Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetic determinants of neutrophil mediator mobilization and release and susceptibility to COPD Zhang, Xiaozhu 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-199237.pdf [ 18.2MB ]
Metadata
JSON: 831-1.0092864.json
JSON-LD: 831-1.0092864-ld.json
RDF/XML (Pretty): 831-1.0092864-rdf.xml
RDF/JSON: 831-1.0092864-rdf.json
Turtle: 831-1.0092864-turtle.txt
N-Triples: 831-1.0092864-rdf-ntriples.txt
Original Record: 831-1.0092864-source.json
Full Text
831-1.0092864-fulltext.txt
Citation
831-1.0092864.ris

Full Text

GENETIC DETERMINANTS O F NEUTROPHIL MEDIATOR MOBILIZATION AND R E L E A S E AND SUSCEPTIBILITY TO C O P D by XIAOZHU ZHANG MD, China Medical University, 1997 M.Sc, National University of Singapore, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA April 2006 © Xiaozhu Zhang, 2006 ABSTRACT Polymorphonuclear leukocytes (PMNs) are believed to be one of the major effector cells in the chronic airway inflammation that is present in chronic obstructive pulmonary disease (COPD). Unrestrained serine protease activity in general and elastase specifically, are currently believed to play a crucial role in the pathogenesis of emphysema. CD63, Hck, and p-arrestins are important molecules in the process of azurophilic granule exocytosis. My thesis work mainly focused on defining the influence of genetic polymorphisms on gene expression and PMN function in healthy individuals and COPD patients. We hypothesized that functional polymorphisms of the CD63 gene, the Hck gene, and the p-arrestin 2 gene change the expression or function of these molecules, and as a consequence, they alter the release of azurophilic granule mediators, modulate the proteolytic activity and tissue injury and influence susceptibility to COPD or COPD related phenotypes. A number of putative genetic polymorphisms of the three genes have been validated, and their linkage disequilibrium maps have been estimated in Asians and Caucasians. Novel polymorphisms of the Hck gene (8,656L/S) and p-arrestin 2 gene (-159C/T) were discovered respectively. The 8,656L/S polymorphism was associated with the differential expression of the Hck protein and PMN MPO release upon IL-8 stimulation. It was also associated with different bronchodilator response in the COPD patients in the Lung Health Study cohort. The -159C/T polymorphism was associated with differential expression of p-arrestin 2 mRNA. A reporter gene assay demonstrated that the different alleles of the -159C/T polymorphism had different luciferase activity. The 3 detected polymorphisms in the CD63 gene were not associated with CD63 gene expression, whereas the polymorphism which was ~4kb downstream of the CD63 gene was associated with MPO release. In summary, this project offered key insight into the influence of genetic polymorphisms of the CD63 gene, the Hck gene, and the (5-arrestin 2 gene on gene expression and azurophilic granule degranulation and this may improve our understanding of COPD pathogenesis and provide therapeutic guidance for COPD treatment. TABLE OF CONTENTS Abstract Table of contents iv List of tables x List of figures xiii Abbreviations xvi Acknowledgement xviii 1 Introduction 1 1.1 Introduction 1 1.2 Literature review 3 1.2.1 COPD definition 3 1.2.2 COPD risk factors 4 1.2.3 Polymorphonuclear neutrophils (PMNs) and COPD 6 1.2.4 PMN Exocytosis 9 1.2.5 Other cell types and COPD 12 1.3 Hypothesis, Study design and Study subjects 14 1.3.1 Hypothesis 14 1.3.2 Study design 14 1.3.3 Study Subjects 14 iv 1.4 References 23 2 Selection of reference genes for gene expression studies in human PMNs by real-time PCR 1 33 2.1 Background 33 2.2 Methods 34 2.2.1 Candidate genes for expression studies 34 2.2.2 Subjects and sample preparation 35 2.2.3 RNA extraction and RT-PCR 35 2.2.4 Amplification of gene transcripts 35 2.2.5 Standard curves 36 2.2.6 Determination of Gene stability and expression levels in human PMNs 36 2.3 Results 37 2.3.1 RNA quality and quantity 37 2.3.2 Expression patterns of the candidate genes in PMNs 37 2.3.3 Standard curve and real-time PCR 38 2.3.4 The stability and expression level of reference genes in the PMNs 38 2.4 Discussion 39 2.5 Conclusions 41 2.6 Abbreviations 41 2.7 References 50 3 Association of Genetic polymorphisms of the CD63 gene with gene expression and COPD 51 v 3.1 Introduction 51 3.2 Materials and Methods 52 3.2.1 Study Subjects 52 3.2.2 SNP selection and genotyping 52 3.2.3 PMN isolation and stimulation 53 3.2.4 RNA extraction and cDNA synthesis 54 3.2.5 mRNA quantification of CD63 54 3.2.6 Flow cytometry 54 3.2.7 PMN mediator release assay 54 3.2.8 Association study in the Lung Health Study cohort 55 3.2.9 Statistical analysis 55 3.3 Results 55 3.3.1 Genetic polymorphisms of the CD63 gene 55 3.3.2 CD63 expression pattern in PMNs 56 3.3.3 CD63 genetic polymorphisms and the gene expression and PMN MPO release 56 3.4 Discussion 57 3.5 References: 80 4 Association of Genetic polymorphisms of the Hck gene with gene expression and COPD 83 4.1 Introduction 83 4.2 Materials and Methods 34 4.2.1 Study Subjects 84 4.2.2 SNP selection and genotyping 84 4.2.3 PMN isolation and stimulation 85 vi 4.2.4 RNA extraction and cDNA synthesis 85 4.2.5 Hck mRNA Quantification 86 4.2.6 Hck protein quantification 86 4.2.7 PMN mediator release assay 86 4.2.8 Association study in the LHS cohort 86 4.2.9 Statistical analysis 87 4.3 Results 87 4.3.1 Hck expression pattern in PMNs 87 4.3.2 Genetic polymorphisms of the Hck gene 88 4.3.3 Hck genetic polymorphisms and gene expression and PMN MPO release 89 4.3.4 Association study of Hck genetic polymorphisms in the LHS cohort 90 4.4 Discussion 90 4.5 References 118 Association of polymorphisms of the Beta-arrestin 2 gene with gene expression and COPD 120 5.1 Introduction 120 5.2 Materials and methods 121 5.2.1 Study subjects 121 5.2.2 S N P selection and genotyping 121 5.2.3 PMN isolation and stimulation 122 5.2.4 RNA extraction and cDNA synthesis 122 5.2.5 ARRB2 mRNA quantification 123 5.2.6 Reporter gene assay for the novel p-arrestin 2 promoter polymorphism 123 5.2.7 PMN mediator release assay 124 5.2.8 Association study in the LHS cohort 124 5.2.9 Statistical analysis 124 5.3 Results 125 5.3.1 SNP discovery and validation of the p-arrestin 2 gene 125 5.3.2 Genetic polymorphisms and p-arrestin 2 expression in PMNs 125 5.3.3 Reporter gene assay of the -159C/T polymorphism 126 5.3.4 p-arrestin 2 polymorphisms in the LHS cohort 126 5.4 Discussion 126 5.5 References 144 Association of genetic polymorphisms of the LYST and CRM1 geneS with gene expression 146 6.1 Introduction 146 6.2 Material and methods 148 6.2.1 Study subjects 148 6.2.2 SNP selection and genotyping 148 6.2.3 PMN isolation and stimulation 149 6.2.4 RNA extraction and cDNA synthesis 149 6.2.5 LYST and CRM1 mRNA and protein quantification 149 6.2.6 PMN mediator release assay 150 6.2.7 Statistical analysis 150 6.3 Results 150 6.4 Discussion 152 6.5 References 172 7 Summary 174 7.1 Novelty of the study design 174 7.2 Significant findings in this study 175 7.2.1 Reference genes for gene expression study in PMNs 175 7.2.2 Novel polymorphism 8,656L/S of the Hck gene 176 7.2.3 Novel polymorphism -159C/T of the (i-arrestin 2 gene 177 7.2.4 Gene expression pattern in healthy individuals and COPD patients 177 7.3 Power of the study 178 7.4 Future directions 180 7.4.1 Perform gene expression study in a large well-matched non COPD cohort 180 7.4.2 Perform association study in a COPD cohort and non COPD cohort 180 7.4.3 Perform further studies to investigate the functional consequence of the polymorphisms 180 7.5 References 184 Appendices 185 Appendix I equipment and reagents 185 Appendix II Experimental Protocols 187 PMN isolation 187 mRNA quantification 188 Protein quantification 192 MPO release assay 195 Genomic DNA isolation 196 Genotyping 196 ix LIST OF T A B L E S Table 1-1 Major t and v-SNARE proteins found in PMNs 17 Table 1-2 Characteristics of the study subjects in the gene expression cohort 18 Table 1-3 Characteristics of the study subjects with fast/slow decline of lung function in the LHS study cohort 19 Table 1 -4 Characteristics of the study subjects with high/low baseline of lung function in the LHS study cohort 20 Table 2-1 10 selected candidate reference genes 43 Table 2-2 Primers for real time PCR 44 Table 2-3 Characteristics of the study subjects 45 Table 3-1 Primers and restriction enzymes used for CD63 genotyping 62 Table 3-2 Detailed CD63 genotyping protocol for the -1523C/T and 1361C/G SNPs 63 Table 3-3 TaqMan CD63 genotyping assays from Applied Biosystems 64 Table 3-4 Distribution of the detected CD63 polymorphisms in the study subjects 65 Table 3-5 CD63 genotypes and the corresponding CD63 mRNA and protein levels in healthy Caucasian and Asian individuals 66 Table 3-6 Genotypes and the levels of mRNA and total CD63 under resting conditions in the COPD patients 67 Table 3-7 Genotypes and the levels of mRNA and total CD63 under stimulated conditions in the COPD patients 68 Table 3-8 CD63 genotype frequencies of the 1361C/G polymorphism in the groups of fast and non decliners of lung function in the Lung Health Study 69 Table 3-9 CD63 genotype frequencies of the 1361C/G polymorphism in the groups with high and low baseline of lung function in the Lung Health Study 70 Table 4-1 Primers and restriction enzymes used for genotyping 95 x Table 4-2 TaqMan genotyping assays of the Hck gene from Applied Biosystems 96 Table 4-3 Minor allele frequencies of the 7 detected polymorphisms of the Hck gene.... 97 Table 4-4 Pairwise allelic association (r2) in the Caucasians 98 Table 4-5 Pairwise allelic association (r2) in the Asians 99 Table 4-6 Genotypes and corresponding levels of Hck mRNA and protein in the Caucasian healthy volunteers 100 Table 4-7 Genotypes a n d corresponding level of mRNA and protein of Hck in the Asian healthy volunteers 101 Table 4-8 Genotypes and corresponding levels of mRNA and protein of Hck under resting condition in the COPD patients 102 Table 4-9 Genotypes and corresponding levels of mRNA and protein of Hck after stimulation in the COPD patients 103 Table 4-10 Genotypes and the amount of released MPO after IL-8 stimulation in COPD patients 104 Table 4-11 Hck genotype frequencies of 8,657L/S polymorphism and the rate of decline of lung function in the LHS cohort 105 Table 4-12 Hck genotype frequencies of the 26,891 C/T polymorphism in the LHS cohort with different levels of baseline lung function 106 Table 5-1 Primers and restriction enzymes used for screening and validation of the (J-arrestin 2 polymorphisms 130 Table 5-2 Detailed p-arrestin 2 genotyping protocol for the -159C/T, 1309A/G and 9019A/G SNPs 131 Table 5-3 Genotype distribution of p-arrestin 2 polymorphisms in the study subjects... 132 Table 5-4 Pairwise allelic association between p-arrestin 2 polymorphisms 133 xi Table 5-5 p-arrestin 2 genotype frequencies of the 9019A/G polymorphism in the LHS cohort with different rate of decline of lung function 134 Table 5-6 p-arrestin 2 genotype frequencies of the 9019C/G polymorphism in the LHS cohort with different baseline of lung function 135 Table 6-1 TaqMan genotyping assays of the LYST and CRM1 genes from Applied Biosystems 155 Table 6-2 Genotype distribution of the LYST and CRM1 polymorphisms 156 Table 6-3 Pairwise allelic association (r2) in healthy Asian volunteers 157 Table 6-4 Pairwise allelic association (r2) in the healthy Caucasian volunteers 158 Table 6-5 Genotype distribution and the mRNA level of LYST and CRM1 in the healthy Asian individuals 159 Table 6-6 Genotype distribution and the mRNA level of LYST and CRM1 in the healthy Caucasian individuals 160 Table 6-7 Genotypes and the levels of mRNA and protein of LYST and CRM1 under resting conditions in the C O P D patients 161 Table 6-8 Genotypes and the levels of mRNA and protein of LYST and CRM1 under stimulated conditions in the COPD patients 162 Table 6-9 LYST and CRM1 genotypes and the amount of released MPO after IL-8 stimulation in the Caucasian COPD patients 163 Table 6-10 LYST and CRM1 genotypes and the amount of released MPO after IL-8 stimulation in the Caucasian healthy volunteers 164 Table 7-1 Minumum detectable mRNA level under different allele frequencies and different sample size with a=0.05, p=0.80 for a two side test 182 Table 7-2 Minimum de tec tab le odds ratio for a sample size of 225 cases a n d 262 controls with a=0.05 a n d p=0.80 for a two sided test 183 xii LIST OF FIGURES Figure 1-1 Specific aims in this study 21 Figure 1-2 Experimental flowchart 22 Figure 2-1 Preliminary screening the gene expression pattern of 10 potential housekeeping gene in PMNs 46 Figure 2-2 Amplification plots and dissociation curves of the 7 candidate reference genes 47 Figure 2-3 Gene expression stability of seven candidate reference genes in PMNs 48 Figure 2-4 The relative expression levels of the 7 candidate reference genes 49 Figure 3-1 Schematic overview of the location and distribution of investigated polymorphisms in the CD63 gene 71 Figure 3-2 Detection of the -1523CVT SNP 72 Figure 3-3 Detection of the 1361C/G polymorphism 73 Figure 3-4 Analysis of CD63 staining by flow cytometry 74 Figure 3-5 CD63 expression pattern in Asian and Caucasian healthy individuals 75 Figure 3-6 mRNA and protein level of CD63 before and after IL-8 stimulation among C O P D patients 77 Figure 3-7 CD63 polymorphisms and the change in expression level of CD63 upon IL-8 stimulation 78 Figure 3-8 CD63 genotypes and the amount of released MPO upon IL-8 stimulation in both the Caucasian healthy individuals and COPD patients 79 Figure 4-1 Schematic overview of the investigated polymorphisms of the Hck gene.... 107 Figure 4-2 Hck expression pattern on PMNs 108 Figure 4-3 Hck mRNA and protein in healthy Caucasian individuals and COPD patients 109 xiii Figure 4-4 The level of Hck mRNA and protein before and after IL-8 stimulation 110 Figure 4-5 Detection of the -627G/T polymorphism of the Hck gene 111 Figure 4-6 Detection of 8,522C/T polymorphism of the Hck gene 112 Figure 4-7 Detection of the novel 15 bp insertion/deletion polymorphism (8,656L/S) of the Hck gene 113 Figure 4-8 TaqMan genotyping assay for 33,367C7T polymorphism of the Hck gene... 114 Figure 4-9 Pairwise linkage disequilibrium (r2) between respective polymorphisms in Caucasians (A) and Asians (B) 115 Figure 4-10 Genotypes of 4 polymorphisms and their corresponding protein levels of Hck in healthy Caucasian volunteers 116 Figure 4-11 The 8.657L/S polymorphism and released MPO in Caucasian healthy volunteers and bronchodilator response in LHS cohort 117 Figure 5-1 Schematic overview of the location and distribution of the investigated polymorphisms (SNPs) in the p-arrestin 2 gene 136 Figure 5-2 Detection of the novel -159C/T polymorphism of the p-arrestin 2 gene 137 Figure 5-3 Detection of the 1309A/G polymorphism of the p-arrestin 2 gene 138 Figure 5-4 Detection of the polymorphism 9019A/G of the p-arrestin 2 gene 139 Figure 5-5 The genotypes and corresponding mRNA level of p-arrestin 2 in the healthy Asian (A) and Caucasian (B) individuals 140 Figure 5-6 Genotypes and the mRNA level of the p-arrestin 2 before and after IL-8 challenge in the COPD patients 141 Figure 5-7 Genotypes of p-arrestin 2 polymorphisms and the amount of released MPO upon IL-8 stimulation in the healthy individuals and COPD patients 142 Figure 5-8 Reporter gene assay of -159 C/T using A549 cells 143 Figure 6-1 TaqMan genotyping of the 51,202C/G polymorphism of the CRM1 gene.... 165 xiv Figure 6-2 TaqMan genotyping of the 136,627C/T polymorphism of the LYST gene 166 Figure 6-3 Standard curves of LYST and CRM1 167 Figure 6-4 Analysis of LYST and CRM1 staining by flow cytometry 168 Figure 6-5 The mRNA level of LYST and CRM1 in the healthy individuals and COPD patients at resting condition 169 Figure 6-6 The mRNA and protein level of LYST and CRM1 before and after IL-8 stimulation 170 Figure 6-7 CRM1 genetic polymorphism 51.202C/G and the change in the expression level of CRM1 mRNA upon IL-8 stimulation in the COPD patients 171 Appendix Figure-1 Standard curves of the p-actin gene 199 Appendix Figure-2 Standard curves of the CD63 gene 200 Appendix Figure-3 Standard curves of the Hck gene 201 Appendix Figure-4 Standard curves of the p-arrestin 2 gene 202 xv ABBREVIATIONS Abbreviation Definition ^ - A T a-antitrypsin a-SNAP soluble A/-ethylmaleimide-sensitive factor adaptor protein ABL1 Abelson murine leukemia viral oncogene homolog ACTB Beta-actin Arrb2 p-arrestin 2 ATS American Thoracic Society B2M Bata-2-microglobulin CFTR Cystic fibrosis transmembrane conductance regulator CHS Chediak-Higashi Syndrome COPD Chronic obstructive pulmonary disease CRM1 exportin 1 ERS European Respiratory Society FEV1 Forced expiratory volume in one second fMLP N-formyl-methionyl-leucyl-phenylalanine GAPD Glyceraldehyde-3-phosphate dehydrogenase GNB2L1 Guanine nucleotide binding protein, p-peptide 2-like 1 GOLD The Global Initiative for Chronic Obstructive Lung Disease G P C R G protein-coupled receptors GSTs Glutathione S-transferases Hck Hematopoietic cell kinase HO-1 Heme oxygenase-1 HPRT1 Hypoxanthine phosphoribosyltransferase 1 LD Linkage Disequilibrium LHS Lung Health Study LYST lysosomal trafficking regulator mEH Microsomal epoxide hydrolase MFI Mean fluorescence intensity MMP Matrix metalloproteinases MMP1 Interstitial collagenase MMP12 Macrophage elastase MMP9 Gelatinase B MPO Myeloperoxidase NET neutrophil extracellular traps NHLBI National Heart, Lung and Blood Institute xvi Abbreviation Definition NSF /V-ethylmaleimide-sensitive factor PBGD Porphobilinogen deaminase PMN Polymorphonuclear leukocytes RFLP Restriction fragment length polymorphism RPL32 Ribosomal protein L32 S C A M P Secretary carrier membrane protein SNAP-23 Synaptosome-associated protein 23 SNARE Soluble A/-ethylmaleimide-sensitive factor adaptor protein receptor SNP Single nucleotide polymorphism TBP TATA-binding protein TNFcx Tumor necrosis factor a) TUBB Beta-tubulin VDBP Vitamin D binding protein xvii ACKNOWLEDGEMENT In September 2002 I left Singapore and came to beautiful Vancouver to pursue my PhD degree in the James Hogg iCAPTURE Center. In the following years I have been engaged in the study of genetic polymorphism, gene expression, and neutrophil function. By now I have finished my project, got fruitful experimental result, and I am going to graduate. At this time and by this opportunity, I would like to thank the following people. First, I would like to give my most sincere thanks to my supervisor Dr. Andrew Sandford. I thank Andy for accepting me as his graduate student. It is Andy who brought me to the field of population genetics. As his student I feel his encouragement, his guidance, his responsibility, his patience, and his humor all the time. From how to design primer, how to use public genome database, how to do genetic statistical analysis Andy never feels bored of any difficulty that I have with my projects. I am deeply impressed by his broad knowledge, novel ideas, clear mind, and quick thought. It is his active guidance and full support that made my project progress smoothly, and my knowledge, my capability, and my experimental technique grow day by day. Secondly, I would like to give my warmest thanks to Dr. Peter Pare. As the head of the James Hogg iCAPTURE Center, Dr. Pare never ignores the students in his labs. In spite of his very busy schedule, Dr. Pare has shown great interest and provided fully assistance with my project. His broad knowledge and enthusiastic attitude toward science stimulate me all the time. I feel sincerely grateful for the precious night and weekend time that Dr. Pare has spent on reading and correcting my thesis and manuscripts, and his expert comments and constructive advice. I also want to thank other members in my committee, Dr. Rick Hegele, Dr. Del Dorscheid, and Dr. Saren Azer for their encouragement, xviii suggestions and intellectual input. I also want to thank the two study coordinators of this project, Ms. Fil Greenslade and Ms. Karen Fleischmann. They have done great job in the process of COPD patient recruitment. Without their fully involvement and precise organization I would not have been able to recruit 70 COPD patients in a period of one year. I would like to thank Dr. Lily Ding and Ms. Beth Whalen. It is they who give me skilled technical guidance on the bench work and on the usage of flow cytometer. I would like to thank my husband, Guangbin, who has shown complete understanding and given me full support for my study in Canada in these years. It is him who supports and takes care of the whole family when I am away from Singapore, especially he takes good care of our little daughter. I also would like to thank my little daughter, Linda, for the small letters and gifts she sent to me from time to time, and her understanding why mother is away, and the joy she has brought to me. I like to thank my parents in law and my parents for their understanding and support for my study. Finally I would like to thank all the blood donors, all the friends and working colleagues for their time, knowledge, and support. xix 1 INTRODUCTION 1.1 Introduction Chronic obstructive pulmonary disease (COPD) is characterized by progressive airflow obstruction caused by chronic inflammation of the airways and lung parenchyma [1]. Cigarette smoke is the major environmental causal factor and in combination with other factors leads to two pathophysiologic processes in the lung. The first is proteolytic destruction of the lung parenchyma which increases the size of the airspaces and these eventually coalesce to form emphysematous spaces. The development of emphysema is associated with a loss of lung elastic recoil. The second process is inflammatory narrowing of peripheral airways which is characterized by edema, mucus hypersecretion and fibrosis, scarring, distortion and obliteration of peripheral airways. The loss of lung elastic recoil and the narrowing of the peripheral airways combine to decrease the maximal expiratory flow and contribute to hyperinflation. In conjunction with gas exchange abnormalities, hyperinflation produces the symptoms of COPD. While cigarette smoking is the major risk factor for COPD, only 15-20% chronic cigarette smokers develop this disease, which suggests that other factors are involved. In recent decades, genetic factors have received more and more attention. Family studies and twin studies have identified a genetic component to COPD. Whole genome scans and a number of association studies have identified linked genomic regions and a plethora of candidate genes for COPD. However, the pathogenesis of COPD is complex, and it is not a disease controlled by a single major gene. Polymorphonuclear neutrophils (PMNs) are believed to be one of the major effector cells in the chronic airway inflammation that is present in COPD and PMNs play a central role in 1 COPD pathogenesis [2]. PMNs synthesize a large number of proinflammatory cytokines/chemokines, growth factors and lipid mediators which are pre-stored in various granule populations and are released to the extracellular space upon cell activation. Azurophilic or primary granules are considered as the main microbicidal compartments of neutrophils. They are characterized by their content of myeloperoxidase and a number of hydrolytic and bactericidal proteins and several serine proteinases [3-5], which are capable of degrading many components of the extracellular matrix and are closely associated with tissue damage and development of inflammation [6, 7]. Unrestrained serine protease activity in general, and elastase specifically, are currently believed to play a crucial role in the pathogenesis of emphysema which is one of the pathologic features of COPD [8]. CD63, Hck, and p-arrestins are important in the process of azurophilic granule exocytosis [9]. Studies in our group have suggested that exportin-1 and LYST are also involved in azurophilic granule degranulation (unpublished data). We hypothesized that functional genetic polymorphisms affect the expression or function of CD63, Hck, p-arrestins, exportin-1, and LYST. Consequently, polymorphisms in these genes alter the release of azurophilic granule mediators, modulate the proteolytic activity and tissue injury, and affect susceptibility to COPD or COPD related phenotypes. In this study, we characterized genetic polymorphisms of these genes, measured their expression level and the amount of released MPO from neutrophils after IL-8 stimulation, and evaluated the potential association of these polymorphisms with gene expression and PMN degranulation activity in healthy volunteers and COPD subjects. Moreover, we assessed the association of function-changing polymorphisms with COPD-related phenotypes in a cohort of the Lung Healthy Study cohort. 2 1.2 Literature review Chronic Obstructive Pulmonary Disease (COPD) is one of the most common chronic inflammatory airway diseases. COPD is defined by the presence of reduced maximal expiratory flow from the lung, as measured by the forced expiratory volume in one second (FEV1) expressed as a percentage of the predicted value (FEV1 % predicted). The definition and categories of COPD severity have been recently refined by the GOLD initiative [10]. The pathophysiologic processes underlying the development of airflow obstruction include emphysema, which is associated with proteolytic destruction of the lung's connective tissue framework and loss of lung elastic recoil, and inflammatory narrowing of the peripheral airways of the lung. Patients who have COPD may or may not have concomitant chronic bronchitis, which is defined on the basis of productive cough on most days during at least 3 consecutive months for not less than 2 consecutive years [11]. In its mild forms COPD is usually not associated with symptoms, but as it progresses patients develop wheeze, exertional dyspnea and eventually respiratory failure. The prevalence of COPD is the highest in countries where cigarette smoking has been, or still is, common, whereas the prevalence is lowest in countries where smoking is less common, or total tobacco consumption per individual is low. In the year 2000 an estimated 10 million United States adults reported physician-diagnosed COPD [12]. In Canada COPD is one of the leading causes of morbidity and mortality. It affects 5% of all adult Canadians and is the fourth leading cause of death [13]. 1.2.1 COPD definition COPD is a disease state characterized by slowly progressive airflow obstruction. The European respiratory society (ERS) and The American Thoracic Society (ATS) published 3 a new definition of COPD recently. It states "COPD is a preventable and treatable disease state characterised by airflow limitation that is not fully reversible. The airflow limitation is usually progressive and is associated with an abnormal inflammatory response of the lungs to noxious particles or gases, primarily caused by cigarette smoking. Although COPD affects the lungs, it also produces significant systemic consequences" [14]. The Global Initiative for Chronic Obstructive Lung Disease (GOLD) report gave a similar definition of COPD [15]. All these definitions encompass the idea that COPD is a chronic inflammatory disease.. 1.2.2 COPD risk factors 1.2.2.1 Environmental factors Tobacco smoke has been considered as the main causal environmental factor for the development of COPD. Tobacco smokers constitute over 90% of COPD patients [10, 16, 17]. Other major environmental factors include heavy exposure to occupational dusts and chemicals, such as vapors, irritants, and fumes, and indoor/outdoor air pollution, which can cause COPD independently or can increase the risk for COPD in tobacco smokers [18, 19]. In addition, childhood viral infection of the lower respiratory tract can also contribute to the loss of lung function and development of COPD in adulthood [20]. 1.2.2.2 Host Factors In addition to environmental factors, many genetic factors also modulate a person's risk of developing COPD. The best documented genetic factor is a-antitrypsin (a rAT). It has been known since the early 1960s that individuals with extremely low levels of a r A T have an increased prevalence of emphysema [21]. A genetic basis for cc rAT deficiency was demonstrated by the observation that the deficiency followed a simple Mendelian pattern of inheritance and was usually associated with the Z isoform of a r A T [22-24]. 4 Homozygosity of the Z variant (which contains lysine rather than glutamic acid at amino acid position 342) results in a severe deficiency that is characterized by plasma ot r AT level approximately 15% of the normal M allele, because the Z protein polymerizes within the endoplasmic reticulum of hepatocytes [25]. Some individuals with the ZZ genotype have a clearly accelerated rate of decline in lung function [26], sometimes even in the absence of smoking [27]. PI Z subjects who smoke cigarettes tend to develop more severe pulmonary impairment at an earlier age than non-smoking PI Z individuals [27-29]. However, many PI Z subjects have normal lung function. The variability in pulmonary function among PI Z individuals has been explained partly by the presence of other environmental and genetic risk factors [30]. Other genes which have been shown as potential risk factors for COPD include matrix metalloproteinases (e.g. MMP1-interstitial collagenase, MMP12-macrophage elastase and MMP9-gelatinase B), xenobiotic metabolizing enzymes (e.g. mEH- microsomal epoxide hydrolase and GSTs - glutathione S-transferases), antioxidants (e.g. HO-1-heme oxygenase-1), inflammatory mediators (e.g. VDBP-vitamin D binding protein and TNFa-tumor necrosis factor a), and molecules involved in mucocilliary clearance (e.g. CFTR-cystic fibrosis transmembrane conductance regulator) [31-45]. Most studies of COPD genetics have been case-control candidate gene studies and were often too small in size to be powerful enough to detect genes of modest effect. More information about the role of genetic risk factors in the development of COPD may be provided by large-scale family studies, by genome-wide association studies, and by investigation of increased number of possible candidate genes identified by the Human Genome Project. It has also been recognized that a critical part of identifying genetic risk 5 factors is the characterization of function-changing polymorphisms, rather than relying on epidemiological approaches alone. 1.2.3 Polymorphonuclear neutrophils (PMNs) and COPD PMNs are the most abundant leukocytes in peripheral blood, normally accounting for 54-75% of the white blood cells. An adult typically has 3,000-7,500 neutrophils/mm3 of blood, but the number may increase 2-3 fold during active infections. PMNs are the key defense cells in the innate immune system. They remove the invading pathogenic microbes by means of phagocytosis and exocytosis. Reactive oxygen species and proteolytic enzymes are the main toxic molecules that allow PMNs to destroy the foreign microorganisms. 