated chemomigration we compared the migration of THP-1 cells to varying concentrations of MCP-1 in the presence or absence of R L X H (Fig. 2B). THP-1 cell migration was linearly responsive to stimulation with 0 to 50 ng/ml MCP-1 [r2 = 0.9943, y-intercept = 1.068357 (±0.0747) migration index (MI), slope = 0.034665 (±0.0026) MI per ng/ml MCP-1]. We observed that R L X H co-stimulation proportionally increased THP-1 cell migration by 1.52-fold (±0.0227) over that of cells treated with MCP-1 alone at all MCP-1 concentrations tested [r2 - 0.9966, y-intercept = 1.626777 (±0.0869) migration index (MI), slope = 0.052093 (±0.0031) MI per ng/ml MCP-1]. The consequence of relaxin exposure is that the chemotactic response at maximal MCP-1 dose (50 ng/ml) can be replicated at 2.5 times lower dose of MCP-1 (20 ng/ml) in the presence of R L X H (0.02 ng/ml in both chambers). These results support the notion that relaxin may make the cells more responsive to MCP-1 at lower doses and that the presence of relaxin can modulate leukocytic chemomigration towards limiting concentration of chemoattractants such as MCP-1. The cAMP signalling dependent adhesion response of the cells to relaxin is complementary to the PKC-dependent chemomigratory response of the cells to MCP-1, which may explain the additive augmentation of migration observed in R L X H and MCP-1 stimulated cells. 64 Relaxin activates adenylate cyclase, promotes adhesion and enhances migration of peripheral blood mononuclear cells. In order to examine the physiological relevance of these experiments in the context of leukocyte biology, we assessed whether relaxin could regulate similar responses in PBMC. Although maximal relaxin-induced adenylate cyclase activity in PBMC was about 15 percent of that observed in comparably treated THP-1 cells (saturating at 36.72 fmol cAMP / pg protein), it nonetheless mirrored the first order dose-dependent saturation kinetics of RLXH-stimulated THP-1 cells (r2 = 0.8782). Intracellular cAMP levels in R L X H -stimulated PBMC were significantly elevated above basal levels by as little as 2.5 pg/ml R L X H and saturated at 5-fold over basal levels. The calculated half-maximal dose for PBMC of 3.6 (±1.7) pg/ml R L X H at 30 min after stimulation (Fig 3.3A) was statistically indistinguishable from the corresponding half-maximal R L X H dose calculated for THP-1 cells described for Fig. 3.1A. Also consistent with the response of THP-1 cells, at 24h, R L X H induced a 1.5-fold increase in adhesion of PBMC to a tissue culture plastic substrate (from 55% to 85%) which was proportional to their response to PMA (Fig 3.3B). Furthermore, relaxin induced a 1.8-fold increase in the migratory response of PBMC (from 20% to 35% of seeded cells; Fig 3.3C). This response was approximately half the migratory response induced by MCP-1 (60% of seeded cells) and is in excellent agreement with our previous observations in THP-1 cells. Together these data suggest that relaxin is a key mediator of adenylate cyclase activation, substrate adhesion and migratory responses of PBMC. Short hairpin targeting suppresses LGR7 mRNA and protein levels in THP-1 cells. In order to verify that the relaxin receptor, LGR7 6 3 , was responsible for mediating relaxin-regulated adenylate cyclase and chemomigration responses of THP-1 cells, we developed an RNA 65 interference approach to inhibit LGR7 expression using lentiviral infection, stable integration and expression of short hairpin interfering RNA sequence independently targeting six different regions of LGR7 (Fig 3.6) (Appendix 6-5). Of these six targeted sequences, two proved to be effective in downregulating LGR7 expression at the mRNA and protein level (Figs 3.4A and B, respectively). Using Real Time PCR analysis, we found that LGR7 mRNA expression was substantially impaired (3-fold) in cells expressing short hairpin RNAs (shRNA) targeting LGR7 sequences starting at nucleotides 274 and 917 (Cell lines designated L7-274 and L7-917, respectively). Control THP-1 cell lines expressing 2 base pair and 4 base pair mismatches of the 274 sequence (mm2 L7-274 and mm4 L7-274, respectively) both exhibited LGR7 mRNA levels that were indistinguishable from that of wild type THP-1 cells (Fig 3.4A). Because flagged-labelled LGR7 protein runs aberrantly on SDS PAGE (Appendix 6-4) and because an LGR7 antibody with immunoblot applications was unavailable, we validated target suppression at the protein level by performing FACS of live cells with an LGR7 antibody targeting the amino-terminal extracellular domain (Fig 3.4B). After correcting for negative control cell surface staining, cell surface LGR7 expression in L7-274 cells was 20 percent of that observed in wild type THP-1 cells, while LGR7 expression in L7-917 cells was 40 percent that of wild type THP-1 cells. In both the mismatch L7-274 cell clones mean LGR7 expression was about 70 percent that of wild type THP-1 cell levels. Although the distribution of the FACS data suggests that there is still substantial overlap of surface expression levels between the various THP-1 cell populations, these results are consistent with shRNA-mediated suppression of mRNA expression and suggest that the LGR7 transcript and protein expression is substantially impaired in L7-917 and L7-274 cells and is relatively intact in the mismatch L7-274 cell clones. 66 LGR7 is required for relaxin-regulated adenylate cyclase activation in THP-1 cells. Next, we examined whether suppressing LGR7 expression affected relaxin-stimulated adenylate cyclase activation (Fig 3.5A). To determine whether the adenylate cyclase function in L7-274 cells was still intact, FSK and IBMX, were used to stimulate intracellular cAMP production. FSK and IBMX-stimulated adenylate cyclase activation in L7-274 cells was indistinguishable from that generated by wild type THP-1 cells. However, L7-274 exhibited a dramatic attenuation of cAMP accumulation relative to wild type THP-1 cells upon stimulation with R L X H . L7-917 cells also exhibit a suppressed response to R L X H . When exposed to relaxin, mm2 L7-274 cells show an intermediate cAMP response and mm4 L7-274 cells exhibit a response not significantly different than wild type THP-1 cells. This suggests that lentiviral infection of THP-1 cells does not in itself impede their ability to respond to relaxin, and that the targeted suppression of LGR7 is likely proportional to the specificity of the shRNA sequence. Together, these results indicate that suppression of LGR7 levels in L7-274 cells blocks their ability to respond to R L X H , and that this suppressed response is specific to relaxin since the FSK and IBMX-induced adenylate cyclase response remains unaffected. This data provide evidence that relaxin stimulates cAMP accumulation in THP-1 cells through an LGR7-dependent signalling pathway, and that the LGR7 receptor is essential for initiating this signal. LGR7 is required for relaxin-regulated migratory potential in THP-1 cells. To determine whether the relaxin-induced migratory response of THP-1 cells is mediated by LGR7, we compared the migratory responses of wild type THP-1 cells with L7-274 and mm4 L7-274 cells. To demonstrate the chemokine-like properties of the relaxin peptide at a more acute time point, THP-1 wild type and recombinant cells were assessed for migratory responses to relaxin under conditions which were more conducive for such activity. As previously established monocytes 67 migrate favourably on laminin-coated transwells . When THP-1 migratory response was assessed on laminin-coated transwells, wild type cells exhibited responses to R L X H , MCP-1 and both treatments which were essentially identical to those observed at 24 h on uncoated transwells (ie. 1.5-fold, 3-fold and 4-fold respectively compared to untreated) (Fig 3.5B vs Fig 3.2A). We observed a substantial impairment of the relaxin-augmented MCP-1 chemotactic response in L7-274 cells migrating across laminin-coated transwells which was not observed in the mm4 L7-274 control cells (Fig 3.5B). These data demonstrate that the relaxin-regulated migratory responses can occur under more acute timelines when provided with appropriate substrate and that the LGR7 signalling pathway is crucial for mediating such responses. DISCUSSION Intercellular communication between tissue at a site of inflammation and distal blood cells relies on production of diffusible molecular mediators. Tumour cells exist in inflammatory microenvironments as they emulate wounds that will not heal 6 5 . Tumour cells must be able to manipulate their microenvironment to support their growth, and this includes recruitment and functional alteration of immune cells from surveillance towards assistance In order for this to occur, tumour-derived chemokines must first stimulate the target immune cells circulating in the bloodstream. In this report, we assessed relaxin-induced stimulation of two THP-1 cell populations by comparing acute adenylate cyclase responses to R L X H in non-adherent and adherent populations, and found that non-adherent cells account for most of the cAMP response to relaxin (Fig 3.IB). This indicates that non-adherent cells are the major relaxin-responsive population, and suggests that once cells have adhered this relaxin-regulated response may no longer be necessary. 68 This prompted us to examine whether relaxin can directly promote adhesion of leukocytes and whether this might be correlated with an enhanced migratory capacity. Here, we show that relaxin induces a 1.5 fold enhancement in THP-1 cell adhesion which is identical to the relaxin-induced 1.5 fold enhanced migration and the 1.5 fold augmentation of MCP-1 induced migration (Figs 3.1C and 3.2A,B). These responses were proportional to relaxin-induced cAMP accumulation and could in part be replicated by direct adenylate cyclase activation (Figs 3.1 A and 3.2A). We also confirmed that relaxin similarly regulates cAMP production, adhesion and migratory responses of PBMC (Fig 3.3A-C). Hence, relaxin-induced migratory responses of leukocytes may be dependent on relaxin-stimulated substrate adhesion through a cAMP-dependent mechanism. These relatively modest changes of relaxin-regulated migratory response are substantially quicker when laminin-coated transwells are provided as an adhesion and migration substrate (Fig 3.5B vs 3.2A), suggesting that relaxin mediated effects are substrate dependent. It is possible that these effects could be accentuated further in the presence of other relevant substrates. Adhesion is an essential step required for leukocytic migration, and modest changes to in vitro cell migration have previously been shown to have substantial biological effects. As an example, R A N K L was shown to induce a 1.6-fold enhancement of monocyte migration 6 6 and a 1.3-fold enhancement of PBMC migration 6 1 . This relatively modest effect of R A N K L on monocyte migration is correlated with substantial biological relevance 6 8 ' 6 9 . Adhesion of leukocytes to vascular endothelium require several signals from chemokine-like molecules which in turn regulate the migratory response 7 0 . For example, MCP-1 and interleukin-8 can each independently induce adhesion of monocytes to vascular endothelium 7 1 . In addition, the adhesion interaction between leukocytes and endothelium stimulates production of leukocyte-69 derived cytokines/chemokines which serve to further activate the immune response n . This suggests that relaxin-mediated adhesion may also modulate similar immune functions. Although the current study is the first to demonstrate stimulatory migration effects of relaxin in mononuclear leukocytes, a number of studies have reported inhibitory functions for relaxin through a nitric oxide-dependent pathway in mast cells , platelets and the 37 38 polymorphonuclear leukocytes: neutrophils and basophils . While relaxin has no effect on polymorphonuclear eosinophil invasion of the rat cervix during pregnancy 7 3 , other studies have reported that relaxin positively regulates the migratory capacity of epithelial cells. Relaxin can stimulate migration and invasion of human breast cancer cells MCF-7 and SK-BR3 on matrigel-Q coated transwells . Similarly, relaxin can stimulate migration of canine breast cancer cells CF33.Mt on laminin coated transwells, though this effect cannot be replicated on uncoated transwells 7 4 . Relaxin can also accelerate migration of bronchial epithelial cells in a wound healing assay 7 : >. Such studies indicate that relaxin-regulated migratory responses are not restricted to cells of a single lineage. Cytokines and hormones are diffusible molecular mediator peptides which are defined by the cells upon which they act. Chemokines were originally defined as groups of cytokines which specifically target subsets of blood cells for chemoattraction. It is clear now that many of these same molecules can elicit similar chemoattraction responses in all cell types including epithelial carcinomas '' 7 6 . Occasionally the distinction between a cytokine and a hormone becomes vague or redundant since some of these can act on both cell types. The current study demonstrates for the first time that the classic hormonal role for relaxin as a regulator of epithelial and stromal functions 4 can now be expanded to include a role in targeting blood cells as a cytokine and 70 possibly a chemokine. Our data depicts a unique role for relaxin in positive regulation of cells of the immune system. A significant enhancement of MCP-1 migratory response is observed in the presence of relaxin in THP-1 cells and PBMC on uncoated transwells and in THP-1 cells on laminin coated transwells. This suggests that relaxin can rapidly activate the adhesion-dependent migratory response under appropriate substrate conditions. This is the first demonstration of relaxin-regulated migration through transwell inserts on any cell type in less than 24 h. Furthermore, the enhanced MCP-1 regulated migratory response in the presence of relaxin is additive at all concentrations of MCP-1 tested (Fig 3.2B). Based on these results, we suggest that by directing substrate adhesion, relaxin can augment cellular response to chemoattractants such as MCP-1 at limiting concentrations, and that relaxin may act in concert with MCP-1 and perhaps other chemokines to enhance recruitment and infiltration of mononuclear cells to relaxin-producing tumour sites. Interestingly, MCP-1 expression has not been detected in prostate adenocarcinomas 1 1 , although its expression is substantially elevated in breast adenocarcinomas 7 8 ' 7 9 . Since relaxin is expressed in both of these adenocarcinomas, it is possible that relaxin fulfills a MCP-1 related role in these cancers. In the milieu of prostate and breast inflammatory tumour tissue, relaxin is likely secreted in combination with other cytokines and chemokines to regulate recruitment and infiltration of the mononuclear cells. To verify that the relaxin receptor LGR7 is required to mediate these relaxin-regulated biological responses in monocytes, recombinant THP-1 cells in which LGR7 expression was suppressed were generated by expression of interfering RNA targeting of LGR7 (Fig 3.4A,B). We have determined that relax in-mediated cAMP production and migratory activity are dependent on LGR7 activation because both biological responses are lost in L7-274 and intact in 71 mismatch cell lines (Fig 3.5A,B). From our results that the migratory response to relaxin is unaffected by inhibition of PKCs, we suggest that PKC is not required to propagate this relaxin-stimulated migratory response (Fig 3.2A). The relaxin-mediated chemomigration response and the relaxin-enhanced MCP-1 response require activation of the G-protein coupled relaxin receptor (LGR7), and these responses can be replicated by FSK-induced adenylate cyclase activation. This implies that a LGR7/Gas/adenylate cyclase/cAMP pathway is necessary to regulate the relaxin-induced migratory response. Although further studies are required to examine the role of relaxin in leukocyte extravasation and infiltration of the tumour, the current study does show that relaxin has a definitive role in recruitment of leukocytes. Because tumour-infiltrating leukocytes often promote cancer in response to chemokinetic factors derived from the tumour itself, the presence of a relaxin gradient emanating from a tumour site may be an indicator of a poor prognosis for cancer patients. In order to provide molecular targets for selective inhibitors and activators, futures studies will require elucidation of specific fate commitment and differentiation pathways induced by relaxin. 72 (A) 300 250 E 200 A co 1— Q. o E < o 150 Q. 100 50 A 0.00 0.01 0.02 RLXH (ng/ml) 0.03 0.04 (B) 200 150 c 'cu o a. .^100 o E < 50 a, b, c 1 (C) 3.5 3 0 2.5 X 0) TS £ 2.0 c o 8 15 T3 < 1 0 0.5 0 0 a -i-a ,b ADHERENT CELLS NON-ADHERENT CELLS Untreated RLXH P M A Figure 3.1 73 Figure 3.1 Relaxin stimulates adenylate cyclase activation and substrate adhesion of THP-1 cells. Serum starved THP-1 cells were plated into a 24-well tissue culture plate followed immediately by treatment with (A) R L X H (0, 0.0013 ng/ml, 0.0025 ng/ml, 0.005 ng/ml, 0.01 ng/ml, 0.02 ng/ml or 0.04 ng/ml) and incubated at 37°C for 30 min. Non-adhered and adhered cells were lysed together in the 24-well plate. Adenylate cyclase activation was expressed as fmol intracellular cAMP normalized to u.g of whole cell lysate protein. Values represent means ± SEM of 5 independent experiments with each sample assayed in quadruplicate. Paired t-test analyses: a vs untreated p < 0.05; b vs untreated p < 0.001. (B) Adenylate cyclase activation in adhered and non-adhered THP-1 cells was determined in cells treated as in (A) except that non-adhered cells were collected and assayed separately from adhered cells. Non-adhered cells accounted for 65% of the total cell number as estimated by relative whole cell lysate protein. Untreated (white bars), Mock (black bars), R L X H 0.02 ng/ml (grey bars). Values represent means ± SEM of 6 independent experiments assayed in triplicate. Paired t-test analyses: a vs respective mock treatment p < 0.05; b vs respective untreated p < 0.05; c vs R L X H treated adhered cells p < 0.05. (C) Relaxin-stimulated substrate adhesion of THP-1 cells was measured in cells treated with PMA (50 ng/ml), R L X H (0.02 ng/ml) or untreated [vehicle alone (-)] and incubated at 37°C for 24 h as described in Experimental Procedures. Substrate adhesion index was calculated as a fold-change of CyQuant fluorescence normalized to that of the untreated samples of washed wells. Values represent means ± SEM of 8 independent experiments assayed in triplicate. Paired t-test analyses: a vs untreated p < 0.01; b vs R L X H treatment p < 0.05. 74 (A) 5.0 4.0 3.0 5 1.0 0.0 -Chamber Upper: Lower: Upper Chamber Lower Chamber b. c RLXH RLXH RLXH FSK GF109203X RLXH RLXH RLXH FSK GF109203X RLXH FSK RLXH FSK MCP-1 MCP-1 MCP-1 (B) x <D T3 J C C o CO I— 1.0 CT 0.0 10 20 30 MCP-1 (ng/ml) 40 50 F igure 3.2 75 Figure 3.2 Relaxin stimulates migration of THP-1 cells. After overnight serum starvation, THP-1 cells were seeded in the upper chamber of 24-well 5 um pore transwells followed immediately by treatment. (A) Migration into the lower chamber of the transwell of untreated cells was compared to that of cells exposed to R L X H (0.02 ng/ml) added to the upper, the lower or both chambers (relaxin checkerboard analysis). Migration of cells treated with R L X H (0.02 ng/ml) in both chambers were compared to RLXH-treated cells in the presence of GF109203X (2 uM) or FSK (10 uM) in both chambers. THP-1 migration was also assessed for cells treated with MCP-1 (50 ng/ml) in the lower chamber in the absence or presence of either R L X H (0.02 ng/ml) or FSK (10 pM) in both chambers. All samples were incubated at 37°C for 24 h. Migration index was calculated as a fold-change of relative CyQuant fluorescence of cells migrated into the lower chamber normalized to that of the untreated samples. Values represent means ± SEM of 6 independent experiments assayed in triplicate. Paired t-test analyses: a vs untreated p < 0.05; b vs untreated p<0.01; c vs R L X H in lower chamber p < 0.05; d vs MCP-1 in lower chamber p < 0.01. (B) The effect of relaxin treatment on the MCP-1 chemotactic response was compared in THP-1 cells stimulated with MCP-1 in the lower chamber at (0, 10 ng/ml, 25 ng/ml or 50 ng/ml) in the absence (dashed line) or presence (solid line) of R L X H (0.02 ng/ml) in both chambers. Migration index was calculated as above and values expressed as means ± SEM from 10 independent experiments assayed in triplicate. Paired t-test analyses: a vs untreated p < 0.01; b vs untreated p < 0.001; c vs no R L X H at same MCP-1 dose p < 0.05; d vs no R L X H at same MCP-1 dose p < 0.01. 76 (A) O) c '55 o a. o E < u 0.00 0.01 0.02 RLXH (ng/ml) 0.03 0.04 (B) 2.0 1.5 x V 13 c .2 1 0 '</> o < 0.5 0.0 (C) 3.5 3.0 x 2 5 o T3 2.0 c o '"io 1.5 O) i 1.0 0.5 0.0 Chamber Upper: RLXH Untreated RLXH PMA Lower: RLXH MCP-1 Figure 3.3 77 Figure 3.3 Relaxin regulates peripheral blood mononuclear cell biology. (A) Relaxin-stimulated activation of cAMP production in PBMC was measured in cells treated with R L X H (0, 0.0025 ng/ml, 0.005 ng/ml, 0.01 ng/ml, 0.02 ng/ml or 0.04 ng/ml) at 37°C for 30 min. Adenylate cyclase activation is measured as fmol cAMP normalized to p,g of whole cell lysate protein. Values represent means ± SEM of 3 to 5 independent experiments assayed in triplicate. Paired t-test analyses: a vs untreated p < 0.05. (B) For measuring relaxin-stimulated adhesion of PBMC to tissue culture treated-plastic, cells were simultaneously plated and treated with R L X H (0.02 ng/ml), PMA (50 ng/ml) or untreated (vehicle control) and incubated at 37°C for 24 h as described in Experimental Procedures. Substrate adhesion index was calculated as a fold-change of CyQuant fluorescence normalized to that of the untreated samples of washed wells. Values represent means ± SEM of 3 technical replicates. Paired t-test analysis: a vs untreated p < 0.05. (C) To measure relaxin-stimulated migration of PBMC, cells were seeded in the upper chamber of 24-well 5 um transwells followed immediately by treatment with either R L X H (0.02 ng/ml), vehicle alone (-) or MCP-1 (50 ng/ml without vehicle) at 37°C for 24 h. Cells that migrated to the lower chamber were measured by CyQuant fluorescence and migration index was calculated as a fold-change of fluorescence normalized to the untreated samples. Values represent means ± SEM from 6 independent experiments assayed in triplicate. Paired t-test analyses: a vs untreated p<0.01. 