T H E R E P L I C A S E ASSOCIATED CUCUMBER NECROSIS VIRUS fa T A R G E T S T O P E R O X I S O M E S A N D IS A S S O C I A T E D WITH T H E I N D U C T I O N OF NECROSIS IN AGRO-INFILTRATED PLANTS. by B H A V A N A SINGH M . S c , G B P U A & T , Pantnagar India, 2000 B . S c , G B P U A & T , Pantnagar India, 1998 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L M E N T OF T H E R E Q U I R E M E N T S FOR T H E D E G R E E OF M A S T E R OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES ( P L A N T SCIENCE) T H E U N I V E R S I T Y OF BRITISH C O L U M B I A December, 2005 © Bhavana Singh, 2005 Abstract Replication of Cucumber necrosis virus ( C N V ) R N A requires two viral-encoded proteins, p33 and its read-through product p92, both of which are believed to be components of C N V replicase enzyme. In this study we have investigated the subcellular location of C N V p33 in order to gain further insight into the C N V replication process. A p33/GFP fusion protein was cloned in an Agrobacterium tumefaciens binary vector and used to agroinfiltrate leaves of Nicotiana benthamiana. Co-infiltration experiments using a Y F P labeled peroxisomal marker (pYFP-SKL) along with confocal microscopy showed that the p33/GFP fusion protein targets to the peroxisomal membrane. In addition, peroxisomes of p33/GFP inoculated cells often showed a high level of aggregation. We also report that patches of necrosis-like symptoms develop on p33/GFP infiltrated leaves suggesting that p33 contributes to the necrotic symptoms typically observed in CNV-infected plants. Similar agroinfiltration experiments were conducted with C N V p20 which is the viral suppressor of gene silencing and a protein previously suggested to modulate symptom induction. The results indicate that p20 is not capable of inducing necrotic-like symptoms on its own in agroinfiltrated plants. Phenol red assays to assess'hydrogen peroxide production in leaf samples failed to show a clear correlation between necrosis and levels of peroxide accumulation in control and p33/GFP infiltrated plants. However, the D A B staining method indicated that peroxide accumulation occurred in p33/GFP infiltrated and C N V infected plants but not control plants. The association of C N V p33 with peroxisomes and its ability to induce necrosis-like symptoms in infiltrated plants suggests that p33 may contribute to the necrotic-like reaction via disruption of peroxisomal function. However, the involvement of peroxide accumulation in necrosis will require further experimentation. Table of Contents Abstract ii Table of Contents iii List of Tables v List of Figures vi List of Abbreviations vii Acknowledgement x C H A P T E R 1-Introduction 1 1.1 Purpose of study 1 1.2 Significance of study 2 1.3 Project objectives 3 C H A P T E R 2-Literature Review 4 2.1 Cucumber necrosis virus 4 2.2 Intracellular replication sites of plus-strand R N A viruses 6 2.2.1 Association of replicase complex with membrane containing structures 2.2.2. Localization of replication proteins in the virus infected cells 2.3 Replication of tombusviruses 6 10 12 2.3.1 The subcellular site of replication 12 2.3.2. Tombusvirus replication complexes 13 2.4 Symptom induction by plant viruses 14 C H A P T E R 3- Materials And Methods 16 3.1 P C R amplification of p33, p20, GFP and YFP-SK.L sequences 16 3.2 Plasmid construction 17 3.3 Agrobacterium-mediaXed transient expression 20 3.4 Isolation and biochemical treatment of membranes 21 iii 3.5 Western-blot analysis 22 3.6 Detection of hydrogen peroxide 22 3.7 Confocal Microscopy! 23 3.8 Plant inoculations with viral R N A transcripts 24 C H A P T E R 4-Results 25 4.1 GFP-tagged C N V p33 associates with peroxisomes in agroinfiltrated leaves of N. benthamiana 25 4.2 The p33/GFP fusion protein associates with membranes in infiltrated plants 30 4.3 The p33/GFP fusion protein is tightly associated with membranes 31 4.4 N. benthamiana leaves agroinfiltrated with p33/GFP develop necrotic-like patches 31 4.5 Phenol red assays to assess hydrogen peroxide production in leaf samples do not show a clear correlation between necrosis and levels of peroxide accumulation in control and p33/GFP infiltrated plants 32 4.6 N. benthamiana leaves agroinfiltrated with p20/GFP do not develop necrotic patches 37 C H A P T E R 5-Discussion..... 39 5.1 C N V p33/GFP targets to peroxisomes in agroinfiltrated plants 39 5.2 C N V p33 is an integral membrane protein 40 5.3 C N V p33 does not contain a clearly identifiable peroxisome targeting signal 41 5.4 C N V p33 may be involved in the induction of necrosis in infected plants 44 5.5 Does C N V p33 expression in N.- benthamiana production? Bibliography result in hydrogen peroxide 46 51 List of Tables Table 2.1. Organellar origin of M V B s induced by several tombusviruses 11 Table 3.1. Oligonucleotides used in this study 19 List of Figures Fig.2.1. Linear representation of the C N V R N A genome structure 5 Fig. 2.2.a. Diagrammatic representation of spherules and the viral R N A replication complex 8 Fig. 2.2.b. A general scheme for replication of a positive-strand R N A virus 9 Fig. 3.1. Schematic representation of the pBINPLUS fusion protein expression constructs. 18 Fig. 4.1. GFP-tagged C N V p33 localizes to the peroxisomal membrane in agroinfiltrated leaves of N. benthamiana 26 Fig. 4.2. The p33/GFP fusion protein associates with membranes in infiltrated N. benthamiana plants 28 Fig. 4.3. The p33/GFP fusion protein is tightly associated with membranes 29 Fig. 4.4. N. benthamiana leaves agroinfiltrated with p33/GFP develop necrotic-like patches. 34 Fig. 4.5. p33/GFP infiltrated N. benthamiana leaves show a modest increase in the levels of hydrogen peroxide 35 Fig. 4.6. p33/GFP infiltrated leaves accumulate peroxide as determined by D A B staining..36 Fig. 5.1. C N V p33 has two predicted transmembrane domains .....42 List of Abbreviations aa Amino acid ATP Adenosine triphosphate BMV Brome mosaic virus CIRV Carnation Italian ring spot virus CNV Cucumber necrosis virus C-terminal Carboxy terminal CymRSV Cymbidium ringspot virus DAB 3,3'diaminobenzidine DI-RNA Defective interfering RNAs. dpi Days post infiltration ds Double-stranded EDTA Ethylenediaminetetraacetic acid EGFP Enhanced green fluorescent protein EM Electron microscopy ER Endoplasmic reticulum EYFP Enhanced yellow fluorescent protein g Genomic, gravity , gram GFP Green fluorescent protein HCV Hepatitis C virus HEPES 2-(4-(2-Hydroxyethyl)-l-piperazinyl) ethanesulfonic acid HF Host factor HIV Human immuno deficiency syndrome virus HR Hypersensitive response HRPO Horseradish peroxidase kb Kilobase kDa Kilodalton LB Luria broth MES 2-(N-morpholino) ethanesulphonic acid MHV Mouse hepatitis virus mPTS Membrane peroxisome targeting signal MVBs Multivesicular bodies Nos Nopaline synthase N-terminal Amino terminal OD Optical density ORF Open reading frame PAGE Polyacrylamide gel electrophoresis PGD Programmed cell death PEB Protein extraction buffer PMSF Phenylmethylsulfonyl fluoride PRS Phenol red solution PTS Peroxisome targeting signal RCNMV Red clover necrotic mosaic virus RdRp R N A dependent R N A polymerase sg Subgenomic TBSV Tomato bushy stunt virus TEV Tobacco etch virus TMDs Trans-membrane domains Tris-HCl Tris - hydrochloric acid TYM V Turnip yellow mosaic virus U Units wt. Wild type YFP Yellow fluorescent protein Acknowledgement I offer my heartfelt gratitude to Dr D ' Ann Rochon, research scientist at Pacific Agriculture Research Center (PARC) Summerland, Canada for her consistent guidance, enlightening inspiration and constructive criticism throughout the course of investigation. I am very grateful to my committee members, Drs. Brian Ellis, Mary Berbee and Janet K . Chantler for their encouragement and motivation. M y sincere appreciation is due to Dr. Michael Weis for introducing me to the science and art of confocal microscopy. I wish to recognize co-operation shown by Jane Theilmann, Steve Orban, Ron Reade and L i z Hui during the course of study. I am thankful to Y u Xiang for providing valuable constructs that were used as starting material for this study. I gratefully acknowledge the Department of Biotechnology, P A R C , Summerland for providing research facilities and an excellent work environment. Many thanks to Yuvonne Kolstee for her personal support and teaching several aspects of life during my stay in Canada. I am grateful to Nitin for his help, inspiration and motivation during the course of study. I feel a deep sense of gratitude for my late mother who formed part of my vision and the happy memory of her continue to provide encouragement and inspiration to this day. I am indepted to my father for his subtle guidance and motivation. I am thankful to Pratibha and Manjul for motivation and to my younger sisters Kamana and Arti for support and love. Finally, I owe my gratitude to Yash for helping me type this manuscript. 1. Introduction Unraveling the molecular mechanisms underlying the complex process of R N A virus replication is important for the development of antiviral strategies. Insights into the overall multiplication cycle of R N A viruses have arisen from recent advances in the identification and function of viral R N A replication factors, the nature of the viral R N A replication complex as a membrane-bounded compartment, and the identification of host proteins that contribute to viral R N A replication. However, several stages of the virus replication cycle remain incompletely characterized and therefore cannot be adequately exploited in antiviral strategies. These include, among others, details on membrane targeting and the association of replication complexes with specific host membranes which is common to all positive-strand R N A viruses. In addition, few studies have addressed the possible specific effects of cellular organelle dysfunction that might be associated with the site of viral R N A replication and how this may relate to symptom induction in plant cells. 1.1. Purpose of the study. Tombusviruses are small plus-strand R N A viruses that have been shown to induce multivesicular bodies (MVBs) in plant cells, with different tombusvirus species being shown to form M V B s in different organelles such as chloroplasts, mitochondria or peroxisomes. A n overall goal of the studies conducted in this laboratory has been to understand the multiplication cycle of Cucumber necrosis virus (CNV), particularly with regards to the viral uncoating process and subsequent targeting of the virion R N A to the site of translation and replication. Towards this, work in Dr. Rochon's laboratory has recently shown that the C N V coat protein (CP) targets to chloroplasts in N. benthamiana cells and that this targeting may reflect the site of C N V particle disassembly. In consideration of this finding, along with the finding that some tombusviruses may replicate in association with chloroplasts, it was of interest to determine where the intracellular site of C N V replication is in N. benthamiana. 1.2. Significance of the study. Positive-strand R N A viruses are responsible for numerous clinically and economically important diseases in humans, animals, and plants. One feature shared by positive-strand R N A viruses is assembly of replication complexes on intracellular membranes with associated membrane proliferation and vesicle formation (Schwartz et al, 2004). Understanding the mechanisms that target replication proteins and templates to specific intracellular membranes could lead to the development of potential antiviral strategies. The need to continuously develop new antiviral drugs to combat viruses such as Human immunodeficiency virus and Hepatitis C virus is partly due to the high error (mutation) frequency of the viral replicase which enables rapid adaptation of the virus to new selection pressures, such as antiviral drugs. Thus strategies that interfere with the viral R N A replication process could be used to minimize the opportunity for replicaseinduced mutations and consequent antiviral drug resistance. The data presented in this thesis deepens our understanding of the site of viral R N A replication in a cell. This knowledge will contribute to the understanding of fundamental aspects of positive-strand R N A virus replication, and thereby assist in strategies aimed to interfere with these processes. 