UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Nutritional and neuroendocrine control of appetite in transgenic coho salmon Raven, Peter Andrew 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2006-0292.pdf [ 9.97MB ]
Metadata
JSON: 831-1.0092571.json
JSON-LD: 831-1.0092571-ld.json
RDF/XML (Pretty): 831-1.0092571-rdf.xml
RDF/JSON: 831-1.0092571-rdf.json
Turtle: 831-1.0092571-turtle.txt
N-Triples: 831-1.0092571-rdf-ntriples.txt
Original Record: 831-1.0092571-source.json
Full Text
831-1.0092571-fulltext.txt
Citation
831-1.0092571.ris

Full Text

NUTRITIONAL A N D NEUROENDOCRINE CONTROL OF APPETITE IN TRANSGENIC C O H O S A L M O N by PETER A N D R E W R A V E N B.Sc, The University of British Columbia, 2002 M A S T E R OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES (Zoology) THE UNIVERSITY OF BRITISH C O L U M B I A April, 2006 © Peter Andrew Raven, 2006 11 ABSTRACT The increased feeding motivation and enhanced growth found in growth hormone (GH) transgenic coho salmon, Oncorhynchus kisutch, raises questions regarding the hormonal changes regulating growth and feed intake. These fish exhibit increased circulating G H and insulin-like growth factor I (IGF-I) and GH mRNA expression resulting from the GH transgene, but the role of the other hormones in the GH-axis and appetite control are unknown. Transgenic and non-transgenic coho salmon pre-smolts were fed diets with 15, 17, 19 and 21 M J of digestible energy/kg for 84 days and they were analyzed for growth, feed intake and protein utilization. Gene mRNA expression of the major regulators in the GH-axis: growth hormone, growth hormone receptor (GHR), insulin-like growth factor I, growth hormone-releasing hormone (GHRH) and somatostatin (SS) as well as the appetite hormone, cholecystokinin (CCK), were analyzed with quantitative PCR in the brain of fish from this experiment and in six brain regions (telencephalon, hypothalamus, pituitary, optic tectum, midbrain, cerebellum) and muscle and liver of size-matched (55g) full-ration transgenic, restricted-ration transgenic (pair-fed to non-transgenic fish) and full-ration non-transgenic fish. Transgenic fish had greater feed intake and growth which were respectively negatively and positively correlated with the digestible energy content of the diet. Protein use was more efficient in transgenic fish when fed the 15 and 17 MJ/kg diets only and diet had no effect on gene expression. Plasma IGF-I was greater in transgenic fish but did not correlate with weight as in the non-transgenic coho salmon. In the size-matched study, G H expression was highest in transgenic fish, except in the pituitary where there were no differences. GHR expression generally followed that of G H but was tissue specific. Transgenic fish has higher IGF-I expression but hepatic IGF-I levels in ration-restricted transgenic fish were reduced to that of non-transgenic fish. G H R H , SS or C C K expression did not differ between groups. It is concluded that transgenic fish, with enhanced growth, feed intake and protein utilization, ingested feed to meet a caloric demand that was possibly set by increased GH, GHR and IGF-I whereas the other G H regulating hormones and the C C K satiety signal showed little change. i i i TABLE OF CONTENTS ABSTRACT i i TABLE OF CONTENTS .......... i i i LIST OF TABLES , vi LIST OF FIGURES '. vii ACKNOWLEDGEMENTS viii DEDICATION ix CHAPTER 1 1 1.1 Introduction 1 1.2 Dietary Energy Utilization ....... - .2 J. 2.1 Protein 4 1.2.2 Lipid 5 1.3 Growth Hormone Axis 7 1.3.1 Growth Hormone Receptor 8 1.3.2 Insulin-Like Growth Factor 1 9 1.3.3 Growth Hormone-Releasing Hormone 11 1.3.4 Somatostatin 13 1.4 Appetite Regulators 15 1.4.1 Neuropeptide Y. 15 1.4.2 Cholecystokinin •• 17 1.5 Objectives and Hypotheses 18 1.6 References 21 CHAPTER 2 45 2.1 Introduction 45 2.2 Materials and Methods 47 2.2.1 Diet Composition 47 2.2.2 Growth Experiment 48 2.2.3 Fish Weighing, Sampling and Treatment ..48 2.2.4 Digestibility Study 49 2.2.5 Chemical Analyses 49 2.2.6 Performance Parameters 50 2.2.7 Statistics 51 iv 2.3 Results 52 2.3.1 Composition and Digestibility of Test Diets 52 2.3.2 Fish Growth, Feed Intake, Diet Utilization and Percent Survival 52 2.3.3 Whole Body Proximate Composition 54 2.4 Discussion 55 2.5 Conclusions 61 2.6 Acknowledgements 61 2.7 References 73 CHAPTER 3 81 3.1 Introduction 81 3.2. Materials and Methods 84 3.2.1 Fish Culture and Sampling 84 3.2.1.1 Trial 1: Transgenic, ration-restricted transgenic, and non-transgenic samples 84 3.2.1.2 Trial 2: Transgenic samples from fish raised on different energy diets 84 3.2.2 RNA Extraction and cDNA Synthesis 85 3.2.3 Quantitative PCR 85 3.2.3.1 Assay design 85 3.2.3.2 Trial 1 86 3.2.3.3 Trial 2 86 3.2.4 Statistics 87 3.3 Results 87 3.3.1 Trial 1 ; 87 3.3.2 Trial 2 89 3.4 Discussion 90 3.4.1 Trial 1 90 3.4.2 Trial 2 •. 94 3.5 Conclusions 95 3.6 Acknowledgements 95 3.7 References 105 CHAPTER 4 114 4.1 Introduction 114 4.2 Digestible Energy and Protein Utilization 114 4.3 Plasma IGF-I 115 V 4.4 Gene mRNA Expression 115 4.5 Additional Research Questions 116 4.6 Conclusions • 119 4.7 References 121 VI LIST OF TABLES Table 2.1 Ingredients and proximate compositions of the test diets 62 Table 2.2 Growth and percent survival of transgenic and non-transgenic coho salmon on diets with different digestible energy 64 Table 2.3 Whole body proximate composition of transgenic and non-transgenic coho salmon in relation to diet treatment t... 65 Table 3.1 Quantitative PCR primer and probe sequences for coho salmon 96 Table 3.2 Correlations of GH, GHR and IGF-I mRNA expression ratios in body tissues of coho salmon 97 Vll LIST OF FIGURES Figure 1.1 Hormonal interactions of the GH-axis 20 Figure 2.1 Apparent digestibility coefficients 66 Figure 2.2 Growth measures 67 Figure 2.3 Total dry feed intake : 68 Figure 2.4 Dry feed intake expressed as % body weight/day 69 Figure 2.5 Energy and protein intake 70 Figure 2.6 Protein efficiency ratio, percent protein deposition and available percent protein deposition 71 Figure 2.7 Gross and available energy utilization 72 Figure 3.1 Gene expression of 13-actin and growth hormone in size-matched fish brain regions 98 Figure 3.2 Gene expression ratios in size-matched fish liver and muscle 99 Figure 3.3 Gene expression ratios of growth hormone receptor and insulin-like growth factor I in size-matched fish brain regions 100 Figure 3.4 Gene expression ratios of growth hormone-releasing hormone and somatostatin in size-matched fish brain regions 101 Figure 3.5 Gene expression ratio of cholecystokinin in size-matched fish brain regions. 102 Figure 3.6 Gene expression in brain regions of fish on different diets 103 Figure 3.7 Plasma insulin-like growth factor I concentrations in fish on different diets 104 ACKNOWLEDGEMENTS Vll l I would like to greatly thank Dr. Robert Devlin for his inspiring insight and generous guidance throughout the duration of my degree. I would also like to thank Dr. David Higgs for his expertise on fish nutrition and support in writing the manuscript as well as Mitchell Uh and Dionne Sakhrani for their tutelage and counsel. I thank Dr. Dolph Schluter for without his support I would not have had the opportunity to pursue this project. Further thanks go to my committee, the faculty, staff and grad students of the Department of Zoology for inspiring me and providing me the tools to achieve my goals. Special thanks go to my parents and Anna Karlen for their support both morally and financially throughout my degree. DEDICATION To Anna CO-AUTHORSHIP STATEMENT The following research projects were designed by Peter A . Raven, Dr. Robert H . Devlin and Dr. David A . Higgs. The nutrition experiments in Chapter 2 involved contributions by Dr. David A . Higgs in the form of diet design and extensive manuscript revision. The experiment was constructed and performed, data analyzed, and manuscript researched and written by Peter A . Raven. The gene analysis experiment in Chapter 3 was partially performed by other members of the Genetics Lab at the Department of Fisheries and Oceans/UBC Center for Aquaculture and Environmental Research. The fish were raised and sampled by other members of Dr. Devlin's lab. Quantitative PCR assays for insulin-like growth factor I, growth hormone receptor, myosin, albumin, B-actin and growth hormone were designed by a Department of Fisheries and Oceans technician, Mitchell Uh. Furthermore, Mitchell Uh measured expression of these genes in liver and muscle tissue. Gene expression assays for growth hormone-releasing hormone, somatostatin and cholecystokinin were designed by Peter Raven and, in addition to the assays noted above, were used to measure gene expression in the brain. Analyses of the fish from the nutrition experiment were performed by Peter A . Raven. Data analysis and manuscript research and writing were conducted by Peter A . Raven with revisions by Dr. Robert H . Devlin. 1 CHAPTER 1 Nutrition, growth hormone and appetite control and thesis objectives. 1.1 Introduction The growth of the aquaculture industry and its modern economic importance has led to the suggestion that endocrinologically or genetically modified salmonids may be used to increase the maximum size and feed utilization, and decrease the growth duration of farmed fish (Mayer et al., 1994; Devlin et al., 1995). Indeed, many species of commercially-raised fish have now been modified for increased growth performance and feed efficiency including Arctic char (Pitkanen et al., 1999), carp (Hinits and Moav, 1999), tilapia (Rahman and Maclean, 1999), mud loach (Nam et al., 2001) and Atlantic salmon (Cook et al., 2000). Coho salmon, Onchorynchus kisutch, transgenic for chinook salmon growth hormone (GH) production is another of these genetically modified species (Devlin et al., 1994; Devlin et al., 1995). Transgenic coho salmon can grow at approximately 2-3 times the daily rate of wild stocks as a result of centrally uncontrolled G H production which can ultimately result in transgenic and non-transgenic siblings being very different sizes (from several fold to 20 fold depending on the species and strain). Associated with increased growth is a greater food consumption in which the fish feed more aggressively (Devlin et al., 1995; Devlin et al., 1999; Sundstrom et al., 2003; Sundstrom et al., 2004b). Growth hormone transgenesis has many pleiotropic effects. For example, pituitary size decreases in G H transgenic coho salmon with age, due to the lack of endogenous G H production (Mori and Devlin, 1999). In contrast the intestinal surface area of these fish is 2.2 fold greater than that of controls (Stevens and Devlin, 2000). Increased intestinal surface area has also been seen in transgenic Atlantic salmon (Stevens et al., 1999). Changes to the shape of the head, caudal peduncle and abdominal region have resulted from enhanced cartilage and bone growth stimulated by increased GH producton (Ostenfeld et al., 1998). Parr-smolt transformation also occurs sooner in transgenic salmon than controls and there is an attendant increase in the osmoregulatory ability of the transgenic fish (Devlin et al., 1995; Devlin et al., 2000). Due to the structure of the muscle in transgenic coho salmon, they may have a higher glycolytic and aerobic requirement for muscle use (Hill et al., 2000). Indeed, these fish have greater oxygen consumption and lower swimming efficiency when starved and they consume more oxygen than controls after feeding (Lee et al., 2003; Leggatt et al., 2003). Furthermore, during smoking, 2 transgenic coho salmon are more susceptible to bacterial disease although no differences are seen at the fry stage (Jhingan et al., 2003). However, before this study was undertaken it was unknown how transgenic coho salmon utilized their enhanced feed intake for growth related to non-transgenic counterparts. Furthermore, there was a scarcity of knowledge in respect to the way in which increased growth hormone titres and feed intake modified, or was modified by, the physiology of both the GH axis and the associated hormones that control feeding. Therefore, the thesis had three major goals: 1) To add to our understanding of growth physiology and nutrient utilization in transgenic coho salmon. 2) To investigate the manner in which appetite regulation is modified by changes in the GH axis in vertebrates; specifically elevations in circulating GH. 3) To use these changes in physiology to help predict the potential impacts of transgenic coho salmon on the natural ecosystem i f these fish were to escape and interact with wild non-transgenic fish. The latter is a major concern when developing genetically modified fish and farming non-transgenic salmon in. sea pens (Johnstone et al., 1978; Kapuscinski and Hallerman, 1991; Devlin, 1997). 1.2 Dietary Energy Utilization In order to elucidate the hormonal mechanisms that result in an increased desire for fish to feed, it is critical to determine the manner in which transgenic fish utilize the nutrients they consume for growth. The energy-yielding fraction of feed includes protein, lipid, and carbohydrate and the non-energetic fraction is comprised of vitamins and minerals. The protein component of feed is composed of about 20 amino acids of which 10 are essential for proper fish growth. The latter include arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine (NRC, 1993). Proteins are enzymatically cleaved to amino acids and di- and tripeptides in the intestine before being absorbed and catabolized (NRC, 1993). Many protein sources contain different amino acid compositions that include limitations in some amino acids that cannot be sufficiently synthesized by fish. Thus, the proper abundance of each amino acid must be provided through the use of protein sources that are complementary in digestible amino acid levels and possibly some supplemental amino acids such as lysine and/or methionine. The protein content required for maximum growth efficiency differs between species and reduced growth or increased susceptibility to disease appears in the absence of proper protein balance (NRC, 1993). Dietary lipid is required to provide 1) sufficient dietary energy, 2) essential fatty acids of the omega-3 (n-3) and/or omega 6 (n-6) families, and 3) fat soluble vitamins. Lipids are digested 3 to free fatty acids or 2-monoglycerides before being absorbed and incorporated into tissues or metabolized for energy (NRC, 1993). Various fish species require a range of dietary lipid for different growth rates, but excessive lipid will result in fat deposition (NRC, 1993; Higgs and DOng, 2000). Carbohydrates may be added to feed to provide energy and allow the use of protein and lipid for tissue or chemical synthesis rather than metabolic energy. Fish possess the enzymes to digest carbohydrates with the exception of complex carbohydrates such as cellulose and fibre (NRC, 1993). Carbohydrate digestibility varies and will be discussed below. Minerals are essential for proper physiological function through hormone and enzyme synthesis, osmoregulation and electron transfer (NRC, 1993). Many essential minerals can be absorbed from the water through the gills, skin and gut including calcium, magnesium, sodium, potassium, iron, iodine, zinc, copper and selenium but these minerals, in addition to phosphates, sulphates and chlorine, can also be absorbed from the feed (NRC, 1993). Vitamins are essential for proper metabolism through their role as coenzymes. The water-soluble vitamins choline, myoinositol, riboflavin, thiamin, pantothenic acid, niacin, biotin, folate and vitamins B and C may be made by microorganisms in some fish intestines but in most cases must be supplied in the diet (NRC, 1993). The fat-soluble vitamins A , D, E and K are dependent on factors that alter fat absorption by the gut. A n excess of fat soluble vitamins may result in toxic vitamin storage, and an extreme deficiency in any vitamin group results in disease (NRC, 1993). Additional feed components include the necessary pigments (astaxanthin and canthaxanthin) for fish colouration, antioxidants to prevent naturally oxidizing lipids from damaging other feed components, pellet binders, and in some cases hormones and feed stimulants (NRC, 1993). Few studies have been conducted on the nutrient utilization in G H transgenic fish (Chatakondi et al., 1995b; Fu et al., 1998; Farmanfarmaian and Sun, 1999; Krasnov et al., 1999b; Cook et al., 2000; Fu et al., 2000; Martinez et al., 2000; Rahman et al., 2001; Dunham et al., 2002), but research on unmodified farmed salmon species is abundant. The effects of varying digestible protein, lipid, carbohydrate, and total energy on the growth and nutrient composition of fish have often been assessed in nutrition studies. Furthermore, the ratios of dietary lipid to protein, and lipid to total digestible energy, have strong effects on the growth of farmed fish. Other dietary parameters such as feeding frequency, feeding time and diet pellet size may also affect fish growth (Brett and Groves, 1979; Higgs et al., 1995). These nutrition variables will be discussed in relation to both farmed and transgenic fish. 4 1.2.1 Protein Fish growth and the deposition of new tissue are greatly affected by total protein intake. The ratio of protein to total energy in the diet can affect feed intake and protein utilization, resulting in differences in growth (mass or length) and differences in protein levels in the proximate composition of the fish. In cases where excessive protein is available, protein must be de-aminated and excreted. When total energy is limiting in diets, protein may be used as an energy source, potentially at the expense of protein available for growth (Millikin, 1982; Higgs et al., 1995). Alternatively, when adequate non-protein dietary energy is available a protein sparing effect may occur, in which protein deposition efficiencies increase in fish on lower protein diets. In Atlantic salmon this has occurred in studies where there has been an increase in dietary carbohydrate (Hemre et al., 1995; Grisdale-Helland and Helland, 1997; Sveier et al., 1999; Hillestad et al., 2001), lipid (Hillestad and Johnsen, 1994) or total energy (Bendiksen et al., 2003; Azevedo et al., 2004; Krogdahl et al., 2004). Protein sparing has also been observed in masu salmon with an increase in dietary energy (Lee and Kim, 2001) and in coho salmon with an increase in dietary lipid (Millikin, 1982; Chan et al., 2002). Conversely, Azevedo et al. (2004) did not find a protein sparing affect in lake trout under the conditions of their study. The protein content of fish tissues is dependent on fish species, age, size, and diet. Protein content increases in Atlantic salmon (Shearer et al., 1994), and rainbow trout (Reinitz, 1983) as they grow and this effect must be accounted for when analyzing the effect of dietary treatment on protein concentration. Coho salmon maintained on a high ration had increased muscle protein content (Markert et al., 1977) whereas starved fish lose protein in their muscle and liver (Einen and Thomassen, 1998; Einen et al., 1998). In cases where too much dietary energy is present, protein content can decrease whereas lipid storage increases (Weathercup et al., 1997; Johansen et al., 2002). The presence of G H greatly affects fish growth and protein utilization. Similarly, increased protein synthesis and accretion has been seen compared to controls in GH-injected rainbow trout (Forster et al., 1988; Fauconneau et al., 1996) and bass (Farmanfarmaian and Sun, 1999). In contrast to the general trend of increased body protein, bovine growth hormone injection caused a decrease in coho salmon muscle protein (Markert et al., 1977). This may have occurred as a result of insufficient total energy intake and the use of protein for energy. GH transgenic carp were found to have increased protein retention and content (Fu et al., 1998; Dunham et al., 2002) and transgenic tilapia were observed to have both greater protein synthesis and efficiency (Martinez et al., 2000; Rahman et al., 2001). 5 1.2.2 Lipid Most stored energy in Pacific salmon is in the form of protein, but because this energy is needed for activities such as swimming, most of the energy that is mobilizable for metabolism is stored as lipid (Hendry et al., 2000). Lipid, like protein, proportionally increases in tissues with fish size (Vanstone and Markert, 1968; Shearer et al., 1994; Torstensen et al., 2001; Nordgarden et al., 2003) and with certain types of diets. Higher energy intake (due to increased energy content in the diet or an increase in ration (Shearer, 1994)), has been found to raise lipid content in masu salmon (Lee and Kim, 2001), coho salmon (Chan et ah, 2002), rainbow trout (Bolliet et al., 2000) and Atlantic salmon (Grisdale-Helland and Helland, 1997). High fat diets also have been found to increase fat content in Atlantic salmon (Bjerkeng and Berge, 2000; Torstensen et al., 2001; Bendiksen et al., 2003) and rainbow trout (Jobling et al., 1998). Alternatively, both starvation and increased activity lower muscle and liver lipid stores (Reinitz, 1983; Einen and Thomassen, 1998; Einen et al., 1998; Morris et al., 2003; Azevedo et al., 2004). High dietary lipid can cause enhanced growth on high protein diets, but when lipid is increased at the cost of protein, as in low protein diets, growth can be reduced (Weathercup et al., 1997; Chan et al., 2002). This effect is similar to an increased protein sparing effect with a reduction in protein until the point at which protein becomes growth limiting. As excess energy is often stored as lipid, lipid content may be an indicator of energy use. Indeed, the lipid content of fish can be altered by changing the protein to energy ratio of the feed (Morris et al., 2003; Azevedo et al., 2004), allowing for greater growth and energy storage. Lipid storage in fish tissues is a tradeoff with tissue moisture content and the two have been noted to be inversely related in coho (Nettleton and Exler, 1992; Chan et al., 2002), Atlantic (Foda, 1974; Jonsson et al., 1996; Einen et al., 1998; Bjerkeng and Berge, 2000; Simpkins et al., 2003; Solberg, 2004), and sockeye (Hendry et al., 2000) salmon, as well as rainbow trout (Reinitz, 1983; Weathercup et al., 1997; Jobling et al., 1998) and GH-injected coho salmon (Markert et al.,~ 1977). Because lipid content is related to energy intake, fish may be using a lipostat to regulate growth and body weight. Thus, they may increase feed intake to increase growth when fat stores are too low and this continues until the body lipid content reaches normal levels (Jobling and Johansen, 1999; Johansen et al., 2001; Johansen et al., 2002). Lipostat control is the expected mechanism in catch-up growth where feed has been restricted. Consequently, growth-restricted fish drastically increase growth rate upon feeding to satiation until normal size for the age group 6 is reached. This model for feed intake control does not agree with some studies on trout and chinook salmon, in which fish were shown to eat to a protein demand (Azevedo et al., 2004). Growth hormone has a marked effect on lipid storage and use. Growth hormone transgenic Atlantic salmon (Cook et al., 2000), and G H transgenic carp (Chatakondi et al., 1995a) have lower lipid content than controls which is concordant with the known lipolytic functions of G H (Higgs et al., 1975; Higgs et al., 1976; Markert et al., 1977). Lipid is mobilized and recruited for the increased energy needs and this resuls in a lower body lipid content. 1.2.3 Carbohydrate Carbohydrates are biologically available to varying degrees in different fish species due to both the species' physiological ability to digest carbohydrate and the form of carbohydrate in the diet. Herbivorous and omnivorous fish are more effective at metabolically utilizing a wide range of carbohydrates than carnivorous salmon (reviewed by Krogdahl et ah, 2005). Also, rainbow trout are better at digesting starch than Atlantic salmon (Krogdahl et al., 2004), although previous studies have shown that carbohydrate absorption is low in the latter species as well (Austreng, 1978). Glucose itself is efficiently absorbed by salmon but the degree to which starch is biologically available is dependent on the degradation of the cellulose layer surrounding the starch granule and the extent of gelatinization (Higgs et al., 1995). As carbohydrate is not known to be required in the diet of wild salmon, the presence of high dietary carbohydrate quantities generally reduces feed utilization and growth (Higgs et al., 1995). For example, a protein sparing effect of low carbohydrate can be seen in Atlantic Salmon (Hemre et al., 1995; Grisdale-Helland and Helland, 1997; Hillestad et al., 2001; Krogdahl et al., 2004) but in cases where starch is 17% of the diet or higher, growth and feed efficiency are reduced (Grisdale-Helland and Helland, 1997; Hemre et al., 2002). Furthermore, a high carbohydrate diet that is low in lipid content may cause lower growth and feed utilization (Torstensen et al., 2001). Coho salmon cannot effectively use carbohydrates in the form of raw starch and fibre in their feed (Sugiura et al., 1998) as increased fibre may reduce amino acid absorption rates (Millikin, 1982; Sugiura et al., 1998). High fibre also reduces lipid use in Atlantic salmon (Hemre et al., 1995). Despite the poor use of carbohydrates by salmon and the negative impact that high carbohydrate diets have on nutrient absorption in general, transgenesis may be able to improve carbohydrate use. For example, some indication of enhanced carbohydrate utilization 7 has been observed in rainbow trout that are transgenic for human glucose transporter I and rat hexokinase II (Krasnov et al., 1999a). 1.3 Growth Hormone Axis Growth hormone is important in the control of growth, ion balance, and smolting in many fish (Peng et al., 1984; Prunet et al., 1989; Devlin et al., 1995; Devlin et al., 2000). The hormones responsible for controlling G H levels include growth hormone-releasing hormone, somatostatin, and neuropeptide Y , and their interactions are complex (Fig. 1.1 )(Hurley and Phelps, 1992; Uchiyama et al., 1994; Flavell et al., 1996; Pellegrini et al., 1997; Minami et al., 1998). Feeding regulation is linked to GH control since neuropeptide Y is important in modulating both G H and appetite hormone systems. Other hormones involved in feed intake include cholecystokinin and leptin, and these may also interact with the GH axis (Peter, 1997; Silverstein and Plisetskaya, 2000; Gelineau and Boujard, 2001; Volkoff and Peter, 2001). These linkages may explain in part why increased feeding responses have been observed in G H transgenic fish. Transgenic mice have been extensively studied and as a result will be discussed in this review to address the evidence for G H control of appetite (Szabo et al., 1995; Flavell et al., 1996; Pellegrini et al., 1997; Peng et al., 2001). The recent research in fish will also be considered in comparison to the research on transgenic mice to reveal similarities and differences that may exist. Growth hormone transgenic salmon now permit examination of the effect that G H transgenesis has on the G H axis in fish. The G H axis consists of growth hormone-releasing hormone (GHRH) which stimulates G H production or release by the pituitary gland, and somatostain (SS, or SRIF (somatotropin release inhibitory factor)) which inhibits it (Fig. l.l)(Hurley and Phelps, 1992; Uchiyama et al., 1994; Peng et al., 2001). Both hormones act on the G H secreting cells, the somatotrophs in the pituitary gland to maintain levels of G H necessary for appropriate physiological function. G H is part of a negative feedback loop which acts through G H stimulation of SS neurons and neuropeptide Y (NPY) neurons in the hypothalamus. N P Y stimulates SS production and inhibits G H R H release (Minami et al., 1998). Another hormone, insulin-like growth factor I (IGF-I) is stimulated by G H and has direct endocrine and paracrine growth effects on target tissues. IGF-I also inhibits GH production, feeding back at the level of the pituitary and hypothalamus (Mathews et al., 1988b; Wallenius et al., 2001). N P Y is also known to stimulate feeding (Peter, 1997; Silverstein and Plisetskaya, 2000), while the digestive tract hormone cholecystokinin 8 (CCK) has a satiating effect (Silver et al., 1989; Silverstein and Plisetskaya, 2000; Jensen et al., 2001). 1.3.1 Growth Hormone Receptor The physiological actions of G H are dependent on the affinities and densities of membrane bound growth hormone receptors (GHRs). GHR expression is seen in most tissues, with the greatest expression in the liver at the major site of IGF-I synthesis. GHR densities are influenced by circulating G H and are correlated with plasma IGF-I concentrations in transgenic mice. GHR knockout mice have low or absent circulating IGF-I (Bartke et al., 1994; Peng et al., 2001; Al-Regaiey et al., 2005) and the level of GHR mRNA expression in the liver is comparable to that of IGF-I in response to G H (Iida et al., 2004). Mutated bovine G H (bGH) binds to G H receptors in the liver causing upregulation of GHR (Chen et al., 1991) and in bGH and human G H transgenic mice, overexpression of G H increases hepatic G H binding (Bartke et aL, 1994; Chen et al., 1995). Furthermore, transgenic GHRH-producing mice (increased GH production) have a three to four fold increase in hepatic GHR expression and nine fold increase in an alternatively spliced GHR transcript encoding for GH binding protein (Gonzalez et al., 2001). GHR expression may be tissue specific. Iida et al. (2004) found that bGH, G H antagonist and control mice showed no differences in pituitary GHR mRNA expression and Chen et al. (1997) found that bGH mice had decreased G H binding in the kidney. Despite the absence of GHR differences found by Iida et al. (2004), GHR dependent feedback control by G H does occur at the level of the pituitary as somatotrophs of GHR deficient mice (in the absence of GH feedback) show histological features characteristic of hyperactive secretion (Asa et al., 2000). Growth hormone receptor has been characterized in many fish species, including black sea bream (Tse et al., 2003), gilthead sea bream (Calduch-Giner et al., 2003; Saera-Vila et al., 2005), sturgeon (Liao and Zhu, 2004), turbot (Calduch-Giner et al., 2000), salmon (Fukada et al., 2004; Wargelius et al., 2005), goldfish (Lee et al., 2001), Japanese flounder (Nakao et al., 2004), snake head (Sun et al., 1997), and rainbow trout (Very et al., 2005). As in mice, GHR mRNA is present in most tissues with the highest expression found in the liver (Calduch-Giner et al., 2000; Lee et al., 2001; Calduch-Giner et al., 2003; Liao and Zhu, 2004). Different levels of GHR expression exist in various tissues, likely due to the presence of two GHR forms, GHR I and II which are present in black but not gilthead sea bream (Calduch-Giner et al., 2003; Tse et al., 2003; Saera-Vila et al., 2005), in coho salmon (GenBank #: AF403539, AF403540) and in 9 rainbow trout (Very et al., 2005). GHR I is the predominant form found in the liver and brain while pancreas and spleen have a greater expression of GHR II (Saera-Vila et al., 2005; Very et al., 2005). The reduction of IGF-I expression through fasting occurs with changes in GHR density (Wargelius et al., 2005). Food restricted rats have lower G H binding and decreased GHR mRNA and circulating IGF-I than fed rats (Maniar et al., 1994). Fasting decreases GHR density in fish as well (Fukada et al., 2004). Coho salmon and sea bream show a decrease in hepatic GHR mRNA expression after fasting but these changes are tissue specific (Fukada et al., 2004; Saera-Vila et al., 2005). In sea bream muscle GHR I expression did not change with fasting while GHR II expression increased three fold (Saera-Vila et al., 2005). Although GHR expression changes with fasting, a threshold in energy deficiency appears to exist before which changes in GHR do not occur. Requeni et al. (2005) found that although growth rate and energy retention of Atlantic salmon decrease with an increase in the energy from plant protein that is used to replace fish oils in the feed, no changes in liver GHR binding or plasma IGF-I concentrations were seen. GHR expression may also be species specific as differences were seen in a similar experiment on sea bream (Gomez-Requeni et al., 2004). 1.3.2 Insulin-Like Growth Factor I Insulin-like growth factor I (IGF-I) is produced predominantly in the liver in response to circulating GH. The growth effects of G H are mediated to a large extent by IGF-I, but both hormones may be needed for proper development. Mice with increased IGF-I production that are G H deficient grow larger than control G H deficient mice but not larger than mice with both intact IGF-I and G H genes (Behringer et al., 1990). The growth effects differed in these mice and this experiment suggested that proper liver growth is dependent on GH, and brain growth is stimulated by IGF-I. In addition, organomegaly is seen in mice with uncontrolled human IGF-I production without changes to skeletal growth (Mathews et al., 1988b). The lack of growth in G H transgenic mice before body tissues are IGF-I responsive further demonstrates the role of IGF-I in somatic growth (Mathews et al., 1988a). Transgenic mice with alterations to the GH axis provide evidence for hormonal mechanisms regulating IGF-I production. In mice over-producing human growth hormone-releasing hormone (GHRH), plasma G H and IGF-I are increased and this response can be reduced with GHRH antagonists (Kovacs et al., 1997). Similarly, mice with increased G H or GH agonist production have higher plasma IGF-I (Mathews et al., 1988a; Blackburn et al., 1997; 10 Sotelo et al., 1998) and liver IGF-I mRNA expression (Mathews et al., 1988a), while those with decreased pituitary GH production have reduced plasma IGF-I (Camacho-Hubner et al., 1991; Szabo et al., 1995). Dwarf, G H deficient mice have decreased G H R H and increased SS mRNA expression when intracerebroventricularly injected with IGF-I (Sato and Frohman, 1993). Growth hormone stimulates IGF-I production and IGF-I may feedback on GHRH neurons in the hypothalamus or on somatotrophs in the pituitary to suppress further G H release (Mathews et al., 1988b; Wallenius et al., 2001). One strain of mice with a mutated G H transgene, and resultant low plasma IGF-I, has increased pituitary G H production because GHR binding of the mutated GH in the liver blocks active G H binding and IGF-I production is not activated. The absence of negative feedback by IGF-I in this case may explain the increase in pituitary G H protein production (Chen et al., 1991). The growth effects of IGF-I are also seen in fish. Plasma IGF-I positively correlates with weight gain in fish such as Atlantic salmon (Dyer et al., 2004), coho salmon (Duan et al., 1995; Myers et al., 1998; Beckman et al., 2004a), chinook salmon (Pierce et al., 2002), and rainbow trout (Gabillard et al., 2003), but not barramundi (Nankervis et al., 2000). The regulatory mechanisms of IGF-I in fish are similar to those in mice. G H addition increased IGF-I liver mRNA expression in coho salmon hepatocyte cultures (Duan et al., 1992; Pierce et al., 2004; Pierce et al., 2005a) and GH injected coho salmon had four-fold greater plasma IGF-I concentrations (Shimizu et al., 1999). G H injection increased plasma IGF-I in rainbow trout (Foucher et al., 1992) and G H transgene expression may also cause IGF-I expression in the liver through autocrine and paracrine mechanisms in tilapia (Caelers et al., 2005). Differential expression of IGF-I mRNA transcripts is seen in fish. G H addition caused increased Ea-1 and Ea-3 IGF-I mRNA expression in the liver but not the Ea-4 transcript in other tissues of coho (Duguay et al., 1994) and Atlantic salmon (Duan, 1998). Furthermore, hepatic IGF-I mRNA decreased in fasted fish but no changes were seen in other tissues in both coho salmon (Duan and Plisetskaya, 1993) and carp (Hua and Lin, 2001). Due to the importance of IGF-I for proper somatic growth, gene expression is influenced by energy intake. Reduced feed intake, or starvation causes decreases in plasma IGF-I or liver IGF-I mRNA expression in chinook salmon (Pierce et al., 2005b), coho salmon (Duan and Plisetskaya, 1993; Shimizu et al., 1999; Pierce et al., 2001), carp (Hua and Lin, 2001), flounder (Nam et al., 1996), barramundi (Matthews et al., 1997), sea bream (Meton et al., 2000; Gomez-Requeni et al., 2004), and in most studies on tilapia (Drakenberg et al., 1989; Uchida et al., 2003). This decrease with starvation often coincides with an increase in plasma G H due to the 11 development of GH resistance by the liver and the uncoupling of IGF-I responsiveness from G H expression (Narnaware and Peter, 2001a; Valente et al., 2003; Pierce et al., 2004). Salmon with stunted growth have low IGF-I mRNA in the liver and low IGF-I protein, which may cause the apparent increases in GH due to the lack of negative feedback control (Duan et al., 1995; reviewed by Dickhoff et al., 1997). Indeed, human IGF-I decreases G H secretion from pituitary cultures in arctic char (Cameron et al., 2005). In most cases refeeding will restore plasma IGF-I and IGF-I mRNA expression (Duan and Plisetskaya, 1993; Meton et al., 2000). Some exceptions to the preceding trends are seen. Meton et al. (2000) found that growth of sea bream responded to changes in ration size and feed composition while plasma IGF-I did not. Two weeks of fasting decreased plasma IGF-I in tilapia, but did not affect G H (Uchida et al., 2003) and the characteristic increase in plasma G H that accompanies IGF-I decreases during fasting does not occur in Atlantic salmon (Bjomsson et al., 1994). Also, the correlation of growth and ration to IGF-I was found to be uncoupled with a change in temperature (Beckman et al., 2004b). Further studies on the time course of these hormonal interactions may help explain these discrepancies. 