UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of the T1 domain in the trafficking of Kv1.5 Jochova, Martina 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-0513.pdf [ 8.52MB ]
Metadata
JSON: 831-1.0092713.json
JSON-LD: 831-1.0092713-ld.json
RDF/XML (Pretty): 831-1.0092713-rdf.xml
RDF/JSON: 831-1.0092713-rdf.json
Turtle: 831-1.0092713-turtle.txt
N-Triples: 831-1.0092713-rdf-ntriples.txt
Original Record: 831-1.0092713-source.json
Full Text
831-1.0092713-fulltext.txt
Citation
831-1.0092713.ris

Full Text

THE ROLE OF THE T1 DOMAIN IN THE TRAFFICKING OF Kv1.5 by Martina Jochova B.Sc, The University of British Columbia, 2001 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Physiology) THE UNIVERSITY OF BRITISH COLUMBIA June, 2006 © Martina Jochova, 2006 A B S T R A C T The T1 domain of Kv channels is important in the subfamily-specific assembly by clustering individual monomers to increase their chances of interaction into tetramers. Furthermore, T1 domain plays roles in channel gating, stability as well as an interaction site with auxiliary subunits that ultimately modulate the function and expression of the channel. We identified a 10 amino acid region at the start of the T1 domain that is an important prerequisite for the functional expression of Kv1.5 ion channels. A number of N-terminal and T1 domain deletions were made that changed the ability of the channel to traffick to the cell surface. N-terminal deletions up to the T1 domain (AN119 Kv1.5) and larger deletions of at least 60% of the T1 domain (AN 189 and AN209 Kv1.5) yielded functional Kv1.5 channels. However, smaller deletions of 15 (AN135 Kv1.5) and 43 (AN163 Kv1.5) amino acids of the T1 domain yielded non-trafficking and non-functional Kv1.5 channels. These mutants formed aggregates and were localized in the ER and the degradation pathway. However, re-addition of the first 10 amino acids of the T1 domain to the non-trafficking mutants rescued their trafficking to the plasma membrane. Furthermore, point mutations of residues thought to be involved in the intermolecular interaction during tetramer formation result in subtle alterations of channel trafficking ability. As well, point mutations of previously identified ER retention motifs (RXR) rescue the aggregation of the non-trafficking mutants with a very small rescue in their current density. We concluded that protein aggregation may be caused by number of states, such as exposure of ER retention motifs, disruption of important (3-sheet secondary structures, disruption of tetramerization contacts, or exposure of large hydrophobic residues. Additionally, the trafficking and function of AN 119, AN 189, and AN209 Kv1.5 mutants may be affected by deletion of important sites involved in the modulation of Kv1.5 function, such as phosphorylation and interaction with auxiliary subunits. It is also possible that the combination of these individual processes affect the overall Kv1.5 cell surface expression. T A B L E O F C O N T E N T S A B S T R A C T ii T A B L E O F C O N T E N T S iv L I S T O F F I G U R E S vi A B B R E V I A T I O N S vii A C K N O W L E D G E M E N T S ix C O - A U T H O R S H I P S T A T E M E N T xi 1 I N T R O D U C T I O N 1 1.1 STRUCTURE AND FUNCTION OF VOLTAGE-GATED POTASSIUM CHANNELS 2 1.1.1 Structure and function of T1 domain 6 1.2 T H E BIOGENESIS OF ION CHANNELS 10 1.2.1 Regulation of ion channel expression via transcription 13 1.2.2 Regulation of ion channel expression in the ER 13 1.2.3 Regulation of ion channel processing in Golgi network 24 1.3 MODULATION OF KV CHANNEL FUNCTION 26 1.3.1 Modulation of Kv channels by B subunits 26 1.3.2 Modulation of Kv channel function by phosphorylation 29 1.3.3 Modulation of Kv channel function by PDZ domains 31 2 M E T H O D S . . 3 3 2.1 CHANNEL MUTAGENESIS 33 2.2 CELL CULTURE AND TRANSFECTION 35 2.3 ELECTROPHYSIOLOGY 37 2.4 IMMUNOCYTOCHEMISTRY 38 2.5 PROTEINASE K TREATMENT AND CELL LYSIS 39 2.6 WESTERN BLOTTING 40 3 R E S U L T S 41 3.1 SMALL DELETIONS OF T1 DOMAIN AFFECT THE TRAFFICKING OF Kv1.5 41 3.2 AN 163 Kv1.5, BUT NOT AN 135 Kv1.5, IS LOCALIZED TO THE E R 47 3.3 GLYCEROL RESCUES THE EXPRESSION OF AN163 Kv1.5 48 3.4 FIRST 10 AMINO ACIDS OF T1 DOMAIN RESCUE SURFACE EXPRESSION OF NON-TRAFFICKING MUTANTS 51 3.5 POINT MUTATIONS WITHIN THE T1 DOMAIN HAVE AN EFFECT ON SURFACE EXPRESSION 59 3.6 POINT MUTATIONS IN THE NH 2 -TERMINAL DI-ARGININE E R RETENTION MOTIF CAUSE A SLIGHT RESCUE OF AN 163 Kv1.5 TRAFFICKING 62 4 D I S C U S S I O N A N D C O N C L U S I O N S 65 4.1 DISCUSSION 65 4.1.1 AN 163 Kv1.5 can not traffic to the plasma membrane 65 iv 4.1.2 First 10 amino acids of T1 domain may be involved in masking ER retention motif(s) 68 4.1.3 fi-sheet structure may play a role in protein trafficking 69 4.1.4 Importance of specific residues in T1 (2) for trafficking of Kv1.5 71 4.1.5 Mutation of residues in 71 domain that are involved in gating may abolish protein trafficking : 72 4.1.6 AN135KV1.5 73 4.1.7 AN119, AN189, and AN209 deletions yield functional Kv1.5 channels with low current density 7 5 4.2 CONCLUSIONS 79 REFERENCES 81 v L I S T O F F I G U R E S FIGURE 1-1 S C H E M A T I C S T R U C T U R E OF K V C H A N N E L . 3 FIGURE 1 - 2 C R Y S T A L S T R U C T U R E OF T 1 DOMAIN A N D p SUBUNIT 7 F I G U R E 1 - 3 S C H E M A T I C OVERVIEW O F T H E S E C R E T O R Y P A T H W A Y 1 1 FIGURE 1 - 4 C R Y S T A L S T R U C T U R E OF T 1 DOMAIN IN C O M P L E X WITH p SUBUNIT 2 7 F I G U R E 3 - 1 S C H E M A T I C REPRESENTATION OF K V 1 . 5 N - T E R M I N A L DELETION MUTANTS 4 2 FIGURE 3 - 2 S M A L L T 1 DOMAIN DELETIONS ABOLISH K V 1 . 5 S U R F A C E E X P R E S S I O N 4 3 FIGURE 3 - 3 S M A L L T 1 DELETIONS C A N NOT P R O D U C E W H O L E - C E L L M A C R O S C O P I C C U R R E N T S W H E R E A S OTHER DELETION MUTANTS C A N 4 6 FIGURE 3 - 4 A N 1 6 3 K v 1 . 5 BUT NOT A N 1 3 5 COLOCALIZES WITH CALNEXIN 5 0 FIGURE 3 - 5 1 0 % G L Y C E R O L R E S C U E S T H E E X P R E S S I O N OF A N 1 6 3 K v 1 . 5 5 0 F I G U R E 3 - 6 S C H E M A T I C REPRESENTATION OF K V 1 . 5 T 1 MUTATIONS 5 2 F I G U R E 3 - 7 ADDITION O F FIRST 1 0 AMINO ACIDS OF T 1 DOMAIN R E S C U E S NON-TRAFFICKING MUTANTS IN H E K 2 9 3 C E L L S 5 4 F I G U R E 3 - 8 ADDITION OF FIRST 1 0 AMINO ACIDS OF T 1 DOMAIN R E S C U E S NON-TRAFFICKING MUTANTS IN C O S - 7 C E L L S 5 5 F I G U R E 3 - 9 ADDITION OF FIRST 1 0 AMINO ACIDS OF T 1 DOMAIN R E S U L T S IN FUNCTIONAL C H A N N E L S 5 7 F I G U R E 3 - 1 0 R E P R E S E N T A T I O N OF INTERSUBUNIT INTERACTION IN T E T R A M E R FORMATION 6 0 F I G U R E 3 - 1 1 E F F E C T S OF K E Y RESIDUES POINT MUTATIONS IN T 1 DOMAIN ON TRAFFICKING 6 1 F I G U R E 3 - 1 2 N H 2 - T E R M I N A L DI-ARGININE E R RETENTION MOTIF POINT MUTATIONS IN K V 1 . 5 SHOW A SMALL R E S C U E OF A N 1 6 3 K v 1 . 5 TRAFFICKING 6 4 A B B R E V I A T I O N S Amino Acid 3 Letter Code 1 Letter Alanine Ala A Arginine Arg R Asparagine Asn N Aspartate Asp D Cysteine Cys C Glutamine Gin Q Glutamate Glu E Glycine Gly G Histidine His H Isoleucine lie I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser s Threonine Thr T Tryptophan Try W Tyrosine Tyr Y Valine Va'l V CFTR Cystic fibrosis transmembrane conductance regulator COP I Coat Protein Complex type I COPII Coat Protein Complex type II COS-7 African green monkey kidney cells ER Endoplasmic Reticulum ERAD Endoplasmic Reticulum Associated Degradation GABA y-amino butyric acid B HEK293 Human Embryonic Kidney 293 hERG human ether-a-go-go channel K + Potassium KATP ATP-sensitive potassium channel Kir inwardly-rectifying potassium Kv voltage-gated potassium MAG UK membrane-associated guanulate kinases Nav voltage-gated sodium NMDA N-methyl-d-aspartate PDZ PSD-95/DLG/ZO-1 PKA Protein Kinase A PKC Protein Kinase C PSD-95 Postsynaptic density 95 QC Quality control SAP-97 Synapse Associated Protein-97 SH3 Src Homology 3 vii SURI/II Sulphonylurea l/ll T1 domain First Tetramerization domain A C K N O W L E D G E M E N T S First of all, I would like to acknowledge my supervisor, Dr. David Fedida, for giving me the opportunity and the tools to do my graduate studies. David has been supportive of my work, whatever the results may have been, and created a comfortable environment to work in. I would also like to acknowledge the other graduate students, post-doctoral fellows, and technicians in the lab. Yan and Fifi, who have provided me with great cells for my experiements. Dr. Rajesh Mathur, who was a post-doctoral fellow in the lab, has introduced me to the biochemical techniques and has worked closely with me throughout the project. Another post-doctoral fellow, Dr. Zuren Wang, who stayed in the lab until late at night and came during the weekend to do electrophysiology experiments for my ptoject. Dr. Vijay Viswanathan, another post-doctoral fellow, who has worked with me closely teaching me and helping me troubleshoot during my mutagenesis experiments, as well as making me laugh even during hard times. I would also like to thank Dr. Dave Steele, research associate in our lab, for helping me design and troubleshoot my mutagenesis experiments and for taking time out of his busy schedule to critically read and edit my thesis. I also need to thank Anu Khurana and Woo Sung Choi, my co-students, for being there not only for intellectual stimulation but also for the fun and debriefing times when my experiments and thesis writing did not go so well. I would like to also thank Dr. Jodene Eldstrom for all the help during my research and the critical assessment of my defense presentation, as well as the electrophysiology guys and girl, in our lab ix and Dr. Kehl's lab for the help and fun that they provided for me, throughout my studies. In addition, my friends outside of the lab have been a source of constant support. Most of all, I would like to thank my parents for preparing me for the hard work and determination which were necessary during my graduate studies. Also, their constant support throughout my undergraduate and graduate studies as well as throughout my life was appreciably received. At last, but definitely not least, I would like to acknowledge Andrew Hume, who is the love of my life. Even though he was extremely busy and stressed at work, he gave me constant support and unconditional love during my graduate studies. He has always kept me smiling and provided an optimal environment for writing my thesis. x C O - A U T H O R S H I P S T A T E M E N T Martina Jochova was responsible for project management, the experimental design (with the help of Dave Steele, Jodene Eldstrom, and Vijay Viswanathan), mutagenesis, transfections, immunoblotting and immunofluorescence experiments, thesis writting, and data analysis including electrophysiological data analysis. Figure preparation was performed with the help of David Fedida, Jodene Eldstrom and Dave Steele. The electrophysiology measurements of the wt and T1 domain deletion mutants were performed by Zuren Wang and of the N-terminal deletion mutants by Harley Kurata. The current density data was provided by Woo Sung Choi (he has also performed the data analysis in figure 3.12). In addition, Jodene Eldstrom has performed and analyzed the immunofluorescent experiments in figure 3-12. xi 1 I N T R O D U C T I O N Voltage-gated potassium channels in excitable cells play important roles in propagation of action potentials. Delayed rectifier potassium channels open in response to changes in the transmembrane voltage during the repolarization stage of the cardiac action potential, returning the cells of the cardiac muscle to their resting potential (Marban, 2002). By definition, the amplitude of the macroscopic current is dependent on the number of functional channels in the plasma membrane, the single channel conductance, and the open probability of each channel (Delisle et al., 2004). Disturbances of any of these factors can lead to cardiac arrhythmias like torsade de pointes and ventricular fibrillation, and potentially to sudden death. The changes in single channel conductance and probability of opening arise due to factors affecting the biophysical properties of ion channels, more specifically mutations in the "pore" affecting the permeability and mutations affecting the gating properties of the channel (Meacham et al., 2001; Zhou et al., 1998). Changes in the number of functional channels at the plasma membrane arise from changes affecting channel biogenesis and intracellular trafficking. For example, truncation mutation lead to missfolding or misassembly and subsequently to early protein degradation, and mutations that cause a decrease in transcription efficiency reduce channel expression levels (Curran et al., 1995; Delisle et al., 2004; Tristani-Firouzi et al., 2001). Therefore, an understanding of the structure and biogenesis of ion channels is of great importance and interest. 1 1.1 Structure and function of voltage-gated potassium channels In our lab, the focus is on KV1.5 voltage-gated potassium channels. KV1.5 is a delayed-rectifier and a mammalian homologue of Shaker. It is expressed ubiquitously, but most significantly in the mammalian cardiac ventricle and atrium (Feng et al., 1997; Ordog et al., 2005; Mays et al., 1995), in the sciatic nerve and other parts of nervous system (Attali et al., 1997; Jou et al., 1998; Peretz et al., 1999; Mi et al., 1995), in pulmonary artery smooth muscle (Yuan et al., 1998; Archer et al., 1998), and in both vascular and visceral smooth muscle (Overturf et al., 1994; Clement-Chomienne et al., 1999). Voltage-gated K + channels, like Kv1.5, consist of four identical monomer subunits assembled in four fold symmetry around a gated central potassium conducting pore, as seen in Figure 1.1B (Jan and Jan, 1997). Each monomer contains six transmembrane domains, S1 - S6, as well as cytoplasmic NH 2 and COOH termini (Figure 1.1 A). The transmembrane domains contain mainly hydrophobic residues and are connected by alternating intracellular and extracellular linkers. The S1-S4 domains contain the voltage sensor, largely consisting of the S4 domain which senses changes in the potential across the membrane (Hille, 1992). S4 contains several Arg's (arginines), spaced at every 3 r d position, that cause the S4 to move across the membrane electric field subsequently forcing the channel into open and closed conformations (Bezanilla et al., 1991; Liman et al., 1991; McCormack et al., 1991; Papazian et al., 1991). The S5 and S6 domains line the pore of the tetrameric channel. The pore is structurally adapted for ion selectivity and gating, and regulates the ion conduction through the channel. 2 Figure 1-1 Schematic Structure of Kv channel A. Schematic structure of Kv channel monomer, consisting of six transmembrane domains and cytoplasmic NH 2 and COOH termini. The TM domains are mainly hydrophobic and are connected by alternating intracellular and extracellular linkers. TM domains S1 - S4 make up the voltage sensor. S4 is made up of a number of positively charged Arg residues. The S5, P-loop (selectivity filter), and S6 form the pore of the channel that regulates the ion conduction through the channel. B. Tetrameric structure of Kv channel. Four monomers, each consisting of six transmembrane domains, assemble together in a four-fold symmetry around a central gated pore, (from Sigma RBI) 3 The P-loop, connecting S5 and S6, contains the selectivity filter in the ion gateway between the extracellular and intracellular environments (Hartmann et al., 1991; Heginbotham et al., 1992; Pongs, 1992; Yool and Schwarz, 1991). More specifically, in Shaker and mammalian Kv1 channels, the selectivity filter signature sequence, TXXTXGYGD, allows efficient permeation of K + ions but not other cations like Na + (Heginbotham et al., 1992; Heginbotham et al., 1994). The carbonyl oxygens line the selectivity filter facing the pore and mimic hydration shells as dehydrated K + ions are directed through the pore (MacKinnon, 2003; Valiyaveetil et al., 2004). The structure of the selectivity filter is maintained by number of interactions involving the residues of the signature sequence and the rest of the Kv channel; these include adjacent tryptophan residues (W67 and W68 in KcsA, W434 and W435 in Shaker) that form an 'aromatic cuff' and interact with tyrosine (Y78 in KcsA, Y445 in Shaker) near the extracellular entrance of the selectivity filter (Doyle et al., 1998; Kurata and Fedida, 2005). These interactions are critical for the function of the selectivity filter since their disruption causes changes in pore selectivity and gating (Heginbotham et al., 1994; Perozoetal., 1993; Kirsch etal., 1995; Yang etal., 1997). The gating of voltage-gated potassium channels involves opening and closing of the channel according to the voltage across the membrane, so as to permit or prevent the passage of ions. The KcsA and MthK channels crystal structures are consistent with the intracellular part of the pore functioning as a 'gate' and their structural differences have been used to model the gating mechanisms of Kv channels (Jiang et al., 2002b). The crystal structure of KcsA shows the intracellular side of the M2 domains (same as S6 in Kv channels) crossing over and forming a 4 bundle at the intracellular side of the channel, known as the inner helix bundle or the bundle crossing (Doyle et al., 1998; Jiang et al., 2002b). The crystal structure of MthK, on the other hand, shows that the intracellular side of the M2 domains are bent so that the pore is wide open, exposing the pore cavity to the cytoplasm (Doyle et al., 1998; Jiang et al., 2002a; Jiang et al., 2002b). It is believed that the difference between the two crystal structures accounts for the difference between a 'closed' (KcsA crystal structure) channel and an 'open' (MthK crystal structure) channel. In addition, the crystal structure of Kv1.2 shows that the extracellular side of the pore is highly conserved in all prokaryotic and eukaryotic channels, whereas the inner side of the pore of Kv1.2 falls between the 'open' conformation (MthK and KvAP crystal structure) and the 'closed' conformation (KcsA crystal structure) (Long et al., 2005). Therefore, it is suggested that the S6 domain undergoes a conformational change during gating (the process by which the pore opens and closes), forcing the a helices to swing open, exposing the pore cavity to the intracellular environment (Jiang et al., 2002b; Kurata and Fedida, 2005). The gating mechanism is thought to involve a "gating hinge" made up of highly conserved glycine residue (Gly 83 in MthK, Gly 99 in KcsA, Gly 386 in Shaker, Gly 504 in Kv1.5) in the 'inner' helices of the S6 region (Jiang et al., 2002b), or the Pro-X-Pro (X is any amino acid) motif in Shaker channels (absent in prokaryotic channels) thought to kink the S6 inner helices (Long et al., 2005) to achieve the different conformations. 5 1.1.1 Structure and function of T1 domain Members of the Shaker (Kv1) family contain a highly conserved region in their cytosolic NH2 termini, known as the first tetramerization (T1) domain (Tempel et al., 1987; Tempel et al., 1988; Kamb et al., 1988; Pongs et al., 1988; Schwarz et al., 1988; Yokoyama et al., 1989). Initially, sequence alignment of the NH 2 terminus in Kv1 ion channel family members showed three highly conserved regions (^70% homology) interspersed by variable regions (Shen and Pfaffinger, 1995; Xu et al., 1995). By deletion mutagenesis, the authors identified the first two conserved regions, or the T1 domain, to be important in subfamily-specific monomer interactions. Later studies showed the importance of the T1 domain in maintaining overall stability of the channel where channels without the T1 domain are easily degraded into monomers (Strang et al., 2001). Furthermore, the T1 domain has been shown important in gating of Kv channels (Cushman et al., 2000; Minor et al., 2000; Kurata et al., 2002) and as an attachment site of the auxiliary p subunit proteins (Gulbis et al., 2000). The crystal structures of the isolated Shaker T1 domain (Kobertz et al., 2000) and of the Kv1.2 T1 domain - (3 subunit complex (Long et al., 2005), show the tetrameric T1 domain suspended in the cytoplasm below the pore of the channel by linkers between the T1 and S1 domains, just like a "hanging gondola" (see figure 1.2 and figure 1.4A). The T1 - S1 linkers project outward from the channel's central axis maintaining a separation between the pore and the intracellular regions (Long et al., 2005). Ions reach the pore through the "windows" between the linkers or "cables" of the gondola-shaped T1 domain (Kobertz et al., 2000). In addition, the side 'windows' 6 are large enough to allow entry of the N-terminal inactivation "ball" which functions as an inactivation domain during the N-type inactivation process in Shaker Kv channels (Hoshi et al., 1990; Zagotta et al., 1990). This inactivation ball domain may be a part of the Kvot channel or a part of the interacting Kvp subunit (see bellow text and figure 1.4A). The T1-S1 linkers may be involved in establishing electrostatic interactions with the hydrophobic region of the N-terminal ball during inactivation (Gulbis et al., 2000; Zhou et al., 2001; Long et al., 2005). Figure 1-2 Crystal structure of T1 domain and p subunit Ribbon representation of T1 tetramer, shown from the N-terminal side (bottom), C-terminal side (top) and side view. The T1 monomers assemble in a four-fold symmetry just like the TM domains of the Kv channels. The monomer interaction takes place via antiparallel (3-sheet structure at the N-terminal part of T1 domain (Minor et al., 2000). 