Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transcriptomic analysis of rhodococcus sp. RHA1 responses to heat shock and osmotic stress Ekpanyaskun, Pat 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-0441.pdf [ 8.43MB ]
Metadata
JSON: 831-1.0092631.json
JSON-LD: 831-1.0092631-ld.json
RDF/XML (Pretty): 831-1.0092631-rdf.xml
RDF/JSON: 831-1.0092631-rdf.json
Turtle: 831-1.0092631-turtle.txt
N-Triples: 831-1.0092631-rdf-ntriples.txt
Original Record: 831-1.0092631-source.json
Full Text
831-1.0092631-fulltext.txt
Citation
831-1.0092631.ris

Full Text

TRANSCRIPTOMIC ANALYSIS OF RHODOCOCCUS sp. RHA1 RESPONSES TO HEAT SHOCK AND OSMOTIC STRESS by Pat Ekpanyaskun B.Sc. (Agr.Env.Sc), McGill University, 2004 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Microbiology and Immunology) THE UNIVERSITY OF BRITISH C O L U M B I A August 2006 © Pat Ekpanyaskun, 2006 11 ABSTRACT Rhodococcus sp. RHA1 is a soil actinomycete that is capable of degrading many aromatic compounds. Thus, it has potential applications in the pharmaceutical, the environmental, and the energy sectors. To efficiently exploit RHA1 in various applications, it is important to understand its responses to stress conditions commonly occurring in soil. This study focused on the global responses of exponentially growing RHA1 to heat shock and osmotic stress, primarily at the transcriptional level. Several genes that belong to the typical heat shock responses (encoding heat shock proteins), as well as the oxidative stress responses (encoding glutathione peroxidase, methionine sulfoxide reductase), were induced following heat shock. Several up-regulated genes following heat shock were related to fatty acid biosynthesis and metabolism. RHA1 adapts to osmotic stress by synthesizing the L-ectoine as a compatible solute, and possibly by turning on components of potassium transporters, KdpAB. It also induces genes encoding a tyrosine kinase and the DNA protection during starvation protein following osmotic stress. The translational machinery was repressed following both stresses; however, the repression was prolonged following the heat shock, which was lethal. Only 20 genes were found common to heat shock and osmotic stress responses. Among these are genes encoding a a-factor similar to oF in M . tuberculosis and a transcriptional regulator similar to HspR in S. coelicolor. The induction of these two genes suggests central roles for them in stress responses, perhaps controlling other regulators that will promote or inhibit the expression of other genes, depending on the type of stress. Overall, this study provides improved understanding of adaptation mechanisms of rhodococci. iii TABLE OF CONTENTS Abstract 1 1 Table of Contents " i List of tables vii List of figures v m Acknowledgements x l 1 Introduction 1 1.1 Characteristics of Rhodococcus sp. RHA1 1 1.2 Environmental stresses 3 1.2.1 Heat shock 4 1.2.1.1 Heat shock proteins 4 1.2.1.2 a-factors 8 1.2.2 Osmotic stress 11 1.2.2.1 Primary response 12 1.2.2.2 Secondary response 14 1.2.2.3 Two-component systems 17 1.2.2.4 a-factors 20 1.3 Transcriptomic Analysis of Rhodococcus sp. RHA1 20 1.4 Objectives 22 2 Materials and methods 23 2.1 Bacterial strains, media, and growth 23 iv 2.2 Stress conditions and sampling .....23 2.3 Cell harvesting and RNA extraction 24 2.4 DNase treatment and RNA purification 26 2.5 cDNA synthesis and labeling 27 2.6 Microarray hybridization and data analysis 28 2.7 Real-Time Quantitative PCR 29 2.8 Scanning Electron Microscopy 30 Results 32 3.1 Growth of RHA1 during temperature and osmotic stress 32 3.1.1 Determination of the substrate concentration for growth experiments 32 3.1.2 Determination of which temperatures are appropriate for normal and stress conditions 33 3.1.3 The effect of shifting the temperature from 30°C to 35°C on exponentially-growing RHA1 34 3.1.4 Determination of the concentration of NaCl which limits RHA1 growth 37 3.1.5 Effect of NaCl on exponentially-growing RHA1 38 3.2 Genomic Analysis of heat shock and osmotic stress responses in RHA1 ...40 3.3 Heat shock and osmotic stress transcriptomes 42 V 3.3.1 Transcriptomic analysis of the heat shock response 43 3.3.2 Transcriptomic analysis of osmotic stress response 63 3.4 Microarray data validation 75 3.5 Cell morphology 76 4 Discussion 80 4.1 Tolerance of temperature and salt concentration of RHA1 80 4.2 Global heat shock responses 81 4.2.1 The repression of translational machinery and energy production 81 4.2.2 The induction of heat shock proteins, and the possible induction of a universal stress protein 82 4.2.3 The induction of a-factors 87 4.2.4 The induction of genes related to lipid transport and metabolism 90 4.2.5 The association between heat shock and oxidative stress... 91 4.3 Global osmotic stress responses 92 4.3.1 Possible induction of KdpA, KdpB, and the induction of a protein-tyrosine kinase 93 4.3.2 The biosynthesis of compatible solutes in RHA1 95 4.3.3 The induction of the a-factors.... 98 4.3.4 The induction of the DNA protection during starvation 100 4.4 Comparison of responses to heat shock and osmotic stress 102 Conclusions 106 References 108 Appendices • 117 Appendix A 117 Appendix B 135 LIST OF TABLES Table 2.1 Primers and probes for Taq-Man quantitative PCR assays 31 Table 3.1 Selected clusters of genes that are differentially expressed following heat shock ( > 8-fold difference and P < 0.05; n = 3) 48 Table 3.2 Subset of selected genes showing differential expression within 30 min following heat shock ( > 2-fold difference and P < 0.05; n=3). Only those genes identified in section 3.2, which have the significant expression ratios, are listed 57 Table 3.3 Selected clusters of genes that are differentially expressed following osmotic stress ( > 8-fold difference and P < 0.05; n=3) 67 Table 3.4 Subset of selected genes showing differential expression within 30 min following osmotic stress ( > 2-fold difference and P < 0.05; n = 3) Only those genes identified in section 3.2, which have the significant expression ratios, are listed..70 Table 3.5 Common genes that are differentially expressed in heat shock and osmotic stress within 30 min following the stress 74 V l l l LIST OF FIGURES Figure 1.1 A model for the reaction cycle of the GroE chaperones 6 Figure 1.2 Different groups of the a70-family based on domain composition 9 Figure 1.3 Activation of an extracytoplasmic function (ECF) a-factor 10 Figure 1.4 Systems involved in the osmotic stress response by synthesizing / transporting compatible solutes in A) E. coli, B) B. subtilis and C) C. glutamicum 16 Figure 1.5 Two-component mechanism in E. coli for osmolality response 18 Figure 3.1 Growth rate of RHA1 grown at 30°C in W medium containing sodium benzoate concentrations of 10, 20, 30, and 40 mM 33 Figure 3.2 Growth rate of RHA1 in W medium with 20 mM sodium benzoate at 10, 15, 30, 33, 35, 37 and 40°C 34 Figure 3.3 Growth curve and cell viability of RHA1 grown to mid-log phase in W medium with 20 mM sodium benzoate and stressed by shifting the growth temperature from 30°C to 35°C 36 Figure 3.4 Growth rate of RHA1 grown at 30°C in W medium containing 20 mM sodium benzoate plus 0, 0.1, 0.25 and 0.5 M NaCl 38 Figure 3.5 Growth rate of RHA1 at 30°C in W medium with 20 mM sodium benzoate, following addition at mid-log phase of varied concentrations of NaCl 39 Figure 3.6 Growth curve of RHA1 stressed at mid-log phases with 0.5, 0.6 or 0.75 M NaCl 40 Figure 3.7 Number of genes whose expression was significantly different at one or more time points following heat shock than just prior to heat shock ( > 2-fold difference and P < 0.05) in heat shock or osmotic stress 45 IX Figure 3.8 Heat maps of transcriptomes associated with heat shock (a) or osmotic stress (b), showing genes that were significantly different at one or more time points ( > 2-fold difference and P < 0.05) 46 Figure 3.9 Expression of genes in selected clusters from the heat shock experiment shown in Figure 3.8a 47 Figure 3.10 The numbers of genes that were differentially expressed (P < 0.05, up- or down- regulated > 2 fold) within 30 min of heat shock or osmotic stress, based on the clusters of orthologous groups 54 Figure 3.11 Expression of genes in selected clusters from the osmotic stress experiment shown in Figure 3.8b 66 Figure 3.12 Comparison of heat shock vs. osmotic stress transcriptomes, showing number of genes differentially expressed within 30 min following the stress (P < 0.05 and up- or down- regulated > 2 fold) and summarizing important categories of genes involved 73 Figure 3.13 Photomicrographs of RHA1 shifted to 35°C; before treatment (A); 30, 60 and 120 min after treatment (B, C and D), respectively 77 Figure 3.14 Photomicrographs of RHA1 treated with 0.6 M sodium chloride; before treatment (A); 30 (B), 60 (C) and 120 (D) min after treatment 78 Figure 3.15 Cell length of RHA1 that were untreated (•); heat shocked (•); osmotic stressed ( A ) at 30, 60 and 120 min post-stress 79 Figure 4.1 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of ro08345 to ro08348 84 X Figure 4.2 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of Hsp genes (ro05497 to ro05500) 85 Figure 4.3 A physical map of ro04728 to ro04732 (a) and the average normalized expression ratios (b) over timecourse of ro04728 to ro04732 in heat shock and osmotic stress 89 Figure 4.4 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of roOl228 to ro01232 that are annotated as K + transporting system 94 Figure 4.5 A physical map (a) and the average normalized expression ratios over timecourse (b) of ro01305 to ro01308, a putative operon encoding L-ectoine biosynthesis. A proposed pathway of the L-ectoine biosynthesis in RHA1 (c) 96 Figure 4.6 A physical map (top) and the average normalized expression ratios over timecourse (bottom) ofrc-00098 to ro00102 100 xi ACKNOWLEDGEMENTS I am grateful to Dr. William W. Mohn for providing me with a great opportunity to do research, and for supervising me throughout my degree. I would like to thank to my committee, Dr. Erin Gaynor and Dr. Lindsay D. Eltis for their research guidance. Special thanks are owed to Dr. Hirofumi Hara and Dr. Edmilson Goncalves for teaching me many lab techniques and for sharing their expertise, to my family, for their moral and financial support, and to my proof-readers, Kent Hui, Jason Li and Claire Stilwell, for their patience with my style of writing. I would also like to thank Dr. Thomas Heuser for his assistance on the scanning electron microscopy, as well as Sachi Okamoto and Jie Liu for their advice in making the knockout mutants. There are a couple of people I would like to really thank at a personal level. An enormous gratitude goes to Poma Akesinn, who continuously offered guidance, consolation, as well as patience and forgiveness for my recalcitrance. I appreciate Hirofumi Hara, Jenny Tsai, Sadeem Fayed, Somrudee Sritubtim, Jochen Brumm, and Mari Winkler for their constant support and their cordiality. I am also thankful to friends and colleagues, who have helped me along with my study and beyond, and have made my life in Vancouver enjoyable. Last, but not least, I am grateful to Buddha for the enlightenment of life happiness. This study was funded by Genome Canada and Genome British Columbia. 1 1 INTRODUCTION 1.1 Characteristics of Rhodococcus sp. RHA1 Rhodococcus sp. RHA1 (RHA1) is a non-motile, gram-positive actinomycete with a high G-C content. Rhodococci are of great interest to chemical, pharmaceutical, energy, and environmental industries due to their ability to metabolize a wide range of aromatic compounds (95). Rhodococci contain long-chain mycolic acids that are suggested to facilitate the uptake of hydrophobic compounds (40). In addition, they can adapt to a wide variety of environments, such as soil and water. RHA1 was first isolated from 7-hexachlorocyclohexane-contaminated soil (107), and is best known for its ability to degrade polychlorinated biphenyls (PCB), some of the most persistent aromatic pollutants in the environment (82). Rhodococci have biotechnological and environmental importance in the bioremediation of hydrophobic natural compounds, the production of acrylamide and acrylic acid (119), the production of steroids, and the biodesulfurization of fossil fuels (82). RHA1 has the potential to synthesize antibiotics. The RHA1 genome is one of the largest bacterial genomes sequenced to date (9.7 Mb), comprising 9,145 predicted protein coding sequences (82). It includes a 7.8 Mb chromosome and three linear plasmids (0.34 Mb, 0.44 Mb and 1.1 Mb) that contribute to catabolic diversity (119). The majority of the transporters are annotated as drug exporters and drug resistance-associated Major Facilitator Superfamily (MFS) transporters (82). Moreover, the presence of 24 non-ribosomal peptide synthase genes and 7 polyketide synthase genes in 2 the RHA1 genome suggest its ability to synthesize secondary metabolites (82). Based on sequence comparison, RHA1 shares 43.3, 35.3, 30.9, 29.3 and 23.3 percent of its proteome with Nocardia farcinica, Mycobacterium tuberculosis, Corynebacterium glutamicum, Streptomyces coelicolor A3(2) and Frankia sp. EANlpec, respectively (82). Rhodococcus sp. RHA1, M. tuberculosis and S. coelicolor are closely related members of the actinomycetes. M. tuberculosis and S. coelicolor are medically important microorganisms (82). M. tuberculosis is the causative agent of tuberculosis, the major bacterial cause of death worldwide (28). S. coelicolor is able to synthesize numerous types of secondary metabolites, such as antibiotics, insecticides, and anti-tumor agents (94). However, M. tuberculosis grows considerably slower than rhodococci, and the developmental cycle of Streptomycetes is more complex. The study of rhodococci provides opportunities to gain insights into the actinomycetes and drug synthesis systems (82). Despite many studies on antibiotic production by bacteria under stress conditions, few studies have concentrated on stress responses in rhodococci. Nutritional stress causes the production of the cyclodecapeptide antibiotic, tyrocidine, in Bacillus brevis (21). Salt stress conditions affect the production of the antibiotics, actinorhodin and undecylprodigiosin, in S. coelicolor (108). Osmoadaptation and antibiotic production are both affected by the OsaB protein in S. coelicolor (9). One of the essential genes in transcriptional machinery, aL is found to regulate a polyketide synthase, essential for secondary metabolite production under stress conditions in M. tuberculosis (41). Heat shock causes the induction of a heat shock protein, GroELl, which contributes to pathogenicity in Mycobacteria (93). 3 No studies have reported on genomic responses of rhodococci to heat shock and osmotic stress, two stresses that commonly occur in soil. There are still gaps in our knowledge of how rhodococci tolerate temperature fluctuations or osmotic stress in the environment. The temperature range for growth of rhodococci and their tolerance to salt have not been studied. Genes and regulatory networks that are essential for survival under these stresses are not well understood. Due to the importance of Rhodococcus spp. for industrial applications and bioremediation, as well as its ability to act as a model organism for soil organisms, it is important to understand the fundamental responses of the rhodococci under these common soil stresses. Investigations of the gene expression and regulatory networks of RHA1 under osmotic and heat stress will greatly facilitate its use for bioremediation, medicine and potentially antibiotic production. It will also assist bioremediation in high temperature or high salinity environments, such as desert and high-salt soils resulting from irrigation. Responses to heat shock and osmotic stress in microorganisms are reviewed in the remaining sections. 1.2 Environmental stresses Microorganisms grow rapidly under their optimum growth conditions. In the soil environment, temperature fluctuation, nutrient limitation, osmotic stress and desiccation create growth conditions which are far from optimal. Survival in this changing environment requires a fast and adaptive response. Thus, soil microbes are expected to express certain groups of genes, or regulate their gene expression, to generate efficient adaptation mechanism for coping with these environmental stresses. Further, some members of populations are mutated to generate a phenotype that facilitate survival and 4 proliferation (26). Microorganisms that successfully adapt to changing environmental conditions will colonize the niche (102). Although many stresses exist, the primary focus of this thesis will be on heat shock and osmotic stress, and how gram-positive organisms respond to these two stresses. 1.2.1 Heat shock Temperature increase is an important environmental stress encountered by bacteria. The main components involved in heat shock response are heat shock proteins and a-factors. These components are discussed below. 1.2.1.1 Heat shock proteins Heat shock proteins (Hsp) are found in all bacteria and as a group, are some of the most conserved proteins in microorganisms (37). Several Hsp families are classified according to their average molecular mass, e.g. Hsp 100, Hsp90, Hsp70 (DnaK), Hsp60 (GroEL), and small Hsp (29). All living microorganisms increase production of two important groups of Hsp when they face high temperature: molecular chaperones and ATP-dependent proteases (44). Chaperones assist the folding of newly synthesized proteins, prevent aggregation of proteins during heat shock, and correct misfolding of denatured proteins that have been damaged by heat shock. Two major chaperones include GroE complex and DnaK. Proteases play a role in degrading improperly folded proteins (75). There are several families of ATP-dependent proteases, including Clp, HslUV, FtsH and Lon. These proteases are large, multi-subunit complexes consisting of ATPase and proteolytic subunits. The ATPase subunit denatures and translocates 5 substrates into the proteolytic subunit for degradation (8). The major ATP-dependent proteases are Lon and Clp, which are responsible for 70-80% of the energy-dependent degradation of proteins in the cells (33). A model for the reaction cycle of the GroE complex with misfolded protein is illustrated in Figure 1.1. The GroE complex is described as a double doughnut, with two rings of GroEL (75). GroES sits as a cap on one end of the complex. An improperly folded protein binds to one of the rings (step 1) and GroES caps the ring with the protein inside using ATP, resulting in a size increase of the cavity (step 2). Once ATP is hydrolyzed (step 3), a new set of proteins with ATP bind to the uncapped ring (step 4). The initial protein located on the other end of the GroEL is released and the GroES moves to cap the new protein (step 5). The entire reaction cycle can now begin again with the binding of GroES to the ring. Hence, GroE provides a protected environment in which protein folding of individual protein can be performed. On the contrary, DnaK binds and protects exposed regions on unfolded or partially folded protein chains. The DnaK complex consists of DnaK and DnaJ. The improperly folded protein either binds directly to DnaK-ATP, or is bound first to DnaJ, which then presents the misfolded protein to DnaK-ATP. During this process, ATP is hydrolyzed and the DnaK-ADP-protein-DnaJ complex is formed. GrpE replaces the ADP with ATP, which consecutively converts DnaK back to its original state, which releases DnaJ and the protein (75). 7 G r o E S n G r o E L (cross sect ion through a single ring) G r o E L (as above) with en larged cavity after nucleot ide and G r o E L b inding. C Mis fo lded protein n A D P ATP O * • Stepl 7CA ADP GroES A T P X Step 3 o ADP A T P Step 2 GroES A D P P i Figure 1.1 A model for the reaction cycle of the GroE chaperones. Explanations for the different steps are given in the text. This figure is taken with some modifications from (75). Many reports investigated the induction of Hsps upon heat shock (35, 57, 76, 115, 124). Shifting the temperature from 37°C to 50°C in Bacillus subtilis represses synthesis of most cellular proteins. However, 26 Hsps, including DnaK, Lon, and GroEL, are induced after 3 minutes (6). A survey of heat shock response caused by shifting the temperature from 30°C to 41°C in S. albus, S. lividans, S. parvulus and S. viridochromogenes reveals the up-regulation of Lon, DnaK and GroEL (36). The level of Hsp induction has been found to be different depending on the growth phase during 7 Hsp induction has been found to be different depending on the growth phase during development in S. coelicolor (99). Vohradsky and colleagues (121) used 2D gel analysis to show that heat, salt, and ethanol stimuli induce independent sets of proteins, indicating the presence of independent regulatory systems for different stresses in S. coelicolor. Furthermore, the stress proteins are also under developmental control, implying that the stress-induced regulatory networks are integral parts of the development (121). Although the induction of Hsp is highly conserved amongst organisms, the regulatory mechanisms controlling Hsp synthesis differ widely amongst organisms. To date, the regulation of the heat-shock response has been reported in few organisms, though bacteria are known to regulate the transcription of Hsp by means of positive and negative mechanisms. The positive regulation in E. coli involves the a 3 2 and a E for Hsp induction (130). In B. subtilis, heat inducible genes are divided into six classes according to their common regulatory characteristics. The regulations are either positive (as the o-factors) or negative (as the repressors). Two classes are controlled by two transcriptional repressors, HrcA and CtsR. One class is controlled by an alternative sigma factor, a B . A fourth class is controlled by an unknown transcriptional activator. The fifth and the sixth classes are controlled by a two-component system and an unknown mechanism, respectively (105). There are three mechanisms that negatively regulate the Hsp in Streptomyces spp., including HrcA, HspR and RheA repressors. The HrcA regulon, consisting of the HrcA repressor interacting with an inverted repeat called the CIRCE element, appears to be common for both high and low G+C content gram-positive bacteria, as well as a-, B-, and 71-purple proteobacteria (106). CtsR and HspR repressors 8 exclusively regulate Hsps in low G+C and high G+C gram-positive bacteria, respectively (106). Additional regulatory mechanisms remain to be characterized. 1.2.1.2 a-factors a-factors are also induced under heat shock conditions, a-factors play key roles in controlling the transcription of specific regulons in certain organisms under normal and stress conditions. A a-factor is a detachable subunit of RNA polymerase (RNAP) that binds to the RNAP core to form the RNAP holoenzyme and direct it to a specific set of promoters (129). Thus, one large set of genes can be turned off and a new set turned on simply by switching the a-factor. There are two distinct families of a-factors, the a 5 4 -and the a 7 0 -family, which do not share any sequence homology (34). The a54-family has not been reported in any high-GC, gram-positive bacteria or in cyanobacteria (34). Four (a70-family) groups have been assigned based on the phylogenetic classification (Figure 1.2) (34). Groups 1 and 2 contain domains 1, 2, 3, and 4 plus the non-conserved region (34). Group 1 is a primary a-factor essential for growth, whereas group 2 is a primary-like a-factor dispensable for growth. Region 1.1 is located within the domain 1, and is the signature of the principle a-factors. It can either promote or inhibit transcription initiation by influencing open complex formation (34). The alternative a-factors form group 3 in the a70-family that is the most divergent compared to other types of a-factors and are essential in controlling the transcription of specialized regulons under growth transition, specific stresses, and morphological changes (49). The group 3 a-factors possess domains 2, 3, and 4. The group 4 a-factors contain domain 2 and 4, and sometimes have extracytoplasmic functions (ECF), which can respond to specific 9 extracellular environmental signals. Some ECF a-factors are involved in cell envelope functions, such as transport, secretion, and extracytoplasmic stress (7, 49). Moreover, they are co-transcribed with one or more negative regulators, which often have transmembrane protein function as an anti a-factor that inhibits the cognate a-factor (49). Upon receiving an extracytoplasmic signal, a a-factor can bind to core RNAP and initiate transcription at specific promoter sites (49) (Figure 1.3). To date, two ECF a-factors have been described in E. coli, seven in B. subtilis and 10 in M. tuberculosis (34). S. coelicolor contains 50 a-factors, which is the highest number among all bacteria to date (82). The presence and functions of alternative a-factors are important characteristics that distinguish individual microorganisms and their ecology. Figure 1.2 Different groups of the a -family based on domain composition. A representation of group 1 or 2 a-factor (A) contains domains 1, 2, 3, and 4 plus a non-conserved region. The group 3 a-factor (B) contains domains 2, 3, and 4. The group 4 a-factor (ECF) is similar to group 3, but it lacks domain 3 (C). This figure is taken directly from (34). A B C 10 Figure 1.3 Activation of an extracytoplasmic function (ECF) a-factor. The anti a-factor is usually located in the cytoplasmic membrane (M), binding to a x under normal conditions. Upon interaction with an extracytoplasmic signal, a x is released and can bind to the core RNAP to direct transcription initiation from its specific promoter sites (P). This figure is adapted from (49). Most studies related to heat shock response have investigated E. coli, B. subtilis and S. coelicolor, since they are model microorganisms. In E. coli, os is the master regulator of the general stress response, which provides resistance to oxidative stress, UV-radiation, heat shock, hyperosmolarity, acidic pH, and ethanol (52). Under heat shock conditions, a 3 2 (encoded by the rpoH gene), allows a huge part of the heat shock regulon, including the chaperones and the proteases to be transcribed (104). In B. subtilis, heat shock activates a 3 , which controls more than 150 general stress genes, 11 including heat-, ethanol-, acid- and salt-stress, as well as carbon-, phosphate- and oxygen-limitation (59). S. coelicolor a H , a functional homologue to o~B of B. subtilis and a F of M. H E 1 B tuberculosis, is involved in the heat shock response (65). Three a-factors, a , a and cr are involved in response to heat shock in M. tuberculosis (78). Interestingly, the heat shock response and the oxidative stress response seem to be interrelated in M. tuberculosis since the a H mutant shows an increased in both heat-shock and oxidative sensitivity (78). In C. glutamicum, one a-factor, a E , is involved in heat shock response, which also induces genes related to oxidative stress, including peptide methionine sulfoxide reductase, thioredoxin and glutathione reductase (89). 