UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression of pro-fibrotic factors in the airways of lungs from patients with chronic obstructive pulmonary… McDonough, John Edward 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-0554.pdf [ 16.61MB ]
Metadata
JSON: 831-1.0092426.json
JSON-LD: 831-1.0092426-ld.json
RDF/XML (Pretty): 831-1.0092426-rdf.xml
RDF/JSON: 831-1.0092426-rdf.json
Turtle: 831-1.0092426-turtle.txt
N-Triples: 831-1.0092426-rdf-ntriples.txt
Original Record: 831-1.0092426-source.json
Full Text
831-1.0092426-fulltext.txt
Citation
831-1.0092426.ris

Full Text

EXPRESSION OF PRO-FIBROTIC FACTORS IN THE A I R W A Y S OF LUNGS F R O M PATIENTS WITH CHRONIC OBSTRUCTIVE P U L M O N A R Y DISEASE by JOHN EDWARD M C D O N O U G H B.Sc , Simon Fraser University, 2001 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF M A S T E R OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES E X P E R I M E N T A L MEDICINE THE UNIVERSITY OF BRITISH C O L U M B I A September 2005 © John Edward McDonough, 2005 Abstract Chronic obstructive pulmonary disease is characterized by a reduction in lung function caused by a thickening of the bronchiole airway wall and narrowing of its lumen. This remodeling is associated with the development of a peribronchial fibrosis. This study compares the expression of several pro-fibrotic mediators using immunohistochemistry, quantitative RT-PCR, and in situ hybridization to quantitate and localize the expression of these proteins. In lung tissue from patients with GOLD stage 0, 1,3, and 4 COPD the volume fraction of the staining for each mediator in the bronchiolar epithelium of randomly selected airways was measured using image analysis software. The results demonstrated a significant increase in the amount of IL-13, TGF-beta2, PDGF-A, PDGF-Ralpha, and CTGF in the airways of more severe GOLD stage 3 and 4 patients relative to the airways of non-obstructed or mild GOLD 0 and 1 patients. No changes were detected in the expression of TGF-betal, p-SMAD2/3, PDGF-B, or PDGF-Rbeta. Using quantitative RT-PCR and in situ hybridization, the expression and localization of TGF-betal, TGF-beta2, and TGF-beta3 are determined. No differences were found in their level of expression but, in accordance with the immunohistochemical results, high levels of R N A were localized to the bronchiolar epithelium. This study highlights the potential role that the bronchiolar epithelium plays in the development of peribronchial fibrosis and disease pathogenesis in COPD. Table of Contents Abstract i i List of Tables v List of Figures vi Chapter 1 Chronic Obstructive Pulmonary Disease 1 1.1 Historical Background. 1 1.2 Diagnosis 4 1.3 Epidemiology. 6 1.4 Pathology. 8 Chapter 2 Cytokines and Growth Factors in COPD. 18 2.1 Interleukin-13 18 2.2 Transforming Growth Factor-Beta 21 2.3 Platelet Derived Growth Factor. 27 Chapter 3 Research 3 0 3.1 Working Hypothesis. 30 3.2 Specific Aims 30 Chapter 4 Materials and Methods 32 4.1 Immunohistochemistry. 32 4.2 Quantitative Real-time Polymerase Chain Reaction. 41 4.3 In Situ Hybridization. 50 Chapter 5 Results 58 5.1 Immunohistochemistry 5 8 5.2 Quantitative Real-time Polymerase Chain Reactioa 75 5.3 In Situ Hybridization 80 Chapter 6 Discussion 88 References 101 List of Tables Page Table 1 34 Table 2 43 Table 3 46 Table 4 51 Table 5 53 Table 6 59 Table 7 74 Table 8 78 List of Figures Page Figure 1 54 Figure 2 60 Figure 3 61 Figure 4 62 Figure 5 64 Figure 6 65 Figure 7 66 Figure 8 67 Figure 9 69 Figure 10 70 Figure 11 71 Figure 12 72 Figure 13 76 Figure 14 79 Figure 15 81 Figure 16 82 Figure 17 84 Figure 18 85 Figure 19 86 Figure 20 87 Figure 21 94 vi Chapter 1: Chronic Obstructive Pulmonary Disease 1.1 Historical Background Chronic obstructive pulmonary disease (COPD) is a progressive disease that prolongs expiratory flow resulting in hyperinflation of the lung first during exercise in the early stages and then at rest(l, 2). It is the result of chronic inflammation of the lower airways and when the central airways are affected there is chronic cough and sputum production which characterizes chronic bronchitis. In addition there is obstruction of the small airways and emphysematous destruction of the lung parenchyma that reduces the elastic recoil force available to expire appropriate volumes of air. Emphysema is derived from the Greek words, en for ' in ' andphysema for 'blowing into' or 'inflated' and is used to describe the abnormal presence of air in the body(3). The clinical symptoms of pulmonary emphysema, such as dyspnea and wheezing, have long been observed but it would not be until the late 17 th and early 18 t h century that the enlarged respiratory gas exchange areas characteristic of this disease were described. In 1691, the Dutch anatomist Frederik Ruysch was the first person to illustrate inflated pulmonary vesicles and deduced that an obstruction of the bronchi prevented the air from exiting the lung(4). More detailed observations were made by the Scottish physician Matthew Baillie in 1793 who gave the first clear description of the enlarged airspaces characteristic of pulmonary emphysema(5). He hypothesized that the emphysema was caused by air being trapped in the lungs and "this accumulation could sometimes break 1 down two or three contiguous cells into one and thereby form a cell of very large size". Rene Laennec in 1819 found that to accurately gauge the presence and extent of emphysema required observing the cut surface of an inflated and air-dried lung(6). He differentiated interstitial emphysema, the collection of gases outside of the normal air passages and within the connective tissue, from pulmonary or vesicular emphysema, and the enlargement of the airspaces caused by destruction of the alveolar walls. Laennec also noticed the variation in severity of the lesion within a lung. He commented on the relationship between chronic bronchitis and emphysema, believing that emphysema was the result of obstruction in the small bronchioles due to bronchiolitis. Following the gross pathological descriptions given by Laennec, the first microscopic observations of emphysema were made in 1848 by Rainey(7). Using thick unstained sections, he described the dilated alveoli and capillary network as well as enlarged fenestrations in the alveolar wall. In 1871, Isaakssohn noted a decrease in the number of alveolar capillaries when he perfused the blood vessels in emphysematous lungs(8). The first investigators to note the damaged elastin fibers in emphysematous lungs were Eppinger in 1876 and Orsos in 1907(9, 10). Orsos, a Hungarian physician, made a detailed study comparing the elastin fibers of normal and emphysematous lungs and concluded that the initiation of emphysema was due to the rupture of the elastic fibers. He also noticed thickened collagen fibers and fine elastin fibers and attributed these changes to be part of a repair process. These studies culminated in the discovery by Schulze in 1962 of the elastase and trypsin inhibitor alpha-l-antitrypsin(l 1). Patients 2 with a deficiency in this protein were found by the Swedish physician Sten Eriksson in the 1960's to be predisposed to the development of emphysema(12). Centrilobular emphysema, the predominant form in cigarette smoke induced emphysema, is characterized by emphysematous lesions present in the central portion of the acinus primarily in the upper regions of the lung. This condition was first described by Villemin in 1886(13) which would follow the increased popularity of cigarette smoking in Europe following the Crimean war which ended in 1856(14). However, the differentiation between centrilobular and panacinar/panlobular emphysema was first made in 1952 by Gough studying thin sections of lung mounted onto paper(15). Serial sections made by Leopold and Gough in 1957 showed that centrilobular emphysema was formed from the terminal orders, the second and third generations, of the respiratory bronchioles(16). Cigarette smoking is known to be a major risk factor for the development of COPD and accounts for 86% of COPD mortality for men and 69% of the mortality in women(17). In 1953, Oswald was the first to make the connection between obstructive lung disease, in this case chronic bronchitis, and cigarette smoking. His study of over 1,000 patients with chronic bronchitis found that only 5% were non-smokers(18). It was considered by the early researchers of obstructive lung disease such as Baillie(5) and Laennec(6) that lung function changes were due to the mucosal obstruction of the bronchioles known as obstructive bronchitis. This eventually led to the development of the British hypothesis for COPD, which claimed that chronic mucus hypersecretion 3 (CMH) initiated recurrent bacterial infections of the airway and led to the development of airway obstruction^ 9). In 1976, Fletcher studied the lung function measurements of men in London, England and established that C M H , while commonly occurring with airway obstruction, was a separate entity from progressive airway obstruction(20). This study challenged the theory that C M H was a causative factor in airway obstruction though more recently it has been associated with increased lung function decline in patients with severe COPD (see page 18, section 1.4 Pathology). An additional outcome from this study was that lung function measurements became the primary means to establish airway disease in patients with COPD. 1.2 Diagnosis In the last decade, several groups have made progress in defining and providing diagnostic classifications for COPD(2, 21-23). The most recent of these is the Global Initiative on Obstructive Lung Disease (GOLD) classification made by the World Health Organization (WHO) and the United States National Heart, Lung and Blood Institute (NHLBI). According to the GOLD standard, COPD is defined as "a disease state characterized by airflow limitation that is not fully reversible. The airflow limitation is usually both progressive and associated with an abnormal inflammatory response of the lungs to noxious particles orgases"(2, 24). This definition excludes asthma which is reversible with bronchodilator treatment or time and other respiratory diseases, including cystic fibrosis, tuberculosis, or bronchiectasis, which can cause airflow limitation but have different etiologies and symptoms. 4 The GOLD classification for COPD is based strictly on lung function measurements (see below) and does not consider pathological structural changes such as emphysema that result in obstruction. Other classifications for COPD have included emphysema in their description with the latest definition of emphysema made by the NHLBI as "a condition of the lung characterized by abnormal permanent enlargement of the airspaces distal to the terminal bronchioles accompanied by destruction of their walls and without obvious fibrosis"(25). Diagnosis of COPD is made through spirometric measurements on symptomatic patients, primarily those with chronic cough and sputum production, dyspnea, and a history of exposure to known risk factors for this disease such as cigarette smoking, alpha-1-antitrypsin deficiency, or exposure to noxious gases. According to the GOLD classification COPD is divided into 5 stages of disease depending on post-bronchodilator measurements of forced expiratory volume in 1 second (FEVi), which is the maximum amount of air that can be exhaled in 1 second, and the ratio of F E V i and Forced Vital Capacity (FVC), also referred to as F E V i / F V C , where F V C is the total volume of air that can be exhaled. These criteria were selected due to their ease for diagnosis in a clinical setting though confounding effects of increased variability of lung function with age and of non-related diseases on lung function reduce the accuracy of this diagnosis. • Stage 0 is the 'at risk' group and includes cigarette smokers or those with known risk factors (See 1.3 Epidemiology) who have chronic cough and 5 sputum production but whose lung function is normal with F E V i >80% predicted and F E V i / F V C > 70%. • Stage 1 has 'mild' COPD with lung function of F E V i > 80% and F E V , / F V C < 70%. • Stage 2 has 'moderate' COPD with lung function of 50% < F E V i < 80% and F E V i / F V C < 70%. • Stage 3 has 'severe' COPD with lung function of 30% < F E V i < 50% and F E V i / F V C < 70%. • Stage 4 has 'very severe' COPD with lung function of F E V i < 30% and F E V i / F V C < 70%. 1 . 3 Epidemiology Currently COPD is the fourth leading cause of mortality and morbidity in the U.S.A. and is projected to become the third most prevalent health concern by the year 2020(26). Worldwide, COPD is projected to become the fifth highest burden on global morbidity and mortality(27). Mortality associated with COPD and decreased lung function is increased in patients with severe disease relative to those with mild or no disease(28). In addition to the respiratory effects of COPD, decreased lung function has also been found to be associated with increased mortality from other non-respiratory diseases such as cardiac failure (29, 30). 6 Like many other chronic diseases, a variety of genetic and environmental factors must be taken into account for the development of this disease. The most important risk factor for the development of COPD is tobacco smoking. While smoking is the major risk factor for the development of COPD, only 15 to 20% of heavy smokers actually go on to develop this disease(20, 31). This suggests that a large genetic component, which is still largely unknown, determines which cigarette smokers later go on to develop airflow obstruction(32). Overall, smoking accounts for 85% to 90% of all COPD in men of industrialized countries(33) with women having a higher incidence of COPD compared to men(34). Other risk factors include age with elderly individuals having lower lung function, exposure to noxious fumes other than tobacco such as biomass fuels(35) or cadmium aerosols(36), asthma(37) and birth weight with a lighter birth weight associated with lung function impairment later in life(38). The only well characterized genetic component of COPD is the alpha-1-antitrypsin deficiency. Alpha-1-antitrypsin is a neutrophil elastase inhibitor that was first isolated by Schultze in 1962(11) and was found to inhibit trypsin activity in vitro. With the discovery in 1964 by Eriksson of a family with several members with severe obstructive lung disease who also carried an inherited mutation in the alpha-1-antitrypsin gene that resulted in reduced activity of this protein, the association between alpha-1-antitrypsin deficiency and emphysema was made(12). Based on genetic population screenings the prevalence of heterozygotes for this mutation has been found to be near 5% in Swedish populations(39). In other populations the frequency of this mutation is much lower with only 2% frequency in Southern Europe and close to 0% in Japan(40). Even among 7 individuals with this deficiency there exists a large variation in the presence and extent of emphysema. Larsson reported in 1978 that cigarette smoking was a key factor in the development of this disease in affected individuals(41). The form of emphysema that develops in those with this deficiency is predominantly panlobular emphysema which primarily affects the lower lobes as opposed to the centrilobular form found in most other COPD patients (see 1.4 Pathology)(42). 1.4 Pathology While COPD is defined as a disease characterized and diagnosed by airflow limitation, there are several pathological features that contribute in varying degrees to this disease. The first is the destruction of the parenchyma as seen in emphysema. The loss of alveolar attachments to the airways can result in the partial collapse of these airways resulting in a reduced luminal diameter and increased resistance to airflow(43, 44). The destruction of the parenchyma will also result in a loss of elastic recoil in the lung reducing the ability of the patient to generate force upon exhalation(45). Second is the remodeling of the airways, possibly as a reaction to the inflammation, which results in thickening of the peripheral airway walls and reduction in luminal diameter(46). The third is reduction in the mucociliary clearance of the airways in conjunction with increased mucous production resulting in the formation of mucous plugs that obstruct airflow through the airways(47). Several studies have been conducted to determine which region is most significantly involved in airflow resistance and have determined that the small peripheral airways, those less than 2 millimeters in diameter, are the 8 primary region of increased airflow resistance in COPD(48,49). This suggests that mechanisms such as remodeling of these airways would be the primary contributor to reduced lung function(46). To understand the pathology of lung disease requires an understanding of the basic structure of the respiratory tract and anatomy of the lung(50). The function of the lungs is to permit gas exchange between the blood and the surrounding air. To accomplish this, lungs are structured to have a very large surface area to volume ratio. The site of gas exchange is at the alveoli, which consist of small pouches of alveolar epithelial cells lining a meshwork of capillaries. To supply air to the alveolus, gases enter the body through the nose or mouth and are conducted into a branching respiratory tract beginning at a singular structure, the trachea. The trachea is a tubular structure consisting of epithelium, cartilage, muscle and connective tissue. The trachea branches into the left and right main stem bronchi which supply each respective lung, which in turn subdivide into the segmental and subsegmental bronchi for each lobe. These segmental bronchi are structurally reinforced with cartilaginous plates which after several successive divisions lose their cartilage and become bronchioles. The terminal bronchioles which are at around 1 -2 mm in diameter are lined with columnar epithelial cells and further divide into the respiratory bronchioles which have a few small alveoli lining their walls. The respiratory bronchioles empty into the alveolar ducts which branch for several more generations and end as alveolar sacs. These ducts and sacs supply the individual alveoli with air. 9 Gas exchange occurs at the alveolar surface which acts as the interface between the blood and the air. The cumulative surface area of the several hundred million alveoli within a normal human lung is 100 m 2 . This large surface area allows for a rapid exchange of gases but also requires an equally large surface area for the flow of blood which is provided by a highly segmented capillary bed between the respiratory arterioles and venules. The alveolar surface is covered by two main cell types, the type I and type II epithelial cells(51). The type I alveolar epithelial cells are squamous cells which line the walls of the alveoli and are very thin allowing for a short diffusion distance for gas exchange into the capillaries. The type II cells have a cuboidal shape and secrete surfactant which lowers the surface tension of fluid in the alveoli and prevent the alveoli from collapsing. At birth the alveolar surface is made up of alveolar duct like structures that are referred to as saccules with alveoli formed through a septation process to develop the saccules into ducts and alveoli. The alveoli develop from the septation of the terminal saccules which results in a large increase of the surface area of the lung(52) and in many animal models of emphysema, it is the disruption in the formation of the alveolar septae which causes the airspace enlargement in the lungs. The two predominant forms of emphysema found in patients with COPD are centrilobular and panacinar forms of alveolar destruction(53). The centrilobular emphysema, also known as centriacinar, proximal acinar, or periacinar, is the most common form found in cigarette smokers and is the result of destruction of the respiratory bronchioles with relative sparing of the distal alveolar ducts and sacs. In high-resolution computed tomography imaging (HRCT) this form of emphysema can be 10 viewed as areas of low attenuation surrounded by normal looking lung tissue and is primarily seen in the upper lung regions(54). The other major form of emphysema is panlobular emphysema and is, as discussed above, predominantly seen in patients with alpha-1-antitrypsin deficiency. This form of emphysema is distinguished by uniform destruction of the entire secondary lobule. This results in a lower density of the whole lung with a predominance for the lower lung regions(55). The mechanism by which these pathological features form has been the focus of many studies. One of the most important concepts to emerge is that the cigarette smoke induced inflammatory response in the lungs triggers these changes. An inflammatory reaction is a dominant component of the innate immune response to injury that has been most extensively studied in relation to infection. It is characterized by a local tissue response to injury associated with increased delivery of blood to the tissue and migration of inflammatory cells into the tissue(56). Cigarette smoking also induces a systemic inflammatory response that elevates the circulating white blood cell count and stimulates the liver to produce acute phase proteins(57-59). A study has shown an increase in the numbers of neutrophils, macrophages and lymphocytes with the loss of FEVi(46). Cigarette combustion results in the release of a variety of toxic aerosols and particulates that are inhaled into the lungs(31). Acute exposure to these components can result in both a local inflammatory response in the lung and a systemic inflammatory response resulting in an increase in neutrophil numbers in the blood and within the bronchial alveolar lavage fluid in humans 11 while animal models have also shown an increase in the number of macrophages(60). Chronic exposure can also result in increased macrophage numbers in humans(61). As well, CD8 positive cells have been detected in the lung parenchyma and pulmonary arteries in humans and this has been correlated with airflow limitation(62). While this in itself is only associative and not definitive to the pathogenesis of COPD, it lends support to one hypothesis, the protease-antiprotease imbalance hypothesis, which accounts for the role that inflammation has in this disease(63). The protease-antiprotease hypothesis suggests that disruption in the balance between protease and protease inhibitors resulting in excess protease activity causes an increased breakdown of collagen and elastin which leads to the development of emphysematous lesions. As inflammatory cells such as the neutrophils and macrophages are a major source of proteolytic enzymes, the inflammatory