Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

LL-37, a human host defense peptide with immunomodulatory properties Bowdish, Dawn Marie Edith 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-104694.pdf [ 17.32MB ]
Metadata
JSON: 831-1.0092442.json
JSON-LD: 831-1.0092442-ld.json
RDF/XML (Pretty): 831-1.0092442-rdf.xml
RDF/JSON: 831-1.0092442-rdf.json
Turtle: 831-1.0092442-turtle.txt
N-Triples: 831-1.0092442-rdf-ntriples.txt
Original Record: 831-1.0092442-source.json
Full Text
831-1.0092442-fulltext.txt
Citation
831-1.0092442.ris

Full Text

LL-37, A H U M A N  HOST DEFENCE  PEPTIDE WITH  IMMUNOMODULATORY  PROPERTIES  by D A W N MARIE EDITH BOWDISH B.Sc. (Honours Microbiology), University of Guelph, 2000 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF T H E REQUIREMENTS FOR T H E D E G R E E OF DOCTOR OF PHILOSOPHY in T H E FACULTY OF GRADUATE STUDIES (MICROBIOLOGY)  T H E UNIVERSITY OF BRITISH COLUMBIA JULY 2005 © Dawn M.E.Bowdish,  2005  Abstract H u m a n cationic antimicrobial protein-18 ( h C A P - 1 8 ) is the sole h u m a n cathelicidin. It is found at high concentrations in the specific granules o f neutrophils, is modestly expressed by epithelial and other cells and can be induced during the course o f infection and/or inflammation. The mature, extracellular form o f h C A P - 1 8 is termed L L - 3 7 , w h i c h is a positively-charged, 37amino acid peptide. components whether  Neutrophil-derived host defence peptides  o f the non-oxidative killing mechanisms  LL-37  concentrations.  kills  bacteria  directly  at  mucosal  I demonstrated that although L L - 3 7  were initially discovered  o f neutrophils; however, surfaces  where  is antimicrobial  it  is  it is unclear  found  in vitro  as  at  lower  under low salt  conditions, it has little or no antimicrobial activity in m e d i a containing physiologically relevant cation concentrations. T h u s I hypothesised that direct antimicrobial activity was probably not its primary function investigated  in vivo  at mucosal surfaces. T h e immunomodulatory properties o f L L - 3 7 were  in tissue culture media w h i c h contains physiological concentrations  o f cations.  W h e n monocytes were treated with L L - 3 7 , lipopolysaccharide ( L P S ) - i n d u c e d production o f proinflammatory cytokines was blocked but T N F - a - induced cytokine production was  unaffected  and I L - i p - i n d u c e d cytokine production was enhanced. Consistent w i t h this observation, L L - 3 7 was  able to b l o c k L P S - i n d u c e d translocation o f the p65  subunit  o f the pro-inflammatory  transcription factor, N F - K B . Other early signalling events mediated b y L L - 3 7 included activation o f two mitogen-activated protein kinases, p38 and extracellular-regulated kinase. T h e activation o f these kinases was required for I L - 8 transcription and release as w e l l as transcription o f the chemokines  MIP-la,  MIP-ip,  and M C P - 1 .  T h e activation o f these kinases  and  subsequent  production and release o f I L - 8 c o u l d be synergistically increased b y the presence o f granulocyte macrophage-colony stimulating factor, but not related cytokines, indicating that the composition o f the inflammatory m i l i e u m a y affect monocyte responses to L L - 3 7 . T h e data presented here demonstrate inflammatory  that  LL-37  properties  is  a multi-functional immunomodulator with both pro- and anti-  which  are maintained at p h y s i o l o g i c a l  cation  concentrations.  The  observation that L L - 3 7 induced chemokines production suggests that it m a y recruit leukocytes to sites o f infection  or inflammation thus providing a possible  antimicrobial properties o f this peptide  explanation  for the  observed  in vivo.  ii  T a b l e of Contents  LL-37, A H U M A N H O S T D E F E N C E PEPTIDE W I T H I M M U N O M O D U L A T O R Y P R O P E R T I E S  I  ABSTRACT  I  T A B L E OF CONTENTS  Ill  LIST O F T A B L E S  V  LIST O F F I G U R E S  VI  LIST O F A B B R E V I A T I O N S ACKNOWLEDGEMENTS STATEMENT OF AUTHORSHIP 1.0  INTRODUCTION  1.1 1.2 1.3 1.4  1.5 1.6  1.7 1.8 2.0  HOST DEFENCE PEPTIDES OF MAMMALS ANTIMICROBIAL OR HOST DEFENCE PEPTIDES? EVIDENCE FOR ANTIMICROBIAL ACTIVITY IN VITRO ANTIMICROBIAL ACTIVITY IN VIVO IMMUNOMODULATORY PROPERTIES OF CATHELICIDINS MODEL FOR THE PHYSIOLOGICAL ROLE OF L L - 3 7 HYPOTHESIS AND EXPERIMENTAL GOALS BIBLIOGRAPHY I M M U N O M O D U L A T O R Y ACTIVITIES O F S M A L L H O S T D E F E N C E PEPTIDES  2.1 2.2 2.3 2.4 2.5 3.0  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION BIBLIOGRAPHY T H E H U M A N C A T I O N I C PEPTIDE LL-37 INDUCES A C T I V A T I O N O F T H E E X T R A C E L L U L A R S I G N A L R E G U L A T E D K I N A S E A N D P38 K I N A S E P A T H W A Y S IN PRIMARY HUMAN MONOCYTES  3.1 3.2 3.3 3.4 3.5 4.0  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION BIBLIOGRAPHY LL-37 IS A P O T E N T A N T I - E N D O T O X I C A G E N T W I T H M U L T I P L E M E C H A N I S M S OF ACTION  4.1 4.2 4.3 4.4 4.5 5.0  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION BIBLIOGRAPHY  VIII X XI 1  2 5 5 7  10 15 16 24  25 26 28 33 35  39  40 41 45 53 57 61  62 63 66 71 74  LL-37 INDUCES R A P I D & E A R L Y C H E M O K I N E P R O D U C T I O N V I A A C T I V A T I O N O F NFKB AND THE M A P K 78  5.1 5.2 5.3 5.4 5.5  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION BIBLIOGRAPHY  79 80 83 89 91  iii  13  6.0  DISCUSSION - THE PRIMARY ROLE OF LL-37 IN VIVO MAY BE IMMUNOMODULATORY  95  6.1  E A R L Y E V I D E N C E THAT H O S T D E F E N C E PEPTIDES M I G H T H A V E I M M U N O M O D U L A T O R Y FUNCTIONS  6.2  T H E A N T I B A C T E R I A L A N D I M M U N O M O D U L A T O R Y PROPERTIES OF L L - 3 7 A R E P H Y S I O L O G I C A L L Y  6.3  INTERACTIONS B E T W E E N L L - 3 7 A N D E U K A R Y O T I C C E L L S  6.4  L L - 3 7 INTERACTIONS W I T H THE EFFECTOR C E L L S OF T H E I M M U N E RESPONSE A R E SPECIFIC B U T N O T  6.5 6.6  C H E M O T A X I S , L E U K O C Y T E INFILTRATION A N D L L - 3 7 SYNERGISTIC INTERACTIONS B E T W E E N L L - 3 7 A N D C O M P O N E N T S OF T H E I N F L A M M A T O R Y M I L E U  6.7  F U T U R E DIRECTIONS - T H E R O L E OF L L - 3 7 IN H E A L T H & D I S E A S E A N D ITS POTENTIAL AS A N O V E L THERAPEUTIC A G E N T  109  6.8  BIBLIOGRAPHY  110  DISTINCT  N E C E S S A R I L Y RECEPTOR M E D I A T E D  96 99 100 101 105 107  iv  List of Tables 1.0  INTRODUCTION T A B L E 1.1. T H E ANTIMICROBIAL PROPERTIES OF HOST DEFENCE PEPTIDES A R E REDUCED OR ELIMINATED IN THE PRESENCE OF SALTS T A B L E 1.2. CONCENTRATIONS OF HOST DEFENCE PEPTIDES FOUND IN T H E L U N G  2.0  I M M U N O M O D U L A T O R Y ACTIVITIES O F S M A L L HOST D E F E N C E PEPTIDES T A B L E 2.1. SEQUENCES OF T H E PEPTIDES USED IN THESE STUDIES T A B L E 2.2. C O M P A R I S O N OF T H E ACTIVITIES OF INDOLICIDIN, B A C 2 A A N D L L - 3 7 (UG/ML)  3.0  T H E H U M A N C A T I O N I C P E P T I D E LL-37 INDUCES A C T I V A T I O N O F T H E E X T R A C E L L U L A R S I G N A L R E G U L A T E D K I N A S E A N D P38 K I N A S E P A T H W A Y S IN PRIMARY H U M A N MONOCYTES T A B L E 3.1. PRIMER SEQUENCES OF CYTOKINE GENES  4.0 5.0  LL-37 IS A P O T E N T A N T I - E N D O T O X I C A G E N T W I T H M U L T I P L E M E C H A N I S M S O F ACTION  6 7 24 26 33  39 45  61  LL-37 INDUCES RAPID & E A R L Y C H E M O K I N E P R O D U C T I O N V I A A C T I V A T I O N O F NFKB & T H E M A P K T A B L E 5.1. PRIMER SEQUENCES USED IN THIS STUDY  6.0  1  DISCUSSION - T H E P R I M A R Y R O L E O F LL-37 IN VIVO M A Y B E IMMUNOMODULATORY T A B L E 6.1. CONCENTRATIONS OF H C A P - 1 8/LL-37 IN HEALTH A N D DISEASE  78 82 95 98  v  List of Figures 1.0  INTRODUCTION FIGURE 1.1. THE STRUCTURE OF THE CATHELICIDINS FIGURE 1.2. INFLUENCE OF TISSUE CULTURE MEDIUM ON THE ANTIMICROBIAL ACTIVITY OF HOST DEFENCE PEPTIDES FIGURE 1.3. EXPERIMENTAL MODEL  2.0  I M M U N O M O D U L A T O R Y A C T I V I T I E S O F S M A L L H O S T D E F E N C E PEPTIDES  1 4 U 15 24  FIGURE 2.1. CYTOTOXICITY OF LL-37, BAC2A AND INDOLICIDIN 29 FIGURE 2.2. ANTI-ENDOTOXIN PROPERTIES OF INDOLICIDIN, BAC2A AND LL-37 30 FIGURE 2.3. ADDITION OF INDOLICIDIN UP TO 60 MINUTES AFTER THE ADDITION OF LPS RESULTS IN INHIBITION OF LPS INDUCED TNF-A FROM PMA TREATED THP-1 CELLS 30 FIGURE 2.4. THE ADDITION OF INDOLICIDIN AND LL-37 IN COMBINATION PRODUCES A GREATER THAN ADDITIVE INHIBITION OF LPS-INDUCED TNF-OC FIGURE 2.5. BAC2A IS A CHEMOATTRACTANT FOR UNDIFFERENTIATED THP-1 CELLS FIGURE 2.6. INDOLICIDIN INDUCES IL-8 PRODUCTION IN A DOSE DEPENDENT MANNER IN THE HUMAN BRONCHIAL EPITHELIAL CELL LINE, 16HBE403.0  T H E H U M A N C A T I O N I C P E P T I D E LL-37 INDUCES A C T I V A T I O N O F T H E E X T R A C E L L U L A R S I G N A L R E G U L A T E D K I N A S E A N D P38 K I N A S E P A T H W A Y S IN PRIMARY H U M A N MONOCYTES  31 32 32  39  FIGURE 3.1. EXPOSURE TO LL-37 INDUCES PHOSPHORYLATION OF ERK1/2 AND P38 46 FIGURE 3.2. LL-37 is UNABLE TO INDUCE MAPK ACTIVATION IN HUMAN MONOCYTES UNDER SERUM FREE CONDITIONS 47 FIGURE 3.3. ACTIVATION OF ERK.1/2 AND P38 PHOSPHORYLATION BY LL-37 is INDUCED IN CELLS OF THE INNATE IMMUNE SYSTEM 48 FIGURE 3.4. LL-37 INDUCED PHOSPHORYLATION OF ERK1/2 AND P38 KINASES IS NOT MEDIATED BY G-PROTEIN COUPLED RECEPTORS 49 FIGURE 3.5. ERK1/2 ACTIVATION IS AMPLIFIED AND OCCURS AT LOWER CONCENTRATIONS OF LL-37 WHEN IN THE PRESENCE OF GM-CSF 50 FIGURE 3.6. LL-37 INDUCES IL-8 PRODUCTION IN HUMAN BLOOD DERIVED MONOCYTES IN THE ABSENCE OF CYTOTOXICITY 51 FIGURE 3.7. LL-37 INDUCES IL-8 SECRETION AND CHEMOKINE TRANSCRIPTION IN A P38 AND ERK1/2 KINASE DEPENDENT MANNER 53 4.0  LL-37 IS A P O T E N T A N T I - E N D O T O X I C A G E N T W I T H M U L T I P L E M E C H A N I S M S O F ACTION FIGURE 4.1. LL-37 REDUCES LPS INDUCED CYTOKINE PRODUCTION IN PERIPHERAL BLOOD DERIVED MONOCYTES AND A MONOCYTE-LIKE CELL LINE FIGURE 4.2. LL-37 CAN BE ADDED AFTER LPS AND REDUCE PRO-INFLAMMATORY CYTOKINE PRODUCTION FIGURE 4.3. PRE-TREATMENT WITH LL-37 REDUCES PRO-INFLAMMATORY CYTOKINE PRODUCTION FIGURE 4.4. LL-37 DOES NOT REDUCE PRO-INFLAMMATORY CYTOKINE PRODUCTION INDUCED BY IL-1 B OR TNF-A FIGURE 4.5. LL-37 BLOCKS LPS INDUCED TRANSLOCATION OF P65 BUT INDUCES TRANSLOCATION OF P50  5.0  61 66 68 69 70 71  LL-37 INDUCES RAPID & E A R L Y C H E M O K I N E P R O D U C T I O N V I A A C T I V A T I O N O F N F KB & T H E M A P K 78 FIGURE 5.1. FIGURE 5.2. FIGURE 5.3. FIGURE 5.4.  LL-37 INDUCTION OF CHEMOKINE AND CYTOKINE TRANSCRIPTION IN PRIMARY MONOCYTES 84 INCREASES IN CHEMOKINE TRANSCRIPTION AS A RESULT OF DE NOVO TRANSCRIPTIONAL EVENTS 85 EFFECTS OF INHIBITORS OF THE P38 AND ERK1/2 KINASES ON LL-37 INDUCED TRANSCRIPTION 86 EFFECT OF CYCLOHEXIMIDE TREATMENT ON IL-8 RELEASE FROM MONOCYTES IN RESPONSE TO LL37 STIMULATION 87 FIGURE 5.5. REQUIREMENT OF BOTH P38 AND ERK1/2 IN THE EARLY RELEASE OF IL-8 IN RESPONSE TO LL-37. ...88 FIGURE 5.6. LL-37 INDUCED TRANSLOCATION O F N F - K B SUBUNITS 88 FIGURE 5.7. Two MODELS OF SIGNALLING PATHWAY ACTIVATION IN LL-37 TREATED MONOCYTES 90  vi  6.0  DISCUSSION - T H E P R I M A R Y R O L E OF LL-37 IN VIVO M A Y B E IMMUNOMODULATORY  95  FIGURE 6.1. THE EFFECT OF HUMAN SERUM ON IL-8 PRODUCTION FROM T H P - 1 CELLS FIGURE 6.2. THREE MODELS ILLUSTRATING THE ROLE OF L L - 3 7 IN LEUKOCYTE INFILTRATION FIGURE 6.3. THE INFLUENCE OF THE CYTOKINE MILIEU ON L L - 3 7 RESPONSES  103 106  109  vii  List of Abbreviations ASL ATCC BAL BPI CCL  airway surface liquid A m e r i c a n T y p e Culture C o l l e c t i o n bronchial alveolar lavage bactericidal / permeability increasing protein chemokine ( C - C motif) ligand  CF  cystic fibrosis  DC  dendritic cell  ECL EGFR  enhanced  chemiluminescence  epidermal growth factor receptor  ELISA  enzyme-linked immunosorbent assay  ERK1/2  extracellular regulated protein kinase  FCS FPRL-1 G-CSF GM-CSF  foetal c a l f serum f o r m y l peptide like receptor-1 granulocyte colony stimulating factor granulocyte macrophage- colony stimulating factor  HBD  human beta defensin  HBE  human bronchial epithelial cells  HDL  high-density lipoproteins  HNP hr  human neutrophil peptide hour  HS  human serum  IL-  interleukin  LBP  lipopolysaccharide binding protein  LDH  lactate dehydrogenase  LDL  low-density lipoproteins  LARC LPS LTA  liver and activation regulated chemokine lipopolysaccharide lipoteichoic acid  MAPK  mitogen activated protein kinase  MCP-1  macrophage chemotattractant protein 1  MCP-3  monocyte chemotactic protein 3  M-CSF  macrophage colony stimulating factor  MHC min MIP-lcx MIP-lp  major histocompatibility complex class minute macrophage inflammatory protein alpha macrophage inflammatory protein beta  PBDM  peripheral blood derived monocytes  PBMC  peripheral blood mononuclear cells  PBS PMSF Ptx qRT-PCR RT-PCR SDS SDS-PAGE TBS TBST  phosphate buffered saline phenyl methyl sulfonyl fluoride pertussis toxin quantitative reverse transcriptase polymerase chain reaction reverse transcriptase polymerase chain reaction sodium dodecyl sulphate S D S polyacrylamide gel electrophoresis tris buffered saline tris buffered saline + 0.1% T w e e n 20  TLR TNF-oc  toll-like receptor tumor necrosis factor alpha  Acknowledgements I w o u l d like to start by thanking m y supervisor D r . B o b H a n c o c k for his support and guidance.  I have  benefited  enormously  opportunities he has p r o v i d e d me.  under his  tutelage  and I truly appreciate  all the  I k n o w that I have grown as a scientist because o f B o b ' s  mentoring style: he gives his students freedom to make mistakes (and discoveries) but reels us in when we might be going astray. I w o u l d like to thank m y committee members, D r . Brett F i n l a y , D r . V i n c e n t D u r o n i o , D r . M i c h a e l G o l d and D r . Francois Jean for a very productive and helpful relationship over the years. I w o u l d also like to acknowledge D r . D a v i d Speert who p r o v i d e d me with advice and support and was like an honorary committee member. T h e H a n c o c k lab has been a very inspiring place to do research and I have been very fortunate to work with some extremely hardworking, committed, bright and enthusiastic people. There are many more people deserving o f thanks than I can list here but I w o u l d like to acknowledge m y co-workers and fellow graduate students for the wonderful impact they have had on me.  T w o people deserve special mention though, E l a i n e L a u and D o n a l d D a v i d s o n . I  would like to thank y o u , Elaine, for all those hours and hours o f discussion on our work and for listening to m y half-baked ideas ("Yes D a w n , but do y o u actually have any p r o o f o f that?"). Those conversations were extremely productive and inspired me to w o r k towards getting that proof.  I w o u l d also like to express m y deep and sincere gratitude to y o u , D o n a l d , for mentoring  me over the course o f m y degree.  I credit so m u c h o f m y academic success to your friendship,  encouragement, gentle and not so gentle pushes to get things finished, to your amazing insight and careful, thorough and critical comments on m y work. There are so m a n y people who were behind the scenes during the course o f m y degree and who  I would  like to thank for their emotional  support.  T h o s e people  include  my  grandparents Jay and V i o l a B o w d i s h , m y parents W a y n e B o w d i s h and D o n n a and R i c k B r y s o n , m y brother R y a n B o w d i s h and sister Jennifer deHaan, and who c o u l d forget little Josh!, m y dear friend C o r i n Forrester, and the V a n d e r w a l family for lending me their son.  f was  always  encouraged in m y academic endeavours by m y grandmother, Barbara Pargeter, and I w i l l always be inspired by her m e m o r y . There is one person who stands out most o f all. I w o u l d like to express m y most heartfelt appreciation for m y husband, A a r o n V a n d e r w a l . T h a n k y o u for all the late night pickups at the lab, for understanding that I m a y never be on time for dinner, for your careful editing o f figures, for fine-tuning m y presentations, and for your most impressive feat yet - formatting this thesis. Thank y o u for all your encouraging words, for holding up the home front when I needed to focus on work, and for m a k i n g m a n y personal sacrifices to support m y school and career choices. Thank y o u for the many conversations w h i c h contributed to m y successes over the course o f m y degree and its timely completion.  I can't even imagine h o w different m y experience with grad  school w o u l d have been without y o u . T h a n k y o u .  x  Statement of A u t h o r s h i p Large sections o f the introduction have been published in: B o w d i s h , D . M . E . , D . J . D a v i d s o n , and R . E . W . H a n c o c k . 2005. A re-evaluation o f the role o f host defence peptides in mammalian immunity.  Curr Protein Pept Sci 6:35.  B o w d i s h , D . M . E . , D . J . D a v i d s o n , Y . E . L a u , K . L e e , M . G . Scott, and R. E . W . H a n c o c k . 2005. Impact o f L L - 3 7 on anti-infective immunity.  J Leukoc Biol 77:451-9.  and have been submitted for publication in: B o w d i s h , D . M . E . , D . J . D a v i d s o n , and R . E . W . H a n c o c k . 2005. T h e role o f cathelicidins and defensins in host defence, in "Antimicrobial Peptides and H u m a n Disease" ed. by D r . W i l l i a m Shafer. Chapter 2 was originally published as: Bowdish,  D . M . E . , D . J . D a v i d s o n , M . G . Scott, and R . E . W . H a n c o c k . 2005.  Immunomodulatory  activities  of  small  host  defense  peptides.  Antimicrob Agents  Chemother 49:1727-32. Chapter 3 was originally published as; B o w d i s h , D . M . E . , D a v i d s o n , D . J . , Speert, D . P . , H a n c o c k , R . E . W . 2004. T h e H u m a n Cationic Peptide L L - 3 7 Induces Activation o f t h e Extracellular Signal-Regulated Kinase and  p38  K i n a s e Pathways  in Primary H u m a n M o n o c y t e s .  Journal of Immunology  772:3758-65 Sections o f chapter 4 w i l l be published as; D . M . E . B o w d i s h , and R . E . W . H a n c o c k . 2005 Antiendotoxin properties o f cationic host defence peptides and proteins.  Journal of Endotoxin Research. In press.  Chapter 5 is being prepared for publication as: B o w d i s h , D . M . E . , D a v i d s o n , D . J . , and H a n c o c k , R . E . W . 2005. L L - 3 7 induces rapid & early chemokine production via activation o f N F - K B and the M A P K . The majority o f Chapter 6 has not been published, however, Figure 6.1 is supplementary data for: L a u , Y . E . , B o w d i s h , D . M . E . , H a n c o c k , R . E . W . , D a v i d s o n , D J . 2005. Apoptosis airway epithelial  cells: human serum sensitive induction by the  cathelicidin  of  LL-37.  Submitted.  In all instances where previously published materials, or materials submitted for publication, are reproduced in this thesis, they represent the original research and writing o f the author. A footnote at the beginning o f each chapter clearly indicates the contributions o f each author. Prof. R . E . W . H a n c o c k has co-authored all o f the publications listed here and his reading o f the thesis will serve to verify this statement o f authorship.  xi  1.0 Introduction 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8  1  INTRODUCTION H O S T D E F E N C E PEPTIDES OF M A M M A L S ANTIMICROBIAL OR H O S T D E F E N C E PEPTIDES? E V I D E N C E FOR ANTIMICROBIAL ACTIVITY IN VITRO ANTIMICROBIAL ACTIVITY IN VIVO I M M U N O M O D U L A T O R Y PROPERTIES OF CATHELICIDINS M O D E L FOR T H E PHYSIOLOGICAL R O L E OF L L - 3 7 HYPOTHESIS A N D E X P E R I M E N T A L G O A L S BIBLIOGRAPHY  2 5 5 7 10 13 15 16  * Components o f this chapter have been published in B o w d i s h , D . M . E . , D . J . D a v i d s o n , Y . E . L a u , K . L e e , M . G . Scott, and R . E . W . H a n c o c k . 2005.  J Leukoc Biol.  Apr;77(4):451-9., B o w d i s h ,  D . M . E . , D . J . D a v i d s o n , and R . E . W . H a n c o c k . 2005. A re-evaluation o f the role o f host defence peptides in m a m m a l i a n immunity.  Curr Protein Pept Sci  6:35. and are in review for publication  in " A n t i m i c r o b i a l Peptides and H u m a n Disease" ed. by D r . W i l l i a m Shafer. 1  1.1  H o s t Defence P e p t i d e s o f M a m m a l s Small cationic peptides with antimicrobial activity have been isolated from virtually  every class o f l i v i n g organsims (reviewed in (1)). E a r l y on, these peptides were recognised to be a major component o f the immune response in invertebrates (2, 3). In mammals, they were shown to be a major constituent o f neutrophils and macrophages, consisting o f as m u c h as 50% and 1.5% o f the total protein content o f these cells respectively (4, 5). Consequently these peptides  were  demonstrated  to  be  an important component  o f the  non-oxidative  killing  mechanisms o f m a m m a l i a n leukocytes (6). It has since been discovered that these peptides are expressed by a variety o f different cell types and are found at low concentrations throughout the body. T h e classical description o f cationic antimicrobial peptides includes molecules that are between 12 and 50 amino acids long, although there is a continuum o f sizes o f such molecules up to large proteins, with 2 or more positively charged residues p r o v i d e d b y arginine, lysine or, in acidic environments, histidine, and a large proportion (generally >50%) o f hydrophobic residues (reviewed in (7-9)). T h e secondary structures o f these molecules follow four themes, including i) a-helical, ii) |3-stranded due to the presence o f two or more disulphide bonds, iii) P-hairpin or loop due to the presence o f a single disulphide bond and/or cyclization o f the peptide chain, and iv) extended. M a n y o f these peptides are in fact unstructured in free solution, and fold into their final  configuration u p o n  partitioning into  biological  membranes.  In  mammals  the  best-  characterized host defence peptides are the defensins and the cathelicidins.  Defensins The  defensins  are  between  29-30  amino  acids  long  (with  a molecular mass  of  approximately 3.5 k D a ) and contain three conserved disulphide bridges and are thus p-stranded (10). T h e y are further subdivided to include the a- and P- defensins, a distinction based on the organization o f the cysteine,  3 characteristic cysteine  arginine, and aromatic residues (11).  disulphide bonds. These peptides T h e a-defensins  are rich in  were initially isolated from  neutrophils and are thus called human neutrophil peptides ( H N P ) - l to -3 (12). Because o f the high sequence similarity and difficulties in purifying the individual peptides, as well as the high degree o f functional similarity, H N P 1-3 are often studied as a group, although certain studies have demonstrated that there are differences in their antimicrobial (13) and immunomodulatory activities (14). H N P - 4 was identified as an H N P due to its structural h o m o l o g y to H N P 1-3 (15). T w o other a-defensins, H D 5 and H D 6 , are found solely in the intestinal tract. H D 5 and H D 6 were found to be expressed at the transcriptional level solely in the small intestine and in situ  2  hybridization demonstrated that this expression occurs in the Paneth cells (16, 17). Southern blot analysis using a nucleotide probe for the conserved signal sequence o f the defensins indicated that a number o f genes with high h o m o l o g y to H N P s exist within the h u m a n genome (16,  17).  T h e (5-defensins are expressed in a variety o f tissue types including epithelial cells from the trachea and lung, in the salivary and m a m m a r y glands, i n the plasma and skin [(18-20), reviewed in (21)]. T h e expression o f certain p-defensins is inducible u p o n stimulation with bacterial components or pro-inflammatory cytokines and thus these peptides are presumed to be an  important  characterised properties  component members  of H B D - 4  of  host  o f the have  defences  (3-defensin  been  against  family  infection  are H B D 1 - 3 ,  recently published (22)  or  inflammation.  however  The  best  the antimicrobial  and over 20 potential  p-defensin  homologs have been identified in the human genome based on sequence similarity to H B D - 1 - 4 (23).  Cathelicidins T h e cathelicidins are an evolutionarily conserved f a m i l y o f peptides w h i c h have been found in cows, sheep, guinea pigs, rabbits, mice, goats, horses and primates [reviewed in (24)]. T h e y are characterised by having an evolutionarily conserved N - t e r m i n a l domain with greater than 70% sequence h o m o l o g y to a protein o f uncertain function called cathelin. Consequently the evolutionarily conserved component  o f these peptides  is called the cathelin domain. These  peptides have a signal sequence that is believed to target their delivery to the secondary granules o f neutrophils. Despite the conserved nature o f the cathelin d o m a i n , its function remains unclear, although it has been proposed to block the antimicrobial activity o f the cleaved product, presumably as a mechanism w h i c h allows storage o f the peptide in its inactive form (25), and there is some evidence that it has anti-protease activity (25). T h e C terminal domain, w h i c h has very little h o m o l o g y across species, is released by cleavage b y proteases, and can consist o f a number o f different structural classes including a-helical, extended or cysteine bridged [reviewed in (26)]. T h i s mature form  o f the peptide  has both antimicrobial and immunomodulatory  properties.  T h e structure o f the cathelicidins is illustrated in Figure  synthesised  at the  myelocyte  Interesting differences  and metamyelocyte  1.1.  Cathelicidins are  stage o f neutrophil maturation (27-29).  in expression occur between species. F o r example, there have been at  least eleven cathelicidin genes identified in cows, eight in sheep and m a n y more in pigs (30-33). In contrast humans and mice appear to have only one cathelicidin. In artiodactyls (even toed hoofed mammals) expression o f the cathelicidins appears to be restricted to cells o f m y e l o i d or  3  lymphoid origin whereas in mice and humans cathelicidins are expressed by a variety of cell types including epithelial cells (34). I  Conserved Pre-Pro Region  29-30 Amino Acids  PRE Signal Peptide  Mature Peptide 1 Antimicrobial & Immunomodulatory  98-114 Amino Acids  PRO  12-100 Amino Acids  [  t  PEPTIDE  Cleavage Site Figure 1.1. The Structure of the Cathelicidins. The cathelicidins shared a conserved preproregion with homology to the cathelin domain. The N-terminal domain contains a signal sequence while the C terminal contains both the antimicrobial and immunomodulatory properties. The sole human cathelicidin hCAP-18 /LL-37 is found at high concentrations (-630 pg per 10 cells) in its unprocessed form in the granules of neutrophils (35, 36). The hCAP-18 9  precursor protein is also found at more modest concentrations in lymphocytes, macrophages and a range of epithelial cells (37, 38). Upon encountering invading microorganisms, neutrophils release the contents of azurophilic and specific granules into the resultant phagolysosome (by phagosome-lysosome fusion), or to the cell exterior. Consequently LL-37 is found at sites of neutrophil degranulation. It is also produced by epithelial cells and is found in a number of tissues and bodily fluids including gastric juices, saliva, semen, sweat, plasma, airway surface liquid and breast milk (38-41). Generally, epithelial cells produce the hCAP-18 form. Although hCAP-18 is cleaved by the neutrophil protease, protease 3, when released from neutrophils, it is not entirely clear how or when hCAP-18 is cleaved when it is produced by epithelial cells. There are a variety of processed forms of hCAP-18 that result from as-yet uncharacterized cleavage processes. For example, a 6 kDa form is found in gastric juice (41), hCAP-18 from semen is cleaved to a 38 amino acid antimicrobial peptide ALL-38 in the vagina, (42), while numerous cleavage products are found in the sweat and saliva (39, 43). There appears to be some overlapping, complementary and possibly even enhanced antimicrobial activity of these isoforms (44) . To date there is no information about the immunomodulatory properties of naturally occurring variants of LL-37 although it has been demonstrated that synthetic variants of LL-37 which are between 12-31 amino acids long have varying capacities to induce IL-8 production (45) . 4  1.2  Antimicrobial or Host Defence Peptides? S m a l l cationic peptides with antimicrobial activity are expressed in all classes o f life and  in lower vertebrates they appear to constitute the entire immune system. In mammals small cationic peptides have been clearly demonstrated to be a component o f the non-oxidative killing mechanisms  of  leukocytes  (12)  and  thus  they  have  traditionally been  called  "cationic  antimicrobial peptides". H o w e v e r , it has since been discovered that these peptides are expressed by a variety o f different cell types and are found at low concentrations throughout the body. It is not entirely clear whether- these peptides  have  significant  antimicrobial activity  at  lower  concentrations and this is c o m p o u n d e d by the fact that the optimal antimicrobial activity o f these peptides occurs under low salt conditions which, in general, are not physiologically relevant in mammals. It has been proposed that the term "antimicrobial peptide" is misleading in some cases, relating more to a bias for  in vivo  than their likely  in vitro antimicrobial  function. Peptides  testing at the point o f discovery rather  initially isolated as and termed "antimicrobial  peptides" have been shown to have more significant alternative functions  in vivo  (e.g. hepcidin is  primarily i n v o l v e d in iron absorption but is also antimicrobial (46)), while conversely a variety of  other  molecules  with  previously-established  functions  (e.g.  anti-proteases  like  serum  leukoprotease inhibitor (47) and elafin (48), and certain chemokines (49)) have been shown to have antimicrobial activity  in vitro  under low salt conditions. In contrast, the immunomodulatory  properties o f these peptides are generally studied in standard tissue culture media (50-54) w h i c h contains physiological concentrations o f ions and it has been proposed that the term "host defence  peptide" might be a more accurate label (55).  meaningful  m i c r o b i c i d a l or  immunoregulatory  activities  Thus whether these peptides  in vivo  must  be  examined  have by  considering two fundamental issues; i) the environment in w h i c h these activities are assessed in  vitro  compared to  in vivo  conditions, and ii) the concentrations at w h i c h such peptides are found  in vivo.  1.3  Evidence for Antimicrobial Activity In Vitro The antimicrobial activity o f all host defence peptides is highest in media o f low ionic  strength, and the activity o f most peptides is inhibited by p h y s i o l o g i c a l concentrations o f ions such as N a , M g +  2 +  and C a  2 +  . T h e antimicrobial properties o f the |3 defensins,  for example,  demonstrate profound salt sensitivity and in some cases their antimicrobial activity is completely lost at concentrations o f 100 m M N a C I (22, 56, 57). M o s t biological fluids, including sputum (58),  airway surface  liquid  (59)  and serum/plasma (60),  contain M g  2 +  and C a  2 +  at  free  concentrations between 1 and 2 m M and the presence o f these ions is generally more detrimental 5  to antimicrobial activity than N a Ca  2 +  and M g  2 +  as l o w as 0.5  +  alone. T h e a-defensins are susceptible to concentrations o f  m M (13).  Table 1.1  summarises the effects o f physiological  concentrations o f sodium ions on the antimicrobial activity o f h u m a n host defence peptides.  Table 1.1. The antimicrobial properties of host defence peptides are reduced or eliminated in the presence of salts. Inhibitory concentration Peptide H N P 1-3 HBD-1 HBD-2 HBD-3 HBD-4 LL-37  1  Inhibitory concentration in presence o f N a  Class o f  in low salt  Bacteria  (Ug/ml)  (ug/ml)  References  G r a m +ve  7->100  *  (61-63)  Gram -ve  2.0 - 40  >250  G r a m +ve  1.0-10  >10-ND  Gram -ve  >50  ND  G r a m +ve  0.01-0.1  + 2  (64) 3  (65, 66)  0.5 - N D  (65, 66)  (66)  4  Gram -ve  10->100  ND  (66, 67)  G r a m +ve  5.0-25  >50  (66, 68-70)  Gram -ve  10 - >25  10->254,ND  G r a m +ve  4.0-  Gram -ve  100  i  (68-70)  *  (22)  >72  (22)  G r a m +ve  15 - 30  125  (38)  Gram -ve  1.5 - 13  2.2 - >79  (64)  4.5  ->100  * Experiment not performed 1  2  Concentration required to induce killing o f at least two log orders in l o w salt (< 10 m M N a C I ) 100 m M N a C I unless otherwise stated.  3  N D = N o detectable decrease in antibacterial activity at less than 200 m M N a C I  4  50 m M N a C I  5  A n t i m i c r o b i a l activity abrogated in 150 m M N a C I In some cases, for example in the granules o f neutrophils, the concentration o f host  defence peptides is estimated to be as great as 10 m g / m l and there is no doubt that upon ingestion o f bacteria these concentrations are sufficient to cause direct antimicrobial activity despite the presence o f divalent cations or other inhibitory substances  (71).  H o w e v e r it is  questionable  whether these concentrations are reached at mucosal surfaces. F o r example, in patients suffering from inflammatory lung disease or infection the concentration o f FfNPs in the bronchoalveolar lavage has been estimated to be 0.7 - 1.2 or 10 ug/ml respectively (72, 73). T h i s contrasts with the concentration required for antimicrobial activity (> 10 ug/ml) or antiviral activity ug/ml) under optimised  in vitro  conditions (72, 74). Concentrations o f host defence  (8-50 peptides  found in the lung during health and disease are summarised in T a b l e 1.2.  6  Table 1.2. Concentrations of host defence peptides found in the lung.  1  Concentration i ug/ml) Inflammatory Peptide  Cellular  Healthy  CF  Infection  L u n g Disease  Sources  (BAL)  (BAL)  (BAL)  (BAL)  References  0-0.1  0 - 0.002  0 - 0.00007  0-0.2  (65, 75-77)  0.0002  0.01-0.1  (78)  2.5 - 30*  -  (79, 80)  ~ 10  (72, 73)  Neutrophils,  HBD-1  epithelia Neutrophils,  HBD-2  epithelia  0 - 0.0004  0.0001 0.01  Neutrophils, epithelia,  LL-37  2.5 - 20*  submucosal  0 - 16  glands HNP-1-3 1  Neutrophils  300 -  0.2  >1600J  0.2-  1.2  A l l values were determined for adult volunteers, except those indicated by an asterisk (*) w h i c h  were determined from infants. 0 implies not detected in a particular assay or patient; "-" indicates no information available, t These include concentrations found in sputum. Interestingly the antimicrobial activity o f host defence peptides m a y also be inhibited by components o f serum. F o r example, H N P - 1 has antiviral activity towards enveloped viruses, but this activity is abrogated by the presence o f serum or a l b u m i n (81).  It is believed, but not  conclusively shown that the high concentrations o f a-defensins in neutrophils w o u l d overcome any localized serum effects (81). T h e antibacterial activity o f L L - 3 7 is abrogated by the presence o f apolipoprotein A - l (82). Thus it is unlikely that under conditions o f high ionic strength and in w h i c h serum proteins are present that the primary role o f host defence  peptides  is direct  antimicrobial activity.  1.4 Antimicrobial Activity In Vivo There has been some debate about whether host defence antimicrobial  in vivo.  Certainly,  neutrophil granules and the  peptides might be directly crypts o f the  lumen contain  sufficiently high concentrations o f peptides to ensure substantial antimicrobial activity. H o w e v e r , it is less clear whether antimicrobial activity occurs at lower concentrations such as those found at mucosal surfaces, and it is worth noting that such sites are often heavily colonized by a rich and diverse collection o f commensal bacteria. T h e evidence for antimicrobial activity in certain body sites is also inconclusive. O n one hand, certain bodily fluids such as sinus fluid (77) and gastric fluids (41)  can directly kill certain microrganisms, and this antimicrobial activity is  ablated or reduced by removal o f proteins or immunodepletion with host defence peptide specific antibodies. H o w e v e r , in certain animal models  in w h i c h peptides  and bacteria are instilled  7  simultaneously, bacterial counts are often not significantly different from mice treated with bacteria alone, despite i m p r o v e d outcome or reduced pro-inflammatory responses (83, 84). T h e  in vivo are  difficulties in assessing the role o f host defence peptides  profound as it is almost  impossible to account for synergistic interactions between peptides and other factors, to assess the actual concentrations at the sites o f infection and to discriminate the direct antimicrobial activity  o f peptides  mechanisms  from  (chemotaxis  other less direct effects and recruitment o f  such as  effector  enhancement  cells,  o f inflammatory  enhancement  of  non-opsonic  phagocytosis, etc). Nonetheless creative experiments and animal models have begun to elucidate the roles o f these peptides  in vivo.  In transgenic mouse m o d e l studies in w h i c h the expression o f certain host  defence  peptides is ablated, these mice are more susceptible to infection and carry increased bacterial loads when challenged (85,  86). A l t h o u g h this has been interpreted as being due to direct  antimicrobial activity, other components o f host defences must be considered. F o r example, in a mouse model o f peritoneal  Klebsiella pneumoniae  infection, small doses o f H N P - 1 (4 ng - 4 pg)  caused an increase in leukocyte accumulation (87). In this m o d e l it was the accumulation o f leukocytes that was linked to H N P - 1 induced antimicrobial activity as the reduction in bacterial counts was ablated in leukocytopenic mice. Similar results were observed in  aureus  Staphylococcus  thigh infections (87).  G a i n o f function studies have found that introducing or increasing the expression o f a host defence  peptide can reduce bacterial loads in certain animal models o f infection. F o r  example adenovirus-mediated transfer o f the L L - 3 7 / h C A P - 1 8 gene into the lungs o f mice that were subsequently challenged with  Pseudomonas aeruginosa  led to a reduction in both the  bacterial load and in the production o f the pro-inflammatory cytokine, T N F - a (88). In a mouse model  of  adenovirus  mediated  gene  therapy  in w h i c h  LL-37  expression  was  increased  systemically, mice demonstrated a decreased susceptibility to lipopolysaccharide ( L P S ) induced septic  shock  in the  complete  absence  o f bacterial  simultaneous instillation into the mouse lung o f  infection  P. aeruginosa  (88).  In  other  models  the  and either o f H B D 2 or an L L - 3 7  derivative led to reduced lung damage and pro-inflammatory cytokine production, but did not affect bacterial counts (83). Perhaps the most c o n v i n c i n g evidence that host defence  peptides  reduce bacterial counts through indirect antimicrobial activity is that in experimental models o f infection in mice administration o f host defence peptides results in both decreases in bacterial numbers and increased infiltration o f leukocytes. W h e n these same studies are performed in leukocytopenic mice there is no decrease in bacterial numbers indicating that the perceived 8  antibacterial activity is due to the infiltration and subsequent activity o f leukocytes (87). In order to dissociate direct antibacterial activity from the immunomodulatory properties o f host defence peptides, synthetic peptides based on natural sequences o f peptides have been designed. These peptides were tested and found not to have antimicrobial activity protective in experimental models o f infection  in vitro,  in vivo indicating  that  however they were  in vitro  antimicrobial  activity is not a necessary requirement for reduction o f bacterial counts during the course o f infection (89). T o date there are no identified individuals who are completely defective in host defence peptide expression. Perhaps this is a testament to the importance o f these peptides in the immune response. H o w e v e r , the neutrophils o f individuals with specific granule deficiency, a disease characterized b y frequent and severe infections, have a reduction in the size o f the peroxidase positive, defensin-containing granules (90),  and are deficient in defensins  (6). A l t h o u g h the  reduction in defensin expression is obviously a contributor to the reduction in bacterial killing by the patient's neutrophils, it is difficult to assess the extent to w h i c h these infections are due to the lack o f defensins, as these patients are also deficient in other neutrophil components. Patients, who suffer with morbus K o s t m a n , a severe congenital neutropenia, and are treated with G - C S F to restore neutrophils level, do not express L L - 3 7 and have reduced expression o f a-defensins in these cells. O n e o f the manifestations periodontal  disease (91).  o f this disease is frequent and severe infections and  It is believed that the  constitutive  production and deposition  of  neutrophils is o f crucial importance to maintaining the i m m u n o l o g i c a l balance o f the mouth. It has been proposed that the absence o f L L - 3 7 may give a selective advantage to bacteria that at low levels are commensals but at higher levels are responsible for periodontal disease. It is unclear, however, whether L L - 3 7 is directly microbicidal towards c o m m o n pathogens o f the mouth or whether  it has other immunomodulatory properties w h i c h might be involved in  maintaining homeostasis in the mouth. A l t h o u g h a number o f oral bacteria are susceptible to L L 37 (<10  ug/ml) at 10 m M N a C I  in vitro,  far fewer bacteria are susceptible in physiologically  more relevant isotonic environments (92). A l t h o u g h L L - 3 7 has been detected in saliva, the actual concentration has not been determined (93). T h i s indirect evidence implies that host defence peptides are an important component o f the innate immune response in humans. Other indirect evidence for  in vivo  antimicrobial activity o f host defence peptides is that a  decreased level o f expression often correlates with frequency or severity o f disease. F o r example, H B D - 2 and L L - 3 7 expression is depressed in patients with atopic dermatitis who often present with cases o f acute or chronic colonization by  Staphylococcus aureus  (94). In contrast to atopic 9  dermatitis, H B D - 2  expression is increased in psoriatic skin, a disease in w h i c h patients are fairly  resistant to bacterial infections (68, 95). It has recently been noted that the neutrophils  of  patients with acute m y e l o i d leukemia have markedly decreased expression o f L L - 3 7 and it has been proposed that this might contribute to the enhanced susceptibility to infection experienced by these patients (96). Lastly, decreased expression o f H B D - 2 in the bronchoalveolar lavage o f cystic  fibrosis  aeruginosa, is  patients  who  are generally  heavily  colonised  with  either  S. aureus  or  P.  correlated with increased severity o f disease (80). T h u s is does appear that host  defence peptides are i n v o l v e d in the antimicrobial defences in humans, although it is not entirely clear i f this is because they are kill bacteria directly. Whether host defence peptides are directly or indirectly antimicrobial, it is apparent that it is o f advantage for bacterial pathogens to subvert their expression or activity. F o r example  Streptococcus pyogenes  binds to ci2-microglobin and secretes a small proteinase w h i c h inhibits  L L - 3 7 from interacting with the bacteria and thus prevents L L - 3 7 mediated killing (97). expression has been shown to be decreased in  Shigella  LL-37  infection, consistent with a proposed  mechanism o f evasion by this bacterium (98). H o w e v e r , it is not clear whether this is a direct down-regulation o f expression, or a consequence expression  in the replacement  o f denuding the epithelium, with reduced  cells. In summary, there is a substantial amount o f indirect  evidence in humans and direct evidence in animal models indicating that host defence peptides play a pivotal role in the innate immune response. 