7 Four T1 domains come together, one from each monomer, to form a tetrameric structure. Using the NH2 terminus of the Shaker B channel as a polypeptide, Min Li and colleagues, were among the first to show that a distal portion of the NH 2 terminus (aa83-196 in Shaker B channel) is involved in intersubunit interactions among monomers belonging to the same family of ion channels (Li et al., 1992). Conversely, studies of chimeras consisting of NH 2 terminus of an unrelated family of ion channels (DRK1) added to the rest of the Shaker B channel, showed a lack of interaction between the chimeric channel and the wt Shaker B channel. These findings were confirmed by yeast-two-hybrid studies using chimeric constructs consisting of a synthetic peptide, homologous in sequence to the T1 domain, replacing the NH 2 terminus of either Kv1.1 or Kv3.1 channels (Shen and Pfaffinger, 1995; Xu et al., 1995). Attaching the T1 domain to both Kv1.1 and Kv3.1 channels resulted in homotetramer formation among Kv1.1 or Kv3.1 monomers as well as heterotetramerization among Kv1.1 and Kv3.1 monomers/dimers. Furthermore, the authors hypothesized that in order to allow for the subfamily interactions to take place, the cytoplasmic NH 2 termini must be folded in such a way as to expose the particular amino acids involved in the interactions. Disruption of the proper folding by affecting the orientation of the interacting residues will lead to lack of tetramer formation. Therefore, one function for the T1 domain was identified: to bring together monomers into structural and functional homotetramers (monomers of the same family member, i.e. Kv1.1) and heterotetramers (monomers of different members of the same subfamily, i.e. Kv1.1 and Kv1.4), and to prevent interaction between different families of ion channels. In later studies, it was shown that Shaker 8 B channels can tetramerize even in the absence of the T1 domain, however the tetramerization efficiency was quite low (Zerangue et al., 2000). Therefore, the T1 domain plays an important first step in the assembly, where it clusters monomers in order to increase their chances of interaction, thus promoting the formation of functional channels. During the process of gating, in response to membrane depolarization, the S4 transmembrane domain moves across the membrane electric field forcing the channel into open and closed conformations (Bezanilla et al., 1991; Liman et al., 1991; McCormack et al., 1991; Papazian et al., 1991). It is hypothesized that the T1 domain is physically linked to the conformational changes that take place in the transmembrane pore (Cushman et al., 2000; Minor et al., 2000). The exact mechanism is not understood but it is thought that changes in the conformation of the pore, force a global conformational change on the T1 domain, affecting the positions and interactions of a number of polar residues within the T1 domain. 9 1.2 The Biogenesis of ion channels In order to avoid insertion of incorrectly folded or oligomerized ion channels into the plasma membrane, the biogenesis and intracellular trafficking of ion channels from the endoplasmic reticulum (ER) to the plasma membrane are highly regulated. Therefore, to ensure that only structurally and functionally correct channels are expressed, the cell is equipped with various quality control (QC) checkpoints along the secretory pathway. The ER is the organelle with stringent QC, since this is the start of the protein biogenesis where newly synthesized proteins are folded and assembled into functional moieties. As a result, ER has primary and secondary QC mechanisms to ensure that only functional proteins enter their final destinations. The primary QC mechanism involves association of newly synthesized proteins with ER chaperone proteins to ensure correct folding and assembly before exit out of ER. Secondary QC involves modulatory mechanisms responsible for protein export out of the ER, including masking and unmasking of motifs encoded in the primary amino acid sequence of the nascent protein (see below). Missfolded proteins are tagged by covalent binding of ubiquiting protein(s) for degradation (Haas and Siepmann, 1997). Once the proteins pass the ER QC machinery they can move into the Golgi network for further maturation processes, including more complex glycosylation and directional sorting to the plasma membrane. 10 Degradation P M Figure 1-3 Schematic overview of the secretory pathway. Proteins are synthesized, folded and assembled in the ER, where membrane-associated ribosomes are shown in yellow. If the proteins are missfolded, they are shunted into the cytosol and degraded by the proteasome. If the proteins are correctly folded, they leave the ER through the ER exit sites, where the COPII coat proteins (yellow triangles) bind the nascent proteins. Inclusion of proteins into COPII vesicles is selective. Once the COPII vesicles have detached from the ER, the cargo protein is released into the Golgi and the COPII coat is replaced by the COPI coat (yellow rectangles). COPI vesicles are involved in the formation of return vesicles that bring ER resident proteins and any proteins that escaped ER QC, back to the ER. The Golgi network, from which cargo moves to the plasma membrane, serves also as a location for the rerouting of misfolded proteins into degradation pathway (Ellgaard et al., 1999). 11 The transportation of the newly synthesized proteins throughout the secretory pathway (between ER, Golgi and plasma membrane) is made possible via secretory vesicles (Figure 1.3). The main components of the transport vesicles are coat proteins that interact with specific amino acid motifs encoded in the primary amino acid sequence of the cargo protein (Balch et al., 1994; Aridor and Balch, 1996; Rothman and Wieland, 1996; Schekman and Orci, 1996). To date, three types of coat proteins and their functions have been identified; clathrin, COPI and COPII coat proteins. The clathrin coat is involved in the late secretory pathway between Golgi and plasma membrane (Kirchhausen, 2000; Robinson, 1994). COPI and COPII coat proteins are involved in the early secretory pathway between ER and Golgi in retrograde and anterograde directions, respectively (Antonny and Schekman, 2001; Klumperman, 2000; Orci et al., 1997). The COOH-terminal tyrosine-based (YXX(j); X is any amino acid and § is a bulky/hydrophobic amino acid) and di-leucine (LL) motifs are recognized by clathrin-mediated endocytosis (Kirchhausen, 2000; Kirchhausen, 2002). The C-terminal di-lysine motifs are recognized by COPI coat protein and position-independent di-acidic motifs, identified in fast ER export, are recognized by COPII coat protein (Bonifacino and Traub, 2003). Once the newly synthesized proteins reach the plasma membrane, they are then endocytosed into the cytoplasm and either recycled back to plasma membrane or shunted to the degradation pathway (Abriel and Staub, 2005). 12 1.2.1 Regulation of ion channel expression via transcription The QC mechanism of the expression of ion channels begins with the regulation of transcription by differential splicing of introns from the heteronuclear RNA to produce mRNAs of different nucleotide content (Levitan et al., 1991; Takimoto et al., 1993; Mori et al., 1995). Gene transcription can be upregulated by the glucocorticoid receptor agonist dexamethasone as well as natural glucocorticoids (i.e. corticosterone) that act by directly stimulating glucocorticoid-response element found upstream of the translation start site in Kv1.5 (Levitan et al., 1991; Takimoto et al., 1993; Mori et al., 1995). In vivo, injection of dexamethasone glucocorticoid was seen to up-regulate Kv1.5 protein expression 20-fold in the heart (Takimoto and Levitan, 1994). Additional regulations on transcription and translation of Kv1.5 and other voltage-gated ion channels in neurons and heart have been also shown; i.e., Kv1.5 and Kv2.1 expression is downregulated by neuropeptide TRH (Takimoto et al., 1995), Kv1.5 and Kv1.6 expression in striatal neurons is reduced by opiates (pharmacological stimulus) (Mackler and Eberwine, 1994), and ventricular Kv4.2 and Kv4.3 expression in the heart is enhanced by thyroid hormone (Shimoni et al., 1997). This type of regulation is slow, occurring over a period of hours, and therefore relevant mainly to long-term effects. 1.2.2 Regulation of ion channel expression in the ER Mammalian membrane proteins, like ion channels, are thought to enter the ER co-translationally and through a ribosome that is attached to a translocon (Ellgaard and Helenius, 2003). A translocon is a membrane protein, located in the 13 ER membrane which has a tunnel-like structure that serves as a passageway for the nascent protein as it is being translated in the ER lumen (White and von Heijne, 2004). While the nascent protein is still attached to the ribosomes, co-translational folding takes place followed by post-translational folding, post-translational modifications, and oligomerization of monomers (Ellgaard and Helenius, 2003). The post-translational modifications, like disulphide-bond formation, signal-peptide cleavage, and N-linked glycosylation, are important for the correct folding and assembly of the new protein. These modifications are performed with the help of ER chaperones, like calnexin, calreticulin, BiP, GRP94, ERp57, ERp72 and protein disulfide isomerase (PDI), which are also part of the QC machinery (Ellgaard et al., 1999). During normal biogenesis these chaperone proteins recognize, even if only transiently, exposed features like hydrophobic patches and exposed mobile loops. Kv1 channels undergo core glycosylation in the ER, followed by further processing of the oligosaccharide tree in the Golgi (Kornfeld and Kornfeld, 1985). The Glu3Man9GlcNac2 core sugar is added co-translationally (Nilsson and von Heijne, 1993) to the N-glycosylation site, in multi-transmembrane glycoproteins, by oligosaccharyl transferase (Silberstein and Gilmore, 1996; Helenius and Aebi, 2001). The consensus N-glycosylation site in Kv1.1-1.5 is Asn-X-Thr/Ser (NXT/S) located in the S1-S2 linker, where X can be any amino acid except proline (P) (Zhu et al., 2003; Stuhmer et al., 1989). The core glycosylation site must be extracellular, usually at the first linker, and must have at least 10 amino acid residues from either S1 or S2 transmembrane domains in order to be accessible to ER glycotransferase (Landolt-Marticorena and Reithmeier, 1994; Zhu et al., 2003). After the core sugar is 14 added, the terminal glucose residues are cleaved by ER glucosidases I and II, mediating a binding of the new glycoprotein to the calnexin or calreticulin chaperones (Hammond et al., 1994; Ware et al., 1995; Spiro et al., 1996). If the glycoprotein cannot be correctly folded during its glycosylation cycles, it is recognized by GT (glucosyltransferase) which can reglucosylate the nascent protein and allow it to reassociate with calnexin causing it to re-enter the glycosylation cycle. The new glycoprotein can only leave the cycle once it is no longer reglycosylated by GT. If, however, the nascent glycoprotein is constantly misfolded, it is marked for degradation by mannosidase I and shunted to the ER degradation pathway (Jakob et al., 1998; Liu et al., 1999; Cabral et al., 2000; Su et al., 1993). Calnexin and calreticulin chaperones are, therefore, not only assisting in the core glycosylation but are also believed to bind the nascent proteins in order to promote their proper folding (Hammond et al., 1994; Hebert et al., 1995; Parodi, 2000; Trombetta and Parodi, 1992). As a result, the trimming of the N-linked oligosaccharide is linked to the QC mechanism in ER. Once the glycoproteins are correctly folded, they exit the cycle and are exported to the Golgi for further trimming and modification of the sugar tree. The functional consequence of core and complex glycosylation is not well understood. A number of studies have shown that it is somehow important for protein stability and trafficking, but not necessary for proper folding, oligomerization, or channel function (Conti et al., 2002; de Souza and Simon, 2002; Khanna et al., 2001; Watanabe et al., 2004; Much et al., 2003; Petrecca et al., 1999). Other studies have proposed that complex glycosylation is necessary for correct protein folding and has an effect on the channel gating because the negatively charged sialic acids 15 in the sugar tree affect the surface potential (Thornhill et al., 1996; Watanabe et al., 2003). Initially, it was believed that once the proteins are folded and oligomerized, they leave the ER and enter the Golgi by a default pathway. Subsequently, a mechanism for QC system was found encoded in the primary protein sequence of the cytoplasmic domains of the new membrane proteins (see below). To date, a number of QC motifs have been identified and they fall into 2 categories; the retention/retrieval motifs and the ER export motifs. 1.2.2.1 Retention and/or retrieval of proteins in endoplasmic reticulum The first retention/retrieval signals were identified in ER-resident lumenal and transmembrane proteins; a KDEL (Lysine - Aspartic acid - Glutamic acid - Leucine) sequence located in the COOH terminus of lumenal ER-resident proteins and a KKXX (di-lysine motif followed by any amino acids) sequence found at the COOH terminus of transmembrane ER-resident proteins (Ellgaard et al., 1999; Murshid and Presley, 2004). The main function of these motifs is the retrieval of ER-resident proteins, after they exit the ER accompanying the new glycoproteins to ER-Golgi intermediate compartment or to Golgi network. ER-resident lumenal proteins with KDEL amino acid sequence are believed to bind a transmembrane receptor, that cycles between ER and Golgi (Hardwick et al., 1990; Semenza et al., 1990), by a pH-dependent mechanism (Wilson et al., 1993). Therefore, it is believed that if the KDEL proteins are transported into the Golgi's acidic environment by mistake, they bind with high affinity to KDEL receptors and are returned to ER, which has a neutral 16 pH, forcing the receptor-protein complex to dissociate (Pelham, 1996). In addition, some KDEL ER-resident proteins (calreticulin) are retained, rather than retrieved, in the ER by a KDEL-independent mechanism (Sonnichsen et al., 1994). The KKXX motif, found in the transmembrane ER-resident proteins and proteins that cycle between ER and Golgi (Cosson and Letourneur, 1994; Letourneur et al., 1994), is similar to the COPI binding motif except the last two amino acids in cycling proteins are phenylalanines, which is similar to COPII binding motif (Dominguez et al., 1998; Fiedler et al., 1996; Kappeler et al., 1997). Mostly, it is believed that KKXX proteins reside in the ER by retrieval and not by retention, just like KDEL ER-resident proteins. However, there are some studies that show retention-type of ER residence in vitro (Andersson et al., 1999). An ER retention/retrieval signal important in newly synthesized protein has been first identified in Kir6.2/6.3 (KATP) and its accessory subunit SUR1/2 (Zerangue et al., 1999). It has been shown to consist of RXR (arginine - X - arginine; X represents any amino acid but usually neutral or basic amino acid) amino acid residues. Initially, the authors observed that in order to be expressed at the plasma membrane, Kir6.2 and Kir6.3 (a subunit) must co-assemble with SUR1 and SUR2 p subunits, respectively. If the a and p subunits are only partially assembled or transfected alone, they will end up localized in the ER and will not express at the plasma membrane. Zerangue et al., found that deletion mutations and point mutations of the RXR motifs can rescue the surface expression of individually transfected Kir6.2/6.3 and SUR1/2 proteins. Therefore, the authors postulated that the RXR motif must be "masked" during correct oligomerization between Kir6.2/6.3 17 and SUR1/2 p subunits. Incorrect stoichiometric assembly, due to either incorrect monomer folding or a mutation in the interacting residue(s), results in an inability of the subunits to assemble. Furthermore, incorrect protein assembly leads to the exposure and recognition of the RXR motif(s) by ER resident protein(s) which retain the incorrectly folded proteins in the ER. The authors confirmed the function of the ER retention motif by adding the RKR residues to Kir2.1 subfamily member, the p2 adrenergic receptor (P2-AR), or an unrelated CD4 protein. All three proteins normally express easily at the plasma membrane, but attaching the RXR peptide, results in ER retention and a lack of cell surface expression. Alternatively, conversion of the RXR motif to AAA in these peptides, allows efficient surface expression of Kir2.1, P2-AR, and CD4 proteins. Subsequent groups have assessed the roles of di-arginine motifs in the expression of additional ion channels. The GABA (y-amino butyric acid B) receptors, NMDA (N-methyl-D-aspartate) receptors, CFTR (cystic fibrosis transmembrane conductance regulator), hERG (human ether-a-go-go), and Na v (sodium voltage-gated) channels have all been investigated. In GABA B receptors, Margeta-Mitrovic et al. have found a C-terminal RSRR motif to be important in heteromeric assembly between GABA B i and GABA B 2 subunits lack of which leads to RXR exposure and ER retention (Margeta-Mitrovic et al., 2000). Point mutations have identified the arginines (Arg) in the 1 s t and 3 r d positions to be functionally important in ER retention, and the Arg in the 4 t h position to only strengthen the ER retention. Similar to KATP channels, the amino acid in the 2 n d position can tolerate any point mutations without affecting its ER retention function. Therefore, the two subunits, GABA B i and 18 G A B A B 2 , must interact and mask each other's RXR motifs, in order to be trafficked to the cell surface. This masking and interaction was further found to take place through the coiled-coil interaction of their a helices. Similarly, an RRR amino acid motif responsible for ER retention, has been found in the C1 cassette of NMDA receptors (Standley et al., 2000). The authors found the ER retention motif by examining different splice variants of NMDA receptors that showed ER localization when expressed alone. Deletion and point mutations showed that the ER localization is indeed due to exposure of the RXR motifs. These results were confirmed by another study, where the authors fused a C-terminal region of the NMDA receptor, containing the RXR motif, to CD8 protein and found that the C-terminal RXR motif was capable of forcing the localization of the fusion protein in the ER (Xia et al., 2001). The CFTR channel has a total of four RXR motifs, but only two (located in the NBD1 domain) were found to play a role in ER retention/retrieval (Owsianik et al., 2003). Co-expression of misfolded AF508 CFTR with truncated CFTR constructs containing RXR motif(s) resulted in a rescue of non-trafficking AF508 CFTR to the cell surface. In another study, point mutations of arginine to a structurally similar lysine amino acid in AF508 CFTR, also resulted in rescue of its surface expression (Chang et al., 1999). Therefore, these studies confirmed that the exposed RXR motifs lead to protein retention in the ER but proper masking of these motifs, due to correct folding, lead to cell surface expression. Similarly, Kupershmidt et al. have identified an RGR motif located in the COOH terminus of HERG (human ether-a-go-go) ion channels and shown that, for 19 expression, the motif must be masked, again, by a proper folding of the long COOH terminus. Exposing the RGR motif through truncation mutations localizes the HERG A147 channel in the ER (Kupershmidt et al., 2002). Overall, the above results show the involvement of the RXR(R) amino acid motif in the correct stoichiometric assembly of a subunits (GABA B receptors and NMDA receptors), heteroassembly of a and (3 subunits (KATP channels) and protein folding (CFTR). Later studies have also shown that exposed RXR motifs bind COPI coat proteins in retrograde transport between Golgi and ER (Yuan et al., 2003). In addition, the neighboring phophoserine, of the masked RXR motifs, may interact with ER chaperone proteins (i.e. 14-3-3) and may function in suppression of ER retention perhaps by displacing the COPI complex. However, the precise mechanism by which this occurs is not yet known. 