UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of cyclic GMP-dependent protein kinase type II in the brain Viswanathan, Vijay 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-995658.pdf [ 15.19MB ]
Metadata
JSON: 831-1.0092443.json
JSON-LD: 831-1.0092443-ld.json
RDF/XML (Pretty): 831-1.0092443-rdf.xml
RDF/JSON: 831-1.0092443-rdf.json
Turtle: 831-1.0092443-turtle.txt
N-Triples: 831-1.0092443-rdf-ntriples.txt
Original Record: 831-1.0092443-source.json
Full Text
831-1.0092443-fulltext.txt
Citation
831-1.0092443.ris

Full Text

R O L E O F C Y C L I C G M P - D E P E N D E N T P R O T E I N K I N A S E T Y P E H I N T H E B R A I N by VJJAY V I S W A N A T H A N B.Sc, Nizam College, 1994 M.Sc, Osmania University, 1996 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY OF SCIENCE in THE FACULTY OF GRADUATE STUDIES ./Neuroscience,/ U B C T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A November 2004 ® V i j a y Viswanathan, 2 004 ABSTRACT P K G is one of the most important downstream effector of the NO/natriuretic peptides cGMP pathway. Of the two types of PKG, within the brain PKG I is almost exclusively expressed in the cerebellum. By contrast PKG II has a much wider expression in the brain, indicating that it is most likely to be the mediator of cGMP actions. However, subcellular distribution and the function of PKG JJ in the brain is still unknown. Western blot analysis using a PKG LI specific antibody confirmed previous reports that PKG II is highly expressed in the cortex, striatum, hippocampus, hypothalamus and thalamus and absent in the cerebellum. In comparison, we found that PKG I is highly expressed in the cerebellum and hypothalamus and very weakly expressed in the hippocampus and cortex. Western blot analysis of subcellular fractions from adult brain shows that PKG U is present in both the pre and postsynaptic fractions and is enriched in the membrane fractions. P K G JJ is also enriched in the synaptosomal membrane fraction of embryonic rat brain subcellular fractions. Immunocytochemisty using the P K G JJ antibody indicates that P K G IJ is present in both the cell body and processes of cortical, hippocampal and thalamic neurons in culture. PKG JJ was found to co-localize with both the presynaptic marker, synaptophysin and the postsynaptic marker PSD-95, indicating that P K G JJ is present at the synapse. Using wild type (wt) and non-myristoylated mutant PKG JJ proteins it was demonstrated that N-myristoylation (N-myr) is important for targeting of PKG LT to membranes and distal ends of filopodia like structures in COS-1 and HEK-293 cells. Full length wt PKG JJ and wt ii regulatory PKG JJ proteins, when overexpressed in hippocampal neurons targeted to the synapse, however, a G2A PKG JJ mutant, which does not undergo myristoylation had a much more diffuse distribution in the entire cell and did not target to the synapse. This indicates that N-myr is important for proper targeting of PKG JJ. Overexpression of the dominant negative regulatory domain of P K G JJ in hippocampal neurons caused a 2.5-fold increase in filopodia in young neurons and a 2-fold increase in spine like structures in older neurons compared to GFP overexpressing cells. Such an effect was not observed with the FLwt PKG JJ. The non-myristoylated forms of PKG JJ overexpressing cells did not show an increase in filopodia/spine like structures, indicating that proper targeting of PKG II through myristoylation is important for the regulatory domain to have a dominant negative effect. This indicates that P K G JJ is most likely to play a role in neuronal development and regulation of synaptogenesis. iii Table of Contents ABSTRACT U Table of Contents iv List of Tables x List of Figures xi List of Abbreviations xiv Dedication xvii Acknowledgement. xviii Introduction 1 I. NO introduction required 1 II. NO targets 2 III. Natriuretic Peptides (NP) 4 IV. cGMP Targets 5 V. P K G 6 1. P K G Genes 6 2. P K G Structure 7 A . Dimerization 8 B. Lipid modification and its importance 9 a. N-Myristoylation 9 C. Autoinhibition and Autophosphorylation 10 3. P K G Expression 14 A. Expression in C. elegans and Drosophila 14 iv B. Expression of mammalian PKGs 14 a. PKG 1 14 b. PKG II 15 4. PKG substrates 16 A. Unknown substrates of PKG in the brain 19 a. Is yeast two-hybrid a good system to use to find partners of PKG II? 20 VI. NO going back, NO/NPs to cGMP to P K G and beyond 21 1. Role in regulation of gene expression 21 2. Role in modulation of neurotransmitter release and synaptic plasticity 24 A. Neurotransmitter release 24 B. NO Hippocampal LTP 25 C. NO Cerebellar LTD 27 D. Possible role in regulation of filopodia/spine morphology 28 3. PKG and behaviour 29 4. Statement of Aims 30 Materials and Methods 32 I. Animal Care 32 II. P K G II Antibody Generation and Purification 32 1. Antibody generation 32 2. Antibody purification 33 A. Material 33 B. Method 33 III. RNA Extraction 33 IV. RT Reactions 34 1. Material 34 2. Method 34 V V. PCR 35 1. Material 35 2. Method 35 VI. Restriction Analysis and Agarose Gel Electrophoresis 36 1. Material 36 2. Method 36 VII. Sub-cloning 37 1. Materials 37 2. Method 37 3. Constructs generated for transfection of mammalian cells 38 A. GFP Fusion Constructs 38 a. FL wt PKG II 38 b. 5'wt PKG II 39 c. FL PKG IIG2A mut 39 d. 5' PKG II G2A mut 39 B. His-Cat PKG II 40 VIII. Subcellular Fractionation 43 IX. Cell Culture 43 1. Material 43 2. Method 44 A. COS Cells and HEK-293 cells 44 B. Neurons 44 X. Cell Transfection 45 1. Material 45 2. Method 45 A. Lipofectamine 2000 45 vi B. Effectene 46 X L Immunocytochemistry 46 1. Material 46 2. Method 47 XII. Image Acquisition and Quantification 49 XIII. Immunoprecipitation (IP) 49 1. Material 49 2. Method 49 A. Cell Lysis 49 B. Preparation of Protein A-Sepharose beads (CLA4) for IP 50 C. IP procedure 50 XIV. Western Blotting 51 1. Material 51 2. Method 51 Results 53 I. Generation and characterization of P K G II antibodies 53 1. PKG II antibody detects FLwt PKG II but not 5'wt PKG II in HEK-293 cells 53 2. Immunocytochemical detection of His-tagged PKG II catalytic domain (His-PKG II cat) protein in HEK-293 cells transfected with His-PKG II cat cDNA using affinity purified PKG II antibody 56 Figure 5: Immunodetection of recombinant PKG II protein in HEK-293 cells transiently transfected with PKG II catalytic domain cDNA using DAB/ABC method 57 3. PKG II antibody detects a major band corresponding to PKG II in crude lysates from various brain regions 58 4. PKG II antibody immunoprecipitates a -86 kD band from thalamic lysates and lysates of hippocampal neurons in culture 60 vii 5. Preincubation of PKG II antibody with the antigenic peptide abolishes staining in hippocampal neurons in culture 61 5. Preincubation of PKG II antibody with the antigenic peptide abolishes staining in hippocampal neurons in culture 62 6. Immunodetection of PKG II in thalamic and cortical neurons in culture 64 II. Subcellular distribution of P K G II in the brain and hippocampal neurons in culture 66 1. PKG II is present in both the pre and postsynaptic fractions of adult rat brain subcellular fractions.... 66 3. PKG II is predominant in the synaptosomal membrane fraction in embryonic rat brain subcellular fractions 68 3. PKG II is predominant in the synaptosomal membrane fraction in embryonic rat brain subcellular fractions 69 4. PKG II partially colocalizes with the presynaptic marker synaptophysin 70 4. PKG II partially colocalizes with the presynaptic marker synaptophysin 71 5. PKG II partially co-localizes with the postsynaptic molecular marker PSD-95 73 II. N-Myristoylation is important for proper targeting of P K G II in COS-1 cells, HEK-293 cells and hippocampal neurons in culture 75 1. N-myr is important for targeting of PKG II to membranes and probable Golgi compartments in COS-1 cells 75 2. N-myr is important for targeting of PKG II to membranes and probable focal adhesion points in HEK-293 cells 78 3. N-myr is important for targeting of PKG II to membranes and probable Golgi compartments in hippocampal neurons in culture 79 3. N-myr appears to be important for synaptic targeting of PKG IIGFP in hippocampal neurons in culture 82 IV. Function of P K G II in hippocampal neurons 85 1. 5'wt PKG II inhibits endogenous PKG I activitiy in HEK-293 cells 85 2. Hippocampal neurons as a model for studying PKG II function 88 viii 3. Overexpression of regulatory domain of PKG II in 10 div hippocampal neurons caused a 2.5-fold increase in filopodia-like structures compared to GFP overexpressing neurons 89 4. Overexpression of regulatory domain of PKG II in 15 div hippocampal neurons caused a 2-fold increase in spine like structures compared to GFP overexpressing neurons 92 5. Most of the dendritic protrusions in the wt regulatory domain PKG II transfected neurons appear to be synaptic 96 6. There was a corresponding increase in density of synaptophysin puncta in 5'wt PKG II overexpressing hippocampal neurons 98 7. Overexpression of human form of VASP had no effect on morphology of hippocampal neurons and does not show an increase in density of synaptic contacts 98 Discussion 104 I. Characterization of P K G II antibody 104 1. Antibody specificity 105 2. Distribution of PKG II in the brain and comparison with other PKG II localization studies 105 II. Subcellular distribution of P K G II 107 III. Importance of N-myr in targeting of P K G II I l l IV. Probable role of P K G II in regulation of synaptogenesis 115 V. Conclusion 120 REFERENCES 122 ix L i s t of T a b l e s Table 1: Antibodies used in Immunocytochemistry Table 2: Antibodies used in Western Blotting L i s t of Figures Figure 1: Functional domains of PKA and PKG 13 Figure 2: Constructs Generated for Transfecting mammalian cells 41 Figure 3: Western blot analysis of expression of various PKG U constructs in transiently transfected HEK-293 cells 42 Figure 4: Affinity purified antibody detects recombinant P K G JJ expressed in HEK-293 cells. 55 Figure 5: Immunodetection of recombinant PKG JJ protein in HEK-293 cells transiently transfected with PKG JJ catalytic domain cDNA using D A B / A B C method 57 Figure 6: Western blot analysis of P K G JJ and P K G I expression in various brain regions.. 59 Figure 7: Immunoprecipitation of PKG JJ from rat thalamic lysates and lysates of hippocampal neurons in culture 61 Figure 8: Immunodetection of PKG IJ in hippocampal neurons in culture and preadsorption of P K G IJ antibodies with the antigenic peptide 63 Figure 9: Immunodetection of PKG JJ in thalamic and cortical neurons in culture 65 Figure 10: Subcellular fractionation of PKG JJ in adult rat brain 68 Figure 11: Subcellular fractionation of rat embryonic brains 70 Figure 12: Immunocytochemical localization of P K G JJ and the presynaptic marker synaptophysin in hippocampal neurons in culture 72 Figure 13: Immunocytochemical localization of PKG JJ and the postsynaptic marker PSD-95 in hippocampal neurons in culture 74 Figure 14: Immunocytochemical localization of FLwt P K G IIGFP and F L PKG JJ G2A mutant GFP in COS-1 cells 77 xi Figure 15: Irnmunocytochemical localization of various recombinant P K G II proteins and GFP in HEK-293 cells 80 Figure 16: Immunocytochemical localization of FLwt P K G H GFP and FL P K G E G2A mutant GFP in hippocampal neurons in culture 81 Figure 17: Myristoylation is important for synaptic targeting of F L P K G II GFP in hippocampal neurons in culture 83 Figure 18: Myristoylation is important for synaptic targeting of FL PKG II GFP in hippocampal neurons in culture 84 Figure 19: wt regulatory domain of PKG U reduces phosphorylation of VASP in HEK-293 cells 87 Figure 20: Exogenous PKG II regulatory domain led to a 2.5-fold increase in number of filopodia in 10 div hippocampal neurons in culture 90 Figure 21: Exogenous PKG II regulatory domain led to a 2.5-fold increase in number of fdopodia in 10 div hippocampal neurons in culture 91 Figure 22: Exogenous PKG II regulatory domain led to a 2-fold increase in number of spine-like structures in 15 div hippocampal neurons in culture 93 Figure 23: Exogenous PKG II regulatory domain led to a 2-fold increase in number of spine-like structures in 15 div hippocampal neurons in culture 94 Figure 24: Hippocampal neurons transfected with non-myristoylated forms of PKG II do not show an increase in density of filopodia/spines 95 Figure 25: Dendritic protrusions in wt regulatory domain transfected cells co-localized with the presynaptic marker synaptophysin and the postsynaptic marker PSD-95 97 xn Figure 26: There is a 2-fold increase in synaptophysin puncta in 5'wt PKG II overexpressing neurons 100 Figure 27: Overexpression of human VASP in neurons did not show an increase in density of synaptophysin puncta 101 xiii L i s t of Abbreviat ions Ab antibody bp base pair BSA bovine serum albumin C Celsius CaMKII Ca2+/calmodulin-dependent protein kinase TJ cAMP adenosine 3', 5'-cyclic monophosphate cat catalytic Cat. No. Catalogue Number cDNA complementary DNA cGMP guanosine 3', 5'-cyclic monophosphate D M E M Dulbeccos' s-modified Eagle medium DMSO di-methyl sulphoxide DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate DTT dithiothreitol E D T A ethylenediamine tetraacetic acid E G T A ethylene glycol-bis (P-aminoethylether) N,N,N',N' tetraacetic acid FBS foetal bovine serum F L full length g gram GFP green fluorescent protein HBSS Hank's balanced salt solution HEK-293 human embryonic kidney-293 cells h hour/s IP immunoprecipitation kb kilo base KC1 potassium chloride kDa kilo Daltons K L H keyhole limpet haemocyanin xiv L litre L T D long-term depression LTP long-term potentiation M molar mA milli amperes MgCl 2 magnesium chloride min minute mL milli litre mM milli Molar mm milli meter M M L V murine mouse leukaemia virus M W molecular weight mRNA messenger RNA mut mutant Na sodium NaCl sodium chloride NaOH sodium hydroxide N B M Neurobasal medium NGS normal goat serum ng nano gram nm nano metre nM nano Molar N M non-myristoylated NO nitric oxide NOS nitric oxide synthase PAGE polyacrylamide gel electrophoresis PBS phosphate buffered saline PCR polymerase chain reaction PFA paraformaldehyde PKA cyclic AMP-dependent protein kinase PKC protein kinase C X V PKG I cyclic GMP-dependent protein kinase type I PKG U cyclic GMP-dependent protein kinase type II pM pico Molar PMSF phenyl methyl sulfonyl fluoride RFP red fluorescent protein RNA ribonucleic acid rpm revolutions per minute RT reverse transcription SDS sodium dodecyl sulphate sec seconds snt supernatant Taq thermus aquaticus T E E N tris-EDTA-EGTA-NaCl temp. temperature Tris tris (hydroxymethyl) aminomethane U Units UBC University of British Columbia u,L micro litre [Ag micro gram u,M micro Molar V volts vol volume wt wild type xvi Dedication This thesis is dedicated to all those animals that unwillingly laid dozim their lives to add another drop of information to the vast biological sciences ocean. xvii Acknowledgement There are numerous people I owe thanks to and I would Like to name tfiem in the order in which they entered my science life. The reason I am in biological sciences is probably because of the influence of the works of Qerald Durrell and Richard Dawfdns. I have great admiration for their work^ and their apparent love for science. Their talent has definitely made science so much more beautiful than it already is. I extremely thank\my parents and my brother for their moral and financial support, without which it would have been impossible for me to come to Canada to pursue higher education. I would like to thanks them for their understanding, for having faith in me and for encouraging me in spite of my choosing a career that they did not quite approve of. I would like, to thankDr. Tim Murphy for allowing me to work-in his lab when I first came to Vancouver and helping me taste my first research experience in Canada. I am also grateful to Tim for his advice and numerous insightful discussions while I was taking the 9{e.uroscience courses and during lab meetings. I am indebted to Dr. 'Paul Mackenzie, a former student of Dr. Tim Murphy, for helping me get used to the. ways of'Kinsmen lab and life in Canada in general. I would have been totally lost if it hadn't been for Paul's advice and help infinding a supervisor forgraduate studies. The primary reason for my having gotten this far is because of Dr. Steven % Vincent, my supervisor. To be honest I have no idea what was going through his mind when he accepted me as a graduate student as I xv i i i had no prior practical experience in molecular biology. Steve has been tremendously patient in spite of my occasionally trying his patience beyond endurance and has shown an unbelievable amount of faith in me for I can't even remember hou) long now. 9iis unconditional support, guidance, scientific or otherwise and encouragement throughout my stay in his lab would be the primary reasons for my getting a (PhD. degree. I am mostgrateful to Steve for letting me carry out my research in an independent manner. I cannot thank\ Steve enough for everything he has done for me and even if I could, I believe 'English language is deficient enough of an expression to communicate my complete gratitude. I would lik\e to express my gratitude to Liz Wong for the great help in dealing with course registration, paper work^andother seemingly simple tasks pertaining graduate studies, which actually required a lot of time and effort. One of the greatest pleasures I have had in 'Kinsmen lab is the company of Dr. Alaa el-din 'El-husseini, initially as a graduate student in Steve's Lab and for the last three years as a faculty member in 'Kinsmen Lab. Although I believe that a graduate student has to motivate himself/herself from within, it is impossible to miss someone like Alaa, who I find to be an infinite source of motivation to do science. I extremely thank\!Alaa for teaching me techniques in molecular biology when I first joined the lab, for numerous intellectual discussions, for encouragement and motivation. I also wouldlik\e to thank^fdm for his wonderful friendship and all the delightful science unrelated conversations we had, which were a result of our mutual admiration for the opposite sex It was an immense privilege to work\ in the same department as Dr. Lynn A. 'Rgymond. I have always tried to incorporate the indefatigable nature of Lynn in my wort^ but I believe I still have a long way to go. I am indebted to Lynn for intuitive discussions, advice during the 9{euT0science courses, during lab xix meetings and the supervisory committee meetings. I am eternaCCy grateful for the sup-port and encouragement that Lynn provided me during my degree, especially during my comprehensive examination. I would life to thankJDr. Teter Reiner and my supervisory committee members Dr. Steven Telech and Dr. 'Timothy O Connor for their enormously useful advice, valuable suggestions and encouragement. I would life to express my gratitude to Tascale fretierforherfriendship and technical assistance, which was invaluable. It was a pleasure to have the company of Tascale with whom I could share my adventures outside the laboratory over a coffee. I would life to thdnk\Cindyfor her technical assistance and the much required smiling face toperfeyou up during depressing rainy days in Vancouver. I would like to acknowledge the exceptional friendship of Dr. Oliver Grange, Dr. Heather Quthrie, 'Brett Abrahams, Catriona Wilson, Chu-see, Dr. 'Bruce Connop, Dr. Stefan le behan, Dr. Dorota Kwasnicfei, Dr. Melinda Zeron, Tim Blanche, Dr. Tara Stewart, Shaheen Mohammadi, tkjizbeh Shooshtarian, Andy LaycociQ Dr. Helen fl&isig, Andy Shih, Zhi Liu, Catherine Qauthier-Campbell, Josh Levinson, Christina Cheng, Jackie Shehadeh, Herman Jernandez, Alicia Davis, Kimberly Qerrow, Sophie Imbeault, Tarn Aristakaitis, Dr. Joseph Taihakamuri and the darling of our lab David Lin for enriching the 'Kinsmen laboratory environment and making it an absolutely fabulous place to work\at. I would also life to thank\ the- UBC Cricfet Club members for giving me an opportunity to play cricket, a game that I absolutely adore and enjoy, and for their friendship, which helped feep my body sound to go with my rarely sound mind. Most important I owe my thanks to them for opening the doors to the world xx of alcohol, which I must confess helped me get through a feu) difficult days during my brief research career and helped me celebrate as well when I got the much needed results. Lastly but not the least, I would like to thank\ Matt Qroening for creating The Simpsons and JOTC, 9{eizuorkJor airing it and providing the refreshing amusement after the occasional long workdays. xxi Introduction /. NO introduction required NO (molecular mass 30 Da) is one of the ten smallest molecules found on earth (Lincoln J et al., 1997). Since the discovery in the 1980s, that the free radical NO could be produced by mammalian cells and can act both as a physiological messenger and a pathophysiological agent, it has opened a whole new field of biological research (Moncada et al., 1991). It was in 1977 that NO was identified as the therapeutically effective compound released from drugs that had been, for over one hundred years, used in medicine to treat cardiovascular diseases (Katsuki et al., 1977). A few years later Furschgott and Zawadzki discovered the presence of a smooth muscle relaxing factor, which they named Endothelial derived relaxing factor (EDRF) (Furchgott and Zawadzki, 1980). Seven years later EDRF was shown to have similar properties to NO (Ignarro et al., 1987; Palmer et al., 1987). NO is synthesized from the amino acid L-Arginine by the family of enzymes known as NO synthases (NOS). Three different isoforms of NOS have been cloned so far, the endothelial NOS (eNOS), inducible NOS (iNOS) and neuronal NOS (nNOS) (Bredt et al , 1991; Marsden et al., 1992; Michel and Lamas, 1992; Nishida et al., 1992; Sessa et al., 1992; Xie et al., 1992). NOS uses three co-substrates, arginine, molecular O2, and NADPH, and converts arginine to NO and citrulline (Dawson and Snyder, 1994; Knowles et al., 1989; Nathan, 1992). In the absence of arginine NOS can convert soluble nitroblue tetrazolium salt to an insoluble, visible formazan in an NADPH-dependent manner (Hope et al., 1991; Schmidt et al., 1993). The NADPH diaphorase histochemistry was commonly used to detect NO producing neurons in the brain. 1 Since its discovery, NO has been shown to be involved in numerous physiological processes such as smooth muscle relaxation, neurotransmission, platelet aggregation and host defense mechanisms [for reviews see (Krumenacker et al., 2004; Nathan, 1992; Snyder and Bredt, 1992; Vincent, 1994). //. NO targets NO brings about its effect in many ways including nitrosylation, ADP-ribosylation of proteins, and mainly by stimulation of cGMP synthesis via soluble guanylyl cylcases (sGC) (Schlossmann et al., 2003). NO targets are mainly metal- and thiol- containing proteins and low molecular weight thiols [for reviews see (Anggard, 1994; Stamler, 1994)]. NO can interact with thiols to form nitrosothiols. Nitrosylation of thiols or thiol containing proteins has been suggested to be a mechanism by which NO can be transported in a stable form, thereby extending its range as a physiological messenger (Anggard, 1994; Stamler, 1994). Axonal proteins GAP-43 and SNAP-25, which are involved in axon growth and synaptogenesis, have been shown to interact with NO and undergo nitrosylation. The nitrosylation of these proteins results in reduced fatty acylation of these proteins. It is thought that reactions of this type could play a role in axonal remodelling during development to establish specific neuronal connections (Hess et al., 1993). Protein nitrosylation has also been shown to be important in regulation of transcription factors like c-Jun, N F - k B and the oncogene p21Ras (Klatt et al., 1999; Lander et al., 1995; Matthews et al., 1996). Nitrosylation is thought to be an important regulatory event and recently a highly conserved de-nitrosylating enzyme has been described, indicating that it is likely to be a 2 reversible process (Liu et al., 2001). High levels of NO have been shown to cause nitrosylation of the glycolytic enzyme, glyceraldhehyde-3-phosphate dehydrogenase (GADPH), which leads to ADP-ribosylation of GADPH. This results in inhibition of the enzyme and it is suggested that NO mediates its cytotoxic effects by this mechanism as it would reduce the capacity of the target cell for energy production (Brune et al., 1994). Thus nitrosylation appears to be important for normal physiological function and also mediates cytotoxicity. NO combines with O2 to form nitrite and it is excreted in this form (Anggard, 1994). NO can form peroxynitrite by reacting with superoxides. This ultimately leads to production of hydroxyl radicals (Beckman et al., 1994). In the presence of high levels of NO and superoxides, peroxynitrite and hydroxyl radicals are most likely to form and these are more toxic than NO itself. The hydroxyl radical is a powerful mutagen and peroxynitrite causes extensive protein tyrosine nitration (Beckman et al., 1994; Dinerman et al., 1993; Lipton et al., 1993). Tyrosine nitration has been shown to inhibit the activity of the sarcoplasmic endoplasmic reticulum calcium ATPase (SERCA2a) and decrease the activity of prostacyclin synthase (Viner et al., 1999; Zou et al., 1998).Tyrosine nitration appears to be a specific event as Viner et al. showed that SERCA2a is nitrated but not SERCA1 (Viner et al, 1999). NO exerts most of its physiological effects by activating soluble guanylyl cyclase (sGC) and subsequently elevating cGMP (Knowles et al., 1989; Schmidt et al., 1993). NO is the most potent activator of sGC and low levels of NO are sufficient for enzyme activation (Lincoln J et al., 1997). sGC is expressed in the cytoplasm of almost all mammalian cells. It is a 3 heterodimer consisting of a and P subunits, both of which are required for catalytic activity. Two isotypes and different subunit compositions have been found for sGC [for review see (Lucas et al., 2000). The NO-cGMP pathway is important for a number of physiological processes such as endothelium dependent relaxation of smooth muscle, inhibition of platelet aggregation and adhesion, neuronal signaling, nitrergic inhibitory transmission in the gastrointestinal, urogenital and cardiovascular systems, pressure-induced natriuresis and tubulo-glomerular feedback in the kidney and modulation of force development in fast-twitch skeletal muscle fibers (Lincoln J et al., 1997). ///. Natriuretic Peptides (NP) cGMP levels can also be elevated by a family of widely distributed polypeptides called natriuretic peptides [for review see (Baxter, 2004; Kuhn, 2004; Levin et al., 1998)]. The natriuretic peptide family consists of three homologous members, atrial (ANP, B-type (BNP) and C-type (CNP) natriuretic peptides. Guanylin and uroguanylin are other related peptides that can also elevate cGMP. A pro-ANP peptide releases a 98 amino acids and a 28 amino acids fragment which is mature ANP. It circulates in the plasma and is also expressed in the ventricles of fetuses and neonates and in the kidney. BNP, which was originally identified from porcine brain, is present in the plasma. Pro-BNP contains 108 amino acids and releases a mature form which is 32amino acids. Two CNP molecules, 22 and 53 amino acids long, have been identified in vivo. The 22 amino acids is predominantly expressed in the central nervous system (CNS), anterior pituitary, kidney, vascular endothelial cells, and plasma. The related peptides guanylin and uroguanylin are 15 and 16 amino acids, respectively, and are 4 produced in the gastro-interstinal mucosa. The NPs have diverse biological roles including maintenance of normal blood pressure and volume, growth-moderating functions in the heart, renal sodium secretion, and cellular proliferation and differentiation in different tissues (Kuhn, 2004). NPs bring about their effect by activating membrane or particulate G C (pGC). Three pGC activated by NPs have been identified so far, NPR-A (GC-A), NPR-B (GC-B) and NPR-C (GC-C), all of which catalyse the conversion of GTP to cGMP (Garbers, 1991; Garbers and Lowe, 1994). Four other pGC have also been reported, however, they are orphan receptors with no extracellular ligands known so far (Lucas et al., 2000). The major target of cGMP downstream of NPs is PKG, which most likely phosphorylates substrates and mediates NPs actions (Baxter, 2004; Kuhn, 2004; Levin et al., 1998). Recently DiCicco-Bloom et al. showed by in situ hybridization the presence of NPs and their receptors NPR-A, NPR-B and NPR-C in embryonic mouse brain and they suggested that the NPs might have an important role in region and stage-specific development of the peripheral and central nervous system (DiCicco-Bloom et al., 2004). IV. cGMP Targets cGMP brings about its effects through a) direct channel gating (opening of inward Ca2+ and Na channels); b) cGMP-dependent phosphodiesterases, which leads to regulation of cyclic nucleotide levels; c) ADP ribosyl cyclase and d) PKG, which is the principal intracellular mediator of cGMP signaling (Garthwaite and Boulton, 1995). The focus of my thesis research was on the NO/NPs-cGMP pathway and its downstream effector P K G in neuronal signaling. 