Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Interactions between the extracellular and transmembrane domains of IG-alpha/beta heterodimer are required… Dylke, Janis 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-0034.pdf [ 14.13MB ]
Metadata
JSON: 831-1.0092462.json
JSON-LD: 831-1.0092462-ld.json
RDF/XML (Pretty): 831-1.0092462-rdf.xml
RDF/JSON: 831-1.0092462-rdf.json
Turtle: 831-1.0092462-turtle.txt
N-Triples: 831-1.0092462-rdf-ntriples.txt
Original Record: 831-1.0092462-source.json
Full Text
831-1.0092462-fulltext.txt
Citation
831-1.0092462.ris

Full Text

INTERACTIONS BETWEEN THE E X T R A C E L L U L A R A N D T R A N S M E M B R A N E DOMAINS OF THE JG-a/(3 HETERODIMER A R E REQUIRED FOR BCR A S S E M B L Y A N D C E L L SURFACE EXPRESSION by JANIS D Y L K E Bachelor of Science, University of British Columbia, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF MASTER OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES (Zoology) THE UNIVERSITY OF BRITISH C O L U M B I A November 2005 © Janis Dylke, 2005 ABSTRACT The B cell antigen receptor (BCR) is expressed on the surface of B-lymphocytes where it binds antigen and transmits signals that regulate B cell activation, growth and differentiation. The B C R is composed of membrane IgM (mlgM) and two signaling proteins, Ig-a and Ig-(3. If either of the signaling proteins is not expressed, the incomplete mlgM-containing B C R w i l l not traffic to the cell surface. Our hypothesis is that specific protein:protein interactions between both the extracellular and transmembrane (TM) regions o f Ig-a and Ig-P are necessary for receptor assembly, cell surface expression and effective signaling to support the proper development of B cells. While previous work has shown the importance of the T M region in B C R assembly, this study indicates that a heterodimer of the extracellular domains of Ig-a and Ig-P are also required for proper association with m l g M . Cel l lines expressing mutated Ig-a proteins that did not heterodimerize with Ig-P in the extracellular and T M domains were unable to properly assemble the B C R . Conversely, an Ig-a mutant with an Ig-P cytoplasmic tail (CP (a/a/p)) was able to assemble with the rest of the B C R and traffic to the cell surface. Thus, both the extracellular and T M regions i f the Ig-a/Ig-P must be properly associated in order for the B C R to assemble. Additionally, an Ig-a mutant with a truncated cytoplasmic domain ( A a K V K (a/a/0)) was not able to associate with Ig-P, indicating that the cytoplasmic domain may play a role in B C R assembly. Further studies with truncation mutants are required to confirm this result. In the future additional Ig-a/Ig-P mutants w i l l be expressed to better define the regions o f proteimprotein interactions. i i T A B L E O F C O N T E N T S Abstract ii Table of Contents iii List of Tables vi List of Figures vii List of Abbreviations ix Acknowledgements xi CHAPTER 1: Introduction 1 1.1 The innate and adaptive immune systems 1 1.2 The BCR during B cell development 2 1.3 BCR structure 5 1.3.1 Membrane immunoglobulin 6 1.3.2 Ig-oc and Ig-p 9 1.3.3 The four chain BCR . 1 0 1.4 BCR assembly and cell surface expression 11 1.5 BCR signalling and antigen processing 13 1.6 BCR mutations 15 1.6.1 BCR mutations affect B cell development. 15 1.6.2 BCR mutations affect BCR cell surface expression 17 1.7 Purpose of thesis study 19 CHAPTER 2: Materials and Methods 25 2.1 Reagents 25 2.1.1 Antibodies . 25 2.1.2 Plasmids 26 2.1.3 Plasmids created 26 2.2 Molecular Biology Techniques . . . . .- 43 2.2.1 Restriction endonuclease digestion 43 2.2.2 Agarose gel electrophoresis 43 2.2.3 Gel purification of DNA fragments . . . . . . . . . . . . . . 43 iii 2.2.4 Ligation of D N A fragments 43 2.2.5 Transformation of competent E. coli 44 2.2.6 Small scale D N A preparation 44 2.2.7 Large scale D N A preparation 44 2.2.8 Polymerase chain reaction 45 2.2.9 Site-directed mutagenesis 45 2.3 Tissue culture 45 2.3.1 Tissue culture cell lines 45 2.3.2 Culture of cell lines 46 2.3.3 Ce l l lysis 47 2.4 Transfection o f B O S C cells 48 2.5 Retroviral infection of cells 48 2.5.1 Retroviral infection of AtT20 cells 48 2.5.2 Retroviral infection of J558 plasmacytoma cells 49 2.5.3 Drug selection and clone isolation of infected cells 49 2.6 hnmunoprecipitations 50 2.7 S D S - P A G E and Western immunoblotting 51 2.8 Surface expression of the B C R 51 2.8.1 Fluorescent activated cell sorting 51 2.8.2 Cel l surface immunofluorescence by microscopy 52 CHAPTER 3: Establishing the Experimental System 53 3.1 Screening antibodies for immunoblotting and immunoprecipitation 53 3.2 Construct expressibility in B O S C cells 56 3.3 Experimental cell systems 56 3.3.1 AtT20 non-lymphoid expression system 56 3.3.2 J558 lymphoid expression system 56 3.4 Expression of constructs in AtT20 and J558 cell lines ' 58 CHAPTER 4: BCR Assembly and Cell Surface Trafficking 60 4.1 Introduction 60 4.2 B C R assembly 60 4.2.1 B C R assembly with the C a (pVpVa) construct 60 4.2.2 B C R assembly with the Xoc2 (a/p/p) construct 61 4.2.3 B C R assembly with the CP (oc/a/p) construct 61 4.2.4 B C R assembly with the AocKVK (a/oc/0) construct 65 4.2.5 B C R assembly with the A X a (0/a/a) construct 65 4.3 B C R cell surface expression 68 i v CHAPTER 5: Discussion 7 0 5.1 Summary of results and discussion of future directions 70 5.2 Further discussion 7 ^ 77 Reference List ' ' Appendix ° v LIST OF TABLES Table 1.1 Summary of mutant constructs 22 Table 1.2 Summary of results from Ig-a mutant constructs 24 Table 2.1 Oligonucleotide primers used for site-directed mutagenesis reactions 30 Table 2.2 Oligonucleotide primers used for polymerase chain reaction (PCR) 42 Table 3.1 Reactivity of the Abeome antibodies to Ig-a or Ig-(3 54 Table 5.1 Summary of results 71 vi LIST OF FIGURES Figure 1.1 Diagram showing the proposed structure of an mlgM-containing B cell antigen receptor (BCR) on the surface of the cell 3 Figure 1.2 The structure of the B C R 7 Figure 1.3 The top view of the m l g M transmembrane region showing the a helix structure 8 Figure 1.4 Depiction of mutant B C R s on the cell surface to display the interactions that could occur between mutant Ig-a constructs and the rest of the B C R . . . 23 Figure 2.1 Creation of the p M X - p u r o - A a K V K expression vector 28 Figure 2.2 Creation of thepMSCV-puro-Cfi and/? WZL-Blast3-Cfi expression vectors. . . 29 Figure 2.3 Creation of the pMSCV-puro-Xa2 and pWZL-Blast3-Xa2 expression vectors 33 Figure 2.4 Creation of the pWZL-Blastl-Ca expression vector 34 Figure 2.5 Creation of the pMIGRJ-Xfi expression vector 35 Figure 2.6 Creation of the pMSCV-puro-MPa and pWZL-Blast3-MPa expression vectors 36 Figure 2.7 Creation of the pMSCV-puro-MPfi and pWZL-B last 3-MP$ expression vectors 39 Figure 2.8 Creation of the pMSCV-puro-AXa and pWZL-Blast3-AXa expression vectors 40 Figure 2.9 Creation of the pMSCV-puro-AXfi and pWZL-Blast3-AX$ expression vectors 41 Figure 3.1 Antibody screening by immunoblotting 55 Figure 3.2 Expression of mutant Ig-a and Ig-P constructs in B O S C human fibroblast cells 57 Figure 3.3 Transient expression of mutant Ig-a constructs in J558 mouse plasmacytoma cells and stable expression of mutant Ig-a constructs in AtT20 non-lymphoid cells 59 vii Figure 4.1 Transient expression of the C a construct in J558 mouse plasmacytoma cells and the association of C a with Ig-p and m l g M 62 Figure 4.2 Transient expression of the X a 2 construct in J558 mouse plasmacytoma cells and the association of X a 2 with Ig-P and m l g M 63 Figure 4.3 Transient expression of the CP construct in J558 mouse plasmacytoma cells and the association of CP with Ig-p and m l g M 64 Figure 4.4 Stable expression of A a K V K in AtT20 non-lymphoid cells and the association of A a K V K with Ig-P and m l g M 66 Figure 4.5 Stable expression of A X a in AtT20 non-lymphoid cells and the association of A X a with Ig-P and m l g M 67 Figure 4.6 Fluorescence activated cell sorting (FACS) of J558 cells expressing C a , X a 2 or Cp 69 v m LIST OF ABBREVIATIONS A P C - antigen presenting cell B C A - bicinchoninic acid B C L L - B cell chronic lymphocytic leukemia B C R - B cell receptor B L N K - B cell linker adapter protein C region- constant region D A G - D-acetyl-glycerol D M E M - Dulbecco's modified Eagle medium D N A - deoxyribonucleic acid D T T - dithiothreitol E C L - enhanced chemiluminescence E D T A - ethylenediaminetetraacetic acid E R - endoplasmic reticulum F A C S - fluorescent activated cell sorting F C S - fetal calf serum H chain- heavy chain H R P - horseradish peroxidase IT A M - Immunoreceptor tyrosine-based activation motif L chain- light chain L T R - long terminal repeat M I I C - M H C class-II containing compartment M H C - major histocompatibility complex mlg- membrane immunoglobulin P A G E - polyacrylamide gel electrophoresis P B S - phosphate buffered saline P C R - polymerase chain reaction PI3K- Phosphatidylinositol-3 phosphate kinase PMSF-phenylmethylsulfonyl fluoride R P M I - Roswell Park Memorial Institute SDS- sodium dodecyl sulfate SH2- Src homology 2 domain T B E - tris-buffered E D T A T B S - tris-buffered saline T B S T - T B S with 0.1% Tween 20 T L R - toll-like receptor V region- variable region ACKNOWLEDGEMENTS I would like to thank my supervisor, Dr. Linda Matsuuchi, for allowing me to work on this project and helping me through my Master's degree. Y o u have been a wonderful teacher and very supportive of my decision to pursue a dental career. Thank you! I would also like to thank my lab mates. Firstly, thank you to M a y Dang-Lawson for showing me how to do almost all of my experiments, you are an incredibly patient person! Also , thank you to Teresa Corkin for putting a positive spin on negative experimental results, or for at least sharing a horror story of your own. Finally, thank you to Steve Machtaler for keeping me thoroughly entertained every day in the lab. Good luck with your PhD! I would also like to thank my parents for their continual love and support. Completing this thesis has been a lot of work and I would not have been able to do it without your encouragement. Finally, I would like to thank T im for putting up with all my late nights in the lab and for being so incredibly supportive of everything I do in life. x i CHAPTER 1 Introduction 1.1 The innate and adaptive immune systems Mammals are continually exposed to a barrage of foreign pathogens that can invade and infect the body, and the immune system is essential in combating this ever-present threat. In mammals, the immune system can be divided into two parts: the innate immune system and the adaptive or acquired immune system. The former is responsible for the initial recognition and destruction of foreign pathogens while the latter ensures that re-infection by the same microorganism does not occur. Without the immune system, mammals would be unable to overcome the attack of infectious microorganisms (Leonard, 2001). The innate immune system is the non-specific branch of the immune system. It is composed of cells that identify foreign pathogens by recognizing cell surface markers specific to bacterial cells. For example, macrophages can recognize bacterial cells through their Toll-l ike receptors (TLRs). T L R s are cell surface proteins that bind to common, repeating, foreign components on pathogens such as glycolipids, lipoproteins, lipopolysaccaride and bacterial deoxyribonucleic acid ( D N A ) (Akira et al., 2001, Kobayashi et al, 2002). Once the macrophages recognize a foreign pathogen they destroy it by phagocytosis. Alternatively, body cells that have been infected with foreign pathogens can be destroyed by natural killer cells (Lanier, 2005). Although the innate immune system is a very effective system in preventing most microbial invasions, occasionally some pathogens evade the innate immune system and begin to multiply in the host. This is where the role of the more specific adaptive immune system comes into play. The adaptive immune system has the ability to mount an immune response to specific antigenic targets produced by invading pathogens. The primary cells responsible for this response are B and T lymphocytes found in the blood, lymph and lymphoid organs. T lymphocytes develop in the thymus to become either cytotoxic T cells, helper T cells or T regulatory cells. The cytotoxic T cells assist in the destruction of cells that have already been infected by a foreign pathogen, whereas the helper and regulatory T cells activate other cells in the immune system (Maekawa 1 and Yasutomo, 2005). In mammals, B cells develop in the bone marrow and are responsible for the production of antibodies. The advantage of the adaptive immune system is that the memory cells produced prevent re-infection because they can recognize and eliminate specific pathogens that have previously infected the body at a faster rate and more efficiently than i f the pathogens were novel microorganisms that were just encountered (Alt et al, 1987). The series of events that occurs during an infection involves cells from both the adaptive and innate immune systems. Initially, antigen presenting cells (APCs) , which include macrophages, dendritic cells and B cells, engulf the invading pathogen, which is then proteolytically degraded into peptides. These peptides are bound to major histocompatibility ( M H C ) molecules within the antigen processing components of the A P C and presented on the cell surface. The MHC:peptide complex is recognized by naive T lymphocytes that subsequently proliferate and differentiate into helper T cells (Melief, 2003). The helper T cells activate B cells by releasing growth factors so the B cells w i l l produce antibodies against the pathogen. Helper T cells also activate cytotoxic T lymphocytes to k i l l somatic cells that are expressing peptides from that particular pathogen (Maekawa and Yasutomo, 2005). This series of events allows the body to rid itself of the microorganism. 1.2 The B C R dur ing B cell development The B cell antigen receptor (BCR) is a key regulator of B lymphocyte activation, growth and differentiation. It is expressed on the surface of B lymphocyte cells and is composed of a ligand binding receptor (membrane immunoglobulin; mlg) and a signalling component (Ig-oc/p) (Figure 1.1) (Hombach et al., 1990). B cell development in the bone marrow requires that the B C R s signal to the cell when a functional receptor has trafficked to the cell surface and i f the B C R binds to self antigen. This prevents non-functional and self-reactive B cells from escaping into the periphery. Once the B cell enters the periphery, the B C R binds foreign antigens and signals to the cell to proliferate and differentiate into an antibody producing plasma cell or a long-lived memory cell (Shapiro-Shelef and Calame, 2005). This allows the body to combat novel microorganisms and to keep a B cell repertoire that is reactive to microorganisms that have been previously encountered, allowing a faster immune response i f reinfection occurs. In this sense, the functionality of the B C R is essential for the immune system to successfully eliminate foreign 2 mlgM L_ L chain Extracellular Plasma membrane Disulfide bonds Cytoplasmic Ig-oc • signalling component Figure 1.1 Diagram showing the proposed structure of an mlgM-con ta in ing B cell antigen receptor ( B C R ) on the surface of the cell. This shows the antigen binding component (mlgM) composed of the H and L chains and the signalling component composed of Ig-a and Ig-P (Hombach et al, 1990). 3 pathogens. In addition, a non-functional B C R can lead to autoimmune diseases and B cell leukemias and lymphomas (Thompson et al, 1997; Payelle-Brogard et al, 1999). The rearrangement and expression of the heavy (H) and light (L) chain genes characterize the stages of B cell development in the bone marrow. This rearrangement is what accounts for antigen specificity of individual B cells. Gene rearrangement first occurs in the stem cell derived pro-B cells that express Ig-a and Ig-p, but do not yet express membrane Ig (mlg). The Ig-a and Ig-p proteins associate with the endoplasmic reticulum (ER) chaperone protein, calnexin, and appear on the surface o f the cell. Although calnexin is normally an E R resident protein, it can be found of the surface of pro-B cells where it may signal (Nagata et al., 1997). Once pro-B cells undergo heavy chain locus rearrangement and produce a membrane bound H chain they are considered pre-B cells. This is the first stage that a complete B C R is expressed on the cell surface because, although pro-B cells express Ig-a/p, they do not express any H or L chains. The pre-BCR is composed o f the rearranged heavy chain, a surrogate light chain and the Ig-a and Ig-P signalling proteins. The surrogate light chain is made up of two proteins, VpreB and A.5 (Martensson and Ceredig, 2000). If the pre-BCR successfully reaches the cell surface, the cell begins light chain rearrangement. A successful light chain gene rearrangement allows the cells to express the heavy and light chain proteins as part o f the B C R . A t this stage the completed B C R signals through Ig-a and Ig-P, and the cell is considered an immature B cell (Reth, 1991). These immature B cells then undergo selection in the bone marrow so that the body can eliminate any self-reactive cells. If the B C R recognizes a self-antigen then that cell w i l l go through clonal deletion and be removed from the B cell repertoire. Alternatively, it w i l l undergo receptor editing that w i l l change the sequence of the m l g M variable region so that it is no longer self-reactive, or w i l l migrate to the periphery, but w i l l not be active. If the B C R does not react to self antigen the cell w i l l enter the periphery and develop into a mature B cell (Gold, 2002). The expression of another heavy chain isoform distinguishes the mature from the immature B cell. Alternative m R N A splicing determines whether or not the H chains wi l l be u. or 5 H chains that result in a B C R of either m l g M or mlgD type, respectively (Venkitaraman et al., 1991). 4 Both m l g M and mlgD B C R s signal through the same Ig-a/p signalling proteins that are associated with them, and the B C R s have the same antigen specificity. Mature B cells primarily express the mlgD form of the B C R (Campbell et al, 1991, Havran et al, 1984). Mature B cells that have not yet encountered an antigen are considered naive B cells. Upon encountering antigen they proliferate and differentiate into antibody producing plasma cells or memory cells. If the cell develops into an antibody producing plasma cell, it secretes another form of the H chain that does not have a transmembrane sequence. The secreted H chain is formed through alternate splicing of the H chain m R N A (Rogers et al, 1980). The secreted antibodies then bind to foreign pathogens in the periphery and target them for destruction by phagocytosis or for lysis by complement (James, 1982; Shapiro-Shelef and Calame, 2005). 