1.3. Project objectives The main objective of this study was to identify the intracellular targeting site of the C N V replicase associated protein p33 in N. benthamiana in order to address the possible site of viral R N A replication and to contribute to the laboratory's overall goal of achieving an in-depth understanding of the C N V multiplication process in cells. During the course of these studies it was. found that C N V p33 targeted to peroxisomes, and that targeting was associated with the induction of necrosis-like symptoms in leaves, a reaction typical of C N V infection in this plant. Due to the potential significance of this observation with regards to C N V symptom development in infected plants, it became of interest to assess if targeting of p33 to peroxisomes might be responsible for the induction of necrosis via disruption of the peroxisome function in peroxide metabolism. Therefore an additional objective of this thesis was to assess whether peroxisome dysfunction occurs in p33/GFP infiltrated leaves. 2. Literature Review 2.1. Cucumber necrosis virus Cucumber necrosis virus (CNV) a member of the genus Tombusvirus, family Tombusviridae, is a small, 30 nm icosahedral virus. The complete C N V genome has been cloned and sequenced (Rochon et al, 1989). The genome is composed of a single positive-strand R N A molecule of 4701 nucleotides (Gene bank Accession number NC_001469) and contains five functional open reading frames (ORFs) encoding proteins designated p33, p92, p41, p21, and p20 (Fig. 2.1). Read-through of the amber stop codon that terminates the ORF1 product (p33) results in the synthesis of the putative R N A polymerase (p92) from ORF2 (Rochon et al, 1991). The p41 product of ORF3 is the viral coat protein. It is translated from a 2.1 kb subgenomic R N A which is generated from the 3' terminus of the C N V genome during replication. The p21 product of ORF4 and p20 product of ORF5 are translated from distinct overlapping ORFs from the same 0.9 kb subgenomic R N A (Russo et al, 1994). The protein p21 is required for viral cellto-cell movement and p20 has been shown to be involved in symptom induction as well as being a suppressor of gene silencing (Rochon, 1991; Rochon and Xiang, personal communication). The non-coding regions at the 5' and 3' ends and those between ORFs 2 and 3 and 3 and 4 contain promoter elements involved in R N A replication and sgRNA synthesis as well as in translation of their respective downstream ORFs. It is generally accepted that C N V p33 (and its homologues in other tombusviruses) is involved in viral R N A replication. This is based on the following observations: 1) p92 cannot support viral replication in the absence of p33 in plant protoplasts (Oster et al, 1998; Panaviene et al, I>3J s t o p c o d o i m e . K l though .1 s tvi o sine t o |>io<luce |>> ' _>> P. e| 4ic.it km ' i f 11A I stut site sgPIIA2 stilt site il P.I IA silencing sti|>|>iessoi iit 0>nn>tonie? sgP.IIA I |>ron»tei' elements P.IIAPolyniei.ise <P.et4k.itiont Co.it Piotein Movenent |>iotein ^ sgRIIA 1 ^ sgP.ll A 2 Fig.2.1. Linear representation of the C N V R N A genome structure. Boxes correspond to the five open reading frames (ORFs 1-5); the protein encoded by each O R F is indicated in yellow. p92 is expressed by translational read-through of the p33 stop codon (UAG). The initiation sites for the two subgenomic RNAs (sgRNAl and sgRNA2) generated during C N V infection are indicated. The coat protein (p41) is expressed from s g R N A l and p20 and p21 are expressed from different overlapping ORFs on sgRNA2. Functions for each of the proteins are indicated. The horizontal bar corresponds to the genome (4701 nt) with the 5' and 3' noncoding regions indicated. 2003); (ii) p33 binds to viral R N A in vitro (Panaviene et al, 2003; Rajendran et al., 2003) and (iii) p33 interacts with p92 in vitro and in vivo (Rajendran et al, 2004). 2.2. Intracellular replication sites of plus-strand RNA viruses. 2.2.1. Association of the replicase complex with membrane-containing structures. A l l characterized positive-strand R N A viruses assemble their R N A replication complexes on intracellular membranes, usually in association with membrane vesicle formation or other membrane rearrangements (Fig. 2.2,a and b) (Carette et al, 2002; Lee et al, 2001; Miller et al, 2001; Navarro et al, 2004; Restrepo-Hartwig et al, Rohozinski et al, 1999; 1996). The membrane associated replication complexes have been shown to contain viral R N A and both virus- and host-encoded proteins (Buck, 1996; Noueiry et al, 2003). For such replication complexes, the host membrane constitutes a crucial host factor serving multiple purposes. First the membrane provides a surface on which replication factors are localized and concentrated for assembly. The membrane also surrounds and protects the viral site of replication providing an environment in which the R N A replication factors and viral R N A s are sequestered from competing host R N A templates and possibly from competing processes such as translation. This organization also helps to protect viral dsRNA replication intermediates from dsRNAinduced host defense responses such as R N A silencing or interferon-induced responses (Ahlquist et al, 2003). While many positive-strand R N A viruses form similar spherical invaginations, others form distinct membrane structures, including alternate types of vesicles or appressed membranes. The detailed organization of membrane rearrangement is not yet defined (Ahlquist et al, 2003; Rust et al, 2001; Schwartz et al, 2002), however it has been suggested that the several apparently different membranous structures may actually represent variations of a common theme (Schwartz et al, 2004). Various (+) strand R N A viruses assemble their R N A replication complexes on different, but usually specific membranes or membrane subsets. For example, certain alphaviruses use endosomal and lysosomal membranes (Kaariainen et al, plant viruse, Brome mosaic virus ( B M V ) reticulum (Restrepo-Hartwig et al, the membrane of 2002), the uses the membranes of the endoplasmic 1996) and Cymbidium ringspot virus (CyRSV) uses the mitochondrion (Rubino et al, 2001). The specific type of membrane system utilized in assembling the viral replication complex depends on the individual virus. The viral-encoded components of the replicase contain sequences that are involved in the specificity of targeting. Some viral and host components are recruited to the complex indirectly via specific interaction with a membrane targeted replicase component. (Burgyan et al, 1996; Hagiwara et al, 2003; Rubino et al, 1998). However, the specific membrane that is targeted by the polymerase may not be critical for replication as several R N A virus replication complexes have been retargeted to other membranes without loss of function (Burgyan et al, 1996; Miller et al, 2003). These observations imply that host membranes are used for providing a surface on which replication factors are localized and concentrated for assembly but that specific membrane proteins themselves do not participate in the replication process. RNA polymera se Helicase Host factors Vii.il ie|)lic<ition complex witliin s p l i e i u l e Splieiules Fig. 2.2.a. Diagrammatic representation of spherules and the viral R N A replication complex. The gray area corresponds to the surface of the organelle membrane. The white invaginations at the cytoplasmic side of the membrane correspond to spherules. The closed circles also represent spherules but the plane of the section is different and therefore they appear as closed spheres (or spheres within spheres). Components of the replication complex and viral RNAs are shown along with their location within a spherule. ++++++++++++++++++ Infectious viral R N A Translation of replicate proteins Helicase \ Hel i f Host factors ^ Ta rge ting o f rep lie as e complex to specific intracellular membranes Membrane rearrangements proliferation HF A Membrane/ replication complex and Negative strand RNA J synthesis • (-) Progeny --RNA () + () + synthesis^ +++++++++++++++++ +++++++++++++++++ () + +++++++++++++++++ Fig. 2.2.b. A general scheme for replication of a positive-strand R N A virus. Specific steps in R N A replication are described. Following release of virion R N A translation occurs to produce proteins involved in viral genome replication. The replication complex consists of viral encoded proteins such as the R N A dependent R N A polymerase (RdRp) and helicase as well as host factors and viral R N A . The complex assembles on a specific intracellular membrane. Negative-strand R N A is synthesized from viral R N A and several plus-strand R N A s are then produced from the negative-strand template. Assembly of the replicase complex on membranes is associated with membrane proliferation and the formation of spherules (cup-shaped vesicles) within the membrane with the opening facing the cytoplasmic side. 2.2.2. Location of replication proteins in virus-infected cells. In a number of cases (e.g., poliovirus, alphaviruses) all of the viral replication proteins are localized within the replication complex (Bienz et al, 1987; Bienz et al, 1992; Froshauer et al, 1988; Restrepo-Hartwig et al, 1996). On the other hand, for the Flavivirus Kunjin, the replicative proteins and R N A viral synthesis sites co-localize in vesicle pockets, while other nonstructural proteins are associated with modified membranes from the intermediate compartment (Mackenzie et al, 1999). In the case of Turnip yellow mosaic ( T Y M V ) , replication appears to occur in association with chloroplasts, where both the 66 kDa and 140 kDa replicase associated proteins are targeted (Prod'homme et al, 2003). Studies showed that targeting of the 66 kDa component of the replicase to the chloroplast envelope is dependent on expression of its 140 kDa read-through protein, indicating that the read-through portion of the 140 kDa protein contains information for chloroplast targeting and that targeting of the 66 kDa protein might occur via its ability to interact with the 140 kDa protein. Targeting was found to induce clumping of chloroplasts, which is one of the typical cytological effects of T Y M V infection. These results suggest that the 140 kDa protein is a key organizer of the assembly of the T Y M V replication complexes and a major determinant for their chloroplastic localization and retention (Prod'homme et al, 2003). A putative N-terminal amphipathic helix (AH) in NS4B protein of hepatitis C virus (HCV) has been found to mediate membrane association and correct localization of replication complex proteins (Elazar et al, 2004). Table 2.1. Organellar origin of M V B s induced by several tombusviruses'. Virus Tomato bushy stunt virus (TBSV) Cucumber necrosis virus (CNV) Eggplant mottled crinkle virus (EMCV) Carnation Italian ringspot virus (CIRV) Cymbidium ringspot virus (CymRSV) 1 Origin of multivesicular bodies Reference(s) Peroxisomes (Martelli etal, 1988) Peroxisomes this thesis; (Rajendran et al, 2004) Peroxisomes, vesicles in chloroplasts (Makkouk etal, 1981) Mitochondria (Burgyan etal, 1996) Peroxisomes and mitochondria (Navarro et al, 2004; Rubino etal, 1998) This table has been partially adapted from Martelli et al, 1988 2.3. Replication of tombusviruses. 2.3.1. The subcellular site of replication. Tombusviruses are positive-strand R N A viruses of plants whose infections are typically associated with the formation of membranous cytoplasmic inclusions called multivesicular bodies (MVBs). The periphery of M V B s have been shown to contain multiple vesicles that are approximately 80-150 nm in diameter. during tombusvirus infection have been shown to originate The M V B s induced from chloroplasts, mitochondria or peroxisomes and the site of localization appears to vary with the host of the virus as well. Table 2.1 summarizes the organellar origin o f tombusvirus induced M V B s and their known or presumed sites of replication. Recently, Red clover necrotic mosaic virus ( R C N M V ) replication proteins have been shown to accumulate in association with the endoplasmic reticulum (Turner et al., 2004). R C N M V is not a tombusvirus but it is a member of the Tombusviridae family. Therefore it appears that replication on M V B s derived from chloroplasts, mitochondria or peroxisomes will not be a general feature of the site of replication of the Tombusviridae. The tombusvirus Carnation Italian ringspot virus (CIRV) induces M V B s derived from mitochondria whereas Cymbidium ringspot virus (CymRSV) induces M V B s from peroxisomes (Burgyan et al, 1996; Rubino et al, 2001). Replacement of 600 nucleotides from the 5' region of the C I R V genome with the corresponding region of the genome of C y m R S V changes the localization of M V B s from mitochondria to peroxisomes (Burgyan et al, 1996) indicating that the region of the genome that specifies the site of replication is located within the 600 nt region. The 3' terminal part of the exchanged region contains the coding information for the amino-terminal regions of the pre-read-through domains of the replicases of C I R V (p36) and CymRSV (p33). This data therefore suggested that that these portions of p36 and p33 may contain the information that determines the site of M V B formation and/or replication in C I R V and CymRSV. Later, biochemical analysis suggested that p33 is anchored to the peroxisomal membrane through a segment of ca. 7 kDa, located in the amino terminal portion of the replicase. This segment contains two hydrophobic transmembrane domains and a hydrophilic interconnecting loop (Navarro et al, 2004). 