5 V.PKG 1. P K G Genes PKG is found in various eurkaryotic organisms. P K G activity was initially reported in arthropods (Kuo and Greengard, 1970) and since then it has been identified in silkworm, Paramecium (Miglietta and Nelson, 1988), Tetrahymena (Murofushi, 1974), Dictyostelium discoideum (Wanner and Wurster, 1990), Caenorhabditis elegans (Stansberry, 2001 #142) and two genes DG1 and DG2 in Drosophila (Kalderon and Rubin, 1989). A soluble mammalian form of PKG was first described (Hofmann and Sold, 1972) followed by isolation of a membrane-bound P K G from intestinal epithelium (de Jonge, 1981), which led to the hypothesis that two forms of PKG existed, type I and type II [for review see (Pfeifer et al., 1999)]. PKG I was cloned from bovine (Wernet et al., 1989) and human smooth muscle (Sandberg et al., 1989), which revealed that PKG I exists in two alternatively spliced isoforms la and ip. The two spliced isoforms differ only in their first -80 aa at the N-terminus (Ruth et al., 1997; Wernet et al., 1989) and the rest of the molecule is identical. A few years later P K G II was cloned from mouse brain (Uhler, 1993), rat intestine (Jarchau et al., 1994) and human (Orstavik et al., 1996). PKG II appears to code for a single protein. The human PKG I and PKG II genes are located on chromosomes 10 (Orstavik et al., 1992) and 4 (Orstavik et al., 1996) respectively. The Drosophila DG1 gene codes for a single protein product, whereas DG2 codes for three T l , T2 and T3 (Kalderon and Rubin, 1989). Sequence comparisons show that bovine PKG I is more similar to DG2 and DG1 than rat PKG U. Phylogenetic analysis indicates that P K G I and DG2 are derived from a common ancestral gene and that the predecessors of PKG II diverged before the appearance of D G 1 in 6 evolution. It is speculated that a mammalian branch of DG1 exists that is yet unidentified (Pfeifer et al., 1999). However, a third isoform does not appear to be present in the completed mouse and human genomes. The conservation of PKG throughout various animal phyla indicates that PKG is an important molecule and the presence of different isoforms indicates that they might have distinctive roles in various physiological processes involving cGMP. 2. PKG Structure PKG has a very similar structure to PKA. Both belong to the family of serine/threonine kinases that are activated by cyclic nucleotides (Francis and Corbin, 1999; Hanks and Hunter, 1995). The enzymes consist of three major domains, an amino-terminal, a regulatory (R) and a catalytic (C) domain. The regulatory domain contains two cyclic nucleotide binding sites and the catalytic domain consists of the Mg-ATP and peptide binding pockets. The catalytic domain catalyses the transfer of y phosphate from ATP to a serine/threonine residue of the target protein (Pfeifer et al., 1999). Mammalian PKGs (Gamm et al., 1995; Hofmann et al., 1992), DG1 (Foster et al, 1996), DG2-T1 and DG2-T3 (Kalderon and Rubin, 1989) are dimers, whereas the P K G purified from Paramecium (Miglietta and Nelson, 1988), Tetrahymena (Murofushi, 1974), and Dictyostelium discoideum (Wanner and Wurster, 1990) are monomeric enzymes. It is unclear if this difference in subunit composition is inherent to the enzymes or the result of partial proteolysis of the dimeric enzymes (Hofmann et al., 1992)since partial proteolysis of mammalian PKG can result in a 7 monomeric enzyme that can be activated by cGMP (Wolfe et al., 1989b).The inactive PKA is a tetramer of two R and two C subunits in which the two R subunits are tightly bound. r Binding of cAMP dissociates the holoenzyme into a R2 (cAMP) dimer and two active C subunits. In contrast, the R and C domains of PKG are present on a single polypeptide chain. Binding of cGMP does not dissociate the PKG enzyme to R and C subunits (Pfeifer et al., 1999) . A. Dimerization The amino terminus of P K G I and II consists of a hydrophobic leucine/Isoleucine zipper motif (a heptad repeat, containing a leucine/isoleucine residue at every first out of seven aa residues), which is important for dimerization of the proteins(Atkinson et al., 1991; Gamm et al., 1995; Landgraf et al., 1990; Vaandrager et al., 1997). Six heptad repeats are present in PKG la, 7-8 in lp and 8-9 in PKG U (Richie-Jannetta et al., 2003). Proteolysis just carboxy-terminal of this domain produces a monomeric PKG that begins just amino-terminal of the autoinhibitory domain (Francis et al., 1996; Monken and Gill, 1980; Wolfe et al., 1989b). In vitro, the monomeric enzymes retain the autoinhibition, autophosphorylation, cGMP binding and kinase activity of the dimeric PKGs (Richie-Jannetta et al., 2003). Dimerization has been shown to increase sensitivity to cGMP activation of P K G ip (Richie-Jannetta et al., 2003). Dimerization has also shown to be important for binding of probable anchoring proteins and substrates such as troponin T (Yuasa et al., 1999), GKAP 42 in germ cells (Yuasa et al., 2000) , and the myosin-binding subunit of myosin phosphatase (Surks et al., 1999) for PKG la and troponin T and inositol 3-phosphate receptor-associated PKG substrate (Ammendola 8 et al., 2001) for PKG lp\ Dimerization in PKG I seems to be important for proper enzyme substrate complex formation. Influence of dimerization on PKG II properties has not been well studied. B. Lipid modification and its importance PKG I and PKG II are acetylated and myristoylated respectively (Takio et al., 1984; Vaandrager et al., 1996). Vaandrager et al. did not find any evidence of palmitoylation or other lipid modification of PKG II (Vaandrager et al., 1996). PKG I is a soluble protein (Jarchau et al., 1994; Lohmann et al., 1997). PKG LI in contrast is a membrane bound enzyme and myristoylation has been shown to be important for membrane targeting of P K G LI (Vaandrager et al , 1996). a. N-Myristoylation Protein N-myristoylation (N-myr) is an irreversible co-translational modification that occurs following removal of the initiator methionine residue by cellular methionylaminopeptidases (Towler et al., 1987; Wolven et al., 1997). It refers to the covalent attachment of myristate, a 14-carbon saturated fatty acid, to the N-terminal glycine of eurkaryotic and viral proteins (Farazi et al., 2001). The step is catalyzed by the enzyme myristoyl CoArprotein N-myristoyltransferase (Towler et al., 1987). N-myr can also occur post-translationally as in the case of the pro-apoptotic protein BED where proteolytic cleavage by caspase 8 reveals a "hidden" myristoylation motif (Zha et al., 2000). N-myr promotes weak and reversible 9 protein-membrane interactions (Murray et al., 1997; Peitzsch and McLaughlin, 1993). N-Myr of PKG II has been shown to be responsible for PKG II to preferentially phosphorylate the CFTR CI" channel in an intestinal cell line (Vaandrager et al., 1998). In the same study PKG ip, which is a soluble protein, was unable to activate the CFTR channel, however, a chimaera with the first 29 amino acids of PKG II attached to the N-terminus of P K G ip protein was able to activate the CFTR channel in the intestinal cell line (Vaandrager et al., 1998), signifying the importance of targeting in specific phosphorylation events. N-myr was shown to be important for targeting of a post-synaptic protein PSD-Zip70 to apical plama membranes of microvilli in Maldin-darby canine kidney cells and for proper targeting in hippocampal neurons in culture (Konno et al., 2002). Dresbach et al showed that Bassoon, a presynaptic particle web protein, requires N-myr for targeting to membrane-bound synaptic organelles (Dresbach et al., 2003). PKG II is myristoylated and appears to be present in neuronal processes (de Vente et al., 2001). We tested the hypothesis that a) N-myr affects localization of PKG II in heterologous systems such as COS and HEK293 cells; b) N-myr is important for targeting of PKG II in neurons. C. Autoinhibition and Autophosphorylation In PKA and P K G autoinhibition is dependent upon the electrostatic interaction between positively charged residues of the pseudosubstrate sequence within the regulatory domain and negatively charged residues within the catalytic cleft (Francis and Corbin, 1994; Lincoln 10 and Corbin, 1978). Ser and Ser in the autoinhibitory pseudosubstrate site in P K G la and ip, respectively, were shown to be important for autoinhibition and mutation of these residues led to a decrease in cGMP binding affinity (Busch et al., 2002). In PKG LI amino acids Lys 1 2 2 , A r g 1 1 8 and A r g 1 1 9 were shown to be responsible for autoinhibition (Taylor et al., 2002). Cyclic nucleotide binding leads to autophosphorylation of specific amino acids in the pseudosubstrate motif of PKA, and decreases the rate of association between the R and C subunits of the type II isoform of PKA (Scott and Mumby, 1985). The decrease in rate of association is thought to be due to electrostatic repulsion between the acidic residues within the catalytic cleft and the negatively charged phosphates incorporated into the autophosphorylated regulatory domain (Taylor et al., 2002). PKG I exhibits similar autoinhibitory characteristics of PKA. Some amino acids responsible for autoinhibition of PKA are conserved in PKG I and Et (Taylor et al., 2002). Possible sites for autophosphorylation in P K G la are Ser1, Ser50, Thr 5 8 , Ser64, Ser7 2 and Thr 8 4 {Monken, 1980 #210;Takio, 1984 #195;Aitken, 1984 #211} and in PKG Ip Ser6 3 and Ser 7 9 (Smith et al., 1996; Wolfe et al., 1989a). Autophosphorylation of PKG la and ip have been shown to increase the basal kinase activity and increase its affinity for cGMP (Busch et al., 2002). In addition P K G la also undergoes autophosphorylation in the presence of cAMP, which increases its affinity for cAMP. The increase in affinity for cAMP, however, does not occur when PKG la is activated in the presence of cGMP (Aitken et al., 1984; Francis et al., 1996). A similar effect has been demonstrated for P K G Ip, in which autophosphorylation in the presence of both cAMP and cGMP leads to an increase in basal activity of the enzyme and increases the affinity for both cyclic nucleotides (Smith et al., 1996). In P K G II the amino acids Ser 1 1 0, Ser 1 1 4, and at a slow rate Ser 1 2 6, Thr 1 0 9 or Ser 1 1 7, all located in the autoinhibitory 11 region of P K G II, were shown to be autophosphorylated after cGMP treatment in vitro (Vaandrager et al., 2003). Mutations of Ser 1 1 0 and Ser 1 1 4 did not alter either kinase activity or affinity for cGMP, however, mutation of the slowly autophosphorylated Ser 1 2 6 generated a constitutively active PKG II (Vaandrager et al., 2003). Autophosphorylation of P K G II has been shown in the presence of cAMP as well, however, at a 100-fold higher concentration of cAMP (de Jonge, 1981). In contrast the autophosphorylation of PKG ip occurs at just a 2-fold higher concentration of cAMP to cGMP (Smith et al., 1996). In the above studies a recombinant P K G II which was non-myristoylated was used. It has, however, been shown that lack of N-myr does not affect specific activity or affinity for cGMP (Vaandrager et al., 1996). Apart from the above mentioned differences between P K G I and n, native PKG la possesses a significantly higher affinity for cGMP and P-phenyl-l-N2-etheno-cGMP than recombinant PKG II. In contrast the Sp- and Rp- isomers of 8-(4-chloro-phenylthio)-guanosine-3',5'-cyclic monophosphorothioate demonstrated selectivity toward PKG II (Gamm et al., 1995). PKG I and PKG II thus have very different physical and biochemical properties and it is plausible to assume that this could result in distinct functions. 12 Figure 1: Funct ional domains of P K A and P K G . The linear arrangement of functional domains of PKA and PKG is shown (Francis and Corbin, 1999). The amino terminal region has the dimerization domain followed by the autoinhibitory region and autophosphorylation sites (see text for detail). This region is followed by two cAMP sites in PKA regulatory domain (A) and cGMP sites in PKG I (C) and P K G II (D), followed by the catalytic domain containing the M g 2 + - A T P binding region and substrate bindng region. The region of the antigenic peptide used for generating an antibody against P K G II is shown in D. CAMPl CAMP2 Catalytic Domain B Dimerization Autohhibitory Region/ Domain Autophosphorylation sites CGMP1 C G M P 2 Catalytic Domain Dimerization Domain Auto inhibitory Region/ Autophosphorylation sites C G M P I C G M P 2 Catalytic Domain 407Anlgerta peptMe420 Dimerization Domain Autohhibitory Region/ Autophosphorylation sites 13 3. P K G Expression A. Expression in C. elegans and Drosophila The C. elegans PKG CGK-1C has been shown to be strongly expressed in the ventral nerve cord and in several other neurons including PQR. It is also expressed in pharyngeal marginal cells, body muscle, intestine, vulval muscles, and spermatheca (Stansberry et al., 2001). Both DG1 and DG2 are expressed during Drosophila embryonic development (Kalderon and Rubin, 1989). Foster et al. showed that embryonic DG1 is temporally restricted to stage 13 embryos and is confined to the cephalic region and to the amnioserosa (Foster et al., 1996). In the adult fly, DG1 transcript was found in head tissue, such as optic lobes and proximal cortex (Foster et al., 1996; Kalderon and Rubin, 1989). Northern blot analyses showed that transcripts of DG2 kinase are expressed in adult head and body tissues of the fly (Kalderon and Rubin, 1989) B. Expression of mammalian PKGs a. P K G I The highest concentration of PKG I is found in smooth muscle, platelets and cerebellum (Keilbach et al., 1992; Lohmann et al , 1981; Waldmann et al., 1986). Presence of PKG I has also been reported in the hippocampus (Kleppisch et al., 1999), dorsal root ganglia (Qian et al., 1996), neuromuscular endplate (Chao et al., 1997) and cells of the kidney vasculature (Joyce et al., 1986). However, El-Husseini et al did not find any PKG I expression in 14 hippocampus, but found a small cluster of neurons in the compact portion of the dorsomedial nucleus of the hypothalamus in addition to Purkinje cell staining in the cerebellum (El-Husseini et al., 1998). Lower levels of P K G I have been reported in vascular endothelial cells (MacMillan-Crow et al., 1994), and immune cells {Pryzwansky, 1995 #223}. PKG I is also found in the bone in growth plate chondrocytes (Pfeifer et al., 1996) and osteoclasts (Van Epps-Fung et al., 1994). Using PKG Ip1 specific antibodies in bovine and rat tissues it was shown that PKG I|3 is highly expressed in the uterus, aorta, and trachea but not in lung, heart and cerebellum (Keilbach et al., 1992), which have been shown to have high concentrations of P K G la. b. P K G II PKG II is predominantly localized in the brain (El-Husseini et al., 1998), intestinal brush border (Markert et al., 1995), proximal convoluted tubules of the kidney (Gambaryan et al., 1996), the ciliary epithelium of the epidydimis, bone and the lung (Pfeifer et al., 1999). Using in situ hybridization El-Husseini showed high levels of PKG JJ mRNA in the Olfactory bulb, the outer layers of cerebral cortex, pyriform cortex, lateral amygdala, the septum, the thalamus, the superior colliculus, the locus ceruleus, the pontine nuclei and the nucleus of the solitary tract (el-Husseini et al., 1995; El-Husseini et al., 1998). De Vente et al showed using western blot analyses and immunohistochemistry that PKG JJ is present in at least 38 different regions of the brain including cerebellar cortex (de Vente et al., 2001). They also found expression of PKG U in oligodendrocytes and astrocytes. De Vente et al. also showed the presence of P K G JJ in some pyramidal neurons in the hippocampus and 15 dendrites of cerebellar purkinje cells. PKG JJ expression in cerebellum has not been observed by others (el-Husseini et al., 1995; El-Husseini et al , 1998). De Vente et al did not find PKG JJ co-localized with cGMP in many regions of the brain. Their study also did not find significant cell body staining of PKG JJ, which did not coincide with the mRNA localization observed by El-Husseini et al (de Vente et al., 2001; el-Husseini et al., 1995; El-Husseini et al., 1998). This raises a few doubts about the specificity of the antibody used. Further studies with different antibodies need to be done to characterize the distribution of P K G JJ. PKG I and PKG II have a very different expression pattern, with PKG II having a much wider expression in the brain compared to PKG I. This indicates that PKG II is most likely to be the candidate for mediating most of the cGMP effects in the brain that require phosphorylation. Although it is now known to a certain extent what tissues and what regions within those tissues express PKG I and PKG II, the subcellular localization of PKG I and PKG II is still unclear. Is it present at the synapse? Is it presynaptic or postsynaptic in location or both? There are still such unanswered questions and one of the objectives of this thesis research was to define the subcellular distribution of PKG I and PKG II. 4. PKG substrates Initial studies on PKG substrate specificity were made using both protein and peptide substrates that were phosphorylated in vitro by homogeneous preparations of PKG and PKA 16 (Lincoln and Corbin, 1977), which indicated that the same primary amino acid sequence (Arg-Arg-X-Ser(P)/Thr(P) was sufficient for substrate recognition by both PKA and PKG, consistent with a close evolutionary relationship between the two kinases (Corbin et al., 1990). Later proteins that were phosphorylated preferentially, but not exclusively by P K G were found like histone H2B (Glass and Krebs, 1982), bovine lung cGMP-binding cGMP-specific phosphodiesterase (cG-BPDE) (Thomas et al., 1990a; Thomas et al., 1990b). Colbran et al. showed that a Phenylalanine in peptide substrates confers selectivity between PKA and PKG (Colbran et al., 1992). Butt et al showed that Ser 1 5 7 on Vasodialator-stimulated phosphoprotein (VASP) is preferred more by PKA and Ser 2 3 9 by PKG (Butt et al., 1994). This shows that although PKA and PKG are evolutionarily similar they have substrates that are phosphorylated preferentially, which indicates that PKG might have specific in vivo substrates and distinct functions from that of PKA. PKG I has been shown to preferentially phosphorylate a broad range of proteins in vitro, however, phosphorylation of very few of these proteins have been shown to occur in vivo. The substrates of P K G I known so far are; 1) IP3 receptor (Komalavilas and Lincoln, 1994; Komalavilas and Lincoln, 1996) and phospholamban (Raeymaekers et al., 1990), which are implicated in SMC relaxation; 2) The vasodilator-stimulated phosphoprotein and vimentin, which are involved in platelet aggregation and neutrophil activation respectively (Aszodi et al., 1999; Pryzwansky et al., 1995); 3) thrombaxane A2 receptor, the activation of which was inhibited in platelets (Wang et al., 1998); 4) the large conductance, voltage-dependent, and calcium-sensitive K+ channel, Hslo (Alioua et al., 1998); 5) the L-type C a 2 + -channel (Jahn et al., 1988) and the large conductance Ca2+-activated K+ channel, cslo-a on Ser 1 0 7 2 in 17 HEK-293 cells (Fukao et al., 1999), which when phosphorylated are thought to regulate V S M tone and cardiac contractility; 6) Phospholipase A2, implicated in intestinal smooth muscle relaxation (Murthy and Makhlouf, 1999); 7) a tyrosine hydroxylase, the activity of which was increased by P K G I in intact bovine chromaffin cells (Rodriguez-Pascual et al., 1999); 8) myosin binding domain of myosin light chain phosphatase, which plays a role in SMC relaxation and vasodilation (Surks et al., 1999); 9) p38 M A P K in 293T Fibroblasts (Browning et al., 2000), and in the brain; 1) Septin 3 in nerve terminals, where PKG I mediated phosphorylation is thought to affect Septin 3 localization, hence its function (Xue et al., 2004), and. 2) G-substrate in the purkinje cells, through which it inhibits protein phosphatase-1 {Endo, 1999 #170;Hall, 1999 #176}. PKG I can phosphorylate DARP-32, a dopamine- and cAMP regulated phosphoprotein, in vitro and cGMP has been shown to stimulate DARP-32 phosphorylation in the substantia nigra. PKG la is thought to be responsible for phosphorylation of most of the above mentioned substrates. P K G 1|3 has been indirectly shown to phosphorylate cytoskeletal and contractile proteins such as myosin light chain, calponin, desmin, connexins and regulate vascular remodeling and neoangiognesis {Lincoln, 1998 #282}. Ln contrast only one specific substrate of PKG LT is known, which is the CFTR Cl- channel. Only PKG LT and not PKG I can phosphorylate CFTR in vivo. P K G LT regulates intestinal Cl -and water secretion by phosphorylating CFTR in the intestinal epithelial cells (Vaandrager et al., 1998; Vaandrager et al., 1997). 18 It has been shown that a peptide substrate derived from histone f2B had much higher specificity for PKG la than for PKG U, whereas a peptide based upon CREB phosphorylation site exhibited a greater selectivity for PKG II. LP3Rtide, derived from LP3R and kemptide, derived from pyruvate kinase did not show any diference in selectivity for either P K G la or II. However, BPDEtide, derived from bovine cG-BPDE, exhibits a two fold lower selectivity to PKG U than to P K G I. The data above indicate that it is quite likely that P K G I and P K G II have unique substrates and possibly mediate different c G M P effects. A. Unknown substrates of PKG in the brain Initial studies reported that the brain is lacking in endogenous PKG substrates (Walaas et al., 1989). In synaptosomes, only a single 60 kD protein whose phosphorylation was stimulated by cGMP has been reported in human postmortem brain (Boehme et al., 1978). It is thought that the reasons for lack of endogenous substrates of P K G were related to two technical factors. The endogenous level of PKG in most brain regions was insufficient to detect substrate phosphorylation, and the background activity of other protein kinases was too high, masking detection of potential PKG substrates (Wang and Robinson, 1997). After overcoming this problem Wang and Robinson detected >40 relatively specific PKG substrates in the brain. They found 10 proteins in the nerve terminals indicating a neuronal localization of the probable substrates (Wang and Robinson, 1995). El-Husseini et al. showed PKG mediated phosphorylation of a number of proteins from thalamic extracts (El-19 Husseini et al., 1998). This indicates that a number of PKG substrates exist in the brain and mediate specific signaling via cGMP. As PKG II is much more widely expressed than PKG I in the brain, most of these substrates are likely to be PKG II substrates. Hence, a main goal of the thesis was to find the function of PKG II in the brain as it is likely to be the major downstream effector of NO. a. Is yeast two-hybrid a good system to use to find partners of PKG II? We initially used the yeast two-hybrid system (Y2H) (Fields and Song, 1989) to find probable substrates and anchoring proteins of PKG n . The catalytic domain of P K G II was expressed in yeast along with a brain cDNA library to find probable substrates. We also used the N-terminus (first 100 aa) of PKG II as bait to find anchoring proteins. However, after screening ~5 million clones in each category we failed to find any interactions. All the required controls were done to make sure the protein was expressed in yeast and the system was working. We realized that since cyclic nucleotide kinases have very high rates of reaction, the transient interaction with the substrate may not be enough to activate the reporter gene expression. So we made a catalytically mutant (D594N) (Yoo and Hamburger, 1998) form of PKG II and used it as a bait in the Y2H system to find interactions. Even that did not yield any positives, neither did a FL wt P K G II bait. It is possible that P K G n , which is myristoylated, may not attain the proper conformation due to improper co/post-translational modification in yeast and hence interaction might not occur. Proteins called Receptors for activated C-kinase (RACKs) only bind activated PKC and enhance its activity (Mochly-Rosen et al., 1991). Activation of PKG II by cGMP may be required for interaction 20 to occur and so far no cGMP presence has been reported in yeast, which could be a reason for the lack of positives in the Y2H system. It is also possible that proteins interacting with PKG LI are developmentally regulated or very weakly expressed. It appears that the Y2H is not the best system to use to find partners of P K G LI. VI. NO going back, NO/NPs to cGMP to PKG and beyond. 1. Role in regulation of gene expression NO regulates vascular tone via cGMP and P K G causing smooth muscle relaxation in a number of ways, including lowering of intracellular Ca2+ and inhibition of RhoA-dependent Ca2+ sensitization of contraction (Lohmann et al., 1997; Sauzeau et al., 2000). cGMP, however, also positively regulates RhoA expression in vascular smooth muscle cells (VSMC) (Sauzeau et al., 2003). When exposed to NO and cGMP analogues for a long time, RhoA expression is increased by both increase in rhoA transcription and RhoA protein stability because of PKG phosphorylation. The P K G mediated increase in transcription is associated with increased CREB and ATF-1 phosphorylation (Sauzeau et al., 2003). cGMP and PKG are also important for V S M C differentiation and phenotypic modulation. Synthetic VSMCs transfected with constitutively active PKG or FL PKG (activated with cGMP) restored a more contractile phenotype with fusiform morphology, increased expression of smooth muscle myosin heavy chain-2 (SM-MHC2), SM a-actin and calponin protein, and decreased expression of osteopontin, thrombospondin, and FGF receptors 21 (Boerth et al., 1997; Dey et al., 1998; Lincoln et al., 2001; Lincoln et al., 1998). Recently it was shown using cDNA micro-array analyses to compare PKG transfected and control transfected late passage VSMCs, that >100 transcripts could be up or down regulated more than three fold by cGMP/PKG (Pilz and Casteel, 2003). It has been shown that cGMP/PKG can have anti-proliferative effects on V S M C , mesangial cells, and various fibroblasts by inhibiting growth factor-induced extracellular signal-regulated kinase (Erk-1/2) activity, increased expression of M A P kinase phosphatase-1 (MKP-1) (Hutchinson et al., 1997; Suhasini et al., 1998; Yu et al., 1997), modulation of cell cycle-associated genes, and reduction of ET-1 synthesis (Fujisaki et al., 1995; Mitsutomi et al., 1999). cGMP has also been shown to increase proliferation of endothelial cells increasing Erk-1/2 activity possibly by increased production of vascular endothelial growth factor (VEGF) (Doi et al., 2001; Hood and Granger, 1998; Parenti et al., 1998; Zhang et al., 2003). cGMP analogues can prevent apoptosis of neurons that is induced by prolonged treatment of NOS and sGC inhibitors. The protective effect of cGMP is associated with increased CREB phosphorylation and increased mRNA and protein expression of the apoptosis inhibitor Bcl-2 (Ciani et al., 2002). cGMP/PKG have been shown to protect neuronal cells from apoptosis during growth factor deprivation by increasing expression of the oxidative stress-related proteins thioredoxin and thioredoxin peroxidase (Tpx-1), which leads to increased Bcl-2 expression (Andoh et al., 2003). 22 Transcription factors can be regulated by cGMP directly by inducing phosphorylation by PKG or by increasing expression of short-lived proteins. Transcription factors that could be phosphorylated in a cGMP-dependent manner include the cAMP response-element (CRE)-binding protein CREB in neuronal cells (Ciani et al., 2002; Lu et al., 1999), activating transcription factor-1 (ATF-1) (Sauzeau et al., 2003), and the multifunctional transcription factor 1T11-I (Casteel et al., 2002). cGMP also regulates expression of transcription factors such as the AP-1 family proteins c-Fos and JunB (Pilz et al., 1995; Thiriet et al., 1997), the early growth response gene Egr-l(Cibelli et al., 2002; Esteve et al., 2001; Thiriet et al., 1997; Yamashita et al., 1997), and the growth arrest-specific homeobox gene G A X . Increase in intracellular cGMP leads to increased CREB Ser 1 3 3 phosphorylation in VSMCs, neuronal cells, and PKG-transfected Baby Hamster Kidney (BHK) cells, but not in PKG-deficient B H K cells (Ciani et al , 2002; Gudi et al., 2000; Lu et al., 1999; Sauzeau et al., 2003). Some researchers have shown nuclear translocation of PKG in neuronal cells, neutrophils, macrophages, and some embryonic smooth muscle cells (Gudi et al., 2000; Gudi et al., 1997; Pryzwansky et al., 1995; Wang et al., 1999; Wyatt et al , 1991), while others have found no evidence of PKG nuclear translocation in primary VSMCs, HEK293, and CV-1 cells, or observed nuclear PKG only in a minority of the cell population (Collins, 1999 #135;Browning, 2001 #136;Feil, 2002 #137}. cGMP could indirectly regulate transcription factors by modulating upstream signal transduction pathways, which include cGMP regulation of an inhibitor of NF-[kappa]B, and inhibition of calcineurin signaling to NF/AT and of RhoA signaling to SRF. cGMP can regulate the activity of multiple transcription factors, including ternary complex factor 23 (TCF), CREB, ATF-2, and c-Jun through activation or inhibition of M A P kinase pathways (Hazzalin and Mahadevan, 2002; Pilz and Casteel, 2003). Together, this data indicates that cGMP/PKG plays a very important role in gene expression, apoptosis, cell growth, and differentiation not only in cardiovascular system but also in neurons and other cell types. 