78 (A) Ct LGR7 CtTBP ACt = (Ct LGR7) -(CtTBP) mean SD mean SD mean SD THP-1 wt 23.31 0.21 23.97 0.26 -0.67 0.33 L7-274 25.31 0.06 24.50 0.28 0.80 0.28 mm2 L7-274 23.52 0.41 24.02 0.25 -0.50 0.48 mm4 L7-274 23.26 0.16 23.97 0.40 -0.71 0.43 L7-917 24.97 0.49 24.04 0.26 0.93 0.55 AACt = (ACt) - (ACt THP-1 wt) 2 - A A C t mean SD mean THP-1 wt 0.00 0.33 1.00 L7-274 1.47 0.28 0.36 mm2 L7-274 0.17 0.48 0.89 mm4 L7-274 -0.05 0.43 1.03 L7-917 1.59 0.55 0.33 c o '55 to a> b. Q . X < z CC E CC o 0) CC 1.4 1.2 1.0 0.8 0.6 ~ 0.4 re 0.2 0.0 THP-1 wt L7-274 mm2 L7-274 mm4 L7-274 L7-917 (B) 1.2 1.0 0.8 0.4 0.2 0.0 101 w Fluorescence THP-1 wt L7-274 mm.2 mm4 L7-917 L7-274 L7-274 F igure 3.4 79 Figure 3.4 shRNA suppression of LGR7 expression in recombinant THP-1 cells. (A) Total RNA was extracted from THP-1 wild type, L7-274, mm2 L7-274, mm4 L7-274 and L7-917 cells under normal culture conditions. Real-time PCR analysis was performed using LGR7 and TBP primer/probe pairs. LGR7 mRNA levels were normalized to TBP mRNA levels and all values are expressed relative to parental (wt) THP-1 cells. A sample calculation for a representative experiment is tabulated. Histogram values represent means ± SEM of 3 independent experiments assayed in triplicate. Paired t-test analyses: a vs THP-1 wt, p < 0.05; b vs THP-1 wt, p < 0.01. (B) LGR7 protein expression was determined by flow cytometry analysis of live cells stained with polyclonal anti-LGR7 antibody and a secondary anti-rabbit IgG coupled to a phycoerythrin fluorophore. Control cells were incubated with an anti-Akt antibody and the phycoerythrin-coupled secondary antibody. Other controls, unstained or stained with secondary antibody alone, showed low background fluorescence (not shown). A representative FACS plot is shown: THP-1 wild type (shaded area), L7-274 (solid thick line), mm2 L7-274, mm4 L7-274 (dashed black lines) and L7-917 cells (solid thin line). A representative a-Akt signal in wild type cells is shown (dashed grey line). Relative LGR7 protein expression for each cell type is calculated by internally correcting for background non-specific staining of intracellular anti-Akt antibody and expressed as the mean relative fluorescence intensity ± SD normalized to wild type THP-1 cells. 80 Figure 3.5 Suppression of LGR7 expression impairs relaxin-induced adenylate cyclase activation and migration of THP-1 cells. (A) THP-1 wild type, L7-274, mm2 L7-274, mm4 L7-274 and L7-917 cells were tested for cAMP responsiveness to R L X H . Serum-starved cells were seeded into wells of 24-well plate and left untreated (white bars) or treated with either, mock (vehicle control) (black bars), R L X H (0.02 ng/ml) (grey bars) or FSK (10 uM) and IBMX (50 uM) (hatched bars) at 37°C for 30 min. Adenylate cyclase activation was measured as fmol cAMP normalized to ug of whole cell lysate protein. Values represent means ± SEM of 6 independent experiments assayed in triplicate. Paired t-test analyses: a vs respective untreated and mock, p < 0.05; b vs respective untreated and mock, p < 0.01; c vs L7-274 R L X H treatment, p < 0.05; d vs L7-274 R L X H treatment, p < 0.01. (B) Impairment of relaxin-induced migratory response by LGR7 suppression in THP-1 cells was assessed in serum starved cells seeded in the upper chamber of 24-well 5 urn pore transwells precoated with laminin (10 ug/ml). Cells were left untreated (not shown), treated with R L X H (0.02 ng/ml) in both chambers, or stimulated with MCP-1 (50 ng/ml) in the lower chamber in the absence or presence of R L X H (0.02 ng/ml) in both chambers at 37°C for 3 h. THP-1 wild type (white bars), L7-274 (black bars), mm4 L7-274 cells (grey bars). The number of migrated cells was determined by CyQuant fluorescence and the migration index was calculated as a fold-change of fluorescence compared to untreated cells. Values represent means ± SEM of 4 independent experiments assayed in triplicate. Paired t-test analyses: a vs untreated p < 0.05; b vs untreated p < 0.01; c vs wt MCP-1 treated in lower chamber, p < 0.05; d vs L7-274 same treatment, p < 0.05. 82 (A) i 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 1441 1501 1561 1621 1681 1741 1801 1861 1921 1981 2041 2101 2161 2221 a t g a c a t c t g g g t g g a c a g g t t g c c t c a g c a a c t g t g g a g a a a a t g a c t t c c a g t g c a a t g t t c c a t c g g c t t c c t c c t g a a g a t t a c a t c t c a g t c a t a g a a t g g c t g a c t a a a t t c t c c c t c t c t g t c a a t t t a a g a a a a c a a a a t t a g a t t t a g g a a c t g t c a c a a t t a t c t t g t c a a g g a t g t t t a g t t c t g t c t t a t g t c a a g t g t c c t g c a c t g a c a a c a a t g g c c c a a t a t c c g t c t t t g c c a t t t c t t c a a a a t t g c t t c a a c c a t c t c c a t a c a g a a t a a c t a a t t g a a g a t t a t t c t c t t a a c a c a t g c e c t t c t a c a t c c t c c c t t g g c t a a c g g t g t g a t g g t c c a t g t t t t g a g g c a a g g t c t g g a g t g t g a c t g c a g a a t t a t c a t c t a t g c t t t c c t t c c t g a a g t a a t c a c c t c a g t c c t g a t g a a g a c t a c a t t t a a t t t t t g t a t t t c c c c t g a c g a c t g c g c a a t t t g a c a g a a a c a c c t q g a a a a t a t t t g t g g g a a c a t g g a a t c a g g c a a t a t t t t g c •a-JfaiBg 11 tgg t a t t t g a c t t t a t c a c t t a a a g t a a t a a g a t c t t g a c t g t g a t g t c a c t t c g a t c t t c a g a a g a g g a c t g a c c g g g t g t t t a g t o g a a t t t a a t a a c g t c c t g g c t g g a c c t a t t t c c t g c t g a a a a t a c t i t g a a a a t c t t a g t a a t t t a a t t t g c a c c t c c c a c c g c t t a a t g a a a c c a a a g t g g a a c t t a g c t g t a c c t a t a g c c t t a c t t g a a g a t c t c c c c a c c a a c t c a c c c g t t t t t g a a g g c a a c t g t t t t a g t t c c a g a a a c t t a t t c a a q q a t t c t c a t g g g c a c a a a g t g c c g a t g a g g a c c a g t t a c t a c t g a a t c t t t c a a c t c a a g t c g _ a c c t c t t a t g g g t a t g c a c a a t c t c t t g g t t t g g a a a c a g c c a t g t c a a a t c g g a g g c t g a g a g t a c t c t t a c t g t t a a g t g a g a c c t g a t a g t g g c t t g g a g t a t g c t g t g g c a a t t t a g c a t g t t t t a a a a a a g a g a t g g a t a c c c a a t a a c c t c t t c a c a t g t t c g c a a g c a t t a t t t t t t g t c a t t c a t t t c t c t t t g a c c t a a a a t t g t c a g c t c a t t t c t g a c g a a a a t g c a g t c a t t c c a t t t c c c t c t t c a t t c t t g g t a t a t a g t g t t c a t g a t c c t t g c t t t t t g t a g t i g g g t a g t g a t c t a t a a t c c a t c t c a g c c t a g a a t c t c t c t c a g c t g t a a a t c a g a g a g t a t t g c a t g c g a c t g c t g t g c c g t t t c g t g g a a t c c a g a a a a g a a g g g a t t g c a c a t a t a t t o c a a a c a o t g t t t g t c t g g g c c t t a t a t c a g a c t g c t t a a g a a t a c a a t a t g t a g g a t c t a t t g g a a a a a a a c a a t t a c a g a g c a a t a a g t t c a g a a g a t t a a t t t g g c c t c a a a g t g c c c a a a c g t t t t g a a a t t t c t t t t t t a t t c t g t t c a a g c a a a a a a t t t c a a l Q t t a a g a a a t t a t g g a a t t t c t f c g t a t c t g c g g t c t g a g a a t g g g a a t a t a a q c a t g c g e a t t t a c g a g c t a a t a a g a a a g g c a a a a c a a t t a a a c t g t a t t c a c a g a c t a a t t t t a t g g a a c c t g a t a a a c c a t a t c c a t g a t g a g g a a a g g a t g a a t t g c c t g a a g g a g c c a a t t t g a t t a t c c a a c a a c c a g t a c t g t a t c t c t a g a g a g t t a c c t g c c a a g c t g t a t t t t a t t c g t g g c t g t g g a t g t a t a c t c t g a c a a a g a a a a t g a a a t g t g g c c c c t g t g a a a c c a c a a g a c c c t a t g g a c a g c a c t g c a g g a t g t c a c t g a t a t t t a a a g a a c a a a g g t c a g g a t g c c a c c t t t c t c a a t c a t t g g c c a t t c t a c a t c t g c a g t t c t g a t t c g a a t t t t t c a a c a g a a a g t a g c a t t t a t c a a t a a c a g c a a t t c t t t a t a g t c a c t g c t t c c c c a t t a a c a a t g a t t c a t c a a a a c a t a t g g a g t t a a t g a a c g a g a c t c a t g t c c a c a g a t t g t c t a t c c t c a t t t g g a t a a a a c t a c t a t t g g a g c c c a t c a t a g t t t t c t g a a a t a c g t a t t t a c t g a a g g t a g a a a t g t g c t t t g a a g g t t t t g g t a c t c c a t c a t t a g c c g g a c c t a t t c c t a t t c a g t a t c a g t t t t t t a g a t g t t a c t g g t t t t t g g c a c c a a t g a t t t a t t c a t t c c t a t g g a g a a t c a a g t t t g c a t t a t g c a c c a g g t a c c i c c c a a t t c t c t a a c t a c a g a c a t c t g g g t g t t t c a c a t a c a t g a L 7 - 2 7 4 L7-732 L 7 - 9 1 7 L7-1067 L7-1404 L7-1980 (B) 5 ' - a c a c c t g a a t g t t t g g t c g g t t c t g t g c c a g - 3 ' L7-274 5 ' - a c a c c t g a a t g t t t g £ t c g g t t g t g t g c c a g - 3 ' mm2 L7-274 5 ' - a c a c c t g a a t c t t t g t t c g g t c [ g r t g t g c c a g - 3 ' mm4 L7-274 F igure 3.6 83 Figure 3.6 LGR7 target sequences for design of pHR-CMV-eGFP shRNA constructs used for lentiviral infection of THP-1 cells. (A) 31 nucleotide target sequences (underlined and shaded) were designed to suppress LGR7 expression in THP-1 cells. Nucleotide number of the first targeted base pair is used to designate THP-1 cell name. Two cell lines (L7-274 and L7-917) demonstrated effective downregulation of LGR7 and relaxin-regulated bioresponses, whereas four other cell lines were ineffective (italicized). (B) LGR7 target sequences used to generate recombinant THP-1 L7-274 and its 2 and 4 base pair mismatch controls (mm2 L7-274 and mm4 L7-274, respectively). Base pairs which are interchanged are shaded and either underlined or italicized. 84 R E F E R E N C E S (Chapter 3) 1. Coussens, L . M . & Werb, Z. Inflammation and cancer. Nature 420, 860-7 (2002). 2. Silvertown, J.D., Summerlee, A.J. & Klonisch, T. Relaxin-like peptides in cancer. Int J Cancer 107,513-9 (2003). 3. Bathgate, R.A., Samuel, C.S., Burazin, T . C , Gundlach, A.L . & Tregear, G.W. Relaxin: new peptides, receptors and novel actions. Trends Endocrinol Metab 14, 207-13 (2003). 4. Bani, D. Relaxin: a pleiotropic hormone. Gen Pharmacol 28, 13-22 (1997). 5. Ivell, R. & Einspanier, A. Relaxin peptides are new global players. Trends Endocrinol Metab 13, 343-8 (2002). 6. Plunkett, E.R. & Gammal, E.B. The effect of relaxin upon DMBA-induced mammary cancer in female rats. Br J Cancer 21, 592-600 (1967). 7. Sacchi, T.B., Bani, D., Brandi, M.L. , Falchetti, A. & Bigazzi, M . Relaxin influences growth, differentiation and cell-cell adhesion of human breast-cancer cells in culture. Int J Cancer 51, 129-34 (1994). 8. Binder, C , Hagemann, T., Husen, B., Schulz, M . & Einspanier, A. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod 8, 789-96 (2002). 9. Binder, C. et al. Elevated Concentrations of Serum Relaxin are Associated with Metastatic Disease in Breast Cancer Patients. Breast Cancer Res Treat 87, 157-66 (2004). 10. Tashima, L.S. & Bryant-Greenwood, G.D. H1/H2 relaxins in the human breast. MacLennan, A.H., Tregear, G.W. & Bryant-Greenwood G.D. (eds) Progress in relaxin research. World Scientific Publ, 552-557 (1995). 11. Mazoujian, G. & Bryant-Greenwood, G.D. Relaxin in breast tissue. Lancet 335, 298-9 (1990). 12. Ivell, R., Hunt, N., Khan-Dawood, F. & Dawood, M.Y. Expression of the human relaxin gene in the corpus luteum of the menstrual cycle and in the prostate. Mol Cell Endocrinol 66, 251-5 (1989). 13. Sokol, R.Z., Wang, X.S., Lechago, J., Johnston, P.D. & Swerdloff, R.S. Immunohistochemical localization of relaxin in human prostate. J Histochem Cytochem 37, 1253-5 (1989). 85 14. Hansell, D.J., Bryant-Greenwood, G.D. & Greenwood, F.C. Expression of the human relaxin HI gene in the decidua, trophoblast, and prostate. ./ Clin Endocrinol Metab 72, 899-904(1991). 15. Winslow, J.W. et al. Human seminal relaxin is a product of the same gene as human luteal relaxin. Endocrinology 130, 2660-8 (1992). 16. Samuel, C.S., Tian, H., Zhao, L . & Amento, E.P. Relaxin is a key mediator of prostate growth and male reproductive tract development. Lab Invest 83, 1055-67 (2003). 17. Gunnersen, J.M., Roche, P.J., Tregear, G.W. & Crawford, R.J. Characterization of human relaxin gene regulation in the relaxin-expressing human prostate adenocarcinoma cell line LNCaP.FGC. J Mol Endocrinol 15, 153-66 (1995). 18. Brookes, D.E., Zandvliet, D., Watt, F., Russell, P.J. & Molloy, P.L. Relative activity and specificity of promoters from prostate-expressed genes. Prostate 35, 18-26 (1998). 19. Silvertown, J.D., Ng, J., Sato, T., Summerlee, A.J. & Medin, J.A. H2 relaxin overexpression increases in vivo prostate xenograft tumor growth and angiogenesis. Int J Cancer (2005). 20. Figueiredo, K.A. , Palmer, J.B., Mui, A.L. , Nelson, C C . & Cox, M.E. Demonstration of upregulated H2 relaxin mRNA expression during neuroendocrine differentiation of LNCaP prostate cancer cells and production of biologically active mammalian recombinant six histidine tagged H2 relaxin. Sherwood, O.D., Steinetz, B.G., & Fields, P. A. (eds) Relaxin and Related Peptides. Ann NY Acad Sci 1041,320-7 (2005). 21. Nguyen, B.T., Yang, L. , Sanborn, B.M. & Dessauer, C W . Phosphoinositide 3-kinase activity is required for biphasic stimulation of cyclic adenosine 3',5'-monophosphate by relaxin. Mol Endocrinol 17, 1075-84 (2003). 22. Bartsch, O., Bartlick, B. & Ivell, R. Relaxin signalling links tyrosine phosphorylation to phosphodiesterase and adenylyl cyclase activity. Mol Hum Reprod 7, 799-809 (2001). 23. Fei, D.T., Gross, M . C , Lofgren, J.L., Mora-Worms, M . & Chen, A.B. Cyclic AMP response to recombinant human relaxin by cultured human endometrial cells~a specific and high throughput in vitro bioassay. Biochem Biophys Res Commun 170, 214-22 (1990). 86 24. Parsell, D.A., Mak, J.Y., Amento, E.P. & Unemori, E.N. Relaxin binds to and elicits a response from cells of the human monocytic cell line, THP-1. J Biol Chem 271, 27936-41 (1996). 25. Kuznetsova, L. , Plesneva, S., Derjabina, N., Omeljaniuk, E. & Pertseva, M . On the mechanism of relaxin action: the involvement of adenylyl cyclase signalling system. RegulPept 80, 33-9(1999). 26. Cronin, M.J., Malaska, T. & Bakhit, C. Human relaxin increases cyclic AMP levels in cultured anterior pituitary cells. Biochem Biophys Res Commun 148, 1246-51 (1987). 27. Meera, P. et al. Relaxin stimulates myometrial calcium-activated potassium channel activity via protein kinase A. Am J Physiol 269, C312-7 (1995). 28. Zhang, Q., Liu, S.H., Erikson, M . , Lewis, M . & Unemori, E. Relaxin activates the MAP kinase pathway in human endometrial stromal cells. J Cell Biochem 85, 536-44 (2002). 29. Palejwala, S. et al. Relaxin positively regulates matrix metalloproteinase expression in human lower uterine segment fibroblasts using a tyrosine kinase signaling pathway. Endocrinology 142, 3405-13 (2001). 30. Masini, E. , Bani, D., Bigazzi, M . , Mannaioni, P.P. & Bani-Sacchi, T. Effects of relaxin on mast cells. In vitro and in vivo studies in rats and guinea pigs. J Clin Invest 94, 1974-80(1994). 31. Bani-Sacchi, T., Bigazzi, M . , Bani, D., Mannaioni, P.F. & Masini, E. Relaxin-induced increased coronary flow through stimulation of nitric oxide production. Br J Pharmacol 116, 1589-94 (1995). 32. Bani, D., Bigazzi, M. , Masini, E. , Bani, G. & Sacchi, T.B. Relaxin depresses platelet aggregation: in vitro studies on isolated human and rabbit platelets. Lab Invest 73, 709-16 (1995). 33. Bani, D., Masini, E. , Bello, M.G. , Bigazzi, M . & Sacchi, T.B. Relaxin activates the L-arginine-nitric oxide pathway in human breast cancer cells. Cancer Res 55, 5272-5 (1995). 34. Masini, E. et al. Relaxin counteracts myocardial damage induced by ischemia-reperfusion in isolated guinea pig hearts: evidence for an involvement of nitric oxide. Endocrinology 138, 4713-20(1997). 87 35. Bani, D . et al. Relaxin activates the L-arginine-nitric oxide pathway in vascular smooth muscle cells in culture. Hypertension 31, 1240-7 (1998). 36. Bani, D . et al. Relaxin up-regulates the nitric oxide biosynthetic pathway in the mouse uterus: involvement in the inhibition of myometrial contractility. Endocrinology 140, 4434.41 (1999). 37. Masini , E . et al. Relaxin inhibits the activation of human neutrophils: involvement of the nitric oxide pathway. Endocrinology 145, 1106-12 (2004). 38. Bani , D . et al. Inhibitory effects of relaxin on human basophils activated by stimulation of the Fc epsilon receptor. The role of nitric oxide. Int Immunopharmacol 2, 1195-204 (2002). . 39. Anwer, K . et al. Calcium-activated K + channels as modulators of human myometrial contractile activity. Am J Physiol 265, C976-85 (1993). 40. Unemori, E . N . et al. Human relaxin decreases collagen accumulation in vivo in two rodent models of fibrosis. J Invest Dermatol 101, 280-5 (1993). 41. Qin, X . , Garibay-Tupas, J., Chua, P .K . , Cachola, L . & Bryant-Greenwood, G .D . A n autocrine/paracrine role of human decidual relaxin. I. Interstitial collagenase (matrix metalloproteinase-1) and tissue plasminogen activator. Biol Reprod 56, 800-11 (1997). 42. Qin, X . , Chua, P .K . , Ohira, R . H . & Bryant-Greenwood, G . D . A n autocrine/paracrine role of human decidual relaxin. II. Stromelysin-1 ( M M P - 3 ) and tissue inhibitor of matrix metalloproteinase-1 (TIMP-1). Biol Reprod 56, 812-20 (1997). 43. Palejwala, S., Tseng, L . , Wojtczuk, A . , Weiss, G . & Goldsmith, L . T . Relaxin gene and protein expression and its regulation of procollagenase and vascular endothelial growth factor in human endometrial cells. Biol Reprod 66, 1743-8 (2002). 44. Lessey, B . A . , Gu i , Y . , Apparao, K . B . , Young, S.L. & Mulholland, J. Regulated expression of heparin-binding EGF- l ike growth factor ( H B - E G F ) in the human endometrium: a potential paracrine role during implantation. Mol Reprod Dev 62, 446-55 (2002). 45. Ohleth, K . M . & Bagnell, C A . Relaxin-induced deoxyribonucleic acid synthesis in porcine granulosa cells is mediated by insulin-like growth factor-I. Biol Reprod 53, 1286-92 (1995). 88 46. Ohleth, K . M . , Zhang, Q., Lenhart, J .A. , Ryan, P .L . & Bagnell, C A . Trophic effects of relaxin on reproductive tissue: role of the IGF system. Steroids 64, 634-9 (1999). 47. Gao, J .G., Mazella, J. & Tseng, L . Activation of the human IGFBP-1 gene promoter by progestin and relaxin in primary culture of human endometrial stromal cells. Mol Cell Endocrinol 104, 39-46 (1994). 48. Unemori, E . N . et al. Relaxin induces vascular endothelial growth factor expression and angiogenesis selectively at wound sites. Wound Repair Regen 8, 361-70 (2000). 49. Paddison, P.J., Caudy, A . A . , Bernstein, E . , Hannon, G.J . & Conklin, D.S. Short hairpin R N A s (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16, 948-58 (2002). 50. Elbashir, S . M . , Martinez, J., Patkaniowska, A . , Lendeckel, W. & Tuschl, T. Functional anatomy of s iRNAs for mediating efficient R N A i in Drosophila melanogaster embryo lysate. Embo J20, 6877-88 (2001). 51. Wu , X . et al. Development of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2, 47-55 (2000). 52. Naldini , L . , Blomer, U . , Gage, F . H . , Trono, D . & Verma, I . M . Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci U S A 93, 11382-8 (1996). 53. Burns, J.C., Friedmann, T., Driever, W. , Burrascano, M . & Yee, J .K. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci US A 90, 8033-7(1993). 54. Jones, L . J . , Gray, M . , Yue, S.T., Haugland, R.P. & Singer, V . L . Sensitive determination of cell number using the C y Q U A N T cell proliferation assay. J Immunol Methods 254, 85-98 (2001). 55. Auwerx, J. The human leukemia cell line, THP-1 : a multifacetted model for the study of monocyte-macrophage differentiation. Experientia 47, 22-31 (1991). 56. Boyden, S. The chemotactic effect of mixtures of antibody and antigen on polymorphonuclear leucocytes. J Exp Med 115, 453-66 (1962). 89 57. Zigmond, S.H. & Hirsch, J .G. Leukocyte locomotion and chemotaxis. New methods for evaluation, and demonstration of a cell-derived chemotactic factor. J Exp Med 137, 387-410(1973). 58. Matsushima, K . , Larsen, C . G . , DuBois, G .C . & Oppenheim, J.J. Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J Exp Med 169, 1485-90 (1989). 59. Rollins, B .J . , Walz, A . & Baggiolini, M . Recombinant human M C P - 1 / J E induces chemotaxis, calcium flux, and the respiratory burst in human monocytes. Blood 78, 1112-6(1991). 60. Sozzani, S. et al. The signal transduction pathway involved in the migration induced by a monocyte chemotactic cytokine. J Immunol 147, 2215-21 (1991). 61. Yen, H . , Zhang, Y . , Penfold, S. & Rollins, B . J . MCP-1-mediated chemotaxis requires activation of non-overlapping signal transduction pathways. J Leukoc Biol 61, 529-32 (1997). 62. Carnevale, K . A . & Cathcart, M . K . Protein kinase C beta is required for human monocyte chemotaxis to M C P - 1 . J Biol Chem 278, 25317-22 (2003). 