Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Gonadal steroids regulate ADAMTS-1 expression in human endometrial stromal cells in vitro Wen, Jiadi 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-0341.pdf [ 7.63MB ]
Metadata
JSON: 831-1.0092638.json
JSON-LD: 831-1.0092638-ld.json
RDF/XML (Pretty): 831-1.0092638-rdf.xml
RDF/JSON: 831-1.0092638-rdf.json
Turtle: 831-1.0092638-turtle.txt
N-Triples: 831-1.0092638-rdf-ntriples.txt
Original Record: 831-1.0092638-source.json
Full Text
831-1.0092638-fulltext.txt
Citation
831-1.0092638.ris

Full Text

GONADAL STEROIDS REGULATE ADAMTS-1 EXPRESSION IN HUMAN ENDOMETRIAL STROMAL CELLS IN VITRO by Jiadi Wen M . D . , Capital University of Medical Sciences, China, 1993 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L M E N T O F T H E R E Q U I R M E N T S F O R T H E D E G R E E O F M A S T E R OF S C I E N C E in The Faculty of Graduate Studies (Reproductive and Developmental Science) U N I V E R S I T Y O F B R I T I S H C O L U M B I A Apr i l 2006 ©Jiadi Wen, 2006 A B S T R A C T Gonadal steroids are regulators of the E C M remodeling events that occur in the human endometrium during each menstrual cycle. The A D A M T S represent a novel family of M M P s , the best characterized of which is the initially identified member, A D A M T S - 1 . A D A M T S - 1 has recently been found to be spatiotemporally expressed in the human endometrium during the menstrual cycle with mice null-mutant for this A D A M T S subtype also exhibiting endometrial dysfunction. To date, the factors capable regulating A D A M T S - 1 in the human endometrium have not been identified. In view of these observations, I hypothesized that A D A M T S - 1 plays a central role in the steroid-mediated remodeling events that occur in the human endometrium during each reproductive cycle. In the studies presented in this thesis, I have examined the ability of the gonadal steroids, progesterone (P4), 17p-estradiol (E2) or the non-aromatisable androgen, dihydrotestosterone (DHT), alone or in combination to regulate A D A M T S - 1 m R N A and protein levels in primary cultures of human endometrial stromal cells in a time- and concentration-dependent manner. In addition, I determined whether the anti-steroidal compounds, RU486 (an antiprogestin), ICI 182, 780 (an anti-estrogen) or hydroxflutamide (an anti-androgen) were capable of inhibiting the regulatory effects of these gonadal steroids on stromal A D A M T S - 1 levels. Real-time P C R and Western blotting revealed that P4 and D H T increased A D A M T S - 1 . expression levels whereas E2 alone had no regulatory effect on the expression levels of this A D A M T S subtype in these primary cell cultures. A combination o f D H T and P4 potentiated the increase in the levels of the A D A M T S - 1 protein species present in these cell cultures whereas E2 was capable of attenuating the stimulatory effects of both P4 and D H T on stromal A D A M T S - 1 i i m R N A and protein expression levels. In contrast, RU486 and hydroxyflutamide specifically inhibited the increase in A D A M T S - 1 expression levels mediated by P4 and D H T , respectively. In summary my studies, demonstrate that the regulation of A D A M T S - 1 m R N A and protein expression levels in human endometrial stromal cells by gonadal steroids involves a complex interplay between progestins, estrogens and androgens. i i i T A B L E OF CONTENTS Abstract i i Table of Contents r iv List of Tables ..vii List o f Figures ; v i i i List of Abbreviation : ; ; x Acknowledgements x i P A R T I O V E R V I E W , . 1 1.1 Background 1 1.2 Structural Development of the Endometrium 2 1.3. Endometrial Cel l Model Systems. 5 1.4 Cellular Mechanisms Underlying Endometrial Remodeling 7 1.4.1 Gonadal Steroids 7 1.4.2 Antisteroidal Compounds 12 1.5 Remodeling of the Extracellular Matrix ( E C M ) of the Endometrium 15 1.5.1 Proteolytic Mechanisms Responsible for Endometrial E C M Remodelling.... 18 1.5.1.1 Plasminogen Activators and Their Inhibitors 19 1.5.1.2 Matrix Metalloproteinases and Their Endogenous Inhibitors 20 T .5.2 A D A M s (A Disintegrin A n d Metalloproteinase) 24 1.6 A D A M T S (A Disintegrin A n d Metalloproteinase with ThromboSpondin motif) 25 1.6.1 Structural and Functional Organization of A D A M T S Subtypes 26 1.6.2 Cel l Biology of A D A M T S 30 iv 1.7 H Y P O T H E S I S 33 P A R T 2 M A T E R I A L S A N D M E T H O D S 35 2.1 Tissues — 35 2.2 Cel l Isolation and Culture ..35 2.3 Experimental Culture Conditions ... 36 2.3.1 Steroid Treatments 36 2.3.2 Antisteroid Treatments 37 2.4 R N A Preparation and Synthesis of First Strand c D N A 37 2.5 Design of Oligonucleotide Primers 38 2.6 Real-time P C R Analysis 39 2.7 Western Blot Analysis. 40 2.8 Statistical Analysis. . , ...40 P A R T 3 R E S U L T S . . . . 42 3.1 Time-Dependent Effects of Gonadal Steroids on Stromal A D A M T S - 1 m R N A and Protein levels 42 3.2 Dose-Dependent Effects of Gonadal Steroids on Stromal A D A M T S - 1 m R N A and Protein Levels 43 3.3 Combinatorial Effects of Gonadal Steroids on Stromal A D A M T S - 1 m R N A and Protein Expression Levels 43 3.4 Effects of Varying Concentrations of E2 to Attenuate the P4-mediated Increase in Stroma A D A M T S - 1 m R N A and Protein levels 44 3.5 Regulatory Effects of the Antisteroidal Compounds on A D A M T S - 1 m R N A and Protein Expression Levels 44 v P A R T 4 D I S C U S S I O N 63 P A R T 5 C O N C L U S I O N , L I M I T A T I O N S A N D F U T U R E D I R E C T I O N S . . . 69 5.1 Conclusion 69 5.2 Limitations 69 5.3 Future direction 70 R E F E R E N C E S 71 v i LIST OF T A B L E S Table 1: Features of the structural and functional domains of the A D A M T S 29 Table 2: Primer sequences for real-time P C R analysis 39 v i i LIST OF FIGURES Figure 1: Diagram of A D A M T S subtypes structure 28 Figure 2: Time-dependent effects o f P4, D H T and E2 on A D A M T S - 1 m R N A levels in endometrial stromal cells 46 Figure 3: Time-dependent effects of P4, D H T and E2 on A D A M T S - 1 protein levels in endometrial stromal cells. 48 Figure 4: Concentration-dependent effect of P4, D H T or E2 on A D A M T S - 1 m R N A levels in endometrial stromal cells 49 Figure 5: Concentration-dependent effect of P4, D H T or E2 on A D A M T S - 1 protein levels in endometrial stromal cells .. ..51 Figure 6: Combinatorial effects of P4 and D H T on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 52 Figure 7: Combinatorial effects of E2 and P4 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells : 53 Figure 8: Combinatorial effects of E2 and D H T on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 54 Figure 9: Expression of A D A M T S - 1 m R N A and protein levels in endometrial stromal cells cultured in the presence of P4 plus increasing concentration of E2 . . . . ; 55 Figure 10: Regulatory effects of the antiprogestin compound, RU486 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 56 Figure 11: Regulatory effects of RU486 on P4 mediated increase of A D A M T S - 1 r h R N A and protein levels in endometrial stromal cells ...57 v i i i Figure 12: Regulatory effects of RU486 on D H T mediated increase of A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 58 Figure 13 Regulatory effects of the antiandrogen compound, flutamide on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 59 Figure 14 Regulatory effects of flutamide on D H T mediated increase of A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 60 Figure 15 Regulatory effects of the antiestrogen compound, ICI 182, 780 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 61 Figure 16 Regulatory effects of E2 plus ICI 182, 780 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells 62 ' i x LIST OF ABBREVIATION A D A M • A Disintegrin and Metalloproteinase . A D A M T S A Disintegrin and Metalloproteinase with TromboSponding repeats E2 . - • 17p-estradiol E R Estrogen Receptor : P4 Progesterone P R Progesterone Receptor T Testosterone D H T 5a-dihydrotestosterone A R Androgen Receptor E C M Extracellular Matrix M M P Matrix Metalloproteinase • M T - M M P Membrane-type Matrix Metalloproteinase, TIMPs Tissue inhibitors of M M P s uPA , urokinase plasminogen activator " tPA tissue-type plasminogen activator PAI Plasminogen activator inhibitor S E M Standard error of mean P R L Prolactin IGFBP-1 Insulin-like growth factor binding protein-1 P R M Progesterone receptor modulator H S P G Heparan sulfate proteoglycan TSP Thrombospondin S V M P Snake venom metalloprotease P C R Polymerase Chain Reaction c D N A Complementary Deoxyribonucleic A c i d D M E M Dulbecco's Modifided Eagle Medium dNTP Deoxynucleoside triphosphate D N A Deoxyribonucleic acid DNAase Deoxyribonuclease F B S fetal bovine serum A N O V A Analysis of variance X A C K N O W L E D G E M E N T S First of all , I would like to express my deepest gratitude to Dr. Col in D . MacCalman, my research supervisor, for providing excellent mentorship to me these past years; for guiding my research with understandable and clear direction through the various stages of this work, being so thorough and concern in supervising the preparation of this thesis. Truly speaking, without his brilliant ideas, personal guidance and patient instruction, it never would have been possible to complete these projects in first place. Secondly, I want thank Dr. Peter C . K . Leung, the Director of Reproductive and Developmental Sciences, who has always offered the most valuable and professional advice to me. I also truly appreciated his support throughout these studies. I want to take this opportunity to thank my supervisory committee: Dr. Peter McComb (chairman), Dr. Peter C . K . Leung, Dr. Timothy Rowe and Dr. Beth Taylor for overseeing my research progress and give me valuable and constructive suggestion. I would like to express my most sincere appreciation to Dr. Catherine J. Pallen for being my external examiner for her most valuable time and comments on this thesis. I would also like to thank Dr. Hua Zhu in Dr. MacCalman's lab for her most valuable technical support, advice, comments and friendship. A s well I would like to take this opportunity to express my appreciation to my collegues: Dr. Shuko Murakami, Alexander Beristain, York H . N g and other lab members for their constant support and friendship during the time we have spent together. I would also like to express my thanks to the members in Oncology division for their ongoing support on the tissue collection. Finally, I am forever indebted to my parents for their nurturance, for giving me encourage and confidence during my growing up. I would also like to thank my husband and my son for their sharing my burden, for their understanding and the love and happiness they gave to me. Here I dedicate this thesis to my family by expressing my sincere appreciation to the people I deeply loved. x i PART 1 O V E R V I E W 1.1 Background Pregnancy loss is major health concern facing reproductive medicine in the 21 s t century. Approximately 35% of pregnancies never come to term and approximately 10% of couples trying to establish a family suffer from severe fertility problems (Stephenson 1996; Paria et al., 2002). It is projected that these clinical problems w i l l increase sharply in the next decade as women in developed countries continue to delay child-bearing. (Ventura et al., 2003). Uncertainty about the underlying causes of infertility associated with implantation failure often leads to open-ended empirical treatments that can create significant emotional and financial burdens for women, families and the health care system (El-Toukhy, 2002). Furthermore, notwithstanding the recent advances made in assisted reproductive technologies, the success rate of in vitro fertilization and embryo transfer ( IVF-ET) rarely exceeds 25% (Nygren and Andersen, 2002). Our inability to significantly improve the pregnancy rate in these women provides further evidence that current clinical practices may have outpaced our basic understanding of the biology of embryonic implantation and placentation. 1 A better understanding of the molecular determinants that create a uterine environment capable of supporting pregnancy w i l l allow us to pinpoint critical aspects of this developmental process that are particularly vulnerable to failure. 1.2 Structural Development of the Endometrium The human endometrium undergoes cyclic remodeling in preparation for pregnancy (Noyes et al., 1950). After menstruation, the endometrium regenerates to produce a dense cellular stroma containing narrow tubular glands and small blood vessels. Immediately after ovulation, a change in epithelial cell morphology can be observed with larger gland profiles and the appearance of basal glycogen masses in these endometrial cells. In contrast, there is little change in the histology of the endometrial stromal or vascular cells at this stage of the menstrual cycle. If fertilization occurs, embryonic implantation occurs in the midsecretory phase of the cycle. This phase is therefore a critical nodal point; with an embryo present, P4 levels w i l l continue to increase, leading to decidualisation of the stroma. Alternatively, in the absence of pregnancy, P4 levels w i l l fall to produce a late secretory endometrial phenotype, followed by menstrual shedding. The endometrium is only receptive to the implanting embryo at a certain stage of the menstrual cycle, named the "window of implantation" ( A D A M et al., 1956). A t other time period o f the menstrual cycle, the endometrium is "non-receptive". The putative "window of implantation" in humans is believed to span cycle days 20-24 and involves the luminal epithelium and subsequently the endometrial stroma (Adam et al. 1956; Nikas, 2 1999; Wi lcox et al., 1999). This receptive period is associated with distinct morphological and molecular changes in the luminal epithelium of the endomtrium. In particular, epithelial dome-like structures (pinopodes), that are believed to mediate the attachment of the embryo to the luminal epithelium, appear at the implantation site (Lindenberg, 1991). The expression of several molecules in this endometrial cell layer including carbohydrate epitopes, H-type 1 antigen, heparan sulfate proteoglycan, mucins, integrin subunits (particulary avp3 and a4pi ) and the trophin-bystin/tastin complex has also been found to be temporally regulated in this endometrial cell layer, thereby framing the "window o f implantation" (Apl in et al., 1995; Suzuki et al., 1999; Lessey et al., 2000; Kao et al., 2002). The mid secretory stroma also exhibits histological changes that represent the earliest cascade of differentiative events leading to decidualisation (Noyes et a l , 1950), a key cellular event in implantation. Focal areas o f edema appear in which the density o f stromal cells is reduced. A s a result, blood vessels in these areas are more obvious, although no overt vascular differentiation is yet evident. Other areas o f the stroma are still densely populated with elongated mesenchymal cells. A s in other phases o f the menstrual cycle, but now becoming more apparent, the periglandular stroma contains a layer o f flattened cells in close apposition to the epithelial basement membrane. In the late secretory phase, the areas of edematous stroma become more extensive, though more densely cellular areas also still persist. A t this time, vascular differentiation occurs to produce prominent spiral arterioles surrounded by a cuff of pseudo-decidual cells, enlarged stromal cells that resemble the decidual cells of pregnancy. 