1.2.3.1 PMN Granules PMNs are granulocytes and their granules are formed sequentially during myeloid cell differentiation. The early-appearing granules were originally defined by their high content of myeloperoxidase (MPO) and were named "peroxidase-positive granules". Due to their high affinity for the basic dye azure A, they are also referred to "azurophilic granules", or simply designated "primary granules" [46]. The granules formed at later stages of myelopoiesis are peroxidase-negative granules, and they are further divided into secondary (specific) granules, gelatinase (tertiary) granules on the basis of their relative content of lactoferrin and gelatinase, respectively and secretary vesicles [47]. Azurophilic granules are considered to be the main microbicidal compartments of neutrophils. A number of hydrolytic bactericidal proteins and serine proteinases are prestored inside azurophilic granules, which include MPO, alpha-defensins, bactericidal permeability-increasing protein, proteinase-3, cathepsin G, and elastase, [3-5, 48, 49]. 6 1.2.3.2 The influence of granule contents on extracellular matrix In the process of exocytosis the granule contents are released into the extracellular environment. PMN serine proteinases have broad substrate specificity and strong proteolytic activities. They are capable of cleaving insoluble elastin and a variety of matrix proteins, including fibronectin, laminin, collagen (types I—IV), and proteoglycans [50]. Therefore, the exocytosis of azurophilic granules can markedly affect the structure and function of extracellular matrix. In addition to exocytosis, the release of granule contents into the extracellular space also happens in the process of phagocytosis and PMN lysis by bacterial toxin. During phagocytosis, degranulation starts before the phagosome closure and therefore part of the granule content is released extracellularly. In cell lysis (necrosis), the granule contents pass freely into the surrounding microenvironment due to the damage to the cell membranes and granule membranes [51, 52]. All these possibilities play a significant role in the pulmonary damage that occurs in emphysema, chronic bronchitis, and cystic fibrosis. Current concepts in the pathogenesis of COPD emphasize the role of unrestrained proteolytic activity on the lung extracellular matrix, especially in patients with oci-AT deficiency. 1.2.3.3 PMNs in COPD pathogenesis PMNs have been implicated in the pathogenesis of COPD for over 40 years. In smokers and subjects with COPD there are increased numbers of PMNs in bronchoalveolar lavage (BAL) fluid and in induced sputum compared with nonsmokers and smokers without COPD [53, 54]. PMN from patients with COPD have enhanced chemotactic activity and proteolytic activity, and express more adhesion molecules compared with controls [55]. 7 Neutrophil elastase and proteinase-3, the two PMN serine proteinases, can produce the pathologic changes that are present in emphysema in experimental animals [56, 57] due to their broad proteolytic degradation of extracellular matrix of the lung. Neutrophil elastase also can inactivate a number of anti-proteases, such as cystatin C, TIMPs, and stimulate the secretions of proteases MMP 2, 3, 9 and cathepsin B, exaggerating tissue destruction. Severe deficiency of a r AT, the inhibitor of neutrophil elastase, was associated with severe early-onset emphysema due to the lack of blocking neutrophil elastase [21]. Neutrophil elastase deficient knockout mice were significantly protected from the development of emphysema after cigarette smoke exposure [58]. In addition to proteolytic degradation, neutrophil elastase can cause extensive airway epithelial disruption and detachment [59], reduced ciliary beating [60], and stimulation of mucous gland hypersecretion [61, 62]. All these impair the host defenses of the lung and facilitate bacterial adherence and colonization. Increased PMNs in the airway also increases the oxidative burden of the lung. PMNs are able to produce reactive oxygen species, such as hydrogen peroxide, nitric oxide (with the use of NADPH) and other related enzymes. Oxidants can inactive antiproteases and cause functional protease-antiprotease imbalance. Oxidants can also increase epithelial cell permeability and apoptosis, induce mucus hypersecretion, impair mucociliary clearance and upregulate the level of gene expression of a number of proinflammatory mediators by activating redox-sensitive transcription factors, such as nuclear factor KB (NF-KB) and activating protein 1 (AP-1), and eventually enhance the two major pathophysiological processes, proteolytic destruction and airway inflammation, of COPD [63]. 8 The major factors that attract PMNs to the airways are two chemoattractants, interleukin (IL)-8 and leukotriene (LT) B4. Neutrophil elastase is capable of stimulating alveolar macrophages to release LTB4 [64]. Cigarette smoke can also induce resident lung cells such as epithelial cells [65], airway smooth muscle cells [66], and fibroblasts [67] to release LTB 4 and IL-8. PMNs themselves are able to synthesize and release IL-8 as well [68]. 1.2.4 PMN Exocytosis Exocytosis refers to the fusion of granules or secretory vesicles' membrane with the plasma membrane, and is associated with the release of granule contents from the cells. 1.2.4.1 Exocytosis patterns and possible mechanisms In PMNs different granules are mobilized in a strict rank order. Secretory vesicles are the most easily mobilized, followed by gelatinase granules, specific granules, and azurophilic granules [69]. This hierarchical pattern of exocytosis coordinates the process of PMN mobilization from circulating blood. The interaction between PMNs and the endothelium induces exocytosis of secretory vesicles. Translocated secretory vesicles enrich the neutrophil surface membrane with B-integrins that mediate firm endothelial adhesion and initiate PMN transmigration. The movement of PMNs through vascular basement membrane is facilitated by the release of collagenolytic metalloproteases from gelatinase granules. On encountering bacteria, the PMNs activate diverse antimicrobial systems by releasing azurophilic and specific granules to the phagocytic vacuole or to the exterior of the cell [70]. The signaling pathways that control PMN exocytosis are not fully understood. It has been found that increased intracellular free calcium concentration, not extracellular calcium, is 9 able to induce the hierarchical exocytosis under some stimuli, e.g. N-formyl-methionyl-leucyl-phenylalanine (fMLP) and L-selectin. The SNAP/SNARE hypothesis suggests that the interaction between SNARE proteins on vesicles (v-SNAREs) and target membranes (t-SNAREs) initiates the process of exocytosis [71]. SNAREs (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor) are a large and diverse group of proteins involved in vesicle trafficking, budding and fusion. The term SNARE describes the activity of these proteins as binding partners of two cytosolic proteins, NSF (N-ethylmaleimide-sensitive factor) and a-SNAP (soluble N-ethylmaleimide-sensitive factor adaptor protein). A range of SNARE proteins has recently been identified in neutrophils ( Table 1-1 ) [72-74]. However, most of them are located on peroxidase-negative granules and secretary vesicles, not azurophilic granules. 1.2.4.2 Molecules associated with azurophilic granule exocytosis The mechanism underlying azurophilic granule exocytosis is not fully understood. The process is not sensitive to increased intracellular free calcium and there are no v-SNARE proteins found on the granule membrane. In 2000, Barlic et al suggested that several molecules, including CD63, hematopoietic cell kinase (Hck) and p-arrestins, are important in the process of chemokine induced azurophilic granule exocytosis [9]. CD63 belongs to the tetraspanin protein superfamily, which consists of 28 widely expressed members. The major function of tetraspanins is to interact with a diverse array of molecules to form the "tetraspanin web [75]. CD63 was originally described as an integral membrane glycoprotein of lysosomes [76]. cDNA cloning and sequencing suggested that CD63 was identical to ME491, an antigen associated with early melanoma cells [77], and granulophysin, a protein associated with platelet dense bodies [78]. In 10 peripheral blood leukocytes, CD63 is most abundantly expressed in PMNs. The biological functions of CD63 have yet to be fully established. CD63 surface expression has been considered as a marker of activation in several cell types including basophils [79], mast cells [80, 81], eosinophils [82] and platelets [83]. In PMNs, CD63 is mainly expressed on the membrane of azurophilic granules. Upon stimulation, CD63 translocates from azurophilic granules to the plasma membrane and this process is associated with azurophilic granule degranulation. Therefore, upregulation of CD63 on the surface of PMNs has been considered as an excellent marker for azurophilic granule release [84]. Hck is a Src tyrosine kinase which is primarily expressed in hematopoietic cells, particularly granulocytes [85]. Hck has two isoforms, p59 and p61, generated by alternative translational initiation codons. p59Hck is the predominantly expressed variant in PMNs [86]. Together with another two tyrosine kinases, Fgr and Lyn, Hck is the essential molecule in the signaling pathway leading to granule-plasma membrane fusion which initiates PMN degranulation [87, 88]. Despite the functional redundancy several studies have suggested that different members of the Src tyrosine kinases have their own subcellular localization and distinct function [88, 89]. For example, c-Fgr is mainly localized to secondary and tertiary granules [90], whereas Hck is mainly associated with the membrane of azurophilic granules and plays a critical role in PMN phagocytosis and azurophilic granule release [86, 91]. PMNs from Hck F / F knock-in transgenic mice showed increased chemotactic activity and degranulation, and the lungs of Hck F / F knock-in mice showed extensive inflammatory cell infiltration and areas of mild emphysema and pulmonary fibrosis [92]. p-arrestins (p-arrestin 1 and p-arrestin 2) belong to the arrestin family which includes two additional members, visual arrestin (S-antigen) [93, 94] and cone arrestin (X-arrestin) [95, 11 96]. Visual arrestin and cone arrestin are expressed almost exclusively in the retina, whereas p-arrestins are expressed in a wide variety of tissues. Although p-arrestin 1 and P-arrestin 2 share over 78% amino acid identity in vitro studies have revealed some functional differences, p-arrestin 2 is 100-fold more potent than p-arrestin 1 in receptor endocytosis [97]. p-arrestins are the pivotal molecules in regulating signaling pathways associated with G protein-coupled receptors (GPCR). By binding to phosphorylated receptor, p-arrestins sterically block further interaction between GPCR and Gs proteins, which terminates or attenuates GPCR signaling (desensitization) [98]. Moreover, p-arrestins play positive roles in signal transduction from the same receptors that they desensitize. For example, p-arrestins function to promote stable complexes between GPCR and several mitogen-activated protein kinases such as ERK and JNK [99-101]. In PMNs, p-arrestins serve as adaptor proteins for the nonreceptor Src tyrosine kinases Hck or Fgr and are involved in the process of azurophilic granule degranulation. Barlic et al has shown that Hck colocalizes with p-arrestin on phosphorylated GPCR (i.e. the IL-8 receptor) after IL-8 stimulation. Following this interaction, the Hck and p-arrestins complex traffics to azurophilic granule rich regions, and initiates the process of mediator release. Granulocytes expressing a dominant-negative p-arrestin-mutation do not release granules after IL-8 stimulation [9]. 1.2.5 Other cell types and COPD Although PMNs play important role in COPD pathogenesis, other cell types are also actively involved. 12 1.2.5.1 Macrophages Macrophages and macrophage-derived proteases are receiving more and more attention in the scientific literature. A number of studies have reported that macrophages are increased in airways, lung parenchyma, BAL fluid and sputum of smokers and COPD patients [102-104]. Increased macrophage numbers in the airways is correlated with the severity of COPD [105]. Alveolar macrophages produce a number of proinflammatory mediators, including lipid mediators (leukotriene B4, prostaglandins), multiple chemokines leading to the recruitment of several cell types from the circulation (including PMNs, monocytes, and T cells), inflammatory cytokines, and reactive oxygen and nitrogen species. All these will result in excessive inflammation in small airways [106]. Macrophages-derived proteolytic enzymes, including MMP-2, MMP-9, MMP-12, cathepsins K, L and S, play a pivotal role in the destruction of extracellular matrix in emphysema. MMP-12 knockout mice showed complete protection against emphysema after long term exposure to cigarette smoke [32]. Macrophages from COPD patients have greater proteolytic activity than normal smokers, and this is further increased by exposure to cigarette smoke [107,108]. 1.2.5.2 T lymphocytes T cells were found to be increased in BAL fluid of patients with COPD [109], and the number of CD3+ T cells was correlated with the number of macrophages and the extent of emphysema [103]. In particular, CD8+ T-cells are identified as the predominant lymphocyte in the airways of smokers with COPD [110], and the CD8+/CD3+ ratio in the airways increases as the amount smoked increases [111]. CD8+ T-cells are cytotoxic T cells. Their major role is to kill infected or injured cells. However, they can produce a number of cytokines including TNFa, IFNy, which would enhance the inflammatory reaction in the lung and cause lung damage. 13 1.3 Hypothesis, Study design and Study subjects 1.3.1 Hypothesis Based on the important role of PMNs in COPD pathogenesis and the close involvement of CD63, Hck and p-arrestins in the process of azurophilic granule exocytosis, we hypothesized that functional polymorphisms may result in abnormal expression or function of these molecules, and as a consequence, they may alter the release of azurophilic granule mediators, modulate PMN-induced proteolytic activity and tissue injury, and influence susceptibility to COPD or COPD-related phenotypes. 1.3.2 Study design In order to test our hypothesis, we had 5 specific aims (Figure 1-1). First, we identified new polymorphisms that may affect gene expression, and validated polymorphisms that were described in publicly available single nucleotide polymorphism (SNP) databases; second we set up the methodology for RNA quantification, protein quantification, and mediator release assays; third was the recruitment of study subjects for the gene expression study, including healthy individuals and COPD patients; fourth was to perform gene expression analysis; finally we performed association studies with functional polymorphisms in a cohort of COPD patients (the Lung Health Study). The experimental flowchart is shown in Figure 1-2. 1.3.3 Study Subjects In this study we utilized three cohorts of individuals. All the participants gave written informed consent. The research protocol was approved by the Providence Health Care Research Ethics Board. 14 1.3.3.1 SNP discovery and validation cohort This cohort consisted of 35 healthy Caucasian volunteers who provided genomic DNA for genotyping. 1.3.3.2 Gene expression cohort This cohort included 95 healthy volunteers and 70 COPD patients. All the subjects donated 20 ml - 40 ml of peripheral blood and answered a detailed questionnaire regarding past respiratory history, smoking history and medication in last 12 months. The characteristics of these study subjects are summarized in Table 1-2. COPD subjects A total of 70 Caucasian physician-diagnosed COPD patients (30 female and 40 male) who attended respiratory clinics at St. Paul's Hospital and Vancouver General Hospital were invited to take part in the study. Their mean age was 70.2 ± 10.8 years. Sixty-eight of the patients were former or current cigarette smokers, and the other two had positive history of exposure to cigarette smoking. Exclusion criteria were presence of a r A T deficiency, a diagnosis of asbestosis and transplant patients (since they were on medications that could change neutrophil function). Healthy volunteers A total of 60 Caucasian (33 female and 27 male) and 35 Asian (19 female and 16 male) healthy volunteers were recruited. The mean age was 34.7 ± 10.4 years for Caucasians and 30.6 ± 7.8 years for Asians. 15 1.3.3.3 COPD patients cohort (Lung Health Study) A total of 5887 smokers were recruited into the National Heart, Lung and Blood Institute (NHLBI) Lung Health Study (LHS). The entry criteria for the study were FEV1% of predicted in the range of 55-90%, and the ratio of FEV1/FVC s 70%. Two subgroups were selected. Selection of the first group (LHS1) was based on the rate of decline in lung function ~300 with rapid decline of lung function (decline in FEV1 % predicted >3.0% per year) and -300 with absence of decline or increase in FEV1 % predicted (Table 1-3). Selection of the second group (LHS2) was based on the level of baseline lung function, including -500 with highest level of baseline lung function and -500 with lowest level of baseline lung function (Table 1-4). The selection criteria were arbitrary. The study subjects in these two subgroups consisted of the extreme phenotypes in the distribution of all the LHS participants. 16 Table 1-1 Major t and v-SNARE proteins found in PMNs v - S N A R E s Vesicle-associated membrane protein-2 (VAMP-2) Azurophilic Specific Gelatinase Secretory Pla^rnl granules granules granules vesicles membrane ++ +++ Secretary carrier membrane protein (SCAMP) +++ +++ ++ Synaptosome-associated protein 23 (SNAP-23) +++ +++ Synaptosome-associated protein 25 (SNAP-25) +++ +++ t -SNAREs Syntaxin-4 Syntaxin-6 +++ +++ - 17-Table 1-2 Characteristics of the study subjects in the gene expression cohort Characteristic Healthy volunteers COPD patients Ethnicity Asian Caucasian Caucasian Number of subjects 35 60 70 Age (Years) 30.6 ± 7.8 34.7 ±10.4 69.8 ± 10.6 Gender (F/M) 19/16 33/27 29/41 FEV1 (% of predicted) Not done Not done 48.5 ± 17.1 FEV1/FVC (%) Not done Not done 50.2 ± 28.5 Former/current smoker (n) 0 13 68 Smoking (pack-years) 0 1.9±4.7 47.0±31.4 Medication history Oral corticosteroid 0 0 8 Inhaled corticosteroid 0 0 57 Short acting p2AR agonist 0 0 36 Long-acting p2AR agonist 0 0 19 Theophylline 0 0 9 - 18-Table 1-3 Characteristics of the study subjects with fast/slow decline of lung function in the LHS study cohort Fast decline Slow decline No. of subjects 225 262 Ethnicity Caucasian Caucasian Male/Female 135/90 176/86 Age (years) 49±6 47±7 Smoking history (pack years) 43+20 38±19 Pre-bronchodilator F E V 1 % of predicted 73±9% 75+8% Continuous variables are shown as mean ± SD Table 1-4 Characteristics of the study subjects with high/low baseline of lung function in the LHS study cohort High baseline Low baseline No. of subjects 537 533 Ethnicity Caucasian Caucasian Male/Female 354/183 330/203 Age (years) 46±6 50±7 Smoking history (pack years) 35±20 45±19 Baseline FEV -! (% predicted) 92+7% 62+8% Continuous variables are shown as mean ± SD Figure 1-1 Specific aims in this study -21 -20ml /40 ml peripheral blood TJ ' w o O 3 PMNs / \ Resting (D Q. a O —I —1 • si (D 0) 0) <D 0) CO CO 3 "D a g> C 0) D • o _-o 13 IL-8 stimulation Mononuclear cells DNA isolation / i \ 7) Z > XJ c o _. o Genotyping Figure 1-2 Experimental flowchart 1.4 References 1. Barnes, PJ. Chronic obstructive pulmonary disease. N Engl J Med 2000;343: 269-80. 2. Stockley, RA. Neutrophils and the pathogenesis of COPD. Chest 2002;121:151S-155S. 3. Campanelli, D, Detmers, PA, Nathan, CF, Gabay, JE. Azurocidin and a homologous serine protease from neutrophils. Differential antimicrobial and proteolytic properties. J Clin Invest 1990;85:904-15. 4. Sinha, S, Watorek, W, Karr, S, Giles, J, et al. Primary structure of human neutrophil elastase. Proc Natl Acad Sci U S A 1987;84: 2228-32. 5. Salvesen, G, Farley, D, Shuman, J , Przybyla, A, et al. Molecular cloning of human cathepsin G: structural similarity to mast cell and cytotoxic T lymphocyte proteinases. Biochemistry 1987;26: 2289-93. 6. Albelda, SM, Smith, CW, Ward, PA. Adhesion molecules and inflammatory injury. Faseb J 1994;8: 504-12. 7. Berton, G, Yan, SR, Fumagalli, L, Lowell, CA. Neutrophil activation by adhesion: mechanisms and pathophysiological implications. Int J Clin Lab Res 1996;26:160-77. 8. Witko-Sarsat, V, Rieu, P, Descamps-Latscha, B, Lesavre, P, et al. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 2000;80: 617-53. 9. Barlic, J , Andrews, JD, Kelvin, AA, Bosinger, SE, et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI. Nat Immunol 2000;1:227-33. 10. Pauwels, RA, Buist, AS, Calverley, PM, Jenkins, CR, et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBl/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 2001 ;163:1256-76. 11. Pare, PD, Fraser, RG (1999) Dianosis of disease of the chest. W. B Saunders company. - 2 3 -12. Mannino, DM, Homa, DM, Akinbami, LJ, Ford, ES, et al. Chronic obstructive pulmonary disease surveillance-United States, 1971-2000. Respir Care 2002;47: 1184-99. 13. Sin, DD, Wu, L, Man, SF. The relationship between reduced lung function and cardiovascular mortality: a population-based study and a systematic review of the literature. Chest 2005;127:1952-9. 14. Celli, BR, MacNee, W. Standards for the diagnosis and treatment of patients with COPD: a summary of the ATS/ERS position paper. Eur Respir J 2004;23: 932-46. 15. Pauwels, RA, Buist, AS, Ma, P, Jenkins, CR, et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: National Heart, Lung, and Blood Institute and World Health Organization Global Initiative for Chronic Obstructive Lung Disease (GOLD): executive summary. Respir Care 2001 ;46: 798-825. 16. Siafakas, NM, Vermeire, P, Pride, NB, Paoletti, P, et al. Optimal assessment and management of chronic obstructive pulmonary disease (COPD). The European Respiratory Society Task Force. Eur Respir J 1995;8:1398-420. 17. BTS guidelines for the management of chronic obstructive pulmonary disease. The COPD Guidelines Group of the Standards of Care Committee of the BTS. Thorax 1997;52 Suppl 5: S1-28. 18. Kauffmann, F, Drouet, D, Lellouch, J , Brille, D. Twelve years spirometric changes among Paris area workers. Int J Epidemiol 1979;8:201-12. 19. Samet, JM, Marbury, MC, Spengler, JD. Health effects and sources of indoor air pollution. Part I. Am Rev Respir Dis 1987;136:1486-508. 20. Hogg, JC. Childhood viral infection and the pathogenesis of asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 1999;160: S26-8. 21. Laurell, CC, Eriksson, S. The electrophorectic alphai-globulin pattern of serum in alphai-antitrypsin deficiency. Scandinavian Journal of Clinical & Laboratory Investigation 1963;15:132-140. 22. Eriksson, S. Pulmonary emphysema and oci-antitrypsin deficiency. Acta Medica Scandinavica 1964;175:197-205. 23. Eriksson, S. Studies in oci-antitrypsin deficiency. Acta Medica Scandinavica 1965;177(suppl. 432): 1-85. -24 -24. Kueppers, F, Briscoe, WA, Beam, AG. Hereditary deficiency of arantitrypsin. Science 1964;146:1678-9. 25. Mahadeva, R, Lomas, DA. Genetics and respiratory disease. 2. Alpha 1-antitrypsin deficiency, cirrhosis and emphysema. Thorax 1998;53: 501-5. 26. Brantly, ML, Paul, LD, Miller, BH, Falk, RT, et al. Clinical features and history of the destructive lung disease associated with ai-antitrypsin deficiency of adults with pulmonary symptoms. American Review of Respiratory Disease 1988;138: 327-36. 27. Janus, ED, Phillips, NT, Carrell, RW. Smoking, lung function, and alpha 1-antitrypsin deficiency. Lancet 1985;1:152-4. 28. Tobin, MJ, Cook, PJ, Hutchison, DC. Alpha 1 antitrypsin deficiency: the clinical and physiological features of pulmonary emphysema in subjects homozygous for Pi type Z. A survey by the British Thoracic Association. Br J Dis Chest 1983;77:14-27. 29. Larsson, C. Natural history and life expectancy in severe alphal-antitrypsin deficiency, Pi Z. Acta Med Scand 1978;204:345-51. 30. Silverman, EK, Province, MA, Campbell, EJ, Pierce, JA, et al. Family study of alpha 1 -antitrypsin deficiency: effects of cigarette smoking, measured genotype, and their interaction on pulmonary function and biochemical traits. Genetic Epidemiology 1992;9: 317-31. 31. D Armiento, J , Dalai, SS, Okada, Y, Berg, RA, et al. Collagenase expression in the lungs of transgenic mice causes pulmonary emphysema. Cell 1992;71: 955-61. 32. Hautamaki, RD, Kobayashi, DK, Senior, RM, Shapiro, SD. Requirement for macrophage elastase for cigarette smoke-induced emphysema in mice. Science 1997;277: 2002-4. 33. Finlay, GA, O Driscoll, LR, Russell, KJ, D Arcy, EM, et al. Matrix metalloproteinase expression and production by alveolar macrophages in emphysema. American Journal of Respiratory & Critical Care Medicine 1997;156: 240-7. 34. Segura-Valdez, L, Pardo, A, Gaxiola, M, Uhal, BD, et al. Upregulation of gelatinases A and B, collagenases 1 and 2, and increased parenchymal cell death in COPD. Chest 2000;117: 684-694. 35. Poller, W, Faber, JP, Scholz, S, Olek, K, et al. Sequence analysis of the cystic fibrosis gene in patients with disseminated bronchiectatic lung disease. Application in the - 2 5 -identification of a cystic fibrosis patient with atypical clinical course. Klinische Wochenschrift 1991 ;69: 657-63. 36. Gervais, R, Lafitte, JJ, Dumur, V, Kesteloot, M, et al. Sweat chloride and AF508 mutation in chronic bronchitis or bronchiectasis. Lancet 1993;342: 997. 37. Home, SL, Cockcroft, DW, Dosman, JA. Possible protective effect against chronic obstructive airways disease by the GC 2 allele. Human Heredity 1990;40:173-6. 38. Ishii, T, Keicho, N, Teramoto, S, Azuma, A, et al. Association of Gc-globulin variation with susceptibility to COPD and diffuse panbronchiolitis. Eur Respir J 2001 ;18: 753-7. 39. Huang, SL, Su, CH, Chang, SC. Tumor necrosis factor-a gene polymorphism in chronic bronchitis. American Journal of Respiratory & Critical Care Medicine 1997;156: 1436-9. 40. Sakao, S, Tatsumi, K, Igari, H, Shino, Y, et al. Association of tumor necrosis factor alpha gene promoter polymorphism with the presence of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001 ;163:420-422. 41. Smith, CA, Harrison, DJ. Association between polymorphism in gene for microsomal epoxide hydrolase and susceptibility to emphysema. Lancet 1997;350: 630-3. 42. Yoshikawa, M, Hiyama, K, Ishioka, S, Maeda, H, et al. Microsomal epoxide hydrolase genotypes and chronic obstructive pulmonary disease in Japanese. International Journal of Molecular Medicine 2000;5:49-53. 43. Rodriguez, F, Jardi, R, Costa, X, Juan, D, et al. Detection of polymorphisms at exons 3 (Tyr113->His) and 4 (His139~>Arg) of the microsomal epoxide hydrolase gene using fluorescence PCR method combined with melting curves analysis. Anal Biochem 2002;308:120. 44. Harrison, DJ, Cantlay, AM, Rae, F, Lamb, D, et al. Frequency of glutathione S-transferase M1 deletion in smokers with emphysema and lung cancer. Human & Experimental Toxicology 1997; 16: 356-60. 45. He, JQ, Ruan, J , Connett, JE, Anthonisen, NR, et al. Antioxidant gene polymorphisms and susceptibility to a rapid decline in lung function in smokers. Am J Respir Crit Care Med 2002;166:323-8. - 2 6 -46. Spicer, SS, Hardin, JH. Ultrastructure, cytochemistry, and function of neutrophil leukocyte granules. A review. Lab Invest 1969;20: 488-97. 47. Borregaard, N, Lollike, K, Kjeldsen, L, Sengelov, H, et al. Human neutrophil granules and secretory vesicles. Eur J Haematol 1993;51:187-98. 48. Ganz, T, Selsted, ME, Szklarek, D, Harwig, SS, et al. Defensins. Natural peptide antibiotics of human neutrophils. J Clin Invest 1985;76:1427-35. 49. Rice, WG, Ganz, T, Kinkade, JM, Jr., Selsted, ME, et al. Defensin-rich dense granules of human neutrophils. Blood 1987;70: 757-65. 50. Bruch, M, Bieth, JG. Influence of elastin on the inhibition of leucocyte elastase by alpha 1-proteinase inhibitor and bronchial inhibitor. Potent inhibition of elastin-bound elastase by bronchial inhibitor. Biochem J 1986;238: 269-73. 51. Weiss, SJ. Tissue destruction by neutrophils. N Engl J Med 1989;320: 365-76. 52. Henson, PM, Johnston, RB, Jr. Tissue injury in inflammation. Oxidants, proteinases, and cationic proteins. J Clin Invest 1987;79: 669-74. 53. Hunninghake, GW, Crystal, RG. Cigarette smoking and lung destruction. Accumulation of neutrophils in the lungs of cigarette smokers. Am Rev Respir Dis 1983;128:833-8. 54. Keatings, VM, Collins, PD, Scott, DM, Barnes, PJ. Differences in interleukin-8 and tumor necrosis factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Respir Crit Care Med 1996;153: 530-4. 55. Burnett, D, Chamba, A, Hill, SL, Stockley, RA. Neutrophils from subjects with chronic obstructive lung disease show enhanced chemotaxis and extracellular proteolysis. Lancet 1987;2:1043-6. 56. Snider, GL, Stone, PJ, Lucey, EC, Breuer, R, et al. Eglin-c, a polypeptide derived from the medicinal leech, prevents human neutrophil elastase-induced emphysema and bronchial secretory cell metaplasia in the hamster. Am Rev Respir Dis 1985;132: 1155-61. 57. Kao, RC, Wehner, NG, Skubitz, KM, Gray, BH, et al. Proteinase 3. A distinct human polymorphonuclear leukocyte proteinase that produces emphysema in hamsters. J Clin Invest 1988;82:1963-73. - 2 7 -58. Shapiro, SD, Goldstein, NM, Houghton, AM, Kobayashi, DK, et al. Neutrophil elastase contributes to cigarette smoke-induced emphysema in mice. Am J Pathol 2003;163:2329-35. 59. Suzuki, T, Wang, W, Lin, JT, Shirato, K, et al. Aerosolized human neutrophil elastase induces airway constriction and hyperresponsiveness with protection by intravenous pretreatment with half-length secretory leukoprotease inhibitor. Am J Respir Crit Care Med 1996;153:1405-11. 60. Smallman, LA, Hill, SL, Stockley, RA. Reduction of ciliary beat frequency in vitro by sputum from patients with bronchiectasis: a serine proteinase effect. Thorax 1984;39: 663-7. 61. Lucey, EC, Stone, PJ, Breuer, R, Christensen, TG, et al. Effect of combined human neutrophil cathepsin G and elastase on induction of secretory cell metaplasia and emphysema in hamsters, with in vitro observations on elastolysis by these enzymes. Am Rev Respir Dis 1985;132: 362-6. 62. Sommerhoff, CP, Nadel, JA, Basbaum, CB, Caughey, GH. Neutrophil elastase and cathepsin G stimulate secretion from cultured bovine airway gland serous cells. J Clin Invest 1990;85: 682-9. 63. MacNee, W. Pulmonary and systemic oxidant/antioxidant imbalance in chronic obstructive pulmonary disease. Proc Am Thorac Soc 2005;2: 50-60. 64. Hubbard, RC, Fells, G, Gadek, J, Pacholok, S, et al. Neutrophil accumulation in the lung in alpha 1-antitrypsin deficiency. Spontaneous release of leukotriene B4 by alveolar macrophages. J Clin Invest 1991 ;88:891-7. 