response is considered an important mechanism in disrupting the protease-antiprotease balance. These ideas stimulated many studies looking at the number of inflammatory cells and their proteolytic enzyme content in the lungs to understand their role in COPD disease pathogenesis. This hypothesis came about from studies of patients with alpha-1-antitrypsin deficiency who lack this important neutrophil elastase inhibitor as discussed above, as well as from studies of instilling papain(64) and other proteases(65) into lungs which results in the development of emphysema. Further evidence for this hypothesis is provided in studies showing increased matrix metalloprotease (MMP) activity in neutrophils and macrophages from patients with COPD(66, 67) as well as an increased ratio of M M P versus tissue inhibitors of M M P protein (TIMP)(68). Studies on animals have shown that macrophage derived 12 MMPs, in particular MMP-12, are required for cigarette smoke induced emphysema in mice(69). Inflammation through the increased number and activity of inflammatory cells can also increase the levels of reactive oxygen species that are present in the lung. Several species of radicals can be formed by phagosomes, primarily in neutrophils(70), which are used for their bactericidal properties but can also be involved in tissue injury(71). Lending support to the idea that oxidants play a role in COPD, studies have shown that smokers with obstructive lung disease have increased levels of oxidants present in their breath condensate compared to those without evidence of disease but the sources of these oxidants remains unknown(72, 73). Cigarette smoke is also a major source of reactive oxygen species which can contribute to the damage of the lungs with each inhalation containing up to 10 1 4 free radicals(74). While animal models suggest a role for inflammation in the development of emphysematous lesions, how inflammation causes the development of these lesions in humans is less clear. Another important mechanism by which emphysema could develop is through apoptosis or programmed cell death. Inflammation can lead to apoptosis through the cleavage of extracellular matrix by MMPs(75) resulting in loss of cell-cell(76) and cell-matrix contacts(77). Studies have shown an increased prevalence of apoptosis in the alveolar wall cells of emphysematous lungs compared to asymptomatic smoker's lungs(78) as well as upregulation of genes related to the apoptotic process(79). The role of cell death in emphysematous tissue destruction has also been tested in mice 13 where intratracheal injection of caspase-3, a pro-apoptotic molecule, along with a transfection reagent resulted in lung damage similar to emphysema(80). As well, oxidants produced by inflammatory cells or cigarette smoke may also play a role in triggering apoptosis by activating the signaling pathway(s) leading to cell death and the formation of emphysematous lesions through the inhibition of the repair process by triggering cell death on the edge of a wound and preventing the proper closure of the wound(81, 82). Studies in animals and human lungs have suggested that the apoptosis leading to emphysema could be the result of endothelial cell death in the alveolar walls as a result of reduction of vascular endothelial growth factor (VEGF) production and oxidative stress(83, 84). The second pathological feature of COPD is the remodeling that occurs in the airways due to the chronic inflammation and cumulative damage accrued through heavy cigarette smoking. The structure of the airway wall from the lumen of the airway into the tissue consists of the surface epithelium, the lamina densa of the basement membrane, the lamina reticularis of the basement membrane to the inner surface of the muscle, the muscle itself and the adventitia from the outer layer of the muscle to the secondary alveoli(85). The epithelium primarily consists of ciliated columnar epithelial cells with several types of secretory cells, including the goblet cells and the Clara cells, and is the primary barrier between the tissue and the outside environment(86). The basement membrane is a form of extracellular matrix that lies under the epithelial cells and provides sites for attachment and support for these cells(87). The submucosa consists of the layers between the basement membrane up to and including the smooth muscle layer 14 of the airways. This layer consists of the smooth muscle, blood vessels, fibroblasts and extracellular matrix as well as other connective tissue that makes up the wall. The adventia is the outer compartment and is composed of the regions beyond the smooth muscle including the cartilaginous layer and extracellular matrix within that region. The small peripheral airways are important in considering the pathology of COPD as studies have shown that they are the primary site of increased airway resistance in patients with COPD(48). The relationship between the airway lumen radius and airway resistance is mathematically described by the Poiseuille-Hagen formula(88). This formula states that the airway resistance is related to the inverse of the luminal radius to the power of four. For example, i f the airway lumen radius was to be halved, the resistance would increase 16 fold (24=16). Decrease in the luminal radii resulting in the increase in airway resistance of those with COPD is probably due to the increased thickness of the bronchial epithelium in these airways as the basement membrane of airways of all individuals remains constant(46) with the increase in the airway wall beneath the basement membrane having a reduced effect on the lumen as this thickening would radiate outward. Since the early study(48) which determined that the increase in airway resistance in COPD is found in the small airways, studies have focused on characterizing the cell types present in the small airways of those with COPD and have found inflammation with increased numbers of neutrophils, macrophages and lymphocytes(46). These airways have also been found to contain increased numbers of mucus secreting cells, smooth muscle cells as well as increased amounts of fibrosis around the airways(89). 15 The third characteristic of COPD is the increased mucus production in the airways which defines chronic bronchitis. This disease is defined as the presence of cough and sputum production on most days for a minimum of 3 months a year for 2 consecutive years(90). The hypothesis which supports a role for chronic bronchitis in COPD was developed in the 1950s and is commonly referred as the British hypothesis(91). According to this hypothesis, mucus over production results in reduced clearance of pathogens, chronic recurrent bacterial infections and colonization of the lungs, inflammation and an increase in the rate of decline in lung function as measured by FEVi. However, a seminal epidemiologic study designed to test this hypothesis on lung function found that while chronic bronchitis was present in a large proportion of patients with COPD, it was not associated with decline in lung function(20). Subsequent studies from the Copenhagen group confirmed this finding for heavy smokers at risk for COPD (GOLD 0) but also showed that in those with severe and very severe COPD (GOLD 3 and 4) chronic bronchitis was associated with a decline in lung function(92). This has never been confirmed but it is now recognized that in the later stages of the disease, chronic bronchitis is associated with increased number of exacerbations and greater decline in function(93-96). A second hypothesis, first proposed by Orie in the 1960s, postulated that the endogenous response to environmental factors led to the development of airway obstruction and that diseases such as asthma and COPD represented a continuum of the same disease(97). The basis of this hypothesis lies in the similarity between the pathological manifestations found between these lung diseases and the difficulty in separating non-bronchodilator 16 responsive asthma to a case of COPD with bronchial hyper-responsiveness and partially reversible airflow obstruction(22, 98). Other similarities involving inflammation and airway remodeling exist between the two diseases which support this hypothesis. Inflammation is a characteristic of both asthma and COPD but the specific leukocytes present in each disease were originally thought to be distinct with eosinophils and CD4+ T cells present in asthma and neutrophils and CD8+ T cells in COPD(99). However, recent studies have shown that, at least in a subset of patients with either disease, all these cells may be present(100,101). Airway remodeling is a prominent feature in asthma with increased numbers of mucus secreting goblet cells present in the airway which is similar to the goblet cell hyperplasia and increased mucus production present in chronic bronchitis. In addition to the physical similarities between asthma and COPD there also exists molecular similarities. Interleukin (IL)-13 is predominantly associated with a Th2 cytokine profile and is involved in most of the effector functions of a typical Th2 type reaction which is characteristic of asthma(102). However, studies using transgenic mice have shown that upregulation of IL-13 can lead to the development of emphysema and that this molecule could potentially be involved in COPD pathogenesis (see below 2.1.2 IL-13 Function)(103). Despite the similarities between asthma and COPD, differences in the remodeling of the airways between these two diseases exist. In the airways of asthmatics, the smooth muscle of the large airways is preferentially thickened compared to the thickening of smooth muscle in the small airways of COPD(104). Other differences involve epithelial injury and the thickening of the basement membrane found in asthmatics which may be partially due to chronic corticosteroid use(105). 17 Chapter 2: Cytokines and Growth Factors in COPD Cytokines and growth factors are intercellular messenger proteins which can trigger a variety of responses. Cytokines are released by inflammatory cells and provide specific directions to control the immune response(51). Growth factors are vital in triggering the development and differentiation of all cell types(51). As these proteins are what controls cellular responses to injury it becomes vital to detect and quantify these proteins to determine the function and fate of the cells within the tissue. In the case of fibrosis, several cytokines and growth factors are important in this pathway and include the cytokine IL-13 and the growth factors, transforming growth factor (TGF)-beta and platelet derived growth factor (PDGF)(106). 2.1 Interleukin-13 IL-13 is a cytokine closely related to IL-4, shares many functions with this cytokine and is a key molecule in mediating allergic inflammation(102). Many studies have focused on the role this cytokine plays in asthma pathogenesis and more recent studies have suggested that it may also play a role in the development of COPD and airway wall remodeling. 2.1.1 IL-13 Structure 18 IL-13 is a class I cytokine which is characterized by 4 alpha-helices in a hydrophobic core(107). Its gene consists of a single copy localized to chromosome 5 in a region which includes several other genes with immune and hemopoietic functions including IL-3, IL-4, IL-5, and GM-CSF(108). IL-13 is related to IL-4 but only 25% of its amino acids are identical, all of which are within the hydrophobic core(109) and accounts for the structural similarity in the arrangement of disulphide bonds within this core(l 10). This similarity can be seen by comparing the 3 dimensional structure of these two molecules(l 11, 112) and explains how they are also able to bind to and signal through the same receptor complex of IL-4Ralpha and IL-13Ralphal(l 13). IL-4 can bind to the common IL-4Ralpha which then complexes with the IL-2 receptor gamma chain(l 14), which is the common component for the receptors binding IL-2, 7, 9, and 15, as well as IL-4 and is necessary for conveying the intracellular signal(107). This dimer is referred to as the type I IL-4 receptor. IL-4Ralpha can also bind to and form a complex with the IL-13Ralphal protein; this is referred to as a type II IL-4 receptor(l 13). While IL-13 and IL-4 both bind to this common type II receptor complex, the affinity for these cytokines to bind to the individual components of the receptor differs(l 15). IL-4 binds initially to the IL-4Ralpha component and forms a complex with the IL-13Ralphal protein. IL-13 binds to the IL-13Ralphal component first and forms a complex with the IL-4Ralpha for signal transduction. IL-13 may also bind with high affinity to the IL-13 Ralpha2 which has an indeterminate biological function and may in fact be an inhibitor of IL-13 function(116). 19 Signaling of the IL-13 ligand is through the JAK/STAT pathway(l 13, 117). IL-4Ralpha can bind to JAK1 while IL-13Ralphal binds to Tyk2, both of which are part of the J A K family of tyrosine kinases. Activation of the JAKs results in phosphorylation of the cytoplasmic domain of the IL-4Ralpha tyrosines which forms a docking site for STAT6 binding to the receptor and subsequent activation through phosphorylation. Activated STAT6 dimerizes and localizes to the nucleus to initiate gene transcription though how differentiation of gene expression can arise between activation by IL-4 or IL-13 is unknown. 2.1.2 IL-13 Function IL-13 has many functions that are relevant to allergic inflammation and pathogenesis, which make this molecule a prime candidate in the study of asthma. While IL-13 is unable to bind T cells and cause their differentiation and initiation of a Th2-type response and trigger an allergic reaction(l 18) it is able to promote many of these effects. IL-13 is able to activate B-cells and induce their production of IgE. This IgE, in turn, can bind to mast cells to activate and prime them (119,120). IL-13 is also able to upregulate the expression of adhesion molecules CDI lb, CDI lc , CDI 8, and CD29 on monocytes and macrophages(121). IL-13 can induce production of vascular cell adhesion molecule-1 on endothelial cells which in turn can recruit eosinophils(122). In addition to its effects on inflammatory cells, IL-13 can be involved in the changes in airway structure and responsiveness. The ability of IL-13 to remodel the airways is important in asthma pathogenesis and is what makes this molecule relevant to the 20 progression of COPD. IL-13 is able to promote airway wall fibrosis through proliferation of fibroblasts via upregulation of PDGF and its receptor(123) (for the role that PDGF plays in the fibrotic response, see below). As well, it has been demonstrated that IL-13 is able to upregulate the production of the pro-fibrotic mediators TGF-betal in macrophages(124) and TGF-beta2 in bronchial epithelial cell cultures(125) (for the role that TGF-beta plays in the fibrotic response, see section 2.2 below). IL-13 can decrease ciliary beat frequency and promote the differentiation of epithelial cells to a secretory cell type(126) which would result in a goblet cell metaplasia(127). This could also allow IL-13 to play a role in the increased mucus production present in chronic bronchitis. The foremost evidence suggesting a role for IL-13 in COPD was made using transgenic mice that can inducibly produce IL-13 in airway Clara cells. The upregulation of IL-13 results in mice displaying a matrix metalloprotease and cathepsin dependent emphysema with airway wall fibrosis with morphological similarities to that present in patients with COPD(103). 2.2 Transforming Growth Factor-beta TGF-beta has been the focus of many studies and reviews regarding its strong association with fibrosis and wound healing. Its name originates from the initial findings that TGFs are able to promote differentiation in cancer cell lines(128). This molecule has also been found to be involved in many pathological conditions that result in fibrosis such as idiopathic pulmonary fibrosis(129) as well as in animal models of fibrosis such as mice whose lungs are instilled with bleomycin(130). In addition to its fibrotic effects, TGF-21 beta has anti-inflammatory properties with the ability to suppress T-cell(131) and macrophage(132) activity. 2.2.1 TGF-beta Structure The TGF-beta superfamily is composed of over 35 proteins with diverse functions ranging from development to fibrosis and inflammation(133). The common element between the members of this family is a six to nine conserved cysteine domain in the mature region of the protein allowing for the formation of intra and intermolecular bonds. Of this superfamily, three proteins have been found to be highly involved in profibrotic and anti-inflammatory activities. These proteins (TGF-betal, TGF-beta2, and TGF-beta3) are highly homologous with 60-80% sequence identity and share common receptors and signal transduction pathways(134). TGF-betas are usually secreted as a biologically inactive form as a consequence of the intramolecular binding of its latency-associated peptide (LAP). The L A P domain is cleaved by a furin-like endoproteinase from the mature TGF-beta protein but L A P remains non-covalently bound to the mature portion of the TGF-beta masking its active domain(135). The L A P can form a disulphide linkage with the latent TGF-beta binding protein (LTBP) which is associated with extracellular matrix proteins and sequesters the latent TGF-beta to the matrix(136). The activation of TGF-beta is through dissociation of L A P from the active portion by proteolysis of the L A P or by conformational changes in the structure of L A P through binding with another molecule causing the binding sites on the active portion of TGF-beta to be revealed. An example of a proteolytic activator of TGF-beta is plasmin, which 22 is involved in the fibrinolytic pathway and clot formation(137). Activation through conformational changes may be mediated by thrombospondin-l(138) or the surface integrin protein alpha-v beta6 by binding to the L A P domain on inactive TGF-beta and inducing a conformational change to reveal its active site(139, 140). Upon activation, TGF-beta binds to the type I and type II receptors found on multiple cell types. Initially, the TGF-beta ligand binds the constitutively active type II TGF-beta receptor and then a complex consisting of the two type II and two type I receptors is formed. Subsequently, type II receptors phosphorylate the type I receptors which then activate a signaling cascade involving the phosphorylation of intracellular S M A D proteins. There also is a type III receptor that includes the receptors endoglin and betaglycan, which preferentially binds the TGF-beta2 isoform and aides in the formation of the complex with the type II receptor(141). The ability of type III receptors to modulate TGF-beta signaling is demonstrated by a study in which overexpression of the type III receptor endoglin suppressed Smad3 signaling(142). SMADs are the principle pathway for TGF-beta signaling and are divided into three classes based upon their biological function. The receptor activated S M A D (R-SMAD) includes SMAD1, 2, 3, 5, and 8 of which SMAD2 and 3 are the principle SMADs phosphorylated by TGF-beta receptor activation(143, 144). The R - S M A D then forms a heterodimer with the common partner S M A D (Co-SMAD) SMAD4 protein and translocates to the nucleus to activate gene expression(145). The inhibitory SMADs (I-SMAD), SMAD6 and 7, can inhibit this pathway by binding to the type I TGF-beta 23 receptor and prevent phosphorylation and subsequent nuclear translocation of SMAD2 and 3 preventing downstream gene activation(146,147). TGF-beta is also able to upregulate SMAD7 in a feedback mechanism to abrogate the cellular response(148). In addition to the S M A D signaling pathway, TGF-beta receptors are able to signal through three classes of mitogen activated protein kinase (MAPK) signal transduction pathways, ERKs, JNK and p38(149). The p44 M A P K , ERK1(150), and p42 M A P K , ERK2(151), are highly homologous proteins which were the first mammalian M A P K to be studied and play a dominant role in the G-protein Ras and Raf mediated M A P K pathway(152). The c-Jun amino-terminal kinase (JNK) is part of a M A P K pathway that is primarily activated through cytokines and stress(153). This pathway can be activated by phophorylation of JNK via the M A P K kinases M K K 4 and M K K 7 which themselves are activated by a host of M A P K kinase kinases including TGF-beta activated kinase (TAK1) and its binding protein, TAK1 binding protein (TAB1)(154, 155). The p38 M A P K is another stress and inflammation associated kinase which can also be activated through M K K 4 as well as the kinases M K K 3 and MKK6(156). 2.2.2 TGF-beta Function The cytokine TGF-beta is a key factor in the fibrotic and inflammatory response and has been constantly linked to fibrosis in the lungs and other organs by experimental studies and association studies in humans. In addition or because of its role in controlling matrix and inflammatory responses, TGF-beta is also essential for the proper development of 24 organ systems as demonstrated by the developmentally lethal defects found in mice in which TGF-beta2 or TGF-beta3 have been disrupted(157, 158). Knockout of TGF-beta2 in these mice did not result in any noticeable gross abnormalities in the lungs prenatally but resulted in collapsed conducting airways postnatally(159), probably arising from disruption in the proper development of lung branching(l 60). Knockout of the TGF-beta3 gene resulted in severe abnormalities in the development of the lung with disruptions in alveolar septation. Mice with disruption in TGF-betal expression have only a 50% viability at birth and develop lethal inflammation shortly thereafter(161). The importance of TGF-beta to lung pathology goes beyond the developmental defects arising from these null mice studies above and includes processes involving airspace enlargement similar to what is found in COPD. Disruption of the integrin alpha-v beta6, which normally would activate TGF-beta, resulted in increased expression of M M P 12 and an emphysematous phenotype in transgenic mice(162). The signaling molecule activated by TGF-beta, SMAD3, when disrupted can also lead to an emphysematous phenotype associated with increased expression of MMP9 and MMP12(163) suggesting that TGF-beta normally suppresses M M P expression. While disruptions in activation of TGF-beta results in poor development and increased expression of metalloproteinases; its activation, on the other hand, can result in myofibroblast activation and fibrosis(164, 165). Fibrosis is the product of an increase in the extracellular matrix, primarily as a response to injury in an attempt to repair the wound, resulting in increased collagen deposition(166). The collagen is produced through activated myofibroblasts, which have a cell phenotype with features of both 25 smooth muscle cells and fibroblasts, in that they are able to express the contractile protein alpha-smooth muscle actin and also have the ability to synthesize and release collagen and other matrix proteins. Activation of myofibroblasts is through TGF-betal or TGF-beta2; TGF-beta3 does not seem to be able to activate this cell type(167). In addition to increased collagen expression, TGF-beta can also affect the regulation of M M P and its inhibitor, tissue inhibitor of metalloproteinase (TIMP), by inhibiting M M P expression and increasing the expression of TIMP, resulting in reduction in collagen degradation and increased fibrosis(168). Intratracheal instillation of TGF-betal in mice increased the expression of type 1 and type 3 collagen in the subepithelial layer of the airways resulting in peribronchial fibrosis(169). Airway smooth muscle cells are able to release TGF-betal and TGF-beta2 as well as plasmin, which can activate TGF-beta through cleavage of the L A P domain, resulting in the autocrine stimulation and synthesis of collagen 1(170). Further studies have tried to elucidate the specific signal transduction pathways activated by TGF-beta that result in fibrosis. In retinal pigment epithelial cells, TGF-beta2 upregulates the expression of type 1 collagen through the p38 pathway(171). In airway smooth muscle cells, TGF-betal, through E R K and JNK, upregulated connective tissue growth factor (CTGF) expression(172). Some of the profibrotic effects of TGF-beta are mediated by CTGF which is released by fibroblasts following stimulation with TGF-beta(173). CTGF can promote proliferation 26 and collagen production in fibroblasts and functions to enhance and prolong the fibrotic response induced by TGF-beta(174). 