63. Hsu, S.Y. et al. Activation of orphan receptors by the hormone relaxin. Science 295, 671 -4 (2002). 64. Pedraza, C. et al. Monocytic cells synthesize, adhere to, and migrate on laminin-8 (alpha 4 beta 1 gamma 1). J Immunol 165, 5831-8 (2000). 65. Dvorak, H .F . Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. N Engl J Med 315, 1650-9 (1986). 66. Mosheimer, B . A . , Kaneider, N . C . , Feistritzer, C , Sturn, D . H . & Wiedermann, C.J . Expression and function of R A N K in human monocyte chemotaxis. Arthritis Rheum 50, 2309-16 (2004). 67. Breuil, V . et al. The receptor activator of nuclear factor (NF)-kappaB ligand ( R A N K L ) is a new chemotactic factor for human monocytes. Faseb J17, 1751-3 (2003). 68. Anderson, D . M . et al. A homologue of the T N F receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature 390, 175-9 (1997). 90 69. Li , J. et al. RANK is the intrinsic hematopoietic cell surface receptor that controls osteoclastogenesis and regulation of bone mass and calcium metabolism. Proc Natl Acad Sci US A 91, 1566-71 (2000). 70. Imhof, B.A. & Aurrand-Lions, M . Adhesion mechanisms regulating the migration of monocytes. Nat Rev Immunol 4, 432-44 (2004). 71. Gerszten, R.E. et al. MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature 398, 718-23 (1999). 72. Kunkel, S.L., Lukacs, N.W., Strieter, R.M., Standiford, T. & Chensue, S.W. The Function of Chemokines in Health and Disease. Rollins, B.J. (ed) Chemokines and Cancer. Humana Press (1999). 73. Luque, E.H., Munoz de Toro, M.M. , Ramos, J.G., Rodriguez, H.A. & Sherwood, O.D. Role of relaxin and estrogen in the control of eosinophilic invasion and collagen remodeling in rat cervical tissue at term. Biol Reprod 59, 795-800 (1998). 74. Silvertown, J.D., Geddes, B.J. & Summerlee, A.J. Adenovirus-mediated expression of human prorelaxin promotes the invasive potential of canine mammary cancer cells. Endocrinology 144, 3683-91 (2003). 75. Wyatt, T.A. et al. Relaxin stimulates bronchial epithelial cell PKA activation, migration, and ciliary beating. Exp Biol Med (Maywood) 227, 1047-53 (2002). 76. Rossi, D. & Zlotnik, A. The biology of chemokines and their receptors. Annu Rev Immunol 18, 217-42 (2000). 77. Mazzucchelli, L. et al. Monocyte chemoattractant protein-1 gene expression in prostatic hyperplasia and prostate adenocarcinoma. Am J Pathol 149, 501-9 (1996). 78. Valkovic, T., Lucin, K., Krstulja, M . , Dobi-Babic, R. & Jonjic, N. Expression of monocyte chemotactic protein-1 in human invasive ductal breast cancer. Pathol Res Prac/194, 335-40 (1998). 79. Saji, H. et al. Significant correlation of monocyte chemoattractant protein-1 expression with neovascularization and progression of breast carcinoma. Cancer 92, 1085-91 (2001). 91 CHAPTER 4 Relaxin promotes Rap1 activation and regulates clustering, igration and activation states of mononuclear myelocytic cells 92 O V E R V I E W M o n o c y t e s are b lood-borne phagocyt ic precursors w i t h c r i t i c a l roles i n i n f l a m m a t i o n a n d tumour b io logy . O n c e monocytes have extravasated into tumour tissue, they can then differentiate into tumour-associated macrophages where intercel lular cross-talk continues between the macrophage and tumour. H e r e w e report that r e l a x i n activates the s m a l l G T P a s e R a p l i n monocytes, and this m e c h a n i s m m a y be responsible for t ime and substrate-dependent re laxin-mediated adhesion properties o f monocytes i n c l u d i n g c e l l c lustering. A d d i t i o n a l l y , w e demonstrate that r e l a x i n can i m p a i r the migratory capacity o f macrophages l i k e l y through a nitr ic oxide-dependent m e c h a n i s m , and we suggest that r e l a x i n is a cr i t ica l regulator o f macrophage act ivat ion states. INTRODUCTION W h i l e the leukocyte infiltrate o f cancers is increas ingly be ing appreciated as an essential contributor to tumour growth and progress ion i n a lmost a l l adenocarcinomas ', our understanding o f h o w their interactions w i t h the tumour create this pro-tumour immunosuppress ive m i c r o e n v i r o n m e n t remains unclear. T h e leukocyte infiltrate includes predominant ly macrophages and T cel ls , as w e l l as natural-ki l ler cel ls , B cel ls , eos inophi ls and granulocytes l _ 3 . T h e types, concentrations and combinat ions o f cytokines and chemokines secreted by the epithel ial tumour and the i m m u n e cel ls themselves determine the number o f cel ls and the c o m p o s i t i o n o f the leukocyte infiltrate. Type-2 p o l a r i z a t i o n is the result o f the combinator ia l inf luence o f m u l t i p l e cytokines o n the loca l i m m u n e cel ls . T h i s is predominant ly characterized b y T-helper 2 (Th2) ce l ls w h i c h suppress c y t o t o x i c T c e l l act iv i ty 4 , and type-2 macrophages (M2) w h i c h also produce immunosuppress ive cytokines 5 ' 6 . 93 The heterogeneity of cells of the mononuclear myelocytic phagocyte system is a reflection of both their adaptability in responding to an array of microenvironmental cues 7 and a continuum of maturation/activation states 8 ' 9 . The leukocyte infiltrate of tumours contains a large component of cells from one such monocyte/macrophage continuum 1 _ 3 . These tumour-associated macrophages (TAM) are differentiated mature cells that can functionally interact with the tumour cells. Their complex interactions have been described by the "macrophage balance hypothesis" 1 0 . T A M can act as both positive and negative regulators of the immune system "; although the prevailing perspectives favour a role in supporting tumour growth through production of growth factors and suppression of anti-tumour activity 5 ' 6 . The undifferentiated T A M precursor, the monocyte, is an essential prerequisite to this end. The "countercurrent principle" suggests that tumour-derived chemokines can actively recruit monocytes resulting in extravasation from the blood 1 2 and digestion of the extracellular matrix, thereby contributing to a pathway for tumour escape and initiation of metastasis 1 3 ' 1 4 . Our lab has previously shown that relaxin is upregulated during neuroendocrine differentiation of prostate cancer cells and relaxin can stimulate adhesion and migration of monocytes 1 5 ' 1 6 (Chapters 2 and 3). Here, we sought to examine whether relaxin could influence other stages of monocytes/macrophage differentiation and activation states commonly observed in tumour-induced leukocyte infiltration. Is relaxin-induced adhesion and migration correlated with enhanced Rap-1 activation as suggested by the currently favoured model for chemokine-induced leukocyte adhesion17 ? Once a non-adherent monocytes become adherent macrophages, is relaxin still able to regulate their migration and otherwise affect their activation states? Here, we provide evidence that relaxin meets several criteria of a tumour-derived factor which can directly influence the biology of the mononuclear cells to potentially support tumour 94 growth. Relaxin stimulates Rap-1 activation likely through a cAMP-dependent pathway, and this correlates with leukocyte clustering, adhesion and migration. Such responses would potentially allow for relaxin-mediated adhesion to endothelium and extravasation into the tumour tissue. Relaxin also impairs the migratory capacity of differentiated macrophages, a function which would likely retain these cells in the vicinity of the tumour. In addition, we provide data indicating that relaxin can alter the phenotype of macrophages from an initial inflammatory phenotype (which supports tumour cell growth and angiogenesis) towards an immunosuppressive phenotype (which is required to attenuate innate immunity). Together these results implicate multiple functions in tumour-derived relaxin regulation of the immune system. M A T E R I A L S A N D M E T H O D S Cell Culture - THP-1, RAW264.7 and RAW264.7gammaNO- cells were all obtained from A T C C . THP-1 cells were cultured in RPMI and 10% fetal bovine serum, whereas RAW264.7 and RAW264.7gammaNO- cells were cultured in D M E M and 10% fetal bovine serum. All experiments were performed with cells cultured less than 15 passages. Ral-GDS production - A pGEX-RalGDS(RBD) construct kindly provided by Dr. Michael Gold (University of British Columbia) was transformed into E. coli, and RalGDS was overexpressed and collected from the lysates using a lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mg/ml lysozyme, 0.1 mg/ml DNase I, 10 pg/ml leupeptin, 10 pg/ml soybean trypsin inhibitor, 1 p.g/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride) as previously described . Rapl activation assays - To measure Rapl activity in THP-1 monocytes, cells were starved overnight in flasks. The next day, 2.5 x 107 cells were aliquoted into eppendorf tubes 95 and incubated in a 37°C waterbath for 1 h. Cells were left untreated or treated with vehicle control (mock), or R L X H (0.02 ng/ml) followed by immediate induction of turbulence. Turbulence was induced by gently flipping tubes up and down 10 times in order to obtain a homogeneous suspension (modified from l 9). Cells were then incubated at 37°C for the indicated time periods. Cells were lysed by addition of equal volume 2X lysis buffer (1% Nonidet P-40, 50 mM Tris-HCL, pH 7.5, 200 mM NaCl, 2 mM MgCl 2 , 10% glycerol, 1 mM Na3VC>4, 1 mM phenylmethylsulfonyl fluoride, 10 p.g/ml leupeptin, 1 pg/ml aprotinin) as previously described 1 8 ' 2 0 . After coupling bacterial lysates containing RalGDS(RBD) to glutathione (GST)-agarose beads (Sigma), treated 350 p,g of THP-1 cell lysates were mixed with the RalGDS(RBD)-GST-agarose complex overnight at 4°C in order to precipitate the activated form of Rapl (RaplGTP). Samples were subsequently washed 3 times in IX lysis buffer prior to SDS PAGE. Immunoblot Analysis - The selectively precipitated RaplGTP and 25 p,g of whole cell lysate were loaded onto 15% SDS PAGE gels. After transferring to nitrocellulose membranes, Rapl levels were probed using a polyclonal a-Rapl (Santa Cruz) and M A P K loading control was probed using monoclonal a-ERKl/2 (1B3B9, Upstate). Expression levels of Rapl and M A P K were determined using fluorescent dye-labeled goat anti-rabbit IgG (680 nm IR Dye, Molecular Probes) and goat anti-mouse IgG (800 nm IR Dye, Rockland, Inc) respectively. Immunoblots were analyzed using an Odyssey infrared imaging system and software (LI-COR Biosciences). Clustering assays - THP-1 cells were treated with phorbol 12-myristate - 13-acetate (PMA, 0, 50, 100 or 200 ng/ml), R L X H (0.02 ng/ml) and/or forskolin (FSK, 10 uM) at 37°C for 24 h. To control for the R L X H vehicle, all samples were treated with the volumetric equivalent 96 of the nickel column elution buffer (50 mM NaH 2 P0 4 , 300 mM NaCl, 250 mM imidazole, and 0.05% Tween-20, pH 8.0) as previously described l 5 . THP-1 cell-cell homotypic adhesion (clustering) was measured under brightfield DIC with a Zeiss Axioplan microscope and Northern Eclipse Imaging software. A group of 10 or more cells adhered to one another is defined as a cluster. cAMP assays - 5 x 105 cells were left untreated or treated with mock, R L X H (0.02 ng/ml), or forskolin (FSK, 10 uM) and isobutylmethylxanthine (IBMX, 50 uM) for 30 min. Non-adhered cells were collected from the media by centrifugation and resuspended in lysis buffer (Biotrak ELISA kit, Amersham). For analysis of the total population cAMP response, the remaining adhered cells were lysed by pooling with the lysis of the corresponding non-adhered cells. Adenylate cyclase activation was measured by competitive cAMP ELISA (Biotrak ELISA kit, Amersham) and normalized to cell equivalents by protein content (BCA assay, Pierce) according to manufacturers' instructions and expressed as fmol cAMP / ug cellular protein. Migration assays - 5 x 105 of RAW264.7 and RAW264.7gammaNO- cells were seeded in the upper chamber of 24-well 5 pm uncoated transwell cell culture inserts (Costar). Cells were treated with or without R L X H (0.02 ng/ml) and/or MCP-1 (50 ng/ml) for 24 h at 37°C. All samples not treated with R L X H received an equivalent volume of the vehicle. The number of migrated cells was determined by CyQuant DNA-binding fluorescence (C-7026, Molecular 21 Probes, Invitrogen) . Relative fluorescence was detected at 485 nm excitation and 527 nm emission by plate reading fluorometer (Fluoroskan Accent FL, ThermoLabsystems) and standardized for cell number. Migration index is the migration normalized to cell number of untreated controls. 97 Analysis of macrophage activation states - 106 THP-1 cells were aliquoted into each well of 24-well plates and PMA-treated (100 ng/ml) for 20 h in RPMI media and 10% FBS. Cell were subsequently left untreated or treated with vehicle control (mock), R L X H (0.0025 ng/ml, 0.005 ng/ml, 0.01 ng/ml or 0.02 ng/ml), IL-4 (10 uM), or IFN-y (10 uM) at 37°C for 1-6 days as indicated. Immediately prior to collection of conditioned media, all cells were treated with the agonist lipopolysaccharide (LPS, 100 ng/ml) for 24 h. Cytokine expression levels in the conditioned media were detected with IL-1 P and IL-lra ELISA duo-sets (RnD Systems) according to the manufacturer's instructions. OD values were determined at 450 nm and 562 nm (reference) wavelengths with a spectrometer (Biotek) and KC4 software. M1/M2 index is a calculated ratio of net IL-ip production versus net IL-lra production. Cytokine levels of relaxin-exposed cells are corrected for basal cytokine expression of vehicle treated cells, and cytokine levels of IFNy and IL-4 exposed cells are corrected for basal cytokine expression of untreated cells. Statistical analysis - Statistical analysis was performed with JMPIN statistical discovery software (SAS Institute). Significant differences among treatments were identified by one way analysis of variance, and significant differences between multiple pairs of treatments were identified by multi-sample matched paired t-tests analyses at a threshold of p < 0.05 unless otherwise noted in the figure legends. RESULTS AND DISCUSSION Relaxin stimulates Rap-1 activation in monocytes Adhesion mechanisms of monocytes have recently been reviewed and these include an essential role for the small GTPase Rap-1 1 7 . Rap-1 has been shown to have critical roles in 98 integrin-mediated cell adhesion and is often mediated through a cAMP-dependent pathway involving the cAMP guanine nucleotide exchange factors (GEF), Epac . In fact, chemokine-induced Rapl mediated leukocyte adhesion and migration has been previously described l 7 ' 2 7 . Because relaxin is able to enhance leukocyte migration through transwells by 1.5 fold and this correlates with relaxin-induced adenylate cyclase activation and a 1.5 fold increase in adhesion to surfaces (Chapter 3) l 6 , we reasoned that relaxin may act through a cAMP-GEF pathway to augment Rapl activity. Rapl activity is induced in monocytes experiencing turbulence l 9 . Here, we demonstrate that in untreated, mock- and RLXH-treated cells, turbulence-induced activation of Rapl was highest at 1 min after turbulence and this was followed by decay in activity until 15 min. Subsequently, a second phase of Rapl activation occurred between 15 and 30 min, likely a result of cells eventually settling to the bottom of the tube. As the cells settle, the chance encounter of cell-cell contact increases dramatically, and this increase in cell-cell contact likely results in increased activation of Rapl through outside-in signalling mechanisms 1 7 . Turbulence-induced Rapl activation in THP-1 monocytes is sustained at higher levels in the presence of relaxin (Fig 4.1). In addition, at all time points examined subsequent to turbulence, Rapl activity was greatest in the presence of relaxin, suggesting that relaxin-induced cAMP accumulation in THP-1 monocytes likely results in activation of Rapl. This relaxin-induced Rapl activation is additive to the turbulence-induced Rapl activation. Relaxin enhanced adhesion and migration is time- and substrate-dependent To examine whether relaxin can promote adhesion of monocytes to substrate surfaces, untreated THP-1 cells were compared to cells treated with either R L X H or phorbol ester myristate (PMA), a chemical agent well known to promote THP-1 adhesion and differentiation 99 . Time course analysis revealed that relaxin enhanced adhesion of THP-1 cells was not evident prior to 8 h and was optimal at about 24 h after initial relaxin exposure (Fig 4.2A). At the latter time point, R L X H induced a 1.5-fold increase in THP-1 adhesion above basal levels, and PMA stimulated monocyte adhesion to an expected almost 3-fold greater response than basal levels. These results suggest that relaxin-induced activation of monocytes may be important in stimulating these cells to express cell surface molecules required for enhanced adhesion. The relaxin-enhanced adhesion response was also assessed on a variety of substrates, but no significant improvement in R L X H vs untreated differential adhesion was achieved when compared to uncoated tissue culture plastic (data not shown). Because relaxin-induced adhesion is optimal at 24 h on tissue-coated plastic, perhaps relaxin-enhanced Rapl activity may be greater at time points beyond 30 min. We reasoned that an increased ability of monocytes to adhere to surfaces may correlate with an enhanced ability to travel through endothelial sheets or artificially through transwells in Boyden-chamber based assays ' . Although, the relaxin enhanced migration of THP-1 cells on uncoated transwells was apparent by 8 h, the relaxin-enhanced MCP-1 chemotactic response was not optimal until about 24 h after initial relaxin exposure (Fig 4.2B). Cells exposed to MCP-1 in the presence of R L X H (0.02 ng/ml in both chambers) demonstrated an increase propensity to migrate to the lower chamber. The migration index of cells treated with MCP-1 for 24 h in the absence of R L X H is 8-fold and [8/4] = 2-fold greater than the vehicle-treated cells at 30 min and 24 h respectively. By contrast the migration index of cells treated with MCP-1 for 24 h in the presence of R L X H is 12-fold and [12/4] = 3-fold greater than the vehicle-treated cells at 30 min and 24 h respectively. Although relaxin-induced adhesion on laminin-coated surfaces had not been tested in our lab, others had demonstrated that laminin could enhance the 100 31 adhesion of monocytes to surfaces . We previously determined that the relaxin-enhanced migratory and the relaxin-enhanced MCP-1 chemotactic response at 24 h on uncoated transwells could be replicated at 3 h on laminin-coated transwells (Chapter 3). Together, these data suggest that relaxin enhanced adhesion and migratory responses on uncoated transwells is optimal at 24 h; however, in the presence of physiologically relevant substrates (eg. those found on endothelial sheets), the relaxin-mediated adhesion and migration responses can occur much more efficiently. Relaxin augments clustering of monomyelocytic cells Clustering or cell-cell adhesion of leukocytes in the blood is advantageous in a tumour model of leukocyte infiltration and extravasation because it could potentially lead to blockage of the microvasculature. This would augment the local population of leukocytes in the blood thereby increasing the number of cells able to extravasate into the tumour tissue. Such tumour-induced microvasculature blockage could also lead to hypoxic conditions which stimulate 32 angiogenesis and further support tumour growth . An enhanced ability for monocytes to adhere to surfaces may indicate an enhanced ability for cells to adhere to each other. We examined whether relaxin could promote cell-cell homotypic adhesion of THP-1 cells at varying concentrations of phorbol 12-myristate 13-acetate (PMA) (Fig 4.3A). At all concentrations of PMA tested R L X H enhanced this adhesion. In a larger field, we observed that relaxin substantially enhances cell-cell clumping in the presence of PMA (80% of cells in clusters) relative to the PMA-treated controls (21% of cells in clusters) (Fig 4.3B). Also this relaxin-enhanced cell-cell homotypic adhesion is replicated by the addition of FSK to PMA-treated cells (88% of cells in clusters). This suggests that relaxin may act through an adenylate cyclase/cAMP pathway to enhance the phorbol ester-induced PKC-101 dependent responses. This relaxin-enhanced cAMP-dependent augmentation of a PKC-mediated response is reminiscent of our earlier observations of relaxin-induced cAMP activation which enhances the MCP-1 PKC-dependent chemotactic response 1 6 (Chapter 3). Relaxin selectively impairs migration of macrophages capable of nitric oxide production Relaxin-induced adenylate cyclase activation in adherent monocytes is substantially reduced when compared to the non-adherent population 1 6 (Chapter 3). These adherent cells no longer produce substantial amounts of cAMP in response to relaxin. To further our studies on relaxin-induced regulation of THP-1 cells and peripheral blood mononuclear cells, and to determine whether relaxin-induced responses were prevalent in other cells of the immune system, a variety of hemopoeitic cells were screened for relaxin stimulated cAMP production and relaxin-mediated migratory responsiveness (Appendix 6-6). The adherent murine macrophage cell line RAW264.7 and its nitric oxide deficient subclone (RAW264.7gammaNO-) provide intriguing results (Fig 4.4). As expected, MCP-1 has little effect on migration of the parental and subclone RAW264.7 macrophages (Fig 4.3B), and this is likely due to downregulation of the MCP-1 receptor (CCR2) when a monocyte becomes a macrophage 4 . Although these cells do not respond to relaxin through production of cAMP (Fig 4.4A), the migratory response of parental RAW264.7 murine macrophages is only 60% of basal levels when these cells are exposed to relaxin regardless