65. Mio, T, Romberger, DJ, Thompson, AB, Robbins, RA, et al. Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells. Am J Respir Crit Care Med 1997; 155:1770-6. 66. Oltmanns, U, Chung, KF, Walters, M, John, M, et al. Cigarette smoke induces IL-8, but inhibits eotaxin and RANTES release from airway smooth muscle. Respir Res 2005;6: 74. 67. Numanami, H, Koyama, S, Nelson, DK, Hoyt, JC, et al. Serine protease inhibitors modulate smoke-induced chemokine release from human lung fibroblasts. Am J Respir Cell Mol Biol 2003;29:613-9. - 28 -68. Baggiolini, M, Dewald, B, Moser, B. Human chemokines: an update. Annu Rev Immunol 1997;15:675-705. 69. Sengelov, H, Kjeldsen, L, Borregaard, N. Control of exocytosis in early neutrophil activation. J Immunol 1993;150:1535-43. 70. Faurschou, M, Borregaard, N. Neutrophil granules and secretory vesicles in inflammation. Microbes Infect 2003;5:1317-27. 71. Rothman, JE. The protein machinery of vesicle budding and fusion. Protein Sci 1996;5: 185-94. 72. Brumell, JH, Volchuk, A, Sengelov, H, Borregaard, N, et al. Subcellular distribution of docking/fusion proteins in neutrophils, secretory cells with multiple exocytic compartments. J Immunol 1995;155:5750-9. 73. Martin-Martin, B, Nabokina, SM, Blasi, J , Lazo, PA, et al. Involvement of SNAP-23 and syntaxin 6 in human neutrophil exocytosis. Blood 2000;96: 2574-83. 74. Nabokina, S, Egea, G, Blasi, J , Mollinedo, F. Intracellular location of SNAP-25 in human neutrophils. Biochem Biophys Res Commun 1997;239:592-7. 75. Rubinstein, E, Le Naour, F, Lagaudriere-Gesbert, C, Billard, M, et al. CD9, CD63, CD81, and CD82 are components of a surface tetraspan network connected to HLA-DR and VLA integrins. Eur J Immunol 1996;26:2657-65. 76. Metzelaar, MJ, Wijngaard, PL, Peters, PJ, Sixma, JJ, et al. CD63 antigen. A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intracellular antigens in eukaryotic cells. J Biol Chem 1991 ;266: 3239-45. 77. Hotta, H, Ross, AH, Huebner, K, Isobe, M, et al. Molecular cloning and characterization of an antigen associated with early stages of melanoma tumor progression. Cancer Res 1988;48: 2955-62. 78. Nishibori, M, Cham, B, McNicol, A, Shalev, A, et al. The protein CD63 is in platelet dense granules, is deficient in a patient with Hermansky-Pudlak syndrome, and appears identical to granulophysin. J Clin Invest 1993;91:1775-82. 79. Knol, EF, Mul, FP, Jansen, H, Calafat, J , et al. Monitoring human basophil activation via CD63 monoclonal antibody 435. J Allergy Clin Immunol 1991 ;88: 328-38. 80. Furuno, T, Teshima, R, Kitani, S, Sawada, J , et al. Surface expression of CD63 antigen (AD1 antigen) in P815 mastocytoma cells by transfected IgE receptors. Biochem Biophys Res Commun 1996;219: 740-4. - 2 9 -81. Valent, P, Schernthaner, GH, Sperr, WR, Fritsch, G, et al. Variable expression of activation-linked surface antigens on human mast cells in health and disease. Immunol Rev 2001 ;179: 74-81. 82. Mahmudi-Azer, S, Downey, GP, Moqbel, R. Translocation of the tetraspanin CD63 in association with human eosinophil mediator release. Blood 2002;99:4039-47. 83. Joseph, JE, Harrison, P, Mackie, IJ, Machin, SJ. Platelet activation markers and the primary antiphospholipid syndrome (PAPS). Lupus 1998;7 Suppl 2: S48-51. 84. Kuijpers, TW, Tool, AT, van der Schoot, CE, Ginsel, LA, et al. Membrane surface antigen expression on neutrophils: a reappraisal of the use of surface markers for neutrophil activation. Blood 1991 ;78:1105-11. 85. Ziegler, SF, Marth, JD, Lewis, DB, Perlmutter, RM. Novel protein-tyrosine kinase gene (hck) preferentially expressed in cells of hematopoietic origin. Mol Cell Biol 1987;7: 2276-85. 86. Mohn, H, Le Cabec, V, Fischer, S, Maridonneau-Parini, I. The src-family protein-tyrosine kinase p59hck is located on the secretory granules in human neutrophils and translocates towards the phagosome during cell activation. Biochem J 1995;309 ( Pt 2): 657-65. 87. Yan, SR, Huang, M, Berton, G. Signaling by adhesion in human neutrophils: activation of the p72syk tyrosine kinase and formation of protein complexes containing p72syk and Src family kinases in neutrophils spreading over fibrinogen. J Immunol 1997;158:1902-10. 88. Mocsai, A, Ligeti, E, Lowell, CA, Berton, G. Adhesion-dependent degranulation of neutrophils requires the Src family kinases Fgr and Hck. J Immunol 1999;162:1120-6. 89. Lowell, CA, Soriano, P, Varmus, HE. Functional overlap in the src gene family: inactivation of hck and fgr impairs natural immunity. Genes Dev 1994;8: 387-98. 90. Gutkind, JS, Robbins, KC. Translocation of the FGR protein-tyrosine kinase as a consequence of neutrophil activation. Proc Natl Acad Sci U S A 1989;86:8783-7. 91. Welch, H, Maridonneau-Parini, I. Hck is activated by opsonized zymosan and A23187 in distinct subcellular fractions of human granulocytes. J Biol Chem 1997;272: 102-9. - 3 0 -92. Ernst, M, Inglese, M, Scholz, GM, Harder, KW, et al. Constitutive activation of the SRC family kinase Hck results in spontaneous pulmonary inflammation and an enhanced innate immune response. J Exp Med 2002;196:589-604. 93. Shinohara, T, Dietzschold, B, Craft, CM, Wistow, G, et al. Primary and secondary structure of bovine retinal S antigen (48-kDa protein). Proc Natl Acad Sci U S A 1987;84: 6975-9. 94. Yamaki, K, Takahashi, Y, Sakuragi, S, Matsubara, K. Molecular cloning of the S-antigen cDNAfrom bovine retina. Biochem Biophys Res Commun 1987;142: 904-10. 95. Lohse, MJ, Benovic, JL, Codina, J , Caron, MG, et al. beta-Arrestin: a protein that regulates beta-adrenergic receptor function. Science 1990;248:1547-50. 96. Attramadal, H, Arriza, JL, Aoki, C, Dawson, TM, et al. Beta-arrestin2, a novel member of the arrestin/beta-arrestin gene family. J Biol Chem 1992;267:17882-90. 97. Kohout, TA, Lin, FS, Perry, SJ, Conner, DA, et al. beta-Arrestin 1 and 2 differentially regulate heptahelical receptor signaling and trafficking. Proc Natl Acad Sci U S A2001;98:1601-6. 98. Kohout, TA, Lefkowitz, RJ. Regulation of G protein-coupled receptor kinases and arrestins during receptor desensitization. Mol Pharmacol 2003;63: 9-18. 99. Luttrell, LM, Roudabush, FL, Choy, EW, Miller, WE, et al. Activation and targeting of extracellular signal-regulated kinases by beta-arrestin scaffolds. Proc Natl Acad Sci U S A 2001 ;98: 2449-54. 100. DeFea, KA, Zalevsky, J , Thoma, MS, Dery, O, et al. beta-arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2. J Cell Biol 2000;148:1267-81. 101. McDonald, PH, Chow, CW, Miller, WE, Laporte, SA, et al. Beta-arrestin 2: a receptor-regulated MAPK scaffold for the activation of JNK3. Science 2000;290:1574-7. 102. Retamales, I, Elliott, WM, Meshi, B, Coxson, HO, et al. Amplification of inflammation in emphysema and its association with latent adenoviral infection. Am J Respir Crit Care Med 2001 ;164:469-73. 103. Finkelstein, R, Fraser, RS, Ghezzo, H, Cosio, MG. Alveolar inflammation and its relation to emphysema in smokers. American Journal of Respiratory & Critical Care Medicine 1995;152:1666-72. -31 -104. Fraig, M, Shreesha, U, Savici, D, Katzenstein, AL. Respiratory bronchiolitis: a clinicopathologic study in current smokers, ex-smokers, and never-smokers. Am J Surg Pathol 2002;26: 647-53. 105. Di Stefano, A, Capelli, A, Lusuardi, M, Balbo, P, et al. Severity of airflow limitation is associated with severity of airway inflammation in smokers. Am J Respir Crit Care Med 1998;158: 1277-85. 106. Barnes, P (2005) Chronic obstructive pulmonary disease. Taylor & Francis. 107. Lim, S, Roche, N, Oliver, BG, Mattos, W, et al. Balance of matrix metalloprotease-9 and tissue inhibitor of metalloprotease-1 from alveolar macrophages in cigarette smokers. Regulation by interleukin-10. Am J Respir Crit Care Med 2000;162:1355-60. 108. Russell, RE, Thorley, A, Culpitt, SV, Dodd, S, et al. Alveolar macrophage-mediated elastolysis: roles of matrix metalloproteinases, cysteine, and serine proteases. Am J Physiol Lung Cell Mol Physiol 2002;283: L867-73. 109. Martin, TR, Raghu, G, Maunder, RJ, Springmeyer, SC. The effects of chronic bronchitis and chronic air-flow obstruction on lung cell populations recovered by bronchoalveolar lavage. Am Rev Respir Dis 1985;132: 254-60. 110. O Shaughnessy, TC, Ansari, TW, Barnes, NC, Jeffery, PK. Inflammation in bronchial biopsies of subjects with chronic bronchitis: inverse relationship of CD8+ T lymphocytes with FEV1. Am J Respir Crit Care Med 1997;155:852-7. 111. Costabel, U, Maier, K, Teschler, H, Wang, YM. Local immune components in chronic obstructive pulmonary disease. Respiration 1992;59 Suppl 1:17-9. - 3 2 -2 SELECTION OF R E F E R E N C E GENES FOR GENE EXPRESSION STUDIES IN HUMAN PMNS BY REAL-TIME PCR 1 2.1 Background Polymorphonuclear leukocytes (PMNs) are the most numerous granulocytes in blood and are responsible for the first line of host defence. However, PMNs have frequently been implicated in the pathogenesis of many diseases because they can produce various cytokines, chemokines and other proinflammatory mediators [1, 2]. Numerous studies have been performed on the mechanisms that regulate the bioactivity of PMNs. Understanding patterns of expressed genes may provide insight into complex regulatory networks and help to identify genes implicated in diseases. Quantitative real time PCR is one of the most powerful quantification methods for gene expression analysis. Similar to other methods used in expression studies, data from samples are usually required to be normalized against a set of data or references to correct for the difference in the amount of starting materials. The genes used as references are often referred to as housekeeping genes, assuming that those genes are constitutively expressed in certain tissues or cells of interest and the level of expression is constant. However, the literature shows that the expression levels of the so called housekeeping genes may vary in different tissues, different cell types, and different disease stages [3-6]. Therefore, the selection of the reference genes is critical for the interpretation of the expression data. A version of this chapter has been published. Zhang X, Ding L, Sandford AJ. Selection of reference genes for gene expression studies in human neutrophils by real-time PCR. BMC Mol Biol. 2005 Feb 18; 6 (1):4 - 3 3 -In this study, we investigated 10 commonly used housekeeping genes (Table 2-1), and found that 5 of these genes are satisfactory references for gene expression studies in human PMNs. 2.2 Methods 2.2.1 Candidate genes for expression studies Ten housekeeping genes were selected from commonly used reference genes (ABL1, ACTB, B2M, GAPD, GNB2L1, HRPT1, PBGD, RPL32, TBP, and TUBB). Gene symbols and their full names, gene accession numbers as well as functions are listed in Table 2-1. These genes were chosen because they have different functions in order to avoid genes belonging to the same biological pathways that may be co-regulated. In selecting the genes to be analyzed, preference was given to pseudogene-free genes in the NCBI linked database. All the primers were designed by the software, Primer 3, (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). Hairpin structure and primer dimerization were analyzed by NetPrimer. Primers spanning at least one intron were chosen to minimize inaccuracies due to genomic DNA contamination. The length of the primers was from 18-mer to 22-mer, GC content was from 45% to 60%, and the expected PCR products range from 114 bp to 318 bp. If the genes have pseudogenes, primers were chosen according to the alignment results between the genes and the pseudogenes, so that the primers were unique to the genes and different from the pseudogenes (Table 2-2). -34 -2.2.2 Subjects and sample preparation A total of 15 volunteers were recruited (Table 2-3). All participants signed an informed consent document. 20 ml of peripheral blood was taken into heparinized tubes. Neutrophil isolation was performed by a Dextran-Ficoll sedimentation and centrifugation method [7] (see Chapter 2 for details). 2.2.3 RNA extraction and RT-PCR Total RNA was isolated using RNeasy Mini Kit (Qiagen) as described by the manufacturer. Genomic DNA was eliminated by RNase-free DNase I digestion (Qiagen) during the isolation procedure. Isolated total RNA was analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 pico labchip Kit (Agilent Technologies). First strand cDNA synthesis was carried out with Superscript RNase H" Reverse Transcriptase (Invitrogen) and random primers (Invitrogen) in a total volume of 20 ul. Reverse transcription was performed at 37 °C for 1 hour followed by 72 °C for 15 min (see Chapter 2 for details). 2.2.4 Amplification of gene transcripts To screen the basal expression patterns of the candidate genes in PMNs, three randomly selected samples of the 15 individuals were tested by PCR with the ten primer pairs (Table 2-2). The expression study was performed using a 384 well plate on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems) with QuantiTect SYBR Green PCR Kit (Qiagen). The reactions were performed according to the manufacturer's instructions with minor modifications. The PCR program was initiated at 95°C for 10 min to activate Taq - 3 5 -DNA polymerase, followed by 45 thermal cycles of 15 seconds at 94°C, 30 seconds at 58°C and 30 seconds at 72°C. Size analysis of the PCR products (dissociation analysis or meting curve analysis) was performed immediately after the real-time PCR. The temperature range used for the melting curve generation was from 60°C to 95°C. Each sample was analyzed in triplicate wells. In addition, all the reactions were further subject to electrophoresis on 2.5% agarose gels stained with ethidium bromide to confirm the expected PCR products. 2.2.5 Standard curves The amplified fragments from each primer pair were purified with QIAquick PCR purification Kit (Qiagen), and confirmed by DNA sequencing (University of British Columbia, NAPS Unit). The concentrations of the PCR products were quantified by a spectrophotometer (Perkin-Elmer Lambda 2 UV/VIS Spectrometer), which were further transformed to copy numbers based on the length and base composition of the PCR products. A ten-fold series dilution was made and 10 to 1,000,000 copies were used for generating standard curves in the real-time PCR, plotted as Ct values (cycle numbers of threshold or crossing points) versus logarithms of the given concentrations of the DNA templates. 2.2.6 Determination of Gene stability and expression levels in human PMNs Gene stability was evaluated using the geNorm software program (http://www.wzw.tum.de/gene-quantification/) [8]. Briefly, this approach relies on the principle that the expression ratio of two perfect reference genes would be identical in all samples in all experimental conditions or cell types. Variation in the expression ratios between different samples reflects the fact that one or both of the genes are not stably - 3 6 -expressed. Therefore, increasing variation in this ratio corresponds to decreasing expression stability. The geNorm program can be used to calculate the gene expression stability measure (M), which is the mean pair-wise variation for a gene compared with all other tested control genes. Genes with higher M values have greater variation in expression. The stepwise exclusion of the gene with the highest M value allows the ranking of the tested genes according to their expression stability. The proposed threshold for eliminating a gene as unstable was M> 0.5. In the final analysis, genes with M value lower than 0.5 were considered as stably expressed genes, and were used for normalization factor (NF) calculation. Using the NF we calculated and ranked the expression level of all the seven genes in our samples. 2.3 Results 2.3.1 RNA quality and quantity RNA analysis by an Agilent 2100 Bioanalyzer provided the size profiles and the concentration of the samples. All the RNA samples used in this study were of good quality despite the long neutrophil isolation procedure. Intact rRNA subunits of 28S and 18S were observed on both the gel electrophoresis and electrophotogram, indicating that the degradation of the RNA was minimal (see Chapter 2). 2.3.2 Expression patterns of the candidate genes in PMNs Initial screening for the gene expression pattern suggested that the 10 candidate housekeeping genes were differentially expressed in PMNs (Figure 2-1). Based on the band intensity of the PCR products, the two lowest expressed genes, two medium expressed genes and the three highest expressed genes were chosen for real-time PCR - 3 7 -analysis. ABL1, PBGD and TUBB were excluded from further evaluation due to their extremely low expression level. 2.3.3 Standard curve and real-time PCR Standard curves were generated by using copy number vs. the threshold cycle (Ct). The linear correlation coefficient (R2) of all the seven genes ranged from 0.976 to 0.999. Based on the slopes of the standard curves, the amplification efficiencies of the standards were from 91% to ~100%, which were derived from the formula E=10 1 / s l ° P e - i . The Ct values of all the 7 genes in all the unknown samples were within 15.9 to 33.5 cycles, covered by the range of the standard curves. Electrophoresis analysis of all the amplified products from real-time PCR showed a single band with the expected sizes, and no primer dimer was observed. The dissociation plots provided by the ABI Prism 7900HT also indicated a single peak in all the reactions. The amplification plots and dissociation curves are shown in Figure 2-2. 2.3.4 The stability and expression level of reference genes in the PMNs The gene expression levels were measured by real-time PCR, and the expression stabilities were evaluated by the M value of GeNorm. The ranking of the expression stability in these genes was (from the most stable to the least stable): GNB2L1, HPRT1, RPL32, ACTB, B2M, GAPD and TBP (Figure 2). The M values of GNB2L1, HPRT1, RPL32, ACTB, and B2M were lower than 0.5, and therefore these genes were concluded to be stably expressed housekeeping genes in PMNs. A normalization factor (NF) was calculated based on the geometric mean of the copy numbers of these 5 selected reference genes in each sample. After normalization - 3 8 -against the NF, the ranking of the relative expression levels was (from high to low): B2M, ACTB, GAPD, RPL32, GNB2L1, TBP, and HPRT1 (Figure 3). Based on both the expression stability and expression level, our data suggested that B2M and ACTB can be used as reference genes for high abundance gene transcripts, RPL32 and GNB2L1 for medium abundance transcripts, and HPRT1 for low abundance transcripts in gene expression studies. 2.4 Discussion Real-time PCR is one of the most sensitive and flexible quantification methods for gene expression analysis. It provides simultaneous measurement of gene expression in many different samples for a number of genes. However, many factors in real-time PCR may affect the results, including the selection of the reference genes. An ideal reference gene should be expressed at a constant level among different tissues of an organism, at all stages of development, and should be unaffected by the experimental treatment. However, no one single gene is expressed at such a constant level in all these situations [4, 9]. For example, ACTB, GAPD, 18S and 28S rRNA are the most commonly used reference genes, but a number of studies have provided solid evidence that their transcription levels vary significantly between different individuals, different cell types, different developmental stages, and different experimental conditions [3-6]. Therefore, thorough validation of candidate reference genes is critical for accurate analysis of gene expression. - 3 9 -It is also well known that RNA quality and quantity are critical for successful gene expression analysis. Degraded and inaccurately quantified RNA would give misleading results. In this study, total RNA was extracted from isolated human PMNs, and usually it takes 2-3 hours from drawing the blood to obtaining the pure PMNs. RNA degradation is frequently observed. For this reason we performed careful RNA analysis by using an Agilent 2100 Bioanalyzer (Agilent Technologies) before the gene expression study. The results indicated our RNA samples were of good quality. Other quantification methods which need a microgram-level of RNA were not practical for our study because the amount of RNA extracted from the PMNs from 10 ml blood was very limited (around 3-5 Wl)-DNA contamination is another important factor that affects the accuracy of gene expression analysis. In this study, the following steps were taken to prevent and monitor DNA contamination: (1) RNase-free DNase I treatment on all the RNA samples; (2) The primers were designed to be able to distinguish the PCR product derived from mRNA or genomic DNA (Table 2); (3) Dissociation analysis by ABI Prism 7900HT; (4) Gel electrophoresis of all the amplified PCR products. With all these precautions in place we were confident that there was no detectable DNA contamination. The signal from SYBR I was specifically from the desired amplicons, not from artifacts (primer dimers or genomic DNA contamination). For the reasons discussed above, we have confidence that our gene expression results were accurate and reliable, and we further analyzed the expression stability and expression level. The principle that the expression ratio of two ideal reference genes - 4 0 -should be identical in all samples is well established. Based on this principle we found GNB2L1, HPRT1, RPL32, ACTB, and B2M were stably expressed in the PMNs, and they were used for the calculation of a normalization factor (NF). After normalization we found B2M was the most highly expressed, followed by ACTB, RPL32, GNB2L1, and HPRT1 was the least expressed. As the expression level of the reference genes may be an additional factor for consideration in the process of reference gene selection, this ranking of the relative expression level of the candidate reference genes may be informative for future gene expression studies in PMNs. 2.5 Conclusions To our knowledge, this is the first detailed study of the stability and level of reference gene expression in PMNs. We found GNB2L1, HPRT1, RPL32, ACTB, and B2M are good choices for reference gene(s) selection. B2M and ACTB can be used for high-abundance mRNA, RPL32 and GNB2L1 for medium-abundance mRNA, and HPRT1 for low-abundance mRNA in expression studies of PMNs. For more accurate normalization, as suggested by other authors [8], we recommend a combination of the stably expressed genes GNB2L1, HPRT1, RPL32, ACTB, and B2M as a panel of reference genes for the normalization. 2.6 Abbreviations ACTB, beta-actin; ALB1, Abelson murine leukemia viral oncogene homolog 1; B2M, beta-2-microglobulin; cDNA, complementary DNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GNB2L1 (Guanine nucleotide binding protein, beta polypeptide 2-like 1; HPRT1, Hypoxanthine phosphoribosyltransferase 1; NCBI, National Center for Biotechnology Information; PCR, polymerase chain reactions; PBGD, porphobilinogen -41 -deaminase; RPL32, ribosomal protein L32; RT-PCR, reverse transcription-chain reactions; TBP, TATA-binding protein; TUBB, beta-tubulin Table 2-1 10 selected candidate reference genes Gene symbol Gene Name Accession Number Gene synonyms mRNA genomic DNA ruiioiiun ABL1 Abelson murine leukemia vira oncogene homolog NM_007313 NT_035014 Cytoplasmic and nuclear protein tyrosine kinase ABL .JTK7 , 150, c-ABL, Beta-actin NM_001101 NT_007819 Cytoskeletal structural protein B2M Bata-2-microglobulin NM_004048 NT_030828 Cytoskeletal protein involved in cell locomotion G A P D Glyceraldehyde-3-phosphate dehydrogenase NM_002046 NT_009759 Glycolytic enzyme G3PD, G A P D H GNB2L1 Guanine nucleotide binding protein, (3-peptide 2-like 1 NM_006098 NT_077451 Involved in binding and anchorage of protein kinase C H12.3, R A C K 1 , Gnb2-rs1 HPRT1 Hypoxanthine phosphoribosyltransferase 1 NM_000194 NT_011786 Constitutively expressed at low levels, involved in the metabolic salvage of purines in mammals. HPRT, H G P R T P B G D Porphobilinogen deaminase NM_000190 NT_033899 Deficiency of porphobilinogen deaminase results in acute intermittent porphyria H M B S , AIP, U P S RPL32 Ribosomal protein L32 NM_000994 NT_005927 Member of the 80 different ribosome proteins T B P TATA-binding protein NM_003194 NT_007583 Involved in the activation of basal transcription from class II promoter GTF2D, SCA17, TFIID, GTF2D1 TUBB Beta-tubulin NM_001069 NT_034880 Member of the tubulin family of structural proteins - 4 3 -Table 2 - 2 Primers for real time PCR Gene symbol Length Position in cDNA Sequence (5'-3') ABL1 20 Exon 7 1217-1236 TGACAGGGGACACCTACACA 20 Exon 9 1535-1516 TCAAAGGCTTGGTGGATTTC ACTB 20 Exon 2 210-229 CATCGAGCACGGCATCGTCA 21 Exon 3 420-400 TAGCACAGCCTGGATAGCAAC B2M 19 Exon 2 268-287 ACTGAATTCACCCCCACTGA 20 Exon 4 381-362 CCTCCATGATGCTGCTTACA GAPD 20 Exon 7 728-747 TGGACCTGACCTGCCGTCTA 22 Exon 8 970-948 CCCTGTTGCTGTAGCCAAATTC GNB2L1 20 Exon 3 327-346 GAGTGTGGCCTTCTCCTCTG 20 Exon 5 550-531 GCTTGCAGTTAGCCAGGTTC HRPT1 20 Exon 4 322-341 GACCAGTCAACAGGGGACAT 22 Exon 7 516-495 AACACTTCGTGGGGTCCTTTTC PBGD 18 Exon 11-12 764-781 AGGATGGGCAACTGTACC 20 Exon 13 995-976 GTTTTGGCTCCTTTGCTCAG RPL32 19 Exon 1/2 33-51 CATCTCCTTCTCGGCATCA 20 Exon 3 185-166 AACCCTGTTGTCAATGCCTC TBP 20 Exon 4 623-642 GAACCACGGCACTGATTTTC 20 Exon 5 780-761 CCCCACCATGTTCTGAATCT TUBB 20 Exon 3 240-259 CTTCGGCCAGATCTTCAGAC 20 Exon 4 416-397 AGAGAGTGGGTCAGCTGGAA Table 2-3 Characteristics of the study subjects Gender Diagnosis No. Age (F/M) Allergy Asthma Healthy Asian 6 4/2 33±3 3 - 3 Caucasian 9 3/6 33±9 3 2 4 500 bp 100 bp Figure 2-1 Preliminary screening the gene expression pattern of 10 potential housekeeping gene in PMNs Ten candidate housekeeping genes were amplified using same amount of cDNA derived from PMNs. Different expression patterns were observed. There was no amplification of the PBGD and TUBB genes, and the ABL1 showed the weakest band. These three genes were excluded from the study. All the other genes were subject to further experiments. -46-Figure 2-3 Amplification plots and dissociation curves of the 7 candidate reference genes - 4 7 -2.5 A o i •c > 1.5 at > t H 0.5 0.367 2.861 0.373 0.381 0.425 0.499 0 5 5 6 GNB2L1 HPRT1 RPL32 ACTB B2M GAPD TBP Figure 2-3 Gene expression stability of seven candidate reference genes in PMNs The expression stabilities were evaluated by the geNorm program. The threshold for eliminating a gene as unstable was M> 0.5. - 4 8 -HPRT1 TBP 6NB2L1 RPL32 GAPD ACTB B2M Figure 2-4 The relative expression levels of the 7 candidate reference genes The relative expression level was normalized against Normalization Factors from the 5 most stable genes (HPRT1, GNB2L1, RPL32, ACTB, and B2M) provided by geNorm. HPRT1 was the lowest expressed gene, and B2M was the highest among the candidate genes in PMNs. - 4 9 -2.7 References 1. Cassatella MA. The production of cytokines by polymorphonuclear neutrophils. Immunol Today 1995;16: 21-6. 2. Cassatella MA. Neutrophil-derived proteins: selling cytokines by the pound. Adv Immunol 1999;73: 369-509. 3. Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M. Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiol Genomics 2000;2:143-7. 4. Thellin O, Zorzi W, Lakaye B, De Borman B, et al. Housekeeping genes as internal standards: use and limits. J Biotechnol 1999;75:291-5. 5. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000;25:169-93. 6. Suzuki T, Higgins PJ, Crawford DR. Control selection for RNA quantitation. Biotechniques 2000;29:332-7. 7. Le Cabec V, Maridonneau-Parini I. Annexin 3 is associated with cytoplasmic granules in neutrophils and monocytes and translocates to the plasma membrane in activated cells. Biochem J 1994;303 ( Pt 2): 481-7. 8. Vandesompele J , De Preter K, Pattyn F, Poppe B, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3: RESEARCH0034. 9. Haberhausen G, Pinsl J , Kuhn CC, Markert-Hahn C. Comparative study of different standardization concepts in quantitative competitive reverse transcription-PCR assays. J Clin Microbiol 1998;36: 628-33. - 5 0 -3 ASSOCIATION OF GENETIC POLYMORPHISMS OF THE CD63 G E N E WITH G E N E EXPRESSION AND COPD 3.1 Introduction Polymorphonuclear leukocytes (PMNs) are believed to be the major effector cells in the chronic airway inflammation of COPD [1]. PMNs synthesize a large number of proinflammatory cytokines/chemokines, growth factors and lipid mediators, which are pre-stored in various granule populations and are released to the extracellular space upon cell activation. PMN degranulation is closely associated with tissue damage and development of inflammation [2, 3]. The serine proteinases in azurophilic granules are capable of degrading almost all the components of the extracellular matrix [4-6]. Therefore, PMN hyperactivity has been considered to be important in COPD development. Unrestrained serine proteases in general and elastase specifically, are currently believed to play a crucial role in the pathogenesis of pulmonary emphysema [7]. The tetraspanin CD63 is a highly glycosylated protein and is widely expressed. Although the precise biological function remains largely unknown, a number of studies have suggested that CD63 has numerous interactions with other molecules, such as other tetraspanins [8]; the MHC class II molecules HLA-DR, HLA-DM, and HLA-DO [9]; integrins [10]; and phosphatidylinositol 4-kinase [11] [12]. In addition, CD63 is involved in endocytosis by means of the interaction of its tyrosine-based motif with adaptor protein complexes 2 and 3 (AP-2 and AP-3), which participate in the clathrin-mediated endocytosis and lysosomal targeting, respectively [13,14]. In peripheral blood leukocytes -51 -CD63 is most abundantly expressed in PMNs. It has been considered as a membrane marker of azurophilic granules and is involved in the process of PMN phagocytosis and azurophilic granule exocytosis. Upregulation of CD63 on the plasma membrane of PMN has been considered as a reflection of PMN activation and azurophilic granule release [15]. Since PMNs are the major effector cells in chronic airway inflammation in COPD and CD63 has been implicated in the process of azurophilic granule degranulation we hypothesized that genetic polymorphism modulate the level of gene expression of CD63, and in consequence, affect the mobilization and mediator release of azurophilic granules, and influence the susceptibility to COPD. Thus, in this study we investigated genetic polymorphisms of the CD63 gene and assessed their potential correlation with CD63 gene expression, the release of MPO upon IL-8 stimulation and the presence of airflow obstruction among smokers. 3.2 Materials and Methods 3.2.1 Study Subjects The genotyping cohort used for these studies consisted of 35 Caucasians. The gene expression cohort consisted of 95 healthy volunteers and 70 COPD patients (See Chapter 1 for details). 