UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of polymyxin B and cationic antimicrobial peptide resistance in pseudomonas aeruginosa McPhee, Joseph B. 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-130199.pdf [ 12.62MB ]
Metadata
JSON: 831-1.0092766.json
JSON-LD: 831-1.0092766-ld.json
RDF/XML (Pretty): 831-1.0092766-rdf.xml
RDF/JSON: 831-1.0092766-rdf.json
Turtle: 831-1.0092766-turtle.txt
N-Triples: 831-1.0092766-rdf-ntriples.txt
Original Record: 831-1.0092766-source.json
Full Text
831-1.0092766-fulltext.txt
Citation
831-1.0092766.ris

Full Text

REGULATION OF POLYMYXIN B AND CATIONIC ANTIMICROBIAL PEPTIDE RESISTANCE IN PSEUDOMONAS AERUGINOSA  By JOSEPH B . M C P H E E B.Sc (1 class honours, Chemistry and Biology), St. Francis Xavier University, 1999 st  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF T H E REQUIREMENTS OF T H E D E G R E E OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Microbiology & Immunology)  T H E UNIVERSITY OF BRITISH C O L U M B I A February 2006 © Joseph B. McPhee, 2006  ABSTRACT Pseudomonas aeruginosa is a Gram-negative, opportunistic pathogen that is noted for its environmental ubiquity, its metabolic potential and its intrinsic resistance to a wide variety of antimicrobials, detergents, dyes, and biocides. These properties are consequences of a large (6.3 Mb) genome containing -5500 genes of which 9.4% encode regulatory proteins. One of the largest classes of regulators in the P. aeruginosa genome is the two-component regulators. This work describes the contribution of two two-component regulatory systems, PhoP-PhoQ and PmrA-PmrB to Mg -limitation induced polymyxin B and cationic antimicrobial peptide 2+  resistance. Both of these systems respond to limiting M g an eight-gene operon, pmrHFIJKLM-ugd,  2 +  and cause increased transcription of  that is responsible for the addition of aminoarabinose  to 1 and 4' phosphates on Lipid A . In addition, the PmrA-PmrB system regulates a three gene operon, PA4773-PA4775 that also contributes to polymyxin B and cationic antimicrobial peptide resistance. In addition to regulating polymyxin B and cationic antimicrobial peptide resistance, the PhoP-PhoQ system also directly regulates several small ORFs, one of which PA0921 contributes to swimming motility via an unknown mechanism. Similarly, PmrA-PmrB regulate other phenotypes, including the growth of P. aeruginosa in the presence of Fe . This growth 3+  phenotype occurs through gene products encoded by the feoAB operon. Interestingly, all genes identified in this study that are PmrA-PmrB regulated are also regulated by the presence of sub-inhibitory concentrations of cationic antimicrobial peptides. The regulation of PA4773-PA4775 and pmrHFIJKLM-ugd  via cationic peptides is mostly  independent of the PmrA-PmrB and PhoP-PhoQ systems.  This observation explains why  adaptive resistance to cationic antimicrobial peptides occurs and suggests that another, as yet unidentified, regulator is responsible for the detection of cationic antimicrobial peptides. A third regulatory system, PxrRS, is also identified.  Mutants in this system show  increased susceptibility to cationic antimicrobial peptides and polymyxin B . This susceptibility was not due to loss of regulation of the PA4773-PA4775 or pmrHFIJKLM-ugd.  Microarray  analysis demonstrated downregulation of a number of heat-shock proteins, as well as two operons potentially involved in efflux. The combined downregulation of heat-shock proteins involved in response to cellular stress and efflux systems suggests that intrinsic cationic peptide resistance is altered in these mutants.  II  TABLE OF CONTENTS ABSTRACT  II  TABLE OF CONTENTS  ///  LIST OF TABLES  VI  LIST OF FIGURES  VII  LIST OFABBREVIA  TIONS  IX  ACKNOWLEDGEMENTS  X  CO-A UTHORSHIP STA TEMENT.  XI  Chapter 1 - Introduction  1  Pseudomonas aeruginosa  /  P. aeruginosa in cystic fibrosis  5  Virulence factors of P. aeruginosa  8  Treatment options for Pseudomonas infections in CF patients  //  Cationic antimicrobial peptides (host defense peptides)  14  Peptides as antimicrobial agents Cationic antimicrobial peptides - mechanisms of action Structural classes of cationic antimicrobial peptides  14 16 17  Bacterial resistance to cationic antimicrobial peptides  20  Goals of this study  28  REFERENCES.  30  CHAPTER  2 - PmrA-PmrB of Pseudomonas aeruginosa  45  INTRODUCTION EXPERIMENTAL  45 PROCEDURES  48  Bacteria) strains, primers, and growth conditions DNA manipulations Gene reporter assays Killing curves Minimal inhibitory concentrations (MICs) Outer membrane permeability assays RESULTS  48 48 52 53 53 53 54  Identification of pmrA-pmrB Regulation of pmrA-pmrB by M g The pmrA-pmrB genes and the PA3S52 (pmrH) gene regulate resistance to polymyxin B and cationic antimicrobial peptides PA4773 and PA3552 affect the permeability of the outer membrane Induction of the pmrA-pmrB containing operon by cationic antimicrobial peptides Induction of LPS modification operon (pmrHFIJKLM-ugd) by cationic antimicrobial peptides Adaptive resistance is induced by preexposure to sub-inhibitory concentrations of cationic antimicrobial peptides 2 +  DISCUSSION  54 55 59 60 60 64 64 66  III  REFERENCES  74  Chapter 3 - Identification of PhoP and PmrA regulated genes: Role of PhoP and PmrA in Mg -regulated phenotypes 78 +  INTRODUCTION MATERIALS  78  AND METHODS  '..80  80 82 82 83 83 84 84  Bacterial strains, primers, and growth conditions Identification of PhoP- and PmrA-binding sites His -PhoP and His -PmrA purification Semi-quantitative PCR assays (qPCR) DNA-binding assays Growth assays Motility assays 6  6  RESUL TS AND DISCUSSION  85  85 91 92 94  Identification of putative PhoP-PhoQ and PmrA-PmrB regulated genes Promoters identified in bioinformatic screens interact specifically with purified PhoP or PmrA Mutants in P. aeruginosa feoB are defective for growth with Fe as an iron source PA0921 plays a role in swimming motility 2+  REFERENCES.  CHAPTER  98  4 - PxrRS of Pseudomonas aeruginosa  102  INTRODUCTION  102  MA TERIALS AND METHODS  104  Bacterial strains, plasmids and growth conditions Luciferase assays Semi-quantitative PCR assays (qPCR) Outer membrane permeability assays Motility assays RNA extraction, cDNA synthesis and hybridization to DNA microarrays Analysis of DNA Microarrays  104 105 105 106 106 107 108  RESULTS  109  Identification of PxrRS 109 PxrR mutants show increased sensitivity to cationic antimicrobial peptides 109 PxrR mutants show normal transcriptional response to CP11CN 110 PxrR mutants have normal outer membrane permeability 110 PxrR mutants undergo adaptive resistance to polymyxin B following pre-exposure to cationic antimicrobial peptides Ill Microarray analysis shows downregulation of several potential intrinsic cationic peptide resistance genes in a pxrR::lSlacZ mutant 111 Downregulation of pili biosynthesis genes in pxrR mutant 114 PxrR mutants are defective in pilin-dependent phenotypes 112 DISCUSSION  ....116  REFERENCES  122  Chapter 5 - Concluding remarks  127  Introduction PhoP-PhoQ of P. aeruginosa PmrA-PmrB of P. aeruginosa PhoP-PhoQ and PmrA-PmrB in virulence Cationic antimicrobial peptide induction of PmrA-regulated promoters Intrinsic resistance of P. aeruginosa to cationic antimicrobial peptides Future research directions  IV  127 129 129 132 134 136 139  REFERENCES.  141  V  LIST OF TABLES Table 2.1.  P. aeruginosa strains, plasmids, and peptides used in this study  50  Table 2.2.  Effect of overexpression of phoP or pmrA on PA4773 expression  Table 2.3.  Minimal inhibitory concentrations (ug/ml) of peptides and aminoglycosides toward P. aeruginosa grown in low M g  Table 2.4.  Induction of ?A4773:luxCDABE  2 +  medium  58  fusion in strain H974 in response to cationic  peptides Table 2.5.  56  66  Differences between the PhoP-PhoQ and PmrA-PmrB systems of Salmonella and Pseudomonas  71  Table 3.1.  P. aeruginosa strains and plasmids used in this study  81  Table 3.2.  Sequences of primers used in this study  81  Table 3.3.  PhoP-like promoters identified in this study  87  Table 3.4.  PmrA-like promoters identified in this study  88  Table 3.5.  Swimming, swarming, and twitching motility of P. aeruginosa strains  95  Table 4.1.  Strains and plasmids used in this study  104  Table 4.2.  Sequences of primers used in this study  105  Table 4.3.  Minimal inhibitory concentration (MIC) to cationic peptides and polymyxin B under Mg -replete (2 mM) and Mg -limiting (20 uM) conditions 2+  Table 4.4.  2+  113  Genes identified as being significantly regulated in a pxrR:.TS/acZ/hah mutant via microarray analysis  115  VI  LIST OF FIGURES Figure 1.1.  Two-component regulatory systems  Figure 1.2.  Examples of structural classes of cationic antimicrobial peptides  Figure 1.3  PhoP-PhoQ  and  PmrA-PmrB  4  signaling  in Salmonella  19  enterica  serovar  Typhimurium  23  Figure 1.4  Structure of Lipid A from Salmonella enterica serovar Typhimurium  26  Figure 2.1.  Structure of the pmrA-pmrB containing operon  54  Figure 2.2.  Regulation of PA4773 inphoP, phoQ, pmrA, and pmrB mutant strains  56  Figure 2.3.  Killing of P. aeruginosa by 2 u.g/ml polymyxin B  58  Figure 2.4.  Outer membrane permeability of P. aeruginosa  61  Figure 2.5.  Induction of the pmrA-pmrB containing operon by cationic antimicrobial peptides  63  Figure 2.6.  Regulation of PA3552 in phoP, phoQ, pmrA, and pmrB mutant strains  ..65  Figure 2.7  Adaptive resistance to polymyxin B induced by CP11CN in P. aeruginosa  65  Figure 2.8.  PhoP and PmrA binding sites  72  Figure 3.1.  PmrA- and PhoP-regulated genes as assessed by RT-PCR  86  Figure 3.2.  Weblogos generated from the conserved sequences identified in the promoters of the PhoP- and PmrA-regulated genes  Figure 3.3.  Exposure  to  2  ug/ml  CP11CN  88 causes  induction  of  PmrA-dependent  promoters  89  Figure 3.4.  Purified His6-tagged PmrA and PhoP from P. aeruginosa  89  Figure 3.5.  Demonstration of binding of PhoP and PmrA to selected promoter regions  90  Figure 3.6.  feoAB are involved in growth on ferrous iron  93  Figure 4.1.  Induction of a pmrHwluxCDABE fusion in response to 2 ug/ml CP11CN in regulatory mutant strains  Figure 4.2.  pxrRr.lSlacZ  110  mutants of P. aeruginosa  have increased  CP11CN Figure 4.3.  susceptibility  to  113  A pxrR.ASlacZ  mutant show normal responses to the presence of subinhibitory  concentrations of cationic antimicrobial peptides.  114  Figure 4.4.  Mutants of pmrR have normal outer membrane permeability  114  Figure4.5.  pxrR.ASlacZ  mutants undergo adaptive resistance following exposure to sub-  MIC levels of cationic antimicrobial peptides VII  114  Figure 4.6.  Mutants of pxrR exhibit pili-negative phenotypes  Figure 5.1:  Model of PhoQ activation by low M g  Figure 5.2.  The PhoP-PhoQ and PmrA-PmrB systems of P. aeruginosa  VIII  2 +  and peptides in S. Typhimurium  .116 135 138  LIST OF ABBREVIATIONS °C - degrees Celsius A y - transmembrane potential A D P - adenosine diphosphate ATP - adenosine triphosphate CCCP - carbonyl cyanide m-chlorophenol hydrozone CF - cystic fibrosis CFTR - cystic fibrosis transmembrane regulator DIG - digoxygenin D N A - deoxyribonucleic acid DTT - dithiothreitol E D T A - ethylenediaminotetraacetate GDP - guanodine diphosphate GTP - guanidine triphosphate HEPES - 2-(4-(2-hydroxyethyl)-l-piperazinyl) ethanesulfonic acid LPS - lipopolysaccharide MIC - minimal inhibitory concentration N P N - 1 -N-phenylnapfhylamine ORF - open reading frame PCR - polymerase chain reaction RND - resistance-nodulation-division SDS - sodium dodecylsulphate S. Typhimurium - Salmonella enterica sv. Typhimurium TNFct - tumour necrosis factor alpha  IX  ACKNOWLEDGEMENTS  I would first and foremost like to thank Bob Hancock for giving me the opportunity to carry out this research in his lab. His willingness to let me follow the data, even when it wasn't going anywhere, has allowed me to become a more thoughtful and independent researcher. I would also like to thank the members of my supervisory committee, Brett Finlay, Michael Murphy, and George Spiegelman for the improvements that their ideas have made to this work. I would like to thank all of the members of the Hancock lab who have come and gone throughout the years, with a special thanks to Shawn Lewenza, JP Powers, and Sandeep Tamber for their willingness to endure the long and occasionally painful discussions about the work described in this thesis.  Special thanks are also extended to Manjeet Bains for excellent  technical expertise that have contributed greatly to the work described in this thesis. Warm appreciation is also extended to Lori Graham at St. Francis Xavier University who first introduced me to the wonders of the microbial world and encouraged me to consider a career in scientific research after completion of my undergraduate degree. M y family's constant support throughout my Ph.D. has been especially welcome. Even when they could not understand what I was doing or why I was doing it, their ability to never question or second-guess my decision is greatly appreciated. Finally and most importantly I would like to thank Janet Butler for her love, her compassion, and her tireless enthusiasm for my graduate school career. She has endured the sleepless nights, boring conversations, and half-baked theorizing with constant smiles and support; words could never fully convey my appreciation.  X  CO-AUTHORSHIP STATEMENT This thesis is submitted in manuscript format and in this section I acknowledge the contribution of a number of co-authors. Unless indicated, all experimental design, experimental results, and manuscript composition are my responsibility. Chapter 2 was largely published in: McPhee, J. B., S. Lewenza, and R. E . W. Hancock. 2003. Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 50:205-17. •  S. Lewenza screened and mapped a library of mim-Tn5-luxCDABE mutants for those that showed strong responses to limiting Mg -concentrations. 2+  •  R. E. W. Hancock edited the final draft of the manuscript.  Chapter 3 has been submitted as: McPhee, JB, Bains, M , Winsor, G, Kwasnicka, A , Lewenza, S, Brinkman, FSL, and REW Hancock. The two-component PhoP-PhoQ and PmrA-PmrB regulators of Pseudomonas aeruginosa are involved in regulating diverse virulence-related functions. J. Bacteriol. •  M . Bains purified His6-PhoP and His6-PmrA and performed gel-shift analysis on target gene promoters.  •  G. Winsor and F. S. L . Brinkman performed bioinformatic analysis and computational prediction of putative PhoP and PmrA-regulated promoters.  •  S. Lewenza contributed to experimental design and analysis.  •  A . Kwasnicka was responsible for the construction of the His6-PhoP expressing plasmid.  •  R. E. W. Hancock edited the final draft of the manuscript.  Chapter 4 is a draft of a manuscript that will be submitted as: McPhee, JB, Bains, M , and REW Hancock. Identification of PxrRS, a two-component regulatory system contributing to intrinsic cationic antmicrobial peptide and polymyxin B resistance. •  M . Bains performed microarray experiments and analysis ofpxrR::lSlacZ and wild-type P A O l XI  •  R. E. W. Hancock edited the final draft of the manuscript.  XII  Chapter 1 - Introduction Pseudomonas aeruginosa  P. aeruginosa is a Gram-negative bacterium that is widely distributed throughout the environment and is commonly isolated from soil and water samples worldwide. It is an opportunistic pathogen of invertebrates, plants, and mammals, including humans. It is noted for its high metabolic diversity and its intrinsic resistance to a broad spectrum of antimicrobial compounds. In 2000, the genome of P. aeruginosa was sequenced, and this work greatly aided in the understanding of the basis for these observations (Stover, Pham et al. 2000). The genome contains a large number (550) of genes encoding known and putative transporters.  This number represents 10% of the entire coding capacity of the genome, and  indicates that P. aeruginosa has the ability to transport a large variety of small molecules across its cell envelope (Stover, Pham et al. 2000). This is believed to be, in part, an adaptation to the intrinsically low permeability of the P. aeruginosa outer membrane (Hancock and Nikaido 1978). Unlike E. coli, where transport across the outer membrane occurs primarily through the general porins OmpC and OmpF, the major P. aeruginosa porin, OprF, is a poorly functional pore (Brinkman, Bains et al. 2000). This is likely due to the presence of a salt-bridge within the porin monomer that restricts the size of the pore opening, and therefore limits diffusion (Brinkman, Bains et al. 2000). To compensate for the low permeability of the outer membrane, P. aeruginosa has several families of specific porins, including one large family with homology to the basic amino acid porin, OprD (Tamber and Hancock 2005). Unlike conventional porins, where the rate of diffusion across the outer membrane increases with increasing concentrations of solute, the specific porins contain a substrate-specific binding site that acts as a selectivity filter, and transport of specific substrates via these proteins is saturable (Tamber and Hancock 2003). The genome also encodes a large family of TonB-dependent iron-siderophore receptors  1  (Stover, Pham et al. 2000). This family is believed to be important in allowing P. aeruginosa to scavenge iron from a wide variety of iron-siderophore complexes that may be present in dilute aqueous environments. Both of these families of proteins serve to increase transport across the outer membrane when solute concentrations are limiting. In addition to this unique outer membrane strategy, P. aeruginosa also contains a large family of resistance-nodulation-division (RND) efflux pumps (Poole and Srikumar 2001). These are tripartite complexes, which span the bacterial inner membrane, cytoplasm, and outer membrane.  They consist of an inner membrane spanning proton-substrate  antiporter  component, an outer membrane spanning outer membrane channel and a membrane linker protein that links the inner membrane pump to the outer membrane channel (Eswaran, Koronakis et al. 2004). Each R N D system has a fairly broad substrate range, and any given substrate may be effluxed by a number of different RND systems (Poole and Srikumar 2001). P. aeruginosa contains a family of 19 outer member efflux proteins, 14 membrane linker protein, and 13 inner membrane pumps that appear to encode subunits of RND-transporters (Stover, Pham et al. 2000). This combination of low outer membrane permeability and active efflux enables P. aeruginosa to maintain a low intracellular concentration of many antimicrobial compounds. Both of these general mechanisms, combined with the ability of P. aeruginosa to acquire resistance elements from the environment (Morrison, Miller et al. 1978; Saye, Ogunseitan et al. 1987), results in an organism that is relatively resistant to the action of many antimicrobial compounds. P. aeruginosa is also noted for a large proportion (-9.3%) of ORFs that encode regulatory proteins (Stover, Pham et al. 2000). This is believed to contribute to the ability of P. aeruginosa to occupy a large number of niches by contributing to the bacterium's metabolic flexibility.  O f these regulatory proteins, a large number are two-component regulators. As 2  suggested by the name, two-component regulatory systems generally consist of two different proteins, one a sensor histidine kinase responsible for signal detection and transduction and the other a response regulator that transmits the signal detected by the sensor kinase and transmits it to some biological output (usually gene regulation) (Wolanin, Thomason et al. 2002). The P. aeruginosa genome contains 63 sensor kinases and 64 response regulators. O f the 63 sensor kinases, 42 are typical, in that they possess a signaling domain attached to a histidine-containing transmitter domain. Following signal detection, the histidine residue is autophosphorylated, permitting subsequent transfer of the phosphate from the histidine residue of the sensor kinase to an aspartate residue contained within a receiver domain in the cognate response regulator (Fig 1.1 A) (Wolanin, Thomason et al. 2002).  Despite the conserved  signaling pathway leading to response regulator phosphorylation, the mechanism by which transcription is modulated is quite diverse and may include increased contact between the response regulator and a particular a-factor or R N A polymerase subunit (Garrett and Silhavy 1987; Makino, Amemura et al. 1993; Stock, Robinson et al. 2000). In addition to these simple systems, the genome also contains other less orthodox sensor/regulator hybrids (Fig. L I B and 1.1C) (Rodrigue, Quentin et al. 2000). These types of systems differ primarily in the structure of the sensor kinase. For the so-called hybrid systems, signal detection still leads to autophosphorylation at a conserved histidine residue, however this phosphate is then transferred to a receiver domain within the sensor kinase (Tsuzuki, Ishige et al. 1995). The phosphate can then be transferred to an Hpt (histidine phosphotransfer) domain at the C-terminus of the sensor kinase.  A final phosphotransfer  phosphorylation of a receiver domain in a response  reaction leads to  regulator protein.  This  phosphotransfer leads to gene modulation by the phosphorylated response regulator.  final P.  aeruginosa contains five of these types of response regulators (Rodrigue, Quentin et al. 2000),  3  and one, GacS has been shown to be crucial in regulating virulence (Kitten, Kinscherf et al. 1998; Goodman, Kulasekara et al. 2004). A third type of so-called unorthodox system, is very similar to the hybrid two-component regulators, although the Hpt module is a free protein, rather than a module at the C-terminus of the sensor histidine kinase (Fig. 1.1C) (Rodrigue, Quentin et al. 2000). These additional phosphotransfer reactions in the hybrid and unorthodox two-component systems allow the integration of multiple signals into a single biological output (Matsushika and Mizuno 1998; Goodman, Kulasekara et al. 2004). These types of systems have been well-characterized in Bacillus subtilis sporulation where phosphate flux through the SpoOF  Figure 1.1. Two-component regulatory systems. A) simple two-component regulatory system B) unorthodox two-component regulatory system C) hybrid two-component regulatory system. Adapted from (Rodrigue, Quentin et al. 2000).  4  -SpoOB-SpoOA system is modulated by a series of dedicated phophatases (Perego and Hoch 1996), thereby preventing sporulation unless environmental conditions are ideal (Stephenson and Hoch 2002).  P. aeruginosa in cystic fibrosis P. aeruginosa causes high rates of infections in individuals with cystic fibrosis (CF). Cystic fibrosis is a common genetic disease caused by mutations in the cystic fibrosis transmembrane regulator (CFTR) (Riordan, Rommens et al. 1989). This protein is a chloride ion channel that when mutated results in a number of clinical symptoms including decreased nutrient absorption in the intestinal epithelium, thickening and scarring of the vas deferens, leading to sterility in males, as well as dehydration of the periciliary mucous of the bronchial epithelium (Ratjen and Doring 2003; Staab 2004). In spite of the other systemic effects of the CFTR mutation, it is this dehydration and thickening of the bronchial airway fluid that reduces the ability of the periciliary beating to remove mucous from the lung. These thickened mucous secretions and the consequent reduction in the efficiency of mucociliary clearance lead to ready infection by a range of pathogens. There appears to be some degree of bacterial succession in early infection, with bacteria like Staphylococcus aureus and Haemophilus influenzae causing the first infections (Rajan and Saiman 2002). These are eventually displaced by non-mucoid strains of P. aeruginosa, which over a period of months to years, will convert to a mucoid phenotype. The emergence of mucoidy has been proposed to be a consequence of oxidative bursts of hyperactive neutrophils that are a hallmark of the CF lung (Mathee, Ciofu et al. 1999). This may be due to the ability of alginate to scavenge oxygen free radicals, like those produced by macrophages (Simpson, Smith et al. 1989). The appearance of mucoid strains also correlates with a loss of lung function, exacerbated by the increased resistance of mucoid P. aeruginosa to neutrophil-mediated killing (Martin, Schurr et al. 1994). 5  In addition to the pronounced conversion to mucoidy, P. aeruginosa from chronic CF infections also have several alterations in their LPS. These include a conversion to serumsensitive rough LPS (Kelly, MacDonald et al. 1990). This conversion to serum sensitivity is genetically separable from conversion to mucoidy and has been linked to the rfb locus (Evans, Pier et al. 1994). It is thus probable that this conversion represents a separate adaptation to the environment of the CF lung. Some patients progress from P. aeruginosa infection to become colonized by the highly antibiotic resistant organisms Burkholderia cepacia and/or Stenotrophomonas maltophilia, developments that are also associated with poor clinical outcome (Gladman, Connor et al. 1992; Whiteford, Wilkinson et al. 1995). In the case of Burkholderia, the poor prognosis may be due to the ability of this strain to efficiently invade bronchial epithelium and to disseminate from the site of initial infection, leading to sepsis (Hutchison and Go van 1999). Although chronic inflammation is a hallmark of the CF lung, it is not entirely clear whether or not inflammation precedes the initial infection, or whether the initial inflammation predisposes the individual to infection. A number of studies have suggested that infants with CF who have not yet been infected still display several hallmarks of inflammation, including increased pro-inflammatory cytokine production (Balough, McCubbin et al. 1995; Khan, Wagener et al. 1995; Hilliard, Konstan et al. 2002). Other groups have published contradictory data, suggesting that there is little difference in inflammation in uninfected infants with cystic fibrosis as compared with control groups (Armstrong, Grimwood et al. 1997; Dakin, Numa et al. 2002).  Additionally, at least in the early stages of infection, antimicrobial treatment can  significantly reduce both bacterial load and inflammation, supporting the hypothesis that the CF lung is not hyperinflamed before the onset of chronic infection. Also, the authors of one of these studies noted a 78% correlation between the number of neutrophils in the lung and bacterial load and a 34% correlation between bacterial load and IL-8 levels in the bronchial 6  airway lavage fluid (Dakin, Numa et al. 2002), supporting the hypothesis that infection precedes inflammation. The reasons for the discrepancies among these data are not currently known, however the authors noted that there were dramatic differences in sampling methodology between studies that reached differing conclusions. Regardless of whether inflammation precedes infection, once infected, individuals with CF are unable to clear the infection and lung damage  is caused by the chronic  hyperinflammation that results at the site of infection (Kharazmi, Schiotz et al. 1986). Bronchial epithelial cells from CF patients secrete higher than normal levels of the chemokine, IL-8 (Corvol, Fitting et al. 2003). Additionally, the presence of pathogens within the lung also serves to increase production of other pro-inflammatory cytokines (TNF-a, IL-1 and IL-6) that serve to further increase neutrophil recruitment to the lungs. These neutrophils themselves are also a significant source of IL-8 production within the lung (Corvol, Fitting et al. 2003). This positive-feedback loop results in a massive neutrophil recruitment to the site of infection (Suter, Schaad et al. 1984; Kharazmi, Schiotz et al. 1986; Fick, Sonoda et al. 1992). These neutrophils appear to be systemically primed before entering the lung, making them more likely than usual to degranulate (Conese, Copreni et al. 2003).  This increased neutrophil recruitment and  degranulation together with hyperinflammation leads to scarring of the bronchial epithelium and loss of lung function. In addition to its prominent role in CF pathology, P. aeruginosa is currently the third leading cause of nosocomial (hospital-acquired) infections in North America, and the leading causative agent of nosocomial ventilator-acquired pneumonia (VAP) (Shorr, Sherner et al. 2005). These acute infections differ significantly from the chronic infections that P. aeruginosa mediate in CF, in that the bacteria are generally highly cytotoxic, due to the expression and  7  secretion of various virulence factors including type II and III effector proteins (Sadikot, Blackwell et al. 2005). Virulence factors of P. aeruginosa A number of P. aeruginosa virulence factors have been identified that appear to be important within the CF lung. There appears to be a succession of changes that occur after an individual first becomes infected with P. aeruginosa.  In the early stages, environmental P.  aeruginosa strains are believed to be inhaled to the lower airway and are not cleared due to the defective mucociliary system described above (Robinson and Bye 2002). At this stage it is presumed that adherence to the bronchial epithelium plays an important role in this initial colonization, as animal studies have pointed to a number of potential bacterial adhesins that contribute to virulence, including flagella, pili, surface outer membrane proteins, and recently described fimbria (Carnoy, Scharfman et al. 1994; Aim, Hallinan et al. 1996; Vallet, Olson et al. 2001; D'Argenio, Calfee et al. 2002). Pseudomonas aeruginosa secretes a number of toxins that are involved in host tissue damage. Additionally, some P. aeruginosa signaling proteins including siderophores (Coffman, Cox et al. 1990; Britigan, Roeder et al. 1992; Britigan, Railsback et al. 1999) and quorum sensing molecules (Smith, Harris et al. 2002; Smith, Kelly et al. 2002) have been shown to have some toxicity toward eukaryotic cells, independent of their roles in iron-scavenging and quorum sensing respectively. In addition to these toxins, during acute infections, a type III secretion system plays an important role in determining the outcome of infection.  This system is  responsible for the secretion of up to four different effector proteins. These proteins, ExoS, ExoT, ExoU, and ExoY are involved in extensive modification of the host response to infection. ExoS and ExoT are closely related bifunctional cytotoxins with an ADP-ribosyltransferase domain as well as a RhoGAP domain, with ExoS being the most important bacterial determinant of dissemination of infection (Lee, Smith et al. 2005). ExoT is involved in the inhibition of 8  phagocytosis by polarized epithelial cells and macrophages (Garrity-Ryan, Shafikhani et al. 2004). The RhoGAP domains of both proteins appear to have similar activity, affecting GTPase activity of Rho, Rac, and Cdc42 (Barbieri and Sun 2004).  However, the A D P ribosyl  transferase activities are different, with ExoS interacting with a wider variety of host proteins than ExoT, the activity of which appears to be quite substrate specific and limited to several proteins involved in the formation of focal adhesion plaques (Barbieri and Sun 2004). ExoY is an adenylate cyclase that has been implicated in cytoskeletal rearrangements of the host cells, although a clear role in virulence for this protein has not yet been established (Cowell, Evans et al. 2005). ExoU is a potent phospholipase that is associated with acute cytotoxicity in strains that possess this protein (Sato, Frank et al. 2003; Sato and Frank 2004). Interestingly, during the conversion from acute to chronic pathogen in the CF lung, P. aeruginosa undergoes several dramatic morphological changes.  Although, type III secretion  appears to be extremely important during acute infection (Roy-Burman, Savel et al. 2001), it is also becoming increasingly clear that isolates from CF patients exhibit dramatically reduced secretion of type III effectors (Jain, Ramirez et al. 2004; Lee, Smith et al. 2005). A recent publication has demonstrated that P. aeruginosa possesses a complex regulatory hierarchy that controls whether or not a bacterium is in the "acute" or the "chronic" infection mode (Goodman, Kulasekara et al. 2004). When in the acute phase, the RetS response regulator is activated, leading to increased type II and III toxin secretion and production of type IV pili responsible for twitching motility, while the synthesis of exopolysaccharides responsible for biofilm formation are repressed. When in the chronic phase, the RetS regulator is repressed, and the state of the cell is dominated by the GacASrsmZ system.  This leads to a reversal of the phenotypes listed  above (i.e. decreased toxin production, decreased twitching motility, and upregulation of biofilm-associated processes). This reversal is presumed to increase resistance to antimicrobial compounds via promotion of biofilm formation while the decrease in exotoxin production 9  reduces the toxicity observed in acute infections. The exact signal(s) to which the bacterium is responding in these situations is not yet clear. In addition to the dramatic phenotypic switching mentioned above, a major phenotypic change during chronic infection is the increased production of alginate. Alginate is a highly hydrated exopolysaccharide composed of long chains of 0-D mannuronate and its C-5 epimer aL-guluronate . The genetics and regulation of alginate production in P. aeruginosa are complex, but have been well described (Govan and Deretic 1996; Ramsey and Wozniak 2005). In vivo, several mutations lead to increased alginate production, but the most common involves a point mutation within the gene encoding the anti-a factor, MucA. This mucA22 mutation leads to activation of A l g U (also called AlgT) and activation of AlgU-dependant promoters (Fyfe and Govan 1983). Among these is the algD-alg8-alg44-algKEGXLIJFA enzymes necessary for the biosynthesis and secretion of alginate.  operon, which encodes the Although metabolically  expensive for the bacterium, this mutation almost always appears during chronic infection of the CF lung and the consequent appearance of anti-alginate antibodies correlate with poor clinical outcome (Govan and Deretic 1996). A number of hypotheses have been advanced as to why P. aeruginosa in the CF lung converts to mucoidy. Mucoid P. aeruginosa are more resistant to opsonization, to reactive oxygen intermediates, and to the activity of complement (Govan and Deretic 1996). There has been some suggestion in the past that the presence of alginate, a polyanionic compound, can make bacteria more resistant to the activity of cationic antimicrobial peptides (Friedrich, Scott et al. 1999; Chan, Burrows et al. 2004; Chan, Burrows et al. 2005), however, it is not entirely clear if this is true for all cationic peptides, or how relevant this observation is in the context of the CF lung since the majority of endogenous cationic host defence peptides are only weakly antimicrobial or are very salt-sensitive (Yan and Hancock 2001; Starner, Agerberth et al. 2005).  10  Although the reasons for the conversion to mucoidy are not entirely clear, it has been shown, in vitro, that exposure of P. aeruginosa biofilms to low levels of hydrogen peroxide or to activated human peripheral polymorphonuclear neutrophils (PMNs) results in the emergence of strains containing mucA22 mutations identical to those found in the strains most commonly isolated from C F patients (Mathee, Ciofu et al. 1999). This data strongly suggests that within the lung, the influx of neutrophils associated with persistant P. aeruginosa infection is directly responsible for the observed conversion to mucoidy. In addition to these well-characterized phenotypic changes, P. aeruginosa cells isolated from the CF lung also possess a number of LPS alterations that are consistent with increased resistance to cationic antimicrobial peptides (Ernst, Y i et al. 1999). These include the presence of altered acylation patterns compared with those cells grown in laboratory media. These cells are also noted for the presence of one or two aminoarabinose groups at the 1 or 4' positions of Lipid A . The addition of these aminoarabinose groups is consistent with adaptations that occur when P. aeruginosa is grown under conditions of divalent cation limitation, and are associated with increased resistance to cationic antimicrobial peptides and polymyxin B (McPhee, Lewenza et al. 2003; Moskowitz, Ernst et al. 2004). Treatment options for Pseudomonas infections in CF patients When cystic fibrosis was first clearly described in the late 1930s it was an untreatable disease (Anderson 1938).  Indeed, survival rates were very low before the advent of  antimicrobial therapy. The last 40 years have been noteworthy for the dramatic improvement in both treatment options for pulmonary infections of CF patients, and in the survival rates for the disease. Currently, an individual diagnosed with CF has a median age of survival of 38 years, as compared with less than four years in 1961 (CCFF, 2005). This improvement is directly related to the improved antimicrobial therapies that have been introduced. The progress and  11  treatment of CF lung disease is often divided into a series of stages, corresponding to both the type and number of bacterial pathogens isolated from lung cultures. The lungs of CF patients are often infected early in life with a variety of pathogenic bacteria, including Haemophilus influenzae and Staphylococcus aureus.  