2. Role in modulation of neurotransmitter release and synaptic plasticity A. Neurotransmitter release A number of studies have reported that NO is important in neurotransmitter release. Release of L-glutamate and norepinephrine upon N M D A receptor (NMDAR) activation in synaptosomal preparations was shown, and this effect was mediated by NO (Montague et al., 1994). Supervision with the NOS inhibitor, NG-nitro-L-arginine in the basal forebrain of conscious rats diminishes the release of acetylcholine (Prast and Philippu, 1992). Sorkin et al. showed activation of N M D A receptors results in extracellular release of glutamate and NO (Sorkin, 1993). Inhibition of NOS blocked evoked increases in extracellular glutamate (Sorkin, 1993) and this effect was shown to be cGMP mediated (Sistiaga et al., 1997). There is evidence for NO mediated modulation of neurotransmitter release of dopamine (Hanbauer et al., 1992) and GAB A (Li et al., 2004). cGMP/protein kinase G pathway has been shown to potentiate glutamatergic transmission induced by NO in immature rat rostral ventrolateral medulla neurons in vitro (Huang et al., 2003). The NO/cGMP pathway is not only important for neurotransmitter release, but also for regulation of synaptic vesicle endocytosis (Micheva 24 et al., 2003). In all these cases NO is thought to act as a retrograde messenger and activate sGC and PKG at the presynaptic terminal. Modulation of neurotransmitter release is important as it plays a role in synaptic plasticity. Most of the evidence mentioned above was obtained using activators and inhibitors against NOS, sGC and PKG. Although it is clear that the N O / c G M P / P K G pathway is involved, it is still unclear how these effects are mediated by P K G . B. NO Hippocampal LTP Hippocampus is responsible for the formation of declarative and spatial memory (Milner et al., 1998). Associative LTP has been shown in pyramidal cells of the CA1 region of hippocampus (Shors and Matzel, 1997). The Schaffer collaterals release glutamate which activates NMDAR. This allows C a 2 + to enter the cell and activate Ca 2 + CaM (Wang and Kelly, 1995), which in turn activates NOS and causes release of NO from postsynaptic CA1 pyramidal cells (Susswein et al., 2004). LTP is thought to be initiated postsynaptically, although there is evidence that it is maintained presynaptically (Arancio et al., 1996). However, others have argued against a presynaptic locus of LTP expression (Luscher et al., 2000; Malenka and Nicoll, 1999). Schuman and Madison proposed that NO can act as a retrograde messenger to send the signal back to the presynaptic terminal after LTP initiation on the postsynaptic side (Schuman and Madison, 1994). Of the two forms of NOS (nNOS, eNOS) expressed in the hippocampus, knockout of either isoform alone does not block LTP expression, but double mutants in which both forms are non-functional show a decreased LTP in some areas of the CA1 region but not others (Son et al., 1996). There is also evidence 25 that NO has no effect on either LTP in the hippocampus (Bannerman et al., 1994b; Cummings et al., 1994; Murphy and Bliss, 1999) or on memory affected by the hippocampus (Bannerman et al., 1994a; Tobin et al., 1995). cGMP and PKG have also been implicated in regulation of LTP. Blocking PKG has been shown to block LTP and selective activators of PKG can produce LTP, implicating the cGMP second messenger pathway (Son et al., 1996; Zhuo et al., 1994a). In cultured hippocampal neurons, intracellular injection of PKG blockers in the presynaptic neuron, but not in the postsynaptic neuron prevents LTP, indicating a presynaptic involvement (Arancio et al., 2001). However, there are also reports that blocking the cGMP pathway, either via pharmacological agents or knocking out genes, fails to block LTP (Schuman et al., 1994; Selig et al., 1996). Kleppisch et al., found that LTP was not altered in PKG I knockout or P K G II knockout or a double knockout of P K G I and LT mice (Kleppisch et al , 1999). These studies found that the effect is probably mediated by ADP-ribosylation of proteins, as using pharmacological inhibitors of ADP-ribosylation blocked LTP (Kleppisch et al., 1999; Schuman et al., 1994; Selig et al., 1996). Other studies showed that P K G activates phosphodiesterases, which degrade cGMP, and thereby lowers its concentration and this effect is necessary for LTP (Monfort et al., 2002). The contradictory evidence regarding involvement of the cGMP/PKG pathway could be because of the high sensitivity of cGMP analogues to experimental conditions {Son, 1998 #283} or possibly because effects of NO on LTP could differ considerably between different strains and species, at different stages of development, and as a result of small differences in protocols used (Blackshaw et al., 2003; Holscher, 2002) 26 Most of the above mentioned studies argue for a role of NO on the presynaptic side. There is also evidence that NO can act post-synaptically, either by enhancing LTP in some cases or by suppressing it in others (Ko and Kelly, 1999; Murphy and Bliss, 1999). Ko and Kelly showed that extracellular application of the NOS inhibitor N(G)-nitro-L-arginine methyl ester (L-NAME) or postsynaptic co-injection of L - N A M E with Ca(2+)/CaM blocked Ca(2+)/CaM-induced synaptic potentiation. Murphy and Bliss showed the opposite effect using flash photolysis of a caged form of NO. They found that photolytically released NO (1-4.5 microM) from bath applied caged NO reduced the magnitude of long-term potentiation (LTP) in a concentration-dependent manner. However, the postsynaptic effects downstream of N O have not been studied in detail. C. NO Cerebellar LTD NO is released by parallel fibre activity and climbing fibre activity causes an increase in C a 2 + entry into Purkinje cells. NO acts through sGC and causes an increase in cGMP, which in turn activates P K G and causes initiation of L T D (Lev-Ram et al., 1997). NO was found to induce L T D when paired with low-frequency stimulation of 0.25 Hz, a frequency that alone did not induce L T D (Zhuo et al., 1994b). NOS inhibitors also blocked L T D induction in the CA1 region of hippocampus (Izumi and Zorumski, 1993) and the dentate gyrus (Wu et al., 1997) . The same effect was observed when sGC and PKG inhibitors were used, indicating that NO acts through the cGMP/PKG pathway to induce L T D in the dentate gyrus (Wu et al., 1998) . Calabresi et al. showed that the NO/cGMP/PKG pathway is also involved in L T D 27 induction in the corticostriatal pathway (Calabresi et al., 1999). However, Glaum et al. showed that NO donors do not induce L T D (Glaum et al., 1992). Another group found that in Purkinje cells NOS inhibition or hemoglobin did not prevent depression of glutamate sensitivity nor could it be mimicked by an exogenously applied NO donor (Linden and Connor, 1992). All this evidence suggests an important role for the cGMP/PKG pathway in regulating synaptic plasticity, however, there is still a lot of controversy over the role of NO in modulation of LTP and LTD. It is also still unclear as to how exactly the cGMP/PKG pathway is involved in regulating plasticity, especially on the postsynaptic side. D. Possible role in regulation of filopodia/spine morphology Post synaptic changes that have been associated with LTP and L T D include phosphorylation of glutamate receptors (Barria et al , 1997; Lee et al., 2000; Nicoll and Malenka, 1999), insertion of receptors in "silent" synapses (Liao et al., 1995), modification of electronic properties and dendritic spine shape (Muller et al., 2000). Modulation of the plasma membrane shape and composition regulate outgrowth of processes, axonal development, dendritic branching and synaptogenesis (Jontes and Smith, 2000). In non-neuronal cells, differential regulation of membrane flow can result in the formation of processes such as microspikes, lamellopodia, and filopodia (Wood and Martin, 2002). Dendritic filopoida are thought to be precursors for developing synapses (Dailey and Smith, 1996; Hering and Sheng, 2001). The NO/cGMP pathway has shown to be important for regulation of growth 28 cone filopodia (Van Wagenen and Rehder, 1999), and neurite outgrowth in mouse hippocampal neurons and PC12 cells (Hindley et al., 1997). The change in spine shape associated with LTP has been shown to involve an increase in F-actin (Lisman, 2003). Ena/VASP proteins, which are specific substrates of PKG and PKA, have been shown to play an important role in linking signaling pathways to remodeling of the actin cytoskeleton [for review see (Kwiatkowski et al., 2003)]. cGMP inhibits collagen-induced platelet aggregation ^  which requires dynamic actin reorganization followed by cell shape change {Aszodi, 1999 #347). PKG has been shown to mediate platelet aggregation through VASP {Aszodi, 1999 #347} and phosphorylation of VASP by PKA has been shown to reduce the ability of VASP to promote in vitro nucleation probably by reducing VASP binding to G-actin (Harbeck et al., 2000; Lambrechts et al., 2000; Walders-Harbeck et al., 2002). NO has been implicated in agrin-induced postsynaptic differentiation at the neurosmuscular junction and has been shown to act through cGMP (Godfrey and Schwarte, 2003). A l l this data leads us to hypothesize that the c G M P / P K G pathway plays an important role in regulation of filopodia/spine morphology. 3 . P K G and behaviour P K G has been shown to be important for regulation of complex behaviours. Genetic studies in Drosophila have shown that the for locus, which encodes a PKG isoform, influences heritable patterns of larval foraging behavior. Animals carrying a "rover" allele (for*) move long distances while feeding, while insects homozygous for the "sitter" allele (/or5), a naturally occurring variant that has less PKG, are relatively inactive in the presence of food 29 (Osborne et al., 1997). Using behavior genetic analyses it was shown that PKG in C. elegans is important for normal motility (Stansberry et al., 2001), olfactory adaptation (L'Etoile et al., 2002) and for regulating multiple developmental and behavioral processes including orchestrated growth of the animal and the expression of particular behavioral states (Fujiwara et al., 2002). This indicates PKG plays an important role in model organisms such as Drosophila and C. elegans, however, the role of PKG in the mammalian nervous system is still unclear. 4. Statement of Aims We hypothesize that PKG II is the major candidate for mediating cGMP effects in the brain. Our first aim was to confirm the hypothesis stated above by showing that PKG II has a wide expression in the brain using a PKG II specific antibody. We also hypothesize that P K G II is present in the synapse and N-myr is important for targeting of PKG II to the synapse. We wanted to test this hypothesis by showing the presence of P K G U, using PKG II specific antibody, in synaptic fractions from the brain and co-localization of P K G II with synaptic markers in hippocampal neurons in culture. Our aim was also to show that N-myr is important for proper targeting of PKG II in neurons and heterologous cells by using a non-myristoylation mutant form of PKG n . Finally we wanted to test the hypothesis that PKG II plays an important role in regulation of synaptogenesis in hippocampal neurons in culture by overexpressing a dominant negative form of PKG IJ. 30 In this thesis, I will be presenting evidence for the synaptic localization of PKG II, the importance of N-myr on PKG II targeting in neurons and the role of PKG II in regulation of synaptogenesis in hippocampal neurons in culture. 31 Materials and Methods /. Animal Care All animal procedures were in strict accordance with the guidelines of the Canadian Council of Animal Care. All animals were obtained from the Animal Care Centre of UBC. //. PKG II Antibody Generation and Purification 1. Antibody generation PKG II antibody was made by Affinity Bioreagents, Inc. The peptide N H 3 - T L N R D D E K R H A K R S - C 0 0 H corresponding to amino acids 407 - 420 of PKG II was used to generate antibodies against PKG n . The sequence was used in the B L A S T program on the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST/) to make sure that there were no sequences similar to it in other proteins. K L H was used as a carrier protein. Pre-Immune serum was collected prior to immunization. Four injections (boosts) of the peptide antigen were given to two rabbits once every 20 days. The first bleed was collected ten days after the third boost, the second and third bleeds were collected 10 and 14 days after the final boost respectively. A fifth and final boost was given a month after the collection of the third bleed. The final bleed, exsanguination bleed, was collected 10 days after the fifth boost. The rabbits were sacrificed after the exsanguination bleed was collected. The pre-immune serum and serum were stored at -80° C. 32 2. Ant ibody purification A. Material SulfoLink® Kit, PIERCE, Cat. No. 20405 B. Method Sulfolink® Columns were used to purify the antibodies. 10 mg of peptide (prepared and supplied by Affinity Bioreagents, Inc.) were first reduced using Sulfolink® Reductant containing 2-mercaptoethylamine). The mixture was incubated at 37° C for 1.5 hours. Excess 2-mercaptoethylamine was removed using D-Salt® Polyacrylamide Plastic Desalting Column. The reduced protein mixture was applied to the Sulfolink® Coupling Gel column consisting of immobilized iodoacetyl on a crosslinked agarose support. The columns were incubated at room temp, for 30 min. The columns were washed with Sulfolink® Coupling Buffer. One mL of serum was applied to the antigen-coupled column. One mL of sample buffer was applied to the column after the serum entered the gel bed. The column was incubated at room temp, for one hour. The column was washed with 16 mL of sample buffer. One mL fractions of the antibody were eluted using glycine buffer at pH 2.5. The one mL fractions were neutralized by adding 50u,L of IM Tris, pH 9.5. Aliquots of the affinity purified antibodies were stored at -20° C. ///. RNA Extraction Total RNA was extracted using the single step RNA extraction method as described (Chomczynski and Sacchi, 1987). Brain was dissected from young adult Rattus norvegicus 33 and homogenized in 1 mL of solution A (4 M guanidinium thiocyanate, 25 mM Na citrate, pH 7.0, 5% sarcosyl, 0.1 M 2-mercaptoethanol) at room temp. After homogenization, 0.1 mL of Na Acetate (pH 4), 1 mL of phenol (water saturated) and 0.2 mL of chloroform/isoamyl alcohol mixture (49:1) were added to the homogenate. The solution was vortexed for 10 sec and cooled on ice for 15 min. It was then centrifuged at 10,000 rpm for 20 min. at 4° C. the aqueous phase (upper layer) was transferred to a fresh tube, mixed with 1 mL isopropanol and incubated at -80° C for 30 min. Samples were then centrifuged at 10,000 rpm for 20 min at 4° C. The precipitate RNA pellet was re-suspended in 300 uL of solution A and RNA was precipitated with 1 vol. of isopropanol. The mixture was centrifuged at 10,000 rpm for 20 min at 4° C to collect the RNA pellet. The pellet was then washed with 70% ethanol, vacuum dried and re-suspended in water and either used immediately or stored at -80° C. IV. RT Reactions 1. M a t e r i a l Product Company M M L V reverse transcriptase Invitrogen RNAguard RNAse Inhibitor Pharmacia dNTPs Pharmacia Cat . N o . 28025-013 27-0815-01 27-2035-01 2. M e t h o d RT reactions were performed similar to the one described earlier (el-Husseini et al., 1994). One pig of total RNA was incubated with 200 U of M M L V reverse transcriptase in a buffer 34 containing a final concentration of 50 m M Tris (pH 8.3), 74 m M KC1, 3 m M M g C l 2 , 10 m M D T T , 5% D M S O , 19 U of R N A s e Inhibitor, 0.01 % B S A , 0.25 ng of R T primer (AGCTACAGCTGAGCTTGAGCTTCAGT20), and 0.5 m M of each dNTPs in a final vol . of 10 p,L. The reaction mixture was incubated for 2 h at 37° C and either used immediately to do a P C R or stored at -20° C . V.PCR 1. Material Product Company Cat. No. dNTPs Pharmacia 27-2035-01 V E N T Polymerase New England Biolabs M 0 2 5 4 L Qiagen G e l Extraction K i t Qiagen 287-04 T4 D N A Ligase Pharmacia 27-0870-03 2. Method P C R was performed in 50 u.L reaction containing 1/10 of R T reaction, 60 p M of each primer, I X P C R buffer, 0.5 m M MgC12, 200 u M dNTPs, 2 U of V E N T D N A Polymerase. The mixture was overlaid with a drop of mineral o i l and then incubated in a GTC-1 genetic thermal cycler (Scientific Precision) using the following profile: an initial denaturation step at 94° C for 5 min, then 35 cycles of the following steps, 94° C for 1 min for denaturation, 60° C for 1 min for annealing, and 72° C for 2.5 min for primer extension. The resultant products were separated by agarose gel electrophoresis, purified using Qiagen gel extraction kit and digested using appropriate restriction enzymes. The digested products were purified 35 using Qiagen DNA purification kit and subcloned into the appropriate vector. Ligation reactions were performed in 15 pL vol. containing IX ligase buffer, 5 U of T4 D N A ligase and 1:3 plasmid vector to cDNA ratio and incubated overnight at 15° C. VI. Restriction Analysis and Agarose Gel Electrophoresis 1. Material Product Company Cat. No. Hindm/React Buffer 2 Invitrogen 15207-012 KpnI/React Buffer 4 Invitrogen 15232-010 Hinc n/React Buffer 4 Invitrogen 15206-014 EcoRI/React Buffer 3 Invitrogen 15202-013 lkb ladder Invitrogen 15615-016 2. Method Restriction digests were performed to check the integrity of the plasmid vectors, to sub-clone PCR products and to verify prepared DNA constructs. All restriction digests were carried out for at least one h at the appropriate temperature. Agarose gel electrophoresis was used to verify the size of PCR products, restriction fragments and to estimate the concentration of DNA fragments for sub-cloning. Samples were subjected to electrophoresis on a 1% agarose gel with 0.1 pg/mL of ethydium bromide using IX T A E as electrophoresis buffer. Samples were loaded with a 1/6* vol. of 6X loading buffer (40% w/v sucrose in water, 0.25% bromophenol blue, 0.25% xylane cyanol). The 36 mixed samples were loaded into wells of the agarose gel. Electrophoresis was performed at 110V. An ultraviolet transilluminator (300 nm wavelength) was used to visualize DNA. Size was compared to a known 1 kb molecular marker. VII. Sub-cloning 1. Materials Product Company DH5 alpha cells Invitrogen Ampicillin Sigma Qiagen Mini-prep kit Qiagen Qiagen Maxi-prep kit Qiagen Qiagen Gel Extraction Kit Qiagen Cat. No. 18265-017 A-9518 271-06 121-62 287-04 2. Method Fifty uX of chemically competent DH5 a E. coli cells were thawed on ice and transferred to a 13-mL tube containing 250-500 ng of pure plasmid DNA or 1/15 of ligation reaction. The mixture was incubated at 4° C for 15 min and heat shocked at 42° C for 45 sec. The mixture was transferred immediately to 4° C and incubated for 2 min. Five hundred uX of SOC medium were added to each tube and incubated for 1 hr. at 37° C. The cells were centrifuged at lOOOg for 5 min, re-suspended in 100 u,L of SOC and plated on LB plates containing the selection antibiotic (ampicillin at 100 p,g/mL). The plates were incubated at 37° C overnight. Individual colonies were picked and transferred to 13 mL tubes containing 5 mL of LB medium with the selection antibiotic and grown overnight at 37° C. Plasmid DNA was 37 purified using Qiagen Plasmid M i n i or Maxi-prep kit. D N A was sequenced at Nucleic A c i d Protein Service (NAPS) Unit, U B C to verify the sequence. 3. Constructs generated for transfection of mammalian cells A. GFP Fusion Constructs The mammalian expression vector G W 1 containing the sequence expressing G F P (gift from Dr. David Bredt's lab) was used for subcloning all of the P K G II constructs (See F ig . 2). A l l constructs were subcloned into the HindlJJ/Kpnl sites of G F P - G W 1 vector. Primers were ordered from either Genset Oligos or N A P S Unit at U B C . The stop codon was omitted from the reverse sequence in order to make a C-terminal G F P fusion protein. A l l the constructs were sequenced at the N A P S Unit at U B C to verify that the P K G II sequence was correct and in frame with the sequence expressing G F P . Western blot was performed using G F P antibodies on lysates from H E K - 2 9 3 cells expressing the various constructs to make sure the fusion proteins were expressed (See Fig . 3). a. F L wt P K G II The forward primer 5' - G C T A G C A A G C T T G C C A C C A T G G G A A A T G G T T C AGTG -3 ' containing the restriction site for HindHI and the reverse primer 5' - G G G C C C G G T A C C G A A G T C C T T A T C C C A G C C - 3 ' containing the restriction site for K p n l were used to amplify the F L wt P K G II from R T brain c D N A . 38 b. 5' wt P K G II The forward primer 5' - G C T A G C A A G C T T G C C A C C A T G G G A A A T G G T T C AGTG -3 ' containing the restriction site for HindJJI and the reverse primer 5' - G G G C C C G G T A C C G A G T T C A T C A A A T G T C C C - 3 ' containing the Kpnl restriction site were used to amplify the regulatory domain of P K G LT consisting of amino acids 1-397 of wt PKG H using FL wt PKG LT GFP-GW1 as a template. c. F L P K G II G 2 A mut To make a FL N M mut of PKG LT the codon for glycine G G A was replaced with the codon for Alanine G G A in the forward primer. The forward primer 5' -GCT A G C A A G C T T G C C A C C A T G G C A A A T G G T T C AGTG-3 ' containing the restriction site for HindTLT and the reverse primer 5 - G G G C C C G G T A C C G A A G T C C T T A T C C C A G C C - 3 ' containing the restriction site for Kpnl were used to amplify the FL PKG LT G2A mut using F L wt P K G LT GFP-GW1 construct as a template. d. 5' P K G I I G 2 A mut To make a N M mut of PKG II regulatory domain the forward primer 5' -GCT A G C A A G C T T G C C A C C A T G G C A A A T G G T T C AGTG-3 ' containing the restriction site for HindHI and the reverse primer 39 5' - G G G C C C G G T A C C G A G T T C A T C A A ATGTCCC -3 ' containing the Kpnl restriction site were used to amplify the region encoding the amino acids 1-397 of P K G II using F L PKG II G2A mut GFP-GW1 as a template. B. His-Cat PKG II To amplify just the catalytic domain the primers 5'-A A A C T T A A G C T T G C C G C C A T G C A T C A C C A T C A C C A T C A C G C C A C C C T G A A C C G T GA-3 ' containing the restriction site HindUI and the reverse primer 5'-G G G C C C G A A T T C G A G T T C A T C A A A T G T C C C - 3 ' containing the EcoRI site were used to amplify the region encoding the last 366 amino acids of P K G II using F L P K G II as a template. The fragment was subcloned into the mammalian expression vector pCDNA3 (Invitrogen). 40 Figure 2: Constructs Generated for Transfecting mammal ian cells. A l l G F P constructs were subcloned in the mammalian expression vector GW1 and the His-tagged catalytic domain of P K G U was subcloned in the p C D N A 3 vector (Invitrogen). Myr FLwtPKG II 1 CGMP1 cGMP2 Catalytic Domain 5'wtPKGII 5'PKGIIG2Amut CGMP1 C G M P 2 G F P FLPKGIIG2Amut CGMP1 CGMP2 Catalytic Domain His-Cat PKG II Hls-| Catalytic Domain 41 Figure 3: Western blot analysis of expression of various PKG II constructs in transiently transfected HEK-293 cells. HEK-293 cells were lysed 24-48 hours post-transfection. Western blot was performed using rabbit GFP antibodies (See Table 2 for concentration used). Arrows indicate the bands corresponding to the expressed proteins. 42 VIII. Subcellular Fractionation Subcellular fractions were prepared from 6 whole brains of adult rats (young adults weighing 100-150 g) or 15 whole brains of rat pups (PO) as described earlier (Huttner et al., 1983) (Lin et al., 1998). All steps were performed on ice. Brains were homogenized with 9 strokes of a Dounce homogenizer at 900 rpm in 50 mL of homogenizing buffer (320 mM sucrose, 4 mM Hepes, pH 7.4, 1 mM E G T A , 1 mg/mL pepstatin and 200 mM PMSF). The lysate was centrifuged for 10 min at 1000 x g, which removed large debris and nuclei (PI). The snt (SI) was centrifuged at 12 000 x g to obtain the S2 fraction containing small cell fragments. The pellet was re-suspended in homogenizing buffer and centrifuged for 15 min at 13 000 x g, which resulted in a snt (S2') consisting of small compartments and a pellet of crude synaptosomal membranes. Homogenizing buffer was used to re-suspend the pellet. The sample was then homogenized at a very slow speed, followed by hypo-osmotic lysis by addition of 9 vol. of ice-cold water. This sample was centrifuged for 20 min at 33,000 x g to obtain heavy membranes (LP1) and a snt. The snt was centrifuged at 251,000 x g for 2 h, which yielded a snt of presynaptic cytosol (LS2) and a pellet (LP2) containing synaptic vesicles. The pellet was re-suspended in 40 mM sucrose. Protein cone, was determined using B C A protein assay kit. Fifty u,g protein of each fraction were loaded on an SDS gel and were detected by western blotting. IX. Cell Culture 1. Ma te r i a l Product Company Cat . N o . 43 HBSS Invitrogen 14170-112 N B M Invitrogen 21103-049 Papain Sigma P-3125 Trypsin Inhibitor Sigma P-9253 DNAse I Sigma DN-25 B-27 supplement Invitrogen 17504-044 L-glutamine Invitrogen 250300-81 D M E M Invitrogen 121000-46 Penicillin/Streptomycin Invitrogen 150700-63 Trypsin 0.25% E D T A Invitrogen 252000-56 FBS, USA Origin Invitrogen 261400-79 Poly-D-Lysine Sigma P-6407 2. Method A. COS Cells and HEK-293 cells Cells were obtained from American Type Culture Collection. Cells were maintained in an incubator containing 5% CO2 at 37° C in D M E M supplemented with penicillin/streptomycin (100 U/mL) and 10% FBS. Cells were passaged every three to four days. For passaging cells, the medium was aspirated, washed once with pre-warmed (37° C) PBS and incubated in 1 mL trypsin (0.25% in PBS) for 2 min at 37° C. Ten mL of fresh PBS were added to cells and the solution was triturated with a 10-mL pipette a few times to detach cells. The solution with cells was centrifuged at 1000 x g for 3 min. The snt was aspirated and the cells re-suspended in 10 mL of pre-warmed fresh medium. B. Neurons Twenty four-well plates with cover slips were coated with poly-D-lysine (50 u.g/mL) for 3 h. Hippocampal neurons were cultured as described previously (Brewer, 1995; Brewer et al., 44 1993). Hippocampi and cortices were dissected from embryonic day 18-19 rat embryos and transferred to HBSS. Thalami were dissected from embryonic day 15 rat embryos. The tissues were digested in papain solution (containing 0.5mM E D T A and 1 mM CaC12) by triturating with a 10 mL pipette gently a few times. The solution was incubated at 37° C for 10 min. The cells were spun down at 2500 rpm for 3 min. Cells were then re-suspended in trypsin inhibitor solution containing DNAse I and L-cysteine, and centrifuged for 3 min at 2500 rpm. The cell pellet was then re-suspended in 5 mL of complete N B M containing B-27 supplement and penicillin/streptomycin solution. Cells were counted using a haemocytometer and plated at a density of 100-150,000 per cover slip. The neurons were maintained in an incubator containing 5% CO2 at 37° C. Fifty % of the medium was changed once every five days. X. Cell Transfection 1. Ma te r i a l Product Lipofectamine 2000 Effectene OPTTMEM Company Invitrogen Qiagen Invitrogen Cat . N o . 