3.2.2 SNP selection and genotyping The CD63 gene is located on chromosome 12q12-q13 and is 3.5 kb in length. At the time of these studies, a total of approximately 30 putative polymorphisms were reported in the - 5 2 -NCBI SNP database but most of them were not validated. In this study, we mainly focused on 11 potential polymorphisms. The selection of these 11 polymorphisms was mainly based on their location. Polymorphisms in the promoter region may affect gene expression level and nonsynonymous SNPs in the coding region may affect the structure and function of the coded protein. Therefore, 4 nonsynonymous polymorphisms, and 2 promoter SNPs were chosen. In addition, 2 intronic SNPs (located in the center of the gene), 2 SNPs located in the 3' genomic region, and 1 SNP located downstream of the CD63 gene (rs3138144) were included to provide sufficient marker density for determination of the Linkage Disequilibrium (LD) pattern of the gene (Figure 3-1). The genotypes were determined by RFLP, allelic-specific PCR, or TaqMan genotyping assays. The primers and restriction enzyme used in these experiments are listed in Table 3-1. The detailed genotyping protocol for -1523C/T and 1361C/G is shown in Table 3-2. The TaqMan genotype assays for 1361C/G and 8041C/G were shown in Table 3-3. All the investigated polymorphisms were further analyzed by automated sequencing to validate the genotyping results. 3.2.3 PMN isolation and stimulation PMNs were isolated by a Dextran-Ficoll sedimentation and centrifugation method [16]. The time course study of PMN MPO release was performed at 2 min, 5 min, 10 min, and 30 min at 37CC by other researchs in our laboratory, and finally 2 min for 10nM fMLP priming and 10 min for 100ng/ml IL-8 stimulation was selected. Genomic DNA was extracted from the mononuclear cells using a DNeasy Tissue Kit (Qiagen). - 5 3 -3.2.4 RNA extraction and cDNA synthesis Total RNA was isolated using an RNeasy Mini Kit (Qiagen; ON, Canada) as described by the manufacturer. Isolated RNA was analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 Nano Labchip Kit (Agilent Technologies; CA, USA). First strand cDNA synthesis was carried out with Superscript RNase FT Reverse Transcriptase (Invitrogen, ON, Canada) and random primers (Invitrogen, ON, Canada) according to the manufacturer's instructions (See appendices for details). 3.2.5 mRNA quantification of CD63 To measure the mRNA level for CD63 an assay-on-demand gene expression kit for the CD63 gene (Hs00156390_m1, Applied Biosystems, CA, USA) was used, p-actin was selected as the reference gene for normalization (Applied Biosystems; CA, USA). The mRNA level of CD63 of each subject was expressed as a ratio of CD63 level over p-actin level (See appendices for details). 3.2.6 Flow cytometry In order to observe the surface and total CD63 expression intact PMNs and permeabilized PMNs were subject to immunostaining and flow cytometry analysis (See appendices for details). 3.2.7 PMN mediator release assay The released myeloperoxidase (MPO) were measured as previously described [17, 18] ( See appendices for details). - 54 -3.2.8 Association study in the Lung Health Study cohort The 1361C/G polymorphism was used in an association study in the LHS cohort. For detailed information about LHS cohort please see Chapter 1. 3.2.9 Statistical analysis Assessment of Hardy-Weinberg equilibrium was performed using the R software package (www.r-project.org/). The evaluation of association of each individual polymorphism with mRNA and protein level was done using the non-parametric Wilcoxon test. The comparison of the level of mRNA and protein of CD63 before and after IL-8 stimulation was done by paired t-test. Association of the polymorphisms with the rate of decline of lung function and the baseline of lung function was evaluated using a logistic regression model. 3.3 Results 3.3.1 Genetic polymorphisms of the CD63 gene Three of the 11 putative polymorphisms were detected in the genotyping cohort. They were -1523C/T (rs772254) in the promoter region, 1361C/G (rs3138132) in intron 1 and 8041C/G (rs3138144) in the 3' genomic region of the CD63 gene (Figure 3-2 and Figure 3-3). The genotype and allele frequencies in healthy individuals and COPD patients are shown in Table 3-4. The minor allele frequencies for -1523C/T and 1361 C/G polymorphisms were approximately 6% in Caucasians and 15-20% in Asians. The 8041 C/G polymorphism was more prevalent with a minor allele frequency of around 50% in both Asians and Caucasians. - 5 5 -The observed genotype frequencies of the three polymorphisms conformed to what is expected from Hardy-Weinberg equilibrium. The -1523C/T and 1361C/G were significantly associated with each other (P<0.0001). The LD estimation indicated the R2=1 in Caucasians and 0.5 in Asians. Only one allele was detected in all other putative polymorphisms assessed by either RFLP or sequencing. 3.3.2 CD63 expression pattern in PMNs In both healthy individuals and COPD patients there was CD63 expression on the surface of PMNs. A dramatic increase in CD63 staining was observed upon permeabilization of the PMNs, which suggested that majority of CD63 was present in the cytoplasm and/or on intracellular granules (Figure 3-4). Interestingly, the level of total CD63 protein was differentially expressed among different ethnic groups. The Caucasians had higher level of CD63 protein when compared with the Asians (214.25l13.35 vs. 162.03110.82, P=0.016) (Figure 3-5). Since the healthy volunteers and COPD subjects in this study were not well matched for age and smoking status, we did not make a comparison of CD63 expression between these two groups. Upon IL-8 stimulation, cell surface CD63 and total CD63 were significantly increased compared to the baseline, whereas the mRNA level of CD63 was markedly decreased (Figure 3-6). 3.3.3 CD63 genetic polymorphisms and the gene expression and PMN MPO release There was no significant difference in the levels of mRNA and CD63 protein between different genotypes for the 3 detected polymorphisms in the healthy Caucasian and Asian subjects (Table 3-5). SNP 1361C/G was associated with differential expression of CD63 - 5 6 -mRNA in the COPD patients under resting conditions. The CC genotype (0.36±0.01) was associated with a lower level of CD63 mRNA compared with the CG genotype (0.42±0.02) (P=0.04). However, there was no association observed at the protein level either under resting conditions or after stimulation (Table 3-6 and Table 3-7). Moreover, there was no association between the change in level of CD63 expression upon IL-8 stimulation and the genetic polymorphisms (Figure 3-7). Upon chemokine stimulation approximately 5-10% of the total MPO was released from PMNs. In healthy Caucasian individuals, the 8041 C/G polymorphism was associated with the amount of released MPO (P=0.007) (Figure 3-8). The group with CC genotype had more MPO released (9.05%±1.11%) compared with the group with GG genotype (4.94%±0.68%). There was no association observed between the polymorphisms and the amount of released MPO in the COPD patients (Figure 3-8). Due to the availability of DNA samples of the LHS cohort only one SNP could be investigated. The 1361 C/G polymorphism and the -1523C/T polymorphism were high LD in both the healthy Caucasian individuals and the COPD patients, the 1361 C/G polymorphism was finally assessed in the LHS cohort. There was no association between the 1361 C/G polymorphism and the rate of decline of lung function (P=0.77) (Table 3-8), and the level of baseline of lung function (P=0.25) (Table 3-9). 3.4 Discussion CD63 has been found to interact with a diverse array of molecules to form the "tetraspanin web", and is involved in cell adhesion, spreading and release of mediators - 57 -[19, 20]. As a membrane marker of azurophilic granules, CD63 is involved in the process of azurophilic granule exocytosis in PMNs. However, its precise biological function in this process is unclear. Looking for genetic mutations which lead to loss-of^function or gain-of-function phenotype is one way to provide insight into the physiology of the protein. In this study we systematically investigated genetic polymorphisms of the CD63 gene, CD63 expression pattern, and azurophilic granule exocytosis in PMNs, and assessed their potential correlation. The CD63 gene spans only 3.5 kb of the genomic region on chromosome 12q12-q13. We investigated 11 of the 30 putative mutations of the CD63 gene. The polymorphisms in the promoter region or intron may affect the processing of gene transcription or translation, and eventually lead to differential expression, whereas the nonsynonymous polymorphisms in exons will result in amino acid change and consequently may affect the protein's function. Both situations could lead to loss-of function or gain-of-function phenotype if this molecule is critical in the process which underlines the phenotype. A total of three polymorphisms were detected in both Caucasians and Asians among the eleven investigated polymorphisms. One was in the promoter region (-1523C/T), and one was in intron (1361C/G). However, their minor allele frequencies were lower in Caucasians (6%) compared with Asians (15-20%), and they were in perfect linkage disequilibrium in Caucasian healthy individuals (R2=1) and marked a haplotype block. The third detected polymorphism (8041C/G) was located approximately 4 kb downstream of the CD63 gene. Its minor allele frequency was around 50% in both ethnic groups. We could not detect other investigated polymorphisms including the 4 nonsynonymous SNPs - 5 8 -reported in the NCBI SNP database. This implies that the polymorphisms are very rare or perhaps do not exist (i.e. represent sequencing errors). Since CD63 has been considered as an attractive candidate for the rare autosomal recessive disorder Hermansky-Pudlak syndrome (HPS) Armstrong et al. looked for any mutations which could account for HPS pathogenesis by sequencing all the coding regions in both a healthy control and HPS cell lines, and they did not detect any mutation in exons either [21]. The mRNA and protein level of the CD63 in PMNs was investigated at resting and/or stimulated condition in both the healthy individuals and in the COPD patients. CD63 is expressed on the surface of PMNs, but predominantly located inside the cells [22, 23]. Upregulation of CD63 on the surface of PMNs has been considered as an excellent marker for azurophilic granule exocytosis, and the level of upregulation is related to the type of stimulants, and to the amount of mediator release from azurophilic granules. fMLP primed PMNs may show 3-5% release of azurophilic granule markers [15]. In this study we performed the MPO release assay, and we observed 5-10% MPO release and significant increase of surface CD63 protein after fMLP priming and IL-8 stimulation Interestingly, we found that CD63 protein expression has an ethnic difference. Under resting conditions the healthy Caucasians had more CD63 protein expressed on PMNs than the healthy Asians. After IL-8 stimulation at 37 °C for 10 min, the level of total CD63 protein was significantly upregulated, whereas the mRNA level was markedly decreased compared with the resting condition. This observation may reflect the fact that CD63 production is regulated at several levels. Study of the genomic structure of the CD63 gene has suggested that the 5-flanking region of exon 1 has features characteristic of - 5 9 -promoters of many house-keeping and growth-regulating genes, i.e. the promoter is highly GC rich and contains potential binding sites for transcription factors such as Sp1, AP-1, and ETF, but not a TATA box [24]. fMLP and IL-8 can significantly increase MAP kinase activity by a PKC-dependent pathway. On activation of MAP kinases, transcription factors present in the cytoplasm or nucleus are phosphorylated and activated, leading to expression of certain target genes resulting in a biological response. Niessen et al reported significant upregulation of CD63 in PMNs activated by fMLP and GTP [25]. On the other hand, we can speculate that the activation of MAP pathway and increased CD63 secretion may negatively affect the transcriptional activity of the transcription factors of the CD63 gene, or speed the degradation of CD63 mRNA and eventually result in a decrease in the amount of CD63 transcript. We investigated three polymorphisms to determine whether they were associated with the level of CD63 expression. We did not find any polymorphism associated with differential expression of the CD63 gene in the healthy Asian and Caucasian individuals. In the COPD patient cohort the 1361 C/G polymorphism was associated with the level of CD63 mRNA under resting conditions. The CC genotype was associated with lower CD63 mRNA compared with the CG genotype (0.36±0.01 vs. 0.42±0.02, P=0.04), but not with the level of CD63 protein. These data suggest that the 1361 C/G polymorphism or other linked loci have a functional effect on the transcription of the CD63 gene. It is also possible that the positive association was type I error. In order to evaluate whether genetic polymorphisms modulate the process of azurophilic granule exocytosis we performed MPO release assays and assessed their correlation. - 6 0 -Surprisingly, the 8041C/G SNP, approximately 4kb downstream of the CD63 gene, was associated with the amount of released MPO in healthy Caucasians. The CC genotype was associated with greater release of MPO than the GG genotype (9.05% ±1.11% vs. 4.94% ± 0.68% P=0.007). Although we do not know the reason for this association there are several speculations that can be made. CD63 is a small gene, and it was not very polymorphic. It is possible that genetic elements, such as silencers and enhancers, beyond the CD63 gene influence its expression and function, and one of these elements may be affected by the 8041 C/G polymorphism. Although we did not observe any association of 8041 C/G with the expression level of CD63 this polymorphism may still be functional, and this might be demonstrated with a larger sample size. Alternatively, 8041 C/G may be in linkage disequilibrium with other functional polymorphisms in nearby linked gene that is critical in the process of azurophilic granule exocytosis. For example, there is a gene downstream of CD63 that is involved in the biogenesis of specialized organelles such as melanosomes, platelet dense granules as well as PMN azurophilic granules (BLOC1S1) [26]. Interestingly, BLOC1S1 is part of the ubiquitously expressed multi-subunit protein complex, biogenesis of lysosome-related organelles complex-1 (BLOC-1), and other subunits in this complex area mutated in mouse models of HPS. In summary, the CD63 gene has few polymorphisms. The influence of these polymorphisms on CD63 expression is limited in human neutrophils, but remains to be determined in other cell types. The genomic region beyond the CD63 gene may be important for genetic regulation of CD63 expression and function. -61 -Table 3-1 Primers and restriction enzymes used for CD63 genotyping (Contig Accession # NT_029419) Reference SNP ID Forward primer Reverse primer Restriction enzyme rs3138134 cttctgtgcaccgctaagg agcaggtgatgagggttctg Ddel rs3138133 agctggatcccttgaggatt gactttgcgaaggtgttggt Ale I rs 1050043 tggtgcttttgtcctttgtg ctgctcagggttatctctta Sty] rs 1804041 gtactggcctgggagtgtgt cacctcgtagccacttctga 7sp509l rs1804040 agggtgctgaacaggaggta catcacctcgtagccacttc catcacctcgtagccacttt rs11574657 ttcacttaacaaccttcttctcca atcccacagcccacagtaac Taql rs2231467 acactgcttcgatcctggac tctgacctcaggtgatctgc Hinfl rs3138132 cccacttcaatttgctcctg ctcccagctcaattctctct Ddel rs12818008 cctcatgtgacgcggtaa cgcttctctgaaccagagtg Hpy188l rs772254 ctggccacactgtgaagaaa cccaacctgccatgtacttt Taql - 6 2 --2 Detailed CD63 genotyping protocol for the -1523C/T and 1361 C/G SNPs PCR Taq DNA Annealing Cut buffer Mg 2+ primers polymerase template temperature Cycles Restriction enzyme allele -1523C/T 1x 1.5mM 0.5 uM 0.5 units 100ng 57°C 30 10 unit of Taq I C 1361C/G 1x 1.5mM 0.5 uM 0.5 units 100ng 55°C 30 10 unit of Dctel C Tab le 3-3 T a q M a n C D 6 3 genotyp ing a s s a y s f rom A p p l i e d B i o s y s t e m s Forward primer Reverse primer Reporter 1 Reporter 2 1361 C /G A G G G C T C C G G A T G T G C A C VIC- T C T C C C A F A M - T C T C C C A (rs3138134) Custom made C A G C T C A A T T C T G G A G G A T A G T G A A C T G C C A A C T G C 8041 C / G (rs3138144) Kit from ABI C__11292963_10 VIC-C allele F A M - G allele - 6 4 -Table 3-4 Distribution of the detected CD63 polymorphisms in the study subjects Asian healthy individuals (N=35) Caucasian healthy individuals (N=60) Caucasian COPD patients (N=70) 1523C/T C C 21 (60%) 52 (86.7%) 61 (87.1%) CT 13(37.1%) 8(13.3%) 9(12.9%) TT 1 (2.9%) 0 0 T allele 21.4% 6.7% 6.4% 1361 C/G C C 26 (74.3%) 52 (86.7%) 61 (87.1%) C G 7(20.0%) 8(13.3%) 9(12.9%) G G 2 (5.7%) 0 0 G allele 15.7% 6.7% 6.4% 8041 C/G C C 8 (22.9%) 18(30.0%) 19(27.1%) C G 16(45.7%) 25 (41.7%) 35 (50.0%) G G 11 (31.4%) 17(28.3%) 16(22.9%) G allele 54.3% 49.2% 47.9% Hardy-Weinberg equilibrium was tested utilizing the R software package. The observed genotype frequencies conformed to those expected from Hardy-Weinberg equilibrium in both healthy individuals and COPD patients. - 6 5 -Table 3-5 CD63 genotypes and the corresponding CD63 mRNA and protein levels in healthy Caucasian and Asian individuals Mean of MFI of total No mRNA P value* CD63 P value** -1523C/T C C 21 0.47±0.05 0.15 163.52112.79 0.49 CT 13 0.35±0.05 164.69120.58 TT 1 0.56 96.00 Asian 1361 C/G C C 26 0.42±0.05 0.52 156.65111.37 0.49 C G 7 0.43±0.07 202.57127.87 G G 2 0.52±0.04 90.0016.00 8041 C/G C C 8 0.45±0.12 1 157.75122.46 0.5 C G 16 0.41 ±0.04 147.75113.87 G G 11 0.43±0.07 185.91122.40 -1523C/T C C 52 0.4810.04 0.43 212.87114.24 0.91 CT 8 0.6710.19 223.25140.68 White 1361 C/G C C 52 0.4810.04 0.43 212.87114.24 0.91 C G 8 0.6710.19 223.25140.68 8041 C/G C C 18 0.4610.07 0.56 224.83126.02 0.82 C G 25 0.4910.07 211.88120.21 G G 17 0.5810.09 206.53125.42 The mRNA and protein level of CD63 are expressed as mean ± SE. The mRNA level of CD63 was normalized by (3-actin. There was no association between different genotypes and level of mRNA and total CD63 in Caucasian and Asian healthy individuals when analyzed by the non-parametric Wilcoxon test. *P value for the comparison of mRNA ** P value for the comparison of total CD63 -66 -Table 3-6 Genotypes and the levels of mRNA and total CD63 under resting conditions in the COPD patients Genotype No Resting CD63 mRNA *P value Resting total CD63 **p value 1361 C/G C C 61 0.36±0.01 0.04 180.95114.48 0.54 C G 9 0.42±0.02 147.56119.23 -1523C/T C C 61 0.37±0.01 0.92 182.03i14.54 0.43 CT 9 0.38±0.03 140.22i14.31 8041 C/G C C 19 0.38±0.02 0.76 206.53+.29.98 0.23 C G 35 0.36±0.01 178.6i18.34 G G 16 0.38±0.02 136.94i14.77 The mRNA and protein level of CD63 are expressed as mean ± SE. SNP 1361C/T was associated with the mRNA level of CD63 under resting condition (P=0.04). There was no other association observed between different genotypes and mRNA and protein level of CD63 in the COPD patients when analyzed by non-parametric Wilcoxon test. *P value for the comparison of mRNA ** P value for the comparison of total CD63 -67 -Table 3-7 Genotypes and the levels of mRNA and total CD63 under stimulated conditions in the COPD patients Genotype No. Stimulated CD63 mRNA *P value Stimulated total CD63 **p value 1361 C/G C C 61 0.3110.01 0.19 290.63124.86 0.77 C G 9 0.2910.01 252144.66 -1523C/T C C 61 0.30±0.01 0.13 292.72125.42 0.88 CT 9 0.3510.02 237.78120.11 8041 C/G C C 19 0.29+0.02 0.41 304.58146.01 0.58 C G 35 0.3210.01 306.2135.74 G G 16 0.3010.01 218.25118.15 The value was mean±SE. There was no association between different genotypes and mRNA and protein level of CD63 after IL-8 stimulation among COPD patients when analyzed by the non-parametric Wilcoxon test. *P value for the comparison of mRNA ** P value for the comparison of total CD63 -68 -Table 3-8 CD63 genotype frequencies of the 1361 C/G polymorphism in the groups of fast and non decliners of lung function in the Lung Health Study Fast decline Slow decline P value C C 228 (84.76%) 244(82.71%) 0.77 C G 37(13.75%) 45(15.25%) G G 4(1.49%) 6 (2.03%) There was no association between the 1361 C/G polymorphism with the rate of decline of lung function (P=0.77) when analyzed by a regression model. - 6 9 -Table 3-9 CD63 genotype frequencies of the 1361 C/G polymorphism in the groups with high and low baseline of lung function in the Lung Health Study. High baseline Low baseline P value C C 448(85.17%) 437 (81.53%) 0.25 C G 71 (13.50%) 88(16.42%) G G 7(1.33%) 11(2.05%) There was no association between the 1361 C/G polymorphism with the baseline of lung function (P=0.25) analyzed by a regression model. - 70-CD63 18266115 18262558 E1 E2 E3 E4 -j r - i | ° l 1 j ' —p Figure 3-1 Schematic overview of the location and distribution of investigated polymorphisms in the CD63 gene. Eleven single nucleotide polymorphisms (SNPs) were selected for genotyping in the CD63 gene located on chromosome 12q12-q13 (reference position indicated refers to the sequence NT_029419). The position of these SNPs in the CD63 gene sequence (+1 is defined as the start of transcription) is as follows: -1523 (rs772254, C/T), -106 (rs12818008, C/T), 1361 (rs3138132, C/G), 2396 (rs2231467, A/G), 2820 (rs11574657, T/C), 3196 (rs1804040, G/A), 3410 (rs1804041, T/C), 3443 (rs1050043, G/A), 3845 (rs3138133 T/G), 3977 (rs3138134, T/C), and 8041 (rs3138144 C/G). A_adenine, C _ cytosine, G _guanine, T _ thymine, and rs _ database SNP accession number. - 71 -600 bp 100 bp Figure 3-2 Detection of the -1523C/T SNP The 206bp amplified PCR products were digested by Taql and analyzed by electrophoresis on a 2.5% agarose gel. Lanes 1, 2, 4, 6, 7, 9, and 10 were C/C homozygotes. Lanes 3, 5, and 8 were C/T heterozygotes. - 72-600 bp 100 bp Figure 3-3 Detection of the 1361 C/G polymorphism The 205 bp amplified PCR product was digested by the restriction enzyme Ddel. Lanes 3, 4, 5, 6, and 7 are C/C homozygotes. Lanes 1 and 2 are C/G heterozygotes. - 7 3 -A B lgG1:6 CD63:38 lgG1:4 CD63:176 R2L06/FL2L06 FL2L0G/R2L0G Figure 3-4 Analysis of CD63 staining by flow cytometry (A) Cell surface staining of CD63 on intact PMNs; (B) Total CD63 staining of permeabilized PMNs. 250.00 E 200.00 0 o a co 150.00 CD 100.00 0 jjj: 50.00 o 0.00 Asian Caucasian Figure 3-5 CD63 expression pattern in Asian and Caucasian healthy individuals The mRNA levels of the CD63 in Asian and Caucasian healthy individuals were not significantly different (0.43±0.04 vs. 0.5110.04, P=0.47). The level of total CD63 protein was markedly higher in Caucasians than in Asians (214.25113.35 vs. 162.03110.82, P=0.016) when compared using the non-parametric Wilcoxon test. - 7 5 -i l 0.60 0.55 0.50 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 Resting Stimulated c c O 1 1200 1000 4 800 1 g 600 400 1 © 200 Resting St imula ted 3 170 Q. 150 C 130 1 j5 n o 0 70 1 50-30 -10 Resting Stimulated 76 Figure 3-6 mRNA and protein level of CD63 before and after IL-8 stimulation among COPD patients A) The mRNA level of CD63 in PMNs under resting conditions and stimulated conditions. There was a significant decrease in the mRNA level of CD63 after IL-8 stimulation compared with resting conditions (0.31 ± 0.01 vs. 0.37 ± 0.01, P<0.0001) B) Total CD63 level in PMNs under resting conditions and after IL-8 stimulation. CD63 was markedly upregulated after IL-8 stimulation compared with resting conditions (280.50 ±22.07 vs. 173.97 ± 12.67, P<0.0001). C) Surface CD63 expression before and after IL-8 stimulation. Surface CD63 level was also increased after IL-8 stimulation (63.96 ± 7.16 vs. 46.06 ± 4.31, P=0.03). - 77-0.00 _ • -0.02 Bg S ™ -0.04 Q co O £ «4— I | I -006 > co ® 3 • - | -0.08 0_ co CD —' C n •g -0.10 -0.12 C C C T - 1 5 2 3 C / T C C C G 1 3 6 1 c / g C C C G G G 8 0 4 1 c / g Figure 3-7 CD63 polymorphisms and the change in expression level of CD63 upon IL-8 stimulation There was no association between genetic polymorphisms and the change in level of CD63 mRNA and protein upon IL-8 stimulation when analyzed by the non-parametric Wilcoxon test (P>0.05). - 7 8 -12.00 • Healthy individuals • COPD patients 1361 C/G 8041 C/G Figure 3-8 CD63 genotypes and the amount of released MPO upon IL-8 stimulation in both the Caucasian healthy individuals and COPD patients A significant difference in the amount of released MPO (percentage) was observed among groups with different 8041 C/G genotypes in the healthy individuals. The group with the CC genotype had more MPO released (9.05% ± 1.11%) compared with the group with GG genotype (4.94% ± 0.68%) (P=0.007). The observed difference in the released MPO between CG genotype (7.52% ± 0.92%) and GG genotype (4.94% ± 0.68%) in the healthy individuals was not significant (P=0.066). There was no significant difference observed in the COPD patients. - 79-3.5 References: 1. Stockley RA. Neutrophils and the pathogenesis of COPD. Chest 2002;121:151S-155S. 2. Albelda SM, Smith CW, Ward PA. Adhesion molecules and inflammatory injury. FasebJ 1994;8:504-12. 3. Berton G, Yan SR, Fumagalli L, Lowell CA. Neutrophil activation by adhesion: mechanisms and pathophysiological implications. Int J Clin Lab Res 1996;26: 160-77. 4. Campanelli D, Detmers PA, Nathan CF, Gabay JE. Azurocidin and a homologous serine protease from neutrophils. Differential antimicrobial and proteolytic properties. J Clin Invest 1990;85:904-15. 5. Sinha S, Watorek W, Karr S, Giles J , et al. Primary structure of human neutrophil elastase. Proc Natl Acad Sci U S A 1987;84: 2228-32. 6. Salvesen G, Farley D, Shuman J, Przybyla A, et al. Molecular cloning of human cathepsin G: structural similarity to mast cell and cytotoxic T lymphocyte proteinases. Biochemistry 1987;26: 2289-93. 7. Witko-Sarsat V, Rieu P, Descamps-Latscha B, Lesavre P, et al. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 2000;80:617-53. 8. Boucheix C, Rubinstein E. Tetraspanins. Cell Mol Life Sci 2001 ;58:1189-205. 9. Hammond C, Denzin LK, Pan M, Griffith JM, et al. The tetraspan protein CD82 is a resident of MHC class II compartments where it associates with HLA-DR, -DM, and -DO molecules. J Immunol 1998; 161:3282-91. 10. Berditchevski F. Complexes of tetraspanins with integrins: more than meets the eye. J Cell Sci 2001 ;114:4143-51. 11. Berditchevski F, Tolias KF, Wong K, Carpenter CL, et al. A novel link between integrins, transmembrane-4 superfamily proteins (CD63 and CD81), and phosphatidylinositol 4-kinase. J Biol Chem 1997;272: 2595-8. 12. Yauch RL, Hemler ME. Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem J 2000;351 Pt 3: 629-37. - 8 0 -13. Robinson MS, Bonifacino JS. Adaptor-related proteins. Curr Opin Cell Biol 2001;13:444-53. 14. Rous BA, Reaves BJ, Ihrke G, Briggs JA, et al. Role of adaptor complex AP-3 in targeting wild-type and mutated CD63 to lysosomes. Mol Biol Cell 2002;13:1071-82. 15. Kuijpers TW, Tool AT, van der Schoot CE, Ginsel LA, et al. Membrane surface antigen expression on neutrophils: a reappraisal of the use of surface markers for neutrophil activation. Blood 1991 ;78:1105-11. 16. Boyum A. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 1968;97: 77-89. 17. Lacy P, Mahmudi-Azer S, Bablitz B, Hagen SC, et al. Rapid mobilization of intracellular^ stored RANTES in response to interferon-gamma in human eosinophils. Blood 1999;94: 23-32. 18. Barlic J , Khandaker MH, Mahon E, Andrews J, et al. beta-arrestins regulate interleukin-8-induced CXCR1 internalization. J Biol Chem 1999;274:16287-94. 19. Rubinstein E, Le Naour F, Lagaudriere-Gesbert C, Billard M, et al. CD9, CD63, CD81, and CD82 are components of a surface tetraspan network connected to HLA-DR and VLA integrins. Eur J Immunol 1996;26:2657-65. 20. Koyama Y, Suzuki M, Yoshida T. CD63, a member of tetraspan transmembrane protein family, induces cellular spreading by reaction with monoclonal antibody on substrata. Biochem Biophys Res Commun 1998;246:841-6. 21. Armstrong LW, Rom WN, Martiniuk FT. The gene for lysosomal protein CD63 is normal in patients with Hermansky-Pudlak syndrome. Lung 1998;176:249-56. 22. van Eeden SF, Lawrence E, Sato Y, Kitagawa Y, et al. Neutrophils released from the bone marrow by granulocyte colony-stimulating factor sequester in lung microvessels but are slow to migrate. Eur Respir J 2000;15:1079-86. 23. Tohami T, Drucker L, Radnay J, Shapira H, et al. Expression of tetraspanins in peripheral blood leukocytes: a comparison between normal and infectious conditions. Tissue Antigens 2004;64: 235-42. -81 -24. Hotta H, Miyamoto H, Hara I, Takahashi N, et al. Genomic structure of the ME491/CD63 antigen gene and functional analysis of the 5-flanking regulatory sequences. Biochem Biophys Res Commun 1992;185:436-42. 25. Niessen HW, Verhoeven AJ. Differential up-regulation of specific and azurophilic granule membrane markers in electropermeabilized neutrophils. Cell Signal 1992;4: 501-9. 26. Starcevic M, Dell Angelica EC. Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1). J Biol Chem 2004;279: 28393-401. - 8 2 -4 ASSOCIATION OF GENETIC POLYMORPHISMS OF THE HCK G E N E WITH G E N E EXPRESSION AND COPD 4.1 Introduction Polymorphonuclear leukocytes (PMNs) are believed to be the major effector cells in the chronic airway inflammation associated with Chronic Obstructive Pulmonary Disease (COPD) [1]. PMNs synthesize a large number of proinflammatory cytokines/chemokines, growth factors and lipid mediators which are pre-stored in various granule populations and are released to the extracellular space upon cell activation. Azurophilic granules in PMNs are characterized by their content of myeloperoxidase and a number of serine proteinases [2-4], which are capable of degrading many components of the extracellular matrix. Controlled mobilization and exocytosis of PMN granules are important in host defense. However, unrestrained serine proteases in general and elastase specifically, are currently believed to play a crucial role in the pathogenesis of pulmonary emphysema [5]. Src tyrosine kinases are key regulators of phagocytic cell activation [6]. Tyrosine phosphorylation of a variety of proteins has been implicated in the intracellular signaling pathways mediating PMN chemotaxis and proteinase release [7]. Hematopoietic cell kinase (Hck), one of the major Src tyrosine kinases expressed in PMNs, is mainly associated with azurophilic granules [8, 9] and plays an important role in PMN phagocytosis and azurophilic granule release [10]. Barlic et al. have shown that Hck colocalizes with beta-arrestin on the G protein coupled IL-8 receptor, traffics to azurophilic granule rich regions, and initiates the process of mediator release after chemokine induction [11]. PMNs from transgenic mice which constitutively overexpress - 8 3 -Hck (Hck ) exhibit enhanced migratory capacity and cell activation, and release twofold more superoxide than their wild-type counterparts in response to TNFa or fMLP stimulation [12]. The HckF / F mice showed enhanced pulmonary innate immune responses. Their lungs show extensive inflammatory cell infiltration, and areas of mild emphysema and pulmonary fibrosis [12]. Based on the important role of Hck in PMN function and in the innate immune system, we hypothesized that functional polymorphisms affect the expression level of Hck, modulate PMN activity and affect the susceptibility to COPD or COPD-related phenotypes. In this study, we characterized genetic polymorphisms of the Hck gene, measured Hck expression level in PMNs, quantified the amount of released MPO upon IL-8 stimulation, and evaluated the potential association of these polymorphisms with Hck expression and PMN degranulation activity in 95 healthy white volunteers and 70 COPD patients. Finally, we assessed the association of potential function-changing polymorphisms with COPD. 4.2 Materials and Methods 4.2.1 Study Subjects The genotyping cohort for these studies consisted of 36 Caucasians. The gene expression cohort consisted of 95 healthy volunteers and 70 Caucasian COPD patients. See Chapter 1 for details. 