Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Effects of VEGFR-2 signalling in post-natal hematopoiesis and vasculogenesis Larrivee, Bruno 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-995011.pdf [ 15.48MB ]
Metadata
JSON: 831-1.0092380.json
JSON-LD: 831-1.0092380-ld.json
RDF/XML (Pretty): 831-1.0092380-rdf.xml
RDF/JSON: 831-1.0092380-rdf.json
Turtle: 831-1.0092380-turtle.txt
N-Triples: 831-1.0092380-rdf-ntriples.txt
Original Record: 831-1.0092380-source.json
Full Text
831-1.0092380-fulltext.txt
Citation
831-1.0092380.ris

Full Text

EFFECTS OF VEGFR-2 SIGNALLING IN P O S T - N A T A L HEMATOPOIESIS A N D VASCULOGENESIS by BRUNO L A R R I V E E  B.Sc, Universite Laval, 1996 M . S c , Universite du Quebec a Montreal, 1999  A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF T H E REQUIREMENTS FOR T H E D E G R E E OF  DOCTOR OF PHILOSOPHY  in T H E F A C U L T Y OF G R A D U A T E STUDIES  Department of Experimental Medicine  T H E UNIVERSITY OF BRITISH C O L U M B I A  January 2005  © Bruno Larrivee, 2005  Abstract  Vascular endothelial growth factor (VEGF) and its receptors play an essential role in the formation and maintenance of the hematopoietic and vascular compartments. Activation of the kinase activity of the VEGF receptor-2 (VEGFR-2) is triggered by binding to VEGF, which affects endothelial cell proliferation, permeability, and migration. Accumulating evidence suggests that VEGFR-2 signalling may play an important role in post-natal hematopoiesis and vasculogenesis. One of the goals of this work was to study some of the biological effects triggered by VEGFR-2 in isolation, without the interference of other VEGF receptors in the contexts of post-natal hematopoiesis and vasculogenesis. By inducing expression of the full length VEGFR-2 or of a VEGFR-2 construct that can be selectively activated in fibroblasts or hematopoietic progenitors, we show that VEGFR-2 can induce activation of the Erkl/2 mitogen activated protein (MAP) kinase, p38 MAP kinase and Akt signalling pathways. Moreover, VEGFR-2 activation can elicit biological responses such as cell proliferation, migration and survival in vitro. Using a bone marrow transplantation model, we also show that VEGFR-2 activation promotes the expansion of myeloid cells in vivo, in part through the up-regulation of the hematopoietic cytokine Granulocyte/MacrophageColony Stimulating Factor (GM-CSF). In the second part of the thesis, we confirm the existence of early endothelial progenitors in mice. These cells originate from the bone marrow and can integrate in the vasculature of tumours, although at a low frequency. VEGF does not modulate the occurrence or mobilization of these progenitors. We also demonstrate that these cells originatefromhematopoietic stem cells and that they arise by  ii  cell differentiation, and not through cell fusion. The work presented in this thesis, by elucidating some of the effects triggered by V E G F signalling though VEGFR-2 in hematopoietic cells, could potentially lead to the development of therapies targeting the growth of malignant hematopoietic cells.  iii  Table of contents  ABSTRACT  ii  T A B L E OF CONTENTS  iv  LIST OF TABLES  ix  LIST OF FIGURES  x  LIST OF ABBREVIATIONS  xii  ACKNOWLEDGEMENTS  xv  CHAPTER 1 INTRODUCTION  1.1 Embryonic origins of hematopoiesis and vasculogenesis  1  2  1.1.1 Yolk sac hematopoiesis and vasculogenesis  2  1.1.2 The formation and maturation of definitive hematopoietic cells  4  1.1.3 The hemangioblast: a common progenitor of hematopoiesis and vasculogenesis 1.2 Hematopoiesis and Vasculogenesis in the adult 1.2.1. The hematopoietic stem cell  6 8 8  1.2.2 Hematopoietic hierarchy  11  1.2.3. Regulation of hematopoiesis  13  1.2.4. The angioblast and evidence of vasculogenesis in the adult  15  1.3 Vascular Endothelial Growth Factor (VEGF)  19  iv  1.3.1. Biological activities of V E G F  20  1.3.2. Regulation of V E G F expression  22  1.3.3. V E G F receptors  24  1.3.4. V E G F signal transduction  29  1.4 V E G F and hematopoiesis  37  1.4.1 Expression and induction of V E G F and its receptors in normal hematopoiesis.37 1.4.2 Role of V E G F and its receptors in hematopoietic cells  40  1.4.3 V E G F and its receptors in hematological malignancies  42  1.5 Rationale and thesis hypotheses CHAPTER 2 MATERIALS AND METHODS  44 47  2.1 Cell culture  48  2.2 Plasmid construct  48  2.3 Gene transfer  49  2.4 HFF proliferation assay  50  2.5 Migration assays  50  2.6 In vitro M A P kinase assay  51  2.7 Isolation of murine bone marrow cells  51  2.8 Animals  52  2.8.1 Bone marrow transplants  52  2.8.2 Single cell transplants  53  2.8.3 CFU-Spleen assay  54  2.9 AP20187 formulation  54  2.10 Antibody staining for FACS analysis  55  2.11 Preparation of cDNA and RT-PCR  56  2.12ELISA  56  2.13 Bone marrow cells viability assays  57  2.14 Hematopoietic colony assays  57  2:15 Immunofluorescence and microscopy  58  2.16 Immunoblotting  59  2.17 Endothelial progenitor assays  59  2.18 Tumour tissue immunohistochemical staining  60  2.19 lacZ and hPLAP staining  60  2.20 Statistical analysis  61  C H A P T E R 3 BIOLOGICAL E F F E C T S AND SIGNALLING PATHWAYS I N D U C E D B Y V E G F R - 2 IN I S O L A T I O N  62  3.1 Introduction  63  3.2 Results  64  3.2.1 VEGFR-2 transmits a mitogenic signal in response to V E G F stimulation  64  3.2.2 V E G F is chemotactic for HFF-VEGFR-2 but not HFF-Neo cells  66  3.2.3 V E G F activates Erkl/2 and p38 M A P kinases in HFF-VEGFR-2 cells  67  3.2.4 V E G F does not induce expression of endothelial markers in primary fibroblasts transduced with VEGFR-2 3.3 Discussion  69 71  C H A P T E R 4 E F F E C T S O F V E G F R - 2 A C T I V A T I O N IN M U R I N E B O N E M A R R O W IN V I T R O 4.1 Introduction  75 76  VI  4.2 Results  77  4.2.1 Activation o f V E G F R - 2 delays loss o f murine hematopoietic progenitors  77  4.2.2 V E G F R - 2 does not increase S-phase entry in hematopoietic progenitors  85  4.2.3 V E G F R - 2 activation reduces the number o f apoptotic cells in hematopoietic precursors  87  4.2.4 V E G F R - 2 activates the PI3-kinase and Erk kinase pathways  88  4.3 Discussion  92  CHAPTER 5 ACTIVATION OF VEGFR-2 IN BONE MARROW CELLS LEADS TO ACCUMULATION OF MYELOID CELLS IN  VIVO:  ROLE OF  GM-CSF  96  5.1 Introduction  97  5.2 Results  99  5.2.1 Activation o f V E G F R - 2 induces expansion o f bone marrow myeloid cells  99  5.2.2 V E G F R - 2 increases the proportion o f myeloid progenitors in the bone marrow  105  5.2.3 V E G F R - 2 activation in bone marrow cells induces G M - C S F expression and secretion 5.3 Discussion  106 113  CHAPTER 6 IMPLICATION OF BONE MARROW-DERIVED CELLS TO TUMOUR VASCULOGENESIS  119  6.1 Introduction  120  6.2 Results  122  6.2.1 Determination o f the existence o f bone marrow-derived endothelial cells  122  vii  6.2.2 Determination of the existence of and adult hemangioblast  126  6.2.3 Role of V E G F and VEGFR-2 in the mobilization and differentiation of bone marrow-derived endothelial cells  131  6.2.4 Determination of the proportion of endothelial progenitors in human umbilical cord blood 6.3 Discussion  136 138  CHAPTER 7 CONCLUSIONS AND FUTURE PROSPECTIVES  144  BIBLIOGRAPHY  151  viii  List of Tables Chapter 1 Table I Commonly used markers for the purification o f hematopoietic stem cells i n human and mouse 10 Table II C o m m o n markers expressed on human endothelial progenitors, endothelial cells and subsets o f hematopoietic cells Table III Expression o f V E G F and its receptors i n hematopoietic malignancies  mature 18 42  Chapter 2 Table I V Murine primers and P C R conditions used i n this thesis  56  Chapter 5 Table V Peripheral blood counts.....  