of the absence or presence of MCP-1 (Fig 4.4B). This relaxin-induced migratory impairment is absent in RAW264.7gammaNO- cells which unlike the parental line, do not produce nitric oxide upon treatment with IFN-y alone, but require LPS for full activation. These data suggest that relaxin may have an inhibitory effect on migration of macrophages, and that this inhibitory response is dependent on nitric oxide 102 production and independent of cAMP production (Fig 4.4A,B). This inhibitory function for relaxin is in good agreement with previous observations of relaxin-impaired migration through a nitric oxide-dependent mechanism in mast cells 3 3 and platelets 3 4 and the polymorphonuclear leukocytes: neutrophils 3 5 and basophils 3 6 . Intriguingly none of these reports were able to demonstrate relaxin-induced cAMP accumulation in any of these cell types. Our current observation of relaxin-impaired macrophage migration supplements our previous suggestions that relaxin may be a critical regulator of leukocyte functions during tumour progression. For example as suggested in Chapter 3, relaxin may be critical for recruiting monocytes to inflammatory tumour tissue. Once there, a monocyte will differentiate into a macrophage, and relaxin may act to impede the escape of these macrophages from the tumour tissue by directly impairing their ability to migrate. Relaxin alters the activation states of macrophages Chemokines are not only important in regulating hemopoeitic cell recruitment and infiltration of inflammatory tissue, but they can also induce morphological differentiation of these cells at the site of inflammation. For example, MCP-1, which is also a lymphocyte chemoattractant, can also induce Thl-type to Th2-type phenotypic switching in T cells 3 1 . It is not inconceivable then that relaxin may regulate similar morphological changes in leukocytes that have infiltrated the tumour tissue. Type-1 activated T cells (Thl) produce IFN-y, IL-2 and T N F -P , whereas type-2 activated T cells (Th2) produce interleukin (IL)-4, 5, 6, 9, 10 and 13 3 8 . In 1999, Piccinni et al demonstrated relaxin stimulates production of interferon (IFN)-y in human T cells, thereby inducing a Thl-like effector phenotype 3 9 . This group speculated that during pregnancy relaxin may counterbalance the Th2-inducing activity of progesterone and stimulate a 103 Thl response to protect the mother against intracellular pathogens. Relaxin has also been shown to be responsible for inducing production of inflammatory cytokines IL-1 p and tumour necrosis factor (TNF)a in peripheral blood mononuclear cells during 24 h exposure 4 0 . Here, we demonstrate for the first time that relaxin can induce an inflammatory response in macrophages for up to 2 days, but beyond that chronic relaxin exposure induces an immunosuppressive phenotype (Fig 4.5 and 4.6). Components of the IL-1 system are coordinately regulated by Thl and Th2 cytokines. IL-1 (ie IL-1 a and IL-1 P ) and IL-1 receptor antagonist (IL-lra) are produced in human myeloid cells stimulated with lipopolysaccharide (LPS). IL-4 suppresses IL-1 (3 production and increases expression of IL-lra in these cells 4 1 ' 4 2 . IL-13 which shares the receptor chain IL-4Rct, similarly impairs production of IL-1 and enhances production of IL-lra 4 3 ' 4 4 . IL-13 treated cells also release the decoy receptor IL-1RII which has 2-fold less avidity for IL-lra than IL-1 P 4 5 . Furthermore, transcriptional profiling of IL-13 stimulated cells reveals that IL-1RII and IL-lra are upregulated, whereas ILip-converting enzyme (caspase 1) is downregulated with the resulting decrease in pro-IL-l(3 processing 4 6 . Together these data suggest that activation of the IL-4Rot through IL-4 or IL-13 can induce downregulation of the IL-1 signaling axis and this is correlated with an alternatively activated M2 phenotype in macrophages. IFN-y has opposite effects on IL-1 system regulation and stimulates the classic pathway of M l activation in macrophages (reviewed in 5). Here, we describe a role for relaxin in regulation of macrophage differentiation and activation using the IL-1 system as phenotypic endpoints (Fig 4.5 and 4.6). Relaxin-exposed PMA-differentiated THP-1 macrophages respond to LPS by stimulating IL-1 p production at 2 days after initial relaxin exposure, however this response is lost at 3 days (Fig 4.5A). Similarly, relaxin-exposed cells respond to LPS by stimulating IL-lra production at 104 2 days, and this response is independent of relaxin concentration (Fig 4.5B). This suggests that relaxin-exposure even at minimal concentrations is able to induce morphological changes in macrophages which allows them to produce IL-lra in response to LPS. As expected, a morphological differentiation is an all-or-none event and is unlikely to be dependent on concentration of the differentiating agent. To examine relaxin-regulation of macrophage activation states, conditioned media was collected and assayed at multiple time points from cells exposed to vehicle control (mock), R L X H (0.02ng/ml), IFN-y (10 pM), or IL-4 (10 uM). All samples were treated with LPS for 24 h immediately prior to collection of conditioned media. IFN-y exposed cells resulted in the expected LPS-induced IL-1 (3 inflammatory response (Fig 4.5C), whereas IL-4 exposed cells resulted in the expected LPS-induced IL-lra immunosuppressive response (Fig 4.5D). Time course analysis reveals that relaxin-exposure results in LPS-induced IL-1 (3 production at 2 days. Interestingly, this relaxin induced an IFN-y inflammatory-like phenotype (Fig 4.5C) may explain the relaxin-induced migratory impairment which is absent in RAW264.7gammaNO- cells which do not produce nitric oxide upon treatment with IFN-y alone (Fig 4.4B). This relaxin-induced inflammatory response subsequently decays in the following days (Fig 4.5C). At all time points examined, relaxin-exposure resulted in enhanced LPS-induced IL-lra production, however the differential increase in IL-lra production of relaxin vs vehicle exposed cells is most apparent between days 2 and 4 (Fig 4.5D). In order to describe a role for relaxin as a mediator of inflammatory or immunosuppressive phenotypes and to provide interpretative value to these experiments, an M1/M2 index is calculated at each time point (Fig 4.6). Relaxin-exposure results in an inflammatory macrophage phenotype at day 2, but subsequently becomes immunosuppressive 105 (Fig 4.6A). To confirm the validity of the M1/M2 index, IFN-y and IL-4 were used as controls for inflammatory and immunosuppressive phenotypes respectively (Fig 4.6B). IFN-y exposure initially results in the expected inflammatory phenotype, but this slowly decays over time. IL-4 exposure results in an immunosuppressive phenotype which is maintained for up to 6 days. Together these results suggest that macrophage exposure to relaxin results in an initial inflammatory phenotype, but chronic relaxin exposure mediates an immunosuppressive phenotype. C O N C L U S I O N Our studies strongly imply that relaxin has critical roles in regulation of cells of the mononuclear myelocytic phagocyte system. Relaxin stimulates monocyte cAMP accumulation16 (Chapter 3) and Rapl activity (Fig 4.1). The physiological repercussions of these events likely include time and substrate-dependent enhanced adhesion and enhanced migratory capacity (Fig 4.2 and Chapter 3), as well as an enhanced ability for cell clustering (Fig 4.3). Although relaxin cannot stimulate cAMP accumulation in adherent macrophages (Fig 4.4A), it is nonetheless able to impair their migratory capacity through a nitric oxide dependent mechanism (Fig 4.4B). In addition, relaxin can dramatically influence the cytokine profiles (Fig 4.5) and activation states (Fig 4.6) of macrophages in a time dependent manner. Because relaxin may potentially be an important regulator of breast and prostate cancer progression (Chapter 1), the current data strongly suggest that relaxin may be a factor at multiple levels and stages of tumour-induced immune cell recruitment and functional alteration. 106 Figure 4.1 107 Figure 4.1 Relaxin enhances turbulence-induced Rapl activation. 2.5 x 107 THP-1 cells were left untreated or treated with vehicle control (mock), or R L X H (0.02 ng/ml) followed by immediate induction of turbulence, and cells were then incubated at 37°C for the indicated time periods. Rapl activity is a measure of specific precipitation of RaplGTP as described in Materials and Methods. 350 u.g of lysates were used for the Rapl pulldown assay. The immunoblots of selectively precipitated RaplGTP and 25 p,g of whole cell lysates were probed using a polyclonal a-Rapl and a monoclonal a-ERKl/2. Expression levels of total Rapl and total M A P K were determined using fluorescent dye-labeled goat anti-rabbit and anti-mouse IgG respectively. Immunoblots were scanned and densitometric quantitation of RaplGTP levels were determined using an Odyssey infrared imaging system and software (LI-COR, Biosciences). 108 Figure 4.2 1 0 9 Figure 4.2 Relaxin-induced adhesion and migration of THP-1 cells is optimal at 24 h. (A) 5 x 105 THP-1 cells were untreated (triangles) or treated with R L X H (0.02 ng/ml) (circles) or phorbol 12-myristate 13-acetate (100 ng/ml) (squares). Cells were incubated for 30 min, 2 h, 8h and 24 h at 37°C, and assayed as described in Chapter 3 Materials and Methods. Adhesion index is calculated as fold-change of adhered cells relative to untreated samples at 30 min. Values are means ± SD of a representative experiment assayed in triplicate. Paired t-test analyses: a) vs respective untreated control p < 0.01; b) vs respective untreated control p < 0.05. (B) 5 x 105 THP-1 cells were serum starved overnight, and then seeded on 24-well uncoated transwell inserts (5 uM pores) and treated with vehicle control (open squares), R L X H (0.02 ng/ml) in both chambers (solid squares), MCP-1 (50ng/ml) in lower chamber (open circles), or R L X H (0.02 ng/ml) in both chambers and MCP-1 (50ng/ml) in lower chamber (solid circles). Cells were incubated for 2 h, 8 h and 24 h at 37°C, and assayed as described in Chapter 3 Materials and Methods. Migration index is calculated as fold-change of cells migrated relative to vehicle control at 2 h. Values are means ± SD of a representative experiment assayed in triplicate. Paired t-test analyses: a) R L X H & MCP-1 vs respective MCP-1 alone treatment p < 0.01. 110 Figure 4.3 i n Figure 4 .3 Relaxin stimulates clustering of THP-1 cells. (A) Relaxin enhances phorbol ester-induced homotypic cell-cell adhesion (clustering) in THP-1 cells. Cells were treated with phorbol 12-myristate - 13-acetate (PMA, 0, 50, 100 or 200 ng/ml) in the absence (-) or presence (+) of R L X H (0.02 ng/ml) and/or forskolin (FSK, 10 uM). All samples were exposed to equivalent amounts of the vehicle control. Magnification = 32X. (B) Relaxin- enhanced PMA-induced cell-cell adhesion can be replicated by FSK (10 uM) in THP-1 cells. Cells were treated with R L X H (0.02ng/ml) or FSK (10 uM) in the presence of PMA (100 ng/ml), or treated with PMA (100 ng/ml) alone. All samples were exposed to equivalent amounts of the vehicle control. Percent cells in clusters represent the proportion of cells in clumps of 10 or more cells. Magnification = 10X. 112 Q. 1 30 25 ro c o Q . 20 £ 15 10 0 • untreated • mock • R L X H 0 F S K IBMX mm R A W 2 6 4 . 7 R A W 2 6 4 . 7 g a m m a N O -B 1.2 1.0 "2 0.8 Oi "io 0.6 ro i 0.4 0.2 0.0 • mock • RLXH • MCP-1 H RLXH & MCP-1 RAW264.7 RAW264.7 gamma NO-ure 4.4 113 Figure 4.4 Adenylate cyclase and migratory responses of RAW macrophages. (A) 5 x 105 cells were untreated (white bars) or treated with mock (black bars), R L X H (0.02 ng/ml) (grey bars), or FSK (lOuM) and IBMX (50uM) (diagonal hatched bars) for 30 min at 37°C. Adenylate cyclase activity was assayed as described in Materials and Methods. Values are means ± SD of a representative experiment assayed in triplicate. (B) 5 x 105 cells were serum starved overnight, and then seeded on 24-well uncoated transwell inserts (5 uM pores) and treated with vehicle control (black bars), R L X H (0.02 ng/ml) in both chambers (grey bars), MCP-1 (50ng/ml) in lower chamber (dotted bars), or R L X H (0.02 ng/ml) in both chambers and MCP-1 (50ng/ml) in lower chamber (horizontal hatched bars). Cells were incubated for 24 h at 37°C, and assayed as described in Materials and Methods. Migration index is calculated as fold-change of cells migrated relative to untreated control. Values are means ± SD of a representative experiment assayed in triplicate. Paired t-test analyses: a) mock vs R L X H p < 0.05; b) MCP-1 alone vs R L X H & MCP-1 p< 0.01. 114 A B 0 0.0025 0.005 0.01 0.02 0 0.0025 0.005 0.01 0.02 RLXH (ng/ml) RLXH (ng/ml) Figure 4.5 115 Figure 4.5 Relaxin regulates cytokine profiles of macrophages. 106 THP-1 cells were added to wells of 24-well plates and pre-treated with PMA (100 ng/ml) for 20h to induce macrophage differentiation. (A and B) Cells were treated with R L X H at 0 ng/ml, 0.0025 ng/ml, 0.005 ng/ml, 0.01 ng/ml or 0.02 ng/ml for either 2 or 3 days at 37°C. All samples were exposed to LPS (100 ng/ml) during the final 24 h. Conditioned media was collected and assayed for IL-1 p (A) or IL-lra (B) cytokine expression as described in Materials and Methods. Paired t-test analyses: a) vs respective untreated p < 0.05. (C and D) Cells were treated with mock, R L X H (0.02 ng/ml), IL-4 (10 uM) or IFN-y (10 uM) for 1 to 6 days at 37°C. All samples were exposed to LPS (100 ng/ml) during the final 24 h. Conditioned media was collected and assayed for IL-lp (C) or IL-lra (D) cytokine expression as described in Materials and Methods. Values are means +/- SD of one of three representative experiments each performed in duplicate. Paired t-test analyses: a) R L X H vs respective mock control p < 0.05; b) R L X H vs respective mock control p < 0.01. 117 F igure 4.6 Time (d) 118 Figure 4.6 Relaxin regulates activation states of macrophages. Inflammatory and immunosuppressive profile of macrophage exposure to (A) R L X H (0.02 ng/ml) or (B) IL-4 (10 uM) or IFN-y (10 uM) for 1 to 6 days at 37°C. All samples were exposed to LPS (100 ng/ml) during the final 24 h. M1/M2 index is a calculated ratio of net IL-1 P production versus net IL-lra production. Cytokine levels of relaxin-exposed cells are corrected for basal cytokine expression of vehicle treated cells, and cytokine levels of IFN-y and IL-4 exposed cells are corrected for basal cytokine expression of untreated cells. Values are means of three independent experiments each performed in duplicate. 119 R E F E R E N C E S (Chapter 4) 1. Coussens, L . M . & Werb, Z. Inflammation and cancer. Nature 420, 860-7 (2002). 2. Balkwill, F. & Mantovani, A. Inflammation and cancer: back to Virchow? Lancet 357, 539-45 (2001). 3. Balkwill, F. Cancer and the chemokine network. Nat Rev Cancer 4, 540-50 (2004). 4. Mantovani, A. et al. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25, 677-86 (2004). 5. Mantovani, A., Sozzani, S., Locati, M. , Allavena, P. & Sica, A. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol 23, 549-55 (2002). 6. Pollard, J.W. Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 4, 71-8 (2004). 7. Leenen, P.J. & Campbell, P.A. Heterogeneity of mononuclear phagocytes, in Blood Cell Biochemistry: Macrophages and Related Cells, Vol. 5 (ed. Horton, M.A.) 29-85 (Plenum Press, New York, NY, 1993). 8. Dransfield, I., Corcoran, D., Partridge, L.J., Hogg, N. & Burton, D.R. Comparison of human monocytes isolated by elutriation and adherence suggests that heterogeneity may reflect a continuum of maturation/activation states. Immunology 63, 491-8 (1988). 9. Gordon, S. & Taylor, P.R. Monocyte and macrophage heterogeneity. Nat Rev Immunol 5, 953-64 (2005). 10. Sica, A., Saccani, A. & Mantovani, A. Tumor-associated macrophages: a molecular perspective. Int Immunopharmacol 2, 1045-54 (2002). 11. Elgert, K.D., Alleva, D.G. & Mullins, D.W. Tumor-induced immune dysfunction: the macrophage connection. JLeukoc Biol 64, 275-90 (1998). 12. Opdenakker, G. & Van Damme, J. Novel monocyte chemoattractants in cancer, in Chemokines and Cancer (ed. Rollins, B.J.) 51-69 (Humana Press, Totowa, NJ, 1999). 13. Opdenakker, G. & Van Damme, J. Chemotactic factors, passive invasion and metastasis of cancer cells. Immunol Today 13, 463-4 (1992). 14. Opdenakker, G. & Van Damme, J. The countercurrent principle in invasion and metastasis of cancer cells. Recent insights on the roles of chemokines. IntJDev Biol 48, 519-27 (2004). 120 15. Figueiredo, K.A. , Palmer, J.B., Mui, A.L. , Nelson, C.C. & Cox, M.E. Demonstration of Upregulated H2 Relaxin mRNA Expression during Neuroendocrine Differentiation of LNCaP Prostate Cancer Cells and Production of Biologically Active Mammalian Recombinant 6 Histidine-Tagged H2 Relaxin. Ann N Y Acad Sci 1041, 320-7 (2005). 16. Figueiredo, K.A. , Mui, A .L . , Nelson, C.C. & Cox, M.E. Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism. J Biol Chem 281, 3030-9 (2006). 17. Imhof, B.A. & Aurrand-Lions, M . Adhesion mechanisms regulating the migration of monocytes. Nat Rev Immunol 4, 432-44 (2004). 18. McLeod, S.J., Ingham, R.J., Bos, J.L., Kurosaki, T. & Gold, M.R. Activation of the Rapl GTPase by the B cell antigen receptor. J Biol Chem 273, 29218-23 (1998). 19. de Bruyn, K . M . , Zwartkruis, F.J., de Rooij, J., Akkerman, J.W. & Bos, J.L. The small GTPase Rapl is activated by turbulence and is involved in integrin [alpha]IIb[beta]3-mediated cell adhesion in human megakaryocytes. J Biol Chem 278, 22412-7 (2003). 20. Franke, B., Akkerman, J.W. & Bos, J.L. Rapid Ca2+-mediated activation of Rapl in human platelets. Embo J16, 252-9 (1997). 21. Jones, L.J., Gray, M . , Yue, S.T., Haugland, R.P. & Singer, V .L . Sensitive determination of cell number using the CyQUANT cell proliferation assay. J Immunol Methods 254, 85-98 (2001). 22. McLeod, S.J., Shum, A.J., Lee, R.L., Takei, F. & Gold, M.R. The Rap GTPases regulate integrin-mediated adhesion, cell spreading, actin polymerization, and Pyk2 tyrosine phosphorylation in B lymphocytes. J Biol Chem 279, 12009-19 (2004). 23. de Bruyn, K . M . , Rangarajan, S., Reedquist, K.A. , Figdor, C G . & Bos, J.L. The small GTPase Rapl is required for Mn(2+)- and antibody-induced LFA-1- and VLA-4-mediated cell adhesion. J Biol Chem 277, 29468-76 (2002). 24. Katagiri, K. et al. Rapl is a potent activation signal for leukocyte function-associated antigen 1 distinct from protein kinase C and phosphatidylinositol-3-OH kinase. Mol Cell Biol 20, 1956-69 (2000). 25. Bos, J.L., de Rooij, J. & Reedquist, K.A. Rapl signalling: adhering to new models. Nat Rev Mol Cell Biol 2, 369-77 (2001). 121 26. Bos, J.L. et al. The role of Rapl in integrin-mediated cell adhesion. Biochem Soc Trans 31, 83-6 (2003). 27. Shimonaka, M . et al. Rapl translates chemokine signals to integrin activation, cell polarization, and motility across vascular endothelium under flow. J Cell Biol 161, 417-27 (2003). 28. Auwerx, J. The human leukemia cell line, THP-1: a multifacetted model for the study of monocyte-macrophage differentiation. Experientia 47, 22-31 (1991). 29. Boyden, S. The chemotactic effect of mixtures of antibody and antigen on polymorphonuclear leucocytes. J Exp Med 115, 453-66 (1962). 30. Zigmond, S.H. & Hirsch, J.G. Leukocyte locomotion and chemotaxis. New methods for evaluation, and demonstration of a cell-derived chemotactic factor. J Exp Med 137, 387-410 (1973). 31. Pedraza, C. et al. Monocytic cells synthesize, adhere to, and migrate on laminin-8 (alpha 4 beta 1 gamma 1). J Immunol 165, 5831-8 (2000). 32. Knowles, H., Leek, R. & Harris, A .L . Macrophage infiltration and angiogenesis in human malignancy. Novartis Found Symp 256, 189-200; discussion 200-4, 259-69 (2004). 33. Masini, E., Bani, D., Bigazzi, M. , Mannaioni, P.F. & Bani-Sacchi, T. Effects of relaxin on mast cells. In vitro and in vivo studies in rats and guinea pigs. J Clin Invest 94, 1974-80(1994). 34. Bani, D., Bigazzi, M . , Masini, E. , Bani, G. & Sacchi, T.B. Relaxin depresses platelet aggregation: in vitro studies on isolated human and rabbit platelets. Lab Invest 73, 709-16 (1995). 35. Masini, E. et al. Relaxin inhibits the activation of human neutrophils: involvement of the nitric oxide pathway. Endocrinology 145, 1106-12 (2004). 36. Bani, D. et al. Inhibitory effects of relaxin on human basophils activated by stimulation of the Fc epsilon receptor. The role of nitric oxide. Int Immunopharmacol 2, 1195-204 (2002). 37. Gu, L. et al. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature 404, 407-11 (2000). 38. Mosmann, T.R. & Coffman, R.L. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol 7, 145-73 (1989). 122 39. Piccinni, M.P. et al. Relaxin favors the development of activated human T cells into Thl -like effectors. Eur J Immunol 29, 2241-7 (1999). 40. Kristiansson, P., Holding, C , Hughes, S. & Haynes, D. Does human relaxin-2 affect peripheral blood mononuclear cells to increase inflammatory mediators in pathologic bone loss? Ann N Y Acad Sci 1041, 317-9 (2005). 41. Dinarello, C A . Interleukin-1 and interleukin-1 antagonism. Blood 77, 1627-52 (1991). 42. Vannier, E. , Miller, L . C & Dinarello, C A . Coordinated antiinflammatory effects of interleukin 4: interleukin 4 suppresses interleukin 1 production but up-regulates gene expression and synthesis of interleukin 1 receptor antagonist. Proc Natl Acad Sci USA 89, 4076-80(1992). 43. de Waal Malefyt, R. et al. Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes. Comparison with IL-4 and modulation by IFN-gamma or IL-10. J Immunol 151, 6370-81 (1993). 44. Muzio, M . et al. Interleukin-13 induces the production of interleukin-1 receptor antagonist (IL-lra) and the expression of the mRNA for the intracellular (keratinocyte) form of IL-lra in human myelomonocytic cells. Blood 83, 1738-43 (1994). 