3 Decidualisation o f the endometrium involves the differentiation of the stromal cells that acquire distinct morphological and functional features (Noyes et al., 1950; Wynn, 1974). Morphological decidualisation is expressed histologically by a change from a spindle to a polyhedral cell shape with an increase in cell size, in conjunction with, an extensive development o f the organelles involved in protein synthesis and secretion, and by the appearance o f desmosomes and gap junctions (Lawn et al., 1971; Wynn, 1974; Jahn et al., 1995). Functionally, decidualisation is associated with the onset of prolactin (PRL) and insulin-like growth factor binding protein-1 (IGFBP-1) secretion (Maslar et al., 1979; Lala et al., 1984). A significant population of bone-marrow derived cells, amounting to which include large granular lymphocytes (LGLs) , macrophages and to a lesser extent, T cells are also now present and account for over 40% of cells of deciduas (Starkey et al., 1988; Bulmer et al., 1990). The L G L s are believed to arise from a smaller population of precursor cells present in the endometrial stroma during the secretory phase of the menstrual cycle. Close intercellular associations are often observed between these bone marrow-derived cells and resident decidual cells (Apl in et al., 1988). Most cells have also been detected in the human decidua (Marx et al., 1999). The diverse populations of cells that constitute the decida allows this dynamic tissue to fulfill paracrine, nutritional, and immunoregulatory functions throughout pregnancy (Lala and Kearns, 1984) In addition, the decidua plays a key embryoregulatory role by virtue o f its intrinsic ability to regulate the invasion of trophoblastic cells into the underlying maternal tissues and vasculature during early pregnancy (Bischof et a l , 2000). The depth 4 of trophoblast invasion is precisely controlled by the decidua and errors have extreme consequences on the health of the mother and fetus (Cross et al., 1994; Paria et al., 2002) 1.3 Endometrial Cell Model Systems Progress in our understanding of the development of uterine environment that w i l l support pregnancy in humans has been hampered by the fact that in vivo human experimentation is not ethically feasible and the morphological differences between the human placenta and the process o f decidualisation and that of experimental and domestic animals (Leiser and Kaufmann, 1994). Consequently, most of our information regarding these two inter-related developmental processes relied on histological studies o f hysterectomy or term placental tissue specimens (Hertig, 1967; Hamilton and Grimes, 1970; Pijnenborg et al., 1980). More recently, several in vitro model systems have been developed and used to examine the biochemical and cellular mechanisms underlying the development, maintenance and regression of the human endometrium. The ability o f gonadal steroids to regulate the cyclic remodeling processes that occur in the endometrium was first demonstrated using ovariectomized rodent model systems (Psychoyos, 1976). However, in contrast to the rat and mouse, embryonic implantation in the human occurs at a time when the stroma is not yet decidualised (Noyes et al., 1950; Hertig, 1967). Consequently, the molecular and biochemical mechanisms underlying the differentiation of the human endometrium have been determined using cultures o f endometrial explants (Bentin-Ley et al., 1994), endometrial carcinoma cell lines 5 (Somkuti et al., 1997) and primary cultures of cells isolated from endometrial tissue specimens obtained from women with a variety of medical conditions and at all stages of the menstrual cycle and early pregnancy (Irwin et al., 1989; Fernandez-Shaw et al., 1992; Shiokawa et al., 1996). In vitro models include primary cultures of the stromal and glandular epithelial cells which can be enzymatically isolated and maintained in culture (Irwin et al., 1989; Fernandez-Shaw et al., 1992; Shiokawa et al., 1996). Bone marrow-derived cells and vascular cells have also been recovered using similar enrichment procedures (Starkey et al., 1988). In view o f the likelihood of intercellular communication via soluble mediators (Wegmann et al., 1993), it is important to define and characterize the cells present in the culture models. The differentiation state of the cell cultures is also an important variable. The addition of gonadal steroids to the culture medium o f endometrial stromal cells stimulates decidualisation as determined by morphological differentiation and the production o f biochemical markers including prolactin, laminin and IGFBP-1 (Irwin et al., 1989). In contrast, the removal o f gonadal steroids from this model culture system mimics many o f the molecular and biochemical events associated with the late luteal phase and menstruation (Salamonsen et al., 1997). 6 1.4 Cellular Mechanisms Underlying Endometrial Remodeling 1.4.1 Gonadal Steroids The human endometrium is a dynamic tissue that undergoes well-defined cycles of proliferation, differentiation, and shedding in response to the prevailing endocrine and paracrine environment. It has been well established that 17(3-estradiol (E2) promotes cellular proliferation in the stroma and glandular epithelium of the endometrium, particularly during the proliferative phase of the menstrual cycle. Progesterone (P4) in turn, is believed to act upon the E2-primed endometrium, thereby initiating glandular secretion and the differentiation of stromal cells into decidual cells during the secretory phase o f the menstrual cycle (Noyes et al., 1950; Clark et al., 1980). Steroids interact with their target organs via their corresponding and specific nuclear receptors, E2 binds to estrogen receptors (ER), P4 binds to progesterone receptors (PR) and androgen binds to androgen receptors (AR) . The receptors vary temporally and spatially across the menstrual cycle (Critchley et al., 2001; Snijder et al., 1992; Garcia et al., 1988; Lesseyetal . , 1988). The P R is composed of two hormone binding proteins, designated P R A and P R B (Truss and Beato 1993). These two proteins are encoded by a single gene under the control o f distinct promoters, each o f which generates distinct P R m R N A transcripts (Kastner at al., 1990). P R A and P R B are both capable o f binding progestins and interacting with steroid 7 response elements (HREs). However, there is increasing evidence to suggest that they are functionally distinct. For example, in transfection studies these two proteins have different abilities to activate progestins responsive promoters (Tora et al. 19891; Vegeto et al.1993). These differences were promoter- and cell-specific suggesting that cellular responsiveness to progestins may be modulated via alterations of the ratio of P R A and P R B expression. Although P R B tends to be a stronger activator of target genes, P R A can act as a dominant repressor of P R B (Tung et al. 1993; Vegeto et al. 1993). These observations suggest that high P R A expression may result in reduced progestin responsiveness and that P R A and P R B may thus be a repressor and activator, respectively. In general, P R expression levels are believed be regulated by E2 and P4 which increase and decrease the levels of this receptor in target tissues, respectively (Levy et al. 1980). In agreement with these observations, E2 has been shown to up-regulate P R whereas P4 has been shown to decrease the levels of both protein isoforms in isolated human glandular epithelial cells (Eckert and Katzenellenbogen 1981; Evans and Leavitt 1980; Katzenellenbogen 1980; Kreitmann et al. 1979). In contrast, P4 was shown to be capable o f coordinately up-regulate the expression levels o f P R A and P R B in human endometrial stromal cells in vitro (Tseng and Zhu 1997). Two structurally related subtypes o f E R , commonly known as E R a and ERp 1, have been identified in human, as well as in other mammals (Green et al., 1986; Kuiper et al., 1996). A second isoform o f the E R has been reported in certain E2-responsive tissues in rat (Kuiper et al. 1996) and human (Mosselman et al. 1996). This isoform, termed ER-(3, is 8 highly homologous to the a-isoform of the receptor, particularly in the DNA-b ind ing and ligand-binding domains (Kuiper et al. 1997; Kuiper et al. 1996). In ligand binding assays ER-P has been shown to bind E2 with an affinity and specificity that is similar to E R - a (Kuiper et al. 1996). ER-P is able to activate transcription of E2-responsed element-containing reporter gene constructs (Kuiper et al. 1996). Furthermore, homodimers and heterodimers o f these two E R isoforms are capable of activating transcription, in an E2-dependent manner, from reporter gene constructs containing estrogen response elements. The activation of these gene constructs was more efficient with homodimers of E R - a (Pettersson et al. 1997). However, recent studies have demonstrated that these two E R subtypes have opposite regulatory modes to the natural hormone from the same D N A response element in transfection studies (Paech et al. 1997). In particular, with E R - a , E2 activates transcription, whereas with E R - P, E2 inhibits transcription at AP-1 site (Paech etal . 1997). E R a and P R are highly expressed in the glandular epithilial and endometrial stroma cells of the human endometrium during proliferative phase of the menstrual cycle. There is a marked decrease in E R a levels as the menstrual cycle enters the secretory phase (Snijders et a l , 1992; Mertens et al., 2001; Taylor et al., 2005). In contrast, E R p levels are low in proliferative endometrial glands with maximum levels being detected in this cellular compartment in secretroy endometrium. E R P was also been detected in endometrial endothelial cells, suggesting E2 may also act directly upon the vasculature o f this dynamic tissue (Critchley et al., 2000; Lecce et al., 2001). 9 There is also increasing evidence to suggest that androgens play an integral role in the cyclic remodeling events that occur in the endometrium under normal and pathological conditions. For example, the concentration of androgens in the human endometrium exceeds those in plasma (Guerrero et al., 1975; Vermeulen-Meiners et al., 1988). In a clinical setting, chronic hyperandrogenism associated with poor reproductive outcome, polycystic ovarian syndrome (PCOS), there is an increase in the level of circulating androgen and an elevation of A R expression in endometrium (Apparao et al., 2002). It has also been reported that, in women with recurrent miscarriage, high androgen concentrations may specifically act in the human endometrium (Okon et al., 1998). The direct biological actions of androgens o f are mediated by the spatiotemporal expression o f A R in the endometrium. In particular, A R levels are low in the glandular epithelium and stromal cells of the proliferative endometrium and increase in both cellular compartments as the menstrual cycle progresses to the secretory phase (Horie et al., 1992; Slayden et al., 2001; Burton et al., 2003; Kato and Seto 1985). There is increasing evidence to suggest that the biological actions of androgens on endometrial tissues vary between species and can mimic both E2 and P4. In the rodent uterus, androgens primarily have an estrogenic effect. For example, testosterone (T) and the non-aromatisable androgen, 5a-dihydrotestosterone (DHT), which cannot be aromatized into estrogen, markedly increased uterus weight and the height of the uterine luminal epithelialum, and modulate biological events simply mimicking estrogen. These effects were not prevented by the co-adminsistration of antiestrogens. However, D H T cannot induce uterine growth in E R a knockout mice. Global gene profiling o f E2- and 10 DHT-regulated gene programs in the rat endoemtrium demonstrates suggest that these two gonadal have both overlapping and distinct regulatroy effects on genes underlying the morphological and functionnal maturation of this dynamic tissue including those associated with (1) protein synthesis, maturation degradation and secretion (2) intracellular signaling and signal transduction (3) tissue growth and remodeling and (4) metabolism and metabolite transport (Gonzalez-Diddi et al., 1972; Nantermet et al., 2005). However, D H T was also capable of maintaining decidualisation in the mouse although it could not substitute for P4 in the priming of the mouse uterus suggesting a dual role o f androgens in rodent endometrim, dependent upon the stage of the reproductive cycle (Zhang et al., 1996). In contrast to the rodent, androgens have a "purely" progestogenic effect on the human endometrium For example, T and D H T both induce of prolactin (PRL) production, a biochemical marker of decidualisation, in a similar manner to that observed in cells cultured with P4. Furthermore, a combination of P4 and T enhanced prolactin (PRL) production in these cell cultures compared to those cultured in the presence of either steroid alone. Flutamide, a specific androgen receptor blocker was capable inhibit T and D H T but not P4 induced P R L secretion (Narukawa et al., 1994). This further suggested that androgen play important roles in human endometrial differentiation. Collectively, these observations suggest that progestins and androgens have independent but cooperative biological actions on endometrial stromal cells differentiation in vivo and in vitro. 11 1.4.2 Antisteroidal Compounds Over the last decade, antisteroidal compounds have replaced surgery as the first choice for the management/tratement of steroid-based medical conditions, including cancer and endometriosis as well as facilitating better control of menstruation and fertility. In addition to their use in the clinical setting, antisteroidal compounds have become useful tools for the study of the molecular and cellular mechanisms underlying the biological action of gonadal steroid hormones under normal and pathological conditions. Anti-progestins The first effective and best characterized antiprogestin is RU486 (mifepristone) (Chwalisz et al., 2000). Several other antiprogestins have subsequently been developed, such as onapristone, which have greater potency and higher specificity for the progesterone receptor (PR) (Chwalisz et al., 2000; Chabbert-Buffet et al., 2005). In addition, mixed antagonists commonly known as mesoprogestins or progesterone receptor modulators (PRMs) have been developed. P R M s can block the actions o f P4 but i n the absence of this gonadal steroid can act as agonists. Both antiprogestins and P R M s have many potentially important clinical uses and chronic low dose treatment with antiprogestins has been proposed for the management of aberrant endometrial bleeding, endometriosis, breast cancer, and contraception. 12 RU486 has been shown to act as an effective antigestional agent when administered during the luteal phase of the menstrual cycle and as an abortifacient when administered during pregnancy (Gobello, 2006). In particularly, the administration o f RU486 during the early luteal phase o f menstrual cycle delays the development o f a secretory endometrium without affecting the function of corpus luteum or the length o f the menstrual cycle (Gemzell-Danielsson, et al., 1994). RU486 binds to the progesterone receptor (PR) with a higher affinity than its naturally occurring ligands (Baulieu, 1997). RU486 prevents P4 binding to the PR, which in turn, results in P4 being eliminated from the cell or metabolished in situ. In addition, it is believed that RU486 also decreases P R levels in the human endometrium (Zaytseva et al., 1993). Anti-estrogens Pharmacologic groups o f compounds that inhibit or modify estrogens are classified as anti-estrogens. Some of these are gonadotrophin releasing hormones (GnRH) analogs and aromatase inhibitors that inhibit estrogen synthesis. Another anti-estrogenic drug group is estrogen receptor blockers (Williams et al., 1996). Clomiphene and tamoxifen citrate are synthetic nonsteroidal type-I anti-estrogenic compound which competitively block estrogen receptors with a combined antagonistic-agonistic effect. They partially inhibit the action o f estrogen agonists, but due to their own agonistic properties, they also induce estrogenic responses (Hoffmann and Schuler, 2000). Thus in women, tamoxifen has anti-estrogenic activities on the mammary gland and agonistic effects on the uterus (Jordan, 1995). 13 ICI 182, 780, is a novel estrogen receptor "blockor", which acts as a 'pure' estrogen antagonist without estrogen-like, agonist activity (Kauffman et al., 1995; Wakeling et al., 1991; Dukes et al., 1992). It has the E R binding affinity approximately 100 times greater than that o f tamoxifen and has no agonistic activity on target tissues including the endometrium and uterus. It has been studied by used in clinical trails as replacement of tamoxifen for the treatment of advanced, and tamoxifen-resistant breast cancer, as it has a longer duration o f response and fewer side effects (Robertson, 2001; H u et al., 1993). Additionally, ICI 182, 780 has been widely used experimentally to investigate the role of estrogen and other hormones on mammalian tissues and cells in vivo and in vitro. Anti-androgens Several groups of compounds have been described to have anti-androgenic properties, These include progestins, receptor binding anti-androgens, and aromatase inhibitors. Flutamide/hydroxyflutamide is a pure androgen receptor blocker, which inhibits androgen uptake and nuclear binding by binding to the androgen receptor (Hoffmann et al., 2000). Clinically, flutamide has yielded good results in treating prostatic hyperplasia with few side-effects (Neri and Monahan, 1972). In addition, hydroxyflutamide has been shown to have anti-progestagenic activities in uterus, cervix, and hypothalamus in rats (Chandrasekhar 1991). 14 Aromatase inhibitors, such as formestane, exert their anti-androgenic effect by inhibiting the conversion of androgens to estrogens in peripheral tissues (Ito et al., 2000). Although it is well established that gonadal steroids play pivotal roles in the cyclic remodeling events that occur in the endometrium in preparation for pregnancy, and that their biological actions can be counterbalanced by synthetic antisteroidal compounds, the molecular mechanisms underlying their biological action in this dynamic tissue at distinct stages of the menstrual cycle remain poorly characterized. 