2.3 Platelet Derived Growth Factor PDGF is another mediator that is central to the fibrotic response and is involved in the proliferation of myofibroblasts and their activation to produce collagen(106). Upregulation of PDGF has been found in such fibrotic lung diseases as idiopathic pulmonary fibrosis(175) and obliterative bronchiolitis(176). 2.3.1 PDGF Structure The four PDGF genes specify 4 distinct isoforms that can be divided into two groups. The first to be discovered were the PDGF-A and PDGF-B forms which share 50% amino acid sequence homology with each other and, later, a second group of PDGFs were discovered, PDGF-C and PDGF-D, which also share 50% amino acid homology with each other(177). A l l four isoforms together have only a 25% homology. A l l PDGF isoforms have a highly conserved region of 100 amino acids which shares a similar motif to one found in VEGF. This conserved region contains a cysteine residue involved in intra and intermolecular bonding which allows the dimerization of PDGF to occur for formation of its active complex. The PDGF ligands form disulphide bonded homo and hetero dimers to bind to their receptors with PDGF-C and PDGF-D differing from the other two ligands in that they only form homodimers. A l l forms of PDGF require 27 proteolytic cleavage of a propeptide form to allow dimerization and activation. PDGF-A and PDGF-B undergo intracellular cleavage of a short N-terminal region by the protease furin in the endoplasmic reticulum before dimerization and release from the cell. PDGF-C and PDGF-D contain a longer N-terminal CUB domain which allows the protein to form protein-protein and protein-carbohydrate bonds and must be cleaved off by protease enzymes for its activation(178, 179). The PDGF dimers bind to their receptors in a specific fashion depending on which ligands are present in the dimer. The dimers PDGF-AA, PDGF-AB, PDGF-BB, and PDGF-CC all bind to and activate a receptor complex composed of two PDGF-Ralpha proteins. The homodimers PDGF-BB and PDGF-DD bind to and activate the receptor complex composed of two PDGF-Rbeta proteins. A heterodimeric complex composed of PDGF-Ralphabeta can be activated by the dimers PDGF-AB, PDGF-BB, and PDGF-CC. 2.3.2 PDGF Function The main function of PDGF is that of a growth factor for smooth muscle and myofibroblast proliferation. This protein is also involved in tumour growth either as an autocrine signal for growth of the tumour or by allowing the formation of new blood vessels to the tumours(180). Transgenic mice have been created with varying levels of PDGF activity to study the function of these proteins(181). Mice lacking functional PDGF-A have a lethal phenotype with death occurring from embryonic day 10 to postnatal 60 days with this variation dependent on genetic background. These null mice 28 have defects in alveologenesis of the lungs resulting in enlarged airspaces possibly due to lack of alveolar smooth muscle cells and elastin deposits(182). Mice null for the ligand PDGF-B or PDGF-Rbeta are embryonic lethal and have developmental deficiencies pertaining to the lack of growth of vascular smooth muscle cell progenitors in the development of new vessels(l 83, 184). PDGF-Ralpha nulls are also embryonic lethal with a functional phenotype similar to PDGF-A nulls with failure of alveolar septal formation(185) possibly due to lack of alveolar smooth muscle cell development and subsequent septal elastin deposition(186). In addition to its role in lung development, PDGF also plays a key role in fibrotic diseases by stimulating replication and migration of myofibroblasts^ 06). PDGF isoforms have been found to be upregulated in several fibrotic lung diseases(176, 187, 188) though its significance in COPD progression remains uncertain. Studies on transgenic mice with overexpression of PDGF-B suggest that this protein may be involved in the pathogenesis of COPD as this mouse has a phenotype characterized by emphysema and fibrotic lesions(189). In lung fibroblasts, PDGF-Ralpha is an inducible factor stimulated by IL-lbeta and the p38 M A P K pathway(190). Bronchial epithelial cells(191) and macrophages(192) from patients with COPD have a greater ability to release IL-lbeta upon stimulation suggesting that PDGF-Ralpha would also be upregulated in these individuals. 29 Chapter 3: Research 3.1 Working Hypothesis Myofibroblasts are key cells in the production of connective tissue matrix in fibrotic disease and could have a role in the development of the peribronchial fibrosis present in the airways of patients with COPD. The experiments reported here are based on the working hypothesis that factors which contribute to the stimulation of myofibroblast proliferation and to the activation of collagen production by these cells are responsible for the small airway wall thickening associated with the progression of COPD. 3.2 Specific Aims The experiments designed to test this hypothesis are focused on detecting and quantifying cytokines and growth factors involved in the regulation of myofibroblasts in the airway wall of patients with COPD. The cytokines and growth factors analyzed included IL-13, all three isoforms of TGF-beta (TGF-betal, TGF-beta2, TGF-beta3), the activated form of the signal transduction factor for TGF-beta (phosphorylated SMAD2/3), the isoforms of PDGF and their receptors (PDGF-A, PDGF-B, PDGF-Ralpha, PDGF-Rbeta), as well as a growth factor which specifically regulates collagen production (CTGF). These proteins were studied in the lung tissues with emphasis on the airways of patients who smoked and maintained normal lung function compared to those with various levels of 30 COPD severity. This research involved quantifying the amount of protein using immunohistochemistry and image analysis software and measuring mRNA expression by quantifying TGF-beta mRNA through quantitative real-time PCR and its localization through in situ hybridization. To accomplish this, the research was divided into 3 parts: 1. Immunohistochemistry with antibodies specific to IL-13, TGF-betal, TGF-beta2, TGF-beta3, phosphorylated SMAD2/3, PDGF-A, PDGF-B, PDGF-Ralpha, PDGF-Rbeta, and CTGF will be used to identify these proteins. Immunostaining will be localized with quantification of the level of staining present in the bronchial epithelial tissue of the airways performed using image analysis software. 2. Use quantitative real-time PCR to determine the TGF-beta mRNA content within whole lung samples. 3. Use in situ hybridization with R N A probes to localize the expression of TGF-beta mRNA within these tissues. 31 Chapter 4: Methods and Materials 4.1 Immunohistochemistry The purpose of these experiments is to determine the quantity of the proteins, IL-13, TGF-betal, TGF-beta2, TGF-beta3, phosphorylated SMAD2/3, PDGF-A, PDGF-B, PDGF-Ralpha, PDGF-Rbeta, and CTGF, in the lung tissue of patients with varying severities of COPD. Measurements were performed to compare the levels of these proteins on the bronchial epithelium of the airways of these patients to levels in a group of smokers without obvious airway dysfunction. To test whether the TGF-beta proteins are active and have an effect on the tissue, staining was done on the activated form of the signal transduction protein S M A D that is specific for TGF-beta activity using an antibody specific for phosphorylated SMAD2/3. Due to the structural differences in the PDGF isoforms, the specificity of the antibodies for the PDGF dimers has an unusual binding pattern. The antibody specific for PDGF-B will bind to PDGF-B as part of the heterodimer PDGF-AB or as part of the homodimer PDGF-BB. Also, the antibody specific for PDGF-A will only bind to PDGF-A as part of the homodimer P D G F - A A and as this ligand will only bind to the PDGF-Ralpha homodimer complex, PDGF-AA should be functionally distinct from the other dimer complexes. 4.1.1 Case selection for Immunostaining Studies 32 Tissue samples for immunohistochemistry were obtained from the National Emphysema Treatment Trial (NETT) study on the efficacy of lung volume reduction surgery on patients with COPD as well as from the lung registry at St. Paul's Hospital from patients undergoing lung resection for tumour removal. The advantage of using tissue from the NETT study is that samples from more severe cases of COPD (GOLD class 3 and 4, F E V i < 50% and < 30%) are available which would not otherwise be available from patients undergoing lung resection since such low levels of lung function exclude them as candidates for surgery. The selection of tissue for this study was based on the GOLD classification of the patients with 11 cases chosen from each of GOLD 0, 1, and 4 and 10 cases from GOLD 3. The lack of GOLD 2 cases is due to changes in the GOLD classification that were made after selection of these tissue samples. Lung function and smoking history for these patients are shown in Table 1 (see page 34). 4.1.2 Selection of Tissue and its Processing for Immunostaining Lung tissue from patients undergoing lung volume reduction surgery was fixed by immersion in formalin while the tissue from lung resection for tumour removal was first inflated to 20 cm H2O then fixed by immersion in formalin. This tissue was then embedded in paraffin. The formalin-fixed, paraffin embedded tissue was sectioned as 4 (im sections and placed on Histobond microscope slides (Marienfeld, Bad Mergenthein, Germany) then heated at 37°C overnight to ensure bonding of the tissue to the slide. Blocks of sectioned lung tissue were screened to include a minimum of three small, non-cartilaginous airways with one block per patient fitting this criterion used in this study. 33 Table 1: Lung function, smoking history, and age of the patients selected for immunohistochemical analysis of their lung tissue. Except for the indicated samples, all others were used for staining of all proteins of interest. * indicates sample immunostained for IL-13, TGF-betal, TGF-beta2, PDGF-B, PDGF-Ralpha, PDGF-Rbeta, and CTGF. ** indicates sample immunostained for IL-13, TGF-beta2, TGF-beta3, and PDGF-A. Case# GOLD Class FEV, / FVC FEV, Pk Year Age Case# GOLD Class FEV, / FVC FEV, Pk Year Age 1251 0 77.8 84.2 21.8 59 6099 3 33.9 44.0 75.0 68 1256 0 71.9 86.9 28.8 64 6139 3 35.8 30.1 33.0 66 1873 0 79.5 97.0 30.0 50 6147 3 35.2 32.1 70.5 68 1912 0 70.1 92.1 21.5 71 6148 3 31.1 37.8 76.5 71 1944 0 82.9 84.5 26.0 57 6164 3 41.0 39.9 64.5 74 1979 0 80.8 86.8 17.0 66 6171 3 46.0 40.2 43.0 65 3411 0 82.8 90.7 38.0 58 6178 3 36.1 33.1 48.0 52 3491 0 77.3 94.8 40.0 76 6179 3 28.3 33.0 36.0 69 5907 0 74.5 96.3 15.0 71 6181* 3 42.0 32.1 60.0 67 6091 0 75.5 85.6 36.0 70 6217** 3 41.9 31.8 68.0 71 6096 0 75.4 84.0 24.0 68 6220 3 29.5 36.4 78.0 66 860 1 64.0 100.9 28.0 72 6078 4 36.7 24.0 47.0 66 1472 1 59.9 87.7 100.0 65 6079 4 24.0 24.0 105.0 69 1740 1 68.8 107.1 0.0 68 6082 4 40.0 24.2 74.0 68 1778 1 63.1 86.8 21.0 62 6100 4 26.9 25.6 69.0 75 2091 1 69.5 100.1 32.5 76 6142 4 34.5 26.5 55.5 66 2281 1 67.9 85.6 49.5 49 6143 4 26.2 16.4 51.0 59 3400 1 63.9 85.3 49.0 61 6145 4 25.6 16.2 112.5 68 6088 1 68.6 84.1 49.0 69 6165 4 31.1 20.7 43.0 65 6093 1 62.0 82.2 44.0 65 6167 4 35.7 25.2 46.0 66 6101 1 68.3 101.1 28.0 65 6182 4 30.0 17.0 26.0 60 6191 1 65.0 101.3 50.0 69 6221 4 31.4 25.5 61.0 71 34 Prior to immunostaining, the slides were deparaffinized by a series of alcohol washes. This involved 2 washes of 10 minutes each in Citrosol followed by 2 washes of 5 minutes each in 100% isopropanol, once in 90% isopropanol and once in 70% isopropanol. The slides were then washed in water and are ready for subsequent immunostaining. 4.1.3 Immunostaining for IL-13, TGF-betal, and pSMAD2/3 After deparaffinization, the slides were placed on a staining tray and the tissue was covered in Tris-buffered saline (TBS) (0.05M Tris base, 0.9% NaCl, pH 7.6) with 0.1% Tween 20 (TBS-Tween). The TBS was made by adding one part lOx TBS stock made from 6.05 g tris methylammonium chloride in 100 ml H2O, pH 7.6, and one part lOx NaCl stock made from 9.0 g NaCl in 100 ml FJ_0 and eight parts H_0. Blocking of biotin present in the tissue was through the Avidin/Biotin Blocking Kit (Vector Laboratories, Burlingame, CA , USA). Non-specific binding sites were blocked with 100 LLL D A K O Protein Block (DAKO, Carpinteria, CA, USA). The slides were drained and the area around the tissue was wiped clear to prevent any liquid from spreading out. A polyclonal rabbit primary antibody specific for IL-13 (H-l 12: sc-7901) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) was diluted 1:400 (0.5 pg/mL) in TBS with 1% bovine serum albumin (TBS-BSA) and 100 LLL placed on top of the tissue. The staining tray with the slides was then place in a fridge at 4°C overnight. Unbound primary antibody was rinsed off by washing twice in TBS-Tween for 5 minutes each. The secondary antibody was a biotinylated goat anti-rabbit antibody (DAKO A/S, Denmark) which was diluted 1:400 in TBS-BSA buffer and placed on the tissue for 30 minutes. 35 This was washed off twice with TBS-Tween for 5 minutes each. The enzyme alkaline phosphatase conjugated to avidin/streptavidin (ABComplex/AP kit, D A K O A/S, Denmark) which binds to the biotinylated secondary antibody was added for 30 minutes. This was rinsed off by 3 washes of TBS-Tween for 5 minutes each. Finally, 200 |0.L of the substrate New Fuchsin (see below) was added for 20 minutes for chromogenic detection of the enzyme resulting in a red colouring localized to the antibody and enzyme complex. The slides were then counterstained with Mayer's Haematoxylin for 30 seconds resulting in a blue staining of the nuclei. The slides were then air dried and coverslipped using Entellan (EM Science, NJ, USA). New Fuchsin substrate solution was made by mixing 100 fiL 5% New Fuchsin in 2N HC1 and 250 joL of freshly prepared 4% aqueous sodium nitrite in an Erlenmeyer flask for 1 minute. Following this, 50 mL of TBS, pH 8.7, and 50 | i L of 1M Levamizole were added to the mixture, the latter to inactivate any alkaline phosphatases present in the tissue. Next, 25 mg of Naphol AS-B1 phosphate was dissolved in 300 (iL dimethylformamide and mixed into this solution. The mixture was then filtered through a Whatman paper filter and was used immediately. The protocol for staining of TGF-betal or pSMAD2/3 was the same as for IL-13 except the primary antibody was a rabbit polyclonal antibody specific for TGF-betal (V)(sc-146) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted at 1:3000 (0.075 pg/mL) in TBS-BSA or pSMAD2/3 (sc-11769-R) (Santa Cruz Biotechnology, Santa Cruz, C A , USA) diluted at 1:2000 (0.1 ug/mL) in TBS-BSA. 36 4.1.4 Immunostaining for T G F - b e t a 2 and T G F - b e t a 3 After deparaffinization, the slides were placed in a staining tray and covered with TBS-Tween. Non-specific binding sites were blocked with 100 | i L D A K O Protein Block (DAKO, Carpinteria, CA, USA). The slides were drained and the area around the tissue was wiped clear to prevent any liquid from spreading out. A monoclonal mouse primary antibody specific for TGF-beta2 (MAB612) (R&D Systems, Minneapolis, M N , USA) was diluted 1:40 in TBS with 1% bovine serum albumin (TBS-BSA) and 100 oL placed on top of the tissue. The staining tray was then placed in a fridge at 4°C overnight. Unbound primary antibody was rinsed off twice with TBS-Tween for 5 minutes each. The secondary antibody was a rabbit anti-mouse antibody (DAKO A/S, Denmark) which was diluted 1:62.5 (8.0 p,g/mL) in TBS-BSA buffer for 30 minutes. Unbound antibody was rinsed off twice with TBS-Tween for 5 minutes each. The enzyme alkaline phosphatase conjugated to a mouse IgG (APAAP, Dako A/S, Denmark) was diluted 1:80 in TBS-BSA prior to adding to the slide for 30 minutes. This was rinsed off by 3 washes of TBS-Tween for 5 minutes each. Finally, 200 | i L of the substrate New Fuchsin was added for 20 minutes and counterstained with Mayer's Haematoxylin for 30 seconds. The slides were then air dried and coverslipped. The protocol for staining of TGF-beta3 was the same as TGF-beta2 except the primary antibody was a mouse monoclonal antibody specific for TGF-beta3 (MAB643) (R&D Systems, Minneapolis, M N , USA) diluted at 1:100 (5.0 ug/mL) in TBS-BSA. 37 4.1.5 Immunostaining for PDGF-A, PDGF-B, PDGF-Ralpha, PDGF-Rbeta, and CTGF Following deparaffinization, the slides were placed for 1 hour in a solution of citrate buffer (lOmM Sodium Citrate, 0.05% Tween 20, pH 6.0) preheated in a water bath to 95-100°C. The slides are then rinsed in TBS-Tween and placed in the staining tray. The rest of the protocol was the same as for IL-13 with the exception of the primary rabbit polyclonal antibodies. For PDGF-A, the primary antibody was N-30: sc-128 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted at 1:200 (1.0 pg/mL) in TBS-BSA; for PDGF-B, RB-9257-P1 (NeoMakers, Fremont, CA, USA) diluted at 1:200 (1.0 pg/mL) in TBS-BSA; for PDGF-Ralpha, C-20: sc-338 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted at 1:200 (1.0 pg/mL) in TBS-BSA; for PDGF-Rbeta, P-20: sc-339 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted at 1:200 (1.0 pg/mL) in TBS-BSA; and for CTGF, H-55: sc-25440 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted at 1:200 (1.0 pg/mL) in TBS-BSA. 4.1.6 Control Immunostaining For controlling non-specific staining during immunostaining, a non-specific antibody from either a purified mouse monoclonal IgGl isotype control (#557273, BD Pharmingen, San Jose, C A , USA) or a rabbit immunoglobin fraction (normal) negative control (X0903, Dako A/S, Denmark) that matched the primary antibody used to detect the protein target of interest at the same concentration as their respective primary 38 antibody, as mentioned above. In all cases, no staining was present in these control tissues. 4.1.7 Image Analys is for Stain Intensity The immunostained sections were examined with a Nikon microscope equipped with a SPOT camera using a 40x objective. Three randomly selected non-cartilaginous airways on one slide per case were chosen as this was the maximum number of these small peripheral airways available in every case following assessment of the available blocks of tissue. A n image of a random portion of the bronchiolar epithelium, randomly selected as being the first intact portion of bronchiolar epithelium that is encountered through a zigzag search pattern of the slide at 20x magnification, from each airway was captured. Then, using the image analysis software Image-Pro Plus (Media Cybernetics, Silver Spring, M D , USA), an outline of the area of interest (AOI) around the bronchial epithelium was drawn on each image to isolate the bronchial epithelium for measurements. A segmentation file was created to specify the colour threshold at which the software would measure the staining. This segmentation was made to maximize the amount of staining captured while excluding any background staining present. To ensure that no background staining would be included in the measurements, only a strong positive staining was selected for the segmentation. The software calculates the area of the objects defined by the segmentation and the area of the AOI and divides the two to give a volume fraction which the program describes as the per-area measurement. An average of the bronchial epithelial volume fraction from the three airways of each case 39 was made and used as the value for that case. Since blocks of tissue were selected with at least three airways per section, in those with more than three airways, the three were randomly selected. Due to the non-normal distribution of the data points, non-parametric statistics were used. Statistics were done using Mann-Whitney U test comparing the cases between each GOLD class. Bonferroni correction for multiple comparisons was used reducing the p-value for significance to 0.0085 for a cumulative alpha level of 0.05 for six measurements. For staining in other cell types, a table was generated to show i f any staining was found in those cells (+) or no staining was found at all (-). 4.1.8 Correlation of Airway Wall Thickness with Protein Expression The cases used in this experiment have also had morphological features of their airway walls quantified in a previous study. Due to the limitation on the number of sections available from a single block, different blocks from the same case were used in the current immunohistochemical study. The thickness of the airway wall and its subcomponents, including the epithelium, submucosa, smooth muscle, and adventitia, have been published elsewhere(46). This was accomplished by measuring the volume of these components by delineating each compartment with an AOI and calculating its area, then dividing this area by the inside perimeter to obtain the thickness of that airway wall component using the same image analysis software used to measure staining intensity of the bronchial epithelium (Image-Pro Plus). The average volume fraction of IL-13, TGF-betal, TGF-beta2, TGF-beta3, pSMAD2/3, PDGF-A, PDGF-B, PDGF-Ralpha, PDGF-Rbeta, and CTGF from each case was correlated to the airway wall component thickness 40 in the respective cases using statistical software program JMP (SAS Institute Inc, Cary, NC, USA). A regression analysis was performed and R-values were given for the correlation between protein content and wall thickness with a p-value calculated for whether there is a significant difference of the slope of the regression from 0. 