4.2.2 SNP selection and genotyping The Hck gene is located on chromosome 20q with the length of 50 kb. The HapMap project (http://www.hapmap.org) has genotyped a total of 15 polymorphisms in this gene -84 -in 95 European-American samples. Based on these genotype results a set of tag SNPs was chosen using the LDSelect program developed by Carlson et al. [13]. This program selects a set of maximally informative tagSNPs based on their having linkage disequilibrium (LD) above a threshold with the non-selected SNPs. A relatively stringent LD threshold of R2>0.8 and minor allele frequency of 10% was used for the selection [14]. Therefore, four intronic SNPs located at 17,562, 22,217, 26,891 and 33,367 were chosen (nucleotide position in the gene). In addition, one polymorphism in the promoter region (at position -627), two nonsynonymous polymorphisms in exons 2 and 4 (19,465 and 21,528) and an intronic polymorphism (+8522) reported in the NCBI SNP database were included, which increased the marker density for further characterization of the LD pattern in the Hck gene (Figure 4-1). The genotypes were determined by restriction fragment length polymorphism (RFLP) or TaqMan genotyping assays (Table 4-1 and Table 4-2). 4.2.3 PMN isolation and stimulation Neutrophils were isolated by a Dextran-Ficoll sedimentation and centrifugation method [15]. The time course study of PMN MPO release was performed at 2 min, 5 min, 10 min, and 30 min at 378C by other researchs in our laboratory, and finally 2 min for 10nM fMLP priming and 10 min for 100ng/ml IL-8 stimulation was selected. 4.2.4 RNA extraction and cDNA synthesis Total RNA was isolated using an RNeasy Mini Kit (Qiagen; ON, Canada) as described by the manufacturer. Isolated RNA was analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 Nano Labchip Kit (Agilent Technologies; CA, USA). First strand cDNA - 8 5 -synthesis was carried out with Superscript RNase H- Reverse Transcriptase (Invitrogen, ON, Canada) and random primers (Invitrogen, ON, Canada) according to the manufacturer's instructions (See appendices for details). 4.2.5 Hck mRNA Quantification To measure the mRNA level for Hck an assay-on-demand gene expression kit for the Hck gene (Hs00176654_m1, Applied Biosystems, CA, USA) was used. The mRNA level of Hck of each subject was normalized by p-actin (See appendices for details). 4.2.6 Hck protein quantification To quantify the level of Hck protein PMNs were subject to Hck immunostaining and flow cytometry analysis. See Chapter 2 for details. 4.2.7 PMN mediator release assay The released myeloperoxidase (MPO) were measured as previously described [16, 17]. See appendices for details. 4.2.8 Association study in the LHS cohort The 8.657L/S polymorphism in the Hck gene (see section 5.3.2) was used in an association study in LHS cohort since it was a novel polymorphism, and was associated with differential expression of Hck protein and MPO release. The 8.657L/S polymorphism, however, was not suitable for genotyping in a large cohort because it was a 15bp insertion/deletion polymorphism and the genotyping had to be performed manually. Thus, the 8657L/S polymorphism was only genotyped in one subgroup in the -86 -LHS cohort which included approximately 600 subjects who were selected on the basis of their rate of decline of lung function. Meanwhile, another polymorphism 26,891 C/T, which was in high LD with the 8,657L/S polymorphism in Caucasians (R2=0.84), was studied in the second subgroup in the LHS cohort. This second subgroup included 1000 subjects who were selected on the basis of the level of baseline of lung function. 4.2.9 Statistical analysis The association of each individual polymorphism with the mRNA and protein level of Hck was evaluated by using the non-parametric Wilcoxon test. The allelic association or linkage disequilibrium (LD) was estimated by using the R package "LDheadmap". The estimation of haplotypes and evaluation of associations between the haplotypes and the mRNA and protein level were done using the R package "Hapassoc" [18]. Association of the polymorphisms with the rate of decline of lung function and the level of baseline lung function was evaluated using logistic regression models. The association of the polymorphism with bronchodilator response was analyzed using linear regression model including baseline pre FEV1% as a covariant. 4.3 Results 4.3.1 Hck expression pattern in PMNs Hck was mainly expressed in the cytoplasm of PMNs (Figure 4-2). The healthy individuals had significantly less Hck mRNA than the COPD patients at resting condition (1.55±0.09 vs. 2.88±0.12, P<0.001) although there was no difference in the level of Hck protein (52.72±1.39 vs. 48.24±3.06, P=0.32) (Figure 4-3). Upon chemokine stimulation Hck mRNA was significantly downregulated compared with the baseline (2.88±0.12 vs. - 87 -2.48±0.20, P<0.001), whereas, no marked change observed in the level of Hck protein (47.71 ±3.05 vs. 45.77±3.68, P=0.21) (Figure 4-4). 4.3.2 Genetic polymorphisms of the Hck gene In the genotyping cohort, 6 of the 8 investigated polymorphisms were detected with a frequency of greater than 8% (Figure 4-5, Figure 4-6, and Table 4-3). The 2 exonic polymorphisms reported in the NCBI SNP database (19,465 and 21,528) were not polymorphic in our population. A novel polymorphism in intron 1 was identified by PCR and gel electrophoresis (Figure 4-7). Sequencing results indicated that this polymorphism was a 15 bp insertion/deletion (ggaagaagaaaggaa) at nucleotide positions 84,4804-84,4819 in intron 1 of the Hck gene (NT_028392). The corresponding genotypes were designated as LL, which represents homozygotes for the 15 bp insertion, LS representing the insertion and deletion heterozygotes and SS representing the 15 bp deletion homozygotes. The minor allele frequencies of all the detected polymorphisms of the Hck gene are shown in Table 4-3. The polymorphism 33.367C/T was analyzed by TaqMan assay (Figure 4-8). The frequency of T allele was ~ 30% in Caucasians, but it could not be detected in Asians. All the observed genotype frequencies conformed to expectations from Hardy-Weinberg equilibrium. The pairwise LD patterns among the detected polymorphisms were different between Caucasians and Asians (Table 4-4, Table 4-5, and Figure 4-9). Due to the presence of high LD in the Caucasians, tag polymorphisms were selected for further study using a threshold of r2 > 0.8 and minor allele frequency >10%. Polymorphisms with minor allele frequency lower than 10% were excluded from the gene expression analysis. - 88 -4.3.3 Hck genetic polymorphisms and gene expression and PMN MPO release The mRNA level of Hck was normalized by p-actin. Mean fluorescence intensity (MFI) was used as the index of the amount of Hck protein. In the healthy Caucasians, individual tests of the tagging SNPs revealed no association between any of the polymorphisms and the mRNA level of Hck (Table 4-6). However, the 8,656L/S polymorphism was associated with Hck protein level under resting conditions. The SS genotype was associated with a higher level of Hck than both the LS genotype (P=0.01) and LL genotype (P=0.02) (Figure 4-10), and interestingly the amount of released MPO was associated with the 8,656L/S polymorphism as well (Figure 4-11). The percentage of released MPO was 9.2±1% (mean ± SE) for the SS group, 6.4±0.8% for the LS group, and 4.8±1% for the LL group (SS vs. LS, P=0.04; SS vs. LL, P=0.008). There was no association observed in the healthy Asians (Table 4-7). In the Caucasian COPD subjects, there was no association between the genetic polymorphisms and the level of Hck mRNA and Hck protein under resting conditions (Table 4-8). After chemokine stimulation, the 33,367T/C polymorphism was associated with differential expression of Hck protein (Table 4-9). The CC genotype had significantly more Hck protein expressed compared with the CT genotype (55.33±6.43 vs. 34.88±3.99, P=0.015). There was also no association of the genetic polymorphisms with the amount of released MPO (Table 4-10) Haplotypes were estimated in both healthy volunteers and COPD patients. However, there was no association between the estimated haplotypes and any phenotype (data not shown). - 8 9 -4.3.4 Association study of Hck genetic polymorphisms in the LHS cohort In the LHS cohort, the 8,656L/S polymorphism was not associated with the rate of decline of lung function (Table 4-11). However, the subjects with the LL and LS genotype had significantly higher mean bronchodilator response compared with subjects who had the SS genotype (P=0.03 and 0.03 respectively) (Figure 4-11). Polymorphism 26,891 T/C was not associated with the level of baseline of lung function (Table 4-12). 4.4 Discussion PMN degranulation is critical in host defense. Excessive, prolonged mediator release, however, is associated with a number of disabling diseases that affect virtually all organs in the body [19]. Hck, a member of the Src family of tyrosine kinases, is one of the essential molecules in the process of PMN degranulation [8, 11, 20]. In this study we described the expression pattern of Hck in PMNs, defined genetic markers which may modulate the expression or function of Hck, and assessed if these genetic markers contribute to COPD susceptibility. Hck is a cytosolic protein. Upon IL-8 stimulation there was no marked change in the amount of total Hck protein, whereas, the level of Hck mRNA was significantly decreased. This may imply that the regulation of Hck expression at the mRNA level was quick and dramatic in response to IL-8 challenge. In the signaling pathway associated with chemokine stimulation, Hck and another Src tyrosine kinase Fgr function as negative regulators by phosphorylation of the immunoreceptor tyrosine-based inhibitory motifs (ITIMs) which are located in the paired immunoglobulin (Ig)-like receptor B for inhibition - 9 0 -(PIR-B). PMNs derived from hck-/- fgr-/- mice showed significantly higher intracellular signaling and functional responses (chemotaxis in vitro and migration in vivo) to a number of different chemokines [21]. Thus, it is likely that PMNs reduce the production of Hck upon chemokine challenge to maintain their chemotactic activity. Lichtenberg er al have reported that the expression of Hck was regulated primarily through control of transcription. Through accumulating Hck transcript, Hck protein expression was increased [22]. In this study, we did not observe paralleled decrease in Hck protein after IL-8 challenge. We speculated that the possible reason may be that the duration of chemokine challenge was not long enough for us to observe a change in Hck protein, or the PMNs from COPD patients had altered expression regulation system due to their particular host and environmental factors, and the expression regulation could be critical at both the mRNA level and the protein level. To explore the correlation between genetic polymorphisms and Hck expression we systematically investigated genetic polymorphisms in Asians and Caucasians. We found significantly different prevalence of the polymorphisms and LD patterns between these two ethnic groups. The polymorphisms were generally more prevalent among Caucasians than Asians. Due to the presence of high LD in the Caucasians we selected tagging SNPs for the gene expression study, which captured most of the genetic heterogeneity within the region. We found that the newly identified 15bp insertion/deletion polymorphism in intron 1 (8,657L/S) was associated with the protein level of Hck and this was consistent with the amount of released MPO in healthy Caucasian volunteers. The subjects with the deletion polymorphism (SS) had higher Hck level, and more released -91 -MPO than those with the insertion polymorphism (LL). Intermediate levels were observed in heterozygotes (LS). The reason for the association of 8.657L/S remains to be determined. The 8.657L/S polymorphism may have functional effects on the process of transcription or translation. The pre-mRNA with the insertion polymorphism may not be spliced and translated as efficiently as the one without the 15 bp insertion, and consequently the production of mature Hck transcript may be reduced. In the process of azurophilic granule exocytosis, Hck may function in a positive fashion by coupling p-arrestin at phosphorylated chemokine receptor, and translocating to azurophilic granules to initiate the process of mediator release from azurophilic granules [11]. Therefore, the cells which possess more Hck would release more MPO. In the COPD patients, there was no similar association observed. This suggests that the regulation of Hck expression in the COPD patients is different from that in healthy individuals. It is known that the COPD patients were old (~ 70yrs old). They have been or still were heavy cigarette smokers when they were recruited into the study, and they were usually on a number of medications, such as corticosteroid. All these factors may change the cellular milieu, and consequently affect the gene expression pattern of the cells, including PMNs [23]. In addition, the disease process itself may cause different expression of the transcription factors and different expression of the target genes. The significantly higher Hck mRNA in the COPD patients may indicate this point. However, the levels of Hck protein were similar between the COPD patients and the healthy individuals, which suggest there is additional regulation system to modulate protein - 9 2 -expression. Therefore, the functional effects of polymorphisms may be masked, or altered. Another possible reason for lack of association in the COPD patients may be due to the smaller sample size, although the two populations were approximately the same size. After IL-8 stimulation, the CT genotype of the 33.367C/T polymorphism had significantly lower Hck protein than the CC (P=0.013). This implies that polymorphism 33.367C/T has an effect on the level of Hck upon chemokine challenge in the specific case of COPD patients. However, the mechanism underlying this observation remains to be determined. In the haplotype analysis, there was no association between the estimated haplotypes and any phenotype. This may be because 8,656L/S is the causal locus for the association. When the data were analyzed as haplotypes the signal from the causal polymorphism was weakened since the S and L allele have been found on most of estimated haplotypes. It is still possible that the true locus that controls the Hck level remains to be identified. It could be located either within the Hck gene or other nearby genes, such as the proximate defensin beta 119 gene (DEFB119), and bactericidal/permeability-increasing protein-like 3 gene (BPIL3). We also investigated whether the 8,657L/S and 26,891 C/T polymorphisms which were in high LD with 33,367 C/T were associated with COPD or COPD-related phenotypes. In the association study in the LHS cohort there was no association observed between these two polymorphisms and the two major phenotypes, the baseline of lung function and the rate of decline of lung function. This suggests that Hck has no significant role in - 9 3 -modulating COPD susceptibility and COPD progression. However, we found that the 8,657L/S polymorphism was associated with different levels of bronchodilator response. The subjects with the LL and LS genotypes had a larger mean bronchodilator response than SS subjects. It is known that the level of baseline lung function can influence bronchodilator response. Therefore, we did linear regression analysis and included baseline prebronchodilator FEV1% predicted into the model as a covariant, and we still found a significant association. Although this is a post hoc observation the association could be due to different level of inflammation in the people with different 8,657L/S genotypes. The SS genotype was associated with higher Hck level and more released MPO upon chemokine stimulation than the LL and LS genotypes. Consequently, individuals with this genotype could have more severe airway inflammation, and be less responsive to bronchodilator treatment. Since p\,-agonist is one of the major symptomatic treatments for COPD, the presence of 8,656L/S polymorphism may influence the improvement of COPD symptoms. However, it still remains unknown if different bronchodilator response is involved in the COPD pathogenesis. In summary, Hck is an important molecule in the signaling pathway mediating PMN chemotaxis and mediator release. Upon chemokine challenge, Hck was downregulated. There was association between the 8.657L/S polymorphism and differential expression of Hck protein and MPO release in healthy Caucasian volunteers. The role of Hck genetic variants in COPD susceptibility may be limited. - 9 4 -Table 4-1 Primers and restriction enzymes used for genotyping Primers Restriction enzyme -627C/T Promoter Sense-GTGGTGGGGAAAAGAGATCA Acil (rs1004910) Ant isense-CGCCTAAGAGTTTTAATACC 8,522 C/T Intron 1 (rs4911541) Sense- T G A G A A G C A G A C T C C C A T A G C Msel Antisense- TCTGATGGCTCTCCTGTCCT 8.657L/S Intron 1 S e n s e - A G G A C A G G A G A G C C A T C A G A (novel) Ant isense-ACTGCACTCCAGCCTGGTC 19.465C/T Exon 2 Sense -CGCATGAGGCTCTTGGTAAC 7sp509l rs6089165 Antisense- CTACTCACCGGCTTGATGGT 21.528G/T Exon 4 rs6089166 Sense- C G A A A C C T C A C C C T C T G T G T Alu I Ant isense-AGGAGGCAGGTCTGTCTTAG (Contig Accession NT_028392) Table 4-2 T a q M a n g e n o t y p i n g a s s a y s of the H c k gene f rom A p p l i e d B i o s y s t e m s . primer sequence reporter sequence 17.562A/G Intron 2 F o r w a r d - C A G A A G A G G T A A A T C C T T G T A A A T A A A A G G A A T C V I C - T A A G C C T A G G A A T T T G (rs6089164) R e v e r s e - A C A T G T A T T T G T G G T T T A A G G A A A A A A A C C C F A M - C T A A G C C T A G G A G T T T G 2 2 ' 2 1 7 C / G l n t r o n 4 F o r w a r d - T C A G A T G C A C A G C A G G A A C T G V I C - T A A T C A T G G C C A C A T G C (rs6061154) R e v e r s e - A G G A C A G G G C T G T G A C T A T G T F A M - T C A T G G G C A C A T G C 26,891 T/C Intron 5 F o r w a r d - C T G C T T G A A C T T T T C C A C C C A A A T A V I C - A T T C T T C C T G A G T A T T G A G (rs242602) Reve rse -GAATTTTATACTTAGGATTATATCCTGGGACATTTTCTT F A M - T T C T T C C T G A A T A T T G A G 33.367T/C Intron 8 F o r w a r d - G G T A A G A C A G A T C T G A G T G G T G A G A V I C - C A T A T A A G A C G C T A G A C T C (rs242609) R e v e r s e - C C G T G G G C T T C C T G T A G T A G F A M - A T A T C A T A T A A G A T G C T A G A C T C - 9 6 -Table 4 - 3 Minor allele frequencies of the 7 detected polymorphisms of the Hck gene Minor allele Caucasian healthy individuals (N=60) Asian healthy individuals (N=35) Caucasian COPD patients (N=70) -627 G/T T 9.2% 7.1% 7.1% 8,522 C/T T 42.5% 28.6% 33.6% 8,657 US L 45.8% 31.4% 31.2% 17,562 A/G A 10.0% 10.0% 3.6% 22,217 C/G C 35.0% 2.8% 33.6% 26,891 T/C C 45.8% 11.4% 35.7% 33,367 T/C T 31.7% 0 30.0% - 97 -Table 4-4 Pairwise allelic association (r2) in the Caucasians SNP8,522 SNP8.656 SNP17,562 SNP22.217 SNP26,891 SNP33.367 SNP627 0.03 0.05 0.00 0.00 0.04 0.03 SNP8.522 0.81 0.00 0.00 0.80 0.60 SNP8.656 0.03 0.00 0.83 0.57 SNP17.562 0.00 0.07 0.00 SNP22.217 0.83 0.68 SNP26.891 0.59 Table 4-5 Pairwise allelic association (r2) in the Asians SNP627 SNP8.522 SNP8,656 SNP17.562 SNP22.217 SNP26,891 SNP627 0.06 0.04 0.19 0.00 0.15 SNP8,522 0.74 0.15 0.04 0.09 SNP8.656 0.24 0.03 0.15 SNP17.562 0.00 0.60 SNP22.217 0.11 - 9 9 -Table 4-6 Genotypes and corresponding levels of Hck mRNA and protein in the Caucasian healthy volunteers Genotype No mRNA P value* total Hck P value** - 6 2 7 G / T G G 4 9 1 . 5 8 1 0 . 1 1 0 . 5 7 5 2 . 9 0 1 2 . 2 0 0 . 8 G T 1 1 1 . 4 6 1 0 . 1 9 5 1 . 9 1 1 4 . 0 8 8 . 6 5 6 L / S L L 1 5 1 . 5 0 1 0 . 1 3 0 . 4 3 4 7 . 8 0 1 3 . 9 5 0 . 0 2 L S 2 5 1 . 4 6 1 0 . 1 4 4 9 . 2 8 1 2 . 6 2 S S 2 0 1 . 7 1 1 0 . 2 1 6 0 . 7 0 1 3 . 2 0 1 7 . 5 6 2 G / A G A 1 2 1 . 5 8 1 0 . 2 2 0 . 9 6 4 6 . 7 5 1 4 . 7 5 0 . 1 2 G G 4 8 1 . 5 5 1 0 . 1 1 5 4 . 2 1 1 2 . 0 8 3 3 . 3 6 7 C / T C C 3 1 1 . 5 9 1 0 . 1 5 0 . 6 5 7 . 2 6 1 2 . 6 1 0 . 0 6 C T T T 2 0 9 1 . 4 9 1 0 . 1 6 1 . 5 7 1 0 . 1 5 4 6 . 5 0 1 3 . 4 2 5 0 . 8 9 1 3 . 7 1 The mRNA level of Hck was normalized by p-actin. The total Hck protein was expressed as MFI (mean fluorescence intensity). There was no association between different genotypes and level of mRNA of Hck. The 8,656L/S polymorphism was associated with differential expression of Hck protein. The group with the S/S genotype had higher levels of Hck compared with the group with L/L and US genotypes when analyzed by non-parametric Wilcoxon test. * P value for the comparison of mRNA levels. ** P value for the comparison of protein levels. -100-Table 4-7 Genotypes and corresponding level of mRNA and protein of Hck in the Asian healthy volunteers Genotype No mRNA P value* Total Hck P value** 8.522C/T CC 18 1.5010.19 0.16 54.8914.60 0.4 TC 14 1.6710.20 60.1417.10 TT 3 1.0410.08 42.0013.79 8.656L/S LL 2 0.9610.03 0.13 45.0014.00 0.62 LS 18 1.5910.16 59.6715.76 SS 15 1.5210.22 52.8015.23 17.562G/A GA 7 1.3410.23 0.34 65.29111.55 0.45 GG 28 1.5710.15 53.5413.67 26,891 C/T CT 8 1.1810.11 0.13 57.0017.25 0.89 TT 27 1.6310.16 55.5614.40 The mRNA level of Hck was normalized by p-actin. The total Hck protein was expressed as MFI (mean fluorescence intensity). There was no association between different genotypes and level of mRNA and total Hck in Asian healthy volunteers when analyzed by non-parametric Wilcoxon test. * P value for the comparison of mRNA levels. ** P value for the comparison of protein levels. -101 -Table 4-8 Genotypes and corresponding levels of mRNA and protein of Hck under resting condition in the COPD patients Genotype No Resting mRNA (mean±SE) P* value Resting Hck (mean±SE) p** value 8.656L7S LL 12 2.5710.18 0.63 41.8313.13 0.96 LS 31 2.8510.19 48.3614.51 S S 27 3.0510.22 52.2916.27 22,217C/G C C 8 2.7110.15 0.9 40.3814.50 0.76 G C 32 2.8210.20 48.6214.30 G G 30 2.9910.19 51.1915.72 33,367C/T C C 35 2.9010.18 0.85 53.6715.20 0.53 TC 27 2.9110.22 44.3814.31 TT 8 2.7110.15 40.3814.50 The mRNA level of Hck was normalized by p-actin. The total Hck protein was expressed as MFI (mean fluorescence intensity). There was no association between different genotypes and level of mRNA and total Hck under resting conditions when analyzed by non-parametric Wilcoxon test. * P value for the comparison of mRNA levels. ** P value for the comparison of protein levels. -102-Table 4 - 9 Genotypes and corresponding levels of mRNA and protein of Hck after stimulation in the COPD patients Stimulated mRNA P* Stimulated Hck P Genotype No (mean±SE) value (meaniSE) value 8.656L/S LL 12 1.9110.19 0.08 40.2514.10 0.38 LS 31 2.5710.41 40.5514.15 SS 27 2.6810.26 55.6118.10 22,217C/G C C 8 2.1010.20 0.08 4415.75 0.31 G C 32 2.1110.13 39.633.93 G G 30 3.0210.45 54.037.41 33,367C/T C C 35 2.9010.39 0.12 55.3316.43 0.015 TC 27 2.0910.15 34.8813.99 TT 8 2.1010.20 4415.75 The mRNA level of Hck was normalized by p-actin. The level of Hck protein was expressed as MFI (mean fluorescence intensity). The 33,367C/T polymorphism was associated with different protein levels of Hck after IL-8 stimulation. The group with TC genotype had markedly lower level of Hck compared with the group with CC genotype when analyzed by non-parametric Wilcoxon test. * P value for the comparison of mRNA levels. ** P value for the comparison of protein levels. -103-Table 4-10 Genotypes and the amount of released MPO after IL-8 stimulation in COPD patients Genotype No of subjects % of released MPO P value 8.656L/S LL 11 5.8710.78 0.5 LS 23 4.7210.30 SS 24 5.5010.62 22,217C/G CC 7 6.4211.17 0.54 GC 24 4.9110.32 GG 27 5.2610.54 33,367C/T CC 29 5.0110.50 0.23 TC TT 22 7 5.2010.32 6.4211.17 There was no association between the amount of released MPO and genotypes of the polymorphisms in COPD subjects when analyzed by non-parametric Wilcoxon test. -104-Table 4-11 Hck genotype frequencies of 8.657L/S polymorphism and the rate of decline of lung function in the LHS cohort Fast decline Slow decline no. (%) no. (%) LL 28(12%) 30(11%) LS 91(40%) 114(44%) S S 106(47%) 118(45%) There was no significant difference in the genotype frequencies between the groups with fast and slow rate decline of lung function when analyzed by logistic regression (P=0.83). -105-Table 4-12 Hck genotype frequencies of the 26,891 C/T polymorphism in the LHS cohort with different levels of baseline lung function High baseline Low baseline No (%) No (%) C C 66(14%) 67(15%) CT 205 (42%) 212(47%) TT 211 (44%) 173(38%) There was no significant difference in the genotype frequencies between the groups with high baseline and low baseline of lung function when analyzed by logistic regression (P=0.26). -106-Hck co cn co co co — 1 O ) <3> O ) O CD O O O O -»• CO CO CD - U - i CD CD —* CD cn _ i _ » . o 5 , * n 2 II . I I 1 1—I O O £ £ < 22 M M (0 CO o) O ) co co § S 8 H-coding region Figure 4-1 Schematic overview of the investigated polymorphisms of the Hck gene A total of 8 single nucleotide polymorphisms (SNPs) were selected for genotyping in the Hck gene located on chromosome 20q11-q12 (NT_028392). The position of these SNPs in the Hck gene sequence (+1 is defined as the start of transcription) is as follows: -627 (rs1004910, G/T); 8,522 (rs4911541, C/T); 17,562 (rs6089164, A/G); 19,465 (rs6089165, C/T); 21,518 (rs6089166, T/G), 22,217 (rs6061154, C/G); 26,891 (rs242602, T/C), 33,367 (rs242609, C/T). A_adenine, C _ cytosine, G _guanine, T _ thymine, and rs _dbSNP accession number. -107-A B l gG1:4 Hck:5 (3%-15) [gG1:4 Hck:71 (95%-74) l gG1 :5 Hck:6 (3%-29) lgG1:3 Hck:47 (92%-51) *>270 l l 8 0 - i o 10° 10' 102 0113-1 0 ' 1 0 ° 1 0 S 10 1 0 3 Figure 4-2 Hck expression pattern on PMNs (A) Hck staining of intact PMNs under resting conditions; (B) Hck staining of permeabilized PMNs under resting conditions; (C) Hck staining of intact PMNs after IL-8 stimulation; (D) Hck staining of permeabilized PMNs after IL-8 stimulation. lgG1 is the negative control. MFI is used as an index of Hck protein level. The percentage represents the proportion of PMNs with positive Hck staining. -108-60.00 i 50.00 i 52.72 •ini 48,24 40.00 4 • control 30.00 4 • patient 20.00 H 10.00 H * 1.55 2 8 9 0.00 Hck mRNA Hck protein Figure 4-3 Hck mRNA and protein in healthy Caucasian individuals and COPD patients The COPD patients had significantly more Hck mRNA than the healthy individuals (P<0.0001). There was no difference in the Hck protein level between these two groups (P=0.31). - 1 0 9 -8.00 7.00 3 | 6.00 x ° "S I 5.00 J | 4.00 | 1 3.00 ^ 1 I 5 i . 2.00 1.00 0.00 Resting Figure 4 - 4 The level of Hck mRNA and protein before and after IL -8 stimulation (A) The mRNA level of Hck was significantly downregulated after IL-8 challenge (2.88±0.12 vs 2.48±0.20, P<0.001); (B) there was no significant change in Hck protein level before and after IL-8 stimulation (47.71 ±3.05 vs 45.77±3.68, P=0.21). -110-Figure 4-5 Detection of the -627G/T polymorphism of the Hck gene Restriction enzyme digested PCR products from 8 Caucasian subjects were analyzed on a 2.5% agarose gel stained with ethidium bromide. Lane M was 100 bp DNA molecular weight marker. Lane 9 was the negative control. Lane 1-6 were GG homozygotes. Lane 7 and 8 were GT heterozygotes. -111 -1 2 3 4 5 6 7 8 9 10 11 12 13 14 M 600bp 100bp Figure 4-6 Detection of 8,522C/T polymorphism of the Hck gene Restriction enzyme digested PCR products from 14 Caucasian subjects were analyzed on a 2.5% agarose gel stained with ethidium bromide. Lane M was 100 bp DNA molecular weight marker. Lane 1, 4, 6, 10-13 were CC homozygotes. Lane 3, 8, and 9 were TT homozygotes. Lane 2,5, 7, and 14 were CT heterozygotes. -112-1 2 3 4 5 6 7 8 9 10 11 12 M 600 bp 100 bp Figure 4-7 Detection of the novel 15 bp insertion/deletion polymorphism (8,656L/S) of the Hck gene PCR products from 12 individuals were analyzed on a 3% agarose gel stained by ethidium bromide. Lane M is a 100 bp DNA molecular weight marker. A single band with a length of 190 bp was in lanes 1, 5, 8, 10-12, and they were designated SS homozygotes (deletion/deletion); one longer band with a length of 205 bp was present in lane 9 and it was designated as a LL homozygote (insertion/insertion); in lanes 2-4, 6-7 both bands were present and they were LS heterozygotes. -113-3 nr <F>\ &\ i A l l e l i c D i s c r i m i n a t i o n P l o t * » * -" • # *• m ft , 9 * B #-ft <• * c j * •> f c > fjt 1.7 Allele X <HCK_333S?C) Figure 4-8 TaqMan genotyping assay for 33.367C/T polymorphism of the Hck gene The X-axis was the C allele labeled with fluorescence FAM, and the Y-axis was the T allele labeled with fluorescence VIC. The group A was TT homozygote. The group C was CC homozygote. The group B was CT heterozygote. The black dots at the lower left corner were negative controls. - 1 1 4 --627* 8,521 8,657* 17,562* 22,217 26,891 33,367* 33,367-26,891-22,217-17,562-8,657-8,521--627 o i ox o s o « o s o s o r o * o •» B 26,891 -22,217-17,562 8,657 8,521--627--627 8,521 8,657 17,562 22,217 26,891 0.1 0.2 0.3 0.4 05 0.6 0.7 O.S 0.9 Figure 4-9 Pairwise linkage disequilibrium (r2) between respective polymorphisms in Caucasians (A) and Asians (B) The polymorphisms were ordered according to their physical position in the gene. The color represents the magnitude of r2 value. The polymorphisms with asterisks were chosen as tagSNPs for the gene expression study. 115 G/G G/T UL US SIS G /G G/A C/C C/T T/T -627G/T 8,656L/S 17,562G/A 33.367C/T Figure 4-10 Genotypes of 4 polymorphisms and their corresponding protein levels of Hck in healthy Caucasian volunteers The S /S genotype of the 8,656L/S polymorphism was associated with higher Hck level compared with the US and UL genotypes (*p<0.05) - 1 1 6 -10 T3 CD CO CO _a> CD 4 B > UJ 0) U_ g £ E o o 5 ^ « 2 L L L S S S LL L S S S Figure 4-11 The 8.657L/S polymorphism and released MPO in Caucasian healthy volunteers and bronchodilator response in LHS cohort (A) The group with LL and LS genotypes released markedly less MPO than the SS genotype group (P<0.05); (B) The LL and LS groups had significantly higher bronchodilator response compared with the SS group (P=0.027) when analyzed by linear regression model adjusted by baseline pre FEV1%. -117-4 . 