1.3.3 Growth Hormone-Releasing Hormone Growth hormone-releasing hormone (GHRH, or growth hormone-releasing factor (GRF)) is produced by neuronal cells in the arcuate nucleus of the medial basal hypothalamus (Hurley and Phelps, 1993). G H R H feedback pathways have been extensively studied in the rat, in which transgenic individuals allow study of altered hormonal physiological states (Szabo et al., 1995; Flavell et al., 1996; Pellegrini et al., 1997; Peng et al., 2001). In transgenic growth retarded rats, human G H (hGH) is constantly expressed, resulting in high levels of hGH in the rat at all times (Flavell et al., 1996). The hGH causes a decrease in GHRH mRNA expression which in turn decreases G H mRNA as well as GH protein in the pituitary (Flavell et al., 1996). The effects of this decrease is a reduced size, or dwarf phenotype due to the inability of hGH to promote somatic growth in this rat. Pellegrini et al. (1997) used these same rats to analyze the relationship of GHRH to GH through the addition of GH producing tumor cells to the pituitary. The stunted growth resulting from a lack of G H production was countered by the addition of G H in this way and GHRH cell number and cell expression were reduced (Pellegrini et al., 1997). This negative feedback control by G H is also seen in other types of transgenic rodents (Hurley and Phelps, 1993). In non-transgenic rats, inactivation of circulating G H R H caused a decrease in GH production in the pituitary and an increase in G H R H mRNA production in the 12 hypothalamus, which could be reversed by addition of GH (Uchiyama et al., 1994). Furthermore, G H injection or intracerebroventricular infusion into G H deficient dwarf rats decreased hypothalamic GHRH mRNA expression (Sato and Frohman, 1993). These results support the presence of GHRH in the hypothalamus and the importance of G H R H in G H feedback regulation. Growth hormone also affects the density of G H R H receptors in somatotrophs (Szabo et al., 1995; Peng et al., 2001). A transgenic giant mouse that overproduces G H shows a characteristic drop in G H R H mRNA expression as well as a drop in G H R H receptor R N A (Szabo et al., 1995). GHRH receptors are normally inhibited by GH yet in another transgenic giant mouse no changes in pituitary G H R H receptors were seen (Peng et al., 2001). Growth hormone receptors may be present in GHRH secreting neurons as GH receptors are seen in the arcuate nucleus of the rat hypothalamus, but evidence for direct feedback by growth hormone on G H R H neurons has yet to be observed (Minami et al., 1998). It is likely that G H has an indirect effect on G H R H secretion by acting on other neurons; these will be discussed later. Although most G H regulation work is done in transgenic mice, GHRH is also present in fish in which it is encoded with another GH-stimulating gene, pituitary adenylate cyclase-activating polypeptide (PACAP) (Parker et al., 1993). GHRH-containing neurons have been found in the brain of the green molly (Batten et al., 1990), as well as in the brain of the sea bass (Moons et al., 1989), pejerry (Miranda et al., 2002), eel (Montero et al., 1998) and salmon (Parhar and Iwata, 1996) where they are associated closely with somatotrophs. In addition to immunoreactive studies, the GHRH/PACAP cDNA has been characterized in many fish species in which mRNA expression is found in most tissues, including the brain (Parker et al., 1993; McRory et al., 1995; Fradinger and Sherwood, 2000; Small and Nonneman, 2001; Jiang et al., 2003). The mechanisms regulating GHRH action in fish are thought to be similar to those of mammals. In tilapia, injection or implantation of human, bovine and carp G H R H increased circulating G H levels and somatic growth (Melamed et al., 1995; Kelly et al., 1996; Shepherd et al., 2000). Furthermore, GHRH induces GH secretion from pituitary cells of carp (Kagabu et al., 1998), rainbow trout (Luo et al., 1990; Luo and McKeown, 1991), and salmon (Parker et al., 1997). In contrast, GHRH had no effect on G H release by either eel or turbot pituitary cells in culture, possibly because basal release is at the maximum physiological level in these species (Montero et al., 1998; Rousseau et al., 2001). Interperitoneal injection of human G H and G H R H stimulated an increase in nutrient uptake by the blood in rainbow trout, indicating increased 13 growth and metabolism (Hernandez Llorente et al., 2004). G H regulation may vary among species, especially in fish where P A C A P is equipotent, or more biologically active than GHRH (Parker et al., 1997). Analyzing the effect of G H transgenesis on G H R H regulation in fish is now possible with G H transgenic coho salmon. 1.3.4 Somatostatin In contrast to the stimulatory effects of GHRH, inhibitory control of G H secretion arises through a decrease in GHRH, mediated by effects of increased somatostatin (SS). SS neurons are present in the medial basal hypothalamus and in the periventricular nucleus (PeV) of the brain (Hurley et al., 1994). They synapse with GHRH neurons in the median eminence of the hypothalamus and inhibit the secretion of GHRH and decrease G H production (Hurley and Phelps, 1992; Uchiyama et al., 1994; Peng et al., 2001). In transgenic mice that produce human GHRH in the brain and pituitary, there is an increase in SS mRNA expression relative to controls (Hurley and Phelps, 1992). A similar increase is seen with G H injections although the response is not as great (Hurley and Phelps, 1992). Hurley et al. (1994) used three types of transgenic mice that produced either bovine or human G H to look at SS expression in the hypothalamus. In all mice there was an increase in SS neuron number and SS mRNA expression until a plateau was reached. They also hypothesized that not only could SS mRNA expression be increased, but that G H could also cause the observed increase in the number of SS neurons during development. A n increase in SS cell number and mRNA expression is seen in GH transgenic rats, and the addition of GH secreting tumor cells further increases the SS cell number and mRNA expression (Pellegrini et al., 1997). Human GH-producing rats show a similar increase in SS mRNA expression (Szabo et al., 1995) and human GHRH-producing mice show a 128% increase in SS mRNA with associated increases in SS receptor mRNA in the pituitary (Peng et al., 2001). A state of G H deficiency demonstrates the importance of SS in reducing G H R H expression. In dwarf rats with a destroyed pituitary and a lack of G H production, a 40% decrease in SS expression is observed compared to controls (Hurley and Phelps, 1992). Similarly, G H deficient rats show a increase in SS mRNA expression when injected with GH (Sato and Frohman, 1993). Deactivation of circulating GHRH molecules causes a decrease in SS mRNA in some areas of the brain but not in others, such as the periventricular nucleus of the hypothalamus (PeV) (Uchiyama et al., 1994). In mice lacking G H receptors, G H cannot act to increase SS expression and there is a 46% drop in SS mRNA (Peng et al., 2001). Direct 14 injection of G H into the PeV reduces the amplitude and duration of G H pulsatile secretion, but does not change the frequency (Minami et al., 1998). This observation along with the identification of G H receptor mRNA expression in SS neurons and other corroborative evidence for decreases in G H secretion with GH injections in the PeV (Minami et al., 1998), suggest that GH has a direct action on SS neurons. Somatostatin is present in fish as well. SS immunoreactivity is found in fish such as the green mollie (Batten et al., 1990), sea bream (Power et al., 1996), sea bass (Moons et al., 1989) and other teleosts (Olivereau et al., 1984; Tsuneki and Nozaki, 1989). Complementary D N A has been characterized from the rainbow trout (Moore et al., 1995) and three forms of differentially expressed somatostatin mRNAs have been characterized from the goldfish brain (Lin et al., 1999; Yunker et al., 2003; Canosa et al., 2005). SS functions in the same way as described in mice and rats. In vitro, it inhibits G H production by pituitary cultures in the European eel (Olivereau et al., 1984; Rousseau et al., 1998; Rousseau et al., 2001), turbot, (Rousseau et al., 2001), tilapia (Melamed et al., 1995), catfish (Lescroart et al., 1996), carp (Lin et al., 1993; Kagabu et al., 1998), arctic char (Cameron et al., 2005), goldfish (Kwong and Chang, 1997) and rainbow trout (Luo et al., 1990; Luo and McKeown, 1991). SS also reduces the increases in GH secretion stimulated by dopamine (Wong et al., 1993; Agustsson et al., 2000), or ghrelin (Unniappan and Peter, 2004). Likewise, SS inhibitors cause a rise in G H secretion in pituitary cultures containing an intact hypothalamus (Xiao and Lin, 2003). Melamed et al. (1996) and Ran et al. (2004) found that the decrease in G H production by cultured pituitary cells was caused by a decrease in G H release without a decrease in GH mRNA transcription. Differences in intracellular responses to various forms of the SS peptide may explain this discrepancy (Yunker et al., 2003; Yunker and Chang, 2004). In vivo, an inverse relationship is seen between SS immunoreactivity and serum G H over different seasons in goldfish (Marchant et al., 1989; Lin et al., 1999) but not in rainbow trout (Holloway et al., 1994), although a correlation is seen during the maturation period (Holloway et al., 1999). SS injections reduce serum G H in goldfish (Cook and Peter, 1984), tilapia (Melamed et al., 1995), and rainbow trout (Very et al., 2001; Peterson et al., 2003). Immunization against serum SS resulted in elevated circulating G H levels in rainbow trout (Peterson et al., 2003) and a growth enhanced chinook salmon was produced through the injection of ananti-SS compound (Mayer et al., 1994). Interestingly, long term starvation of eel and carp reduces SS immunoreactivity in the pituitary despite the fact that starvation often causes an increase in circulating GH (Olivereau et al., 1984). G H resistance similar to that seen in the liver may be 15 occurring in the brain as well. The mechanism of SS action seems to be similar between mammals and fish, and the previous data can be corroborated with research on transgenic coho salmon in which increased G H production should have marked effects on SS expression. 1.4 Appetite Regulators Many hormones are involved in regulating the hunger and satiation responses in fish. Feed intake is stimulated by P-endorphin (de Pedro et al., 1995a), galanin (de Pedro et al., 1995b), melanin concentrating hormone, agouti-related peptide and orexins A and B (reviewed by Tritos and Maratos-Flier, 1999). Conversely, serotonin is important in short term satiation (Halford and Blundell, 2000) and feed intake is decreased by bombesin (Himick and Peter, 1994), coticotrophin-releasing factor, neurotensin, and glucagon-like peptide 1 (reviewed by Tritos and Maratos-Flier, 1999). Leptin is a major regulator of feed intake, G H and lipid metabolism (Cai and Hyde, 1998). In goldfish, leptin injections at low levels that would not normally have an effect on feeding, enhance the inhibitory effect of cocaine and amphetamine-regulated transcript (CART) peptides on N P Y and thereby decrease appetite (Volkoff and Peter, 2001). Furthermore it attenuates the effect of C C K (Volkoff et al., 2003). Another important hormone in both G H control and appetite is the gut-derived hormone, ghrelin. Ghrelin increases GH release and stimulates feed intake (reviewed by Unniappan and Peter, 2005). Both the orexigenic hormone, NPY, and anorexigenic hormone, C C K , are also important in appetite control and have roles in G H regulation. 1.4.1 Neuropeptide Y The complexities of G H regulation become important when considering the interactions between the G H axis and the hormones that are involved in feeding control, such as neuropeptide Y (NPY). N P Y is produced by neurons in the arcuate nucleus (ARC) and is structurally related to the gut peptides PP and P Y Y (Larhammer, 1996). N P Y is thought to stimulate food intake in general, and specifically stimulate SS expression in the A R C and PeV to reduce pituitary GH release (Minami et al., 1998). Studies of food intake often do not consider the effects of N P Y on the G H axis, and studies concerned with G H interactions do not normally consider the role of N P Y in feeding (Chan et al., 1996; Silverstein et al., 1996; Peter, 1997; Silverstein and Plisetskaya, 2000). Some evidence explains the effects of N P Y on the G H axis. In transgenic mice without GH receptors, N P Y mRNA in the hypothalamus is only 86% that of controls (Peng et al., 2001). 16 This suggests that G H receptors are necessary for N P Y to interact with G H and maintain its expression level. In rats with pituitaries removed, somatotrophs are removed and G H cannot be produced. This causes a decrease in N P Y mRNA levels that can be alleviated through the addition of rat GH (Chan et al., 1996). In mice that over-produce human G H no changes in N P Y mRNA are seen (Peng et al., 2001), suggesting that there is a maximum physiological expression in N P Y that cannot be exceeded with increasing additions of G H to these mice (Peng et al., 2001). Injections of N P Y into the third ventricle of the rat brain caused a 3 to 4 hour drop in blood G H (Minami et al., 1997). Similarly, injections of rat G H into the A R C cause a drop in G H peak concentrations and secretion duration (Minami et al., 1997). This is hypothesized to be the result of GH-induced N P Y stimulation of SS neurons to inhibit GHRH secretion (Minami et al., 1997). This mode of action is supported by the presence of G H receptor genes in 95% of the N P Y expressing cells in the A R C of the rat (Kamegai et al., 1996), and by other independent identifications of GH receptors in N P Y neurons (Chan et al., 1996; Peng et al., 2001). Minami et al. (1998) found that 65% of cells showing G H receptor expression in the A R C were N P Y cells and 60% of cells with GH receptor expression in the PeV were SS cells. Kamegai et al. (1994) obtained the same percentages by monitoring c-fos expression as a proxy for neuronal activity , after the administration of recombinant human growth hormone to the A R C and PeV. It is likely that G H directly stimulates N P Y neurons in addition to SS secreting cells. There is considerably more research on the role of N P Y than on other feeding hormones in fish. N P Y cells are found in a variety of fish tissues, including the brain (Peng et al., 1994; Ebbesson et al., 2000; Weng and Fang, 2003; Chen et al., 2005; Sakharkar et al., 2005). It is also associated with G H cells in sea bass (Moons et al., 1989) and pejerry (Traverso et al., 2003). N P Y is associated with the pituitary in the grouper (Chen et al., 2005), sole (Rodriguez-Gomez et al., 2001), catfish (Gaikwad et al., 2004) and zebra fish (Mathieu et al., 2002) but not in one species of Antarctic fish (Mathieu et al., 2001) or in the goldfish (Peng et al., 1994). N P Y mRNA expression is found in various regions of the rainbow trout brain with the greatest expression in the telencephalon (Doyon et al., 2003). The exact role that N P Y plays in G H control is assumed to be similar to that seen in mammals but most studies on N P Y in fish concentrate on feeding behavior. Indeed, N P Y immunoreactivity has been detected in the gustatory regions of many fish species (Farrell et al., 2002; Pirone et al., 2004). Generally, N P Y causes an increase in feeding and suppresses energy expenditure (Silverstein and Plisetskaya, 2000). Fasting increases N P Y expression in mammals, chinook salmon, and gold fish (Peter, 1997). During starvation, N P Y peptide and mRNA increases in 17 salmon (Silverstein et al., 1996) and intracerebroventricular (ICV) injections of N P Y increase food intake by 45% to 100% in the catfish (Silverstein and Plisetskaya, 2000). Fasting increases brain N P Y mRNA expression in the gold fish while refeeding returns expression to a lower level (Narnaware and Peter, 2001a; Volkoff et al., 2003). How the feeding effects of N P Y are linked to GH levels and function in fish needs to be determined. G H is seen to increase immediately after feeding, yet it is thought to stimulate N P Y secretion that would then increase appetite further after feeding has occurred (Peter, 1997). It is evident that there may be unaddressed interactions, and it is possible that the overall hormonal or neuronal state of fish after feeding dampens the orexigenic effects of N P Y . Neuronal responses to gut distension may also influence the control of appetite and the effect of N P Y and other hormones. Appetite in many fish has been found to follow gastric evacuation and some teleost species eat to a specific volume (Grove et al., 1985; Singh and Srivastava, 1985; Seyhan et al., 1998; Tekinay and Davies, 2002). 1.4.2 Cholecystokinin Cholecystokinin (CCK) is released by 1) the intestinal tract in response to the presence of digesta (Koven et al., 2002) and 2) by different portions of the brain following feeding (Peyon et al., 1999) to cause satiation (Peter, 1997; Jensen et al., 2001). C C K is also important in other functions such as gallbladder discharge and trypsin and chymotrypsin secretion (Einarsson et al., 1997). C C K has not been studied in transgenic mice, but in other mice and rats C C K administration shortens feeding or prevents feeding initiation (Silver et al., 1989), and can act with leptin to decrease feeding and reduce body weight (Barrachina et al., 1997; Matson et al., 2000). Interestingly, C C K does not change due to starvation in some strains of rats (Schneider et al., 1979). C C K may also be related to the G H axis in some cases as it can inhibit G H release in particular types of rats (Karashima et al., 1984). Although mammals have one form of C C K , it is present in 3 preprohormone forms in the rainbow trout (designated C C K - N , C C K - L and CCK-T according to amino acid differences) and in three forms in the goldfish (Jensen et al., 2001), likely due to a gene duplication event in both cases (Jensen et al., 2001). C C K - N mRNA is found in the brain, upper and middle intestine and pyloric caeca of the goldfish, while C C K - L and C C K - T mRNA are found in the brain and gut (Jensen et al., 2001). At the peptide level, only C C K - N and C C K - L are present in the brain (Jensen et al., 2001). C C K immunoreactivity and mRNA expression have been found in the intestine and brain of many other teleost species including Japanese flounder (Suzuki et al., 18 1999), herring (Kamisaka et al., 2005), halibut (Kamisaka et al., 2001), pufferfish (Kurokawa et al., 2003) and bluefin tuna (Kamisaka et al., 2002). The localization of C C K neurons with the pituitary and hormonal responses to C C K suggest that it interacts with the G H axis. C C K is found in the telencephalon of the brain as well as the neurohypophysis and proximal pars distalis of the pituitary in the green molly (Batten et al., 1990). C C K neuronal terminals have been found to synapse with somatotrophs in the proximal pars distalis of the pituitary in goldfish brains (Peter, 1997), although no pituitary C C K gene expression was found by Jensen et al. (2001). Similarly, Moons et al. (1989) found that C C K neurons directly innervate somatotropic cells in the proximal pars distalis in the sea bass. Thus, C C K is likely synthesized in C C K cell bodies in the hypothalamus and transported through the cell to the pituitary for use. Hormonal changes also support an association with GH. In goldfish, after natural feeding, there is an increase in plasma G H followed by a decrease. This trend can be replicated through the addition of C C K (Peter, 1997). Furthermore, central and peripheral administration of C C K reduces preprosomatostatin-I mRNA expression in the brain (Canosa and Peter, 2004). This reduction may contribute to the increase in GH after feeding. How C C K interacts with GH and what the consequences are to the other hormones involved in G H control requires further study. The satiating effect of C C K in many fish species may be achieved through intestinal or neural production. Indeed, C C K fibres have been found in the gustatory centers of the goldfish brain (Farrell et al., 2002) and C C K mRNA expression increases two hours after feeding (Peyon et al., 1999). When C C K A receptor antagonists were added to the food of rainbow trout, food intake increased significantly compared to the untreated control (Gelineau and Boujard, 2001). Thus, C C K released from the gut likely acts on C C K A receptors to stop feeding as C C K applied through the food would enter the trout through the gut (Gelineau and Boujard, 2001). ICV injections of the sulfated C C K octapeptide in the catfish caused a decrease in food consumption after thirty minutes (Silverstein and Plisetskaya, 2000). Conversely, C C K receptor antagonists remove the satiety signal achieved through C C K injection in goldfish, although in this study no differences in brain C C K mRNA expression were seen after fasting (Volkoff et al., 2003). 1.5 Objectives and Hypotheses The first objective of this thesis research was to examine the potential regulatory changes in the G H axis that are occurring in GH transgenic coho salmon as well as how the G H axis responds to changes in dietary energy. To accomplish this, I first sought to determine how these 19 fish utilize the dietary components of their feed and how they respond to changes in dietary digestible energy while maintaining similar ratios of the energetically contributing components: protein, lipid and carbohydrate. Previous studies have shown that increased G H in vivo causes increases in growth, protein utilization and lipid mobilization. In this study it was hypothesized that G H transgenic coho salmon would have greater growth than controls as well as increased protein and decreased lipid content. Further, it was hypothesized that these fish would eat to volumetric satiation due to uncontrolled regulation of appetite through changes to the G H axis and that maximum gut distension would determine digestible nutrient and energy intake regardless of the energetic content of the feed. Alternatively, it was postulated that growth-enhanced salmon may eat to satisfy a new, higher level of energy requirement. The second objective was to determine what changes, i f any, have occurred to the hormones of the G H axis in the G H transgenic coho salmon. In this regard, the mRNA expression levels (as an indicator of protein production) of G H , IGF-I, G H R H , SS, GHR and C C K were measured in six brain regions of G H transgenic and non-transgenic coho salmon. These regions included the telencephalon, optic tectum, mid brain, cerebellum, hypothalamus and pituitary. It was postulated that the increased exogenous G H production in transgenic coho salmon would cause a decrease in endogenous G H production by the pituitary, and that brain IGF-I mRNA levels would not change due to the unresponsive nature of the Ea-4 transcript to G H (Duguay et al., 1994; Duan, 1998). Moreover, it was thought at the outset that G H R H expression may decrease and SS expression increase in the hypothalamus of transgenic coho salmon, while GHR expression may increase in the pituitary and hypothalamus to allow for the negative feedback of G H on its own production. Due to the increased appetite observed in transgenic coho salmon it was hypothesized that C C K expression would be reduced in the brain, and that this would result in a decreased satiation response. The third objective was to examine the changes to the previously described hormone and neuropeptide mRNA levels occurring between G H transgenic coho salmon on high and low energy diets. In addition plasma IGF-I concentrations were analyzed. It was hypothesized that G H production would be decreased in the brain of fish on the high energy diet due to the increased feedback by circulating IGF-I, and that C C K would be higher in transgenic fish due to an increased satiation response. Since decreases in feed and energy intake cause a decrease in G H production, it was also postulated that GHRH may increase and SS decrease in fish ingesting diets of higher energy content. 20 Hypothalamus Figure 1.1: Hormonal interactions of the G H axis. The effects that are shown have mostly been observed in mammalian studies but are expected to operate in fish. NPY: neuropeptide Y , SS: somatostatin, C C K , cholecystokinin, G H R H : growth hormone-releasing hormone, GH: growth hormone, GHR: growth hormone receptor, IGF-I: insulin-like growth factor 1. Both N P Y and C C K have roles in appetite regulation. 1.6 References Agustsson, T., Ebbesson, L.O.E., Bjomsson, B.T., 2000. Dopaminergic innervation of the rainbow trout pituitary and stimulatory effect of dopamine on growth hormone secretion in vitro. Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 127A, 355-364. Al-Regaiey, K .A . , Masternak, M . M . , Bonkowski, M . , Sun, L., Bartke, A. , 2005. Long-lived growth hormone receptor knockout mice: Interaction of reduced insulin-like growth factor I/insulin signaling and caloric restriction. Endocrinology 146, 851-860. Asa, S.L., Coschigano, K.T., Bellush, L. , Kopchick, J.J., Ezzat, S., 2000. Evidence for growth hormone (GH) autoregulation in pituitary somatotrophs in G H antagonist-transgenic mice and GH receptor-deficient mice. American Journal of Pathology 156, 1009-1015. Austreng, E., 1978. Digestibility determination in fish using chromic oxide marking and analysis of contents from different segments of the gastrointestinal tract. Aquaculture 13, 265-272. Azevedo, P.A., Leeson, S., Cho, C.Y. , Bureau, D.P., 2004. Growth, nitrogen and energy utilization of juveniles from four salmonid species: diet, species and size effects. Aquaculture 234, 393-414. Barrachina, M . , Martinez, V . , Wang, L. , Wei, J., Tache, Y . , 1997. Synergistic interaction between leptin and cholecystokinin to reduce short-term food intake in lean mice. Proceedings of the National Academy of Sciences of the United States of America 94, 10455-10460 Bartke, A. , Turyn, D., Aguilar, C.C., Sotelo, A . L , Steger, R.W., Chen, X .Z . , Kopchick, J.J., 1994. Growth hormone (GH) binding and effects of G H analogs in transgenic mice. Proceedings of the Society for Experimental Biology & Medicine 206, 190-194. Batten, T., Cambre, M . , Moons, L. , Vandesande, F., 1990. Comparative distribution of neuropeptide-immunoreactive systems in the brain of the Green Molly, Poecilia latipinna. The Journal of Comparative Neurology 302, 893-919. Beckman, B.R., Shimizu, M . , Gadberry, B.A. , Cooper, K . A . , 2004a. Response of the somatotropic axis of juvenile coho salmon to alterations in plane of nutrition with an analysis of the relationships among growth rate and circulating IGF-I and 41 kDa IGFBP. General & Comparative Endocrinology 135, 334-344. Beckman, B.R., Shimizu, M , Gadberry, B.A. , Parkins, P.J., Cooper, K . A . , 2004b. The effect of temperature change on the relations among plasma IGF-1, 41-kDa IGFBP, and growth rate in postsmolt coho salmon. Aquaculture 241, 601 -619. Behringer, R.R., Lewin, T .M. , Quaife, C.J., Palmiter, R.D., Brinster, R.L., D'Ercole, A.J . , 1990. Expression of insulin-like growth factor I stimulates normal somatic growth in growth hormone-deficient transgenic mice. Endocrinology 127, 1033-1040. Bendiksen, E.A., Berg, O.K., Jobling, ML, Arnesen, A . M . , Masoval, K. , 2003. Digestibility, growth and nutrient utilisation of Atlantic salmon parr (Salmo salar L.) in relation to temperature, feed fat content and oil source. Aquaculture 224, 283-299. Bjerkeng, B. , Berge, G .M. , 2000. Apparent digestibility coefficients and accumulation of astaxanthin E/Z isomers in Atlantic salmon (Salmo salar L.) and Atlantic halibut (Hippoglossus hippoglossus L.). Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 127B, 423-432. Bjornsson, B.T., Taranger, G.L., Hansen, T., Stefansson, S.O., Haux, C , 1994. The Interrelation between photoperiod, growth hormone, and sexual maturation of adult Atlantic salmon (Salmo salar). General & Comparative Endocrinology 93, 70-81. Blackburn, A. , Dressendoerfer, R.A., Blum, W.F., Erhard, M . , Brem, G., Strasburger, C.J., Wolf, E., 1997. Interactions of insulin-like growth factor (IGF)-II and growth hormone in vivo: Circulating levels of IGF-I and IGF-binding proteins in transgenic mice. European Journal of Endocrinology 137, 701-708. Bolliet, V . , Cheewasedtham, C , Houlihan, D., Gelineau, A. , Boujard, T., 2000. Effect of feeding time on digestibility, growth performance and protein metabolism in the rainbow trout Oncorhynchus mykiss: Interactions with dietary fat levels. Aquatic Living Resources 13, 107-113. Brett, J.R., Groves, T.D.D., 1979. Physiological Energetics. In: Hoar, W.S., Randall, D.J. (Eds.), Fish Physiology Vol . VIII. Academic Press Inc., New York, pp. 279-351. Caelers, A. , Maclean, N . , Hwang, G., Eppler, E., Reinecke, M . , 2005. Expression of endogenous and exogenous growth hormone (GH) messenger (m) R N A in a GH-transgenic tilapia (Oreochromis niloticus). Transgenic Research 14, 95-104. Cai, A. , Hyde, J., 1998. Upregulation of leptin receptor gene expression in the anterior pituitary of human growth hormone-releasing hormone transgenic mice. Endocrinology 139, 420-423. 23 Calduch-Giner, J.A., Mingarro, M . , Vega-Rubin de Celis, S., Boujard, D., Perez-Sanchez, J., 2003. Molecular cloning and characterization of gilthead sea bream (Spams aurata) growth hormone receptor (GHR). Assessment of alternative splicing. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 136B, 1-13. Calduch-Giner, J.A., Duval, H. , Chesnel, F., Boeuf, G., Perez-Sanchez, J., Boujard, D., 2000. Molecular characterisation of growth hormone receptor in turbot (Psetta maxima). Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 126A, S21. Camacho-Hubner, C , Clemmons, D.R., D'Ercole, A.J . , 1991. Regulation of insulin-like growth factor IGF binding proteins in transgenic mice and with altered expression of growth hormone and IGF-I. Endocrinology 129, 1201-1206. Cameron, C , Moccia, R.D., Leatherland, J.F., 2005. Growth hormone secretion from the Arctic charr (Salvelinus alpinus) pituitary gland in vitro: effects of somatostatin-14, insulin-like growth factor-I, and nutritional status. General & Comparative Endocrinology 141, 93-100. Canosa, L.F., Peter, R.E., 2004. Effects of cholecystokinin and bombesin on the expression of preprosomatostatin-encoding genes in goldfish forebrain. Regulatory Peptides 121, 99-105. Canosa, L.F., Unniappan, S., Peter, R.E., 2005. Periprandial changes in growth hormone release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide. American Journal of Physiology - Regulatory Integrative & Comparative Physiology 289, R125-R133. Chan, J.C.K., Mann, J., Skura, B.J., Rowshandeli, M . , Rowshandeli, N . , Higgs, D.A., 2002. Effects of feeding diets containing various dietary protein and lipid ratios on the growth performance and pigmentation of post-juvenile coho salmon Oncorhynchus kisutch reared in sea water. Aquaculture Research 33, 1137-1156. Chan, Y . , Steiner, R., Clifton, D., 1996. Regulation of hypothalamic neuropeptide-Y neurons by growth hormone in the rat. Endocrinology 137, 1319-1325. Chatakondi, N . , Lovell, R.T., Duncan, P.L., Hayat, M . , Chen, T.T., Powers, D.A., Weete, J.D., Cummins, K., Dunham, R.A., 1995a. Body composition of transgenic common carp, Cyprinus carpio, containing rainbow trout growth hormone gene. Aquaculture 138, 99-109. Chatakondi, N . , Lovell, R.T., Duncan, P.L., Hayat, M . , Chend, T.T., Powers, D.A., Weete, J.D., Cummins, K. , Dunham, R. A . , 1995b. Body composition of transgenic common carp, Cyprinus carpio, containing rainbow trout growth gene. Aquaculture 137, 189-190. Chen, N. -Y. , Chen, W.Y. , Kopchick, J.J., 1997. Liver and kidney growth hormone (GH) receptors are regulated differently in diabetic GH and G H antagonist transgenic mice. Endocrinology 138, 1988-1994. Chen, N. -Y. , Chen, W.Y. , Bellush, L. , Yang, C.-W., Striker, L.J. , Striker, G.E., Kopchick, J.J., 1995. Effects of streptozotocin treatment in growth hormone (GH) and G H antagonist transgenic mice. Endocrinology 136, 660-667. Chen, R., L i , W., Lin, H. , 2005. cDNA cloning and mRNA expression of neuropeptide Y in orange spotted grouper, Epinephelus coioides. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 142, 79-89. Chen, W.Y., White, M.E. , Wagner, T.E., Kopchick, J.J., 1991. Functional antagonism between endogenous mouse growth hormone (GH) and a G H analog results in dwarf transgenic mice. Endocrinology 129, 1402-1408. Cook, A. , Peter, R., 1984. The effects of somatostatin on serum growth hormone levels in the goldfish Carassius-auratus. General & Comparative Endocrinology 54, 109-113. Cook, J.T., McNiven, M.A. , Richardson, G.F., Sutterlin, A . M . , 2000. Growth rate, body composition and feed digestibility/conversion of growth-enhanced transgenic Atlantic salmon {Salmo salar). Aquaculture 188,15-32. de Pedro, N . , Delgado, M . , Alonso-Bedate, M . , 1995a. Central administration of p-endorphin increases food intake in goldfish: pretreatment with opioid antagonist naloxone. Regulatory Peptides 55, 189-195. de Pedro, N . , Cespedes, M . , Delgado, M . , Alonso-Bedate, M . , 1995b. The galanin-induced feeding stimulation is mediated via a2-adrenergic receptors in goldfish. Regulatory Peptides 57, 77-84. Devlin, R., 1997. Transgenic Salmonids. In: Houdebine, L . M . (Ed.), Transgenic Animals, Generation and Use. Harwood Academic Publishers, Canada, pp. 10. Devlin, R.H., Yesaki, T.Y., Donaldson, E .M. , Du, S.J., Hew, C.L., 1995. Production of germline transgenic Pacific salmonids with dramatically increased growth performance. Canadian Journal of Fisheries and Aquatic Sciences 52, 1376-1384. Devlin, R.H., Yesaki, T.Y., Biagi, C.A., Donaldson, E .M. , Swanson, P., Chan, W.-K., 1994. Extraordinary salmon growth. Nature 371, 209-210. Devlin, R.H., Johnsson, J.I., Smailus, D.E., Biagi, C.A., Jonsson, E., Bjornsson, B.T., 1999. Increased ability to compete for food by growth hormone-transgenic coho salmon Oncorhynchus kisutch (Walbaum). Aquaculture Research 30, 479-482. Devlin, R.H., Swanson, P., Clarke, W . C , Plisetskaya, E., Dickhoff, W., Moriyama, S., Yesaki, T.Y., Hew, C.L., 2000. Seawater adaptability and hormone levels in growth-enhanced transgenic coho salmon, Oncorhynchus kisutch. Aquaculture 191, 367-385. Dickhoff, W.W., Beckman, B.R., Larsen, D.A., Duan, C , Moriyama, S., 1997. The role of growth in endocrine regulation of salmon smoltification. Fish Physiology & Biochemistry 17, 231 -236. Doyon, C , Gilmour, K . M . , Trudeau, V . L . , Moon, T.W., 2003. Corticotropin-releasing factor and neuropeptide Y mRNA levels are elevated in the preoptic area of socially subordinate rainbow trout. General & Comparative Endocrinology 133, 260-271. Drakenberg, K. , Sara, V.R., Lindahl, K.I., Kewish, B., 1989. The study of insulin-like growth factors in tilapia Oreochromis-mossambicus. General & Comparative Endocrinology 74, 173-180. Duan, C , 1998. Nutritional and developmental regulation of insulin-like growth factors in fish. Journal of Nutrition 128, 306S-314S. Duan, C , Plisetskaya, E .M. , 1993. Nutritional regulation of insulin-like growth factor-I mRNA expression in salmon tissues. Journal of Endocrinology 139, 243-252. Duan, C , Duguay, S.J., Plisetskaya, E .M. , 1992. Hormonal regulation of insulin-like growth factor I (IGF-I) mRNA expression in coho salmon. American Zoologist 32, 13A. Duan, C , Plisetskaya, E .M. , Dickhoff, W.W., 1995. Expression of insulin-like growth factor I in normally and abnormally developing coho salmon (Oncorhynchus kisutch). Endocrinology 136, 446-452. Duguay, S.J., Swanson, P., Dickhoff, W.W., 1994. Differential expression and hormonal regulation of alternatively spliced IGF-I mRNA transcripts in salmon. Journal of Molecular Endocrinology 12, 25-37. Dunham, R.A., Chatakondi, N . , Nichols, A.J . , Kucuktas, H. , Chen, T.T., Powers, D.A., Weete, J.D., Cummins, K. , Lovell, R.T., 2002. Effect of rainbow trout growth hormone complementary D N A on body shape, carcass yield, and carcass composition of F l and F2 transgenic common carp (Cyprinus carpio). Marine Biotechnology 4, 604-611. Dyer, A.R., Barlow, C.G., Bransden, M.P., Carter, C.G., Glencross, B.D., Richardson, N . , Thomas, P .M. , Williams, K.C. , Carragher, J.F., 2004. Correlation of plasma IGF-I 26 concentrations and growth rate in aquacultured finfish: a tool for assessing the potential of new diets. Aquaculture 236, 583-592. Ebbesson, L.O., Ekstrom, P., Ebbesson, S.O., Hansen, T., Yoho, L .L . , Kuhar, M.J. , 2000. C A R T immunoreactivity in the salmon brain: distribution and relation to NPY. Society for Neuroscience Abstracts 26, Abstract No. Einarsson, S., Davies, P., Talbot, C , 1997. Effect of exogeneous cholecystokinin on the discharge of the gallbladder and the secretion of trypsin and chymotrypsin from the pancreas of the Atlantic salmon, Salmo salar L. Comparitive Biochemistry and Physiology C 117, 63-67. Einen, O., Thomassen, M.S., 1998. Starvation prior to slaughter in Atlantic salmon (Salmo salar). II. White muscle composition and evaluation of freshness, texture and colour characteristics in raw and cooked fillets. Aquaculture 169, 37-53. Einen, O., Waagan, B., Thomassen, M.S., 1998. Starvation prior to slaughter in Atlantic salmon (Salmo salar). I. Effects on weight loss, body shape, slaughter- and fillet-yield, proximate and fatty acid composition. Aquaculture 166, 85-104. Farmanfarmaian, A. , Sun, L.