1.3 BCRstructure The B cell receptor (BCR) is found on the surface of B cells. It is composed of an antigen binding component (mlg) and a signalling component (Figure 1.1). The mlg is comprised of two membrane immunoglobulin H chains linked by a disulfide bond and two immunoglobulin L chains linked to the H chains by a disulfide bond. Alternative m R N A splicing determines whether or not the B C R contains a mlg of either m l g M or mlgD (Venkitaraman et al, 1991). Mature B cells primarily express the mlgD form of the B C R (Havran et al, 1984). Memory cells and plasma cells can also express B C R s on their cell surface. Surface B C R s can be of all five isotypes of mlg (mlgM, mlgD, mlgA, mlgG, mlgE) and all are normally associated with the Ig-a/p heterodimer (Venkitaraman et al, 1991). Differential cleavage and polyadenylation of the mlg R N A sequence produces a secreted Ig complex that is lacking the transmembrane and cytoplasmic domains (Rogers et al, 1980). Each B cell expresses B C R s with variable regions that are specific for different potential antigens. The mlg component of the m l g M B C R is unable to signal due to its short cytoplasmic domain, therefore it must associate with two signalling proteins, Ig-a and Ig-P, to form the complete functional B C R (Hombach et al, 1990). Ig-a and Ig-P are disulfide-linked, transmembrane proteins that are non-covalently associated with mlg. The current model suggests that one heterodimer of Ig-a/p associates with one mlg complex (Schamel and Reth, 2000). Ig-a and Ig-P are found on the surface of B cells during the early stages of B cell development. Antigen 5 binding or cross-linking of the B C R results in signalling mediated by the Ig-oc/p heterodimer (Reth, 1991) (see section 1.5). 1.3.1 Membrane Immunoglobulin (mlg) The ligand, or antigen binding portion, of the B C R is a membrane Ig. The H chain protein of m l g M has a large extracellular domain, a transmembrane domain and a small cytoplasmic domain (Figure 1.2). In mice, the extracellular domain has a variable ( V ) , 110 amino acid V D J H region at the N-terminus that is followed by four 110 amino acid constant (C) regions. Each region is a barrel shaped structure and is composed of P-pleated sheets. This structure is maintained with a disulfide bond that holds the sheets together. The H chain protein of m l g M bends between the second and third barrel region (Davies and Metzger, 1983). The transmembrane portion of the protein is proposed to be an a helix consisting of 26 amino acids that span the l ipid bilayer (Figure 1.3) (Rogers et al., 1980). Thirteen o f those amino acids are highly conserved among different immunoglobulin isotypes, and 11 of those 13 are proposed to line up on one side of the helix suggesting that they, or that side of the helix, may be important for interaction with other molecules. The transmembrane region is not composed entirely of hydrophobic amino acids, as is seen with many transmembrane proteins. There are 9 polar amino acids in the transmembrane region of m l g M . This suggests that the H chain transmembrane region could be interacting with the transmembrane regions o f other proteins since one might predict that polar amino acids should be hidden or shielded in the lipid bilayer (Reth, 1992). The cytoplasmic region of the murine u, H chain is very short, consisting o f only three amino acids, lysine, valine, lysine ( K V K (single letter amino acid code)). This sequence is also identical in mice, humans and sharks (Reth, 1992). The same three amino acids also make up the cytoplasmic domain of human and mouse mlgD (Reth, 1992). 6 region Ig-a Ig-p Figure 1.2 The structure of the B C R . This shows the looped barrel domains (variable (V) and constant (C) regions), the intramolecular disulfide bonds (dashed lines), the proposed extracellular glycosylation sites (O), the alpha helical transmembrane region and the cytoplasmic tails with the IT A M regions (adapted from Abbas et al, 2000). 7 conserved polar side Figure 1.3 The top view of the mlgM transmembrane region showing the a helix structure (Reth, 1992). Polar amino acids are shaded. Evolutionarily conserved amino acids are represented with a star (ft). Amino acidQ]is at the extracellular side of the transmembrane region and amino acid 25 is at the cytoplasmic side. Single letter amino acid code is used. 8 The L chain protein is linked to the H chain protein by a disulfide bond in its C region. The L chain is a 25 k D a molecule. The variable region of the L chain is at the N-terminus of the protein and the C region is at the C-terminus. The variable region is composed o f two p sheets with four and five amino acid strands composing each sheet. The C region is composed of two p sheets with three and four strands making up each sheet. These form into two barrel shapes and are stabilized with a disulfide bond (Figure 1.2) (Edelman, 1991). The barrel shape is highly conserved among immunoglobulin molecules and is known as the immunoglobulin fold (Siden et al, 1981). Together the H and L chain proteins make up the antigen binding portion of the B C R . 1.3.2 Ig-a and Ig-P The signalling portion of the B C R is composed of a heterodimer of Ig-a and Ig-p. Ig-a is a transmembrane glycoprotein with the predicted membrane topology shown in Figure 1.2. The extracellular portion of murine Ig-a is composed of 109 amino acids. The amino acid sequence indicates that the extracellular regions o f Ig-a fold into a barrel domain similar to those seen in the H and L chains. There are two cysteine residues (50 and 101) that form a disulfide bond between the P sheets in the extracellular region. Another cysteine residue (113) forms a disulfide bond with Ig-p. Ig-a also two has glycosylation sites at amino acids 58 and 68 (Sakaguchi et al, 1988, Hombach et al, 1988). The transmembrane and cytoplasmic domains are predicted a helices consisting o f 22 and 61 amino acids, respectively (Reth, 1992). The transmembrane domain of Ig-a contains two polar amino acids (Hombach et al, 1999). The cytoplasmic domain has a highly conserved immunoreceptor tyrosine-based activation motif ( ITAM) with the amino acid sequence D / E X 7 D / E X 2 Y X 2 L / I X 7 Y X 2 L / I (Reth, 1989). Additionally, the cytoplasmic domain has two other tyrosine residues (176 and 204). Phosphorylation of these residues recruits the B cell linker proteins Vav and Grb2. Activated B cells lacking these residues do not present antigen to T cells, indicating that tyros ine]76,204 phosphorylation is important for intracellular trafficking o f the receptor after antigen crosslinking (Siemasko, 2002). The residue at position 204 may also have a role in binding the SH2 domain of the adaptor protein B L N K (Baba et al, 2001, Kabak et al, 2002) 9 The Ig-P protein is similar in structure to Ig-a. The extracellular region of Ig-p is composed of 129 amino acids that form P sheets. There are four cysteine residues that form two intramolecular disulfide bonds (43:124 and 65:120) and an additional cysteine residue (135) that forms the disulfide bond with Ig-a. The extracellular domain also has three glycosylation sites (68, 99, 130) (Hermanson et al, 1988). The transmembrane region, like Ig-a, is an a helix composed of 22 amino acids. The transmembrane domain of Ig-P contains two polar amino acids (Hermanson et al, 1988). The cytoplasmic tail consists o f 48 amino acids and has an I T A M domain. The I T A M sequence for both Ig-a and Ig-P is conserved in different species indicating that protein function requires that the sequence remains unchanged (Reth, 1989). Tyrosine phosphorylation of the I T A M domains by Src-family tyrosine kinases leads to interaction with the SH2 domains of Syk, a protein tyrosine kinase, resulting in the activation of numerous downstream intracellular signalling cascades (Gold, M . R. , 2002) . Murine Ig-P, unlike Ig-a, does not contain any additional tyrosine residues (Reth, 1989). The Ig-a/p heterodimer makes up the signalling portion of the B C R . 1.3.3 The Fou r C h a i n B C R The four different components that make up the B C R (H chains, L chains, Ig-a and Ig-p) interact through covalent and non-covalent bonds. Disulfide bonds jo in the two H chains, the L and H chains and Ig-a and Ig-P to each other. A model of how these chains could interact is shown in Figure 1.1 with the transmembrane portion of m l g M interacting noncovalently with Ig-a/p. The current model of B C R structure suggested by Schamel and Reth (2000) indicates that only one Ig-a/p heterodimer is associated with a mlg complex to make up the B C R as opposed to two heterodimers. They found that when a cell line was created that expressed both a tagged and untagged form of Ig-a, there were never any B C R complexes that contained both forms of the Ig-a protein. This indicates that there must only be one heterodimer of Ig-a/p per mlg molecule. If there were two heterodimers per molecule, as was previously hypothesized, then there should be some complexes with both forms of Ig-a. Additionally, Schamel and Reth (2000) supported their model by radiolabeling cells with 3 5S-methionine and allowing the radiolabeled amino acid to incorporate into cellular proteins. They then quantified and compared the known number of methionine molecules contained in each component of the B C R complex to their data and 10 determined that the B C R complex contained only one Ig-a/p heterodimer. The difficulty with this model comes in reconciling how the single heterodimer associates with the mlg molecule. The mlg complex has two predicted polar patches in its transmembrane region (see Figure 1.3) that need to be covered over by association with Ig-a/p or perhaps by some other component. It is hypothesized that one of the proteins in the heterodimer could associate with both polar regions or each heterodimer protein could associate with a different polar region, but this-remains unknown (Matsuuchi and Gold, 2001). This idea led to the controversial proposal by Schamel and Reth (2000) that the B C R is present as an oligomer on the cell surface. They suggest that the polar amino acids on one side of the transmembrane region of mlg interact with Ig-a/p and that the polar amino acids on the other side interact with other B C R complexes. This creates a cluster of B C R s in one location. This model is controversial and yet to be confirmed or disproved. 1.4 B C R assembly and surface expression B lymphocyte chaperone proteins play a vital role in ensuring that intact B C R s are expressed on the cell surface. Because B C R signalling is required for B cell development and differentiation it is important that all the components of the B C R are properly folded and associated with one another on the cell surface. Without chaperone proteins controlling B C R assembly and lymphocyte development could be severely impaired. This could have profound effects on the adaptive immune system. In order for the mlgM-containing B C R to be expressed on the cell surface, all four components of the receptor must pass through quality control mechanisms within the E R and be trafficked to the plasma membrane. Intermediate forms of assembled B C R chains are held in the E R by chaperone proteins until assembly is complete. If one or more components of the B C R are not expressed, then the remaining B C R proteins remain trapped in the E R (Matsuuchi et al, 1992; Venkitaraman et al, 1991). If a protein is incorrectly folded, mutated or improperly assembled, it w i l l remain in the E R , bound by chaperone proteins, until it can be degraded in the cytoplasm by proteosomes (Fagioli and Sitia, 2001; Foy and Matsuuchi, 2001). In order to ensure that unfolded proteins do not escape the E R , chaperone proteins contain amino acid sequences that identify them as E R resident proteins. A s long as a chaperone is bound to an 11 unfolded protein, neither of the proteins w i l l be permitted to leave the E R . Soluble E R resident chaperones, such as B i P , contain an H / K D E L amino acid sequence that binds to the membrane associated K D E L receptor. This receptor keeps the chaperone in the E R or returns it to the E R i f it is found in the Golgi (Nilsson and Warren, 1994; Teasdale and Jackson, 1996). Membrane bound proteins, such as calnexin, contain a K K X X sequence on their cytoplasmic tails which ensures their retention in the E R (Teasdale and Jackson, 1996). E R localization of chaperone proteins also makes sure that target proteins can not escape until properly folded and assembled into complexes. Chaperone proteins recognize and bind to newly synthesized proteins using common mechanisms. Generally, chaperones function by recognizing properties universal to unfolded or unassembled proteins. For example, they may bind to exposed hydrophobic patches, sulfhydryl groups or oligosaccharides, or to groups of proteins that have formed large aggregates. This method of binding allows the chaperones to recognize many different proteins rather than just those with a particular amino acid sequence (Hammond and Helenius, 1995). Many different chaperone proteins are present in the E R at any given time, therefore it is important that the correct chaperones interact with the correct target proteins to ensure proper folding. It is believed that the position of the glycans in the glycoprotein sequence may determine the order in which the target proteins interact with certain chaperone proteins (Ellgaard and Helenius, 2001). Two chaperones, BiP(GRP78) and GRP94, interact with the B C R L chain. B i P binds to an earlier intermediate of the forming L chain, and i f the internal disufide bond fails to form, B i P w i l l target the protein for degradation (Skowronek et al, 1998), but, i f the protein folds correctly, GRP94 w i l l bind to it and allow for its association with the H chain (Melnick et al, 1994). The H chain is initially bound to B i P and upon formation of the disulfide bond between the H and L chains, B i P w i l l dissociate and allow further B C R assembly (Lee et al., 1999; Foy and Matsuuchi, 2001). In order for the complete B C R to form, Ig-a and Ig-P must associate with one another and then with m l g M . Ig-a is initially associated with GRP94 and dissociates upon bond formation between Ig-a and Ig-P (Foy and Matsuuchi, 2001). In addition to being folded in the E R the B C R components are glycosylated. Folded proteins are glycosylated with both N-linked and O-linked oligosaccharides. Calnexin, a membrane bound chaperone, has been shown to interact with unfolded proteins in the E R and dissociate from them 12 when they are glycosylated. This could be a quality control mechanism that ensures that unfolded proteins cannot leave the E R until they are properly glycosylated. After E R glycosylation the glycoproteins traffic to the Golgi where the oligosaccharides are processed and the proteins are sorted to the cell surface (Wu et al, 1997). If the mlgM-containing B C R is missing a component, then the other proteins in the m l g M -containing B C R remain trapped in the E R and are eventually degraded. Pulse-chase experiments have shown that the u, H chain is degraded much more quickly when not associated with other components of the B C R . Interestingly, Ig-a and the L chain are not more rapidly degraded when lacking associations with other B C R components. This may be because the u, H chain is bound to B i P when not bound to L chain, and B i P enhances the rate of degradation (Foy and Matsuuchi, 2001). A s Ig-a synthesis is the rate-limiting step in human B C R complex formation and Ig-P, H and L chain are produced in excess, Ig-a may be used to assemble complete B C R s immediately, leaving little time for it to be sequestered in the E R by chaperones (Brouns et al, 1995). 1.5 BCR signalling and antigen processing It has been proposed that once the B C R has reached the cell surface, the receptors form oligomeric complexes. Schamel and Reth (2000) found that when the membranes of B C R expressing cells are solubilized, the extracted B C R complexes appear to form oligomers of their particular isotype (i.e. m l g M interacts with m l g M and not mlgD, and vice versa). They propose that the isotype specific complexes are a result of interactions between the transmembrane regions of the mlg proteins suggesting that the polar amino acids on one side of the transmembrane helix (Figure 1.3) interact with Ig-a/p and those on the other side interact with isotype-specific mlg molecules. Upon B C R activation and cross-linking the receptors cluster further and migrate into lipid rafts (Pierce, 2002). L ip id rafts are regions of cell membranes that are enriched in cholesterol and sphingolipids, whereas other regions of the membrane contain unsaturated phosphatidylcholine and cholesterol. L ip id rafts also contain GPI-anchored proteins, transmembrane proteins and tyrosine kinases of the Src family. The GPI-anchored proteins are incorporated into plasma membrane rafts immediately after transport from the Golgi and remain there indefinitely. It is believed that proteins that are doubly acylated by saturated chains, such as the Src-family kinases 13 (in particular, Lyn), are partitioned into rafts (Pierce, 2002) whereas transmembrane proteins may have an affinity to rafts, but they may travel in and out of them (Simons and Dconen, 1997). The current l ipid raft model is that the resting B C R has a low affinity for l ipid rafts, but upon crosslinking, the B C R ' s affinity for the lipid raft increases and it moves into the rafts. The rafts contain signalling proteins such as Lyn, which phosphorylate Ig-a/p and initiate intracellular signalling cascades. The rafts also contain B C R associated proteins such as C D 19 (Carroll, 1998). It is suggested that lipid rafts help to bring the signalling proteins and the B C R in close proximity to aid in signal transduction (Pierce, 2002). B C R signalling begins with phosphorylation of the IT A M domains of Ig-cc/p by the Src family protein tyrosine kinases (Fyn, B l k and Lyn) and the protein tyrosine kinase, Syk. These kinases are believed to associate weakly with some inactivated B C R s , but upon B C R activation and clustering they are believed to activate each other and promote I T A M phosphorylation. I T A M phosphorylation leads to the activation o f three signalling pathways controlled by PI3K, PLCy2 and Ras (Gold, 2002). PI3K activation causes the B cell to proliferate by activating the enzyme A K T , which inhibits pro-apoptotic factors. In the second pathway, PLCy2 is recruited to the membrane by B L N K , and this produces inositol-1,4,5-triphosphate and D A G . This results in the expression of genes that determine B cell fate and the transcription of anti-apoptotic genes (Niiro and Clark, 2002). The third pathway activated by B C R antigen binding is the Ras pathway. Ras is a GTPase that controls Raf-1 activation, leading to activation of the Erk cascade. This pathway is important for B cell development and proliferation of mature B cells (Gold, 2002). In addition to signalling from an antigen-bound B C R , the receptor can be internalized and the antigen processed for presentation on M H C class II molecules. The M H C class II molecule presents a peptide fragment from the antigen to helper T cells. The T cells then activate the B cells and stimulate them to produce antibodies (McHeyzer-Williams, 2003). In order for receptor internalization to occur there must be signalling from the crosslinked B C R to the rest of the cell. In mlgG B C R s this can occur through a tyrosine residue on the H chain cytoplasmic tail. In other B C R isotypes this occurs through Ig-a signalling. The signal depends on the first tyrosine residue in the I T A M domain of Ig-a (Cassard et al, 1998). Stoddart et al. 14 (2002) hypothesize that B C R signalling is supported through B C R localization in lipid rafts because l ipid rafts have been shown to contain the signalling molecules necessary for internalization. In their model, B C R signalling activates Src-family kinases such a Lyn, which phosphorylate clathrin. The clathrin forms a clathrin-coated pit either beside or within the lipid raft, and this allows B C R internalization by invagination of the pit and pinching-off of the membrane to form a cytoplasmic vesicle. Once internalized, the contents of the vesicle are degraded in endosomes and targeted to the M H C class-U containing compartment (MLIC) where M H C class II molecules are assembled. The peptides in the vesicles are then loaded onto M H C class II molecules. The intracellular trafficking of the vesicle appears to be mediated by the cytoplasmic tails of Ig-a/p. If chimeric proteins with only Ig-a or only Ig-P cytoplasmic tails are expressed in cells, they are not targeted to the MIIC compartment, but i f both Ig-a and Ig-P tails are expressed, then there is targeting to the MIIC compartment resulting in M H C presentation. Additionally, the cytoplasmic tail of Ig-a slows down vesicle trafficking, whereas the cytoplasmic tail o f Ig-p speeds it up. This also corresponds to how quickly they are degraded into peptides for M H C class II binding (Li et al., 2002). Therefore, Ig-a and Ig-p appear to play distinct roles in the trafficking of the B C R -antigen-containing vesicle to the M H C compartment. In the adaptive immune system the B cell is both an antibody producing cell and an antigen-presenting cell. The B C R is an integral component in both of these processes. In order to reach the antibody producing stage the B C R must signal through many developmental stages, eventually promoting differentiation into an antibody producing plasma cell. In addition to signalling, a second function of the B C R is antigen internalization for processing and presentation to T lymphocytes (Niiro and Clark, 2002). 