In spite of this  association, studies documenting a link between infection with H. influenzae and S. aureus and lung pathogenesis are sparse. Indeed, there is some evidence that eradication of SI aureus is actually a risk factor for early colonization with P. aeruginosa (Ratjen, Comes et al. 2001). In spite of this controversy, early treatment of CF patients often includes anti-Staphylococcal therapy, a treatment which often leads, to bacterial clearance (Rajan and Saiman 2002; Solis, Brown et al. 2003). P. aeruginosa infections also go through a series of stages beginning with the appearance of the first P. aeruginosa positive culture. At this stage, aggressive treatment can apparently eradicate the infection (Rosenfeld, Ramsey et al. 2003).  This treatment usually  involves treatment with oral ciprofloxacin in combination with aerosolized tobramycin or colistin (Wiesemann, Steinkamp et al. 1998; Rosenfeld, Ramsey et al. 2003).  Successful  eradication has also been observed following 14-21 day courses of intravenous ceftazidime or cefipime combined with intravenous tobramycin (Marchetti, Giglio et al. 2004).  If this  treatment is unsuccessful (i.e. P. aeruginosa is still isolated from sputa), the patient is assumed to be chronically colonized with P. aeruginosa (Rosenfeld, Ramsey et al. 2003). At this stage, the goal of antimicrobial treatment is to reduce the bacterial load in the lungs, thereby reducing the levels of inflammation.  Although maintenance therapy has not yet been standardized,  continuous treatment with inhaled colistin may decrease the density of P. aeruginosa in the sputum (Jensen, Pedersen et al. 1987).  Cyclic, 28-day treatment with TOBI, a tobramycin  formulation designed for inhalation has also been shown to be effective at reducing bacterial load and increasing pulmonary function (Pai and Nahata 2001). 12  Following chronic colonization, CF patients are often subject to sporadic exacerbations in which the bacterial load suddenly increases with a concomitant decrease in pulmonary function. This stage of infection is also correlated with the rise of hypermutable strains of P. aeruginosa, including mucoid strains (Oliver, Canton et al. 2000; Oliver, Baquero et al. 2002; Macia, Blanquer et al. 2005). As mentioned above, the clearest correlation with decreasing clinical outcome is the isolation of mucoid P. aeruginosa from the lower respiratory tract, and aggressive antimicrobial therapy is usually undertaken when mucoid strains are detected . This treatment is usually a combination therapy  involving anti-Pseudomonal penicillin or  cephalosporin (ticarcillin, piperacillin, ceftazidime, or cefepime) in combination with a monobactam (aztreonam) or a carbapenem (imipenem or meropenem) and tobramycin (Canton, Cobos et al. 2005).  These aggressive antimicrobial treatments have been successful in  decreasing the bacterial load, resulting in a prolonged period where there is intermittent positive and negative P. aeruginosa cultures, and a corresponding delay in the onset of lung deterioration (Smith, Doershuk et al. 1999; Doring, Conway et al. 2000). In recent years, there has been a dramatic increase in the infection rate of CF patients by other, even more aggressive pathogens (Gladman, Connor et al. 1992). The most important of these emerging pathogens is Burkholderia cepacia. This species is actually a complex of nine different Burkholderia genomovars, only some of which are associated with human infection (Speert 2002; Cunha, Leitao et al. 2003; Petrucca, Cipriani et al. 2003). Infections by this species are found in -20% of patients and these infections are even more difficult to treat than are P. aeruginosa infections (Speert 2002). These bacteria are invasive toward lung epithelial cells and in -20% of B. cepacia infected patients, can lead to a condition known as cepacia syndrome (Mahenthiralingam, Urban et al. 2005). This condition is characterized by necrosis of the lung sometimes leading to systemic dissemination of the infection, causing sepsis and death. Infection by B. cepacia is strongly correlated with poor clinical prognosis. Indeed, it has been 13  estimated that infection with B. cepacia causes an average 50% decrease in residual life expectancy (Hutchison and Govan 1999). Cationic antimicrobial peptides (host defense peptides)  Cationic antimicrobial peptides are generally defined as being less than 50 amino acids in length, with an overall charge ranging from +2 to >+10 due to the presence of excess lysine and/or arginine residues and are further delineated here as demonstrating antimicrobial activity under physiological conditions.  Cationic antimicrobial peptides are also usually capable of  folding into amphipathic structures, with a clear separation of hydrophobic and hydrophilic amino acid residues, thereby interacting with biological membranes and exerting antimicrobial activity. A related class of peptides is the host defense peptides, which have similar physical properties, but generally these peptides are only weakly antimicrobial under physiological concentrations of monovalent and divalent cations (Bals, Wang et al. 1998; Garcia, Krause et al. 2001). This definition serves to discriminate between peptides for which antimicrobial activity is the most important function, and those for which immunomodulatory activity is more important (McPhee, Scott et al. 2005).  It is important to note that these activities are not  mutually exclusive, and a single peptide can express these different activities at separate tissue sites; however recent studies have demonstrated that these activities are separable (Wu, Hoover et al. 2003; Braff, Hawkins et al. 2005). Both antimicrobial and immunomodulatory cationic peptides are widespread throughout Life, being found in bacteria, plants, insects, arthropods, and mammals. Peptides as antimicrobial agents  Cationic antimicrobial peptides are important antibiotic candidates because they are broad-spectrum, with activity against both Gram-negative and Gram-positive bacteria, fungi, and enveloped viruses. They also have rapid killing kinetics . There is a tendency to label peptides as "potent" when activities have only been tested in dilute media such as 10 m M 14  phosphate buffer or highly diluted growth medium. Indeed when tested in either 100 m M NaCl (the concentration of NaCl in the blood) or even more importantly 2 m M M g  2 +  or C a  2+  these  antimicrobial activities are often revealed to be rather weak (Friedrich, Scott et al. 1999). There are however some peptides, such as polymyxin B, polyphemusin I, and tachyplesins that maintain their antimicrobial activity in a physiologically relevant environment (Tam, Lu et al. 2002; McPhee, Lewenza et al. 2003). Cationic peptides selected for commercial development can have potent activity against bacterial cells, but generally have reduced toxicity towards eukaryotic cells. This selectivity is achieved by exploiting the intrinsic differences between eukaryotic and prokaryotic membrane structure. Eukaryotic membranes typically have 45%55% phosphatidylcholine and 15-25% phosphatidylethanolamine lipids on their surfaces, lipids which have no net charge at pH 7 (Yeaman and Yount 2003). Mammalian membranes also contain 10-20%) cholesterol (Yeaman and Yount 2003).  In contrast, Gram-negative bacteria  contain a highly negatively charged polyanionic lipopolysaccharide (LPS) on their outer membrane surface, while the cytoplasmic membrane of all bacteria contains greater than 30% negatively charged lipids like phosphatidyl glycerol, and cardiolipin (Yeaman and Yount 2003). These features would tend to attract the binding of peptides to bacterial membranes. Another difference is the large transmembrane electrochemical potential gradient (A\\i) across bacterial cytoplasmic membranes (—130 to -150 mV) whereas most eukaryotic cells possess modest transmembrane potential gradients of around -15 mV. This greater bacterial Ax\r is oriented interior negative, such that it would effectively "electrophorese" these peptides into cells and thus may be a major factor in determining cationic peptide susceptibility (Yeaman and Yount 2003).  15  Cationic antimicrobial peptides - mechanisms of action  The mechanism of action of many cationic peptides is still not well-characterized. To date, most studies have focused on their interactions with bacterial membranes as well as with various model membrane systems (Jelinek and Kolusheva 2005). It is clear that all cationic antimicrobial peptides interact with biological membranes but it is less clear whether this is directly responsible for their antimicrobial activity. Two membranes surround Gram-negative bacteria. The inner cytoplasmic membrane has a typical bilayer structure composed of phospholipids, with a number of integral and peripheral membrane proteins. The outer membrane is asymmetric, with the inner leaflet composed of phospholipids and the outer leaflet comprising polyanionic glycolipid LPS (Erridge, BennettGuerrero et al. 2002; Raetz and Whitfield 2002). The negative charges on LPS, due to a high content of phosphates and acidic sugars, are bridged by divalent cations that serve to partially neutralize the negative charge and stabilize the outer membrane (Nicas and Hancock 1980). These divalent cations bind with moderate affinity to the LPS, and such sites are the location at which self-promoted uptake of polycations, like the cationic antimicrobial peptides, occurs. The polycationic lipopeptide  polymyxin B was  demonstrated to  increase  the  permeability of the outer membrane and to sensitize Gram-negative cells to antibiotics that are normally unable to cross the outer membrane (Vaara 1992; Vaara 1993; Morris, George et al. 1995) and thus has been utilized as a model for the activity of other cationic antimicrobial peptides.  The ability of polymyxin B to bind to and neutralize lipopolysaccharide was first  described in the 1960s (Rifkind and Palmer 1966; Rifkind 1967; Rifkind 1967). In addition, mutant strains resistant to polymyxin B binds less polymyxin B and bind it with lower affinity than wild-type cells (Hancock, Irvin et al. 1981; Vaara and Vaara 1981; Vaara 1992). Based on these observations, and the isolation of a mutant that mimicked cells grown on low M g  2 +  (constitutive expression of Mg -regulated protein OprH) and was cross resistant to polymyxin 2+  16  B, gentamicin and E D T A (Nicas and Hancock 1983), the self-promoted uptake hypothesis was proposed (Nicas and Hancock 1980).  This hypothesis proposes that polycationic molecules  bind to the divalent cation binding sites on LPS at the surface of the outer membrane by displacing native divalent cations such as M g  2 +  or C a . 2+  This leads to the disruption of the  stabilization of LPS by divalent cation cross-bridging, leading to localized disruption of the bilayer. The disrupting polycation is then taken up through the membrane it has destabilized, hence the name for the process, self-promoted uptake (Nicas and Hancock 1980).  Self-  promoted uptake explains the preferential activity of many cationic peptides against Gramnegative bacteria. It also explains the observation that divalent cations, such as M g  and C a ,  2 +  2+  are far more antagonistic to peptide activity than are monovalent cations like N a or K , because +  +  of the peptide binding to a site that is normally occupied by a divalent cation. A l l cationic peptides must interact with the cytoplasmic membrane (in both Gram negative and Gram positive bacteria) to lead to lethality. Indeed, i f high enough concentrations of cationic amphipathic peptides are used (i.e. well above the MIC), these usually cause membrane disruption. Despite this observation, it is also quite clear that at the minimal lethal concentration not all peptides kill through membrane disruption. Structural classes of cationic antimicrobial peptides The most abundant class of cationic peptides (~50% of sequences in the antimicrobial peptides database (Tossi 2003)) is the amphipathic ct-helical class, which upon interaction with target membranes, folds into amphipathic a-helices with one face of the helix containing the majority of hydrophobic amino acids, and the opposite face containing the majority of polar or charged amino acids. This class includes the human cathelicidin LL-37 (Oren, Lerman et al. 1999) (hCAP-18) which although a relatively weak antimicrobial agent, plays an extremely important role in immune system signaling/modulation (Yang, Chertov et al. 2001; Scott, Davidson et al. 2002; Davidson, Currie et al. 2004). Although structurally conserved, the mode 17  of action of this class of peptides appears to be quite diverse. A model of pleurocidin, an cthelical cationic antimicrobial peptide isolated from the winter flounder is shown in Fig 1.3A (Syvitski, Burton et al. 2005). Due to the relatively simple secondary structure of the ct-helical peptides, large numbers of synthetic peptide variants have been designed on this template. These include simple nonnatural peptides such as the K L A L peptides.  Most of these peptides have been used to  quantitate the relative contribution of particular biophysical features to the activity of a given peptide, including charge, hydrophobicity, hydrophobic moment and amphipathicity (Dathe, Schumann et al. 1996; Wieprecht, Dathe et al. 1996; Wieprecht, Dathe et al. 1997). In practice, it is very difficult to alter one of these features without also causing changes in other properties, but strong correlations can be drawn between alterations of each property and the effect these have on antimicrobial and hemolytic activity, and such variants are thus useful in testing hypotheses regarding mechanism of action (Dathe, Schumann et al. 1996; Wieprecht, Dathe et al. 1996; Wieprecht, Dathe et al. 1997). The second large class of peptides includes the P-stranded peptides, also isolated from diverse sources. These peptides are stabilized by two or more disulfide bonds or by cyclization. They include the relatively short and highly antimicrobial P-hairpin tachyplesins (Park, Lee et al. 1992; Yang, Chertov et al. 2001) and polyphemusins (Miyata, Tokunaga et al. 1989) from the Asian and American horseshoe crabs (Fig 1.3B), and protegrins from pig neutrophils (Chen, Falla et al. 2000) which each contain two disulfide bonds stabilizing a two-stranded p-hairpin. Gramicidin S, an already commercialized cyclic P-stranded decapeptide antibiotic produced by Bacillus brevis, has been extensively characterized and indeed has spawned many derivatives (Jones, Sikakana et al. 1978; Gibbs, Kondejewski et al. 1998). Overall charge, hydrophobicity,  18  Figure 1.2. Examples of structural classes of cationic antimicrobial peptides. Illustrations were prepared from PDB structural files using Protein Explorer 2.0 beta. A) a-helical pleurocidin, PDB ID 1Z64 (Syvitski, Burton et al. 2005). B) p-sheet peptide polyphemusin I, PDB ID 1RKK (Powers, Rozek et al. 2004). C) atypically structured indolicidin, PDB ID 1G89 (Rozek, Friedrich et al. 2000). D) mixed o>P structure peptide human P-defensin 3 (hBD-3), PDB ID 1KJ6 (Schibli, Hunter et al. 2002). and amphipathicity are also important in determining the activity of this class of peptides, although due to the added structural constraints, it is somewhat more difficult to make accurate predictions of what effect a particular substitution will have on activity (Kondejewski, Jelokhani-Niaraki et al. 1999; Jelokhani-Niaraki, Kondejewski et al. 2000; Mclnnes, Kondejewski et al. 2000). There are also a vast number of 3 to 4 disulphide bond-stabilized peptides, the most prominent of which are the defensins, a major component of innate immunity in plants, insects and mammals (Fig 1.3D) (Lehrer, Barton et al. 1989; Goldman, Anderson et al. 1997; Bals, Wang et al. 1998; Imler and Bulet 2005; Lay and Anderson 2005).  19  A number of other cationic antimicrobial peptides are characterized by their unusual composition, containing high proportions of particular amino acids such as tryptophan, histidine, or proline. Some of these (indolicidin and tritrpticin) appear to adopt extended structures upon interaction with membranes such that the structure is stabilized by hydrogen bonding and Van der Waals forces with lipids, rather than intra-peptide interactions (Schibli, Hwang et al. 1999; Rozek, Friedrich et al. 2000), although others (histatin) do form well-defined structures (Raj, Marcus et al. 1998). The peptide indolicidin is relatively small (13 residues) and contains a large proportion of tryptophan residues. In SDS micelles, it forms a boat-like structure (Fig. 1.3C) that is unique among peptides examined to date (Rozek, Friedrich et al. 2000). The histatin family of peptides (Oppenheim, X u et al. 1988; X u , Telser et al. 1990) of humans and other primates contains ~27% histidine residues and is involved in protection of the buccal mucosa from pathogenic yeast (Tsai and Bobek 1998). The mode of action of many of these types of peptides is not well characterized, although indolicidin appears not to cause bacterial membrane disruption at its effective concentration (Gennaro, Zanetti et al. 2002). Due to the fact that colistin and polymyxin B may be effective anti-Pseudomonal therapeutics, and that this class of drugs has a practical advantage of low rates of spontaneous resistance to the drug (Bratu, Quale et al. 2005; L i , Nation et al. 2005), there is currently a great deal of interest in developing variant cationic antimicrobial peptides that will offer even greater therapeutic success than polymyxin or colistin. Although, to date, there has been only limited success in the clinical trials that have been undertaken, this class of compounds still represents a potential therapeutic option (Zhang and Falla 2004; Zhang, Parente et al. 2005). Bacterial resistance to cationic antimicrobial peptides Growth of many bacterial species under conditions of divalent cation limitation leads to increased cationic antimicrobial peptide resistance via the activation of the PhoP-PhoQ twocomponent regulatory systems (Macfarlane, Kwasnicka et al. 1999; Groisman 2001; Llama20  Palacios, Lopez-Solanilla et al. 2003; Winfield, Latifi et al. 2005). This system has been wellcharacterized in Salmonella enterica sv. Typhimurium (S. Typhimurium), and is diagrammed in Figure 1.3. In this species, activation of the PhoP-PhoQ system leads to increased transcription of a number of genes, many of which could cooperate to increase bacterial resistance to cationic antimicrobial peptides. Although this system is also involved in regulating genes that play no known role in resistance to cationic antimicrobial peptides, these genes are omitted from Figure 1.3. Divalent cations serve a number of important roles within bacterial cells, including outer membrane stabilization (Nicas and Hancock 1980; Nicas and Hancock 1983; Moore, Chan et al. 1984), cofactors for A T P within the cells, stabilization of polyanions like D N A and R N A , and as a cofactor for many metabolic enzymes.  In order to maintain a sufficient intracellular  concentration of divalent cations, a number of transport proteins have evolved to transport M g across the cytoplasmic membrane.  2 +  In S. Typhimurium, these include the MgtA, MgtB, and  CorA proteins (Moncrief and Maguire 1999). MgtA and MgtB are homologs of one another, belonging to the P-type ATPase class of transporters (Kehres and Maguire 2002). CorA is expressed constitutively, while both mgtA and mgtB are induced upon exposure to limiting M g via the phoPQ system (Tao, Snavely et al. 1995). P. aeruginosa contains homologs of cor A and one MgtA/B homologue (Stover, Pham et al. 2000). In addition, P. aeruginosa contains a gene encoding another putative M g  transporter, MgtE. While this protein was identified based on  •  9+  its ability to complement a M g  94-  transport deficiency, its role in M g  transport is not well  understood (Townsend, Esenwine et al. 1995; Stover, Pham et al. 2000). The most obvious phenotypic changes upon PhoP-PhoQ activation are the alterations that occur in the Lipid A moiety of the S. Typhimurium LPS. The PhoP-PhoQ system directly activates transcription of the pagP gene as well as the ugtL gene. The pagP gene encodes an outer membrane localized acyltransferase that transfers palmitate from a phospholipid molecule 21  to the N-linked myristoyl residue of the proximal sugar (Bishop, Gibbons et al. 2000). The presence of this extra acyl chain increases the hydrophobicity of the lipidic face of the LPS and this increased. hydrophobicity may serve to increase the stability of the outer membrane to cationic peptide-induced membrane distortion (Guo, Lim et al. 1998). The ugtL gene encodes an inner membrane localized protein that promotes the formation of monophosphorylated Lipid A (i.e. only phosphorylated at the 1 or the 4' position, rather than at both positions (Shi, Cromie et al. 2004). This deficit of a phosphate reduces the charge on the Lipid A moiety and would therefore reduce the interaction of the cationic peptide with the LPS. Another PhoP-PhoQ activated gene is that encoding the small protein, PmrD.  This  protein induces the activation of a second two-component regulatory system, PmrA-PmrB. This activation occurs because the PmrD protein binds to the phosphorylated (activated) form of PmrA and protects it from dephosphorylation by its cognate response regulator, PmrB (Kato and Groisman 2004). Once activated, the PmrA-PmrB system causes increased transcription of the ugd gene, and a seven gene operon, pmrHFIJKLM 2000; Mouslim and Groisman 2003).  (Gunn, L i m et al. 1998; Gunn, Ryan et al.  These genes are responsible for the addition of N 4 -  aminoarabinose to the 1 and 4' positions of the S. Typhimurium Lipid A (Nummila, Kilpelainen et al. 1995; Gunn, Ryan et al. 2000). In addition to this, the PmrA-regulated gene, PmrC, is involved in the addition of ethanolamine to the same 1 and 4' phosphates as are modified by pmrHFIJKLM  and ugd (Lee, Hsu et al. 2004). A model showing the known Lipid A changes  observed in S. Typhimurium and regulated by the PhoP-PhoQ or PmrA-PmrB system is shown in Fig. 1.4 (Zhou, Ribeiro et al. 2001; Lee, Hsu et al. 2004; Shi, Cromie et al. 2004). The net result is a heterogeneous mixture of Lipid A molecules, which possess reduced charge, due to the removal or blocking of the  22  |[Mg ] 2+  T[CAP]  TfFe *] 3  Figure 1.3. PhoP-PhoQ and PmrA-PmrB signaling in Salmonella enterica serovar Typhimurium. Limiting concentrations of M g or elevated concentrations of cationic antimicrobial peptides induce autophosphorylation of the PhoQ protein. This phosphate is then transferred to a conserved aspartate residue on PhoP. Phospho-PhoP then promotes transcription from a number of promoters, including those shown. The pmrD gene encodes a small basic protein that binds to PmrB, inhibiting PmrB-catalyzed dephosphorylation of PmrA. This leads to elevated levels of phospho-PmrA. Phospho-PmrA promotes transcription of the pmrHFIJKLM and ugd genes, leading to the addition a N4-aminoarabinose to the Lipid A . Transcription of PmrCAB leads to increased levels of PmrA and PmrB as well as PmrC, a protein responsible for addition of ethanolamine to Lipid A . PmrA-PmrB also respond to the presence of elevated concentrations of F e independently of PmrD, leading to similar Lipid A alteration. Figure adapted from Kato & Groisman, 2004. +  3+  phosphates normally found at the 1 and 4' positions and/or altered acylation patterns. The modification of phosphates results in the reduction of the anionic charge on LPS, which in turn, reduces the requirement for divalent cation-mediated outer membrane stabilization and makes  23  the bacteria containing these modifications more resistant to the activity of cationic antimicrobial peptides. Although it is clear that growth of Salmonella under conditions of limiting M g  2 +  is  capable of stimulating the PhoP-PhoQ and PmrA-PmrB mediated LPS changes, it is unclear as to whether this is a relevant mechanism with respect to pathogenesis. Within most tissues of the human body, including the bronchioles of the lung (Matsui, Grubb et al. 1998), and the intestinal lumen, divalent cation concentrations are in the low millimolar range, more than enough to repress the PhoP-PhoQ mediated signaling (Vescovi, Ayala et al. 1997; McPhee, Lewenza et al. 2003). It has long been argued that the divalent cation concentration within the Salmonella-containing vacuole is limiting, and therefore, in vivo, Salmonella is responding to this intracellular condition (Garcia-del Portillo, Foster et al. 1992; Groisman 2001). Recently however, this assertion has also been questioned and an alternative model has been presented for intramacrophage activation of the PhoP-PhoQ system (Bader, Sanowar et al. 2005; Hancock and McPhee 2005). The PhoQ protein of a number of bacteria, including E. coli, Salmonella sp., Shigella sp., Yersinia sp., contains a patch of acidic aspartate and glutamate residues that is proposed to be important for both divalent cation and cationic peptide sensing (Bader, Sanowar et al. 2005). In this work, the authors provide an elegant explanation for their previous observation that cationic antimicrobial peptides directly activate the PhoQ protein (Bader, Navarre et al. 2003). The acidic patch, which is located directly adjacent to the plane of the membrane in vivo, is normally bound by divalent cations, thereby stabilizing the kinase in a non-active conformation. Upon divalent cation limitation, or upon divalent cation displacement by cationic peptides, the sensor kinase is activated, leading to phosphorylation of PhoP and activation of target promoters (Bader, Sanowar et al. 2005; Hancock and McPhee 2005). This new hypothesis has also been supported by recent work that directly measured divalent cation concentrations within the SCV, 24  showing that the M g  z +  concentration is —1 m M , a normally non-inducing concentration (Orozco,  Touret et al. 2005). Interestingly, several non-enteric bacteria such as Pseudomonas,  Photorhabdus,  Providencii, and Agrobacterium, have PhoQ homologues that respond to limiting divalent cation concentration, but that do not contain this acidic patch, suggesting that the actual mechanism by which this protein detects limiting divalent cation concentration may differ depending upon the species examined. Indeed, there is some support for this in the literature as when divalent cations are removed from the P. aeruginosa PhoQ periplasmic domain, the monomeric state of the sensor is promoted, while the E. coli sensor protein remains in a dimeric conformation regardless of the divalent cation concentration (Lesley and Waldburger 2001). Additionally, the cation-bound periplasmic domain of the PhoQ protein has a dramatically different 2D-structure when compared with the E. coli protein (Lesley and Waldburger 2001). *  2"i"  When M g  is added to the P. aeruginosa periplasmic domain, a conformational shift occurs as  assessed by circular dichroism and fluorescence spectroscopy. In constrast, no such shift occurs for the purified E. coli PhoQ periplasmic domain (Lesley and Waldburger 2001). In spite of these differences in the signaling domain, hybrid PhoQ proteins containing the periplasmic domain from P. aeruginosa and the signaling domain from E. coli show similar ability to respond to divalent cation limitation as native E. coli PhoQ (Lesley and Waldburger 2001). In other organisms, other LPS alterations have been identified that lead to increased resistance to cationic antimicrobial peptides. Yersinia pestis produces a modified LPS termed lipooligosaccharide, differing primarily by the lack of repeating O-antigen subunits. In Yersinia pestis, PhoP regulates the addition of a galactose moiety to the LOS, in addition to regulating the addition of aminoarabinose to Lipid A (Hitchen, Prior et al. 2002). Mutants of Y. pestis lacking 25  core oligosaccharide  Figure 1.4. Structure of Lipid A from Salmonella enterica serovar Typhimurium. Modifications to Lipid A that are associated with PhoP-PhoQ and PmrA-PmrB mediated signaling are shown. Modifications shown in red represent the PmrC catalyzed addition of ethanolamine to the 1 or 4' phosphates of Lipid A . The structure of N4-aminoarabinose is indicated in blue. The PagP-catalyzed addition of palmitic acid to the N2-myristoyl group is indicated in green. Additionally, the sites of phosphate hydrolysis catalyzed by the UgtL protein are also indicated.  phoP exhibit > 100-fold increased sensitivity to polymyxin B and 8-fold higher sensitivity to cecropin P I , an insect-derived cationic antimicrobial peptide (Hitchen, Prior et al. 2002). The authors of this work did not observe any of the Lipid A changes seen in S. Typhimurium, and attributed the increased sensitivity of the phoP mutant to the loss of LOS modification. These 26  results have been contradicted by several groups that have observed Lipid A modification by aminoarabinose in Y. pestis, as well as in other yersiniae (Marceau, Sebbane et al. 2004; Rebeil, Ernst et al. 2004; Winfield, Latifi et al. 2005). This issue is currently unresolved, although the suggestion that LOS, as well as Lipid A modifications can lead to increased resistance to cationic peptides is supportive of the strong influence that the characteristics of the outer membrane have on cationic antimicrobial sensitivity. In addition to the LPS/LOS modifications described above, there are a number of other types of systems that contribute to increased cationic peptide resistance in a number of organisms. In 5. Typhimurium, for example, another PhoP-regulated gene, pgtE, encodes an OmpT-family outer membrane protease (Guina, Y i et al. 2000).  This protein catalyzes the  degradation of a-helical cationic peptides, giving rise to increased resistance.  In E. coli,  deletion of ompT results in increased susceptibility of the bacterium to killing by protamine, likely via a mechanism similar to that observed with pgtE (Stumpe, Schmid et al. 1998). A Yersinia pestis homologue of PgtE called Pla, is known to be expressed at 37°C, but not at 25°C and is a virulence factor involved in the movement of the bacteria from a subcutaneous wound to distal sites, although what role, i f any it plays in cationic antimicrobial peptide resistance is unknown (Lahteenmaki, Kukkonen et al. 2001).  Furthermore, studies that looked at the  susceptibility of both Gram-positive and Gram-negative bacteria in the presence of protease inhibitors suggested that a number of intracellular proteases including DegP, also contributed to the intrinsic resistance of a number of bacteria to cationic peptides (Ulvatne, Haukland et al. 2002). In addition to the impermeability-based mechanisms of cationic peptides resistance described above, there is a precedent for the ability of certain proteins to efflux cation antimicrobial peptides. As described on page 2, efflux is a very common mechanism used by  27  various bacteria to reduce the concentration of a given antibiotic within the cytoplasm. In Yersinia species, the rosA-rosB genes encode a temperature-regulated potassium-efflux pump antiporter that shows specificity for several cationic antimicrobial peptides (Bengoechea and Skurnik 2000). This system also appears to respond to the presence of cationic antimicrobial peptides, demonstrating that the presence of these compounds may induce systems responsible for increasing peptide resistance (Bengoechea and Skurnik 2000). Goals of this study P. aeruginosa infections represent the third leading cause of nosocomial infections in North America.  Furthermore, they are the leading cause of increased morbidity in cystic  fibrosis patients. Treatment of these P. aeruginosa infections often involves the administration of colistin, a cationic peptide antimicrobial.  Furthermore, a number of novel cationic  antimicrobial peptide therapies are being developed for the treatment of infections that are recalcitrant to conventional antimicrobial therapy.  Given the clinical importance of P.  aeruginosa infections in cystic fibrosis patients, this study was undertaken to identify and characterize resistance determinants to cationic antimicrobial peptides.  At the time of the  commencement of these studies, the PhoP-PhoQ system of P. aeruginosa had been identified, but the pathway by which this system led to resistance was unknown. Furthermore, some unusual regulatory phenomena identified in the initial studies characterizing PhoP-PhoQ from P. aeruginosa, strongly suggested that other regulatory systems were involved in regulating resistance to polymyxin B and cationic antimicrobial peptides (Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000). Therefore the major hypotheses and goals for this work included: 1.  A novel regulatory system is involved in the regulation of cationic antimicrobial peptide resistance in response to limiting concentrations of M g . The first goal was to identify 2 +  this system. 28  2.  This new system and the previously identified PhoP-PhoQ system form a regulatory network that contributes to resistance via the regulation of unknown effector genes. The goal here was to identify these genes and characterize the role they play in contributing to cationic antimicrobial peptide resistance.  3.  Resistance to cationic antimicrobial peptides in many bacterial species occurs via mechanisms that are unrelated to PhoP-PhoQ or PmrA-PmrB signaling. Examples of this include active efflux of the cationic peptide and degradation by endogenous proteases. I hypothesized that these types of systems would be present in P. aeruginosa and sought to identify them through a screening approach.  29  REFERENCES Aim, R. A., Hallinan, J. P., Watson, A. A. & Mattick, J. S. (1996). Fimbrial biogenesis genes of Pseudomonas aeruginosa: pilWand pilXincvQa.se the similarity of type 4 fimbriae to the GSP protein-secretion systems and p i l Y l encodes a gonococcal PilC homologue. Mol Microbiol 22, 161-173. Anderson, D. H. (1938). Cystic fibrosis of the pancreas and its relation to celiac disease: a clinical and pathologic study. Am JDis Child 56, 344-399. Armstrong, D. S., Grimwood, K., Carlin, J. B. & other authors (1997). Lower airway inflammation in infants and young children with cystic fibrosis. Am JRespir Crit Care Med 156, 1197-1204. Bader, M . W., Navarre, W. W., Shiau, W., Nikaido, H., Frye, J. G., McClelland, M., Fang, F. C. & Miller, S. I. (2003). Regulation of Salmonella typhimurium virulence gene expression by cationic antimicrobial peptides. Mol Microbiol 50, 219-230. Bader, M . W., Sanowar, S., Daley, M . E., Schneider, A. R., Cho, U., Xu, W., Klevit, R. E . , Le Moual, H. & Miller, S. I. (2005). Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122, 461-472. Balough, K., McCubbin, M., Weinberger, M., Smits, W., Ahrens, R. & Fick, R. (1995). The relationship between infection and inflammation in the early stages of lung disease from cystic fibrosis. Pediatr Pulmonol 20, 63-70. Bals, R., Wang, X., Wu, Z., Freeman, T., Bafna, V., Zasloff, M . & Wilson, J. M . (1998). Human beta-defensin 2 is a salt-sensitive peptide antibiotic expressed in human lung. J Clin Invest 102, 874-880. Barbieri, J. T. & Sun, J. (2004). Pseudomonas aeruginosa ExoS and ExoT. Rev Physiol Biochem Pharmacol 152, 79-92. Bengoechea, J. A. & Skurnik, M . (2000). Temperature-regulated efflux pump/potassium antiporter system mediates resistance to cationic antimicrobial peptides in Yersinia. Mol Microbiol 37, 67-80. Bishop, R. E., Gibbons, H . S., Guina, T., Trent, M . S., Miller, S. I. & Raetz, C. R. (2000). Transfer of palmitate from phospholipids to lipid A in outer membranes of gram-negative bacteria. EMBO J19, 5071-5080. Braff, M . H., Hawkins, M . A., Di Nardo, A. & other authors (2005). Structure-function relationships among human cathelicidin peptides: dissociation of antimicrobial properties from host immunostimulatory activities. J Immunol 174, 4271-4278. Bratu, S., Quale, J., Cebular, S., Heddurshetti, R. & Landman, D. (2005). Multidrugresistant Pseudomonas aeruginosa in Brooklyn, New York: molecular epidemiology and in vitro activity of polymyxin B. Eur J Clin Microbiol Infect Dis 24, 196-201. 