45. Colotta, F. et al. Regulated expression and release of the IL-1 decoy receptor in human mononuclear phagocytes. J Immunol 156, 2534-41 (1996). 46. Scotton, C J . et al. Transcriptional profiling reveals complex regulation of the monocyte IL-1 beta system by IL-13. J Immunol 174, 834-45 (2005). 123 C H A P T E R 5 CONCLUSION: A model for tumour-derived relaxin mediation of the immune response 124 OVERVIEW - Novel physiological functions and signalling in leukocytes exposed to relaxin Relaxin has many pleiotropic functions in many cell types and tissues (Table 1.2), and some of these are characteristic of a tumour-derived factor which is capable of affecting malignant progression (Fig 1.4). This thesis has sought to broaden our understanding of the functions of tumour-derived relaxin in the context of immune responses. The signalling pathways required for these functions are outlined in Figure 5.1. Relaxin was characterized as a novel product of neuroendocrine differentiation in LNCaP cells ' (Chapter 2). In order to examine the impact of relaxin on host cells, recombinant 6 histidine tagged human relaxin H2 was overexpressed (RLXH), purified and characterized 1 (Chapter 2). Relaxin was shown to be capable of inducing dose-dependent cAMP accumulation in THP-1 cells and peripheral blood mononuclear cells (PBMC), and relaxin preferentially stimulates cAMP accumulation in the non-adherent population 2 (Chapter 3). Relaxin was able to stimulate substrate adhesion and chemomigration of THP-1 and PBMC, and relaxin was able to enhance the MCP-1 chemotactic response of THP-1 cells (Chapter 3). The relaxin receptor, LGR7, was shown to be responsible for mediating relaxin-induced cAMP accumulation and relaxin-enhanced chemomigratory responses in THP-1 cells 2 (Chapter 3). Relaxin was also able to enhance turbulence-induced Rap-1 activity in THP-1 cells, suggesting that relaxin may act through a LGR7/ adenylate cyclase/ cAMP/ Epac / Rapl mechanism to promote integrin activation thereby allowing for enhanced adhesion and chemomigratory properties (Chapters 3 and 4). In addition, relaxin was able to promote clustering of THP-1 cells, likely through a similar mechanism (Chapter 4). Relaxin was also able to impede the migration of RAW264.7 macrophages through a nitric oxide dependent mechanism (Chapter 4). And finally, relaxin was shown to be a regulator of 125 macrophage morphological changes by altering their activation states and cytokine profiles over time (Chapter 4). Characterization of the relaxin molecule as a mediator of immune responses Relaxin has chemokine-Iike properties Chemokinesis refers to the non-directional chemically induced random kinetic movement of cells. Chemokines refer to chemotactic cytokines which cause the directed migration of leukocytes, and are classified into four highly conserved groups based on the position and number of cysteine residues at the amino terminus . Hence, the term chemokine is actually a misnomer which has been commandeered by the abundance of molecules with chemotactic properties. Relaxin in a sense is a real chemokine because it meets the definition of a molecule which can induce chemokinesis. However, relaxin does not categorically belong in any of the four known groups of chemokines because of its unique N-terminal structure and because it regulates chemokinesis through a GPCR coupled to Gas rather than through f3y subunits of God coupled receptors 4 . Nonetheless, switching of Gas signalling to Gai signalling has previously been demonstrated in the (3-adrenergic receptor GPCR 5 , so such a similar mechanism in LGR7 signalling cannot be excluded. It is however unlikely that (3y subunits are responsible for relaxin induced migration, since this response can be replicated by direct activation of adenylyl cyclase with forskolin treatment (Fig 3.2A). In addition to directly promoting mononuclear cell adhesion (Fig 3.1C and Fig 3.3B), the 1.5 to 1.8 fold increase in migration observed in the presence of relaxin (Fig 3.2A and Fig 3.3C) may also be attributed to relaxin's ability to stimulate random non-directional migration. This random migration may allow for more frequent encounters with surfaces, thereby allowing for greater adhesion opportunities. 126 This thesis describes that relaxin can stimulate a chemomigratory response in mononuclear cells which is dependent on G protein-coupled receptor activation resulting in c A M P production 2 (Chapter 3), whereas others have demonstrated that M C P - 1 regulates their chemotactic migratory response through a P K C dependent pathway 6 ' 7 . The additive effect of activation of these distinct pathways should not be surprising since several studies have shown that leukocyte chemotaxis/kinesis signalling pathways differ from those responsible for adhesion ' . Direct involvement of c A M P / P K A signalling pathways in actin-based adhesion and migration are well established and have recently been reviewed 1 0 . In addition, the c A M P - G E F , Epac has been shown to be important in cAMP-mediated, Rapl dependent, integrin activation "" l 4 . Therefore, an Epac-mediated pathway may be an important alternative to a P K A pathway in propagating the relaxin-induced adhesion and migratory signals in mononuclear cells. A s shown in Chapter 4, relaxin can augment turbulence-induced Rap l activation. This is likely responsible for relaxin induced clustering, adhesion and chemomigration, and implies a relaxin/ L G R 7 / Gas / adenylate cyclase/ c A M P / Epac/ Rapl signalling mechanism (Fig 5.1). Relaxin may also be important in upregulating expression of other chemokine receptors in leukocytes. For example, the relaxin-induced c A M P / P K A activation may upregulate cell surface expression of C C R 2 , thereby allowing for enhanced responsiveness to M C P - 1 . c A M P / P K A induced upregulation of another chemokine receptor has been previously established l 5 . Similarly, relaxin-induced activation may upregulate expression of other chemokines in'leukocytes. Hence, a relaxin gradient emanating from a tumour may establish gradients of 'conventional' chemokines to further promote leukocyte recruitment. Chemomigratory factors have previously been shown to stimulate adhesion of leukocytes. For example, MCP-1 and interleukin-8 (IL-8) can each independently induce 127 adhesion of monocytes to vascular endothelium . Cytokines interleukin-1 (IL-1) and tumour neurosis factor (TNF) can also each induce adhesion of leukocytes to vascular endothelium. In fact, the adhesion interaction between leukocytes and endothelium stimulates production of leukocyte-derived cytokines/chemokines which serve to further activate the immune response 1 6 . Chemokines are not only important in regulating hemopoeitic cell recruitment and infiltration of inflammatory tissue, but they can also induce morphological differentiation of these cells at the site of inflammation. For example, M C P - 1 , which is also a lymphocyte chemoattractant, can also induce Thl-type to Th2-type phenotypic switching in T cells l 7 . Similarly, relaxin can also induce morphological changes in macrophages by initially promoting an inflammatory M l - l i k e phenotype, followed by an immunosuppressive tumour supporting M2-l ike phenotype (Chapter 4). It is likely that relaxin promotes similar skewing of activation states in leukocytes that have infiltrated the tumour tissue. Relaxin is potentially a chemokine Although Boyden chamber based transwell assays are useful in distinguishing between cells that regulate chemotaxis versus chemokinesis or chemomigration, the in vivo migration distances are much greater and allow for more pronounced gradients. Any factor that can initiate chemokinesis of cells in vivo, must also be at some level, a chemoattractant. For example, i f a chemokinetic factor gradient is present, then cells at a distant location which move away from the source wi l l eventually lose contact with the chemokinetic factor and cellular activation may cease. Cells that are retarded as they move away from the source wi l l eventually be exposed to more molecules travelling towards them. Because the gradient is not only spatially, but also temporally dependent, retarded cells wi l l eventually be overcome by a temporal gradient and 128 become re-activated. These cells wi l l then have another opportunity to 'randomly' move towards the source. If they move away, then again, they wi l l be overcome by a temporal gradient, and so forth. Hence, chemokinetic factor- induced activation selects for time dependent directional migration towards the source. In addition, those cells that move towards the source wi l l be activated further as the local concentration of the chemokinetic factor increases. Leukocyte activation states are often also correlated with leukocyte-secreted chemotactic chemokines. Hence, the initial chemokinetic factor gradient wi l l produce a gradient of activation states in its target cells which in turn wi l l create a chemotactic gradient, thereby ultimately recruiting leukocytes to the source site of inflammation. Therefore, cells which randomly move away from the source wi l l lose activity and exhibit reduced migratory capacity, and cells which randomly approach the source may be activated further with enhanced migratory capacity. Hence, relaxin may be an activator of chemotaxis - both directly by selecting for random movement to the source, and indirectly by creating gradients of other chemoattractants. Over the past 17 years, the list of chemokines has been growing steadily, and this has forced the creation of new chemokine families. For example, the C group was created to explain the chemokinetic effects (and controversial chemotactic effects) of the lymphotactin molecule l 8 " 21 . Hence, it tempting to propose that relaxin is the first member of a fifth group of chemokines with a X i o C motif, because its first cysteine residue is expressed on the eleventh amino acid of the mature peptide. Most chemokine c D N A s encode proteins of less than 125 amino acids, and the mature relaxin H2 protein (55 amino acids) fits within this range. This thesis has demonstrated that relaxin H2 clearly has chemomigratory or chemokinetic activity in vitro, and we can speculate that it may also regulate chemotactic responses in vivo. 129 Relaxin is a cytokine Nonetheless, since relaxin does not have obvious chemotactic properties in vitro (Fig 3.2A) and since it is not a member of the classic four highly conserved groups, perhaps relaxin should be refered to as a 'chemokinetic factor'. Based on the evidence provided in this thesis, the least controversial terminology may be to simply refer to the classic relaxin hormone as a 'cytokine'. The latter term identifies a molecule which is able to induce a biological response in cells of the immune system. Positive feedback model of relaxin-regulated tumour inflammation In acute inflammatory responses and during the initial phases of tumour growth, neutrophils and eosinophils are usually the first to respond, followed by an abundance of 7 7 monocyte/macrophages, and eventually lymphocytes and other blood cells . A s the tumour becomes established, a chronic inflammatory response occurs, and the long-living, more robust monocyte/macrophages wi l l dominate the inflammatory site. This thesis suggests that relaxin is a critical regulator of this leukocyte infiltration and subsequent maintenance of the tumour (Fig 5.2). A tumour which produces relaxin wi l l establish a concentration gradient in the extracellular fluid surrounding the inflamed tumour tissue. Some of these relaxin molecules may be transported across the endothelial sheet. The proteoglycans on the endothelial surface may present relaxin molecules to monocytes and other leukocytes circulating in the bloodstream (Fig 5.2A). Subsequent relaxin-induced G P C R activation wi l l likely stimulate a c A M P / Epac/ Rapl signalling pathway which results in alteration of integrins towards a high affinity state. These high affinity integrins wi l l then be able to interact with intracellular adhesion molecules ( I C A M ) on the endothelial surface, resulting in firm adhesion. This is a prerequisite to junctional 130 adhesion molecule (JAM)-regulated transendothelial migration. Once the leukocyte has extravasated into the extracellular fluid and matrix, the relaxin gradient w i l l be more pronounced (Fig 5.2B). The leukocyte may follow this relaxin gradient (and gradients of other chemokines) towards the inflamed tumour tissue. In the meantime, relaxin may initiate morphological changes in the monocyte promoting a transitional macrophage-like phenotype. Once the monocyte/macrophage has reached the tumour site, relaxin may complete its differentiation into a M l -like inflammatory macrophage. This inflammatory macrophage would produce high levels of IL-1P and nitric oxide for a couple days (Fig 5.2C). This inflammatory response would support tumour growth by promoting tumour cell proliferation and angiogenesis. A macrophage at the tumour periphery, exposed to reduced concentrations of relaxin, may be able to wander off since nitric oxide production would be reduced (Fig 5.2D). After chronic exposure to relaxin, a macrophage wi l l eventually differentiate into an M2-l ike immunosuppressive macrophage characterized by high levels of IL-1 receptor antagonist (IL-lra) and reduced levels of IL-1 p production (Fig 5.2E). This would allow for attenuation of innate immune responses, thereby allowing the tumour to continue to proliferate unchecked. This immunosuppressive response also includes production of IL-6 which can stimulate neuroendocrine differentiation of prostate cancer cells, resulting in stimulation of relaxin production (Chapter 2). This is likely followed by relaxin-induced immune regulation (Chapter 3 and 4) which further reinforces the positive feedback mechanism for tumour survival and growth. In addition to these paracrine/endocrine roles for relaxin in adenocarcinoma progression, tumour-derived relaxin may also play a role in autocrine regulation of the epithelial tumour cells (Appendix 6-3). Relaxin may be a critical mediator of tumour-induced leukocyte recruitment, and it may also affect direct tumour-modulation. For example, upregulation of the relaxin 131 ligand-receptors axis in tumour cells may reinforce tumour-induced leukocyte recruitment which in turn may produce relaxin-regulated factors to support tumour growth. Once at the tumour site, leukocytes may stimulate growth of the epithelial tumour by responding either directly to relaxin or by responding to relaxin-induced gene products from the epithelial tumour. Thus, a positive feedback model of relaxin-regulated tumour inflammation and immunosuppression emerges. The studies described in this thesis and summarized in Figures 5.1 and 5.2 implicate that relaxin-mediated immune cell regulation may be a crucial component of the tumour cells repertoire of tactics that make the local microenvironment more conducive to tumour survival and growth. 132 Future Direction There are several questions that arise from these studies. Future studies should examine whether relaxin enhances the invasive capacity of monocyte/macrophages through matrigel or endothelial cell layers. The question also arises whether the relaxin-induced chemomigratory effects observed in Fig 3.2 are a result of differentiation and/or activation changes of the cells. In addition, it would be useful to characterize the cell types involved in the relaxin-regulated migration observed in the peripheral blood mononuclear cells (Fig 3.3). This could involve cell surface analysis of C D molecules by flow cytometry. Are the cells that respond to relaxin primarily the monocytes, which consist of about 30% of the P B M C population? Because T cells constitute the majority of the remaining P B M C s , are T cells (or B cells) partially responsible for the relaxin-enhanced chemomigratory effect observed in Fig 3.3C? A concise demonstration of relaxin-induced nitric oxide production in macrophages would also be useful to supplement Fig 4.3. Analysis of other markers of M l and M 2 polarization would also be useful to supplement Fig 4.4 and 4.5. These might include measurements of IL-12, T N F a ( M l polarization), and IL-10, TGF(3 (M2 polarization). Future studies should also consider whether mononuclear myelocytic cells co-cultured with T cells can also affect activation states. Additionally, it may be interesting to consider co-culture experiments with mononuclear myelocytic cells and L N C a P or M C F - 7 cell lines. In the presence of relaxin, are leukocytes able to produce factors which in turn support tumour cell growth and stimulate anti-apoptotic properties? Before considering relaxin in vivo models, it may be useful to first examine the effects of other chemokines in animal models. It would seem that i f we plot leukocyte infiltrate versus tumour growth a bell-shaped curve is observed. M C P - 1 overexpression in a M M T V mammary tumour transgenic mouse results in no monocyte infiltrate in any tissue, likely due to receptor desensitization 2~\ However, highly tissue-restricted expression of MCP-1 can induce an infiltrate , and when MCP-1 is expressed in a xenograft model it is able to recruit an intense infiltrate which actually leads to rejection of the tumour 2 4 ' 2 5 . In fact numerous animal studies Oft demonstrate that multiple chemokines have anti-tumour properties . This is somewhat counterintuitive since an adenocarcinoma is unlikely to produce a factor which is not beneficial to its maintenance and growth, and it is even less likely to produce a factor which will lead to its own destruction. In patients, chemokine expression from biopsies and serum samples is most 26 27 often correlated with a leukocyte infiltrate and disease progression ' suggesting that human cancers may not be effectively represented by conventional murine xenograft models. In agreement, are studies performed with the MCP-1 -/- mouse where tumour appearance is substantially delayed, tumour growth is reduced and there is increased overall survival compared to the wild type- treated mice . These studies can be summarized as follows. High levels of chemokine expression prevent infiltration of tumour-promoting leukocytes, thereby leading to reduced tumour growth. Moderate levels of chemokine expression stimulate an intense leukocyte infiltrate which leads to destruction of the tumour. The growth of human cancers can likely be attributed to their ability to produce comparatively low levels of chemokines in order to stimulate a modest leukocyte infiltrate. Therefore, human cancers are selected for their ability to remain in the middle of the bell-shaped curve of leukocyte infiltrate and tumour growth. With this bell-shaped curve in consideration, future studies should determine whether relaxin-induced leukocyte infiltration supports tumour growth in in vivo mouse models. (A) PBMC obtained from SCID mice can be infected with the mm4 L7-274 or L7-274 shRNA lentiviral sequences and these can then be re-injected into the corresponding mice containing low-levels of R L X H expression from a LNCaP or MCF-7 xenograft or matrigel plug. 134 These should be compared to the corresponding mock-xenograft/matrigel controls. Leukocyte infiltration can be monitored over time by eGFP co-expression from the lentiviral-infected PBMCs, or by histological analysis of the xenograft. The amount of leukocyte infiltrate can then be compared to tumour mass. The SCID mice that receive a low-level expressing R L X H -xenograft and are injected with mm4 L7-274 PBMC, will likely exhibit the greatest capacity to stimulate a modest tumour-supportive infiltrate thereby resulting in maximal tumour growth. (B) Production of transgenic mice with a myeloid cell-specific promoter coupled to the L7-274 shRNA sequence would useful for further assessing the role of relaxin-induced leukocyte infiltration and tumour support. It is expected that a low level expressing R L X H xenograft established in such transgenic mice would result in impaired leukocyte infiltrate and reduced tumour growth when compared to similarly treated wild-type mice. 28 29 (C) Relaxin-/- mice , but not LGR7-/- mice , exhibit reduced organ weight/ body mass ratio of the prostate suggesting that relaxin may act through an alternative receptor to regulate prostate growth. However, in both relaxin-/- and LGR7-/- mice impaired development of other tissues including the testes and epididymis in the males, and nipple and mammary glands in the 28 30 females is observed " , suggesting that LGR7 may be the exclusive relaxin receptor at these sites. The leukocyte infiltrate has not been examined in these knockout mouse models, so it would be interesting to determine whether irradiated or carcinogen-fed LGR7-/- mice exhibit an impaired capacity to stimulate an infiltrate and whether this may have a protective effect on tumour growth compared to similarly treated wild-type mice. 135 P M A M C P - 1 FSK NO \ \ \ CCR2 Adenylate Cyclase c A M P cPKC \ I I 1 polymerization Integrin activation PI3K NOS ADHESION MIGRATION * NO DIFFERENTIATION ACTIVATION Figure 5.1 Figure 5.1 Novel physiological consequences of relaxin stimulation in leukocytes. Solid arrows depict established pathways with known mechanism. Dashed arrows depict established pathways with unknown mechanism in relaxin signalling. Dotted arrows depict possible pathway that remains to be proven in relaxin signalling. As described in this thesis, novel pathways of relaxin mediated leukocyte functions and novel physiological roles for relaxin are shown. 