-Z., 1999. Growth hormone effects on essential amino acid absorption, muscle amino acid profile, N-retention and nutritional requirements of striped bass hybrids. Genetic Analysis: Biomolecular Engineering 15, 107-113. Farrell, W.J., Bottger, B., Ahmadi, F., Finger, T.E., 2002. Distribution of cholecystokinin, calcitonin gene-related peptide, neuropeptide Y , and galanin in the primary gustatory nuclei of the goldfish. Journal of Comparative Neurology 450,103.-114. Fauconneau, B. , Mady, M.P., LeBail, P.Y., 1996. Effect of growth hormone on muscle protein synthesis in rainbow trout (Onchorynchus mykiss) and Atlantic salmon (Salmo salar). Fish Physiology and Biochemistry 15, 49-56. Flavell, D., Wells, T., Wells, S., Carmignac, D., Thomas, G., Robinson, I., 1996. Dominant dwarfism in transgenic rats by targeting human growth hormone (GH) expression to hypothalamic GH-releasing factor neurons. The E M B O Journal 15, 3871-3879. Foda, A. , 1974. Seasonal variations in proximate composition of hatchery-reared Atlantic salmon, Technical Report Series No. MAR/T-74-2. Resource Development Branch, Fisheries and Marine Service, Department of the Environment, Halifax, Nova Scotia, pp. 12. Forster, I., Higgs, D.A., Bell, G.R., Dosanjh, B.S., March, B.E., 1988. Effect of diets containing herring oil oxidized to different degrees on growth and immunocompetence of juvenile 27 coho salmon (Oncorhynchus kisutch). Canadian Journal of Fisheries and Aquatic Sciences 45, 1988. Foucher, J.L., Le Bail, P.Y., Le Gac, F., 1992. Influence of hypophysectomy castration fasting and spermiation on SBP concentration in male rainbow trout Oncorhynchus-mykiss. General & Comparative Endocrinology 85, 101-110. Fradinger, E.A., Sherwood, N . M . , 2000. Characterization of the gene encoding both growth hormone-releasing hormone (GRF) and pituitary adenylate cyclase-activating polypeptide (PACAP) in the zebrafish. Molecular & Cellular Endocrinology 165, 211-219. Fu, C , Cui, Y . , Hung, S.S.O., Zhu, Z., 1998. Growth and feed utilization by F4 human growth hormone transgenic carp fed diets with different protein levels. Journal of Fish Biology 53, 115-129. Fu, C , Cui, Y . , Hung, S.S.O., Zhu, Z., 2000. Whole-body amino acid pattern of F 4 human growth hormone gene-transgenic red common carp (Cyprinus carpio) fed diets with different protein levels. Aquaculture 189, 287-292. Fukada, H. , Ozaki, Y . , Pierce, A . L . , Adachi, S., Yamauchi, K. , Hara, A. , Swanson, P., Dickhoff, W.W., 2004. Salmon growth hormone receptor: molecular cloning, ligand specificity, and response to fasting. General & Comparative Endocrinology 139, 61-71. Gabillard, J . -C, Weil, C , Rescan, P.-Y., Navarro, I., Gutierrez, J., Le Bail, P.-Y., 2003. Effects of environmental temperature on IGF1, IGF2, and IGF type I receptor expression in rainbow trout {Oncorhynchus mykiss). General & Comparative Endocrinology 133, 233-242. Gaikwad, A. , Biju, K .C . , Saha, S.G., Subhedar, N . , 2004. Neuropeptide Y in the olfactory system, forebrain and pituitary of the teleost, Clarias batrachus. Journal of Chemical Neuroanatomy 27, 55-70. Gelineau, A. , Boujard, T., 2001. Oral administration of cholecystokinin receptor antagonists increase feed intake in rainbow trout. Journal of Fish Biology 58, 716-724. Gomez-Requeni, P., Mingarro, M . , Calduch-Giner, J.A., Medale, F., Martin, S.A.M., Houlihan, D.F., Kaushik, S., Perez-Sanchez, J., 2004. Protein growth performance, amino acid utilisation and somatotropic axis responsiveness to fish meal replacement by plant protein sources in gilthead sea bream (Sparus aurata). Aquaculture 232, 493-510. 28 Gonzalez, L., Sotelo, A . L , Bartke, A. , Turyn, D., 2001. Growth hormone (GH) and estradiol regulation of membrane-associated G H binding protein and G H receptors in G H releasing hormone transgenic mice. Growth Hormone & Igf Research 11, 34-40. Grisdale-Helland, B:, Helland, S.J., 1997. Replacement of protein by fat and carbohydrate in diets for Atlantic salmon (Salmo salar) at the end of the freshwater stage. Aquaculture 152, 167-180. Grove, D.J., Moctezuma, M.A. , Flett, H.R.J., Foott, J.S., Watson, T., Flowerdew, M.W., 1985. Gastric emptying and the return of appetite in juvenile turbot Scophthalmus-maximus fed on artificial diets. Journal of Fish Biology 26, 339-354. Halford, J., Blundell, J., 2000. Separate systems for serotonin and leptin appetite control. Annals of Medicine 32, 222-232. Hemre, G.-L, Sandnes, K. , Lie, O., Torrissen, O., Waagboe, R., 1995. Carbohydrate nutrition in Atlantic salmon, Salmo salar L.: Growth and feed utilization. Aquaculture Research 26, 149-154. Hemre, G.-L, Bjornevik, M . , Beattie, C , Bjornson, B.T., Hansen, T., 2002. Growth and salt-water tolerance of juvenile Atlantic salmon, Salmo salar, reared under different combinations of dietary carbohydrate and photoperiod regime. Aquaculture Nutrition 8, 23-32. Hendry, A.P., Dittman, A . H . , Hardy, R.W., 2000. Proximate composition, reproductive development, and a test for trade-offs in captive sockeye salmon. Transactions of the American Fisheries Society 129, 1082-1095. Hernandez Llorente, M.D. , Dato Gomez, M.J. , Costa Ruiz, J.d., Mendiola Lopez, P., Zamora Navarro, S., 2004. Effect of recombinant human G H and G H R H on plasma metabolite levels in rainbow trout (Oncorhynchus mykiss). Journal of Physiology & Biochemistry 60,211-218. Higgs, D.A., Dong, F .M. , 2000. Lipids and Fatty Acids. In: Stickney, R.R. (Ed.), Encyclopedia . of Aquaculture. John Wiley & Sons Inc., Toronto, pp. 20. Higgs, D.A., Donaldson, E .M. , Dye, H .M. , McBride, J.R., 1975. A preliminary investigation of the effect of bovine growth hormone on growth and muscle composition of coho salmon (Oncorynchus kisutch). General and Comparative Endocrinology 27, 240-253. Higgs, D.A., Donaldson, E .M. , Dye, H . M . , McBride, J.R., 1976. Influence of bovine growth hormone and L-thyroxine on growth, muscle composition and histological structure of 29 the gonads, thyroid, pancreas and pituitary of coho salmon {Oncorhynchus kisutch). Journal of the Fisheries Research Board of Canada 33, 1585-1603. Higgs, D.A., MacDonald, J.S., Levings, C D . , Dosanjh, B.S., 1995. Nutrition and Feeding Habits in Relation to Life History Stage. In: Groot, C , Margolis, L. , Clarke, W.C. (Eds.), Physiological Ecology of Pacific Salmon. U B C Press, Vancouver, pp. 161-315. Hi l l , J.A., Kiessling, A. , Devlin, R.H., 2000. Coho salmon (Oncorhynchus kisutch) transgenic for a growth hormone gene construct exhibit increased rates of muscle hyperplasia and detectable levels of differential gene expression. Canadian Journal of Fisheries and Aquatic Sciences 57, 939-950. Hillestad, M . , Johnsen, F., 1994. High-energy/low-protein diets for Atlantic salmon: Effects on growth, nutrient retention and slaughter quality. Aquaculture 124, 109-116. Hillestad, M . , Johnsen, F., Asgard, T., 2001. Protein to carbohydrate ratio in high-energy diets for Atlantic salmon (Salmo salar L.). Aquaculture Research 32, 517-529. Himick, B., Peter, R., 1994. Bombesin acts to suppress feeding behavior and alter serum growth hormone in goldfish. Physiology and Behavior 55, 65-72. Hinits, Y . , Moav, B., 1999. Growth performance studies in transgenic Cyprinus carpio. Aquaculture 173, 285-296. Holloway, A. , Reddy, P., Sheridan, ML, Leatherland, J., 1994. Diurnal rhythms of plasma growth hormone, somatostatin, thyroid hormones, Cortisol and glucose concentrations in rainbow trout, Oncorhynchus mykiss, during progressive food deprivation. Biological Rhythm Research 25, 415-432. Holloway, A.C. , Sheridan, M.A. , Van Der Kraak, G., Leatherland, J.F., 1999. Correlations of plasma growth hormone with somatostatin, gonadal steroid hormones and thyroid hormones in rainbow trout during sexual recrudescence. Comparative Biochemistry & Physiology - B: Comparative Biochemistry 123, 251-260. Hua, Y . - M . , Lin, H.-R., 2001. Effects of different nutritional status on expression of IGF-I mRNA in immature Common carp liver. Acta Zoologica Sinica 47, 94-100. Hurley, D., Phelps, C , 1992. Hypothalamic preprosomatostatin messenger ribonucleic acid expression in mice transgenic for excess or deficient endogenous growth hormone. Endocrinology 130, 1809-1815. Hurley, D., Phelps, C , 1993. Altered growth hormone-releasing hormone mRNA expression in transgenic mice with excess or deficient endogenous growth hormone. Cellular Neurosciences 4, 237-244. 30 Hurley, D., Bartke, A. , Wagner, T., Wee, B., 1994. Increased hypothalamic somatostatin expression in mice transgenic for bovine or human GH. Journal of Neuroendocrinology 6, 539-548. Iida, K. , del Rincon, J.P., Kim, D.-S., Itoh, E., Nass, R., Coschigano, K.T., Kopchick, J.J., Thorner, M.O., 2004. Tissue-specific regulation of growth hormone (GH) receptor and insulin-like growth factor-I gene expression in the pituitary and liver of GH-deficient (lit/lit) mice and transgenic mice that overexpress bovine GH (bGH) or a bGH antagonist. Endocrinology 145, 1564-1570. Jensen, H. , Rourke, I., Moller, M . , Jonson, L., Johnsen, A. , 2001. Identification and distribution of CCK-related peptides and mRNAs in the rainbow trout, Onchorynchus mykiss. Biochimica et Biophysica Acta 1517, 190-201. Jhingan, E., Devlin, R.H., Iwama, G.K., 2003. Disease resistance, stress response and effects of triploidy in growth hormone transgenic coho salmon. Journal of Fish Biology 63, 806-823. Jiang, Y . , L i , W.-S., Xie, J., Lin, H.-r., 2003. Sequence and expression of a cDNA encoding both pituitary adenylate cyclase activating polypeptide and growth hormone-releasing hormone in grouper (Epinephelus coioides). Acta Biochimica et Biophysica Sinica 35, 864-872. Jobling, M . , Johansen, S.J.S., 1999. The lipostat, hyperphagia and catch-up growth. Aquaculture Research 30, 473-478. Jobling, M . , Koskela, J., Savolainen, R., 1998. Influence of dietary fat level and increased adiposity on growth and fat deposition in rainbow trout, Oncorhynchus mykiss (Walbaum). Aquaculture Research 29, 601-607. Johansen, S.J.S., Ekli, M . , Jobling, M . , 2002. Is there lipostatic regulation of feed intake in Atlantic salmon Salmo salar L.? Aquaculture Research 33, 515-524. Johansen, S.J.S., Ekli, M . , Stangnes, B., Jobling, M . , 2001. Weight gain and lipid deposition in Atlantic salmon, Salmo salar, during compensatory growth: Evidence for lipostatic regulation? Aquaculture Research 32, 963-974. Johnstone, R., Simpson, T., Youngson, A. , 1978. Sex reversal in salmonid culture. Aquaculture 13,115-134. Jonsson, E., Johnsson, J.I., Bjornsson, B.T., 1996. Growth hormone increases predation exposure of rainbow trout. Proceedings of the Royal Society of London - Series B: Biological Sciences 263, 647-651. Kagabu, Y . , Mishiba, T., Okino, T., Yanagisawa, T., 1998. Effects of thyrotropin-releasing hormone and its metabolites, cyclo(His-Pro) and TRH-OH, on growth hormone and prolactin synthesis in primary cultured pituitary cells of the common carp, Cyprinus carpio. General & Comparative Endocrinology 111, 395-403. Kamegai, J., Minami, S., Sugihara, H. , Hasegawa, O., Higuchi, H. , Wakabayashi, I., 1994. Growth hormone induces expression of the c-fos gene on hypothalamic neuropeptide-Y and somatostatin neurons in hypophysectomized rats. Endocrinology 135, 2765-2771. Kamegai, J., Minami, S., Sugihara, H. , Hasegawa, O., Higuchi, H. , Wakabayashi, I., 1996. Growth hormone receptor gene is expressed in neuropeptide Y neurons in hypothalamic arcuate nucleus of rates. Endocrinology 137, 2109-2112. Kamisaka, Y . , Totland, G.K., Tagawa, M . , Kurokawa, T., Suzuki, T., Tanaka, M . , Ronnestad, I., 2001. Ontogeny of cholecystokiniri-immunoreactive cells in the digestive tract of Atlantic halibut, Hippoglossus hippoglossus, larvae. General & Comparative Endocrinology 123, 31-37. Kamisaka, Y . , Drivenes, O., Kurokawa, T., Tagawa, M . , Ronnestad, I., Tanaka, M . , Helvik, J.V., 2005. Cholecystokinin mRNA in Atlantic herring, Clupea harengus - molecular cloning, characterization, and distribution in the digestive tract during the early life stages. Peptides 26, 385-393. Kamisaka, Y . , Kaji, T., Masuma, S., Tezuka, N . , Kurokawa, T., Suzuki, T., Totland, G.K., Ronnestad, I., Tagawa, M . , Tanaka, M . , 2002. Ontogeny of cholecystokinin-immunoreactive cells in the digestive tract of bluefin tuna, Thunnus thynnus, larvae. Sarsia 87, 258-262. Kapuscinski, A . , Hallerman, E., 1991. Implications of introduction of transgenic fish into natural ecosystems. Canadian Journal of Fisheries and Aquatic Sciences 48. Karashima, T., Okajima, T., Kato, K. , Ibayashi, H. , 1984. Suppressive effects of cholecystokinin and bombesin on growth hormone and prolactin secretion in urethane-anesthetized rats Endocrinologia Japonica 31, 539-548. Kelly, A . M . , Kohler, C.C., Grau, E.G., 1996. A mammalian growth hormone-releasing hormone increases serum growth hormone levels and somatic growth at suboptimal temperatures in tilapia. Journal of the World Aquaculture Society 27, 384-401. Kovacs, M . , Kineman, R.D., Schally, A . V . , Zarandi, M . , Groot, K. , Frohman, L .A. , 1997. Effects of antagonists of growth hormone-releasing hormone (GHRH) on G H and 32 insulin-like growth factor I levels in transgenic mice overexpressing the human G H R H gene, an animal model of acromegaly. Endocrinology 138, 4536-4542. Koven, W., Rojas-Garcia, C., Finn, R., Tandler, A . , Ronnestad, I., 2002. Stimulatory effect of ingested protein and/or free amino acids on the secretion of the gastro-endocrine hormone cholecystokinin and on tryptic activity, in early-feeding herring larvae, Clupea harengus. Marine Biology 140, 1241-1247. Krasnov, A. , Pitkanen, T.I., Molsa, H. , 1999a. Gene transfer for targeted modification of salmonid fish metabolism. Genetic Analysis: Biomolecular Engineering 15, 115-119. Krasnov, A. , Agren, J.J., Pitkanen, T.I., Molsa, H. , 1999b. Transfer of growth hormone (GH) transgenes into Arctic charr (Salvelinus alpinus L.): II. Nutrient partitioning in rapidly growing fish. Genetic Analysis: Biomolecular Engineering 15, 99-105. Krogdahl, A . , Sundby, A. , Oll i , J.J., 2004. Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) digest and metabolize nutrients differently. Effects of water salinity and dietary starch level. Aquaculture 229, 335-360. Krogdahl, A . , Hemre, G.I., Mommsen, T.P., 2005. Carbohydrates in fish nutrition: digestion and absorption in postlarval stages. Aquaculture Nutrition 11, 103-122. Kurokawa, T., Suzuki, T., Hashimoto, H. , 2003. Identification of gastrin and multiple cholecystokinin genes in teleost. Peptides 24, 227-235. Kwong, P., Chang, J., 1997. Somatostatin inhibition of growth hormone release in goldfish: Possible targets of intracellular mechanisms of action. General & Comparative Endocrinology 108, 446-456. Larhammer, D., 1996. Evolution of neuropeptide Y , peptide Y Y and pancreatic polypeptide. Regulatory Peptides 62, 1-11. Lee, C.G., Devlin, R.H., Farrell, A.P. , 2003. Swimming performance, oxygen consumption and excess post-exercise oxygen consumption in adult transgenic and ocean-ranched coho salmon. Journal of Fish Biology 62, 753-766. Lee, L.T.O., Nong, G., Chan, Y . H . , Tse, D.L .Y. , Cheng, C.H.K., 2001. Molecular cloning of a teleost growth hormone receptor and its functional interaction with human growth hormone. Gene 270, 121-129. Lee, S.M., Kim, K.D. , 2001. Effects of dietary protein and energy levels on the growth, protein utilization and body composition of juvenile masu salmon (Oncorhynchus masou Brevoort). Aquaculture Research 32, 39-45. Leggatt, R.A., Devlin, R.H. , Farrell, A.P., Randall, D.J., 2003. Oxygen uptake of growth hormone transgenic coho salmon during starvation and feeding. Journal of Fish Biology 62, 1053-1066. Lescroart, O., Roelants, I., Mikolajczyk, T., Bosma, P.T., Schulz, R.W., Kuhn, E.R., Ollevier, F., 1996. A radioimmunoassay for African catfish growth hormone: Validation and effects of substances modulating the release of growth hormone. General & Comparative Endocrinology 104, 147-155. Liao, Z.-y., Zhu, S.-Q., 2004. Identification and characterization of G H receptor and serum G H -binding protein in Chinese sturgeon (Acipenser sinensis). Acta Biochimica et Biophysica Sinica 36, 811-816. Lin, X.-W., Lin, H.-R., Peter, R.E., 1993. Growth hormone and gonadotropin secretion in the common carp (Cyprinus carpio L.): In vitro interactions of gonadotropin-releasing hormone, somatostatin, and the dopamine agonist apomorphine. General & Comparative Endocrinology 89, 62-71. Lin, X . , Otto, C.J., Peter, R.E., 1999. Expression of three distinct somatostatin messenger ribonucleic acids (mRNAs) in goldfish brain: Characterization of the complementary deoxyribonucleic acids, distribution and seasonal variation of the mRNAs, and action of a somatostatin-14 variant. Endocrinology 140, 2089-2099. Luo, D., McKeown, B.A. , 1991. Interaction of carp growth hormone-releasing factor and somatostatin on in-vitro release of growth hormone in rainbow trout Oncorhynchus-mykiss. Neuroendocrinology 54, 359-364. Luo, D., Mckeown, B., Rivier, J., Vale, W., 1990. In-vitro responses of rainbow trout, Oncorhynchus-mykiss, somatotrophs to carp growth hormone-releasing factor (GRF) and somatostatin. General & Comparative Endocrinology 80, 288-298. Maniar, S., Martini, J.F., Villares, S., Delehaye-Zervas, M.C. , Kleinknecht, C , Postel-Vinay, M.C. , 1994. Hepatic growth hormone receptor (GHR) expression in experimental uremia: Role of anorexia. Journal of the American Society of Nephrology 5, 723. Marchant, T., Dulka, G., Peter, R., 1989. Relationship between serum growth hormone levels and the brain and pituitary content of immunoreactive somatostatin in the goldfish Carassius-auratus L. General & Comparative Endocrinology 73, 458-468. Markert, J.R., Higgs, D.A., Dye, H . M . , MacQuarrie, D.W., 1977. Influence of bovine growth hormone on growth rate, appetite, and food conversion of yearling coho salmon 34 (Onchorynchus kisutch) fed two diets of different composition. Canadian Journal of Zoology 55, 74-83. Martinez, R., Juncal, J., Zaldivar, C , Arenal, A. , Guillen, I., Morera, V. , Carrillo, O., Estrada, M . , Morales, A. , Estrada, M.P., 2000. Growth efficiency in transgenic tilapia (Oreochromis sp.) carrying a single copy of an homologous cDNA growth hormone. Biochemical & Biophysical Research Communications 267, 466-472. Mathews, L.S., Hammer, R.E., Brinster, R.L., Palmiter, R.D., 1988a. Expression of insulin-like growth factor I in transgenic mice with elevated levels of growth hormone is correlated with growth. Endocrinology 123, 433-437. Mathews, L.S., Hammer, R.E., Behringer, R.R., D'Ercole, A.J . , Bell, G.I., Brinster, R.L. , Palmiter, R.D., 1988b. Growth enhancement of transgenic mice expressing human insulin-like growth factor. Endocrinology 123, 2827-2833. Mathieu, M . , Tagliafierro, G., Bruzzone, F., Vallarino, M . , 2002. Neuropeptide tyrosine-like immunoreactive system in the brain, olfactory organ and retina of the zebrafish, Danio rerio, during development. Brain Research. Developmental Brain Research 139,255-265. Mathieu, M . , Testino, M . , Candiani, S., Vallarino, M . , Pestarino, M . , 2001. Organization of neuropeptide tyrosine-like immunoreactive system in the brain of the Antarctic fish, Trematomus bernacchii. Polar Biology 24, 818-827. Matson, C , Reid, D., Cannon, T., Ritter, R., 2000. Cholecystokinin and leptin act synergistically to reduce body weight. American Journal of Physiology 278, R882-R890. Matthews, S.J., Kinhult, A . K . K . , Hoeben, P., Sara, V.R., Anderson, T.A., 1997. Nutritional regulation of insulin-like growth factor-I mRNA expression in barramundi, Lates calcarifer. Journal of Molecular Endocrinology 18, 273-276. Mayer, I., McLean, E., Kieffer, T., Souza, L., Donaldson, E., 1994. Antisomatostatin-induced growth acceleration in chinook salmon (Oncorhynchus tshawytscha). Fish Physiology & Biochemistry 13, 295-300. McRory, J.E., Parker, D.B., Ngamvongchon, S., Sherwood, N . M . , 1995. Sequence and expression of cDNA for pituitary adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing hormone (GHRH)-like peptide in catfish. Molecular & Cellular Endocrinology 108, 169-177. Melamed, P., Gur, G., Elizur, A. , Rosenfeld, H. , Sivan, B. , Rentier-Delrue, F., Yaron, A. , 1996. Differential effects of gonadotropin-releasing hormone, dopamine and somatostatin and 35 their second messengers on the mRNA levels of gonadotropin II-beta subunit and growth hormone in the teleost fish, tilapia. Neuroendocrinology 64, 320-328. Melamed, P., Eliahu, N . , Levavi-Sivan, B., Ofir, M . , Farchi-Pisanty, O., Rentier-Delrue, F., Smal, J., Yaron, Z., Naor, Z., 1995. Hypothalamic and thyroidal regulation of growth hormone in tilapia. General & Comparative Endocrinology 97, 13-30. Meton, I., Caseras, A. , Canto, E., Fernandez, F., Baanante, I.V., 2000. Liver insulin-like growth factor-I mRNA is not affected by diet composition or ration size but shows diurnal variations in regularly-fed gilthead sea bream (Sparus aurata). Journal of Nutrition 130, 757-760. Millikin, M.R., 1982. Qualitative and quantitative nutrient requirements of fishes: A review. Fisheries Bulletin 80, 655-686. Minami, S., Kamegai, J., Sughihara, H. , Suzuki, N . , Wakabayashi, I., 1998. Growth hormone inhibits its own secretion by acting on the hypothalamus through its receptors on neuropeptide Y neurons in the arcuate nucleus and somatostatin neurons in the periventricular nucleus. Endocrine Journal (Suppl), SI9-S26. Minami, S., Suzuki, N . , Sugihara, H. , Tamura, H. , Emoto, E., Wakabayashi, I., 1997. Microinjection of rat G H but not human IGK-1 into a defined area of the hypothalamus inhibits endogenous G H secretion in rats. Journal of Endocrinology 153, 283-290. Miranda, L .A. , Strobl-Mazzulla, P H . , Somoza, G.M. , 2002. Ontogenetic development and neuroanatomical localization of growth hormone-releasing hormone (GHRH) in the brain and pituitary gland of pejerrey fish Odontesthes bonariensis. International Journal of Developmental Neuroscience 20, 503-510. Montero, M . , Yon, L. , Rousseau, K. , Arimura, A . , Fournier, A . , Dufour, S., Vaudry, H. , 1998. Distribution, characterization, and growth hormone-releasing activity of pituitary adenylate cyclase-activating polypeptide in the European eel, Anguilla anguilla. Endocrinology 139, 4300-4310. Moons, L., Cambre, M . , Ollevier, F., Vandesande, F., 1989. Immunocytochemical demonstration of close relationships between neuropeptide nerve fibers and hormone-producing cell types in the adenohypophysis of the sea bass (Dicentrarchus labrax). General and Comparative Endocrinology 73, 270-283. Moore, C.A., Kittilson, J.D., Dahl, S.K., Sheridan, M.A. , 1995. Isolation and characterization of a cDNA encoding for preprosomatostatin containing (Tyr-7, Gly-10)-somatostatin-14 36 from the endocrine pancreas of rainbow trout, Oncorhynchus mykiss. General & Comparative Endocrinology 98, 253-261. Mori, T., Devlin, R.H., 1999. Transgene and host growth hormone gene expression in pituitary and nonpituitary tissues of normal and growth hormone transgenic salmon. Molecular & Cellular Endocrinology 149, 129-139. Morris, P.C., Beattie, C , Elder, B., Finlay, J., Gallimore, P., Jewison, W., Lee, D., MacKenzie, K. , McKinney, R., Sinnott, R., Smart, A. , Weir, M . , 2003. Effects of the timing of the introduction of feeds containing different protein and lipid levels on the performance and quality of Atlantic salmon, Salmo salar, over the entire seawater phase of growth. Aquaculture 225, 41-65. Myers, K.W., Davis, N.D. , Dickhoff, W.W., Urawa, S., 1998. Blood plasma levels of insulin-like growth factor-I in Pacific salmon in offshore waters in winter. North Pacific Anadromous Fish Commission Bulletin.(l), 129-137. Nakao, N . , Higashimoto, Y . , Ohkubo, T., Yoshizato, FL, Nakai, N . , Nakashima, K. , Tanaka, M . , 2004. Characterization of structure and expression of the growth hormone receptor gene of the Japanese flounder (Paralichtys olivaceus). Journal of Endocrinology 182, 157-164. Nam, T.-J., Park, K . - Y . , Lee, Y. -D. , Kim, Y . - U . , 1996. Serum levels of insulin-like growth factor-I in flounder, Parlichthys olivaceus. Bulletin of the Korean Fisheries Society 29, 150-156. Nam, Y . K . , Noh, J.K., Cho, Y.S. , Cho, H.J., Cho, K . - N . , Kim, C.G., Kim, D.S., 2001. Dramatically accelerated growth and extraordinary gigantism of transgenic mud loach Misgurnus mizolepis. Transgenic Research 10, 353-362. Nankervis, L., Matthews, S.J., Appleford, P., 2000. Effect of dietary non-protein energy source on growth, nutrient retention and circulating insulin-like growth factor I and triiodothyronine levels in juvenile barramundi, Lates calcarifer, Aquaculture 191, 323-335. Narnaware, Y . K . , Peter, R.E., 2001. Effects of food deprivation and refeeding on neuropeptide Y (NPY) mRNA levels in goldfish. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 129B, 633-637. Nettleton, J.A., Exler, J., 1992. Nutrients in wild and farmed fish and shellfish. Journal of Food Science 57, 257-260. 37 Nordgarden, U . , Ornsrud, R., Hansen, T., Hemre, G.I., 2003. Seasonal changes in selected muscle quality parameters in Atlantic salmon (Salmo salar L.) reared under natural and continuous light. Aquaculture Nutrition 9, 161-168. NRC, 1993. Nutrient Requirements of Fish. National Academy Press, Washington, D.C., 114 pp. Olivereau, M . , Ollevier, F., Vandesande, F., Olivereau, J., 1984. Somatostatin in the brain and the pituitary of some teleosts immunocytochemical identification and the effect of starvation. Cell & Tissue Research 238, 289-296. Ostenfeld, T.H., McLean, E., Devlin, R.H., 1998. Transgenesis changes body and head shape in Pacific salmon. Journal of Fish Biology 52, 850-854. Parhar, I.S., Iwata, M . , 1996. Intracerebral expression of gonadotropin-releasing hormone and growth hormone-releasing hormone is delayed until smoltification in the salmon. Neuroscience Research 26, 299-308. Parker, D.B., Coe, I.R., Dixon, G.H., Sherwood, N . M . , 1993. Two salmon neuropeptides encoded by one brain cDNA are structurally related to members of the glucagon superfamily. European Journal of Biochemistry 215,439-448. Parker, D.B., Power, M.E. , Swanson, P., Rivier, J., Sherwood, N . M . , 1997. Exon skipping in the gene encoding pituitary adenylate cyclase-activating polypeptide in salmon alters the expression of two hormones that stimulate growth hormone release. Endocrinology 138, 414-423. Pellegrini, E., Carmignac, D., Bluet-Pajot, M . , Mounier, F., Bennet, P., Epelbaum, J., Robinson, I., 1997. Intrahypothalamic growth hormone feedback: From dwarfism to acromegaly in the rat. Endocrinology 138,4543-4551. Peng, C , Gallin, W., Peter, R., Blomqvist, A . , Larhammer, D., 1984. Neuropeptide-Y gene expression in the goldfish brain: distribution and regulation by ovarian steroids. Endocrinology 134,1095-1103. Peng, C , Gallin, W., Peter, R., Blomqvist, A. , Larhammer, D., 1994. Neuropeptide-Y gene expression in the goldfish brain: distribution and regulation by ovarian steroids. Endocrinology 134, 1095-1103. Peng, X. -D. , Park, S., Gadelha, M.R., Coschigano, K.T., Kopchick, J.J., Frohman, L .A. , Kineman, R.D., 2001. The growth hormone (GH)-axis of G H receptor/binding protein gene-disrupted and metallothionein-human GH-releasing hormone transgenic mice: 38 Hypothalamic neuropeptide and pituitary receptor expression in the absence and presence of GH feedback. Endocrinology 142,1117-1123. Peter, R., 1997. Voluntary food intake in fish, Neuroendocrine regulation of appetite in fish, pp. 33. Peterson, B.C., Simpson, P.R., Cain, K.D. , Hardy, R.H., Schelling, G.T., Ott, T.L., 2003. Effects of administration of somatostatin-14 and immunoneutralization of somatostatin on endocrine and growth responses in rainbow trout. Journal of Fish Biology 63, 506-522. Peyon, P., Saied, H. , Lin, X . , Peter, R.E., 1999. Postprandial, seasonal and sexual variations in cholecystokinin gene expression in goldfish brain. Molecular Brain Research 74, 190-196. Pierce, A . L . , Fukada, H. , Dickhoff, W.W., 2005a. Metabolic hormones modulate the effect of growth hormone (GH) on insulin-like growth factor-I (IGF-I) mRNA level in primary culture of salmon hepatocytes. Journal of Endocrinology 184, 341-349. Pierce, A . L . , Shearer, K.D. , Baker, D .M. , Dickhoff, W.W., 2002. An autumn profile of growth regulatory hormones in chinook salmon {Oncorhynchus tshawytscha). Fish Physiology & Biochemistry 25, 81-86. Pierce, A . L . , Beckman, B.R., Shearer, K.D. , Larsen, D.A., Dickhoff, W.W., 2001. Effects of ration on somatotropic hormones and growth in coho salmon. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 128B, 255-264. Pierce, A . L . , Shimizu, M . , Beckman, B.R., Baker, D .M. , Dickhoff, W.W., 2005b. Time course of the GH/IGF axis response to fasting and increased ration in chinook salmon (Oncorhynchus tshawytscha). General & Comparative Endocrinology 140, 192-202. Pierce, A . L . , Dickey, J.T., Larsen, D.A., Fukada, H. , Swanson, P., Dickhoff, W.W., 2004. A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of G H regulation of IGF-I gene expression in primary culture of salmon hepatocytes. General & Comparative Endocrinology 135, 401-411. Pirone, A. , Lenzi, C , Betti, L., Giannaccini, G., Lucacchini, A . , Marroni, P., Fabiani, O., 2004. Immunohistochemical distribution of neuropeptide Y in the mesencephalon and rhombencephalon of carp, Cyprinus carpio L. (Cyprinidae: Teleostei). Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 138, 175-185. Pitkanen, T.I., Krasnov, A. , Teerijoki, H. , Molsa, H. , 1999. Transfer of growth hormone (GH) transgenes into Arctic charr (Salvelinus alpinus L.): I. Growth response to various GH constructs. Genetic Analysis: Biomolecular Engineering 15, 91-98. 39 Power, D .M. , Canario, A . V . M . , Ingleton, P .M. , 1996. Somatotropin release-inhibiting factor and galanin innervation in the hypothalamus and pituitary of seabream (Sparus aurata). General & Comparative Endocrinology 101, 264-274. Prunet, P., Boeuf, B. , Bolton, J., Young, G., 1989. Smoltification and seawater adaptation in Atlantic salmon (Salmo salar): prolactin, growth hormone, and thyroid hormones. General & Comparative Endocrinology 74, 355-364. Rahman, M.A . , Maclean, N . , 1999. Growth performance of transgenic tilapia containing an exogenous piscine growth hormone gene. Aquaculture 173, 333-346. Rahman, M.A . , Ronyai, A. , Engidaw, B.Z., Jauncey, K. , Hwang, G.L., Smith, A. , Roderick, E., Penman, D., Varadi, L. , Maclean, N . , 2001. Growth and nutritional trials on transgenic Nile tilapia containing an exogenous fish growth hormone gene. Journal of Fish Biology 59, 62-78. Ran, X.-Q. , L i , W.-S., Lin, H.-r., 2004. Regulation of the expression of growth hormone mRNA and the release of growth hormone by somatostatin and cysteamine in orange-spotted groupers Epinephelus coioides. Acta Zoologica Sinica 50, 222-230. Reinitz, G., 1983. Relative effect of age, diet and feeding rate on the body composition of young rainbow trout (Salmo gairdneri). Aquaculture 35, 19-27. Requeni, P.G., Calduch-Giner, J., Vega-Rubin de Celis, S., Medale, F., J. Kaushik, S., Perez-Sanchez, J., 2005. Regulation of the somatotropic axis by dietary factors in rainbow trout (Oncorhynchus mykiss). British Journal of Nutrition 94, 353-361. Rodriguez-Gomez, F.J., Rendon-Unceta, C , Sarasquete, C , Munoz-Cueto, J.A., 2001. Distribution of neuropeptide Y-like immunoreactivity in the brain of the Senegalese sole (Solea senegalensis). Anatomical Record 262, 227-237. Rousseau, K. , Huang, Y.-S. , Le Belle, N . , Vidal, B., Marchelidon, J., Epelbaum, J., Dufour, S., 1998. Long-term inhibitory effects of somatostatin and insulin-like growth factor 1 on growth hormone release by serum-free primary culture of pituitary cells from European eel (Anguilla anguilla). Neuroendocrinology 67, 301-309. Rousseau, K. , Le Belle, N . , Pichavant, K. , Marchelidon, J., Chow, B.K.C. , Boeuf, G., Dufour, S., .2001. Pituitary growth hormone secretion in the turbot, a phylogenetically recent teleost, is regulated by a species-specific pattern of neuropeptides. Neuroendocrinology 74, 375-385. Saera-Vila, A . , Calduch-Giner, J.-A., Perez-Sanchez, J., 2005. Duplication of growth hormone receptor (GHR) in fish genome: gene organization and transcriptional regulation of GHR 40 type I and II in gilthead sea bream (Sparus auratd). General & Comparative Endocrinology 142 193-203. Sakharkar, A.J . , Singru, P.S., Sarkar, K. , Subhedar, N.K. , 2005. Neuropeptide Y in the forebrain of the adult male cichlid fish Oreochromis mossambicus: Distribution, effects of castration and testosterone replacement. Journal of Comparative Neurology 489, 148-165. Sato, M . , Frohman, L .A. , 1993. Differential effects of central and peripheral administration of growth hormone (GH) and insulin-like growth factor on hypothalamic GH-releasing hormone and somatostatin gene expression in GH-deficient dwarf rats. Endocrinology 133,793-799. Schneider, B. , Monahan, J., Hirsch, J., 1979. Brain cholecystokinin and nutritional status in rats and mice. Journal of Clinical Investigation 64, 1348-1356 Seyhan, K. , Cove, D.J., King, J., 1998. Feeding behaviour of whiting, Merlangius merlangus, L. in captivity. Fisheries Research 34, 39-45. Shearer, K.D. , 1994. Factors affecting the proximate composition of cultured fishes with emphasis on salmonids. Aquaculture 119, 63-88. Shearer, K.D. , Asgard, T., Andorsdottir, G., Aas, G.H., 1994. Whole body elemental and proximate composition of Atlantic salmon (Salmo salar) during the life cycle. Journal of Fish Biology 44, 785-797. Shepherd, B.S., Eckert, S.M., Parhar, I.S., Vijayan, M . M . , Wakabayashi, I., Hirano, T., Grau, E.G., Chen, T.T., 2000. The hexapeptide KP-102 (D-Ala-D-B-Nal-Ala-Trp-D-Phe-Lys-NH2) stimulates growth hormone release in a cichlid fish (Oreochromis mossambicus). Journal of Endocrinology 167, R7-R10. Shimizu, M . , Swanson, P., Dickhoff, W.W., 1999. Free and protein-bound insulin-like growth -factor-I (IGF-I) and IGF-binding proteins in plasma of coho salmon, Oncorhynchus kisutch. General & Comparative Endocrinology 115, 398-405. Silver, A . , Flood, J., Song, A. , Morley, J., 1989. Evidence for a physiological role for C C K in the regulation of food intake in mice. American Journal of Physiology 256, R646-R652. Silverstein, J., Plisetskaya, E., 2000. The effects of N P Y and insulin on food intake regulation in fish. American Society of Zoologists 40, 296-308. Silverstein, J., Breininger, J., Baskin, D., Plisetskaya, E., 1996. Neuropeptide Y abundance and gene expression in the salmon brain: A role in regulation of food intake. American Zoologist 36, 82A. Simpkins, D.G., Hubert, W.A., Del Rio, C M . , Rule, D . C , 2003. Effect of swimming activity on relative weight and body composition of juvenile rainbow trout. North American Journal of Fisheries Management 23, 283-289. Singh, R.P., Srivastava, A . K . , 1985. Satiation time gastric evacuation and appetite revival in Heteropneustes-fossilis Siluriformes Pisces. Aquaculture 49, 307-314. Small, B.C., Nonneman, D., 2001. Sequence and expression of a cDNA encoding both pituitary adenylate cyclase activating polypeptide and growth hormone-releasing hormone-like peptide in channel catfish (Ictalurus punctatus). General & Comparative Endocrinology 122,354-363.. Solberg, C , 2004. Influence of dietary oil content on the growth and chemical composition of Atlantic salmon (Salmo salar). Aquaculture Nutrition 10, 31-37. Sotelo, A . L , Bartke, A. , Kopchick, J.J., Knapp, J.R., Turyn, D., 1998. Growth hormone (GH) receptors, binding proteins and IGF-I concentrations in the serum of transgenic mice expressing bovine G H agonist or antagonist. Journal of Endocrinology 158, 53-59. Stevens, E.D., Devlin, R.H., 2000. Intestinal morphology in growth hormone transgenic coho salmon. Journal of Fish Biology 56, 191-195. Stevens, E.D., Wagner, G.N., Sutterlin, A . M . , 1999. Gut morphology in growth hormone transgenic Atlantic salmon. Journal of Fish Biology 55, 517-526. Sugiura, S.H., Dong, F .M. , Rathbone, C.K., Hardy, R.W., 1998. Apparent protein digestibility and mineral availabilities in various feed ingredients for salmonid feeds. Aquaculture 159, 177-202. Sun, X . , Zhu, S., Chan, S.S.H., Toresson, G., Cheng, C.H.K., 1997. Identification and characterization of growth hormone receptors in snakehead fish (Ophiocephalus argus Cantor) liver. General & Comparative Endocrinology 108, 374-385. Sundstrom, L.F., Devlin, R.H., Johnsson, J.I., Biagi, C.A., 2003. Vertical position reflects increased feeding motivation in growth hormone transgenic coho salmon (Oncorhynchus kisutch). Ethology 109, 701-712. Sundstrom, L.F., Lohmus, M . , Devlin, R.H., Johnsson, J.I., Biagi, C.A., Bohlin, T., 2004. Feeding on profitable and unprofitable prey: Comparing behaviour of growth-enhanced transgenic and normal coho salmon (Oncorhynchus kisutch). Ethology 110, 381-396. Suzuki, T., Kurokawa, T., McVey, D . C , 1999. Sequence and expression analyses of cholecystokinin (CCK) precursor cDNA in the Japanese flounder (Paralichthys olivaceus). Fish Physiology & Biochemistry 21, 73-80. 