2.3.2. Tombusvirus replication complexes. Tombusviruses encode two proteins (p33 and p92) that are required for replication (Panaviene et al, 2003). As described in Section 2.1, p92 is an amber readthrough protein of p33. The p92 read-through region contains the conserved motifs that are characteristic of RdRps. A conserved helicase motif, typically associated with viral R N A replicases, has not been found in p92 or p33 or any of the other 3 proteins encoded by the tombusvirus genome. The involvement of p33 in tombusvirus R N A replication (Panavas et al, Panaviene et al, 2005; 2003) is supported by the observation that p92 cannot support viral replication in the absence of p33 in plant protoplasts (Oster et al, 1998; Panaviene et al, 2003); Also, it has been shown that C N V p33 can bind.to viral R N A in vitro which is consistent with its proposed role in viral R N A replication (Panaviene et al, 2003; Rajendran et al, 2003). Recently, C N V p33 has been found to form dimers or multimers via interaction with other p33 molecules or with the p33 region of p92 (Rajendran et al, 2004). The RNA-binding region in p33 has been mapped to an arginine-proline-rich motif (RPR motif). Mutations within the RPR motif in p33 affected g R N A and sgRNA synthesis (Panaviene et al, 2003) as well as viral R N A recombination (Panaviene et al, 2003) suggesting that p33 is involved in the replication process at multiple steps. In vitro studies with C N V replicase preparations demonstrated that the C N V RdRp could recognize the essential viral R N A promoter sequences (Panavas et al, 2002), replication enhancers, (Panavas et al, 2003) and a replication silencer element (Pogany et al, 2003) during R N A synthesis. 2.4. Symptom induction by plant viruses. Virus-infected host cells undergo many defense responses that can lead to the development of disease. As viruses invade susceptible plants, they create conditions that favor systemic infections by suppressing multiple layers of innate host defenses. When viruses meddle in these defense mechanisms, which are interlinked with basic cellular functions, phenotypic changes can result that contribute to disease symptoms (Whitham et al, 2004). However, although much insight into the molecular basis of virus and host interactions that lead to disease has been obtained, many aspects of the disease induction process are not understood and therefore require further study. Many virus encoded proteins or viral genome sequences confer some level of either resistance to the host defense response and/or ameliorate host disease symptoms. Such viral sequences include the coat protein, subunits of the viral replicase, non-coding regions of the genome, virus associated defective interfering RNAs, satellite viruses and certain viral-encoded suppressors of gene silencing (Simon et al, 2004). With regards to host defense systems, there are probably many different mechanisms involved, but in general terms there is a tendency towards increased local necrosis at the sites of virus infection. The hypersensitive response (HR) of plants resistant to microbial pathogens involves a complex form of programmed cell death (PCD) that differs from developmental P C D in its consistent association with the induction of local and systemic defense responses. Hypersensitive cell death is commonly controlled by direct or indirect interactions between pathogen avirulence gene products and those of plant resistance genes and it can be the result of multiple signalling pathways. Ion fluxes and the generation of reactive oxygen species commonly precede cell death, but a direct involvement of the latter seems to vary with the plant-pathogen combination (Heath, 2000). In certain strains of Tobacco mosaic virus (TMV) it has been shown that the host hypersensitive response is linked to the viral-encoded RdRp but in other cases T M V may induce the hypersensitive response via another gene such as the coat protein (Whitham et al., 1996). Moreover, in some viruses, necrosis develops, but there is little or no restriction in virus movement as a result of the necrotic reaction and systemic necrosis develops, indicating that a different mechanism may induce the necrosis and/or the virus counter-defense strategy is more effective than the host defense strategy (Matthews, 1992). Diverse number of mechanisms may be involved in host resistance to viruses as well as in the viral antidefense process. These processes are not only of fundamental interest to the scientific community, but their understanding could lead to new strategies for managing virusinduced disease. 3. Materials and Methods A l l D N A manipulations were performed using standard techniques (Sambrook et al, 1989). The sequences of polymerase chain reaction (PCR) generated D N A fragments within plasmid constructs were confirmed by sequencing and the overall structure of the final construct was confirmed by restriction enzyme analysis. 3.1. PCR amplication of p33, p20, GFP and YFP-SKL sequences. PCR was used to amplify the p33, p20 and G F P ORFs from plasmid constructs already available in the laboratory. In the case of Y F P - S K L , a commercially available construct was used (see below). The overall strategy for PCR amplification for subsequent cloning purposes was as follows: Each pair of primers (Table 3.1) corresponded to the 5' [forward primer (F)] or 3' [reverse primer; (R)] end of the respective protein coding region and also carried a restriction enzyme sequence (Table 3.1) added to the primer 5' terminus that was used for subsequent cloning of the PCR fragment (see Section 3.2). Following amplification, the P C R product was digested with the indicated restriction enzyme electrophoresed through a 1% agarose gel. The excised P C R fragment was purified using a Qiagen's QIAquick PCR purification kit. PCR was carried out as described by Fisher et al, (1997).The thermal cycling parameters were; 1 cycle of 95°C for 1 minute followed by 25 cycles of 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 2 minutes. The p33 O R F was amplified using primers Ncol-33K-¥ and Pj7/-33K-R and then digested with Ncol and Pstl and the GFP ORF was amplified using primers P.y/7-GFP-F and BamHl-GFP-R and then digested with Pstl and BamHl. The C N V p33 O R F was amplified from pK2/M5 (Rochon et al, 1991) and a previous pK2/M5 construct containing G F P was used for amplification of GFP. A similar strategy was used to construct PBI525/p20/GFP except that the p20 ORF was amplified using primers Ncol20K-F and Pstl-20K-R using pK2/M5 as template. 3.2. Plasmid construction The Agrobacterium tumefaciens binary vector pBINPLUS (Van Engelen et al, 1995) was the plasmid used for expression of p33- and p20-GFP fusion proteins following agroinfiltration of plant leaves. Constructs (Fig. 3.1) were prepared in two overall steps as follows. In the first step, fusion protein ORFs were cloned into the plant expression vector pBI525 (Pang et al, 1992) between the dual 35-S promoter and the Nos terminator. In the second step the region between the dual 35-S promoter and the Nos terminator was transferred to pBINPLUS. The construct pBI525/p33/GFP was made by trimolecular ligation of Ncol- and BamHl-digested pBI525, and the C N V p33 and GFP P C R fragments described above. pBI525/p33/GFP was then digested with Sail and EcoRl, which flanks the insert region, and ligated into to similarly digested pBINPLUS. A similar trimolecular ligation approach was used for construction of pBI525/p20/GFP. The Sstl and Sail digested fragment of pBI525/p20/GFP was cloned in Sstl and Sail digested pBINPLUS to make p20/GFP. The construct pBin/GFP was a gift from Y u Xiang, Plasmid pEYFP-peroxi with S K L peroxisomal signal peptide was purchased from Clontech (Palo Alto, C A ) . This was used to make the peroxisomal-marker plasmid p Y F P / S K L in two steps. pEYFP-peroxi was digested with Ncol and Xbal and ligated to Nco1 pBIN-GFP — NPT 35-S Promoter AMV Sa/1 it Bamm G F P A/co1 r-T Nos-T Psfl SamH1 lacZ |— EcoR1 pBIN-p33/GFP ' _ i — i _ J -S Promoter AMV Sa/1 NPT 35-S Promoter AMV H/ndlll PBIN-YFP/-SKL 3.1. •j Nco1 | GFP Psfl p20 ^ | - Bamm GFP Xba1 \ - Bamm Nos-T /acZ " | _ EcoR1 Nos-T /acZ — EcoP.1 f ~WPT~[— Fig. p33 Nco1 pBIN-p20/GFP — -| 35-S P r o m o t e r ; Schematic representation AMV | ^ YFP-SKL " | ^ - j Nos-T | - < ^ / a c Z of the pBINPLUS fusion protein [- expression constructs. C N V p33 or p20 were fused in-frame with G F P and placed downstream of the dual 35S promoter. A M V corresponds to the alfalfa mosaic virus translational enhancer and Nos to the nopaline synthase transcription termination site, Lac Z encodes for pgalactosidase. and N P T II is the kanamycin resistance gene used for selection of pBINPLUS in A. tumefaciens cultures. Individual protein sequences were amplified by PCR using the primers shown in Table 3.1 and then ligated into the intermediate vector pBI-525. In the case of the p33 and p20 G F P fusions, the ligation reaction contained pBI525, G F P and either p33 or p20. The sequences between the dual 35S promoter to the Nos terminator were excised from pBI-525 using Sail and EcoRI and cloned into the corresponding site of pBINPLUS resulting in the construct shown above. Restriction enzyme(s) site(s) utilized in making constructs have been shown. The Y F P - S K L peroxisomal marker was constructed by transfer of the gene from plasmid pEYFP-peroxi ,(Clontech) to pBI525 using restriction enzymes and cloned in pBINPLUS . Table 3.1. Oligonucleotides used in this study (see Materials and Methods). Primer Name Primer Sequence Purpose Afco/_p33_F 5' C A A G A C C A T G G T G T G G C C T A A G A A A G 3 ' Ncol site at 5' end of p33 ORF Pstlj>33 _R 5' A A G C C C T G C A G T T T C A C A C C A A G G G A C 3 ' Pstl site at 3' end of p33 ORF Pstl_GFPJ 5' A T A T A C T G C A G G T G A G C A A G G G C G 3 ' Pstl site at 5' end of GFP BamHl _G¥?_K 5' T A T T A G G A T C C T T A C T T G T A C A G C T C G T A 3 ' BamHl site at 3' end of GFP NcoI_p20_F 5' A T A A A C C A T G G A A C G A G C T A T A C A 3 ' Ncol site at 5' end of P20 Pstl_p2Q_K 5' AGTCTCTGCAGCTCGCTTTCTTTA3' Pstl site at 3' end of P20 similarly digested pBI525 to create pBI525/YFP/SKL. The Hindlll- EcoRl fragment of pBI525/SKL/YFP was cloned in the corresponding site of pBINPLUS to create pYFP/SKL. 3.3. Agrobacterium-mediated transient expression A l l pBINPLUS constructs were used to transform A. tumefaciens strain GV3101 (Koncz et al, 1986) by the freeze and thaw method (Chen et al, agroinfiltration procedure was performed as described 1994). The by Guo et al, (2002). Transformants were streaked on LB/agar plates containing 50 u.g/ml kanamycin and 10 fig/ml rifampicin and incubated at 28 °C overnight. A single colony from the plate was inoculated into 3 ml L B medium containing antibiotics as above, and grown at 28 °C for 48 h with vigorous shaking. One \i\ of the culture was transferred to 50 ml L B medium containing the above antibiotics, 10 m M M E S , pH 5.6 and 20 u M acetosyringone. After incubation at 28 °C for 20 h with vigorous shaking, whereupon the OD oo of the culture 6 had reached 1.0, the bacteria were centrifuged at 4000 g for 6 min at 4° C. The pellet was resuspended in 50 ml 10 m M M E S , pH 5.6 and 10 m M M g C l , and then 200 u M 2 acetosyringone was added. The bacterial suspension was incubated at room temperature for 5 h without shaking. The cultures were used to infiltrate N. benthamiana leaves. To maintain a uniform concentration of Agrobacterium, the. OD600 of the mixtures was adjusted to 1.0-1.2. Simultaneous agroinfiltration of two different constructs was done using mixtures of individually transformed bacterial suspensions. The suspensions were mixed in a 1:1 ratio. Twenty four to thirty five hours post-infiltration, plant leaves were examined by confocal microscopy and/or were used for protein analysis. A l l experiments were repeated two to four times, and the results of a representative experiment are shown. 