1.5  I m m u n o m o d u l a t o r y P r o p e r t i e s of C a t h e l i c i d i n s It is b e c o m i n g increasingly apparent that host defence peptides have a wide range o f  immunomodulatory properties that are either complementary to, or independent of, antimicrobial activity. Interest in the immunomodulatory functions o f these has increased tremendously in the last  few  years.  In  contrast  to  the  antimicrobial  activity  of  these  peptides,  their  immunomodulatory properties are generally studied in tissue culture m e d i u m , w h i c h contains physiologically relevant concentrations o f ions and serum proteins. F o r example, even at a concentration as high as 100 p g / m l , L L - 3 7 is not antimicrobial in standard tissue culture m e d i u m (Figure 1.2).  H o w e v e r , all o f its immunomodulatory properties are maintained under these  conditions. Because these peptides lose their antimicrobial properties under these physiological conditions, but maintain their immunomodulatory properties, I and others have proposed that for certain peptides such as L L - 3 7 , antimicrobial activity may be secondary to immunomodulatory activity  in vivo  (89).  10  Figure 1.2. Influence of tissue culture medium on the antimicrobial activity of host defence peptides. Overnight serovar  of Salmonella T y p h i m u r i u m Staphylococcus aureus A T C C  cultures  enterica  or  25923 were diluted 50-fold i n L u r i a B r o t h and allowed to grow to exponential phase (optical density at 600nm o f 0.5)  at 3 7 ° C .  T h e cultures were spun down and  resuspended in either l O m M phosphate buffer, p H 7.0 or  in tissue  culture m e d i u m , D u l b e c c o ' s  Modified  Eagle m e d i u m ( D M E M ) , with or without 10% foetal bovine serum. L L - 3 7 was added at a concentration o f 100 u g / m l . Samples (100 ul) were removed at 0 m i n and after 15, 30 and 60 m i n viability was assessed by appropriate dilution and plating for viable bacteria on  Salmonella Staphylococcus  L agar ( L broth containing 1% agar). A ) T y p h i m u r i u m serovar  aureus  ATCC  25923  enterica was  or B )  re-suspended  l O m M phosphate buffer, p H 7.0 ( • )  in  either  or in D u l b e c c o ' s  M o d i f i e d Eagle m e d i u m ( D M E M ) , with (x) or without ( A ) 1 0 % foetal bovine serum. L L - 3 7 was antimicrobial at 15 minutes in phosphate buffer; however it lost all T i m e (min)  antimicrobial activity for both strains in tissue culture media. F r o m B o w d i s h et  al.,  J Leukoc Biol.  2005  Apr;77(4):451-9.  It is possible that m a n y o f the antimicrobial effects observed in animal models m a y in fact be due to these immunomodulatory properties. T h i s perspective is quite controversial, and will remain so since it is extremely difficult to discriminate between direct and indirect (i.e. through stimulation o f innate immunity) mechanisms o f killing. H o w e v e r , an increasing body o f evidence suggests that L L - 3 7 and similar peptides might be i n v o l v e d in the clearance o f infection by recruiting leukocytes to the site o f infection, by inducing cytokine and chemokine production, and altering leukocyte responses at the transcriptional and functional level. T h e a-defensins and cathelicidins have also been proposed to be involved in the promotion o f w o u n d healing.  Thus  their role may extend beyond just the resolution o f infection to the maintenance and repair o f damaged tissues. A t very low concentrations many host defence peptides have the ability to neutralise  L P S and  other  bacterial components,  thereby  attenuating  the  potential  for  an  inflammatory response. T h u s these peptides might also be i n v o l v e d in homeostasis at mucosal surfaces by preventing small amounts o f bacterial components from triggering an inflammatory response.  The  immunomodulatory properties  of  LL-37  and  the  related  cathelicidins  are  summarised below.  11  O n e o f the earliest discovered immunomodulatory properties o f the cathelicidins was the ability o f these peptides to bind and neutralise L P S (99, 100). E a r l y experiments determined that cathelicidins from a variety o f different species could b i n d to many different chemotypes o f L P S and reduce L P S - i n d u c e d release o f pro-inflammatory cytokines (e.g. TNF-cx, I L - 1 , IL-6) and nitric oxide by monocytes or macrophages (101-104), although these two observations are not obligately linked (105). L L - 3 7 has been demonstrated to reduce pro-inflammatory cytokine production induced by other bacterial components such as  Mycobacterium A r a L A M  (53).  S. aureus  lipotechoic acid ( L T A ) and  It has been clearly demonstrated that various host  defence  peptides protect m i c e from L P S - i n d u c e d lethality (53, 88, 106-109). A s the ability o f L L - 3 7 to neutralise L P S - i n d u c e d cytokine occurs at very low levels o f L L - 3 7 (1 p g / m l or less) (53, 110) I and others have suggested that one o f the functions o f these peptides at mucosal surfaces is to minimize inflammation due to low levels o f bacterial components during health or aid in the resolution o f inflammation during an immune response induced b y infection. L L - 3 7 may also be involved in the clearance o f infection by recruiting leukocytes to sites o f high concentrations o f the peptide. A c o m m o n property o f m a n y host defence peptides in general  and the  cathelicidins  in particular is the  chemotactic  for neutrophils  (111).  Similarily,  chemotactic  for  (112).  LL-37  neutrophils  has  the  ability to  induce  pro-forms o f  been  a bovine  demonstrated  neutrophils (113), mouse mononuclear cells and P M N s (14),  chemotaxis.  to  be  PR-39  is  bactenecin  are  chemotactic  for  as w e l l as human neutrophils,  monocytes and T cells (114). Thus it is believed that elevated concentrations o f host defence peptides c o u l d contribute to the recruitment o f the effector cells o f the innate and adaptive immune response. H o w e v e r , the concentrations required to induce chemotaxis b y host defence peptides is 1 0 - 1 0 0 fold higher than that o f conventional chemokines and thus it is expected that this w o u l d only be a function o f these peptides at the high concentrations found in the acute inflammatory response. In addition to a role for cathelicidins in recruitment o f immune cells, L L 37 has also been demonstrated to interact with epithelial cells and to promote  chemokine  production (53, 54, 115, 116). Host defence peptides m a y also be involved i n the resolution o f inflammatory responses. E a r l y experiments indicated that these peptides might be i n v o l v e d i n w o u n d healing. Consistent with this hypothesis, both h u m a n and mouse cathelicidins are up-regulated at sites o f incision or wounding, even i f the w o u n d is sterile. T h e appearance o f cathelicidins i n the skin has been ascribed to both synthesis within epidermal keratinocytes, and deposition from granulocyctes that migrate to the site o f injury (117). U p o n incision, h C A P - 1 8 (the precursor to L L - 3 7 ) has 12  been shown to be up-regulated in the epidermis bordering the w o u n d . T h i s increase in expression at both the R N A and protein levels was clearly evident at the migrating front o f the wound during  re-epithelialization.  Levels  of  hCAP-18  decreased  following  wound  closure  and  eventually returned to baseline levels when the w o u n d was intact and re-epithelization  was  complete. h C A P - 1 8 was found to be an active component in the process o f re-epithelization since antibodies specific for the peptide decreased the rate o f re-epithelization in a concentration dependent manner (50). Consistent with this observation, low levels o f L L - 3 7 (as low as 50 ng/ml) have been demonstrated to increase proliferation in an endothelial cell line (51). T h e importance o f this peptide in re-epithelization has been further inferred from its presence in wounds  w h i c h are healing normally, but its absence in chronic ulcers (50).  cathelicidin,  P R - 3 9 , has  been  demonstrated  to  induce  the  T h e porcine  production o f heparan  sulfate  proteoglycans, called syndecans, at sites o f wound repair. T h e expression o f syndecans increased during w o u n d repair, causing the cells to become more responsive to growth factors and regulate cell proliferation and migration in response to these effectors. T h e ability o f P R - 3 9 to induce syndecan expression indicated that this peptide, and possibly other cathelicidins, might function as signalling molecules in w o u n d repair. Since I began these studies the range o f immunomodulatory functions ascribed to L L - 3 7 have been expanded to include the promotion o f angiogenesis (118), the modulation o f the differentiation o f  immature dendritic cells from precursor cells, with consequent impact on T h  cell polarization (119) and the enhancement o f anti-tumour responses (120).  In conclusion, the  immunomodulatory properties o f host defence peptides in general and L L - 3 7 in particular are not as well characterised as their antimicrobial properties. Despite the fact that studies on the immunmodulatory properties o f the peptide are in their infancy it is apparent that this peptide and others like it have a variety o f role in the immune response, the nature o f which is just beginning to be understood. 1.6  M o d e l f o r the P h y s i o l o g i c a l R o l e o f L L - 3 7 L L - 3 7 , the 37-residue C-terminal peptide o f h C A P - 1 8 , is cleaved b y proteinase-3  after  exocytosis from neutrophils (36). T h u s , during infection and inflammation h i g h concentrations o f L L - 3 7 w i l l be released at sites o f neutrophil accumulation. T h i s occurs in gingival tissues and in the saliva where it has been proposed that L L - 3 7 is not produced b y these tissues, but instead is deposited by the homeostatic degranulation o f neutrophils (91, 121). T h e precursor h C A P - 1 8 is also produced by a variety o f epithelial cell types. Its expression is moderately inducible upon stimulation with pro-inflammatory cytokines such as I L - l a (122) or bacterial components  (41). 13  A l t h o u g h it is not yet clear h o w h C A P - 1 8 is released from these cell types and processed, the processed peptide L L - 3 7 is found at increased concentrations at cell surfaces in a number o f inflammatory conditions, including psoriasis (123) Thus  and inflammatory lung conditions (124).  in the context o f infection and inflammation, L L - 3 7  can be derived v i a release by  neutrophils recruited to the site o f infection, and v i a secretion b y epithelial cells. T h e first cells that are recruited to sites o f infection and inflammation are neutrophils. If the infection is not resolved in minutes to hours, a second wave o f cells including monocytes w i l l be conscripted to the site o f infection (125). These monocytes w i l l arrive at sites o f elevated local concentrations o f L L - 3 7 . U p o n exposure to L L - 3 7 , epithelial cells produce I L - 8 and peripheral-blood-derived monocytes  produce  chemokines  such  as  I L - 8 , M C P - 1 and M C P - 3  (53,  54,  115).  These  chemokines w o u l d attract neutrophils, monocytes and macrophages respectively. L L - 3 7 has also been demonstrated to be directly chemotactic for neutrophils, T cells, and monocytes  (114).  Thus, when the first line response is insufficient, levels o f L L - 3 7 are expected to be high enough to induce chemotaxis o f these cells types directly and L L - 3 7 - a c t i v a t e d monocytes and epithelial cells may produce chemokines w h i c h w i l l lead to the recruitment o f important immune response effector cells to assist in the resolution o f infection.  Figure 1.3 summarises this experimental  model. Less is k n o w n about the expression o f cathelicidins in other species. F o r example, it is not  known  i f they  concentrations  to  are  LL-37.  produced by However  epithelial  it has  cells  or i f they  been demonstrated  are  that they  found  at  equivalent  are found at high  concentrations in the granules o f neutrophils and are chemotactic for a variety o f different cell types thus elements o f this m o d e l m a y also be applicable.  14  LUMEN  Inflammatory s t i m u l u s  Monocyte  Figure 1.3. Experimental model. Upon detection of infection or stimulation with inflammatory mediators, resident or recruited neutrophils release granule contents including high concentrations of antimicrobial peptides such as LL-37. Epithelial cells respond to inflammatory stimuli produce LL-37. A concentration gradient of LL-37 would occur at the site of infection. This concentration gradient could lead directly to chemotaxis of neutrophils, monocytes and other cell types. In addition, LL-37 can induce epithelial cells to produce IL-8 and other chemokines. Increased concentrations of IL-8 would lead to increased infiltration of neutrophils and monocytes. These cells would be arriving at sites with relatively high concentrations of LL-37 which would promote a variety of immunomodulatory effects. From Bowdish et al., J Leukoc Biol. 2005.77(4):451-9  1.7  Hypothesis and Experimental Goals It has become increasingly apparent that LL-37 is an immunomodulator, however at the  time that I began this thesis it was not apparent how this peptide interacts with the effector cells of the innate immune response. It has been proposed that LL-37 may mediate its effects through either specific receptor mediated interactions or through more non-specific interactions (i.e. generalised membrane disruption or cytotoxicity). At the start of this research I hypothesised that LL-37 interacted directly with the cells of the innate immune response and that this interaction would not occur with cells of the adaptive immune response. These interactions were measured by activation of certain signalling pathways. I theorised that this cell specificity would not occur if LL-37 interacted with eukaryotic cells through a non-specific interaction. I also hypothesised  15  that L L - 3 7  induced signalling w o u l d be linked to some or all o f the immunomodulatory  properties o f this peptide. One o f the goals o f these studies was to characterise early interactions o f L L - 3 7 and the effector cells o f the innate immune response, with particular emphasis on monocytes. O n c e it was determined that L L - 3 7 interacted directly with the effector cells o f the innate immune response I hypothesised that activation o f these signalling pathways was a requirement for the immunomodulatory properties o f this peptide such as chemokine  production and the anti-  endotoxin response. M y a i m was to determine the extent o f the involvement o f L L - 3 7 induced signalling in chemokine production in both the very early responses (< 30 min) and at slightly  in vivo  longer time points (4 - 24 hrs) as I hypothesised that cells o f the  innate  immune response  L L - 3 7 interactions with the effector  w o u l d occur at the  onset o f infection  and that  the  immunomodulatory properties o f this peptide w o u l d be most evident at short time points. 1.8 1.  Bibliography Bulet, P., R . Stocklin, and L . M e n i n . 2004. A n t i - m i c r o b i a l peptides: from invertebrates to vertebrates.  2.  Immunol Rev 198:169.  M i l l e t , A . C , and J . J . E w b a n k . 2004. Immunity in Caenorhabditis elegans.  Curr Opin  Immunol 16:4. 3.  Leclerc,  V.,  and  J.  M.  Reichhart.  2004.  The  immune  response  of  Drosophila  melanogaster. Immunol Rev 198:59. 4.  R i c e , W . G . , T . G a n z , J . M . K i n k a d e , Jr., M . E . Selsted, R . I. Lehrer, and R . T . Parmley. 1987. Defensin-rich dense granules o f human neutrophils. Blood 70:757.  5.  Patterson-Delafield, J . , R . J . Martinez, and R . I. Lehrer.  1980.  Microbicidal  cationic  proteins in rabbit alveolar macrophages: a potential host defense mechanism.  Infect  Immun 30:180. 6.  Ganz,  T.,  J.  A.  Metcalf,  J.  I.  Gallin,  L. A.  Boxer,  and  R.  I.  Lehrer.  1988.  M i c r o b i c i d a l / c y t o t o x i c proteins o f neutrophils are deficient in two disorders: ChediakH i g a s h i syndrome and "specific" granule deficiency. I.  Papagianni, M . 2003. R i b o s o m a l l y synthesized peptides with antimicrobial properties: biosynthesis, structure, function, and applications.  8.  Scott,  Curr Pharm Des 8:727.  M . G . , and R . E . H a n c o c k . 2000. C a t i o n i c antimicrobial peptides  multifunctional role in the immune system. 10.  Curr Opin Struct Biol 5:521.  Selsted, M . E . , S. S. H a r w i g , T . G a n z , J . W . S c h i l l i n g , and R . I. Lehrer. 1985. Primary structures o f three human neutrophil defensins.  12.  and their  Crit Rev Immunol 20:407.  White, S. H . , W . C . W i m l e y , and M . E . Selsted. 1995. Structure, function, and membrane integration o f defensins.  II.  Biotechnol Adv 21:465.  Sitaram, N . , and R . Nagaraj. 2002. Host-defense antimicrobial peptides: importance o f structure for activity.  9.  J Clin Invest 82:552.  J Clin Invest 76:1436.  G a n z , T . , M . E . Selsted, D . Szklarek, S. S. H a r w i g , K . Daher, D . F . Bainton, and R . I. Lehrer. 1985. Defensins. Natural peptide antibiotics o f human neutrophils.  J Clin Invest  76:1427. 13.  Lehrer, R . I., T . G a n z , D . Szklarek, and M . E . Selsted. 1988. M o d u l a t i o n o f the in vitro candidacidal  activity o f human neutrophil defensins b y target  cell metabolism  and  divalent cations. J Clin Invest 81:1829. 16  14.  Chertov, O . , D . F . M i c h i e l , L . X u , J. M . W a n g , K . T a n i , W . J . M u r p h y , D . L . L o n g o , D . D.  Taub,  and J. J . O p p e n h e i m .  CAP37/azurocidin  as  stimulated neutrophils. 15.  T-cell  1996.  Identification  chemoattractant  o f defensin-1,  proteins  released  defensin-2,  from  J Biol Chem 271:2935.  W i l d e , C . G . , J . E . Griffith, M . N . M a r r a , J. L . Snable, and R . W . Scott. 1989. Purification and characterization o f human neutrophil peptide 4, a novel member o f the family.  16.  defensin  J Biol Chem 264:11200.  Jones, D . E . , and C . L . B e v i n s . 1992. Paneth cells o f the human small intestine express an antimicrobial peptide gene.  17.  and  interleukin-8-  Jones,  J Biol Chem 267:23216.  D . E . , and C . L . Bevins.  1993.  Defensin-6  mRNA  in human Paneth  implications for antimicrobial peptides in host defense o f the human bowel.  cells:  FEBS Lett  315:187. 18.  Z h a o , C , I. W a n g , and R. I. Lehrer. 1996. Widespread expression o f beta-defensin h B D -  19.  B e n s c h , K . W . , M . Raida, H . J. Magert, P. S c h u l z - K n a p p e , and W . G . Forssmann. 1995.  1 in human secretory glands and epithelial cells.  FEBS Lett 396:319. FEBS Lett 368:331.  h B D - 1 : a novel beta-defensin from human plasma. 20.  Harder, J . , J. Bartels, E . Christophers, and J. M . Schroder. 1997. A peptide antibiotic from human skin.  21.  Nature 387:861. Curr Opin Immunol  Lehrer, R . I., and T . G a n z . 2002. Defensins o f vertebrate animals.  14:96. 22.  G a r c i a , J . R . , A . Krause, S. Schulz, F . J. Rodriguez-Jimenez, E . K l u v e r , K . A d e r m a n n , U . Forssmann, A . F r i m p o n g - B o a t e n g , R . Bals, and W . G . Forssmann. 2001. H u m a n betadefensin  4:  a  novel  antimicrobial activity. 23.  inducible  peptide  with  a  specific  salt-sensitive  spectrum  of  Faseb J 15:1819.  Schutte, B . C , J. P. M i t r o s , J . A . Bartlett, J. D . Walters, H . P. Jia, M . J . W e l s h , T . L . Casavant, and P. B . M c C r a y , Jr. 2002. D i s c o v e r y o f five conserved beta -defensin gene clusters using a computational search strategy.  24.  Proc Natl Acad Sci USA 99:2129.  Zanetti, M . 2004. Cathelicidins, multifunctional peptides o f the  innate  immunity. J  Leukoc Biol 75:39. 25.  Z a i o u , M . , V . Nizet,  and R . L . G a l l o . 2003. A n t i m i c r o b i a l and protease inhibitory  functions o f the human cathelicidin ( h C A P 1 8 / L L - 3 7 ) prosequence.  J Invest Dermatol  120:810. 26.  Gennaro, R . , and M . Zanetti. 2000. Structural features and biological activities o f the  27.  N a g a o k a , I., Y . Tsutsumi-Ishii, S. Y o m o g i d a , and T . Y a m a s h i t a . 1997. Isolation o f c D N A  cathelicidin-derived antimicrobial peptides.  Biopolymers 55:31.  encoding guinea p i g neutrophil cationic antibacterial polypeptide o f 11 k D a ( C A P 1 1 ) and evaluation o f C A P 11 m R N A  expression  during neutrophil maturation.  J Biol Chem  272:22742. 28.  Zanetti, M . , L . Litteri, R . Gennaro, H . Horstmann, and D . R o m e o . 1990. defense polypeptides  o f bovine neutrophils, are generated  stored in the large granules. 29.  J Cell Biol 111:1363.  Sorensen, O . , K . Arnljots, J . B . C o w l a n d , D . F . B a i n t o n , and N . Borregaard. 1997. T h e human  antibacterial  cathelicidin,  hCAP-18,  is  synthesized  metamyelocytes and localized to specific granules in neutrophils. 30.  S c o c c h i , M . , S. W a n g , and M . Zanetti. 1997.  in  myelocytes  and  Blood 90:2796.  Structural organization o f the  cathelicidin gene family and identification o f a novel member. 31.  Bactenecins,  from precursor molecules  bovine  FEBS Lett 417:311.  Castiglioni, B . , M . S c o c c h i , M . Zanetti, and L . Ferretti. 1996. Six antimicrobial peptide genes o f the cathelicidin family map to bovine chromosome 22q24 by fluorescence situ hybridization.  in  Cytogenet Cell Genet 75:240. 17  32.  Huttner, K . M . , M . R . Lambeth, H . R . B u r k i n , D . J. B u r k i n , and T . E . B r o a d . L o c a l i z a t i o n and genomic organization  o f sheep antimicrobial peptide genes.  1998.  Gene  206:85. 33.  Storici, P . , and M . Zanetti. 1993. A novel c D N A sequence encoding a pig leukocyte antimicrobial peptide with a cathelin-like pro-sequence.  Biochem Biophys Res Commun  196:1363. 34.  G a l l o , R . L . , K . J. K i m , M . Bernfield, C . A . K o z a k , M . Zanetti, L . M e r l u z z i , and R. Gennaro.  1997.  Identification  of  CRAMP,  expressed in the embryonic and adult mouse. 35.  a  cathelin-related  antimicrobial  peptide  J Biol Chem 272:13088.  Sorensen, O . , J . B . C o w l a n d , J. A s k a a , and N . Borregaard. 1997. A n E L I S A for h C A P 18, the  cathelicidin  present in human neutrophils  and plasma.  J Immunol Methods  206:53. 36.  Sorensen, O . E . , P. F o l l i n , A . H . Johnsen, J. Calafat, G . S. Tjabringa, P. S. Hiemstra, and N . Borregaard. 2001.  H u m a n cathelicidin, h C A P - 1 8 , is processed to the antimicrobial  peptide L L - 3 7 by extracellular cleavage with proteinase 3. 37.  Blood 97:3951.  Agerberth, B . , H . G u n n e , J . Odeberg, P. K o g n e r , H . G . B o m a n , and G . H . Gudmundsson. 1995. F A L L - 3 9 , a putative human peptide antibiotic, is cysteine-free and expressed in bone marrow and testis.  38.  Proc Natl Acad Sci USA 92:195.  Bals, R . , X . W a n g , M . Zasloff, and J. M . W i l s o n . 1998.  T h e peptide antibiotic L L -  3 7 / h C A P - 1 8 is expressed in epithelia o f the human lung where it has broad antimicrobial activity at the airway surface. 39.  Proc Natl Acad Sci USA 95:9541.  M u r a k a m i , M . , T . Ohtake, R . A . Dorschner, B . Schittek, C . G a r b e , and R. L . G a l l o . 2002. Cathelicidin anti-microbial peptide expression in sweat, an innate defense system for the skin.  40.  J Invest Dermatol 119:1090.  M u r a k a m i , M . , R . A . Dorschner, L . J. Stern, K . H . L i n , and R . L . G a l l o . 2005. Expression and secretion o f cathelicidin antimicrobial peptides in murine m a m m a r y glands and human milk.  41.  Pediatr Res 57:10.  Hase, K . , M . M u r a k a m i , M . Iimura, S. P. C o l e , Y . H o r i b e , T . Ohtake, M . O b o n y o , R. L . G a l l o , L . E c k m a n n , and M . F . Kagnoff. 2003. E x p r e s s i o n o f L L - 3 7 by human gastric epithelial  cells as  a potential  host defense mechanism  against Helicobacter pylori.  Gastroenterology 125:1613. 42.  Sorensen, O . E . , L . G r a m , A . H . Johnsen, E . Andersson, S. B a n g s b o l l , G . S. Tjabringa, P. S. Hiemstra, J. M a l m , A . Egesten, plasma  hCAP-18  to  ALL-38  antimicrobial peptides in vagina. 43.  by  and N . Borregaard. 2003. Processing gastricsin:  a  novel  mechanism  of  of  seminal  generating  J Biol Chem 278:28540.  W o o , J. S., J . Y . Jeong, Y . J. H w a n g , S. W . C h a e , S. J . H w a n g , and H . M . L e e . 2003. Expression o f cathelicidin in human salivary glands.  Arch Otolaryngol Head Neck Surg  129:211. 44.  M u r a k a m i , M . , B . L o p e z - G a r c i a , M . Braff, R . A . Dorschner, and R . L . G a l l o . 2004. Postsecretory  processing  antimicrobial defense. 45.  generates  multiple  cathelicidins  for  enhanced  topical  J Immunol 172:3070.  Braff, M . H . , M . A . H a w k i n s , A . D . N a r d o , B . L o p e z - G a r c i a , M . D . H o w e l l , C . W o n g , K . L i n , J. E . Streib, R . Dorschner, D . Y . L e u n g , and R . L . G a l l o . 2005. Structure-Function Relationships  among  Human  Cathelicidin  Peptides:  Properties from Host Immunostimulatory Activities. 46.  Dissociation  o f Antimicrobial  J Immunol 174:4271.  Hunter, H . N . , D . B . Fulton, T . G a n z , and H . J . V o g e l . 2002. T h e solution structure o f human hepcidin, a peptide hormone with antimicrobial activity that is involved in iron uptake and hereditary hemochromatosis.  J Biol Chem 277:37597.  18  47.  Hiemstra, P. S., R . J . Maassen, J. Stolk, R. H e i n z e l - W i e l a n d , G . J . Steffens, and J . H . D i j k m a n . 1996. Antibacterial activity o f antileukoprotease.  48.  Infect Immun 64:4520.  Simpson, A . J . , A . I. M a x w e l l , J. R. G o v a n , C . Haslett, and J. M . Sallenave. 1999. Elafin (elastase-specific inhibitor) has anti-microbial activity against gram-positive negative respiratory pathogens.  and gram-  FEBS Lett 452:309.  49.  D u r r , M . , and A . Peschel. 2002. Chemokines meet defensins: the merging concepts o f  50.  H e i l b o r n , J. D . , M . F . N i l s s o n , G . Kratz, G . Weber, O . Sorensen, N . Borregaard, and M .  chemoattractants and antimicrobial peptides in host defense.  Infect Immun 70:6515.  Stahle-Backdahl. 2003. T h e cathelicidin anti-microbial peptide L L - 3 7 is involved in reepithelialization  o f human skin wounds and is lacking in chronic ulcer epithelium.  J  Invest Dermatol 120:379. 51.  K o c z u l l a , R . , G . v o n Degenfeld, C . Kupatt, F . K r o t z , S. Zahler, T . G l o e , K . Issbrucker, P. Unterberger, M . Z a i o u , C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . W e l s c h , P. S. Hiemstra, C . Vogelmeier, R. L . G a l l o , M . Clauss, and R . Bals. 2003. A n angiogenic  role  for  the  human  peptide  antibiotic  LL-37/hCAP-18.  J Clin Invest  111:1665. 52.  B o w d i s h , D . M . E . , D . J. D a v i d s o n , and R . E . W . H a n c o c k . 2005. A re-evaluation o f the  Curr Protein Pept Sci 6:35.  role o f host defence peptides in mammalian immunity. 53.  Scott, M . G . , D . J. D a v i d s o n , M . R . G o l d , D . B o w d i s h , and R. E . W . H a n c o c k . 2002. T h e human antimicrobial peptide L L - 3 7 is a multifunctional modulator o f innate immune responses.  54.  J Immunol 169:3883.  Tjabringa, G . S.,  J. A a r b i o u , D . K . Ninaber, J . W . Drijfhout, O . E . Sorensen,  N.  Borregaard, K . F . Rabe, and P. S. Hiemstra. 2003. T h e antimicrobial peptide L L - 3 7 activates innate immunity at the epidermal growth factor receptor. 55.  airway epithelial  surface  by transactivation  of  the  J Immunol 171:6690.  H a n c o c k , R . E . W . , D e v i n e , D . 2004. "Antimicrobial" or "host defence" peptides? In  Mammalian host defence peptides.  R. E . W . Hancock, Devine,  D . , ed. Cambridge  University Press, N e w Y o r k . 56.  Bals, R . , M . J . G o l d m a n , and J. M . W i l s o n . 1998.  M o u s e beta-defensin 1 is a salt-  sensitive antimicrobial peptide present in epithelia o f the lung and urogenital tract.  Infect  Immun 66:1225. 57.  Bals, R . , X . W a n g , Z . W u , T . Freeman, V . B a f n a , M . Zasloff, and J . M . W i l s o n .  1998.  H u m a n beta-defensin 2 is a salt-sensitive peptide antibiotic expressed in human lung. J  Clin Invest 102:874. 58.  Halmerbauer,  G . , S.  Arri,  M . Schierl, E . Strauch,  and  D.  Y . Roller.  2000.  The  relationship o f eosinophil granule proteins to ions in the sputum o f patients with cystic fibrosis. 59.  Clin Exp Allergy 30:1771.  Baconnais, S., R. T i r o u v a n z i a m , J. M . Z a h m , S. de Bentzmann, B . Peault, G . Balossier, and E . Puchelle. 1999. Ion composition and rheology o f airway liquid from cystic fibrosis fetal tracheal xenografts.  60.  Am JRespir Cell Mol Biol 20:605.  H o s h i n o , K . , K . O g a w a , T . Hishitani, and R. K i t a z a w a . 2003. Influence o f heart surgery on magnesium concentrations in pediatric patients.  61.  M i y a s a k i , K . T . , A . L . Bodeau, T . G a n z , M . E . Selsted, and R . I. Lehrer. 1990. In vitro sensitivity o f oral, gram-negative, human neutrophil defensins.  62.  Pediatr Int 45:39.  facultative  bacteria to the bactericidal activity  of  Infect Immun 58:3934.  T a k e m u r a , H . , M . K a k u , S. K o h n o , Y . Hirakata, H . T a n a k a , R . Y o s h i d a , K . T o m o n o , H . K o g a , A . W a d a , T . H i r a y a m a , and S. K a m i h i r a . 1996.  E v a l u a t i o n o f susceptibility  of  gram-positive and -negative bacteria to human defensins by using radial diffusion assay.  Antimicrob Agents Chemother 40:2280. 19  63.  E r i c k s e n , B . , Z . W u , W . L u , and R . I. Lehrer. 2005. Antibacterial activity and specificity  64.  Turner, J . , Y . C h o , N . N . D i n h , A . J . W a r i n g , and R . I. Lehrer. 1998. Activities o f L L - 3 7 ,  o f the six human {alpha}-defensins. a cathelin-associated  Antimicrob Agents Chemother 49:269.  antimicrobial peptide  o f human neutrophils.  Antimicrob Agents  Chemother 42:2206. 65.  Singh, P. K . , H . P. Jia, K . W i l e s , J. Hesselberth, L . L i u , B . A . C o n w a y , E . P. Greenberg, E . V . V a l o r e , M . J. W e l s h , T . G a n z , B . F . T a c k , and P. B . M c C r a y , Jr. 1998. Production o f beta-defensins by human airway epithelia.  66.  Proc Natl Acad Sci U S A 95:14961.  M i d o r i k a w a , K . , K . Ouhara, H . Komatsuzawa, T . K a w a i , S. Y a m a d a , T . Fujiwara, K . Y a m a z a k i , K . Sayama, M . A . T a u b m a n , H . K u r i h a r a , K . H a s h i m o t o , and M . Sugai. 2003. Staphylococcus aureus susceptibility to innate antimicrobial peptides, beta-defensins and  Infect Immun 71:3730.  C A P 1 8 , expressed by human keratinocytes. 67.  N i s h i m u r a , E . , A . E t o , M . K a t o , S. Hashizume, S. Imai, T . N i s i z a w a , and N . Hanada. 2004.  Oral  streptococci  exhibit  diverse  susceptibility  antimicrobial effects o f h B D - 2 on oral streptococci. 68.  Harder,  J . , J. Battels,  to  human  beta-defensin-2:  Curr Microbiol 48:85.  E . Christophers, and J. M . Schroder.  2001.  Isolation  and  characterization o f human beta -defensin-3, a novel h u m a n inducible peptide antibiotic. J  Biol Chem 276:5707. 69.  G a r c i a , J . R . , F . Jaumann, S. Schulz, A . Krause, J. Rodriguez-Jimenez, U . Forssmann, K . A d e r m a n n , E . K l u v e r , C . Vogelmeier, D . Becker, R . H e d r i c h , W . G . Forssmann, and R . Bals. 2001. Identification o f a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes o f X e n o p u s oocytes and the induction o f macrophage chemoattraction.  70.  Cell Tissue Res 306:257.  H o o v e r , D . M . , Z . W u , K . Tucker, W . L u , and J. L u b k o w s k i . 2003. A n t i m i c r o b i a l characterization o f human beta-defensin  3 derivatives.  Antimicrob Agents Chemother  47:2804. 71.  Ganz,  T.  1987.  Extracellular  polymorphonuclear leukocytes. 72.  release  of  antimicrobial  defensins  by  human  Infect Immun 55:568.  Spencer, L . T . , G . Paone, P. M . K r e i n , F . N . R o u h a n i , J. R i v e r a - N i e v e s , and M . L . Brantly. 2003. T h e R o l e o f H u m a n Neutrophil Peptides in L u n g Inflammation Associated with {alpha} 1-Antitrypsin Deficiency.  73.  Am J Physiol Lung Cell Mol Physiol.  C o l e , A . M . , S. T a h k , A . Oren, D . Y o s h i o k a , Y . H . K i m , A . Park, and T . G a n z . 2001. Determinants o f Staphylococcus aureus nasal carriage.  74.  Clin Diagn Lab Immunol 8:1064.  N a g a o k a , I., S. Hirota, S. Y o m o g i d a , A . O h w a d a , and M . Hirata. 2000. actions o f antibacterial neutrophil defensins and cathelicidins.  75.  Synergistic  Inflamm Res 49:73.  A s h i t a n i , J . , H . M u k a e , T . Hiratsuka, M . Nakazato, K . K u m a m o t o , and S. Matsukura. 2001. P l a s m a and B A L fluid concentrations o f antimicrobial peptides in patients with M y c o b a c t e r i u m avium-intracellulare infection.  76.  Chest 119:1131.  Schnapp, D . , and A . Harris. 1998. Antibacterial peptides in bronchoalveolar lavage fluid.  Am JRespir Cell Mol Biol 19:352. 11.  C o l e , A . M . , P. D e w a n , and T . G a n z . secretions.  78.  1999.  Innate antimicrobial activity o f nasal  Infect Immun 67:3267.  Singh, P. K . , H . P. Jia, K . W i l e s , J. Hesselberth, L . L i u , B . A . C o n w a y , E . P. Greenberg, E . V . V a l o r e , M . J . W e l s h , T . G a n z , B . F . T a c k , and P. B . M c C r a y , Jr. 1998. Production o f beta-defensins by human airway epithelia.  19.  Proc Natl Acad Sci USA 95:14961.  Schaller-Bals, S., A . Schulze, and R . Bals. 2002. Increased peptides in tracheal aspirates o f newborn infants during infection.  levels o f antimicrobial  Am J Respir Crit Care  Med 165:992.  20  80.  C h e n , C . I., S. Schaller-Bals, K . P. Paul, U . W a h n , and R . B a l s . 2004. Beta-defensins and L L - 3 7 in bronchoalveolar lavage fluid o f patients with cystic fibrosis.  81. 82.  J Cyst Fibros 3:45.  Daher, K . A . , M . E . Selsted, and R . I. Lehrer. 1986. Direct inactivation o f viruses by human granulocyte defensins.  J Virol 60:1068.  Wang,  A.  Y.,  B.  Agerberth,  Lothgren,  A.  Almstedt,  and  J.  Johansson.  1998.  A p o l i p o p r o t e i n A - I binds and inhibits the human antibacterial/cytotoxic peptide L L - 3 7 . J  Biol Chem 273:33115. 83.  Sawa, T . , K . K u r a h a s h i , M . Ohara, M . A . Gropper, V . D o s h i , J . W . Larrick, and J . P. W i e n e r - K r o n i s h . 1998. Evaluation o f antimicrobial and effects o f a synthetic C A P 18 fragment model.  84.  lipopolysaccharide-neutralizing  against Pseudomonas aeruginosa  in a mouse  Antimicrob Agents Chemother 42:3269.  Giacometti, A . , O . C i r i o n i , R. G h i s e l l i , F . M o c c h e g i a n i , G . D ' A m a t o , R. C i r c o , F . Orlando,  B.  Skerlavaj,  C . Silvestri,  V.  Saba,  M . Zanetti,  and  G.  Scalise.  2004.  Cathelicidin peptide sheep myeloid antimicrobial peptide-29 prevents endotoxin-induced mortality in rat models o f septic shock. 85.  Nizet,  V . , T . Ohtake,  X . Lauth,  Am J Respir Crit Care Med 169:187.  J. Trowbridge, J . R u d i s i l l , R .  A . Dorschner,  V.  Pestonjamasp, J. Piraino, K . Huttner, and R . L . G a l l o . 2001. Innate antimicrobial peptide  Nature 414:454.  protects the skin from invasive bacterial infection. 86.  W i l s o n , C . L . , A . J . Ouellette,  D . P. Satchell, T . A y a b e , Y . S. L o p e z - B o a d o , J. L .  Stratman, S. J . Hultgren, L . M . Matrisian, and W . C . Parks. 1999. Regulation o f intestinal alpha-defensin  activation by the metalloproteinase matrilysin in innate host defense.  Science 286:113. 87.  W e l l i n g , M . M . , P. S. Hiemstra, M . T . van den Barselaar, A . P a u l u s m a - A n n e m a , P. H . Nibbering,  E . K . Pauwels,  and W . Calame.  neutrophil defensins in experimental leukocyte accumulation. 88.  Antibacterial activity is accompanied by  of  human  increased  J Clin Invest 102:1583.  Bals, R . , D . J. Weiner, A . D . M o s c i o n i , R . L . M e e g a l l a , and J . M . W i l s o n . Augmentation peptide.  89.  1998.  infections in mice  o f innate host defense by expression o f a cathelicidin  1999.  antimicrobial  Infect Immun 67:6084.  B o w d i s h , D . M . , D . J. D a v i d s o n , Y . E . L a u , K . L e e , M . G . Scott, and R . E . W . H a n c o c k . 2004. Impact o f L L - 3 7 on anti-infective immunity.  90.  Parmley, R . T . , C . S. Gilbert, and L . A . Boxer.  91.  Putsep,  granules in "specific granule" deficiency.  J Leukoc Biol. 1989.  A b n o r m a l peroxidase-positive  Blood 73:838.  K . , G . Carlsson, H . G . B o m a n ,  and M . A n d e r s s o n .  2002.  Deficiency  antibacterial peptides in patients with morbus K o s t m a n n : an observation study.  of  Lancet  360:1144. 92.  Tanaka, D . , K . T . M i y a s a k i , and R . I. Lehrer. 2000.  Sensitivity  of  Actinobacillus  actinomycetemcomitans and Capnocytophaga spp. to the bactericidal action o f L L - 3 7 : a cathelicidin found in human leukocytes and epithelium. 93.  Murakami,  M . , T . Ohtake, R. A . Dorschner,  Oral Microbiol Immunol 15:226.  and R . L . G a l l o .  antimicrobial peptides are expressed in salivary glands and saliva. 94.  2002.  Cathelicidin  J Dent Res 81:845.  O n g , P. Y . , T . Ohtake, C . Brandt, I. Strickland, M . B o g u n i e w i c z , T . G a n z , R . L . G a l l o , and D . Y . L e u n g . 2002. Endogenous antimicrobial peptides and skin infections in atopic dermatitis.  95.  N Engl J Med 347:1151.  N o m u r a , I., E . G o l e v a , M . D . H o w e l l , Q . A . H a m i d , P. Y . O n g , C . F . H a l l , M . A . Darst, B. Gao, M . Boguniewicz,  J . B . Travers, and D . Y . L e u n g . 2003. Cytokine milieu o f  atopic dermatitis, as compared to psoriasis, skin prevents induction o f innate immune response genes.  J Immunol 171:3262.  21  96.  A n , L . L . , X . T . M a , Y . H . Y a n g , Y . M . L i n , Y . H . Song, and K . F . W u . 2005. M a r k e d reduction o f L L - 3 7 / h C A P - 1 8 , an antimicrobial peptide, in patients with acute m y e l o i d leukemia.  97.  Int J Hematol 81:45.  N y b e r g , P., M . Rasmussen,  and L . B j o r c k . 2004. alpha  2-macroglobulin-proteinase  complexes protect Streptococcus pyogenes from k i l l i n g b y the antimicrobial peptide L L -  37. J Biol Chem. 98.  Islam, D . , L . Bandholtz, J. N i l s s o n , H . W i g z e l l , B . Christensson, B . Agerberth, and G . G u d m u n d s s o n . 2001.  Downregulation o f bactericidal peptides in enteric infections:  novel immune escape mechanism with bacterial D N A as a potential regulator. Nat  a  Med  7:180. 99.  Larrick, J . W . , J. G . M o r g a n , I. Palings, M . Hirata, and M . H . Y e n . 1991. Complementary D N A sequence o f rabbit C A P 1 8 ~ a unique lipopolysaccharide binding protein.  Biochem  Biophys Res Commun 179:170. 100.  Hirata, M . , Y . S h i m o m u r a , M . Y o s h i d a , S. Endotoxin-binding  synthetic  anticoagulant activities. 101.  peptides  with  C . Wright, and J. W . Larrick.  endotoxin-neutralizing,  1994.  antibacterial  and  Prog Clin Biol Res 388:147.  Larrick, J . W . , M . Hirata, H . Z h e n g , J . Z h o n g , D . B o l i n , J . M . C a v a i l l o n , H . S. Warren, and S. C . Wright. 1994. A novel granulocyte-derived peptide with lipopolysaccharideneutralizing activity.  102.  J Immunol 152:231.  Larrick, J. W . , M . Hirata, R . F . Balint, J. L e e , J. Z h o n g , and S. C . Wright. 1995. H u m a n C A P 1 8 : a novel antimicrobial lipopolysaccharide-binding protein.  103.  Infect Immun 63:1291.  V a n d e r M e e r , T . J . , M . J. M e n c o n i , J . Z h u a n g , H . W a n g , R . M u r t a u g h , C . B o u z a , P. Stevens, and M . P. F i n k . 1995. Protective effects o f a novel 32-amino acid C-terminal fragment o f C A P 1 8 in endotoxemic pigs.  104.  Surgery 117:656.  K i r i k a e , T . , M . Hirata, H . Y a m a s u , F . K i r i k a e , H . T a m u r a , F . K a y a m a , K . Nakatsuka, T . Y o k o c h i , and M . N a k a n o . 1998. Protective effects o f a h u m a n 18-kilodalton cationic antimicrobial  protein  ( C A P 1 8 ) - d e r i v e d peptide  against  murine  endotoxemia.  Infect  Immun 66:1861. 105.  Scott, M . G . , A . C . V r e u g d e n h i l , W . A . B u u r m a n , R . E . H a n c o c k , and M . R . G o l d . 2000. Cutting edge: cationic antimicrobial peptides block the binding o f lipopolysaccharide ( L P S ) to L P S b i n d i n g protein.  106.  J Immunol 164:549.  K i r i k a e , T . , M . Hirata, H . Y a m a s u , F . K i r i k a e , H . T a m u r a , F . K a y a m a , K . Nakatsuka, T . Y o k o c h i , and M . N a k a n o . 1998. Protective effects o f a h u m a n 18-kilodalton cationic antimicrobial  protein  ( C A P 1 8 ) - d e r i v e d peptide  against  murine  endotoxemia.  Infect  Immun 66:1861. 107.  O h g a m i , K . , I. B . Ilieva, K . Shiratori, E . Isogai, K . Y o s h i d a , S. K o t a k e , T . N i s h i d a , N . M i z u k i , and S. O h n o . 2003. Effect o f human cationic antimicrobial protein 18 Peptide on endotoxin-induced uveitis in rats.  108.  Invest Ophthalmol Vis Sci 44:4412.  Giacometti, A . , O . C i r i o n i , R . G h i s e l l i , C . B e r g n a c h , F . O r l a n d o , G . D ' A m a t o , F . M o c c h e g i a n i , C . Silvestri, M . S. D e l Prete, B . Skerlavaj, V . Saba, M . Zanetti, and G . Scalise. 2004. T h e antimicrobial peptide B M A P - 2 8 reduces lethality in mouse models o f staphylococcal sepsis.  109.  Crit Care Med 32:2485.  