101  ix  List of Figures Chapter 1 Figure 1 Hematopoietic sites in the developing embryo  3  Figure 2 Schematic representation of the hematopoietic hierarchy  12  Figure 3 Current concepts for neovascularization in adult ischemic tissues  16  Figure 4 Receptors of the V E G F family  24  Figure 5 Signalling pathways induced by V E G F  29  Chapter 3 Figure 6 Generation of a primary human foreskin fibroblast cell line expressing V E G F R 2 65 Figure 7 V E G F induces a proliferative response in HFF-VEGFR-2 cells but not in HFFNeo cells 66 Figure 8 V E G F simulates migration of H M E C and HFF-VEGFR-2 cells, but not HFFNeo cells 67 Figure 9 V E G F induces phosphorylation and activation of Erkl/2 M A P kinase in HFFVEGFR-2 but not HFF-Neo cells 68 Figure 10 V E G F induces phosphorylation of p38 M A P kinase in HFF-VEGFR-2 but not HFF-Neo cells 69 Figure 11 V E G F does not induce expression of endothelial markers in HFF-VEGFR-2 cells 70  Chapter 4 Figure 12 MIG-FKBP/VEGFR-2 fusion construct  79  Figure 13 VEGFR-2 maintains hematopoietic cell numbers  81  Figure 14 VEGFR-2 delays the loss of CFCs  83  Figure 15 VEGFR-2 dimerization maintains the number of multipotential bone marrow progenitors 85  Figure 16 VEGFR-2 dimerization does not increase BrdU uptake in hematopoietic progenitors 86 Figure 17 VEGFR-2 dimerization inhibits apoptosis of cytokine-starved hematopoietic progenitors 88 Figure 18 VEGFR-2 dimerization activates Akt and Erkl/2 hematopoietic progenitors  M A P kinases  in 90  Figure 19 Effect of PI3-kinase or M E K inhibition on hematopoietic progenitor survival 92  Chapter 5 Figure 20 VEGFR-2 induces expansion of retrovirally transduced hematopoietic cells in vivo 100 Figure 21 VEGFR-2 induces expansion of myeloid cells, but not of erythroid and lymphoid cells in the bone marrow 103 Figure 22 FKBP-VEGFR-2-transduced cells are not mobilized in the peripheral blood in response to AP20187 104 Figure 23 VEGFR-2 induces expansion of bone marrow myeloid progenitors in vivo.. 105 Figure 24 Effects of VEGFR-2 activation on expression of hematopoietic factors in murine bone marrow cells 107 Figure 25 VEGFR-2 dimerization increases expression of GM-CSF at the protein level in murine bone marrow 109 Figure 26 Blocking of GM-CSF inhibits VEGFR-2-induced expansion of myeloid progenitors 112  Chapter 6 Figure 27 vasculature  Bone  marrow  derived  endothelial  cells  incorporate  into  tumour 124  Figure 28 Bone marrow-derived endothelial cells have a relatively small contribution to the formation of blood vessels in B6RV2 lymphomas 125  XI  Figure 29 Bone marrow-derived endothelial cells arise by differentiation and not by cell fusion 128 Figure 30 A single hematopoietic stem cell can give rise to endothelial progenitor cells that incorporate into tumour blood vessels 130 Figure 31 V E G F secretion by tumour cells does not increase the contribution of bone marrow-derived cells to the formation of tumour blood vessels 132 Figure 32 VEGFR-2 activation in bone marrow cells does not result in endothelial progenitor mobilization or recruitment into tumour vasculature 135 Figure 33 Rarity of endothelial progenitors in post-natal human mononuclear cells  137  Chapter 7 Figure 34 Hypothetical model for the possible effects induced by VEGFR-2 activation in hematopoietic cells 148  xii  List of Abbreviations 5-fluorouracil 5-FU acetylated low density lipoprotein AcLDL aorta-gonad-mesonephros AGM acute myeloid leukemia AML burst forming unit erythroid BFU-E blast colony forming cell BL-CFC bone marrow BM bovine serum albumin BSA cluster of differentiation CD colony forming unit endothelial cell CFU-EC colony forming unit granulocyte CFU-G C F U - G E M M colony forming unit granulocyte, erythrocyte, macrophage, megakaryocyte colony forming unit granulocyte macrophage CFU-GM colony forming unit macrophage CFU-M colony forming unit spleen CFU-S chronic myeloid leukemia CML diacylglycerol DAG Dulbecco's modified Eagle's medium DMEM deoxyribonucleic acid DNA endothelial nitric oxide synthase eNOS endothelial progenitor cell EPC extracellular-regulated kinase Erk embryonic stem ES endothelial specific transcription factor Ets-1 fluorescence activated cell sorting FACS fetal bovine serum FBS basic fibroblast growth factor bFGF fibroblast growth factor receptor FGFR FK506 binding protein FKBP glyceraldehydes-3-phosphate-dehydrogenase GAPDH granulocyte colony stimulating factor G-CSF green fluorescent protein GFP granulocyte-macrophage colony stimulating factor GM-CSF granulocyte-macrophage colony stimulating factor receptor GM-CSFR Grey Gy hemagglutinin HA human foreskin fibroblast HFF hypoxia inducible factor HIF human microvascular endothelial cell HMEC hematopoietic stem cell HSC heat shock protein HSP human umbilical vein endothelial cell HUVEC inhibitor of apoptosis LAP immunoglobulin Ig  xiii  IL IMDM IRES INK kDa KDR Lin" MAPK MBP M-CSF MIG MMP MSCV MTT NO PAS PBS PCR PDGF PDZ PI3-kinase PK PLC P1GF RAFTK RNA RT-PCR SAPK SCF SCL SDS-PAGE SP TGF-/3 TNF-a Tpo UTR VE-cadherin VEGF VEGFR vHL VPF vWF  interleukin Iscove's modified Dulbecco's medium internal ribosomal entry site c-Jun NH-2-terminal kinase kiloDalton kinase domain region lineage negative mitogen activated protein kinase myelin basic protein macrophage colony stimulating factor mscv ires gfp matrix metalloproteinase murine stem cell virus 3-(4',5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide nitric oxide para-aortic-splanchnopleura phosphate buffered saline polymerase chain reaction platelet-derived growth factor PSD- 95/Dlg/ZO-l phosphatidylinositol-3 kinase protein kinase phospholipase C placenta growth factor related adhesion-focal tyrosine kinase ribonucleic acid reverse transcriptase polymerase chain reaction stress-activated protein kinase stem cell factor stem cell leukemia sodium dodecyl sulphate polyacrylamide gel electrophoresis side population transforming growth factor j8 tumour necrosis factor-a thrombopoietin untranslated region vascular-endothelial cadherin vascular endothelial growth factor vascular endothelial growth factor receptor von Hippel-Lindau vascular permeability factor von Willebrand factor  xiv  Acknowledgements  First, I would like to thank my supervisor, Dr. Aly Karsan, for giving me the opportunity to work on these projects, and for his many years of patient guidance and support with which I have come this far from knowing very little about the subjects discussed in this thesis. I would also like to thank all members of the Karsan lab, past and present, for providing a work environment that was fun and stimulating to work in. I would especially like to thank Ingrid Pollet for all the help she gave me over the years: your dedication, sense of organization and positive attitude were always greatly appreciated. I also thank Siun Murphy for drawing one of the figures presented in this thesis. Many thanks to my supervisory committee members, Drs. Peggy Olive, Keith Humphries and Vince Duronio for many invaluable discussions. I also want to thank members of the department of Medical Biophysics, from which I received many insights and useful technical tips. Special thanks to Denise McDougal and Fred Wong for taking care of the FACS analysis and cell sorting. I finally want to acknowledge the contribution of Dr. Fabio Rossi, Mike Long and Stephane Corbel who performed some of the transplants described in Chapter 6. I would like to thank my family: Gilles, Anne, Jean-Francois, even though you are far away, your support has meant a lot to me. I also want to express my gratitude to my aunt Madeleine and my cousin Matthew for their constant encouragement and for always being there for me, in good times and bad times. Finally, I am thankful to the Heart and Stroke foundation of Canada for the funding it provided me during my doctoral studies.  