136 Figure 5.2 Figure 5.2 A model for relaxin-mediated immune regulation in the context of inflamed tumour tissue. (A) Mononuclear cells in blood stream are slowed by selectin binding to endothelial cells, followed by relaxin-mediated adhesion. This leads to transendothelial migration into the inflamed tissue. (B) Relaxin or other cytokines in the inflammatory milieu may mediate conversion of the monocyte towards a macrophage-like phenotype and stimulate recruitment towards the site of inflammation. (C) Once at the tumour site, relaxin stimulates an acute inflammatory response likely resulting in indirect recruitment of other leukocytes to the inflamed tumour tissue. Relaxin may also act to prevent random migration of macrophages away from the tumour. This likely occurs through relaxin-induced nitric oxide (NO) production. 137 (D) In locations of lower relaxin concentrations, some macrophages may wander away, since they are not impeded by relaxin-induced NO production. (E) Prolonged exposure to relaxin results in conversion to an immunosuppressive phenotype with high levels of IL-lra production and reduced levels of IL-1 (3. 1 3 8 R E F E R E N C E S (Chapter 5) 1. Figueiredo, K . A . , Palmer, J.B., M u i , A . L . , Nelson, C . C . & Cox, M . E . Demonstration of Upregulated H2 Relaxin m R N A Expression during Neuroendocrine Differentiation of L N C a P Prostate Cancer Cells and Production of Biologically Active Mammalian Recombinant 6 Histidine-Tagged H2 Relaxin. Ann N Y Acad Sci 1041, 320-7 (2005). 2. Figueiredo, K . A . , M u i , A . L . , Nelson, C .C . & Cox, M . E . Relaxin stimulates leukocyte adhesion and migration through a relaxin receptor LGR7-dependent mechanism. J Biol Chem 281 , 3030-9 (2006). 3. Ba lkwi l l , F. Cancer and the chemokine network. Nat Rev Cancer 4, 540-50 (2004). 4. Neptune, E.R. & Bourne, H.R. Receptors induce chemotaxis by releasing the betagamma subunit of G i , not by activating G q or Gs. Proc Natl Acad Sci USA94, 14489-94 (1997). 5. Daaka, Y . , Luttrell, L . M . & Lefkowitz, R.J . Switching of the coupling of the beta2-adrenergic receptor to different G proteins by protein kinase A . Nature 390 , 88-91 (1997). 6. Yen, FL, Zhang, Y . , Penfold, S. & Rollins, B . J . MCP-1-mediated chemotaxis requires activation of non-overlapping signal transduction pathways. J Leukoc Biol 61 , 529-32 (1997). 7. Carnevale, K . A . & Cathcart, M . K . Protein kinase C beta is required for human monocyte chemotaxis to M C P - 1 . J Biol Chem 278, 25317-22 (2003). 8. Gerszten, R . E . et al. M C P - 1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature 398, 718-23 (1999). 9. Loike, J.D. et al. Differential regulation of betal integrins by chemoattractants regulates neutrophil migration through fibrin. J Cell Biol 144, 1047-56 (1999). 10. Howe, A . K . Regulation of actin-based cell migration by c A M P / P K A . Biochim Biophys Acta 1692, 159-74 (2004). 11. Bos, J .L. , de Rooij, J. & Reedquist, K . A . Rap l signalling: adhering to new models. Nat Rev Mol Cell Biol 2, 369-77 (2001). 12. Bos, J .L. et al. The role of Rap l in integrin-mediated cell adhesion. Biochem Soc Trans 3 1 , 83-6 (2003). 13. Caron, E. Cellular functions of the Rap l GTP-binding protein: a pattern emerges. J Cell Sci 116, 435-40 (2003). 139 14. Stork, P..T. Does Rap l deserve a bad Rap? Trends Biochem Sci 28, 267-75 (2003). 15. Cole, S.W., Jamieson, B . D . & Zack, J .A. c A M P up-regulates cell surface expression of lymphocyte C X C R 4 : implications for chemotaxis and HIV-1 infection. J Immunol 162, 1392-400 (1999). 16. Kunkel , S.L., Lukacs, N . W . , Strieter, R . M . , Standiford, T. & Chensue, S.W. The Function of Chemokines in Health and Disease. Rollins, B.J. (ed) Chemokines and Cancer. Humana Press (1999). 17. Gu, L . et al. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature 404, 407-11 (2000). 18. Hedrick, J .A. et al. Lymphotactin is produced by N K cells and attracts both N K cells and T cells in vivo. J Immunol 158, 1533-40 (1997). 19. Giancarlo, B . , Silvano, S., Albert, Z. , Mantovani, A . & Allavena, P. Migratory response of human natural killer cells to lymphotactin. Eur J Immunol 26, 3238-41 (1996). 20. Dorner, B . et al. Purification, structural analysis, and function of natural A T A C , a cytokine secreted by CD8(+) T cells. J Biol Chem 272, 8817-23 (1997). 21. Kennedy, J. et al. Molecular cloning and functional characterization of human lymphotactin. J Immunol 155, 203-9 (1995). 22. Coussens, L . M . & Werb, Z. Inflammation and cancer. Nature 420, 860-7 (2002). 23. Gu, L . et al. In vivo properties of monocyte chemoattractant protein-1. J Leukoc Biol 62, 577-80 (1997). 24. Bottazzi, B . , Walter, S., Govoni, D. , Colotta, F. & Mantovani, A . Monocyte chemotactic cytpkine gene transfer modulates macrophage infiltration, growth, and susceptibility to IL-2 therapy of a murine melanoma. J Immunol 148, 1280-5 (1992). 25. Rollins, B . J . & Sunday, M . E . Suppression of tumor formation in vivo by expression of the JE gene in malignant cells. Mol Cell Biol 11, 3125-31 (1991). 26. Rollins, B..T. Inflammatory chemokines in cancer growth and progression. Eur J Cancer 42, 760-7 (2006). 27. Ben-Baruch, A . Inflammation-associated immune suppression in cancer: the roles played by cytokines, chemokines and additional mediators. Semin Cancer Biol 16, 38-52 (2006). 28. Samuel, C.S., Tian, H . , Zhao, L . & Amento, E.P. Relaxin is a key mediator of prostate growth and male reproductive tract development. Lab Invest 83, 1055-67 (2003). 140 29. Krajnc-Franken, M.A. et al. Impaired nipple development and parturition in LGR7 knockout mice. Mol Cell Biol 24, 687-96 (2004). 30. Zhao, L. et al. Mice without a functional relaxin gene are unable to deliver milk to their pups. Endocrinology 140, 445-53 (1999). 141 CHAPTER 6 APPENDIX 142 O V E R V I E W This chapter may be considered a series of appendices, or it may be read as a chapter on its own and contains a single reference list for all sections. This appendix chapter is a collection of supplemental or preliminary material which eventually resulted in the manuscript chapters as well as unpublished novel data that was not directly relevant to the manuscript chapters. The sections described in this appendix chapter are referenced throughout the thesis. These sections are relegated to this appendix chapter rather than integrated into the main chapters of the thesis in order to avoid inundating the reader with excessive information that would potentially undermine the theme (title) of the thesis. The information provided in this appendix chapter is intended only as supplemental information and is not required for understanding the thesis objectives. 143 A P P E N D I X 6-1 Nucleotide and amino acid sequence comparisons of human and mouse relaxins and LGR7s Human Relaxin H2 Human Relaxin H1 Human Relaxin H2 Human Relaxin H1 Human Relaxin H2 1 2 8 1 2 1 61 18? 21 M P R L F F F H L L G V C L L L N Q F S A T G C C T C G C C T G n n n n n n n n C C A C C T G C T A G G A G T C T G T T T A C T A C T G A A C C A A T T T T C C I I I l l II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M A T G C C T C G C C T G T T C T T G T T C C A C C T G C T A G A A T T C T G T T T A C T A C T G A A C C A A T T T T C C M P R L F L F H L L E F C L L L N Q F S R A V A D S W M E E V I K L C G A G A G C A G T C G C G G A C T C A T G G A T G G A G G A A G T T A T T A A A T T A T G C G G II li III11 I I I I I I I I I I I I I I I I I II I I I I I I I I II I I If I I I A G A G C A G T C G C G G C C A A A T G G A A G G A C G A T G T T A T T A A A T T A T G C G G R A V A A K W K D D V I K L C G 4 1 R ft Q I A j 1 2 1 C G C ' i i i i it i I I : A T T ' 2 4 8 l l i 1 111 1 l l 1 ~ A T T ' 41 li- I 60 1 8 7 G M S T W S K R S L S Q E i G C A T G A G C A C C T G G A G C A A A A G G T C T C T G A G C C A G G A A 1 8 0 I I I I I I ! I I I I I I I I I I I I I I I I I I I 11 I ill I II * IIII! I I S d C A T G A G C A C C T G G A G C A A A A G G T C T C T G A G C C A G G A A 3 0 7 G M S T W S K R S L S Q E Receptor Binding Region Human Relaxin H2 Human Relaxin H1 61 181 3 0 8 61 D A P Q T P R P V A E I V P S F I N K D G A T G C T C C T C A G A C A C C T A G A C C A G T G G C A G A A A T T G T G C C A T C C T T C A T C A A C A A A G A T 2 4 0 I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I G A T G C T C C T C A G A C A C C T A G A C C A G T G G C A G A A A T T G T A C C A T C C T T C A T C A A C A A A G A T 3 6 7 D A P Q T P R P V A E I V P S F I N K D Human Relaxin H2 Human Relaxin H1 81 T E T I N M M S E F V A N L P Q E L K L 2 4 1 A C A G A A A C C A T A A A T A T G A T G T C A G A A T T T G T T G C T A A T T T G C C A C A G G A G C T G A A G T T A 3 0 0 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I 3 68 A C A G A A A C T A T A A T T A T C A T G T T G G A A T T C A T T G C T A A T T T G C C A C C G G A G C T G A A G G C A 4 27 81 T E T I I I M L E F I A N L P P E L K A Human Relaxin H2 1 0 1 T L S E M Q P A L P Q L Q Q H V P V L K 3 0 1 A C C C T G T C T G A G A T G C A G C C A G C A T T A C C A C A G C T A C A A C A A C A T G T A C C T G T A T T A A A A 3 6 0 I N I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I II I I Human Relaxin H1 4 2 8 G C C C T A T C T G A G A G G C A A C C A T C A T T A C C A G A G C T A C A G C A G T A T G T A C C T G C A T T A A A G 4 87 1 0 1 A L S E R Q P S L P E L Q Q Y V P A L K Human Relaxin H2 Human Relaxin H1 1 2 1 3 6 1 4 8 8 1 2 1 D S S L L F E E F K K L I R N R Q S E A G A T T C C A G T C T T C T C T T T G A A G A A T T T A A G A A A C T T A T T C G C A A T A G A C A A A G T G A A G C C 4 20 I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I G A T T C C A A T C T T A G C T T T G A A G A A T T T A A G A A A C T T A T T C G C A A T A G G C A A A G T G A A G C C 54 7 D S N L S F E E F K K L I R N R Q S E A Human Relaxin H2 Human Relaxin H1 1 4 1 4 2 1 5 4 8 1 4 1 A D S S P S E L K Y L G L D T H S R K K G C A G A C A G C A G T C C T T C A G A A T T A A A A T A C T T A G G C T T G G A T A C T C A T T C T C G A A A A A A G 4 80 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I G C A G A C A G C A A T C C T T C A G A A T T A A A A T A C T T A G G C T T G G A T A C T C A T T C T C A A A A A A A G 6 0 7 A D S N P S E L K Y L G L D T H S Q K K Human Relaxin H2 Human Relaxin H1 161 481 6 0 8 1 6 1 R Q L Y S A L A N K C C H V G C T K R S A G A C A A C T C T A C A G T G C A T T G G C T A A T A A A T G T T G C C A T G T T G G T T G T A C C A A A A G A T C T 54 0 I I I I II I N I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I A G A C G A C C C T A C G T G G C A C T G T T T G A G A A A T G T T G C C T A A T T G G T T G T A C C A A A A G G T C T 6 6 7 R R P Y V A L F E K C C L I G C T K R S Human Relaxin H2 1 8 1 5 4 1 Human Relaxin H1 6 6 8 1 8 1 Ei A R F C C T T G C T A G A T T T T G C T G A G A T G A A G C T A A T T G T G C A C A T C T C G T A T A A T A T T C A C A C A T A 6 0 0 I I I I I I I M I II I I I I I I I I I I I II I I I I I I I I I I I I II II I I I I I I I I I I I I I I C T T G C T A A A T A T T G C T G A G A T G A A G C T A A T T G T G C A C A T C T T G T C T A A T T T T C A C A C A T A 7 2 7 L A K 1 C Human Relaxin H2 6 0 1 Human Relaxin H1 72 8 T T C T T A A T G A C A T T T C A C T G A T G C T T C T A T C A G G T C C C A T C A A T T C T T A G A A T A T 6 5 5 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I | G T C T T G A T G A C A T T T C A C T G A T G C T T C T G T C A G G T C C C A C T A A T T A T T A G A A T A T 7 82 Figure 6-1.1 144 B Human Relaxin H2 Mouse Relaxin 1 Human Relaxin H2 Mouse Relaxin 1 Human Relaxin H2 Mouse Relaxin 1 Human Relaxin H2 Mouse Relaxin 1 5 13 13 5 24 70 73 25 44 130 133 45 64 190 190 64 F F F H L L G V C L L L N Q F S R A V TTTTTTTTCCACCTGCTAGGAGTCTGTTTACTACTGAACCAATTTTCCAGAGC AGTC I I I I ! I I I i I I I I I I I I I I I I I I I I I I I I II I I I I I I I I TTTTTGCTCCAGCTCCTGGGGTTCTGGCTATTGCTGAGCCAGCCTTGCAGGACGCGAGTC F L L Q L L G F W L L L S Q P C R T R V A D S W M E E V I K L GCGGACTCATGGATGGAGGAAGTTATTAAATTA1 I I I I I I I I I I I I I I I I I I I TCGGAGGAGTGGATGGACGGATTCATTCGGATGf S E E W M D G F I R M R S L V R & Q PCGC .'GCGG E V A 1 i X'-GT R 1 •JAATTG E L K C G M S T W S K R S L S Q E D A P iC '-GCATGAGCACCTGGAGCAAAAGGTCTCTGAGCCAGGAAGATGCTCCT M M ! I I I I I I I I I I I I I I I I I I I I I I I I II [/GCGG GGCCTCCGTGGGAAGATTGGCTTTGAGCCAGGAGGAGCCAGCT C G A S V G R L A L S Q E E P A 69 72 129 132 189 189 Q T P R P V A E I V P S F I N K D T E T CAGACACCTAGACCAGTGGCAGAAATTGTGCCATCCTTCATCAACAAAGATACAGAAACC 24 9 I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I CTGCTTGCCAGGCAAGCCACTGAAGTTGTGCCATCCTTCATCAACAAAGATGCAGAGCCT 2 4 9 L L A R Q A T E V V P S F I N K D A E P Receptor Binding 9 o Human Relaxin H2 Mouse Relaxin 1 84 250 250 84 I N M M S E F V A N L P Q E L K L T L S ATAAATATGATGTCAGAATTTGTTGCTAATTTGCCACAGGAGCTGAAGTTAACCCTGTCT 309 I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I TTCGATACGACGCTGAAATGCCTTCCAAATTTGTCTGAAGAGCTCAAGGCAGTACTGTCT 309 F D T T L K C L P N L S E E L K A V L S Human Relaxin H2 Moose Relaxin 1 104 310 310 104 E M Q P A L P Q L Q Q H V P V L K D S S GAGATGCAGCCAGCATTACCACAGCTACAACAACATGTACCTGTATTAAAAGATTCCAGT 369 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M i l l I GAGGCTCAGGCCTCGCTCCCAGAGCT ACAACACGCACCTGTGTTGAGCGATTCTGTT 3 66 E A Q A S L P E L Q H A P V L S D S V Human Relaxin H2 Mouse Relaxin 1 124 L L F E E F K K L I R N R Q S E A A D S 37 0 CTTCTCTTTGAAGAATTTAAGAAACTTATTCGCAATAGACAAAGTGAAGCCGCAGACAGC 4 2 9 I I I I I II I II II I II II I I I | | II II I I II II I I II II II 3 67 GTTAGCTTGGAAGGCTTTAAGAAAACTCTCCATGATAGACTGGGTGAAGCAGAAGACGGC 42 6 123 V S L E G F K K T L H D R L G E A E D G Human Relaxin H2 Mouse Relaxin 1 Human Relaxin H2 Mouse Relaxin 1 144 S P S E L K Y L G L D T H S R K K R Q L 4 30 AGTCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCGAAAAAAGAGACAACTC 4 8 9 II I II I II I I I I II I I I I I I II II I I II I II I I I I I I I I I 427 AGTCCTCCAGGGCTTAAATACTTGCAATCAGATACCCATTCACGGAAAAAGAGGGAGTCT 4 8 6 143 S P P G L K Y L Q S D T H S R K K R E S 164 Y S A L A N K C C H V G C T K R S L A R 4 90 TACAGTGCATTGGCTAATAAATGTTGCCATGTTGGTTGTACCAAAAGATCTCTTGCTAGA 54 9 I II I II I I I II II I I I I II II II II I I I I II I II II II I 4 87 GGTGGATTGATGAGCCAGCAATGTTGCCACGTCGGTTGTAGCAGAAGATCTATTGCTAAA 54 6 163 G G L M S Q Q C C H V G C S R R S I A K Human Relaxin H2 Mouse Relaxin 1 184 550 547 183 F C TTTTGCTGAGATGAAGCTAATTGTGCACATCTCGTATAATATTCACACATATTCTT 605 I I I I II I I I I I I II II I I I II II I II I I I I I I | | I I II I I CTCTATTGCTGATACGGAGCTAATTGTGTACCACCAGTCCAGTGTTCACATGCATTCTT 605 L Y C Figure 6-1.1 145 H u m a n L G R 7 Mouse LGR7 1 8 3 M T S G S V F F Y I L I F G K Y F S H G A T G A C A T C T G G T T C T G T C T T C T T C T A C A T C T T A A T T T T T G G A A A A T A T T T T T C T C A T G G G 1 4 2 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I | | A T G A C A T C T G G T C C A T T C T T C T T C T G C A T C T T C A T T A T T G G A A A A T A T T T C A C T C T C G G A 6 0 M T S G P F F F C I F I I G K Y F T L G H u m a n L G R 7 Mouse LGR7 H u m a n L G R 7 Mouse LGR7 H u m a n L G R 7 M o o s e LGR7 H u m a n L G R 7 MouseLGR7 2 1 1 4 3 6 1 2 1 • 1 2 0 3 1 2 1 4 ] 6 1 2 6 3 1 8 1 6 1 8 1 3 2 3 2 4 1 8 1 G G Q D V K C S L G Y F P C G N I T K C G G T G G A C A G G A T G T C A A G T G C T C C C T T G G C T A T I T C C C C T G T G G G A A C A T C A C A A A G T G C M l I I I 1 I I I f I 1 I M M M ! I II I II I I II II II II II I i f I M M A G T G C A C A G G A T G T C A G T T G T C C C C T C G G C T C C T T C C C C T G T G G G A A C A T G A G C A G G T G C S A Q D V : C r L G .-, F F C G N ' C C T G C C T C A G C T G C T T C A C T G C A A T G G T G T G G . C G G G A A C C G A G C T G A T G A G G A C L P Q IJ Kl C Q D M M M I M ! N G V D D C G N E D K G W ^ S ^ L ^ 0 ^ P D K Y r A S Y Y II II I I II I I I II II II I II I II II I II II II I I I I I M C A C T G C G G A G A O A A C A A T G G G T G G T C T C T G C A A C T G G A C A A A T A T T T T G C T A A T T A C T A T H C G D N N G W S L Q D K Y F A Y Y A A A C T G G C T T C C A C T A A C T C C T T T G A G G C A G A A A C T T C C G A A T G C T T G G T T G G C T C T G T G K A S . $ S. F E A £ T ,- E C L V G S V 2 0 2 1 2 0 2 6 2 1 8 0 3 2 2 2 4 0 3 8 2 3 0 0 H u m a n L G R 7 Mouse LGR7 H u m a n L G R 7 Mouse LGR7 1 0 1 3 8 3 3 0 1 1 0 1 1 2 1 4 4 3 3 6 1 1 2 1 J A G C T T G A C T G T G A I GTTCCATC I I M M ! M M G T C C C A T C A G T T T f T C T l C D E L Q W iCTGCAATt I I I M l F T T A C G A G C T 4 4 2 I II II I I II I F T T A C G A G C T 3 6 0 N L I P, K \ A C T T A A T A A G A A A G 5 0 2 M i l l II I i I I I - A C T T C A T A A G A A C A 4 2 0 Leucine Rich Repeats H u m a n L G R 7 MouseLGR7 H u m a n L G R 7 Mouse LGR7 H u m a n L G R 7 Mouse LGR7 H u m a n L G R 7 MouseLGR7 1 4 1 5 0 3 4 2 1 1 4 1 1 6 1 5 6 3 4 8 1 1 6 1 1 8 1 6 2 3 5 4 1 1 8 1 2 0 1 6 8 3 6 0 1 2 0 1 H D CT: M i l l C T C A G ' N L H S 1TGAATAGC L Q N H :TGCAAAACAAT :AAAAGAAT Q N H T K L T C A C T A A A C T S T A C L T K i Y H P. E W L I . , ! . £ . . D N H L S ' R ' I S P - . P T F Y G G A A T G G C T G A T A A T T G A A G A T A A T C A C C T C A G T C G A A T T T C C C C A C C A A C A T T T T A T G G A I ! I II I i ! I II I i II I II II II i i II I II II II II II I II I! II I II II II II M l G A A T G G C T G A T A A T T G A A G A C A A T C A C C T C A G T C G A A T T T C C C C A C T C A C A T T T T A C G G A E W L I I E D M H L S R I S F T F Y G 5 6 2 4 8 0 6 2 2 5 4 0 6 8 2 6 0 0 7 4 2 6 6 0 H u m a n L G R 7 M o o s e LGR7 221 7 4 3 6 6 1 2 2 1 L N S L I L L V L M K N L T R L P D K Figure 6-1.1 146 C (cont) Human LGR7 Mouse LGR7 241 803 721 241 P L C Q H M F R L H W L D L E G N H I H CCTCTCTGTCAACACATGCCAAGACTACATTGGCTGGACCTTGAAGGCAACCATATCCAT 8 62 II I M I i I i I I I I I I I I I ! I I 1 I M I N I M I I I M M M I ! M II I II II CCCCTCTGTCAGCACATGCCCCGCCTGCSCTGGCTGGACTTTGAAGGCAACCGTATCCAT 780 L C H I H 261 Human LGR7 3 5 3 781 Mouse LGR7 2 61 Human LGR7 281 923 841 Mouse LGR7 2 81 Human LGR7 Mouse LGR7 301 983 901 301 S - A T T T ; N I: D ] 3ATT I ' l l iATT. D ] AAT': TAA; -.TTTAACTGTT7TGGT7-ATGAGGAAG AACTi M P. K E L W T T G 922 840 982 900 1042 960 Leucine Rich Repeats Human LGR7 321 1043 Mouse LGR7 Human LGR7 1021 Mouse LGR7 3 4 1 VAT! H L \ATCT1 961 CI 321 I 341 jH 1103 TP r, I 3 A A A A n SAT ZAACAA A^ACAA 0 Q 1102 1020 1162 1080 Human LGR7 Mouse LGR7 361 1163 1081 361 5 H I Y F K K F Q Y C 1TCACATATATTTTAAGAAATTCCAGTACTGT 12 22 H U M 11111111111111 111111111 :TCACATCTATTTTAAGAAATTTCAGTACTGT 114 0 5 H I Y F K K F Q Y C 381 G Y A P H V R S C K P N T D G I S S L E Human LGR7 1 223 GGGTATGCACCACATGTTCGCAGCTGTAAACCAAACACTGATGGAATTTCATCTCTAGAG 1282 M II I I I I I I I II II II I II I I II II II II II I II II I II I II I II I I I I I II 1141 GGATACGCACCACATGTGCGCAGCTGTAAGCCCAACACGGATGGGATTTCATCTCTAGAG 1200 Mouse LGR7 381 G Y A P H V R S C K P N T D G I S S L E Human LGR7 Mouse LGR7 401 N L L A S I I Q R V F V W V V S A V T C 1283 AATCTCTTGGCAAGCATTATTCAGAGAGTATTTGTCTGGGTTGTATCTGCAGTTACCTGC 134 2 II II I I M I I II I 1 I I II II I I II I I II I I I I I I I I II I I I II I I I I I II II II 1201 AACCTCTTGGCAAGCATCATCCAGAGAGTCTTTGTCTGGGTTGTATCTGCCATTACCTGC 12 60 401 N L L A S I I Q R V F V W V V S A I T C Human LGR7 Mouse LGR7 421 F G N I F V I C M R P Y I R S E N K L Y 134 3 TTTGGAAACATTTTTGTCATTTGCATGCGACCTTATATCAGGTCTGAGAACAAGCTGTAT 14 02 I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I II II II I I I I M I I II II II II II 12 61 TTTGGAAACATTTTTGTTATTTGTATGCGACCATACATCAGATCTGAGAACAAGCTGCAT 1320 421 F G N I F V I C M R P Y I R S E N K L H Human LGR7 4 4 1 A M S I I S L C C A D C L M G I Y L F V 14 03 GCCATGTCAATCATTTCTCTCTGCTGTGCCGACTGCTTAATGGGAATATATTTATTCGTG 14 62 M I M II I I II I II I I II I I I I! I I I II I I II I I II II II I I III I I I I III Mouse LGR7 1 3 2 1 GCCATGTCGATCATTTCTCTCTGCTGTGCTGACTGCCTAATGGGGGTGTATCTATTTGTG 1380 441 A M S I I S L C C A D C L M G V Y L F V Human LGR7 MouseLGR7 461 I G G F D L K F F 14 63 ATCGGAGGCTTTGACCTAAAGTTTC II II I I II I I I I I I I I I II 1381 ATTGGTGCCTTTGACCTCAAGTT' 461 I G A F D L K F Figure 6-1.1 Extracellular Loop 1 C (cont) H u m a n LGR7 Mouse LGR7 4 8 1 152; 1 4 4 1 4 8 1 M L A I L S T E V S V " T T G G C C A T T C T G T C C A C A G A A G T A T C A G T T 1 5 8 2 I Vi I I I I I I I I I I1 I 1 I I I I I ! I I li I I I III J T T G G C C A T T C T G T C C A C A G A A G T A T C C G T T 1 5 0 0 L A I L S T E V S V Extracellular Loop 1 H u m a n LGR7 Mouse LGR7 5 0 1 L L L T F L T L E K Y I C I V Y P F R C 1 5 8 3 T T A C T G T T A A C A T T T C T G A C A T T G G A A A A A T A C A T C T G C A T T G T C T A T C C T T T T A G A T G T 1 6 4 2 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M l 1 5 0 1 T T A C T T T T A A C A T T T C T G A C A T T G G A A A A G T A C A T C T G C A T T G T G T A T C C T T T T C G G T G T 1 5 6 0 5 0 1 L L L T F L T L E K Y I C I V Y P F R C H u m a n LGR7 Mouse LGR7 5 2 1 V R P G K C R T I T V L I L I W I T G F 1 6 4 3 G T G A G A C C T G G A A A A T G C A G A A C A A T T A C A G T T C T G A T T C T C A T T T G G A T T A C T G G T T T T 1 7 0 2 I II III I I I I I I I I I I I I I I I I II I I II I I I I I I I I I 1 I I I I I I I III M l 1 5 6 1 T T A A G G C C T C G A A A A T G C A G A A C A A T C A C G G T T C T G A T T T T C A T T T G G A T T A T T G G G T T T 1 6 2 0 5 2 1 L R P R K C R T I T V L I F I W I I G F H u m a n LGR7 Moose LGR7 Mouse LGR7 5 4 1 1 7 0 3 1 6 2 1 5 4 1 H u m a n LGR7 5 6 1 1 7 6 3 1 6 8 1 5 6 1 I V A F I P L S N K E F F K N Y Y A T A G T G G C T T T C A T T C C A T T G A G C A A T A A G G A A T T T T T C A A A A A C T A C T A T C I I I I I I I I I I I I I I I ! I I I I I I I I I I I I I I I I I I I I I I I I I I i I I I A T A G T G G C T T T T G C T C C A C T T G G C A A T A A G G A A T T T T T C A A A A A C T A C T A T d I V A F A P L G N K E F F K N Y Y | A Q I Y S lAGCCCAGATTTATTCA 1 8 2 2 I I I I I I I I I I I I I I I I I 5 A G C C C A G A T T T A T T C A 1 7 4 0 I A Q I Y S H u m a n LGR7 Mouse LGR7 5 8 1 V A I F L G I N