1.6 BCR mutations 1.6.1 BCR mutations affect B cell development B cell development can be divided into two parts, that which occurs in the bone marrow and that which occurs in the periphery (see section 1.2). Both of these stages are B C R dependent, and 15 mutations in the B C R can lead to a block in B cell development in either the bone marrow or the periphery. In order to understand the functions of different components of the B C R during B cell development and differentiation, many researchers have created strains of mice with deletions or modifications in one or more of their B C R proteins. Kitamura et al. (1991) found that disruption of the transmembrane region of m l g M in mice results in blockage of B cell development at the pro-B cell stage, potentially due to the inability of Ig-a/p to associate with mlg and get expressed on the cell surface with the pre-BCR. This would prevent signals from the pre-BCR from being generated, and B cell development would be impaired. Additionally, Pelanda et al. (2002) generated Ig-a and Ig-P deficient mice. They found that B cell development in these mice does not proceed past the pro-B cells stage, but that H chain recombination can occur. This is expected because after the pro-B cell stage the B C R is expressed on the cell surface and requires Ig-a/p to signal that it has reached the cell surface. If a pro-B cell is lacking Ig-q/p, then it w i l l not be able to signal and B cell development w i l l be blocked at the pro-B cell stage. This also indicates that B cell development does not require Ig-a/p signalling before the pre-B cell stage. In a similar study, Reichlin et al. (2001) examined the effects of mutating Ig-a or Ig-P on B cell development. They found that mice that have a deletion of the cytoplasmic domain of Ig-P proceed normally through the initial stages of B cell development and produce immature B cells, but that development is arrested at the immature B cell stage. In contrast, when they examined mice that contained a deletion of the cytoplasmic domain of Ig-a, they found that very few of these cells even make it to the immature B cell stage and that most begin to apoptose at the pre-B cell stage. This indicates that the cytoplasmic tails of Ig-a and Ig-P have different functions during B cell development and that the Ig-a cytoplasmic tail allows development to a later stage than the Ig-P cytoplasmic tail. Wang et al. (2004) further examined the specific roles of Ig-a and Ig-P in B cell development. They created two Ig-P constructs, one that was cytoplasmically truncated ( A C Y (p/p/0)) and one that had an Ig-a cytoplasmic domain ( C a (p/p/a)). They found that the A C Y construct rescued B cell development in the bone marrow, but not the periphery (similar to the results seen by Reichlin et al. (2001)) and that the C a construct rescued development in the bone marrow and 16 variably in the periphery. This indicates that signalling from two Ig-a cytoplasmic tails enhances the B cell 's ability to develop and differentiate. 1.6.2 B C R mutations affect B C R cell surface expression In order for the mlgM-containing B C R to be expressed on the cell surface, all four components of the B C R must be expressed in the cells. If one or more of the components are lacking, the rest of the B C R remains trapped in the E R (Matsuuchi et al, 1992; Venkitaraman et al, 1991). In addition, certain m l g M or Ig-a/p mutations can prevent cell surface expression by disrupting the association of the various B C R components (described further below). Shaw et al. (1990) found that i f certain polar amino acids in the transmembrane region of m l g M are changed to hydrophobic residues, m l g M does not interact with Ig-a/p. They found that mutating the tyrosine-serine dipeptide, the 19 t h and 20 t h amino acids in the transmembrane region, to valines ( Y S / V V ) affected both signal transduction and antigen presentation, presumably by interfering with proper Ig-a/p association with m l g M , which is essential for these events. B l u m et al. (1993) found that switching 41 amino acids in the C-terminal (transmembrane) region of the H chain with amino acids from h C D 8 a permitted surface B C R expression, but prevented any interaction with Ig-a/p and, therefore, prevented signalling from occurring. B l u m et al (1993) also individually mutated eight o f the polar amino acids in the transmembrane region o f m l g M and found that none o f the mutations disrupted signalling completely. From this they were able to conclude that Ig-a/p must interact with more than one residue in the transmembrane region and that the transmembrane region is important for the association of the various B C R components. It also appears important that the extracellular domains of Ig-a and IgP remain intact in order for B C R cell surface expression to occur. Some mutations in the extracellular domains of Ig-a or Ig-P w i l l prevent B C R cell surface expression or allow an incomplete B C R to be trafficked to the cell surface without all of its components. For example, i f a particular proline residue (amino acid 126) in the extracellular domain of Ig-a is mutated, the protein is glycosylated differently and is unable to associate with m l g M , but it does traffic to the cell surface with Ig-p. Therefore, the extracellular domain of Ig-a appears to be important for interacting with quality control 17 mechanisms within the cell that would normally sequester the incomplete B C R in the E R (Condone/al, 2000). Additionally, a truncation of the extracellular domain of Ig-p' prevents heterodimerization with Ig-a and w i l l not allow trafficking o f the B C R to the cell surface. Or, i f a chimeric Ig-P protein is created that has an extracellular Ig-a domain and Ig-P transmembrane and cytoplasmic domains, it w i l l not associate with Ig-a and w i l l not allow B C R cell surface trafficking (Wang et al., 2004). This demonstrates that quality control mechanisms interact with the extracellular or transmembrane domains of Ig-a/p, but not the cytoplasmic domains, and therefore, B C R cell surface trafficking is dependent on both the extracellular and transmembrane domains. If the,above mutations were to occur in an immature B cell, the cell should be eliminated from the body in the bone marrow due to its inability to signal through the B C R . But, somatic hypermutation can introduce mutations in mature B cells that are already circulating in the periphery. Somatic hypermutation is a process that occurs after the B cell encounters antigen in the periphery and has begun to proliferate. It involves introducing point mutations into the H and L chain genes so that they wi l l bind to the foreign antigen more effectively (Kruppers et al, 1999). In some cases errors occur during somatic hypermutation and the point mutations are inserted in the genes encoding Ig-a and Ig-P instead. This is believed to be due to sequence similarity in the transcriptional control regions between Ig-a/p and the target genes (Gordon et al, 2003). In a study o f the B cell mutations in patients with B cell chronic lymphocytic leukemia ( B C L L ) , a leukemia resulting from an accumulation of non-functional, mature B cells in the body, Gordon et al. (2003) found that the genes encoding Ig-a and Ig-P were often mutated, primarily in the extracellular domain or in the cytoplasmic I T A M region. This indicates that mutations in Ig-a and Ig-P can cause improper B C R assembly or signalling leading to an accumulation of ineffective B cells resulting in B C L L . In fact, mature B cells with a B C R that contains two Ig-a cytoplasmic tails have lower levels of B C R surface expression, are anergic and appear to live longer than wild-type B cells. These are all characteristics of B C L L s and indicate that the Ig-a/p heterodimer may help control B cell longevity (Reichlin et al, 2004). Further understanding of the role of Ig-a/p in B C R assembly, trafficking and signalling is vital to further understanding this disease. 18 1.7 Purpose of thesis study The interest in studying how B C R mutations affect B C R assembly, cell surface expression and, ultimately, B cell development is in an effort to further understand the generation of B cell leukemias and lymphomas. Initial studies on B C R cell surface expression showed that correct assembly and cell surface trafficking of the m l g M B C R requires that all four chains of the B C R be expressed in the cells (Matsuuchi et al, 1992; Venkitaraman et al., 1991). Deletion of Ig-a or Ig-P prevents B cell development past the pro-B cell stage (Pelanda et al, 2002). However, i f only the cytoplasmic tails of Ig-a or Ig-P are truncated or mutated, the m l g M B C R can still traffic to the cell surface, but B cell signalling and development are disrupted (Reichlin et al, 2001, Wang et al, 2004). If the B cell is allowed to mature prior to a B C R mutation that creates a B C R with two Ig-a cytoplasmic tails, the cell become anergic and long-lived, likely due to lower B C R cell surface expression (Reichlin et al, 2004). This could be a analogous to a B cell leukemia in which somatic hypermutation disrupts B C R cell surface trafficking so that only low levels of signalling can occur, resulting in B cells that are nonfunctional and long-lived (Gordon et al, 2003). In order to further understand B C L L s , it is important to determine which portions of the B C R are important for receptor assembly and cell surface trafficking. The purpose of this study is to test the hypothesis that specific protein interactions between the transmembrane and extracellular domains of Ig-a and Ig-P are necessary for B C R assembly and cell surface trafficking. The approach I have used is to create mutant Ig-a and Ig-P genes and express them in cell lines containing the other chains of the B C R . The association of the various B C R components was examined by immunoprecipitation experiments. C e l l surface expression of the B C R was studied by cell surface fluorescence or fluorescent activated cell sorting (FACS) . Two different expression systems were used for this study. The first being a series o f non-lymphoid cultured cell lines (AtT20 endocrine cells) that have been previously transfected with various combinations of the B C R components (Matsuuchi and Kel ly , 1991, Matsuuchi et al, 1992). The advantages of using this non-lymphoid cell line are that the cell lines created are stable and can express high levels of the B C R components so that B C R assembly and membrane trafficking can be examined. Also, the number of cells produced is unlimited, so recovering enough material for biochemical analyses is not the problem that it would be in other transient expression systems. The disadvantage of the AtT20 system is that it is a non-lymphoid system 19 so the cells do not contain all the components of a lymphoid cell and, therefore, may not behave in the same manner. This drawback, however, appears to be more important when studying downstream signalling events than for receptor assembly and secretion or trafficking studies (Matsuuchi et al., 1992; Foy and Matsuuchi, 2001). The second expression system is based on a lymphoid tissue cultured cell line derived from the J558 plasmacytoma. Normally these cells do not express the B C R on their surface since they are antibody-secreting plasma cells. We have obtained four J558 cell lines that have been transfected with, and express, various components of the B C R . The advantage of this system is that the expression studies can be done transiently as well as stably. The transient expression studies allow for much quicker analysis because screening of clones and their recovery as isolated clonal cultures is not required. This allows for more efficient experimentation and analysis. In order to test the importance o f specific protein interactions between the transmembrane and extracellular domains of Ig-a/p in B C R assembly and cell surface trafficking, I created seven mutant Ig-a/p constructs (Xa2 , C p , M P p , A X p , A X a , M P a and X p ) (Table 1.1) using either polymerase chain reaction (PCR) or by ligating digested Ig-a D N A fragments into a plasmid already containing Ig-P D N A . Additionally, I altered one construct to make it expressible in our cell lines ( A a K V K ) , and I used one construct that was used in a previous study (Ca) (Wang et al, 2004) (Table 1.1). Throughout this thesis the constructs w i l l be named and then followed by a description in parentheses using the format: (extracellular domain/ transmembrane domain/ cytoplasmic domain). For example, the X a 2 construct has an Ig-a extracellular domain and Ig-P transmembrane and cytoplamic domains and wi l l be described as: X a (a/p/p). To verify that a heterodimer in the cytoplasmic domain is not sufficient to allow B C R cell surface expression I used the C a (p/p/a) construct (Figure 1.4). C a is extracellularly and transmembrane Ig-P and cytoplasmically Ig-a and, when associated with Ig-P (p/p/p), there w i l l only be a heterodimer in the cytoplasmic domain. To determine whether having an Ig-a/p heterodimer in the extracellular domain was important I created the Ig-a mutant X a 2 (a/p/p) (Figure 1.4). X a 2 is extracellularly Ig-a and 20 transmembrane and cytoplasmically Ig-p. When associated with Ig-p (p/p/p), an Ig-a/p heterodimer w i l l only occur in the extracellular domain. To examine the significance of having an Ig-a/p heterodimer in the transmembrane and extracellular domains I created the CP (a/a/p) and A a K V K (a/a/0) constructs (Figure 1.4). CP is extracellularly and transmembrane Ig-a and cytoplasmically Ig-p. A a K V K is an Ig-a mutant that is truncated cytoplasmically. When associated with Ig-P (p/p/p), both CP and A a K V K wi l l form a heterodimer in the extracellular and transmembrane domains. To test the importance o f having an Ig-a/p heterodimer in the transmembrane region I created an Ig-a mutant construct, A X a (o/a/a), that is truncated in the extracellular domain (Figure 1.4). When Ig-P (p/p/p) is associated with A X a there w i l l be an Ig-a/p heterodimer in the transmembrane and cytoplasmic domains. M y data showed that the CP (a/a/p) construct is able to associate with both the \i H chain and with Ig-p (P/p/p) and is able to traffic to the cell surface with the rest of the B C R . The A a K V K (a/a/0) construct is able to associate with the (j, H chain, but not Ig-P and, therefore, does not traffic to the cell surface. Similarly, the A X a (O/a/a) construct is able to associate with the JJ. H chain, but not with Ig-P and, also, does not traffic to the cell surface. The rest of the constructs do not associate with any B C R components so B C R cell surface trafficking does not occur. A summary of these findings is shown in Table 1.2. This data indicates that a heterodimer in the extracellular and transmembrane domains and, potentially, dimerization in the cytoplasmic domain, is required for B C R assembly and cell surface expression. 21 Table 1.1: Summary of mutant constructs. The green colouration represents Ig-a and the blue colouration represents Ig-p\ E X : the extracellular domain, T M : the transmembrane domain, C Y : the cytoplasmic domain, M P : membrane proximal region o f the extracellular domain. Construct name Construct diagram Construct description Approximate molecular weight Ig-a (a/a/a) W T I g - a 34 k D a Ig-P (P/P/P) s W T Ig-P 40 k D a X a 2 (a/p/p) E X : Ig-a T M : Ig-p C Y : lg-p 27 k D a cp (a/a/p) : E X : Ig-a T M : Ig-a C Y : Ig-P 27 k D a M P p (MPp/p/p) 1 E X : Ig-P M P region T M : Ig-p C Y : Ig-p 14 k D a A X p (o/p/p) 1 E X : none T M : Ig-p C Y : Ig-p 13 kDa M P a (MPa /a / a ) 1 E X : Ig-a M P region T M : Ig-a C Y : Ig-a 16 k D a A X a (0/a/a) 1 E X : none T M : Ig-a C Y : lg -a 13 k D a xp (P/a/a) 1 E X : lg-p T M : Ig-a C Y : Ig-a 39 k D a A a K V K (a/a/0) s E X : Ig-a T M : Ig-a C Y : none 20 k D a C a (P/p/a) 1 E X : Ig-p T M : Ig-p C Y : Ig-a 39 k D a structure of proposed protein following removal of the signal peptide 22 W T B C R C a (pVpVa) B C R X a 2 (a/p/8) B C R Cp (a/a/p) B C R A X a (O/a/a) B C R A a K V K (a/a/O) B C R Figure 1.4: Depiction of mutant B C R s on the cell surface to display the interactions that could occur between mutant Ig-a constructs and the rest of the B C R . These interactions were tested by co-immunoprecipitation studies (green colouration represents Ig-a, light blue colouration represents Ig-P, dark blue colouration represents mlgM) . 2 3 Table 1.2: Summary of results from Ig -a mutant constructs . The green colouration represents Ig-a and the blue colouration represents Ig-p. E X : the extracellular domain, T M : the transmembrane domain, C Y : the cytoplasmic domain, M P : membrane proximal region of the extracellular domain. Construct name Construct diagram Construct description Association with m l g M Association with Ig-P B C R cell surface expression Ig-a (a/a/a) _ W T I g - a yes yes yes C a (P/p/a) 1 E X : Ig-P T M : Ig-p C Y : Ig-a no no no Xa2 (a/p/p) E X : Ig-a T M : Ig-p C Y : Ig-P no no no cp (a/a/p) I E X : Ig-a T M : Ig-a C Y : lg-p yes yes yes A a K V K (a/a/0) 1 E X : Ig-a T M : Ig-a C Y : none yes no no A X a (O/a/a) 1 E X : none T M : Ig-a C Y : Ig-a yes no no * the constructs not included in this table ( M P a , M P P , A X P and X P ) wi l l be used to study B C R formation and cell surface expression in the future. 