XV  Chapter 1  Introduction  1.1 Embryonic origins of hematopoiesis and vasculogenesis 1.1.1 Yolk sac hematopoiesis and vasculogenesis The development of a functional circulatory system is an early prerequisite for the survival and growth of the mammalian embryo. The first differentiated cells to form in the mammalian embryo are those of the hematopoietic and endothelial lineages, which, along with cardiac components, are the backbone of the developing circulatory system (Ema and Rossant, 2003). Cells from the hematopoietic and endothelial lineages are mesodermal in origin and are first generated in yolk sac blood islands beginning at embryonic day 7 (E7.0) in the mouse (Haar and Ackerman, 1971) and between the second and third week of human gestation. Thereafter, hematopoiesis shifts to the fetal liver and again, around the time of birth, to the bone marrow (Moore and Metcalf, 1970). The generation of blood cells in blood islands of the yolk sac is referred as primitive hematopoiesis and results primarily in the production of large, nucleated erythroblasts (Wong et al., 1986), as well as some megakaryocytes (Xu et al., 2001) and primitive macrophages (Shepard and Zon, 2000), as opposed to definitive hematopoiesis, which can generate mature cells of all the blood lineages. Blood islands, which consist of a central focus of hematopoietic cells surrounded by a layer of endothelial cells, arise in the mouse from proximal mesodermal cells in the visceral yolk sac between E7.0 and E7.5 (Shepard and Zon, 2000).  2  Figure 1 Hematopoietic sites in the developing mouse embryo. Schematic representation of whole mouse embryos at (a) E8.5/9 and (b) E10.5/11. Abbreviations: A G M , aortagonad-mesonephros. Adapted from Dzierzak et al. (Dzierzak et al., 1998).  Between E8.0 and E9.0, the cells comprising the outer layer ofthe blood island cell aggregates assume a spindle shape as they differentiate into endothelial cells (Shepard and Zon, 2000). The vast majority of the inner cells of the blood islands progressively lose their intercellular attachments as they differentiate into primitive erythroblasts. The simultaneous spatial and temporal appearance of hematopoietic and endothelial cells in the yolk sac blood islands has led to the concept of the hemangioblast, a common precursor for the hematopoietic and endothelial lineages (Ema and Rossant, 2003). Moreover, many known markers of endothelial cells are also expressed on hematopoietic cells (Fina et al., 1990; Kallianpur et al., 1994; Matthews et al., 1991). Recent studies with cells from chick embryos and with embryonic stem cells have led credence to this concept (Eichmann et al., 1997). While histological studies indicate a restricted hematopoietic potential within the yolk sac, precursor analysis in vitro and transplantation studies in vivo have provided clear evidence that this tissue is able to generate multiple definitive lineages as well (Yoder and Hiatt, 1997). Macrophage precursors were detected in low numbers as early  3  as those of the primitive erythroid lineage (Takahashi and Naito, 1993). Definitive erythroid precursors were found at E8.25 and also showed a dramatic increase followed by a general decline of their numbers (Palis et al., 1999). Precursors of the mast cell lineage developed slightly later at E8.5 (Palis et al., 1999). Unlike primitive erythroblasts, definitive erythroid precursors and mast cell precursors do not mature in the yolk sac, suggesting that they are produced for export to other sites, presumably the fetal liver (Palis et a l , 1999). These findings suggest a dual role for the yolk sac: the generation of a functional primitive erythroid lineage as well as the production of a cohort of definitive precursors which migrate to the fetal liver and establish the initial stage of definitive hematopoiesis in this tissue (Galloway and Zon, 2003). Yolk sac hematopoiesis is transient and shows a dramatic decline in activity between E l l and E12. This decline coincides with the onset of activity in the developing liver, which becomes the predominant hematopoietic tissue throughout the remainder of fetal life. In contrast to the restricted program observed in the yolk sac, the fetal liver is a site of multilineage definitive hematopoiesis which includes erythropoiesis, myelopoiesis and lymphopoiesis (Galloway and Zon, 2003). 1.1.2 The formation and maturation of definitive hematopoietic cells Shortly before the onset of organogenesis the embryo starts to generate a transitory population of embryonic hematopoietic cells that serve its immediate needs. These first hematopoietic cells, consisting mainly of primitive erythroid cells, appear in the embryonic circulation in growing numbers and then colonize the initially inactive fetal liver (Medvinsky and Dzierzak, 1996). Definitive hematopoiesis, which results in the production of all hematopoietic lineages, develops slightly later and gradually forms a  4  massive pool in the fetal liver, which becomes the main source of hematopoietic stem cells which  subsequently  colonize  the  bone  marrow (Dzierzak  et  al., 1998).  Hematopoietic stem cells are defined within the context of stringent transplantation assays used for adult bone marrow cells and are characterized by the following properties: 1) they clonally give rise to all differentiated lineages of the blood cells; 2) they are self-renewing; 3) they possess high proliferative/expansion potential contributing to high level hematopoietic repopulation of the recipient; and 4) they are active long term/over the lifespan of the individual (Wognum et al., 2003). Definitive hematopoietic stem cells are produced both in the mature yolk sac and within the para-aortic splanchnopleura (PAS, E8.5-E9.5) and the aorta-gonad-mesonephros region ( A G M , E10.5-E11.5) (Galloway and Zon, 2003). When A G M , yolk sac and fetal liver cells are directly compared throughout development for repopulation capabilities by the criteria previously mentioned, the A G M region consistently demonstrates more hematopoietic stem cells than the yolk sac or fetal liver at E10 and E l l (Muller et al., 1994). The definitive hematopoietic stem cells formed in the yolk sac and the A G M region do not mature  in situ but instead are believed to migrate and seed the fetal liver, where they  undergo terminal differentiation (Palis and Yoder, 2001). Thus, within the yolk sac, there is a temporal, if not spatial, overlap between primitive and definitive hematopoiesis. Although it was previously believed that the definitive hematopoietic stem cells formed in the yolk sac contribute only to primitive hematopoiesis (Muller et al., 1994), it was later shown that yolk sac cells isolated around day 9 and later can engraft and repopulate recipient animals following transplantation into the livers of newborn mice (Yoder and Hiatt, 1997; Yoder et al., 1997a; Yoder et al., 1997b). Furthermore, yolk sac  5  hematopoietic cells have the ability to repopulate adult bone marrow following coculture on certain types of stromal cells (Matsuoka et al., 2001) or when HoxB4 is ectopically expressed (Kyba et al., 2002). Yolk sac and A G M definitive hematopoietic stem cells appear to circulate (Kumaravelu et al., 2002) and can presumably seed intraembryonic tissues such as the liver and large arteries. 