42 Sveier, H. , Wathne, E., Lied, E., 1999. Growth, feed and nutrient utilisation and gastrointestinal evacuation time in Atlantic salmon (Salmo salar L.): The effect of dietary fish meal particle size and protein concentration. Aquaculture 180, 265-282. Szabo, M . , Butz, M . , Banerjee, S., Chikaraishi, D., Frohman, L. , 1995. Autofeedback suppression of growth hormone (GH) secretion in transgenic mice expressing a human G H reporter targeted by tyrosine hydroxylase 5'-flanking sequences to the hypothalamus. Endocrinology 139, 4044-4048. Tekinay, A . A . , Davies, S.J., 2002. Effects of dietary carbohydrate level on gastric evacuation and return of appetite in the rainbow trout, Oncorhynchus mykiss. Turkish Journal of Biology 26, 25-31. Torstensen, B.E., Lie, O., Hamre, K. , 2001. A factorial experimental design for investigation of effects of dietary lipid content and pro- and antioxidants on lipid composition in Atlantic salmon (Salmo salar) tissues and lipoproteins. Aquaculture Nutrition 7, 265-276. Traverso, J .M., Ravaglia, M.A. , Vissio, P.G., Maggese, M.C. , Paz, D.A., 2003. Localization of Neuropeptide Y-like immunoreactive structures in the brain of the pejerrey, Odontesthes bonariensis (Teleostei, Atheriniformes). Anatomia, Histologia, Embryologia: Veterinary . Medicine Series C 32, 29-35. Tritos, N . , Maratos-Flier, E., 1999. Two important systems in energy homeostasis: melanocortins and melanin-concentrating hormone. Neuropeptides 22, 339-349. Tse, D.L.Y. , Tse, M.C.L . , Chan, C.B., Deng, L. , Zhang, W.M. , Lin, H.R., Cheng, C.H.K., 2003. Seabream growth hormone receptor: Molecular cloning and functional studies of the full-length cDNA, and tissue expression of two alternatively spliced forms. Biochimica et Biophysica Acta 1625, 64-76. Tsuneki, K. , Nozaki, M . , 1989. Histological and immunohistochemical studies of the neurohypophysis of primitive teleosts the Osteoglossidae. Acta Zoologica 70, 47-52. Uchida, K. , Kajimura, S., Riley, L .G. , Hirano, T., Aida, K. , Grau, E.G., 2003. Effects of fasting on growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 134A, 429-439. Uchiyama, T., Kaji, H. , Abe, H. , Chihara, K. , 1994. Negative regulation of hypothalamic growth hormone-releasing factor messenger ribonucleic acid by growth hormone and insulin-like growth factor 1. Neuroendocrinology 59, 441-450. 43 Unniappan, S., Peter, R.E., 2004. In vitro and in vivo effects of ghrelin on luteinizing hormone and growth hormone release in goldfish. American Journal of Physiology 286, R1093-R1101. Unniappan, S., Peter, R.E., 2005. Structure, distribution and physiological functions of ghrelin in fish. Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 140, 396-408. Valente, L.M.P. , Le Bail, P.Y., Gomes, E.F.S., Fauconneau, B., 2003. Hormone profile in fast-and slow-growing strains of rainbow trout (Oncorhynchus mykiss) in response to nutritional state. Aquaculture 219, 829-839. Vanstone, W.E., Markert, J.R., 1968. Some morphological and biochemical changes in coho salmon, Onchorynchus kisutch, during parr-smolt transformation. Journal of the Fisheries Research Board of Canada 25, 2403-2418. Very, N . M . , Knutson, D., Kittilson, J.D., Sheridan, M.A . , 2001. Somatostatin inhibits growth of rainbow trout. Journal of Fish Biology 59, 157-165. Very, N . M . , Kittilson, J.D., Norbeck, L .A. , Sheridan, M.A . , 2005. Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 140, 615-628. Volkoff, H. , Peter, R., 2001. Characterization of two forms of cocaine- and amphetamine-regulated transcript (CART) peptide precursors in goldfish: Molecular cloning and distribution, modulation of expression by nutritional status, and interactions with leptin. Endocrinology 142, 5076-5088. Volkoff, H. , Eykelbosh, A.J . , Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: Interactions with cholecystokinin, neuropeptide Y and orexin A , and modulation by fasting. Brain Research 972, 90-109. Wallenius, K. , Sjogren, K. , Peng, X. -D. , Park, S., Wallenius, V. , Liu, J.-L., Umaerus, M . , Wennbo, H. , Isaksson, O., Frohman, L. , Kineman, R., Ohlsson, C , Jansson, J.-O., 2001. Liver-derived IGF-I regulates GH secretion at the pituitary level in mice. Endocrinology 142,4762-4770. Wargelius, A. , Fjelldal, P.-G., Benedet, S., Hansen, T., Bjornsson, B.T., Nordgarden, U . , 2005. A peak in gh-receptor expression is associated with growth activation in Atlantic salmon vertebrae, while upregulation of igf-I receptor expression is related to increased bone density. General & Comparative Endocrinology 142, 163-168. Weathercup, R.N. , McCracken, K.J . , Foy, R., Rice, D., McKendry, J., Mairs, R.J., Hoey, R., 1997. The effects of dietary fat content on the performance and body composition of farmed rainbow trout (Onchorynchus mykiss). Aquaculture 151, 173-184. Weng, Y . -Z . , Fang, Y.-Q. , 2003. Distribution and morphology of neuropeptide Y and beta-endorphin endocrine cells in the gut of grey mullet, Mugil cephalus L. Acta Hydrobiologica Sinica 27, 619-624. Wong, A.O.L. , Chang, J.P., Peter, R.E., 1993. Interactions of somatostatin, gonadotropin-releasing hormone, and the gonads on dopamine-stimulated growth hormone release in the goldfish. General & Comparative Endocrinology 92, 366-378. Xiao, D., Lin, H.-R., 2003. Cysteamine: A somatostatin-inhibiting agent: Induced growth hormone secretion and growth acceleration in juvenile grass carp (Ctenopharyngodon idellus). General & Comparative Endocrinology 134, 285-295. Yunker, W.K., Chang, J.P., 2004. Somatostatin-14 actions on dopamine- and pituitary adenylate cyclase-activating polypeptide-evoked Ca2+ signals and growth hormone secretion. Journal of Neuroendocrinology 16, 684-694. Yunker, W.K., Smith, S., Graves, C , Davis, P.J., Unniappan, S., Rivier, J.E., Peter, R.E., Chang, J.P., 2003. Endogenous hypothalamic somatostatins differentially regulate growth hormone secretion from goldfish pituitary somatotropes in vitro. Endocrinology 144, 4031-4041. 45 CHAPTER 21 Influence of dietary digestible energy content on growth, protein and energy utilization and body composition of growth-hormone transgenic and non-transgenic coho salmon (Oncorhynchus kisutch). 2.1 Introduction Growth hormone (GH) transgenic (T) coho salmon, Oncorhynchus kisutch, were generated through the insertion of a gene construct consisting of a sockeye (O. nerka) G H gene fused to a metallothionein-B promoter sequence (Devlin et al., 1994). Subsequently, it was shown that the T coho salmon grew much more rapidly and matured in a shorter period than wild coho salmon (Devlin et al., 1994; Devlin et al., 2004a), primarily due to their markedly enhanced appetite (feed intake) without any loss in their ability to convert feed into flesh. The extreme desire for food during growth of T coho salmon, however, appears to increase their risk of predation because of reduced predator awareness (Devlin et al., 1999; Sundstrom et al., 2003; Sundstrom et al., 2004a), but little is known regarding their energy metabolism and nutritional requirements. The increased growth performance of T coho salmon using commercially-available diets that are optimal in composition for growth of non-transgenic (NT) coho salmon has been well documented (Devlin et al., 1994; Devlin et al., 1995; Devlin et al., 2000; Devlin et al., 2004a; Devlin et al., 2004b). However, little is known about the nutrient and energy needs of T coho salmon or other aquatic finfish species relative to their non-transgenic counterparts and whether there is much scope to enhance the growth of T fish through improvements in the composition of extant diet formulations for fish (Fu et al., 1998; Cook et al., 2000; Rahman et al., 2001). The nutritional requirements and growth responses of many commercially important NT salmonid species have been determined and some examples are as follows: Atlantic salmon, Salmo salar (Austreng et al., 1987; Shearer et al., 1992; Hillestad et al., 2001); rainbow trout, O. mykiss (Weathercup et al., 1997; Chan et al., 2002; Glencross et al., 2004); chinook salmon, O. tshawytscha (McCallum and Higgs, 1989; Hajen et al., 1993a); coho salmon (Forster et al., 1988; Haard et al., 1996); masu salmon, O. masu (Lee and Kim, 2001). Many of these studies have been directed at optimizing the dietary concentrations of the energy yielding nutrients i.e., 1 A version of this chapter has been accepted for publication. Raven, P. A., Devlin, R.H., Higgs, D.A. 2005. Influence of dietary digestible energy content on growth, protein and energy utilization and body composition of growth-hormone transgenic and non-transgenic coho salmon (Oncorhynchus kisutch). Aquaculture. doi: 10.1016/j .aquaculture.2005.11.009 46 protein, lipid, and carbohydrate and the ratio of digestible protein to energy for cost efficient growth and/or improvement of flesh quality. Moreover, emphasis has also been placed on optimization of various abiotic (e.g., water temperature) and biotic (e.g., fish size), factors to maximize fish growth and feed utilization (Brett and Groves, 1979). The development of genetically modified transgenic fish to improve the cost efficacy of aquaculture has led to concerns regarding the potential impacts that these fish may have on the environment and, in the possible case of T escapes, their potential effects on the survival and sustainability of wild populations of salmon and other fish species. Many fish species have now been modified for various traits, especially for increased growth performance (Du et al., 1992; Devlin et al., 1994; Devlin et al., 1995; Hinits and Moav, 1999; Pitkanen et al., 1999; Rahman and Maclean, 1999; Morales et al., 2001; Nam et al., 2001; Rahman et al., 2001; Lu et al., 2002). However, concomitant changes in fish behaviour and physiology have resulted from these modifications, which conceivably could not only influence the success of the genetically-modified species in the natural environment but also, as indicated above, lead to undesirable interactions with other NT wild fish species (Rahman et al., 1998; Devlin et al., 1999; Martinez et al., 2000; Stevens and Devlin, 2000; Devlin et al., 2004b; Sundstrom et al., 2004b). Examination of the physiology, growth, and nutrition of T fish in culture can facilitate our understanding of what potential adverse impacts the growth-enhanced fish may have on natural fish populations, particularly i f it is known how susceptible they are to predation and infectious disease agents, what their food (energy and nutrient) needs are, and how well they metabolically utilize diets of varying available energy and non-nutritive content (e.g., chitin or fibre-enriched diets) relative to NT counterparts. In this study my main goal was to determine whether size- and age-matched T and NT coho salmon differed in their abilities to ingest and metabolically utilize feed that varied widely in digestible energy (DE) content while other aspects of their diet composition remained constant, e.g., the ratio of digestible protein to available energy and essential amino acid balance. In this regard, I was particularly interested in determining whether the physical distention of the stomach and other aspects of the digestive physiology of T coho salmon would allow these fish to maintain similar available protein and energy intake and consequently fish growth across a wide range of dietary DE content. The latter was accomplished by progressively increasing dietary fibre content at the expense of the energy yielding nutrients viz., protein, lipid and carbohydrate. It was of further interest to ascertain how well the T coho salmon utilized the fibre-enriched diets. It was felt that the findings from this study could have potential ecological 47 implications especially in cases where rises in sea surface temperatures result in suboptimal nutrient and energy concentrations in prey for maximum salmon growth (e.g., increased contribution of prey of higher chitin content and/or prey of reduced DE content; (Higgs et al., 1995)). Also, I thought that the results could be of interest for improving the cost effectiveness of aquaculture, especially i f I obtained indications that the T coho salmon would grow well on the fibre-enriched diets without much loss in protein and energy utilization. For example, such a finding may indicate that T coho salmon are able to grow well on diets extensively based on fibre-rich plant protein sources such as inexpensive canola meal and sunflower meal, although this would have to be confirmed in subsequent studies. 2.2 Materials and Methods 2.2.1 Diet Composition Four test dry diets of different DE content were formulated with constant ratios of digestible protein to available energy i.e., 23 MJ/kg on a dry weight basis as well as essential amino acid balance. This was accomplished by proportionately reducing the levels of the dietary protein sources as the concentration of DE was lowered in equal steps from 21 MJ/kg to 15 MJ/kg (Table 1), decreasing the supplemental levels of anchovy oil and pre-gelatinized wheat starch while simultaneously maintaining a constant ratio between the available dietary concentrations of lipid and carbohydrate (1.8 g/g) and concomitantly raising dietary concentrations of a-cellulose (non-nutritive bulk). Care was taken to ensure that all diets contained adequate levels of essential amino acids, vitamins and minerals in relation to the known essential amino acid, vitamin and mineral needs of Pacific salmon and other salmonids (NRC, 1993). Further, all diets were supplemented with 0.5% chromic oxide as an indigestible indicator. A l l diets were prepared and steam pelleted (2.5 mm pellets were fed to NT coho salmon between day 0 and 84 and to T coho salmon between day 0 and 63, and 4.0 mm pellets thereafter) as described by Higgs et al. (1979). Moreover, all diets were stored under cool (5°C) and dry conditions in air-tight containers throughout the study. During the first 3 weeks of the experiment only, one kilogram amounts of each of the pelleted diets were supplemented with an additional 10 ml of anchovy oil containing 50 mg of hydrolyzed krill powder in an attempt to improve the palatability of the lowest DE diet, since this was not accepted well by the NT coho salmon (unlike the T coho salmon). 48 2.2.2 Growth Experiment Triplicate groups of 25 size matched (initial mean weight 12.9 ± 1.2 g (SD)) and age matched (1.5 year-old) NT and T coho salmon were fed each of the aforementioned test diets by hand twice daily (0800 and 1300 h) to satiation for 84 days using a randomized block design. At each feeding time, the pellets were added at a slow to modest rate depending upon fish appetite and the point of satiety was deemed to be reached when 3 consecutive pellets were not Consumed and therefore reached the bottom of the tank. Unconsumed pellets were counted and this number multiplied by the mean air-dry weight of the pellets for a given diet provided an estimate of feed wastage. This, in turn, was deducted from the daily ration dispensed to give the actual ration consumed by each group. The fish were reared in 180 L opaque blue fibreglass tanks supplied with running (8L/min), 8-11 °C, aerated (dissolved oxygen, 8.4-10.6 mg/L; total gas pressure, 96.6-100.3%) well water and maintained on a simulated natural photocycle (Vancouver, Canada, 49 ° 15' N 123 0 10' W from January to March) using daylight fluorescent lights regulated by a photocell. Each of the tanks was covered by a hinged plexiglass sheet whose back half was darkened to afford the fish some cover. Also, the water was introduced into each tank in a manner that forced the fish to swim at about 0.5 body lengths per second to minimize aggressive behavior between the fish and discourage the fish from resting on the tank bottom. Before the start of the experiment the fish were fed commercially available extruded dry pelleted diets of appropriate composition for NT. Pacific salmon at this life history stage (Skretting Canada, Vancouver, BC). During the study, the 8 different treatment groups were distinguished on the basis of their genotype (NT or T) and the digestible energy content of their prescribed diet (i.e., 15, 17, 19 or 21 MJ/kg). Thus, for example, NT coho salmon fed the diet with 17 M J DE/ kg were denoted as NT-17. 2.2.3 Fish Weighing, Sampling and Treatment The fish in each group were not fed for at least 2 lhr before they were anesthetized in tricaine methane sulphonate (MS 222; 150 mg/L supplemented with 300 mg of sodium bicarbonate/L for 1.5 min) and then at 28-day intervals individually weighed to the nearest 0.01 g and measured (fork lengths) to the nearest 0.1 cm. On day 0, a total of 10 NT and 10 T fish that were common to their respective genotypes were sampled and euthanized (0.2 g MS 222/L) for individual determinations of their initial whole body proximate compositions. Each group of fish was stored in a vacuum-packed, oxygen impermeable food-grade bag at -20°C pending analysis. On day 84, 6 fish were sampled 49 randomly from each group for individual determinations of whole body proximate composition and these samples were treated and stored as described above for the initial samples. Subsequently, 10 fish were removed from each of the 12 T groups of coho salmon and these were placed into twelve 150 L digestibility tanks for assessment of the bioavailable levels of protein, organic matter, and energy in each of the test diets as described below. It should be mentioned that on day 5 of the study, all groups were treated with 4 mg of Chloramine T/L for a 15 min period followed by 0.2 ml of formalin/L for 20 min to eliminate a low incidence of suspected bacterial infection that was noted in some of the T groups. This protocol was repeated 10 days later. 2.2.4 Digestibility Study Because the final sizes of the NT coho salmon were too small for proper assessment of their respective diet digestibilities (low fecal output) and these fish had poor appetite, diet digestibility determinations were conducted only using the T coho salmon. In this regard, estimates of the apparent digestibility coefficients for protein, organic matter (ash-free dry weight), and gross energy were obtained using the procedures and digestibility tanks described by Hajen et al. (1993a; 1993b). The same water supply that was used for the growth trial was employed and all groups of fish were fed their prescribed diet to satiation twice daily for 10 days and then feces were collected for 5 additional consecutive days. The feces that were collected from each of the fecal collection columns each morning before the first daily feeding were centrifuged, freeze-dried and then pooled (n = 3 per diet treatment) for the 5-day period for subsequent analyses of their respective moisture, ash, protein, gross energy and chromic oxide concentrations. The dietary concentrations of the preceding proximate constituents, energy and chromic oxide were also determined (see below). 2.2.5 Chemical Analyses A l l diets as well as the initial and final NT and T fish and fecal samples were analyzed in duplicate for moisture (16 hr at 100 °C in a drying oven ), ash (2 hr at 600 °C in a muffle furnace; A O A C Official Method 942.05 (Horwitz, 2000)), lipid (chloroform/methanol procedure of Bligh and Dyer (1959)), and protein (Technicon industrial method No. 334-74W/B, revised March, 1977, Technicon Industrial Systems, Tarrytown, N . Y . ; percent nitrogen in each sample was multiplied by 6.25 to obtain percent protein). The gross energy concentrations in the diets and feces were determined by adiabatic bomb calorimetry (IKA Calorimeter System C5001 duo 50 control, Germany). The gross energy concentrations in the fish samples were estimated by ascribing 0.02364 MJ/g protein and 0.03954 MJ/g lipid. Dietary and fecal chromic oxide concentrations were determined using the procedures of Fenton and Fenton (1979)). 2.2.6 Performance Parameters Fish performance during this study was assessed by the following: (1) Final mean weight (g) (2) SGR; Specific growth rate in weight or length (SGR = [(In final weight or fork length-ln initial weight or fork length)/number of days] x 100 (3) Percent survival (number of fish remaining on day 84 expressed as a percentage of initial number of fish in each group) (4) CF; Condition factor [CF = (fish weight (g)/fork length (cm)3) x 100] (5) DFI; Dry feed intake. DFI was expressed either as g/fish (DFIj calculated as the total weight of dry feed consumed per fish in each interval or in the total experiment) or as % body weight/day (DFI%). The latter was calculated for a given time period (t, t +1) according to the following formula of Richardson et al. (1985), DFID X 100/ logw t +1 + logw t 12) e x p where DFID was the mean daily dry feed intake per fish (t, t + 1), and logw t and log t + i were the averaged log wet weights at the start (t) and the end (t +1) of the period. (6) TEI; Total energy intake (TEI expressed as MJ/g body weight/day). TEI = DFID X gross energy content of diet (MJ/g)/geometric mean weight of the fish (g/fish) for a given time period as calculated in 5 above. (7) AEI: Available energy intake (AEI expressed as MJ/g body weight/day). AEI = D F I D x available energy content of diet (MJ/g)/ geometric mean weight of the fish (g/fish) for a given time period as calculated in 5 above. (8) TPI; Total protein intake (TPI expressed as g/body weight/day). TPI = D F I D x crude protein content of diet (g/g)/geometrie mean weight of the fish (g/fish) for a given time period as calculated in 5 above. (9) API; Available protein intake (API expressed as g/g body weight/day). API = DFID X available protein content of diet (g/g)/geometric mean weight of the fish (g/fish) for a given time period as calculated in 5 above. (10) FER; Feed Efficiency Ratio (FER = wet weight gain (g)/ DFIy). (11) PER; Protein efficiency ratio (PER = wet weight gain (g)/ protein intake (g)) . 5 1 (12) PPD; Percent protein deposited (PPD = protein gain (g) x 100/ protein intake (g)) (13) APPD; Available percent protein deposited (APPD = protein gain (g) x 100/available protein intake) (14) GEU; Gross energy utilization (GEU = gross energy gain (MJ/fish) x 100/ gross energy intake (MJ/fish)) (15) A E U ; Available energy utilization (AEU = energy gain (MJ/fish) x 100/available energy intake (MJ/fish)) (16) A D C ; Apparent digestibility coefficients (ADC, %) for dietary protein (ADC P ) , energy (ADC e n ) and organic matter (ADC 0m) were determined according to Cho et al (1985) as follows: A D C = [ 1- (F/D x D c r/Fcr)] x 100 where F = % nutrient (p or om) or energy content (MJ/g) of feces, D = % nutrient (p or om) or energy content (MJ/g) of diet, D c r = % chromic oxide in diet and F c r = % chromic oxide in feces. (17) Digestible protein (DP, g/kg) and energy (DE, MJ/kg) concentrations in the diets on a dry weight basis; DP = (diet protein content, g/kg dry diet x A D C P ) DE = (diet gross energy content (MJ/kg) x A D C e n ) 2.2.7 Statistics Due to the similar variability in each genotype at the start of the experiment, statistical comparisons were carried out using a two-way analysis of variance in Sigma Stat (v. 3.0.1, Build 3.01.0, SPSS Inc.) for initial tank means (tanks were treated as replicates, three tanks per treatment). Subsequently, large differences in growth and other performance values at the end of the experiment prevented combined analysis of both diet treatments and genotypes as the data could not be normalized by any transformation. As a result, a two-way A N O V A was run with diet and block effects within each genotype along with Tukey multiple comparison post hoc tests. In DFI, TEI, AEI, TPI and API the means for each point and significant differences between the digestible energy of the diets over the whole experiment (tot) were determined by a two-way A N O V A with diet and interval as the variables and Tukey multiple comparison post hoc tests (for the non-transgenics, values were log transformed before analysis). Further, an A N O V A (on ranks in cases without normality) was performed between the genotypes, ignoring the effects of the diet, or a student's t-test was performed within each treatment between 52 genotypes (if any comparison between the genotypes was made at all) to provide an indication of the degree to which the genotypes differed. Comparisons between end proximate compositions were made using an A N C O V A (general linear model) in SYSTAT (v. 10.2.05, SYSTAT Corporation Inc.) on 5 fish from each tank (60 fish total) with the variables of genotype, diet, block and the covariate weight. Fish weight has been found to affect proximate composition, especially percentages of protein and lipid (Vanstone and Markert, 1968; Foda, 1974; Shearer et al., 1994; Johansen et al., 2001; Torstensen et al., 2001). Therefore, it was important in this study to remove the effect of this confounding variable to properly determine the effect of diet treatment on the whole body proximate composition of both genotypes of fish. Comparisons of proximate compositions between genotypes were not performed due to the non-normal distribution of the weight covariate and resultant violation of A N C O V A assumptions. Comparisons between start compositions were made using an A N O V A on arcsine square root transformed percentiles. A l l differences were considered significant at P < 0.05. 2.3 Results 2.3.1 Composition and Digestibility of Test Diets The determined concentrations of crude and digestible protein and gross and digestible energy in the test diets were close to those expected. In this regard, DP levels varied between 355 and 433 g/kg and DE levels ranged from 15.1-20.7 MJ/kg and ratios of DP to DE extended from 20.9-23.6 g/MJ (mean of 22 g/MJ across all diets; Table 2.1). Crude lipid levels were also noted to be close to expected values (ranged from 144-191 g/kg). As expected the A D C o m and A D C e n values were found to be strongly positively correlated with dietary DE (r = 0.99) due to progressive reduction of indigestible crude fibre and the attendant inclusion of more digestible protein, lipid and carbohydrate as the dietary DE content was increased (Table 2.1). Interestingly, A D C P values showed the opposite trend since the diet with 15 M J DE/kg had the highest value (92.5%) and those containing 17-21 M J DE/kg had values of 91-91.5% (Fig. 2.1). 2.3.2 Fish Growth, Feed Intake, Diet Utilization and Percent Survival A l l diets supported excellent growth in T coho salmon but only diets with > 17 M J DE/kg supported growth in NT coho salmon (Table 2.2; Fig. 2.2). Values for SGR for T coho salmon fed diets with 17-21 M J DE/kg were observed to be 6-13 fold higher than those of NT counterparts (Table 2.2). Within T fish, SGR values for weight and final mean weights and 53 lengths were not significantly depressed in T-17 and T-19 groups relative to T-21 groups whereas T-1'5 groups exhibited significantly reduced growth with respect to the foregoing parameters relative to T-21 fish. In comparison to T-21 fish, SGR values for length were lower in T fish when the diets contained < 17 M J DE/kg. Collectively the foregoing growth results indicated that T fish at this stage of their life history required > 17 M J DE/kg diet for maximum growth under our experimental conditions. In general, the values for all of the preceding growth performance parameters in NT fish indicated that these fish too required > 17 M J DE/kg diet and preferably > 19 MJ DE/kg for maximum growth, especially in weight (Table 2.1). Terminal CF values were uninfluenced by diet treatment in both T and NT fish (Fig. 2.2) and in the former groups, they rose throughout the study especially until day 56. Alternatively, in NT fish terminal CF values remained similar to initial values (T-17, T-19 and T-21 fish) or declined during the study (NT-15 fish). The excellent growth of T fish relative to NT fish was associated with much higher dry feed intake (DFI T Fig. 2.3, DFI% Fig. 2.4), TEI (Fig. 2.5), TPI (Fig. 2.5), and protein utilization (particularly PPD values and in two situations, i.e., at DE 15 and 17 MJ/kg, PER values; Fig. 2.6) than noted in NT fish and, in some cases, G E U (T-15 fish versus NT-15 fish; T-21 fish versus NT-21 fish; Fig. 2.7). Within T fish, overall values for DFI% (% body weight/day basis) and TEI showed an inverse relationship to diet DE (DFI% values for T-15 and 17 fish significantly higher than those for T-19 and 21 fish), but those for AEI, TPI, and API were directly related to diet DE (r2 = 0.68 for AEI , 0.49 for TPI, and 0.32 for API and AEI was significantly higher in T-21 fish versus T-15 fish). Hence, it was apparent that although T fish attempted to maintain similar available (digestible) energy intake as the dietary DE was lowered, they were unable to do so, especially when diet D E was 15 MJ/kg (Fig. 2.5). Regardless of the dietary DE content, T fish exhibited equivalent abilities to convert dietary protein and energy into body protein and energy (no significant effects of diet treatment noted for PER, PPD, APPD, G E U and A E U values). By contrast, FER values were significantly increased with each increment of DE probably as a consequence of the marked decreases in ration (fibre intake) of the T fish consuming the diets of progressively higher DE content. The progressively increased growth of NT fish in weight and length as the dietary DE content was raised from 15 to 21 MJ/kg was associated with marked elevations in dry feed intake (the overall mean values for DFIy observed for NT-19 and NT-21 fish were significantly higher than that noted for NT-15 fish in Fig 2.3., and the value for DFI% for NT-21 fish was higher than that for NT-15 fish in Fig. 2.4) , TEI (overall mean value observed for T-21 fish 54 significantly higher than found for all other groups and that for T-15 fish was significantly lower than observed for all other groups), FER (FER values significantly increased when DE > 17 MJ/kg relative to NT-15 fish and were significantly higher for NT-21 fish than observed for NT-17 coho salmon) and protein utilization (significantly higher PER and PPD values noted in all NT treatment groups in comparison to NT-15 fish when DE > 17 MJ/kg). The percent survival of all NT groups of fish during the study was 100% and the percent survival of T fish was generally high (> 94%) except for fish consuming the diet with 17 MJ DE/kg where 84% survived (Table 2.2). The poorer survival of T-17 fish was observed especially in two of the replicate groups (80% survival in each case) whereas percent survival in the third replicate group was 92%. It should be noted that significant block effects were found during some intervals for the final weight, percent protein, and FER, PER, DFI, and TEI values for non-transgenic fish and for FER, DFI and AEI values for transgenic fish. These variables were dependant on feed intake and therefore exhibited block effects that were present in the feed intake data. As each block contained a group fed each diet treatment, an increase in one block would not affect the treatment comparisons, especially in instances where no significant differences were seen. 2.3.3 Whole Body Proximate Composition On day 0 of the study, T and NT fish were not found to be significantly different in mean percentages of body protein, but T fish had markedly reduced percentages of body lipid and significantly higher percentages of body moisture and ash relative to NT fish (Table 2.3). In general, on day 84, whole body percentages of protein and ash were unaffected by dietary DE content in both T and NT fish (Table 2.3). The exceptions to the foregoing generalization were found within T fish, where the mean percentage of body protein in T-21 fish was significantly lower than observed in T-19 fish and the percentage of body ash in T-21 fish was significantly lower relative to fish given the other test diets, which showed no differences amongst themselves. Percentages of lipid and moisture were not significantly affected in NT fish by diet treatment. However, in T fish, the mean terminal percentage of body lipid was directly related to dietary DE (significantly elevated in T-19 and 21 fish versus T-15 fish) and body water content in general was found to be inversely related to dietary DE (significantly higher in T-15 fish than observed in T-19 and 21 fish). 55 As general trends, T fish had higher percentages of body protein and lipid and lower percentages of body moisture and ash than observed in NT fish across all diet treatments, which is consistent with the improved nutritional status of the T fish relative to the NT fish. 2.4 Discussion The present findings indicate that growth hormone-transgenic coho salmon had markedly increased rates of growth relative to non-transgenic coho salmon over the experimental period, irrespective of the range of the digestible energy content of the diet employed, namely, 15-21 MJ/kg. The former fish achieved the higher growth rates relative to the latter through dramatic increases in their feed, protein and energy intake as well as by more efficacious conversion of dietary protein into body protein and to a lesser degree, improved feed efficiency (when dietary DE 15 and 17 MJ/kg) and gross energy utilization (when dietary DE 15 or 21 MJ/kg). The aforementioned findings agree with and extend those of previous studies that have compared growth of growth hormone-transgenic coho salmon with non-transgenic coho salmon (Devlin et al., 1994; Devlin et al., 2000; Devlin et al., 2004a). Digestible energy content of the diet was found to be a major factor that influenced the growth responses of non-transgenic coho salmon in this study. Indeed, non-transgenic coho salmon ingesting the diet with 15 M J of digestible energy/kg actually lost weight during the study even though they had unlimited feeding opportunity. Best growth of non-transgenic fish was observed when the determined dietary DE content was 18.5-20.7 MJ/kg and this was coincident with high digestible dietary protein concentration i.e., 405- 433 g/kg, 180-191 g of crude lipid/kg, 21-22 g of digestible protein/available M J and alpha-cellulose less than lOOg/kg. These ranges for the dietary nutrient and energy levels are similar to those recommended by Higgs et al. (1995) for optimum growth of juvenile non-transgenic coho salmon and are in accord with the findings of Fagerlund et al. (1983). The poorer growth responses noted for the control coho salmon given the diets of lower digestible energy and protein content were likely due to elevated dietary concentrations of crude fibre and reduced concentrations of the protein sources that are known to contribute to overall diet palatability in salmonids i.e., fishmeal, squid meal, and krill meal. With respect to the feeding behavior of the non-transgenic coho salmon during this study, it was noted that all groups had far less interest in the feed than their transgenic counterparts and this disinterest increased progressively with each stepwise decrease in the digestible energy content of the diet. Other factors that may have lowered the feeding responses of non-transgenic coho salmon in this study during this stage of the life history may have 56 included being more sensitive to the extent of cover, lighting and other disturbances. Also, wild non-transgenic coho salmon and other salmon species are known to have slower rates of growth in winter (when two thirds of this study was conducted) relative to spring and summer (Fagerlund et al., 1983; Markert et al., 1984; Metcalfe and Thorpe, 1992) which has not been observed in growth-hormone transgenic salmon (Devlin et al., 1995; Mori and Devlin, 1999; Devlin et al., 2004a). In the non-transgenic coho salmon, growth and dry feed intake increased throughout the experiment with increasing photoperiod, but did not reach the intake seen in the transgenic salmon. Certainly, the non-transgenic coho salmon ingesting the diets containing reduced protein and energy and high fibre content did not overcome the risk of feeding exposure to the same degree as those given the other test diets and this contributed to the observed differences in growth rate between the genotypes given the various diets (Metcalfe and Thorpe, 1992; Sundstrom et al., 2003). Although the non-transgenic coho salmon did not feed well in comparison to their transgenic counterparts, comparisons between the genotypes are still important as an indicator of the natural differences that exist between these fish. The initial condition factors of the transgenic coho salmon were found to be lower than noted in the non-transgenic coho salmon. This resulted from the pair feeding of the former fish to the ration level consumed by the non-transgenic fish so that the initial weights of both age-matched genotypes would be similar or equivalent at the start of the study. Bone growth in salmon has been found to be independent of muscle and tissue growth with length increasing even when energy intake is insufficient to support a desired weight, as in starved fish (Einen et al., 1998). In this case, the transgenic fish at the start of the experiment were longer in fork length than the non-transgenic fish even though they had similar weights. Consequently, the initial CF values were lower in the former fish than the latter, but they improved rapidly as the transgenic fish were allowed to feed to satiation and realize their maximum growth potential. The observed dissimilar concentrations of whole body lipid on day 0 between the genotypes (body lipid content significantly lower in the transgenic fish relative to non-transgenic fish) probably arose from insufficient energy availability prior to the onset of the experiment. The differences in initial rate of growth in weight and length coupled with the subsequent increases in body lipid may have arisen simply from provision of adequate energy resources but could have also involved compensatory growth mechanisms (Johansen et al., 2001; Johansen et al., 2002). However, transgenic fish continued to grow quickly relative to the non-transgenic coho salmon throughout the whole experimental period. 