1.2.2.2 ER export motif Studies on trafficking of inwardly rectifying family of potassium channels revealed a second type of QC in the ER, the forward/export trafficking signals. Like the retention/retrieval signals, these signals are encoded in the primary sequence of the cargo proteins and are location independent. Unlike the retention/retrieval signals, these motifs must be exposed on the surface of the protein, in order to be rapidly exported out of the ER. The ER export motifs were first discovered in Kir channels, by noticing that different subfamilies express to different degrees at the plasma membrane (Nichols and Lopatin, 1997). Ma et al., set out to investigate the cause of this behavior by constructing deletion mutations, point mutations, and C-20 terminal chimeras between the different subfamilies of Kir channels (Ma et al., 2001). They have identified a five amino acid motif (FCY)ENE or EXD that, when mutated or deleted, results in a lack of plasma membrane expression in Kir2.1 and Kir1.1, respectively. Assuming, that these results are due to failure of folding and/or assembly, the group examined the biophysical properties: ion permeation, rectification, and the single-channel properties of the Kir2.1 wt and deletion mutant (C-terminal deletion after residue 374 which contains the diacidic residues). The authors found that the lack of cell surface expression is not due to a failure of protein assembly, but rather to lack of trafficking to the plasma membrane. In addition, to confirm the function of the FCYENE motif as an ER export signal, they tested its ability to allow surface expression of non-trafficking proteins. Fusion of the di-acidic motif to Kir 6.2A36 (deletion of 36 amino acids removes RXR motif so that it does not interfere with ER export) and GABA B i -ASRR (point mutation of the first R removes the ER retention motif, so that it does not interfere with the ER export) proteins, resulted in surface expression. Similarly, fusing the FCYENE motif to an unrelated ion channel family (Kv1.2) or Kir4.1, which normally require the help of either Kv(32 subunit or other auxiliary proteins to traffic to the plasma membrane, allowed the Kv1.2 and Kir4.1 surface expression without the auxiliary subunits (Ma et al., 2001; Stockklausner et al., 2001). In another study, Ma et al., identified the location and function of a di-acidic ER export motif in G protein-activated inwardly rectifying potassium channels, Kir3 (GIRK) (Ma et al., 2002). GIRK is made up of heterotetramers between Kir3.1, Kir3.2, Kir3.3, and Kir3.4 a-subunits, depending on the tissue in which they are 21 expressed. The authors identified an ER export motif, (D/N)QD(V/M)E(S/I)(P/G)V, in the NH2-terminus of Kir3.2 and Kir3.4 that is not present in Kir3.1 or Kir3.3. Therefore, Kir3.1, when expressed alone, localizes to the ER. However, coassembly of Kir3.2/Kir3.1 and Kir3.4/Kir3.1 causes the heterotetramers to express at the cell surface. Again, fusing the NH2-terminal 35 amino acids of Kir3.4 or Kir3.2 to a member of a different subfamily, Kir2.1 with Ala substitutions of its ER export motif, as well as to an unrelated protein GABA B rASRR, results in surface expression. Alternatively, fusion of Kir2.1's C-terminal di-acidic motif to Kir3.4 (36-419 deletion to remove its di-acidic motif) and Kir3.2 (1-44 deletion to remove its di-acidic motif) results in surface expression. Therefore, the above chimera studies confirm the functions of the di-acidic motifs in Kir1.1, Kir2.1, Kir3.2, and Kir3.4 in regulating ER export and promoting cell surface expression. Interestingly, Ma et al., found that fusing the di-acidic motif to full-length Kir6.2 and wt GABA B i proteins, does not increase the surface expression of these proteins, indicating that the ER export motif is not able to override the ER retention motif (Ma et al., 2001). As in Kir channels, an ER export motif has been identified in the COOH terminus of the Kv1 channels (Li et al., 2000). However, unlike Kir channels, Kv1 channels do not employ a di-acidic motif for this purpose. Instead, the authors have identified VXXSL (valine-X-X-serine-leucine) and LXXSL (leucine-X-X-serine-leucine) motifs as ER export signals in Kv1.4 and Kv1.5, respectively. Initially, the authors noticed differences in the levels of surface expression of Kv1.4 as compared to Kv1.5 ion channels. Interchanging the ER export motifs between Kv1.4 and Kv1.5 reversed this relationship and deletion of the motif caused a failure of surface 22 expression, as assayed by glycosylation experiments. By sequence alignment, a similar motif, VXXSN (valine-X-X-serine-asparagine), has been identified in Kv1.2 (Li et al., 2000). Normally, KV1.2 requires the help of p subunit in order to be properly trafficked to the plasma membrane. Interchanging the leucine residue (the last residue of VXXSL motif) and asparagine residue (the last residue of VXXSN motif) between Kv1.2 and Kv1.4, caused Kv1.4 to be retained in the ER and Kv1.2 to be efficiently trafficked to. cell surface. Furthermore, the low levels of cell surface expression of Kv1.4L623N were rescued by addition of p subunit and the Kv1.2N469L expressed well at the plasma membrane without the help of the p subunit. These results show that the (V/L)XXS(L/N) motif seems to be involved in a step between oligomerization and Golgi processing, but acts independently of p subunit proteins. Furthermore, the ER export motif is proposed to be a recognition signal for the COPII transport vesicles in the anterograde direction between ER and Golgi network (Klumperman, 2000). Unlike the di-acidic motif, however, the (V/L)XXS(L/N) motif is not important in subunit multimerization (Li et al., 2000). Using chimera studies, Manganas et al., have identified a pore region important to heteromerization (Manganas et al., 2001). Normally, Kv1.1 is retained in the ER and only trafficks to the plasma membrane when heterotetramerized with KV1.4. The authors have identified, using immunofluorescence and Proteinase K experiments, the P-loop domain (linker between S5 and S6 domains) of Kv1.1 as a dominant regulator of the Kv1.1/Kv1.4 heterotetramer trafficking. They postulate that a P-loop motif is in fact an ER-23 retention signal, acting on folding and assembly, and the C-terminal VXXSL is the ER export signal. However, the mechanism behind this retention is unknown. 1.2.3 Regulation of ion channel processing in Golgi network Provided that the newly synthesized proteins have passed the ER QC machinery, they can leave the ER and enter Golgi where they are subjected to further modifications along with QC checkpoints. Golgi network consists of stacks of flattened cisternae with each stack being polarized with three regions: c/'s-Golgi network, medial-Golgi network, and trans-Go\g\ network (Rambourg and Clermont, 1990). Newly synthesized proteins from ER or ER-Golgi intermediate compartment enter the c/s-Golgi network for the initial complex glycosylation. In the medial-Golgi network, the protein undergoes cycles of adding and trimming of the carbohydrate tree. Consequently, the newly synthesized protein enters the trans-Golgi network for completion of glycosylation and plasma membrane sorting or lysosomal degradation. Although a number of studies have shown the molecular mechanisms involved in early secretory trafficking pathways, the QC mechanisms of trafficking from the Golgi to the plasma membrane are much less understood. It is known that the chaperone proteins that are found in the ER are not found in the Golgi network (Castro-Fernandez et al., 2005). In addition, the chemical environment of the Golgi, which is more acidic and contains less number of chaperone proteins, differs from ER environment. However, a few studies of Kir2 homo- and heterotetrameric channels have shown an N-terminal cluster of basic residues and C-terminal tyrosine-dependent (YXX<))) motifs, both important for Golgi exit/sorting (Stockklausner and 24 Klocker, 2003; Hofherr et al., 2005). In one study, Stockklausner et al., postulated that the positively charged N-terminal residues function in Golgi QC by electrostatic interactions with the negatively charged head groups of sphingolipids making up the transport vesicles (Stockklausner and Klocker, 2003). The C-terminal YXX(j> motif has been shown to interact with clathrin coat proteins and may therefore be involved in transport between plasma membrane and Golgi (Kirchhausen, 2000). 25 1.3 Modulation of Kv channel function 1.3.1 Modulation of Kv channels by p subunits Four Kvp genes have been identified in the mammalian genome. Their products are >85% conserved in their amino acid "core" region although they differ in their NH 2 termini (England et al., 1995a; Leicher et al., 1996). Kvp1.1, Kvp1.2 and Kvpi.3 are splice variants of the same gene whereas Kvp2.1, Kvp3.1, and Kvp4.1 are products of three different genes. The crystal structure of Kvp2 has revealed structural similarities to aldo-keto reductases exemplified by a symmetrical tetrameric barrel structure with bound NADP + co-factor (Gulbis et al., 1999). The crystal structure of co-expressed rat Kvp2 with the rat Kv1.1 T1 domain, is shown in Figure 1.4A, and shows Kvp2 hanging under the cytoplasmic T1 domain of Kv channel in a T1 4 - P4 hetero-octamer conformation around a central axis running along its entire length (Gulbis et al., 2000). More specifically, the highly conserved FYQLGDEAM residues of NH 2 terminus in Kv1.1 - Kv1.6 (residues 193 - 201 of NH 2 terminus in Kv1.5) are involved in the interaction with Kvp1 (figure 1.4B) (Sewing etal., 1996). The main functions of Kvp subunits involve modulation of gating, stability, and trafficking of Kv1a channels. Additional proposed functions of Kvp subunits include tethering of Kva channels to other cellular proteins such as cytoskeletal proteins and protein kinases (Levin et al., 1996; Nakahira et al., 1998; Gong et al., 1999; Kwak et al., 1999; Williams et al., 2002). Kvp1 and Kvp3.1 contain inactivating "p ball" 26 Figure 1-4 Crystal structure of T1 domain in complex with p subunit A. A model of the T1 domain located under the TM part of the channel and the p subunit (blue). The model is based on the crystal structure of KcsA potassium channel. The NH 2 terminus is shown to enter the TM pore through the openings between T1-S1 linkers. B. A close-up of the residues involved in the interaction between the T1 domain loop (red) and p subunit (blue) (Gulbis et al., 2000). 27 domains in their NH 2 termini. Therefore, Kvpi and KvB3 isoforms function mainly in an increase of the rate of inactivation in otherwise non-inactivating Kv1a channels (Rettig et al., 1994; Heinemann et al., 1995; Heinemann et al., 1996), or speed up the inactivation of a slowly inactivating channels (Uebele et al., 1996; Uebele et al., 1998). Other functions of Kvp1 and Kvp3 include, a shift in the voltage dependence of activation towards the hyperpolarized direction (England et al., 1995a; Heinemann et al., 1996; Uebele et al., 1996), and slowing of deactivation in Kv1.5 channels (England et al., 1995a; England et al., 1995b; De Biasi et al., 1997). Furthermore, point mutations within the NADP + binding pocket of Kvpi.1, were seen to attenuate its inactivating function in Xenopus oocytes and therefore, couple the p subunit function and the gating of Kv1 channels to the oxidation state of the cell (Bahring et al., 2001). Alternatively, Kvp3 was seen to increase current density of Kv2 channels, probably by assisting in Kv2 trafficking (Shi et al., 1996; Martens et al., 2000). Kvp2 and Kvp4, both of which lack an inactivating domain, are mainly involved in maturation and trafficking of Kva channels. Nagaya et al. have shown that the Kvp2 subunit attaches co-translationally to the hydrophobic residues of the nascent Kv1.2a NH 2 terminus, while Kva is still attached to the ribosome, and appears to assist channel folding in the endoplasmic reticulum (Shi et al., 1996; Nagaya and Papazian, 1997). In a number of Kv1a homo- and hetero-tetramers, the co-translational binding of Kvp2 was shown to increase their stability, their degree of N-linked glycosylation, and their cell surface expression (Shi et al., 1996; Manganas and Trimmer, 2000). In addition, Kvp2 has been shown to increase the current density of Kv4.3 channels without affecting its gating properties (Yang et al., 2001; 28 Deschenes and Tomaselli, 2002). The Kvp4 subunit interacts with the COOH terminus (rather than NH 2 terminus, as seen with other Kva channels) of Kv2.2 channel only, and no other family of potassium channels (Kv1, Kv3 or Kv4) or even the closely related Kv2.1 channel, increasing Kv2.2 channel's surface expression (Fink et al., 1996). Furthermore, point mutations within the NADP + binding pocket of Kv(32 residues, revealed an inability of Kv1.2a trafficking to the plasma membrane in COS-1 cells and an inability of axonal targeting in cultured hippbcampal neurons (Campomanes et al., 2002). Therefore, NADP+ binding and the oxidoreductase activity of p subunit may be crucial for its function. 1.3.2 Modulation of Kv channel function by phosphorylation The a subunits of voltage-gated K + channels can be regulated by both serine/threonine and tyrosine phosphorylation. Phosphorylation acts as a fast regulator of ion channel trafficking and, therefore, adds to the complexity of channel expression profiles. Protein kinase A (PKA) activation was shown to enhance Kv1.1 current density due to increase in protein synthesis (Levin et al., 1996; Winklhofer et al., 2003). Protein kinase C (PKC) activation, despite the presence of a canonical PKC phosphorylation site, does not lead to direct phosphorylation of Kv1.1 channel but indirectly increases its protein synthesis (Winklhofer et al., 2003). Kv1.2 current density was found to be down-regulated by G-protein/PKC phosphorylation while up-regulated by PKA phosphorylation (Huang et al., 1993; Huang et al., 1994) and Kv1.3 current density was decreased by both PKA and PKC activation (Payet and Dupuis, 1992). Kv1.4 and Kv1.5 currents were found to be modulated by tyrosine 29 phosphorylation via Src-dependent and Src-independent binding to Src homology 3 (SH3) domain (Holmes et al., 1996; Nitabach et al., 2002). Upon tyrosine phosphorylation, Kv1.4 and Kv1.5 currents were suppressed via Src-binding to SH3 domain. Conversely, activation of the tyrosine-phosphorylation pathway without Src-binding leads to slowed inactivation kinetics in Kv1.4 as well suppression of Kv1.5 currents. 1.3.2.1 Modulation of Kv channel trafficking by phosphorylation A mechanism of phosphorylation affecting ion channel trafficking has been discovered in Kir1.1 channels. Kir1.1 ion channels, must be phosphorylated at S 4 4 for high surface expression (O'Connell et al., 2005; Yoo et al., 2005). Point mutations of S 4 4 to Alanine eliminates the possibility of phosphorylation and results in ER/Golgi retention; mimicking phosphorylation by mutagenizing S 4 4 to Aspartic acid ( D 4 4 ) , rescues the Kir1.1 surface expression. Even though, the phosphorylation site ( S 4 4 ) is located in the COOH terminus and the ER/Golgi retention motifs are located in the NH 2 terminus, the crystal structure of prokaryotic Kir channel (KirBad.1) shows that the cytoplasmic NH 2 and COOH termini are in close proximity interacting by hydrogen bonding. The authors, therefore, hypothesized that S 4 4 phosphorylation 'masks' either the di-arginine ER retention motif or the basic residue cluster found in the primary sequence of Kir1.1. Similarly, other phosphorylation-induced ER export has been found in NMDA receptors (Scott et al., 2001; Scott et al., 2003), glutamate receptors (Ren et al., 2003), the KDEL receptor (Cabrera et al., 2003), and human cardiac Na channels (Zhou et al., 2002). In these proteins, 30 however, the phosphorylation site and the ER/Golgi retention motifs are located in close proximity. These results imply that both the ER and the Golgi may accumulate a pool of properly folded channels and a phosphorylation switch can modulate a fast delivery to the cell surface. 1.3.3 Modulation of Kv channel function by PDZ domains PDZ domains are modular protein-protein interaction domains of proteins that bind specific C-terminal peptide sequences of membrane proteins (Doyle et al., 1996; Ponting et al., 1997; Sheng and Kim, 1996; Songyang et al., 1997) or other PDZ containing protiens (Brenman et al., 1996). Many proteins contain a number of PDZ domains, allowing for multimerization or scaffolding of protein complexes (Kim et al., 1998; Niethammer et al., 1998; Pawson and Scott, 1997; Tsunoda et al., 1997). MAGUK (membrane-associated guanulate kinases) proteins are part of a major PDZ containing class of proteins involved in the clustering of protein complexes at specialized membrane domains like cell junctions in epithelial cells and synaptic junctions in neurons (Anderson, 1996). In terms of clustering of ion channels, Kim et al., have shown that the PSD-95 family of membrane associated MAGUKs are involved in clustering of Sha/cer-related ion channels (Kim et al., 1995). The direct interaction between Shaker channel and PSD-95 proteins takes place at the cytoplasmic COOH terminus of the potassium channel. This clustering requires a simultaneous binding of cysteine residues located on the NH 2 terminus of PSD-95 (Hsueh and Sheng, 1999). In Kv1.5, PSD-95 was shown to interact directly, resulting in downregulation of Kv1.5 currents (Eldstrom et al., 2002). In contrast, SAP-97 31 (another member of MAGUK family of proteins) was shown to interact with Kv1.5 channels indirectly, resulting in upregulation of the channel's current density (Eldstrom et al., 2003). Direct interaction between PSD-95 and Kv1.2 ion channels does not affect the channel's trafficking but instead increases the stability of the channels at the plasma membrane (Tiffany et al., 2000). Furthermore, the function of PDZ binding domain proteins, like SAP 97, may be modulated by PKC phosphorylation (Mathur et al., 2006). In our study, we have identified a 10 amino acid region in the N-terminal end of the T1 domain that is an important prerequisite for functional expression of Kv1.5 ion channels. A number of N-terminal and T1 domain deletions have been made that resulted in variations in Kv1.5 cell surface trafficking. N-terminal deletions up to the T1 domain and larger deletions in which at least 60% of the T1 domain was deleted yielded functional channels. However, smaller deletions of 15 and 43 amino acids of the T1 domain yielded non-trafficking Kv1.5 channels. Interestingly, addition of first 10 amino acids of the T1 domain to the non-trafficking mutants is able to rescue their trafficking to the plasma membrane. 32 2 METHODS 2.1 Channel Mutagenesis The mammalian expression vector pcDNA3 was used for expression of all Kv1.5 constructs in this study. All primers used were synthesized by Sigma Genosys (Oakville, Ontario, Canada). All constructs were sequenced to check for errors during PCR amplification and to ensure correct reading frame. AN119 Kv1.5, AN163 Kv1.5, AN189 Kv1.5 and AN209 Kv1.5 mutants were generated as previously described (Kurata et al., 2002). Kv1.5 AN 135 was generated by PCR amplification of hKv1.5 pcDNA3 encoding residue 135 to the COOH-terminus of hKv1.5 using a primer of sequence CCCAAGCnTl7GGGCACCCTGGCGCAGTTC at the 5'end, which includes a Hindlll site (introduced restriction site is underlined and introduced start codon is italicized) and CCGCGCGGACCCAGAGCTC primer at the 3' end. The resultant product was cloned into wtKv1.5 on pcDNA3 as a Hindlll - BspEI fragment, replacing a similarly-bounded fragment from the wild-type channel. The T112o-i4o+AN163 Kv1.5 mutant was constructed in two parts that were PCR amplified and then ligated. For preparation of Kv1.5 pcDNA3 encoding amino acids 163 to COOH terminus, wtKv1.5 pcDNA3 digested with Seal at the 5' end and Notl at the 3' end was PCR amplified using primer of sequence CAGCTGGGCACCCTGGCGTACTTCTTCGACCGCAACCG (start of aa 163 is underlined) at the 5' end and AAGACCGAGACGATGGCGATG at the 3'end to yield a ~300bp product. For the preparation of the "T1120-140" part, wtKv1.5 pcDNA3 was 33 digested with Hindlll at the 5'end and Seal at the 3' end yielding a ~500bp product that was again digested with Drall to yield a ~450pb product. The ~450bp product was PCR amplified using a primer of sequence CCCAAGCTT4 TGCAGCGCGTCCACATCAACATC at the 5' end and CGCCAGGGTGCCCAGCTG at the 3' end to yield a ~60bp product. This ~60bp product was ligated with the ~300bp product and then subcloned back into analogous location of wtKvl .5 pcDNA3 digested with Hindlll at the 5'end and BspEI at the 3'end. T1(1)+AN163 Kv1.5 and T1 (2)+AN 163 Kv1.5 were generated by PCR amplification of T1 1 2o-i4o +AN163 Kv1.5 pcDNA3 construct using CCCAAGCTTyArGCAGCGCGTCCACATCAACATCTCCGGGTACTTCTTCGACCG CAACCGGC and CCCAAGCTT/ATGCTGCGCTTTGAGACGCAGCTG primers at the 5' end, respectively, introducing Hindlll restriction sites. At the 3' end, a AAGACCGAGACGATGGCGATG primer was used in both constructs for PCR amplification. The PCR products were digested with Hindlll at the 5'end and BspEI at the 3'end, followed by subcloning into similarly digested hKv1.5 pcDNA3 to replace the analogous region. T1(1)+AN140 Kv1.5 and T1(2)+AN140 Kv1.5 were generated by PCR amplification of hKv1.5 in pcDNA3 using CCCAAGCTT/ATGCAGCGCGTCCACATCAACATCTCCGGGCAGTTCCCCAACAC ACTCCTGG and CCCAAGCTT>A TGCTGCGCTTTGAGACGCAGCTG primers in the forward direction, respectively, introducing a Hindlll restriction site. The primer CCTCATCCTCGCGGAAGC was used in the 3' direction for both constructs. The 34 PCR products were digested with Hindlll at the 5'end and BspEI at the 3'end, and subcloned into simil digested hKv1.5 pcDNA3 to replace the analogous region. Site-directed mutagenesis of Kv1.5 was performed using QuickChange method by Stratagene. For preparation of A131-133ANI4O and Ai 3i. 1 33AN163 mutants, the primers used were GCTTATGCTGCGCTTTGcGgCGgcGCTGGGCACCCTGGCGC and GCTTATG CTGCGCTTTGcGgCGgcGCTGGGCACCCTGGCGTAC, respectively, and their complements (small case codons represent changes to create the point mutations). For preparation of Ai66AN140 and A166AN163 mutants, the primers used were GGAACGAGTACTTCTTCGcCCGCAACCGGCCCAGCTTCG and CACCCTGGCGTACTTCTTCGcCCGCAACCGGCCCAGCTTCG, respectively, and their complements. For RXA 1 (R 1 6 7 N 1 6 8 A 1 6 9 ) , RXA 2 (R 1 8 4 L 1 8 5 A 1 8 6 ) , and RXA 3 ( R 2 1 2 F 2 1 3 A 2 1 4 ) point mutations, the primers used were GTACTTCTTCGACGCCAACCGGCCCAGCTTCG, CTACCAGTCCGGGGGCGCCCTGCGGAGGCCGGTC, GACGAGGCCATGGAGGCCTTCCGCGAGGATGAG, respectively, and their complements. 