30  Brinkman, F. S., Bains, M . & Hancock, R. E. (2000). The amino terminus of Pseudomonas aeruginosa outer membrane protein OprF forms channels in lipid bilayer membranes: correlation with a three-dimensional model. JBacteriol 182, 5251-5255. Britigan, B. E., Roeder, T. L., Rasmussen, G. T., Shasby, D. M., McCormick, M . L. & Cox, C. D. (1992). Interaction of the Pseudomonas aeruginosa secretory products pyocyanin and pyochelin generates hydroxyl radical and causes synergistic damage to endothelial cells. Implications for Pseudomonas-associated tissue injury. J Clin Invest 90, 2187-2196. Britigan, B. E., Railsback, M . A. & Cox, C. D. (1999). The Pseudomonas aeruginosa secretory product pyocyanin inactivates alpha 1 protease inhibitor: implications for the pathogenesis of cystic fibrosis lung disease. Infect Immun 67, 1207-1212. Canton, R., Cobos, N., de Gracia, J. & other authors (2005). Antimicrobial therapy for pulmonary pathogenic colonisation and infection by Pseudomonas aeruginosa in cystic fibrosis patients. Clin Microbiol Infect 11, 690-703. Carnoy, C , Scharfman, A., Van Brussel, E., Lamblin, G., Ramphal, R. & Roussel, P. (1994). Pseudomonas aeruginosa outer membrane adhesins for human respiratory mucus glycoproteins. Infect Immun 62, 1896-1900. Chan, C , Burrows, L . L. & Deber, C. M . (2004). Helix induction in antimicrobial peptides by alginate in biofilms. J Biol Chem 279, 38749-38754. Chan, C , Burrows, L. L . & Deber, C. M . (2005). Alginate as an auxiliary bacterial membrane: binding of membrane-active peptides by polysaccharides. JPept Res 65, 343-351. Chen, J., Falla, T. J., Liu, H . & other authors (2000). Development of protegrins for the treatment and prevention of oral mucositis: structure-activity relationships of synthetic protegrin analogues. Biopolymers 55, 88-98. Coffman, T. J., Cox, C. D., Edeker, B. L . & Britigan, B. E . (1990). Possible role of bacterial siderophores in inflammation. Iron bound to the Pseudomonas siderophore pyochelin can function as a hydroxyl radical catalyst. J Clin Invest 86, 1030-1037. Conese, M., Copreni, E., Di Gioia, S., De Rinaldis, P. & Fumarulo, R. (2003). Neutrophil recruitment and airway epithelial cell involvement in chronic cystic fibrosis lung disease. J Cyst Fibros 2, 129-135. Corvol, H., Fitting, C , Chadelat, K., Jacquot, J., Tabary, O., Boule, M . , Cavaillon, J. M . & Clement, A. (2003). Distinct cytokine production by lung and blood neutrophils from children with cystic fibrosis. Am J Physiol Lung Cell Mol Physiol 284, L997-1003. Cowell, B. A., Evans, D. J. & Fleiszig, S. M . (2005). Actin cytoskeleton disruption by ExoY and its effects on Pseudomonas aeruginosa invasion. FEMS Microbiol Lett 250, 71-76. Cunha, M . V., Leitao, J. H., Mahenthiralingam, E., Vandamme, P., Lito, L., Barreto, C , Salgado, M . J. & Sa-Correia, I. (2003). Molecular analysis of Burkholderia cepacia complex 31  isolates from a Portuguese cystic fibrosis center: a 7-year study. J Clin Microbiol 41, 41134120. D'Argenio, D. A., Calfee, M . W., Rainey, P. B. & Pesci, E. C. (2002). Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J Bacteriol 184, 6481-6489. Dakin, C. J., Numa, A. H., Wang, H., Morton, J. R., Vertzyas, C. C. & Henry, R. L. (2002). Inflammation, infection, and pulmonary function in infants and young children with cystic fibrosis. Am JRespir Crit Care Med 165, 904-910. Dathe, M., Schumann, M., Wieprecht, T., Winkler, A., Beyermann, M., Krause, E., Matsuzaki, K., Murase, O. & Bienert, M . (1996). Peptide helicity and membrane surface charge modulate the balance of electrostatic and hydrophobic interactions with lipid bilayers and biological membranes. Biochemistry 35, 12612-12622. Davidson, D. J., Currie, A. J., Reid, G. S., Bowdish, D. M., MacDonald, K. L., Ma, R. C , Hancock, R. E. W. & Speert, D. P. (2004). The cationic antimicrobial peptide LL-37 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization. J Immunol 172, 1146-1156. Doring, G., Conway, S. P., Heijerman, H. G., Hodson, M . E., Hoiby, N., Smyth, A. & Touw, D. J. (2000). Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus. Eur Respir J16, 749-767. Ernst, R. K., Yi, E. C , Guo, L., Lim, K. B., Burns, J. L., Hackett, M . & Miller, S. I. (1999). Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa. Science 286, 1561-1565. Erridge, C , Bennett-Guerrero, E. & Poxton, I. R. (2002). Structure and function of lipopolysaccharides. Microbes Infect 4, 837-851. Eswaran, J., Koronakis, E., Higgins, M . K., Hughes, C. & Koronakis, V. (2004). Three's company: component structures bring a closer view of tripartite drug efflux pumps. Curr Opin Struct Biol 14, 741-747. Evans, D. J., Pier, G. B., Coyne, M . J., Jr. & Goldberg, J. B. (1994). The rfb locus from Pseudomonas aeruginosa strain PAI03 promotes the expression of O antigen by both LPSrough and LPS-smooth isolates from cystic fibrosis patients. Mol Microbiol 13, 427-434. Fick, R. B., Jr., Sonoda, F. & Hornick, D. B. (1992). Emergence and persistence of Pseudomonas aeruginosa in the cystic fibrosis airway. Semin Respir Infect 7, 168-178. Friedrich, C , Scott, M . G., Karunaratne, N., Yan, H. & Hancock, R. E. W. (1999). Saltresistant alpha-helical cationic antimicrobial peptides. Antimicrob Agents Chemother 43, 15421548.  32  Fyfe, J. A. M . & Govan, J. R. (1983). Synthesis, regulation and biological function of bacterial alginate. In Progress in Industrial Microbiology, pp. 45-83. Edited by M . E. Bushnell. Amsterdam: Elsevier. Garcia-del Portillo, F., Foster, J. W., Maguire, M . E . & Finlay, B. B. (1992). Characterization of the micro-environment of Salmonella typhimurium-contammg vacuoles within M D C K epithelial cells. Mol Microbiol 6, 3289-3297. Garcia, J. R., Krause, A., Schulz, S. & other authors (2001). Human beta-defensin 4: a novel inducible peptide with a specific salt-sensitive spectrum of antimicrobial activity. Faseb J15, 1819-1821. Garrett, S. & Silhavy, T. J. (1987). Isolation of mutations in the alpha operon of Escherichia coli that suppress the transcriptional defect conferred by a mutation in the porin regulatory gene envZ. JBacteriol 169, 1379-1385. Garrity-Ryan, L., Shafikhani, S., Balachandran, P. & other authors (2004). The A D P ribosyltransferase domain of Pseudomonas aeruginosa ExoT contributes to its biological activities. Infect Immun 72, 546-558. Gennaro, R., Zanetti, M., Benincasa, M., Podda, E. & Miani, M . (2002). Pro-rich antimicrobial peptides from animals: structure, biological functions and mechanism of action. CurrPharm Des 8, 763-778. Gibbs, A. C , Kondejewski, L. H., Gronwald, W., Nip, A. M., Hodges, R. S., Sykes, B. D. & Wishart, D. S. (1998). Unusual beta-sheet periodicity in small cyclic peptides. Nat Struct Biol 5, 284-288. Gladman, G., Connor, P. J., Williams, R. F. & David, T. J. (1992). Controlled study of Pseudomonas cepacia and Pseudomonas maltophilia in cystic fibrosis. Arch Dis Child 67, 192195. Goldman, M . J., Anderson, G. M., Stolzenberg, E. D., Kari, U. P., Zasloff, M . & Wilson, J. M . (1997). Human beta-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis. Cell 88, 553-560. Goodman, A. L., Kulasekara, B., Rietsch, A., Boyd, D., Smith, R. S. & Lory, S. (2004). A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell 7, 745-754. Govan, J. R. & Deretic, V. (1996). Microbial pathogenesis in cystic fibrosis; mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 60, 539-574. Groisman, E. A. (2001). The Pleiotropic Two-Component Regulatory System PhoP-PhoQ. J Bacteriol 183, 1835-1842. Guina, T., Yi, E. C , Wang, H., Hackett, M . & Miller, S. I. (2000). A PhoP-regulated outer membrane protease of Salmonella enterica serovar Typhimurium promotes resistance to alphahelical antimicrobial peptides. JBacteriol 182, 4077-4086. 33  Gunn, J. S., Lim, K. B., Krueger, J., Kim, K., Guo, L., Hackett, M . & Miller, S. I. (1998). PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol Microbiol 27, 1171-1182. Gunn, J. S., Ryan, S. S., Van Velkinburgh, J. C., Ernst, R. K. & Miller, S. I. (2000). Genetic and functional analysis of a PmrA-PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar Typhimurium. Infect Immun 68, 6139-6146. Guo, L., Lim, K. B., Poduje, C. M . , Daniel, M., Gunn, J. S., Hackett, M . & Miller, S. I. (1998). Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides. Cell 95, 189-198. Hancock, R. E . W. & Nikaido, H . (1978). Outer membranes of gram-negative bacteria. X I X . Isolation from Pseudomonas aeruginosa P A O l and use in reconstitution and definition of the permeability barrier. JBacteriol 136, 381-390. Hancock, R. E . W., Irvin, R. T., Costerton, J. W. & Carey, A . M . (1981). Pseudomonas aeruginosa outer membrane: peptidoglycan-associated proteins. J Bacteriol 145, 628-631. Hancock, R. E . W. & McPhee, J. B. (2005). Salmonella's Sensor for Host Defense Molecules. Cell 122, 320-322. Hilliard, J. B., Konstan, M . W. & Davis, P. B. (2002). Inflammatory mediators in CF patients. Methods Mol Med 70, 409-431. Hitchen, P. G., Prior, J. L., Oyston, P. C , Panico, M., Wren, B. W., Titball, R. W., Morris, H. R. & Dell, A . (2002). Structural characterization of lipo-oligosaccharide (LOS) from Yersinia pestis: regulation of LOS structure by the PhoPQ system. Mol Microbiol 44, 16371650. Hutchison, M . L . & Govan, J. R. (1999). Pathogenicity of microbes associated with cystic fibrosis. Microbes Infect 1, 1005-1014. Imler, J. L . & Bulet, P. (2005). Antimicrobial peptides in Drosophila: structures, activities and gene regulation. Chem Immunol Allergy 86, 1-21. Jain, M., Ramirez, D., Seshadri, R. & other authors (2004). Type III secretion phenotypes of Pseudomonas aeruginosa strains change during infection of individuals with cystic fibrosis. J Clin Microbiol 42, 5229-5237. Jelinek, R. & Kolusheva, S. (2005). Membrane interactions of host-defense peptides studied in model systems. Curr Protein PeptSci 6, 103-114. Jelokhani-Niaraki, M., Kondejewski, L. H., Farmer, S. W., Hancock, R. E . W., Kay, C. M . & Hodges, R. S. (2000). Diastereoisomeric analogues of gramicidin S: structure, biologicalactivity and interaction with lipid bilayers. Biochem J349 Pt 3, 747-755. 34  Jensen, T., Pedersen, S. S., Garne, S., Heilmann, C., Hoiby, N. & Koch, C. (1987). Colistin inhalation therapy in cystic fibrosis patients with chronic Pseudomonas aeruginosa lung infection. JAntimicrob Chemother 19, 831-838. Jones, C. R., Sikakana, C. T., Hehir, S., Kuo, M . C. & Gibbons, W. A. (1978). The quantitation of nuclear Overhauser effect methods for total conformational analysis of peptides in solution. Application to gramicidin S. Biophys J 24, 815-832. Kato, A. & Groisman, E. A. (2004). Connecting two-component regulatory systems by a protein that protects a response regulator from dephosphorylation by its cognate sensor. Genes Dev IS, 2302-2313. Kehres, D. G. & Maguire, M . E . (2002). Structure, properties and regulation of magnesium transport proteins. Biometals 15, 261-270. Kelly, N. M., MacDonald, M . H., Martin, N., Nicas, T. & Hancock, R. E . (1990). Comparison of the outer membrane protein and lipopolysaccharide profiles of mucoid and nonmucoid Pseudomonas aeruginosa. J Clin Microbiol 28, 2017-2021. Khan, T. Z., Wagener, J. S., Bost, T., Martinez, J., Accurso, F. J. & Riches, D. W. (1995). Early pulmonary inflammation in infants with cystic fibrosis. Am J Respir Crit Care Med 151, 1075-1082. Kharazmi, A., Schiotz, P. O., Hoiby, N., Baek, L. & Doring, G. (1986). Demonstration of neutrophil chemotactic activity in the sputum of cystic fibrosis patients with Pseudomonas aeruginosa infection. Eur J Clin Invest 16, 143-148. Kitten, T., Kinscherf, T. G., McEvoy, J. L . & Willis, D. K. (1998). A newly identified regulator is required for virulence and toxin production in Pseudomonas syringae. Mol Microbiol 28,917-929. Kondejewski, L. H., Jelokhani-Niaraki, M., Farmer, S. W., Lix, B., Kay, C. M., Sykes, B. D., Hancock, R. E. W. & Hodges, R. S. (1999). Dissociation of antimicrobial and hemolytic activities in cyclic peptide diastereomers by systematic alterations in amphipathicity. J Biol Chem 274, 13181-13192. Lahteenmaki, K., Kukkonen, M . & Korhonen, T. K. (2001). The Pla surface protease/adhesin of Yersiniapestis mediates bacterial invasion into human endothelial cells. FEBS Lett 504, 69-72. Lay, F. T. & Anderson, M . A. (2005). Defensins—components of the innate immune system in plants. Curr Protein Pept Sci 6, 85-101. Lee, H., Hsu, F. F., Turk, J. & Groisman, E. A. (2004). The PmrA-regulated pmrC gene mediates phosphoethanolamine modification of lipid A and polymyxin resistance in Salmonella enterica. JBacteriol 186, 4124-4133.  35  Lee, V. T., Smith, R. S., Tummler, B. & Lory, S. (2005). Activities of Pseudomonas aeruginosa effectors secreted by the Type III secretion system in vitro and during infection. Infect Immun 73,1695-1705. Lehrer, R. I., Barton, A., Daher, K. A., Harwig, S. S., Ganz, T. & Selsted, M . E . (1989). Interaction of human defensins with Escherichia coli. Mechanism of bactericidal activity. J Clin Invest 84, 553-561. Lesley, J. A. & Waldburger, C. D. (2001). Comparison of the Pseudomonas aeruginosa and E. coli PhoQ sensor domains: Evidence for distinct mechanisms of signal detection. J Biol Chem 12, 12. Li, J., Nation, R. L., Milne, R. W., Turnidge, J. D. & Coulthard, K. (2005). Evaluation of colistin as an agent against multi-resistant Gram-negative bacteria. Int J Antimicrob Agents 25, 11-25. Llama-Palacios, A., Lopez-Solanilla, E., Poza-Carrion, C , Garcia-Olmedo, F. & Rodriguez-Palenzuela, P. (2003). The Erwinia chrysanthemi phoP-phoQ operon plays an important role in growth at low pH, virulence and bacterial survival in plant tissue. Mol Microbiol 49, 347-357. Macfarlane, E . L., Kwasnicka, A., Ochs, M . M . & Hancock, R. E . W. (1999). PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outer-membrane protein OprH and polymyxin B resistance. Mol Microbiol 34, 305-316. Macfarlane, E . L., Kwasnicka, A. & Hancock, R. E . W. (2000). Role of Pseudomonas aeruginosa PhoP-PhoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology 146 (Pt 10), 2543-2554. Macia, M . D., Blanquer, D., Togores, B., Sauleda, J., Perez, J. L . & Oliver, A. (2005). Hypermutation is a key factor in development of multiple-antimicrobial resistance in Pseudomonas aeruginosa strains causing chronic lung infections. Antimicrob Agents Chemother 49, 3382-3386. Mahenthiralingam, E., Urban, T. A. & Goldberg, J. B. (2005). The multifarious, multireplicon Burkholderia cepacia complex. Nat Rev Microbiol 3, 144-156. Makino, K., Amemura, M., Kim, S. K., Nakata, A. & Shinagawa, H . (1993). Role of the sigma 70 subunit of R N A polymerase in transcriptional activation by activator protein PhoB in Escherichia coli. Genes Devi, 149-160. Marceau, M., Sebbane, F., Ewann, F., Collyn, F., Lindner, B., Campos, M . A., Bengoechea, J. A. & Simonet, M . (2004). The pmrF polymyxin-resistance operon of Yersinia pseudotuberculosis is upregulated by the PhoP-PhoQ two-component system but not by PmrAPmrB, and is not required for virulence. Microbiology 150, 3947-3957. Marchetti, F., Giglio, L., Candusso, M., Faraguna, D. & Assael, B. M . (2004). Early antibiotic treatment of Pseudomonas aeruginosa colonisation in cystic fibrosis: a critical review of the literature. Eur J Clin Pharmacol 60, 67-74. 36  Martin, D. W., Schurr, M . J., Yu, H . & Deretic, V. (1994). Analysis of promoters controlled by the putative sigma factor A l g U regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to sigma E and stress response. J Bacteriol 176, 6688-6696. Mathee, K., Ciofu, O., Sternberg, C. & other authors (1999). Mucoid conversion of Pseudomonas aeruginosa by hydrogen peroxide: a mechanism for virulence activation in the cystic fibrosis lung. Microbiology 145 (Pt 6), 1349-1357. Matsui, H., Grubb, B. R., Tarran, R., Randell, S. H., Gatzy, J. T., Davis, C. W. & Boucher, R. C. (1998). Evidence for periciliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airways disease. Cell 95, 1005-1015. Matsushika, A . & Mizuno, T. (1998). A dual-signaling mechanism mediated by the ArcB hybrid sensor kinase containing the histidine-containing phosphotransfer domain in Escherichia coli. J Bacteriol 180, 3973-3977. Mclnnes, C., Kondejewski, L . H., Hodges, R. S. & Sykes, B. D. (2000). Development of the structural basis for antimicrobial and hemolytic activities of peptides based on gramicidin S and design of novel analogs using N M R spectroscopy. J Biol Chem 275, 14287-14294. McPhee, J. B., Lewenza, S. & Hancock, R. E. W. (2003). Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 50, 205-217. McPhee, J. B., Scott, M . G. & Hancock, R. E . W. (2005). Design of host defence peptides for antimicrobial and immunity enhancing activities. Combinatorial Chemistry & High Throughput Screening 8, 257-272. Miyata, T., Tokunaga, F., Yoneya, T., Yoshikawa, K., Iwanaga, S., Niwa, M., Takao, T. & Shimonishi, Y. (1989). Antimicrobial peptides, isolated from horseshoe crab hemocytes, tachyplesin II, and polyphemusins I and II: chemical structures and biological activity. J Biochem (Tokyo) 106, 663-668. Moncrief, M . B. & Maguire, M . E . (1999). Magnesium transport in prokaryotes. J Biol Inorg Chem 4, 523-527. Moore, R. A., Chan, L . & Hancock, R. E . W. (1984). Evidence for two distinct mechanisms of resistance to polymyxin B in Pseudomonas aeruginosa. Antimicrob Agents Chemother 26, 539-545. Morris, C. M., George, A . , Wilson, W. W. & Champlin, F. R. (1995). Effect of polymyxin B nonapeptide on daptomycin permeability and cell surface properties in Pseudomonas aeruginosa, Escherichia coli, and Pasteurella multocida. JAntibiot (Tokyo) 48, 67-72. Morrison, W. D., Miller, R. V. & Sayler, G. S. (1978). Frequency of F l 16-mediated transduction of Pseudomonas aeruginosa in a freshwater environment. Appl Environ Microbiol 36, 724-730. 37  Moskowitz, S. M., Ernst, R. K. & Miller, S. I. (2004). PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and addition of aminoarabinose to lipid A. J Bacteriol 186, 575-579. Mouslim, C. & Groisman, E. A. (2003). Control of the Salmonella ugd gene by three twocomponent regulatory systems. Mol Microbiol 47, 335-344. Nicas, T. I. & Hancock, R. E . W. (1980). Outer membrane protein HI of Pseudomonas aeruginosa: involvement in adaptive and mutational resistance to ethylenediaminetetraacetate, polymyxin B, and gentamicin. J Bacteriol 143, 872-878. Nicas, T. I. & Hancock, R. E . W. (1983). Alteration of susceptibility to E D T A , polymyxin B and gentamicin in Pseudomonas aeruginosa by divalent cation regulation of outer membrane protein H I . J Gen Microbiol 129 (Pt 2), 509-517. Nummila, K., Kilpelainen, I., Zahringer, U., Vaara, M . & Helander, I. M . (1995). Lipopolysaccharides of polymyxin B-resistant mutants of Escherichia coli are extensively substituted by 2-aminoethyl pyrophosphate and contain aminoarabinose in lipid A . Mol Microbiol 16, 271-278. Oliver, A., Canton, R., Campo, P., Baquero, F. & Blazquez, J. (2000). High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 288, 12511254. Oliver, A., Baquero, F. & Blazquez, J. (2002). The mismatch repair system (mutS, mutL and uvrD genes) in Pseudomonas aeruginosa: molecular characterization of naturally occurring mutants. Mol Microbiol 43, 1641-1650. Oppenheim, F. G., Xu, T., McMillian, F. M., Levitz, S. M., Diamond, R. D., Offner, G. D. & Troxler, R. F. (1988). Histatins, a novel family of histidine-rich proteins in human parotid secretion. Isolation, characterization, primary structure, and fungistatic effects on Candida albicans. J Biol Chem 263, 7472-7477. Oren, Z., Lerman, J. C , Gudmundsson, G. H., Agerberth, B. & Shai, Y. (1999). Structure and organization of the human antimicrobial peptide LL-37 in phospholipid membranes: relevance to the molecular basis for its non-cell-selective activity. Biochem J341 (Pt 3), 501513. Martin-Orozco, N. M., Touret, N., Zaharik, M . L., Park, E., Kopelman, R., Miller, S., Finlay, B. B., Gros, P. & Grinstein, S. (2006). Visualization of Vacuolar Acidificationinduced Transcription of Genes of Pathogens inside Macrophages. Mol Biol Cell. 17 (1), 498510 Pai, V. B. & Nahata, M . C. (2001). Efficacy and safety of aerosolized tobramycin in cystic fibrosis. Pediatr Pulmonol 32, 314-327.  38  Park, N. G., Lee, S., Oishi, O., Aoyagi, H., Iwanaga, S., Yamashita, S. & Ohno, M . (1992). Conformation of tachyplesin I from Tachypleus tridentatus when interacting with lipid matrices. Biochemistry 31, 12241-12247. Perego, M . & Hoch, J. A. (1996). Cell-cell communication regulates the effects of protein aspartate phosphatases on the phosphorelay controlling development in Bacillus subtilis. Proc Natl Acad Sci USA 93, 1549-1553. Petrucca, A., Cipriani, P., Valenti, P. & other authors (2003). Molecular characterization of Burkholderia cepacia isolates from cystic fibrosis (CF) patients in an Italian CF center. Res Microbiol 154, 491-498. Poole, K. & Srikumar, R. (2001). Multidrug efflux in Pseudomonas aeruginosa: components, mechanisms and clinical significance. Curr Top Med Chem 1, 59-71. Powers, J. P. S., Rozek, A. & Hancock, R. E . W. (2004). Structure-activity relationships for the beta-hairpin cationic antimicrobial peptide polyphemusin I. Biochim Biophys Acta. Raetz, C. R. & Whitfield, C. (2002). Lipopolysaccharide endotoxins. Annu Rev Biochem 71, 635-700. Raj, P. A., Marcus, E . & Sukumaran, D. K. (1998). Structure of human salivary histatin 5 in aqueous and nonaqueous solutions. Biopolymers 45, 51-67. Rajan, S. & Saiman, L . (2002). Pulmonary infections in patients with cystic fibrosis. Semin Respir Infect 17, 47-56. Ramsey, D. M . & Wozniak, D. J. (2005). Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol Microbiol 56, 309-322. Ratjen, F., Comes, G., Paul, K., Posselt, H. G., Wagner, T. O. & Harms, K. (2001). Effect of continuous antistaphylococcal therapy on the rate of P. aeruginosa acquisition in patients with cystic fibrosis. Pediatr Pulmonol 31, 13-16. Ratjen, F. & Doring, G. (2003). Cystic fibrosis. Lancet 361, 681-689. Rebeil, R., Ernst, R. K., Gowen, B. B., Miller, S. I. & Hinnebusch, B. J. (2004). Variation in lipid A structure in the pathogenic yersiniae. Mol Microbiol 52, 1363-1373. Rifkind, D. & Palmer, J. D. (1966). Neutralization of endotoxin toxicity in chick embryos by antibiotics. J Bacteriol 92, 815-819. Rifkind, D. (1967a).. Studies on the interaction between endotoxin and polymyxin B. J Infect Dis 117,433-438. Rifkind, D. (1967b). Prevention by polymyxin B of endotoxin lethality in mice. J Bacteriol 93, 1463-1464. 39  Riordan, J. R., Rommens, J. M., Kerem, B. & other authors (1989). Identification of the cystic fibrosis gene: cloning and characterization of complementary D N A . Science 245, 10661073. Robinson, M . & Bye, P. T. (2002). Mucociliary clearance in cystic fibrosis. Pediatr Pulmonol 33, 293-306. Rodrigue, A., Quentin, Y., Lazdunski, A., Mejean, V. & Foglino, M . (2000). Twocomponent systems in Pseudomonas aeruginosa: why so many? Trends Microbiol 8, 498-504. Rosenfeld, M., Ramsey, B. W. & Gibson, R. L . (2003). Pseudomonas acquisition in young patients with cystic fibrosis: pathophysiology, diagnosis, and management. Curr Opin Pulm Med 9, 492-497. Roy-Burman, A., Savel, R. H., Racine, S., Swanson, B. L., Revadigar, N. S., Fujimoto, J., Sawa, T., Frank, D. W. & Wiener-Kronish, J. P. (2001). Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J Infect Dis 183, 1767-1774. Rozek, A., Friedrich, C. L . & Hancock, R. E . (2000). Structure of the bovine antimicrobial peptide indolicidin bound to dodecylphosphocholine and sodium dodecyl sulfate micelles. Biochemistry 39, 15765-15774. Sadikot, R. T., Blackwell, T. S., Christman, J. W. & Prince, A. S. (2005). Pathogen-host interactions in Pseudomonas aeruginosa pneumonia. Am JRespir Crit Care Med 171, 12091223. Sato, H., Frank, D. W., Hillard, C. J. & other authors (2003). The mechanism of action of the Pseudomonas aeruginosa-encoded type III cytotoxin, ExoU. Embo J22, 2959-2969. Sato, H . & Frank, D. W. (2004). ExoU is a potent intracellular phospholipase. Mol Microbiol 53, 1279-1290. Saye, D. J., Ogunseitan, O., Sayler, G. S. & Miller, R. V. (1987). Potential for transduction of plasmids in a natural freshwater environment: effect of plasmid donor concentration and a natural microbial community on transduction in Pseudomonas aeruginosa. Appl Environ Microbiol 53, 987-995. Schibli, D. J., Hwang, P. M . & Vogel, H. J. (1999). Structure of the antimicrobial peptide tritrpticin bound to micelles: a distinct membrane-bound peptide fold. Biochemistry 38, 1674916755. Schibli, D. J., Hunter, H . N., Aseyev, V., Starner, T. D., Wiencek, J. M., McCray, P. B., Jr., Tack, B. F. & Vogel, H. J. (2002). The solution structures of the human beta-defensins lead to a better understanding of the potent bactericidal activity of HBD3 against Staphylococcus aureus. J Biol Chem 277, 8279-8289.  40  Scott, M . G., Davidson, D. J., Gold, M . R., Bowdish, D. & Hancock, R. E . W. (2002). The human antimicrobial peptide LL-37 is a multifunctional modulator of innate immune responses. J Immunol 169, 3883-3891. Shi, Y., Cromie, M . J., Hsu, F. F., Turk, J. & Groisman, E . A. (2004). PhoP-regulated Salmonella resistance to the antimicrobial peptides magainin 2 and polymyxin B. Mol Microbiol 53,229-241. Shorr, A. F., Sherner, J. H., Jackson, W. L. & Kollef, M . H . (2005). Invasive approaches to the diagnosis of ventilator-associated pneumonia: a meta-analysis. Crit Care Med 33, 46-53. Simpson, J. A., Smith, S. E . & Dean, R. T. (1989). Scavenging by alginate of free radicals released by macrophages. Free Radic Biol Med 6, 347-353. Smith, A. L., Doershuk, C , Goldmann, D. & other authors (1999). Comparison of a betalactam alone versus beta-lactam and an aminoglycoside for pulmonary exacerbation in cystic fibrosis. JPediatr 134, 413-421. Smith, R. S., Harris, S. G., Phipps, R. & Iglewski, B. (2002a). The Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxododecanoyl)homoserine lactone contributes to virulence and induces inflammation in vivo. JBacteriol 184, 1132-1139. Smith, R. S., Kelly, R., Iglewski, B. H. & Phipps, R. P. (2002b). The Pseudomonas autoinducer N-(3-oxododecanoyl) homoserine lactone induces cyclooxygenase-2 and prostaglandin E2 production in human lung fibroblasts: implications for inflammation. J Immunol 169, 2636-2642. Solis, A., Brown, D., Hughes, J., Van Saene, H . K. & Heaf, D. P. (2003). Methicillin-resistant Staphylococcus aureus in children with cystic fibrosis: A n eradication protocol. Pediatr Pulmonol 36, 189-195. Speert, D. P. (2002). Advances in Burkholderia cepacia complex. Paediatr Respir Rev 3, 230• 235. Staab, D. (2004). Cystic fibrosis ~ therapeutic challenge in cystic fibrosis children. Eur J Endocrinol 151 Suppl 1, S77-80. Starner, T. D., Agerberth, B., Gudmundsson, G. H . & McCray, P. B., Jr. (2005). Expression and activity of beta-defensins and LL-37 in the developing human lung. J Immunol 174, 1608-1615. Stephenson, K. & Hoch, J. A. (2002). Evolution of signalling in the sporulation phosphorelay. Mol Microbiol 46,297-304. Stock, A. M., Robinson, V. L . & Goudreau, P. N. (2000). Two-component signal transduction. Annu Rev Biochem 69, 183-215. Stover, C. K., Pham, X. Q., Erwin, A. L . & other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406, 959-964. 41  Stumpe, S., Schmid, R., Stephens, D. L., Georgiou, G. & Bakker, E. P. (1998). Identification of OmpT as the protease that hydrolyzes the antimicrobial peptide protamine before it enters growing cells of Escherichia coli. J Bacteriol 180, 4002-4006. Suter, S., Schaad, U. B., Roux, L., Nydegger, U. E . & Waldvogel, F. A . (1984). Granulocyte neutral proteases and Pseudomonas elastase as possible causes of airway damage in patients with cystic fibrosis. J Infect Dis 149, 523-531. Syvitski, R. T., Burton, I., Mattatall, N. R., Douglas, S. E . & Jakeman, D. L . (2005). Structural characterization of the antimicrobial peptide pleurocidin from winter flounder. Biochemistry 44, 7282-7293. Tam, J. P., Lu, Y. A . & Yang, J. L. (2002). Correlations of cationic charges with salt sensitivity and microbial specificity of cystine-stabilized beta -strand antimicrobial peptides. J Biol Chem 277, 50450-50456. Tamber, S. & Hancock, R. E . (2003). On the mechanism of solute uptake in Pseudomonas. Front Biosci 8,s472-483. Tamber, S. & Hancock, R. E. W. (2005). The role of the novel OprD family of porins in nutrient uptake in Pseudomonas aeruginosa. J Bacteriol in press. Tao, T., Snavely, M . D., Farr, S. G. & Maguire, M . E . (1995). Magnesium transport in Salmonella typhimurium: mgtA encodes a P-type ATPase and is regulated by M g in a manner similar to that of the mgtB P-type ATPase. J Bacteriol 177, 2654-2662. 2 +  Tossi, A . (2003).Antimicrobial Sequences Database (AMSDbase). Townsend, D. E., Esenwine, A . J., George, J., 3rd, Bross, D., Maguire, M . E . & Smith, R. L. (1995). Cloning of the mgtE M g transporter from Providencia stuartii and the distribution of mgtE in gram-negative and Gram-positive bacteria. J Bacteriol 177, 5350-5354. 2 +  Tsai, H. & Bobek, L. A . (1998). Human salivary histatins: promising anti-fungal therapeutic agents. Crit Rev Oral Biol Med 9, 480-497. Tsuzuki, M . , Ishige, K. & Mizuno, T. (1995). Phosphotransfer circuitry of the putative multisignal transducer, ArcB, of Escherichia coli: in vitro studies with mutants. Mol Microbiol 18, 953-962. Ulvatne, H., Haukland, H. H., Samuelsen, O., Kramer, M . & Vorland, L . H . (2002). Proteases in Escherichia coli and Staphylococcus aureus confer reduced susceptibility to lactoferricin B. J Antimicrob Chemother 50, 461-467. Vaara, M . & Vaara, T. (1981). Outer membrane permeability barrier disruption by polymyxin in polymyxin-susceptible and -resistant Salmonella typhimurium. Antimicrob Agents Chemother 19, 578-583.  42  Vaara, M . (1992). Agents that increase the permeability of the outer membrane. Microbiol Rev 56,395-411. Vaara, M . (1993). Outer membrane permeability barrier to azithromycin, clarithromycin, and roxithromycin in gram-negative enteric bacteria. Antimicrob Agents Chemother 37, 354-356. Vallet, I., Olson, J. W., Lory, S., Lazdunski, A. & Filloux, A. (2001). The chaperone/usher pathways oi Pseudomonas aeruginosa: identification of fimbrial gene clusters (cup) and their involvement in biofilm formation. Proc Natl Acad Sci USA9S, 6911-6916. Vescovi, E . G., Ayala, Y. M., Di Cera, E . & Groisman, E . A. (1997). Characterization of the bacterial sensor protein PhoQ. Evidence for distinct binding sites for M g and C a . J Biol Chem 272, 1440-1443. 2 +  2+  Whiteford, M . L., Wilkinson, J. D., McColl, J. H., Conlon, F. M., Michie, J. R., Evans, T. J. & Paton, J. Y. (1995). Outcome of Burkholderia (Pseudomonas) cepacia colonisation in children with cystic fibrosis following a hospital outbreak. Thorax 50, 1194-1198. Wieprecht, T., Dathe, M., Schumann, M., Krause, E., Beyermann, M . & Bienert, M . (1996). Conformational and functional study of magainin 2 in model membrane environments using the new approach of systematic double-D-amino acid replacement. Biochemistry 35, 10844-10853. Wieprecht, T., Dathe, M., Krause, E., Beyermann, M., Maloy, W. L., MacDonald, D. L . & Bienert, M . (1997). Modulation of membrane activity of amphipathic, antibacterial peptides by slight modifications of the hydrophobic moment. FEBS Lett 417, 135-140. Wiesemann, H . G., Steinkamp, G., Ratjen, F., Bauernfeind, A., Przyklenk, B., Doring, G. & von der Hardt, H. (1998). Placebo-controlled, double-blind, randomized study of aerosolized tobramycin for early treatment of Pseudomonas aeruginosa colonization in cystic fibrosis. Pediatr Pulmonol 25, 88-92. Winfield, M . D., Latifi, T. & Groisman, E . A. (2005). Transcriptional regulation of the 4amino-4-deoxy-L-arabinose biosynthetic genes in Yersinia pestis. J Biol Chem 280, 1476514772. Wolanin, P. M., Thomason, P. A. & Stock, J. B. (2002). Histidine protein kinases: key signal transducers outside the animal kingdom. Genome Biol 3. Wu, Z., Hoover, D. M., Yang, D., Boulegue, C , Santamaria, F., Oppenheim, J. J., Lubkowski, J. & Lu, W. (2003). Engineering disulfide bridges to dissect antimicrobial and chemotactic activities of human beta-defensin 3. Proc Natl Acad Sci USA 100, 8880-8885. Xu, T., Telser, E., Troxler, R. F. & Oppenheim, F. G. (1990). Primary structure and anticandidal activity of the major histatin from parotid secretion of the subhuman primate, Macaca fascicularis. J Dent Res 69, 1717-1723. Yan, H . & Hancock, R. E . (2001). Synergistic interactions between mammalian antimicrobial defense peptides. Antimicrob Agents Chemother 45, 1558-1560. 43  Yang, D., Chertov, O. & Oppenheim, J. J. (2001). Participation of mammalian defensins and cathelicidins in anti-microbial immunity: receptors and activities of human defensins and cathelicidin (LL-37). JLeukoc Biol 69, 691-697. Yeaman, M . R. & Yount, N. Y. (2003). Mechanisms of antimicrobial peptide action and resistance. Pharmacol Rev 55, 27-55. Zhang, L . & Falla, T. J. (2004). Cationic antimicrobial peptides - an update. Expert Opin Investig Drugs 13, 97-106. Zhang, L., Parente, J., Harris, S. M., Woods, D. E., Hancock, R. E . & Falla, T. J. (2005). Antimicrobial peptide therapeutics for cystic fibrosis. Antimicrob Agents Chemother 49, 29212927. Zhou, Z., Ribeiro, A. A., Lin, S., Cotter, R. J., Miller, S. I. & Raetz, C. R. (2001). Lipid A modifications in polymyxin-resistant Salmonella typhimurium: PmrA-dependent 4-amino-4deoxy-L-arabinose, and phosphoethanolamine incorporation. J Biol Chem 276, 43111-43121.  44  C H A P T E R 2 - P m r A - P m r B of Pseudomonas aeruginosa* INTRODUCTION Infections with Pseudomonas aeruginosa are particularly difficult to cure through antimicrobial therapy due to the bacterium's intrinsically impermeable outer membrane and active efflux of toxic agents from the cytoplasm (Nikaido 1996). Virtually no novel antibiotics are available for this organism although cationic antimicrobial peptides hold the promise of improving the success of anti-Pseudomonas therapy (Hancock 1997; Zhang, Parente et al. 2005). Cationic antimicrobial peptides are a structurally diverse group of molecules that are found in virtually all eukaryotes examined to date (Hancock, Falla et al. 1995; Hancock and Chappie 1999). In addition to their proven role in killing a wide variety of potential pathogens including Gram-positive and Gram-negative bacteria, fungi, and viruses, they are also multifunctional modulators of innate immunity (Scott and Hancock 2000). They are known to interact with the outer membrane via the self-promoted uptake pathway permitting activity against Gram-negative bacteria (Hancock, Falla et al. 1995; Hancock and Chappie 1999). As a widespread environmental isolate, P. aeruginosa has evolved mechanisms for responding to many different stimuli. This diversity of responsiveness is reflected in the genome sequence, in which 9.4% of ORFs encode regulatory proteins (Stover, Pham et al. 2000). This compares to ~6% for E.coli or B. subtilis (Stover, Pham et al. 2000) and -12% for S. coelicolor (Bentley, Chater et al. 2002). One major class of regulatory systems found in P. aeruginosa is  * A version of this chapter has been published as: McPhee, JB, Lewenza, S, and R E W Hancock, Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa, Molecular Microbiology, 2003 Oct;50(l):205-17  45  the two-component regulatory system family. These systems generally involve a cytoplasmic membrane-spanning histidine kinase sensor protein and a cytoplasmic response regulator. Generally, upon engagement of a periplasmic binding site on the sensor kinase by an effector molecule, this protein autophosphorylates at a histidine residue on the cytoplasmic domain and transfers this phosphate to an aspartate residue of the response regulator leading to increased transcription of multiple genes, and/or repression of others (Rodrigue, Quentin et al. 2000; Stock, Robinson et al. 2000; West and Stock 2001). The Pseudomonas genome contains 64 response regulators and 63 histidine kinases as well as sixteen atypical kinases (Rodrigue, Quentin et al. 2000). The function of most of these regulatory proteins is undetermined. In Salmonella, the PhoP-PhoQ two-component regulatory system is a global regulatory system that responds to limiting concentrations of M g  2 +  and other divalent cations to activate  virulence, as well as polymyxin B and cationic antimicrobial peptide resistance, by affecting the transcription of more than 40 genes (Soncini, Garcia Vescovi et al. 1996; Gunn, Belden et al. 1998; Heithoff, Conner et al. 1999; Monsieurs, De Keersmaecker et al. 2005). In P. aeruginosa, the PhoP-PhoQ system has been shown to control resistance to aminoglycosides, polymyxin B , and cationic antimicrobial peptides (Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000). Insertional inactivation of PhoQ, but not PhoP, also decreases the virulence of P. aeruginosa in a burned mouse model by 100-fold relative to a wild-type parent strain (Brinkman, Macfarlane et al. 2001). LPS isolated from the sputum isolates of patients with cystic fibrosis chronically infected with P. aeruginosa showed modifications that reflect those observed in Salmonella when grown in M g In  Salmonella,  limiting conditions (Ernst, Y i et al. 1999).  PhoP-PhoQ-mediated resistance  to  polymyxin  B and cationic  antimicrobial peptides largely occurs through changes in the structure of Lipid A , including the addition of N -aminoarabinose, ethanolamine, and palmitic acid (Zhou, Ribeiro et al. 2001). 4  The addition of aminoarabinose to the Lipid A-phosphates of LPS is catalyzed by the seven46  gene operon, pmrHFIJKLM  (Trent, Ribeiro et al. 2001; Trent, Ribeiro et al. 2001) which is  controlled indirectly by PhoP-PhoQ via another two-component regulatory system, PmrA-PmrB (Soncini, Garcia Vescovi et al. 1996; Kox, Wosten et al. 2000; Wosten, Kox et al. 2000). In addition to this regulatory hierarchy between the two response regulators, Salmonella PmrB can be independently activated by high (100 u.M) concentrations of F e by influencing F e  3+  3+  or by reduced pH (possibly  solubility) (Soncini, Garcia Vescovi et al. 1996; Wosten, Kox et al. 2000).  Homologues of the pmrHFIJKLM  LPS modification system (PA3552-PA3558) are present in  the genome of P. aeruginosa. In Pseudomonas, the operon contains an eighth gene (PA3559) that is homologous to the ugd gene (UDP-glucose dehydrogenase) that in Salmonella is required for LPS modification and is regulated by the PhoP-PhoQ, PmrA-PmrB, and the YojN-RcsARcsB systems (Mouslim and Groisman 2003). P. aeruginosa possesses several closely related homologues of the response regulator PmrA, and the signal sensor kinase, PmrB. However, the most closely related Pseudomonas homologues of the PmrB sensor kinase share similarity only in the C-terminal kinase domain and, until this study was undertaken, the identity of PmrA and PmrB in P. aeruginosa had not been determined. In this chapter, the identification of the PmrA-PmrB encoding operon of P. aeruginosa is described. Additionally, this work describes a target operon of the PmrA-PmrB system that is homologous to the pmrHFIJKLM  and ugd operons of S. Typhimurium.  