57 In general, other studies have shown that salmonids consume palatable diets of high nutritive value to satisfy their daily energy needs. For instance, Atlantic salmon feed intakes have been noted to increase when their diets have lower energy content (Shearer et al., 1992; Johansen et al., 2002). Also, feed intake in coho salmon has been observed to decrease when they have been fed low protein diets of increased digestible energy content (Chan et al., 2002). Hormones that can increase metabolism, such as growth hormone in the transgenic fish, can also increase feed intake (Markert et al., 1977). Our findings for the transgenic fish therefore agree with those of previous studies with respect to their need to satisfy daily energy needs and the dramatically enhanced appetite of these fish, which characteristically have high circulating titres of growth hormone, relative to non-transgenic counterparts (Devlin et al., 1999; Cook et al., 2000). Our results, however, contrast with those of Martinez et al. (2000) in which transgenic tilapia were found to have reduced feed consumption in relation to the controls, although it is important to note that these fish contained a different gene construct. Although the transgenic coho salmon in this study consumed progressively more feed and total energy on a body weight basis as the digestible energy content of the diet was lowered, it is apparent that the groups given the diet of lowest digestible energy content (15 MJ/kg) were unable to ingest as much available energy as those given the diets where the digestible energy content was > 17 MJ/kg. This may have occurred because their stomachs were not able to accommodate any more of the fibre-rich 15 MJ/kg diet (stomach reached maximum physical distention) and consequently their growth rates declined relative to the fish given the other test diets. At the outset of this study, we hypothesized that the transgenic fish would likely consume more of the low energy diets to meet their metabolic demands and thereby offset a slower growth rate until the point of maximum gut distension was reached. Here, further feed intake would be prevented and hence the fish would no longer be able to increase their growth rate in comparison to the fish consuming the diets of higher digestible energy content. Maximum growth occurred when the diet concurrently contained 22 grams of digestible protein per available M J . Interestingly, the available protein intake of all groups of transgenic coho salmon regardless of diet treatment was not significantly different. Thus the reduced growth of transgenic coho salmon fed the diet with 15 M J of digestible energy was due to inadequate intake of energy, not energy and protein. Further, we observed that there were no significant differences between the transgenic coho salmon given the different diets in terms of their abilities-to convert dietary protein into flesh and to utilize dietary gross and available energy for growth. 58 Feed efficiency values in transgenic coho salmon were significantly improved with each stepwise increment in dietary digestible energy content. This likely reflected the progressive reduction of crude fibre and concurrent increases in digestible protein contents as the dietary digestible energy content was increased. It is noteworthy that the transgenic fish were no better at utilizing the feed for growth than the non-transgenic fish until the dietary digestible energy content dropped below 19 MJ/kg. The latter situation likely was caused by the low feed intakes of the non-transgenic coho salmon coupled with the high indigestible carbohydrate contents of the diets containing 15 and 17 M J of digestible energy/kg. The trends in feed efficiency in relation to the growth rates of both transgenic and non-transgenic coho salmon found in this study generally agreed with those seen in other studies on salmonids and non-salmonids. For instance, one would expect a higher feed efficiency with rapid growth as less energy is needed for maintenance (Jobling, 1994; Cook et al., 2000). In this regard, Cook et al. (2000) found a 10% increase in feed efficiency in growth hormone-transgenic Atlantic salmon that were growing 2.62 to 2.85 fold faster than control fish. Similarly, coho salmon injected with bovine growth hormone showed increases in both growth and feed efficiency (Markert et al., 1977). Moreover, higher feed efficiency has also been observed in other genera of transgenic fish, such as growth hormone-transgenic tilapia (Rahman et al., 1998; Martinez et al., 2000). Also, increases in feed efficiency in direct relation to dietary energy content have been noted in non-transgenic masu (Lee and Kim, 2001), Atlantic (Morris et al., 2003), and coho salmon (Chan et al., 2002) as well as rainbow trout (Bolliet et al., 2000). By contrast, rainbow trout consuming low amounts of a high protein and high lipid diet were observed to have reduced feed efficiency compared to those ingesting a low protein and lipid diet, but this difference was not apparent at a higher feeding rate (Reinitz, 1983). The amount of fibre in the diet is also known to adversely affect nutrient absorption and feed utilization by decreasing the transit time of ingesta through the gut (Brett and Higgs, 1970; Mill ikin, 1982). Once again, this likely is one of the main reasons why the non-transgenic coho salmon that consumed the two diets of lowest digestible energy content (highest oc-cellulose contents) had markedly reduced values for feed efficiency. Moreover their feed (energy and nutrient) intakes may have been only sufficient to satisfy their maintenance energy needs. Consequently, less of their available dietary energy would have been available for growth. In contrast, the transgenic fish did not show a sudden drop in feed efficiency with reduction of dietary digestible energy (elevation of dietary fibre content) which suggests that they were very efficient at absorbing nutrients such as protein (e.g., amino acids as revealed by our findings for apparent digestibility coefficients for protein). Further, our results 59 for growth and protein utilization in transgenic fish suggest that they were able to maintain ratios of available protein and energy levels within an optimal range, especially when the dietary digestible energy content was > 17 MJ/kg. One of the reasons why the transgenic coho salmon were so efficient at nutrient absorption likely relates to their previously observed greater anterior intestinal surface area compared to controls (Stevens et al., 1999; Stevens and Devlin, 2000; Stevens and Devlin, 2005). Diet treatment did not influence protein efficiency ratios or percentages of protein deposited in transgenic coho salmon. Non-transgenic coho salmon, however, had similar protein efficiency ratios when dietary digestible energy content was > 17 MJ/kg but not when the diet contained 15 MJ/kg. Values for percent protein deposited followed a similar trend and were more meaningful since they reflected differences in the abilities of the fish to convert dietary protein into body protein rather than gain in weight due to shifts in body protein, lipid and water accretion. Protein retention has been observed to vary between 47% and 56% in Atlantic salmon (Grisdale-Helland and Helland, 1997), which is similar to the range observed for the available percentages of protein deposited in the transgenic coho salmon in the present experiment. Protein efficiency ratios or percentages of protein deposited are affected by the amount of dietary protein in relation to lipid (Chan et al., 2002), starch (Hemre et al., 1995) or total energy content of the diet (Hillestad and Johnsen, 1994; Higgs et al., 1995; Lee and Kim, 2001). In cases where excessive protein is available, protein is de-aminated and excreted. When energy is limiting, protein must be used as an energy source at the expense of protein available for growth (Higgs et al., 1995). In non-transgenic coho salmon fed low protein diets, protein utilization has been observed to increase in direct relation to dietary lipid content until an optimum lipid concentration is reached (Higgs et al., 1995). Furthermore, at the same digestible lipid level, protein efficiency ratios in coho salmon have been found to increase as dietary protein content is lowered (Chan et al., 2002). The preceding findings suggest that coho salmon utilize dietary protein for growth more efficiently as dietary protein is reduced provided that there is sufficient dietary energy available from non-protein energy sources, i.e., lipid and carbohydrate. In transgenic coho salmon the dietary digestible energy content as well as digestible concentrations of lipid and carbohydrate appeared to be sufficient even at 15 MJ/kg for optimal protein utilization. However, in non-transgenic coho salmon ingesting the diet with 15 M J of digestible energy/kg, the diet was likely too low in digestible lipid and carbohydrate content to spare protein for growth. 60 The observed improved ability of growth hormone-transgenic coho salmon to convert . dietary protein into body protein even when the diet concurrently contained high indigestible carbohydrate (fibre) content suggests that these fish may be able to perform well on diets based on high fibre plant protein or carbohydrate sources such as inexpensive sunflower meal (Gill, 2002) as well as on natural diets high in chitin or ash content (e.g., marine Mysidacea and Mollusca as well as Gastropods, and fresh water amphipods and garhmarids (Higgs et al., 1995)). Improvements in the cost effectiveness of salmon aquaculture could be realized by de-emphasizing the use of expensive premium quality fishmeal to meet a significant portion of the daily protein needs, whereas in nature, the fish conceivably could grow and survive well i f there were shifts in the daily diet composition that involve the inclusion of more prey of reduced digestible energy content. If high fibre plant derived diets are adopted, care should be taken to ensure that the dietary fibre contents should be less than 10% to minimize the adverse effects of formulated diets for Oncorhynchus salmonid species on the environment (Higgs et al., 1995). The whole body proximate compositions of the transgenic and non-transgenic coho salmon in this study followed expected trends. In this regard, the transgenic fish at the start of the experiment had lower lipid but greater moisture content than the non-transgenic fish. These results are concordant with the known lipolytic functions of growth hormone in coho salmon and they also reflect the reduced plane of nutrition of the transgenic fish to achieve similar initial weights between the transgenic and non-transgenic coho salmon (Higgs et al., 1975; Higgs et al., 1976; Markert et al., 1977). Within the transgenic fish at the end of the study, lipid was observed to increase in direct relation with the digestible energy content of the diet (excess energy was deposited as lipid) while percentages of moisture generally followed the reverse trend. The foregoing moisture-lipid relationship and increased lipid content agrees well with data from studies on non-transgenic salmon (Nettleton and Exler, 1992; Hendry et al., 2000; Lee and Kim, 2001; Torstensen et al., 2001; Chan et al., 2002; Bendiksen et al., 2003; Solberg, 2004). In other transgenic and growth hormone-treated fish, there tends to be an increase in feed conversion efficiency, protein synthesis and retention, amino acid transport and quantities, muscle growth, and lipid metabolism (Sun, 1990; Foster and Houlihan, 1991; Chatakondi et al., 1995a; Fauconneau et al., 1996; Fauconneau et al., 1997; Fu et al., 1998; Farmanfarmaian and Sun, 1999; Krasnov et al., 1999b; Cook et al., 2000; Fu et al., 2000; Martinez et al., 2000; Rahman et al., 2001; Dunham et al., 2002). The trend of increased feed efficiency and ability to incorporate protein (possible lipid mobilization) are also seen in growth hormone-transgenic 61 coho salmon. However, in contrast to the findings in the present experiment, other studies have reported decreased or unaffected feed intake and reduced feeding motivation in transgenic fish (Sun, 1990; Guillen et al., 1999; Martinez et al., 2000). Such effects may have resulted from characteristics of the species, the strain or the gene construct utilized. 2.5 Conclusions M y results suggest that juvenile growth-hormone transgenic salmon require > 17 M J of digestible energy /kg diet on diets containing about 22 g of digestible protein/ available MJ for maximum growth. Further, the non-transgenic coho salmon were found to need at least this amount of digestible dietary energy and preferably 19 M J or more/kg diet for best growth. Marked differences were noted between the genotypes in their abilities to not only grow but also convert dietary protein into new body protein with the transgenic fish being far more effective in regard to both performance parameters. Limitations in stomach distention likely prevented the transgenic coho salmon from meeting their daily energy requirements when the dietary digestible energy content was below 17 MJ/kg i.e., at 15 MJ/kg. The excellent ability of transgenic coho salmon to utilize dietary protein and energy for growth across a wide range in dietary digestible energy content may indicate that these fish are efficient at utilizing diets high in fibre (e.g., some sources of inexpensive plant protein) and chitin content and to metabolically utilize digestible carbohydrate for growth. If these hypotheses are proven to be correct in subsequent studies, there could be important benefits such as more cost effective culture of salmon. These findings may also have important ecological implications since the transgenic salmon conceivably could survive better than non-transgenic coho salmon in the ocean environment in situations of suboptimal prey nutrient composition and energy density. 2.6 Acknowledgements I would like to sincerely thank Mahmoud Rowshandeli, Janice Oakes, Geordia Rigter, Paul Fitzpatrick, Carlo Biagi and Wendy Tymchuk for their technical assistance. 62 Table 2.1 Ingredients and proximate compositions of the test diets1 Experimental Diet Ingredients (g/kg) 15 MJ/kg 17 MJ/kg 19 MJ/kg 21 MJ/kg LT-anchovy meal 315.63 350.71 389.68 432.97 Blood flour; spray- dried 31.69 35.22 39.13 43.47 Squid meal 46.15 51.28 56.98 63.32 Krill meal 62.93 69.90 77.68 86.32 Wheat gluten meal 45.97 51.09 56.77 63.07 Pre-gelatinized wheat starch 67.84 76.54 86.17 96.87 2 Vitamin supplement 20.00 20.00 20.00 20.00 3 Mineral Supplement 30.00 30.00 30.00 30.00 Anchovy oil; stabilized 90.75 101.95 114.37 128.20 Soybean lecithin 10.00 10.00 10.00 10.00 Choline chloride (60%) 5.00 5.00 5.00 5.00 Vitamin C, 3.57 3.57 3.57 3.57 monophosphate (42%) cc-cellulose 253.86 177.95 93.66 -Permapell (lignin-sulphonate binder) 10.00 10.00 10.00 10.00 DL-methionine 1.61 1.79 1.9.9 2.21 Chromic oxide 5.00 5.00 5.00 5.00 Total 1 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 Calculated proximate constituents (g/kg) Protein 364.5 405.0. 450.0 500.0 Lipid 145.8 162.0 180.0 200.0 Carbohydrate 92.1 101.4 111.8 123.4 Determined proximate constituents (g/kg) 4 Protein 384.8 404.9 445.4 476.2 Digestible protein5 355.8 372.2 405.2 433.0 Lipid 144.4 160.6 180.3 191.0 Dry Matter 918.8 919.1 918.9 915.2 Ash 83.4 91.9 101.7 111.4 Gross Energy (MJ/kg) 21.6 22.1 22.6 23.3 Digestible energy (MJ/kg)6 15.1 16.8 18.5 20.7 Digestible protein / digestible energy (g/MJ) 23.6 22.1 21.9 20.9 Al l values are on a dry weight basis. 2 Vitamin supplement consisted of (amount/kg dry matter): Ca D-pantothenate, 168.4 mg; pyridoxine-HCl, 49.3 mg; riboflavin, 60 mg, folic acid, 15 mg; thiamine mononitrate, 56 mg; biotin, 1.5 mg; vitamin B ) 2,0.09 mg; vitamin K (as menadione sodium bisulphte), 18 mg (menadione); vitamin E, 300 IU; vitamin D 3 , 2400 IU; vitamin A, 5000 IU; inositol, 400 mg; niacin, 300 mg; BHT, 22 mg. 3 Mineral supplement consisted of (mg/kgdry matter): Mn (as MnSCyH 20), 75 ; Zn (as ZnSCy7H20), 100; Co (as CoCl2-6H20), 3; Cu (as CuSCy5H20), 5; Fe (as FeS04-7H20), 100; I (as KI0 3 and KI, 1:1) 10; F (as NaF), 5; Na (as NaCl), 1000; Se (as Na 2Se0 3), 0.1; Mg (as MgS0 4-7H 20), 400; K (as K 2 S 0 4 , 1055 and as K 2 C 0 3 , 1055). 4 Protein as determined by multiplying % nitrogen x 6.25 5 Digestible protein calculated using the apparent protein digestibility coefficients (ADCP) determined for each diet i.e., ADC values of 92.45, 91.53, 90.96, and 90.96 for the 15, 17, 19 and 21 MJ/kg diets, respectively. 63 Digestible energy calculated using the apparent energy digestibility coefficients (ADCe„) values determined for each diet i.e., 60.94, 76.36, 81.79 and 88.93 for the 15, 17, 19, and 21 MJ/kg diets, respectively. Table 2.2 Growth and percent survival of transgenic and non-transgenic coho salmon on diets with different digestible energy1 Diet Initial Weight2 Final Weight (g)3 Initial Length (g) Final Length (g)3 SGR Weight SGR Length Percent (g) (%/day)3 (%/day)3 Survival4 Transgenic 15MJ/kg 12.8410.04^ 130.62 ±0.97 A 11.1 ±0.02 A 21.4±0.2 A 2.76±0.01 A 0.783 ±0.010A 94.7 17 MJ/kg 13.13 ±0.08 A 145.44 ± 4.76AB 11.1 ± 0.05A 22.2 ± 0.1A B 2.86±0.04 A B 0.825 + 0.006^ 84.0 19 MJ/kg 13.10 ±0.02 A 151.95 ±4.58 B 11.0 ± 0.02A 22.6±0.2 B 2.92±0.03 B 0.855 ± 0.011BC 96.0 21 MJ/kg 13.11 ±0.08 A 159.29 ± 1.34B 11.1 ±0.05 A 23.0 ± 0.1B . 2.97±0.01 B 0.873 ± 0.004c 98.7 Non-transgenic 12.6410.11^ 10.5±0.02B 15 MJ/kg 12.55 ±0.46 a 10.8 ± 0.1a -0.010 ±0.033 a 0.034 ± 0.0063 100 17 MJ/kg 12.65 ±0.07 B 15.43 ± 1.44b 10.5 + 0.02B 11.4 ± 0.2ab 0.227 ±0.101 a b 0.095 ± 0.024ab 100 19 MJ/kg 12.75 ±0.07 B 17.19 ± 1.21bc 10.6±0.02B 11.6 ± 0.1ab 0.350 + 0.084" 0.109 ±0.014 a b 100 21 MJ/kg 12.72 ±0.12 B 19.24 ±0.72 c 10.5±0.03B 12.3 ± 0.3b 0.491 +0.037b 0.182 ±0.027 b 100 1 Al l values are means of three tank means ± SEM. Significant differences are indicated by letter superscripts. 2 Significant differences are determined by a two-way ANOVA in which genotypes differed within the 17, 19 and 21 but not the 15 MJ/kg treatment groups. Diet treatments within each genotype and overall did not differ. 3 Comparisons between genotypes could not be made due to drastic differences in values. The greater sizes or growth rates of the transgenic fish are obvious, and when tested between genotypes (ignoring previous test and diet differences), are significant. 4 Total percent survival of all fish in the diet treatment group after pooling replicate tanks. Table 2.3 Whole body proximate composition of transgenic and non-transgenic coho salmon in relation to diet treatment Component (%) Transgenic Non-transgenic 15 MJ/kg Diet 17 MJ/kg Diet 19 MJ/kg Diet 21 MJ/kg Diet 15 MJ/kg Diet 17 MJ/kg Diet 19 MJ/kg Diet 21 MJ/kg Diet Fish DayO1 Protein 17.66 ± 0.22A 17.94 + 0.12A Lipid 2.08 ± 0.30A 8.11 ± 0.39B Moisture 78.72 ± 0.41A 72.40 ± 0.32B Ash 2.92 ± 0.11A J 2.46 ± 0.06B Fish Day 842 Protein 16.47 ± 0.27ab 16.41 ± 0.27ab 16.57 ± 0.29a 16.11 ± 0.50b 15.39 ± 0.29A 15.52 ± 0.38A 15.30 ± 0.30A 15.23 ± 0.43A Lipid 10/78 ± 0.52" 11.37 ± 0.48ab 12.40 ± 0.28bc 12.43 ± 0.48c 6.57 ± 0.64A 7.65 ± 0.76A 8.20 ± 0.40A 8.55 ± 0.16A Moisture 71.85 ± 0.48a 70.26± 0.37ab 69.40 + 0.39b 69.78 ± 0.32b 73.78 ± 0.54A 73.75 ± 0.80A 73.15 ± 0.37A 73.23 ± 0.19A Ash 1.85 ± 0.06a 1.86 ± 0.09a 1,97 ± 0.06a 1.64 ± 0.08b 2.51 + 0.12A 2.53 ± 0.05A 2.48 ± 0.07A 2.48 ± 0.11A 1 Day 0 proximate constituents are determined for each genotype before feeding different diets and displayed as mean ± SEM, n=5. Each of the five replicates used to determine the mean was a composite sample of two fish. Significant differences are shown with letter superscript differences within each proximate component. Significant differences were not determined between day 0 and day 84 fish proximate constituents. 2 Al l day 84 proximate constituents are displayed as means ± SEM, n = 3. Differences is letter superscripts along a row but within a genotype (transgenic or control) denote a significant difference at P < 0.05 determined from an ANCOVA with weight as a covariate. Comparisons between genotypes were not performed due to the non-normal nature of the weight distribution, and consequently the ANCOVA assumptions were violated. Al l percentages are on a wet weight basis. ON U l 66 A >, 15 "Jo CD D) b cu O) o CU i t c cu LU o o I c 0) CO Q . CL < B >> 15 to cu g> Q ' c "a> o i_ CL c cu L ro a . CL < 95 n 90 H 85 H 80 H 75 H 70 H 65 93.0 -i 92.5 92.0 H c cu :y 91.5 H it= o ° 91.0 90.5 90.0 r2 = 0.99 1 1 1 1 15 17 19 21 Digestible energy of diet (MJ/kg) ^=0.82 15 17 19 21 Digestible energy of diet (MJ/kg) .2 i t c cu CD O g>o O c 5 cu ~ < Q 90 -t 85 H 80 H 75 H 70 H 65 H 60 H 55 1^=0.99 1 1 1 1 15 17 19 21 Digestible energy of diet (MJ/kg) Fig. 2.1. Apparent digestibility coefficients for energy (A), protein (B) and organic matter (C) of fish on diets of different digestible energy. Letter differences denote significant differences. A l l points are means of three replicate tank means with standard error. 67 A 180 - • T-21 160 - • • T-19 T-17 * A / % A 140 - • T-15 //V A B 120 - O • NT-21 NT-19 ////* B 100 - V NT-17 A 80 - o NT-15 jyy Wei 60 -40 -20 -a ab — 0 U 1 0 - 1 1 1— 0 28 56 84 Time (days) B 24 -22 -M. A /fe A B ^ 20 -E o ~ 1 8 -/y/ B cn § 16 -_ i 14 -12 - ^ _ _ ^ = ^ ^ ^ ab 10 - , 0 ^ ^  <> b r — — — i — 0 28 56 84 Time (days) 1.4 - i 0.9 -\ 1 1 1-0 28 56 84 Time (days) Fig. 2.2. Growth measures. (A) Fish weight over the course of the experiment on the 21 MJ/kg diet (21), 19 MJ/kg diet (19), 17 MJ/kg diet (17) and 15 MJ/kg diet (15) for transgenic (T) and non-transgenic (NT) fish. (B) Fish length. (C) Condition factor. Significant differences in values at experiment end, 84 days, are denoted by letter differences. 68 CO C D 200 n 100 -80 -60 -40 -20 H 10 8 6 4H 2H 1< 0.8 0.6 0.4 H 0.2 A 0.1 0.08 0.06 0.04 o- -o-r 2 = 0.01 1^ = 0.09 1^ = 0.02 r 2 = 0.76 O • A V O o T-int 1 T-int 2 T-int 3 T-tot NT-int 1 NT-int 2 NT-int 3 NT-tot 15 17 19 21 Digestible energy of diet (MJ/kg) Fig. 2.3. Total dry feed intake (DFIT) during each interval (int 1-3) and over the entire experiment (tot) for transgenic (T) and non-transgenic (NT) fish on diets of different digestible energy. Each data point is a mean of three replicate tank means with associated standard error. Significant differences in total DFI are denoted by letter differences. The intervals are displayed to emphasize trends. 69 A 3.6 -i 15 17 19 21 Digestible energy of diet (MJ/kg) Digestible energy of diet (MJ/kg) Fig. 2.4. (A) Dry feed intake expressed as % body weight/day (DFI%) during each interval (int 1-3) and over the entire experiment (tot) for transgenic (T) and non-transgenic (NT) fish on each diet. Significant differences between diets are denoted by letter differences over the experiment (tot) with other intervals included to emphasize trends. Points are means of three replicate tank means with standard error for int 1-3. Plotted points for the total (tot) are least squares means from a two-way A N O V A with diet and interval as variables with the LS standard errors of the diet variable. (B) Feed efficiency. Significant differences between diets are denoted by letter differences within each genotype. Comparisons between genotypes are not shown. 70 0.0075 - i 0.0070 0.0065 0.0060 S 0.0055 0.0050 0.0045 LU •5 0.0040 o 0.0015 -f 0.0010 H 0.0005 0.0000 o o A • V NT-int 1 O NT-int 2 O NT-int 3 r2 = 0.53 r2 = 0.73 1 1 1 1 15 17 19 21 Digestible energy of diet (MJ/kg) B 0.0060 -0.0055 -0.0050 -0.0045 -0.0040 -0.0035 -0.0030 - 1 1 1 1 15 17 19 21 Digestible energy of diet (MJ/kg) 0.014 - i 0.013 H 0.012 0.011 H 0.010 T5> 0.009 c CO 2 ± 0.003 H CO o I-0.002 H 0.001 H o.ooo H r2 = 0.50 r2 = 0.72 r2 = 0.94 r2 = 0.74 i — ' 1 1 1 15 17 19 21 Digestible energy of diet (MJ/kg) ' £ ro Q_ .CO ^1^=0.02 s 0.013 -j 0.012 -I 0.011 0.010 H 0.009 0.008 H r2 = 0.14 0.007 1 r 15 17 19 21 Digestible energy of diet (MJ/kg) Fig. 2.5. Energy intake (total (A) and available (B)) and protein intake (total (C) and available (D)) during each interval (int 1-3) and over the entire experiment (tot) for transgenic (T) and non-transgenic fish (NT). Significant differences over the experiment (tot) are denoted by letter differences and determined from a two-way A N O V A with diet and interval as variables. Other intervals are shown to emphasize trends. Points are means of three tank means with associated standard error for int 1-3, and LS means with LS standard errors of diet for the total (tot). 71 A 4 "I r* = 0 . 3 4 0 I A A A A - 8 0 J 1 1 1 1 1 5 1 7 1 9 2 1 Digestible energy of diet (MJ/kg) c CO .o J2 4 2 -to > < 4 0 -I 1 1 1 — i 1 5 1 7 1 9 2 1 Digestible energy of diet (MJ/kg) Fig. 2.6. Protein efficiency ratio (A) and percent protein deposition (B) with available percent protein deposition (C). Significant differences between diet treatments within genotypes are denoted by letter differences. Significant differences between genotypes are not shown. 72 Fig. 2.7. Gross (A) and available (B) energy utilization. Significant differences are denoted by letter differences. Upper error bars only shown for transgenic fish and lower error bars only shown for non-transgenic fish in (A) to avoid obscuring the data points. Differences between genotypes in (A) not shown. 73 2.7 References Austreng, E., Storebakken, T., Torbjorn, A. , 1987. Growth rate estimates for cultured Atlantic salmon and rainbow trout. Aquaculture 60, 157-160. Bendiksen, E.A., Berg, O.K., Jobling, M . , Arnesen, A . M . , Masoval, K. , 2003. Digestibility, growth and nutrient utilisation of Atlantic salmon parr (Salmo salar L.) in relation to temperature, feed fat content and oil source. Aquaculture 224, 283-299. Bligh, G., Dyer, W.J., 1959. A rapid method for total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology 37, 911-927. Bolliet, V. , Cheewasedtham, C , Houlihan, D., Gelineau, A. , Boujard, T., 2000. Effect of feeding time on digestibility, growth performance and protein metabolism in the rainbow trout Oncorhynchus mykiss: Interactions with dietary fat levels. Aquatic Living Resources 13, 107-113. Brett, J.R., Higgs, D.A., 1970. Effect of temperature on the rate of gastric digestion in fingerling sockeye salmon, Onchorynchus nerka. Journal of the Fisheries Research Board of Canada 27,1767-1779. Brett, J.R., Groves, T.D.D., 1979. Physiological Energetics. In: Hoar, W.S., Randall, D.J. (Eds.), Fish Physiology Vol . VIII. Academic Press Inc., New York, pp. 279-351. Chan, J.C.K., Mann, J., Skura, B.J., Rowshandeli, M . , Rowshandeli, N . , Higgs, D.A., 2002. Effects of feeding diets containing various dietary protein and lipid ratios on the growth performance and pigmentation of post-juvenile coho salmon Oncorhynchus kisutch reared in sea water. Aquaculture Research 33,1137-1156. Chatakondi, N . , Lovell, R.T., Duncan, P.L., Hayat, M . , Chen, T.T., Powers, D.A., Weete, J.D., Cummins, K. , Dunham, R.A., 1995. Body composition of transgenic common carp, Cyprinus carpio, containing rainbow trout growth hormone gene. Aquaculture 138, 99-109. Cho, C.Y., Cowey, C.B., Watanabe, T., 1985. Finfish nutrition in Asia: methodological approaches to research and development. IDRC, Ottawa, 154 pp. Cook, J.T., McNiven, M.A. , Richardson, G.F., Sutterlin, A . M . , 2000. Growth rate, body composition and feed digestibility/conversion of growth-enhanced transgenic Atlantic salmon (Salmo salar). Aquaculture 188, 15-32. Devlin, R.H., Biagi, C.A., Yesaki, T.Y., 2004a. Growth, viability and genetic characteristics of GH transgenic coho salmon strains. Aquaculture 236, 607-632. 74 Devlin, R.H., D'Andrade, M . , Uh, M . , Biagi, C.A.^ 2004b. Population effects of growth hormone transgenic coho salmon depend on food availability and genotype by environment interactions. Proceedings of the National Academy of Sciences 101, 9303-9308. Devlin, R.H., Yesaki, T.Y., Donaldson, E.M.', Du, S.J., Hew, C.L., 1995. Production of germline transgenic Pacific salmonids with dramatically increased growth performance. Canadian Journal of Fisheries and Aquatic Sciences 52, 1376-1384. Devlin, R.H., Yesaki, T.Y., Biagi, C.A., Donaldson, E .M. , Swanson, P., Chan, W.-K., 1994. Extraordinary salmon growth. Nature 371, 209-210. Devlin, R.H., Johnsson, J.I., Smailus, D.E., Biagi, C.A., Jonsson, E., Bjornsson, B.T., 1999. Increased ability to compete for food by growth hormone-transgenic coho salmon Oncorhynchus kisutch (Walbaum). Aquaculture Research 30, 479-482. Devlin, R.H., Swanson, P., Clarke, W.C., Plisetskaya, E., Dickhoff, W., Moriyama, S., Yesaki, T.Y., Hew, C.L., 2000. Seawater adaptability and hormone levels in growth-enhanced transgenic coho salmon, Oncorhynchus kisutch. Aquaculture 191, 367-385. Du, S.J., Gong, Z., Fletcher, G.L., Shears, M.A. , King, M.J. , Idler, D.R., Hew, C.L., 1992. Growth enhancement in transgenic Atlantic salmon by the use of an "all fish" chimeric growth hormone gene construct. Bio/technology 10, 176-181. Dunham, R.A., Chatakondi, N . , Nichols, A.J . , Kucuktas, H. , Chen, T.T., Powers, D.A., Weete, J.D., Cummins, K. , Lovell, R.T., 2002. Effect of rainbow trout growth hormone complementary D N A on body shape, carcass yield, and carcass composition of F l and F2 transgenic common carp {Cyprinus carpio). Marine Biotechnology 4, 604-611. Einen, O., Waagan, B. , Thomassen, M.S., 1998. Starvation prior to slaughter in Atlantic salmon {Salmo salar). I. Effects on weight loss, body shape, slaughter- and fillet-yield, proximate and fatty acid composition. Aquaculture 166, 85-104. Fagerlund, U.H.M. , Higgs, D.A., McBride, J.R., Plotnikoff, M.D. , Dosanjh, B.S., Markert, J.R., 1983. Implications of varying dietary protein, lipid, and 17 a-mefhyltestosterone content on growth and utilization of protein and energy in juvenile coho salmon {Oncorhynchus kisutch). Aquaculture 30, 109-124. Farmanfarmaian, A. , Sun, L.-Z. , 1999. Growth hormone effects on essential amino acid absorption, muscle amino acid profile, N-retention and nutritional requirements of striped bass hybrids. Genetic Analysis: Biomolecular Engineering 15, 107-113. 75 Fauconneau, B., Mady, M.P., LeBail, P.Y., 1996. Effect of growth hormone on muscle protein synthesis in rainbow trout (Onchorynchus mykiss) and Atlantic salmon (Salmo salar). Fish Physiology and Biochemistry 15, 49-56. Fauconneau, B., Andre, S., Chmaitilly, J., Le Bail, P.-Y., Krieg, F., Kaushik, S.J., 1997. Control of skeletal muscle fibres and adipose cells size in the flesh of rainbow trout. Journal of Fish Biology 50,296-314. Fenton, T.W., Fenton, M . , 1979. An improved procedure for determination of chromic oxide in feed and feces. Canadian Journal of Animal Science 59, 631-639. Foda, A. , 1974. Seasonal variations in proximate composition of hatchery-reared Atlantic ' . salmon, Technical Report Series No. MAR/T-74-2. Resource Development Branch, Fisheries and Marine Service, Department of the Environment, Halifax, Nova Scotia, pp. 12. Forster, I., Higgs, D.A., Bell, G.R., Dosanjh, B.S., March, B.E., 1988. Effect of diets containing herring oil oxidized to different degrees on growth and immunocompetence of juvenile coho salmon (Oncorhynchus kisutch). Canadian Journal of Fisheries and Aquatic Sciences 45, 1988. Foster, A.R., Houlihan, D.F., 1991. The effect of ovine growth hormone on protein turnover in rainbow trout. General and Comparative Endocrinology 82, 111-120. Fu, C , Cui, Y . , Hung, S.S.O., Zhu, Z., 1998. Growth and feed utilization by F4 human growth hormone transgenic carp fed diets with different protein levels. Journal of Fish Biology 53,115-129. Fu, C , Cui, Y . , Hung, S.S.O., Zhu, Z., 2000. Whole-body amino acid pattern of F4 human growth hormone gene-transgenic red common carp (Cyprinus carpio) fed diets with different protein levels. Aquaculture 189, 287-292. Gi l l , N . , 2002. Effect of varying concentrations of partially dehulled and extruded sunflower meal on growth performance and sensory attributes of post-juvenile Atlantic salmon (Salmo salar). University of British Columbia, Vancouver, pp. 186. Glencross, B.D., Carter, C.G., Duijster, N . , Evans, D.R., Dods, K. , McCafferty, P., Hawkins, W.E., Maas, R., Sipsas, S., 2004. A comparison of the digestibility of a range of lupin and soybean protein products when fed to either Atlantic salmon (Salmo salar) or rainbow trout (Oncorhynchus mykiss). Aquaculture 237, 333-346. Grisdale-Helland, B., Helland, S.J., 1997. Replacement of protein by fat and carbohydrate in diets for Atlantic salmon (Salmo salar) at the end of the freshwater stage. Aquaculture 152,167-180. Guillen, I., Berlanga, J., Valenzuela, C., Morales, A. , Toledo, J., Estrada, M . , Puentes, P., Hayes, O., J, d.l.F., 1999. Safety Evaluation of Transgenic Tilapia with Accelerated Growth. Marine Biotechnology 1, 2-14. Haard, N.F., Dimes, L.E. , Arndt, R.E., Dong, F .M. , 1996. Estimation of protein digestibility: IV. Digestive proteinases from the pyloric caeca-of coho salmon (Oncorhynchus kisutch) fed diets containing soybean meal. Comparative Biochemistry & Physiology - B : Comparative Biochemistry 115, 533-540. Hajen, W.E., Beames, R . M . , Higgs, D.A., Dosanjh, B.S., 1993a. Digestibility of various feedstuffs by post-juvenile chinook salmon (Onchorynchus tshawytscha) in sea water. 1. Validation of technique. Aquaculture 112, 321-332. Hajen, W.E., Higgs, D.A. , Beames, R .M. , Dosanjh, B.S., 1993b. Digestibility of various feedstuffs by post-juvenile chinook salmon (Onchorynchus tshawytscha) in sea water. 2. Measurement of digestibility. Aquaculture 112, 333-348. Hemre, G.-L, Sandnes, K. , Lie, O., Torrissen, O., Waagboe, R., 1995. Carbohydrate nutrition in Atlantic salmon, Salmo salar L. : Growth and feed utilization. Aquaculture Research 26, 149-154. Hendry, A.P., Dittman, A . H . , Hardy, R.W., 2000. Proximate Composition, Reproductive Development, and a Test for Trade-Offs in Captive Sockeye Salmon. Transactions of the American Fisheries Society 129,1082-1095. Higgs, D.A., Donaldson, E .M. , Dye, H .M. , McBride, J.R., 1975. A preliminary investigation of the effect of bovine growth hormone on growth and muscle composition of coho salmon (Oncorynchus kisutch). General and Comparative Endocrinology 27, 240-253. Higgs, D.A., Donaldson, E .M. , Dye, H .M. , McBride, J.R., 1976. Influence of bovine growth hormone and L-thyroxine on growth, muscle composition and histological structure of the gonads, thyroid, pancreas and pituitary of coho salmon (Oncorhynchus kisutch). Journal of the Fisheries Research Board of Canada 33,1585-1603. Higgs, D.A., MacDonald, J.S., Levings, C D . , Dosanjh, B.S., 1995. Nutrition and Feeding Habits in Relation to Life History Stage. In: Groot, C , Margolis, L. , Clarke, W.C. (Eds.), Physiological Ecology of Pacific Salmon. U B C Press, Vancouver, pp. 161-315. Higgs, D.A., Markert, J.R., MacQuarrie, D.W., McBride, J.R., Dosanjh, B.S., Nichols, C , Hoskins, G., 1979. Development of practical dry diets for coho salmon, Oncorhynchus kisutch using poultry-by-product meal, feather meal, soybean meal and rapeseed meal as major protein sources. In: Halver, J.E., Tiews, K. (Eds.), Finfish Nutrition and Fishfeed Technology. Heenemann Verlagsgesellschaft MbH, Berlin, pp. 191-218. Hillestad, M . , Johnsen, F., 1994. High-energy/low-protein diets for Atlantic salmon: Effects on growth, nutrient retention and slaughter quality. Aquaculture 124, 109-116. Hillestad, M . , Johnsen, F., Asgard, T., 2001. Protein to carbohydrate ratio in high-energy diets for Atlantic salmon (Salmo salar L.). Aquaculture Research 32, 517-529. Hinits, Y . , Moav, B., 1999. Growth performance studies in transgenic Cyprinus carpio. Aquaculture 173, 285-296. Horwitz, W., 2000. Official methods of analysis of A O A C International, 17th Edition, Chapter 4, pp. 5. Jobling, M . , 1994. Fish bioenergetics. Chapman and Hall, London. Johansen, S.J.S., Ekli, M . , Jobling, M . , 2002. Is there lipostatic regulation of feed intake in Atlantic salmon Salmo salar L.? Aquaculture Research 33, 515-524. Johansen, S.J.S., Ekli , M . , Stangnes, B. , Jobling, M . , 2001. Weight gain and lipid deposition in Atlantic salmon, Salmo salar, during compensatory growth: Evidence for lipostatic regulation? Aquaculture Research 32, 963-974. Krasnov, A. , Agren, J.J., Pitkanen, T.I., Molsa, H. , 1999. Transfer of growth hormone (GH) transgenes into Arctic chart (Salvelinus alpinus L.): II. Nutrient partitioning in rapidly growing fish. Genetic Analysis: Biomolecular Engineering 15, 99-105. Lee, S.M., Kim, K.D. , 2001. Effects of dietary protein and energy levels on the growth, protein utilization and body composition of juvenile masu salmon (Oncorhynchus masou Brevoort). Aquaculture Research 32, 39-45. Lu, J.