Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Tumor necrosis factor receptor type-2 (p75) functions as a co-stimulator of antigen-driven T cell responses Kim, Edward Yong 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-200025.pdf [ 14.64MB ]
Metadata
JSON: 831-1.0092866.json
JSON-LD: 831-1.0092866-ld.json
RDF/XML (Pretty): 831-1.0092866-rdf.xml
RDF/JSON: 831-1.0092866-rdf.json
Turtle: 831-1.0092866-turtle.txt
N-Triples: 831-1.0092866-rdf-ntriples.txt
Original Record: 831-1.0092866-source.json
Full Text
831-1.0092866-fulltext.txt
Citation
831-1.0092866.ris

Full Text

TUMOR NECROSIS FACTOR RECEPTOR TYPE-2 (p75) FUNCTIONS AS A CO-STIMULATOR OF ANTIGEN-DRIVEN T C E L L RESPONSES by E D W A R D Y O N G K I M B.Sc. (Hons), University of British Columbia, 1999 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Microbiology and Immunology) THE UNIVERSITY OF BRITISH C O L U M B I A August 2006 © Edward Yong Kim, 2006 i i Abstract Co-stimulation is a fundamental mechanism for self-nonself discrimination in adaptive immunity and encompasses a remarkably dynamic system of receptor-ligand interactions that are spatially and temporally regulated to achieve fine-tuning of T cell responses. In addition to members of the CD28 superfamily, T cell co-stimulation can also be mediated through members of the T N F receptor (TNFR) superfamily. Although TNFcx/TNF receptor-2 (TNFR2) interactions were shown to be capable of augmenting T cell proliferation, TNFR2-deficient mice were initially reported to have normal T and B cell compartments, with no apparent defect in T cell function. This thesis re-visited the question applying gene-targeted and T C R transgenic systems to examine the putative co-stimulatory role for T N F a / T N F R 2 in controlling T cell responses in vitro and in vivo. M y results demonstrate that T N F R 2 is an important co-stimulatory molecule for both C D 4 + and C D 8 + T cells in promoting IL-2 induction, lowering the activation threshold, and promoting early survival for the dividing population during primary expansion. T N F R 2 functions non-redundant of CD28, as T N F R 2 is necessary to sustain A K T and N F K B activation, as well as to promote B C 1 - X L expression. C D 8 + T C R transgenic T cells deficient in T N F R 2 exhibited dramatic reduction in clonal expansion in vivo upon recombinant Listeria monocytogenes ( L M ) challenge, which correlated with a survival defect of responding cells and diminished Bcl-2 and survivin expression. The frequency of LM-specific C D 4 and C D 8 effector T cells was diminished in T N F R 2 7 " mice upon primary challenge with recombinant L M , and led to the generation of a smaller pool of memory T cells. Moreover, TNFR2-deficient mice were more susceptible to a high dose of primary challenge with L M correlating with a marked reduction in the LM-specific iii effector T cell pool in vivo. Thus, T N F R 2 promotes adaptive immunity as a co-stimulator of T cell responses in both C D 4 + and C D 8 + subsets, and represents an interesting therapeutic target for modulating T cell immunity in disease contexts. IV T a b l e o f C o n t e n t s Abstract i i Table of Contents iv List of Figures -. vi List of Abbreviations v i i i Acknowledgements • x Preface xi C h a p t e r 1 I n t r o d u c t i o n 1 1.1 Preface •••• 1 1.2 T cell co-stimulation 2 1.2.1 Self-tolerance: two-signal model 2 1.2.2 CD28/B7 pathway in T cell responses 3 1.2.3 CD28 in .Thl /Th2 differentiation '. 5 1.2.4 CD28/B7 co-stimulation in autoimmune disease models 6 1.2.5 CD28 signal transduction 9 1.2.6 Signal 2 not solely defined by CD28 12 1.2.7 Danger signals induce a myriad of co-stimulatory ligands 13 1.3 T N F receptor superfamily and co-stimulation 14 1.3.1 T N F a in the immune system 14 1.3.2 Co-stimulatory members of the T N F R superfamily 15 1.3.3 Expression and function of T N F R superfamily in T cells 16 1.3.4 T N F R in co-stimulating primary T-cell responses 17 1.3.5 T N F R signal transduction 20 1.3.6 T N F R 2 as a putative T cell co-stimulatory molecule 22 1.3.7 Summary of thesis 24 1.4 References 28 C h a p t e r 2 T u m o r nec ros is f ac to r recep to r type-2 (p75) l owers the t h r e s h o l d o f T ce l l ac t i va t i on 40 2.1 Preface '. 40 2.2 Introduction 41 2.3 Materials and Methods 45 2.4 Results .' 49 2.5 Discussion 58 2.6 Acknowledgements 62 2.7 Figures 63 2.8 References 74 V Chapter 3 Critical role of tumor necrosis factor receptor type-2 (p75) as a co-stimulator for IL-2 induction and T cell survival: a functional link to CD28 77 3.1 Preface '.' 77 3.2 Introduction 78 3.3 Materials and Methods 82 3.4 Results '. 87 3.5 Discussion • 96 3.6 Acknowledgements 103 3.7 Figures 104 3.8 References I l l Chapter 4 Tumor necrosis factor receptor type-2 (p75) functions as a co-stimulator for antigen-driven T cell responses in vivo 116 4.1 Preface •. 116 4.2 Introduction 117 4.3 Materials and Methods.: 121 4.4 Results 124 4.5 Discussion > 133 4.6 Acknowledgements 137 4.7 Figures 138 4.8 References 149 Chapter 5 General discussion and perspectives 153 5.1 TNFR-mediated co-stimulation in T cell responses 153 5.1.1 Role of co-stimulation in T c e l l expansion and survival 153 5.1.2 Role of co-stimulation for directing effector T cell differentiation 156 ~ 5.1.3 Role of co-stimulation in T cell memory 158 5.2 T N F R as a potential therapeutic target of autoimmunity 160 5.2.1 Asthma 160 5.2.2 Rheumatoid arthritis 163 5.3 Concluding remarks 165 5.4 Figures • 167 5.5 References.. 169 i V I Lis t of Figures Figure 2.1 Proliferative response to TCR cross-linking is reduced in lymph node T cells from TNFR2" / _ mice '. 63 Figure 2.2 TNFR2 lowers the threshold of activation for T cell proliferation in response to TCR cross-linking 64 Figure 2.3 (A) CD8 + T cells deficient in TNFR2 are resistant to activation-induced cell death. (B) TNFR2-deficient CD4 + T cells are not resistant to activation-induced cell death 65 Figure 2.4 TNFR2"'" CD8 + T cells are more susceptible to apoptosis when stimulated with anti-CD3 without exogenous IL-2 66 Figure 2.5 TNFR2_ /~ CD8 + T cells display marked reduction in the proportion that undergo division in response to TCR cross-linking 67 Figure 2.6 CD28 co-stimulation partially rescues the hypo-proliferative response of TNFR2-deficient CD8 + T cells 68 Figure 2.7 Induction of CD25 and CD69 expression as well as blastogenesis in response to TCR cross-linking occurs with delayed kinetics in TNFR2"7" CD8 + T cells 69 Figure 2.8 TNFR2"7" CD8 + T cells display a marked reduction in the level of IL-2 produced in response to TCR cross-linking 70 Figure 2.9 TNFa production in response to TCR cross-linking is largely unaffected for TNFR2 _ /- CD8 + T cells 71 Figure 2.10 The marked decrease in IFN-y expression by TNFR2 7 " CD8 + T cells is due to a substantial decrease in the percentage of cells that express IFN-y, as well as a decrease in the intracellular levels expressed per cell 72 Figure 2.11 Model of TNFR2 co-stimulation for T cell activation 73 Figure 3.1 A) TNFR2 expression on naive and activated T cells. B) IL-2 production in response to TCR/CD28-mediated stimulation is defective in TNFR2-deficient CD8 + T cells 104 Figure 3.2 TNFR2-deficient CD8 + T cells display a marked reduction in steady-state levels of IL-2 transcript in response to TCR/CD28-mediated stimulation 105 Figure 3.3 TCR-proximal signaling events are largely unaffected by TNFR2-deficiency. 106 Vll Figure 3.4 M A P K activation is unaffected by TNFR2-deficiency 107 Figure 3.5 A K T activation is defective in TNFR2-deficient CD8 + T cells 108 Figure 3.6 A) IKBCC phosphorylation and subsequent degradation is defective in TNFR2-deficient CD8 + T cells. B) N F K B activation is defective in TNFR2-deficient CD8 + T cells 109 Figure 3.7 Early survival and expression of BC1-XL is defective in TNFR2-deficient C D 8 + T cells 110 Figure 4.1 TNFR2 regulates clonal expansion of Ag-specific CD8 T cell responses in vitro ; , 138 Figure 4.2 TNFR2 regulates clonal expansion of Ag-specific CD4 T cell responses in vitro 139 Figure 4.3 TNFR2 is critical for clonal expansion of CD8 T cells in response to secreted peptide expressed by recombinant L. monocytogenes 140 Figure 4.4 TNFR2_ /~ CD8 T cells display defective survival during the early rounds of division, leading to quantitative reduction of the T cell response to rLM-SIY 142 Figure 4.5 Survivin and Bcl-2 expression are dependent on TNFR2 during antigen-driven response in vitro 143 Figure 4.6 TNFR2 controls clonal expansion of CD4 and CD8 T cells against M H C class I and II-restricted epitopes of rLM-SIY : 144 Figure 4.7 Antigen presentation in null mutant animals appears intact. 145 Figure 4.8 TNFR2-deficient mice display delayed bacterial clearance upon challenge with high dose of rLM-SIY 146 Figure 4.9 TNFR2~ /_ mice display reduced C D 4 T cell response specific for wild-type strain of L M 147 Figure 4.10 TNFR2~/~ mice are compromised in the generation of antigen-specific memory populations against rLM-SIY 148 Figure 5.1 Model for TNFR2-mediated signal transduction during T cell activation. ..167 Figure 5.2 Model of TNFR2-mediated co-stimulation in the T cell response in vivo. ..168 List of Abbreviations 7-AAD APC A S M B A L CFSE ConA CQ-PCR CTL DC DD D L N EAE EMSA GSK-3 GM-CSF GVHD H I V HSV-1 H V E M iKBa. JNK7SAPK K L H LAT L C M V LIGHT LLO L M LPS 7-amino-actinomycin D antigen-presenting cell airway smooth muscle bronchial alveolar lavage carboxyfluorescein diacetate succinimidyl ester concanavalin a competitive and quantitative polymerase chain reaction cytotoxic T lymphocyte dendritic cell death domain draining lymph node experimental autoimmune encephalomyelitis electrophoretic mobility shift assay glycogen synthase kinase-3 granulocyte macrophage colony stimulating factor graft-versus-host disease human immunodeficiency virus herpes simplex virus-1 herpes virus entry mediator inhibitor of N F K B Jun N-tenninal kinase/stress-activated protein kinase keyhole limpet hemocyanin linker of activated T cells lymphocytic choriomeningitis virus lymphotoxin-like, exhibits inducible expression, and competes with HSV glycoprotein D for H V E M , a receptor expressed by T lymphocytes listeriolysin-0 Listeria monocytogenes lipopolysaccharide IX LT lymphotoxin mAb ' monoclonal antibody M A P K mitogen activated protein kinase mem TNF 26-kDa membrane-bound TNFa MHC major histocompatibility complex M L R mixed lymphocyte reaction N F - K B nuclear factor K B NIK NFicB-inducing kinase N K natural killer NOD non-obese diabetic PCC pigeon cytochrome C PI-3K phosphatidylinositol 3-kinase PKB protein kinase B R A G recombinase activating gene RIP receptor-interacting protein rLM-SIY recombinant Listeria monocytogenes expressing secreted form of SIY peptide SIY S IYRYYGL peptide solTNF 17-kDa soluble TNFa TCR T cell receptor TLR Toll-like receptor TRAF TNFR receptor-associated factor TNF tumor necrosis factor TNFR TNF receptor TNFR1, p55 tumor necrosis factor receptor-1 TNFR2, p75 tumor necrosis factor receptor-2 Treg CD4 + CD25 + regulatory T cell VSV vesicular stomatitis virus WT wild-type ZAP-70 zeta-associated protein of 70-kDa x Acknowledgements I thank Dr. Hung-Sia Teh for excellent supervision and encouragement, as well as my supervisory committee, Drs. Michael Gold, Francois Jean, and Kelly McNagny, for outstanding guidance and support. I am grateful for funding support through the CIHR/MSFHR Transplant Research Trainee Award and the John Richard Turner Fellowship in Microbiology. I have been privileged to have worked along side great people in past and present-members of the Teh lab. Oliver Utting and Soo-Jeet Teh helped to provide me with early training in the tools and assays of an immunologist. 1 am also grateful to John Priatel and Salim Dhanji for their help and support throughout this project. I have been blessed with support and friendship of many in the Department of Microbiology & Immunology. Cheers to H.K., B . M . , P.H., D.L., D.W., J.P.P., D.B., A.C. , J.N. Finally, I thank my parents for all their great love and support, and my brothers for keeping me in check. X I Preface Co-stimulation is an essential mechanism for self-tolerance in adaptive immunity and involves coordinated receptor-ligand interactions delivered to T cells by APCs. In addition to this important signal, the strength and duration of TCR-mediated signals, the nature of the pathogen in (eg. acute vs. persistent strains of bacteria or virus), and the local cytokine milieu all represent important cues for determining T cell fate. Gene-targeting approaches in mice have led to a substantial advance in our understanding of the cellular and molecular mechanisms controlling the T cell response. This thesis consists of three main parts: (1) an introduction providing a historical perspective on the two-signal model of self-nonself discrimination and the growing number of co-stimulatory molecules belonging to either the CD28- or TNFR-superfamilies; (2) a series of published manuscripts describing the important role of TNFR2 as a T cell co-stimulatory molecule as revealed using gene-targeted mice; and (3) a conclusion section with discussion/perspectives on TNFR co-stimulation in the context of our current understanding of the dynamics of T cell differentiation and exploration of their therapeutic potential in autoimmunity. ' 1 Chapter 1 Introduction 1.1 Preface The focus of this thesis was the characterization of T N F receptor-2 (TNFR2) in co-stimulating the T cell response as defined by augmenting IL-2 production, lowering the threshold of T cell activation, and providing important survival signals for generating a robust effector and memory population. The role of T N F a in the immune system has been extensively characterized in cell lineages across the hematopeoitic range, reflecting the ubiquitous expression of its receptors. In addition to CD28, Studies in the past few years have highlighted the importance of a second major class of co-stimulatory molecules belonging to the T N F R superfamily. TNFR2-deficient mice were initially reported to have normal T and B cell compartments; no overt phenotype in T cell function was apparently observed in this original report. This thesis re-visited the question applying gene-targeting approaches to dissect T cell responses in the absence of T N F R 2 , and revealed T N F R 2 as an important co-stimulatory molecule for both C D 4 and CD8 T cells in vitro and in vivo. This chapter w i l l highlight historical perspectives of T cell co-stimulation, beginning with a review of CD28 superfamily and then leading into the more recently identified T N F R superfamily, emphasizing a large variety of receptors that co-stimulate T cell responses and bestow remarkable flexibility in regulating discrete phases of the differentiation program. 2 1.2 T cell co-stimulation 1.2.1 Self-tolerance: two-signal model A myriad of cell surface receptor-ligand interactions serve as control points in determining cell fate for homeostasis and function in the vertebrate immune system. For T cells the ability to discriminate self from non-self is fundamental to maintaining a highly diverse T-cell repertoire, while eliminating or suppressing lymphocytes capable of recognizing and responding to self-antigens. It is indeed a remarkable evolutionary achievement bestowing T cells with a remarkably effective mechanism that ensures destruction of pathogenic entities while leaving normal host tissue intact. To put this into perspective, consider the substantial number of lymphocyte antigen receptors, which confer the ability to recognize and respond to both foreign and self-antigens, encompassing an estimated 25 x 106 T-cell receptors (TCRs) (1) and between 104 and 10 1 0 B-cell receptors (2). Much has been learned since Brestcher and Cohn first postulated a 2-signal model for self-nonself discrimination more than 30 years ago (3). Although antigen specificity of the T cell response is defined by the T cell receptor (signal 1), the fidelity of the immune response is achieved via non-cognate co-stimulatory receptor-ligand interactions (signal 2). Signal 1 occurs constantly in peripheral homeostasis with low-affinity interactions between cognate antigen and TCR as a natural consequence of the thymic selection process. However, ligands that induce signal 2 are selectively expressed when host defense surveillance encounters a pathogenic challenge. Thus, the physiological requirement of co-stimulatory signals for optimal activation of T cells in addition to the Ag-specific signal delivered through the TCR is a major means by which self-tolerance is achieved. The nature of signal 2 has been the subject of intense 3 investigations over the past decade resulting in a major conceptual advance of T cell co-stimulation beyond two-signal models that previously posited greatest significance to members of the well-studied Ig-like CD28 superfamily. 1.2.2 CD28/B7 pathway in T cell responses From a historical perspective, co-stimulation as a major mechanism of self-tolerance for the T cell compartment was discovered along a course of experiments that led to the identification of the CD28/B7 pathway. Work in the early 80's showed that T cell clones failed to undergo expansion in the absence of co-stimulatory signals, and instead enter an anergic state in which they are refractory to further activation. Importantly, T cell anergy was found to be a direct consequence of a failure to induce IL-2 production, and co-stimulation was therefore intimately linked with a signal that regulated IL-2 expression. This search resulted in the identification of the CD28/B7 pathway as a prominent co-stimulatory pathway for T cells (3, 4). CD28 (reviewed in ref. 1) is the best characterized of a growing number of co-stimulatory molecules, and has been shown to synergize with the TCR to lower the threshold of T cell activation (11, 12), enhance initial clonal expansion (13), regulate IL-2 production (7, 14), and augment the expression of anti-apoptotic members of the Bcl-2 family (15). CD28 is constitutively expressed on the surface of ~ 80% of human T cells and virtually 100% of murine T cells, and undergoes up-regulation in cell surface expression following T cell activation. In vitro studies have shown CD28 dependence of antigen-specific proliferation by naive TCR transgenic T cells. Lucas et al. (4) showed using DO. 10 TCR transgenic CD4 + T cells that CD28 deficiency is associated with a 4 significant decrease in proliferative response to limiting concentrations of O V A peptide during the first 48 hrs of stimulation, and that CD28"A DO. 10 TCR transgenic CD4 + T cells could not maintain their proliferative response after 60 hrs even at high Ag concentrations (4, 5). These findings suggest that CD28 plays a conditional role for initiating Ag-specific T cell proliferation but is essential for optimal IL-2 production and sustained T cell proliferation (4, 5). Sperling et al. (5) used M H C class I-restricted 2C TCR transgenic system to show that blockade of CD28 signaling by CD28-deficiency or CTLA-4 Ig treatment resulted in aborted proliferation after 48 hrs of stimulation, thus demonstrating an essential role for CD28 in sustaining proliferative responses and promoting T cell survival (4, 5). Moreover, the same study showed that co-ligation with anti-CD28 mAb during stimulation with B A L B / c splenocytes promotes late proliferation and survival (4, 5). In vivo studies corroborated these in vitro findings establishing the role of CD28 on the T cell proliferative response. Using the D O l 1.10 TCR transgenic (OVA-specific) CD4 + T cell adoptive transfer system into syngeneic B A L B / c mice to track clonal expansion in vivo following OVA/IFA immunization, Gudmundsdottir et al. (6) found that a responding Ag-specific CD4 + T cell undergoes division to generate >20 daughter cells in vivo as detected in regional lymph nodes 72 hrs after immunization (6). The role of co-stimulation by CD28 in clonal expansion of Ag-specific CD4 T cells was measured in this system using CTLA-4 Ig: in contrast to control Ig treatment that was associated with accumulation of over 200,000 OVA-specific CD4 T cells in regional lymph nodes 72 hrs after immunization from a starting population of 20,000 OVA-specific T cells, CTLA-4 Ig treatment led to a dramatic decrease of less than 40,000 OVA-specific T cells 5 (6). TCR and CD28 signals cooperatively determine the degree of primary clonal expansion by increasing both the proportion of Ag-specific T cells that divide and the number of rounds of division the responding T cells undergo (6). In contrast to naive T cells that depend on CD28 co-stimulation, studies on proliferation and cytokine production by memory T cells indicate CD28-independence during the recall response (7, 8). Indeed, Suresh et al. (2001) found that disrupting CD28/B7 interactions did not significantly affect the generation and maintenance of CD8 T cell memory and LCMV-specific CD28-deficient memory CD8 T cells showed normal homeostatic proliferation in vivo, conferring protective immunity to re-challenge (9). This could be due to high constitutive levels of activated src-kinase Lck in memory T cells, which localizes to and phosphorylates the TCR complex and thus decreases the threshold for T cell activation (10), thereby reflecting functional and biochemical differences between naive and memory T cells. London et al. (12) showed that memory cells rapidly produced effector cytokines (IFN-gamma, IL-4, IL-5) within 12-24 h of Ag exposure and proliferated at lower Ag concentrations than naive cells. Using APCs deficient in B7 and CD40, they also showed that memory cells were less dependent on co-stimulation by B7:CD28 and CD40L:CD40 interactions (11). These findings further support the notion that memory CD4+ T cells possess a lower threshold of activation compared to their naive cell counterparts, allowing for rapid response during re-challenge. 1.2.3 CD28 in T h l / T h 2 differentiation In addition to a role in clonal expansion and survival, CD28/B7 interactions have also been found to regulate Thl/Th2 differentiation of naive CD4 + T cells. CD28 6 engagement has been shown to enhance the production of various cytokines including IL-1, IL-2, IL-4, IL-5, TNFa, and IFNy (12), and studies support a fundamental role for CD28 in the early development and differentiation of both Thl and Th2 T cell subsets (13). In the absence of CD28-mediated co-stimulation, Th2 cytokines (IL-4, IL-5, and IL-10) are not produced whereas IFN-y production is not severely affected (14-16), and hence bias naive T cells toward a Thl phenotype. This was demonstrated using hCTLA4Ig to block CD28/B7 interactions, which resulted in strong abrogation of IL-4 production (17). Seder et al. (1994) suggest that this bias away from Th2 phenotype was due to the lack of IL-2 production, since the addition of exogenous IL-2 overcame the defect in IL-4 production (17). The importance of CD28 signaling in the differentiation of Th2 cells is supported by several studies in vivo utilizing CD28~/_ mice, which display reduced Th2-dependent antibody response to VSV while the Thl-dependent DTH response to L C M V remains intact (18). Moreover, T cells isolated from CTLA4Ig transgenic mice produce significantly reduced amounts of IL-4 and elevated levels of IFNy in response to primary immunization (19, 20). Hence, CD28-mediated signaling can modulate both quantitative and qualitative outcomes during the T cell response, affecting threshold of activation and survival as well as regulating Thl/Th2 differentiation. 1.2.4 CD28/B7 co-stimulation in autoimmune disease models Many of the investigations into clinical applications of CD28/B7 blockade have focused on experimental autoimmune encephalomyelitis (EAE) as an animal model for multiple sclerosis (MS) (21). EAE is an acute or chronic-relapsing, acquired, inflammatory and demyelinating autoimmune disease mediated by CD4 + Thl cells. It can 7 be induced by immunization with various myelin proteins or their immunodominant peptide epitopes (21). Initial studies performed at the onset of the disease showed that blockade of CD28/B7 interactions resulted in the reduction of E A E , correlating with a significant reduction in proliferation of CNS-reactive T cells in the draining lymph nodes 10-15 days after immunization, suggesting that amelioration of disease was due to limited T cell expansion in vivo (22, 23). A more clinically relevant system is the investigation of CD28/B7 blockade after disease onset. These studies use a murine relapsing-remitting E A E (R-EAE) that is induced by immunization with the immunodominant proteolipid protein epitope (PLP139-151) (24). Following immunization, mice exhibit a paralytic acute phase followed by spontaneous remission and clinical relapses, pathology that bears similarity to MS. Interestingly, blockade of the CD28/B7 pathway during the acute or remission phases of E A E prevents further relapses (25, 26), which might not have been predicted based on the previous observations that the stimulation of recently activated T cells and memory T cells was CD28-independent (7, 11). One possible explanation could be that the activation of autoreactive T cells may be more dependent on CD28/B7 co-stimulation due to weaker affinity for their ligand. This is corroborated by evidence showing that ex vivo proliferation of myelin-autoreactive T cells purified from mice that were developing acute E A E remain dependent on CD28/B7 co-stimulation (27). Importantly, several groups showed that the clinical relapses were a consequence of the activation of naive autoreactive T cells triggered by endogenously presented myelin epitopes derived from autoimmune tissue destruction, a phenomenon known as epitope spreading (28, 29). 8 Hence, CD28/B7 interactions plays an important role in controlling relapse due to a dependence upon activation, of a naive set of autoreactive T cells in this system. The NOD mouse, a model of spontaneous autoimmune diabetes, has been used to study the role of CD28/B7 interactions in Thl/Th2 differentiation as a crucial determinant of disease outcome. Augmenting Th2 cytokines either by exogenous injection or over-expression in islets protects mice from the disease (30). Consistent with in vitro data showing dependence of Th2 phenotype on CD28 signals, blockade of the CD28/B7 pathway via disruption of CD28 gene expression led to an earlier onset, increased incidence, and increased severity of diabetes in NOD mice as compared to their littermate controls (31). Re-enforcing the protective role of Th2 cytokines in diabetes and the dependence of Th2 differentiation on CD28, it was shown that treatment of young NOD mice with a stimulating anti-CD28 mAb led to increased production of IL-4 by islet-infiltrating NOD T cells and prevented the development of autoimmune diabetes (32). More recently, another explanation has arisen to account for exacerbation of spontaneous diabetes in both B7-l/B7-2-deficient and CD28-deficient NOD mice (31): a profound decrease in the regulatory CD4 + CD25 + T cell (Treg) compartment in the absence of CD28 signaling (33). Transfer of this regulatory T cell subset from control NOD animals into CD28-deficient animals can delay/prevent diabetes, demonstrating that Treg's are important for controlling autoimmune diabetes (33). f Notably in the NOD system, the islet autoreactive T cells that develop during the course of disease produce Thl cytokines but not immunoregulatory Th2 cytokines, reflecting a change in cytokine balance that leads to more severe insulitis and suggests a basis for the exacerbation of diabetes (31). Within this context, once an established 9 effector T cell population has developed, proliferation of Thl cells but not of Th2 cells is CD28-dependent, manifested as increased T cell death late in culture that cannot be fully rescued by IL-2 or other survival cytokines (7, 11). Lenschow et al. (1995) found that NOD mice treated at the onset of insulitis (2-4 wk of age) with CTLA4Ig or a monoclonal antibody specific for B7-2 prevented the development of diabetes (34). However, late therapy had no effect on disease progression (34). Together these results suggest that blockade of CD28-mediated co-stimulatory signals is effective early in disease development, after insulitis but before the onset of diabetes, presumably by ablating Thl-type autoreactive pathology. Thus, the CD28/B7 pathway can play paradoxical roles in autoimmune diabetes. CD28 blockade can skew away from Th2 differentiation and hence bias naive T cells towards Th l , as well as reduce the numbers of Treg's leading to reduced protection (33); CD28 blockade may also limit the activation and expansion of Thl cells established during the course of disease leading to increased protection against autoimmune diabetes (35). 1.2.5 CD28 signal transduction CD28 was established as a key co-stimulatory molecule for IL-2 induction based on its ability to substantially augment expression in T cells stimulated via TCR (36). Indeed, CD28 has been shown to synergize with the TCR to lower the threshold of T cell activation (37, 38), enhance initial clonal expansion (4), regulate IL-2 production (36, 39), and augment the expression of anti-apoptotic members of the Bcl-2 family (40). Transcriptional regulation of IL-2 is achieved by cooperative binding of different transcription factors (including NFAT, AP-1, N F K B ) (41), which are downstream targets of both the TCR and CD28 signaling 10 pathways (36, 42, 43). Their integration at the IL-2 promoter has been mapped to the CD28 response element (CD28RE), which functions in conjunction with a nonconsensus AP-1 site (44). Notably, a number of other cytokine genes are transcriptionally up-regulated through CD28RE, including IL-3, IFNy, granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-8 (36, 45, 46). The CD28RE in the IL-2 promoter contains a sequence similar to a consensus binding site for N F K B family transcription factors (47). CD28 ligation in conjunction with TCR cross-linking antibody or low concentrations of phorbol 12-myristate 13-acetate (PMA), leads to I K B degradation and subsequent increases in nuclear concentrations of N F K B dimers and transcriptional activation of genes regulated by N F K B (48-50). Thus, coordinated signals provided by external stimuli elicit intracellular signaling pathways that converge qualitatively and quantitatively towards changes in gene expression profile. Initial biochemical studies of CD28 function demonstrated its role in the transcription and stability of IL-2 mRNA (36, 39, 51, 52). Subsequent studies of CD28 signaling showed synergy with those mediated via the TCR complex towards the activation of downstream effectors (53). In particular, optimal activation of the transcription factors NFAT, AP-1, and N F K B is dependent on 'amplification signals' provided by CD28-mediated recruitment and subsequent activation of Vav (54) and phosphoinositide 3-kinase (PI3K) (53). More recently, protein kinase B (AKT) was shown to provide the CD28-mediated co-stimulatory signal for up-regulation of IL-2, suggesting that CD28 also utilizes discrete signaling pathways (55). However, the effects mediated by CD28 were found to be insufficient to sustain long term T cell survival, and 11 therefore the effects of CD28 are functionally positioned early during T cell activation (within 24 hrs of antigen encounter) (56). The co-stimulatory role of CD28 on T cell proliferation is therefore due to several mechanisms: increased transcription and mRNA stability of IL-2, increased expression of the anti-apoptotic protein Bcl-Xi_ that promotes cell survival in vitro (5, 40) and in vivo (57, 58), and decreased threshold of T cell activation (59). In naive T cells, CD28 co-stimulation also appears to promote the formation of an immunological synapse, a distinct region formed at the contact zone of the T cell and APC resulting from the specific re-organization of specific signaling and adhesion cell-surface proteins accompanied by re-orientation of the microtubule organizing centre and golgi apparatus to a region just beneath the contact site (60, 61). Wulfing and Davis (1998) used beads coated with an antibody against the cortical actin cytoskeleton-linked adhesion molecule ICAM-1 to measure the movement of anti-ICAM-1-coated beads towards the contact site (60, 61). They were able to show that the engagement of B7/CD28 triggers an active accumulation of molecules at the T cell-APC interface. This movement of beads towards the interface was inhibited by blocking antibodies against ICAM-1 and B7 (60, 61). The accumulation of receptor-pairs and other cytoskeletal-linked molecules thereby increases their local densities at the contact site for signal amplification (60, 61). This suggests that co-stimulation could be mediated to a significant extent by the re-distribution of lipid rafts to the synapse. Viola et al. (1999) showed that immobilizing cholera toxin B subunit or a monoclonal antibody to the glycophosphatidylinositol (GPI)-linked protein CD59 in culture wells with anti-CD3 provided efficient co-stimulation of the proliferative response by resting T cells (60, 61). Viola et al. (1999) suggest that cross-linking rafts 12 mimics the co-stimulatory effect of CD28 and that the recruitment of rafts to the immunological synapse may be a general mechanism to amplify signals, resulting from increased local accumulation of kinases (60, 61). 1.2.6 Signal 2 not solely defined by CD28 Shahinian et al. (1993), who first reported the generation of a CD28-deficient mouse, observed that T cell responses to lectins, activity of T helper cells and immunoglobulin class switching were significantly reduced in CD28 - /" mice. In contrast, cytotoxic T cells were still induced in CD28_/~ mice and exhibited delayed-type hypersensitivity after infection with lymphocytic choriomeningitis virus (18). These findings suggest that CD28 is not required for all T cell responses in vivo, and implies that alternative co-stimulatory pathways may exist. Further studies using CD28-deficient mice showed that co-stimulation through the CD28 pathway was not an absolute requirement for T cell activation (4, 37, 62-64). These studies strongly suggest that the intensity and duration of the antigenic signal mediated through the TCR is also a critical factor (42, 62, 65). Additional members of the B7/CD28 family have been identified in recent years. ICOS, a CD28 homolog, is a co-stimulatory receptor that is upregulated on both CD4 + and CD8 + T cells following activation through the TCR and enhanced via CD28 signaling (66). ICOS binds a unique B7 family member, B7h, which is expressed constitutively by B cells and macrophages, and its expression can be induced by inflammatory stimuli on non-lymphoid cells, including endothelial cells, fibroblasts, and epithelial cells. Although CD28 and ICOS share remarkable similarity in signaling functions, ICOS co-stimulation alone is insufficient to induce substantial IL-2 production 13 or BC1-XL upregulation (67). ICOS, in contrast to the early role of CD28 in IL-2 induction, appears to be important for the generation of effector T-cell cytokine responses (68). Thus, ICOS appears to play a critical role disctint from CD28 in T cell activation. 1.2.7 Danger signals induce a myriad of co-stimulatory ligands Dendritic cells (DCs), in their role as professional APCs, are pivotal in the generation of strong innate and adaptive immune responses, serving as the upstream regulator for decisions between immunity and tolerance. Current data support the danger signal model in which stimuli received by DCs via Toll-like receptors (TLRs) signal DC maturation as measured by enhanced expression of the co-stimulatory molecules B7.1, B7.2 and CD40 (69). The corollary of this model is that in the absence of danger signals elicited by pathogen, T cell-DC interactions would lead to tolerance induction (70). As Janeway first proposed (71), the induction of B7.1 and B7.2 on the DC surface is a particularly important step in the initiation of adaptive immunity, thereby coupling pathogen surveillance with the induction of the co-stimulators that allows activation of pathogen-specific T cells. Naive CD4 + T cells can differentiate into either Thl or Th2 cells depending on a number of determinants expressed by activated APCs, including types of co-stimulatory molecules expressed and cytokines secreted (72). Thus, the differentiation program that expands a naive T cell population into effector and memory cells depends on a complex and dynamic array of temporally and spatially regulated factors. Not surprisingly, investigations into,novel co-stimulatory molecules over the past few years has led to a major conceptual advance of the two-signal model, integrating a 14 myriad of receptors to include not only CD28-superfamily members, but also cell surface receptors belonging to the TNFR superfamily. 