2 ^ CHAPTER 2 Materials and Methods 2.1 Reagents 2.1.1 Antibodies The rabbit anti-mouse IgM (\x chain specific) antibody was purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, Pennsylvania). The rabbit polyclonal anti-mouse X light chain antibody was from Bethyl Laboratories (Montgomery, Texas). The polyclonal rabbit anti-mouse Ig-a cytoplasmic antibody, produced against a 34 amino acid peptide from the Ig-a cytoplasmic tail (amino acids 187-220), was previously described (Gold, et al., 1991). The polyclonal rabbit anti-mouse Ig-a extracellular antibodies, produced with a 30 amino acid peptide to the extracellular domain of Ig-a (amino acids 29-58) and the polyclonal rabbit anti-mouse Ig-P extracellular antibody, produced with a 30 amino acid peptide to the extracellular domain of Ig-P (amino acids 71-100) were a gift from Abeome (Athens, Georgia) and Dr. Richard Meagher (University of Georgia, Athens, Georgia). The rabbit anti-mouse Ig-P cytoplasmic antibody that recognizes the cytoplasmic tail o f Ig-P was a gift from Dr. Marcus Clark (University of Chicago, Chicago, Illinois). The horseradish peroxidase (HRP)-conjugated protein A secondary reagent used for Western immunoblotting was from Amersham Biosciences (Baie d'Urfe, Quebec). The goat anti-rabbit IgG-HRP was from Jackson Immunoresearch Laboratories, Inc. (West Grove, Pennsylvania). The fluorescein (FITC)-conjugated goat anti-mouse IgM (\x chain specific) antibody used for fluorescence activated cell sorting ( F A C S ) was purchased from Jackson ImmunoResearch Laboratories, Inc. The rhodamine labeled goat anti-mouse I g M (|i chain specific) used for cell surface fluorescence was from B D Biosciences (Palo Alto , California). 25 2.1.2 Plasmids The pMX-puro retroviral expression vector was a gift from Dr. Al ice M u i (Jack Be l l Research Centre, Vancouver, B C ) . ThepWZL-Blastl andpWZL-Blast3 retroviral expression vectors were a gift from Dr. Stephen Robbins (University of Calgary, Calgary, Alberta). The pMSCV-puro retroviral expression vector was purchased from B D Biosciences. The pMIGRl-Xa, pMIGRl-Ig/3, pMIGRl-ACY and MIGRlp-Ca expression vectors were gifts from Dr. Marcus Clark (University of Chicago, Chicago, Illinois) (Wang et al., 2004). 2.1.3 Plasmids created pMX-puro-AaKVK (a/a/0) This plasmid encodes an Ig-a protein that is truncated cytoplasmically (Table 1.1). The initial construction o f this plasmid was done by M a y Dang-Lawson, the laboratory technician and lab manager. The D N A for the extracellular and transmembrane portions of Ig-a was amplified using polymerase chain reaction (PCR), and the fragment was inserted into the pMX-puro vector between the upstream A p a I and downstream Not I restriction enzyme sites, creating pMX-puro-A a . To create pMX-puro-AaKVK the three amino acids in the cytoplasmic tail o f A a were then changed from A r g Lys A r g to Lys V a l Lys ( K V K , single digit amino acid code) using site-directed mutagenesis (Figure 2.1). The Lys V a l Lys amino acids are the same three amino acids found in the cytoplasmic tail of the heavy chain of m l g M . They were used to ensure that the construct was anchored in the plasma membrane. The primers used for site-directed mutagenesis were mb>1-1 and mb1-2 (the sequences of which can be found in Table 2.1). Details of the molecular biology techniques wi l l be discussed in section 2.2. pMSCV-puro-Cfi andpWZL-Blast3-C$ (a/a/p) This plasmid encodes an Ig-a protein that is extracellularly and transmembrane Ig-a and cytoplasmically Ig-P (Table 1.1). Site-directed mutagenesis was used to insert a Bam HI restriction enzyme site into pMX-puro-Aa between the transmembrane and cytoplasmic domains. The primers used for site-directed mutagenesis were J D X A 1 and J D X A 2 (the sequences of which can be found in Table 2.1). The Ig-a fragment from pMX-puro-Aa was then excised using X h o I and Bam HI restriction enzymes and inserted into pMIGRI-Xa to create pMIGRI-* 26 Cp. The D N A encoding CP was then excised from p M I G R l using Xho I and Eco R l restriction enzymes and ligated into pWZL-BlastS and pMSCV-puro to create pWZL-Blast3-C$ and pMSCV-puro-Cfi (Figure 2.2). 27 5 'LTR 3 ' L T R Digest with A p a I and Not I Ligate •jMX-puro-Aaf~NotI ' 3 ' L T R Site-directed mutagenesis Figure 2 . 1 Creat ion of the p M X - p u r o - A c c K V K expression vector. This expression vector encodes an Ig-a protein lacking its cytoplasmic tail. The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1 .3 for more details. 28 Site-directed mutagenesis Digest with Xho I and Eco R l L i gate into pWZL-BIast3 and pMSCV-puro Figure 2.2 Creation of the pMSCV-puro-C$ and pWZL-Blast3-C$ expression vectors. These vectors encode a protein that is extracellularly and transmembrane Ig-a and cytoplasmically Ig-p. The green colour represents Ig-a D N A and the blue colour represent Ig-P D N A . The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. 29 Table 2.1: Oligonucleotide primers used for site-directed mutagenesis reactions. The highlighted nucleotides are the ones that were changed from the wild-type sequences. Underlined nucleotides indicate restriction enzyme cut sites. Primer Name Primer Sequence (5'-3') Primer binding site mbl-1 G G G A C G C T G C T G C T A TTC KAG GTA A AG T A A T T G C G G C C G CC The noncoding strand of Ig-a between the transmembrane and cytoplasmic domains mbl -2 G G C G G C C G C A A T A A T T A e f f f l H JCTTj G A A T A G C A G C A G CGT C C C The coding strand of Ig-a between the transmembrane and cytoplasmic domains J D X A 1 G C T G C T A TTC A G G A H C G G T A A T T G C G G C C G The noncoding strand of Ig-a between the transmembrane and cytoplasmic domains, creating a Bam HI restriction site J D X A 2 C G G C C G C A A T A A C C G S I T CCT G A A T A G C A G C The coding strand of Ig-a between the transmembrane and cytoplasmic domains, creating a Bam HI restriction site S a c B l C G G C G G A A C A C A C T G AAC'CG(3 GGC A T T A T C T T G A T C C A G A C C The noncoding strand of Ig-P between the extracellular and transmembrane domains, creating a Sac II restriction site SacB2 GGT C T G G A T C A A G A T A A T GCC I l l W t T T C A G TGT GTT C C G C C G The coding strand of Ig-P between the extracellular and transmembrane domains, creating a Sac II restriction site S a c A l G G G G A A GGT A C C A A G A A C CGC g g C A T C A C A G C A G A A G G G The noncoding strand of Ig-a between the extracellular and transmembrane domains, creating a Sac LI restriction site SacA2 C C C TTC TGC TGT G A T G § 1 G C G GTT CTT GGT A C C TTC C C C The coding strand of Ig-a between the extracellular and transmembrane domains, creating a Sac LI restriction site f i x X B l C G G C G G A A C A C A C T G A A A G A T A T C A T C A C A G C A G A A G G G The noncoding strand of Xp between the extracellular and transmembrane domains, erasing a Sac II restriction site. f i x X B 2 C C C TTC TGC TCT G A T G A T A T C TTT C A G TGT GTT C C G C C G The coding strand of xp between the extracellular and transmembrane domains, erasing a Sac II restriction site. 30 pMSCV-puro-Xa.2 and pWZL-Blast3-Xa2 (oc/p7P) These plasmids encode a protein that is extracellularly Ig-a and transmembrane and cytoplasmically Ig-P (Table 1.1). Site-directed mutagenesis was used to insert a Sac II restriction enzyme site into pMIGRl-Igfi and pMX-puro-Aa between the extracellular and transmembrane domains. The primers used for pMIGRl-lg$ were SacB1 and SacB2, and the primers used for pMX-puro-Aa were SacA1 and SacA2 (the sequence of these primers can be found in Table 2.1). The Ig-a extracellular domain D N A fragment was then excised from pMX-puro-Aa using the Xho I and Sac II restriction enzyme sites and inserted into pMIGRl-lgfi, replacing the Ig-p extracellular domain and creating pMIGRl-Xa2. The X a 2 D N A fragment was then excised from pMIGRl-Xa2 using Xho I and Eco R l restriction enzymes and ligated into pWZL-Blast3 and pMSCV-puro to create pWZL-Blast3-Xa2 and pMSCV-puro-Xa2 (Figure 2.3). pWZL-Blastl-Ca (P/p/a) This plasmid encodes a protein that is extracellularly and transmembrane Ig-P and cytoplasmically Ig-a (Table 1.1). The D N A encoding C a was excised from MIGRlp-Ca with B g l II and X h o I restriction enzymes. It was then ligated into pWZL-Blastl that had been digested with B g l II and Sal I (Xho I and Sal I have compatible cohesive ends). This created pWZL-Blastl-Ca (Figure 2.4). pMIGRl-X$ (p/a/a) This plasmid encodes a protein that is extracellularly Ig-p and transmembrane and cytoplasmically Ig-a (Table 1.1). Site-directed mutagenesis was used to insert a Sac II restriction enzyme site into pMIGRl-lg$ and pMX-puro-Aa between the extracellular and transmembrane domains. The primers used forpMIGRJ-Igfi were SacB1 and SacB2, and the primers used for pMX-puro-Aa were SacA1 and SacA2 (the sequence of these primers can be found in Table 2.1). Polymerase chain reaction (PCR) was used to amplify a segment of D N A encoding the Ig-a transmembrane and cytoplasmic domains. The primers used for P C R were SacA1 and a 3 E c o . The plasmid and the P C R product were then digested with Eco R l and Sac II restriction enzymes and ligated together to formpMIGRl-X$ (Figure 2.5). 31 pMSCV-puro-MPa andpWZL-Blast3-MVa (MPa/a/a) These plasmids encode an Ig-a protein that is truncated in the N T and IG regions of the extracellular domain (Table 1.1). P C R was used to amplify the Ig-a D N A fragment encoding the membrane proximal (MP) region (amino acids 121 to 137), the transmembrane domain and the cytoplasmic domain. The D N A fragment had a Xho I restriction enzyme site upstream and an Eco RI restriction enzyme site downstream. The primers used were MPAXho and a3Eco (the sequence of these primers can be found in Table 2.2). This fragment was digested and ligated into pWZL-Blast3 using the Xho I and Eco RI restriction enzyme sites. P C R was then used to amplify the D N A encoding the signal peptide o f Ig-a (amino acids 1 to 22) with a Bam H I restriction enzyme sequence upstream and a Xho I restriction enzyme sequence downstream. The primers used for P C R were SRSal and SRSa2 (the sequence of these primers can be found in Table 2.2). The D N A fragment was digested with Bam HI and Xho I restriction enzymes and inserted into pWZL-Blast3 that already contained the M P a insertion described above; this created pWZL-Blast3-MPa. To create pMSCV-puro-MPa the D N A encoding M P a was excised with Bam HI and Eco RI restriction enzymes and ligated into pMSCV-puro that had been cleaved at the B g l LI and Eco RI restriction enzyme sites (Bam HI and Bg l II have compatible cohesive ends) (Figure 2.6). 32 EcoRI 3'LTR 5'LTR Digest with Xho I and Sac II Ligate SacII Digest with Xho I and Eco RI Ligate into pWZL-Blast3 and pMSCV-puro Figure 2 . 3 Creation of the pMSCV-puro-Xa2 and pWZL-Blast3-Xa2 expression vectors. These plasmids encode a protein that is extracellularly Ig-a and transmembrane and cytoplasmically Ig-p. The green colour represents Ig-a D N A and the blue colour represents Ig-p D N A . The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2 .1.3 for more details. 0 -NotI Bglll 5'LTR HMIGR1 Digest with B g l l l and Xho I Bglll U 900 bp y \ 3' Xhol Bglll Xhol BamHI 5'LTR Ligate BamHI Bglll Xhol sail 5'LTR 3 'LTR Digest with B g l l l and Sai l BamHI Bglll Xhol S a U 5'LTR 3 'LTR Figure 2.4 Creation of the pWZL-Blastl-Ca expression vector. This vector encodes a protein that is extracellularly and transmembrane Ig-P and cytoplasmically Ig-a. The green colour represents Ig-a D N A and the blue colour represents Ig-P D N A . The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. 34 Xhol 5'LTR Xhol 5'LTR '3 'LTR Site-directed mutagenesis SacH SacII EcoRI \pMIGRl-lg$ Jf-EcoRI Ig-a transmembrane and cytoplasmic domain P C R product 250 bp Digest with Sac II and Eco R l Ligate SacII EcoRI 3'LTR Site-directed mutagenesis to erase Sac II site (to be performed at a later date) EcoRI 3'LTR Figure 2.5 Creation of the pMIGRl-Xfi expression vector. This plasmid encodes a protein that is extracellularly Ig-P and transmembrane and cytoplasmically Ig-a. The green colour represents Ig-a D N A and the blue colour represents Ig-p D N A . The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. ^ 5'LTR Xhol EcoRI 1 M P a P C R product" 300 bp BamHI Xhol EcoRI 3'LTR Digest with X h o l and EcoRI Ligate BamHI Xhol 1 = 1 Ig-a signal peptide P C R product 66 bp Xhol BamHI 5'LTR EcoRI 3'LTR Digest with BamHI and X h o l Ligate 5'LTR Bglll Xhol EcoRI pMSCV-puro\ 6.3 kb V 3'LTR Digest with BamHI /Bg l l l and EcoRI Ligate Xhol Alwl, BstYI, Dpnl 5'LTR Figure 2.6 Creation of the pMSCV-puro-MVct and pWZL-Blast3-MPa expression vectors. These vectors encode an Ig-a protein that is truncated in the N T and IG regions of the extracellular domain. The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. 36 pMSCV-puro-MPfi andpWZL-Blast3-MY$ (MPp/p/p) These plasmids encode an Ig-P protein that is truncated in the N T and IG regions of the extracellular domain (Table 1.1). P C R was used to amplify the Ig-P D N A fragment encoding the membrane proximal (MP) region (amino acids 143 to 180), the transmembrane domain and the cytoplasmic domain. The D N A fragment had a Xho I restriction enzyme site upstream and an Eco R l restriction enzyme site downstream. The primers used were M P B X h o and p 3 E c o (the sequence o f these primers can be found in Table 2.2). This fragment was digested and ligated into pWZL-Blast3 using the X h o I and Eco RJ restriction enzyme sites. P C R was then used to amplify the D N A encoding the signal peptide of Ig-P (amino acids 1 to 25) with a Bam HI restriction enzyme sequence upstream and a Xho I restriction enzyme sequence downstream. The primers used for P C R were S R S p i and S R S p 2 (the sequence of these primers can be found in Table 2.2). The D N A fragment was digested with Bam HI and Xho I restriction enzymes and inserted into pWZL-Blast3 that already contained the M P p insertion described above; this created pWZL-Blast3-W?§. To create pMSCV-puro-MPfi the D N A encoding M P p was excised with Bam HI and Eco R l restriction enzymes and ligated into pMSCV-puro that had been cleaved at the B g l II and Eco R l restriction enzyme sites (Bam HI and Bgl II have compatible cohesive ends) (Figure 2.7). pMSCV-puro-AXa andpWZL-Blast3-AXa (O/a/a) These plasmids encode an Ig-a protein that is truncated in the extracellular domain (Table 1.1). P C R was used to amplify the Ig-a D N A fragment encoding the transmembrane domain and cytoplasmic domains. The D N A fragment had a Xho I restriction enzyme site upstream followed by nucleotides encoding methionine and lysine (as an extracellular domain to anchor the protein in the membrane (Johansson et al, 1999)) and an Eco R l restriction enzyme site downstream. The primers used were A X a X h o and a 3 E c o (the sequence o f these primers can be found in Table 2.2). This fragment was digested and ligated into pWZL-Blast3 using the Xho I and Eco R l restriction enzyme sites. P C R was then used to amplify the D N A encoding the signal peptide of Ig-a (amino acids 1 to 22) with a Bam HI restriction enzyme sequence upstream and a Xho I restriction enzyme sequence downstream. The primers used for P C R were S R S a l and S R S a 2 (the sequence of these primers can be found in Table 2.2). The D N A fragment was digested with Bam H I and Xho I restriction enzymes and inserted into pWZL-Blast3 that already contained the A X a insertion described above; this created pWZL-Blast3-AXa. To create 37 pMSCV-puro-AXa the D N A encoding A X a was excised with Bam H I and Eco RI restriction enzymes and ligated into pMSCV-puro that had been cleaved at the B g l II and Eco R I restriction enzyme sites (Bam HI and B g l II have compatible cohesive ends) (Figure 2.8). pMSCV-puro-AXfi and PWZL-Blast3-AX§ (0/p/p) These plasmids encode an Ig-P protein that is truncated in the extracellular domain (Table 1.1). P C R was used to amplify the Ig-P D N A fragment encoding the transmembrane and cytoplasmic domains. The D N A fragment had a Xho I restriction enzyme site upstream followed by nucleotides encoding methionine and lysine (as an extracellular domain to anchor the protein in the membrane (Johansson et al., 1999)) and an Eco RI restriction enzyme site downstream. The primers used were A X p X h o and p3Eco (the sequence of these primers can be found in Table 2.2). This fragment was digested and ligated into pWZL-Blast3 using the Xho I and Eco RI restriction enzyme sites. P C R was then used to amplify the D N A encoding the signal peptide o f Ig-B (amino acids 1 to 25) with a Bam HI restriction enzyme sequence upstream and a Xho I restriction enzyme sequence downstream. The primers used for P C R were S R S p i and SRSP2 (the sequence of these primers can be found in Table 2.2). The D N A fragment was digested with Bam HI and Xho I restriction enzymes and inserted into pWZL-Blast3 that already contained the A X p insertion described above; this created pWZL-Blast3-AX$. To create pMSCV-puro-AXfi the D N A encoding A X p was excised with Bam HI and Eco RI restriction enzymes and ligated into pMSCV-puro that had been cleaved at the Bg l LI and Eco RI restriction enzyme sites (Bam HI and B g l LI have compatible cohesive ends) (Figure 2.9). 38 5'LTR Xhol BamHI Xhol EcoRI 3'LTR Digest with X h o I and Eco R l Ligate BamHI Xhol 5'LTR Ig-P signal peptide P C R product 75 bp Digest with Bam HI and Xho I Ligate 5'LTR BglH Xhol EcoRI 3'LTR Digest with Bam H l / B g l II and Eco R l Ligate >MSCV-puro-^.Bo6R1 M P P 6.6 kb 3'LTR Figure 2.7 Creation of the pMSCV-puro-MPfi and pWZL-Blast3-M¥$ expression vectors. These vectors encode an Ig-P protein that is truncated in the N T and IG regions of the extracellular domain. The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. 39 5'LTR Digest with Xho I and Eco RI Ligate peptide P C R product 66 bp Digest with Bam HI and Xho I Ligate Digest with Bam H l / B g l II and Eco RI Ligate A l w l , BstYI Figure 2.8 Creation of the pMSCV-puro-AXa and pWZL-Blast3-AXa expression vectors. These vectors encode an Ig-a protein that is truncated in the extracellular domain. The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. 40 5'LTR Xhol EcoRI A X p P C R product 204 bp BamHI Xhol EcoRI 3'LTR Digest with Xho I and Eco RI Ligate BamHI Xhol Ig-P signal peptide P C R product 75 bp 5'LTR Digest with Bam HI and Xho I Ligate 5'LTR 5'LTR Bglll Xhol EcoRI 3'LTR Digest with Bam H l / B g l II and Eco RI Ligate A l w l , B s t Y I Figure 2.9 Creation of the pMSCV-puro-AXfi and pWZL-Blast3-AXfi expression vectors. These vectors encode an Ig-P protein that is truncated in the extracellular domain. The L T R sequences and the direction of transcription are represented by the yellow arrows. See section 2.1.3 for more details. 41 Table 2.2: Oligonucleotide primers used for polymerase chain reaction (PCR). Underlined nucleotides indicate restriction enzyme recognition sites. Primer Name Primer S equence (5' -3') Primer binding site M P A X h o C C G CTC G A G C G G A T G A A T C C A GTC CCT A G G CCC TTC The noncoding strand of Ig-a, amino acid 121, with a Xho I restriction site added a3Eco C C G G A A TTC C G G T C A T G G CTT TTC C A G C T G GGC The coding strand of Ig-a at the stop site with an Eco R l restriction site added S R S a l C G C G G A TCC G C G A T G C C A G G G GGT C T A G The noncoding strand of Ig-a at start site with Bam HI restriction site added SRSa2 C C G CTC G A G C A A A C A GGC G T A T G A C A A G The coding strand of Ig-a, amino acid 22, with a Xho I restriction site added M P B X h o C C G CTC G A G C G G A T G G G A TTC A G C A C G T T G G A C C A A The noncoding strand of Ig-P, amino acid 143, with a X h o I restriction site added (33Eco C C G G A A TTC C G G T C A TTC C T G C C G T G G A T G The coding strand of Ig-P at the stop site with an Eco R l restriction site added S R S p l C G C G G A TCC G C G A T G GCC A C A C T G G T G C T G The noncoding strand of Ig-P at start site with Bam HI restriction site added SRS(32 C C G CTC G A G C G G CTC A C C T G A G A A G A G The coding strand of Ig-P, amino acid 25, with a Xho I restriction site added A X a X h o C C G CTC G A G A T G A A G A T C A T C A C A G C A G A A G G G The noncoding strand of Ig-a, between the extracellular and transmembrane domains, with a Xho I restriction site added A X p X h o C C G CTC G A G A T G A A G GGC ATT A T C T T G A T C C A G The noncoding strand of Ig-P, between the extracellular and transmembrane domains, with a Xho I restriction site added 42 2.2 Molecular Biology Techniques 2.2.1 Restriction endonuclease digestion Restriction enzymes (Invitrogen Life Technologies (Burlington, Ontario) or New England Biolabs (Pickering, Ontario)) were added to the D N A according to manufacturer's instructions and digested at 37°C for 2 hours. If a double digest was to be performed, a mutually compatible buffer for both enzymes was used and the enzymes were added to the D N A to a total volume of no more than 10%. The reactions were then run on an agarose gel to visualize or extract the digested fragments. 