2.2 Cell culture and transfection Human embryonic kidney (HEK)293 or COS-7 cells were cultured in minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in an air, 5%C02 incubator. Cultured cells were transiently transfected using Lipofectamine 2000 (Invitrogen) reagent and method. 35 For electrophysiological experiments, one day before the transfection, the cells were plated on a 1u,m wide sterile glass coverslip in 35-mm Petri dishes with 10-20% confluence. 1-2p.g of pGFP expressing vector was co-transfected with 1.5 - 2.5ug of channel DNA in 100u,L serum-free medium and 3uJ of Lipofectamine 2000 added to dishes of HEK293 cells containing a total of 1ml of MEM +10% FBS. GFP was used to allow for the identification of transfected cells during electrophysiological experiments which were performed 24hr after transfection. For immunocytochemical applications, 2 or 3 days before transfection, the cells were plated on a 1.5u.m wide sterile glass coverslip 35-mm Petri dishes with 40-50% confluence. 2.5 - 3u.g of channel DNA in 100 u.l serum-free medium and 5 -6uJ of Lipofectamine 2000 was added to dishes of HEK293 cells containing a total of 1ml of MEM + 10% FBS. COS-7 cells, used for immunocytochemical experiments, were also co-transfected with pGFP vector in for easy visual identification of the cytoplasm. For the glycerol treated cells, 2.5-3u.g of channel DNA in 100uJ serum-free medium and 5 - 6uJ of Lipofectamine 2000 were added to dishes of HEK293 cells containing a total of 1ml of MEM +10% FBS + 10% Glycerol. -20 hours after transfection, the glycerol was slowly diluted out, over a period of 1 or 2 hours, by addition of MEM+10% FBS media. The cells were allowed to recover from the glycerol treatment for at least 1 hr prior to immunocytochemistry. The immunocytochemical experiments were performed 24hr after transfection. For immunoblotting applications, the cells were plated in a sterile T-25 flask 5-7 days before transfection and transfected once grown to 90-100% confluence. 4.5 36 u,g of channel DNA in 500 uJ serum-free medium and 12 or 18pJ of Lipofectamine 2000 were added to dishes of HEK293 cells containing a total of 3ml of MEM + 10% FBS. The immunoblotting experiments were performed 24hr after transfection. 2.3 Electrophysiology Coverslips containing cells were removed from the incubator before experiments and placed in a superfusion chamber (volume 250 u.l) containing the bath solution at ambient temperature (22-23°C), and perfused with bathing solution throughout the experiments. Transfected cells were selected for using fluorescence microscopy. Whole-cell current recording and data analysis were performed using an Axopatch 200B amplifier and pClamp 9.2 software (Axon Instruments, Foster City, CA, USA). Patch electrodes were fabricated using thin-walled borosilicate glass (World Precision Instruments, Sarasota, FL, USA). Electrodes had resistances of 1-3 MQ when filled with the filling solution. Capacitance compensation and 80% series resistance compensation were routinely used in all whole cell recordings. Measured series resistance was between 1 and 4 MQ for all recordings. When the series resistance changed during the course of an experiment, data were discarded. Data were sampled at 10-20 kHz and filtered at 5-10 kHz. Membrane potentials were not corrected for small junctional potentials between bath and pipette solutions. No leak subtraction was used when recording currents. Data for K + current analysis and presentation were leak subtracted off-line if required. For recording K + current, patch pipettes contained (in mM): NaCI, 5; KCI, 135; Na 2ATP, 4; GTP, 0.1; MgCI2, 1; EGTA, 5; HEPES, 10; and was adjusted to pH 7.2 with KOH. The bath solution 37 contained (in mM): NaCI, 135; KCI, 5; HEPES, 10; sodium acetate, 2.8; MgCI2, 1; CaCb, 1; and was adjusted to pH 7.4 with NaOH. All chemicals were from Sigma Aldrich Chemical (Mississauga, ON, Canada). Statistical significance between groups of data was determined using one-way ANOVA, with pairwise multiple comparisons. A value of p<0.05 was deemed statistically significant. Data are presented as mean±S.E.M. 2.4 Immunocytochemistry 24hr post-transfection, HEK293 cells or COS-7 cells were washed 3 times with ice-cold 1X Phosphate-buffered saline (PBS; 137 mM NaCI, 2.7 mM KCI, 4.3 mM Na 2 HP0 4 , 1.4 mM KH 2 P0 4 ) . Cells were then fixed at room temperature for 12 min using 4% formaldehyde and followed by incubation in Quenching buffer (50mM Glycine, 1X PBS) for 10 min to remove autofluorescence. After three 5 min washes with 1X PBS at room temperature, the cells were blocked and permeabilized using Blocking solution (2% BSA and 0.2% Triton X-100 in 1X PBS) for 30min at room temperature. Cells were then incubated with mouse monoclonal antibody to the T7 tag (1:1000; Novagen) or a rabbit anti-Kv1.5 polyclonal antibody to the C-terminal region of Kv1.5 (1:500; generated in our laboratory, aa 537-553 EQGTQSQGPGLDRGVQR) in blocking solution and incubated for 2 hr at room temperature or overnight at 4°C. In the Calnexin labeling colocalization experiments, the cells were incubated with rabbit anti-calnexin polyclonal antibody (1:200; Stressgen) and mouse anti-T7 monoclonal antibody (1:1000; Novagen) in blocking solution for 2 hr at room temperature. Following three 5 min washes with 1X PBS at 38 room temperature, cells were incubated with Alexa 594-conjugated goat anti-mouse IgG antibody and/or Alexa 488-conjugated goat anti-rabbit IgG antibody (1:1000; Molecular Probes) for 1 hr at room temperature. After incubation with 300nM 4',6-Diamidino-2-phenylindole (DAPI; Molecular Probes) to stain the nuclei, the cells were washed three times for 5 min with 1X PBS at room temperature. Cells were then mounted with 10 ul of a 90% glycerol + 2.5% w/v DABCO-PBS solution. Images of labeled cells were observed under Nikon C1 laser scanning confocal microscope (Nikon DEclipse C1, Melville, NY) at 60X oil immersion objective and processed using the operation EZ-C1 software for Nikon C1 confocal microscope (Nikon). Images were later viewed and prepared using Adobe Photoshop software packages. 2.5 Proteinase K treatment and cell lysis 24 hrs post-transfection, HEK293 cells were washed 3 times with ice-cold 1X PBS and then treated with Proteinase K buffer (10 mM Hepes, 150 mM NaCI, 2mMCaCI2; pH 7.4) without (control) or with 200 fig/ml Proteinase K for 20 - 30 min at 37°C in an air, 5%C0 2 incubator (Manganas et al., 2001; Zhou et al., 1998). The reaction was stopped using 1.3 ml of Quenching Buffer (25 mM EDTA, 6mM PMSF), in which the cells were harvested by centrifugation at 1000Xg at 4°C. The cells were then washed three times for 5 min in 1X PBS and again centrifuged at 1000xg at 4°C. Then, the cells were lysed in Lysis buffer (LB; 25mM Phosphate Buffer at pH7.4, 150mM NaCI, 2.5mM EDTA, 10% Glycerol) with 1% IGEPAL or 1% Triton detergent for 1 hr at 4°C or on ice with occasional mixing. Additional protease 39 inhibitors (1 mM lodoacetamide, Aprotinin, 1 mM PMSF) were added to the LB to prevent degradation of the protein. The lysates were then centrifuged at 10 OOOxg for 25 min at 4°C to separate supernatant and pellet fractions. 2.6 Western Blotting Cell extracts were run on 8% or 10% SDS - PAGE in Running buffer and transferred for 2hr at 60V or overnight at 20V in Transfer buffer according to standard protocol. PVDF membranes were blocked for either 30min at 37°C or 1.5hr at room temperature in 10% Blocking solution (10% w/v non-fat milk powder in Rinse buffer; lOOmM NaCI, 10mM Tris-CI pH8.0, 1mM EDTA, 0.1% Tween 20). The membranes were then incubated with rabbit anti-Kv1.5 polyclonal antibodies directed against C-terminal Kv1.5 protein (1:5000; generated in our laboratory, aa 537-553 EQGTQSQGPGLDRGVQR) in 5% Blocking Solution (5% w/v non-fat milk powder in Rinse buffer) for either 1 hr at 37°C or overnight at 4°C. After four 15min washes at 37°C or at room temperature in Rinse buffer, the membranes were incubated with secondary goat anti-rabbit antibodies conjugated to horseradish peroxidase (HRP; Jackson Immunoresearch, West Grove, Pa. USA) and 5% Blocking solution for 30min at 37°C. Following four 15min washes at 37°C in Rinse buffer, the antibody - protein interactions were visualized by using Western Lightning Chemiluminescence Reagent Plus (Perkin Elmer Life Sciences) and detected on X-ray film (Kodak). 40 3 R E S U L T S 3.1 Small deletions of T1 domain affect the trafficking of Kv1.5 Previously it was shown in our lab that a naturally occurring truncated version of Kv1.5, (missing 209 amino acids from the NH 2 terminus; AN209), was able to produce measurable macroscopic currents with few changes in the inactivation properties (Kurata et al., 2001). This channel lacks the bulk of the Kv1.5 NH 2 terminus including -80% of the channel's T1 domain. Smaller deletions of T1 domain, namely AN135 (missing 15 amino acids from the T1 domain), AN140 (missing 20 amino acids from the T1 domain), and AN163 (missing 43 amino acids from the T1 domain), produced channels that failed to functionally express as evidenced by an inability to measure ionic currents (Kurata et al., 2002). Therefore, we set out to investigate whether this lack of macroscopic currents is due to the channels' inability to traffic to the plasma membrane or due to an inability of the channels to function after insertion into the plasma membrane. We have constructed a number of NH2-terminal and T1 deletion mutants (Figure 3.1), namely, AN119 (the whole T1 domain is intact), AN135, AN163, AN189 (deletes -70 amino acids of the T1 domain), and AN209 (deletes >80% of the T1 domain). Figure 3.1 shows schematic diagrams of Kv1.5 deletion mutants. The diagrams represent the cytoplasmic NH 2 terminus where black fill shows the boundaries of T1 domain and grey fill represents the rest of the NH 2 terminus. 41 Figure 3-1 Schematic representation of Kv1.5 N-terminal deletion mutants. The transmembrane domains are shown for the first mutant only and left out, thereafter, for clarity. The mutants were prepared as described in "Methods". Black fill represents the T1 domain and grey fill represents the rest of the NH2-terminus. SE stands for surface expression. In order to determine each channel's ability to traffic to the plasma membrane, the localization of the constructs were assayed by immunofluorescence/confocal microscopy and by testing the channel's sensitivity to Proteinase K enzyme (Figure 3.2). Immunofluorescence assay of transiently transfected AN189 Kv1.5 mutant in HEK293 cells, shows plasma membrane as well as some intracellular staining (red staining) (Figure 3.2A). Wt Kv1.5, used as a positive control, shows clear plasma membrane staining, as do AN119 Kv1.5 and AN209 Kv1.5 (not shown). On the other hand, confocal images of transiently transfected AN135 Kv1.5 and AN163 Kv1.5 mutants in HEK293 cells, show aggregated and diffuse intracellular staining without any plasma membrane labelling. Therefore, these results show that deletion of the first half of the T1 domain impairs trafficking of the channel perhaps caused by some type of missfolding. Deletion of the NH2-terminus (AN119) excluding T1 domain and deletion of >60% of T1 domain (AN 189 and AN209) yields properly assembled channels that are able to reach and insert into the plasma membrane. 42 A f WT Kv1.5 « AN135Kv1.5 — AN163 Kv1.5 _ AN189 Kv1.5 B WtKv1.5 PK . + AN135 Figure 3-2 Small T1 domain deletions abolish Kv1 .5 surface expression. A. Confocal images of transiently transfected HEK293 cells expressing AN135, AN163, AN189, and Wt Kv1.5. Each image is a single optical slice of fixed cells taken through the middle of the cell. Red staining represents Kv1.5 protein and blue staining represents nuclear staining (DAPI). The size bars are 10um. B. Western blot of post-nuclear lysates from control and Proteinase K treated HEK293 cells transiently transfected with AN135, AN163, AN189 and Wt Kv1.5 (control). Where applicable, cells were treated with 20ug/ul Proteinase K for 30min, followed by regular lysis and immunoblotting protocol. Left lane on the western blots represents untreated protein under regular lysis and immunoblotting protocol. 43 The results obtained by confocal microscopy were confirmed by subjecting the mutants to Proteinase K (PK) digestion (Figure 3.2B). PK is a non-specific serine protease that is unable to penetrate cellular membrane and is, therefore, ineffective in clearing intracellular proteins. However, PK will efficiently digest proteins or parts of proteins that are exposed to the extracellular environment and thus, combined with subsequent immunoblotting assay, PK digestion can be used as an assay for detecting the presence of transmembrane proteins at the cell surface (Manganas et al., 2001). In Kv1.5 expressed at the plasma membrane, PK enzyme cleaves the extracellular loops connecting the transmembrane domains of the channel and the mature pool of proteins will be detected at a much smaller size on the western blot. If the protein is not inserted in the cellular membrane, the PK enzyme will not cleave the intracellular Kv1.5 proteins and there will be no difference between the untreated and treated samples in the western blot. Figure 3.2B shows an immunoblot of Wt Kv1.5, AN135 Kv1.5, AN163 Kv1.5, and AN189 Kv1.5. Untreated Wt Kv1.5 protein runs as a doublet at around 83kDa, where the upper band represents mature, fully glycosylated pool of proteins present at the plasma membrane and the lower band represents immature, core-glycosylated pool of proteins mostly likely present in the ER (Eldstrom et al., 2002; Li et al., 2000). As seen in Figure 3.2B, treatment of wt Kv1.5 with PK enzyme results in digestion of mature pool of proteins which are then detected at a much smaller size of about 32 kDa. This band represents the S6 transmembrane domain with the cytoplasmic COOH-terminal fragment of wt Kv1.5 because the antibody we used detects the COOH-terminus of Kv1.5. The immature pool of proteins, as expected, is not affected by PK treatment. Similarly, the bands in 44 the untreated AN189 Kv1.5 lane run as doublet at ~ 47kDa. PK treatment of AN189 Kv1.5 eliminates the upper band and has no effect on the lower band. The sizes of AN135 Kv1.5 and AN163 Kv1.5 proteins have been calculated to be 53kDa and 49.5kDa, respectively. Untreated AN 163 Kv1.5 runs as a single band at around 50kDa on the western blot. However, PK digestion of AN163 Kv1.5 has no effect on this band. Therefore, it would appear that AN163 Kv1.5 is not present at the plasma membrane. Similarly, AN 135 Kv1.5 is resistant to PK digestion even though it runs as a doublet at around 50kDa on a western blot. Overall, these results confirm that T1 deletions of at least 15 residues but less than 43 residues prevent the channel from trafficking and insertion to the cell membrane. To determine whether the T1 and NH2-terminal deletion mutants present at the cell surface are functional, we tested for currents using whole cell patch clamping methods (Figure 3.3). Figure 3.3A shows representative macroscopic current traces of wt Kv1.5, pGFP, AN119 Kv1.5, AN135 Kv1.5, AN163 Kv1.5 and AN209 Kv1.5. GFP (green fluorescent protein) current traces show the endogenous current since these cells were transfected with GFP DNA carrying vector only, without any Kv1.5 protein, and therefore serve as a negative control. Similar to the magnitude of the endogenous macroscopic current in HEK293 cells, previously shown to be less than 1nA (Yu and Kerchner, 1998; Zhu et al., 1998), cells transfected with pGFP alone exhibited currents of <1nA. The macroscopic currents of AN 135 Kv1.5 and AN 163 Kv1.5 were also measured to be less than 1nA, consistent with failure to express at the cell surface (figure 3.3A). 45 Control (GFP) 5nA 100 ms AN163 Kv1.5 5nA| +80 mv I I 100 ms AN119 Kv1.5 I ' . +20 mV AN 135 Kv1.5 5nA I S 5nA| 40 ms AN209 Kv1.5 5nA 40 ms +80 mV ^ 1 20nA 40ms B o c i—t-D CD W -< 1.5 H G F P A119 A135 A163 A209 wtKv1.5 Figure 3-3 Small T1 deletions can not produce whole-cell macroscopic currents whereas other deletion mutants can. A. Representative current traces from HEK293 cells transiently transfected with Wt, AN119, AN 135, AN163, AN 189, and AN209 Kv1.5 or pGFP . The cells were held at -80 mV and stepped to voltages ranging between -70mV to +80 mV in 5 or 10 mV steps for at least 100 ms. G F P was co-transfected enable identification of transfected cells. B. Summary of averaged current density of the above mutants at +60 mV depolarization normalized to cell capacitance. The results are statistically significant ( AN119 and AN209 vs Wt and v s G F P , p<0.05) 46 Alternatively, whole cell current traces of AN119 Kv1.5, AN 189 Kv1.5 (not shown) and AN209 Kv1.5 deletion mutants show large macroscopic currents of about 20nA; and wt Kv1.5 peak currents can reach as much as 100nA. Therefore, these channels are functional at the plasma membrane. Figure 3.3B shows a summary plot of current density values, which represents averaged macroscopic current measured at +60mV depolarization and normalized to cell capacitance (nA/pF). The opening threshold of Wt Kv1.5 channel is around -40mV to -50mV, which means that at +60mV majority of the ion channels are open. The average current densities of AN 135 Kv1.5 and AN 163 Kv1.5 mutants are the same as average current density of pGFP transfected cells, and therefore these mutants are not functional. The average current densities of AN119 Kv1.5 and AN209 Kv1.5 was calculated to be about 1nA/pF at +60mV, which is about one-third of the current density of transiently transfected Wt Kv1.5 (calculated to be 3nA/pF). Therefore, these results confirm that AN119 Kv1.5 and AN209 Kv1.5 are not only present in the plasma membrane but are also functional at the plasma membrane. 3.2 AN163 Kv1.5, but not AN135 Kv1.5, is localized to the ER Immunofluorescence studies showed that AN135 Kv1.5 and AN163 Kv1.5 aggregate in the cellular cytoplasm (figure 3.2A). Perhaps, if we can identify their exact location in the cytoplasm, we can better determine the reason for their aggregation and their lack of trafficking. Calnexin is a resident ER membrane protein thought to be involved in the processing of proteins during their biogenesis in the ER 47 (Manganas and Trimmer, 2004). Therefore, we used this protein to mark the location of ER in HEK293 cells and to determine whether or not Kv1.5 non-trafficking mutants colocalize with it. Figure 3.4 shows confocal images of cells expressing channel mutants stained with anti-Kv1.5 and anti-calnexin. The top three images show that AN135 KV1.5 (red staining) and calnexin (green staining) do not co-localize. Thus, the AN 135 KV1.5 mutant is not retained in the ER. However, the lower three images show that AN163 Kv1.5 (red staining) and calnexin (green staining) do co-localize (yellowish staining), indicating that AN163 Kv1.5 is retained in the ER. 3.3 Glycerol rescues the expression of AN163 Kv1.5 Several studies have successfully employed chemical and pharmacological chaperones to rescue the trafficking of non-trafficking mutants (Sato et al., 1996; Brown et al., 1996; Zhou et al., 1999; Ficker et al., 2000; Kagan et al., 2000; Gong et al., 2004). One example of a chemical chaperone is glycerol which has been shown to rescue the expression of missfolded proteins like CFTR AF508 (Sato et al., 1996; Brown et al., 1996) and hERG (Ficker et al., 2000; Kagan et al., 2000; Zhou et al., 1999) mutants. Although the exact mechanism of its action is unknown, glycerol is thought to facilitate correct folding by acting as a protective agent by physico-chemical interactions with the missfolded protein and perhaps preventing ER chaperones from binding to the missfolded protein (Qu et al., 1997). Other proposed mechanisms include slowing of protein synthesis in order to help the folding of the 48 protein and altering the energy barrier for the formation of a properly folded protein conformation (Gekko and Timasheff, 1981; Welch and Brown, 1996). We set out to investigate whether glycerol could rescue the trafficking of our non-trafficking mutants. If the channel mutants are missfolded or misassembled, glycerol treatment might rescue their trafficking or at least eliminate their aggregates. Figure 3.5 shows the confocal images of AN135 Kv1.5 and AN163 Kv1.5 treated with 10% glycerol. The last image in figure 3.5 represents wt Kv1.5 treated with 10% glycerol, which was used as a positive control of channel capable of trafficking. The staining pattern of glycerol treated AN163 Kv1.5 (red staining) has been changed from aggregated staining to what looks like Golgi and plasma membrane staining with a notable absence of any aggregation. Therefore, it appears that the surface expression of this mutant has been rescued by the treatment, and implies that the 163 residue Nhb-terminal deletion causes the channel to misfold or misassemble. Similarly, the immunostaining pattern of AN135 Kv1.5 was also changed from an aggregated pattern to more diffuse intracellular staining, however, there does not seem to be clear plasma membrane or even Golgi staining. 