1.3 TNF receptor superfamily and co-stimulation 1.3.1 TNFa in the immune system TNFa was identified thirty years ago as a product of lymphocytes and macrophages that caused the lysis of tumor cells (73, 74). Though systemic toxicity stymied early hopes of using LTa or TNFa as anti-tumor agents, the discovery of new members of the TNFR superfamily opened new lines of investigation into host defense, inflammation, apoptosis, autoimmunity, and organogenesis. Large-scale sequencing of expressed sequence tags (ESTs) identified many related proteins constituting the TNFR superfamily proteins (reviewed in (75-77). Pharmaceutical intervention designed to inhibit TNFa have been successful in the clinic for inflammatory conditions such as rheumatoid arthritis and inflammatory bowel disease (78, 79). Indeed, TNFa and other members of the TNF/TNFR superfamily are now being targeted for therapies aimed at prevalent medical conditions such as atherosclerosis, osteoporosis, autoimmune disorders, allograft rejection, and cancer (reviewed in (80). TNF is initially synthesized as a non-glycosylated, homo-trimeric transmembrane 26-kDa protein (memTNF), which is then cleaved by the matrix metalloprotease TNFa-converting enzyme (TACE), to release the 17-kDa soluble TNF (sTNF) (reviewed in (81)). The relative roles of memTNF and sTNF in immunity have recently been addressed using a gene knock-in strategy of a deletion/mutant TNFa allele to ensure 15 complete loss of TACE-mediated cleavage but normal cell surface expression and function of mem TNF (82), (83). Mice which expressed memTNF in the absence of solTNF were protected against acute Mycobacterium tuberculosis infection but succumbed to late progressive infection (82). Although memTNF knock-in mice cleared low-dose Listeria infection and were protected against an otherwise lethal secondary challenge, higher dose of primary Listeria challenge led to delayed clearance of bacteria with slower T-cell accumulation and increased inflammation and mortality, indicating that solTNF is required for optimal control of a primary infection (84). Georgopoulos' et al. showed using transgenic mice that express a T cell-targeted membrane-associated mutant human TNFa that memTNF plays a role in tissue destruction and autoimmune inflammation (85). memTNF has been directly associated with specific immune functions, including the contact-dependent lymphocyte and monocyte-mediated cell killing and the CD40 ligand-independent, T cell-mediated polyclonal B cell activation (85). 1.3.2 Co-stimulatory members of the T N F R superfamily In the past few years, a number of TNF/TNFR superfamily members have been shown to play co-stimulatory roles in T cell responses: OX40/OX40 ligand (OX40L), 4-1BB/4-1BBL, CD27/CD70, CD30/CD30L and H V E M (herpes-virus entry mediator)/LIGHT (86, 87). The following serves as summary highlighting key features of this superfamily. TNFRs are type I transmembrane proteins comprised of extracellular cysteine-rich domains, which typically consist of pseudo-repeats of six cysteines that form three disulphide bridges (88). Croft (2003) suggests that the different TNFR 16 molecules may have arisen through gene-duplication events, as indicated by the close proximity of the genes that encode OX40, 4-1 BB, CD30 and H V E M (86). Studies using gene-targeted murine models, as well as monoclonal antibodies with modulatory activity, have established their role in co-stimulating discrete aspects of the T cell response, including priming of naive T cells and the generation and maintenance of a robust memory cell population (86). 1.3.3 Expression and function of TNFR superfamily in T cells Examination of TNFR superfamily member expression reveals important insight into their relative functions within the T cell-APC interface. On naive T cells, TNFR family members are either expressed at constitutive levels or are induced, reflecting temporal usage and discrete roles in the differentiation program of the T cell response. Based on in vitro data, CD27 (89) and H V E M (90) are found at low-to-medium levels on the T cell surface, whereas OX40 and 4-IBB are induced with peak expression 2-4 days into the T cell response (91, 92). During the course of activation, TCR signals are sufficient for expression of the inducible TNFRs. However, CD28/B7 interactions augment the kinetics and levels of expression of OX40 and 4-1 BB (92-94), suggesting an interesting link between the two major co-stimulatory families. The other side to the T cell-APC interaction is the expression of co-stimulatory TNF superfamily ligands, which in keeping with the danger signal model of self-nonself discrimination, are induced after APC activation (95, 96). OX40L, 4-1BBL, CD70 and CD30L are not constitutively expressed by resting or immature APCs but are induced 24 hrs to several days after activation, largely coinciding with the peak level of expression of 17 their receptors on T cells (95, 96) . CD70 is mainly expressed by B cells (97), whereas OX40L, 4-1BBL and CD30L are mainly expressed by a broad range of professional APCs. From a temporal perspective, a cascade or rounds of co-stimulation may be mediated depending on timing of peak expression: the constitutive expression of H V E M by naive T cells and LIGHT by immature dendritic cells indicates a role in the early activation of T cells and APCs; CD27 is also constitutively expressed but peaks after T cell activation, suggesting that this interaction might indicate a second round of co-stimulation during clonal expansion. OX40, 4-IBB and CD30, and their ligands are induced in the late phase of primary expansion and so these interactions function later to sustain the response (86). 1.3.4 TNFR in co-stimulating primary T-cell responses The roles of the co-stimulatory members of the TNFR superfamily have been the subject of intense investigations in the past few years (86, 87). Each role has been delineated temporally during primary expansion; the following will highlight CD27, OX40, and 4-1BB, as the data set is particularly strong for identifying as co-stimulatory in T cell responses. CD27: Engaging CD27 signaling with antibody or ligand can enhance CD4 + or CD8 + T cell proliferation and cytokine production (98, 99). In contrast to CD28, which promotes cell division, CD27 appears to promote T cell expansion by allowing T cells to survive through successive divisions, without influencing the rate of cell division (100). In vitro blocking studies of CD27 have shown inhibition of T cell proliferation and cytokine secretion, suggesting a role in the early stages of T cell activation (101, 102) . 18 CD27_/~ T cells undergo normal division initially but then proliferate poorly 3 or more days after activation in vitro, indicating an important role in initial expansion (103). Moreover, using an influenza virus infection system in combination with MHC H2-D b tetramers loaded with the immunodominant influenza NP366 -374 peptide (which allows visualization and quantification of virus- specific CD8 T cells), Hendriks et al. (2000) showed that CD27-deficiency is associated with lower numbers of virus-specific CD4 + and CD8 + T cells at the peak of primary responses (days 8-10) and fewer memory T cells generated over 3 or more weeks (103). Temporally, because expression of CD27 is upregulated early after T-cell activation, it may function to deliver signals that maintain early proliferation, before the peak of the effector response. OX40: Initial studies using OX40L or anti-OX40 antibody showed that OX40 signaling can enhance cytokine production and proliferation of CD4 + T cells (reviewed in (104), independently of CD28 (105). Although most evidence suggests a role'for OX40 primarily on CD4 T cells, agonistic anti-OX40 antibodies enhanced the expansion of both CD4 + and CD8 T + cells in vivo (106, 107). OX40 appears to act later in the T cell response. Although TCR plus OX40 co-signal can induce IL-2 production, OX40 does not replace CD28 or influence the initial rate of cell division. Rather, OX40 allows for survival of greater numbers of T cells later in the response (94, 108). OX40 7" and OX40L 7 " mice have reduced primary CD4 + T-cell responses to several viruses, yielding lower frequencies of antigen-specific effector T cells and a smaller memory T cell pool (107, 109). In contrast to CD27-deficient T cells, OX40"7" CD4 T cells are unimpaired in early proliferation, but show reduced proliferation and marked apoptotic cell death 4-5 days after activation (94). Although CD8 + T cell responses to viruses were unimpaired in 19 O X 4 0 o r OX40L 7 " mice (109, 110), there were small defects in alloantigen or contact sensitivity-induced CD8 T cell responses in the absence of OX40L (111). However, the effects of OX40 on CD8 T cells in these studies may be due to indirect effects of OX40 on CD4 T cell help (87). Thus, OX40 plays a clear role in CD4 T cell responses in vivo but appears to be dispensable for CD8 T cell responses in vivo. 4-1 BB: Initial analysis of 4-1 BB in murine T cells indicated a role in augmenting T cell proliferation and both Thl and Th2 cytokine production (reviewed in (112), thereby regulating the number of cytokine-producing cells (113, 114). Under conditions of strong TCR signaling, co-stimulation with 4-1BBL induced similar levels of IL-2 as CD28-mediated co-stimulation (115). Similar to the role of OX40 in T cell survival during primary expansion, 4-1 BB engagement prevented activation-induced cell death in T cells (116). Gene targeted deletion of 4-1BBL led to markedly fewer antigen-specific CD8 + T cells in primary responses and fewer memory T cells generated (117-119). Blocking 4-1 B B L did not alter the initial proliferative response of CD8 + T cells but suppressed the accumulation of effector CTLs at the peak of the primary response, due to a survival defect in the dividing population (120). Mice deficient in 4-1BB or 4-1 B B L showed defects in CD8 + T cell responses to viruses, with no observed defects in antibody or CD4 T cell responses to vesicular stomatitis virus (VSV), L C M V , or influenza virus (117,118,121). Taken together, the body of evidence supports a model of co-stimulation characterized by temporally regulated functions in the T cell response. Given the early expression of CD27, its main effect may be to regulate cell division and expansion of T-cell numbers, rather than being essential for T-cell survival after this clonal expansion 20 phase (86). CD27 may therefore function in temporal coincidence with CD28 to provide early pro-survival signals in support of primary expansion. The studies of OX40 and 4-1BB indicate that these molecules have similar functions providing late-acting survival signals that ensure transition from effector into memory T cells. OX40 and 4-1 BB appear to function later than CD28, as they are upregulated by CD28 signals. Even more telling are functional analyses of CD28-deficiency versus OX40- or 4-lBBL-deficiency, which have shown that early primary T-cell responses are markedly impaired in the absence of CD28 signals, but only late responses are impaired in the absence of OX40 or 4-1 BB signals (94, 122). 1.3.5 T N F R signal transduction The receptors of this superfamily couple directly to signaling pathways for cell proliferation, survival, and differentiation (reviewed in ref. (80). The expansion of this superfamily across the mammalian genome and many indispensable roles in mammalian biology emphasize its evolutionary success (80). The cytoplasmic domains of TNFRs function as docking sites for signaling molecules, principally through two classes of adaptor molecules: TRAFs (TNF receptor-associated factors) and death domain-containing (DD) molecules (reviewed in (123)). In mammals, at least six TRAF molecules and a number of DD molecules have evolved at locations spread through the genome (124). Co-stimulatory members of the TNFR superfamily are non-DD-containing receptors with TRAF-binding domain in their cytoplasmic portion, which function to propagate the signal downstream through intracellular effectors linked to the TRAF network of adaptors. 21 The precise pathways for activation of caspases, N F K B , and other cellular responses, although still not well understood, appear to involve a variety of signaling molecules such as p38, JNK, ERK, RIP, and NIK (124). Signaling studies of co-stimulatory members of the TNFR superfamily (HVEM, CD27, OX40, 4-1BB, CD30) have shown a good deal of commonality, each bearing the potential to bind TRAF2 and TRAF3 (124). As an aside, TRAFs have the potential to form heterotrimeric signaling complexes in addition to homotrimeric complexes (124), complicating our understanding of the purpose of their promiscuous binding to TNFR. However, several studies indicate that TRAF2 is crucial to at least some of the signals from the co-stimulatory TNFR-family members (86). More recently, a pathway involving phosphatidylinositol-3-kinase (PI3K) and the serine-threonine Protein Kinase B (AKT) has been linked to co-stimulatory molecules in T cells. Kane et al. (2001) showed that retro virus-mediated expression of activated A K T in primary T cells from CD28-deficient mice was capable of selectively restoring production of IL2 and IFNy (55). Kane et ai, also showed that A K T overexpression leads to specific N F K B induction in the Jurkat T cell line, This pathway also appears to be used by co-stimulatory members of the TNFR superfamily. Ligation of OX40 induces PI3K and the activation of A K T ; OX40 7" T cells are defective in sustained expression of AKT , correlating with the survival defect that quantitatively limits the generation of a robust effector and memory pool (86). With regard to T-cell survival, both OX40 and 4-IBB can upregulate the expression of the anti-apoptotic proteins B C L - X L and BFL1, directly correlating with their suppression of apoptotic cell death (16, 83, 84). This again supports the idea that 22 these molecules are functionally analogous. So far, there is no information on whether CD27, H V E M or CD30 regulate proteins of the BCL2 family, although it is probable.that they might also target anti-apoptotic molecules. 1.3.6 TNFR2 as a putative T cell co-stimulatory molecule Several studies have implicated TNFa as a ligand playing a co-stimulatory role in T cell proliferation (125-127) in the context of infection by activated APCs. T cell proliferation was found to be markedly enhanced when TNFa was added exogenously to cultures stimulated by TCR cross-linking, and that this increase was comparable to the effect of adding the T cell growth factor IL-2 exogenously (65). The proliferative response of T cells to stimulation through the TCR complex was ablated when a neutralizing antibody to TNFa was added to T cell cultures, suggesting that TNFa acts in an autocrine manner as a T cell growth factor (65). Consistent with this notion, TNFa is expressed early during T cell activation (129). Taken together, this suggests that TNFa provided by activated APCs and endogenously upon T cell activation can act through a co-stimulatory pathway and may be a critical regulatory point for the progression of the T cell response. TNFa binds to two distinct receptors on the cell surface, TNFR1 and TNFR-2 (reviewed in (130)). Studies using agonist antibodies have demonstrated that the two receptors signal distinct TNF activities (125). While TNFR1 was shown to be responsible for signaling cytotoxicity and the induction of several genes, TNFR2 was shown to be capable of signaling proliferation of primary thymocytes and a cytotoxic T cell line (126)., Agonist antibodies towards TNFR2 can enhance the proliferative response of T cells to a 23 level observed when adding TNF-a exogenously to cell cultures, whereas specific activation of TNFR1 had no effect. More recently, Micheau and Tschopp showed that TNFR.l can signal both death and survival by using a mechanism involving two sequential signaling complexes: an initial plasma membrane bound complex (complex I) consisting of TNFR1, the adaptor TRADD, the kinase RIP1, and TRAF2 that rapidly signals activation of NF-kappa B. and a second step forming a cytoplasmic complex (complex II), wherein T R A D D and RIP1 associate with F A D D and caspase-8 to signal cell death (131). However, TNFR2 is the predominant TNF receptor on activated T cells (132), (133) , suggesting that the pro-survival signal potentially derived from. TNFR1 is likely minimal during T cell activation. However, these studies did not address whether the TNFR2 signal is important, or if it is actually a redundant pathway. Mice deficient in TNFR1 (134, 135) and TNFR2 (136) were generated to clarify their respective roles in the immune system. These studies confirmed the importance of TNFR1 for the cytotoxicity associated with TNF-a. TNFRT 7" T cells did not exhibit a defect in proliferative response to mitogens such as Concanavalin A (ConA) nor agonist antibody specific for the TCR complex (137). This was consistent with the observations that agonists specific for TNFR1 did not affect the proliferative response to TCR agonists. Functional analysis of TNFR2 7 " T cells did not reveal any changes in responsiveness compared to wild-type T cells, including response to the mitogen ConA (136). However, this first report describing TNFR2 7 " mice did not examine T cell response to specific stimulation through the TCR complex, which is the normal physiological route of T cell activation. Therefore, a potentially critical co-stimulatory 24 pathway has been neglected, and the elucidation of the mechanisms that lead to a functional T cell response is incomplete. 1.3.7 Summary of thesis The goal of this research was to investigate the functional role of TNFa/TNFR2 interactions for T cell responses to gain a clearer understanding of the factors that control T cell activation threshold, differentiation into cytokine-producing effector cells, and the generation of memory T cells. The objective was to examine the putative co-stimulatory function of TNFR2 by assaying T cells from TNFR2" A mice using well-established in vitro stimulation systems and TCR transgenic model systems coupled with an in vivo cognate Ag-expression system. TNFa and its receptors are an important cytokine/receptor system in the innate and adaptive arms of the immune system for controlling differentiation, survival and death. Most of the work on this pleiotropic cytokine focused on its role as an effector cytokine promoting innate pro-inflammatory responses against pathogen. The first published report describing the TNFR2 knockout mice did not identify an important role for TNFa/TNFR2 interactions in T cell responses, despite earlier work showing: (1) TNFR2 is expressed on activated T cells, (2) TNFR2 plays an important role in TCR-agonist induced T cell proliferation as agonistic Abs against TNFR2 promotes proliferation and antagonistic Abs against TNFR2 impairs the proliferative response, and (3) TNFa plays an important role in TCR-agonist induced T cell proliferation as exogenous addition of the cytokine augments proliferation and neutralizing antibodies against TNFa abolishes the proliferative response. The hypothesis tested in this research was that TNFR2 functions as a co-stimulator of T cell responses in 25 promoting IL-2 production, lowering the threshold of T cell activation, and promoting T cell clonal expansion. Chapter 1 describes in vitro experiments showing that T cell activation requires a threshold amount of T cell receptor (TCR)-mediated signals, an amount that is reduced by signals mediated through TNFR2-mediated co-stimulation in both naive CD4 + and CD8 + T cell subsets. TNFR2 deficiency in CD8 + T cells increased the requirements for TCR agonist approximately 5-fold. This resulted in a marked reduction in the accumulation of effector TNFR2 7 " T cells in cultures stimulated with TCR agonist. This hypo-proliferative response was associated with delayed kinetics of induction of the acute activation markers CD25 and CD69, as well as a marked decrease in the production of IL-2 and IFN-y. The net result was that very few cells were recruited into the dividing population. Interestingly, CD28 co-stimulation was only partially effective in rescuing the proliferative defect of TNFR2" A CD8 + T cells. Thus TNFR2 provides an important co-stimulatory signal in addition to that provided by CD28 towards optimal T cell proliferation and IL-2 production. This chapter describes experiments showing that TNFR2 lowers the threshold of T cell activation, promotes IL-2 production, and induces clonal expansion of effector CD8 + T cells. It also indirectly implicates the autocrine consumption of TNFa during T cell activation as an important checkpoint for inducing clonal expansion and IL-2 production. Chapter 2 continues the in vitro examination of TCR and TNFR2-mediated signals that promote IL-2 production and identifies a functional link between TNFR2 and CD28 at a critical checkpoint of T cell activation: sustaining A K T and N F K B activation after short duration of TCR/CD28-mediated stimulation. TNFR2-deficient T cells possessed a 26 profound defect in IL-2 production in response to TCR/CD28-mediated stimulation, an important finding given the major role previously attributed to CD28 for promoting IL-2 production. Examination of key signaling intennediates revealed that TCR-proximal events such as global tyrosine phosphorylation and ZAP-70 phosphorylation, as well as downstream M A P K cascades are unperturbed in TNFR2-deficient T cells. In contrast, TNFR2 is non-redundantly coupled to sustained A K T activity and N F K B activation in response to TCR/CD28-mediated stimulation. Moreover, TNFR2-deficient T cells exhibit a defect in survival during the early phase of T cell activation that is correlated with a striking defect in B c l - X L expression. These reveal the synergistic requirement of TCR, CD28, and TNFR2 towards optimal IL-2 induction and T cell survival. It is proposed that TNFR2 acts as one of the earliest co-stimulatory members of the TNFR family, and is functionally linked to CD28 for initiating and determining T cell fate during activation. Chapter 3 describes the utilization of M H C class I- and II-restricted TCR transgenic model systems in combination with an in vivo cognate Ag-expression system to assay for the role of TNFR2-mediated co-stimulation in Ag-driven T cell responses. Experiments described in this chapter showed that CD4 + and CD8 + T cells depended on TNFR2 for survival during clonal expansion, allowed larger accumulation of effector cells and conferred protection from apoptosis for a robust memory pool in vivo. Using the MHC class I-restricted 2C TCR and M H C class II-restricted AND TCR transgenic systems, it was shown that TNFR2 regulates threshold for clonal expansion of CD4 + and CD8 + T cell subsets in response to cognate antigen. Using a novel recombinant Listeria monocytogenes (rLM-SIY) expressing a secreted form of the 2C agonist peptide (SIY) to investigate the role of TNFR2 for T cell immunity in vivo, TNFR2 was shown to control 27 the survival and accumulation of effector cells during the primary response. TNFR2" / _ CD8 T cells exhibit loss of protection from apoptosis that is correlated with diminished survivin and Bcl-2 expression. Null mutant mice were more susceptible to rLM-SIY challenge at high doses of primary infection, correlating with impaired LM-specific T cell response in the absence of TNFR2-mediated co-stimulation. Moreover, the resulting memory pools specific for SIY- and listeriolysin (LLO)-epitopes derived from rLM-SIY were diminished in TNFR2"7" mice. Thus, examination of antigen-driven T cell responses revealed a hitherto unknown co-stimulatory function for TNFR2 in regulating T cell survival during the differentiation program elicited by intracellular pathogen in vivo. Overall, this research demonstrated the critical role of TNFR2 in regulating the threshold of T cell activation, and that clonal expansion depended on TNFR2 particularly at lower Ag doses. Importantly, TNFR2 functions in both CD4 + and CD8 + T cell subsets within the first 10 hrs of TCR/CD28-mediated stimulation to sustain A K T and N F K B activation and promote BC1-XL expression, which correlates with the non-redundant role of TNFR2 in promoting IL-2 production and T cell survival. It also indicates an unappreciated role for autocrine consumption of TNFa by activated T cells for clonal expansion and survival. TNFR2 controls the clonal expansion of Ag-specific effector T cells and generation of a robust memory pool during the adaptive immune response against intracellular pathogen by inducing the expression of anti-apoptotic molecules such as Bcl-2 and survivin. The early role for TNFR2-mediated co-stimulation of T cell responses indicates that this receptor acts upstream of other members of the TNFR family such as OX-40 and 4-IBB. This research demonstrates the exciting potential of targeting TNFR2 in ameliorating T cell-mediated diseases. 28 1.4 References 1. Arstila, T. P., A . Casrouge, V. Baron, J. Even, J. Kanellopoulos, P. Kourilsky. 1999. A direct estimate of the human alphabeta T cell receptor diversity. Science 286:958. 2. Bachmann, M . F., T .M. Kundig, C P . Kalberer, H. Hengartner, R .M. Zinkernagel. 1994. How many specific B cells are needed to protect against a virus? J. Immunol. 52:4235. 3. Bretscher, P. A . a. M . A. C. 1970. A theory of self-nonself discrimination. Science 169:1042. 4. Lucas, P. J., I. Negishi, K. Nakayama, L.E. Fields, and D. Loh. 1995. Naive CD28-deficient T cells can initiate but not sustain an in vitro antigen-specific immune response. J. Immunol. 154:5757. 5. Sperling, A . I., J.A. Auger, B.D. Ehst, L C Rulifson, C.B. Thompson, J.A. Bluestone. 1996. CD28/B7 interactions deliver a unique signal to naive T cells that regulates cell survival but not early proliferation. J. Immunol. 157:3909. 6. Gudmundsdottir, H. , A.D. Wells, and L .A . Turka. 1999. Dynamics and requirements of T cell clonal expansion in vivo at the single-cell level: effector function is linked to proliferative capacity. Immunity 162:5212. 7. Croft, JVL, L . M . Bradley, S.L. Swain. 1994. Naive versus memory CD4 T cell response to antigen. Memory cells are less dependent on accessory cell costimulation and can respond to many antigen-presenting cell types including resting B cells. J. Immunol. 152:2675. 8. Scholz, C , K.T. Patton, D.E. Anderson, G.J. Freeman, D.A. Hafler. 1998. Expansion of autoreactive T cells in multiple sclerosis is independent of exogenous B7 costimulation. J. Immunol. 160:1532. 9. Suresh, M . , J.K. Whitmire, L.E. Harrington, C P . Larsen, T.C. Pearson, J.D. Altman, R. Ahmed. 2001. Role of CD28-B7 interactions in generation and maintenance of CD8 T cell memory. J. Immunol. 167:5565. 10. Bachmann, M . F., A. Gallimore, S. Linkert, V. Cerundolo, A. Lanzavecchia, M . Kopf, A . Viola. 1999. Developmental regulation of Lck targeting to the CD8 coreceptor controls signaling in naive and memory T cells. J. Exp. Med. 189:1521. 29 11. London, C. A., M.P. Lodge, A.K. Abbas. 2000. Functional responses and costimulator dependence of memory CD4 T cells. J. Immunol. 164:265. 12. Linsley, P. S., J.A. Ledbetter. 1993. The role of the CD28 receptor, during T cell responses to antigen. Annu. Rev. Immunol. 11:191. 13. King, C. L., R.J. Stupi, N. Craighead, C.H. June, G. Thyphronitis. 1995. CD28 activation promotes Th2 subset differentiation by human CD4+ cells. Eur. J. . Immunol. 25:587. 14. Schweitzer, A. N., A .H . Sharpe. 1998. Studies using antigen-presenting cells lacking expression of both B7-1 (CD80) and B7-2 (CD86) show distinct requirements for B7 molecules during priming versus restimulation of Th2 but Thl cytokine production. J. Immunol. 161:2762. 15. Rulifson, I. C , A.I. Sperling, P.E. Fields, F.W. Fitch, J.A. Bluestone. 1997. CD28 costimulation promotes the production of Th2 cytokines. J. Immunol. 158:658. 16. Rogers, P. R., M. Croft. 2000. CD28, Ox-40, LFA-1 , and CD4 modulation of Thl/Th2 differentiation is directly dependent on the dose of antigen. J. Immunol. 164:2955. 17. Seder, R. A., R.N. Germain, P.S. Linsley, W.E. Paul. 1994. CD28-mediated costimulation of interleukin 2 (IL-2) production plays a critical role in T cell priming for IL-4 and interferon gamma production. J. Exp. Med. 179:299. 18. Shahinian, A., K. Pfeffer, K.P. Lee, T.M. Kundig, K. Kishihara, A. Wakeham, K. Kawai, P.S. Ohashi, C B . Thompson, T.W. Mak. 1993. Differential T cell costimulatory requirements in CD28-deficient mice. Science 261:609. 19. Lane, P., C. Bur det, S. Hubele, D. Scheidegger, U. Muller, F. McConnell, M. Kosco-Vilbois. 1994. B cell function in mice transgenic for mCTLA4-Hv 1: lack of germinal centers correlated with poor affinity maturation and class switching despite normal priming of CD4+ T cells. J. Exp. Med. 179:819. 20. Ronchese, F., B. Hausmann, S. Hubele, P. Lane. 1994. Mice transgenic for a soluble form of murine CTLA-4 show enhanced expansion of antigen-specific CD4+ T cells and defective antibody production in vivo. J. Exp. Med. 179:809. 21. Wekerle, H. 1991. Immunopathogenesis of multiple sclerosis. Acta Neurol. 13:197. 22. Oliveira-dos-Santos, A. J., A. Ho, Y . Tada, J.J. Lafaille, S. Tonegawa, T.W. Mak, J.M. Penninger. 1999. CD28 costimulation is crucial for the development of spontaneous autoimmune encephalomyelitis. J. Immunol. 162:4490. 30 23. Cross, A. H., T.J. Girard, K.S. Giacoletto, R.J. Evans, R.M. Keeling, R.F. Lin, J.L. Trotter, R.W. Karr. 1995. Long-term inhibition of murine experimental autoimmune encephalomyelitis using CTLA-4-Fc supports a key role for CD28 costimulation. J. Clin. Invest. 95:2783. 24. McRae, B. L., M.K. Kennedy, L.J. Tan, M.C. Dal Canto, K.S. Picha, S.D. Miller. 1992. Induction of active and adoptive relapsing experimental autoimmune encephalomyelitis (EAE) using an encephalitogenic epitope of proteolipid protein. J. Neuroimmunol. 38:229. 25. Miller, S. D., C.L. Vanderlugt, D.J. Lenschow, J.G. Pope, N.J. Karandikar, M.C. Dal Canto, J.A. Bluestone. 1995. Blockade of CD28/B7-1 interaction prevents epitope spreading and clinical relapses of murine EAE. Immunity 3:739. 26. Perrin, P. J., C H . June, J.H. Maldonado, R.B. Ratts, M.K. Racke. 1999. Blockade of CD28 during in vitro activation of encephalitogenic T cells or after disease onset ameliorates experimental autoimmune encephalomyelitis. J. Immunol. 163:1704. 27. Arima, T., A. Rehman, W.F. Hickey, M.W. Flye. 1996. Inhibition by CTLA4Ig of experimental allergic encephalomyelitis.- J. Immunol. 156:4916. 28. Lehmann P.V., T. F., A. Miller, E.E. Sercarz. 1992. Spreading of T cell autoimmunity to cryptic determinants of an autoantigen. Nature 358:155. 29. McRae, B. L., C.L. Vanderlugt, M.C. Dal Canto, S.D. Miller. 1995. Functional evidence for epitope spreading in the relapsing pathology of experimental autoimmune encephalomyelitis. J. Exp. Med. 182:75. 30. Sarvetnick, F. M. N. 1999. Cytokines that regulate autoimmune responses. Curr. Opin. Immunol. 11:670. 31. Lenschow, D. J., K.C. Herold, L. Rhee, B. Patel, A. Koons, H.Y. Qin, E. Fuchs, B. Singh, C B Thompson, J.A. Bluestone. 1996. CD28/B7 regulation of Thl and Th2 subsets in the development of autoimmune diabetes. Immunity 5:285. 32. Arreaza, G. A., M.J. Cameron, A. Jaramillo, B.M. Gi l l , D. Hardy, K.B. Laupland, M.J. Rapoport, P. Zucker, S. Chakrabarti, S.W. Chensue, H.Y. Qin, B. Singh, T.L. Delovitch. 1997. Neonatal activation of CD28 signaling overcomes T cell anergy and prevents autoimmune diabetes by an IL-4 dependent mechanism. J. Clin. Invest. 100:2243. 33. Salomon, B., D.J. Lenschow, L. Rhee, N. Ashourian, B. Singh, A. Sharpe, and J.A. Bluestone. 2000. B7/CD28 costimulation is essential for the homeostasis of the CD4 + CD25 + immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431. 31 34. Lenschow, D. J., S.C. Ho, H. Sattar, L. Rhee, G.Gray, N . Nabavi, K .C . Herold, J.A. Bluestone. 1995. Differential effects of anti-B7-l and anti-B7-2 monoclonal antibody treatment on the development of diabetes in . the nonobese diabetic mouse. J. Exp. Med. 181:1145. 35. Salomon, B . a. J. A. B . 2001. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu. Rev. Immunol. 19:225. 36. Fraser, J. D., B . A . Irving, G.R. Crabtree, and A. Weiss. 1991. Regulation of interleukin-2 gene enhancer activity by the T cell accessory molecule CD28. Science 251:313. 37. Kundig, T. M . , A . Shahinian, K. Kawai, H-W. Mittrucker, E. Sebzda, M.F. Bachman, T.K. Mak, and P.S. Ohashi. 1996. Duration of TCR stimulation determines costimulatory requirement of T cells. Immunity 5:41. 38. Viola, A. , and A. Lanzavecchia. 1996. T cell activation determined by T cell receptor number and tunable thresholds. Science 273:104. 39. Jenkins, M . K., P.S. Taylor, S.D. Norton, and K . B . Urdahl. 1991. CD28 delivers a costimulatory signal involved in antigen-specific IL-2 production by human T cells. J. Immunol. 147:2461. 40. Boise, L. H. , A.J . Minn, P.J. Noel, C.H. June, M . A . Accavitti, T. Lindsten, and C B . Thompson. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of B C I - X L - Immunity 3:87. 41. Hollander, G. A . 1999. On the stochastic regulation of interleukin-2 transcription. Semin. Immunol. 11:357. 42. Rudd, C. E. 1996. Upstream-downstream: CD28 cosignaling pathways and T cell ( function. Immunity 4:527. 43. Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333. 44. Shapiro, V . S., K .E . Truitt, J.B. Imboden, A . Weiss. 1997. CD28 mediates transcriptional upregulation of the interleukin-2 (IL-2) promoter through a composite element containing the CD28RE and NF-IL-2B AP-1 sites. Mol. Cell Biol. 17:4051. 45. Thompson, C. B., T. Lindsten, J.A. Ledbetter, S.L. Kunkel, H.A. Young, S.G. Emerson, J .M. Leiden, C.H. June. 1989. CD28 activation pathway regulates the production of multiple T-cell-derived lymphokines/cytokines. Proc. Natl. Acad. Sci. 86:1333. 32 46. Wechsler, A. S., M.C. Gordon, U. Dendorfer, K.P. LeClair. 1994. Induction of IL-8 expression in T cells uses the CD28 costimulatory pathway. J. Immunol. 153:2515. 47. Civi l , A., M. Geerts, L.A. Aarden, and C.L. Verweij. 1992. Evidence for a role of CD28RE as a response element for distinct mitogenic T cell activation signals. Eur. J. Immunol. 22:3041. 48. McGuire, K. L. a. M. I. 1997. Involvement of Rel, Fos, and Jun proteins in binding activity to the IL-2 promoter CD28 element/AP-1 sequence in human T cells. J. Immunol. 159:1319. 49. Verweij, C. L., M. Geerts, L.A. Aarden. 1991. Activation of interleukin-2 gene transcription via the T-cell surface molecule CD28 is mediated through an NF-KB-l ike response element. J. Biol. Chem. 266:141 79. 50. Ghosh, P., T.H. Tan, N.R. Rice, A . Sica, H.A. Young. 1993. The interleukin 2 CD28-response complex contains at least three members of the N F - K B family: c-rel, p50, and p65. Proc. Natl. Acad. Sci. 90:1696. 51. Lindsten, T., C H . June, J.A. Ledbetter, G. Stella, C.B. Thompson. 1989. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244:339. 52. Norton, S. D., L. Zuckerman, K.B.Urdahl, R. Shefner, J. Miller, M.K. Jenkins. 1992. The CD28 ligand, B7, enhances IL-2 production by providing a costimulatory signal to T cells. J. Immunol. 149:1556. 53. Michel, F., G. Attal-Bonnefoy, G. Mangino, S. Mise-Omata, and O. Acuto. 2001. CD28 as a molecular amplifier extending TCR ligation and signaling capacities. Immunity 15:935. 54. Rudd, C. E., and M. Raab. 2003. Independent CD28 signaling via V A V and SLP-76: a model for in trans costimulation. Immunol. Rev. 192:32. 55. Kane, L. P., P.G. Andres, K.C. Howland, A.K. Abbas, and A. Weiss. 2001. Akt provides the CD28 costimulatory signal for up-regulation of IL-2 and IFN-y but not TH2 cytokines. Nat. Immunol. 2:3 7. 56. Song, J., S. Salek-Ardakani, P.R. Rogers, M. Cheng, L.V. Parijs, and M. Croft. 2004. The costimulation-regulated duration of PKB activation controls T cell longevity. Nat. Immunol. 5:150. 57. Kearney, E. R., T.L. Walunas, R.W Karr, P.A. Morton, D.Y. Loh, J.A. Bluestone, M.K. Jenkins. 1995. Antigen-dependent clonal expansion of a trace population of 33 antigen-specific CD4 T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4. J. Immunol. 155:1032. 58. Vella, A . T., T. Mitchell, B. Groth, P.S. Linsley, J .M Green, C.B. Thompson, J.W. Kappler, P. Marrack. 1997. CD28 engagement and proinflammatory cytokines contribute to T cell expansion and long-term survival in vivo. J. Immunol. 158:4714. 59. Viola, A. , and A. Lanzavecchia. 1996. T cell activation determined by T cell receptor number and tunable thresholds. Science 273:104. 60. Viola, A. , S. Schroeder, Y . Sakakibara, A . Lanzavecchia. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680. 61. Wulfing, C., M . M . Davis. 1998. A receptor/cytoskeletal movement triggered by costimulation during T cell activation. Science 282. 62. Iezzi, G., K. Karjalainen, and A. Lanzavecchia. 1998. The duration of antigenic stimulation determines the fate of naive and effector T cells. Immunity 8:89. 63. Shahinian, A. , K. Pfeffer, K.P. Lee, T .M. Kundig, K. Kishihara, A. Wakeham, K. Kawai, P.S. Ohashi, C.B. Thompson, and T.K. Mak. 1993. Differential T cell costimulatory requirements in CD28-deficient mice. Science 261:609. 64. Wang, B., R. Maile, R. Greenwood, E.J. Collins, and J.A. Frelinger. 2000. Naive CD8 T cells do not require costimulation for proliferation and differentiation into cytotoxic effector cells. J. Immunol. 164:1216. 65. Pimental-Muinos, F. X . , M . A . Munoz-Fernandez, and M . Fresno. 1994. Control of T lymphocyte activation and IL-2 receptor expression by endogenously secreted lymphokines. J. Immunol. 152:5714. 66. McAdam, A. J., T.T. Chang, A,E . Lumelsky, E.A. Greenfield, V . A . Boussiotis, J.S. Duke-Cohan, T. Chernova, N . Malenkovich, C. Jabs, V . K . Kuchroo, V . Ling, M . Collins, A . H . Sharpe, G.J. Freeman. 2000. Mouse inducible costimulatory molecule (ICOS) expression is enhanced by CD28 costimulation and regulates differentiation of CD4+ T cells. J. Immunol. 