1.2.2 Osmotic stress The cytoplasmic membrane of bacteria is permeable to water but forms an effective barrier for solutes in the surrounding medium (87). Thus, the total concentration of solutes within a cell is generally higher than that in the surroundings, causing water to flow down its chemical potential into the cells (87). As a result, a hydrostatic pressure or turgor pressure is exerted on to the bacterial cell wall to balance the difference in osmotic pressure between the cell interior and its surroundings. Microorganisms must maintain an intracellular osmotic pressure greater than that of the growth medium to enlarge the cell envelope for growth and division (17). There are often fluctuations in the osmolality in the soil environment, causing soil microorganisms to experience osmotic stress (87). For example, a sudden increase in the osmolality of the environment (hyperosmotic stress) due to evaporation of water on a sunny day causes water to move from inside the cell to the outside (18). As a consequence, cell turgor 12 pressure is lost and the intracellular solute concentration, as well as the cell volume, are changed (87). Under these conditions, cells becomes dehydrated and may plasmolyse (120). Similarly, following a decrease in the osmolality of the environment (hypoosmotic stress) on a rainy day, passive influx of water will increase the turgor pressure, membrane tension and eventually lyse the cells if there are no mechanisms to counteract the stress (97). To adapt to osmotic stress, many nonhalophilic bacteria maintain turgor pressure by adjusting their intracellular osmolyte concentrations via bi-phasic responses (127). Certain systems or elements, including two-component systems and alternative a-factors are induced. In addition, cells may undergo morphological changes, such as changes in cell surface hydrophobicity, cytoplasmic membrane composition and cell wall composition. For instance, an increase in hydrophobicity was observed in Lactobacillus casei under the osmotic stress (96). The cell wall increased in thickness following osmotic stress in B. subtilis (73). The bi-phasic responses and the elements required for osmoadaptation will be described in detail in the following section. Studies of various organisms suggest a general progression of physiological responses in osmotically stressed bacteria, but there are many gaps in our knowledge and it is uncertain how different organisms may vary from this generalized progression. 1.2.2.1 P r ima ry response The primary response of osmoadaptation in some bacteria is the accumulation of potassium (K +) that is mediated by activation of low and high affinity transporter systems to compensate for the efflux of water that accompanies the increase in the external salinity, as seen inii. coli, B. subtilis, C. glutamicum and Listeria monocytogenes (22, 88, 13 111, 125). However, glutamate is synthesized in E. coli to counterbalance the charge of K + ion (22), whereas B. subtilis accumulates osmoprotective compounds such as glycine betaine (110). In E. coli, there are four constitutive low-affinity K + transport systems: TrkD, TrkF, TrkG and TrkH, as well as one high-affinity system, Kdp (110). The Trk systems require both membrane potential and ATP for K + uptake, whereas the Kdp system only requires ATP hydrolysis (42). The Kdp system operates when cells need to scavenge K + that is present at low concentrations (42) or when cells encounter osmotic stress (60). The Kdp system is a membrane-associated P-type ATPase, comprised of KdpA, KdpB, KdpC and KdpF proteins encoded by the kdpFABC operon in E. coli (23). Compared to the information available for K + accumulation in gram-negative bacteria, there is much less known for gram-positive bacteria. However, it is known that there are two transport systems, Ktrl and Ktrll found in a lactic acid bacterium, Enterococcus hirae (110). Ktrl recognizes K + and Rb + , and requires both ATP and proton potential. Instead, Ktrll recognizes K + exclusively and does not require proton potential (110). As well, in B. subtilis, there are two transport systems, KtrAB and KtrCD that differ in their affinity for K + . KtrA is a peripheral membrane protein and KtrB is a membrane-embedded subunit (55). KtrAB is cotranscribed as an operon, whereas KtrC and KtrD, which are located away from each other on B. subtilis chromosome, are expressed as single transcriptional units (55). KtrAB and KtrCD are essential for K + uptake under osmotic stress in B. subtilis (55). An increase in the K + concentration has been detected in L. monocytogenes and C. glutamicum following the osmotic upshift, but the responsible K + uptake systems remain 14 unknown to date (48). K + transporters associated with osmotic stress have not been reported in Streptomyces ox Mycobacterium spp. 1.2.2.2 Secondary response During the secondary response of osmotic stress, there is a dramatic increase in the cytoplasmic concentration of compatible solutes (through synthesis and/or uptake) (110) (Figure 1.4). Compatible solutes are highly soluble molecules, which carry no net charge at physiological pH and do not interact with proteins (48). They function as effective stabilizers of enzyme function, providing protection against salinity, high temperature and drying (48). In addition, they help increase the cell volume and can be accumulated at high concentration without adversely affecting cellular processes, unlike the ionic osmolytes of the primary response, K + and glutamate (110). Common osmoprotectants found in microorganisms are glycine betaine, carnitine and ectoine (97). C. glutamicum uses proline, trehalose, ectoine, betaine or glutamate as compatible solutes (120). In streptomycetes, ectoine and hydroxyectoine are accumulated under elevated temperature and hyperosmotic stresses (77). Trehalose, ectoine and hydroxyectoine are reported to be three osmolytes found in R. opacus PD630 during water stress (3). The major osmoprotectants in Mycobacteria have not been reported. However, trehalose production is vital for growth o f M tuberculosis and C. glutamicum (118, 128). In general, microorganisms seem to preferentially take up osmoprotective compounds from the environment rather than synthesize their own (11). For instance, E. coli possesses ProP, PutP and ProU for betaine uptake, whereas B. subtilis has OpuA, OpuC and OpuD (87). Four betaine uptake transporters have been identified in C. 15 glutamicum, including BetP, EctP, LcoP and ProP (66). Sinorhizobium meliloti uptakes glycine betaine/proline betaine from the environment using BetS (12). In the absence of osmoprotectants available in the environment, cells can synthesize their own. E. coli generates betaine by transporting any available choline into the cells via the BetT and ProU system and converting choline to betaine via a two-step enzymatic reaction (Figure 1.4). C. glutamicum is able to produce glutamate, trehalose and proline depending on nutrient availability (126). Proline is the major compatible solute of C. glutamicum when excess nitrogen is supplied (126). Once there is a sufficient amount of osmoprotectant inside the cells, any excess is released by mechanosensitive channels (MS) to prevent water inflow (hypoosmotic shock). MS channels are activated by tension of the cell membrane (81) and are classified based on their conductance (117). MS channels are extensively studied in E. coli, in which three channels are identified: MscM, MscS and MscL (117). It has been shown that the MS channels are also essential for survival of stationary phase of E. coli (117). Furthermore, MscS and MscL have been shown to be components of a-factor, RpoS regulon in E. coli (117). Based on existing reports, MS channels are found in M. tuberculosis and C. glutamicum but are absent in S. coelicolor (71, 91). 16 K d p I Kef4 B o t T l Proui^ ProPl Aqpaf • 4 • • U i Hi G l u t a m a t e s y n t h e s i s C h o l i n e 3etA l i t G l y c i n e b e t a i n e a l d e h y d e ^B«tA BetB G l y c i n e b e t a i n e M s c U S G l u c o s e - f i - P U D P - G l u c o s e OtsA OtsB OM PP CM T r e h a l o s e B Bacillus subtilis: OpuA^9 O p u J ^ M ^ O p u ^ ^ ^ O p u D t a p u f j d A T P ^ T A T p " ^ * A T P * ^ • ™ * C h o l i n e JtrtB l o t Glycine betaine aldehyde ^GbsA G l y c i n e Detains CM G l u t a m a t e ProJ Pr P r o l i n e C Corynebacterlum glutamicum: K* ? V B e t p l E c t P I L c o P l P r o P l 4 • MM! G l u t a m a t e s y n t h e s i s Trehalose synthesis out CM M s c U S ProB ProC G l u t a m a t e — • • • P r o l i n e Figure 1.4 Systems involved in the osmotic stress response by synthesizing / transporting compatible solutes in A) E. coli, B) B. subtilis and C) C. glutamicum. O M = outer membrane, PP = periplasm, C M = cytoplasmic membrane. Shaded ovals represent 17 biosynthesis processes. Ovals in membranes represent transporters. This figure is taken directly from article (87). 1.2.2.3 Two-component systems In B. subtilis and other bacteria, osmoregulation occurs through transcriptional control involving a two-component system: a membrane-bound histidine sensor kinase and a cytoplasmic response regulator (24). The sensor kinase consists of two distinct domains: a sensor domain and a transmitter domain. The sensor domain is located at the N-terminus and has a divergent sequence important for substrate recognition (24). A histidine residue of the transmitter domain located at the C-terminus becomes autophosphorylated after sensing the environmental signal (24). Subsequently, the phosphate group is transferred to an aspartic acid residue at the N-terminus of the regulator where receiver domain resides, causing the effector domain at the C-terminus to become activated (24) (Figure 1.5). 18 Stimulus H P K I i ± ® i 1 R R O u t p u t A Osmolarity Sensor Transmitter Receiver Effector DNA-binding A Transcription of ompF ompC Figure 1.5 Two-component mechanism in E. coli for osmolarity response (98). Sensor kinase binds to a specific substrate during changes in the osmolarity. Substrate binding results in a conformational change that causes a histidine residue at the transmitter to become autophosphorylated. The response regulator receives the signal from the sensor kinase, activates the effector and allows the effector to bind DNA. Subsequently, ompF and ompC, encoding porins, are transcribed and change the osmolarity inside the cell. 19 The activated regulator can induce or suppress a specific operon that encodes transport or degradation proteins specific for the substrate. Both the receiver domain and effector domain are highly conserved in all response regulators, unlike the sensor domain. Two-component systems are found across all three domains of life and are most widespread in Bacteria (60), including B. subtilis, S. coelicolor, M. tuberculosis and C. glutamicum (43, 60, 86, 123). A well-characterized example of a two-component system for osmolarity response is the envZ/ompR system found in E. coli (98) (Figure 1.5). The sensor histidine kinase, EnvZ, senses a change in osmolarity, causing the response regulator OmpR to become activated; which in turn increases the expression of ompF and ompC. These genes encode porins that directly change the osmolarity inside the cell (98). Another two component system essential for osmoadaptation is the KdpDE system found in E. coli, Mycobacterium spp. and S. coelicolor (60). The histidine kinase KdpD interacts specifically with two membrane lipoproteins, LprJ and LprF, to modulate kdp expression in M. tuberculosis and M. smegmatis (116). The kdpDE genes in M. tuberculosis are located away from the kdpFABC operon and expression of the latter operon is highly induced by low intracellular potassium levels (116). On the other hand, in E. coli, kdpD and kdpE are the last two genes in the kdpFABCDE operon, which, besides the two-component system, encodes the potassium-transporting KdpFABC ATPase, as described previously (22). The sensor kinase KdpD becomes autophosphorylated upon an environmental signal, causing the phosphate group to be transferred to the cytoplasmic response regulator KdpE (46). However, it has been shown in later studies that KdpD is not essential for sensing K + limitation, but actually 20 stabilizes the interaction between KdpE and the corresponding DNA-binding site in E. coli (46, 47). 1.2.2.4 a-factors In addition to the two-component systems, a-factors are involved in transcribing genes related to osmotic stress in many organisms. For instance, a of E. coli is a global c regulator for the osmotic, heat and acid shock control of gene expression (51). a -dependent genes, including otsA, otsB and trehalose synthesis enzymes, are induced upon osmotic induction (53). a B has been shown to regulate osmotic stress response and virulence in L. monocytogenes (63), and to induce general stress genes following heat, ethanol, osmotic or acid stress, or during energy depletion in B. subtilis (45). Interestingly, a B activity is tightly regulated by the anti-a-factor, RsbW, and the antagonist protein RsbV to prevent unnecessary transcription of stress proteins (56). Upon stressful circumstances, RsbV dephophorylates and takes away RsbW from a B , which releases and activates a B (56). Similarly, S. coelicolor a B is controlled by RsbA and RsbB (homologs of RsbW and RsbV, respectively in B. subtilis) and is required for osmoprotection and proper differentiation (15, 70). To date, a-factors responsible for osmoadaptation in Corynebacteria or Mycobacteria have not been reported. 1.3 Transcriptomic Analysis of Rhodococcus sp. RHA1 Transcriptomic analysis using a microarray was used to elucidate the genetic responses of RHA1 under heat shock and osmotic stress. The development of microarray technology is a result of the availability of complete genome sequences in many 21 organisms and allows researchers to study global gene expression on a single chip (84). The technique relies on the collection of hybridization probes with known identities that bind to complementary labeled targets on a platform. The amount of labeled targets bound to the probes reflects mRNA abundance of genes, which identifies genes essential for particular cellular responses, phenotypes or conditions (100). Many phenotypic changes originate at the transcriptional level and the ability to measure mRNA level reveals the end effects of the global transcriptional regulation (100). Thus, the DNA array-based technology facilitates the identification of genes associated with particular condition and provides insight into various biological processes of an organism (84). Some of the microarray applications include elucidating the metabolic and biosynthetic pathways of adaptation and identifying co-regulated genes (16). Recently, microarray has been used to study microbial communities in several environmental habitats, including soils (90) and fecal samples (27). To detect the changes in gene expression, mRNA is first isolated from the organism or tissue being studied. Subsequently, mRNA is reverse transcribed into cDNA and labeled with fluorescent dyes, such as cy3 and cy5. The microarray slides containing probes are hybridized to the labeled target and are later washed to remove excess hybridization solution from the array and to reduce cross-hybridization (114). The hybridized spots are detected by a laser scanning, which excites each dye to fluoresce. The emitted light is then converted to a digital signal and analyzed using statistical programs, such as ArrayPipe. Differences in the expression of particular sequences can be further validated using other methods, such as northern blot, Quantitative PCR, etc. 22 The microarray used in this project is the oligonucleotide microarray, which was printed by the Gene Array Facility at the Prostate Cancer Center in British Columbia. The microarray format consists of 70-mer oligonucleotides immobilized on the chip. The oligonucleotide probes correspond to 8,975 RHA1 open reading frames (ORFs), which account for approximately 96% of the total ORFs in the RHA1 genome. 1.4 Objectives This thesis is a part of a global study of stress responses and their underlying molecular mechanisms in Rhodococcus sp. RHA1, which ultimately will facilitate its use in environmental, bioremediation applications. The main focus of this thesis is to investigate the mechanisms by which RHA1 responds to heat shock and osmotic stress, including: 1) The identification of heat shock proteins, two-component systems, transporters, ff-factors and partial characterizations of their possible regulons, and regulatory elements. 2) The identification of any novel mechanisms of protection from heat shock and osmotic stress, such as osmoprotectants, modifications of the cell wall or cell envelope, and additional adaptations. 3) The comparison of the heat shock and osmotic stress responses of RHA1, as well as the responses of RHA1 compared to other organisms. 23 2 MATERIALS AND METHODS 2.1 Bacterial strains, media, and growth RHA1 was grown on W medium plates with some biphenyl crystals. W medium (per liter) is composed of 1.7 g K H 2 P 0 4 , 9.8 g Na 2 HP0 4 , 1.0 g (NH 4) 2S0 4 , 0.1 g MgS0 4 -7H 2 0, 0.95 mg FeS0 4-7H 20, 10.75 mg MgO, 2.0 mg CaC0 3 , 1.44 mg ZnS0 4-7H 20, 0.25 mg CuS0 4-5H 20, 0.28 mg CoS0 4-7H 20, 0.06 mg H 3 B 0 3 , and 51.3 fiL concentrated HC1 (20). For solid media, agar was added at a concentration of 1.5%. Isolated colonies grown from the plate were inoculated into 50-mL liquid W medium supplemented with 20 mM sodium benzoate (CeFLjCOONa) in 250-mL Erlenmeyer flasks. 1% of the liquid culture was subsequently used to inoculate 600-mL liquid W medium with 20 mM sodium benzoate in a 2-L flask, which was shaken at 200 rpm. The incubation temperature was 30°C. Sterile salt was prepared by autoclaving sodium chloride (NaCl) wrapped in aluminum foil. Sterile salt was added to the culture at mid-log phase. The growth was determined by measuring optical density at 600 nm and the growth rates from triplicate cultures were used to estimate the growth rates, which were calculated according to the following equation: Growth rate = (In ODi- In OD 2 )/Ti-T 2 . 2.2 Stress conditions and sampling 600-mL RHA1 cultures were grown up to mid-log phase (OD6oo 1.8-2.0) in W medium supplemented with 20 mM sodium benzoate at 30°C. To generate an osmotic stress, 0.6 M NaCl was added directly to the mid-log cells and samples were collected at 24 0 minute (min) (prior salt addition), 15 min, 30 min, 1 h, 2 h and 3 h after salt addition. These time points were chosen to track rapid transcription of ff-factors, Hsps, chaperones, two-component systems, and transcriptional regulators, as well as the later response of osmoprotectant synthesis enzymes, transporters and any unexpected genes. In addition, some of these time points were chosen to match the changes in the growth curve. The heat shock was achieved by placing the mid-log culture in a waterbath shaker at 35°C. After the temperature inside the flasks reached 35°C (~5 min), the time point was considered as 0 min. Subsequently, samples were collected at the same time points as for the osmotic stress so the gene expression from two stresses could be directly compared. The control cultures were sampled at 15 min, 30 min, 1 h, 2 h and 4 h after the mid-log phase to distinguish genes that were differentially expressed due to a transition from mid-log to stationary phase rather than the stress responses. Optical density at 600 nm and colony forming units were measured until the cells reached the beginning of stationary phase. At the end of the experiment, a small aliquot of culture from each flask was plated on a LB plate to verify that there was no contamination. Each stress treatment was performed three times. 2.3 Cell harvesting and RNA extraction All protocols in the section below were developed by Goncalves (32) and were proceeded with some modifications. To preserve RNA, "stop solution" composed of 5% phenol pH 5.0 in 100% ethanol was chilled on ice and was added to the cultures. Cells were immediately centrifuged at 7,400 x g for 10 min at 4°C. 500-piL of supernatant was used to resuspend cell pellets and 1.0 mL "RNA protect" (Qiagen) was added according 25 to the manufacturer's instructions. The cell mixture was vortexed gently for ~5 sec, left at room temperature for 5 min and centrifuged at 10,000 x g for 5 min. The supernatant was discarded and the cell pellets were immediately frozen in liquid nitrogen and stored at -80°C. Glass beads and phenol pH 5.0 were used to break cell walls and extract total RNA. Cell pellets from 6-mL cultures were resuspended in 2 mL of cold DEPC-treated water with 5 mM E D T A and transferred to a 50-mL falcon tube. Cold phenol pH 5.0 and SDS were added at final concentrations of 0.25% and 1.25% (v/v), respectively. Glass beads (3 mm diameter) were added until the total volume reached 10 mL. The tubes were placed in a water bath at 64°C for 1 min and vortexed for another minute. The water bath and vortex treatments were repeated 5 times. Before being transferred to a water bath and vortexed as previously described for another 10 min, 0.07 mL of 3 M sodium acetate (pH 5.4) and equal volume of phenokchloroform were added to each sample. The liquid was transferred to a new 15-mL falcon tube and phenol-chloroform extraction was performed. Briefly, cells were centrifuged at 7,400 x g for 10 min at 4°C to recover the upper phase. One-tenth volume of 3.0 M sodium acetate and equal volume of isopropanol were added at room temperature to precipitate RNA. The liquid was equally transferred to 1.5-mL eppendorf tubes and were centrifuged at 10,000 x g for 25 min at 4°C. The supernatant was removed and the tubes were left at room temperature for 5 min. Lastly, 200 /xL of DEPC-water was added to each sample. 2.4 DNase treatment and RNA purification 26 DNase treatment was performed according to the manufacturer's instructions (Invitrogen). Briefly, 80 U RNase inhibitor, 25 /xL DEPC-treated water, 25 /xL 10X DNasel buffer (200 mM Tris, pH 8.4, 20 mM MgCl 2 , 500 mM KC1) and 15 U RNase-free were added to 200 /xL RNA sample. The mixture was incubated for 1 hour (h) at 37°C and was immediately purified using the RNeasy Mini Kit (Qiagen). The following components were added to the DNase treated samples; 750 /xL RLT buffer, 7.5 /xL, /3-mercaptoethanol (98%), and 250 /xL ethanol (100%). Samples were mixed by pipetting and loaded onto RNeasy mini columns, which had been placed on 2-mL collection tubes. Samples were centrifuged for 15 sec at 8,900 x g and the flow-through was discarded. Then, 700 /xL buffer RW1 was added and the sample was centrifuged for 15 sec at 8,900 x g. Subsequently, the column was transferred into a new 2 mL collection tube. RPE buffer (500 /xL) was added to the column and the sample was centrifuged for 15 sec at 8,900 x g. This step was repeated, except that samples were centrifuged for 2 min to dry the RNeasy silica-gel membrane. To elute the RNA, the column was transferred to a new 1.5-mL tube and DEPC-treated water (20 /xL) was added. Samples were incubated at room temperature for 3 minutes and centrifuged for 1 min at 8,900 x g. Additional DEPC-treated water (20 /xL) was added, followed by centrifugation for 1 minute at 8,900 x g. The amount of RNA extracted was quantified by measuring absorbance at 260 nm. 2.5 cDNA synthesis and labeling 27 Amounts of 1.5 rig random hexamers (Invitrogen) were added to 6 [ig of purified RNA and the total volume was brought to 13.3 /xL using DEPC-treated water. The RNA mixture was denatured at 70°C for 10 min in a thermocycler and chilled on ice for 5 min. The following components were added to the RNA mixture to synthesize cDNA: 3 mM each dCTP, dATP, dGTP; 1.2 mM dTTP; 0.01 mM DTT; 1.8 mM amino-allyl dUTP; 40 U cloned RNase inhibitor (Ambion); 6 riL 5xRT buffer and 380 U reverse transcriptase Superscript II (Invitrogen). The samples were placed in a thermocycler at 42°C for 2 h. Amounts of 10 pL 1.0 N NaOH and 10 uL 0.5 M E D T A were added and left at 65°C for 30 min. Subsequently, 25 uL HEPES (1.0 M , pH 7.5) was added. Samples were purified and concentrated using a Microcon YM30 column (Eppendorf) under vacuum. cDNA probes were indirectly labeled by reverse transcription using the amino-allyl dUTP (Amersham-Pharmacia). Initial samples (0 min) were labeled with Cy5 and the post-stress samples were labeled with Cy3 in two experiments, and the labels were reversed for the third experiment. The coupling of either Cy3 or Cy5 dyes to the cDNA was performed according to the manufacturer's instruction (Ambion). Briefly, cDNA was mixed with 4.5 uL of fresh sodium bicarbonate pH 9.0. Amounts of 4.5 uL Cy dyes, which were resuspended in DMSO, were added to the mixture and incubated for 1 h in the dark at room temperature. The QiaQuick PCR purification system (Qiagen) and a Microcon YM30 column were used to purify and to concentrate the labeled probe, respectively. The labeled probe was spotted on a glass slide and scanned at 580 and 670 28 nm, using a Typhoon scanner (Amersham Pharmacia). The signals from scanned slides were measured using ImageQuant 5.2 software (Molecular Dynamics). 2.6 Microarray hybridization and data analysis Microarray slides were gently washed twice in 0.1% SDS for 5 min using a shaker and subsequently washed in nanopure water five times for 1 min each in different staining jars. Buffer composed of 5x SSC, 0.1%SDS and 0.2% BSA was pre-warmed at 48°C and used to pre-hybridize the microarray slides for 45 min. Slides were immediately used for a 18-h hybridization in a GeneTac HybStation (Genomic Solution) at 42°C. Equal amounts (50 million pixels) of Cy3 and Cy5 plus 120 uL of SlideHyb#l hybridization solution (Ambion) were used for each slide. After hybridization was completed, slides were rinsed 3 times for 20 sec each in the following solutions; medium stringency solution (2x SSC plus 0.1% SDS) at 42°C; high stringency solution (O.lx SSC plus 0.05% SDS) at 25°C and low stringency solution (O.lx SSC) at 25°C. Slides were then removed from the HybStation and were centrifuged for 5 min at 350 x g at room temperature to dry. Lastly, slides were scanned and the signal intensities were quantified using GenePix 4000B scanner (Axon Instruments) and Imagene 6.0 (BioDiscovery, Inc.), respectively. The statistical analysis was done using ArrayPipe, a web-based tool for microarray data analysis developed by the Genome Canada Pathogenomics project (54). It provides the flexibility for users to select an analysis method that is the most appropriate for particular experiment (54). Various steps were performed as follows. 29 The background (non-specific) signal was subtracted for each dye using the 'by-subgrid B G correction' option. This method removed the median signal intensity from 10% of all probes that had the lowest intensity, within a corresponding subgrid. Total signals were normalized to adjust for dye bias using the Lowess method. The underlying assumption was that most of the genes had equal signal intensities and were equally expressed. Duplicated spots on the same array were averaged* prior to averaging replicate arrays. A N O V A was performed to select for probe signals that exhibited a p-value less than 0.05. These data is being submitted to the Gene Expression Omnibus, which is a part of the national center for biotechnology information (http://www.ncbi.nlm.nih.gov/geo/). Genes were considered statistically significant if they exhibited both an expression ratio (signal intensity of sample divided by signal intensity of the corresponding initial sample) of greater than two and a p-value less than 0.05. Hierarchical clustering and /T-means clustering were done using MeV: MultiExperiment Viewer (MeV) software (http://www.tm4.org/mev.html). 