11668-027 3014-25 226000-50 2. M e t h o d A. Lipofectamine 2000 Lipofectamine 2000 reagent was used to transfect COS cells and HEK-293 cells. Cells were passaged and plated in 6-well plates a day before transfection. DNA and Lipofectamine 45 reagent were mixed in 500 uL OPTTMEM at a ratio of 1:2.5 and incubated at room temp for 20 min. The medium was aspirated from the well and the mixture was added to the cells along with 1.5 mL of fresh complete D M E M . The cells were either lysed or fixed 24-48 h after transfection. B. Effectene Hippocampal neurons were transfected either on div 6 or div 10 with Effectene reagent. Two u.g of DNA was used to transfect six wells in a 24-well plate. Two \ig of DNA and 8 uL of enhancer solution were added to 150 uL of E C buffer. When two constructs were co-transfected, 1 pig each of the constructs was used. The mixture was incubated at room temp for 5 min and then 12-15 uL of Effectene reagent were added. The solution was gently vortexed for two seconds and incubated at room temperature for 10 min. One mL of fresh complete N B M was added to each tube containing the mixture of DNA and Effectene reagent. One hundred and forty uL of the mixture were added to each of the six wells containing 200 uL of complete N B M . The cells were incubated at 37° C and 5% C02 for 2.5 to 3 h after which the transfection mixture was aspirated and 1 mL of fresh complete N B M was added to each well. Cells were fixed 4-5 days after transfection. XI. Immunocytochemistry 1. M a t e r i a l Product Company Cat . N o . Electron Microscopy Fluoromount G Sci. 17984-25 46 2. Method All immunocytochemistry experiments were done on 24-well plates. One to two days after transfection COS cells and HEK-293 cells were fixed for 15 min with a solution containing 4% PFA and 0.1 M potassium phosphate. Cells were then washed three times with PBS containing 0.3% Triton-X (PBS-t). Cells were incubated for one h at room temp in 150-200 u.L of the appropriate primary Ab in PBS containing 0.3% Triton-X (PBS-t) and 2% NGS (See table above for primary Ab cone). Cells were washed three times with PBS-t. Cells were then incubated with the appropriate fluorescent secondary Ab (see table above for secondary Ab cone) or biotinylated antibodies in case of D A B / A B C staining, for 1 h at room temp. Cells were washed 3 times with PBS-t and cover-slipped in Fluoromount G. Cells were stored in dark until analyzed. Hippocampal neurons were fixed in 100% methanol 4-5 days post transfection. Rest of the procedure was as described above. For immunoperoxidase staining, the A B C method was used using Vectastain® A B C kit. Cells were incubated for 1 h at RT in PBS-t solution containing avidin-biotinylated horseradish peroxidase complex. Following a final series of rinses in PBS, the immunoreactivity was revealed using a nickel-enhanced DAB reaction. For peptide inhibition studies 3 u,g of PKG II Ab were incubated with 30 u.g of peptide antigen (supplied by Affinity bioreagent, Inc) in one mL of PBS-t overnight at 4° C. Between 150 to 200 uX of the dilution was added to each well. 47 Table 1: Antibodies used in Immunocytochemistry Primary Abs GFP (AFP5002) GFP (132002) PKG II Affinity purified PKG I CT (KAP-PK005) PSD-95 (MA1-046) Synaptophysin (S5768) Synaptophysin (18-0130) Secondary Abs Alexa 488 anti-rabbit (A11034) Fluorescein (FTTC) Anti-Mouse IgG Texas Red anti-rabbit IgG Texas Red anti-mouse IgG Company Dilution used Host Qbiogene 1 in 1000 Mouse Synaptic Systems 1 in 2000 Rabbit custom made 1 in 200 Rabbit StressGen 0.25 ng/mL Rabbit ABR 1 in 200 Mouse Sigma 1 in 1000 Mouse Zymed Laboratories, 1 in 1000 Rabbit Inc. Company Dilution used Host Molecular Probes 1 in 1000 Jackson 1 in 1000 Goat ImmunoResearch Jackson 1 in 200 Donkey ImmunoResearch Jackson 1 in 200 Donkey ImmunoResearch 48 XII. Image Acquisition and Quantification Fluorescence Images were acquired using Zeiss Axiophot microscope. Images were acquired using a 63X objective. At least fifteen cells in each category were randomly selected and analysed. Morphometric measurements were performed using Northern Eclipse image analysis software (Empix Imaging Inc.). Dendritic filopodia/spines (Hering and Sheng, 2001) and synaptophysin puncta were counted manually and logged into Microsoft Excel. One way A N O V A was performed to test the significance of the data. XIII. lmmunoprecipitation (IP) 1. Material Product Company Cat. No. Protein A-Sepharose Amersham 17-0780-01 Primary Abs Company Dilution used Host PKG LI Affinity purified custom made 3 u,g Rabbit 2. Method A. Cell Lysis Cells were lysed in 500 uT of T E E N (50 mM Tris, pH7.4, 1 mM EDTA, 1 mM E G T A and 150 mM NaCl) containing 1 u.g/mL peptatin A, 10 mM PMSF and 1 % Triton-X (unless indicated otherwise) for 20 min at 4° C with vigorous shaking. The cells were scraped and transferred to a 1.5 mL centrifuge tube and centrifuged at 10 000 rpm for 15 min. The snt was transferred to a fresh tube and used for experiment immediately or stored at -80° C. 49 Brains were homogenized with 9 strokes of a Dounce homogenizer at 900 rpm in 1 to 10 w/vol of the above mentioned lysis buffer that also contained 320 mM sucrose and 0.1% SDS. The homogenates were rotated for 20 min at 4° C for complete lysis to occur. The homogenates were then centrifuged for 20 min at 10 000 rpm and the snt transferred to fresh tube. The homogenates were either used immediately for experiments or stored at -80° C until further use. B. Preparation of Protein A-Sepharose beads (CLA4) for IP. Two mL of beads slurry were suspended in 10 mL of 50 mM Tris, pH 7.4, by rotating for 30 min. at 4° C. Beads were collected by centrifugation at 1000 x g for 5 min. Two mg/mL of crystallized BSA was added to the beads and the beads were re-suspended in 10 mL of 50 mM Tris, pH 7.4, by rotating for 10 min at 4° C. The process was repeated twice. After the last centrifugation step, the Tris solution was aspirated and 1 vol. of T E E N +1% Triton-X was added to the beads. The beads were stored at 4° C until further use. C. IP procedure All steps were done at 4° C. For the IP experiments 500 \iL of cell lysate was pre-cleared with 20 uL of protein A-Sepharose slurry. Samples were centrifuged at 5000 rpm for 2 min and the snt transferred to a fresh tube. The snt was incubated with primary Ab (see table above for cone of Ab used) overnight. Eighty \iL of bead slurry were added the next day and the samples rotated for 1 h. Beads were collected by centrifugation at 5000 rpm for 2 min. The beads were washed three times with the lysis buffer mentioned under cell lysis for two 50 min each. Beads were collected between washes by centrifugation at 5000 rpm for 2 min. The beads collected after the final wash were re-suspended in 50 u.L of SDS-sample loading buffer and boiled for three min to extract immunoprecipitated proteins. XIV. Western Blotting 1. M a t e r i a l P r o d u c t C o m p a n y ECL Western Blotting reagent Amersham C a t . N o . RPN2106 V8701302 RPN303C Kodak BioMax mR-1 Film Kodak/Amersham Hybond-C Nitrocellulose Amersham memb. Protein A-Sepharose Amersham 17-0780-01 2. M e t h o d Ten % polyacrylamide gels were prepared as described in a manual from BioRad. PAGE was performed at constant 30 mamp in the stacking gel and 36 mamp in the separating gel. Proteins were transferred to nitrocellulose membranes using the wet transfer method and the Bio Rad transfer system. After transfer, membranes were washed twice with TBS-t (25 mM Tris, 0.8% NaCl, 0.02% KC1, pH 7.6 and 0.05% TWEEN-20) for 10 min each. They were then incubated in blocking solution (6% milk in TBS-t) for 2 h at room temperature. Membranes were the rinsed three times with TBS-t and incubated with the specific primary Ab overnight at 4° C in TBS-t containing 1% BSA and 0.02% Na Azide. The membranes were washed three times for 10 min each and incubated with species specific horse-radish-peroxidase-linked secondary Abs for 1 h at room temp in TBS-t containing 1% BSA and 51 0.02% Na Azide. Membranes were again washed three times for 10 min each at room temperature. Membranes were finally incubated for two min at room temperature in E C L reagents and exposed to X-ray films in a dark room to visualize protein bands. Table 2: Antibodies used in Western Blotting Primary Abs (Cat. No.) Company Dilution used Host Actin (A 2066) Sigma 1 in 500 Rabbit GFP (83621-1) Clontech 1 in 1000 Mouse NR-1 (114011) Synaptic Systems 1 in 10,000 Mouse P K G LI Affinity purified custom made 1 in 200 Rabbit PKG I C T (KAP-PK005) StressGen 0.25 u.g/mL Rabbit PSD-95 (MA 1-046) ABR 1 in 2000 Mouse Synaptophysin (S5768) Sigma 1 in 400 Mouse VASP (ALX-804-177) Alexis Biochemicals 1 in 1000 Mouse Phospho S239 VASP (ALX- Alexis Biochemicals 1 in 1000 Mouse 804-240) Secondary Abs Company Dilution used Host Anti-Rabbit HRP (NA934V) Amersham 1 in 5000 Donkey Anti-Mouse HRP (NA93IV) Amersham 1 in 5000 Sheep 52 Results /. Generation and characterization of PKG II antibodies To characterize the distribution of P K G II protein in the brain and to study the subcellular distribution of PKG U, we raised a polyclonal antibody in rabbit against a 14 amino acid peptide corresponding to rat PKG LT sequence. The sequence is in the hinge region of PKG n . The hinge region was chosen as it exhibits the highest sequence divergence from PKG I. The sequence was also put through the B L A S T program on the NCBI web site to make sure there were no other similar sequences in the database. The exsanguination bleed was initially tested and affinity purified using sulpholink® columns (see Materials and Methods). The affinity purified antibody (PKG LT antibody) was used for further studies. 1. P K G II antibody detects FLwt P K G II but not 5'wt P K G II in HEK-293 cells. To test the specificity of P K G II antibody, we used transiently expressed F L P K G II, which contains the antibody recognition site, and the regulatory domain of P K G II (5'wt P K G II) in HEK-293 cells. For this study the F L PKG II tagged to GFP and 5'wt PKG H tagged to GFP were subcloned in the GW-1 vector and transfected into HEK-293 cells as described in Materials and Methods. HEK-293 cells were used because of their high transfection efficiency. On the one hand, as shown in Fig. 4, the P K G LT antibody detected only the F L P K G H GFP (-98 kD) and not the 5'wt P K G LT (-65 kD). On the other hand, a rabbit polyclonal GFP antibody detected both the bands as they are both tagged with GFP (See 53 Table 2 for antibody concentrations). The P K G LT antibody also detected a smaller band in Lane Two on the right panel in Fig. 4 (n=5). It is possible that this band corresponded to a cleaved form of PKG FL Previous studies on rat intestine have shown that the 86 kD P K G LT is cleaved to a protein of -72 kD (de Jonge, 1981; Jarchau et al., 1994) and the lower band shown in Fig. 4 corresponded to the size of -72 kD PKG LT. These results show that P K G II antibody recognized transfected F L wt P K G II. The results also indicate that HEK-293 cells probably do not express endogenous P K G II. 54 Figure 4: Aff ini ty purif ied antibody detects recombinant P K G II expressed i n H E K - 2 9 3 cells. Cells overexpressing GFP tagged regulatory domain (5 ' wt PKG U GFP) and FL PKG H (FL wt PKG LT GFP) were lysed and Western blot anaylysis was performed using rabbit polyclonal GFP antibodies (left panel) and affinity purified antibody against PKG II (right panel). PKG LT antibody recognizes only the FL wt PKG LT and not 5 ' wt P K G U , which does not have the antibody recognition site. In contrast, the GFP antibody detected both the recombinant proteins (n=3). MW (KD) 112 FL wt PKG II 86 70 5 5' wt PKG II Anti-GFP Anti-PKG II 55 2. Immunocytochemical detection of His-tagged P K G II catalytic domain (His-PKG II cat) protein in HEK-293 cells transfected with H i s - P K G II cat cDNA using affinity purified P K G II antibody. Next, we wanted to check if the PKG II antibodies can be used to immunocytochemically detect recombinant PKG II expressed in H E K cells. H E K cells were transfected with a His-tagged PKG II catalytic domain and immunocytochemistry was performed using the PKG II antibodies and D A B / A B C method. In this study we used just the catalytic domain, containing the P K G II antibody recognition site, to find out if the PKG II antibody can detect not only the full length, but also part of the P K G II molecule. The catalytic domain was tagged with hexa histidine to confirm the expression of the protein by a second method. PKG II antibodies stained H E K cells transfected with His-PKG II cat cDNA but not the vector alone (Fig. 5A; n=3). Stained cells showed cytoplasmic localization of the PKG II catalytic domain, although the catalytic domain of PKG II appeared to be slightly more concentrated in the perinuclear area. Western blotting was performed using histidine antibodies, and as shown in Fig 5C, a protein corresponding to the His-cat PKG II is detected only in lysates overexpressing the His-cat PKG II. These results demonstrate that the P K G II antibody can recognize recombinant PKG II both by Western blot and immunocytochemical methods. The results demonstrate that P K G II antibody can be used for immunocytochemistry. 56 Figure 5: Immunodetection of recombinant P K G II protein in HEK-293 cells transiently transfected with P K G II catalytic domain cDNA using D A B / A B C method. His-tagged P K G II catalytic domain expressing the last 366 amino acids of P K G II was transfected into H E K cells using lipofectamine reagent. 24 well plates were transfected with the vector alone (A) or with H i s - P K G II cat c D N A (Cell in B) . Cells were stained using the P K G II antibody. A s shown, staining was detected only in cells transfected with H i s - P K G II cat c D N A , but not the vector. Histidine antibodies were used to detect H i s - P K G II cat in lysates from H E K cells transfected with His-Cat P K G II (Fig. 5C right panel) and vector alone (Fig 5C left panel). There were no major bands detected in lysates from cells transfected with the vector alone (n=3). C / / MW xO s (KD) - JF ^ 112— 86— 70— 59— His-Cdt PKG II 57 3 . P K G II antibody detects a major band corresponding to P K G II in crude lysates from various brain regions. Although PKG II antibody recognized recombinant P K G II expressed in HEK-293 cells, we wanted to verify that P K G II antibody could also detect endogenous PKG II from brain lysates. PKG U antibody detected a major band ~86 kD corresponding to the size of P K G II in lysates from various brain regions. The band was detected in all regions tested except cerebellum (Fig. 6, n=3). PKG II expression appeared to be highest in cortex and striatum. PKG II was also detected in hippocampus, hypothalamus and thalamus. The 86 kD band was conspicuously absent from cerebellar lysate. These results corelated with the distribution of PKG IJ mRNA shown by situ hybridization by El-Husseini et.al. (el-Husseini et al., 1995). Actin antibodies were used on the same membrane to confirm equal amounts of protein were loaded in each lane. In order to compare the distribution of PKG II with PKG I, Western blotting was performed using PKG I antibodies on the same lysates. In contrast to PKG II, PKG I showed the highest expression in cerebellum. PKG I was also present in hypothalamus and weakly expressed in hippocampus and cortex. It was almost absent in thalamus and striatum. These data also agreed with previous studies on P K G I distribution, where it was shown to be expressed in the Purkinje cells of the cerebellum, the dorsomedial hypothalamus and hippocampus (Arancio et al., 2001; El-Husseini et al , 1999; Kleppisch et al , 1999; Lohmann et al., 1981). These results indicate that the P K G II antibody recognized endogenous P K G II in brain lysates and P K G II was widely distributed in the brain. 58 Figure 6: Western blot analysis of P K G II and P K G I expression i n various b ra in regions. Affinity purified P K G U antibody and a commercially available rabbit polyclonal P K G I antibody were used to detect the expression of PKG JJ and P K G I in various brain regions. PKG JJ is present in all the brain regions examined except cerebellum, where it is conspicuously absent. P K G JJ has the highest expression in Cortex, but is also highly expressed in striatum, hippocampus and thalamus. In contrast, PKG I had the highest expression in cerebellum followed by hypothalamus and weakly expressed in hippocampus and cortex and almost absent in striatum and thalamus. Actin antibodies were used to confirm equal amounts of protein were loaded in each well (n=3). MW / / / / / / (KD) 7 0 H PKG I 7 0 <—PKG I  < — Actin 39-59 4 . PKG II antibody immunoprecipitates a - 8 6 kD band from thalamic lysates and lysates of hippocampal neurons in culture. We also wanted to test if the PKG LT antibody could be used for immunoprecipitation. Thalamic lysates were used as there was high level of P K G II but no detectable P K G I protein. Lysates from hippocampal neurons in culture were also used to find out if there was any P K G II protein so that the hippocampal neurons can be used as a model to study PKG II function. The PKG II antibody immunoprecipitated a -86 kD band from thalamic lysates (Fig. 7A) and from lysates of 10 div and 15 div hippocampal neurons in culture (Fig. 7B). As a negative control P K G I antibody was used and it did not immunoprecipitate any proteins from thalamic lysates (Fig. 7A lane 1). When primary antibodies were omitted as a negative control in the immunoprecipitation experiment using lysates from hippocampal neurons in culture, no proteins were detected (Fig. 7B lane 1). P K G II antibody also detected a protein band corresponding to the size of PKG II from crude extracts of both 10 div and 15 div hippocampal neurons in culture. These results indicate that PKG II was present in hippocampal neurons in culture and that the PKG II antibody could be used for immunoprecipitation studies. 60 Figure 7: Immunoprecipitat ion of P K G II from rat thalamic lysates and lysates of hippocampal neurons i n culture. Affinity purified P K G II antibody was used for immunoprecipitation of P K G II from lysates of rat thalami (A) and 10 div and 15 div hippocampal neurons in culture (B). A single -86 kD band was immunoprecipitated. The band was also detected in the extracts. As a negative control, PKG I antibody (A left lane) was used or primary antibodies were omitted (B lane far left) (n=2). 61 5. Preincubation of PKG II antibody with the antigenic peptide abolishes staining in hippocampal neurons in culture. PKG II antibody appeared to work well in Western blotting applications, but we wanted to confirm the endogenous PKG II expression in hippocampal neurons in culture using immunocytochemistry. We also wanted to see if PKG II antibody staining could be inhibited by the peptide against which it was raised. PKG II antibody was used to stain 15 div hippocampal neurons in culture. Neurons were double stained with P K G II antibody and an antibody against the presynaptic marker protein, synaptophysin (Fig. 8A). Texas red conjugated mouse IgG and FTTC conjugated rabbit IgG secondary antibodies were used to detect the staining (See Table 1 for Ab concentrations). PKG II antibody stained both the cell body and processes. To test the specificity of the PKG II antibody, the antibody was preadsorbed with the peptide against which the antibody was raised (see Materials and Methods for detailed description of methods). The P K G II antibody peptide solution also containing synaptophysin antibody was used to stain hippocampal neurons in culture. As shown in Figure 8B, preadsorption of PKG II antibody with the peptide abolished the staining of PKG II, but left the synaptophysin staining intact. This indicates that the peptide specifically bound to PKG II antibody. These results indicate that the PKG II antibody specifically recognized PKG II. 62 Figure 8: Immunodetection of P K G II in hippocampal neurons i n culture and preadsorption of P K G II antibodies with the antigenic peptide. Affinity purified P K G II antibodies were used to detect endogenous P K G LT (A) in 15 div hippocampal neurons in culture. As a negative control P K G II antibodies were preadsorbed with the peptide (B) against which it was generated and that completely abolished the staining. Synaptophysin antibodies were also used to make sure that the peptide was specific in abolishing the staining by PKG II antibody and not synaptophysin antibody. PKG II antibody preincubated with antigenic peptide (Ab+peptide) (n=3). P K C ; II A b + pep — •;. ... f % Synaptophysii Synaptophysii Overlay Overlay 63 6. Immunodetection of P K G II in thalamic and cortical neurons in culture. As PKG II appeared to be present in the cortical and thalamic lysates, we wanted to check if the P K G LI antibody detected PKG LI in thalamic and cortical neurons in culture. PKG LI antibody was used to detect PKG II in thalamic and cortical neurons in culture. Texas red conjugated mouse IgG and FTTC conjugated rabbit IgG secondary antibodies were used to detect the staining. As shown in Fig. 7 PKG LT appeared to be present in the cell bodies of both thalamic (9A) and cortical (9B) neurons in culture. PKG LT was also present in the dendritic processes of thalamic neurons and partially co-localized with the presynaptic marker when double stained with synaptophysin antibody (Fig. 9C). P K G II also had a punctate distribution in the thalamic neuron processes suggestive of membrane targeting (Fig. 9C green). 64 Figure 9: Immunodetection of P K G II in thalamic and cortical neurons in culture. Affinity purified antibodies also detected P K G II in thalamic (A) and cortical (B) neurons in culture. It was present in both the cell body (A) and processes (C) of thalamic neurons in culture and appeared to partially co-localize (arrow heads in C) with the presynaptic marker synaptophysin (n=2). A | I B I PKG I I I PKG II c Synaptophysin 6 5 //. Subcellular distribution of PKG II in the brain and hippocampal neurons in culture. Although the general tissue distribution of PKG II is known, its subcellular distribution in neurons is poorly described. Numerous synaptic functions have been attributed to cGMP and PKG (see Introduction). However, there is no evidence for the presence of P K G II in the synapse so far. Wang and Robinson found at least three proteins in the peripheral membrane fractions from synaptosomes that were phosphorylated in a PKG specific manner (Wang and Robinson, 1995) and they suggested that PKG is likely to be present in the synapse. Hence we chose to investigate the subcellular distribution of PKG U in the brain and hippocampal neurons in culture to see if PKG U was targeted to the synapse. 1. P K G II is present in both the pre and postsynaptic fractions of adult rat brain subcellular fractions. Western blot analysis of adult rat brain subcellular fractions revealed that PKG II is predominantly expressed in the synaptic vesicle fraction (LP2) and small compartments (S2') containing small vesicles other than the vesicles in nerve endings (Fig. 10) (Huttner et al., 1983). PKG II was also present in the synaptosomal membrane fraction (LP1). P K G II appeared to be predominantly associated with membrane fractions and had a subcellular fractionation profile that partly overlaped with NR1, which is enriched in the postsynaptic density (PSD). PKG II was conspicuously absent from the presynaptic cytosol (LS2), again suggestive of membrane association. In fact PKG II has been shown to be membrane associated in intestinal brush borders and in HEK-293 cells (Jarchau et al., 1994). 66 To compare the subcellular distribution of PKG I with PKG n, we used P K G I antibodies on the same membranes. In contrast to PKG II, PKG I was very weakly expressed in all the synaptic fractions tested. The subcellular fractions were also immunoblotted with the synaptic markers NR1 (Ehlers et al., 1995) and synaptophysin to make sure that the fractions were clean and not contaminated with proteins belonging to a different fraction. Actin antibodies were used to confirm equal amounts of protein were loaded in the wells. These results indicated a membrane association and synaptic localization for P K G II. They also showed that P K G I and P K G II were enriched in different fractions leading to the hypothesis that most of the synaptic functions attributed to c G M P are likely to be mediated by P K G II and not P K G I. 67 Figure 10: Subcellular fractionation of P K G II in adult rat brain. Homogenate (H), small cell fragments (S2), small compartments (S2'), synaptosomal membrane fraction (LP1), presynaptic cytosol (LS2), synaptic vesicles (LP2). Subcellular fractions were prepared from 6 adult rat brains. PKG II appeared to be in the LP1 and LP2 fraction indicating a synaptic localization. In contrast P K G I was very weakly expressed in both the LP1 and LP2 fractions. Antibodies against NR1 and synaptophysin were used to make sure the fractions were not contaminated. Actin antibody was used to confirm equal amounts of proteins were loaded in each lane (n=3). PKG II (86kDa) PKG I (75kDa) NRI(118kDa) Synaptophysin (38kDa) Actin (42kDa) 68 3. PKG II is predominant in the synaptosomal membrane fraction in embryonic rat brain subcellular fractions. Western blot analysis of embryonic rat brain subcellular fractions revealed that PKG II was enriched in the synaptosomal membrane fraction (LP1) (Fig. 11). It appeared to be absent from the large debris and nuclei fraction (PI) and small cell fragments fraction (S2). P K G II had a profile similar to PSD-95, which is highly enriched in the PSD. PKG I by contrast was very weakly expressed in the synaptosomal membrane fraction (LP1), and was enriched in small cell fragments fraction (S2) just like in adult subcellular fractions. 69 Figure 11: Subcellular fractionation of rat embryonic brains. Whole brain homogenate (H), large debris and nuclei (PI), small cell fragments (S2), synaptosomal membrane fraction (LP1). Subcellular fractions were prepared from 15 PO rat pups. PKG II expression seems to be highest in the LP1 fraction and has a profile similar to that of PSD-95, a postsynaptic density enriched protein. PSD-95 antibody was used to make sure the fractions were clean. The membrane was blotted with actin antibody to make sure equal amounts of protein were loaded in each lane. The result shown is a representative of results from three different experiments (n=3). * <*N & \9 _ <—PKG II (86kDa) PKG I (75kDa) PSD-95 (95kDa) Actin (42kDa) 70 4. P K G II partially colocalizes with the presynaptic marker synaptophysin. We wanted to test if endogenous PKG II was targeted to synaptic sites in hippocampal neurons in culture. Hippocampal neurons were double labeled for P K G U and the presynaptic molecular marker synaptophysin (Fig. 12a top, middle and bottom). Texas red conjugated mouse IgG and FTTC conjugated rabbit IgG secondary antibodies were used to detect the staining. PKG II stained both the cell body (Fig. 8A) and dendritic processes (Fig. 12b top panel) in hippocamapal neurons. P K G II was present in the perinuclear area in the cell body (Fig. 8A top panel). The PKG II and synaptophysin merged pictures (Fig. 12a, b and c bottom panels) showed that P K G II and synaptophysin partially co-localize in hippocampal neurons. A magnified portion of Fig. 12b is shown in Fig. 12c. At higher magnification (Fig. 12c) a slight shift in fluorescence is observed, which was indicative of the proteins located at opposite sides of the synapse. As synaptophysin is a presynaptic marker, PKG II appeared to be on the postsynaptic side. 71 Figure 12: Immunocytochemical localization of P K G II and the presynaptic marker synaptophysin in hippocampal neurons in culture. Endogenous PKG JJ and synaptophysin were double labeled using affinity purified rabbit PKG JJ antibody (a top) and mouse synaptophysin antibody (a middle) and merged (a bottom). The right panel [b top (PKG JJ, b middle (synaptophysin) and b bottom (merged)] shows a magnified process. A further magnification of a portion of the process is shown in c top (PKG II), c middle (synaptophysin) and c bottom (merged), (n=4). w PKG II >• Synaptophysir % « Overlay 7 2 5. P K G II partially co-localizes with the postsynaptic molecular marker PSD-95. Based on the results obtained from the study above, we wanted to test if P K G LT co-localized with the postsynaptic marker PSD-95 in hippocampal neurons in culture. Hippocampal neurons were double labeled with P K G II and the postsynaptic molecular marker PSD-95 antibodies (Fig. 13a top, middle and bottom). Texas red conjugated mouse IgG and FITC conjugated rabbit IgG secondary antibodies were used to detect the staining. The P K G II and PSD-95 merged pictures (Fig. 13a and 13b bottom panels) shows that PKG LI and PSD-95 partially co-localize in hippocampal neurons. At higher magnification (13b bottom panel) no shift in fluorescence was observed, which indicated that the proteins are localized in the same compartment. This indicates that PKG LT targets to the postsynaptic side in hippocampal neurons in culture. These results show that endogenous P K G II was targeted to synaptic sites in hippocampal neurons in culture. 73 Figure 13: Immunocytochemical localization of P K G II and the postsynaptic marker PSD-95 in hippocampal neurons in culture. Endogenous P K G II and PSD-95 were double labeled using affinity purified rabbit P K G II antibody (a top) and mouse PSD-95 antibody (a mid.) and merged (a bottom). The right panel [b top (PKG II), middle (PSD-95), bottom (merged)] shows a magnifed process (n=4). 74 //. N-Myristoylation is important for proper targeting of PKG II in COS-1 cells, HEK-293 cells and hippocampal neurons in culture. de Jonge first showed that PKG II activity is mainly present in the particulate fraction in the intestinal brush borders (de Jonge, 1981). On the one hand, N-myr has been shown to be important for targeting of rat PKG II to membranes in COS-1 cells and intestinal epithelial cells (Vaandrager et al., 1996; Vaandrager et al., 1998). The mouse P K G IJ isoform, on the other hand, when expressed in COS-1 cells appeared to be localized mostly (98%) in the cytosol (Uhler, 1993). However, all of these localization data were based on measurements of kinase activity and Western blotting rather than immunocytochemistry. We constructed various P K G JJ GFP fusion proteins including F L P K G JJ G2A mutant, which has been shown to be non-myristoylated (Vaandrager et al., 1996), 5' P K G JJ G2A mutant (regulatory domain of PKG JJ that is non-myristoylated) and 5'wt PKG JJ (regulatory domain of wt PKG U) (See Materials and Methods for details on generation of constructs) to test the importance of N-myr in targeting of PKG JJ in COS-1 cells, HEK-293 cells and hippocampal neurons in culture. 1. N-myr is important for targeting of P K G II to membranes and probable Golgi compartments in COS-1 cells. COS-1 cells were transfected with FLwt PKG H and FL PKG JJ G2A mutant using lipofectamine reagent. Cells were fixed 24 h post transfection with 2% PFA and stained with rabbit GFP antibody and Alexa Fluor 488 anti-rabbit IgG secondary antibody to visualize the recombinant proteins. As shown in Fig. 14A left panel FLwt PKG JJ was localized predominantly in the perinuclear region in what appeared to be Golgi apparatus. FLwt P K G 75 II also localizes to the membrane and tips of filopodia like structures. By contrast, F L P K G II G2A mutant was diffuse (Fig. 14A right panel) and did not show any membrane localization or concentration in the perinuclear region, thus confirming that N-myr is important for membrane localization of PKG II in COS-1 cells. We did not observe nuclear localization of the recombinant P K G II proteins in COS cells. 