1.5 Remodeling of the Extracellular Matrix (ECM) of the Endometrium Recent microarray array studies have demonstrated that the biological actions of gonadal steroids on the endometrium are mediated by the sequential and categorical activation o f multiple gene programs with a wide variety of functions and which exhibit either distinct or overlapping expression patterns (Popovici et al., 2000). To date, the overall biological significance o f these gene expression patterns in the developmental of a uterine environmet capable of supporting pregnancy remains to be elucidated. Consequently, remodelling o f the endometrial E C M is still considered to be a key underlying event o f the morphological and functional maturation of this dynamic tissue during the menstrual cycle and in pregnancy (Apl in et al., 1988; Iwahashi et al., 1996; Schatz et al., 1999) 15 Regeneration of the endometrium during the proliferative phase of the menstrual cycle involves the deposition of an E C M scaffold (Apl in et al., 1988; Mylona et al., 1995; Church et al., 1996). The undifferentiated stroma produces an E C M that has a classical mesenchymal composition; in particular collagens I, III, V , and V I and fibronectin (Fn) have all been shown to be present and there are periglandular deposits o f tenascin that appear to reflect the proliferative state of the epithelial compartment (Vollmer et al., 1990). The epithelium and blood vessels are surrounded by basement membranes containing laminin, collagen type IV and heparan sulfate proteoglycan (HSPG). Ovulation has little effect on the composition of the stromal or vascular E C M although collagen deposited into the E C M is organized into fibril bundles that form an anastomosing network in the intercellular spaces. Changes in the E C M accompany the transition from undifferentiated stroma to decidua (Wynn, 1974; Wewer et al., 1985; Kisalus et al., 1987; Ruck et al., 1994). These include a decrease in type I collagen, fibronectin and laminin of endometrium significant decreased after implantation. In addition, the type IV collagen and laminin of epithelial basement membrane also remarkably declined during early pregnancy (Yamada et al., 2002). The decidual cell basement membrane is composed o f laminins 2 and 4, type I V collagen, H S P G and B M - 4 0 (Faber et al., 1986; Wewer et al., 1988 Church et al., 1996). The decidual E C M lacks the bundles of uniform-diameter parallel fibrils found in the intercellular spaces of the endometrial stroma. Fibr i l diameters and orientations are variable and fibrils are sparsely distributed, though the major collagen types I, III, and V and fibronectin are still present. Type V I collagen is now absent. The decidual cells 16 encapsulate themselves in a pericellular basal lamina through which pedicels protrude. The pedicels contain secretory granules probably involved in the secretion o f basement membrane components (Kislaus et al., 1988). The differentiation of endometrial stromal E C M presents two contrasting molecular paradigms. The first is the selective removal during decidualisation of collagen V I , a structural component that plays a key role in the integration and structural stabilization o f tissue architecture, perhaps by cross-linking the major scaffolding elements o f the endometrial E C M during the proliferative phase. The focal loss of collagen V I in the endometrial stroma during the mid secretory phase may mediate, at least in part, the reduction and cellular density and increased edema associated with this stage o f the menstrual cycle (Apl in et al., 1988). In addition, the loss o f collagen V I during decidualisation may help promote cellular interaction and/or create a uterine environment into which trophoblast invasion may occur more readily (Apl in , 1991). The second is the appearance of laminins (Ln) 2 and 4 in association with the differentiating stromal cells (Church et al., 1996). A s previous studies have demonstrated that laminin 2 is capable of mediating cell attachment and spreading (Brown et al., 1994), it is tempting to speculate that it may play a role in trophoblast adhesion, migration and/or differentiation during early pregnancy. Similar speculations apply to the migratory bone marrow-derived cells that are often observed to be attached to the pericellular basal lamina. It is also believed that the decidual basement membrane plays a role in the structural organization and integration o f decidual E C M that is required to support the developing 17 conceptus, expand as the feto-placental compartment grows and be permeable to macromolecules, such as prolactin, secreted by the decidua and destined for the fetal compartment (Apl in et al., 1988; Ruck et al., 1994). Alterations in the composition in the endometrial E C M are coordinated with regulated changes in the expression levels of cell-matrix receptors on the cell surface. In particular, there is a marked increase in the endometrial levels of av and (33 integrin subunits, members o f the gene superfamily of calcium-dependent cell-matrix adhesion molecules, during the window of implantation in humans (Lessey, 2002) Aberrant expression o f avb3 integrin subunits in the endometrium are associated with infertility and recurrent pregnancy loss (Lessey 1998). 1.5.1 Proteolytic Mechanisms Responsible for Endometrial ECM Remodeling The majority o f the tissue remodeling events that occur in the endometrium during the proliferative and secretory phases o f the menstrual cycle involves the degradation o f E C M components, particularly interstitial collagens and basement membranes (Fata et al., 2000, Curry and Osteen, 2001). The decidua is also subject to further degradation, particularly the first trimester of pregnancy, by the invading trophoblast that have been shown to adopt similar cellular mechanisms for E C M degradation to those observed during tumour cell invasion and metastasis (Yagel et al., 1988; Strickland and Richards, 1992; Lala and Hamilton, 1996; Bischof et al., 2000). 18 Consequently, proteolytic enzymes have been assigned key roles in these develop process of tissue remodeling. In particular, urokinase plasminogen activator (uPA) and the matrix metalloproteinases ( M M P s ) have been shown work in concert or in cascades to degrade or process specific components of the endometrial E C M (Schatz et al., 1999; Fata et al., 2000; Curry et al., 2001). However, as aberrant expression or distribution of E C M components in the endometrial stroma has been associated with infertility and recurrent pregnancy loss (Bilalis et al., 1996; Jokimaa et al., 2002), it is important to define the full repertoire of proteinases expressed by these cells, their regulation, and ultimately, their individual contribution(s) to the development of a uterine environment that is capable of supporting pregnancy. 1.5.1.1 Plasminogen Activators and Their Inhibitors The plasminogen activators are substrate-specific serine proteinases that mediate cleavage of plaminogen to plasmin, which exhibits a broad range of serine protease activity (Vasselli et al., 1991; Andreasen et al., 2000). The proteinase activator system includes the urokinase-type plasminogen activator (uPA), the tissue-type P A (tPA), and their endogenous inhibitors, P A inhibitor-1 and - 2 (PAI-1 and PAI-2 , respectively) and their common receptor, u P A receptor in the human endometrium. u P A and t P A expression in the human endometrium are temporally expressed during the menstrual cycle with highest levels being detected during the secretory phase and early pregnancy (Casslen and Astedt, 1983; K o h et a l , 1992). Similarly, PAI-1 expression 19 levels have also been shown to be high during the secretory phase and decline with the onset o f menstruation (Koh et al., 1992). The withdrawal of P4 from the culture medium of endometrial stromal cells was found to increase u P A activity and concomitantly decrease PAI-1 expression levels in these cultures (Schatz et al., 1999). However, mice null mutant for u P A , urokinase receptor (uPAR), tPA, did not exhibit reduced fertility (Bugge et al., 1996), indicated that other proteinases also involved in this complex process. 1.5.1.2 Matrix Metalloproteinases and Their Endogenous Inhibitors The matrix metalloproteinases ( M M P s ) are a large gene family of zinc-dependent proteinases that mediate a variety of tissue remodeling processes (Woessner, 1991; Fata et al., 2000). To date, 24 distinct members of the M M P gene family been identified. These distinct M M P subtypes can be further divided into several subgroups based upon their substrate specificities and/or structural similarities; collagenases ( M M P - 1 , M M P - 8 , M M P - 1 3 ) , gelatinases ( M M P - 2 , M M P - 9 ) , stromelysins ( M M P - 3 , M M P - 7 , M M P - 1 0 , M M P - 1 1 ) , membrane-type M M P s ( M T - M M P 1 though M T - M M P 6 ) and a miscellaneous group that contains M M P - 1 2 , M M P - 1 9 through M M P - 2 6 . In addition to the hydrolysis o f distinct E C M components, M M P s have been shown to be capable o f cleaving cytokines-chemokines and their ligands (either in soluble form or bound to the cell surface), cell adhesion molecules (cadherins and integrins), their own zymogen forms and other M M P s and proteinases inhibitors such as serpins (Egebald and Werb, 2002). In general, M M P s are synthesized as latent zymogens that must be cleaved in order to 20 become activated. The activity o f M M P s can be further regulated by the secretion o f specific tissue inhibitors o f M M P s (TIMPs). T I M P s are the major endogenous regulators of M M P proteolytic activity in vivo (Woessner, 1991). To date, four homologous T I M P subtypes, T I M P - 1 , -2, -3, and -4, have been identified. T I M P s are small secreted proteins (21-28 kDa) that form tight, non-covalent bonds with the proteloytic domain of the M M P subtypes with a stoichiometry of 1:1 (Woessner, 1991; Egebald and Werb, 2002). The unique structural properties o f TIMP-3 however allow it to bind to heparan-sulphate-containing proteoglycans and possibly chondroitin-sulphate-containing proteoglycans in the E C M ( Y u et al., 2000). T I M P s also exhibit other biological functions that are independent o f their ability to inhibit the proteolytic activity of M M P s . For example, TIMPs-1 and -2 have mitogenic effects on a number of cell types (Wang et al., 2002) whereas overexpression o f these proteins reduces tumor cell growth (Ikenka et al., 2003). TIMP-3 has been shown to promote apoptosis in human melanoma and colon carcinoma cells (Smith et al., 1997; Ahonen et al., 2003). To date, 13 M M P subtypes have been detected in the human endometrium during the menstrual cycle (Curry and Osteen, 2001, Fata et al, 2002; Goffin et al., 2003). The complex expression patterns observed for each of these endometrial M M P subtypes suggests distinct roles in the development, maintenance and regression o f this dynamic tissue. In particular, M M P - 7 , M M P - 1 1 , M M P - 2 6 , and M T 3 - M M P expression levels are high during the proliferative phase in the menstrual cycle and decrease in the secretory 21 phase. In contrast, M M P - 2 , M M P - 1 9 , M T 1 - M M P and M T 2 - M M P are constitutively expressed in the endometrium throughout the menstrual cycle whereas M M P - 1 , M M P - 3 , M M P - 8 , M M P - 9 , and M M P - 1 2 are only detected in the endometrium during menstruation. M M P - 2 , M M P - 3 , M M P - 9 but not M M P - 1 , M M P - 7 have been detected in the decidua o f early pregnancy whereas only M M P - 2 and M M P - 9 are expressed in this dynamic tissue at term ( X u et al., 2002). To date, the cellular localization of only some of the M M P s in the human endometrium has been determined. During the follicular phase, M M P - 1 , M M P - 2 and M M P - 3 have been detected in the stroma, M M P - 7 and M M P - 9 in glandular epithelium and M M P - 9 also in neutrophils and monocytes (Rodgers et al., 1993, 1994; Hampton et al., 1995; Irwin et al., 1996; Jeziorska et al., 1996). In the luteal phase, M M P - 3 , M M P - 1 0 and M M P - 1 1 have been reported to be present in the stroma, M M P - 7 in the glandular epithelium, and M M P - 9 in the glandular epithelium and neutrophils (Rodgers et al., 1994; Irwin et al., 1996; Jeziorska et al., 1996). Within menstrual tissue, M M P - 1 and M M P - 3 have been detected in stromal cells near blood vessels, M M P - 2 , M M P - 9 , M M P - 1 0 and M M P - 1 1 in the stroma, M M P - 7 in the glandular epithelium and M M P - 9 in monocytes, neutrophils and macrophages (Rodgers et al., 1993, 1994; Hampton et al., 1994, 1995; Marbaix et a l , 1995; Kokorine 1996). The human endometrium has also been shown to constitutively express T I M P - 1 , T IMP-2 , and TIMP-3 whereas the expression of TIMP-4 in this dynamic tissue has not been examined (Fata et al., 2000, Osteen and Curry, 2001; Goffin et al., 2003). In contrast to 22 the M M P s , there appear to be only small fluctuations in the overall expression levels of T I M P - 1 , T I M P - 2 and TIMP-3 expression in the endometrium during the menstrual cycle. However a localized increase in TIMP-1 m R N A and protein expression areas has been detected near small arteriolar and capillary tissue in the secretory endometrium and menstrual tissue suggesting that it may be focally regulated in the endometrial vasculature (Rodgers et al., 1993; Salamonsen and Woolley, 1996; Zhang and Salamonsen, 1997). Similarly, T IMP-2 m R N A and protein expression levels were found to be highest in the vasculature than glandular epithelium, stroma or decidua o f early pregnancy (Hampton and Salamonsen 1994; Zhang and Salmonsen, 1999). TIMP-3 expression levels have also been shown to increase in the predecidual cells o f the secretory phase suggesting that it may serve as a cellular marker o f decidualisation and/or play a critical role in regulating trophoblast invasion (Zhang and Salmonsen, 1999; Goffin et al., 2003). Therefore, it appears that the regulation M M P expression levels in the human endometrium are two-fold involving large cyclic fluctuations in the epithelial and/or stromal cells o f the endometrium and at small localized foci within these cellular compartments which occur through the menstrual cycle. The activity o f endometrial M M P s is counterbalanced by the spatial expression of T I M P levels within the two cellular compartments of this dynamic tissue. The roles of M M P s and TIMPs in the cyclic remodeling events that occur in the endometrium during each menstrual cycle have been extended to primary cultures o f human endometrial cells. Conditioned media from stromal cells isolated from human endometrial tissues have been shown to contain the latent forms of M M P - 1 , M M P - 2 , 23 M M P - 3 , M M P - 9 and M M P - 1 1 and T I M P - 1 , TIMP-2 and TIMP-3 using zymography and reverse zymography, respectively (Salamonsen et al., 1997). The addition of P4, but not E2, to the culture medium of these primary cell cultures is capable of causing a significant decrease in the levels of these M M P subtypes and concomitant increase in T I M P expression levels (Marbaix et a l , 1995; Osteen et al., 1994; Schatz et al., 1999. In contrast, the withdrawal of gonadal steroids from the culture medium of endometrial stromal cells allowed to undergo steroid-mediated decidualisation, a culture model system believed to mimic the cellular mechanisms underlying menstruation, resulted in a marked increase in all o f the M M P subtypes expressed by endometrial stromal cells but had no effect on T I M P m R N A or protein expression levels in these primary cultures (Salamaonsen et al., 1997). 1.5.2 ADAMs (A Disintegrin And Metalloproteinase) The A D A M s (A Disintegrin A n d Metalloproteinase) is a gene family of transmembrane proteins that contain a disintegrin and a metalloprotease domain. The metalloprotease domains can induce ectodomain shedding and cleave E C M protein. The disintegrin and cysteine-rich domain have adhensive activities. Thus, the A D A M s have the potential to act as adhesion molecules and/or proteinases. Two generic functions have been proposed for the A D A M proteases: (1) local activation of signalling pathways by the shedding o f cell surface cytokines and growth factors and (2) cell migration/invasion by the degradation of the E C M (Wolfsberg et al., 1995; Black and white, 1998). 24 Although five A D A M subtypes ( A D A M s - 9 , -10, 12, 17, and -28) have been shown to act as metalloproteases in vitro, only A D A M S - 9 , -10, and -17 are known to be catalytically active in vivo. In particular A D A M - 9 is responsible for the shedding of Heparin-binding epidermal growth factor ( H B - E G F ) from cultured cells. A D A M - 1 0 acts as a sheddase in the Notch signalling pathway. A D A M - 1 7 is involved in multiple ectodomain-shedding events, most notably the release of T N F - a . Several observations also suggest that A D A M s may be involved in cell migration. For example, A D A M - 1 0 and snake venom metalloproteases (SVMPs) , the closest relatives of A D A M s , have been shown to cleave purified E C M components in vitro. A D A M - 9 has been shown to promote the migration o f fibroblasts in vitro whereas A D A M - 1 3 expression has been detected in cranial neural-crest cells, a highly migratory population o f cells in the Xenopus embryo. In support o f a role for the A D A M S in implantation and placentation, A D A M - 9 expression has recently been detected in the trophoblastic column, trophoblastic shell and stroma cells o f the chorionic v i l l i o f the placenta of rhesus monkeys (Wang et al., 2005). 1.6 A D A M T S (A Disintegrin And Metalloproteinase with ThromboSpondin motif) Recent cloning studies have identified new members o f the A D A M family, known as A D A M T S , in C elegans, Drosophila and mammals. In contrast to the A D A M S , A D A M T S are secreted proteins which do not contain the cysteine rich, EGF- l ike , transmembrane and cytoplasmic domains characteristic of the other members of the A D A M gene family. 