2.2.2 Agarose gel electrophoresis Agarose gels between 0.8 and 1.0% agarose (Fisher Scientific, Ottawa, Ontario) in Tris-buffered E D T A (TBE) (90 m M Tr i s -HCl p H 8.2, 90 m M boric acid (Fisher Scientific), 2 m M E D T A ) with 300 ng/mL of ethidium bromide (Invitrogen Life Technologies) were used to separate D N A fragments. The samples were prepared with D N A sample buffer (final concentration 0.04% bromophenol blue, 0.04% xylene cyanol F F ad 10% sucrose) and loaded onto the gel. A 1 k B or a 100 bp molecular weight marker (Invitrogen Life Technologies) was also loaded onto the gel. The gels were run at 100 V for approximately 1 hour in T B E . Ultraviolet light was used to visualize the D N A fragments. 2.2.3 Gel purification of DNA fragments Digested D N A fragments run in an agarose gel were removed from the gel with a razor blade and purified using a QIAquick Gel Extraction K i t (Qiagen, Mississauga, Ontario) following manufacturer's instructions. 2.2.4 Ligation of DNA fragments D N A ligations were performed by combining approximately 1.0 u,g o f digested vector D N A with varying amounts of digested insert D N A (between 3 and 20 fig). T4 D N A ligase and 5 X T4 43 D N A ligase buffer (both from Invitrogen Life Technologies) were added to each tube to make up 10% and 20% of the total volume, respectively. The mixture was incubated at room temperature for 2 hours before being used to transform competent bacteria. 2.2.5 Transformation of competent E. coli Competent D H 5 a (Invitrogen Life Technologies) or X L l - B l u e (Stratagene, L a Jolla, California) E. coli strains (prepared by M a y Dang-Lawson) were transformed with 100 ng of plasmid D N A or with the ligation mixture described previously. Typically, 100 u L of bacteria was mixed with the D N A by vortexing for 10 seconds and then the mixture was incubated on ice for 10 minutes. If very few colonies were anticipated, the mixture was heat-shocked for 2 minutes at 42°C and placed back on ice for 5 minutes. It was then plated onto L B agar plates (5 g yeast extract, 10 g tryptone, 15 g agar (all from Difco Laboratories, Sparks, Maryland) and 5 g N a C l per litre) containing 100 \xglmL o f ampicillin (Sigma) and incubated at 37°C overnight. 2.2.6 Small scale D N A preparation Small volumes of plasmid D N A were purified using the GenElute Plasmid Miniprep K i t (Sigma Aldr ich Canada, Oakville, Ontario). A n individual bacterial colony was used to inoculate 3 m L of Luria-Bertani (LB) broth (5 g yeast extract, 10 g tryptone (Difco Laboratories) and 5 g N a C l per litre) containing 100 ng/mL of ampicillin and was incubated for 16 hours at 37°C with shaking. One and a half milliliters of the overnight culture was centrifuged and the plasmid was isolated and purified following manufacturer's instructions. 2.2.7 Large scale D N A preparation Large volumes of plasmid D N A were isolated and purified using the GenElute H P plasmid Maxiprep K i t (Sigma Aldr ich Canada). A n individual bacterial colony was used to inoculate 150 m L of L B broth containing 100 ug/mL of ampicillin. The bacteria were grown for 16 hours at 37°C while shaking. The culture was then used to isolate and purify the plasmid D N A according to manufacturer's instructions. 44 2.2.8 Polymerase Chain Reaction Polymerase chain reaction (PCR) was performed using puReTaq Ready-To-Go P C R beads (Amersham Biosciences Canada) according to manufacturer's instructions. Twenty-five picomole of each of the two D N A primers (Nucleic A c i d Protein Service Unit, U B C ) were added to each tube, along with 5.0 ng of template D N A . The reactions were overlaid with 10 u L of sterilized mineral o i l before being placed in a D N A Thermal Cycler (Perkin Elmer Cetus, Woodbridge, Ontario). The reactions were run at 95°C for 45 seconds, 55°C for 2 minutes and 72°C for 2 minutes for a total of 35 cycles. 2.2.9 Site-directed mutagenesis Site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis K i t (Stratagene). A l l oligonucleotide primers were purchased from the Nucleic A c i d Protein Service Unit ( U B C ) and the reactions were run in a D N A Thermal Cycler (Perkin Elmer Cetus, Woodbridge, Ontario) according to manufacturer's instructions. After transformation of the X L l - B l u e Supercompetent bacteria, a single colony was used to inoculate L B broth for small scale D N A preparation. The resulting D N A was tested for the presence of the intended mutation by restriction enzyme digestion and D N A sequencing (Nucleic A c i d Protein Service Unit). 2.3 Tissue Culture 2.3.1 Tissue culture cell lines The AtT20 murine pituitary tumor cell line was from Dr. Regis K e l l y (University of California, San Francisco, California) and has been previously described (Matsuuchi and Kel ly , 1991). The A S S cell line is an AtT20 cell line that does not contain any components of the B C R . The R142 cell line in an AtT20 cell line that expresses m l g M and Ig-a (Matsuuchi et al, 1992). The WT5 cell line is an AtT20 cell line that expresses m l g M and Ig-P (Lopes and Matsuuchi, unpublished). The Syk 13 cell line is an AtT20 cell line that expresses m l g M , Ig-a and Ig-P (Richards et al, 1996). The J558 u.u3 and J558 15-25 murine plasmacytoma cell lines were 45 from Dr. Louis Justement (University of Alabama, Birmingham, Alabama) and the J558 L u m and J558 L murine plasmacytoma cell lines were from Dr. Marcus Clark (University of Chicago, Chicago, Illinois). The B O S C 23 human fibroblast cell line was a gift from Dr. Warren Pear (University of Pennsylvania, Philadelphia, Pennsylvania). 2.3.2 Culture of cell lines The AtT20 and B O S C 23 cell lines were grown on 10 cm polystyrene tissue culture dishes (Falcon, Franklin Lakes, New Jersey) in Dulbecco's modified Eagle's medium ( D M E M ) (Invitrogen Life Technologies) containing 4.5 g/L glucose, 2 m M L-glutamine and 110 mg/L sodium pyruvate. Ten percent heat inactivated fetal calf serum (FCS) (Invitrogen Life Technologies), 50 units/mL penicillin and 50 |j.g/mL streptomycin sulfate (Invitrogen Life Technologies) were also added to the media. The cell lines were incubated in an air-jacketed incubator (ThermoForma, Marietta, Ohio) at 37°C in a 10% C 0 2 environment. The cells were grown to 90% confluency before being split into new tissue culture dishes. For long-term storage the cell lines are frozen in liquid nitrogen. The freezing media used for AtT20 and B O S C 23 cells is complete D M E M with 10% dimethyl sulphoxide ( D M S O ) (Sigma Aldrich). The adherent cells were removed from the tissue culture dish by aspirating off the media and replacing it with 2 m L of Tryps in-EDTA (0.25% trypsin/1 m M ethylenediaminetetraacetic ac id (EDTA)) (Invitrogen Life Technologies). Once the cells were no longer adhered to the plate they were resuspended in 10 m L of complete D M E M by pipeting up and down with a 10 m L sterile plastic pipette (Corning, Corning, New York) . Approximately 1 m L of the cell suspension was then placed in a new 10 cm tissue culture dish with 10 m L of complete D M E M and grown as described above. The J558 plasmacytoma cell lines were grown in 10 cm polystyrene tissue culture dishes (Falcon) in Roswell Park Memorial Institute (RPMI)-1640 media (Invitrogen Life Technologies) containing 10% heat inactivated F C S (Invitrogen Life Technologies), I m M sodium pyruvate (Invitrogen Life Technologies), 50 u M P-mercaptoethanol (Sigma Aldrich), 50 units/mL penicillin and 50 \xg/mL streptomycin sulfate (Invitrogen Life Technologies). The cells were incubated in a water-jacketed incubator (Forma Scientific, Marietta, Ohio) at 37°C in a 5% CO2 46 environment. The cells were split 1:10 in fresh media into new tissue culture dishes every 4-5 days. For long-term storage the cell lines are frozen in liquid nitrogen. The freezing media used for J558 plasmacytoma cells is heat inactivated F C S with 10% dimethyl sulphoxide ( D M S O ) (Sigma Aldrich). 2.3.3 Cell lysis AtT20 cells were grown to confluency on a 10 cm tissue culture dish, the media was removed and the cells were washed twice with phosphate buffer saline (PBS) (1.5 m M N a C l , 1.9 m M N a H 2 P 0 4 H 2 0 , 8.4 m M N a 2 H P 0 4 , p H 7.2 with 1 m M N a 3 V 0 4 (Sigma Aldrich)). The cells were then lysed with 0.5-1.0 m L of cold Triton X-100 lysis buffer (20 m M T r i s - H C l p H 8.0, 137 m M N a C l , 1% Triton X-100, 2 m M E D T A (Fisher Scientific Canada, Ottawa, Ontario), 10% glycerol, 10 pg/mL leupeptin (Roche Diagnostics, Indianapolis, Indiana), 1 pg/mL aproprotin (Roche Diagnostics), 1 m M pepstatin A (Sigma Aldrich), 1 m M N a 3 V 0 4 , 1 m M phenylmethylsulfonyl fluoride (PMSF) (Roche Diagnostics)) or cold digitonin lysis buffer (1% digitonin (Sigma Aldrich), 10 m M triethanolamine p H 7.8, 150 m M N a C l , 1 m M E D T A , 10 pg/mL leupeptin, 1 pg/mL aproprotin, 1 m M pepstatin A , 1 m M P M S F ) . The cells were incubated on ice for 20 minutes (for Triton X-100 buffer) or 45 minutes (for digitonin buffer) and then transferred to a 1.5 m L tube (Axygen Scientific, Union City, California) to be centrifuged at 14000 rpm for 15 minutes at 4 °C. The soluble lysates were then transferred to a new tube and the protein concentration was determined using the bicinchoninic acid ( B C A ) protein assay kit (Pierce Biotechnology, Rockford, Illinois). The samples were frozen at -20°C for long-term storage. J558 plasmactoma cells were centrifuged at 1500 rpm for 5 minutes at 12°C in an LEC Centra-8R tabletop centrifuge (International Equipment Company, Needham Heights, Massachusetts). The media was removed and the cells were washed twice with P B S and then lysed as described above. 2.4 Transfection of BOSC 23 Cells The B O S C cells were split into a 6 well tissue culture dish (Falcon) or a 10 cm tissue culture dish, depending on the amount of retroviral particles or cell lysate required, so that they were 47 approximately 40% confluent. They were grown to 80% confluency as described in section 2.2.2. To transfect one well of a 6 well dish, 2.0 ug of D N A was added to 200 u L of C a C h in a clear polystyrene tube (Falcon 2054). The D N A mixture was vortexed for 10 seconds while 200 u L of 2 X HEPES-buffered saline (50 m M HEPES p H 7.2, 10 m M KC1, 12 m M N a C l , 1.5 m M Na2HP04) was added to the tube dropwise. The media was then removed from the B O S C cells and replaced with 1 m L o f complete D M E M containing 25 u M chloroquinone (Sigma Aldrich). The D N A mixture was then added to the cells and the cells were incubated at 37°C in a 5% CO2 environment for 7-8 hours. The media was then replaced with 2 m L of complete D M E M and the cells were incubated at 37°C in a 5% CO2 environment for 48 hours from the time of D N A addition. The cells were then lysed i f they were to be used to determine i f a particular protein construct was expressible. To recover the retroviral particle the media was removed and used immediately for retroviral infection or frozen at - 8 0 ° C for long-term storage. To transfect B O S C cells in a 10 cm tissue culture dish, 8 pg of D N A was added to 800 u L of 250 m M C a C b and 800 u L of 2 X HEPES-buffered saline was added dropwise while vortexing for 10 seconds. The media was then removed from the B O S C cells and replaced with 5 m L of complete D M E M containing 25 u M chloroquinone and the D N A mixture was added to the cells. After incubating the cells for 7-8 hours at 37°C in a 5% CO2 environment the media was replaced with 6 m L of complete D M E M . The cells were incubated for 48 hours as described above and then either lysed or the virus particle was collected. 2.5 Retroviral Infection of Cells 2.5.1 Retroviral infection of AtT20 cells AtT20 cells were grown to 80% confluency on a 10 cm tissue culture dish, the media was aspirated off and replaced with 5-6 m L of sterile filtered media containing virus particle from the transfected B O S C cells (syringe filtered with a 0.22 um filter (Millipore, Billerica, Massachusetts)). Ten pg/mL of polybrene (hexadimethrine bromide, Sigma Aldrich) was added to the cells, and they were incubated for 6-7 hours at 37°C in a 10% CO2 environment. The media was then aspirated off the cells and replaced with complete D M E M , and the cells were grown for 48 hours at 37°C in a 10% CO2 environment before being placed in drug selection. 48 2.5.2 Retroviral infection of J558 plasmacytoma cells H a l f a mi l l ion J558 plasmacytoma cells were plated into one wel l o f a 6 wel l tissue culture dish (Falcon). Two milliliters of sterile filtered media containing virus particles from transfected B O S C cells (syringe filtered with a 0.22 um filter (Millipore)) was added to the cells along with 2.5 m L of polybrene (hexadimethrine bromide) (Sigma Aldrich). The cells were incubated for 6-20 hours at 37°C in a 5% CO2 environment. They were then centrifuged at 1500 rpm for 5 minutes in an IEC Centra-8R tabletop centrifuge (International Equipment Company), and the media was replaced with complete R P M I media. The cells were grown for 48 hours at 37°C in a 5% CO2 environment before being placed in drug selection. 2.5.3 Drug selection and clone isolation of infected cells Forty-eight hours after infection of the AtT20 cells with a retroviral plasmid containing a puromycin resistance gene, the media was aspirated from the cells and they were removed from the tissue culture dish with 2 m L of Tryps in-EDTA (0.25% trypsin/1 m M ethylenediaminetetraacetic ac id (EDTA)) (Invitrogen Life Technologies). The cells were resuspended in 20 m L of complete D M E M with 0.4 (j,g/mL puromycin (Calbiochem, L a Jolla, California) and pipetted up and down to break up any cell clumps. One drop to 1 m L of cell suspension was added to a 10 cm tissue culture dish containing 20 m L o f complete D M E M with puromycin. The cell suspension from these plates was pipetted into 96 well tissue culture dishes (Falcon), putting 150 u.L into each well . The cells were then allowed to grow at 37°C in a 10% CO2 environment until an individual clone could be seen in a single well . The media from wells containing one clone was aspirated and 100 u L of Tryps in-EDTA was added to each well . The cells were resuspended in 100 u L of complete D M E M with puromycin and added to 24 well tissue culture dishes (Falcon) contained complete D M E M with puromycin. The cells were then grown to confluency and transferred to 6 well tissue culture plates (Falcon) so that they could be screened for protein construct expression by Western immunoblotting. To select for a population o f J558 cells that transiently express a protein o f interest, the cells were placed into complete R P M I media containing 4 ug/mL of blasticidin S (Invitrogen Life Technologies) 48 hours after infection. The cells that did not contain the blasticidin resistance 49 gene in the retroviral plasmid were allowed to die over 5 days and the remaining cells were considered a transient population of protein expressing cells. To select for J558 cells that stably expressed a protein of interest, a population of identical clones from a single cell were isolated. Forty-eight hours after infection, the cells were diluted to varying concentrations (10 4, 10 3 and 10 2 cells/ mL) in selection media ( R P M I media containing 4 p.g/mL of blasticidin S (Invitrogen Life Technologies)). The cells from these plates were pipetted into 96 well tissue culture dishes (Falcon), putting 150 u L into each well . They grew at 37°C in a 5% CO2 environment until cells could be seen growing in the individual wells (usually 10-14 days). If fewer than 15 wells on the plate had cells growing in them, the cells from those wells were removed and plated into a 24 well plate (Falcon) in selection media. They were then screened for the expression of the protein of interest by Western immunoblotting. 2.6 Immunoprecipitations A l l cells to be used for immunoprecipitations were lysed in digitonin lysis buffer as described previously. One millilitre of cell lysate was added to 20 u L of washed Protein A-Sepharose 4B beads (Sigma Aldrich) in 1.5 m L tubes (Axygen Scientific). Five microliters of antibody was added to each tube, and the mixture was rocked for 1 hour at 4°C. The samples were centrifuged after incubation, and the lysate was aspirated off. The beads were then washed twice with lysis buffer, and the bound proteins were removed from the beads by adding S D S - P A G E (sodium dodecyl sulphate polyacrylamide electrophoresis) reducing sample buffer (62.5 m M Tr i s -HCl p H 6.8, 4% glycerol, 2.5% SDS, 0.02% bromophenol blue, 100 m M dithiothreitol (DTT) (Sigma Aldrich) and boiling for 5 minutes in a water bath. The samples were then loaded onto an SDS-P A G E mini-gel and analyzed by Western immunoblotting. 2.7 SDS-PAGE and Western Immunoblotting Samples containing S D S - P A G E sample buffer (62.5 m M Tr i s -HCl p H 6.8, 4% glycerol, 2.5% SDS, 0.02% bromophenol blue, 100 m M dithiothreitol (DTT) (Sigma Aldrich) were boiled in a water bath for 5 minutes and loaded into 1.5 mm thick S D S - P A G E mini-gels along with BenchMark pre-stained molecular weight standards (Invitrogen Life Technologies). The gels were run in a dual vertical mini-gel apparatus (CBS Scientific, De l Mar, California) at 25 50 milliamps per gel for approximately 2.5 hours. The proteins from the gels were transferred onto a BioTraceNT nitrocellulose blotting membrane (Pall Life Sciences, Pensacola, Florida) at 125 V for 1 hour in transfer buffer (20 m M Tr i s -HCl p H 8.0, 150 m M glycine, 20% methanol) using a Transblotter transfer apparatus (Bio-Rad Laboratories). The nitrocellulose filters were then blocked for half an hour at room temperature in Tris-buffered saline (TBS) containing 5% skim milk powder (Pacific M i l k Division, Vancouver, B C ) . The filters were then quickly washed in T B S with 0.1% Tween 20 (TBST) (Sigma Aldrich). The filters were then incubated in primary antibody while rocking overnight at 4°C. The next day the filters were washed in T B S T for 1 hour, changing the T B S T every 15 minutes. They were then incubated for 1 hour in a horseradish peroxidase (HRP) conjugated secondary reagent diluted 1:10 000 in T B S T . The filters were then washed in T B S T 4 times at 15-minute intervals and bathed in enhanced chemiluminescence ( E C L ) reagent (Amersham Biosciences) for 1.5 minutes and exposed to Kodak X-Omat Blue autoradiography film (Mandel Scientific, Guelph, Ontario). The film was developed using a Kodak M 3 5 A X - O M A T Processor (Medtec Marketing Limited, Burnaby, B C ) . If the filters were to be reprobed with a different primary antibody, they were washed at room temperature in T B S p H 2.0 for 20 minutes. The low p H was then neutralized by washing briefly with T B S p H 8.0. The filter could then be blocked and reprobed as described above. 