3.4. Isolation and biochemical treatment of membranes Cellular fractionation and biochemical treatment of membranes was done as described by Schaad et al, (1997). Leaf tissues obtained from pBin/GFP or p33/GFP infiltrated N. benthamiana plants were used for fractionation experiments as follows. One g of leaf tissue was ground in 4 ml of buffer P E B (50 m M T r i s - H C l , pH 7.4, 15 m M M g C I , 10 m M KC1, 20% glycerol, 0.1% P-mercaptoethanol, 10 m M phenyl-methyl2 sulfonyl fluoride [PMSF]), and the extract was centrifuged at 3000 g at 4°C for 10 min to pellet nuclei, chloroplasts and cell wall debris (PI). The supernatant (SI) was subjected to centrifugation at 30 000 g at 4°C for 30 min, resulting in soluble (S30) and crude membrane (P30) fractions. Analysis of protein/membrane interactions in the P30 membrane fraction was conducted using a previously described method (Schaad et al, 1997) as follows. For alkaline extraction, the P30 pellet was resuspended in 0.1 M N a C 0 , pH 10.5, 4 m M E D T A and 4 m M PMSF. For urea extraction, the P30 pellet was 2 3 resuspended in 25 m M HEPES, pH 6.8, 4 m M E D T A , 4 m M PMSF and 4 M urea. For salt extraction, the P30 pellet was resuspended in PEB buffer containing 1 M K G . In each extraction, the samples were incubated on ice for 30 min, then subjected to centrifugation at 30 000 g at 4°C for 30 min. S30 fractions were pelleted and the pellets of P30 as well as S30 fractions were resuspended in Laemmli buffer in volumes equal. Equivalent amounts of samples were electrophoresed through an S D S - P A G E gel and analyzed by immunoblotting using anti-GFP antibodies (Clontech). 3.5. Western blot analysis Aliquots of protein samples were electrophoresed in SDS-12% P A G E gels, and electrotransferred to a polyvinylidene difluoride membrane (PVDF, Bio-Rad). Membranes were blocked with 5% nonfat dry milk solution in Tris-buffered saline (TBS) (25 m M Tris-HCI, pH 8.0, 125 m M NaCl,) containing 0.1% Tween 20. Blocked membranes were then probed with monoclonal anti-GFP antibodies (Clontech) diluted 1:500 in T B S buffer and incubated for 1 h at room temperature This was followed by three 10-min washes with T B S and incubation for an additional 1 h at room temperature with alkaline phosphatase-conjugated goat anti-mouse antibody (Sigma) at a dilution of 1:800. Reactive protein bands were visualized with the enhanced chemiluminescence system (ECL; Amersham) according to the manufacturer's instructions. 3.6. Detection of hydrogen peroxide Detection of hydrogen peroxide in agroinfiltrated leaves using phenol red was done as described by (Svalheim et al, 1993). In this assay, an increase in absorbance at 590-610 nm resulting from the peroxidase-catalyzed oxidation of phenol red by H2O2 is measured. Leaf discs (8 mm in diameter) from mock, pBin/GFP, pBIN/p33, pBIN/p20 agroinfiltrated or C N V infected N. benthamiana were washed in distilled water, blotted dry with K i m Wipes, floated on 1ml phenol red solution (PRS) (10 m M M E S - K O H , pH 6.5, 0.56 m M phenol red, sodium salt) and incubated for 4 h in the dark in the presence of horseradish peroxidase (HRPO, type II, salt free powder, Sigma) at 8.5 U/ml. The reaction was stopped by increasing the pH to 12.5 via the addition of 10 Gl of 1 N NaOH. Production of H2O2 by the leaf discs was assayed by measuring the OD590 of the phenol red solution. Assays were conducted at 1, 2, 3, 4 and 5 days post-infiltration for each construct using 6 samples from two different leaves of the agroinfiltrated plant. The OD590 obtained using mock infiltrated plants was subtracted from all other values. The statistical significance of differences between values obtained for each construct in comparison to six leaves of pBin/GFP at each day was assessed using a T-test. For histochemical determination of hydrogen peroxide levels, leaves from agroinfiltrated plants were immersed in freshly prepared 3,3'-diaminobenzidine (DAB)/HC1 stain (lmg/ml, pH 3.8 ) in distilled water for 4 h (Thordal-Christensen et al., 1997). Tissue was then cleared by immersing the leaf in boiling ethanol for 10 minutes. Leaves were then examined at 40X magnification. In the presence of hydrogen peroxide and peroxidase, D A B instantly polymerizes to a brown precipitate. 3.7. Confocal microscopy Confocal microscopy was carried out using a Leica TCS SP2 microscope. A krypton-argon laser (488, 568 and 647-nm lines) was used to discriminate between EGFP and E Y F P fluorescence. The bandwidth mirror settings for discriminating between the two signals were 493/518 (EGFP) and 585/612 (EYFP). E F Y P (512 nm) and EGFP (488 nm) excitation was observed and was confirmed empirically as well. The two channels were allocated false green (EGFP) and red (EYFP) colors. G F P fluorescence was observed with standard settings (excitation wavelength 488 nm). To observe G F P fluorescence in living leaf epidermal cells, 2 cm by 2 cm samples of leaf tissue were cut from agroinfiltrated N. benthamiana leaves, 1 day post-infiltration. The leaf samples were placed on a glass slide, a drop of water was applied on top of the samples and a cover slip was added. 3.8. Plant inoculations with viral RNA transcripts Synthetic C N V genomic R N A was produced by T7 R N A polymerase run-off transcription of a Swa/-linearized full-length C N V infectious clone (pK2/M5) as previously described (Rochon et al, 1991). Transcripts were used to inoculate four leaves of carborundum-dusted N. benthamiana plants at the six- to eight leaf stage. Transcripts were used to inoculate to four plants and leaves were used for peroxidase and D A B assays at 4dpi. Each experiment was repeated at least three times. 4. Results 4.1. GFP-tagged CNV p33 associates with peroxisomes in agroinfiltrated leaves of TV. benthamiana. The M V B s associated with tombusvirus infection have been suggested to be sites of virus replication (Appiano et al, 1986; Bleve-Zacheo et al, 1997; Rubino et al, 2001). Electron microscopy of CNV-infected TV. clevelandii leaves has indicated that C N V induces the formation of M V B s from peroxisomes (personal communication, D. Rochon). To assess whether C N V p33 associates with peroxisomes, the C N V p33 O R F was fused in-frame with that of GFP and placed under control of a dual 35S promoter in a binary vector (Fig. 3.1). This construct (p33/GFP) and a control construct containing the GFP O R F but lacking the p33 O R F were introduced into N. benthamiana leaf cells using agroinfiltration. Localization of G F P was assessed using confocal microscopy. Examination of p33/GFP agroinfiltrated cells indicated that fluorescence was associated with several small, circular, green fluorescent structures. Higher magnification clearly revealed that the subcellular structures were fluorescent at their periphery (Fig. 4.1 A , panel a). The organelles were 1.2-1.5 Cm in diameter, and were occasionally observed to be somewhat motile (not shown). Large aggregates of the small round structures were often observed (Fig. 4.IB, panel a). In addition, fluorescence appeared to be largely confined to the small circular structures. As expected, control cells expressing unfused GFP showed green fluorescence throughout the cytoplasm and nucleus; G F P was not seen in association with the small structures observed using p33/GFP constructs (not shown). A B Fig. 4.1. GFP-tagged C N V p33 localizes to the peroxisomal membrane in agroinfiltrated leaves of N. benthamiana. The upper and lower panels show two different areas of coinfiltrated leaves. In each panel 'a' shows G F P fluorescence, 'c' shows Y F P fluorescence (artificially coloured red - see Materials and Methods) and 'b' shows a merged image of both G F P and Y F P fluorescence. Panel B shows an aggregate of peroxisome which was 10 Cm in length. The size and shape of the fluorescent structures detected using p33/GFP agroinfiltration are consistent with the possibility that they represent peroxisomes. The scanning micrographs using merged images of the green fluorescence and the red autofluoroscence of chloroplasts showed that these spherical structures were present in the vicinity of chloroplasts (not shown).To assess if the structures do represent peroxisomes, N. benthamiana leaves were co-infiltrated with p33/GFP and p Y F P / S K L . The latter construct expresses yellow fluorescent protein (YFP) and targets to peroxisomes due to the presence of a C-terminal serine-lysine-leucine (SKL) tripeptide which is known to target proteins to the peroxisomal matrix (Titorenko et al, 2001). Since some overlap exists between the fluorescence spectra of G F P and Y F P , it was necessary to exclude fluorescence emissions where the overlap occurs. Also, since the yellow and green fluorescence is difficult to differentiate by eye, yellow fluorescence was artificially coloured red. Leaves co-in filtrated with p33/GFP and p Y F P / S K L showed colocalization of green and yellow fluorescence to the small circular organelles (Fig. 4.1A and B , panels b and c) observed in p33/GFP infiltrations (Fig. 4.1 A and B , panels a) indicating that p33/GFP targets to peroxisomes. Notably, however, fluorescence produced by p33/GFP was found only in association with the periphery of peroxisomes and not with the peroxisomal matrix as was observed in p Y F P / S K L infiltrations (see Fig. 4.1 A and B, panels a and c ). Aggregates of peroxisomes were often observed in p33/GFP infiltrated leaves (Fig. 4.IB, panels a-c). The same level of aggregation in p Y F P / S K L infiltrated leaves was not observed (not shown) raising the speculation that the aggregation may be specifically due to p33/GFP expression in the peroxisome membrane. unfractionated „ $ # 1 fractionated # 2 3 GFP > <p 4 PI P30 5 6 S30 p33/GFP PI P30 S30 7 8 9 Fig. 4.2. The p33/GFP fusion protein associates with membranes in infiltrated N. benthamiana plants. Extracts of leaf tissue infiltrated with G F P or p33/GFP were electrophoresed through a 12% S D S - P A G E gel and then blotted and probed with a G F P monoclonal antibody. Lanes 1-3 show total leaf extracts of GFP-, p33/GFP- and mockinfiltrated leaves. Lanes 4-6, show the PI, P30 and S30 fractions of GFP-infiltrated leaves and lanes 7-9 those of p33/GFP-infiltrated leaves. The PI and P30 lanes contain 5% of the total leaf extract whereas the S30 lane represents 3.75 % of the total leaf extract. The position of GFP and the p33/GFP fusion protein is indicated on the right. Molecular mass standards (BenchMark™ , Invitrogen) (not shown) were used to confirm that the bands correspond to the predicted GFP or p33/GFP fusion protein mass. buffer P30 S30 NaoCOj P30 S30 urea P30 KCI S30 P30 S30 - p33/GFP 1 2 3 4 5 6 7 8 Fig. 4.3. The p33/GFP fusion protein is tightly associated with membranes. The P30 fraction of C N V p33/GFP infiltrated leaves was either not treated (lanes 1 and 2) or treated with 0.1 M N a C 0 (lanes 3 and 4), 4 M urea (lanes 5 and 6) or 1 M KCI (lanes 7 2 3 and 8). Following treatment, extracts were centrifuged at 30,000 g and aliquots of the pellet (P30) and supernatant (S30) were electrophoresed, blotted onto P V D F membranes and detected with a G F P monoclonal antibody. Approximately equal amounts of each sample were analyzed. The position of the p33/GFP fusion protein is indicated on the right. Molecular mass standards (BenchMark™ , Invitrogen) (not shown) were used to confirm that the band corresponded to the predicted p33/GFP fusion protein. Our results thus far suggest that p33 may be specifically associated with the peripheral membranes of peroxisomes in C N V infections. 