-K., Fu, B.-H. , Wu, J.-L., Chen, T.T., 2002. Production of transgenic silver sea bream (Sparus sarba) by different gene transfer methods. Marine Biotechnology 4, 328-337. Markert, J.R., Higgs, D.A., Dye, H . M . , MacQuarrie, D.W., 1977. Influence of bovine growth hormone on growth rate, appetite, and food conversion of yearling coho salmon (Onchorynchus kisutch) fed two diets of different composition. Canadian Journal of Zoology 55, 74-83. Markert, J.R., Higgs, D.A., MacQuarrie, D., McBride, J.R., Dosanjh, B.S., Van Tine, J., Reinhardt, R., 1984. Evaluation of the potential for using dry rather than semi-moist 78 food for culturing coho salmon in British Columbia hatchery facilities. 2. Quinsam Hatchery 1977 brood. No. 1260, Can. Tech. Rep. of Fish. Aquat. Sci., pp. 37. Martinez, R., Juncal, J., Zaldivar, C , Arenal, A. , Guillen, I., Morera, V. , Carrillo, O., Estrada, M . , Morales, A. , Estrada, M.P., 2000. Growth efficiency in transgenic tilapia (Oreochromis sp.) carrying a single copy of an homologous cDNA growth hormone. Biochemical & Biophysical Research Communications 267, 466-472. McCallum, I.M., Higgs, D.A., 1989. A n Assessment of Processing Effects on the Nutritive value of Marine Protein Sources for Juvenile Chinook Salmon (Onchorynchus tshawytscha). Aquaculture 77, 181-200. Metcalfe, N.B. , Thorpe, J.E., 1992. Anorexia and Defended Energy Levels in over-Wintering Juvenile Salmon. Journal of Animal Ecology 61,175-181. Millikin, M.R., 1982. Qualitative and quantitative nutrient requirements of fishes: A review. Fisheries Bulletin 80, 655-686. Morales, R., Herrera, M.T., Arenal, A . , Cruz, A. , Hernandez, O., Pimentel, R., Guillen, I., Martinez, R., Estrada, M . , 2001. Tilapia chromosomal growth hormone gene expression accelerates growth in transgenic zebrafish (Danio rerio). EJB: Electronic Journal of Biotechnology 4, 1-7. Mori, T., Devlin, R.H., 1999. Transgene and host growth hormone gene expression in pituitary and nonpituitary tissues of normal and growth hormone transgenic salmon. Molecular & Cellular Endocrinology 149, 129-139. Morris, P.C., Beattie, C , Elder, B. , Finlay, J., Gallimore, P., Jewison, W., Lee, D., MacKenzie, K. , McKinney, R., Sinnott, R., Smart, A . , Weir, M . , 2003. Effects of the timing of the introduction of feeds containing different protein and lipid levels on the performance and quality of Atlantic salmon, Salmo salar, over the entire seawater phase of growth. Aquaculture 225, 41-65. Nam, Y . K . , Noh, J.K., Cho, Y.S. , Cho, H.J., Cho, K . - N . , Kim, C.G., Kim, D.S., 2001. Dramatically accelerated growth and extraordinary gigantism of transgenic mud loach Misgurnus mizolepis. Transgenic Research 10, 353-362. Nettleton, J.A., Exler, J., 1992. Nutrients in wild and farmed fish and shellfish. Journal of Food Science 57, 257-260. NRC, 1993. Nutrient Requirements of Fish. National Academy Press, Washington, D . C , 114 pp. Pitkanen, T.I., Krasnov, A. , Teerijoki, H. , Molsa, H. , 1999. Transfer of growth hormone (GH) transgenes into Arctic charr (Salvelinus alpinus L.): I. Growth response to various G H constructs. Genetic Analysis: Biomolecular Engineering 15, 91-98. Rahman, M.A . , Maclean, N . , 1999. Growth performance of transgenic tilapia containing an exogenous piscine growth hormone gene. Aquaculture 173, 333-346. Rahman, M.A. , Mak, R., Ayad, H. , Smith, A. , Maclean, N . , 1998. Expression of a novel piscine growth hormone gene results in growth enhancement in transgenic tilapia (Oreochromis niloticus). Transgenic Research 7, 357-369. Rahman, M.A. , Ronyai, A . , Engidaw, B.Z., Jauncey, K. , Hwang, G.L., Smith, A. , Roderick, E., Penman, D., Varadi, L., Maclean, N . , 2001. Growth and nutritional trials on transgenic Nile tilapia containing an exogenous fish growth hormone gene. Journal of Fish Biology 59, 62-78. Reinitz, G., 1983. Relative effect of age, diet and feeding rate on the body composition of young rainbow trout (Salmo gairdneri). Aquaculture 35, 19-27. Richardson, N.L . , Higgs, D.A., Beames, R .M. , McBride, J.R., 1985. Influence of dietary calcium, phosphorus, zinc and sodium phytate level on cataract incidence, growth, and histopathology in juvenile chinook salmon (Oncorhynchus tshawytscha). Journal of Nutrition 115, 553-567. Shearer, K.D. , Maage, A . , Opstvedt, J., Mudheim, H. , 1992. Effects of high-ash diets on growth, feed efficiency, and zinc status of juvenile Atlantic salmon (Salmo salar). Aquaculture 106, 345-355. Shearer, K.D. , Asgard, T., Andorsdottir, G., Aas, G.H., 1994. Whole body elemental and proximate composition of Atlantic salmon (Salmo salar) during the life cycle. Journal of Fish Biology 44, 785-797. Solberg, C., 2004. Influence of dietary oil content on the growth and chemical composition of Atlantic salmon (Salmo salar). Aquaculture Nutrition 10, 31-37. Stevens, E.D., Devlin, R.H., 2000. Intestinal morphology in growth hormone transgenic coho salmon. Journal of Fish Biology 56, 191-195. Stevens, E.D., Devlin, R.H., 2005. Gut size in GH-transgenic coho salmon is enhanced by both the GHtransgene and increased food intake. Journal of Fish Biology 66, 1633—1648. Stevens, E.D., Wagner, G.N., Sutterlin, A . M . , 1999. Gut morphology in growth hormone transgenic Atlantic salmon. Journal of Fish Biology 55, 517-526. 80 Sun, L., 1990. Effect of bovine growth hormone on fish growth and intestinal amino acid absorption, Diss. Abst. Int. Pt. B - Sci. & Eng., pp. 172. Sundstrom, L.F., Lohmus, M . , Devlin, R.H., 2004a. Growth hormone transgenic salmon pay for growth potential with increased predation mortality. Proc. R. Soc. Lond. B (Suppl.), Biology Letters 271, S350-S352. Sundstrom, L.F., Devlin, R.H., Johnsson, J.I., Biagi, C.A., 2003. Vertical position reflects increased feeding motivation in growth hormone transgenic coho salmon (Oncorhynchus kisutch). Ethology 109, 701-712. Sundstrom, L.F., Lohmus, M . , Devlin, R.H., Johnsson, J.I., Biagi, C.A., Bohlin, T., 2004b. Feeding on profitable and unprofitable prey: Comparing behaviour of growth-enhanced transgenic and normal coho salmon (Oncorhynchus kisutch). Ethology 110, 381-396. Torstensen, B.E., Lie, O., Hamre, K. , 2001. A factorial experimental design for investigation of effects of dietary lipid content and pro- and antioxidants on lipid composition in Atlantic salmon (Salmo salar) tissues and lipoproteins. Aquaculture Nutrition 7, 265-276. Vanstone, W.E., Markert, J.R., 1968. Some Morphological and Biochemical Changes in Coho Salmon, Onchorynchus kisutch, During Parr-Smolt Transformation. Journal of the Fisheries Research Board of Canada 25, 2403-2418. Weathercup, R.N. , McCracken, K.J . , Foy, R., Rice, D., McKendry, J., Mairs, R.J., Hoey, R., 1997. The effects of dietary fat content on the performance and body composition of farmed rainbow trout (Onchorynchus mykiss). Aquaculture 151, 173-184. 81 CHAPTER 3 Gene expression of growth hormone-regulating and appetite-regulating peptides in the brain of growth hormone transgenic and non-transgenic coho salmon, Oncorhynchus kisutch. 3.1 Introduction The increased feed intake and enhanced growth found in growth hormone (GH) transgenic coho salmon, Oncorhynchus kisutch, raises questions regarding the hormonal changes that mediate these physiological traits. The enhanced growth rate in these fish results from centrally uncontrolled G H production by an all-fish G H transgene present throughout the body tissues (Devlin et al., 1994; Devlin et al., 2004a). Concurrent increases in appetite and feed intake result in altered feeding behaviour (and other behaviours such as reduced predator awareness) and allow for rapid development and maturation (Devlin et al., 1999; Devlin et al., 2000; Sundstrom et al., 2003; Devlin et al., 2004a; Sundstrom et al., 2004a). However, the precise hormonal and neuroendocrine mechanisms controlling increased G H production and associated appetite in these fish are unknown. Circulating levels of hormones involved in growth hormone control, the G H axis, have been examined (Mori and Devlin, 1999; Devlin et al., 2000), but brain and pituitary expression of genes encoding these hormones, with the exception of G H (Mori and Devlin, 1999), have not been analyzed. Furthermore, it is unknown how the GH-axis in transgenic coho salmon responds to changes in dietary energy and the potential impact this may have on appetite. Growth hormone production by somatotrophs in the pituitary is regulated both by the hypothalamus and by circulating hormones. Growth hormone-releasing hormone (GHRH), produced by the hypothalamus, is the main stimulator of G H release while somatostatin (SS, or somatotropin-release inhibitory factor, SRIF) and neuropeptide Y (NPY), inhibit it (Hurley and Phelps, 1992; Uchiyama et al., 1994; Minami et al., 1998; Peng et al., 2001). Growth is thought to be mediated primarily by liver-derived insulin-like growth factor I (IGF-I) in response to G H binding to liver growth hormone receptors (GHRs)(Bartke et al., 1994; Al-Regaiey et al., 2005). Both circulating G H and IGF-I can negatively feedback on G H R H and SS neurons in the hypothalamus, and on somatotrophs in the pituitary to reduce endogenous G H production (Mathews et al., 1988b; Wallenius et al., 2001). Gene expression of hormones in the G H axis has been characterized in many fish species, but to my knowledge no studies have analyzed the G H axis in a G H transgenic fish. 82 In non-transgenic fish, the way the G H axis is regulated is similar to that seen in mammals. G H R H stimulates G H release from teleost pituitary cells (Luo and McKeown, 1991; Parker et al., 1997) and G H R H injection causes an increase in circulating G H (Melamed et al., 1995; Kelly et al., 1996; Shepherd et al., 2000). Unlike mammals, G H R H is encoded in the same gene as another GH-releasing peptide, pituitary adenylate cyclase-activating polypeptide (PACAP) (Parker et al., 1993). Both these peptides have potent G H releasing effects and in some cases P A C A P may be more effective at stimulating a GH response (Parker et al., 1997). Somatostatin inhibits pituitary G H release in many fish species (Luo and McKeown, 1991; Lin et al., 1993; Melamed et al., 1995; Lescroart et al., 1996; Kwong and Chang, 1997; Parker et al., 1997) and SS injection reduces plasma G H levels (Cook and Peter, 1984; Melamed et al., 1995; Very et al., 2001). Generally, growth hormone increases GHR expression but the response is tissue specific likely due to the presence of two forms of GHR (Saera-Vila et a l , 2005; Very et al., 2005). IGF-1 increases in response to G H addition to teleost hepatocyte cultures, or as in-vivo G H injections (Foucher et al., 1992; Shimizu et al., 1999; Pierce et al., 2004). Neuropeptide Y (NPY) is also involved in appetite regulation. N P Y is a known orexigen (Silverstein and Plisetskaya, 2000), countered in part by the satiety signal from the octapeptide, cholecystokinin (CCK), which is produced by the gut and brain (Peyon et al., 1999; Gelineau and Boujard, 2001). During starvation, N P Y mRNA increases in salmon (Silverstein et al., 1996), and intracerebroventricular injections of N P Y increase food intake by 45% to 100% in the catfish (Silverstein and Plisetskaya, 2000). Fasting increases brain N P Y mRNA expression in the gold fish while refeeding returns expression to a lower level (Narnaware and Peter, 2001a; Volkoff et al., 2003). Conversely, C C K injections caused a decrease in food consumption in the catfish (Silverstein and Plisetskaya, 2000) and C C K receptor antagonists increased feed intake in rainbow trout and removed the satiation affects of C C K addition in the goldfish (Gelineau and Boujard, 2001; Volkoff et al., 2003). Cholecystokinin may also be involved in regulating the GH-axis. C C K neuronal terminals have been found to synapse with somatotrophs in the pituitary of at least three teleost species (Moons et al., 1989; Batten et al., 1990; Peter, 1997). Furthermore, central and peripheral administration of C C K reduces preprosomatostatin-I mRNA expression in the gold fish brain (Canosa and Peter, 2004). A further connection between the GH-axis and food intake exists through G H , IGF-I and GHR. Reduced feed intake or starvation causes decreases in plasma IGF-I or liver IGF-I mRNA expression in chinook salmon (Pierce et al., 2005b) and coho salmon (Duan and Plisetskaya, 1993; Shimizu et al., 1999; Pierce et al., 2001). This decrease with starvation often coincides 83 with an increase in plasma G H due to the development of G H resistance by the liver and the uncoupling of IGF-I responsiveness from G H expression (Narnaware and Peter, 2001a; Valente et al., 2003; Pierce et al., 2004). G H resistance results from decreases in hepatic GHR expression after fasting (Fukada et al., 2004; Saera-Vila et al., 2005). Salmon with stunted growth but high circulating G H have low IGF-I mRNA in the liver and low IGF-I protein, which may cause the apparent increases in G H due to the lack of IGF-I feedback (Duan et al., 1995; reviewed by Dickhoff et al., 1997). In most cases refeeding will restore plasma IGF-I, IGF-I mRNA expression and subsequently growth (Duan and Plisetskaya, 1993; Meton et al., 2000). The objective of my first study was to determine the expression patterns of the hormones responsible for G H regulation in the brains of G H transgenic coho salmon raised in two culture conditions. One group of transgenic coho salmon was fed a full ration and one group was fed a restricted ration equivalent to the full ration of non-transgenic coho salmon (pair-fed). Messenger R N A expression of G H , GHR, GHRH, SS, IGF-I and C C K was measured in six brain regions that consisted of the telencephalon, optic tectum, midbrain, hypothalamus, pituitary and cerebellum, in addition to muscle and liver. Direct comparisons of gene expression with non-transgenic coho salmon allowed me to determine how the GH-axis likely responded to increased levels of G H and i f any of the apparent changes coincided with those suspected to influence appetite. As mRNA expression has been found to respond to both hormone and diet manipulation for many of these hormones (Duan et al., 1992; Duguay et al., 1994; Uchiyama et al., 1994; Pellegrini et al., 1997; Peyon et al., 1999; Fukada et al., 2004; Pierce et al., 2004; Saera-Vila et al., 2005), expression analysis will in most cases indicate changes to protein production and subsequently physiology. The second study investigated the expression levels of the above hormones in similar brain regions of transgenic coho salmon from the experiment outlined in Chapter 2; specifically those fish fed the extremes of the energy-varied diets (i.e. 21 MJ/kg and 15 MJ/kg diets). The goal was to determine how the expression patterns of my hormones of interest changed between fish with different dietary energy intake. Using these expression patterns I hoped to determine i f G H transgenic coho salmon responded normally to changes in dietary energy intake and whether the hormonal control of appetite through C C K expression was operating properly in these fish. 84 3.2. Materials and Methods 3.2.1 Fish Culture and Sampling 3.2.1.1 Trial 1: Transgenic, ration-restricted transgenic, and non-transgenic samples Transgenic (OnMTGHl) coho salmon and non-transgenic Chehalis River broodstock were raised on a simulated natural photoperiod (Vancouver, Canada, 49 0 15' N 123 0 10' W) in separate 2935 L tanks supplied with 8-11 °C well water. One tank of transgenic fish was fed to satiation twice a day with commercial fish feed (T-Full) (Skretting Canada, Vancouver, BC) for 9 months until reaching a mean body weight of approximately 55g. The non-transgenic fish were fed twice a day to satiation for 21 months to reach the same weight (NT-Full). Another group of transgenic coho salmon were pair-fed a ration equivalent to the amount consumed by the non-transgenic fish for 21 months to maintain an equivalent growth rate (T-Restricted). Thus, all fish were size matched at the time of sampling (overall weight 55.5 ± 1.2 g, mean ± SE). Over three days, 11 randomly-selected fish/day were obtained serially from each group in turn and euthanized in tricane methane sulphonate (0.2 g MS 222/L), weighed, measured, and rapidly team-sampled for muscle, liver and brain tissue. The telencephalon was extracted prior to the remainder of the brain being removed to cooled 0.2 M phosphate buffered saline and divided into the 1) hypothalamus (containing the saculous venosus), 2) optic tectum, 3) cerebellum and 4) remainder of the brain (midbrain). The pituitary was removed from the cavity under the brain, yielding a total of eight tissues for analysis. A l l tissues were immediately frozen in liquid nitrogen following dissection and stored at -80 °C. It should be noted that the work prior to this point was conducted by Dr. Devlin and technical personnel associated with his lab prior to initiation of my thesis research. 3.2.1.2 Trial 2: Transgenic samples from fish raised on different energy diets Fish were raised as described in Chapter 2. During the end of the digestibility study (refer to Chapter 2), 15 of each of the transgenic groups fed the 15 MJ/kg and 21 MJ/kg diets were serially sampled for blood and brain tissue in the same manner as described in Trial 1. A l l fish were fed the afternoon prior to sampling. Euthanization and brain dissection were performed as described for Trial 1 with the exception that all brain regions were placed in RNAlater (Ambion) and left for one afternoon at room temperature before being stored at -80 °C. Before the brain regions were placed into Trizol reagent for R N A extraction, part of the midbrain was dissected and added to the hypothalamus so that the hypothalamus samples contained the 85 same tissue regions as isolated in Trial 1. The brain regions from 12 of the 15 fish sampled for each diet treatment were processed as described below. Plasma IGF-I concentrations were determined using an I 1 2 5 radioimmunoassay (GrowPep IGF-I Fish Kit) as described by the manufacturer and measured in a gamma counter (1272 Clinigamma, L K B Wallac). 3.2.2 RNA Extraction and cDNA Synthesis A l l frozen brain tissues (Trial 1) and only transgenic samples from RNAlater (Trial 2) were placed in Trizol reagent (Invitrogen) and immediately homogenized using a micropestle. The recommended Trizol procedure was followed with the addition of 2 u-g muscle glycogen as a carrier to the brain and pituitary extractions before isopropanol precipitation. The RNA pellet was dissolved in RNAse free water (Gibco, ultraPURE) and quantified by mass spectrophotometry (Milton Roy, Spectronic 1001 Plus) before being diluted to 500 ng/uL to be used in reverse transcription reactions. R N A samples were stored at -80 °C and were kept on ice during use to minimize R N A degradation. Complementary D N A was synthesized using the Multiscribe Reverse Transcriptase Kit (Applied Biosystems) with Oligo-d(T) primer and 500 ng RNA. A second set of cDNA was produced using a gene specific reverse primer for salmon growth hormone (GH4R, Table 3.1), and 250 ng R N A . Additional reverse transcription reactions (Oligo-d(T) and GH4R) were performed using randomly selected samples of each brain region to combine and make two cDNA standards. It should be noted that cDNA for the brain regions from 11 fish were available for the NT-Full and T-Restricted groups and 10 fish were available for the T-Full group. Muscle and liver samples were extracted by Mitchell Uh (a technician in the Devlin lab) who analyzed them by quantitative PCR (Q-PCR) for GH, GHR, IGF-1, B-actin, myosin and albumin mRNA expression prior to brain analysis. The proper tissue specific expression of myosin and albumin confirmed the success of the Q-PCR design and procedure (Fig. 3.2E,F). 3.2.3 Quantitative PCR 3.2.3.1 Assay design Primers for GHRH, and C C K were determined from alignments of teleost cDNA sequences from GenBank and used to amplify coho salmon cDNA (GenBank # used for alignments: GHRH: #X73233, AF343976, AF343977; C C K : #AJ011846, AJ012056, AJ012055). Prospective amplicons were inserted into pCRII-TOPO vectors (Invitrogen) and incorporated into OneShot chemically competent E. coli cells (Invitrogen). Colonies were 86 plated and screened and vectors with successfully incorporated transcripts were extracted with the QIAprep Spin Miniprep Kit (Qiagen). D N A inserts were sequenced on an A B I Prism 310 Genetic Analyzer (Applied Biosystems). Gene sequences were then compared to other teleost GenBank sequences to confirm gene identity. Quantitative PCR primers and TaqMan M G B probes (Applied Biosystems) were designed from the newly determined coho salmon gene sequences (Table 3.1). SS primers and probe were designed directly from rainbow trout, Onchorynchus mykiss, cDNA (Genbank#: U32471). Furthermore, previously designed quantitative PCR assays for (3-actin, GH, IGF-I and GHR were used (Table 3.1). 3.2.3.2 Trial 1 Samples were run on 96 well plates in an A B I Prism 7000 Sequence Detection System (Applied Biosystems) with the proper cDNA standards (Oligo-d(T) for all assays except G H which uses the GH4R standard). Average PCR efficiencies were as follows: B-actin, 97.6%; GH, 99.2%; GHR, 97.4%; IGF-I, 97.4%; GHRH, 98.9%; SS, 96.5%; C C K , 97.7%. Three samples from one plate were run on all plates used in the same gene assay to standardize between plates. Relative quantities determined on a plate were corrected for changes in the standardized samples before analysis to reduce inter-plate variability (standard sample quantity on plate of interest / standard sample quantity from initial plate • experimental sample on plate of interest). Following correction for interplate variability, quantities were divided by the P-actin quantity for that sample to correct for variation between cDNA reactions and to yield a relative ratio of gene expression. Because all tissue types were run together on each plate, comparisons can be made between treatment groups within each brain region and between brain regions. The exception to this was the G H assay on pituitaries in which expression was too high to standardize to that of other brain regions. A new cDNA Oligo-d(T) standard was reverse transcribed from the same samples as the previous standard for use in 9 plates in assays using the original standard (5 C C K , 1 IGF-I, 1 GHR and 2 B-actin plates). Brain totals were determined by assigning the gene expression ratio of the NT-Full group to 1 (0.01 for GH) and the expression of the T-Full and T-Restricted groups as a multiple of NT-Full for each tissue before averaging all tissues within an assay (not including the pituitary). 3.2.3.3 Trial 2 The procedure in Trial 2 was similar to Trial 1 with the exception that all samples for each brain region within each gene assay were run on 1, or in some cases 2, plates to reduce 87 inter-plate variability. Therefore, comparisons between tissues cannot be as reliably made. Furthermore, only selected brain regions that showed differences in Trial 1 were analyzed in Trial 2. Average PCR efficiencies for Trial 2 were as follows: B-actin, 99.4%; GH, 99.2%; GHR, 99.4%; IGF-I, 98.7%; GHRH, 99,5%; SS, 98.8%; C C K , 99.3%. 3.2.4 Statistics Statistical differences were determined in Trial 1 using a one-way analysis of variance (ANOVA, Sigma Stat v. 3.0, SPSS Inc.) on treatment group within each brain region and gene assay. Non-normally distributed data were Ln or Log transformed. Two-way A N O V A was not possible in most cases due to the inability of the expression data to be normalized between tissues with any transformation and the resultant violation of A N O V A assumptions. Correlations were performed with a Pearson product moment correlation analysis or a non-parametric Spearman rank correlation analysis. In Trial 2 mRNA expression and plasma IGF-I concentrations were compared using t-tests and Mann Whitney U tests. Samples with low R N A expression at the level in which repeats within a 0.5 Ct difference could not be obtained were removed from statistical analysis. Significance was determined at p < 0.05. 3.3 Results 3.3.1 Trial 1 Within each brain region some samples showed expression that was too low to accurately quantify and were removed from analysis, although amplification was seen in brain regions for all the genes tested using the present assays. As anticipated from the known pituitary-dominant expression of GH, expression was low for G H in all NT-Full fish brain regions except the hypothalamus, but these results are included in Fig. 3.1 for comparison. In the G H assay, no amplification was seen in the liver of NT-Full fish, 5 samples were removed from analysis in the T-Full cerebellum and 1 cerebellum sample, 1 muscle and 2 liver samples were removed from the T-Restricted group. The GHR assay had 1 liver sample removed from the NT-Full group and 1 muscle and 2 liver samples removed from the T-Restricted group. In IGF-1, 2 pituitary, 1 liver and 1 cerebellum samples were removed from NT-Full, 1 liver was removed from T-Full and 1 pituitary, 2 liver and 1 cerebellum were removed from the T-Restricted group. A l l pituitary samples showed low expression in the GHRH assays in addition to 3 cerebellum samples from T-Full fish and 1 from NT-Full fish. Only the hypothalamus and telencephalon could be accurately quantified from the SS assay. Similar to the G H R H assay, C C K expression 88 was too low in pituitaries of all fish as well as in 1 cerebellum sample from each of the NT-Full and T-Full groups. Despite the absence of these samples, each tissue analyzed within each group and assay had 9-11 replicates (with the exception of one group of 5 replicates in the G H assay and one group of 7 replicates in the GHRH assay). The gene used for normalization, B-actin, was lower in the pituitary tissues than the other brain regions (Fig. 3.1 A). T-Full fish had greater B-actin expression than NT-Full fish in the hypothalamus, optic tectum and telencephalon and in the brain overall (total). In all tissues T-Restricted fish had similar expression to both the T-Full and NT-Full fish and no differences between any groups were seen in"the cerebellum, midbrain, pituitary, liver or muscle (Fig. 3.2D). Growth hormone expression was highest in the hypothalamus and similar between T-Full and T-Restricted fish (Fig 3.IB). In all brain regions NT-Full fish had significantly lower G H expression than T-Restricted fish and was lower than the T-Full group in the midbrain and optic tectum only. Pituitary G H expression did not change between the groups, although there was a slightly lower expression in T-Full fish. In muscle and liver tissue both transgenic groups had greater G H expression than the NT-Full fish, the latter of which did not show any expression in the liver (Fig. 3.2A). T-Restricted fish had reduced hepatic G H expression compared to T-Full fish. Growth hormone receptor (GHR) expression was highest in the hypothalamus but differences between groups varied between brain regions. T-Restricted fish had the greatest GHR expression in the hypothalamus, midbrain and telencephalon but were similar to T-Full fish in the cerebellum, optic tectum and overall (Fig. 3.3A). NT-Full fish showed similar expression to T-Full fish in some tissues but were significantly lower in the hypothalamus and cerebellum. Contrary to other tissues, T-Full fish had lower GHR expression in the pituitary in which there was no difference between T-Restricted or NT-Full fish. Similar to the trends in the brain, the transgenic groups had significantly higher GHR expression in muscle and liver (Fig. 3.2B). The differences in insulin-like growth factor I (IGF-I) expression varied (Fig. 3.3B). Neither the cerebellum nor the optic tectum showed differences between groups. T-Restricted fish had greater expression than T-Full fish in the hypothalamus but this difference disappeared in the midbrain and telencephalon. In the pituitary this difference switched with greater expression in the T-Full fish. In half of the brain regions, T-Restricted fish had greater IGF-I than NT-Full fish while no differences between the two are seen in the remaining brain regions despite a trend to elevated levels in T-Full fish. Overall, transgenic fish had greater IGF-I expression than non-transgenic fish in the brain. IGF-I expression was highest in T-Full fish in 89 both the muscle and liver although it was only significantly so in the latter (Fig. 3.2C). NT-Full fish had expression lower than, and similar to, that of T-Restricted fish in muscle and liver tissue respectively. There were no differences observed between groups in growth hormone-releasing hormone expression within any of the brain regions examined (Fig. 3.4 A). Expression between regions differed with the highest expression seen in the hypothalamus and telencephalon, followed by lower expression in both the midbrain and optic tectum, and extremely low expression in the cerebellum. Somatostatin expression in the telencephalon was higher in NT-Full fish than T-Full fish but both did not differ significantly from the intermediate expression in T-Restricted fish (Fig. 3.4B). The hypothalamus and total brain showed no differences between groups. Cholecystokinin (CCK) also showed similar expression between groups in all brain regions and overall (Fig. 3.5). The telencephalon had the highest C C K expression followed by the optic tectum while the remaining tissues, had lower C C K expression levels. Correlation analysis between the expression of G H and GHR, G H and IGF-I, and GHR and IGF-I in the telencephalon, hypothalamus, pituitary, muscle, and liver showed significant relationships in only seven instances (Table 3.2). There was a strong positive correlation between GHR and IGF-I in the telencephalon and hypothalamus of NT-Full fish, and in the hypothalamus, pituitary and liver of T-Restricted fish. Furthermore, significance was almost reached in the pituitary of T-Full fish and the telencephalon of T-Restricted fish. G H was positively correlated with IGF-I in T-Full muscle and with GHR in the T-Restricted telencephalon. 3.3.2 Trial 2 In each graph the expression ratio is shown for all brain regions within each assay. Comparisons between the gene expression ratios of each tissue cannot be made as samples from each brain region were run on separate plates. Expression did not differ between transgenic fish fed the 21 MJ/kg diet and those fed the 15 MJ/kg diet for any of the genes tested or in any tissue with the exception of pituitary GHR expression in which fish on the 21 MJ/kg diet had significantly lower expression (Fig. 3.6). Plasma concentrations of IGF-I were significantly higher in transgenic (T) than non-transgenic (NT) fish (T: 37.4 ±1.6 ng/mL; NT: 6.4 +1.1 ng/mL)(Fig 3.7A). There was a strong positive correlation between plasma IGF-I and mass in the non-transgenic fish only (p = 0.001) (Fig. 3.7C). Diet treatment had no effect on plasma IGF-I in both genotypes (T fed 21 MJ/kg 90 diet: 36.7 + 2.1 ng/mL; T fed 15 MJ.kg diet: 38.1 ± 2.6 ng/mL; NT fed 21 MJ/kg diet: 8.5 ± 1.8 ng/mL; NT fed 15 MJ/kg diet: 4.3 ±1.1 ng/mL) but the non-transgenic fish fed the 21 MJ/kg diet almost reached a plasma IGF-I concentration significantly higher than that of the 15 MJ/kg diet group.(p = 0.058)(Fig. 3.7A). 3.4 Discussion 3.4.1 Trial 1 A general trend of increased B-actin expression was seen in T-Full fish but only reached significance in three brain regions. Because B-actin is not normalized to any other gene these differences may have arisen from technical variation (i.e. varying reverse transcription efficiencies causing differences in total cDNA quantities between samples). However, since the samples were processed in random order, the persistent trend across tissues suggests that there may have been an alternative biological explanation. T-Full fish had a much greater growth rate than T-Restricted and NT-Full fish due to increased feed intake. B-actin is an important structural protein and may have been increased in rapidly developing cells, although muscle and liver did not show this trend. Furthermore, B-actin expression appeared to be much lower in the pituitary than other tissues (Fig. 3.1), possibly due to increased expression of other genes in pituitary cells and the decrease in the relative abundance of B-actin expression. The differences that may have existed in B-actin expression between the NT-Full and T-Full groups is small, approximately 10 to 20 %, depending on the tissue, and there was no difference between the NT-Full and T-Restricted groups. Thus, normalization to this expression as a proxy for total R N A quantities would have a small impact on gene expression ratios and would not affect mutifold differences in expression. Growth hormone expression followed trends that were expected in an assay that detects both endogenous G H and G H transgene expression. Detectable, but unquantifiable, levels were present in all non-transgenic tissues (except the pituitary, hypothalamus and muscle), whereas expression was abundant in all transgenic tissues. G H expression in non-pituitary tissues of non-transgenic coho salmon has been found previously (Mori and Devlin, 1999). In addition, trace amounts of cellular cross-contamination during sampling and trace amounts of genomic D N A in the cDNA samples may have minutely contributed to the apparent G H expression. In the present study, pituitary G H expression was high and similar in all groups. This is in contrast to a previous study by Mori and Devlin (1999) on transgenic coho salmon. They found that transgenic fish had reduced pituitary G H R N A compared to that of non-transgenic fish. 91 However, they noted that the magnitude of this difference decreased with the size of the fish being compared. The present study was conducted on 55g fish, a size that may well be expected to lack differences in pituitary G H expression when extrapolating the trend found by Mori and Devlin (1999). There was no evidence for an increase in pituitary G H expression by feed-restricted fish as was seen by Valente et al. (2003) and Pierce et al. (2004). Despite this difference, my results are in agreement with two studies on tilapia and Atlantic salmon in which a difference in feed intake greater than that in this experiment (i.e. fasting) did not increase circulating G H (Bjornsson et al., 1994; Uchida et al., 2003). The difference in feed intake between these two groups may not have been great enough for the formation of G H resistance by the liver, a concomitant decrease in plasma IGF-I, and an increase in G H production (Maniar et al., 1994; Duan et al., 1995; Wargelius et al., 2005). Indeed, I found no differences in hepatic GHR expression in T-Restricted fish. Within other tissues, the similar G H expression between the transgenic groups agrees with expected trends as the G H transgene is driven by a metallothionein-B promoter sequence and is not known to respond to signals for endogenous GH regulation (Devlin et al., 2004a). The general increase in growth hormone receptor expression across tissues in both full and restricted ration transgenic groups coincided with the increase in G H seen in these fish. In transgenic mice, increased G H stimulated increased G H binding and GHR mRNA expression which in turn increased G H receptor abundances to both facilitate IGF-I production and to allow for negative feedback to both the hypothalamus and pituitary from circulating G H (Chen et al., 1991; Bartke et al., 1994; Chen et al., 1995; Asa et al., 2000). This appears to be happening in transgenic fish as well. There is considerable variability in the significance of the observed increases which may be in part due to the expression of multiple forms of GHR. Black sea bream, coho salmon and trout have two forms of GHR, designated GHR I and GHR II, which show differential expression in body tissues (Fukada et al., 2004; Saera-Vila et al., 2005). GHR I is the predominant form in the liver and brain while GHR II is dominant in the pancreas and spleen. M y assay did not distinguish between the two forms of GHR and therefore, my expression values reflected the net changes in these two transcripts. The two forms of GHR may be changing in distinct ways among the brain regions analyzed. Such changes would explain the sharp decrease in pituitary, and increase in hypothalamic, GHR expression in T-Full fish. Among the brain regions, the hypothalamus showed the greatest GHR expression. This region contains neuropeptide Y , and somatostatin neurons involved in the negative regulation of GH 92 production in many fish species (Olivereau et al., 1984; Moons et al., 1989; Batten et al., 1990; Power et al., 1996; Lin et al., 1999; Rodriguez-Gomez et al., 2001; Mathieu et al., 2002; Traverso et al., 2003; Chen et al., 2005). A n upregulation in GHR expression in the hypothalamus would increase the sensitivity of SS and N P Y neurons to changes in the chronically high circulating GH by allowing for greater G H binding and preventing receptor saturation. IGF-I is important for proper somatic growth and is a major mediator of the growth effects stimulated by GH in vertebrates. The increased G