R o g y , M . A . , H . S. O l d e n b u r g , S. E . C a l v a n o , W . J. Montegut, S. A . Stackpole, K . J. V a n Zee, M . N . M a r r a , R . W . Scott, J. J. Seilhammer, L . L . M o l d a w e r , and et al. 1994. T h e role o f bactericidal/permeability-increasing protein in the treatment o f primate bacteremia and septic shock.  110.  J Clin Immunol 14:120.  B o w d i s h , D . M . E . , D . J. D a v i d s o n , M . G . Scott, Immunomodulatory  Activities  of  S m a l l Host  and R . E . W . H a n c o c k . 2005.  Defense  Peptides.  Antimicrob Agents  Chemother 49:172 7. 22  111.  H u a n g , H . J . , C . R . Ross, and F . B l e c h a . 1997. Chemoattractant properties o f P R - 3 9 , a neutrophil antibacterial peptide.  112.  JLeukoc Biol 61:624.  V e r b a n a c , D . , M . Zanetti, and D . R o m e o . activities o f antibiotic peptide precursors.  113.  1993.  Chemotactic and  protease-inhibiting  FEBS Lett 317:255.  N i y o n s a b a , F . , K . Iwabuchi, A . Someya, M . Hirata, H . M a t s u d a , H . O g a w a , and I. N a g a o k a . 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis.  114.  Immunology 106:20.  D e , Y . , Q . C h e n , A . P . Schmidt, G . M . A n d e r s o n , J . M . W a n g , J. Wooters, J . J . O p p e n h e i m , and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like  1 ( F P R L 1 ) as a receptor to  chemoattract human peripheral b l o o d neutrophils, monocytes, and T cells. J Exp  Med  192:1069. 115.  B o w d i s h , D . M . E . , D a v i d s o n , D . J . , Speert, D . P . , H a n c o c k , R . E . W . 2004. T h e H u m a n C a t i o n i c Peptide L L - 3 7 Induces Activation o f the Extracellular Signal-Regulated K i n a s e and p38  Kinase  Pathways  in Primary H u m a n M o n o c y t e s .  Journal of Immunology  172:3758 116.  L a u , Y . E . , A . R o z e k , M . G . Scott, D . L . Goosney, D . J . D a v i d s o n , and R. E . H a n c o c k . 2005. Interaction and cellular localization o f t h e human host defense peptide L L - 3 7 with lung epithelial cells.  117.  Infect Immun 73:583.  Dorschner, R . A . , V . K . Pestonjamasp, S. T a m a k u w a l a , T . Ohtake, J. R u d i s i l l , V . Nizet, B . Agerberth, G . H . G u d m u n d s s o n , and R. L . G a l l o . 2001. Cutaneous injury induces the release o f cathelicidin anti-microbial peptides active against group A Streptococcus.  J  Invest Dermatol 117:91. 118.  K o c z u l l a , A . R . , and R . B a l s . 2003. A n t i m i c r o b i a l peptides: current status and therapeutic potential. Drugs 63:389.  119.  D a v i d s o n , D . J . , A . J. Currie, G . S. R e i d , D . M . B o w d i s h , K . L . M a c D o n a l d , R . C . M a , R. E . H a n c o c k , and D . P. Speert. 2004. T h e cationic antimicrobial peptide L L - 3 7 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization.  J Immunol  172:1146. 120.  A n , L . L . , Y . H . Y a n g , X . T . M a , Y . M . L i n , G . L i , Y . H . Song, and K . F . W u . 2005. L L 37 enhances adaptive antitumor immune response in a murine m o d e l when genetically fused with M - C S F R ( J 6 - 1 ) D N A vaccine.  121.  LeukRes 29:535.  Dale, B . A . , J. R . K i m b a l l , S. Krisanaprakornkit, F . Roberts, M . R o b i n o v i t c h , R. O'Neal, E . V . V a l o r e , T . G a n z , G . M . A n d e r s o n , and A . W e i n b e r g . 2001. L o c a l i z e d antimicrobial peptide expression in human gingiva.  122.  J Periodontal Res 36:285.  Erdag, G , and J . R . M o r g a n . 2002. Interleukin-1 alpha and interleukin-6 enhance the antibacterial properties o f cultured composite keratinocyte grafts.  123.  Ann Surg 235:113.  F r o h m , M . , B . Agerberth, G . A h a n g a r i , M . Stahle-Backdahl, S. L i d e n , H . W i g z e l l , and G . H . G u d m u n d s s o n . 1997. T h e expression o f the gene c o d i n g for the antibacterial peptide L L - 3 7 is induced in human keratinocytes during inflammatory disorders.  J Biol Chem  272:15258. 124.  Agerberth, B . , J. G r u n e w a l d , E . Castanos-Velez, B . O l s s o n , H . Jornvall, H . W i g z e l l , A . E k l u n d , and G . H . G u d m u n d s s o n . 1999. Antibacterial components in bronchoalveolar lavage fluid from healthy individuals and sarcoidosis patients.  Am J Respir Crit Care  Med 160:283. 125.  Witte, M . B . , and A . B a r b u l . 1997. General principles o f w o u n d healing.  Am 77:509.  Surg Clin North  23  2.0 Immunomodulatory Activities of Small Host Defence Peptides 2.0  I M M U N O M O D U L A T O R Y A C T I V I T I E S O F S M A L L H O S T D E F E N C E PEPTIDES 2.1 2.2 2.3 2.4 2.5  T  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION BIBLIOGRAPHY  T h e majority  o f the  work  24 25 26 28 33 35  in this chapter  has  been published  in B o w d i s h ,  D.M.E., D.J.  D a v i d s o n , M . G . Scott and R . E . W . H a n c o c k . 2005. Immunomodulatory properties o f small host defense peptides.  Antimicrob Agents & Chemother.  2005 May;49(5): 1727-32. A d d i t i o n a l data,  not included in the original publication, are presented in T a b l e 2.1, Figure 2.1, Figure 2.2B, and Figure 2.3. T h e text has been modified accordingly. A l l data were collected and analysed by D . Bowdish. 24  2.1  Introduction Cationic antimicrobial peptides are conserved across virtually all forms o f life as a  primitive component o f the innate immune response. T h e y can be expressed either constitutively or  in  response  to  pathogen-associated  molecular  pattern  molecules,  such  as  bacterial  lipopolysaccharide ( L P S ) , or inflammatory mediators such as I L - 6 and T N F - c c (1, 2). A l t h o u g h they can be potent antimicrobial agents, a key element o f their therapeutic potential may involve the m y r i a d o f other activities attributed to them (3). Indeed, some peptides such as the human cathelicidin L L - 3 7 , have been proposed to have far more potent immunomodulatory activities than antimicrobial functions  (4,  5).  W h e n considering the use  o f peptides  like L L - 3 7  in  immunotherapy one must take into account the large size o f this peptide and the corresponding issues this raises including cost o f goods, protease lability and pharmacokinetics. In this study, we investigated the immunomodulatory properties o f two o f the smallest k n o w n active peptides, both derived from bovine cathelicidins, and contrasted those activities to L L - 3 7 , a k n o w n immunomodulator, with the goal o f developing novel immunomodulatory therapies. Naturally occurring cationic peptides can vary in size from 12 to 50 amino acids and have the property o f folding into amphipathic structures (often after contact with membranes) that have a positively-charged, hydrophilic face and a hydrophobic face. In humans the major linear peptide is the sole cathelicidin characterized to date, L L - 3 7 . processed,  extracellular form  of hCAP-18,  LL-37  a cathelicidin peptide  is the proteolyticallywhich  is  constitutively  produced in the secondary granules o f neutrophils and by a variety o f other cells. A l t h o u g h found at mucosal surfaces at concentrations o f around 2 u g / m l , its expression is induced upon exposure to pro-inflammatory mediators or during the course o f infection or inflammation in a variety o f tissues (5-8).  A l t h o u g h cathelicidins are not well conserved between species, the evolutionary  relationship between these peptides can be inferred from the highly conserved pro-region called the cathelin domain that is cleaved to release the active peptide. Cathelicidins have been found in cows ( B M A P - 2 7 , i n d o l i c i d i n , bactenecin), pigs (protegrins), m i c e ( C R A M P ) , rabbits ( C A P 18) and humans ( h C A P - 1 8 / L L - 3 7 ) and this evolutionary conservation suggests an important role in innate immunity (reviewed in  (9)). T o date studies o f the influence o f peptides as effectors o f  innate immunity have tended to utilize larger peptides o f 26 amino acids or more in size (10). In this study, two o f the shortest k n o w n peptides, indolicidin and B a c 2 A , a derivative o f bactenecin, were investigated for their ability to affect a variety o f innate immune responses such as cytokine production, anti-endotoxin activity and chemotaxis. Indolicidin, a 13 amino acid, proline and  25  tryptophan rich cathelicidin, folds into a characteristic boat shaped structure when  associated  with membranes (11). Its moderate antimicrobial activity ( M I C values o f between 16-64 | i g / m l for c o m m o n Gram-negative bacteria and between 4-8 u.g/ml for G r a m - p o s i t i v e bacteria) and ability to interact with microbial membranes have been w e l l characterized (12). Bactenecin is a 12 amino acid cathelicidin that is also found in the large granules o f bovine neutrophils and is also  moderately  active  against  many  c o m m o n Gram-negative pathogens  ( M I C values  of  approximately 8 u.g/ml) and Gram-positive bacteria ( M I C values o f 64 u,g/ml and greater). T h e functional structure o f bactenecin  in vivo  has not been w e l l characterized, and there is some  evidence for a linear structure (13). B a c 2 A is a linearized derivative o f bactenecin in w h i c h two cysteine residues have been replaced with two alanine residues. It has modest broad-spectrum activity with M I C values o f between 2-32 p.g/ml for Gram-negative bacteria and between 0.2516 p.g/ml for G r a m - p o s i t i v e bacteria that is consistent with the activity o f the disulphide bonded peptide (14). T h i s modification prevents the possibility o f concatemer formation thus m a k i n g B a c 2 A a better target for drug development. Sequence information for the peptides used in this study is presented in T a b l e 2.1.  Table 2.1. Sequences of the peptides used in these studies. Sequence Name  Amino acids Charge  Bac2A  RLARIVVIRVAR  12  +4  Indolicidin  ILPWKWPWWPWRR  13  +3  LL-37  LLGDFFRKSKEKIGKEFrCRIVQRIKDFLRNLVPRTES  37  +6  Previous research has shown that L L - 3 7 is a potent immunomodulator. L L - 3 7 has been demonstrated to be a chemoattractant for human monocytes,  T cells (15) and mast cells (16),  a potent anti-endotoxic agent (17) and induces chemokine production (4).  is  In light o f these  observations we compared the immunomodulatory activities o f the two bovine cathelicidins, indolicidin and B a c 2 A , to those o f the better characterized L L - 3 7 with respect to anti-endotoxin properties, chemotaxis and chemokine production. W e found that i n d o l i c i d i n and B a c 2 A have different immunomodulatory properties, w h i c h make them candidates for development as novel therapies.  2.2  Materials & Methods  Cell lines and culture conditions T h e h u m a n monocyte-like cell line, T H P - 1 (18), was obtained from the A T C C (No. T I B 202, R o c k v i l l e , M D ) , and grown in supplemented R P M I 1640 m e d i a containing 10% foetal c a l f serum and 1% L-glutamine ( G i b c o B R L , Burlington, O N ) . T H P - 1 cells were differentiated into  26  adherent macrophage-like cells by addition o f l O O m M phorbyl myristate acetate and incubation at 3 7 ° C , 5% C 0 2 for three days as described previously (19). Undifferentiated T H P - 1  monocytes  were used for the chemotaxis experiments. Differentiated macrophage-like cells were used for the anti-endotoxin assays. T h e human bronchial epithelial cell line 1 6 H B E 1 4 o - ( H B E ) was a gift from D r . D . Gruenert (Cardiovascular Research Institute, U n i v e r s i t y o f California, U C S F ) and  was  maintained in m i n i m a l essential  (20)  media ( M E M ) with Earle's salts ( G i b c o B R L ,  Burlington, O N ) . H B E cells were maintained in flasks and seeded into wells that had been treated with mouse type-4 collagen and human fibronectin solution (8.5 m l M E M with Earle's salts, 1% fibronectin, 1% collagen and 1 m g B S A ; G i b c o B R L , B u r l i n g t o n , O N ) .  Peptide synthesis. A l l peptides were synthesized by N - (9-fluorenyl) methoxycarbonyl (frnoc) chemistry at the N u c l e i c A c i d / P r o t e i n Service unit at the University o f British C o l u m b i a , as previously described  (21).  Peptides  were  purified  by  reverse-phase  high-performance  liquid  chromatography and were at least 98% pure. T h e concentration o f the peptides in solution was determined by amino acid analysis.  Cytotoxicity assay A n M T T assay ( A T C C ) was used to assess the cytotoxicity o f the peptides and was performed as per the manufacturer's instructions. T h e assay is based o n the cleavage o f the y e l l o w tetrazolium salt M T T into purple formazan b y metabolically active cells. Cells were cultured as described above and peptides were added for 24 h.  A decrease in the absorbance at  550 n m indicated a decrease in cell viability.  Cytokine production IL-8  or T N F - a  found in the supernatants  o f the treated cells was  measured  using  commercially prepared E L I S A plates in accordance to the manufacturer's suggestion ( R & D systems, M i n n e a p o l i s , N M ) . C e l l s were seeded in 24 well tissue culture plates at a concentration of 2 x 10 cells/ml ( T H P - 1 ) or 5 x 10 cells/ml ( H B E ) and incubated for either three days ( T H P 5  5  1) or 48 hours ( H B E ) . C e l l s were then incubated in at least triplicate, for six hours (to measure T N F - a production) or eight hours (to measure I L - 8 production) in the presence o f either media alone, or with peptides  Escherichia coli  L P S 0111:B4 (Sigma C h e m i c a l C o . , St L o u i s , M o . ) , cationic  or a combination o f L P S and peptide  (concentrations  stated in text) in media.  Supernatants were collected and stored at - 2 0 ° C until use.  27  Chemotaxis assay Chemotaxis o f the monocyte-like cell line T H P - 1 was assayed in a 96-well  disposable  chemotaxis system with 5 p m polycarbonate filters (Chemotx, Neuroprobe, Gaithersburg, M D ) . Chemotactic factors were diluted i n R P M I media supplemented with 1% bovine serum albumin (chemotaxis medium) and added to the bottom chamber o f the chemotaxis  plate. A 1 x  10  6  cell/ml suspension o f T H P - 1 cells was made in chemotaxis media and 50 pl was added to the top o f the chamber. T h e plate was incubated at 3 7 ° C , 5% CO2 for three hours. In order to quantify the number o f cells that migrated through the filter, a standard curve o f cell number represented by colour change was created using a colorimetric assay o f cell viability based on cleavage o f tetrazolium salt, W S T - 1 (Roche Diagnostics). W S T - 1 (10% v/v) was added and the plate was incubated at 3 7 ° C in 5% CO2 until colour development was complete. T h e plate was then read at 570 n m in a P o w e r W a v e 340 E L I S A plate reader. T h e number o f cells that had migrated through the membrane was expressed as a percentage o f the total number o f cells added (chemotaxis index).  Statistical analysis Student's t test was performed to determine statistical significance. V a l u e s are expressed as mean +/- standard error. Significance was determined as p value <0.05. 2.3  Results  Indolicidin, Bad A and LL-37 are not cytotoxic at concentrations used in this study. Cytotoxicity was assessed using the M T T assay. N o n e o f the peptides caused significant cytotoxicity in either the H B E or T H P - 1 cell lines at concentrations o f < 100 p g / m l (Figure 2.1). In contrast, the cytotoxic peptide C P 2 9 caused significant cell death at a concentration o f 50 pg/ml.  28  Figure 2.1. Cytotoxicity of LL-37, Bac2A and Indolicidin. M T T assays were performed and it was found that LL-37, Bac2A and indolicidin are not cytotoxic to THP-1 cells (A) or H B E cells (B) at concentrations < 100 ug/ml. At 300 ug/ml, significant cytotoxicity was observed in indolicidin treated H B E cells and in indolicidin and LL-37 treated THP-1 cells. Mean values of three independent experiments are represented ± standard error of the mean. A Student's t test was performed and asterisks denote significance at a p<0.005 level compared to cells treated with a vehicle control only.  Peptide concentration (ug/ml)  Indolicidin, but not Bac2A, displays potent anti-endotoxic properties. Certain cationic peptides have the ability to block the production of cytokines produced in response to LPS by either directly up-regulating inhibitory pathways in cells (22) or interfering with the ability of LPS to bind LBP (17). THP-1 cells were stimulated with E. coli LPS and the amount of TNF-a in the supernatant was assayed by ELISA. The cells produced between 2,600-3,900 ng/ml of TNF-a. The ability of the short peptides indolicidin and Bac2A to inhibit LPS-induced T N F - a production in the THP-1 cell line was investigated at low concentrations of host defence peptides such as would be found at mucosal surfaces. The addition of indolicidin at the same time as LPS suppressed the LPS-induced production of TNFa in a dose dependent manner (Figure 2.2A) in the differentiated macrophage-like THP-1 cell line and was statistically significant at > 5 ug/ml (p<0.001). This inhibition was not as potent at low concentrations as was observed for LL-37 (Figure 2.2A), a human cathelicidin previously shown to have anti-endotoxin ability (17), however, at concentrations of 50 ug/ml over 80% inhibition was observed (Figure 2.2B). In contrast, Bac2A caused no inhibition over the concentration range of 1-10 p.g/ml and demonstrated only moderate anti-endotoxin activity (approximately 30%) at 20 ug/ml. Interestingly, as shown previously with LL-37 and the insectderived peptide C E M A (4, 21), the inhibition of cytokine production was observed even when indolicidin was added to the THP-1 cells up to one hour after LPS (Figure 2.3). This indicates that the anti-endotoxin properties of indolicidin may be due to an interaction of the peptide with cells in addition to direct neutralization of LPS.  29  Figure 2.2. Anti-endotoxin properties of indolicidin, Bac2A and  100  .2 80 t3 CD  20 O  all ' Bac2A  1  I  „  5  10  Peptide concentration (ug/ml)  I  20  Indolicidin concentration (ug/ml)  Figure 2.3. Addition of indolicidin •M up to 60 minutes after the addition of LPS results in inhibition of LPS induced TNF-a from PMA treated THP-1 cells. THP-1 cells were stimulated with E. coli 0111:B4 LPS (lOOng/ml) and 20 pg/ml of indolicidin which was added either simultaneously, or 20, 40 or 60 minutes after the addition of LPS. There was no statistically significant change in inhibition of LPS induced T N F - a production when indolicidin was added up to 60 minutes after the LPS. Mean values of the average of three independent experiments ± the standard error of the mean shown.  LL-37. A ) Indolicidin and LL-37 significantly reduced the amount of T N F - a produced by differentiated THP-1 cells upon stimulation with 100 ng/ml ofE. coli 0111:B4 LPS. Bac2A did not reduce the amount of TNF-a at the concentrations tested (N/D, no detectable decrease in TNF-a). B) Higher doses of indolicidin are required to inhibit LPS induced TNFa production. Mean values of one representative experiment of at least three are represented ± standard error of the mean. A Student's t test was performed and * denotes significant at p< 0.05, ** denotes significant at a p<0.001, *** denotes p<0.005 level compared to LPS-only treated controls.  60  20  40  60  Minutes post LPS addition  The anti-endotoxin activity of indolicidin and LL-37 in combination is greater than additive. It has been well established that certain cationic peptides used in combination can demonstrate synergistic antimicrobial activity (23). To determine whether this phenomenon was applicable to the non-antimicrobial activities of cationic peptides, we examined the ability of L L 37 to work synergistically with indolicidin to inhibit LPS-induced T N F - a production. The anti30  endotoxin activity o f i n d o l i c i d i n and L L - 3 7 in combination was significantly greater than either peptide alone and greater than the additive effect o f these two peptides (Figure 2.4; p<0.05)  Figure 2.4. The addition of indolicidin and LL-37 in combination produces a greater than additive inhibition of LPS-induced TNF-a.  Indolicidin  significantly TNF-a  and  reduced the  produced  by  LL-37  amount  of  differentiated  T H P - 1 cells u p o n stimulation with 100 ng/ml  of  E. coli  0111:B4 L P S . T h e  combination o f very small amounts o f indolicidin ug/ml  or  (1  |ig/ml)  or  LL-37  100  ng/ml)  resulted  (1  in a  greater reduction o f L P S - i n d u c e d T N F a than w o u l d be predicted to occur i f s? 10  this effect was strictly additive. M e a n values  of  the  independent  average  experiments  of ±  three the  standard error o f the mean shown. A one-tailed  Student's  t  test  was  performed a n d the results significant at a  p<0.05  level  are marked with an  asterisk.  Bac2A is a more potent chemotactic agent than indolicidin. It has been shown previously that L L - 3 7 is chemotactic for various cells types, including monocytes, mast cells and T cells (15, 24). Little is k n o w n about the chemoattractant properties o f other cathelicidins, although a relative o f bactenecin, B a c 7 , has been shown to chemoattract monocytes (25). In this experiment the abilities o f indolicidin, B a c 2 A and L L - 3 7 to induce chemotaxis o f undifferentiated T H P - 1 cells were investigated. T h e addition o f B a c 2 A to the bottom chamber o f the Neuroprobe C h e m o t x filter, induced the migration o f T H P - 1 cells in a statistically significant (p<0.05 at 10 (ig/ml B a c 2 A , p<0.001 at >50 U-g/ml B a c 2 A ) and dosedependant manner (Figure 2.5). Indolicidin did not induce a statistically significant increase in chemotaxis, except at a concentration o f 300 |J.g/ml, at w h i c h concentration it demonstrated some cytotoxicity. Interestingly L L - 3 7 , w h i c h has previously been shown to be chemotactic for bloodderived monocytes (15), was not chemotactic for T H P - 1 cells.  31  Figure  2.5.  Bac2A  is  a  chemoattractant  for  u n d i f f e r e n t i a t e d T H P - 1 cells. Indolicidin, B a c 2 A ,  o o in =  x 9 3—  o CO E o <u t ;  sz in " 1 o TJ CO  L L - 3 7 , or water (vehicle control) were added to the  80 70 60 50 40 30 20 10  bottom  » No peptide •Bac2A a Indolicidin • LL-37  well  of  concentrations  a  chemotaxis  shown.  chamber  Undifferentiated  at  the  THP-1  cells were added to the top w e l l and after three hours chemotaxis  was assessed. Chemotaxis  was  measured b y calculating the total number o f cells that migrated as a percentage o f the total number o f cells added. M e a n values o f the average o f three  s I  10  50  100  Peptide (ug/ml)  independent experiments ± the standard error o f the mean shown. A  Students's  two-tailed t test was  performed and the results significant at a p<0.05 level  are  marked  significant  with  at p<0.001  an  asterisk  and  are marked by  those  a double  asterisk.  Indolicidin, but not Bac2A, can induce IL-8 expression in 16HBE4o- cells. It has been shown previously that L L - 3 7 induces the release o f the chemokines I L - 8 and/or M C P - 3 in both the murine lung and in various cell lines (4). Therefore we investigated the possibility that i n d o l i c i d i n and/or B a c 2 A might have similar properties. In differentiated T H P - 1 cells, indolicidin inhibited the L P S induced production o f the cytokine T N F - a , but d i d not itself induce T N F - a or I L - 8 (data not shown). However, in the h u m a n b r o n c h i a l cell line, 1 6 H B E 4 o - , indolicidin concentrations > 10 p g / m l induced significant production o f the chemokine I L - 8 (p < 0.05) in a dose dependant manner (Figure 2.6), but did not induce T N F - a (data not shown). B a c 2 A did not induce any cytokine or chemokine production, even at 50 p g / m l (data not shown).  3000 "  F i g u r e 2.6. I n d o l i c i d i n i n d u c e s I L - 8 p r o d u c t i o n in  Ia  Q.  §  2000"  were  o  o P -a p  dependent epithelial  grown  to  manner  cell l i n e ,  confluency  in  the  human  16HBE4o-. and  Cells  subsequently  i n d o l i c i d i n for eight hours. T h e  presence o f I L - 8 in the supernatant was detected by  1000 -  ELISA.  a 1  dose  incubated with  oo '  a  bronchial  Mean  experiment  of  values at  least  of three  one are  representative represented  ±  standard error o f the mean, n=4 replicates for each  0  0  0.1  1  10  Indolicidin (ug/ml)  50  100  condition. A two tailed T test was performed and results significant at a p<0.05 are marked with an asterisk.  32  2.4  Discussion In  this  study  the  bovine  neutrophil-derived peptides  i n d o l i c i d i n and B a c 2 A  were  demonstrated to have diverse and complementary immunomodulatory functions, as summarized in Table 2.2, in addition to their established antimicrobial activities. Indolicidin inhibited the L P S - i n d u c e d pro-inflammatory cytokine responses in a macrophage-like cell line and induced chemokine production in a dose dependant manner in a bronchial epithelial cell line. Conversely, B a c 2 A had very weak anti-endotoxic or chemokine inducing properties but acted directly to induce chemotaxis o f macrophage-like T H P - 1 cells.  Table 2.2. Comparison of t le activities of Indolicidin, Bac2A and L L - 3 7 (Ug/ml). M i n i m a l concentration demonstrating the given property (pg/ml) Indolicidin  Bac2A  LL-37  Reference  8  4  64  (26, 27)  64  8  64  (23, 26)  Anti-endotoxin activity  5  20  1  Figure 2.2  IL-8 production  10  Property G r a m Positive MIC  (e.g. S. aureus) G r a m Negative  (e.g. P. aeruginosa)  Chemotaxis 1  ND(>  ND(> 100)  10  2  100)  Figure 2.6(28, 29)  10  1  N D (> 300)  3  Figure 2.5  N D = not detectable at concentrations < 100 p g / m l .  2  N D = chemotaxis was observed at 300 p g / m l (data not shown)  3  N D = not detectable at concentrations < 300 p g / m l . Cationic peptides have traditionally been studied as antimicrobial agents. In bovine  neutrophils, multiple classes o f peptides have been found, including the P- sheet defensins (30), the a-helical peptide B M A P , and the short (12-13 amino acids) cationic peptides bactenecin (31) and indolicidin (32). It seems reasonable to assume that these peptides have evolved to work in combination as opposed to independently, and that each peptide has distinct (but possibly overlapping) functions. Indeed, p-defensins have different antimicrobial activity spectra (33) while certain combinations o f peptides  have been demonstrated to be synergistic  in their  antimicrobial activities (23). H o w e v e r direct killing o f microbes m a y not always be the primary role that these agents perform in the innate immune response as the physiological concentrations o f peptides and o f antagonistic m o n o - and di-valent cations are often difficult to rationalize with a primary antimicrobial role  in vivo  (5, 34)  Alternatively, their possible primary action is  modulation o f immune mechanisms, as these functions occur at physiological salt and peptide concentrations (4, 5). H o w e v e r , the degree to w h i c h these functions contrast and/or complement each other in different host defence peptides is largely unknown. 33  Individual peptides have a distinct spectrum o f immune defense functions. T o test the possibility that different peptides may have diverse immunomodulatory functions on human cells, and thus have alternatively directed potential as immune boosting drugs, we chose to evaluate the properties o f two o f the smallest related cationic peptides. It was interesting to observe that B a c 2 A , despite having a stronger binding affinity than i n d o l i c i d i n for L P S (17), was unable to b l o c k L P S - i n d u c e d  TNF-a  production at equivalent  concentrations.  This  was  consistent with our previous results indicating that the ability o f peptides to b l o c k L P S - i n d u c e d responses does not rely entirely on their ability to bind to L P S (35). Indeed, gene array studies on the R A W 264.7 mouse macrophage cell line demonstrated that peptides can b l o c k the expression o f only a subset o f the genes induced by L P S , while themselves inducing the expression o f a unique subset o f genes (22). T h i s is consistent with the interpretation that the addition o f peptides does not merely prevent L P S from binding to the macrophages, but alters L P S - i n d u c e d gene expression in a more directed fashion. Indeed, we showed that i n d o l i c i d i n can block cytokine production when  added up to an hour after the  addition o f L P S to  cells  as previously  demonstrated for L L - 3 7 and the insect peptide C E M A . In this time period, we assume that L P S w o u l d already b i n d to L P S receptors on macrophages, and initiate signalling (36). T h e ability o f peptides to selectively b l o c k pro-inflammatory cytokine gene expression implies that although their ability to b i n d to L P S and disrupt L P S binding to L P S - b i n d i n g protein (17) may be a component o f their anti-endotoxin ability, it is not the sole method b y w h i c h they block proinflammatory responses. Indeed amongst the genes that are up regulated directly by peptides are anti-inflammatory cytokines such as I L - 1 0 (4). T h e ability o f peptides to b l o c k the excess cytokine production that is a hallmark o f sepsis has lead to their consideration as anti-sepsis agents (37-39). H o w e v e r toxicity due to the relatively  high concentrations  o f peptide  required is  a major concern. In this  study  we  demonstrate that low concentrations o f various peptides m a y be more effective in blocking L P S induced cytokine responses than higher concentrations o f a single peptide and that exogenous addition o f peptides might lead to synergy with the hosts o w n naturally occurring peptides. It has been postulated that antimicrobial peptides have evolved from the deletion products o f C X C chemokines (40) and, consistent with this, certain peptides are chemotactic for distinct subsets o f leukocytes. F o r example, L L - 3 7 is chemotactic for h u m a n blood-derived monocytes and  T  cells  (15)  through  formyl  peptide  receptor-like  1 (FPRL1)  approximately 50 u g / m l , whereas it is chemotactic towards mast cells receptors between 5-10 u g / m l (16).  at  concentrations  of  through two different  Thus chemotaxis occurs at concentrations that are generally 34  higher than those required for anti-endotoxin activity. A l t h o u g h there is a paucity o f data indicating the exact concentrations  o f host defence peptides  in vivo  it is k n o w n that  the  cathelicidins are found at extremely high concentrations in the granules o f neutrophils and it seems reasonable  that  chemotaxis  in vivo  might  occur  in response  to  somewhat  higher  concentrations o f peptides, such as w o u l d occur at sites o f neutrophil degranulation. Interestingly in our study, L L - 3 7 was not chemotactic for the T H P - 1 monocyte-like cell line (Figure 2.5) even though this cell line has been shown to express F P R L - 1 (41) and we found that these cells express F P R L - 1 at the R T - P C R level. Conversely, B a c 2 A , but not i n d o l i c i d i n , was shown to induce chemotaxis o f the cells at concentrations o f > 10 ng/ml (Figure 2.5). Future experiments should aim to elucidate the chemotactic receptor for B a c 2 A . These data indicate that short peptides such as i n d o l i c i d i n and B a c 2 A possess contrasting immunomodulatory properties, w h i c h appear to be comparable to certain activities o f the k n o w n immunomodulator, L L - 3 7 . Interestingly, these bovine derived peptides function on human cell lines, indicating that host defence peptides may demonstrate conserved function across species. The  differences  in  their  complementary functions  in vivo, and/or  naturally occurring bactenecin contrasting activities  immunomodulatory  properties  be a consequence  may  valuable  in the  physiologically  o f the modifications made to the  to produce the derivative B a c 2 A .  make these peptides  reflect  design  Regardless  o f this, these  o f alternatively  directed  therapeutic agents, and as tools in dissecting the variations i n the mechanisms that underpin these diverse activities. In addition their smaller size compared to L L - 3 7 makes them potentially exciting prototypes for development as novel immunomodulatory drugs, especially since their collective ability to enhance chemokine production, induce chemotaxis  and block endotoxin  responses resembles the properties o f L L - 3 7 . Future work w i l l involve optimizing these peptides and better characterising their immunomodulatory properties to further illuminate their potential as novel therapeutic agents. 2.5 1.  Bibliography D i a m o n d , G . , J . P. Russell, and C . L . Bevins. 1996. Inducible expression o f an antibiotic peptide gene in lipopolysaccharide-challenged tracheal epithelial cells.  Proc Natl Acad  Sci US A 93:5156. 2.  Z h a n g , G . , H . W u , C . R . Ross, J . E . M i n t o n , and F . B l e c h a . 2000. C l o n i n g o f porcine NRAMP1  and its induction by lipopolysaccharide, tumor necrosis  interleukin-lbeta: role o f C D 14 and mitogen-activated  factor alpha, and  protein kinases.  Infect Immun  68:1086. 3.  Scott, M . G . , and R . E . H a n c o c k . 2000. C a t i o n i c antimicrobial peptides multifunctional role in the immune system.  and their  Crit Rev Immunol 20:407.  35  4.  Scott, M . G . , D . J. D a v i d s o n , M . R . G o l d , D . B o w d i s h , and R . E . H a n c o c k . 2002. T h e human antimicrobial peptide L L - 3 7 is a multifunctional modulator o f innate immune responses.  5.  J Immunol 169:3883.  B o w d i s h , D . M . E . , D a v i d s o n , D . J . , H a n c o c k , R . E . W . 2004. A re-evaluation o f the role o f host defence  peptides  in mammalian  Combinatorial Chemistry & High  immunity.  Throughput Screening In press. 6.  K i m , S. T . , H . E . C h a , D . Y . K i m , G . C . H a n , Y . S. C h u n g , Y . J . L e e , Y . J . H w a n g , and H.  M . Lee.  2003.  inflammatory disease. 7.  A n t i m i c r o b i a l peptide  LL-37  is  upregulated  in  chronic  nasal  Acta Otolaryngol 123:81.  W o o , J. S., J. Y . Jeong, Y . J. H w a n g , S. W . C h a e , S. J . H w a n g , and H . M . L e e . 2003. Expression o f cathelicidin in human salivary glands.  Arch Otolaryngol Head Neck Surg  129:211. 8.  O n g , P. Y . , T . Ohtake, C . Brandt, I. Strickland, M . B o g u n i e w i c z , T . G a n z , R. L . G a l l o , and D . Y . L e u n g . 2002. Endogenous antimicrobial peptides and skin infections in atopic dermatitis.  9.  NEngl J Med 347:1151.  Zanetti, M . 2004. Cathelicidins, multifunctional  peptides o f the  innate immunity.  J  Leukoc Biol 75:39. 10.  Gennaro, R . , M . Zanetti, M . Benincasa,  E . Podda,  and M . M i a n i .  2002.  Pro-rich  antimicrobial peptides from animals: structure, biological functions and mechanism 11.  action.  Curr Pharm Des 8:763.  Rozek,  A . , C . L . Friedrich,  and  R.  E . Hancock.  2000.  Structure  antimicrobial peptide indolicidin bound to dodecylphosphocholine sulfate micelles. 12.  1996.  M o d e o f action o f  the  M e c h a n i s m o f interaction  of  classes o f cationic antimicrobial peptides with planar bilayers and with the  cytoplasmic membrane o f Escherichia coli. 14.  bovine  J Biol Chem 271:19298.  W u , M . , E . M a i e r , R . B e n z , and R. E . H a n c o c k . 1999. different  the  and sodium dodecyl  Biochemistry 39:15765.  Falla, T . J . , D . N . Karunaratne, and R. E . H a n c o c k . antimicrobial peptide indolicidin.  13.  of  of  Biochemistry 38:7235.  R o m e o , D . , B . Skerlavaj, M . Bolognesi, and R . Gennaro. 1988. Structure and bactericidal activity o f an antibiotic dodecapeptide purified from bovine neutrophils.  J Biol Chem  263:9573. 15.  D e , Y . , Q . C h e n , A . P. Schmidt, G . M . A n d e r s o n , J. M . W a n g , J . Wooters,  J. J.  O p p e n h e i m , and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like chemoattract  1 ( F P R L 1 ) as a receptor  human peripheral blood neutrophils, monocytes, and T cells. J Exp  to  Med  192:1069. 16.  N i y o n s a b a , F . , K . Iwabuchi, A . Someya,  M . Hirata, H . M a t s u d a , H . O g a w a , and I.  Nagaoka. 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis. 17.  Immunology 106:20.  Scott, M . G . , A . C . V r e u g d e n h i l , W . A . B u u r m a n , R . E . H a n c o c k , and M . R . G o l d . 2000. Cutting edge: cationic antimicrobial peptides block the b i n d i n g o f ( L P S ) to L P S b i n d i n g protein.  18.  lipopolysaccharide  J Immunol 164:549.  T s u c h i y a , S., M . Y a m a b e , Y . Y a m a g u c h i , Y . K o b a y a s h i , T . K o n n o , and K . T a d a .  1980.  Establishment and characterization o f a human acute monocytic leukemia cell line ( T H P -  1). Int J Cancer 26:171. 19.  Stokes, R. W . , and D . Doxsee. 1999. T h e receptor-mediated uptake, survival, replication, and drug sensitivity o f M y c o b a c t e r i u m tuberculosis within the macrophage-like cell line T H P - 1 : a comparison with human monocyte-derived macrophages.  Cell Immunol 197:1.  36  20.  C o z e n s , A . L . , M . J. Y e z z i , K . K u n z e l m a n n , T . O h r u i , L . C h i n , K . E n g , W . E . Finkbeiner, J. H . W i d d i c o m b e , and D . C . Gruenert. 1994. C F T R expression and chloride secretion in  Am JRespir Cell Mol Biol 10:38.  polarized immortal human bronchial epithelial cells. 21.  G o u g h , M . , R. E . H a n c o c k , and N . M . K e l l y . 1996. A n t i e n d o t o x i n activity o f cationic peptide antimicrobial agents.  22.  Infect Immun 64:4922.  Scott, M . G , C . M . Rosenberger, M . R. G o l d , B . B . F i n l a y , and R . E . H a n c o c k . 2000. A n alpha-helical cationic antimicrobial peptide selectively modulates macrophage responses to  lipopolysaccharide  and directly  alters  macrophage  gene  J Immunol  expression.  165:3358. 23.  Y a n , H . , and R. E . H a n c o c k . 2001. A n t i m i c r o b i a l Defense Peptides.  24.  Synergistic  Interactions  between M a m m a l i a n  Antimicrob Agents Chemother 45:1558.  N i y o n s a b a , F . , A . S o m e y a , M . Hirata, H . O g a w a , and I. N a g a o k a . 2001. Evaluation o f t h e effects o f peptide antibiotics human beta-defensins-1/-2 and L L - 3 7 o n histamine release  Eur J Immunol 31:1066.  and prostaglandin D ( 2 ) production from mast cells. 25.  Verbanac, D . , M . Zanetti, and D . R o m e o . activities o f antibiotic peptide precursors.  26.  W u , M . , and R . E . H a n c o c k .  1999.  Chemotactic and protease-inhibiting  Improved derivatives  dodecameric antimicrobial cationic peptide. 21.  1993.  FEBS Lett 317:255. o f bactenecin,  a  cyclic  Antimicrob Agents Chemother 43:1274.  Turner, J . , Y . C h o , N . N . D i n h , A . J. W a r i n g , and R . I. Lehrer. 1998. Activities o f L L - 3 7 , a cathelin-associated  antimicrobial peptide  o f human neutrophils.  Antimicrob Agents  Chemother 42:2206. 28.  L a u , Y . E . , A . R o z e k , M . G . Scott, D . L . G o o s n e y , D . J . D a v i d s o n , and R . E . W . H a n c o c k . 2005. Interaction and cellular localization o f the h u m a n host defense peptide L L - 3 7 with lung epithelial cells.  29.  Infect Immun 73:583.  B o w d i s h , D . M . E . , D a v i d s o n , D . J . , Speert, D . P . , H a n c o c k , R . E . W . 2004. T h e H u m a n Cationic Peptide L L - 3 7 Induces Activation o f the Extracellular Signal-Regulated Kinase and p38  K i n a s e Pathways  in Primary H u m a n M o n o c y t e s .  Journal of Immunology  172:3758 30.  Selsted, M . E . , Y . Q . T a n g , W . L . M o r r i s , P. A . M c G u i r e , M . J . N o v o t n y , W . Smith, A . H . Henschen, and J. S. C u l l o r . 1993. Purification, primary structures, and antibacterial activities  of  neutrophils. 31.  beta-defensins,  a new  family  antimicrobial peptides  from  bovine  J Biol Chem 268:6641.  Gennaro, R . , L . D o l z a n i , and D . R o m e o . 1983. Potency o f bactericidal proteins purified from the large granules o f bovine neutrophils.  32.  of  Infect Immun 40:684.  Selsted, M . E . , M . J. N o v o t n y , W . L . M o r r i s , Y . Q . T a n g , W . Smith, and J . S. Cullor. 1992.  Indolicidin, a novel bactericidal tridecapeptide  amide f r o m neutrophils.  J Biol  Chem 267:4292. 33.  Singh, P. K . , H . P. Jia, K . W i l e s , J. Hesselberth, L . L i u , B . A . C o n w a y , E . P. Greenberg, E . V . V a l o r e , M . J . W e l s h , T . G a n z , B . F . T a c k , and P. B . M c C r a y , Jr. 1998. Production o f beta-defensins b y human airway epithelia.  34.  Proc Natl Acad Sci U SA 95:14961.  H a n c o c k , R . E . W . , D e v i n e , D . 2004. "Antimicrobial" or "host defence" peptides? In  Mammalian host defence peptides.  R. E . W . H a n c o c k , D e v i n e ,  D . , ed. Cambridge  University Press, N e w Y o r k . 35.  Scott, M . G , H . Y a n , and R. E . H a n c o c k . 1999. B i o l o g i c a l properties o f structurally  36.  H s u , Y . W . , K . H . C h i , W . C . H u a n g , and W . W . L i n . 2001.  related alpha-helical cationic antimicrobial peptides. lipopolysaccharide-mediated  Infect Immun 67:2005. Ceramide inhibits  nitric oxide synthase and cyclooxygenase-2 induction in  macrophages: effects on protein kinases and transcription factors.  J Immunol 166:5388.  37  37.  C i o r n e i , C . D . , A . Egesten, M . Engstrom, K . Tornebrandt, and M . Bodelsson. Bactericidal/permeability-increasing oxide synthesis.  38.  protein inhibits endotoxin-induced  2002.  vascular nitric  Acta Anaesthesiol Scand 46:1111.  Jiang, J . , P . Z h u , Z . W a n g , Y . H e , D . L i u , K . T i a n , and Y . D i a o . 1998. Protective effect o f bactericidal/permeability-increasing protein in mice with E . c o l i sepsis.  Chin J Traumatol  1:21. 39.  L e v i n , M . , P. A . Quint, B . Goldstein, P. Barton, J. S. B r a d l e y , S. D . Shemie, T . Y e h , S. S. Kim,  D.  P.  Cafaro,  P.  J.  Scannon,  and  B.  P.  Giroir.  2000.  Recombinant  bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment for children with severe meningococcal Study G r o u p . 40.  sepsis: a randomised trial. rBPI21 M e n i n g o c o c c a l  K r i j g s v e l d , J . , S. A . Zaat, J. M e e l d i j k , P. A . van V e e l e n , G . F a n g , B . P o o l m a n , E . Brandt, J.  E . Ehlert,  Thrombocidins,  A.  J . Kuijpers, G .  microbicidal  H . Engbers,  proteins  deletion products o f C X C chemokines. 41.  Sepsis  Lancet 356:961.  from  J. Feijen,  human  blood  and  J . Dankert.  platelets,  2000.  are C-terminal  J Biol Chem 275:20374.  Resnati, M . , I. P a l l a v i c i n i , J . M . W a n g , J . O p p e n h e i m , C . N . Serhan, M . R o m a n o , and F . B l a s i . 2002. T h e fibrinolytic receptor for urokinase chemotactic receptor F P R L 1 / L X A 4 R .  activates the G  protein-coupled  Proc Natl Acad Sci USA 99:1359.  38  3.0 The Human Cationic Peptide LL-37 Induces Activation of the Extracellular Signal Regulated Kinase and p38 Kinase Pathways in Primary Human Monocytes* 3.0  T H E H U M A N C A T I O N I C P E P T I D E LL-37 I N D U C E S A C T I V A T I O N O F T H E E X T R A C E L L U L A R S I G N A L R E G U L A T E D K I N A S E A N D P38 K I N A S E P A T H W A Y S I N PRIMARY HUMAN MONOCYTES 3.1 3.2 3.3 3.4 3.5  1  P.  