Mutation of pmrH  results in hypersusceptibility to cationic antimicrobial peptides and polymyxin B. The work also demonstrates that certain cationic antimicrobial peptides and the polymyxins are capable of inducing the pmrA-pmrB genes, and the pmrHFIJKLM-ugd  operon, increasing the resistance of  Pseudomonas to these agents. This argues that the development of cationic peptide derivatives that do not induce these genes will represent an important improvement in therapeutic treatment of Pseudomonas infections of cystic fibrosis patients. We also show that M g 47  2 +  regulates the LPS  modification operon via a mechanism that is dependent upon both PmrA-PmrB and PhoP-PhoQ systems. These and other observations, demonstrate that the PmrA-PmrB and PhoP-PhoQ systems, while sharing several features, operate differently in Pseudomonas and Salmonella. EXPERIMENTAL PROCEDURES Bacterial strains, primers, and growth conditions. The bacterial strains and plasmids used in this study are described in Table 2.1. Cultures were routinely grown in Luria-Bertani broth or BM2-glucose minimal medium containing low (20 uM) or high (2 mM) M g S 0 4 concentrations. Antibiotics for selection were used at the following concentrations: tetracycline, 100 ug/ml for P. aeruginosa and 10 ug/ml for E. coli; ampicillin 100 ug/ml for E. coli; carbenicillin, 300-500 ug/ml for P. aeruginosa; gentamicin 50 ^g/ml for P. aeruginosa and 15 ug/ml for E. coli. Routine genetic manipulations were carried out according to Maniatis et al. (Maniatis, Fritsch et al. 1989). DNA manipulations. A bank of luxCDABE fusion strains were made by mobilizing pUT mini-Tn5 luxCDABE (Winson, Swift et al. 1998) into HI03 and selecting for resistance to 100 ug/ml tetracycline. Resulting mutants were screened for differential expression of the fusion in response to high (2mM) or low (20 uM) MgS04 concentration. Briefly, a 48-pin replicator stamp was used to subculture overnight L B cultures into the left and right half of 96-well plates containing low Mg  and high M g  conditions, respectively. After growth for 4-6 h, the luminescence was  observed using a ChemiGenius Bio-Imaging System (Syngene). In total, 10,000 mutants were 2  screened for differential expression. Interrupted genes were identified by arbitrarily-primed PCR using primers Tn51uxout (5' G T C A T T C A A T A T T G G C A G G T A A A C A C T A T T A T C A C C ) and ARB1 (5' G G C C A - C G C G T C G A C T A G T A C N N N N N G A T A T ) , and the following cycling conditions: 95°C for 5 min followed by 5 cycles of 95°C for 30 s, 45°C for 30 s, and 72°C for 48  1.5 min Thirty cycles were then performed with cycling at 95°C for 30 s, 60°C for 30 s, and 72°C for 2 min followed by an extension step at 72°C for 5 min. The products from this P C R reaction were then used as the template in another P C R reaction using primers A R B 2 ( G G C C A C G C G T C G A C T A G T A C ) and Tn51uxout. The cycling conditions for this second reaction were 95°C for 5 min followed by 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1.5 min followed by an extension step at 72°C for 5 min. A l l P C R reactions used 150 LIM each dNTP, 5% D M S O , I X polymerase buffer and 0.5 u M each primer with 1.25U of Vent polymerase (NEB, Mississauga, Canada). These amplicons were then sequenced using BigDye sequencing chemistry (PE Biosystems, Foster City, C A ) on a BaseStation51 D N A fragment analyzer (MJ Research, Reno, N V ) . Strain H974 was identified as having an insertion in the intergenic region between PA4773 and PA4774 and is described hereafter as a PA4773::/wx mutant. For construction of a pmrB interposon mutant, a fragment containing the pmrA and pmrB genes was PCR amplified using primers designed from the genome sequence. These amplicons were then cloned into pCR2.1-TOPO using the TOPO-TA cloning kit (Invitrogen, Carlsbad C A ) according to the manufacturer's instructions. A n EcoRI fragment containing the pmrA-pmrB genes was then ligated into EcoRl digested pEX18Tc (Hoang, Karkhoff-Schweizer et al. 1998) creating pEXpmrAB. A BamHI fragment from pX1918GT containing a xy/£-Gm cassette was R  cloned into the unique Bglll site in the pmrB gene of pEXpmrAB creating pEXpmrB-xylE. The inserted cassette was shown to be in the forward orientation by restriction analysis. For construction of strain H973, a pmrB merodiploid, pEXpmrB-xylE was mobilized into the chromosome without selection on 5% sucrose to maintain the plasmid vector sequence. To produce the pmrA interposon mutant, pmrA was P C R amplified and cloned into pEXlOOT (Schweizer and Hoang 1995) producing pEXpmrA. A xylE-Gm  R  cassette from plasmid  pX1918GT was removed with Pstl and ligated into Pstl digested pEXpmrA. 49  Table 2.1. P. aeruginosa strains, plasmids, and peptides used in this study. Strain H103 H851  Genotype, Characteristics, or Sequence wild-type P. aeruginosa PAO 1 phoP::xylE-Gm derivative of HI 03  H854  phoQ::xylE-Gm  H970 H973  pmrB:: xylE-Gm derivative of HI 03 pmrB ; pmrB::xylE-Gm merodiploid derivative of HI 03 PA4773::luxCDABE derivative of H103; T c ?A4773::luxCDABE; phoQ::xylE-Gm derivative of HI 03 ?A4773::luxCDABE; pmrB::xylE-Gm derivative of HI 03 PA4773: :luxCDABE; phoP::xylE-Gm derivative of HI 03 PA4773::luxCDABE;pmrA::xylE-Gm derivative of HI 03 pmrA::xylE-Gm derivative of HI 03 pmrH::xylE-Gm derivative of HI03  H974 H975 H976 H980 H981 H988 H993 Plasmids pCR2.1-TOPO pCS26  Reference (Macfarlane, Kwasnicka et al. 1999) (Macfarlane, Kwasnicka et al. 1999) This study This study  R  derivative of H103  R  R  +  R  R  R  This study This study  R  This study  R  This study  R  R  R  PCR cloning vector, A p source of a 6 kb NotI luxCDABE cassette  This study This study This study  pEXlOOT  suicide vector containing sacB gene,Ap  R  pEX18Tc  suicide vector containing sacB gene, T c  R  pX1918GT  source of xylE-Gm  pVCphoP  formerly pEMR3, phoP cloned into pUCP19  pEXpmrA  pEXlOOT containing pmrA gene  Invitrogen (Bjarnason, Southward et al. 2003) (Schweizer and Hoang 1995) (Hoang, KarkhoffSchweizer et al. 1998) (Schweizer and Hoang 1995) (Macfarlane, Kwasnicka et al. 1999) This study  pEXpmrAB pUCpmrA  pEXlOOT containing pmrA-pmrB genes pmrA cloned into pUCP23  This study This study  pEXpmrA: :xylE  suicide vector containing pmrA: :xylE-Gm fusion suicide vector containing pmrB: :xylE-Gm fusion  pEXpmrB: :xylE  K  R  cassette; G m , A p R  50  R  R  This study  R  This study  pEXQ-xy/£Fl  suicide vector containing phoQ::xylE-Gm fusion  pUT mini-Tn5 luxCDABE pUCpmrH:: luxCDABE  mini-Tn.5-luxCDABE containing plasmid pUCP23 containing the entire intergenic region between PA3551 (algA) and PA3552 (pmrH) fused to luxCDABE  Peptides CP10A  ILAWKWAWWAWRR-NH2  CEMA  KWKLFKKIGIGAVLKVLTTGLPALKLTK*  CP208  KKKSFIKLLTS A K V S VLTTAKPLIS S*  indolicidin  ILPWKWPWWPWRR-NH2*  CP11CN  ILKKWPWWPWRRK-NH2*  cycCPll  IC1LKK WP WWP WRRC1K  LL-37  LLGDFFRKSKEKIFKEFKRIVQRIKDFLRNL VPRTES*  polyphemusin  RRWC1FRVC2YRGFC2YRKC1R*  linear  RRWAFRVAYRGFAYRKAR*  polyphemusin polymyxin B  fa-B T B(B B FL B B T )  PMBN  B T B(B B FL B B T )  colistin  fa-B T B(B B LL B B T )  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  L  t  r  L  t  (Macfarlane, Kwasnicka et al. 1999) (Winson, Swift etal. 1998) This study  (Friedrich, Rozek et al. 2001) (Macfarlane, Kwasnicka et al. 2000) (Friedrich, Scott et al. 1999) (Selsted, Novotny et al. 1992) (Friedrich, Moyles et al. 2000) (Rozek, Powers et al. 2003) (Gudmundsson, Agerberth et al. 1996) (Zhang, Scott et al. 2000) (Zhang, Scott et al. 2000) (Windholz, Budavari et al. 1976) (Windholz, Budavari et al. 1976) (Windholz, Budavari et al. 1976)  sequence in the one letter amino acid code; - N H 2 indicates amidation of the carboxyl terminus; numbered cysteines represent residues joined by disulphide bonds. * sequence in the one letter amino acid code; B indicates a, y diamino butyrate; a superscripted L indicates that amino acid is the L-enantiomer; fa indicates a 6-methyloctanoyl or 6methylheptanoyl fatty acid chain 51  A similar approach was used to construct apmrH::xylE-Gm  allele. PA3552 encodes a  homolog (61% identity, 78% similarity) of the S. Typhimurium pmrH gene. Gene-replacement constructs were mobilized into P. aeruginosa HI03 using biparental mating and resolved by successive selection on 50 ug/ml gentamicin and 5% sucrose. The allelic exchanges were confirmed by PCR. The PCR amplified pmrA gene was cloned into pUCP23, producing pUQwjTvl.  Plasmid pUCP/wx was created by first replacing the M C S of pUCP23 (West, Schweizer et al. 1994) with a new linker (EcoRl-Bamm-Smal-XhoI-Notl-HindllY). The luxCDABE genes from plasmid pCS26 (Bjarnason, Southward et al. 2003) were cloned as a Notl fragment into the new M C S . The orientation of the luxCDABE cassette was confirmed by restriction digestion. To determine how the eight-gene operon encoding the LPS aminoarabinose modification system (pmrHFIJKLM-ugd) of Pseudomonas is regulated, a plasmid-encoded promoter fusion to the entire intergenic region between PA3551 (algA) and PA3552 (pmrH) was created by P C R amplifying the promoter for pmrH and cloning it in front of the luxCDABE cassette, to produce pUCpmrH:: luxCDABE. Gene reporter assays.  X y l E assays were performed as described previously (Macfarlane, Kwasnicka et al. 1999). Briefly, a 25 ml P. aeruginosa culture was grown in 125 ml Erlenmeyer flasks to an OD600 of 0.3-0.6. The cells were pelleted by centrifugation, resuspended in 750 ul of 50 m M potassium phosphate buffer pH 7.5 containing 10% v/v acetone, and broken by sonication. Unbroken cells and debris were removed by centrifugation. The protein content of the crude extracts was determined by the modified Lowry assay. Aliquots of the cell extracts were then added to 1 ml of 50 m M potassium phosphate buffer, pH 7.5 containing 0.3 m M catechol. The absorbance change of the solution was monitored at 375 nm and the rate of change over 5 minutes was used  52  to determine the enzyme activity in the sample using an  E375  for 2-hydroxymuconic  semialdehyde of 44,000. Induction of the  luxCDABE  fusion in liquid  media was measured  using a  SPECTRAFluorPlus luminometer (Tecan, San Jose, C A ) . Luminescence was corrected for growth by simultaneously monitoring the absorbance at 620 nm. Results presented show the average and standard deviation of 6-8 replicate measurements.  Image analysis of colonies  grown on agar plates was performed with a Luminograph LB980 photon-imaging video system (EG&G Berthold, Bundoora, Australia). Killing curves. P. aeruginosa cultures were grown to  OD600  of 0.3-0.6 in BM2-glucose minimal media  containing 20 u M M g . These cultures were then diluted 1:100 into pre-warmed sodium 2 +  phosphate buffer, pH 7.5 containing 2  Lig/ml  polymyxin B sulphate (Sigma). Samples were  shaken at 37°C and aliquots were withdrawn at specified times, and then assayed for survivors by plating onto L B agar. Minimal inhibitory concentrations (MICs). MICs were assessed using standard broth microdilution procedures in B M 2 glucose minimal medium containing 20 u M or 2 m M M g  2 +  (Macfarlane, Kwasnicka et al. 1999). Growth was  scored following 24 hr incubation at 37°C. For measuring MICs against cationic antimicrobial peptides, a modified assay was used to prevent artificially high MICs due to aggregation of peptides and binding to polystyrene (Zhang, Scott et al. 2000). Outer membrane permeability assays. P. aeruginosa was grown to mid-logarithmic phase in BM2-glucose minimal media supplemented with 20 u M MgS04. OD600  The cells were then harvested, washed, resuspended to  ~ 0.5 in buffer containing 5 m M HEPES (pH 7.0), 5 m M glucose, and 5 m M K C N and  53  incubated at 20°C for 10 minutes. Bacterial suspensions were placed in a quartz cuvette with a magnetic stir bar. 1-N-phenyl napthylamine (NPN) was added to the cuvette at a concentration of 5 u M and the baseline fluorescence was measured at an excitation wavelength of 350 nm and an emission wavelength of 420 nm.  The assay was initiated by the addition of various  concentrations of polymyxin B . Fluorescence was measured until a stable signal was observed, indicating that additional N P N entry into the membrane had stopped.  RESULTS Identification of  pmrA-pmrB.  To permit screening for M g  2 +  responsive promoters, a library of mini-Tn5 luxCDABE mutants  was constructed. Strain H974 contained a transposon insertion between ORFs PA4773 and PA4774 and luminescence was strongly activated under Mg -limitation (Fig. 2.1 A , Table 2.2). 2+  A. luxCDABE  PA4773  pmrA  Tc  R  PA4774  pmrB  PA4775  sacB  pmrA  tetA  pmrB  pmrA  pmrB  PA4778  PA4778  Figure 2.1. A) Structure of the pmrA-pmrB containing operon. The site of transposon insertion in strain H974 is shown. PI and P2 represent hypothetical, unmapped, PmrA-regulated and weakly constitutive promoters, respectively, positioned approximately based on the data presented in the text. B) Structure of the merodiploid fusion in strain H973. Plasmid encoded sequences are boxed or the site of insertion of the xylE-Gm cassette is indicated. R  54  These open reading frames are situated in an operon upstream of a two-component regulatory system PA4776 (response regulator) and PA4777 (sensor kinase), and a MerR-type regulator, PA4778. The sensor kinase and response regulator pair exhibited significant similarity at the amino acid level to the PmrA-PmrB system of Salmonella (PmrA: 45% identical, 60% similarity; PmrB: 27% identical, 48% similarity), although the periplasmic sensing domain of the sensor protein shared very little homology with that of PmrB from Salmonella. Regulation of pmrA-pmrB by M g . 2 +  As shown in Table 2.2 and Fig. 2.2, the PA4773::/«x fusion in strain H974 was strongly induced by low (20 LIM) M g  2 +  and repressed by high (2 mM) M g . To determine i f the Mg -regulation 2 +  2+  observed for this fusion was controlled by the PhoP-PhoQ system or other M g  2 +  responsive  elements, a series of double mutants were created. Since PhoQ-null mutants are known to express PhoP-activated genes under normally repressing conditions (Macfarlane, Kwasnicka et al. 1999), phoQ mutants were constructed in strain H974, producing strain H975 (phoQ::xylEG m ; PA4773::/wx). This strain exhibited increased activation of the luxCDABE cassette under R  high M g  2 +  conditions, suggesting that the luxCDABE fusion in this strain was controlled in part  by phoQ (Table 2.2, Fig. 2.2), although some level of M g  2 +  regulation was still observed. A  phoP mutant was also created in the H974 background. This strain (H980) showed wild-type response to M g indicating that the effect of phoQ deletion was not mediated via PhoP (Fig. 2.2). A n interposon mutant, H970, was created in the putative pmrB sensor kinase gene by cloning the pmrA-pmrB genes and interrupting the pmrB gene with a cassette containing the reporter gene xylE prior to recombining the pmrB::xylE-Gm  R  gene back into P. aeruginosa. The  presence of the xylE cassette allowed examination of the response of pmrB transcription to changing environmental conditions. Initial examination of this response showed very little  55  activity  regardless  of  Mg  2 +  concentration,  with  only  6.4  ±  0.4 pmols-ug^min"  ?MlTx.:luxCDABE  chromosome-encoded Q O  I  O  c O <D  wt  phoP phoQ pmrA pmrB  wt  phoP phoQ pmrA pmrB  wt  2 mM Mg2+  20 u M M g 2+  phoP phoQ pmrA  pmrB  2 mM Mg + 4 ug/ml CP11CN  :  :  2+  Figure 2.2. Regulation of P A 4 7 7 3 in phoP, phoQ, pmrA, and pmrB mutant strains. Induction of PA4773::/wx fusion in BM2-glucose minimal media supplemented with 20 u M M g , 2 m M M g , and 2 m M M g with 4 ug/ml CP 1 I C N in H974 (PA4773.\7ux), H980 (PA4773.\7wx; p/ioP), H975 (PA4773;.7«x; phoQ), H981 (PA4773::te; ^ ) and H976 (PA4773:.7ux; 2 +  2 +  2 +  Table 2.2. Effect of overexpression of /J/WP or pmrA on P A 4 7 7 3 expression. Luminescence of the PA4773::luxCDABE fusion in strains H974 (PA4773::/icc), H975 (PA4773::lux, phoQ), and H976 (PA4773:7wx, pmrB) fusion under high and low M g conditions were measured. Measurements are expressed in thousands of RLU/OD6202 +  2 mM Mg (high)  2 +  Plasmid  H974  H975  Fold-change  none  16.6±3.1  78.8±7.3  4.7  3  H976  Fold-change"  2.0±0.8  0.12  pUCphoP 8.8±3.6 52.8±4.2 6 0.14 1.3±0.5 pUCpmrA 20.2±1.7 ND ND 1.8±0.8 0.09 none 876±23 829±14 0.94 91.8±1.3 2 uM Mg 0.10 (low) pUCphoP 951±38 650±18 0.68 40±l.l 0.04 pUCpmrA 2630±30 ND ND 16.7±0.6 0.006 indicates the fold-change of H975 compared to H974 indicates the fold-change of H976 compared to H974 The modest 2.5 to 5.5 fold decrease in R L U in the/?mr,4-overexpressing strain H976 compared to- the same strain with no plasmid or the phoP-overexpressing strain H976 may be due to the overexpression of PmrA in the absence of phosphorylation by PmrB, causing this PmrA to act as a repressor. C  2 +  c  C  a  b  c  56  of 2- hydroxymuconic semialdehyde produced under high M g pmols-Lig'Wn" produced under low M g 1  2 +  conditions and 21.7 ± 5.0  conditions. We reasoned that this could be due to a  strict requirement for the PmrA and PmrB proteins to activate the operon. To determine whether or not this was the case strain H973 was created (Fig. 2.IB), a co-integrate merodiploid mutant that contained both a wild-type pmrB gene in addition to a pmrBr.xylE fusion. Strain H973 (merodiploid strain) produced 29.6 ± 1 . 3 pmols-Lig" min" 2-hydroxymuconic semialdehyde 1  1  when grown in high M g , increasing 39-fold to 1150 ± 30 pmols-Ltg^min" when grown in low 2 +  1  2"+-  Mg  . This demonstrates that a functional copy of pmrB was required for maximal expression of  pmrB.  .  •  To further confirm the strict requirement for pmrB, strain H976 was constructed, in which pmrB was interrupted by the xylE::Gm cassette in a H974 (PA4773::/wx) background. R  Strain H976 exhibited 10-16 fold lower expression of the luxCDABE reporter (Table 2.2 and Fig. 2.2) compared to H974. However both H974 and H976 were inducible in low M g  2 +  concentrations, which may be due to PhoQ mediated regulation of PmrA phosphorylation as discussed below. Strain H981, a pmrA mutant also showed abrogation of the induction of the PA4773:/wx fusion under low M g  2 +  conditions (Fig 2.2).  When pmrA was supplied on a plasmid (pUCpmrA) to strain H974 (PA4773::/wx), luminescence was increased three-fold in low M g  2 +  media (Table 2.2). When pUCpmrA was  added to strain H976, which lacked a functional copy of pmrB, very little expression was observed from the PA4773::/wx fusion, even in low M g  2 +  media. These results were consistent  with the hypothesis that PmrB was required to activate PmrA, leading to increased expression of the PA4773::/z/x fusion. Addition of pUCphoP did not have any effect on expression of the PA4773::/ux fusion (Table 2.2).  57  Table 2.3. Minimal inhibitory concentrations (jig/ml) of peptides and aminoglycosides toward P. aeruginosa grown in low M g medium. MICs were determined by two-fold serial dilution in BM2-glucose minimal media with 20 u M M g added. Results shown are the mode of 4-8 independent experiments. 2+  2 +  MIC (ug/ml) H970 H988 (pmrB::xylE) (pmrA: :xylE) 2 2 16 16 32 32 16 16 8 16 0.5 0.5  HI 03 (wt) 32 32 >32 16 16 1  H974 (PA4773: :lux) 2 4 4 2 8 0.5  >32 2 >32 8  >32 1 >32 0.25  >32 0.5 >32 1  >32 1 >32 0.25  ND 2 ND <0.03  >32  >32  >32  >32  ND  colistin tobramycin  32 2  16 1  4 2  8 2  <0.03 2  amikacin  4  1  4  2  1  Antibiotic CP 1-0 A indolicidin CP11CN cycCPIl LL-37 polyphemusin linear polyphemusin CEMA CP208 polymyxin B PMBN*  H993 (pmrH::xylE) 8 16 2 4 8 0.25  *polymyxin B nonapeptide  Time (min)  Figure 2.3. Killing of P. aeruginosa by 2 ug/ml polymyxin B . Strains are O HI 03 (WT) grown in 2 m M M g ; A H970 (pmrBr.xylE), 2 m M M g ; • H974 (PA4773::luxCDABE), 2 m M M g ; 2+  2 +  2 +  • HI03, 10 u M M g ; A H970, 10 u M M g ; • H974, 10 u M M g . 2 +  2 +  2 +  58  The  pmrA-pmrB genes and the pmrH (PA3552) gene regulate resistance to polymyxin B  and cationic antimicrobial peptides.  Strains H103 (wt), H970 (pmrB::xylE-Gm ), R  and H974 (PA4773::/wx) were examined  for sensitivity to killing by 2 ug/ml polymyxin B after growth in medium containing high (2mM) or low (20 uM) M g  2 +  (Fig. 2.3). Under high M g  2 +  conditions, all strains exhibited  complete susceptibility to polymyxin B, with 6 log orders of killing taking place within two min. In low M g medium, the parent strain was more resistant to polymyxin B , exhibiting only two-log orders of killing in 10 min, while the mutants, H970 and H974 were completely susceptible to killing (i.e. >6 log orders reduction in colonies within 5 min) upon exposure to this concentration of antibiotic. MIC data also confirmed the increased susceptibility of strains H970 (pmrB::xylE), H974 (PA4773::/wx), H988 (pmrAwxylE), and H993 (pmrHwxylE) to polymyxin B , and certain cationic antimicrobial peptides (Table 2.3). The mutant strains showed 8-32-fold lower MICs to polymyxin B. Strains H974 (PA4773.vto), H970 (pmrB::xylE), and H988 showed marginal MIC changes to peptides LL-37, polyphemusin, linear polyphemusin and polymyxin B nonapeptide. Linear polyphemusin and CP208 showed no antimicrobial activity towards any of the strains at the concentrations examined. Strain H974 showed 8-fold decreases in MIC to indolicidin, CP 1 I C N , and c y c C P H C N , while strains H970 and H988 showed no significant change in MIC to these compounds.  CP10A exhibited a 16-fold reduced MIC to all mutant  strains. Interestingly, interruption of pmrH resulted in a different susceptibility pattern to that of either the FA4773, pmrA or pmrB mutants. This strain showed a modest 4-fold decrease in M I C to CP10A. However, the strain was supersusceptible to both polymyxin B and colistin, with more than a 1000-fold decrease in the M I C to these drugs.  There was little effect of these  mutations on the susceptibility of the strains to amikacin and tobramycin. Overall, strain H974  59  was generally more sensitive than H970 {pmrB::xylE-Gm ) or H988 (pmrA: :xylE-Gm ) to most R  R  of the antimicrobial agents examined. This may be due to a polar effect of the transposon on the downstream genes PA4774 and PA4775. The functions of the PA4773, PA4774, and PA4775 genes are unknown, but they share some similarity with polyamine biosynthetic genes. PA4773 and pmrH affect the permeability of the outer membrane. The functions of PA4773, PA4774, and PA4775 are unknown. Therefore, the sensitivity of the outer membrane to permeabilization with polymyxin B was examined measuring N P N uptake (Fig. 2.4). N P N is a hydrophobic dye that is normally excluded from the interior of the lipid bilayer by the tight association of the hydrophilic LPS headgroups.  Antibiotics that  interfere with this packing arrangement allow N P N to access the interior of the bilayer. The fluorescence of the molecule increases due to the increased hydrophobic character of this region of the bilayer. The results demonstrated that permeability of the outer membrane correlated with the susceptibility of each strain to polymyxin B. Following exposure to 4 (xg/ml polymyxin B, the pmrH::xylE strain exhibited an immediate and dramatic increase in N P N fluorescence. The isogenic parent strain did not show any increased N P N fluorescence, while the VK4113\\luxCDABE strain showed an increase that was intermediate between those of the pmrHr.xylE strain and the wild-type strain. Induction of the pmrA-pmrB containing operon by cationic antimicrobial peptides. Two types of antibiotic resistance that can influence clinical outcome are mutational resistance and adaptative resistance. Adaptive antibiotic resistance can involve multiple mechanisms one of which could involve pre-exposure to sub-inhibitory concentrations of the antibiotic. In the case of polymyxin B resistance in Salmonella sp., detection of low M g  2 +  by  PhoQ or high Fe /low pH by PmrB leads to induction of genes responsible for the LPS 3+  modifications that reduce self-promoted uptake across the outer membrane. Reporter fusions in strains H973 and H974 were utilized to determine whether or not these signals and/or 60  polymyxin B and cationic antimicrobial peptides could induce expression of pmrB::xylE or ¥A4773::luxCDABE  in P. aeruginosa.  No induction was observed in response to increased F e  3+  concentrations or lowered pH,  the signals responsible for activation of PmrB in Salmonella (Fig. 2.5B). However, a dosedependent induction ofpmrBr.xylE in the merodiploid strain H973 was observed over a range of  500  20  40  60  80  100  120  140  160  IS  Figure 2.4. Outermembrane permeability of P. aeruginosa. M i d logarithmic phase cultures of HI03 (WT, solid line), H974 (APA4773, dotted line) and H993 (ApmrH, dashed line) were exposed to 1 ug/ml polymyxin B and the increase in NPN fluorescence was measured.  Time (sec)  concentrations from 0 to 750 ng/ml of polymyxin B (Fig. 2.5A). Similarly, growth of the pmrBr.xylE fusion in high (2 mM) M g  2 +  with the addition of sub-inhibitory concentrations of  cationic antimicrobial peptides led to a very strong induction of the pmrBr.xylE fusion in response to certain cationic peptides (Fig. 2.5B). Cattle indolicidin caused a 50-fold increase in expression while CP 1 I C N , an improved indolicidin variant, increased expression of the fusion by 45-fold. Polyphemusin was considerably less effective with only a four-fold increase. Utilization of the lux fusion as a reporter in H974 permitted rapid and sensitive analysis of the effects on the pmrA-pmrB operon of a variety of peptides at different concentrations (Table 2.4). The patterns observed using the lux reporter matched very closely to those observed using the xylE reporter although the fold-changes for induction appeared to be higher when  61  measured by lux expression, probably because baseline expression could be more reliably determined by luminescence. Thus, both of these reporters appeared to be regulated in the same manner. The PA4773::/wx fusion in H974 was strongly induced in high M g  2 +  by indolicidin and  the indolicidin variants CP10A, c y c C P l l and especially CP 1 I C N (Table 2.4). These sequence related peptides appeared to affect the expression to similar degrees and importantly, very low concentrations (31-250 ng/ml; <1% of MIC) still caused significant induction of this fusion. The a-helical peptide C E M A was also capable of causing modest induction of luminescence in the PA4773::/«x fusion, although the lowest concentration causing induction was significantly higher (0.5 ug/ml) than that observed for CP1 I C N (31 ng/ml), despite the fact that the MIC of C E M A toward P. aeruginosa is 16-fold lower than that for CP 1 I C N (Table 3). Conversely, the inactive a-helical variant, CP208 still caused induction of the fusion at extremely high concentrations, but induction fell off rapidly as the concentration of CP208 fell below 8 ug/ml. The weakly antimicrobial human cathelicidin peptide LL-37 demonstrated similar effects to CP208. Nevertheless, it is clear that induction of this operon was not related to the ability of the peptides to kill bacteria, implying that induction of resistance and cellular damage may be separate events. Horseshoe crab polyphemusin and related peptides were also examined for their ability to induce luminescence in the PA4773::lux fusion, since polyphemusin displays strong antibacterial activity toward Pseudomonas. Interestingly, the p-hairpin peptide polyphemusin induced only a 17-fold increase in luminescence in the PA4773::/wx fusion in H974 (Table 2.4), despite the fact that P. aeruginosa is >32 fold more sensitive to killing by this peptide compared to indolicidin and its derivatives (Table 2.3). Interestingly, the non-bactericidal linear  62  A. 350  control  Fe  2 +  Fe  3 +  pH 5.8  PM1  indolicidin C P 1 1 C N  Figure 2.5. Induction of the pmrA-pmrB containing operon by cationic antimicrobial peptides. A ) Dose-dependent response to increasing concentration of polymyxin B of the pmrBr.xylE fusion in strain H970. B) Induction of pmrBr.xylE fusion in strain H970 by various stimuli. Control - B M 2 medium supplemented with 2 m M M g pH 7.0; F e - addition of 100 u M FeSC-4 + 300 u M desferroximine mesylate; F e - addition of 100 u M FeCl + 300 u M 2, 2 dipyridyl; pH 5.8 - altering the pH of B M 2 medium to pH 5.8; PM1 - addition of 62 ng/ml polyphemusin; indolicidin - addition of 500 ng/ml indolicidin; CP11CN - addition of 500 ng/ml CP11CN. 2 +  2+  3+  3  63  polyphemusin variant P1L caused very high induction of the fusion at concentrations from 0.5-4 (j,g/ml, equivalent to that observed with the indolicidin-like peptides. The response to a number of aminoglycoside antibiotics and polymyxins was also examined. None of the aminoglycosides studied were able to induce luminescence in the PA4773::/wx fusion strain. Five to eleven-fold induction was observed in response to polymyxin B concentrations between 0.125-1 ug/ml, to colistin (polymyxin E) between 0.25-2 ug/ml, and polymyxin B nonapeptide  between 0.5-2ug/ml. Thus, induction by polymyxins was  substantially lower that that observed with certain peptides. A series of mutants were created in strain H974 to determine whether or not the induction, by peptides, of the PA4773:/wx fusion depended upon the products of the phoP, phoQ, pmrA, or pmrB genes. We used the indolicidin variant peptide, CP 1 I C N , as a representative peptide, due to the fact that it demonstrated the strongest effect on transcription of PA4773::lux in our comparison of different peptides (Table 2.4).  Interestingly, the fusion  showed strong induction by CP1 I C N in all of these strains (Fig 2.2), implying that the regulator controlling peptide-mediated activation of this operon is not known. Induction of L P S modification operon (pmrHFIJKLM-ugd)  by cationic antimicrobial  peptides. The genes responsible for LPS modifications in Salmonella are directly regulated by PmrA and PmrB. In order to determine how the eight-gene operon encoding the putative LPS modification system (pmrHFIJKLM-ugd) of Pseudomonas is regulated, we created a plasmidencoded promoter fusion to the entire intergenic region between algA (PA3551) and pmrH (PA3552). This pmrHv.lux fusion was then mobilized into strains HI03 (WT), H851 (phoP), H854 (phoQ), H988 (pmrA), and H970 (pmrB) and the luminescence of these strains under 2+  varying M g and peptide conditions was examined. As shown in Figure 2.6, the expression of this fusion was induced 86-fold in low M g  in a wild-type background. Expression was 64  PA3552::luxCDABE plasmid-encoded Q  O  2500000  D ^  2000000  x  C  I  O  wt  p/jo/> p/zog p/wH pmrB 20 uM M g  wt  /?//oP p/?o(? / " » ^ pmrB 2 mM M g  2 +  2  wt  jp/zaP phoQ pmrA  pmrB  2 mM M g + 4 ug/ml CP11CN 2 +  Figure 2.6. Regulation of pmrH (PA3552) in phoP, phoQ, pmrA, and pmrB mutant strains. Induction of p^^si'-'-lux fusion in BM2-glucose minimal media supplemented with 20 u M M g , 2 m M M g , or 2 m M M g with 4 ug/ml CP11CN in H103 (wt), H851 (phoP), H854 (phoQ), H988 (pmrA) and H970 (pmrB). The p^f^ssi'-'-lux fusion contained a /wx cassette fused to the entire intergenic region between PA3551 and PA3552 and reports on the transcription of the eight-gene operon encoding the LPS aminoarabinose modification system (PA3552PA3559) of Pseudomonas. In Salmonella this operon is PmrA-PmrB regulated. 2 +  2 +  2 +  1000 100 11  \  10  >  E s  C/3  •• s  H  11  \ \ \ \  1 0.1 0.01  -  0.001  i  0  Time (min)  10  Figure 2.7 Adaptive resistance to polymyxin B induced by CP11CN in P. aeruginosa. Cultures of P. aeruginosa HI03 were grown to mid-logarithmic phase in the presence (•) or absence (•) of 2 ug/ml CP 1 I C N . Killing was initiated by the addition of 1 ug/ml polymyxin B at 0 min. Aliquots were withdrawn and serial dilutions were plated to determine the percentage of cells that survive the polymyxin B exposure.  65  Table 2.4. Induction of P'A4112>:luxCDABE fusion in strain H974 in response to cationic peptides  Foldinduction 82 86 130 119 25 17 132  Antibiotic CP10A. indolicidin CP11CN cycCPll LL-37 polyphemusin linear polyphemusin CEMA CP208 polymyxin B PMBN* colistin gentamicin tobramycin polymyxin B  Maximal luminescence (RLU/OD ) 81500 85600 130000 119000 24500 16800 132000  7 16 5 6 11 1 1 nonapeptide  Peptide Concentration (ng/ml) leading to 10% 50% 100% luminescence luminescence luminescence 0.25 1 4 0.25 2 8 0.031 1 4 0.031 1 4 2 4 16 0.015 0.062 0.5 0.5 2 4  620  6800 16100 5200 5600 11000 1260 1220  0.5 8 0.125 0.5 0.25  0.5 16 0.25 2 0.5  2 32 0.5 4 2  reduced 13-fold in strain H851 (phoP) while in strain H988 (pmrA) expression was reduced by 2-fold, indicating that the PhoP activator is an important determinant of low M g  induced  activation of the fusion. In high M g , the pmrHv.lux fusion in the phoQ mutant was strongly derepressed, similar to the phenotype observed for the PA4773::/ux fusion in strain H976 (Fig. 2.2) and for OprH expression (Macfarlane et al, 1999). In addition to this regulation by M g , 2 +  thepmrHr.lux fusion was also induced 50-80 fold by 4 Lig/ml CP11CN in all strains examined (Fig. 2.6). Adaptive resistance is induced by preexposure to sub-inhibitory concentrations of cationic antimicrobial peptides. To confirm that the observed response to sub-inhibitory concentrations of cationic antimicrobial peptides actually leads to increased cationic antimicrobial peptide resistance, killing assays were  66  performed in cells that had been pre-exposed to the indolicidin variant peptide, CP11CN. These conditions were chosen based on the observed high level of induction of a PA4773:: luxCDABE fusion in the presence of this peptide (Table 2.4).  As demonstrated in Figure 2.7, this  preexposure to sub-MIC CP11CN resulted in a 4 log-order decrease in killing by 1 Lig/ml polymyxin B as compared to a culture that was not preexposed to CP11CN. DISCUSSION Previous work has demonstrated that the PhoP-PhoQ system of P. aeruginosa plays a role in regulating resistance to polymyxin B, a-helical peptides, and aminoglycosides (Ernst, Y i et al. 1999; Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al.2000) and hinted at the possibility that other regulatory systems are likely involved in regulation of these phenotypes. We have shown here an additional role for PmrA-PmrB. This is conceptually similar to the situation for Salmonella but this study illustrates several key differences between the PhoPPhoQ and PmrA-PmrB systems of Pseudomonas compared to those of Salmonella (Table 2.5). In Salmonella, the PhoP-PhoQ system responds to conditions that are found within the Salmonella-containing vacuole (SCV) and is essential for intramacrophage survival (Garcia-del Portillo, Foster et al. 1992; Groisman 2001).  The PmrA-PmrB system of Salmonella is  interconnected with PhoP-PhoQ, but also independently activated by increased concentrations of Fe  (Soncini and Groisman 1996; Wosten, Kox et al. 2000). The concentration of iron in the  mouse stomach and small intestine may approach the levels required- for PmrB-signaling (Wosten, Kox et al. 2000). Thus, the Salmonella PhoP-PhoQ and PmrA-PmrB systems appear to be involved in adapting to the many environments encountered during the lifestyle of Salmonella species. P. aeruginosa however, is primarily a pathogen of mucosal surfaces. As such, it does not usually encounter decreases in pH, nor, generally speaking, are the M g 67  2 +  concentrations within  the airway surface fluid, which can be as high as 2.2 m M , limiting (Cowley, Govindaraju et al. 1997; Baconnais, Tirouvanziam et al. 1999).  The airway surface fluid of CF patients can  possess a very high concentration of cationic peptides and proteins (300 ug/mL) (Soong, Ganz et al. 1997), yet the lungs of CF patients are often chronically infected with P. aeruginosa, which is capable of resisting these high concentrations of peptides. A previous report indicated that P. aeruginosa from the lungs of patients with cystic fibrosis had LPS modifications similar to those associated with the Salmonella PhoP-PhoQ-regulated changes and this was taken as evidence of activation of PhoP-PhoQ (Ernst, Y i et al. 1999). The data presented here provide an alternative explanation for these modifications since endogenous lung peptides and/or colistin treatment of P. aeruginosa infection could have resulted in direct activation of the putative LPS modification operon (pmrHFIJKLM-ugd) and the pmrA-pmrB  operon.  In vitro data  demonstrates that LL-37, a peptide constitutively expressed in the human lung, is capable of inducing the pmrA-pmrB fusion at concentrations in the range of 2-16 ug/ml. This may be clinically relevant, since it is known that newborns with cystic fibrosis complicated by pulmonary infections have levels of approximately 6-8 ug/ml of LL-37 in their bronchoalveolar lavage fluid (Schaller-Bals, Schulze et al. 2002), a level higher than that observed in non-CF individuals. In this work the identification of a two-component regulatory system, PmrA-PmrB, in P. aeruginosa has been described. The PmrA-PmrB system is regulated by M g  2 +  and this M g  2 +  regulation is largely independent of the PhoP-PhoQ system, which also responds to M g . PmrA 2 +  and PmrB are required for high-level expression of this operon under Mg -deficient conditions 2+  (Fig. 2.2). The promoter for the pmrA-pmrB operon contained an imperfect direct repeat that may form a binding site for PmrA (Fig. 2.8). Moreover, the fact that the PA4773::/wx fusion is expressed despite a polar insertion indicates that there must be a second promoter in front of the downstream pmrA-pmrB genes. 