5 References 1. Stockley RA. Neutrophils and the pathogenesis of C O P D . Chest 2002;121:151S-155S. 2. Campanelli D, Detmers PA, Nathan C F , Gabay J E . Azurocidin and a homologous serine protease from neutrophils. Differential antimicrobial and proteolytic properties. J C l i n Invest 1990;85:904-15. 3. Sinha S, Watorek W, Karr S, Giles J , et al. Primary structure of human neutrophil elastase. Proc Natl Acad Sci U S A 1987;84: 2228-32. 4. Salvesen G, Farley D, Shuman J , Przybyla A, et al. Molecular cloning of human cathepsin G : structural similarity to mast cell and cytotoxic T lymphocyte proteinases. Biochemistry 1987;26: 2289-93. 5. Witko-Sarsat V, Rieu P, Descamps-Latscha B, Lesavre P, et al. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 2000;80: 617-53. 6. Berton G, Mocsai A, Lowell CA. Src and Syk kinases: key regulators of phagocytic cell activation. Trends Immunol 2005;26: 208-14. 7. Lowell CA, Fumagalli L, Berton G. Deficiency of Src family kinases p59/61 hck and p58c-fgr results in defective adhesion-dependent neutrophil functions. J Cell Biol 1996;133:895-910. 8. Mohn H, Le Cabec V, Fischer S, Maridonneau-Parini I. The src-family protein-tyrosine kinase p59hck is located on the secretory granules in human neutrophils and translocates towards the phagosome during cell activation. Biochem J 1995;309 ( Pt 2): 657-65. 9. Welch H, Maridonneau-Parini I. Hck is activated by opsonized zymosan and A23187 in distinct subcellular fractions of human granulocytes. J Biol Chem 1997;272:102-9. 10. Mocsai A, Ligeti E, Lowell CA, Berton G. Adhesion-dependent degranulation of neutrophils requires the Src family kinases Fgr and Hck. J Immunol 1999;162:1120-6. 11. Barlic J , Andrews J D , Kelvin AA, Bosinger S E , et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI . Nat Immunol 2000;1: 227-33. 12. Ernst M, Inglese M, Scholz G M , Harder KW, et al. Constitutive activation of the S R C family kinase Hck results in spontaneous pulmonary inflammation and an enhanced innate immune response. J Exp Med 2002;196:589-604. - 1 1 8 -13. Carlson C S , Eberle MA, Rieder MJ , Yi Q, et al. Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium. Am J Hum Genet 2004;74:106-20. 14. The International HapMap Consortium. The International HapMap Project. Nature 2003;426: 789-96. 15. Boyum A. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 1968;97: 77-89. 16. Lacy P, Mahmudi-Azer S, Bablitz B, Hagen S C , et al. Rapid mobilization of intracellular^ stored R A N T E S in response to interferon-gamma in human eosinophils. Blood 1999;94:23-32. 17. Barlic J , Khandaker MH, Mahon E, Andrews J , et al. beta-arrestins regulate interleukin-8-induced CXCR1 internalization. J Biol Chem 1999;274:16287-94. 18. Burkett K, McNeney B, Graham J . A note on inference of trait associations with S N P haplotypes and other attributes in generalized linear models. Hum Hered 2004;57: 200-6. 19. Borregaard N, Christensen L, Bejerrum OW, Birgens HS, et al. Identification of a highly mobilizable subset of human neutrophil intracellular vesicles that contains tetranectin and latent alkaline phosphatase. J Clin Invest 1990;85:408-16. 20. N'Diaye E N , Darzacq X, Astarie-Dequeker C, Daffe M, et al. Fusion of azurophil granules with phagosomes and activation of the tyrosine kinase Hck are specifically inhibited during phagocytosis of mycobacteria by human neutrophils. J Immunol 1998;161:4983-91. 21. Zhang H, Meng F, Chu CL, Takai T, et al. The Src family kinases Hck and Fgr negatively regulate neutrophil and dendritic cell chemokine signaling via PIR-B. Immunity 2005;22: 235-46. 22. Lichtenberg U, Quintrell N, Bishop J M . Human protein-tyrosine kinase gene HCK: expression and structural analysis of the promoter region. Oncogene 1992;7: 849-58. 23. MacNee W. Oxidants/antioxidants and C O P D . Chest 2000;117: 303S-17S. - 1 1 9 -5 ASSOCIATION OF POLYMORPHISMS OF THE BETA-ARRESTIN 2 GENE WITH GENE EXPRESSION AND COPD 5.1 Introduction G protein-coupled receptors (GPCR) represent the largest, most versatile superfamily of cell membrane receptors, which transmit extracellular signals to the interior of cells, and regulate cell motility, chemotaxis, apoptosis, cell growth and proliferation. These receptors share a common core architecture of seven transmembrane domains, and the ability to modulate intracellular metabolism through activation of heterotrimeric GTP-binding proteins (G proteins) [1]. p-arrestins are the pivotal molecules in regulating signaling pathways associated with G P C R . By binding to phosphorylated receptor, p-arrestins sterically block further interaction between G P C R and G s proteins, which terminates or attenuates G P C R signaling (desensitization) [2]. Besides desensitization, p-arrestins are also involved in the G P C R resensitization and signal transduction. Since PMNs are the major effector cells in the chronic airway inflammation in C O P D , and the chemokine receptors in PMNs are a large family of G P C R , p-arrestins play an important role in the processes of PMN chemotaxis and granule exocytosis. Barlic ef al have suggested that P-arrestins are able to bind to the phosphorylated chemokine receptor, form a complex with Src tyrosine kinases, such as Hck, and initiate the process of azurophilic granule degranulation [3, 4]. P-arrestins include two isoforms, p-arrestin 1 and p-arrestin 2. The isoforms share over 78% amino acid identity, and are coexpressed ubiquitously. It has been demonstrated by fluorescence in situ hybridization that the p-arrestin 1 gene (ARRB1) maps to 11q13 and is - 1 2 0 -48 kb long, whereas the p-arrestin 2 gene (ARRB2) is on chromosome 17p13 and is 11 kb long [5, 6]. While the two isoforms perform similarly in receptor desensitization, in vitro studies have revealed that p-arrestin 2 is 100-fold more potent than p-arrestin 1 in receptor endocytosis [7]. Certain conditions, such as morphine treatment, depression, and antidepressant therapy, modulate the level of p-arrestins [8, 9]. In this study, we aimed to evaluate the correlation of genetic variants with p-arrestin 2 level in PMNs in healthy individuals and COPD patients. To identify new promoter polymorphisms approximately 1 kb of the p-arrestin 2 promoter was sequenced in 36 Caucasians. In addition, another 6 polymorphisms spanning the p-arrestin 2 gene, spaced 2-4 kb apart, were also investigated. We identified a novel polymorphism, -159 C/T, which was associated with the level of p-arrestin 2 mRNA in Caucasian healthy individuals. A reporter gene assay indicated that -159 C/T may be a functional polymorphism which modulates p-arrestin 2 production. However, in the COPD patients and in the LHS cohort there was no association observed. 5.2 Materials and methods 5.2.1 Study subjects The genotyping cohort used for these studies consisted of 36 Caucasians. The gene expression cohort consisted of 95 healthy volunteers and 70 COPD patients. See Chapter 2 for details. 5.2.2 SNP selection and genotyping For SNP discovery, ~ 1 kb of the 5' flanking region of the ARRB2 gene (-718-+228) was amplified by PCR. The PCR-amplified products were electrophoresed in a 2% agarose gel, purified from excised gel slices using the QIAquick Gel Extraction Kit (Qiagen; Mississauga, -121-O N , Canada), and analyzed in 2 overlapping sequencing reactions by an ABI377 automated sequencer (Applied Biosystems; Foster City, CA). This identified a single nucleotide polymorphism (SNP) at -159 nucleotides relative to the transcription start site. This novel polymorphism was genotyped in the gene expression cohort by restriction fragment length polymorphism (RFLP). In addition, another 6 polymorphisms spanning the ARRB2 gene, separated by 2-4 kb, were investigated by R F L P (Figure 5-1). These polymorphisms were either potentially functional polymorphisms (located in the promoter region) or were intronic markers which helped to delineate the linkage disequilibrium pattern of the ARRB2 gene. The primers and restriction enzymes used and detailed genotyping protocol are listed in Table 5-1 and Table 5-2. 5.2.3 PMN isolation and stimulation Polymorphonuclear leukocytes (PMNs) were isolated by a Dextran-Ficoll sedimentation and centrifugation method [10]. The time course study of PMN M P O release was performed at 2 min, 5 min, 10 min, and 30 min at 37 f i C, and 2 min for 10nM fMLP priming and 10 min for 100ng/ml IL-8 stimulation was finally selected. Genomic DNA was extracted from the mononuclear cells using a DNeasy Tissue Kit (Qiagen). 5.2.4 RNA extraction and cDNA synthesis Total RNA was isolated using an RNeasy Mini Kit (Qiagen) as described by the manufacturer and was analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 Nano Labchip Kit (Agilent Technologies; Palo Alto, CA). First strand cDNA was synthesized by using Superscript RNase H- Reverse Transcriptase and random primers (Invitrogen; Burlington, O N , Canada). See appendices for details. - 1 2 2 -5.2.5 ARRB2 mRNA quantification The mRNA levels for p-arrestin 2 were measured by real-time PCR. The primers and TaqMan probe were as follows: Forward primer: AAGTCGAGCCCTAACTGCAA, Reverse primer: TTGCGGTCCTTCAGGTAGTC, TaqMan Probe: 6FAM-CACCTGGACAAAGTG, The primers and probes were designed by the Primer Express 1.5 software (Applied Biosystems). p-actin was chosen as the housekeeping gene for normalization (Applied Biosystems; CA, USA). The expression level of mRNA in each subject was expressed as a ratio of p-arrestin 2 over p-actin. 5.2.6 Reporter gene assay for the novel p-arrestin 2 promoter polymorphism To explore the effect of the -159 C/T polymorphism on transcription efficiency the promoter region (-333~-28 upstream of the first codon) was amplified by PCR (forward primer: aattctcgaggcaattgaaccgctcacc and reverse primer: aattaagcttcttcccagcctggtagcc) and purified by a QIAGEN column purification method (Qiagen). The genomic DNA from individuals with different -159 C/T genotypes was used as DNA templates. The promoter fragment with either T or C at the -159 bp position was inserted into a promoterless pGL3-luciferase reporter gene basic vector. The Xho\ site and HinchU site were chosen as insertion sites and added to the forward and reverse primers, respectively for directional cloning (underlined bases in the sequences above). Once constructed the plasmids were propagated in E. coli DH5a, purified from bacterial cultures using the QIAprep Maxi Kit (Qiagen), and were further subject to sequencing for confirmation of both orientation and correct DNA inserts. For each allele, three different aliquots of the plasmids were prepared. -123-A549 pulmonary type II epithelial cells (A549) were transiently transfected with the luciferase gene constructs using Lipofectamine 2000 (Invitrogen). Cells were harvested 18 h after transfection, and extracts were prepared using standard techniques. The transfection efficiency was normalized by cotransfection of the Renilla luciferase expression vector pRL-TK (Promega; Madison, Wl), and relative luciferase activity was determined as recommended by the manufacturer. Three independent transfections were performed for each allele. 5.2.7 PMN mediator release assay The released myeloperoxidase (MPO) were measured as previously described [4, 11]. See appendices for details. 5.2.8 Association study in the LHS cohort Since the TaqMan genotyping assay for -159C/T polymorphism could not be designed by Applied Biosystems, the 9019A/G polymorphism was used in an association study in the LHS cohort. The primers and probes were as follows: Forward primer: GGAGGATAGCCAAATCTGATCAGT; Reverse primer: CCTGGCI I I I ICTCCTTCATACTTG; Reporter 1: VIC- ACTGTACAGCAGGTTT; Reporter 2: FAM- TGTACGGCAGGTTT For detailed information about the LHS cohort please see Chapter 1. 5.2.9 Statistical analysis Assessment of Hardy-Weinberg equilibrium was performed using the R software package (www.r-project.org/). The difference in mRNA levels between different genotypes was analyzed using the non-parametric Wilcoxon test. A t-test was used to compare the difference in luciferase activity between different alleles. The comparison of the level of B--124-arrestin 2 mRNA before and after IL-8 stimulation was done by paired t-test. Association of the polymorphism with the rate of decline of lung function and the baseline level of lung function was evaluated using a logistic regression model. The level of significance used was <0.05. 5.3 Results 5.3.1 SNP discovery and validation of the p-arrestin 2 gene A novel SNP, -159 C/T relative to the transcription start site of the p-arrestin 2 gene, was identified by sequencing in the genotyping cohort. The RFLP assay for the -159 SNP is shown in Figure 5-2. The 1309 A/G and 9019 A/G polymorphisms were also detected (Figure 5-3 and Figure 5-4). The allele and genotype frequencies of these three polymorphisms in the gene expression cohort are listed in Table 5-3. The minor allele frequencies of these three SNPs were greater than 15% in Caucasians. However, the novel -159 C/T polymorphism could not be detected in Asians. The observed genotype frequencies in both ethnic groups conformed to expectations from Hardy-Weinberg equilibrium. There were pairwise allelic associations between these polymorphisms in both Asians and Caucasians (Table 5-4). Only one allele was detected at -803 A/G, -705 A/G and 11,908 C/T. The 4,683 A/G polymorphism was very rare with a minor allele frequency of 1.6%. The latter 4 polymorphisms were excluded from further study. 5.3.2 Genetic polymorphisms and p-arrestin 2 expression in PMNs One -159 TT homozygote and two 1309 AA and 9019 AA homozygotes were observed in the 60 Caucasian healthy volunteers. Due to their rarity, these samples were excluded from further analysis. We found that the -159C/T promoter polymorphism was significantly associated with the p-arrestin 2 mRNA level in Caucasians. The group with the CT genotype -125-had lower mRNA than the group with CC genotype (1.26±0.09 vs. 0.91 ±0.08, P=0.03). There was no association observed with mRNA level for other polymorphisms in either the Asian healthy volunteers (Figure 5-5) or the COPD patients (Figure 5-6). The three polymorphisms were not associated with the amount of released MPO in COPD patients (Figure 5-7). Upon IL-8 stimulation the mRNA level of p-arrestin 2 was significantly downregulated compared with the baseline (0.30±0.01 vs. 0.25±0.01, P<0.001) 5.3.3 Reporter gene assay of the -159C/T polymorphism To further characterize the influence of -159C/T on p-arrestin 2 production, a reporter gene assay was performed. The result was consistent with the data presented above in that the T allele had lower luciferase activity when compared with the C allele (0.86±0.16 vs. 1.00±0.18, P=0.004) (Figure 5-8). 5.3.4 p-arrestin 2 polymorphisms in the LHS cohort The 9019A/G polymorphism was used in the association study in the LHS cohort. There was no association between 9019A/G polymorphism and either the rate of decline of lung function (P=0.31) or the baseline of lung function (P=0.89) in the LHS cohort when analyzed by logistic regression models (Table 5-5 and Table 5-6). 5.4 Discussion The arrestin family consists of four members, visual arrestin (S-antigen) [12, 13], cone arrestin (X-arrestin), and two p-arrestins (P-arrestin 1 and p-arrestin 2) [14, 15]. The visual arrestin and the cone arrestin are expressed almost exclusively in the retina, whereas p-arrestins are expressed in a wide variety of tissues, p-arrestins not only desensitize GPCR, but also play multifaceted roles as adaptors and scaffolds connecting GPCR with an ever-growing list of signaling proteins, and organizing a number of signaling pathways. -126-The influence of genetic variants on gene expression or function is important. It has been suggested that a one base pair homozygous deletion in visual arrestin may be a frequent cause of a rare autosomal recessive disease (Oguchi disease) characterized by congenital stationary night blindness with all other visual functions normal [16]. In the present study we identified a novel SNP (-159 C/T) in the promoter region of the B-arrestin 2 gene in Caucasians. In the gene expression analysis, we found that this -159 C/T SNP exists in Caucasians but not in Asians, and that it is associated with the level of B-arrestin 2 in normal blood donors and expression levels in a reporter assay. The findings in the present study provide the first evidence of genetic control of B-arrestin 2 production. We speculate that the association between -159 C/T and mRNA level might be due to increased mRNA production from the C allele, as opposed to decreased degradation. There are several examples of promoter SNPs that affect gene transcription and protein production. Polymorphisms such as -308 G/A of the TNFa gene, -590 C/T of the IL-4 gene, and -251 G/A of the ferrochelatase gene all affect the binding of transcription factors and transcription activity, and result in different expression levels between different alleles [17-19]. By using several computer programs we analyzed the 2 kb of sequence upstream of the transcription start site of the B-arrestin 2 gene. We found that the first 350 bp immediately upstream of the start site was predicted to contain binding sites for many transcription factors, and the -159 position was adjacent to binding sites for Sp1, CTF, and GCR, which prompted us to perform the reporter gene assay of this region. It is possible that different alleles of the -159 C/T SNP affect the binding of transcription factors, and consequently result in different levels of mRNA and protein production of B-arrestin 2. However, it is also possible that the -159 C/T polymorphism is in linkage disequilibrium with other causal alleles, which are located either within the B-arrestin 2 gene or in other nearby genes. -127-Although we observed that the -159C/T polymorphism was associated with the mRNA level of p-arrestin 2 in the healthy individuals it was not duplicated in the COPD patients, under either the resting or stimulated condition. This implies that the regulation of p-arrestin 2 expression may be different in COPD patients from that in healthy individuals. It is known the transcription of a eukaryotic protein-coding gene is very complex. The promoters, in conjunction with enhancers, silencers and insulators, define the combinatorial codes that specify gene expression patterns. The core initiation machinery and large families of DNA sequence-specific binding transcription factors are required for the activation or enhancement of the process of transcription, and many co-activators and co-repressors are also required for mediating signals between sequence-specific transcription factors and the core machinery [20]. Thus, it is an intricate network that regulates gene expression at many layers and provides the plasticity required for cell specific development and function. In the COPD patients the p-arrestin 2 may not be expressed in the same way as in healthy people. It is noted that the level of p-arrestin 2 in the Caucasian healthy individuals was higher that that in the COPD patients although the healthy individuals were not matched with the COPD patients in several aspects. This may explain why the -159C/T polymorphism was not associated with the abundance of p-arrestin 2 transcript in the COPD patients. The TaqMan genotyping assay for the -159C/T polymorphism could not be successfully designed. The association study in LHS cohort was performed by using the 9019A/G polymorphism. The result indicated that the 9019A/G polymorphism was not associated with the two COPD-related phenotypes, baseline lung function and the rate of decline of lung function in the Lung Healthy Study cohort. However, the 9019A/G polymorphism was in lower LD with the -159C/T and 1309A/G in the Caucasian COPD patients than the healthy -128-individuals (Table 5-4). This may have contributed to the lack of association seen in the patients. In summary, we have identified a novel -159 C/T SNP in the promoter of the B-arrestin 2 gene in Caucasians, and found that it was associated with different B-arrestin 2 production in normal blood donors and with expression levels in a reporter assay. However, there was no association between the -159C/T polymorphism and the level of B-arrestin 2 in the COPD patients. -129-Table 5-1 Primers and restriction enzymes used for screening and validation of the B-arrestin 2 polymorphisms Primer pairs Restriction enzyme B-arrestin 2 promoter promoter ggccatggtaattcgtatgtg Nil Sequencing fragment 1 gccttccaggggatctaagt p-arrestin 2 promoter promoter gccactgagaaagcaaacaa Sequencing fragment 2 gccaagatccctgctcct Rs2055720(-807) promoter aaacttctgcgcatccttcg Taql cgatggggacacatacgaa rs9892602(-705) promoter aacttctgcgcatccttcag Ddel tgctattcactatgccaatcg Novel SNP(-159) promoter caagcatcacgcaattgaac BsaJI cccttgaaaccgattggac Rs3786047(+1309) intron agggagtgggacggatggat Taql gaggagcagcgtgcatatact Rs16954146(+4683) intron caacaaagcccagccttc Waell gcttcaggagggaaggaagt RS2271167(+9019) intron atcctagtgtgccagggatg BsrG I ctttcctgctcacccacatt Rs14540(+11908) intron ccaacacctcccattatgac Hin\ I tgatagcctccgtgtcaggt Table 5-2 Detailed p-arrestin 2 genotyping protocol for the -159C/T, 1309A/G and 9019A/G SNPs PCR buffer Mg 2+ primers Taq polymerase DNA template Annealing temperature Cycles Restriction enzyme Cut allele -159C/T 1x 1.5mM 0.5 nM 0.5 units 100ng 56 "C 30 10 unit of BsaJ\ C 1309A/G 1x 1.5mM 0.5 nM 0.5 units 100ng 56 °C 30 10 unit of Taol G 9019A/G 1x 1.5mM 0.5 |xM 0.5 units 100ng 55 °C 30 10 unit of BsrG\ A - 131 -Table 5-3 Genotype distribution of p-arrestin 2 polymorphisms in the study subjects Caucasian healthy individuals (N=60) Asian healthy individuals (N=35) Caucasian COPD patients (N=70) -159C/T C C 40 (66.7%) 35(100%) 45 (64.3%) CT 19(31.7%) 0 19(27.1%) TT 1 (1.6%) 0 6 (8.6%) T allele 17.5% 0 22.1% 1309A/G AA 2 (3.3%) 2 (5.7%) 9(12.9%) A G 21 (35.0%) 11 (31.4%) 30 (42.9%) G G 37 (61.7%) 22 (62.9%) 31 (44.3%) A allele 20.8% 21.4% 34.3% 9019A/G AA 2 (3.3%) 1 (2.9%) 9(12.9%) A G 20 (33.3%) 10(28.6%) 29 (41.4%) G G 38 (63.3%) 24 (68.6%) 32 (45.7%) A allele 20.0% 17.1% 33.6% The observed genotype frequencies conformed to what was expected by Hardy-Weinberg equilibrium (P>0.05). -132-Table 5-4 Pairwise allelic association between B-arrestin 2 polymorphisms -159C/T 1309A/G 9019 A/G Caucasian healthy volunteers -159C/T 1309A/G - 0.81 0.65 0.76 Caucasian C O P D patients -159C/T 1309A/G - 0.35 0.37 0.91 Asian healthy volunteers 1309A/G - 0.76 The allelic association (R2) was estimated by the R software package. The -159C/T polymorphism was not detected in the healthy Asian volunteers. Table 5-5 p-arrestin 2 genotype frequencies of the 9019A/G polymorphism in the LHS cohort with different rate of decline of lung function Fast decline Slow decline P value AA 29(11.0%) 23 (7.8%) 0.31 A G 121 (46.0%) 126 (42.9%) G G 113(43.0%) 145 (49.3%) There was no association between the 9019A/G polymorphism with the rate of decline of lung function (P=0.31) analyzed by logistic regression. -134-Table 5-6 p-arrestin 2 genotype frequencies of the 9019C/G polymorphism in the LHS cohort with different baseline of lung function High baseline Low baseline P value AA 54(10.3%) 54(10.7%) 0.89 A G 223 (42.6%) 198 (39.4%) G G 247 (47.1%) 251 (49.9%) There was no association between the 9019A/G polymorphism with the baseline of lung function (P=0.89) analyzed by logistic regression. -135-Arrb2 5' 4217162 3' 4228168 I I I • • B -coding region Figure 5-1 Schematic overview of the location and distribution of the investigated polymorphisms (SNPs) in the B-arrestin 2 gene The B-arrestin 2 gene is located on chromosome 17p13 (reference position indicated refers to the sequence NT_010718). The position of these SNPs in the B-arrestin 2 gene sequence (+1 is defined as the start of transcription) is as follows: -803 (rs2255720, G/A), -705 (rs9892602, G/A), -159 (novel SNP, C/T), +1309 (rs3786047, A/G), +4683 (rs16954146, A/G), +9019 (rs2271167, A/G), +11908 (rs14540, G/A), A_adenine, C _ cytosine, G _guanine, T _ thymine, and rs _ database SNP accession number. -136-1 2 3 4 5 6 7 8 9 10 11 12 M 600 bp 100 bp Figure 5-2 Detection of the novel -159C/T polymorphism of the B-arrestin 2 gene The 237bp amplified PCR products were digested by BsaJ\ and analyzed by electrophoresis on a 3% agarose gel. Lanes 1, 3, 4, 6, 7, 10, and 12 were C/C homozygotes. Lanes 2, 5, and 11 were T/T homozygotes. Lanes 8 and 9 were C/T heterozygotes. -137-1 2 3 4 5 6 7 8 9 10 11 12 13 M 600 bp 100 bp Figure 5-3 Detection of the 1309A/G polymorphism of the p-arrestin 2 gene The 209bp amplified PCR products were digested by Taq\ and analyzed by electrophoresis on a 3% agarose gel. Lanes 1, 4, 5, 7, 8 and 13 were G/G homozygotes. Lanes 2, 9, 10, and 11 were G/T heterozygotes. Lanes 3, 6, and 12 were T/T homozygotes. -138-Figure 5-4 Detection of the polymorphism 9019A/G of the p-arrestin 2 gene The 232bp amplified PCR products were digested by BsrG\ and analyzed by electrophoresis on a 2% agarose gel. Lanes 2-4, 6-12, 14, 15, and 17 were G/G homozygotes. Lanes 5, 13, and 17 were G/A heterozygotes. Lane 1 was an A/A homozygote. - 1 3 9 -B 1.4 1.2 "S ^ 0.8 -I 1 -s £ ^ 0.6 C -2 0.4 E 1 W 0.2 0 ft1 CC -159C/T 1.6 ^ 1.4 o 1 1 f 0 8 ^  "8 0.6 1 0 4 w 0.2 0 rh CC CT -159C/T 1.TJ2 1-03 AG G G 1309A/G i p ffl ~i r~ AG G G 1309A/G 1.fl6 0.90 AG G G 9019A/G ' i f f 0.56 " 1 1 — • 1 1 AG G G 9019A/G Figure 5-5 The genotypes and corresponding mRNA level of p-arrestin 2 in the healthy Asian (A) and Caucasian (B) individuals The CC genotype of the -159 C/T had higher level of p-arrestin 2 mRNA when compared with the CT genotype (P=0.03). There was no significant difference observed between other genotypes and the mRNA levels. The rare genotypes (AA of 1309A/G and AA of 9019A/G) are not shown in this graph. -140-CC CT TT -159C/T AA AG GG 1309A/G AA AG GG 9019A/G Figure 5-6 Genotypes and the mRNA level of the B-arrestin 2 before and after IL-8 challenge in the COPD patients There was no significant difference in the mRNA level of B-arrestin 2 between different genotypes of the B-arrestin 2 gene polymorphisms either before or after IL-8 stimulation (P>0.05). -141 -Figure 5-7 Genotypes of B-arrestin 2 polymorphisms and the amount of released MPO upon IL-8 stimulation in the healthy individuals and COPD patients There was no significant difference in the amount of released MPO between different genotypes in both the healthy individuals and the COPD patients (P>0.05). - 1 4 2 -O :• .33' CC " f c . ,o a "55 E i _ o 1 5 J 1 .4H 1.3-1.2H 1.1-1-0.9-0.8 H 0.7-0.6-0.5 Figure 5-8 Reporter gene assay of -159 C/T using A549 cells The points represent the normalized ratio of luciferase activity (see Methods) from every independent experiment. The lines are means ± standard deviation (SD). The mean luciferase activity was 0.86±0.16 for the T allele, and 1.00 ± 0.18 for the C allele (P=0.004 when compared by t-test). -143-5.5 References 1. Hamm HE, Gilchrist A. Heterotrimeric G proteins. Curr Opin Cell Biol 1996;8:189-96. 2. Kohout TA, Lefkowitz RJ. Regulation of G protein-coupled receptor kinases and arrestins during receptor desensitization. Mol Pharmacol 2003;63: 9-18. 3. Barlic J , Andrews JD, Kelvin AA, Bosinger SE, et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI. Nat Immunol 2000;1:227-33. 4. Barlic J , Khandaker MH, Mahon E, Andrews J, et al. beta-arrestins regulate interleukin-8-induced CXCR1 internalization. J Biol Chem 1999;274:16287-94. 5. Calabrese G, Sallese M, Stornaiuolo A, Morizio E, et al. Assignment of the beta-arrestin 1 gene (ARRB1) to human chromosome 11q13. Genomics 1994;24:169-71. 6. Calabrese G, Sallese M, Stornaiuolo A, Stuppia L, et al. Chromosome mapping of the human arrestin (SAG), beta-arrestin 2 (ARRB2), and beta-adrenergic receptor kinase 2 (ADRBK2) genes. Genomics 1994;23:286-8. 7. Kohout TA, Lin FS, Perry SJ, Conner DA, et al. beta-Arrestin 1 and 2 differentially regulate heptahelical receptor signaling and trafficking. Proc Natl Acad Sci U S A 2001 ;98:1601-6. 8. Avissar S, Matuzany-Ruban A, Tzukert K, Schreiber G. Beta-arrestin-1 levels: reduced in leukocytes of patients with depression and elevated by antidepressants in rat brain. Am J Psychiatry 2004;161:2066-72. 9. Fan XL, Zhang JS, Zhang XQ, Yue W, et al. Differential regulation of beta-arrestin 1 and beta-arrestin 2 gene expression in rat brain by morphine. Neuroscience 2003:117: 383-9. 10. Boyum A. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 1968;97: 77-89. -144-11. Lacy P, Mahmudi-Azer S, Bablitz B, Hagen SC, et al. Rapid mobilization of intracellularly stored RANTES in response to interferon-gamma in human eosinophils. Blood 1999;94:23-32. 12. Shinohara T, Dietzschold B, Craft CM, Wistow G, et al. Primary and secondary structure of bovine retinal S antigen (48-kDa protein). Proc Natl Acad Sci U S A 1987;84: 6975-9. 13. Yamaki K, Takahashi Y, Sakuragi S, Matsubara K. Molecular cloning of the S-antigen cDNAfrom bovine retina. Biochem Biophys Res Commun 1987;142: 904-10. 14. Lohse MJ, Benovic JL, Codina J , Caron MG, et al. beta-Arrestin: a protein that regulates beta-adrenergic receptor function. Science 1990;248:1547-50. 15. Attramadal H, Arriza JL, Aoki C, Dawson TM, et al. Beta-arrestin2, a novel member of the arrestin/beta-arrestin gene family. J Biol Chem 1992;267:17882-90. 16. Fuchs S, Nakazawa M, Maw M, Tamai M, et al. A homozygous 1-base pair deletion in the arrestin gene is a frequent cause of Oguchi disease in Japanese. Nat Genet 1995;10: 360-2. 17. Di Pierro E, Cappellini MD, Mazzucchelli R, Moriondo V, et al. A point mutation affecting an SP1 binding site in the promoter of the ferrochelatase gene impairs gene transcription and causes erythropoietic protoporphyria. Exp Hematol 2005;33: 584-91. 18. Kroeger KM, Carville KS, Abraham LJ. The -308 tumor necrosis factor-alpha promoter polymorphism effects transcription. Mol Immunol 1997;34: 391-9. 19. Rosenwasser LJ, Klemm DJ, Dresback JK, Inamura H, et al. Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy. Clin Exp Allergy 1995;25 Suppl 2: 74-8; discussion 95-6. 