2.7 Real-Time Quantitative PCR (QPCR) RNA samples of 1 \xg, collected at 0 min (before stress; control) and 15 min after stress, were reverse-transcribed to cDNA using the Thermoscript RT-PCR System (Invitrogen Life Technology). The following components from the kit were added to the RNA samples; 1 fiL each 0.1 M DTT and 40 XJ/fiL RNaseOUT; 4 jiL 5x cDNA synthesis buffer, and the final volume was brought to 20 /xL with DEPC-water. The following steps were performed; 5 min at 65°C, 10 min at 25°C, 30 seconds (sec) for each 0.5°C 30 increase from 45°C to 60°C, and 5 min at 85°C. 1.0 /xL-RNase was added prior incubation at 37°C for 20 min. Forward and reverse primers of ro04728 and ro01702 were designed according to the default parameters of the software Primer Express version 2 (Applied Biosystems). TaqMan probes (Applied Biosystems) specific to ro04728 and ro01702, were used to quantitatively measure the rate of PCR amplification as it occurred cycle-by-cycle. The probe combination (Table 2.1) was used as follows: 6FAM (5'reporter) for ff-factor and VIC (5'reporter) for the internal control, using T A M R A as quencher for both probes in the same tube (32). Amounts of 2 /xL cDNA were used for real-time PCR reaction in the Mx3000P™ QPCR system (Stratagene). The following conditions were used; 10 min at 95°C, 40 cycles of 15 sec at 95°C and 1 minute at 60°C (32). All reactions were done in triplicate, and the data were normalized using the average of the internal control. The relative quantification was determined using the post-stress samples compared to the 0 minute time point. Subsequently, the relative quantification was compared to the relative fold change from microarray data. 2.8 Scanning Electron Microscopy Samples of RHA1 were collected immediately before and 30, 60, 120 min after the treatments. Scanning electron microscopy (SEM) examination was done according to the microwave-fixation protocol of the Bioimaging Facility at UBC. Cells were centrifuged for 30 sec at 10,000 x g at room temperature, and the medium was removed. For fixation, 10% glutaraldehyde in W medium was added to the samples and incubated 31 for 1 h at room temperature. Subsequently, cells were collected on a filter and rinsed with 0.1 M cacodylate buffer pH 7.33. Samples were placed in the microwave set at 28°C and heated at power level of 200W for 40 sec. This step was repeated three times. Cells were then stained using 0.1% osmium tetroxide in 0.1 M cacodylate buffer. Filters containing cells were placed in the microwave set at 28°C and heated twice at power level of 100W for 2 min. Samples were rinsed with distilled water and dehydrated using increasing concentrations of ethanol (50%, 70% and 95%, 3 times of 100%) and hexamethyldisilazane (HMDS). Filters were dried in a 60°C oven for 5 min until all the HMDS evaporated. Finally, samples were coated with gold using Nanotech SEMPrep II Sputter Coater, (Nanotech (Thin Films) Ltd., Prestwich, Manchester) and examined under a scanning electron microscope Hitachi S-2600 VPSEM for physiological changes such as morphology, shape and size. Table 2.1 Primers and probes for Taq-Man quantitative PCR assays Target gene Primers & probe sigF sense primer 5 ' A A T C A C T T C C C G A C C T C G A A 3 ' anti sense primer 5 ' G G G T C A T G T T G C C G A A G A A 3 ' probe (6FAM)CACCGTGCTGGTCC(TAMRA) DNApol IV sense primer 5 ' G A C A A C A A G T T A C G A G C C A A G A T C 3 ' anti sense primer 5 ' C C T C C G T C A G C C G G T A G A T 3 ' probe (VIC)CGACGGACTTCGGCAAACCGC(TAMRA) 32 3 RESULTS 3.1 Growth of RHA1 during temperature and osmotic stress Prior to conducting experiments investigating the effects of heat shock and osmotic stress on gene expression in RHA1, it was important to examine the effects of temperature and NaCl concentration on RHA1 growth so the temperature and NaCl concentration that best represented stress conditions could be determined. The optimal substrate concentration was also determined so that starvation or substrate toxicity effects on RHA1 growth could be excluded as possible stress factors. Optical densities and viable cell counts were measured to monitor growth. 3.1.1 Determination of the substrate concentration for growth experiments To ensure that the only stresses on the cells are heat shock and osmotic stress, the substrate concentration had to be such that the cells would not experience starvation or inhibitory effects due to substrate toxicity. RHA1 was grown at 30°C in W medium supplemented with sodium benzoate at various concentrations: 10, 20, 30 and 40 mM (Figure 3.1). The maximum ODs were 1.5, 2.4, 3.0 and 3.1 at the sodium benzoate concentrations of 10, 20, 30 and 40 mM, respectively. The highest and lowest growth rates were at 20 and 40 mM benzoate, respectively. As 20 mM sodium benzoate was determined to be the optimal substrate concentration among the concentrations tested, it was used in the growth experiment. 33 0.05 -j 0 -I , 1 . . 1 0 10 20 30 40 50 Sodium benzoate concentration (mM) Figure 3.1 Growth rate of RHA1 grown at 30°C in W medium containing sodium benzoate concentrations of 10, 20, 30, and 40 mM (n = 3; bars indicate standard deviation). Cells were precultured in W medium with 20 mM sodium benzoate. 3.1.2 Determination of which temperatures are appropriate for normal and stress conditions To determine which temperature is optimal for RHA1 growth, and which is limiting, the range of temperatures under which RHA1 can grow was investigated. RHA1 was grown at 10, 15, 30, 33, 35, 37 and 40°C (Figure 3.2). The cultures were left incubated for up to one week. Cultures were checked for growth by measuring the OD6oo- PvHAl grew at temperatures between 15°C to 33°C, based on the temperatures examined. The highest growth rate was observed at 30°C, with growth rates quickly falling to negligible levels by 35°C. This result suggested that 30 and 35°C are 34 appropriate temperatures to grow RHA1 under normal and heat shock conditions, respectively. 0.3 Temperature ( d e g r e e s C e l s i u s ) Figure 3.2 Growth rate of RHA1 in W medium with 20 mM sodium benzoate at 10, 15, 30, 33, 35, 37 and 40°C (n = 3; bars indicate standard deviation). Cells were pre-cultured in the same medium at 30°C. *, no growth within one week 3.1.3 The effect of shifting the temperature from 30°C to 35°C on exponentially-growing RHA1 To investigate the transcriptional responses of RHA1 to heat shock, it was important to first investigate the effect of the stress on growth and viability. RHA1 was grown to mid-log phase in an incubator at 30°C, and was then immediately switched to a waterbath shaker at 35°C, whereas the control culture remained shaking in the 30°C 35 incubator. The treated culture did not reach the same OD600 in the stationary phase as the control culture (OD600 2.75 compared to OD600 3.25) (Figure 3.3, top panel). The OD600 of the treated culture increased in a manner similar to the control culture after the shift to 35°C, yet the number of viable cells in the treated culture only increased during the first two hours following the stress (Figure 3.3, bottom panel). And after 3 h, the number of viable cells decreased dramatically until there were no viable cells remaining. This result indicates that shifting the temperature to 35°C is stressful to RHA1 cells, permitting growth to continue for only a few hours and then being lethal. Thus, cells were heat shocked at 35°C for the heat-shock transcriptomic analysis. 36 4.0 3.5 3.0 2.5 | 2.0 O 1.5 1.0 0.5 0.0 2.50E+08 _ 2.00E+08 - OD control - H — OD treatment 30°C to 35°C i r 25 30 35 40 45 50 55 60 65 70 75 T i m e (h) E 5 1.50E+08 « 1.00E+08 > O 5.00E+07 0.00E+00 - • — c e l l viabil i ty contro l - H — c e l l viabil i ty t reatment 30°C to 35°C 25 30 35 40 45 50 55 60 65 70 75 T i m e (h) Figure 3.3 Growth curve (measured as optical density) and cell viability (measured as colony forming units) of RHA1 grown to mid-log phase in W medium with 20 mM sodium benzoate and stressed by shifting the growth temperature from 30°C to 35°C (n = 3; bars indicate standard deviation). Cells were pre-cultured at 30°C on the same medium. Arrow indicates the time at which the cultures were switched to a 35°C waterbath shaker. 37 3.1.4 Determination of the concentration of NaCl which limits RHA1 growth Before the limits of RHAl's tolerance to added NaCl could be determined, it was necessary to find the NaCl concentration at which RHA1 cannot grow. The growth rates of RHA1 cells, grown for one week in medium containing various concentrations of NaCl (0.1, 0.25, 0.5 and 1.0 M), were determined (Figure 3.4). RHA1 cells in the control culture (no NaCl added) exhibited highest growth rate. RHA1 could only grow in the medium containing 0, 0.1 and 0.25 M NaCl, indicating that NaCl concentrations of 0.25 M to 0.5 M are limiting to RHA1 growth. The growth rate of RHA1 cultured in medium containing 0.1 and 0.25 M was similar even though a longer lag period was observed in medium containing 0.25 M NaCl (data not shown). Based on this experiment, 0.5 M NaCl or higher should be added to exponentially growing RHA1 cells to see the effects on growth curves. 38 Figure 3.4 Growth rate of R H A 1 grown at 30°C in W medium containing 20 m M sodium benzoate plus 0, 0.1, 0.25 and 0.5 M N a C l (n = 3; bars indicate standard deviation). 3.1.5 Effect of NaCl on exponentially-growing RHA1 To determine the appropriate N a C l concentration to induce osmotic stress, it is important to examine growth curves and growth rates following the stress. 50 m L - R H A l cultures were grown to mid-log phase and various N a C l concentrations were added to each flask. Growth rates were calculated using the ODeoo following the stress. In general, growth rates decreased as N a C l concentrations increased (Figure 3.5). Based on these data, I decided to use less than 1.0 M N a C l to treat the cells, since the growth rate of the 1.0 M N a C l - treated cells is approximately four times slower than the control culture. The appropriate N a C l concentrations were narrowed to concentrations of 0.5 M to 0.75 M N a C l . Growth curves and cell viability were considered in addition to growth rates to help decide the appropriate N a C l concentration for osmotic stress. Exponentially growing R H A 1 cells treated with 0.5 M N a C l did not display decreases in OD6oo- h i 39 contrast, RHA1 cells subjected to 0.6 M and 0.75 M NaCl exhibited slight declines in OD600 during the first 2 hours post-stress (Figure 3.6). It was concluded that RHA1 cells with 0.6 or 0.75 M NaCl added were able to adapt and eventually grow to similar OD600 at stationary phase as the control culture. The number of viable cells from 0.6 M and 0.75 M NaCl-treated samples were counted, and the lethality immediately following NaCl addition was ca. 10% and ca. 30%, respectively (data not shown). Since the objective was to isolate primarily live cells that were able to adapt to the osmotic stress, I decided to stress the cells with 0.6 M NaCl. Figure 3.5 Growth rate of RHA1 at 30°C in W medium with 20 mM sodium benzoate, following addition at mid-log phase of varied concentrations of NaCl (n = 3; bars indicate standard deviation). Cells were pre-cultured at 30°C on the same medium. 40 Q O 25 35 45 55 Time (h) 65 75 Figure 3.6 Growth of RHA1 stressed at mid-log phases with 0.5 (•), 0.6 ( A ) or 0.75 (•) M NaCl (n = 3; bars indicate standard deviation). Culture conditions were the same as for Figure 3.5. Arrows indicate the time at which 0.5, 0.6, and 0.75 M NaCl were added to the respective flasks. 3.2 Genomic Analysis of potential heat shock and osmotic stress responses in RHA1 The RHA1 genome contains numerous genes potentially involved in heat shock and osmotic stress responses. Analysis of the Rhodococcus sp. RHA1 genome was based on the genome sequence (82) and Generic Utility for Research Unification (GURU). GURU is the genomic software used to store and manage the annotation data of all ORFs of RHA1, and any information related to these ORFs 41 (http://www.rhodococcus.org/annotation/). Genes potentially related to heat shock encode 17 Hsps and 13 chaperones. Multiple homo logs of genes encoding the DnaK complex were identified, including 7 dnaK, 6 dnaJ and 4 grpE; whereas, a few genes are related to the GroE complex: 2 groEL {ro00448 and ro02146) and 1 groES (ro06189) the GroE complex. In addition, there are many clusters of Hsp and chaperone genes that appear to be transcribed polycistronically. Examples include groups of ORFs arranged in order from ro03566 to ro03568 (encoding Hsp, a hypothetical protein and a possible DnaJ), ro05497 to ro05500 (encoding DnaK, GrpE, DnaJ and probable Hsp), ro06702 to ro06710 (encoding a probable thioredoxin, ClpA, ClpB, DnaJ, GrpE, DnaK, Hsp90 and two hypothetical proteins), ro06936 and ro06937 (encoding DnaK and GrpE), and ro08365 to ro08367 (encoding DnaK, GrpE and DnaJ). The presence of these genes indicates the possibility that RHA1 exhibits the classical heat shock response as was described in the introduction. A total of 40 protease genes are also annotated, 12 of which belong to the Clp protease class. Sixteen ORFs are annotated as genes encoding universal stress proteins. Genes that are potentially related to osmoadaptation are also present. The RHA1 genome encodes 75 ATP binding cassette (ABC) superfamily transporters and 155 MFS transporters. Twelve ORFs are annotated as genes encoding K + channels. The kdpABCDE operon encoding a K + channel was found on the chromosome of RHA1. KdpABC (ro01232, ro01231 and ro01230) comprises the ATPase subunit, whereas KdpDE (ro01229 and ro01228) encode a sensor kinase and response regulator, respectively. Probable Trk systems were annotated (ro06834, ro06835 and ro00062), suggesting that both Kdp and Trk systems exist in RHA1. Genes encoding 8 42 proline/betaine transporters are also found. There is only one gene annotated as a possible large-conductance MS channel (ro05628). Genes were found encoding several pathways for compatible solute biosynthesis, including trehalose, glycine betaine, glutamate, ectoine, and proline biosynthesis. Thus, RHA1 is hypothesized to synthesize various types of osmoprotectants when under osmotic stress. Finally, several genes are potentially involved in regulation of stress responses. There are genes encoding 33 complete two-component systems and 7 isolated genes encoding one component of a two-component system. There are genes encoding 34 o-factors, 6 anti a-factors, and 3 anti-anti a-factors. A gene (ro01247) encoding a heat-inducible transcription repressor, HrcA, was found. Five ORFs (ro05500, ro04731, ro04729, ro08349, ro03565) have greater than 40% identity to the HspR transcription repressor of S. coelicolor. Homologues of RheA and CtsR repressors were not found. 3.3 Heat shock and osmotic stress transcriptomes The main objective of this thesis is to look at global responses of RHA1 to environmental stresses at the transcriptional level. Each transcriptome was initially analyzed separately to look at individual mechanisms of adaptation. Subsequently, two stresses were compared to identify genes that were common or specific to each stress responses. 43 3.3.1 Transcriptomic analysis of the heat shock response The analysis revealed 598 genes whose expression differed significantly at one or more time points following heat shock, relative to expression immediately preceding heat shock (2-fold difference and P <0.05). During the time course following heat shock, 438, 114 and 46 genes that were up-, down- and both up- and down-regulated, respectively (Figure 3.7). Approximately 34% of highly up-regulated genes were hypothetical, indicating that a substantial part of the heat shock response remains to be identified. The highest number of genes up-regulated occurred 3 h post-stress, just prior to a rapid loss of viability. It is possible that heat shock initiated a cascade of gene regulation. The effect of heat shock was quite dramatic, because there were many genes that were continuously repressed or induced, as seen in the heat map (Figure 3.8a). Cluster analysis revealed groups of genes with shared expression patterns. K-means clustering (K = 15) of genes that exhibit P < 0.05 revealed four clusters containing a total of 144 genes that were induced or repressed at least 8-fold (Figure 3.9). The first set of genes (cluster A) contains down-regulated genes that are related to transcription, translation and metabolism, encoding ATPases (ro01472, ro01474 and ro07198), ribosomal proteins (ro00961, ro06149, ro06151 and ro06152), a methionyl aminopeptidase (ro06155), the DNA-directed RNA polymerase alpha subunit (ro06162), a possible aldehyde dehydrogenase (ro07116) and a NAD(P)H-dependent reductase (ro09064) (Table 3.1). Cluster B is comprised of genes that were up-regulated at early time points and then remained relatively steady or slightly decreased in expression throughout the time-course experiment. This group encodes some Hsps (ro03566, 44 ro08348 and ro08365), a probable helicase (ro01653), a possible vanillate monooxygenase subunit (ro04165), and various enzymes involved in metabolism (ro05409, ro05917, ro05973, ro06073 and ro07119). Other Hsps were up-regulated transiently and became non-differentially expressed by 45 min (ro00448, ro05497, ro05498, ro06937 and ro08361), which is consistent with a typical heat shock response. There are 64 genes grouped into cluster C, which is the largest cluster. These are the ones that gradually increased their expression level, encoding a probable ATPase involved in cell division (ro02161), phenol hydroxylases (ro02379, ro02513 and ro02514), a phenol 2-monoxygenase (ro02380), a DNA polymerase III subunit (ro04199), a ligase (ro05407), an oxidoreductase (ro08631), a possible mycobacteriophage excisionase (roll261), as well as possible fatty-acid-CoA ligase (ro08419). The diverse functions of members within cluster C may reflect generalized damage and malfunction as the cells lost viability. Heat shock may have indirectly led to additional stresses, such as oxidative stress and destabilization of intracellular membrane. Cluster D includes genes highly up-regulated at early timepoints but returning to pre-treatment expression ratios at later timepoints. Interestingly, many of the phenylacetic acid degradation genes (ro02855, ro02858, ro02860 and ro02864) are in cluster D. 45 500 450 400 w 350 o Jl 300 H 0 250 4. 0) 1 200 z 150 100 50 0 438 80 Up-regula ted 114 64 • Heat shock • Osmotic stress 72 Down-regula ted G e n e e x p r e s s i o n Up- a n d down-regulated Figure 3.7 Number of genes whose expression was significantly different at one or more time points following heat shock than just prior to heat shock ( > 2-fold difference and P < 0.05) in heat shock (•) or osmotic stress (•). 4 6 Figure 3.8 Heat maps of transcriptomes associated with heat shock (a) or osmotic stress (b), showing genes that were significantly different at one or more time points following the stress than immediately prior to stress ( > 2-fold difference and P < 0.05). Color scale indicates log2 of average normalized expression ratio (time post-treatment / immediately pre-treatment), with genes color-coded as follows: red, up-regulated; green, down-regulated; black, equally expressed. Clusters of genes discussed in the text are shown. 47 Selected Clusters for Heat Shock o -'.5 o g ^ 8 * - I I I I I I : A - 1 1 1 1 1 1 i i i i i i 1 1 1 1 1 1 i i i i i i : c - 1 1 I I I I -1 1 1 1 1 1 i i i i i i Time (min) Figure 3.9 Expression of genes in selected clusters from the heat shock experiment shown in Figure 3.8a. Horizontal lines represent the average gene expression ratio, and bars, the standard deviation. Table 3.1 Selected clusters of genes that are differentially expressed following heat shock ( > 8-fold difference and P < 0.05; n = 3). Cluster Gene ID Gene name Gene annotation ro00861 Multidrug resistance transporter, MFS superfamily ro00961 rplT 50S ribosomal protein L20 ro01037 nadB L-aspartate oxidase ro01472 atpD H(+)-transporting two-sector ATPase beta subunit ro01474 atpA H(+)-transporting two-sector ATPase alpha subunit ro01599 A B C transporter, permease component ro01716 possible MaoC dehydratase ro02141 Prolyl oligopeptidase ro02432 possible membrane protein ro02652 possible ferredoxin ro02722 possible phosphotransferase ro02992 probable inositol 2-dehydrogenase ro02993 Conserved hypothetical protein ro02998 sugar transporter, MFS superfamily ro03326 possible CBS domain-containing protein ro03602 Conserved hypothetical protein ro05445 GDP-L-fucose synthase ro05453|ro05448a probable protein-tyrosine kinase ro05524 benE benzoate membrane transport protein BenE ro06149 rplR 5OS ribosomal protein LI 8 ro06151 rpmD 50S ribosomal protein L30 ro06152 rplOl 50S ribosomal protein LI 5 ro06153 secY Preprotein translocase ro06155 Methionyl aminopeptidase ro06162 rpoA DNA-directed RNA polymerase alpha subunit ro06488 ilvC ketol-acid reductoisomerase ro06587 Conserved hypothetical protein 4 ^ Cluster Gene ID Gene name Gene annotation ro07116 possible aldehyde dehydrogenase, N-terminal ro07168 ribD Riboflavin biosynthesis protein RibD reductase ro07198 sufC FeS assembly ATPase ro08803 probable tartrate dehydrogenase/ 3-isopropylmalate dehydrogenase ro09064 NAD(P)H-dependent reductase B ro00105 Conserved hypothetical protein ro00677 possible extracellular protein ro00758 hypothetical protein ro01050 possible succinate dehydrogenase ro01653 probable helicase ro01833 Conserved hypothetical protein ro02500 Conserved hypothetical protein rc-02749 possible Mce family protein ro02859 paaG phenylacetic acid degradation ring hydroxlyating complex protein 1 ro03412|ro00705a Conserved hypothetical protein ro03566 heat shock protein ro04165 possible vanillate monooxygenase oxygenase subunit ro04616 Conserved hypothetical protein ro04739|ro04740a hypothetical protein ro04791 A B C transporter, ATP-binding component ro05409 Riboflavin biosynthesis protein ro05917 probable N A D H dehydrogenase subunit I ro05973 probable rRNA (guanine-N(l)-)-methyltransferase ro06073 probable FMN-dependent (S)-2-hydroxy-acid oxidase ro06328 Conserved hypothetical protein ro07119 acyl-CoA dehydrogenase ro08347|ro03567a hypothetical protein ro08348 heat shock protein (18 kDa antigen-like protein) ro08365 dnaK4 heat shock protein Hsp70 Cluster Gene ID Gene name Gene annotation ro08398 Conserved hypothetical protein C ro00322 leuBl 3-isopropylmalate dehydrogenase ro00480 hyuB Hydantoin utilization protein B ro00523 probable methylenetetrahydromethanopterin reductase ro00543 dihydrolipoyllysine-residue succinyltransferase ro00554|ro00637a hypothetical protein ro00636|ro00553a Conserved hypothetical protein ro00670 possible IS element ATP-binding protein ro01061 hypothetical protein ro01258 Conserved hypothetical protein ro01942 probable adenylate cyclase ro01999 probable siderophore interacting protein ro02161 probable ATPase involved in cell division ro02257 Conserved hypothetical protein ro02281 Conserved hypothetical protein ro02379 Phenol hydroxylase, reductase component ro02380|ro08077a Phenol 2-monoxygenase, oxygenase component ro02513 pheA2 Phenol hydroxylase, reductase component ro02514|ro08077a pheAl Phenol hydroxylase, oxygenase component ro02520 hypothetical protein ro02625 hypothetical protein ro02735 probable 3-oxoacyl-[acyl-carrier-protein] reductase ro03199|ro00116a possible resolvase, N-terminal ro03402 transcriptional regulator, TetR family ro03409|ro00708a possible gas vesicle synthesis protein ro03522 possible glycosyltransferase ro03565 transcriptional regulator, MerR family ro03604 transcriptional regulator, GntR family ro04199 DNA polymerase III subunit o Cluster Gene ID Gene name Gene annotation ro04243 Conserved hypothetical protein ro04244 Flavin binding monooxygenase ro04496 A B C transporter, ATP-binding component ro04800 pyk4 pyruvate kinase ro05162|ro03897a Conserved hypothetical protein ro05169 Conserved hypothetical protein ro05335 giyA3 Glycine hydroxymethyltransferase ro05340 Conserved hypothetical protein ro05378 possible glycosyl transferase ro05407 Ligase ro05646 Conserved hypothetical protein ro05883 possible membrane protein ro05989 A B C sugar transporter, permease component ro06226 Conserved hypothetical protein ro06436 NADPH-dependent F M N reductase ro06625 Conserved hypothetical protein ro06817 Conserved hypothetical protein ro07096 Conserved hypothetical protein ro07152 carB carbamoyl-phosphate synthase large subunit ro08085 bphE3 2-oxopent-4-enoate hydratase ro08175|rol0200a tpaR transcriptional regulator, IclR family ro08314 D-lactate dehydrogenase (cytochrome) ro08399 Conserved hypothetical protein ro08419 possible fatty-acid-CoA ligase ro08615 possible DNA hydrolase ro08631 Oxidoreductase ro08861 Conserved hypothetical protein ro08956 Conserved hypothetical protein ro 10056 Conserved hypothetical protein Cluster Gene ID Gene name Gene annotation ro 10060 Conserved hypothetical protein rol0108 rhodococcal conserved hypothetical protein rol0333 hypothetical protein roll261 possible mycobacteriophage excisionase roll324 rhodococcal conserved hypothetical protein roll331 probable transcriptional regulator, LuxR family D ro00238 Conserved hypothetical protein ro00609 dadAl D-amino acid dehydrogenase small chain subunit ro02855 paaK phenylacetic acid degradation ring hydroxylating complex protein 5 ro02858 paaH phenylacetic acid degradation ring hydroxylating complex protein 2 ro02860 paaB Enoyl-CoA hydratase ro02864 paaN aldehyde dehydrogenase ro03031 transcriptional regulator, GntR family ro03421 Conserved hypothetical protein ro04568 possible glycosidase ro04695 probable 3-oxoacyl-[acyl-carrier-protein] reductase ro04926 gluconate permease ro05077 probable CoA-transferase ro05134 Conserved hypothetical protein ro05497 dnaKl heat shock protein Hsp70 ro06112 Conserved hypothetical protein ro08582 Conserved hypothetical protein ro08624 probable acetoin dehydrogenase beta subunit rol0433 probable Xaa-Pro dipeptidase ro 11207 Conserved hypothetical protein ro 11208 Conserved hypothetical protein roll210 probable copper-exporting ATPase a Probe lacks specificity due to high similarity of genes to 53 To focus on genes that are likely involved in the heat shock response per se and not associated with the subsequent loss of viability, genes that were differentially expressed within 30 min of heat shock were further analyzed. Many genes were found in addition to those obtained from the cluster analysis. 