76 Figure 14: Immunocytochemical localization of FLwt P K G II G F P and F L P K G II G2A mutant G F P in COS-1 cells. FLwt PKG II and F L PKG U G 2 A mutant were transfected into COS-1 cells with lipofectamine reagent. Cells were fixed with 2 % PFA and stained with rabbit GFP antibodies and corresponding fluorescent secondary antibodies. Expressions of FLwt PKG II GFP (A) and FL PKG II G 2 A mutant (B) in COS-1 cells (A) are shown. Arrows in A indicate membranous staining and arrowheads show concentration of the protein in tips of filopodia like structures. At least 2 0 cells from each transfection category from two different batches of transfection were analysed. 77 2. N-myr is important for targeting of P K G II to membranes and probable focal adhesion points in HEK-293 cells. We also wanted to test the localization of the various PKG II recombinant proteins in HEK-293 cells in order to gain more insight into the functions of different structural regions of PKG H. 5'wt PKG II GFP (a), 5'PKG II G2A (b), FLwt P K G H GFP (c), F L P K G II G2A mutant (d) and GFP expressing vector alone (e), were all transiently transfected into HEK-293 cells using lipofectamine reagent. Cells were fixed 24 hours post transfection using 2% PFA and stained with rabbit GFP antibody and Alexa Fluor 488 anti-rabbit IgG secondary antibody to visualize the recombinant proteins. Both 5'wt PKG II and FLwt PKG II were concentrated in the perinuclear area, just as observed for FLwt P K G II in COS-1 cells, and also appeared to be targeted to the membrane (Fig. 15 a&e). The myristoylated forms are also concentrated at the distal ends of filopodia like structures. What was also striking was that the 5'wt PKG II transfected cells (Fig. 15 b) appeared to have more filopodia like structures than the FLwt P K G II (Fig. 14 e) or the non-myristoylated P K G II proteins (Fig. 15 c,d, and f) and also appeared to be localized in probable focal adhesion points (Fig. 15b). The non-myristoylated forms [5' PKG II G2A mutant (Fig. 15 c&d) and F L PKG E G2A mutant (Fig. 15 f)] and GFP (Fig. 15 g) had a much more diffuse localization. As in COS-1 cells, we did not observe any nuclear translocation of any of the P K G II recombinant proteins. There was no nuclear staining detected even when just the catalytic domain of P K G II was expressed in H E K cells (Fig. 5). This indicates that the catalytic domain does not translocate into the nucleus, unlike the PKG I catalytic domain, which has been shown to translocate into the nucleus in the absence of the N-terminus (Browning et al., 2001). This also indicates that the catalytic domain alone is unlikely to play a role in targeting of PKG II. 78 3. N-myr is important for targeting of PKG II to membranes and probable Golgi compartments in hippocampal neurons in culture. Hippocampal neurons (10 div) were transfected with FLwt PKG LI and F L P K G LT G2A mutant using effectene reagent. Cells were fixed 15 div with 100% methanol and stained with rabbit GFP antibody and Alexa Fluor 488 anti-rabbit IgG secondary antibody to visualize the recombinant proteins. Fig. 16a shows that FLwt PKG II was localized predominantly in the perinuclear region, just like in COS-1 and HEK-293 cells. In contrast F L P K G II G2A mutant has a much more diffuse localization in the cell body of hippocampal neurons in culture (Fig. 16b). In the dendrite FLwt PKG LT has a punctate distribution, which is consistent with membrane association (Fig. 16c). F L PKG LT G2A mutant is diffusely localized even in the dendrites (Fig. 16d). Neither did we observe nuclear localization of the recombinant PKG II proteins in hippocampal neurons. These results indicate that N-myr is important for targeting of PKG II to the membrane and other subcellular sites in COS-1 cells, HEK cells and hippocampal neurons in culture. 79 Figure 15: Immunocytochemical localization of various recombinant P K G II proteins and G F P in HEK-293 cells. HEK-293 cells were transfected with various PKG II GFP constructs using Lipofectamine reagent. Cells were fixed 24 hours post transfection with 2% PFA and stained with rabbit GFP antibodies and corresponding fluorescent secondary antibodies. 5'wt P K G LT transfected cells (a) show concentration of proteins in possible focal adhesion points and filopodia like structures. Fig. 15b shows a magnified portion of a. Arrowheads in b indicate concentration of protein in possible focal adhesion points and filopodia like structures. Fl wt PKG II also appears to concentrate in filopodia like structures (arrowheads in e). However the non-myristoylated P K G II mutants, 5' PKG H G2A mutant (Fig. 15 c&d), F L P K G II G2A mutant (Fig. 15 f) and GFP (Fig. 15 g) have a much more diffuse localization (Fig. 15 c, d, f and g). 20 cells from each transfection category from two different batches were analysed. 80 Figure 16: Immunocytochemical localization of FLwt P K G II G F P and F L P K G II G2A mutant G F P in hippocampal neurons in culture. Expression of FLwt PKG H GFP (a) and FL PKG II G2A mutant (b) in the cell body of hippocampal neurons in culture and a magnified process in hippocampal neurons in culture (c and d) is shown. Arrows in c indicate membranous staining and arrowheads shows concentration of the protein in tips of spine like structures. At least 1 0 cells of each transfection category from two different batches of transfection were analysed. F L P K G II G 2 A mut F L wt P K G II 81 3. N-myr appears to be important for synaptic targeting of P K G II G F P in hippocampal neurons in culture. Based on the punctate localization of FLwt P K G LT in hippocampal neurons in culture, we wanted to test if any of these puncta corresponded to synaptic sites and if myristoylation was important for targeting of FLwt PKG LT to synaptic sites in hippocampal neurons in culture. Ten div hippocampal neurons in culture were transfected with FLwt PKG IT and F L PKG LT G2A mutant using effectene reagent. Cells were fixed 15 div with 100% methanol and double stained with a mouse GFP antibody and rabbit synaptophysin antibody. FTTC conjugated anti-mouse IgG and Texas-red conjugated anti-rabbit IgG secondary antibodies were used to visualize the recombinant proteins. Fig. 17 shows a dendritic process of a hippocampal neuron in culture overexpressing FLwt P K G II GFP (Fig. ,17a left panel) and F L P K G II G2A mutant GFP (Fig. 17a top right panel, endogenous synaptophysin (Fig. 17b right and left panel) and the merged images (Fig. 17c right and left panel). A portion of this dendritic branch is magnified in Fig. 18. It is clear that FLwt PKG II had a punctate distribution (Fig. 17a left panel) and some of these puncta partially co-localized with the presynaptic molecular marker synaptophysin (Fig. 18c right panel), indicating that these were synaptic sites. F L P K G II G2A mutant by contrast had a diffuse distribution along the dendrite (Fig. 18a right panel) and there was no apparent concentration of the F L PKG LT G2A mut protein at synaptic sites as shown by synaptophysin staining (Fig. 18c right panel). This demonstrated that N-myr is important for targeting FLwt P K G II to synaptic sites in hippocampal neurons. 82 Figure 17: Myristoylation is important for synaptic targeting of F L P K G II G F P in hippocampal neurons in culture. Hippocampal neurons (10 div) were transfected with FLwt P K G II GFP and F L P K G IIG2A mutant GFP using Effectene reagent. Cells were fixed 15 div with methanol and double stained with rabbit anti-GFP and mouse anti-synaptophysin and corresponding fluorescent secondary antibodies. Arrowheads indicate synaptic contacts. At least 10 cells of each transfection category from two different batches of transfection were analysed. a > FLwt PKG II 1 - , FL PKG II G2Amut b S y n a p t o p h y s i n * « *. S y n a p t o p h y s i n C % % * 0 O v e r l a y * O v e r l a y 83 Figure 18: Myristoylation is important for synaptic targeting of F L P K G II G F P in hippocampal neurons in culture. A high magnification of a dendritic process is shown. FLwt P K G II has a punctate distribution (a left panel) as compared to the diffuse distribution of F L P K G II G2A mutant. FLwt PKG II appears to be concentrated at synaptic sites (c left panel) as compared to FL PKG LI G2A mutant protein (c right panel). FL PKG II is clearly clustered at sites where there is synaptophysin staining. Such an accumulation of FL P K G II G2A mutant is not observed. 84 IV. Function of PKG II in hippocampal neurons. 1. 5'wt PKG II inhibits endogenous PKG I activitiy in HEK-293 cells. Recently a novel splice variant of PKG LT (PKG II A 4 4 1 " 4 6 9 ) lacking 2 9 amino acids of the PKG LT Mg-ATP binding/catalytic domain was discovered (Gambaryan et al., 2002) . Gambaryan et al. showed that this isoform of P K G LT does not have intrinsic enzymatic activity itself, but can antagonize PKG II and PKG I but not PKA activity. This is the first evidence for the presence of an endogenous inhibitor of PKG II. Thus PKG LT function can not only be regulated by cGMP levels, but also by this novel splice isoform, which has been shown to act as a dominat negative. We wanted to first test if our P K G II deletion mutant 5'wt PKG LT can inhibit endogenous PKG I activity in H E K cells, like the splice isoform of PKG II as previously shown by Gambaryan et al. using PKG II A 4 4 1 " 4 6 9 (Gambaryan et al., 2002) . VAsodilator Stimulated Phospho-Protein (VASP), which has been shown to be a PKG substrate, was used in the phosphorylation studies. We co-transfected H E K cells with either GFP and human VASP or 5'wt PKG II GFP and human VASP. Twenty four hours post-transfection cells were treated with 8Br-cGMP for 15 min. Cells were lysed and SDS-PAGE was performed followed by Western blotting using a phospho-Ser239 VASP specific antibody, which detects VASP phosphorylated on Ser 2 3 9, which is the preferred site of phosphorylation for PKG. As shown in figure 19b (n=4) there is a clear reduction in the Ser 2 3 9 phosphorylated VASP in cells overexpressing 5'wt PKG II as compared to cells expressing GFP. Fig. 19a shows that GFP and 5'wt P K G II GFP proteins were expressed. A monoclonal antibody that detects 85 phosphorylated and non-phosphorylated VASP was used to make sure that equal amounts of VASP proteins were loaded (Fig. 19c). Finally in order to detect endogenous PKG I, a PKG I specific antibody was used to confirm PKG I was expressed in H E K cells. Gambaryan et al. previously showed that PKG JJ A 4 4 1 " 4 6 9 markedly inhibited the activity of wt P K G U and PKG I in NJJJ-3T3 cells stably transfected with wt PKG JJ and wt P K G I, respectively (Gambaryan et al., 2002). We have shown that the regulatory domain of P K G JI when expressed alone, like PKG JI A 4 4 1 " 4 6 9 , can inhibit endogenous PKG I activity in HEK-cells. Based on this data and the study by Gambaryan et al., it is plausible to assume that overexpressing 5'wt PKG II GFP in cells expressing P K G JI would inhibit the endogenous PKG JI activity as well. We thus wanted to use the 5'wt PKG II construct as a possible dominant negative in hippocampal neurons to study the function of P K G JJ. 8 6 Figure 19: wt regulatory domain of P K G II reduces phosphorylation of V A S P i n H E K -293 cells. HEK-293 cells were transfected with either 5'wt PKG II GFP and human VASP or GFP and human VASP using lipofectamine reagent. VASP was used for assessing its phosphorylation as a measure of PKG LT activity. Twenty four hours post transfection cells were treated with 50 u.M 8-Br cGMP. Cells were lysed and Western blotting was performed using GFP antibodies (a), phospho-Ser239 VASP antibody that detects only the Serine 239 phosphorylated form of VASP (b), mouse monoclonal VASP antibody (c) and PKG I antibody (d). There is a clear reduction in Ser 2 3 9 phosphorylated form of VASP upon 8-Br cGMP treatment in wt regulatory domain expressing cells (b right panel) as compared to GFP expressing cells (b left panel), (n=3). 87 2. Hippocampal neurons as a model for studying P K G II function. Hippocampus has been one of the best models for studying plasticity in the brain. Both forms of synaptic plasticity, LTP and LTD, have been extensively studied in both hippocampal slices and hippocampal neurons in culture. There is considerable evidence supporting the role of the NO/cGMP/PKG pathway in LTP and L T D in the hippocampus. We have also shown in this study that PKG II is present endogenously in hippocampal neurons in culture and also localizes to synaptic sites. Hence we chose to use hippocampal neurons in culture as a model for studying the function of P K G II. Most of the studies implicating a role for PKG II in neuronal function (see Introduction) were done using a selective PKG inhibitor such as KT-5823. However, it was recently shown that KT-5823 did not inhibit PKG in a standard protein kinase assay (Bain et al., 2003). Bain et al also showed that KT-5823 inhibited PRAK and GSK 3(3 in vitro by 50% at a concentration of 10 u.M. There was also another report that indicated that KT-5823 does not inhibit P K G in intact human platelets or mesangial cells (Burkhardt et al., 2000). Based on these studies it appears that KT-5823 is not a very selective PKG inhibitor. To avoid any discrepancy due to possible cross reactivity of PKG inhibitors, we chose to study the function of PKG II by overexpressing a dominant negative form of PKG II in hippocampal neurons instead of using the commercially available PKG inhibitors. We wanted to find "loss of function" phenotypes in cultured hippocampal neurons transfected with just the regulatory domain of PKG II (5'wt PKG II), which is a possible dominant negative form of P K G n . 88 3. Overexpression of regulatory domain of P K G II in 10 div hippocampal neurons caused a 2.5-fold increase in filopodia-like structures compared to G F P overexpressing neurons. Neurons transfected with 5'wt PKG II GFP (Fig. 20b, 21) showed a striking increase in density of filopodia compared to control GFP transfected neurons (Fig. 20a, Fig. 21). In contrast the FLwt PKG E (Fig. 20c) and the non-myristoylated forms of PKG E , 5'PKG E G2A mutant (Fig. 20d) and FL PKG E G2A mutant (Fig. 20e) had similar number of filopodia as GFP overexpressing cells (Fig. 21). To visualize the entire cell we co-transfected the PKG E constructs with an RFP construct (Fig. 24). Fig. 24 shows that the fewer filopodia seen in FLwt P K G E and the non-myristoylated PKG E overexpressing cells is not due to improper targeting of the recombinant proteins and lack of visualization of the dendritic protrusions. This also indicated that N-myr is important for the regulatory domain of PKG II to cause an increase in number of filopodia as the non-myristoylated regulatory domain did not show an increase in density of filopodia. 89 Figure 20: Exogenous P K G II regulatory domain led to a 2.5-fold increase in number of filopodia in 10 div hippocampal neurons in culture. Six div hippocampal neurons were transfected with various P K G I I constructs and stained for G F P at 10 div. Examples of dendrites transfected with G F P (a), wt regulatory domain of P K G II (b), F L wt (c), non-myristoylatted regulatory domain (d) and non-myristoylated F L P K G II (e) are shown. As shown, there was a dramatic increase in filopodial processes in the wt regulatory domain transfected cells. Atleast 15 cells in each transfection category from three different batches were analysed. Dendritic protrusions on every dendrite of each cell were counted. 5' PKG II G2A mut 90 Figure 21: Exogenous P K G II regulatory domain led to a 2.5-fold increase in number of filopodia in 10 div hippocampal neurons in culture. Data analysis was performed using Northern Eclipse program (see details in Materials and Methods). Number of protrusions from the dendrites were counted and automatically logged into Microsoft Excel. Error bars represent standard deviation. 5'wt PKG II overexpressing cells show a significant increase in density of filopodia (p<0.0008). Filopodia density in 10 div PKG II transfected neurons • 5'wt • FLwt - •FLG2Amut . •5'G2Amut • GFP 91 4. Overexpression of regulatory domain of P K G II in 15 div hippocampal neurons caused a 2-fold increase in spine like structures compared to G F P overexpressing neurons. Based on the data obtained from the previous study, we wanted to assess if the increase in filopodia translated to increase in spines in older cultures. Neurons transfected with 5'wt PKG II GFP (Fig. 22b, 23) showed a striking increase in density of spine-like structures compared to control GFP transfected neurons (Fig.22a, Fig. 23). In contrast, the FLwt P K G II (Fig. 22c) and the non-myristoylated forms of PKG H, 5'PKG II G2A mutant (Fig. 22d) and F L P K G II G2A mutant (Fig. 22e), had a similar number of spine-like structures as GFP overexpressing cells (Fig. 23). As shown in Fig. 17 and 18, N-myr is important for proper targeting of PKG II to membranes and synaptic sites. As in the case of 10 div hippocampal neurons, N-myr appears to be important for the regulatory domain of P K G II to cause an increase in number of spine-like structures as the non-myristoylated regulatory domain did not show an increase in density of spine like structures. 92 Figure 22: Exogenous P K G II regulatory domain led to a 2-fold increase in number of spine-like structures in 15 div hippocampal neurons in culture. Ten div hippocampal neurons were transfected with various P K G II constructs and stained for GFP at 15 div. Examples of dendrites transfected with GFP (a), wt regulatory domain of PKG JI (b), FL wt (c), non-myristoylatted regulatory domain (d) and non-myristoylated FL PKG II (e) are shown. As shown, there was a drastic increase in spine like structures in the wt regulatory domain transfected cells. Atleast 15 cells in each transfection category from three different batches were analysed. Dendritic protrusions on every dendrite of each cell were counted. 93 Figure 23: Exogenous PKG II regulatory domain led to a 2-fold increase in number of spine-like structures in 15 div hippocampal neurons in culture. Data analysis was performed using Northern Eclipse program (see details in materials and methods). Number of protrusions from the dendrites were counted and automatically logged into Microsoft Excel. Error bars represent standard deviation. As in the case of 10 div 5'wt P K G U overexpressing cells show a significant increase in density of spine-like structures (p<0.0001). Spine/Filopodia density in 15 div PKG II transfected neurons T ^ ^  I JI • 5'wt • FLwt • FLG2Amut • 5'G2Amut • GFP 94 Figure 24: Hippocampal neurons transfected wi th non-myristoylated forms of P K G II do not show an increase i n density of filopodia/spines. Six div hippocampal neurons were co-transfected with various P K G II constructs and RFP and fixed with 2% PFA at 10 div. Examples of dendrites transfected with wt regulatory domain of PKG II, F L wt, non-myristoylated regulatory domain and non-myristoylated FL PKG II (Panel A), RFP (Panel B) and merged images (Panel C) are shown. As shown, there is drastic increase in filopodial processes in the wt regulatory domain transfected cells and not in non-myristoylated forms or F L wt P K G II transfected neurons. Atleast 10 cells in each category from two different batches were analysed. 95 5. Most of the dendritic protrusions in the wt regulatory domain P K G II transfected neurons appear to be synaptic. To find out if the dendritic protrusions might correspond to synaptic sites, we co-stained hippocampal neurons transfected with 5'wt P K G II with GFP and synaptophysin antibodies (Fig. 25A) or GFP and PSD-95 antibodies (Fig. 25B). Fig 25C shows that more than 90% of the dendritic protrusions in the 5'wt PKG II overexpressing cells co-localized with both the presynaptic marker synaptophysin and the postsynaptic marker PSD-95. This shows that there was an increase in synaptic contacts in the PKG II dominant negative overexpressing neurons and most of the increase in filopodia seen during 10 div appeared to go on to become spines. 96 Figure 25: Dendritic protrusions in wt regulatory domain transfected cells co-localized with the presynaptic marker synaptophysin and the postsynaptic marker PSD-95. Ten div hippocampal neurons were transfected with wt regulatory domain of P K G II construct and stained for G F P , synaptophysin (A) and PSD-95 (B) at 15 div. Most of the protrusions from the dendrite of a 5'wt P K G II overexpressing cell co-localize with the synaptic markers, indicating that they are most likely to be functional synapses. Atleast 10 cells in each category from two different batches were analysed. 5' wt P K G II Synaptophysin Overlay i PSD-95 Overlay Synaptic contacts on spines/filopodia of 5'wt PKG II transfected HN neurons 45 -]— 40 35 30 25 20 15 10 5 0 I spines/fi lopodia I spines/fi lopodia with synaptic contacts 97 6. There was a corresponding increase in density of synaptophysin puncta in 5'wt PKG II overexpressing hippocampal neurons. As most of the spine like structures in the 5'wt P K G LI overexpressing neurons co-localized with the synaptic markers, we also wanted to analyze if there was a corresponding increase in the presynaptic marker synaptophysin puncta. Fig. 26 shows that this is the case as there is a 2-fold increase in synaptophysin puncta in 5'wt P K G II overexpressing neurons. This indicates that the increase in filopodia translates to probable functional synapses. 7. Overexpression of human form of VASP had no effect on morphology of hippocampal neurons and does not show an increase in density of synaptic contacts. Cell crawling is an important phenomenon that drives processes such as morphogenesis and metastasis. Cell locomotion is associated with actin polymerization (Mogilner and Oster, 1996; Mogilner and Oster, 2003). The increase in density of spines and filopodia like structures has also been shown to involve actin polymerization (Fischer et al., 1998). A recent model for cell motility suggests a possible motor-like mechanism based on the modulated binding interaction between actin filaments and Vasodialor stimulated phosphoprotein (VASP), which is fueled by hydrolysis of actin-bound ATP (Dickinson and Purich, 2002).. VASP is a well known P K G substrate (Waldmann et al., 1986), that induces polymerization of G-actin into F-actin bundles in in vitro assays and it is thought to stabilize F-actin in a phosphorylation dependent manner (Laurent et al., 1999). Excess of VASP results in long, unbranched filaments in fibroblasts (Bear et al., 2002). VASP has been shown to be expressed in neonatal brain but not in adult brain and has been implicated to play a role in development (Gambaryan et al., 2001). We wanted to test if overexpression of 98 VASP could lead to an increase in filopodia in neurons. Human VASP construct (gift from Dr. Ulrich Walter) was transfected into 10 div hippocampal neurons using Effectene reagent. Cells were fixed 4-5 days later with 100 % methanol and visualized using a monoclonal antibody against VASP. Cells were also stained with the presynaptic marker protein synaptophysin to find out if there is an increase in number of synaptic contacts on VASP overexpressing cells. Phosphorylation of VASP has been shown to negatively regulate actin polymerization (Harbeck et al., 2000; Walders-Harbeck et al., 2002). As VASP is a substrate of PKG, we treated cells for 4-5 days with 100 \iM of the PKG selective activator 8Br-cGMP to see if phosphorylation of VASP by endogenous PKG U has any effect on the morphology of neurons. As shown in Fig. 27, there was no apparent increase in density of synaptic contacts, as shown by synaptophysin puncta, in untreated VASP overexpressing cells (Fig. 27A, 27C) when compared to GFP overexpressing cells (Fig. 27C) or VASP overexpressing cells treated with 8Br-cGMP (Fig. 27 B, 27C). 99 Figure 26: There is a 2-fold increase in synaptophysin puncta in 5'wt P K G II overexpressing neurons. Ten div hippocampal neurons were transfected with various P K G II constructs and stained for GFP and synaptophysin at 15 div. Length of dendrites was manually traced and number of synaptophysin puncta on dendrites were manually counted and entered into Microsoft Excel. Error bars represent standard deviation. As in the case of 15 div 5'wt P K G II overexpressing cells show a significant increase in desity of synaptophysin puncta (p<0.0001). Atleast 10 cells in each category from two different batches were analysed. A FL PKG II G2A mut Density of Synaptophysin puncta In PKG II transfected HN neurons 100 Figure 27: Overexpression of human V A S P in neurons did not show an increase in density of synaptophysin puncta. Human VASP or GFP constructs were transfected into hippocampal neurons on 10 div using Effectene reagent and fixed 15 div using 100% methanol. VASP overexpressing neurons were either untreated or treated with 8Br-cGMP for four days. There is no apparent increase in density of synaptophysin puncta in untreated VASP overexpressing neurons (Fig. 26 A & C) when compared to either GFP (Fig. 26 C) or VASP overexpressing neurons treated with 8Br-cGMP (Fig. 26 B & C). Error bars represent standard deviation. Results are a representation of four different expreriments. Atleast 10 cells in each category from two different batches were analysed. 101 102 c Density of Synaptophysin puncta in VASP transfected HN neurons • VASPwt No treat • VASPwt 8Br-cGMP • G F P 1 103 Discussion P K G is the major downstream effector of the N O / c G M P and natriuretic peptides/cGMP pathway. Recent evidence indicates that P K G mediates a number of neuronal effects of c G M P , but how it brings about its effect is still unclear. O f the three P K G isoforms known so far, P K G II is much more widely distributed than P K G l a and P K G ip . Although the distribution of P K G II in various brain regions is known, the subcellular localization of P K G II and the regions of P K G U protein responsible for its subcellular localization in the brain are poorly understood. In spite of the widespread expression of P K G n, its function in the brain is still unknown. This thesis involved characterization of a PKG II specific antibody, examination of the subcellular distribution of PKG II in the brain, evaluation of the importance of N-myr in the subcellular distribution of PKG II, and investigation of possible role for PKG II in synaptogenesis. /. Characterization of PKG II antibody. A polyclonal antibody against P K G U was raised using a 13 amino acid peptide corresponding to the hinge region of the rat P K G n sequence. The hinge region, between the second c G M P binding site and the start of the M g - A T P binding site, exhibits the highest sequence divergence from the other P K G isoforms. Hence, this region was used to raise an antibody as it is most l ikely to be specific to P K G n. 104 1. Antibody specificity The specificity of the antibody was tested in a number of different ways. The P K G II antibody recognized only the FLwt P K G II recombinant protein expressed in H E K - 2 9 3 cells and not the regulatory domain of P K G U (5'wt P K G II), which lacks the antibody recognition site. H E K - 2 9 3 cells expressed P K G I (Fig. 19d). However, our P K G II antibody did not recognize any band in untransfected or 5'wt P K G II expressing H E K - 2 9 3 cell lysates, which indicated that the P K G II antibody did not crossreact with P K G I. The affinity purified antibodies immunoprecipitated a major band of -86 k D in brain lysates and lysates from hippocampal neurons in culture. When these antibodies were omitted or a P K G I specific antibody was used, no bands were detected in the immunoprecipitation studies. P K G II antibody stains hippocampal, cortical and thalamic neurons in culture and this staining was abolished when the antibody was preadsorbed with the peptide against which it was raised prior to performing irnmunocytochemistry. 