1.1.3 The hemangioblast: a common progenitor of hematopoiesis and vasculogenesis The close spatial and temporal appearance of hematopoietic and endothelial cells in the embryo has led to the hypothesis that a common precursor exists for both of these lineages. The term hemangioblast was first introduced to describe discrete cell masses that develop in chick embryo cultures and displayed both hematopoietic and endothelial potential (Haar and Ackerman, 1971). Since originally introduced, the concept of the hemangioblast has gained support from studies demonstrating that the hematopoietic and endothelial lineages share expression of a number of different genes such as MB1/QH1 in the quail (Pardanaud et al., 1987; Peault et al., 1983), CD31, CD34, SCL/Tal-1 and VEGFR-2 (Kabrun et al., 1997; Kallianpur et al., 1994; Watt et al., 1995; Young et al., 1995). Gene targeting studies in the mouse have provided further evidence for this bipotential precursor in showing that some of these genes are essential for the development of both lineages (Robb et al., 1995; Shalaby et al., 1995; Shivdasani et al., 1995). Furthermore,  overexpression  of  SCL/Tal-1  in  zebrafish  embryos  results  in  overproduction of common hematopoietic and endothelial precursors, perturbation of vasculogenesis and concomitant loss of pronephric duct and somitic tissue (Gering et al., 1998). Analysis of knock-in embryos in which SCL/Tal-1 is expressed under the control of the VEGFR-2 locus suggests that VEGFR-2 and SCL/Tal-1 act in combination to  6  regulate cell fate decisions for formation of endothelial and hematopoietic cells in early development  (Ema et al., 2003). Additional  support for the  existence of the  hemangioblast comes from analysis of a specific mutation in zebrafish known as cloche, which affects the development of hematopoietic cells and endocardium (Stainier et al., 1995). The most compelling and direct evidence for the presence of the hemangioblast comes from recent studies utilizing the in vitro ES cell system (Choi et al., 1998). Embryoid bodies differentiated for 2.5-3.5 days contain a unique cell population, the blast colony-forming cell (BL-CFC). BL-CFCs form blast colonies in the presence of vascular endothelial growth factor (VEGF) in methylcellulose cultures (Choi et al., 1998). Gene expression analysis indicates that cells within blast colonies express a number of genes common to both hematopoietic and endothelial lineages, including SCL, CD34, and the V E G F receptor-2 (VEGFR-2) (Kennedy et al., 1997a). Most importantly, BL-CFCs give rise to primitive, definitive hematopoietic and endothelial cells when replated in medium with both hematopoietic and endothelial cell growth factors (Choi et al., 1998; Kennedy et al., 1997a). Moreover, in the quail embryo, V E G F R - 2  +  cells  isolated from the mesoderm can give rise to cells of the hematopoietic or endothelial lineages depending on the culture conditions (Eichmann et al., 1997). Blast colonies have recently been shown to give rise to a third lineage, the smooth muscle cell (Ema et al., 2003). These characteristics of the B L - C F C suggest that it represents the in vitro equivalent of the hemangioblast and, as such, one of the earliest stages of hematovascular development described to date.  BL-CFCs have been detected in small numbers in dissected mouse embryos (Baron, 2003), suggesting  that hemangioblasts  may form during normal mouse  development. The technical difficulties encountered in identifying cells with the properties of the hemangioblast in mouse embryos suggests that these cells are produced in very small numbers and for a very short time, indicating that these cells might be short-lived, differentiating soon after their formation.  1.2 Hematopoiesis and Vasculogenesis in the adult 1.2.1. The hematopoietic stem cell The scale of the hematopoietic system is quite remarkable, considering that daily some 2 x 10  11  erythrocytes and 5 x 10  10  granulocytes, in addition to platelets,  lymphocytes, and monocytes enter the circulation (Finch et al., 1977). Despite the magnitude of this production system, dysregulation is uncommon and external influences can rapidly induce changes in the blood cell count of a specific lineage. For example, hypoxia can induce an increase in erythrocyte production, but does not affect the neutrophil count, whereas the opposite is true in an acute bacterial infection. The regulation of hematopoiesis must be exquisitely fine to be able to maintain blood cells counts within a relatively narrow range. This prodigious output of mature cells is ultimately dependent on the precise regulation of primitive hematopoietic stem cells, which, in turn, give rise to an ordered series of transit populations of progenitor and precursor cells of progressively more restricted proliferative and differentiative potentiality. B y definition, a hematopoietic stem cell is a cell isolated from the blood or bone marrow that can renew itself, can differentiate to a variety of specialized cells, can  8  mobilize out of the bone marrow into circulating blood and can undergo apoptosis (Krause, 2002). Definitive proof of the existence of a hematopoietic stem cell requires the demonstration of its ability to produce a long-lasting multilineage clone in vivo. Identifying and characterizing the properties of hematopoietic stem cells has been a formidable task, since it is estimated that about 1 in every 10,000 to 15,000 bone marrow cells is thought to be a stem cell (Coulombel, 2004). In the bloodstream, the proportion falls to 1 in 100,000 blood cells (Coulombel, 2004). Despite the immense burden of producing over 1 0  n  cells per day in the human  adult, the great majority of stem cells are not dividing at any one time (Lajtha et al., 1971). The current picture of the stem cell pool is that of a small, but potent group of cells, able to maintain tremendous hematopoietic cell supplies through the division of a small fraction of its members, keeping the remainder of the stem cells in reserve. There appear to be two kinds of hematopoietic stem cells. If bone marrow cells from a transplanted mouse can, in turn, be transplanted to another lethally irradiated mouse and restore its hematopoietic system over some months, they are considered to be long-term stem cells that are capable of self-renewal (Coulombel, 2004). Other cells from bone marrow can immediately regenerate all the different types of blood cells, but under normal circumstances cannot renew themselves over the long term, and these are referred to as short-term progenitor or precursor cells (Coulombel, 2004). Progenitor or precursor cells are relatively immature cells that are precursors to a fully differentiated cell of the same tissue type. They are capable of proliferating, but they have a limited capacity to differentiate into more than one cell type, as hematopoietic stem cells do (Messner, 1998).  9  The  primitive hematopoietic stem cells and their immediate progeny are  morphologically indistinguishable (Messner, 1998). Despite continued refinement of multiparameter cell separation strategies, unique phenotypic markers that are able to unmistakably characterize, resolve, and purify hematopoietic stem cells have not been identified. However, several makers have been used in combination in order to separate hematopoietic stem cells. Some of the markers most frequently used to separate human and murine hematopoietic stem cells are listed in Table 1 (Wognum et al., 2003).  