20. Lemon B, Tjian R. Orchestrated response: a symphony of transcription factors for gene control. Genes Dev 2000;14: 2551-69. -145-6 ASSOCIATION OF GENETIC POLYMORPHISMS OF THE LYST AND CRM1 G E N E S WITH G E N E EXPRESSION 6.1 Introduction We also investigated two additional genes involved in PMN degranulation; lysosomal trafficking regulator (LYST) and exportin 1 (CRM1). Mutations in the LYST gene are responsible for Chediak-Higashi Syndrome (CHS). CHS is a autosomal recessive disease characterized by severe immunologic defects including impaired chemotaxis of macrophages and PMNs [1-3], and lack of natural killer (NK) cell function leading to recurrent bacterial infections in the skin and respiratory tract [4, 5], The phagocytic ability of PMNs in patients who have CHS is normal, but there is a delay in fusion of phagosomes with lysosomes. This delay permits bacterial replication and escape leading to persistent infections. A CHS-like disorder has been found in various mammalian species including mouse, rat, mink, killer whale, cattle and cats [6-8] A positional cloning approach resulted in the identification of the CHS1/LYST gene on chromosome 1 in humans. This gene is among the largest genes identified in the human genome with a messenger RNA (mRNA) of approximately 11.5 kb. The protein encoded by this gene is 3801 amino acids and is highly conserved throughout evolution. The LYST protein is predicted to be a cytosolic protein with three to four defined domains which are important in protein-protein interaction and lipid association. However, the biochemical role that LYST plays in vesicular trafficking remains unknown [9]. -146-Identified mutations in the LYST gene include frameshift mutations identified at codons 40, 489, 633,1026 and 3197, non-sense mutations at codons 50, 566, and 1029 [10], as well as missense mutations [11]. These data establish that the full-length protein is needed for normal function. The final protein we investigated is exportin 1 (CRM1). CRM1 (named for 'required for chromosome region maintenance') is one of the components of the nuclear pore complex which is embedded in the double membrane of the nuclear envelope and is responsible for the transport of macromolecules between the nuclear and cytoplasmic compartments [12, 13]. CRM1 functions as a mediator for the nuclear export signals (NESs)-dependent transport of proteins. [14]. Leptomycin B, a specific inhibitor of the NES-dependent nuclear export of protein, is able to bind to CRM1 protein and specifically inhibits the nuclear export function [15]. A report by Brinkmann et al revealed a new mechanism that PMNs kill invading bacteria [16]. This mechanism involves the release by PMNs of azurophilic granule proteins and chromatin to form PMN extracellular traps (NETs) which bind bacteria, degrade virulence factors, and kill bacteria [16]. These data suggest that DNA plays an active role in antimicrobial defense, and nuclear export proteins may be involved in this process. The model of chemokine induced azurophilic granule degranulation proposed by Barlic et al suggested that Hck and B-arrestin form a complex and translocate to azurophilic granules and initiate the process of mediator release [17]. Studies in our group have found localization of CRM1 to azurophilic granules, and molecular association of CRM1 and -147-LYST with Hck and p-arrestin (unpublished data), which implies the involvement of LYST and CRM1 in the process of azurophilic granule exocytosis. Based on the essential role of LYST in lysosome trafficking and the preliminary result from our group indicating the involvement of LYST and CRM1 in the process of azurophilic granule exocytosis we hypothesized that genetic polymorphisms in these genes could modulate their expression in healthy individuals and in COPD patients, and affect the susceptibility to COPD and COPD related phenotypes. 6.2 Material and methods 6.2.1 Study subjects The genotyping cohort used for these studies consisted of 36 Caucasians. The gene expression cohort consisted of 95 healthy volunteers and 70 COPD patients. See Chapter 1 for details. 6.2.2 SNP selection and genotyping The LYST gene is located on chromosome 1q42.1-q42.2 with an approximate length of 210kb. The CRM1 gene is located on chromosome 2p16 with a length of 60kb. According to the SNP genotype data and the LD data of the HapMap project (http://www.hapmap.org) a set of tagging SNPs were selected including 4 SNPs for the LYST gene and 2 SNPs for the CRM1 gene. However, the TaqMan genotyping assay for one of the SNPs could not be successfully designed. A total of 5 SNPs were included for this study (Table 6-1). -148-6.2.3 PMN isolation and stimulation Polymorphonuclear leukocytes (PMNs) were isolated by a Dextran-Ficoll sedimentation and centrifugation method [18]. The time course study of PMN MPO release was performed at 2 min, 5 min, 10 min, and 30 min at 37QC, and 2 min for 10nM fMLP priming and 10 min for 100ng/ml IL-8 stimulation was finally selected. Genomic DNA was extracted from the mononuclear cells using a DNeasy Tissue Kit (Qiagen). 6.2.4 RNA extraction and cDNA synthesis Total RNA was isolated using an RNeasy Mini Kit (Qiagen) as described by the manufacturer and analyzed on an Agilent 2100 Bioanalyzer using the RNA 6000 Nano Labchip Kit (Agilent Technologies; Palo Alto, CA). First strand cDNA was synthesized using Superscript RNase H- Reverse Transcriptase (Invitrogen; Burlington, ON, Canada) and random primers (Invitrogen). 6.2.5 LYST and CRM1 mRNA and protein quantification To measure the mRNA level for LYST and CRM1 two assay-on-demand gene expression kits (Hs00185645_m1 and Hs00179814_m1, Applied Biosystems, CA, USA) were used. B-actin was selected as the reference gene for normalization (Applied Biosystems; CA, USA). The mRNA level of LYST and CRM1 of each subject was expressed as a ratio of LYST and CRM1 level over B-actin level. The amount of LYST and CRM1 protein in human PMNs was measured by flow cytometry. Permeabilized PMNs were subject to immunostaining with mouse anti-human CRM1 monoclonal antibody (Santa Cruz, US) and a custom-made rabbit anti-human -149-LYST polyclonal antibody. Rabbit IgG and Mouse IgG were used respectively as the negative controls. See Chapter 2 for the detailed protocol of immunostaining. Since LYST and CRM1 were included into this study after the recruitment of the healthy individuals the quantification of LYST and CRM1 protein was only performed in the COPD patient cohort. 6.2.6 PMN mediator release assay The released myeloperoxidase (MPO) were measured as previously described [19, 20]. See appendices for details. 6.2.7 Statistical analysis Assessment of Hardy-Weinberg equilibrium was performed using the R software package (www.r-project.org/). The differences in mRNA and protein levels between different genotypes were analyzed by using the non-parametric Wilcoxon test. The comparison of the level of LYST and exportin before and after IL-8 stimulation was done by paired t-test. The level of significance used was <0.05. 6.3 Results Representative TaqMan genotyping results of the LYST and CRM1 polymorphisms are shown in Figure 6-1 and Table 6-2. The genotype distribution of the investigated SNPs is summarized in Table 6-2. The observed genotype frequencies conformed to what are expected from Hardy-Weinberg equilibrium. The estimated pairwise LD in Asians and Caucasians is shown in Table 6-3 and Table 6-4. The standard curves of the realtime -150-PCR of LYST and CRM1 are shown in Figure 6-3. The flow cytometry analyses of LYST and CRM1 protein are shown in Figure 6-4. The resting level of LYST and CRM1 mRNA was compared between the healthy Caucasian individuals and the COPD patients using linear regression model including age and gender as covariates (Figure 6-5). We found that the healthy individuals had significantly higher LYST and CRM1 mRNA than the patients (0.083±0.008 vs. 0.028±0.001, P=0.0006 for LYST; 0.42±0.05 vs.0.17±0.01, P=0.0026 for CRM1). Since the protein level of LYST and CRM1 was not available in the healthy individuals, a similar comparison at the protein level could not be made. There was no association between genetic polymorphisms and the mRNA level of LYST and CRM1 in the healthy Asian and Caucasian volunteers (Table 6-5 and Table 6-6). In the COPD patient cohort, the genetic polymorphisms were not associated with the mRNA and protein of LYST and CRM1 under resting conditions (Table 6-7). Upon IL-8 stimulation CRM1 mRNA was significantly downregulated. However, there was no significant change in the level of CRM1 protein (Figure 6-6). The CRM1 polymorphism 51.202C/G was not associated with the change in CRM1 mRNA upon IL-8 stimulation (Figure 6-7). The level of LYST mRNA and protein did not change significantly after IL-8 stimulation (Figure 6-6). The 121.948A/G polymorphism of the LYST gene was marginally associated with LYST protein after IL-8 challenge (P=0.05) (Table 6-8). -151 -Polymorphisms 136.627C/T and 172.633A/G of the LYST gene were marginally associated with the amount of released MPO (P=0.06) in the healthy Caucasian individuals, but not in the COPD patients (Table 6-9Table 6-10). 6.4 Discussion PMNs are the major effector cells in the chronic airway inflammation of COPD. Excessive mediator release from azurophilic granules is closely associated with tissue injury and the pathogenesis of emphysema. The mechanisms underlining the process of azurophilic granule degranulation are not fully understood. In the model suggested by Barlic et al Hck and p-arrestins are essential molecules in this process [17]. Our group has found that two additional molecules, LYST and CRM1, are associated with Hck and p-arrestins. These data imply that LYST and CRM1 play a role in the process of PMN exocytosis. LYST, lysosome trafficking regulator, is the causal gene for the rare disease CHS which is characterized by abnormally large lysosomes and lysosome-related secretory granules [9, 21]. Although the biological function of LYST protein remains to be established these cellular defects in CHS have suggested that the LYST protein is involved in maintaining or possibly shuttling these vesicles to their proper location [21]. CRM1 is the first identified nuclear export protein. The new role that chromatin plays in killing bacteria in PMN extracellular traps suggests the possibility that nuclear export factors are also involved in azurophilic granule exocytosis [16]. -152-LYST (210 kb) and CRM1 (60 kb) are big genes given that the average gene in the human genome spans ~27 kb [22, 23]. The predicted common polymorphic sites of these two genes could number in the hundreds if they occur every ~600 bp [24]. It is not efficient and practical to study all existing common polymorphism. Therefore, studying the tagSNPs of the LYST and CRM1 gene is more efficient since a number of polymorphisms have been described to be strongly correlated. In this study we investigated 4 intronic polymorphisms of the LYST gene and 1 intronic polymorphism of the CRM1 gene. The 4 SNPs of the LYST gene were in high LD (R2 >0.8) with approximately 30 other SNPs which were scattered throughout the LYST gene, and the investigated CRM1 polymorphism (51.202C/G) was also closely linked with another 10 CRM1 polymorphisms (R2>0.85). Thus, these polymorphisms may maximally reveal the genetic information of all these variants. The expression pattern of the LYST and CRM1 gene in PMNs were systematically explored. We observed that the healthy Caucasian individuals had significantly higher LYST and CRM1 mRNA compared with the COPD patients. This may imply that LYST and CRM1 are differently expressed in the COPD patients from the normal individuals. Since the protein level of these two molecules were not available in the healthy individuals it is unknown if similar differences were also present at the protein level. However, LYST and CRM1 may be associated with COPD. A number of studies have suggested that the full length LYST protein is critical in the process of lysosome trafficking. It is conceivable that insufficient LYST protein could affect lysosome trafficking as well as the phagocytic ability of PMNs, and lead to the insufficient defense against invading pathogens and persistent infection or inflammation, and thus contribute to -153-COPD development. The reason that LYST and CRM1 were less expressed in the COPD patients remains to be determined. We did not find association between the studied polymorphisms and the resting level of LYST and CRM1 mRNA and/or protein in both the healthy volunteers and the COPD patients. This implies that the influence of the genetic polymorphisms on gene expression of these two molecules is limited. Upon IL-8 stimulation the 121,948A/G polymorphism of the LYST gene was marginally associated with the differential expression of LYST protein (P=0.05). Since LYST is a large gene, and this polymorphism was in LD with approximately 20 other LYST polymorphisms the causal locus for this observation remain to be determined. In summary, we investigated 4 tagSNPs of the LYST gene and 1 of the CRM1 gene in the healthy individuals and in the COPD patients. We did not find significant association between these SNPs and the expression level of the two genes. However, LYST and CRM1 may still be important in the pathogenesis of COPD. -154-T a q M a n g e n o t y p i n g a s s a y s of the L Y S T and C R M 1 g e n e s f rom A p p l i e d B i o s y s t e m s r- —f A r\ A A ; /""\ Primer sequence Reporter sequence 57,121A/C LYST Forward- G A G A C T G T T G G T G C T C C C T A A C V I C - A C T A T T T C A G G T A T T G C T G (rs6670720) Intron Reverse- G T C C T G A T G C A A A G T A G A C A G T C A F A M - T T T C A G G G A T T G C T G 121.948A/G LYST Forward- T G G T C A T T C C T C A T A A A A T A A T T G A G A T T T C A G T VIC- A T T T T G C T T T C A A T A A A G T (rs10754726) Intron Reverse- TTCTTTTTTCTGAATACAAAAGTTATAATGTGCTAATTACTT F A M - A T T T T G C T T T C A G T A A A G T 136.627C/T LYST Forward- G C A G C A C A G A T G A G C T A G A A A T A C T VIC- T C T T T C G T G A G A T T T G (rs7541057) Intron Reverse- G C A A G G A A C A A G G T A A A A T A A A A T G T A A C G A F A M - A T A T C T T T C A T G A G A T T T G 172.633A/G LYST Forward- T G T T G G A C A T T A G G G T T T C T A A G C T T T VIC- A T A G A C T C T T A C A G T A T A C T C (rs7545788) Intron Reverse- G T G C T T A C C T G T A T T T G C G A T A G C F A M - A C T C T T A C G G T A T A C T C 51,202C/G CRM1 Forward- G C T T G C T G C C A T C T T A C A T A T A C A G VIC- C T G C C A C C T A A C T T G G A G A (rs3821222) Intron Reverse- T G A G G C T C A A A A T T C A G T G G G T F A M - T G C C A C C T A A G T T G G A G A - 155-Table 6-2 Genotype distribution of the LYST and CRM1 polymorphisms Caucasian Genotype Asian healthy volunteers healthy volunteers Caucasian COPD patients LYST 57.121A/C AA 0 2 (3.3%) 4 (5.7%) AC 2 (5.7%) 18(30.0%) 30 (42.9%) C C 33(94.3%) 40 (66.7%) 36 (51.4%) LYST 121,948/VG AA 27 (77.1%) 25 (41.7%) 17(24.3%) A G 8 (22.9%) 31 (51.7%) 40 (57.1%) G G 0 4 (6.7%) 13(18.6%) LYST 136.627C/T C C 23 (65.7%) 17(28.3%) 11 (15.7%) CT 10(28.6%) 35 (58.3%) 42 (60.0%) TT 2 (5.7%) 8(13.3%) 17(24.3%) LYST 172.633A/G AA 24 (68.6%) 13(21.7%) 12(17.1%) A G 11 (31.4%) 37 (61.7%) 39 (55.7%) G G 0 10(16.7%) 19(27.1%) CRM1 51.202C/G C C 18(51.4%) 19(31.7%) 24 (34.3%) C G 16(45.7%) 28 (46.7%) 36 (51.4%) G G 1 (2.9%) 13(21.6%) 10(14.3%) The observed genotype frequencies conformed to those expected from Hardy-Weinberg equilibrium in both healthy individuals and COPD patients (P>0.05). -156-Table 6-3 Pairwise allelic association (r2) in healthy Asian volunteers LYST121.948 LYST136,627 LYST172,633 LYST57.121 0.03 0.12 0.16 LYST121.948 0.52 0.69 LYST136,627 0.57 Table 6 - 4 Pairwise allelic association (r2) in the healthy Caucasian volunteers LYST121.948 LYST136,627 LYST172,633 LYST57.121 0.39 0.18 0.19 LYST121.948 0.40 0.53 LYST136,627 0.63 Table 6-5 Genotype distribution and the mRNA level of LYST and CRM1 in the healthy Asian individuals SNP Genotypes No MeantSE (mRNA) P value LYST 57.121A/C AC 1 0.08 CC 30 0.07010.011 121.948A/G AA 26 0.07310.012 0.91 AG 5 0.05810.019 136.627C/T CC 23 0.06810.013 0.69 CT 6 0.07710.026 TT 2 0.078010.006 172.633A/G AA 24 0.07110.013 0.57 AG 7 0.06810.015 CRM1 51.202C/G CC 16 0.28810.047 0.61 CG 15 0.37210.077 The mRNA levels of LYST and CRM1 are expressed as mean ± SE, and they have been normalized by (3-actin. There was no association between different genotypes and the level of mRNA of LYST and CRM1 in Asian healthy individuals when analyzed by non-parametric Wilcoxon test. -159-Table 6-6 Genotype distribution and the mRNA level of LYST and CRM1 in the healthy Caucasian individuals Genotypes No Mean±SE (mRNA) P value LYST 57.121A/C AA 2 0.051 ±0.041 0.68 AC 18 0.075±0.010 CC 40 0.088±0.011 121.948A/G AA 25 0.088±0.016 0.5 AG 31 0.083±0.010 GG 4 0.051 ±0.023 136.627C/T CC 17 0.068±0.011 0.68 CT 35 0.09310.013 TT 8 0.06910.013 172.633A/G AA 13 0.07210.014 0.96 AG 37 0.08610.012 GG 10 0.08410.015 CRM1 51.202C/G CC 19 0.35710.052 0.69 CG 28 0.44910.067 GG 13 0.46510.141 The mRNA levels of LYST and CRM1 are expressed as mean ± SE, and they have been normalized by B-actin. There was no association between different genotypes and the level of mRNA of LYST and CRM1 in Caucasian healthy individuals when analyzed by non-parametric Wilcoxon test. -160-Table 6-7 Genotypes and the levels of mRNA and protein of LYST and CRM1 under resting conditions in the COPD patients Resting Resting No mRNA P value* protein P value** LYST 57.121A/C AA 4 0.01910.004 0.12 31.25111.60 0.88 A C 30 0.02910.002 27.5712.12 C C 36 0.02910.002 25.7512.35 121,948A/G AA 17 0.03110.003 0.07 22.4712.36 0.16 A G 40 0.02910.002 29.0012.09 G G 13 0.02310.002 25.9214.92 136.627C/T C C 11 0.03010.004 0.71 21.7313.02 0.1 CT 42 0.02910.002 28.8812.15 TT 17 0.02510.002 25.1213.42 172.633A/G AA 12 0.030+0.004 0.82 21.3312.87 0.11 A G 39 0.03010.002 28.9212.26 G G 19 0.02610.002 26.0513.17 CRM1 51.202C/G C C 24 0.16210.011 0.93 14.7511.44 0.95 C G 36 0.17210.019 15.1711.30 G G 10 0.15710.023 14.0012.17 The mRNA and protein level are expressed as mean ± SE. There was no significant difference between different genotypes and mRNA and protein level of LYST and CRM1 under resting conditions among COPD patients when analyzed by non-parametric Wilcoxon test. *P value for the comparison of mRNA ** P value for the comparison of protein -161 -Table 6-8 Genotypes and the levels of mRNA and protein of LYST and CRM1 under stimulated conditions in the COPD patients No Stimulated mRNA P value* Stimulated protein P value** L Y S T 5 7 . 1 2 1 A / C A A 4 0 . 0 2 3 1 0 . 0 1 1 0 . 5 6 2 5 . 2 5 1 8 . 0 6 0 . 8 9 A C 3 0 0 . 0 3 9 1 0 . 0 0 8 3 1 . 2 3 1 3 . 2 1 C C 3 6 0 . 0 3 7 1 0 . 0 0 6 2 8 . 7 5 1 2 . 6 1 1 2 1 , 9 4 8 A / G A A 1 7 0 . 0 4 1 1 0 . 0 1 0 0 . 9 9 2 4 . 2 9 1 2 . 9 8 0 . 0 5 A G 4 0 0 . 0 3 5 1 0 . 0 0 6 3 3 . 2 2 1 2 . 5 0 G G 1 3 0 . 0 3 7 1 0 . 0 1 1 2 5 . 4 6 1 5 . 5 8 1 3 6 . 6 2 7 C / T C C 1 1 0 . 0 3 6 1 0 . 0 1 1 0 . 5 2 2 3 . 0 0 1 3 . 2 7 0 . 0 6 C T 4 2 0 . 0 3 4 1 0 . 0 0 6 3 3 . 3 3 1 2 . 7 0 T T 1 7 0 . 0 4 5 1 0 . 0 1 1 2 4 . 7 1 1 3 . 5 3 1 7 2 . 6 3 3 A / G A A 1 2 0 . 0 3 3 1 0 . 0 1 1 0 . 3 2 2 3 . 0 0 1 3 . 5 0 0 . 0 7 A G 3 9 0 . 0 3 4 1 0 . 0 0 6 3 3 . 5 9 1 2 . 8 8 G G 1 9 0 . 0 4 5 1 0 . 0 1 0 2 5 . 6 3 1 3 . 0 8 C R M 1 5 1 . 2 0 2 C / G C C C G G G 2 4 3 6 1 0 0 . 1 1 5 1 0 . 0 1 5 0 . 0 9 4 1 0 . 0 1 0 0 . 0 6 9 1 0 . 0 1 3 0 . 2 4 1 5 . 0 8 1 1 . 8 6 1 7 . 6 4 1 1 . 6 1 1 4 . 7 0 1 2 . 3 6 0 . 5 4 The mRNA level is expressed as the ratio of target gene over B-actin. The mRNA and protein level in the table are mean ± SE. There was no significant difference between different genotypes and mRNA and protein level of LYST and CRM1 under stimulated conditions among COPD patients when analyzed by non-parametric Wilcoxon test. *P value for the comparison of mRNA ** P value for the comparison of protein -162-Table 6-9 LYST and CRM1 genotypes and the amount of released MPO after IL-8 stimulation in the Caucasian COPD patients No released % MPO P value LYST 57,121A/C AA 3 4.4110.86 0.88 AC 26 5.0510.42 C C 29 5.4210.51 121.948A/G AA 14 5.6010.66 0.33 A G 32 4.9910.47 G G 12 5.3110.43 136.627C/T C C 8 4.7810.77 0.19 CT 35 5.1510.46 TT 15 5.5410.42 172.633A/G AA 9 5.0010.66 0.09 A G 33 4.9410.47 G G 16 5.8410.49 CRM1 51.202C/G C C 17 5.7310.60 0.39 C G 32 5.0910.45 G G 9 5.2510.58 There was no association between the amount of released MPO and genotypes of the polymorphisms in the COPD subjects when analyzed by non-parametric Wilcoxon test. -163-Table 6-10 LYST and CRM1 genotypes and the amount of released MPO after IL-8 stimulation in the Caucasian healthy volunteers Genotype No % released MPO P value LYST 57.121A/C AA 1 11.58 0.12 AC 12 9.0015.02 C C 28 6.5813.10 121.948A/G AA 21 6.2713.06 0.08 A G 17 8.4014.67 G G 3 9.6311.85 136.627C/T C C 16 6.2913.26 0.06 CT 21 7.6414.26 TT 4 10.6012.45 172,633/VG AA 16 6.2913.26 0.06 AG 21 7.6414.26 G G 4 10.6012.45 CRM1 51.202C/G C C 12 5.7210.91 0.10 C G 19 7.4210.69 G G 10 9.3811.69 There was no association between the amount of released MPO and genotypes of the polymorphisms in the healthy subjects when analyzed by non-parametric Wilcoxon test. -164-M a r k e r : | c R M 1 _ S 1 2 0 2 33 Ca l l : j u n i j . - w . - | [ >t ^ I O I ^ j j 1 M B D i s c r i m i n a t i o n P l o t Allele X ( O R M 1 _ 5 1 2 e ? C > Figure 6-1 TaqMan genotyping of the 51,202C/G polymorphism of the CRM1 gene The X-axis was the C allele labeled with fluorescence FAM, and the Y-axis was the G allele labeled with fluorescence VIC. The group A was GG homozygote. The group C was CC homozygote. The group B was CG heterozygote. The black dots at the lower left corner were negative controls. -165-Figure 6-2 TaqMan genotyping of the 136.627C/T polymorphism of the LYST gene The X-axis was the C allele labeled with fluorescence FAM, and the Y-axis was the T allele labeled with fluorescence VIC. The group A was TT homozygote. The group C was CC homozygote. The group B was CT heterozygote. The black dots at the lower left corner were negative controls. -166-Standard Curve Plot Detector: [LYST - | S t a n d a r d P l o t Detector: [cRM1 -• I S t a n d a r d Plot tX> 1.0 B»1 1.0 1.0 & 0 t l W 1.0 E«5 DEM Figure 6-3 Standard curves of LYST and CRM1 The upper panel is the standard curve of the LYST gene. The lower panel is the standard curve of the CRM1 gene. lgG1:10 CRM1:32 Jh 102 FL210G/FL2LOO B 5330-0 IIP lgG1:20 LYST: 42 _____ K » . v t . 1 0 ' 1 0 * 1 0 5 F L 2 L O G / F L 2 L O G Figure 6-4 Analysis of LYST and CRM1 staining by flow cytometry (A) CRM1 staining on permeabilized PMNs and mouse lgG1 was used as the negative control; (B) LYST staining on permeabilized PMNs, and rabbit IgG was used as the negative control. -168-O (0 >-0) > < Z CC E 0.500 -, 0.450 0.400 0.350 -0.300 -0.250 -0.200 0.150 -0.100 -0.050 0.000 0 083 0.028 LYST CRM1 • control • patient Figure 6-5 The mRNA level of LYST and CRM1 in the healthy individuals and COPD patients at resting condition The healthy individuals had significantly higher LYST and CRM1 mRNA compared with the COPD patients (P<0.0001 respectively) when analyzed using non-parametric Wilcoxon test. -169-Z 0.400 -DC E 0.350 -0 4 1 , , , Resting Stimulated Resting Stimulated L Y S T C R M 1 Figure 6-6 The mRNA and protein level of LYST and CRM1 before and after IL-8 stimulation There was significant decrease of CRM1 mRNA after IL-8 challenge (0.099±0.008 vs. 0.168±0.011, P<0.0001). There was no significant difference observed in the level of LYST mRNA and LYST and CRM1 protein (P>0.05). -170-0.000 z -0.020 £ ^ -0.040 " -0.060 o . • > -0.080 a> C C C G G G 0) £= O -0.100 -0.120 H -0.ID46 0.088 Figure 6-7 CRM1 genetic polymorphism 51.202C/G and the change in the expression level of CRM1 mRNA upon IL-8 stimulation in the COPD patients There was no association between 51,202C/G polymorphism and the change in CRM1 mRNA level upon IL-8 stimulation when analyzed by the non-parametric Wilcoxon test (P>0.05). -171 -6.5 References 1. Baehner RL. Molecular basis for functional disorders of phagocytes. J Pediatr 1974;84:317-27. 2. Lynch MJ. Mechanisms and defects of the phagocytic systems of defense against infection. Perspect Pediatr Pathol 1973;1:33-115. 3. Quie PG. Bactericidal function of human polymorphonuclear leukocytes. E. Mead Johnson Award Address. Pediatrics 1972;50: 264-70. 4. Blume RS, Wolff SM. The Chediak-Higashi syndrome: studies in four patients and a review of the literature. Medicine (Baltimore) 1972;51:247-80. 5. Padgett GA. Neutrophilic function in animals with the Chediak-Higashi syndrome. Blood 1967;29:906-15. 6. Padgett GA, Reiquam CW, Gorham JR, Henson JB, et al. Comparative studies of the Chediak-Higashi syndrome. Am J Pathol 1967;51:553-71. 7. Lutzner MA, Lowrie CT, Jordan HW. Giant granules in leukocytes of the beige mouse. J Hered 1967;58: 299-300. 8. Nishimura M, Inoue M, Nakano T, Nishikawa T, et al. Beige rat: a new animal model of Chediak-Higashi syndrome. Blood 1989;74: 270-3. 9. Shiflett SL, Kaplan J , Ward DM. Chediak-Higashi Syndrome: a rare disorder of lysosomes and lysosome related organelles. Pigment Cell Res 2002;15:251-7. 10. Spritz RA. Genetic defects in Chediak-Higashi syndrome and the beige mouse. J Clin Immunol 1998;18: 97-105. 11. Karim MA, Suzuki K, Fukai K, Oh J, et al. Apparent genotype-phenotype correlation in childhood, adolescent, and adult Chediak-Higashi syndrome. Am J Med Genet 2002;108:16-22. 12. Macara IG. Transport into and out of the nucleus. Microbiol Mol Biol Rev 2001 ;65: 570-94, table of contents. 13. Adam SA. The nuclear pore complex. Genome Biol 2001 ;2: REVIEWS0007. 14. Fukuda M, Asano S, Nakamura T, Adachi M, et al. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 1997;390: 308-11. -172-15. Fornerod M, Ohno M, Yoshida M, Mattaj IW. CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 1997;90:1051-60. 16. Brinkmann V, Reichard U, Goosmann C, Fauler B, et al. Neutrophil extracellular traps kill bacteria. Science 2004;303:1532-5. 17. Barlic J , Andrews JD, Kelvin AA, Bosinger SE, et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI. Nat Immunol 2000;1: 227-33. 18. Boyum A. Isolation of mononuclear cells and granulocytes from human blood. Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand J Clin Lab Invest Suppl 1968;97: 77-89. 19. Lacy P, Mahmudi-Azer S, Bablitz B, Hagen SC, et al. Rapid mobilization of intracellular^ stored RANTES in response to interferon-gamma in human eosinophils. Blood 1999;94: 23-32. 20. Barlic J , Khandaker MH, Mahon E, Andrews J , et al. beta-arrestins regulate interleukin-8-induced CXCR1 internalization. J Biol Chem 1999;274:16287-94. 21. Ward DM, Griffiths GM, Stinchcombe JC, Kaplan J . Analysis of the lysosomal storage disease Chediak-Higashi syndrome. Traffic 2000;1: 816-22. 22. Lander ES, Linton LM, Birren B, Nusbaum C, et al. Initial sequencing and analysis of the human genome. Nature 2001 ;409: 860-921. 23. Venter JC, Adams MD, Myers EW, Li PW, et al. The sequence of the human genome. Science 2001 ;291:1304-51. 24. Kruglyak L, Nickerson DA. Variation is the spice of life. Nat Genet 2001 ;27: 234-6. -173-7 SUMMARY COPD is one of the most common chronic airway inflammatory diseases in the world. It contributes a great burden to the economy, to society and to the individuals who suffer from the disorder. The pathogenesis of COPD is still not clear. The major environmental risk factor is tobacco smoke [1]. However, the genetic component has received more and more attention although COPD is not a disease controlled by a single major gene. Studies of lung or bronchial biopsies and induced sputum have shown evidence of enhanced inflammation in cigarette smokers and patients with COPD. PMNs have been considered as the major effector cells in the chronic airway inflammation. Azurophilic granules in PMNs are well known for their microbicidal activity, and the stored serine proteinases, such as elastase, cathepsin G, and proteinase 3, have the potential to degrade almost all the components of the extracellular matrix of the lung. Uncontrolled mobilization and exocytosis of PMN granules are currently believed to play a crucial role in the pathogenesis of pulmonary emphysema [2]. 7.1 Novelty of the study design The mechanism underlying azurophilic granule mobilization and release remains largely unknown. Previous studies have suggested that several molecules are critical in this process, such as Hck, CD63 and Arrb2 [3]. Preliminary results from our group have found that the interaction of two additional molecules, CRM1 and LYST, with Hck, CD63 and Arrb2, which are involved in azurophilic granule exocytosis. In this study we focused on searching for genetic polymorphisms which lead to loss-of-function or gain-of-function phenotypes to study the biological role of these molecules in PMN degranulation and -174-COPD pathogenesis. We searched for new polymorphisms of these genes, validated putative polymorphisms, estimated their linkage disequilibrium pattern, and finally we investigated the correlation of genetic polymorphisms with gene expression and PMN function in both healthy individuals and COPD patients. In order to further evaluate whether these polymorphisms are correlated with COPD, we did the association studies in the LHS cohort. To our knowledge, there has been no similar study to address these issues by making use of this strategy, and there has been no detailed study on the correlation of genetic polymorphisms with gene expression of these 5 genes. 7.2 Significant findings in this study This study has produced several informative and novel results. 7.2.1 Reference genes for gene expression study in PMNs PMNs have frequently been implicated in the pathogenesis of many diseases. A number of studies have been performed on the mechanisms that regulate the bioactivity of PMNs. Real-time PCR, as one of the most sensitive and flexible quantification methods for gene expression analysis, has been used more and more widely, and ideal reference genes are critical for accurate interpretations of the gene expression data. In this study we investigated 10 commonly used housekeeping genes, compared their expression stability and expression level, and found that 5 of these genes are satisfactory references for gene expression studies in human PMNs. This is the first study that explored reference genes in PMNs and the findings provided scientific guidance for researchers who are interested in PMN study. These data have been published in a paper in the journal BMC Molecular Biology. -175-7.2.2 Novel polymorphism 8.656L/S of the Hck gene We identified a novel polymorphism in the Hck gene (8,656L/S), which was a 15 bp insertion/deletion polymorphism located in intron 1. The 8,656L/S polymorphism was associated with differential expression of the Hck protein and mediator release from PMNs upon chemokine challenge in the healthy Caucasian subjects. Subjects with the SS genotype had significantly higher Hck protein and more MPO release upon IL-8 stimulation compared with subjects with LL or LS genotype. In the Lung Healthy Study cohort, COPD patients with SS genotype tended to have significantly lower bronchodilator response compared with the patients who had LL and LS genotypes. Taken together these results indicated that this insertion/deletion polymorphism may be a functional polymorphism of the Hck gene, which modulated gene expression and altered PMN function although further studies are required to justify this conclusion. The reason for the association is to be determined. However, there have been other examples of intronic polymorphisms that correlate with gene expression and function. The insertion/deletion (indel) polymorphism in the angiotensin converting enzyme (ACE) gene is one of these examples [4]. Since Rigat et al. identified this 287 bp indel polymorphism in intron 16 of the ACE gene and showed it correlated with the level of circulating ACE in plasma this polymorphism has received much attention. Numerous subsequent studies have suggested that the indel polymorphism is associated with a number of phenotypes and has profound clinical implications. -176-7.2.3 Novel polymorphism -159C/T of the B-arrestin 2 gene Another novel polymorphism that we identified was -159C/T which was in the promoter region of the p-arrestin 2 gene. Interesting, we found this polymorphism was only present in Caucasians, not in Asians, and it was associated with differential expression of p-arrestin 2 gene mRNA in PMNs in the healthy Caucasian volunteers. Subjects with the CC genotype had significantly higher Arrb2 mRNA than the subjects with CT genotype. Since we could not measure the protein level of Arrb2 in PMNs it is still unknown if a similar difference is present at the protein level. However, the reporter gene study indicated that CC genotype had higher luciferase activity than the CT genotype, which further supported the finding that different alleles of -159C/T polymorphism are associated with different level of gene expression. As to mediator release from PMNs, although there was a difference in the amount of released MPO in these genotypic groups (7.79±0.33 vs. 6.55±0.95) this did not achieve statistical significance. 