2.8 Surface Expression of the BCR 2.8.1 Fluorescence activated cell sorting (FACS) The J558 lymphoid cells were centrifuged at 1500 rpm for 5 minutes in an IEC Centra-8R tabletop centrifuge (International Equipment Company) and resuspended in 1 m L of cold sorter buffer (phosphate buffer saline (PBS) with 1% heat inactivated fetal calf serum (FCS)). One mil l ion cells were added to each Falcon 2054 F A C S c a n tube, and the volume was adjusted to 1 m L with sorter buffer. The cells were then centrifuged at 1500 rpm for 5 minutes and resuspended in 50 p L of FITC-goat anti-IgM solution (30 pg/mL o f FITC-goat anti-IgM (Jackson ImmunoResearch Laboratories, Inc.) in sorter buffer) and incubated on ice for 30 minutes. The cells were resuspended in 1 m L of sorter buffer, vortexed and another milliliter o f sorter buffer was added. The cells were then centrifuged at 1500 rpm for 5 minutes in the cold 51 and resuspended in 1 mL of sorter buffer with 4 \xg/mL of 7-Amino actinomycin D to mark the dead cells. The cells were then examined on the Becton Dickinson FACScan (BD Biosciences) according to manufacturers directions and the data was analyzed using CellQuest Software (BD Biosciences). 2.8.2 Cell surface immunofluorescence by microscopy AtT20 cell lines were grown on glass coverslips (Sigma Aldrich) coated in poly-D-lysine (Matsuuchi, 1988) to semi-confluency. The cells were rinsed twice with phosphate buffered saline (PBS) with 20 mM glycine and fixed for 20 minutes in PBS containing 3% paraformaldehyde (BDH, Toronto, Ontario) pH 7.5. The coverslips were rinsed twice in 20 mM glycine in PBS and stained by incubating in rhodamine labeled goat anti-mouse IgM diluted 1:500 in 20 mM glycine in PBS for 30 minutes in the dark. The cells were then rinsed in PBS with 20 mM glycine and then in water. The coverslip was placed cell-side down on a slide in 3 uL of mounting media (90% glycerol, 10% PBS and 2.5% l,4-diazobicyclo-[2.2.2]-octane (DABCO) (Sigma Aldrich)) (Johnson et al., 1982) and sealed with nailpolish. The cells were examined using an Olympus 1X70 Based DeltaVision microscope (Applied Precision, Seattle, Washington) and the data was analyzed using DeltaVision Software (Applied Precision). 52 CHAPTER 3 Establishing the Experimental System 3.1 Screening Antibodies for Immunoblotting and Immunoprecipitation The immunoprecipitation experiments planned for this project required antibodies that were specific to the extracellular and cytoplasmic domains of Ig-a and Ig-(3. The Matsuuchi lab had been using an Ig-a antibody, produced against the Ig-a cytoplasmic tail (described in Gold, et al., 1991) as well as an Ig-P antibody that recognizes the cytoplasmic tail of Ig-p (a gift from Dr. Marcus Clark, University of Chicago, Chicago, Illinois), but two other antibodies, an Ig-a extracellular antibody and an Ig-p extracellular antibody were required. Fortunately, Abeome (Athens, Georgia) and Dr. Richard Meagher (University of Georgia, Athens, Georgia) provided the serum from several rabbits that had been immunized with a 30 amino acid peptide to the extracellular domain of mouse Ig-a or a 30 amino acid peptide to the extracellular domain of mouse Ig-p. The reactivity level of the rabbit serum to either Ig-a or Ig-P was then examined by immunoblotting. The results are shown in Table 3.1. The Abeome 689 antibody was used when an antibody to the extracellular domain of Ig-a was required because it proved to have the least amount of non-specific binding when immunoblotting. The Abeome 624 antibody was used when an antibody to the extracellular domain of Ig-P was needed. Figure 3.1 shows the specificity of the four different Ig-a and Ig-P antibodies used for this project. 53 Table 3.1: Reactivity of the Abeome antibodies to Ig-a or Ig-(3. +, ++ and +++ represent low, medium and high levels of reactivity as determined by western blot, respectively. Abeome antibody Bleed Date Reactive to domain: Reactivity 688 11/19/02 Ig-a extracellular + 12/23/02 Ig-a extracellular + 2/20/03 Ig-a extracellular ++ 4/17/03 Ig-a extracellular +++ 7/8/03 Ig-a extracellular ++ 689 4/17/03 Ig-a extracellular +++ 7/8/03 Ig-a extracellular +++ 690 3/20/03 Ig-a extracellular +++ 7/8/03 Ig-a extracellular +++ 624 12/3/02 Ig-P extracellular +++ 1/16/03 Ig-P extracellular ++ 1/27/03 Ig-P extracellular ++ 7/8/07 Ig-P extracellular + 54 (a) O B SS-SS-8 ca X c a 36-25-X a 2 Ig-a Xa2 IB: anti-a (extracellular) (c) SS-CO. ,8, P 5 is ^ ^ kDal ^ i a IB: anti-P (cytoplasmic) (b) T3 U u CO. CO, B 8 0 u u O O vr>a I fl i a. i m i m i IB: anti-p (extracellular) (d) U 8 CO. CO. 8 CO. X 8" c a << << ^ 1 3 | 1 | 1 | 1 | Ig-a IB: anti-a (cytoplasmic) Figure 3.1 Antibody screening by immunoblotting. 30-50 pg of whole cell lysate from either cells expressing various components of the BCR or from transiently transfected BOSC cells was analyzed by SDS-PAGE. Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a or Ig-P antibodies (a) antibody reactive to the extracellular domain of Ig-a. (b) antibody reactive to extracellular domain of Ig-B. (c) antibody reactive to the cytoplamic domain of Ig-P and (d) antibody reactive to the cytoplasmic domain of Ig-a. p, X, a, P: the components of the BCR that the cell line expresses, IB: immunoblotting antibody •: background band, green colouration: Ig-a, blue colouration: Ig-p. 55 3.2 Construct Expressibility in BOSC Cells To ensure that the mutant constructs created for this project are expressible, the plasmids described in section 2.1.3 were transfected into B O S C human fibroblast cells which are easily transiently transfected and used as a test system. Whole cell lysate was run by S D S - P A G E and immunoblotted. Figure 3.2 shows the expression of all nine constructs ( X a 2 , C p , M P p , A X p , A X a , M P a , X p , C a and A a K V K ) in B O S C cells. 3.3 Experimental Cell Systems In order to examine the assembly and cell surface expression o f a mutant B C R , cell lines needed to be created that expressed m l g M , Ig-P and mutant Ig-a constructs. Two different expression systems, the AtT20 non-lymphoid system and the J558 lymphoid system, were used for this purpose. 3.3.1 AfT20 non-lymphoid expression system The AtT20 expression system is a series of non-lymphoid tissue culture cell lines (AtT20 endocrine cells) that have been previously transfected with various combinations of the B C R components. This system includes one cell line lacking Ig-a, so that mutant versions of Ig-a could be expressed. 3.3.1 J558 lymphoid expression system The J558 expression system makes use of lymphoid tissue culture cell lines derived from the J558 plasmacytoma. Normally these cells do not express the B C R on their surface since they are antibody-secreting cells. The J558 cell lines used for this project were transfected with, and express, various components of the B C R . One of the J558 cell lines expresses m l g M and Ig-P, to which the mutant Ig-a constructs were added. 56 (c) kDa eg I -8 i g i <J i ± i M P a (MPa/a/a) - A X a (O/a/a) IB: anti-a (cytoplasmic) (d) -a k D a | I ! 5 i >< | C a (p/p/a) H X p (p/a/a) IB: anti-a (cytoplasmic) (Ca from Wang et al., 2004) (e) kDa 37 -35 § | X 26 co. U L_U -Xa2 (a/p/p) = CP (a/a/p) IB: anti-P (cytoplasmic) (f) o k D a 19 15 -MPB(MPp/p/p) "AXp (0/p/p) IB: anti-p (cytoplasmic) Figure 3.2: Expression of mutant Ig-a and Ig-P constructs in BOSC human fibroblast cells. 30-50 \ig o f whole cell lysate from transiently transfected B O S C cells was analyzed by SDS-P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a or Ig-P antibodies, (a) schematic representation of all mutant Ig-a/p proteins (the green colouration represents Ig-a, the blue colouration represents Ig-P), (b) expression of A a K V K , (c) expression of A X a and M P a , (d) expression of C a and XP (the various sizes are due to differential glycosylation), (e) expression o f X a 2 and Cp and (f) expression o f M P p and A X p . IB: immunoblotting antibody, • : background band, *: potential homodimerization. 57 3.4 Expression of constructs in AfT20 and J558 cell lines To create the cell lines needed to examine mutant B C R assembly and cell surface trafficking, five of the nine mutant constructs were successfully retrovirally infected into either the AtT20 expression system or the J558 expression system (the other four constructs w i l l be used in future studies). J558 cells already expressing Ig-(3 and m l g M were infected with Ca (p/p/a), X a 2 (a/p/p) or CP (a/a/p) D N A (Figure 3.3 (a), (b) and (c)). Additionally, AtT20 cells already expressing Ig-P and m l g M were infected with A X a (O/a/a) or A a K V K (a/a/0) D N A (Figure 3.3 (d) and (e)). Wi th these five mutant Ig-a constructs being expressed in cell lines already expressing the other components of the B C R , it was then possible to begin to study the assembly and cell surface trafficking of the mutant B C R s . 58 (a) kDa ca 8 ca B c a a . 8 u c£ (b) kDa co. s" e a t s x 3 ca U CO. CO. CO. »\ c\ ^ ^ C a Ig-a J558 cells IB: anti-a (cytoplasmic) J558 cells IB: anti-P (cytoplasmic) X a 2 , C 0 (c) kDa 25-19-15" a a o o ca 8 ca ca (d) Ig-a A X a k D a 37-2 5 -o j3 a AtT20 cells IB: anti-a (cytoplasmic) AtT20 cells IB: anti-a (extracellular) Figure 3.3: Transient expression of mutant Ig-a constructs in J558 mouse plasmacytoma cells and stable expression of mutant Ig-a constructs in A t 120 non-lymphoid cells.. Thirty-50 \ig o f whole cell lysate from drug selected cells were analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a or Ig-P antibodies, (a) expression o f C a (p/p/a) in J558 cells, (b) expression o f X a 2 (a/p/p) and CP (a/a/p) in J558 cells, (c) expression of A X a (O/a/a) in AtT20 cells, (d) expression of A a K V K (a/a/0) in AtT20 cells. Labels on top of gels indicate B C R chains expressed by transfected cells. IB: immunoblotting antibody, •: background band. 59 CHAPTER 4 BCR Assembly and Cell Surface Trafficking 4.1 Introduction A l l four components of the mlgM-containing B C R (H chains, L chains, Ig-a and Ig-P) must be expressed in the cell in order for assembly and cell surface trafficking to occur (Matsuuchi et al, 1992; Venkitaraman et al, 1991). However, i f the cytoplasmic tails o f either Ig-a or Ig-P are truncated or mutated, the m l g M B C R can still traffic to the cell surface, but B cell signalling and development are disrupted (Reichlin et al, 2001, Wang et al, 2004). The study by Reichlin et al. (2001) showed that truncation o f the Ig-a or Ig-P cytoplasmic tail, leaving a heterodimer in the extracellular and transmembrane domains, allowed for B C R formation and cell surface trafficking. In support of this data, a study by Wang et al. (2004) showed that an Ig-P mutant that heterodimerized with Ig-a in the extracellular and transmembrane domains, but homodimerized in the cytoplasmic domain, was able to form a complete B C R and traffic to the cell surface. Both of these studies suggest that heterodimerization in the extracellular and transmembrane domains is required for B C R assembly and cell surface trafficking. This hypothesis was further examined here with five mutant Ig-a constructs ( C a (p/p/a), X a 2 (a/p/p), CP (a/a/p), A a K V K (a/a/0) and A X a (0/a/a)). These studies w i l l help us to increase our understanding of which portions of the B C R are required for B C R cell surface expression during the different stages of B cell development. 4.2 BCR Assembly 4.2.1 BCR assembly with the Ca (P/p/a) construct J558 cells expressing m l g M , Ig-P and the mutant Ig-a construct C a (p/p/a), were used to examine whether Ig-a/p heterodimerization in the cytoplasmic domain would allow for B C R assembly. Figure 4.1(a) depicts the potential structure of the C a B C R . In this B C R heterodimerization can only occur between the cytoplasmic domains o f Ig-P and C a . 60 Irrirnunoprecipitation experiments were used to examine whether or not the C a B C R is able to assemble into a complete B C R . The p H chain portion o f m l g M was successfully immunoprecipitated from the cells expressing C a , but immunoblotting demonstrated that C a does not associate with m l g M (Figure 4.1(c)). Additionally, the C a protein was immunoprecipitated from the C a cell lysate, but immunoblotting for Ig-P showed that C a does not associate with Ig-p (Figure 4.1(d)). These findings suggest that heterodimerization in the cytoplasmic domain of Ig-a/p does not allow for B C R assembly. 4.2.2 B C R assembly with the Xa2 (a/p/p) construct In a second examination, J558 cells expressing m l g M , Ig-P and the X a 2 (a/p/p) construct were used to identify whether heterodimerization in the Ig-a/p extracellular domain would allow for B C R assembly. Figure 4.2(a) shows the potential structure of the X a 2 B C R . Immunoprecipitation of the p H chain of m l g M followed by immunoblotting for X a 2 showed that X a 2 is not able to associate with m l g M (Figure 4.2(c)). Immunoprecipitation of Ig-P followed by immunoblotting indicated that X a 2 is also not able to associate with Ig-P (Figure 4.2(d)). These findings suggest that heterodimerization solely in the extracellular domain of Ig-a/p does not allow for B C R assembly. 4.2.3 B C R assembly with the CP (a/a/p) construct Due to the finding that Ig-a/p heterodimerization in the cytoplasmic or extracellular domains on their own, do not allow for B C R assembly, J558 cells, expressing m l g M , Ig-P and the CP (a/a/p) construct, were used to determine i f heterodimerization in the extracellular and transmembrane domains would allow for B C R formation. Figure 4.3(a) shows the potential structure of the CP B C R . Immunoprecipitation of the p H chain of m l g M followed by immunoblotting for CP showed that CP is able to interact with m l g M in these cells (Figure 4.3(c)). Immunoprecipitation of Ig-P and immunoblotting for CP indicated that CP also binds Ig-P (Figure 4.3(d)). These findings suggest that heterodimerization in the extracellular and transmembrane domains of Ig-a/p does allow for B C R assembly. 61 m l g M m l g M kDa 8 ea. U 8 ca ca c< << << C a Ig-a J558 cells IB: anti-a (cytoplasmic) C a (p/p/a) B C R m l g M (d) 3 6 -25" Ig-a IP 1 IP 1: anti-p IB: anti-a (cytoplasmic) ca 0 8 ca ca c£. <4 e£ kDa | _ l j _ £ j _ £ j ^ J 49" 36" 25" "Ig-P IP 2: anti-a (cytoplasmic) IB: anti-P (cytoplasmic) p H chain C a Ig-p (P/p/a) (p/p/p) 4 9 -3 6 -S & R : anti-p 25"! C a Ig-a S & R : anti-a (cytoplasmic) Figure 4.1: Transient expression of the C a construct in J558 mouse plasmacytoma cells and the association of C a with lg-B and m l g M (a) diagrammatic representation of the C a B C R to show the potential interactions that could occur between the different components, (b) expression of C a in J558 cells, 30-50 pg of whole cell lysate from drug selected cells was analyzed by SDS-P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies. Figure repeated from Figure 3.3(a). (c) association o f C a with Ig-P and (d) association of C a with m l g M . J558 cells expressing C a were lysed and B C R components were immunoprecipitated from 1000 pg of whole cell lysate using Protein A-Sepharose and p or Ig-a specific antibodies. Immunoprecipitates were analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a or Ig-P antibodies (upper panels) and then stripped and reprobed (S&R) with p or Ig-a antibodies (lower panels), p, X, a , p: the components of the B C R that the cell line expresses, IP: immunoprecipitating antibody, IB: immunoblotting antibody, S & R : immunoblotting antibody used to reprobe the filter, • : background band, Ik; immunoprecipitating antibody, green colouration: Ig-a, light blue colouration: Ig-P, dark blue colouration: m l g M . 62 (a) (b) mlgM mlgM k D a 37 -25 -8 ea. X S CO. CO. R-J R«£ X a 2 J558 cells IB: anti-P (cytoplasmic) W T B C R X a 2 (a/p/p) B C R C 4 ea I b a e l <£ r< c? (c) k D a [ ^ (d) m l g M S c a X sf c a c a R£ R£ E*? I cDaMl ^ 1 ^ 1 ^ 1 2 5 " 19" Ig-a IP 1 IP 1: anti-p. IB: anti-a (extracellular) 82 - | 61 S & R : anti-u u H chain 2 5 -1 9 " •IP2 Ig-a IP 2: anti-P (extracellular) IB: anti-a (extracellular) X a 2 Ig-P (a/p/p) (P/p/p) 3 6 - Ig-P" S & R : anti-P (cytoplasmic) Figure 4.2: Transient expression of the Xa2 construct in J558 mouse plasmacytoma cells and the association of Xa2 with Ig-P and mlgM (a) diagrammatic representation o f the X a 2 B C R to show the potential interactions that could occur between the different components, (b) expression of X a 2 in J558 cells, 30-50 ug of whole cell lysate from drug selected cells was analyzed by SDS-P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-P antibodies. Figure repeated from Figure 3.3(b). (c) association of X a 2 with Ig-p and (d) association of X a 2 with m l g M . J558 cells expressing X a 2 were lysed and B C R components were immunoprecipitated from 1000 p,g o f whole cell lysate using Protein A-Sepharose and |u or Ig-P specific antibodies. Immunoprecipitates were analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies (upper panels) and then stripped and reprobed (S&R) with p. or Ig-P antibodies (lower panels), p, X, a, P: the components of the B C R that the cell line expresses, IP: immunoprecipitating antibody, IB: immunoblotting antibody, S & R : immunoblotting antibody used to reprobe the filter, • : background band, * : immunoprecipitating antibody, green colouration: Ig-a, light blue colouration: Ig-P, dark blue colouration: m l g M . * the various sizes of Ig-P are due to a range of glycosylated forms. 63 ( a ) m l g M W T B C R m l g M CP (a/a/p) B C R (b) k D a 37 -25 " co. co. rj cf CO. CO. << c< c< Ig-P* C P J558 cells IB: anti-P (cytoplasmic) (c) CO. co. rj cf co. co. #i ri c< c< k D a | ^ | =£| =L| =L| 2 5 -19" m l g M <*- Ig-a rep IP i IP 1: anti-p IB: anti-a (extracellular) 82 - | 61 S & R : ami-u p H chain IP 2 cp ig-p (a/a/p) ( p / p / p ) IP 2: anti-P (extracellular) IB: anti-a (extracellular) S & R : anti-P (cytoplasmic) Figure 4.3: Transient expression of the C p construct in J558 mouse plasmacytoma cells and the association of Cp with Ig-P and m l g M (a) diagrammatic representation of the CP B C R to show the potential interactions that could occur between the different components, (b) expression of CP in J558 cells, 30-50 pg of whole cell lysate from drug selected cells was analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-P antibodies. Figure repeated from Figure 3.3(b). (c) association of CP with lg-P and (d) association of CP with m l g M . J558 cells expressing CP were lysed and B C R components were immunoprecipitated from 1000 pg of whole cell lysate using Protein A-Sepharose and p or Ig-P specific antibodies. Immunoprecipitates were analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies (upper panels) and then stripped and reprobed (S&R) with p or Ig-P antibodies (lower panels), p, X, a, P: the components of the B C R that the cell line expresses, IP: immunoprecipitating antibody, IB: immunoblotting antibody, S & R : immunoblotting antibody used to reprobe the filter, • : background band, * : immunoprecipitating antibody, green colouration: Ig-a, light blue colouration: Ig-P, dark blue colouration: m l g M . * the various sizes of Ig-P are due to a range of glycosylated forms. 