2. Distribution of PKG II in the brain and comparison with other PKG II localization studies. Western blot analysis using the P K G II antibody revealed a -86 k D band in the lysates of cortex, hippocampus, hypothalamus, striatum and thalamus. N o such band was detected in cerebellar lysates. Our results of high P K G II expression in the rat brain was in agreement with the P K G II m R N A distribution study by El-Husseini et al. (el-Husseini et al., 1995; E l -Husseini et al., 1999) and other reports of high levels of P K G II in the rat and mouse brain (Jarchau et al., 1994; Lohmann et al., 1997; Uhler, 1993). El-Husseini et al. reported very 105 low levels of P K G II m R N A in cerebellum which correlated with our Western blotting analysis of cerbellar lysates using P K G II antibody, where we did not detect any bands. Others have shown low levels of P K G II in the cerebellum by Western blotting analysis. However, they detected much stronger immunocytochemical P K G U staining in the cerebellum (de Vente et al., 2001). El-Husseini et a l , showed low levels of P K G II m R N A in striatum and hippocampus and highest levels in the thalamus. But our study using P K G II antibody detected highest levels of P K G U protein in the cortex and striatum and high levels of P K G It protein in the hippocampus and thalamus, which does not coincide with the study by El-Husseini et al. A n earlier report, however, indicated the presence of P K G in the medium spiny neurons (Ariano, 1983) and de Vente et al. reported the presence of P K G n in the striatum (de Vente et al., 2001). de Vente et al. did not find that the cell bodies were stained in the striatum. Striatum receives input from midline thalamic nuclei and the subthalamic nucleus, which express high levels of P K G n. Our results of high P K G II expression in the striatum could be partially explained by the probable presence of P K G II in the nerve terminals of these inputs, de Vente et al. reported low levels of P K G U in the hippocampus. Hippocampus receives input from the cortex, which has high levels of P K G II and again it is tempting to speculate that the high protein expression observed in the hippocampus in this study could be partly due to the protein present in the nerve terminals of cortical inputs. Our P K G II antibody stains hippocampal neurons in culture and P K G II appears to be present in both the cell body and dendritic processes and de Vente et al. also reported P K G II staining in some pyramidal neurons. On the one hand de Vente et al. rarely detected cell body staining in thalamic and subthalamic nuclei. Our results on the other hand show the presence of P K G II in the cell body and dendrites of thalamic neurons in culture. It 106 is unclear as to why this difference in staining was observed. Overall, the widespread distribution of P K G LT in the brain is undisputed. Compared to P K G LT, P K G I is highly expressed in the cerebellum, moderately expressed in the hypothalamus and very weakly expressed in the hippocampus and cortex. However, Arancio et al. showed that P K G I is highly expressed in the hippocampus and showed the presence of P K G I and not P K G LT in hippocampal neurons in culture (Arancio et a l , 2001). Using our P K G LT antibody we found a high expression of P K G LT in hippocampal neurons in culture, both in the cell body and dendritic processes. This discrepancy could be partially explained due to differences in affinities of antibodies used. Based on these studies and studies mentioned above, it is clear that P K G II is highly expressed in the brain and has a much wider distribution in the brain than P K G I. This indicates that P K G II is most likely to be the downstream mediator of c G M P actions in the brain. A role for c G M P and P K G has been shown at nerve terminals {Akamatsu, 1993 #302;Sistiaga, 1997 #304;Gray, 1999 #303}, but the localization of P K G I and LT in the synapses has still not been demonstrated. Next we used our P K G LT specific antibody to study the subcelluar distribution of P K G II in the rat brain subcellular fractions and hippocamapal neurons in culture. //. Subcellular distribution of PKG II de Vente et al. showed that P K G II was localized more in the processes than in the cell body (de Vente et al., 2001). However, they could not conclusively show the localization of P K G 107 n at nerve terminals. W e chose to study the subcellular distribution of P K G II using the P K G II antibody on subcellular fractions of rat brain and hippocampal neurons in culture. We found that P K G JJ was highly concentrated in the synaptic vesicle fraction and we found it in high levels in the synaptosomal membrane fraction which contains the postsynaptic density (PSD) in adult brain subcellular fractions. It was also highly present in the other membrane rich fraction like the small compartments fraction, which contains light membranes. It had a partially similar subcellular fractionation profile to N R 1 in this respect, which is also highly expressed in the small compartments fraction and synaptosomal membrane fraction. In contrast, P K G I appeared to be very weakly expressed in both the synaptic vesicle fraction and synaptosomal membrane fraction, indicating that most of the c G M P functions at the nerve terminal may be mediated by P K G JJ and not P K G I. We also found that P K G JJ was expressed in the synaptosomal membrane fraction in embryonic brain subcellular fractions. It shared this subcellular fractionation profile with PSD-95, a P S D enriched protein, which has been shown to be important for synapse maturation (El-Husseini et al., 2000). B y contrast, P K G I was very weakly expressed in the synaptosomal membrane fraction in embryonic rat brain subcellular fractions and concentrated in the soluble fraction. P K G JJ is present in both the cell body and dendritic processes in hippocampal neurons in culture. We showed that it partially co-localized with the presynaptic molecular marker synaptophysin and the postsynaptic molecular marker PSD-95. A t higher magnification a slight shift in fluorescence was observed when hippocampal neurons were double stained with P K G JJ and synaptophysin, indicating that the proteins were present in the opposite compartments of the synapse. Such a shift was not noted in dendritic processes double 108 stained with P K G LT and PSD-95 indicating that P K G II was present in spine like structures on the postsynaptic side. The N O , c G M P and P K G pathway has been shown to be important for regulation of hippocampal neuronal L T P (Arancio et al., 1995; Boulton et al., 1995; L u et al., 1999; Son et al., 1998; W u et al., 1998; Zhuo et al., 1994a). However, in all the studies mentioned above (see introduction for detailed description), the importance of P K G was shown using activators or inhibitors of P K G . The presence of P K G in the synapse has not been demonstrated using immunocytochemical methods. Our Western blotting study indicated that P K G II was present at a high concentration in hippocampus. W e also showed that P K G LT was present at high levels in hippocampal neurons in culture and that it is targeted to synaptic sites. It has been recently shown that L T P and L T D in corticostriatal pathways are regulated by P K A and P K G in striatal neurons (Calabresi et al., 2000; Calabresi et al., 1999). Their finding is consistent with our observation that P K G II is present in both the cortex and striatum. Using Western blotting we detected very low levels of P K G I in cortex and hippocampus and did not detect P K G I in the striatum indicating that P K G II is most likely the molecule responsible for the c G M P actions in these areas. P K G has been shown to be involved in regulation of neurotransmitter release. (Akamatsu et al., 1993; Gray et al., 1999; Sistiaga et al., 1997) Recently G-Septin and Septin 3, proteins highly concentrated in the nerve terminals, were shown to be phosphorylated by P K G (Xue et al., 2004; X u e et al., 2000). Mena, which is a substrate of P K G , is a cytoskeletal protein associated with neuronal growth cone activity responsible for axonal path finding. Mena 109 deficient mice have defective axonal pathfinding (Lanier et al., 1999). Neural growth cone responses are converted from repulsion to attraction by c A M P and c G M P signaling (Song et al., 1998). Although a role for c G M P and P K G has been suggested at the presynaptic terminal, the presence of P K G in the presynaptic terminals has not been demonstrated. Using subcellular fractions from the brain and by Western blotting we showed that P K G U is highly concentrated in the synaptic vesicle fraction. P K G II was present at a much higher concentration in the synaptic vesicle fraction than P K G I, indicating that these effects are most likely mediated by P K G II and not P K G I. Our data that P K G LI is localized in the presynaptic vesicle fraction suggests that P K G LI could contribute to potentiation, possibly by altering presynaptic release of transmitters. N O has been shown to act post-synaptically, either by enhancing L T P in some cases or by suppressing it in others (Ko and Kel ly , 1999; Murphy and Bliss , 1999). K o and Ke l ly (1999) showed that postsynaptic co-injection of the N O S inhibitor L - N A M E with Ca(2+)/CaM blocked Ca(2+)/CaM-induced synaptic potentiation. Murphy and Bliss (1999) found that photolytically released N O (1-4.5 microM) from bath applied caged N O reduced the magnitude of long-term potentiation (LTP) in a concentration-dependent manner. Dendritic production of c G M P as observed by Honda et al. (Honda et al., 2001) allows one to argue for a role of c G M P in the dendrites. However, the presence of P K G has not been shown at the postsynaptic side so far. W e have shown that P K G LT was highly present in the dendrites and co-localized with the postsynaptic marker PSD-95 in hippocampal neurons in culture. 110 III. Importance of N-myr in targeting of PKG II. P K G II unlike P K G I is myristoylated on the N-terminal glycine. N-myr has been shown to be important for membrane targeting of P K G II (Vaandrager et al., 1996). The importance of N-myr in membrane targeting was shown by Western blotting of subcellular fractions and assaying protein kinase activity in HEK-293 and COS-1 cells. Recently it was demonstrated that the presynaptic cytomatrix protein Bassoon requires N-myr to be targeted to the synapse (Dresbach et al., 2003). The importance of N-myr in P K G II targeting in neurons is unknown. We chose to study the significance of N-myr on P K G II targeting by generating constructs containing different regions of the P K G II protein including G 2 A mutants of P K G II, which cannot be myristoylated. We showed that N-myr is responsible for targeting F L w t P K G II G F P to the perinuclear region and membranes in COS-1 cells, HEK-293 cells and hippocampal neurons in culture. In COS-1 cells and H E K - 2 9 3 cells, the FLwt and 5'wt P K G II are specifically targeted to the membrane and are concentrated at the distal ends of filopodia like structures, indicating possible interaction with actin binding proteins. V A S P , a substrate of P K G (Waldmann et al., 1986), also accumulates at such focal adhesion points, where it interacts with actin binding machinery and regulates filopodia growth (Bear et al., 2002; Kwiatkowski et al., 2003; Laurent et al., 1999; Waldmann et al., 1986). In contrast both 5 ' P K G II G 2 A mutant and F L P K G II G 2 A mutant showed a diffuse distribution indicating that N-myr is important for proper subcellular targeting of P K G II. Recent studies using P K G I G F P proteins have shown that both F L P K G I G F P and the regulatory domain of P K G I tagged to G F P are diffusely localized in H E K cells (Browning et al., 2001). Browning et al. found that the P K G I 111 regulatory domain, like PKG U regulatory domain in our study, is also found in dynamic regions of the plasma membrane. Browning et al. showed that when the PKG I catalytic domain was expressed without the regulatory domain, it accumulated in the nucleus. In this study, when the catalytic domain of PKG II was expressed without the regulatory domain, it did not translocate into the nucleus. On the one hand, in hippocampal neurons in culture FLwt PKG II accumulated in the perinuclear area and had a punctate and membranous distribution in the dendritic processes. In the processes it co-localizes with the presynaptic marker synaptophysin and showed an accumulation at these probable synaptic sites. On the other hand the FL PKG U G2A mutant was much more diffusely distributed in the cell and did not accumulate at probable synaptic sites. This evidence supports the observation that PKG U is found concentrated in the synaptosomal membrane fractions and synaptic vesicle fractions in rat brain subcellular fractions, de Vente et al. also observed PKG U to be predominantly membrane associated in rat brain sections stained for PKG II (de Vente et al., 2001). N-myr has been shown to be important for proper functioning of proteins. N-myr has been shown to be important for the stability of the PKA catalytic subunit (Carr et al., 1982) and for the transforming activity of p6(frc (Garber and Hanafusa, 1987). However, Vaandrager et al showed that myristoylation has no effect on either stability or activity of PKG II (Vaandrager et al., 1996). In the PKG n, N-myr appeared to be exclusively for targeting. Due to its intermediate hydrophobicity N-myr has been implicated in reversible membrane association (Taniguchi, 1999; Towler et al., 1988). Myristoylated alanine-rich PKC substrate 112 ( M A R C K S ) is known to translocate between membrane and soluble fractions in a phosphorylation manner (Wu et a l , 1982). A s the intermediate hydrophobicity of N-myr is thought to be insufficient for membrane binding, it has been suggested that M A R C K S binds membrane not only through its N-myr anchor but also through its P K C phosphorylation domain (Taniguchi, 1999). However, in the case of P K G JJ it has been suggested that N-myr alone would be sufficient as P K G II is a dimer and has two myr anchors per molecule of P K G JI (Vaandrager et al., 1996). Although N-myr is thought to be an irreversible co-translational modification, demyristoylase activity has been demonstrated in the brain (Manenti et al., 1993; Manenti et al., 1994). Demyristoylation offers a novel way of changing the localization of proteins, but the significance of demyristoylation of specific proteins has not been well studied. Subcellular localization of protein kinases and phosphatases provides a means to restrict where and when phosphorylation events occur. The importance of subcellular localization has already been demonstrated for P K G JI. Membrane targeting of P K G II has been shown to be important for phosphorylation of the C F T R C f channel. Although both P K G I and JJ can phosphorylate the C F T R C F channel in vitro, only P K G LI can phosphorylate the C F T R C l " channel in intact cells. This is due to its myristoylation and subcellular localization in the membrane (Lxjhmann et al., 1997; Vaandrager et al., 1998). It is also interesting to note that Wang et al. found a number of potential P K G substrates in peripheral membrane fractions from synaptosomes (Wang and Robinson, 1995). These are most l ikely to be substrates of P K G JI as it is targeted to the membrane through myristoylation. 113 Subcellular localization of protein kinases can also occur through interaction with kinase anchoring proteins. A number of such proteins have been described for P K A . P K A has been shown to be targeted to cytoskeleton ( M A P 2), endoplasmic reticulum ( A K A P 100), Golg i ( A K A P 85), mitochondria ( A K A P 84), nucleus ( A K A P 95), peroxisome ( A K A P 220) and P S D ( A K A P 79) (Coghlan et al., 1993; Coghlan et al., 1995; Hausken and Scott, 1996; Rubin, 1994). Such proteins have been described for P K C as well . They are called receptors for activated P K C ( R A C K s ) and receptors for inactive P K C (RICKs) (Sim and Scott, 1999). P K A and P K G share a lot of structural similarities, both in the regulatory and catalytic subunits. V o et al. used the regulatory domain of P K G JJ in a protein overlay assay and found a number of interacting proteins in the aorta, brain and intestine (Vo et al., 1998). They identified one ubiquitously expressed P K G JJ binding protein as myosin. However, Vaandrager et al. did not find any proteins in H E K cells that interacted with P K G JJ (Vaandrager et al., 1996), where P K G JJ is targeted to the membrane and possible focal adhesion points as we have observed in our study. Although the study of V o et al. found interacting proteins from aorta tissue, P K G JJ, so far, has not been shown to be expressed in the aorta. In our study, we found that mutation of the N-terminal glycine, which renders P K G II non-myristolyated, leads to a diffuse localization of P K G JJ not only in H E K cells and C O S cells but also in hippocampal neurons in culture. Dresbach et al. showed apart from myristoylation, a central region of bassoon is also required for targeting of bassoon to the synapse (Dresbach et al., 2003),. Our study indicates that N-myr of P K G U is an important factor for P K G JJ targeting. At the moment it is not known i f N-myr alone is enough for P K G JJ targeting to the membrane and synaptic sites. Further deletion studies with the regulatory domain of P K G JJ have to be done to better understand the targeting of P K G JJ. 114 / V . Probable role of PKG II in regulation of synaptogenesis.. One model for synapse formation predicts that active dendritic filopodia contact axons to induce presynaptic boutons, followed by a period of filopodial maturation into postsynaptic spines (Harris et al., 1992; Maletic-Savatic et al., 1999; Rao and Craig, 2000; Ziv and Smith, 1996). We have shown that overexpression of a possible dominant negative of P K G LT in hippocampal neurons causes a dramatic increase in the number of filopodia at 10 div in hippocampal neurons and a similar increase in spines at 15 div hippocampal neurons, indicating that the increase in filopodia translates to spines. We have also shown that P K G IL is expressed in the synaptosomal membrane fraction in both the adult and embryonic brain subcellular fractions. This implicates a role for P K G LT in regulation of density of synaptic sites and hence a possible role in nervous system development and synaptic plasticity. Exactly how P K G LT brings about this effect is still unclear. The most plausible explanation, based on the ability of the wt regulatory domain of PKG LT to inhibit P K G activity, seems to be that inhibition of endogenous PKG II activity leads to an increase in the number of filopodia/spines. However, we did not find a decrease in density of filopodia and spines in FL wt PKG II overexpressing cells. It is likely that the P K G substrate is completely phosphorylated by the endogenous PKG LT thus masking the effect of the recombinant protein. This indicates that P K G II probably plays a role in pruning of synapses. Consistent with this finding, NO has been shown to act as a "slow-down and search signal" in developing neurites and this effect was dependent on cGMP (Trimm and Rehder, 2004). NO has also been shown to cause collapse of growth cones and retraction of neurites (Ernst et al., 2000; Gallo et al., 2002; He et al., 2002). NO has also been shown to facilitate neurite outgrowth in PCI2 cells in a cGMP dependent manner (Hindley et al., 1997; Rialas et al., 115 2000). c G M P is also involved in inhibiting collagen-induced platelet aggregation, which requires dynamic actin reorganization followed by cell shape change {Aszodi, 1999 #347}. P K G mediates platelet aggregation through V A S P {Aszodi, 1999 #347} and phosphorylation of V A S P by P K A has been shown to reduce the ability of V A S P to promote in vitro nucleation probably by reducing V A S P binding to G-actin (Harbeck et al., 2000; Lambrechts et al., 2000; Walders-Harbeck et al., 2002). A l l this data is consistent with our finding that P K G II regulates filopodia/spine growth. L T P , which is a model system for studying synaptic learning, produces an increase in the labeling of F-actin in the dendritic regions where L T P was induced but not in the control region (Fukazawa et al., 2003). Fukazawa et al also found that after L T P induction there was a persistent increase in the fraction of spines with high F-actin content and an increase in the diameter of spines. N O , c G M P and P K G are important for regulation of hippocampal neuron L T P (Arancio et a l , 1995; Boulton et al., 1995; L u et al., 1999; Son et al., 1998; W u et al., 1998; Zhuo et al., 1994a). However, there is also evidence that indicates that this pathway is not involved in L T P (Schuman and Madison, 1994; Selig et al., 1996; W u et al., 1998). Son et al. suggested that c G M P plays an important role in L T P under some conditions but not other situations (Son et al., 1998). Part of the discrepancy in the above studies may be due to the use of the commercially available P K G selective inhibitor KT-5823, which was recently shown to be not as selective to P K G as thought earlier (Bain et al., 2003; Burkhardt et al., 2000). It has been suggested by Son et al. that slight differences in protocols for induction of L T P could also be responsible for these different observations. W u et al. suggested that the N O / c G M P / P K G pathway is involved in L T D induction but not L T P induction in dentate 116 gyrus. They found that postsynaptic application of a P K G inhibitor inhibited zaprinast-induced L T D of E P S C s (Wu et a l , 1998). Consistent with this finding Murphy and Bliss found that photolytically released N O (1-4.5 microM) from bath applied caged N O reduced the magnitude of long-term potentiation (LTP) in a concentration-dependent manner (Murphy and Bliss, 1999). K o and Kel ly , however, showed that extracellular application of the N O S inhibitor N(G)-nitro-L-arginine methyl ester ( L - N A M E ) or postsynaptic co-injection of L - N A M E with Ca(2+)/CaM blocked Ca(2+)/CaM-induced synaptic potentiation (Ko and Kel ly , 1999). This indicates a postsynaptic role for P K G , which is consistent with our finding that P K G LT was expressed on the postsynaptic side in hippocampal neurons in culture. Our finding that the dominant negative regulatory domain of P K G LT causes an increase in filopodia and spines indicates that endogenous P K G II most l ikely plays a role in reducing the number of filopodia or spines, and thus is l ikely to play a role in L T D in hippocampal neurons. Our data suggest that for long-term plasticity, P K G II affects synaptic formation in the early stages, and may contribute to adult neuronal reorganization during learning. Previous studies have shown that P K G I is present in hippocampal neurons in culture (Arancio et al., 2001; Kleppisch et al., 1999). We have shown that the wt P K G II regulatory domain can inhibit the activity of endogenous P K G I in H E K cells. It is still unclear i f the effect seen is due to inhibition of P K G II activity or P K G I activity. The subcellular fractionation studies and immunocytochemical studies showing the presence of endogenous P K G II and not P K G I in synaptic sites indicate that the increase in filopodia/spines is most 117 likely due to the inhibition of P K G U . We have also shown that P K G II is present in higher concentrations than P K G I in hippocampal lysates. It is not known so far as to what substrates of P K G might regulate filopodia/spine formation. The dynamic protrusion and retraction of filopodia is dependent on the regulation of actin binding and capping proteins (Rao et al., 2000). E n a / V A S P proteins are a structurally conserved protein family found in vertebrates, invertebrates and Dictyostelium (Kwiatkowski et al., 2003). They have been shown to have an important function in cell motility (Anderson et al., 2003; Bear et al., 2000; Bear et al., 2002; Garcia Arguinzonis et al., 2002; Goh et a l , 2002). V A S P was initially identified as a P K A / P K G substrate in platelets (Halbrugge et al., 1990; Reinhard et al., 1992). Later on it was shown that al l E n a / V A S P members are substrates of P K A / P K G (Butt et al., 1994; Gertler et al., 1996; Lambrechts et al., 2000). One study showed phosphorylation of V A S P decreases its affinity to F-actin (Harbeck et a l , 2000) and another showed the opposite effect where phosphorylation showed an increase in affinity to F-actin (Laurent et al., 1999). V A S P has been shown to promote actin polymerization and phosphorylation of V A S P by P K A significantly reduces the ability of V A S P to bind G-actin (Walders-Harbeck et al., 2002). Murine Ena (Mena) is enriched in filopodial tips of the neuronal growth cone and is required for proper axonal path-finding (Lanier et al., 1999). Based on the above data, we wanted to check i f overexpression of human V A S P would have an effect on the phenotype of hippocampal neurons. We found no differences in the number of filopodia/spines in the neurons transfected with human V A S P when comapared to G F P overexpressing cells. There was also no difference in the density of spines/filopodia when V A S P overexpressing cells were treated with 8 B r - c G M P . It is unclear 118 as to why we did not observe a morphological effect in V A S P overexpressing neurons. It is possible that the overexpressed V A S P is still fully phosphorylated by endogenous P K G LT and does not enhance F-actin/filopodia formation. These data suggest that V A S P is not involved in the P K G II pathway mediating increase in filopodia/spines, but not completely ruled out. It is possible that a yet unidentified E n a / V A S P member might play a role in regulation of filopodia/spine formation in hippocampal neurons in culture. In our studies we used the human homologue of V A S P and it is possible that it might not function in the same way as the rat homologue would. Is it possible that the regulatory domain of P K G II can by itself reorganize the cytoskeleton and cause process outgrowth? It was recently reported that protein acylation confers localization to cholesterol and sphingolipid-enriched membranes (McCabe and Berthiaume, 2001). It has also been shown that presence of basic residues nearby the acylation motifs stabilize interactions with the negatively charged phospholipids present at the plasma membrane (Resh, 1999). Previous studies showed that alteration in the concentration of specific lipids alter membrane dynamics and fluidity. For example, addition of sphingomyelin or phosphatidyl ethanolamine analogs, lipids that expand the plasma membrane, increase the rate of cell spreading and lamellipodia extension and cause a decrease in membrane tension (Bershadsky and Futerman, 1994; Furuya et al., 1995; Harel and Futerman, 1993; Schwarz et al., 1995). It is possible that a similar mechanism is involved whereby the increased rate of addition of myristate to specific plasma membrane microdomains stimulates process outgrowth by a physical alteration of membrane tension. Alternatively, a change in membrane tension and expansion may stimulate the activation of 119 elements critical for recruitment and anchoring of specific proteins associated with filopodia extension at the plasma membrane. P K G U is myristoylated and also has basic residues in the vicinity of the myristoylation motif. However, it is not known i f the dominant negative P K G U is targeted to l ipid rafts. It is, however, unlikely that the regulatory domain alone might be inducing this growth effect, as the FLwt P K G II is myristoylated and has the entire regulatory domain, but does not induce filopodial or spine growth. V. Conclusion In this work we have identified a possible role for P K G U in regulation of synaptogenesis. Dendritic spine pathology has been associated with neurological disorders such as Alzheimer's disease and Creutzfeldt-Jakob disease and genetic disorders such as Down's and fragile-X syndromes (Fiala et al., 2002). In many brain regions, normal development involves an increase in synapses followed by pruning to mature levels (Huttenlocher and Dabholkar, 1997). Disruption of this developmental pruning may lead to increased spine density. For example, ovariectomy disrupts pruning in visual cortex (Munoz-Cueto et al., 1990). Similarly, an overabundance of dendritic spines in the reticular formation, vagal nuclei and ventrolateral medulla in infants dying from sudden infant death syndrome is thought to be a failure of developmental synapse elimination, and appears to be involved in the defective cardiorespiratory regulation (O'Kusky and Norman, 1994; Quattrochi et a l , 1985; Takashima and Becker, 1985; Takashima et al., 1985). Defective pruning has also been shown to be responsible for increased spine density seen in phenylketonuria (Lacey, 1985) and fragile-X syndrome (Irwin et al., 2001). Identifying and studying the molecules 120 involved in regulation of filopodia/spine formation w i l l contribute to our understanding of not only the normal dendritic spine function, but also the pathogenic aspects of central nervous system. 121 R E F E R E N C E S Aitken, A., B.A. Hernrnings, and F. Hofmann. 1984. Identification of the residues on cyclic GMP-dependent protein kinase that are autophosphorylated in the presence of cyclic AMP and cyclic GMP. Biochim Biophys Acta. 790:219-25. Alioua, A., Y. Tanaka, M . Wallner, F. Hofmann, P. Ruth, P. Meera, and L. Toro. 1998. The large conductance, voltage-dependent, and calcium-sensitive K+ channel, Hslo, is a target of cGMP-dependent protein kinase phosphorylation in vivo. J Biol Chem. 273:32950-6. Ammendola, A., A. Geiselhoringer, F. Hofmann, and J. Schlossmann. 2001. Molecular determinants of the interaction between the inositol 1,4,5-trisphosphate receptor-associated cGMP kinase substrate (IRAG) and cGMP kinase Ibeta. J Biol Chem. 276:24153-9. Anderson, S.I., B. Behrendt, L . M . Machesky, R.H. Insall, and G.B. Nash. 2003. Linked regulation of motility and integrin function in activated migrating neutrophils revealed by interference in remodelling of the cytoskeleton. Cell Motil Cytoskeleton. 54:135-46. Andoh, T., C C . Chiueh, and P.B. Chock. 2003. Cyclic GMP-dependent protein kinase regulates the expression of thioredoxin and thioredoxin peroxidase-1 during hormesis in response to oxidative stress-induced apoptosis. J Biol Chem. 278:885-90. Anggard, E . 1994. Nitric oxide: mediator, murderer, and medicine. Lancet. 343:1199-206. Arancio, O., I. Antonova, S. Gambaryan, S.M. Lohmann, J.S. Wood, D.S. Lawrence, and R.D. Hawkins. 