30 min was chosen to be the cut off time point based on many transcriptomic analyses found in the literature (29, 62, 114). Clusters of orthologous groups (COGs) analysis was done to investigate if there were any categories that were particularly changed due to the stress. There were 261 genes that were up- and 106 genes that were down- regulated within 30 min. Approximately half of those genes do not have any assigned COGs or have more than one COGs. Only those that having only one assigned COGs were graphed (Figure 3.10). Based on COGs of genes associated with heat shock response, most of the genes that were differentially expressed within 30 min were genes related to energy production and conversion, followed by genes related to lipid transport and metabolism, and transcription. Many genes classified as lipid transport and metabolism genes were likely involved in fatty acid biosynthesis and metabolism, and they were induced within 30 min. • O s m o t i c s t ress • Hea t shock S e c o n d a r y metaboli tes b iosyn thes i s , t ransport a n d c a t a bo l i sm Inorganic ion t ransport a n d m e t a b o l i s m Lipid t ransport a n d m e t a b o l i s m C o e n z y m e transport a n d m e t a b o l i s m Nucleot ide t ransport a n d m e t a b o l i s m A m i n o ac id t ransport a n d m e t a b o l i s m Carbohydra t e t ransport a n d m e t a b o l i s m o Ene rgy produc t ion a n d c o n v e r s i o n o 8 Post t rans la t ional modif icat ion, protein turnover , c h a p e r o n e s « O Intracellular trafficking, secre t ion , and v e s i c u l a r t ransport o C e l l w a l l / m e m b r a n e / e n v e l o p e b ioge ne s i s S i g n a l t ransduct ion m e c h a n i s m s D e f e n s e m e c h a n i s m s C e l l cyc le control , ce l l d iv is ion , c h r o m o s o m e partit ioning Rep l i ca t ion , r ecombina t ion a n d repair Transc r ip t ion Trans la t ion , r i b o s o m a l structure a n d b ioge ne s i s i 1 1 1 1 N u m b e r o f g e n e s 30 25 20 15 10 5 0 5 10 15 20 25 30 Figure 3.10 The numbers of genes that were differentially expressed (P < 0.05, up- or down- regulated > 2 fold) within 30 min of heat shock or osmotic stress, based on the clusters of orthologous groups (COGs) 55 A list of genes differentially expressed within 30 min is shown in Table 3.2 To specify the time of expression, genes were further classified as early induction / repression (within 5 min) or late induction / repression (15 and/or 30 min) following the stress. Genes encoding Hsps (ro03566, ro05497, ro05498, ro08365, ro08345 and ro08348), a a-factor (ro04728), transcriptional regulators (ro01135, ro03402, ro08520, ro06109, ro03031, ro01900, ro03604, ro06784, ro05520 and ro03565), a probable helicase (ro01653), a possible vanillate monooxygenase (ro04165), a possible Fe-S reductase (ro05474), an oxidoreductase (ro08631), a possible transposase (ro08894), a probable glutathione peroxidase (ro04823) and a Fe 3 + uptake regulator (ro04308) were up-regulated 5 min following the stress, indicating that a wide range of stress-related genes operate promptly. A gene encoding a universal stress protein (ro02999) may have been induced at 5 min post-stress. Early repression includes genes involved in membrane biogenesis and energy production, such as diaminopimelate ligase (ro01093), apolipoprotein N-acyltransferase (ro00146), a possible penicillin-binding protein (ro06592) and citrate synthase (ro04993). Later induction includes the following genes encoding a small Hsp (ro08361), groELl (ro00448), grpE (ro06937), possible large MS channel (ro05628), betaine-aldehyde dehydrogenase (ro00383), probable siderophore interacting proteins (ro01999), DNA polymerase III (ro04199), and a possible monooxygenase (ro05405). The a-factor (ro01673) may have been up-regulated at 30 min post-stress. Several genes related to aromatic degradation were later induced, including bphGl (ro09018), pcal2 (ro03894), padCl (ro08161) and monooxygenase (ro00392 and ro05405). The paa cluster, encoding phenylacetate degradation, was highly up-regulated. For instance, paaG (ro02859) was induced 105-fold at 15 min post-56 stress. Genes involved in energy production, transcription and translation were repressed following 15 min. None of the other genes identified in section 3.2, potentially having roles in heat shock responses, were found to have significant expression ratios. Therefore, they are not likely to participate in the heat shock response, and their signal intensities were not listed. Table 3.2 Subset of selected genes showing differential expression within 30 min following heat shock (> 2-fold difference and P < 0.05; n=3). Only those genes identified in section 3.2, which have the significant expression ratios, are listed. Gene Functional category Gene ID name Gene product Trend Transporters ro04560 probable transporter, MFS superfamily + ro08873 probable transport protein + ro09089 probable permease + probable multidrug resistance transporter, MFS ro03626 superfamily + probable ethanolamine permease, APC ro06083 superfamily + multidrug resistance transporter, MFS ro06572 superfamily + ro02099 anion cation symporter, MFS family + ro05388 Amino acid transporter, APC family + ro00945 A B C transporter, permease component + ro02013 A B C transporter, ATP-binding protein + ro04791 A B C transporter, ATP-binding component + ro04496 A B C transporter, ATP-binding component + ro02805 A B C sugar transporter, permease component + ro09081 A B C sugar transporter, permease component + ro05989 A B C sugar transporter, permease component + A B C amino acid transporter, ATP-binding ro01895 component A B C Fe(3+) transporter, substrate binding ro03144a protein SfuA ro02224 A B C peptide transporter, permease component — i Functional category Gene ID ro00861 ro03215 ro02998 Transcriptional regulator and kinases roOl 872 ro03402 ro03565 ro03031 ro03604 ro06784 ro01135 ro04729 ro05225 ro02808 ro08520 |ro08382a ro01900 ro06109 ro03404 ro02780 ro05453 ro08893 ro04212 ro02626 ro04564 Gene product multidrug resistance transporter, MFS superfamily probable aromatic acid transporter, MFS superfamily sugar transporter, MFS superfamily transcriptional regulator, TetR family transcriptional regulator, TetR family transcriptional regulator, MerR family transcriptional regulator, GntR family transcriptional regulator, GntR family transcriptional regulator, DeoR family probable transcriptional regulator, TetR family probable transcriptional regulator, MerR family probable transcriptional regulator, ArsR family probable transcriptional regulator possible transcriptional regulator, TetR family possible transcriptional regulator, MarR family possible transcriptional regulator, GntR family possible transcription antitermination regulator possible transcriptional regulator, TetR family probable protein-tyrosine kinase probable serine-threonine protein kinase/ transcriptional regulator probable transcriptional regulator transcriptional regulator transcriptional regulator, LacI family Functional category Gene ro05507 Stress response related genes ro00448 ro04308 ro03566 ro08348 ro05498 ro06937 ro05497 ro08345 ro08361 ro08365 ro06862 ro00383 ro05628 ro04823 ro01999 ro04728 ro01673 ro02999 Lipid transport and metabolism ro08508 ro08871 ro06096 ro07119 Gene name Gene product Trend possible cation transport regulator + groELl 60 kDa chaperonin GroEL + Fe(3+) uptake regulator + heat shock protein + heat shock protein (18 KDa antigen-like protein) + grpEl heat shock protein GrpE + grpE3 heat shock protein GrpE + dnaKl heat shock protein Hsp70 + Chaperone protein + hsp A small heat shock protein + dnaK4 heat shock protein Hsp70 + methionine sulfoxide reductase + probable betaine-aldehyde dehydrogenase + possible large-conductance mechanosensitive channel + probable glutathione peroxidase + probable siderophore interacting protein + Sigma factor, sigma 70 type, group 3 + Sigma factor, sigma 70 type, probable group 2 + universal stress protein +/-3-oxoacyl-[acyl-carrier-protein] reductase + acetyl-CoA C-acetyltransferase + acetyl-CoA carboxylase biotin carboxylase accCl subunit + acyl-CoA dehydrogenase + Gene Functional category Gene ID name ro00759 ro08188 |rol0184a ro05062 ro08419 ro04695 ro02735 ro06695 ro06372 ro08438 ro05967 ro06887 Transposon and mutagenesis ro08894 ro08147 ro00311 ro08080 |rol0103a Aromatic degradation pathway genes ro08085 bphE3 ro09018 bphGl ro01997 menD ro02862 paaA ro02860 paaB ro02861 paaC ro02863 paaE Gene product Trend acyl-CoA dehydrogenase + possible acetate-CoA ligase, C-terminal + possible acyl dehydratase + possible fatty-acid-CoA ligase + probable 3-oxoacyl-[acyl-carrier-protein] reductase + probable 3-oxoacyl-[acyl-carrier-protein] reductase + probable enoyl-CoA hydratase + probable triacylglycerol lipase + acyl-CoA dehydrogenase acyl-CoA synthetase acyl-CoA thioesterase II possible transposase + possible transposase, C-terminal + probable transposase + transposase, IS4 + 2-oxopent-4-enoate hydratase + acetaldehyde dehydrogenase + 2- succinyl-6-hydroxy-2,4-cyclohexadiene-1 -carboxylate synthase/ 2-oxoglutarate decarboxylase + enoyl-CoA hydratase + enoyl-CoA hydratase + 3- hydroxyacyl-CoA dehydrogenase + beta-ketoadipyl CoA thiolase + o Functional category Gene ID ro02858 ro02855 ro02864 ro08167 ro03894 ro00392 ro02379 ro05405 ro02492 ro07112 ro04165 Membrane biogenesis ro00146 ro01093 ro06592 Replication / Transcription / Translation / Repair ro04199 ro01653 ro06152 ro06149 ro00961 ro06151 ro03667 Gene name Gene product Trend phenylacetic acid degradation ring paaH hydroxlyating complex protein 2 phenylacetic acid degradation ring paaK hydroxlyating complex protein 5 paaN aldehyde dehydrogenase padAal phthalate 3,4-dioxygenase alpha subunit pcaI2 3-oxoacid Co A-transferase alpha subunit Monooxygenase phenol hydroxylase, reductase component possible monooxygenase Cyclohexanone monooxygenase probable flavin-binding monooxygenase possible vanillate monooxygenase oxygenase subunit apolipoprotein N-acyltransferase UDP-N-acetylmuramoylalanyl-D-glutamate--murEl 2,6-diaminopimelate ligase possible penicillin-binding protein + + + + + + + + DNA polymerase III subunit probable helicase rplOl 50S ribosomal protein LI 5 rplR 50S ribosomal protein LI 8 rplT 50S ribosomal protein L20 + + rpmD 50S ribosomal protein L30 dnaN DNA-directed DNA polymerase III beta Functional category Gene ID ro04951 Energy production and conversion ro06240 ro06232 ro06155 ro04097 ro08984 ro06446 ro01474 General metabolism ro01472 ro04993 ro05445 ro09064 ro01050 ro01355 ro08631 ro05474 ro02726 ro06401 ro08793 ro01150 ro06073 Gene name subunit Gene product Trend probable DNA repair helicase probable DNA-(apurinic or apyrimidinic site) lyase tRNA/rRNA methyltransferase methionyl aminopeptidase glucose-1-phosphate thymidylyltransferase + Cytochrome P450 CYP256 Cytochrome-c oxidase H(+)-transporting two-sector ATPase alpha atpA subunit H(+)-transporting two-sector ATPase beta atpD subunit citA2 citrate (Si) synthase GDP-L-fiicose synthase NAD(P)H-dependent reductase possible succinate dehydrogenase + Oxidoreductase + Oxidoreductase + possible Fe-S reductase + possible short chain oxidoreductase + probable multicopper oxidase + probable oxidoreductase + possible oxidoreductase probable FMN-dependent (S)-2-hydroxy-acid oxidase + ON 63 +, induction greater than 2 fold in one of the time points -, repression greater than 2 fold in one of the time points +/-, initially induced and later repressed greater than 2 fold in one of the time points a , Probe lacks specificity due to high similarity of genes 3.3.2 Transcriptomic analysis of osmotic stress response The analysis revealed 216 genes whose expression differed significantly at one or more time points following osmotic stress, relative to expression immediately preceding osmotic stress (2-fold difference and P < 0.05). During the time course following osmotic stress, 80, 64 and 72 genes were up-, down-, or both up- and down- regulated during the time course, respectively (Figure 3.7). The highest number of genes up-regulated occurred 30 min post-stress. The expression changes of most genes were transient, suggesting that the effect of osmotic stress on cells was mild and that RHA1 can adapt well to 0.6 M NaCl (Figure 3.8b). Cluster analysis revealed groups of genes with shared expression patterns. K-means clustering (K = 15) of genes that exhibit P < 0.05 revealed a total of 46 genes that were induced or repressed at least 8-fold (Figure 3.11). Cluster C includes transiently down-regulated (up to 30 min) genes involved in a wide range of functions, such as energy production, nucleotide/coenzyme transport and metabolism (Table 3.3). Genes that were repressed for extended period were grouped into cluster B, encoding an ATPase (ro01476), a ribosomal protein (ro01975), a probable oxidoreductase (ro02039), Hsps (ro02146, ro05892 and ro06189), a probable cystathionin gamma-lyase (ro06506), and an acylphosphatase (ro06527). Genes in cluster D were transiently up-regulated and included those encoding a a-factor (ro04728), DNA polymerase IV (ro01077), as well as 64 transporters. Both ro00403 and ro01536 within cluster D, encode transporters, which belong to the MFS superfamily and the DAACS family, respectively. Cluster A included genes encoding L-ectoine synthase, the DNA protection during starvation protein (roOOlOl), a probable transcriptional regulator (ro04731) and a probable protein-tyrosine kinase (ro07020). Other genes encoding enzymes for biosynthesis of osmoprotectants (trehalose, glutamate, glycine betaine and proline) were not induced. These results suggest that RHA1 produces L-ectoine as an osmoprotectant under the osmotic stress conditions used. Genes that were annotated as KdpAB and some unidentified transporters appeared to be up-regulated following osmotic stress. A probable protein-tyrosine kinase (ro07020) was up-regulated 4- to 14-fold at all time points, except 5 min and 1 h post-stress, but there was no response regulator gene close to ro07020. Two-component systems do not appear to be induced in RHA1 upon the change in the osmolarity, since neither the kdpDE system nor other two-component systems were differentially expressed. The gene encoding possible large-conductance MS channel (ro05628) did not meet the A N O V A criterion for significantly different expression following osmotic stress (P - 0.15). Many hypothetical genes were highly up-regulated (ca. 15-30 fold): ro04732, ro08492, ro00105, ro04904, ro03828, roll209, rol0342, ro08738 and rol0062, suggesting that they also play important roles in osmoadaptation. . There were 91 up-regulated genes and 106 down-regulated genes within 30 min of osmotic stress, which were classified according to COGs (Table 3.4). Most of the changes occurring within 30 min involved genes related to energy production and 65 conversion, followed by genes related to transcription, as well as inorganic transport and metabolism (Figure 3.10). Briefly, genes that were up-regulated within 5 min include many transcriptional regulators, a a-factor (ro04728), a starvation-response DNA binding protein (ro08251), and a metabolite transporter (ro00403). As well, a a-factor (ro03512) appeared to be induced at 5 min post-stress. On the contrary, an anti-a-factor antagonist (ro02115), a a-factor (ro00098), a possible protease (ro04326), and a possible glutamate synthase (ro08275) were repressed within 5 min. Later induction includes the following genes; DNA protection during starvation protein (roOOlOl), a possible hydroxylase (ro04934), transporters (ro05677, ro08171 and ro06083) a probable lipase (ro02486) and a-factor (ro00098). A group of genes that were repressed 15 or 30 min following the stress consists of an A B C sugar transporter (ro01347), ribosomal proteins (ro01975 and ro06160), a transcription elongation factor (ro05850), DNA topoisomerase subunit A (ro03680), a probable chromosome partitioning ATPase (ro02895), an acylphosphatase (ro06527), and chaperone protein HtpG (ro05892). None of the other genes identified in section 3.2 potentially having the roles in osmotic stress responses were found to have significant expression ratios. Therefore, they are not likely to be involved in the osmotic stress responses, and their signal intensities were not listed. There were only 11 genes affected by both heat shock and osmotic stress within 30 min post-stress, and only 9 of those responded in the same way (up- or down-regulation) in both experiments (Table 3.5), (Figure 3.12). 66 Selected Clusters for Osmotic Stress ra ° c • O n 'oo ' </> •« h 0 i 1 1 1 1 r x <u D) n O " 4 4-J I I I L T 1 1 1 1 r B J I I I I L 44. i 1 1 1 1 r J I I I I L <o <o Q <o , ^ <5 <o <o Q <o ^ ^ ,5s Time (min) Figure 3.11 Expression of genes in selected clusters from the osmotic stress experiment shown in Figure 3.8b. Horizontal lines represent the average gene expression ratio, and bars, the standard deviation. Table 3.3 Selected clusters of genes that are differentially expressed following osmotic stress ( > 8-fold difference andP < 0.05; n=3). Cluster Gene category Gene ID name Gene product A roOOlOl dps DNA protection during starvation protein ro00105 conserved hypothetical protein . ro00238 conserved hypothetical protein ro01307 ectC L-ectoine synthase ro04731 probable transcriptional regulator, MerR family ro04732 hypothetical protein ro05119 possible protocatechuate dioxygenase ro07020 probable protein-tyrosine kinase ro07021 hypothetical protein ro08002|rol0457a conserved hypothetical protein B ro00146 apolipoprotein N-acyltransferase ro00164 hypothetical protein ro00421 possible transcriptional regulator, TetR family ro00617 conserved hypothetical protein ro00866 conserved hypothetical protein ro00950 argG argininosuccinate synthase ro01933 conserved hypothetical protein ro01975 rplL 50S ribosomal protein L7/L12 ro02029 conserved hypothetical protein ro02039 probable oxidoreductase ro02146 groEL2 60 kDa chaperonin GroEL ro03152|ro08804a conserved hypothetical protein ro04066 propionyl-CoA carboxylase Cluster Gene category Gene ID name Gene product ro04948 conserved hypothetical protein ro05892 htpG chaperone protein HtpG (heat shock protein HtpG) ro05957 conserved hypothetical protein ro06189 10 kDa chaperonin ro06506 probable cystathionine gamma-lyase ro06527 acyP Acylphosphatase ro10045 possible type II/IV secretion system protein rol l 115 possible general secretion pathway protein C ro00229 hypothetical protein ro01253 sulfate adenylyltransferase small subunit ro01347 A B C sugar transporter, substrate-binding component ro02115 anti-sigma factor antagonist ro03287 hypothetical protein ro03677 conserved hypothetical protein ro05442 probable glycosyltransferase ro05489 conserved hypothetical protein ro05855 possible hemolytic factor ro06027 addl adenosine deaminase ro06861 trimethylamine-N-oxide reductase (cytochrome c)/ dimethyl sulfoxide reductase ro07130 possible membrane protein ro08084 bphG3 acetaldehyde dehydrogenase ro 11278 conserved hypothetical protein D ro00362 probable CobW protein ro00403 metabolite transporter, MFS superfamily ro01077 DNA polymerase IV ro01789 NADH: flavin oxidoreductase ro02377 Multicopper oxidase ro02966 conserved hypothetical protein 0 \ OO Cluster Gene Gene ID name Gene product ro02997 probable catechol 1,2-dioxygenase ro03386 possible fumarylacetoacetate hydrolase family protein ro03775 conserved hypothetical protein ro04728 sigma factor, sigma 70 type, group 3 ro04904 conserved hypothetical protein ro05677 dctA3 C4-dicarboxylate transporter, DAACS family ro06028 possible amidase ro06081 Dehydrogenase ro06083 probable ethanolamine permease, APC superfamily ro06629 acyl-CoA dehydrogenase ro08251 starvation-response DNA binding protein ro08281 GTP cyclohydrolase I ro08492 hypothetical protein ro08712 hypothetical protein ro08738 hypothetical protein ro08854 probable muconate cycloisomerase ro10062 rhodococcal conserved hypothetical protein 'Probe lacks specificity due to high similarity of genes ON Table 3.4 Subset of selected genes showing differential expression within 30 min following osmotic stress (> 2-fold difference and P < 0.05; n = 3). Only those genes identified in section 3.2, which have the significant expression ratios, are listed Functional category Gene ID Gene name Gene Annotation Trend ro01347 A B C sugar transporter, substrate-binding component -ro05677 dctA3 C4-dicarboxylate transporter, DAACS family + ro07252 fepG Fe(3+) enterobactin transport system permease protein -ro08171 probable A B C taurine transporter, permease component + ro06083 probable ethanolamine permease, APC superfamily + roll238 probable membrane transport protein + ro05105 probable Mg(2+) and Co(2+) transporter -ro03242 possible transcriptional regulator + ro00421 possible transcriptional regulator, TetR family +/-ro04316 possible transcriptional regulator, WhiB family + ro10074 possible transcriptional regulator, WhiB family +/-ro07020 probable protein-tyrosine kinase + ro04731 probable transcriptional regulator, MerR family + ro04729 probable transcriptional regulator, MerR family + ro02917 probable transcriptional regulator, TetR family -ro06353 transcriptional regulator, AraC family + ro05387 transcriptional regulator, AsnC family -ro05072 transcriptional regulator, GntR family + ro02115 anti-sigma factor antagonist -ro05892 htpG chaperone protein HtpG (heat shock protein HtpG) -roOOlOl dps DNA protection during starvation protein + ro01307 ectC L-ectoine synthase + Transporters Transcriptional regulator and kinases Stress responses related genes Functional category Gene ID Gene name Gene Annotation Trend ro00561 possible DNA binding protein + ro04934 possible hydroxylase + ro04326 possible protease -ro01232 kdpA potassium-transporting ATPase A chain + ro05290 probable betaine-aldehyde dehydrogenase -/+ ro02039 probable oxidoreductase -ro00098 sigma factor, sigma 70 type, group 3 -/+ ro04728 sigma factor, sigma 70 type, group 3 + ro03512 sigma factor, sigma 70 type, group 4 (ECF) + ro08251 starvation-response DNA binding protein + Lipid transport and metabolism ro02486 probable esterase / lipase + ro08919 pccB2 propionyl-CoA carboxylase beta subunit + Aromatic degradation phenylacetic acid degradation ring hydroxlyating complex pathway genes ro02858 paaH protein 2 -ro00316 possible monoxygenase + ro06008 Monooxygenase -ro05119 Possible protocatechuate dioxygenase + ro02997 probable catechol 1,2-dioxygenase + Membrane biogenesis ro05442 probable glycosyltransferase -Replication / Transcription / Translation / Repair ro06160 rpsK 3OS ribosomal protein SI 1 -ro01975 rplL 5 OS ribosomal protein L7/L12 -ro01077 DNA polymerase IV + ro03680 gyrA DNA topoisomerase subunit A -ro05850 transcription elongation factor -Energy production and ro06861 trimethylamine-N-oxide reductase (cytochrome c)/ -Functional category Gene ID Gene name Gene Annotation Trend conversion dimethyl sulfoxide reductase ro08084 bphG3 acetaldehyde dehydrogenase -ro06527 acyP Acylphosphatase ro02660 aldehyde dehydrogenase + ro02648 aryl-alcohol dehydrogenase + ro02944 aspAl aspartate ammonia-lyase + ro08275 possible glutamate synthase (ferredoxin) -ro02895 probable chromosome partitioning ATPase, ParA family -ro00434 probable NADPH:quinine reductase -ro01789 NADH: flavin oxidoreductase + ro08854 probable muconate cycloisomerase -/+ ro00434 probable NADPH :quinone reductase --, repression greater than 2 fold in one of the time points +, induction greater than 2 fold in one of the time points +/-, initially induced and later repressed greater than 2 fold in one of the time points -/+, initially repressed and later induced greater than 2 fold in one of the time points 73 Heat shock Osmotic stress •Heat shock proteins •Fatty acid related genes •Oxidative stress related genes •Universal stress protein •Phenylacetic acid degradatior genes / +m 274f \ 1191 Protein-tyrosine kinase L-ectoine synthase D N A protection during starvation •Transcriptional regulator •C4-dicarboxylate transporter •Sigma factor •hypothetical Figure 3.12 Comparison of heat shock vs. osmotic stress transcriptomes, showing number of genes differentially expressed within 30 min following the stress (P < 0.05 and up- or down- regulated > 2-fold) and summarizing important categories of genes involved. 74 Table 3.5 Common genes that are differentially expressed in heat shock and osmotic stress within 30 min following the stress. Gene Gene ID name Gene product association ro00105 hypothetical protein + ro00238 conserved hypothetical protein 4-ro00677 extracellular protein -ro00759 acyl-CoA dehydrogenase + phenylacetic acid degradation ring ro02858 hydroxlyating complex protein 2 -ro03287 hypothetical protein + possible fumarylacetoacetate hydrolase family ro03386 protein + ro04728 sigma factor, sigma 70 type, group 3 + ro04729 probable transcriptional regulator, MerR family + ro05677 dctAS C4-dicarboxylate transporter, DAACS family + ro08712 hypothetical protein + +, same trend of expression for heat shock and osmotic stress -, reverse trend of expression of heat shock and osmotic stress 75 3.4 Microarray data validation QPCR analysis was performed to validate microarray results and to better quantify expression changes of selected genes. The expression levels of some genes can be underestimated by the microarray analysis, due to the limited range of the technique. For instance, the spots corresponding to some genes were saturated during the scanning of the microarray slides. In addition, some probes may cross-hybridize with other probes, and data is bound to have noise and error. ro04728 was chosen since it encodes for a a-factor that was 13.6- and 3.4-fold up-regulated 15 min following osmotic stress and heat shock, respectively. roOl 702 encodes for a probable DNA polymerase IV that was used as an internal standard for normalization of QPCR. Based on QPCR analysis, ro04728 was found to be 20-fold up-regulated 15 min following the osmotic stress. In general, microarray analysis often underestimates gene up-regulation by 2- to 10-fold by comparison to QPCR analysis (16). Therefore, the up-regulation of the ff-factor gene was confirmed and the microarray was found to be quantitatively accurate for this gene. This may be because the magnitude of up-regulation tended to be rather small (two- to 100-fold). Inaccuracy of microarray analysis is more pronounced with greater expression ratios, probably due to limited dynamic range of the method. Although QPCR analysis was not done on samples from heat shock experiment, the microarray analysis was likely to have the same accuracy for analyses of both the heat shock and osmotic stress experiments. 76 3.5 Cell morphology Morphological changes of RHA1 under heat shock and osmotic stress were examined in order to understand how they physiologically adapt to these stresses. Samples of RHA1 were collected before treatments and 30, 60, and 120 min post-stress. There were approximately 10 SEM pictures taken for each time point to observe these changes. Representative pictures from the various time points following heat shock and osmotic stress are shown (Figure 3.13 and Figure 3.14). According to the pictures taken, there was no observable fragmentation or elongation of cells following either stress. The majority of the cells did not become shortened or become cocci, but remained as branched rods similar to the control cultures. The average cell lengths during those sampling time points were 9.3, 8.7, and 8.6 /mi, for the control, heat shock, and osmotic stress treated cells, respectively (Figure 3.15). Given the variability of cell lengths, there was no significant difference in cell length between the control and the treated cultures following the stresses. There were some extracellular materials around the RHA1 cells from all samples collected (prior and following the stresses), and these artifacts could not be removed during SEM processing. RHA1 cultures at 10 h post-stress were collected for curiosity, but no RHA1 cells were found under the microscope, suggesting that they were totally covered by extracellular substances or in the heat shock experiment, may have lysed (data not shown). Figure 3.13 Photomicrographs of RHA1 shifted to 35°C; before treatment (A); 30, 60 and 120 min after treatment (B, C and D), respectively; White bar, 5.0 /mi. 79 Figure 3.15 Ce l l length of R H A 1 that were untreated (•); heat shocked (•); osmotic stressed ( A ) at 30, 60 and 120 min post-stress, (n = 20; bars indicate standard deviation). 80 4 DISCUSSION 4.1 Tolerance of temperature and salt concentration of RHA1 The optimal growth temperature appropriate for RHA1 under normal condition (30°C) is in similar range as those of R. opacus, S. coelicolor (3, 62), as well as cold-tolerant rhodococci, such as R. sp. N014-1, and R. sp. NO20-3 (80). However, the cold-tolerant rhodococci (80) are able to grow at lower temperature than RHA1 (1 to 30°C), indicating that RHA1 does not tolerate low temperature well compared to the cold-tolerant rhodococci. Rhodococcus sp. RBI, a salt-tolerant strain has been shown to tolerate up to 0.9 M NaCl (10). The NaCl concentration, which inhibited growth of RHA1, is between 0.25 and 0.5 M , indicating that RHA1 cannot tolerate high NaCl concentration as the salt-tolerant strain. Thus, RHA1 does not tolerate extreme temperatures or NaCl concentrations, as compared to some other rhodococci. The conditions used to test heat shock and osmotic stress responses differ among organisms. For instance, S. coelicolor was heat-shocked at temperature range of 35 to 42°C, and was treated with 1 M sucrose under osmotic stress (62). M. tuberculosis cells were heat shocked at 52°C, and the cell number was reduced by 10"4 after 3 h (101). Further, due to the limited experimental detail in those reports, it was not possible to directly compare the tolerance of temperature and salt concentration of RHA1 to that of other organisms. The morphological examination of RHA1 agrees with a study of R. opacus, in which no major variations in the cell morphology were observed during water stress, which is a stress related to osmotic stress (3). 