165:5035. 67. Parry, R. V., C A . Rumbley, L .H . Vandenberghe, C H . June, J.L Riley. 2003. CD28 and inducible costimulatory protein Src homology 2 binding domains show distinct regulation of phosphatidylinositol 3-kinase, Bcl-xL, and IL-2 expression in primary human CD4 T lymphocytes. J. Immunol. 171:166. 68. Liang, L., W.C. Sha. 2002. The right place at the right time: novel B7 family members regulate effector T cell responses. Curr. Opin. Immunol. 14:384. f 34 69. Iwasaki, A., R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5:987. 70. Steinman, R. M., D. Hawiger, M.C. Nussenzweig. 2003. Tolerogenic dendritic cells. Annu. Rev. Immunol. 21:685. 71. Janeway, C. A. J., R. Medzhitov. 1998. Introduction: the role of innate immunity in the adaptive immune response. Semin. Immunol. 10:349. 72. Constant, S. L., K. Bottomly. 1997. Induction of Thl and Th2 CD4 + T cell responses: the alternative approaches. Annu. Rev. Immunol. 15:297. 73. Carswell, E. A., L.J. Old, R.L. Kassel, S. Green, N. Fiore, B. Williamson. 1975. An endotoxin-induced serum factor that causes necrosis of tumors. Proc. Natl. Acad. Sci. USA 72:3666. 74. Granger, G. A., S.J. Shack, T.W. Williams, W.P. Kolb. 1969. Lymphocyte in vitro cytotoxicity: specific release of lymphotoxin-like materials from tuberculin-sensitive lymphoid cells. Nature 221:1155. 75. Smith, C. A., T. Farrah, R.G. Goodwin. 1994. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell 76:959. 76. Ashkenazi, A., V . M . Dixit. 1998. Death receptors: signaling and modulation. Science 281:1305. 11. Wallach, D., E.E. Varfolomeev, N.L. Malinin, Y .V . Goltsev, A.V. Kovalenko, M.P. Boldin. 1999. Tumor necrosis factor and Fas signaling mechanisms. Annu. Rev. Immunol. 17:331. 78. Maini, R. N., P.C. Taylor. 2000. Anti-cytokine therapy for rheumatoid arthritis. Annu. Rev. Med. 51:207. 19. Papadakis, K. A., S.R. Targan. 2000. Role of cytokines in the pathogenesis of inflammatory bowel disease. Annu. Rev. Med. 51:289. 80. MacEwan, D. J. 2002. TNF ligands and receptors - a matter of life and death. Br. J. Pharmacol. 135:855. 81. Paul, A. T., V . M . Gohil, and K.K. Bhutani. 2006. Modulating TNF-a signaling with natural products. Drug Discovery Today 11:725. 82. Olleros, M. L., R. Guler, N. Corazza, D. Vesin, H.P. Eugster, G. Marchal, P. Chavarot, C. Mueller, and I. Garcia. 2002. Transmembrane TNF induces an efficient cell-mediated immunity and resistance to Mycobacterium bovis bacillus 35 Calmette-Guerin infection in the absence of secreted TNF and lymphotoxin-alpha. J. Immunol. 168:3394. 83. Ruuls, S. R., R.M Hoek, V.N. Ngo, T. McNeil, L.A. Lucian, M.J. Janatpour, H. Korner, H. Schreerens, E.M. Hessel, J.G. Cyster, L.M. McEvoy, J.D. Sedgwick. 2001. Membrane-bound TNF supports secondary lymphoid organ structure but is subservient to secreted TNF in driving autoimmune inflammation. Immunity 15:533. 84. Musicki, K., H. Briscoe, S. Tran, W.J. Britton, and B.M. Saunders. 2006. Differential requirements for soluble and transmembrane tumor necrosis factor in the immunological control of primary and secondary Listeria monocytogenes infection. Infect. Immun. 74:3180. 85. Georgopoulos, S., D. Plows, and G. Kollias. 1996. Transmembrane TNF is sufficient to induce localized tissue toxicity and chronic inflammatory arthritis in transgenic mice. J. Inflamm. 46:86. 86. Croft, M. 2003. Co-stimulatory members of the TNFR family: keys to effective T-cell immunity. Nat. Rev. Immunol. 3:609. 87. Watts, T. H. 2005. TNF/TNFR family members in costimulation of T cell responses. Annu. Rev. Immunol. 23:23. 88. Bodmer, J. L., P. Schneider, J. Tschopp. 2002. The molecular architecture of the TNF superfamily. Trends Biochem. Sci. 27:19. 89. Borst, J., C. Sluyser, E. De Vries, H. Klein, C.J. Melief, R.A. Van Lier. 1989. Alternative molecular form of human T cell-specific antigen CD27 expressed upon T cell activation. Eur. J. Immunol. 19:357. 90. Morel, Y., J.M. Schiano de Colella, J. Harrop, K.C. Deen, S.D. Holmes, T.A. Wattam, S.S. Khandekar, A. Truneh, R.W. Sweet, J.A. Gastaut, D. Olive, R.T. Costello. 2000. Reciprocal expression of the TNF family receptor herpes virus entry mediator and its ligand LIGHT on activated T cells: LIGHT down-regulates its own receptor. J. Immunol. 165:4397. 91. Gramaglia, I., A.D. Weinberg, M. Lemon, M. Croft. 1998. Ox-40 ligand: a potent co-stimulatory molecule for sustaining primary CD4 T cell responses. J. Immunol. 161:6510. 92. Pollok, K. E., S.H. Kim, B.S. Kwon. 1995. Regulation of 4-1BB expression by cell-cell interactions and the cytokines, interleukin-2 and interleukin-4. Eur. J. Immunol. 25:488. 36 93. Diehl, L., G.J. van Mierlo, A.T. den Boer, E. van der Voort, M . Fransen, L. van Bostelen, P. Krimpenfort, C.J. Melief, R. Mittler, R.E. Toes, R. Offringa. 2002. In vivo triggering through 4-1 BB enables Th-independent priming of CTL in the presence of an intact CD28 costimulatory pathway. J. Immunol. 168:3755. 94. Rogers, P. R., J. Song, I. Gramaglia, N . Kileen, M . Croft. 2001. OX40 promotes Bcl-x L and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity 15:445. 95. Pollok, K. E., Y . J . Kim, J. Hurtado, Z. Zhou, K . K Kim, B.S. Kwon. 1994. 4-1 BB T cell antigen binds to mature B cells and macrophages, and costimulates anti-mu-primed splenic B cells. Eur. J. Immunol. 24:367. 96. Ohshima, Y. , Y . Tanaka, H. Tozawa, Y . Takahashi, C. Maliszewski, G. Delespesse. 1997. Expression and function of OX40 ligand on human dendritic cells. J. Immunol. 159:3838. 97. Hintzen, R. Q., S.M. Lens, M.P Beckmann, R.G. Goodwin, D. Lynch, R.A. van Lier. 1994. Characterization of the human CD27 ligand, a novel member of the TNF gene family. J. Immunol. 152:1762. 98. Lens, S. M . , K . Tesselaar, M . H . van Oers, R.A. van Lier. 1998. Control of lymphocyte function through CD27-CD70 interactions. Semin. Immunol. 10:491. 99. Hintzen, R. Q., S.M. Lens, K. Lammers, H. Kuiper, M.P. Beckmann, R.A. van Lier. 1995. Engagement of CD27 with its ligand CD70 provides a second signal for T cell activation. J. Immunol. 154:2612. 100. Hendriks, J., Y . Xiao, J. Borst. 2003. CD27 promotes survival of activated T cells and complements CD28 in generation and establishment of the effector T cell pool. J. Exp. Med. 198:1369. 101. Agemats.u, K., T. Kobata, K. Sugita, G.J. Freeman, M.P. Beckmann, S.F. Schlossman, C. Morimoto. 1994. Role of CD27 in T cell immune response. Analysis by recombinant soluble CD27. J. Immunol. 153:1421. 102. Oshima, H., H. Nakano, C. Nohara, T. Kobata, A . Nakajima, N.A. Jenkins, D.J. Gilbert, N .G Copeland, T. Muto, H. Yagita, K. Okumura. 1998. Characterization of murine CD70 by molecular cloning and mAb. Int. Immunol. 10:517. 103. Hendriks, J., L .A. Gravestein, K. Tesselaar, R.A. van Lier, T.N. Schumacher, J. Borst. 2000. CD27 is required for generation and long-term maintenance of T cell immunity. Nat. Immunol. 1:433. 104. Weinberg, A.-D. , A.T. Vella, M . Croft. 1998. OX-40: life beyond the effector T cell stage. Semin. Immunol. 10:471. 37 105. Akiba, H., H. Oshima, K. Takeda, M . Atsuta, H. Nakano. 1999. CD28-independent costimulation of T cells by OX40 ligand and CD70 on activated B cells. J. Immunol. 162:7058. 106. Bansal-Pakala, P., B.S. Halteman, M.H . Cheng, and M . Croft. 2004. Costimulation of CD8 T cell responses by OX40. J. Immunol. 172:4821. 107. Gramaglia, I., A . Jember, S.D. Pippig, A.D. Weinberg, N . Killeen, M . Croft. 2000. The OX40 costimulatory receptor determines the development of CD4 memory by regulating primary clonal expansion. J. Immunol. 165:3043. 108. Song, J., S. Salek-Ardakani, P.R. Rogers, M . Cheng, L. Van Parijs, and M . Croft. 2004. The costimulation-regulated duration of PKB activation controls T cell longevity. Nat. Immunol. 5:150. 109. Chen, A. I., A.J . McAdam, J.E. Buhlmann, S. Scott, M.L . Lupher Jr, E.A. Greenfield, P.R. Baum, W.C. Fanslow, D .M. Calderhead, G.J. Freeman, A . H . Sharpe. 1999. OX40-ligand has a critical costimulatory role in dendritic cell:T cell interactions. Immunity 11:689. 110. Kopf, M . , C. Ruedl, N . Schmitz, A . Gallimore, K. Lefrang, B. Ecabert, B. Odermatt, M.F. Bachmann. 1999. OX40-deficient mice are defective in Th cell proliferation but are competent in generating B cell and CTL responses after virus infection. Immunity 11:699. 111. Murata, K., N . Ishii, H . Takano, S. Miura, L.C. Ndhlovu, M . Nose, T. Noda, K. Sugamura. 2000. Impairment of antigen-presenting cell function in mice lacking expression of OX40 ligand. J. Exp. Med. 191:365. 112. Vinay, D. S., B.S. Kwon. 1998. Role of 4-1BB in immune responses. Semin. Immunol. 10:481. 113. Gramaglia, I., D. Cooper, K.T. Miner, B.S. Kwon, M . Croft. 2000. Co-stimulation of antigen-specific CD4 T cells by 4-IBB ligand. Eur. J. Immunol. 30:392. 114. Chu, N . R., M.A. DeBenedette, B.J. Stiernholm, B.H. Barber, T.H. Watts. 1997. Role of IL-12 and 4-IBB ligand in cytokine production by CD28 + and CD28" T cells. J. Immunol. 158:3081. 115. Saoulli, K., S.Y. Lee, J.L. Cannons, W.C. Yeh, A. Santana, M.'D. Goldstein, N . Bangia, M.A. DeBenedette, T.W. Mak, Y . Choi, T.H. Watts. 1998. CD28-independent, TRAF2-dependent costimulation of resting T cells by 4-1 BB ligand. J. Exp. Med. 187:1849. 38 116. Hurtado, J. C , Y .J . Kim, B.S. Kwon. 1997. Signals through 4-1 BB are costimulatory to previously activated splenic T cells and inhibit activation-induced cell death. J. Immunol. 158:2600. 117: DeBenedette, M. A., T. Wen, M.F. Bachmann, P.S. Ohashi, B.H. Barber, K.L Stocking, J.J. Peschon, T.H. Watts. 1999. Analysis of 4-1BB ligand (4-1BBL)-deficient mice and of mice lacking both 4-1 B B L and CD28 reveals a role for 4-1BBL in skin allograft rejection and in the cytotoxic T cell response to influenza virus. J. Immunol. 163:4833. 118. Tan, J. T., J.K. Whitmire, R. Ahmed, T.C. Pearson, C P . Larsen. 1999. 4-1 BB ligand, a member of the TNF family, is important for the generation of antiviral CD8 T cell responses. J. Immunol. 163:4859. 119. Tan, J. T., J.K. Whitmire, K. Murali-Krishna, R. Ahmed, J.D. Altman, R.S. Mittler, A. Sette, T.C. Pearson, C P . Larsen. 2000. 4-1 BB costimulation is required for protective anti-viral immunity after peptide vaccination. J. Immunol. 164:2320. 120. Cooper, D., P. Bansal-Pakala, M. Croft. 2002. 41BB (CD137) controls the clonal expansion and survival of CD8 T cells in vivo but does not contribute to the development of cytotoxicity. Eur. J. Immunol. 32:521. 121. Kwon, B. S., J.C. Hurtado, Z.H. Lee, K.B. Kwack, S.K. Seo, B.K. Choi, B.H. Koller, G. Wolisi, H.E. Broxmeyer, D.S. Vinay. 2002. Immune responses in 4-1BB (CD137)-deficient mice. J. Immunol. 168:5483. 122. Bertram, E. M., P. Lau, T.H. Watts. 2002. Temporal segregation of 4-1BB versus CD28-mediated co-stimulation: 4-IBB ligand influences T cell numbers late in the primary response and regulates the size of the T cell memory response following influenza infection. J. Immunol. 168:3777. 123. Inoue, J., T. Ishida, N. Tsukamoto, N. Kobayashi, A. Naito, S. Azuma, T. Yamamoto. 2000. Tumor necrosis factor receptor-associated factor (TRAF) family: adaptor proteins that mediate cytokine signaling. Exp. Cell. Res. 254:14. 124. Wajant, H., M. Grell, P. Scheurich. 1999. TNF receptor associated factors in cytokine signaling. Cytokine Growth Factor Rev. 10:15. 125. Tartaglia, L. A., R.F. Weber, S. Figari, C. Reynolds, M.A. Palladino Jr., and D.V. Goeddel. 1991. The two different receptors for tumor necrosis factor mediate distinct cellular responses. Proc. Natl. Acad. Sci. USA 88:9292. 126. Shalaby, M. R., A. Sundan, H. Loetscher, M. Brockhaus, W. Lesslauer, and T. Espevik. 1990. Binding and the regulation of cellular functions by monoclonal antibodies against human tumor necrosis factor receptors. J. Exp. Med. 172:1517. 39 127. Chan, F. K.-M., R. Siegel, and M.J. Lenardo. 2000. Signaling by die TNF receptor superfamily and T cell homeostasis. Immunity 13:419. 128. Yokota, S., T.D. Geppart, and P.E. Lipsky. 1988. Enhancement of antigen- and mitogen-induced human T lymphocyte proliferation by tumor necrosis factor-alpha. J. Immunol. 140:531. 129. Ware, C. F., P.D. Crowe, T.L. Vanarsdale, J.L. Andrew, M.H. Grayson, R. Jerzy, C A . Smith, and R.G. Goodwin. 1991. Tumor necrosis factor (TNF) receptor expression in T lymphocytes. Differential regulation of the type 1 TNF receptor during activation of resting and effector T cells. J. Immunol. 147:4229. 130. Tartaglia, L. A., and D.V. Goeddel. 1992. Two TNF receptors. Immunol. Today 13:151. 131. Micheau, O., and J. Tschopp. 2003. Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114:181. 132. Zheng, L., G. Fisher, R.E.. Miller, J. Peschon, D.H. Lynch, and M.J. Lenardo. 1995. Induction of apoptosis in mature T cells by tumour necrosis factor. Nature 377:348. 133. Tsitsikov, E. N., D. Laouini, LF. Dunn, T.Y. Sannikova, L. Davidson, F.W. Alt, and R.S. Geha. 2001. TRAF1 is a negative regulator of TNF signaling: enhanced TNF signaling in TRAF1 -deficient mice. Immunity 15:647. 134. Rothe, J., W. Lesslauer, H. Lotsher, Y . Lang, P. Koebel, F. Kontgen, A. Althage, R. Zinkernagel, M. Steinmetz, and H. Bluethmann. 1993. Mice lacking the tumor necrosis factor receptor-1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364:798. 135. Pfeffer, K., T. Matsuyama, T.M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P.S. Ohashi, M. Kronke, and T.W. Mak. 1993. Mice deficient for the 55 kD tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73:45 7. 136. Erickson, S. L., F.J. de Sauvage, K. Kikly, K. Carver-Moore, S. Pitts-Meek, N. Gillett, K.C.F. Sheehan, R.D. Schreiber, D.V. Goeddel, and M.W. Moore. 1994. Decreased sensitivity to tumor necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature 372:560. 137. Hi l l , G. R., T. Teshima, V.I. Rebel, O.I. Krijanovski, K.R. Cooke, Y.S. Brinson, and J.L.M. Ferrara. 2000. The p55 TNF-alpha receptor plays a critical role in T cell alloreactivity. J. Immunol. 164:656. 40 Chapter 2 Tumor necrosis factor receptor-2 (p75) lowers the threshold of T cell activation1 2.1 Preface T cell activation requires a threshold amount of T cell receptor (TCR)-mediated signals, an amount that is reduced by signals mediated through co-stimulatory molecules expressed on the T cell surface. This chapter examines the role of TNFR2 as a putative co-stimulatory receptor for T cell activation in response to TCR cross-linking stimulation in vitro. TNFR2 deficiency in CD8 + T cells increased the requirements for TCR agonist-induced proliferation approximately 5-fold. TNFR2 7 " T cells displayed a marked reduction in the proliferative response to TCR agonist, delayed kinetics of induction of the acute activation markers CD25 and CD69, and a marked decrease in the production of IL-2 and IFN-y. Addition of exogenous IL-2 to T cell cultures rescued the proliferative response of TNFR2"7" T cells. Interestingly, CD28 co-ligation was only partially effective in rescuing the proliferative defect of TNFR2" / _ CD8 + T cells. Thus TNFR2 provides an important co-stimulatory signal in addition to that provided by CD28 towards optimal T cell proliferation and IL-2 production. This chapter describes experiments showing that TNFR2 lowers the threshold of T cell activation, promotes IL-2 production, and induces clonal expansion of effector CD8 + T cells. A version of this chapter has been published as: Kim, E.Y. and H.S. Teh. 2001. TNF type 2 receptor (p75) lowers the threshold of T-cell activation. J. Immunol. 167:6812-6820. 41 2.2 Introduction T cells occupy a central role in the initiation and regulation of the adaptive immune response (reviewed in ref. 1). T cell activation is tightly regulated, involving coordinated integration of multiple signals to ensure antigen-specific clonal expansion and differentiation (1). Although the T cell receptor (TCR) plays a major role in defining the fine specificity of an immune response, additional mechanisms have evolved to ensure self-tolerance (2). The general requirement of co-stimulatory signals for the optimal activation of T cells, in addition to the antigen-specific signal delivered through the TCR, is a major means by which self-tolerance is achieved. The antigen-specific signal is integrated with co-stimulatory signals, and the convergence of positive signals pushes the T cell towards activation (3). Such mechanisms serve to protect against untoward autoimmune reactions and to focus the immune response on the infected target tissue (2). Clearly, the elucidation of the multiple mechanisms that regulate T cell behavior is crucial towards elucidation of their potential role in disease processes, such as immunodeficiency and autoimmunity. In the context of infection, a major co-stimulatory pathway involves the CD28 molecule on the T cell surface (reviewed in ref* 1). Antigen presenting cells (APCs) express CD28-ligand (B7) upon activation by foreign pathogen (4). Infectious agents are processed into antigenic peptides, and APCs thus display both antigen and co-stimulatory ligands to antigen-specific T cells (4). Therefore, the induction of B7 on the surface of the APC alerts antigen-specific T cells of the presence of infectious agents. These signals are integrated within the responding T cell, and in effect, co-stimulation serves to lower the threshold amount of signals required through the TCR complex for optimal T cell activation (5). Conversely, in the absence of infection, APCs do not upregulate co-stimulatory molecules, 42 and T cells normally remain functionally inactive or are tolerized upon contact with such an APC (1). A corollary of this model is that without co-stimulatory signals, the signals mediated through the TCR complex are normally insufficient for mounting a functional antigen-specific T cell response. However, studies using CD28-deficient mice have shown that co-stimulation through the CD28 pathway is not an absolute requirement for T cell activation (6-10). These studies suggest that the intensity and duration of the antigenic signal mediated through the TCR is a critical factor (5, 8, 11). Furthermore, although CD28 represents a major co-stimulatory pathway, both in vitro and in vivo studies strongly suggest that there are additional co-stimulatory pathway(s) that can lead to a functional T cell response. Indeed, infectious agents can trigger numerous co-stimulatory molecules and cytokines in addition to B7, including the pro-inflammatory cytokine TNF-a. Several studies have implicated TNF-a in playing a co-stimulatory role in T cell proliferation (12-16). Indeed, APCs not only express CD28 ligand in response to infectious agents, but also express TNF-a when activated. Interestingly, there is a substantial increase in T cell proliferation in response to TCR agonist when TNF-a is added exogenously, comparable to that found when IL-2 is added exogenously (11). Importantly, the proliferative response of T cells to stimulation through the TCR complex is essentially abolished when a neutralizing antibody to TNF-a is added (11). In addition, TNF-a is expressed early during T cell activation (17), suggesting that it may serve as a regulatory control point. Taken together, this suggests that TNF-a, provided both exogenously upon APC activation by infectious agents and/or endogenously upon T cell activation, can act 43 through a co-stimulatory pathway and may be a critical regulatory point for the progression of the T cell response. TNF-a binds to two distinct receptors on the cell surface, TNFR-1 (p55) and TNFR-2 (p75) (reviewed in ref. 18). Studies using agonist antibodies have demonstrated that the two receptors signal distinct TNF activities (12). While TNFR1 signaling was shown to be responsible for inducing cytotoxicity and the induction of several genes, TNFR2 signaling was shown to be capable of inducing proliferation of primary thymocytes and a cytotoxic T cell line (13). Agonist antibodies towards TNFR2 can enhance the proliferative response of T cells to a level observed when adding TNF-a exogenously to cell cultures, whereas specific activation of TNFR 1 had no effect (15). More recently, Micheau and Tschopp showed that TNFR1 can signal both death and survival by using a mechanism involving two sequential signaling complexes: an initial plasma membrane bound complex (complex I) consisting of TNFR1, the adaptor TRADD, the kinase RIP1, and TRAF2 that rapidly signals activation of NF-kappa B. and a second step forming a cytoplasmic complex (complex II), wherein TRADD and RIP1 associate with FADD and caspase-8 to signal cell death. However, TNFR2 is the predominant TNF receptor on activated T cells, suggesting that the pro-survival signal potentially derived from TNFR1 is likely minimal during T cell activation. However, these studies do not address whether the TNFR2 signal is important, or if it is actually a redundant pathway. Recently, mice deficient in TNFR1 (19, 20) and TNFR2 (21) TNFRs were generated to clarify the respective roles of these receptors in the immune system. These studies confirmed the importance of p55 for the cytotoxicity associated with TNF-a. Interestingly, T N F R l 7 " T 44 cells did not exhibit a defect in proliferative response to mitogens such as concanavalin A (ConA) or TCR cross-linking (22). This is consistent with the observations that agonists specific for p55 did not affect the proliferative response to TCR agonists (15). Functional analysis of TNFR2 _ /" T cells did not reveal any changes in responsiveness,, including response to the mitogen Con A (21). However, the same group that generated TNFR2_ /~ mice did not examine T cell response to specific stimulation through the TCR complex, which is the normal physiological route of T cell activation. Furthermore, no study to date had examined the importance of TNFR2 for T cell proliferation using TCR specific stimulation. Therefore, a potentially critical co-stimulatory pathway has been neglected, and the elucidation of the mechanisms that lead to a functional T cell response is incomplete. This question was addressed in this chapter by examining the ex vivo response of TNFR2 / _ T cells to specific stimulation through the TCR complex. It was determined that TNFR2~/~ T cells display a marked reduction in this proliferative response, and that TNFR2 deficiency in CD8 + T cells increased the requirements for TCR agonist to generate an equivalent response to wild-type. The nature of this hypo-proliferative response was further characterized to elucidate the role of TNFR2 amongst the complex signaling pathways that are activated during the T cell response. Functional analyses revealed that TNFR2_ /~ CD8 + T cells produce significantly less IL-2 and IFN-y in response to TCR agonist, and display delayed kinetics in the acquisition of activation phenotype. We propose a model in light of these data that TNFR2 contributes in a non-redundant manner to the activation of gene expression that are associated with T cell activation. 1 45 2.3 Materials and Methods Mice Breeders for C57BL/6 (B6, H-2b) and B6-TNFR2 7" mice were obtained from The Jackson Laboratories (Bar Harbor, ME). B6 mice deficient in the TNFR2 TNF-a receptor have been previously described (21). TNFR2 _ /" mice were genotyped using a PCR strategy. Mice 4 to 7 weeks of age were used for all experiments. Antibodies and flow cytometry The'following Abs were used: FITC-conjugated mAbs to mouse CD8 (53.67), PE-conjugated CD4 (GK1.5), and biotin-conjugated CD25 (PC61), CD44 (Pgp-1), and CD69 (H1.2F3) (PharMingen, supplied by Cedarlane, Hornby, Ontario). Cell staining and flow cytometric analysis were performed according to standard procedures. Briefly, cells were incubated with the relevant Abs for at least 15 min at 4 °C, and subsequently washed twice with FACS medium (PBS + 2% FCS). CELLQUEST (Becton Dickinson, Mountain View, CA) was used for data acquisition and analysis. Cells Lymph nodes were harvested and single cell suspensions prepared from each of the mouse lines. For studies of CD4" CD8 + (CD8) and CD4 + CD8" (CD4) T cell subsets, each of the respective populations were purified from whole lymph node cell suspensions using miniMACS microbeads (Miltenyi Biotec, Auburn, CA) and either mouse biotin-conjugated CD8(3 (53.58) mAb or CD4 mAb (GK1.5). The respective T cell subsets were positively selected using a M A C S M S + Separation column and Min iMACS magnet, as per 46 manufacturer's protocol (Miltenyi Biotec), achieving > 95% purity as determined by flow cytometry. Cells were cultured at 37°C and 5% CO2 in Iscove's D M E M (Life Technologies, Burlington, Ontario) supplemented with 10% (v/v) FBS (Life Technologies), 5 x 10"5 uM 2-ME, and antibiotics (1-media). Proliferation assays and cell surface marker expression Proliferation assays were performed by incubating 1 x 105 cells with varying concentrations (0 to 10 ug/ml) of plate-bound anti-CD3s (2C11). Cells were cultured in triplicates in a volume of 0.2 ml in flat-bottom 96-well plates, and 1 uCi of [3H]thymidine was added for the last 10 hrs of a 72 hr culture period. In some cultures, exogenous IL-2 was added at a concentration of 20 U/ml. Cell surface marker expression was assayed using 1 x 105 cells incubated in flat-bottom 96-well plates coated with 10 |ig/ml of anti-CD3 for various periods of time. The activation markers CD25 and CD69 were analyzed by FACS (described above). In other cultures, 10 ug/ml of soluble anti-CD28 mAb (37.51) was included. Carboxyfluorescein diacetate succinimidyl ester fluorescence assay Purified CD8 + T cells (1 x 106) were labeled with 1 uM carboxyfluorescein diacetate succinimidyl ester (CFSE) and incubated with 10 p.g/ml of plate-bound anti-CD3 in a flat-bottom 24-well plate for various periods of time. Cells were harvested and stained with the indicated Abs or with 7-amino actinomycin D (7-AAD), and subsequently analyzed by FACS (described above). 47 7-AAD assay CD8 + T cells (1 x 106) were incubated with 10 fag/ml of plate-bound anti-CD3 in a flat-bottom 24-well plate for various periods of time. Cells were harvested and stained with 7-A A D (10 ug/ml in FACS medium), fixed with 4% paraformaldehyde, and subsequently analyzed by FACS (described above). Cytokine ELISA C D 8 + T cells (2 x 106) were cultured in 1 ml of I-media in a flat-bottom 24-well plate coated with 10 (ag/ml of anti-CD3 for 20 hrs. The amount of IL-2 and IFN-y secreted into the supernatant was determined by ELISA. The capture and detection Abs used for IL-2 were JES6-1A12 and JES6-5H4, respectively (obtained from PharMingen). The capture and detection Abs used for IFN-y were R4-6A2 and XMG1.2, respectively (PharMingen). Briefly, plates were coated with the capture Ab (4 u-g/ml in carbonate buffer) and blocked with 1% BSA/ 0.1% azide in PBS. Wells were washed with PBS-Tween 20 and samples were then added in three dilutions (1:2, 1:5, 1:10), with each plate containing wells for standard. The wells were washed and the detection Ab (1 ug/ml in 1% BSA/ 0.1% azide in PBS) was added. The wells were then washed and streptavidin-alkaline phosphatase (PharMingen) was added (1/2000 in 1% BSA/ 0.1% azide in PBS). After washing the wells, substrate (Sigma 104) was added and plates were subsequently analyzed with an ELISA plate reader at 405 nm. 48 Intracellular cytokine assay L N cells (1 x 106) were incubated with 10 pg/ml of plate-bound anti-CD3 for 36 hrs, with the last 6 hrs in the presence of Golgi Stop (PharMingen) and subsequently stained for intracellular cytokine expression, as described previously (23). Briefly, cells were harvested and stained with anti-CD8PE and anti-CD4Tricolor. Cells were then fixed with 2% paraformaldehyde and permeabilized with 0.3% (w/v) saponin in FACS medium. Anti-cytokine Abs used: for IL-2, FITC-anti-mouse IL-2 (JES6-5H4); for IFN-y, PE-anti-mouse IFN-y (XMG1.2). Cells were washed with permeabilization buffer and analyzed by FACS. Competitive and quantitative RT-PCR for cytokine mRNA levels Competitive and quantitative polymerase chain reaction (CQ-PCR) was used to determine the intracellular levels of IL-2 and TNF mRNA. T cells (2 x 106) were cultured in 1 ml of I-media in flat-bottom 24-well plates coated with 5 pg/ml of anti-CD3 for 9 hrs. Cells were then harvested and total RNA was prepared according to the manufacturer's recommendations using the RNeasy Mini Kit (Qiagen). cDNAs were generated from the total RNA preparation as previously described (24). CQ-PCR was then performed as previously described (24). Briefly, the amount of cDNA was normalized between TNFR2 7 " and wild-type T cells using the house-keeping gene HPRT. The linearized pPQRS plasmid was used as the competitor (gift from Richard Locksley, University of California San Francisco). The sequences for the 5' and 3' oligonucleotide primers used for IL-2 were, respectively: 49 5' CCACTTCAAGCTCTACAGCGGAAG 3' and 5' GAGTCAAATCCAGAACATGCCGCA 3'. The sequences for the 5' and 3' oligonucleotide primers used for TNF-a were, respectively: 5'GTTCTATGGCCCAGACCCTCACAC 3' and 5' TCCCAGGTATATGGGTTCATACCAAG 3'. The sequences for the 5' and 3' oligonucleotide primers used for HPRT were, respectively: 5' GTTGGATACAGGCCAGACTTTGTTG 3' and 5' GAGGGTAGGCTGGCCTATAGGCT 3'. The PCR products were subjected to electrophoresis on a 2% agarose gel, and visualized with ethidium bromide. Densitometry was performed using the Alphalmager software. 2.4 Results Proliferative response to TCR cross-linking is reduced in lymph node T cells from TNFR2'A mice To determine whether TNFR2 plays a role in the proliferative response of T cells to TCR cross-linking, lymph node cells from B6 and B6-TNFR2"7" mice were stimulated with immobilized anti-CD3e mAb (2C11) to induce proliferation. Immobilized Ab mimics the MHC:peptide arrays on the surface of an APC. The proliferative response of TNFR2_ /~ lymph node T cells was significantly reduced (Fig. 2.1^4). We next investigated whether exogenous IL-2 could rescue the hypo-proliferative response displayed by TNFR2 7 " T cells. As shown in Fig. 2AB, the addition of exogenous IL-2 was able to rescue the proliferative response ot TNFR2"7" T cells to TCR cross-linking. This suggests that TNFR2 7 " T cells are able to respond to IL-2, and that the reduction in the proliferative response to TCR cross-linking may be due, at least in part, to a lack of IL-2 production. The hypo-proliferative response of TNFR2"7" T cells is not due to defects in TCR expression since these cells express similar levels as wild-type (data not shown). The TNFR2" /" and wild type T cells 50 used in these studies were similar in cell surface expression of activation/memory markers (i.e. CD25, CD69, CD44) (data not shown). Furthermore, a similar proliferative defect in response to TCR cross-linking was observed in TNFR2_ /~ T cells even after depletion of CD44-positive cells (data not shown). Thus, naive T cells lacking TNFR2 expression are hypo-proliferative in response to TCR cross-linking. This proliferative defect was not observed for TNFR1"7" T cells (data not shown), demonstrating that the biological effect of TNF on T cell proliferation is restricted to TNFR2. TNFR2 lowers the activation threshold for proliferation by CD4+ and CD8+ T cells To examine whether TNFR2 modulates the threshold of T cell activation for proliferation, the proliferative response of purified TNFR2"A CD8 + T cells to varying doses of anti-CD3 was determined. As shown in Fig. 2.2.4, CD8 + T cells deficient in TNFR2 required approximately five-fold greater anti-CD3 stimulation to mount a response equivalent to wild-type CD8 + T cells. This result suggests that TNFR2 decreases the threshold of activation for proliferation by lowering the requirement for signals derived from the TCR. Similarly, the proliferative response of CD4 + T cells deficient in TNFR2 was also affected, indicating that TNFR2 plays an important role for both T cell subsets (Fig. 2.2B). To determine whether exogenous IL-2 could rescue the hypo-proliferative response of TNFR2 7 " T cells, the proliferation assays were performed in cultures supplied with exogenous IL-2. As shown in Figs. 2.2,4 and 2.2B, exogenous IL-2 markedly enhanced the proliferative potential for both cell types. At lower doses of anti-CD3, exogenous IL-2 was able to rescue the proliferative response of TNFR2 _ /" CD4 + and CD8 + T cells. Since IL-2 is a critical growth factor for T cell proliferation, this observation is consistent with the hypothesis that . 51 the induction of IL-2 production (or secretion) in response to T C R cross-linking is impaired in T cells deficient in T N F R 2 . We noted in Fig. 2.2A that at higher doses of anti-CD3 and in the presence of exogenous IL-2, TNFR2" / _ C D 8 + T cells displayed a greater proliferative response than wild-type C D 8 + T cells. Wild-type C D 8 + T cells undergo activation-induced cell death (AICD) as a means of limiting the extent of expansion in an auto-regulatory manner (25). We have previously shown that TNFR2" / _ C D 8 + T cells are highly resistant to Fas-mediated A I C D (26). To determine whether this increase in proliferative response could be due to the resistance of TNFR2 _ / " C D 8 + T cells to A I C D , C D 8 + T cells were stimulated with anti-CD3 in the presence of exogenous IL-2 and subsequently stained with 7 - A A D as a means of determining the percentages of viable cells. A s shown in Fig. 2.3A, cultures of TNFR2 _ / " C D 8 + T cells contained more live cells (74 % 7 - A A D negative) than wild-type (19% 7 - A A D negative). The TNFR2~ / _ population also contains fewer early apoptotic cells (1%) compared to the wild-type population (19%). This observation is consistent with the hypothesis that the increase in the proliferative response of TNFR2 _ / ~ C D 8 + T cells compared to' wild-type when activated with high concentrations of anti-CD3 and exogenous IL-2 is due to their resistance to A I C D . B y contrast, the proliferative response of TNFR2" / " C D 4 + T cells is fairly similar to that of wild-type C D 4 + T cells at all concentrations of anti-CD3 tested in the presence of exogenous IL-2. We have previously found that in contrast to C D 8 + T cells, T N F R 2 7 " C D 4 + T cells were similar in sensitivity to Fas-mediated A I C D when compared to wild-type C D 4 + T cells (26). Staining of the TNFR2" 7" C D 4 + T cell culture with 7 - A A D indicated that there were only minor differences in the proportion of live and early apoptotic cells in this culture compared to wi ld type (Fig. 2.35). This observation provides additional 52 support to the hypothesis that activated TNFR2"'" C D 4 + and C D 8 + T cells differ in their susceptibility to A I C D and that T N F R 2 has distinct functions in C D 4 + and C D 8 + T cells. The hypo-proliferative response of TNFR2 _ / " T cells was further investigated by examining their susceptibility to apoptosis when stimulated with T C R agonist alone. The number of viable cells recovered after 72 hrs of anti-CD3 stimulation was much lower for T N F R 2 7 " C D 8 + T cell cultures (Fig. 2AA), consistent with the proliferation data (Fig. 2.2A). Staining of the cultures with 7 - A A D after 48 h of anti-CD3 stimulation revealed that a greater percentage of cells were viable (42% 7 - A A D negative) in the wild-type cultures compared to those of TNFR2" / _ T cells (19% 7 - A A D negative) (Fig. 2AB). This indicates that TNFR2" 7" T cells stimulated with anti-CD3 without exogenous IL-2 are more susceptible to apoptosis than wild-type cells. TNFR2'1' CD8+ T cells display a marked reduction in the dividing population in response to TCR cross-linking C F S E is a dye that binds irreversibly to cellular proteins, and pennits analyses of the parameters and kinetics of cell division events (27). We used this technique to determine the number of cellular divisions by T N F R 2 7 " and wild type C D 8 + T cells that have been activated by T C R cross-linking. As shown in Fig. 2.5, there was a marked reduction in the proportion of T N F R 2 7 " C D 8 + T cells that have divided after 60 hrs of anti-CD3 stimulation. Wild-type C D 8 + T cells underwent considerable division, as nearly all cells had decreased C F S E fluorescence relative to unstimulated cells that' remained C F S E h l . This indicates that the hypo-proliferative response of T N F R 2 7 " C D 8 + T cells in the absence of exogenous IL-2 is due to a marked reduction in the number of cells that have undergone division. 53 CFSE-labeled cells were also stimulated in the presence of exogenous IL-2 to study whether it could rescue the hypo-proliferative response observed for TNFR2_ /~ CD8 + T cells. As expected, cultures that were stimulated in the presence of exogenous IL-2 had undergone a greater number of divisions than in the absence of exogenous IL-2, as reflected in the relative decrease in CFSE fluorescence. Consistent with the results from the [3H]thymidine incorporation assay (Fig. 2.2), TNFR2 7 " CD8 + T cells stimulated in the presence of IL-2 were able to divide to at least the same extent as wild-type. In addition, essentially all of the TNFR2_ /~ CD8 + T cells that were stimulated in the presence of exogenous IL-2 had undergone division. Together, these results demonstrate that TNFR2 7 " CD8 + T cells are able to use IL-2 when supplied exogenously, and that the induction of this critical growth factor in response to TCR cross-linking may be limited in TNFR2-deficient T cells. CD28 co-stimulation partially rescues the hypo-proliferative response of TNFR2~/~ CD8+ T cells To examine whether CD28 co-stimulation could rescue the hypo-proliferative response by TNFR2-/- CD8+ T cells, the cells were stimulated with anti-CD28 in addition to anti-CD3. As expected, CD28 co-stimulation increased the proliferative potential of anti-CD3 stimulated wild-type CD8+ T cells (Fig. 2.6). This is in agreement with the well-documented decrease in the threshold of activation that CD28 co-stimulation mediates (5). CD28 co-stimulation caused a partial increase in proliferative potential by TNFR2-/-CD8+ T cells, but was only restored to the level of wild-type T cells stimulated with anti-CD3 alone. This indicates that TNFR2 plays an important co-stimulatory role for T cell activation that is distinct from CD28 co-stimulation. 