4.2. The p33/GFP fusion protein associates with membranes in infiltrated plants. The confocal microscopy results suggest that C N V p33 associates with peroxisomal membranes. To further ascertain the membrane localization of p33, cellular fractionation experiments were conducted using leaf tissue obtained from agroinfiltrated N. benthamiana plants. Leaves from plants infiltrated with p33/GFP were homogenized, filtered and separated into P I , P30 and S30 fractions using centrifugation. The PI fraction is enriched for nuclei and may also contain some intact cellular organelles. The P30 fraction consists primarily of smaller organelles and endoplasmic reticulum and the S30 fraction predominantly soluble cellular material. Aliquots of each fraction were then electrophoresed though a S D S - P A G E gel and the association of p33/GFP with different fractions was assessed by Western blot analysis using a G F P monoclonal antibody for detection. Fig. 4.2 shows that the p33/GFP fusion protein is predominantly in the P30 fraction (compare lanes 7-9). Unfused G F P was found primarily in the S30 fraction as expected (Fig. 4.2, compare lanes 4-6). The association of p33/GFP with the P30 fraction is consistent with the results obtained using confocal microscopy where p33/GFP was found to be on the periphery (membranes) of peroxisomes. It is noted that the p33/GFP protein was also found in the PI fraction. This may be due to the presence of large aggregates of peroxisomes that were often observed in p33/GFP infiltrated plants (Fig. 4.1, panel B). p33/GFP was not found to be associated with the S30 fraction. This is unexpected as some organellar breakage is expected to occur during leaf extraction and the S30 fraction would be expected to contain the membranes of the broken organelles.. 4.3. The p33/GFP fusion protein is tightly associated with membranes To further analyze the association of p33/GFP with membranes, the P30 fraction was treated with either 1 M KCI, 4 M urea or 0.1 M Na2C03, pH 10.5. These treatments are expected to dislodge proteins that are weakly or peripherally associated with membranes. Following treatment, the extracts were centrifuged at 30,000 g and protein associated with the P30 pellet (membrane) and P30 supernatant (soluble) fractions were assessed using S D S - P A G E analysis followed by Western blotting using a G F P monoclonal antibody for detection. It can be seen in Fig. 4.3 that p33/GFP was found only in the pellet fraction of each of the treatments. These results show that p33/GFP is tightly associated with cellular membranes. Taken together, our results support the notion that C N V p33 associates with the peroxisomal membrane as an integral protein in infected plants. 4.4. N. benthamiana leaves agroinfiltrated with p33/GFP develop necrotic-like patches. During the course of the experiments involving agroinfiltrations, we noted that the surface of p33/GFP infiltrated leaves frequently contained necrotic-like patches. Since C N V infected N. benthamiana typically produces necrotic symptoms, we further examined the p33/GFP infiltrated leaves for the possible presence of necrosis as this observation suggested to us that p33 may contribute to the induction of necrosis during C N V infections. To do this, several N. benthamiana plants were agroinfiltrated with p33/GFP. Fig. 4.4 (panel d) shows a typical result, wherein a p33/GFP infiltrated leaf contains necrotic-like patches. Experiments using mock- and pBin/GFP-infiltrated leaves did not produce the necrotic-like patches. The necrotic-like symptoms typically became visible 4-5 days post-infiltration and were only observed in the cells of N benthamiana agroinfiltrated leaves that were confirmed by fluorescence microscopy to be expressing p33/GFP (not shown). Leaves infiltrated with p Y F P / S K L were also examined and necrosis was not observed (data not shown), and therefore it is unlikely that the p33/GFP induced necrotic-like reaction is due to a non-specific effect of overexpression of p33/GFP in peroxisomes of agroinfiltrated N. benthamiana. 4.5. Phenol red assays to assess hydrogen peroxide production in leaf samples do not show a clear correlation between necrosis and levels of peroxide accumulation in control and p33/GFP infiltrated plants. Many previous studies have implicated increased peroxide accumulation in the development of necrosis in pathogen infected plants (Levine et al, 1994). Since peroxide metabolism occurs within peroxisomes (Titorenko et al, 2001), we wished to assess whether the necrotic like patches in p33/GFP infiltrated plants were associated with increased levels of peroxide, possibly as a result of the association of p33/GFP with peroxisomes. A n assay utilizing phenol red was used to quantify peroxide levels in p33/GFP infiltrated N. benthamiana leaves as previously described (Svalheim et al, 1993). As shown in Fig. 4.5, p33/GFP infiltrated leaves appear to show slightly higher levels of peroxide than pBin/GFP infiltrated leaves at 3-4 days post-infiltration. A T-test analysis was therefore conducted and the results of this analysis indicated that statistically significant differences between pBin/GFP and p33/GFP infiltrated plants occur at 3 and 4 days post-infiltration. Significant differences were also found between pBin/GFP and C N V at 4 and 5 days post-infiltration. However, the level of peroxide accumulation in p33/GFP and C N V was very small in comparison to that obtained in another study that used specific elicitors from cell walls of Phythophthora megasperma ( Svalheim and Robertsen, 1993). O f considerable significance to the observations made here, is the finding that G F P infiltrated plants accumulate very high levels of peroxide even when p33 is absent. Therefore the observations described in Fig. 4.5 appear to be largely due to either the presence of A. tumefaciens, pBin itself, or the high levels of GFP protein produced during agroinfiltration. Therefore, further experiments will need to be conducted to examine the potential role of peroxide accumulation in the development of necrosis in p33/GFP infiltrated plants (see Discussion). Fig. 4.4. N. benthamiana leaves agroinfiltrated with p33/GFP develop necrotic-like patches. Panels a-d show mock-, GFP-, C N V p20/GFP- and C N V p33/GFP- infiltrated leaves. Photographs were taken at 4 days post infiltration. O a y x p o s t i n f i l t r a t i o n (dpi) Fig. 4.5. p33/GFP infiltrated N. benthamiana leaves show a modest increase in the levels of hydrogen peroxide. Bars indicate the O D bioassay for measuring H2O2 5 9 0 obtained following the phenol red production in leaves. Each bar corresponds to the average of six treatments from two separate leaves in one experiment. Lines above the bar indicate the standard deviation. The numbers below each set of bars correspond to the number of days post-infiltration (or post-inoculation in the case of C N V ) of the indicated construct. Values obtained from mock-inoculated leaves were subtracted from each treatment prior to statistical analysis. A t-test was conducted to determine i f there are any statistically significant differences between the values obtained for the various constructs (see Results section). Fig. 4.6. p33/GFP infiltrated leaves accumulate peroxide as determined by D A B staining: Panel a shows G F P - and panel b shows p20/GFP-agroinfiltrated leaves. Panels c and d show CNV-inoculated and p33/GFP-agroinfiltrated leaves. Take-up and polymerization of D A B is indicated by the reddish-brown staining in the leaf tissue and signifies the production of hydrogen peroxide. A n additional experiment to assess the possibility of increased hydrogen peroxide production was done using the D A B (3,3'-diaminobenzidine) uptake method for in vivo detection of H 2 O 2 production in leaves (Thordal-Christensen et al, 1997). This procedure that has been widely used for assessing the involvement of increased peroxide production in the necrotic reaction of pathogen infected plants. In this procedure, peroxide production is measured by the take-up and polymerization of D A B in necrotic tissue which can be observed by examining leaves for the presence of dark-red staining. It can be seen in Fig. 4.6 (panels c and d) that staining does occur in the vascular tissue of both p33/GFP infiltrated leaves and in CNV-infected leaves (Fig. 4.6). The possibility that this observation relates to disruption of peroxisome function in p33/GFP agroinfiltrated or C N V infected plants will be discussed. 4.6. TV. benthamiana leaves agroinfiltrated with p20/GFP do not develop necroticlike patches. Previous experiments have suggested that the C N V p20 protein is involved in the production of necrosis in infected plants (Rochon et al, 1991). Similar experiments conducted with the homologous protein (pi 9) of the related virus, Tomato bushy stunt virus (TBSV) have also indicated that this protein is responsible for inducing necrosis (Scholthof et al, 1995a). However, in both cases, the effect of p20/pl9 was determined by expression of the protein from a viral genome and therefore the interpretation of the effect could be influenced by other viral factors. Since our results with p33/GFP infiltrations indicated that p33/GFP may be responsible for inducing necrosis in plants, we wished to further evaluate the role of C N V p20 in inducing necrosis by expressing p20 via agroinfiltration and independent of viral infection or expression of other viralencoded proteins. The subcellular location of C N V p20 was first assessed by agroinfiltration of a p20 G F P fusion protein (p20/GFP) in N. benthamiana leaves. Confocal microscopy of agroinfiltrated leaves indicated that the fusion protein was diffusely distributed in the cytoplasm with no apparent association with cellular organelles (data not shown). C N V p20/GFP infiltrated leaves were also examined as with p33/GFP infiltrated tissue for: 1) the production of necrosis on inoculated leaves; 2) increased production of H2O2 using the Phenol Red method and 3) increased H C»2 2 production using D A B staining. It can be seen in Fig. 4.4, (panel b) that p20/GFP infiltrated plants do not develop obvious signs of necrosis. In addition, in Fig. 4.5 and Fig. 4.6, (panel b) no evidence for increased H2O2 production was obtained (this was confirmed using a t-test analysis). These results indicate that under these experimental conditions and with the criteria used for assessing necrosis, that necrosis is not directly induced by p20 expression. 5. Discussion Viral genome replication plays a pivotal role in the life cycle of the virus and constitutes a critical step in viral disease development. The aim of the present study was to determine the subcellular location of the replicase associated C N V p33 in cells of N. benthamiana as part of a longer term goal to identify the cellular site of C N V replication. While previous biochemical studies have shown that C N V p33 (and its homologs in other tombusviruses) is associated with viral replication complexes (Nagy et al., 2000; Panaviene et al., 2004; Scholthof et al., 1995) the intracellular location of C N V p33 with cellular membranes during the course of C N V replication had not yet been determined at the onset of this study. 5.1 C N V p33/GFP targets to peroxisomes in agroinfiltrated plants. It has previously been shown that the N-terminal half of ORF1 (p33) of two tombusviruses, CIRV(p36) and C y R S V (p33), contain the determinants for the formation of M V B s (Burgyan et al., 1996; Rubino et al., 1998). The replicase proteins of these viruses have been shown to have M V B s derived from mitochondria and peroxisomes. (Burgyan et al., 1996). The thought that the peripheral vesicles of M V B s are the site of tombusvirus replication was derived from the observation that they: 1) appear in infected cells before virus particle accumulation (Appiano et al., 1981), contain fibrillar material consisting of double stranded R N A (Di Franco et al., 1984; Russo et al., 1983); 3) incorporate [ H] uridine (Appiano et al., 1986) and 4) contain viral replicase proteins 3 (Bleve-Zacheo et al., 1997). Electron microscopy (EM) of CNV-infected tissues show M V B s originating from a subcellular organelle which appeared to be a peroxisome since some of the M V B s contained what appeared to be crystals of catalase (personal communication, D. Rochon). The data described in this thesis demonstrates that the replicase-associated C N V p33 indeed targets to peroxisomes. Additionally, it is shown here, via confocal analysis, that targeting to the membrane of peroxisomes occurs. Taken together, our confocal and E M studies suggest that the membrane of peroxisomes is a possible site for assembly of the C N V replicase complex and that this assembly leads to the formation of M V B s . However, the manner in which p33 induces proliferation of membrane is not known. 