L A A F I I I V F S Y G 1 8 2 3 G T G G C A A T T T T T C T T G G T A T T A A T T T G G C C G C A T T T A T C A T C A T A G T T T T T T C C T A T G G A 1 8 8 2 I I I I I I I I I I I I I I I I I I I I I I III I I I I II I I I I I I I I II II I I I I I I I I I 1 7 4 1 G T G G T A A T T T T T C T T G G T A T T A A C C T G G T G G C A T T T A T C A T C A T T G T G T T C T C C T A T G G A 1 8 0 0 5 8 1 V V I F L G I N L V A F I I I V F S Y G H u m a n LGR7 Mouse LGR7 6 0 1 S M F Y S V H Q S A I T A T E I R N Q V 1 8 8 3 A G C A T G T T T T A T A G T G T T C A T C A A A G T G C C A T A A C A G C A A C T G A A A T A C G G A A T C A A G T T 1 9 4 2 I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I III II I I I I I III I I I I I 1 8 0 1 A G C A T G T T T T A C A G T G T T C A T C A A A G C T C C G T A A C A G T A A C C G A A A T A C A G A A G C A A G T G 1 8 6 0 6 0 1 S M F Y S V H Q S S V T V T E I Q K Q V 6 2 1 K K E M I L A K R F F F I V F T D A L C H u m a n LGR7 2 9 4 3 A A A A A A G A G A T G A T C C T T G C C A A A C G T T T T T T C T T T A T A G T A T T T A C T G A T G C A T T A T G C 2 0 0 2 II II III II I II 11111111 11111111111 II II II II II I III 1 8 6 1 A A G A A G G A G G T G G T T C T C G C C A A A C G C T T T T T C T T T A T C G T T T T C A C C G A C G C G C T G T G C 1 9 2 0 Mouse LGR7 6 2 1 K K E V V L A K R F F F I V F T D A L C H u m a n LGR7 Mouse LGR7 H u m a n LGR7 Mouse LGR7 6 4 1 W I P I F V V K F L S L L Q V E I P G T 2 0 0 3 T G G A T A C C C A T T T T T G T A G T G A A A T T T C T T T C A C T G C T T C A G G T A G A A A T A C C A G G T A C C 11111 11111 II II 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1111111111 I I 1 9 2 1 T G G A T T C C C A T C T T C A T A C T G A A A T T T C T T T C A C T G C T T C A G G T G G A A A T A C C A G A T T C T 6 4 1 W I P I F I L K F L S L L Q V E I P D S 6 6 1 2 0 6 3 1 9 8 1 6 6 1 T F I L P I N S A L N P I L W T T T T A T T C T G C C C A T T A A C A G T G C T T T G A A C C C A A T T C T C H I 1111 n 111 II n 11 111111111111111111111 11 V T T T T T A T T C T G C C T A T C A A C A G T G C T T T G A A C C C A A T T A T C I F I L P I N S A L N P I I 2 0 6 2 1 9 8 0 2 1 2 2 2 0 4 0 Extracellular Loop 3 H u m a n LGR7 Mouse LGR7 6 8 1 Y T L T T R P F K E M I H R F W Y N Y R 2 1 2 3 T A T A C T C T G A C C A C A A G A C C A T T T A A A G A A A T G A T T C A T C G G T T T T G G T A T A A C T A C A G A 2 1 8 2 II II 1111111 11111 II II 11111111 I I I I I III I 111111111 2 0 4 1 T A C A C G T T G A C C A C T A G A C C T T T C A A G G A A A T G A T C C A T C A A C T C T G G C A C A A C T A C A G A 2 1 0 0 6 8 1 Y T L T T R P F K E M I H Q L W H N Y R H u m a n LGR7 Mouse LGR7 7 0 1 Q R K S M D S K G Q K T Y A P S F I W 2 1 8 3 C A A A G A A A A T C T A T G G A C A G C A A A G G T C A G A A A A C A T A T G C T C C A T C A T T C A T C T G G 2 2 3 9 I I I I I I I III I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 2 1 0 1 C A A A G A A G G T C T G T T G A C A G G A A A G A G A C T C A G A A G G C A T A T G C T C C A T C A T T C A T C T G G 2 1 6 0 7 0 1 Q R R S V D R K E T Q K A Y A P S F I W Figure 6-1.1 148 C (cont) Human LGR7 720 2240 V E M W P L Q E M P P E L M K P D L F T GTGGAAATGTGGCCACTGCAGGAGATGCCACCTGAGTTAATGAAGCCGGACCTTTTCACA 22 99 Mouse LGR7 2161 721 GTGGAAATGTGGCCCTTGCAGGAGATGTCCTCTGGGTTCATGAAGCCAGGCGCTTTCACA 22 20 V E M W P L Q E M S S . G F M K P G A F T Human LGR7 740 2300 Y P C E M S L I S Q S T R L N S Y S TACCCCTGTGAAATGTCACTGATTTCTCAATCAACGAGACTCAATTCCTATTC 2 352 Mouse LGR7 2221 741 GACCCCTGTGATCTGTCGCTAGTTTCTCAGTCATCTAGACTCAATTCTTATTC 22 73 D P C D L S L V S Q S S R L N S Y S Figure 6-1.1 Figure 6-1.1 Nucleotide and amino acid sequence comparisons of human and mouse relaxins and LGR7s. Regions important for receptor or ligand binding are shaded. (A) BlastN sequence alignments of Human Relaxin H2 (Homo sapiens relaxin 2 GenBank accession number NM_134441) and Human Relaxin HI (Homo sapiens relaxin 1 GenBank accession number NM_006911). Nucleotide sequences are 90% identical. Region important for receptor binding is on B-chain (shaded). Conserved residues essential for receptor binding are boxed '. (B) BlastN sequence alignments of Human Relaxin H2 (Homo sapiens relaxin 2 GenBank accession number NM_134441) and Mouse Relaxin 1 (Mus musculus relaxin 1 GenBank accession number NM_011272). Nucleotide sequences are 64% identical. Region important for receptor binding is on B-chain (shaded). Conserved residues essential for receptor binding are boxed '. [Not Shown: BlastN sequence alignments of Human Relaxin H2 (Homo sapiens relaxin 2 GenBank accession number N M I 34441) and Human Relaxin H3 (Homo sapiens relaxin 3 GenBank accession number NM_080864). No significant similarity was found, although boxed residues in (A) and (B) are also conserved in Human Relaxin H3.] (C) BlastN sequence alignments of Human LGR7 (Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 7 GenBank accession number NM_021634) and Mouse LGR7 (Mus musculus leucine-rich repeat-containing G protein-coupled receptor 7 GenBank accession number NM_212452). Nucleotide sequences are 85% identical. Regions important for ligand binding are leucine rich repeats on the N-terminal extracellular tail and the extracellular loops 1-3 (shaded). 149 A P P E N D I X 6-2 Production of human recombinant six-histidine tagged relaxin H2 (RLXH) a) Cloning of RLXH The immediate limitation of initiating these studies stemmed from the difficulties in obtaining relaxin commercially. Consequently, we produced biologically active recombinant human relaxin H2. A full-length human H2 relaxin c D N A cloned from a L N C a P c D N A library was subcloned into pcDNA3.1 V5-His plasmid (Invitrogen) (Fig 6-2.1 A ) . Because H E K 2 9 3 T cells failed to efficiently express R L X H when transfected with this plasmid, the full-length relaxin sequence and the in-frame C-terminal 6 his-tag were restriction digested and ligated into pcDEF3 mammalian expression vector containing the E l F c t promoter sequence (Fig 6-2.IB). This E l F a promoter is a powerful mammalian expression promoter 2 ' 3 , which proved to be essential for efficient production of human recombinant 6-histidine tagged relaxin H2 ( R L X H ) (Chapter 2, F ig 2.2). During processing of prepro-relaxin, the C-chain centre peptide and the N-terminal signalling peptide are removed, leaving behing the disulphide-bonded A - and B-chains. A space-filling model shows that addition of the 6 histidine residues to the C-terminus would not interfere with residues required for receptor binding on the B-chain interface (Fig 6-2.IC). b) Expression and characterization of RLXH R L X H was overexpressed in H E K 2 9 3 T cells by transfection with the p c D E F 3 - R L X H expression construct. We chose the H E K 2 9 3 T mammalian expression system to maximize the probability of correct processing of the relaxin peptide. R L X H expression by transfected H E K 2 9 3 T cells was confirmed by reverse transcriptase P C R (Fig 6-3.2A), immunofluorescence (Fig 6-2.2), immunoblots (Fig 6-2.3), E L I S A (Fig 6-2.5B) and bioassays (Fig 2.3). 150 For immunofluorescence analysis, HEK293T cells were co-transfected with GFP and R L X H constructs, and DAPI stains the nucleus (Fig 6-2.2). These experiments reveal that R L X H production is limited to the endoplasmic reticulum, the golgi and the secretory vesicles, as detected with anti-histidine primary antibodies (Qiagen, Research Diagnostics) and texas red-coupled secondary antibody (Jackson Immunoresearch). Control cells were treated with Brefeldin A to demonstrate that when the golgi collapses, R L X H is trapped in vesicles throughout the cells (Fig 6-2.2E). The His-tag has proven useful in overcoming many of the difficulties associated with relaxin immunoblotting in the literature. The first problem is that native relaxin is a 6 kD protein in its mature form, composed of disulfide linked a and P chains of 2.5 kD and 3.5 kD respectively. SDS-PAGE resolution of proteins at these molecular weights becomes difficult. Furthermore, the anti-relaxin epitope(s) may be lost upon denaturation during SDS-PAGE. Efforts to blot relaxin have gone as far as synthesizing metabolically labelled relaxin, immunoprecipitating using anti-relaxin antibody, attempting resolution on a tris-tricine gel, and then assessing for radioactivity 4 . Because of the complications of obtaining immunoblots with relaxin, we decided that it would be best to label the relaxin sequence with a 6 His-tag at the C-terminus. Immunoblots of R L X H are expected to produce several bands: preprorelaxin (-22 kD), prorelaxin (~20 kD), mature relaxin (~6 kD) and reduced forms of mature relaxin (~3 kD). Time course collections of conditioned media from RLXH-overexpressing HEK293T cells demonstrate that relaxin accumulates in the media of HEK293T-RLXH cells over time (Fig 6-2.3). When membrane is probed an anti-relaxin antibody (Immunodiagnostik), only the 20-22 kD band is predominantly visible (Fig 6-2.3A). However, when membrane is reprobed with an 151 anti-histidine antibody (Qiagen, Research Diagnostics, New England Biolabs) the other bands become evident (Fig 6-2.3B). The signal intensity produced with the anti-histidine antibody is several orders of magnitude greater than that obtained with the anti-relaxin antibody. This approach can be used to further characterize commercially available anti-relaxin antibodies. These transfection experiments have shown for the first time that H E K 2 9 3 cells do not require co-transfection of a prohormone convertase-1 (PCI) construct for processing of R L X to the 6kD mature protein, contrary to what had been previously reported 4 . Immunoblots of R L X H demonstrate that H E K 2 9 3 T cells can process approximately 30% conversion to 6 k D mature R L X H (Fig 6-2.3B), however after five days the ratio of processed mature material increases to approximately 80%> (Fig 2.2). Time course analysis suggests that some R L X H processing may be occurring outside of the cell in the conditioned media (Fig 6-2.3). It is possible that P C I is expressed endogenously in H E K 2 9 3 T cells and is secreted into the media along with R L X H since co-transfection with a P C I construct had no observable effect on processing of R L X H (compare Fig 6-2.4 with Fig 2.2). The ability to detect relatively high signals of processed R L X H in these experiments may be attributed in part to the T-antigen transformed 293 cells which readily replicate the transfected plasmid, and to the significant improvement in signal intensity with the anti-histidine antibody compared to anti-relaxin used in previous reports. Unprocessed relaxin has been previously shown to retain approximately 50% bioactivity of the mature form 5 ' 6 , so although processing is occurring in H E K 2 9 3 T cells, it is likely not essential for bioactivity. Attempts to separate unprocessed and processed relaxin are rarely seen in the literature, and are only done for the purposes of analyzing the proform. 152 c) Nickel column purification of R L X H and additional evidence of R L X H bioactivity The purity, yield and composition of R L X H are described in Chapter 2. The formulas used to calculate these values are shown in Fig 6-2.5A. The R L X H purification procedure described in Chapter 2 results in purification of approximately 1 ng R L X H per 10 cm dish of tranfected HEK293T cells as quantified with a relaxin ELISA kit (Immundiagnostik) (Fig 6-2.5B). Purified R L X H 0.01 ng/ml is sufficient to induce a cAMP response in THP-1 treated cells which is up to five-fold greater than the response generated by 0.01 ng/ml of the calibrator human recombinant R L X (hRLX) from the kit. This calibrator hRLX was supplied to Immundiagnostik from the Connetics Corporation and was the only commercial source of human recombinant relaxin. THP-1 cells are a human monocyte/macrophage cell line that has been routinely used to assess relaxin-induced cAMP production (Chapter 1). 153 P C R Product >_ I'Sx^ oaj w " i " 2 : pcDNA3.1/ V5-His-TOPO 5523 bp B Aatll6100 I 3000 H s c I F igure 6-2.1 154 Figure 6-2.1 Figure 6-2.1 Cloning of R L X H . (A) A full-length human H2 relaxin c D N A cloned from a L N C a P c D N A library was subcloned into the pcDNA3.1 V5-His T O P O vector (Invitrogen) with Hind III and Age I restriction enzymes. (B) The 6 His-tagged relaxin sequence was then transferred into the pcDEF3 mammalian expression vector. (C) Space filling model of mature relaxin shows that addition of six histidine residues at the C-terminus does not interfere with amino acids required for receptor binding on the B-chain interface. 155 Figure 6-2.2 156 Figure 6-2.2 HEK293T cells transfected with pcDEF3-eGFP and pcDEF3-RLXH. Brightfield (A); DAPI (B); GFP (C); R L X H expression is detected with an anti-histidine antibody and Texas Red secondary in untreated (D) and Brefeldin A-treated cells (E). HEK293T cells transfected with pcDEF3-eGFP and pcDEF3-RLXH in a 1:10 ratio show that R L X H is expressed in every cell, GFP is expressed in one cell and DAPI stains the nuclei (F). 157 A B WB; ( / . - r e l a x i n Time (h) 3 7 24 31 3 0 — 201 — 14.3 — 6,5— 3.0 — W B : <x-histidme Time (h) 3 7 24 31 30 — 20.1 — 14.3 — W 65 — 30 — Figure 6-2.3 158 Figure 6-2.3 Time course analysis of R L X H accumulation in conditioned media of HEK293T cells transfected with pcDEF3-RLXH construct. (A) Blots were probed with a-relaxin polyclonal antibody (Immundiagnostik) and a-rabbit secondary HRP followed by chemiluminescence exposure to film for 30 min. (B) Subsequently, blots were stripped and reprobed with a-histidine polyclonal antibody (Research Diagnostic) and a-rabbit secondary HRP followed by chemiluminescence exposure to film for 2 min. 159 I IN | FT |W1 I W2 I E1 ( E2 I E3 I | R L X M o e J RLX ttedtM BLX M e c k | R U ( Mock|RUC M o c K | MJC Mock | BLX Meek § 45 -30 -20.1 -14.3 -6.5 -3.5 -2.5 -Figure 6-2.4 Figure 6-2.4 R L X H elution profile from 2 9 3 T - R L X H cells cotransfected with prohormone convertase 1 (PCI) . H E K 2 9 3 T cells (5 x 106) were transfected with 10 pg p c D E F 3 - R L X H and 10 ug pcNeo-PCl expression constructs (lanes labeled R L X ) or 10 p.g empty pcDEF3 plasmid and 10 p.g pcNeo-PCl expression construct (lanes labeled mock). After 5 days, conditioned media was collected and R L X H was purified by nickel column chromatography. A representative anti-histidine immunoblot of column fractions collected during purification of R L X H is shown. The upper bands (-18-20 kD) are prepro- and p r o R L X , and the immunoreactive proteins centered at ~6 k D represent processed mature R L X H . N o R L X H was detected in the flow through (FT) or either of the two wash fractions ( W I , W2). Imidazole buffer was used to displace R L X H from the nickel column. A l l detectable R L X H was eluted in the first two elution fractions ( E l , E2). Comparisons to Figure 2.2 suggest that cotransfection with PCI has little effect on enhancing processing of R L X H . 160 (A) Nickel column purification of RLXH: mature RLXH band intensity n n n , . Composition = — - 7 : — — T~ = 80% processed precursor RLXH band intensity Yield = elution band intensity input band intensity 1 concentration factor of purification = 30% of input Purity = elution RLXH mass / elution total protein mass input RLXH mass / input total protein mass = 40X input (B) Quantitation of nickel column purified RLXH: hRLX ELISA standard curve OS c S as' o 05 cs (fl n < 03-02-A f IIE y = 0.2246log(x)2 + 0.3068log(x) + 0.2771 r2 = 0.9727 10 ' 109 hRLX concentration (pg/ml) RLXH nickel column purified sample Concentration Sample Abs (450nm) Concentration (pg/ml) Factor Concentration Mean (ng/ml) Standard Deviation Duplicate 1 Duplicate 2 0.8230 0.8240 242.83 243.56 5X 5X 1.216 0.2129 1.2 ng RLXH per 8ml conditioned media (confluent 10cm dish of transfected HEK293T cells) Figure 6-2.5 161 Figure 6-2.5 Characterization of RLXH. (A) Formulas used to calculate composition, yield and purity of R L X H after nickel column chromatography of H E K 293T conditioned media collected 5 days after transfection with pcDEF3-RLXH construct. (B) Quantitation of nickel column purified R L X H from conditioned media of RLXH-transfected HEK293T cells by ELISA analysis. Sample is representative of a typical R L X H preparation, resulting in approximately 1 ng R L X H per 10 cm confluent dish of cells. 162 A P P E N D I X 6-3 Relaxin expression, relaxin receptors and responses in cancer cells a) LNCaP cells overexpressing R L X H LNCaP prostate cancer cells were transfected with pcDEF3-eGFP and pcDEF3-RLXH constructs, and R L X H expression was demonstrated by immunofluorescence with an anti-histidine primary and texas-red-coupled secondary antibodies (Fig 6-3.1A-D). R L X H was detected in the endoplasmic reticulum and the golgi, and is expressed along the secretory neuritic processes in these cells (Fig 6-3.ID). Stable LNCaP-RLXH clones were generated and immunoblot of lysates reveals that R L X H is present in the precursor and mature forms (Fig 6-3.IE). These stable clones have been frozen for future use. These overexpressing R L X H clones of LNCaP cells can be used in future experiments to study an in vivo model of relaxin-induced leukocyte recruitment. For example, LNCaP-RLXH or LNCaP-mock xenografts could be subcutaneously implanted with matrigel into mice, and the infiltration of intravenously injected THP-1 L7-274 or its control mismatch (co-expressers of both shRNA and eGFP) could be assessed by measuring relative fluorescence of the matrigel plug. The shRNA-LGR7 constructs could also be used to generate similar recombinant mouse peripheral blood mononuclear cells which may represent a more physiologically relevant model. b) Relaxin expression in cancer cell lines All prostate cancer cells lines tested express some endogenous levels of one of the two relaxins (Fig 6-3.2A), and these levels can be augmented during neuroendocrine differentiation (Fig 2.1). As discussed in Chapter 1, the prostate is one of the very few tissues where relaxin HI is expressed in humans, and Figure 6-3.2A confirms its presence in the androgen dependent cell line LNCaP. Relaxin HI transcripts are detected at 30 cycles of RTPCR, suggesting that it's 163 expressed at higher levels compared to the relatively low expression of relaxin H2 transcript which is only detected at 40 cycle numbers. This agrees with a report describing that relaxin HI mRNA is significantly more stable than relaxin H2 mRNA, at least in LNCaP cells 1 . Nonetheless, relatively high mRNA levels do not necessarily correlate with relatively high protein expression levels, and as described in Chapter 1, unlike the H2 isoform, relaxin HI is not expressed at detectable levels in the prostatic fluid or bloodstream. Although the relative expression levels of these two isoforms is not well understood, the biological functions are likely similar since they share 90% homology (Appendix 6-1). Brief Methodology Reverse transcriptase PCR (RTPCR) was perform using relaxin and GADPH primers 7 8 previously established ' . RTPCR is a semiquantitative method which is useful for providing a general idea of whether a transcript is present or not. However, it is not a substitute for northern blots or quantitative PCR (QPCR) in terms of accuracy in determining relative expression levels. Although the RTPCR analyses shown in Figure 6-3.2 are a useful initial screen of expression levels, northern blot or QPCR analysis would be required to pursue these studies further, c) Relaxin receptors and relaxin-induced responses in cancer cell lines LGR7 and LGR8 were not detected in LNCaP cells by reverse transcriptase PCR at up to 30 cycles (Fig 6-3.2B). RTPCR was performed using LGR7 and LGR8 primers previously established 9 . Although we previously reported cAMP accumulation when these cells are exposed to relaxin (Table 2.1), further experiments have failed to demonstrate that cAMP accumulation is an important readout for LNCaP responses to relaxin (Fig 6-3.2C). Nonetheless, our initial observations that relaxin is upregulated during neuroendocrine differentiation were referenced with regard to the recent demonstration that relaxin can stimulate androgen 164 independent growth of a LNCaP p53 gain of function mutant cell lines 1 0 . Interestingly, this group did not show, or comment on, whether relaxin could induce cAMP accumulation in LNCaP, and although they demonstrate the presence of LGR7 by reverse transcriptase PCR, the cycle number used for this analysis is not described. The androgen independent prostate cancer PC3 cells do express relatively high levels of LGR8 and modest levels of LGR7 (Fig 6-3.2B), which likely explains their capacity to produce cAMP in response to R L X H (Fig 6-3.2C). Our initial observations of relaxin-induced cAMP accumulation in PC3 cells (Table 2.1) were the first demonstration of acute adenylate cyclase response to relaxin in these cells and supports subsequent observations that PC3-relaxin xenografts show enhanced metastatic properties 1 1 . Because PC3 cells represent a more advanced stage of prostate cancer than LNCaP, the upregulation of the relaxin ligand-receptors axis in PC3 cells may represent an adaptive response to support survival and growth in this androgen-depleted metastatic bone environment. A major repercussion of upregulation of this axis may include relaxin-regulated growth factor production in the prostate. For example, prostate cancer cells use epidermal growth factor receptor (EGFR)-dependent pathways for growth and 12 proliferation . ProHB-EGF processing is required for GPCR-induced EGFR transactivation and downstream signals, whereby processing involves matrix metalloproteinase (MMP)-dependent cleavage of ProHB-EGF to release of EGF. A direct link was established between ligand activation of GPCR, constitutive tyrosine phosphorylation of the EGFR and proliferation 13 of human prostate cancer cells . The ability of relaxin to activate GPCRs, LGR7 and LGR8, and the ability of relaxin to increase MMP expression in a large variety of cell types would suggest that a similar mechanism may be functional in prostate cancer cells. Future studies should examine whether EGF is present in the media of relaxin-treated PC3 cells or epithelial-165 stromal and/or epithelial-hemopoeitic co-cultures, and whether this is dependent on relaxin-induced MMP production. MCF-7 cells express the secondary relaxin receptor LGR8 (Fig 6-3.2B) and demonstrate a modest cAMP response to R L X H (Fig 6-3.2C). In response to relaxin, LGR8 induces a half-maximal cAMP response at five-fold lower levels than the primary LGR7 receptor 9 . This is the first demonstration of a relaxin receptor and acute adenylate cyclase response to relaxin in M C F -7 cells, and supports previous observations that relaxin can induce a migratory response in these cells 1 . 