54 TNFR2'A CD8+ T cells display a reduction in activation phenotype in response to TCR cross-linking Acute activation markers such as CD25 (IL2Rcx) and CD69 are expressed at the cell surface during T cell activation and serve as a measure of the frequency of activated cells. Given that T cells deficient in TNFR2 proliferated poorly in response to TCR cross-linking, it was of interest to determine whether these cells also display a, defect in acquiring an activated phenotype. The cell surface expression of CD25 in response to TCR cross-linking was important to study since it is the critical component of the high-affinity IL-2R. As shown in Fig. 2.7, the cell surface expression of CD25 was similar between the two cell types at the earliest time point tested (3 h). However, at 8 h of anti-CD3 stimulation the percentage of cells that were CD25 + was reduced for TNFR2"7" CD8 + T cells compared to wild-type (50% vs. 84%, respectively). Since CD25 expression is essential for optimal IL-2 signaling, the marked reduction in the proportion of cells that are CD25 + for TNFR2_ /" CD8 + T cells may be an important factor that contributes to the marked reduction in the proportion of cells that divide in response to TCR cross-linking. CD69 is an early activation marker of T cells. The pattern of induction of CD69 for TNFR2 7" CD8 + T cells stimulated with anti-CD3 closely parallels that of CD25 (Fig. 2.7). With greater duration of TCR-mediated stimulation, there is greater recruitment of TNFR2 7" CD8 + T cells into the CD69 h l population, demonstrating the increased requirement in the amount of TCR-mediated signals to generate a particular response for the TNFR2 7" T cell population compared to wild-type. The forward light scatter (FSC) pattern was also examined in this kinetic study to assess blastogenesis in response to TCR cross-linking. As both the kinetics of induction of CD25 55 and CD69 indicate that TNFR2 - /" CD8 + T cells are activated with delayed kinetics (due to increased requirements for TCR-mediated stimulation in the absence of TNFR2), it would be expected that FSC should also display the same pattern. Indeed, as shown in Fig. 2.7, the percentage of cells that have increased in size in response to TCR cross-linking is markedly reduced at the 20 h time point, and that there is increasing recruitment of TNFR2 7 " CD8 + T cells into the FSC h l population with greater duration of TCR-mediated stimulation. IL-2 production in response to TCR cross-linking is reduced in TNFR2'A T cells Based on the observation that exogenous IL-2 was able to rescue the marked reduction of the proliferative response by TNFR2"7" T cells, the amount of IL-2 produced in response to TCR cross-linking was examined to assess whether this was one of the limiting factors. The amount of IL-2 that was secreted in response to TCR cross-linking was measured by ELISA performed on the culture supernatant. As shown in Fig. 2.8,4, there was a marked reduction in the amount of IL-2 in the culture supernatant of TNFR2 7 " CD8 + T cells compared to wild type at 20 h of anti-CD3 stimulation. This suggests that the amount of IL-2 secreted is limiting for the proliferative response of TNFR2"A CD8 + T cells. Furthermore, when the culture supernatant of TNFR2"7" CD8 + T cells was assayed for IL-2 at 40 h of anti-CD3 stimulation, the amount of IL-2 was equivalent to the amount produced by wild-type cells at 20 h. This indicates that the production of IL-2 occurs in a delayed manner for TNFR2"7" CD8 + T cells, as a greater duration of TCR-mediated stimulated allows for increased accumulation of TCR-mediated signals. This is consistent with the threshold model of T cell activation, in this case for IL-2 production, such that TNFR2 lowers the requirement for TCR-mediated stimulation. 5 6 To study whether the observed reduction in IL-2 production by T N F R 2 7 " C D 8 + T cells was paralleled by a reduction in the transcript, IL-2 m R N A was measured by competitive and quantitative reverse transcription-polymerase chain reaction (CQ-PCR) . As shown in Fig. 2.85, TNFR2 _ / " C D 8 + T cells displayed a 2- to 3-fold reduction in the amount of IL-2 transcript in response to T C R cross-linking compared to wild type. This result suggests that T N F R 2 provides a co-stimulatory signal that lowers the threshold of activation for IL-2 gene induction. TNF-a induction in response to TCR cross-linking is modestly reduced in TNFR2'1' T cells T N F - a is another important cytokine that is expressed during T cell activation (23). Previous studies have shown that T N F - a can enhance the proliferative response of T cells to T C R cross-linking (11). To determine whether T N F R 2 is required for T N F - a expression upon T C R stimulation, the level of T N F - a m R N A was measured using C Q - P C R . It was found that TNFR2" 7" C D 8 + T cells displayed a modest decrease in the level of T N F - a transcript compared to wild-type (Fig. 2.9). Interestingly, this decrease was not as marked as for IL-2. This is likely due to differential requirements for the assembly and constitution of the transcription factor complexes needed for the induction of these two cytokine genes (28). Indeed, previous reports have shown that T N F - a is expressed earlier than IL-2 during T cell activation (23) suggesting that the latter cytokine possesses a higher T C R signaling threshold for its induction during T cell activation. Furthermore, T N F - a was found to be one of the first cytokines produced by T cells upon activation (23), suggesting that it may be an important early checkpoint for the progression of the T cell response. 57 IFN-y expression in response to TCR cross-linking is reduced in TNFR2~/~ T cells' A third cytokine that is transcriptionally regulated and expressed in particularly large amounts by activated CD8 + T cells is IFN-y. The total amount of secreted cytokine was measured using ELISA. As shown in Fig. 2.10/4, TNFR2 _ /" CD8 + T cells produced markedly less IFN-y than wild type. To examine whether this difference was due to a reduction in the number of cells expressing IFN-y, or to a reduction in the amount of IFN-y produced per cell, an intracellular cytokine immunostaining assay was used. As shown in Fig. 2.105, there was both a marked reduction in the number of cells expressing IFN-y (25% for wild-type vs. 9% for TNFR2 CD8 + T cells), as well as a marked decrease in the amount produced per cell, as measured by mean fluorescence intensity (MFI). Thus, deficiency of TNFR2 in T cells results in the diminished recruitment of cells in the IFN-y expressing population in response to TCR-mediated stimulation, as well as a reduction in the intracellular levels of cytokine produced per cell. 58 2.5 D i s c u s s i o n T cell activation is a complex process and involves not only the engagement of the TCR with its antigenic ligand but also a myriad of adhesion molecules and co-stimulatory ligands that are found on APCs activated by pathogenic stimuli. Engagement of B7-1 and B7-2 on APCs by CD28 molecules on T cells provides a critical signal for cell cycle progression, IL-2 production and clonal expansion (5). However, it is becoming clear that CD28 is part of a larger family of related counter-receptors that regulate the T cell response. These additional molecules play an important role, together with CD28, to regulate the acquisition of effector function and/or induction of tolerance in T cells (14). In this study we examined the importance of the TNFR2 TNF-a receptor (TNFR-2) for T cell activation and more broadly assessed the role that TNF-a plays as an environmental cue towards eliciting an efficient T cell response. Previous reports have shown that TNF-a can act through TNFR2 to enhance the proliferative response of T cells to TCR agonists (11, 15, 16). However, the mechanism by which TNFR2 elicits this enhancement has not been determined. Moreover, it is not clear whether TNFR2 perfomis an essential or redundant function in T cells. We addressed these questions by investigating T cells from TNFR2 7 " mice. It was determined that TNFR2 performs an important co-stimulatory function that effectively lowers the threshold of activation, and thus lowers the requirement for TCR agonist to produce a given proliferative response. This conclusion is partly based on the observation that a much higher concentration of anti-CD3 was required by TNFR2"7" T cells to achieve the same level of proliferation as wild-type T cells. 59 We investigated the nature of the hypo-proliferative response of TNFR2_ /~ T cells. Since T cell proliferation is particularly dependent on signals mediated through the high-affinity IL-2R, we assessed the kinetics of.expression of CD25, a component of the high affinity IL-2R and the amount of IL-2 produced in response to TCR cross-linking. It was found that TNFR2" / _ CD8 + T cells showed delayed kinetics in the recruitment of cells to the CD25 h l population. This observation can be interpreted according to a threshold model for T cell activation. In the absence of TNFR2, greater amounts of TCR-mediated signals are required to elicit a particular response. With longer incubation times with TCR agonist, there would be a net accumulation and increase in the amount of TCR-mediated signals. Thus, over time there is an increase in the proportion of cells that are CD25 + . For wild-type CD8 + T cells, this activation threshold is achieved with much shorter incubation times with anti-CD3 antibodies compared to TNFR2"/~ CD8 + T cells. This demonstrates the co-stimulatory importance of TNFR2 in that much less stimulation is required to reach the activation threshold for the induction of CD25 in the wild-type CD8 + population. Interestingly, the response by TNFR2"7" CD8 + T cells to TCR cross-linking seems to display a bimodal distribution (Fig. 2.7), giving rise to two apparent populations: those that are CD25 + and the others that are CD25 n e g . The observation that a proportion of TNFR2" / _ CD8 + T cells were CD25 + at the 8 h time point may be due to a stochastic phenomenon in which the amount of TCR-mediated signals received permits a particular frequency of CD25 + cells, similar to the stochastic pattern of effector responses described by Keslo et al. (29). An alternative explanation is that there exists a subpopulation of TNFR2 - /" CD8 + T cells that readily upregulate CD25 and another subpopulation that requires a greater amount 6 0 of TCR-mediated signal. It is of interest to determine whether subpopulations of C D 8 + T cells have an intrinsically lower threshold of activation. The threshold model for a particular T cell response can be applied to the induction of cytokines. As Itoh and Germain (28) pointed out, signaling thresholds exist for elicitation of a particular cytokine response, and signals that rise above this point lead to an increase in the overall amount of cytokine produced by a cell population (28). Three cytokines that are expressed during T cell activation are T N F - a , IL-2, and IFN-y. Consistent with the hierarchal organization of T C R signaling thresholds proposed by Itoh and Germain (29), we observed that the induction of T N F - a was similar between T N F R 2 7 " and wild-type C D 8 + T cells, whereas there was a marked decrease in the induction of IL-2 and IFN-y for T N F R 2 7 " T cells. This suggests that the T C R signaling threshold for T N F - a gene expression is lower than for the other two cytokines studied. This is also consistent with previous studies on the kinetics of cytokine induction and which demonstrate that T N F - a is expressed earlier than IL-2 and IFN-y (23). The observation that exogenous IL-2 rescued the hypo-proliferative response of TNFR2" / _ C D 8 + T cells suggested that its expression might be limiting. Indeed, as determined at the level of secreted cytokine as well as IL-2 transcript, there is a marked reduction in the level of IL-2 gene induction in the absence of T N F R 2 . This is consistent with the threshold model of activation, in that greater amounts of TCR-mediated signals is required to reach the threshold for T N F R 2 7 " C D 8 + T cells. Furthermore, since IL-2 is a critical growth factor and important for the proliferative response, it could account, at least in part, for the reduction in proliferation observed for T N F R 2 7 " T cells. 61 The expression of IFN-y followed the same pattern as IL-2, consistent with the threshold model of activation. There was a significant reduction in the recruitment of TNFR2 7 " CD8 + T cells into the IFN-y expressing population, as well as a reduction in the intracellular levels per cell. This is interpreted to mean that for wild-type CD8 + T cells, the amount of signals generated by the time point tested was sufficient to reach the threshold of activation. This is reflected in both the significant recruitment of wild type cells into the IFN-y expressing population, as well as a marked increase in the intracellular levels per cell relative to TNFR2"A CD8 + T cells. What is the mechanism by which TNFR2 provides co-stimulation for T cell activation? A model that can account for the co-stimulatory role of TNFR2 in T cell proliferation is shown in Fig. 2.11. This model suggests that TNFR2 provides an important signal that recruits and utilizes proteins disctint from those used by the TCR, but converges at the level of N F K B and c-Jun activation. Consistent with this hypothesis, it has been shown that the TNFR2 signaling pathway leads to the activation of N F K B and c-Jun (14), both of which are critical for the induction of genes, particularly IL-2, during T cell activation. This hypothesis is supported by increasing number of reports that provide evidence that little gene transcription is detected until all the transcription factors that are necessary for forming a complete complex at the promoter are available at an adequate concentration (30). Previous reports have shown that co-stimulation of T cells mediated through CD28 arises from upregulating the activity of transcription factors that are essential for IL-2 gene induction (31). It seems likely that TNFR2 provides unique co-stimulatory signals to complement CD28 co-stimulatory signals in order to achieve maximum IL-2 production. 62 Many groups have investigated the signaling events that are generated specifically through the TCR complex. However, current models for T cell activation and proliferation do not implicate the TNFR2 pathway. Based on the current schematic for the TNFR2 signaling pathway, convergence with the pathways activated through the TCR occurs far downstream at the level of transcription factor activation, specifically N F K B and c-Jun (see Fig. 2.11). If TNFR2 provides a signal that is distinct and independent of that mediated through the TCR complex, then TCR-proximal signaling events should not be affected by TNFR2 deficiency. Our preliminary experiments support this conclusion. We found that the global tyrosine phosphorylation of substrates, as well as Erkl/Erk2 activation, shortly after stimulation of T cells with anti-CD3 indicate that these events were not affected by TNFR2-deficiency (data not shown). Further studies are required to elucidate the biochemical mechanism though which TNFR2 lowers the threshold of T cell activation. 2.6 Acknowledgements We thank Becky Dinesen and Soo-Jeet Teh for excellent technical assistance, and Drs. Oliver Utting and John Priatel for helpful discussions. We also thank Dr. Richard Locksley (UCSF) for the pPQRS plasmid. 63 2.7 Figures E • a • c T5 E x CO anti-CD3 alone anti-CD3 + IL2 Figure 2.1 Proliferative response to T C R cross-linking is reduced in lymph node T cells from TNFR2" 7" mice. Lymph node cells (1 x 105) were stimulated with either plate-bound anti-CD3 alone, or in the presence of exogenous IL-2, for 48 h and pulsed with [ 3H]thymidine for the last 8 h of culture. Data denotes mean ± standard deviation for triplicate determinations and is representative of three independent experiments. 64 B ^ 100000 £ a. 6^ a c 'S I > \— I CO E ri. o> c '•5 E > x: r— I CO 0 2 4 6 8 10 anti-CD3 (pig ml"1) 2 4 6 8 10 anti-CD3(|igmH) B6.p75-/- + IL2 B6.wt + IL2 B6.wt B6.p75-/-B6.p75-/- + IL2 i B6.wt + IL2 m B6.wt B6.p75-/-Figure 2.2 TNFR2 lowers the threshold of activation for T cell proliferation in response to TCR cross-linking. (A) C D 8 + T cells (1 x 105) were stimulated with either plate-bound anti-CD3 alone, or in the presence of exogenous IL-2, for 72 h with [3H]thymidine added for the last 10 h of culture (see Materials and Methods). (B) CD4 + T cells (1 x 105) were stimulated with either plate-bound anti-CD3 alone, or in the presence of exogenous IL-2, for 78 h with [3H]thymidine added for the last 10 h of culture. Mean ± standard deviation of triplicate determinations was used to express the data. The data were reproduced in three independent experiments. 65 Forward Light Scatter Forward Light Scatter Figure 2.3 (A) CD8 T cells deficient in TNFR2 are resistant to activation-induced cell death. (B) TNFR2-deficient CD4 + T cells are not resistant to activation-induced cell death. (A) Cells were harvested at 72 h of stimulation with plate-bound anti-CD3+ exogenous IL-2, stained with 7-AAD and analyzed using FACS (see Materials and Methods). Percentage refers to 7-AAD negative cells (live cells). (B) Culture conditions are similar to (A) except CD4+ T cells were used and the cells were harvested at 78 h. The data were reproduced in three independent experiments. 66 anti-CD3e a lone anti-CD3e + IL-2 c5 o in O "O o > o o CD w a3 o .£> > 7.0 6.0 5.0 4.0 3.0 2.0 1.0 B B6.wt B6.p75- B6.wt B6.p75-10 4 t Q < < B6.wt B6.P75"7- B6 uns t imu la ted Forward Scat te r Figure 2.4 TNFR2"" CD8 + T cells are more susceptible to apoptosis when stimulated with anti-CD3 without exogenous IL-2. CD8 + T cells (1x10 ) were stimulated with either 10 pg/ml of plate bound anti-CD3 alone, or in the presence of exogenous IL-2, and harvested after 48 and 72 h. (A) The total number of viable cells in each culture was determined using a hemocytometer. White bars correspond to stimulated B6 wild-type CD8 + T cells; gray bars correspond to unstimulated controls; black bars correspond to stimulated TNFR2" / _ CD8 + T cells. (B) Cultures were also stained with 7-AAD and analyzed using FACS (see Materials and Methods). The data shown is representative of three independent experiments performed. 67 o J Q E 3 a C F S E Figure 2.5 TNFR2_ /~ CD8 + T cells display marked reduction in the proportion that undergo division in response to TCR cross-linking. CD8 + T cells (5 x 105) were labeled with 1 uM CFSE and stimulated with either 10 ug/ml of plate-bound anti-CD3 alone, or in the presence of exogenous IL-2, for 60 h (see Materials and Methods). The shaded gray curve corresponds to the stimulated cells; the black line corresponds to CFSE-labeled unstimulated cells (negative control). The data were reproduced in three independent experiments. 68 Figure 2.6 CD28 co-stimulation partially rescues the hypo-proliferative response of TNFR2-deficient CD8 + T cells. CD8 + T cells (1 x 10 5) were stimulated with either 10 p.g/ml of plate-bound anti-CD3 alone, or in the presence of 10 |-ig/ml anti-CD28, for 72 h with [3H]thymidine added for the last 10 h of culture (see Materials and Methods). Mean ± standard deviation for triplicate determinations were used to express the data. The data shown are representative of three independent experiments performed. 69 at • Z o FSC CD25 CD69 i • • • '—r 3 h 8 h 20 h 30 h Forward Scatter Fluorescence Intensity Figure 2.7 Induction of CD25 and CD69 expression as well as blastogenesis in response to TCR cross-linking occurs with delayed kinetics in T N F R 2 / _ CD8 + T cells. CD8 T cells (1 x 10") were stimulated with 10 pg/ml of plate-bound anti-CD3 for the indicated periods of time, stained with the relevant antibodies, and analyzed by FACS (see Materials and Methods). Shaded gray curve corresponds to stimulated wild-type C D 8 + T cells; bold black line corresponds to stimulated T N F R 2 " CD8 + T cells; light gray line corresponds to unstimulated wild-type CD8 + T cells; dark gray line corresponds to unstimulated TNFR2"'" CD8 + T cells. FSC = Forward Light Scatter. Data shown are representative of one of three independent experiments performed. 70 0.5 0.4 — 0 3 D rj* 0 . 2 B [competitor] comp cDNA ^ IL-2 cDNA >• B6.wt B6,p75^-B6,p75-'" B6.wt LY £ CL *-> CM « =! g 0 7 0 3 B6.wt B6.p75_/" B6.p75-'- B6.wt comp cDNA HPRTcDNA Figure 2.8 T N F R 2 " CD8 T cells display a marked reduction in the level of IL-2 produced in response to TCR cross-linking. (A) CD8 + T cells (1 x 106) were stimulated with 10 ug/ml of plate-bound anti-CD3 and cytokine ELISA was performed on the culture supernatants (see Materials and Methods). The data points denote mean ± standard deviation of triplicate determinations. (B) TNFR2 CD8 + T cells display a reduction in the levels of IL-2 mRNA in response to TCR cross-linking. TNFR2 _ /" CD8 + T cells (2 x 106) were stimulated with 10 pg/ml of plate-bound anti-CD3 for 9 h. Total RNA was harvested, reverse transcribed, and subsequently analyzed using CQ-PCR (see Materials and Methods). Gradient bar refers to the concentration of competitor in each lane (1, 10, 100 x). (C) The IL-2/HPRT transcript ratios of anti-CD3 stimulated wild type TNFR2"" CD8 + T cells. Abbreviations used: comp = competitor, HPRT = hypoxanthine phosphoribosyl transferase. Data is representative of one of three independent experiments performed. 71 B6.p75 B6.wt [competitor] comp cDNA 3*-TNF-a c D N A B6.p75-'- BS.wt comp cDNA >-H P R T cDNA B 9" CO U_ I— X •«-> , Q. 0 8 0 b D 4 0 2 BS.wt B6.p75"/-Figure 2.9 TNFa production in response to TCR cross-linking is largely unaffected for TNFR2"" CD8 + T cells. CD8 + T cells (2 x 1 0 6 ) were stimulated with 1 0 pg/ml of plate-bound anti-CD3 for 9 hrs. CQ-PCR was used to analyze the relative amounts of TNF-a transcripts between wild type and T N F R 2 C D 8 + T cells, as described for IL-2 in Fig. 8. 72 Figure 2.10 The decrease in IFN-y expression by TNFR2"" CD8 T cells is due to a decrease in the percentage of cells that express IFN-y, as well as a decrease in the intracellular levels expressed per cell. L N cells (1 x 106) were stimulated with 10 j.ig/ml of plate-bound anti-CD3 for 36 hrs, with the last 6 hrs in the presence of the Golgi inhibitor, Golgi Stop (see Materials and Methods). The cells were stained for intracellular cytokine and analyzed by F A C S . Ig + cells stimulated with LPS were used as negative control. A s an additional control, IFN-y expression was analyzed in C D 4 + T cells, since this T cell subset does not express significant amounts of IFN-y at this stage of activation. M F I = Mean Fluorescence Intensity. The percentages refer to C D 8 T cells that express IFN-y, as demarcated by gates within the F A C S dot plots. Data is representative of one of three independent experiments performed. 73 Figure 2.11 Model of TNFR2 co-stimulation for T cell activation. This model postulates that TNFR2 contributes signals towards the activation and recruitment of transcription factors to the enhancer/promoter regions of genes that are upregulated during T cell activation. 74 2.8 References 1. Lenschow, D. J., T.L. Walunas, and J.A. Bluestone. 1996. CD28/B7 system of T cell co-stimulation. Annu. Rev. Immunol. 14:233. 2. Medema, J. P., and J. Borst. 1999. T cell signaling: a decision of life and death. Hum. Immunol. 60:403. 3. Acuto, O., and D. Cantrell. 2000. T cell activation and the cytoskeleton. Annu. Rev. Immunol. 18:165. 4. Liu, Y., and C A . Janeway, Jr. 1992. Cells that present both specific ligand and costimulatory activity are the most efficient inducers of clonal expansion of normal CD4 T cells. Proc. Natl. Acad. Sci. USA 89:3845. 5. Rudd, C. E. 1996. Upstream-downstream: CD28 cosignaling pathways and T cell function. Immunity 4:527. 6. Lucas, P. J., I. Negishi, K. Nakayama, L.E. Fields, and D. Loh. 1995. Naive CD28-deficient T cells can initiate but not sustain an in vitro antigen-specific immune response. J. Immunol. 154:5757. 7. Kundig, T. M., A. Shahinian, K. Kawai, H-W. Mittrucker, E. Sebzda, M.F. Bachman, T.K. Mak, and P.S. Ohashi. 1996. Duration of TCR stimulation determines costimulatory requirement of T cells. Immunity 5:41. 8. Iezzi, G., K. Karjalainen, and A. Lanzavecchia. 1998. The duration of antigenic stimulation determines the fate of naive and effector T cells. Immunity 8:89. 9. Shahinian, A., K. Pfeffer, K.P. Lee, T.M. Kundig, K. Kishihara, A. Wakeham, K. Kawai, P.S. Ohashi, C.B. Thompson, and T.K. Mak. 1993. Differential T cell costimulatory requirements in CD28-deficient mice. Science 261:609. 10. Wang, B., R. Maile, R. Greenwood, E.J. Collins, and J.A. Frelinger. 2000. Naive CD8 T cells do not require co-stimulation for proliferation and differentiation into cytotoxic effector cells. J. Immunol. 164:1216. 11. Pimental-Muinos, F. X., M.A. Munoz-Fernandez, and M. Fresno. 1994. Control of T lymphocyte activation and IL-2 receptor expression by endogenously secreted lymphokines. J. Immunol. 152:5714. 12. Tartaglia, L. A., R.F. Weber, S. Figari, C. Reynolds, M.A. Palladino Jr., and D.V. Goeddel. 1991. The two different receptors for tumor necrosis factor mediate distinct cellular responses. Proc. Natl. Acad. Sci. USA 88:9292. 75 13. Shalaby, M. R., A. Sundan, H. Loetscher, M. Brockhaus, W. Lesslauer, and T. Espevik. 1990. Binding and the regulation of cellular functions by monoclonal antibodies against human tumor necrosis factor receptors. J. Exp. Med. 172:1517. 14. Chan, F. K.-M., R. Siegel, and M.J. Lenardo. 2000. Signaling by the TNF receptor superfamily and T cell homeostasis. Immunity 13:419. 1.5. Tartaglia, L. a., D.V. Goeddel, C. Reynolds, I.S. Figari, R.F. Weber, B.M. Fendly, and M.A. Palladino Jr. 1993. Stimulation of human T-cell proliferation by specific activation of the 75-kDa tumor necrosis factor receptor. J. Immunol. 151:4637. 16. Yokota, S., T.D. Geppart, and P.E. Lipsky. 1988. Enhancement of antigen- and mitogen-induced human T lymphocyte proliferation by tumor necrosis factor-alpha. J. Immunol. 140:531. 17. Ware, C. F., P.D. Crowe, T.L. Vanarsdale, J.L. Andrew, M.H. Grayson, R. Jerzy, C A . Smith, and R.G. Goodwin. 1991. Tumor necrosis factor (TNF) receptor expression in T lymphocytes. Differential regulation of the type 1 TNF receptor during activation of resting and effector T cells. J. Immunol: 147:4229. 18. Tartaglia, L. A., and D.V. Goeddel. 1992. Two TNF receptors. Immunol. Today 13:151. 19. Rothe, J., W. Lesslauer, H. Lotsher, Y . Lang, P. Koebel, F. Kontgen, A. Althage, R. Zinkernagel, M. Steinmetz, and H. Bluethmann. 1993. Mice lacking the tumor , necrosis factor receptor-1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364:798. 20. Pfeffer, K., T. Matsuyama, T.M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P.S. Ohashi, M. Kronke, and T.W. Mak. 1993. Mice deficient for the 55 kD tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73:45 7. 21. Erickson, S. L., F.J. de Sauvage, K. Kikly, K. Carver-Moore, S. Pitts-Meek, N. Gillett, K.C.F. Sheehan, R.D. Schreiber, D.V. Goeddel, and M.W. Moore. 1994. Decreased sensitivity to tumor necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature 372:560. 22. Hi l l , G. R., T. Teshima, V.I. Rebel, O.I. Krijanovski, K.R. Cooke, Y.S. Brinson, and J.L.M. Ferrara. 2000. The p55 TNF-alpha receptor plays a critical role in T cell alloreactivity. J. Immunol. 164:656. 23. Mascher, B., P. Schlenke, and M. Seyfarth. 1999. Expression and kinetics of cytokines determine by intracellular staining using flow cytometry. J. Immunol. Methods 223:115. 24. Reiner, S. L., S. Zheng, D.B. Corry, and R .M. Locksley. 1993. Constructing polycompetitor cDNAs for quantitative PCR. J. Immunol. Methods 165:37. 25. Lenardo, M . , F. K . - M . Chan, F. Hornung, H. McFarland, R. Siegel, J. Wan, L. Zheng. 1999. Mature T lymphocyte apoptosis: immune regulation in a dynamic and unpredictable antigenic environment. Annu. Rev. Immunol. 17:221. 26. Teh, H. S., A . Seebaran, and S.J. Teh. 2000. TNF receptor 2-deficient CD8 T cells are resistant to Fas/Fas ligand-induced cell death. J. Immunol. 165:4814. 27. Lyons, A . B., and C R . Parish. 1994. Determination of lymphocyte division by flow cytometry. J. Immunol. Methods 171:131. • 28. Itoh, Y . , and R. Germain. 1997. Single cell analysis reveals regulated hierarchical T cell antigen receptor signaling thresholds and intraclonal'heterogeneity for individual cytokine responses of CD4 + T cells. J. Exp. Med. 186:757. 29. Keslo, A. , P. Groves, A .B . Troutt, and K. Francis. 1995. Evidence for trie stochastic acquisition of cytokine profile by CD4 + T cells activated in a T-helper 2-like response in vivo. Eur. J. Immunol. 25:1168: 30. Fiering, S., J.P. Northrop, G.P. Nolan, P.S. Mattila, G.R. Crabtree, and L .A. Herzenberg. 1990. Single cell assay of a transcription factor reveals a threshold in transcription activated by signals emanating from the T cell antigen receptor. Genes Dev. 4:1823. 31. McGuire, K. L., and M . Iacobelli. 1997. Involvement of Rel, Fos, and Jun proteins in binding activity to the IL-2 promoter CD28 response element/AP-1 sequence in human T cells. J. Immunol. 159:1319. 77 Chapter 3 Cr i t i ca l role of tumor necrosis factor receptor type-2 (p75) as a co-stimulator for I L - 2 induction and T cell survival : a functional l ink to C D 2 8 1 3.1 Preface CD28 provides important signals that lower the threshold of T cell activation, augment the production of IL-2, and promote T cell survival. The recent identification of a second family of co-stimulatory molecules within the TNFR family has re-shaped the 'two-signal' model of T cell activation. This chapter examines the role of TNFR2 as a T cell co-stimulatory molecule in controlling cell fate during TCR/CD28-mediated stimulation in vitro. TNFR2-deficient T cells possessed a defect in IL-2 production in response to TCR/CD28-mediated stimulation. TNFR2 is non-redundantly coupled to sustained A K T activity and N F K B activation in response to TCR/CD28-mediated stimulation. Moreover, TNFR2-deficient T cells exhibit a defect in survival during the early phase of T cell activation that is correlated with a striking defect in BC1-XL expression. This chapter describes experiments showing a role for TNFR2 in sustaining the activation of key signaling intermediates during T cell activation, and the synergistic requirement of TCR, CD28, and TNFR2 towards optimal IL-2 induction and T cell survival. Moreover, it is proposed that TNFR2 acts as one of the earliest co-stimulatory members of the TNFR family, and is functionally linked to CD28 for initiating and determining T cell fate during activation. ' A version of this chapter has been published as: Kim, E.Y. and H.S. Teh. 2004. Critical role of TNF receptor type-2 (p75) as a costimulator for IL-2 induction and T cell survival: a functional link to CD28. J. Immunol. 173:4500-4509. 78 3.2 Introduction T cells play a key role in immunity as actors and facilitators in the antigen-specific eradication of potential threats. They are tightly regulated by multiple mechanisms in a spatial- and temporal-dependent manner. The T cell receptor (TCR) confers specificity of response towards specific antigen, whereas numerous co-stimulatory molecules affect the response outcome (1, 2). In biochemical terms, while TCR-mediated signal transduction can activate a multitude of signaling cascades, a number of co-stimulatory molecules have been shown to promote more robust T cell responses, as well as fine-tuning of T cell differentiation toward specific effector mechanisms. Current models of T cell co-stimulation suggest several co-stimulatory molecules are required for the development of effective T cell-mediated immunity, reflecting the requirement of several signals in simultaneous action during the course of the T cell response, and the requirement of different signals at different times/stages of T cell differentiation (2). The extensive literature identifies two general families of co-stimulatory molecules: CD28-related and the members of the TNF receptor (TNFR) family (2-4). Their respective characterization indicates overlapping and distinct activity on T cell proliferation, cytokine production, survival, and differentiation. The integration of signals stemming from the TCR and accessory cell surface proteins is thereby an important mode of molecular regulation for T cell activation. An important integration point for TCR-mediated and co-stimulatory signals that allows a robust T cell response is the tight regulation of the critical T cell growth factor IL-2 (5, 6). Early characterization of TCR- and CD28-mediated signals illustrated the two-signal concept for functional T cell activation. CD28 was established as a key co-stimulatory molecule for induction of IL-2 based on its ability to substantially augment its 79 expression in T cells stimulated via TCR (7). Transcriptional regulation of IL-2 is achieved by cooperative binding of transcription factors (including NFAT, AP-1, N F K B ) (8), which are downstream targets of both the TCR and CD28 signaling pathways (5, 9). Their integration at the IL-2 promoter has been mapped to the CD28 response element (CD28RE), which contains a sequence similar to the N F K B consensus-binding site (10). Thus, coordinated signals provided by external stimuli activate intracellular signaling pathways that converge qualitatively and quantitatively towards changes in gene expression profile. CD28 is the best characterized of the growing numbers of identified co-stimulatory molecules, and has been shown to synergize with the TCR to lower the threshold of T cell activation (11, 12), enhance initial clonal expansion (13), regulate IL-2 production (7, 14), and augment the expression of anti-apoptotic members of the Bcl-2 family (15). Initial biochemical studies of CD28 function demonstrated its role in promoting the transcription and stability of IL-2 mRNA (16). Subsequent studies showed synergy of CD28 signaling with signals mediated via the TCR complex towards the activation of downstream effectors (17). In particular, optimal activation of the transcription factors NFAT, AP-1, and N F K B is dependent on 'amplification signals' provided by CD28-. mediated recruitment and subsequent activation of Vav (18) and phosphoinositide 3-kinase (PI3K) (17). More recently, protein kinase B (AKT) was shown to provide the . CD28-mediated co-stimulatory signal for up-regulation of IL-2, suggesting that it also utilizes discrete signaling pathways (19). However, the effects mediated by CD28 were found to be insufficient to sustain long term T cell survival, and is thus functionally positioned early during T cell activation (within 24 hrs of antigen encounter) (20). 