4.1.9 Inter-Observer Error for Quantitative Immunohistochemistry A second observer who was not involved in the initial quantification completed an independent quantization of the immunostaining for TGF-beta2 in order to obtain an estimate of the reproducibility of the data. Regression analysis of the data from the two observers showed a high correlation between the two data sets with R = 0.95. 4.2 Quantitative Real-time Polymerase Chain Reaction To measure the expression of TGF-beta mRNA in the tissues from patients with COPD, the technique of quantitative real-time polymerase chain reaction (qRT-PCR) was used. This technique allows an absolute quantification of mRNA to obtain the exact number of copies of each transcript within the tissue and is sensitive enough for small sample quantities. 4.2.1 Sample Selection and Processing for Quantitative Real-time PCR 41 Since RNA extracted from paraffin-embedded lung tissue has been shown to be of lower quality than that from frozen tissue(193), frozen cores of lung tissue were used for the analysis of mRNA. The St. Paul's Hospital lung registry which has been described elsewhere (193) contains frozen lung tissues from over 150 cases from the GOLD 0, 1, and 2 groups. From these groups two sample sets were taken. For the first set, lung tissue cores from several patients in each GOLD class was selected based on the criteria that they contained at least one small, non-cartilaginous airway. The 31 cases selected included 9 GOLD 0, 11 GOLD 1 and 11 GOLD 2. Lung function measurements and smoking history of these individuals are given in Table 2a (page 43). For each case, one core from those matching the selection criteria was randomly chosen and had a 100 Ltm section cut on a cryomicrotome to be processed for RNA extraction. The qRT-PCR results from the first set (see section 5.2) suggested a large variability within each GOLD grouping and as COPD is a heterogeneous disease with the lung of one patient able to contain regions with severe emphysema as well as regions without any evidence of disease, we increased the number of cores used per case. For this second set, 9 cases were chosen, 3 for each GOLD class 0, 1, and 2. For each case all available cores were used, regardless of the airway components, which resulted in the number of cores for each case ranging from 9 to 19. From each core a 100 Ltm section was taken and the RNA was extracted. Lung function measurements for these individuals are given in Table 2b (page 43). 42 Table 2: L u n g f u n c t i o n o f t h e p a t i e n t s s a m p l e d f o r q u a n t i t a t i v e R T - P C R . A ) T h e c a s e s u s e d f o r q R T - P C R i n w h i c h o n e s a m p l e p e r c a s e w a s a n a l y z e d . B ) T h e c a s e s u s e d f o r q R T - P C R i n w h i c h a l l t h e c o r e s a v a i l a b l e f o r that c a s e (# C o r e s ) w e r e a n a l y z e d . A) Case # GOLD Class FEV, FEV,/FVC Case # GOLD Class FEV, FEV,/FVC 2299 0 99 85 1991 2 73 65 3378 0 92 80 2142 2 63 62 3468 0 91 76 2169 2 62 63 5726 0 97 70 3395 2 75 68 5769 0 86 70 3469 2 77 61 5970 0 111 78 3489 2 72 66 6019 0 93 84 3490 2 69 68 6043 0 112 83 5837 2 61 60 6054 0 110 79 6055 2 61 60 2131 1 97 61 6332 2 63 61 2145 1 82 55 6337 2 61 50 2159 1 89 67 2281 1 86 68 3266 1 97 69 3267 1 84 68 3385 1 81 66 3408 1 82 69 6056 1 91 59 6191 1 101 65 6280 1 85 68 B) Case # GOLD Class FEV, FEV,/FVC # Cores 6018 0 87 120 11 6146 0 84 114 14 6412 0 74 97 19 2131 1 61 97 15 2281 1 68 86 10 6041 1 56 108 14 2169 2 63 62 12 2284 2 42 64 9 6097 2 58 73 14 43 4.2.2 RNA Extraction from Lung Tissue To extract the RNA from the tissue, the 100 Lim section from each core was placed in a 2 mL microcentrifuge tube. The tube was flash frozen in liquid nitrogen and the tissue was ground down using a metal stick to increase its surface area and prevent clumps of tissue forming when the lysis buffer was added (see below). To prevent cross contamination, the stick was cleaned with ethanol after each sample was crushed. After the tissue was ground into a fine powder, RNA was purified using a Qiagen RNeasy Fibrous Tissue mini kit (Qiagen, Mississauga, ON, Canada). Initially, a cell lysis buffer was added to the powdered tissue and, after dilution of the preparation, proteinase K added to digest the collagen fibers that are present in the sample and thus increase the yield of RNA. A DNase step using RNase-free DNase (Qiagen, Mississauga, ON, Canada) was also added to the procedure to degrade any residual DNA in the sample to prevent contamination of the RNA and amplification of pseudogenes. At the end of the procedure, the RNA was eluted from the isolation column with a volume of 16.5 LlL of H2O and this solution was placed directly into a reverse transcriptase step to create cDNA. 4.2.3 Reverse Transcription of mRNA The mRNA was converted immediately into its complementary DNA (cDNA) as this form is less prone to degradation than RNA and is required for the amplification steps in PCR. This was accomplished by taking the eluted RNA and putting it directly into a 44 reverse transcriptase reaction. One LLL of oligo dT12-18 primers (Invitrogen, Burlington, ON, Canada) was added to the solution to bind the oligo A 's present on the ends of the mRNA. The mixture was heated at 70°C for 5 minutes and then placed immediately on ice. The mixture was centrifuged to retrieve any condensate that had formed on the sides of the tube. A master mix consisting of 1.5 fiL dNTP (10mM) (Invitrogen, Burlington, ON, Canada), 1.0 | i L dithiothreitol (DTT), 1.0 (iL RNaseOut Recombinant Ribonuclease Inhibitor (Invitrogen, Burlington, ON, Canada), 1.0 L l L M - M L V Reverse Transcriptase (Invitrogen, Burlington, ON, Canada), and 4.0 L l L 5x Buffer was added and this solution heated to 37°C for 60 minutes then 42°C for 60 minutes and then 70°C for 10 minutes to inactivate the enzymes. 4.2.4 Primers used for Quantitative Real-time PCR For qRT-PCR, primers were designed to have amplicons of 250 base pairs or less. Each amplicon was designed to span at least 1 intron. This was to ensure that any amplified product was mRNA specific without any contaminating genomic D N A as genomic D N A would result in longer amplicon sizes which would be then discerned through melting curve analysis (see below). The qRT-PCR primers were designed to detect the cDNA corresponding to the genes for TGF-betal, TGF-beta2, TGF-beta3, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) which is a common housekeeping gene used to normalize the values for the other genes to a common expression quantity that was input into the reaction. The primer sequences for each gene are shown in Table 3 (page 46). 45 Table 3: Forward and reverse primers used for quantitative RT-PCR. Primer position refers to the position of the primers in reference to the annotated sequence for each mRNA as found in the NCBI database. Primer Primer Position* Primer Sequence TGF-pM Forward Primer TB1-698F 5 ' - A A G T G G A C A T C A A C G G G T T C - 3 ' TGF-pM Reverse Primer TB1-915R 5 ' - G T C C T T G C G G A A G T C A A T G T - 3 ' TGF-f32 Forward Primer TB2-514F 5 ' - A C C C A G C G C T A C A T C G A C A G - 3 ' T G F - P 2 Reverse Primer TB2-694R 5 ' - C A A A A G T G C A G C A G G G A C A G T - 3 ' TGF-P3 Forward Primer TB3-482F 5 ' - C T A A G C G G A A T G A G C A G A G G - 3 ' TGF-(33 Reverse Primer TB3-705R 5 ' - A T T G G G C T G A A A G G T G T G A C - 3 ' G A P D H Forward Primer G A P - 2 3 6 F 5 ' - A G C G A G A T C C C T C C A A A A T C - 3 ' G A P D H Reverse Primer G A P - 5 0 1 R 5 ' - G T T G T C A T G G A T G A C C T T G G - 3 ' * Numbers indicate position on CDS sequence for the accession numbers NM_000660, NM_003238, NM_003239, and NM_002046 for TGF-betal, TGF-beta2, TGF-beta3, and GAPDH respectively. 46 4.2.5 Standards used for Quantitat ive Real-t ime P C R Standards were created for qRT-PCR to allow for the absolute quantification of the cDNA samples. These standards consisted of bacterial plasmids containing the amplicons used for the PCR reaction as this was a more stable standard to use than isolated PCR product alone and it is easier to quantify the specific amplicon than i f it were a part of a cDNA mixture. To create these plasmids, the pCR-2.1-TOPO vector from the TOPO T A Cloning Kit (Invitrogen, Burlington, ON, Canada) was used. A conventional PCR technique using Taq D N A polymerase (Qiagen, Mississauga, ON, Canada) at 55°C hybridization temperature and 40 cycles of amplification was used to amplify the PCR product, from cDNA obtained from one of the above cases using the respective primer pairs for each target (table 3). The PCR product was then run on a 2% agarose gel and isolated using the QIAquick Gel Extraction Kit (Qiagen, Mississauga, ON, Canada). To insert each purified PCR product into the vector, the vector and the isolated PCR product were allowed to ligate overnight at 16°C. Transformation of competent Escherichia coli bacteria from strain JA129 with the recombinant plasmid was performed using a heat shock method after which bacteria were plated onto L B plates containing 100 Lig/mL of the antibiotic ampicillin for selection of only transformed bacteria and 40 |ig/mL X-Gal to identify bacteria transformed with the PCR product inserted into the vector(194). One bacterial colony was selected for each of the four RNAs of interest and grown in a broth of 50 mL L B containing 100 Lig/mL of ampicillin overnight at 37°C in a shaking incubator. Several samples of the bacteria 47 culture were removed and stored in a 1:1 ratio of glycerol:LB media at -80°C. The plasmid was isolated from the remaining bacterial culture using the QIAprep Spin Miniprep Kit (Qiagen, Mississauga, ON, Canada) and a sample of this isolated plasmid was sequenced by the Nucleic Acid Protein Service Unit (NAPS) at U B C to ensure that the correct PCR product was inserted. The amount of plasmid isolated from the bacteria was quantified on a U V spectrophotometer (Lambda 2 Spectrometer, PerkinElmer, Boston, M A , USA). Based on the number of base pairs of the recombinant plasmid, the absolute number of plasmids can be calculated by the molecular weight of one base pair of D N A being equal to 649 Daltons. The plasmid was then diluted to create the standards for its respective PCR reaction, either TGF-betal, TGF-beta2, TGF-beta3, or GAPDH. The plasmids were diluted into aliquots containing 10, 102, 103,104,105,106, and 107 copies of plasmids per U.L to be used as the standards for qRT-PCR. 4.2.6 Protocol for Quantitative Real-time PCR The A B I 7900 (Applied Biosystems, Foster City, CA, USA) was used to perform qRT-PCR with a 384 well plate reader which scans the plate after every amplification cycle to obtain a measurement of the amount of fluorescence in the samples. The QuantiTect S Y B R Green PCR Kit (Qiagen, Mississauga, ON, Canada) used during amplification contains the fluorescent dye SYBR Green which intercalates with double stranded D N A to allow the detection of the PCR product by the ABI 7900. The qRT-PCR reaction for 48 each of the transcripts of TGF-betal, TGF-beta2, TGF-beta3, and G A P D H was performed for each sample of cDNA isolated from lung tissue. These reactions were performed in triplicate simultaneously with the standards containing copy numbers of 10 to 107 of each of the respective cloned cDNAs also done in triplicate. Each reaction consisted of 10 LLL of the S Y B R Green master mix supplied by the Qiagen kit that contained Taq polymerase, 8.6 | i L of H2O, 0.2 (iL of each forward and reverse primer at 50 nM concentrations, and 1.0 LLL of the cDNA template. Each PCR cycle consisted of 1 min at the standard reaction temperature of 60°C for hybridization with an additional step of 72°C for 30 sec to increase the time for the elongation step, which is also the time that the machine takes a reading of the fluorescence in the sample. Afterwards, a temperature of 95°C is maintained for 15 seconds to denature the strands. There were 40 amplification steps in each run after which a melting curve analysis was performed to ensure the specificity of the reaction. A standard curve was made using the PCR results from the quantified plasmids and the software provided by the ABI 7900. The crossing point threshold (Ct) values were converted to absolute number of the template using this standard curve for each of the PCR reactions. This data was normalized to the amount of R N A used by dividing the absolute copy number of the product of interest, TGF-betal, TGF-beta2, or TGF-beta3, by the absolute copy number of that of the housekeeping gene GAPDH. Other housekeeping genes were considered but no difference was found in the relative expression of the genes when normalized to these other housekeeping genes (data not shown). 49 4.3 In Situ Hybridization To identify the cells which express TGF-betal, TGF-beta2, and TGF-beta3 mRNAs, the technique of in situ hybridization using R N A probes specific for each of these transcripts was used. 4.3.1 Sample Selection for In Situ Hybridization One block of paraffin embedded tissue was used from each case with 9 or 10 cases selected per G O L D class. Lung function and smoking history for these patients are shown in Table 4 (page 50). For each block, 20 slides were made with 2 serial sections cut per slide at 4 LUTI thickness on a microtome. The sections were floated on a water bath containing diethyl pyrocarbonate (DEPC)-treated water (DEPC-H2O) (made by adding 800 \\L of DEPC per litre of H 2 0 which was then left to stir overnight then autoclaved) to inhibit RNase activity then placed on Histobond slides (Marienfeld, Bad Mergenthein, Germany). The slides were then baked at 60°C overnight to allow adherence of the tissue to the slide. 4.3.2 Probes for In Situ Hybridization Recombinant plasmids with D N A specific for each of the transcripts, TGF-betal, TGF-beta2, and TGF-beta3, were developed for use as templates to make R N A transcripts that would serve as probes. The plasmids developed for PCR standards in the previous 50 Table 4: Lung function and smoking history of the patients sampled for in situ hybridization. C a s e # GOLD Class F E V , F E V / F V C Pk Year Age 1979 0 86.8 80.8 17.0 66 2299 0 98.8 84.7 38.0 53 2415 0 108.8 75.7 37.0 57 2416 0 95.6 77.1 26.5 73 2753 0 93.0 78.0 42.0 62 3381 0 91.1 82.1 49.0 69 5503 0 96.9 73.6 71.0 64 5771 0 103.7 76.6 46.0 59 5907 0 96.3 74.5 15.0 71 5968 0 96.9 70.0 68.8 78 1984 1 101.2 68.7 49.0 67 1995 1 88.8 66.1 21.5 69 2028 1 93.9 69.8 40.0 74 2091 1 100.1 69.5 32.5 75 2145 1 82.5 54.6 111.0 72 3400 1 85.3 63.9 49.0 61 5833 1 84.7 65.7 70.0 54 6191 1 101.3 65.0 50.0 69 6280 1 85.4 68.0 52.8 69 1200 2 72.1 69.8 37.0 65 2076 2 61.0 62.9 60.0 66 2086 2 61.1 52.4 65.0 64 2097 2 72.8 68.8 15.8 62 2427 2 69.1 54.1 40.5 69 2891 2 60.5 65.1 22.0 63 3145 2 66.3 61.4 140.0 70 3395 2 75.4 68.1 50.0 62 3412 2 77.6 58.1 74.0 56 3469 2 77.3 60.9 23.5 53 51 experiment were not suitable for generating in situ hybridization probes as the pCR-2.1 TOPO vector lacks dual promoters for bi-directional transcription of the insert. Also, as unique sequences are desirable for in situ hybridization probes, the sequences selected were compared to the NCBI database using a Blast search. Once identified, these unique sequences were amplified using a conventional PCR technique (see 4.2.4 Primers used for Quantitative Real-time PCR) from the same source of cDNA as was used for the development of the plasmids used as PCR standards. The sequences of the primers used to amplify these unique sequences representing each of the TGF-beta transcripts are shown in Table 5 (page 53). These PCR products were ligated into a pGEM-T Easy Vector System I (Promega, Madison, WI) vector (Figure 1, page 54) between the SP6 and T7 promoter sequences to allow transcription of the sense and antisense sequences of each RNA. The recombinant plasmids were grown in a TOP 10 (Invitrogen, Burlington, ON) strain of E. coli overnight in 250 mL L B broth containing 100 ixg/mL ampicillin antibiotic and isolated using the Qiagen plasmid isolation midi kit for a final concentration of 1 fig/|iL. The inserts were sequenced to confirm the sequence of the PCR product and to determine the orientation of insertion. The isolated plasmid was linearized with Ncol or Sacl restriction enzymes as these enzymes provided unique cutting sites in the recombinant plasmid while keeping the transcribed insert intact. This involved combining 2 (il of plasmid with 0.5 JLLI of the appropriate restriction enzyme, 2 il l of lOx digestion buffer and 15.5 | i l of H2O. This 52 Table 5: Forward and reverse primers for the amplicons used in the development of plasmids for in situ hybridization. Primer position refers to the position of the primers in reference to the annotated sequence for each mRNA as found in the NCBI database. Primer Primer Position* Primer Sequence TGF-b1 Forward Primer TB1-154F 5 ' - C A G A G T C T G A G A C G A G C C G - 3 ' TGF-b1 Reverse Primer TB1-602R 5 ' - T T G A A T A G G G G A T C T G T G G C - 3 ' TGF-b2 Forward Primer TB2-514F 5 ' - A C C C A G C G C T A C A T C G A C A G - 3 ' TGF-b2 Reverse Primer TB2-694R 5 ' - C A A A A G T G C A G C A G G G A C A G T - 3 ' TGF-b3 Forward Primer TB3-2087F 5 ' - C A G G G A G A A A A T C C A G G T C A - 3 ' TGF-b3 Reverse Primer TB3-2518R 5 ' - C C A G G A T G C C C C A A A A A T A - 3 ' * Numbers indicate posit ion on the sequence for the accession numbers NM_000660 , N M _ 0 0 3 2 3 8 , and N M _ 0 0 3 2 3 9 for TGF4oeta l , TGF4jeta2, and TGF4)eta3 respectively. 53 Figure 1 : Vector used for in situ hybridization. Insertion of PCR product is made in the lacZ domain using the A nucleotide overhang existing on the PCR product to bind the T nucelotide overhangs present in the vector. 54 solution was then allowed to incubate at 37°C for at least 2 hours. The plasmid was purified from the digest by adding 2 0 ixl phenol/chloroform, vortexing and then spinning at 14 ,000 rpm for 5 minutes to separate the aqueous layer from which plasmid D N A was precipitated with 2 JLXI NaOAc ( 3 M ) and 4 0 |LXl cold 100% ethanol. The pellet was washed with 7 0 % ethanol and air dried then redissolved in 2 0 ul DEPC-H2O. The plasmid linearization was confirmed by running a sample of the digested product on a 1 % agarose gel. The probes were prepared by in vitro transcription using digoxigenin-labelled nucleotides according to the protocol for Riboprobe in vitro transcription systems by Promega with the exception of using digoxigenin-labelled 11-UTP (Roche Diagnotics) instead of radiolabeled nucleotides. A solution with 11 ul DEPC-H 2 0 , 2 il l DTT, 0.5 ul RNasin ribonuclease inhibitor, 4 ul of rNTP (digoxigenin-labelled rUTP 0.875mM final cone; unlabeled rUTP 1.625mM; rATP, rCTP, and rGTP 2.5mM each), 2 ul linearized cDNA and 0.5 ul of either SP6 or T7 polymerase (6U). This solution was incubated at 37°C for 45 minutes. Then 1 ul Dnase I (5U) was added and incubated for 15 minutes before R N A was isolated by precipitation with 2 ul NaOAc and 40 ul cold 100% ethanol and cooling to -20°C for 30 minutes, then centrifuging at 14,000 rpm for 15 minutes, washing with 70% ethanol, air drying, then redissolving in 20 ul H2O. To quantify the total amount of R N A transcribed from the recombinant plasmid, a sample of the transcript was run on the Agilent Bioanalyzer 2100 and compared to a known standard. 55 4.3.3 Protocol for In Situ Hybr id izat ion Tissue sections on the slides are first deparaffinized according to the same protocol in section 4.1.2 except all solutions used DEPC-H2O to inactivate contaminating RNases. Then the tissue was permeabilized to allow the probe to come into contact with the target RNA. This involved treating the slides for 5 minutes with DEPC-H2O followed by 20 minutes in 0.2N HC1, then washing in D E P C - H 2 0 for 5 minutes and 2x SSC buffer (0.3 M NaCl, 0.03 M sodium citrate, pH 7) for 30 minutes, and finally washing in DEPC-H 2 0 . Sections were incubated in lOOmM Tris, pH 7.2, 50 m M EDTA, pH 8.0, and 30 Lig/ml proteinase K at 37°C for 15 minutes followed by washing in DEPC-H2O for 10 minutes. The slides were placed in freshly prepared 100 m M triethanolamine with 0.25% acetic anhydride twice for 5 minutes each time, then in 2x SSC for 5 minutes before a final wash in DEPC-H2O. Sections were then dehydrated twice in 70% ethanol for 5 minutes, 90% ethanol for 4 minutes, and 100% ethanol for 3 minutes, then air dried for 30 minutes at room temperature. The probes were incubated at 75°C for 5 minutes to denature and remove any secondary structure in the R N A then placed on ice for 5 minutes. The slides were placed in a hybridization chamber and covered with 20 | i L of probe solution (TGF-betal or TGF-beta3 at 3.5 Lig/mL, or TGF-beta2 at 14 Lig/mL cone, in hybridization solution: 50% formamide, 0.01 M Tris/0.001 M EDTA (pH 7.4), 22.2 ug tRNA, 0.6 M NaCl, 0.01 M DTT, 0.02% polyvinylpyrrolidone, 0.02% Ficoll, 0.2% BSA, 0.1% SDS). The section was sealed with a coverslip using rubber cement to prevent dehydration during 56 incubation. The slides were then incubated at 75°C for 5 minutes then 50°C overnight. The coverslips were then removed and the slides washed in 2x SSC at 50°C for 20 minutes and 0.2x SSC at 50°C for 5 minutes, twice, to remove non-specific hybridization, then neutralized in TBS for 5 minutes. The digoxigenin was detected using immunohistochemistry with primary anti-sheep antibodies specific for digoxigenin. A secondary antibody which recognizes the sheep primary antibody that is conjugated to an alkaline phosphatase enzyme was then added at a concentration of 100 Lig/ml. The substrate used was Vector Red which gives a red colouring when it reacts with alkaline phosphatase enzyme. The slides are then placed in haematoxylin for a blue nuclear counterstain. 4.3.4 Image Analys is of In Situ Hybr id izat ion Slides were observed at 20x magnification to localize the Vector Red staining indicating TGF-betal, TGF-beta2, or TGF-beta3 R N A with both the sense and antisense probes. Specific focus for staining was placed on the tissues of the airways, blood vessels, and alveolar macrophages as these tissues are what were primarily observed with immunostaining for these proteins. A l l staining was graded through a four point grading scale with 0 being no staining and 3 being strong staining. Statistical comparisons were performed between each GOLD class using Wilcoxon Mann-Whitney non-parametric tests. 