81 4.2 Global heat shock responses Despite the importance of rhodococci in various ecological and biotechnological applications, little is known about how they adapt to environmental stresses, including heat shock. Using a microarray, which represents greater than 95% of total RHA1 genes, genetic responses of Rhodococcus sp. RHA1 to a sudden increase in temperature were determined. Approximately 7% of total genes, 598 genes, were differentially expressed during the initial 3 h following heat shock. The percentage of genes differentially expressed following heat shock is similar to that of Neisseria meningitidis (5%) and group A Streptococcus sp. (9%) (35, 112). The delayed expression of genes was evident at 3 h following heat shock, when the highest number of differentially-expressed genes was observed and cell viability had started to decline. There were 367 genes that were differentially expressed during the initial 30 min following heat shock. These genes span a range of cellular functions, with energy production, transcription, and lipid transport and metabolism being the dominant categories. Many of these genes are related to those that have been described in heat shock responses in other organisms, whereas some are related to oxidative stress responses. The following discussion mostly focuses on the genes that were differentially expressed within 30 min following the stress. 4.2.1 The repression of translational machinery and energy production Heat shock caused the repression of gene expression for energy production and cell growth, and caused the induction of certain metabolic genes, supporting the hypothesis that stress conditions cause reservation of energy and nutrients for metabolic 82 activities responsible for cell maintenance and survival. ATPases and ribosomal proteins were repressed due to heat shock (cluster A, Figure 3.9). Heat shock caused the repression of some ATPase subunits (ro01471, ro01472, ro01474) that form extramembraneous and transmembraneous sectors, reducing the number of active ATPase complexes for ATP synthesis via proton translocation (25). Some genes encoding ribosomal subunits (ro06149, ro06151 and ro06152) were repressed due to heat shock. The repression of ribosomal proteins under stress conditions was previously observed in many studies (29, 35, 62, 69, 85). 4.2.2 The induction of heat shock proteins, and the possible induction of a universal stress protein Heat shock caused the induction of nine Hsp genes (29% of the total Hsp genes), including a chaperone gene, a GroEL gene, two GrpE genes, two DnaK genes, an HspA gene and an 18-kDa Hsp gene (Table 3.2). The Hsps induced following heat shock are similar to those induced in other actinomycetes. DnaK, DnaJ, GrpE, HspR, ClpB and Lon were up-regulated in S. coelicolor following similar treatment. DnaJ, DnaK, GroEL and Clp protease subunit genes were induced following the heat shock in C. glutamicum (124). DnaK, DnaJ, GrpE, ClpB, GroES, HtpX, HspR, GroEL 1, and GroEL2 were up-regulated in M. tuberculosis (115). The percentage of up-regulated Hsp genes in RHA1 is similar to that of S. coelicolor (62), whereas 50% of Hsps were induced in M. tuberculosis under heat shock conditions (115). The results here confirm that Hsp induction under heat shock conditions is conserved among organisms, and that RHA1 is similar to S. coelicolor in terms of the Hsp induction. 83 Expression of Hsps was transiently induced immediately following the heat shock and became non-differentially expressed by 45 min. However, there were minor variations in expression patterns of different Hsps in RHA1 since three of seven Hsps were classified as cluster B by cluster analysis (Figure 3.9). Similar to RHA1, S. coelicolor increased expression of heat-shock genes within 15 min, and reduced their expression to the previous levels by 30 min (62). Heat shock also caused the transient induction of Hsp expression in actinomycetes, B. subtilis, E. coli and Saccharomyces cerevisiae (50, 62, 69, 115, 124), in patterns similar to that observed in RHA1. The results in this study support that the expression patterns of Hsps, in response to heat shock, are also similar among microorganisms. Heat shock caused the induction of a cluster of genes encoding two Hsps (Figure 4.1). The expression patterns of these genes are similar except one outlier at 90 min post-stress, indicating that they may be expressed as an operon. The two hypothetical proteins encoded in this cluster may have functions in heat shock response. A second cluster of four Hsp genes includes two that are simultaneously induced (Figure 4.2). Although the arrangement suggests that the four might be transcribed as an operon, only dnaK and grpE appear to be co-regulated. 84 ro08345 ro08346 ro08347 ro08348 40 0 50 100 150 200 Time (min) Figure 4.1 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of ro08345 to ro08348. The microarray did not include a probe for ro08346. 85 0 5 0 1 0 0 1 5 0 Time (min) Figure 4.2 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of Hsp genes (ro05497 to ro05500). The microarray did not include a probe for ro05500. Only two putative protease genes (ro05504 and ro05481) were induced out of 40, which were previously identified by genomic analysis. Also, a hypothetical gene encoding a possible protease (ro05086) was induced 2.3-fold at 15 min post-stress. Expression of ro05504 increased at 45 min post-stress onwards by less than seven-fold. This protease was not among the clusters with similar expression pattern nor the list of genes differentially expressed within 30 min. Expression of ro05481 increased at 180 min post-stress. The latter two proteases seem likely to be expressed due to cell death, rather than as a direct result of heat shock. A small percentage of proteases induced 86 under heat shock are also observed in S. coelicolor and M. tuberculosis (62, 115). The results here suggest that some of up-regulated Hsps may provide the necessary protease activities following heat shock. RHA1 likely employs many regulatory mechanisms for Hsp synthesis and other responses following heat shock, since more than 15 transcriptional regulators were up-regulated. Regulatory mechanisms controlling Hsp synthesis in M. tuberculosis and Streptomycetes were proposed. A study of knockout mutants of M. tuberculosis showed that HspR and HrcA repressed the transcription of components of the DnaK and the GroE regulon, respectively (115). S. coelicolor contains the RheA repressor, which regulates the transcription of hsp 18, in addition to those described in M. tuberculosis (106). Heat shock caused high induction (34.8-fold) of an hspl8 homologue (ro08348) in RHA1 but caused no significant effect on the expression the transcriptional regulator neighboring that gene (ro08349). Thus, it remains unclear if ro08349 is a transcriptional regulator for ro08348 and perhaps other heat shock response genes of RHA1. Moreover, heat shock caused no significant effect on the expression hrcA (ro01247), the transcriptional repressor known to be involved in heat shock responses in other actinomycetes. Future experiments on HrcA" knockout mutants would provide a system for testing transcriptional repression of Hsps in RHA1, allowing further understanding of transcriptional regulation of Hsps in RHA1. Universal stress protein (Usp) protects cells against DNA damage by unknown mechanisms. Only one of 16 RHA1 genes homologous to that encoding the Usp may have been up-regulated following heat shock, but the evidence for up-regulation was 87 weak. The expression ratio of ro02999 at 5 min post-stress was significant but not high (2.22). Further, the signal intensities were relatively low throughout the timecourse (Appendix A), suggesting that the level of expression was not high, even if the genes were up-regulated. This gene was not induced following osmotic stress, suggesting that ro02999 is functionally significant specifically in heat shock responses. The function of the closest relative of ro02999 (uspA in Brevibacterium linens; 61% amino acid identity) has yet to be determined. Usps from diverse organisms (Archaea, Eubacteria, yeast, fungi and plants), having conserved amino acid sequences, have been studied (68). The induction of Usps differs among organisms and among stress conditions. For instance, five of six Usps in E. coli were induced due to heat shock (109). UspA and UspD were induced in E. coli due to superoxide stress (109). Usps induced due to heat shock in E. coli were similar to those induced in M. tuberculosis due to oxygen limitation (92). These studies suggest that the stimulation of Usps occurs in response to various stresses depending on the species. The induction of the Usp is atypical of actinomycete heat shock response. Results from further studies for other stress responses in RHA1 will likely find the involvement of Usps other than ro02999. 4.2.3 The induction of a-factors One a-factor (ro04728) was clearly induced, and another a-factor (ro01673) may have been induced in RHA1 in response to heat shock. The a-factor encoded by ro04728 was induced 5, 15, 120 and 180 min following heat shock (Figure 4.3b). The signal intensities were high, strongly suggesting that ro04728 play roles in regulation of heat shock response. Sequence analysis showed that ro04728 encodes a group 3 a-factor. 88 Interestingly, a transcriptional regulator (ro04729), encoded on the opposite strand was also up-regulated at 5 min post-stress and had a similar expression pattern as ro04728, suggesting that these two genes are related in regulation of the heat shock response. As well, ro04728 and ro04729 were up-regulated and had similar expression patterns following osmotic stress. The importance of this a-factor and transcriptional regulator are further discussed in section 4.4. The a-factor encoded by ro01673 has an ambiguous role in the heat shock response. The expression ratios at 30 min and 3 h following heat shock were significant but small, 2.6 and 3.2, respectively. Further, the signal intensities were relatively low throughout the timecourse (Appendix A), suggesting that the level of expression was not high, even if the gene was up-regulated. Sequence analysis showed that ro01673 encodes a group 2 a-factor. As such, the amino acid sequence of roOl 673 aligned with conserved residues of RpoD, a primary a-factor in E. coli (61). The closest matches to ro01673 are the a-factor PYR-1 in M. vanbaalenii and a A , the primary a-factor in M. tuberculosis cells (78) (51 and 50 % amino acid identity, respectively). a A was shown to be essential for growth in M. smegmatis, and was suggested to be essential for all mycobacteria (31). The ro01673 gene is not believed to encode the primary a-factor of RHA1. Based on these data, it was not possible to conclude whether ro01673 plays a role in regulation of the heat shock response. 89 a) o I •.So . £ <» <U ro04728 b) 50 100 T i m e (min) 150 200 O s m o t i c s t r e s s ro04728 - B - ro04729 ro04730 ro04731 - * - ro04732 50 100 T i m e (min) 150 200 Figure 4.3 A physical map of ro04728 to ro04732 (a) and the average normalized expression ratios over timecourse (b) of ro04728 to ro04732 in heat shock and osmotic stress. ro04731 and ro04732 had p-value greater than 0.05 in the heat shock response. ro04730 had a p-value greater than 0.05 in both the heat shock response and the osmotic stress response. 90 The current grouping system for a-factors is based on phylogenetic classification, and does not correspond to roles in the transcriptional response to stress (49). For instance, heat shock caused the induction of a H (group 3) in S. coelicolor and a E (group 4) in C. glutamicum (65, 89) and caused the induction a H (group 4), a E (group 4) and a B (group 2) in M. tuberculosis (78). In RHA1, the group 3 a-factor encoded by ro04728 was induced in response to heat shock, and the group 2 a-factor encoded by ro01673 may have been induced. Thus, different types of a-factors regulate heat shock responses in different organisms, and RHA1 is distinct in this respect from S. coelicolor, C. glutamicum and M. tuberculosis. 4.2.4 The induction of genes related to lipid transport and metabolism At least 12 genes involved in fatty acid biosynthesis and metabolism (Table 3.2), were induced in RHA1 following heat shock. Fatty acid biosynthesis and metabolism are important for energy storage and for altering cell membrane composition modification following heat shock (103). Previous studies found that fatty acid biosynthesis and metabolism function in energy storage in actinomycetes. For instance, Streptomyces and Rhodococcus strains grown up to stationary phase accumulate triacylglycerols (TAG), triesters of glycerol with fatty acids which are more efficient as an energy source than carbohydrates and proteins (5). When there is a nitrogen source but no carbon source, 90% of stored T A G in R. opacus were used for generating energy (4). Accumulation of T A G has been observed in plants and in the actinomycetes, including members of Mycobacterium, Streptomyces, Nocardia and Rhodococcus (122), but not in other bacterial groups. 91 Modification of membrane composition following heat shock was demonstrated in Archaeoglobus fulgidus (103). Genes encoding membrane protein were differentially expressed upon the temperature increase in Shewanella oneidensis (29). In mycolic acid bacteria (those organisms that produce this long, branched-chain fatty acid as a part of cell envelope), the induction of mycolic acid synthesis is important to the regulation of cell membrane following heat shock, since mycolic acid is a critical component of the cell wall (29). In M. tuberculosis, two genes related to mycolic acid synthesis (under the control of the HspR repressor and over-expressed in an hspR knockout mutant) were induced due to heat shock (115). 4.2.5 The association between heat shock and oxidative stress This study confirmed that heat shock and oxidative stress responses are linked in actinomycetes. The partial reduction of dioxygen in aerobic metabolism under stress conditions can lead to the formation of superoxide, hydrogen peroxide (H2O2) and hydroxyl radicals (OH'), which damage nucleic acids, membrane lipids and proteins (38). Genes related to oxidative stress, including ones encoding an iron uptake regulator, a methionine sulfoxide reductase, a probable glutathione peroxidase, a probable siderophore interacting protein, and five oxidoreductases (Table 3.2), were induced in RHA1 at 5 min following heat shock. The functions of the oxidoreductases are not known, so any role of those enzymes in heat shock response is highly speculative. Heat shock response is also linked to the oxidative stress response in C. glutamicum and M. tuberculosis (89, 115). In M. tuberculosis, susceptibility to both heat shock and oxidative stress increased due to inactivation of a H , a stress related a-factor (79). A study of S. 92 coelicolor demonstrated that heat shock responses were similar to responses to oxidative stress and the antibiotic vancomycin (62). 4.3 Global osmotic stress responses Transcriptomic analysis reveals that approximately 2.4% of genes in RHA1 are differentially expressed in response to osmotic stress. The fold changes of-90% of total genes that were differentially expressed due to salt treatment in RHA1 are less than 10-fold. Only two ribosomal proteins were transiently down-regulated. The small number of genes affected, relative to the heat shock response, suggests that cells adapt well to the NaCl addition, and that the modulation of expression of a relatively small number of genes provides most of the functions required for growth in the presence of an inhibitory salt concentration. Some of the potential genes involved in osmotic stress, predicted by the annotation of the RHA1 genome, were differentially expressed. Genes involved in energy production and conversion, inorganic transport and metabolism, and transcription were the three dominant COGs categories affected within 30 minutes post-stress. 35% of the total differentially expressed genes are annotated as hypothetical proteins, which could possibly encode unrecognized osmoadaptation mechanisms. The second part of this study focused on gene expression for osmoadaptation, providing a model for mechanisms of osmoadaptation in the rhodococci. 93 4.3.1 The possible induction of KdpA, KdpB, and the induction of a protein-tyrosine kinase Following osmotic stress treatment, kdpA and kdpB, encoding two components of the Kdp system for K + transport, had significant expression ratios (Figure 4.4). However, the expression ratios and signal intensities were relatively low for both genes (Appendix B) , and the patterns of expression differed. Unfortunately, there was no probe and so no data for a gene encoding a third component of the same system kdpC. The kdp genes are in a putative operon additionally including genes encoding a sensor kinase and response regulator, and neither of these genes was clearly up-regulated. Thus, the Kdp system does not appear to have been substantially induced following osmotic stress. Neither was any other annotated K + transporters induced. Thus, it was not possible to conclude that K + uptake was the primary response following osmotic stress, preceding the synthesis of compatible solutes, in R H A 1 , as has been observed in other bacteria (127). Unidentified transporters that were significantly up-regulated could possibly be involved in K + transport. 94 o < 0.0 -I 1 , , 0 50 100 150 200 Time (min) Figure 4.4 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of ro01228 to ro01232 that are annotated as K + transporting system. The microarray had no probe for ro01230. The up-regulation of ro07020, encoding a probable protein-tyrosine kinase, is quite interesting. ro07020 showed significant expression ratios at all time points, except 5 min and 1 h post-stress (Appendix B). Protein-tyrosine kinases are now recognized to play roles in the regulation of many physiological processes, including stress responses and exopolysaccharide synthesis (83). The protein-tyrosine kinase is capable of interacting with its cognate transmembrane protein. Upon changes in the environment, the protein-tyrosine kinase becomes autophosphorylated, resulting in the subsequent phosphorylation of different protein substrates, like ff-factors, single-stranded DNA-95 binding proteins, etc. (83). A protein-tyrosine kinase was demonstrated to function in controlling heat shock regulons in B. subtilis, in particular the derepression of the CtsR regulon (64). Thus, there is a possibility that the protein-tyrosine kinase encoded by ro07020 plays a role in sensing changes in osmolarity. However, the cognate transmembrane protein for this kinase is not known. A homologue of protein-tyrosine phosphatase was found in RHA1 (ro05454), but there is no probe corresponding to the gene in the microarray used. 4.3.2 The biosynthesis of compatible solutes in R H A 1 This study showed for the first time that L-ectoine is one of the compatible solutes synthesized by rhodococci under osmotic stress conditions. Genes encoding enzymes for L-ectoine biosynthesis (ro01305 and ro01307) appear to constitute an operon, along with an additional gene (Figure 4.5a). Although there is no probe for one of the genes, the expression pattern of the other three match very well, strongly suggesting that the four genes comprise an operon. The expression ratios and the signal intensities of these genes were relatively high during the first 2 h following osmotic stress (Appendix B), suggesting that they were highly expressed. 96 a) CD C? C o JN . ra07305 ro0730o ro07305 b) 1 4 . 0 5 1 2 . 0 • ro01305 •ro01307 •ro01308 1 0 0 Time (min) 1 5 0 2 0 0 c) H ro01306 " o s C v tilutamaie JOG > r v A s t ^ A <** H.» ro01305 A*«tyi-GoA GoA ro01307 L-aspartate-P-scmiaidehjtie L-2,4-diamino-butyratc Ny-acetyl-L-2,4-diaminobutyrale L-ectoine Figure 4.5 A physical map (a) and the average normalized expression ratios over timecourse (b) o f ro01305 to ro01308, a putative operon encoding L-ectoine biosynthesis. The microarray had no probe for ro01306. A proposed pathway of the L -ectoine biosynthesis in R H A 1 (c). EctB, E c t A and EctC correspond to L-2,4-diaminobutyric acid transaminase, L-2,4-diaminobutyric acid acetyltransferase, and ectoine synthase, respectively. The figure is taken from (67). 97 The enzymes encoded by ro01305, ro01306 and ro01307 appear to catalaze L-ectoine synthesis via the pathway described in Bacillus spp. (Figure 4.5c) (67) and are 59%, 68% and 74% identical, respectively, to their homologues in N. farcinica. In a separate study, ro01307 was induced in RHA1 after approximately 12 hours of desiccation (Goncalves and LeBlanc, unpublished). The synthesis of L-ectoine by RHA1 following osmotic stress is consistent with reports of L-ectoine accumulation in Rhodococcus sp. PD600 during water stress (3). The expression of a putative hydroxylase (ro04934) was induced by up to 9.8-fold at 15 min-post stress, and the signal intensities were high (Appendix B). The closest relatives of this putative hydroxylase were hydroxylases in S. coelicolor and N. farcinica (55% and 54% amino acid identity, respectively). L-ectoine was converted to hydroxyectoine by a hydroxylase in S. coelicolor, however, the detailed mechanism has not been described (77). Thus, it is possible that putative hydroxylase in RHA1 catalyzes hydroxyectoine production, but there is no direct evidence for this possibility. RHA1 is unlikely to synthesize betaine as a compatible solute under conditions used. The biosynthesis of betaine involves two enzymes: choline dehydrogenase (equivalently choline oxidase) and betaine-aldehyde dehydrogenase, which catalyze the conversion of choline to betaine aldehyde and the conversion of betaine aldehyde to betaine, respectively (87). Five choline dehydrogenase genes are present in RHA1, but none of them had significant expression ratios in this experiment. In addition, expression ratio and signal intensities indicate that they were probably not constitutively expressed at a high level. A betaine-aldehyde dehydrogenase gene (ro05290) is present and had a 98 significant expression ratio 15 min post-stress. However, its signal intensities were consistently low, suggesting that the single significant expression ratio was a false-positive result and that the gene was not up-regulated. Thus, RHA1 synthesizes ectoine as a compatible solute for protection against osmotic stress. RHA1 does not appear to synthesize other compatible solutes under the conditions of this study, but analysis of the genome suggests that it may produce others, such as hydroxyectoine, trehalose, proline, glutamate or glycine betaine, under different conditions. The uptake from the environment of other available compatible solutes or their precursors is also possible. No such compounds were provided in the W medium used in this study, so their possible uptake and effects on gene expression cannot be determined without further experimentation. The mechanisms responsible for triggering osmoprotectant biosynthesis in RHA1 remain unknown. Several stimuli that can trigger this secondary response to osmotic stress have been described, such as changes in turgor pressure, membrane structure and ion concentrations, etc. (87). These processes can occur more or less simultaneously, so it is very difficult to identify to responsible processes in organisms (87). Future studies are required to understand the regulatory mechanism for individual genes and for signal stimulation and transduction. 4.3.3 The induction of the a-factors The ro00098 gene, encoding a group 3 a-factor, was initially down-regulated at 5 min and then up-regulated at 30 min post-stress (Figure 4.6). The expression ratio of 99 ro00099 was not significant (p-value = 0.30), but its pattern of expression closely followed that of ro00098. Moreover, these two genes are located next to each other, with two overlapping nucleotides. Thus, it seems likely that the two genes are co-transcribed and the anti a-factor encoded by ro00099 plays a role in controlling transcription involving the a-factor encoded by ro00098. The pattern of gene expression for ro00098 and ro00099 suggests that the genes were initially repressed and then induced. The a-factor encoded by ro04728, and the transcriptional regulator encoded by ro04729, were clearly induced 5, 15 and 30 min post-stress and became non-differentially expressed by 45 min post-stress (Figure 4.3b). Moreover, genes that are located in proximity (ro04731 and ro04732) were also up-regulated. These genes are further discussed in section 4.4. Gene expression of ro03512, encoding a group 4 a-factor, may have been induced transiently (2.1-fold) at 5 min post-stress. It is possible that this a-factor was transiently up-regulated at a higher expression ratio before 5 min post-stress, since a-factors can be stimulated simultaneously. However, expression ratios at other time points were close to 1.0 and the signal intensities were low throughout timecourse (Appendix B), suggesting that the single significant expression ratio could be a false-positive result. Thus, no conclusion regarding the involvement of this a-factor in the osmotic stress response can be made without further experimentation. The a-factor most similar to ro03512 is SCC57A.13c in & coelicolor (79% amino acid identity), whose function is unknown. The response of RHA1 to osmotic stress seems to involve at least two sigma factors, which indicates complex genetic regulatory changes. The involvement of two sigma 100 factors in response to osmotic stress has not previously been reported, but may simply reflect incomplete knowledge of the responses in other organisms. o i *>> 0 0 to r i o Co O I NT ]r?2^ SS—^  I—I rn00098 rn00099 roOOWO roOOlOl ro00102 ro00098 —a— ro00099 roOOWO — B — ro00101 - * - ro00102 50 100 Time (min) 150 200 Figure 4.6 A physical map (top) and the average normalized expression ratios over timecourse (bottom) of ro00098 to ro00102. ro00099, roOOWO and ro00102 had p-value greater than 0.05. 4.3.4 The induction of the DNA protection during starvation (Dps) The DNA protection during starvation protein (Dps), encoded by roOOlOl, was up-regulated at 15, 30, and 45 min and 2 h following the onset of osmotic stress (Figure 101 4.6). The signal intensities were relatively high, suggesting a high level of expression and confirming the role of Dps in response to osmotic stress. In addition, roOOlOl is located close to the a-factor and anti a-factor genes, ro00098 and ro00099, mentioned above and ro00102, encoding a hypothetical protein. Both roOOlOl and ro00102 were up-regulated after the peak in expression of ro00098 and ro00099. The gene arrangement and expression pattern suggests that roOOlOl and ro00102 are co-regulated and perhaps dependent for expression on the products of ro00098 and ro00099. Dps is a dodecamer that is packed in several layers in a shape similar to a hexagon (38). Dps gene expression was induced following osmotic stress in E. coli and Burkholderia pseudomallei (72, 74). In general, Dps protects cells against oxidative damage and nutritional stress by binding non-specifically to DNA by an unknown mechanism (38). DNA resides in between packed layers of Dps, as if DNA is shielded (38). Dps can also sequester iron to prevent Fe 2 + from reacting with the H2O2, which can lead to the formation of the OH' (131). Dps was found to protect E. coli from H2O2 damage in stationary phase, as well as exponential phase (2). Dps in M. smegmatis is expressed under carbon starvation conditions (39). In RHA1, Dps was also induced during desiccation (Goncalves and LeBlanc, unpublished), but not following heat shock. Interestingly, other genes that are involved in protection from oxidative damage were not induced following osmotic stress. Oxidative protection systems were induced following osmotic stress in B. subtilis and Streptococcus mutans (1, 58). Therefore, Dps likely provides this function in RHA1. 