166 Figure 6-3.1 R L X H expression i n L N C a P cel ls . ( A - D ) Immunofluorescence analysis o f L N C a P cel ls transfected w i t h p c D E F 3 - e G F P and p c D E F 3 - R L X H . ( A ) B r i g h t f i e l d ; ( B ) D A P I ; ( C ) G F P ; ( D ) R L X H expression is detected w i t h an anti-hist idine antibody ( R D I ) and Texas R e d coupled secondary. (E) L N C a P cel ls stably transfected w i t h pcDEF3 -mock or pcDEF3-R L X H . Immunoblot o f ce l l lysates shows R L X H expression w i t h an anti-hist idine ( R D I ) antibody and anti-rabbit H R P secondary by chemi luminescence detection. 167 30 cycles •43 c? r& r& ^ ^ 40 cycles H1 RELAXIN H2 RELAXIN G A P D H < ? ° < r oN ^° ^^ ^^ ^^  30 cycles ^° <T d* ^ cr c r <**«P A 0 168 Figure 6-3.2 Relaxins, receptors and responses in cancer cell lines. (A) Relaxin HI and H2 mRNA transcript levels assessed by RTPCR analysis in prostate cancer cell lines PC3 (androgen independent), LNCaP (androgen responsive) and C4-2 (androgen nonresponsive). HEK293T wild type, R L X H and mock transfected are shown as controls. (B) LGR7 and LGR8 mRNA transcript levels assessed by RTPCR analysis in prostate cancer cell lines PC3, LNCaP and C4-2, MCF-7 (breast adenocarcinoma), A-549 (non-small cell lung adenocarcinoma), OUCAR (ovarian adenocarcinoma), and CAKI-2 (renal adenocarcinoma). (C) Adenylate cyclase response of cancer cell lines. PC3, LNCaP and MCF-7 cells untreated (white bars); mock and IBMX 50 uM (black bars); R L X H 0.02 ng/ml and IBMX 50 uM (grey bars); ISP 10 uM and IBMX 50 uM (hatched bars). Values are means ± SD of a representative experiment assayed in triplicate. For comparison, boxed graph: THP-1 cells untreated (white bar); mock (black bar); R L X H 0.02 ng/ml (grey bar); FSK 10 uM and IBMX 50 uM (hatched bar). 169 APPENDIX 6-4 Cloning and expression of LGR7 in HEK293T cells In 2002, A. Hsueh's lab reported that relaxin can activate the orphan G protein coupled receptor LGR7 resulting in adenylate cyclase activation and cAMP accumulation in HEK293 cells designed to overexpress LGR7 9 . When this orphan receptor was shown to respond to relaxin, it came as a surprise to the relaxin community because the relaxin receptor had eluded discovery for over 75 years. At the time, our lab had already established the bioactivity of the R L X H preparation using the THP-1 cell line, which was first shown to be responsive to relaxin in 1996 l 5 . When A. Hsueh's original manuscript was published, we were in the process of searching for relaxin binding proteins or potential receptors with cross-linking experiments. These experiments were subsequently abandoned, and we decided to verify that the putative relaxin receptor LGR7 was in fact responsible for relaxin-regulated responses. We could simultaneously use it to confirm the bioactivity of the R L X H preparation. Full-length LGR7 was amplified from kidney tissue cDNA library. LGR7 was subcloned into the pcDEF3 plasmid and a flag epitope was added to the C-terminus (LGR7F). This construct was transfected into HEK293T cells and LGR7F expression was detected by immunofluorescence and immunoblots (Fig 6-4.1). For immunoflourescence assays, cells were permealized to allow for epitope binding of the anti-LGR7 (G-001-53, Phoenix Peptides) primary followed by Texas Red-coupled secondary (Fig 6-4.1 A). This assay demonstrates that LGR7F is expressed near the cell surface. Although the expected molecular weight of LGR7 is 85 kD, immunoblot analysis demonstrates that LGR7F is detected with an anti-flag antibody at approximately 200 kD (Fig 6-4.IB). This discrepancy in expected versus observed molecular weights can be explained by the fact that G-protein coupled receptors are known to aggregate in 170 live cells, and this effect may be more pronounced with lysates used under standard SDS-PAGE 16 18 conditions " . However, under strongly denaturing urea gel conditions, this discrepancy was resolved when LGR7F was detected at the expected 85 kD (Fig 6-4.IC). These were the first demonstrations of LGR7 immunoblots. The observation that LGR7F runs aberrantly under standard reducing conditions makes for an interesting scenario since several publications in the past have shown that relaxin binds a protein >200kD (Fig 6-4.ID and Table 6-4.1) 15'19>20. When this LGR7 construct was overexpressed in HEK293T cells and these cells were then treated with R L X H , the expected adenylate cyclase accumulation did not occur. Because we had previously characterized R L X H bioactivity with a THP-1 bioassay (eg. Fig 3-1 A), the problem was likely due to the LGR7 construct. We then obtained a pcDNA3.1/Zeo(+) construct containing N-terminal flag-labelled LGR7 kindly provided by Aaron Hsueh's lab (F-LGR7) 9 . When HEK293T cells were transfected with this construct, the immunoprecipitation and immunoblot analysis was similar to that observed with our LGR7 construct (Fig 6-4.IE). However, HEK293T- F-LGR7 cells were responsive to R L X H and so these were then used to characterize the bioactivity of the R L X H preparation (Fig 2.3). A possible explanation for the relaxin-responsiveness of Hsueh's construct is that this group added an additional prolactin (PRL) signalling peptide to the N-terminus. This signalling peptide likely improved transport to the plasma membrane, thereby making the receptor responsive to its ligand. The lack of this PRL signalling molecule in the LGR7 sequence, suggests that the LGR7 signalling peptide is sufficient to promote membrane transport in endogenously-expressing cells (eg THP-1) but other transport mechanisms may be required in cells that do not express LGR7 endogenously. Alternatively, since LGR7F surface expression was observed in HEK293T cells (Fig 6-4.1 A), it is possible that the pcDEF3 expression system is responsible for the lack of bioactivity. The T-171 antigen mediated replication of this plasmid coupled with the powerful E l F a promoter may have resulted in abnormally high expression levels. For example although equal amounts of cell lysates were immunoprecipitated, LGR7F protein levels appear significantly greater than F-LGR7 (Fig 6-4.IE). Unlike during production of R L X H where the protein is secreted, the excessive production of LGR7 from this pcDEF3 construct may have resulted in receptor aggregation and inactivity on the cell surface. Another possibility is that addition of the F L A G sequence to the C-terminus of LGR7 directly interfered with coupling of the G protein to LGR7F, thereby preventing signalling. 172 Tab le 6-4.1 - Relaxin receptors and relaxin binding proteins Predicted molecular weight (kD) Ref LGR7 85 09 LGR8 85 09 Relaxin binds to a protein this molecular weight (kD) Ref marmoset monkey uterine tissue 42, 100*, 200* 20 marmoset monkey myometrial tissue 42, 100*, 200* 20 human uterine segment fibroblast 220,36* 19 rat atrial cardiomyocytes 220,36* 19 human THP-1 monocytic cells >200, 100* 15 * denotes minor bands 173 B L G R 7 F mock 2 2 0 97 6 6 L G R 7 F mock 220 9 7 6 6 3 D 2 0 i D 200 > 97 > ISP 69 > 46> 30 > 21 > Parsell, DA. et al J Biol Chem 271 (1996) Figure 6-4.1 174 Figure 6-4.1 LGR7 expression in HEK 293T cells. LGR7 was Flag-tagged at the C-terminus and overexpressed in HEK293T cells (LGR7F). (A) Immunofluorescence of a permealized cell shows surface expression of LGR7 as detected with an anti-LGR7 antibody specific for the C-terminal epitope and a texas red-coupled secondary. (B-C) An anti-Flag monoclonal antibody was used to detect recombinantly expressed LGR7F from cell lysates (B) under reducing conditions and (C) under strongly denaturing urea gel conditions. [(D) For comparison, D. Parsell et al 1 5 showed cross-linking of 32P-relaxin to membrane-bound proteins on THP-1 cells in the absence or presence of unlabelled relaxin or unlabelled insulin.] (E) Immunoprecipitation and whole cell lysates of LGR7 from HEK293T overexpressing pcDEF3-LGR7F, or pcDNA3.1/Zeo(+) F-LGR7, or mock. Flagged-tagged LGR7 expression is detected with an anti-flag antibody and anti-mouse HRP secondary by chemiluminescence. 175 A P P E N D I X 6 - 5 Cloning and expression of L G R 7 shRNA and screening of recombinant THP-1 cells for impaired relaxin-induced cAMP accumulation In order to generate the LGR7-deficient and mismatch recombinant clones described in Chapter 3, short hairpin target sequences were cloned into the pSHAG-1 vector (Fig 6-5.1 A) and then transferred by 'Gateway' (Invitrogen) recombination reactions into the pHR lentiviral construct (Fig 6-5.IB). These were then used in conjunction with envelope and gag-pol plasmids to generate the recombinant THP-1 cells as described in Chapter 3. After the third round of flow cytometric sorting, recombinant cells were almost 100% GFP positive (Fig 6-5.2). These cells maintained GFP expression for at least 15 subsequent passages. Production of THP-1 recombinant cell lines To generate the LGR7-deficient and mismatch recombinant THP-1 clones, an RNA interference approach was used involving lentiviral infection, stable integration and expression of short hairpin interfering RNA (shRNA) sequence targeting LGR7. Six different regions of LGR7 were independently targeted and respective THP-1 cell lines were generated: L7-274, L7-732, L7-917, L7-1067, L7-1404 and L7-1980 (Fig 3.6). Two and four base pair mismatch populations (mm2 and mm4 respectively) were generated for the L7-274 sequence subsequent to confirmation of LGR7 suppression. Short hairpin target sequences of LGR7 were selected by Blast N sequence analysis and according to previously established guidelines 2 1 , 2 2 , complementary oligos were synthesized, annealed and ligated into the pSHAG-1 vector backbone (Cold Spring Harbor) 2 1 . Recombination reactions (Gateway, Invitrogen) were performed to transfer the target sequences into the pHR-eGFP lentiviral vector. Presence of the inserted target sequence was confirmed by restriction digests and sequencing. Recombination 176 reactions (Gateway, Invitrogen) were performed to transfer the target sequences into the Gateway-modified pHR-CMV-eGFP lentiviral vector 2 3 . 10 pg of this recombinant vector was co-transfected with 7.5 u.g the packaging plasmid pCMV-gag-pol (AR8.2) and 2.5 pg of the V S V - G expressing envelope plasmid pMD.G into HEK293T cells 2 3 - 2 5 using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. Conditioned media was collected every 24h for two days, filtered through 2.0 um pores (Millipore), and immediately used to infect THP-1 cells. THP-1 cells were exposed to the virus-containing conditioned media for 48 h, followed by replacement with fresh RPMI and 10% FBS. eGFP expression of THP-1 cells was most noticeable 48 h after fresh media was added. These lentivirus-infected THP-1 cells were then facs sorted for eGFP tag. After several days of expansion, cells were resorted again for eGFP tag. This procedure was repeated three times until THP-1 cell lines approached 100% expression of the eGFP tag (Fig 6-5.2). To minimize drift of the shRNA sequence, recombinant cells were only used for up to 5 passages after the third facs sort, (although subsequent analysis demonstrates insignificant loss of eGFP expression levels at passage 15). The initial screen of RLXH-induced cAMP responses in the six LGR7-targeted and two mismatch recombinant cells is shown in Figure 6-5.3. Two of these, L7-274 and L7-917, exhibited a suppressed response to relaxin, and this response was restored in the L7-274 mismatch clones. This screen led to the further analysis of these recombinant cells as described in Chapter 3. 177 B A<*6SH9m$\ HmMi i9\ u>y;:< XhrA i(At^i ' /V-R7! (<Ji'>2\ ArwHI (8253). V. AV/d (7842ji %»DI (7<J4S)\ /><MU {?55'>), \ A M (6773) \ Aeei mm) BnUit (6340) \\ A'ftel (8S6> (728) "~£h>47111 (814) PmoCX (S919), pHR CMV-EGFP /•/pal (532fl)„ //mrfll (5326)" / Wfnell (5326) ^«9J1{47<>23/ PfiMl (4762) Pwl (177?) .ytef jS923j ,.<!K'it{i923) £»» 11051 (2146) Sfii (3491) (3537) _ Ski (3537) . h / i l (3538> A W (353S) F igure 6-5.1 ,.(/,<«! (460?) 1 7 8 Figure 6-5.1 Plasmid constructs used for shRNA. (A) Short Hairpin target sequences described in fig 3.6A,B were cloned into the pSHAG-1 vector backbone derived from the pENTR/D topo backbone (Invitrogen). (B) shRNA target sequences were subsequently transfered to a Gateway-modified version of pHR-CMV EGFP by Gateway recombination reactions (Invitrogen). 179 FL1-A THP-1 wt F U - A L7-274 FL1-A mm2 L7-274 Figure 6-5.2 GFP expression (FL1-A) of recombinant THP-1 cells after third round of FACS sorting. GFP expression was maintained in recombinant cells for at least 15 subsequent passages. 180 5000 4000 ^3000 O £ Q. S 2000 < o 1000 • Untreated • Mock C RLXH B F S K , IBMX THP-1 w.t. L7-274 F igure 6-5.3 m I J I ! 4 mm2 mm4 L7-732 L7-917 L7-1067 L7-1404 L7-1980 L7-274 L7-274 Figure 6-5.3 Adenylate cyclase responses of recombinant THP-1 cells. Cells were untreated (white bars), treated with mock (black bars), 0.02 ng/ml R L X H (grey bars), or 10 u M F S K and 50 u M I B M X (hatched bars) and assayed as described in Chapter 3 Materials and Methods. Values are means ± SD of a representative experiment assayed in triplicate. 181 APPENDIX 6-6 Relaxin-regulated responses in other immune cells To supplement the initial screen of relaxin-induced adenylate cyclase accumulation in hemopoeitic cells (Table 2.1), relaxin-regulated responses in several immune cells are described here (Fig 6-6.1). R L X H induces a substantial cAMP response in murine A-20 B cells (Fig 6-6.1 A), suggesting that in addition to monocytes, B cells may be another component of the peripheral blood mononuclear cells whose responses are regulated by relaxin (Fig 3.3A,B). This is the first demonstration of relaxin-induced intracellular response in B cells. R L X H also induces modest cAMP responses in murine macrophages J774 and in murine BL/6 splenocytes. It is worth noting that the protein sequences of human relaxin H2 and murine relaxin are 64 percent homologous as identified by Blast database sequence alignments (Appendix 6-1), although the receptor binding regions of human relaxin H2 and mouse relaxin 1 are highly conserved (Chapter 1). In addition, the LGR7 receptors in human and mouse are 85% identical (Appendix 6-1). In addition to relaxin-mediated responses of PBMC, THP-1 and RAW264.7 mononuclear myelocytic cells (described in Chapters 2, 3 and 4), another interesting cell line is J774 murine macrophages which exhibit a modest enhanced response to MCP-1 in the presence of relaxin, and this correlates with a modest increase in cAMP levels in the presence of relaxin (Fig 6-6.1A,B). This data suggests that relaxin may act to make these cells more responsive to MCP-1, perhaps even during limited cell surface expression of CCR2 in macrophages; and that enhanced cAMP levels may be an indicator of this responsiveness. 182 A 40 35 30 I I 25 a 2 a X 20 3. < o 15 10 • untreated • mock • RLXH a FSK IBMX • RAW264.7 RAW264.7 J774 gamma NO-K562 U 9 3 7 Jurkat _JL I BL/6 A-20 splenocytes HL-60 Figure 6-6.1 183 Figure 6-6.1 Adenylate cyclase and migratory responses of immune cells. (A) 5 x 105 cells were untreated (white bars) or treated with mock (black bars), R L X H (0.02 ng/ml) (grey bars), or FSK (lOuM) and IBMX (50uM) (diagonal hatched bars) for 30 min at 37°C. Adenylate cyclase activity was assayed as described in Ch 3 Materials and Methods. Values are means ± SD of a representative experiment assayed in triplicate. [Note: untreated, or FSK and IBMX responses were not tested in J774, A20 or HL-60.] For comparison, boxed graph: THP-1 cells treated as above. (B) 5 x 105 cells were serum starved overnight, and then seeded on 24-well uncoated transwell inserts (5 uM pores) and treated with vehicle control (black bars), R L X H (0.02 ng/ml) in both chambers (grey bars), MCP-1 (50ng/ml) in lower chamber (dotted bars), or R L X H (0.02 ng/ml) in both chambers and MCP-1 (50ng/ml) in lower chamber (horizontal hatched bars). Cells were incubated for 24 h at 37°C, and assayed as described in Ch 3 Materials and Methods. Migration index is calculated as fold-change of cells migrated relative to vehicle control. Values are means ± SD of a representative experiment assayed in triplicate. For comparison, boxed graph: THP-1 cells treated as above. 184 R E F E R E N C E S (Chapter 6) 1. Bullesbach, E.E. & Schwabe, C. The relaxin receptor-binding site geometry suggests a novel gripping mode of interaction. J Biol Chem 275, 35276-80 (2000). 2. Kim, D.W., Uetsuki, T., Kaziro, Y., Yamaguchi, N. & Sugano, S. Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene 91,217-23 (1990). 3. Wakabayashi-Ito, N. & Nagata, S. Characterization of the regulatory elements in the promoter of the human elongation factor-1 alpha gene. J Biol Chem 269, 29831-7 (1994). 4. Marriott, D., Gillece-Castro, B. & Gorman, C M . Prohormone convertase-1 will process prorelaxin, a member of the insulin family of hormones. Mol Endocrinol 6, 1441-50 (1992). 5. Layden, S.S. & Tregear, G.W. Purification and characterization of porcine prorelaxin. J Biochem Biophys Methods 31, 69-80 (1996). 6. Zarreh-Hoshyari-Khah, R., Bartsch, O., Einspanier, A., Pohnke, Y. & Ivell, R. Bioactivity of recombinant prorelaxin from the marmoset monkey. Regul Pept 97, 139-46(2001). 7. Garibay-Tupas, J.L., Bao, S., Kim, M.T., Tashima, L.S. & Bryant-Greenwood, G.D. Isolation and analysis of the 3'-untranslated regions of the human relaxin HI and H2 genes. J Mol Endocrinol 24, 241-52 (2000). 8. Dschietzig, T. et al. The pregnancy hormone relaxin is a player in human heart failure. FasebJ 15, 2187-95 (2001). 9. Hsu, S.Y. et al. Activation of orphan receptors by the hormone relaxin. Science 295, 671-4 (2002). 10. Vinall, R.L. et al. The R273H p53 mutation can facilitate the androgen-independent growth of LNCaP by a mechanism that involves H2 relaxin and its cognate receptor LGR7. Oncogene 25, 2082-93 (2006). 11. Siivertown, J.D., Ng, J., Sato, T., Summerlee, A.J. & Medin, J.A. H2 relaxin overexpression increases in vivo prostate xenograft tumor growth and angiogenesis. Int J Cancer (2005). 185 12. Ching, K.Z. et al. Expression of mRNA for epidermal growth factor, transforming growth factor-alpha and their receptor in human prostate tissue and cell lines. Mol Cell Biochem 126, 151-8 (1993). 13. Prenzel, N. et al. EGF receptor transactivation by G-protein-coupled receptors requires metalloproteinase cleavage of proHB-EGF. Nature 402, 884-8 (1999). 14. Binder, C , Hagemann, T., Husen, B., Schulz, M . & Einspanier, A. Relaxin enhances in-vitro invasiveness of breast cancer cell lines by up-regulation of matrix metalloproteases. Mol Hum Reprod 8, 789-96 (2002). 15. Parsell, D.A., Mak, J.Y., Amento, E.P. & Unemori, E.N. Relaxin binds to and elicits a response from cells of the human monocytic cell line, THP-1. J Biol Chem 271, 27936-41 (1996). 16. Rios, C D . , Jordan, B.A., Gomes, I. & Devi, L.A. G-protein-coupled receptor dimerization: modulation of receptor function. Pharmacol Ther 92, 71-87 (2001). 17. Jordan, B.A., Trapaidze, N., Gomes, I., Nivarthi, R. & Devi, L.A. Oligomerization of opioid receptors with beta 2-adrenergic receptors: a role in trafficking and mitogen-activated protein kinase activation. Proc Natl Acad Sci USA9S, 343-8 (2001). 18. Salim, K. et al. Oligomerization of G-protein-coupled receptors shown by selective co-immunoprecipitation. J Biol Chem 277, 15482-5 (2002). 19. Osheroff, P.L. & King, K.L. Binding and cross-linking of 32P-labeled human relaxin to human uterine cells and primary rat atrial cardiomyocytes. Endocrinology 136, 4377-81 (1995). 20. Einspanier, A. et al. Characterization of relaxin binding in the uterus of the marmoset monkey. Mol Hum Reprod 7, 963-70 (2001). 21. Paddison, P.J., Caudy, A.A. , Bernstein, E. , Hannon, G.J. & Conklin, D.S. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16, 948-58 (2002). 22. Elbashir, S.M., Martinez, J., Patkaniowska, A., Lendeckel, W. & Tuschl, T. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EmboJ20, 6877-88 (2001). 23. Wu, X. et al. Development of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2, 47-55 (2000). 186 24. Naldini, L., Blomer, U., Gage, F.H., Trono, D. & Verma, L M . Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector.-Proc Natl Acad Sci USA93,\ 1382-8 (1996). 25. Burns, J.C., Friedmann, T., Driever, W., Burrascano, M . & Yee, J.K. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci US A 90, 8033-7 (1993). 26. de Bruyn, K . M . , Zwartkruis, F.J., de Rooij, J., Akkerman, J.W. & Bos, J.L. The small GTPase Rapl is activated by turbulence and is involved in integrin [alpha] lib [beta] 3-mediated cell adhesion in human megakaryocytes. J Biol Chem 278, 22412-7 (2003). 187 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0092919/manifest

Comment

Related Items