5.2 C N V p33 is an integral membrane protein Verification and characterization of the membrane association of C N V p33 was conducted by cellular fractionation experiments (Fig. 4.2) where it was found that p33/GFP was specifically associated with the membrane fraction, but not the supernatant fraction. Further treatment of the P30 membrane fraction under conditions known to remove weakly bound proteins showed that p33/GFP was resistant to this treatment indicating that p33 has an integral membrane protein. Recently, C y m R S V p36 (Navarro et al, 2004) and C N V p33 (Panavas et al, 2005) were shown to be targeted to peroxisomes when expressed in yeast cells. However, the experiments described here were conducted in plant cells and therefore provide more convincing information regarding the actual site of p33 targeting in a plant host. The data provided here can also be interpreted to indicate that the cellular mechanisms underlying peroxisome targeting sites in cells is conserved among yeast and plants. 5.3 GNV p33 does not contain a clearly identifiable peroxisome targeting signal. The peroxisomal targeting signals differ according to whether the peroxisomal proteins are destined to the matrix or to the membrane (Rachubinski et al, 1995). Most peroxisomal matrix proteins contain a PTS1 signal consisting of the C-terminal tripeptide S K L (or essentially constitutes a tripeptide from the consensus sequence (S/T/A/G/C/N)(K/R/H)-(L/I/V/M/A/F/Y), whereas only a few have the N-terminal PTS2 signal which consists of the nonapeptide (R/K)(L/V/I)(X) (H/Q)(L/A). Examination of the C N V p33 5 sequence indicates that it contains neither a PTS1 nor a PTS2 signal. The membrane PTS (mPTS) involved in targeting peroxisomal membrane proteins is not defined, since a consensus sequence has not yet been identified. However, one to several transmembrane domains and stretches of positive amino acids in the proximity of the domains have been shown to be required. Many integral membrane proteins are synthesized on free polysomes in the cytosol and post-translationally targeted to, and inserted into, the peroxisomal membrane. This process involves (in order): (1) protection of hydrophobic transmembrane segments of membrane proteins from aggregation and maintenance of their import-competent conformations during and after synthesis in the cytosol; (2) targeting of proteins to the peroxisomal membrane which is mediated by targeting signals of the mPTSl type and/or cytosolic receptor(s); (3) docking to the peroxisomal membrane, which involves membrane-bound proteins and (4) A T P hydrolysis- independent insertion of proteins into the peroxisomal membrane, followed by their assembly within the membrane (see review by Titorenko et al, 2001 and references therein). _J?MA binding regions RPR molif Mt-r'ribi.ine A <<;n:hcnruj r e g i o n gi g- 4 4 / Ml Loop A MDI TMDM I •p.o B r \ 1 * " \ R d R p motifs 8 "* C p22 EBaMmali Oirr D imer r e a i o n D E di: ' TMOII: L OC H mai s..i i m 1 N 1 v" 'F' -' "' \ / 3-i • p-'. £o-1G:i r: K l "•: rnc'.il p33 dtmetization sites* 21 \ Peroxisome r v r i i i . ' - i r it- Predicted p33/membrane as 241045 'from Panaviene ?! a!. 2005, Panavas et at, 21103 topology Fig. 5.1.CNV p33 has two predicted transmembrane domains. Putative transmembrane domains (TMD) were predicted using the program H M M T O P (Tusnady et al., 2001; http://www.en/im.hu/hmmtop). (A) Diagrammatic representation of p92 indicating the location of T M D I and TMDII, a 29 aa hydrophilic "loop" between the domains, the R N A binding domains (includes the RPR motif) and the p33:p33 and p33:p92 dimerization regions. The numbers in the blue box indicate the position of the T M D s in the p33 protein R N A binding domain and p33:p33/p92 interaction domains are as predicted by Panavas et al., 2005. (B)Topology of C N V p33 in the peroxisome membrane based on H M M T O P predictions is shown. The H M M T O P "out" prediction is interpreted to mean the cytoplasmic face of the organelle and the " i n " prediction the inside or matrix of the organelle. The colouring scheme for the various domains is as in (A). Computer analysis of the 295 aa p33 sequence using the H M M T O P program described by Tusnady et al, (2001) suggested the presence of two 17 aa hydrophobic, domains long enough to span the membrane of peroxisomes. The N - and C-terminal regions were predicted to be on the "outside" of the membrane and therefore are interpreted as being on the cytoplasmic side of the membrane. This orientation is consistent with our suggestion that C N V p33 could be a transmembrane protein (Fig.5.1). A further prediction from the computer analysis is that the two T M D s are separated by a 29 aa hydrophilic loop which may protrude into the peroxisomal matrix (i.e., predicted by H M M T O P to be "inside"). It has recently been shown that C N V p33 contains 3 R N A binding motifs and also two regions involved in p33:p33 and p33:p92 dimerization (Panavas et al, 2005). A diagram summarizing the location of the various predicted domains on the linear sequence of p33 is shown in Fig. 5.1. In addition a schematic illustration of the potential topology of p33 with respect to the peroxisomal membrane is also shown. Several analyses have failed to indicate that C N V p33/GFP contains any conspicuous peroxisomal targeting region despite the fact that p33/GFP is clearly associated with peroxisomes in agroinfiltrated plants. This is similar to the findings reported by (Navarro et al, 2004)) regarding CymRSV p33 localization signals wherein obvious consensus signals thought to be characteristic of proteins targeted to peroxisomes were not evident. Panavas et al, (2005) found that the p33 N-terminal sequence does not affect its subcellular localization to peroxisomes in yeast, however it was found to play an important role in tombusvirus replication While membrane association is possibly a universal feature of positive-strand viral R N A replication, the mechanisms involved in targeting replication proteins and templates to specific intracellular membranes are largely unknown (Salonen et al, 2005). Determining the peroxisome membrane targeting signal in C N V p33 is an important area of research as it will provide further insight into membrane targeting signals as well as furthering the understanding of the structure and function of C N V p33. 5.4 C N V p33 may be involved in the induction of necrosis in infected plants. C N V infected N. benthamiana plants typically develop necrotic lesions on inoculated leaves and systemic symptoms develop at about 4-5 days post-inoculation. Necrosis, blackening and curling occurs at the base of the new leaves that were just developing at the time of inoculation. Symptoms then spread to other parts of the plant and to other leaves and eventually the plant succumbs to systemic necrosis. During our experiments directed towards localization of C N V p33 in cells, we noted that agroinfiltration of C N V p33/GFP in N. benthamiana leaves is associated with the formation of necrotic-like symptoms in leaves (Fig. .4.4). Using genetically engineered CymRSV and C I R V hybrid viruses indirect evidence has been obtained that the products of ORF1 in these viruses (equivalent to C N V p33) may play a significant role in the induction of necrosis while hybrids containing chimeric ORF1 were not able to induce lethal necrosis. It was also shown that elicitation of the necrotic phenotype requires the presence of both p33 and p 19 (the equivalent of C N V p20) (Burgyan et al, 2000). In addition, studies with Cucumber leafspot virus (CLSV), an aureusvirus that is closely related to the tombusviruses, showed that infections where p27 and p82 (the homologs of C N V p33 and p92) are the only C L S V proteins expressed, exhibit severe necrosis (Reade et al, 2002). Thus our data in conjunction with reports by of Burgyan et al, (2000) and Reade et al, (2002) suggest that p33 may be a determinant for necrosis among tombusviruses and aureusviruses. Previous work with C N V suggested that p20 is responsible for the development of necrosis. This was based on the observation that whereas infections with W T C N V in plants was associated with severe necrosis, plants infected with C N V p20 knock-out mutants failed to develop necrotic symptoms (Rochon et al, 1991). Similar results were obtained with other tombusviruses (Russo et al, 1994) as well as with the closely related aureusviruses (Reade et al, 2002). However, these experiments did not directly test p20 for its ability to induce necrosis, as p20 expression was always within the context of virus infection. The results of the p20/GFP agroinfiltration experiments (Fig. 4.4) show that p20 expression in leaves (in the absence of virus infection) does not result in observable necrotic symptoms. Therefore it seems likely that p20, on its own, does not induce symptoms during virus infection and, moreover, that p33 may instead be involved. The tombusvirus p20 protein has been demonstrated to be a powerful suppressor of the antiviral gene silencing response in plants through its ability to bind siRNAs (Voinnet, 2005). This property is regularly exploited by researchers to increase expression of foreign genes in plants via agroinfiltration (Voinnet, 2005), and to our knowledge there have been no reports that its use in agroinfiltration induces necrosis. This reinforces our observation that C N V p20 does not induce necrosis and indirectly supports the notion that p33 may be involved instead. We do not know why knock-out mutants of p20 in tombusviruses result in attenuation of necrosis. However, given that p20 is a suppressor of the gene silencing pathway, we propose that infections that lack p20 allow the host defense system to silence C N V viral R N A (through degradation) and thereby reduce levels of p33 expression and resultant necrosis. In T M V , the helicase domain of replicase protein has been shown to induce the N-mediated defense response in tobacco (Erickson et al, 1999). C N V p33 is important for C N V replication but it does not contain the motifs that are characteristic of viral helicases. Our results suggest that C N V p33 induces necrosis but that the presence of a helicase domain is not required. 5.5 Does C N V p33 expression in N. benthamiana result in hydrogen peroxide production? Using hydrogen peroxide assays we have shown that C N V p33/GFP agroinfiltrated tissues accumulate statistically higher levels of hydrogen peroxide (H2O2) compared to G F P or p20/GFP inoculated plants. In addition, necrotic tissue from C N V infected plants also accumulates higher levels of H2O2. However, in both cases, the increased level of peroxide production was very low in comparison to published studies using a similar method (Svalheim and Robertson, 1993), so the biological significance of the increased peroxide levels will require additional studies. Many different viral proteins have been identified as inducing symptoms in plants. These include the helicase domain of T M V (Erickson et al, 1999), the pi 9 protein of T B S V (Scholthof et al, 1995) and the T M V coat protein (Culver, 2002). There are probably many different mechanisms involved in the host response and the virus/host interaction leading to symptom development. Hydrogen peroxide (H2O2) is an often- used biological indicator for programmed cell death (Mittler et al, 1998). H2O2 from the oxidative burst plays a key role in the orchestration of a localized hypersensitive response during the expression of plant disease resistance (Levine et al, 1994). The peroxisomes contain enzymes that use molecular oxygen to oxidize various substrates, forming hydrogen peroxide (H2O2 ). Catalase, also a peroxisome-localized enzyme, efficiently decomposes H2O2 into H2O (Lopez-Huertas et al, 2000). H2O2 has been suggested to be a signaling molecule for the induction of the hypersensitive reaction (Dat et al, 2003; Kwon et al, 2003; Vandenabeele et al, 2003). Intracellular concentrations of H2O2 can be quantified spectrophotometrically by oxidation of the dye, phenol red (Svalheim et and Robertson, 1993) or by histochemical staining by D A B (Thordal-Christensen et al, 1997. These assays have been used to measure levels of H2O2 in necrotic tissue resulting from pathogen infection. In experiments to assess accumulation of H202 5 spectrophotometric quantification using the phenol red assay indicated that H2O2 levels were statistically