25 1.6.1 Structural and Functional Organization of ADAMTS Subtypes A D A M T S are characterized by four structural and functional subunits: an amino terminal prodomain, a catalytic domain, a disintegrin-like domain, and an E C M binding domain (which is composed of a central thrombospondin (TSP) type 1 motif, a spacer region and a variable number o f TSP-l ike motifs) at the carboxy terminal end of the protein (Kuno et al., 1997a; Hurskainen et al., 1999; Vazquez et al., 1999; Nath et a l , 2000; Tang et al., 1999, 2001) (Figure 1). The structural features of these domains are further summarized in Table 1. Thus all numbers of this gene family have the potential to act as M M P s and to regulate cell adhesion. Some A D A M T S subtypes have been further subclassified according to the presence o f additional C-terminal modules or by the identification of common substrates. For example, A D A M T S - 1 2 contains a mucin domain between the 3rd and 4th of its seven C -terminal TSP-1 repeats (Kuno et al. 2004). Similarly, A D A M T S - 1 , -4, -5, -8 and -15 have been assigned to the subfamily of A D A M T S subtypes known as the aggrecanases owing to their ability to cleave the large chondroitin sulphates: versican, brevican, aggrecan and neurocan (Tang et al., 1999, 2001; Nagase and Kashiwagi, 2003, Porter et al., 2005). In addition to the N-terminal processing of the A D A M T S zymogens, resulting in the cleavage of the signal peptide and prodomain, C-terminal processing has been described for A D A M T S - 1 , -4, -8, and -12. These cleavage events occur within the spacer region and in the case o f A D A M T S - 1 2 , within the mucin domain of its characteristic 2 n d spacer 26 region (Porter et al., 2005; Tang et al., 1999). To date, one C-terminal processing event has been described for A D A M T S - 1 , -8 and -12, and two events for A D A M T S - 4 (Kuno et al., 1997, Tang et al., 1999, 2001; Poter et al., 2005). Removal o f the ancillary C-terminal domain of the A D A M T S have a profound impact on the proetolytic activity, substrate specificity and subcellular localization of these enzymes. The C-terminal protein fragments of some o f the A D A M T S also have independent and distinct biological functions. For example, the C-terminal fragment o f A D A M T S - 2 and -4 inhibits the enzymatic activity of the mature forms of these A D A M T S subtypes whereas those o f A D A M T S - 1 and -8 exhibit potent anti-angiogenic properties (Poter et al., 2005; Rodriguez-Manzaneque et al., 2000; Vazquez et al, 1999). Recently, the exogenous expression of the mature form of A D A M T S - 1 was showfi to have pro-metastatic effects on carcinoma cells whereas the C-terminal fragment of this A D A M T S subtype exhibited anti-metastatic effects on the cells in vivo (L iu et al., 2005). The structural-functional relationship(s) and the molecular mechanisms underlying the distinct biological activities of the C-terminal fragments of these and the other A D A M T S subtypes subject to post translational cleavage remain to be elucidated. 27 ADAMTS-4 ADAMTS-5 ADAMTS-8 ADAMTS-9 ADAMTS-1 S signal peptide pro domain metalloproteinase domain disintegrin domain cysteine-rich domain spacer region gon-1 -Iike motif Thrombospondin type 1 motif Figure 1 Diagram of A D A M T S subtypes structure. Conserved structural motifs are shown. 28 Table 1: Features of the structural and functional domains of the ADAMTS DOMAIN GENERAL FEATURES BIOLOGICAL FUNCTIONS Signal Peptide Prodomain A l l A D A M T S contain an SPC (subtilisin-like proprotein convertase) cleavage site and with the exception of A D A M T S - 1 0 and -12 they are all furin recognition sequences following the consensus R X R / K R . Only A D A M T S - 1 , -6, -7, -10, -12 and -15 contain a cysteine residue in their prodomain within a X X C G V D motif that loosely resembles that of the cysteine switch in M M P s Responsible for maintaining latency of catalytic domain, correct protein folding and secretion. Cleaved in Golgi prior to secretion. Some A D A M T S subtypes ( A D A M T S - 7 and -13) can be catalytically active with their prodomains still attached. MMP-domain A metalloproteinase domain with a reprolysin-type zinc binding motif H E X X H X X G / N / S X X H D . The conserved aspartic acid residue (bolded) distinguishes the A D A M and A D A M T S from other M M P s and a methionine residue within the sequence V / I M A S / S or Met-turn down, downstream of the 3 r d zinc binding histidine. A l l A D A M T S subtypes exhibit proteolytic activity in vitro Specific substrates for most A D A M T S subtypes unidentified, however, A D A M T S - 2 , -13 and -14 are procollagen N-proteinases involved in processing pro-collagens to collagen. A D A M T S - 1 , -4, 5, -8 and -15 preferentially cleave hyalectans A D A M T S - 1 3 cleaves the large proteoglycan, von Willebrand factor (vWF) Disintegrin domain Shares sequence similarity to the soluble snake venom disintegrins, a family of polypetides which conatin an integrin recognition sequence (RGD). No A D A M T S has an R G D motif in their disintegrin domain. N o biological activity identified in any A D A M T S subtype. N o evidence that A D A M T S disintergin domain associates with integrins. E C M Binding cassette • Central TSP-1 domain • Cysteine rich domain • Spacer Region • TSP-l ike domains TSP-1 repeat seen in thrombospondins 1 and 2 High sequence homology among A D A M T S subtypes, contains 10 cysteine residues. Spacer region is of variable length with no distinguishing structural features. Variable number of C-terminal TSP-1 motifs (range from 0 repeats in A D A M T S - 4 to 14 repeats in A D A M T S - 2 0 ) . Deletion mutants demonstrated that central TSP-1, spacer region and TSP-1-like motifs all contribute to E C M binding and subsequent proteolytic activity/specificity of the A D A M T S , particularly, A D A M T S - 1 , -2, -4, and -8. 1.6.2 Cell Biology of ADAMTS To date, the majority of the distinct A D A M T S subtypes have only been characterized at the structural levels. However, there is increasing evidence to suggest that these novel proteases play important roles in organogenesis during embryonic development (Cho et al.,1998; Nakamoto et al., 2005; Shindo et al., 2000), in the onset and progression of cancer (Poter et a l , 2006; Held-Feindt et al., 2006 ), arthritis (Jones and Riley, 2005), a number of thrombotic and inflammatory conditions (Kuno et al., 1997) and in the cyclic remodeling events that occur in adult reproductive tissues (Cho et al.,1998; Boerboom et al., 2003; Young et al., 2004; Nakamoto et a l , 2005). A D A M T S - 1 The best characterized member of the A D A M T S gene family is A D A M T S - 1 . A D A M T S -1 was initially identified as an inflammation-associated protein in an animal model for colon cancer cachexia (Kuno et al, 1997a). The proteolytic activity o f A D A M T S - 1 has subsequently been associated with cancer (Masui et al, 2001), osteoarthritis (Nagase and Kashiwagi, 2003; Jones and Riley, 2005) and in the development of inflammation associated with these two diseases (Kuno et al., 1997b; Nagase and Kashiwagi, 2003) or in response to trauma (Sasaki et al, 2001). For example, altered expression levels o f A D A M T S - 1 have been detected in human carcinomas but its individual contribution(s) to the onset and progression of cancer also remains unclear (Porter et al., 2004, 2005; Masui 30 et al., 2001; Rocks et al., 2006). A D A M T S - 1 m R N A levels have been shown to be either increased or decreased (Porter et al., 2004) in breast carcinomas. Higher levels o f this A D A M T S subtype have also being associated with pancreatic and hepatocellular cancer (Masui et al., 2004) whereas A D A M T S - 1 m R N A levels are unchanged in the onset and progression o f kidney cancer (Roemer et a l , 2004) and decreased in lung carcinomas (Rocks et al., 2006). Among the pancreatic cancer cases, those with higher levels o f A D A M T S - 1 showed poorer prognosis, with evidence o f increased local invasion and lymph node metastasis (Masui et al., 2004) whereas there was no direct correlation between A D A M T S - 1 expression and the clinicopathological features o f breast or renal carcinomas (Porter et al., 2004; Roemer et al., 2004). Furthermore, the exogenous expression o f A D A M T S - 1 has been shown to decrease the experimental metastasis o f Chinese hamster ovary cells (Kuno et al., 2004) but increase the metastatic potential o f mammary and lung cancer cell lines in vivo (L iu et al., 2005a). Further studies are required to evaluate the biological and clinical significance of (dys)regulated expression levels o f A D A M T S - 1 , alone or in combination with other distinct A D A M T S subtypes, in the onset and/or progression o f cancer to the later stages o f the disease state. Gene knockout studies in mice have demonstrated that A D A M T S - 1 can have either redundant or non-redundant biological activities depending upon the tissue, its developmental stage or its disease state. For example, A D A M T S - 1 has redundant roles in the growth and development of cartilage and bone (Little et al., 2005), in cartilage degradation during the progression of arthritis (Stanton et al., 2005) but has non-31 redundant roles in follicular development and ovulation (Shindo et al., 2000; Shozu et al., 2005). ADAMTS -1 and the Endometrium Studies from our laboratory have recently determined that A D A M T S - 1 is also spatiotemporally expressed in the human endometrium during the menstrual cycle and in pregnancy (Ng et al., 2006). In particular, A D A M T S - 1 expression was readily detectable throughout the glandular epithelium but was restricted to the predecidualised stromal cells surrounding the spiral arterioles of the secretory endometrium. Extensive A D A M T S - 1 immunostaining was subsequently detected in the stromal cells of first trimester decidua, large polyhedral cells that are characteristic o f this dynamic tissue. This expression pattern suggests that A D A M T S - 1 , mediates at least in part, the steroid-mediated E C M remodeling events that occur in endometrium during each menstrual cycle. A D A M T S - 1 expression has also been detected in the uterine tissues o f pregnant mice (Shindo et al., 2000; Mittaz et al., 2004) but the role of this novel metalloproteinase in the development o f a uterine environment that is capable of supporting pregnancy remains unclear. Although there is a significant increase in A D A M T S - 1 m R N A levels in the mouse endometrium during the peri-implantation period ( K i m et al., 2005), endometrial tissues of mice null-mutant for this gene have been shown to either develop large cysts (Shindo et al., 2000) or be capable of undergoing normal morphological decidualisation (Mittaz et al., 2004). However, all A D A M T S - 1 gene knockout female mice are reported 32 to have reduced pregnancy rates (Shindo et al., 2000; Mittaz et al., 2004). 1.7 HYPOTHESIS To date, the factors responsible for the spatiotemporal expression of ADAMTS-1 in the endometrium have not been identified. However, as ADAMTS-1 expression is associated with the decidualisation of endometrial stromal cells of both murine and human endometrium, a developmental process that is governed by increasing levels of P4 and a concomitant decrease in E2, we hypothesis that gonadal steroids are potent regulators of endometrial ADAMTS-1 expression levels. In support of this hypothesis, P4 has recently been shown to regulate ADAMTS-1 expression in rodent and porcine ovaris (Doyle et al., 2004; Shimada et al., 2004). Specific Aim 1: To examine the ability of progestins, estrogens and androgens to regulate ADAMTS-1 mRNA and protein expression levels in primary cultures of human endometrial stromal cells. To determine the regulatory effects of gonadal steroids on ADAMTS-1 expression in the human endometrium, we will examine the abilities of P4, E2, and DHT, alone or in combination, to regulate ADAMTS-1 mRNA and protein expression levels in a dose- and time-dependent manner. This will be achieved by using primary cultures of human endometrial stromal cells. The ability of these gonadal steroids to regulate ADAMTS-1 33 mRNA and protein levels in these primary cell cultures will be determined by using a real-time PCR strategy and Western blot analysis, respectively. Specific Aim 2: To examine the regulatory effects of antisteroidal compounds on ADAMTS-1 mRNA and protein expression levels in primary cultures of human endometrial stromal cells. We will next examine the regulatory effects of the antisteroidal compounds, RU486 (an anti-progestin), ICI 181, 872 (an anti-estrogen) or flutamide (an anti-androgen) alone or in combination with P4, E2, and DHT, alone or in combination, to regulate ADAMTS-1 mRNA and protein expression levels in a dose- and time-dependent manner. This will be achieved by using the same primary cell cultures and approaches as described above. 34 PART 2 M A T E R I A L S AND M E T H O D S 2.1 Tissues Endometrial tissues were obtained from women of reproductive age undergoing hysterectomy for reasons other than endometrial cancer. A l l patients had normal menstrual cycles and had not received hormones for at least 3 months prior to tissues collection. 2.2 Cell Isolation and Culture Enriched cultures o f stromal cells were isolated from these endometrial tissues by enzymatic digestion and mechanical dissociation as previously described (Chen et a l . ) In this protocol, endometrial tissue samples are minced and subjected to 0.1% collagenase (type IV , sigma Chemical Co , St Lois , M O ) and 0.1% hyaluronidase (type I-S, sigma Chemical Co , St Lois, M O ) digestion in a shaking water bath at 37°C for 60 min. The cell digest are then passed through a nylon sieve (38um). The isolated glands and any undigested tissue fragments are retained on the sieve, and the eluate containing the stromal cells was collected in a 50ml tube. The stromal cells are then pelleted by centrifugation at 800 x g for 10 min at room temperature. The cell pellet are washed once with phenol red-free D M E M containing 10% charcoal-stripped fetal bovine serum (FBS) before being resuspended and plated in phenol red-free D M E M containing 25 m M 35 glucose, L-glutamine, antibiotics (lOOU/ml penicillin, lOOtig/ml streptomycin) and supplemented with 10% charcoal-stripped F B S , The culture medium is replaced 30 min after plating to reduce epithelial cell contamination. The purity o f the endometrial stromal cell cultures is determined by immunocytochemical staining for vimentin (fibroblast), cytokeratin (epithelial), muscle actin (muscle cells) and factor VIII (endothelial). These cellular markers have been used to determine the purity o f human endometrial cell cultures (Irwin et al., 1989). A s defined by these criteria, the endometrial stromal cell cultures used in these studies contained < 1 % epithelial or vascular cells. 2.3 Experimental Culture Conditions 2.3.1 Steroid Treatments Endometrial stromal cells (passage 2) were grown to confluence, washed with P B S and cultured in phenol red-free D M E M supplemented with 10% charcoal-stripped F B S and containing either increasing concentrations of P4 (1-1 OuM), E2 ( l -100nM), or D H T (1-200nM) for 72h or a fixed concentrations of P4 ( l u M ) , E2 (30nM) or D H T (lOOnM) for 0 ,6 , 12, 24, 48, or 72h. To determine whether a combination of steroids was required for maximal A D A M T S - 1 expression in endometrial stromal cells, the cells were cultured in the presence o f P4 plus E2 , P4 plus D H T or E2 plus D H T for 0-72 h before being harvested for real-time P C R and Western blot analysis. 36 2.3.2 Antisteroid Treatments Endometrial stromal cells were cultured in the presence or absence of increasing concentrations o f RU486 (25nM, 250nM, 2 .5pM, 5 p M , and lOpM), ICI 182, 780 ( l O n M , lOOnM, l p M , 5 p M , 10pM)) or flutamide ( I n M , l O n M , lOOnM, 500nM, l p M ) for 72 hours, or fixed concentration of RU486 (2.5pM), ICI 182, 780 ( l p M ) or flutamide (lOOnM) for 0, 6, 12, 24, 48 or 72 hours. Endometrial stromal cells cultured with vehicle (0.1% ethanol) served as controls for these studies. The concentrations of gonadal steroids and antisteroidal compounds and the time points examined in this study based upon previous studies (Chen et al, 1998, 1999; L i n g et al., 2002). A l l o f the primary cultures of endometrial stromal cells were harvested for either total R N A or protein extraction. 2.4 RNA Preparation and Synthesis of First Strand cDNA Total R N A was prepared from endometrial tissue cell cultures using Tri-Reagent (Bio/Can, Mississauga, Canada) and protocol recommended by the manufacturer. The total R N A extracts were then treated with Deoxyribonuclease-1 (Sigma Aldrich) to eliminate possible contamination with genomic D N A . To verify the integrity of the R N A , aliquots o f the total R N A was electrophoresed in a 1 % (w/v) denaturing agarose gel containing 3.7% (v/v) formaldehyde and the 28 S and 18 S ribosomal R N A subunits 37 visualized by ethidium bromide staining. The purity and concentration o f total R N A present in each o f the extracts was quantified by optical densitometry (260/280nm) using a Du-64 UV-spectrophotometer (Beckman Coulter, Mississuaga, O N , Canada) Aliquots (~1 pg) o f the total R N A extracts prepared from each of the decidual stromal cell cultures were then reverse-transcribed into c D N A using a First Strand c D N A Synthesis K i t according to the manufacturer's protocol (Amersham Pharmacia Biotech, Oakville, O N , Canada). Briefly, an aliquot ( lpg) of the total R N A dissolved in DNase/RNase-free water (8pl in total) was heated at 65°C for 10 minutes and cooled on ice. Dithiothreitol (DTT) ( lp l ) , oligo-dT ( lp l ) , and bulk mixture (dATP, dCTP, dGTP, dTTP) (5 pi) was added to the sample, and the mixture was incubated at 37°C for 1 hour. After incubation, the sample was boiled for 5 minutes to inactive reverse transcriptase and subsequently stored at -20°C until use. 2.5 Design of Oligonucleotide Primers Nucleotide sequences specific for human A D A M T S - 1 were identified in the Genebank database using the B L A S T (basic Local Alignment Search Tool) computer program (www.ncbi.com). Forward and reverse oligonucleotide primers specific for A D A M T S - 1 or G A P D H , which served as an internal control for these studies, were designed by the P R I M E R E X P R E S S software (Applied Biosystems). The specific nucleotide sequences o f these primers are listed in Table 2. 