57 Chapter 5: Results 5.1 Immunohistochemistry Table 6 (page 59) summarizes the lung cell types that stained for IL-13, TGF-betal, TGF-beta2, TGF-beta3, pSMAD2/3, PDGF-A, PDGF-B, PDGF-Ralpha, PDGF-Rbeta, and CTGF. There was a varying pattern of expression of these proteins in the tissue though with relatively high expression for all proteins found in the bronchiolar epithelium and most proteins in the alveolar macrophages. For the cytokine IL-13, the highest immunostaining was found in the cytoplasm of the bronchial epithelium and in nearly all of the alveolar macrophages present (Figure 2, page 60). The smooth muscle from both the airway and arterioles also were slightly positive, though not as much as the bronchial epithelium. Though the TGF-beta isoforms may have similar physiological functions, the pattern of staining for each of these growth factors differed significantly from each other. TGF-betal was found in the neutrophils, as defined by the lobular nuclei (Figure 3B and C, page 61), in 52% of all the cases investigated as well as in the endothelium and vascular smooth muscle of the blood vessels (Table 6 and data not shown). The staining in the bronchiolar epithelium had a granular nature suggesting that TGF-betal was present within granules (Figure 3A). TGF-beta2 showed strong staining within the cytoplasm of what appears to be interstitial macrophages (Figure 4B and C, page 62). This staining 58 Table 6: Assessment of the expression of profibrotic cytokines and growth factors within the cells of COPD patients in the lung. Alveolar Macrophage Interstitial Macrophage Neutrophil Bronchiolar Epithelium Airway Smooth Muscle Blood Vessel Smooth Muscle Interstitium IL-13 + - - + + + -TGF-pi - - + + + + + TGF-P2 - + - + - - -TGF-P3 + - - + - - + PSMAD2/3 + - - + + + -PDGF-A + - - + + - -PDGF-B + - - + - + -PDGF-Ra + - - + + + -PDGF-RR + - - + - - + CTGF - - - + - + -59 60 Figure 3 : TGF-betal immunostaining in A) Bronchiolar Epithelium (BE), B) Vascular Smooth Muscle (SM) with Neutrophils (N) and C) higher magnification of rectangle in B showing positive staining of Neutrophils (N) in lung tissue from a GOLD 4 patient. Figure 4: TGF-beta2 immunostaining in A) Bronchiolar Epithelium (BE), B) Interstitial Macrophages (M) and C) higher magnification of rectangle in B showing positive staining of Interstitial Macrophage (M) in lung tissue from a GOLD 4 patient. A ) B) C ) 62 was present in 68% of the cases, with more positive cells present in the severe G O L D categories (data not presented). As well, the staining of the bronchial epithelium for TGF-beta2 was highly localized to the apical surface of the epithelial cells in vesicle-like structures (Figure 4A) . TGF-beta3 showed diffuse staining throughout the cytoplasm of the bronchial epithelial cells (Figure 5A , page 64). It was also found in the connective tissue matrix just beneath the smooth muscle cells in the blood vessels (data not shown) and in alveolar macrophages (Figure 5B). The pattern of S M A D activation follows the expression pattern for TGF-betal around the bronchial epithelium and vascular smooth muscle and TGF-beta3 expression for alveolar macrophages (Figure 6, page 65). In this study the PDGF members which included the ligands PDGF-A and PDGF-B as well as their receptors PDGF-Ralpha and PDGF-Rbeta were analyzed. PDGF-A was found in the smooth muscle cells around airways (Table 6 and data not shown) as well as the bronchiolar epithelium (Figure 7A , page 66). Also, this protein was found in the alveolar macrophages (Figure 7B). PDGF-B had strong staining in the bronchial epithelium (Figure 8A , page 67) and, like the A ligand, is found in smooth muscle and the alveolar macrophage (Figure 8B and C, respectively). Staining of the smooth muscle around the blood vessels was more intense than around the airways (Table 6). The receptor PDGF-Ralpha had a similar pattern of staining to that of the two ligands, that is, within the bronchial epithelium, alveolar macrophages, and smooth muscle, but in this case Ralpha was expressed in the smooth muscle around both the airway and blood 63 64 Figure 6: pSMAD2/3 immunostaining in A) Bronchiolar Epithelium (BE) and Airway Smooth Muscle (SM), B) Vascular Smooth Muscle (SM) and C) Alveolar Macrophage (AM) in lung tissue from a GOLD 4 patient. A ) B) C ) 6 5 6 6 Figure 8: PDGF-B immunostaining in A) Bronchiolar Epithelium (BE), B) Vascular Smooth Muscle (SM) and C ) Alveolar Macrophages (AM) in lung tissue from a GOLD 4 patient. 67 vessels (Figure 9, page 69, and Table 6). The other receptor, PDGF-Rbeta, had a more limited, albeit very strong, staining restricted to the bronchiolar epithelium and alveolar macrophages (Figure 10A and B, respectively, page 70). The last protein analyzed was CTGF which can activate collagen production, dependency or independently of TGF-beta signaling(195). Surprisingly, the staining for this protein was quite sparse considering the fibrotic nature of COPD around the airways. There was staining within the bronchial epithelium of the airways with some staining present in the vascular smooth muscle (Figure 11, page 71). Since the expression of the proteins of interest was most consistent in the bronchiolar epithelium, an average volume fraction of each protein in this compartment per subject was quantified and the results analyzed using the non-parametric Mann-Whitney U-test. This analysis (Figure 12, pages 72-73) showed that relative to the GOLD 0 control group, the expression of several of these proteins have increased significantly as disease severity increases. The p-values derived from the non-parametric Mann-Whitney U test are given in Table 7 (page 74). Following Bonferonni corrections for multiple comparisons (p < 0.0085 being significant) in comparing the severely obstructed GOLD 3 or 4 group to the unobstructed GOLD 0 or mildly obstructed GOLD 1 group (that is, GOLD 3 versus 0, 3 versus 1, 4 versus 0 or 4 versus 1), the protein levels for IL-13, TGF-beta2, PDGF-A, PDGF-Ralpha, and CTGF all increased significantly for at least one of these comparisons. TGF-beta3 was significant without this correction (p < 0.05) in all 68 Figure 9: PDGF-Ralpha immunostaining in A) Bronchiolar Epithelium (BE), B) Vascular Smooth Muscle (SM) and C) Alveolar Macrophages (AM) in lung tissue from a GOLD 4 patient. v 100 um 69 70 Figure 11: CTGF immunostaining in A) Bronchiolar Epithelium (BE) and B) Vascular Smooth Muscle (SM) in lung tissue from a GOLD 4 patient. Figure 12: Comparison of volume fractions of staining A) IL-13, B) TGF-betal, C) TGF-beta2, D) TGF-beta3, E) CTGF, F) pSMAD2/3, G) PDGF-A, H) PDGF-B, I) PDGF-Ralpha, and J) PDGF-Rbeta in the bronchiolar epithelium in lung tissue from patients in the four GOLD classes. A l l data is presented as quantiles with the centre line representing the median. A) IL-13 B) TGF-(31 GOLD Qass GOLD Qass C) TGF-p2 D) TGF-(33 GOLD Qass 72 E) p-SMAD 2/3 F) CTGF 0.25-0.2-^  m 0.15-) Si Q < 5 o .H 03 1 0.05H 0-I X 1 1 3 GOLD Qass 0.5-0.4-0.3-u_ a o 0.2-0.1-0-X 1 1 0 1 3 GOLD Class G) PDGF-A H) PDGF-B I) PDGF-Roc J) PDGF-RJ3 1 0.9 0.8 a 0.7-% 0-6-_ 0.5-I § 0.4-| °- 0.3 0.2-j 0.1-1 0' T 1 1 1 3 4 GOLD Class GOLD Class 73 Table 7: The p-values derived from multiple comparisons between GOLD classes for all 10 proteins using the non-parametric Mann-Whitney U-test where the blocks in red contain p-values below 0.05 and those in yellow contain p-values below the Bonferroni corrected p-value of 0.0085. M a n n - W h i t n e y U-test p-va lues G O L D 0 vs G O L D 1 G O L D 0 vs G O L D 3 G O L D 0 vs G O L D 4 G O L D 1 v s G O L D 3 G O L D 1 v s G O L D 4 G O L D 3 vs G O L D 4 IL-13 0.8501 0.0011 0 .0035 0 .0005 0.4701 T G F - p 1 0 .1310 0.4597 0 .3787 TGF- I32 0 .3579 0 .0016 0.5545 TGF-P3 0.9698 0 .9698 p S M A D 2 / 3 0 .9698 0 .4379 0 .2057 P D G F - A 0 .2730 0 .0073 0 .0003 0 .0004 0.3847 P D G F - B 0.1131 0.1041 0 .2453 0 .5495 0 .3847 P D G F - R a 0 .0036 0 .0008 0 .3418 0 .1859 P D G F - F t p 0 .3072 0 .0539 0 .7337 0 .1697 0.2751 C T G F 0.1041 0 .0028 0 .1212 0 .3075 0 .9097 7 4 four comparisons. The expression of TGF-betal, pSMAD2/3, PDGF-B, and PDGF-Rbeta remained relatively constant with no significant differences. Regression analysis was performed on the expression levels of these proteins and airway wall thickness measurements of similar airways from the same patients reported in a previous study(46). There was a good correlation between the bronchiolar epithelium layer thickness and the protein expression of IL-13, TGF-beta2, TGF-beta3, PDGF-A, and PDGF-Ralpha (Figure 13, pages 76-77). The R-value from the regression analysis and probability that the slope is unequal to 0 for each correlation is given in Table 8 (page 78). There was a good correlation between the bronchiolar epithelium layer thickness and the protein expression of IL-13, TGF-beta2, PDGF-A, and PDGF-Ralpha. 5.2 Quantitative Real-time Polymerase Chain Reaction The initial qRT-PCR was based on 10 cases per GOLD category where one R N A sample was extracted from one 100 um frozen lung section per case. A comparison of mRNA expression levels in GOLD 0, GOLD 1, and GOLD 2 groups showed no correlation between mRNA expression levels of any TGF-beta isoforms and lung function and no significant difference between this expression and GOLD categories. Even after log transformation of the mRNA expression regression analysis showed no significant differences between TGF-betal, TGF-beta2, or TGF-beta3 and lung function (Figure 14, page 79). 75 Figure 13: Correlations between the wall thickness of the bronchial epithelium and the volume fraction of expression of the protein in the epithelium. The correlations between A) IL-13, B) TGF-betal, C) TGF-beta2, D) TGF-beta3, E) pSMAD2/3, F) PDGF-A, G) PDGF-B, H) PDGF-Ralpha, I) PDGF-Rbeta, and J) CTGF with the bronchial epithelium thickness are shown. Refer to Table 8 for R-values and p-values of the slope of the regression lines. Red icons refer to GOLD 0, green for GOLD 1, blue for GOLD 3, and yellow for GOLD 4. A) IL-13 i 1 1 1 1 1 r .005 .01 .015 .02 .025 .03 .035 .04 .045 EPITHELIUM B) TGF-pi T 1 1 1 1 r .005 .01 .015 .02 .025 .03 .035 .04 .045 EPITHELIUM C) TGF-(32 D) TGF-P3 .005 .01 .015 .02 .025 .03 .035 .04 .045 .005 .01 .015 .02 .025 .03 .035 .04 .045 EPITHELIUM EPITHELIUM 7 6 Table 8: Correlation between protein expression in the bronchiolar epithelium and the thickness of the airway wall components. A) The R values obtained from regression analysis of log volume fraction of protein expression versus airway wall thickness. The boxes in yellow indicate R values above 0.50. B) The p-values obtained from regression analysis signifying the probability the slope of the regression line differs from 0. Bonferroni corrections for multiple analysis applied with an alpha level of less than 0.001 considered significant. The boxes in yellow have p-values below 0.001. A) Epithelium Submucosa Smooth Muscle Adventitja Total Wall IL-13 0.5773 0.4275 0.2937 0.3771 0.4705 TGF-P1 0.1227 0.0836 0.0197 0.3467 0.2565 TGF-P2 0.5007 0.5249 0.3617 0.3375 0.4506 TGF-P3 0.4709 0.3964 0.2713 0.3729 0.4273 pSMAD273 0.0585 0.1224 0.0393 0.1624 0.1383 PDGF-A 0.6387 0.5443 0.3174 0.5479 0.6140 PDGF-B 0.2758 0.2049 0.0495 0.1208 0.1917 PDGF-Fta 0.5071 0.3933 0.1546 0.3891 0.4567 PDGF-Rp 0.1677 0.2323 0.0465 0.3240 0.2877 CTGF 0.4245 0.4051 0.2532 0.3456 0.4087 B) Epithelium Submucosa Smooth Muscle Adventitia Total Wall IL-13 0.0001 0.0059 0.0001 0.0165 0.0022 TGF-P1 0.4330 0.5940 0.9002 0.0232 0.0968 TGF-p2 0.C005 0.0003 0.0159 0.0251 0.0021 TGF-p3 0.0022 0.0113 0.0904 0.0178 0.0060 pSMAD2/3 0.7237 0.4579 0.8124 0.3233 0.4012 PDGF-A 0.0001 0.0003 0.0460 0.0003 0.0001 PDGF-B 0.0809 0.1987 0.7584 0.4517 0.2299 PDGF-Roc 0.0007 0.0110 0.3346 0.0119 0.0027 PDGF-Rp 0.2945 0.1438 0.7729 0.0388 0.0682 CTGF 0.0063 0.0095 0.1149 0.0289 0.0088 78 Figure 14: The mRNA expression in tissue from one core of lung tissue from each of the patients in each G O L D category. The log transformed ratio of A) TGF-betal, B) TGF-beta2 and C) TGF-beta3 and G A P D H mRNA is plotted against lung function (FEVI). The red icons are for GOLD 0 (n=9), green for GOLD 1 (n=l 1), and blue for GOLD 2 (n=l 1). Data are expressed as the mean of triplicate measurements completed per case. The red line is the regression line to signify trends. A ) TGF-(31 B) TGF-J32 C) TGF-p3 2 90 100 110 120 FEV1 FEV1 FEV1 79 To compensate for the large variability in the degree of severity of the lesions within one lung of an individual that is attributed to the heterogeneous nature of COPD, we studied the expression of the TGF-beta isoforms in a large number of lung samples from the same patient. In this second study, three cases from each GOLD class with an average of 13 cores each. In comparing the expression of each TGF-beta isoform and lung function, no significant differences were noted between TGF-betal, TGF-beta2, or TGF-beta3 and F E V i (Figure 15, page 81). Although no difference in expression levels of the mRNAs of the three isoforms of TGF-beta between the different GOLD stages was found, the expression of TGF-betal was consistently 10 fold higher than that of either TGF-beta2 or TGF-beta3 in both of the above studies. The overall results of these experiments on expression of the transcripts of TGF-betal, TGF-beta2, and TGF-beta3 relative to G A P D H differed from the protein expression observed using immunohistochemical analysis. 5.2 In Situ Hybridization In situ hybridization allows cellular localization of expressed transcripts by hybridization of the labeled probe representing the antisense sequence of the transcript to the expressed sense transcript. Therefore the orientation of the insertion of the PCR product representing the probe into the plasmid vector must be determined. For this, D N A sequencing was performed using primers complementary to either the T7 or SP6 promoter sequences which flank the site of insertion (Figure 16, page 82). Sequencing determined that the 5' end of the inserted TGF-betal and TGF-beta3 cDNAs were 80 Figure 15: Average mRNA expression in multiple cores of lung tissue from each of three patients in each GOLD category. The mRNA levels expressed as a ratio between the A) TGF-betal, B) TGF-beta2, or C) TGF-beta3 and GAPDH versus lung function (FEV,) of that patient. The red icons are GOLD 0, green GOLD 1, and blue GOLD 2. Data are expressed as the mean expression with standard error from an average of 13 cores (range 7 to 19) per case. A) TGF-(31 7 Q OL < i LL o I-"5 o TO CC r i _ T • * | r£ " i 60 70 80 90 100 FEV1 110 120 130 B ) TGF-(32 0.025 I o CL 0.02 < 2 0.015 LL l 0.01 o o ca 0.005 CC 0 60 70 80 90 100 110 120 1 30 FEV1 C) TGF-p3 0.07 0.06 x Q CL < O 0.05 ^ 0.04 O 0.03 "5 0.02 o r, 001 CO & 0 I 1 1 • ^ * i t 60 70 80 90 100 110 120 130 FEV1 Figure 16: Sequence data for the probes used in in situ hybridization. Sequences are for A) TGF-betal, B) TGF-beta2 and C) TGF-beta3. Nucleotides highlighted in red are the T7 promoter region and blue is the SP6 promoter region. Inserted sequences are in red with the arrow indicating direction of transcription (sense strand) of the gene of interest. A \ ^NCXJCTx^AAGAACG^C^CTCAACNCAAAGGGCGAAACCGTNTATCAGGCGATGGCCCA -<V T T A C G T G A C C A T C X C C T A A r c M G T T T T T T G G G G T C G A S G ^ ^ ^ AAAGGAAGGGAAGAAAGOGAAAGGSGCGGGCGCTAGGGOGCT G-CTTGCGCGTAACCACCACACCCGCaSC^^ CAGCTGG<SAAAGGGGG.ATGTGCTGCAAGGaAATrAAGTTGG^ C A G T C A C G A C G T T G T A A A A C G A C G G C C A G ? G M T 7 ' ^ _ _ _ ^ AGGGACGAGCTGGTCGSGAGAAGAGGAAAAAAAACTTTTGAGAC? GGAGCCGa^GGCGCGGGGACCTCT^G^CGCGACGCTCCCCC^CC-AGGAGGCAGGACTTGG GGACCCCAGAC^GCCTCC^T 'rTGCXTGCCGGGGACGC"^ GCAWGACTT-TCCCCAGACCTCGGGCGCACCCCCTGCACGCCGCCTTCATCCCCG'JCCT A C C T G C C A C A G A ' T C C C C - A T X ^ ^ ^ CATATGGGAGAGCTCCCAACGCGTTGGATGCATAj3CTTGAGTATTCTA^5TGTCttCC*?. E . A A r A G c r r G G C G r A A T C A r G G T C A r A G c r G r r r c c r G r G r G A A A r r G r r A T C C G C i r A ^ A ArTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTG AGCTAACTCACftTTAAT?GCGTTGCGC?cacTGOCCGCTTTCCAGTCGGGAAACXrTGTCG TGCXJAAGCTGCATTAAXGAA^GGCC^ACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCG CTCTTCCGCTTCCTCGGTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGT ATCA<K7CACTCARAGGCOTTAATAOSGTTATCCACAGAA?CAGG03ATAACGCANGAAA G AAC ATGTGAGC AAAAAGGCAAGCAAAAGGCAGGACCGTAAAAAGGC GCGT? GCT GGCGT T T T T C A T A G G C N C G C C C C T G A G A G A T A C A A A A S G A C K B) TAAGAACGKGACTCAAC^AAAGGGCG-AAACCGTK^^^ CCATCAC(^AA2C?JiGTTTTTTGGGCTCGAGGrGrJCGrAAAGCA£rAAATC;GGAACCCNA AGGGAGCajCCrGATrrAGAGCTTGACGGGGAAACCCGGCGAACGTGGCGAG.AAAGGAAG G G . A A G A A A G C S A . A A G G A G C G G & : G C f X G G 3 C G C T ^ TAACCACCACACCrGCCGCGCTSAATGCGCCGCTACAGGGCGCGTCCA'ITCGCCArTCAG GCT^CGCAACTGTXGGGAAGGGCGATCGGTC^GGGCCTC^TCCK^AS'TACGCCAGCTGGC GAAAG'GG-GG^TGTGCTGCAA 'GGC'GATX.AAG^GGGTAAC^CXJA'GG'GrTTXCCCAGTCACG A C G T T G T A A A A C G A C G G C C A . G ^ G A A ~ C _ _ _ _ _ _ _ | _ _ _ _ B c G A A 7 ? G i G G C C C CaarrCGCAfGCTCCCGGOCGCCASGGCGGCCGCGGGAAT-CGA-T:: ACAGCArCAGT?ACATCGAAGGAGAGCCArTCGCGTTCTGCTCTTGTrTTCAGAACTrrG C5GTCGATGTAGCSC:':->;7AATCACTAGTGAAT-03C&:.CCGCC-:.C-AG3rC'GACCATA T S G G A G A G C T C C C A A C G C G T T G G ^ G C A T A G C T r G A G T A ^ G C r t G G C G 5 A A S C A f G G ? C A T A G W ^ ^ R W G W ^ A A A ^ G r r A r c C G . ~ G A C A A - - C CACACAftCArAjrGAGCCGGAAGCA -TAAAGTGTAAAGOCTGGGGTGCKTAATGAGTGAGCr A^CTCACA^TAA?TGC^TTGCGCTCACTGCCCGCTT!rCCAGTCGGGAA.^CTGTCG^GCC A S C T G C A r r A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G r r T G e ^ CCGCTTC^CGCTCACTGACTCGCTGCGCTCGGTCGITCGGCTGCGGCGAGCGGTATCAG CTCACTC-AA^GGOG^TA-ATAOG^TTATCCACAG.AATCAGGGGATAACGCAGGAAAGAACA TSTGAGCAAAAGGGCAGO^AAAGGGCAGGAACCGTAAAAAGGC^ TCCATANGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAAGTGGC GAAAKCCGACAGGACTATA^AGATACXA1^K^TTTCCCCTGG.AAACTGCCICGTGNGCTC TCCrGTTCKAACCTTCCGCTTACGGAAACTGKCajCTTTCrrC TCTCATAGCTCACGCTGTAGNATCTCAGTTCGGTGARGNCGTTCGCTCCAACTGGGTGNG GGAC.AAACCCCGTTAGCCCAACGCTGNGCCTATCCGNAOTATCGCTTGAGCCAACCGMAA A A A C A N T i r e C C S C ^ G G A C A C C C T G G T A A A K ! ^ ^ AGGGGGCNACAX;CNTACCAAAAAKAAKTTGGNNTKCCCTNrA Q TAAAAKAAAAANf^NTKNGCCS^TNCGNAAKNCCCCNATGGGGGNA^CNNCCNTTNTNA GG<_VATCCCTCGGAA^G?AANNTrATATTTNNKAAATCGGNTAAATTTTTTAATNlJKTC TT~TTTACNA.=B3aNGGAAATGGCAA.NNT:C?TT.AAATCA.^^ TNTTGTNCAGTTGNANAAGATCCATTI^AAAAACTGGACTCCAANGTCAAGGKGAAAAC3< GTTTTCAGGGGANGCCCACTACGTSACtnx:tKCTTATCAACTTTrTGGGTCGACTGCGTA AACG7GGC^AG£J^GGAAGGGAAGAAAGOGAAAGCw\GCGGGCGCTAGGGCGC7GGC3\AGT 5TAGCGGTCACGCrGCG<STAACCACCACACCCGCCGCGCTTAA;GCG<XGCTACAGG(K GCGTCCATTCGCCATTCAGGCTGCGCAACTGTT'GGGAAGGGCGATCGGTGCGGGCCTC - T CGCTArrACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGC C A G G G T T - T C C C A G T C A O G A O G T T G T A A A A C G A C G G C C A G T G A A - ^ G M ^ ^ ^ ^ ^ M ______fc___S|GG£3^^ CGAT7 "A-3535GAAAa: - : ' A . - ; T :ArGCAGrTOOTGGCOCATCAACTGTATTGGGCCTTT TGGATATGCTGAACGCAGAAGAAAGGGTGGAAATCAACCCTC7CCTGTCTGCCCTCTGGG TCCCTCCTCTCACCTCTCCCTCGATCATATTTCCCCTTGGACACTTViGTTAGACGCCTTC TCCCCCACTTCCCCTCCAAGACCCTGTGTTCATT?G<37GTTCCTGG,V^G<^GGTGCTACA ACATGTGAGGCAIt^GGGGAAGCTGCACATCTGCCACACAGTGACTTGGCCCCAGACGCA TAGAC'TGAGGTArAAAGACAAGTATGAATATTACTCTCAAAAT'TrTTGTATAAATAAATA TTTTTGGGGCATCC^GGAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGG TG^CGTAATCATGGTCATAGOTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCAC ACAACATACGAiSCOGGAAGCAIAAAGTGTAAAGCCTGGGGrGCCSAArGAGIGAGC-AAC TCACArrAATTGCGTTGOGCTCACTGCCCGCTTTCaGTCGGGAAACCTGTCGTGCCAGC T G C A T T A A T r ^ T C G G C C ^ C G C G C G G G G A G A G G C G G T I T K C T T C C T C G C T C a C T G A C T C G C T G O ^ C G G T C G T C G G C T G C G G C G A G C G G T A r c a G C T C A CTCAAAG/SCCiGNAATACCGGTTTCCACAGAATCAGGGATAACGCANGAANAACATGTGAG CAAAAGGCAGCAAAAGfiCNNGAArcGTAAAAAGGClCGTTGCTGGircT CGCX^CCCTGACAGCATCNAA^AATCGACGCTNAANCANAGHGGSAAACCX!ANNGATNAAA AAAACCAGNGTTCCCCTGGANCTCCTKGGGCTNfNNNNTCXNACCTGCGTTACGGAAACTG GCGCCTT^CKTNGGAANNGNNNTrSJCAANNNCCNGAGAXNCATCGNGANGGNTNOTCAN TNGGTGGGGAAAACCGTTACCNACGTNGCCTTCGAAANS 82 adjacent to the T7 promoter region of the plasmid. Therefore transcription from the T7 promoter for these two cDNA inserts would produce a sense probe. For TGF-beta2, the 5' end was adjacent to the SP6 promoter region. Localization of the staining for TGF-betal, TGF-beta2, or TGF-beta3 R N A using the sense and antisense probes resulted in the observation that staining for expression of these genes or their unannotated antisense counterparts is primarily localized to the bronchial epithelium, the vascular smooth muscle, alveolar macrophages, and lymphocytes. Qualitative analysis of the tissue using a four point grading system for each cell type using either the sense or antisense probes are summarized in Figure 17 (page 84). The highest expression was found in the alveolar macrophages, lymphocytes, and bronchial epithelium using the sense probe for TGF-betal and TGF-beta3. TGF-beta2 had the highest expression in the alveolar macrophage, bronchial epithelium and vascular smooth muscle using the antisense probe. It was noted that with TGF-betal and TGF-beta3, the antisense transcript had a higher expression than the sense transcript in all cases compared with TGF-beta2 where the sense transcript had the higher expression. Even though there was some variability in the level of staining between cases, no correlation between staining intensity and GOLD class was noted for any of these TGF-beta isoforms in any of the cell types in which they were localized. Images of the staining with both sense and antisense probes in alveolar macrophages, bronchial epithelium, and blood vessels from a GOLD 2 patient for TGF-betal, TGF-beta2, and TGF-beta3 mRNA can be found in Figures 18,19, and 20 (page 85-87), respectively. 