49 Figure 3-4 AN163 Kv1.5 but not AN135 colocalizes with calnexin Confocal images of transiently transfected HEK293 cells expressing AN135 and AN163 Kv1.5. Each image is a single optical slice of fixed cells taken through the middle of the cells. Red staining represents Kv1.5 protein, blue staining represents nuclear staining (DAPI), and green staining represents ER marker calnexin. Colocalization between Kv1.5 mutants and calnexin is represented in the "Merge" image as orange to yellow color. The size bars are 10 pm. Figure 3-5 10% Glycerol rescues the expression of AN163 Kv1.5 Confocal images of transiently transfected HEK293 cells expressing AN135, AN163 and Wt Kv1.5 (positive control). Each image is a single optical slice of fixed cells taken through the middle of the cells. The cells were incubated at 37°C with 10% Glycerol, during transfection. Red staining represents Kv1.5 protein and blue staining represents nuclear staining (DAPI). The size bars are 10 pm. 50 3.4 First 10 amino acids of T1 domain rescue surface expression of non-trafficking mutants So far we showed that the AN119 Kv1.5 deletion mutant characterized by deletion of all NH2-terminal amino acids up to T1 domain, is able to assemble, traffic, and express at the cell surface. Deletion of less than 50% of the T1 domain of Kv1.5 (deletion of 15 T1 domain residues in AN135 Kv1.5 and deletion of 43 T1 domain residues in AN163 Kv1.5) yields likely misfolded proteins that are retained in the ER and/or are unable to insert into the plasma membrane. Since adding the first 20 amino acids of T1 domain (T1I2O-HO) to AN 135 Kv1.5 yields functional channels (T1 i2o- i4o + AN140 or AN119 Kv1.5), we decided to add the same region to the AN163 Kv1.5 mutant (T1i2o-i4o+AN163). In order to find out whether this new mutant TI120-140+AN163 Kv1.5 is able to rescue the trafficking of AN163 Kv1.5, we subjected T1-I20-140+AN163 Kv1.5 to immunofluorescence and whole cell patch clamping studies. Figure 3.6 shows a schematic diagram of the new T1 mutants. 51 Figure 3-6 Schematic representation of Kv1.5 T1 mutations The transmembrane domains are shown for the first mutant only and left out, thereafter, for clarity. The mutants were prepared as described in "Methods". Black fill represents the T1 domain and grey fill represents the rest of the NH2-terminus. T1(1) (amino acids 120-128) and T1(2) (amino acids 129-140) were inserted into both AN163 and AN140. SE stands for Surface Expression. 52 Figures 3.7 and 3.8 show the immunofluorescence of T1 mutants in HEK293 and C O S - 7 cells, respectively. The COS-7 cell line was used to confirm the observations seen in HEK293 cells as well as eliminate any "cell-specific" occurrences from HEK293 cells. In addition, C O S - 7 cells have a large cytoplasm and a smaller nucleus, compared to HEK293 cells, and are thus a better choice for following intracellular localization and trafficking of proteins. Immunostaining results from both HEK293 cells (Figure 3.7) and COS-7 cells (Figure 3.8) show that the T1i2o-i4o+AN163 Kv1.5 mutant is distributed throughout the cytoplasm, ER and Golgi, as well as the surface of the cell. The staining of T1-i2o-i4o+AN163 Kv1.5 mutant looks similar to immunofluorescence of T1i2o-i4o+AN140 Kv1.5 (AN119 Kv1.5) mutant in these cells, which means that addition of the first 20 residues of T1 domain appears to rescue the trafficking of AN163 Kv1.5 to the plasma membrane. From an examination of the Kv1.2 T1 domain crystal structure, it is apparent that the first 20 amino acids of T1 domain (T1-i2u-i4o) form an antiparallel (3-sheet structure. More specifically, the first 10 amino acids of the T1 domain (N-terminal residues 120-128; T1(1)) form the first part of the antiparallel p-sheet and amino acids 11-20 of T1 domain (N-terminal residues 129-140; T1(2)) form the second part (or antiparallel part) of the p-sheet structure (represented in Figure 3.6). These two parts of the p-sheet are connected by a random coil. Therefore, in light of the fact that T1i 29-uo can be split into two p-sheet halves, we constructed two additional mutants adding either the first or the second part of the p-sheet structure to both AN 135 Kv1.5 and AN 163 Kv1.5 mutants. 53 T1 ,20 -140 + \ N 1 6 3 K v 1 . 5 T1(1) + \ N 1 6 3 K v 1 . 5 T1(2) +AN163 K v 1 . 5 4 i T1120-140 +AN140 K v 1 . 5 J • T1(1) +AN140 K v 1 . 5 / T1(2) + \ N 1 4 0 K v 1 . 5 t • « < • I y ' .V Figure 3-7 Addition of first 10 amino acids of T1 domain rescues non-trafficking mutants in HEK293 cells. Confocal imaging of transiently transfected HEK293 cells expressing T1 1 2 0 - i4o + AN163, Ti(1)+AN163, and T1(2)+AN163 Kv1.5 mutants as well asT1 1 2 0 -i4o+ AN 140 (same as AN 119), T1(1)+AN140, and T1(2)+AN140 Kv1.5 mutants. The arrows point to membrane staining. Each image represents a single optical slice through the middle of fixed cells. Red staining represents Kv1.5 protein and blue staining represents nuclear staining (DAPI). The size bars are 10 pm. 54 Figure 3-8 Addition of first 10 amino acids of T 1 domain rescues non-trafficking mutants in C O S - 7 cells. Confocal imaging of transiently transfected COS-7 cells expressing T1i2o-i4o+ AN163, T1(1)+AN163, and T1(2)+AN163 Kv1.5 mutants as well asT1 1 2 0-i4o+ AN140 (same as AN119), T1(1)+AN140, and T1(2)+AN140 Kv1.5 mutants. The arrows point to membrane staining. Each image represents a single optical slice through the middle of fixed cells. Red staining represents Kv1.5 protein, blue staining represents nuclear staining (DAPI), and green staining represents G F P used for identification of the size of cytoplasm. The size bars are 10 um. 55 As illustrated in Figure 3.6, adding the first 10 residues of T1 domain to AN 135 Kv1.5 and AN163 Kv1.5 mutants, yields TKD+AN140 Kv1.5 and TKD+AN163 Kv1.5 mutants, respectively. Adding only the second part of the p-sheet structure (residues 11-20 of the T1 domain) to AN 135 Kv1.5 and AN 163 Kv1.5 mutants, yields T1(2)+AN1_40 Kv1.5 and T1(2)+AN163 Kv1.5, respectively. Immunofluorescence images of all transiently transfected T1(1) and T1(2) mutants in COS-7 and HEK293 cells, show substantially more intracellular staining resembling the staining pattern of T1i2o-i4o+AN163 Kv1.5 (red staining) and eliminating aggregation (Figs. 3.7, 3.8). In addition, T1(1)+AN140 Kv1.5 and T1(1)+AN163 Kv1.5 mutants show Golgi and some plasma membrane staining whereas T1(2)+AN140 Kv1.5 and T1(2)+AN163 Kv1.5 mutants do not. T1(2)+AN140 Kv1.5 and T1(2)+AN163 Kv1.5 mutants show limited intracellular staining, as seen better in COS-7 cells, and lack plasma membrane staining. Therefore, adding the first 10 amino acids of T1 domain to non-trafficking mutants seems to rescue the trafficking of both AN135 Kv1.5 and AN163 Kv1.5, whereas adding the second 10 amino acid region does not. In parallel experiments the macroscopic currents from these mutants were measured using whole-cell patch clamping. Current traces of Wt Kv1.5, TI120-140+AN163 Kv1.5, T1(1)+AN163 Kv1.5 and T1(2)+AN163 Kv1.5 are shown in figure 3.9A. All three mutants produced relatively small current compared to wt Kv1.5. Figure 3.9A shows that T1(2)+AN163 Kv1.5 mutants produced, mostly, currents of less than 1nA (similar to GFP transfected controls) with about 3/15 cells producing currents slightly above 1nA, whereas T1(1)+AN163 Kv1.5 produced current of about 15nA. 56 A T1,2M40+AN163 T1(1)12o-i28+AN163 T1(2)129.,40+AN163 Kv1.5 * V 1 S Kv1.5 • 8 0 m V B T1,2o.«o+AN163 T1(1)+AN163 T1(2)+AN163 Figure 3-9 Addition of first 10 amino acids of T1 domain results in functional channels. A. Representative current traces from wt, T 1 1 2 o - i 4 o + AN163 , T1(1)+AN163, T1(2)+AN163 Kv1.5 transiently transfected in HEK293 cells. The cells were held at -80 mV and stepped to voltages ranging between -70 mV to +80 mV in 10 mV steps for at least 100 ms. GFP was co-transfected with pcDNA3 in order to identify transfected cells. B. Summary of averaged current density at +60 mV depolarization normalized to cell capacitance. The results are statistically significant (T1120-140+ AN163, T1(1)+AN163, T1(2)+AN163 vs. wtKv1.5; p<0.05). Interestingly, T1-|2o-i4o+AN163 Kv1.5 produced medium-size currents, falling between T1(1)+AN163 Kv1.5 and T1(2)+AN163 Kv1.5 peak currents, with 1 cell producing currents of 6nA and 5 cells producing currents of 1.5nA - 2.5nA. Figure 3.9B shows the summary plot of current density values, calculated from averaged macroscopic current measured at +60mV depolarization and normalized to cell capacitance (nA/pF). The current density of T1i2o-i4o+AN163 Kv1.5 mutant is about 0.2nA/pF, meaning that even though T1i20-i4o+AN163 Kv1.5 channels seem to traffic towards the plasma membrane, the channel can not insert into or is not functional at the plasma membrane. The current density of T1(2)+AN163 Kv1.5 is less than 0.1nA/pF, and therefore, T1(2)+AN163 channels are not functional. On the other hand, the current density of T1(1)+AN163 Kv1.5 was measured and calculated to be 0.8nA/pF, showing that this mutant is able to both express and be functional at the plasma membrane. Therefore, the first 10 amino acids of T1 domain rescue the surface expression of AN163 Kv1.5. However, compared to wt Kv1.5, the current density of T1(1)+AN163 Kv1.5 is significantly lower (>2.5 nA/pF, Figure 3.9B, inset). Whole-cell patch clamp data from T11 2 0.i4o+AN140 Kv1.5 expressing cells is shown in Figure 3.3 (same as AN119 Kv1.5) and its average current density is close to 1nA/pF. We did not obtain whole-cell patch clamp data of the T1(1)+AN140 Kv1.5 and T1(2)+AN140 Kv1.5 mutants, since the fluorescence images of these mutants resemble the ones of T1(1)120-i28+AN163 Kv1.5 and T1(2) 1 2 9 . 1 4 o + AN163 Kv1.5, respectively. 58 3.5 Point mutations within the T1 domain have an effect on surface expression Since we have found that the first 10 residues of the Kv1.5 T1 domain rescue the surface expression of AN135 Kv1.5 and AN163 Kv1.5, we decided to attempt to determine whether a specific amino acid motif or region was responsible for the rescue of the non-trafficking mutants. Recently, a study was published where the authors used computer homology modeling of the Kv1.5 T1 domain (and other Kv1 channels) based on the crystal structure of the Shaker channel T1 domain (Liu et al., 2005). From this model, it would appear that important residues involved in intra-domain T1 interactions reside in the first 20 amino acids of the T1 domain (TI120-140) (figure 3.10). In particular, E 1 3 2T 1 3 3 Q 1 34 residues are predicted to form side chain interactions with D166 on adjacent monomers during assembly of the Kv1.5 tetramer. Therefore, we performed point mutations on these residues to Ala in T1(2)+AN163 (AAA132-134AN163 and D166AAN163) and T1(2)+AN140 (AAA132-134AN140 and D166AAN140) backgrounds. Figure 3.11 shows the immunofluorescence of the D166AAN163 Kv1.5 and D166AAAN140 Kv1.5 in HEK293 cells demonstrate an aggregated staining pattern compared to T1 mutants without point mutations and wt Kv1.5. AAA132-134AN163 Kv1.5 and AAA132-134AN140 Kv1.5 showed more cytoplasmic and some plasma membrane staining. Therefore, it seems that mutating D i e e to Alanine (D166AAN163 and D166AAN140) results in aggregation of the T1 mutants and mutating E 1 3 2 T i 3 3 Q i 3 4 to Alanine (AAA132-134AN163 and AAA132-134AN140) results in thorough intracellular and some plasma membrane staining. 59 A B Figure 3-10 Representation of intersubunit interaction in tetramer formation A. Crystal structure of Shaker T1 domain forming a tetramer. The blue labelling shows the location of E ^ T ^ O ^ and D-|6  residues contributing to the tetramer structure. B. Hypothetical intersubunit interaction of highly polar residues in Kv1.5, based on homology modeling of ShakerT1 crystal structure. Only side chain residues and their interactions are shown (Liu et al., 2005). 60 Figure 3-11 Effects of key residues point mutations in T1 domain on trafficking. Confocal images of transiently transfected HEK293 cells expressing D166AAN163, AAA132-134AN163, D166AAN140, and AAA132-134AN140 Kv1.5 mutants and wt Kv1.5 (positive control). Each image represents a single optical slice through the middle of fixed cells. Red staining represents Kv1.5 protein and blue staining represents nuclear staining (DAPI). The size bars are 10 pm. 61 However, we did not confirm these observations by testing the functionality of these mutants at the plasma membrane by electrophysiology. 3.6 Point mutations in the NH2-terminal di-Arginine ER retention motif cause a slight rescue of AN163 Kv1.5 trafficking Thus far, we have found that AN 135 Kv1.5 and AN 163 Kv1.5 are unable to traffic to the plasma membrane. In addition, we have shown that AN163 Kv1.5 is retained in the ER. A number of amino acid sequences have been identified to be involved in ER retrieval/retention in transmembrane proteins including ion channels. If the protein is missfolded such that its retention/retrieval motif(s) are exposed, these motifs are thought to be recognized by ER resident chaperone proteins and the newly synthesized protein is retained in the ER. In a number of different protein families, including K A T P (Zerangue et al., 1999); CFTR (Owsianik et al., 2003); GABA (Margeta-Mitrovic et al., 2000); hERG (Kupershmidt et al., 2002); and Na v channels (Zhou et al., 2002), RXR (arginine-X-arginine) motifs serve this function. Therefore, we decided to look for the di-arginine motif(s) in our non-trafficking mutants. AN 135 Kv1.5 does not contain any RXR motifs in the region between amino acid 135 and 163. AN 163 Kv1.5 has three RXR motifs, located at positions 167 - 169 ( R 1 6 7 N 1 6 8 R 1 6 9 . R X R ^ _ 1 8 g ( R 184 L 185 R 186 . ^ r x r 2 ) ] ^ _ ^ ( R 2 1 2 F 2 1 3 R 2 1 4 ; aka RXR 3). Therefore, we constructed point mutations converting one, two, or three RXR motifs in the AN163 Kv1.5 mutant to RXA (arginine-X-alanine). 62 Figure 3.12A shows immunofluorescent confocal imaging in HEK293 cells and figure 3.12B shows the confirming whole-cell patch clamping data. From confocal imaging we can see that mutating the di-arginine motif changes the Kv1.5 staining (red) from aggregated pattern, as seen in AN163 Kv1.5 and RXA 1 +(R 1 6 7 N 1 6 8 A 1 6 9 ) , to more diffuse intracellular pattern as well as some cell membrane staining, as seen in RXA 2 (R 167 N168 A169 a n d R i 8 4 L i 8 5 A i 8 6 j a n d R X A 3 ( R 1 6 7 N 1 6 8 A 1 6 9 , R 184 L185 A186 a n d R 212 R 213 A 214 ) S j m j | a r | y j t h e wh 0| 'e-cell current density (figure 3.12B) at +60mV shows a slight increase from 40pA/pF in AN 163 Kv1.5 and RXA1+AN163 Kv1.5, to ~100pA/pF in RXA2+AN163 Kv1.5 and RXA3+AN163 Kv1.5. These results show, therefore, that a sequential removal of the di-arginine motifs show a very small increase in AN163 Kv1.5 surface expression associated with a more diffuse distribution of the channels in the cell. 63 B 120 I 100 9 | 80 o 5 60 3 5 40 I 20 0 (n=8) (n=4) i - i r i (n=6) (n=4) i AN 163 RXA1 RXA2 RXA 3 Figure 3-12 NH2-terminal di-arginine ER retention motif point mutations in Kv1.5 show a small rescue of AN163 Kv1.5 trafficking. A . Confocal images of transiently transfected HEK293 cells expressing single, double, and triple arginine to alanine mutations, encompassing three potential NH2-terminal di-arginine ER retention signals of AN 163. Each image represents a single optical slice through the middle of fixed cells. Red staining represents channel protein and blue staining represents nuclear staining (DAPI ) . The size bars are 10 pm. B. Summary of averaged current density of the above mutants at +60 mV depolarization normalized to cell capacitance. The results are statistically significant (p<0.05). 4 D I S C U S S I O N A N D C O N C L U S I O N S 4.1 Discussion We have found that deletion of N-terminal -120 amino acids of Kv1.5 has a significant effect on the cell surface protein expression, as measured using the patch clamp technique (Figure 3.3). Similarly, deletion of the whole NH2 terminus, including more than 60% of the T1 domain (Kv1.5 AN209) causes problems for the normal surface expression of Kv1.5. However, smaller deletions of 15 to ~40 amino acids at the start of the T1 domain impair the normal trafficking of Kv1.5 far more seriously, as determined by immunofluorescence as well as PK experiments and whole cell patch clamp. AN135 and AN163 Kv1.5 mutants form aggregates in the cytoplasm and are not able to traffic to the plasma membrane (figure 3.2A). Co-localization studies have shown that AN 163 is most likely retained in the ER as evidenced by co-localization with an ER marker calnexin, whereas AN135 did not colocalize with calnexin suggesting lysosomal or other organelle localization. Addition of the first 10 amino acids of the T1 domain (T1(1)+AN140 and T1(1)+AN163) to non-trafficking Kv1.5 mutants AN 135 and AN 163, eliminated their aggregation and allowed trafficking to the cell surface. 4.1.1 AN163 Kv1.5 can not traffic to the plasma membrane Interestingly, we have found that AN 163 is retained in the ER and its surface trafficking can be rescued by the help of a chemical chaperone, glycerol. Previous 65 studies have shown that newly synthesized proteins are retained in the ER if they are missfolded, misassembled, or can not properly tetramerize with their accessory subunits (Kowalski et al., 1998; Kopito, 1997). Glycerol as well as other chemical chaperones have been shown to repair missfolded proteins or help missfolded proteins to escape the ER QC machinery (Sato et al., 1996; Zhou et al., 1999; Gong et al., 2004). Although the exact mechanism of its action is unknown, glycerol is thought to facilitate correct folding by acting as a protective agent by physico-chemical interactions with the missfolded protein and perhaps preventing ER chaperones from binding to the missfolded protein (Qu et al., 1997). Other proposed mechanisms include slowing of protein synthesis in order to help the folding of the protein and altering the energy barrier for the formation of a properly folded protein conformation (Gekko and Timasheff, 1981; Welch and Brown, 1996). In our study, addition of glycerol changed the distribution of A N 135 and A N 163 Kv1.5 mutants from intracellular aggregates to more diffuse intracellular localization and possibly allowed cell surface expression (figure 3.4). Unfortunately, we were not able to measure whole cell currents of the glycerol treated, otherwise non-trafficking mutants, because glycerol quenches the GFP signal needed for identification of transiently transfected cells during patch clamping experiments. Attempts at biochemical assays, like Proteinase K digestion, were unsuccessful because a great majority of cells detached during glycerol treatment. Further experiments need to be done to determine whether these channels are able to insert into the plasma membrane and, if they do, whether they are functional. 66 As stated above, Zerangue et al. have shown that during missfolding and incorrect assembly of a new protein a particular motif, RXR, is exposed and recognized by the ER QC machinery (Zerangue et al., 1999). As a result, the missfolded proteins are retained in the ER until the mistake is corrected or are shunted to the degradation pathway. These and other studies have shown that during correct folding (Owsianik et al., 2003; Kupershmidt et al., 2002) and correct assembly with accessory subunits (Zerangue et al., 1999; Margeta-Mitrovic et al., 2000), the di-arginine motif(s) is/are masked. In our study, AN163 Kv1.5 has been found to localize to the ER, as determined by calnexin co-localization and immunofluorescence studies (Figure 3.4). The primary sequence of AN 163 Kv1.5 has three RXR motifs located at the N-terminal-most position of the mutant, at positions 167 - 169 (R 1 6 7 N 1 6 8 R 1 6 9 ) , 184 - 186 ( R 1 8 4 L 1 8 5 R 1 8 6 ) , and 212 - 214 ( R 2 1 2 F 2 1 3 R 2 1 4 ) . Therefore, it is possible that some or all of the ER retention motifs are exposed in AN163 Kv1.5 mutant and that these may be responsible for the lack of plasma membrane expression of AN163 Kv1.5. In fact, we showed that mutating the last Arg of each di-arginine motif(s) results in a small increase in current density and sequential recovery from aggregation from RXA 1 to RXA 2 to RXA 3 (A = Alanine) (Figure 3.11). The reason for only a small increase in current density could be the fact that we did not mutate both arginines of the RXR motif since it has been shown before that both arginines play a role in the ER retention and so both arginines must be masked (Zerangue et al., 1999; Margeta-Mitrovic et al., 2000; Standley et al., 2000; Kupershmidt et al., 2002; Zhou et al., 2002; Owsianik et al., 2003). Alternatively, it is possible that the RXR motifs are suppressed by phosphorylation 67 and/or binding with PDZ proteins, as shown previously in cardiac sodium channel and NMDA receptors (Standley et al., 2000; Scott et al., 2001; Zhou et al., 2002). It is also possible that these ER retention motifs do not play any functional role in Kv1.5 channel trafficking in HEK293 cells. 