Table I Commonly used markers for the purification of hematopoietic stem cells in human and mouse. Lin: Lineage markers (CD1 lb, B220, Gr-1, TER119) Human  Mouse CD34  CD34  +  +  CD59  +  + / l o w  Thyl  l o w /  Sca-1 Thyl  CD38 c-kit  '  +  low/  c-kit -  +  "  / l o w  Lin"  Lin" FGFR  CD38  +  +  CD 133  CD201  VEGFR-1  VEGFR-1  VEGFR-2  Fluorescent dye staining approaches have also been used to define hematopoietic stem cells based on efflux capacity and staining profile. The combination of both Rhodamine 123 and Hoechst 33342 staining has demonstrated that Hoechst  low  -  10  Rhodamine  low  cells are highly enriched for hematopoietic stem cell activity (Goodell et  al., 1996). A dual-wavelength flow cytometric analysis of bone marrow based on differential Hoechst 33342 staining that identifies a "side population" (SP) which gives rise to all mature blood lineages in transplanted mice has attracted much interest in the field of hematopoietic stem cells (Goodell et al., 1996). To detect hematopoietic stem cell functional activity, in vivo transplantation is generally considered to be the most appropriate assay because the ability of cells to reconstitute blood cell production in a myeloablated recipient measures the capacity of stem cells for both extensive proliferation and multilineage differentiation over extended time periods (Coulombel, 2004). 1.2.2 Hematopoietic hierarchy The bone marrow contains a bewildering array of dividing and intermediate or immature cell types. These immature types can be recognized by morphology, antibodies to specific surface markers or stains. In this way, it is possible to arrange the immature cells into lineages and construct a path by which an immature cell becomes fully mature.  li  Common Lymphoid Progenitor  T Lymphocyte  Figure 2 Schematic representation of the hematopoietic hierarchy: all the final mature blood cells (extreme right) are derived from a multipotential hematopoietic stem cell (extreme left). Self-renewal potential decreases from left to right co-ordinately with increasing differentiation; therefore, cells on the left are more primitive than those on the right.  Successive divisions of the hematopoietic stem cell generate a series of lineage-limited divisions, and differentiation generates the end cells. The mature bone marrow cells within each cell lineage are believed to derive from a small pool of undifferentiated cells (progenitors), whose destiny is to divide and differentiate along a single hematopoietic pathway, resulting in the unique production of mature, differentiated cells (Messner, 1998).  When  hematopoietic  progenitors  are placed  into  in vitro cultures  in  methylcellulose in the presence of optimal combinations of hematopoietic growth factors, each progenitor cell repeatedly divides and differentiates, giving rise to colonies of one or  12  more hematopoietic lineages. Progenitor cells constitute approximatively 0.1% of total bone marrow mononuclear cells (Messner, 1998). Progenitors for B and T cells appear to diverge early and follow separate modes and sites of differentiation: progeny of Bcommitted progenitors differentiate partly in the bone marrow, then migrate to the lymph nodes. T cell progenitors migrate to the thymus where independent proliferation, differentiation, and selection for immune function take place (Petrie, 2003). The common myeloid  progenitors  (CFU-GEMM)  are  unipotential  progenitors  committed  to  granulocytopoiesis, erythropoiesis and megakaryocytopoiesis. The granulocytic colonies which emerge in vitro are usually made up of both neutrophils and monocytes and originate from a single bipotential cell, named C F U - G M (Barreda et al., 2004). Progenitor cells committed to the erythroid cell line will also grow in vitro but will differentiate to haemoglobin-containing erythroblasts only if erythropoietin is present (Koury et al., 2002). 1.2.3 Regulation of hematopoiesis The regulation of lineage commitment and expansion is clearly physiologically critical, since this determines what sorts of blood cells are finally produced by the bone marrow. Hematopoietic stem cells either self-renew, thereby maintaining stem cell properties, or alternatively give rise to cells increasingly committed to differentiation into various hematopoietic lineages. It is unclear if this cell fate decision is controlled by a purely stochastic mechanism or is the result of environmental cues mediated at least in part through specific receptor-ligand interaction. It is likely that cell fate is influenced both by the stochastic nature of gene expression and by soluble factors and cell-cell interactions.  13  The processes of self-renewal and differentiation occur in vivo within bone marrow  microenvironments.  These  niches  are  populated  by  densely  packed  differentiating hematopoietic cells and by stromal endothelial cells, fibroblasts and adipocytes, as well as macrophages and lymphocytes (Sensebe et al., 1997). These stromal cells not only provide physical support and points of adhesion, but actually direct the processes of hematopoietic differentiation, by secreting positive hematopoietic growth factors such as colony stimulating factors, tyrosine kinase receptor ligands, or negative regulators such as transforming growth factor B (TGF-/3) (Ogawa, 1993; Sensebe et al., 1997). These cytokines can act independently or in combination to maintain or stimulate hematopoietic stem cell lineage commitment by binding to cell surface receptors. Some cytokines are known to have various biological functions on different types of progenitors, but how they elicit these functions and what signal transduction pathways they activate remains unclear. In addition to cytokines, lineage commitment and maturation of hematopoietic cells is driven by the action of a few lineage-specific transcription factors (Friedman, 2002). As cells differentiate, there is an orchestrated silencing of some genes and activation of others. Experimental data suggest that pluripotent stem/progenitor cells are primed to differentiate down several different lineages by low level transcription of many genes that are characteristic of multiple independent discrete lineages. Over the past years, gene targeting experiments have demonstrated the essential functions of individual transcription factors  in specifying  commitment  to  the  mature blood  lineages.  Transcription factors such as SCL/Tal-1, L M 0 2 and G A T A - 2 are required for the formation and maintenance of stem cells (Robb et al., 1996; Tsai et al., 1994; Yamada et  14  al., 1998). GATA-1 and PU.l serve as the dominant factors for erythroid/megakaryocytic and myeloid development, respectively (Nerlov and Graf, 1998; Rekhtman et al., 1999). Other transcription factors such as GATA-3, Dcaros (T-lymphoid cells) and Pax-5 (Blymphoid cells) are required for normal lymphopoiesis (Busslinger, 2004; Pai et al., 2003; Smith and Sigvardsson, 2004). Other proteins, such as the Notch receptors, play a central role in the fate decisions of multipotent precursor cells. The Notch pathway is an evolutionarily conserved mechanism that plays a fundamental role in regulating cell-fate decisions of various types of progenitors in both invertebrates and vertebrates (Harper et al., 2003). Notch  signalling  is  involved  in  multiple  developmental  processes,  including  neurogenesis, myogenesis, eye development, and oogenesis (Artavanis-Tsakonas et al., 1999). Hematopoietic cells and bone marrow stromal cells have been shown to express Notch receptors and their ligands, and Notch signalling affects the survival, proliferation and fate choices of progenitors at various stages of hematopoietic development (Ohishi et al., 2003), including whether hematopoietic  stem cells self-renew  or differentiate  (Varnum-Finney et al., 2000), whether common lymphoid precursors undergo T or B cell differentiation (Izon et al., 2002), and whether monocytes differentiate into macrophages or dendritic cells (Ohishi et al., 2001). These observations suggest that Notch signalling can play a fundamental role in regulating hematopoietic development. 