2001. Presynaptic role of cGMP-dependent protein kinase during long-lasting potentiation. J Neurosci. 21:143-9. Arancio, O., E .R. Kandel, and R.D. Hawkins. 1995. Activity-dependent long-term enhancement of transmitter release by presynaptic 3',5'-cyclic GMP in cultured hippocampal neurons. Nature. 376:74-80. Arancio, O., M . Kiebler, C J . Lee, V. Lev-Ram, R.Y. Tsien, E .R. Kandel, and R.D. Hawkins. 1996. Nitric oxide acts directly in the presynaptic neuron to produce long-term potentiation in cultured hippocampal neurons. Cell. 87:1025-35. Ariano, M.A. 1983. Distribution of components of the guanosine 3',5'-phosphate system in rat caudate-putamen. Neuroscience. 10:707-23. 122 Aszodi , A . , A . Pfeifer, M . Ahmad, M . Glauner, X . H . Zhou, L . N y , K . E . Andersson, B . Kehrel, S. Offermanns, and R. Fassler. 1999. The vasodilator-stimulated phosphoprotein ( V A S P ) is involved in c G M P - and cAMP-mediated inhibition of agonist-induced platelet aggregation, but is dispensable for smooth muscle function. EmboJ. 18:37-48. Atkinson, R . A . , V . Saudek, J.P. Huggins, and J.T. Pelton. 1991. 1H N M R and circular dichroism studies of the N-terminal domain of cyclic G M P dependent protein kinase: a leucine/isoleucine zipper. Biochemistry. 30:9387-95. Bain, J. , H . McLauchlan, M . Elliott, and P. Cohen. 2003. The specificities of protein kinase inhibitors: an update. Biochem J. 371:199-204. Bannerman, D . M . , P.F. Chapman, P . A . Kel ly , S.P. Butcher, and R . G . Morris . 1994a. Inhibition of nitric oxide synthase does not impair spatial learning. J Neurosci. 14:7404-14. Bannerman, D . M . , P.F. Chapman, P . A . Kel ly , S.P. Butcher, and R . G . Morris . 1994b. Inhibition of nitric oxide synthase does not prevent the induction of long-term potentiation in vivo. J Neurosci. 14:7415-25. Barria, A . , D . Muller , V . Derkach, L . C . Griffith, and T.R. Soderling. 1997. Regulatory phosphorylation of A M P A - t y p e glutamate receptors by C a M - K I I during long-term potentiation. Science. 276:2042-5. Baxter, G.F. 2004. The natriuretic peptides. Basic Res Cardiol. 99:71-5. Bear, J.E., J J . Loureiro, I. Libova, R. Fassler, J . Wehland, and F . B . Gertler. 2000. Negative regulation of fibroblast motility by E n a / V A S P proteins. Cell. 101:717-28. Bear, J.E., T . M . Svitkina, M . Krause, D . A . Schafer, J.J. Loureiro, G . A . Strasser, I .V. Maly , O . Y . Chaga, J .A . Cooper, G . G . Borisy, and F . B . Gertler. 2002. Antagonism between E n a / V A S P proteins and actin filament capping regulates fibroblast motility. Cell. 109:509-21. Beckman, J.S., J . Chen, H . Ischiropoulos, and J.P. Crow. 1994. Oxidative chemistry of peroxynitrite. Methods Enzymol. 233:229-40. Bershadsky, A . D . , and A . H . Futerman. 1994. Disruption of the Go lg i apparatus by brefeldin A blocks cell polarization and inhibits directed cell migration. Proc Natl Acad Sci U SA. 91:5686-9. 123 Blackshaw, S., M J . Eliasson, A . Sawa, C . C . Watkins, D . Krug, A . Gupta, T. Ara i , R .J . Ferrante, and S .H. Snyder. 2003. Species, strain and developmental variations in hippocampal neuronal and endothelial nitric oxide synthase clarify discrepancies in nitric oxide-dependent synaptic plasticity. Neuroscience. 119:979-90. Boehme, D . H . , R. Kosecki , and N . Marks. 1978. Protein phosphorylation in human synaptosomal membranes: evidence for the presence of substrates for cyclic nucleotide guanosine 3'-5'-monophosphate dependent protein kinases. Brain Res Bull. 3:697-700. Boerth, N . J . , N . B . Dey, T . L . Cornwell, and T . M . Lincoln. 1997. Cycl ic GMP-dependent protein kinase regulates vascular smooth muscle cell phenotype. / Vase Res. 34:245-59. Boulton, C . L . , E . Southam, and J . Garthwaite. 1995. Nitric oxide-dependent long-term potentiation is blocked by a specific inhibitor of soluble guanylyl cyclase. Neuroscience. 69:699-703. Bredt, D.S. , P . M . Hwang, C E . Glatt, C . Lowenstein, R .R . Reed, and S .H. Snyder. 1991. Cloned and expressed nitric oxide synthase structurally resembles cytochrome P-450 reductase. Nature. 351:714-8. Brewer, G J . 1995. Serum-free B27/neurobasal medium supports differentiated growth of neurons from the striatum, substantia nigra, septum, cerebral cortex, cerebellum, and dentate gyrus. J Neurosci Res. 42:674-83. Brewer, G.J . , J.R. Torricelli , E . K . Evege, and P J . Price. 1993. Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res. 35:567-76. Browning, D . D . , M . M c Shane, C . Marty, and R . D . Ye . 2001. Functional analysis of type 1 alpha cGMP-dependent protein kinase using green fluorescent fusion proteins. J Biol Chem. 276:13039-48. Browning, D . D . , M . P . McShane, C . Marty, and R . D . Y e . 2000. Nitr ic oxide activation of p38 mitogen-activated protein kinase in 293T fibroblasts requires cGMP-dependent protein kinase. JBiol Chem. 275:2811-6. Brune, B . , S. Dimmeler, L . Mol ina y Vedia, and E . G . Lapetina. 1994. Nitr ic oxide: a signal for ADP-ribosylation of proteins. Life Sci. 54:61-70. Burkhardt, M . , M . Glazova, S. Gambaryan, T. Vollkommer, E . Butt, B . Bader, K . Heermeier, T . M . Lincoln, U . Walter, and A . Palmetshofer. 2000. KT5823 inhibits 124 cGMP-dependent protein kinase activity in vitro but not in intact human platelets and rat mesangial cells. J Biol Chem. 275:33536-41. Busch, J .L. , E .P . Bessay, S .H. Francis, and J.D. Corbin. 2002. A conserved serine juxtaposed to the pseudosubstrate site of type I cGMP-dependent protein kinase contributes strongly to autoinhibition and lower c G M P affinity. JBiol Chem. 277:34048-54. Butt, E . , K . Abe l , M . Krieger, D . Palm, V . Hoppe, J . Hoppe, and U . Walter. 1994. c A M P -and cGMP-dependent protein kinase phosphorylation sites of the focal adhesion vasodilator-stimulated phosphoprotein ( V A S P ) in vitro and in intact human platelets. JBiol Chem. 269:14509-17. Calabresi, P., P. Gubellini, D . Centonze, B . Picconi, G . Bernardi, K . Chergui, P. Svenningsson, A . A . Fienberg, and P. Greengard. 2000. Dopamine and c A M P -regulated phosphoprotein 32 k D a controls both striatal long-term depression and long-term potentiation, opposing forms of synaptic plasticity. J Neurosci. 20:8443-51. Calabresi, P., P. Gubellini, D . Centonze, G . Sancesario, M . Morel lo , M . Giorgi , A . Pisani, and G . Bernardi. 1999. A critical role of the nitric ox ide /cGMP pathway in corticostriatal long-term depression. J Neurosci. 19:2489-99. Carr, S.A., K . Biemann, S. Shoji, D . C . Parmelee, and K . Titani. 1982. n-Tetradecanoyl is the NH2-terminal blocking group of the catalytic subunit of cyclic AMP-dependent protein kinase from bovine cardiac muscle. Proc Natl Acad Sci USA. 79:6128-31. Casteel, D . E . , S. Zhuang, T. Gudi , J. Tang, M . Vuica , S. Desiderio, and R . B . Pi lz . 2002. cGMP-dependent protein kinase I beta physically and functionally interacts with the transcriptional regulator TFiI-I . JBiol Chem. 277:32003-14. Chao, D.S. , F. Silvagno, H . X i a , T .L . Cornwell, T . M . Lincoln, and D.S . Bredt. 1997. Nitric oxide synthase and cyclic GMP-dependent protein kinase concentrated at the neuromuscular endplate. Neuroscience. 76:665-72. Chomczynski, P., and N . Sacchi. 1987. Single-step method of R N A isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162:156-9. Ciani , E . , S. Guidi , R. Bartesaghi, and A . Contestabile. 2002. Nitric oxide regulates c G M P -dependent cAMP-responsive element binding protein phosphorylation and Bcl -2 expression in cerebellar neurons: implication for a survival role of nitric oxide. J Neurochem. 82:1282-9. 125 Cibel l i , G . , V . Policastro, O .G . Rossler, and G . Thiel . 2002. Nitr ic oxide-induced programmed cell death in human neuroblastoma cells is accompanied by the synthesis of Egr-1, a zinc finger transcription factor. J Neurosci Res. 67:450-60. Coghlan, V . M . , S.E. Bergeson, L . Langeberg, G . Nilaver, and J .D. Scott. 1993. A-kinase anchoring proteins: a key to selective activation of cAMP-responsive events? Mol Cell Biochem. 127-128:309-19. Coghlan, V . M . , Z . E . Hausken, and J.D. Scott. 1995. Subcellular targeting of kinases and phosphatases by association with bifunctional anchoring proteins. Biochem Soc Trans. 23:592-6. Colbran, J .L. , S .H. Francis, A . B . Leach, M . K . Thomas, H . Jiang, L . M . McAll is ter , and J .D. Corbin. 1992. A phenylalanine in peptide substrates provides for selectivity between c G M P - and cAMP-dependent protein kinases. J Biol Chem. 267:9589-94. Corbin, J .D., M . K . Thomas, L . Wolfe, J .B. Shabb, T . A . Woodford, and S .H. Francis. 1990. New insights into c G M P action. Adv Second Messenger Phosphoprotein Res. 24:411-8. Cummings, J .A. , S . M . Nicola , and R . C . Malenka. 1994. Induction in the rat hippocampus of long-term potentiation (LTP) and long-term depression ( L T D ) in the presence of a nitric oxide synthase inhibitor. Neurosci Lett. 176:110-4. Dailey, M . E . , and S.J. Smith. 1996. The dynamics of dendritic structure in developing hippocampal slices. J Neurosci. 16:2983-94. Dawson, T . M . , and S .H. Snyder. 1994. Gases as biological messengers: nitric oxide and carbon monoxide in the brain. J Neurosci. 14:5147-59. de Jonge, H . R . 1981. Cycl ic GMP-dependent protein kinase in intestinal brushborders. Adv Cyclic Nucleotide Res. 14:315-33. de Vente, J . , E . Asan, S. Gambaryan, M . Markerink-van Ittersum, H . Axer , K . Gallatz, S . M . Lohmann, and M . Palkovits. 2001. Localization of cGMP-dependent protein kinase type II in rat brain. Neuroscience. 108:27-49. Dey, N . B . , N J . Boerth, J .E. Murphy-Ullr ich, P .L . Chang, C W . Prince, and T . M . Lincoln. 1998. Cycl ic GMP-dependent protein kinase inhibits osteopontin and thrombospondin production in rat aortic smooth muscle cells. Circ Res. 82:139-46. 126 DiCicco-Bloom, E . , V . Lelievre, X . Zhou, W . Rodriguez, J . Tam, and J .A . Waschek. 2004. Embryonic expression and multifunctional actions of the natriuretic peptides and receptors in the developing nervous system. Dev Biol. 271:161-75. Dickinson, R . B . , and D . L . Purich. 2002. Clamped-filament elongation model for actin-based motors. Biophys J. 82:605-17. Dinerman, J .L. , C J . Lowenstein, and S.H. Snyder. 1993. Molecular mechanisms of nitric oxide regulation. Potential relevance to cardiovascular disease. CircRes. 73:217-22. D o i , K . , T. Ikeda, H . Itoh, K . Ueyama, K . Hosoda, Y . Ogawa, J . Yamashita, T . H . Chun, M . Inoue, K . Masatsugu, N . Sawada, Y . Fukunaga, T. Saito, M . Sone, K . Yamahara, H . Kook, M . Komeda, M . Ueda, and K . Nakao. 2001. C-type natriuretic peptide induces redifferentiation of vascular smooth muscle cells with accelerated reendothelialization. Arterioscler Thromb Vase Biol. 21:930-6. Dresbach, T., A . Hempelmann, C. Spilker, S. torn Dieck, W . D . Altrock, W . Zuschratter, C . C . Garner, and E . D . Gundelfinger. 2003. Functional regions of the presynaptic cytomatrix protein bassoon: significance for synaptic targeting and cytomatrix anchoring. Mol Cell Neurosci. 23:279-91. Ehlers, M . D . , W . G . Tingley, and R . L . Huganir. 1995. Regulated subcellular distribution of the N R 1 subunit of the N M D A receptor. Science. 269:1'/'34-7'. el-Husseini, A . E . , C . Bladen, and S.R. Vincent. 1995. Molecular characterization of a type II cyclic GMP-dependent protein kinase expressed in the rat brain. J Neurochem. 64:2814-7. El-Husseini, A . E . , C . Bladen, J .A . Will iams, P . B . Reiner, and S.R. Vincent. 1998. Nitric oxide regulates cyclic GMP-dependent protein kinase phosphorylation in rat brain. J Neurochem. 71:676-83. El-Husseini, A . E . , E . Schnell, D . M . Chetkovich, R . A . Nico l l , and D.S . Bredt. 2000. PSD-95 involvement in maturation of excitatory synapses. Science. 290:1364-8. El-Husseini, A . E . , J . Will iams, P . B . Reiner, S. Pelech, and S.R. Vincent. 1999. Localization of the cGMP-dependent protein kinases in relation to nitric oxide synthase in the brain. / Chem Neuroanat. 17:45-55. el-Husseini, A.e . -D. , J .A . Paterson, and R.P. Shiu. 1994. Basic fibroblast growth factor (bFGF) and two of its receptors, F G F R 1 and F G F R 2 : gene expression in the rat brain during postnatal development as determined by quantitative R T - P C R . Mol Cell Endocrinol. 104:191-200. 127 Ernst, A . F . , G . Gallo, P .C . Letoumeau, and S.C. M c L o o n . 2000. Stabilization of growing retinal axons by the combined signaling of nitric oxide and brain-derived neurotrophic factor. J Neurosci. 20:1458-69. Esteve, L . , P. Lutz, N . Thiriet, M . Revel, D . Aunis, and J . Zwil ler . 2001. Cycl ic G M P -dependent protein kinase potentiates serotonin-induced Egr-1 binding activity in P C 12 cells. Cell Signal. 13:425-32. Farazi, T . A . , G . Waksman, and J.I. Gordon. 2001. The biology and enzymology of protein N-myristoylation. J Biol Chem. 276:39501-4. Fiala, J . C , J . Spacek, and K . M . Harris. 2002. Dendritic spine pathology: cause or consequence of neurological disorders? Brain Res Brain Res Rev. 39:29-54. Fields, S., and O. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature. 340:245-6. Fischer, M . , S. Kaech, D . Knutti, and A . Matus. 1998. Rapid actin-based plasticity in dendritic spines. Neuron. 20:847-54. Foster, J .L. , G . C . Higgins, and F.R. Jackson. 1996. Biochemical properties and cellular localization of the Drosophila D G 1 cGMP-dependent protein kinase. J Biol Chem. 271:23322-8. Francis, S.H., and J .D. Corbin. 1994. Structure and function of cyclic nucleotide-dependent protein kinases. Annu Rev Physiol. 56:237-72. Francis, S .H. , and J .D. Corbin. 1999. Cycl ic nucleotide-dependent protein kinases: intracellular receptors for c A M P and c G M P action. Crit Rev Clin Lab Sci. 36:275-328. Francis, S .H. , J .A . Smith, J .L. Colbran, K . Grimes, K . A . Walsh, S. Kumar, and J .D. Corbin. 1996. Arginine 75 in the pseudosubstrate sequence of type Ibeta cGMP-dependent protein kinase is critical for autoinhibition, although autophosphorylated serine 63 is outside this sequence. J Biol Chem. 271:20748-55. Fujisaki, H . , H . Ito, Y . Hirata, M . Tanaka, M . Hata, M . L i n , S. Adachi , H . Akimoto, F . Marumo, and M . Hiroe. 1995. Natriuretic peptides inhibit angiotensin LT-induced proliferation of rat cardiac fibroblasts by blocking endothelin-1 gene expression. J Clin Invest. 96:1059-65. 128 Fujiwara, M . , P. Sengupta, and S.L. Mclntire. 2002. Regulation of body size and behavioral state of C . elegans by sensory perception and the E G L - 4 cGMP-dependent protein kinase. Neuron. 36:1091-102. Fukao, M . , H .S . Mason, F . C . Britton, J .L. Kenyon, B . Horowitz, and K . D . Keef. 1999. Cycl ic GMP-dependent protein kinase activates cloned B K C a channels expressed in mammalian cells by direct phosphorylation at serine 1072. J Biol Chem. 274:10927-35. Fukazawa, Y . , Y . Saitoh, F . Ozawa, Y . Ohta, K . Mizuno, and K . Inokuchi. 2003. Hippocampal L T P is accompanied by enhanced F-actin content within the dendritic spine that is essential for late L T P maintenance in vivo. Neuron. 38:447-60. Furchgott, R.F . , and J . V . Zawadzki. 1980. The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature. 288:373-6. Furuya, S., K . Ono, and Y . Hirabayashi. 1995. Sphingolipid biosynthesis is necessary for dendrite growth and survival of cerebellar Purkinje cells in culture. J Neurochem. 65:1551-61. Gallo, G . , A . F . Ernst, S.C. M c L o o n , and P .C . Letourneau. 2002. Transient P K A activity is required for initiation but not maintenance of BDNF-mediated protection from nitric oxide-induced growth-cone collapse. J Neurosci. 22:5016-23. Gambaryan, S., W . Hauser, A . Kobsar, M . Glazova, and U . Walter. 2001. Distribution, cellular localization, and postnatal development of V A S P and Mena expression in mouse tissues. Histochem Cell Biol. 116:535-43. Gambaryan, S., C . Hausler, T. Markert, D . Pohler, T. Jarchau, U . Walter, W . Haase, A . Kurtz, and S . M . Lohmann. 1996. Expression of type LT cGMP-dependent protein kinase in rat kidney is regulated by dehydration and correlated with renin gene expression. / Clin Invest. 98:662-70. Gambaryan, S., A . Palmetshofer, M . Glazova, A . Smolenski, G.I. Kristjansson, M . Zimmer, and S . M . Lohmann. 2002. Inhibition of cGMP-dependent protein kinase II by its own splice isoform. Biochem Biophys Res Commun. 293:1438-44. Gamm, D . M . , S .H. Francis, T.P. Angelotti, J .D. Corbin, and M . D . Uhler. 1995. The type II isoform of cGMP-dependent protein kinase is dimeric and possesses regulatory and catalytic properties distinct from the type I isoforms. J Biol Chem. 270:27380-8. Garber, E . A . , and H . Hanafusa. 1987. NH2-terminal sequences of two src proteins that cause aberrant transformation. Proc Natl Acad Sci USA. 84:80-4. 129 Garbers, D . L . 1991. Guanylyl cyclase-linked receptors. Pharmacol Ther. 50:337-45. Garbers, D . L . , and D . G . Lowe. 1994. Guanylyl cyclase receptors. JBiol Chem. 269:30741-4. Garcia Arguinzonis, M . I . , A . B . Galler, U . Walter, M . Reinhard, and A . Simm. 2002. Increased spreading, Rac/p21-activated kinase ( P A K ) activity, and compromised cell motility in cells deficient in vasodilator-stimulated phosphoprotein ( V A S P ) . JBiol Chem. 277:45604-10. Garthwaite, J., and C . L . Boulton. 1995. Nitric oxide signaling in the central nervous system. Annu Rev Physiol. 57:683-706. Gertler, F . B . , K . Niebuhr, M . Reinhard, J . Wehland, and P. Soriano. 1996. Mena, a relative of V A S P and Drosophila Enabled, is implicated in the control of microfilament dynamics. Cell. 87:227-39. Glass, D . B . , and E . G . Krebs. 1982. Phosphorylation by guanosine 3':5'-monophosphate-dependent protein kinase of synthetic peptide analogs of a site phosphorylated in histone H 2 B . JBiol Chem. 257:1196-200. Glaum, S.R., N . T . Slater, D J . Rossi, and R J . Mi l le r . 1992. Role of metabotropic glutamate ( A C P D ) receptors at the parallel fiber-Purkinje cell synapse. / Neurophysiol. 68:1453-62. Godfrey, E . W . , and R . C . Schwarte. 2003. The role of nitric oxide signaling in the formation of the neuromuscular junction. J Neurocytol. 32:591-602. Goh, K . L . , L . Cai , C . L . Cepko, and F . B . Gertler. 2002. E n a / V A S P proteins regulate cortical neuronal positioning. CurrBiol. 12:565-9. Gudi , T., D . E . Casteel, C . Vinson, G.R. Boss, and R . B . Pi lz . 2000. N O activation of fos promoter elements requires nuclear translocation of G-kinase I and C R E B phosphorylation but is independent of M A P kinase activation. Oncogene. 19:6324-33. Gudi , T., S . M . Lohmann, and R . B . Pi lz . 1997. Regulation of gene expression by cyclic GMP-dependent protein kinase requires nuclear translocation of the kinase: identification of a nuclear localization signal. Mol Cell Biol. 17:5244-54. Halbrugge, M . , C . Friedrich, M . Eigenthaler, P. Schanzenbacher, and U . Walter. 1990. Stoichiometric and reversible phosphorylation of a 46-kDa protein in human platelets in response to c G M P - and cAMP-elevating vasodilators. J Biol Chem. 265:3088-93. 130 Hanbauer, I., D . Wink, Y . Osawa, G . M . Edelman, and J .A . Gaily. 1992. Role of nitric oxide in N M D A - e v o k e d release of [3H]-dopamine from striatal slices. Neuroreport. 3:409-12. Hanks, S.K., and T. Hunter. 1995. Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. Faseb J. 9:576-96. Harbeck, B . , S. Huttelmaier, K . Schluter, B . M . Jockusch, and S. Illenberger. 2000. Phosphorylation of the vasodilator-stimulated phosphoprotein regulates its interaction with actin. JBiol Chem. 275:30817-25. Harel, R., and A . H . Futerman. 1993. Inhibition of sphingolipid synthesis affects axonal outgrowth in cultured hippocampal neurons. J Biol Chem. 268:14476-81. Harris, K . M . , F . E . Jensen, and B . Tsao. 1992. Three-dimensional structure of dendritic spines and synapses in rat hippocampus (CA1) at postnatal day 15 and adult ages: implications for the maturation of synaptic physiology and long-term potentiation. J Neurosci. 12:2685-705. Hausken, Z . E . , and J .D. Scott. 1996. Properties of A-kinase anchoring proteins. Biochem Soc Trans. 24:986-91. Hazzalin, C . A . , and L . C . Mahadevan. 2002. MAPK-regulated transcription: a continuously variable gene switch? Nat Rev Mol Cell Biol. 3:30-40. He, Y . , W . Y u , and P .W. Baas. 2002. Microtubule reconfiguration during axonal retraction induced by nitric oxide. J Neurosci. 22:5982-91. Hering, H . , and M . Sheng. 2001. Dendritic spines: structure, dynamics and regulation. Nat Rev Neurosci. 2:880-8. Hess, D.T. , S.I. Patterson, D.S . Smith, and J .H . Skene. 1993. Neuronal growth cone collapse and inhibition of protein fatty acylation by nitric oxide. Nature. 366:562-5. Hindley, S., B . H . Juurlink, J .W. Gysbers, P.J. Middlemiss, M . A . Herman, and M . P . Rathbone. 1997. Nitric oxide donors enhance neurotrophin-induced neurite outgrowth through a cGMP-dependent mechanism. J Neurosci Res. 47:427-39. Hofmann, F. , W . Dostmann, A . Keilbach, W . Landgraf, and P. Ruth. 1992. Structure and physiological role of cGMP-dependent protein kinase. Biochim Biophys Acta. 1135:51-60. 131 Hofmann, F. , and G . Sold. 1972. A protein kinase activity from rat cerebellum stimulated by guanosine-3':5'-monophosphate. Biochem Biophys Res Commun. 49:1100-7. Holscher, C . 2002. Different strains of rats show different sensitivity to block of long-term potentiation by nitric oxide synthase inhibitors. Eur J Pharmacol. 457:99-106. Honda, A . , S.R. Adams, C . L . Sawyer, V . Lev-Ram, R . Y . Tsien, and W . R . Dostmann. 2001. Spatiotemporal dynamics of guanosine 3',5'-cyclic monophosphate revealed by a genetically encoded, fluorescent indicator. Proc Natl Acad Sci USA. 98:2437-42. Hood, J. , and H.J . Granger. 1998. Protein kinase G mediates vascular endothelial growth factor-induced Raf-1 activation and proliferation in human endothelial cells. J Biol Chem. 273:23504-8. Hope, B .T . , G.J . Michael , K . M . Knigge, and S.R. Vincent. 1991. Neuronal N A D P H diaphorase is a nitric oxide synthase. Proc Natl Acad Sci USA. 88:2811-4. Huang, C . C . , S .H. Chan, and K . S . Hsu. 2003. cGMP/protein kinase G-dependent potentiation of glutamatergic transmission induced by nitric oxide in immature rat rostral ventrolateral medulla neurons in vitro. Mol Pharmacol. 64:521-32. Hutchinson, H . G . , P T . Trindade, D . B . Cunanan, C .F . W u , and R . E . Pratt. 1997. Mechanisms of natriuretic-peptide-induced growth inhibition of vascular smooth muscle cells. Cardiovasc Res. 35:158-67. Huttenlocher, P.R., and A . S . Dabholkar. 1997. Regional differences in synaptogenesis in human cerebral cortex. J Comp Neurol. 387:167-78. Huttner, W . B . , W . Schiebler, P. Greengard, and P. De Camil l i . 1983. Synapsin I (protein I), a nerve terminal-specific phosphoprotein. HI. Its association with synaptic vesicles studied in a highly purified synaptic vesicle preparation. / Cell Biol. 96:1374-88. Ignarro, L . J . , G . M . Buga, K . S . Wood, R . E . Byrns, and G . Chaudhuri. 1987. Endothelium-derived relaxing factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci USA. 84:9265-9. Irwin, S .A. , B . Patel, M . Idupulapati, J .B . Harris, R . A . Crisostomo, B . P . Larsen, F . Kooy, P.J. Willems, P. Cras, P .B . Kozlowski , R . A . Swain, I J . Weiler, and W T . Greenough. 2001. Abnormal dendritic spine characteristics in the temporal and visual cortices of patients with fragile-X syndrome: a quantitative examination. Am J Med Genet. 98:161-7. 132 Izumi, Y . , and C.F. Zorumski. 1993. Nitric oxide and long-term synaptic depression in the rat hippocampus. Neuroreport. 4:1131-4. Jahn, H . , W . Nastainczyk, A . Rohrkasten, T. Schneider, and F. Hofmann. 1988. Site-specific phosphorylation of the purified receptor for calcium-channel blockers by c A M P - and cGMP-dependent protein kinases, protein kinase C , calmodulin-dependent protein kinase U and casein kinase LT. Eur J Biochem. 178:535-42. Jarchau, T., C . Hausler, T. Markert, D . Pohler, J. Vanderkerckhove, H . R . De Jonge, S . M . Lohmann, and U. Walter. 1994. Cloning, expression, and in situ localization of rat intestinal cGMP-dependent protein kinase II. Proc Natl Acad Sci USA. 91:9426-30. Jontes, J.D., and S.J. Smith. 2000. Filopodia, spines, and the generation of synaptic diversity. Neuron. 27:11-4. Joyce, N . C . , P. DeCamil l i , S . M . Lohmann, and U. Walter. 1986. cGMP-dependent protein kinase is present in high concentrations in contractile cells of the kidney vasculature. / Cyclic Nucleotide Protein Phosphor Res. 11:191-8. Kalderon, D . , and G . M . Rubin. 1989. cGMP-dependent protein kinase genes in Drosophila. / Biol Chem. 264:10738-48. Katsuki, S., W . Arnold, C . Mittal , and F. Murad. 1977. Stimulation of guanylate cyclase by sodium nitroprusside, nitroglycerin and nitric oxide in various tissue preparations and comparison to the effects of sodium azide and hydroxylamine. J Cyclic Nucleotide Res. 3:23-35. Keilbach, A . , P. Ruth, and F. Hofmann. 1992. Detection of c G M P dependent protein kinase isozymes by specific antibodies. Eur J Biochem. 208:467-73. Klatt, P., E .P . Mol ina , and S. Lamas. 1999. Nitric oxide inhibits c-Jun D N A binding by specifically targeted S-glutathionylation. J Biol Chem. 274:15857-64. Kleppisch, T., A . Pfeifer, P. Klatt, P. Ruth, A . Montkowski, R. Fassler, and F. Hofmann. 1999. Long-term potentiation in the hippocampal C A 1 region of mice lacking c G M P -dependent kinases is normal and susceptible to inhibition of nitric oxide synthase. J Neurosci. 19:48-55. Knowles, R . G . , M . Palacios, R . M . Palmer, and S. Moncada. 1989. Formation of nitric oxide from L-arginine in the central nervous system: a transduction mechanism for stimulation of the soluble guanylate cyclase. Proc Natl Acad Sci USA. 86:5159-62. 133 K o , G . Y . , and P.T. Ke l ly . 1999. Nitric oxide acts as a postsynaptic signaling molecule in calcium/calmodulin-induced synaptic potentiation in hippocampal C A 1 pyramidal neurons. J Neurosci. 19:6784-94. Komalavilas, P. , and T . M . Lincoln . 1994. Phosphorylation of the inositol 1,4,5-trisphosphate receptor by cyclic GMP-dependent protein kinase. JBiol Chem. 269:8701-7. Komalavilas, P., and T . M . Lincoln. 1996. Phosphorylation of the inositol 1,4,5-trisphosphate receptor. Cycl ic GMP-dependent protein kinase mediates c A M P and c G M P dependent phosphorylation in the intact rat aorta. J Biol Chem. 271:21933-8. Konno, D . , J .A . K o , S. Usui , K . Hor i , H . Maruoka, M . Inui, T. Fujikado, Y . Tano, T. Suzuki, K . Tohyama, and K . Sobue. 2002. The postsynaptic density and dendritic raft localization of PSD-Zip70, which contains an N-myristoylation sequence and leucine-zipper motifs. J Cell Sci. 115:4695-706. Krumenacker, J.S., K . A . Hanafy, and F. Murad. 2004. Regulation of nitric oxide and soluble guanylyl cyclase. Brain Res Bull. 62:505-15. Kuhn, M . 2004. Molecular physiology of natriuretic peptide signalling. Basic Res Cardiol. 99:76-82. Kuo , J.F., and P . Greengard. 1970. Cycl ic nucleotide-dependent protein kinases. V I . Isolation and partial purification of a protein kinase activated by guanosine 3',5'-monophosphate. JBiol Chem. 245:2493-8. Kwiatkowski, A . V . , F . B . Gertler, and J J . Loureiro. 2003. Function and regulation of E n a / V A S P proteins. Trends Cell Biol. 13:386-92. Lacey, D.J . 1985. Normalization of dendritic spine numbers in rat hippocampus after termination of phenylacetate injections ( P K U model). Brain Res. 329:354-5. Lambrechts, A . , A . V . Kwiatkowski, L . M . Lanier, J .E. Bear, J . Vandekerckhove, C . Ampe, and F . B . Gertler. 2000. cAMP-dependent protein kinase phosphorylation of E V L , a M e n a / V A S P relative, regulates its interaction with actin and SH3 domains. J Biol Chem. 275:36143-51. Lander, H . M . , J.S. Ogiste, S.F. Pearce, R. Lev i , and A . Novogrodsky. 1995. Nitric oxide-stimulated guanine nucleotide exchange on p21ras. JBiol Chem. 270:7017-20. Landgraf, W . , F. Hofmann, J.T. Pelton, and J.P. Huggins. 1990. Effects of cyclic G M P on the secondary structure of cyclic G M P dependent protein kinase and analysis of the 134 enzyme's andno-terminal domain by far-ultraviolet circular dichroism. Biochemistry. 29:9921-8. Lanier, L . M . , M . A . Gates, W . Witke, A . S . Menzies, A . M . Wehman, J .D. Mackl is , D . Kwiatkowski, P. Soriano, and F . B . Gertler. 1999. Mena is required for neurulation and commissure formation. Neuron. 22:313-25. Laurent, V . , T.P. Loisel , B . Harbeck, A . Wehman, L . Grobe, B . M . Jockusch, J. Wehland, F . B . Gertler, and M . F . Carlier. 1999. Role of proteins of the E n a / V A S P family in actin-based motility of Listeria monocytogenes. J Cell Biol. 144:1245-58. Lee, H . K . , M . Barbarosie, K . Kameyama, M . F . Bear, and R . L . Huganir. 2000. Regulation of distinct A M P A receptor phosphorylation sites during bidirectional synaptic plasticity. Nature. 405:955-9. L'Etoile, N . D . , C M . Coburn, J . Eastham, A . Kistler, G . Gallegos, and C I . Bargmann. 2002. The cyclic GMP-dependent protein kinase E G L - 4 regulates olfactory adaptation in C . elegans. Neuron. 36:1079-89. Levin, E .R. , D . G . Gardner, and W . K . Samson. 1998. Natriuretic peptides. N Engl J Med. 339:321-8. Lev-Ram, V . , T. Jiang, J . Wood, D.S . Lawrence, and R . Y . Tsien. 1997. Synergies and coincidence requirements between N O , c G M P , and Ca2+ in the induction of cerebellar long-term depression. Neuron. 