102 4.4 Comparison of responses to heat shock and osmotic stress One of the most striking findings is that there are only 20 differentially expressed genes common to the heat shock and the osmotic stress responses (Table 3.5). Further, only a small number of genes are common to osmotic stress and desiccation responses of RHA1 (Mohn, personal communication). Common genes in the heat shock and the osmotic stress responses function in various processes, including metabolism, transcription, and transport. The diverse roles of these genes typify general protection systems for many types of stress. However, the small number of genes common to these two stresses suggests that RHA1 expresses relatively specific groups of genes in response to particular stresses. Among the 20 common genes, ones encoding a a-factor (ro04728) and a transcriptional regulator (ro04729) are the only two that are located close to each other. Both ro04731 and ro04732 appear to be induced after the peak in expression of ro04728 and ro04729 (Figure 4.3b). The gene arrangement and expression pattern suggests that ro04731 and ro04732 are co-regulated and perhaps are dependent for expression on the products of ro04728 and ro04729. ro04730, encoding a hypothetical protein, appears to be the noise, since the expression pattern do not fit with that of other genes in both heat shock and osmotic stress. It is obvious that the induction of ro04728, ro04729 and ro04732 in the osmotic stress was at a higher level than the heat shock, and that all genes within this cluster became non-differentially expressed by 90 min post-stress in the osmotic stress. However, ro04731, encoding probable transcriptional regulator, remained induced under heat shock conditions, in contrast to the osmotic stress. The results here 103 indicate that this cluster play important roles under heat shock and osmotic stress; however, the level of induction and the duration in each stress were different. ro04728 is 57% identical to o~F of M. tuberculosis at the amino acid level. a F of M. tuberculosis was strongly induced during stationary phase, cold shock, and nitrogen starvation (19). The a mutant had the same growth rate as the wild-type, but is less virulent by time-to-death-analysis (14). Further, it is not essential for growth and survival in the macrophage (14). There are three a F homologs, ro00098, ro02118, and ro04728, in the RHA1 genome based on annotation data. It is thought that a F homologs must be important in all stress responses because of the multiple copies present in the genome. ro04729 has a conserved N-terminal DNA binding domain similar to a transcriptional regulator, HspR, which has been shown to regulate transcription in response to high temperature in Streptomyces and to osmotic stress in Helicobacter (106, 113). Specifically, the DNA binding domain promotes the transcription by reconfiguring the spacer between -35 and -10 promoter elements (13). The a-factor (ro04728), and the transcriptional regulator (ro04729) were also up-regulated during desiccation of RHA1 (Goncalves and LeBlanc, unpublished). Thus, it is hypothesized that these two genes play central roles in stress responses, perhaps by controlling other regulators that can turn on / off certain groups of genes depending on the type of stress. However, the distinct sets of genes up-regulated following these different stresses suggest that there are additional unknown mechanisms of regulation of those genes. RHA1 has more complex mechanisms of regulation corresponding to different types of stresses than was originally hypothesized. 104 Studies have compared different stress responses in many organisms. RpoS controls a general response to starvation, hyperosmolarity, acidic pH, and cold and heat shock in E. coli (52). In yeast, a group of -900 genes, called "environmental stress response" genes, were induced in response to various treatments, such as heat, H2O2, salt, and nutrient starvation (30). These genes participate in many processes and represent protection systems that respond to many stresses (30). Multiple stress responses, such as those for heat-, salt- and ethanol- treatment, are regulated by a single a-factor in B. subtilis (44). On the contrary, a single group of genes common to a number of stress 0 treatments (heat and ethanol shock, osmotic shifts, and phosphate upshift) were not detected in S. coelicolor by two-dimensional gels or the microarray (62, 121). Instead, S. coelicolor stress stimulons are activated in coordination with growth phase (121), indicating that stresses are integrated into the developmental processes. Thus, actinomycetes like RHA1 and S. coelicolor may respond to heat shock and osmotic stress differently from other organisms by employing distinct genes for particular stresses and only a small number of genes for multiple stresses. Several factors may contribute to the small number of genes common to osmotic stress and heat shock responses. Based on cluster analysis, the repression of genes related to translation, and energy production and conversion was transient in the osmotic stress response, unlike the heat shock response where there was a continuous repression. There was no cluster in which a constant induction was observed in the osmotic stress condition, which is consistent with the fact that RHA1 was able to successfully adapt to the osmotic stress. RHA1 resumed growth and was able to reach the stationary phase following only the osmotic stress treatment (Figure 3.6); whereas, the heat shock 105 treatment killed the cells (Figure 3.3). Together, these aspects support the results of getting a small number of the overlapping genes. This study broadens our understanding of how the rhodococci react to the stresses occurring in the soil environment. Based on the limited knowledge of the group, RHA1 responds to stresses similarly to other members of the actinomycetes. RHA1 efficiently adapted to the osmotic shock (increase to 0.6 M NaCl), but not to the heat shock (increase from 30°C to 35°C). Overall, microarray data provides a global glance at transcription; however, further studies like mutagenesis are required to confirm mechanisms of stress adaptation. 106 5 CONCLUSIONS This study provides the first report on the transcriptional responses of Rhodococcus to heat shock and osmotic stress. The effects of increases in temperature and NaCl concentration on RHA1 growth were examined to find the best experimental stress conditions. RHA1 was able to grow from 15 to 33°C, so 30°C and 35°C were chosen to represent normal and heat shocked conditions, respectively. NaCl concentrations of 0.25 M to 0.5 M are limiting to RHA1 growth; however, 0.6 M NaCl was a non-lethal stress for exponentially growing cells. A sodium benzoate concentration of 20 mM allowed cells to grow at the maximal growth rate; therefore, this concentration was used in the growth experiments. The morphological examination of RHA1 cultures treated with heat and salt did not show significant changes in terms of size or shape compared to the control cultures. The genomic and the transcriptomic analysis revealed groups of genes that were affected by heat shock and osmotic stress. Both stresses cause the repression of translational machinery and energy production, although the repression profiles were different, and the induction of several (7-factors. The vast majority of differentially expressed genes were unique to each stress. Following heat shock, RHA1 induces nine heat shock proteins, two proteases, and perhaps a universal stress protein. RHA1 also appears to metabolize fatty acids for generating energy and for altering cell membrane composition modification following heat shock. Several genes associated with an oxidative stress response were also induced following heat shock. 107 RHA1 efficiently adapts to 0.6 M NaCl perhaps by synthesizing L-ectoine as a compatible solute and perhaps by turning on K + transporters. However, mechanisms responsible for sensing osmotic stress in RHA1 remain unknown. A protein-tyrosine kinase and a DNA protection during starvation protein were also induced following osmotic stress. A a-factor (ro04728) and a transcriptional regulator (ro04729) are common between two stresses, suggesting that these two genes are important in stress responses, perhaps by controlling other regulators that can turn on / off certain groups of genes depending on the type of stress. This study suggests that additional unknown mechanisms of regulation are present to control transcription of genes specific to each stress. The microarray data were consistent with the QPCR analysis. 108 REFERENCES 1. Abranches, J., J. A. Lemos, and R. A. Burne. 2006. Osmotic stress responses of Streptococcus mutans UA159. FEMS Microbiol Lett 255:240-6. 2. Altuvia, S., M. Almiron, G. Huisman, R. Kolter, and G. Storz. 1994. The dps promoter is activated by OxyR during growth and by IHF and sigma S in stationary phase. Mol Microbiol 13:265-72. 3. Alvarez, H., R. Silva, A. Cesari, A. Zamit, S. Peressutti, R. Reichelt, U. Keller, U. Malkus, C. Rasch, and T. Maskow. 2004. Physiological and morphological responses of the soil bacterium Rhodococcus opacus strain PD630 to water stress. FEMS Microbiol Ecol 50:75-86. 4. Alvarez, H. M., R. Kalscheuer, and A. Steinbuchel. 2000. Accumulation and mobilization of storage lipids by Rhodococcus opacus PD630 and Rhodococcus ruber NCIMB 40126. Appl Microbiol Biotechnol 54:218-23. 5. Alvarez, H. M. , and A. Steinbuchel. 2002. Triacylglycerols in prokaryotic microorganisms. Appl Microbiol Biotechnol 60:367-76. 6. Arnosti, D. N., V. L. Singer, and M. J. Chamberlin. 1986. Characterization of heat shock in Bacillus subtilis. J Bacterid 168:1243-9. 7. Bashyam, M. D., and S. E. Hasnain. 2004. The extracytoplasmic function sigma factors: role in bacterial pathogenesis. Infect Genet Evol 4:301-8. 8. Bellier, A., and P. Mazodier. 2004. ClgR, a novel regulator of clp and Ion expression in Streptomyces. J Bacteriol 186:3238-48. 9. Bishop, A., S. Fielding, P. Dyson, and P. Herron. 2004. Systematic insertional mutagenesis of a streptomycete genome: a link between osmoadaptation and antibiotic production. Genome Res 14:893-900. 10. Blasco, R., M. Martinez-Luque, M. P. Madrid, F. Castillo, and C. Moreno-Vivian. 2001. Rhodococcus sp. RBI grows in the presence of high nitrate and nitrite concentrations and assimilates nitrate in moderately saline environments. Arch Microbiol 175:435-40. 11. Boch, J., G. Nau-Wagner, S. Kneip, and E. Bremer. 1997. Glycine betaine aldehyde dehydrogenase from Bacillus subtilis: characterization of an enzyme required for the synthesis of the osmoprotectant glycine betaine. Arch Microbiol 168:282-9. 12. Boscari, A., K. Mandon, L. Dupont, M. C. Poggi, and D. Le Rudulier. 2002. BetS is a major glycine betaine/proline betaine transporter required for early osmotic adjustment in Sinorhizobium meliloti. J Bacteriol 184:2654-63. 13. Bucca, G., G. Ferina, A. M. Puglia, and C. P. Smith. 1995. The dnaK operon of Streptomyces coelicolor encodes a novel heat-shock protein which binds to the promoter region of the operon. Mol Microbiol 17:663-74. 14. Chen, P., R. E. Ruiz, Q. Li , R. F. Silver, and W. R. Bishai. 2000. Construction and characterization of a Mycobacterium tuberculosis mutant lacking the alternate sigma factor gene, sigF. Infect Immun 68:5575-80. 15. Cho, Y. H., E. J. Lee, B. E. Ahn, and J. H. Roe. 2001. SigB, an RNA polymerase sigma factor required for osmoprotection and proper differentiation of Streptomyces coelicolor. Mol Microbiol 42:205-14. 109 16. Conway, T., and G. K. Schoolnik. 2003. Microarray expression profiling: capturing a genome-wide portrait of the transcriptome. Mol Microbiol 47:879-89. 17. Csonka, L. N. 1989. Physiological and genetic responses of bacteria to osmotic stress. Microbiol Rev 53:121-147. 18. De Angelis, M. , and M. Gobbetti. 2004. Environmental stress responses in Lactobacillus: a review. Proteomics 4:106-122. 19. DeMaio, J., Y. Zhang, C. Ko, D. B. Young, and W. R. Bishai. 1996. A stationary-phase stress-response sigma factor from Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 93:2790-4. 20. Denef, V. J., J. Park, T. V. Tsoi, J. M. Rouillard, H. Zhang, J. A. Wibbenmeyer, W. Verstraete, E. Gulari, S. A. Hashsham, and J. M. Tiedje. 2004. Biphenyl and benzoate metabolism in a genomic context: outlining genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl Environ Microbiol 70:4961-70. 21. Dieckmann, R., M. Pavela-Vrancic, and H. von Dohren. 2001. Synthesis of (di)adenosine polyphosphates by non-ribosomal peptide synthetases (NRPS). Biochim Biophys Acta 1546:234-41. 22. Epstein, W. 1986. Osmoregulation by potassium transport in Escherichia coli. FEMS Microbiol Rev 39. 23. Epstein, W., V. Whitelaw, and J. Hesse. 1978. A K+ transport ATP-ase in Escherichia coli. J Biol Chem 253:6666-6668. 24. Fabret, C , F. V.A., and H. J.A. 1999. Two-component signal transduction in Bacillus subtilis: How One Organism Sees Its World. J Bacterid 181:1975-1983. 25. Fillingame, R. H., and O. Y. Dmitriev. 2002. Structural model of the transmembrane Fo rotary sector of H+-transporting ATP synthase derived by solution NMR and intersubunit cross-linking in situ. Biochim Biophys Acta 1565:232-45. 26. Foster, P. L. 2005. Stress responses and genetic variation in bacteria. Mutat Res 569:3-11. 27. Franke-Whittle, I. H., S. H. Klammer, and H. Insam. 2005. Design and application of an oligonucleotide microarray for the investigation of compost microbial communities. J Microbiol Methods 62:37-56. 28. Frothingham, R., J. E. Stout, and C. D. Hamilton. 2005. Current issues in global tuberculosis control. Int J Infect Dis 9:297-311. 29. Gao, H., Y. Wang, X. Liu, T. Yan, L. Wu, E. Aim, A. Arkin, D. K. Thompson, and J. Zhou. 2004. Global transcriptome analysis of the heat shock response of Shewanella oneidensis. J Bacteriol 186:7796-803. 30. Gasch, A. P., and M. Werner-Washburne. 2002. The genomics of yeast responses to environmental stress and starvation. Funct Integr Genomics 2:181-92. 31. Gomez, M., L. Doukhan, G. Nair, and I. Smith. 1998. sigA is an essential gene in Mycobacterium smegmatis. Mol Microbiol 29:617-28. 32. Goncalves, E. R., H. Hara, D. Miyazawa, J. E. Davies, L. D. Eltis, and W. W. Mohn. Submitted. Transcriptomic assessment of isozymes in the biphenyl pathway of Rhodococcus sp. RHA1. Applied & Environmental Microbiology. 110 33. Gophna, IL, and E. Z. Ron. 2003. Virulence and the heat shock response. Int J Med Microbiol 292:453-61. 34. Gruber, T. M., and C. A. Gross. 2003. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol 57:441-66. 35. Guckenberger, M., S. Kurz, C. Aepinus, S. Theiss, S. Haller, T. Leimbach, U. Panzner, J. Weber, H. Paul, A. Unkmeir, M. Frosch, and G. Dietrich. 2002. Analysis of the heat shock response of Neisseria meningitidis with cDNA- and oligonucleotide-based DNA microarrays. J Bacteriol 184:2546-51. 36. Guglielmi, G., P. Mazodier, C. J. Thompson, and J. Davies. 1991. A survey of the heat shock response in four Streptomyces species reveals two groEL-like genes and three groEL-like proteins in Streptomyces albus. J Bacteriol 173:7374-81. 37. Gupta, R. S., K. Bustard, M. Falah, and D. Singh. 1997. Sequencing of heat shock protein 70 (DnaK) homologs from Deinococcus proteolyticus and Thermomicrobium roseum and their integration in a protein-based phylogeny of prokaryotes. J Bacteriol 179:345-57. 38. Gupta, S., and D. Chatterji. 2005. Stress responses in mycobacteria. IUBMB Life 57:149-59. 39. Gupta, S., S. B. Pandit, N. Srinivasan, and D. Chatterji. 2002. Proteomics analysis of carbon-starved Mycobacterium smegmatis: induction of Dps-like protein. Protein Eng 15:503-12. 40. Gurtler, V., B. C. Mayall, and R. Seviour. 2004. Can whole genome analysis refine the taxonomy of the genus Rhodococcus? FEMS Microbiol Rev 28:377-403. 41. Hahn, M. Y., S. Raman, M. Anaya, and R. N. Husson. 2005. The Mycobacterium tuberculosis extracytoplasmic-function sigma factor SigL regulates polyketide synthases and secreted or membrane proteins and is required for virulence. J Bacteriol 187:7062-71. 42. Haupt, M., M. Bramkamp, M. Coles, K. Altendorf, and H. Kessler. 2004. Inter-domain motions of the N-domain of the KdpFABC complex, a P-type ATPase, are not driven by ATP-induced conformational changes. J Mol Biol 342:1547-58. 43. Haydel, S. E. , and J. E. Clark-Curtiss. 2004. Global expression analysis of two-component system regulator genes during Mycobacterium tuberculosis growth in human macrophages. FEMS Microbiol Lett 236:341-7. 44. Hecker, M., W. Schumann, and U. Volker. 1996. Heat-shock and general stress response in Bacillus subtilis. Mol Microbiol 19:417-28. 45. Hecker, M. , and U. Volker. 2001. General stress response of Bacillus subtilis and other bacteria. Adv Microb Physiol 44:35-91. 46. Heermann, R., K. Altendorf, and K. Jung. 2003. The N-terminal input domain of the sensor kinase KdpD of Escherichia coli stabilizes the interaction between the cognate response regulator KdpE and the corresponding DNA-binding site. J Biol Chem 278:51277-84. 47. Heermann, R., A. Fohrmann, K. Altendorf, and K. Jung. 2003. The transmembrane domains of the sensor kinase KdpD of Escherichia coli are not essential for sensing K+ limitation. Mol Microbiol 47:839-48. I l l 48. Heermann, R., and K. Jung. 2004. Structural features and mechanisms for sensing high osmolality in microorganisms. Curr Opin Microbiol 7:168-74. 49. Helmann, J. D. 2002. The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol 46:47-110. 50. Helmann, J. D., M. F. Wu, P. A. Kobel, F. J. Gamo, M. Wilson, M. M. Morshedi, M. Navre, and C. Paddon. 2001. Global transcriptional response of Bacillus subtilis to heat shock. J Bacterid 183:7318-28. 51. Hengge-Aronis, R. 1996. Back to log phase: sigma S as a global regulator in the osmotic control of gene expression in Escherichia coli. Mol Microbiol 21:887-93. 52. Hengge-Aronis, R. 2002. Signal transduction and regulatory mechanisms involved in control of the sigma(S) (RpoS) subunit of RNA polymerase. Microbiol Mol Biol Rev 66:373-95. 53. Hengge-Aronis, R., R. Lange, N. Henneberg, and D. Fischer. 1993. Osmotic regulation of rpoS-dependent genes in Escherichia coli. J Bacterid 175:259-65. 54. Hokamp, K., F. M. Roche, M. Acab, M. E. Rousseau, B. Kuo, D. Goode, D. Aeschliman, J. Bryan, L. A. Babiuk, R. E. Hancock, and F. S. Brinkman. 2004. ArrayPipe: a flexible processing pipeline for microarray data. Nucleic Acids Res 32:W457-9. 55. Holtmann, G., E. P. Bakker, N. Uozumi, and E. Bremer. 2003. KtrAB and KtrCD: two K+ uptake systems in Bacillus subtilis and their role in adaptation to hypertonicity. J Bacteriol 185:1289-98. 56. Holtmann, G., M. BriguIIa, L. Steil, A. Schutz, K. Barnekow, U. Volker, and E. Bremer. 2004. RsbV-independent induction of the SigB-dependent general stress regulon of Bacillus subtilis during growth at high temperature. J Bacteriol 186:6150-8. 57. Homuth, G., S. Domm, D. Kleiner, and W. Schumann. 2000. Transcriptional analysis of major heat shock genes of Helicobacter pylori. J Bacteriol 182:4257-63. 58. Hoper, D., J. Bernhardt, and M. Hecker. 2006. Salt stress adaptation of Bacillus subtilis: a physiological proteomics approach. Proteomics 6:1550-62. 59. Hoper, D., U. Volker, and M . Hecker. 2005. Comprehensive Characterization of the Contribution of Individual SigB-Dependent General Stress Genes to Stress Resistance of Bacillus subtilis. J. Bacteriol. 187:2810-2826. 60. Hutchings, M. I., P. A. Hoskisson, G. Chandra, and M. J. Buttner. 2004. Sensing and responding to diverse extracellular signals? Analysis of the sensor kinases and response regulators of Streptomyces coelicolor A3 (2). Microbiology 150:2795-806. 61. Jishage, M. , A. Iwata, S. Ueda, and A. Ishihama. 1996. Regulation of RNA polymerase sigma subunit synthesis in Escherichia coli: intracellular levels of four species of sigma subunit under various growth conditions. J Bacteriol 178:5447-51. 62. Karoonuthaisiri, N., D. Weaver, J. Huang, S. N. Cohen, and C. M. Kao. 2005. Regional organization of gene expression in Streptomyces coelicolor. Gene 353:53-66. 112 63. Kazmierczak, M. J., S. C. Mithoe, K. J. Boor, and M. Wiedmann. 2003. Listeria monocytogenes sigma B regulates stress response and virulence functions. J Bacteriol 185:5722-34. 64. Kirstein, J., and K. Turgay. 2005. A new tyrosine phosphorylation mechanism involved in signal transduction in Bacillus subtilis. J M o l Microbiol Biotechnol 9:182-8. 65. Kormanec, J., B. Sevcikova, N. Halgasova, R. Knirschova, and B. Rezuchova. 2000. Identification and transcriptional characterization of the gene encoding the stress-response sigma factor sigma(H) in streptomyces coelicolor A3(2). F E M S Microbiol Lett 189:31-8. 66. Kramer, R., and S. Morbach. 2004. BetP of Corynebacterium glutamicum, a transporter with three different functions: betaine transport, osmosensing, and osmoregulation. Biochim Biophys Acta 1658:31-6. 67. Kuhlmann, A. IL , and E. Bremer. 2002. Osmotically regulated synthesis of the compatible solute ectoine in Bacillus pasteurii and related Bacillus spp. A p p l Environ Microbiol 68:772-83. 68. Kvint, K., L. Nachin, A. Diez, and T. Nystrom. 2003. The bacterial universal stress protein: function and regulation. Curr Opin Microbiol 6:140-5. 69. Lashkari, D. A., J. L. DeRisi, J. H. McCusker, A. F. Namath, C. Gentile, S. Y . Hwang, P. O. Brown, and R. W. Davis. 1997. Yeast microarrays for genome wide parallel genetic and gene expression analysis. Proc Natl Acad Sci U S A 94:13057-62. 70. Lee, E. J., Y . H. Cho, H. S. Kim, B. E. Ahn, and J. H. Roe. 2004. Regulation of sigmaB by an anti- and an anti-anti-sigma factor in Streptomyces coelicolor in response to osmotic stress. J Bacteriol 186:8490-8. 71. Levin, G., and P. Blount. 2004. Cysteine scanning of M s c L transmembrane domains reveals residues critical for mechanosensitive channel gating. Biophys J 86:2862-70. 72. Lomovskaya, O. L. , J. P. Kidwell, and A. Matin. 1994. Characterization of the sigma 38-dependent expression of a core Escherichia coli starvation gene, pexB. J Bacteriol 176:3928-35. 73. Lopez, C. S., H. Heras, S. M. Ruzal, C. Sanchez-Rivas, and E. A. Rivas. 1998. Variations of the envelope composition of Bacillus subtilis during growth in hyperosmotic medium. Curr Microbiol 36:55-61. 74. Loprasert, S., W. Whangsuk, R. Sallabhan, and S. Mongkolsuk. 2004. D p s A protects the human pathogen Burkholderia pseudomallei against organic hydroperoxide. Arch Microbiol 182:96-101. 75. Lund, P. A. 2001. Microbial molecular chaperones. A d v Microb Physiol 44:93-140. 76. Madsen, M. L., D. Nettleton, E. L. Thacker, R. Edwards, and F. C. Minion. 2006. Transcriptional profiling of Mycoplasma hyopneumoniae during heat shock using microarrays. Infect Immun 74:160-6. 77. Malin, G., and A. Lapidot. 1996. Induction of synthesis of tetrahydropyrimidine derivatives in Streptomyces strains and their effect on Escherichia coli in response to osmotic and heat stress. J Bacteriol 178:385-95. 113 78. Manganelli, R., R. Provvedi, S. Rodrigue, J. Beaucher, L. Gaudreau, and I. Smith. 2004. Sigma factors and global gene regulation in Mycobacterium tuberculosis. J Bacteriol 186:895-902. 79. Manganelli, R., M. I. Voskuil, G. K. Schoolnik, E. Dubnau, M. Gomez, and I. Smith. 2002. Role of the extracytoplasmic-function sigma factor sigma(H) in Mycobacterium tuberculosis global gene expression. Mol Microbiol 45:365-74. 80. Margesin, R., P. A. Fonteyne, and B. Redl. 2005. Low-temperature biodegradation of high amounts of phenol by Rhodococcus spp. and basidiomycetous yeasts. Res Microbiol 156:68-75. 81. Martinac, B. 2004. Mechanosensitive ion channels: molecules of mechanotransduction. J Cell Sci 117:2449-60. 82. McLeod, M., R. L. Warren., N. Araki., W. W. L. Hsiao., M. Myhre., C. Fernandes., D. Miyazawa, W. Wong, A. L. Lillquist, D. Wang, M. Dosanjh, H. Hara, A. Petrescu, R. D. Morin, G. Yang, J. M. Stott, J. E. Schein, H. Shin, D. Smailus, A. S. Siddiqui, M. A. Marra, S. J. M. Jones, R. Holt, F. S. L. Brinkman, K. Miyauchi, M. Fukuda, J. E. Davies, W. W. Mohn, and L. D. Eltis. The complete genome of Rhodococcus sp. RHA1: insights into a catabolic powerhouse. PNAS. In press. 83. Mijakovic, I., D. Petranovic, N. Bottini, J. Deutscher, and P. Ruhdal Jensen. 2005. Protein-tyrosine phosphorylation in Bacillus subtilis. J Mol Microbiol Biotechnol 9:189-97. 84. Mockler, T. C , S. Chan, A. Sundaresan, H. Chen, S. E. Jacobsen, and J. R. Ecker. 2005. Applications of DNA tiling arrays for whole-genome analysis. Genomics 85:1-15. 85. Moen, B., A. Oust, O. Langsrud, N. Dorrell, G. L. Marsden, J. Hinds, A. Kohler, B. W. Wren, and K. Rudi. 2005. Explorative multifactor approach for investigating global survival mechanisms of Campylobacter jejuni under environmental conditions. Appl Environ Microbiol 71:2086-94. 86. Moker, N., M. Brocker, S. Schaffer, R. Kramer, S. Morbach, and M. Bott. 2004. Deletion of the genes encoding the MtrA-MtrB two-component system of Corynebacterium glutamicum has a strong influence on cell morphology, antibiotics susceptibility and expression of genes involved in osmoprotection. Mol Microbiol 54:420-38. 87. Morbach, S., and R. Kramer. 2002. Body shaping under water stress: osmosensing and osmoregulation of solute transport in bacteria. Chembiochem 3:384-97. 88. Morbach, S., and R. Kramer. 2003. Impact of transport processes in the osmotic response of Corynebacterium glutamicum. J Biotechnol 104:69-75. 89. Muffler, A., S. Bettermann, M. Haushalter, A. Horlein, U. Neveling, M. Schramm, and O. Sorgenfrei. 2002. Genome-wide transcription profiling of Corynebacterium glutamicum after heat shock and during growth on acetate and glucose. J Biotechnol 98:255-68. 90. Neufeld, J. D., W. W. Mohn, and V. de Lorenzo. 2006. Composition of microbial communities in hexachlorocyclohexane (HCH) contaminated soils from Spain revealed with a habitat-specific microarray. Environ Microbiol 8:126-40. 114 91. Nottebrock, D., U. Meyer, R. Kramer, and S. Morbach. 2003. Molecular and biochemical characterization of mechanosensitive channels in Corynebacterium glutamicum. FEMS Microbiol Lett 218:305-9. 92. O'Toole, R., and H. D. Williams. 2003. Universal stress proteins and Mycobacterium tuberculosis. Res Microbiol 154:387-92. 93. Ojha, A., M. Anand, A. Bhatt, L. Kremer, W. R. Jacobs, Jr., and G. F. Hatfull. 2005. GroELl: a dedicated chaperone involved in mycolic acid biosynthesis during biofilm formation in mycobacteria. Cell 123:861-73. 94. Paradkar, A., A. Trefzer, R. Chakraburtty, and D. Stassi. 2003. Streptomyces genetics: a genomic perspective. Crit Rev Biotechnol 23:1-27. 95. Patrauchan, M. A., C. Florizone, M. Dosanjh, W. W. Mohn, J. Davies, and L. D. Eltis. 2005. Catabolism of benzoate and phthalate in Rhodococcus sp. strain RHA1: redundancies and convergence. J Bacteriol 187:4050-63. 96. Pelletier, C , C. Bouley, C. Cayuela, S. Bouttier, P. Bourlioux, and M. N. Bellon-Fontaine. 1997. Cell surface characteristics of Lactobacillus casei subsp. casei, Lactobacillus paracasei subsp. paracasei, and Lactobacillus rhamnosus strains. Appl Environ Microbiol 63:1725-31. 97. Poolman, B., P. Blount, J. H. Folgering, R. H. Friesen, P. C. Moe, and T. van der Heide. 2002. How do membrane proteins sense water stress? Mol Microbiol 44:889-902. 98. Pratt, L. A., and T. J. Silhavy. 1995. Porin regulation of Escherichia coli, p. 105-128. In T. S. J Hoch (ed.), Two-Component Signal Transduction. A S M Press, Washington, DC. 99. Puglia, A. M. , J. Vohradsky, and C. J. Thompson. 1995. Developmental control of the heat-shock stress regulon in Streptomyces coelicolor. Mol Microbiol 17:737-46. 100. Quackenbush, J. 2001. Computational analysis of microarray data. Nat Rev Genet 2:418-27. 