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION BIBLIOGRAPHY  39 40 41 45 53 57  T h e majority o f this w o r k was originally published in the B o w d i s h , D . M . E . , D . J . D a v i d s o n , D . Speert and R . E . W . H a n c o c k . T h e human cationic peptide L L - 3 7 induces activation o f the  extracellular signal regulated kinase and p38 kinase pathways in primary human monocytes.  Journal of Immunol.  2004 M a r 15;172(6):3758-65. A l l data was collected and analysed by D .  B o w d i s h except Figure 3 . 6 A w h i c h was produced by D . J . D a v i d s o n . Figure 3.5B represents new data. T h e text has been updated to reflect advances in the literature. 39  3.1 Introduction Cationic host defense peptides are a primitive and conserved component o f the innate immune response. These peptides can be expressed either constitutively or induced in response to pathogen  associated  molecular patterns,  such as bacterial lipopolysaccharide ( L P S ) ,  or  inflammatory mediators such as interleukin-6 and tumor necrosis factor alpha ( T N F - a ) (1, 2). W h i l e some o f these peptides have the ability to k i l l microorganisms (3, 4), leading to their categorization as antimicrobial peptides, they also appear to have functions in modulating immune responses (5-7).  T h e role o f cationic peptides has been considered to be o f primary  significance in the innate immune response. H o w e v e r , it is b e c o m i n g increasingly apparent that they provide a key link between the innate and adaptive responses (8, 9). The  cathelicidins  are  an  evolutionarily  conserved  group  of  peptides  of  which  h C A P 1 8 / L L - 3 7 is the only human member. In neutrophils, h C A P 1 8 is found in its unprocessed form, however u p o n release from cells the C terminal domain, w h i c h is called L L - 3 7 , is cleaved from the N terminal cathelin domain (10). L L - 3 7 is a potent modulator o f the immune response and to date a wide variety o f interactions with the effector cells o f the immune response have been described (11). M o n o c y t e s , the precursors o f both macrophages and certain lineages o f dendritic cells, have been shown to demonstrate chemotaxis towards L L - 3 7 (12), w h i c h is also able to stimulate the production o f chemokines and chemokine receptors (13). A variety o f cationic peptides can also reduce pro-inflammatory cytokine production b y macrophages to T o l l like receptor agonists, such as L P S (14). endotoxin-mediated  lethality  in animals  Consistent with this function, L L - 3 7 can suppress (15).  Dendritic cells  are also  affected  by  LL-37  treatment. Recent studies have shown that differentiation, function and surface expression o f a variety o f cell surface markers o f human monocyte-derived dendritic cells are altered by exposure  to L L - 3 7 ,  w h i c h generates cells with enhanced antigen uptake and presentation  capacity (16). L L - 3 7 also has a variety o f other functions including promotion o f histamine release from mast cells,  inhibition o f tissue proteases,  stimulation o f w o u n d healing, and  angiogenesis (17-20). Despite burgeoning interest in the immunomodulatory properties o f cationic peptides, little is k n o w n about their mechanism o f stimulation o f the effector cells o f the innate immune response. A t the time this w o r k was originally published there was only one proposed receptor for  LL-37,  FPRL-1,  a pertussis-toxin  sensitive,  G-protein coupled receptor that has  been  proposed to be the chemotactic receptor on monocytes, neutrophils and subsets o f T cells (12). The recently-demonstrated ability o f L L - 3 7 to induce mast cell chemotaxis is also pertussis toxin 40  sensitive and thus mediated b y a G-protein coupled receptor, however the F P R L - 1 receptor was not found to be i n v o l v e d (21). These studies indicated that there may be two types o f receptors for  LL-37  on mast  chemotaxis  cells,  and a low  a h i g h affinity  receptor that  is  affinity receptor with an undefined  responsible  for L L - 3 7  function (21).  The  induced  downstream  signalling and consequences o f L L - 3 7 binding to these receptors has not been characterized. Since this work was published it has been proposed that the epidermal growth factor receptor ( E G F R ) is the receptor linked to mitogen activated protein kinases ( M A P K ) activation and I L - 8 production in epithelial cells and that  P2X7,  an purinergic receptor is linked to L L - 3 7 induced I L -  i p processing in L P S primed monocytes (22, 23). A l t h o u g h there is ample evidence that cationic host defence peptides interact directly with the effector cells o f the innate and adaptive immune response, very little is known about eukaryotic cell signalling induced by peptide interaction. In this paper we demonstrate that L L 37 can signal v i a the induction o f phosphorylation o f the M A P K , E R K 1 / 2 and p38 in peripheral blood derived monocytes and in a human bronchial epithelial cell line. W e demonstrate that L L 37 promotes the activation o f E R K 1 / 2 and p38, at concentrations equivalent to those likely to be found at the site o f acute inflammation (25-50 pg/ml). In addition, i n the presence o f the cytokine G M - C S F , activation o f these kinases occurs at concentrations o f L L - 3 7 as low as 5-10 pg/ml, w h i c h w o u l d be predicted to be present at the onset o f inflammation. T h u s we hypothesize that low levels o f peptide are homeostatic and do not possess a major immunomodulatory effect unless they are expressed in the presence o f other agonists such as cytokines. demonstrate secretion  that at least two  o f the  immunomodulatory properties o f L L - 3 7 ,  o f I L - 8 and the transcription o f the  chemokines,  MCP-1,  MCP-3  Lastly, we increases in  and I L - 8 , are  dependent upon the activation o f the p38 and E R K 1 / 2 kinases. 3.2  Materials & Methods  Cell purification and culture B l o o d monocytes were prepared using standard techniques (24). B r i e f l y , 100 m l o f fresh human venous b l o o d was collected in sodium heparin-containing Vacutainer collection tubes (Becton  D i c k i n s o n , Mississauga, O N , Canada) from volunteers  according to U B C C l i n i c a l  Research Ethics B o a r d protocol C 0 2 - 0 0 9 1 . T h e b l o o d was m i x e d , at a 1:1 ratio, with R I O media ( R P M I 1640 m e d i u m supplemented with 10% v/v fetal c a l f serum ( F B S ) , 1% L-glutamine, 1 n M sodium pyruvate) in an E-toxa-clean ( S i g m a - A l d r i c h , O a k v i l l e , O N , Canada) washed, endotoxinfree bottle. P B M C were separated using F i c o l l - P a q u e Plus ( A m e r s h a m Pharmacia Biotech, Baie D ' U r f e , P Q , Canada) at r o o m temperature and washed with phosphate buffered saline ( P B S ) . 41  M o n o c y t e s were enriched by removal o f T-cells by resetting with fresh sheep red blood cells (UBC  animal  Biosciences  care  unit)  pre-treated  with  Vibrio cholerae  neuraminidase  (Calbiochem  Inc., L a Jolla, C A , U S A ) and repeat separation by F i c o l l Paque Plus (25). T h e  enriched monocytes were washed with P B S , then cultured (approximately 2-3 x 106 per well) in R I O media for 1 hour at 3 7 ° C followed by the removal o f non-adherent cells; monocytes were >95% pure as determined b y flow cytometry (data not shown). B lymphocytes were isolated by removing non-adherent cells and adding them to a new plate for one hour at 3 7 ° C . T h i s was repeated a total o f three times. A n y remaining monocytes adhered to the plates, and residual nonadherent cells were primarily B cells. Cells were cultured in F a l c o n tissue culture 6-well plates (Becton D i c k i n s o n , Mississauga, O N , Canada). T h e adherent monocytes were cultured in 1 m l R I O media at 3 7 ° C in w h i c h L L - 3 7 and/or cytokines dissolved in endotoxin-free water (SigmaA l d r i c h , O a k v i l l e , O N , Canada) were added. Endotoxin-free water was added as a vehicle control. F o r studies using pertussis toxin the media was replaced with 1 m l o f R I O media containing 100 n g / m l o f toxin and incubated for 60 m i n at 3 7 ° C . L L - 3 7 and cytokines were added directly to the media containing pertussis toxin. F o r the isolation o f T lymphocytes, the rosetted T cells and sheep red b l o o d cells were resuspended in 20 m l P B S and 10 m l o f distilled water was added to lyse the latter. T h e cells were then centrifuged at 1000 r p m for 5 m i n after w h i c h the supernatant was removed. T h e pelleted T cells were promptly washed in P B S and increasing amounts o f water were added until all sheep red b l o o d cells had lysed. T h e remaining T cells were washed once in P B S , and viability was confirmed using a 0.4% T r y p a n blue solution. Primary human b l o o d monocytes and T cells were cultured in R P M I 1640 supplemented with 10%> v/v heat-inactivated F B S , 1% v/v L - glutamine,  1 n M sodium pyruvate ( G I B C O Invitrogen Corporation, Burlington, O N ,  Canada). F o r each experiment between two and eight donors were used. T h e simian virus 40-transformed, immortalized 1 6 H B E 1 4 o - bronchial epithelial cell line was a generous gift o f D r . D . Gruenert (University o f California, San Francisco, C A ) (26). C e l l s were routinely cultured to confluence in 100% humidity and 5%> C 0 2 at 3 7 ° C . T h e y were grown in M i n i m a l Essential media with Earles' salts ( G I B C O Invitrogen Corporation, Burlington, O N , Canada) containing 10%> F B S (Hyclone), 2 m M L-glutamine. F o r experiments, cells were seeded at 1x10  s  cells per m l o f media in 24 well plates and cultured at 3 7 ° C and 5%> CO2 for two days.  T h e cells were used between passages 8 and 20.  42  Media and reagents LL-37 (sequence  (sequence L L G D F F R K S K E K I G K E F P C R I V Q R I K D F L R N L V P R T E S )  KWKSFIKKLTTAVKKVLTTGLPALIS),  were  synthesized  by  and C P 2 9  Fmoc  [(N-(9-  fluorenyl) methoxycarbonyl)] chemistry at the N u c l e i c A c i d / P r o t e i n Synthesis ( N A P S ) U n i t at UBC.  Human  recombinant  granulocyte-macrophage  colony-stimulating  factor  (GM-CSF),  interleukin-4 (IL-4) and macrophage colony-stimulating factor ( M - C S F ) were purchased from Research Diagnostics Inc. (Flanders, N J , U S A ) . Pertussis toxin was supplied by List B i o l o g i c a l Laboratories Inc. ( C a m p b e l l , C A , U S A ) . S B 203580, a specific  inhibitor o f p38 kinase  was  purchased from S i g m a - A l d r i c h (Oakville, O N , Canada) and P D 9 8 0 5 9 , a specific inhibitor o f E R K 1 / 2 kinase was purchased from C e l l Signaling T e c h n o l o g y (Beverly, M A ) . T h e peptide W K Y M V M was a k i n d gift from D r . Claes Dahlgren, Phagocyte Research Laboratory, Dept. o f Rheumatology & Inflammation Research, University o f Goteborg, Sweden.  Analysis of cytotoxicity and cell viability V i a b i l i t y after cell isolation was determined by resuspending cells in a 0.4% T r y p a n blue solution ( G i b c o ) . Peptide cytotoxicity  was  assessed b y collecting  culture supernatants  after  stimulation with L L - 3 7 or vehicle control. T h e concentration o f L D H - 1 in the supernatants was quantified using a Cytotoxicity Detection kit (Roche Diagnostics, L a v a l , P Q , Canada) according to the manufacturer's instructions.  Analysis of endotoxin contaimination. T h e media, peptide and chemokine stocks, and vehicle controls were tested for endotoxin contamination using a L A L C h r o m a g e n i c Endpoint A s s a y ( H y C u l t Biotechnology). E n d o t o x i n levels were less than 0.3 E U / m l .  Immunob lotting After stimulation, cells were washed with ice c o l d P B S containing (Sigma). N e x t 125 p l o f R I P A buffer (50 m M T r i s - H C l , p H 7.4,  1 m M vanadate  1% N P - 4 0 , 0.25%  sodium  deoxycholate, 150 m M N a C I , 1 m M E D T A , 1 m M P M S F , 1 p g / m l each o f aprotinin, leupeptin, pepstatin, 1 m M sodium orthovanadate, 1 m M N a F ) was added and the cells were incubated on ice  until they were completely  lysed  as  assessed b y visual  inspection.  T h e lysates were  quantitated using a B C A assay (Pierce). 30 pg o f lysate was loaded onto 1.5 m m thick gels, which  were  run at  100  volts  for  approximately  2  hours.  Proteins  were  transferred  to  nitrocellulose filters for 75 m i n at 70 V . T h e filters were blocked for 2 hours at r o o m temperature with 5% skim m i l k in T B S T (10 m M T r i s - H C l p H 8, 150 m M N a C I , 0.1% Tween-20). T h e  43  filters were then incubated overnight  at 4 ° C with the  anti-ERKl/2-P  or anti-p38-P  (Cell  Signalling T e c h n o l o g y , M a ) polyclonal antibodies. Immunoreactive bands were detected using horseradish peroxidase-conjugated  sheep anti-mouse  I g G antibodies  ( A m e r s h a m Pharmacia,  N e w Jersey) and chemiluminescence detection (Sigma, M o ) . T o quantify bands, the films were scanned and then quantified by densitometry using the software program, ImageJ. T h e blots were reprobed with a P-actin antibody ( I C N B i o m e d i c a l Incorporated, O h i o ) and densitometry  was  performed to allow correction for protein loading.  Kinase Assay A n E R K 1 / 2 activity assay was performed using a non-radioactive kit ( C e l l Signalling Technology). Briefly, cells were treated for 15 m i n and lysed in lysis buffer. E q u a l amounts o f proteins were immunoprecipitated with an i m m o b i l i z e d p h o s p h o - E R K l / 2 antibody that reacts only with the phosphorylated (i.e.  active)  form o f E R K 1 / 2 .  T h e i m m o b i l i z e d precipitated  enzymes were then used for the kinase assay using E l k - 1 followed by immunoblot analysis with antibodies that allow detection and quantitation o f phosphorylated substrates.  Quantification of IL-8 H u m a n I L - 8 from supernatants o f 1 6 H B E 1 4 0 - cells and blood-derived monocytes measured  by  using  the  commercially  available  enzyme-linked  immunosorbent  assay  was kit  (Biosource, M o n t r e a l , Q C ) according to the manufacturer's instructions.  Semiquantitative RT-PCR Total R N A was isolated from donor blood derived monocytes  using an RNaqueous  M i c r o - k i t ( A m b i o n ) as described by the manufacturer. T h e samples were D N a s e treated, and then c D N A synthesis was accomplished by using a first-strand c D N A synthesis kit (Gibco). T h e resultant c D N A s were used as a template  in P C R s for various cytokine genes the primer  sequences for w h i c h are listed in Table 3.1. E a c h R T - P C R reaction was performed in at least duplicate. Results were analyzed in the linear phase o f amplification and normalized to the housekeeping  control,  glyceraldehyde-3-phosphate  dehydrogenase.  The  absence  contaiminating genomic D N A was verified by including controls generated without  of  reverse  transcriptase.  44  Table 3.1. Primer sequences of cytokine genes. Primer  F o r w a r d sequence (5'-3')  Reverse Sequence (5'-3')  MCP-1  TCATAGCAGCCACCTTCATTC  TAGCGCAGATTCTTGGGTTG  IL-8  GTGCAGAGGGTTGTGGAGAAG  TTCTCCCGTGCAATATCTAGG  MCP-3  TGTCCTTTCTCAGAGTGGTTCT  TGCTTCCATAGGGACATCATA  TNF-a  AGGGAGCCTTTGGTTCTGG  TCAGCAATGAGTGACAGTTGG  IL-P  GGATATGGAGCAACAAGTGG  ATGTACCAGTTGGGGAACTG  GAPDH  GAAACTGTGGCGTGATGG  GTCGCTGTTGAAGTCAGAGG  3.3  Results  LL-3 7 induces ERK1/2 andp38 phosphorylation in peripheral blood derived monocytes. T o determine i f L L - 3 7 induced the activation o f the M A P kinases, E R K 1 / 2 and/or p38, peripheral b l o o d derived monocytes were treated with 50 p g / m l L L - 3 7 or water (as a vehicle control)  for  15  min.  To  visualize  the  activated  (phosphorylated)  form  of  the  kinases,  immunoblots were performed with antibodies specific for the dually phosphorylated form o f the kinases  (phosphorylation  on  Thr202+Tyr204  and  Thrl80+Tyrl82  for  ERK1/2  and  p38  respectively). T h e gels were re-probed with an antibody for P-actin to normalize for loading differences. In all cases, an increase in phosphorylation o f E R K 1 / 2 (n=8) and p38 (n=4)  was  observed i n response to L L - 3 7 treatment (Figure 3.1).  45  F i g u r e 3.1.  E x p o s u r e to  LL-37  induces  phosphorylation  ERK1/2  and  peripheral  p38. blood  monocytes  were  of  Human derived  exposed  to  50  u g / m l o f L L - 3 7 (+), or endotoxin free water (-) as a vehicle control, for 15 minutes. A n t i b o d i e s specific for  the  phosphorylated forms  ERK1/2  and p38  were  of  used  to  detect activation o f E R K 1 / 2  and  p38  was  in cell  lysates.  B-actin  quantified to a l l o w correction for protein loading. A l l donors tested showed increased phosphorylation o f E R K 1 / 2 and p38 in response to LL-37  treatment.  A)  One  representative donor is shown. B ) The  phosphorylation o f  ERK1/2  (n=9 donors) and p38 (n=4 donors) was quantified b y densitometry. student's  one-tailed  performed. indicates  p  t-test  A  was  Double  asterisk  <  asterisk  0.01,  indicates p<0.05. M e a n values  ±  S E M are shown.  A serum component is required for LL-37-induced activation It has been proposed that L L - 3 7 binds to at least one serum protein, and that this binding modifies its activities (27). T h u s , we tested the ability o f L L - 3 7 to activate E R K 1 / 2 and p38 in the presence and absence o f serum. N o cytotoxicity was observed i n response to a 15 minute L L 37 exposure in the presence or absence o f serum, as assessed by trypan blue exclusion or the L D H - 1 assay (data not shown). In the absence o f serum, no detectable activation o f E R K 1 / 2 or p38 was observed using antibodies specific for the phosphorylated forms o f the kinases, in contrast to the activation observed in the presence o f F C S (n=3,  F i g u r e 3.2). In addition, a  functional assay for E R K 1 / 2 activation was performed. In this assay, activation o f an E R K 1 / 2 controlled transcription factor, E l k - 1 , was detected in m e d i a containing serum but not in serum free media (n=2, Figure 3.2). T h i s indicates that L L - 3 7 requires the addition o f at least one serum component to induce activation o f the M A P kinases, E R K 1 / 2 and p38.  46  F i g u r e 3.2.  LL-37  is u n a b l e  to i n d u c e  MAPK  activation i n h u m a n m o n o c y t e s u n d e r s e r u m free conditions. C e l l s were exposed to 50 p g / m l o f L L 37 (+),  or endotoxin free water (-)  as a vehicle  control, for 15 minutes. A ) After exposure to L L - 3 7 in  media  ERK1/2  containing was  10%  F C S , phosphorylated  detectable,  phosphorylation o f E R K 1 / 2 absence o f serum (n=3). factor  downstream  of  however,  was  detected  no in the  B ) E l k - 1 , a transcription ERK1/2,  was  activated  (phosphorylated) upon exposure to 50 p g / m l o f L L 37 in media containing 10% F C S , but not in the absence o f serum (n=2).  LL-3 7 activation of MAPK pathways is specific for monocytes and epithelial cells. T o assess whether L L - 3 7 induced activation o f the E R K 1 / 2 and p38 kinases was specific to effector cells o f the innate immune response, phosphorylation o f p38 and E R K 1 / 2 was studied in freshly isolated primary monocytes, 16HBE14oconditions,  (Figure 3.3).  B cells, T cells and the h u m a n epithelial cell line  N o cytotoxicity  was  detected  as assessed by trypan blue exclusion  or the  i n any cell type under the L D H - 1 assay (data not  Immunoblot analysis demonstrated that both the epithelial cell line (n=2 primary  monocytes  (n=8  donors)  showed  substantial  increases  in  shown).  experiments) ERK1/2  assay  and  and p38  phosphorylation u p o n exposure to L L - 3 7 for 15 m i n (as assessed after normalization for loading differences, by re-probing with an antibody for P-actin). H o w e v e r , no phosphorylation o f either E R K 1 / 2 or p38 kinases was evident in human T cells or B cells (n=4 donors and n=2 donors respectively). T h i s cellular specificity indicates that activation o f the M A P kinases is specific to certain cell types and therefore may relate to similar receptors in these types o f cells or to similarities in membrane organization.  47  PBDM  LL-37  T cells  +  -  B cells  HBE  +  F i g u r e 3.3. A c t i v a t i o n o f E R K 1 / 2 a n d p38 p h o s p h o r y l a t i o n b y L L - 3 7 is i n d u c e d i n cells of the  innate  immune  system.  Freshly isolated human peripheral b l o o d derived  monocytes  ( P B D M ) , T cells, and B cells, and the human bronchial epithelial cell line ( H B E ) were stimulated for 15 minutes with 50 | l g / m l o f L L - 3 7 (+), or endotoxin free water as a vehicle control (-), in media containing 10% F C S . Antibodies specific for the phosphorylated forms o f E R K 1 / 2 and p38 were used to detect their activation in cell lysates. A c t i v a t i o n o f E R K 1 / 2 and p38  was  evident in monocytes and the bronchial epithelial cell line, but not T or B cells. F o r monocytes, T cells, and B cells, one representative donor is shown from n=8, 4 and 2 respectively. F o r the 1 6 H B E 1 4 o - cell line, one representative experiment o f two is shown, fi-actin was quantified to allow correction for protein loading.  G-coupled proteins are not involved in LL-3 7 induced activation of MAPK. F P R L - 1 , a pertussis toxin sensitive G - c o u p l e d protein has been proposed to be a receptor for L L - 3 7 on monocytes, certain subsets o f T cells, and neutrophils (12). T o test whether F P R L - 1 or other G-protein c o u p l e d receptors were involved in L L - 3 7 - i n d u c e d signalling, sensitivity to inhibition  with  phosphorylation  pertussis was  toxin  observed  was as  a  examined. result  of  No  significant  incubation  with  reduction pertussis  of  ERK1/2  toxin.  ERK1/2  phosphorylation upon stimulation with 50 ug/ml L L - 3 7 was increased an average o f 8.3 fold in the absence (n=9) and 7.6 fold in the presence (n=3) o f pertussis toxin. (Figure 3.4). A synthetic peptide activator/agonist ( W K Y M V M ) o f F P R L - 1 and F P R L - 2 was used as a positive control. The F P R L - 1 agonist induced massive E R K 1 / 2 phosphorylation, w h i c h was partially inhibited by the incubation with pertussis toxin (approximately 6 and 9 fold inhibition as determined by densitometry was seen in two donors; Figure 3.4), indicating that the incubation with pertussis toxin under the conditions studied did indeed inhibit G-protein c o u p l e d receptor signalling. Since L L - 3 7 induced signalling was not affected by pertussis toxin treatment these data suggest that activation o f E R K 1 / 2 was not linked to a pertussis toxin sensitive receptor, and in particular was not linked to the F P R L - 1 receptor.  48  F i g u r e 3.4. L L - 3 7 i n d u c e d p h o s p h o r y l a t i o n o f  ERK1/2  a n d p38 k i n a s e s is not m e d i a t e d b y  G - p r o t e i n c o u p l e d r e c e p t o r s . Antibodies were used to detect the phosphorylated forms o f E R K 1 / 2 and p38 in cell lysates from human peripheral b l o o d derived monocytes. 13-actin was quantified to allow correction for protein loading. C e l l s were exposed to 50 p g / m l o f L L - 3 7 (+), or endotoxin free water (-) as a vehicle control, for 15 minutes in m e d i a containing 10% F C S . Phosphorylation induced b y L L - 3 7 was not inhibited b y lOOng/ml pertussis toxin (+)  added  thirty minutes before exposure to L L - 3 7 and present during L L - 3 7 induced stimulation. A s a positive control cells were exposed to 100 ng/ml o f W K Y M V M , a synthetic agonist o f F P R L - 1 (+). Phosphorylation o f E R K induced by F P R L - 1 was reduced approximately nine-fold by the addition o f pertussis toxin (+). O n e representative experiment o f two shown.  LL-37 induced activation ofERKl/2 andp38 is dose dependent and demonstrates synergy with GM-CSF. The  precursor h C A P 1 8 is found at low levels in b l o o d and serum while L L - 3 7 , the  processed form o f the peptide, is found at m u c h higher concentrations in the context o f infection (28-30). W e hypothesized  that L L - 3 7 induced activation o f the M A P kinases may be more  pronounced in the presence o f cytokines w h i c h are up-regulated during the course o f infection. T o test this hypothesis we added G M - C S F , I L - 4 or M - C S F (each at lOOng/ml) concurrently with L L - 3 7 and measured phosphorylation o f E R K 1/2 in freshly isolated h u m a n b l o o d monocytes (Figure 3 . 5 A ) . L L - 3 7 (8.3  E R K 1 / 2 phosphorylation was evident w h e n cells were treated with 50 p g / m l o f  fold increase over untreated, n=9) but not at lower concentrations  (n=2). In the  presence o f 100 n g / m l G M - C S F , L L - 3 7 - i n d u c e d E R K 1/2 phosphorylation increased markedly (58 fold greater than untreated, n=5). T h i s synergistic activation d i d not occur in the presence o f 100 n g / m l M - C S F or I L - 4 .  Furthermore, in the presence o f G M - C S F , activation o f E R K 1 / 2  occurred in response to concentrations o f 5 and 10 p g / m l o f L L - 3 7 , respectively, in the two donors tested (Figure 3.5B).  T h i s demonstrates  that L L - 3 7  induced activation o f  ERK1/2  occurred at a lower threshold in the presence o f G M - C S F , a cytokine found locally at sites o f infection. T h e presence o f G M - C S F also enhanced L L - 3 7 induced phosphorylation o f p38 (data not shown). T o test whether increased phosphorylation o f the M A P K in the presence o f G M - C S F  49  had a biologically significant outcome, IL-8 production was measured. In the presence of GMCSF, IL-8 production was increased in 3 of 4 donors (Figure 3.5C). A  45000  *  .1 40000  •  | 35000  I1  0 fig/mt I SO LIU/Mil nn/ml  1 Ju  g 30000 £ 25000 j£ 20000 LU  :  o 15000  2>  £ 10000  s  - 5000 0  •  M-CSF  IL-4  No Cytokines G M - C S F  B LL-37 (ng/ml) 0  10  25  50  FCS  MMBflfefll<MM  FCS + GM-CSF  6000  • 0 ng/ml GMCSF •  10 ng/ml GM-CSF  • 25 ng/ml GM-CSF • 50 ng/ml GM-CSF • 100 ng/ml GM-CSF  0  Concentration of  25 LL-37 (ug/ml)  Figure 3.5. ERK1/2 activation is amplified and occurs at lower concentrations of LL-37 when in the presence of GM-CSF. A) Freshly isolated monocytes were stimulated with LL-37 (50 pg/ml), or endotoxin free water (0 pg/ml LL-37) as a vehicle control, in media containing 10% FCS and either no cytokines, GM-CSF (100 ng/ml), M-CSF (100 ng/ml) or IL-4 (100 ng/ml). A minimum of three donors was used for each experiment. LL-37 induced phosphorylation of ERK 1/2 was significantly enhanced in the presence of GMCSF, but not IL-4 or M-CSF. Mean ± SE. Asterisk indicates p=0.004. B) The concentration of LL-37 required to induce phosphorylation of ERK 1/2 was decreased from 50 pg/ml to 5 pg/ml. One representative donor of two is shown. C) LL-37 and GM-CSF synergy results in increased IL-8 production. LL-37 induced IL-8 production is increased in the presence of GM-CSF in three of four donors tested. One representative donor is shown. Mean of three wells ± SE, p<0.002.  LL-37 induced MAPK activation is not related to cytotoxicity in human blood derived monocytes.  Some cationic peptides induce lysis of eukaryotic cells. To test whether LL-37 was cytotoxic in our model system over longer exposure periods, human blood derived monocytes from two donors were incubated with LL-37 (10-50 pg/ml), the cytotoxic peptide CP29 (50 pg/ml) or a vehicle control for 0.5 to 4 hours (Figure 3.6A). The concentration of LDH in the supernatants was quantified as a measure of cytotoxicity. The cytotoxic peptide, CP29, induced 50  significant cell lysis beginning at 0.5 hours. In contrast, cells exposed to up to 50 p.g/ml L L - 3 7 demonstrated no more lysis than the controls (Figure 3 . 6 A ) . These data demonstrate that M A P K phosphorylation induced b y 15 minute exposure to L L - 3 7 in h u m a n b l o o d derived monocytes does not correlate with later cytotoxicity at the concentrations used in this study.  Figure 3.6. LL-37 induces IL-8  production in human blood derived monocytes in the absence of cytotoxicity. A )  Human  peripheral b l o o d derived  monocytes donors  from  two  were  separate  exposed  concentrations o f between  to 10-50  u g / m l o f L L - 3 7 or endotoxin free water as a vehicle control, for up to four hours. T h e concentration o f L D H - 1 in the supernatants induces a  colourmetric  change  which  provides a measure o f cytotoxicity. T h e average release o f L D H by the two donors is shown. Error bars represent the range o f results for the two donors. B ) After assaying for  cytotoxicity  the  supernatants  collected at 4 hrs were assayed for IL-8 by E L I S A . donors  is  T h e average o f 2  shown.  Error  bars  represent the range o f results for the two donors.  LL-3 7 exposure induces IL-8 secretion in human blood-derived monocytes W e have recently demonstrated that L L - 3 7 induced the secretion o f chemokines in the human A 5 4 9 epithelial cell line (IL-8), and whole human b l o o d ( M C P - 1 and IL-8) (13). In addition to testing for L D H levels, the supernatants from h u m a n b l o o d derived monocytes treated with 10-200 u g / m l , the cytotoxic peptide C P 2 9 (50 ug/ml) or a vehicle control for up to four hours were assayed for I L - 8 secretion b y E L I S A . In both donors tested, the addition o f L L - 3 7 led to an increase in I L - 8 secretion; however, the cytotoxic peptide C P 2 9 did not induce I L - 8 secretion (Figure 3.6B). These data confirm that the i m m u n o m o d u l a t o r y properties o f L L - 3 7 and cytotoxicity are independent.  51  Activation of ERK1/2 and p38 is necessary for transcription of Elk-1 controlled genes and secretion ofIL-8. IL-8 release is k n o w n to be governed, at least in part, b y activation o f the E R K 1 / 2 and p38 kinases (31). In order to determine i f activation o f the M A P kinases was required for I L - 8 release, cells were incubated with a p38 kinase-specific inhibitor, S B 203580, and/or an E R K 1 / 2 specific inhibitor, P D 9 8 0 5 9 , for one hour prior to a four hour incubation with 50 p g / m l L L - 3 7 . IL-8 in the culture media was assayed by E L I S A . In both donors tested, L L - 3 7 induced I L - 8 secretion was reduced b y the presence o f either 10 u M E R K 1 / 2 or p38 kinase inhibitors and was abrogated in the presence o f the combination o f both inhibitors (Figure 3 . 7 A ) . W h e n the human bronchial epithelial cells were stimulated with 50 ug/ml o f L L - 3 7 for four hours, a significant increase in the amount o f I L - 8 released into the media was detected (Figure 3.7B). T h i s L L - 3 7 induced secretion o f I L - 8 was reduced in the presence o f either the p38 inhibitor or the E R K 1 / 2 inhibitor. In the presence o f both inhibitors in combination I L - 8 secretion was not significantly different from the baseline level o f I L - 8 secretion (Figure 3.7B). These data indicate that both p38 and E R K 1 / 2 kinases are i n v o l v e d in L L - 3 7 mediated I L - 8 secretion in b l o o d derived monocytes and epithelial cells.  Activation of ERK1/2 and p38 is necessary for LL-37 induced transcription of certain chemokines. T o determine the downstream transcriptional effects o f L L - 3 7 - i n d u c e d M A P kinase activation, the expression o f genes k n o w n to be regulated by E R K 1 / 2 or p38 was assessed. S e m i quantitative R T - P C R  was  performed on R N A collected from monocytes  isolated from two  donors and pre-treated with the E R K 1 / 2 and p38 inhibitors or vehicle control prior to a  four  hour exposure with 50 u g / m l o f L L - 3 7 (n=2). M C P - 1 and I L - 8 have been demonstrated to be under the transcriptional control o f both E R K 1 / 2  and p38  (32,  33).  Consistent with these  observations the expression o f these genes was up-regulated f o l l o w i n g exposure to L L - 3 7 and this up-regulation was abolished in cells pretreated with either E R K 1 / 2 or p38 inhibitors (Figure 3.7C). Transcription o f the gene encoding M C P - 3 was also increased in the presence o f L L - 3 7 and was dependent on the activation o f both p38 and E R K 1 / 2 kinase. C o n v e r s e l y , there were no increases in the transcription o f the genes encoding the pro-inflammatory cytokines T N F - a , I L 1(3 or I L - 6 in either donor (data not shown). These data are consistent with the hypothesis that the activation o f the E R K 1 / 2 and p38 signalling pathways has functional effects on transcription o f cytokine genes with immunomodulatory functions.  52  Figure 3.7. LL-37 induces IL-8 secretion and chemokine transcription in a p38 and ERK1/2 kinase dependent manner. A ) H u m a n peripheral blood  1 1 ^ 11 J  » • Donor 1 •  Donor 2  derived  monocytes  from  2  donors  were  incubated with 10 u M p38 kinase specific inhibitor S B 203580  (10  S B ) , and/or  10  u M ERK1/2  specific  inhibitor P D 9 8 0 5 9 (10 P D ) for one hour, after w h i c h the cells were exposed for four hours to 50 u g / m l L L 37 or endotoxin free water as a vehicle control. I L - 8  LL-37 +10 PD  LL-37 LL-37+ +10 SB 10 PD&10 SB  was  assayed  in the  Approximately  lxl0  culture m e d i a b y cells  5  ELISA.  B)  o f the human bronchial  epithelial cell line, 1 6 H B E 1 4 o - , were seeded per well o f a 24 well plate and g r o w n for two days. T h e cells were then incubated with 50 u M p38 kinase specific inhibitor S B 203580 (50 S B ) , and/or 50 u M E R K 1 / 2 specific inhibitor P D 9 8 0 5 9 (50 P D ) for one hour, after w h i c h the cells were exposed for four hours to  50  u g / m l o f L L - 3 7 or endotoxin free water as a vehicle control. I L - 8 was ELISA.  Mean  assayed ±  SEM  experiments  shown.  significantly  difference  in the culture media by of  The at  three  independent  asterisk p<0.05.  peripheral b l o o d derived monocytes  indicates C)  Human  were incubated  with kinase inhibitors and L L - 3 7 as above. After four hours  RNA  was  collected  performed. T h e m R N A  and  RT-PCR  was  expression o f the chemokine  genes was corrected for G A P D H expression. M C P - 1 , MCP-3  and  IL-8  were  up-regulated  treatment and this up-regulation was .V\V MCP-3  MCP-1  by  LL-37  abrogated by  treatment with inhibitors o f either E R K 1 / 2  and p38.  Representative data for one o f two donors tested is shown.  3.4  Discussion There is a paucity o f information on h o w antimicrobial peptides exert their effects on  eukaryotic cells. Despite the fact that there have been hundreds, i f not thousands o f antimicrobial peptides characterized to date, many o f w h i c h have i m m u n o - m o d u l a t o r y properties, little or nothing is k n o w n about h o w they initiate signalling within eukaryotic cells. In this paper we demonstrate for the first time that the human cathelicidin, L L - 3 7 , induces activation o f both the p38 and E R K 1 / 2 kinases in monocytes and epithelial cells. A c t i v a t i o n o f these kinases has been demonstrated to have pleiotropic influences  on the effector  cells o f the immune response  including cytokine production, cellular activation, proliferation and differentiation (34).  Since  L L - 3 7 has been demonstrated to modulate all o f these processes, it is tempting to speculate that  53  its immunomodulatory abilities may be regulated in part by its ability to signal through these pathways. In a study b y Y a n g et al. L L - 3 7 was demonstrated to be a chemoattractant for monocytes, neutrophils and T cells (12).  T h i s activity o f L L - 3 7 was proposed to be receptor-mediated,  functioning v i a the G-protein coupled receptor F P R L - 1 and inhibited b y an peptide agonist o f F P R L - 1 (12). D u e to the insensitivity o f L L - 3 7 induced M A P K activation to both pertussis toxin (Figure 3.4) and cholera toxin (data not shown), we believe that activation o f E R K 1 / 2 and p38 by L L - 3 7 is not linked to a G-protein coupled receptor, such as F P R L - 1 . Indeed, although F P R L - 1 is expressed on both monocytes and T cells, L L - 3 7 induced activation o f E R K 1 / 2 and p38 was observed in monocytes and epithelial cells, but not on T or B cells, indicating that this receptor is not the mechanism b y w h i c h the M A P kinases are activated. N i y o n s a b a et al. demonstrated that F P R L - 1 was not the receptor on mast cells, w h i c h undergo both chemotaxis and degranulation in response to L L - 3 7 . In fact, the authors suggest that L L - 3 7 has two receptors in this cell type, one high affinity pertussis toxin sensitive receptor w h i c h is linked to L L - 3 7 induced chemotaxis and one low affinity receptor with as o f yet undefined function (21). O u r study indicates that L L - 3 7 induces activation o f p38 and E R K 1/2 kinases, directly or indirectly, through a pertussis toxin insensitive mechanism. L L - 3 7 induced signalling was not observed in the absence o f serum. T h e properties o f L L - 3 7 have been demonstrated to be altered in the presence o f serum (35).  In fact, in the  absence o f serum, moderate concentrations (30-100 p g / m l ) o f L L - 3 7 and related peptides were cytotoxic towards both prokaryotic and eukaryotic cells (27, 36, 37). H o w e v e r in the presence o f serum, cytotoxicity towards both cell types was substantially reduced (36, 38). In the current study it was demonstrated that in media containing serum, L L - 3 7 does not induce substantial cytotoxicity in h u m a n b l o o d derived monocytes. In other studies we have shown that in the absence o f serum, 50 p g / m l o f L L - 3 7 does result in increased cell lysis in as little as two hours (39). L L - 3 7 induced activation o f the M A P K is not a result o f cytotoxicity as it does not occur in the absence o f serum. W h e n L L - 3 7 is found in the b l o o d or tissues during the course o f infection it may exists coupled to one or several proteins. T h e presence o f apolipoprotein 1 has been proposed to reduce L L - 3 7 induced cytotoxicity while also inhibiting its antimicrobial functions (27). It w i l l be o f interest to determine i f the presence o f apolipoprotein can restore the ability o f L L - 3 7 to induce signalling in serum free medium. H o w e v e r , it is not unreasonable to assume that there are multiple components in serum that m a y interact with the positively charged L L - 3 7 .  54  These data illustrate the importance o f studying the immunomodulatory effects o f L L - 3 7 , and perhaps other cationic peptides, in the presence o f serum. L L - 3 7 induces chemokine secretion in airway epithelial cell lines, human whole b l o o d and mouse models (13, 40, 41). In this study we demonstrated that the activation o f E R K 1 / 2 and p38 kinases is required for L L - 3 7 induced transcription o f the chemokines I L - 8 , M C P - 1 and MCP-3  in human b l o o d derived monocytes.  W e also demonstrated that this transcription is  specific for chemokine genes, and not pro-inflammatory cytokines such as T N F - c t , IL-1 (3 and I L 6. Transcription o f I L - 8 and other chemokine genes was completely abrogated in the presence o f inhibitors o f either the p38 or E R K 1 / 2 epithelial cell line and the monocytes  kinases.  In addition, secretion o f I L - 8 in both the  was only partially inhibited b y the presence o f either  inhibitor and only completely inhibited in the presence o f both inhibitors, indicating that the kinases may effect chemokine production at both the transcriptional and post-transcriptional levels. M o n o c y t e s circulate in the blood and enter the tissues v i a the process o f extravasation upon detection o f chemokines such as I L - 8 or potentially L L - 3 7 . D u r i n g this migration from the bloodstream to the tissues the processed o f differentiation and activation begin (42). U p o n arrival at sites o f high concentrations o f L L - 3 7 we believe that activation o f the M A P K w o u l d occur and that this activation w o u l d have important physiological outcomes.  Interestingly, L L - 3 7 induced  activation o f E R K 1/2 and p38 signalling is enhanced i n the presence o f G M - C S F , but not M - C S F or  I L - 4 . A l t h o u g h initial characterization o f G M - C S F  focused  on  its  ability to  generate  granulocytes and macrophage colonies from c o m m o n precursor cells, it has more recently been proposed to have m a n y roles in the inflammatory response. These include generating increased numbers o f circulating neutrophils and peritoneal macrophages (43), promotion o f peripheral blood monocyte survival (30), and potentiation o f L P S - i n d u c e d cytokine release and subsequent lethality  in vivo  (44).  G M - C S F is not generally found in the serum o f healthy adults  (45),  however it is present in the serum after stimulation with L P S (46) and is produced by a variety o f tissues, including upper airway epithelial cells, fibroblasts, endothelial cells and  monocytes  themselves (47). T h i s pattern o f expression m i m i c s that o f L L - 3 7 during the course o f infection or  stimulation  with  inflammatory  mediators  (29,  48-50).  H a m i l t o n et  al.  propose  that  hematopoietic cells respond to infection by stimulating surrounding tissues to produce G M - C S F . T h i s localised increase in the concentration o f G M - C S F encourages survival and differentiation and  alters the activation state o f local monocytes  and polymorphonuclear neutrophils, thus  promoting clearance o f infectious organisms (51). T h e production and action o f G M - C S F occurs 55  locally  at  the  site  of  inflammation  indicating  that  this  activation  and  proliferation  of  hematopoietic cells w o u l d be a localized, rather than systemic, orchestration o f the immune response. L L - 3 7 alone activates cell signalling pathways only at h i g h concentrations, w h i c h in  vivo  w o u l d be found only at sites o f acute inflammation. T h e presence o f G M - C S F lowers the  threshold  for  LL-37  induced  activation  concentrations that w o u l d be found  of  in vivo at  the  M A P kinases  to  between  5-10  ug/ml,  the onset o f infection and w h i c h are modestly  higher than the normal concentration o f circulating h C A P - 1 8 (28, 29, 52). T h i s increase in phosphorylation  results  in  an  increase  in  IL-8  production.  