18:1025-38. L i , D.P. , S.R. Chen, T.F. Finnegan, and H . L . Pan. 2004. Signalling pathway of nitric oxide in synaptic G A B A release in the rat paraventricular nucleus. / Physiol. 554:100-10. Liao, D . , N . A . Hessler, and R. Malinow. 1995. Activation of postsynaptically silent synapses during pairing-induced L T P in C A 1 region of hippocampal slice. Nature. 375:400-4. L i n , J .W., M . Wyszynski, R. Madhavan, R. Sealock, J .U. K i m , and M . Sheng. 1998. Yotiao, a novel protein of neuromuscular junction and brain that interacts with specific splice variants of N M D A receptor subunit N R 1 . J Neurosci. 18:2017-27. Lincoln, T . M . , and J .D. Corbin. 1977. Adenosine 3':5'-cyclic monophosphate- and guanosine 3':5'-cyclic monophosphate-dependent protein kinases: possible homologous proteins. Proc Natl Acad Sci USA. 74:3239-43. Lincoln, T . M . , and J .D. Corbin. 1978. Purified cyclic GMP-dependent protein kinase catalyzes the phosphorylation of cardiac troponin inhibitory subunit (TN-1). J Biol Chem. 253:337-9. 135 Lincoln, T . M . , N . Dey, and H . Sellak. 2001. Invited review: cGMP-dependent protein kinase signaling mechanisms in smooth muscle: from the regulation of tone to gene expression. J Appl Physiol. 91:1421-30. Lincoln, T . M . , N . B . Dey, N . J . Boerth, T . L . Cornwell , and G . A . Soff. 1998. Nitr ic o x i d e -cyclic G M P pathway regulates vascular smooth muscle cell phenotypic modulation: implications in vascular diseases. Acta Physiol Scand. 164:507-15. Linden, D.J . , and J .A. Connor. 1992. Long-term Depression of Glutamate Currents in Cultured Cerebellar Purkinje Neurons Does Not Require Nitric Oxide Signalling. Eur J Neurosci. 4:10-15. Lipton, S.A. , Y . B . Choi , Z . H . Pan, S.Z. Le i , H .S . Chen, N . J . Sucher, J . Loscalzo, D .J . Singel, and J.S. Stamler. 1993. A redox-based mechanism for the neuroprotective and neurodestructive effects of nitric oxide and related nitroso-compounds. Nature. 364:626-32. Lisman, J . 2003. Actin's actions in LTP-induced synapse growth. Neuron. 38:361-2. L i u , L . , A . Hausladen, M . Zeng, L . Que, J. Heitman, and J.S. Stamler. 2001. A metabolic enzyme for S-nitrosothiol conserved from bacteria to humans. Nature. 410:490-4. Lohmann, S . M . , A . B . Vaandrager, A . Smolenski, U . Walter, and H .R . De Jonge. 1997. Distinct and specific functions of cGMP-dependent protein kinases. Trends Biochem Sci. 22:307-12. Lohmann, S . M . , U . Walter, P .E . Mi l le r , P. Greengard, and P. De Cami l l i . 1981. Immunohistochemical localization of cyclic GMP-dependent protein kinase in mammalian brain. Proc Natl Acad Sci USA. 78:653-7. L u , Y . F . , E .R . Kandel, and R . D . Hawkins. 1999. Nitric oxide signaling contributes to late-phase L T P and C R E B phosphorylation in the hippocampus. J Neurosci. 19:10250-61. Lucas, K . A . , G . M . Pitari, S. Kazerounian, I. Ruiz-Stewart, J . Park, S. Schulz, K . P . Chepenik, and S.A. Waldman. 2000. Guanylyl cyclases and signaling by cyclic G M P . Pharmacol Rev. 52:375-414. Luscher, C , R . A . N ico l l , R . C . Malenka, and D . Muller . 2000. Synaptic plasticity and dynamic modulation of the postsynaptic membrane. Nat Neurosci. 3:545-50. MacMil lan-Crow, L . A . , J .E. Murphy-Ullr ich, and T . M . Lincoln. 1994. Identification and possible localization of cGMP-dependent protein kinase in bovine aortic endothelial cells. Biochem Biophys Res Commun. 201:531-7. 136 Malenka, R.C., and R.A. Nicoll. 1999. Long-term potentiation--a decade of progress? Science. 285:1870-4. Maletic-Savatic, M., R. Malinow, and K. Svoboda. 1999. Rapid dendritic morphogenesis in CA1 hippocampal dendrites induced by synaptic activity. Science. 283:1923-7. Manenti, S., O. Sorokine, A. Van Dorsselaer, and H. Taniguchi. 1993. Isolation of the non-myristoylated form of a major substrate of protein kinase C (MARCKS) from bovine brain. J Biol Chem. 268:6878-81. Manenti, S., O. Sorokine, A. Van Dorsselaer, and H. Taniguchi. 1994. Demyristoylation of the major substrate of protein kinase C (MARCKS) by the cytoplasmic fraction of brain synaptosomes. J Biol Chem. 269:8309-13. Markert, T., A.B. Vaandrager, S. Gambaryan, D. Pohler, C. Hausler, U . Walter, H.R. De Jonge, T. Jarchau, and S.M. Lohmann. 1995. Endogenous expression of type II cGMP-dependent protein kinase mRNA and protein in rat intestine. Implications for cystic fibrosis transmembrane conductance regulator. J Clin Invest. 96:822-30. Marsden, P.A., KT. Schappert, H.S. Chen, M. Flowers, C.L. Sundell, J.N. Wilcox, S. Lamas, and T. Michel. 1992. Molecular cloning and characterization of human endothelial nitric oxide synthase. FEBS Lett. 307:287-93. Matthews, J.R., CH. Botting, M. Panico, H.R. Morris, and R.T. Hay. 1996. Inhibition of NF-kappaB DNA binding by nitric oxide. Nucleic Acids Res. 24:2236-42. McCabe, J.B., and L.G. Berthiaume. 2001. N-terminal protein acylation confers localization to cholesterol, sphingolipid-enriched membranes but not to lipid rafts/caveolae. Mol Biol Cell. 12:3601-17. Michel, T., and S. Lamas. 1992. Molecular cloning of constitutive endothelial nitric oxide synthase: evidence for a family of related genes. / Cardiovasc Pharmacol. 20 Suppl 12:S45-9. Micheva, K.D., J. Buchanan, R.W. Holz, and SJ. Smith. 2003. Retrograde regulation of synaptic vesicle endocytosis and recycling. Nat Neurosci. 6:925-32. Miglietta, L.A., and D.L. Nelson. 1988. A novel cGMP-dependent protein kinase from Paramecium. J Biol Chem. 263:16096-105. Milner, B., L.R. Squire, and E.R. Kandel. 1998. Cognitive neuroscience and the study of memory. Neuron. 20:445-68. 137 Mitsutomi, N . , C . Akashi , J . Odagiri, and Y . Matsumura. 1999. Effects of endogenous and exogenous nitric oxide on endothelin-1 production in cultured vascular endothelial cells. Eur J Pharmacol. 364:65-73. Mochly-Rosen, D . , H . Khaner, and J . Lopez. 1991. Identification of intracellular receptor proteins for activated protein kinase C . Proc Natl Acad Sci USA. 88:3997-4000. Mogilner, A . , and G . Oster. 1996. Ce l l motility driven by actin polymerization. Biophys J. 71:3030-45. Mogilner, A . , and G . Oster. 2003. Force generation by actin polymerization U : the elastic ratchet and tethered filaments. Biophys J. 84:1591-605. Moncada, S., R . M . Palmer, and E . A . Higgs. 1991. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol Rev. 43:109-42. Monfort, P., M . D . Munoz, E . Kosenko, and V . Felipo. 2002. Long-term potentiation in hippocampus involves sequential activation of soluble guanylate cyclase, c G M P -dependent protein kinase, and cGMP-degrading phosphodiesterase. J Neurosci. 22:10116-22. Monken, C . E . , and G . N . G i l l . 1980. Structural analysis of cGMP-dependent protein kinase using limited proteolysis. JBiol Chem. 255:7067-70. Montague, P.R., C D . Gancayco, M . J . Winn, R . B . Marchase, and M . J . Friedlander. 1994. Role of N O production in N M D A receptor-mediated neurotransmitter release in cerebral cortex. Science. 263:973-7. Muller , D . , N . Toni , and P . A . Buchs. 2000. Spine changes associated with long-term potentiation. Hippocampus. 10:596-604. Munoz-Cueto, J .A. , L . M . Garcia-Segura, and A . Ruiz-Marcos. 1990. Developmental sex differences and effect of ovariectomy on the number of cortical pyramidal cell dendritic spines. Brain Res. 515:64-8. Murofushi, H . 1974. Protein kinases in Tetrahymena cil ia, n. Partial purification and characterization of adenosine 3',5'-monophosphate-dependent and guanosine 3',5'-monophosphate-dependent protein kinases. Biochim Biophys Acta. 370:130-9. Murphy, K . P . , and T . V . Bliss. 1999. Photolytically released nitric oxide produces a delayed but persistent suppression of L T P in area C A 1 of the rat hippocampal slice. J Physiol. 515(Pt2) :453-62. 138 Murray, D . , N . Ben-Tal, B . Honig, and S. McLaughl in . 1997. Electrostatic interaction of myristoylated proteins with membranes: simple physics, complicated biology. Structure. 5:985-9. Murthy, K . S . , and G . M . Makhlouf. 1999. Identification of the G protein-activating domain of the natriuretic peptide clearance receptor (NPR-C) . J Biol Chem. 274:17587-92. Nathan, C . 1992. Nitric oxide as a secretory product of mammalian cells. Faseb J. 6:3051-64. N i c o l l , R . A . , and R . C . Malenka. 1999. Expression mechanisms underlying N M D A receptor-dependent long-term potentiation. Ann N Y Acad Sci. 868:515-25. Nishida, K . , D . G . Harrison, J.P. Navas, A . A . Fisher, S.P. Dockery, M . Uematsu, R . M . Nerem, R . W . Alexander, and T.J. Murphy. 1992. Molecular cloning and characterization of the constitutive bovine aortic endothelial cel l nitric oxide synthase. J Clin Invest. 90:2092-6. O'Kusky, J.R., and M . G . Norman. 1994. Sudden infant death syndrome: increased synaptic density in the central reticular nucleus of the medulla. J Neuropathol Exp Neurol. 53:263-71. Orstavik, S., M . Sandberg, D . Berube, V . Natarajan, J . Simard, U . Walter, R. Gagne, V . Hansson, and T. Jahnsen. 1992. Localization of the human gene for the type I cyclic GMP-dependent protein kinase to chromosome 10. Cytogenet Cell Genet. 59:270-3. Orstavik, S., R. Solberg, K . Tasken, M . Nordahl, M . R . Altherr, V . Hansson, T. Jahnsen, and M . Sandberg. 1996. Molecular cloning, c D N A structure, and chromosomal localization of the human type LI cGMP-dependent protein kinase. Biochem Biophys Res Commun. 220:759-65. Osborne, K . A . , A . Robichon, E . Burgess, S. Butland, R . A . Shaw, A . Coulthard, H .S . Pereira, R.J . Greenspan, and M . B . Sokolowski. 1997. Natural behavior polymorphism due to a cGMP-dependent protein kinase of Drosophila. Science. 277:834-6. Palmer, R . M . , A . G . Ferrige, and S. Moncada. 1987. Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature. 327:524-6. Parenti, A . , L . Morbidel l i , X . L . Cu i , J .G. Douglas, J .D. Hood, H . J . Granger, F . Ledda, and M . Ziche. 1998. Nitric oxide is an upstream signal of vascular endothelial growth factor-induced extracellular signal-regulated kinase 1/2 activation in postcapillary endothelium. J Biol Chem. 273:4220-6. 139 Peitzsch, R.M., and S. McLaughlin. 1993. Binding of acylated peptides and fatty acids to phospholipid vesicles: pertinence to myristoylated proteins. Biochemistry. 32:10436-43. Pfeifer, A., A. Aszodi, U. Seidler, P. Ruth, F. Hofmann, and R. Fassler. 1996. Intestinal secretory defects and dwarfism in mice lacking cGMP-dependent protein kinase U. Science. 274:2082-6. Pfeifer, A., P. Ruth, W. Dostmann, M. Sausbier, P. Klatt, and F. Hofmann. 1999. Structure and function of cGMP-dependent protein kinases. Rev Physiol Biochem Pharmacol. 135:105-49. Pilz, R.B., and D.E. Casteel. 2003. Regulation of gene expression by cyclic GMP. Circ Res. 93:1034-46. Pilz, R.B., M. Suhasini, S. Idriss, J.L. Meinkoth, and G.R. Boss. 1995. Nitric oxide and cGMP analogs activate transcription from AP-1-responsive promoters in mammalian cells. Faseb J. 9:552-8. Prast, H., and A. Philippu. 1992. Nitric oxide releases acetylcholine in the basal forebrain. Eur J Pharmacol. 216:139-40. Pryzwansky, K.B., S. Kidao, T.A. Wyatt, W. Reed, and T.M. Lincoln. 1995. Localization of cyclic GMP-dependent protein kinase in human mononuclear phagocytes. J Leukoc Biol. 57:670-8. Qian, Y., D.S. Chao, D.R. Santillano, T.L. Cornwell, A.C. Nairn, P. Greengard, T.M. Lincoln, and D.S. Bredt. 1996. cGMP-dependent protein kinase in dorsal root ganglion: relationship with nitric oxide synthase and nociceptive neurons. J Neurosci. 16:3130-8. Quattrochi, J.J., P.T. McBride, and AJ. Yates. 1985. Brainstem immaturity in sudden infant death syndrome: a quantitative rapid Golgi study of dendritic spines in 95 infants. Brain Res. 325:39-48. Raeymaekers, L., J.A. Eggermont, F. Wuytack, and R. Casteels. 1990. Effects of cyclic nucleotide dependent protein kinases on the endoplasmic reticulum Ca2+ pump of bovine pulmonary artery. Cell Calcium. 11:261-8. Rao, A., E.M. Cha, and A.M. Craig. 2000. Mismatched appositions of presynaptic and postsynaptic components in isolated hippocampal neurons. J Neurosci. 20:8344-53. 140 Rao, A . , and A . M . Craig. 2000. Signaling between the actin cytoskeleton and the postsynaptic density of dendritic spines. Hippocampus. 10:527-41. Reinhard, M . , M . Halbrugge, U. Scheer, C . Wiegand, B . M . Jockusch, and U. Walter. 1992. The 46/50 k D a phosphoprotein V A S P purified from human platelets is a novel protein associated with actin filaments and focal contacts. Embo J. 11:2063-70. Resh, M . D . 1999. Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins. Biochim Biophys Acta. 1451:1-16. Rialas, C M . , M . Nomizu, M . Patterson, H . K . Kleinman, C . A . Weston, and B .S . Weeks. 2000. Nitric oxide mediates laminin-induced neurite outgrowth in P C 12 cells. Exp Cell Res. 260:268-76. Richie-Jannetta, R., S .H. Francis, and J .D. Corbin. 2003. Dimerization of cGMP-dependent protein kinase Ibeta is mediated by an extensive amino-terminal leucine zipper motif, and dimerization modulates enzyme function. J Biol Chem. 278:50070-9. Rodriguez-Pascual, F., R. Ferrero, M . T . Miras-Portugal, and M . Torres. 1999. Phosphorylation of tyrosine hydroxylase by cGMP-dependent protein kinase in intact bovine chromaffin cells. Arch Biochem Biophys. 366:207-14. Rubin, C S . 1994. A kinase anchor proteins and the intracellular targeting of signals carried by cyclic A M P . Biochim Biophys Acta. 1224:467-79. Ruth, P., A . Pfeifer, S. Kamm, P. Klatt, W . R . Dostmann, and F. Hofmann. 1997. Identification of the amino acid sequences responsible for high affinity activation of c G M P kinase Ialpha. J Biol Chem. 272:10522-8. Sandberg, M . , V . Natarajan, I. Ronander, D . Kalderon, U . Walter, S . M . Lohmann, and T. Jahnsen. 1989. Molecular cloning and predicted full-length amino acid sequence of the type I beta isozyme of cGMP-dependent protein kinase from human placenta. Tissue distribution and developmental changes in rat. FEBS Lett. 255:321-9. Sauzeau, V . , H . Le Jeune, C . Cario-Toumaniantz, A . Smolenski, S . M . Lohmann, J . Bertoglio, P. Chardin, P. Pacaud, and G . Loirand. 2000. Cycl ic GMP-dependent protein kinase signaling pathway inhibits RhoA-induced Ca2+ sensitization of contraction in vascular smooth muscle. J Biol Chem. 275:21722-9. Sauzeau, V . , M . Rolli-Derkinderen, C . Marionneau, G . Loirand, and P . Pacaud. 2003. R h o A expression is controlled by nitric oxide through cGMP-dependent protein kinase activation. J Biol Chem. 278:9472-80. 141 Schlossmann, J. , R. Fei l , and F. Hofmann. 2003. Signaling through N O and c G M P -dependent protein kinases. Ann Med. 35:21-7. Schmidt, H . H . , S . M . Lohmann, and U . Walter. 1993. The nitric oxide and c G M P signal transduction system: regulation and mechanism of action. Biochim Biophys Acta. 1178:153-75. Schuman, E . M . , and D . V . Madison. 1994. Locally distributed synaptic potentiation in the hippocampus. Science. 263:532-6. Schuman, E . M . , M . K . Meffert, H . Schulman, and D . V . Madison. 1994. A n A D P -ribosyltransferase as a potential target for nitric oxide action in hippocampal long-term potentiation. Proc Natl Acad Sci USA. 91:11958-62. Schwarz, A . , E . Rapaport, K . Hirschberg, and A . H . Futerman. 1995. A regulatory role for sphingolipids in neuronal growth. Inhibition of sphingolipid synthesis and degradation have opposite effects on axonal branching. JBiol Chem. 270:10990-8. Scott, C .W. , and M . C . Mumby. 1985. Phosphorylation of type II regulatory subunit of cAMP-dependent protein kinase in intact smooth muscle. JBiol Chem. 260:2274-80. Selig, D . K . , M . R . Segal, D . Liao, R . C . Malenka, R . Mal inow, R . A . N i c o l l , and J .E. Lisman. 1996. Examination of the role of c G M P in long-term potentiation in the C A 1 region of the hippocampus. Learn Mem. 3:42-8. Sessa, W . C . , J .K . Harrison, C M . Barber, D . Zeng, M . E . Durieux, D . D . D'Angelo, K . R . Lynch, and M J . Peach. 1992. Molecular cloning and expression of a c D N A encoding endothelial cell nitric oxide synthase. JBiol Chem. 267:15274-6. Shors, T.J., and L . D . Matzel . 1997. Long-term potentiation: what's learning got to do with it? Behav Brain Sci. 20:597-614; discussion 614-55. Sim, A . T . , and J .D. Scott. 1999. Targeting of P K A , P K C and protein phosphatases to cellular microdomains. Cell Calcium. 26:209-17. Sistiaga, A . , M . T . Miras-Portugal, and J . Sanchez-Prieto. 1997. Modulation of glutamate release by a nitric oxide/cyclic GMP-dependent pathway. Eur J Pharmacol. 321:247-57. Smith, J .A. , S .H. Francis, K . A . Walsh, S. Kumar, and J .D. Corbin. 1996. Autophosphorylation of type Ibeta cGMP-dependent protein kinase increases basal catalytic activity and enhances allosteric activation by c G M P or c A M P . JBiol Chem. 271:20756-62. 142 Snyder, S.H. , and D .S . Bredt. 1992. Biological roles of nitric oxide. Sci Am. 266:68-71,74-7. Son, H . , R . D . Hawkins, K . Martin, M . Kiebler, P . L . Huang, M . C . Fishman, and E .R. Kandel. 1996. Long-term potentiation is reduced in mice that are doubly mutant in endothelial and neuronal nitric oxide synthase. Cell. 87:1015-23. Son, H . , Y . F . L u , M . Zhuo, O. Arancio, E .R. Kandel, and R . D . Hawkins. 1998. The specific role of c G M P in hippocampal L T P . Learn Mem. 5:231-45. Song, H . , G . M i n g , Z . He, M . Lehmann, L . McKerracher, M . Tessier-Lavigne, and M . Poo. 1998. Conversion of neuronal growth cone responses from repulsion to attraction by cyclic nucleotides. Science. 281:1515-8. Sorkin, L . S . 1993. N M D A evokes an L - N A M E sensitive spinal release of glutamate and citrulline. Neuroreport. 4:479-82. Stamler, J.S. 1994. Redox signaling: nitrosylation and related target interactions of nitric oxide. Cell. 78:931-6. Stansberry, J. , E J . Baude, M . K . Taylor, P J . Chen, S.W. Jin, R . E . El l i s , and M . D . Uhler. 2001. A cGMP-dependent protein kinase is implicated in wild-type motility in C . elegans. J Neurochem. 76:1177-87. Suhasini, M . , H . L i , S . M . Lohmann, G.R. Boss, and R . B . P i l z . 1998. Cyclic-GMP-dependent protein kinase inhibits the Ras/Mitogen-activated protein kinase pathway. Mol Cell Biol. 18:6983-94. Surks, H . K . , N . Mochizuki , Y . Kasai, S.P. Georgescu, K . M . Tang, M . Ito, T . M . Lincoln , and M . E . Mendelsohn. 1999. Regulation of myosin phosphatase by a specific interaction with c G M P - dependent protein kinase Ialpha. Science. 286:1583-7. Susswein, A . J . , A . Katzoff, N . Mil ler , and I. Hurwitz. 2004. Nitric oxide and memory. Neuroscientist. 10:153-62. Takashima, S., and L . E . Becker. 1985. Developmental abnormalities of medullary "respiratory centers" in sudden infant death syndrome. Exp Neurol. 90:580-7. Takashima, S., T. Mi to , and L . E . Becker. 1985. Neuronal development in the medullary reticular formation in sudden infant death syndrome and premature infants. Neuropediatrics. 16:76-9. 143 Takio, K . , R . D . Wade, S.B. Smith, E . G . Krebs, K . A . Walsh, and K . Titani. 1984. Guanosine cyclic 3',5'-phosphate dependent protein kinase, a chimeric protein homologous with two separate protein families. Biochemistry. 23:4207-18. Taniguchi, H . 1999. Protein myristoylation in protein-lipid and protein-protein interactions. Biophys Chem. 82:129-37. Taylor, M . K . , R. Ahmed, M . Begley, and M . D . Uhler. 2002. Autoinhibition and isoform-specific dominant negative inhibition of the type II cGMP-dependent protein kinase. JBiol Chem. 277:37242-53. Thiriet, N . , L . Esteve, D . Aunis, and J . Zwiller. 1997. Immediate early gene induction by natriuretic peptides in P C 12 phaeochromocytoma and C 6 glioma cells. Neuroreport. 8:399-402. Thomas, M . K . , S .H. Francis, and J .D. Corbin. 1990a. Characterization of a purified bovine lung cGMP-binding c G M P phosphodiesterase. JBiol Chem. 265:14964-70. Thomas, M . K . , S .H. Francis, and J .D. Corbin. 1990b. Substrate- and kinase-directed regulation of phosphorylation of a cGMP-binding phosphodiesterase by c G M P . / Biol Chem. 265:14971-8. Tobin, J.R., L . K . Gorman, M . G . Baxter, and R.J . Traystman. 1995. Nitr ic oxide synthase inhibition does not impair visual or spatial discrimination learning. Brain Res. 694:177-82. Towler, D . A . , S.P. Adams, S.R. Eubanks, D.S . Towery, E . Jackson-Machelski, L . Glaser, and J.I. Gordon. 1987. Purification and characterization of yeast myristoyl CoA:protein N-myristoyltransferase. Proc Natl Acad Sci USA. 84:2708-12. Towler, D . A . , J.I. Gordon, S.P. Adams, and L . Glaser. 1988. The biology and enzymology of eukaryotic protein acylation. Annu Rev Biochem. 57:69-99. Trimm, K . R . , and V . Rehder. 2004. Nitric oxide acts as a slow-down and search signal in developing neurites. Eur J Neurosci. 19:809-18. Uhler, M . D . 1993. Cloning and expression of a novel cyclic GMP-dependent protein kinase from mouse brain. JBiol Chem. 268:13586-91. Vaandrager, A . B . , E . M . Ehlert, T. Jarchau, S . M . Lohmann, and H .R . de Jonge. 1996. N -terminal myristoylation is required for membrane localization of cGMP-dependent protein kinase type II. JBiol Chem. 271:7025-9. 144 Vaandrager, A . B . , B . M . Hogema, M . Edixhoven, C M . van den Burg, A . G . Bot, P. Klatt, P. Ruth, F. Hofmann, J . Van Damme, J . Vandekerckhove, and H . R . de Jonge. 2003. Autophosphorylation of cGMP-dependent protein kinase type U . J Biol Chem. 278:28651-8. Vaandrager, A . B . , A . Smolenski, B . C . Ti l ly , A . B . Houtsmuller, E . M . Ehlert, A . G . Bot, M . Edixhoven, W . E . Boomaars, S . M . Lohmann, and H . R . de Jonge. 1998. Membrane targeting of cGMP-dependent protein kinase is required for cystic fibrosis transmembrane conductance regulator C l - channel activation. Proc Natl Acad Sci U S A. 95:1466-71. Vaandrager, A . B . , B . C . T i l ly , A . Smolenski, S. Schneider-Rasp, A . G . Bot, M . Edixhoven, B . J. Scholte, T. Jarchau, U . Walter, S . M . Lohmann, W . C Poller, and H . R . de Jonge. 1997. c G M P stimulation of cystic fibrosis transmembrane conductance regulator C l -channels co-expressed with cGMP-dependent protein kinase type II but not type Ibeta. JBiol Chem. 272:4195-200. Van Epps-Fung, C , J.P. Will iams, T . L . Cornwell, T . M . Lincoln , J . M . McDonald , W . Radding, and H . C . Blair . 1994. Regulation of osteoclastic acid secretion by c G M P -dependent protein kinase. Biochem Biophys Res Commun. 204:565-71. Van Wagenen, S., and V . Rehder. 1999. Regulation of neuronal growth cone filopodia by nitric oxide. J Neurobiol. 39:168-85. Vincent, S.R. 1994. Nitric oxide: a radical neurotransmitter in the central nervous system. Prog Neurobiol. 42:129-60. Viner, R . L , D . A . Ferrington, T .D . Will iams, D . J . Bigelow, and C . Schoneich. 1999. Protein modification during biological aging: selective tyrosine nitration of the S E R C A 2 a isoform of the sarcoplasmic reticulum Ca2+-ATPase in skeletal muscle. Biochem J. 340 (P t 3):657-69. V o , N . K . , J . M . Gettemy, and V . M . Coghlan. 1998. Identification of cGMP-dependent protein kinase anchoring proteins ( G K A P s ) . Biochem Biophys Res Commun. 246:831-5. Walaas, S.I., J .A . Girault, and P. Greengard. 1989. Localization of cyclic GMP-dependent protein kinase in rat basal ganglia neurons. J Mol Neurosci. 1:243-50. Walders-Harbeck, B . , S .Y . Khaiflina, H . Hinssen, B . M . Jockusch, and S. Fllenberger. 2002. The vasodilator-stimulated phosphoprotein promotes actin polymerisation through direct binding to monomeric actin. FEBS Lett. 529:275-80. 145 Waldmann, R., S. Bauer, C . Gobel, F. Hofmann, K . H . Jakobs, and U. Walter. 1986. Demonstration of cGMP-dependent protein kinase and cGMP-dependent phosphorylation in cell-free extracts of platelets. Eur J Biochem. 158:203-10. Wang, G.R. , Y . Zhu, P . V . Halushka, T . M . Lincoln, and M . E . Mendelsohn. 1998. Mechanism of platelet inhibition by nitric oxide: in vivo phosphorylation of thromboxane receptor by cyclic GMP-dependent protein kinase. Proc Natl Acad Sci USA. 95:4888-93. Wang, J .H. , and P.T. Ke l ly . 1995. Postsynaptic injection of C A 2 + / C a M induces synaptic potentiation requiring C a M K I I and P K C activity. Neuron. 15:443-52. Wang, X . , S. Bruderer, Z . Rafi, J . Xue, P J . Milburn, A . Kramer, and P J . Robinson. 1999. Phosphorylation of splicing factor SF1 on Ser20 by cGMP-dependent protein kinase regulates spliceosome assembly. Embo J. 18:4549-59. Wang, X . , and P J . Robinson. 1995. Cycl ic GMP-dependent protein kinase substrates in rat brain. J Neurochem. 65:595-604. Wang, X . , and P J . Robinson. 1997. Cycl ic GMP-dependent protein kinase and cellular signaling in the nervous system. J Neurochem. 68:443-56. Wanner, R., and B . Wurster. 1990. Cycl ic GMP-activated protein kinase from Dictyostelium discoideum. Biochim Biophys Acta. 1053:179-84. Wernet, W. , V . Flockerzi, and F. Hofmann. 1989. The c D N A of the two isoforms of bovine cGMP-dependent protein kinase. FEBS Lett. 251:191-6. Wolfe, L . , J .D. Corbin, and S.H. Francis. 1989a. Characterization of a novel isozyme of cGMP-dependent protein kinase from bovine aorta. JBiol Chem. 264:7734-41. Wolfe, L . , S .H. Francis, and J .D. Corbin. 1989b. Properties of a cGMP-dependent monomeric protein kinase from bovine aorta. JBiol Chem. 264:4157-62. Wolven, A . , H . Okamura, Y . Rosenblatt, and M . D . Resh. 1997. Palmitoylation of p59fyn is reversible and sufficient for plasma membrane association. Mol Biol Cell. 8:1159-73. Wood, W. , and P. Martin. 2002. Structures in focus—filopodia. Int J Biochem Cell Biol. 34:726-30. W u , J., Y . Wang, M J . Rowan, and R. A n w y l . 1997. Evidence for involvement of the neuronal isoform of nitric oxide synthase during induction of long-term potentiation and long-term depression in the rat dentate gyrus in vitro. Neuroscience. 78:393-8. 146 W u , J., Y . Wang, M J . Rowan, and R. Anwyl . 1998. Evidence for involvement of the c G M P -protein kinase G signaling system in the induction of long-term depression, but not long-term potentiation, in the dentate gyrus in vitro. J Neurosci. 18:3589-96. W u , W . C . , S.I. Walaas, A . C . Nairn, and P. Greengard. 1982. Calcium/phospholipid regulates phosphorylation of a M r "87k" substrate protein in brain synaptosomes. Proc Natl Acad Sci USA. 79:5249-53. Wyatt, T . A . , T . M . Lincoln, and K . B . Pryzwansky. 1991. Vimentin is transiently co-localized with and phosphorylated by cyclic GMP-dependent protein kinase in formyl-peptide-stimulated neutrophils. JBiol Chem. 266:21274-80. X i e , Q.W., H .J . Cho, J . Calaycay, R . A . Mumford, K . M . Swiderek, T . D . Lee, A . Ding , T. Troso, and C . Nathan. 1992. Cloning and characterization of inducible nitric oxide synthase from mouse macrophages. Science. 256:225-8. Xue, J., P J . Milburn, B . T . Hanna, M . E . Graham, J .A . Rostas, and P J . Robinson. 2004. Phosphorylation of Septin 3 on Ser-91 by cyclic GMP-dependent protein kinase-I in nerve terminals. Biochem J. Pt. Xue , J. , X . Wang, C.S . Mal ladi , M . Kinoshita, P J . Milburn, I. Lengyel, J .A . Rostas, and P J . Robinson. 2000. Phosphorylation of a new brain-specific septin, G-septin, by c G M P -dependent protein kinase. JBiol Chem. 275:10047-56. Yamashita, J . , H . Itoh, Y . Ogawa, N . Tamura, K . Takaya, T. Igaki, K . D o i , T . H . Chun, M . Inoue, K . Masatsugu, and K . Nakao. 1997. Opposite regulation of Gax homeobox expression by angiotensin IJ and C-type natriuretic peptide. Hypertension. 29:381-7. Y o o , J .Y . , and A . W . Hamburger. 1998. The use of the yeast two hybrid system to evaluate ErbB-3 interactions with SH2 domain containing proteins. Biochem Biophys Res Commun. 251:903-6. Y u , S . M . , L . M . Hung, and C . C . L i n . 1997. cGMP-elevating agents suppress proliferation of vascular smooth muscle cells by inhibiting the activation of epidermal growth factor signaling pathway. Circulation. 95:1269-77. Yuasa, K . , H . Michibata, K . Omori, and N . Yanaka. 1999. A novel interaction of c G M P -dependent protein kinase I with troponin T. JBiol Chem. 274:37429-34. Yuasa, K . , K . Omori, and N . Yanaka. 2000. Binding and phosphorylation of a novel male germ cell-specific cGMP-dependent protein kinase-anchoring protein by c G M P -dependent protein kinase Ialpha. JBiol Chem. 275:4897-905. 147 Zha, J. , S. Weiler, K J . Oh, M . C . We i , and S.J. Korsmeyer. 2000. Posttranslational N -myristoylation of B I D as a molecular switch for targeting mitochondria and apoptosis. Science. 290:1761-5. Zhang, R., L . Wang, L . Zhang, J . Chen, Z . Zhu, Z . Zhang, and M . Chopp. 2003. Nitr ic oxide enhances angiogenesis via the synthesis of vascular endothelial growth factor and c G M P after stroke in the rat. Circ Res. 92:308-13. Zhuo, M . , Y . H u , C . Schultz, E .R . Kandel, and R . D . Hawkins. 1994a. Role of guanylyl cyclase and cGMP-dependent protein kinase in long-term potentiation. Nature. 368:635-9. Zhuo, M . , E .R . Kandel, and R . D . Hawkins. 1994b. Nitric oxide and c G M P can produce either synaptic depression or potentiation depending on the frequency of presynaptic stimulation in the hippocampus. Neuroreport. 5:1033-6. Z iv , N . E . , and S J . Smith. 1996. Evidence for a role of dendritic filopodia in synaptogenesis and spine formation. Neuron. 17:91-102. Zou, M . H . , T. Kle in , J.P. Pasquet, and V . Ul l r ich . 1998. Interleukin lbeta decreases prostacyclin synthase activity in rat mesangial cells via endogenous peroxynitrite formation. Biochem J. 336 (P t 2):507-12. 148 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0092443/manifest

Comment

Related Items