83 Figure 17: Qualitative quantification of staining intensity for TGF-betal, TGF-beta2, and TGF-beta3 R N A within specific cells types in lung tissue using in situ hybridization with either sense or antisense probes specific for each transcript. Grading was done on a 4 point scale with 0 = no staining, 1 = light staining, 2 = medium staining, and 3 = strong staining. A M - alveolar macrophage; N - neutrophil; L - lymphocyte; BE - bronchial epithelium; A S M - airway smooth muscle; Endo - endothelium; V S M - vascular smooth muscle; S - sense probe; AS - antisense probe. G O L D O • G O L D 1 • G O L D 2 AMS AM AS N S N AS L S L A S BE S B E A S ASMS ASM AS EndO S Endo AS VSMS VSMAS 84 Figure 18: Micrographs of staining after in situ hybridization using sense and antisense probes specific for TGF-betal are shown in lung tissue from a patient with GOLD stage 2 COPD. A - C show the staining using the sense probe. D-F show the staining using the antisense probe. A and D show alveolar macrophages. B and E show the bronchial epithelium. C and F show the smooth muscle within the vascular wall. Sense Probe Antisense Probe 100 um f / w 100 um 1 100 um 100 um c i 1 • 100 nm F 100 um 85 Figure 19: Micrographs of staining after in situ hybridization using sense and antisense probes specific for TGF-beta2 are shown in lung tissue from a patient with GOLD stage 2 COPD. A - C show the staining using the sense probe. D-F show the staining using the antisense probe. A and D show alveolar macrophages. B and E show the bronchial epithelium. C and F show the smooth muscle within the vascular wall. Sense Probe Antisense Probe Figure 20: Micrographs of staining after in situ hybridization using sense and antisense probes specific for TGF-beta3 are shown in lung tissue from a patient with GOLD stage 2 COPD. A - C show the staining using the sense probe. D-F show the staining using the antisense probe. A and D show alveolar macrophages. B and E show the bronchial epithelium. C and F show the smooth muscle within the vascular wall. Sense Probe mm Antisense Probe Chapter 6: Discussion The epithelium that covers the conducting airways and gas exchanging surface of the lungs provides the primary barrier that protects the underlying lung tissue from toxic gases, particles and infectious agents. Numerous studies have used bronchial epithelial cells and have shown these cells as being highly active and capable of expressing many pro-inflammatory factors(196-198). The focus of this thesis is on the pro-fibrotic molecules that the bronchial epithelium may express to promote the proliferation of myofibroblasts and their subsequent activation to produce collagen. Immunohistochemical techniques based on antibodies specific for IL-13, TGF-beta (1, 2, and 3), the TGF-beta specific signal transduction molecule (p-SMAD2 and 3), PDGF (A and B), PDGF-receptors (alpha and beta), and CTGF; as well as quantitative real-time PCR to measure the expression of TGF-beta (1, 2 and 3) and in situ hybridization to localize mRNA expression were used to quantify and localize the expression of these molecules. The results showed that in the small airways it is primarily the bronchiolar epithelium that expresses increasing levels of several factors involved in the signaling of proliferation and activation of myofibroblasts as disease becomes more severe in COPD. The increase in these factors, particularly PDGF-A and its receptor PDGF-Ralpha, suggests that the peribronchial fibrosis resident in the airways of these patients is an active and ongoing process controlled by the bronchial epithelium. Analysis of digital images from immunostained tissue was performed to quantitate the level of staining in the airways of each patient. One limitation of this methodology was a 88 consequence of setting a threshold of staining intensity at which measurements were taken. Staining above this threshold level was all considered equivalent with only the area of staining that met this threshold of staining intensity being taken into account such that a cell with twice the area of staining that met this threshold but only half the intensity of staining of another cell would be scored as having twice the staining. To partially compensate for this limitation, the threshold was set at a level at which only very strong staining would be measured. The factors which were studied by immunohistochemistry in this research project were all localized to the bronchiolar epithelium and several other cell types specific for each factor. For the cytokine IL-13, expression was significantly increased in the bronchiolar epithelium of the small airways in patients from GOLD 3 and 4 compared to GOLD 0 and this expression correlated with the epithelial thickness of the airways. This result supports previous studies showing that in healthy subjects bronchial epithelium expresses IL-13 when exposed to diesel exhaust(198). Others have focused on the effects IL-13 has on bronchial epithelial cells, showing that IL-13 is able to increase mucus production by inducing a goblet cell phenotype in human bronchial epithelial cells(199). The strong staining for IL-13 within the alveolar macrophages of the smokers in this study is consistent with a report of this expression in both normal and fibrotic human lungs(200). IL-13 was also detected in the smooth muscle of both the airways and blood vessels (see Table 6, page 59). Previous studies have shown that IL-13 is found in mast cells present within the smooth muscle of asthmatics(201) but the present results indicate that the expression of IL-13 within the smooth muscle was not localized to infiltrating 89 inflammatory cells. In contrast to the present findings where IL-13 staining was not observed in lymphocytes, previous studies have localized IL-13 to CD4+ and CD8+ T-cells in humans(102, 202) and because of its similarity to IL-4, is generally considered of lymphocyte origin. It is interesting to note that a previous study(46), based on the same patients used in the present study, showed that the number of airways containing CD4 and CD8 lymphocytes increased with progression of COPD in association with the formation of bronchial associated lymphoid tissue. However, the present study on the same patients did not detect IL-13 in these follicles. There was no measurable difference in the expression of TGF-betal in the various stages of COPD, either in the bronchiolar epithelium as assessed by immunohistochemistry or in whole lung slices by the quantitative PCR of mRNA expression. In these smokers TGF-betal localized to the bronchial epithelium, airway and vascular smooth muscle. No staining for TGF-betal was detected in the alveolar macrophages but it was found in the neutrophils that were identified by their segmented nuclei. Earlier studies in human lungs have localized TGF-betal to the bronchiolar epithelial cells, airway and vascular smooth muscle cells, and alveolar macrophages(203, 204) as well as the connective tissue of the airways(203, 205). Few studies have noted TGF-beta expression in the neutrophils. In one such study, TGF-betal has been demonstrated in neutrophils isolated from peripheral blood of human donors by Western blotting(206). Another group has shown that TGF-beta2 but not TGF-betal was the protein released using isoform specific ELISA(207). This latter group argued that the TGF-betal reported in the earlier study by Grotendorst(206) might be attributed to TGF-betal contamination in the bovine serum 90 albumin used for the culture media. This last study also showed that TGF-beta2 was released from neutrophils and that this release was augmented by stimulation with phorbol myristate acetate (PMA), but its mRNA, although expressed constitutively, was not affected by this stimulation. On the other hand, the mRNA of TGF-betal, which was also constitutively expressed by these neutrophils, was upregulated by this stimulation. A possible explanation for these seemingly incongruent results is that while the P M A regulation of TGF-beta2 expression occurs at the level of its release from granules, that of betal is at the level of transcription, so that 30 minute time-point chosen after the stimulation with P M A to measure protein release might have been too early to detect newly synthesized TGF-betal. Therefore despite these negative results on expression of this growth factor(207), the feasibility of TGF-betal protein expression by neutrophils remains a possibility. While the expression of TGF-betal was relatively constant across the stages of COPD, TGF-beta2 and TGF-beta3 increased in the more severe stages relative to the milder stages of the disease. In this study, TGF-beta2 and TGF-beta3 were detected in the bronchiolar epithelium. TGF-beta2 was also detected in interstitial macrophages while TGF-beta3 was detected in alveolar macrophages where TGF-beta2 was not. In previous studies, TGF-beta2 and TGF-beta3 have been found in the murine bronchiolar epithelium and vascular smooth muscle cells(208). TGF-beta2 is secreted by human bronchial epithelium(125) and blood monocytes from hypertensive patients(209) with the latter likely explaining the presence of TGF-beta2 in the interstitial macrophages as they are derived from these monocytes. 91 The relevance of increased expression of TGF-beta must be taken in context with the fact that TGF-beta is normally secreted in a latent, inactive form bound to the L A P domain and requires proteolytic or conformational changes for the active site to be revealed to allow TGF-beta to bind to its receptors(210). It is with this reasoning that detection of the active forms of the TGF-beta specific signal transduction factors, SMAD2 and SMAD3, was performed. However, the results were inconclusive as no differences between the active forms of SMAD2 or 3 and COPD severity were detected. As TGF-beta receptors may also signal through the M A P K pathways, it is possible that these pathways are the ones being activated by TGF-beta release but to determine this with an associative study would be difficult due to the complex nature of the M A P K pathway which includes multiple possible agonists(149). PDGF-A and its receptor PDGF-Ralpha both showed a significant increase in their expression on the bronchiolar epithelium in relation to the GOLD categories in COPD with higher expression present in the severe forms relative to the mild form of COPD. The other isoform of PDGF, PDGF-B and its receptor PDGF-Rbeta, did not show this relationship. The localization of both PDGF isoforms as well as their receptors, as shown in Table 6 (page 59), was primarily in the bronchiolar epithelium and alveolar macrophages. PDGF-Ralpha was also present in both the airway and vascular smooth muscles while PDGF-A was found in smooth muscle of the airways and PDGF-B in the vascular smooth muscle. Previous workers have localized PDGF to many of these same cell types. The PDGF ligand and the receptor PDGF-Rbeta have been detected in the bronchial epithelium of the small airways(211). Alveolar macrophages are considered a 92 major source of PDGF with groups having shown expression of both PDGF-A and PDGF-B subtypes in this cell(187, 212). PDGF-B has also been detected in interstitial macrophages within the lung(213) though our findings did not show this. PDGF-Ralpha expression has been demonstrated in the airway smooth muscle cells but in these in vitro experiments the Ralpha specific ligand, PDGF-AA, required other factors found in fetal calf serum to be functional(214). PDGF-Rbeta was not found in the airway smooth muscle cells but both PDGF ligand and PDGF-Rbeta have both been detected in vascular smooth muscle cells(211). Vascular smooth muscle cells have also been demonstrated to express PDGF-Ralpha which can be activated by mechanical stress(215). In summary the results show that IL-13, TGF-beta2 and beta3, PDGF-A and its receptor PDGF-Ralpha were all upregulated in the bronchiolar epithelium in patients with severe COPD relative to those with mild disease. The combination of these results with the finding that the airways in patients with severe COPD have significantly thicker walls than those with mild disease(46) suggests that these pro-fibrotic mediators are involved in the peribronchial fibrosis and thickening of the airway walls. Figure 21 (page 94) summarizes a current hypothesis for the activation of myofibroblasts(106) where following the initial injury, the proliferation of myofibroblasts is dependent on PDGF. While PDGF is a key mitogen for myofibroblasts, it is also potentially involved synergistically with TGF-beta in the stimulation of myofibroblast differentiation from precursor cells(216). The induction of PDGF-A expression in the lungs is through a STAT6 mediated signal transduction mechanism initiated by IL-13 93 Figure 21 : Myofibroblast proliferation and activation to produce collagen is mediated through several key proteins following injury. The inflammatory cytokine IL-1 beta stabilizes the transcript of PDGF-Ralpha from degradation, allowing its protein to be expressed on the surface of the cell. IL-13 upregulates PDGF-A production which through an autocrine or paracrine mechanism binds its receptor and induces myofibroblast proliferation. TGF-beta downregulates PDGF-Ralpha and switches the myofibroblast from a proliferative state to an active and collagen synthesizing state. Modified from Bonner, Ingram, et al(106, 123). P D G F - A Myofibroblast | PDGF-Roc, growth inhibition proliferation and f collagen synthesis 94 binding to its receptor(123). Since our results show that the expression of both IL-13 and PDGF-A correlates in a similar fashion to lung function with both ligands having higher expression in the more severe stages of COPD relative to milder stages, we can infer that IL-13 may be inducing PDGF-A expression in these airways. The specific binding of PDGF-A to its receptor requires the presence of the PDGF-Ralpha which is upregulated by IL-lbeta through a p38 signal transduction pathway(217). IL-lbeta is an inflammatory cytokine whose overexpression in mice can lead to an emphysematous phenotype(218) and which has been noted to be increased in COPD patients(219). We found that the expression of PDGF-Ralpha also increases in the severe stages of COPD and correlates with the expression of its ligand. The stimulation of myofibroblasts to proliferate is associated with their activation to produce collagen which requires TGF-beta. While the expression of TGF-betal was relatively constant across the stages of COPD, TGF-beta2 and TGF-beta3 increased in the more severe stages relative to the milder stages of the disease and could themselves be involved in myofibroblast differentiation^67). TGF-beta2 is a major profibrotic mediator with the ability to activate fibroblasts(220) and upregulation of the expression of this protein has been detected in fibrotic diseases(221-223). As TGF-beta2 is able to activate myofibroblasts to produce collagen its increase in the more severe stages of COPD might be involved in stimulating the myofibroblasts to produce collagen. TGF-beta3 is also involved in regulating collagen production with some studies suggesting that increased TGF-beta3 can reduce scar formation(224). Since phosphorylated SMAD2 or 3, an indicator we used for activation of the signal transduction pathway downstream of 95 TGF-beta, remained constant across the GOLD stages and was not related to either TGF-beta2 or 3, we suggest that the TGF-beta2 and TGF-beta3 signal through an alternative pathway that we did not examine. One pathway through which TGF-beta2 and TGF-beta3 can signal is the M A P K c-Jun-NF^ kinase pathway which has been shown to cause activation of fibroblasts to the myofibroblast phenotype(225). CTGF was also found to be increased in severe COPD relative to milder forms which promotes this process of increased myofibroblast activity and fibrosis. Measurements on the wall thickness of the small airways on patients with COPD have shown that there is a significant increase in this thickness at GOLD stage 3 and 4 compared to more mild stages of COPD(46). This thickening is likely due to an increase in the number and productive activity of the myofibroblasts within the airway wall. Our findings that mediators which trigger myofibroblast proliferation and activation are present in greater abundance in these advanced stages of COPD supports this theory. However, precise information about the localization of these factors at specific sites in the airways and their role in myofibroblast activation is sparse in human tissues. Measurements were primarily done on the bronchiolar epithelium since this area of the airway was found to be highly active in expressing these factors. It is possible that these factors signal in a paracrine manner to the adjacent submucosa where the myofibroblasts reside, which is supported by the evidence that the bronchial epithelium acts as a regulator in controlling myofibroblasts(226). The localization of the receptors for PDGF to the bronchial epithelium suggests that other mechanisms for the differentiation and proliferation of myofibroblasts are involved. One possible, but highly speculative, 96 mechanism is the differentiation of epithelial cells in the airways into myofibroblasts which migrate into the submucosal region(227). This theory of epithelial-mesenchymal transition has been supported primarily by studies on epithelial cells of the kidney during renal fibrosis(228, 229). Interpreting the quantitative PCR results in relation to the immunohistochemistry is difficult due to the differences in GOLD stages of samples used in the two studies as well as the different trends shown in both studies. The quantitative PCR shows that TGF-betal and TGF-beta2 either remain constant or show a slight decrease in expression as lung function decreases, while TGF-beta3 has a spike in expression of the GOLD 1 stage with both GOLD 0 and GOLD 2 having an equal but lower expression. This differs from the immunohistochemistry which shows an increase in expression for TGF-beta2 and beta3 from G O L D 0 to GOLD 4. It is difficult to derive any correlation between protein and mRNA expression with TGF-beta in this case and this lack of correlation between protein and mRNA data has been shown in other studies. One earlier study has shown TGF-beta2 mRNA remaining low but protein levels high in mechanically stressed bronchial epithelium of asthmatics(230). In that study, it was suggested that TGF-beta2 was present in a preformed pool which can be released upon stress. Another study on asthmatics showed high levels of TGF-beta mRNA but low levels of protein expression in the airway tissue of asthmatics(231). The results from the in situ hybridization experiments show a possible regulatory mechanism at work controlling the expression of TGF-betal and TGF-beta3 expression 97 through the production of antisense transcripts for these genes. While it is unusual to note expression of antisense transcripts, others have reported similar results in lung tissue(232). However, in that study, the expression of antisense transcripts for TGF-beta2 was detected with the sense transcripts for TGF-betal and TGF-beta3 being the ones expressed which is the opposite of what was found here. No correlation was noted between the expression of the sense or antisense transcripts for TGF-betal, TGF-beta2, or TGF-beta3 to their respective protein expression as noted in the immunohistochemistry experiments reported above, however, the localization of these transcripts was in the same cell types, primarily the alveolar macrophages, bronchial epithelium, and vascular smooth muscle, as was found using protein specific antibodies. The fact that of the three isoforms of TGF-beta analyzed by in situ hybridization, TGF-beta2, the only sense transcript expressed in the lung tissue of patients with COPD, was also the only isoform of TGF-beta whose protein expression correlated with GOLD class. This result suggests that the regulation and expression of TGF-beta2 contributes to the fibrotic pathogenesis seen in COPD. This study has demonstrated that mediators expressed in the airway walls of patients with COPD are associated with the development and progression of airway wall fibrosis and the resulting thickening of the airways and decrease in lung function. The increased connective tissue deposition observed in the airway walls is likely due to the increased activity of myofibroblasts stimulated by these growth factors. Increased PDGF-A and PDGF-Ralpha expression result in the proliferation of myofibroblasts^ 06). As well, IL-13 is known to upregulate the production of PDGF-A(123). TGF-beta can stimulate the 98 differentiation of epithelial cells into myofibroblasts as well as activate myofibroblasts to produce collagen(167). Future studies should investigate additional mediators of myofibroblast activation such as IL-lbeta which was alluded to previously or other proteins involved in the activation of factors studied here, such as the TGF-beta activator alpha-v integrin, for their relevance to COPD. Though emphysema and chronic bronchitis as components of COPD, have been studied for nearly two centuries, the realization that the major site of obstruction is in the small conducting airways is much more recent(48). The airway narrowing and related lung function restriction which defines the severity of the airway obstruction in COPD have been associated with increased numbers of inflammatory cells infiltrating the airway tissue and a repair and remodeling process that thickens the wall and produces dense peribronchial fibrosis as the severity of the disease mounts. Theories as to the causative nature of this disease have led to the study of the inflammatory cells and the cytokines and enzymes they produce with most treatment options attempting to inhibit their function or downregulate their activity. The work presented in this thesis has focused on the role that the bronchiolar epithelium may play in airway remodeling and disease progression. The results show that cytokines and growth factors which are known to cause the proliferation and activation of myofibroblasts are present in the airway wall and associated with progression of COPD. Though the associations that have been demonstrated cannot provide definitive proof of a precise relationship between epithelial cells and myofibroblasts, the results strongly 99 suggest the bronchiolar epithelium has a role in the regulation of myofibroblast function, either through paracrine cytokine signaling or through the differentiation of epithelial cells to myofibroblasts with both mechanisms having been shown in other model systems. This opens up a new pathway for treatment of COPD by disrupting or altering the interaction between the epithelial and myofibroblast cells. Hopefully, this will prevent or even reverse the remodeling of the airways which occurs in patients with COPD and result in the improvement of their lung function and quality of life. 100 References 1. O'Donnell, D. E., Bertley, J. C , Chau, L. K., and Webb, K . A . (1997) Qualitative aspects of exertional breathlessness in chronic airflow limitation: pathophysiologic mechanisms. Am J Respir Crit Care Med 155, 109-115 2. Pauwels, R. A. , Buist, A . S., Calverley, P. M . , Jenkins, C. R., and Hurd, S. S. (2001) Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 163, 1256-1276 3. Smith, B. (2005) The nursing of a patient following lung volume reduction surgery. Nurs Times 101, 61-63 4. Ruysch, F. (1691) Observationem anatomico-chirugicarum. Amsterdam: Apud Henricum & Viduam T Boom, 25-27 5. Baillie, M . (1793) The Morbid Anatomy of some of hte most important parts of the human body., J. Johnson & G. Nicol, London 6. Laennec, R. T. (1819) De L'auscultation mediate, on traite du disgnostic des