We  hypothesize  that  low  concentrations o f L L - 3 7 (< 5 ug/ml) are homeostatic and do not activate the effector cells o f the innate immune response unless they exist in the presence o f pro-inflammatory signals such as the presence o f pro-inflammatory cytokines. T h e presence o f both L L - 3 7 and G M - C S F may thus lead to novel functional phenotypes o f effector cells o f the innate immune response. A l t h o u g h cationic peptides often have antimicrobial activity, the key to their therapeutic potential may lie amongst the myriad o f other activities attributed to them, such as their ability to alter the inflammatory response (53). F o r example, under conditions analogous to those found in  vivo, L L - 3 7  is a weak antimicrobial agent [Chapter 1, Figure 1.2]. C o n v e r s e l y , it is one o f the  most potent anti-endotoxic agents among cationic host defense peptides, is directly chemotactic, and induces dramatic changes in the phenotype o f monocyte derived dendritic cells, indicating a substantial role in the innate immune response (13). T h u s it is b e c o m i n g increasingly clear that peptides are more than s i m p l y "nature's antibiotics" but rather play a complex role in resolving infection, attenuating inflammation and, when this attempt at resolution is not sufficient, in alerting the adaptive immune response. Characterization o f the mechanism o f action o f these peptides is shedding light on the properties that make them potential therapeutic agents. W e propose that L L - 3 7 - i n d u c e d activation o f the E R K 1 / 2 and p38 kinases is a pivotal function o f this peptide, acting v i a an as yet undetermined G-protein coupled receptor-independent, but serum-dependent mechanism. W e demonstrate that this M A P K activation displays synergy with other modulators o f the immune response and hypothesize that the direct downstream signalling consequences are fundamental to many o f the immunomodulatory activities o f L L - 3 7 , both with regard to their physiological role and as potential therapeutics.  56  3.5 1.  Bibliography D i a m o n d , G . , J . P. Russell, and C . L . Bevins. 1996. Inducible expression o f an antibiotic peptide gene in lipopolysaccharide-challenged  tracheal epithelial cells.  Proc Natl Acad  SciUSA 93:5156. 2.  L i u , L . , A . A . Roberts, and T . G a n z . 2003. B y IL-1 signaling, monocyte-derived dramatically  enhance the  epidermal  antimicrobial response to  cells  lipopolysaccharide.  J  Immunol 170:575. 3.  Edgerton, M . , S. E . K o s h l u k o v a , M . W . A r a u j o , R . C . Patel, J. D o n g , and J . A . Bruerm. 2000. Salivary histatin 5 and human neutrophil defensin 1 k i l l C a n d i d a albicans shared pathways.  4.  via  Antimicrob Agents Chemother 44:3310.  Giacometti, A . , O . C i r i o n i , F . Barchiesi, M . Fortuna, and G . Scalise.  1999.  In-vitro  activity o f cationic peptides alone and in combination with clinically used antimicrobial agents against Pseudomonas aeruginosa. 5.  J Antimicrob Chemother 44:641.  C h a l y , Y . V . , E . M . Paleolog, T . S. K o l e s n i k o v a , T i k h o n o v , II, E . V . Petratchenko, and N . N . V o i t e n o k . 2000. Neutrophil alpha-defensin cytokine  production  endothelial cells. 6.  in  monocytes  human neutrophil peptide modulates  and  adhesion  molecule  expression  in  Eur Cytokine Netw 11:257.  Chertov, O . , D . F . M i c h i e l , L . X u , J . M . W a n g , K . T a n i , W . J . M u r p h y , D . L . L o n g o , D . D.  Taub,  and J . J . O p p e n h e i m .  CAP37/azurocidin  as  stimulated neutrophils. 7.  human  T-cell  1996.  Identification  chemoattractant  o f defensin-1,  proteins  released  defensin-2,  from  and  interleukin-8-  J Biol Chem 271:2935.  K i r i k a e , T . , M . Hirata, H . Y a m a s u , F . K i r i k a e , H . T a m u r a , F . K a y a m a , K . Nakatsuka, T . Y o k o c h i , and M . N a k a n o . 1998. antimicrobial  protein  Protective effects o f a human 18-kilodalton  (CAP18)-derived  peptide  against  murine  cationic  endotoxemia. Infect  Immun 66:1861. 8.  T a n i , K . , W . J . M u r p h y , O . Chertov, R . Salcedo, C . Y . K o h , I. U t s u n o m i y a , S. Funakoshi, O. Asai,  S. H . H e r r m a n n , J . M . W a n g , L . W . K w a k ,  and J . J . Oppenheim. 2000.  Defensins act as potent adjuvants that promote cellular and humoral immune responses in mice to a l y m p h o m a idiotype and carrier antigens. 9.  Int Immunol 12:691.  L i l l a r d , J. W . , Jr., P. N . B o y a k a , O . Chertov, J. J. O p p e n h e i m , and J . R . M c G h e e .  1999.  M e c h a n i s m s for induction o f acquired host immunity b y neutrophil peptide defensins.  Proc Natl Acad Sci USA 96:651. 10.  Lehrer, R . I., and T . G a n z . 2002. Cathelicidins: a family o f endogenous antimicrobial peptides.  11.  Curr Opin Hematol 9:18.  H a n c o c k , R . E . , and G . D i a m o n d . 2000. T h e role o f cationic antimicrobial peptides in innate host defences.  12.  Trends Microbiol 8:402.  D e , Y . , Q . C h e n , A . P. Schmidt, G . M . A n d e r s o n , J. M . W a n g , J . Wooters, J . J . O p p e n h e i m , and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like chemoattract  1 ( F P R L 1 ) as a receptor  human peripheral blood neutrophils, monocytes, and T cells. J Exp  to  Med  192:1069. 13.  Scott, M . G . , D . J . D a v i d s o n , M . R . G o l d , D . B o w d i s h , and R . E . H a n c o c k . 2002. T h e human antimicrobial peptide L L - 3 7 is a multifunctional modulator o f innate immune responses.  14.  J Immunol 169:3883.  N a g a o k a , I., S. Hirota, F . Niyonsaba, M . Hirata, Y . A d a c h i , H . T a m u r a , and D . Heumann. 2001.  C a t h e l i c i d i n family  o f antibacterial  peptides  CAP18  and C A P 1 1 inhibit  expression o f T N F - a l p h a by b l o c k i n g the binding o f L P S to C D 1 4 ( + ) cells.  the  J Immunol  167:3329. 57  15.  B a l s , R . , D . J . W e i n e r , A . D . M o s c i o n i , R . L . M e e g a l l a , and J . M . W i l s o n . Augmentation o f innate  1999.  o f a cathelicidin antimicrobial  Infect Immun 67:6084.  peptide. 16.  host defense by expression  D a v i d s o n , D . J . , A . J. Currie, G . S. R e i d , D . M . B o w d i s h , K . L . M a c D o n a l d , R . C . M a , R . E . H a n c o c k , and D . P. Speert. 2004. T h e cationic antimicrobial peptide L L - 3 7 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization.  J Immunol  172:1146. 17.  K o c z u l l a , R . , G . v o n Degenfeld, C . Kupatt, F . K r o t z , S. Zahler, T . G l o e , K . Issbrucker, P. Unterberger, M . Z a i o u , C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . W e l s c h , P. S. Hiemstra, C . Vogelmeier, R . L . G a l l o , M . Clauss, and R . Bals. 2003. A n angiogenic  role  for  the  human  peptide  antibiotic  LL-37/hCAP-18.  J Clin Invest  111:1665. 18.  H e i l b o r n , J. D . , M . F . N i l s s o n , G . Kratz, G . Weber, O . Sorensen, N . Borregaard, and M . Stahle-Backdahl. 2003. T h e cathelicidin anti-microbial peptide L L - 3 7 is involved in reepithelialization o f human skin wounds and is lacking in chronic ulcer epithelium. J  Invest Dermatol 120:379. 19.  N i y o n s a b a , F . , A . S o m e y a , M . Hirata, H . O g a w a , and I. N a g a o k a . 2001. Evaluation o f the effects o f peptide antibiotics human beta-defensins-l/-2 and L L - 3 7 on histamine release  Eur J Immunol 31:1066.  and prostaglandin D(2) production from mast cells. 20.  Z a i o u , M . , V . Nizet, and R . L . G a l l o . 2003. A n t i m i c r o b i a l and protease inhibitory functions o f the h u m a n cathelicidin ( h C A P 1 8 / L L - 3 7 ) prosequence.  J Invest Dermatol  120:810. 21.  N i y o n s a b a , F . , K . Iwabuchi, A . Someya, M . Hirata, H . M a t s u d a , H . O g a w a , and I. N a g a o k a . 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis.  22.  Immunology 106:20.  Tjabringa, G . S., J. A a r b i o u , D . K . Ninaber, J . W . Drijfhout, O . E . Sorensen, Borregaard, K . F . Rabe, and P. S. Hiemstra. 2003. T h e antimicrobial peptide activates innate  immunity at the airway epithelial  epidermal growth factor receptor. 23.  surface  N.  LL-37  b y transactivation o f the  J Immunol 171:6690.  Elssner, A . , M . D u n c a n , M . G a v r i l i n , and M . D . Wewers. 2004. A novel P 2 X 7 receptor activator, the h u m a n cathelicidin-derived peptide L L 3 7 , induces IL-1 beta processing and release.  24.  J Immunol 172:4987.  Sallusto, F . , and A . Lanzavecchia. 1994. cultured  human  dendritic  cells  is  Efficient presentation o f soluble antigen by  maintained  by  granulocyte/macrophage  colony-  stimulating factor plus interleukin 4 and downregulated b y tumor necrosis factor alpha. J  Exp Med 179:1109. 25.  Indiveri, F . , J . Huddlestone, M . A . Pellegrino, and S. Ferrone. 1980. Isolation o f human T lymphocytes: comparison between n y l o n w o o l filtration and resetting with neuraminidase ( V C N ) and 2-aminoethylisothiouronium bromide ( A E T ) - t r e a t e d sheep red blood cells (SRBC).  26.  J Immunol Methods 34:107.  C o z e n s , A . L . , M . J. Y e z z i , K . K u n z e l m a n n , T . O h r u i , L . C h i n , K . E n g , W . E . Finkbeiner, J. H . W i d d i c o m b e , and D . C . Gruenert. 1994. C F T R expression and chloride secretion in polarized immortal human bronchial epithelial cells.  21.  Wang,  Y.,  B.  Agerberth,  A.  Lothgren,  A.  Am J Respir Cell Mol Biol 10:38.  Almstedt,  and  J.  Johansson.  1998.  A p o l i p o p r o t e i n A - I binds and inhibits the human antibacterial/cytotoxic peptide L L - 3 7 . J  Biol Chem 273:33115. 28.  Sorensen, O . , J . B . C o w l a n d , J . A s k a a , and N . Borregaard. 1997. A n E L I S A for h C A P 18, the  cathelicidin present  in human neutrophils  and plasma.  J Immunol Methods  206:53. 58  29.  Schaller-Bals, S., A . Schulze, and R . B a l s . 2002. Increased peptides in tracheal aspirates o f newborn infants during infection.  levels o f antimicrobial  Am J Respir Crit Care  Med 165:992. 30.  X i n g , Z . , T . Ohtoshi, P. R a l p h , J. Gauldie, and M . Jordana. 1992. H u m a n upper airway structural cell-derived cytokines support human peripheral b l o o d monocyte survival: a potential mechanism for monocyte/macrophage accumulation in the tissue.  Am J Respir  Cell Mol Biol 6:212. 31.  O ' B r i e n , D . , T . O ' C o n n o r , F . Shanahan, and J. O ' C o n n e l l . 2002. A c t i v a t i o n o f t h e p38 M A P K and E R K 1 / 2 pathways is required for Fas-induced I L - 8 production in colonic epithelial cells.  32.  Ann N Y Acad Sci 973:161.  K u m a r , A . , A . J. K n o x , and A . M . Boriek. 2003. C C A A T / E n h a n c e r - b i n d i n g Protein and Activator Protein-1  Transcription Factors Regulate  the  through the Mitogen-activated Protein K i n a s e Pathways Stretch o f H u m a n A i r w a y Smooth M u s c l e C e l l s . 33.  Expression o f in Response  Interleukin-8  to M e c h a n i c a l  J Biol Chem 278:18868.  Parhar, K . , A . R a y , U . Steinbrecher, C . N e l s o n , and B . Salh. 2003. T h e p38 mitogenactivated protein kinase regulates interleukin-1 beta-induced I L - 8 expression v i a an effect on the I L - 8 promoter in intestinal epithelial cells.  34.  Immunology 108:502.  D o n g , C , R . J . D a v i s , and R . A . F l a v e l l . 2002. M A P kinases in the immune response.  Annu Rev Immunol 20:55. 35.  Johansson, J . , G . H . G u d m u n d s s o n , M . E . Rottenberg, K . D . Berndt, and B . Agerberth. 1998.  Conformation-dependent antibacterial activity o f the naturally occurring human  peptide L L - 3 7 . 36.  J Biol Chem 273:3718.  O r e n , Z . , J . C . L e r m a n , G . H . G u d m u n d s s o n , B . Agerberth, and Y . Shai. 1999. Structure and organization o f the human antimicrobial peptide L L - 3 7 in phospholipid membranes: relevance to the molecular basis for its non-cell-selective activity.  Biochem J 341 ( Pt  3): 501. 37.  C i o r n e i , C . D . , A . Egesten, and M . Bodelsson.  2003. Effects  o f human cathelicidin  antimicrobial peptide L L - 3 7 on lipopolysaccharide-induced nitric oxide release from rat aorta in vitro.  Acta Anaesthesiol Scand 47:213.  38.  W a n g , Y . , B . Agerberth, and J. Johansson. 1998. Structure and activity o f cathelicidin  39.  B o w d i s h , D . M . E . , D . J. D a v i d s o n , and R . E . W . H a n c o c k . 2005. A re-evaluation o f the  antibacterial proteins.  J Protein Chem 17:522.  role o f host defence peptides in mammalian immunity. 40.  Curr Protein Pept Sci 6:35.  V a n Wetering, S., S. P. Mannesse-Lazeroms, J. H . D i j k m a n , and P. S. Hiemstra. 1997. Effect o f neutrophil serine proteinases and defensins on lung epithelial cells: modulation o f cytotoxicity and I L - 8 production.  41.  JLeukoc Biol 62:217.  V a n Wetering, S., S. P. Mannesse-Lazeroms, M . A . V a n Sterkenburg, M . R . D a h a , J . H . D i j k m a n , and P. S. Hiemstra. 1997. Effect o f defensins on interleukin-8 synthesis in airway epithelial cells.  42.  Am J Physiol 272:L888.  M u l l e r , W . A . , and G . J. R a n d o l p h . 1999. M i g r a t i o n o f leukocytes across endothelium and beyond: molecules involved in the transmigration and fate o f monocytes.  J Leukoc  Biol 66:698. 43.  Metcalf, D . , C . G . B e g l e y , D . J . W i l l i a m s o n , E . C . N i c e , J . D e Lamarter, J. J. M e r m o d , D . Thatcher, and A . Schmidt. 1987. Hemopoietic responses i n mice injected with purified recombinant murine G M - C S F .  44.  Tiegs,  Exp Hematol 15:1.  G , J. B a r s i g , B . M a t i b a ,  S.  Uhlig,  and A . W e n d e l .  1994.  Potentiation  by  granulocyte macrophage colony-stimulating factor o f lipopolysaccharide toxicity in mice.  J Clin Invest 93:2616.  59  45.  C e b o n , J . , J. E . L a y t o n , D . M a h e r , and G . M o r s t y n . 1994.  46.  Endogenous  haemopoietic  Br J Haematol 86:265.  growth factors in neutropenia and infection.  Sheridan, J . W . , and D . Metcalf. 1972. Studies on the bone marrow colony  stimulating  J Cell Physiol 80:129. inflammation and autoimmunity. Trends Immunol  factor ( C S F ) : relation o f tissue C S F to serum C S F . 47.  H a m i l t o n , J. A . 2002. G M - C S F in  23:403. 48.  Agerberth, B . , J . C h a r o , J . Werr, B . Olsson, F . Idali, L . L i n d b o m , R . Kiessling, H . Jornvall, H . W i g z e l l , and G . H . G u d m u n d s s o n . 2000. T h e human antimicrobial and chemotactic peptides L L - 3 7 and alpha-defensins are expressed by specific and monocyte populations.  49.  lymphocyte  Blood 96:3086.  Agerberth, B . , J . G r u n e w a l d , E . Castanos-Velez, B . O l s s o n , H . Jornvall, H . W i g z e l l , A . E k l u n d , and G . H . G u d m u n d s s o n . 1999. Antibacterial components in bronchoalveolar lavage fluid from healthy individuals and sarcoidosis patients.  Am J Respir Crit Care  Med 160:283. 50.  F r o h m , M . , B . Agerberth, G . A h a n g a r i , M . Stahle-Backdahl, S. L i d e n , H . W i g z e l l , and G . H . G u d m u n d s s o n . 1997. T h e expression o f the gene coding for the antibacterial peptide L L - 3 7 is induced in human keratinocytes during inflammatory disorders.  J Biol Chem  272:15258. 51.  H a m i l t o n , J. A . 1993. C o l o n y stimulating factors, cytokines and -some controversies.  52.  monocyte-macrophages-  Immunol Today 14:18.  M u r a k a m i , M . , T . Ohtake, R . A . Dorschner, B . Schittek, C . G a r b e , and R . L . G a l l o . 2002. Cathelicidin anti-microbial peptide expression in sweat, an innate defense system for the skin.  53.  J Invest Dermatol 119:1090.  Scott, M . G . , and R . E . H a n c o c k . 2000. Cationic antimicrobial peptides and their multifunctional role in the immune system.  Crit Rev Immunol 20:407.  60  4.0 LL-37 is a Potent Anti-endotoxic Agent With Multiple Mechanisms of Action 4.0  LL-37 IS A POTENT ANTI-ENDOTOXIC AGENT WITH MULTIPLE MECHANISMS OF ACTION  61  4.1  INTRODUCTION  62  4.2  MATERIALS & METHODS  63  4.3 4.4  RESULTS DISCUSSION  66 71  4.5  BIBLIOGRAPHY  74  61  4.1  Introduction Host defence peptides are small, positively charged peptides w h i c h are an evolutionarily  conserved component o f the innate immune response.  Individual peptides are found in high  concentrations in the granules o f neutrophils and some can be produced b y epithelial and other cell types u p o n stimulation with bacterial components  or inflammatory mediators  (1,  2).  Originally these peptides were believed to function simply as natural antibiotic compounds in the antibacterial defences o f neutrophils; however, it has become apparent that their antimicrobial activity extends to viruses and eukaryotic microbes, and they appear to enhance host defences b y interacting with neutrophils (3), monocytes (4), macrophages (5), dendritic cells (6), T cells (3), and  epithelial  cells  (7,  8).  T h u s they  are  being  developed  as  novel  antimicrobial and  immunostimulatory agents. A l t h o u g h the mechanisms by w h i c h they k i l l bacteria are not fully elucidated, m a n y m a m m a l i a n antimicrobial peptides k i l l bacterial cells in a non-lytic manner (9). T h i s is an especially valuable asset considering that the use o f antibiotics w h i c h lyse bacteria, and consequently  release immunostimulatory bacterial components  has been  linked to  the  development or enhancement o f septic shock (10, 11). E a r l y experiments also determined that a number o f host defence peptides from various sources bound to diverse strains o f L P S and reduced L P S - i n d u c e d release o f pro-inflammatory cytokines (e.g. T N F - a , I L - 1 , IL-6) and nitric oxide  from monocytes  or macrophages  (12-15),  although these two  observations  are  not  obligately linked (16). Nevertheless it has been clearly demonstrated that various host defence peptides protect mice f r o m L P S - i n d u c e d lethality (17-21). A s the excessive production o f proinflammatory cytokines precedes the development o f full-blown septic shock, the ability o f these peptides to reduce pro-inflammatory cytokine production induced b y a variety o f pathogen molecules, including L T A , C p G and L P S , indicates that they might function as broad-spectrum anti-sepsis agents (22, 23). T h e cathelicidins are host defence peptides found at h i g h concentrations in the granules o f neutrophils. T h e ability o f cathelicidins to bind to L P S and b l o c k L P S induced proinflammatory cytokine production seems to be conserved in all identified homologs to date, including those found in sheep (24),  cows (25,  26),  and humans (13).  These peptides  are  characterised b y their evolutionarily-conserved N-terminal cathelin domain/pro-piece w h i c h is cleaved  from  the  antimicrobial/immunomodulatory C-terminus  upon  degranulation  from  neutrophils. T h e human cathelicidin, named h C A P - 1 8 in its unprocessed form, can be processed to several peptides including the 37 amino acid peptide called L L - 3 7 (27). Initial studies on the anti-endotoxin properties o f this peptide focussed on h C A P - 1 8 (17), however, it was later found 62  that the L P S b i n d i n g properties o f the peptide were contained within the processed peptide, L L 37 (28). It has been proposed that the anti-endotoxic properties o f this peptides are due in part to an inhibition o f the binding o f L P S the cell surface molecule/receptor component C D 14 (29) and lipopolysaccharide binding protein ( L B P ) (16), although the b i n d i n g affinity o f L L - 3 7 for L P S is less that o f either o f these components.  L L - 3 7 has been shown to b l o c k a number o f L P S -  induced inflammatory responses including contractility and N O release in aortic rings infiltration  of  leukocytes  and chemokine  production (19),  and pro-inflammatory  production in a macrophage cell line or in whole human b l o o d (18).  (30),  cytokine  It is possible that at  physiological concentrations L L - 3 7 may provide homeostatic buffering o f the effects o f low concentrations o f L P S or other pathogen components. It is not entirely clear whether L L - 3 7 and other host defence peptides are able to mediate these effects exclusively through direct binding and neutralisation o f L P S and other negatively charged bacterial components or whether this is due to a more subtle interaction with host cells. E v i d e n c e for both possibilities exists. In this study I investigated  the ability o f L L - 3 7 to block L P S induced pro-inflammatory cytokine  production from h u m a n peripheral b l o o d derived monocytes and a  monocyte/macrophage-like  cell line and demonstrate that although L L - 3 7 appears to b l o c k L P S induced cytokine production  in vitro b y  binding and neutralising L P S directly, evidence exists for a possible  secondary  mechanism o f action.  4.2  Materials & Methods  Isolation of Peripheral Blood Derived Monocytes. B l o o d monocytes were prepared using standard techniques (31). B r i e f l y , 100 m l o f fresh human venous b l o o d was  collected  in sodium heparin Vacutainer collection tubes  D i c k i n s o n , Mississauga, O N , Canada) from volunteers  (Becton  according to U B C C l i n i c a l Research  Ethics B o a r d protocol C 0 2 - 0 0 9 1 . T h e b l o o d was mixed, at a 1:1 ratio, with R P M I 1640 media [supplemented with 10% v/v foetal c a l f serum ( F C S ) , 1% L - g l u t a m i n e , 1 n M sodium pyruvate] in an E-toxa-clean  ( S i g m a - A l d r i c h , O a k v i l l e , O N , Canada) washed,  endotoxin-free  bottle.  Peripheral b l o o d mononuclear cells ( P B M C ) were separated using F i c o l l - P a q u e Plus ( A m e r s h a m Pharmacia B i o t e c h , B a i e D ' U r f e , P Q , Canada) at r o o m temperature and washed with phosphate buffered saline ( P B S ) . M o n o c y t e s were enriched b y the removal o f T-cells by fresh  sheep  red  blood  cells  ( U B C animal  neuraminidase ( C a l b i o c h e m Biosciences  care  unit)  pre-treated  with  resetting  with  Vibrio cholerae  Inc., L a Jolla, C A , U S A ) and repeated separation b y  using F i c o l l Paque Plus (32). T h e enriched monocytes were washed with P B S , then cultured in tissue culture plates for  1 hour at 3 7 ° C  followed  by the  removal  o f non-adherent  cells. 63  M o n o c y t e s isolated in this way were >95% shown).  Cells  were  cultured  pure as determined b y flow cytometry (data not  in F a l c o n tissue  culture  48-well  plates  (Becton  Dickinson,  Mississauga, O N , Canada). T h e adherent monocytes were cultured in 0.25 m l media at 3 7 ° C in w h i c h L P S , L L - 3 7 and/or cytokines dissolved in endotoxin-free water ( S i g m a - A l d r i c h , O a k v i l l e , O N , Canada) were added. Endotoxin-free water was added as a vehicle control.  Cell Culture T h e human monocyte-like cell line, T H P - 1 (33), was obtained from the A T C C (No. T I B 202, R o c k v i l l e , M D ) , and g r o w n in supplemented R P M I 1640 m e d i a containing 10% foetal c a l f serum , 1% sodium pyruvate and 1%> L-glutamine ( G i b c o B R L , B u r l i n g t o n , O N ) . T H P - 1 cells were differentiated  into adherent macrophage-like cells by the addition o f 100 m M phorbyl  myristate acetate ( P M A ) and incubation at 3 7 ° C , 5% CO2 for three days as described previously (34) .  Peptide Synthesis. L L - 3 7 was synthesized  b y N-(9-fluorenyl) methoxycarbonyl ( F m o c ) chemistry at the  N u c l e i c A c i d / P r o t e i n Service unit at the University o f British C o l u m b i a , as previously described (35) . Peptides were purified b y reverse-phase high-performance liquid chromatography and were at least 98%> pure. L L - 3 7 was dissolved in endotoxin-free water (Sigma, St. L o u i s , M O ) and the concentration o f the peptides in solution was determined b y amino acid analysis.  Cytokine Production T h e concentrations o f either T N F - a or I L - 6 found in the supernatants o f the treated cells were measured using c o m m e r c i a l l y prepared E L I S A plates in accordance to the manufacturer's suggestion ( R & D systems, M i n n e a p o l i s , M N ) . F o r T H P - 1 cells, cells were treated with P M A and 2 x 10 cells were seeded in 1 m l o f media containing 10%> F C S in 24 w e l l tissue culture plates 5  and allowed to differentiate  for three days. F o r primary peripheral b l o o d derived monocytes  between 0.5-1 x 10 cells were seeded in 250 ul in 48 well tissue culture plates. C e l l s were then 5  incubated in at least triplicate, for four hours in the presence o f either media alone, or with  Pseudomonas aeruginosa  H I 0 3 L P S , cationic peptides or a combination o f L P S and peptide  (concentrations stated in text) in media. Supernatants were collected and stored at - 2 0 ° C until use.  Immunoblotting THP-1  cells were cultured as above. O n the day o f the assay the cells were gently  detached using C e l l Dissociation  Solution (Sigma, St. L o u i s , M O ) . C e l l s were washed,  re64  suspended in media and added to 5 m l polystyrene tubes (Becton D i c k i n s o n ) and allowed to rest for 2 hours. A p p r o x i m a t e l y 1 x 10  6  T H P - 1 cells were used per condition. C e l l s were then  stimulated by adding L P S , L L - 3 7 or water as a vehicle control. After stimulation the cells were centrifuged, washed one time with ice-cold P B S with I m M vanadate and nuclear extracts were isolated using N E - P E R  N u c l e a r and C y t o p l a s m i c Extraction Reagents  Canada, O N ) as per the  manufacturer's directions.  K i t (Pierce, Fisher  T h e lysates were assayed  for protein  concentration using a B C A assay (Pierce, Fisher Canada, O N ) . Lysate (7.5 pg) was loaded per lane onto 1.0 m m thick gels, w h i c h were run at 100 V for approximately 2-3 hr. Proteins were transferred to P V D F filters for 80 m i n at 80 V . T h e filters were b l o c k e d for 1 hour at r o o m temperature with 5% s k i m m i l k in T B S T (10 m M T r i s - H C l p H 8, 150 m M N a C I , 0.1% T w e e n 20). T h e filters were then incubated overnight at 4 ° C with the anti-p50 or anti-p65 (Santa C r u z , C A ) monoclonal antibodies. Immunoreactive bands were detected using horseradish peroxidaseconjugated  sheep anti-mouse  or donkey anti-rabbit I g G antibodies  ( A m e r s h a m Pharmacia,  Piscataway, N J ) and chemiluminescence detection (Sigma, St. L o u i s , M O ) .  Gel Shift Assays G e l shift assays using a biotinylated N F - K B consensus sequence were performed with the above mentioned nuclear extracts using a LightShift Chemiluminescent E M S A K i t (Pierce, Fisher Canada, O N ) as per the manufacturer's directions. Briefly, a N F - K B probe consensus sequence ( 5 ' - A G T T G A G G G G T C T T C C C A G G C - 3 ' , Panomics, R e d w o o d C i t y , C a ) labelled with biotin was m i x e d with approximately 7.5 p g o f nuclear lysate and binding buffer supplemented with glyercol (8%), M g C l  2  (5 m M ) , K C I (100 m M ) , E D T A (1 m M ) , D T T (1 m M ) and poly  I C : d C (1.5 pg). T o determine the specificity o f the reaction an unlabelled biotin probe was used to block the shift. Extracts were incubated for 20 m i n and then run on a 7% acrylamide gel for 1 -2 hours. T h e gels were transferred to nitrocellulose membranes at a 380 m A for 30 minutes and U . V . cross-linked before detection as per the manufacturer's directions.  Statistical Analysis Student's t test was performed to determine statistical significance. V a l u e s are expressed as mean ± standard error o f the mean.  65  4.3  Results  LL-37 blocks LPS induced pro-inflammatory cytokine production from primary human monocytes and a monocyte-like cell line L L - 3 7 has been demonstrated to b l o c k L P S induced T N F - a production by a mouse macrophage cell line (18)  and from a monocyte cell line (26)  but it's ability to b l o c k the  production o f other pro-inflammatory cytokines b y primary h u m a n cells has not been evaluated. In this experiment peripheral b l o o d derived monocytes were treated with 10 n g / m l L P S with or without L L - 3 7 (10 or 50 pg/ml) for four hours and supernatants were assayed for either T N F - a (n=5), or I L - 6 (n=2)(one representative donor shown, Figure 4.1 A & B ) .  Figure 4.1. LL-37 reduces LPS induced cytokine production in peripheral blood derived monocytes and a monocyte-like cell line. A ) Peripheral b l o o d derived monocytes  from 5  donors were treated with 10 0  10  50  LL-37 (ug/ml)  n g / m l o f L P S for 4 hr. L L 37  (10  or  50  ug/ml)  reduced L P S induced T N F a  production  to  baseline  levels. T h e average o f three separate  wells  representative standard shown.  of  one  donor  +/-  deviation B) LL-37  is  reduces  L P S induced production o f I L - 6 . T h e average o f three separate 10  50  LL-37 (pg/ml)  wells  representative standard shown.  of  one  donor  +/-  deviation C)  is  THP-1  cells  were treated with L P S or LPS  &  LL-37  for 4 hrs.  T h e presence o f 10 u g / m l L L - 3 7 reduced the amount of  TNF-a  produced  approximately average  90%. of  by The  three  independent experiments ± 0  LL-37  10 (pg/ml)  standard  deviation  is  shown.  66  LL-37  reduced L P S induced pro-inflammatory cytokine production, with almost  inhibition occurring at 10 p g / m l o f L L - 3 7 . L L - 3 7  complete  d i d not itself induce T N F - a production  although a small increase in I L - 6 was observed in one donor (data not shown). L L - 3 7  effectively  blocks pro-inflammatory cytokine production from L P S stimulated monocytes. T H P - 1 cells were seeded at a higher concentration than the primary cells (2 x 10  5  cells  per well versus approximately 5 x 10 for the primary cells) and thus the concentrations o f T N F 4  a detected in response to L P S were greater than the primary cells (between 4000-7000 ng/ml versus between 1000-6000 n g / m l depending on the donor). L L - 3 7 also induces a dose dependent decrease in T N F - a in T H P - 1 cells (Chapter 2, Figure 2.2) with an approximate 90% reduction occurring at 10 p g / m l (Figure 4.1C). Consistent with the published data these T H P - 1 cells did not produce I L - 6 (36). T h u s L L - 3 7 is as effective at b l o c k i n g L P S induce pro-inflammatory cytokine production from primary cells as it is from cell lines.  LL-3 7 can be added after LPS and reduce TNF-a production W e have previously shown that L L - 3 7 can be added up to an hour after L P S and reduce pro-inflammatory cytokine production and it has been proposed that this reduction is due to a direct interaction between L L - 3 7 and host cells (18). T o date it has not been tested whether the resulting decrease i n T N F - a after delayed addition o f L L - 3 7 is because L P S must be continually present to m a x i m a l l y induce pro-inflammatory signalling as has been demonstrated for other peptides in other m o d e l systems (37). T o test this, T H P - 1 cells were stimulated with 10 n g / m l L P S for four hours and T N F - a production was assessed. L L - 3 7 (10 pg/ml) was added either simultaneously or 30, 60 or 90 minutes after the L P S . Alternatively, the cells were washed three times with 1 m l o f media at these same timepoints. Fresh media without L P S was added and the cells were incubated for a total o f 4 hr at w h i c h point the supernatants were collected and T N F - a production was assessed. T h e total amount o f T N F - a produced in the L P S stimulated cells was calculated to be 100%) and the amount o f T N F - a in the supernatants o f the cells treated with L L 37 or washed was expressed as a percentage o f the total amount o f T N F - a . T h e addition o f L L 37 or the removal o f L P S at 30 or 60 minutes resulted in an equivalent reduction in cytokine production (Figure 4.2).  67  t = 0 T LPS added  • LL-37  • Wash o  •g 80  t = 4hr  supernatants collected and TNF-a production measured  30  60  90  Time (minutes)  Figure 4.2. L L - 3 7 can be added after L P S and reduce proinflammatory cytokine production. THP-1 cells were  treated with 10 ng/ml LPS for four hours. At 30, 60 or 90 min either LL-3 7(10 pg/ml) was added or the supernatant was removed and fresh media without LPS was added. At 4 hr the supernatants were removed and TNF-a production was assessed. There was no statistically significant difference between LL-37 treatment and removal of the LPS. Average of three independent experiments +/- standard deviation from the mean shown.  Pre-treatment with LL-37 results in a reduction of LPS induced TNF-a production In order to test whether LL-37 is required to be present to result in a decrease in proinflammatory cytokine production or if there might be an additional interaction between the peptide and the cells which results in a subsequent decrease in cytokine production, THP-1 cells were pre-treated with either endotoxin-free water as a vehicle control or LL-37 (50 pg/ml) for 30 minutes. The cells were washed three times with 1 ml of media and then fresh media (including 10% FCS) containing LPS (10 ng/ml) was added. TNF-a production was assessed after four hours. Although the cells pre-treated with LL-37 produced less TNF-a the reduction did not reach statistical significance (Figure 4.3).  68  t = -30 min T  t = 0 min  " control added  L L  3 7  O R  V E N I C L E  1600-  Cells washed and L P S added  E 1200  Q. U_  z Supernatants t = 4 hr J , collected and T T N F - a production measured  0  30  Minutes of LL-37 pre-treatment  Figure 4.3. Pre-treatment with LL-37 reduces pro-inflammatory cytokine production. T H P - 1 cells were treated with L L - 3 7 (50 ng/ml) for 30 m i n prior to the addition o f L P S (10 ng/ml) and then washed three times. A v e r a g e o f three independent experiments +/- standard deviation from the mean shown.  The anti-inflammatory properties of LL-37 are specific for LPS In  order to test whether the ability o f L L - 3 7 to reduce pro-inflammatory cytokine  production was specific for L P S induced responses or was applicable to other pro-inflammatory stimuli, monocytes were stimulated with either I L - l p (100 ng/ml) or T N F - a (10 ng/ml) in the presence or absence o f L L - 3 7 (10 & 50 ug/ml) for 4 hr. Stimulation with I L - i p resulted in an increase in T N F - a found in the supernatants (between 150 - >2000 p g / m l , donor dependent). T h e presence o f L L - 3 7 enhanced I L - 1 B induced T N F - a production in a dose dependent manner and this increase in T N F - a was statistically significant in four o f five donors (p values range  from  p<0.06 to p<0.0006, donor dependent, Figure 4 . 4 A ) . A l t h o u g h I L - i p also induced the production o f I L - 6 , L L - 3 7 d i d not significantly alter the amount o f I L - 6 produced in response to I L - i p (n=2, data not shown). Stimulation with T N F - a  (10  ng/ml) also resulted in autocrine production o f  TNF-a  (approximately 60 n g / m l , n=2) and I L - 6 production in one o f two donors (data not shown). T h e presence o f L L - 3 7 at h i g h concentrations (50 pg/ml) resulted i n a slight decrease in T N F - a production in both donors tested but this was not statistically significant (Figure 4.4B). In summary, the presence o f L L - 3 7 enhances IL-1 P induced pro-inflammatory cytokine production and does not appear to alter T N F - a induced pro-inflammatory cytokine production.  69  Figure 4.4. LL-37 does not reduce pro-inflammatory cytokine production induced by IL-ip or TNF-a. A ) Primary monocytes were treated with lOOng/ml o f IL-1 p for four hr. Supernatants were collected and assayed for T N F - a production. A l l five donors showed an increase in T N F - a production in response to IL-1 p. In all donors tested there was an increase in I L - i p induced cytokine production in the presence  of  LL-37.  This  increase  was  statistically  significant in four out o f five donors. O n e representative donor o f five shown. A v e r a g e o f three wells +/- standard deviation is shown. B )  LL-37  does not reduce  TNF-a  induced T N F - a production. T N F - a (10 ng/ml) stimulation o f primary monocytes stimulated production o f T N F - a and there  was  no  statistically  significant  decrease  in  the  presence o f L L - 3 7 . O n e representative donor o f two shown. Average o f three wells +/- standard deviation is shown.  LL-3 7 inhibits p65 translocation in response to LPS It  is  not  entirely  clear  if LL-37  blocks  L P S induced pro-inflammatory  cytokine  production by b i n d i n g to L P S and thus preventing N F - K B activation and pro-inflammatory responses or i f there m a y be another more subtle interaction with host cells. In order to determine i f L L - 3 7 was able to alter L P S induced activation and translocation o f N F - K B , gel shift assays were performed. T H P - 1 cells were treated with L P S (10 ng/ml), L L - 3 7 (10 ug/ml) or both L P S and L L - 3 7 for 20 minutes. N F - K B is found primarily in the cytoplasm in unstimulated cells. U p o n exposure to pro-inflammatory stimuli activation and translocation to the nucleus occurs. Nuclear extracts were collected and gel shift assays were performed. A shift in the gel occurs when N F - K B is present to b i n d to the biotinylated probe. T h e specificity o f the reaction was determined by b l o c k i n g the reaction with excess unbiotinylated probe ("cold" probe). L P S induces translocation o f N F - K B as previously described. L L - 3 7 d i d not prevent L P S induced translocation o f N F - K B and in fact L L - 3 7 stimulation resulted in nuclear translocation o f N F - K B (Figure 4 . 5 A ) . A s the N F - K B transcription factor family consists o f five different proteins w h i c h form homo- and heterodimers that have different specificities for D N A binding. T h e best characterised heterodimer consists o f the p65:p50 subunits. B i n d i n g o f this heterodimer is required for L P S induced transcription o f pro-inflammatory cytokine genes such as T N F - a . In order to determine i f L L - 3 7 had any effect on L P S induced p65:p50 translocation, Western blots o f the nuclear extracts were performed. L P S induced translocation o f both p65 and p50 (Figure 4.5B). L L - 3 7 70  did not induce translocation o f p65 but did induce translocation o f p50. L L - 3 7 could block L P S induced p65 translocation when it was added either simultaneously or after 10 m i n o f L P S stimulation (Figure 4 . 5 B ) . F i g u r e 4.5. L L - 3 7 b l o c k s L P S i n d u c e d t r a n s l o c a t i o n o f p65 but induces t r a n s l o c a t i o n o f p 5 0 . T H P - 1 cells were stimulated with either L P S (10 ng/ml), L L - 3 7 (10 ug/ml) or a combination o f L P S or L L - 3 7 for 20 m i n . Nuclear extracts were isolated and gel shift assays and Western blots  were  performed.  A)  LPS  and  LL-37  induced  translocation o f N F - K B . L L - 3 7 d i d not block L P S induced NF-KB  translocation.  One  representative  gel  of  two  independent experiments is shown. B ) L L - 3 7 blocked L P S induced translocation o f p65 but not o f p50. L P S induced translocation o f p65 c o u l d be b l o c k e d when L L - 3 7  was  added either simultaneously or w h e n added after 10 m i n o f L P S stimulation. L L - 3 7 induced translocation o f p50 and did not reduce L P S induced translocation o f p50. O n e representative experiment o f three shown.  4.4  Discussion Host defence peptides and synthetic derivatives b i n d to the anionic sugars,  phosphate  groups and lipid A core o f L P S and L P S binding has been demonstrated to be an important requirement for bacterial k i l l i n g (38). Indeed, it has been proposed that a conserved L P S binding m o t i f exists w h i c h consists o f both basic and hydrophobic amino acids and accounts for the ability o f natural and synthetic peptides to bind and neutralise L P S (39, 40). B i n d i n g o f host defence peptides to L P S has been proposed to mask its biological effects (41) since high affinity binding induces changes in the endotoxic L P S aggregate structure and a neutralisation o f the negative charges o f L P S . L L - 3 7 binds directly to L P S and this b i n d i n g is o f sufficiently high affinity to displace L B P . There is some  in vitro  evidence that the inhibition o f pro-inflammatory  cytokine production induced by bacterial components correlates to some extent with binding and neutralisation o f these components by host defence peptides (16). Nevertheless doubt exists as to whether this is the only mechanism o f action as most peptides have L P S b i n d i n g affinities that are orders o f magnitude lower than well established L P S neutralising molecules such as bacterial permeability increasing protein (BPI) and yet are as effective, or in some cases more effective, at preventing mortality in animal models o f septic shock. Similarly, although L P S binding affinity correlates with an ability to block T N F - a production from a macrophage cell line, there are certain peptides, such as a derivative o f bovine bactenecin, that has a relatively high binding 71  affinity for L P S but is virtually unable to b l o c k L P S induced cytokine production (16, 26). There is emerging evidence suggesting that these peptides might have other, subtler mechanisms o f altering the pro-inflammatory response w h i c h m a y be applicable to  in vivo  experiments or  human clinical trials. L L - 3 7 , for example, has been demonstrated to increase the expression o f anti-inflammatory  genes  such  as  IL-10  in  a  macrophage  cell  line  (18).  Although  low  concentrations o f B P I reduce pro-inflammatory cytokine production induced by L P S , m u c h higher concentrations o f B P I are required to neutralize the anti-inflammatory cytokine I L - 1 R A (42). T h i s selective modulation o f L P S induced responses also occurs with C E M A , an insect derived peptide with anti-inflammatory properties  in vitro and in vivo, w h i c h  blocks some but  not all, o f the transcriptional responses induced by L P S in a macrophage-like cell line and induces expression o f genes believed to be involved in host  responses to infection (43). Thus  there is a subtle g r o w i n g body o f evidence suggesting that host defence peptides may be able to modulate host responses to L P S at the transcriptional and post-transcriptional level. L L - 3 7 and other host defence peptides show potential as anti-sepsis agents. T h e ability o f LL-37  and other host defence  peptides  to b l o c k L P S induced pro-inflammatory cytokine  production is believed to provide an advantage over treatment with conventional antibiotics. In many animal models in w h i c h sepsis, or septic shock, is induced b y injection o f high numbers o f bacteria, host defence peptides do not reduce bacterial counts. T h u s , at first blush it might appear that they are no more effective than currently established therapies. H o w e v e r , in all cases in w h i c h they were measured, the serum levels o f cytokines and L P S were reduced and in many studies mortality is decreased (17). In human disease it is clear that treatment with antibiotics is not sufficient to prevent mortality, as decreases in viable bacteria do not correlate with survival. It is thus believed that the fatal aspect o f septic shock is mediated due to overwhelming production o f pro-inflammatory cytokines. In studies where the efficacy o f host defence peptides is compared with that o f conventional antibiotics, it is clear that only the peptides have an ability to reduce pro-inflammatory cytokine production. In this study we c o n f i r m that L L - 3 7 can reduce L P S induced pro-inflammatory cytokine production but demonstrate that  in vitro this  is likely  due to binding and sequestering the L P S since this does not occur in response to I L - i p or T N F - a . T h i s is consistent with previous studies demonstrating that B P I can reduce L P S , but not I L - i p induced, N O synthesis (44). T h i s data is somewhat contradictory to one study in an animal model in w h i c h the cathelicidin peptide B M A P - 2 8  can often be added up to six hours after  administration o f bacterial components, by w h i c h point a cascade o f pro-inflammatory cytokines has been produced and clearance o f L P S has begun, and still reduce pro-inflammatory cytokine 72  production and mortality (20).  