68  Overexpression of phoP in strain H974 (PA4773::/wx), H975 (PA4773::/ux; phoQr.xylE) and H976 (PA4773::/i/x; phoPr.xylE) had only a marginal effect on induction of the operon by low M g  2 +  (Table 2). In contrast PhoQ was capable of affecting operon expression since a phoQ  interposon mutant (H975) lead to 5-fold increased expression of a PA4773::luxCDABE fusion (Table 2.2, Fig. 2.2). This latter result was consistent with the suggestion that in addition to the ability of PhoQ to act as both a kinase and phosphatase toward PhoP (Macfarlane, Kwasnicka et al. 1999), it may also be a phosphatase toward PmrA. As mentioned above, certain classes of cationic antimicrobial peptides and polymyxin B were shown to activate the PA4773-4775-pmrAB and pmrHFIJKLM-ugd  operons in a M g 2 +  independent manner. The activation of the FA4773::lux fusion by peptides appeared to take place in the absence of both the PhoP-PhoQ system and the PmrA-PmrB system. This contrasts with the situation in Salmonella, where LPS modification induced by cationic antimicrobial peptides requires the PhoP-PhoQ system (Bader, Navarre et al. 2003).  This suggests that  another regulatory system exists in P. aeruginosa that responds to peptides by inducing this operon. The relationship between inducibility of the system and resistance to a given peptide was incomplete because induction did not require peptide activity per se, and since the peptides used have different structures and mechanisms of action and are apparently differentially affected by the PmrAB-regulated resistance mechanism. Examination of the data in Tables 3 and 4 shows that when the antibacterial activity of an antibiotic was high, (e.g. polyphemusin I, C E M A , polymyxin B) its ability to induce PmrA-PmrB was relatively weak. The converse did not hold true, indicating that there can be other reasons for weak antibacterial activity, but the generally poor activity of the indolicidins against P. aeruginosa might be explained in part by their strong ability to induce PmrA-PmrB. It is important to note that the ability to induce the pmrA-pmrB operon is not related to the mechanism of action of specific peptides, as completely non bactericidal peptides like CP208 and polymyxin B nonapeptide were still able to induce this 69  operon. Similarly there was no strong relationship between peptide structure and the ability to induce the pmrA-pmrB-containmg operon as all cationic peptides, including lipopeptides, ahelical, cyclic, and p-hairpin molecules had some ability to induce. Adaptive antibiotic resistance can involve multiple mechanisms one of which would involve pre-exposure to antibiotic. P. aeruginosa exhibits a phenotype known as adaptive polymyxin B resistance (Gilleland and Farley 1982). This phenotype occurs when P. aeruginosa is passaged in medium containing serially increasing concentrations of polymyxin B , after which growth can be observed at concentrations 1000 times greater than the MIC. However, the resistance is not stable, so that when these cells are grown in medium containing no antibiotic, the cells revert to normal susceptibility. The mechanism by which this takes place is unknown, although the regulation of this type of resistance suggests that the cells may be responding directly to the presence of polymyxin B, thereby inducing resistance. The activation of the pmrA-pmrB and the pmrHFIJKLM-ugd  operons by cationic peptides is consistent with the  adaptive polymyxin B resistance phenotype. Furthermore, this hypothesis is supported by the demonstration that pre-exposure to CP 1 I C N resulted in -5 log orders increased survival in the presence of a subsequent polymyxin B exposure. In Salmonella, the PmrA-PmrB system directly controls the pmrHFIJKLM  and ugd  operons, which are responsible for LPS modifications involved in resistance to cationic antimicrobial peptides. Since Pseudomonas possesses orthologs of this system, the regulation of these genes (PA3552-PA3559) was examined. The pmrH.iux  fusion was activated by growth  on low (20 uM) M g . Deletion of either phoP or phoQ resulted in -95% less expression under 2 +  2"r"  low M g  conditions, while deletion of pmrA or pmrB resulted in -50% less expression than  wild-type cells, but still substantially more than in the phoP or phoQ mutants. M g 2~^, this fusion was 700-fold derepressed in the phoQ mutant (Fig. 2.6).  70  Under high  Table 2.5. Differences between the PhoP-PhoQ and PmrA-PmrB systems of Salmonella and Pseudomonas. Phenotype /property Lifestyle  Salmonella enterica sv. Typhimurium  Pseudomonas aeruginosa  Intracellular pathogen; SCV is an acidified, low M g environment  Extracellular pathogen associated with mucosal surfaces; Commonly found in soil and water samples  Cationic peptide resistance  LPS modifications are important for resistance; PhoP mutants are susceptible  Cationic peptide signaling Virulence  Occurs via the PhoP-PhoQ systems  Unique three-gene operon (PA4773PA4775) also contributes to resistance; PhoP mutants do not differ from wildtype Is independent of both the PhoP-PhoQ and PmrA-PmrB systems  2 +  PhoP  PhoP and PhoQ mutants exhibit decreased virulence; PmrA mutants are also less virulent; constitutive PhoP expression attenuates virulence Indirectly regulates PmrA-PmrB via PmrD  PmrA  Directly regulates LPS modification operon  PhoQ  Activated by limiting M g  PmrB  Activated by lowered p H and increased F e  2 +  PhoQ mutants show 100-fold less virulence than wild-type; PhoP mutants have similar virulence to wild-type strain Directly regulates OprH and LPS modification operon; 70% similar to Salmonella PhoP throughout entire sequence Directly regulates LPS modification operon and the pmrA-pmrB operon; pmrA-pmrB genes are induced by cationic peptides; 60%o similar to Salmonella PmrA throughout entire sequence Activated by limiting M g ; 52% similar to Salmonella PhoQ throughout entire sequence, 23 residue insertion in signaling domain Activated by limiting M g ; 48%o similar to Salmonella PmrB in the C-terminal sequence, no similarity in the N-terminal 170 residues 2 +  2 +  3+  71  The promoter structure of pmrH, contains three binding motifs, two that resemble a PhoP-like binding sequence (Macfarlane, Kwasnicka et al. 1999), and one that resembles a putative PmrA-like binding sequence (Fig. 2.8). This putative PmrA-motif is also found in the promoter of P A4773 and both types of motifs are direct repeats with conserved spacing between them.  This is a common motif for other known two-component regulators and thus may  represent the binding sites for PhoP and PmrA.  oprH  G T T C A G C C C G G G T T C A G : A A G C JTTCAGGGGCGGTTCAG  60 bp  ATG  GTTAAGCACCTCTTAAGI  67 bp  ATG  PA4773 pmrH  r  JGTTCAGTCTTCATTCAGCCGTTbTTAAGCGAGTCTTAAc[\AACGTTCAGGCAGCATTCAG  ^ =  :  '  1  5 bp  i  I  56 bp  ATG  —:  5 bp  5 bp  PhoP direct repeat : PmrA direct repeat Figure 2.8. PhoP and PmrA binding sites. Alignment of the promoter regions of P. aeruginosa oprH, PA4773 and pmrH depicting putative PhoP and PmrA binding sites (boxed regions). The PhoP binding site (solid line) contains two 6 bp direct repeats separated by a 5 bp spacer region which resembles the known E. coli PhoP binding site (Yamamoto, Ogasawara et al. 2002) and that identified in Macfarlane et al. (Macfarlane, Kwasnicka et al. 1999). The PmrA binding site (dashed line) contains similar but distinct, direct repeats with a 5 bp spacer region that resembles the Salmonella PmrA binding site (Aguirre, Lejona et al. 2000). The distance between the predicted binding sites and the putative start codon (ATG) of the gene is indicated.  Previous studies in Pseudomonas have shown that while deletion of phoQ results in resistance to cationic antimicrobial peptides under M g -replete conditions where the bacteria would normally be sensitive, phoP mutants had no susceptibility phenotype (Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000). Data presented in this paper 9-1-  suggests that in addition to PhoQ acting as a kinase under low M g  •  growth conditions, it also  9+  acts as a phosphatase under M g -replete conditions. This difference is consistent with the 72  observation that the PhoQ sensing domain of P. aeruginosa undergoes a large conformational 2__ | ,  ,  ,  shift when M g is non-limiting, while the sensing domain of E. coli PhoQ does not (Lesley and Waldburger 2001). Intriguingly, the data also suggest that PhoQ exerts an effect on genes regulated by PmrA exclusively, since phoQ mutants exhibit derepression of a PA4773::/z/x fusion (Fig. 2.2). PmrD is a small basic protein that regulates the activity of PmrA via a post translational mechanism. It connects the PhoPQ system with the PmrAB system in S. Typhimurium and is strictly required for M g  regulation of polymyxin B resistance (Kox, Wosten et al. 2000). The  possibility that PhoQ acts via a PmrD-like intermediate has not been formally excluded, however, unlike the situation observed in Salmonella (Kox, Wosten et al. 2000), the derepression/activation is not dependent upon PhoP (Fig. 2.2) and there is no gene homologous to pmrD in P. aeruginosa. Thus, although there are many similarities between the PhoP-PhoQ and PmrA-PmrB systems of Pseudomonas and Salmonella, there are many differences as well (Table 2.5). Collectively, these data indicate that the regulation of cationic peptide resistance is very complex. The data indicate P. aeruginosa possesses at least two regulatory systems that respond independently to M g , and PmrB appears to also respond to signals other than limiting M g 2 +  2 +  and different from those signals that Salmonella PmrB respond to. More work is needed to elucidate the mechanism for cationic peptide-mediated gene induction.  Although the data  presented here suggest a potential problem with induced resistance to cationic peptides, the results also point to one group of peptides, the polyphemusins, that are almost unaffected by PmrA-PmrB-mediated resistance and have a relatively poor ability to induce the pmrA-pmrB operon. Thus, this provides clear evidence that it is possible to design cationic antimicrobial peptides which are unaffected by the resistance mechanisms discussed here. 73  REFERENCES  Aguirre, A., Lejona, S., Vescovi, E . G. & Soncini, F. C. (2000). Phosphorylated PmrA interacts with the promoter region of ugd in Salmonella enterica serovar Typhimurium. J Bacteriol 182, 3874-3876. Baconnais, S., Tirouvanziam, R., Zahm, J. M., de Bentzmann, S., Peault, B., Balossier, G. & Puchelle, E . (1999). Ion composition and rheology of airway liquid from cystic fibrosis fetal tracheal xenografts. AmJRespir Cell Mol Biol 20, 605-611. Bader, M . W., Navarre, W. W., Shiau, W., Nikaido, H., Frye, J. G., McClelland, M., Fang, F. C. & Miller, S. I. (2003). Regulation of Salmonella typhimurium virulence gene expression by cationic antimicrobial peptides. Mol Microbiol 50, 219-230. Bentley, S. D., Chater, K. F., Cerdeno-Tarraga, A. M . & other authors (2002). Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417, 141147. Bjarnason, J., Southward, C. M . & Surette, M . G. (2003). Genomic profiling of ironresponsive genes in Salmonella enterica serovar Typhimurium by high-throughput screening of a random promoter library. JBacteriol 185, 4973-4982. Brinkman, F. S., Macfarlane, E . L., Warrener, P. & Hancock, R. E . W. (2001). Evolutionary relationships among virulence-associated histidine kinases. Infect Immun 69, 5207-5211. Cowley, E . A., Govindaraju, K., Lloyd, D. K. & Eidelman, D. H. (1997). Airway surface fluid composition in the rat determined by capillary electrophoresis. Am J Physiol 273, L895899. Ernst, R. K., Yi, E . C , Guo, L., Lim, K. B., Burns, J. L., Hackett, M . & Miller, S. I. (1999). Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa. Science 286, 1561-1565. Friedrich, C , Scott, M . G., Karunaratne, N., Yan, H. & Hancock, R. E . W. (1999). Saltresistant alpha-helical cationic antimicrobial peptides. Antimicrob Agents Chemother 43, 15421548. Friedrich, C. L., Moyles, D., Beveridge, T. J. & Hancock, R. E . W. (2000). Antibacterial action of structurally diverse cationic peptides on Gram-positive bacteria. Antimicrob Agents Chemother 44, 2086-2092. Friedrich, C. L., Rozek, A., Patrzykat, A. & Hancock, R. E . W. (2001). Structure and mechanism of action of an indolicidin peptide derivative with improved activity against Grampositive bacteria. J Biol Chem 276, 24015-24022.  74  Garcia-del Portillo, F., Foster, J. W., Maguire, M . E . & Finlay, B. B. (1992). Characterization of the micro-environment of Salmonella typhimurium-containing vacuoles within M D C K epithelial cells. Mol Microbiol 6, 3289-3297. Gilleland, H . E . , Jr. & Farley, L . B. (1982). Adaptive resistance to polymyxin in Pseudomonas aeruginosa due to an outer membrane impermeability mechanism. Can J Microbiol 28, 830-840. Groisman, E . A. (2001). The Pleiotropic Two-Component Regulatory System PhoP-PhoQ. J Bacteriol 183, 1835-1842. Gudmundsson, G. H., Agerberth, B., Odeberg, J., Bergman, T., Olsson, B. & Salcedo, R. (1996). The human gene F A L L 3 9 and processing of the cathelin precursor to the antibacterial peptide LL-37 in granulocytes. Eur J Biochem 238, 325-332. Gunn, J. S., Belden, W. J. & Miller, S. I. (1998). Identification of PhoP-PhoQ activated genes within a duplicated region of the Salmonella typhimurium chromosome. Microb Pathog 25, 7790. Hancock, R. E . W., Falla, T. & Brown, M . (1995). Cationic bactericidal peptides. Adv Microb Physiol 37, 135-175. Hancock, R. E . W. (1997). Peptide antibiotics. Lancet 349, 418-422. Hancock, R. E . W. & Chappie, D . (1999). Peptide Antibiotics. Antimicrobial Agents and Chemotherapy 43, 1317-1323. Heithoff, D . M., Conner, C. P., Hentschel, U., Govantes, F., Hanna, P. C. & Mahan, M . J. (1999). Coordinate intracellular expression of Salmonella genes induced during infection. J Bacteriol 181, 799-807. Hoang, T. T., Karkhoff-Schweizer, R. R., Kutchma, A. J. & Schweizer, H . P. (1998). A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomallylocated D N A sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212, 77-86. Kox, L . F., Wosten, M . M . & Groisman, E . A. (2000). A small protein that mediates the activation of a two-component system by another two-component system. EMBO J 19, 18611872. Lesley, J. A. & Waldburger, C. D . (2001). Comparison of the Pseudomonas aeruginosa and E. coli PhoQ sensor domains: Evidence for distinct mechanisms of signal detection. J Biol Chem 12, 12. Macfarlane, E . L . , Kwasnicka, A., Ochs, M . M . & Hancock, R. E . W. (1999). PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outer-membrane protein OprH and polymyxin B resistance. Mol Microbiol 34, 305-316.  75  Macfarlane, E . L . , Kwasnicka, A. & Hancock, R. E . W. (2000). Role of Pseudomonas aeruginosa PhoP-phoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology 146 (Pt 10), 2543-2554. Maniatis, T., Fritsch, E . & Sambrook, J. (1989). Molecular Cloning: A Laboratory Manual, 2 edn. Plainview, New York: Cold Spring Harbour Press. Monsieurs, P., De Keersmaecker, S., Navarre, W. W. & other authors (2005). Comparison of the PhoPQ regulon in Escherichia coli and Salmonella typhimurium. J Mol Evol 60, 462-474. Mouslim, C. & Groisman, E . A. (2003). Control of the Salmonella ugd gene by three twocomponent regulatory systems. Mol Microbiol 47, 335-344. Nikaido, H . (1996). Multidrug Efflux Pumps of Gram-Negative Bacteria. Journal of Bacteriology 178, 5853-5859. Rodrigue, A., Quentin, Y., Lazdunski, A., Mejean, V. & Foglino, M . (2000). Twocomponent systems in Pseudomonas aeruginosa: why so many? Trends Microbiol 8, 498-504. Rozek, A., Powers, J. P., Friedrich, C. L . & Hancock, R. E . (2003). Structure-based design of an indolicidin peptide analogue with increased protease stability. Biochemistry 42, 1413014138. Schaller-Bals, S., Schulze, A. & Bals, R. (2002). Increased levels of antimicrobial peptides in tracheal aspirates of newborn infants during infection. Am J Respir Crit Care Med 165, 992995. Schweizer, H . P. & Hoang, T. T. (1995). A n improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158, 15-22. Scott, M . G. & Hancock, R. E . W. (2000). Cationic antimicrobial peptides and their multifunctional role in the immune system. Crit Rev Immunol 20, 407-431. Selsted, M . E . , Novotny, M . J., Morris, W. L . , Tang, Y. Q., Smith, W. & Cullor, J. S. (1992). Indolicidin, a novel bactericidal tridecapeptide amide from neutrophils. J Biol Chem 267, 4292-4295. Soncini, F. C , Garcia Vescovi, E . , Solomon, F. & Groisman, E . A. (1996). Molecular basis of the magnesium deprivation response in Salmonella typhimurium: identification of PhoPregulated genes. J Bacteriol 178, 5092-5099. Soncini, F. C. & Groisman, E . A. (1996). Two-component regulatory systems can interact to process multiple environmental signals. J Bacteriol 178, 6796-6801. Soong, L . B., Ganz, T., Ellison, A. & Caughey, G. H . (1997). Purification and characterization of defensins from cystic fibrosis sputum. Inflamm Res 46, 98-102. Stock, A. M . , Robinson, V. L . & Goudreau, P. N. (2000). Two-component signal transduction. Annu Rev Biochem 69, 183-215. 76  Stover, C. K., Pham, X. Q., Erwin, A. L . & other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen [see comments]. Nature 406, 959-964. Trent, M . S., Ribeiro, A. A., Doerrler, W. T., Lin, S., Cotter, R. J. & Raetz, C. R. (2001a). Accumulation of a polyisoprene-linked amino sugar in polymyxin-resistant Salmonella typhimurium and Escherichia coli: structural characterization and transfer to lipid A in the periplasm. JBiol Chem 276, 43132-43144. Trent, M . S., Ribeiro, A. A., Lin, S., Cotter, R. J. & Raetz, C. R. (2001b). A n inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-Larabinose to lipid A : induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J Biol Chem 276, 43122-43131. West, A. H . & Stock, A. M . (2001). Histidine kinases and response regulator proteins in twocomponent signaling systems. Trends Biochem Sci 26, 369-376. West, S. E . , Schweizer, H . P., Dall, C , Sample, A. K. & Runyen-Janecky, L . J. (1994). Construction of improved Escherichia-Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene 148, 81-86. Windholz, M., Budavari, S., Stroumtsos, L . & Fertig, N. (1976).The Merck Index. Rahway, NJ: Merck & Co., Inc. Winson, M . K., Swift, S., Hill, P. J., Sims, C. M., Griesmayr, G., Bycroft, B. W., Williams, P. & Stewart, G. S. (1998). Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol Lett 163, 193-202. Wosten, M . M., Kox, L . F., Chamnongpol, S., Soncini, F. C. & Groisman, E . A. (2000). A signal transduction system that responds to extracellular iron. Cell 103, 113-125. Yamamoto, K., Ogasawara, H., Fujita, N., Utsumi, R. & Ishihama, A. (2002). Novel mode of transcription regulation of divergently overlapping promoters by PhoP, the regulator of twocomponent system sensing external magnesium availability. Mol Microbiol 45, 423-438. Zhang, L., Scott, M . G., Yan, H., Mayer, L . D. & Hancock, R. E . W. (2000). Interaction of polyphemusin I and structural analogs with bacterial membranes, lipopolysaccharide, and lipid monolayers. Biochemistry 39, 14504-14514. Zhang, L., Parente, J., Harris, S. M., Woods, D. E . , Hancock, R. E . & Falla, T. J. (2005). Antimicrobial peptide therapeutics for cystic fibrosis. Antimicrob Agents Chemother 49, 29212927. Zhou, Z., Ribeiro, A. A., Lin, S., Cotter, R. J., Miller, S. I. & Raetz, C. R. (2001). Lipid A modifications in polymyxin-resistant Salmonella typhimurium: PmrA-dependent 4-amino-4deoxy-L-arabinose, and phosphoethanolamine incorporation. JBiol Chem 276, 43111-43121. 77  Chapter 3 — Identification of PhoP and PmrA regulated genes: Role of PhoP and PmrA in Mg -regulated phenotypes 2+  1  INTRODUCTION Pseudomonas aeruginosa is an important opportunistic pathogen, capable of infecting a large number of hosts including nematodes, insects, plants, animals, and especially humans. It is the third-leading cause of nosocomial infection and is also the leading cause of morbidity and mortality in cystic fibrosis (CF) patients (Rajan and Saiman 2002). This organism is also noted for its metabolic diversity, which allows it to colonize a large number of environmental habitats. Its versatility is believed to be related to the large number of regulatory proteins found in its genome (469 of 5570 ORFs) (Stover, Pham et al. 2000). The two-component response regulators constitute one of the largest families of regulatory proteins in P. aeruginosa (Stover, Pham et al. 2000). These systems typically contain a sensor protein that responds to some chemical or physical stimulus, leading to phosphorylation of the sensor protein at a conserved histidine residue, thus altering the conformation of the sensor and promoting interaction with a cognate response regulator protein (Stock, Robinson et al. 2000). Following binding, there is a phosphotransfer to a conserved aspartate residue in the response regulator and the phosphorylated response regulator then recognizes and binds to a specific D N A sequence leading to modulation of transcription from that promoter (Stock, Robinson et al. 2000). Alternatively, some regulation occurs through phosphatase action on the response regulator (Stock, Robinson et al. 2000).  In P. aeruginosa, there are 64 response  regulators and 63 histidine kinases as well as sixteen atypical kinases (Rodrigue, Quentin et al. 2000). The function of the majority of these regulatory proteins has not yet been established.  1  A version of this chapter will be submitted for publication as McPhee, JB, Bains, M, Winsor, G, Kwasnicka, A,  Lewenza, S, Brinkman, FSL, and REW Hancock. Contribution of the PhoP-PhoQ and PmrA-PmrB twocomponent regulatory systems to Mg -induced gene expression in Pseudomonas aeruginosa. 2+  78  In Salmonella sp., the PhoP-PhoQ and PmrA-PmrB systems are involved in cationic peptide and polymyxin B resistance, as well as in coordinating virulence (Miller, Kukral et al. 1989; Miller and Mekalanos 1990; Guo, Lim et al. 1998; Gunn, Ryan et al. 2000). Although the systems appear to regulate some similar phenotypes in P. aeruginosa (Brinkman, Macfarlane et al. 2001; McPhee, Lewenza et al. 2003; Lewenza, Falsafi et al. 2005), there are some major differences between the two species. In both, the PhoP-PhoQ system responds strongly to limiting concentrations of divalent cations. Studies have suggested however that the mechanism by which the PhoQ proteins in these species sense the divalent cation limitation may differ (Lesley and Waldburger 2001). Indeed, in addition to responding to limiting concentrations of divalent cations, the PhoQ protein of S. typhimurium, unlike that of P. aeruginosa (McPhee, Lewenza et al. 2003), also responds directly to the presence of cationic antimicrobial peptides (Bader, Sanowar et al. 2005). In P. aeruginosa, the PmrA-PmrB system is required for regulating polymyxin B and cationic antimicrobial peptide resistance in response to limiting M g  2 +  conditions (McPhee,  Lewenza et al. 2003). These alterations in cationic peptide resistance take place primarily via the regulation of the pmrH-ugd LPS modification operon. Mutants in pmrH-ugd or in the pmrApmrB regulator exhibit increased sensitivity to cationic antimicrobial peptides under M g limiting conditions (McPhee, Lewenza et al. 2003).  Furthermore, mutants containing  constitutively active PmrB show constitutive addition of aminoarabinose to Lipid A which results in increased resistance to cationic peptides (Moskowitz, Ernst et al. 2004). In addition to this M g -regulated response, both operons are also directly activated by cationic peptides via a mechanism that is independent of PmrA-PmrB and PhoP-PhoQ (McPhee, Lewenza et al. 2003). 2__ |  Mg  ,  ,  t  dependent regulation of cationic peptide and polymyxin B resistance in P.  aeruginosa is also regulated by the PhoP-PhoQ system (Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000). This is likely because the pmrH-ugd LPS modification 79  operon, that encodes enzymes responsible for the addition of aminoarabinose to the Lipid A moiety of LPS, is directly regulated by both the PmrA-PmrB systems and the PhoP-PhoQ systems (McPhee, Lewenza et al. 2003; Moskowitz, Ernst et al. 2004). Previous work established that there are two conserved binding motifs within the promoters that control the phoP-phoQ and pmrA-pmrB containing operons and which have been implicated to be involved in autoregulation of the expression of the respective two-component regulators (Macfarlane, Kwasnicka et al. 1999; McPhee, Lewenza et al. 2003). The promoters of the PA4773-pmrAB and pmrH-ugd operons contain the sequence C T T A A G N C T T A A G that was proposed to be the 5  PmrA-binding sequence (McPhee, Lewenza et al. 2003). The promoter upstream of the PhoPQ, and PmrAB regulated pmrH-ugd operon also contains two PhoP-like binding sites that are very similar to those previously identified in the oprH-phoP-phoQ promoter (Macfarlane, Kwasnicka etal. 1999). Given the importance of the PhoP-PhoQ and PmrA-PmrB genes in regulating virulence and host antimicrobial and cationic antimicrobial peptide resistance in P. aeruginosa, we searched the P. aeruginosa genome for promoters that contained the putative PhoP or PmrA binding sites. Using a combination of genetic and biochemical analyses, a series of new PhoP and PmrA regulated genes were identified. MATERIALS AND METHODS Bacterial strains, primers, and growth conditions. The bacterial strains and plasmids used in this study are described in Table 3.1. A l l primers were synthesized by AlphaDNA (Montreal, QC) and the sequences of these primers are shown in Table 3.2. Mutants in PA0921 and PA1343 were obtained from the University of Washington (Jacobs, Alwood et al. 2003). Cultures were routinely grown in Luria-Bertani broth or BM2-glucose minimal medium containing low (20 uM) or high (2 mM) MgS04 concentrations. Antibiotics for selection were used at the following concentrations: tetracycline, 80  Table 3.1. P. aeruginosa strains and plasmids used in this study.  Strain or plasmid H103 H851 H974 H988 H1025 UW-WT UW-44235 UW-47583  Genotype or characteristics wild-type P. aeruginosa P A O l phoP: :xylE:aacCl; G m ?A4773::luxCDABE derivative of HI 03; Tc pmrA::xylE:aacCl; G m feoA: -.luxCDABE derivative of H103 Wild-type P. aeruginosa P A O l , PA1343:IS^/20^ PA0920-PA0921 dSphoA  McPhee et al., 2003 Lewenza et al., 2005 Jacobs et al., 2003 Jacobs et al., 2003 Jacobs et al., 2003  pphoP-Hisb ppmrA-WiSf,  Hise-phoP cloned into pET28a Hise-pmrA cloned into pET28a  This study This study  R  Reference Macfarlane etal., 1999 Macfarlane et al., 1999 McPhee et a l , 2003  R  R  Table 3.2. Sequences of primers used in this study. Primer RTrpsL-F RTrpsL-R RTPA4773-F RTPA4773-R RTPA3552-F RTPA3552-R RTPA1249-F RTPA1249-R RTPA1343-F RTPA1343-R RTPA0921-F RTPA0921-R RTPA4782-F RTPA4782-R RTPA4359-F RTPA4359-R RTPA1559-F RTPA1559-R RToprH-F RToprH-R  Sequence (5' - 3') TGCGTAAGGTATGCCGTGTA CAGCACTACGCTGTGCTCTT GCAC C TGGCGATCCATAC CTGGGCGCCATCGAGTA CACTGGACTTTCTGCCATTCT TGTTCGAGCTCCTGGTTCTT TACGCCGTGGAAGTATGTCA GCGTCGACGAAGTGGATATT C CCTG A A C A C A A C A A T CAC C CCAGTAGGCGTAGTTGGAG ATTGGGAACAGTCGTTGCAG CGAATAGACCAGCAGGGAAC GTGTGGTCCTGGTGTTCCTT GAAACGCAGTGGCGAATC GCACCCTGAACACCCTCTAC AGGCTGAAGGTATCGACCAG GCGATTTCCTCGACACCTC GATGGTCGGGTTCTTCGAG CGAAGGCGGCTATCGTTAC AGAATTGCGAGCTGCTGTG  81  100 ug/ml and gentamicin, 50 ug/ml. Routine genetic manipulations were carried out according to standard molecular biology procedures (Maniatis, Fritsch et al. 1989). Identification of PhoP- and PmrA-binding sites. Sequence logos for the proposed PhoP binding sites upstream of the oprH-phoPQ and pmrH-ugd operons, as well as the proposed PmrA-binding sites upstream of the  VAAll'i-pmrB  and pmrH-ugd operons were first constructed using Weblogo. Frequency matrices were then constructed using the Emboss program, "Prophecy". These matrices were used to parse the P. aeruginosa genome for additional matching binding sites, using a conservative cut-off score of 0.82-0.85. Any sites that were present within an ORF, or in a promoter between convergent genes were excluded from further analysis based on the likelihood that these did not represent real promoters. Regulation of the putative target genes was then examined by semi-quantitative PCR (qPCR) in strains H103 (WT), H851 (phoP::xylE) and H988 (pmrA::xylE) in response to limiting M g . Genes identified as being regulated by PhoP and/or PmrA were then used to refine the binding motif and carry out a second iteration of frequency matrix construction and genomic searches for matching motifs. His6-PhoP and His6-PmrA purification. The constructs used to overexpress and purify the Ffis6-PmrA and His6-PhoP were created by P C R by amplifying the phoP or pmrA genes and cloning them separately into pET28a (Invitrogen, Carlsbad, C A ) as Ndel-BamHI fragments. The plasmids containing the Wse-phoP or Hiss-pmrA genes were transformed into E. coli BL21. Cells were grown to OD600 -0.5 before being induced with 1 m M IPTG for 3 hr. Cells were harvested and resuspended in sonication buffer containing 500 m M NaCl, 5 m M MgCh,  50 m M N a P 0 pH 7.8 and 10 m M 4  imidazole. Cells were lysed by sonication on ice (3 X 1 min). Cell debris and unbroken cells were removed by centrifugation at 7,500 X g. The supernatant was filtered through a 0.8 um 82  filter (Nalgene, Rochester, N Y ) .  The filtered supernatant was mixed with N i - N T A resin  (Qiagen, Mississauga, ON) and gently shaken at 23 °C for 1 hr. The resin was washed sequentially with 5-ml sonication buffer containing 30, 50, 100 or 200 m M imidizole. His6phoP was eluted with sonication buffer containing 300 m M imidazole and 15 % glycerol. Protein was collected on ice, aliquoted and frozen in a dry ice and ethanol bath. Frozen aliquots were stored at -80C. Purified proteins are shown in Fig. 3.4. Semi-quantitative PCR assays (qPCR). Total R N A was isolated using RNeasy mini columns (Qiagen, Mississauga, ON) from mid-log phase P. aeruginosa grown in BM2-glucose minimal media with 20 u M M g Mg . 2 +  2 +  or 2 m M  R N A samples were treated with DNase I (Invitrogen, Carlsbad, C A ) to remove  contaminating genomic DNA). Four jxg of total R N A was combined with 0.5 u M dNTPs, 500 U/ml SuperaseLN (Ambion, Austin, TX), 10 u M DTT, in I X reaction buffer and reverse transcribed for 1 hour at 37°C and 2 hr at 42°C with 10,000 U/ml Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). The R N A was subsequently destroyed by the addition of 170 m M NaOH and incubation at 65°C for 10 minutes. The reaction was then neutralized by addition of HC1 and the c D N A was used as a template for PCR. The number of cycles used to amplify each gene of interest was chosen to ensure that the PCR reaction was not saturated. A l l reactions were normalized to the rpsL gene encoding the 3OS ribosomal protein SI2. DNA-binding assays. These were done according to previously published methods (Haydel et a l , 2002). PCR-amplified promoter fragments of the entire intergenic region of the genes of interest were purified by excision from agarose gels using the Qiaquick column purification system (Qiagen, Mississauga, ON). These were DIG-labeled using a DIG gel shift kit ( 2 generation) from nd  Roche Applied Science. The purified protein (HisePhoP or HisePmrA) was mixed with 40 pg of  83  DIG-labeled  probe  in  buffer  consisting  of  20  m M 2-(4-(2-hydroxyethyl)-l-  piperazinyl)ethanesulfonic acid (HEPES), 1 m M E D T A , 10 m M ( N H ) S 0 , 1 m M DTT, 0.2% 4  2  4  Tween 20, 30 m M KC1 and 0.5 m M M g C ^ . For samples containing unlabelled probe, 100 ng of the probe was allowed to bind for 15 min at 20°C before adding DIG-labeled probe and incubating for another 20 min. A l l other samples were allowed to incubate for 20 min at 20°C before electrophoresis. Following electrophoresis, the sample were blotted to nylon membranes and exposed to film overnight at 23 °C. Growth assays. Overnight  cultures  of P. aeruginosa  PAOl  strain HI03  (WT) and HI032  (feoAv.luxCDABE) were grown in HEPES buffered minimal medium containing containing 20 m M glucose, 2 m M M g S 0 and 10 u M FeS0 . These were washed in sterile 0.85% NaCl and 4  diluted to OD600  =  0.2 in 0.85% NaCl.  4  Five ul of these cultures were added to 200 ul of  minimal medium containing high (2 mM) or low (20 uM) M g S 0 and 10 u M F e S 0 or FeCl3. 4  4  Media containing F e S 0 was also supplemented with 1 m M sodium ascorbate to maintain the 4  iron in the ferrous form and with 300 u M desferrioxamine mesylate to chelate any contaminating ferric ions. Similarly, media containing ferric iron was supplemented with 300 u M 2, 2, dipyridyl to chelate ferrous ions. The growth of the cultures at 37°C was monitored in a TEC A N Spectrofluor Plus by measuring the A620 every 20 min for 36 h. Growth experiments were carried out twice, with eight replicates per experiment. A representative example is shown in Figure 3.6. Motility assays. Swimming assays were performed by inoculating 1 ul of an overnight bacterial culture onto a BM2-glucose plate containing 0.3% agar. M g  2 +  was added to 2 m M for the high M g  2 +  media, while 200 u M E D T A was added for the M g -limiting media. Twitching assays were  84  carried out L B media containing 1% agar.  M g -replete conditions were created by  supplementing the media with 2 m M M g S C v Mg -deficient media was created by adding 200 2+  u M E D T A to the media. As with the swimming assays, 1 ul of an overnight culture was inoculated into the agar/plastic interface. After 24 hours of growth the agar was removed and the twitch zones were measured.  For swarming assays, brain-heart infusion broth (BHI)  containing 0.5% agar and either 2 m M M g S 0 or 200 u M E D T A were inoculated with 1 ul of 4  an overnight culture. After 24 hr the swarm zones were measured. RESULTS AND DISCUSSION Identification of putative PhoP-PhoQ and PmrA-PmrB regulated genes. As the PhoP-PhoQ and PmrA-PmrB systems both regulate transcriptional changes upon growth in limiting M g , and microarray experiments suggest that growth in limiting M g 2+  2 +  affects transcription of - 3 % of the genome (Bains and Hancock, unpublished), a bioinformatic search for novel target genes of the PhoP-PhoQ and PmrA-PmrB systems was undertaken. Putative binding sites for PhoP and PmrA were identified in previous studies (Macfarlane et al., 1999; McPhee et al., 2003). These sequences were used to generate frequency matrices with the Emboss program "Prophecy".  These matrices were then used to search the P. aeruginosa  genome sequence for sequences with high similarity to the PmrA or PhoP matrix. As new sequences were found and confirmed by q-PCR, they were incorporated into the matrix to provide a larger list of putatively regulated genes. A number of PmrA-like and PhoP-like sequences were identified suggesting that these genes may be regulated by either of these systems. The promoters identified via this analysis are shown in Table 3.3 (PhoP) and Table 3.4 (PmrA). Transcript levels of the candidate genes were examined in wild-type, phoPr.xylE and pmrA::xylE strains grown in minimal media under high (2 mM) and low (20 uM) M g conditions. Analysis of q-PCR results (Fig. 3.1) confirmed PmrA-dependent M g 85  2 +  2 +  regulation for  the feoAB (PA4359-8), PA4782 and PA1559-60 operons as well as the previously identified pmrH-ugd (PA3552-3559) and Y hAll!>-pmrAB operons. PhoP-dependent M g  2 +  regulation was  observed for PA0921 and PAI343, as well as for the previously identified oprH-phoPO and pmrH-ugd operons. Interestingly, the aprA gene encoding alkaline protease, was regulated by M g , although this regulation was not strongly dependent on PhoP or PmrA. This indicates that 2 +  there may be other, as yet unidentified regulators that are involved in the P. aeruginosa response to divalent cation limitation.  No M g - or PhoP-dependent regulation was observed for 2 +  PAI851, PA3925, PA0918, PA2775, or PA0297 (spuA) (data not shown). Similarly, no M g 2 +  or PmrA-dependent regulation of PA0327, PA0545, PA0053, PA4500, PA2505, PA2506, PA3868, PA4498, PA4499, or PA5106 was observed (data not shown). These results suggest that these genes are  Figure 3.1. PmrA- and PhoP-regulated genes as assessed by RT-PCR. Primers were designed to amplify a 100-150 bp fragment in the 5' region of each gene indicated. R N A was isolated from HI03 (wild-type), H851 (phoPr.xylE) and H988 (pmrA::xylE) under M g -limiting (-) and Mg -replete (+) conditions.  PA0921 oprH  PA1343 pmrH  2+  PA4773 PA4782 feoA  PA1559 aprA rpsL  Mg 2^  +  +  +  H103 (wt)  H851 AphoP  ApmrA  H988  86  Patterns of regulation detected by qPCR and results of gel-shift assays are also indicated. Positions that differ from the consensus are indicated with bold type. Abbreviations: N - A , C, G, or T; R - A or G T a b l e 3.3. PhoP-like promoters identified in this study.  