significantly higher in p33/GFP infiltrated leaves compared to pBin/GFP at 3 (p= 0.0159) and 4 (p=0.0002) days post-infiltration. statistically significant differences were found between However, no pBin/GFP and p20/GFP infiltrated leaves at any day. Statistically significant differences in the levels of peroxide were also observed in comparisons between pBin/GFP infiltrated and CNV-infected tissue at the 4th (p= 0.00221 and 5th (p = 0.0482) day of the assay. Our data also suggest that H2O2 levels progressively increased in p33/GFP infiltrated tissues from 3 to 4 days, and a statistical analysis confirmed that the difference was significant. However, there was a considerable production of hydrogen peroxide in leaves when pBin/GFP itself was inoculated (see Fig. 4.5). Phenol red assays to assess hydrogen peroxide production in leaf samples failed to show a convincing correlation between necrosis and high levels of peroxide accumulation in control and p33/GFP infiltrated plants or C N V infected plants.. However, D A B staining with p33/GFP and C N V inoculated leaves at 4 dpi indicated peroxide accumulation occurred in p33/GFP infiltrated and C N V infected plants but not control plants (Fig 4.6). The association of C N V p33 with peroxisomes and its ability to induce necrosis-like symptoms in infiltrated plants suggests that p33 may contribute to the necrotic-like reaction via disruption of peroxisomal function, but the involvement of peroxide accumulation in the induced necrosis will require further experimentation. D A B staining was visible prior to detectable necrosis (Fig. 4.6). This suggests that increased levels of peroxide are associated with the subsequent necrosis. A time course of the D A B staining would be a useful means for further examining the correlation between hydrogen peroxide levels and necrosis. Using the phenol red assay an overall increase in the average level of peroxide was apparent from 1-4 dpi but then at 5 dpi levels appeared to drop. The drop at 5 dpi in hydrogen peroxide levels could be due to death of the cell tissues. These results indicate that expression of C N V p33/GFP in N. benthamiana leaves brought about an increase of hydrogen peroxide that preceded cell death. However it should be noted that using the phenol red assay the amount hydrogen peroxide accumulation was much lower than that observed in other similar studies using elicitors or pathogens (Svalheim and Robertson, 1993; Malolepsza et al, 2005). Therefore further experimentation to explain the basis for the necrosis produced in p33/GFP inoculated plants is required. Our results (Fig. 4.1) show that p33/GFP agroinfiltration is associated with aggregation of peroxisomes. The aggregation of the peroxisomes could result from extensive dimerization (Fig 5.1) (Panavas et al, 2005) of membrane bound p33 from different peroxisomes. Regardless of the basis for peroxisomal aggregation, it is not known i f aggregation occurs in natural C N V infections or if aggregation is merely a reflection of overexpression of p33 in cells. Recently it has been shown that the C N V coat protein (CP) targets to chloroplasts in N. benthamiana cells and that this targeting may reflect the site of C N V particle disassembly (Rochon, unpublished observations). It is interesting to note that the R domain of the C N V coat protein, which binds virion R N A , has a putative peroxisomal targeting sequence. It is possible that after virus disassembly the coat protein may assist in viral R N A targeting to peroxisomes for subsequent replication. Recently, it has been predicted that threshold levels of C N V p33 are required for recruitment of the viral R N A into replication complexes (Pogany et al, 2005). Also, in CIRV, the level of viral R N A replication was shown to be proportional to R N A polymerase levels and depended on a threshold concentration of p36 (Pantaleo et al, 2004). C N V p33 is one of the first proteins synthesized in virus infected cells and it is usually present at 20 times the level of its read-through product, p92 (Scholthof et al, 1995). When p33 is expressed in the cell it causes severe necrosis of the plant tissues as shown in our experiments. High amounts of C N V p33 may therefore destroy cells even before the virus is able to complete its life cycle. Therefore, when expressed in the context of virus infection, it is likely that the amount of p33 synthesized is regulated by the other viral genes to ensure that virus can complete its replicative cycle. Taken together, the data described in this thesis suggest that replicase-associated C N V p33 localizes to peroxisomes. In addition, the data suggest that p33 appears to be responsible, on its own, for the induction of necrosis in C N V infected cells. It is possible that increased levels of peroxide in p33 agroinfiltrated leaves as determined by D A B staining suggests that the necrosis may be a result of increased peroxide production. Further experiments will be required to strengthen and validate these suggestions. Bibliography 1. Ahlquist, P., Noueiry, A . , Lee, W. M . , Kushner, D. B . & Dye, B . T. (2003). Host factors in positive-strand R N A virus genome replication. J Virology 11, 81818186. 2. Appiano, A . , D'Agostino, G., Bassi, M . , Barbieri, N . , Viale, G . & Dell'Orto, P. (1986). Origin and function of tomato bushy stunt virus-induced inclusion bodies. II. Quantitative electron microscope autoradiography and immunogold cytochemistry. J Ultrastructure Res 97, 31-38. 3. Appiano, G., D'Agostino, P., A , R. & Pennazio, S. (1981). Sequence of cytological events during the process of local lesion formation in the tomato bushy stunt virus-Gomphrena globosa hypersensitive system. J Ultrastructure Res 16, 173-180. 4. Bienz, K . , Egger, D. & Pasamontes, L. (1987). Association of polioviral proteins of the P2 genomic region with the viral replication complex and virus induced membrane synthesis as visualized by electron microscopic immunocytochemistry and autoradiography. Virology 160. 5. Bienz, K . , Egger, D., Pfister, T. & Troxler, M . (1992). Structural and functional characterization of the poliovirus replication complex. J Virol 66, 2740-2747. 6. Bleve-Zacheo, T., Rubino, L . , Melillo, M . T. & Russo, M . (1997). The 33K protein encoded by cymbidium ringspot tombusvirus localizes to modified peroxisomes of infected cells and of uninfected transgenic plants. J Plant Path 19, 197-202. 7. Buck, K . W. (1996). Comparison of the replication of positive-stranded R N A viruses of plants and animals. Adv Virus Res 47, 159-251. 8. Burgyan, J., Rubino, L . & Russo, M . (1996). The 5'-terminal region of a tombusvirus genome determines the origin of multivesicular bodies. J Gen Virol 11, 1967-1974. 9. Burgyan, J., Hornyik, C , Szittya, G., Silhavy, D. & Bisztray, G . (2000). The ORF1 products of tombusviruses play a crucial role in lethal necrosis of virusinfected plants. J Virology 74, 10873-10881. 10. Carette, J. E., Van Lent, J., MacFarlane, S. A . , Wellink, J. & Van Kammen, A . (2002). Cowpea mosaic virus 32- and 60-kilodalton replication proteins target and change the morphology of endoplasmic reticulum membranes. J Virol 76, 62936301. 11. Chen, H . , Nelson, R. S. & Sherwood, J. L . (1994). Enhanced recovery of transformants of Agrobacterium tumefaciens after freeze-thaw transformation and drug selection. Biotechniques 16, 664-668, 670. 12. Culver, J. N . (2002). Tobacco mosaic virus assembly and disassembly: determinants in pathogenicity and resistance. Annu Rev Phytopathol 40, 287-308. 13. Dat, J. F., Pellinen, R., Beeckman, T., Kangasjarvi, J., Langebartels, C , Inze, D. & Van Breusegem, F. (2003). Changes in hydrogen peroxide homeostasis trigger an active cell death process in tobacco. Plant J33, 621-632. 14. Di Franco, A . , Russo, M . & Martelli, G . P. (1984). Ultrastructure and origin of MVBsinduced by carnation Italian ringspot virus. J Gen Virol 65, 1233-1237. 15. Elazar, M . , Liu, P., Rice, C. M . & Glenn, J. S. (2004). A n N-terminal amphipathic helix in hepatitis C virus (HCV) NS4B mediates membrane association, correct localization of replication complex proteins, and H C V R N A replication. J Virol 78,11393-11400. 16. Erickson, F., Holzberg, S., Calderon-Urrea, A . , Handley, V . , Axtell, M . , Corr C. & Baker, B. (1999). The helicase domain of the T M V replicase proteins induces the N-mediated defence response in tobacco. Plant J Apr; 18(1), 67-75. 17. Fisher, L . C. & Pei, G . K . (1997). Modification of PCR based Site -Directed Mutagenesis Method. Biotechniques 23, 570-574. 18. Froshauer, S., Kartenbeck, J. & Helenius, A . (1988). Alphavirus R N A replicase is located on the cytoplasmic surface of endosomes and Iysosomes. J Cell Biol 6, 2075-2086. 19. Guo, H . S. & Ding, S. W. (2002). A viral protein inhibits the long range signaling activity of the gene silencing signal. The EMBO Journal 21, 398-407. 20. Hagiwara, Y . , Komoda, K . , Yamanaka, T., Tamai, A . , Meshi, T., Funada, R., Tsuchiya, T., Naito, S. & Ishikawa, M . (2003). Subcellular localization of host and viral proteins associated with tobamovirus R N A replication. The EMBO J 22, 344-353. 21. Heath, M . C. (2000). Hypersensitive response-related death. Plant Mol Biol Oct;44(3), 321-334. 22. Kaariainen, L . & Ahola, T. (2002). Functions of alphavirus nonstructural proteins in R N A replication. Prog Nucleic Acid Res Mol Biol 71,187-222. 23. Koncz, C. & Schell, J. (1986). The promoter of T i - D N A gene controls the tissuespecific expression of chimaeric genes by a novel type of Agrobacterhim binary vector. Mol Gen Genet 204, 383-396. 24. Kwon, S. H . , Pimentel, D. R., Remondino, A . , Sawyer, D. B . & Colucci, W. S. (2003). H2O2 regulates cardiac myocyte phenotype via concentration-dependent activation of distinct kinase pathways. J Mol Cell Cardiol 35, 615-621. 25. Lee, S. K . , Dabney-Smith, C , Hacker, D. L . & Bruce, B. D. (2001). Membrane activity of the southern cowpea mosaic virus coat protein: the role of basic amino acids, helix-forming potential, and lipid composition. Virology 291, 299-231. 26. Levine, A . , Tenhaken, R., Dixon, R. & Lamb, C. (1994). H202 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-593. 27. Lopez-Huertas, E., Charlton, W. L . , Johnson, B., Graham, I. A . & Baker, A . (2000). Stress induces peroxisome biogenesis genes. The EMBO Journal 19, 6770-6777. 28. Mackenzie, J. M . , Jones, M . K . & Westaway, E. G . (1999). Markers for transGolgi membranes and the intermediate compartment localize to induced membranes with distinct replication functions in flavivirus-infected cells. J Virol 73. 29. Makkouk,. K . M . , Koenig, R. & Leseman, D. E. (1981). Characterization of a tombusvirus isolated from eggplant. Phytopathology 71, 572-577. 30. Malolepsza U , Rozalska S. Nitric oxide and hydrogen peroxide in tomato resistance. Nitric oxide modulates hydrogen peroxide level in 0 hydroxyethylorutin-induced resistance to Botrytis cinerea in tomato.Plant Physiol Biochem. 2005 Jun;43(6):623-35. 31. Martelli, G . P., Gallitelli, D. & Russo, M . (1988). Tombusviruses. New York: Plenum Publishing Corp. 32. Matthews, R E F 1992. Fundamentals of Plant Virology. Academic Press, N Y . 403 PP33. Miller, D. J., Schwartz, M . D. & Ahlquist, P. (2001). Flock house virus R N A replicates on outer mitochondrial membranes in Drosophila cells. J Virology 75, 11664-11676. 34. Miller, D . J., Schwartz, M . D., Dye, B . T. & Ahlquist, P. (2003). Engineered retargeting of viral R N A replication complexes to an alternative intracellular membrane. J Virol 11, 12193-12202. 35. Mittler, R., Feng, X . & Cohen, M . (1998). Post-transcriptional suppression of cytosolic ascorbate peroxidase expression during pathogen-induced programmed cell death in tobacco. Plant Cell 10, 461-473. 36. Nagy, P. & Pogany, J. (2000). Partial purification and characterization of Cucumber necrosis virus and Tomato bushy stunt virus RNA-dependent R N A polymerases: similarities and differences in template usage between tombusvirus and carmovirus RNA-dependent R N A polymerases. Virology 276 (2), 279-288. 37. Navarro, B., Rubino, L . & Russo, M . (2004). Expression of the Cymbidium ringspot virus 33-kilodalton protein in Saccharomyces cerevisiae and molecular dissection of the peroxisomal targeting signal. J Virology 78, 4744-4752. 38. Noueiry, A . O. & Ahlquist, P. (2003). Brome mosaic virus R N A replication: revealing the role of the host in RNA virus replication. Annu Rev Phytopathol 41, 77-98. 