1.2.4 The angioblast and evidence of vasculogenesis in the adult Until recently, neovascularization in the adult was thought to occur by angiogenesis only, which represents the sprouting of new blood vessels from pre-existing blood  vessels  (Tonini  et  al., 2003).  The other means  of  neovascularization,  15  vasculogenesis, which refers to the de novo formation of blood vessels from endothelial progenitors (angioblasts), was thought to occur only in the embryo (Figure-3).  A  Angiogenic factors (VEGF,  bFGF)  B  Figure 3 Current concepts for neovascularization in adult ischemic tissues. Angiogenesis (A) and vasculogenesis (B).  In recent years, several groups have shown that such endothelial progenitors can be isolated from adult sources such as peripheral blood, bone marrow and umbilical cord blood mononuclear cells (Asahara et a l , 1997; Nieda et a l , 1997; Peichev et a l , 2000; Shi et al., 1998). Likewise hematopoietic cells positive for the hematopoietic stem cell marker CD133 (previously named AC133) are capable of differentiating into endothelial cells in vitro (Gehling et al., 2000).  16  Under the current status, it is impossible to differentiate endothelial progenitors from hematopoietic cells or endothelial cells, since the markers used to isolate endothelial progenitors are also expressed on subsets of hematopoietic cells (CD 133, CD34) and endothelial cells (VEGFR-2, VE-cadherin) (Bhatia, 2001). In circulation, the endothelial progenitors are considered to be included in the cell population expressing CD 133 and VEGFR-2 markers within the subset of CD34 cells (Gill et al., 2001). When isolated and +  cultured in vitro, CD133 VEGFR-2 endothelial progenitors loose expression of CD133, +  +  but acquire features of mature endothelial cells, such as cobblestone morphology, uptake of acetylated low density lipoproteins (AcLDL) and expression of von Willebrand factor (Peichev et al., 2000). Mature endothelial cells derived in vitro from endothelial progenitors also display higher proliferative potential than endothelial cells such as H U V E C s (human umbilical vein endothelial cells) (Quirici et al., 2001). It has also been reported that VEGFR-3 and CD133 identify a population of lymphatic endothelial progenitors in fetal liver, bone marrow and peripheral blood (Salven et al., 2003). Table II displays some of the markers found to be expressed on endothelial progenitors, and how these markers overlap with markers found on endothelial cells and subsets of hematopoietic cells.  17  Table II Common markers expressed on human endothelial progenitors, mature endothelial cells and subsets of hematopoietic cells.  Surface antigen CD133 CD117(cKit) CD34 VEGFR-1 VEGFR-2 VEGFR-3  Tie-1 Tie-2 VE-cadherin CD31 (PECAM) A c L D L uptake  Hematopoietic cells  Endothelial progenitors  Mature endothelial cells  Subset (primitive hematopoietic stem cells) Subset (Hematopoietic stem/progenitor cells) Subset (Hematopoietic stem/progenitor cells) Subset Subset  +  -  +  +  +  +  ?  + +  ?  Lymphatic endothelial progenitors  + (lymphatic endothelial cells)  ?  ?  Subset  -  -  + + +  + + + + +  +  + Subset (mainly monocytes/macrophages)  -  -  E-selectin  + (activated endothelium)  Some groups have demonstrated in a mouse model that the recruitment of bone marrow-derived endothelial precursors plays an essential role in tumour vascularization and tumour growth (Lyden et al., 2001). These bone marrow-derived endothelial cells are thought to have the capacity to form new vessels in cancer and ischemic tissues. The relative contribution of bone marrow-derived endothelial cells to tumour vasculature remains unclear however. Studies report a relative contribution of bone marrow-derived endothelial progenitors to neovessel formation ranging from 5 to 25% in response to granulation  tissue  formation  (Crosby et  al.,  2000)  or  growth  factor-induced  neovascularization (Murayama et al., 2002). In tumour neovascularization, the reported ranges are from 35-65% higher than the former events (Hilbe et al., 2004; Lyden et al.,  18  2001; Rafii et al., 2002). This issue remains controversial however, as recent studies report no significant contribution of bone marrow-derived cells to tumour vascularization (Gothert et al., 2004a; Machein et al., 2003; Rajantie et al., 2004).  1.3 Vascular Endothelial Growth factor (VEGF) The  formation and maintenance of the vascular system is a fundamental  requirement for organ development and differentiation during embryonic life and for processes such as wound healing and reproduction in the adult. Many types of cancer cells secrete angiogenic factors that attract endothelial cells to neovascularize solid tumours (Dvorak, 2002; Folkman, 1995). Angiogenesis is the formation of a new vascular network from preexisting vessels. Other than cancer, abnormal angiogenesis is implicated in diseases such as rheumatoid arthritis, diabetic retinopathy and psoriasis (Folkman, 1995). In contrast, in ischemic diseases such as angina and peripheral vascular disease, the relative lack of neovasculature may worsen symptoms. Inhibition or promotion of angiogenesis may therefore offer a new approach for the treatment of many diseases. Many secreted molecules have been shown to promote angiogenesis, including transforming growth factors (TGF) a and p\ tumour necrosis factor a  (TNF-a),  angiogenin, interleukin 8 (Folkman and Shing, 1992; Risau, 1997), angiopoietins (Maisonpierre et al., 1997; Suri et al., 1996), members of the fibroblast growth factor family (FGF) (Mergia et al., 1989) and vascular endothelial growth factor (VEGF) (Neufeld et al., 1999). These factors can induce a diverse array of signals and initiate downstream intracellular pathways that affect the survival, proliferation, transcription,  19  adherence, permeability and migration of endothelial cells. Some of these signals can be elicited through transmembrane tyrosine kinase receptors that are expressed at high levels in endothelial cells, including VEGFR-1 (flt-1), VEGFR-2 (KDR/flk-1), VEGFR-3 (flt4), Tie-1 and Tie-2/Tek (Mustonen and Alitalo, 1995; Terman et al., 1992). V E G F was first purified in 1989 by Ferrara and Henzel (Ferrara and Henzel, 1989). Cloning and expression of V E G F revealed that it was the same molecule as vascular permeability factor (VPF) (Keck et al., 1989), a protein first described in 1983 (Senger et al., 1983) which was able to promote extravasation of proteins from tumourassociated blood vessels. It was later reported that the V E G F gene could produce several isoforms by alternative splicing to form active disulfide-linked homodimers (Poltorak et al., 1997; Robinson and Stringer, 2001; Tischer et al., 1989; Tischer et al., 1991). Studies have shown that the loss of a single V E G F allele results in embryonic lethality, pointing to the indispensable role of this protein in development and maintenance of the whole organism (Carmeliet and Collen, 1999; Carmeliet et al., 1996; Ferrara et al., 1996; Patterson et a l , 1996). Over the past few years, several members of the V E G F gene family have been identified, including placenta growth factor (P1GF) (Maglione et al., 1991), V E G F - B (Olofsson et al., 1996a; Olofsson et al., 1996b), V E G F - C (Joukov et al., 1996), V E G F - D (Achen et al., 1998) and V E G F - E , a viral protein that binds specifically to VEGFR-2 (Meyer et a l , 1999; Ogawa et al., 1998; Wise et al., 1999). 