Operon identified oprH-phoPphoQ pmrH-ugd PA1343 PA0921 PA4457-4461 PA1851 PA3925 PA0918 PA2775-2774 spuABCD (PA0297-0301)  Consensus  sequence  CGTTCAGNNNNNRTTCAG  regulated?  CGTTCAGCCCGGGTTCAG and CGTTCAGGGGCGGTTCAG CGTTCAGTCTTCATTCAG and CGTTCAGGCAGCATTCAG C G T T C A G 7 A A A T T G T T C A G and CGTTCAGGCCCGATTCAG CGTTCAGCGATGGTTCAG CGTTCAGCTTGGATTCAG CGTCCAGGCCTGTTTCAG CGTTCAGACCCTATCCAG CATTCAGGCTGGCTTCAG CCTTCACGGATGATTCAG CGTTGAGGCCGTTTTCAG  "Determined by q-RT-PCR not tested " - " signifies not tested, as no M g  PhoP-  Gel-  regulated?"  shift  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes  Yes No No No No No No  Yes _b -  Yes -  -  -  8  -  b  0  2 +  regulation could be demonstrated  9-1-  either not regulated by M g  and PhoP/PmrA at all, or their expression is co-dependent upon the  presence of a second regulatory signal (e.g. release from repression) that was not present under the conditions assayed. Examination of the sequence logos generated from these data (Fig 3.2 A and 3.2B) indicated that there was a higher level of plasticity within the PmrA-binding site than within the PhoP-binding site. It was also clear that both the PmrA and PhoP consensus sequences are quite strongly related to one another. Prokaryotic transcription factor binding sites are often direct or inverted repeats and consistent with this, the PhoP consensus sequence approximately consisted of two G T T C A G half sites separated by 5 nucleotides while the PmrA consensus was approximately two C T T A A G half-sites separated by five nucleotides. The PhoP consensus from Pseudomonas is quite different from that of Salmonella [(G/T)GTTTA(A/T) 87  Table 3.4. PmrA-like promoters identified in this study. Positions that differ from the consensus are indicated with bold type. Abbreviations: N - A , C, G, or T; S - C or G Consensus sequence NTTAASNNNNNCTTAAS  Operon identified pmrH-ugd VMllZ-pmrAB feoAB-?A4357 PA1559-1560 PA4782-4781 PA0327 algD-8-44-  TTTAAGCTTGGCTTCAG  regulated? Yes Yes Yes Yes Yes No  CTTAAGGTTTGCTTAAG  No  GTTAAGGGACAATTAAG TTTAAGCATGTCGCAAG  No No Yes No No No No No No No No  8  GTTAAGCGAGTCTTAAC GTTAAGCACCTCTTAAG CTTAAGCGAGCCTTAAG ATTAACGGTTCCTTAAG CTTAAGCGATCCCTAAG  KEGXLIGFA PA0545 PA0053 aprA (PA 1249) PA2050-2051 PA4500 PA2505 PA2506 PA3868 PA4498 PA4499 PA5106  TTTAAGTGCAGCTTAAT TTTAAGTGCAGCTTAAT TTTCAGCATGACTTAAT ATTAAGTGCGAGTTAAG CTTAACTCGCACTTAAT ATTAAGGCCTGCTCAAC TTTAAGCTCGACTTAAA TTTAAGTCGAGCTTAAA TTTACGCACCGCTTAAT  "Determined by q-RT-PCR not tested " - " signifies not tested, as no M g  PmrAregulated?" Yes Yes Yes Yes Yes  Gelshift Yes Yes Yes Yes ND  -  -  c  -  b  -  No  ND  -  -  -  -  -  -  b  -  _  b  c  2 +  regulation could be demonstrated  A)  i  i  r  a  ,  _ i r a  Figure 3.2. Weblogos generated from the conserved sequences identified in the promoters of the PhoP- and PmrA-regulated genes. (A) PhoP weblogo; (B) PmrA weblogo  B)  .ITJlc^CjTJi 88  (G/T)GTTTA(A/T)]  (Yamamoto, Ogasawara et al. 2002) while that for PmrA is almost  identical (C/T)YTTAA(G/T)-N -(C/T)YTTAA(G/T) (Aguirre, Lejona et al. 2000; Tamayo, 5  Ryan et al. 2002) Studies described in Chapter 2 indicated that two known PmrA-regulated genes, pmrH and PA4773 were also regulated by sub-inhibitory concentrations of cationic antimicrobial peptides. Here, these observations were extended to all of the genes that were confirmed to be PmrA-regulated in this study. In addition to PA4773 and pmrH, cationic antimicrobial peptides  Figure 3.3. Exposure to 2 ug/ml C P 1 1 C N causes induction of PmrA-dependent promoters. Primers were designed to amplify a 100-150 bp fragment in the 5' region of each gene indicated. R N A was isolated from HI03 (wild-type) in BM2-glucose medium supplemented with 2 m M MgS04 in the absence (-) or presence (+) of 2 ug/ml CP 1 I C N .  Figure 3.4. Purified His -tagged PmrA and PhoP from P. aeruginosa. Lane 1- His6-PmrA; Lane 2 - His6-PhoP; Lane 3 M W markers. 6  89  Figure 3.5. PhoP and PmrA bind to D. promoters that A. ppmrH contain PmrA poprH and/or PhoP motifs. Examples of results of gel PhoP PmrA PmrA PhoP shift assays are 1 2 3 4 5 7 8 displayed. All 1 2 3 4 5 6 7 B. E. lanes contain 40 pg pPA0921 pPA4773 of labeled probe prepared as described in Materials PhoP PmrA and Methods. A. 12 3 4 5 6 7 9 10 PhoP PmrA The entire inter1 2 3 4 5 6 7 9 10 genic region bepPA1343 tween napE pfeoA (PAI 177) and oprH (PAI 178) was amplified by PhoP PmrA PhoP PmrA PCR and end 5 ug His6-PhoP; lane labeled with DIG. Lane 1 - no protein; lane 2 - 2.5 jag His -PhoP; lane 3 4 - 5 ug His6-PhoP preincubated with 100 ng unlabeled probe; Lane 5 - no protein; lane 6 - 2.5 ug His6-PmrA; lane 7 - 5 ug His6-PmrA; lane 8 - 5 {xg His6-PmrA preincubated with 100 ng unlabeled probe; B . The entire intergenic region between PA0921 and PA0921 was used as a probe. Lane 1 - no protein; lane 2 - 2.5 jag His6-PhoP; lane 3 — 5 jxg His6-PhoP; lane 4 - 5 jag His6-PhoP preincubated with 100 ng unlabeled probe; Lane 5 - no protein; lane 6 - 2.5 jig His6PmrA; lane 7 - 5 jig His6-PmrA; lane 8 - 5 jig His6-PmrA preincubated with 100 ng unlabeled probe. C. The entire intergenic region between PAI343 and PAI343 was used as a probe. Lane 1- no protein; lane 2 - 1 . 2 5 jag His6-PhoP; lane 3 - 2.5 jag His6-PhoP; lane 4 - 5 jig His6-PhoP; lane 5 - 5 jig His6-PhoP preincubated with 100 ng unlabeled probe; Lane 6- no protein; lane 7 1.25 ug His6-PmrA; lane 8 - 2.5 ug His6- PmrA; lane 9 - 5 jig His - PmrA; lane 10 - 5 jig His6PmrA preincubated with 100 ng unlabeled probe. D . The entire intergenic region between algA (PA3551) and pmrH (PA3552) was used as a probe. Lane 1- no protein; lane 2 - 1.25 fig His6PhoP; lane 3 - 2.5 jig His6-PhoP; lane 4 - 5 jig His6-PhoP; lane 5 - 5 jag His6-PhoP preincubated with 100 ng unlabeled probe; Lane 6- no protein; lane 7 - 1 . 2 5 ug His6-PmrA; lane 8 - 2.5 ug His6- PmrA; lane 9 - 5 jag His6- PmrA; lane 1 0 - 5 jig His6- PmrA preincubated with 100 ng unlabeled probe. E. The entire intergenic region between PA4772 and PA4773 was used as a probe. Lane 1 - no protein; lane 2 - 2.5 jig His6-PhoP; lane 3 - 5 jig His6-PhoP; lane 4 - 5 jig His6-PhoP preincubated with 100 ng unlabeled probe; Lane 5 - no protein; lane 6 - 2.5 jig His6PmrA; lane 7 - 5 jig His6-PmrA; lane 8 - 5 jag His6-PmrA preincubated with 100 ng unlabeled probe. F. The entire intergenic region between PA4360 and PA4359 was used as a probe. Lane 1- no protein; lane 2 - 1.25 jag His6-PhoP; lane 3 - 2.5 jag His6-PhoP; lane 4 - 5 jag His6PhoP; lane 5 - 5 jag His6-PhoP preincubated with 100 ng unlabeled probe; Lane 6- no protein; lane 7 - 1.25 ug His6-PmrA; lane 8 - 2.5 jag His6- PmrA; lane 9 - 5 jig His6- PmrA; lane 1 0 - 5 jig His6- PmrA preincubated with 100 ng unlabeled probe. 1  2  3  4  5  6 7  6  6  90  also increased transcription of the PA4782,/eovl, and PA1559, genes containing PmrA-motifs (Fig. 3.3). This regulation strongly supports the hypothesis that the recognition site for the, as yet unknown, cationic antimicrobial peptide regulator overlaps that of the PmrA response regulator. Promoters identified in bioinformatic screens interact specifically with purified PhoP or PmrA. To further investigate the role of PhoP in the apparent PhoP-regulation of the PA0921, PAI 343, oprH-phoPQ, and pmrH-ugd operons, gel-mobility shift assays were performed using a PCR-amplified upstream intergenic region of these operons. When recombinant PhoP was incubated with the promoter upstream of the oprH,pmrH, PA0921, or PA1343 genes (Fig. 3.5), a D N A fragment with reduced mobility was observed. Similarly, mobility shift analysis of the putative PmrA-regulated promoters revealed that those upstream of the pmrH (Fig. 3.5), PA4773, PA1559, and feoA (Table 3.4) promoters were all bound by the PmrA protein, and this binding was specifically inhibited by an excess of unlabelled probe. Promoters regulated by PmrA did not interact with HisePhoP, nor did PhoP-regulated genes interact with His6PmrA, with the exception of that upstream of the pmrH-ugd operon, which is known to be regulated by both regulatory systems (McPhee, Lewenza et al. 2003).  When the PAI343 promoter was  mixed with His -PhoP, an insoluble precipitate formed that did not enter the gel at all (Fig. 6  3.5C).  These results indicate that the PhoP and PmrA systems of P. aeruginosa regulate  separate gene sets (with a single overlapping target operon) and that these gene sets independently respond to the M g  2 +  limitation signal. These results also indicate that, in contrast  to the situation in Salmonella, the PhoP-PhoQ and PmrA-PmrB systems of P. aeruginosa regulate a relatively small subset of the total number of Mg -limitation responsive genes. This 2+  observation, and the observation that the alkaline protease gene is regulated by neither PhoP nor  91  PmrA, indicates that there may be other, as yet unidentified, regulators contributing to the total Mg  2 +  stimulon.  Mutants in P. aeruginosa feoB are defective for growth with Fe as an iron source. 2+  It has been demonstrated that phoQ knockout mutants of P. aeruginosa are considerably less virulent in a mouse infection model and that PhoP-PhoQ regulates motility (Brinkman, Macfarlane et al. 2001). Therefore we examined selected Mg -limitation responsive genes for 2+  virulence related phenotypes.  Since this study demonstrated that PmrA and limiting M g  2 +  regulated the feoAB operon, the function of feoAB in iron-dependent growth was examined. FeoAB is a well conserved system that is involved in the transport of ferrous iron (Marlovits, Haase et al. 2002). While the function of the FeoA protein is currently unknown FeoB, a GTPrequiring G protein, has been well studied (Kammler, Schon et al. 1993; Boyer, Bergevin et al. 2002). Deletion of the GTP binding motif eliminates F e  2+  transport activity (Marlovits, Haase  et al. 2002). However due to the lack of similarity of E. coli FeoB to other known metal transporters, and the low rates of GDP/GTP binding and hydrolysis, it has been suggested, that FeoB may not act alone as a membrane-spanning F e  2+  transporter (Marlovits, Haase et al. 2002).  Previous studies have shown that feoB mutants of E. coli are defective for colonization and have decreased virulence in mouse models of infection (Kammler, Schon et al. 1993; Boyer, Bergevin et al. 2002), while Helicobacter pylori feoB mutants are also less virulent in mouse models (Velayudhan, Hughes et al. 2000). To investigate the role of P. aeruginosa FeoAB, growth studies were performed in media containing only F e  2+  or F e  3+  as the sole source of iron comparing a polar knockout mutant  in the feoA gene with an isogenic wild type strain (Fig. 3.6). These studies clearly demonstrated that the feoA mutant had a severe growth defect when F e showed no change in growth when F e  3+  2+  was provided as the iron source, but  was the sole iron source, consistent with analogous  observation made for H. pylori (Velayudhan, Hughes et al. 2000). This defect was apparent 92  under both M g -limiting and M g -replete conditions, but the phenotype was more pronounced when M g was limiting, as under these conditions growth was completely abrogated in the feoA mutant (Fig. 3.6). It is not yet clear whether P. aeruginosa utilizes F e  2+  or F e  3+  as its primary iron source  during infection . There is clear evidence for the presence of Fe -chelating siderophores like 3+  pyoverdine and pyochelin in the sputum of CF patients indicating that iron is limiting in the C F lung (Haas, Kraut et al. 1991).  Also mutants in Fe -siderophore uptake, especially ferri3+  pyoverdine, have somewhat reduced virulence in a number of model systems (Meyer, Neely et al. 1996; Takase, Nitanai et al. 2000). However pyoverdine deficient mutants have been found in the CF lung indicating that other iron-uptake systems may be functional in these bacteria (De Vos,DeChial etal. 2001).  Figure 3.6. Demonstrated involvement of feoAB in growth on ferrous iron. The growth of HI03 (wt) and HI025 (feoAv.luxCDABE) were measured under Mg -limiting and M g replete conditions with only F e or F e available as an iron-source. A ) Mg -replete conditions. B) Mg -limiting conditions. • , H103 + Fe ; o, H103 + F e ; • . H1025 + F e , •,H1025 + F e ; 2+  2 +  2+  3+  2+  2+  3+  2+  3+  2+  Time (hrs)  Recent results demonstrate that the thickened and dehydrated mucous in the CF lung has reduced oxygen tension and direct measurements of O2 concentrations within this layer indicate 93  that it approaches complete hypoxia (~5 mmHg), even though the p02 within the lung is normal (-200 mmHg) elsewhere in the CF lung (Worlitzsch, Tarran et al. 2002). Indeed P. aeruginosa is known to grow anaerobically in the CF lung (Yoon, Hennigan et al. 2002). This decreased oxygen tension would tend to stabilize iron in the F e  2+  state. Furthermore, the sputa from the CF  lung is noted for its higher than normal concentrations of ferritins, being up to 70-fold higher than observed in healthy individuals (Stites, Plautz et al. 1999; Reid, Withers et al. 2002), and CF individuals have 20 fold higher proportions of H-type ferritins, which are important for detoxifying F e  2+  ions, oxidizing them to F e  3+  before they are sequestered within the ferritin shell  (Harrison and Arosio 1996). In spite of this circumstantial evidence for the presence of F e  2+  in  the lung, little is known about the ratio of ferrous iron to ferric iron within the lung. This is due to the fact that assays for the presence of iron in the lung usually involve the chemical reduction of transferrin-bound iron making it impossible to determine the F e / F e ratio (Stites, Plautz et 2+  3+  al. 1999). In spite of this uncertainty, the results presented suggest that Pseudomonas aeruginosa in the mucous layer may utilize F e  2+  to satisfy their iron requirement for growth.  Consistent with this the P. aeruginosa multicopper oxidase, a ferroxidase that forms a crucial part of the ferrous iron uptake pathway, was detected in all of the 35 respiratory clinical isolates surveyed although considerable variation was observed in siderophore expression (Huston, Jennings et al. 2002; Huston, Potter et al. 2004). PA0921 plays a role in swimming motility. The PA0921 and PAI343 genes, shown here to be regulated by PhoP and Mg -limitation, 2+  encode small basic proteins that are unique to P. aeruginosa. Resistance to polymyxin B was unchanged in strains containing mutantions in these genes (data not shown). The PhoP-PhoQ system of P. aeruginosa has been shown to regulate swarming motility in Pseudomonas aeruginosa (Brinkman, Macfarlane et al. 2001).  Due to this link between Mg -status and 2+  motility, we examined the swimming, swarming, and twitching motility of a wild-type strain 94  and of a APA1343 (UW-44235 and a APA0921 (UW-47583) mutant to determine i f either of these genes was involved in regulating motility. A significant swimming defect was observed in the APA0921 mutant on swimming media when medium was supplemented with 2 m M MgSO"4, but only a marginal defect was observed under Mg -deficient conditions (Table 3.5). There 2+  were no significant differences observed with respect to swarming or twitching in either of these mutants, nor was there any motility defect in the APA1343 strain (Table 3.5). The reasons for the swimming defect in a APA0921 strain are not known, however, Western immunoblots on a wild-type strain and on the APA0921 strain showed no difference in flagellin production under either Mg -replete or Mg -limited conditions (data not shown), 2+  2+  indicating that the regulation may be due to a chemosensory defect, rather than down-regulation of flagellar components, as has been described for P. aeruginosa growth in CF mucin (Palmer, Mashburn et al. 2005). Table 3.5. Swimming, swarming, and twitching motility of P. aeruginosa strains grown on BM2-glucose medium supplemented with 2 m M M g S 0 (high M g ) or with 200 u M E D T A (low M g ) . Results shown are the average of 4-6 different measurements. 2+  4  2+  Phenotype  Strain  Phenotype  Swimming (mm)  UW-WT UW-47583 UW-44235  Wild-type APA0921 APA1343  Motility Zone (mm) High M g Low M g 23.4 ± 0 . 8 8.5 ± 0 . 4 16.9 ± 0 . 7 * 7.4 ± 0 . 3 * 25.4 ± 1.2 8.1 ± 0 . 4  Swarming (mm)  UW-WT UW-47583 UW-44235  Wild-type APA0921 APA1343  13.7 ± 3 . 2 15.4 ± 4 . 1 15.4 ± 4 . 6  13.8 ± 1.1 12.3 ± 3 . 5 14.1 ± 2 . 7  Twitching (mm)  UW-WT UW-47583 UW-44235  Wild-type APA0921 APA1343  20.0 ± 2 . 1 18.7 ± 1.5 18.9 ± 0 . 8  15.3 ± 4 . 3 16.1 ± 0 . 6 17.7 ± 1.6  2 +  - significantly different from WT-strain (Student's t-test, p < 0.05).  95  2 +  Little is known about the PA0921 protein. It is unique to P. aeruginosa, with no other homologues found in other bacterial genomes sequenced to date. It is predicted to be a small (12.8 kDa) protein with a slightly basic pi of 9.05. These properties bear some similarity to the PmrD protein of S. typhimurium (Kox, Wosten et al. 2000). This protein interacts with the PmrA protein, preventing its dephosphorylation by PmrB under non-inducing conditions (Winfield, Latifi et al. 2005). PSORT-b analysis suggested that the protein is localized to the cytoplasmic membrane (Gardy, Laird et al. 2005) with 4 transmembrane helices identified. In summary, this work has expanded the number of known targets of the PhoP-PhoQ and PmrA-PmrB two-component regulatory systems. In addition to the previously identified pmrHugd operon responsible for the addition of aminoarabinose to the Lipid A moiety of LPS, and the PA4773-pmrAB operon, we have shown that the PmrA-PmrB system also regulates three other operons. It regulates the PA1559-PA1560 operon, encoding two conserved hypothetical proteins, the feoAB operon, encoding a system involved in the uptake of Fe , and the PA4782 2+  gene. Interestingly, the PA4782 gene encodes a small protein of unidentified function that is just upstream of PA4781, an uncharacterized response regulator. This apparent regulation of a second two-component response regulator by PmrA-PmrB suggests that there may be hierarchical control over some, currently unknown, members of the M g  2 +  stimulon. While the  function of the PA4781 protein is unknown, it does contain a conserved H D - G Y P domain. This domain is proposed to be involved in cyclic-di-GMP turnover, a known regulator of diverse functions in P. aeruginosa, including biofilm formation, antibiotic resistance, and production of surface adhesins (D'Argenio, Calfee et al. 2002; Hoffman, D'Argenio et al. 2005; Meissner, Wild et al. 2005). This work has also demonstrated that all PmrA-regulated genes identified in this work were also regulated by exposure to sub-inhibitory concentrations of CP 1 I C N . The regulator responsible for this phenotype is currently unknown. This observation indicates that the PmrA 96  regulon may have evolved in such a way as to permit its stimulation in environments where Mg  2 +  limitation does not occur.  The observation of regulation by cationic antimicrobial  peptides is consistent with conditions that are found within the surface airway liquid of the lung, where M g  concentration is non-limiting (~2 mM) but there is a high concentration of cationic  host defence peptides, due to the inflammation and chronic neutrophil degranulation that characterize the CF lung.  97  REFERENCES Aguirre, A., Lejona, S., Vescovi, E . G. & Soncini, F. C. (2000). Phosphorylated PmrA interacts with the promoter region of ugd in Salmonella enterica serovar Typhimurium. J Bacteriol 182, 3874-3876. Bader, M . W., Sanowar, S., Daley, M . E., Schneider, A. R., Cho, U., Xu, W., Klevit, R. E., Le Moual, H . & Miller, S. I. (2005). Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122, 461-472. Boyer, E., Bergevin, I., Malo, D., Gros, P. & Cellier, M . F. (2002). Acquisition of Mn(II) in addition to Fe(II) is required for full virulence of Salmonella enterica serovar Typhimurium. Infect Immun 70, 6032-6042. Brinkman, F. S., Macfarlane, E . L., Warrener, P. & Hancock, R. E . W. (2001). Evolutionary relationships among virulence-associated histidine kinases. Infect Immun 69, 5207-5211. D'Argenio, D. A., Calfee, M . W., Rainey, P. B. & Pesci, E . C. (2002). Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J Bacteriol 184, 6481-6489. De Vos, D., De Chial, M., Cochez, C , Jansen, S., Tummler, B., Meyer, J. M . & Cornelis, P. (2001). Study of pyoverdine type and production by Pseudomonas aeruginosa isolated from cystic fibrosis patients: prevalence of type II pyoverdine isolates and accumulation of pyoverdine-negative mutations. Arch Microbiol 175, 384-388. Gardy, J. L., Laird, M . R., Chen, F., Rey, S., Walsh, C. J., Ester, M . & Brinkman, F. S. (2005). PSORTb v.2.0: expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. Bioinformatics 21, 617-623. Gunn, J. S., Ryan, S. S., Van Velkinburgh, J. C , Ernst, R. K. & Miller, S. I. (2000). Genetic and functional analysis of a PmrA-PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar Typhimurium. Infect Immun 68, 6139-6146. Guo, L., Lim, K. B., Poduje, C. M., Daniel, M., Gunn, J. S., Hackett, M . & Miller, S. I. (1998). Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides. Cell 95, 189-198. Haas, B., Kraut, J., Marks, J., Zanker, S. C. & Castignetti, D. (1991). Siderophore presence in sputa of cystic fibrosis patients. Infect Immun 59, 3997-4000. Harrison, P. M . & Arosio, P. (1996). The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1275, 161-203. Hoffman, L . R., D'Argenio, D. A., MacCoss, M . J., Zhang, Z., Jones, R. A. & Miller, S. I. (2005). Aminoglycoside antibiotics induce bacterial biofilm formation. Nature 436, 1171-1175. 98  Huston, W. M., Jennings, M . P. & McEwan, A. G. (2002). The multicopper oxidase of Pseudomonas aeruginosa is a ferroxidase with a central role in iron acquisition. Mol Microbiol 45, 1741-1750. Huston, W. M., Potter, A. J., Jennings, M . P., Rello, J., Hauser, A. R. & McEwan, A. G. (2004). Survey of ferroxidase expression and siderophore production in clinical isolates of Pseudomonas aeruginosa. J Clin Microbiol 42, 2806-2809. Jacobs, M . A., Alwood, A., Thaipisuttikul, I. & other authors (2003). Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Nad Acad Sci USA 100, 1433914344. Kammler, M., Schon, C. & Hantke, K. (1993). Characterization of the ferrous iron uptake system of Escherichia coli. J Bacteriol 175, 6212-6219. Kox, L. F., Wosten, M . M . & Groisman, E. A. (2000). A small protein that mediates the activation of a two-component system by another two-component system. EMBO J19, 18611872. Lesley, J. A. & Waldburger, C. D. (2001). Comparison of the Pseudomonas aeruginosa and E. coli PhoQ sensor domains: Evidence for distinct mechanisms of signal detection. J Biol Chem 12, 12. Lewenza, S., Falsafi, R. K., Winsor, G., Gooderham, W. J., McPhee, J. B., Brinkman, F. S. & Hancock, R. E . (2005). Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa P A O l : a tool for identifying differentially regulated genes. Genome Res 15, 583-589. Macfarlane, E. L., Kwasnicka, A., Ochs, M . M . & Hancock, R. E. W. (1999). PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outer-membrane protein OprH and polymyxin B resistance. Mol Microbiol 34, 305-316. Macfarlane, E. L., Kwasnicka, A. & Hancock, R. E. W. (2000). Role of Pseudomonas aeruginosaphoP-phoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology 146 (Pt 10), 2543-2554. Maniatis, T., Fritsch, E. & Sambrook, J. (1989). Molecular Cloning: A Laboratory Manual, 2 edn. Plainview, New York: Cold Spring Harbour Press. Marlovits, T. C , Haase, W., Herrmann, C , Aller, S. G. & Unger, V. M . (2002). The membrane protein FeoB contains an intramolecular G protein essential for Fe(II) uptake in bacteria. Proc Natl Acad Sci USA 99, 16243-16248. McPhee, J. B., Lewenza, S. & Hancock, R. E . W. (2003). Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 50, 205-217.  99  Meissner, A., Wild, V., Romling, U.ySimm, R., Rohde, M., Morr, R. & Haussler, S. (2005). Fimbria expression is regulated by the intracellular c-di-GMP level and determines the Pseudomonas aeruginosa phenotype. In Pseudomonas 2005. Marseille, France. Meyer, J. M., Neely, A., Stintzi, A., Georges, C. & Holder, I. A. (1996). Pyoverdin is essential for virulence of Pseudomonas aeruginosa. Infect Immun 64, 518-523. Miller, S. I., Kukral, A. M . & Mekalanos, J. J. (1989). A two-component regulatory system {phoP phoQ) controls Salmonella typhimurium virulence. Proc Natl Acad Sci USAS6, 50545058. Miller, S. I. & Mekalanos, J. J. (1990). Constitutive expression of the phoP regulon attenuates Salmonella virulence and survival within macrophages. J Bacteriol 172, 2485-2490. Moskowitz, S. M., Ernst, R. K. & Miller, S. I. (2004). PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and addition of aminoarabinose to lipid A . J Bacteriol 186, 575-579. Palmer, K. L., Mashburn, L . M., Singh, P. K. & Whiteley, M . (2005). Cystic fibrosis sputum supports growth and cues key aspects of Pseudomonas aeruginosa physiology. J Bacteriol 187, 5267-5277. Raj an, S. & Saiman, L . (2002). Pulmonary infections in patients with cystic fibrosis. Semin Respir Infect 17, 47-56. Reid, D. W., Withers, N. J., Francis, L., Wilson, J. W. & Kotsimbos, T. C. (2002). Iron deficiency in cystic fibrosis: relationship to lung disease severity and chronic Pseudomonas aeruginosa infection. Chest 121, 48-54. Rodrigue, A., Quentin, Y., Lazdunski, A., Mejean, V. & Foglino, M . (2000). Twocomponent systems in Pseudomonas aeruginosa: why so many? Trends Microbiol 8, 498-504. Stites, S. W., Plautz, M . W., Bailey, K., O'Brien-Ladner, A. R. & Wesselius, L . J. (1999). Increased concentrations of iron and isoferritins in the lower respiratory tract of patients with stable cystic fibrosis. Am J Respir Crit Care Med 160, 796-801. Stock, A. M., Robinson, V. L . & Goudreau, P. N. (2000). Two-component signal transduction. Annu Rev Biochem 69, 183-215. Stover, C. K., Pham, X. Q., Erwin, A. L . & other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406, 959-964. Takase, H., Nitanai, H., Hoshino, K. & Otani, T. (2000). Impact of siderophore production on Pseudomonas aeruginosa infections in immunosuppressed mice. Infect Immun 68, 1834-1839. Tamayo, R., Ryan, S. S., McCoy, A. J. & Gunn, J. S. (2002). Identification and genetic characterization of PmrA-regulated genes and genes involved in polymyxin B resistance in Salmonella enterica serovar Typhimurium. Infect Immun 70, 6770-6778. 100  Velayudhan, J., Hughes, N . J., McColm, A. A., Bagshaw, J., Clayton, C. L., Andrews, S. C. & Kelly, D. J. (2000). Iron acquisition and virulence in Helicobacter pylori: a major role for FeoB, a high-affinity ferrous iron transporter. Mol Microbiol 37, 274-286. Winfield, M . D., Latifi, T. & Groisman, E . A. (2005). Transcriptional regulation of the 4amino-4-deoxy-L-arabinose biosynthetic genes in Yersinia pestis. J Biol Chem 280, 1476514772. Worlitzsch, D., Tarran, R., Ulrich, M . & other authors (2002). Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109,317-325. Yamamoto, K., Ogasawara, H., Fujita, N . , Utsumi, R. & Ishihama, A. (2002). Novel mode of transcription regulation of divergently overlapping promoters by PhoP, the regulator of twocomponent system sensing external magnesium availability. Mol Microbiol 45, 423-438. Yoon, S. S., Hennigan, R. F., Hilliard, G. M . & other authors (2002). Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Dev Cell 3, 593-603.  101  C H A P T E R 4 - PxrRS of Pseudomonas aeruginosa 2 INTRODUCTION Pseudomonas aeruginosa  is an opportunistic Gram-negative bacterial  pathogen,  responsible for high infection rates in the immunocompromised and cystic fibrosis patients (Gibson, Burns et al. 2003; Park 2005).  This bacterium is also noted for its high intrinsic  resistance to a wide variety of antimicrobials due to a combination of a generally impermeable outer membrane and secondary resistance mechanisms including multi-drug efflux systems and inducible chromosomal P-lactamases (Hancock and Nikaido 1978; Poole and Srikumar 2001; Ciofu 2003). This combination of features has contributed to making P. aeruginosa one of the leading causes of nosocomial infections in Western society (Fagon, Chastre et al. 1993; Richards, Edwards et al. 1999). One of the most effective treatments in use is inhaled colistin, either alone or in combination with ciprofloxacin (Marchetti, Giglio et al. 2004). Colistin (polymyxin E) is a cationic lipopeptide produced by Bacillus polymyxa that has been used as an anti-Pseudomonal drug for over 40 years (Gordon and M . 1960). Polymyxins interact with the outer membrane of Gram-negative bacteria by binding to the Lipid A component of lipopolysaccharide, thereby displacing divalent cations that normally stabilize the outer membrane (Nicas and Hancock 1983; Hancock and Wong 1984; Moore, Chan et al. 1984; Moore, Bates et al. 1986). This selfpromoted uptake across the outer membrane gives the drug access to internal targets. Polymyxins kill bacteria rapidly and clinically significant levels of resistance have not yet emerged (Fish, Piscitelli et al. 1995; Littlewood, Koch et al. 2000; L i , Nation et al. 2005). Polymyxins share certain properties with a large class of natural antibiotics termed cationic  2  A version of this chapter will be submitted as McPhee, JB, Bains, M, and Hancock, REW. Identification and  characterization of PxrRS, a two-component regulatory system controlling susceptibility to polymyxin B and cationic antimicrobial peptides. Microbiology 102  antimicrobial peptides.  This class of compounds holds great potential as a novel class of  antibiotics, with wide-spectrum activity against Gram-positive and Gram-negative bacteria, enveloped viruses, and fungi (Brogden 2005; Jenssen 2005). Several highly active variants have been described and are in various stages of clinical and preclinical trials (Zhang and Falla 2004; Zhang, Parente et al. 2005). In P. aeruginosa, the PhoP-PhoQ and PmrA-PmrB systems regulate polymyxin and cationic antimicrobial peptides resistance in response to limiting concentrations of M g (Macfarlane, Kwasnicka et al. 2000; McPhee, Lewenza et al. 2003). This resistance occurs primarily via the coregulation of an LPS modification operon, pmrHFIJKLM-ugd  (PA3552-  PA3559), that encodes proteins that catalyze the addition of aminoarabinose to the 1 and 4' phosphates of Lipid A (McPhee, Lewenza et al. 2003; Moskowitz, Ernst et al. 2004). This modification reduces the negative charge normally found on Lipid A and is associated with cationic antimicrobial peptide and polymyxin B resistance (Zhou, Ribeiro et al. 2001; Moskowitz, Ernst et al. 2004). P. aeruginosa also undergoes an adaptive response to the presence of sub-inhibitory concentrations of cationic antimicrobial peptides and polymyxin B (Gilleland and Farley 1982; McPhee, Lewenza et al. 2003). pmrHFIJKLM-ugd  This response results in increased transcription of the  and PA4773-477'5-pmrAB operons when the cells are exposed to sub-  inhibitory concentrations of cationic antimicrobial peptides (McPhee, Lewenza et al. 2003). The adaptive response is independent of both PmrA-PmrB and PhoP-PhoQ, and presumably depends on an unknown regulator.  In an effort to identify novel regulatory systems that  contribute to polymyxin B and cationic antimicrobial peptide resistance, a panel of mutants in two-component response regulators was screened for an altered response to the presence of the sub-inhibitory cationic antimicrobial peptide, CP11CN. Through this approach we were able to identify a previously uncharacterized two-component regulatory system, named here PxrRS 103  (PA 1799-1798), which is responsible for intrinsic resistance to polymyxin B and cationic antimicrobial peptides in P. aeruginosa.  In addition to its role in polymyxin B resistance,  mutants in pxrR also have a loss of functional type IV pili, due to down-regulation of the fimUpilVWXYlY2E  operon. MATERIALS AND METHODS  Bacterial strains, plasmids and growth conditions. Bacterial strains and plasmids used in this study are described in Table 4.1. Sequences of primers used in this study are shown in Table 4.2. P. aeruginosa was routinely grown in B M 2 glucose minimal medium supplemented with 20 u M (low) or 2 m M (high) M g , containing 2 +  Table 4.1. Strains and plasmids used in this study.  Strain UW-WT 42767 10580 13144 39547 5552 44882 17142 4715 1772 43428 H103 P A O l lux 1 E7 P A O l lux 32 C12 P A O l lux 97 E3 PA01_lux_ll~ G4 Plasmid pUCP22 pUCpmrH. luxCDABE  pUCpxrR  Phenotype Wild-type P A O l strain ?A0756::lSphoA PA1798::IS/acZ PA1799:: ISlacZ ?A2479::lSphoA PA2523::IS/acZ PA2657y.lSphoA PA2809::IS/acZ PA3204::IS/acZ PA3205::IS/acZ PA4885::IS^/70v4  Wild-type P A O l strain htpG: AuxCDABE PA3523::luxCDABE PA3522::luxCDABE PA4065::luxCDABE Relevant characteristics E. coli-Pseudomonas shuttle vector Entire intergenic region between algA and pmrH cloned upstream of a luxCDABE cassette pxrR gene and promoter cloned into pUCP22 104  Reference (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Jacobs, Alwood et al. 2003) (Lewenza, Falsafi et al. 2005) (Lewenza, Falsafi et al. 2005) (Lewenza, Falsafi et al. 2005) (Lewenza, Falsafi et al. 2005) (Lewenza, Falsafi et al. 2005) (West, Schweizer et al. 1994) (McPhee, Lewenza et al. 2003)  This study  Table 4.2. Sequences of primers used in this study.  Primer RTrpsL-F RTrpsL-R RTPA4773-F RTPA4773-R RTPA3552-F RTPA3552-R RTpilV-F RTpilV-R PA1799-F PA1799-R  Sequence (5'-3') TGCGTAAGGTATGCCGTGTA CAGCACTACGCTGTGCTCTT GCACCTGGCGATCCATAC CTGGGCGCCATCGAGTA CACTGGACTTTCTGCCATTCT TGTTCGAGCTCCTGGTTCTT CTTCAGCATGATCGAAGTGC GCCTTGAAGAAGTCGGATTG GAATCAAGGGCATGCATTCTA CGTACCACCAGCAGGTTCTT  antibiotics at the following concentrations: carbenicillin, 200 |a.g/ml; gentamicin, 50 (ig/ml; tetracycline, 50 ixg/ml. Routine genetic manipulations were carried out according to Maniatis et al. (Maniatis, Fritsch et al. 1989). Luciferase assays. Briefly, 18 hr cultures of P. aeruginosa containing p\JCpmrH::luxCDABE ft  were diluted to ~5 X  9+  10 cfu/ml in BM2-glucose high M g  either in the presence or absence of 2 ug/ml CP11CN  (Friedrich, Moyles et al. 2000; McPhee, Lewenza et al. 2003). These cultures were incubated in a Tecan Spectrafluor Plus at 37°C with shaking. Luminescence measurements were taken using at 18 minute intervals throughout the growth of the bacteria in the same instrument. Semi-quantitative PCR assays (qPCR). Total R N A was isolated using RNeasy mini columns (Qiagen, Mississauga, ON) from midlogarithmic (OD600 -0.4-0.6) phase P. aeruginosa grown in BM2-glucose minimal media with 20 u M M g  2 +  or 2mM M g . R N A samples were treated with DNase I (Invitrogen, Carlsbad, 2 +  CA) to remove contaminating genomic D N A . Four jxg of total R N A was combined with 0.5 u M dNTPs, 500 U/ml SuperaseLN (Ambion, Austin, TX), 10 u M DTT, in I X reaction buffer and reverse transcribed for 1 hour at 37°C and 2 hr at 42°C with 10,000 U/ml Superscript II reverse 105  transcriptase (Invitrogen, Carlsbad, CA). The R N A was subsequently destroyed by the addition of NaOH to 170 m M and incubation at 65 °C for 10 minutes. The reaction was then neutralized by addition of HC1 and the c D N A was used as a template for PCR. The number of cycles used to amplify each gene of interest was chosen to ensure that the P C R reaction was not saturated via trial and error. A l l reactions were normalized to the rpsL gene encoding the 30S ribosomal protein SI2. Outer membrane permeability assays. P. aeruginosa cells were grown to mid-logarithmic phase (OD600-0.4-0.6) in BM2-glucose minimal media. Cells were washed then resuspended to OD600 in 5 m M HEPES buffer pH 7.0 containing 5 m M glucose and 5 m M K C N . The cells were incubated for 10 minutes. Two ml of cell suspension was added to a quartz cuvette and placed in a Perkin-Elmer L B 5 OB luminescence spectrometer. N P N (5 LLM) was then added to the cuvette containing the K C N treated P. aeruginosa cells. Fluorescence was monitored at an excitation wavelength of 350 nm and an emission wavelength of 420 nm. After the baseline stabilized, polymyxin B was added to the cell suspension at various concentrations and the fluorescence was monitored until it had stabilized. Motility assays. Swimming assays were performed by inoculating 1 ul of an overnight bacterial culture onto a BM2-glucose plate containing 2 m M M g  2 +  and 0.3% agar. Twitching assays were carried out on  L B media containing 1% agar. Inoculation was done with 1 ul of an overnight culture that was stabbed into the agar/plastic interface. After 24 hours of growth, the agar was removed and the twitch zones were measured. For swarming assays, brain-heart infusion broth (BHI) containing 0.5%o agar were inoculated with 1 ul of an overnight culture. After 24 hr the swarm zones were measured.  Results shown are the average''and "standard deviation of 4-6 independent  measurments. 106  Biofilm assays. Stationary phase cultures of UW-WT and pxrR: :ISlacZ were diluted to OD600 ~0.1 and 100 ul of this culture was added to a polystyrene microtitre dish. This was incubated at 37°C for 24 hours. The media was removed and the adherent cells were extensively washed with deionized water. The biofilm was then stained with 1% crystal violet for 10 minutes. The crystal violet was removed and the plate was extensively washed with deionized water. The biofilm was then solubilized by washing each well with 100 ul of ethanol.  