80 A number of novel co-stimulatory molecules have been identified from the TNFR family, including 4-IBB, CD 134 (OX40), and CD27 (2). The discrete co-stimulatory roles played by these members of the TNFR family correspond with their expression pattern during the T cell response: peak expression occurs between day 2 and 4, and remains at significant levels thereafter (2). Analysis of CD27-deficient T cells revealed that CD27 promotes antigen-specific expansion of naive T cells as well as memory T cells , as reflected by delayed response kinetics and reduction of CD8 + T cell numbers during secondary challenge (21). Stimulation of 4-1 BB induces enhanced proliferative response when combined with anti-CD3 and anti-CD28 stimulation (22), sustains established CD4 + and CD8 T cell responses as well as enhances .cell division and effector function (23, 24). Engagement of OX40 promotes effector and memory T cell function, and can also enhance clonal expansion and cytokine production. Characterization of OX40-deficient T cells showed relatively unimpaired IL-2 production, cell division and clonal expansion, but revealed an important role towards sustaining the expression of ahti-apoptotic molecules B C I - X L and Bcl-2 thereby promoting T cell survival (25). Thus, the roles of 4-1 BB and OX40 for T cell differentiation and function appear to sustain the response (2), whereas CD28 appears to be important for the initial stages of activation and IL-2 induction. Several lines of evidence suggest that the prototypic member of the TNFR family, TNFR-2 (p75), plays an important co-stimulatory role for T cells. First, it was found that adding exogenous TNF-a to T cell cultures stimulated via TCR cross-linking augmented the proliferative response to a degree comparable with T cell cultures supplemented with exogenous IL-2 (26). Furthermore, anti-TCR-induced proliferation in T cells is essentially abolished by a neutralizing Ab to TNF-a (26). Second, agonistic antibodies showed that of 81 the two receptors for TNF-a, TNFR2 signals the enhancement of the proliferative response (27). In correlation with these findings, it was found that TNFR2 is the dominant TNFR during T cell activation (28). Moreover, the known TNFR2 ligands are expressed by activated T cells and antigen presenting cells. TNF-a is one of the earliest cytokines expressed during activation of lymphocytes and antigen-presenting cells (28), and lymphotoxin-a is expressed on activated T and B cells (29). Biochemical characterization of the cytoplasmic domain of the TNFR2 TNF receptor revealed a TNF receptor-associated factor (TRAF)-binding domain that was shown to recruit TRAF2 (30), an adaptor molecule through which co-stimulatory members of the TNFR family are thought to mediate their signaling functions. More recently, we have shown that TNFR2 decreases the threshold of T cell activation using TNFR2-deficient mice (31). Further cellular characterization of TNFR2-deficient CD8 + T cells revealed a co-stimulatory role for TNFR2 for a number of aspects of T cell activation, including IFN-y and IL-2 production, as well as the proliferative response that was only partially rescued by CD28 co-ligation (31). These data strongly suggested an important relationship between TCR, CD28 and TNFR2 towards optimal T cell responses. Here we show that T cells deficient in TNFR2 possess a marked defect in IL-2 production in response to TCR/CD28-mediated stimulation, demonstrating for the first time the co-stimulatory role of TNFR2 in relation to TCR and CD28-mediated signals towards IL-2 induction. Biochemical characterization showed that TNFR2 provides distinct qualitative signals via A K T and N F K B , whereas TCR-proximal signaling events and M A P K family cascades were largely intact in TNFR2 7 " T cells. Moreover, we found that TNFR2-deficient CD8 + T cells are more susceptible to apoptosis during the early phase of T cell activation in 82 response.to TCR/CD28-mediated stimulation. This decreased survival of TNFR2-deficient CD8 + T cells correlated with a defect in the expression of the anti-apoptotic molecule Bcl-Xi_. These results support a model of co-stimulation that implicates TNFR2 in a critical role during TCR/CD28-mediated stimulation of IL-2 induction, clonal expansion, and survival. These functional aspects are correlated with a distinct role for TNFR2 in the intracellular signaling milieu during the early phase of the T cell response. 3.3 Materials and Methods Mice •Breeders for C57BL/6 (B6, H-2b) and B6-TNFR2-deficient mice were obtained from The Jackson Laboratories (Bar Harbor, ME). B6 mice deficient in the TNFR2 have been previously described (32). TNFR2-deficient mice were genotyped using a PCR strategy. Mice 4 to 7 weeks of age were used for all experiments'. Cells Lymph nodes were harvested and single cell suspensions prepared from each of the mouse lines. The CD4" CD8 + (CD8 +) T cell subset was purified from whole lymph node cell suspensions using miniMACS microbeads (Miltenyi Biotec, Auburn, CA). CD8 + T cells were positively selected using a MACS M S + Separation column and Min iMACS magnet, as per manufacturer's protocol (Miltenyi Biotec), achieving > 95% purity. Cells were cultured at 37°C and 5% C Q 2 in Iscove's D M E M (Life Technologies, Burlington, Ontario) 83 supplemented with 10% (w/v) FBS (Life Technologies), 5 x 10° pM 2-ME, and antibiotics (I-media). Antibodies and flow cytometry PE-conjugated hamster anti-mouse TNFR2 monoclonal antibody (TR75-89) was used to study TNFR2 expression (BD Pharmingen, Mississauga, ON). Cell staining and flow cytometry were performed according to standard procedures. Briefly, cells were incubated with the relevant antibodies for at least 15 min at 4 °C, and subsequently washed twice with FACS medium (PBS + 2% FCS). The CELLQUEST software program (Becton Dickinson, Mountain View, CA).was used for data acquisition and analysis. For TNF-a neutralization studies, two antibodies were used: rat anti-mouse TNF-a used (MP6-XT3) (BD Pharmingen, Mississauga, ON) and rat anti-mouse TNF-a (VI q) (Cedarlane, Hornby, ON). 7-AAD assay CD8 + T cells (1 x 106) were stimulated with 10 pg/ml of immobilized anti-CD3s (2C11) and 10 ug/ml of anti-CD28 (35.71) in a flat-bottom 24-well plate for various periods of time. Cells were harvested and stained with 7-AAD (10 pg/ml in FACS buffer), fixed with 4% paraformaldehyde, and subsequently analyzed by FACS (described above). Cytokine ELISA C D 8 + T cells (2 x 106) were cultured in a flat-bottom 24-well plate coated with 10 pg/ml of anti-CD3 for 20 hrs. The amount of IL-2 and IFN-y in the supernatant was determined by ELISA. The capture and detection Abs used for IL-2 were JES6-1A12 and JES6-5H4, 84 respectively (obtained from BD Pharmingen, Mississauga, ON). The capture and detection Abs used for IFN-y were R4-6A2 and XMG1.2, respectively (BD Pharmingen, Mississauga, ON). Briefly, plates were coated with the capture Ab (4 ug/ml in carbonate buffer) and blocked with 1% BSA/ 0.1% azide in PBS. Wells were washed with PBS-Tween 20 and samples were then added in three dilutions, with each plate containing wells for standard. The wells were washed and the detection Ab (1 u.g/ml in 1% BSA/ 0.1% azide in PBS) was added. The wells were then washed and streptavidin-alkaline phosphatase (BD Pharmingen, Mississauga, ON) was added (1/2000 in 1% BSA/ 0.1% azide in PBS). After washing the wells, substrate (Sigma 104) was added and plates were subsequently analyzed with an ELISA plate reader at 405 nm. Cytokine Competitive and Quantitative RT-PCR Competitive and quantitative polymerase chain reaction (CQ-PCR) was used to determine the steady-state levels of IL-2 and TNF mRNA. T cells (2 x 106) were cultured in 1 ml of I-media in flat-bottom 24-well plates coated with 5 u-g/ml of anti-CD3 for 9 hrs. Cells were then harvested and total RNA was prepared according to the manufacturer's recommendations using the RNeasy Mini Kit (Qiagen). cDNAs were generated from the total RNA preparation as previously described (33). CQ-PCR was then performed as previously described (33). Briefly, the amount of cDNA was normalized between TNFR2-deficient and WT T cells using the housekeeping gene HPRT. The linearized pPQRS plasmid was used as the competitor (gift from Richard Locksley, UCSF). The sequences for the 5' and 3' oligonucleotide primers used for IL-2 were, respectively: 85 5'-CCA CTT C A A GCT CTA C A G CGG AAG-3 ' and 5'-GAG TCA AAT CCA G A A CAT GCC GCA-3' . The sequences for the 5' and 3' oligonucleotide primers used for TNF-a were, respectively: 5'-GTT CTA TGG CCC A G A CCC TCA CAC-3 ' and 5'-TCC C A G GTA TAT GGG TTC ATA CCA AG-3'. The sequences for the 5' and 3' oligonucleotide primers used for HPRT were, respectively: 5'-GTT GGA TAC A G G C C A G A C TTT GTT G-3' and 5'-G A G GGT A G G CTG GCC TAT A G G CT-3'. The PCR products were subjected to electrophoresis on a 2 % agarose gel and stained with ethidium bromide. Densitometry was performed using the Alphalmager software. Western Blot C D 8 + T cells (2 x 106) were cultured in a flat-bottom 24-well plate coated with 10 jig/ml of anti-CD3 (2C11) alone and in combination with 10 u.g/ml of soluble anti-CD28 (37.51) for various periods of time. Whole cell lysates were prepared as previously described. Briefly, cells were harvested, washed with PBS and treated with lysis buffer (1% Triton X-100, TNE, ImM sodium orthovanadate, ImM sodium molybdate, Complete protease inhibitor cocktail (Roche Diagnostic, Laval, QC), and 10% glycerol) for 20 mins on ice. Total protein was quantified using Dc Protein Assay (BioRad, Hercules, CA). Equivalent amounts were resolved by SDS-PAGE, and then transferred to Immobolin-P membrane (Millipore Corporation, Bedford, MA) . The following antibodies (all from Cell Signaling Technologies, Pickering, ON) were used: rabbit phospho-p44/42 M A P K (Thr202/Tyr204) antibody, rabbit p44/42 M A P K antibody, rabbit phospho-p38 M A P K antibody, rabbit p38 M A P K antibody, rabbit phospho-SAPK/JNK (Thrl83/Tyrl85) antibody, rabbit SAPK/JNK antibody, 86 rabbit phospho-ZAP-70 (Tyr319) antibody, rabbit phospho-AKT (Ser473) antibody, rabbit A K T antibody, rabbit phospho-IicBa (Ser32) antibody, rabbit I K B O : antibody. Tyrosine phosphorylation was assayed using 4G10, a mouse IgG2b monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA). A K T activation was measured using the A K T kinase assay kit, which involves immunoprecipitating A K T from cell extracts, incubation with cold ATP and GSK-3ccP fusion protein as substrate, and detecting for phosphoryiated GSK-3a,p by western blot as per manufacturer's protocol (Cell Signaling Technologies, Pickering O N ) . Electrophoretic Mobility Shift Assay CD8 + T cells (4 x 106) were cultured in a flat-bottom 24-well plate coated with anti-CD3 (2C11) mAb (10 pg/ml) in the presence or absence of soluble anti-CD28 (37.51) mAb (10 pg/ml) for 8 hrs. Nuclear extracts were prepared as previously described (34). Briefly, cells were harvested and washed with PBS. Cell pellets were resuspended in Buffer A (10 mM HEPES, 1.5 mM MgCl 2 , 10 mM KC1, 0.5 mM DTT, 0.2 mM PMSF) and incubated on ice for 15 minutes. Samples were centrifuged, resuspended in Buffer C (20 mM HEPES, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl 2 , 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF), and incubated on ice for 20 minutes. Cellular debris was removed by centrifugation. Protein concentration of nuclear extracts was quantified using Dc Protein Assay (BioRad, Hercules, CA). The oligonucleotide probe used for N F K B was end-labeled with y[ 3 2P]-GTP. The 5' and 3' sequences used for generating three-nucleotide overhangs of the oligonucleotide probe were, respectively: 5'-ATG TGA GGG GAC TTT CCC-3' and 3'-ACT CCC CTG A A A 87 GGG TCC-5'. The fill-in reaction was mediated using the large fragment (klenow) of DNA polymerase I (Invitrogen, Carlsbad, CA). Nuclear extracts (4 ug) were incubated with radioactively labeled probe for 20 mins at room temperature, and then resolved by PAGE (5% acrylamide). Gel shifts were analyzed using Molecular Dynamics Phosphorimager SI system (Amersham Biosciences, Sunnyvale, CA) and ImageQuant (v 5.2) software (Amersham Biosciences, Sunnyvale, CA). 3.4 Results TNFR2 expression during T cell activation Patterns of cell surface expression of receptors can provide insight to their usage and function. The kinetics of expression of co-stimulatory members of the TNFR family appear to correlate with their temporal functions during T cell activation (2). Early work on the two TNF receptors reported that TNFR2 is the dominant TNF receptor on activated T cells (28), indicating that the pleiotropic effects of TNF-a can be attributed to, the differential expression of the TNF receptors. However, the kinetics of TNFR2 expression is unknown, and their examination may reveal insight into the temporal aspects of its function during T cell activation. We therefore examined TNFR2 expression during TCR/CD28-mediated stimulation of naive T cells. Immediately ex vivo CD8 T cells expressed a low level of TNFR2, and expression increased for at least 48 hrs of TCR/CD28-mediated stimulation (Fig. 3.1A). As expected, TNFR2-deficient T cells did not display any expression on the T cell surface. The basal expression of TNFR2 in 88 naive T cells suggests that it plays a very early role in T cell activation, and continues to exert its effect as its expression is upregulated during the early phase of the response. IL-2 induction during T cell activation is dependent on both CD28 and TNFR2 The induction of IL-2 gene during T cell activation requires both TCR-mediated and co-stimulatory signals. These signals provided at the initiation of the T cell response can control commitment to cytokine production and proliferation. CD28 is well characterized in its ability to co-stimulate robust IL-2 production. We previously reported the defect in the proliferative response to TCR/CD28-mediated stimulation by TNFR2-deficient CD8 + T cells (31). Moreover, IL-2 induction was defective in TNFR2-deficient CD8 + T cells stimulated via TCR-mediated stimulation. We sought to determine whether TNFR2 is critical for optimal IL-2 induction in T cells stimulated via both TCR and CD28. The amount of IL-2 that was secreted in response to TCR cross-linking alone and in combination with CD28 co-ligation was measured by ELISA performed on culture supernatants. As shown in Fig. 3.15, TNFR2-deficient CD8 + T cells stimulated with anti-CD3 displayed a marked reduction in the amount of IL-2 detected in the culture supernatant compared to WT CD8 + T cells. CD28 co-ligation led to enhancement of IL-2 production in WT CD8 + T cells, which is consistent with its known function in co-stimulating IL-2 induction. Strikingly, CD28 co-ligation did not rescue the defect in IL-2 production of TNFR2-deficient CD8 + T cells, demonstrating the importance of TNFR2 as a co-stimulator of IL-2 during T cell activation. This suggests that TNFR2 and CD28 may act synergistically in co-stimulating optimal IL-2 induction. A key point of IL-2 regulation is at the transcriptional level (9). To study whether the observed reduction in IL-2 production by TNFR2-deficient CD8 + T cells stemmed from a 89 reduction in the steady-state levels of cytokine transcript, IL-2 mRNA was measured by competitive and quantitative reverse transcription-polymerase chain reaction (CQ-PCR). This technique permits quantitative analysis of relative transcript levels as a function of competitor dose. When stimulated with anti-CD3 alone, TNFR2-deficient CD8 + T cells displayed a reduction in steady-state levels of IL-2 transcript compared to WT CD8 + T cells (Fig. 3.2). As expected, CD28 co-ligation caused a substantial (10-fold) increase in steady-state levels of IL-2 transcript in WT CD8 + T cells. In striking contrast, CD28 co-ligation only caused a modest increase for TNFR2-deficient CD8 + T cells, which displayed a 10-fold reduction in IL-2 transcript compared to WT (Fig. 3.2). This result reveals for the first time the importance of TNFR2 in the optimal induction of IL-2 at the mRNA level in response to TCR/CD28-mediated stimulation. The defect in steady-state levels of IL-2 transcript suggests that TNFR2 and CD28 may converge on common intracellular signaling effectors to achieve fine control over the activation of transcription factors that assemble at the IL-2 ( promoter for its optimal induction. TCR-proximal signaling events function independently ofTNFR2 The biochemical events following TCR engagement are well characterized, involving signaling events that ultimately lead to alteration of gene expression (35). TCR-mediated signal transduction involves phosphorylation of key tyrosine residues in the TCR complex by Src-family protein tyrosine kinases that lead to recruitment and activation of the tyrosine kinase ZAP-70 at the T cell surface (36). These tyrosine kinases then phosphorylate adaptor proteins such as LAT and couple the TCR complex to the Ras- and Rho-family GTPase signaling cascades, that lead to activation of the ERK1/2, JNK, p38 MAPKs (18). 90 Given the important contribution made by TNFR2 for IL-2 induction during TCR/CD28-mediated stimulation, we sought to investigate the signaling events through which TNFR2 exerts its effect in relation to those mediated through the TCR and CD28. We first examined whether TNFR2 affects TCR-proximal signaling events in response to stimulation with anti-CD3 alone, or in combination with either anti-CD28 or exogenous TNF-a (10 ng/ml), by assaying for global tyrosine phosphorylation. Notable TCR-proximal substrates observed by examination of the tyrosine phosphorylation profile include ZAP-70 (70-kDa) and its immediate downstream target LAT (36-38-kDa). As shown in Fig. 3.3/4, the tyrosine phosphorylation profiles of TNFR2-deficient CD8 + T cells appeared largely similar to WT. In addition, anti-CD28 and exogenous TNF-a treatment of TNFR2-deficient CD8 + T cells did not affect global tyrosine phosphorylation. These data suggest that TNFR2 is not required for tyrosine phosphorylation of substrates that are immediately coupled to the TCR complex, and that TCR-mediated stimulation is sufficient for these early signaling events. Consistent with this finding, ZAP-70 phosphorylation assayed directly by western blot showed that this TCR-proximal signaling event is not coupled to TNFR2 (Fig. 3.35). Hence, TCR-proximal signaling events of CD8 + T cells are functional and independent of TNFR2 at early time points of stimulation. MAPK family cascades are not coupled to TNFR2 during T cell activation TCR engagement is directly linked to the mitogen-activated protein kinase (MAPK) pathways, which include the ERK, JNK, and p38 MAPKs (37). Signals are delivered from the TCR complex to the ERK pathway via SLP76 and Grb2 (38), whereas JNK and p38 pathways appear to be coupled to both CD28 and TCR (39, 40). M A P K pathways are 91 notable for their role in activating transcription factors such as E l k l , c-Fos and c-Jun (the latter two of which are components of the heterodimeric transcription factor AP-1) (35, 41), which are known to be important for the regulation of IL-2 gene expression (40). We determined the relative roles of TCR, CD28 and TNFR2 in these M A P K pathways at various time points of stimulation using western blot analysis. We were particularly interested in examining the intracellular signaling milieu around the 10-hour time point, since we observed that steady-state levels of IL-2 transcript were markedly reduced in TNFR2-deficient CD8 + T cells at this time point. As shown in Fig. 3.4, anti-CD3 treatment was sufficient to phosphorylate ERK 1/2, JNK, and p38 in both TNFR2-deficient and WT CD8 + T cells, and phosphorylation persisted up to 10 hrs of stimulation. Moreover, CD28 co-ligation did not lead to an increase in phosphorylation of these M A P K s . These data suggest that the M A P K pathways are sufficiently activated by TCR-mediated stimulation and do not require TNFR2. TNFR2 is critical for sustaining protein kinase B (AKT) phosphorylation during the early phase of TCR/CD28-mediated T cell activation TCR signaling is coupled to phosphoinositide-3 kinase (PI3K), which then leads to A K T recruitment and activation (42). A previous report demonstrated that A K T acts as a mediator for CD28 co-stimulation of IL-2 induction (19), indicating that both TCR and CD28 signaling promote A K T phosphorylation (42). The finding that CD28 co-ligation failed to rescue the defect in IL-2 induction by TNFR2 7 " T cells suggested that TNFR2 may be functionally linked to CD28 in regulating IL-2. We therefore examined the possibility that A K T phosphorylation may be a downstream site of convergence between TNFR2 and 92 CD28. It was found that A K T underwent robust phosphorylation in response to anti-CD3 stimulation in both WT and TNFR2-deficient CD8 + T cells at early time points (Fig. 3.5A). This phosphorylation was sustained over the 10 hrs of anti-CD3 stimulation examined for WT CD8 T cells, but was dramatically decreased for TNFR2-deficient CD8 T cells. Interestingly, CD28 co-ligation failed to rescue this defect in A K T phosphorylation. To directly measure the activation of AKT, we utilized a non-radioactive A K T assay that measures the phosphorylation of the substrate, a GSK-3a/p fusion protein (see Materials and Methods). As shown in Fig. 3.55, wild-type and TNFR2-deficient CD8 + T cells displayed similar immediate activation of A K T after 10 minutes of stimulation as indicated by similar levels of phosphoryiated GSK-3a/p. Strikingly, A K T activity was dramatically less in TNFR2-deficient T cells compared to wild type after 10 hrs of stimulation, and CD28 co-ligation did not rescue this defect. These data demonstrate the importance of TNFR2 towards sustaining the activation of A K T during T cell activation, and indicate a functional link between the CD28 and TNFR2 co-stimulatory pathways. Previous work has shown that IL-2 and related cytokines can activate A K T (43). Given that TNFR2-deficient CD8 + T cells possess a defect in IL-2 induction, we sought to determine whether the defect in A K T phosphorylation was indirectly due to limited IL-2 production by TNFR2-deficient CD8 + T cells. We addressed this question using a blocking antibody for IL-2R during stimulation with anti-CD3 and CD28 co-ligation. The dose of anti-IL2RP used was sufficient to completely abrogate T cell proliferation (data not shown). It was found that anti-IL-2Rp treatment did not substantially affect A K T phosphorylation in WT CD8 + T cells after 10 hrs of stimulation, demonstrating that the IL-2 is not necessary for A K T phosphorylation during the early phase (up to 10 hrs) of the response. This suggests 9 3 that this period represents an IL-2 independent phase of T cell activation. This strongly suggests that the defect in A K T activation observed for TNFR2-deficient CD8 + T cells is due to lack of a direct signal towards A K T via TNFR2. TNFR2 is critical for NFKB activation N F K B is one of a crucial set of transcription factors that coordinately bind to the IL-2 promoter ( 4 4 ) . It is downstream of both TCR and CD28 signaling via protein kinase C theta and A K T ( 4 5 ) . In its latent form, it is found in a complex with IKBCC in the cytoplasm ( 4 6 ) . Activation signals target this complex by phosphorylating IKBCC , leading to its degradation mediated by ubiquitin. The liberated N F K B then translocates through nuclear pores and subsequently acts upon on gene targets. Hence, N F K B activation can be measured directly by its translocation into the nucleus, and indirectly by the phosphorylation of IKBCC. Previous work has shown that A K T activation leads to activation of N F K B ( 4 7 ) . Given the defect in A K T phosphorylation observed in TNFR2-deficient CD8 + T cells, as well as the important role that N F K B in IL-2 gene expression, we sought to determine whether TNFR2 couples to this transcription factor during T cell activation. First, we examined the phosphorylation of IKBCC and steady-state levels of the unphosphorylated form in response to TCR/CD28-mediated stimulation. As shown in Fig. 3 . 6 , IKBOC underwent robust phosphorylation in the immediate response (i.e. 5 minutes) to TCR-, TCR/CD28-, and TCR/CD28/TNFa-mediated stimulation in WT and TNFR2-deficient CD8 + T cells. IKBCC phosphorylation was sustained in WT CD8 + T cells after 1 0 hrs of stimulation, whereas TNFR2-deficient CD8 + T cells display markedly reduced IKBOC phosphorylation in comparison. CD28 co-ligation was unable to rescue IKBOC phosphorylation in TNFR2-deficient CD8 + T cells. The steady-state 94 level of IKBOC protein was diminished in WT CD8 + T cells at 10 hrs of stimulation, indicating its degradation subsequent to phosphorylation. In contrast, TNFR2-deficient CD8 + T cells displayed similar level of IKBCC protein relative to unstimulated control. These data suggest that TCR-mediated stimulation is sufficient for immediate phosphorylation of IKBCC, and that TNFR2 provides an important contribution to sustain this response during T cell activation. To directly measure the activation of N F K B , its presence in the nucleus of T cells upon TCR- and TCR/CD28-mediated stimulation was detennined using electrophoretic mobility shift assay. Consistent with the IKBCC phosphorylation data, the steady-state levels of N F K B in the nucleus of WT CD8 + T cells was substantially greater than for TNFR2-deficient CD8 + T cells in response to TCR/CD28-mediated stimulation. These data strongly suggest that TNFR2 plays an important role in activating N F K B translocation to the nucleus during T cell activation. TNFR2 promotes T cell survival and is required for BCI-XL expression during T cell activation T cell survival is an essential means by which the strength of the immune response is regulated. T cell activation can lead to a number of cell fate outcomes, depending on the context of signals provided by the local environment. Co-stimulation mediated by CD28 controls initial clonal expansion and provides early signals for expression of the Bcl-2 family member Bcl-X[_ (15). The co-stimulatory TNFR family member OX40 was shown to be important for maintaining high levels of Bcl-X[_ later during activation (days 4-8), indicating the temporally linked functions of CD28 and OX40 towards T cell survival (48). 95 Given that TNFR2-deficient T cells exhibit a defective proliferative response to TCR/CD28-mediated stimulation, we next addressed whether this defect is due to an inability to survive during T cell activation. We analyzed cell death using 7-AAD staining and correlated this with cell proliferation, as measured using CFSE by flow cytometry. CFSE fluorescence measured by flow cytometry revealed that anti-CD3 and anti-CD28 co-treatment led to the proliferation of TNFR2-deficient CD8 + T cells to the dividing population after 65 hrs of culture (Fig. 3.1 A), although the total clone size as measured by the number of viable cells recovered was reduced in TNFR2-deficient CD8 + T cell cultures (Fig. 3.IB). The latter result suggested that TNFR2-deficient T cells are defective for survival during T cell activation. Examination of 7-AAD fluorescence revealed that the percentage of live cells was reduced in TNFR2-deficient T cell cultures compared to WT (42% and 71% respectively), and that proportionately more cells that were induced to divide stained as apoptotic. This suggests that TNFR2 is important for the survival of T cells during the proliferative response, and indicates that dividing cells possess an increased propensity to undergo apoptosis in the absence of survival signals provided by TNFR2. The observation that CD28 co-ligation failed to rescue the survival defect of TNFR2-deficient T cells suggested that the expression of anti-apoptotic molecules attributable to CD28 signaling is also defective. We therefore examined TCR/CD28-mediated upregulation of B c l - X L using western blot analysis. Consistent with previous reports (15, 49), CD28 co-ligation led to an increase in BC1-XL expression over TCR'-mediated stimulation alone. Strikingly, the expression of this anti-apoptotic molecule was completely abolished in TNFR2-deficient CD8 + T cells, and CD28 co-ligation failed to rescue this defect. This 9 6 strongly suggests that TNFR2 acts to promote survival via expression of Bcl-Xi_ during th very early phase of T cell activation. 3.5 Discussion The two-signal model for T cell activation has been substantially modified since it was first proposed more than 30 years ago (50). The 'second signal' that was initially attributed to CD28 has now grown in complexity based on observations that other cell surface molecules can modulate specific aspects of the T cell response. The identification of other co-stimulatory molecules is important in light of the ability of CD28-deficient T cells to undergo a robust activation response depending on the strength of signal mediated initiated by the TCR. We demonstrated here the critical role of TNFR2 in TCR/CD28-mediated stimulation of the induction of IL-2. The striking finding that IL-2 production in TNFR2-deficient T cells could not be rescued by CD28, strongly suggested that both receptors are important for co-stimulating IL-2 production. The results advance the current co-stimulatory model of IL-2 induction during T cell activation, for which CD28 has been understood to be the dominant co-stimulatory receptor. Our results revealed a hitherto unknown functional link between TNFR2 and TCR/CD28 in up-regulating the state-steady levels of IL-2 transcript, and that this relationship was correlated with defects in the activation of A K T and N F K B in TNFR2-deficient CD8 + T cells. We found that TNFR2 is one of the earliest expressed receptor among the known co-stimulatory members of the TNFR family, with basal expression in naive CD8 T cells set to co-stimulate T cell activation. Moreover, our data showed that TNFR2 was important for T cell survival during TCR/CD28-mediated activation, and that TNFR2 97 deficiency correlated with a defect in the expression of the anti-apoptotic molecule Bcl-X L . Thus, TNFR2 is positioned as one of the earliest of the known co-stimulatory members of the TNFR family and functionally linked to CD28 for IL-2 induction and T cell survival, and thereby serves as an important control point for T cell fate. Biochemical mechanism ofTNFR2 and CD28 in promoting IL-2 induction Many studies have examined the biochemical nature of CD28 co-stimulation in relation to TCR signaling. The body of evidence strongly suggests that CD28 utilizes both qualitative and quantitative signals. Michel et al. (2001) showed that CD28 co-stimulation potentiates TCR signaling by amplifying PLC-yl activation and intracellular calcium response, demonstrating quantitative signaling and synergy between the TCR and CD28 signaling pathways. Kane et al. (2001) showed that CD28 signal transduction involving A K T is needed for activating CD28RE in the IL-2 promoter, demonstrating qualitative signals that are uniquely mediated by CD28 towards IL-2 induction. In examining the biochemical nature of the co-stimulatory role of TNFR2 in IL-2 induction, we observed that TCR-proximal events such as tyrosine phosphorylation of L A T and ZAP-70 phosphorylation were not coupled to the TNFR2 pathway. Moreover, M A P K cascades (ERK, JNK, and p38) were also found to be largely unaffected by TNFR2-deficiency in CD8 + T cells, demonstrating that TCR-mediated signaling is adequate to activate the M A P K pathways. These findings strongly suggest that TNFR2 might provide a distinct signal for its co-stimulatory properties in T cells. Indeed, we showed specific defects in the activation of the A K T and N F K B pathways in TNFR2-deficient CD8 + T cells, demonstrating that a co-stimulatory member of the TNFR family activates the 98 A K T / N F K B signaling axis, in a manner that cannot be replaced by CD28 signaling. Furthermore, blockade of IL-2 signaling (using anti-IL-2RP) during the first 10 hrs of culture did not abrogate the phosphorylation of A K T for wild-type T cells, indicating that defective A K T activation observed for TNFR2-deficient T cells was not due to indirect effects associated with defective IL-2 production. These data suggest that the TNFR2 pathway is not coupled to TCR-proximal signaling events or M A P K family cascades, but rather acts through a distinct signal to activate the A K T / N F K B pathway. The observation that TNFR2 is required for sustaining A K T phosphorylation at 10 hrs of TCR/CD28 stimulation suggests that TNFa is produced during the first 10 hrs of activation and then signals in an autocrine fashion through TNFR2. If this were the case, then we should be able to block A K T activation in WT cells by adding a neutralizing anti-TNFa Ab during the first 10 hr of activation. We used two neutralizing anti-TNFa mAbs from commercial sources (see Materials and Methods)but neither antibody was effective in inhibiting anti-TCR induced proliferation in WT cells. The lack of availability of an effective neutralizing anti-TNFa Ab prevented us from testing this hypothesis. The finding that CD28 co-stimulation only led to a marginal increase in the steady-state levels of IL-2 transcript and secreted cytokine in TNFR2-deficient T cells (though leading to a substantial increase in wild-type cells) suggests a novel relationship between these two co-stimulatory molecules, and an interesting functional link between the CD28-related and TNFR families. The marginal increase demonstrated that CD28 was still functional in TNFR2-deficient T cells, and suggests that TNFR2 provides an important contribution relative to CD28 for IL-2 production during T cell activation. The relative signaling from these two co-stimulatory molecules appear to converge at the level of 99 A K T and N F K B , critical mediators of IL-2 production. The cytoplasmic tail of CD28 is known to contain a binding domain for PI3K, which is immediately upstream of A K T phosphorylation. Further work is required to examine signaling pathways by which TNF receptors and CD28 differentially regulate A K T and N F K B immediately proximal to these cell surface receptors. Role oj' TNFR2 In co-stimulation relative to CD28 and other members of the TNFR family l On a temporal basis, CD28 controls the early outcomes of T cell activation by co-stimulating IL-2 induction and anti-apoptotic members of the Bcl-2 family, reflecting its constitutive expression on naive T cells. GD28 is therefore positioned among the earliest co-stimulatory molecules in a temporal model of T cell activation, affecting threshold of signaling required for progression of T cell activation upon TCR engagement such as initial clonal expansion, survival, and IL-2 induction. Engagement of CD28 then leads to efficient expression of TNFR family members (such as OX40, 4-1BB, and CD27) in a temporal sequence of co-stimulatory modulation of the T cell response. The growing number of co-stimulatory members identified in the TNFR family suggests that there are multiple specific and simultaneous signals that function in a temporal manner towards modulating T cell response outcomes (2). The data described in this chapter provide the first case of a co-stimulatory member of the TNFR family acting in the earliest phase of T cell activation, positioned temporally with CD28 in a non-redundant manner to promote the induction of IL-2 and promoting T. cell survival. Moreover, this is the first TNFR member identified to have a functional link to CD28 towards IL-2 induction, in contrast 100 to the temporal link that exists between CD28 and other co-stimulatory members of the TNFR family. The findings in our study are particularly important given the recent advances in our understanding of the signaling networks that are linked to various co-stimulatory , molecules (2). Signaling by CD28 and TNFR family members appear to converge on common intermediates and their respective roles during T cell activation are temporally delineated by kinetics of expression at the cell surface. The constitutive expression of TNFR2 on T cells and subsequent up-regulation early during T cell activation, together with the observation that IL-2 induction is defective in TNFR2-deficient T cells, which cannot be rescued by CD28 co-ligation, strongly argues that TNFR2 is a critical co-stimulatory receptor for early T cell activation events during which T cell fate is determined. Integral role of AKT as a common signaling mediator of co-stimulatory molecules A K T activity is functionally associated with TCR/CD28-mediated induction of IL-2, expression of anti-apoptotic members of the Bcl-2 family, and T cell survival (20, 51). Indeed, the important role of A K T in T cell survival was shown by Song et al. (2004) using ectopic expression of active and dominant negative variants of A K T (20). A link between co-stimulatory members of the TNFR family and A K T was previously postulated (2). More recently, it was shown that OX40, a member of the TNFR family, functions to maintain A K T activity over time. OX40-deficient CD4 + T cells display normal levels of phosphoryiated A K T over the first 24 hrs of antigen-specific stimulation, but do not maintain large amounts of phosphoryiated A K T from day 2 to day 4 (20). Sustained A K T 101 signaling mediated via OX40 is correlated with prolonged cell survival over time. Our observation that A K T phosphorylation is defective in TNFR2-deficient T cells during the first 24 hrs of stimulation suggests that the functional link between co-stimulatory molecules is temporally regulated through A K T as a common signaling mediator. Moreover, the early role of TNFR2 in the A K T / N F K B pathway during T cell activation suggests that it is an important regulatory point for initiation and progression of the T cell response. CD28, OX40 and now TNFR2 are therefore identified as co-stimulatory molecules that are linked with the A K T pathway to exert discrete effects (i.e. IL-2 induction, clonal expansion, and survival) during the T cell response. Each co-stimulatory molecule acts in a temporally distinct manner based on their peak expression on the cell surface suggesting critical check points during T cell activation. Regulation of T cell survival by TNFR2 during T cell activation T cell fate decisions are dependent on the signals that are provided during antigenic challenge, which regulate pathways involved in cell survival and death. CD28-mediated co-stimulation was thought to be the primary signal for commitment of responding T cells to clonal expansion, IL-2 production, and survival, depending on the strength of TCR-mediated signals (11). An inadequate level of signaling (i.e. sub-threshold) via CD28 and TCR-mediated signals leads to either anergy or death (1), whereas a sufficient level of signaling through these pathways leads to the induction of co-stimulatory members of the TNFR family, which subsequently functions to sustain the T cell response by promoting survival (2). We found in our study that TNFR2 functions at early time points during TCR/CD28-mediated activation towards T cell fate outcome early during activation by controlling 102 survival. The data suggest that the progression of the T cell response beyond day 1 is largely dependent on TNFR2. Indeed, TNFR2-deficient CD8 + T cells show an increased propensity towards apoptosis during TCR/CD28-mediated stimulation, leading to reduced clone size. This suggests that the balance between life and death in controlling T cell fate outcomes is determined by early signals provided by TCR, CD28 and TNFR2. The expression of B C 1 - X L was upregulated as early as 10 hrs after TCR/CD28-mediated stimulation, and was completely abrogated in TNFR2-deficient CD8 + T cells. A previous study by Noel et al. (15, 49) showed that anti-CD3 treatment led to B c l - X L expression, and that CD28 co-ligation led to even greater levels of B c l - X L after 24 hrs of stimulation. The same study also showed that CD28-deficient T cells and CTLA4-Ig treatment displayed a substantial decrease in B C 1 - X L expression after 24 hrs of stimulation. Our study examined Bcl-X|_ expression after 9 hrs of stimulation, showing that anti-CD3 treatment in wild-type CD8 + T cells led to expression of B C 1 - X L and that CD28 co-ligation was additive towards greater expression. Although CD28 co-ligation led to an increase in expression, the level of Bcl-Xi_ was still significant after 9 hrs of anti-CD3 treatment alone, conditions that would be similar to examining CD28-deficient T cells at the same early time point. However, TNFR2-deficient T cells displayed a striking abrogation of B C 1 - X L expression when treated with either anti-CD3 alone or in combination with anti-CD28. This suggests that TNFR2 is critical for co-stimulating Bcl-X L expression with the TCR complex during the very early phase of T cell activation. Overall, the data show that TNFR2 acts as one the earliest of the identified co-stimulatory members of the TNFR family, functionally linked to CD28 during the early phase of the T cell response. TNFR2-deficiency in CD8 + T cells led to specific biochemical 1 0 3 defects in the activation of A K T , N F K B , and B c l - X L as early as 1 0 hrs after T C R / C D 2 8 -mediated stimulation. The importance of T N F R 2 during TCR/CD28-mediated stimulation reveals an important framework of cell surface molecules from distinct receptor families towards crucial activation events such as IL-2 induction, clonal expansion, and survival. It also points to the importance of the temporal and environmental context in dictating T cell fate outcomes during the early stages of activation. 