1.3.1 Biological activities of V E G F V E G F is a secreted mitogen whose target cell specificity is mainly restricted to endothelial cells (Partanen et al., 1999). V E G F was first purified from conditioned  20  medium of several cell lines as a glycosylated homodimer of 46 to 48 kDa (Ferrara and Henzel, 1989; Leung et al., 1997). Differentially spliced mRNA transcripts encode five V E G F transcripts coding for polypeptides of 121, 145, 165, 189 and 206 amino acids (Houck et al., 1991; Poltorak et al., 1997; Tischer et al., 1989). V E G F ,  is the  6 5  predominant V E G F isoform produced by a variety of normal and transformed cells, whereas  VEGF121,  VEGF145,  VEGFigg and V E G F 2 0 6 are rarer forms encountered in some  of the tissues expressing the V E G F gene (Houck et al., 1991; Poltorak et al., 1997). VEGF165  is a basic, homodimeric glycoprotein of 45 kDa which has affinity for heparan  sulfates, and is partially sequestered in the pericellular matrix. In contrast,  VEGF121  is a  weakly acidic polypeptide which lacks the heparin binding domain, and is secreted as a freely diffusible protein (Houck et al., 1992). VEGFigg and V E G F 2 0 6 are more basic, and bind heparan sulfates with greater affinity than V E G F 1 6 5 (Houck et al., 1992). These two molecules are almost completely sequestered in the extracellular matrix, but can be released as soluble forms by heparinase or by plasmin, which generate a bioactive proteolytic fragment (Park et al., 1993). This suggests that V E G F may become available to endothelial cells in two ways: as freely diffusible proteins  (VEGF121  and V E G F 1 6 5 ) or  following protease activation and cleavage of the two longer isoforms ( V E G F 9 and ]8  V E G F o 6 ) - Thus, plasminogen activation and generation of plasmin could play an 2  important role in angiogenesis. Although V E G F is a mitogen for vascular endothelial cells, it lacks significant mitogenic activity for most other cell types, because the expression of V E G F receptors is mainly restricted to endothelial cells (Barleon et al., 1994; Plouet and Bayard, 1994). Moreover, it can act as a survival factor for endothelial cells cultured in serum-deprived  21  conditions (Karsan et al., 1997). The mechanisms of the V E G F cytoprotective effect have not been well-studied but may involve the PI3-kinase pathway and upregulation of members of the Bcl-2 and LAP (Inhibitor of Apoptosis) family of anti-apoptotic proteins (Tran et al., 1999). V E G F also promotes expression of intercellular adhesion molecule 1 and vascular cell adhesion molecule 1 in endothelial cells, which can result in the adhesion of activated leukocytes to endothelial cells (Melder etal., 1996a; Melder et al., 1996b). In hematopoiesis, V E G F can inhibit the maturation of antigen-presenting cells, such as dendritic cells, thereby inhibiting the ability of the immune system to recognize and target tumour cells (Gabrilovich et al., 1998; Kusmartsev and Gabrilovich, 2002; Takahashi et al., 2004). In vivo, V E G F is known for its ability to induce vascular leakage, thus causing the exudation of plasma proteins (Bates et al., 1999). This leakage results in the laying down of a provisional matrix of fibrin and fibronectin allowing endothelial migration (Dvorak et al., 1995). V E G F possesses a potent ability to increase microvessel permeability to a 50,000-fold higher level than histamine (Dvorak et al., 1995). 1.3.2 Regulation of V E G F expression V E G F is a key regulator of angiogenesis, and its expression is regulated by many external factors. Many cytokines, which do not promote angiogenesis, can modulate angiogenesis indirectly by regulating V E G F expression in specific cell types. Molecules that can increase V E G F expression include epidermal growth factor (EGF), insulin-like growth factor 1, fibroblast factor 4 (FGF-4) (Deroanne et al., 1997), TGFp (Pertovaara et al., 1994), T N F a (Ryuto et al., 1996), PDGF (Finkenzeller et al., 1997) and IL-6 (Cohen et al., 1996). On the other hand, cytokines such as IL-10 and IL-13 can inhibit V E G F  22  expression (Matsumoto et al., 1997). In addition, hydrogen peroxide, which is produced by neutrophils that invade a wound in the healing process, or U V - B radiation also potentiate V E G F production by keratinocytes (Bielenberg et al., 1998; Brauchle et al., 1996; Mildner et al., 1999). Nitric oxide can also increase V E G F production, which, in turn upregulates the production of nitric oxide in a positive feedback loop (Frank et al., 1999; Kroll and Waltenberger, 1999; Shen et al., 1999). Hypoxia is also a major stimulator of V E G F expression. Since cells in a solid tumour are often hypoxic, this could account, at least in part, for the increased V E G F expression in many types of cancer cells (Richard et al., 1999). The transcription ofthe V E G F gene, under hypoxic conditions is mediated by the binding of hypoxia-inducible factor 1 (HIF-1) to a hypoxic responsive element localized in the V E G F promoter (Levy et al., 1995; Liu et al., 1995; Semenza et al., 1999). Hypoxia also stabilizes the V E G F transcript by inducing proteins that bind and stabilize the 3' untranslated region (UTR) of V E G F mRNA (Stein et al., 1998; Stein et al., 1995). Specific transforming events can also result in induction of V E G F gene expression. For example, oncogenic mutations or amplification of ras lead to V E G F mRNA stabilization (Okada et al., 1998). The von Hippel-Lindau (vHL) tumour suppressor gene has also been implicated in up-regulation of V E G F (Brieger et al., 1999; Siemeister et al., 1996). Wild type v H L inhibits the production of several hypoxiaregulated proteins such as V E G F at the post-transcriptional level. vHL is known to inhibit the activity of protein kinase C zeta and delta (Pal et al., 1997). In the absence of wildtype vHL, these kinases remain active and V E G F mRNA is stabilized as a result of  23  constititutive interactions of various proteins that are normally induced by hypoxia with the 3'UTR (Pal etal., 1997). Finally, loss of the wild-type tumour suppressor p53 also correlates with upregulation of V E G F expression, and with increased angiogenesis in developing tumours (Kieser et al., 1994; Saito et al., 1999). 1.3.3 V E G F receptors The V E G F family members are ligands for a set of mammalian tyrosine kinase receptors (VEGF receptors, VEGFRs) (Figure 4). Three V E G F tyrosine kinase receptors have been identified and cloned: VEGFR-1 also known as fit-1 (fins-like tyrosine kinase) (de Vries et a l , 1992), VEGFR-2 (KDR/flk-1) (Terman et al., 1992) and VEGFR-3 (flt-4) (Neufeld et a l , 1994).  VEGFR-1  VEGFR-2  VEGFR-3  (flt-1)  (KDR/flk-1)  (flt-4)  Neuropilin-1  Neuropilin-2  Figure 4 Receptors of the V E G F family. These receptors include three tyrosine kinase receptors: VEGFR-1 (flt-1), VEGFR-2 (KDR/flk-1) and VEGFR-3 (flt-4). Other receptors for V E G F also include neuropilin-1, which binds VEGFRs and P1GF-2, and neuropilin-2, which binds VEGFRs- Ligand binding causes dimerization and transphosphorylation of V E G F receptors.  