T h i s indicates that  responses m a y not necessarily reflect  in vitro  in vivo conditions.  models o f L P S induced cytokine  It also appears as though L L - 3 7 may  enhance pro-inflammatory cytokine production by other stimuli such as I L - l p \ A l t h o u g h L L - 3 7 treatment has been demonstrated to increase I L - 1 B release in L P S p r i m e d monocytes (4) this is the first indication that synergistic increases in cytokine production m a y occur in unprimed cells as well. T h i s observation m a y have clinical relevance as these peptides  are developed  into  immunomodulatory therapies. L L - 3 7 has been demonstrated to be protective in animal models o f sepsis i f administered at l o w concentrations but to increase mortality at higher concentrations (45). As  has previously been demonstrated for the insect derived peptide C E M E ,  and the  bovine cathelicidin indolicidin, L L - 3 7 can be added to a monocyte cell line up to an hour after L P S and still reduce pro-inflammatory cytokine production (18, 35). Initially this was attributed to the ability o f the peptide to interact directly with the host cell and b l o c k L P S - i n d u c e d cytokine production through an unspecified mechanism o f action, however, these data are also consistent with the hypothesis that L L - 3 7 and other host defence peptides b i n d to and neutralise the existing L P S . T h i s has also been demonstrated for a B P I derivative w h i c h reduces L P S - i n d u c e d E selectin expression and activation o f the key pro-inflammatory transcription factor N F - K B when added concurrently with L P S or as m u c h as 6 hours afterwards (37). T h i s implies that L P S must be continually present to m a x i m a l l y induce pro-inflammatory signalling and L P S induced responses (37). Consistent with this, washing away the L P S results i n similar reductions in T N F rx production. It is clear that further experiments w i l l be required to determine i f interactions o f LL-37  and other host defence  peptides  with monocytes  are i n v o l v e d i n suppressing  pro-  inflammatory responses. T h i s study also demonstrates that L L - 3 7 might counteract the L P S - i n d u c e d translocation of  the p65  subunit o f N F - K B  in a manner consistent  with b i n d i n g and neutralising L P S  interactions with monocytes. H o w e v e r L L - 3 7 induced p50 translocation and d i d not appear to alter p50 translocation in response to L P S . T h i s is an especially intriguing observation as the accumulation o f p50 homodimers in the nucleus has been demonstrated to b l o c k transcription o f T N F - a (46) and to be an important component in inducing L P S tolerance (47). Future studies should focus on elucidating the role o f alternative subunit formation in L L - 3 7 treated cells and to determine  i f accumulation o f these subunits  occurs  in cells pre-treated with L L - 3 7  thus  elucidating a possible mechanism o f action by w h i c h pre-treatment prevents T N F - a production.  73  In animal models cathelicidins have been demonstrated to reduce L P S - i n d u c e d T N F - a production(18,  19),  to  reduce  circulating levels o f endotoxin  infiltration in a m o d e l o f endotoxin-induced uveitis (19)  (24),  to  suppress  leukocyte  and to prevent lethality in animal  models o f sepsis in w h i c h the animals are injected with high concentrations o f bacteria or L P S (18, 45).  A l t h o u g h current in vitro models o f host defence peptide interactions study host  defence peptide and L P S interactions over short time points and indicate that the suppressive effects o f these peptides are due primarily to their L P S binding and neutralising functions, there may be additional more subtle mechanisms by w h i c h L L - 3 7 and other peptides also alter proinflammatory responses w h i c h may ultimately be more useful in the development  o f these  peptides into drugs with immunomodulatory properties.  4.5 1.  Bibliography D i a m o n d , G . , J . P. Russell, and C . L . Bevins. 1996. Inducible expression o f an antibiotic peptide gene in lipopolysaccharide-challenged tracheal epithelial cells.  Proc Natl Acad  Sci USA 93:5156. 2.  N e l l , M . J . , G . Sandra Tjabringa, M . J . V o n k , P. S. H i e m s t r a , and J . J . Grote. 2004. Bacterial products increase expression cultured human sinus epithelial cells.  3.  o f the human cathelicidin h C A P - 1 8 / L L - 3 7 in  FEMS Immunol Med Microbiol 42:225.  D e , Y . , Q . C h e n , A . P. Schmidt, G . M . A n d e r s o n , J . M . W a n g , J . Wooters, J . J . O p p e n h e i m , and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like 1 ( F P R L 1 ) as a receptor to chemoattract human peripheral b l o o d neutrophils, monocytes,  and T cells. J Exp  Med  192:1069. 4.  Elssner, A . , M . D u n c a n , M . G a v r i l i n , and M . D . Wewers. 2004. A novel P 2 X 7 receptor activator, the human cathelicidin-derived peptide L L 3 7 , induces IL-1 beta processing and  release. J Immunol 172:4987. 5.  Scott, M . G . , and R . E . H a n c o c k . 2000. C a t i o n i c antimicrobial peptides multifunctional role in the immune system.  6.  and their  Crit Rev Immunol 20:407.  D a v i d s o n , D . J . , A . J . Currie, G . S. R e i d , D . M . B o w d i s h , K . L . M a c D o n a l d , R . C . M a , R . E . H a n c o c k , and D . P. Speert. 2004. T h e cationic antimicrobial peptide L L - 3 7 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization. J Immunol  172:1146. 7.  van Wetering, S., S. P. Mannesse-Lazeroms, M . A . v a n Sterkenburg, and P . S. Hiemstra. 2002. N e u t r o p h i l defensins stimulate the release o f cytokines b y airway epithelial cells:  modulation b y dexamethasone. Inflamm Res 51:8. 8.  L a u , Y . E . , A . R o z e k , M . G . Scott, D . L . G o o s n e y , D . J . D a v i d s o n , and R . E . H a n c o c k . 2005. Interaction and cellular localization o f the h u m a n host defense peptide L L - 3 7 with lung epithelial cells.  Infect Immun 73:583.  9.  Powers, J . P., and R . E . H a n c o c k . 2003. T h e relationship between peptide structure and  10.  Periti, P., and T . M a z z e i .  antibacterial activity.  Peptides 24:1681. 1999. N e w  criteria for selecting  chemotherapy for severe sepsis and septic shock. 11.  the proper antimicrobial  Int J Antimicrob Agents 12:97.  Frank, E . D . , D . K a u f m a n , H . K o r m a n , F . Schweinburg, H . A . Frank, and J . Fine. 1955. Effect o f antibiotics on hemodynamics  of hypovolemic  septic shock. Am J Physiol  182:166. 74  12.  Larrick, J . W . , M . Hirata, H . Z h e n g , J . Z h o n g , D . B o l i n , J . M . C a v a i l l o n , H . S. Warren, and S. C . W r i g h t . 1994. A novel granulocyte-derived peptide with lipopolysaccharideneutralizing activity.  13.  J Immunol 152:231.  Larrick, J. W . , M . Hirata, R . F . Balint, J. L e e , J. Z h o n g , and S. C . Wright. 1995. H u m a n C A P 1 8 : a novel antimicrobial lipopolysaccharide-binding protein.  14.  Infect Immun 63:1291.  V a n d e r M e e r , T . J . , M . J. M e n c o n i , J . Z h u a n g , H . W a n g , R . M u r t a u g h , C . B o u z a , P. Stevens, and M . P. F i n k . 1995. Protective effects o f a novel 32-amino acid C-terminal fragment o f C A P 18 in endotoxemic pigs.  15.  Surgery 117:656.  K i r i k a e , T . , M . Hirata, H . Y a m a s u , F . K i r i k a e , H . T a m u r a , F . K a y a m a , K . Nakatsuka, T . Y o k o c h i , and M . N a k a n o . 1998. Protective effects o f a h u m a n 18-kilodalton antimicrobial  protein  ( C A P 1 8 ) - d e r i v e d peptide  against  murine  endotoxemia.  cationic  Infect  Immun 66:1861. 16.  Scott, M . G . , A . C . V r e u g d e n h i l , W . A . B u u r m a n , R . E . H a n c o c k , and M . R. G o l d . 2000. Cutting edge: cationic antimicrobial peptides block the b i n d i n g o f lipopolysaccharide ( L P S ) to L P S b i n d i n g protein.  17.  J Immunol 164:549.  K i r i k a e , T . , M . Hirata, H . Y a m a s u , F . K i r i k a e , H . T a m u r a , F . K a y a m a , K . Nakatsuka, T . Y o k o c h i , and M . N a k a n o . 1998. Protective effects o f a human 18-kilodalton cationic antimicrobial  protein  ( C A P 1 8 ) - d e r i v e d peptide  against  murine  endotoxemia.  Infect  Immun 66:1861. 18.  Scott, M . G , D . J . D a v i d s o n , M . R . G o l d , D . B o w d i s h , and R . E . H a n c o c k . 2002. T h e human antimicrobial peptide L L - 3 7 is a multifunctional modulator o f innate immune responses.  19.  J Immunol 169:3883.  O h g a m i , K . , I. B . Ilieva, K . Shiratori, E . Isogai, K . Y o s h i d a , S. K o t a k e , T . N i s h i d a , N . M i z u k i , and S. O h n o . 2003. Effect o f human cationic antimicrobial protein 18 Peptide on endotoxin-induced uveitis in rats.  20.  Giacometti, A . , O . C i r i o n i ,  Invest Ophthalmol Vis Sci 44:4412.  R. Ghiselli, C . Bergnach, F . Orlando, G . D'Amato, F .  M o c c h e g i a n i , C . Silvestri, M . S. D e l Prete, B . Skerlavaj, V . Saba, M . Zanetti, and G . Scalise. 2004. T h e antimicrobial peptide B M A P - 2 8 reduces lethality in mouse models o f staphylococcal sepsis. 21.  Crit Care Med 32:2485.  R o g y , M . A . , H . S. O l d e n b u r g , S. E . C a l v a n o , W . J . Montegut, S. A . Stackpole, K . J. V a n Zee, M . N . M a r r a , R . W . Scott, J. J . Seilhammer, L . L . M o l d a w e r , and et al. 1994. T h e role o f bactericidal/permeability-increasing protein in the treatment o f primate bacteremia and septic shock.  22.  J Clin Immunol 14:120.  Scott, M . G , M . R . G o l d , and R . E . H a n c o c k . 1999. Interaction o f cationic peptides with lipoteichoic acid and gram-positive bacteria.  23.  Infect Immun 67:6445.  Britigan, B . E . , T . S. L e w i s , M . Waldschmidt, M . L . M c C o r m i c k , and A . M . K r i e g . 2001. Lactoferrin binds C p G - c o n t a i n i n g oligonucleotides and inhibits their immunostimulatory effects on h u m a n B cells.  24.  J Immunol 167:2921.  Giacometti, A . , O . C i r i o n i , R . G h i s e l l i , F . M o c c h e g i a n i , G . D ' A m a t o , R . C i r c o , F . Orlando,  B.  Skerlavaj, C . Silvestri,  V.  Saba,  M . Zanetti,  and  G . Scalise.  2004.  Cathelicidin peptide sheep m y e l o i d antimicrobial peptide-29 prevents endotoxin-induced mortality i n rat models o f septic shock. 25.  Am J Respir Crit Care Med 169:187.  N a g p a l , S., K . J . K a u r , D . Jain, and D . M . Salunke. 2002. Plasticity in structure and interactions is critical for the action o f indolicidin, an antibacterial peptide o f innate immune origin.  26.  Bowdish,  D.  Protein Sci 11:2158. M.  Immunomodulatory  E.,  Davidson,  Activities  of  D.J.,  Scott,  M.,  S m a l l Host Defence  Hancock,  Peptides.  R.E.W.  2005.  Antimicrob Agents  Chemother in press.  75  27.  Sorensen, O . E . , P. F o l l i n , A . H . Johnsen, J . Calafat, G . S. Tjabringa, P. S. Hiemstra, and N . Borregaard. 2001. H u m a n cathelicidin, h C A P - 1 8 , is processed to the antimicrobial peptide L L - 3 7 b y extracellular cleavage with proteinase 3.  28.  Blood 97:3951.  Turner, J . , Y . C h o , N . N . D i n h , A . J . W a r i n g , and R . I. Lehrer. 1998. Activities o f L L - 3 7 , a cathelin-associated  Antimicrob Agents  antimicrobial peptide o f human neutrophils.  Chemother 42:2206. 29.  N a g a o k a , I., S. Hirota, F . N i y o n s a b a , M . Hirata, Y . A d a c h i , H . T a m u r a , and D . H e u m a n n . 2001.  C a t h e l i c i d i n family  o f antibacterial peptides  C A P 18  and C A P 11  inhibit the  expression o f T N F - a l p h a b y b l o c k i n g the binding o f L P S to C D 1 4 ( + ) cells.  J Immunol  167:3329. 30.  C i o r n e i , C . D . , A . Egesten, and M . Bodelsson. 2003. Effects o f human cathelicidin antimicrobial peptide L L - 3 7 on lipopolysaccharide-induced nitric oxide release from rat aorta in vitro.  31.  Acta Anaesthesiol Scand 47:213.  Sallusto, F . , and A . Lanzavecchia. 1994. cultured  human  dendritic  cells  is  Efficient presentation o f soluble antigen b y  maintained  by  granulocyte/macrophage  colony-  stimulating factor plus interleukin 4 and downregulated b y tumor necrosis factor alpha. J  Exp Med 179:1109. 32.  Indiveri, F . , J . Huddlestone, M . A . Pellegrino, and S. Ferrone. 1980. Isolation o f human T lymphocytes: comparison between n y l o n wool filtration and rosetting with neuraminidase ( V C N ) and 2-aminoethylisothiouronium bromide ( A E T ) - t r e a t e d sheep red b l o o d cells (SRBC).  33.  J Immunol Methods 34:107.  T s u c h i y a , S., M . Y a m a b e , Y . Y a m a g u c h i , Y . K o b a y a s h i , T . K o n n o , and K . Tada.  1980.  Establishment and characterization o f a human acute monocytic leukemia cell line ( T H P -  1). Int J Cancer 26:171. 34.  Stokes, R . W . , and D . Doxsee. 1999. T h e receptor-mediated uptake, survival, replication, and drug sensitivity o f M y c o b a c t e r i u m tuberculosis within the macrophage-like cell line T H P - 1 : a comparison with human monocyte-derived macrophages.  35.  peptide antimicrobial agents. 36.  Cell Immunol 197:1.  G o u g h , M . , R . E . H a n c o c k , and N . M . K e l l y . 1996. A n t i e n d o t o x i n activity o f cationic  Infect Immun 64:4922.  K o h r o , T . , T . T a n a k a , T . M u r a k a m i , Y . W a d a , H . Aburatani, T . H a m a k u b o , and T . K o d a m a . 2004. A comparison o f differences i n the gene expression profiles o f phorbol 12-myristate macrophage.  37.  13-acetate  differentiated  THP-1  cells  and  human  monocyte-derived  JAtheroscler Thromb 11:88.  H u a n g , K . , D . M . F i s h w i l d , H . M . W u , and R . L . D e d r i c k . 1995. Lipopolysaccharideinduced E-selectin expression requires continuous presence o f L P S and is inhibited by bactericidal/permeability-increasing protein.  38.  Inflammation 19:389.  Papo, N . , and Y . Shai. 2005. A molecular mechanism for L P S protection o f gramnegative bacteria from antimicrobial peptides.  39.  J Biol Chem.  Ferguson, A . D . , W . Welte, E . H o f m a n n , B . L i n d n e r , O . Hoist, J . W . Coulton, and K . Diederichs. 2000. A conserved structural m o t i f for lipopolysaccharide recognition b y procaryotic and eucaryotic proteins.  40.  Structure Fold Des 8:585.  Japelj, B . T . , P. Pristov-Ek, A . Majerle,  and R . Jerala. 2005.  Structural origin o f  endotoxin neutralization and antimicrobial activity o f a lactoferrin-based peptide.  J Biol  Chem. 41.  Andra,  J.,  M.  H.  Koch,  R.  Bartels,  and  K.  Brandenburg.  2004.  Biophysical  characterization o f endotoxin inactivation b y N K - 2 , an antimicrobial peptide derived from m a m m a l i a n N K - l y s i n . 42.  Antimicrob Agents Chemother 48:1593.  M e s z a r o s , K . , J . B . Parent, H . Gazzano-Santoro, R . Little, A . H o r w i t z , T . Parsons, G . Theofan, L . G r i n n a , J . W e i c k m a n n , P. Elsbach, and et al. 1993. A recombinant amino 76  terminal fragment o f bactericidal/permeability-increasing protein inhibits the induction o f leukocyte responses b y L P S . 43.  JLeukoc Biol 54:558.  Scott, M . G . , C . M . Rosenberger, M . R. G o l d , B . B . F i n l a y , and R . E . H a n c o c k . 2000. A n alpha-helical cationic antimicrobial peptide selectively modulates macrophage responses to  lipopolysaccharide  and directly  alters  macrophage  gene  expression.  J Immunol  165:3358. 44.  C i o r n e i , C . D . , A . Egesten, M . Engstrom, K . Tornebrandt, and M . Bodelsson. 2002. Bactericidal/permeability-increasing protein inhibits endotoxin-induced oxide synthesis.  45.  vascular nitric  Acta Anaesthesiol Scand 46:1111.  F u k u m o t o , K . , I. N a g a o k a , A . Yamataka, H . K o b a y a s h i , T . Y a n a i , Y . K a t o , and T . M i y a n o . 2005. Effect o f antibacterial cathelicidin peptide C A P 1 8 / L L - 3 7 on sepsis in neonatal rats.  46.  Pediatr Surg Int 21:20.  Baer, M . , A . D i l l n e r , R. C . Schwartz, C . Sedon, S. Nedospasov, and P . F . Johnson. 1998. T u m o r necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces N F - k a p p a B p50.  47.  Mol Cell Biol 18:5678.  Bohuslav, J . , V . V . K r a v c h e n k o , G . C . Parry, J. H . E r l i c h , S. G e r o n d a k i s , N . M a c k m a n , and R . J. U l e v i t c h . 1998. Regulation o f an essential innate immune response b y the p50 subunit o f N F - k a p p a B .  J Clin Invest 102:1645.  11  5.0 LL-37 Induces Rapid & Early Chemokine Production Via Activation of N F - K B and the MAPK 5.0  LL-37 INDUCES RAPID & EARLY CHEMOKINE PRODUCTION VIA ACTIVATION OF NFKB & THE MAPK 78 5.1  INTRODUCTION  5.2  MATERIALS & METHODS  79 80  5.3  RESULTS  83  5.4  DISCUSSION  89  5.5  BIBLIOGRAPHY  91  78  5.1  Introduction L e u k o c y t e infiltration is a hallmark o f inflammation and is an essential component o f the  early immune response. Leukocytes accumulate at infection foci early in the course o f infection and dissipate as the infection is managed. In general, this is a tightly regulated process w h i c h results in the resolution o f infection without damaging the host; however, dysregulation has been linked to conditions such as asthma (1), rheumatoid arthritis (2), neurodegenerative disease (3) and tumour formation (4). In certain diseases such as arthritis and cystic fibrosis, the infiltration o f excessive numbers o f leukocytes is believed to be a major contributing factor to disease pathology (5-7). T h u s it is essential to characterise and understand the involvement o f novel chemoattractants and chemokine-inducing agents. Host defence peptides are essential components o f the innate immune response w h i c h are found at elevated concentrations during the course o f infection and inflammation (8-10). These are small, positively charged peptides that are found in h i g h concentrations in the granules o f neutrophils and at lower concentrations in other cell types such as monocytes, T cells and N K cells (11). T h e y are also expressed by epithelial cells and keratinocytes u p o n stimulation with bacterial components or pro-inflammatory cytokines (12,  13). T h e y have been shown to have  diverse functions in the innate immune response including altering the differentiation o f dendritic cells (14), promoting angiogenesis and w o u n d healing (15-17), and inducing chemotaxis and chemokine production (18-20). There are three major classes o f host defence peptides in humans, the alpha defensins, beta defensins and the sole cathelicidin, h C A P - 1 8 / L L - 3 7 .  M e m b e r s o f each  o f these classes have been demonstrated to function as chemoattractants for dendritic cells, neutrophils, monocytes, and/or T cells although the concentrations required for chemotaxis tend to be m u c h higher than conventional chemokines (21, 22). These peptides m a y also be involved in the recruitment o f leukocytes b y inducing the production o f chemokines. L L - 3 7 , for example, has been demonstrated to induce I L - 8 production from epithelial cells and epithelial cell lines, from  keratinocytes  and  from  peripheral blood  derived monocytes  (23-26).  Interestingly,  increased pulmonary concentrations o f L L - 3 7 correlate with granulocyte infiltrations as well as the presence o f neutrophil chemokines and neutrophil markers in cystic fibrosis (27). Other cell types are also found at sites o f high concentrations o f L L - 3 7  i n c l u d i n g mononuclear cells.  A l t h o u g h L L - 3 7 m a y function as a chemoattractant for these cells, the high concentrations required for chemotactic activity in vitro i m p l y that this might not be the primary role o f this peptide in leukocyte recruitment.  79  I have demonstrated i n Chapter 3 that L L - 3 7 induces activation o f the mitogen activated protein kinases ( M A P K ) , extracellular regulated kinase ( E R K 1 / 2 ) and p38, this activation is linked to transcription o f the chemokines  in monocytes and  I L - 8 , M C P - 1 and M C P - 3 . I also  demonstrated that L L - 3 7 induces the production o f substantial amounts o f I L - 8 from peripheral b l o o d derived monocytes.  I propose  that the  ability o f this peptide  to induce  chemokine  production may be i n v o l v e d in the recruitment o f leukocytes to sites o f elevated concentrations o f L L - 3 7 w h i c h occur at site o f infection and inflammation. In this chapter the ability o f L L - 3 7 to  induce  transcription o f  other  C C chemokines  was  investigated.  LL-37  stimulation  of  peripheral b l o o d monocytes resulted in release o f I L - 8 w h i c h can be detected in supernatants after only 15 m i n o f stimulation. Because o f the quick kinetics o f this response, the possibility that L L - 3 7 was inducing a transcript stabilisation event or was stimulating the release o f preformed stores o f I L - 8 was investigated. T h i s study demonstrates that L L - 3 7 mediated activation o f the M A P K results in  novo  de novo  transcription o f various C C chemokines and is required for in  de  I L - 8 production w h i c h is detectable in as short a time as 15 minutes after stimulation. L L -  37 is thus a potent immunostimulatory agent w h i c h is likely i n v o l v e d i n the early recruitment o f leukocytes to sites o f infection or inflammation. 5.2  Materials & Methods  Isolation of Peripheral Blood Derived Monocytes. B l o o d monocytes were prepared using standard techniques (28). B r i e f l y , 100ml o f fresh human venous b l o o d was collected in sodium heparin-containing Vacutainer collection tubes (Becton D i c k i n s o n , Mississauga, O N , Canada) from volunteers  according to U B C C l i n i c a l  Research Ethics B o a r d protocol C02-0091. T h e b l o o d was m i x e d , at a 1:1 ratio, with R P M I  1640  media [supplemented with 10% v/v foetal c a l f serum ( F B S ) , 1% L-glutamine, 1 m M sodium pyruvate] in an E-toxa-clean ( S i g m a - A l d r i c h , O a k v i l l e , O N , Canada) washed, bottle. Peripheral b l o o d mononuclear cells ( P B M C )  endotoxin-free  were separated using F i c o l l - P a q u e Plus  ( A m e r s h a m Pharmacia B i o t e c h , B a i e D ' U r f e , P Q , Canada) at r o o m temperature and washed with phosphate resetting  cholerae Ficoll  buffered saline ( P B S ) . M o n o c y t e s were enriched with the removal o f T-cells b y with fresh sheep red blood cells ( U B C animal care unit) pre-treated with  Vibrio  neuraminidase ( C a l b i o c h e m Biosciences Inc., L a Jolla, C A ) and repeat separation b y  Paque  Plus  (29).  The  enriched monocytes  were washed  with  P B S , then  cultured  (approximately 0.5-1 x 10 per well) for 1 hour at 3 7 ° C followed b y the removal o f non-adherent 5  cells; monocytes were >95%  pure as determined b y flow cytometry. C e l l s were cultured in  F a l c o n tissue culture 48-well plates (Becton D i c k i n s o n , Mississauga, O N , Canada). T h e adherent 80  monocytes were cultured in 0.25 m l media at 3 7 ° C in w h i c h L L - 3 7 dissolved in endotoxin-free water ( S i g m a - A l d r i c h , O a k v i l l e , O N , Canada) were added. Endotoxin-free water was added as a vehicle control. A total o f six donors were used in these experiments.  Cell Culture T h e h u m a n monocyte-like cell line, T H P - 1 (30), was obtained from the A T C C (No. T I B 202, R o c k v i l l e , M D ) , and g r o w n in supplemented R P M I 1640 m e d i u m containing 10% foetal c a l f serum , 1%> s o d i u m pyruvate and 1% L-glutamine ( G i b c o B R L , B u r l i n g t o n , O N ) . T H P - 1 cells were differentiated into adherent macrophage-like cells b y addition o f 100 m M phorbyl myristate acetate and incubation at 3 7 ° C , 5%> CO2 for three days as described previously (31).  Inhibitor Studies SB  203580, a specific  inhibitor o f p38  kinase  was  purchased from S i g m a - A l d r i c h  (Oakville, O N , Canada) and P D 9 8 0 5 9 , a specific inhibitor o f E R f G / 2 kinase was purchased from C e l l Signaling T e c h n o l o g y . C e l l s were incubated with the kinase inhibitors (5 or 10 u M ) for 1 hr prior to stimulation with L L - 3 7 . T h e transcriptional inhibitor actinomycin D and the protein synthesis inhibitor cycloheximide were incubated at a concentration o f 5 u g / m l and 1 u g / m l respectively for 30 m i n prior to stimulation with L L - 3 7 ( C a l b i o c h e m Biosciences Inc., L a Jolla, C A ) . A l l inhibitors were present over the course o f L L - 3 7 stimulation.  Peptide Synthesis. L L - 3 7 was synthesized b y N-(9-fluorenyl) methoxycarbonyl ( F m o c ) chemistry at the N u c l e i c A c i d / P r o t e i n Service unit at the University o f British C o l u m b i a , as previously described (32). Peptides were purified b y reverse-phase high-performance liquid chromatography and were at least 98% pure. L L - 3 7 was dissolved in endotoxin-free water (Sigma, St. L o u i s , M O ) and the concentration o f the peptides in solution was determined b y amino acid analysis.  Semi-Quantitiative and Quantitative Reverse-Transcriptase-PCR (RT-PCR) Total R N A was  isolated from donor b l o o d derived monocytes using an RNaqueous  M i c r o - k i t ( A m b i o n ) as described b y the manufacturer. T h e samples were D N a s e treated, and then c D N A synthesis was accomplished b y using a first-strand c D N A synthesis kit (Gibco). T h e resultant c D N A s were used as a template in P C R s for various cytokine genes (Table 5.1). A l l quantitative  R T - P C R experiments  were performed in duplicate on an A B I 7700. Sequence  Detection System. Results were analyzed in the linear phase o f amplification and normalized to the R T - P C R results for the housekeeping control, glyceraldehyde-3-phosphate (GAPDH).  T o quantify bands o f the semi-quantitative  dehydrogenase  R T - P C R the gels were quantified b y 81  densitometry using the software program ImageJ and normalised to the housekeeping  gene,  G A P D H . Reactions were verified by including controls lacking reverse transcriptase. T a b l e 5.1. P r i m e r sequences used i n this study. Reverse Sequence (5'-3')  F o r w a r d sequence (5'-3')  Primer MCP-1/CCL4  TCATAGCAGCCACCTTCATTC  TAGCGCAGATTCTTGGGTTG  MIP-la/CCL3  GCATCACTTGCTGCTGACAC  CTGGACCCACTCCTCACTGG  MIP-1(3/CCL2  CTTTTCTTACACCGCGAGGAA  GCAGAGGCTGCTGGTCTCAT  IL-8/CXCL8  GTGCAGAGGGTTGTGGAGAAG  TTCTCCCGTGCAATATCTAGG  IL-6  ACCTGAACCTTCCAAAGATGG  GCGCAGAATGAGATGAGTTG  TNF-a  AGGGAGCCTTTGGTTCTGG  TCAGCAATGAGTGACAGTTGG  IL-p  GGATATGGAGCAACAAGTGG  ATGTACCAGTTGGGGAACTG  GAPDH  GAAACTGTGGCGTGATGG  GTCGCTGTTGAAGTCAGAGG  Cytokine Production T h e concentration o f I L - 8 i n the supernatants o f the treated cells was measured using commercially prepared E L I S A plates i n accordance to the manufacturer's suggestion (Biosource, Montreal, Q C , Canada). M o n o c y t e s were seeded at approximately 0.5-1 x 10 cells per well i n 5  48 well plates. C e l l s were then stimulated with either endotoxin free water as a vehicle control or L L - 3 7 in at least triplicate. Supernatants were collected and stored at - 2 0 ° C until use.  Immunoblotting THP-1  cells were cultured as above. O n the day o f the assay the cells were  gently  detached using C e l l Dissociation Solution (Sigma). C e l l s were washed, re-suspended in media and  added to 5 m l polystyrene tubes (Becton D i c k i n s o n ) and allowed to rest for 2 hours.  A p p r o x i m a t e l y 1 x 10  6  T H P - 1 cells were used per condition. C e l l s were then stimulated by  adding L P S , L L - 3 7 or water as a vehicle control. After stimulation the cells were centrifuged, washed one time with ice-cold P B S with I m M vanadate and nuclear extracts were isolated using N E - P E R N u c l e a r and C y t o p l a s m i c Extraction Reagents K i t (Pierce, Fisher Canada, O N ) as per the manufacturer's directions. T h e protein concentrations o f the lysates were quantitated using a B C A assay (Pierce, Fisher Canada, O N ) . Lysate (7.5 pg) was loaded onto 1.0 m m thick gels, which were run at 100 V for approximately 2-3 hours. Proteins were transferred to P V D F filters for 80 m i n at 80 V . T h e filters were blocked for 1 hour at r o o m temperature with 5% s k i m m e d m i l k in T B S T (10 m M T r i s - H C l p H 8, 150 m M N a C I , 0.1% Tween-20). T h e filters were then incubated  overnight  at 4 ° C with  monoclonal antibodies.  the anti-p50  or anti-p65  Immunoreactive bands were  detected  (Cell  Signalling  Technology)  using horseradish peroxidase-  conjugated donkey anti-rabbit I g G antibodies ( A m e r s h a m Pharmacia) and chemiluminescence detection (Sigma). 82  5.3 Results LL-37 induces transcription of chemokines and cytokines T o determine whether L L - 3 7 induced transcription o f chemokines and cytokines at early time points, monocytes from three donors were treated with 50 p g / m l o f L L - 3 7 for 30, 60, or 90 minutes. R N A was collected and quantitative R T - P C R ( q R T - P C R ) was performed. E a c h q R T P C R reaction was performed in duplicate. T h e increases  in expression were calculated by  dividing the expression level in the L L - 3 7 treated samples b y the expression level in the vehicle control treated samples. Increases in chemokine transcripts for the C C family chemokines M C P 1, M l P - l a , M I P - i p , for I L - 8 and the cytokine I L - 6 (Figure 5.1) occurred as a result o f L L - 3 7 treatment in all donors tested. H o w e v e r , there was considerable variation in both the amplitude and the kinetics o f the response between donors. F o r example, transcription o f M C P - 1 peaked at 60 m i n for L L - 3 7 - t r e a t e d monocytes from donors 1 and 2 and at 30 m i n for donor 3 (Figure 5.1). Peak transcription o f M I P - l p occurred for donors 2 and 3 at 30 m i n , however there was no increase in transcription at 30 or 60 m i n for donor 1 and instead, transcription was greatly increased at 90 m i n . Semi-quantitative P C R was  also performed for the pro-inflammatory  cytokines T N F - a , I L - 1 2 p 4 0 and I L - l p \ H o w e v e r , no detectable increase in transcription o f these genes was found due to L L - 3 7 treatment at 38 rounds o f amplification (data not shown).  83  i i Donor 1 • Donor 2 • Donor 3  30  60  30  Time (min)  Time (min)  30  60  60 Time (min)  Time (min) 30  an  CD OJ  MIP-ip/ . 20 CCL4  1  old  O  10  30  60  Time (min)  60  90  Figure 5.1. LL-37 induction of chemokine and cytokine transcription in primary monocytes. Monocytes from three different donors were stimulated with LL-37 (50 ug/ml) or endotoxin free water as a vehicle control for 30, 60 & 90 min. R N A was collected and quantitative RT-PCR was performed. Bars are the average of duplicate qRT-PCR reactions. Changes in gene expression were measured by dividing the expression level of the LL-37 treated samples by the expression level of the vehicle control treated samples. LL-37 induces transcription of C C family chemokines (A), a neutrophil chemokine (B) and at least one cytokine (C).  Early production of chemokines is a result of de novo transcription which is controlled in part activation of both the p38 and ERK1/2 kinases Many genes which are induced in response to stress or detection of infection demonstrate increases in expression which are due to increased stabilisation of the mRNA transcript rather than increases in de novo transcription (33). One possible explanation for the very rapid LL-37induced increases in chemokine transcripts was that an LL-37-induced transcript stabilisation event was occurring. To test whether transcript stabilisation was increased after stimulation with 84  L L - 3 7 , cells were pre-treated with actinomycin D , a k n o w n inhibitor o f m R N A synthesis (34). If increases in the m R N A transcript were due to a stabilisation event, there w o u l d be no apparent decrease in gene expression with actinomycin D treatment. C o n v e r s e l y i f was  required then actinomycin D treatment  de novo  should result i n a decrease i n the  transcription chemokine  transcripts. M o n o c y t e s were pre-treated with actinomycin D (5 p g / m l ) for 30 m i n and then stimulated with L L - 3 7 . A c t i n o m y c i n D was present for the entire course o f the experiment. R N A was collected, c D N A was synthesised and q R T - P C R was performed. E a c h q R T - P C R reaction was performed in duplicate and bars represent the average o f the duplicate experiments. O n e representative donor o f two shown. Pre-treatment with a c t i n o m y c i n D reduced transcription o f chemokine genes to values close to baseline  de novo  primarily due to  indicating that increases  transcription (Figure 5.2).  IL-8/CXCL8 0  CD C CD  8  •  sz  O  i n transcription were  A  MIP-1p7CCL4  41  0 pg/ml LL-37 50 pg/ml LL-37  •  TJ 4 O LL  0  Actinomycin D  VC  Actinomycin D  VC  MCP-1/CCL2  MIP-1a/CCL3  & 8 6  i  I  o  TJ O  4  : 2 0  Actinomycin D  VC  de novo  F i g u r e 5.2. Increases i n c h e m o k i n e t r a n s c r i p t i o n as a r e s u l t o f  transcriptional  events. M o n o c y t e s from 2 donors were pre-treated with a c t i n o m y c i n D (5 pg/ml) or a vehicle control ( V C ) for 30 m i n then stimulated with L L - 3 7  (50  p g / m l ) for 30 m i n .  Increases in the c h e m o k i n e transcripts were detected b y quantitative P C R . Treatment with actinomycin D prior to L L - 3 7 stimulation reduced the transcription o f chemokine genes to baseline, indicating that chemokine transcription in response to L L - 3 7 was primarily due to  de novo  transcriptional events. Changes in the transcript are expressed as expression in L L -  37-treated  samples/expression  performed  in  duplicate  and  in  untreated  bars  represent  samples. the  Each  average  qRT-PCR of  these  reaction  was  duplicates.  One  representative donor o f two shown. LL-37  induced  transcription o f  certain  chemokines  at  4  hr  has  previously  demonstrated to be controlled by L L - 3 7 - i n d u c e d activation o f both the p38 and E R K 1 / 2  been  kinases  [Chapter 3, Figure 3.3 & 3.7; (24)] but it was not determined i f activation o f these kinases was a  85  requirement for early transcriptional events. Treatment with inhibitors o f either p38 or E R K 1 / 2 (10  u M ) i n d i v i d u a l l y resulted in  monocytes  slight reductions in transcription o f chemokine genes in  from two donors, however, when both inhibitors were used in combination the  transcription o f the chemokine genes was completely abrogated suggesting that activation o f both kinases is required for m a x i m a l transcription (Figure 5.3).  F i g u r e 5.3. E f f e c t s o f i n h i b i t o r s o f the p38  LL-37 inhibitor  ERK  and  ERK1/2  kinases  on L L - 3 7  induced  t r a n s c r i p t i o n . M o n o c y t e s from two donors  p38 inhibitor  were pre-treated with an inhibitor for either  MCP-1  ERK1/2  or p38  inhibitors  kinase  for  1  hr.  (10  u M ) or both  Cells  were  then  stimulated with L L - 3 7 (50 ug/ml) for 30 or 60  min.RNA  was  collected,  cDNA  was  created and semi-quantitative R T - P C R was performed for M C P - 1 (60' L L - 3 7 treatment, GAPDH  B c o  35 cycles), I L - 8 (30' L L - 3 7 treatment,  26  cycle),  MlP-la  28  cycles)  and M I P - l p  (30'  LL-37  treatment,  ( 3 0 ' L L - 3 7 treatment,  30 cycles). P C R products were run on a gel  6000  and normalised to G A P D H (30 & 60',  '</)  cycles).Treatment  cn CD  inhibitor  cL 4000  X LU  with  either  i n d i v i d u a l l y resulted  31  MAPK  in a  slight  reduction in transcription but treatment with both  CD  > 2000 ro  inhibitors  resulted  in  a  complete  abrogation o f c h e m o k i n e transcription. A ) One representative donor o f two shown. B )  CD  cm  A v e r a g e quantified results LL-37  LL-37 + ERK inhibitor  LL-37 + LL-37 + p38 ERK &p38 inhibitor inhibitor  o f two  donors  shown. Bars represent the average o f both donors and the error bars represent the range o f responses between both donors.  Treatment De novo protein synthesis is requiredfor IL-8 release Certain chemokines have been demonstrated to be released independently o f  de novo  protein production (35). L L - 3 7 induces I L - 8 release into the supernatants w h i c h can be detected as early as 15 minutes after stimulation (Figure 5.4) T o test whether L L - 3 7 induced I L - 8 release was a result o f  de novo  protein synthesis or release from internal stores, monocytes were pre-  treated with c y c l o h e x i m i d e prior to stimulation with L L - 3 7 . C y c l o h e x i m i d e is an inhibitor o f protein synthesis (36). T h u s , i f I L - 8 levels in the supernatant decreased u p o n cycloheximide treatment, this w o u l d i m p l y that I L - 8 release is most likely subsequent to new protein synthesis.  86  L L - 3 7 induced release o f I L - 8 in a time dependent manner i n both donor tested. T h e presence o f cycloheximide (1 p g / m l ) substantially reduced the amount o f I L - 8 released at most time points indicating that I L - 8 release is primarily due to  de novo  ,  ,  translation.  800,  Time (min) F i g u r e 5.4. from  ,  T  i  m  Effect of cycloheximide treatment  monocytes  i n response  to  LL-37  e  (  m i n  )  o n IL-8  stimulation.  release  Monocytes  were pre-treated with cycloheximide (1 pg/ml) or a vehicle control for  30  m i n prior to L L - 3 7  (50  pg/ml)  stimulation.  I L - 8 in the  supernatants was detected by E L I S A . Bars represent the mean o f three wells minus background levels o f I L - 8 ± standard error o f the mean. Results from both donors shown.  The p38 and ERK 1/2 kinases are involved in early IL-8 release I have previously demonstrated that L L - 3 7 activated both the p38 and E R K 1/2  kinases  after 15 m i n o f stimulation and inhibition o f this response reduced I L - 8 production at 4 hrs [Chapter 3, Figures 3.3 & 3.7, (24)]. T o determine what the involvement o f these kinases i n early IL-8 release, monocytes were pre-incubated with an inhibitor for either kinase for 1 hr prior to stimulation with L L - 3 7 (50 pg/ml).  Supernatants were collected after 15, 30 a n d 60 minutes o f  L L - 3 7 treatment and the amount o f I L - 8 was assessed by E L I S A . Interestingly,  pre-treatment  with the p38 inhibitor resulted in a greater reduction in I L - 8 production than did pre-treatment with an E R K 1/2 inhibitor (Figure 5.5), in contrast to inhibition o f transcription o f the I L - 8 gene w h i c h appeared to be equally reduced by both kinase inhibitors (Figure 5.3).  87  800  • LL-37 alone D + 5 nM ERK inhibitor • + 5 nM p38 inhibitor  Figure both  5.5.  p38  Requirement  and E R K 1 / 2  in  of the  e a r l y release o f I L - 8 i n response  2 400  to L L - 3 7 . donors  M o n o c y t e s from two  were  inhibitors  pre-treated  with  either  (SB  for  203580) or E R K 1 / 2  p38  (PD98059)  kinases (5 u M ) for 60 m i n prior to L L - 3 7 (50 ug/ml) stimulation. Supernatants were collected and assayed  for I L - 8 production by  ELISA.  Treatment  kinase  inhibitor  with  either  reduced  the  amount o f I L - 8 release. Bars are the average o f three wells minus the  background  production Results  15  ±  from  levels standard  both  of  IL-8 error.  donors  are  shown.  30 Time (min)  LL-3 7 induces translocation ofp50 and this may be involved in chemokine transcription & secretion IL-8 transcription has been demonstrated to be highly dependent u p o n activation o f N F KB therefore the ability o f L L - 3 7 to induce activation o f N F - K B was investigated. A monocyte cell line ( T H P - 1 ) was treated with 10 ug/ml o f L L - 3 7 , or vehicle control, for 20 m i n at w h i c h time nuclear protein extracts were collected. In general N F - K B subunits are maintained in the cytoplasm and upon stimulation with activating agents the subunits become phosphorylated and translocate to the nucleus. L P S is k n o w n to induce translocation o f both the p65 and p50 subunits and thus was utilised as a positive control. T o determine i f activation o f N F - K B occurred in response to L L - 3 7 treatment, Western blots o f the nuclear extracts were probed for the presence of two o f the major subunits.  L L - 3 7 stimulation caused the translocation o f the p50 but not the  p65 subunit to occur (Figure 5.6). F i g u r e 5.6. L L - 3 7 i n d u c e d t r a n s l o c a t i o n o f N F - K B subunits. A  LL-37 p65 p50  LPS  monocyte-like cell line ( T H P - 1 ) was stimulated with L L - 3 7  (10  ug/ml) for 20 m i n and nuclear extracts were collected. Western blots for the p50 and p65 subunits o f N F - K B were performed. L P S (10  ng/ml)  w h i c h is  a known  inducer o f both p50  and  p65  translocation, was used as a positive control. O n e representative experiment o f three is shown.  88  5.4  Discussion I have demonstrated that L L - 3 7  induced the  stimulation o f peripheral b l o o d derived  transcription and release o f the  major neutrophil chemokine,  monocytes  I L - 8 and  the  transcription o f four C C family chemokines. T h e induction o f these chemokines was rapid, with increases at the transcriptional level occurring within 30 minutes. C y t o k i n e and chemokine genes often have A U - r i c h sequences in the 3' untranslated region o f their m R N A . T h e presence o f A U rich sequences leads to rapid degradation o f the transcripts unless they are b o u n d by stabilisation proteins (37). T h i s provides a mechanism by w h i c h rapid translation from the m R N A transcript can occur in response to inflammatory stimuli. Because I L - 8 and other chemokines are k n o w n to contain A U - r i c h regions, the possibility that transcript levels were increased due to a stabilisation event was examined. Despite the rapid nature o f this response, the substantial inhibition o f I L - 8 gene expression by actinomycin D or cycloheximide indicated that the production o f these chemokines was most likely due to The  involvement  o f the  de novo MAPK  transcription and protein production.  