3.6 Acknowledgements We thank Soo-Jeet Teh for excellent technical assistance, and Dr. John Priatel and Salim Dhanji for helpful discussions. We also thank Dr. Richard Locksley (UCSF) for the pPQRS plasmid. 104 3.7 Figures aCD3 + aCD28 A WT p75-/- Oh 24h 48h 10° 101 102 103 IO4 p75 expression B E • ctCD3 aCD3 + aCD28 Figure 3.1 A) TNFR2 expression on naive and activated T cells. B) IL-2 production in response to TCR/CD28-mediated stimulation is defective in TNFR2-deficient CD8 + T cells. A) CD8 + T cells ( lx lO 6) were stimulated with 10 pg/ml of plate-bound anti-CD3 in combination with soluble anti-CD28 (10 pg/ml) for various times, harvested and subjected to analysis by flow cytometry (see Materials and Methods). Dotted line = TNFR2-deficient T cells, grey line = immediately ex vivo WT T cells, black line = WT T cells stimulated for 24 hrs, shaded line = WT T cells stimulated for 48 hrs. B) CD8 + T cells ( lxlO 6) were stimulated with 10 pg/ml of plate-bound anti-CD3 alone, or in combination with anti-CD28 (10 pg/ml). Cytokine ELISA was performed on the culture supernatants (see Materials and Methods). The data points denote mean ± standard deviation of triplicate determinations. 1 0 5 aCD3+ aCD3 aCD3+ a C D 3 aCD28 alone aCD28 alone I II II II [competitor] 1 10 1 10 1 10 1 10 competitor IL-2 p75"'- B6 competitor H P R T B B6 p75"'-Figure 3.2 TNFR2-deficient CD8 + T cells display a marked reduction in steady-state levels of IL-2 transcript in response to TCR/CD28-mediated stimulation. A) C D 8 + T cells (2xl0 6) were stimulated with 10 ug/ml of plate-bound anti-CD3 alone, or in combination with anti-CD28 (10 pg/ml). Total RNA was harvested, reverse transcribed, and subsequently analyzed using CQ-PCR (see Materials and Methods). Numerical values (i.e. 1 and 10) refer to the concentration of competitor relative to R N A sample in each lane. B) The IL-2/HPRT transcript ratios of WT and TNFR2-deficient CD8 + T cells stimulated with either aCD3 alone, or in combination with otCD28. Abbreviations used: comp = competitor, HPRT = hypoxanthine phosphoribosyl transferase. Data is representative of one of three independent experiments perfonned. 1 0 6 kDa 175 83 62 47.5 32.5 25 16.5 6 5 B6 p75" ;-1 2 3 4 5 1 2 3 4 5 &m JUl HiK a^aife Hp • Hi • w W Mi <^  H i * » - * p-Tyr 1. aCD3 2: aCD3 + aCD28 3: aCD3 + T N F a 4: T N F a 5: no stimulation B aCD3 aCD28 1: B6 2' p75" ;-10 mins + + + + - + + , « ™ J „ .^ ^^  jHH^' 1 2 1 2 1 2 p-Zap70 10 mins Figure 3.3 TCR-proximal signaling events are largely unaffected by TNFR2-deficiency. A) Global tyrosine phosphorylation is unaffected by TNFR2-deficiency. CD8 + T cells (2xl0 6) were stimulated for 10 mins with 10 fig/ml of plate-bound anti-CD3 alone, or in combination with anti-CD28 (10 u,g/ml) and TNFa (10 ng/ml). Whole cell lysates were prepared, resolved by SDS-PAGE, and subjected to western blot (see Materials and Methods). B) Zap-70 phosphorylation is unaffected by TNFR2-deficiency. CD8 + T cells (2x10°) were stimulated for 10 mins with 10 pg/ml of plate-bound anti-CD3 alone, or in combination with anti-CD28 (10 pg/ml). Whole cell lysates were prepared, resolved by SDS-PAGE, and subjected to western blot (see Materials and Methods). Data are representative of three independent experiments. 107 odGD3 aCD28 1: B6 2: p75J-B a C D 3 aCD28 - + + + + PMA + + + + + + + + p-Erk1/2 1 2 12 12 1 2 1 2 1 2 I I I I Erk:2 10 mins 5 h - - + + + + PMA + + + + - . . . + + + + — — — — • , — p-Jnk 1 2 12 12 1 2 1 2 1 2 Jnk I I I I 10 mins 10 h C a CDS + + + + PMA + + + * aCD28 + • - • + » • p-p38 1 2 12 12 1 2 1 2 1 2 ^ 10 mins 10h Figure 3.4 M A P K activation is unaffected by TNFR2-deficiency. CD8 + T cells (2xl0 6) were stimulated with 10 pg/ml of plate-bound anti-CD3 alone, or in combination with anti-CD28 (10 pg/ml). P M A (10 ng/ml) stimulation was used as positive control. Whole cell lysates were prepared, resolved by SDS-PAGE, and subjected to western blot (see Materials and Methods). Data is representative of three independent experiments. 108 cc CD3 a CD28 1: B6 2: p75-;-- - + + + + - - - - + + 12 12 1 2 a CD3 a CD28 a IL-2 1 B6 2 n75 10 m i n s + + + + + + + + + + 1 2 1 2 1 2 10 h p-Akt Akt B a CDS aCD28 + + + + - - + + 12 12 1 2 + + + + + + 1 2 1 p -GSK3a /p Akt 10 mins 10 h Figure 3.5 A K T activation is defective in TNFR2-deficient C D 8 + T cells. A) A K T phosphorylation is defective in TNFR2-deficient T cells. C D 8 + T cells (2x10 ) were stimulated with 10 pg/ml of plate-bound anti-CD3 alone and in combination with anti-CD28 (10 pg/ml) or anti-IL2R(3 (20 pg/ml). Whole cell lysates were prepared, resolved by SDS-P A G E , and subjected to western blot (see Materials and Methods). B) A K T activity is defective in TNFR2-deficient T cells. C D 8 + T cells (2x l0 6 ) were stimulated with 10 pg/ml of plate-bound anti-CD3 and anti-CD28 (10 pg/ml) for 10 hrs and total cell extracts were subsequently prepared. A K T was immunoprecipitated, incubated with cold A T P and G S K -3a/p fusion protein substrate, and phosphorylated GSK-3a/(3 was measured using western blot (see Materials and Methods). Data is representative of three independent experiments. 109 A aCD3 ++++++ - + + + + + + aCD28 - -+ + + + . . - + + + + TNFa. . . - - + + . + + - —— - — — - i f - i t — phospho-kBot 1: B6 1 2121212 12 12 12 2 p75"/- —••«--•— — - - — - ***** - mm iicBa i if i t , J PMA 5 mins 10 h aCD3 - - + + + + aCD28 - - - - + + 1 B6 12 12 12 2: p75";-NFKB complex : : r e e p r o b e Figure 3.6 A) IKBOC phosphorylation and subsequent degradation is defective in T N F R 2 -deficient C D 8 + T cells. B) N F K B activation is defective in TNFR2-deficient C D 8 + T cells. A) C D 8 + T cells (2x l0 6 ) were stimulated with 10 pg/ml of plate-bound anti-CD3 alone, or in combination with anti-CD28 (10 pg/ml) and T N F a (10 ng/ml). Whole cell lysates were prepared, resolved by S D S - P A G E , and subjected to western blot (see Materials and Methods). E) C D 8 + T cells (2 x 106) were treated with 10 pg/ml of plate-bound anti-CD3 alone or in the presence of anti-CD28 (10 pg/ml) for 8 hrs and nuclear extracts prepared (see Materials and Methods). Nuclear extracts were incubated with radio-labeled probe containing N F K B binding sites, and N F K B activation was determined using a gel shift assay as described in Materials and Methods. Data is representative of three independent experiments. 110 36 7AAD 10° 10 1 10 2 10 3 10* p75" 10° 10' 10 J 10 3 10* C F S E B o ffl > ffl Jo E Z • B6 • pis-1-<.CD3 O.CD3 + 8 . C 0 2 8 o.CD3 - - + + + + O.CD28 . - - - + + B d - X L , : 0 6 , 1 2 1 2 1 2 2. p / J amm mm* mmm mm*m mmm —* ' ' K . 10 h F i g u r e 3.7 Early survival and expression of B C 1 - X L is defective in TNFR2-deficient CD8 + T cells. A) CFSE-labeled CD8 + T cells ( lxlO 6) were treated with 10 ug/ml of plate-bound anti-CD3 and soluble anti-CD28 (10 ug/ml) for 65 hrs, harvested and stained with 7-AAD, and analyzed by flow cytometry (see Materials and Methods). B) Total live cell counts in culture after 48 hrs of stimulation with 10 pg/ml of plate-bound anti-CD3 and soluble anti-CD28 (10 pg/ml). C) CD8 + T cells (2xl0 6) were stimulated with 10 pg/ml of plate-bound anti-CD3 alone, or with soluble anti-CD28 (10 pg/ml) for 9 hrs. Whole cell lysates were prepared and B c l - X L expression was analyzed using western blot. Data is representative of three independent experiments. I l l 3.81 References 1. Lenschow, D. J., T.L. Walunas, and J.A. Bluestone. 1996. CD28/B7 system of T cell co-stimulation. Annu. Rev. Immunol. 14:233. 2. Croft, M . 2003. Co-stimulatory members of the TNFR family: keys to effective T-cell immunity. Nat. Rev. Immunol. 3:609. 3. Watts, T. H., and M . A . DeBenedette. 1999. T cell co-stimulatory molecules other than CD28. Curr. Opin. Immunol. 11:286. 4. Rothstein, D. M . a. M . H. S. 2003. T-cell costimulatory pathways in allograft rejection and tolerance. Immunol. Rev. 196:85. 5. Rudd, C. E. 1996. Upstream-downstream: CD28 cosignaling pathways and T cell function. Immunity 4:527. 6. Abbas, A . K. 2003. The control of T cell activation vs. tolerance. Autoimmun. Rev. 2:115. 7. Fraser, J. D., B.A. Irving, G.R. Crabtree, and A. Weiss. 1991. Regulation of interleukin-2 gene enhancer activity by the T cell accessory molecule CD28. Science 251:313. 8. . Hollander, G. A. 1999. On the stochastic regulation of interleukin-2 transcription. Semin. Immunol. 11:357. 9. Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333. 10. Civil , A. , M . Geerts, L .A. Aarden, and C L . Verweij. 1992. Evidence for a role of CD28RE as a response element for distinct mitogenic T cell activation signals. Eur. J. Immunol. 22:3041. 11. Kundig, T. M . , A . Shahinian, K. Kawai, H-W. Mittrucker, E. Sebzda, M.F. Bachman, T.K. Mak, and P.S. Ohashi. 1996. Duration of TCR stimulation determines costimulatory requirement of T cells. Immunity 5:41. 12. Viola, A . a. A . L. 1996. T cell activation determined by T cell receptor number and tunable thresholds. Science 273:104. 13. Lucas, P. J., I. Negishi, K. Nakayama, L.E. Fields, and D. Loh. 1995. Naive CD28-deficient T cells can initiate but not sustain an in vitro antigen-specific immune response. J. Immunol. 154:5757. 112 14. Jenkins, M . K . , P.S. Taylor, S.D. Norton, and K . B . Urdahl. 1991. CD28 delivers a costimulatory signal involved in antigen-specific IL-2 production by human T cells. J. Immunol. 147:2461. 15. Boise, L . H . , A . J . Minn, P.J. Noel , C H . June, M . A . Accavitti, T. Lindsten, and C B . Thompson. 1995. CD28 co-stimulation can promote T cell survival by enhancing the expression of B C 1 - X L . Immunity 3:87. 16. Lindsten, T., C H . June, J .A. Ledbetter, G . Stella, and C B . Thompson. 1989. Regulation of lymphokine messenger R N A stability by a surface-mediated T-cell activation pathway. Science 244:339. 17. Michel , F., G. Attal-Bonnefoy, G . Mangino, S. Mise-Omata, and O. Acuto. 2001. CD28 as a molecular amplifier extending T C R ligation and signaling capacities. Immunity 15:935. 18. Rudd, C. E. , and M . Raab. 2003. Independent CD28 signaling via V A V and S L P -76: a model for in trans co-stimulation. Immunol. Rev. 192:32. 19. Kane, L . P., P .G . Andres, K . C . Howland, A . K . Abbas, and A . Weiss. 2001. Akt provides the CD28 costimulatory signal for up-regulation of IL-2 and IFN-y but not T H 2 cytokines. Nat. Immunol. 2:37. 20. Song, J., S. Salek-Ardakani, P.R. Rogers, M . Cheng, L . V . Parijs, and M . Croft. 2004. The co-stimulation-regulated duration of P K B activation controls T cell longevity. Nat. Immunol. 5:150. 21. Hendriks, J., L . A . Gravestein, K . Tesselaar, R . A . W . van Lier, T . N . M . Schumacher, and J. Borst. 2000. CD27 is required for generation and long-term maintenance of T cell immunity. Nat. Immunol. 1:433. 22. Shuford, W . W., K . Klussman, D . D . Tritchler, D.T. Loo, J. Chalupny, A . W . Siadak, T.J. Brown, J. Emswiler, H . Raecho, C P . Larsen, T .C . Pearson, J .A. Ledbetter, A . Aruffo, and R.S. Mittler. 1997. 4-1BB costimulatory signals preferentially induce C D 8 + T cell proliferation and lead' to the amplification in vivo of cytotoxic T cell responses. J. Exp. Med. 186:47. 23. Bertram, E . M . , P. Lau, and T . H . Watts. 2002. Temporal segregation of 4-1 B B versus CD28-mediated co-stimulation: 4-1BB ligand influences T cell numbers late in the primary response and regulates the size of the T cell memory response following influenza infection. J. Immunol. 168:3 777. 24. Melero, I., W . W . Shuford, S.A. Newby, A . Arrufo, J .A. Ledbetter, K . E . Hellstrom, R.S. Mittler, and L . Chen. 1997. Monoclonal antibodies against the 4-1BB T-cell activation molecule eradicate established tumors. Nat. Med. 3:682. ) 113 25. Gramaglia, I., A . Jember, S.D. Pippig, A . D . Weinberg, N . Killeen, and M . Croft. 2000. The O X 4 0 costimulatory receptor determines the development of C D 4 memory by regulating primary clonal expansion. J. Immunol. 165:3043. 26. Pimental-Muinos, F. X . , M . A . Munoz-Fernandez, and M . Fresno. 1994. Control of T lymphocyte activation and. IL-2 receptor expression by endogenously secreted lymphokines. J. Immunol. 152:5714. 27. Tartaglia, L . A . , D . V . Goeddel, C. Reynolds, I.S. Figari, R.F . Weber, B . M . Fendly Jr., and M . A . Palladino. 1993. Stimulation of human T-cell proliferation by specific activation of the 75-kDa tumor necrosis factor receptor. J. Immunol. 151:4637. 28. Ware, C. F., P .D. Crowe, T . L . Vanarsdale, J .L. Andrew, M . H . Grayson, R. Jerzy, • C A . Smith, and R . G . Goodwin. 1991. Tumor necrosis factor (TNF) receptor expression in T lymphocytes. Differential regulation of the type 1 T N F receptor during activation of resting and effector T cells. J. Immunol. 147:4229. 29. Ware, C. F., P .D. Crowe, M . H . Grayson, M . J . Androlewicz, and J .L. Browning. 1992. Expression of surface lymphotoxin and tumor necrosis factor on activated B , T, and natural killer cells. J. Immunol. 149:3881. 30. Rothe, M . , S . C Wong, W.J . Henzel, and D . V . Goeddel. 1994. A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell 78:681. 31. K i m , E . Y . , and H.S. Teh. 2001. T N F type 2 receptor (p75) lowers the threshold of T cell activation. J. Immunol. 167:6812. 32. Erickson, S. L . , F.J . de Sauvage, K . K i k l y , K . Carver-Moore, S. Pitts-Meek, N . Gillett, K . C . F . Sheehan, R .D . Schreiber, D . V . Goeddel, and M . W . Moore. 1994. Decreased sensitivity to tumor necrosis factor but normal T-cell development in T N F receptor-2-deficient mice. Nature 372:560. 33. Reiner, S. L . , S. Zheng, D . B . Corry, and R . M . Locksley. 1993. Constructing polycompetitor c D N A s for quantitative P C R . J. Immunol. Methods 165:37. 34. Andrews, N . C , and D . V . Faller. 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19:2499. 35. Cantrell, D . 1996. T cell antigen receptor signal transduction pathways. Annu. Rev. Immunol. 14:259. 36. Acuto, O., and D. Cantrell. 2000. T cell activation and the cytoskeleton. Annu. Rev. Immunol. 18:165. 114 37. Dong, C , R.J. Davis, and R.A. Flavell. 2002. MAP kinases in the immune response. Annu. Rev. Immunol. 20:55. 38. Kane, L. P., J. Lin, and A. Weiss. 2000. Signal transduction by the TCR for antigen. Curr. Opin. Immunol. 12:242. 39. Salmon, R. A., I.N. Foltz, P.R. Young, and J.W. Schrader. 1997. The p38 mitogen-activated protein kinase is activated by ligation of the T or B lymphocyte antigen receptors, Fas or CD40, but suppression of kinase activity does not inhibit apoptosis induced by antigen receptors. J. Immunol. 159:5309. 40. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, and Y . Ben-Neriah. 1994. Jnk is involved in signal integration during co-stimulation of T lymphocytes. Cell 77:727. 41. Davis, R. J. 1995. Transcriptional regulation by MAP kinases. Mol. Reprod. Dev. 42:459. 42. Kane, L. P., A. Weiss. 2003. The PI-3 kinase/Akt pathway and T cell activation: pleiotropic pathways downstream of PIP3. Immunol. Rev. 192:7. 43. Kelly, E., A. Won, Y . Refaeli, and L. Van Parijs. 2002. IL-2 and related cytokines can promote T cell survival by activating AKT. J. Immunol. 168:597. 44. Hoyos, B., D.W. Ballard, E. Bohnlein, M. Siekevitz, and W.C. Greene. 1989. Kappa B-specific DNA binding proteins: role in the regulation of human interleukin-2 gene expression. Science 244:457. 45. Bauer, B. a. G. B. 2001. Protein kinase C and AKT/protein kinase B in CD4+ T-lymphocytes: new partners in TCR/CD28 signal integration. Mol. Immunol. 38:1087. 46. Kane, L. P., J. Lin, and A. Weiss. 2002. It's all Rel-ative: N F K B and CD28 co-stimulation of T-cell activation. Trends Immunol. 23:413. 47. Kane, L. P., V.S. Shapiro, D. Stokoe, and A. Weiss. 1999. Induction of N F K B by the Akt/PKB kinase. Curr. Biol. 9:601. 48. Rogers, P. R., J. Song, I. Gramaglia, N. Killeen, and M. Croft. 2001. OX40 promotes Bcl-xL and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity 15:445. 49. Noel, P. J., L.H. Boise, J.M. Green, and C.B. Thompson. 1996. CD28 co-stimulation prevents cell death during primary T cell activation. J. Immunol. 157:636. 115 50. Bretscher, P. A. a. M. A. C. 1970. A theory of self-nonself discrimination. Science 169:1042. 51. Cantrell, D. 2002. Protein kinase B (Akt) regulation and function in T lymphocytes. Semin. Immunol. 14:19. 116 Chapter 4 Tumor necrosis factor receptor type-2 (p75) functions as a co-stimulator for antigen-driven T cell responses in vivo 1 4.1 Preface Naive T cells require co-stimulation for robust antigen-driven differentiation and survival. Members of the TNFR family have been shown to provide co-stimulatory signals conferring survival at distinct phases of the T cell response. This chapter examines the dependency of CD4 and CD8 T cells on TNFR2 for survival during Ag-driven clonal expansion in vitro and in vivo. Using the M H C class I-restricted 2C TCR and MHC class II-restricted AND TCR transgenic systems, TNFR2 was shown to regulate threshold for clonal expansion of CD4 and CD8 T cell subsets in response to cognate antigen in vitro. Using a novel recombinant Listeria monocytogenes (rLM-SIY) expressing a secreted form of the 2C agonist peptide (SIY) to investigate the role of TNFR2 for T cell immunity, TNFR2 was shown to allow larger accumulation of effector cells and conferred protection from apoptosis for a robust memory pool in vivo. TNFR2_ /~ CD8 T cells exhibited loss of protection from apoptosis that was correlated with diminished survivin and Bcl-2 expression. This chapter describes experiments showing a hitherto unappreciated co-stimulatory function for TNFR2 in regulating T cell survival during the differentiation program elicited by an intracellular pathogen in vivo. 1 A version of this chapter has been published as: Kim, E.Y., J.J. Priatel, S.J. Teh, H.S. Teh. 2006. TNF Receptor Type 2 (p75) Functions as a Costimulator for Antigen-Driven T Cell Responses In vivo. J. Immunol. 176:1026-1035. 117 4.2 I n t r o d u c t i o n The adaptive immune response is based on a myriad of spatially and temporally regulated interactions between receptors and ligands. These interactions are mediated by receptors on the T cell surface (TCR, adhesion molecules, cytokine receptors, co-stimulatory receptors), and their counterparts expressed on activated APCs: MHC-peptide antigen complex, cytokines (IL-2, IL-7, IL-15), and co-stimulatory ligands (B7, TNF superfamily members). The expression of these stimulatory ligands is orchestrated in a temporal sequence for effective adaptive immunity. Examination of the minimal requirements for a productive T cell response revealed that brief duration of antigenic stimulation can commit CD8 T cells to several rounds of cell division and concomitant effector/memory differentiation (1, 2). These studies demonstrated that threshold-crossing activation signals triggered by antigenic stimulation induce a differentiation program utilized by T cells for their expansion, effector and memory function. However, recent studies have shown that execution of this program for CD8 T cell differentiation also relies on external signals in addition to antigenic stimuli, indicating a dynamic process that yields flexibility for developing an appropriate adaptive response depending on all variables concerning host defense. Greater duration of antigenic stimulation leads to increased survival of primed T cells for the antigen-independent proliferative phase of the differentiation program (3), demonstrating that TCR-mediated signals provides important input for imprinting cellular survival. External factors such as IL-2 are important for enhancing antigen-independent proliferation after brief priming of CD8 T cells (2), strongly suggesting that external signals can integrate into the program to govern quantitative outcomes during clonal expansion. Given that the extent and 118 magnitude of clonal expansion is directly related to survival after primary activation (4), a key regulatory modality for the progression of productive antigen-driven T cell response may be derived from both internal (i.e. TCR-mediated) and external (i.e. cytokine-mediated and co-stimulatory) interactions that control survival. Co-stimulation has been extensively studied as an integral component of the differentiation program during the primary response (5, 6). Two families of co-stimulatory receptors have been identified for T cells. CD28 and TNFR sup erf ami lies have been shown to modulate discrete aspects of T cell function, with each member playing a role in transition points during T cell differentiation. For instance, CD28 plays a role in modulating the threshold of T cell activation, augmenting IL-2 production, and promoting T cell survival in order to sustain T cell responses (6). TNFR superfamily members such as OX40 and 4-IBB have been implicated in the effector to memory cell transition, acting temporally later than CD28 (5, 7). Mice deficient in either of these TNFR family members display a marked decrease in the memory pool due to defects in survival during and after primary expansion (8, 9). These effects have been attributed to the regulation of apoptotic molecules such as survivin and Bcl-2 mediated by co-stimulatory signals during clonal expansion (10). Several recent studies have investigated the role of co-stimulation during infection with L M . CD28-deficient mice have reduced LM-specific CD8 T cell responses compared to wild-type mice, but differentiation into effector and memory T cells appears intact (11). Mice that lack. CD137L (4-1BBL) also display diminished activation of CD8 T cells compared to wild-type (12). Thus, co-stimulation mediated by members of two distinct superfamilies of receptors provides 119 multiple checkpoints in the differentiation program that confers flexibility in the adaptive immune response. Listeria monocytogenes (LM) is a well-characterized model system for studying T cell-mediated immunity against intracellular bacteria (13). L M rapidly triggers an innate response that is essential for host survival; early resistance is conferred by production of IFNy and TNFa, as mice lacking these cytokines or their cognate receptors succumb to infection (14, 15). Adaptive immunity is crucial for clearance and long-term protective immunity after L M infection. SC1D mice are able to control low-dose L M infection but fail to clear it (16), and mice lacking ap T cells rapidly succumb to high-dose L M infection within 5 days (17), demonstrating the critical role that T cells play for bacterial clearance. As an intracellular bacterium, L M induces a potent CD8 + T cell response that is critical for anti-Listerial defense (18, 19). M H C class I- and II-restricted epitopes derived from L M have been characterized facilitating the tracking of both CD4 + and CD8 + T cell responses to intracellular bacterial challenge, and provide a powerful system for studying cellular processes and mechanisms that regulate T cell-mediated immunity in vivo (13). We have recently reported that TNF receptor type-2 (TNFR2), also referred to as p75, is an important co-stimulator for T cell activation, that is functionally linked to CD28 for optimal IL-2 induction and survival during the early phase of the T cell response in vitro (20, 21). In these studies, we found that TNFR2" A T cells are defective in IL-2 induction- that was only partially rescued by CD28 co-ligation, and exhibit increased susceptibility to apoptosis during the early phase of the proliferative response, thereby reducing the accumulation of polyclonal effector cells in vitro (21). A study by 120 another group confirmed that TNFR2 functions as a co-stimulator for human T cells (22). Similarly, another study found that TNFR2 7 " mice display a delayed clearance of replication-deficient adenovirus that correlates with decreased adenovirus-specific CTL activity of intrahepatic lymphocytes. This indicates that TNFR2 facilitates generation of CTL effector function for anti-viral immune responses in the liver in vivo (23). These studies show that TNFR2 functions in T cells as an important co-stimulator for the differentiation program triggered by TCR-mediated stimulation. However, the role of TNFR2 for co-stimulating antigen-driven T cell responses is poorly characterized. To investigate the role of TNFR2 in antigen-driven CD4 and CD8 T cell responses, we utilized two well-characterized TCR transgenic systems that are restricted to either M H C class I (2C) (24, 25) or M H C class II (AND) (26). Our data establish a critical role for TNFR2 as a co-stimulator of antigen-driven T cell responses in vivo, and demonstrates a key modality by which progression of the T cell differentiation program can be regulated. 121 4.3 Materials and Methods Mice Breeders for C57BL/6 (B6, H-2 b ) and B6-TNFR2-deficient mice were obtained from The Jackson Laboratories (Bar Harbor, M E ) . B6 mice deficient in T N F R 2 have been previously described (27); TNFR2-deficient mice were genotyped using a P C R strategy. Mice 4 to 7 weeks of age were used for all experiments. Breeders for the H - 2 b 2C T C R transgenic mice were kindly provided by Dr. D . Y . Loh (then at the Washington University, St. Louis, M O ) . T h e 2 C T C R transgenic mice (24, 25) were bred onto the C57BL/6 (H-2 b) background, and crossed with TNFR2" 7 " mice to generate 2C T N F R 2 7 " mice. B I O . A N D T C R transgenic mice (26) were obtained from Jackson Laboratories, and subsequently crossed with TNFR2" / "mice to generate A N D TNFR2~ /~ mice. Animal studies were approved by our institutional review board. Cells Lymph nodes were harvested and single cell suspensions prepared from each of the mouse lines. The CD4" C D 8 + (CD8 + ) T cell and C D 4 + CD8" (CD4 + ) T cell subsets were purified from whole lymph node cell suspensions using m i n i M A C S microbeads (Miltenyi Biotec, Auburn, C A ) . C D 4 + and C D 8 T cells from A N D and 2C T C R T g mice, respectively, were positively selected using a M A C S M S + Separation column and M i n i M A C S magnet, as per manufacturer's protocol (Miltenyi Biotec), achieving > 95% purity. Splenocytes from B6 mice were irradiated for use as A P C s to present the S I Y R Y Y G L peptide (abbreviated as SIY) in complex with H - 2 K b M H C class I molecules, and alone as feeder cells as indicated. 122 The S1Y/K b complex is a cognate ligand for the 2C TCR (25). The DCEK cell line was used as antigen presenting cells for displaying PCC peptide (amino acid residues 88-104) in complex with I-E k M H C class II molecules and is recognized by the A N D TCR (26). Cells were cultured at 37°C and 5% CO2 in Iscove's D M E M (Life Technologies, Burlington, Ontario) supplemented with 10% (v/v) FBS (Life Technologies), 5 x 10"5 uM 2-ME, and antibiotics (I-media). Antibodies and intracellular staining Antibodies against CD4, CD8, 2C TCR (clone: 1B2 mAb), T h y l . l , Thyl.2, and IFNy were from eBioscience, anti-survivin (NB500-201) was from Novus Biologicals, and anti-Bcl-2 was from BD Pharmingen. Cell staining and flow cytometry were performed according to standard procedures. Briefly, cells were incubated with the relevant antibodies for > 15 min at 4°C, and subsequently washed twice with FACS medium (PBS + 2% FCS). Annexin V -PE (BD Biosciences) staining was carried out at RT for 15 minutes in saline containing 10 mM HEPES (pH 7.2) and 2.5 mM CaC^. For intracellular cytokine staining, cells were incubated in a fixation/permeabilization solution (2% paraformaldehyde, 0.2% Tween20 in PBS). Anti-cytokine-, CD8-, and Thyl.2-specific antibodies were added to cells in PBC containing 0.2% Tween20. The CELLQUEST software program (Becton Dickinson, Mountain View, CA) and FACScan was used for data acquisition and analysis. Generation of rLM-SIY and infection A recombinant Listeria monocytogenes (rLM-SIY) was constructed to express a secreted form of an SIY-bearing peptide (Priatel et ai, manuscript in preparation). Briefly, the A g 123 cassette containing the SIY-peptide, a sequence previously shown to induce strong anti-SIY responses (28), was introduced into the bacterial genome by homologous recombination as previously described (29). Mice were infected by intravenous injection of the tail vein with indicated doses in PBS. Bacterial doses were determined by plating the injected stock on brain-heart infusion agar. In vitro re-stimulation for quantification of T cells specific for epitopes derived from LM Splenocytes from infected and uninfected mice were harvested at various time points p.i. and re-stimulated with SIY, LLO190-201, or anti-CD3 (plate-bound, 10 uM) for 5 hrs in the presence of golgi inhibitor (GolgiStop; BD Biosciences, San Jose CA). A total of 5x106 splenocytes were cultured in 24-well flat-bottom tissue culture plates. Expression of IFNy was determined using intracellular FACS staining (see above for details), which was used as a marker for epitope-specific T cells. Adoptive transfer experiments included the use of additional tracking markers: congenic Thyl .2 and clonotypic 2C TCR transgenic (detected by mAb 1B2). 124 4.4 Results TNFR2 regulates threshold for clonal expansion of antigen-specific CD8 and CD4 T cells 2C is a well-characterized transgenic TCR that recognizes cognate antigen (SIY peptide) in the context of M H C class I (K b) (24, 25) We used this transgenic system to investigate whether TNFR2 plays an important role for the CD8 T cell response to cognate antigen. Using an assay in which the numbers of peptide-loaded APCs (irradiated B6 splenocytes) was titrated with proportionate numbers of feeder cells (irradiated B6 splenocytes not coated with peptide) so as to keep total cell number in culture constant, we found that 2C TNFR2_ /~ CD8 T cells are hypo-responsive relative to wild-type at limiting Ag conditions. As shown in Fig. 4.1 A, 2C CD8 T cells initiated a program of clonal expansion in response to 1 x 105 peptide loaded APCs (p-APCs), undergoing multiple rounds of cell division. In contrast, 2C TNFR2 7 " CD8 T cells failed to undergo any cell division at this dose. This is consistent with our previous findings that TNFR2 lowers the threshold of T cell activation (20). Increasing antigenic stimulation (i.e. dose of peptide-loaded APCs) results in an increase in the proportion of cells that crossed this threshold to initiate a program of CD8 T cell differentiation and cell division, such that 2C TNFR2 _ /" CD8 T cells required excess p-APCs to undergo robust proliferation. Although 2C TNFR2"A CD8 T cells underwent multiple rounds of cell division when stimulated with 4 x 105 p-APCs, we noted that the total number of cells in culture was diminished compared to wild-type (Fig. 4AB) suggesting that the survival of CD8 T cells undergoing cell division may be controlled by TNFR2. 