64 4.2.4 B C R assembly with the AaKVK (a/a/O) construct AtT20 cells expressing m l g M , Ig-P and A a K V K (a/a/O) were used to determine whether B C R assembly can occur with Ig-a/p heterodimerization in the extracellular and transmembane domains, but without cytoplasmic dimerization. The A a K V K construct is truncated in the cytoplasmic domain and has only three cytoplasmic amino acids, lysine, valine, lysine. These are the same amino acids that are in the cytoplasmic tail o f the p H chain of m l g M . A diagram of the potential structure of the A a K V K B C R is shown in Figure 4.4(a). Immunoprecipitation of the p H chain followed by immunoblotting for A a K V K showed that A a K V K is able to associate with m l g M (Figure 4.4(c)). Immunoprecipitation of Ig-P and immunoblotting for A a K V K showed that A a K V K is not able to associate with Ig-P (Figure 4.4(d)). As the structures of CP and A a K V K are similar, with the only difference being that CP has an Ig-p cytoplasmic tail, this data indicates that dimerization in the cytoplasmic domain and heterodimerization in the extracellular and transmembrane domains of Ig-a/p is needed for proper B C R assembly. 4.2.5 B C R assembly with the AXa (0/a/a) construct AtT20 cells expressing m l g M , Ig-P and A X a were used to determine whether B C R assembly can occur with heterodimerization in the transmembrane and cytoplasmic domains. Figure 4.5(a) diagrams the potential structure of the A X a B C R . Immunoprecipitation of the p H chain of m l g M followed by immunoblotting for A X a showed that A X a is able to associate with m l g M (Figure 4.5(c)). Immunoprecipitation of Ig-P with immunoblotting for A X a showed that A X a is not able to associate with Ig-p. Therefore, as with A a K V K , only the interaction between m l g M and A X a occurs, and Ig-P is not able to associate to form a complete B C R . 65 m l g M (a) W T B C R (c) T ) O M ex b c a c a a << c< << kDa I P I =E| =M ^ 3 6 -2 5 -m l g M A a K V K (a/a/O) B C R <- Ig-a 4 - A a K V K m l g M IP 1: anti-u IB: anti-a (extracellular) IP 1 82 H 61 -p H chain kDa 37-2 5 -I * g ca < I S ca ca J3 E"£ c< << I g I 1^ 1^ 1^ Ig-a A a K V K AtT20 cells IB: anti-a (extracellular) (d) -o kDa 25 19-| a ca ca §m m,. -m. m B I = £ I = L I £ I Ig-a •IP 2 IP 2: anti-P (extracellular) IB: anti-a (extracellular) 3 6 -S & R : anti-u A a K V K Ig-P ( a / a / O ) (P/p/p) S & R : anti-P (cytoplasmic) Figure 4.4: Stable expression of A a K V K in AtT20 non-lymphoid cells and the association of A a K V K with Ig-P and mlgM (a) diagrammatic representation of the A a K V K B C R to show the potential interactions that could occur between the different components, (b) expression of A a K V K in AtT20 cells, 30-50 pg o f whole cell lysate from drug selected cells was analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies. Figure repeated from Figure 3.3(d). (c) association of A a K V K with Ig-p and (d) association of A a K V K with m l g M . AtT20 cells expressing A a K V K were lysed and B C R components were immunoprecipitated from 1000 pg of whole cell lysate using Protein A -Sepharose and p or Ig-P specific antibodies. Immunoprecipitates were analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies (upper panels) and then stripped and reprobed (S&R) with p or Ig-P antibodies (lower panels), p, X, a, P: the components of the B C R that the cell line expresses, IP: immunoprecipitating antibody, IB: immunoblotting antibody, S & R : immunoblotting antibody used to reprobe the filter, • : background band, * : immunoprecipitating antibody, green colouration: Ig-a, light blue colouration: Ig-p, dark blue colouration: m l g M . * the various sizes of Ig-P are due to a range of glycosylated forms. 66 (a) m l g M m l g M (b) k D a 2 5 -1 9 -1 5 -o •4~> o M eo, | S ca ca £ << «i d Ig-a A X a W T B C R A X a B C R AtT20 cells IB: anti-a (cytoplasmic) (c) -a < I 8 a ca 43 c< r< kDa l § I -T I -T I -T I m l g M IP 1 A X a IP 1: anti-p IB: anti-a (cytoplasmic) d) & °o-a o ca ca a «. « 43 ^ ^ k D a l § I z L l z L l z L l IP 2 - p H chain A X a lg-p (O/A/A) (P/P/P) S & R : anti-p 25 15H Ig-a IP 2: anti-p (extracellular) IB: anti-a (cytoplasmic) 3 6 H Ig-P S & R : anti-P (cytoplasmic) Figure 4.5: Stable expression of A X a in AtT20 non-lymphoid cells and the association of A X a with lg-P and mlgM (a) diagrammatic representation of the A X a B C R to show the potential interactions that could occur between the different components, (b) expression of A X a in AtT20 cells, 30-50 pg of whole cell lysate from drug selected cells was analyzed by SDS-P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies. Figure repeated from Figure 3.3(c). (c) association of A X a with Ig-P and (d) association of A X a with m l g M . AtT20 cells expressing A X a were lysed and B C R components were immunoprecipitated from 1000 pg of whole cell lysate using Protein A-Sepharose and p or Ig-p specific antibodies. Immunoprecipitates were analyzed by S D S - P A G E . Proteins from the gels were transferred to nitrocellulose and immunoblotted with Ig-a antibodies (upper panels) and then stripped and reprobed (S&R) with p or Ig-P antibodies (lower panels), p, X, a , P: the components of the B C R that the cell line expresses, IP: immunoprecipitating antibody, IB: immunoblotting antibody, S & R : immunoblotting antibody used to reprobe the filter, • : background band, * : immunoprecipitating antibody, green colouration: Ig-a, light blue colouration: Ig-P, dark blue colouration: m l g M . 67 4.3 B C R C e l l Surface Expression If all the components of the B C R are able to interact with one another within a cell, the B C R w i l l assemble and traffic to the cell surface. Ce l l surface expression of the B C R can be determined using a fluorescently tagged antibody to the p H chain of m l g M and employing either fluorescent activated cell sorting ( F A C S ) or microscopy. If.the B C R is expressed on the cell surface, then the surface o f the cell w i l l be fluorescently labeled. F A C S was used to determine whether or not the C a , X a 2 and C(3 B C R s are expressed on the surface of J558 cells. Figure 4.6 shows the F A C S data for the cells that were expressing one of these three constructs. In the W T B C R panel the two clusters of data points represent either cells that were fluorescently labeled and were expressing the B C R on their cell surface (lower right quadrant) or cells that were not (lower left quadrant). The upper quadrants represent dead cells. O f the three constructs tested by this method, the only one that had data points in the lower right quadrant was C(3 (a/a/p). This indicates that B C R s containing C P are expressed on the cell surface while the B C R s containing C a or X a 2 are not expressed on the cell surface. Immunofluorescence microscopy was used to visualize B C R cell surface expression in adherent AtT20 cells. B C R surface expression was seen in the cells expressing the W T B C R , but neither of the cell lines expressing the A a K V K B C R or the A X a B C R had any B C R surface expression (data not shown). 68 W T B C R (p, X, p, a ) I* : 1 5 • * - • « ! ? 2 0 io° io' 102 t i 3 t i fu-h H, A, p | n 3 is**?*-... 'IP 0 p, X, P, C a (p/p/a) to0 102 FU-H 103 104 p, X, p, X a 2 (a/p/p) p, C p (a/a/p) anti-p surface fluorescence Figure 4.6: Fluorescence activated cell sorting (FACS) of J558 cells expressing C a , X a 2 or C p . J558 cells expressing mutant Ig-a constructs were stained with FITC-goat anti-IgM to label the p H chain on the cell surface, and with 7-Amino actinomycin D ( 7 - A A D ) to mark the dead cells. The cells were then analyzed by F A C S . p, X, a , P: the components of the B C R that the cell line expresses. Live cells expressing the B C R on their cell surface are represented in the lower right quadrant. The numbers represent the percent o f cells in each quadrant. Green colouration represents Ig-a, light blue colouration represents Ig-p. 69 CHAPTER 5 Discussion 5.1 Summary of results and discussion of future directions A l l four components of the mlgM-containing B C R must be expressed in a cell in order for B C R assembly and cell surface trafficking to occur (Matsuuchi et al., 1992; Venkitaraman et al., 1991). If the B C R is not able to be expressed on the cell surface, B cell development does not occur. For example, a deletion of Ig-a or Ig-P prevents B cell development past the pro-B cell stage (Pelanda et al., 2002). Although it is recognized that all four components of the B C R are required for B C R cell surface expression, few studies have examined which portions of the B C R are important for receptor assembly and cell surface trafficking. This knowledge wi l l allow future researchers to study B C R signalling and, the role of the B C R in B cell development and B cell leukemias. This study has indicated that for B C R assembly and cell surface expression to occur the Ig-a/p proteins must heterodimerize in the extracellular and transmembrane domains and, potentially, dimerize in the cytoplasmic domain. This was determined by creating, seven new Ig-a/p mutant constructs (Xa2 , CP, A X a , A X p , M P a , MPP and X p ) , altering one Ig-a construct ( A a K V K ) and using one construct that had been previously used as an Ig-p mutant construct (Ca). Five of these constructs (Ca , X a 2 , Cp , A X a and A a K V K ) were expressed in cell lines already expressing m l g M and Ig-B. Immunoprecipitation and cell surface fluorescence studies were used to determine whether or not these mutant Ig-a constructs were able to associate with m l g M and Ig-P and i f the mutant B C R was able to traffic to the cell surface. The results of these studies are summarized in Table 5.1. Immunoprecipitation experiments showed that constructs that heterodimerized with Ig-P in the transmembrane domain (CP (a/a/p), A a K V K (a/a/O) and A X a (0/a/a)) were able to associate with m l g M , but not with Ig-p. Since A a K V K (a/a/O) is truncated cytoplasmically and A X a is truncated extracellularly and neither construct contains any extraneous cytoplasmic or 70 Table 5.1: Summary of results. The green colouration represents Ig-a, the light blue colouration represents Ig-P and dark blue colouration represents m l g M . E X : the extracellular domain, T M : the transmembrane domain, C Y : the cytoplasmic domain, M P : membrane proximal region of the extracellular domain. Mutant Ig-a B C R Mutant Ig-a Description Potential B C R Structure Mutant Ig-a association with m l g M Mutant Ig-a association with Ig-p B C R cell surface expression W T Ig-a (a/a/a) W T Ig-a 1 yes yes yes C a (P/p/a) E X : Ig-P T M : Ig-p C Y : Ig-a i no no no X a (a/p/p) E X : Ig-a T M : Ig-p C Y : Ig-p no no no cp (a/a/p) E X : Ig-a T M : Ig-a C Y : Ig-p yes yes yes A X a (0/a/a) E X : none T M : Ig-a C Y : Ig-a yes no no A a K V K (a/a/O) E X : Ig-a T M : Ig-a C Y : none Jjl yes no no 71 extracellular amino acids in the truncated region, we can infer that the association between m l g M and Ig-a is through the transmembrane domain. A mutant that is made up o f only the Ig-a transmembrane domain would confirm this finding. The CP (a/a/p) chimeric protein is the only construct tested that is able to associate with W T Ig-P and m l g M to form a complete B C R . It forms a heterodimer with Ig-P in the extracellular and transmembrane domains indicating that heterodimerization in those regions is necessary for B C R assembly. But, the lack of association between A a K V K (a/a/0) and Ig-P is puzzling because the only difference between A a K V K and CP is that CP has an Ig-P cytoplasmic tail, rather than being truncated cytoplasmically. Previous studies have shown that truncation o f the Ig-a or Ig-p cytoplasmic tail allows for complete B C R formation and cell surface trafficking (Reichlin et al., 2001). These unexpected results could indicate that the three amino acids in the cytoplasmic tail o f A a K V K are disrupting its association with Ig-B. The three amino acids (lys, val, lys) are the same three amino acids that compose the cytoplasmic tail o f the p H chain, and they may be preventing A a K V K from associating with Ig-p. Alternatively, the construct used by Reichlen et al. (2001) is truncated at amino acid 181 of Ig-a (Torres et al., 1996), therefore there are 21 cytoplasmic Ig-a amino acids in that construct, whereas A a K V K has none. Those extra amino acids may be enough to allow that construct to associate with Ig-p. A new A a K V K construct with a different cytoplasmic tail w i l l confirm whether my findings are due to interference by the K V K cytoplasmic tail, or whether a cytoplasmic tail (being either Ig-a or Ig-P) is required for Ig-a to associate with Ig-p. In the future the constructs that were created as a part of this project, along with additional constructs, can be used to determine which portions of the extracellular domain are necessary for B C R assembly and cell surface trafficking. The M P a and M P P constructs w i l l help determine i f the membrane proximal region o f the extracellular domain w i l l allow B C R assembly and cell surface trafficking. Ig-P constructs, such as M P p , which are lacking the IG region of the extracellular domain have a deletion is in a very similar region to an alternatively spliced form of the human Ig-P gene (Koyama et al., 1995). This alternatively spliced form has been found to be expressed in some human B cell chronic lymphocytic leukemias ( B C L L s ) (Cragg et al, 2002). Understanding how the splicing mutation and other mutations affect B C R assembly and cell 72 surface trafficking is an important part in understanding more about how low levels of B C R cell surface expression affect B cell chronic lymphocytic leukemia ( B C L L ) formation. The signalling abilities of the B C R were not examined in this study, but the mutant B C R s that are found to traffic to the cell surface can be used for signalling studies. It may be that B C R s with only Ig-a or Ig-p cytoplasmic tails are not able to interact with the same signalling molecules as those with both Ig-a and Ig-P cytoplasmic tails. This is a likely scenario because although Ig-a and Ig-P both have I T A M motifs in their cytoplasmic domains, Ig-a has two other tyrosine residues that can recruit different B cell proteins (Clark et al, 1992). Signalling studies performed using the J558 lymphoid cell lines would give an indication of how the mutant B C R s would function in vivo because the B cell derived cell line should express the proteins normally expressed in a B cell. A n d i f mutant B C R s signal differently than W T B C R s , it would be expected that B cell development would also be affected. Developmental studies using mouse models have already shown that the cytoplasmic tails of Ig-a and Ig-P have different functions during B cell development. Truncation of the cytoplasmic tails of either Ig-a or Ig-P demonstrated that the Ig-a cytoplasmic tail allows B cell development to a later stage than the Ig-p cytoplasmic tail (Reichlin et al, 2001). Also , having a B C R with two Ig-a cytoplasmic tails allowed the B cell to proceed further developmentally than i f it expressed just one Ig-a cytoplasmic tail (Wang et al, 2004). These studies could be taken further to examine which cytoplasmic regions and amino acid residues are important for different aspects of B cell development. Developmental studies can also be used to model B C L L s . If a B C R is able to traffic to the cell surface, but surface expression or signalling is reduced, the B cell becomes nonfunctional and long-lived, potentially developing into a B C L L (Gordon et al, 2003) Reichlin et al, (2004) have found that i f a B cell is allowed to mature prior to inducing a B C R mutation that creates a B C R with two Ig-a cytoplasmic tails, the cell become anergic and long-lived, l ikely due to lower B C R cell surface expression. Similar B C R mutations may be one of the ways that B C L L s develop. Cragg et al. (2002) looked at cells from B C L L s and showed that they tend to express m R N A from a differentially spliced version of the Ig-P gene. The resulting protein is lacking a portion of its extracellular domain. They propose that the mutant protein is acting as a negative 73 regulator of the B C R and preventing functional levels of signalling from occurring, resulting in the long-lived anergic cell characteristic of a B C L L . In order to further understand B cell leukemias, studies need to be performed that examine which regions of the B C R protein are important for B C R assembly, trafficking and signalling during B cell development. This can be performed using the experimental systems employed for this project as wel l as using mouse models. This w i l l give significant insight into how B C L L s develop and how they can be cured. Additionally, modeling common B C L L mutations in mice may demonstrate how B C L L s arise and persist in humans. 5.2 Further discussion B C R assembly and trafficking to the cell surface is dependent upon the proper association of all four components of the B C R . This study has shown that heterodimerization between Ig-a and Ig-P in the extracellular and transmembrane domains is necessary for B C R assembly. Assembly o f the B C R within the cell is dependent upon chaperone proteins that retain B C R components in the E R until assembly is complete (Matsuuchi et al, 1992; Venkitaraman et al, 1991). The sequence of events leading to B C R assembly by chaperone proteins may require Ig-a/p heterodimerization in the extracellular domain and the chaperone proteins bound to Ig-a or Ig-P may remain bound until disulfide bond formation occurs between Ig-a and Ig-p. Disulfide bonds could potentially occur between homodimers, but this may be prevented due to conformational differences or due to interactions between the glycosylations of the proteins. Ig-a and Ig-p have a different number of extracellular glycosylation sites, two and four, respectively, and these may assist in disulfide bond formation between heterodimers. This study has shown that the interaction between m l g M and Ig-a appears to occur in the transmembrane domain. A s mentioned, m l g M contains nine polar amino acids in its transmembrane domain. This is unusual for a membrane spanning protein and suggests that these amino acids are likely interacting with another transmembrane protein (Reth, 1992). Taking into consideration that both Ig-a and Ig-p also have polar amino acids in their transmembrane region it is likely that Ig-a and/or Ig-P shield the polar amino acids of m l g M from the hydrophobic l ipid bilayer by way of hydrogen bonding between the residues. Additional interactions between Ig-a/p and m l g M may occur by way of extracellular 74 glycosylations. A study done by L i et al. (1998) indicated that the secreted form of IgM that is lacking the transmembrane domain is still able to associate with Ig-a and Ig-P and, when IgM is deglycosylated Ig-a/p binding is reduced. The formation of the Ig-a/p heterodimer seems to require heterodimerization in the extracellular and transmembrane domains. The extracellular interactions are through disulfide bonds and potentially through other non-covalent interactions or contact between glycosylations. The heterodimerization in the transmembrane domain is conceivably by way of hydrogen bonding between two particular amino acid residues. The fifth residue in the Ig-a transmembrane region is glutamic acid, a negatively charged polar amino acid. This amino acid could be interacting with the sixth amino acid in the Ig-p transmembrane domain, a glutamine residue. Glutamic acid and glutamine are both strongly polar residues and should form strong hydrogen bonds. This bond is strengthened in the transmembrane environment, which does not contain water molecules that compete with these residues for hydrogen bonding (Partridge et al., 2002). The experiments showing that Ig-a mutant constructs can associate with m l g M prior to binding to Ig-P is contrary to the belief that the human Ig-a/p heterodimer must form before associating with human m l g M (Brouns et al., 1995), but supports data by Matsuuchi and Foy (2001) who showed that murine Ig-a w i l l associate with m l g M in the absence of Ig-B. These findings may indicate that the mouse B C R forms differently than the human B C R , but further studies are needed to confirm this finding because the truncated Ig-a proteins, A a K V K (a/a/O) and A X a (0/a/a) may interact differently with truncated Ig-P proteins than they do with W T Ig-p. In the future, construct combinations pairing A a K V K (a/a/O) and A p K V K (p/p/0) or pairing Sola (a/0/0) and Soip (p/0/0) may indicate whether Ig-a/p heterodimerize before interacting with m l g M or i f heterodimerization occurs after either Ig-a or Ig-P interact with m l g M . Overall, I have found that the extracellular and transmembrane domains of Ig-a/p need to be heterodimeric in order for B C R assembly and cell surface trafficking to occur. Dimerization in the cytoplasmic domain may also be required, but additional studies w i l l need to be performed in order to confirm this finding. The experiments performed as a part of this study should be the beginning of many avenues of research for the Matsuuchi lab, including studying B C R assembly 75 and signalling by creating mutant B C R s and examining the role of the B C R in B cell development using mouse models. 