38 Table 2 Primer sequences for real-time PCR analysis Gene Primer sequence(5'-3') Position Product(bp) GAPDH Forward ATGGAAATCCCATCACCATCTT 269-290 57 GAPDH Reverse CGCCCCACTTGATTTTGG 325-308 ADAMTS-1 Forward GCTCATCTGCCAAGCCAAAG 1979-1999 59 ADAMTS-1 Reverse CTACAACCTTGGGCTGCAAAA 2037-2016 2.6 Real-time PCR Analysis Real-time PCR was used to detect ADAMTS-1 mRNA levels in our primary cultures of human endometrial stromal cells. GAPDH mRNA levels served as endogenous control for these studies. Real-time PCR was performed using the ABI PRISM 7000 sequence detection system and SYBR green master mix reagent (Applied Biosystems). The relative quantification of gene expression was analyzed by the 2 _ A A C T method. For the treated samples, evaluation of 2~ A A C j indicates the fold change in gene expression relative tO the Control. ACx= Cj Target"CT.GAPDH• AACT= (Cx.Target-CT.GAPDH)x-( Cj.Target-CT.GAPDH)O- The CT value represents the cycle number at which a fluorescent signal rises statistically above background. X is any time or dose point of treated sample, 0 represented control sample (Kenneth and Thomas 2001). Data were analyzed using SDS 2.0 software (Applied Biosysterms). 39 2.7 Western Blot Analysis Endometrial stromal cell cultures were washed three times in cold 1% P B S and incubated in 100 ul o f cell extraction buffer (Biosource International, Camarillo, C A ) supplemented with 1.0 m M P M S F and protease-inhibitor cocktail at 4°C for 30 minutes on a rocking platform. The cell lysates were centrifuged at 10, 000 x g for 20 minutes at 4°C and the supernatants w i l l be used for Western blot analysis. The concentrations o f protein in the cell lysates were determined using a B C A kit (Pierce Chemicals, Rockford, IL). Using a polyclonal antibody directed against human A D A M T S - 1 (Biodesign Intl., Saco, M E ) . To standardize the amounts of protein loaded into each lane, the blots were reprobed with a monoclonal antibody directed against human P-actin (Sigma Chemical Co.). The Amersham E C L system was used to detect the amount of each antibody bound to antigen and the resultant autoradiograms analyzed by U V densitometry. The absorbance values obtained for A D A M T S - 1 were then normalized relative to the corresponding P-actin absorbance value. 2.8 Statistical Analysis The absorbance values obtained from the real-time P C R products and the autoradiograms generated by Western blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (GraphPad, San Diego, C A ) . Statistical differences between the absorbance values were assessed by the analysis o f variance ( A N O V A ) . Differences 40 were considered significant for p < 0.05. Significant differences between the means were determined using Dunnett's test. The results are presented as the mean relative absorbance (+ S E M ) obtained using cell cultures isolated from tissue samples obtained from >3 different patients. 41 PART 3 RESULTS 3.1 Time-Dependent Effects of Gonadal Steroids on Stromal ADAMTS-1 mRNA and Protein Levels A D A M T S - 1 m R N A was detected in all o f the endometrial stromal cell cultures. The addition of vehicle to the culture medium had no significant effect on the levels of the A D A M T S - 1 m R N A transcript present in these cells at any o f the time points examined in these studies (data not shown). A significant increase in A D A M T S - 1 m R N A levels was detected in endometrial stromal cells cultured in the presence of either P4 or D H T after 24h (Figure 2 A and B , respectively). A D A M T S - 1 m R N A levels in these cells continued to increase until the termination of these studies at 72h. In contrast, E2 alone did not significantly increase stromal A D A M T S - 1 m R N A levels, at least at any of the time points examined in these studies (Figure 2 C) . Western blot analysis revealed the presence of a single A D A M T S - 1 protein species o f 110 k D a in all o f the endometrial stromal cell cultures. This protein species corresponds to the A D A M T S - 1 zymogen (Rodriguez-Manzaneque et al., 2000; Wachsmuth et al., 2004). In agreement with our P C R data, A D A M T S - 1 protein expression levels remained relatively constant in endometrial stromal cells cultured in the presence of vehicle alone (data not shown). Similarly, P4 and D H T but not E2 caused a significant increase in 42 A D A M T S - 1 protein expression levels in endometrial stromal cells over time in culture (Figure 3 A - C , respectively). 3.2 Dose-Dependent Effects of Gonadal Steroids on Stromal ADAMTS-1 mRNA and Protein Levels A significant increase in A D A M T S - 1 m R N A and protein expression levels was only observed in cells cultured with the higher concentrations of P4 ( l p M or 5 p M ; Figure 4 A and 5A) or D H T (lOOnM or 200nM; 4B and 5B) examined in these studies. In contrast, A D A M T S - 1 m R N A and protein expression levels remained relatively constant in cells cultured in the presence o f increasing concentrations o f E2 (Figure 4 C and 5C). 3.3 Combinatorial Effects of Gonadal Steroids on Stromal ADAMTS-1 mRNA and Protein Expression Levels P4 plus D H T caused a significant increase in stromal A D A M T S - 1 m R N A levels over time in culture (Figure 6) that were not significantly different from those observed in endometrial stromal cells cultured in the presence of P4 or D H T alone. In contrast, the levels o f the A D A M T S - 1 protein species present in these cell cultures were significantly greater than those detected in cells cultured in either gonadal steroid over the same time periods (Figure 6). 43 In contrast to endometrial stromal cells cultured in the presence of either P4 or D H T alone, we failed to detect any significant changes in A D A M T S - 1 m R N A and protein expression levels in cells cultured in E2 plus P4 (Figure 7) or E2 plus D H T (Figure 8) at any o f the time points examined in these studies. 3.4 Effects of Varying Concentrations of E2 to Attenuate the P4-mediated Increase in Stroma ADAMTS-1 mRNA and Protein Levels In agreement with our preceding findings, P4 increased A D A M T S - 1 m R N A and protein levels after 72 h o f culture (Figure 9). There was no significant difference between A D A M T S - 1 m R N A and protein levels in these cells and those cultured with the lower concentrations o f E2 (0.1 n M and InM) examined in these studies. However, a significant decrease in A D A M T S - 1 m R N A and protein levels was first detected in cells cultured in the presence o f 10 n M of E2. The addition of higher concentrations (30nM and lOOnM) o f E2 to the culture medium did not result in a further decrease in A D A M T S - 1 m R N A and protein levels in these cells. 3.5 Regulatory Effects of the Antisteroidal Compounds, RU486, ICI 182, 780 and Flutamide on Stromal ADAMTS-1 mRNA and Protein Expression Levels 44 A D A M T S - 1 m R N A and protein expression levels remained relatively constant in endometrial stromal cells cultured in the presence of RU486 at least at the concentrations o f this antisteroidal compound examined in our studies (Figure 10). R U 486 inhibited the P4-mediated increase in stromal A D A M T S - 1 m R N A and protein expression levels in a concentration-dependent manner (Figure 11). In contrast, A D A M T S - 1 m R N A and protein expression levels remained elevated in endometrial stromal cells cultured with a combination of D H T and increasing concentrations of R U 486 (Figure 12). Similarly, there was no significant difference in A D A M T S - 1 m R N A and protein expression levels in endometrial stromal cells cultured with increasing concentrations o f hydroxyflutamide alone (Figure 13). Hydroxyflutamide inhibited the DHT-mediated increase in stromal A D A M T S - 1 m R N A and protein expression levels in a concentration-dependent manner (Figure 14). Increasing concentrations of ICI 182, 780, alone or in combination with E2, had no significant effect on stromal A D A M T S - 1 m R N A and protein expression at least at the concentrations we studied (Figure 15, 16). Flutamide has no significant effect on A D A M T S - 1 m R N A and protein levels expression (Figure 15A and B) . Flutamide significant inhibited the DHT-mediated increase in A D A M T S - 1 at m R N A and protein levels (Figure 16A and B) . 45 ADAMTS-1 by P4 Time 2 A 2.5 1 « 2 -1 < 1.5 15 1 0.5 I P4 0h III 2B 6h 12h 24h ADAMTS-1 by DHT Time DHT Oh ADAMTS-1 by E2 Time 2C i i i i i i E2 0h 6h 12h 24h Figure 2 48h 72h Figure2. Time-dependent effects of gonadal steroids on A D A M T S - 1 m R N A levels in endometrial stromal cells. Real-time P C R analysis of A D A M T S - 1 m R N A levels in endometrial stroma cells cultured in the presence of a fixed concentration of (A) P4 ( l p M ) , (B) D H T (lOOnM) or (C) E2 (30nM) for 0, 6, 12, 24, or 48 h. The results are presented as mean+SEM, n>3 in the bar graphs (* P<0.05 vs. untreated control). 46 3 A ADAMTS-1 (3-actin Oh 6h 12h 24h 48h 72h mm HOkD 42kD ADAMTS-1 by P4 Time Oh 6h 12h 24h 48h 72h P-actin HOkD 42kD ADAMTS-1 by DHT Time DHT Oh 47 3C Oh 6h 12h 24h 48h 72h ADAMTS-1 P-actin HOkD 42kD ADAMTS-1 by E2 Time g 1.5 a. • • • • • • E2 0h 6h 12h 24h 48h 72h Figure 3 Figure 3. Time-dependent effects o f gonadal steroids on A D A M T S - 1 protein expression levels in endometrial stromal cells. Western blot analysis was performed using total protein extracts (30pg) prepared from endometrial stromal cells cultured in the presence o f a fixed concentration of (A) P4 ( l u M ) , (B) D H T (lOOnM) or (C) E2 (30nM) for 0, 6, 12, 24, or 48 hours. The blots were probed with a polyclonal antibody directed against A D A M T S - 1 or a mononoclona. The Amersham E C L system was used to detect antibody bound to antigen. The resultant autoradiograms were scanned and the values obtained for A D A M T S - 1 normalized to absorbance values obtained for the corresponding b-actin. The results derived from this analysis, as well as those from at least three other studies (autoradiograms not shown) were standardized to the Oh control and are represented (mean + S E M ; n > 3) in the bar graphs (* P<0.05 vs. untreated control). 48 ADAMTS-1 by P4 Dose 4 A P4 10nM 100nM ADAMTS-1 by DHT dose 4B 3.5 3 2.9 E > us iiil Ctrl DHT 1nM 10nM 50nM ADAMTS-1 by E2 Dose 100nM 200nM 4C • • • • • • Ctrl E21nM 10nM 30nM 50nM 100nM Figure 4 Figure 4. A D A M T S - 1 m R N A and protein levels in endometrial stromal cells cultured in the presence o f increasing concentration o f P4, D H T , or E2 for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs, (* P<0.05 vs. untreated control). (A) Cells cultured with 0, l O n M , lOOnM, l p M , 5 p M , l O p M of P4 for 72 hours. (B) Cells cultured with 0, I n M , l O n M , 50nM, lOOnM, 200nM of D H T for 72 hours. (C) Cells cultured with 0, I n M , l O n M , 30nM, 50nM, lOOnM of E2 for 72 hours. 49 Ctrl 10nM lOOnM luM S\iM \Q^M ADAMTS-1 HOkD ADAMTS-1 by P4 Dose 100nM Figure 3 D Ctrl InM lOnM 50nM lOOnM 200nM f3-actin « M H H n i a ^ ^ <— 42kD ADAMTS-1 by DHT Dose Ctrl 1nM 10nM 50nM 100nM 200nM 50 5C Ctrl InM lOnM 30nM 50nM lOOnM A D A M T S - 1 P-actin HOkD 42kD ADAMTS-1 by E2 Dose I £ 2 c '5 S 1.3 • • • • • • Ctrl InM 10nM 30nM 50nM 1O0nM Figure 5 Figure 5. A D A M T S - 1 m R N A and protein levels in endometrial stromal cells cultured in the presence o f increasing concentration o f P4, D H T , or E2 for 72 hours. Panel D-F , Western blot analysis o f A D A M T S - 1 expression in protein extraction (30pg) prepared from endometrial stromal cells cultured in the presence o f increased concentration o f P4 (0-1 OuM), D H T (0-200nM) and E2 (0-100nM) for 72 hours respectively. Result presented as Mean+SEM, n>3 in the bar graphs (* P<0.05 vs. untreated control). 51 ADAMTS-1 by P+TTime 6 A Oh 6h 12h 24h 48h 72h 6B ADAMTS-1 * P-actin H | HOkD 42kD ADAMTS-1 by P+TTime P+TOh 24h 48h 72h Figure 6 Figure 6. Expression of combinatorial effects of gonadal steroids on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells. Representative A D A M T S - 1 levels in cells cultured in the presence of P4 ( l p M ) plus D H T (lOOnM) for 0, 6, 12, 24, 48, and 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs (* P<0.05 vs. untreated control). (A) Real-time P C R analysis of A D A M T S - 1 m R N A levels. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 52 7 A ADAMTS-1 by P+ETime 4 3.5 S 3 H > 0} < 2.5 2 £ 1.1 0) a I E 0.5 0 • I I I I I PEOh 6h 12h 24h 48h 72h Oh 6h 12h 24h 48h 72h 7B HOkD 42kD ADAMTS-1 by P+ETime °> 2 S 1.5 Q. I I • I • I P+EOh 6h 12h 24h Figure 7 48h 72h Figure 7. Expression of combinatorial effects of gonadal steroids on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells. Representative A D A M T S - 1 levels in cells cultured in the presence of P4 ( l p M ) plus E2 (30nM) for 0, 6, 12, 24, 48, and 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs.(A)Rea\-time P C R analysis of A D A M T S - 1 m R N A levels. (B) Western blot analysis o f A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 53 8 A 2.5 £ 2 i ADAMTS-1 by E+T Time I I I I I I E+TOh 6h 12h 24h 48h 72h 8B Oh 6h 12h 24h 48h 72h ADAMTS-1 B-actin HOkD 42kD ADAMTS-1 by E+TTime E+TOh 6h 12h 24h 48h 72h Figure 8 Figure 8. Expression of combinatorial effects of gonadal steroids on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells. Representative A D A M T S - 1 levels in cells cultured in the presence of D H T (lOOnM) plus E2 (30nM) for 0, 6, 12, 24, 48, and 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs. (A) Real-time P C R analysis of A D A M T S - 1 m R N A levels. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30ug) prepared from the endometrial stromal cells. 54 A D A M T S - 1 b y P + E 2 D o s e 9 A Ctrl P P+E0.1nM P+E1nM P+E10nM P+E30nM P+E100nM 9B Ctrl P4 n " InM lOnM 30nM lOOnM O.lnM P-actin . in in - —inn i i i . mi mm •« ,», , 1 1 „ » 4 — 42kD A D A M T S - 1 b y P + E D o s e Ctrl P P+E0.1nM P+E1nM P+E10nM P+E30nM P+E100nM Figure 9 Figure 9. Expression o f A D A M T S - 1 m R N A and protein levels in endometrial stromal cells cultured in the presence of P4 ( l p M ) plus increased concentration of E2 (O . lnM, I n M , l O n M , 30nM, lOOnM) for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs (* P<0.05 vs. untreated control, ** P<0.05 vs. P4). (A) Representative real-time analysis o f A D A M T S - 1 m R N A level. (B) Western blot analysis of A D A M T S -1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 55 ADAMTS-1 by Ru486 Dose 10A > at I • I I I Ctrl Ru 25nM 250nM 2.5uM 5uM 10uM 10B Ctrl 25nM 250nM 2.5^M 5^iM lOuM A D A M T S -1 p-actin i ADAMTS-1 by Ru486 Dose Figure 10 l l O k D 42kD I I I I I Ru25nM 250nM 2 .5uM 5 u M 1 0 n M Figure 10. Representative regulatory effects o f antiprogestin compound RU486 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells. Panel A and B , cell cultured in the presence of 0, 25nM, 250nM, 2.5 u M , 5 u M , l O u M of RU486 for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs. (A) Representative real-time analysis of A D A M T S - 1 m R N A level. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 56 11A ADAMTS-1 by P+Ru486 II P4 P+Ru25nM 250nM 2.5uM 5uM 10uM 11B P+Rn Ctrl P4 2 5 n M 250nM 2.5uM 5uM lOuM ADAMTS-1 ~ m m I, m i m a m < HOkD P-actin - - [IIIIIIM.II /..IIJ .1 - <— 42kD ADAMTS-1 by P+Ru486 Dose Ctrl P4 P+Ru25nM 250nM 2.5 P M 5 u M 1 0 ^ M Figure 11 Figure 11. Representative regulatory effects o f antiprogestin compound RU486 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells. Expression of A D A M T S - 1 levels in endometrial stromal cells cultured in the presence of P4 ( l p M ) plus increased concentration of RU486 (25nM, 250nM, 2 .5uM, 5 p M , lOpM) for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs (* P<0.05 vs. untreated control, ** P O . 0 5 vs. P4). (A) Real-time analysis of A D A M T S - 1 m R N A level. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 57 12A ADAMTS-1 by DHT+Ru486 a> 3 > ffl ^ 2.5 z % . 0) B K 1 ! Ctrl DHT T+Ru25nM 250nM 2.5uM 5uM 10uM 12B Ctrl DHT 250nM2.5nM 5^M 10nM 25nM A D A M T S - 1 P-actin a^mtmt Mmtm^mm M > I # ^ ^ ^ M . HOkD 42kD ADAMTS-1 by DHT+Ru486 Dose 4 3.S > a a) > 1.5 J5 <s 1 0.5 0 Ctrl MINI DHT T+Ru25nM 250nM 2.5 u M 5 u M 10 u M Figure 12 Figure 12. Representative regulatory effects of antiprogesterone compound RU486 on A D A M T S - 1 m R N A and protein levels in endometrial stromal cells. Panel E and F, Expression o f A D A M T S - 1 levels in endometrial stromal cells cultured in the presence o f D H T (lOOnM) plus increased concentration of RU486 (25nM, 250nM, 2 .5uM, 5 u M , 10pM) for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs. (A) Real-time analysis of A D A M T S - 1 m R N A levels. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 58 13A ADAMTS-1 by Flutamide 500nM 13B ADAMTS -1 P-actin £ 2 2 1.3 Ctrl F l u Ctrl o.lnM InM lOnM lOOnM 500nM luM ADAMTS-1 by Flu Dose Flu O.lnM 1nM 10nM 100nM 50OnM HOkD 42kD I I I I I I I 1uM Figure 13 Figure 13. Expression of A D A M T S - 1 m R N A levels in endometrial stromal cells cultured in the presence of increased concentration of flutamide ( I n M , l O n M , lOOnM, 500nM and l p M ) for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs. (A) Representative real-time analysis of A D A M T S - 1 m R N A level. (B) Western blot analysis o f A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 59 14A Ctrl ADAMTS-1 by DHT+Flutamide III DHT DHT+ 1nM 10nM 100nM 5O0nM 1uM nuO.lnM T+Flu 14B Ctrl Flu D H T 0 l n M InM lOnM 100nM500nMluM A D A M T S - 1 B-actin l lOkD 42kD ADAMTS-1 by DHT+Flu Dose ** ** ?F >|t T I I I Ctrl Flu DHT DHT+Flu 1nM 10nM 100nM 500nM 1uM 0.1 nM Figure 134 Figure 14. Expression of A D A M T S - 1 m R N A levels in endometrial stromal cells cultured in the presence of D H T (lOOnM) plus increased concentration o f flutamide ( I n M , l O n M , lOOnM, 500nM l u M ) for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs. (* P<0.05 vs. untreated control, ** P<0.05 vs. D H T ) . (A) Representative real-time analysis of A D A M T S - 1 m R N A level. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 60 ADAMTS-1 by ICI182 780 Dose 15A I I I . I CMOnM 100nM 1uM 5uM 10uM Ctrl lOnM lOOnM l u M 5^iM 10uM 15B ADAMTS-1 by ICI Dose • • • • • CMOnM "lOOnM 1 p M 5 p M 10 u M Figure 145 Figure 15. Expression of A D A M T S - 1 m R N A levels in endometrial stromal cells cultured in the presence of 0, l O n M , lOOnM, l p M , 5 p M , l O p M of ICI 182 780 for 72 hours, Results are presented as Mean±SEM, n>3 in the bar graphs. (A) Representative real-time analysis of A D A M T S - 1 m R N A level. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 61 u 5uM 10uM E+ICI E2 jOnM lOOnM l u M 5uM l O ^ M ADAMTS-1 mmm^m. nmmmm •mmmmm —mm \ mm mmwm <— 1 lOkD ADAMTS-1 by E+ICI Dose E2 E+CI10nM 100nM 1 U M 5 u M 1 0 u M Figure 156 Figure 16. Expression of A D A M T S - 1 m R N A levels in endometrial stromal cells cultured in the presence of E2 (30nM) plus increased concentration of ICI 182, 780 ( l O n M , lOOnM, l u M , 5 u M , lOuM) for 72 hours. Results are presented as Mean+SEM, n>3 in the bar graphs. (A) Representative real-time analysis of A D A M T S - 1 m R N A level. (B) Western blot analysis of A D A M T S - 1 expression in protein extracts (30pg) prepared from the endometrial stromal cells. 16A ADAMTS-1 by E+ICI182 780 • •IIIctrl E2 E+CI10nM 100nM 1uM 62 P A R T 4 DISCUSSION In these studies, I have determined that that the regulation of ADAMTS-1 mRNA and protein expression levels in human endometrial stromal cells by gonadal steroids involves a complex interplay between progestins, estrogens and androgens. In particular, P4 and DHT increased ADAMTS-1 expression levels whereas E2 alone had no regulatory effect on the expression levels of this ADAMTS subtype in these primary cell cultures. A combination of DHT and P4 potentiated the increase in the levels of the ADAMTS-1 protein species present in these cell cultures whereas E2 was capable of attenuating the stimulatory effects of both P4 and DHT on stromal ADAMTS-1 mRNA and protein expression levels. In contrast, RU486 and hydroxyflutamide specifically inhibited the increase in ADAMTS-1 expression levels mediated by P4 and DHT, respectively. ADAMTS-1 mRNA transcripts have been detected in a wide array of adult human tissues including term placenta and non-pregnant uterus (Abbaszade et al., 1999; Vazquez et al., 1999). ADAMTS-1 expression has also been detected in the uterine tissues of pregnant mice (Shindo et al., 2000; Mittaz et al., 2004) but the role of this novel metalloproteinase in the development of a uterine environment that is capable of supporting pregnancy remains unclear. Although there is a significant increase in ADAMTS-1 mRNA levels in the mouse endometrium during the peri-implantation period (Kim et al., 2005), endometrial tissues of mice null-mutant for this gene have been shown to either develop large cysts (Shindo et al , 2000) or be capable of undergoing normal morphological decidualisation (Mittaz et al., 2004). However, all ADAMTS-1 gene knockout female 63 mice are reported to have reduced pregnancy rates (Shindo et al., 2000; Mittaz et a l , 2004) . Taken together, these observations suggest that A D A M T S - 1 is neither necessary nor sufficient to mediate decidualisation but may play an important role in the later stages of implantation and placentation and/or that other A D A M T S subtypes expressed in the endometrium may have overlapping and thus, non-redundant functions in this multi-step reproductive process. A potential candidate for the partial rescue o f the reproductive capacity of the A D A M T S - 1 gene knockout mouse is A D A M T S - 5 , also known as aggrecanase-2, A D A M T S - 1 1 or by its trivial name "implantin" (Hurskainen et al., 1999). Both proteinases are expressed in the mouse decidua (Hurskainen et al., 1999; Shindo et al., 2000; Mittaz et al., 2004) and preferentially cleave members of the gene family o f chondroitin sulphate glycoproteins known as the hyalectins (Apte, 2004; Porter et al., 2005) . Furthermore, mice null-mutant for the A D A M T S - 5 gene are viable and fertile (Stanton et al., 2005). To our knowledge, any reciprocal and compensatory changes in the expression levels of distinct A D A M T S subtypes in the endometrium o f either A D A M T S -1 or A D A M T S - 5 gene knockout mice have not been examined. A D A M T S - 1 is a secreted, multidomain, multifunctional protein composed o f an amino terminal prodomain, a proteolytic domain, a disintegrin-like domain, and an E C M binding domain (which is composed o f a central thrombospondin (TSP) type 1 motif, a spacer region and 3 TSP-l ike motifs) (Kaushal and Shah, 2000; Tang, 2001; Apte, 2004; Porter et al., 2005). In addition to its proteolytic activity, A D A M T S - 1 has been shown to have both angioinhibitory and angiogenic properties in vitro and in vivo (Vazquez et al., 1999; Carpizo and Iruela-Arispe, 2000; Shindo et al., 2000). Thus, A D A M T S - 1 has the 64 potential to contribute to the development of an uterine environment capable of supporting a pregnancy via the regulated degradation of the endometrial E C M and/or the extensive vascular changes that occur in this dynamic tissue during the menstrual cycle, another steroid-mediated developmental process implantation. Initial biochemical studies predicted that the A D A M T S - 1 zymogen (110 kDa) undergoes two consecutive post-translational cleavage steps that generate two distinct bioactive fragments (87 k D a and 67 kDa) of this protein (Rodriguez-Manzaneque et al., 2000). A l l three of the A D A M T S - 1 protein species have subsequently been detected in cellular extracts prepared from mouse ovaries (Russell et al., 2003). However, similar to our findings, only the A D A M T S - 1 zymogen was detected in primary cultures o f human chondrocytes (Wachsmuth et al., 2004). These differences are l ikely attributable to the loss o f endogenous proteolytic factors capable of cleaving A D A M T S - 1 (Rodriguez-Manzaneque et al., 2000) following the isolation and culture o f these enriched populations o f cells. O f these proteolytic factors, only M M P - 2 has been detected in the human endometrium (Fata et al., 2000). However, M M P - 2 activity in primary cultures o f endometrial stromal cells is dependent upon the presence of soluble factor(s) derived from the glandular epithelium (Goffin et al., 2002). P4 increased A D A M T S - 1 m R N A and protein expression in our cultures o f endometrial stromal cells in a concentration and time-dependent manner. Similarly, P4 has been shown to be a key regulator o f A D A M T S - 1 in the rodent ovary. The ability o f the progestin synthesis epostane, to inhibit the preovulatory increase in A D A M T S - 1 m R N A 65 levels in rat follicles, which was also not observed in mice null-mutant for the progesterone receptor provided indirect evidence that P4 is a key regulator o f A D A M T S -1 in the ovary. However, the levels of the m R N A transcript encoding this A D A M T S subtype were found to be higher in early stage corpus luteum when P4 levels are low and decline during the mid luteal phase o f the estrous cycle when the circulating levels of this gonadal steroid are high, suggesting that other factors are involved in the regulation o f A D A M T S - 1 m R N A levels, at least in the ovary (Madan et al., 2003). Computer-based searches o f the nucleotide sequence and functional assays have subsequently failed to identify a P R response element in the promoter region of the murine A D A M T S - 1 gene (Doyle et al., 2004). Instead, P4 appears to regulate A D A M T S - 1 gene expression, at least in the mouse, through an indirect mechanism(s) that involves the D N A binding transcription factors Spl /Sp3, C / E B P b and/or NF-1 (Doyle et al., 2004). Interestingly, interleukin-ip ( IL- ip) and tansforming growth factor- p i ( T G F - p i ) , two cytokines which have been shown to regulate A D A M T S - 1 in several mammalian cell types including decidual stromal cells (Ng et al., 2006), mediate many of the biological actions o f P4 on the human endometrium (Graham and Lala, 1992; Godkin and Dore, 1998; Salamonsen et al., 2000, 2003; Fazleabas et al., 2004) and to regulate gene expression in other human cell types via the Spl/Sp3 complex (Chadjichristos et al., 2002, 2003). E2 alone did not alter A D A M T S - 1 m R N A or protein expression levels in isolated endometrial stromal cells. In agreement with these findings, A D A M T S - 1 expression is low in proliferative endometrium of mice and humans and in preovulatory follicles o f rodent, bovine and equine preovulatory follicles when E2 is the predominant steroid. 66 Similarly, previous studies have failed to demonstrate a direct effect of E2 on the expression o f several markers of decidualisation including intgerin subunits and P R L and IGFBP-1 (Osteen et a l , 1989) or the secretion o f M M P s (Osteen et al., 1994) by endometrial stromal cells in vitro. Furthermore, although E2 is essential for the regulated expression o f a myriad of proteins in the endometrium (Nantermet et al., 2005), depleted levels o f this gonadal steroid during the luteal phase of the menstrual cycle do not appear to adversely affect endometrial development in vivo (Younis et al., 1994). The ability o f mice null mutant for E R to undergo decidualisation provides further evidence that E2 is not required for the activation of signaling pathways that control this developmental process via, at least in part increased A D A M T S - 1 expression. Our studies indicate that E2 has a suppressive effect on the ability of P4 and D H T to increase A D A M T S - 1 expression levels in endometrial stromal cells in vitro. Similarly, there is a marked increase in ovarian levels o f A D A M T S - 1 following the gonadotropin surge when there is an increase in P4 levels and a concomitant decrease in estrogen levels decline in follicular fluid (Boerboom et al., 2003). To date, the molecular mechanisms by which E2 modulates the regulatory effects o f P4 and D H T remain to be elucidated but are unlikely to involve alterations in the expression of P R and/or A R in these cells. The relative potencies o f P4 and D H T on A D A M T S - 1 expression levels were similar, with a combination o f both gonadal steroids producing an additive stimulatory effect. Taken together, these observations suggest that D H T has a specific effect that is mediated by a pathway that is cooperative but independent from that of P4 A D A M T S - 1 . Similar results have been observed with the biological actions o f P4 and D H T on decidualisation 67 o f the rodent endometrium. D H T and other androgens have been shown to have a direct effect on the human endometrium and mimic the biological actions of P4 in vitro and in vivo. For example, both progesterone and androgens antagonize the E2-meditaed proliferation of endometrial cells in vivo. Furthermore, T and D H T can substitute for P4 in inducing secretion of P R L and IGFBP-1 , two biochemical markers of decidualisation, in primary cultures o f human endometrial stromal cells in vitro and in maintaining the decidualisation of the mouse endometrium in vivo (Zhang and Croy, 1996). The possibility that A R s mediate D H T actions is supported by the ability of flutamide/hydroxyflutamide to block the regulatory effects of this non-aromatisable androgen on stromal A D A M T S - 1 expression levels. Hydroxyflutamide has also been shown to be suppressive o f the decidual cell reaction in the rodent endometrium (Chandrasekhar et al., 1991, Zhang and Croy, 1996). However, unlike the regulatory effects of D H T in human endometrial stromal cells, RU486 was capable of partially inhibiting the biological actions of D H T on the rodent endometrium suggesting that it is mediated, at least in part by its cross-reactivity with PR. In contrast to our findings, hydroxyflutamide had no significant effect on A D A M T S - 1 expression levels in porcine cumulus-oocyte complexes suggesting that the ability of androgens to regulate this A D A M T S subtype may be dependent upon the cellular context. In summary, my studies demonstrated the regulation of A D A M T S - 1 in human endometrial stromal cells in vitro involves a complex interplay between progestins, estrogens and androgens. 68 P ART 5 CONCLUSION, LIMITATIONS AND F U T U R E DIRECTIONS 5.1 Conclusion In conclusion, I have determined that P4 and D H T regulate A D A M T S - 1 m R N A and protein expression levels in primary cultures of endometrial stromal cells in a concentration and time-dependent manner. In contrast, E2 does not have this regulatory effect on stromal A D A M T S - 1 expression levels. Although these observations are indicative o f the expression pattern of previously described for A D A M T S - 1 in the human endometrium during the menstrual cycle, care should be taken in extrapolating our findings to the in vivo situation. Elucidation of the molecular mechanisms by which these gondal steroids regulate A D A M T S - 1 expression in endometrial stromal cells and the biological function(s) of this A D A M T S subtype in the human endometrium w i l l require further experimentation. However, my findings provide a basis for future studies into the expression and function(s) of A D A M T S - 1 in the human endometrium under normal and pathological conditions. 5.2 Limitations These in vitro studies my not directly correlated to in vivo situation. The biological function of A D A M T S - 1 in endometrium remains to be elucidated. 69 Future direction To investigate A D A M T S - 1 expression in endometrium under pathological conditions, such as endometrial cancer, infertility,and endometrosis. To examin the molecular mechanisms underlying steroids regulate o f A D A M T S - 1 in endometrial stromal cells. 70 R E F E R E N C E S Abbaszade I, Liu RQ, Yang F, Rosenfeld SA, Ross O H , Link JR, Ellis D M , Tortorella MD, Pratta M A , Hollis J M , Wynn R, Duke J L , George HJ , Hillman M C Jr, Murphy K, Wiswall B H , Copeland RA, Decicco CP, Bruckner R, Nagase H, Itoh Y, Newton R C , Magolda R L , Trzaskos J M , Burn T C , et al. (1999) Cloning and characterization of A D A M T S 1, an aggrecanase from the A D A M T S family. J B i o l Chem. 1999 A u g 13;274(33):23443-50 Adam E C , Hertig A T , Rock J . (1956) A description of 34 human ova within the first 17 days of development. A m J Anat. May; 98(3):435-93 Ahonen M, Poukkula M, Baker A H , Kashiwagi M, Nagase H, Eriksson J E , Kahari VM.( 2003) Tissue inhibitor of metalloproteinases-3 induces apoptosis in melanoma cells by stabilization of death receptors. Oncogene. Apr 10;22(14):2121-34 Andreasen PA, Egelund R, Petersen H H . (2000) The plasminogen activation system in tumor growth, invasion, and metastasis. Cel l M o l Life Sci. Jan 20;57(l):25-40 Aplin JD, Charlton A K , Ayad S. (1988) A n immunohistochemical study of human endometrial extracellular matrix during the menstrual cycle and first trimester of pregnancy. Cel l Tissue Res. Jul; 253(1): 231-40 Aplin JD, Hey NA. (1995) M U C 1 , endometrium and embryo implantation. Biochem Soc Trans. 1995 Nov;23(4):826-31 Aplin JD. (1991) Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. J Ce l l Sci . Aug;99 ( Pt 4):681-92 Apparao K B , Lovely LP, Gui Y , Lininger RA, Lessey BA (2002) Elevated endometrial androgen receptor expression in women with polycystic ovarian syndrome. B i l Reprod 66:297-304 Apte SS. (2004) A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the A D A M T S family. Int J Biochem Cel l B i o l 36:981-985 Baulieu E E . (1997) RU486 (mifepristone), A short overview of its mechanisms of action and clinical uses at the end of 1996. A n n N Y Acad Sci. Sep 26; 828: 47-58. Bentin-Ley U, Pedersen B, Lindenberg S, Larsen JF , Hamberger L, Horn T. (1994) Isolation and culture of human endometrial cells in a three-dimensional culture system. J Reprod Fertil. Jul;101(2):327-32 71 Bilalis DA, Klentzeris L D , Fleming S. (1996) Immunohistochemical localization of extracellular matrix proteins in luteal phase endometrium of fertile and infertile patients. H u m Reprod. Dec ; l l(12):2713-8 Bischof P, Campana A. (2000) Molecular mediators of implantation Baillieres Best Pract Res C l i n Obstet Gynaecol. Oct;14(5):801-14 Black RA, White J M . (1998) A D A M s : focus on the protease domain. Curr Opin Ce l l B i o l . Oct;10(5):654-9. Boerboom D, Russell DL , Richards JS, Sirois J . (2003) Regulation of transcripts encoding A D A M T S - 1 (a disintegrin and metalloproteinase with thrombospondin-like motifs-1) and progesterone receptor by human chorionic gonadotropin in equine preovulatory follicles. J M o l Endocrinol. Dec;31(3):473-85 Brown J C , Wiedemann H, Timpl R. (1994) Protein binding and cell adhesion properties o f two laminin isoforms ( A m B l e B 2 e , A m B l s B 2 e ) from human placenta. J Ce l l Sci . Jan;107 ( Pt l):329-38 Bugge T H , Flick M J , Danton M J , Daugherty C C , Romer J , Dano K, Carmeliet P, Collen D, Degen J L . (1996) Urokinase-type plasminogen activator is effective in fibrin clearance in the absence of its receptor or tissue-type plasminogen activator. Proc Natl Acad Sci U S A . Jun 11;93(12):5899-904 Bulmer JN, Morrison L, Johnson P M , Meager A. (1990) Immunohistochemical localization of interferons in human placental tissues in normal, ectopic, and molar pregnancy. A m J Reprod Immunol. 