101. Raman, S., T. Song, X. Puyang, S. Bardarov, W. R. Jacobs, Jr., and R. N. Husson. 2001. The alternative sigma factor SigH regulates major components of oxidative and heat stress responses in Mycobacterium tuberculosis. J Bacteriol 183:6119-25. 102. Ramos, J. L. , M. T. Gallegos, S. Marques, M. I. Ramos-Gonzalez, M. Espinosa-Urgel, and A. Segura. 2001. Responses of Gram-negative bacteria to certain environmental stressors. Curr Opin Microbiol 4:166-71. 103. Rohlin, L. , J. D. Trent, K. Salmon, U. Kim, R. P. Gunsalus, and J. C. Liao. 2005. Heat shock response of Archaeoglobus fulgidus. J Bacteriol 187:6046-57. 104. Rosen, R., and E. Z. Ron. 2002. Proteome analysis in the study of the bacterial heat-shock response. Mass Spectrometry Reviews 21:244-265. 105. Schumann, W. 2003. The Bacillus subtilis heat shock stimulon. Cell Stress Chaperones 8:207-17. 106. Servant, P., and P. Mazodier. 2001. Negative regulation of the heat shock response in Streptomyces. Arch Microbiol 176:237-42. 107. Seto, M., K. Kimbara, M . Shimura, T. Hatta, M. Fukuda, and K. Yano. 1995. A Novel Transformation of Polychlorinated Biphenyls by Rhodococcus sp. Strain RHA1. Appl Environ Microbiol 61:3353-3358. 115 108. Sevcikova, B., and J. Kormanec. 2004. Differential production of two antibiotics of Streptomyces coelicolor A3(2), actinorhodin and undecylprodigiosin, upon salt stress conditions. Arch Microbiol 181:384-9. 109. Siegele, D. A. 2005. Universal stress proteins in Escherichia coli. J Bacteriol 187:6253-4. 110. Sleator, R. D. 2001. Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol Rev 2001:49-71. 111. Sleator, R. D., C. G. Gahan, and C. Hill. 2003. A postgenomic appraisal of osmotolerance in Listeria monocytogenes. Appl Environ Microbiol 69:1-9. 112. Smoot, L. M., J. C. Smoot, M. R. Graham, G. A. Somerville, D. E. Sturdevant, C. A. Migliaccio, G. L. Sylva, and J. M. Musser. 2001. Global differential gene expression in response to growth temperature alteration in group A Streptococcus. Proc Natl Acad Sci U S A 98:10416-21. 113. Spohn, G., and V. Scarlato. 1999. The autoregulatory HspR repressor protein governs chaperone gene transcription in Helicobacter pylori. Mol Microbiol 34:663-74. 114. Stekel, D. 2003. Microarray Bioinformatics. Cambridge University Press, Cambridge. 115. Stewart, G. R., L. Wernisch, R. Stabler, J. A. Mangan, J. Hinds, K. G. Laing, D. B. Young, and P. D. Butcher. 2002. Dissection of the heat-shock response in Mycobacterium tuberculosis using mutants and microarrays. Microbiology 148:3129-38. 116. Steyn, A. J., J. Joseph, and B. R. Bloom. 2003. Interaction of the sensor module of Mycobacterium tuberculosis H37Rv KdpD with members of the Lpr family. Mol Microbiol 47:1075-89. 117. Stokes, N. R., H. D. Murray, C. Subramaniam, R. L. Gourse, P. Louis, W. Bartlett, S. Miller, and I. R. Booth. 2003. A role for mechanosensitive channels in survival of stationary phase: regulation of channel expression by RpoS. Proc Natl Acad Sci U S A 100:15959-64. 118. Tzvetkov, M. , C. Klopprogge, O. Zelder, and W. Liebl. 2003. Genetic dissection of trehalose biosynthesis in Corynebacterium glutamicum: inactivation of trehalose production leads to impaired growth and an altered cell wall lipid composition. Microbiology 149:1659-73. 119. van der Geize, R., and L. Dijkhuizen. 2004. Harnessing the catabolic diversity of rhodococci for environmental and biotechnological applications. Curr Opin Microbiol 7:255-61. 120. Varela, C , E. Agosin, M. Baez, M. Klapa, and G. Stephanopoulos. 2003. Metabolic flux redistribution in Corynebacterium glutamicum in response to osmotic stress. Appl Microbiol Biotechnol 60:547-55. 121. Vohradsky, J., X. M. Li, G. Dale, M. Folcher, L. Nguyen, P. H. Viollier, and C. J. Thompson. 2000. Developmental control of stress stimulons in Streptomyces coelicolor revealed by statistical analyses of global gene expression patterns. J Bacteriol 182:4979-86. 122. Waltermann, M. , H. Luftmann, D. Baumeister, R. Kalscheuer, and A. Steinbuchel. 2000. Rhodococcus opacus strain PD630 as a new source of high-116 value single-cell oil? Isolation and characterization of triacylglycerols and other storage lipids. Microbiology 146 ( Pt 5):1143-9. 123. Wang, L., C. Fab ret, K. Kanamaru, K. Stephenson, V. Dartois, M. Perego, and J. A. Hoch. 2001. Dissection of the functional and structural domains of phosphorelay histidine kinase A of Bacillus subtilis. J Bacteriol 183:2795-802. 124. Wendisch, V. F. 2003. Genome-wide expression analysis in Corynebacterium glutamicum using DNA microarrays. J Biotechnol 104:273-85. 125. Whatmore, A. M., J. A. Chudek, and R. H. Reed. 1990. The effects of osmotic upshock on the intracellular solute pools of Bacillus subtilis. J Gen Microbiol 136:2527-35. 126. Wolf, A., R. Kramer, and S. Morbach. 2003. Three pathways for trehalose metabolism in Corynebacterium glutamicum ATCC13032 and their significance in response to osmotic stress. Mol Microbiol 49:1119-34. 127. Wood, J. M. 1999. Osmosensing by bacteria: signals and membrane-based sensors. Microbiol Mol Biol Rev 63:230-62. 128. Woodruff, P. J., B. L. Carlson, B. Siridechadilok, M. R. Pratt, R. H. Senaratne, J. D. Mougous, L. W. Riley, S. J. Williams, and C. R. Bertozzi. 2004. Trehalose is required for growth of Mycobacterium smegmatis. J Biol Chem 279:28835-43. 129. Wosten, M. M. 1998. Eubacterial sigma-factors. FEMS Microbiol Rev 22:127-50. 130. Yura, T., and K. Nakahigashi. 1999. Regulation of the heat-shock response. Curr Opin Microbiol 2:153-8. 131. Zhao, G., P. Ceci, A. Ilari, L. Giangiacomo, T. M. Laue, E. Chiancone, and N. D. Chasteen. 2002. Iron and hydrogen peroxide detoxification properties of DNA-binding protein from starved cells. A ferritin-like DNA-binding protein of Escherichia coli. J Biol Chem 277:27689-96. APPENDICES Appendix A Expression data for genes described in the heat shock' Time upon treatment (min) 0 5 15 30 45 60 90 120 180 Gene ID Gene Name Gene Product Expression ratio Signal intensityb ro00098d sigma factor, sigma 70 type, group 3 0.9 2.9 1.1 1.2 1.0 1.5 1.4 1.5 10.3 8.8 42.7 21.7 54.8 44.9 75.0 34.0 37.9 ro00105 conserved hypothetical protein 2.6 25.2 15.2 10.7 7.5 5.3 1.9 1.7 14.9 39.0 207.6 269.2 167.5 149.5 78.8 44.7 29.4 ro00146 apolipoprotein N-acyltransferase 0.4 1.0 1.2 1.6 1.3 1.0 1.3 1.1 39.1 15.0 74.1 79.0 186.1 143.5 195.1 190.2 162.0 ro00238 conserved hypothetical protein 3.0 4.7 3.5 1.9 1.8 1.8 1.2 1.2 264.7 792.1 943.5 300.8 785.8 838.8 698.1 518.4 662.8 ro00311 probable transposase 0.9 1.2 2.1 1.5 1.6 1.2 1.6 1.0 69.4 178.7 448.1 595.9 1413.4 1263.7 1382.2 1068.8 645.1 ro00322 leuBl 3-isopropylmalate dehydrogenase 3.0 2.8 2.0 1.5 3.5 3.3 4.0 6.9 278.1 846.0 633.2 668.4 812.5 1565.5 1944.7 1700.3 4752.8 ro00383 probable betaine-aldehyde dehydrogenase 1.6 3.1 2.3 1.9 1.0 1.2 0.8 1.2 173.3 285.1 356.6 359.7 418.0 261.1 313.8 189.7 165.5 ro00392 monooxygenase 1.0 0.9 2.1 1.4 0.9 1.0 0.8 0.7 65.9 63.1 53.3 53.1 130.4 87.2 96.6 70.7 75.2 ro00448 groELJ 60 kDa chaperonin GroEL 1.5 3.7 2.1 2.6 0.8 0.8 0.7 1.2 164.9 251.6 302.4 307.6 360.4 194.0 173.2 138.4 153.4 a Based on difference in expression ratio (time post-treatment / immediately pre-treatment); P < 0.05, n = 3 b Uncorrected average probe signal intensity; n = 3 0 Probe lacks specificity due to high similarity of genes d No significance difference in expression ratio between time post-treatment and immediately pre-treatment for any time point (P > 0.05) Appendix A - Continued ro00480 hyuB hydantoin utilization protein B 1.0 1.1 1.2 1.4 2.5 3.4 4.0 11.3 217.1 222.1 348.9 426.9 819.0 1167.5 2762.0 2056.7 6647.1 ro00523 probable methylenetetrahydromethanopterin reductase 1.1 2.1 1.4 1.9 1.8 3.0 4.0 5.5 86.1 98.3 104.7 96.2 206.0 169.6 371.2 477.3 679.3 ro00543 dihydrolipoyllysine-residue succinyltransferase 1.1 1.1 1.4 1.7 2.2 2.5 4.9 12.0 19.3 21.1 15.8 18.2 47.6 50.7 92.1 159.5 268.9 ro00554 hypothetical protein 1.2 1.3 1.4 1.7 3.4 3.8 3.8 10.1 160.6 192.5 626.6 707.0 1148.6 2719.7 4275.1 2286.5 7337.5 ro00609 dadAl D-amino acid dehydrogenase small chain subunit 7.0 7.9 2.9 3.0 3.2 2.3 2.5 2.4 48.7 342.1 970.6 390.4 749.9 826.5 568.2 522.8 526.6 ro00636 conserved hypothetical protein 1.5 2.6 1.9 3.1 2.2 2.2 2.8 7.2 133.1 197.7 231.0 129.7 547.3 432.3 482.1 607.3 1364.9 ro00670 possible IS element ATP4}inding protein 1.9 1.5 1.4 1.4 2.7 3.6 5.5 8.0 15.1 852.5 567.7 419.5 1015.7 1674.5 2711.4 3344.0 5432.2 ro00677 possible extracellular protein 2.1 4.9 8.1 9.4 6.2 5.1 5.0 10.1 111.0 237.4 452.0 405.4 2007.4 641.5 729.5 547.1 819.4 ro00758 hypothetical protein 3.5 9.3 7.6 18.6 14.8 10.4 3.6 3.9 9.7 33.4 102.1 163.2 311.3 232.0 106.5 67.0 34.6 ro00759 acyl-CoA dehydrogenase 3.7 0.9 1.2 0.4 0.5 0.5 0.8 0.4 4.5 16.7 5.8 6.0 4.5 5.2 8.3 13.5 3.4 ro00861 multidrug resistance transporter, MFS superfamily 1.2 0.4 0.1 0.3 0.0 1.1 0.0 1.5 6.7 8.0 2.0 0.5 6.3 0.8 4.8 0.3 22.8 ro00945 A B C transporter, permease component 3.0 1.7 1.1 0.9 1.0 1.0 1.0 1.0 28.1 84.5 54.8 26.7 39.6 37.3 40.6 29.4 35.3 ro00961 rplT 50S ribosomal protein L20 0.5 0.3 0.5 0.1 0.2 0.2 0.2 0.3 241.6 125.7 59.1 50.6 67.5 52.7 54.8 86.9 86.2 ro00989 thioredoxin 1.4 1.5 1.7 1.5 1.1 1.4 1.0 3.3 47.7 66.4 54.8 112.3 144.3 55.0 94.1 88.6 190.0 ro01037 nadB L-aspartate oxidase 1.3 1.6 0.4 0.3 0.1 0.2 0.2 0.2 39.2 50.7 45.7 10.7 15.3 2.8 8.8 6.3 10.4 Appendix A - Continued ro01471 atpC H(+)-transporting two-sector ATPase 1.5 0.9 0.8 0.3 0.8 0.5 0.4 0.7 epsilon subunit 46.0 67.1 41.6 23.4 14.9 42.8 18.8 24.7 26.8 ro01472 atpD H(+)-transporting two-sector ATPase beta 0.9 0.6 0.4 0.3 0.2 0.2 0.3 0.3 subunit 579.3 500.9 333.1 215.9 210.2 161.1 • 218.6 217.8 184.2 ro01474 atpA H(+)-transporting two-sector ATPase alpha 0.7 0.2 0.1 0.2 0.1 0.1 0.1 0.2 subunit 157.4 117.4 98.7 45.1 112.4 63.1 63.4 71.9 92.4 ro01599 A B C transporter, permease component 0.6 0.5 0.5 0.4 0.3 0.3 0.4 0.3 65.4 41.1 97.1 55.8 107.8 82.6 90.1 84.5 84.7 ro01653 probable helicase 6.1 9.8 5.6 5.6 4.6 4.3 4.9 4.9 33.1 200.4 423.9 374.2 722.2 423.8 548.5 392.7 515.8 ro01673 sigma factor, sigma 70 type, probable group 2 1.3 0.9 2.6 0.9 0.9 1.6 1.2 3.2 13.9 18.0 12.0 29.8 26.3 19.3 58.2 28.2 189.3 ro01716 possible MaoC dehydratase 0.8 0.6 0.2 0.4 0.4 0.6 0.3 0.5 50.6 38.2 43.0 14.5 35.6 47.0 76.3 22.5 69.0 ro01833 conserved hypothetical protein . 2.2 6.6 8.9 6.8 3.3 4.4 2.1 2.8 48.0 104.8 168.4 200.9 224.6 225.1 219.7 113.4 114.5 ro01872 transcriptional regulator, TetR family 1.5 2.2 1.8 2.5 1.7 1.5 1.5 1.2 480.5 724.8 1638.2 1400.9 2779.7 2286.0 2715.4 1593.8 1418.4 ro01895 A B C amino acid transporter, ATP-binding 0.5 1.8 1.1 1.1 1.1 1.1 1.4 1.3 component 74.1 9.8 37.4 25.9 49.5 53.8 73.2 59.2 55.7 ro01900 possible transcriptional regulator, MarR family 1.7 1.6 2.2 1.7 1.8 1.3 1.7 1.0 19.2 32.8 65.6 51.4 100.0 56.1 73.2 65.0 57.7 ro01942 probable adenylate cyclase 2.1 2.3 3.1 2.4 4.0 3.3 5.0 6.4 594.9 1276.0 3561.4 3610.1 7062.5 6704.0 8463.0 8494.2 12104.7 ro01997 menD 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1 - 1.5 1.8 2.5 1.2 1.0 1.4 1.2 1.5 carboxylate synthase 41.3 62.3 44.8 17.8 62.8 75.6 83.4 78.5 63.5 ro01999 probable siderophore interacting protein 1.4 0.7 2.6 i.7 2.1 4.0 4.8 4.8 14.3 20.1 28.8 82.6 190.8 151.2 441.6 228.3 337.8 ro02013 A B C transporter, ATP-binding protein 1.9 2.4 1.5 1.8 2.9 2.4 2.6 5.4 552.8 1025.4 1599.6 1054.5 2450.0 3053.4 3519.6 2302.2 6319.2 Appendix A - Continued ro02099 anion cation symporter, MFS family 2.3 1.2 0.8 161.3 378.0 133.2 166.2 ro02141 prolyl oligopeptidase 2.2 0.4 0.6 7.2 16.0 10.3 6.9 ro02146d groEL2 60 kDa chaperonin GroEL 2.7 1.7 1.8 989.0 2676.3 2565.6 734.7 ro02161 probable ATPase involved in cell division 1.0 0.7 1.1 42.5 44.1 19.3 41.5 ro02224 A B C peptide transporter, permease component 0.8 0.2 0.6 7.8 6.0 1.5 2.4 ro02257 conserved hypothetical protein 3.5 3.6 2.9 55.7 195.6 354.4 349.1 ro02281 conserved hypothetical protein 1.0 3.9 3.3 29.2 13.3 83.2 65.0 ro02377 multicopper oxidase 1.4 1.7 1.3 156.6 221.0 300.7 159.4 ro02379 phenol hydroxylase, reductase component 1.3 1.6 2.9 78.4 100.5 50.2 67.5 ro02380 phenol 2-monoxygenase, oxygenase component 1.2 1.5 1.7 48.1 57.6 88.3 183.8 ro02432 possible membrane protein 0.8 0.6 0.2 76.9 19.6 8.2 2.7 ro02492 cyclohexanone monooxygenase 0.5 0.9 2.7 5.0 2.4 5.8 9.7 ro02500 conserved hypothetical protein 4.5 9.8 5.5 158.0 718.5 1744.5 805.3 ro02506 possible suppressor protein DnaK 0.8 0.9 0.9 103.3 87.5 77.8 60.8 ro02513 pheA2 phenol hydroxylase, reductase component 1.1 1.3 1.2 25.9 27.4 35.2 37.1 1.5 1.1 281.1 265.2 0.0 0.3 2.0 9.6 1.7 2.1 4209.6 3154.4 0.7 1.1 66.0 47.6 0.6 0.5 8.2 7.3 2.3 4.7 470.3 730.2 3.3 5.6 166.6 182.0 1.0 1.3 393.9 320.8 2.1 4.0 252.9 530.6 2.8 3.4 381.9 663.8 0.0 0.6 0.3 2.5 5.7 2.2 6.7 7.9 9.2 5.0 1674.7 485.3 0.9 0.8 111.4 108.3 1.6 2.5 91.9 127.1 I. 2 0.7 265.4 165.0 0.4 1.2 12.0 22.2 1.6 0.6 3110.8 1068.7 1.6 1.1 83.1 50.1 0.4 1.7 II. 8 13.3 4.8 4.9 921.7 714.5 3.5 5.4 123.1 168.2 1.2 1.9 463.4 665.7 9.7 5.9 1639.5 923.9 6.3 7.4 1806.0 1416.5 2.3 0.4 16.8 6.6 0.7 5.0 7.0 15.5 3.4 2.1 858.7 • 395.2 1.1 1.3 140.9 198.2 4.5 4.6 303.1 238.3 0.8 167.5 0.5 16.4 1.8 3303.9 1.3 46.0 2.1 25.3 11.1 802.8 3.0 107.6 4.1 1501.1 15.2 2592.4 10.9 4923.6 I. 2 5.3 0.6 3.9 3.1 343.2 1.4 171.8 II. 5 616.3 O ro02514 pheAl ro02520 ro02625 ro02626 ro02652 ro02722 ro02726 ro02735 ro02749 ro02780 ro02805 ro02808 ro02855 paaK ro02858 paaH ro02859 paaG ro02860 paaB Appendix phenol hydroxylase, oxygenase component hypothetical protein hypothetical protein transcriptional regulator possible ferredoxin possible phosphotransferase possible short chain oxidoreductase probable 3-oxoacyl-[acyl-carrier-protein] reductase possible Mce family protein possible transcriptional regulator, TetR family A B C sugar transporter, permease component probable transcriptional regulator phenylacetic acid degradation ring hydroxylating complex protein 5 phenylacetic acid degradation ring hydroxylating complex protein 2 phenylacetic acid degradation ring hydroxylating complex protein 1 enoyl-CoA hydratase A - Continued 1.0 0.7 132.3 133.8 66.1 1.9 1.7 68.2 132.8 74.6 1.1 0.9 16.2 17.3 11.0 0.4 0.7 16.2 8.0 17.8 0.5 0.5 170.0 87.1 64.4 0.8 0.4 70.6 58.4 25.8 2.0 1.3 888.6 1768.3 1315.9 0.8 0.8 14.0 11.1 15.7 4.2 8.9 65.9 275.4 664.8 0.6 0.4 57.1 35.5 22.1 3.4 1.7 624.6 2093.5 831.2 8.7 3.9 6.7 58.4 29.8 7.1 23.0 21.2 151.0 477.3 6.1 29.4 102.7 629.4 1268.5 24.1 105.0 7.7 185.0 1481.0 7.3 12.2 1.3 1.4 2.0 117.1 352.0 189.8 1.3 1.5 1.3 83.7 142.4 91.0 0.9 1.6 1.6 16.7 39.4 36.4 0.6 0.6 1.2 23.3 45.9 45.7 0.3 0.3 0.3 38.7 83.8 52.2 0.3 0.3 0.3 26.2 24.2 39.1 2.1 0.6 1.1 2358.5 1180.6 1218.9 0.3 1.8 2.2 2.6 37.1 69.6 10.1 6.3 7.3 460.6 1259.4 645.0 0.6 1.1 0.9 46.2 107.2 69.5 0.9 0.9 1.4 359.7 959.0 1092.9 0.8 0.5 0.5 3.5 9.1 2.6 25.4 17.5 5.3 1228.8 1003.7 203.6 7.5 9.5 5.3 803.5 1713.9 727.4 67.7 44.6 15.0 1370.1 1573.7 188.3 9.0 9.7 2.2 4.2 4.0 9.5 931.6 882.0 2058.6 2.9 3.6 8.3 206.3 347.8 479.9 4.4 10.4 7.6 69.6 61.5 160.6 0.9 1.4 2.0 48.5 48.8 42.4 0.3 0.3 0.4 64.4 61.6 45.8 0.2 0.3 0.3 27.6 31.7 27.3 1.0 0.7 0.8 1750.1 844.9 1246.8 5.7 8.3 11.2 153.0 171.8 283.5 3.9 2.4 2.7 556.5 300.5 263.2 1.0 1.1 1.1 126.9 85.3 88.2 0.8 0.8 0.8 935.2 574.2 735.1 0.8 1.6 0.5 11.1 10.2 3.3 0.6 0.9 1.2 41.0 49.1 52.4 1.1 0.8 1.1 202.5 107.5 109.0 2.2 1.8 0.8 22.1 7.9 4.4 1.9 1.5 1.8 Appendix A - Continued 16.0 117.3 290.7 195.3 573.1 91.9 76.9 68.6 78.4 ro02861 paaC 3-hydroxyacyl-CoA dehydrogenase 2.4 4.0 2.5 4.2 0.9 0.9 0.9 0.6 32.9 79.0 156.0 144.8 336.9 60.5 67.4 57.5 38.6 ro02862 paaA enoyl-CoA hydratase 2.8 2.8 2.3 1.8 0.8 0.8 0.7 0.8 31.2 87.2 137.9 122.4 191.4 72.6 70.1 69.1 81.8 ro02863 paaE beta-ketoadipyl CoA thiolase 2.0 2.1 1.8 1.9 0.7 0.8 0.7 0.6 136.3 273.9 189.3 126.5 351.5 136.1 148.5 129.0 93.6 ro02864 paaN aldehyde dehydrogenase 3.9 8.7 8.1 5.7 1.7 0.5 0.6 0.5 24.2 94.0 89.3 137.5 219.7 48.2 13.2 20.1 17.9 ro02992 probable inositol 2-dehydrogenase 1.3 0.5 0.5 0.3 0.4 0.3 0.7 0.3 63.9 85.5 36.0 37.2 38.8 35.6 30.3 54.7 30.6 ro02993 conserved hypothetical protein 1.2 0.5 0.6 0.2 0.3 0.2 0.3 0.3 43.4 54.1 18.5 27.3 10.0 17.1 11.8 17.6 18.9 ro02998 sugar transporter, MFS superfamily 1.4 0.7 0.5 0.4 0.4 0.4 0.5 0.2 28.8 40.4 42.8 43.6 47.3 45.8 46.7 27.8 32.6 ro02999 universal stress protein 2.2 1.0 0.5 0.5 0.4 0.4 0.6 0.9 15.7 34.9 34.3 15.0 23.9 12.5 15.6 10.6 35.6 ro03031 transcriptional regulator, GntR family 2.0 3.2 4.8 3.6 2.1 1.3 1.3 1.1 65.3 129.0 159.4 269.5 249.9 176.9 146.0 125.7 84.6 ro03144c A B C Fe(3+) transporter, substrate binding protein SfuA 0.5 0.6 0.7 0.9 0.9 1.0 1.0 1.6 1430.8 76.6 56.3 44.2 162.2 87.0 149.6 141.8 108.1 ro03199| possible resolvase, N-terminal 0.8 1.8 1.7 1.7 2.0 3.9 5.6 8.4 ro00116c 316.6 261.1 157.3 160.0 538.7 759.3 2045.7 2656.0 3803.0 ro03215 probable aromatic acid transporter, MFS superfamily 0.7 0.6 0.5 0.3 0.5 0.4 0.7 0.6 149.6 109.8 152.0 65.4 115.2 120.6 208.4 234.1 291.1 ro03287 hypothetical protein 0.8 0.3 0.2 0.5 0.7 1.6 1.7 2.3 33.7 25.8 10.7 2.6 37.4 28.1 67.5 82.8 89.9 ro03326 possible CBS domain-containing protein 0.8 0.6 0.4 0.4 0.4 0.4 0.4 0.3 107.5 84.5 52.5 54.0 69.8 92.1 71.1 71.7 51.8 ro03386 possible fumarylacetoacetate hydrolase family protein 2.4 1.9 0.7 0.9 1.1 1.2 0.9 0.8 29.2 69.2 40.6 13.3 48.2 45.3 61.9 58.5 34.7 to to Appendix A - Continued ro03402 transcriptional regulator, TetR family 1.2 1.5 2.2 1.8 2.5 2.4 4.1 5.5 41.2 50.6 43.9 52.6 145.1 166.8 207.8 263.1 387.7 ro03404 possible transcription antitermination 0.7 0.4 0.4 0.5 0.9 0.6 0.9 0.6 regulator 131.6 87.5 118.7 129.6 184.7 223.6 280.6 342.9 276.7 ro03409| possible gas vesicle synthesis protein 1.4 2.1 2.3 1.7 3.1 3.3 6.4 10.8 ro00708c 131.7 187.8 421.7 377.2 807.2 584.0 1440.7 1999.2 3298.0 ro03412| conserved hypothetical protein 4.6 6.1 2.9 4.9 2.9 4.5 3.7 1.8 ro00705c 15.8 71.8 99.3 37.5 126.0 63.8 104.1 77.3 35.9 ro03421 conserved hypothetical protein 1.3 4.7 4.5 3.4 2.6 1.4 1.0 1.3 20.3 27.4 82.1 22.0 73.2 81.5 58.8 27.1 24.9 ro03522 possible glycosyltransferase 1.6 2.1 1.8 2.4 1.8 4.0 6.4 28.1 45.7 71.5 65.7 145.3 95.7 119.9 296.9 444.8 1073.4 ro03565 transcriptional regulator, MerR family 2.8 2.0 1.9 2.0 3.6 2.2 2.9 6.1 1809.7 5013.6 3389.2 3679.6 5393.0 10266.1 7921.9 4591.4 13693.5 ro03566 heat shock protein 21.2 33.0 5.7 7.6 4.6 2.6 2.7 2.7 11.5 245.1 483.1 57.0 133.4 41.2 53.4 11.8 34.0 ro03567| hypothetical protein 5.8 26.0 2.8 5.8 2.6 3.1 1.8 2.3 ro08347c 703.9 4050.6 5993.8 3149.6 5994.8 2755.4 2691.2 2032.2 1171.8 ro03602 conserved hypothetical protein 0.3 0.4 0.3 0.3 0.3 0.5 0.5 0.5 53.1 16.3 34.9 23.4 67.7 50.3 73.6 76.8 56.9 ro03604 transcriptional regulator, GntR family 1.2 2.1 1.2 1.7 2.3 4.0 5.9 18.8 71.6 88.3 96.2 76.7 136.3 179.0 423.0 616.7 2258.0 ro03626 probable multidrug resistance 0.7 0.9 2.1 1.3 1.3 1.5 1.7 3.3 transporter,MFS superfam 152.3 113.6 113.8 112.9 369.9 167.7 363.9 367.4 469.4 ro03667 dnaN DNA-directed D N A polymerase III beta 0.9 0.4 0.5 0.5 0.4 0.4 0.6 0.6 subunit 31.6 28.7 24.0 20.9 44.3 38.4 40.3 43.5 48.9 ro03728| probable chaperone protein 0.9 0.9 0.6 1.1 0.8 0.8 1.2 0.7 ro03729c 431.5 378.6 333.6 289.6 602.9 461.1 674.3 552.6 485.3 ro03894 pcaI2 3-oxoacid Co A-transferase alpha subunit 1.1 2.1 1.0 0.9 1.5 1.6 2.4 2.9 35.2 38.7 41.9 17.2 44.4 47.5 39.2 92.2 87.9 to Appendix A - Continued 64.8 107.1 46.1 62.9 145.2 71.2 62.7 54.7 59.8 ro04165 possible vanillate monooxygenase 14.9 35.8 13.5 9.8 11.6 8.7 2.7 5.8 oxygenase subunit 658.5 9788.2 23260.2 9751.8 11522.8 14947.2 14867.3 2884.1 6752.2 ro04199 D N A polymerase III subunit 1.1 1.3 2.2 1.7 3.4 3.7 4.3 9.5 114.9 124.3 237.8 333.5 713.7 1013.4 2268.3 1430.0 4103.9 ro04212 probable transcriptional regulator 0.4 0.2 1.3 0.3 0.9 0.5 1.0 0.5 12.1 4.9 5.9 5.2 13.8 17.4 23.2 24.9 19.0 ro04243 conserved hypothetical protein 1.9 1.1 1.8 2.2 5.1 9.0 11.5 12.4 160.0 304.1 138.9 209.5 550.0 1520.6 3251.4 2622.7 4709.5 ro04244 flavin binding monooxygenase 1.9 2.1 2.3 4.4 4.9 7.0 7.3 5.2 24.7 46.5 58.5 63.2 323.0 326.0 598.5 454.1 297.2 ro04308 Fe(3+) uptake regulator 2.1 1.0 0.7 1.3 0.6 0.7 0.8 0.6 6.9 14.8 25.4 24.7 65.6 25.3 40.1 21.2 22.3 ro04496 A B C transporter, ATP-binding component 0.8 3.1 3.6 6.1 2.9 6.5 2.8 7.3 10.7 8.9 10.4 17.1 11.1 33.5 21.1 16.9 38.3 ro04564 transcriptional regulator, LacI family 1.8 1.0 0.4 0.5 0.7 1.5 1.8 0.8 16.4 29.7 14.4 9.1 17.2 24.7 28.2 38.0 23.2 ro04568 possible glycosidase 3.1 5.2 14.7 2.8 3.8 2.3 1.9 1.4 4.5 13.8 36.2 44.8 39.9 53.6 44.3 20.2 18.8 ro04616 conserved hypothetical protein 2.2 9.8 8.9 7.9 4.2 6.1 2.7 2.3 51.9 116.2 311.9 218.2 742.2 417.9 634.3 258.9 182.5 ro04695 hsd4A 17-beta-hydroxysteroid dehydrogenase 2.9 5.8 2.6 3.9 3.0 2.9 0.9 1.5 106.5 305.8 278.0 363.2 426.8 424.1 281.1 141.7 136.2 ro04728 sigma factor, sigma 70 type, group 3 4.3 3.4 1.3 1.5 2.0 1.5 2.0 2.3 429.9 1836.4 1169.8 501.8 787.0 1253.3 1177.1 1016.4 1050.4 ro04729 probable transcriptional regulator, MerR family 2.4 1.6 1.0 1.4 0.8 0.9 0.7 0.9 57.8 140.0 139.1 104.0 234.4 154.2 250.1 111.1 140.1 ro04730d hypothetical protein 1.8 2.3 1.3 2.9 1.6 2.6 1.4 1.5 24.5 43.3 78.4 57.8 211.1 128.1 206.1 69.2 105.4 ro04731d probable transcriptional regulator, MerR family 4.3 6.8 3.8 2.3 4.1 3.7 3.8 3.6 26.4 112.6 235.9 126.5 112.5 137.6 111.8 70.7 85.1 4 ^ Appendix A - Continued ro04732d hypothetical protein 5.1 4.7 2.0 1.7 1.8 2.1 1.5 2.1 467.0 2388.2 1524.4 1149.2 790.2 990.8 903.3 796.7 791.1 ro04739| hypothetical protein 3.4 8.9 10.3 9.3 4.1 10.7 4.7 3.8 ro04740c 95.5 323.6 569.6 591.8 1016.5 880.5 1393.8 424.8 379.4 ro04791 A B C transporter, A T P binding component 1.8 4.5 . 4.6 6.7 4.6 5.2 2.4 2.4 46.3 85.1 174.6 274.3 659.4 355.3 392.4 225.9 185.6 ro04800 pyk4 pyruvate kinase 1.5 1.9 1.4 1.5 2.3 2.7 5.0 8.5 27.6 41.7 79.7 50.7 92.6 151.7 228.0 326.5 1055.0 ro04823 probable glutathione peroxidase 2.4 2.7 2.2 1.8 2.0 2.2 3.6 2.9 422.0 995.9 757.4 620.3 1349.3 1305.6 1308.3 1709.0 1194.3 ro04926 gluconate permease 3.0 4.2 2.7 2.8 2.2 2.4 1.4 1.1 24.3 73.4 65.3 61.6 72.1 60.0 70.2 46.8 27.4 ro04951 probable D N A repair helicase 0.8 0.6 0.3 0.9 0.6 0.8 0.5 0.8 298.9 239.3 110.4 93.7 343.8 136.2 230.9 198.0 189.8 ro04993 citA2 citrate (Si) synthase 0.4 0.6 0.6 0.1 0.5 0.5 0.9 0.7 71.6 30.2 49.2 22.0 12.6 53.9 52.6 85.1 69.3 ro05000d sensor kinase, two-component system 1.1 0.9 0.9 0.9 1.3 1.1 1.4 1.1 37.6 40.9 62.1 69.9 107.9 119.1 133.7 118.4 102.7 ro05062| possible acyl dehydratase 2.4 1.6 0.8 1.5 2.0 2.0 1.6 2.0 ro03897c 245.0 599.0 225.3 147.1 550.7 477.2 628.7 543.6 446.9 ro05077 probable CoA-transferase 11.3 10.5 25.1 9.2 3.2 1.5 1.3 0.9 24.5 276.8 203.0 560.5 417.4 125.2 58.1 50.4 33.4 ro05086 conserved hypothetical protein 1.9 2.3 1.7 1.0 0.9 1.1 0.6 1.0 39.0 74.2 200.7 119.5 177.4 183.5 208.8 59.4 183.7 ro05134 conserved hypothetical protein 1.3 9,6 7.7 4.0 9.8 2.1 2.0 1.5 18.7 23.6 51.5 47.4 112.6 62.6 74.9 9.6 17.6 ro05162 conserved hypothetical protein 2.7 4.2 2.7 2.9 4.1 3.4 5.9 17.5 41.3 112.3 301.4 198.7 467.8 623.6 861.8 897.8 7981.5 ro05169 conserved hypothetical protein 1.7 1.5 1.2 2.8 2.0 3.0 2.2 9.7 35.7 59.0 44.4 10.3 120.7 100.4 148.5 138.4 337.2 Appendix A - Continued ro05225 probable transcriptional regulator, ArsR family 3.8 1.9 1.3 1.2 1.3 1.3 1.6 1.4 13.0 49.2 26.9 25.7 27.6 29.9 40.0 39.0 26.0 ro05335 gfyA3 glycine hydroxymethyltransferase 2.2 2.8 3.1 2.0 2.6 4.5 5.3 9.5 47.6 103.2 108.6 68.4 168.7 142.9 273.4 512.5 1209.8 ro05340 conserved hypothetical protein 1.6 1.7 2.3 1.7 2.7 3.1 3.1 10.7 51.6 81.6 138.0 161.2 343.2 338.6 706.8 517.3 1777.8 ro05378 possible glycosyl transferase 3.3 2.9 1.4 2.3 3.5 2.7 4.1 11.8 66.3 215.6 233.5 85.9 367.6 189.2 485.9 503.9 1838.8 ro05388 amino acid transporter, APC family 0.9 2.4 2.0 4.4 1.4 3.5 1.2 2.0 219.0 204.1 253.8 335.9 741.8 409.6 892.6 371.6 347.4 ro05405 possible monooxygenase 2.3 3.6 2.6 1.7 1.0 0.9 1.0 1.1 209.6 489.8 2234.3 394.6 1970.0 813.8 867.8 872.3 1310.6 ro05407 ligase 1.4 1.0 1.4 1.5 3.1 5.8 8.0 15.0 38.7 53.5 26.9 66.9 122.5 318.3 594.3 777.7 2053.4 ro05409 riboflavin biosynthesis protein 8.4 6.8 7.5 2.2 2.1 4.3 3.4 5.6 50.6 427.2 302.2 202.9 209.3 191.2 282.7 239.2 337.5 ro05445 GDP-L-fucose synthase 0.4 0.2 0.0 0.1 0.2 0.2 0.3 0.4 35.1 15.6 11.0 1.3 9.7 9.8 26.3 15.5 26.0 ro05453| probable protein-tyrosine kinase 0.9 0.9 0.3 0.2 0.1 0.1 0.1 0.3 ro05448c 55.4 52.1 113.4 37.1 27.0 18.0 18.9 18.8 36.5 ro05457d probable chaperone protein 0.4 0.5 1.3 0.5 0.9 0.8 0.7 1.4 59.8 21.2 21.2 42.4 58.6 64.3 83.9 44.3 81.3 ro05474 possible Fe-S reductase 3.1 0.4 0.4 0.3 0.3 0.7 1.3 0.8 4.9 14.9 8.2 5.4 6.6 7.6 14.3 19.9 17.8 ro05481 probable protease 1.2 1.0 1.4 1.1 1.2 1.3 1.8 3.4 56.4 69.3 166.5 126.6 272.1 269.0 305.9 299.1 991.7 ro05497 dnaKl heat shock protein Hsp70 11.5 12.4 12.6 2.7 1.2 0.6 0.7 0.9 150.3 1724.6 2175.7 586.4 806.1 180.3 238.4 119.4 140.7 ro05498 grpEl heat shock protein GrpE 3.8 3.8 3.6 2.0 0.8 0.5 0.6 0.5 120.9 457.4 1083.5 1623.9 1032.7 452.9 411.3 268.8 271.9 ON Appendix A - Continued ro05499 dnaJ2 chaperone protein 1.0 0.8 0.6 0.7 0.8 0.8 1.6 1.8 425.5 435.1 871.9 602.4 809.2 1457.0 1515.0 2045.2 2750.7 ro05504 conserved hypothetical protein 0.7 2.0 1.5 2.5 1.3 3.0 2.2 6.4 16.9 11.4 50.4 53.2 141.3 77.9 203.5 108.2 263.9 ro05507 possible cation transport regulator 0.9 2.8 2.0 1.7 1.9 1.6 1.4 1.3 52.9 45.8 179.3 265.2 310.0 296.9 249.8 160.2 154.9 ro05514d clpBl ATP43inding subunit of heat shock protein ClpB 2.4 2.4 1.5 1.4 1.5 1.6 2.1 2.4 78.9 192.2 156.3 62.2 191.9 176.6 219.8 245.7 211.3 ro05524 benE benzoate membrane transport protein BenE 0.7 0.2 0.1 0.3 0.4 0.3 0.4 0.4 29.7 19.3 5.9 4.8 14.1 15.4 13.2 20.4 17.9 ro05628 possible large-conductance mechanosensitive 1.7 2.6 3.2 1.8 2.0 2.4 1.6 1.9 channel 93.4 158.6 149.3 101.7 263.5 216.5 285.9 254.7 232.6 ro05633 molybdopterin biosynthesis protein 1.1 0.8 1.3 1.5 1.7 1.3 2.4 12.6 59.6 63.5 30.9 56.5 106.9 67.5 122.5 173.0 353.2 ro05646 conserved hypothetical protein 1.6 1.8 1.5 1.6 1.8 2.6 4.7 14.9 30.2 47.2 52.2 35.0 101.6 75.0 163.4 193.9 771.7 ro05677 dctA3 C4-dicarboxylate transporter, D A A C S family 1.2 2.2 2.7 1.4 1.6 1.0 0.9 0.9 263.2 327.3 712.3 680.7 921.3 908.3 743.5 510.9 557.9 ro05745 probable UDP-glucose 4-epimerase 2.8 4.6 4.2 2.0 1.0 0.8 0.8 0.9 91.6 254.6 356.4 309.2 305.7 176.3 152.4 125.6 102.3 ro05883 possible membrane protein 1.3 1.1 0.9 1.2 2.2 3.6 6.0 8.9 43.7 56.7 54.0 45.1 125.5 151.2 438.3 587.3 901.4 ro05892 htpG chaperone protein HtpG 1.8 1.3 0.7 0.9 0.7 0.9 0.7 1.0 161.2 296.1 258.2 226.8 353.2 306.5 392.9 314.7 337.3 ro05917 probable N A D H dehydrogenase subunit I 1.5 6.8 5.9 6.7 9.1 5.0 5.3 4.0 27.6 42.0 126.6 177.3 427.7 414.0 273.2 245.8 153.1 ro05967 acyl-CoA synthetase 0.7 0.7 0.2 0.3 0.8 0.9 0.7 1.0 47.1 33.5 23.8 9.2 14.9 37.6 42.8 25.3 44.5 ro05973 probable rRNA (guanine-N(l)-)-methyltransferase 4.2 6.3 3.5 6.3 4.1 3.9 2.6 2.1 213.0 897.0 1484.5 1043.7 2687.4 1457.2 1613.0 981.9 712.0 Appendix A - Continued ro05989 A B C sugar transporter, permease component 1.2 2.1 2.8 3.1 2.0 2.9 1.9 11.6 71.9 82.8 71.8 85.1 223.3 191.0 255.8 183.6 541.5 ro06073 probable FMN-dependent (S)-2-hydroxy-acid oxidase 5.7 5.3 13.5 19.2 10.9 22.9 13.3 13.5 23.6 134.5 210.6 211.0 1039.1 619.4 1426.7 538.4 711.9 ro06083 probable ethanolamine permease, A P C superfamily 1.4 1.1 2.5 1.1 1.1 1.2 2.7 0.4 8.4 11.7 12.1 12.1 22.1 13.5 29.6 15.6 11.0 ro06096 accCl acetyl-CoA carboxylase biotin carboxylase subunit 1.5 3.1 1.1 1.4 1.8 1.8 1.2 1.7 116.4 173.4 534.8 260.6 543.1 380.9 641.7 359.8 570.8 ro06109 possible transcriptional regulator, GntR family 2.4 2.2 1.6 0.8 1.2 1.2 0.8 0.7 28.4 69.3 55.9 14.4 35.5 45.4 42.9 43.1 27.8 ro06112 conserved hypothetical protein 6.2 5.3 3.0 3.4 1.7 1.8 2.4 0.7 22.6 139.9 165.2 140.8 141.5 71.5 79.2 85.9 32.0 ro06148d rplF 50S ribosomal protein L6 0.7 0.2 0.3 0.2 0.2 0.2 0.1 0.2 460.4 311.0 84.1 82.7 121.1 60.1 84.5 57.8 100.8 ro06149 rplR 50S ribosomal protein LI8 0.5 0.1 0.1 0.3 0.1 0.2 0.3 0.2 355.8 193.5 46.7 31.1 152.6 40.5 53.9 101.6 66.5 ro06151 rpmD 