in I L - 8 transcription and release has  been  well  documented in a variety o f cell types and model systems (38-40). It has been demonstrated that activation o f the E R K 1/2  and p38  kinases  are i n v o l v e d i n both transcriptional and post-  transcriptional regulation o f I L - 8 although there is substantial variability in the contribution o f these kinases w h i c h depends in part on the type o f stimuli and the target cell [reviewed in (41)]. Because o f the well-documented involvement o f N F - K B in I L - 8 transcription, I investigated the ability o f L L - 3 7  to induce N F - K B translocation. T h e observation that L L - 3 7  induced the  translocation o f the p50 subunit o f N F - K B but not the p65 subunit was a departure from the consensus within the literature. In a general model o f I L - 8 production, the binding o f N F - K B (p50/p65) and A P - 1 to the promoter sequence is required for transcription while p38 activation is required for transcript stabilisation and protein production (42). T h e observation that activation o f the p65 subunit is not required for I L - 8 transcription in L L - 3 7 - treated monocytes  is not  entirely consistent with published reports, w h i c h indicate that although many N F - K B homo- and hetero- dimer combinations b i n d to the I L - 8 promotor, subunits containing the p65 subunit are the major contributor to transcription (43). H o w e v e r there are several reports indicating that IL-8 release may occur independently o f N F - K B activation and it is possible that this is the case for L L - 3 7 stimulated cells (44, 45). Other chemokines including M C P - 1 are also regulated at the transcriptional and post-translational levels by p38 and N F - K B (p65/p50)(46). This generalisation may however  not be applicable to all situations  or chemokines  however  as, for example,  transcription o f the M I P - i p gene requires p50 and R e l B activation (47, 48). It is obvious that the 89  control of chemokine genes at the transcriptional level is quite complicated and although there may be common themes there are differences between cell types, the type of stimuli, mouse and human cells and primary cells versus cell lines. Future studies should focus on the composition of the N F - K B dimers stimulated by LL-37. This study suggests but does not demonstrate that N F - K B is involved in LL-37-induced transcription of IL-8 and other CC-family chemokines. It is not evident whether  NF-KB  activation occurs in parallel to or downstream of MAPK activation (Figure 5.7). The requirement of ERK1/2 and p38 upstream of N F - K B activation has been discovered in a number of different systems (49, 50) and thus future experiments using inhibitors of these kinases should be performed to determine if LL-37 induced MAPK activation is upstream of or parallel to  NF-KB  activation.  NF-KB  ERK1/2-P  P  3  8  -  P  B ERK1/2-P  p38-P  Figure 5.7. Two models of signalling pathway activation in LL-37 treated monocytes. A) N F K B activation could occur in parallel with ERK 1/2 and p38 activation. B ) N F - K B activation could occur downstream of activation of the ERK 1/2 and or p38 kinases.  90  Certain diseases such as cystic fibrosis and psoriasis are characterised b y both high levels o f L L - 3 7 and h i g h levels o f neutrophil markers and neutrophil specific chemokines such as I L - 8 (12, 27, 51, 52).  Elevated levels o f L L - 3 7 at sites o f infection correlate with elevated numbers o f  leukocytes including granulocytes and mononuclear cells (27). H o w e v e r , it is not k n o w n i f the increased number o f leukocytes is due to the chemotactic properties o f the peptide itself (21, 22) or whether these cells arrive at sites o f high concentrations o f L L - 3 7 due to the chemokineinducing properties o f the peptide. A l t h o u g h L L - 3 7 is chemotactic for a number o f cell types including neutrophils and monocytes chemokines  (21) it is m u c h less potent (50  such as I L - 8 (1 n M ) (53).  A s a result o f the ability o f  u M ) than conventional L L - 3 7 to induce the  production o f chemokines in a rapid fashion it may not be the elevated levels o f L L - 3 7 that lead to increases in leukocyte infiltration but rather the increased levels o f chemokines produced in response to L L - 3 7 exposure w h i c h may contribute to L L - 3 7 - a s s o c i a t e d leukocyte infiltration. In certain diseases it is the tissue damage due to excessive inflammatory cell infiltration w h i c h appears to be the major contributor to pathology. In these cases it w i l l be necessary to develop therapies w h i c h target not only the causative agent but also target the detrimental host response. Novel  contributors to  leukocyte  recruitment such as L L - 3 7  are potential targets for such  therapies. 5.5 1.  Bibliography Schuh, J . M . , K . Blease, S. L . K u n k e l , and C . M . H o g a b o a m . 2003. Chemokines and cytokines: axis and allies in asthma and allergy.  2.  Cytokine Growth Factor Rev 14:503. Curr  M a , Y . , and R . M . Pope. 2005. T h e role o f macrophages in rheumatoid arthritis.  Pharm Des 11:569. 3.  Cartier, L . , O . Hartley, M . D u b o i s - D a u p h i n , and K . H . Krause. 2005. C h e m o k i n e receptors i n the central nervous system: role in brain inflammation and neurodegenerative  Brain Res Brain Res Rev 48:16.  diseases. 4.  Rosenkilde, M . M . , and T . W . Schwartz. 2004. T h e chemokine regulator o f angiogenesis in health and disease.  5.  system ~  a major  Apmis 112:481.  Shadidi, K . R . 2004. N e w drug targets in rheumatoid arthritis: focus on chemokines.  BioDrugs 18:181. 6.  Paleolog,  7.  M e y e r , K . C . 2004. Neutrophils, myeloperoxidase, and bronchiectasis in cystic fibrosis:  arthritis.  E . 2003. T h e therapeutic potential o f T N F - a l p h a blockade in rheumatoid  Expert Opin Investig Drugs 12:1087.  green is not good. 8.  J Lab Clin Med 144:124.  Spencer, L . T . , G . Paone, P. M . K r e i n , F . N . R o u h a n i , J . R i v e r a - N i e v e s , and M . L . Brantly. 2003. T h e R o l e o f H u m a n Neutrophil Peptides in L u n g Inflammation Associated with {alpha} 1-Antitrypsin Deficiency.  9.  Am J Physiol Lung Cell Mol Physiol.  C o l e , A . M . , S. T a h k , A . O r e n , D . Y o s h i o k a , Y . H . K i m , A . Park, and T . G a n z . 2001. Determinants o f Staphylococcus aureus nasal carriage.  Clin Diagn Lab Immunol 8:1064.  91  10.  K i m , S. T . , H . E . C h a , D . Y . K i m , G . C . H a n , Y . S. C h u n g , Y . J . L e e , Y . J . H w a n g , and H.  M . Lee.  2003.  A n t i m i c r o b i a l peptide  inflammatory disease. 11.  LL-37  is  upregulated  in  chronic  nasal  Acta Otolaryngol 123:81.  Agerberth, B . , J . C h a r o , J. W e i r , B . Olsson, F . Idali, L . L i n d b o m , R . Kiessling, H . Jornvall, H . W i g z e l l , and G . H . G u d m u n d s s o n . 2000. T h e human antimicrobial and chemotactic peptides L L - 3 7 and alpha-defensins are expressed by specific and monocyte populations.  12.  lymphocyte  Blood 96:3086.  F r o h m , M . , B . Agerberth, G . A h a n g a r i , M . Stahle-Backdahl, S. L i d e n , H . W i g z e l l , and G . H . G u d m u n d s s o n . 1997. T h e expression o f the gene c o d i n g for the antibacterial peptide L L - 3 7 is induced in human keratinocytes during inflammatory disorders.  J Biol Chem  272:15258. 13.  N e l l , M . J . , G . Sandra Tjabringa, M . J . V o n k , P. S. Hiemstra, and J . J . Grote. 2004. Bacterial products  increase expression o f the human cathelicidin h C A P - 1 8 / L L - 3 7  cultured human sinus epithelial cells. 14.  in  FEMS Immunol Med Microbiol 42:225.  D a v i d s o n , D . J . , A . J . Currie, G . S. R e i d , D . M . B o w d i s h , K . L . M a c D o n a l d , R . C . M a , R . E . H a n c o c k , and D . P. Speert. 2004. T h e cationic antimicrobial peptide L L - 3 7 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization.  J Immunol  172:1146. 15.  K o c z u l l a , R . , G . v o n Degenfeld, C . Kupatt, F . K r o t z , S. Zahler, T . G l o e , K . Issbrucker, P. Unterberger, M . Z a i o u , C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . W e l s c h , P. S. Hiemstra, C . V o g e l m e i e r , R. L . G a l l o , M . Clauss, and R . Bals. 2003. A n angiogenic  role  for  the  human  peptide  antibiotic  LL-37/hCAP-18.  J Clin Invest  111:1665. 16.  Sorensen,  O . E . , J. B .  Cowland, K . Theilgaard-Monch, L . L i u , T . Ganz,  and N .  Borregaard. 2003. W o u n d healing and expression o f antimicrobial peptides/polypeptides in human keratinocytes, a consequence o f c o m m o n growth factors. 17.  J Immunol 170:5583.  H e i l b o r n , J. D . , M . F . N i l s s o n , G . Kratz, G . Weber, O . Sorensen, N . Borregaard, and M . Stahle-Backdahl. 2003. T h e cathelicidin anti-microbial peptide L L - 3 7 is involved in reepithelialization  o f human skin wounds and is lacking in chronic ulcer epithelium.  J  Invest Dermatol 120:379. 18.  Y a n g , D . , Q . C h e n , O . Chertov, and J. J. O p p e n h e i m . 2000. H u m a n neutrophil defensins  19.  Niyonsaba,  selectively chemoattract naive T and immature dendritic cells. F . , M . Hirata, H . O g a w a , and I. N a g a o k a .  J Leukoc Biol 68:9.  2003. Epithelial  cell-derived  antibacterial peptides human beta-defensins and cathelicidin: multifunctional activities on mast cells. 20.  Curr Drug Targets Inflamm Allergy 2:224.  van Wetering, S., S. P. Mannesse-Lazeroms, M . A . v a n Sterkenburg, and P. S. Hiemstra. 2002. Neutrophil defensins stimulate the release o f cytokines by airway epithelial cells: modulation by dexamethasone.  21.  Inflamm Res 51:8.  D e , Y . , Q . C h e n , A . P. Schmidt, G . M . A n d e r s o n , J . M . W a n g , J . Wooters, J . J . O p p e n h e i m , and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like chemoattract  1 ( F P R L 1 ) as a receptor to  human peripheral blood neutrophils, monocytes, and T cells. J Exp  Med  192:1069. 22.  N i y o n s a b a , F . , K . Iwabuchi, A . Someya, M . Hirata, H . M a t s u d a , H . O g a w a , and I. N a g a o k a . 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis.  23.  Immunology 106:20.  Tjabringa, G . S., J . A a r b i o u , D . K . Ninaber, J. W . Drijfhout, O . E . Sorensen,  N.  Borregaard, K . F . Rabe, and P. S. Hiemstra. 2003. T h e antimicrobial peptide L L - 3 7  92  activates innate i m m u n i t y at the airway epithelial surface epidermal growth factor receptor. 24.  b y transactivation o f the  J Immunol 171:6690.  B o w d i s h , D . M . E . , D a v i d s o n , D . J . , Speert, D . P . , H a n c o c k , R . E . W . 2004. T h e H u m a n Cationic Peptide L L - 3 7 Induces A c t i v a t i o n o f the Extracellular Signal-Regulated K i n a s e and  p38  K i n a s e Pathways  in Primary H u m a n M o n o c y t e s .  Journal of Immunology  172:3758 25.  L a u , Y . E . , A . R o z e k , M . G . Scott, D . L . G o o s n e y , D . J . D a v i d s o n , and R . E . H a n c o c k . 2005. Interaction and cellular localization o f the h u m a n host defense peptide L L - 3 7 with lung epithelial cells.  26.  Infect Immun 73:583.  Braff, M . H . , M . A . H a w k i n s , A . D . N a r d o , B . L o p e z - G a r c i a , M . D . H o w e l l , C . W o n g , K . L i n , J . E . Streib, R . Dorschner, D . Y . L e u n g , and R . L . G a l l o . 2005. Structure-Function Relationships  among  H u m a n Cathelicidin Peptides:  Properties from Host Immunostimulatory Activities. 21.  Dissociation  C h e n , C . I., S. Schaller-Bals, K . P. Paul, U . W a f i n , and R . B a l s . 2004. Beta-defensins and L L - 3 7 in bronchoalveolar lavage fluid o f patients with cystic fibrosis.  28.  o f Antimicrobial  J Immunol 174:4271.  Sallusto, F . , and A . L a n z a v e c c h i a . 1994. cultured  human  dendritic  cells  is  J Cyst Fibros 3:45.  Efficient presentation o f soluble antigen b y  maintained  by  granulocyte/macrophage  colony-  stimulating factor plus interleukin 4 and downregulated b y tumor necrosis factor alpha. J  Exp Med 179:1109. 29.  Indiveri, F . , J . Huddlestone, M . A . Pellegrino, and S. Ferrone. 1980. Isolation o f human T lymphocytes: comparison between n y l o n w o o l filtration and resetting with neuraminidase ( V C N ) and 2-aminoethylisothiouronium bromide ( A E T ) - t r e a t e d sheep red blood cells (SRBC).  30.  J Immunol Methods 34:107.  T s u c h i y a , S., M . Y a m a b e , Y . Y a m a g u c h i , Y . K o b a y a s h i , T . K o n n o , and K . Tada.  1980.  Establishment and characterization o f a human acute m o n o c y t i c leukemia cell line ( T H P -  1). Int J Cancer 26:171. 31.  Stokes, R . W . , and D . Doxsee. 1999. T h e receptor-mediated uptake, survival, replication, and drug sensitivity o f M y c o b a c t e r i u m tuberculosis within the macrophage-like cell line T H P - 1 : a comparison with human monocyte-derived macrophages.  32.  peptide antimicrobial agents. 33.  Cell Immunol 197:1.  G o u g h , M . , R . E . H a n c o c k , and N . M . K e l l y . 1996. A n t i e n d o t o x i n activity o f cationic  Infect Immun 64:4922.  F a n , J . , X . Y a n g , W . W a n g , W . H . W o o d , 3rd, K . G . B e c k e r , and M . Gorospe. 2002. G l o b a l analysis o f stress-regulated  m R N A turnover b y using c D N A arrays.  Proc Natl  Acad Sci USA 99:10611. 34.  Sengupta, S. K . , S. K . Tinter, H . Lazarus, B . L . B r o w n , and E . J. Modest. 1975. substituted actinomycin D analogs. C h e m i c a l and growth-inhibitory studies.  7-  J Med Chem  18:1175. 35.  Catalfamo, M . , T . K a r p o v a , J. M c N a l l y , S. V . Costes, S. J . Lockett, E . B o s , P. J. Peters, and P. A . Henkart. 2004. H u m a n C D 8 + T cells store R A N T E S in a unique secretory  Immunity 20:219. de novo protein Exp Cell Res 216:149.  compartment and release it rapidly after T c R stimulation. 36.  C h o w , S. C , I. Peters, and S. Orrenius. 1995. Reevaluation o f the role o f synthesis in rat thymocyte apoptosis.  37.  Shaw, G . , and R . K a m e n .  1986. A conserved A U sequence from the 3' untranslated  region o f G M - C S F m R N A mediates selective m R N A degradation. 38.  Cell 46:659.  T o r e k , A . M . , A . H . B o u t o n , and J . B . G o l d b e r g . 2005. Helicobacter pylori  induces  interleukin-8 secretion b y T o l l - l i k e receptor 2- and T o l l - l i k e receptor 5-dependent and independent pathways.  Infect Immun 73:1523.  93  39.  R e d d i , K . , S. B . Phagoo, K . D . A n d e r s o n , and D . Warburton. 2003. Burkholderia cepacia-induced I L - 8 gene expression in an alveolar epithelial cell line: signaling through C D 14 and mitogen-activated protein kinase.  40.  TLR5-mediated  activation  o f p38  posttranscriptional mechanism. 41.  MAPK  regulates  epithelial  I L - 8 expression  via  Am J Physiol Gastrointest Liver Physiol 285.G282.  H o f f m a n n , E . , O . Dittrich-Breiholz, H . H o l t m a n n , and M . Kracht. 2002. M u l t i p l e control o f interleukin-8 gene expression.  42.  Pediatr Res 54:297.  Y u , Y . , H . Z e n g , S. L y o n s , A . Carlson, D . M e r l i n , A . S. N e i s h , and A . T . Gewirtz. 2003.  JLeukoc Biol 72:847.  H o l t m a n n , H . , R . W i n z e n , P. H o l l a n d , S. Eickemeier, E . H o f f m a n n , D . W a l l a c h , N . L . M a l i n i n , J . A . C o o p e r , K . Resch, and M . Kracht.  1999.  Induction o f  interleukin-8  synthesis integrates effects on transcription and m R N A degradation from at least three different  cytokine-  or stress-activated  signal  transduction pathways.  Mol Cell Biol  19:6742. 43.  K u n s c h , C , and C . A . Rosen.  44.  Gerber, A . , A . H e i m b u r g , A . Reisenauer, A . W i l l e , T . Welte, and F . B u h l i n g . 2004.  interleukin-8 promoter.  1993.  N F - k a p p a B subunit-specific  regulation o f the  Mol Cell Biol 13:6137.  Proteasome inhibitors modulate chemokine production i n lung epithelial and monocytic cells. 45.  Eur Respir J 24:40.  K i m , Y . M . , W . R e e d , A . G . L e n z , I. Jaspers, R . Silbajoris, H . S. N i c k , and J . M . Samet. 2005. Ultrafine carbon particles induce interleukin-8 gene transcription and p38 M A P K  Am J Physiol Lung Cell Mol  activation in normal human bronchial epithelial cells.  Physiol 288.L432. 46.  W o n g , C . K . , C . B . W a n g , W . K . Ip, Y . P. T i a n , and C . W . L a m . 2005. R o l e o f p38 MAPK  and N F - k B  for chemokine  bronchial epithelial cells. 47.  release in coculture  RelB  regulation  of  chemokine  Am J Pathol 151:375.  Dejardin, E . , N . M . D r o i n , M . Delhase, E . Haas, Y . C a o , C . M a k r i s , Z . W . L i , M . K a r i n , C . F . Ware, and D . R . Green. 2002. T h e lymphotoxin-beta receptor induces patterns o f gene expression v i a two N F - k a p p a B pathways.  49.  and  Clin Exp Immunol 139:90.  X i a , Y . , M . E . Pauza, L . F e n g , and D . L o . 1997. expression modulates local inflammation.  48.  o f human eosinophils  Hollenbach, E . , M . Vieth,  A . Roessner,  different  Immunity 17:525.  M . Neumann,  P.  Malfertheiner, and M .  N a u m a n n . 2005. Inhibition o f R I C K / n u c l e a r factor-kappaB and p38 signaling attenuates the inflammatory response in a murine model o f C r o h n disease. 50.  J Biol Chem 280:14981.  Das, S., J. C h o , I. Lambertz, M . A . Kelliher, A . G . E l i o p o u l o s , K . D u , and P. N . Tsichlis. 2005. T p l 2 / C o t signals activate E R K , I N K and N F - k a p p a B in a cell type and stimulusspecific manner.  51.  J Biol Chem.  Barker, C . L . , M . T . M c H a l e , A . K . Gillies, J. W a l l e r , D . M . Pearce, J. Osborne, P. E . Hutchinson, G . M . Smith, and J . H . Pringle. 2004. T h e development and characterization o f an in vitro m o d e l o f psoriasis.  52.  J Invest Dermatol 123:892.  N o m u r a , I., E . G o l e v a , M . D . H o w e l l , Q . A . H a m i d , P. Y . O n g , C . F . H a l l , M . A . Darst, B . G a o , M . B o g u n i e w i c z , J. B . Travers, and D . Y . L e u n g . 2003. C y t o k i n e milieu o f atopic dermatitis, as compared to psoriasis, skin prevents induction o f innate immune response genes.  53.  J Immunol 171:3262.  C a s i l l i , F . , A . B i a n c h i n i , I. G l o a g u e n , L . B i o r d i , E . A l e s s e , C . Festuccia, B . Cavalieri, R . Strippoli, M . N . Cervellera, R . D i Bitondo, E . Ferretti, F . M a i n i e r o , C . B i z z a r r i , F . Colotta, and R . Bertini. 2005. Inhibition o f interleukin-8 ( C X C L 8 / I L - 8 ) responses b y repertaxin, a new inhibitor o f the chemokine receptors C X C R 1 and C X C R 2 .  Biochem  Pharmacol 69:385. 94  6.0 Discussion - The Primary Role of LL-37 In Vivo May Be Immunomodulatory  8  6.0  DISCUSSION - T H E P R I M A R Y R O L E O F LL-37 IN VIVO M A Y B E IMMUNOMODULATORY 6.1  E A R L Y E V I D E N C E THAT H O S T D E F E N C E PEPTIDES M I G H T H A V E I M M U N O M O D U L A T O R Y FUNCTIONS  6.2  T H E A N T I B A C T E R I A L A N D I M M U N O M O D U L A T O R Y PROPERTIES OF L L - 3 7 A R E P H Y S I O L O G I C A L L Y  6.3 6.4 6.5 6.6 6.7 6.8  5  95 96  DISTINCT 99 INTERACTIONS B E T W E E N L L - 3 7 A N D E U K A R Y O T I C C E L L S 100 L L - 3 7 INTERACTIONS W I T H T H E EFFECTOR C E L L S OF T H E I M M U N E RESPONSE A R E SPECIFIC B U T N O T N E C E S S A R I L Y RECEPTOR M E D I A T E D 101 C H E M O T A X I S , L E U K O C Y T E INFILTRATION A N D L L - 3 7 105 SYNERGISTIC INTERACTIONS B E T W E E N L L - 3 7 A N D C O M P O N E N T S OF T H E I N F L A M M A T O R Y M I L E U 107 F U T U R E DIRECTIONS - T H E R O L E OF L L - 3 7 IN H E A L T H & DISEASE A N D ITS POTENTIAL AS A N O V E L THERAPEUTIC A G E N T 109 BIBLIOGRAPHY 110  Figure 6.1  is supplemental  Hancock, R . E . W . ,  data submitted for publication i n L a u , Y . E . , B o w d i s h , D . M . E . ,  D a v i d s o n , D . J . 2005. A p o p t o s i s  sensitive induction b y the cathelicidin L L - 3 7 .  o f airway epithelial  cells: human serum  Submitted. 95  6.1  Early Evidence that Host Defence Peptides Might Have Immunomodulatory Functions W h e n I began m y degree in September 2000, the number o f published reports on the  immunomodulatory properties o f L L - 3 7 was m i n i m a l . T h e r e was one report that L L - 3 7 was a chemoattractant for monocytes,  neutrophils and T cells (1)  and one  report that increased  expression o f L L - 3 7 c o u l d protect mice against bacterial or L P S induced shock (2). Preliminary unpublished data from our laboratory suggested that L L - 3 7 had anti-endotoxin properties, w h i c h might be not be completely explained by L L - 3 7 ' s ability to b i n d and neutralise L P S . M o r e o v e r , L L - 3 7 c o u l d induce chemokine production from the mouse macrophage cell line, R A W 264.7, [later published in (3)]. immunomodulatory  There were  properties  such  scattered reports that other host defence  peptides had  as  (4),  the  ability  to  activate  complement  promote  chemotaxis (5) and alter cell signalling (6) but the emphasis in the published literature was clearly on the antimicrobial properties o f these peptides. In fact in 2000 published reports on the antimicrobial functions o f these peptides were approximately 10-fold more prevalent than papers on their immunomodulatory properties. T h e emphasis i n the published literature changed slightly u p o n the discovery that the Pdefensins bound to a receptor on immature dendritic cells and T cells and that this receptor was linked to chemotaxis (7). T h i s receptor was identified as C C R 6 , whose k n o w n ligand was the chemokine L A R C / M I P - 3 a charged, or have regions properties and thus  (8).  Chemokines and host defence  o f h i g h positive  it was  peptides  are both  charge and have antimicrobial and  suggested that certain defensins  were  positively  chemotactic  evolutionarily related to  chemokines (9-11). T h i s contributed to the enticing hypothesis that the chemotactic properties o f these peptides c o u l d be explained in part b y their evolutionary and structural relatedness chemokines (12).  It followed that host defence  to  peptides might have a broader role in host  defence, however it was difficult to determine i f this was p h y s i o l o g i c a l l y relevant due to the high concentrations required for chemotaxis. T h e discovery o f a receptor for some o f these peptides also indicated that interactions between host defence peptides and eukaryotic cells might not s i m p l y be a result o f interactions with membranes. These peptides eukaryote m o d e l hypothesis  that  have been demonstrated to interact with both prokaryote and  membranes the  high  [reviewed  in (13)]  concentrations  of  and in 2000 the  LL-37  and  other  literature favoured the host  peptides  used  in  immunomodulatory studies were sufficient to induce cytotoxicity and thus that the observed  96  immunomodulatory effects o f these peptides might be a secondary response to this cytotoxicity. I and others have demonstrated that at the concentrations used in these studies, L L - 3 7 was not cytotoxic [Chapter 2, Figure 2.1; Chapter 3, Figure 3.6]. A n o t h e r c o m m o n criticism o f research on the immunomodulatory properties o f L L - 3 7 was that the concentrations o f peptides used in in  vitro studies  are higher than w o u l d be expected to be found  in vivo. A l t h o u g h  very little was  k n o w n about the concentrations o f this peptide at the time this thesis w o r k began, it is n o w k n o w n that the concentrations o f L L - 3 7 found at sites o f infection and inflammation are within the range o f concentrations used in this thesis (Table 6.1).  97  Table 6.1. Concentrations of hCAP-18/LL-37 in health and disease. Form  B o d y Site  Lungs  Concentration  Concentration  in H e a l t h  in Disease  (pg/ml)  (pg/ml)  2.5 - 20  2.5-30  (14-16)  +/-  +++  (17)  1.2  *  (18)  +  ++  (19-21)  42 - 143  *  (22)  +/-  1300  (23)  12-40  *  (24)  +++  +/-  (25)  140  *  (26)  Produced b y  hCAP-18/  Neutrophils,  LL-37 /  epithelia,  alternatively  submucosal  processed  glands, alveolar  forms  macrophages  3  Epithelia, mucosal glands,  LL-37  Nasal fluid  References  4  leukocytes hCAP-18/ alternatively  Mouth  ?  hCAP-18  B l o o d / Plasma  processed  Salivary glands, infiltration o f leukocytes  forms / L L - 3 7 Semen  hCAP-18  Skin  LL-37  1  6  epithelium o f the epididymis Keratinocytes / infiltrating leukocytes  Female reproductive  hCAP-18/  Deposited in  ALL-38  ejaculatory fluid  tract  2  Gastro-  hCAP-18/  intestinal tract  LL-37  Breastmilk  LL-37  Epithelial cells or Infiltrating  5  leukocytes Ductule cells, leukocytes?  * A s s a y not done. 1  A post-translationally modified form o f h C A P - 1 8 was also observed but not characterised.  2  A L L - 3 8 is an alternatively process form only detectable after sexual intercourse.  3  Western blot shown detected both h C A P - 1 8 & L L - 3 7 as w e l l as uncharacterised bands o f  intermediate size(16). 4  T h e transcript for h C A P - 1 8 and immunostaining for L L - 3 7 was found at l o w levels in some o f  the healthy controls and was found at high levels for most o f the patients with nasal inflammatory disease 5  In healthy tissue h C A P - 1 8 / L L - 3 7 is expressed primarily in epithelial cells, in diseased tissues it  is found primarily in infiltrating leukocytes 6  Expression o f h C A P - 1 8 was increased at the transcript level in patients with chronic  sialadenitis (21). Since  2000,  multiple mouse  knockouts  that  are deficient  in host defence  peptide  expression have demonstrated that reduced expression o f these peptides results in a reduced ability to clear infection and increased bacterial counts (27, 28). Consistent with this, mice that overexpress host defence peptides are resistant to infection and carry lower bacterial numbers  98  (29). A t first blush this might appear to indicate that the expression o f host defence peptides can result in direct bacterial k i l l i n g . H o w e v e r , these experiments do not distinguish between direct and indirect bacterial k i l l i n g . I and others have hypothesised that the perceived reduction in microbial counts in  in vivo  experiments might be due, at least in part, to the immunomodulatory  properties o f these peptides. evidence  suggests  that  T h i s perspective  LL-37  immunomodulatory properties apparent when  and  other  is gaining support as an increasing body host  defence  in vitro and in vivo. T h i s  examining the shift  in the focus  peptides  have  a  of  variety  of  change in perspective is particularly  o f published reports on the antimicrobial  properties o f host defence peptides. In 2005 almost an equal number o f reports addressed the antimicrobial activity versus the immunomodulatory properties o f host defence peptides. B e l o w I discuss  the  accumulating  evidence  for  my  hypothesis  that  LL-37  is  primarily  an  immunomodulatory agent.  6.2  The Antibacterial and Immunomodulatory Properties of LL-37 are Physiologically Distinct Increasing evidence suggests that a primary role o f various cationic host defence peptides  in vivo  may be to modulate or prime the immune response. W h i l e there is no doubt that under  some circumstances these peptides have antimicrobial activity  in vivo,  for example at the m g / m l  concentrations at w h i c h a-defensins are found in the lysosomes o f neutrophils, this may not be the case for other host defence peptides such as L L - 3 7 or at other b o d y locations such as at mucosal surfaces. Neutrophils are major contributors to antibacterial defences and are expected to be major sources o f host defence peptides. T h e unprocessed form o f h C A P - 1 8 is found at extremely high concentrations in the granules o f neutrophils (-630  u.g per 10  9  cells) and the  processed form, L L - 3 7 is expected to be found at high concentrations at sites o f neutrophil degranulation since neutrophils release both h C A P - 1 8 and proteinase 3, the enzyme that cleaves the peptide to its active form (18, 30). Thus it is possible that antimicrobial activity at sites o f neutrophil degranulation might be attributable in part to the presence o f L L - 3 7 . It is not clear, however, whether antimicrobial activity is a general property o f this peptide at mucosal surfaces where it is produced by epithelial cells and is constitutively found at lower  concentrations.  A l t h o u g h there are certain body fluids in w h i c h innate antimicrobial activity is attributed, at least in  part, to  the  presence  of LL-37  (e.g.  bronchoalveolar lavage  sarcoidosis (16)) oftentimes the antimicrobial activity o f L L - 3 7  fluid  in vivo has  from patients  with  been inferred from  the correlation o f h i g h concentrations o f the peptide with the absence o f bacterial infection. In psoriasis, for example, h C A P - 1 8 / L L - 3 7  has been demonstrated to be present at extremely high 99  concentrations (23, 31). Patients with psoriasis rarely have skin infections whereas patients with atopic dermatitis, a disease in w h i c h h C A P - 1 8 / L L - 3 7 expression is generally not detectable, are frequently colonised with  S. aureus  (23). A l t h o u g h there m a y be a correlation between high  concentrations o f L L - 3 7 and reduced bacterial numbers this does not necessarily mean that L L 37 kills bacteria directly. T h e possibility has not been thoroughly investigated as to whether L L 37 and other host defence  peptides might reduce bacterial numbers through modulation or  enhancement o f the i m m u n e response, for example b y recruiting neutrophils or other effector cells o f the innate immune response. T h e assumption that h i g h levels o f host defence  peptides  lead to reductions in bacterial numbers does not h o l d up in other biological situations, such as in the lungs o f cystic fibrosis patients. These patients have elevated concentrations o f L L - 3 7 in the bronchoalveolar lavage when compared to healthy controls but are chronically colonised with pathogens such as  P. aeruginosa  (15).  Care must also be taken to distinguish between the  presence o f the antimicrobially inactive unprocessed form o f the peptide, h C A P - 1 8 and the processed form, L L - 3 7 , w h i c h has the antimicrobial activity. In certain body fluids the presence o f h C A P - 1 8 is h i g h (up to 120 ug/ml) but no antibacterial activity is detected (22, 25). A l t h o u g h it is not clear i f h C A P - 1 8 functions as an immunomodulatory agent, it is presumed to be an important component o f host defence  as it is constitutively  expressed  i n lymphocytes and  macrophages, is produced at mucosal surfaces b y epithelial cells, is up-regulated in response to infection and inflammation, and is released upon degranulation o f neutrophils (32-37). In  contrast to studies on the antimicrobial properties o f L L - 3 7 , the studies on the  immunomodulatory properties o f the peptide are performed i n standard tissue culture m e d i u m that has physiological concentrations o f salts. A s previously stated, the antibacterial activity o f L L - 3 7 is ablated in physiological concentrations o f salt while the immunomodulatory properties remain  intact. A l t h o u g h it is obviously quite difficult to  separate  the immunomodulatory  functions o f this peptide from its antimicrobial functions in vivo, it is fairly easy to distinguish the differences in these properties  in vitro.  T h e culture conditions used in this thesis did not  support the antibacterial activity o f this peptide [Chapter 1, Figure 1.2] but did m i m i c ionic conditions  in vivo and  thus are an acceptable m o d e l in w h i c h to study the non-antimicrobial  functions o f L L - 3 7 and its interactions with host cells. 6.3  Interactions B e t w e e n L L - 3 7 a n d E u k a r y o t i c C e l l s Due  to the amphipathic properties o f some host defence  peptides, their affinity for  membrane binding and their membrane disrupting effects at h i g h concentrations  for both  prokaryote and eukaryote m o d e l membranes (38, 39) it was initially believed that many o f the 100  observed immunomodulatory properties might be a result o f membrane stress and thus nonspecific.  There  are  not  many  examples  in  the  literature  of  host  defence  peptide-like  immunomodulatory properties resulting from non-specific membrane disruption such as the induction  o f cytokine  production (40).  T h e perceived  cytotoxicity  o f these peptides  for  eukaryotic cells m a y be an artifact o f performing these assays i n l o w ionic strength buffer, or in the absence o f serum, as the presence o f serum abrogates the cytotoxic effect in a number o f different cell types (41-43). T h e experiments in this thesis were performed in standard tissue culture media using 10 % foetal c a l f serum, conditions under w h i c h I demonstrated that L L - 3 7 was not cytotoxic for the cells used in these studies [Chapter 2, Figure 2.1, Chapter 3, Figure 3.6].  I also demonstrated that peptide-induced I L - 8 production was  not a consequence  of  cytotoxicity, as the cytotoxic peptide C P 2 9 did not induce I L - 8 production [Chapter 3, Figure 3.6]. Because o f these and analogous observations, the current consensus in the literature is that these peptides  are not merely non-specific membrane disrupting agents. T h i s  change  occurred due to published reports indicating that the immunomodulatory properties o f host defence peptides are not non-specific, but rather result from specific interaction with certain subsets o f the cells o f the innate and adaptive immune response, as w e l l as epithelial cells, keratinocytes and cells o f the reproductive tract (1, 2 2 , 41, 44). I demonstrated here that L L - 3 7 induced activation o f the M A P K in monocytes and epithelial cells but not B or T cells [Chapter 3, Figure 3.3], and this observation implied that there was specificity in responses to exposure to LL-37.  T h e directed nature o f these responses indicates that there m a y even be a receptor or  receptors for L L - 3 7 that is linked to the immunomodulatory properties o f this peptide. 6.4  LL-37  Interactions With the Effector Cells of the Immune Response Are Specific But  Not Necessarily Receptor Mediated To  date  there  have  been  a number o f receptors  associated  with  immunomodulation including formyl peptide receptor like-1 ( F P R L - 1 ) , P 2 X 7 ,  LL-37  induced  epidermal growth  factor receptor ( E G F R ) , and as yet unidentified high and low affinity receptors (1, 45, 46). T w o o f these putative receptors, P 2 X  7  and E G F R are not proposed to be direct receptors for L L - 3 7 .  F o r example, although L L - 3 7 mediated I L - i p processing can be b l o c k e d b y inhibitors o f the P 2 X 7 receptor, other effects such as an increase in membrane permeability and size and shape changes cannot be inhibited. T h e authors o f this study propose that L L - 3 7 induces an upstream activation event that results in activation o f P 2 X 7 and appears to be independent o f other identified receptors (47). T h i s upstream event must occur very rapidly, as altered membrane 101  permeability is observed in as little as one minute after L L - 3 7 stimulation. Similarly it is not proposed that L L - 3 7 binds E G F R directly, but rather that it induces cleavage o f surface bound metalloproteases in an undefined fashion, the result o f w h i c h is transactivation o f E G F R  (46).  Inhibitors o f E G F R associated tyrosine kinases b l o c k L L - 3 7 induced I L - 8 production in airway epithelial cells and partially inhibit I L - 8 production f r o m . keratinocytes (44, 46). Interestingly the positively charged L P S binding lipopeptide, p o l y m y x i n B , also interacts with P 2 X (48) and 7  enhances E G F R mediated endocytosis (49), indicating that these receptors m a y have a general affinity for small positively charged peptides. T o date the only receptor to w h i c h L L - 3 7 has been proposed to b i n d directly is the pertussis-toxin-sensitive,  G-protein coupled receptor F P R L - 1 (1). T h i s receptor is a G-protein  coupled receptor w h i c h can be inhibited by treatment with pertussis toxin. L L - 3 7  mediated  chemotaxis can be inhibited either by an agonist o f this receptor or b y pertussis toxin. Further complicating this story is the observation that I L - 8 production i n keratinocytes and mast cell chemotaxis is reduced but not abolished upon treatment with pertussis toxin, indicating that these events are linked to a Gi-protein coupled receptor, although this receptor cannot be F P R L - 1 , as agonists for F P R L - 1 do not have the same effects (44-46).  H o w e v e r , other L L - 3 7 mediated  effects such as M A P kinase activation and I L - 8 production in monocytes are not pertussis-toxinsensitive,  indicating that L L - 3 7 may mediate these events through other receptors or other  mechanisms o f action (41). These contradictory and sometimes conflicting reports suggest that L L - 3 7 , and possibly other host defence  peptides, m a y not actually work through a conventional ligand-receptor  interaction. F o r example, host defence  peptides have often been compared to  chemokines;  however, unlike the majority o f chemokines, L L - 3 7 has cross-species reactivity. Whereas chemokines have greatly reduced or abolished activity across species (50),  most  L L - 3 7 has been  shown to exert its immunomodulatory effects on cells from a wide range o f species including rat (45, 51), mouse (3, 52), rabbit (53), and humans (54). A l t h o u g h this does not eliminate the possibility o f a non-specific  receptor, it is an unusual phenomenon w h i c h requires more  investigation. A recent observation that L L - 3 7 synthesised with D - a m i n o acids ( D - L L - 3 7 ) is a more potent inducer o f I L - 8 production b y keratinocytes than is the conventionally synthesised L - f o r m raises  some  interesting  questions  concerning whether  LL-37  has  a conventional  receptor.  Similarly the L - and D - forms induced membrane permeability in a dose dependant manner, although the D - L L - 3 7 induces m a x i m a l permeability at a lower concentration (44). Thus the 102  authors of this study propose that LL-37 and D-LL-37 may interact with membranes rather than with a conventional receptor. Although many receptors do not recognise ligands made from Damino acids, it has been proposed that receptors that bind a wide range of proteins and peptides such as the signalling protein calmodulin and the major histocompatibilty complex (MHC), might also be able to bind to peptides composed of D-amino acids (55, 56). Consistent with this it has been found that these receptors recognise lower-order structural properties of their ligands, specifically regions of segmental or helical amphipathicity. LL-37 is an alpha-helical peptide with such regions of amphipathicity and thus might interact with a promiscuous binding protein. Interesting differences exist between LL-37 mediated signalling events in epithelial cells and monocytes, and these differences are substantial enough to indicate that LL-37 may have a different receptor or interaction with these two cell types. In monocytes LL-37 does not activate either the ERK1/2 or p38 kinases with the resultant production of IL-8 unless there is serum present (41). In experiments performed in epithelial cells the presence of serum is not a requirement for M A P K activation or IL-8 production (41, 46). The type of serum also has profound effects on LL-37 interactions with epithelial cells. In the presence of 10% human serum in the culture medium IL-8 production is abolished in an airway epithelial cell line (43) but this did not occur in a monocyte cell line (Figure 6.1).  Figure 6.1. The effect of human serum on IL-8 production from THP-1 cells. THP-1  1400 1200  — 1000 E  LL-37  (pg/ml)  cells were cultured as previously described. Cells were stimulated with LL-37 for 4 hr in the presence of either 10% human serum (HS) or 10% foetal calf serum (FCS) in the culture medium. IL-8 was produced in a dose dependant manner in the presence of both HS and FCS. Bars are the average of three independent experiments ± standard deviation from the mean. A single asterisk indicates p<0.004, double asterisk indicates p<0.0008.  The observation that airway epithelial cells do not appear to require a serum component to respond to LL-37 is biologically relevant. The lung is an opsonin poor environment in which serum components are not present unless there is a serious breach in the integrity of the epithelial barrier. Thus LL-37 induced signalling in pulmonary epithelial cells would be expected to occur independent of serum proteins. The high rate of LL-37 induced cytotoxicity and apoptosis which occurs in these cell types under serum free conditions is abrogated by the presence of HDLs (43). Consistent with this, HDLs are present in the lung and play an important role in modulating the 103  inflammatory  response  in  response  to  infection  (57-59).  In  a  manuscript  prepared  in  collaboration, although we d i d not formally demonstrate that exogenous H D L s were inhibitory to cytotoxicity  and  that  the  presence  of H D L s  i n serum  reduced  I L - 8 production, it  was  demonstrated that the presence o f human serum, in w h i c h the concentration o f H D L s is high, abrogated I L - 8 production (43).  Thus, the presence o f other L L - 3 7 b i n d i n g components such as  lipoproteins m a y thus be crucial to the  in vivo  biological functions o f this peptide.  In other b i o l o g i c a l contexts the presence o f serum m a y be important for L L - 3 7 signalling. It has been demonstrated that h C A P - 1 8 is predominantly b o u n d to l o w density lipoprotein and/or very low density lipoprotein particles in human serum (60) whereas L L - 3 7 binds predominantly to apolipoprotein A - l , a component o f H D L in human serum (61). A l t h o u g h a p o l i p o p r o t e i n - A l blocks the antimicrobial and cytotoxic properties o f the peptide, it is not k n o w n i f this binding alters  its immunomodulatory properties such as activation o f signalling pathways  and the  induction o f I L - 8 production. L L - 3 7 may bind to and interact with epithelial cells with relatively high affinity; however, binding to monocytes requires the presence o f lipoproteins w h i c h w o u l d bind many L L - 3 7 molecules and thus result in a h i g h avidity interaction between bound L L - 3 7 and other types o f receptors such as the scavenger receptors. A n y m o d e l that suggests that there is a specific receptor for L L - 3 7 must account for the transient membrane permeabilization observed after L L - 3 7 treatment o f some cell types. In a L P S - p r i m e d monocyte-like cell line, L L - 3 7 causes a transient increase in lactate (LDH)  release, a marker for cell permeability (47)  dehydrogenase  and this release cannot be blocked b y  inhibitors o f the P 2 X 7 receptor, indicating that it is independent o f activation o f this receptor. These increases  in membrane permeability correlate with L L - 3 7 induced increases  in  IL-ip  processing (47).  In keratinocytes there is no observed increase in L D H release, however there is  evidence that some increase in membrane permeability occurs as p r o p i d i u m iodine incorporation occurs in a dose dependent manner (44). release b y these cells.  