4.1.2 First 10 amino acids of T1 domain may be involved in masking ER retention motif(s) Addition of the first 10 amino acids of the T1 domain (amino acids 120-128 in the wt Kv1.5) to AN 163 Kvi.5 (T1(1)+AN163 Kv1.5) rescues cell surface expression of the mutant, as shown by electrophysiology and confocal imaging experiments. However, we have not been able to determine the exact mechanism by which the rescue is affected. It is possible that this 10 amino acid region of T1 domain (this region forms the antiparallel p-sheet structure) contains a trafficking motif necessary for ER export, but examining the primary amino acid sequence reveals no known trafficking motifs. It is also possible that this region is involved in "masking" of one or all RXR motifs during correct folding of the T1 domain, as seen when observing the crystal structure of Kv1.2 ion channel (Minor et al., 2000). Kv1.2 and Kv1.5 amino acid sequences are about 60% homologous, but the sequence similarity between their T1 domains is more than 90%. Therefore, it is safe to assume that the secondary folding of the Kv1.5 and Kv1.2 ion channel T1 domains are very similar. Yet another possibility is that the 10 amino acid region, that forms part of the antiparallel p-sheet structure, is involved in intermolecular interactions contributing to the tetramer formation and/or stability of the tetramer T1. 68 Region of N-terminal residues 129 - 140 (residues 9 - 20 of T1 domain; T1(2)+AN163 Kv1.5) was not able to rescue the surface expression of non-trafficking AN 163 Kv1.5, as shown by electrophysiology and confocal imaging experiments. Even though these residues appear to mask the RXR motifs, deletion of the first 10 amino acids of T1 domain may disrupts the p-sheet structure. Disruption of the p-sheet structure may contribute to missfolding of a part or the whole NH2 terminus, leading to exposure of the ER retention motifs. 4.1.3 p-sheet structure may play a role in protein trafficking Recently, it has been shown that a coiled-coil structure is necessary for correct trafficking of cardiac potassium channel KCNQ1 (Kanki et al., 2004). Coiled coil structures consist of two a helices, oriented antiparallel to each other (Monera et al., 1994; Monera et al., 1996; Myszka and Chaiken, 1994). Disruptions or mutations in the coiled coil structure in COOH terminus of KCNQ1 channel, result in LQT phenotype (Kanki et al., 2004). This region does not contain any trafficking motifs except a leucine zipper, which when disrupted without affecting the secondary structure, resulted in normal surface expression. Coiled coil structures have also been shown to be necessary for protein interaction in G A B A receptors where G A B A B i and G A B A B 2 interact via coiled-coil to form a mature functional channel and, at the same time, "mask" the RXR motif(s) (Kammerer et al., 1999; Kuner et al., 1999). Disruption of this interaction and subsequent exposure of the di-arginine motif(s) causes retention of the receptor subunits in the ER (Margeta-Mitrovic et al., 2000; Pagano et al., 2001). 69 Similarly, exposed strands of p-sheets are important for protein-protein interaction and disruption of these secondary structures can result in protein aggregation. Such a mechanism has been implicated in a number of neurodegenerative disorders (Richardson and Richardson, 2002; Siepen et al., 2003). As an example, defensin HNP-3 protein, involved in the mammalian immune response, consists of three p-sheet strands in each monomer that hydrogen bond with the neighboring monomer to form a six-stranded p sheet (Hill et al., 1991). This P sheet conformation contributes to a stable and compact structure, preventing the small protein from being digested by proteases. In our study, we have seen that the disruption of the first 20 amino acids of the T1 domain, which forms an antiparallel p-sheet structure, by either deletion or point mutations, results in aggregation of the Kv1.5 mutant channels. The crystal structures of Shaker and the Kv1.2 T1 domain, as well as the homology models for T1 domain of Kv1 family of channels, indicate that several interactions between monomers take place via the p sheet structures (Kobertz et al., 2000; Cushman et al., 2000; Minor et al., 2000; Liu et al., 2005). Therefore, it is possible that the aggregation observed in immunofluorescent studies is due to the inability of the monomer to form a tetrameric structure. Just like defensin protein, disruption of the two stranded p-sheet structure may threaten the stability of the tetrameric T1 domain and/or the whole channel leading to collapse and missfolding. In addition, NH2-terminal residues 155-165 form another small antiparallel p-sheet structure. Therefore, it is possible that the reason for lack of trafficking of AN163 Kv1.5 is the disruption of this p-sheet. Incidentally, this small antiparallel p-70 sheet structure has been determined to be involved in the (3-subunit interaction. Perhaps, disruption of this antiparallel p-sheet structure may have an effect on the ion channel folding and/or assembly in the ER and, as a result, is caught by the QC machinery. Further experiments need to be done in order to determine whether any of the above hypotheses are relevant in the trafficking of the AN 163 Kv1.5 mutant. 4.1.4 Importance of specific residues in T1(2) for trafficking of Kv1.5 A study, using computer homology modeling of the Kv1.5 T1 domain based on the crystal structure of Shaker channel T1 domain, showed that certain residues are important in intermolecular interactions contributing to the tetrameric structure (Liu et al., 2005). In their model, the authors propose that Kv1.5 N-terminal residues 132 - 134 (E132T133Q134 in Kv1.5) on one monomer are involved in side chain interactions with residue 166 (D-|66 in Kv1.5) on adjacent monomer (Figure 3.10B). Interestingly, Ei32Ti 3 3 Qi 3 4 are located in the second half of the 20 amino acid region of T1 domain, i.e., T1(2)+AN140 and T1(2)+AN163. Therefore, we have performed point mutations of these residues to Ala (A132A133A134 and A i 6 6) in both T1(2)+AN140 and T1(2)+AN163 Kv1.5 mutants. Our immunofluorescence studies of D166AAN140, D166AAN163 and AAA132-134AN163 identified an aggregated staining pattern unlike the immunofluorescence of T1(2)+AN140 and T1(2)+AN163 mutants which showed mostly diffuse intracellular staining (compare Figure 3.7 and Figure 3.10). AAA132-134AN140 also showed increased cytoplasmic as well as some plasma membrane staining (Figure 3.11). Therefore, residues including E i 3 2 T i 3 3 Q i 3 4 and 71 D-166 may play a role in the tetramerization of the channel. In addition, the A166 point mutation, similarly, causes significant aggregation of both T1(2)+AN140 and T1(2)+AN163 Kv1.5 as would be expected from its hypothesized interaction with E132T133Q134. 4.1.5 Mutation of residues in T1 domain that are involved in gating may abolish protein trafficking The T1 domain has been implicated in the gating mechanics of Kv1 ion channels, previously (Cushman et al., 2000; Minor et al., 2000). The exact mechanism is not well understood but the authors hypothesize that the gating process forces a global conformational change on T1, affecting the positions and interactions of a number of polar residues within the T1 domain; i.e., the T1 domain may be physically linked to the changes that take place in the transmembrane pore. The Kv1.5 NH2-terminal,residues thought to be involved include N124 F131E132T133 T137 F-I64 D-166 D173 Vi89 D194 and D i 9 8 (Minor et al., 2000). It is possible that the interactions of these residues are not only important in their gating function but also in the proper folding and assembly of the T1 domain while the channel is synthesized in the ER. Therefore, a deletion or mutation of these residues may result in missfolding that may be detected by the QC machinery preventing their exit from the ER. Alternatively, the trafficking of these Kv1.5 mutants might not be compromised or slowed down, but their gating mechanics may be altered, resulting in low macroscopic current. These hypotheses require further testing. 72 4.1.6 AN135Kv1.5 Just like AN163, the other Kv1.5 non-trafficking mutant in our study, AN135 also forms aggregates in the cytoplasm of HEK293 cells (see figure 3.2A). We were unable to determine why the AN135 Kv1.5 mutant is unable to traffick to the plasma membrane or why it aggregates in the cytoplasm. The primary amino acid sequence of Kv1.5 between residues 135 and 163 contains no known ER retention motifs or any other previously identified trafficking motif(s). Our experiments do show, however, that AN135 Kv1.5 is not retained in the ER, as shown by the lack of co-localization with calnexin in immunofluorescence experiments. In addition, its aggregation staining seems to be attenuated by the help of glycerol to a much smaller extent than the AN 163 mutant. Since this mutant is not retained in the ER, it may be folded and assembled properly. In addition, it may be able to leave the ER and enter the Golgi network. In this scenario, the QC machinery in the Golgi does not allow the sorting and the exit of the protein to the plasma membrane and instead the mutant may be shunted into the degradation pathway. Since the Golgi QC checkpoints involved in protein trafficking are not well understood, it is difficult to say how a protein that enters the Golgi would be retained there and subsequently enter the degradation pathway. Alternatively, since we could not detect the AN135 Kv1.5 localization in the ER, it is more likely that the mutant is shunted into the degradation pathway directly from the ER. During this process, called the ER-associated degradation (ERAD), missfolded and/or unassembled proteins are recognized by the ERAD machinery and are retrotranslocated into the cytoplasm where they are degraded by the proteasome (Abriel and Staub, 2005). 73 Proteinase K experiments provided useful information. Whereas AN163 Kv1.5 runs as a single band in the western blot before and after the treatment with the enzyme (Figure 3.2B), consistent with its retention in the ER, AN135 Kv1.5 runs as a double band in the Western blots. Interestingly, both bands of AN135 are resistant to the Proteinase K treatment (Figure 3.2B). While it is conceivable that the upper band is a result of complex glycosylation associated with entrance into Golgi network it is much more likely that the two bands represent degraded pool(s) of AN 135 proteins. In addition, both bands of AN135 mutant run in the Western blot at a smaller molecular weight than AN163 Kv1.5 (at about 47kDa, whereas the theoretical molecular weight of un-glycosylated AN 135 Kv1.5 is 53kDa) and the fact that this mutant was rapidly cleared out of most cells, confirming the possibility that this mutant is in the degradation pathway. Addition of the first 10 amino acids of the T1 domain, T1(1)+AN140 Kv1.5, rescues the trafficking and surface expression of AN135, just as was the case for AN163 Kv1.5 (Figure 3.7 and 3.8). Observing the crystal structure of the Kv1.2 T1 domain, the 20 amino acid region that is deleted in the AN 163 does not form any particular secondary structure. However, this region consists of a number of large hydrophobic residues and contains a small antiparallel p-sheet at positions -155 -165 (Minor et al., 2000). Therefore, it is possible that the first 10 amino acids of the T1 domain that form the antiparallel p-sheet structure may act as a "stabilizer" of the overall T1 domain, as discussed above. When the "stabilizer" p-sheet is deleted, the T1 domain cannot fold properly due to its exposed large hydrophobic residues (residues 135 - 163) and, as a result, forms aggregates. In addition, if the T1 74 domain can not fold correctly, it may also be possible that this leads to exposure of the ER retention RXR motifs. Adding the second part of the 20 amino acid region of T1 domain to the AN135 mutant (T1(2)+AN140; N-terminal residues 129-140) does not seem to rescue the trafficking of the AN135 mutant to the cellular membrane (Figure 3.7 and 8), most likely for the same reasons as listed above for T1(2)+AN163 Kv1.5. Further experiments must be done to determine whether there are any new trafficking motifs involved or whether it is the incorrect folding of the T1 domain that is responsible for the lack of trafficking and aggregation of AN135 Kv1.5. 4.1.7 AN119, AN189, and AN209 deletions yield functional Kv1.5 channels with low current density We have found that even though AN189 and AN209 Kv1.5 constructs are missing more than 60% of T1 domain, they are still able to traffic, insert, and be functional in the plasma membrane. Perhaps these results are not surprising since we have deleted two of the di-arginine ER retention motifs and therefore, the ER QC chaperone proteins that are involved in recognition of these motifs may not be able to bind to the missfolded protein. Furthermore, it has been shown previously that ion channels without a T1 domain can still fold correctly, tetramerize, and function at the plasma membrane (Zerangue et al., 2000), but the tetramerization efficiency of these channels is compromised. Therefore, it would appear that a significant fraction of AN189 and AN209 Kv1.5 constructs are correctly assembled and trafficked to the 75 plasma membrane, but at much slower rates than wt Kv1.5. Also, it has been shown that a channel without the T1 domain is less stable than a wt channel (Strang et al., 2001). This means that these proteins may easily be degraded along their secretory pathway and therefore, smaller numbers of ion channels are able to make it to the plasma membrane. As a result, the measured macroscopic current densities are lower than those of channels with intact T1 domains (wt). We have not measured the kinetic properties of most of these constructs but we have shown (Kurata et al., 2001) a small shift in the half-activation voltage of AN209 Kv1.5 in the hyperpolarized direction compared to wt Kv1.5. All of the theories above may contribute to the low macroscopic current density of AN 189 and AN209 Kv1.5 mutants compared to that of wt Kv1.5. Further studies will be necessary to properly evaluate these possibilities. Deletion of the N-terminal 189 or 209 amino acids removes the attachment site for (3 subunits and most of the T1 residues thought to play roles in gating of voltage-gated potassium channels (Minor et al., 2000; Cushman et al., 2000). The p subunit interaction loop is located in the T1 domain of Kv1 channels (Gulbis et al., 2000). In Kv1.5 ion channels, the residues thought to be involved in this interaction include amino acids 156 - 163 (FDPLRNEY) most of which, as inferred from the crystal structure of the Kv1.2 T1 domain, are part of the antiparallel p-sheet discussed earlier. Even though Kv1.5 is able to traffic to the plasma membrane without the help of a p subunit, it has been shown that p subunits alter Kv1.5 kinetics (England et al., 1995a; Uebele et al., 1996; De Biasi et al., 1997; Uebele et al., 1998). In addition, studies of Kv1.2 ion channel synthesis found that p subunits 76 assist in the folding of the newly synthesized protein, as soon as its NH 2 terminus is translated and enters the ER from the translocon (Shi et al., 1996; Nagaya and Papazian, 1997). Therefore, it is possible that there are ER-resident QC proteins that somehow check for the p subunit interaction. If this is true, a lack of p subunit interaction site might slow down the QC processes of the nascent AN 189 and AN209 Kv1.5 protein and result in reduced ion channel number at the cell surface. Interestingly, the AN119 Kv1.5 has an intact T1 domain.but its whole-cell current density is 1/3 that of wt Kv1.5 ion channel. This means that the long NH 2 terminus, preceding the T1 domain, may be important in the biogenesis and trafficking of Kv1.5 ion channels. In fact, it is interesting that Kv1.1 and Kv1.2 ion channels which have very short NH 2 termini preceding their T1 domains are only able to express at the cell surface as either a heterotetramer, in the case of Kv1.1, or with the help of a p subunit, in the case of Kv1.2. The long NH 2 terminus of Kv1.5 contains two SH3-binding domains as well as additional proline-rich domains. SH3 domains have been implicated in recruitment of tyrosine kinases to a protein. Recently, our lab has identified the importance of the first SH3 domain in Kv1.5 endocytosis via a dynein-dependent pathway (Choi et al., 2005). The authors showed that deletion of N-terminal amino acids 65 to 93, which include both SH3 domains, has no effect on the currents upon treatment with p50, compared to control (no p50 treatment) and wt Kv1.5 (increase in current density with p50 treatment). Although it is not known whether an SH3 domain is involved, trafficking from the ER to the Golgi also requires dynein (Presley et al., 1997; Hamm-Alvarez et al., 1993; Valetti et al., 1999; Presley et al., 2002). Perhaps deleting the SH3 domain(s), which 77 are located between residues 65 - 93, may have a small impact on the forward trafficking between ER and Golgi. Similarly, the AN119 mutant is missing the two SH3 domains and therefore, its trafficking to the plasma membrane may be slowed down for the same reasons. Phosphorylation has been further implicated in the regulation of Kv1.5. Kv1.5 phosphorylation by src tyrosine kinases results in a decrease of Kv1.5 current density (Holmes et al., 1996), and inhibition of Protein Kinase A (PKA) results in a decrease of Kv1.5 current density (Mason et al., 2002). The latter occurs despite the fact that PKA activation has no effect on Kv1.5 current density (Mason et al., 2002). Therefore, the trafficking of Kv1.5 channel is directly and indirectly modulated by different phosphorylation kinases and removal of their sites of action from the target protein will likely have an effect on current density and trafficking of the ion channel. Another reason for the downregulation of AN119 Kv1.5 relative to wild-type may involve a-actinin. N-terminal residues 63 - 150 of Kv1.5 have been shown to interact with a-actinin (Maruoka et al., 2000; Cukovic et al., 2001)., This interaction very probably ties Kv1.5 channels to the actin cytoskeleton, linking them to regulatory kinases and phosphatases which have been shown to up-regulate KV1.5 current in X. laevis oocytes (Mason et al., 2002). AN119 Kv1.5 mutant lacks more than 60% of the a-actinin interaction domain in Kv1.5. Therefore, disruption of this cluster of ion channels/actin and associated regulatory enzymes and phosphatases may affect the trafficking of AN119 Kv1.5 to the plasma membrane or its retention there and, therefore, its current density level. 78 A novel PDZ-binding domain has been found in the NH 2 terminus of Kv1.5, comprising roughly N-terminal amino acid residues 1 7 - 6 5 (Eldstrom et al., 2002). Members of the PDZ-binding family of proteins interact directly or indirectly with Kv1 ion channels exerting different effects on the ion channel function. For example, PSD95 was shown to interact with Kv1.5 ion channel directly resulting in downregulation of Kv1.5 whole-cell current density (Eldstrom et al., 2002). Alternatively, SAP97 was shown to interact with Kv1.5 ion channel indirectly, resulting in upregulation of Kv1.5 whole-cell current density (Eldstrom et al., 2003). Direct interaction between PSD95 and Kv1.2 ion channels does not affect the channel's trafficking, but instead has been shown to increase the stability of the ion channel at the plasma membrane (Tiffany et al., 2000). Therefore it is possible that the deletion of the NH 2 terminus with PDZ-binding and actin-binding domains weakens the channel's stability or its ability to cluster at the plasma membrane, ultimately resulting in lower whole cell current density. 