7.2.4 Gene expression pattern in healthy individuals and COPD patients The gene expression studies in the healthy subjects were designed to assess whether genetic polymorphisms of these critical molecules contribute to altered PMN function in all individuals or only in the specific context of COPD. In fact, we found the expression levels of these genes were dramatically different in the COPD patients from that in the healthy individuals. For example, the level of Hck and p-arrestin 2 mRNA in healthy individuals was significantly lower compared with the COPD patients. This implies that different factors regulated gene expression in the COPD patients than in the healthy subjects. Usually genes are regulated by complex networks and the expression level is determined by specific factors, such as age, gender, smoking status, medications, etc. In -177-this study almost all the COPD patients were old (-70 years old), former or current heavy smokers, and on corticosteroid (CS) treatment. CS molecules penetrate the cell membrane and then bind to the glucocorticoid receptor (GR) through the CS-binding domain. The active CS-GR complex translocates from the cytosol to the nucleus of the cell, where it binds to specific DNA sequences (glucocorticoid response elements [GRE]) in the promoter region of target genes, leading to an increase or a decrease in gene transcription. Alternatively, the active CS-GR complex can interact directly with intracellular transcription factors, such as activating protein-1 or nuclear factor-icB, through a protein-protein interaction to attenuate proinflammatory processes mediated by transcription factors [5]. CS was often used in combination with a long-acting B2-agonist in our COPD patients. There is emerging evidence of an interaction between these two drugs. Long-acting B2-agonists can prime the GR for subsequent CS binding and increase the translocation of the GR from the cell cytosol to the nucleus, which enhances the CS effect. Thus, the effects of the genetic polymorphisms on gene expression apparent in the healthy controls could be diluted or totally masked in the COPD patients. Other factors such as age and smoking history may also have had effects on gene expression that mask allele specific expression. These reasons may explain why there was no association observed between genetic polymorphisms and gene expression in the COPD patient. 7 . 3 Power of the study The power of a study is mainly determined by sample size. Given the allele or genotype frequencies of a polymorphism and the mRNA or protein level of one genotype, a larger sample size can detect a smaller difference in the expression levels between different -178-genotypes. For example, C and T are the two alleles of one SNP, and the allele frequency was 0.7 for C and 0.3 for T. According to Hardy-Weinberger Equilibrium the genotype frequencies for CC, CT and TT will be 0.49, 0.42 and 0.09. If CC is presumed to be the reference genotype with the mRNA level of 1.5, the detectable expression level under the sample size of 60 for CT and TT genotype will be 1.9 and 2.2 given the power of 80% (6=0.8) and the significance level of 0.05 (a=0.05). If the sample size is 100, the detectable expression level is brought down to 1.8 and 2.0. Therefore, the study with larger sample size is more sensitive to detect the difference between subgroups. Table 7-1 lists the detectable mRNA level for CT and TT genotype under different allele frequency and different sample size with a=0.05, B=0.80 for a two side test. As to the association study in LHS cohort we think that it had sufficient power to detect potential associations. For example, in the association study of the 8,656L/S polymorphism and the rate of decline of lung function in the LHS cohort, we did not find association between the polymorphism and the phenotype. After estimation of the minimum detectable odds ratio (OR) with the current sample size (225 cases and 262 controls) and SS genotype frequency (47%) we believe that this study provided meaningful information because it had 80% power to detect an association with an ORS1.67 (Table 7-2). Our results show that the 8656L/S polymorphism was a not risk factor for rapid rate of decline of lung function because the ORs were close to 1 in all possible genetic models. -179-7.4 Future directions 7.4.1 Perform gene expression study in a large well-matched non COPD cohort In this study the healthy volunteers and the COPD patients for the gene expression study were not well matched on age, gender and smoking status. Therefore, the difference in the level of gene expression between these two groups is difficult to interpret. However, information on gene expression of these target genes in COPD patients and matched controls would be very helpful for understanding disease pathogenesis, and recruitment of a matched non COPD cohort is important. At the same time, recruitment of more study subjects in each group can increase the power of the study and detect even smaller difference between different genotypes. 7.4.2 Perform association study in a COPD cohort and non COPD cohort A large scale association study of several thousand cases and controls will more definitively assess if these potential functional polymorphisms contribute to the susceptibility to COPD. Unfortunately, there was no such large scale cohort available for these studies. 7.4.3 Perform further studies to investigate the functional consequence of the polymorphisms In this study we identified two novel polymorphisms. We also found that several polymorphisms were associated with differential expression of the genes. However, it remains unknown if these polymorphisms are the real functional polymorphisms or merely in linkage disequilibrium with the causal variants. In addition, the precise mechanism by which these polymorphisms modulate the pattern of gene expression -180-should be elucidated. For example, we performed a reporter gene assay in a cell line for the -159C/T polymorphism of the Arrb2 gene, which supported our finding in the healthy subjects. A further study could be to use a gel shift assay to determine whether there are changes in DNA-protein binding at the polymorphic site. In addition, the association of the polymorphisms with gene expression and PMN mediator release was studied in periphery blood. It would be more informative, but challenging to study the function of PMNs which infiltrate in the lung tissues. -181 -Table 7-1 Minumum detectable mRNA level under different allele frequencies and different sample size with <x=0.05, 6=0.80 for a two side test Frequency genotypes Genotype Detectable mRNA level of minor allele T frequency N=60 N=100 N=150 0.1 CT TT 0.18 0.01 1.98 1.87 1.80 2.51 0.2 CT 0.32 1.90 1.81 1.75 TT 0.04 2.36 2.23 2.10 0.3 CT 0.42 1.89 1.80 1.74 TT 0.09 2.15 2.02 1.93 0.4 CT 0.48 1.90 1.81 1.75 TT 0.16 2.07 1.93 1.85 The presumed reference genotype is CC with the mRNA level of 1.5. Table 7-2 Minimum detectable odds ratio for a sample size of 225 cases and 262 controls with a=0.05 and (3=0.80 for a two sided test Prevalence of polymorphism* Minimum detectable OR (susceptive) Minimum detectable OR (protective) 5% 2.58 0.18 10% 2.09 0.35 20% 1.80 0.49 30% 1.70 0.55 40% 1.67 0.58 50% 1.67 0.60 individuals who have the SS genotype of the 8656L/S polymorphism. OR=odds ratio -183-7.5 References 1. Pauwels RA, Buist AS, Calverley PM, Jenkins CR, et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 2001 ;163:1256-76. 2. Witko-Sarsat V, Rieu P, Descamps-Latscha B, Lesavre P, et al. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 2000;80: 617-53. 3. Barlic J , Andrews JD, Kelvin AA, Bosinger SE, et al. Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI. Nat Immunol 2000;1:227-33. 4. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, et al. An insertion/deletion polymorphism in the angiotensin l-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86:1343-6. 5. Barnes PJ. Molecular mechanisms of glucocorticoid action in asthma. Pulm Pharmacol Ther 1997;10: 3-19. -184-APPENDICES Appendix I equipment and reagents Name Company ABI PRISM 7900HT Sequence Detection System Applied Biosystems; CA, USA Agilent 2100 Bioanalyzer Agilent Technologies; CA, USA Eagle Eye II gel detection system Stratagene, CA, USA FACScan flow cytometer Becton Dickinson, CA, USA Gene Pulser II Bio-Rad, ON, Canada Spectra & Rainbow ELISA reader Tecan, Austria Spectrophotometer Perkin-Elmer, ON, Canada Thermocycler Hybaid, Teddington, Middlesex, UK Name Company B-actin detection reagent Applied Biosystems, USA B-arrestin 2 probe Applied Biosystems, USA Agar (500g) Sigma-Aldrich, ON, Canada CD63 gene expression assay Applied Biosystems, USA Dextran( 100,000-20,000 kDa) Sigma-Aldrich, ON, Canada DNeasy Tissue Kit Qiagen; ON, Canada Ficol l-Plaque I Mplus Pharmacia, Uppsala, Sweden Hck gene expression assay Applied Biosystems, USA Hispeed plasmid Maxi Kit Qiagen; ON, Canada Lipofectamine 2000 Invitrogen, ON, Canada Mouse anti-human CD63 monoclonal antibody BD, ON, Canada Mouse anti-human Hck monoclonal antibody BD, ON, Canada Mouse anti-human Hck monoclonal antibody BD, ON, Canada One shot Top 10 competent cells Invitrogen, ON, Canada PE-conjugated anti-mouse IgG Santa-Cruze, CA, USA pGL3 luciferase reporter vectors Promega, USA Primers Sigma-Aldrich, ON, Canada QIAprep Spin Miniprep Kit (250) Qiagen; ON, Canada QIAquick Gel Extraction Kit (250) Qiagen; ON, Canada Random primer (300ug) Invitrogen, ON, Canada Restriction enzymes New England Biolabs, Canada RNA 6000 Nano Labchip Kit Agilent Technologies; CA, USA RNase Away Invitrogen, ON, Canada RNase Out Invitrogen, ON, Canada RNase-free DNase I digestion Qiagen, ON, Canada RNeasy Mini Kit Qiagen; ON, Canada Superscript reverse transcriptase Invitrogen, ON, Canada T4 Ligase Invitrogen, ON, Canada Taqman Universal PCR Master Mix Applied Biosystems, USA TOPO-TA cloning kit Invitrogen, ON, Canada Tryptone (1 kg) Sigma-Aldrich, ON, Canada - 186-Appendix II Experimental Protocols PMN isolation PMNs were isolated by a Dextran-Ficoll sedimentation and centrifugation method. The preparations usually contained >98% PMNs. (1) Fresh blood was mixed with 5% Dextran in RPMI (4:1) and incubated for 40 min at room temperature. (2) The upper layer (white blood cell rich plasma) was transferred onto the top of 10 ml Ficoll (2:1), and was centrifuged at 2500 rpm for 15 min with high brake. (3) After centrifugation, the supernatant was collected into new 50 ml centrifuge tubes, washed with 1x phosphate-buffered saline (PBS), and centrifuged at 3000 rpm for 20 min for mononuclear cell collection. (4) After the previous step, the cell pellets consisted of the isolated PMNs. To remove the contaminating erythrocytes, 2 ml ddH20 were added, the mixture was pipetted gently for 10-15 times (10-15 seconds), and RPMI was added to a final volume of 25 ml immediately. (5) The cell pellet was spun down at 1300-1400 rpm for 4-5 min. (6) The cell pellets were resuspended in 15-25 ml phenol red-free RPMI-1640 and incubated on ice for 40-60 min prior to other experiments. (7) A 300 ul sample of the cell mixtures was taken for cell counting either manually or using a cell analyzer. -187-mRNA quantification We performed two-step reverse transcriptase (RT) and polymerase chain reaction (PCR) to quantify the mRNA levels of our target genes. RNA isolation Approximately 10-30 million PMNs were used for RNA isolation using RNeasy Mini Kit (Qiagen; ON, Canada). (1) 350 pi of buffer RLT containing 10% B-mercaptoethanol (B-ME) was added to the cell pellets to lyse the cells and sample was homogenized by drawing through a 22-gauge needle 5 times, then the homogenized cells were stored at -80°C for further RNA isolation. (2) The homogenized cells were thawed, 1 volume of 70% ethanol was added and the solution was mixed well by pipetting. (3) The samples were loaded onto an RNeasy mini column placed in a 2 ml collection tube, were centrifuged for 15 s at 10,000 rpm, and the flowthrough was discarded. (4) The column was rinsed with buffer RW1, the DNase I incubation mix was pipetted directly onto the RNeasy silica-gel membrane, and the column was incubated at room temperature (20-30 <C) for 15 min. (5) The column was rinsed with buffer RW1 and RPE. (6) Finally, the RNeasy column was transferred to a new 1.5 ml collection tube, 40 pi of RNase-free water was pipetted directly onto the RNeasy silica-gel membrane, and the column was centrifuged for 1 min at 10,000 rpm to elute the RNA. (7) The isolated total RNA was analyzed by an Agilent 2100 Bioanalyzer. -188-RNA analysis An Agilent 2100 Bioanalyzer provided the analysis of the quantity and quality of RNA samples. The RNA 6000 Nano Labchip Kit was used according the manufacturer's instructions. (1) The gel dye mix was prepared prior to the chip priming procedure by pipetting 1 pi dye into a pre-filtered 65 pi gel aliquot. (2) The gel dye mix was vortexed, followed by an additional centrifugation step (13000 g for 10 min) to remove particles. (3) The top of gel dye mix was aspirated for the chip priming, and the remaining gel dye mix was discarded. (4) 1 ul of marker was added into every well except the 3 gel wells. (5) The RNA samples and RNA ladder were denatured at 70°C for 2 min, and the denatured RNA samples were kept on ice. (6) 1 ul of the RNA samples and RNA ladders were pipetted into their corresponding wells and the run was commenced. cDNA synthesis First strand cDNA synthesis was carried out in a total volume of 20 ul containing 30-60 ng of total RNA, 1X first-strand buffer (50 mM Tris-HCI, pH 8.3 at 25°C), 55 mM KCI, 3 mM MgClz), 10mM dithiothreitol (DTT), 0.5 mM dNTP, 10 units/ul of Superscript RNase H-Reverse Transcriptase, random primers (Invitrogen, ON, Canada), and R N A S E O U T ribonuclease inhibitor. The reaction was carried out at 37<C for 1 hour followed by incubation at 72 °C for 15 min. -189-Standard curves and TA cloning The mRNA levels of the target genes were measured by real time PCR and relative quantification i.e. the mRNA level of target gene was normalized by a housekeeping gene. In this study, B-actin was selected as the reference gene for normalization (4326315e, Applied Biosystems; CA, USA). Assay-on-demand gene expression kits for the CD63 gene (Hs00156390_m1) and Hck gene (Hs00176654_m1) were purchased from Applied Biosystems. The primers and TaqMan probe for B-arrestin 2 were designed by Primer Express 1.5 software, and synthesized by Applied Biosystems. In order to minimize genomic DNA contamination, primers that span at least one intron of the genomic sequence were chosen. There are several ways to prepare standard curves for quantitative PCR; using recombinant plasmid DNA (cloned PCR product) is one of the options. Plasmid DNA is easily made in large quantity, and usually generates highly reproducible standard curves even after a long storage time. However, the amplification efficiency of recombinant plasmid DNA may not be same as cDNA. In this study we made both types standard curves and compared their amplification efficiencies. We used the TA cloning kit (Invitrogen, ON, Canada) to clone the PCR products of target genes. TA Cloning provided a highly efficient, fast, and one-step cloning strategy for the direct insertion of PCR products amplified by Taq polymerase into a plasmid vector. The plasmid vector (pCR2.1-TOPO) was linearized with a single, overhanging 3' deoxythymidine (T) residue at both ends. Taq DNA polymerase has a nontemplate-dependent terminal transferase activity that adds a single deoxyadenosine (A) to the 3' -190-ends of PCR products. This allowed PCR inserts to be ligated efficiently with the vector. The constructed plasmids were propagated in E. coli DH5a, purified from bacterial cultures using the QIAprep Maxi Kit (Qiagen), and were further subject to restriction analysis and sequencing for confirmation of both orientation and correct DNA inserts. Correctly constructed plasmids were quantified by a spectrophotometer (Perkin-Elmer, ON, Canada). A ten-fold dilution series was prepared and 10 to 1,000,000 copies were used for generating standard curves. The cDNA samples were also serially diluted from 1 to 1 x10"5 for standard curve construction. The standard curves built from serially diluted cDNA and recombinant plasmid DNA are shown in Appendix Figure-1 (for the B-actin gene), Appendix Figure-2 (for the CD63 gene), Appendix Figure-3 (for the Hck gene), and Appendix Figure-4 (for the B-arrestin 2 gene). The amplification efficiency of PCR reaction was calculated from the formula E= [10 ( 1 / s l o p e )]-1. After comparison we found that the cDNA and recombinant plasmid DNA have similar amplification efficiencies during PCR (similar slope). The cDNA samples, however, had higher sensitivity when compared with recombinant plasmid DNA (lower Y intercept). However, the sensitivity was not a problem in our experiment because we found the expression level of the every target gene was quite high in PMNs when we optimized the experiment, whereas the total amount of cDNA extracted from the isolated PMNs was very limited. Thus we decided to use recombinant plasmid DNA to build the calibration curves. -191 -Real time PCR Real-time PCR allows the amplification to be followed in real-time during the exponential phase of the run, and thus allows the amount of starting material to be determined precisely. We used TaqMan gene expression assays to measure the mRNA level of our target genes. The TaqMan assay (Applied Biosystems) utilizes the 5' nuclease activity of Taq DNA polymerase to hydrolyze a hybridization probe bound to its target amplicon. The probe contains a fluorescent reporter dye at its 5' end, the emission spectrum of which is quenched by a second fluorescent dye at its 3' end. During the annealing step, the probe hybridizes to the amplicon. As the 5' exonuclease activity of Taq polymerase is double-strand-specific, it will cleave the hybridized probes in the process of extension, which releases the reporter dye from quencher dye, and allows the reporter to emit fluorescence. In our experiments the 10x diluted cDNA samples were run in triplicate using 384 well plates on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems; CA, USA). The expression level of mRNA in each subject was expressed as a ratio of target gene over B-actin. Protein quantification The protein levels of CD63 and Hck were measured by flow cytometry. Cell surface and total protein level were obtained by immunostaining intact PMNs and permeabilized PMNs. -192-PMN permeabilization by electroporation PMNs were permeabilized by electroporation immediately before use. As in previous methods, the electro-permeabilization procedure was carried out at room temperature. 3-5x106 cells were resuspended in 0.6 ml electroporation buffer (120mmol/L KCI, 10 mmol/L NaCI, 1 mmol/L KH 2 P0 4 , 10 mmol/L glucose, 20 mmol/L Hepes, pH 7.0), and transferred to a Gene Pulser cuvette (Bio-Rad, ON, CA) and subjected to 2 discharges of 5 kV/cm, 25 uF, and 50 ft using a Gene Pulser II (Bio-Rad, ON, CA). The cells were pipetted gently between pulses. Permeabilized cells were immediately transferred to a plastic tube and fixed with 5% formalin. Flow cytometry Cell surface and total CD63 and Hck levels were measured by flow cytometry. (1) Aliquots of intact and permeabilized PMNs were incubated with either 100 u.l 2.5 ug/ml of mouse anti-human CD63 or 100 uJ 2.5 ug/ml of mouse anti-human Hck monoclonal antibody at room temperature for 40 min (both antibodies from BD, ON, Canada). (2) Additional aliquots of intact and permeabilized PMNs were prepared and incubated with 2.5 u.g/ml mouse anti-human lgG1 for 40 min to act as negative controls. (3) The cells were washed with flow buffer (1x PBS, 0.1% BSA and 0.02% sodium azide). (4) The cells were incubated with 2.5 ug/ml of PE-conjugated rabbit anti-mouse IgG (Santa-Cruze, CA, USA) for another 40 min. (5) The cells were washed with flow buffer, and analyzed by a FACScan flow cytometer (Becton Dickinson, San Jose, CA). -193-B-arrestin 2 protein quantification B-arrestin 2 is mainly localized in central nervous system and spleen although it is expressed in most peripheral tissues. In this study we attempted to measure the mRNA and protein level of B-arrestin 2 in PMNs. We found B-arrestin 2 is expressed abundantly at the mRNA level in PMNs. However, the measurement of B-arrestin 2 protein was problematic although we tried several different methods and different antibodies (see below). We believe the main reason for our inability to measure the protein was the low level of B-arrestin 2 in PMNs. Flow cytometry: Permeabilized PMNs were stained with mouse anti-human B-arrestin 2 monoclonal antibody and PE-conjugated rabbit anti-mouse IgG. After washing, cells were analyzed by flow cytometry. Western blotting: 3-5 x10 6 PMNs were subject to western blotting. Cells were resuspended in PBS and lysed by sonication. Approximately, 20 ug of total protein was loaded into each well of a SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After transfer and blocking, the blot was incubated with mouse anti-human B-arrestin 2 antibody which was diluted in blocking buffer at proportion of 1 in 250 (1:250). After washing, the blot was incubated in rabbit anti-mouse IgG-HRP (horseradish peroxidase) conjugate in blocking buffer. Finally, ECL solution (Amersham) was added and developed for 1 min. Finally, the blot was exposed to X-ray film for 1 to 30 min. Only very weak bands were observed, which are not adequate for precise quantification. - 1 9 4 -Sandwich ELISA: 3-5 x10 6 PMNs were resuspended with PBS and lysed by sonication. High affinity microtiter plates were used. First, capture antibody (10 pg/ml mouse anti-human B-arrestin 2 monoclonal antibody) in coating buffer (pH=9.3) was bound onto the bottom of each well by incubation at 4°C overnight. After washing and blocking, 50 ul of 2x serial diluted cell lysates in blocking buffer were added into each well. The detection antibody was rabbit anti-human B-arrestin 2 polyclonal antibody. Since the detection antibody was not labeled, goat anti-rabbit IgG-HRP conjugate was used after the detection antibody, which was able to change colorless tetramethylbenzidine (TMB) into colored product. We did not find a significant difference in the absorbance under different dilutions. MPO release assay An aliquot of 5-10x106 cells/ml in phenol red-free RPMI-1640 was primed by 10 nM fMLP at 37eC for 2 min followed by 100ng/ml IL-8 stimulation at 372C for 10 min. Stimulated PMNs and an identical aliquot of nonstimulated PMNs were centrifuged at 2500 rpm for 3 min. The supernatant and cell pellets were kept separately at -70 QC for final mediator release assay. The cell pellet of the unstimulated cells was homogenized by short sonication, and then lysed by electroporation using 3 discharges of 6.25 kV/cm, 25 uF, and 50 Q using a Gene Pulser II (Bio-Rad, ON, CA). The released myeloperoxidase (MPO) were measured as previously described. For released MPO, 100 pL sample was mixed with 150 pL tetramethylbenzidine (TMB) substrate in a96-well microplate and incubated at room temperature for 15 minutes. The reaction was terminated by 50 uL 1M sulfuric acid. The absorbance was read at 450 nm -195-in a spectrophotometric microplate reader (Spectra & Rainbow ELISA reader, Tecan, Austria). The amount of released mediators was calculated as a percentage of total cellular mediator activity by dividing the absorbance of the supernatant from the stimulated cells by the sum of absorbance from the supernatant and lysed cell pellet during the resting condition. Genomic DNA isolation Genomic DNA was extracted from mononuclear cells using a DNeasy Tissue Kit (Qiagen). (1) The cell pellet was resuspended in 200 pi PBS. (2) 20 pi proteinase K and 200 pi Buffer AL was added to the sample, mixed thoroughly by vortexing, and incubated at 70°C for 10 min. (3) 200 pi ethanol (96-100%) was added to the sample, and mixed thoroughly by vortexing. (4) The mixture from step 3 (including any precipitate) was pipetted into the DNeasy Mini spin column, centrifuged at 8000 rpm for 1 min, and the flow-through discarded. (5) The column was rinsed with 500 pi Buffer AW1 and 500 ul Buffer AW2. (6) Genomic DNA was eluted with 100 Buffer AE twice. (7) The concentration of the extracted DNA was measured using a spectrophotometer. Genotyping In order to evaluate the influence of genetic polymorphisms on gene expression, a number of polymorphisms were investigated using several genotyping methods, including -196-restriction fragment length polymorphism (RFLP), allele-specific PCR, and TaqMan SNP genotyping assay. Restriction fragment length polymorphism (RFLP) RFLP is a gel-based genotyping method to detect known polymorphisms. RFLP entails amplifying the fragment spanning the polymorphic site by PCR. Following amplification the PCR product was digested by a specific restriction enzyme which was determined by the sequence of the polymorphic site. If the genetic polymorphism produces a gain or loss of the restriction site, one allele will be recognized and cut by the enzyme, but not the other allele. The different digestion pattern can be recognized by electrophoresis with ethidium bromide staining. The investigated polymorphisms were further analyzed by automatic sequencing to validate the genotyping results. Allele-specific PCR Allele specific PCR is based on the premise that under the appropriate conditions, a match between template and primer at the most 3 nucleotide is necessary for generation of a PCR product and that mismatches result in no product. Usually two probes are made to assay each SNP, one for each allele. These two probes are identical except for the last base at the 3 end, which is specific to the particular allele of the SNP that the probe is intended to detect. When an exact match occurs between the 3 termini of the template and the primer, Taq DNA polymerase binds to the primer-template junction and performs a primer-extension reaction. If a mismatch happens at the 3' termini the DNA polymerases will extend the primer with much lower efficiency than correctly matched termini and no PCR product is produced. -197-TaqMan SNP genotyping assay The TaqMan assay is a popular high-throughput genotyping technology for SNPs. It makes use of the 5 nuclease activity of Taq polymerase to detect a fluorescent reporter signal generated during PCR reactions. For SNP detection, one pair of TaqMan probes and one pair of PCR primers are used. The two TaqMan probes are different at the polymorphic site, with one probe complementary to the wild-type allele and the other to the variant allele, and the two probes are labeled with two different reporter dyes at the 5 end. Since a quencher dye is present at the 3 end of each probe, no fluorescence can be detected when the probe is intact. In the process of PCR, the two probes hybridize to the targeted polymorphic site during the annealing step. During the extension phase, Taq polymerase cleaves the hybridized probes and releases the 5' reporter dye from quencher dye. Specific genotyping is determined by measuring the signal intensity of the two different reporter dyes after the PCR reaction. -198-Standard Curve Plot detector: | » - a c t m g _ , S tandard Plot * p _ • • • • . • • t,8 frl Q u a n t i t y Standard Curve Plot Detector; |t>~aetin^  jjj: • : . 38 38-: *»•:' a-;: »•••• 28 28--• - - -1 • S t a n d a r d P l o t 1 « o H f c i i « * e t o at M M **"•>• MMM Appendix Figure-1 Standard curves of the p-actin gene (A) Standard curve built from serially diluted cDNA. The slope and Y intercept were 3.74 and 36.9; (B) Standard curve built from recombinant plasmid DNA. The slopes and Y intercept were 3.75 and 41.1. -199-Standard Curve Plot Detector: |ca63 _E_ n S t a n d a r d P l o t 2 6 24 22-i a e - 2 i o f t Q u a n t i t y Standard Curve P ta t Deflector: jcd63 3 S t a n d a r d P k K f - f r j '" v • " * - i r k -I . . . ... I* t * B » 2 I . O & J U M Appendix Figure-2 Standard curves of the CD63 gene (A) Standard curve constructed from serially diluted cDNA. The slope and Y intercept were 3.33 and 34.4; (B) Standard curve constructed from serially diluted recombinant plasmid DNA. The slope and Y intercept were 3.33 and 34.93. -200-Standard Curve Plot D e t e c t o r : Jhck StatwtaraPtm 3» »-»•••; 23 21 1« S t a n d a r d Curv» P l o t B a 34 28 -29 S t a n d a r d Plot "'Sc. ^ « 24-Ml" 14 * <3 t 0 E.1 10 i 0 5 « 3 0 S*4 1 T O E+S $ 0 fc Appendix Figure-3 Standard curves of the Hck gene (A) Standard curve constructed from serial diluted cDNA. The slope and Y intercept were 3.27 and 35; (B) Standard curve constructed from serial diluted recombinant plasmid DNA. The slopes and Y intercept were 3.30 and 38.03. -201 -standard Curve Plot Detector; jarrestlnaetaZ - 1 23 27 Standard Plot T4:tilittr —I i ,„j,.„},,i.|lp 1.0 &3 1,0 6-2 Quantity Standard Curve Plot Detector: JarmTjO StandaiilPlot It 29 24 « -20 1.0 B*» Quantity Appendix Figure-4 Standard curves of the p-arrestin 2 gene (A) Standard curve constructed from serial diluted cDNA. The slope and Y intercept were 3.09 and 35; (B) Standard curve constructed from serial diluted recombinant plasmid DNA. The slopes and Y intercept were 3.20 and 34.26. -202-

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092864/manifest

Comment

Related Items