maladies des poumons et du coeur., Brosson & Chaude, Paris 7. Rainey, G. (1848) On the minute anatomy of the emphysematous lung. Med-Chir Trans 31, 297-304 8. Isaakssohn, E. (1871) Pathologisch-anatomische Veranderungen der Lungengefasse beim Emphysem. Virchows Arch Path Anat 53, 466-469 9. Eppinger, H . (1876) Das Emphysem der lungen. Vrtljjschr f dprakt Heilk Prag 4, 1-80 10. Orsos, F. (1907) Uber das elastische Gerust der normalen und der emphysematosen lunge. Beitr Pathol Anat 41, 95-121 11. Schultze, H . E., Heide, K. , and Haupt, H. (1962) [alphal-Antitrypsin from human serum]. Klin Wochenschr 40, 427-429 12. Eriksson, S. (1964) Pulmonary Emphysema and Alphal-Antitrypsin Deficiency. Acta Med Scand 175, 197-205 13. Villemin, J. A . (1886) Recherches sur la vesicule pulmonaire et l'emphyseme. II. De l'emphyseme pulmonaire. Arch Gen Med 8, 566-589 14. Kluger, R. (1996) Ashes to ashes : America's hundred-year cigarette war, the public health, and the unabashed triumph of Philip Morris, Alfred A. Knopf: Distributed by Random House, New York 15. Gough, J. (1952) Discussion on the diagnosis of pulmonary emphysema. The pathological diagnosis of emphysema. Proc R Soc Med 45, 576-577 16. Leopold, J. G., and Gough, J. (1957) The centrilobular form of hypertrophic emphysema and its relation to chronic bronchitis. Thorax 12, 219-315 17. Davis, R. M . , and Novotny, T. E. (1989) The epidemiology of cigarette smoking and its impact on chronic obstructive pulmonary disease. Am Rev Respir Dis 140, S82-84 18. Oswald, N . C , Harold, J. T., and Martin, W. J. (1953) Clinical pattern of chronic bronchitis. Lancet 265, 639-643 19. Vestbo, J. (2002) Epidemiology. In Chronic Obstructive Lung Diseases (Voelkel, N . F., and MacNee, W., eds) pp. 41-55, BC Decker Inc, Hamilton, Ontario 101 20. Fletcher, C. M . , Peto, R., Tinker, C. M . , and Speizer, F. E. (1976) The natural history of chronic bronchitis and emphysema, Oxford University Press, Oxford 21. (1997) BTS guidelines for the management of chronic obstructive pulmonary disease. The COPD Guidelines Group of the Standards of Care Committee of the BTS. Thorax 52 Suppl 5, SI-28 22. (1995) Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. American Thoracic Society. Am J Respir Crit Care Med 152, S77-121 23. Siafakas, N . M . , Vermeire, P., Pride, N . B., Paoletti, P., Gibson, J., Howard, P., Yernault, J. C , Decramer, M . , Higenbottam, T., Postma, D. S., and et al. (1995) Optimal assessment and management of chronic obstructive pulmonary disease (COPD). The European Respiratory Society Task Force. Eur Respir J 8, 1398-1420 24. Fabbri, L. M . , and Hurd, S. S. (2003) Global Strategy for the Diagnosis, Management and Prevention of COPD: 2003 update. Eur Respir J 22, 1-2 25. (1985) The definition of emphysema. Report of a National Heart, Lung, and Blood Institute, Division of Lung Diseases workshop. Am Rev Respir Dis 132, 182-185 26. Croxton, T. L., Weinmann, G. G., Senior, R. M . , and Hoidal, J. R. (2002) Future research directions in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 165, 838-844 27. Hurd, S. (2000) The impact of COPD on lung health worldwide: epidemiology and incidence. Chest 117, 1S-4S 28. Mannino, D. M . , Buist, A . S., Petty, T. L., Enright, P. L., and Redd, S. C. (2003) Lung function and mortality in the United States: data from the First National Health and Nutrition Examination Survey follow up study. Thorax 58, 388-393 29. Beaty, T. H. , Newill, C. A. , Cohen, B. H. , Tockman, M . S., Bryant, S. H. , and Spurgeon, H. A . (1985) Effects of pulmonary function on mortality. J Chronic Dis 38, 703-710 30. Kuller, L. H. , Ockene, J. K. , Townsend, M . , Browner, W., Meilahn, E., and Wentworth, D. N . (1989) The epidemiology of pulmonary function and COPD mortality in the multiple risk factor intervention trial. Am Rev Respir Dis 140, S76-81 31. Sethi, J. M . , and Rochester, C. L. (2000) Smoking and chronic obstructive pulmonary disease. Clin Chest Med 21, 67-86, viii 32. Barnes, P. J. (1999) Genetics and pulmonary medicine. 9. Molecular genetics of chronic obstructive pulmonary disease. Thorax 54, 245-252 33. Surgeon-General, U . (1984) The Health Consequences of Smoking: Chronic Obstructive Lung Disease. In, US Department of Health and Human Services, Washington DC 34. Chapman, K. R. (2004) Chronic obstructive pulmonary disease: are women more susceptible than men? Clin Chest Med 25, 331-341 35. Kiraz, K. , Kart, L. , Demir, R., Oymak, S., Gulmez, I., Unalacak, M . , and Ozesmi, M . (2003) Chronic pulmonary disease in rural women exposed to biomass fumes. Clin Invest Med 26, 243-248 102 36. Mannino, D. M . , Holguin, F., Greves, H. M . , Savage-Brown, A. , Stock, A . L., and Jones, R. L. (2004) Urinary cadmium levels predict lower lung function in current and former smokers: data from the Third National Health and Nutrition Examination Survey. Thorax 59, 194-198 37. Silva, G. E., Sherrill, D. L. , Guerra, S., and Barbee, R. A . (2004) Asthma as a risk factor for COPD in a longitudinal study. Chest 126, 59-65 38. Shaheen, S. (1997) The beginnings of chronic airflow obstruction. Br Med Bull 53,58-70 39. Elzouki, A . N . , Eriksson, S., Lofberg, R., Nassberger, L. , Wieslander, J., and Lindgren, S. (1999) The prevalence and clinical significance of alpha 1-antitrypsin deficiency (PiZ) and A N C A specificities (proteinase 3, BPI) in patients with ulcerative colitis. Inflamm Bowel Dis 5, 246-252 40. Luisetti, M . , and Seersholm, N . (2004) Alphal-antitrypsin deficiency. 1: epidemiology of alphal-antitrypsin deficiency. Thorax 59, 164-169 41. Larsson, C. (1978) Natural history and life expectancy in severe alphal-antitrypsin deficiency, Pi Z. Acta Med Scand 204, 345-351 42. Dowson, L. J., Guest, P. J., Hi l l , S. L., Holder, R. L., and Stockley, R. A . (2001) High-resolution computed tomography scanning in alphal-antitrypsin deficiency: relationship to lung function and health status. Eur Respir J\l,\097-1104 43. McParland, B. E., Macklem, P. T., and Pare, P. D. (2003) Airway wall remodeling: friend or foe? J Appl Physiol 95, 426-434 44. Petty, T. L., Silvers, G. W., and Stanford, R. E. (1986) Radial traction and small airways disease in excised human lungs. Am Rev Respir Dis 133, 132-135 45. Saetta, M . , Turato, G., and Zuin, R. (2000) Structural basis for airflow limitation in chronic obstructive pulmonary disease. Sarcoidosis Vase Diffuse Lung Dis 17, 239-245 46. Hogg, J. C , Chu, F., Utokaparch, S., Woods, R., Elliott, W. M . , Buzatu, L., Cherniack, R. M . , Rogers, R. M . , Sciurba, F. C , Coxson, H. O., and Pare, P. D. (2004) The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 350, 2645-2653 47. Rogers, D. F. (2001) Mucus hypersecretion in chronic obstructive pulmonary disease. Novartis Found Symp 234, 65-77; discussion 77-83 48. Hogg, J. C , Macklem, P. T., and Thurlbeck, W. M . (1968) Site and nature of airway obstruction in chronic obstructive lung disease. NEngl JMed 278, 1355-1360 49. Yanai, M . , Sekizawa, K. , Ohrui, T., Sasaki, H. , and Takishima, T. (1992) Site of airway obstruction in pulmonary disease: direct measurement of intrabronchial pressure. J Appl Physiol 72, 1016-1023 50. Williams, P. L., Warwick, R., Dyson, M . , and Bannister, L. H. , eds (1989) Gray's Anatomy, Churchill Livingstone, London, U K 51. Alberts, B., Johnson, A. , Lewis, J., Raff, M . , Roberts, K., and Walter, P. (2002) Molecular Biology of the Cell, Garland Science, New York 52. Prodhan, P., and Kinane, T. B. (2002) Developmental paradigms in terminal lung development. Bioessays 24, 1052-1059 53. Hogg, J. C. (2004) Pathophysiology of airflow limitation in chronic obstructive pulmonary disease. Lancet 364, 709-721 103 54. Hruban, R. H. , Meziane, M . A. , Zerhouni, E. A. , Khouri, N . F., Fishman, E. K. , Wheeler, P. S., Dumler, J. S., and Hutchins, G. M . (1987) High resolution computed tomography of inflation-fixed lungs. Pathologic-radiologic correlation of centrilobular emphysema. Am Rev Respir Dis 136, 935-940 55. Foster, W. L., Jr., Gimenez, E. I., Roubidoux, M . A. , Sherrier, R. H. , Shannon, R. H. , Roggli, V . L. , and Pratt, P. C. (1993) The emphysemas: radiologic-pathologic correlations. Radiographics 13, 311-328 56. Janeway, C. A. , Travers, P., Walport, M . , and Schlomchik, M . J. (2001) Immunobiology, Garland Publishing, New York 57. Wright, J. L., Hobson, J. E., Wiggs, B., Pare, P. D., and Hogg, J. C. (1988) Airway inflammation and peribronchiolar attachments in the lungs of nonsmokers, current and ex-smokers. Lung 166, 277-286 58. van Eeden, S. F., and Hogg, J. C. (2000) The response of human bone marrow to chronic cigarette smoking. Eur Respir J15, 915-921 59. Niewoehner, D. E., Kleinerman, J., and Rice, D. B. (1974) Pathologic changes in the peripheral airways of young cigarette smokers. NEngl J Med 291, 755-758 60. van der Vaart, H. , Postma, D. S., Timens, W., and ten Hacken, N . H . (2004) Acute effects of cigarette smoke on inflammation and oxidative stress: a review. Thorax 59, 713-721 61. Barnes, P. J. (2004) Alveolar macrophages in chronic obstructive pulmonary disease (COPD). Cell Mol Biol (Noisy-le-grand) 50 Online Pub, OL627-637 62. Saetta, M . , Baraldo, S., Corbino, L., Turato, G., Braccioni, F., Rea, F., Cavallesco, G , Tropeano, G., Mapp, C. E., Maestrelli, P., Ciaccia, A. , and Fabbri, L. M . (1999) CD8+ve cells in the lungs of smokers with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 160, 711-717 63. Turino, G. M . (2002) The origins of a concept: the protease-antiprotease imbalance hypothesis. Chest 122, 1058-1060 64. Gross, P., Pfitzer, E. A. , Tolker, E., Babyak, M . A. , and Kaschak, M . (1965) Experimental Emphysema: Its Production with Papain in Normal and Silicotic Rats. Arch Environ Health 11, 50-58 65. Janoff, A. , Sloan, B., Weinbaum, G., Damiano, V. , Sandhaus, R. A. , Elias, J., and Kimbel, P. (1977) Experimental emphysema induced with purified human neutrophil elastase: tissue localization of the instilled protease. Am Rev Respir Dis 115, 461-478 66. Segura-Valdez, L., Pardo, A. , Gaxiola, M . , Uhal, B. D., Becerril, C , and Selman, M . (2000) Upregulation of gelatinases A and B, collagenases 1 and 2, and increased parenchymal cell death in COPD. Chest 117, 684-694 67. Imai, K. , Dalai, S. S., Chen, E. S., Downey, R., Schulman, L. L., Ginsburg, M . , and D'Armiento, J. (2001) Human collagenase (matrix metalloproteinase-1) expression in the lungs of patients with emphysema. Am J Respir Crit Care Med 163, 786-791 68. Beeh, K. M . , Beier, J., Kornmann, O., and Buhl, R. (2003) Sputum matrix metalloproteinase-9, tissue inhibitor of metalloprotinease-1, and their molar ratio in patients with chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis and healthy subjects. Respir Med 97, 634-639 104 69. Hautamaki, R. D., Kobayashi, D. K. , Senior, R. M . , and Shapiro, S. D. (1997) Requirement for macrophage elastase for cigarette smoke-induced emphysema in mice. Science 277, 2002-2004 70. Hampton, M . B., Kettle, A . J., and Winterbourn, C. C. (1998) Inside the neutrophil phagosome: oxidants, myeloperoxidase, and bacterial killing. Blood 92,3007-3017 71. McCord, J. M , Gao, B., Leff, J., and Flores, S. C. (1994) Neutrophil-generated free radicals: possible mechanisms of injury in adult respiratory distress syndrome. Environ Health Perspect 102 Suppl 10, 57-60 72. Montuschi, P., Collins, J. V. , Ciabattoni, G., Lazzeri, N . , Corradi, M . , Kharitonov, S. A. , and Barnes, P. J. (2000) Exhaled 8-isoprostane as an in vivo biomarker of lung oxidative stress in patients with COPD and healthy smokers. Am J Respir Crit Care Med 162, 1175-1177 73. Kostikas, K. , Papatheodorou, G., Psathakis, K. , Panagou, P., and Loukides, S. (2003) Oxidative stress in expired breath condensate of patients with COPD. Chest UA, 1373-1380 74. Church, D. F., and Pryor, W. A . (1985) Free-radical chemistry of cigarette smoke and its toxicological implications. Environ Health Perspect 64, 111-126 75. Alexander, C. M . , Howard, E. W., Bissell, M . J., and Werb, Z. (1996) Rescue of mammary epithelial cell apoptosis and entactin degradation by a tissue inhibitor of metalloproteinases-1 transgene. J Cell Biol 135, 1669-1677 76. Hague, A. , Hicks, D. J., Bracey, T. S., and Paraskeva, C. (1997) Cell-cell contact and specific cytokines inhibit apoptosis of colonic epithelial cells: growth factors protect against c-myc-independent apoptosis. Br J Cancer 75, 960-968 77. Pullan, S., Wilson, J., Metcalfe, A. , Edwards, G. M . , Goberdhan, N . , Tilly, J., Hickman, J. A. , Dive, C , and Streuli, C. H. (1996) Requirement of basement membrane for the suppression of programmed cell death in mammary epithelium. J Cell Sci 109 ( Pt 3), 631-642 78. Yokohori, N . , Aoshiba, K. , and Nagai, A . (2004) Increased levels of cell death and proliferation in alveolar wall cells in patients with pulmonary emphysema. Chest 125, 626-632 79. Imai, K. , and D'Armiento, J. (2002) Differential gene expression of sFRP-1 and apoptosis in pulmonary emphysema. Chest 121, 7S 80. Aoshiba, K. , Yokohori, N . , and Nagai, A . (2003) Alveolar wall apoptosis causes lung destruction and emphysematous changes. Am J Respir Cell Mol Biol 28, 555-562 81. Boots, A . W., Haenen, G. R., and Bast, A . (2003) Oxidant metabolism in chronic obstructive pulmonary disease. Eur Respir J Suppl 46, 14s-27s 82. Geiser, T., Ishigaki, M . , van Leer, C , Matthay, M . A. , and Broaddus, V . C. (2004) H(2)0(2) inhibits alveolar epithelial wound repair in vitro by induction of apoptosis. Am J Physiol Lung Cell Mol Physiol 287, L448-453 83. Kasahara, Y . , Tuder, R. M . , Taraseviciene-Stewart, L., Le Cras, T. D., Abman, S., Hirth, P. K. , Waltenberger, J., and Voelkel, N . F. (2000) Inhibition of V E G F receptors causes lung cell apoptosis and emphysema. J Clin Invest 106, 1311-1319 105 84. Kasahara, Y . , Tuder, R. M . , Cool, C. D., Lynch, D. A. , Flores, S. C , and Voelkel, N . F. (2001) Endothelial cell death and decreased expression of vascular endothelial growth factor and vascular endothelial growth factor receptor 2 in emphysema. Am J Respir Crit Care Med 163, 737-744 85. Bai, A. , Eidelman, D. FL, Hogg, J. C , James, A. L., Lambert, R. K. , Ludwig, M . S., Martin, J., McDonald, D. M . , Mitzner, W. A. , Okazawa, M . , and et al. (1994) Proposed nomenclature for quantifying subdivisions of the bronchial wall. J Appl Physiolll, 1011-1014 86. Harkema, J., Mariassy, A. , and St George, J. (1991) Epithelial cells of the conducting airways. A species comparison. In The airway epithelium. Physiology, pathophysiology, and pharmacology. (Farmer, S. G., and Hay, D. W. P., eds) Vol . 54 pp. 3-40, Marcel Dekker, New York 87. Timpl, R., Paulsson, M . , Dziadek, M . , and Fujiwara, S. (1987) Basement membranes. Methods Enzymol 145, 363-391 88. Lipsett, J. (2002) Analysis of the conducting airway system in the lung: a new method combining morphometry with mathematical modeling for airway classification. Anat Rec 266, 51-57 89. Cosio, M . , Ghezzo, H. , Hogg, J. C , Corbin, R., Loveland, M . , Dosman, J., and Macklem, P. T. (1978) The relations between structural changes in small airways and pulmonary-function tests. N Engl J Med 298, 1277-1281 90. Brunton, S., Carmichael, B. P., Colgan, R., Feeney, A . S., Fendrick, A . M . , Quintiliani, R., and Scott, G. (2004) Acute exacerbation of chronic bronchitis: a primary care consensus guideline. Am JManag Care 10, 689-696 91. Fletcher, C. M . (1959) Chronic bronchitis. Its prevalence, nature, and pathogenesis. Am Rev Respir Dis 80, 483-494 92. Vestbo, J., and Lange, P. (2002) Can GOLD Stage 0 provide information of prognostic value in chronic obstructive pulmonary disease? Am J Respir Crit Care Med 166, 329-332 93. Anthonisen, N . R. (2004) The British hypothesis revisited. Eur Respir J 23, 657-658 94. Kanner, R. E., Anthonisen, N . R., and Connett, J. E. (2001) Lower respiratory illnesses promote FEV( l ) decline in current smokers but not ex-smokers with mild chronic obstructive pulmonary disease: results from the lung health study. Am J Respir Crit Care Med 164, 358-364 95. Donaldson, G. C , Seemungal, T. A. , Bhowmik, A. , and Wedzicha, J. A . (2002) Relationship between exacerbation frequency and lung function decline in chronic obstructive pulmonary disease. Thorax 57, 847-852 96. Sethi, S., Evans, N . , Grant, B. J., and Murphy, T. F. (2002) New strains of bacteria and exacerbations of chronic obstructive pulmonary disease. NEnglJ Med 347, 465-471 97. Postma, D. S., and Boezen, H. M . (2004) Rationale for the Dutch hypothesis. Allergy and airway hyperresponsiveness as genetic factors and their interaction with environment in the development of asthma and COPD. Chest 126, 96S-104S; discussion 159S-161S 98. Bleecker, E. R. (2004) Similarities and differences in asthma and COPD. The Dutch hypothesis. Chest 126, 93S-95S; discussion 159S-161S 106 99. Elias, J. (2004) The relationship between asthma and COPD. Lessons from transgenic mice. Chest 126, 111S-116S; discussion 159S-161S 100. Saetta, M . , Di Stefano, A. , Maestrelli, P., Turato, G., Ruggieri, M . P., Roggeri, A. , Calcagni, P., Mapp, C. E., Ciaccia, A. , and Fabbri, L. M . (1994) Airway eosinophilia in chronic bronchitis during exacerbations. Am J Respir Crit Care Med 150, 1646-1652 101. Wenzel, S. E., Schwartz, L. B., Langmack, E. L., Halliday, J. L., Trudeau, J. B., Gibbs, R. L. , and Chu, H . W. (1999) Evidence that severe asthma can be divided pathologically into two inflammatory subtypes with distinct physiologic and clinical characteristics. Am J Respir Crit Care Med 160, 1001-1008 102. Wills-Karp, M . (2004) Interleukin-13 in asthma pathogenesis. Immunol Rev 202, 175-190 103. Zheng, T., Zhu, Z., Wang, Z., Homer, R. J., Ma, B., Riese, R. J., Jr., Chapman, H . A. , Jr., Shapiro, S. D., and Elias, J. A . (2000) Inducible targeting of IL-13 to the adult lung causes matrix metalloproteinase- and cathepsin-dependent emphysema. J Clin Invest 106, 1081 -1093 104. Aoshiba, K. , and Nagai, A . (2004) Differences in airway remodeling between asthma and chronic obstructive pulmonary disease. Clin Rev Allergy Immunol 27, 35-43 105. White, S. R., and Dorscheid, D. R. (2002) Corticosteroid-induced apoptosis of airway epithelium: a potential mechanism for chronic airway epithelial damage in asthma. Chest 122, 278S-284S 106. Bonner, J. C. (2004) Regulation of PDGF and its receptors in fibrotic diseases. Cytokine Growth Factor Rev 15, 255-273 107. Leonard, W. J., and Lin, J. X . (2000) Cytokine receptor signaling pathways. J Allergy Clin Immunol 105, 877-888 108. McKenzie, A . N . , L i , X . , Largaespada, D. A. , Sato, A. , Kaneda, A. , Zurawski, S. M . , Doyle, E. L. , Milatovich, A. , Francke, U . , Copeland, N . G., and et al. (1993) Structural comparison and chromosomal localization of the human and mouse IL-13 genes. J Immunol 150, 5436-5444 109. Chomarat, P., and Banchereau, J. (1998) Interleukin-4 and interleukin-13: their similarities and discrepancies. Int Rev Immunol 17, 1-52 110. Tsarbopoulos, A. , Varnerin, J., Cannon-Carlson, S., Wylie, D., Pramanik, B. , Tang, J., and Nagabhushan, T. L. (2000) Mass spectrometric mapping of disulfide bonds in recombinant human interleukin-13. JMass Spectrom 35, 446-453 111. Muller, T., Oehlenschlager, F., and Buehner, M . (1995) Human interleukin-4 and variant R88Q: phasing X-ray diffraction data by molecular replacement using X -ray and nuclear magnetic resonance models. J Mol Biol 247, 360-372 112. Eisenmesser, E. Z., Horita, D. A. , Altieri, A . S., and Byrd, R. A. (2001) Solution structure of interleukin-13 and insights into receptor engagement. J Mol Biol 310, 231-241 113. Hershey, G. K. (2003) IL-13 receptors and signaling pathways: an evolving web. J Allergy Clin Immunol 111, 677-690; quiz 691 114. Russell, S. M . , Keegan, A . D., Harada, N . , Nakamura, Y . , Noguchi, M . , Leland, P., Friedmann, M . C , Miyajima, A. , Puri, R. K. , Paul, W. E., and et al. (1993) 107 Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science 262, 1880-1883 115. Kelly-Welch, A . E., Hanson, E. M . , Boothby, M . R., and Keegan, A . D. (2003) Interleukin-4 and interleukin-13 signaling connections maps. Science 300, 1527-1528 116. Kawakami, K. , Taguchi, J., Murata, T., and Puri, R. K . (2001) The interleukin-13 receptor alpha2 chain: an essential component for binding and internalization but not for interleukin-13-induced signal transduction through the STAT6 pathway. Blood 97, 2673-2679 117. Takeda, K. , Kamanaka, M . , Tanaka, T., Kishimoto, T., and Akira, S. (1996) Impaired IL-13-mediated functions of macrophages in STAT6-deficient mice. J Immunol 157, 3220-3222 118. Sornasse, T., Larenas, P. V. , Davis, K. A. , de Vries, J. E., and Yssel, H . (1996) Differentiation and stability of T helper 1 and 2 cells derived from naive human neonatal CD4+ T cells, analyzed at the single-cell level. J Exp Med 184, 473-483 119. de Vries, J. E. (1998) The role of IL-13 and its receptor in allergy and inflammatory responses. J Allergy Clin Immunol 102, 165-169 120. Oettgen, H. C , and Geha, R. S. (2001) IgE regulation and roles in asthma pathogenesis. J Allergy Clin Immunol 107, 429-440 121. Zurawski, G., and de Vries, J. E. (1994) Interleukin 13, an interleukin 4-like cytokine that acts on monocytes and B cells, but not on T cells. Immunol Today 15, 19-26 122. Bochner, B. S., Klunk, D. A. , Sterbinsky, S. A. , Coffman, R. L. , and Schleimer, R. P. (1995) IL-13 selectively induces vascular cell adhesion molecule-1 expression in human endothelial cells. J Immunol 154, 799-803 123. Ingram, J. L., Rice, A . B. , Geisenhoffer, K. , Madtes, D. K. , and Bonner, J. C. (2004) IL-13 and IL-1 beta promote lung fibroblast growth through coordinated up-regulation of PDGF-AA and PDGF-Ralpha. Faseb J18, 1132-1134 124. Lee, C. G., Homer, R. J., Zhu, Z., Lanone, S., Wang, X . , Koteliansky, V . , Shipley, J. M . , Gotwals, P., Noble, P., Chen, Q., Senior, R. M . , and Elias, J. A . (2001) Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor beta(l). J Exp Med 194, 809-821 125. Wen, F. Q., Kohyama, T., Liu, X . , Zhu, Y . K. , Wang, H. , Kim, H. J., Kobayashi, T., Abe, S., Spurzem, J. R., and Rennard, S. I. (2002) Interleukin-4- and interleukin-13-enhanced transforming growth factor-beta2 production in cultured human bronchial epithelial cells is attenuated by interferon-gamma. Am J Respir Cell Mol Biol 26, 484-490 126. Laoukili, J., Perret, E., Willems, T., Minty, A. , Parthoens, E., Houcine, O., Coste, A. , Jorissen, M . , Marano, F., Caput, D., and Tournier, F. (2001) IL-13 alters mucociliary differentiation and ciliary beating of human respiratory epithelial cells. J Clin Invest 108,1817-1824 127. Zhu, Z., Homer, R. J., Wang, Z., Chen, Q., Geba, G. P., Wang, J., Zhang, Y . , and Elias, J. A . (1999) Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest 103, 779-788 