4.2 Conclusions Our studies have uncovered a number of interesting phenomena. We have identified a 10 amino acid region at the start of the T1 domain that is an important prerequisite for functional Kv1.5 ion channels. N-terminal deletions up to the T1 domain (AN119 Kv1.5) and large deletions of the T1 domain (AN189 and AN209 Kv1.5) have no effect on the surface expression of Kv1.5 but minor effects on the function of Kv1.5. Small deletions at the start of the T1 domain (AN 135 and AN 163 Kv1.5) yield mutants unable to. traffick to the plasma membrane. We found that the 79 non-trafficking mutants aggregate in the ER, are probably degraded by the proteosome of the ERAD, and are rescued from aggregation by treatment with the chemical chaperone glycerol. Furthermore, addition of the first 10 amino acids of the T1 domain, N-terminal residues 120 - 128 (or residues 1-8 of T1 domain), rescues the non-trafficking mutants from aggregation and renders them functional at the cell surface. This T1 region does not contain any trafficking motifs, but it forms an antiparallel p-sheet structure and contains key residues involved in channel tetramerization. Our results are inconclusive in terms of the exact mechanisms that determine the lack of trafficking and low macroscopic current density of these particular mutants. Instead a number of hypothetical mechanisms have been listed throughout the discussion. To summarize, it is possible that the trafficking of AN135 and AN163 Kv1.5 mutants is abolished because of missfolding of the T1 domain and/or the NH 2 terminus that can lead to protein aggregation. The protein aggregation may be caused by number of states, such as exposure of ER retention motifs, disruption of important p-sheet secondary structures, disruption of tetramerization contacts, or exposure of large hydrophobic residues. Additionally, the trafficking and function of the AN 119, AN 189, and AN209 Kv1.5 mutants may be affected by deletion of important sites involved in the modulation of Kv1.5 channel function, such as phosphorylation and interaction with auxiliary subunits. It is also possible that a combination of these individual processes affects the Kv1.5 cell surface expression. Further studies will be necessary in order to determine the relative roles of these activities in the biogenesis of the Kv1 family of ion channels. 80 R E F E R E N C E S Abriel.H. and Staub.O. (2005). Ubiquitylation of ion channels. Physiology. (Bethesda.) 20, 398-407. Anderson, J.M. (1996). Cell signalling: MAG UK magic. Curr. Biol. 6, 382-384. Andersson.H., Kappeler.F., and Hauri.H.P. (1999). Protein targeting to endoplasmic reticulum by dilysine signals involves direct retention in addition to retrieval. J . Biol. Chem. 274, 15080-15084. Antonny.B. and Schekman,R. (2001). ER export: public transportation by the COPII coach. Curr. Opin. Cell Biol. 13, 438-443. Archer.S.L, Souil,E., Dinh-Xuan,A.T., Schremmer.B., Mercier.J.C., El Yaagoubi,A., Nguyen-Huu,L, Reeve,H.L., and Hampl.V. (1998). Molecular identification of the role of voltage-gated K+ channels, Kv1.5 and Kv2.1, in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes. J. Clin. Invest 101, 2319-2330. Aridor.M. and Balch.W.E. (1996). Membrane fusion: timing is everything. Nature 383, 220-221. Attali.B., Wang.N., Kolot.A., Sobko.A., Cherepanov.V., and Soliven.B. (1997). Characterization of delayed rectifier Kv channels in oligodendrocytes and progenitor cells. J . Neurosci. 17, 8234-8245. Bahring.R., Milligan.C.J., Vardanyan.V., Engeland.B., Young,B.A., Dannenberg.J., Waldschutz.R., Edwards.J.P., Wray.D., and Pongs.O. (2001). Coupling of voltage-dependent potassium channel inactivation and oxidoreductase active site of Kvbeta subunits. J . Biol. Chem. 276, 22923-22929. Balch.W.E., McCaffery.J.M., Plutner.H., and Farquhar.M.G. (1994). Vesicular stomatitis virus glycoprotein is sorted and concentrated during export from the endoplasmic reticulum. Cell 76, 841-852. Bezanilla.F., Perozo.E., Papazian,D.M., and Stefani.E. (1991). Molecular basis of gating charge immobilization in Shaker potassium channels. Science 254, 679-683. Bonifacino.J.S. and Traub.L.M. (2003). Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. 72, 395-447. Brenman.J.E., Chao.D.S., Gee.S.H., McGee,A.W., Craven.S.E., Santillano.D.R., Wu,Z., Huang,F., Xia.H., Peters.M.F., Froehner.S.C., and Bredt.D.S. (1996). Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alphal-syntrophin mediated by PDZ domains. Cell 84, 757-767. 81 Brown,C.R., Hong-Brown,L.Q., Biwersi.J., Verkman.A.S., and Welch.W.J. (1996). Chemical chaperones correct the mutant phenotype of the delta F508 cystic fibrosis transmembrane conductance regulator protein. Cell Stress. Chaperones. 1, 117-125. Cabral.C.M., Choudhury.P., Liu.Y., and Sifers.R.N. (2000). Processing by endoplasmic reticulum mannosidases partitions a secretion-impaired glycoprotein into distinct disposal pathways. J . Biol. Chem. 275, 25015-25022. Cabrera,M., Muniz.M., Hidalgo.J., Vega.L, Martin,M.E., and Velasco.A. (2003). The retrieval function of the KDEL receptor requires PKA phosphorylation of its C-terminus. Mol. Biol. Cell 14, 4114-4125. Campomanes.C.R., Carroll,K.I., Manganas,L.N., Hershberger.M.E., Gong.B., Antonucci.D.E., Rhodes,K.J., and Trimmer.J.S. (2002). Kv beta subunit oxidoreductase activity and Kv1 potassium channel trafficking. J. Biol. Chem. 277, 8298-8305. Castro-Fernandez,C, Maya-Nunez,G., and Conn,P.M. (2005). Beyond the signal sequence: protein routing in health and disease. Endocr. Rev. 26, 479-503. Chang.X.B., Cui,L., Hou.Y.X., Jensen.T.J., Aleksandrov.A.A., Mengos.A., and Riordan.J.R. (1999). Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis. Mol. Cell 4, 137-142. Choi.W.S., Khurana.A., Mathur.R., Viswanathan.V., Steele,D.F., and Fedida.D. (2005). Kv1.5 surface expression is modulated by retrograde trafficking of newly endocytosed channels by the dynein motor. Circ. Res. 97, 363-371. Clement-Chomienne.O., Ishii.K., Walsh,M.P., and Cole.W.C. (1999). Identification, cloning and expression of rabbit vascular smooth muscle Kv1.5 and comparison with native delayed rectifier K+ current. J . Physiol 515 (Pt 3), 653-667. Conti.L.R., Radeke.C.M., and Vandenberg.C.A. (2002). Membrane targeting of ATP-sensitive potassium channel. Effects of glycosylation on surface expression. J . Biol. Chem. 277, 25416-25422. Cosson.P. and Letourneur.F. (1994). Coatomer interaction with di-lysine endoplasmic reticulum retention motifs. Science 263, 1629-1631. Cukovic.D., Lu.G.W., Wible.B., Steele.D.F., and Fedida.D. (2001). A discrete amino terminal domain of Kv1.5 and Kv1.4 potassium channels interacts with the spectrin repeats of alpha-actinin-2. FEBS Lett. 498, 87-92. Curran,M.E., SplawskiJ., Timothy,K.W., Vincent.G.M., Green,E.D., and Keating,M.T. (1995). A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell 80, 795-803. 82 Cushman.S.J., Nanao.M.H., Jahng.A.W., DeRubeis.D., Choe.S., and Pfaffinger.P.J. (2000). Voltage dependent activation of potassium channels is coupled to T1 domain structure. Nat. Struct. Biol. 7, 403-407. De Biasi.M., Wang.Z., Accili.E., Wible.B., and Fedida,D. (1997). Open channel block of human heart hKv1.5 by the beta-subunit hKv beta 1.2. Am. J . Physiol 272, H2932-H2941. de Souza.N.F. and Simon.S.M. (2002). Glycosylation affects the rate of traffic of the Shaker potassium channel through the secretory pathway. Biochemistry 41, 11351-11361. Delisle,B.P., Anson.B.D., Rajamani.S., and January.C.T. (2004). Biology of cardiac arrhythmias: ion channel protein trafficking. Circ. Res. 94, 1418-1428. Deschenes.l. and Tomaselli,G.F. (2002). Modulation of Kv4.3 current by accessory subunits. FEBS Lett. 528, 183-188. Dominguez.M., Dejgaard.K., Fullekrug.J., Dahan.S., Fazel.A., Paccaud.J.P., Thomas,D.Y., Bergeron,J.J., and Nilsson,T. (1998). gp25L/emp24/p24 protein family members of the cis-Golgi network bind both COP I and II coatomer. J . Cell Biol. 140, 751-765. Doyle,D.A., Lee.A., Lewis.J., Kim.E., Sheng.M., and MacKinnon,R. (1996). Crystal structures of a complexed and peptide-free membrane protein-binding domain: molecular basis of peptide recognition by PDZ. Cell 85, 1067-1076. Doyle,D.A., Morais.C.J., Pfuetzner.R.A., Kuo.A., Gulbis.J.M., Cohen.S.L., ChaitB.T., and MacKinnon,R. (1998). The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science 280, 69-77. Eldstrom.J., Choi.W.S., Steele.D.F., and Fedida.D. (2003). SAP97 increases Kv1.5 currents through an indirect N-terminal mechanism. FEBS Lett. 547, 205-211. Eldstrom.J., Doerksen.K.W., Steele.D.F., and Fedida.D. (2002). N-terminal PDZ-binding domain in Kv1 potassium channels. FEBS Lett. 531, 529-537. Ellgaard,L. and Helenius.A. (2003). Quality control in the endoplasmic reticulum. Nat. Rev. Mol. Cell Biol. 4,181 -191. Ellgaard,L., Molinari.M., and Helenius.A. (1999). Setting the standards: quality control in the secretory pathway. Science 286, 1882-1888. England.S.K., Uebele.V.N., Kodali.J., Bennett.P.B., and Tamkun.M.M. (1995a). A novel K+ channel beta-subunit (hKv beta 1.3) is produced via alternative mRNA splicing. J . Biol. Chem. 270, 28531-28534. 83 England,S.K., Uebele,V.N., Shear.H., Kodali.J., Bennett.P.B., and Tamkun.M.M. (1995b). Characterization of a voltage-gated K+ channel beta subunit expressed in human heart. Proc. Natl. Acad. Sci. U. S. A 92, 6309-6313. Feng.J., Wible.B., Li.G.R., Wang.Z., and Nattel.S. (1997). Antisense oligodeoxynucleotides directed against Kv1.5 mRNA specifically inhibit ultrarapid delayed rectifier K+ current in cultured adult human atrial myocytes. Circ. Res. 80, 572-579. Ficker.E., Thomas,D., Viswanathan.P.C, Dennis.A.T., Priori,S.G., Napolitano.C, Memmi.M., Wible,B.A., Kaufman,E.S., lyengar.S., Schwartz.P.J., Rudy,Y., and Brown.A.M. (2000). Novel characteristics of a misprocessed mutant HERG channel linked to hereditary long QT syndrome. Am. J. Physiol Heart Circ. Physiol 279, H1748-H1756. Fiedler,K., Veit.M., Stamnes,M.A., and Rothman.J.E. (1996). Bimodal interaction of coatomer with the p24 family of putative cargo receptors. Science 273, 1396-1399. Fink,M., Duprat.F., Lesage,F., Heurteaux.C, Romey.G., Barhanin.J., and Lazdunski.M. (1996). A new K+ channel beta subunit to specifically enhance Kv2.2 (CDRK) expression. J. Biol. Chem. 271, 26341-26348. Gekko,K. and Timasheff,S.N. (1981). Thermodynamic and kinetic examination of protein stabilization by glycerol. Biochemistry 20, 4677-4686. Gong.J., Xu,J., Bezanilla.M., van Huizen.R., Derin.R., and Li,M. (1999). Differential stimulation of PKC phosphorylation of potassium channels by ZIP1 and ZIP2. Science 285, 1565-1569. Gong,Q., Anderson,CL, January.C.T., and Zhou.Z. (2004). Pharmacological rescue of trafficking defective HERG channels formed by coassembly of wild-type and long QT mutant N470D subunits. Am. J . Physiol Heart Circ. Physiol 287, H652-H658. Gulbis.J.M., Mann.S., and MacKinnon,R. (1999). Structure of a voltage-dependent K+ channel beta subunit. Cell 97, 943-952. Gulbis.J.M., Zhou.M., Mann.S., and MacKinnon,R. (2000). Structure of the cytoplasmic beta subunit-T1 assembly of voltage-dependent K+ channels. Science 289, 123-127. Haas.A.L. and Siepmann.T.J. (1997). Pathways of ubiquitin conjugation. FASEB J . 77,1257-1268. Hamm-Alvarez,S.F., Kim,P.Y., and Sheetz,M.P. (1993). Regulation of vesicle transport in CV-1 cells and extracts. J. Cell Sci. 106 (Pt 3), 955-966. 84 Hammond.C., Braakman.,1., and Helenius.A. (1994). Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control. Proc. Natl. Acad. Sci. U. S. A 91, 913-917. Hardwick,K.G., Lewis,M.J., Semenza.J., Dean,N., and Pelham.H.R. (1990). ERD1, a yeast gene required for the retention of luminal endoplasmic reticulum proteins, affects glycoprotein processing in the Golgi apparatus. EMBO J. 9, 623-630. Hartmann.H.A., Kirsch.G.E., Drewe.J.A., Taglialatela.M., Joho.R.H., and Brown.A.M. (1991). Exchange of conduction pathways between two related K+ channels. Science 251, 942-944. Hebert.D.N., Foellmer.B., and Helenius.A. (1995). Glucose trimming and reglucosylation determine glycoprotein association with calnexin in the endoplasmic reticulum. Cell 81, 425-433. Heginbotham,L., Abramson.T., and MacKinnon,R. (1992). Afunctional connection between the pores of distantly related ion channels as revealed by mutant K+ channels. Science 258, 1152-1155. Heginbotham,L., Lu,Z., Abramson.T., and MacKinnon.R. (1994). Mutations in the K+ channel signature sequence. Biophys. J . 66, 1061-1067. Heinemann,S.H., Rettig.J., Graack.H.R., and Pongs,O. (1996). Functional characterization of Kv channel beta-subunits from rat brain. J . Physiol 493 ( Pt 3), 625-633. Heinemann,S.H., Rettig,J., Wunder.F., and Pongs,O. (1995). Molecular and functional characterization of a rat brain Kv beta 3 potassium channel subunit. FEBS Lett. 377, 383-389. Helenius.A. and Aebi.M. (2001). Intracellular functions of N-linked glycans. Science 291, 2364-2369. Hill.C.P., Yee.J., Selsted.M.E., and Eisenberg.D. (1991). Crystal structure of defensin HNP-3, an amphiphilic dimer: mechanisms of membrane permeabilization. Science 251, 1481-1485. Hofherr.A., Fakler.B., and Klocker.N. (2005). Selective Golgi export of Kir2.1 controls the stoichiometry of functional Kir2.x channel heteromers. J . Cell Sci. 118, 1935-1943. Holmes,T.C., Fadool.D.A., Ren.R., and LevitanJ.B. (1996). Association of Src tyrosine kinase with a human potassium channel mediated by SH3 domain. Science 274, 2089-2091. Hoshi.T., Zagotta.W.N., and Aldrich.R.W. (1990). Biophysical and molecular mechanisms of Shaker potassium channel inactivation. Science 250, 533-538. 85 Hsueh.Y.P. and Sheng,M. (1999). Requirement of N-terminal cysteines of PSD-95 for PSD-95 multimerization and ternary complex formation, but not for binding to potassium channel Kv1.4. J. Biol. Chem. 274, 532-536. Huang.X.Y., Morielli.A.D., and Peralta.E.G. (1993). Tyrosine kinase-dependent suppression of a potassium channel by the G protein-coupled ml muscarinic acetylcholine receptor. Cell 75, 1145-1156. Huang.X.Y., Morielli,A.D., and Peralta.E.G. (1994). Molecular basis of cardiac potassium channel stimulation by protein kinase A. Proc. Natl. Acad. Sci. U. S. A 91, 624-628. Jakob.C.A., Burda.P., Roth,J., and Aebi.M. (1998). Degradation of misfolded endoplasmic reticulum glycoproteins in Saccharomyces cerevisiae is determined by a specific oligosaccharide structure. J . Cell Biol. 742,1223-1233. Jan.L.Y. and Jan.Y.N. (1997). Cloned potassium channels from eukaryotes and prokaryotes. Annu. Rev. Neurosci. 20, 91-123. Jiang.Y., Lee.A., Chen.J., Cadene,M., Chait.B.T., and MacKinnon,R. (2002a). Crystal structure and mechanism of a calcium-gated potassium channel. Nature 477, 515-522. Jiang.Y., Lee,A., Chen.J., Cadene,M., Chait.B.T., and MacKinnon,R. (2002b). The open pore conformation of potassium channels. Nature 477, 523-526. Jou,l., Pyo,H., Chung,S., Jung,S.Y., Gwag.B.J., and Joe.E.H. (1998). Expression of Kv1.5 K+ channels in activated microglia in vivo. Glia 24, 408-414. Kagan.A., Yu,Z., Fishman.G.I., and McDonald.T.V. (2000). The dominant negative LQT2 mutation A561V reduces wild-type HERG expression. J . Biol. Chem. 275, 11241-11248. Kamb.A., Tseng-Crank,J., and Tanouye.M.A. (1988). Multiple products of the Drosophila Shaker gene may contribute to potassium channel diversity. Neuron 7, 421-430. Kammerer.RA, Frank.S., Schulthess.T., Landwehr.R., LustigA, and Engel.J. (1999). Heterodimerization of a functional GABAB receptor is mediated by parallel coiled-coil alpha-helices. Biochemistry 38,13263-13269. Kanki,H., Kupershmidt.S., Yang.T., Wells.S., and Roden.D.M. (2004). A structural requirement for processing the cardiac K+ channel KCNQ1. J. Biol. Chem. 279, 33976-33983. Kappeler,F., Klopfenstein.D.R., Foguet.M., Paccaud,J.P., and Hauri.H.P. (1997). The recycling of ERGIC-53 in the early secretory pathway. ERGIC-53 carries a 86 cytosolic endoplasmic reticulum-exit determinant interacting with COPII. J . Biol. Chem. 272, 31801-31808. Khanna,R., Myers,M.P., Laine.M., and Papazian.D.M. (2001). Glycosylation increases potassium channel stability and surface expression in mammalian cells. J . Biol. Chem. 276, 34028-34034. Kim.E., Niethammer.M., RothschildA, Jan.Y.N., and Sheng.M. (1995). Clustering of Shaker-type K+ channels by interaction with a family of membrane-associated guanylate kinases. Nature 378, 85-88. Kim.J.H., Liao.D., Lau,L.F., and Huganir.R.L. (1998). SynGAP: a synaptic RasGAP that associates with the PSD-95/SAP90 protein family. Neuron 20, 683-691. Kirchhausen,"!". (2000). Clathrin. Annu. Rev. Biochem. 69, 699-727. Kirchhausen,"!". (2002). Clathrin adaptors really adapt. Cell 109, 413-416. Kirsch.G.E., Pascual.J.M., and Shieh.C.C. (1995). Functional role of a conserved aspartate in the external mouth of voltage-gated potassium channels. Biophys. J . 68, 1804-1813. Klumperman.J. (2000). Transport between ER and Golgi. Curr. Opin. Cell Biol. 12, 445-449. Kobertz,W.R., Williams.C, and Miller.C. (2000). Hanging gondola structure of the T1 domain in a voltage-gated K(+) channel. Biochemistry 39, 10347-10352. Kopito.R.R. (1997). ER quality control: the cytoplasmic connection. Cell 88, 427-430. Kornfeld.R. and Kornfeld.S. (1985). Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem. 54, 631-664. Kowalski.J.M., Parekh.R.N., Mao,J., and Wittrup.K.D. (1998). Protein folding stability can determine the efficiency of escape from endoplasmic reticulum quality control. J . Biol. Chem. 273, 19453-19458. Kuner.R., Kohr.G., Grunewald.S., Eisenhardt.G., Bach,A., and Kornau.H.C. (1999). Role of heteromer formation in GABAB receptor function. Science 283, 74-77. Kupershmidt.S., Yang.T., Chanthaphaychith.S., Wang,Z., Towbin.J.A., and Roden.D.M. (2002). Defective human Ether-a-go-go-related gene trafficking linked to an endoplasmic reticulum retention signal in the C terminus. J . Biol. Chem. 277, 27442-27448. Kurata.H.T. and Fedida.D. (2005). A structural interpretation of voltage-gated potassium channel inactivation. Prog. Biophys. Mol. Biol. 87 Kurata.H.T., Soon.G.S., Eldstrom,J.R., Lu.G.W., Steele.D.F., and Fedida.D. (2002). Amino-terminal determinants of U-type inactivation of voltage-gated K+ channels. J. Biol. Chem. 277, 29045-29053. Kurata,H.T., Soon,G.S., and Fedida.D. (2001). Altered state dependence of c-type inactivation in the long and short forms of human Kv1.5. J. Gen. Physiol 778, 315-332. Kwak.Y.G., Navarro-Polanco.R.A., Grobaski.T., Gallagher.D.J., and Tamkun.M.M. (1999). Phosphorylation is required for alteration of kv1.5 K(+) channel function by the Kvbeta1.3 subunit. J . Biol. Chem. 274, 25355-25361. Landolt-Marticorena.C. and Reithmeier.R.A. (1994). Asparagine-linked oligosaccharides are localized to single extracytosolic segments in multi-span membrane glycoproteins. Biochem. J. 302 (Pt 1), 253-260. Leicher.T., Roeper.J., Weber.K., Wang.X., and Pongs,O. (1996). Structural and functional characterization of human potassium channel subunit beta 1 (KCNA1B). Neuropharmacology 35, 787-795. Letourneur,F., Gaynor.E.C, Hennecke.S., Demolliere.C, Duden.R., Emr,S.D., Riezman,H., and Cosson.P. (1994). Coatomer is essential for retrieval of dilysine-tagged proteins to the endoplasmic reticulum. Cell 79, 1199-1207. Levin,G., Chikvashvili.D., Singer-Lahat,D., Peretz.T., Thornhill.W.B., and Lotan,l. (1996). Phosphorylation of a K+ channel alpha subunit modulates the inactivation conferred by a beta subunit. Involvement of cytoskeleton. J . Biol. Chem. 277, 29321-29328. Levitan,E.S., Hemmick.L.M., Bimberg.N.C, and Kaczmarek.L.K. (1991). Dexamethasone increases potassium channel messenger RNA and activity in clonal pituitary cells. Mol. Endocrinol. 5, 1903-1908. Li,D., Takimoto,K., and Levitan,E.S. (2000). Surface expression of Kv1 channels is governed by a C-terminal motif. J . Biol. Chem. 275, 11597-11602. Li,M., Jan.Y.N., and Jan.L.Y. (1992). Specification of subunit assembly by the hydrophilic amino-terminal domain of the Shaker potassium channel. Science 257, 1225-1230. Liman.E.R., Hess,P., Weaver.F., and Koren.G. (1991). Voltage-sensing residues in the S4 region of a mammalian K+ channel. Nature 353, 752-756. Liu,H.L., Chen.C.W., and Lin,J.C. (2005). Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6. J . Biomol. Struct. Dyn. 22, 387-398. 88 Liu.Y., Choudhury.P., Cabral.C.M., and Sifers.R.N. (1999). Oligosaccharide modification in the early secretory pathway directs the selection of a misfolded glycoprotein for degradation by the proteasome. J . Biol. Chem. 274, 5861-5867. Long.S.B., Campbell,E.B., and MacKinnon,R. (2005). Crystal structure of a mammalian voltage-dependent Shaker family K+ channel. Science 309, 897-903. Ma,D., Zerangue.N., Lin.Y.F., Collins.A., Yu,M., Jan.Y.N., and Jan.L.Y. (2001). Role of ER export signals in controlling surface potassium channel numbers. Science 291, 316-319. Ma,D, Zerangue.N., Raab-Graham,K., Fried.S.R., Jan.Y.N., and Jan.L.Y. (2002). Diverse trafficking patterns due to multiple traffic motifs in G protein-activated inwardly rectifying potassium channels from brain and heart. Neuron 33, 715-729. MacKinnon,R. (2003). Potassium channels. FEBS Lett. 555, 62-65. Mackler.S.A. and Eberwine.J.H. (1994). Cellular adaptation to opiates alters ion-channel mRNA levels. Proc. Natl. Acad. Sci. U. S. A 91, 385-389. Manganas.L.N. and Trimmer.J.S. (2000). Subunit composition determines Kv1 potassium channel surface expression. J . Biol. Chem. 275, 29685-29693. Manganas.L.N. and Trimmer.J.S. (2004). Calnexin regulates mammalian Kv1 channel trafficking. Biochem. Biophys. Res. Commun. 