T h i s membrane permeability correlates with I L - 8  M e m b r a n e permeabilization m a y be an essential  component  o f the  mechanism o f action o f L L - 3 7 , as it has been demonstrated that L L - 3 7 must enter epithelial cells for I L - 8 production to occur (62). T h e evidence linking the i m m u n o m o d u l a t o r y properties o f L L 37 with transient increases in membrane permeability, as a potential mechanism o f action, is currently weak. It is also difficult to reconcile this mode o f action with cell specificity, however, this observation has the potential to provide a unifying link between the observed activation o f a number  o f different  receptors  and signalling  pathways,  and to  explain  the  cross-species  interaction o f the peptides 104  6.5  Chemotaxis, Leukocyte Infiltration and  LL-37  One o f the conserved properties o f cathelicidins from a number o f species is the ability to induce chemotaxis and it is believed that the increased expression o f cathelicidins during the course o f infection and inflammation m a y play a role in leukocyte recruitment (63-65). In some situations increased concentrations o f L L - 3 7 correlate with disruption o f the integrity o f the epithelial barrier and as such m a y contribute to the pathology o f disease (43, 66). In cystic fibrosis, the increased concentration o f L L - 3 7  in the lung correlates with severity o f lung  dysfunction (15). It is fairly well established that some o f the lung damage in cystic fibrosis and other lung diseases is due to the accumulation o f neutrophils and the subsequent release o f proteolytic neutrophil components [reviewed in (67, 68)]. Since exogenous expression o f L L - 3 7 in both a xenograft m o d e l o f the C F lung, and in tissue culture systems, has been demonstrated to increase bacterial k i l l i n g o f  P. aeruginosa,  it has been proposed that this peptide m a y be a useful  therapeutic treatment for the chronic lung infections in C F (2, 69). H o w e v e r , these models did not ascertain whether neutrophil accumulation w o u l d occur in response to increased levels o f L L - 3 7 , and i f this were to occur whether lung dysfunction w o u l d be exacerbated. Elucidating the time at w h i c h L L - 3 7 is produced and its role in the recruitment o f leukocytes w i l l be important in order to understand the role o f this peptide in disease. Increased concentrations o f the neutrophil-derived peptides L L - 3 7 and the a-defensins during the course o f infections infiltrating leukocytes  or chronic inflammation correlate with increased levels o f  including granulocytes  and mononuclear cells (15,  70)  and correlate  especially w e l l with concentrations o f neutrophils, neutrophil markers and neutrophil specific chemokines (15,  17, 71-74). D u r i n g the course o f infection or inflammation, epithelial cells  produce h C A P - 1 8 / L L - 3 7 , the latter o f w h i c h has been demonstrated to be a chemoattractant for neutrophils and other cells. A l t h o u g h it is possible that this initial production o f L L - 3 7 by epithelial cells (75), and possibly b y other resident cells, results i n infiltration o f (Figure  6.2A),  this  model  is problematic due to the  fact  that  LL-37  is  leukocytes  a much  weaker  chemoattractant than conventional chemokines. T h e correlation o f L L - 3 7 expression with the influx o f neutrophils implies that elevated concentrations o f L L - 3 7 might result from release by incoming neutrophils. In this scenario, neutrophils and other cells w o u l d arrive at the site o f infection or inflammation due to the elevated concentrations o f chemokines, and the resulting neutrophil degranulation w o u l d result in increased levels o f L L - 3 7 (Figure 6.2B).  105  Infectious or Pro-inflammatory stimuli B  A  Infectious or Pro-inflammatory stimuli C  Infectious or Pro-inflammatory stimuli  Epithelium  © © LL-37 Leukocyte Infiltration  Circulating cells  © • <@  ® (J),  Figure 6.2. Three models illustrating the role of LL-37 in leukocyte infiltration. A) Elevated levels of LL-37 due to inducible expression in response to pro-inflammatory or infectious agents lead to chemotaxis of leukocytes. B) Infectious or pro-inflammatory stimuli lead to production of chemokines which recruit leukocytes to the site of infection. LL-37 is deposited at sites of infection by degranulation of neutrophils. C) Leukocytes are recruited to the site of infection due to increased chemokine production. LL-37 is produced by epithelial cells and is released by incoming neutrophils. As monocytes and other precursor cells arrive at sites with elevated concentrations of LL-37 they produce chemokines resulting in increased leukocyte infiltration. By collating what is currently known about LL-37 expression in the early stages of infection and accounting for the observed chemokine inducing properties of this peptide described in this thesis, it is possible to expand on these models. At the initial stages of infection, elevated levels of LL-37 would occur as a result of stimulation of epithelial cells with either bacterial components or with pro-inflammatory stimuli (33, 75), or by release from cells such as incoming neutrophils or resident macrophages. LL-37 induces IL-8 production from epithelial cells, thus initiating the recruitment of neutrophils (46, 62). IL-8 induces neutrophils to release adefensins and may also be involved in release of LL-37 (71). If an infection is not resolved in minutes to hours a second wave of cells including monocytes will be conscripted to the site of infection (76). In this scenario monocytes would be arriving at sites containing high concentrations of LL-37 and other cytokines. Upon exposure to LL-37, peripheral-blood-derived monocytes produce chemokines such as IL-8, MCP-1, MCP-3, MlP-la and MIP-ip in a matter of minutes in a MAP kinase dependent manner [Chapter 5, Figure 5.1, (41)]. Production of these chemokines would result in the further recruitment of neutrophils, monocytes and macrophages. Consistent with this hypothesis, mononuclear cells are found at sites of high LL-37 concentration in the lung (15). Thus when the first line response is insufficient, LL-37-activated monocytes are induced to produce chemokines that will lead to the recruitment of important immune response effector cells to assist in the resolution of infection (Figure 6.2C). Although there is evidence to 106  support this hypothesis in the lungs, it is important to note that i n other experimental models the administration o f exogeneous L L - 3 7 does not appear to lead to the infdtration o f leukocytes (53). However, as the supporting experiments were done in rabbits, it is unclear whether this is because the chemotactic properties o f L L - 3 7 are specific to human cells or whether induced leukocyte recruitment  in vivo  LL-37-  does not occur in all tissue types.  T h e data presented within this thesis is consistent with the hypothesis that the L L - 3 7 induced production o f chemokines results in increased recruitment o f the effector cells o f the innate immune response. A l t h o u g h L L - 3 7 and other host defence peptides are generally thought o f as "anti-inflammatory" since they inhibit the production o f T N F - a and other pro-inflammatory cytokines [Chapter 2, Figure 2.2, (77-79)], it is difficult to reconcile this characterization with the observed influx o f leukocytes  w h i c h is one o f the hallmarks o f the inflammatory response.  Indeed, it has been demonstrated that increases in L L - 3 7 and the a-defensins during the course o f lung infections occurs in parallel with increased production o f the peptides in the bone marrow and elevated concentrations i n the plasma, indicating that localized infections can be mirrored by a systemic enhancement o f innate immunity (71). I believe that the data from the  expression  of  host  defence  peptides  in human  disease  and  in vivo  in vitro  studies o f  studies  of  the  immunomodulatory properties o f these peptides indicate that they are more accurately described as initiators o f a localised recruitment o f the effector cells o f the innate immune response and a constitutive component o f immune surveillance.  6.6  Synergistic Interactions Between LL-37 and Components of the Inflammatory Mileu A major criticism o f host defence peptide research is that m a n y o f the antimicrobial and  immunomodulatory effects observed are only induced b y concentrations o f peptides that are higher than w o u l d be expected  in vivo,  or that w o u l d only be expected to occur at sites o f severe,  chronic inflammation. Determining the exact concentrations  o f cationic peptides  in vivo  is  technically difficult (80). W i t h this caveat, L L - 3 7 can be detected at concentrations o f 1 \xM (~5 Ug/ml) in the bronchoalveolar lavage fluid o f healthy infants (14),  and its concentration is  increased by 2- to 3- fold in the bronchoalveolar lavage fluid from infants with either systemic or pulmonary inflammation (14). However, accurately assessing the dilution factor for the airway surface liquid, w h i c h has an estimated depth o f only 1 ul per c m o f tissue (81), and accounting 2  for any secretory response stimulated during the lavage procedure means that bronchoalveolar lavage estimations probably have low accuracy. A l s o this method measures the average increase in peptide concentration across a wide surface area and any localized increases, w h i c h could be m u c h greater than are currently estimated, w o u l d be missed. T h u s it seems possible that under 107  some physiological conditions the concentrations o f host defence peptides, and specifically the concentrations o f L L - 3 7 , might be quite high at localized sites o f infection. D u r i n g the course o f infection or inflammation, increased concentrations o f L L - 3 7 w o u l d form in the lung as a result o f both release o f the peptide b y neutrophils and  de novo  production  by epithelial cells. H o w e v e r , many other cytokines and inflammatory mediators w o u l d also be present  and the  involvement  o f these  other  inflammatory mediators  immunomodulation has not been fully assessed. T o date, peptides  and components  o f the  synergies  in  peptide-mediated  between host  inflammatory m i l i e u , i n c l u d i n g larger proteins  defence such  as  lactoferrin, lysozyme, elastase, and S L P I , have only been tested with regards to antimicrobial activity (37, naturally  be  82,  83).  present  H o w e v e r , synergies in  the  course  of  between host defence infection  have  not  components  been  which would  investigated  for  other  immunomodulatory activities. I have demonstrated that L L - 3 7 induces activation o f the M A P kinases, E R K 1 / 2 and p38, in peripheral b l o o d derived monocytes at high concentrations o f L L - 3 7 (50 pg/ml). Interestingly the presence o f granulocyte macrophage colony stimulating factor ( G M - C S F ) both increased the magnitude o f this activation and decreased, to between 5-10 u g / m l , the threshold amount o f L L 37 required to induce activation [Chapter 3, Figure 3.5, (41)]. T h i s synergy was found to be specific to G M - C S F as the structurally related polypeptides I L - 4 and M - C S F d i d not have the same ability to enhance L L - 3 7 induced signalling. In studies performed b y D a v i d s o n et al (84) in collaboration with me, D C s were exposed to both G M - C S F and L L - 3 7 . Statistically significant changes in both the size and surface complexity o f the cells and o f C D 18, and C D 1 l b expression were observed at 5 u g / m l o f L L - 3 7 and it seems likely that this was due i n part to the synergistic interaction between L L - 3 7 and G M - C S F (84). G M - C S F is a cytokine that is produced b y macrophages and T lymphocytes (85), and is also produced b y lung epithelial cell lines in response to pro-inflammatory cytokines or exposure to bacteria (86, 87). G M - C S F promotes the survival, proliferation, differentiation, and activation o f haematopoietic cells, predominantly in the macrophage and neutrophil lineages (85). G M - C S F has a number o f other immunomodulatory properties including the enhancement o f antigen presentation,  promotion  of  phagocytosis  and  antibody-dependent  killing,  induction  of  chemotaxis, and induction o f the release o f reactive oxygen intermediates and histamines, (8891). G M - C S F is k n o w n to work synergistically with other cytokines. F o r example, the addition o f G M - C S F with I L - 1 0 leads to increased expression the chemokine receptor C C R 1 (92). In bronchial epithelial cells, G M - C S F is produced upon stimulation with T o l l - l i k e receptor 108  agonists and pro-inflammatory cytokines (86, 93, 94). Thus I propose (Figure 6.3) that stimulation by pro-inflammatory components would result in GM-CSF production at local infection sites, the presence of which would serve to magnify the local immunomodulatory effects of LL-37. Incoming monocytes and pre-dendritic cells would then be attracted to sites containing higher concentrations of LL-37 and GM-CSF and which would modulate their function and/or differentiation. LUMEN  Pro-inflammatory Stimuli  precursor cells  Figure 6.3. The influence of the cytokine milieu on LL-37 responses. Circulating effector cells of innate and adaptive immunity arrive at sites of high LL-37 concentration. LL-37, produced by epithelial cells and neutrophils at sites of infection and inflammation, modulates the differentiation of iDC from precursor cells. These LL-37-derived second-line DCs have altered phenotypes with increased antigen capture capacity and promote a more robust Thl response. Synergy between GM-CSF and LL-37 may be important in this process. Adapted with permission f artwork by D. J. Davidson. rom  J  I believe that the modest levels of LL-37 found at a variety of sites throughout the body (14, 18) may not be sufficient to initiate all of the immunomodulatory events ascribed to this molecule. However in the presence of a secondary signal such as GM-CSF, the threshold for immunomodulation would be decreased. There are many precedents in the adaptive immune response for the requirement of secondary signals (95, 96). These observations highlight the inadequacy of studying the properties of these peptides in isolation, and highlight the possibility that combinations of cytokines, chemokines or inflammatory mediators may enhance or alter the immunomodulatory properties of these peptides. 6.7  Future Directions - The Role of LL-37 in Health & Disease and its Potential as a Novel Therapeutic Agent The importance of host defence peptides in the immune response is only beginning to be  understood. The conservation of these peptides as a component of the immune response across all classes of life is a testament to both their importance and effectiveness. In humans a number of polymorphisms in related proteins such as bacterial permeability increasing protein (97) and the defensins (98, 99) have been identified as risk factors in certain disease conditions. To date no polymorphisms or genetic defects in expression have been identified in the gene encoding hCAP-18; however, in the one syndrome in which neutrophil expression of LL-37 and possibly 109  other host defence peptides is defective, although not abrogated, patients suffer from untreatable chronic infections as w e l l as acute and severe infectious episodes w h i c h are often life-threatening (20).  T h i s indirect evidence  is consistent with the idea that these peptides are an essential  component o f the innate immune response in humans. A s interest in the role o f host defence peptides in health and disease is increasing, reports o f changes in expression during the course o f infection and disease are beginning to emerge. It is increasingly clear that inducible expression is an important component o f the body's response to infectious and inflammatory stimuli and that these peptides m a y play a homeostatic role in neutralizing low levels o f bacterial components, thus m i n i m i z i n g inflammatory responses. hypothesis  that L L - 3 7  T h e data i n this  thesis are consistent  with  the  is i n v o l v e d in the resolution o f inflammation both b y b l o c k i n g the  production o f pro-inflammatory cytokines induced b y low levels o f bacterial components, and b y recruiting cells o f the immune response w h i c h are required to remove invading micro-organisms. However, L L - 3 7 is clearly multi-functional and when the resolution o f infection does not occur, or i f the inflammatory stimulus is an endogenous  cytokine such as IL-1 p, it might help to  enhance, sustain or even amplify o f the immune response. Host defence  peptides  in general, and L L - 3 7  in particular, show potential as novel  therapeutic agents. E x o g e n o u s addition o f host defence peptides or their modified derivatives reduce bacterial counts in a number o f disease models including those o f septic shock and bacterial infection, and demonstrate potential as novel adjuvants and immunostimulatory agents. A s virtually every antibiotic in the physician's repertoire is m o d i f i e d or adapted from nature's design, it is likely that further studies o f the immunomodulatory properties o f L L - 3 7 , as well as other naturally occurring host defence peptides and their derivatives w i l l provide insight into the complexity o f the immune response and the potential o f these peptides to become invaluable additions to existing anti-infective therapies. 6.8 1.  Bibliography D e , Y . , Q . C h e n , A . P. Schmidt, G . M . A n d e r s o n , J . M . W a n g , J . Wooters, J . J . O p p e n h e i m , and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like 1 ( F P R L 1 ) as a receptor to chemoattract h u m a n peripheral blood neutrophils, monocytes, and T cells. J Exp  Med  192:1069. 2.  B a l s , R . , D . J . W e i n e r , A . D . M o s c i o n i , R . L . M e e g a l l a , and J . M . W i l s o n . Augmentation o f innate host defense by expression peptide. Infect Immun  3.  1999.  o f a cathelicidin antimicrobial  67:6084.  Scott, M . G . , D . J . D a v i d s o n , M . R . G o l d , D . B o w d i s h , and R . E . H a n c o c k . 2002. T h e human antimicrobial peptide L L - 3 7 is a multifunctional modulator o f innate immune responses. J Immunol  169:3883.  110  4.  Prohaszka, Z . , K . Nemet, P. Csermely, F . H u d e c z , G . M e z o , and G . Fust. 1997. purified  from h u m a n granulocytes  b i n d C l q and activate  pathway like the transmembrane glycoprotein gp41 o f H I V - 1 . 5.  Defensins  complement  Mol Immunol 34:809.  Chertov, O . , D . F . M i c h i e l , L . X u , J. M . W a n g , K . T a n i , W . J . M u r p h y , D . L . L o n g o , D . D.  Taub,  and J . J . O p p e n h e i m .  CAP37/azurocidin  as  T-cell  stimulated neutrophils. 6.  the classical  1996.  Identification  chemoattractant  o f defensin-1,  proteins  released  defensin-2,  from  and  interleukin-8-  J Biol Chem 271:2935.  Shi, J . , C . R . Ross, T . L . L e t o , and F . B l e c h a . 1996. P R - 3 9 , a proline-rich antibacterial peptide that inhibits phagocyte N A D P H oxidase activity b y b i n d i n g to Src homology 3  Proc Natl Acad Sci USA 93:6014.  domains o f p47 phox. 7.  Y a n g , D . , O . Chertov, S. N . B y k o v s k a i a , Q . C h e n , M . J . B u f f o , J . Shogan, M . A n d e r s o n , J. M . Schroder, J . M . W a n g , O . M . H o w a r d , and J . J . O p p e n h e i m . 1999. linking innate  and adaptive  Beta-defensins:  immunity through dendritic and T cell C C R 6 .  Science  286:525. 8.  L i a o , F . , R . L . R a b i n , C . S. Smith, G . Sharma, T . B . N u t m a n , and J . M . Farber. 1999. C C chemokine receptor 6 is expressed on diverse m e m o r y subsets o f T cells and determines responsiveness to macrophage inflammatory protein 3 alpha.  9.  Lubkowski. /CCL20.  2002. T h e structure o f human macrophage  inflammatory  protein-3alpha  L i n k i n g antimicrobial and C C chemokine receptor-6-binding activities  human beta-defensins. 10.  J Immunol 162:186.  H o o v e r , D . M . , C . Boulegue, D . Y a n g , J. J . O p p e n h e i m , K . T u c k e r , W . L u , and J . with  JBiol Chem 277:37647.  C o l e , A . M . , T . G a n z , A . M . Liese, M . D . B u r d i c k , L . L i u , and R . M . Strieter.  2001.  Cutting edge: I F N - i n d u c i b l e E L R - C X C chemokines display defensin-like antimicrobial activity. 11.  J Immunol 167:623.  Y a n g , D . , Q . C h e n , D . M . H o o v e r , P. Staley, K . D . T u c k e r , J . L u b k o w s k i , and J. J . Oppenheim.  2003.  antimicrobial activity. 12.  Many  chemokines  including  C C L 2 0 / M I P - 3 alpha  JLeukoc Biol 74:448.  D u r r , M . , and A . Peschel. 2002. Chemokines meet defensins: the merging concepts o f chemoattractants and antimicrobial peptides in host defense.  13.  Infect Immun 70:6515.  Papo, N . , and Y . Shai. 2003. C a n we predict biological activity o f antimicrobial peptides from their interactions with model phospholipid membranes?  14.  display  Peptides 24:1693.  Schaller-Bals, S., A . Schulze, and R . Bals. 2002. Increased  levels o f antimicrobial  Am J Respir Crit Care  peptides in tracheal aspirates o f newborn infants during infection.  Med 165:992. 15.  C h e n , C . I., S. Schaller-Bals, K . P. Paul, U . W a h n , and R . B a l s . 2004. Beta-defensins and  16.  Agerberth, B . , J . G r u n e w a l d , E . Castanos-Velez, B . O l s s o n , H . Jornvall, H . W i g z e l l , A .  L L - 3 7 in bronchoalveolar lavage fluid o f patients with cystic fibrosis. E k l u n d , and G . H . G u d m u n d s s o n . 1999. Antibacterial components lavage fluid f r o m healthy individuals and sarcoidosis patients.  J Cyst Fibros 3:45. in bronchoalveolar  Am J Respir Crit Care  Med 160:283. 17.  K i m , S. T . , H . E . C h a , D . Y . K i m , G . C . H a n , Y . S. C h u n g , Y . J . L e e , Y . J. H w a n g , and H.  M . Lee.  2003.  inflammatory disease. 18.  A n t i m i c r o b i a l peptide  LL-37  is  upregulated  in  chronic  nasal  Acta Otolaryngol 123:81.  Sorensen, O . , J . B . C o w l a n d , J. A s k a a , and N . Borregaard. 1997. A n E L I S A for h C A P 18, the cathelicidin present  in human neutrophils  and plasma.  J Immunol Methods  206:53. 19.  Murakami,  M . , T . Ohtake, R. A . Dorschner, and R . L . G a l l o .  antimicrobial peptides are expressed in salivary glands and saliva.  2002. Cathelicidin  J Dent Res 81:845.  111  20.  Putsep,  K . , G . Carlsson, H . G . B o m a n , and M . A n d e r s s o n .  2002.  Deficiency  of  Lancet  antibacterial peptides in patients with morbus K o s t m a n n : an observation study.  360:1144. 21.  W o o , J . S., J . Y . Jeong, Y . J . H w a n g , S. W . C h a e , S. J . H w a n g , and H . M . L e e . 2003. Expression o f cathelicidin in human salivary glands.  Arch Otolaryngol Head Neck Surg  129:211. 22.  M a l m , J . , O . Sorensen, T . Persson, M . F r o h m - N i l s s o n , B . Johansson, A . Bjartell, H . L i l j a , M.  Stahle-Backdahl, N .  Borregaard, and  A.  Egesten.  2000.  The  human  cationic  antimicrobial protein ( h C A P - 1 8 ) is expressed i n the epithelium o f human epididymis, is present in seminal plasma at high concentrations, and is attached to spermatozoa.  Infect  Immun 68:4297. 23.  O n g , P. Y . , T . Ohtake, C . Brandt, I. Strickland, M . B o g u n i e w i c z , T . G a n z , R . L . G a l l o , and D . Y . L e u n g . 2002. Endogenous antimicrobial peptides and skin infections in atopic dermatitis.  24.  N Engl J Med 347:1151.  Sorensen, O . E . , L . G r a m , A . H . Johnsen, E . A n d e r s s o n , S. B a n g s b o l l , G . S. Tjabringa, P. S. Hiemstra, J . M a l m , A . Egesten, and N . Borregaard. 2003. Processing o f seminal plasma  hCAP-18  to  ALL-38  antimicrobial peptides in vagina. 25.  by  gastricsin:  a  novel  mechanism  of  generating  J Biol Chem 278:28540.  Islam, D . , L . Bandholtz, J . N i l s s o n , H . W i g z e l l , B . Christensson, B . Agerberth, and G . G u d m u n d s s o n . 2001.  Downregulation o f bactericidal peptides in enteric infections:  novel immune escape mechanism with bacterial D N A as a potential regulator. Nat  a  Med  7:180. 26.  M u r a k a m i , M . , R . A . Dorschner, L . J . Stern, K . H . L i n , and R . L . G a l l o . 2005. Expression and secretion human m i l k .  21.  Nizet,  o f cathelicidin antimicrobial peptides in murine m a m m a r y glands and  Pediatr Res 57:10.  V . , T . Ohtake, X . Lauth,  J. T r o w b r i d g e , J . R u d i s i l l ,  R . A . Dorschner, V .  Pestonjamasp, J . Piraino, K . Huttner, and R . L . G a l l o . 2001. Innate antimicrobial peptide protects the skin from invasive bacterial infection. 28.  Nature 414:454.  W i l s o n , C . L . , A . J . Ouellette, D . P. Satchell, T . A y a b e , Y . S. L o p e z - B o a d o , J. L . Stratman, S. J. Hultgren, L . M . Matrisian, and W . C . Parks. 1999. Regulation o f intestinal alpha-defensin  activation by the metalloproteinase  matrilysin in innate host defense.  Science 286:113. 29.  Salzman, N . H . , D . G h o s h , K . M . Huttner, Y . Paterson, and C . L . Bevins.  2003.  Protection against enteric salmonellosis in transgenic mice expressing a human intestinal . defensin. 30.  Nature 422:522.  Sorensen, O . E . , P. F o l l i n , A . H . Johnsen, J . Calafat, G . S. Tjabringa, P. S. Hiemstra, and N . Borregaard. 2001. H u m a n cathelicidin, h C A P - 1 8 , is processed to the antimicrobial peptide L L - 3 7 b y extracellular cleavage with proteinase 3.  31.  Blood 97:3951.  F r o h m , M . , B . Agerberth, G . A h a n g a r i , M . Stahle-Backdahl, S. L i d e n , H . W i g z e l l , and G . H . G u d m u n d s s o n . 1997. T h e expression o f the gene c o d i n g for the antibacterial peptide L L - 3 7 is induced in human keratinocytes during inflammatory disorders.  J Biol Chem  272:15258. 32.  Hase, K . , L . E c k m a n n ,  J. D . L e o p a r d , N . V a r k i ,  and M . F . Kagnoff. 2002.  Cell  differentiation is a key determinant o f cathelicidin L L - 3 7 / h u m a n cationic antimicrobial protein 18 expression b y human colon epithelium. 33.  Infect Immun 70:953.  E r d a g , G . , and J. R . M o r g a n . 2002. Interleukin-1 alpha and interleukin-6 enhance antibacterial properties o f cultured composite keratinocyte grafts.  34.  the  Ann Surg 235:113.  Dorschner, R . A . , V . K . Pestonjamasp, S. T a m a k u w a l a , T . Ohtake, J . R u d i s i l l , V . Nizet, B . Agerberth, G . H . G u d m u n d s s o n , and R . L . G a l l o . 2001. Cutaneous injury induces the 112  release o f cathelicidin anti-microbial peptides active against group A Streptococcus.  J  Invest Dermatol 117:91. 35.  Sorensen, O . , K . Arnljots, J. B . C o w l a n d , D . F . Bainton, and N . Borregaard. 1997. T h e human  antibacterial  cathelicidin,  hCAP-18,  is  synthesized  metamyelocytes and localized to specific granules in neutrophils. 36.  in  myelocytes  and  Blood 90:2796.  Agerberth, B . , H . G u n n e , J. Odeberg, P. K o g n e r , H . G . B o m a n , and G . H . Gudmundsson. 1995. F A L L - 3 9 , a putative human peptide antibiotic, is cysteine-free and expressed in bone marrow and testis.  37.  Proc Natl Acad Sci USA 92:195.  Bals, R . , X . W a n g , M . Zasloff, and J . M . W i l s o n . 1998.  T h e peptide antibiotic L L -  3 7 / h C A P - 1 8 is expressed in epithelia o f the human lung where it has broad antimicrobial activity at the airway surface. 38.  Proc Natl Acad Sci USA 95:9541.  Henzler W i l d m a n , K . A . , D . K . L e e , and A . R a m a m o o r t h y . 2003. M e c h a n i s m o f lipid bilayer disruption by the human antimicrobial peptide, L L - 3 7 .  39.  Biochemistry 42:6545.  H e n z l e r - W i l d m a n , K . A . , G . V . Martinez, M . F . B r o w n , and A . Ramamoorthy. 2004. Perturbation o f the hydrophobic core o f lipid bilayers by the h u m a n antimicrobial peptide LL-37.  40.  Biochemistry 43:8459.  N a n g a k u , M . , S. J. Shankland, and W . G . Couser. 2005. C e l l u l a r Response to Injury in M e m b r a n o u s Nephropathy.  41.  J Am Soc Nephrol.  B o w d i s h , D . M . E . , D a v i d s o n , D . J . , Speert, D . P . , H a n c o c k , R . E . W . 2004. T h e H u m a n Cationic Peptide L L - 3 7 Induces A c t i v a t i o n o f the Extracellular Signal-Regulated Kinase and p38  K i n a s e Pathways in Primary H u m a n M o n o c y t e s .  Journal of Immunology  172:3758 42.  C h a l y , Y . V . , E . M . Paleolog, T . S. K o l e s n i k o v a , T i k h o n o v , II, E . V . Petratchenko, and N . N . V o i t e n o k . 2000. Neutrophil alpha-defensin cytokine  production  human  monocytes  human neutrophil peptide modulates expression  in  L a u , Y . E . , B o w d i s h , D . M . E . , H a n c o c k , R . E . W . , D a v i d s o n , D . J . 2005. Apoptosis  and  adhesion  molecule  of  Eur Cytokine Netw 11:257.  endothelial cells. 43.  in  airway epithelial  cells: human serum sensitive induction b y the cathelicidin  LL-37.  Submitted. 44.  Braff, M . H . , M . A . H a w k i n s , A . D . N a r d o , B . L o p e z - G a r c i a , M . D . H o w e l l , C . W o n g , K . L i n , J. E . Streib, R . Dorschner, D . Y . L e u n g , and R . L . G a l l o . 2005. Structure-Function Relationships  among  Human  Cathelicidin  Peptides:  Properties from Host Immunostimulatory Activities. 45.  Dissociation  of Antimicrobial  J Immunol 174:4271.  N i y o n s a b a , F . , K . Iwabuchi, A . Someya, M . Hirata, H . M a t s u d a , H . O g a w a , and I. Nagaoka. 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis.  46.  Immunology 106:20.  Tjabringa, G . S., J . A a r b i o u , D . K . Ninaber, J . W . Drijfhout, O . E . Sorensen,  N.  Borregaard, K . F . Rabe, and P. S. Hiemstra. 2003. T h e antimicrobial peptide L L - 3 7 activates innate immunity at the airway epithelial epidermal growth factor receptor. 47.  surface  b y transactivation  o f the  J Immunol 171:6690.  Elssner, A . , M . D u n c a n , M . G a v r i l i n , and M . D . Wewers. 2004. A novel P 2 X 7 receptor activator, the h u m a n cathelicidin-derived peptide L L 3 7 , induces IL-1 beta processing and release.  48.  J Immunol 172:4987.  Ferrari, D . , C . Pizzirani, E . A d i n o l f i , S. Forchap, B . Sitta, L . Turchet, S. F a l z o n i , M . M i n e l l i , R . B a r i c o r d i , and F . D i V i r g i l i o . 2004. T h e antibiotic p o l y m y x i n B modulates P 2 X 7 receptor function.  49.  J Immunol 173:4652.  Deshpande, D . , D . T o l e d o - V e l a s q u e z , D . Thakkar, W . L i a n g , and Y . Rojanasakul. E n h a n c e d cellular uptake o f oligonucleotides by E G F receptor-mediated A 5 4 9 cells.  1996.  endocytosis in  Pharm Res 13:57. 113  50.  Rot, A . 1991. Chemotactic potency o f recombinant human neutrophil attractant/activation protein-1 (interleukin-8) for polymorphonuclear leukocytes o f different species.  Cytokine  3:21. 51.  C i o r n e i , C . D . , A . Egesten, and M . Bodelsson. 2003. Effects o f human cathelicidin antimicrobial peptide L L - 3 7 on lipopolysaccharide-induced nitric oxide release from rat aorta  52.  in vitro. Acta Anaesthesiol Scand 47:213.  A n , L . L . , Y . H . Y a n g , X . T . M a , Y . M . L i n , G . L i , Y . H . S o n g , and K . F . W u . 2005. L L 37 enhances adaptive antitumor immune response in a murine m o d e l when genetically fused with M - C S F R ( J 6 - 1 ) D N A vaccine.  53.  LeukRes 29:535.  K o c z u l l a , R . , G . v o n Degenfeld, C . Kupatt, F . K r o t z , S. Zahler, T . G l o e , K . Issbrucker, P. Unterberger, M . Z a i o u , C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . W e l s c h , P. S. Hiemstra, C . V o g e l m e i e r , R . L . G a l l o , M . Clauss, and R . Bals. 2003. A n angiogenic  role  for  the  human peptide  antibiotic  LL-37/hCAP-18.  J Clin Invest  111:1665. 54.  H e i l b o r n , J . D . , M . F . N i l s s o n , C . I. Jimenez, B . Sandstedt, N . Borregaard, E . T h a m , O . E . Sorensen, G . Weber, and M . Stahle. 2005. A n t i m i c r o b i a l protein h C A P 1 8 / L L - 3 7  is  highly expressed i n breast cancer and is a putative growth factor for epithelial cells. Int J  Cancer 114:713. 55.  K e r s h , G . J . , and P. M . A l l e n . 1996. Essential flexibility in the T - c e l l recognition o f  56.  Fisher, P. J . , F . G . Prendergast, M . R . Ehrhardt, J . L . Urbauer, A . J . W a n d , S. S.  antigen.  Nature 380:495.  Sedarous,  D . J. McCormick,  and P. J . B u c k l e y .  amphiphilic peptides composed o f all D - a m i n o acids. 57.  1994.  Calmodulin  interacts  with  Nature 368:651.  V a n Lenten, B . J . , A . C . Wagner, G . M . Anantharamaiah, D . W . Garber, M . C . Fishbein, L . A d h i k a r y , D . P . N a y a k , S. H a m a , M . N a v a b , and A . M . F o g e l m a n . 2002. Influenza infection promotes macrophage traffic into arteries o f mice that is prevented by D - 4 F , an apolipoprotein A - I mimetic peptide.  58.  Grainger, D . J . , J . Reckless, clearance o f apoptotic bodies  Circulation 106:1127.  and E . M c K i l l i g i n . 2004. A p o l i p o p r o t e i n E  in vitro  59.  in vivo, resulting i n a J Immunol 173:6366.  and  state in apolipoprotein E-deficient mice.  modulates  systemic proinflammatory  M c D o n a l d , M . C , P. D h a d l y , G . W . C o c k e r i l l , S. C u z z o c r e a , H . M o t a - F i l i p e , C . J . H i n d s , N.  E . Miller,  and  C . T h i e m e r m a n n . 2003.  Reconstituted  high-density  lipoprotein  attenuates organ injury and adhesion molecule expression in a rodent model o f endotoxic shock. 60.  Shock 20:551.  Sorensen, O . , T . Bratt, A . H . Johnsen, M . T . M a d s e n , and N . Borregaard. 1999. T h e human antibacterial cathelicidin, h C A P - 1 8 , is bound to lipoproteins in plasma.  J Biol  Chem 274:22445. 61.  Wang,  Y.,  B.  Agerberth,  A.  Lothgren,  A.  Almstedt,  and  J.  Johansson.  1998.  A p o l i p o p r o t e i n A - I binds and inhibits the human antibacterial/cytotoxic peptide L L - 3 7 . J  Biol Chem 273:33115. 62.  L a u , Y . E . , A . R o z e k , M . G . Scott, D . L . G o o s n e y , D . J . D a v i d s o n , and R . E . H a n c o c k . 2005. Interaction and cellular localization o f the human host defense peptide L L - 3 7 with lung epithelial cells.  63.  Infect Immun 73:583.  Verbanac, D . , M . Zanetti, and D . R o m e o . 1993. Chemotactic and protease-inhibiting activities o f antibiotic peptide precursors.  64.  H u a n g , H . J . , C . R . Ross, and F . B l e c h a . 1997. Chemoattractant properties o f P R - 3 9 , a neutrophil antibacterial peptide.  65.  FEBS Lett 317:255.  JLeukoc Biol 61:624.  Zanetti, M . 2004. Cathelicidins, multifunctional peptides  o f the innate  immunity. J  Leukoc Biol 75:39. 114  66.  Z h a n g , H . , G . Porro, N . O r z e c h , B . M u l l e n , M . L i u , and A . S. Slutsky. 2001. Neutrophil defensins mediate acute inflammatory response and lung dysfunction fashion.  67.  in  dose-related  Am J Physiol Lung Cell Mol Physiol 280.L947.  Conese, M . , E . C o p r e n i , S. D i G i o i a , P. D e Rinaldis, and R . F u m a r u l o . 2003. Neutrophil recruitment and airway epithelial cell involvement in chronic cystic fibrosis lung disease.  JCystFibros 2:129. 68.  Ohbayashi, H . 2002. N o v e l neutrophil elastase inhibitors as a treatment for neutrophil-  IDrugs 5:910.  predominant inflammatory lung diseases. 69.  Bals, R . , D . J . W e i n e r , R . L . M e e g a l l a , and J . M . W i l s o n . 1999. Transfer o f a cathelicidin peptide antibiotic gene restores bacterial k i l l i n g in a cystic fibrosis xenograft model. J  Clin Invest 103:1113. 70.  A s h i t a n i , J . , H . M u k a e , M . Nakazato, T . Ihi, H . M a s h i m o t o , J . K a d o t a , S. K o h n o , and S. Matsukura. 1998. Elevated concentrations o f defensins in bronchoalveolar lavage fluid in diffuse panbronchiolitis.  71.  Eur Respir J 11:104.  A s h i t a n i , J . , H . M u k a e , Y . A r i m u r a , A . Sano, M . T o k o j i m a , and M . Nakazato. 2004. H i g h concentrations o f alpha-defensins in plasma and bronchoalveolar lavage fluid o f patients with acute respiratory distress syndrome.  12.  Life Sci 75:1123.  A s h i t a n i , J . , H . M u k a e , T . Hiratsuka, M . Nakazato, K . K u m a m o t o , and S. Matsukura. 2001. P l a s m a and B A L fluid concentrations M y c o b a c t e r i u m avium-intracellulare infection.  73.  o f antimicrobial peptides in patients with  Chest 119:1131.  A s h i t a n i , J . , H . M u k a e , T . Hiratsuka, M . Nakazato, K . K u m a m o t o , and S. Matsukura. 2002. Elevated levels o f alpha-defensins in plasma and B A L fluid o f patients with active pulmonary tuberculosis.  74.  Chest 121:519.  A s h i t a n i , J . , H . M u k a e , M . Nakazato, H . T a n i g u c h i , K . O g a w a , S. K o h n o , and S. Matsukura. 1998. Elevated pleural fluid levels o f defensins in patients with empyema.  Chest 113:788. 15.  N e l l , M . J . , G . Sandra Tjabringa, M . J . V o n k , P. S. Hiemstra, and J . J . Grote. 2004. Bacterial products increase  expression  cultured human sinus epithelial cells.  16.  o f the human cathelicidin h C A P - 1 8 / L L - 3 7  in  FEMS Immunol Med Microbiol 42:225. Surg Clin North  Witte, M . B . , and A . B a r b u l . 1997. General principles o f w o u n d healing.  Am 77:509. 11.  N a g a o k a , I., S. Hirota, F . N i y o n s a b a , M . Hirata, Y . A d a c h i , H . T a m u r a , S. Tanaka, and D . H e u m a n n . 2002. Augmentation o f the lipopolysaccharide-neutralizing  activities o f  human cathelicidin C A P 1 8 / L L - 3 7 - d e r i v e d antimicrobial peptides b y replacement hydrophobic and cationic amino acid residues. 78.  Scott, M . G , A . C . V r e u g d e n h i l , W . A . B u u r m a n , R . E . H a n c o c k , and M . R . G o l d . 2000. Cutting edge: cationic antimicrobial peptides b l o c k the binding o f ( L P S ) to L P S b i n d i n g protein.  19.  lipopolysaccharide  J Immunol 164:549.  Scott, M . G , M . R . G o l d , and R. E . H a n c o c k . 1999. Interaction o f cationic peptides with lipoteichoic acid and gram-positive bacteria.  80.  with  Clin Diagn Lab Immunol 9:972.  Infect Immun 67:6445.  B o w d i s h , D . M . E . , D a v i d s o n , D J . , H a n c o c k , R . E . W . 2004. A re-evaluation o f the role o f host defence  peptides in m a m m a l i a n  immunity.  Combinatorial Chemistry & High  Throughput Screening In press. 81.  W i d d i c o m b e , J . H . 2002. Regulation o f the depth and composition o f airway surface liquid.  82.  JAnat 201:313.  Singh, P. K . , B . F . T a c k , P. B . M c C r a y , Jr., and M . J. W e l s h . 2000. Synergistic and additive k i l l i n g by antimicrobial factors found in human airway surface liquid. Am  J  Physiol Lung Cell Mol Physiol 279.L799.  115  83.  Y a n , H . , and R . E . H a n c o c k . 2001. A n t i m i c r o b i a l Defense Peptides.  84.  Synergistic  Interactions  between  Mammalian  Antimicrob Agents Chemother 45:1558.  D a v i d s o n , D . J . , A . J . Currie, G . S. R e i d , D . M . B o w d i s h , K . L . M a c D o n a l d , R . C . M a , R . E . H a n c o c k , and D . P . Speert. 2004. T h e cationic antimicrobial peptide L L - 3 7 modulates  J Immunol  dendritic cell differentiation and dendritic cell-induced T cell polarization.  172:1146. 85.  Barreda, D . R . , P. C . Hanington, and M . B e l o s e v i c . development and function by colony stimulating factors.  86.  2004. Regulation o f m y e l o i d  Dev Comp Immunol 28:509.  X u , H . , A . O k a m o t o , J . Ichikawa, T . A n d o , K . Tasaka, K . M a s u y a m a , H . O g a w a , H . Y a g i t a , K . O k u m u r a , and A . N a k a o . 2004. T W E A K / F n l 4 interaction stimulates human bronchial epithelial cells to produce I L - 8 and G M - C S F .  Biochem Biophys Res Commun  318:422. 87.  Saba, S., G . S o o n g , S. Greenberg, and A . Prince. 2002. Bacterial stimulation o f epithelial G - C S F and G M - C S F expression promotes P M N survival in C F airways.  Am J Respir  Cell Mol Biol 27:561. 88.  N i e d a , M . , M . T o m i y a m a , and K . E g a w a . 2003. E x v i v o enhancement  o f antigen-  presenting function o f dendritic cells and its application for D C - b a s e d immunotherapy.  Hum Cell 16:199. 89.  C a m p b e l l , J . R . , and M . S. Edwards. 2000. Cytokines enhance opsonophagocytosis type III group B Streptococcus.  90.  of  JPerinatol 20:225.  Ottonello, L . , A . L . Epstein, M . M a n c i n i , G . Tortolina, P . D a p i n o , and F . Dallegri. 2001. C h i m a e r i c L y m - 1 m o n o c l o n a l antibody-mediated cytolysis b y neutrophils from G - C S F treated patients: stimulation b y G M - C S F and role o f F c g a m m a -receptors.  Br J Cancer  85:463. 91.  D i s s e m o n d , J . , T . K . W e i m a n n , L . A . Schneider, A . Schneeberger,  K . Scharffetter-  K o c h a n e k , M . G o o s , and S. N . Wagner. 2003. A c t i v a t e d neutrophils exert antitumor activity against human melanoma cells: reactive oxygen species-induced mechanisms and their  modulation  by  granulocyte-macrophage-colony-stimulating  factor.  J Invest  Dermatol 121:936. 92.  L i , H . , W . C h e u n g , H . H . C h o o , J . H . C h a n , P. S. L a i , and W . S. F r e d W o n g . 2003. IL-10 synergistically enhances G M - C S F - i n d u c e d C C R 1 expression i n m y e l o m o n o c y t i c  cells.  Biochem Biophys Res Commun 304:417. 93.  K u m a g a i , M . , T . Imaizumi, K . Suzuki, H . Y o s h i d a , S. Takanashi, K . O k u m u r a , K . Sugawarai, and K . Satoh. 2004. 15-Deoxy-delta(12,14)-Prostaglandin 1 beta-induced  expression  of  granulocyte-macrophage  B E A S - 2 B bronchial epithelial cells. 94.  J2 inhibits the I L -  colony-stimulating  factor  in  Tohoku J Exp Med 202:69.  Sha, Q . , A . Q . T r u o n g - T r a n , J . R . Plitt, L . A . B e c k , and R . P. Schleimer. 2004. A c t i v a t i o n o f A i r w a y Epithelial C e l l s by T o l l - l i k e Receptor Agonists.  Am J Respir Cell Mol Biol.  95.  Chambers, C . A . , and J . P. A l l i s o n . 1999. Costimulatory regulation o f T cell function.  96.  Kiefer, F . , W . F . V o g e l , and R . A r n o l d . 2002. Signal transduction and co-stimulatory  Curr Opin Cell Biol 11:203. pathways. 97.  Transpl Immunol 9:69.  K l e i n , W . , A . T r o m m , C . F o l w a c z n y , M . H a g e d o r n , N . D u e r i g , J . E p p l e n , W . Schmiegel, and T . G r i g a . 2005. A p o l y m o r p h i s m o f the bactericidal/permeability increasing protein (BPI) gene is associated with Crohn's disease.  98.  J Clin Gastroenterol 39:282.  L e v y , H . , B . A . R a b y , S. L a k e , K . G . Tantisira, D . K w i a t k o w s k i , R . Lazarus, E . K . Silverman, B . Richter, W . T . K l i m e c k i , D . V e r c e l l i , F . D . Martinez, and S. T . Weiss. 2005. A s s o c i a t i o n o f defensin beta-1 gene p o l y m o r p h i s m s with asthma.  J Allergy Clin  Immunol 115:252. 116  H u , R . C , Y . J. X u , Z . X . Z h a n g , W . N i , and S. X . C h e n . 2004. Correlation o f H D E F B 1 p o l y m o r p h i s m and susceptibility H a n population.  to chronic obstructive pulmonary disease in Chinese  Chin Med J (Engl) 117:1637.  117  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092442/manifest

Comment

Related Items