H and GHR mRNA expression noted in this study was accompanied by an increase in IGF-I expression in transgenic fish over the non-transgenic controls in muscle and brain (total) tissue. This result does not agree with studies by Duguay et al. (1994) and Duan (1998) who found that the IGF-I transcript present in all non-hepatic tissues, transcript Ea-4, did not increase with the hepatic transcripts, Ea-1 and Ea-3, after G H addition to coho and Atlantic salmon. Conversely, a study by Iida et al. (2004) on GH transgenic mice suggested that IGF-I mRNA expression in the pituitary may increase when exposed to chronically higher G H and that IGF-I is regulated differently between the pituitary and liver. It is clear from this study that there are region specific expression patterns of IGF-I in non-hepatic tissues of transgenic coho salmon, but the manner by which various IGF-I transcripts may have been involved in this observation needs to be determined. In support of the above studies, and in addition to studies on teleost hepatocyte cultures (Duan et al., 1992; Pierce et al., 2004; Pierce et al., 2005a), hepatic IGF-I expression in our experiment increased in the T-Full treatment. In the T-Restricted group, feed restriction reduced the increase in hepatic IGF-I expression to that of NT fish. The difference in IGF-I expression in the liver but lack thereof in the brain is consistent with fasted coho salmon and carp in which liver IGF-I mRNA expression responded to starvation while other tissues did not (Duan and Plisetskaya, 1993; Hua and Lin, 2001). Interestingly, the decrease in IGF-I expression by the liver in the feed-restricted group is not accompanied by an obvious decrease in GHR expression even though these two variables were positively correlated in most of the T-Restricted tissues. These two variables were not related in NT-Full or T-Full treatments suggesting that other factors (e.g. food intake or appetite satiation) may be controlling GHR and IGF-I expression in these groups. GHRH expression did not differ significantly between groups in any of the brain regions. This is surprising as I hypothesized that increased G H production in transgenic fish would negatively feedback on G H R H expression. There is a slight trend in the hypothalamus, optic tectum and telencephalon for increased G H R H expression in NT-Full and T-Restricted fish. 93 This may be due to a reduction in GHRH expression in T-Full fish, as hypothesized above, combined with an increased GHRH expression in T-Restricted fish due to decreased circulating IGF-I (Mathews et al., 1988a; Wallenius et al., 2001), but these results are inconclusive. The highest G H R H expression was found in the hypothalamus and telencephalon. Consistent with my data, GHRH cells have been detected in many fish tissues with expression in areas where GHRH neurons extend to the pituitary (Parhar and Iwata, 1996; Montero et al., 1998; Miranda et al.,2002). SS expression was measurable in two tissues, the hypothalamus and telencephalon, of which only the telencephalon showed a significant difference. There was a trend in the hypothalamus for reduced SS in the full-ration transgenic fish but contrary to our hypotheses, SS expression was not significantly different. Increases in circulating G H due to transgenesis and injection positively feedback on SS neurons in order to suppress G H production by the pituitary in rodents (Hurley and Phelps, 1992; Sato and Frohman, 1993; Hurley et al., 1994; Szabo et al., 1995; Pellegrini et al., 1997). GH transgenic coho salmon can have as much as a 40-fold increase in circulating G H (Devlin et al., 1994) and yet SS expression in this experiment did not change. Three transcripts of preprosomatostatin, encoding for three SS proteins, have been found in goldfish in which they may elicit different intracellular pituitary responses (Lin et al., 1999; Yunker et al., 2003; Yunker and Chang, 2004). M y assay did not distinguish between these forms and further studies are needed to determine i f there are multiple SS mRNA transcripts in coho salmon and the manner in which they may respond to changes in G H production. To understand the increased feeding motivation in G H transgenic coho salmon we analyzed the expression of one of the appetite regulating hormones, C C K , that may interact with the G H axis. However, C C K expression did not differ between groups in any of the brain regions analyzed despite the very large difference in feeding behaviour observed between transgenic and non-transgenic salmon. The lack of a difference suggests that the C C K satiation signal in G H transgenic fish was operating in a similar way as non-transgenic fish, at least at the time of sampling. M y data do not support the initial hypothesis that the low level of feed provided to the T-Restricted group would cause a chronic decrease in C C K expression. One explanation is that C C K expression may have been low in all groups as they were sampled at least 24 hours after last feeding, allowing diurnal C C K fluctuations to mask any long term changes in expression. C C K mRNA expression rises post-feeding (Peyon et al., 1999), and our fish were not fed immediately prior to sampling. Studies on the time course of C C K expression 94 in G H transgenic coho salmon is therefore warranted. Furthermore, three forms of C C K are found in the rainbow trout and goldfish, designated C C K - N , C C K - L and C C K - T (Jensen et al., 2001). These transcripts have different expression patterns throughout the brain (Jensen et al., 2001) but my assay is designed to detect the combined expression of all three forms. In order to confirm my conclusions, expression of the different C C K transcripts in the brain and C C K protein in other tissues, especially the gut, should be analyzed as the gut is the first area to respond to changes in energy intake (Jensen et al., 2001; Kamisaka et al., 2001; Kamisaka et al., 2002) . Differences in expression between transcripts in the brain and differences in C C K protein production in the gut are likely occurring in these fish and should be examined as they were not specifically examined in my analysis. 3.4.2 Trial 2 Comparisons between the transgenic fish fed a 21 MJ/kg and 15 MJ/kg diet showed no differences in any of the tissues examined, with the exception of GHR in the pituitary which is likely not biologically significant as the increase was not accompanied by any changes to G H mRNA expression. Possibly, the difference in energy intake between fish in this study was not enough to affect neuronal expression of any of the genes of interest. During starvation, hepatic IGF-I expression (Duan and Plisetskaya, 1993) and plasma IGF-I concentrations (Shimizu et al., 1999; Pierce et al., 2001) are expected to decline. Although we did not measure liver IGF-I mRNA expression in this trial, plasma IGF-I concentrations did not change in response to dietary energy intake. Consistent with studies on G H injection in salmon and rainbow trout (Foucher et al., 1992; Shimizu et al., 1999) and the resultant increases in growth, the G H transgenic coho salmon did have a 5.8-fold increase in circulating IGF-I. There is some evidence that the growth of G H transgenic coho salmon may not be responding normally to plasma IGF-I levels. Weight did not correlate with IGF-I concentrations in transgenic fish and the decreased size of transgenic fish fed the 15 MJ/kg diet (Chapter 2 Fig. 2.1) was not accompanied by a change in IGF-I plasma levels. In contrast, non-transgenic coho salmon showed a significant relationship between weight and plasma IGF-I. Unfortunately, in this trial sufficient plasma was not available to determine G H concentrations and how they may have related to fish growth. Despite the impact that these two diets had on growth, feed intake, arid feed efficiency (Chapter 2), I found no modifications to the GH-axis based upon mRNA levels or C C K expression. 95 3.5 Conclusions Growth hormone expression was higher in transgenic coho than that of non-transgenic fish in the muscle and liver and in all brain regions tested, except the pituitary. No differences were seen between the feed-restricted and full-ration transgenic fish except in the liver. The higher G H expression in transgenic fish was generally accompanied by higher GHR expression, although these differences, as well as those between the transgenic groups, were tissue specific. IGF-I expression was higher in full-ration transgenic individuals, and in most tissues the feed-restricted group had IGF-I levels reduced to that of non-transgenic fish. This expression corresponded to the reduced growth seen in both the non-transgenic and feed-restricted transgenic fish. No conclusive differences were seen in GHRH, SS or C C K expression between the treatment groups suggesting that the large difference in growth and feed utilization in transgenic fish did not result from these G H regulating hormones or a deficiency in satiety signaling. The change in dietary energy intake between a 21 MJ/kg and 15 MJ/kg diet did not appear to be great enough to show mRNA expression differences in any of the hormones analyzed in transgenic fish, despite significant differences in growth and feed intake. Plasma IGF-I levels were greatly impacted by G H transgenesis with a 5.8 fold increase in the transgenic fish but diet had no effect on plasma IGF-I in either genotype. Furthermore, growth in weight may have been uncoupled with plasma IGF-I in transgenic individuals. Thus, growth hormone production, GHR expression and IGF-I expression were increased in both body tissues and the brain with no response by the central regulators of G H , G H R H and SS, to reduce this expression. Reduced dietary energy intake did not influence gene expression in the brain but had a marked effect on G H and IGF-I expression in the liver. 3.6 Acknowledgements I would like to thank Mitchell Uh for his help analyzing muscle and liver samples, as well as Dionne Sakhrani, Carlo Biagi, and Geordia Rigter for their technical assistance. Table 3.1 Quantitative PCR primer and probe sequences for coho salmon, Onchorynchus kisutch Gene Forward Primer Reverse Primer TaqMan MGB Probe 13-actin ACGGCCGAGAGGGAAATC CAAAGTCCAGCGCCACGTA CACAGCTTCTCCTTGATGT GH CAAGATATTCCTGCTGGACTT GGGTACTCCCAGGATTCAATCA CAGTCCTGAAGCTGC GHR CACTGTGGAAGACATCGTGGAA CAAAGTGGCTCCCGGTTAGA AACTGGACCCTGCTGAA IGF-I GGCATTTATGTGATGTCTTCAAGAGT CCTGTTGCCGCCGAAGT TCTCACTGCTGCTGTGC GHRH TCATCTATGGAATCATAATGCACTACAG CCATCCTCGTCATAAACCTCATT CTATCCTAACCTTAGACTTGAA SS CCGGCTTTGCGCTCAC ATTATATCCCAACTGTCCTTGCCT CCACTGAGCGCTCCA CCK T GCCTACCTCAGTGAATTGTTGGC CGGGGTAGTCTCGGTCTTTTATC AACTCAACAGTGAACAGCAGA Sequences are written 5' to 3' left to right 97 Table 3.2 Correlations of GH, GHR and IGF-I mRNA expression ratios in body tissues of coho salmon, Oncorhynchus kisutch NT-Full T-Full T-Restricted Tissue Correlation r(rs)1 p value r(rs)1 p value r(rs)1 p value Telencephalon2 GH v. GHR - - 0.159 0.662 0.770 0.006 GH v. IGF-I - - -0.187 0.604 0.392 0.233 GHR v. IGF-I 0.686 0.028 0.325 0.360 0.602 0.0501 Hypothalamus2 GH v. GHR - - 0.277 0.438 0.566 0.069 , GHv. IGF-I - - 0.252 0.482 0.415 0.205 GHR v. IGF-I 0.796 0.003 0.196 0.586 0.706 0.015 Pituitary GH v. GHR -0.126 0.747 0.117 0.742 0.440 0.203 GH v. IGF-I 0.308 . 0.420 -0.183 0.612 0.483 0.158 GHR v. IGF-I 0.143 0.714 0.600 0.077 0.831 0.003 Muscle GH v. GHR 0.500 0.109 0.217 0.521 0.248 0.468 GH v. IGF-I 0.145 0.653 0.676 0.023 -0.018 0.946 GHR v. IGF-I -0.173 0.595 0.227 0.502 -0.333 0.327 Liver2 GH v. GHR _ _ 0.436 0.168 0.338 0.374 GH v. IGF-I - -0.127 0.707 0.639 0.064 GHR v. IGF-I 0.001 0.999 0.164 0.631 0.740 0.023 Pituitary v. p GH v. 1 GHR -0.234 0.516 - - -Liver3 p GH v. 1 IGF-I 0.293 0.411 - - • - -Pituitary v. p GH v. m GHR 0.0455 0.881 - - - -Muscle3 i _ p GH v. m IGF-I 0.164 . 0.614 - - - -coefficients, rs, for non-parametric data 2 GH values were too low in NT-Full group for correlation analysis 3 Correlations of pituitary GH against liver and muscle GHR and IGF-1 were only analyzed in NT-Full fish because GH is produced by all tissues in the other two groups and any trends should be apparent in the intra-tissue correlations. 98 3.0 - i 2.5 § 2.0 IS) in CD CL x 1 5 LU o CD CO. LO 0.5 A 0.0 B 1.2 - i 1.0 -\ a: c g S3 0.6 CL X LU X 0.4 0 0.2 0.0 NT-Full T-Full T-Restricted I A B I I B I A B I A B I mb o p Brain Region AB A j j i. AB total 0 B B B i l -nl J l .11 mb o Brain Region t total Fig. 3.1. Gene expression of A : fl-actin and B: growth hormone (GH) in the cerebellum (c), hypothalamus (h), midbrain (mb), optic tectum (o), pituitary (p), telencephalon (t) and whole brain without pituitary (total) of full-ration non-transgenic (NT-Full), full-ration transgenic (T-Full) and pair-fed, restricted-ration transgenic (T-Restricted) coho salmon. Values for B-actin and GH in each tissue were standardized to NT-Full fish that were assigned a ratio of 1 and 0.01 respectively. These values were then combined for comparison (total). Comparisons between groups were made within each brain region. Comparisons between tissues are not shown and cannot be made with pituitary G H expression (inset). Letters that differ mark significant differences where they occur. Bars are means ± SE, N = 10 to 11 (GH T-Full c has an N of 5). 99 B c ©" 0.06 - i o cn (Mu 0.05 -Ratio 0.04 -c o cn 0.03 -ares: 0.02 --1 Ex| 0.01 -IGF 0.00 -E NT-Full T-Full T-Restricted B x L CO cn c o "cn cn CD s_ Q. X UJ cn x o Muscle Liver Muscle Liver Muscle Liver Muscle Liver X AB A B ro cn CZ O cn cn CD Q_ X LU C E < 0.8 —i 0.6 H 0.4 H 0.2 H 0.0 Muscle Liver Muscle Liver Fig. 3.2. Gene expression ratios of A : G H , B: GHR, C: IGF-I, D: B-actin, E: myosin and F: albumin, in muscle and liver tissue of full-ration non-transgenic (NT-Full), full-ration transgenic (T-Full) and pair-fed, restricted-ration transgenic (T-Restricted) coho salmon. Comparisons between tissues were not made. Letters that differ mark significant differences where they occur. Bars are means ± SE, N = 9 to 11. 100 5.0 B NT-Full T-Full T-Restricted c h mb o p t total Brain Region 3.0 2.5 H £ 2.0 H c o 1 G _ X U J l i 0.5 0.0 B B II II A B B Li B II A B mb o p Brain Region t total Fig. 3.3. Gene expression ratios of A : growth hormone receptor (GHR) and B: insulin-like growth factor I (IGF-I) in the cerebellum (c), hypothalamus (h), midbrain (mb), optic tectum (o), pituitary (p), telencephalon (t) and all regions except the pituitary (total) of full-ration non-transgenic (NT-Full), full-ration transgenic (T-Full) and pair-fed, restricted-ration transgenic (T-Restricted) coho salmon. GHR and IGF-I expression in both T groups were standardized to that of NT fish that were assigned a ratio of 1 for each tissue. These values for each tissue were then combined for comparison (total). Letters that differ mark significant differences where they occur. Bars are means ± SE, N = 10 to 11. 101 B 03 cn CO CO CD i_ C L X LU CO CO mb Brain Region 20 -, 1-5 H 1.0 0.5 0.0 -r h t Brain Region total Fig 3.4. Gene expression ratios of A : growth hormone-releasing hormone (GHRH) and B: somatostatin (SS) in the cerebellum (c), hypothalamus (h), midbrain (mb), optic tectum (o) and telencephalon (t) and all regions (total) of full-ration non-transgenic (NT-Full), full-ration transgenic (T-Full) and pair-fed, restricted-ration transgenic (T-Restricted) coho salmon. GHRH and SS expression in both T groups were standardized to that of NT fish that were assigned a ratio of 1 for each tissue. These values were then combined for comparison (total). Letters that differ mark significant differences where they occur. Bars are means ± SE, N = 7 to 11. 102 CD cr: c g <n cn co %— CL X L U O O 3.0 - i 2.5 H N T - F u l l T - F u l l T - R e s t r i c t e d m b o Bra in R e g i o n total Fig 3.5. Gene expression ratio of cholecystokinin (CCK) in the cerebellum (c), hypothalamus (h), midbrain (mb), optic tectum (o), telencephalon (t) and all regions (total) of full-ration non-transgenic (NT-Full), full-ration transgenic (T-Full) and pair-fed, restricted-ration transgenic (T-Restricted) coho salmon. Gene expression in both T groups were normalized to that of NT fish that were assigned a ratio of 1 for each tissue. These values for each tissue were then combined for comparison (total). Letters that differ mark significant differences where they occur. Bars are means ± SE, N = 9 to 11. 103 B 3.0 - i 2.5 -2.0 -1.5 LO H 0.5 0.0 5.0 - i 4.0 -I 3.0 2.0 1.0 0.0 4.0 - i X I h t Brain Region (3 LL 8.0 CD or 6.0 H c § 4.0 H CD i_ C L x LU 2.0 0.0 D g CO 0L cz g CO C L X L U 4.0 - i 3.0 -1.0 H 0.0 F g '-*-> CO or c g <x> i _ C L X LU CO 0.5 H CO 0.0 3.0 - i 2.5 -2.0 -1.0 H •P mp I I X Brain Region • 21 MJ/kg Diet • 15 MJ/kg Diet Brain Region: h - Hypothalamus t - Telencephalon p - Pituitary Fig. 3.6. Gene expression of A: B-actin; and ratios of B: growth hormone (GH); C: growth hormone receptor (GHR); D: insulin-like growth factor I (IGF-I); E: growth hormone-releasing hormone (GHRH); F: somatostatin (SS); and G: cholecystokinin (CCK) in the hypothalamus (h), telencephalon (t) and pituitary (p) of transgenic coho salmon fed a 21 MJ/kg (black bar) or 15 MJ/kg (grey bar) diet. Comparisons between brain regions were not made. Letters that differ mark significant differences where they occur. Bars are means ± SE, N = 12. 104 CO E co _ro C L 50 -i 40 r? 30 20 H 10 21 MJ/kg Diet 15 MJ/kg Diet 1 B B Transgenic Non-transgenic B 60 50 H CD c -7 40 O co E w _co D_ 30 20 H 100 150 200 250 Weight (g) Non-transgenic 1^ =0.23 — i — 10 15 20 25 Weight (g) — i 1 30 35 Fig. 3.7. Plasma insulin-like growth factor I (IGF-I) concentrations of transgenic and non-transgenic coho salmon fed a 21 MJ/kg and 15 MJ/kg diet (A). Correlations between weight and plasma IGF-I concentrations in transgenic (B) and non-transgenic (C) fish. In plot A , letters that differ mark significant differences where they occur, bars are means + SE, N = 13 to 15. Note the difference in scale between plots B and C. The correlation between plasma IGF-I and weight was significant in the non-transgenic fish (C) only. 3.7 References Al-Regaiey, K . A . , Mastemak, M . M . , Bonkowski, M . , Sun, L., Bartke, A. , 2005. Long-lived growth hormone receptor knockout mice: Interaction of reduced insulin-like growth factor I/insulin signaling and caloric restriction. Endocrinology 146, 851-860. Asa, S.L., Coschigano, K.T., Bellush, L. , Kopchick, J.J., Ezzat, S., 2000. Evidence for growth hormone (GH) autoregulation in pituitary somatotrophs in G H antagonist-transgenic mice and G H receptor-deficient mice. American Journal of Pathology 156, 1009-1015. Bartke, A. , Turyn, D., Aguilar, C.C., Sotelo, A . L , Steger, R.W., Chen, X .Z . , Kopchick, J.J., 1994. Growth hormone (GH) binding and effects of G H analogs in transgenic mice. Proceedings of the Society for Experimental Biology & Medicine 206, 190-194. Batten, T., Cambre, M . , Moons, L. , Vandesande, F., 1990. Comparative distribution of neuropeptide-immunoreactive systems in the brain of the Green Molly, Poecilia latipinna. The Journal of Comparative Neurology 302, 893-919. Bjornsson, B.T., Taranger, G.L., Hansen, T., Stefansson, S.O., Haux, C , 1994. The Interrelation between photoperiod, growth hormone, and sexual maturation of adult Atlantic salmon {Salmo salar). General & Comparative Endocrinology 93, 70-81. Canosa, L.F., Peter, R.E., 2004. Effects of cholecystokinin and bombesin on the expression of preprosomatostatin-encoding genes in goldfish forebrain. Regulatory Peptides 121, 99-105. Chen, N. -Y. , Chen, W.Y. , Bellush, L. , Yang, C.-W., Striker, L.J. , Striker, G.E., Kopchick, J.J., 1995. Effects of streptozotocin treatment in growth hormone (GH) and G H antagonist transgenic mice. Endocrinology 136, 660-667. Chen, R., L i , W., Lin, H. , 2005. cDNA cloning and mRNA expression of neuropeptide Y in orange spotted grouper, Epinephelus coioides. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 142, 79-89. Chen, W.Y. , White, M.E. , Wagner, T.E., Kopchick, J.J.,1991. Functional antagonism between endogenous mouse growth hormone (GH) and a G H analog results in dwarf transgenic mice. Endocrinology 129, 1402-1408. Cook, A. , Peter, R., 1984. The effects of somatostatin on serum growth hormone levels in the goldfish Carassius-auratus. General & Comparative Endocrinology 54, 109-113. Devlin, R.H., Biagi, C.A., Yesaki, T.Y., 2004.. Growth, viability and genetic characteristics of G H transgenic coho salmon strains. Aquaculture 236, 607-632. Devlin, R.H., Yesaki, T.Y., Biagi, C.A., Donaldson, E .M. , Swanson, P., Chan, W.-K., 1994. Extraordinary salmon growth. Nature 371, 209-210. Devlin, R.H., Johnsson, J.I., Smailus, D.E., Biagi, C.A., Jonsson, E., Bjornsson, B.T., 1999. Increased ability to compete for food by growth hormone-transgenic coho salmon Oncorhynchus kisutch (Walbaum). Aquaculture Research 30, 479-482. Devlin, R.H., Swanson, P., Clarke, W.C., Plisetskaya, E., Dickhoff, W., Moriyama, S., Yesaki, T.Y., Hew, C.L., 2000. Seawater adaptability and hormone levels in growth-enhanced transgenic coho salmon, Oncorhynchus kisutch. Aquaculture 191, 367-385. Dickhoff, W.W., Beckman, B.R., Larsen, D.A., Duan, C , Moriyama, S., 1997. The role of growth in endocrine regulation of salmon smoltification. Fish Physiology & Biochemistry 17, 231-236. Duan, C , 1998. Nutritional and developmental regulation of insulin-like growth factors in fish. Journal of Nutrition 128, 306S-314S. Duan, C , Plisetskaya, E .M. , 1993. Nutritional regulation of insulin-like growth factor-I mRNA expression in salmon tissues. Journal of Endocrinology 139, 243-252. Duan, C , Duguay, S.J., Plisetskaya, E .M. , 1992. Hormonal regulation of insulin-like growth factor I (IGF-I) mRNA expression in coho salmon. American Zoologist 32, 13A. Duan, C , Plisetskaya, E .M. , Dickhoff, W.W., 1995. Expression of insulin-like growth factor I in normally and abnormally developing coho salmon (Oncorhynchus kisutch). Endocrinology 136, 446-452. Duguay, S.J., Swanson, P., Dickhoff, W.W., 1994. Differential expression and hormonal regulation of alternatively spliced IGF-I mRNA transcripts in salmon. Journal of Molecular Endocrinology 12, 25-37. Foucher, J.L., Le Bail, P.Y., Le Gac, F., 1992. Influence of hypophysectomy castration fasting and spermiation on SBP concentration in male rainbow trout Oncorhynchus-mykiss. General & Comparative Endocrinology 85, 101-110. Fukada, H. , Ozaki, Y . , Pierce, A . L . , Adachi, S., Yamauchi, K. , Hara, A. , Swanson, P., Dickhoff, W.W., 2004. Salmon growth hormone receptor: molecular cloning, ligand specificity, and response to fasting. General & Comparative Endocrinology 139, 61-71. Gelineau, A. , Boujard, T., 2001. Oral administration of cholecystokinin receptor antagonists increase feed intake in rainbow trout. Journal of Fish Biology 58, 716-724. Hua, Y . - M . , Lin, H.-R., 2001. Effects of different nutritional status on expression of IGF-I > mRNA in immature Common carp liver. Acta Zoologica Sinica 47, 94-100. 107 Hurley, D., Phelps, C , 1992. Hypothalamic preprosomatostatin messenger ribonucleic acid expression in mice transgenic for excess or deficient endogenous growth hormone. Endocrinology 130, 1809-1815. Hurley, D., Bartke, A. , Wagner, T., Wee, B., 1994. Increased hypothalamic somatostatin expression in mice transgenic for bovine or human GH. Journal of Neuroendocrinology 6, 539-548. Iida, K. , del Rincon, J.P., Kim, D.-.S., Itoh, E., Nass, R., Coschigano, K.T., Kopchick, J.J., Thorner, M.O., 2004. Tissue-specific regulation of growth hormone (GH) receptor and insulin-like growth factor-I gene expression in the pituitary and liver of GH-deficient (lit/lit) mice and transgenic mice that overexpress bovine G H (bGH) or a bGH antagonist. Endocrinology 145, 1564-1570. Jensen, H. , Rourke, I., Moller, M . , Jonson, L., Johnsen, A. , 2001. Identification and distribution of CCK-related peptides and mRNAs in the rainbow trout, Onchorynchus mykiss. Biochimica et Biophysica Acta 1517, 190-201. Kamisaka, Y . , Totland, G.K., Tagawa, M . , Kurokawa, T., Suzuki, T., Tanaka, M . , Ronnestad, I., 2001. Ontogeny of cholecystokinin-immunoreactive cells in the digestive tract of Atlantic halibut, Hippoglossus hippoglossus, larvae. General & Comparative Endocrinology 123, 31-37. Kamisaka, Y . , Kaji, T., Masuma, S., Tezuka, N . , Kurokawa, T., Suzuki, T., Totland, G.K., Ronnestad, I., Tagawa, M . , Tanaka, M . , 2002. Ontogeny of cholecystokinin-immunoreactive cells in the digestive tract of bluefin tuna, Thunnus thynnus, larvae. Sarsia 87, 258-262. Kelly, A . M . , Kohler, C.C., Grau, E.G., 1996. A mammalian growth hormone-releasing hormone increases serum growth hormone levels and somatic growth at suboptimal temperatures in tilapia. Journal of the World Aquaculture Society 27, 384-401. Kwong, P., Chang, J., 1997. Somatostatin inhibition of growth hormone release in goldfish: Possible targets of intracellular mechanisms of action. General & Comparative Endocrinology 108, 446-456. Lescroart, O., Roelants, I., Mikolajczyk, T., Bosma, P.T., Schulz, R.W., Kuhn, E.R., Ollevier, F., 1996. A radioimmunoassay for African catfish growth hormone: Validation and effects of substances modulating the release of growth hormone. General & Comparative Endocrinology 104, 147-155. 108 Lin, X. -W. , Lin, H.-R., Peter, R.E., 1993. Growth hormone and gonadotropin secretion in the common carp (Cyprinus carpio L.): In vitro interactions of gonadotropin-releasing hormone, somatostatin, and the dopamine agonist apomorphine. General & Comparative Endocrinology 89, 62-71. Lin, X . , Otto, C.J., Peter, R.E., 1999. Expression of three distinct somatostatin messenger ribonucleic acids (mRNAs) in goldfish brain: Characterization of the complementary deoxyribonucleic acids, distribution arid seasonal variation of the mRNAs, and action of a somatostatin-14 variant. Endocrinology 140, 2089-2099. Luo, D., McKeown, B.A. , 1991. Interaction of carp growth hormone-releasing factor and somatostatin on in-vitro release of growth hormone in rainbow trout Oncorhynchus-mykiss. Neuroendocrinology 54, 359-364. Maniar, S., Martini, J.F., Villares, S., Delehaye-Zervas, M.C. , Kleinknecht, C , Postel-Vinay, M.C. , 1994. Hepatic growth hormone receptor (GHR) expression in experimental uremia: Role of anorexia. Journal of the American Society of Nephrology 5, 723. Mathews, L.S., Hammer, R.E., Brinster, R.L., Palmiter, R.D., 1988a. Expression of insulin-like growth factor I in transgenic mice with elevated levels of growth hormone is correlated with growth. Endocrinology 123, 433-437. Mathews, L.S., Hammer, R.E., Behringer, R.R., D'Ercole, A.J . , Bell, G.L, Brinster, R.L. , Palmiter, R.D., 1988b. Growth enhancement of transgenic mice expressing human insulin-like growth factor. Endocrinology 123, 2827-2833. Mathieu, M . , Tagliafierro, G., Bruzzone, F., Vallarino, M . , 2002. Neuropeptide tyrosine-like immunoreactive system in the brain, olfactory organ and retina of the zebrafish, Danio rerio, during development. Brain Research. Developmental Brain Research 139, 255-265. Melamed, P., Eliahu, N . , Levavi-Sivan, B., Ofir, M . , Farchi-Pisanty, O., Rentier-Delrue, F., Smal, J., Yaron, Z., Naor, Z., 1995. Hypothalamic and thyroidal regulation of growth hormone in tilapia. General & Comparative Endocrinology 97, 13-30. Meton, I., Caseras, A. , Canto, E., Fernandez, F., Baanante, I.V., 2000. Liver insulin-like growth factor-I mRNA is not affected by diet composition or ration size but shows diurnal variations in regularly-fed gilthead sea bream (Sparus auratd). Journal of Nutrition 130, 757-760. Minami, S., Kamegai, J., Sughihara, H. , Suzuki, N . , Wakabayashi, I., 1998. Growth hormone inhibits its own secretion by acting on the hypothalamus through its receptors on 109 neuropeptide Y neurons in the arcuate nucleus and somatostatin neurons in the periventricular nucleus. Endocrine Journal (Suppl), S19-S26. Miranda, L .A. , Strobl-Mazzulla, P.H., Somoza, G.M. , 2002. Ontogenetic development and neuroanatomical localization of growth hormone-releasing hormone (GHRH) in the brain and pituitary gland of pejerrey fish Odontesthes bonariensis. International Journal of Developmental Neuroscience 20, 503-510. Montero, M . , Yon, L. , Rousseau, K. , Arimura, A. , Fournier, A. , Dufour, S., Vaudry, H. , 1998. Distribution, characterization, and growth hormone-releasing activity of pituitary adenylate cyclase-activating polypeptide in the European eel, Anguilla anguilla. Endocrinology 139, 4300-4310. Moons, L., Cambre, M . , Ollevier, F., Vandesande, F., 1989. Immunocytochemical demonstration of close relationships between neuropeptide nerve fibers and hormone-producing cell types in the adenohypophysis of the sea bass (Dicentrarchus labrax). General and Comparative,Endocrinology 73, 270-283. Mori, T., Devlin, R.H., 1999. Transgene and host growth hormone gene expression in pituitary and nonpituitary tissues of normal and growth hormone transgenic salmon. Molecular & Cellular Endocrinology 149, 129-139. Narnaware, Y . K . , Peter, R.E., 2001. Effects of food deprivation and refeeding on neuropeptide Y (NPY) mRNA levels in goldfish. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 129B, 633-637. Olivereau, M . , Ollevier, F., Vandesande, F., Olivereau, J., 1984. Somatostatin in the brain and the pituitary of some teleosts immunocytochemical identification and the effect of starvation. Cell & Tissue Research 238, 289-296. Parhar, I.S., Iwata, M . , 1996. Intracerebral expression of gonadotropin-releasing hormone and growth hormone-releasing hormone is delayed until smoltification in the salmon. Neuroscience Research 26, 299^-308. Parker, D.B., Coe, I.R., Dixon, G.H., Sherwood, N . M . , 1993. Two salmon neuropeptides encoded by one brain cDNA are structurally related to members of the glucagon superfamily. European Journal of Biochemistry 215, 439-448. Parker, D.B., Power, M.E. , Swanson, P., Rivier, J., Sherwood, N . M . , 1997. Exon skipping in the gene encoding pituitary adenylate cyclase-activating polypeptide in salmon alters the expression of two hormones that stimulate growth hormone release. Endocrinology 138, 414-423. 110 Pellegrini, E., Carmignac, D., Bluet-Pajot, M . , Mounier, F., Bennet, P., Epelbaum, J., Robinson, I., 1997. Intrahypothalamic growth hormone feedback: From dwarfism to acromegaly in the rat. Endocrinology 138, 4543-4551. Peng, X. -D. , Park, S., Gadelha, M.R., Coschigano, K.T., Kopchick, J.J., Frohman, L .A. , Kineman, R.D., 2001. The growth hormone (GH)-axis of G H receptor/binding protein gene-disrupted and metallothionein-human GH-releasing hormone transgenic mice: Hypothalamic neuropeptide and pituitary receptor expression in the absence and presence of G H feedback. Endocrinology 142, 1117-1123. Peter, R., 1997. Voluntary food intake in fish, Neuroendocrine regulation of appetite in fish, pp. 33. Peyon, P., Saied, H. , Lin, X . , Peter, R.E., 1999. Postprandial, seasonal and sexual variations in cholecystokinin gene expression in goldfish brain. Molecular Brain Research 74, 190-196. Pierce, A . L . , Fukada, H. , Dickhoff, W.W., 2005a. Metabolic hormones modulate the effect of growth hormone (GH) on insulin-like growth factor-I (IGF-I) mRNA level in primary culture of salmon hepatocytes. Journal of Endocrinology 184, 341-349. Pierce, A . L . , Beckman, B.R., Shearer, K .D. , Larsen, D.A., Dickhoff, W.W., 2001. Effects of ration on somatotropic hormones and growth in coho salmon. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 128B, 255-264. Pierce, A . L . , Shimizu, M . , Beckman, B.R., Baker, D .M. , Dickhoff, W.W., 2005b. Time course of the GH/IGF axis response to fasting and increased ration in chinook salmon (Oncorhynchus tshawytscha). General & Comparative Endocrinology 140, 192-202. Pierce, A . L . , Dickey, J.T., Larsen, D.A., Fukada, H. , Swanson, P., Dickhoff, W.W., 2004. A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of G H regulation of IGF-I gene expression in primary culture of salmon hepatocytes. General & Comparative Endocrinology 135, 401-411. Power, D .M. , Canario, A . V . M . , Ingleton, P .M. , 1996. Somatotropin release-inhibiting factor and galanin innervation in the hypothalamus and pituitary of seabream (Spams auratd). General & Comparative Endocrinology 101, 264-274. Rodriguez-Gomez, F.J., Rendon-Unceta, C , Sarasquete, C , Munoz-Cueto, J.A., 2001. Distribution of neuropeptide Y-like immunoreactivity in the brain of the Senegalese sole (Solea senegalensis). Anatomical Record 262, 227-237. I l l Saera-Vila, A . , Calduch-Giner, J.-A., Perez-Sanchez, J., 2005. Duplication of growth hormone receptor (GHR) in fish genome: gene organization and transcriptional regulation of GHR type I and II in gilthead sea bream (Spams aurata). General & Comparative Endocrinology 142 193-203. Sato, M . , Frohman, L .A. , 1993. Differential effects of central and peripheral administration of growth hormone (GH) and insulin-like growth factor on hypothalamic GH-releasing hormone and somatostatin gene expression in GH-deficient dwarf rats. Endocrinology 133,793-799. Shepherd, B.S., Eckert, S.M., Parhar, I.S., Vijayan, M . M . , Wakabayashi, I., Hirano, T., Grau, E.G., Chen, T.T., 2000. The hexapeptide KP-102 (D-Ala-D-B-Nal-Ala-Trp-D-Phe-Lys-NH2) stimulates growth hormone release in a cichlid fish (Oreochromis mossambicus). Journal of Endocrinology 167, R7-R10. Shimizu, M . , Swanson, P., Dickhoff, W.W., 1999. Free and protein-bound insulin-like growth factor-I (IGF-I) and IGF-binding proteins in plasma of coho salmon, Oncorhynchus kisutch. General & Comparative Endocrinology 115, 398-405. Silverstein, J., Plisetskaya, E., 2000. The effects of N P Y and insulin on food intake regulation in fish. American Society of Zoologists 40, 296-308. Silverstein, J., Breininger, J., Baskin, D., Plisetskaya, E., 1996. Neuropeptide Y abundance and gene expression in the salmon brain: A role in regulation of food intake. American Zoologist 36, 82A. Sundstrom, L.F., Lohmus, M . , Devlin, R.H., 2004. Growth hormone transgenic salmon pay for growth potential with increased predation mortality. Proc. R. Soc. Lond. B (Suppl.), Biology Letters 271, S350-S352. Sundstrom, L.F., Devlin, R.H., Johnsson, J.I., Biagi, C.A., 2003. Vertical position reflects increased feeding motivation in growth hormone transgenic coho salmon (Oncorhynchus kisutch). Ethology 109, 701-712. Szabo, M . , Butz, M . , Banerjee, S., Chikaraishi, D., Frohman, L. , 1995. Autofeedback suppression of growth hormone (GH) secretion in transgenic mice expressing a human G H reporter targeted by tyrosine hydroxylase 5'-flanking sequences to the hypothalamus. Endocrinology 139, 4044-4048. Traverso, J .M., Ravaglia, M.A . , Vissio, P.G., Maggese, M.C. , Paz, D.A., 2003. Localization of Neuropeptide Y-like immunoreactive structures in the brain of the pejerrey, Odontesthes 112 bonariensis (Teleostei, Atheriniformes). Anatomia, Histologia, Embryologia: Veterinary Medicine Series C 32, 29-35. Uchida, K. , Kajimura, S., Riley, L .G. , Hirano, T., Aida, K. , Grau, E.G., 2003. Effects of fasting on growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 134A, 429-439. Uchiyama, T., Kaji, H. , Abe, H. , Chihara, K. , 1994. Negative regulation of hypothalamic growth hormone-releasing factor messenger ribonucleic acid by growth hormone and insulin-like growth factor 1. Neuroendocrinology 59, 441-450. Valente, L.M.P. , Le Bail, P.Y., Gomes, E.F.S., Fauconneau, B., 2003. Hormone profile in fast-and slow-growing strains of rainbow trout (Oncorhynchus mykiss) in response to nutritional state. Aquaculture 219, 829-839. Very, N . M . , Knutson, D., Kittilson, J.D., Sheridan, M.A . , 2001. Somatostatin inhibits growth of rainbow trout. Journal of Fish Biology 59, 157-165. Very, N . M . , Kittilson, J.D., Norbeck, L .A. , Sheridan, M.A . , 2005. Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry & Physiology. Part B , Biochemistry & Molecular Biology 140, 615-628. Volkoff, H. , Eykelbosh, A.J . , Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: Interactions with cholecystokinin, neuropeptide Y and orexin A , and modulation by fasting. Brain Research 972, 90-109. Wallenius, K., Sjogren, K. , Peng, X . -D . , Park, S., Wallenius, V . , Liu, J.-L., Umaerus, M . , Wennbo, H. , Isaksson, O., Frohman, L. , Kineman, R., Ohlsson, C , Jansson, J.-O., 2001. Liver-derived IGF-I regulates G H secretion at the pituitary level in mice. Endocrinology 142,4762-4770. Wargelius, A. , Fjelldal, P.-G., Benedet, S., Hansen, T., Bjornsson, B.T., Nordgarden, U . , 2005. A peak in gh-receptor expression is associated with growth activation in Atlantic salmon vertebrae, while upregulation of igf-I receptor expression is related to increased bone density. General & Comparative Endocrinology 142, 163-168. Yunker, W.K., Chang, J.P., 2004. Somatostatin-14 actions on dopamine- and pituitary adenylate cyclase-activating polypeptide-evoked Ca2+ signals and growth hormone secretion. Journal of Neuroendocrinology 16, 684-694. 113 Yunker, W.K. , Smith, S., Graves, C., Davis, P.J., Unniappan, S., Rivier, J.E., Peter, R.E., Chang, J.P., 2003. Endogenous hypothalamic somatostatins differentially regulate growth hormone secretion from goldfish pituitary somatotropes in vitro. Endocrinology 144, 4031-4041. ) 114 CHAPTER 4 Thesis summary and future research. 