1990 Mar-Apr;22(3-4):109-16 Bulun SE, Economos K, Miller D, Simpson ER. (1994) C Y P 19 (aromatase cytochrome P450) gene expression in human malignant endometrial tumors. J C l i n Endocrinol Metab 79:1831^1 Burton K A , Henderson T A , Hillier SG, Mason JI, Habib F, Brenner RM,Critch ley Ho (2003) Local levonorgestrel regulation of androgen receptor and 17(3-hydroxysteroid dehydrogennase type 2 expression in human endometrium. Hum Reprod 18:2610-2617 Carpizo D, Iruela-Arispe M L . (2000) Endogenous regulators o f angiogenesis-emphasis on proteins with thrombospondin—type I motifs. Cancer Metastasis Rev. 19(1-2): 159-65 Casslen B, Astedt B. (1983) Occurrence of both urokinase and tissue plasminogen activator in the human endometrium. Contraception. Dec;28(6):553-64 72 Chabbert-Buffet N, Meduri G, Bouchard P, Spitz IM. (2005) Selective progesterone receptor modulators and progesterone antagonists: mechanisms of action and clinical applications. Hum Reprod Update. May-Jun;ll(3):293-307. Epub 2005 Mar 24 Chadjichristos C, Ghayor C , Herrouin JF , Ala-Kokko L, Suske G, Pujol JP, Galera P. (2002) Down-regulation of human type II collagen gene expression by transforming growth factor-beta 1 (TGF-beta 1) in articular chondrocytes involves SP3/SP1 ratio. J B i o l Chem. N o v 15;277(46):43903-17. Chadjichristos C, Ghayor C , Kypriotou M, Martin G, Renard E, Ala-Kokko L, Suske G, de Crombrugghe B, Pujol JP, Galera P. (2003) S p l and Sp3 transcription factors mediate interleukin-1 beta down-regulation of human type II collagen gene expression in articular chondrocytes. J B i o l Chem. Oct 10;278(41):39762-72. Epub 2003 Jul 29 Chandrasekhar Y , Armstrong DT.(1991) Regulation o f uterine progesterone receptors by the nonsteroidal anti-androgen hydroxyflutamide. B i o l Reprod. Jul;45(l):78-81 Chen G T C , Getsios S and MacCalman CD. (1998) 17p-estradiol potentiates the stimulatory effects o f progesterone on cadherin-11 expression in cultured human endometrial stromal cells Endocrinology 139, 8, 3512-3519 Chen G T C , Getsios S and MacCalman CD. (1999) Antisteroidal compounds and steroid withdrawal down-regulate cadheruin-11 m R N A and protein expression levels in human endometrial stromal cells undergoing decidualization in vitro. M o l Reprod. Dev. 53: 384-393 Cho C, Bunch DO, Faure J E , Goulding E H , Eddy E M , Primakoff P, Myles DG. (1998) Fertilization defects in sperm from mice lacking fertilin beta. Science. 1998 Sep 18;281(5384):1857-9 Church H J , Vicovac L M , Williams JD, Hey NA, Aplin JD. (1996) Laminins 2 and 4 are expressed by human decidual cells. Lab Invest. Jan;74(l):21-32 Chwalisz K, Brenner R M , Fuhrmann UU, Hess-Stumpp H, Elger W. (2000) Antiproliferative effects o f progesterone antagonists and progesterone receptor modulators on the endometrium. Steroids. Oct-Nov;65(10-11):741-51 Clark J H , Markaverich B, Upchurch S, Eriksson H, Hardin JW. (1980) Heterogeneity o f estrogen binding site: relationship to estrogen receptors and estrogen responses. Recent Prog Horm Res 36:89-134 Clarke C L , Sutherland Rl (1990) Progestin regulation of cellular proliferation. EndocrRev 11:266-301 73 Cohen S M , Werrmann J G , Rasmusson G H , Tanaka W K , Malatesta PF, Prahalada S, Jacobs J G , Harris G, Nett T M . (1995) Comparison o f the effects o f new specific azasteroid inhibitors of steroid 5 alpha-reductase on canine hyperplastic prostate: suppression of prostatic D H T correlated with prostate regression. Prostate. Feb;26(2):55-71 Critchley H O , Brenner RM,Henderson T A , Willans K,Nayak NR,Slayden OD,Millar MR,Saunders PT (2000) Estrogen receptor P, but not estrogen receptor a, is present in the vascular endothelium o f the human and nonhuman primate endometrium. J C l i n Endocrinol Metab 86:1370-1378 Critchley H O , Kelly RW, Brenner R M , Baird DT (2001) The endocrinology o f menstruation—a role for the immune system. C l i n Endocrinol (Oxf). Dec;55(6):701-10 Cross J C , Werb Z, Fisher SJ. (1994) Implantation and the placenta: key pieces of the development puzzle. Science. Dec 2;266(5190):1508-18 Curry T E Jr, Osteen K G . (2001) Cycl ic changes in the matrix metalloproteinase system in the ovary and uterus. B i o l Reprod. May; 64(5): 1285-96 Doyle K M , Russell DL , Sriraman V, Richards JS. (2004) Coordinate transcription of the A D A M T S - 1 gene by luteinizing hormone and progesterone receptor. M o l Endocrinol. Oct;18(10):2463-78. Epub 2004 Jul 15 Dukes M, Miller D, Wakeling A E . (1992) Antiuterotrophic effect of pure antiestrogen, ICI 182,780: magnetic resonance imaging o f uterus in ovariectomized monkeys. J Endocrinol. 135 (2) 239-247 Egeblad M, Werb Z. (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer. Mar;2(3):161-74 El-Toukhy T A . (2002) Unexplained subfertility: a pragmatic approach. J Obstet Gynaecol. May;22(3):239-42 Faber M, Wewer U M , Berthelsen J G , Liotta L A , Albrechtsen R. (1986) Laminin production by human endometrial stromal cells relates to the cyclic and pathologic state o f the endometrium. A m J Pathol. Sep;124(3):384-91 Fata J E , Ho A T , Leco K J , Moorehead RA, Khokha R. (2000) Cellular turnover and extracellular matrix remodeling in female reproductive tissues: functions of metalloproteinases and their inhibitors. Cel l M o l Life Sci . Jan 20;57(l):77-95 Fazleabas A T , Kim J J , Strakova Z. (2004) Implantation: embryonic signals and the modulation of the uterine environment—a review. Placenta. Apr;25 Suppl A:S26-31 74 Fernandez-Shaw S, Shorter SC, Naish C E , Barlow DH, Starkey P M . (1992) lation and purification o f human endometrial stromal and glandular cells using immunomagnetic microspheres. Hum Reprod. Feb;7(2): 156-61 Garcia E, Bouchard P, De Brux J , Berdah J , Frydman R, Schaison G , Milgrom E, Perrot-Applanat M (1988) Use of immunocytochemistry of progesterone and estrogen receptors for endometrial dating. J C l i n Endocrinol Metab 67:80-87 Gemzell-Danielsson K, Svalander P, Swahn M L , Johannisson E, Bygdeman M. (1994) Effects of a single post-ovulatory dose of RU486 on endometrial maturation in the implantation phase. Hum Reprod. Dec; 9(12): 2398-404 Gobello C. (2006) Dopamine agonists, anti-progestins, anti-androgens, long-term-release G n R H agonists and anti-estrogens in canine reproduction: A review Theriogenology. Mar 13 Godkin JD, Dore J J . (1998) Transforming growth factor beta and the endometrium. Rev Reprod. Jan;3(l):l-6 Goffin F, Frankenne F, Beliard A , Perrier D'Hauterive S, Pignon MR, Geenen V, Foidart J M . (2002) Human endometrial epithelial cells modulate the activation of gelatinase a by stromal cells. Gynecol Obstet Invest. 53(2):105-11 Gonzalez-Diddi M, Komisaruk B, Beyer C. (1972) Differential effects of testosterone and dihydrotestosterone on the diverse uterine tissues o f the ovariectomized rat. Endocrinology. Oct;91(4):l 129-32 Graham C H , Lala PK. (1992) Mechanisms of placental invasion o f the uterus and their control. Biochem Cel l B i o l . Oct-Nov;70(10-11):867-74 Green S, Walter P, Kumar V, Krust A, Borenrt Jm, Argos P, Champom P (1986) Human oestrogen receptor c D N A : sequence, expression and homology to v-erb-A. Nature 320:134-139 Guerrero R, Landgren B M , Montiel R, Cekan Z, Dczfalusy E. (1975) Unconjugated steroids in the human endometrium. Contraception. 11:168-177 Hamilton WJ , Grimes DH. (1970) Growth relationship between the foetus and the placenta. Proc R Soc Med . May;63(5):496-8 Hampton A L , Butt AR, Riley SC, Salamonsen L A (1995) Tissue inhibitors o f metalloproteinases in endometrium o f ovariectomized steroid-treated ewes and during the estrous cycle and early pregnancy. B i o l Reprod. Aug;53(2):302-11 75 Hampton A L , Salamonsen L A . (1994) Expression of messenger ribonucleic acid encoding matrix metalloproteinases and their tissue inhibitors is related to menstruation. J Endocrinol. Apr ;141( l ) :Rl -3 Held-Feindt J , Paredes E B , Blomer U, Seidenbecher C, Stark A M , Mehdorn H M , Mentlein R. (2006) Matrix-degrading proteases A D A M T S 4 and A D A M T S 5 (disintegrins and metalloproteinases with thrombospondin motifs 4 and 5) are expressed in human glioblastomas. Int J Cancer. Jan 1;118(1 ):55-61 Hertig A T , (1967) Human trophoblast: normal and abnormal. A plea for the study o f the normal so as to understand the abnormal. Ward Burdick Award Address. A m J C l i n Pathol. Mar;47(3):249-68 Hoffmann B, Schuler G. (2000) Receptor blockers - general aspects with respect to their use in domestic animal reproduction. A n i m Reprod Sci . Jul 2;60-61:295-312. Horie K, Takakura K, Imai K, Liao S,Mori T (1992) Immunohistochemical localization o f androgen receptor in the human endometrium, deciduas,placenta and pathological conditions of the endometrium. Hum Reprod 7:1461-1466 Hu X F , Veroni M, Luise MD, Wakeling A E , Sutherland R, Watts C K W , (1993) Circumvention o f tamoxifen resistance by the pure antiestrogen ICI 182 780. Int. J. Cancer 55 (5) 873-876 Hurskainen T L , Hirohata S, Seldin M F , Apte SS. (1999) A D A M - T S 5 , A D A M - T S 6 , and A D A M - T S 7 , novel members of a new family o f zinc metalloproteases. General features and genomic distribution o f the A D A M - T S family. J B i o l Chem. Sep 3; 274(36): 25555-25563. Iozzo RV. (2001) Heparan sulfate proteoglycans: intricate molecules with intriguing functions. J C l i n Invest. Jul; 108(2): 165-7 Irwin J C , Kirk D, Gwatkin RB, Navre M, Cannon P, Giudice L C (1996) Human endometrial matrix metalloproteinase-2, a putative menstrual proteinase. Hormonal regulation in cultured stromal cells and messenger R N A expression during the menstrual cycle. J C l i n Invest. Jan 15;97(2):438-47 Irwin J C , Kirk D, King R J , Quigley M M , Gwatkin RB. (1989) Hormonal regulation o f human endometrial stromal cells in culture: an in vitro model for decidualization. Fertil Steril 52:761-768. Ito K, Fukabori Y , Shibata Y, Suzuki K, Mieda M, Gotanda K, Honma S, Yamanaka H. (2000) Effects of a new steroidal aromatase inhibitor, TZA-2237, and/or chlormadinone acetate on hormone-induced and spontaneous canine benign prostatic hyperplasia Eur J Endocrinol. Oct;143(4):543-54 76 Jahn E, Classen-Linke I, Kusche M, Beier H M , Traub O, Grummer R, Winterhager E. (1995) Expression of gap junction connexins in the human endometrium throughout the menstrual cycle. Hum Reprod. Oct;10(10):2666-70 Jeziorska M, Nagase H, Salamonsen L A , Woolley DE.(1996) Immunolocalization o f the matrix metalloproteinases gelatinase B and stromelysin 1 in human endometrium throughout the menstrual cycle. J Reprod Fertil. May; 107(1 ):43-51 Jokimaa V, Oksjoki S, Kujari H, Vuorio E, Anttila L.(2002) Altered expression o f genes involved in the production and degradation of endometrial extracellular matrix in patients with unexplained infertility and recurrent miscarriages. M o l Hum Reprod. D e c ; 8 ( 1 2 ) : l l l l - 6 Jones G C , Riley GP. (2005) A D A M T S proteinases: a multi-domain, multi-functional family with roles in extracellular matrix turnover and arthritis. Arthritis Res Ther.;7(4): 160-9. Epub 2005 Jun 21 Jongen V H W M , Hollema H, van der Zee A G J , Santema J G , Heineman M J . (2003) Ovarian stromal hyperplasia and ovarian vein steroid levels in relation to endometrioid endometrial cancer. B r J Obstet Gynaecol 110:690-5. Jordan V C . (1995) Alternate antiestrogens and approaches to the prevention o f breast cancer. J Ce l l Biochem Suppl.;22:51-7 Kao L C , Tulac S, Lobo S, Imani B, Yang JP, Germeyer A , Osteen K, Taylor RN, Lessey BA, Giudice L C . (2002) lobal gene profding in human endometrium during the window o f implantation. Endocrinology. Jun;143(6):2119-38 Kato J , Seto T. (1985) Correlation of androgen receptors with histological differentiation in human endometrial carcinomas. Acta Obstet Gynecol Scand 64:209-212 Kauffman RF, Bryant H U (1995) Selective estrogen receptor modulators. Drug News Perspect8 (9) 531-539 Kaushal GP, Shah SV. (2000) The new kids on the block: A D A M T S s , potentially multifunctional metalloproteinases o f the A D A M family. J C l i n Invest. 2000 May;105(10):1335-7 Kayisli UA, Korgun E T , Akkoyunlu G, Arici A , Demir R (2005) Expression o f integrin alpha5 and integrin beta4 and their extracellular ligands fibronectin and laminin in human decidua during early pregnancy and its sex steroid-mediated regulation. Acta Histochem.; 107(3): 173-85 77 Kenneth J L and Thomas DS. (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative P C R and the 2 ~ A A C T Method. Methods. Dec;25(4):402-8 Kim J , Kim H, Lee SJ, Choi Y M , Lee SJ, Lee JY. (2005) Abundance o f A D A M - 8 , -9, -10, -12, -15 and -17 and A D A M T S - 1 in mouse uterus during the oestrous cycle. Reprod Fertil Dev.l7(5):543-55 Kisalus L L , Herr J C , Little CD. (1987) Immunolocalization of extracellular matrix proteins and collagen synthesis in first-trimester human decidua. Anat Rec. Aug;218(4):402-15 Kisalus L L , Herr J C . (1988) Immunocytochemical localization of heparan sulfate proteoglycan in human decidual cell secretory bodies and placental fibrinoid B i o l Reprod. Sep;39(2):419-30 Koh SC, Wong PC, Yuen R, Chua SE, Ng B L , Ratnam SS (1992) Concentration o f plasminogen activators and inhibitor in the human endometrium at different phases o f the menstrual cycle. J Reprod Fertil. Nov;96(2):407-13. Kokorine I, Marbaix E, Henriet P, Okada Y, Donnez J , Eeckhout Y, Courtoy PJ. (1996) Focal cellular origin and regulation of interstitial collagenase (matrix metalloproteinase-1) are related to menstrual breakdown in the human endometrium. J Ce l l Sci . Aug;109 ( Pt 8):2151-60 Kuiper G G , Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. (1996) Cloning o f a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci U S A . Jun ll;93(12):5925-30 Kuno K, Bannai K, Hakozaki M, Matsushima K, Hirose K. (2004) The carboxyl-terminal half region of A D A M T S - 1 suppresses both tumorigenicity and experimental tumor metastatic potential. Biochem Biophys Res Commun. 2004 Jul 9;319(4): 1327-33 Kuno K, Iizasa H, Ohno S, Matsushima K. (1997b) The exon/intron organization o f the mouse A D A M T S - 1 gene encoding an A D A M family protein with TSP motifs. Genomics 46:466-471 Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F, Matsushima K. (1997a) Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J B i o l Chem. Jan 3;272(l):556-62 Lala PK, Hamilton GS. (1996) Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta. Nov; 17(8):545-55 Lala PK, Kearns M, Colavincenzo V. (1984) Cells of the fetomaternal interface: their role in the maintenance o f viviparous pregnancy. A m J Anat. Jul;170(3):501-17 78 Lawn A M , Wilson EW, Finn C A . (1971) The ultrastructure of human decidual and predecidual cells. J Reprod Fertil. Jul; 26(l):85-90 Lecce G , Meduri G , Ancelin M,Bergeron C,Perrot-Applanant M (2001) Presence of estrogen receptor P in the human endometrium through the cycle: expression in glandular, stromal and vascular cells. J C l i n Endocrinol Metab 86:1379-1386 Leiser R, Kaufmann P. (1994) Placental structure: in a comparative aspect. Exp C l i n Endocrinol. 102(3): 122-34 Lessey B A (1998) Lessey BA. (2000) The role of the endometrium during embryo implantation. Hum Reprod 15 (Suppl. 6), 39-50 Lessey BA. (2002) Adhesion molecules and implantation. J Reprod Immunol. May-Jun;55(l-2):101-12. Lessey BA. (2000) The role of the endometrium during embryo implantation. H u m Reprod 15 (Suppl. 