This ethanol was removed and  quantitated by measuring the absorbance at 595 nm. R N A extraction, cDNA synthesis and hybridization to D N A microarrays Five biological samples each of Pseudomonas aeruginosa P A O l and pxrR::lSlacZ (Jacobs, Alwood et al. 2003) were grown overnight in BM2-glucose medium supplemented with 2 m M MgSCM in acid washed glassware. Cultures were diluted 1/100 into the fresh media and cells were harvested at mid-log phase, (OD600 0.5-0.6). R N A was prepared according to Qiagen RNeasy Midi R N A isolation kit according to the manufacturers instructions (Qiagen Inc., Canada). The isolated R N A was treated with DNA-free kit (Ambion Inc., Austin,TX, USA) to remove any contaminating genomic D N A . R N A was stored at -80°C with 0.2 units of SUPERase-In RNase Inhibitor (Ambion Inc., Austin, T X ) . R N A quality was assessed by running on 1% Agarose-Le gel (Ambion Inc., Austin, TX), as well as spectrophotometrically. Ten (ig of total R N A was treated using the Microbe Express kit with Pseudomonas module (Ambion) to remove ribosomal R N A via short magnetic-bead linked oligonucleotides that are specific for P. aeruginosa 16s and 23 s rRNA . Messenger R N A was reverse transcribed according to TIGR protocols (http://pfgrc.tigr.org/protocols/M007.pdf).  Briefly,  reverse  transcription reactions (20 uL) were combined with 42.5 ug/ml mRNA, 300 ng/ml random hexamers (Invitrogen, Mississauga, ON), 300 U/ml Superase In (Ambion, Austin, TX), 15 m M  107  DTT, and 20000 U/ml Superscript III (Invitrogen, Mississauga, ON).  Removal of  unincorporated aminoallyl-dUTP and free amines, labeling using Cy-dyes, removal of free dyes and analysis of labeling reaction was performed as in the TIGR Microbial R N A aminoallyl labeling for microarrays protocol, http://pfgrc.tigr.org/protocols/M007.pdf,  cDNA  from  pxrR::lSlacZ was labeled with cyanine-5 (GE Healthcare Canada) and all P A O l cDNA was labeled with cyanine-3 (GE Healthcare Canada).  Yield and fluorophore incorporation was  measured using a Lamda 35 UV/VIS fluorimeter (PerkinElemer Life and Analytical Sciences, Inc., USA). P. aeruginosa P A O l microarray slides were provided by The Institute of Genomic Research-Pathogenic  Functional  Genomics  Resource  Center  (http://pfgrc.tigr.org/).  Hybridization of labeled cDNA was done as per the protocol for TIGR hybridization of labeled D N A probes, http://pfgrc.tigr.org/protocols/M008.pdf. Two hundred pmoles of each cyanine labeled sample from P A O l and pxrR::lSlacZ cells were combined and hybridized to the array slides overnight at 42°C. Slides were scanned using the ScanArray™ Express scanner/software (Packard Bioscience BioChip Technologies) and quantified using ImaGene 6.0 Standard Edition software (BioDiscovery, Inc., E l Segundo, C A , USA). Analysis of D N A Microarrays Assessment of slide quality, data normalization, detection of differential gene expression and statistical analysis was carried out using ArrayPipe version 1.7, a web-based, semi-automated software specifically designed for processing of microarray data (Hokamp, Roche et al. 2004) with gene annotation from TIGR and linked with the Pseudomonas aeruginosa genome database (http://www.pseudomonas.com).  The following processing steps were applied:  flagging of markers and control spots; subgrid-wise background correction using the median of the lower 10% foreground intensity as an estimate for the background noise; data-shifting to rescue most of the negative spots; printTip LOESS normalization; merging of duplicate spots;  108  two-sided one-sample Student's t-test on the log2-ratios within each experiment; and finally, averaging of biological replicates to yield overall fold-changes for each treatment group. RESULTS Identification of PxrRS. Mutants in two-component response regulators were obtained from the University of Washington Genome Sequencing Center (Jacobs, Alwood et al. 2003). The plasmid pUCpmrH:.luxCDABE  was mobilized into these strains by electroporation. Luminescence of the  plasmid-containing strains was then measured in the presence and absence of 2 ug/ml CP 1 I C N . One strain, containing a transposon insertion in PAI 799 exhibited markedly lower luminescence in the presence of CP 1 I C N than either the isogenic parent strain, or any of the other response regulator mutants tested.  A sample of the screening results is shown in Fig. 4.1. Minimal  inhibitory concentrations to polymyxin B and CP 1 I C N were determined for UW-WT, PA1799:.TS/acZ and PA1798::IS/acZ using the broth microdilution method (Table 4.3). These results showed that mutants in PA 1798 and P A 1799 were consistently 2-4 fold more sensitive to polymyxin B than the wild type strain, regardless of M g  concentration in the growth medium.  When P A 1799 was provided on a plasmid to PA1799.\TS/acZ, the resistance to polymyxin B and CP 1 I C N was restored to wild-type levels or greater. Based on these observations, PAI799 and P A I 798 were named pxrR and pxrS, for polymyxin resistance regulator and sensor, respectively. PxrR mutants show increased sensitivity to cationic antimicrobial peptides. Killing assays were carried out with CP11CN on both pxrR: ASlacZ and an isogenic wild-type strain, as these assays are more sensitive that inhibition assays. Although MIC assays (Table 4.3) showed a sensitivity phenotype only for polymyxin B , killing assays showed that the pxrR.ASlacZ mutant was more sensitive to CP 1 I C N compared to an isogenic wild-type strain  109  (Fig. 4.2). In addition, complementation of the strain with pUCpxrR restored killing to wildtype levels, while providing pUCP22 (vector control) did not. 50  WT  APA0756  APA1799  APA2479  APA2809  APA2523  APA26S7  APA3204  APA3205  APA4885  Figure 4.1. Induction of apmrH::luxCDABE fusion in response to 2 ug/ml CP11CN in regulatory mutant strains. Strains containing transposon insertion mutations in the genes indicated were transformed with a plasmid containing a fusion between the pmrH promoter and a promoterless luxCDABE cassette. Luminescence was measured following 5 hours growth in the presence of 2 ug/ml CP11CN. The fold-change was calculated by normalizing to the luminescence of cells grown in the absence of CP11CN.  PxrR mutants show normal transcriptional response to CP11CN. To confirm the results of the initial screen, semi-quantitative RT-PCR (q-PCR) was conducted on wild-type and pxrR::lSlacZ mutants in the presence and absence of 2 (J,g/ml CP11CN. The pxrR::lSlacZ strain strain showed a transcriptional response to cationic antimicrobial peptides that was indistinguishable from that of the wild-type strain (Fig 4.3). Taken together with the killing assays it seems apparent that pxrRS pmrH::luxCDABE  mutants failed to demonstrate sustained  expression in the presence of CP11CN because the subinhibitory level of  CP11CN inhibited bacterial growth and A T P production required for luminescence, rather than causing specific loss of cationic peptide induced PA4773 and pmrH expression. PxrR mutants have normal outer membrane permeability.  110  To examine the basis of increased susceptibility, the outer membrane permeability of a pxrR::lSlacZ  mutant was assessed using the N P N uptake assay.  No differences in outer  membrane permeability induced by polymyxin B were observed between the strains (Fig. 4.4). P x r R mutants undergo adaptive resistance to polymyxin B following pre-exposure to cationic antimicrobial peptides.  Exposure to cationic antimicrobial peptides induces the pmrHFIJKLM-ugd and the PA4773PA4775 operons independently of the PhoP-PhoQ and PmrA-PmrB two-component regulatory systems (McPhee, Lewenza et al. 2003). This adaptive resistance leads to increased resistance to a subsequent exposure to polymyxin B (Fig. 2.7). In a similar fashion to the wild-type strain, when the pxrR::lSlacZ strain is grown in BM2-glucose medium in the presence of 2 ug/ml CP 1 I C N , specific induction of the PA4773 and pmrH genes was observed (Fig. 4.3). Additionally, both the U W - W T strain and the pxrR: :!SlacZ strain become adaptively resistant to a subsequent exposure to polymyxin B (Fig. 4.5). increased susceptibility of the pxrR:.ISlacZ  However, consistent with the observed  mutant to polymyxin B, even the adaptively  resistant pxrR::lSlacZ cells demonstrated approximately 10-fold reduced survival to 1 ug/ml polymyxin B compared to a similarly treated wild-type strain. M i c r o a r r a y analysis shows downregulation of several potential intrinsic cationic peptide resistance genes in  a pxrR::ISlacZ  mutant.  The somewhat surprising observation that a pxrR::\SlacZ  strain had normal responses to  subinhibitory concentrations of cationic antimicrobial peptides led to the hypothesis that there were other, novel genes involved in intrinsic resistance to this class of compounds. Microarray analysis indicated that PxrR regulated a number of heat shock proteins in P. aeruginosa (Table 4.4). These include the htpG, dnaK, PA3601-3600 ribosomal genes, and the ibpA gene, all of which have been described as encoding heat shock proteins in several other bacterial species. The DnaK protein has been directly implicated as a target of cationic antimicrobial peptides 111  (Kragol, Lovas et al. 2001), while both htpG and ibpA have been shown to affect protein aggregation and refolding in E. coli (Thomas and Baneyx 2000; Lethanh, Neubauer et al. 2005). Additionally, two efflux systems were observed to be downregulated in the pxrR:ASlacZ strain. One is an A B C transporter operon PA4063-PA4066 and the other is an R N D efflux-type transporter system, mexPQ-opmE (PA2523-PA2521). Downregulation of pili biosynthesis genes in pxrR mutant. Microarray  analysis  also  showed  that the pxrRrASlacZ  strain  exhibited significant  downregulation of an operon containing the fimUpilVWZYlY2E genes. This operon has been shown to be involved in type IV pili biosynthesis using a combination of transposon mutagenesis and some functional analysis (Aim, Hallinan et al. 1996; A i m and Mattick 1996; Jacobs, Alwood et al. 2003). In order to confirm this, the transcription of the first gene in the operon, pilV was examined via semi-quantitative RT-PCR (4.6A). This analysis confirmed the downregulation of the pilV gene observed in the microarray analysis. PxrR mutants are defective in pilin-dependent phenotypes. In order to further characterize the consequences of the strong down-regulation of the fimUpilVWZYl Y2E operon, a number of pili-dependent phenotype were examined. Twitching motility is characterized as the movement of bacteria over surfaces due to the progressive extension and retraction of type IV pili (Mattick 2002). This motility is strictly dependent upon the presence of functional type IV pili (Mattick 2002). In turn, twitching motility is required for the early stages of biofilm production, and pili deficient mutants are incapable of forming the robust biofilms that are characteristic of P. aeruginosa (O'Toole and Kolter 1998; Heydorn, Ersboll et al. 2002; Mattick 2002; Klausen, Heydorn et al. 2003). As shown in Fig. 4.6B and 4.6C, mutants in pxrR are completely deficient in both twitching motility and biofilm formation. In addition, the pxrR.ASlacZ mutant was completely resistant to the pilin-specific phage P04 (data not shown). 112  Table 4.3. Minimal inhibitory concentration (MIC) of cationic peptides and polymyxin B in BM2-glucose medium under 2 mM (high) and 20 uM (low) M g  2+  conditions.  Minimal inhibitory concentration (ug/ml) in BM2-glucose containing high (2 mM) or low (20 uM) M g Polymyxin B  CP10A  CP 1 I C N  2 +  Indolicidin  CEMA  high  low  high  low  high  low  high  low  UW-WT  2  8  64  8  >64  64  >64  >64  8  8  ApxrS  0.5  2  64  8  >64  64  >64  >64  8  4  ApxrR  0.5  4  64  16  >64  >64  >64  >64  8  4  ApxrR + pUCpxrR  4  16  64  64  >64  >64  >64  >64  8  16  H103  1  ND*  32  ND  ND  ND  ND  ND  4  ND  PA01_11_G4  1  ND  32  ND  ND  ND  ND  ND  4  ND  1  ND  32  ND  ND  ND  ND  ND  4  ND  1  ND  32  ND  ND  ND  ND  ND  4  ND  0.5  ND  32  ND  ND  ND  ND  ND  4  ND  [Mg ] /+  high  low  (PA4065::/wx) PA01_97_E3 imexPr.lux) PA01_32_C12 (mexQ::lux) PA01JE7 (htpGr.lux) *ND - not determined Figure 4.2. ApxrR mutants of P. aeruginosa have increased susceptibility to C P 1 1 C N . Killing curves were carried out using 8 ug/ml CP 1 I C N on cells grown to midlogarithmic phase in BM2-glucose medium supplemented with 2 m M M g S 0 . UW-WT, • ; xrR::lSlacZ, •; pxrR:.ISlacZ + pUCpxrR, •; ApxrR + pUCP22, • . 4  0.0001 -I  1  1  1  1  1  0  2  4  6  8  10  Time (min)  113  P  PA4773 pmrH rpsL CP11CN  + UW-WT  -  +  pxrR::ISlacZ  Figure 4.3. A pxrR::lSlacZ mutant show normal responses to the presence of subinhibitory concentrations of cationic antimicrobial peptides. UW-WT or pxrR::\SlacZ strains were grown to midlogarithmic phase in the presence or absence of 2 ug/ml of CP 1 I C N . Cells were harvested, R N A was extracted, and cDNA synthesized from the R N A . The relative levels of the PA4773 and pmrH mRNAs was then assessed by qPCR.  Figure 4.4. Mutants of pxrR have normal outer membrane permeability. Outer membrane permeability was measure using the N P N uptake assay. No significant differences were observed.  Figure 4.5. pxrR mutants undergo adaptive resistance following exposure to sub-MIC levels of cationic antimicrobial peptides. UW-WT and pxrR::lSlacZ strains were grown to mid-logarithmic phase in the presence or absence of 2 ng/ml CP 1 I C N . Cells were then harvested, washed, and resuspended in I X BM2 0.001 salts buffer. Killing was initiated by the 0.0001 addition of 1 ug/ml polymyxin B . Cells were removed and serial dilutions plated and counted to determine the percentage of cells that Time (min) survived the exposure. • - UW-WT cells preexposed to CP 1 I C N before the onset of killing; • - UW-WT cells without prexposure; o pxrR:.ISlacZ cells preexposed to CP11CN before the onset of killing • - pxrR:.ISlacZ cells without prexposure. 1000  114  T a b l e 4.4. Genes identified as being significantly regulated in a pxrR::ISlacZ m i c r o a r r a y analysis  PAID PA0527 PA0718 PA0781 PA 1596 PA 1922 PA2343 PA2862 PA3006 PA3126 PA3600 PA3601 PA3920 PA4063 PA4066 PA4528 PA4551 PA4552 PA4553 PA4554 PA4555 PA4556 PA4761 PA4836 PA4837 PA4919 PA5172 PA5173 PA5534 PA5535 PA5538  Gene name dnr  htpG  lipA psrA ibpA  pilD pilV pilW pilX pilYl pil2 -  pilE  ' dnaK  arcB arcC  ami A  Fold change 1.7. . -1.6 -1.8 -1.7 -2.2 -1.7 1.6 -1.7 -1.7 -2.1 -2.2 -4.7 -2.0 -1.9 -2.0 -1.8 -1.6 -1.5 -1.7 -1.6 -1.6 -2.2 -2.1 -1.6 -1.6 1.7 1.6 -2.1 -5.4 -1.7  Gene description transcriptional regulator Dnr hypothetical protein of bacteriophage Pfl hypothetical protein heat shock protein HtpG probable TonB-dependent receptor xylulose kinase lactonizing lipase precursor probable transcriptional regulator heat-shock protein IbpA ribosomal protein L36 ribosomal protein L31 probable metal transporting P-type ATPase hypothetical protein hypothetical protein type 4 prepilin peptidase PilD type 4 fimbrial biogenesis protein PilV type 4 fimbrial biogenesis protein PilW type 4 fimbrial biogenesis protein PilX type 4 fimbrial biogenesis protein PilY1 type 4 fimbrial biogenesis protein PilY2 type 4 fimbrial biogenesis protein PilE DnaK protein hypothetical protein probable outer membrane protein nicotinate phosphoribosyltransferase ornithine carbamoyltransferase, catabolic carbamate kinase hypothetical protein conserved hypothetical protein N-acetylmuramoyl-L-alanine amidase  115  mutant via  B. 2.5  A. pilV rpsL  c.  pxrR:: ISlacZ  ~ 20 E  pxrS:: ISlacZ  WT  pxrR:: ISlacZ  Figure 4.6. Mutants of pxrR exhibit pili-negative phenotypes. A . pxrR:.ISlacZ mutants have decreased expression of pilV, a gene involved in assembly of pili B. pxrR::\SlacZ mutants are defective for biofilm formation after 24 hours. C. Mutants in pxrR, but not pxrS, are defective for twitching.  DISCUSSION  Previous work in P. aeruginosa has demonstrated the existence of two separate twocomponent regulatory systems that contribute independently to polymyxin B and cationic antimicrobial peptide resistance in response to limiting concentrations of M g media.  in the growth  These systems, PhoP-PhoQ and PmrA-PmrB contribute to cationic peptide and  polymyxin B resistance through the regulation of two separate operons, PA4773-PA4775 and pmrHFIJKLM-ugd  (PA3552-PA3559) (Macfarlane, Kwasnicka et al. 1999; Macfarlane,  Kwasnicka et al. 2000; McPhee, Lewenza et al. 2003).  The pmrHFIJKLM-ugd  operon is  directly regulated by both the PmrA-PmrB and PhoP-PhoQ systems. It contributes to resistance via the addition of aminoarabinose to the 1 and 4' positions of lipid A , which results in the  116  neutralization of the negative charge on the lipid A , thereby decreasing the strength of the interaction between Lipid A and cationic antimicrobial peptides (Moskowitz, Ernst et al. 2004). The PA4773-PA4775 genes of the pmrAB operon also contribute to resistance via an as yet uncharacterized mechanism. In addition to this M g  regulation of cationic peptide resistance, work described in  Chapters 2 and 3 has also demonstrated that the presence of sub-inhibitory concentrations of cationic antimicrobial peptides causes increased transcription of the PmrA-dependent genes, including the PA4773 operon and the pmrHFIJKLM-ugd  operon, even in the presence of 2 m M  2+  Mg .  In contrast to the situation in Salmonella enterica sv Typhimurium, this cationic  antimicrobial peptide mediated regulation was largely independent of PhoP-PhoQ and was also independent of the PmrA-PmrB system, strongly supporting the existence of another regulatory system that specifically responds to the presence of cationic antimicrobial peptides (Bader, Navarre et al. 2003; McPhee, Lewenza et al. 2003; Bader, Sanowar et al. 2005). The initial screen carried out in this study was designed to identify this regulator by looking for a mutant that exhibited diminished response to the presence of sub-inhibitory concentrations of CP11CN.  A pxrR::lSlacZ  luminescence of a pmrH.-.luxCDABE  mutant showed only a 5-fold increase in  plasmid fusion following six hours of incubation,  compared with 30-40 fold induction in an isogenic parent strain. Interestingly, mutants in both pxrR and pxrS showed 4-fold lower MICs to polymyxin B than the isogenic parent strain, even in the absence of CP 1 I C N (Table 4.3). The strain also showed evidence of increased resistance under Mg -limiting conditions (i.e. PhoPQ and PmrAB regulated resistance), indicating that the 2+  mutation in pxrR did not interfere with Mg -signaling. The resistance of the pxrR mutant was 2+  restored to that of the wild-type strain when pxrR was overexpressed from a multi-copy plasmid. Altered MICs for pxrR and pxrS mutants were observed only for polymyxin B and no differences were observed in the M I C to indolicidin, the indolicidin variants CP10A or 117  CP11CN, or an a-helical cecropin-magainin hybrid, C E M A . However, overexpression of pxrR did lead to significant increases in resistance to CP10A and moderate increases to CP11CN 2"j_  under M g  limiting conditions.  Consistent with this, killing experiments confirmed that,  although pxrR mutants showed the same M I C as an isogenic parent strain, higher levels of killing were observed for the pxrR strain following treatment with 8 ug/ml CP11CN (Fig. 4.2). In spite of these changes, examination of the transcript levels of pmrH and PA4773 in CP1 lCN-treated cells did not show any significant differences between a pxrR:.ISlacZ strain and an isogenic wild-type strain. This result suggested that the defect in pxrR::\SlacZ mutant bacteria was not due to a direct regulatory effect on the pmrH promoter, but rather, may have been an indirect effect due to increased sensitivity to the treatment. In an effort to understand why pxrR::lSlacZ mutants were more sensitive to cationic antimicrobial peptides and polymyxin B , microarray experiments were conducted. Genes with significantly altered gene expression are indicated in Table 4.4. These experiments showed that a large number of heat-shock proteins, including dnaK, htpG, ibpA, and PA3601-3600, two small ribosomal proteins that have been shown to be heat-shock regulated in E. coli, were downregulated in a pxrR mutant.  This might indicate that either one of these proteins is the  direct target for cationic peptides or that the pxrRS mutants failed to initiate heat-shock repair/adaptation mechanisms in response to peptide-mediated damage. Several studies have suggested that some insect-derived cationic antimicrobial peptides may function by binding to both DnaK and GroES, two heat-shock systems that are responsible for the refolding of heat-damaged proteins (Otvos, O et al. 2000; Kragol, Lovas et al. 2001). The binding to DnaK occurs via a specific interaction between pyrrhocoricin, an antimicrobial peptide found in the haemolymph of the sap sucking aphid, Pyrrhocoris apterus (and presumably apidaecin and drosocin, peptides from the honeybee and fruit fly, respectively) 118  (Casteels, Ampe et al. 1989; Bulet, Dimarcq et al. 1993) and the lid region of DnaK (Otvos, O et al. 2000; Kragol, Lovas et al. 2001). This inhibition causes an increase in the level of misfolded intracellular proteins, leading to cell death. This interaction is stereospecific, and bacteria with mutations in the lid region of DnaK, are resistant to the action of pyrrhocoricin (Kragol, Hoffmann et al. 2002). These studies were among the first to suggest specific interactions between a cationic antimicrobial peptide and an intracellular target. Due to the observation of increased transcription of a number of heat-shock proteins, we examined the sensitivity of several heat shock protein mutants to polymyxin B. Our studies however, failed to demonstrate any link between the absence of htpG and polymyxin B sensitivity (Table 4.3). Neither was this strain, nor the pxrR::\SlacZ strain more sensitive to a 46°C heat shock than wild-type P A O l (data not shown). This result indicates that differences in sensitivity may only be seen after the loss of multiple heat-shock proteins, as has been previously described in E. coli (Thomas and Baneyx 1998; Thomas and Baneyx 2000). Efflux has been described as a resistance mechanism against cationic antimicrobial peptides in several bacterial species.  In Neisseria meningitidis, mutants in the mtrCDE  multidrug efflux system exhibit a 6-20 fold increase in susceptibility to protegrin, a cationic antimicrobial peptide of porcine neutrophils (Shafer, Qu et al. 1998). Recently, this system has also been shown to be involved in susceptibility to polymyxin B and the human host defense peptide, LL-37 (Tzeng, Ambrose et al. 2005). Similarly, in Staphylococcus aureus, mutants in the qacA gene are more sensitive to a small antimicrobial peptide from platelet microbicidal protein (Kupferwasser, Skurray et al. 1999).  The RosAB system in Yersinia sp. is a  potassium/drug antiporter system that increases resistance to polymyxin B (Bengoechea and Skurnik 2000). In spite of these examples, to date, no efflux systems involved in resistance to cationic antimicrobial peptides have been observed in P. aeruginosa.  119  The R N D family of  multidrug efflux systems has been well described in a wide number of bacterial species and P. aeruginosa has several RND efflux systems that are involved in resistance to aminoglycosides, P-lactams, quinolones, chloramphenicol, tetracycline, rifampicin, and a wide variety of other unrelated compounds (Poole 2004). In spite of the downregulation of the mexPQ-opmE efflux system observed in the pxrRr.lSlacZ strain, M I C assays did not demonstrate any difference between mutants in mexPQ-opmE and an isogenic wild-type strain (Table 4.3). In addition to the mexPQ-opmE RND efflux system, the PA4063-PA4066 operon was also observed to be downregulated in a pxrR: .ISlacZ strain. This operon contains homologs of proteins involved in the efflux of an endogenous lytic cationic peptide in Streptococcus pneumoniae  (Novak, Charpentier et al. 2000).  Again however, despite the observed  downregulation of PA4063-PA4066 in the pxrRr.lSlacZ mutant, no differences in MIC were observed between a PA4065 wluxCDABE mutant and an isogenic parent strain. In addition to the effects on polymyxin B resistance, mutants in pxrR were completely defective for functions requiring type IV pili. Type IV pili are polarly localized appendages that are involved in adherence to host epithelial cells (Aim, Hallinan et al. 1996), biofilm formation (O'Toole and Kolter 1998; Klausen, Heydorn et al. 2003), twitching motility (Mattick 2002) and sensitivity to phage P04 (Hobbs, Collie et al. 1993). Pili contribute to motility via extension and retraction over smooth surfaces.  The pilus is composed primarily of the PilA protein,  forming a helical fibre extending from a basal structure that is not yet well characterized. Pili extension and retraction occurs via regulation of pilin assembly and disassembly, likely catalyzed by the PilB, PilT, and PilU proteins (Turner, Lara et al. 1993; Merz, So et al. 2000; Graupner, Weger et al. 2001). A number of other proteins are also involved in pilus biogenesis, including PilQ, which forms the outer membrane pore (secretin) through which the assembled pilus in inserted (Bitter, Koster et al. 1998; Collins, Frye et al. 2005). A number of other  120  accessory proteins are involved in pilin assembly, including PilE, PilV, PilW, PilX, FimU and FimT (Russell and Darzins 1994; Aim, Hallinan et al. 1996; A i m and Mattick 1996). Microarray analysis demonstrated that the pxrR:.ISlacZ strain showed a reduction of expression of the flmUpilVWXYlY2E operon, and this was confirmed by measuring R N A for the pilV gene by q-PCR. Although little is known about this operon, the PilW and PilX proteins show similarities to proteins of the general secretion pathway from a number of Gram-negative bacteria (Aim, Hallinan et al. 1996). Briefly, they possess leader sequences similar to the prepilin-like class of proteins and are membrane localized. The P i l Y l and PilY2 proteins share similarity to the gonococcal PilC protein, which forms the tip of the pilus (Aim, Hallinan et al. 1996).  These similarities suggest that the  secretion and assembly of pilin monomers.  fimUpilVWXYlY2E  operon is involved in the  Additionally, transposon mutant screens have  demonstrated that mutants in each of the genes of this operon lead to a loss of twitching motility (Jacobs, Alwood et al. 2003). This work expands the number of known two-component regulators that contribute to polymyxin B and cationic antimicrobial peptide resistance in P. aeruginosa to three. Unlike the PhoP-PhoQ and PmrA-PmrB systems however, the PxrRS system appears to regulate resistance via a different mechanism than the alteration of expression of the pmrHFIJKLM-ugd PA4773-PA4775 operons. mutant.  and  These latter operons are normally regulated in a pxrRr.lSlacZ  Transcriptional profiling suggested possible reasons for this increased sensitivity  including downregulation of several intrinsic resistance mechanisms such as active efflux systems and heat-shock proteins.  121  REFERENCES Aim, R. A., Hallinan, J. P., Watson, A. A. & Mattick, J. S. (1996). Fimbrial biogenesis genes of Pseudomonas aeruginosa: pilW and pilX increase the similarity of type 4 fimbriae to the GSP protein-secretion systems and p i l Y l encodes a gonococcal PilC homologue. Mol Microbiol 22, 161-173. Aim, R. A. & Mattick, J. S. (1996). Identification of two genes with prepilin-like leader sequences involved in type 4 fimbrial biogenesis in Pseudomonas aeruginosa. JBacteriol 178, 3809-3817. Bader, M . W., Navarre, W. W., Shiau, W., Nikaido, H., Frye, J. G., McClelland, M., Fang, F. C. & Miller, S. I. (2003). Regulation of Salmonella typhimurium virulence gene expression by cationic antimicrobial peptides. Mol Microbiol 50, 219-230. Bader, M . W., Sanowar, S., Daley, M . E., Schneider, A. R., Cho, U., Xu, W., Klevit, R. E., Le Moual, H. & Miller, S. I. (2005). Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122, 461-472. Bengoechea, J. A. & Skurnik, M . (2000). Temperature-regulated efflux pump/potassium antiporter system mediates resistance to cationic antimicrobial peptides in Yersinia. Mol Microbiol 37, 67-80. Bitter, W., Koster, M., Latijnhouwers, M., de Cock, H. & Tommassen, J. (1998). Formation of oligomeric rings by XcpQ and PilQ, which are involved in protein transport across the outer membrane of Pseudomonas aeruginosa. Mol Microbiol 27, 209-219. Brogden, K. A. (2005). Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol 3, 238-250. Bulet, P., Dimarcq, J. L., Hetru, C , Lagueux, M., Charlet, M., Hegy, G., Van Dorsselaer, A. & Hoffmann, J. A. (1993). A novel inducible antibacterial peptide of Drosophila carries an O-glycosylated substitution. J Biol Chem 268, 14893-14897. Casteels, P., Ampe, C , Jacobs, F., Vaeck, M . & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. Embo J8, 2387-2391. Ciofu, O. (2003). Pseudomonas aeruginosa chromosomal beta-lactamase in patients with cystic fibrosis and chronic lung infection. Mechanism of antibiotic resistance and target of the humoral immune response. APMIS Suppl, 1-47. Collins, R. F., Frye, S. A., Balasingham, S., Ford, R. C , Tonjum, T. & Derrick, J. P. (2005). Interaction with type IV pili induces structural changes in the bacterial outer membrane secretin PilQ. J Biol Chem 280, 18923-18930. Fagon, J. Y., Chastre, J., Hance, A. J., Montravers, P., Novara, A. & Gibert, C. (1993). Nosocomial pneumonia in ventilated patients: a cohort study evaluating attributable mortality and hospital stay. Am J Med 94, 281-288. 122  Fish, D. N., Piscitelli, S. C. & Danziger, L . H. (1995). Development of resistance during antimicrobial therapy: a review of antibiotic classes and patient characteristics in 173 studies. Pharmacotherapy 15, 279-291. Friedrich, C. L., Moyles, D., Beveridge, T. J. & Hancock, R. E . W. (2000). Antibacterial action of structurally diverse cationic peptides on gram-positive bacteria. Antimicrob Agents Chemother 44, 2086-2092. Gibson, R. L., Burns, J. L . & Ramsey, B. W. (2003). Pathophysiology and management of pulmonary infections in cystic fibrosis. Am J Respir Crit Care Med 168, 918-951. Gilleland, H . E., Jr. & Farley, L. B. (1982). Adaptive resistance to polymyxin in Pseudomonas aeruginosa due to an outer membrane impermeability mechanism. Can J Microbiol 28, 830-840. Gordon, D. M . & M., M . J. (1960). Colistin in Pseudomonas infection. Report of a successfully treated case. Am J Ophthalmol 50, 33-35. Graupner, S., Weger, N., Sohni, M . & Wackernagel, W. (2001). Requirement of novel competence genes pilT and pilU of Pseudomonas stutzeri for natural transformation and suppression of pilT deficiency by a hexahistidine tag on the type IV pilus protein PilAI. J Bacteriol 183, 4694-4701. Hancock, R. E . W. & Wong, P. G. (1984). Compounds which increase the permeability of the Pseudomonas aeruginosa outer membrane. Antimicrob Agents Chemother 26, 48-52. Hancock, R. E . W. & Nikaido, H. (1978). Outer membranes of gram-negative bacteria. X I X . Isolation from Pseudomonas aeruginosa P A O l and use in reconstitution and definition of the permeability barrier. J Bacteriol 136, 381-390. Heydorn, A., Ersboll, B., Kato, J., Hentzer, M., Parsek, M . R., Tolker-Nielsen, T., Givskov, M . & Molin, S. (2002). Statistical analysis of Pseudomonas aeruginosa biofilm development: impact of mutations in genes involved in twitching motility, cell-to-cell signaling, and stationary-phase sigma factor expression. Appl Environ Microbiol 68, 2008-2017. Hobbs, M., Collie, E . S., Free, P. D., Livingston, S. P. & Mattick, J. S. (1993). PilS and PilR, a two-component transcriptional regulatory system controlling expression of type 4 fimbriae in Pseudomonas aeruginosa. Mol Microbiol 7, 669-682. Hokamp, K., Roche, F. M., Acab, M . & other authors (2004). ArrayPipe: a flexible processing pipeline for microarray data. Nucleic Acids Res 32, W457-459. Jacobs, M . A., Alwood, A., Thaipisuttikul, I. & other authors (2003). Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci USA 100, 1433914344. Jenssen, H . (2005). Anti herpes simplex virus activity of lactoferrin/lactoferricin - an example of antiviral activity of antimicrobial protein/peptide. Cell Mol Life Sci. 123  Klausen, M . , Heydorn, A., Ragas, P., Lambertsen, L., Aaes-Jorgensen, A., Molin, S. & Tolker-Nielsen, T. (2003). Biofilm formation by Pseudomonas aeruginosa wild type, flagella and type IV pili mutants. Mol Microbiol 48, 1511-1524. Kragol, G., Lovas, S., Varadi, G., Condie, B. A., Hoffmann, R. & Otvos, L., Jr. (2001). The antibacterial peptide pyrrhocoricin inhibits the ATPase actions of DnaK and prevents chaperone-assisted protein folding. Biochemistry 40, 3016-3026. Kragol, G., Hoffmann, R., Chattergoon, M . A. & other authors (2002). Identification of crucial residues for the antibacterial activity of the proline-rich peptide, pyrrhocoricin. Eur J Biochem 269, 4226-4237. Kupferwasser, L. I., Skurray, R. A., Brown, M . H., Firth, N., Yeaman, M . R. & Bayer, A. S. (1999). Plasmid-mediated resistance to thrombin-induced platelet microbicidal protein in staphylococci: role of the qacA locus. Antimicrob Agents Chemother 43, 2395-2399. Lethanh, H., Neubauer, P. & Hoffmann, F. (2005). The small heat-shock proteins IbpA and IbpB reduce the stress load of recombinant Escherichia coli and delay degradation of inclusion bodies. Microb Cell Fact 4, 6. Lewenza, S., Falsafi, R. K., Winsor, G., Gooderham, W. J., McPhee, J. B., Brinkman, F. S. & Hancock, R. E. (2005). Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa P A O l : a tool for identifying differentially regulated genes. Genome Res 15, 583-589. Li, J., Nation, R. L., Milne, R. W., Turnidge, J. D. & Coulthard, K. (2005). Evaluation of colistin as an agent against multi-resistant Gram-negative bacteria. Int J Antimicrob Agents 25, 11-25. Littlewood, J. M., Koch, C , Lambert, P. A., Hoiby, N., Elborn, J. S., Conway, S. P., Dinwiddie, R. & Duncan-Skingle, F. (2000). A ten year review of colomycin. Respir Med 94, 632-640. Macfarlane, E. L., Kwasnicka, A., Ochs, M . M . & Hancock, R. E. W. (1999). PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outer-membrane protein OprH and polymyxin B resistance. Mol Microbiol 34, 305-316. Macfarlane, E. L., Kwasnicka, A. & Hancock, R. E. W. (2000). Role of Pseudomonas aeruginosa PhoP-phoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology 146 (Pt 10), 2543-2554. Maniatis, T., Fritsch, E. & Sambrook, J. (1989). Molecular Cloning: A Laboratory Manual, 2 edn. Plainview, New York: Cold Spring Harbour Press. Marchetti, F., Giglio, L., Candusso, M., Faraguna, D. & Assael, B. M . (2004). Early antibiotic treatment of Pseudomonas aeruginosa colonisation in cystic fibrosis: a critical review of the literature. Eur J Clin Pharmacol 60, 67-74. Mattick, J. S. (2002). Type IV pili and twitching motility. Annu Rev Microbiol 56, 289-314. 124  McPhee, J. B., Lewenza, S. & Hancock, R. E. W. (2003). Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 50, 205-217. Merz, A. J., So, M . & Sheetz, M . P. (2000). Pilus retraction powers bacterial twitching motility. Nature 407, 98-102. Moore, R. A., Chan, L. & Hancock, R. E . W. (1984). Evidence for two distinct mechanisms of resistance to polymyxin B in Pseudomonas aeruginosa. Antimicrob Agents Chemother 26, 539-545. Moore, R. A., Bates, N. C. & Hancock, R. E. W. (1986). Interaction of polycationic antibiotics with Pseudomonas aeruginosa lipopolysaccharide and lipid A studied by using dansyl-polymyxin. Antimicrob Agents Chemother 29, 496-500. Moskowitz, S. M., Ernst, R. K. & Miller, S. I. (2004). PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and addition of aminoarabinose to lipid A . JBacteriol 186, 575-579. Nicas, T. I. & Hancock, R. E . W. (1983). Alteration of susceptibility to E D T A , polymyxin B and gentamicin in Pseudomonas aeruginosa by divalent cation regulation of outer membrane protein H I . JGen Microbiol 129 (Pt 2), 509-517. Novak, R., Charpentier, E., Braun, J. S. & Tuomanen, E. (2000). Signal transduction by a death signal peptide: uncovering the mechanism of bacterial killing by penicillin. Mol Cell 5, 49-57. O'Toole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295-304. Otvos, L., Jr., O, I., Rogers, M . E., Consolvo, P. J., Condie, B. A., Lovas, S., Bulet, P. & Blaszczyk-Thurin, M . (2000). Interaction between heat shock proteins and antimicrobial peptides. Biochemistry 39, 14150-14159. Park, D. R. (2005). The microbiology of ventilator-associated pneumonia. Respir Care 50, 742763; discussion 763-745. Poole, K. & Srikumar, R. (2001). Multidrug efflux in Pseudomonas aeruginosa: components, mechanisms and clinical significance. Curr Top Med Chem 1, 59-71. Poole, K. (2004). Efflux-mediated multiresistance in Gram-negative bacteria. Clin Microbiol Infect 10, 12-26. Richards, M . J., Edwards, J. R., Culver, D. H . & Gaynes, R. P. (1999). Nosocomial infections in medical intensive care units in the United States. National Nosocomial Infections Surveillance System. Crit Care Med 21, 887-892. 