4.1 Introduction The enhanced production of growth hormone (GH) in G H transgenic coho salmon has marked effects on the growth and physiology of this species. Growth is increased 2-3 fold, resulting in early smolting and development of salt water tolerance (Devlin et al., 1995; Devlin et al., 2000). Both intestinal surface area and cartilage deposition are increased (Ostenfeld et al., 1998; Stevens and Devlin, 2000), and there is an elevation in the oxygen requirement of muscle tissue during exertion and following feeding of G H transgenic coho Salomon (Hill et al., 2000; Lee et al., 2003). Furthermore, G H transgenesis may be disadvantageous as it increases the susceptibility of these fish to bacterial infections during the smoltification phase of their development (Jhingan et al., 2003). In addition to the above changes, feeding activity and feed intake have been observed to increase in transgenic coho salmon. Little is known, however, about their nutritional and energy needs and how appetite is controlled. Also, no studies have examined gene expression of the hormones regulating G H or appetite control and the manner in which gene expression changes in response to dietary energy source and level. The present thesis provides the first study on the dietary energy and nutrient use required to support enhanced growth in G H transgenic coho salmon. Furthermore, this is the first study on gene expression of the major G H regulating and appetite regulating hormones in a transgenic fish. 4.2 Digestible Energy and Protein Utilization The results of the present study have shown that the physiology of growth hormone (GH) transgenic coho salmon has been altered in such a way that they are eating to a new energy demand and are more efficient at utilizing dietary protein than their non-transgenic counterparts. G H transgenic salmon can respond in growth and appetite to increases in dietary digestible energy in the range of 15 MJ/kg to 21 MJ/kg, whereas non-transgenic coho salmon on the other hand require 17 MJ/kg and preferably 19 to 21 MJ/kg for efficient growth during the winter season when this experiment was conducted. The increased feed efficiency and protein utilization that was observed in transgenic coho salmon in the present study is in accord with data from other G H transgenic and GH-protein-treated fish in which there tended to be an increase in feed conversion efficiency, protein synthesis and retention, amino acid transport and quantities, muscle growth, and lipid metabolism (Sun, 1990; Foster and Houlihan, 1991; 115 Chatakondi et al., 1995a; Fauconneau et al., 1996; Fauconneau et al., 1997; Fu et al., 1998; Farmanfarmaian and Sun, 1999; Krasnov et al., 1999b; Cook et al., 2000; Fu et al., 2000; Martinez et al., 2000; Rahman et al., 2001; Dunham et al., 2002). The ability of transgenic coho salmon to grow well on diets that were nutritionally insufficient for non-transgenic coho salmon (i.e. those diets with low digestible energy and high fibre content) may indicate that transgenic coho salmon, i f introduced into the wild, would better utilize natural food sources that are nutritionally inferior to wild fish (e.g. those with high indigestible chitin content) and thus shift resource utilization in natural ecosystems. 4.3 Plasma IGF-I Transgenic fish from the diet experiment had greater insulin-like growth factor I (IGF-I) plasma concentrations. Fish weights (representing growth rate) were only correlated with plasma IGF-I in non-transgenic fish, which suggests that transgenic fish may not be responding to or inducing levels of plasma IGF-I using normal mechanisms. For example, transgenic coho salmon may be insensitive to small changes in plasma IGF-I at such an elevated level due to the saturation of growth hormone receptor signaling. The increased plasma IGF-I concentrations in the transgenic fish agree with previous studies in mice (Mathews et al., 1988a; Blackburn et al., 1997; Sotelo et al., 1998) and fish (Foucher et al., 1992; Shimizu et al., 1999) that have shown an increase in IGF-I with increases in GH. Among transgenic fish on different diets, despite changes in growth between the groups, there were no differences in plasma IGF-I concentrations. Although diet did not affect plasma IGF-I, decreases in energy intake due to fasting have previously been shown to cause reduced plasma IGF-I in coho salmon (Duan and Plisetskaya, 1993; Shimizu et al., 1999; Pierce et al., 2001). 4.4 Gene m R N A Expression Gene expression data from size-matched transgenic and non-transgenic fish was found to be correlated with the presence/absence of the transgene in all transgenic body tissues tested and resulted in increased G H gene expression in transgenic fish. In some tissues, such as the hypothalamus, growth hormone receptor was increased in transgenic fish, a change which may have increased G H sensitivity of the neurons producing negative G H regulators. Increased IGF-I expression was accompanied by increased G H expression in transgenic fish, but a reduction in growth rate in these fish by decreasing the level of feed intake decreased hepatic IGF-I expression to that of non-transgenic controls. Little or no change occurred in the mRNA 116 expression of the other hormones in the G H axis viz., growth hormone-releasing hormone (GHRH), somatostatin (SS) and cholecystokinin (CCK). This result suggests that the major changes in growth likely stemmed from differences in G H and IGF-I interacting with other growth and appetite-regulating pathways. Furthermore, there were no changes in gene expression of any of the tested hormones within brain tissue from the diet experiment, with the exception of GHR in the pituitary. The absence of significant differences (other than GHR and IGF-I) that were observed for the hormones of the G H axis generally does not agree with data from studies on transgenic rodents in which increases in circulating G H were found to increase, somatostatin (Hurley et al., 1994; Szabo et al., 1995; Pellegrini et al., 1997) and decrease growth hormone-releasing hormone expression (Sato and Frohman, 1993; Flavell et al., 1996; Pellegrini et al., 1997). Furthermore, the difference in dietary energy intake between the different groups of transgenic coho salmon did not stimulate the suite of changes that would be expected in fish that had become GH resistant (Dauncey et al., 1994; Duan et al., 1995; Valente et al., 2003; Pierce et al., 2004). Some results are, however, concordant with other systems, such as the increase in GHR seen in the present experiment (Chen et al., 1991; Bartke et al., 1994; Chen et al., 1995; Gonzalez et al., 2001) and the rises in hepatic IGF-I mRNA expression and in plasma IGF-I concentrations (Du et al., 1992; Foucher et al., 1992; Shimizu et al., 1999; Pierce et al., 2004; Caelers et al., 2005; Pierce et al., 2005a). These data suggest that some but not all aspects of G H regulation are conserved among different vertebrate species. 4.5 Additional Research Questions To my knowledge this is the first survey of the gene expression of hormones that are involved in G H regulation and appetite control in the brain of a G H transgenic fish. A central assumption of this analysis is that mRNA expression accurately reflects protein synthesis and that synthesis is proportional to protein release and a subsequent change in growth and appetite physiology. This may not always be the case. For example, a decrease in G H release by cultured pituitary cells has occurred without changes to G H mRNA expression (Melamed et al., 1996; Ran et al., 2004) which may in part be explained by the different intracellular responses regulating G H secretion that are stimulated by different forms of the somatostatin protein (Yunker et al., 2003; Yunker and Chang, 2004). A mRNA assay that detects changes to the prepro-mRNA will not accurately determine which form of the protein that will be produced to have a specific effect on G H secretion. Most hormones of the G H axis are neuropeptides and as 117 such require a depolarization of the neuron for secretion to occur. Changes in mRNA expression may indicate enhanced intracellular protein synthesis but not protein release. Furthermore, post-transcriptional regulation of mRNA, post-translation packaging of protein in cellular organelles, and protein turnover will also affect protein synthesis and secretion. Despite the various stages controlling protein release after mRNA transcription, gene expression has been found to respond to hormone and diet manipulation in other studies on the G H axis (Duan et al., 1992; Duguay et al., 1994; Uchiyama et al., 1994; Pellegrini et al., 1997; Peyon et al., 1999; Fukada et al., 2004; Pierce et al., 2004; Saera-Vila et al., 2005), suggesting an immediate role of mRNA expression in hormonal change. Also, changes in gene expression are often associated with changes in the production of the hormones for which they encode (Devlin, 1984; Mathews et al., 1988a; Maniar et al., 1994; Duan et al., 1995; Pellegrini et al., 1997). The absence of significant differences in gene expression between groups in the present study, despite the observed differences in behaviour and growth, may have been due in part to changes in protein levels that are not apparent from mRNA expression. The development of salmonid radioimmunoassays for each hormone in the G H axis would be ideal but were not feasible (with the exception of IGF-I) in this experiment. Gene mRNA expression is an effective alternative to direct protein measurements and is commonly used in this field of study as a reliable indicator of hormonal change. Future studies on the protein levels of GH, GHR, G H R H , SS and C C K would be useful to complement the findings of this experiment. The purpose of this study was to determine general expression patterns of each of the hormones of interest and thus the assays were designed to detect conserved areas in alignments of multiple transcripts within and between related species. In future studies, it would be beneficial to determine whether different forms of each of these transcripts are regulated differentially within the brain. Further, many genes present in salmonids are anticipated to be duplicated due to the semi-tetraploid nature of their genomes (Ohno et al., 1967; Allendorf and Thorgaard, 1984). G H is present in two forms in addition to the transgene in coho salmon, all of which may be expressed differently (Mori and Devlin, 1999). GHR is found in two forms in coho salmon (GenBank #: AF403539, AF403540), rainbow trout (Very et al., 2005) and sea bream (Saera-Vila et al., 2005) in which expression of the two forms changes in different tissues (Saera-Vila et al., 2005). Furthermore, both somatostatin (Lin et al., 1999; Canosa et al., 2005) and cholecystokinin (Jensen et al., 2001) may have three different transcripts in coho salmon. Determining i f indeed these forms exist and their distribution across body tissues, will allow further research on their response to enhanced G H in transgenic salmon. 118 A considerable degree of growth regulation may be happening at the membrane-bound receptor level. G H R H receptor mRNA is reduced in somatotrophs of some G H transgenic mice (Szabo et al., 1995) but not others (Peng et al., 2001). SS receptors have been analyzed in the pituitary of G H transgenic mice where two forms, designated sst2 and sst5, did not change despite reductions in SS mRNA (Peng et al., 2001). Different forms of somatostatin trigger different intracellular responses in somatotrophs that affect G H release (Yunker et al., 2003; Yunker and Chang, 2004). Considerable research has also been done on the various N P Y receptors in the teleost brain and their impact on feed intake (Berglund et al., 2000; Narnaware and Peter, 2001b). Growth hormone receptor and IGF-I receptors are important in the formation of growth hormone and IGF-I binding proteins. The extracellular regions of these transmembrane proteins cleave to carry bound protein throughout circulation (Bartke et al., 1994; Duan, 1998; Calduch-Giner et al., 2000; Liao and Zhu, 2004). It is possible that a wide range of cellular responses, including gene expression, can be modified at the receptor level. It would be beneficial to clone the genes encoding these receptors in order to study the mechanisms in which they operate in G H transgenic coho salmon. Gene mRNA expression was analyzed for only a small selection of the hormones that influence GH production and regulate appetite. For example, it will be critical to complement the present studies with analyses of neuropeptide Y (NPY) mRNA expression in the brain of G H transgenic salmon. N P Y is a negative regulator of G H expression that acts through stimulation of SS neurons (Minami et al., 1997) or through direct contact with somatotrophs in fish (Mathieu et al., 2002). It is also a potent appetite stimulator in fish and N P Y gene expression is enhanced during starvation (Silverstein et al., 1996; Silverstein and Plisetskaya, 2000). As such, understanding the function of N P Y and how it may respond to increased G H production is vital to understanding feeding and growth in transgenic coho salmon. The gut-derived hormone, ghrelin, is also important as it has been recently cloned from goldfish in which it increases G H release and stimulates feed intake (reviewed by Unniappan and Peter, 2005). Another major regulator of feed intake, growth and lipid metabolism is leptin (Cai and Hyde, 1998), which has recently been cloned in rainbow trout (Zou et al., GenBank #: AM042713). When leptin is injected into goldfish, appetite is increased (Volkoff and Peter, 2001) and the effect of C C K is attenuated (Volkoff et al., 2003). C C K production by the gut (CCK mRNA expression in the gut and the response of transgenic coho salmon to C C K antagonists is presently under investigation by collegues in my lab) (Gelineau and Boujard, 2001; Kamisaka et al., 2001; Kamisaka et al., 2002) and many other hormones that impact appetite (Himick and Peter, 1994; de Pedro et al., 119 1995b; de Pedro et al., 1995a; Tritos and Maratos-Flier, 1999; Halford and Blundell, 2000) are likely affecting transgenic salmon as well and must be considered to fully understand appetite regulation in this system. The absence of significant differences in gene expression within tissues other than the liver and between the full-ration and restricted-ration fish in trial 1, and the transgenic fish fed the 21 MJ/kg and 15 MJ/kg diets in trial 2, may have occured because the differences in dietary energy intake were too small. Most studies that investigate changes in hormone expression and plasma concentrations have analyzed fully-fed and fully-starved groups (Olivereau et al., 1984; Duan and Plisetskaya, 1993; Bjornsson et al., 1994; Hua and Lin, 2001; Uchida et al., 2003; Valente et al., 2003; Pierce et al., 2004). Presently we have obtained brain samples from transgenic and non-transgenic fish under fed and prolonged starvation conditions. Many appetite regulating hormones may not change during the first four weeks of starvation (Silverstein, personal communication), likely due to adaptations to natural periods of low food supply in salmon. The results from this study combined with the analysis of N P Y (and potentially other appetite regulating hormones) will be very helpful in determining i f there are any other differences in the way that G H transgenic coho salmon regulate growth and appetite control. 4.6 Conclusions Transgenic coho salmon have greater feed intake and growth than non-transgenic counterparts which were respectively negatively and positively correlated with digestible energy of the diet. Dietary utilization of protein was more efficient in transgenic fish when they were fed diets that contained the 15 and 17 MJ/kg of digestible energy, suggesting that the enhanced growth seen in transgenic coho salmon may be supported on diets in which the digestible energy content is insufficient for growth of wild fish during the winter period when this study was conducted. Although growth was affected by dietary energy concentration, gene expression of the hormones involved in the GH-axis did not change between transgenic fish on the different diets. Plasma IGF-I was greater in transgenic fish but did not correlate with weight as in the non-transgenic coho salmon, possibly due to a reduced ability of the transgenic fish to respond to circulating IGF-I. In the size-matched study, G H expression was highest in transgenic fish, except in the pituitary where there were no differences. GHR expression generally followed that of G H but was tissue specific. IGF-I expression was highest in the transgenic fish and hepatic IGF-I levels in ration-restricted transgenic fish were reduced to that of non-transgenic fish, following the changes in dietary energy intake. There were no conclusive differences between 120 the size-matched groups in GHRH, SS or C C K expression. Transgenic fish, that had increased growth, feed intake and protein utilization, consumed food to meet an elevated energy demand possibly due to increased GH, GHR and IGF-I with little changes noted to the expression of other G H regulating hormones and the C C K satiety signal. Although this study did not resolve the underlying physiological basis for the increased feeding motivation of transgenic coho salmon, the research furthered our understanding of energy and nutrient use and growth regulation in these fish in response to both elevated growth hormone and changes in dietary energy and these findings provide a foundation for future studies in this area. 121 4.7 References Allendorf, F., Thorgaard, G., 1984. Tetraploidy and salmonid evolution. In: Turner, B. (Ed.), Evolutionary Genetics of Fishes. Plenum Press, New York, pp. 1-53. Bartke, A. , Turyn, D., Aguilar, C.C., Sotelo, A . L , Steger, R.W., Chen, X .Z . , Kopchick, J J . , 1994. Growth hormone (GH) binding and effects of G H analogs in transgenic mice. Proceedings of the Society for Experimental Biology & Medicine 206, 190-194. Berglund, M . M . , Lundell, I., Cabrele, C , Serradeil-Le Gal, C , Beck-Sickinger, A .G . , Larhammer, D., 2000. Binding properties of three neuropeptide Y receptor subtypes from zebrafish: Comparison with mammalian Y l receptors. Biochemical Pharmacology 60, 1815-1822. Bjornsson, B.T., Taranger, G.L., Hansen, T., Stefansson, S.O., Haux, C , 1994. The Interrelation between photoperiod, growth hormone, and sexual maturation of adult Atlantic salmon (Salmo salar). General & Comparative Endocrinology 93, 70-81. Blackburn, A. , Dressendoerfer, R.A., Blum, W.F., Erhard, M . , Brem, G., Strasburger, C.J., Wolf, E., 1997. Interactions of insulin-like growth factor (IGF)-II and growth hormone in vivo: Circulating levels of IGF-I and IGF-binding proteins in transgenic mice. European Journal of Endocrinology 137, 701-708. Caelers, A. , Maclean, N . , Hwang, G., Eppler, E., Reinecke, M . , 2005. Expression of endogenous and exogenous growth hormone (GH) messenger (m) R N A in a GH-transgenic tilapia (Oreochromis niloticus). Transgenic Research 14, 95-104. Cai, A. , Hyde, J., 1998. Upregulation of leptin receptor gene expression in the anterior pituitary of human growth hormone-releasing hormone transgenic mice. Endocrinology 139,420-423. Calduch-Giner, J.A., Duval, H. , Chesnel, F., Boeuf, G., Perez-Sanchez, J., Boujard, D., 2000. Molecular characterisation of growth hormone receptor in turbot (Psetta maxima). Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 126A, S21. Canosa, L.F., Unniappan, S., Peter, R.E., 2005. Periprandial changes in growth hormone release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide. American Journal of Physiology - Regulatory Integrative & Comparative Physiology 289, R125-R133. Chatakondi, N . , Lovell, R.T., Duncan, P.L., Hayat, M . , Chen, T.T., Powers, D.A., Weete, J.D., Cummins, K. , Dunham, R.A., 1995. Body composition of transgenic common carp, 122 Cyprinus carpio, containing rainbow trout growth hormone gene. Aquaculture 138, 99-109. Chen, N. -Y. , Chen, W.Y. , Bellush, L. , Yang, C.-W., Striker, L.J., Striker, G.E., Kopchick, J.J., 1995. Effects of streptozotocin treatment in growth hormone (GH) and GH antagonist transgenic mice. Endocrinology 136, 660-667. Chen, W.Y. , White, M.E. , Wagner, T.E., Kopchick, J.J., 1991. Functional antagonism between endogenous mouse growth hormone (GH) and a G H analog results in dwarf transgenic mice. Endocrinology 129, 1402-1408. Cook, J.T., McNiven, M.A. , Richardson, G.F., Sutterlin, A . M . , 2000. Growth rate, body composition and feed digestibility/conversion of growth-enhanced transgenic Atlantic salmon (Salmo salar). Aquaculture 188, 15-32. Dauncey, M.J. , Burton, K . A . , White, P., Harrison, A.P., Gilmour, R.S., Duchamp, C , Cattaneo, D., 1994. Nutritional regulation of growth hormone receptor gene expression. Faseb, 81-88. de Pedro, N . , Delgado, M . , Alonso-Bedate, M . , 1995a. Central administration of P-endorphin increases food intake in goldfish: pretreatment with opioid antagonist naloxone. Regulatory Peptides 55, 189-195. de Pedro, N . , Cespedes, M . , Delgado, M . , Alonso-Bedate, M . , 1995b. The galanin-induced feeding stimulation is mediated via a2-adrenergic receptors in goldfish. Regulatory Peptides 57, 77-84. Devlin, R.H., 1984. Gene expression in and development of trisomies of Drosophila melanogaster, Department of Zoology. University of British Columbia, Vancouver, pp. 293. Devlin, R.H., Yesaki, T.Y., Donaldson, E .M. , Du, S.J., Hew, C.L., 1995. Production of germline transgenic Pacific salmonids with dramatically increased growth performance. Canadian Journal of Fisheries and Aquatic Sciences 52, 1376-1384. Devlin, R.H., Swanson, P., Clarke, W.C., Plisetskaya, E., Dickhoff, W., Moriyama, S., Yesaki, T.Y., Hew, C.L., 2000. Seawater adaptability and hormone levels in growth-enhanced transgenic coho salmon, Oncorhynchus kisutch. Aquaculture 191, 367-385. Du, S.J., Gong, Z., Fletcher, G.L., Shears, M.A . , King, M.J . , Idler, D.R., Hew, C.L., 1992. Growth enhancement in transgenic Atlantic salmon by the use of an "all fish" chimeric growth hormone gene construct. Bio/technology 10, 176-181. 123 Duan, C , 1998. Nutritional and developmental regulation of insulin-like growth factors in fish. Journal of Nutrition 128, 306S-314S. Duan, C , Plisetskaya, E .M. , 1993. Nutritional regulation of insulin-like growth factor-I mRNA expression in salmon tissues. Journal of Endocrinology 139, 243-252. Duan, C , Duguay, S.J., Plisetskaya, E .M. , 1992. Hormonal regulation of insulin-like growth factor I (IGF-I) mRNA expression in coho salmon. American Zoologist 32, 13A. Duan, C , Plisetskaya, E . M . , Dickhoff, W.W., 1995. Expression of insulin-like growth factor I in normally and abnormally developing coho salmon (Oncorhynchus kisutch). Endocrinology 136, 446-452. Duguay, S.J., Swanson, P., Dickhoff, W.W., 1994. Differential expression and hormonal regulation of alternatively spliced IGF-I mRNA transcripts in salmon. Journal of Molecular Endocrinology 12, 25-37. Dunham, R.A., Chatakondi, N . , Nichols, A.J . , Kucuktas, H. , Chen, T.T., Powers, D.A., Weete, J.D., Cummins, K. , Lovell, R.T., 2002. Effect of rainbow trout growth hormone complementary D N A on body shape, carcass yield, and carcass composition of F l and F2 transgenic common carp (Cyprinus carpio). Marine Biotechnology 4, 604-611. Farmanfarmaian, A. , Sun, L.-Z. , 1999. Growth hormone effects on essential amino acid absorption, muscle amino acid profile, N-retention and nutritional requirements of striped bass hybrids. Genetic Analysis: Biomolecular Engineering 15, 107-113. Fauconneau, B., Mady, M.P., LeBail, P.Y., 1996. Effect of growth hormone on muscle protein synthesis in rainbow trout (Onchorynchus mykiss) and Atlantic salmon (Salmo salar). Fish Physiology and Biochemistry 15, 49-56. Fauconneau, B., Andre, S., Chmaitilly, J., Le Bail, P.-Y., Krieg, F., Kaushik, S.J., 1997. Control of skeletal muscle fibres and adipose cells size in the flesh of rainbow trout. Journal of Fish Biology 50, 296-314. Flavell, D., Wells, T., Wells, S., Carmignac, D., Thomas, G., Robinson, I., 1996. Dominant dwarfism in transgenic rats by targeting human growth hormone (GH) expression to hypothalamic GH-releasing factor neurons. The E M B O Journal 15, 3871-3879. Foster, A.R., Houlihan, D.F., 1991. The effect of ovine growth hormone on protein turnover in rainbow trout. General and Comparative Endocrinology 82, 111-120. Foucher, J.L., Le Bail, P.Y., Le Gac, F., 1992. Influence of hypophysectomy castration fasting and spermiation on SBP concentration in male rainbow trout Oncorhynchus-mykiss. General & Comparative Endocrinology 85, 101-110. Fu, C , Cui, Y . , Hung, S.S.O., Zhu, Z., 1998. Growth and feed utilization by F4 human growth hormone transgenic carp fed diets with different protein levels. Journal of Fish Biology 53,115-129. Fu, C., Cui, Y . , Hung, S.S.O., Zhu, Z., 2000. Whole-body amino acid pattern of F 4 human growth hormone gene-transgenic red common carp (Cyprinus carpio) fed diets with - different protein levels. Aquaculture 189, 287-292. Fukada, H. , Ozaki, Y . , Pierce, A . L . , Adachi, S., Yamauchi, K. , Hara, A. , Swanson, P., Dickhoff, W.W., 2004. Salmon growth hormone receptor: molecular cloning, ligand specificity, and response to fasting. General & Comparative Endocrinology 139, 61-71. Gelineau, A. , Boujard, T., 2001. Oral administration of cholecystokinin receptor antagonists increase feed intake in rainbow trout. Journal of Fish Biology 58, 716-724. Gonzalez, L., Sotelo, A . L , Bartke, A. , Turyn, D., 2001. Growth hormone (GH) and estradiol regulation of membrane-associated GH binding protein and G H receptors in G H releasing hormone transgenic mice. Growth Hormone & Igf Research 11, 34-40. Halford, J., Blundell, J., 2000. Separate systems for serotonin and leptin appetite control. Annals of Medicine 32, 222-232. Hi l l , J.A., Kiessling, A. , Devlin, R.H., 2000. Coho salmon (Oncorhynchus kisutch) transgenic for a growth hormone gene construct exhibit increased rates of muscle hyperplasia and detectable levels of differential gene expression. Canadian Journal of Fisheries and Aquatic Sciences 57, 939-950. Himick, B., Peter, R., 1994. Bombesin acts to suppress feeding behavior and alter serum growth hormone in goldfish. Physiology and Behavior 55, 65-72. Hua, Y . - M . , Lin, H.-R., 2001. Effects of different nutritional status on expression of IGF-I mRNA in immature Common carp liver. Acta Zoologica Sinica 47, 94-100. Hurley, D., Bartke, A. , Wagner, T., Wee, B., 1994. Increased hypothalamic somatostatin expression in mice transgenic for bovine or human G H . Journal of Neuroendocrinology 6, 539-548. Jensen, H. , Rourke, I., Moller, M . , Jonson, L., Johnsen, A. , 2001. Identification and distribution of CCK-related peptides and mRNAs in the rainbow trout, Onchorynchus mykiss. Biochimica et Biophysica Acta 1517, 190-201. Jhingan, E., Devlin, R.H., Iwama, G.K., 2003. Disease resistance, stress response and effects of triploidy in growth hormone transgenic coho salmon. Journal of Fish Biology 63, 806-823. Kamisaka, Y . , Totland, G.K., Tagawa, M . , Kurokawa, T., Suzuki, T., Tanaka, M . , Ronnestad, I., 2001. Ontogeny of cholecystokinin-immunoreactive cells in the digestive tract of Atlantic halibut, Hippoglossus hippoglossus, larvae. General & Comparative Endocrinology 123, 31-37. Kamisaka, Y . , Kaji, T., Masuma, S., Tezuka, N . , Kurokawa, T., Suzuki, T., Totland, G.K., Ronnestad, I., Tagawa, M . , Tanaka, M . , 2002. Ontogeny of cholecystokinin-immunoreactive cells in the digestive tract of bluefin tuna, Thunnus thynnus, larvae. Sarsia 87, 258-262. Krasnov, A. , Agren, J.J., Pitkanen, T.I., Molsa, H. , 1999. Transfer of growth hormone (GH) transgenes into Arctic charr (Salvelinus alpinus L.): II. Nutrient partitioning in rapidly growing fish. Genetic Analysis: Biomolecular Engineering 15, 99-105. Lee, C.G., Devlin, R.H., Farrell, A.P. , 2003. Swimming performance, oxygen consumption and excess post-exercise oxygen consumption in adult transgenic and ocean-ranched coho salmon. Journal of Fish Biology 62, 753-766. Liao, Z.-y., Zhu, S.-Q., 2004. Identification and characterization of G H receptor and serum G H -binding protein in Chinese sturgeon (Acipenser sinensis). Acta Biochimica et Biophysica Sinica 36, 811-816. Lin, X . , Otto, C.J., Peter, R.E., 1999. Expression of three distinct somatostatin messenger ribonucleic acids (mRNAs) in goldfish brain: Characterization of the complementary deoxyribonucleic acids, distribution and seasonal variation of the mRNAs, and action of a somatostatin-14 variant. Endocrinology 140, 2089-2099. Maniar, S., Martini, J.F., Villares, S., Delehaye-Zervas, M.C. , Kleinknecht, C., Postel-Vinay, M.C. , 1994. Hepatic growth hormone receptor (GHR) expression in experimental uremia: Role of anorexia. Journal of the American Society of Nephrology 5, 723. Martinez, R., Juncal, J., Zaldivar, C , Arenal, A . , Guillen, I., Morera, V . , Carrillo, O., Estrada, M . , Morales, A. , Estrada, M.P., 2000. Growth efficiency in transgenic tilapia (Oreochromis sp.) carrying a single copy of an homologous cDNA growth hormone. Biochemical & Biophysical Research Communications 267, 466-472. Mathews, L.S., Hammer, R.E., Brinster, R.L., Palmiter, R.D., 1988. Expression of insulin-like growth factor I in transgenic mice with elevated levels of growth hormone is correlated with growth. Endocrinology 123,433-437. Mathieu, M . , Tagliafierro, G., Bruzzone, F., Vallarino, M . , 2002. Neuropeptide tyrosine-like immunoreactive system in the brain, olfactory organ and retina of the zebrafish, Danio 126 rerio, during development. Brain Research. Developmental Brain Research 139, 255-265. Melamed, P., Gur, G., Elizur, A . , Rosenfeld, H. , Sivan, B., Rentier-Delrue, F., Yaron, A. , 1996. Differential effects of gonadotropin-releasing hormone, dopamine and somatostatin and their second messengers on the mRNA levels of gonadotropin II-beta subunit and growth hormone in the teleost fish, tilapia. Neuroendocrinology 64, 320-328. Minami, S., Suzuki, N . , Sugihara, H. , Tamura, H. , Emoto, E., Wakabayashi, I., 1997. Microinjection of rat G H but not human IGK-1 into a defined area of the hypothalamus inhibits endogenous G H secretion in rats. Journal of Endocrinology 153, 283-290. Mori, T., Devlin, R.H., 1999. Transgene and host growth hormone gene expression in pituitary and nonpituitary tissues of normal and growth hormone transgenic salmon. Molecular & Cellular Endocrinology 149, 129-139. Narnaware, Y . K . , Peter, R.E., 2001. Neuropeptide Y stimulates food consumption through multiple receptors in goldfish. Physiology & Behavior 74, 185-190. Ohno, S., Muramoto, J., Christian, L., Atkin, N . , 1967. Diploid-tetraploid relationship among old-world members of the fish family Cyprinidae. Chromosoma 23, 1-9. Olivereau, M . , Ollevier, F., Vandesande, F., Olivereau, J., 1984. Somatostatin in the brain and the pituitary of some teleosts immunocytochemical identification and the effect of starvation. Cell & Tissue Research 238, 289-296. Ostenfeld, T.H., McLean, E., Devlin, R.H., 1998. Transgenesis changes body and head shape in Pacific salmon. Journal of Fish Biology 52, 850-854. Pellegrini, E., Carmignac, D., Bluet-Pajot, M . , Mounier, F., Bennet, P., Epelbaum, J., Robinson, I., 1997. Intrahypothalamic growth hormone feedback: From dwarfism to acromegaly in the rat. Endocrinology 138, 4543-4551. Peng, X. -D. , Park, S., Gadelha, M.R., Coschigano, K.T., Kopchick, J.J., Frohman, L .A. , Kineman, R.D., 2001. The growth hormone (GH)-axis of G H receptor/binding protein gene-disrupted and metallothionein-human GH-releasing hormone transgenic mice: Hypothalamic neuropeptide and pituitary receptor expression in the absence and presence of GH feedback. Endocrinology 142, 1117-1123. Peyon, P., Saied, H. , Lin, X . , Peter, R.E., 1999. Postprandial, seasonal and sexual variations in cholecystokinin gene expression in goldfish brain. Molecular Brain Research 74, 190-196. Pierce, A . L . , Fukada, H. , Dickhoff, W.W., 2005. Metabolic hormones modulate the effect of growth hormone (GH) on insulin-like growth factor-I (IGF-I) mRNA level in primary culture of salmon hepatocytes. Journal of Endocrinology 184, 341-349. Pierce, A . L . , Beckman, B.R., Shearer, K.D. , Larsen, D.A., Dickhoff, W.W., 2001. Effects of ration on somatotropic hormones and growth in coho salmon. Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 128B, 255-264. Pierce, A . L . , Dickey, J.T., Larsen, D.A., Fukada, H. , Swanson, P., Dickhoff, W.W., 2004. A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of G H regulation of IGF-I gene expression in primary culture of salmon hepatocytes. General & Comparative Endocrinology 135, 401-411. Rahman, M.A. , Ronyai, A. , Engidaw, B.Z., Jauncey, K. , Hwang, G.L., Smith, A. , Roderick, E., Penman, D., Varadi, L. , Maclean, N . , 2001. Growth and nutritional trials on transgenic Nile tilapia containing an exogenous fish growth hormone gene. Journal of Fish Biology 59, 62-78. Ran, X.-Q. , L i , W.-S., Lin, H.-r., 2004. Regulation of the expression of growth hormone mRNA and the release of growth hormone by somatostatin and cysteamine in orange-spotted groupers Epinephelus coioides. Acta Zoologica Sinica 50, 222-230. Saera-Vila, A. , Calduch-Giner, J.-A., Perez-Sanchez, J., 2005. Duplication of growth hormone receptor (GHR) in fish genome: gene organization and transcriptional regulation of GHR type I and II in gilthead sea bream (Spams aurata). General & Comparative Endocrinology 142 193-203. Sato, M . , Frohman, L .A. , 1993. Differential effects of central and peripheral administration of growth hormone (GH) and insulin-like growth factor on hypothalamic GH-releasing hormone and somatostatin gene expression in GH-deficient dwarf rats. Endocrinology 133,793-799. Shimizu, M . , Swanson, P., Dickhoff, W.W., 1999. Free and protein-bound insulin-like growth factor-I (IGF-I) and IGF-binding proteins in plasma of coho salmon, Oncorhynchus kisutch. General & Comparative Endocrinology 115, 398-405. Silverstein, J., Plisetskaya, E., 2000. The effects of N P Y and insulin on food intake regulation in fish. American Society of Zoologists 40, 296-308. Silverstein, J., Breininger, J., Baskin, D., Plisetskaya, E., 1996. Neuropeptide Y abundance and gene expression in the salmon brain: A role in regulation of food intake. American Zoologist 36, 82A. Sotelo, A . L , Bartke, A. , Kopchick, J.J., Knapp, J.R., Turyn, D., 1998. Growth hormone (GH) receptors, binding proteins and IGF-I concentrations in the serum of transgenic mice expressing bovine G H agonist or antagonist. Journal of Endocrinology 158, 53-59. Stevens, E.D., Devlin, R.H., 2000. Intestinal morphology in growth hormone transgenic coho salmon. Journal of Fish Biology 56, 191-195. Sun, L., 1990. Effect of bovine growth hormone on fish growth and intestinal amino acid absorption, Diss. Abst. Int. Pt. B - Sci. & Eng., pp. 172. Szabo, M . , Butz, M . , Banerjee, S., Chikaraishi, D., Frohman, L. , 1995. Autofeedback suppression of growth hormone (GH) secretion in transgenic mice expressing a human G H reporter targeted by tyrosine hydroxylase 5'-flanking sequences to the hypothalamus. Endocrinology 139, 4044-4048. Tritos, N . , Maratos-Flier, E., 1999. Two important systems in energy homeostasis: melanocortins and melanin-concentrating hormone. Neuropeptides 22, 339-349. Uchida, K. , Kajimura, S., Riley, L.G. , Hirano, T., Aida, K. , Grau, E.G., 2003. Effects of fasting on growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 134A, 429-439. Uchiyama, T., Kaji, H. , Abe, H. , Chihara, K. , 1994. Negative regulation of hypothalamic growth hormone-releasing factor messenger ribonucleic acid by growth hormone and insulin-like growth factor 1. Neuroendocrinology 59, 441-450. Unniappan, S., Peter, R.E., 2005. Structure, distribution and physiological functions of ghrelin in fish. Comparative Biochemistry & Physiology. Part A , Molecular & Integrative Physiology 140, 396-408. Valente, L.M.P. , Le Bail, P.Y., Gomes, E.F.S., Fauconneau, B., 2003. Hormone profile in fast-and slow-growing strains of rainbow trout {Oncorhynchus mykiss) in response to nutritional state. Aquaculture 219, 829-839. Very, N . M . , Kittilson, J.D., Norbeck, L .A. , Sheridan, M.A. , 2005. Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry & Physiology. Part B, Biochemistry & Molecular Biology 140, 615-628. Volkoff, H. , Peter, R., 2001. Characterization of two forms of cocaine- and amphetamine-regulated transcript (CART) peptide precursors in goldfish: Molecular cloning and 129 distribution, modulation of expression by nutritional status, and interactions with leptin. Endocrinology 142, 5076-5088. Volkoff, H. , Eykelbosh, A.J . , Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: Interactions with cholecystokinin, neuropeptide Y and orexin A , and modulation by fasting. Brain Research 972, 90-109. Yunker, W.K., Chang, J.P., 2004. Somatostatin-14 actions on dopamine- and pituitary adenylate cyclase-activating polypeptide-evoked Ca2+ signals and growth hormone secretion. Journal of Neuroendocrinology 16, 684-694. Yunker, W.K., Smith, S., Graves, C , Davis, P.J., Unniappan, S., Rivier, J.E., Peter, R.E., Chang, J.P., 2003. Endogenous hypothalamic somatostatins differentially regulate growth hormone secretion from goldfish pituitary somatotropes in vitro. Endocrinology 144, 4031-4041. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0092571/manifest

Comment

Related Items