6), 39-50 Lessey BA. (2002) Adhesion molecules and implantation. J Reprod Immunol. May-Jun;55(l-2):101-12. Lessey BA, Killam AP, Metzer DA, Haney A F , Greene G L , McCarty KS (1988) Immunohistochemical analysis o f human uterine estrogen and progesterone receptors throughout the menstrual cycle. J C l i n Endocrinol Metab 67:334-340 Lindenberg S. (1991) Experimental studies on the initial trophoblast endometrial interaction. Dan M e d B u l l . Oct;38(5):371-80 Ling S, Dai A , Williams MR, Myles K, Dilley R J , Komesaroff PA, Sudhir K. (2002) Testosterone (T) enhances apoptosis-related damage in human vascular endothelial cells. Endocrinology. Mar;143(3):l 119-25 Little C B , Mittaz L, Belluoccio D, Rogerson F M , Campbell IK, Meeker C T , Bateman JF , Pritchard M A , Fosang A J . (2005) ADAMTS-1-knockou t mice do not exhibit abnormalities in aggrecan turnover in vitro or in vivo. Arthritis Rheum. May;52(5): 1461-72 Liu Y J , Xu Y and Yu Q. (2005a) Full-length A D A M T S - 1 and the A D A M T S - 1 fregments display pro-and antimetastatic activity, respectively. Oncogene: 1-16 Madan P, Bridges PJ, Komar C M , Beristain A G , Rajamahendran R, Fortune J E , MacCalman CD. (2003) Expression of messenger R N A for A D A M T S subtypes changes in the periovulatory follicle after the gonadotropin surge and during luteal development and regression in cattle. B i o l Reprod. Nov;69(5): 1506-14. Epub 2003 Jul 9 79 Marbaix E, Kokorine I, Henriet P, Donnez J , Courtoy PJ, Eeckhout Y. (1995) The expression o f interstitial collagenase in human endometrium is controlled by progesterone and by oestradiol and is related to menstruation. Biochem J. Feb 1;305 ( P t 3): 1027-30. Marx L, Arck P, Kapp M, Kieslich C, Dietl J . (1999) Leukocyte populations, hormone receptors and apoptosis in eutopic and ectopic first trimester human pregnancies. Hum Reprod. Apr;14(4):l 111-7 Masui T, Hosotani R, Tsuji S, Miyamoto Y, Yasuda S, Ida J , Nakajima S, Kawaguchi M , Kobayashi H, Koizumi M, Toyoda E, Tulachan S, Arii S, Doi R, Imamura M. (2001) Expression o f M E T H - 1 and M E T H - 2 in pancreatic cancer. C l i n Cancer Res. Nov;7 ( l l):3437-43 Mertens H, Heineman M J , Theunissen P, De Jong F H , Evers J L H (2001) Androgen, estrogen and progesterone receptor expression in the human uterus during the menstrual cycle. Eur J Obstet Gynecol Reprod B i o l 98:58-65 Mittaz L, Russell DL , Wilson T, Brasted M, Tkalcevic J , Salamonsen L A , Hertzog PJ, Pritchard M A . (2004) Adamts-1 is essential for the development and function o f the urogenital system. B i o l Reprod 70:1096-1105 Mote PA, Balleine R L , McGowan E M Clarke C L (1999) Colocalization o f progesterone receptors A and B by dual immunofluo-rescent histochemistry in human endometrium during the menstrual cysle. J C l i n Endocrionl Metab 84:2963-2971 Mote PA, Balleine R L , McGowan E M Clarke C L (2000) Heterogeneity o f progesterone receptors A and B expression in human endometrial glands and stroma. H u m Reprod 15(suppl 3):48-56 Mylona P, Kielty C M , Hoyland JA, Aplin JD. (1995) Expression o f type V I collagen m R N A s in human endometrium during the menstrual cycle and first trimester o f pregnancy. J Reprod Fertil. Jan;103(l):159-67 Nagase H, Kashiwagi M. (2003) Aggrecanases and cartilage matrix degradation. Arthritis Res Ther. 5(2):94-103. Epub 2003 Feb 14 Nakamoto T, Okada H, Nakajima T, Ikuta A , Yasuda K and Kanzaki H. (2005) Progesterone induces the fibulin-1 expression in human endometrial stromal cells. Human Reprod; 10.1093-1102 Nantermet PV, Masarachia P, Gentile M A , Pennypacker B, Xu J , Holder D, Gerhold D, Towler D, Schmidt A , Kimmel DB, Freedman LP , Harada S, Ray WJ . (2005) Androgenic induction of growth and differentiation in the rodent uterus involves 80 the modulation o f estrogen-regulated genetic pathways. Endocrinology. Feb;146(2):564-78. Epub 2004 Oct 21 Narukawa S, kanzaki H, Inoue T, Imai K, Higuchi T, Hatayama H, Kariya M , Mori T. (1994) Androgen induce prolactin productionby human endometrial stromal cells in vitro. J C l i n Endocrinol Metab 78: 165-168 Nath D, Slocombe P M , Webster A, Stephens PE, Docherty A J , Murphy G. (2000) Meltr in gamma(ADAM-9) mediates cellular adhesion through alpha(6)beta(l )integrin, leading to a marked induction of fibroblast cell motility. J Cel l Sci . Jun;113 ( Pt 12):2319-28 Ng Y H, Zhu H, Leung P C K and MacCalman C D. (2006) Differential effects of IL-1 beta and transforming growth factor-betal on the expression of the inflammation associated protein, A D A M T S - 1 in human decidual stromal cells in vitro. Hum. Reprod Nikas G . (1999) Cell-surface morphological events relevant to human implantation. H u m Reprod. Dec; 14 Suppl 2:37-44 Noyes RW, Hertig A T , Rock J . (1950) Dating the endometrial biopsy. Fertile Steril 1:3-25 Oestrogen and progesterone receptor immunocytochemistry in human hyperplastic and Nygren K G , Andersen AN. (2002) Assisted reproductive technology in Europe, 1999. Results generated from European registers by E S H R E . Hum Reprod. Dec; 17(12):3260-74 Okon M A , Laird SM, Tuckerman E M , L i T C . (1998) Serum androgen levels in women who have recurrent miscarriages and their correlation with markers o f endometrial function. Fertil Steril. Apr;69(4):682-90 Osteen K G , Hill G A , Hargrove JT , Gorstein F. (1989) Development of a method to isolate and culture highly purified populations of stromal and epithelial cells from human endometrial biopsy specimens. Fertil Steril. Dec;52(6):965-72 Osteen K G , Rodgers W H , Gaire M, Hargrove JT , Gorstein F, Matrisian L M . (1994) Stromal-epithelial interaction mediates steroidal regulation of metalloproteinase expression in human endometrium. Proc Natl Acad Sci U S A . Oct 11;91(21): 10129-33 Paria B C , Reese J , Das SK, Dey SK. (2002) Deciphering the cross-talk o f implantation: advances and challenges. Science. Jun 21;296(5576):2185-8 Pijnenborg R, Dixon G, Robertson WB, Brosens I. (1980) Trophoblastic invasion o f human decidua from 8 to 18 weeks of pregnancy. Placenta. Jan-Mar;l(l):3-19 81 Popovici R M , Kao L C , Giudice L C . (2000) Discovery of new inducible genes in in vitro decidualized human endometrial stromal cells using microarray technology. Endocrinology. Sep;141(9):3510-3 Porter S, Clark IM, Kevorian L and Edwards DL . (2005) The A D A M T S metalloproteinases, Biochem. J. 386, 15-27 Porter S, Scott SD, Sassoon E M , Williams MR, Jones J L , Girling A C , Ball RY , Edwards DR. (2004) Dysregulated expression of adamalysin-thrombospondin genes in human breast carcinoma. C l i n Cancer Res. Apr l;10(7):2429-40 Porter S, Span PN, Sweep F C , Tjan-Heijnen V C , Pennington C J , Pedersen T X , Johnsen M, Lund LR, Romer J , Edwards DR. (2006) A D A M T S 8 and A D A M T S 15 expression predicts survival in human breast carcinoma. Int J Cancer. Mar l;118(5):1241-7 Psychoyos A. (1976) Hormonal control of uterine receptivity for nidation. J Reprod Fertil Suppl. Oct;(25): 17-28 Robertson JFR (2001) Faslodex (ICI182, 780), a novel estrogen receptor downregulator-future possibilities in breast cancer. J Steroid Biochem M o l B i o l . Dec;79(l-5):209-12 Rodgers W H , Osteen K G , Matrisian L M , Navre M, Giudice L C , Gorstein F. (1993) Expression and localization of matrilysin, a matrix metalloproteinase, in human endometrium during the reproductive cycle. A m J Obstet Gynecol. Jan; 168(1 Pt 1):253-60 Rodriguez-Manzaneque J C , Milchanowski AB , Dufour E K , Leduc R, Iruela-Arispe M L . (2000) Characterization of M E T H - 1 / A D A M T S 1 processing reveals two distinct active forms. J B i o l Chem. Oct 27;275(43):33471-9 Roemer A , Schwettmann L, Jung M, Roigas J , Kristiansen G, Schnorr D, Loening SA, Jung K, Lichtinghagen R. (2004) Increased m R N A expression o f A D A M s in renal cell carcinoma and their association with clinical outcome. Oncol Rep. Feb;ll(2):529-36 Rogers W H , Matrisian L M , Guudice L C , Dsupin B, et al. (1994) Patterns of matrix mettaloproteinase expression in cycling endometrium imply differential function and regulation by steroid hormones. J C l i n Invest 94: 946-953 Rose PG, Brunetto V L , VanLe L, Bell J , Walker J L , Lee RB. (2000) A phase III trial o f anastrozole in advanced recurrent or persistent endometrial carcinoma: a gynecologic oncology group study. Gynecol Oncol 78:212-6. 82 Ruck P, Marzusch K, Kaiserling E, Horny HP, Dietl J , Geiselhart A , Handgretinger R, Redman CW. (1994) Distribution of cell adhesion molecules in decidua o f early human pregnancy. A n immunohistochemical study. Lab Invest. Jul;71(l):94-101 Russell D L , Doyle K M H , Ochsner SA, Sandy JD, Richards JS. (2003) Processing and localization of A D A M T S - 1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J B i o l Chem: 43: 42330-42339 Salamonsen L A , Butt AR, Hammond FR, Garcia S, Zhang J . (1997) Production o f endometrial matrix metalloproteinases, but not their tissue inhibitors, is modulated by progesterone withdrawal in an in vitro model for menstruation. J C l i n Endocrinol Metab. May;82(5):1409-15 Salamonsen L A , Dimitriadis E, Jones R L , Nie G. (2003) Complex regulation o f decidualization: a role for cytokines and proteases~a review. Placenta. Apr;24 Suppl A:S76-85 Salamonsen L A , Dimitriadis E, Robb L. (2000) Cytokines in implantation. Semin Reprod Med . 18(3):299-310 Salamonsen L A , Woolley DE (1996) Matrix metalloproteinases in normal menstruation. Hum Reprod. Oct; 11 Suppl 2:124-33 Sasaki M , Seo-Kiryu S, Kato R, Kita S, Kiyama H. (2001) A disintegrin and metalloprotease with thrombospondin typel motifs ( A D A M T S - 1 ) and IL-1 receptor type 1 m R N A s are simultaneously induced in nerve injured motor neurons. Brain Res M o l Brain Res. 2001 A p r 18;89(1-2): 158-63 Sasano H, Kaga K, Sato S, Yajima A , Nagura H, Harada N. (1996) Aromatase P450 gene expression in endometrial carcinoma. Br J Cancer 74:1541^1. Schatz F, Krikun G , Runic R, Wang EY , Hausknecht V, Lockwood C J . (1999) Implications o f decidualization-associated protease expression in implantation and placentation. SeminReprod Endocrinol 17:3-12 Shimada M, Nishibori M, Yamashita Y, Ito J , Mori T, Richards JS. (2004) Down-regulated expression of A disintegrin and metalloproteinase with thrombospondin-like repeats-1 by progesterone receptor antagonist is associated with impaired expansion of porcine cumulus-oocyte complexes. Endocrinology. Oct;145(10):4603-14. Epub 2004 Jul 1 Shindo T, Kurihara H, Kuno K, Yokoyama H, Wada T, Kurihara Y, Imai T, Wang Y , Ogata M, Nishimatsu H, Moriyama N, Oh-hashi Y , Morita H, Ishikawa T, Nagai R. ( 2000) A D A M T S - 1 : a metalloproteinase-disintegrin essential for normal growth, fertility, and organ morphology and function. J C l i n Invest. May; 105(10): 1345-52 83 Shiokawa S, Yoshimura Y, Nagamatsu S, Sawa H, Hanashi H, Oda T, Katsumata Y , Koyama N, Nakamura Y. (1996) Expression of beta 1 integrins in human endometrial stromal and decidual cells. J C l i n Endocrinol Metab. Apr;81(4): 1533-40 Shozu M, Minami N, Yokoyama H, Inoue M, Kurihara H, Matsushima K, Kuno K. (2005) A D A M T S - 1 is involved in normal follicular development, ovulatory process and organization o f the medullary vascular network in the ovary. J M o l Endocrinol. Oct;35(2):343-55 Slayden OD, Nayak NR, Burton K A , Chwalisz K, Cameron ST, Critchley H O , Baird DT, Smith MR, Kung H, Durum SK, Colburn NH, Sun Y. (1997) T IMP-3 induces cell death by stabilizing TNF-alpha receptors on the surface of human colon carcinoma cells. Cytokine. Oct;9(10):770-80 Snijders MP, de Goeij A F , Debets-Te Baerts M J , Rousch M J , Koudstaal J , Bosman FT . (1992) Immunocytochemical analysis of oestrogen receptors and progesterone receptors in the human uterus throughout the menstrual cycle and after the menopause. J Reprod Fertil . Mar;94(2):363-71 Somkuti SG, Yuan L, Fritz M A , Lessey BA. (1997) Epidermal growth factor and sex steroids dynamically regulate a marker o f endometrial receptivity in Ishikawa cells. J C l i n Endocrinol Metab. Jul;82(7):2192-7. Stanton H, Rogerson F M , East C J , Golub SB, Lawlor K E , Meeker C T , Little C B , LastK, Starkey P M , Sargent IL, Redman CW. (1988) Ce l l populations in human early pregnancy decidua: characterization and isolation o f large granular lymphocytes by flow cytometry. Immunology. Sep;65(l):129-34 Stephenson MD.(1996) Frequency of factors associated with habitual abortion in 197 couples. Fertil Steril. Jul;66(l):24-9 Strickland S, Richards W G . (1992) Invasion of the trophoblasts. Cel l . 1992 Oct 30;71(3):355-7 Suzuki N, Nakayama J , Shih IM, Aoki D, Nozawa S, Fukuda MN. (1999) Expression of trophinin, tastin, and bystin by trophoblast and endometrial cells in human placenta. B i o l Reprod. Mar; 60(3):621-7 Tang B L , Hong W. (1999) A D A M T S : a novel family of proteases with an A D A M protease domain and thrombospondin 1 repeats. F E B S Lett. Feb 26;445(2-3):223-5 Tang B L . (2001) A D A M T S : a novel family of extracellular matrix proteases. Int J Biochem Cel l B i o l 33: 33-44 84 Taylor A H , Guzail M , Wahab M, Tompson JR, Al-Azzawi F (2005) Quantitative histomorphometric analysis of gonadal steroid receptor distribution in the normal human endometrium through the menstrual cycle. Histochem Cel l B i o l 123: 463-474 Tseng L, Mazella J , Mann WJ , Chumas J . (1982) Estrogen synthesis in normal and malignant human endometrium. J C l i n Endocrinol Metab 55:1029-31. Vassalli JD, Dayer J M , Wohlwend A , Belin D. (1984) Concomitant secretion o f prourokinase and of a plasminogen activator-specific inhibitor by cultured human monocytes-macrophages. J Exp Med. Jun 1; 159(6): 1653-68 Vazquez F, Hastings G , Ortega M A , Lane TF , Oikemus S, Lombardo M, Iruela-Arispe M L . (1999) M E T H - 1 , a human ortholog of A D A M T S - 1 , and M E T H - 2 are members o f a new family of proteins with angio-inhibitory activity. J B i o l Chem. A u g 13;274(33):23349-57 Ventura SJ, Hamilton B E , Sutton PD. (2003) Revised birth and fertility rates for the United States, 2000 and 2001. Natl Vi ta l Stat Rep. Feb 6;51(4):1-18 Vermeulen-Meiners C, Poortman M, Nabuurs M, Thijsen J H H . (1988) The endogeneous concentration and subcellular distribution of androgens in normal human premenopausal endometrium, myometrium and vagima. Gynecol Endocrinol. 2:121-130. Vitoratos N, Gregoriou O, Hassiakos D, Zourlas PA. (1991) The role o f androgens in the late-premenopausal woman with adenomatous hyperplasia of the endometrium. Int J Gynaecol Obstet. Feb;34(2): 157-61 Vollmer G, Siegal GP, Chiquet-Ehrismann R, Lightner V A , Arnholdt H, Knuppen R. (1990) Tenascin expression in the human endometrium and in endometrial adenocarcinomas. Lab Invest. Jun;62(6):725-30 Wachsmuth L, Bau B, Fan Z , Pecht A , Gerwin N, Aigner T. (2004) A D A M T S - 1 , a gene product o f articular chondrocytes in vivo and in vitro, is downregulated by interleukin lbeta. J Rheumatol. Feb;31(2):315-20 Wakeling A E , Dukes M, Bowler J (1991) A potential specific pure antiestrogen with clinical potential, Cancer Res. 51(15) 3867-3873 Wang H, Critchley HO, Kelly RW, Shen D, Baird DT (1998) Progesterone receptor subtype B is differentially regulated in human endometrial stroma. M o l H u m Reprod 4:407-412 Wang H M , Yang Q, Lin HY, Sang QX, Zhu C. (2005) Expression o f adamalysin 1 9 / A D A M 1 9 in the endometrium and placenta of rhesus monkey (Macaca mulatta) during early pregnancy. M o l Hum Reprod. Jun;l l(6):429-35. Epub 2005 M a y 18 85 Wang J C , Novetsky A , Chen C, Novetsky AD (2002) Plasma matrix metalloproteinase and tissue inhibitor of metalloproteinase in patients with agnogenic myeloid metaplasia or idiopathic primary myelofibrosis. B r J Haematol. Dec;119(3):709-12 Watanabe K, Sasano H, Harada N et al. (1995) Aromatase in human endometrial carcinoma and hyperplasia. Immunohistochemical, in situ hybridization, and biochemical studies. A m J Pathol 146:491-500 Wegmann T G , Lin H, Guilbert L, Mosmann TR. (1993) Bidirectional cytokine interactions in the maternal-fetal relationship: is successful pregnancy a T H 2 phenomenon? Immunol Today. Jul;14(7):353-6 Wewer U M , Albrechtsen R, Fisher L W , Young M F , Termine JD. (1988) Osteonectin/SPARC/BM-40 in human decidua and carcinoma, tissues characterized by de novo formation o f basement membrane. A m J Pathol. Aug;132(2):345-55 Wewer U M , Faber M, Liotta L A , Albrechtsen R. (1985) Immunochemical and ultrastructural assessment o f the nature o f the pericellular basement membrane o f human decidual cells. Lab Invest. Dec;53 (6):624-3 3 Wilcox A J , Baird DD, Weinberg CR. (1999) Time of implantation o f the conceptus and loss o f pregnancy. N Engl J Med . Jun 10;340(23):1796-9 Williams JP, Blair H C , McKenna M A , Jordan SE, McDonald J M . (1996) Regulation of avian osteoclastic H+ -ATPase and bone resorption by tamoxifen and calmodulin antagonists. Effects independent of steroid receptors. J B i o l Chem. M a y 24;271(21):12488-95 Woessner J F Jr (1991) Matrix metalloproteinases and their inhibitors in connective tissue remodeling. F A S E B J. May;5(8):2145-54 Wolfsberg T G , Primakoff P, Myles D G , White J M . (1995) A D A M , a novel family o f membrane proteins containing A Disintegrin A n d Metalloprotease domain: multipotential functions in cell-cell and cell-matrix interactions. J Cel l B i o l . Oct;131(2):275-8 Wynn R M . (1974) Ultrastructural development o f the human deciduas. A m J Obstet Gynecol. M a r l;118(5):652-70 Xu P, Alfaidy N, Challis JR. (2002) Expression of matrix metalloproteinase ( M M P ) - 2 and M M P - 9 in human placenta and fetal membranes in relation to preterm and term labor. J C l i n Endocrinol Metab. Mar;87(3):1353-61 86 Yagel S, Parhar RS, Jeffrey J J , Lala PK. (1988) Normal nonmetastatic human trophoblast cells share in vitro invasive properties of malignant cells. J Cel l Physiol. Sep; 136(3):455-62 Yamada O, Todoroki J , Takahashi T, Hashizume K. (2002) The dynamic expression o f extracellular matrix in the bovine endometrium at implantation. J Vet M e d Sci . Mar;64(3):207-14 Young K A , Tumlinson B, Stouffer R L . (2004) A D A M T S - 1 / M E T H - l and TIMP-3 expression in the primate corpus luteum: divergent patterns and stage-dependent regulation during the natural menstrual cycle. M o l Hum Reprod. Aug;10(8):559-65. Epub2004 Jun 18 Younis JS, Ezra Y , Sherman Y, Simon A , Schenker J G , Laufer N. (1994) The effect of estradiol depletion during the luteal phase on endometrial development. Fertil Steril. Jul;62(l): 103-7 Yu W H , Yu S, Meng Q, Brew K, Woessner JF Jr.(2000) TIMP-3 binds to sulfated glycosaminoglycans of the extracellular matrix. J B i o l Chem. Oct 6;275(40):31226-32 Zaytseva TS, Goncharova V N , Morozova MS, Astakhova T M , Manuilova IA, Pankov YA. (1993) The effect of RU486 on progesterone and oestrogen receptor concentration in human decidua on early pregnancy. Hum Reprod. Aug;8(8): 1288-92 Zhang J , Salamonsen L A . (1997) Tissue inhibitor of metalloproteinases ( T I M P ) - l , -2 and -3 in human endometrium during the menstrual cycle. M o l Hum Reprod. Sep;3(9):735-41 Zhang X and Croy BA. (1996) Maintenance o f decidual cell reaction by androgens in the mouse. B i o l Reprod: 55, 519-524 Zygmunt M, Herr F, Munstedt K, Lang U, Liang OD. (2003) Angiogenesis and vasculogenesis in pregnancy. Eur J Obstet Gynecol Reprod B i o l . Sep 22; 110 Suppl LS10-8 87 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092638/manifest

Comment

Related Items