108 128. Roberts, A . B., and Sporn, M . B. (1985) Transforming growth factors. Cancer Surv 4, 683-705 129. Khalil, N . , Parekh, T. V. , O'Connor, R., Antman, N . , Kepron, W., Yehaulaeshet, T., Xu , Y . D., and Gold, L. I. (2001) Regulation of the effects of TGF-beta 1 by activation of latent TGF-beta 1 and differential expression of TGF-beta receptors (T beta R-I and T beta R-II) in idiopathic pulmonary fibrosis. Thorax 56, 907-915 130. Coker, R. K. , Laurent, G. J., Shahzeidi, S., Lympany, P. A. , du Bois, R. M . , Jeffery, P. K. , and McAnulty, R. J. (1997) Transforming growth factors-beta 1, -beta 2, and -beta 3 stimulate fibroblast procollagen production in vitro but are differentially expressed during bleomycin-induced lung fibrosis. Am J Pathol 150, 981-991 131. Wahl, S. M . , Swisher, J., McCartney-Francis, N . , and Chen, W. (2004) TGF-beta: the perpetrator of immune suppression by regulatory T cells and suicidal T cells. J Leukoc Biol 76, 15-24 132. Bogdan, C , and Nathan, C. (1993) Modulation of macrophage function by transforming growth factor beta, interleukin-4, and interleukin-10. Ann N Y Acad 685, 713-739 133. Chang, FL, Brown, C. W., and Matzuk, M . M . (2002) Genetic analysis of the mammalian transforming growth factor-beta superfamily. Endocr Rev 23, 787-823 134. Grande, J. P. (1997) Role of transforming growth factor-beta in tissue injury and repair. Proc Soc Exp Biol Med 214, 27-40 135. Dubois, C. M . , Blanchette, F., Laprise, M . H. , Leduc, R., Grondin, F., and Seidah, N . G. (2001) Evidence that furin is an authentic transforming growth factor-betal-converting enzyme. Am J Pathol 158, 305-316 136. Hyytiainen, M . , Penttinen, C , and Keski-Oja, J. (2004) Latent TGF-beta binding proteins: extracellular matrix association and roles in TGF-beta activation. Crit Rev Clin Lab Sci 41, 233-264 137. Rifkin, D. B., Mazzieri, R., Munger, J. S., Noguera, I., and Sung, J. (1999) Proteolytic control of growth factor availability. Apmis 107, 80-85 138. Murphy-Ullrich, J. E., and Poczatek, M . (2000) Activation of latent TGF-beta by thrombospondin-1: mechanisms and physiology. Cytokine Growth Factor Rev 11, 59-69 139. Munger, J. S., Huang, X . , Kawakatsu, H. , Griffiths, M . J., Dalton, S. L., Wu, J., Pittet, J. F., Kaminski, N . , Garat, C , Matthay, M . A. , Rifkin, D. B. , and Sheppard, D. (1999) The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell 96, 319-328 140. Annes, J. P., Rifkin, D. B., and Munger, J. S. (2002) The integrin alphaVbeta6 binds and activates latent TGFbeta3. FEBS Lett 511, 65-68 141. ten Dijke, P., and Hi l l , C. S. (2004) New insights into TGF-beta-Smad signalling. Trends Biochem Sci 29, 265-273 142. Leask, A. , Abraham, D. J., Finlay, D. R., Holmes, A. , Pennington, D., Shi-Wen, X . , Chen, Y . , Venstrom, K. , Dou, X . , Ponticos, M . , Black, C , Bernabeu, C , Jackman, J. K. , Findell, P. R., and Connolly, M . K. (2002) Dysregulation of transforming growth factor beta signaling in scleroderma: overexpression of endoglin in cutaneous scleroderma fibroblasts. Arthritis Rheum 46, 1857-1865 109 143. Riggins, G. J., Thiagalingam, S., Rozenblum, E., Weinstein, C. L., Kern, S. E., Hamilton, S. R., Willson, J. K. , Markowitz, S. D., Kinzler, K. W., and Vogelstein, B. (1996) Mad-related genes in the human. Nat Genet 13, 347-349 144. Zhang, Y . , Feng, X . , We, R., and Derynck, R. (1996) Receptor-associated Mad homologues synergize as effectors of the TGF-beta response. Nature 383, 168-172 145. Hahn, S. A. , Schutte, M . , Hoque, A . T., Moskaluk, C. A. , da Costa, L. T., Rozenblum, E., Weinstein, C. L., Fischer, A. , Yeo, C. J., Hruban, R. H. , and Kern, S. E. (1996) DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. Science 271, 350-353 146. Imamura, T., Takase, M . , Nishihara, A . , Oeda, E., Hanai, J., Kawabata, M . , and Miyazono, K. (1997) Smad6 inhibits signalling by the TGF-beta superfamily. Nature 389, 622-626 147. Hayashi, H. , Abdollah, S., Qiu, Y . , Cai, J., Xu , Y . Y . , Grinnell, B. W., Richardson, M . A. , Topper, J. N . , Gimbrone, M . A. , Jr., Wrana, J. L., and Falb, D. (1997) The MAD-related protein Smad7 associates with the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell 89, 1165-1173 148. von Gersdorff, G., Susztak, K. , Rezvani, F., Bitzer, M . , Liang, D., and Bottinger, E. P. (2000) Smad3 and Smad4 mediate transcriptional activation of the human Smad7 promoter by transforming growth factor beta. J Biol Chem 275, 11320-11326 149. Yue, J., and Mulder, K. M . (2001) Transforming growth factor-beta signal transduction in epithelial cells. Pharmacol Ther 91, 1-34 150. Boulton, T. G , Gregory, J. S., and Cobb, M . H . (1991) Purification and properties of extracellular signal-regulated kinase 1, an insulin-stimulated microtubule-associated protein 2 kinase. Biochemistry 30, 278-286 151. Hoshi, M . , Nishida, E., and Sakai, H. (1988) Activation of a Ca2+-inhibitable protein kinase that phosphorylates microtubule-associated protein 2 in vitro by growth factors, phorbol esters, and serum in quiescent cultured human fibroblasts. JBiol Chem 263, 5396-5401 152. Cano, E., and Mahadevan, L. C. (1995) Parallel signal processing among mammalian M A P K s . Trends Biochem Sci 20, 117-122 153. Ip, Y . T., and Davis, R. J. (1998) Signal transduction by the c-Jun N-terminal kinase (JNK)~from inflammation to development. Curr Opin Cell Biol 10, 205-219 154. Fanger, G. R., Gerwins, P.,- Widmann, C , Jarpe, M . B., and Johnson, G. L. (1997) M E K K s , GCKs, M L K s , PAKs, TAKs, and tpls: upstream regulators of the c-Jun amino-terminal kinases? Curr Opin Genet Dev 7, 67-74 155. Shibuya, H. , Yamaguchi, K., Shirakabe, K. , Tonegawa, A. , Gotoh, Y . , Ueno, N . , Irie, K. , Nishida, E., and Matsumoto, K. (1996) TAB1: an activator of the TAK1 M A P K K K in TGF-beta signal transduction. Science 272, 1179-1182 156. Whitmarsh, A . J., and Davis, R. J. (1996) Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J Mol Med 74, 589-607 157. Sanford, L. P., Ormsby, I., Gittenberger-de Groot, A . C , Sariola, H. , Friedman, R., Boivin, G. P., Cardell, E. L., and Doetschman, T. (1997) TGFbeta2 knockout 110 mice have multiple developmental defects that are non-overlapping with other TGFbeta knockout phenotypes. Development 124, 2659-2670 158. Kaartinen, V . , Voncken, J. W., Shuler, C , Warburton, D., Bu, D., Heisterkamp, N . , and Groffen, J. (1995) Abnormal lung development and cleft palate in mice lacking TGF-beta 3 indicates defects of epithelial-mesenchymal interaction. Nat Genet 11, 415-421 159. Dunker, N . , and Krieglstein, K. (2000) Targeted mutations of transforming growth factor-beta genes reveal important roles in mouse development and adult homeostasis. Eur J Biochem 267, 6982-6988 160. Liu, J., Tseu, I., Wang, J., Tanswell, K., and Post, M . (2000) Transforming growth factor beta2, but not betal and beta3, is critical for early rat lung branching. DevDyn 217, 343-360 161. Shull, M . M . , Ormsby, I., Kier, A . B., Pawlowski, S., Diebold, R. J., Yin , M . , Allen, R., Sidman, C , Proetzel, G., Calvin, D., and et al. (1992) Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359, 693-699 162. Morris, D. G., Huang, X . , Kaminski, N . , Wang, Y . , Shapiro, S. D., Dolganov, G., Glick, A . , and Sheppard, D. (2003) Loss of integrin alpha(v)beta6-mediated TGF-beta activation causes Mmpl2-dependent emphysema. Nature All, 169-173 163. Bonniaud, P., Kolb, M . , Gait, T., Robertson, J., Robbins, C , Stampfli, M . , Lavery, C , Margetts, P. J., Roberts, A . B., and Gauldie, J. (2004) Smad3 null mice develop airspace enlargement and are resistant to TGF-beta-mediated pulmonary fibrosis. J Immunol 173, 2099-2108 164. Phan, S. H . (2002) The myofibroblast in pulmonary fibrosis. Chest 122, 286S-289S 165. Gabbiani, G. (2003) The myofibroblast in wound healing and fibrocontractive diseases. J Pathol 200, 500-503 166. Diegelmann, R. F., and Evans, M . C. (2004) Wound healing: an overview of acute, fibrotic and delayed healing. Front Biosci 9, 283-289 167. Petroll, W. M . , Jester, J. V. , Bean, J. J., and Cavanagh, H . D. (1998) Myofibroblast transformation of cat corneal endothelium by transforming growth factor-betal, -beta2, and -beta3. Invest Ophthalmol Vis Sci 39, 2018-2032 168. Seeland, U . , Haeuseler, C , Hinrichs, R., Rosenkranz, S., Pfitzner, T., Scharffetter-Kochanek, K. , and Bohm, M . (2002) Myocardial fibrosis in transforming growth factor-beta(l) (TGF-beta(l)) transgenic mice is associated with inhibition of interstitial collagenase. Eur J Clin Invest 32, 295-303 169. Kenyon, N . J., Ward, R. W., McGrew, G., and Last, J. A . (2003) TGF-betal causes airway fibrosis and increased collagen I and III mRNA in mice. Thorax 58, 772-777 170. Coutts, A . , Chen, G., Stephens, N . , Hirst, S., Douglas, D., Eichholtz, T., and Khalil, N . (2001) Release of biologically active TGF-beta from airway smooth muscle cells induces autocrine synthesis of collagen. Am J Physiol Lung Cell Mol Physiol 280, L999-1008 171. Kimoto, K. , Nakatsuka, K., Matsuo, N . , and Yoshioka, H. (2004) p38 M A P K mediates the expression of type I collagen induced by TGF-beta 2 in human 111 retinal pigment epithelial cells ARPE-19. Invest Ophthalmol Vis Sci 45, 2431-2437 172. Xie, S., Sukkar, M . B., Issa, R., Oltmanns, U . , Nicholson, A. G., and Chung, K . F. (2005) Regulation of TGF-{beta} 1-induced connective tissue growth factor expression in airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 288, L68-L76 173. Grotendorst, G. R. (1997) Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts. Cytokine Growth Factor Rev 8, 171-179 174. Leask, A. , and Abraham, D. J. (2004) TGF-beta signaling and the fibrotic response. Faseb J18, 816-827 175. Martinet, Y . , Rom, W. N . , Grotendorst, G. R., Martin, G. R., and Crystal, R. G. (1987) Exaggerated spontaneous release of platelet-derived growth factor by alveolar macrophages from patients with idiopathic pulmonary fibrosis. NEngl J Med 317, 202-209 176. Hertz, M . I., Henke, C. A. , Nakhleh, R. E., Harmon, K. R., Marinelli, W. A. , Fox, J. M . , Kubo, S. H. , Shumway, S. J., Bolman, R. M . , 3rd, and Bitterman, P. B. (1992) Obliterative bronchiolitis after lung transplantation: a fibroproliferative disorder associated with platelet-derived growth factor. Proc Natl Acad Sci USA 89, 10385-10389 177. Fredriksson, L., L i , H. , and Eriksson, U . (2004) The PDGF family: four gene products form five dimeric isoforms. Cytokine Growth Factor Rev 15, 197-204 178. L i , X . , Ponten, A. , Aase, K. , Karlsson, L., Abramsson, A. , Uutela, M . , Backstrom, G., Hellstrom, M . , Bostrom, H., L i , H. , Soriano, P., Betsholtz, C , Heldin, C. H. , Alitalo, K. , Ostman, A. , and Eriksson, U . (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol 2, 302-309 179. Bergsten, E., Uutela, M . , L i , X . , Pietras, K. , Ostman, A. , Heldin, C. H. , Alitalo, K. , and Eriksson, U . (2001) PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor. Nat Cell Biol 3, 512-516 180. Ostman, A . (2004) PDGF receptors-mediators of autocrine tumor growth and regulators of tumor vasculature and stroma. Cytokine Growth Factor Rev 15, 275-286 181. Betsholtz, C. (2004) Insight into the physiological functions of PDGF through genetic studies in mice. Cytokine Growth Factor Rev 15, 215-228 182. Bostrom, H. , Willetts, K., Pekny, M . , Leveen, P., Lindahl, P., Hedstrand, H. , Pekna, M . , Hellstrom, M . , Gebre-Medhin, S., Schalling, M . , Nilsson, M . , Kurland, S., Tornell, J., Heath, J. K., and Betsholtz, C. (1996) PDGF-A signaling is a critical event in lung alveolar myofibroblast development and alveogenesis. Cell 85, 863-873 183. Leveen, P., Pekny, M . , Gebre-Medhin, S., Swolin, B., Larsson, E., and Betsholtz, C. (1994) Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities. Genes Dev 8, 1875-1887 184. Soriano, P. (1994) Abnormal kidney development and hematological disorders in PDGF beta-receptor mutant mice. Genes Dev 8, 1888-1896 185. Bostrom, H. , Gritli-Linde, A. , and Betsholtz, C. (2002) PDGF-A/PDGF alpha-receptor signaling is required for lung growth and the formation of alveoli but not for early lung branching morphogenesis. Dev Dyn 223, 155-162 112 186. Lindahl, P., Karlsson, L. , Hellstrom, M . , Gebre-Medhin, S., Willetts, K. , Heath, J. K. , and Betsholtz, C. (1997) Alveogenesis failure in PDGF-A-deficient mice is coupled to lack of distal spreading of alveolar smooth muscle cell progenitors during lung development. Development 124, 3943-3953 187. Nagaoka, I., Trapnell, B. C , and Crystal, R. G. (1990) Upregulation of platelet-derived growth factor-A and -B gene expression in alveolar macrophages of individuals with idiopathic pulmonary fibrosis. J Clin Invest 85, 2023-2027 188. Harmon, K . R., Witkop, C. J., White, J. G., King, R. A. , Peterson, M . , Moore, D., Tashjian, J., Marinelli, W. A. , and Bitterman, P. B. (1994) Pathogenesis of pulmonary fibrosis: platelet-derived growth factor precedes structural alterations in the Hermansky-Pudlak syndrome. J Lab Clin Med 123, 617-627 189. Hoyle, G. W., L i , J., Finkelstein, J. B., Eisenberg, T., Liu, J. Y . , Lasky, J. A. , Athas, G., Morris, G. F., and Brody, A . R. (1999) Emphysematous lesions, inflammation, and fibrosis in the lungs of transgenic mice overexpressing platelet-derived growth factor. Am J Pathol 154, 1763-1775 190. Lindroos, P. M . , Coin, P. G., Osornio-Vargas, A. R., and Bonner, J. C. (1995) Interleukin 1 beta (IL-1 beta) and the IL-1 beta-alpha 2-macroglobulin complex upregulate the platelet-derived growth factor alpha-receptor on rat pulmonary fibroblasts. Am J Respir Cell Mol Biol 13, 455-465 191. Rusznak, C , Mills, P. R., Devalia, J. L., Sapsford, R. J., Davies, R. J., and Lozewicz, S. (2000) Effect of cigarette smoke on the permeability and IL-lbeta and sICAM-1 release from cultured human bronchial epithelial cells of never-smokers, smokers, and patients with chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 23, 530-536 192. Rupp, J., Kothe, H. , Mueller, A. , Maass, M . , and Dalhoff, K . (2003) unbalanced secretion of IL-lbeta and IL-1RA in Chlamydia pneumoniae-infected mononuclear cells from COPD patients. Eur Respir J 22, 274-279 193. Ding, L. , Quinlan, K. B., Elliott, W. M . , Hamodat, M . , Pare, P. D., Hogg, J. C , and Hayashi, S. (2004) A Lung Tissue Bank for Gene Expression Studies in Chronic Obstructive Pulmonary Disease. COPD 1, 191-204 194. Ausubel, F. M . , Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A . , and Struhl, K. , eds (1994) Current Protocols in Molecular Biology Vo\. 1, John Wiley & Sons, USA 195. Gupta, S., Clarkson, M . R., Duggan, J., and Brady, H. R. (2000) Connective tissue growth factor: potential role in glomerulosclerosis and tubulointerstitial fibrosis. Kidney Int 58,1389-1399 196. Mullol, J., Baraniuk, J. N . , Logun, C , Benfield, T., Picado, C , and Shelhamer, J. H . (1996) Endothelin-1 induces GM-CSF, IL-6 and IL-8 but not G-CSF release from a human bronchial epithelial cell line (BEAS-2B). Neuropeptides 30, 551-556 197. Sousa, A . R., Lane, S. J., Nakhosteen, J. A. , Lee, T. H. , and Poston, R. N . (1996) Expression of interleukin-1 beta (IL-lbeta) and interleukin-1 receptor antagonist (IL-lra) on asthmatic bronchial epithelium. Am J Respir Crit Care Med 154, 1061-1066 113 198. Pourazar, J., Frew, A . J., Blomberg, A. , Helleday, R., Kelly, F. J., Wilson, S., and Sandstrom, T. (2004) Diesel exhaust exposure enhances the expression of IL-13 in the bronchial epithelium of healthy subjects. Respir Med 98, 821-825 199. Atherton, H. C , Jones, G., and Danahay, H. (2003) IL-13-induced changes in the goblet cell density of human bronchial epithelial cell cultures: M A P kinase and phosphatidylinositol 3-kinase regulation. Am J Physiol Lung Cell Mol Physiol 285, L730-739 200. Hancock, A. , Armstrong, L., Gama, R., and Millar, A . (1998) Production of interleukin 13 by alveolar macrophages from normal and fibrotic lung. Am J Respir Cell Mol Biol 18, 60-65 201. Brightling, C. E., Symon, F. A. , Holgate, S. T., Wardlaw, A . J., Pavord, I. D., and Bradding, P. (2003) Interleukin-4 and -13 expression is co-localized to mast cells within the airway smooth muscle in asthma. Clin Exp Allergy 33, 1711-1716 202. Minty, A. , Chalon, P., Derocq, J. M . , Dumont, X . , Guillemot, J. C , Kaghad, M . , Labit, C., Leplatois, P., Liauzun, P., Miloux, B., and et al. (1993) Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362, 248-250 203. Aubert, J. D., Dalai, B. I., Bai, T. R., Roberts, C. R., Hayashi, S., and Hogg, J. C. (1994) Transforming growth factor beta 1 gene expression in human airways. Thorax 49, 225-232 204. de Boer, W. I., van Schadewijk, A. , Sont, J. K. , Sharma, H . S., Stolk, J., Hiemstra, P. S., and van Krieken, J. H . (1998) Transforming growth factor betal and recruitment of macrophages and mast cells in airways in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 158, 1951-1957 205. Kokturk, N . , Tatlicioglu, T., Memis, L., Akyurek, N . , and Akyol, G. (2003) Expression of transforming growth factor betal in bronchial biopsies in asthma and COPD. J Asthma 40, 887-893 206. Grotendorst, G. R., Smale, G., and Pencev, D. (1989) Production of transforming growth factor beta by human peripheral blood monocytes and neutrophils. J Cell Physiol 140, 396-402 207. Szymkowiak, C. H. , Csernok, E., Reinhold, D., Bank, U . , Gross, W. L. , and Kekow, J. (2000) Neutrophils synthesize and activate TGFbeta2. Cytokine 12, 397-400 208. Pelton, R. W., Johnson, M . D., Perkett, E. A. , Gold, L. I., and Moses, H . L. (1991) Expression of transforming growth factor-beta 1, -beta 2, and -beta 3 mRNA and protein in the murine lung. Am J Respir Cell Mol Biol 5, 522-530 209. Porreca, E., Di Febbo, C , Mincione, G., Reale, M . , Baccante, G., Guglielmi, M . D., Cuccurullo, F., and Colletta, G. (1997) Increased transforming growth factor-beta production and gene expression by peripheral blood monocytes of hypertensive patients. Hypertension 30, 134-139 210. Javelaud, D., and Mauviel, A . (2004) Mammalian transforming growth factor-betas: Smad signaling and physio-pathological roles. Int J Biochem Cell Biol 36, 1161-1165 211. Aubert, J. D., Hayashi, S., Hards, J., Bai, T. R., Pare, P. D., and Hogg, J. C. (1994) Platelet-derived growth factor and its receptor in lungs from patients with asthma and chronic airflow obstruction. Am J Physiol 266, L655-663 114 212. Homma, S., Nagaoka, I., Abe, H. , Takahashi, K. , Seyama, K. , Nukiwa, T., and Kira, S. (1995) Localization of platelet-derived growth factor and insulin-like growth factor I in the fibrotic lung. Am J Respir Crit Care Med 152, 2084-2089 213. Vignaud, J. M . , Allam, M . , Martinet, N . , Pech, M . , Plenat, F., and Martinet, Y . (1991) Presence of platelet-derived growth factor in normal and fibrotic lung is specifically associated with interstitial macrophages, while both interstitial macrophages and alveolar epithelial cells express the c-sis proto-oncogene. Am J Respir Cell Mol Biol 5, 531-538 214. Hirst, S. J., Barnes, P. J., and Twort, C. H. (1996) PDGF isoform-induced proliferation and receptor expression in human cultured airway smooth muscle cells. Am J Physiol 270, L415-428 215. Hu, Y . , Bock, G., Wick, G., and Xu, Q. (1998) Activation of PDGF receptor alpha in vascular smooth muscle cells by mechanical stress. Faseb J12, 1135-1142 216. Jester, J. V. , Huang, J., Petroll, W. M . , and Cavanagh, H . D. (2002) TGFbeta induced myofibroblast differentiation of rabbit keratocytes requires synergistic TGFbeta, PDGF and integrin signaling. Exp Eye Res 75, 645-657 217. Wang, Y . Z., Zhang, P., Rice, A . B., and Bonner, J. C. (2000) Regulation of interleukin-1 beta -induced platelet-derived growth factor receptor-alpha expression in rat pulmonary myofibroblasts by p38 mitogen-activated protein kinase. J Biol Chem 275, 22550-22557 218. Lappalainen, U . , Whitsett, J. A. , Wert, S. E., Tichelaar, J. W., and Bry, K. (2005) IL-1 {beta} causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung. Am J Respir Cell Mol Biol 219. Chung, K . F. (2001) Cytokines in chronic obstructive pulmonary disease. Eur Respir J Suppl 34, 50s-59s 220. Smith, P., Mosiello, G., Deluca, L., Ko, F., Maggi, S., and Robson, M . C. (1999) TGF-beta2 activates proliferative scar fibroblasts. J Surg Res 82, 319-323 221. Lagord, C , Berry, M . , and Logan, A. (2002) Expression of TGFbeta2 but not TGFbetal correlates with the deposition of scar tissue in the lesioned spinal cord. Mol CellNeurosci 20, 69-92 222. McKaig, B. C , Hughes, K., Tighe, P. J., and Mahida, Y . R. (2002) Differential expression of TGF-beta isoforms by normal and inflammatory bowel disease intestinal myofibroblasts. Am J Physiol Cell Physiol 282, C172-182 223. Lee, S. Y . , Chuang, J. H. , Huang, C. C , Chou, M . H. , Wu, C. L. , Chen, C. M . , Hsieh, C. S., and Chen, C. L. (2004) Identification of transforming growth factors actively transcribed during the progress of liver fibrosis in biliary atresia. J Pediatr Surg 39, 702-708 224. Hosokawa, R., Nonaka, K. , Morifuji, M . , Shum, L., and Ohishi, M . (2003) TGF-beta 3 decreases type I collagen and scarring after labioplasty. J Dent Res 82, 558-564 225. Hashimoto, S., Gon, Y . , Takeshita, I., Matsumoto, K. , Maruoka, S., and Horie, T. (2001) Transforming growth Factor-betal induces phenotypic modulation of human lung fibroblasts to myofibroblast through a c-Jun-NH2-terminal kinase-dependent pathway. Am J Respir Crit Care Med 163, 152-157 115 226. Zhang, S., Smartt, H. , Holgate, S. T., and Roche, W. R. (1999) Growth factors secreted by bronchial epithelial cells control myofibroblast proliferation: an in vitro co-culture model of airway remodeling in asthma. Lab Invest 79, 395-405 227. Postlethwaite, A . E., Shigemitsu, FL, and Kanangat, S. (2004) Cellular origins of fibroblasts: possible implications for organ fibrosis in systemic sclerosis. Curr Opin Rheumatol 16, 733-738 228. Liu, Y . (2004) Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 15, 1-12 229. Zeisberg, M . , and Kalluri, R. (2004) The role of epithelial-to-mesenchymal transition in renal fibrosis. J Mol Med 82, 175-181 230. Tschumperlin, D. J., Shively, J. D., Kikuchi, T., and Drazen, J. M . (2003) Mechanical stress triggers selective release of fibrotic mediators from bronchial epithelium. Am J Respir Cell Mol Biol 28, 142-149 231. Balzar, S., Chu, H. W., Silkoff, P., Cundall, M . , Trudeau, J. B., Strand, M . , and Wenzel, S. (2005) Increased TGF-beta2 in severe asthma with eosinophilia. J Allergy Clin Immunol 115, 110-117 232. Coker, R. K. , Laurent, G. J., Dabbagh, K., Dawson, J., and McAnulty, R. J. (1998) A novel transforming growth factor beta2 antisense transcript in mammalian lung. Biochem J 332 (Pt 2), 297-301 116 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0092426/manifest

Comment

Related Items