125 A N D is a well-characterized transgenic TCR that recognizes cognate antigen (PCCgg-iw) in the context of M H C class II (H-2 I-Ek) (26). To determine whether TNFR2 is important for co-stimulating CD4 T cell response to cognate antigen, the peptide dose was titrated in culture with APCs (DCEK cell line expressing M H C Class II-Ek) in the presence or absence of exogenous IL-2. As shown in Fig. 4.1C, A N D TNFR2 7 " CD4 T cells failed to undergo clonal expansion at the lowest Ag dose tested (0.01 uM), whereas A N D CD4 T cells underwent multiple rounds of cell division. A N D TNFR2 7 " CD4 T cells required greater doses of cognate antigen to achieve an equivalent response as wild-type counterparts, demonstrating a role for TNFR2 in regulating threshold for clonal expansion. Interestingly, exogenous IL-2 provided only a modest increase in the clonal expansion of A N D TNFR2 7 " CD4 T cells at the lowest Ag dose, whereas A N D CD4 T cells underwent robust cell division (Fig, 4.1Q. These data demonstrate that TNFR2 is an important co-stimulatory molecule for CD4 and CD8 subsets in regulating the threshold for clonal expansion in response to cognate antigen. CD8 T cells depend on TNFR2 for survival during the early phase of the T cell response in response to recombinant Listeria monocytogenes (rLM-SIY) Listeria monocytogenes (LM) is a well-studied intracellular pathogen infection model for measuring T cell responses in vivo. We engineered a recombinant L M that expresses the 2C agonist peptide (SIY) (Priatel et al, manuscript in preparation) to investigate whether TNFR2 functions as a co-stimulator for T cell responses to intracellular pathogen in vivo. Following adoptive transfer of CFSE-labeled 2C or 2C TNFR2"7" CD8 Thy 1.2 T cells into B6-Thyl . l mice, rLM-SIY was used to infect hosts 126 (104 CFU) and spleens were subsequently harvested on days 3 and 7 post-infection (Figs. 4.2A and B respectively). Adoptively transferred cells were tracked using the congenic marker Thy 1.2 and the transgenic 2C TCR (with mAb 1B2), analyzed for cell division using CFSE, and differentiation into effectors using intracellular cytokine staining of IFNy. Rounds of cell division by 2C Thyl.2 CD8 T cells in the spleens in response to rLM-SIY were detected by CFSE on day 3 post-infection. The wild-type population comprised -0.58% of the total spleen (Fig. 4.2A), or ~90xl0 4 2C CD8 T cells (Fig. 4.2C -total numbers of transferred cells per spleen). In contrast, 2C TNFR2"7" Thyl.2 CD8 T cells exhibited a marked reduction in clonal expansion, comprising only 0.13% of the total spleen of infected mice, or ~20xl 0 4 2C TNFR2 7 " CD8 T cells (Fig. 4.2C7), resulting in -4.5-fold reduction in clone size compared to wild-type. However, CFSE dilution analysis showed that 2C TNFR2 7 " CD8 T cells were able to undergo multiple rounds of cell division at this dose of rLM-SIY infection; the diminished clone size therefore suggests that TNFR2 controls T cell survival once the program of cell division is initiated. Interestingly, the differentiation program for transiting 2C TNFR2 7 " CD8 T cells into effectors appeared intact since surviving cells expressed IFNy after brief re-stimulation with S1Y peptide in vitro (Fig. 4.2A). These data indicate that TNFR2 regulates the accumulation of effector cells in response to intracellular pathogen, and suggest that the survival of CD8 T cells during the first rounds of cell division is dependent on TNFR2. We next quantified the frequency of adoptively transferred cells at the peak of the T cell response to L M challenge (one week post-infection) (13). Examination of the numbers of Thyl .2 + cells in infected spleens at one week post-infection revealed a 127 significant reduction in 2C TN'FR2"/" CD8 T cells (1.02% vs. 0.33%; Fig. 4.2C). Whereas 2C CD8 T cells continued to expand to reach peak numbers at one week post-infection (~150xl04 2C Thyl .2 + CD8 T cells), the frequency of 2C TNFR2 7 " CD8 T cells in the spleens of infected mice was reduced ~5-fold (Fig. 4.2Q. 2C CD8 T cells underwent multiple rounds of cell division as demonstrated by complete dilution of CFSE. Strikingly, 2C TNFR2 7 " CD8 T cells were virtually devoid of this clonally expanded population, suggesting a loss of protection from apoptosis during expansion (Fig. 4.2Q. This dramatic defect is highlighted by the substantial reduction in the frequency of 2C TNFR2 7 " IFNy + CD8 effector cells in the spleens of infected mice. Furthermore, the small residual population of TNFR2"7" 2C CD8 T cells present at day 7 p.i. did not produce IFNy after antigen stimulation (Fig. 4.2B), suggesting that this population is either anergic or antigen-inexperienced. We next tested the susceptibility of TNFR2" / ; T cells to apoptosis during clonal expansion. Annexin V staining in conjunction with CFSE dilution revealed that a large proportion of 2C TNFR2 _ /" CD8 T cells undergo cell death during the first few rounds of cell division;-virtually all of the cells that were recruited to the dividing population were Annexin V + , whereas wild-type counterparts contained an Annexin V n e g population that persisted through multiple rounds of division (Fig. 4.2D). Thus TNFR2 confers protection from apoptosis during the first rounds of cell division. In this staining we noted a population of Annexin V + cells from spleens of infected wild-type mice, which we believe correspond to T cells that die by attrition early during the response to L M . Adoptively transferred cells in uninfected mice remained CFSE h l and Annexin V n e g (data not shown). This is consistent with previously reported observations of selective 128 depletion of T cells en masse via apoptosis in the spleens of mice infected with pro-inflammatory pathogens such as L M (30). Our results suggest that co-stimulation mediated via TNFR2 is important in rescuing Ag-specific T cells from generalized depletion that occurs during the early stages of L M infection. We previously showed that TNFR2 lowers the threshold of T cell activation and survival (21), and so we investigated whether increasing antigenic doses of primary challenge with rLM-SIY would increase the proportion of 2C TNFR2 7 " CD8 T cells that survive to form the effector pool. As shown in Fig. 4.3.4, increasing doses in log increments of L M infection led to increased numbers of 2C and 2C TNFR2_ /~ CD8 T cells in the spleens of infected mice on day 4 post-infection. However, TNFR2-deficiency led to a >8-fold reduction in frequency of SIY-specific 2C CD8 T cells even at the highest dose of rLM-SIY tested. CFSE dilution revealed that 2C TNFR2" A CD8 T cells were able to undergo multiple rounds of, cell division (Fig. 4.3B), confirming that 2C TNFR2_ /~ CD8 T cells were activated by rLM-SIY infection but failed to survive during clonal expansion. These data suggest that the antigen-driven differentiation program can be aborted via apoptosis in the absence of TNFR2. Song et al. (2005) recently showed that survivin expression promotes proliferation and antagonizes apoptosis, leading to enhanced accumulation of effector cells (10). T cell survival during antigen-driven response is also dependent on co-stimulation-mediated expression of anti-apoptotic Bcl-2 family members (31, 32), particularly after the phase of cell division (10). We further investigated TNFR2-mediated survival by examining the expression kinetics of anti-apoptotic molecules survivin and Bcl-2 during T cell activation in vitro (Fig. 4.4). TNFR2-deficiency led to a dramatic reduction in the 129 percentage of survivin+ CD8 T cells in culture: 87% for WT vs. 67% for TNFR2"7" on day 2; 67% for WT vs. 23% for TNFR2_ /~ on day 4. Bcl-2 expression was also regulated by TNFR2 during T cell activation, as the percentage of Bcl-2 h l CD8 T cells was dramatically lower in TNFR2 7 " CD T cells on day 2 of culture: 82% for WT vs. 51% for TNFR2"7". TNFR2 also regulated the proportion of Bcl-2 h l T cells as well as Bcl-2 expression per cell on day 4: -64% of 2C CD8 T cells were Bcl-2 h i (MFI of 361) whereas only - 5 % of 2C TNFR2 _ /" CD8 T cells were Bcl-2 h i (MFI of 199). These data indicate that TNFR2 regulates the expression of anti-apoptotic molecules that confer survival during and after cell division, and con-elates with its role for conferring protection against apoptosis during the antigen-driven T cell response. TNFR2 is important for endogenous CD4 and CD8 T cell responses to rLM-SIY The adoptive transfer-infection model above allowed tracking of the response of a clonotypic population of CD8 T cells to rLM-SIY in vivo. We were next interested in investigating the endogenous CD4 and CD8 T cell response to epitopes derived from rLM-SIY simultaneously in the same animal. We noted that infection of mice with rLM-SIY elicited robust endogenous responses specific for SIY (MHC class I-restricted peptide) and LLO190-201 (MHC class II-restricted, endogenous peptide derived from listeriolysin O) peptides in host animals (33, 34). This way we could examine the importance of TNFR2 in the endogenous CD8 + and CD4 + T cell responses to M H C class I- and II-restricted epitopes of rLM-SIY in the same host. TNFR2 7 " or wild-type animals were infected with indicated doses of rLM-SIY, and the frequency of SIY-specific CD8 + and LLO-specific CD4 + T cells were determined by intracellular cytokine staining of 130 IFNy in response to brief peptide re-stimulation in vitro. We investigated the course of T cell response in wild-type and TNFR2 7 " mice to assess the total numbers of CD4 + and CD8 + T cells specific for epitopes derived from rLM-SIY as a function of time after primary, challenge. Examination of the kinetics of CD8 + and CD4 + T cell responses confirmed the defect in clonal expansion of TNFR2_ /~ T cells specific for epitopes derived from rLM-SIY, as indicated by dramatic reductions across the time points tested (Fig. 4.5A - SIY-specific CD8 + T cells; Fig. 4.5B - LLO-specific CD4 + T cells). Notably, TNFR2 _ /" mice exhibited very little expansion of SIY-specific CD8 + or LLO-specific CD4 + T cells between days 3 and 5 post-infection across all doses of infection tested, whereas wild-type counterparts were able undergo robust expansion. This suggests that T cell-mediated immunity may be particularly compromised around day 5 post-infection for TNFR2 7 " mice, due to diminished expansion and survival of effectors against ' intracellular pathogen. To determine whether the hypo-responsiveness of CD8 + and CD4 + T cells in TNFR2 _ /" mice was due to defective antigen presentation, we tested the response of 2C CD8 + T cells adoptively transferred into B6 or TNFR2 _ /" hosts and subsequently infected with rLM-SIY. Transferred cells underwent robust clonal expansion in both wild-type and TNFR2" / _ hosts (Fig. 4.6/4 and B), indicating that antigen presentation was intact and that the reduction in the T cell response was not due to a T cell-extrinsic defect. Taken together, these data strongly suggest that TNFR2 can regulate the response of CD8 + and CD4 + T cell subsets to intracellular bacterial pathogen by promoting the accumulation of effector cells and lowering the threshold of antigenic stimulation required for optimal clonal expansion. 131 TNFR2 is important for immunity against high dose of rLM-SIY challenge Previous reports have suggested that T cell-mediated immunity is important for clearance of L M infection when challenged with high doses of bacteria (16, 17). We therefore examined bacterial load in the spleens of infected mice to determine whether the substantial reduction in the T cell response observed for TNFR2" / _ mice correlates with increased susceptibility to rLM-SIY infection. When challenged with lower doses of rLM-SIY, bacterial load in the spleen peaked around day 3 post-infection in wild-type and TNFR2 / _ mice (Fig. 4.7). However, TNFR2" /" mice were more susceptible when challenged with high dose of rLM-SIY; bacterial load persisted in the spleens of TNFR2" / _ mice at day 5, whereas wild-type mice were able to clear bacteria. Thus the diminished clonal expansion of CD8 and CD4 T cells specific for epitopes derived from rLM-SIY between days 3 and 5 post-infection correlates with increased susceptibility to infection when challenged with high dose. It also suggests that the bacterial burden on day 5 post-infection provided increased antigenic stimulation in driving expansion of rLM-SIY-specific T cells in TNFR2~ /_ mice observed at day 7 post-infection, which in turn coincided with clearance of rLM-SIY in the spleens of TNFR2 7 " mice. We were also interested in whether TNFR2-deficiency correlated with increased susceptibility to virulent L M challenge. To address this question we used the wild-type strain of L M , which possesses > 10-fold greater virulence than rLM-SIY (data not shown). Consistent with rLM-SIY challenge, TNFR2" /" mice displayed a dramatic decrease in the frequency of LLO-specific CD4 T cell effectors (Fig. 4.8.4) in the spleens of infected mice, corresponding to a 6-fold reduction in the number of LLO-specific CD4 T cells at the peak of the primary response against wild-type L M compared to wild-type 132 (Fig. 4.85). Wild-type mice were able to clear bacteria by 1 week post-infection. In contrast, TNFR2_ /~ mice displayed delayed clearance of bacteria, demonstrated by titers that persisted at day 7 post-infection (data not shown). These data indicate that TNFR2 is important for mounting a strong T cell response to high dose challenge with virulent L M , which correlates with efficient clearance of bacteria from the spleens of infected mice. Generation of memory T cells against rLM-SIY is compromised in TNFR2'A mice After expansion of antigen-specific T cells and concomitant effector function against intracellular pathogen, massive contraction by apoptosis ensues leaving a relatively small population of memory T cells (reviewed in ref. 35). Pope et al. (36) showed that the magnitude of the primary response to L M is correlated with the size of the resulting antigen-specific memory population (36). We therefore examined whether the diminished T cell response in TNFR2 7 " mice against rLM-SIY would correlate with a decrease in the resulting memory pool at 3 months after primary challenge. As shown in Fig. A.9A and B respectively, the frequency of SIY-specific CD8 and LLO-specific CD4 T cells was decreased 3-fold in the spleens of TNFR2 _ /" mice compared to wild-type. Consistent with results reported by Pope et al. (36), we found that increasing the dose of primary challenge led to an increase in the frequency of antigen-specific memory T cells (Fig. A.9A and B). The percentage of SIY-specific CD8 and LLO-specific CD4 T cells that survived from the peak of the primary response to form the resulting memory pools were -13% and 10% for wild-type mice respectively, whereas TNFR2" / _ mice were 6% and 4% respectively (Fig. 4.9C and D, SIY- and LLO-specific memory T cells respectively). Although higher doses of primary challenge with rLM-SIY led to an 133 increase in frequency of the memory populations, TNFR2"'" mice were still compromised compared to wild-type mice suggesting that TNFR2 promotes survival during the generation of the memory population. These data indicate that TNFR2 can regulate the size of the resulting memory pool against intracellular pathogen by promoting optimal primary expansion and subsequent survival following bacterial clearance. 4.5 Discussion The antigen-driven T cell differentiation program consists of clonal expansion and concomitant differentiation into effector and memory cells. The threshold of T cell activation is dependent on interactions in addition to those of the TCR/MHC-peptide complexes, namely co-stimulation by molecules such as CD28 (37). Indeed, CD28 has been reported to reduce the time necessary for antigenic stimuli to activate naive T cells, as well as to augment the magnitude of T-cell responses for both naive and primed T cells (38). Previous reports have suggested a molecular link between cell division and effector cytokine expression (39, 40), indicating that T cell immunity is functionally productive once a threshold has been reached for initiating a differentiation program of multiple rounds of cell division and subsequent acquisition of effector function. More recently however, members of the TNFR superfamily (such as OX40 and 4-IBB) have been shown to function at distinct phases during the T cell response (7). Notably, co-stimulation appears to confer T cell survival for driving clonal expansion of cells that progress through the differentiation program (10, 32). These studies broaden the roles for co-stimulation to include temporal and spatial regulation of distinct receptor-ligand 134 interactions that profoundly influence T cell fate during differentiation by controlling survival. The T cell response is a dynamic and flexible process that depends on signals that maximize the pool of effectors and formation of memory by conferring survival through 'check points'. Members of two different families of receptors (CD28-related Ig-like superfamily and the TNFR superfamily) appear to govern specific outcomes of T cell fate: CD28 and CD27 appear to function in promoting T cell expansion during the early phase, whereas OX40 and 4-1BB control survival late in the primary response (5, 7). Our data showed that TNFR2 plays a critical role during the early phase of the T cell response by conferring survival during the first rounds of cell division, and thereby regulated the extent of clonal expansion at the peak of the response. Interestingly, the expression of anti-apoptotic molecules survivin and Bcl-2 was dependent on TNFR2 and con-elated with protection from apoptosis during and after cell division. Song et al. (10) showed that OX40-mediated expression of survivin antagonizes apoptosis during proliferation, whereas Bcl-2 was required for the phase after cell division (10). Anti-apoptotic molecules are therefore common targets of co-stimulatory signals derived from distinct cell surface receptors for controlling survival at distinct phases of the T cell response. The dramatic reduction in the clone size of antigen-specific TNFR2 7 " T cells was associated with increased susceptibility to apoptosis as well as an increased requirement for greater antigenic stimulation (i.e. increased threshold of activation). In the absence of TNFR2, CD4 and CD8 T cells required greater antigenic stimulation and the clone size of effectors was thereby greatly diminished in vitro. However, the differentiation program as measured by activation markers such as CD44, CD69, and CD62L appeared intact in 135 TNFR2_ /~ T cells (data not shown), indicating that TNFR2 regulated threshold of activation, with surviving T cells retaining the ability to differentiate into effectors. Taken together, our data revealed a hitherto undefined co-stimulatory role for TNFR2 in regulating threshold of activation and early cell survival during antigen-specific T cell responses, regulating quantity rather than quality of effector cells generated. We tested whether TNFR2-mediated co-stimulation was important for T cell-mediated immunity against L M challenge. Our data showed that TNFR2 conferred a survival advantage for CD4 and CD8 T cells during challenge with L M , whereas null mutants exhibited a dramatic reduction in the T cell response that con-elated with increased susceptibility to primary challenge. These findings appear in contrast with previous studies that showed that TNFR2 did not play a significant role in the susceptibility of mice to bacterial challenge (41, 42), as bacterial loads were cleared by day 5 post-infection, and survival of TNFR2-deficient mice was comparable to wild-type control (42). Although these studies identified a critical role for TNFR1 in the inflammatory innate response to L M , they did not analyze the T cell response to L M . The end-points measured in these studies using TNFR2 7 " mice (42) are largely attributable to innate immunity. By engineering rLM-SIY system to specifically monitor CD8 T cells specific for secreted epitope derived from intracellular bacteria as well as CD4 T cells specific for the endogenous epitope LLO, our data revealed a critical role for LM-specific CD4 and CD8 T cell expansion stemming from defective survival during the early phase of the response. The smaller pool of effector T cells that resulted from TNFR2-deficiency correlated with increased susceptibility to higher doses of primary L M challenge, which has been previously shown to be dependent on T cell-mediated immunity (16, 17). Our 136 results are consistent with a recent report that showed an important role for T cell-derived TNFa, which found that TNFa knocked out in the T cell lineage resulted in increased susceptibility to L M challenge, as well as inability to control bacterial load by day 4 post-infection (43). Moreover, our results support the notion that T cell-derived TNFa possesses a distinct function in host defense by providing protection against high bacterial load (43), constituting a second line of defense. We extend this model to suggest that TNF-TNFR2 interactions provide co-stimulation of the primary T cell response against L M , regulating threshold of activation and survival during the generation of effector T cells, which is important for mounting effective T cell-mediated clearance at high dose of L M infection. The role of co-stimulation during infection has been studied using gene-targeted mice (13). The co-stimulatory role of TNFR2 during L M infection appears similar to CD28. CD28_/~ mice possess reduced L M -specific CD8 T cell responses compared to wild-type, but differentiation into effector T cells is intact (11, 12). Moreover, CD28 7" mice exhibit increased susceptibility to L M , as evidenced by persistent bacterial load even up to day 7 post-infection (11, 12). This is in. contrast to 4-lBBL-deficient mice that were able to clear bacteria, and the activation of the CD4 T cell compartment appeared intact while the number of Ag-specific CD8 T cells was slightly reduced compared to wild-type mice (12). The phenotypic similarity between CD28 and TNFR2 knockout mice suggests an interesting functional link during the early phase of the T cell response to infection, as we had proposed previously based on commonality of signaling intennediates used for IL-2 induction and T cell survival (21). CD28 and TNFR2 likely perform non-redundant and complementary functions since signaling defects in TNFR2 7 " 137 T cells were not rescued by CD28 signaling (21). Two recently characterized co-stimulatory members of the T N F R superfamily, 4-1 B B and OX40 , were found to have spatially and temporally segregated roles during the T cell response: OX40L-deficient mice exhibited decreased C D 4 T cells late in the primary response and no detectable secondary expansion of adoptively transferred C D 4 T cells, whereas 4- lBBL-def ic iency had a minor effect on the primary response of C D 4 T cells, but a more profound affect on the secondary response (44). O X 4 0 L / 4 - l B B L - d o u b l e knockout mice were impaired in both the C D 4 and CD8 T cell responses to protein A g and influenza virus (44). Our data strongly suggest that T N F R 2 is positioned early during the T cell response, regulating clonal expansion by promoting survival during the first rounds of cell division. This role translates into optimal clonal expansion in response to intracellular bacterial pathogens and robust generation of an antigen-specific memory T cell population. 4.6 Acknowledgements We thank Xiaox i Chen for assistance with intravenous injections of mice. We also thank Salim Dhanji for helpful discussions. 138 4.7 Figures A WT CDS T N F R 2 - ; - C D 8 # S I Y - l o a d e d #feeder A100 o O A P C s 25,000 100,000 400,000 cells 1.975.000 1,900,000 1,600,000 • t a . 1,000,000 1,000,000 1 0 t > 1 0 , 1 0 ' J 1 0 3 1 0 ' B <o 4 i o u C F S E • W T C D 8 • TNFR2- A CDS SlY-loaded A P C s (x10- , 1 pJVI) Figure 4.1 TNFR2 regulates clonal expansion of Ag-specific CD8 T cell responses in vitro. A) 2C TNFR2" / _ CD8 T cells display defective clonal expansion under antigen-limiting conditions that is associated with increased threshold for cell division and survival. 2C or 2C TNFR2 7 " CFSE-labeled CD8 T cells ( lxlO 6) were cultured with indicated ratios of peptide-loaded APCs (irradiated B6 splenocytes pulsed with 1 uM of SIY peptide) and feeder cells (irradiated B6 splenocytes), harvested at day 3 and analyzed by FACS (see Materials and Methods). B) The total number of 2C (1B2+) TNFR2 7 " CD8 T cells in culture was significantly reduced compared to wild-type. The percentage of 1B2 + CD8 + cells was multiplied by total numbers of live cells in culture. Asterisk denotes statistical significance (p < 0.05; three independent experiments). 139 [ P C C ] 0.01 L I M 0.1 p . M 1 pJW O O 100 0 15D 0 150 0 37 30 25 — ^""^ '--i • • - -« — • 90 59 ] 36 — — j 20 9 8 86 43 19 10n1Q110J105lO* 10°10 11O 31D J1O' HO^ IO'lO810*10* WT CD4 TNFR2"" CD4 WT CD4 +IL2 -I-TNFR2 CD4 + IL2 C F S E Figure 4.2 T N F R 2 regulates clonal expansion of Ag-specific C D 4 T cell responses in vitro. A N D TNFR2"" C D 4 T cells display defective clonal expansion that is associated with increased threshold for cell division, and only partially rescued by exogenous IL-2. A N D or A N D TNFR2~~ CFSE-labeled C D 4 T cells ( l x l 0 6 ) were cultured with peptide loaded A P C s (irradiated D C E K cells pulsed with indicated concentration of P C C peptide), harvested on day 3 and analyzed by F A C S (see Materials and Methods). Data are representative of three independent experiments. 1 4 0 o o Day 3 WT T N F R 2 ' 10° 10' IO2 1 0 3 1 0 l 10° 101 1 0 J 1 0 ^ 1 0 * C F S E CJ CD 1 0 ' -0 58% 1 0 3 -1D Z ~ 1 0 1 -10° 10 " 1 0 1 10^ 1 0 J 1 0 ' 1 0 ° 1 0 1 1 0 2 1 O J 1 0 l Thy 1.2 z UL * 1 0 ' I D ' 10» 0 ° 1 0 ' 10* 1 0 * 10 l •t^ -r-.T-.,'[ ,Tai»i rrm 1D° 1 0 ' 1 0 1 1 D 3 I d ' C F S E B c 3 O O Day 7 WT _ TNFR2-/" too j— 1 1 0 ° 1 0 1 1 0 * 1 0 3 1 D l 1Q0 1Q< 1 0 2 1 0 3 1 Q l CM C F S E 1.02% 0.33% 1 0 ° 1 0 ' 101 1 D 3 * J O * 1 0 ° 10* 10* 1 0 3 10 * A 50 3 o O 1 0 " 1 0 ' 1 0 * 1 0 J 1 0 ' 1 0 " 1 0 " 10- 1 1 D ' S 1 0 * IFNy CD 200 x + 160 , - 120 >. £ 30 CM CQ 40 o rLMSlY: • VVT D • T N F R 2 ' - 1 - • > "5 <u c c < * 1 0 ' WT T N F R 2 - / -] -t , »>>|'!'»»| 1,-T., 1 to0 io 1 to2 io J io* io° io 1 io 2 to*io' C F S E Day 3 Day 7 Figure 4.3 TNFR2 is critical for clonal expansion of CD8 T cells in response to secreted peptide expressed by recombinant L. monocytogenes. CFSE-labeled 2C or 2C TNFR2"'" CD8 Thyl.2 T cells (2xl0 6) were adoptively transferred into B6-Thyl. l mice (transferred cells were tracked using the congenic marker Thyl.2) and analyzed for cell division using CFSE and differentiation into effectors using intracellular cytokine staining of IFNy. One day after transfer, rLM-SIY was used to infect hosts (104 CFU) and spleens were subsequently harvested on days 3 (Fig. 2A) and 7 (Fig. 2B) post-infection. Uninfected mice were used as negative control, denoted as unfilled lines. Q Total numbers of 1B2 + (2C) IFNy1" CD8 + T cells 141 were enumerated by multiplying the percentage of the population in the spleen and the total number of viable splenocytes. Asterisk denotes statistical significance (three mice per group). D) Loss of protection from apoptosis during the first rounds, of cell division in TNFR2_ /~ CD8 T cells. Spleens were harvested on day 3 post-infection using the adoptive transfer-infection model as above, and CFSE vs. annexin V was analyzed using flow cytometry (gated on Thyl .2 + cells, all of which were CD8 + 1B2+). Data are representative of three independent experiments. 142 1° dose: Hi 1 10*, CO O 1 0 ' t o 3 10* Lo WT io° io ' io 3 io J io ' io° io ' i o J i o J i o ' io° io 1 no2 IQ 3 IO ' TNFR2- / -10° 1 0 1 1 0 z 1 Q 3 1 0 l 10° 10* tO 2 1 Q 3 f O * 10° 10 ' 1 0 s 1 0 a 1 D * »*-Thy1.2 B | 200 c o O 100 • 100 0 WT 10° 1 0 ' ! 0 3 1 0 * 1 0 * 10° 10' 1 0 a 1 0 3 1 0 * 10° 1 0 ' 1 D J 1 0 * 1 0 * 50 f TNFR2- / -io° 101 io 2 i o 3 i o * to0 101 io 2 to310* io° io 1 io 2 ID 3IO* C F S E Figure 4.4 T N F R 2 C D 8 T cells display defective survival during the early rounds of division, leading to quantitative reduction of the T cell response to rLM-SIY. TNFR2"" CD8 T cells display defective survival during the early rounds of division, leading to quantitative reduction of the T cell response to rLM-SIY. A) TNFR2-deficiency in 2C CD8 T cells leads to a marked reduction in response to primary challenge with rLM-SIY. CFSE-labeled 2C or 2C TNFR2"'" CD8 T cells (3xl0 6) were transferred into unmanipulated B6-Thyl. l recipients and infected with indicated doses of rLM-SIY the next day (see Materials and Methods). Range of bacterial dose denoted as follows: Lo = 4x l0 3 , Med = 4xl0 4 , Hi = 4x l0 5 CFU. Animals were sacrificed 4 days post-infection and transferred cells were tracked using CD8 and Thyl.2 markers via flow cytometry. Numbers above gate in each dot plot refers to percentage of Thyl .2 + CD8 + cells in the spleen. B) Null mutant T cells are able to undergo cell division events in response to varying doses of rLM-SIY, but display a marked reduction in clone size. CFSE dilution was analyzed on the transferred population, as gated by Thyl .2 + and CD8 + . Shaded line corresponds to infected mice, and bold unfilled line corresponds to uninfected control. Data are representative of three independent experiments. 143 Day 2 Day 4 10° 101 102 103 104 I 0° IO 1 102 103 104 Survivin Bcl-2 Figure 4.5 Survivin and Bcl-2 expression are dependent on TNFR2 during antigen-driven response in vitro. 2C or 2C T N F R 2 C D 8 T cells ( lxlO 6 ) were cultured in vitro with 3x l0 6 SIY peptide-loaded APCs for 4 days, and anti-apoptotic molecules were analyzed by intracellular FACS staining (see Materials and Methods) at indicated time points. Histograms reflect population gated on 1B2 + (2C) CD8 + cells. Shaded line = 2C CD8 T cells; unfdled black line = 2C TNFR2"" CD8 T cells; dotted unfdled line = isotype control. Data are representative of two independent experiments. 144 A SlY-specific LO o CD O Z CO Q U B 3 5 7 21 Days post-infection 30 20 • B6 A T N F R 2 - / " io LLO-spec i f ic Lo 3 5 7 21 Days post-infection Figure 4.6 TNFR2 controls clonal expansion of CD4 and CD8 T cells against M H C class I and Il-restricted epitopes of rLM-SIY. Wild-type and TNFR2"7" mice were infected with doses of rLM-SIY (Lo = lx lO 3 , Med = lx lO 4 , Hi = lx lO 5 CFU) and spleens were harvested at indicated times post-infection. To quantitate SIY- and LLO-specific cells, splenocytes were re-stimulated in vitro for 5 hrs in the presence of golgi inhibitor, and IFNy expression was analyzed by intracellular FACS (see Materials and Methods); values correspond to number of IFNy + cells in the spleen. Data represent mean from three animals per group. A) Kinetics of the T cell response to the MHC class I-restricted epitope, SIY, derived from rLM-SIY. B) Kinetics of the T cell response to the M H C class II-restricted epitope, LLO. 145 10* 1 0 J >> 1Q2 10 1 F 10° 2CThy1.1 2CThy1.1 1 0 * | 1 Q 3 | >> 1 0 M F i o H 1 0 " 1 0 ' 1 0 - 1 0 J 1 0 * 1B2 B6 Thy1.2 10" 10' 10-* 10 J 10* TNFR2-'- Thy1.2 10" 10 ' 10 10° I D CFSE B 12 O [E o • B6 TNFR2 uninfected infected Figure 4.7 Antigen presentation in null mutant animals appears intact. CFSE-labeled 2C T h y l . l + CD8 T cells were adoptively transferred into B6 Thyl .2 + or TNFR2"" Thyl .2 + recipients and subsequently infected with rLM-SIY the next day. Spleens were harvested on day 4 p.i. and analyzed by FACS; transferred cells were enumerated by staining for Thyl . l and 2C TCR (mAb: 1B2). A) CFSE profde was determined for transferred cells as gated by Thyl . l and 2C TCR. B) Frequency of transferred cells was determined by multiplying percentage of Thy 1.1+ 2C + cells and total number of splenocytes (statistics determined with three mice per group). Data are representative of three independent experiments. 1 4 6 r d o s e : Lo Med Hi Days post-infection Figure 4.8 TNFR2-deficient mice display delayed bacterial clearance upon challenge with high dose of r L M - S I Y . Bacterial load in spleens of infected mice at indicated doses (Lo = l x l 0 5 , Med = l x l O 4 . H i = l x l O 5 C F U ) of primary challenge with r L M - S I Y (see Materials and Methods). Asterisk denotes statistical significance. Data are representative of three independent experiments. 147 LL0190-201 a n t i - C D 3 unstimulated 001 10° 101 102 103 10* 10° IO1 10s lONO 1 10° 10' 10* 10* 10* 2.9 8 6 0 01 10 J TNFR2 B I i m » i j i . . . | m n i i . n . [ n m I-I.I m n , „ „ » | i , , . „ i,,,u,|, . . . . y 10E 10' W 3 10310* 10° 101 10* 10J10' to" 10' 103 10*10* C D 4 L L O LTT1 o 20 -u u 15 • z 10 -LL 4. 5 -Q O 0 < MM O 1 3 0 - 2 0 1 I WT TNFR2-'-Figure 4.9 TNFR2"" mice display reduced CD4 T cell response specific for wild-type strain of L M . A) WT or TNFR2 _ / ~ mice were infected with wild-type L M and spleens harvested 1 week after. To quantify the frequency of C D 4 T cells specific for L L O 1 9 0 . 2 0 1 , splenocytes were re-stimulated with this peptide in vitro for 5 hrs and then analyzed for I F N y expression via intracellular FACS staining (see Materials and Methods). As a positive control, splenocytes were also re-stimulated with 10 uM of plate-bound anti-CD3. Percentages indicated above gates in each dot plot refer to I F N y + C D 4 + cells in the total spleen. B) Total numbers of L L O 190-201-specific C D 4 T cells is diminished at the peak of the response to wild-type L M . Statistical analyses performed with 3 mice per group. 148 20 Q. 2 i 1 2 ro -t-• CO 8 O U 4 3* Z LL O b to o SIY UJ • W T • T N F R 2 - / -104 105 1° dose (CFU) * i 104 105 ° dose (CFU) CL. io + * + o b O o LLO * * T t h i 104 10 s 1° dose (CFU) * * I T 10 4 10 5 1° dose (CFU) Figure 4.10 TNFR2"" mice are compromised in the generation of antigen-specific memory populations against rLM-SIY. Wild-type and T N F R 2 " mice were infected with indicated doses of rLM-SIY, and spleens were harvested 81 days post-infection. Splenocytes were re-stimulated for 5 hrs with SIY or L L O 1 9 0 - 2 0 1 peptides and IFNy expression analyzed by intracellular FACS (A and B, respectively). C, D) The frequency of SIY-specific CD8 and LLO-specific CD4 memory T cells that survived from the peak of the primary response is compromised in TNFR2"" mice. Percentages (average of four mice per group) were detennined by dividing the total numbers of SIY-specific CD8 or LLO-specific CD4 T cells at day 81 post-infection by the total numbers at day 7 post-infection. The total numbers of SIY- and LLO-specific memory T cells at day 81 p.i. was determined by multiplying the percentage of IFNy+ cells in response to the respective peptide re-stimulation and the total number of splenocytes. Asterisk denotes statistical significance (4 mice per group). 149 4.8 References 1. van Stipdonk, M. J., E.E. Lemmens, and S.P. Schoenberger. 2001. Naive CTLs require a single brief period of antigenic stimulation for clonal expansion and differentiation. Nat. Immunol. 2:423-429. 2. Kaech, S. M., and R. Ahmed. 2001. Memory CD8+ T cell differentiation: initial antigen encounter triggers a developmental program in naive cells. Nat. Immunol. 2:415-422. 3. van Stipdonk, M. J., G. Hardenberg, M.S. Bijker, E.E. Lemmens, N.M. Droin, D.R. Green, and S.P. Schoenberger. 2003. Dynamic programming of CD8 T lymphocyte responses. Nat. Immunol. 4:361-365. 4. Plas, D., J. Rathmell, and C. Thompson. 2002. Homeostatic control of lymphocyte survival: potential origins and implications. Nat. Immunol. 3:515-521. 5. Croft, M. 2003. Co-stimulatory members of the TNFR family: keys to effective T-cell immunity. Nat. Rev. Immunol. 3:609-620. 6. Lenschow, D. J., T.L. Walunas, and J.A. Bluestone. 1996. CD28/B7 system of T cell co-stimulation. Annu. Rev. Immunol. 14:233-258. 7. Watts, T. H. 2005. TNF/TNFR family members in co-stimulation of T cell responses. Annu. Rev. Immunol. 23:23-68. 8. Bansal-Pakala, P., B.S. Halteman, M.H. Cheng, and M. Croft. 2004. Co-stimulation of CD8 T cell responses by OX40. J. Immunol. 172:4821-4825. 9. Dawicki, W., T.H. Watts. 2004. Expression and function of 4-1BB during CD4 versus CD8 T cell responses in vivo. Eur. J. Immunol. 34:743-751. 10. Song, J., T. So, M. Cheng, X . Tang, and M. Croft. 2005. Sustained survivin expression from OX40 costimulatory signals drives T cell clonal expansion. Immunity 22:621-631. 11. Mittrucker, H. W., M. Kursar, A. Kohler, R. Hurwitz, and S.H.E. Kaufmann. 2001. Role of CD28 for the generation and expansion of antigen-specific CD8 T lymphocytes during infection with Listeria monocytogenes. J. Immunol. 167:5620-5627. 150 12. Shedlock, D. J., J.K. Whitmire, J. Tan, A.S. MacDonald, R. Ahmed, and H. Shen. 2003. Role of CD4 T cell help and co-stimulation in CD8 T cell responses during Listeria monocytogenes infection. J. Immunol. 170:2053-2063. 13. Pamer, E. G. 2004. Immune responses to Listeria monocytogenes. Nat. Rev. Immunol. 4:812-823. 14. Buchmeier, N . A., and R.D. Schreiber. 1985. Requirement of endogenous interferon-y production for resolution of Listeria monocytogenes infection. Proc. Natl. Acad. Sci. USA 90:7404-7408. 15. Havell, E. A . 1989. Evidence that tumor necrosis factor has an important role in antibacterial resistance. J. Immunol. 143:2894-2899. 16. Bhardwaj, V. , O. Kanagawa, P.E. Swanson, and E.R. Unanue. 1998. Chronic Listeria infection in SC1D mice: requirements for the carrier state and dual role of T cells in transferring protection or suppression. J. Immunol.,160:376-384. 17. DiTirro, J., E.R. Rhoades, A.D. Roberts, J .M. Burke, A. Mukasa, A . M . Cooper, A . A . Frank, W.K. Born, and L M . Orme. 1998. Disruption of the cellular inflammatory response to Listeria monocytogenes infection in mice with disruptions in targeted genes. Infect. Immun. 66:2284-2289. 18. Kaufmann, S. H. 1993. Immunity to intracellular bacteria. Annu. Rev. Immunol. 11:129-163. 19. Mittrucker, H. W., A. Kohler, S.H.E. Kaufmann. 2000. Substantial in vivo proliferation of CD4 + and CD8 + T lymphocytes during secondary Listeria monocytogenes infection. Eur. J. Immunol. 30:1053-1059. 20. Kim, E. Y. , and H.S. Teh. 2001. TNF type 2 receptor (p75) lowers the threshold of T cell activation. J. Immunol. 167:6812-6820. 21. Kim, E. Y . , and H.S. Teh. 2004. Critical role of TNF receptor type-2 (p75) as a costimulator for IL-2 induction and T cell survival: a functional link to CD28. J. Immunol. 173:4500-4509. 22. Aspalter, R. M . , M . M . Eibl, and H . M . Wolf. 2003. Regulation of TCR-mediated T cell activation by TNF-RII. J. Leukocyte Biol. 74:572-582. 23. Kafrouni, M . I., G.R. Brown, and D.L. Thiele. 2003. The role of TNF-TNFR2 interactions in generation of CTL responses and clearance of hepatic adenovirus infection. J. Leukocyte Biol. 74:564-571. 151 24. Sha, W. C , C A . Nelson, R.D. Newberry, D.M. Kranz, J.H. Russell, D.Y. Loh. 1988. Selective expression of an antigen receptor on CD8-bearing T lymphocytes in transgenic mice. Nature 335:271-274. 25. Ukada, K., K.H. Wiesmuller, S. Kienle, G. Jung, P. Walden. 1996. Self-MHC-restricted peptides recognized by an alloreactive T lymphocyte clone. J. Immunol. 157:670-678. 26. Kaye, J., M.L. Hsu, M.E. Sauron, S.C. Jameson, N.R. Gascoigne, and S.M. Hedrick. 1989. Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor. Nature 341:746-749. 27. Erickson, S. L., F.J. de Sauvage, K. Kikly, K. Carver-Moore, S. Pitts-Meek, N. Gillett, K.C.F. Sheehan, R.D. Schreiber, D.V. Goeddel, and M.W. Moore. 1994. Decreased sensitivity to tumor necrosis factor but nonnal T-cell development in TNF receptor-2-deficient mice. Nature 372:560-563. 28. Cho, B. K., D. Palliser, E. Guillen, J. Wisniewski, R.A. Young, J. Chen, H.N. Eisen. 2000. A proposed mechanism for the induction of cytotoxic T lymphocyte production by heat shock fusion proteins. Immunity 12:263-272. 29. Shen, H., M.K. Slifka, M. Matloubian, E.R. Jensen, R. Ahmed, J.F. Miller. 1995. Recombinant Listeria monocytogenes as a live vaccine vehicle for the induction of protective anti-viral cell-mediated immunity. Proc. Natl. Acad. Sci. USA 92:3987-3991. 30. Jiang, J., L.L. Lau, and H. Shen. 2003. Selective depletion of nonspecific T cells during the early stage of immune responses to infection. J. Immunol. 171:4352-4358. 31. Rogers, P. R., J. Song, 1. Gramaglia, N. Killeen, and M. Croft. 2001. OX40 promotes Bcl-xL and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity 15:445-455. 32. Song, J., S. Salek-Ardakani, P.R. Rogers, M. Cheng, L.V. Parijs, and M. Croft. 2004. The co-stimulation-regulated duration of PKB activation controls T cell longevity. Nat. Immunol. 5:150-158. 33. Busch, D. H., L M . Pilip, S. Vijh, E.G. Pamer. 1998. Coordinate regulation of complex T cell populations responding to bacterial infection. Immunity 8:353-362. 34. Pamer, E. G., A.J. Sijts, M.S. Villanueva, D.H. Busch, S. Vijh. 1997. M H C class I antigen processing of Listeria monocytogenes proteins: implications for dominant and subdominant CTL responses. Immunol. Rev. 158:129-136. 152 35. Schluns, K. S. and L. Lefrancois 2003. Cytokine control of memory T-cell development and survival. Nat. Rev. Immunol. 3:269-279. 36. Pope, C , S.-K. Kim, A. Marzo, K. Williams, J. Jiang, H. Shen, L. Lefrancois. 2001. Organ-specific regulation of the. CD8 T cell response to Listeria monocytogenes infection. J. Immunol. 166:3402-3409. 37. Alegre, M.-L., K.A. Frauwirth, and C.B. Thompson. 2001. T-cell regulation by CD28 and CTLA-4. Nat. Rev. Immunol. 1:220-228. 38. Iezzi, G., K. Karjalainen, and A. Lanzavecchia. 1998. The duration of antigenic stimulation detennines the fate of naive and effector T cells. Immunity 8:89-95. 39. Bird, J. J., D.R. Brown, A.C. Mullen, N.H. Moskowitz, M.A. Mahowald, J.R. Sider, T.F. Gajewski, C.