50S ribosomal protein L30 0.6 0.5 0.2 0.2 0.2 0.2 0.3 0.2 848.8 471.4 189.6 137.2 154.4 178.4 145.4 294.8 187.5 ro06152 rplOl 50S ribosomal protein LI5 0.8 0.4 0.5 0.4 0.4 0.3 0.7 0.3 388.5 292.8 272.9 269.3 502.2 355.2 288.5 772.1 337.4 ro06153 secY preprotein translocase 0.6 0.6 0.4 0.4 0.4 0.4 0.5 0.3 88.7 57.2 103.3 81.0 130.3 129.3 141.1 121.0 100.9 ro06155 methionyl aminopeptidase 0.6 0.4 0.2 0.2 0.2 0.2 0.4 0.3 148.1 83.9 58.6 35.9 57.5 48.8 49.1 87.2 68.4 ro06162 rpoA DNA-directed R N A polymerase alpha subunit 0.6 0.5 0.8 0.3 0.4 0.4 0.4 0.3 209.7 136.0 69.4 81.9 118.7 70.2 101.5 124.6 67.6 ro06189d 10 kDa chaperonin 1.6 1.5 1.2 1.9 0.8 1.4 0.9 0.9 211.8 344.2 323.5 301.9 757.4 282.8 538.9 322.7 335.9 ro06190c chaperone protein 1.1 0.8 0.6 0.7 0.7 0.9 0.9 0.7 63.7 68.1 57.3 41.3 98.6 113.0 141.1 115.2 95.2 OO Appendix A - Continued ro06226 conserved hypothetical protein 1.6 1.7 1.2 1.3 1.5 3.7 3.7 7.7 204.3 327.9 187.1 177.0 325.6 535.0 1043.4 1061.5 2437.7 ro06232 tRNA/rPvNA methyltransferase 0.7 0.4 0.4 0.5 0.9 0.5 1.2 1.1 12.0 8.5 6.9 4.6 27.9 13.4 20.1 28.2 25.4 rc-06240 probable DNA-(apurinic or apyrimidinic site) lyase 0.5 0.4 0.5 0.6 0.6 0.6 0.8 1.2 96.1 50.8 28.9 49.3 65.6 102.2 130.9 128.0 151.6 ro06328 conserved hypothetical protein 5.4 7.6 17.2 13.6 8.8 6.1 2.5 3.6 213.7 1160.7 1562.5 1375.7 2831.6 2794.6 1693.4 612.5 984.9 ro06372 probable triacylglycerol lipase 1.8 3.2 3.1 1.9 1.0 1.6 1.2 1.1 29.3 52.3 85.7 22.6 82.7 72.4 78.5 59.7 47.7 ro06396 A B C transporter, ATP4}inding component 1.5 0.5 0.6 0.4 0.7 0.8 0.9 0.6 7.8 11.3 8.8 7.0 9.2 11.8 21.9 25.9 9.7 ro06401 probable multicopper oxidase 1.1 0.9 2.0 1.5 1.6 1.6 1.2 2.0 185.8 209.2 129.7 199.5 347.1 451.6 503.5 239.8 513.5 ro06436 NADPH-dependent F M N reductase 1.0 0.9 1.1 1.0 1.9 3.9 7.1 15.3 54.0 52.0 122.0 122.2 198.7 296.7 989.1 1206.4 3638.3 ro06446 cytochrome-c oxidase 1.1 0.5 0.5 0.3 0.4 0.4 0.6 0.5 718.2 774.5 352.9 404.2 297.0 376.9 394.6 524.9 411.1 ro06488 ilvC ketol-acid reductoisomerase 0.9 0.4 0.2 0.1 0.3 0.2 0.4 0.5 50.3 45.8 21.0 13.7 17.9 25.3 24.5 41.1 52.2 ro06572 multidrug resistance transporter, MFS superfamily 0.8 1.1 2.3 1.4 0.9 0.9 0.7 0.6 78.3 60.5 70.5 171.8 158.7 140.2 126.6 63.9 82.5 ro06587 conserved hypothetical protein 1.3 0.7 0.5 0.5 0.3 0.3 0.4 0.4 110.3 139.7 83.8 32.7 114.9 43.3 57.0 62.9 63.2 ro06592 possible penicillu>binding protein 0.5 0.5 0.6 0.8 0.8 0.9 0.8 0.8 1898.9 907.4 615.3 1019.3 1533.5 1994.9 2346.7 1595.5 1392.1 ro06625 conserved hypothetical protein 1.4 1.8 2.2 2.8 3.8 3.1 0.5 18.2 15.1 21.4 16.3 20.3 39.6 17.7 23.1 11.5 16.0 ro06695 probable enoyl-CoA hydratase 0.9 1.5 2.0 2.2 2.1 1.5 1.5 4.6 75.0 69.4 78.0 39.3 222.2 131.5 166.1 187.6 329.9 Appendix A - Continued ro06703d probable thioredoxin 0.5 0.5 0.6 0.6 0.9 0.6 0.8 0.7 58.7 28.8 45.2 24.6 146.3 132.5 131.5 91.6 119.1 ro06704d possible ClpA 0.6 0.8 1.3 2.1 1.0 1.2 0.8 1.0 186.5 117.8 38.8 90.8 402.1 249.6 461.6 287.4 176.8 ro06705d clpB2 ATP-binding subunit of heat shock protein ClpB 1.4 1.3 0.9 2.5 1.2 0.8 0.9 0.5 12.1 16.7 14.8 9.1 53.8 18.3 9.0 15.5 10.2 ro06708d grpE2 heat shock protein GrpE 1.4 0.9 1.0 1.4 1.9 0.4 0.4 0.6 6.7 9.0 3.2 15.2 18.8 4.3 8.6 3.8 2.1 ro06709d dnaK2 heat shock protein Hsp70 0.9 0.5 0.8 0.9 0.7 0.9 1.0 0.9 26.3 24.7 45.9 86.5 144.3 140.7 179.2 125.4 140.0 ro06710d conserved hypothetical protein 1.0 0.9 1.3 1.3 0.9 0.7 0.9 0.7 197.9 203.9 70.1 87.8 333.6 327.4 205.2 205.2 186.6 ro06784 transcriptional regulator, DeoR family 4.2 3.0 1.0 1.6 1.7 1.9 1.4 1.7 43.3 180.8 111.7 39.8 114.2 154.0 150.2 109.4 129.2 ro06817 conserved hypothetical protein 0.3 0.2 3.3 1.1 2.5 4.8 8.8 5.0 10.8 3.3 2.6 6.7 26.1 28.2 115.8 131.8 170.6 ro06862 methionine sulfoxide reductase 2.1 2.9 2.1 2.1 1.8 2.0 2.0 1.5 93.5 198.3 744.9 537.9 1183.2 1161.4 1365.2 945.0 754.0 ro06887 acyl-CoA thioesterase II 1.0 0.7 0.4 0.4 0.4 0.5 0.6 0.5 72.5 70.0 55.8 31.0 46.3 52.3 59.7 61.6 56.4 ro06937 grpE3 heat shock protein GrpE 1.0 2.2 1.6 1.4 0.9 0.9 0.5 1.0 755.7 790.9 857.4 620.0 1457.6 1000.8 1006.9 564.5 437.2 ro06938d chaperone protein 0.5 1.1 0.7 1.0 0.8 0.7 0.8 0.9 127.9 67.8 333.6 482.5 736.2 373.1 665.7 484.4 446.4 ro07096 conserved hypothetical protein 2.6 2.3 2.4 1.2 2.9 2.9 3.7 7.1 1934.7 5009.3 3501.6 3236.3 3201.8 5924.6 7026.8 6963.4 15006.7 ro07112 probable flavin-binding monooxygenase 1.0 0.2 0.6 0.2 0.6 0.5 0.5 0.5 50.7 52.8 4.9 14.2 20.6 23.2 41.1 21.3 28.2 ro07116 possible aldehyde dehydrogenase, N-terminal 0.8 0.4 0.4 0.1 0.3 0.2 0.4 0.3 34.5 27.9 6.5 16.0 7.7 13.9 14.7 18.6 12.5 Appendix A - Continued ro07119 acyl-CoA dehydrogenase 5.5 7.2 4.7 7.3 5.5 4.4 3.6 2.8 35.3 194.0 220.7 271.8 495.1 274.5 210.6 115.1 138.8 ro07152 carB carbamoyl-phosphate synthase large 2.2 1.9 2.7 2.3 3.0 3.9 4.7 6.8 subunit 2017.8 4383.0 2380.2 2934.9 5455.5 5974.4 11706.7 9312.4 12601.4 ro07168 ribD riboflavin biosynthesis protein RibD 0.7 0.4 0.3 0.2 0.5 0.4 0.3 0.5 32.5 24.0 11.8 7.5 6.5 27.5 26.6 9.5 18.0 ro07198 sufC FeS assembly ATPase 0.6 0.4 0.2 0.2 0.2 0.2 0.4 0.3 87.6 54.7 107.7 37.0 88.1 104.4 100.8 166.2 127.3 ro08080| transposase, IS4 1.6 2.2 1.1 1.1 1.2 1.0 1.0 1.5 rol0103c 236.7 381.0 1221.7 540.0 981.2 923.1 990.0 864.9 1583.2 ro08085 bphE3 2-oxopent-4-enoate hydratase 1.2 1.8 2.0 1.9 2.8 4.3 5.8 11.2 25.4 30.6 77.9 69.3 184.3 279.6 480.7 543.7 981.6 ro08147 possible transposase, C-terminal 1.1 2.0 1.6 1.6 1.5 1.6 2.7 4.3 42.1 45.6 162.1 129.0 255.8 202.5 310.3 256.3 727.9 ro08167| rol0208c padAal phthalate 3,4-dioxygenase alpha subunit 38.9 0.6 21.5 0.6 19.1 2.4 32.2 4.1 102.4 1.2 62.4 6.6 182.3 5.1 131.9 26.5 322.4 ro08175 transcriptional regulator, IclR family 1.4 1.6 1.8 1.9 2.5 2.8 4.7 6.1 73.4 106.1 299.2 241.1 611.7 643.3 1345.9 1600.9 2320.1 ro08188| possible acetate—CoA ligase, C-terminal 2.0 2.9 1.5 1.4 1.1 1.0 1.2 0.9 rol0184c 47.2 95.6 300.3 116.6 318.2 225.9 261.4 188.1 152.6 ro08314 D-lactate dehydrogenase (cytochrome) 1.4 1.9 1.9 1.7 2.8 3.5 5.5 6.1 282.7 397.5 302.7 338.8 509.0 939.7 1047.1 1835.4 1970.5 ro08345 dnaJ4 chaperone protein 19.2 21.8 11.0 11.2 11.1 28.6 3.7 6.3 23.5 450.4 185.8 204.9 160.3 98.3 191.4 69.8 107.3 ro08347| hypothetical protein 5.8 26.0 2.8 5.8 2.6 3.1 1.8 2.3 ro03567c 703.9 4050.6 5993.8 3149.6 5994.8 2755.4 2691.2 2032.2 1171.8 ro08348 heat shock protein (18 KDa antigen-like 17.4 34.8 32.7 16.9 11.4 9.8 5.3 7.1 protein) 648.3 11270.2 13773.9 8958.4 14798.1 9997.8 9768.2 3868.7 5325.3 ro08349d transcriptional regulator, MerR family 1.6 2.4 1.8 1.7 1.5 1.5 1.3 1.7 42.1 65.6 64.3 32.5 111.6 80.4 124.6 82.0 84.3 Appendix A - Continued ro08361 hspA small heat shock protein 1.7 4.3 2.4 2.3 1.3 1.5 1.4 1.4 14.5 25.1 134.3 54.4 123.8 116.7 121.1 68.4 65.6 ro08365 dnaK4 heat shock protein Hsp70 8.5 72.5 19.6 9.7 7.9 4.0 4.1 10.3 10.1 86.1 132.2 64.8 126.5 111.2 51.5 26.8 40.2 ro08366d grpE4 heat shock protein GrpE 1.6 3.9 2.5 2.0 1.9 2.2 2.1 4.6 1459.7 2390.5 3419.3 2430.6 3256.3 2570.6 4115.0 3602.3 4567.0 ro08367d dnaJ5 chaperone protein 1.8 2.5 2.6 1.2 2.1 1.4 2.0 1.2 2934.9 5409.4 6569.0 3303.9 7444.1 6688.1 7854.9 7317.4 5883.7 ro08398 conserved hypothetical protein 14.0 14.4 10.3 10.7 7.1 7.0 4.4 4.2 26.1 365.1 578.5 647.1 1132.5 785.5 729.3 397.1 307.5 ro08399 conserved hypothetical protein 1.5 1.5 2.1 1.9 2.7 2.7 5.1 8.2 115.7 173.3 253.4 263.1 670.0 575.2 1179.9 1373.6 2388.5 ro08419 possible fatty-acid-CoA ligase 2.6 2.6 2.0 1.8 3.8 3.7 4.2 4.2 30.6 80.0 155.9 89.7 240.7 299.3 463.7 441.6 402.2 ro08438 acyl-CoA dehydrogenase 0.5 1.0 0.4 0.4 0.9 0.8 0.9 0.8 20.6 10.5 32.3 17.4 24.2 46.6 59.0 46.3 34.1 ro08508 3 -oxoacyl- [acyl-carrier-protein] reductase 1.0 2.0 2.2 1.7 1.3 1.5 1.3 2.5 29.3 29.9 25.6 15.7 69.0 51.6 104.5 84.7 63.7 ro08520| possible transcriptional regulator, TetR family 1.1 2.3 3.4 3.7 3.2 2.4 2.2 3.0 ro08382c 140.3 158.4 204.0 134.2 532.9 352.2 516.3 497.9 465.4 ro08582 conserved hypothetical protein 4.1 4.0 2.7 3.9 2.9 1.9 1.4 1.9 175.4 724.1 469.9 259.3 964.5 712.4 765.4 387.2 349.1 ro08615 possible D N A hydrolase 3.4 2.3 1.8 2.2 2.9 2.9 3.9 6.7 270.3 911.5 422.9 562.9 767.2 990.3 1231.5 1396.4 2031.1 ro08624 probable acetoin dehydrogenase beta subunit 4.9 7.0 3.6 1.8 0.9 0.8 1.3 1.9 202.6 998.4 1402.6 710.2 666.0 313.2 289.2 433.9 590.0 ro08631 oxidoreductase 3.0 4.8 6.3 2.9 2.9 3.5 5.2 28.5 7.1 21.0 25.3 30.2 37.9 46.6 88.7 130.4 505.1 ro08712 hypothetical protein 4.5 3.8 1.5 2.1 2.3 1.7 2.0 5.1 191.4 867.4 1301.2 615.0 1375.8 1148.2 1393.1 967.4 2579.1 Appendix A - Continued ro08793 probable oxidoreductase 2.1 1.7 1.2 0.8 2.0 1.8 4.2 5.4 2.4 5.1 9.8 8.7 15.5 21.8 36.0 36.2 57.0 ro08803 probable tartrate dehydrogenase 3.1 0.5 0.1 0.2 0.6 1.6 0.3 0.6 3.3 10.1 1.2 0.9 5.8 8.7 18.8 2.9 5.4 ro08861 conserved hypothetical protein 3.3 2.4 1.8 1.6 2.9 3.0 3.3 8.8 167.1 554.0 272.0 259.4 377.5 504.4 732.8 623.8 1534.4 ro08871 acetyl-CoA C-acetyltransferase 1.5 2.1 2.9 1.3 1.9 1.6 1.8 1.3 120.3 181.7 256.1 178.7 320.1 235.0 368.9 367.6 280.9 ro08873 probable transport protein 1.1 1.0 2.1 0.9 1.1 1.5 1.5 2.9 295.9 332.1 325.2 306.9 777.2 554.5 1079.4 753.1 1705.4 ro08893 probable serine-threonine protein kinase 0.9 1.1 0.2 0.6 0.5 0.9 2.2 2.6 16.1 14.4 5.7 2.8 12.0 7.5 12.3 10.5 10.7 ro08894 possible transposase 2.0 1.5 2.3 0.6 0.8 0.9 0.8 0.8 34.3 69.5 36.5 11.2 29.2 41.5 22.5 19.1 14.5 ro08956 conserved hypothetical protein 3.4 3.6 1.3 2.9 11.7 14.8 32.7 8.6 10.8 37.1 55.2 26.7 100.7 156.2 562.9 422.2 275.5 ro08984 cytochrome P450 CYP256 0.5 1.1 0.4 1.7 0.7 1.4 1.0 2.1 26.5 14.3 19.9 18.6 53.0 40.0 38.2 39.8 54.2 ro09018 bphGl acetaldehyde dehydrogenase 1.1 6.2 1.5 1.2 1.3 0.4 0.8 1.3 6.6 7.3 6.2 6.1 10.8 10.0 5.6 3.2 12.1 ro09064 NAD(P)H-dependent reductase 0.3 0.1 0.1 0.0 0.2 0.5 0.9 2.4 6.2 2.2 1.1 0.6 1.2 2.5 8.1 11.8 53.8 ro09081 A B C sugar transporter, permease component 2.5 1.4 4.0 2.0 1.5 0.8 1.4 1.3 5.3 12.9 20.2 14.4 35.7 25.5 29.6 31.0 20.1 ro09089 probable permease 1.6 2.8 1.0 0.8 0.7 0.8 0.6 0.6 199.8 320.3 434.9 280.2 330.2 387.6 470.4 233.9 202.8 ro 10056 conserved hypothetical protein 1.1 2.8 2.7 1.5 2.4 3.0 4.7 6.2 145.0 159.8 307.6 139.7 299.2 370.4 737.5 1017.3 1049.9 ro 10060 conserved hypothetical protein 1.4 1.7 1.3 1.5 2.0 3.3 2.7 10.1 30.8 43.3 56.6 56.4 116.5 206.9 353.6 202.5 896.2 Appendix A - Continued rol0108 rhodococcal conserved hypothetical protein 4.5 2.8 2.0 2.8 2.8 3.4 7.7 18.6 5.0 22.3 35.7 42.4 79.9 68.5 146.1 231.4 599.9 rol0246d conserved hypothetical protein 1.2 0.7 1.4 0.9 0.9 1.1 1.6 0.8 1110.0 1283.5 355.8 436.9 1191.8 1464.3 1835.0 1830.5 850.0 rol0333 hypothetical protein 1.6 1.9 1.9 1.6 3.3 3.5 5.8 15.3 26.9 42.5 97.7 99.1 143.1 167.0 367.2 426.0 1817.1 rol0433 probable Xaa-Pro dipeptidase 2.0 4.9 3.4 3.7 3.0 1.9 1.9 1.3 18.5 36.3 66.8 44.5 70.2 73.0 92.8 44.7 28.1 ro 11207 conserved hypothetical protein 1.6 2.4 4.4 2.8 1.5 0.9 1.3 1.3 30.7 48.2 113.5 210.6 250.4 87.8 68.1 62.9 53.5 ro 11208 conserved hypothetical protein 2.5 6.1 9.2 4.6 2.3 1.4 2.2 1.1 17.3 42.6 140.4 101.9 184.4 62.6 17.0 11.6 20.7 ro 11209 conserved hypothetical protein 1.1 2.0 1.9 2.2 1.6 0.9 0.8 1.0 268.1 301.9 399.4 580.3 767.3 557.7 236.8 162.0 173.2 roll210 probable copper-exporting ATPase 3.0 8.4 6.6 6.0 1.4 1.3 0.8 1.2 25.1 75.4 145.5 69.5 171.7 46.2 28.0 13.6 18.3 roll261 possible mycobacteriophage excisionase 1.2 1.4 1.9 1.5 1.8 3.5 4.0 12.1 55.5 66.7 66.6 56.0 144.6 156.6 398.1 481.5 1131.5 ro 11324 rhodococcal conserved hypothetical protein 0.6 2.3 2.2 1.2 2.2 2.4 3.7 7.3 1378.8 875.4 2784.5 1120.5 2741.7 3580.9 6372.8 4707.7 11172.4 roll331 probable transcriptional regulator, LuxR family 1.1 2.1 1.7 1.7 1.7 2.6 4.2 7.0 47.5 54.2 151.8 171.2 324.3 242.0 520.6 744.5 1099.1 Appendix B Expression data for genes described in the osmotic stress' Time upon treatment (min) 0 5 15 30 45 60 90 120 180 Gene Gene Gene Product Expression ratio ID Name Signal intensityb ro00062d possible potassium channel protein TrkA 1.0 1.6 1.3 1.1 1.6 0.7 0.9 0.8 147.2 141.0 103.5 89.9 55.5 77.2 46.4 125.5 33.0 ro00098 sigma factor, sigma 70 type, group 3 0.4 1.7 2.4 1.0 1.7 1.7 1.1 1.1 23.3 9.0 20.9 25.5 11.1 14.9 12.3 22.0 7.8 ro00099d anti-sigma factor, possible RsbW 0.8 2.3 2.0 1.7 1.4 1.7 1.1 1.4 122.3 103.2 152.6 154.7 48.7 90.0 52.6 142.9 35.5 ro00100d cold shock protein 0.7 7.1 0.8 0.7 0.6 0.3 0.7 1.0 6.3 4.2 20.4 5.7 8.8 2.8 2.5 5.2 4.7 roOOlOl dps D N A protection during starvation protein 1.6 2.9 7.8 4.4 1.5 2.3 0.8 1.7 581.2 936.3 1415.6 3642.9 1083.4 985.4 508.7 767.3 288.5 ro00102d conserved hypothetical protein 1.3 2.2 4.5 2.0 2.1 1.2 0.9 0.9 548.2 712.7 840.8 2699.0 741.7 750.3 446.2 873.7 284.0 ro00T05 conserved hypothetical protein 0.5 1.9 16.1 9.2 2.2 2.6 2.2 1.3 30.4 15.1 22.6 147.0 67.8 29.9 23.6 18.2 19.2 ro00146 apolipoprotein N-acyltransferase 1.9 0.6 0.6 0.3 1.1 0.3 0.6 0.7 13.0 24.4 11.7 10.2 5.8 16.2 3.1 20.2 8.9 ro00164 hypothetical protein 1.2 0.3 0.3 0.9 0.7 0.2 0.4 2.2 18.6 22.7 10.6 8.2 25.7 10.8 4.0 13.5 27.3 rp00229 hypothetical protein 0.8 0.1 0.7 0.6 0.7 2.8 1.0 0.9 24.6 19.2 3.9 11.0 13.0 15.3 14.9 23.7 12.5 a Based on difference in expression ratio (time post-treatment / immediately pre-treatment); P < 0.05, n = 3 b Uncorrected average probe signal intensity; n = 3 c Probe lacks specificity due to high similarity of genes d No significance difference in expression ratio between time post-treatment and immediately pre-treatment for any time point (P > 0.05) Appendix B - Continued ro00238 conserved hypothetical protein 4.2 7.8 29.1 6.3 3.8 2.1 2.0 1.8 48.1 199.9 601.2 1428.9 240.3 149.8 58.3 114.6 48.3 ro00298d transcriptional regulator, AraC family 1.2 1.0 2.1 1.8 1.9 1.1 2.1 1.0 126.4 152.7 126.8 225.1 178.8 172.6 79.8 189.7 64.7 ro00316 possible monoxygenase 1.8 2.0 2.3 0.4 2.5 0.6 1.5 1.6 9.2 16.9 18.6 8.5 4.7 9.8 3.6 7.5 8.2 ro00362 probable CobW protein 1.4 4.2 3.0 2.3 1.8 0.7 1.0 0.4 11.8 16.5 42.7 33.5 29.6 26.6 8.4 23.1 6.2 ro00403 metabolite transporter, MFS superfamily 2.2 2.1 11.5 0.9 0.8 2.0 0.3 1.9 7.5 16.3 43.8 21.2 20.2 12.4 25.7 6.9 7.6 ro00421 possible transcriptional regulator, TetR 4.0 0.5 0.5 0.3 0.6 1.1 0.6 1.2 family 6.5 26.1 5.0 2.2 3.8 5.5 2.5 8.3 5.6 ro00434 probable NADPH:quinone reductase 1.0 0.4 1.0 0.4 0.4 0.4 2.6 1.0 13.2 12.8 5.9 17.3 7.6 7.7 4.0 40.3 9.0 ro00561 possible D N A binding protein 1.7 3.9 0.9 1.0 1.3 0.9 1.2 0.7 38.6 64.4 61.4 35.0 32.2 34.7 24.4 72.9 23.8 ro00617 conserved hypothetical protein 0.7 0.1 0.2 0.1 2.2 0.9 1.7 0.7 2.9 1.9 1.3 0.9 2.8 12.1 1.3 10.3 3.3 ro00759 acyl-CoA dehydrogenase 3.6 1.4 2.3 0.9 1.4 2.4 1.4 0.6 3.8 13.8 4.8 8.2 11.5 6.9 6.7 8.9 2.4 ro00866 conserved hypothetical protein 1.0 0.3 0.4 0.6 1.4 0.8 0.5 1.4 24.1 24.6 8.0 9.4 10.0 18.6 9.7 13.6 30.1 ro00950 argG argininosuccinate synthase 1.0 0.3 0.3 0.3 0.3 0.6 0.6 1.1 202.6 198.2 73.3 88.4 37.9 74.9 95.9 218.6 126.8 ro01077 D N A polymerase IV 1.1 3.0 2.0 1.9 1.4 1.0 1.1 0.8 116.4 129.3 163.8 137.1 98.9 82.6 58.3 168.5 50.1 ro01228d kdpE response regulator, two-component system 1.1 0.7 0.6 0.8 1.0 0.7 0.9 0.8 248.1 271.4 105.2 176.8 139.1 115.0 96.0 402.5 107.9 ro01229d kdpD histidine sensor kinase, two-component 1.0 1.7 0.3 1.3 0.4 1.4 0.6 2.4 system 11.5 11.2 4.2 2.0 9.4 5.5 6.6 7.9 8.6 ro01231 kdpB potassium-transporting ATPase B chain 1.3 0.9 1.2 0.8 2.1 1.4 1.1 1.0 59.3 76.1 42.8 51.7 27.7 49.1 27.9 72.1 30.5 ON Appendix B - Continued ro01232 kdpA potassium-transporting ATPase A 0.9 2.2 2.3 2.5 1.1 1.2 1.8 2.1 chain 16.6 14.4 19.1 23.4 20.0 19.6 13.2 38.9 19.5 ro01253 sulfate adenylyltransferase small 0.7 0.2 0.4 1.0 0.3 1.1 1.1 0.7 subunit 178.2 121.3 43.4 62.1 57.6 40.1 81.4 167.4 60.1 ro01258 conserved hypothetical protein 1.3 1.7 2.0 1.0 2.0 2.6 0.9 1.7 27.9 37.1 46.4 36.3 22.7 35.2 30.2 28.7 20.9 ro01302d proline/betaine transporter, MFS 1.6 2.8 2.4 1.6 1.4 2.4 1.8 1.3 superfamily 59.6 96.2 218.7 170.0 86.6 98.2 100.7 149.1 52.2 ro01305 probable acetyltransferase 2.3 5.1 11.6 6.3 3.8 4.5 1.7 1.3 96.8 221.9 432.2 917.6 397.7 370.5 189.3 252.1 60.9 ro01307 ectC L-ectoine synthase 1.1 3.1 8.3 5.0 3.8 6.3 2.1 1.9 200.0 213.6 504.7 1153.3 462.6 722.6 404.5 523.1 137.5 ro01308 possible phosphoglycerate 1.0 2.0 4.6 7.2 2.6 3.7 2.3 1.7 dehydrogenase 126.1 121.1 251.8 660.7 504.7 330.7 325.8 451.9 130.0 ro01309d npdA NAD-dependent deacetylase 1.1 1.5 0.7 0.6 1.0 1.2 0.9 1.3 2642.9 2815.0 1893.1 2049.8 748.4 1264.1 1368.7 3332.6 1485.1 ro01347 A B C sugar transporter, substrate- 0.6 0.2 0.2 6.7 0.7 0.5 0.4 2.1 binding component 4.8 3.1 2.9 0.9 22.0 6.9 3.4 2.8 20.8 ro01471d atpC H(+)-transporting two-sector 0.8 0.6 0.7 1.1 0.6 1.1 0.6 1.0 ATPase epsilon subunit 48.1 39.7 17.6 30.2 24.0 24.5 18.5 29.7 25.5 ro01476 atpF H(+)-transporting two-sector 1.0 0.5 0.5 0.5 0.6 0.8 0.7 0.8 ATPase subunit B 967.7 925.2 526.1 638.9 277.6 490.7 361.1 1043.7 240.8 ro01536 multidrug resistance transporter, 1.0 2.6 1.3 1.3 2.0 1.5 1.9 1.2 MFS superfamily 108.1 107.8 131.2 80.7 45.8 97.2 46.8 154.8 37.9 ro01702d probable D N A polymerase IV 1.0 1.6 0.6 0.5 1.0 1.3 1.0 1.3 8605.9 8231.8 9117.8 7966.1 2306.0 6462.5 6747.9 14250.4 6385.2 ro01789 NADH:flavin oxidoreductase 0.6 4.9 13.6 1.9 1.1 0.3 0.7 1.6 21.4 13.3 81.2 80.2 20.0 14.2 3.9 12.7 11.8 ro01933 conserved hypothetical protein 1.3 0.6 0.2 0.2 0.6 1.7 1.0 0.9 14.1 18.5 9.6 3.6 2.6 7.2 11.3 16.6 8.6 ro01975 rplL 50S ribosomal protein L7/L12 0.8 1.0 0.4 0.2 0.3 1.6 0.6 0.7 1277.6 1029.4 929.4 447.9 85.1 161.0 679.4 1079.9 554.8 ^1 Appendix B - Continued ro02029 conserved hypothetical protein 1.1 0.6 0.5 0.5 0.7 0.5 0.6 0.6 64.7 74.4 43.3 44.2 25.6 44.4 22.4 67.0 28.3 ro02039 probable oxidoreductase 0.9 0.6 0.2 0.3 1.3 0.8 1.2 0.9 9.1 8.5 4.7 1.0 3.4 6.4 3.2 7.6 2.4 ro02115 anti-sigma factor antagonist 0.3 0.2 1.5 2.3 0.7 1.3 0.9 1.2 19.5 5.8 3.3 16.9 12.8 12.5 7.5 14.9 12.0 ro02146 groL2 60 kDa chaperonin GroEL 0.9 0.6 0.6 0.2 0.2 0.3 0.2 0.6 1857.5 1624.1 877.4 1261.8 239.0 274.6 253.1 563.5 548.9 ro02188d thiG thiazole biosynthesis protein ThiG 1.1 0.7 0.9 0.9 0.8 1.0 1.0 1.4 124.4 135.4 95.2 168.2 78.6 97.7 94.1 175.7 81.6 ro02377 multicopper oxidase 2.0 2.9 6.5 1.7 1.6 1.1 1.2 1.4 57.0 114.6 195.6 409.3 92.0 90.3 47.1 107.0 48.9 ro02486 probable sterase / lipase 0.5 1.6 3.2 1.1 1.5 2.0 0.3 0.4 12.8 6.8 17.4 10.1 18.0 10.1 9.3 1.8 5.0 ro02648 aryl-alcohol dehydrogenase 0.5 1.4 6.8 0.4 2.8 5.9 2.8 1.9 14.4 6.8 9.6 24.0 4.3 5.8 32.9 9.0 5.0 ro02660 aldehyde dehydrogenase 1.4 4.3 3.1 2.9 1.0 0.6 1.3 0.8 |ro05244c 132.2 62.3 146.5 132.2 46.6 38.5 20.5 61.8 21.7 ro02682d proline/betaine transporter, 4.4 1.8 2.4 2.6 0.9 1.3 1.4 1.1 MFS family 2.7 12.1 28.5 12.3 26.2 9.3 9.3 7.6 7.0 ro02858 paaH phenylacetic acid degradation ring 0.9 1.2 0.3 0.8 1.0 0.9 0.6 0.9 hydroxlyating complex protein 2 31.9 28.2 24.1 21.4 11.0 15.5 8.9 35.9 21.0 ro02895 probable chromosome partitioning 0.9 0.4 0.9 1.0 0.6 1.0 1.0 1.6 ATPase, ParA family 176.1 159.4 97.3 147.3 91.9 105.9 121.4 225.7 139.6 ro02917 probable transcriptional regulator, 1.0 1.0 0.2 4.0 0.8 4.2 1.3 1.2 TetR family 20.6 20.2 12.9 2.0 19.6 14.5 18.8 25.1 9.3 ro02944 aspAl aspartate ammonia-lyase 0.9 0.7 2.7 2.4 0.9 0.5 0.4 0.8 117.5 104.4 88.1 332.1 161.9 93.4 44.0 76.4 56.1 ro02966 conserved hypothetical protein 1.7 3.5 4.6 2.0 1.7 0.9 0.8 0.9 69.2 119.1 235.8 280.6 88.7 108.9 30.8 95.0 31.8 ro02992 probable inositol 2-dehydrogenase 1.0 0.5 2.3 1.0 0.5 0.7 0.6 1.4 148.1 149.5 105.2 262.4 71.1 72.6 41.2 132.3 71.6 OO ro02997 ro03152 |ro08804c ro03242 ro03287 ro03386 ro03512 ro03677 ro03680 gyrA ro03775 ro03828 ro03963d ro04066 ro04165 ro04267 ro04316 ro04326 Appendix B probable catechol 1,2-dioxygenase 11.1 conserved hypothetical protein 775.0 possible transcriptional regulator 21.4 hypothetical protein 39.7 possible fumarylacetoacetate hydrolase family protein 12.2 sigma factor, sigma 70 type, group 4 (ECF) 37.2 conserved hypothetical protein 108.4 D N A topoisomerase subunit A 183.5 conserved hypothetical protein 1756.1 conserved hypothetical protein 18.7 proline/betaine transporter, MFS family 114 propionyl-CoA carboxylase 36.9 possible vanillate monooxygenase oxygenase subunit 537.9 possible low temperature requirement protein A 31.1 possible transcriptional regulator, WhiB family 20.4 possible protease 9.7 Continued 0.9 2.2 2.5 1.4 76.6 200.7 142.4 43.6 1.1 0.5 0.7 0.4 816.0 394.7 534.7 176.2 0.8 1.4 2.5 1.2 17.1 30.3 25.2 20.5 0.8 0.6 0.3 2.0 32.7 20.4 10.7 23.7 0.8 2.7 3.0 1.8 9.8 33.2 18.5 13.9 2.1 0.8 1.1 1.2 77.7 47.9 59.3 43.1 0.8 0.4 0.5 1.0 89.1 32.6 42.7 39.5 1.1 0.3 0.9 0.8 207.8 83.4 153.0 83.7 1.4 3.3 3.8 1.8 69.5 114.3 156.9 67.6 0.4 3.7 1.1 0.3 7.3 12.6 5.8 7.2 1.8 1.0 1.1 0.3 20.5 11.4 4.4 2.2 0.8 0.6 0.4 0.4 158.1 103.9 78.4 37.3 0.9 1.1 1.5 0.8 477.8 765.9 1380.5 277.0 1.2 0.5 0.5 0.3 36.5 20.1 16.8 10.2 2.8 1.1 1.8 0.7 56.6 19.4 22.7 14.5 0.5 0.8 1.2 2.1 4.8 6.2 7.7 15.4 0.7 0.7 0.7 1.2 52.9 34.2 84.3 28.0 0.2 0.3 0.3 0.9 162.0 94.5 311.1 62.1 1.7 0.9 1.0 0.8 36.2 7.6 25.6 13.9 0.5 1.4 0.7 1.5 19.8 26.1 31.9 24.3 0.5 1.8 2.3 0.6 6.7 7.5 18.2 3.8 1.1 1.0 1.5 1.4 43.6 26.2 85.3 35.7 0.7 1.7 1.4 1.9 78.1 71.6 217.0 94.3 0.5 1.0 1.1 1.6 107.2 151.7 259.8 188.9 2.7 0.8 1.0 0.9 85.3 26.3 74.2 21.4 2.6 1.3 0.8 0.6 13.6 3.7 9.6 5.8 1.2 0.6 1.6 3.1 10.0 3.5 6.5 13.8 0.6 1.0 0.9 1.4 111.0 112.3 228.4 141.4 0.6 0.4 0.4 0.6 339.2 199.5 457.8 267.5 1.0 1.0 0.8 1.2 29.3 16.9 42.9 26.1 0.2 1.0 1.1 1.2 4.9 6.4 19.8 10.8 1.5 0.3 13.0 0.2 8.6 2.6 24.7 2.0 ro04728 ro04729 ro04730d ro04731 ro04732 ro04904 ro04934 ro04948 ro05072 ro05105 ro05119 ro05290 ro05387 ro05442 ro05489 ro05628d Appendix B sigma factor, sigma 70 type, group 3 probable transcriptional regulator, MerR family hypothetical protein probable transcriptional regulator, MerR family hypothetical protein conserved hypothetical protein possible hydroxylase conserved hypothetical protein transcriptional regulator, GntR family probable Mg(2+) and Co(2+) transporter possible protocatechuate dioxygenase probable betaine-aldehyde dehydrogenase transcriptional regulator, AsnC family probable glycosyltransferase conserved hypothetical protein possible large-conductance mechanosensitive channel 222.1 126.3 72.7 28.7 240.9 77.4 473.9 128.3 8.2 48.1 59.7 19.4 38.2 27.7 15.5 81.8 Continued 3.1 13.6 5.2 1.3 466.6 1969.6 596.5 98.2 2.1 2.8 2.1 0.7 219.9 299.8 268.0 43.9 0.6 0.9 0.8 0.8 46.7 45.3 38.3 23.9 2.7 8.9 13.6 4.9 231.6 482.3 837.6 206.6 2.4 9.0 18.5 5.6 554.5 2680.7 4867.2 644.8 1.4 3.2 4.6 2.0 106.0 229.3 224.7 84.3 1.3 1.2 3.5 5.5 611.3 528.9 1620.9 882.3 1.0 0.2 0.5 0.5 108.1 27.2 62.3 23.2 2.5 0.8 2.0 0.5 20.5 8.7 10.6 10.3 0.5 0.5 1.3 1.3 24.6 24.6 43.3 24.9 1.1 2.3 5.0 7.0 67.6 117.7 252.7 162.5 0.4 6.4 1.7 1.3 7.5 4.7 6.8 6.4 1.0 0.4 0.9 1.7 36.8 14.7 22.0 24.7 0.5 0.1 0.4 1.0 13.8 2.6 9.2 11.2 0.9 0.4 0.3 5.4 13.5 8.1 2.8 27.0 1.0 2.2 1.8 1.2 78.2 86.8 101.2 41.3 0.9 1.0 0.6 1.0 106.8 90.5 136.2 83.2 0.7 0.9 0.7 0.8 85.5 53.2 123.8 64.4 1.0 1.2 0.6 0.6 52.5 21.9 55.7 15.0 1.2 1.3 1.0 1.2 62.2 50.0 91.5 50.8 2.6 2.1 1.3 1.9 570.1 307.5 421.8 235.5 2.1 1.0 1.3 1.1 78.5 47.7 90.3 28.1 2.4 9.8 5.8 8.4 1863.3 2158.3 3353.4 2287.7 0.3 0.7 0.7 1.3 34.7 40.3 126.2 87.3 2.1 1.7 0.9 1.0 35.3 11.3 9.0 8.0 0.9 1.0 1.2 2.0 33.4 26.8 55.9 55.3 1.7 3.0 2.0 2.0 101.9 95.6 126.8 52.1 0.2 0.1 1.0 0.6 11.6 0.3 13.2 4.0 1.1 2.0 0.9 2.5 33.3 22.3 39.9 17.5 0.1 1.5 0.5 2.4 1.5 14.2 12.5 16.5 1.6 1.6 0.8 2.1 15.0 9.5 13.3 7.8 0.8 1.1 0.9 1.5 54.3 34.7 89.5 61.8 ro05633 ro05677 dctA3 ro06795d ro06834 trkA ro06835d ro05745 ro05850 ro05855 ro05892 htpG ro05957 ro06008 ro06027 addl ro06028 ro06073 ro06081 |ro08917c Appendix B molybdopterin biosynthesis protein 33.8 C4-dicarboxylate transporter, D A A C S family 447.6 proline/betaine transporter, MFS family 79.2 Trk system potassium uptake protein 73.2 Trk system potassium uptake protein 44.1 probable UDP-glucose 4-epimerase 7.9 transcription elongation factor 112.8 possible hemolytic factor 83.8 chaperone protein HtpG (heat shock protein HtpG) 212.5 conserved hypothetical protein 7.9 monooxygenase 18.8 adenosine deaminase 16.2 possible amidase 52.3 probable FMN-dependent (S)-2-hydroxy-acid oxidase 24.3 dehydrogenase 135.7 Continued 0.9 1.0 1.1 2.1 0.9 1.0 0.8 0.4 30.2 28.4 25.2 20.8 20.8 18.2 28.5 7.4 1.1 3.6 3.7 2.0 2.2 2.2 1.0 1.0 479.9 1166.2 1391.1 311.6 627.5 336.0 537.2 218.9 1.2 1.7 2.6 1.4 0.9 1.7 1.5 1.4 94.7 134.4 195.4 64.8 67.8 81.5 155.7 69.3 1.2 0.8 0.7 0.9 0.7 0.6 0.8 1.1 91.3 39.0 43.7 40.4 35.1 25.3 72.6 40.7 0.9 0.7 0.5 0.6 0.8 1.3 0.9 1.1 38.4 19.3 15.4 10.6 22.7 13.9 38.6 21.0 0.7 1.0 0.5 0.4 0.4 2.6 1.9 1.3 5.2 5.3 4.5 4.1 1.9 11.0 18.5 4.6 1.0 0.5 0.7 1.1 0.7 1.2 1.0 1.8 118.5 40.3 56.0 39.0 65.6 42.0 132.1 57.9 0.7 0.3 0.8 1.6 0.4 1.1 0.7 1.0 58.1 19.4 40.9 41.4 30.9 30.8 78.3 39.4 1.0 0.4 0.7 0.4 0.3 0.6 0.8 1.2 213.0 90.0 157.0 51.8 67.6 63.6 248.3 106.5 2.9 0.7 0.1 0.6 0.5 0.5 0.8 1.5 22.6 10.0 1.0 3.5 3.7 4.6 12.4 6.9 1.0 0.3 1.7 1.5 0.4 0.7 0.7 5.8 19.4 6.2 21.7 20.0 7.3 7.0 12.0 10.3 0.8 0.2 0.5 1.0 0.7 0.8 1.3 0.8 12.6 3.7 11.1 10.8 15.4 10.9 33.1 15.9 1.3 2.4 4.2 1.9 2.0 1.2 0.9 1.1 70.4 90.7 156.8 70.6 67.5 24.3 53.0 27.1 1.2 1.6 0.8 0.5 0.3 1.2 0.8 1.3 28.1 47.7 22.8 10.5 10.5 11.4 30.1 24.4 1.1 3.8 8.1 1.5 1.3 2.0 0.8 0.9 48.4 152.8 279.3 39.4 41.5 39.3 43.6 23.2 Appendix B - Continued ro06083| probable ethanolamine permease, A P C superfamily 1.0 1.4 1.4 1.1 1.1 1.2 0.7 0.7 rol0428c 14.2 14.0 24.5 12.9 17.1 20.2 6.6 8.0 7.3 ro07020 probable protein-tyrosine kinase 1.2 4.7 13.8 10.6 1.2 3.7 4.3 6.3 18.5 22.0 165.0 308.1 159.2 61.7 76.2 142.0 80.8 ro08171 probable A B C taurine transporter, 1.0 2.3 1.7 1.5 1.3 1.3 1.0 0.9 |rol0204c permease component 196.3 193.0 278.4 181.0 113.9 154.3 65.3 210.5 48.9 ro08175 tpaR transcriptional regulator, IclR family 0.9 1.4 3.0 2.1 1.0 1.3 1.5 2.2 |rol0200c 148.8 136.7 247.1 499.9 169.7 170.7 160.6 346.0 186.0 ro08251 starvation-response D N A binding protein 2.3 0.7 6.8 3.7 1.7 0.9 1.2 1.9 12.0 28.1 13.7 61.1 38.9 36.3 17.7 38.0 19.4 ro08275 possible glutamate synthase (ferredoxin) 0.3 0.5 0.5 1.2 2.1 1.0 3.3 5.8 8.9 2.6 2.9 1.7 8.3 6.4 4.9 16.7 8.7 ro08281 GTP cyclohydrolase I 0.7 2.7 7.4 0.9 1.6 0.5 0.7 0.8 15.1 10.0 16.2 30.0 9.4 7.1 4.7 6.6 9.6 ro08492 hypothetical protein 0.7 2.0 6.2 3.1 0.6 0.5 1.0 0.4 19.7 13.6 35:4 24.0 22.2 13.2 4.1 20.1 7.9 ro08626d proline/betaine transporter, 1.0 1.2 1.2 1.5 1.2 0.5 1.4 1.1 MFS family 48.0 45.7 34.7 51.7 37.7 33.5 16.9 51.7 16.6 ro08712 hypothetical protein 1.7 2.5 3.3 2.5 2.1 1.1 1.3 0.8 89.8 150.4 206.5 280.1 166.2 164.7 84.8 136.3 50.7 ro08738 hypothetical protein 1.1 2.6 3.1 2.2 2.4 0.9 1.5 0.8 102.1 111.8 169.1 189.7 103.1 90.3 37.6 138.9 37.8 ro08854 probable muconate cycloisomerase 0.5 3.7 2.5 2.7 0.7 2.1 1.3 1.5 9.9 4.6 9.5 14.5 15.4 4.9 5.5 23.1 7.0 ro08919d pccB2 propionyl-CoA carboxylase beta subunit 0.7 0.5 0.8 1.3 2.5 1.5 0.6 0.5 7.6 5.0 1.5 9.2 8.3 12.5 4.7 12.0 5.2 ro10045 possible type II/IV secretion system 0.8 0.3 0.5 0.5 0.4 0.6 0.8 1.1 protein 363.6 301.3 180.7 208.0 105.2 183.1 183.4 355.3 240.0 ro10062 rhodococcal conserved hypothetical 0.8 1.9 5.5 5.1 2.9 0.4 1.7 1.3 protein 5.4 4.1 18.2 12.4 12.2 21.8 3.4 16.1 20.5 Appendix B - Continued ro10074 possible transcriptional regulator, 4.6 0.4 1.3 1.3 0.4 2.3 2.3 0.1 WhiB family 1.4 6.3 4.4 1.8 14.6 12.3 4.7 4.8 1.4 ro10342 conserved hypothetical protein 0.8 1.0 2.1 1.4 2.6 2.3 0.7 0.7 31.3 25.4 34.9 36.5 36.1 59.9 11.4 26.0 17.7 rol0435d probable proline/ betaine transporter, 1.1 1.5 1.4 2.1 2.3 1.3 1.7 0.7 MFS superfamily 56.0 62.8 54.5 58.4 72.5 59.7 27.5 104.2 20.1 r o l l l l 5 possible general secretion pathway 1.8 0.7 0.0 0.1 0.9 0.7 0.4 1.1 protein 2.4 4.2 5.0 0.8 1.8 2.8 1.4 4.0 2.8 ro 11209 conserved hypothetical protein 1.2 1.1 5.9 3.3 3.4 6.1 3.8 6.1 85.6 105.6 68.3 317.7 119.3 269.5 178.6 369.2 194.6 roll238 probable membrane transport protein 0.9 3.0 1.1 3.0 2.4 1.4 1.0 0.9 46.2 42.9 61.7 32.9 25.0 45.9 21.5 36.9 13.1 roll278 conserved hypothetical protein 0.5 0.2 0.6 1.2 0.6 1.1 1.2 1.5 38.5 34.5 15.1 28.1 34.5 34.0 30.8 103.8 39.7 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092631/manifest

Comment

Related Items