125  Russell, M . A. & Darzins, A. (1994). The pilE gene product of Pseudomonas aeruginosa, required for pilus biogenesis, shares amino acid sequence identity with the N-termini of type 4 prepilin proteins. Mol Microbiol 13, 973-985. Shafer, W. M., Qu, X., Waring, A. J. & Lehrer, R. I. (1998). Modulation of Neisseria gonorrhoeae susceptibility to vertebrate antibacterial peptides due to a member of the resistance/nodulation/division efflux pump family. Proc Natl Acad Sci USA 95, 1829-1833. Thomas, J. G. & Baneyx, F. (1998). Roles of the Escherichia coli small heat shock proteins IbpA and IbpB in thermal stress management: comparison with ClpA, ClpB, and HtpG In vivo. J Bacteriol 180, 5165-5172. Thomas, J. G. & Baneyx, F. (2000). ClpB and HtpG facilitate de novo protein folding in stressed Escherichia coli cells. Mol Microbiol 36, 1360-1370. Turner, L . R., Lara, J. C , Nunn, D. N. & Lory, S. (1993). Mutations in the consensus ATPbinding sites of XcpR and PilB eliminate extracellular protein secretion and pilus biogenesis in Pseudomonas aeruginosa. J Bacteriol 175, 4962-4969. Tzeng, Y. L., Ambrose, K. D., Zughaier, S., Zhou, X., Miller, Y. K., Shafer, W. M . & Stephens, D. S. (2005). Cationic antimicrobial peptide resistance in Neisseria meningitidis. J Bacteriol 187, 5387-5396. West, S. E., Schweizer, H . P., Dall, C , Sample, A. K. & Runyen-Janecky, L. J. (1994). Construction of improved Escherichia-Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene 148, 81-86. Zhang, L. & Falla, T. J. (2004). Cationic antimicrobial peptides - an update. Expert Opin Investig Drugs 13, 97-106. Zhang, L., Parente, J., Harris, S. M., Woods, D. E., Hancock, R. E . & Falla, T. J. (2005). Antimicrobial peptide therapeutics for cystic fibrosis. Antimicrob Agents Chemother 49, 29212927. Zhou, Z., Ribeiro, A. A., Lin, S., Cotter, R. J., Miller, S. I. & Raetz, C. R. (2001). Lipid A modifications in polymyxin-resistant Salmonella typhimurium: PmrA-dependent 4-amino-4deoxy-L-arabinose, and phosphoethanolamine incorporation. JBiol Chem 276, 43111-43121.  126  Chapter 5 - Concluding remarks Introduction The rise of antibiotic resistance will be one of the greatest challenges facing the medical profession for the foreseeable future.  The introduction of antibiotics into general clinical  practice has resulted in the greatest increase to average life expectancy since the introduction of improved public sanitation in the late 19 century . However, since the very first introduction th  of antimicrobial chemotherapy in the 1940s, bacteria that are resistant to those antimicrobials have appeared, usually within only a few years of the introduction of said drug into the clinic. This trend can result in rates of resistance that approach 50-90% of isolates, rendering the drug essentially useless for therapy. resistant Staphylococcus  Indeed, the increased rates of appearance of methicillin  aureus and vancomycin-resistant  Enterococcus  are particularly  troubling public-health problems, as these infections are difficult to eradicate (Menichetti 2005; Zetola, Francis et al. 2005). The problem of increasing antibiotic resistance is compounded by the lack of research and development of new antimicrobial therapies (Shah 2005).  Only two novel classes of  antibiotics have been introduced since the 1960s; these being the oxazolinidones, of which linezolid represents the fist approved example and the lipopeptide daptomycin (Strahilevitz and Rubinstein 2002; Carpenter and Chambers 2004).  These antibiotics have broad spectrum  activity against Gram-positive bacteria, and their use is generally limited to treatment of multidrug resistant infections, serving as a drug of last resort for these infections (Kauffman 2003; Cunha 2005). In spite of linezolid's novel mechanism of action, resistant strains have already emerged, indicating the continuing need for novel antibiotics (Mutnick, Enne et al. 2003). Cationic antimicrobial peptides represent a potentially new class of antibiotics. These peptides seem to have several natural advantages as antibiotics, they kill rapidly and do not easily engender resistance and they have broad-spectrum activity against Gram-negative and 127  Gram-positive bacteria, fungi, and enveloped viruses. Although there has been a great deal of research on cationic antimicrobial peptides in the last 15 years, to date the promise of antimicrobial peptides as therapeutic agents has been hampered by difficulties in bringing them through clinical trials (Zhang and Falla 2004; McPhee and Hancock 2005). One of the leading causes of nosocomial and other opportunistic infections is the Gramnegative bacterium Pseudomonas aeruginosa (Fagon, Chastre et al. 1993; Richards, Edwards et al. 1999). This bacterium is noted for its environmental ubiquity, its intrinsic resistance to many antibiotics, and its high metabolic diversity. This diversity is a consequence of a large genome size (6.3 Mb) with many metabolic and transport gene, and the large proportion of this genome that is devoted to gene regulation (Stover, Pham et al. 2000).  Of the 5570 ORFs in the  annotated P. aeruginosa genome, 592 are involved in transcriptional regulation, including 123 two-component response regulatory proteins (Stover, Pham et al. 2000).  Of these two-  component systems, the majority remain uncharacterized. It has long been known that growth in medium depleted of divalent cations leads to increased resistance to polymyxin B (Brown and Melling 1969; Brown and Melling 1969). This has been observed in a large number of bacterial species, including Salmonella, P. aeruginosa, E. coli, Yersinia, Photorhabdus, Meningococcus, and Erwinia (Guo, L i m et al. 1997; LlamaPalacios, Lopez-Solanilla et al. 2003; Derzelle, Turlin et al. 2004; Newcombe, Jeynes et al. 2005).  Although the best characterized two component regulatory systems that influence  cationic peptide/polymyxin resistance, namely the PhoP-PhoQ and PmrA-PmrB systems are those studied in Salmonella, it is a mistake to assume that they are identical in every species examined. In fact, while there are similarities, the way in which signals from these systems are integrated differs in every species examined (McPhee, Lewenza et al. 2003; Winfield, Latifi et al. 2005).  In fact, even between 5". Typhimurium and E. coli species examined, there is  128  significant heterogeneity in the way in which these systems work (Winfield and Groisman 2004). PhoP-PhoQ of P. aeruginosa In P. aeruginosa, mutants generated by chemical mutagenesis were isolated that showed constitutive resistance to E D T A , polymyxin B and aminoglycosides (Nicas and Hancock 1980). These mutants also showed constitutive expression of an outer membrane protein, OprH and lower concentrations of divalent cations in the cell envelope than wild-type strains.  These  results suggested that OprH was involved in polymyxin B resistance. However, in 1999, the PhoP-PhoQ two-component regulatory system of P. aeruginosa was identified, located just downstream of the oprH gene, forming an operon with it (Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000).  Interestingly, interposon mutants in phoP showed a  complete loss of OprH expression under both Mg -replete and Mg -limiting conditions, but 2+  2+  resistance to cationic antimicrobial peptides was unaffected in limiting M g  2 +  (Macfarlane,  Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000). Mutants of PhoQ on the other hand demonstrated constitutive expression of OprH and constitutive resistance to polymyxin B and cationic antimicrobial peptides (Macfarlane, Kwasnicka et al. 1999; Macfarlane, Kwasnicka et al. 2000). These results strongly suggested that the PhoP-PhoQ system was solely responsible for regulating OprH expression, but that another unidentified regulatory system contributed to 2"r" •  the M g -induced polymyxin B and cationic peptide resistance in P. aeruginosa.  It was  hypothesized that this unidentified regulatory system would be regulated by M g , would 2 +  interact somehow with the PhoP-PhoQ regulatory system, and would be involved in resistance to polymyxin B. PmrA-PmrB of P. aeruginosa. Chapter 2 of this work describes the identification of the PmrA-PmrB system of P. aeruginosa. This regulatory system has all of the characteristics that were predicted in that it is 129  Mg  z +  regulated, is upregulated in PhoQ mutants, and is involved in regulating polymyxin B  resistance.  The PmrA-PmrB system has been well-described in S. Typhimurium.  In  Salmonella, the PmrA-PmrB system lies in a regulatory hierarchy beneath the PhoP-PhoQ system (Fig 1.3). In S. Typhimurium, in the absence of the PhoP-PhoQ system, there is no divalent cation or cationic antimicrobial peptide induced response (Bader, Navarre et al. 2003; Bader, Sanowar et al. 2005). This occurs because a small PhoP-regulated protein, PmrD, is strictly required for signal transduction from the PhoP-PhoQ system of Salmonella, to the PmrA-PmrB system. In turn, the PmrA-PmrB system is directly responsible for the regulation of the pmrHFIJKLM  operon, which catalyzes the addition of aminoarabinose to Lipid A ,  leading to polymyxin B resistance (Fig. 5.2). It is clear from results in P. aeruginosa, that while there are many similarities to the S. Typhimurium system, there are also many distinct differences.  One of the most prominent  2+  differences is that the PhoP protein is dispensible for M g  induced polymyxin B resistance.  This occurs, in part, because the PmrA-PmrB regulatory system also responds to limiting divalent cation concentrations, independently of the PhoP-PhoQ system.  Signals from both  systems lead to increased transcription of the P. aeruginosa pmrHFIJKLM-ugd both systems are required for maximal transcription of the pmrHFIJKLM-ugd can be deleted and some M g  2 +  operon. While  operon, either one  induced transcription still occurs via the remaining system,  leading to increased resistance. This work also implicated the three genes preceeding the pmrA-pmrB genes in resistance to cationic antimicrobial peptides.  Knockouts of PA4773, PA4774, and PA4775 all showed  altered sensitivity to cationic antimicrobial peptides and polymyxin B .  Furthermore, the  patterns of resistance are dramatically different from those of pmrHFIJKLM-ugd mutants. Mutants in pmrHFIJKLM-ugd  knockout  were exquisitely supersusceptible to polymyxin B and  colistin exposure under M g -limitation, while the effect on CP10A and other cationic 130  antimicrobial peptides was less striking.  Conversely, mutants in PA4773-4775 showed a  stronger supersusceptibility towards certain cationic antimicrobial peptides (CP10A, CP 1 I C N , and indolicidin) than they did toward polymyxin B or colistin. This altered sensitivity pattern suggested that the phenotypes observed in the PA4773-PA4775 mutants were not due to polar effects on transcription of pmrA-pmrB, but rather were a consequence of the biological activity of these novel proteins.  These genes are unique to P. aeruginosa, although PA4773 and  PA4774 have high similarity to enzymes involved in polyamine biosynthesis in many bacterial and eukaryotic species.  PA4773 is similar to S-adenosylmethionine decarboxylases (SpeD)  while PA4774 is similar to polyamine aminopropyltransferases (SpeD). P. aeruginosa also contains more related homologs of the SpeD and SpeE proteins, perhaps indicating that the PA4773 and PA4774 proteins might be involved in novel polyamine-associated phenotypes. Polyamines are organic polycations that have been found in virtually every species examined. The most common polyamines in biological systems are putrescine, cadaverine, spermidine, and spermine (Fig 5.1). They are often found associated inside cells with anionic cellular components like D N A , R N A , and ribosomes (Tabor and Tabor 1976). In addition to these intracellular roles for polyamines, there is some evidence that polyamines are involved in membrane stability in erythrocytes (Ballas, Mohandas et al. 1983), with significant increases in resistance to shear-stress when the erythrocytes are also exposed to spermine. Studies with E. coli and Salmonella have also demonstrated that polyamines are a constituent of the bacterial outer membrane that can be preferentially displaced by washing cells with 1 M NaCl (Koski and Vaara 1991). Of specific interest to polyamine involvement in polymyxin B or cationic antimicrobial peptide resistance are studies that examined the interactions of purified LPS with a variety of cationic compounds (Peterson, Hancock et al. 1985). This study measured the displacement of a cationic spin-labeled probe, 4-dodecyl dimethyl ammonium-1-oxyl- 2,2,6,6-tetramethyl 131  piperidine bromide (CAT 12), from purified LPS. These studies permitted the simultaneous examination of the head group motility of LPS and the actual ability of the probe to be displaced from the LPS. Head group motility is a measure of the fluidity of the membrane, while measurement of the dissociation constant permit a description of the ability of cations to compete for a specific binding site. Addition of polymyxin B, polymyxin B nonapeptide, or EM49 (a cationic antimicrobial peptide) caused the greatest displacement of C A T 12 from the LPS samples as compared to aminoglycosides or polyamines (Peterson, Hancock et al. 1985). When the splitting parameter (a function of spin-label mobility) was measured following the addition of cationic compounds however, the change in motility did not vary as a function of charge, but rather varied depending upon the class of compound examined. addition of aminoglycosides or cationic antimicrobial peptides  In this way,  caused a pronounced  rigidiflcation of the LPS samples while addition of M g , spermine, spermidine, cadaverine, or 2 +  putrescine increased the fluidity of the LPS samples. These results demonstrate that although cationic antimicrobial peptides and polyamines both bind to LPS with high affinity, polyamines are able to bind without rigidifying the LPS and presumably permit the cell to maintain normal membrane-associated processes. These results are intriguing and they suggest that it would be possible for P. aeruginosa to regulate susceptibility to cationic antimicrobial peptides, via the regulation of endogenous polyamine production. The fact that the PA4773-PA4775 operon is regulated by the PmrAPmrB system, which is also involved in cationic antimicrobial peptide resistance via the pmrHFIJKLM-ugd  operon supports this hypothesis. It must be stated however, that a great deal  more research is required to test this hypothesis extensively. PhoP-PhoQ and PmrA-PmrB in virulence. In P. aeruginosa, mutants in phoP did not have any real phenotype, showing similar virulence as an isogenic wild-type strain (Brinkman, Macfarlane et al. 2001). In contrast to this, 132  mutants of PhoQ, which show constitutive resistance to cationic antimicrobial peptides, are ~100-fold less virulent than wild-type P. aeruginosa (Brinkman, Macfarlane et al. 2001). The reasons for this are not yet clear, although it is interesting to note that PhoQ mutants appear to have altered regulation of both PhoP- and PmrA-dependent phenotypes (McPhee, Lewenza et al. 2003). Thus, mutants in phoQ exhibited derepression of both the pmrHFIJKLM-ugd modestly Y/\A113-VPA115-pmrAB.  and  These results suggested that the PhoQ protein was capable  of dephosphorylating PhoP and PmrA, modulating the activity of these proteins. Thus, in the case of a phoQ mutant, the loss of this phosphatase activity would lead to constitutive activation of PmrA- and PhoP-dependent promoters. In addition to the role these systems play in polymyxin B and cationic antimicrobial peptide resistance, the work described in Chapter 3 expanded on the role of these systems in regulating phenotypes that may be associated with virulence.  Using a combination of  bioinformatic and genetic analysis, the regulons of the PhoP-PhoQ and PmrA-PmrB systems were expanded. This analysis demonstrated that the PhoP system regulates two small ORFs, unique to P. aeruginosa, PA0921 and P A 1343, as well as the pmrHFIJKLM-ugd oprH-phoPQ operon.  operon and the  One of these proteins, PA0921 modulated swimming motility under  Mg -replete conditions. Since swimming motility has been associated with early stages of 2+  virulence in P. aeruginosa (Montie, Doyle-Huntzinger et al. 1982), this may play a role in the P. aeruginosa infectious process. In a similar approach, the PmrA regulon was also expanded to include the PA4782, the feoAB operon, and the PA1559-PA1560 operon, in addition to the pmrHFIJKLM-ugd  and  PA4773-477'5-pmrAB operons. Although little is known about the PA4782 or PA1559-PA1560 genes, the feoAB genes are involved in the ability of P. aeruginosa to grow using Fe source (Chapter 3).  as an iron  This would tend to be an advantage in environments where F e  2+  is  stabilized, such as environments that are anoxic or acidic. Recently, evidence has emerged 133  suggesting that within the CF lung, P. aeruginosa grows as an anaerobic biofilm within the thickened dehydrated airway surface liquid (Yoon, Hennigan et al. 2002). Direct measurement of the oxygen concentrations within this thickened layer shows that even though the pQ>2 within the lung is normal, the interior of the mucous layer can be hypoxic (Worlitzsch, Tarran et al. 2002). Cationic antimicrobial peptide induction of P m r A - r e g u l a t e d promoters.  Transcriptional responses to cationic antimicrobial peptides have been described in a number of species, including E. coli (Hong, Shchepetov et al. 2003), Yersinia (Bengoechea and Skurnik 2000), Salmonella (Bader, Navarre et al. 2003), Bacillus subtilis (Pietiainen, Gardemeister et al. 2005), and P. aeruginosa (McPhee, Lewenza et al. 2003). Although each species examined to date shows significant differences from one another, a general observation is that they all include adaptations that serve to ameliorate cell wall induced damage caused by the cationic antimicrobial peptide exposure. One of the most interesting findings to have come out of this research was the observation that the presence of sub-inhibitory concentrations of cationic antimicrobial peptides causes transcriptional regulation of the PA4773 and pmrH operons that are responsible for increased resistance to cationic antimicrobial peptides when grown under M g  limitation. This  response occurred independently of the PmrA-PmrB and PhoP-PhoQ systems, as strains that have these genes deleted show similar transcriptional responses to the presence of cationic antimicrobial peptides as the wild-type strain. This observation suggested a mechanism by which adaptive resistance to polymyxin B and other cationic antimicrobial peptides might take place. The initial sub-inhibitory exposure to polymyxin B or cationic antimicrobial peptides might cause increased transcription of the PA4773-PA4775 and pmrHFIJKLM-ugd  operons, thereby increasing the resistance to a later,  even higher concentration of the compound (Fig. 2.7). 134  In the same issue of Molecular  Microbiology that this work was published, a study in Salmonella documented a similar phenotype (Bader, Navarre et al. 2003).  In contrast to the situation in Pseudomonas, in  Salmonella the response required the PhoP-PhoQ system, implying that this system acted directly in the detection of cationic antimicrobial peptides.  This observation was later  confirmed, and a model for cationic antimicrobial peptide detection in Salmonella was described, in which the binding of cationic antimicrobial peptides to the cytoplasmic membrane led to displacement of divalent cations from the PhoQ sensor kinase (Bader, Sanowar et al. 2005). A model for the cationic peptide response of 5*. Typhimurium is shown in Figure 5.1.  High Mg  2+  B  -  Low Mg  2+  C.  High Mg Cationic peptides 2+  Genes switched on leading to the addition of aminoarabinose to LPS, production of outer membrane protein PgtE, transcription of pmrD, transcription of phoPQ, etc.  Figure 5.1: Model of PhoQ activation by low M g and peptides in S. Typhimurium A . In the presence of high M g concentrations in the medium in the absence of peptides, M g ions bridge the negatively charged cytoplasmic membrane and a prominent anionic surface of PhoQ, stimulating phosphatase activity and leading to dephosphorylation (inactivation) of the transcriptional regulator PhoP. At low M g concentrations in the medium (B.) or in the presence of cationic host defence peptides ( C ) , M g ions can no longer bridge between the negatively charged cytoplasmic membrane and a prominent anionic surface of PhoQ, causing a conformational shift that stimulates kinase activity and leads to phosphorylation of the transcriptional regulator PhoP, stimulating transcription of the PhoPQ regulon 2+  2 +  2 +  2 +  2 +  135  This conformational shift is similar to that observed when PhoQ is subjected to divalent cation limitation (Bader, Sanowar et al. 2005). This leads to phosphorylation of PhoP and activation of PhoP regulon. In P. aeruginosa, the mechanism of sensing cationic antimicrobial peptides is likely different. It does not involve the PmrB or PhoQ sensor kinases, but rather yet another, as- yet unidentified regulatory protein. However, data presented in Chapter 3, shows that all members of the PmrA regulon that have been identified, are also upregulated in response to CP 1 I C N , including those genes that do not play a role in cationic antimicrobial peptide or polymyxin B resistance. Since there are no other obvious similarities in the promoters of these genes, it is likely that the unknown regulator involved in the response to CP 1 I C N recognizes the same binding site as the PmrA protein. A model for PhoPQ, PmrAB, and cationic antimicrobial peptide sensing in P. aeruginosa is presented in Figure 5.2. Intrinsic resistance of P. aeruginosa to cationic antimicrobial peptides In addition to the inducible types of cationic antimicrobial peptide resistance, a number of intrinsic resistance mechanisms have been described in several species. These mechanisms tend to be constitutively expressed, but otherwise do not differ from the adaptive resistance mechanisms that have been described in other species. Proteases within bacterial cells are crucial to a number of processes, including intrinsic resistance to cationic antimicrobial peptides. This mechanism of intrinsic resistance is active in both Gram-negative and Gram-positive bacteria. S. aureus mutants in the degP protease gene, show increased susceptibility to lactoferricin B (Haukland, Ulvatne et al. 2001). Similarly, the constitutively active outer membrane protease OmpT has been implicated in resistance to protamine in E. coli, under both high/low M g  2 +  conditions (Stumpe, Schmid et al. 1998). The  importance of this has been further highlighted through the development of a protease stabilized variant of the cationic antimicrobial peptide CP 1 I C N , itself a variant of indolicidin. 136  Cyclo-  C P U was engineered by introducing a disulphide bridge between the N - and C-terminus, thereby restricting the mobility of the protease-sensitive site (Rozek, Powers et al. 2003). This variant showed similar activity to CP 1 I C N but this activity was retained following incubation with trypsin, whereas the activity of the parent peptide was completely lost. Efflux systems, although described as inducible systems in Yersinia (Bengoechea and Skurnik 2000), form part of the intrinsic cationic peptide resistance system of several bacterial species.  In Neisseria meningitidis, the MtrCDE efflux system is responsible for ~5 fold  increased resistance to protegrin, a cationic peptide from porcine neutrophils (Shafer, Qu et al. 1998).  Similarly, the sapABCDF  system of S. Typhimurium has also been shown to be  involved in resistance to cationic peptides (Parra-Lopez, Baer et al. 1993). The work described in Chapter 4 of this thesis points to a regulatory system, PxrRS, that was involved in intrinsic resistance to cationic antimicrobial peptides.  Mutants of pxrR and  pxrS had a 2-4-fold increased susceptibility to polymyxin B as assessed by MIC.  Similarly,  mutant strains were also more sensitive to exposure to the cationic antimicrobial peptide CP 1 I C N as assessed by killing curves. dependent M g  2 +  These strains showed normal PmrA and PhoP  regulation as well as a normal response to subinhibitory concentrations of  cationic antimicrobial peptides. This strongly supports the hypothesis that the PxrRS system is involved in a process controlling susceptibility to cationic antimicrobial peptides and polymyxin B.  Microarray analysis comparing the pxrRy.lSlacZ strain to an isogenic parent further  suggested that the resistance phenotype may have occured in part through the activation of certain efflux systems. P. aeruginosa is noted for the large number of active efflux systems, but none have, to date, been implicated in cationic antimicrobial peptide resistance.  137  A.  low M g other signal(s)1 2 +  low M g  2 +  PmrB  P( PmrA  PA3552 - PA3559 PA4773-PA4774-PA4775-pmM-p»"-« PA4782 PA 1559-1560  B.  high M g  cationic peptides  ;  signaling protein(s)?  Iff  oco (PhoP) P ^ s S ( ^ ~ A ) P ' ^ . ^ (phop)+P  i  no Mg -induction 2+  of any operons pmrHFIJKLM-ugd  'PA4773-PA4774-PA4775-pmr.4-/>mrB ^ C = > C = > [ = > ^  >  C> PA4782 PA1559-1560  Figure 5.2. The PhoP-PhoQ and P m r A - P m r B systems of P. aeruginosa. A . Under M g limitation, phospho-PhoP causes increased transcription of the PA0921, PAI 343, oprH-phoPQ, and the pmrHFIJKLM-ugd operons. Similarly, Phospho-PmrA also causes increased transcription of the pmrHFIJKLM-ugd operon independently of PhoP, and it also increases transcription of PA4773-PA4774-PA4775-/wir,4fl, PA4782, and PA1559-PA1560. B . Under Mg -replete conditions the PhoP and PmrA protein are dephosphorylated (by PhoQ and/or other unidentified phosphatases) reducing transcription from PmrA- and PhoP-dependant promoters. In the presence of cationic antimicrobial peptides however, an unidentified signaling protein causes increased transcription of PA4773-PA4774-PA4775-/wiMfl, PA4782, P A I 559PA1560, and pmrHFIJKLM-ugd, largely independently of the PmrAB or PhoPQ system. 2 +  2+  138  Future research directions The work described in this thesis has opened up a novel field of Pseudomonas aeruginosa research. It describes both the first identification of the Mg -regulated PmrA-PmrB 2+  two-component regulatory system of P. aeruginosa, as well as the PxrR-PxrS two-component regulatory system, contributing to intrinsic cationic peptide resistance. It also describes the first demonstration of a biological basis for the development of adaptive resistance in P. aeruginosa. With these discoveries in mind, several novel research avenues have been opened. The first and most pressing question that needs to be addressed is to identify the regulatory protein that is responsible for cationic peptide sensing.  While this has been  accomplished in S. Typhimurium (Bader, Sanowar et al. 2005), it is clear that P. aeruginosa is different in this respect.  The protein may be induced upon exposure to sub-inhibitory  concentrations of cationic antimicrobial peptide, and therefore, this question may lend itself to microarray analysis. Indeed, microarray analysis in the presence of sub-inhibitory cationic antimicrobial peptides has revealed certain candidate regulators. In the event that the gene is not transcriptionally induced by cationic peptides, but rather regulation occurs posttranscriptionally, simultaneous screening of transposon mutant libraries for mutants that fail to induce known peptide-regulated luxCDABE fusions, is also being carried out. This work is currently in progress in the Hancock lab, where it will form the core study of another P h D student. A further point of interest that has come out of these studies is the intriguing link between a single histidine sensor kinase (PhoQ) and two separate response regulators (PhoP and PmrA). This suggests a novel signalling pathway consisting of cross-talk between PhoQ and PmrA/PhoP.  Indeed, preliminary microarray studies have suggested that the PhoQ protein  regulates a much larger repertoire of bacterial genes than would be predicted based solely upon the PmrA or PhoP regulons alone.  This hints at the possibility that PhoQ is a highly 139  promiscuous regulatory protein that affects the relative phosphorylation states of a number of response regulators. A more precise definition of this interaction is required to fully appreciate why this system differs so much from other simple two-component regulatory systems. This research would ideally be conducted using purified PhoQ, PhoP, PmrB, and PmrA proteins to study the rates of phosphate flux through each system under different conditions. Further research will be needed to out to understand the contribution of the PxrRS system to intrinsic cationic antimicrobial resistance. Microarray studies point to both active efflux and modulation of heat-shock protein levels as potential contributors to this phenotype, but functional studies of the target genes did not show a strong phenotype for any of the efflux systems or individual heat-shock proteins examined. This may indicate that each target gene contributes only a small amount to the observed phenotype. In order to study this further, a series of multiple mutants may need to be constructed in order to explore this phenomenon more completely. It is clear from the results discussed in this thesis that the response of P. aeruginosa to both limiting M g  and to cationic antimicrobial peptides is a complex developmental process.  While this work has delineated the contributions of three two-component regulatory systems to cationic antimicrobial peptide resistance, it is likely that the actual process is even more complex and that we have only scratched the surface.  140  REFERENCES Bader, M . W., Navarre, W. W., Shiau, W., Nikaido, H., Frye, J. G., McClelland, M., Fang, F. C. & Miller, S. I. (2003). Regulation of Salmonella typhimurium virulence gene expression by cationic antimicrobial peptides. Mol Microbiol 50, 219-230. Bader, M . W., Sanowar, S., Daley, M . E., Schneider, A. R., Cho, U., Xu, W., Klevit, R. E., Le Moual, H. & Miller, S. I. (2005). Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122, 461-472. Ballas, S. K., Mohandas, N., Marton, L. J. & Shohet, S. B. (1983). Stabilization of erythrocyte membranes by polyamines. Proc Natl Acad Sci USA 80, 1942-1946. Bengoechea, J. A. & Skurnik, M . (2000). Temperature-regulated efflux pump/potassium antiporter system mediates resistance to cationic antimicrobial peptides in Yersinia. Mol Microbiol 37, 67-80. Brinkman, F. S., Macfarlane, E. L., Warrener, P. & Hancock, R. E . W. (2001). Evolutionary relationships among virulence-associated histidine kinases. Infect Immun 69, 5207-5211. Brown, M . R. & Melling, J. (1969a). Sensitivity of Pseudomonas aeruginosa to polymyxin B sulphate and E D T A : role of the divalent cation of the growth medium. J Gen Microbiol 58, xii. Brown, M . R. & Melling, J. (1969b). Role of divalent cations in the action of polymyxin B and E D T A on Pseudomonas aeruginosa. J Gen Microbiol 59, 263-274. Carpenter, C. F. & Chambers, H. F. (2004). Daptomycin: another novel agent for treating infections due to drug-resistant gram-positive pathogens. Clin Infect Dis 38, 994-1000. Cunha, B. A- (2005). Methicillin-resistant Staphylococcus aureus: clinical manifestations and antimicrobial therapy. Clin Microbiol Infect 11 Suppl 4, 33-42. Derzelle, S., Turlin, E., Duchaud, E., Pages, S., Kunst, F., Givaudan, A. & Danchin, A. (2004). The PhoP-PhoQ two-component regulatory system of Photorhabdus luminescens is essential for virulence in insects. J Bacteriol 186, 1270-1279. Fagon, J. Y., Chastre, J., Hance, A. J., Montravers, P., Novara, A. & Gibert, C. (1993). Nosocomial pneumonia in ventilated patients: a cohort study evaluating attributable mortality and hospital stay. Am J Med 94, 281-288. Guo, L., Lim, K. B., Gunn, J. S., Bainbridge, B., Darveau, R. P., Hackett, M . & Miller, S. I. (1997). Regulation of lipid A modifications by Salmonella typhimurium virulence genes phoPphoQ. Science 276,250-253. Haukland, H. H., Ulvatne, H., Sandvik, K. & Vorland, L . H . (2001). The antimicrobial peptides lactoferricin B and magainin 2 cross over the bacterial cytoplasmic membrane and reside in the cytoplasm. FEBSLett 508, 389-393.  141  Hong, R. W., Shchepetov, M., Weiser, J. N. & Axelsen, P. H . (2003). Transcriptional profile of the Escherichia coli response to the antimicrobial insect peptide cecropin A . Antimicrob Agents Chemother 47, 1-6. Kauffman, C. A. (2003). Therapeutic and preventative options for the management of vancomycin-resistant enterococcal infections. J Antimicrob Chemother 51 Suppl 3, iii23-30. Koski, P. & Vaara, M . (1991). Polyamines as constituents of the outer membranes of Escherichia coli and Salmonella typhimurium. J Bacteriol 173, 3695-3699. Llama-Palacios, A., Lopez-Solanilla, E., Poza-Carrion, C , Garcia-Olmedo, F. & Rodriguez-Palenzuela, P. (2003). The Erwinia chrysanthemi phoP-phoQ operon plays an important role in growth at low pH, virulence and bacterial survival in plant tissue. Mol Microbiol 49, 347-357. Macfarlane, E. L., Kwasnicka, A., Ochs, M . M . & Hancock, R. E. W. (1999). PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outer-membrane protein OprH and polymyxin B resistance. Mol Microbiol 34, 305-316. Macfarlane, E. L., Kwasnicka, A. & Hancock, R. E . W. (2000). Role of Pseudomonas aeruginosa phoP-phoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology 146 (Pt 10), 2543-2554. McPhee, J. B., Lewenza, S. & Hancock, R. E . (2003). Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 50, 205-217. McPhee, J. B. & Hancock, R. E . (2005). Function and therapeutic potential of host defence peptides. JPept Sci 11, 677-687. Menichetti, F. (2005). Current and emerging serious Gram-positive infections. Clin Microbiol Infect 11 Suppl 3, 22-28. Montie, T. C , Doyle-Huntzinger, D., Craven, R. C. & Holder, I. A. (1982). Loss of virulence associated with absence of flagellum in an isogenic mutant of Pseudomonas aeruginosa in the burned-mouse model. Infect Immun 38, 1296-1298. Mutnick, A. H., Enne, V. & Jones, R. N. (2003). Linezolid resistance since 2001: S E N T R Y Antimicrobial Surveillance Program. Ann Pharmacother 37,169-11A. Newcombe, J., Jeynes, J. C , Mendoza, E., Hinds, J., Marsden, G. L., Stabler, R. A., Marti, M . & McFadden, J. J. (2005). Phenotypic and transcriptional characterization of the meningococcal PhoPQ system, a magnesium-sensing two-component regulatory system that controls genes involved in remodeling the meningococcal cell surface. J Bacteriol 187, 49674975. Nicas, T. I. & Hancock, R. E . W. (1980). Outer membrane protein HI of Pseudomonas aeruginosa: involvement in adaptive and mutational resistance to ethylenediaminetetraacetate, polymyxin B, and gentamicin. JBacteriol 143, 872-878. 142  Parra-Lopez, C , Baer, M . T. & Groisman, E . A. (1993). Molecular genetic analysis of a locus required for resistance to antimicrobial peptides in Salmonella typhimurium. EMBO J12, 4053-4062. Peterson, A. A., Hancock, R. E . W. & McGroarty, E. J. (1985). Binding of polycationic antibiotics and polyamines to lipopolysaccharides of Pseudomonas aeruginosa. JBacteriol 164, 1256-1261. Pietiainen, M., Gardemeister, M., Mecklin, M., Leskela, S., Sarvas, M . & Kontinen, V. P. (2005). Cationic antimicrobial peptides elicit a complex stress response in Bacillus subtilis that involves ECF-type sigma factors and two-component signal transduction systems. Microbiology 151, 1577-1592. Richards, M . J., Edwards, J. R., Culver, D. H. & Gaynes, R. P. (1999). Nosocomial infections in medical intensive care units in the United States. National Nosocomial Infections Surveillance System. Crit Care Med 27, 887-892. Rozek, A., Powers, J. P., Friedrich, C. L . & Hancock, R. E . (2003). Structure-based design of an indolicidin peptide analogue with increased protease stability. Biochemistry 42, 1413014138. Shafer, W. M., Qu, X., Waring, A. J. & Lehrer, R. I. (1998). Modulation of Neisseria gonorrhoeae susceptibility to vertebrate antibacterial peptides due to a member of the resistance/nodulation/division efflux pump family. Proc Natl Acad Sci USA 95, 1829-1833. Shah, P. M . (2005). The need for new therapeutic agents: what is the pipeline? Clin Microbiol Infect 11 Suppl 3, 36-42. Stover, C. K., Pham, X. Q., Erwin, A. L . & other authors (2000). Complete genome sequence of Pseudomonas aeruginosa P A O l , an opportunistic pathogen. Nature 406, 959-964. Strahilevitz, J. & Rubinstein, E . (2002). Novel agents for resistant Gram-positive infections—a review. Int J Infect Dis 6 Suppl 1, S38-46. Stumpe, S., Schmid, R., Stephens, D. L., Georgiou, G. & Bakker, E . P. (1998). Identification of OmpT as the protease that hydrolyzes the antimicrobial peptide protamine before it enters growing cells of Escherichia coli. JBacteriol 180, 4002-4006. Tabor, C. W. & Tabor, H . (1976). 1,4-Diaminobutane (putrescine), spermidine, and spermine. Annu Rev Biochem 45, 285-306. Winfield, M . D. & Groisman, E. A. (2004). Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes. Proc Natl Acad Sci USA 101, 17162-17167. Winfield, M . D., Latifi, T. & Groisman, E. A. (2005). Transcriptional regulation of the 4amino-4-deoxy-L-arabinose biosynthetic genes in Yersinia pestis. J Biol Chem 280, 1476514772. 143  Worlitzsch, D., Tarran, R., Ulrich, M . & other authors (2002). Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109,317-325. Yoon, S. S., Hennigan, R. F., Hilliard, G. M . & other authors (2002). Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Dev Cell 3, 593-603. Zetola, N., Francis, J. S., Nuermberger, E. L . & Bishai, W. R. (2005). Community-acquired meticillin-resistant Staphylococcus aureus: an emerging threat. Lancet Infect Dis 5, 275-286. Zhang, L. & Falla, T. J. (2004). Cationic antimicrobial peptides - an update. Expert Opin Investig Drugs 13,97-106.  144  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092766/manifest

Comment

Related Items