322, 577-584. Manganas.L.N., Wang.Q., Scannevin.R.H., Antonucci.D.E., Rhodes,K.J., and Trimmer.J.S. (2001). Identification of a trafficking determinant localized to the Kv1 potassium channel pore. Proc. Natl. Acad. Sci. U. S. A 98, 14055-14059. Marban.E. (2002). Cardiac channelopathies. Nature 415, 213-218. Margeta-Mitrovic,M., Jan.Y.N., and Jan.L.Y. (2000). A trafficking checkpoint controls GABA(B) receptor heterodimerization. Neuron 27, 97-106. Martens.J.R., Navarro-Polanco.R.. Coppock.E.A., Nishiyama.A., Parshley.L., Grobaski,T.D., and Tamkun.M.M. (2000). Differential targeting of Shaker-like potassium channels to lipid rafts. J . Biol. Chem. 275, 7443-7446. Maruoka.N.D., Steele.D.F., Au.B.P., Dan,P., Zhang.X., Moore,E.D., and Fedida.D. (2000). alpha-actinin-2 couples to cardiac Kv1.5 channels, regulating current density and channel localization in HEK cells. FEBS Lett. 473, 188-194. Mason,H.S., Latten.M.J., Godoy.L.D., Horowitz.B., and Kenyon.J.L. (2002). Modulation of Kv1.5 currents by protein kinase A, tyrosine kinase, and protein tyrosine phosphatase requires an intact cytoskeleton. Mol. Pharmacol. 61, 285-293. 89 Mathur.R., Choi.W.S., Eldstrom,J., Wang,Z., Kim.J., Steele.D.F., and Fedida.D. (2006). A specific N-terminal residue in Kv1.5 is required for upregulation of the channel by SAP97. Biochem. Biophys. Res. Commun. 342, 1-8. Mays.D.J., Foose.J.M., Philipson.L.H., and Tamkun.M.M. (1995). Localization of the Kv1.5 K+ channel protein in explanted cardiac tissue. J . Clin. Invest 96, 282-292. McCormack.K., Tanouye.M.A., Iverson.L.E., Lin.J.W., Ramaswami.M., McCormack.T., Campanelli.J.T., Mathew.M.K., and Rudy.B. (1991). A role for hydrophobic residues in the voltage-dependent gating of Shaker K+ channels. Proc. Natl. Acad. Sci. U. S. A 88, 2931-2935. Meacham.G.C., Patterson.C, Zhang.W., Younger.J.M., and Cyr.D.M. (2001). The Hsc70 co-chaperone CHIP targets immature CFTR for proteasomal degradation. Nat. Cell Biol. 3, 100-105. Mi,H., Deerinck.T.J., Ellisman.M.H., and Schwarz.T.L. (1995). Differential distribution of closely related potassium channels in rat Schwann cells. J . Neurosci. 15, 3761-3774. Minor.D.L., Lin.Y.F., Mobley.B.C., AvelarA, Jan.Y.N., Jan.L.Y., and Berger.J.M. (2000). The polar T1 interface is linked to conformational changes that open the voltage-gated potassium channel. Cell 102, 657-670. Monera.O.D., Kay.C.M., and Hodges.R.S. (1994). Electrostatic interactions control the parallel and antiparallel orientation of alpha-helical chains in two-stranded alpha-helical coiled-coils. Biochemistry 33, 3862-3871. Monera.O.D., Zhou.N.E., Lavigne.P., Kay.C.M., and Hodges.R.S. (1996). Formation of parallel and antiparallel coiled-coils controlled by the relative positions of alanine residues in the hydrophobic core. J. Biol. Chem. 271, 3995-4001. Mori.Y., Folco.E., and Koren.G. (1995). GH3 cell-specific expression of Kv1.5 gene. Regulation by a silencer containing a dinucleotide repetitive element. J . Biol. Chem. 270, 27788-27796. Much.B., Wahl-Schott.C, Zong.X., Schneider.A., Baumann.L., Moosmang.S., Ludwig.A., and Biel.M. (2003). Role of subunit heteromerization and N-linked glycosylation in the formation of functional hyperpolarization-activated cyclic nucleotide-gated channels. J . Biol. Chem. 278, 43781-43786. MurshidA and Presley,J.F. (2004). ER-to-Golgi transport and cytoskeletal interactions in animal cells. Cell Mol. Life Sci. 61, 133-145. Myszka.D.G. and ChaikenJ.M. (1994). Design and characterization of an intramolecular antiparallel coiled coil peptide. Biochemistry 33, 2363-2372. 90 Nagaya,N. and Papazian.D.M. (1997). Potassium channel alpha and beta subunits assemble in the endoplasmic reticulum. J. Biol. Chem. 272, 3022-3027. Nakahira,K., Matos.M.F., and Trimmer.J.S. (1998). Differential interaction of voltage-gated K+ channel beta-subunits with cytoskeleton is mediated by unique amino terminal domains. J . Mol. Neurosci. 11, 199-208. Nichols,C.G. and Lopatin.A.N. (1997). Inward rectifier potassium channels. Annu. Rev. Physiol 59, 171-191. Niethammer.M., Valtschanoff,J.G., Kapoor.T.M., Allison,D.W., Weinberg.T.M., Craig.A.M., and Sheng.M. (1998). CRIPT, a novel postsynaptic protein that binds to the third PDZ domain of PSD-95/SAP90. Neuron 20, 693-707. Nilsson.l.M. and von Heijne,G. (1993). Determination of the distance between the oligosaccharyltransferase active site and the endoplasmic reticulum membrane. J . Biol. Chem. 268, 5798-5801. Nitabach.M.N., Llamas.D.A., Thompson,I.J., Collins.K.A., and Holmes.T.C. (2002). Phosphorylation-dependent and phosphorylation-independent modes of modulation of shaker family voltage-gated potassium channels by SRC family protein tyrosine kinases. J . Neurosci. 22, 7913-7922. O'Connell.A.D., Leng.Q., Dong.K., MacGregor.G.G., Giebisch.G., and Hebert.S.C. (2005). Phosphorylation-regulated endoplasmic reticulum retention signal in the renal outer-medullary K+ channel (ROMK). Proc. Natl. Acad. Sci. U. S. A 102, 9954-9959. Orci.L, Stamnes.M., Ravazzola.M., Amherdt.M., Perrelet,A., Sollner.T.H., and Rothman.J.E. (1997). Bidirectional transport by distinct populations of COPI-coated vesicles. Cell 90, 335-349. Ordog,B., Brutyo.E., Puskas.L.G., Papp.J.G., Varro.A., Szabad.J., and Boldogkoi.Z. (2005). Gene expression profiling of human cardiac potassium and sodium channels. Int. J . Cardiol. Overturf.K.E., Russell,S.N., Carl.A., Vogalis.F., Hart.P.J., Hume.J.R., Sanders.K.M., and Horowitz.B. (1994). Cloning and characterization of a Kv1.5 delayed rectifier K+ channel from vascular and visceral smooth muscles. Am. J. Physiol 267, C1231-C1238. Owsianik.G., Cao.L, and Nilius.B. (2003). Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells. FEBS Lett. 554, 173-178. Pagano.A., Rovelli.G., Mosbacher.J., Lohmann.T., Duthey.B., Stauffer.D., Ristig.D., SchulerA/., Meigel.l., Lampert.C, Stein.T., Prezeau.L., Blahos.J., Pin.J., Froestl.W., Kuhn,R., Heid.J., Kaupmann.K., and Bettler.B. (2001). C-terminal interaction is 91 essential for surface trafficking but not for heteromeric assembly of GABA(b) receptors. J . Neurosci. 21, 1189-1202. Papazian,D.M., Timpe.L.C., Jan.Y.N., and Jan.L.Y. (1991). Alteration of voltage-dependence of Shaker potassium channel by mutations in the S4 sequence. Nature 349,305-310. Parodi.A.J. (2000). Protein glucosylation and its role in protein folding. Annu. Rev. Biochem. 69, 69-93. Pawson.T. and Scott.J.D. (1997). Signaling through scaffold, anchoring, and adaptor proteins. Science 278, 2075-2080. Payet.M.D. and Dupuis.G. (1992). Dual regulation of the n type K+ channel in Jurkat T lymphocytes by protein kinases A and C. J. Biol. Chem. 267, 18270-18273. Pelham.H.R. (1996). The dynamic organisation of the secretory pathway. Cell Struct. Funct. 27,413-419. Peretz.A., Sobko.A., and Attali.B. (1999). Tyrosine kinases modulate K+ channel gating in mouse Schwann cells. J . Physiol 519 Pt 2, 373-384. Perozo.E., MacKinnon,R., Bezanilla,F., and Stefani.E. (1993). Gating currents from a nonconducting mutant reveal open-closed conformations in Shaker K+ channels. Neuron 11, 353-358. Petrecca.K., Atanasiu.R., Akhavan.A., and Shrier.A. (1999). N-linked glycosylation sites determine HERG channel surface membrane expression. J . Physiol 515 (Pt 1), 41-48. Pongs,O. (1992). Structural basis of voltage-gated K+ channel pharmacology. Trends Pharmacol. Sci. 13, 359-365. Pongs,O., Kecskemethy.N., Muller,R., Krah-Jentgens,l., Baumann.A., Kiltz,H.H., Canal,I., Llamazares.S., and Ferrus.A. (1988). Shaker encodes a family of putative potassium channel proteins in the nervous system of Drosophila. EMBO J. 7,1087-1096. Ponting.C.P., Phillips.C., Davies.K.E., and Blake.D.J. (1997). PDZ domains: targeting signalling molecules to sub-membranous sites. Bioessays 19, 469-479. Presley.J.F., Cole.N.B., Schroer.T.A., Hirschberg.K., Zaal.K.J., and Lippincott-Schwartz.J. (1997). ER-to-Golgi transport visualized in living cells. Nature 389, 81-85. Presley.J.F., Ward.T.H., Pfeifer.A.C, Siggia.E.D., Phair.R.D., and Lippincott-Schwartz.J. (2002). Dissection of COPI and Arf1 dynamics in vivo and role in Golgi membrane transport. Nature 417, 187-193. 92 Qu.B.H., Strickland,E.H., and Thomas,P.J. (1997). Localization and suppression of a kinetic defect in cystic fibrosis transmembrane conductance regulator folding. J . Biol. Chem. 272, 15739-15744. Rambourg.A. and Clermont.Y. (1990). Three-dimensional electron microscopy: structure of the Golgi apparatus. Eur. J . Cell Biol. 51, 189-200. Ren.Z., Riley.N.J., Needleman.L.A., Sanders,J.M., Swanson.G.T., and Marshall.J. (2003). Cell surface expression of GluR5 kainate receptors is regulated by an endoplasmic reticulum retention signal. J . Biol. Chem. 278, 52700-52709. Rettig.J., Heinemann,S.H., Wunder.F., Lorra.C, Parcej.D.N., Dolly.J.O., and Pongs,O. (1994). Inactivation properties of voltage-gated K+ channels altered by presence of beta-subunit. Nature 369, 289-294. Richardson.J.S. and Richardson.D.C. (2002). Natural beta-sheet proteins use negative design to avoid edge-to-edge aggregation. Proc. Natl. Acad. Sci. U. S. A 99, 2754-2759. Robinson,M.S. (1994). The role of clathrin, adaptors and dynamin in endocytosis. Curr. Opin. Cell Biol. 6, 538-544. Rothman.J.E. and Wieland,F.T. (1996). Protein sorting by transport vesicles. Science 272, 227-234. Sato.S., Ward.C.L, Krouse.M.E., Wine.J.J., and Kopito.R.R. (1996). Glycerol reverses the misfolding phenotype of the most common cystic fibrosis mutation. J. Biol. Chem. 271, 635-638. Schekman,R. and Orci.L. (1996). Coat proteins and vesicle budding. Science 271, 1526-1533. Schwarz.T.L, Tempel,B.L, Papazian.D.M., Jan.Y.N., and Jan.L.Y. (1988). Multiple potassium-channel components are produced by alternative splicing at the Shaker locus in Drosophila. Nature 331, 137-142. Scott.D.B., Blanpied.TA, and Ehlers.M.D. (2003). Coordinated PKA and PKC phosphorylation suppresses RXR-mediated ER retention and regulates the surface delivery of NMDA receptors. Neuropharmacology 45, 755-767. Scott,D.B., Blanpied.TA, Swanson.G.T., Zhang,C., and Ehlers,M.D. (2001). An NMDA receptor ER retention signal regulated by phosphorylation and alternative splicing. J . Neurosci. 21, 3063-3072. Semenza.J.C, Hardwick.K.G., Dean.N., and Pelham.H.R. (1990). ERD2, a yeast gene required for the receptor-mediated retrieval of luminal ER proteins from the secretory pathway. Cell 61, 1349-1357. 93 Sewing,S., Roeper,J., and Pongs,O. (1996). Kv beta 1 subunit binding specific for shaker-related potassium channel alpha subunits. Neuron 76, 455-463. Shen.N.V. and Pfaffinger.P.J. (1995). Molecular recognition and assembly sequences involved in the subfamily-specific assembly of voltage-gated K+ channel subunit proteins. Neuron 14, 625-633. Sheng,M. and Kim.E. (1996). Ion channel associated proteins. Curr. Opin. Neurobiol. 6, 602-608. Shi.G., Nakahira.K., Hammond,S., Rhodes,K.J., Schechter.L.E., and Trimmer.J.S. (1996). Beta subunits promote K+ channel surface expression through effects early in biosynthesis. Neuron 16, 843-852. Shimoni.Y., Fiset,C., Clark.R.B., Dixon.J.E., McKinnon.D., and Giles.W.R. (1997). Thyroid hormone regulates postnatal expression of transient K+ channel isoforms in rat ventricle. J . Physiol 500 (Pt 1), 65-73. Siepen.J.A., Radford.S.E., and Westhead.D.R. (2003). Beta edge strands in protein structure prediction and aggregation. Protein Sci. 12, 2348-2359. Silberstein,S. and Gilmore,R. (1996). Biochemistry, molecular biology, and genetics of the oligosaccharyltransferase. FASEB J. 10, 849-858. Songyang.Z., Fanning.A.S., Fu,C, Xu,J., Marfatia.S.M., Chishti.A.H., Crompton.A., Chan.A.C, Anderson.J.M., and Cantley.L.C. (1997). Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 275, 73-77. Sonnichsen.B., Fullekrug.J., Nguyen.V.P., Diekmann.W., Robinson,D.G., and Mieskes.G. (1994). Retention and retrieval: both mechanisms cooperate to maintain calreticulin in the endoplasmic reticulum. J. Cell Sci. 707 (Pt 10), 2705-2717. Spiro.R.G., Zhu,Q., Bhoyroo.V., and Soling,H.D. (1996). Definition of the lectin-like properties of the molecular chaperone, calreticulin, and demonstration of its copurification with endomannosidase from rat liver Golgi. J . Biol. Chem. 277, 11588-11594. Standley.S., Roche.K.W., McCallum.J., Sans.N., and Wenthold,R.J. (2000). PDZ domain suppression of an ER retention signal in NMDA receptor NR1 splice variants. Neuron 28, 887-898. Stockklausner,C. and Klocker.N. (2003). Surface expression of inward rectifier potassium channels is controlled by selective Golgi export. J . Biol. Chem. 278, 17000-17005. Stockklausner.C, Ludwig.J., Ruppersberg.J.P., and Klocker.N. (2001). A sequence motif responsible for ER export and surface expression of Kir2.0 inward rectifier K(+) channels. FEBS Lett. 493, 129-133. 94 Strang.C., Cushman.S.J., DeRubeis.D.. Peterson,D., and Pfaffinger.P.J. (2001). A central role for the T1 domain in voltage-gated potassium channel formation and function. J . Biol. Chem. 276, 28493-28502. Stuhmer.W., Ruppersberg,J.P., Schroter.K.H., Sakmann.B., Stocker.M., Giese,K.P., Perschke.A., Baumann.A., and Pongs,O. (1989). Molecular basis of functional diversity of voltage-gated potassium channels in mammalian brain. EMBO J. 8, 3235-3244. Su,K., Stoller.T., Rocco.J., Zemsky.J., and Green,R. (1993). Pre-Golgi degradation of yeast prepro-alpha-factor expressed in a mammalian cell. Influence of cell type-specific oligosaccharide processing on intracellular fate. J . Biol. Chem. 268, 14301-14309. Takimoto.K., Fomina.A.F., Gealy.R., Trimmer.J.S., and Levitan.E.S. (1993). Dexamethasone rapidly induces Kv1.5 K+ channel gene transcription and expression in clonal pituitary cells. Neuron 11, 359-369. Takimoto.K., Gealy.R., Fomina.A.F., Trimmer.J.S., and Levitan.E.S. (1995). Inhibition of voltage-gated K+ channel gene expression by the neuropeptide thyrotropin-releasing hormone. J . Neurosci. 15, 449-457. Takimoto.K. and Levitan.E.S. (1994). Glucocorticoid induction of Kv1.5 K+ channel gene expression in ventricle of rat heart. Circ. Res. 75, 1006-1013. Tempel,B.L., Jan.Y.N., and Jan.L.Y. (1988). Cloning of a probable potassium channel gene from mouse brain. Nature 332, 837-839. Tempel,B.L., Papazian.D.M., Schwarz.T.L., Jan.Y.N., and Jan.L.Y. (1987). Sequence of a probable potassium channel component encoded at Shaker locus of Drosophila. Science 237, 770-775. Thornhill.W.B., Wu.M.B., Jiang.X., Wu.X., Morgan.P.T., and Margiotta.J.F. (1996). Expression of Kv1.1 delayed rectifier potassium channels in Lec mutant Chinese hamster ovary cell lines reveals a role for sialidation in channel function. J . Biol. Chem. 271, 19093-19098. Tiffany.A.M., Manganas.L.N., Kim.E., Hsueh.Y.P., Sheng.M., and Trimmer.J.S. (2000). PSD-95 and SAP97 exhibit distinct mechanisms for regulating K(+) channel surface expression and clustering. J . Cell Biol. 148, 147-158. Tristani-Firouzi.M., Chen.J., Mitcheson.J.S., and Sanguinetti.M.C. (2001). Molecular biology of K(+) channels and their role in cardiac arrhythmias. Am. J . Med. 110, 50-59. Trombetta.S.E. and Parodi.A.J. (1992). Purification to apparent homogeneity and partial characterization of rat liver UDP-glucose:glycoprotein glucosyltransferase. J . Biol. Chem. 267, 9236-9240. 95 Tsunoda.S., Sierralta.J., Sun,Y., Bodner.R., Suzuki,E., Becker.A., Socolich.M., and Zuker.C.S. (1997). A multivalent PDZ-domain protein assembles signalling complexes in a G-protein-coupled cascade. Nature 388, 243-249. Uebele.V.N., England.S.K., Chaudhary.A., Tamkun.M.M., and Snyders.D.J. (1996). Functional differences in Kv1.5 currents expressed in mammalian cell lines are due to the presence of endogenous Kv beta 2.1 subunits. J . Biol. Chem. 277, 2406-2412. Uebele.V.N., England.S.K., Gallagher.D.J., Snyders.D.J., Bennett.P.B., and Tamkun.M.M. (1998). Distinct domains of the voltage-gated K+ channel Kv beta 1.3 beta-subunit affect voltage-dependent gating. Am. J . Physiol 274, C1485-C1495. Valetti.C, Wetzel,D.M., Schrader.M., Hasbani.M.J., Gill.S.R., Kreis.T.E., and Schroer.T.A. (1999). Role of dynactin in endocytic traffic: effects of dynamitin overexpression and colocalization with CLIP-170. Mol. Biol. Cell 70, 4107-4120. Valiyaveetil.F.I., Sekedat.M., MacKinnon,R., and Muir.T.W. (2004). Glycine as a D-amino acid surrogate in the K(+)-selectivity filter. Proc. Natl. Acad. Sci. U. S. A 707, 17045-17049. Ware.F.E., Vassilakos,A., Peterson,P.A., Jackson,M.R., Lehrman,M.A., and Williams,D.B. (1995). The molecular chaperone calnexin binds Glc1Man9GlcNAc2 oligosaccharide as an initial step in recognizing unfolded glycoproteins. J . Biol. Chem. 270, 4697-4704. Watanabe.l., Wang.H.G., Sutachan.J.J., Zhu.J., Recio-Pinto,E., and Thornhill.W.B. (2003). Glycosylation affects rat Kv1.1 potassium channel gating by a combined surface potential and cooperative subunit interaction mechanism. J . Physiol 550, 51-66. . ' _ Watanabe.l., Zhu.J., Recio-Pinto.E., and Thornhill.W.B. (2004). Glycosylation affects the protein stability and cell surface expression of Kv1.4 but Not Kv1.1 potassium channels. A pore region determinant dictates the effect of glycosylation on trafficking. J . Biol. Chem. 279, 8879-8885. Welch.W.J. and Brown,C.R. (1996). Influence of molecular and chemical chaperones on protein folding. Cell Stress. Chaperones. 7, 109-115. White,S.H. and von Heijne,G. (2004). The machinery of membrane protein assembly. Curr. Opin. Struct. Biol. 14, 397-404. Williams.C.P., Hu,N., Shen.W., Mashburn.A.B., and Murray.K.T. (2002). Modulation of the human Kv1.5 channel by protein kinase C activation: role of the Kvbeta1.2 subunit. J . Pharmacol. Exp. Ther. 302, 545-550. Wilson,D.W., Lewis.M.J., and Pelham.H.R. (1993). pH-dependent binding of KDEL to its receptor in vitro. J . Biol. Chem. 268, 7465-7468. 96 Winklhofer,M., Matthias,K., Seifert.G., Stocker.M., Sewing,S., Herget.T., Steinhauser.C, and Saaler-Reinhardt.S. (2003). Analysis of phosphorylation-dependent modulation of Kv1.1 potassium channels. Neuropharmacology 44, 829-842. Xia,H., Hornby.Z.D., and Malenka,R.C. (2001). An ER retention signal explains differences in surface expression of NMDA and AMPA receptor subunits. Neuropharmacology 41, 714-723. Xu,J., Yu,W., Jan.Y.N., Jan.L.Y., and Li,M. (1995). Assembly of voltage-gated potassium channels. Conserved hydrophilic motifs determine subfamily-specific interactions between the alpha-subunits. J . Biol. Chem. 270, 24761-24768. Yang,E.K., Alvira.M.R., Levitan.E.S., and Takimoto.K. (2001). Kvbeta subunits increase expression of Kv4.3 channels by interacting with their C termini. J . Biol. Chem. 276, 4839-4844. Yang.Y., Yan.Y., and Sigworth.F.J. (1997). How does the W434F mutation block current in Shaker potassium channels? J . Gen. Physiol 109, 779-789. Yokoyama.S., Imoto.K., Kawamura.T., Higashida.H., Iwabe.N., Miyata.T., and Numa.S. (1989). Potassium channels from NG108-15 neuroblastoma-glioma hybrid cells. Primary structure and functional expression from cDNAs. FEBS Lett. 259, 37-42. Yoo.D., Fang.L., Mason.A., Kim.B.Y., and Welling,P.A. (2005). A phosphorylation-dependent export structure in ROMK (Kir 1.1) channel overrides an endoplasmic reticulum localization signal. J . Biol. Chem. 280, 35281-35289. Yool.A.J. and Schwarz.T.L. (1991). Alteration of ionic selectivity of a K+ channel by mutation of the H5 region. Nature 349, 700-704. Yu.S.P. and Kerchner.G.A. (1998). Endogenous voltage-gated potassium channels in human embryonic kidney (HEK293) cells. J . Neurosci. Res. 52, 612-617. Yuan.H., Michelsen,K., and Schwappach.B. (2003). 14-3-3 dimers probe the assembly status of multimeric membrane proteins. Curr. Biol. 13, 638-646. Yuan.X.J., Wang.J., Juhaszova.M., Gaine.S.P., and Rubin,L.J. (1998). Attenuated K+ channel gene transcription in primary pulmonary hypertension. Lancet 351, 726-727. Zagotta.W.N., Hoshi.T., and Aldrich.R.W. (1990). Restoration of inactivation in mutants of Shaker potassium channels by a peptide derived from ShB. Science 250, 568-571. 97 Zerangue.N., Jan.Y.N., and Jan.L.Y. (2000). An artificial tetramerization domain restores efficient assembly of functional Shaker channels lacking T1. Proc. Natl. Acad. Sci. U. S. A 97, 3591-3595. Zerangue.N., Schwappach.B., Jan.Y.N., and Jan.L.Y. (1999). A new ER trafficking signal regulates the subunit stoichiometry of plasma membrane K(ATP) channels. Neuron 22, 537-548. Zhou.J., Shin.H.G., Yi.J., Shen.W;, Williams.C.P., and Murray.K.T. (2002). Phosphorylation and putative ER retention signals are required for protein kinase A-mediated potentiation of cardiac sodium current. Circ. Res. 91, 540-546. Zhou.M., Morais-Cabral.J.H., Mann.S., and MacKinnon,R. (2001). Potassium channel receptor site for the inactivation gate and quaternary amine inhibitors. Nature 411, 657-661. Zhou.Z., Gong.Q., Epstein,M.L., and January.C.T. (1998). HERG channel dysfunction in human long QT syndrome. Intracellular transport and functional defects. J . Biol. Chem. 273, 21061-21066. Zhou,Z., Gong.Q., and January.C.T. (1999). Correction of defective protein trafficking of a mutant HERG potassium channel in human long QT syndrome. Pharmacological and temperature effects. J . Biol. Chem. 274, 31123-31126. Zhu.G., Zhang.Y., Xu,H., and Jiang,C. (1998). Identification of endogenous outward currents in the human embryonic kidney (HEK 293) cell line. J . Neurosci. Methods 81, 73-83. Zhu,J., Watanabe.l., Poholek.A., Koss.M., Gomez.B., Yan.C, Recio-Pinto.E., and Thornhill.W.B. (2003). Allowed N-glycosylation sites on the Kv1.2 potassium channel S1-S2 linker: implications for linker secondary structure and the glycosylation effect on channel function. Biochem. J. 375, 769-775. 98 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092713/manifest

Comment

Related Items