39. Oster, S. K . , Wu, B . & White, K . A . (1998). Uncoupled expression of p33 and p92 permits amplification of tomato bushy stunt virus RNAs. J Virol 72, 58455851. 40. Panavas, T., Pogany, J. & Nagy, P. D. (2002). Internal initiation by the cucumber necrosis virus RNA-dependent R N A polymerase is facilitated by promoter-like sequences. Virology 296, 275-287. 41. Panavas, T. & Nagy, P. D. (2003). Yeast as a model host to study replication and recombination of defective interfering R N A of Tomato bushy stunt virus. Virology 314(1), 315-325. 42. Panavas, T., Hawkins C M . , Panaviene Z. & Nagy P.D. (2005). The role of the p33:p33/p92 interaction domain in R N A replication and intracellular localization of p33 and p92 proteins of Cucumber necrosis tombusvirus. Virology 338, 81-95. 43. Panaviene, Z., Baker, J. M . & Nagy, P. D. (2003). The overlapping RNA-binding domains of p33 and p92 replicase proteins are essential for tombusvirus replication. Virology 308, 191-205. 44. Panaviene, Z. & Nagy, P. D. (2003). Mutations in the RNA-binding domains of tombusvirus replicase proteins affect R N A recombination in vivo. Virology 317, 359-372. 45. Panaviene, Z., Panavas, T., Serva, S. & Nagy, P. D. (2004). Purification of the cucumber necrosis virus replicase from yeast cells: role of coexpressed viral R N A in stimulation of replicase activity. J Virol 78, 8254-8263. 46. Pang, S. Z., Nagpala, P., Wang, M . , Slightom, J. L . & Gonsalves, D. (1992). Resistance to heterologous isolates of tomato spotted wilt virus in transgenic tobacco expressing its nucleocapsid protein gene. Phytopathology 82, 1223-1229. 47. Pantaleo, V., Rubino, L . & Russo, M . (2004). The p36 and p95 replicase proteins of Carnation Italian ringspot virus cooperate in stabilizing defective interfering R N A . J Gen Virol 85, 2429-2433. 48. Pogany, J., Fabian, M . R., White, K . A . & Nagy, P. D. (2003). A replication silencer element in a plus-strand R N A virus. The EMBO Journal 22, 5602-5611. 49. Pogany, J., White, K . A . & Nagy, P. D. (2005). Specific binding of tombusvirus replication protein p33 to an internal replication element in the viral R N A is essential for replication. J Virol 79, 4859-4869. 50. Prod'homme, D., Jakubiec, A . , Tournier, V . , Drugeon, G . & Jupin, I. (2003). Targeting of the turnip yellow mosaic virus 66K replication protein to the chloroplast envelope is mediated by the 140K protein. J Virol 77, 9124-9135. 51. Rachubinski, R. A . & Subramani, S. (1995). How proteins penetrate peroxisomes. Cell 83, 525-528. 52. Rajendran, K . S. & Nagy, P. D. (2003). Characterization of the RNA-binding domains in the replicase proteins of tomato bushy stunt virus. J Virology 11, 9244-9258. 53. Rajendran, K . S. & Nagy, P. D. (2004). Interaction between the replicase proteins of Tomato bushy stunt virus in vitro and in vivo. Virology 326, 250-261. 54. Rajendran, K . S. & Nagy, P. D . (2005). Kinetics and functional studies on interaction between the replicase proteins of Tomato Bushy Stunt Virus: Requirement of p33:p92 interaction for replicase assembly. Virology Oct 19. 55. Reade, R., Miller, J., Robbins, M . , Xiang, Y . & Rochon, D. (2002). Molecular analysis of the cucumber leafspot virus genome. Virus Research 91, 171-179. 56. Restrepo-Hartwig, M . A . & Ahlquist, P. (1996). Bromo mosaic virus helicaseand polymerase-like proteins colocalize on the endoplasmic reticulum at sites of viral R N A synthesis. J Virology 70, 8908-8916. 57. Restrepo-Hartwig, M - A . & Ahlquist, P. (1999). Brome mosaic virus R N A replication proteins l a and 2a colocalize and l a independently localizes on the yeast endoplasmic reticulum. J Virol 73, 10303-10309. 58. Rochon, D. M . & Tremaine, J. H . (1989). Complete nucleotide sequence of the cucumber necrosis virus genome. Virology 169, 251-259. 59. Rochon, D. M . & Johnston, J. C. (1991). Infectious transcripts from cloned cucumber necrosis virus c D N A : evidence for a bifunctional subgenomic m R N A . Virology 181, 656-665. 60. Rohozinski, J. & Hancock, J. M . (1996). Do light-induced pH changes within the chloroplast drive turnip yellow mosaic virus assembly. J Gen Virol 77, 163-165. 61. Rubino, L . & Russo, M . (1998). Membrane targeting sequences in tombusvirus infections. Virology 252, 431-437. 62. Rubino, L., Weber-Lotfi, F., Dietrich, A . , Stussi-Garaud, C. & Russo, M . (2001). The open reading frame 1-encoded ('36K') protein of Carnation Italian ringspot virus localizes to mitochondria. J Gen Virol 82, 29-34. 63. Russo, M . , Di Franco, A . & Martelli, G . P. (1983). The fine structure of cymbidium ringspot virus infections in host tissues. III. Role of peroxisomes in the genesis of multivesicular bodies. J Ultrastructure Res 82, 52-63. 64. Russo, M . , Burgyan, J. & Martelli, G . P. (1994). Molecular biology of tombusviridae. Adv Virus Res 44, 381-428. 65. Rust, R. C , Landmann, L . , Gosert, R., Tang, B . L . , Hong, W., Hauri, H . P., Egger, D. & Bienz, K . (2001). Cellular COPII proteins are involved in production of the vesicles that form the poliovirus replication complex. J Virol 75, 98089818. 66. Salonen, A . , Ahola, T. & Kaariainen, L . (2005). Viral R N A replication in association with cellular membranes. Curr Top Microbiol Immunol 285, 139-173. 67. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N . Y . 68. Schaad, M . C , Jensen, P. E. & Carrington, J. C. (1997). Formation of plant R N A virus replication complexes on membranes: role of an endoplasmic reticulumtargeted viral protein. The EMBO Journal 16, 4049-4059. 69. Scholthof K B , Scholthof H.B & A . O , J. (1995). The tomato bushy stunt virus replicase proteins are coordinately expressed and membrane associated. Virology 208, 365-369. 70. Scholthof, H . B., Scholthof, K . B . & Jackson, A . O. (1995). Identification of tomato bushy stunt virus host-specific symptom determinants by expression of individual genes from a potato virus X vector. Plant Cell Aug;7(8), 1157-1172. 71. Schwartz, M . , Chen, J., Janda, M . , Sullivan, M . , Den Boon, J. & P., A . (2002). A positive-strand R N A virus replication complex parallels form and function of retrovirus capsids. Mol Cell Mar;9(3), 505-514. 72. Schwartz, M . , Chen, J., Lee, W. M . , Janda, M . & Ahlquist, P. (2004). Alternate, virus-induced membrane rearrangements support positive-strand R N A virus genome replication. P roc Natl Acad Sci USA 101, 11263-11268. 73. Simon, A . E., Roossinck, M . J. & Havelda, Z . (2004). Plant virus satellite and defective interfering RNAs: new paradigms for a new century. Annu Rev Phytopathol 42,415-437. 74. Svalheim, O. & Robertsen, B. (1993). Elicitation of H202 production on cucumber hypocotyl segements by oligo-l,4-a-D-galacturonides and an oligo-Bglucan preparation from cell walls of Phythophthora megasperma f.sp. glycinea. Physiologia Plantarum 88, 675-681. 75. Thordal-Christensen, H . , Zhang, Z., Wei, Y . & Collinge, D. B . (1997). Subcellular localization of H202 in plants. H202 accumulation in papillae and hypersensitive response during the barley powdery mildew interaction. Plant J11, 1187-1194. 76. Titorenko, V . I. & Rachubinski, R. A . (2001). The life cycle of the peroxisome. Nature Reviews Molecular Cell Biology 2, 357-368. 77. Turner, K . A . , Sit, T. L , Callaway, A . S., Allen, N . S. & Lommel, S. A . (2004). Red clover necrotic, mosaic virus replication proteins accumulate at the endoplasmic reticulum. Virology 320, 276-290. 78. Tusnady, G . E. & Simon, I. (2001). The H M M T O P transmembrane topology prediction server. Bioinformatics 17, 849-850. 79. Van Engelen, F. A . , Molthoff, J. W., Conner, A . J., Nap, J. P., Pereira, A . & Stiekema, W. J. (1995). pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res 4, 288-290. 80. Vandenabeele, S., Van Der Kelen, K . , Dat, J. & other authors (2003). A comprehensive analysis of hydrogen peroxide-induced gene expression in tobacco. Proc Natl Acad Sci U SA 100, 16113-16118. 81. Voinnet, O. (2005). Non-cell autonomous R N A silencing. FEBS Lett Oct 31, 5858-5871. 82. Whitham, S., McCormick, S. & Baker, B . (1996). The N gene of tobacco confers resistance to tobacco mosaic virus in transgenic tomato. Proc Natl Acad Sci Aug 6;93(16), 8776-8781. 83. Whitham, S. A . & Wang, Y . (2004). Roles for host factors in plant viral pathogenicity. Curr Opin Plant Biol Aug;7(4), 365-371.
- Library Home /
- Search Collections /
- Open Collections /
- Browse Collections /
- UBC Theses and Dissertations /
- The replicase associated Cucumber necrosis virus p33...
Open Collections
UBC Theses and Dissertations
Featured Collection
UBC Theses and Dissertations
The replicase associated Cucumber necrosis virus p33 targets to peroxisomes and is associated with the… Singh, Bhavana 2005
pdf
Page Metadata
Item Metadata
Title | The replicase associated Cucumber necrosis virus p33 targets to peroxisomes and is associated with the induction of necrosis in agro-infiltrated plants |
Creator |
Singh, Bhavana |
Date Issued | 2005 |
Description | Replication of Cucumber necrosis virus (CNV) RNA requires two viral-encoded proteins, p33 and its read-through product p92, both of which are believed to be components of CNV replicase enzyme. In this study we have investigated the subcellular location of CNV p33 in order to gain further insight into the CNV replication process. A p33/GFP fusion protein was cloned in an Agrobacterium tumefaciens binary vector and used to agroinfiltrate leaves of Nicotiana benthamiana. Co-infiltration experiments using a YFP-labeled peroxisomal marker (pYFP-SKL) along with confocal microscopy showed that the p33/GFP fusion protein targets to the peroxisomal membrane. In addition, peroxisomes of p33/GFP inoculated cells often showed a high level of aggregation. We also report that patches of necrosis-like symptoms develop on p33/GFP infiltrated leaves suggesting that p33 contributes to the necrotic symptoms typically observed in CNV-infected plants. Similar agroinfiltration experiments were conducted with CNV p20 which is the viral suppressor of gene silencing and a protein previously suggested to modulate symptom induction. The results indicate that p20 is not capable of inducing necrotic-like symptoms on its own in agroinfiltrated plants. Phenol red assays to assess'hydrogen peroxide production in leaf samples failed to show a clear correlation between necrosis and levels of peroxide accumulation in control and p33/GFP infiltrated plants. However, the DAB staining method indicated that peroxide accumulation occurred in p33/GFP infiltrated and CNV infected plants but not control plants. The association of CNV p33 with peroxisomes and its ability to induce necrosis-like symptoms in infiltrated plants suggests that p33 may contribute to the necrotic-like reaction via disruption of peroxisomal function. However, the involvement of peroxide accumulation in necrosis will require further experimentation. |
Genre |
Thesis/Dissertation |
Type |
Text |
Language | eng |
Date Available | 2010-01-16 |
Provider | Vancouver : University of British Columbia Library |
Rights | For non-commercial purposes only, such as research, private study and education. Additional conditions apply, see Terms of Use https://open.library.ubc.ca/terms_of_use. |
DOI | 10.14288/1.0092875 |
URI | http://hdl.handle.net/2429/18289 |
Degree |
Master of Science - MSc |
Program |
Plant Science |
Affiliation |
Land and Food Systems, Faculty of |
Degree Grantor | University of British Columbia |
Graduation Date | 2005-11 |
Campus |
UBCV |
Scholarly Level | Graduate |
Aggregated Source Repository | DSpace |
Download
- Media
- 831-ubc_2006-0107.pdf [ 4.79MB ]
- Metadata
- JSON: 831-1.0092875.json
- JSON-LD: 831-1.0092875-ld.json
- RDF/XML (Pretty): 831-1.0092875-rdf.xml
- RDF/JSON: 831-1.0092875-rdf.json
- Turtle: 831-1.0092875-turtle.txt
- N-Triples: 831-1.0092875-rdf-ntriples.txt
- Original Record: 831-1.0092875-source.json
- Full Text
- 831-1.0092875-fulltext.txt
- Citation
- 831-1.0092875.ris
Full Text
Cite
Citation Scheme:
Usage Statistics
Share
Embed
Customize your widget with the following options, then copy and paste the code below into the HTML
of your page to embed this item in your website.
<div id="ubcOpenCollectionsWidgetDisplay">
<script id="ubcOpenCollectionsWidget"
src="{[{embed.src}]}"
data-item="{[{embed.item}]}"
data-collection="{[{embed.collection}]}"
data-metadata="{[{embed.showMetadata}]}"
data-width="{[{embed.width}]}"
async >
</script>
</div>

http://iiif.library.ubc.ca/presentation/dsp.831.1-0092875/manifest