-R. Wang, and S.L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229-237. 40. Gudmundsdottir, H., A.D. Wells, and L.A. Turka. 1999. Dynamics and requirements of T cell clonal expansion in vivo at the single-cell level: effector function is linked to proliferative capacity. Immunity 162:5212-5223. 41. Sheehan, K. C , J..K. Pinckard, C D . Arthur, L.P. Dehner, D.V. Goeddel, and R.D. Schreiber. 1995. Monoclonal antibodies specific for murine p55 and p75 tumor necrosis factor receptors: identification of a novel in vivo role for p75. J. Exp. Med. 181:607-617. 42. Peschon, J. J., D.S. Torrance, K.L. Stocking, M.B. Glaccum, C. Otten, C R . Willis, K. Charrier, P.J. Morrissey, C B . Ware, and K.M. Mohler. 1998. TNF receptor-deficient mice reveal divergent roles for p55 and p75 in several models of inflammation. J. Immunol. 160:943-952. 43. Grivennikov, S. I., A.V. Tumanov, D.J. Liepinsh, A.A. Kruglov, B.I. Marakusha, A.N. Shakhov, T. Murakami, L.N. Drutskaya, I. Forster, B.E. Clausen, L. Tessarollo, B. Ryffel, D.V. Kuprash, and S.A. Nedospasov. 2005. Distinct and nonredundant in vivo functions of TNF produced by T cells and macrophages/neutrophils: protective and deleterious effects. Immunity 22:93-104. 44. Dawicki, W., E.M. Bertram, A .H. Sharpe, T.H. Watts. 2004. 4-1 BB and OX40 act independently to facilitate robust CD8 and CD4 recall responses. J. Immunol. 173:5944-5951. 153 Chapter 5 General discussion and perspectives 5.1 TNFR-mediated co-stimulation in T cell responses 5.1.1 Role of co-stimulation in T cell expansion and survival The previous chapters showed that absence of TNFR2-mediated co-stimulatory signals results in markedly reduced IL-2 induction, increased threshold of T cell activation, and decreased survival of the dividing population of cells transiting from naive to effector T cells (1,2). Importantly, TNFR2" A mice were more susceptible to high dose of primary challenge with Listeria monocytogenes (LM), correlating with a marked reduction in both LM-specific CD8 and CD4 T cells that accumulated at the peak of the primary response (3). Using an engineered recombinant L M system (rLM-SIY) that expresses the secreted form of the 2C TCR-specific peptide agonist, SIY, a specific role for TNFR2 was revealed in T cell survival during the early rounds of cell division, which correlated with survivin and Bcl-2 expression (3). As the extent of antigen-specific T cell expansion has crucial bearing over the extent of adaptive immunity, TNFR2 plays a determining role in outcomes of T cell responses against primary challenge. The frequency of memory T cells is directly proportional to the number of effector T cells that accumulate at the peak of the primary response (4). Thus, the absence of TNFR2-mediated co-stimulation results in a reduced pool of effector T cells and fewer memory T cells following clearance of antigen. From a qualitative perspective, it is noteworthy that although TNFR2 controls the absolute numbers of effector T cells that accumulate at the peak of the primary response, the relatively small pool of TNFR2" A CD8 + T cells that do survive during cell division appear to express effector cytokines such as TNFa and IFNy, and CTLs thus generated 154 are able to kill targets coated with cognate antigen. This is consistent with studies showing that cell division-dependent expression of markers of T cell differentiation such as CD44, CD45RB, and CD62L, as well as expression of effector cytokines such as IFNy depend primarily on cell division and indirectly on receipt of co-stimulatory signals (5). That is, TNFR2 promotes the survival of CD8 T cells during early rounds of cell division but differentiation of surviving cells into effectors in TNFR2 7 " mice depends on extent of cell division just as in wild-type mice. Thus, at least in the context of a predominantly Thl-mediated response against L M , TNFR2 appears to control the T cell response in quantitative terms to augment the numbers of cytokine-producing effector T cells. Since TNFa is produced early upon T cell activation, the assumption for source of TNFa in T cell cultures stimulated by TCR cross-linking in vitro is that activated T cells produced the cytokine endogenously. Ideally, the TNF neutralization experiment described in chapter 3 would have yielded insight as to whether the hypo-proliferative response observed for TNFR2~/" T cells was due to blockade of TNF signaling through TNFR2 during T cell activation. However, TNFa neutralization did not reproduce the phenotype of TNFR2-deficient T cells, which may indicate interesting mechanistic properties for TNFa signaling. Since membrane-bound TNFa (memTNF) was not distinguished from soluble TNFa (solTNF) in T cell culture assays described in this thesis, it is unknown which form dominates TNFa signaling during T cell activation. If memTNF dominates, perhaps TNFa/TNFR2 interactions within cell-cell contact zones are inaccessible to neutralizing anti-TNFa antibody. Since the same T cell is capable of producing TNFa as well expressing TNFR2, perhaps their interaction and signaling occurs inside the cell rather than at outer face of the cell surface, and thus inaccessible to 155 neutralizing antibodies. Adding TACE inhibitors to prevent cleavage of memTNF and therefore release of solTNF could help to address their respective roles during T cell activation. To directly assess the effect of TNFa ablation on T cell proliferation/survival, TNFa-deficient T cells derived from the Lck-Cre /TNF n o x / l l o x mice or TNF 7 " mice could be used in proliferation assays. Although this thesis identified a crucial role for TNFR2 in anti-LM T cell responses, it is important to note that the requirement for co-stimulation may be dependent on the nature of infectious agent, with parameters such as the duration and density of antigenic stimulation in acute vs. persistent infections determining this requirement. Recently, Suresh et al. (6) used the L C M V Armstrong strain to infect mice deficient in TNFR1, TNFR2, or both TNFR1 and TNFR2 (DKO) to examine the role of TNFRs in CD8 T cell responses to acute viral infection (6). They reported that primary CD8 T cell expansion of virus-specific CD8 T cells, which was measured using M H C class I tetramers specific for the L C M V CTL epitopes NP (D b NP 3 9 6 .404) and GP33 (D b G P 3 3 . 41 ) , was not dependent on TNFR2. The absolute numbers of CD8 + Ag-specific T cells in the spleens of TNFR2 7 " mice were not significantly different from those in wild-type mice (6). Thus, TNFR signaling does not appear to be required for optimal activation and expansion of CD8 T cells specific to the dominant CTL epitopes of LCMV. This is not surprising given the uniquely strong and prolonged signal-1 delivered in this viral infection model (7). Indeed, Suresh et al. (8) observed substantial activation and expansion of LCMV-specific CD8 T cells in both wild-type and CD28 7" mice, and blockade of CD28/B7 interactions by CTLA4-Ig only resulted in a modest reduction in the anti-LCMV CD8 T cell responses (8). Moreover, CD28 7" LCMV-specific memory 156 CD8 T cells showed normal homeostatic proliferation in vivo and also conferred protective immunity, indicating that CD28 signaling may be dispensable when the infectious agent delivers a potent signal-1, and thereby bypasses co-stimulatory requirements (8). This is consistent with findings by Kundig et al. (9) who reported that continued presence of signal-1 alone, either through prolonged viral replication or repeated injection of peptide, prevents the induction of anergy and generates a functional T cell response in vivo (9). Similarly, the requirement for TNFR2-mediated co-stimulation in the T cell response appears to diminish where signal 1 is potently delivered by an infectious agent. 5.1.2 Role of co-stimulation for directing effector T cell differentiation CD28 has been shown to play a role in determining Thl/Th2 differentiation for naive CD4 T cells, in addition to its role in regulating threshold of activation and T cell survival (reviewed in ref. (10). The qualitative nature of the CD28 signal that detennines this outcome is not well understood, though it may be related to its role in driving IL-2 production and thereby skewing differentiation towards a Th2 phenotype via IL-4 induction (11). Parallels may exist in the TNFR superfamily in determining Thl versus Th2 responses. Early studies using blocking antibodies against OX40L showed that these Abs ameliorated the Th2 response that arises in BALB/c mice following Leishmania major infection, whereas antibodies to CD70, CD30L or 4-1BBL had no effect (12). Moreover, OX40~/~ mice are resistant to the induction of experimental allergic lung inflammation, a Th2-mediated disease (13). This is consistent with the finding that OX40 is mainly expressed on activated CD4 + Th2 T cells and perhaps preferentially bestows a 157 survival advantage to the Th2 subset. However, the outcome of OX40 signaling for Thl/Th2 differentiation appears to be dependent on the model used to study OX40/OX40L interactions, as the systemic administration of a soluble form of OX40L (which increases OX40 signaling) results in increased CD4 + Thl responses in the lung in response to infection with Cryptococcus neoformans (14). More studies are required to investigate a possible role for TNFR/TNF interactions in type 1 vs. type 2 T cell responses, particularly in analyses of disease states in which a predominance of one cytokine-secreting subset occurs. It would be interesting to study if differential expression patterns of TNFR2 exist between T cell subsets, or whether its role in IL-2 induction could skew responses towards Th2 as in the case of CD28. Interestingly, it has been recently shown that 4-lBB-mediated co-stimulation of CD4 + T cells enhanced the survival and development of Thl cytokine-producing T cells with a sustained increase in IFNy-producing cells and suppression of IL-4 and TNFa production (15). This suggests that there may be differential roles for TNFR superfamily members in Thl vs. Th2 responses, which has interesting implications in disease states associated with autoimmunity. Lineage commitment to Thl or Th2 by activated CD4 + T cells can be traced to select transcription factors that induce differential cytokine profiles. For Thl development, the expression of a T-box transcription factor, T-bet, plays a critical role in inducing IFN-y and selective responsiveness to IL-12 (16, 17). GATA3 plays a critical role in Th2 differentiation, contributing to chromatin remodeling events that favor IL-4 production (18, 19). It would be interesting to investigate the possible linkage between co-stimulation and activation of these transcription factors for Thl/Th2 differentiation. 158 5.1.3 Role of co-stimulation in T cell memory The generation, maintenance, and function of memory T cells, which is a hallmark of adaptive immunity, have been the subject of intense investigations in the past decade (reviewed in ref. (20). Approximately 5-10% of the clonally expanded antigen-specific T-cell pool survives and is maintained indefinitely following primary challenge (21). The T cell differentiation program during effector to memory cell transition involves epigenetic imprinting that depend on numerous cellular and molecular factors during priming such as the cytokine environment, duration of antigen stimulation, type of antigen presenting cells and co-stimulatory signals. Bourgeois et al. (22) reported a requirement for CD4 T cell-help in the generation of memory CD8 + T cells via CD40 signals; in the absence of CD4 + T-cell help, memory CD8 + T cells exhibited poor proliferative capacity and cytokine production upon in vitro re-stimulation (22). Although mice that lack CD4 + T cells mount a normal primary CD8 response to Listeria monocytogenes, memory CD8 + T cells generated without CD4 help are defective in their ability to respond to secondary encounters with antigen (23). Thus it appears that signals provided by CD4 T cell-help during priming imprint a survival advantage on the memory population for robust recall responses. Co-stimulation mediated by CD28 and TNFR superfamilies provides important signals during priming that control the development of memory T cells. However, in their study on the role of CD28 in memory T cell function, Suresh et al. (8) found that the lack of CD28/B7 interactions did not significantly affect the sensitivity of LCMV-specific memory CD8 T cells to antigenic stimulation in vitro, indicating that activation threshold 159 of memory CD8 T cells is not influenced by CD28 co-stimulation. In contrast, recent studies suggest that co-stimulatory members of the TNFR superfamily may function in secondary responses in an analogous manner to their role in primary expansion and survival (24). Upon secondary challenge, the accumulation of memory effector T cells at the peak of the recall response is markedly inhibited in CD27-deficient (25), 4-1BBL-deficient (26-28), CD30L-deficient (29), and OX40-deficient (30) mice. Given the role of TNFR2 in early T cell activation and survival in the primary response, it would be interesting to investigate the expression of TNFR2 on the memory T cell subset and whether it also may play a role in secondary challenge in an analogous manner. Along these lines, Turner et al. ((31)) found that TNFR2 is uniformly expressed on effector CD8 + T cells specific for epitopes derived from HKx31 (H3N2) influenza A virus following secondary challenge. We have shown that the rLM-SIY infection model allows tracking of epitope-specific T cells throughout the course of the T cell response, including the visualization of the memory pool 81 days post-infection (3). Thus, this model can also be used to evaluate the role of TNFR2 for the expansion and differentiation of memory T cells upon secondary challenge. In addition, the TNFR2 _ /" can be bred onto TCR transgenic backgrounds such as OT-I and OT-II to facilitate direct tracking of clonal population of memory T cells and assess whether TNFR2 also provides an important survival signal in recall responses, as observed for OX40-deficient OT-II CD4 + T cells (30). If TNFR2 is important for memory T cells, the expected result is that TNFR2-deficient memory T cells will exhibit diminished expansion upon rechallenge due to loss of protection from apoptosis. 160 5.2 T N F R as a potential therapeutic target of autoimmunity The critical role of co-stimulatory molecules for the regulation of T cell responses makes these molecules attractive targets for novel therapeutic strategies. A substantial number of studies in murine models provided insight into the contribution of co-stimulation in various autoimmune diseases. Strategies utilizing a variety of approaches, such as stimulating or blocking monoclonal antibodies (mAb), fusion proteins, or gene-targeted mice, have highlighted the potential of targeting co-stimulation for controlling autoimmunity. Of the identified co-stimulatory members of the TNFR superfamily, the most compelling evidence for a role in autoimmunity and inflammation exists for OX40-OX40L interactions (24, 32). OX40-OX40L interaction has been shown to be required for the induction of EAE in mice: the addition of soluble OX40Ig to C D l l b + brain microglia/macrophages inhibited T cell proliferation by 50-70%, in vivo administration of soluble OX-40R at the onset of EAE reduced disease symptoms, and the mice recovered more quickly from acute, disease (33, 34). Moreover, blockade or deficiency in OX40/OX40L reduces the severity of collagen-induced arthritis (35), airway inflammation in mouse asthma models (13, 30, 36), and completely prevented diabetes development in NOD mice (37). The following sections highlight the therapeutic target potential of TNFR2 in several autoimmune disease models. 5.2.1 Asthma Suppression of acute and chronic inflammation is a primary goal of asthma therapy. Novel therapeutic strategies with a more specific blockade of the inflammatory cascade are required for the significant population of patients who do not respond well to the 161 established anti-inflammatory therapy of corticosteroids that is normally used to control asthmatic symptoms (38). Co-stimulation is an attractive therapeutic target for controlling cellular and molecular pathways in the inflammation and autoimmunity associated with asthma. Allergic asthma is intimately linked with airway inflammation (reviewed in (38). The initiation and progression of the inflammatory process are driven by allergen-specific T lymphocytes that attract eosinophils, mast cells, and B cells to the airways by the secretion of specific cytokines. Murine models of allergic airway disease have provided important insight into the pathophysiology of allergen-mediated lung inflammation. Although mast cells are the main effector cells of immediate hypersensitivity and anaphylaxis, it has been shown that mast cell-deficient mice (W/Wv) sensitized to ovalbumin (OVA) by intraperitoneal injection and subsequently challenged with O V A via the airways show no difference in OVA-specific IgE levels in the serum (39). Moreover, numbers of eosinophils in the bronchoalveolar lavage (BAL) fluid compared to littermate control were similar (39). This indicates that mast cells or IgE-mast cell activation are not required for the development of eosinophil-mediated inflammation in this model of allergen-induced airway hyper-responsiveness. However, there is strong evidence that allergen-induced airway inflammation is driven by Th2 cejls (40), which produce proinflammatory cytokines (mainly IL-4, IL-5, and IL-13) to attract and activate other effector cells such as eosinophils, B cells, and mast cells into the airways, thus triggering the progress of asthma pathology (41). Investigations into the role of T cell co-stimulation in airway hyper-responsiveness have yielded interesting insight on their potential as therapeutic targets. 162 Recently, Kimzey et al. (42) used adoptive transfer of Ag-specific T cells to demonstrate that CD28 has a critical role in both the induction and effector phase of allergic airway inflammation, affecting not only the priming of robust T cell expansion but also IL-4 secretion upon secondary stimulation with Ag (42). Consistent with the idea that co-stimulation plays an important role upon re-exposure to Ag in vivo, the transferred CD28-deficient Th2 cells were unable to support sufficient cytokine secretion to mediate an inflammatory response (42). In addition, CD28 appears to play an important role in eosinophil recruitment to both the lung and peritoneum, suggesting a generalized defect in the ability of eosinophils to accumulate at sites of inflammation in vivo in the absence of CD28. Memory Th2 cells secreting the cytokines IL-4, IL-5, IL-9, and IL-13 are thought to be the major driver in allergic asthma (38). Salek-Ardakani et al. (30) showed that co-stimulation through OX40 is critical for all aspects of lung inflammation driven by memory Th2 cells (30). Blocking OX40-OX40L interactions at the time of inhalation of aerosolized antigen suppressed memory effector accumulation in draining lymph nodes of the lung, and prevented eosinophilia, airway hyper-reactivity, mucus secretion, and Th2 cytokine production (30). The effect of OX40-OX40L interactions on recall responses regulated by memory Th2 cells is particularly relevant in the clinical setting where patients have already been sensitized. Given the co-stimulatory role of TNFR2 in regulating threshold of T cell activation and generation of a robust effector and memory T cell pool, this murine model of airway hyper-responsiveness could well be applied to TNFR2"7" mice to determine whether Th2 differentiation and subsequent inflammatory reactions could be altered through therapeutic blockade of TNFR2/TNF interactions. 163 5.2.2 Rheumatoid arthritis The therapeutic management of patients with rheumatoid arthritis has seen a major evolution (43), with a number of biological reagents being developed for suppression of inflammation, most notably TNFa blocking agents (44, 45). However, of about 2 million people who have rheumatoid arthritis, analysts estimate that only 250,000 are on anti-TNF therapy, and 15 to 25% of these patients have an inadequate response. More recently, impressive therapeutic responses are being reported for B-cell-depleting regimens using anti-CD20 antibodies (46). Moreover, co-stimulatory blockade using CTLA4-Ig has shown remarkable therapeutic efficacy (47). Indeed, CTLA4-Ig (Orencia; generic: abatacept) was just approved by the US Food and Drug Administration as the first in a new class of drugs of co-stimulation blockers for the treatment of rheumatoid arthritis. Interest in co-stimulatory blockade as a therapeutic modality stemmed from earlier work using the collagen type II-induced arthritis (CIA) animal model system in which immunization of genetically susceptible strains of mice, such as DBA/1, with type II collagen (CII) leads to the development of arthritis mediated by immune mechanisms involving CH-specific T cells and B cells and their products (reviewed in refs. (48, 49). Webb et al. (50) found that administration of CTLA-4Ig at the time of immunization prevented the development of CIA, and that this effect correlated with reduced lymphocyte expansion and abrogated production of anti-collagen IgGl or IgG2a antibodies (50). Clinically relevant was the finding that when treatment was delayed until after the onset of clinical disease, CTLA4-Ig was still able to ameliorate CIA. This suggests an active role for T cells in the later stages of this disease and implicates both 164 B7-1 and B7-2-mediated co-stimulation in the pathogenesis of CIA (50). The role for CD28 in CIA was further confirmed using CD28" / _ mice, which were found to be highly resistant to CIA (51). Similar results were also found for inducible co-stimulator (ICOS), a member of the CD28 superfamily, wherein ICOS 7" on the DBA/1 background were completely resistant to CIA accompanied by reduced anti-collagen IgM and IgG2a titers (52). Co-stimulatory members of the TNFR superfamily have also been explored for a possible role in the pathogenesis of rheumatoid arthritis. Yoshioka et al: (35) used neutralizing anti-OX40L mAb to study the role OX40/OX40L interactions on the development of CIA, and they reported dramatic amelioration in disease severity (35). Interestingly, this treatment regimen did not inhibit the expansion of CH-reactive T cells, but suppressed IFNy and anti-CII IgG2a production, suggesting that OX40 signaling can enhance Thl-type responses (35). A study has also suggested a role for TNFR2 in the pathogenesis of CIA (53). TNF is well-established as a potent pro-inflammatory cytokine important for the development of arthritis in human and animals. Tada et al. (53) showed that although TNFRl" '" mice developed arthritis with similar incidence and severity as TNFR1 + / " littermates, TNFR1"7" mice injected with murine TNFa during the early induction phase enhanced the development of arthritis, but inhibited arthritis when administered during the late progression phase. This indicates that TNFR2 plays a role independent of TNFR1 during the early induction phase of CIA, but can also transduce an inhibitory signal against disease. It would be interesting to investigate CIA in TNFR2-deficent mice to evaluate whether type 1 responses are reduced and arthritis ameliorated. Since the TNFR2"" mice are on the H-2 b background (C57BL/6), which is relatively 165 resistant to a number of autoimmune conditions, these mice will need to be crossed onto susceptible H-2d strains (e.g. DBA/1 mice) (48, 49). However, immunization protocols with collagen type II and complete Freund's adjuvant have been modified to render H-2 b mice more susceptible to CIA (54), which would allow for examination of CH-specific T cell and B cell responses in TNFR2~A mice currently on the B6 background. 5.3 Concluding remarks This thesis provided compelling evidence of a co-stimulatory role for TNFR2 in T cell responses. Naive CD4 + and CD8 + T cells depend on TNFR2 for survival during early rounds of cell division in response to TCR agonist and Ag-specific stimulation, particularly under antigen-limiting conditions. TNFR2 lowers the threshold of activation and promotes IL-2 production, acting as an early co-stimulatory molecule for generating a robust pool of effector T cells. Levels of antigen stimulation, as determined by strength of TCR/peptide-MHC interactions or antigenic dose, determine the degree of dependence on TNFR2-mediated co-stimulation, as stronger stimulation decreases the requirement for TNFR2 on T cell responses. Moreover, CD4 + T cells appear more dependent on TNFR2 for clonal expansion than CD8 + T cells, as TNFR2" A CD4 T cells were hypo-proliferative in response to pAPCs with the addition of exogenous IL-2. TNFR2 7 " mice exhibit increased susceptibility to high dose L M challenge, correlating with diminished frequency of LM-specific effector T cells. By crossing the TNFR2-null mutation onto TCR transgenic mice, an important advance was made in current understanding of T cell tolerance, identifying TNFR2 as an important co-stimulatory molecule for CD4 + and CD8 + T cell responses in vivo. The recent exciting developments in new therapeutics 166 designed as co-stimulatory blockers suggest that TNFR2 represents an attractive therapeutic target for modulating immune-mediated disease. 167 5.4 Figures Figure 5.1 Model for TNFR2-mediated signal transduction during T cell activation. TCR-mediated stimulation induces early synthesis of TNFa, which can subsequently act as an autocrine factor upon T cell activation. TNFR2 subsequently transduces signals to sustain A K T and N F K B activation, and thereby augments IL-2 production and expression of anti-apoptotic molecules survivin, Bcl-2 and Bc l -X L . TNFR2 synergizes with TCR and CD28 to co-stimulate IL-2 induction, T cell proliferation and survival. Dotted lines refer to proposed signals. 1 6 8 T i m e ( d a y s ) Figure 5.2 Model of TNFR2-mediated co-stimulation in the T cell response in vivo. Naive T cells require signaling from TCR and CD4/CD8 co-receptor for initial activation. Co-stimulation from CD28 and TNFR2 lowers the threshold of activation and T cell survival during early expansion. If sufficient co-stimulation is provided, naive T cells undergo substantial clonal expansion with concomitant acquisition of effector function. Continued co-stimulatory signals through TNFR2, OX40, and 4-IBB are required for endowing survival on responding T cells, allowing accumulation of a massive number of effector cells at the peak of the T cell response (~ 1 week). Late acting signals from OX40 and 4-IBB are required for efficient survival of effectors to generate a robust memory population. 169 5.5 References 1. Kim, E. Y., and H.S. Teh. 2001. TNF type 2 receptor (p75) lowers the threshold of T cell activation../. Immunol. 167:6812. 2. Kim, E. Y., and H.S. Teh. 2004. Critical role of TNF receptor type-2 (p75) as a costimulator for IL-2 induction and T cell survival: a functional link to CD28. J. Immunol. 173:4500. 3. Kim, E. Y., J.J. Priatel, S.J. Teh, H.S. Teh. 2006. TNF receptor type 2 (p75) functions as a costimulator for antigen-driven T cell responses in vivo. J. Immunol. 176:1026. 4. Pope, C , S.-K. Kim, A. Marzo, K. Williams, J. Jiang, H. Shen, L. Lefrancois. 2001. Organ-specific regulation of the CD8 T cell response to Listeria monocytogenes infection. J. Immunol. 166:3402. 5. Gudmundsdottir, H., A.D. Wells, L.A. Turka. 1999. Dynamics and requirements of T cell clonal expansion in vivo at the single-cell level: effector function is linked to proliferative capacity. J. Immunol. 162:5212. 6. Suresh, M., A. Singh, C. Fischer. 2005. Role of tumor necrosis factor receptors in regulating CD8 T-cell responses during acute lymphocytic choriomeningitis virus infection. J. Virol. 79:202. 7. Christensen, J. E.; J.P. Christensen, N.N. Kristensen, N.J. Hansen, A. Stryhn, A.R. Thomsen. 2002. Role of CD28 co-stimulation in generation and maintenance of virus-specific T cells. Int. Immunol. 14:701. 8. Suresh, M., J.K. Whitmire, L.E. Harrington, C P . Larsen, T . C Pearson, J.D. Altman, R. Ahmed. 2001. Role of CD28-B7 interactions in generation and maintenance of CD8 T cell memory. J. Immunol. 167:5565. 9. Kundig, T. M., A. Shahinian, K. Kawai, H-W. Mittrucker, E. Sebzda, M.F. Bachman, T.K. Mak, and P.S. Ohashi. 1996. Duration of TCR stimulation determines costimulatory requirement of T cells. Immunity 5:41. 10. Keir, M. E., A .H. Sharpe. 2005. The B7/CD28 costimulatory family in autoimmunity. Immunol. Rev. 204:128. 11. Seder, R. A., R.N. Germain, P.S. Linsley, W.E. Paul. 1994. CD28-mediated co-stimulation of interleukin 2 (IL-2) production plays a critical role in T cell priming for IL-4 and interferon gamma production. J. Exp. Med. 179:299. 170 12. Akiba, HL, Y . Miyahira, M. Atsuta, K. Takeda, C. Nohara, T. Futagawa, H. Matsuda, T. Aoki, FL Yagita, K. Okumura. 2000. Critical contribution of OX40 ligand to T helper cell type 2 differentiation in experimental leishmaniasis. J. Exp. Med. 191:375. 13. Jember, A. G., R. Zuberi, F.T. Liu, M. Croft. 2001. Development of allergic inflammation in a murine model of asthma is dependent on the co-stimulatory receptor OX40. J. Exp. Med. 193:387. 14. Humphreys, I. R., L. Edwards, G. Walzl, A.J. Rae, G. Dougan, S. Hi l l , T. Hussell. 2003. OX40 ligation on activated T cells enhances the control of Cryptococcus neoformans and reduces pulmonary eosinophilia. J. Immunol. 170:6125. 15. Kim, Y . J., S.H. Kim, P. Mantel, B.S. Kwon. 1998. Human 4-1 BB regulates CD28 co-stimulation to promote Thl cell responses. Eur. J. Immunol. 28:881. 16. Mullen, A. C , A.S. Hutchins, F.A. High, H.W. Lee, K.J. Sykes, L.A. Chodosh, S.L. Reiner. 2002. Hlx is induced by and genetically interacts with T-bet to promote heritable TH1 gene induction. Nat. Immunol. 3:652. 17. Mullen, A. C , F.A. High, A.S. Hutchins, H.W. Lee, A.V. Villarino, D.M. Livingstone, A.L. Kung, N. Cereb, T.P. Yao, S.Y. Yang, S.L. Reiner. 2001. Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science 292:1907. 18. Zheng, ,W., R.A. Flavell. 1997. The transcription factor GAT A-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587. 19. Lee, H. J., N. Takemoto, H. Kurata, Y . Kamogawa, S. Miyatake, A. O'Garra, N. Arai. 2000. GATA-3 induces T helper cell type 2 (Th2) cytokine expression and chromatin remodeling in committed Thl cells. J. Exp.'Med. 192:105. 20. Masopust, D., S.M Kaech, E.J. Wherry, R. Ahmed. 2004. The role of programming in memory T-cell development. Curr. Opin. Immunol. 16:217. 21. Gourley, T. S., E.J. Wherry, D. Masopust, and R. Ahmed. 2004. Generation and maintenance of immunological memory. Semin. Immunol. 16:323. 22. Bourgeois, C , B. Rocha, C. Tanchot. 2002. A role for CD40 expression on CD8 + T cells in the generation of CD8 + T cell memory. Science 297:2060. 23. Sun, J. C , M.J. Bevan. 2003. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 300:339. 24. Croft, M. 2003. Co-stimulatory members of the TNFR family: keys to effective T-cell immunity. Nat. Rev. Immunol. 3:609. 171 25. Hendriks, J., L.A. Gravestein, K. Tesselaar, R.A. van Lier, T.N. Schumacher, J. Borst. 2000. CD27 is required for generation and long-term maintenance of T cell immunity. Nat. Immunol. 1:433. 26. DeBenedette, M. A., T. Wen, M.F. Bachmann, P.S. Ohashi, B.H. Barber, K.L Stocking, J.J. Peschon, T.H. Watts. 1999. Analysis of 4-1 BB ligand (4-1BBL)-deficient mice and of mice lacking both 4-1 B B L and CD28 reveals a role for 4-1BBL in skin allograft rejection and in the cytotoxic T cell response to influenza virus. J. Immunol. 163:4833. 27. Tan, J. T., J.K. Whitmire, R. Ahmed, T.C. Pearson, C P . Larsen. 1999. 4-1 BB ligand, a member of the TNF family, is important for the generation of antiviral CD8 T cell responses. J. Immunol. 163:4859. 28. Bertram, E. M., P. Lau, T.H. Watts. 2002. Temporal segregation of 4-1BB versus CD28-mediated co-stimulation: 4-1BB ligand influences T cell numbers late in the primary response and regulates the size of the T cell memory response following influenza infection. J. Immunol. 168:3777. 29. Podack, E. R., N. Strbo, V. Sotosec, H. Muta. 2002. CD30-governor of memory T cells? Ann. NY Acad. Sci 975:101. 30. Salek-Ardakani, S., J. Song, B.S. Halteman, A.G. Jember, H. Akiba, H. Yagita, M. Croft. 2003. OX40 (CD 134) controls memory T helper 2 cells that drive lung inflammation. J. Exp. Med. 198:315. 31. Turner, S. J., N.L. La Grata, J. Stambas, G. Diaz, and P.C. Doherty. 2004. Differential tumor necrosis factor receptor 2-mediated editing of virus-specific CD8 + effector T cells. Proc. Natl. Acad. Sci. USA 101:3545. 32. Watts, T. H. 2005. TNF/TNFR family members in co-stimulation of T cell responses. Annu. Rev. Immunol. 23:23. 33. Weinberg, A. D., K.W. Wegmann, C. Funatake, R.H. Whitman. 1999. Blocking OX40/OX40 ligand interaction in vitro and in vivo leads to decreased T-cell function and amelioration of EAE. J. Immunol. 162:1818. 34. Ndhlovu, L. C , N. Ishii, K. Murata, T. Sato, K. Sugamura. 2001. Critical involvement of OX40 ligand signals in the T cell priming events during experimental autoimmune encephalomyelitis. J. Immunol. 167:2991. 35. Yoshioka, T., A. Nakajima, H. Akiba, T. Ishiwata, G. Asano, S. Yoshino, H. Yagita, K. Okumura. 2000. Contribution of OX40/OX40 ligand interaction to the pathogenesis of rheumatoid arthritis. Eur. J. Immunol. 30:2815. 172 36. Hoshino, A., Y. Tanaka, H. Akiba, Y. Asakura, Y . Mita, T. Sakurai, A. Takaoka, S. Nakaike, N. Ishii, K. Sugamura, H. Yagita, K. Okumura. 2003. Critical role for OX40 ligand in the development of pathogenic Th2 cells in a murine model of asthma. Eur. J. Immunol. 33:861. 37. Martin-Orozco, N., Z.B. Chen, L. Poirot, E. Hyatt, A. Chen, O. Kanagawa, A. Sharpe, D. Mathis, C. Benoist. 2003. Paradoxical dampening of anti-islet self-reactivity but promotion of diabetes by OX40 ligand. J. Immunol. 171:6954. 38. Kallinich, T., K.C. Beier, E.W. Gelfand, R.A. Kroczek, E. Hamelmann. 2005. Co-stimulator molecules as potential targets for therapeutic intervention in allergic airway disease. Clin. Exp. Allergy 35:1521. 39. Takeda, K., E. Hamelmann, A. Joetham, L.D. Shultz, G.L. Larsen, C G . Irvin, E.W. Gelfand. 1997. Development of eosinophilic airway inflammation and airway hyperresponsiveness in mast cell-deficient mice. J. Exp. Me'd. 186:449. 40. Lambrech, B. N., H. Hammad. 2003. Taking our breath away: dendritic cells in the pathogenesis of asthma. Nat. Rev. Immunol. 3:994. 41. Durham, S. R., S. Ying, V.A. Varney, M.R. Jacobson, R.M. Sudderick, I.S. Mackay, A.B. Kay, Q.A. Hamid. 1992. Cytokine messenger RNA expression for IL-3, IL-4, IL-5 and granulocyte/macrophage-colony-stimulating factor in the nasal mucosa after local allergen provocation: relationship to tissue eosinophilia. J. Immunol. 148:2390. 42. Kimzey, S. L., P. Liu, J.M. Green. 2004. Requirement for CD28 in the effector phase of allergic airway inflammation. J. Immunol. 173:632. 43. Kremer, J. M. 2001. Rational use of new and existing disease-modifying agents in rheumatoid arthritis. Ann. Intern. Med. 134:695. 44. Feldmann, M., R.N. Maini. 2003. TNF defined as a therapeutic target for rheumatoid arthritis and other autoimmune diseases. Nat. Med. 9:1245. 45. Feldmann, M., R.N. Maini. 2001. Anti-TNF alpha therapy of rheumatoid arthritis: what have we learned? Annu. Rev. Immunol. 19:163. 46. Edwards, J. C , L. Szczepanski, J. Szechinski, A. Filipowicz-Sosnowska, P. Emery, D.R. Close, R.M. Stevens, T. Shaw. 2004. Efficacy of B-cell-targeted therapy with rituximabin patients with rheumatoid arthritis. N. Engl. J. Med. • 350:25 72. 47. Kremer, J. M., R. Westhovens, M. Leon, E. Di Giorgio, R. Alten, S. Steinfeld, A. Russell, M. Dougados, P. Emery, I.F. Nuamah, G.R. Williams, J .C Becker, D.T. Hagerty, L.W. Moreland. 2003. Treatment of rheumatoid arthritis by selective 173 inhibition of T-cell activation with fusion protein CTLA4Ig. N. Engl. J. Med. 349:1907. 48. Lucross, J. A. , N .A. Williams. 2001. The genetic and immunopathological processes underlying collagen-induced arthritis. Immunology 103:407. 49. Myers, L. K., E.F. Rosloniec, M . A . Cremer, A . H . Kang. 1997. Collagen-induced arthritis, an animal model of autoimmunity. Life Sci. 61:1861. 50. Webb, L. M . , M.J. Walmsley, M . Feldmann. 1996. Prevention and amelioration of collagen-induced arthritis by blockade of the CD28 co-stimulatory pathway: requirement for both B7-1 and B7-2. Eur. J. Immunol. 26:2320. 51. Tada, Y . , K. Nagasawa, A. Ho, F. Morito, O. Ushiyama, N . Suzuki, H . Ohta, T.W. Mak. 1999. CD28-deficient mice are highly resistant to collagen-induced arthritis. J. Immunol. 162:203. 52. Nurieva, R. I., P. Treuting, J. Duoun, R.A. Flavell, C. Dong. 2003. Inducible costimulator is essential for collagen-induced arthritis. J. Clin. Invest. 111:701. 53. Tada, Y . , A . Ho, S. Koarada, F. Morito, O. Ushiyama, N . Suzuki, Y . Kikuchi, A. Ohta, T.W. Mak, K. Nagasawa. 2001. Collagen-induced arthritis in TNF receptor-1-deficient mice: TNF receptor-2 can modulate arthritis in the absence of TNF receptor-1. Clin. Immunol. 99:325. 54. Campbell, I. K. , J.A. Hamilton, and I.P. Wicks. 2000. Collagen-induced arthritis in C57BL/6 (H-2b) mice: new insights into an important disease model of rheumatoid arthritis. Eur. J. Immunol. 30:1568. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092866/manifest

Comment

Related Items