76 REFERENCE LIST Abbas, A . K . , Lichtman, A . H . and Pober, J. S. (2000). Cellular and Molecular Immunology, 4 m edition. W . B . Saunders Company. Philadelphia, Penn. Akira , S., Takeda, K . , Kaisho, T. (2001). Toll-l ike receptors: critical proteins linking innate and acquired immunity. Nature Immunology 2:675. Al t , F. , Blackwell , K . and Yancopoulos, G . (1987). Development of the primary antibody repertoire. Science 238:1079. Baba, Y . , Hashimoto, S., Matsushita, M . , Watanabe, D . , Kishimoto, T., Kurosaki, T. and Tsukada, S. (2001). B L N K mediates Syk-dependent Btk activation. Proc. Natl. Acad. Sci. U S A 98:2582. Blum, J. H . , Stevens, T. L . , and DeFranco, A . L . (1993). Role of the mu immunoglobulin heavy chain transmembrane and cytoplasmic domains in B cell antigen receptor expression and signal transduction. Journal of B i o l . Chem. 368:27236. Brouns, G.S. , de Vries, E . and Borst, J. (1995). Assembly and intracellular transport o f the human B cell antigen receptor complex. International Immunology 7:359. Campbell, K . S . , Hager, E.J . , and Cambier, J.C. (1991). a-chains of I g M and IgD antigen receptor complexes are differentially N-glycosylated mb-1 -related molecules. Journal o f Immunology 147:1575. Carroll, M . C. (1998). CD21/CD35 in B cell activation. Seminars in Immunology 10:279. Cassard, S., Salamero, J., Hanau, D . , Spehner, D . , Davoust, J., Fridman, W . H . and Bonnerot, C. (1998). A tyrosine-based signal present in Ig a mediates B cell receptor constitutive internalization. Journal of Immunology 160:1767. Clark, M . R . , Campbell, K . S . , Kazlauskas, A . , Johnson, S.A., Hertz, M . , Potter, T .A . , Pleiman, C. and Cambier, J.C. (1992). The B cell antigen receptor complex: association of Ig-a and Ig-P with distinct cytoplasmic effectors. Science 258:123. Condon, C , Hourihane, S. L . , Dang-Lawson, M . , Escribano, J. and Matsuuchi, L . (2000). Aberrant trafficking of the B cell receptor Ig-ap subunit in a B lymphoma cell line. Journal of Immunology 165:1427. Cragg, M . S . , Chan, H.T. , Fox, M . D . , Tutt, A . , Smith, A . , Oscier, D . G . , Hamblin, T.J. and Glennie, M . J . (2002). The alternative transcript of CD79b is overexpressed in B - C L L and inhibits signaling for apoptosis. Blood 100:3068. Davies, D . R. and Metzger, H . (1983). Structural basis of antibody function. Annual Review of Immunology 1:87. 77 Edelman, G . M . (1991). Antibody structure and molecular immunology. Scandinavian Journal o f Immunology 34:4. Ellgaard, L . and Helenius, A . (2001). E R quality control: towards an understanding at the molecular level. Current Opinion in Cel l Biology 13:431. Fagioli , C . and Sitia, R. (2001). Glycoprotein quality control in the endoplasmic reticulum. Journal of Biological Chemistry 276:12885. Foy, S. P. and Matsuuchi, L . (2001). Association of B lymphocyte antigen receptor polypeptides with multiple chaperone proteins. Immunology Letters 78:149. Gold, M . R . (2002) To make antibodies or not: signaling by the B-cel l antigen receptor. Trends in Pharmacological Sciences 23:316. Gordon, M . , Kanegai, C , Doerr, J. and Wal l , R. (2003). Somatic hypermutation of the B cell receptor genes B29 (IgB, CD79b) and m b l (Iga, CD79a). Proc Natl Acad Sci 100:4126. Hammond, C. and Helenius, A . (1995). Quality control in the secretory pathway. Current Opinion in Ce l l Biology 7:523. Havran, W . L . , Digiusto, D . L . , and Cambier, J .C. (1984). mIgM:mIgD ratios on B cells: mean mlgD expression exceeds m l g M by 10-fold on most splenic B cells. Journal of Immunology 132:1712. Hermanson, G . G . , Eisenberg, D . , Kincade, P. W . and Wal l , R. (1988). B29: A member of the immunoglobulin gene superfamily exclusively expressed on B-lineage cells. Proc Natl Acad Sci 85:6890. Hombach, J., Leclercq, L . , Radbruch, A . , Rajewsky, K . and Reth, M . (1988). A novel 34-kd protein co-isolated with the IgM molecule in surface IgM-expressing cells. E M B O Journal 7:3451. Hombach, J., Tsubata, T., Leclercq, L . and Stappert, H . (1990). Molecular components of the B-cel l antigen receptor complex of the IgM class. Nature 343:760. James, K . (1982). Complement: activation, consequences, and control. American Journal of Medical Technology. 48:735. Johansson, B . , Palmer, E . , and Bolliger, L . (1999). The extracellular domain of the <^-chain is essential for T C R function. Journal of Immunology 162:878. Johnson, G .D. , Davidson, R., McNamee, K . , Russell, G . , Goodwin, D . and Holbrow, E.J . (1982). Fading of immunofluorescence during microscopy: a study of the phenomenon and it's remedy. Journal of Immunological Methods 55:231. Kabak, S., Skaggs, B . J . , Gold, M . R . , Affolter, M . , West, K . L . , Foster, M . S . , Siemasko, K . , Chan, A . C . , Aebersold. R. and Clark. M . R . (2002). The direct recruitment of B L N K to 78 immunoglobulin a couples the B-cel l antigen receptor to distal signalling pathways. Molecular and Cellular Biology 22:2524. Kitamura, D . , Roes, J., Kuhn, R., and Rajewsky, K . (1991). A B cell deficient mouse by targeted disruption of the membrane exons of the immunoglobulin p chain gene. Nature 350:423. Kobayashi, K . , Hernandez, L . , Galan, J., Janeway, C , Medzhitov, R. and Flavell , R. (2002). I R A K - M is a negative regulator of Toll-l ike receptor signalling. Cel l 110:191. Koyama, M . , Nakamura, T., Higashihara, M . , Herren, B . , Kuwata, S., Shibata, Y . , Okumura, K . and Kurokawa, K . (1995). The novel variants of mb-1 and B29 transcripts generated by alternative m R N A splicing. Immunology Letters 47:151. Koyama M , Nakamura T, Higashihara M , Herren B , Kuwata S, Shibata Y , Okumura K , Kurokawa K . Kruppers, R., Kle in , U . , Hansmann, M . and Rajewsky, K . (1999). Mechanisms of disease: Cellular origin of human B-cel l lymphomas. New England Journal of Medicine 341:1520. Lanier, L . L . (2005). N K cell recognition. Annual review of immunology. 23:225. Lee, Y . , Brewer, J., Hellman, R. and Hendershot, L . (1999). B i P and immunoglobulin light chain cooperate to control the folding of heavy chain and ensure the fidelity of immunoglobulin assembly. Molecular Biology of the Ce l l 10:2209. Leonard, W.J . (2001). Cytokines and immunodeficiency diseases. Nature Reviews Immunology 1:200. L i , C , Siemasko, K . , Clark, M . R . and Song, W . (2002). Cooperative interaction of Iga and Ig(3 of the B C R regulates the kinetics and specificity of antigen targeting. International Immunology 14:1179. L i , Q., Santini, R. , Rosenspire, A . R . (1998). Glycosylated extracellular domains of membrane immunoglobulin contribute to its association with mb- l /B29 gene products and the B cell receptor complex. Immunological Investigations 27:57. Maekawa, Y . and Yasutomo, K . (2005). Antigen-driven T-cell repertoire selection. Critical Reviews in Immunology 25:59. Martensson, I.-L. and Ceredig, R. (2000). Role of surrogate light chain and the pre-B-cell receptor in mouse B-cel l development 101:435. Matsuuchi, L . , Buckley, K . M . , Lowe, A . W . and Kel ly , R. B . (1988). Targeting of secretory vesicles to cytoplasmic domains in AtT-20 and PC-12 cells. Journal of Cel l Biology 106:239. 79 Matsuuchi, L . and Gold, M . R . (2001). New views of B C R structure and organization. Current Opinion in Immunology 13:270. Matsuuchi, L . , Gold, M . R., Travis, A . , Grosschedl, R., DeFranco, A . and Ke l ly R. B . (1992). The membrane IgM-associated proteins M B - 1 and Ig-P are sufficient to promote surface expression of a partially functional B-cel l antigen receptor in a nonlymphoid cell line. Proc. Natl. Acad. Sci. 89:3404. Matsuuchi, L . and Kel ly , R. B . (1991). Constitutive and basal secretion from the endocrine cell line AtT-20. Journal of Cel l Biology 112:843. McHeyzer-Will iams, M . G . (2003). B cells as effectors. Current Opinion in Immunology 15:354. Melief, C . J. M . (2003). Mini-review: Regulation of cytotoxic T lymphocyte responses by dendritic cells: peaceful coexistence of cross-priming and direct priming? European Journal of Immunology 33:2645. Melnick, J., D y l , J. L . and Argon, Y . (1994). Sequential interaction of the chaperones B i P and GRP94 with immunoglobulin chains in the endoplasmic reticulum. Nature 370: 373. Nagata, K . , Nakamura, T., Kitamura, F., Kuramochi, S., Taki , S., Campbell, K . and Karasuyama, H . (1997). The Iga/IgP heterodimer on p-negative proB cells is competent for transducing signals to induce early B cell differentiation. Immunity. 7:559. Ni i ro , H . and Clark, E . A . (2002). Regulation of B-cel l fate by antigen-receptor signals. Nature Reviews Immunology 2:945. Nilsson, T. and Warren, G . (1994). Retention and retrieval in the endoplasmic reticulum and the Golgi apparatus. Current Opinion in Cel l Biology 6:517. Partridge, A . W. , Melnyk, R. A . and Deber, C. M . (2002). Polar residues in membrane domains of proteins: molecular basis for helix-helix association in a mutant C F T R transmembrane segment. Biochemistry 41:3647. Payelle-Brogard, B . , Magnac, C , Mauro, F. , Mandelli , F. and Dighiero, G . (1999). Analysis of the B-cel l receptor B29 (CD79b) gene in familial chronic lymphocytic leukemia. Blood. 94:3516. Pelanda, R., Braun, U . , Hobeika, E . , Nussenzweig, M . C . and Reth, M . (2002). B cell progenitors are arrested in maturation but have intact V D J recombination in the absence of Ig-a and Ig-B. Journal of Immunology 169:865. Pierce, S. K . (2002) Lip id rafts and B-cel l activation. Nature Reviews 2:96. Rajewsky, K . (1996). Clonal selection and learning in the antibody system. Nature 381:751. 80 Reichlin, A . , Gazumyan, A . , Nagaoka, H . , Kirsch, K . H . , Kraus, M . , Rajewsky, K . and Nussenzweig, M . C . (2004). A B cell receptor with two Iga cytoplasmic domains supports development of mature but anergic B cells. Journal of Experimental Medicine 199:855. Reichlin, A . , Hu , Y . , Meffre, E . , Nagaoka, H . , Gong, S., Kraus, M . , Rajewsky, K . and Nussenzweig, M . C . (2001). Journal of Experimental Medicine 193:13. Reth, M . (1991). Regulation of B cell development by pre-B cell receptors. Current Biology 3:198. Reth, M . (1992). Antigen receptors on B lymphocytes. Annual Review of Immunology 10:97. Reth, M . (1989). Antigen receptor tail clue. Nature 338:383. Richards J.D., Gold, M . R . , Hourihane, S.L., DeFranco, A . L . and Matsuuchi L . (1996). Reconstitution of B cell antigen receptor-induced signaling events in a nonlymphoid cell line by expressing the Syk protein-tyro sine kinase. Journal o f Biological Chemistry 15:6458. Rogers, J., Early, P., Carter, C , Calame, K . , Bond, M . , Hood, L . , and Wal l , R. (1980). Two m R N A s with different 3' ends encode membrane-bound and secreted forms of immunoglobulin p chain. Cel l 20:303. Roiink, A . G . , ten Boekel, E . , Yamagami, T., Ceredig, R., Anderson, J., and Melchers, F. (1999). B cell development in the mouse from early progenitors to mature B cells. Immunology Letters 68:89. Rudin, C M . and Thompson, C . B . (1998). B-cel l development and maturation. Seminars in Oncology 25:435. Sakaguchi, N . , Kashiwamura, S., Kimoto, M . , Thalmann, P., and Melchers, F. (1988). B lymphocyte lineage-restricted expression of mb-1, a gene with CD3-l ike structural properties. E M B O Journal 7:3457. Sakaguchi, N and Melchers, F. (1986). Lambda 5, a new light-chain-related locus selectively expressed in pre-B lymphocytes. Nature 324:579. Schamel, W . W . A and Reth, M . (2000). Monomeric and oligomeric complexes of the B cell antigen receptor. Immunity 13:5. Shapiro-Shelef, M . and Calame K . (2005) Regulation of plasma-cell development. Nature Reviews Immunology 5:230-42. Shaw, A . C . , Mitchel l , R . N . , Weaver, Y . K . , Campos, T.J. , Abbas, A . K . , Leder, P. (1990). Mutations o f immunoglobulin transmembrane and cytoplasmic domains: effects on intracellular signalling and antigen presentation. Ce l l 63:381. 81 Siden, E . , A l t , F .W. , Shinefeld, L . , Sato V . and Baltimore D . (1981) Synthesis of immunoglobulin mu chain gene products precedes synthesis o f light chains during B -lymphocyte development. Proc Natl Acad Sci 78:1823. Siemasko, K . , Skaggs, B . J., Kabak, S., Williamson, E. , Brown, B . K . , Song, W . and Clark, M . R. (2002). Receptor-facilitated antigen presentation requires the recruitment of B cell linker protein to Igoc. Journal o f Immunology 168:2127. Simons, K . and Ikonen, E . (1997). Functional rafts in cell membranes. Nature 387:569. Skowronek, M . , Hendershot, L . and Haas, I. (1998). The variable domain of nonassembled Ig light chains determines both their half-life and binding to the chaperone B i P . Proc Natl Acad Sci 95:1574. Stoddart, A . , Dykstra, M . L . , Brown, B . K . , Song, W. , Pierce, S.K. and Brodsky, F . M . (2002). L ip id rafts unite signalling cascades with clathrin to regulate B C R internalization. Immunity 17:451. Teasdale, R . D . and Jackson, M . R . (1996). Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the Golgi apparatus. Annual Review of Cel l and Developmental Biology. 12:27. Thompson, A . , Tally, J., Do, H . , Kagan, H . , Kunkel , L . , Berenson, J., Cooper, M . , Saxon, A . and Wal l , R. (1997). Aberrations of the B-cel l receptor B29 (CD79b) gene in chronic lymphocytic leukemia. Blood 90: 1387. Torres, R . M . , Heinrich, F. , Reth, M . and Rajewsky, K . (1996). Abberant B cell development and immune response in mice with a compromised B C R complex. Science 272:1804. Venkitaraman, A . R . , Will iams, G.T., Dariavach, P., and Neuberger, M . S . (1991). The B-cell antigen receptor of the five immunoglobulin classes. Nature 352:777. Wang, L . D . , Lopes, J., Cooper, A . B . , Dang-Lawson, M . , Matsuuchi, L . and Clark, M . R. (2004). Selection of B lymphocytes in the periphery is determined by the functional capacity of the B cell antigen receptor. Proc Natl Acad Sci 101:1027. Will iams, A . F . and Barclay, A . N . (1988). The immunoglobulin superfamily-domains for cell surface recognition. Annual Review of Immunology 6:381. W u , Y . , Pun, C. and Hozumi, N . (1997) Roles of calnexin and Ig-a(3 interactions with membrane Igs in the surface expression o f the B cell antigen receptor o f the I g M and IgD classes. Journal of Immunology 158:2762. 82 APPENDIX Ig-a sequence (sequence from N C B I online database, sequence number gi6680891 Mus musculus C D 7 9 A antigen, m R N A ) . Interprotein disulfide bonds between cysteine residues 50 and 101, disulfide bonding with Ig-B at cysteine residue 113 and glycosylation sites at amino acids 58 and 68 (Sakaguchi et al, 1988, Hombach et al., 1988). 1 tgggagacgatgccagggggtctagaagccctcagagccctgcctctcctcctcttcttg 60 1 M 5 ^ . g " Q " L : ' F ~ A - I." R^A L P L L L F iJ Signal Peptide (aa 1-22) 61 tcatacgcctgtttgggtcccggatgccaggccctgcgggtagaagggggtccaccatcc 120 18 S Y A C L G P G C Q A L R V E G G P P S N T region (aa 1 -34) 121 ctgacggtgaacttgggcgaggaggcccgcctcacctgtgaaaacaatggcaggaaccct 180 38 L T V . . N . L G..E E .A R L T E . . E . N N G R N P 181 a a t a j ^ c a t g g t g g t t c a g c ^ 58 N " I T W W F S L Q S N I T W P P V P L G IG region (aa 35-120) 241 cctggccagggtaccacaggccagctgttcttccccgaagtaaacaagaacacaggggct 300 78 P G..Q G . T T . G Q L F F P E _V_N K N T G A 301 tgtactgggtgccaagtgatagaaaacaacatattaaaacgctcctgtggtacttacctc 360 98 C T G..B."P. V I J . N N T L K R S C . G . T . Y L cgcgtgcgcaatccagtccctaggcccttcctggacatgggggaaggtaccaagaaccgc 420 118 R V R N P V P R P F L D M G E G T K N R M P region (aa 121-137) T M domain (aa 138-159) 481 ctattcaggaaacggtggcaaaatgagaagtttggggtggacatgccagatgactatgaa 540 1 5 8 L R R K R W Q N E K F G V D M P D D Y E 541 gatgaaaatctctatgagggcctgaaccttgatgactgttctatgtatgaggacatctcc 600 1 7 8 D E N L Y E G L N L D D C S M Y E D I S Cytoplasmic domain (aa 160-220) 601 aggggactccagggcacctaccaggatgtgggcaacctccacattggagatgcccagctg 660 1 9 8 R G L Q G T Y Q D V G N L H I G D A Q L 661 gaaaagccatgactgacatgtcccacccttccctgcctgccatatgtctgactccagcat 720 218 E K P A A A 83 Ig-P sequence (sequence from N C B I online database, sequence number gi6680374 Mus musculus CD79B antigen, mRNA). Interprotein disulfide bonds between cysteine residues 43 and 124 and between 65 and 120, disulfide bonding wi th Ig-a at cysteine residue 135 and glycosylation sites at amino acids 68, 99, and 130 (Hermanson et al, 1988). 181 gaccatggccacactggtgctgtcttccatgccctgccactggctgttgttcctgctgct 240 1 M. A .T_L V L S S M P C H W_L L,F L.L L Signal Peptide (aa 1-25) 241 gctcttctcaggtgagccggtaccagcaatgacaagcagtgacctgccactgaatttcca 300 20 r F T G l ' R V P A M T S S D L P L N F Q N T region (aa 1-49) 301 aggaagcccttgttcccagatctggcagcacccgaggtttgcagccaaaaagcggagctc 360 40 G S P @ S Q I W Q H P R F A A k K R S $ 361 catggtgaagtttcactgctacacaaaccactcaggtgcactgacctggttccgaaagcg 420 60 M V K F H g Y T N ' H S G A L T W F R K R 421 agggagccagcagccccaggaactggtctcagaagagggacgcattgtgcagacccagaa 480 80 G S " Q Q " P " Q " E " L V S E E G R I V Q T Q N* 541 ctgcaag^a^gaa^tgtgacagcgccaaccataatgtc^c^^ 1 2 0 | K Q K @ D S A N H N ' V T D S S 6 T E L 601 tctagtcttaggattcagcacgttggaccaactgaagcggcggaacacactgaaagatgg 660 140 L V l l G F S T L D Q L K R R N T L K D l M P region (aa 143-158) 661 cattatcttgatccagaccctcctcatcatcctcttcatcattgtgcccatcttcctgct 720 160 F J J L T T Q T J L L I I L F I I V P I F L L T M domain (aa 159-179) 721 acttgacaaggatgacggcaaggctgggatggaggaagatcacacctatgagggcttgaa 780 180 L D K D D G K A G M E E D H T Y E G L N 781 cattgaccagacagccacctatgaagacatagtgactcttcggacaggggaggtaaagtg 840 200 I D Q T A T Y E D I V T L R T G E V K W Cytoplasmic domain (aa 180-228) 841 gtcggtaggagagcatccaggccaggaatgagggtcaccttcatcctgctcaactcttgg 900 220 S V G E H P G Q E A A A 84 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092462/manifest

Comment

Related Items