24  These receptors form a subfamily distinguished by the presence of immunoglobulin-like loops in their extracellular portion, a single transmembrane region and a split tyrosinekinase domain in the intracellular region. The presence of the split kinase domain places these receptors in the subfamily of class III receptor tyrosine kinases, which includes cFms, c-Kit and the a and p chains of the PDGF receptor (Shibuya et al., 1999). V E G F binds and activates both VEGFR-1 (de Vries et al., 1992) and VEGFR-2 (Kendall et al., 1999), whereas P1GF (Athanassiades and Lala, 1998; Shore et al., 1997) and V E G F - B (Olofsson et al., 1998) bind only VEGFR-1. V E G F - C (Joukov et al., 1996; Kukk et al., 1996) and V E G F - D (Achen et al., 1998) bind VEGFR-2 in addition to VEGFR-3 (Figure 4). VEGFR-1 has a higher binding affinity for V E G F (Kd of 10-20 pM) than VEGFR-2 (Kd of 75-125 pM) (de Vries et al., 1992; Terman et al., 1992). VEGFR-3 binds V E G F - C and V E G F - D (Achen et al., 1998; Ristimaki et al., 1998). VEGFR-1 and VEGFR-2 are expressed mainly on endothelial cells, although other cell types have also been shown to express these receptors. VEGFR-1 has been shown to be expressed in monocytes (Barleon et al., 1996), megakaryocytes (Casella et al., 2003) and hematopoietic stem cells (Hattori et al., 2002) whereas VEGFR-2 is also expressed in hematopoietic stem cells (Ziegler et al., 1999) and megakaryocytes (Katoh et al., 1995). In addition, some tumour cells, such as melanoma cells, leukemic blasts, lymphoma cells and multiple myeloma cells, express VEGFR-1 or VEGFR-2 (Bellamy et al., 1999; Gitay-Goren et al., 1993; Graeven et al., 1999; Herold-Mende et al., 1999; Padro et al., 2002; Ria et al., 2003; Zhang et a l , 2004). VEGFR-3, which is expressed mainly in lymphatic endothelium, has been shown to be involved in the regulation of lymphatic angiogenesis (Jussila et al., 1998). However, recent evidence indicates that  25  VEGFR-3 is required for vasculogenesis in mouse embryos, thus indicating that this receptor plays an essential role in the development of the cardiovascular system (Dumont etal., 1998). To provide evidence of the proposed role of VEGFR-1 and VEGFR-2 in vascular development, the genes encoding VEGFR-1 and VEGFR-2 have been disrupted in mice. Because VEGFR-2 is expressed in the primitive blood islands, it has been proposed that this receptor may play an essential role during the initial stages of vasculogenesis, when both endothelial and blood progenitor cells are presumed to differentiate from a common precursor, the hemangioblast (Hatva et al., 1996). Embryos lacking wild-type VEGFR-2 died in utero by day 9. Morphological analysis revealed an absence of blood islands and hemopoietic progenitor cells. These embryos were also characterized by the absence of mature endothelial cells (Shalaby et al., 1997; Shalaby et al., 1995). Hence, VEGFR-2 is required for the formation, migration and/or proliferation of endothelial and hemopoietic cells during vasculogenesis. In contrast to the critical role of VEGFR-2 in vasculogenesis, endothelial and hemopoietic cell differentiation was found to occur in embryos lacking the VEGFR-1 gene. However, the organization of vascular structures was grossly abnormal, and the mutant embryos also died in utero by day 9. Instead of fusing into typical blood vessels, the endothelia in VEGFR-1 mutants formed abnormal vascular channels, characterized by large lumens containing trapped endothelial cells mixed with blood cells. Moreover, an excessive number of endothelial cells accumulated in the VEGFR-1 knockout embryos (Fong et al., 1996; Fong et al., 1995; Fong et a l , 1999). These studies suggest that VEGFR-1 is necessary to repress excessive endothelial cell proliferation.  26  As with V E G F , the expression of VEGFR-1 and VEGFR-2 is reported to be affected by hypoxia, although to a lesser extent than V E G F (Gerber et al., 1997; Tuder et al.,  1995). VEGFR-1 transcription is upregulated by hypoxia (Suzuki et al., 1999)  whereas VEGFR-2 production is also up-regulated by hypoxia, but at the posttranscriptional level (Waltenberger et al., 1996). This hypoxia-induced upregulation of VEGFR-1 and VEGFR-2 may be indirectly triggered, since V E G F is known to potentiate the expression of these two receptors (Kremer et al., 1997;  Shen et al.,  1998;  Tsopanoglou and Maragoudakis, 1999). Of the seven IgG-like domains of the extracellular portion of VEGFR-1 and VEGFR-2, only domains 2 and 3 are required for the tight binding of V E G F to these two receptors (Fuh et al., 1998). Several studies have mapped the binding site for V E G F to the second Ig-like domain of the receptors. V E G F also interacts with the neuronal cell-guidance receptors, neuropilin-1 and neuropilin-2 (Miao et al., 1999; Soker et al., 1998). These receptors were initially described to bind several types of semaphorins, which are factors that act as axonal repellents (Chedotal et al., 1998; Chen et al., 1998; He and Tessier-Lavigne, 1997). The neuropilins, which are known to be expressed in neurons, some cancer cell lines and endothelial cells, bind to V E G F i , but not VEGF121 (Neufeld et al., 1999; Soker et al., 6 5  1998). In addition to  VEGF165,  neuropilin-1 has also been found to bind the heparin  binding form of P1GF, P1GF-2 (Migdal et al., 1998). The neuropilins have only a short intracellular domain. It has recently been shown that the cytoplasmic domain of neuropilin-1 contains a central PSD- 95/Dlg/ZO-l (PDZ) domain, which may act as a protein interaction module (Jelen et al., 2003), and a C-terminal acyl carrier protein  27  domain (Cai and Reed, 1999), thus indicating that neuropilin-1 might be able to transduce a signal. However, no responses to  VEGF165  were observed when cells expressing  neuropilin-1 but no other V E G F receptors were stimulated with  VEGF165  (Soker et al.,  1998). It is not known whether V E G F binding is sufficient for signal transduction via a neuropilin-1-associated hypothetical signal-transducing polypeptide chain although the enhanced mitogenic signalling of VEGFR-2 in neuropilin-1 -overexpressing cells suggests such a possibility. Mouse embryos lacking a functional neuropilin-1 die in utero because their cardiovascular system fails to develop properly, indicating that this receptor is probably an important regulator of blood vessel development (Kawasaki et al., 1999; Kitsukawa et al., 1997). Furthermore, overexpression of neuropilin-1 under the p-actin promoter is lethal because of severe anomalies of the nervous and cardiovascular systems (Kitsukawa et al., 1995). The cardiovascular defects may result from modulation of V E G F bioactivity and VEGF-induced angiogenesis by abnormal neuropilin-1 levels. Therefore, it has been proposed that neuropilin-1 acts as a VEGF]65 co-receptor. This postulate is supported by studies showing that VEGFR-2 binds V E G F 165 more efficiently in cells expressing neuropilin-1, resulting in a better migratory response to  VEGF165  (Soker et al., 1998). However it does not seem that neuropilin-1 acts as a VEGFR-1 coreceptor, since P1GF-1 and P1GF-2, which both bind VEGFR-1, promote migration of endothelial cells equally well (Clauss et al., 1996). Neuropilin-2 also binds V E G F i , but 6 5  its expression pattern is different from that of neuropilin-1 or VEGFR-1, in that it is absent from endothelial cells of capillaries (Chen et al., 1997; Giger et al., 1998).  28  1.3.4 V E G F signal transduction Studies of receptor tyrosine kinases in a number of different systems have clearly shown that the pathways activated by these molecules can lead to drastic changes in cells, including their fate, survival, proliferation, migration and adhesion (van der Geer et al., 1994). Although VEGFR-1 and VEGFR-2 are both activated by the same ligand, their downstream signalling pathways cause different cellular responses.  V E G F  VEGFR  SMOOTH MUSCLE RELAXATION/ VASODILATION  PLCy  Grb2/Shc/S0S MKK3  RAFTK  IP3  p38  V Rac  Ca  I  DAG  \  I  eNOS  JNK  N  - > MEK  t  \  I  PKG  MAPK(ERK)  /  n GC  cGMP  I  RAS  PI3 Kinase  RAF  SAPK-2  \  ->  PKC  2  I •  I MAPKAPK-2  •  Jt  I  ACTIN REORGANIZATION  PKB/Akt  PROLIFERATION JNK<fc.  HSP27  CELL SURVIVAL/ PROLIFERATION  Ets-1^  TRANSCRIPTION  cJun-  Figure 5 Signalling pathways induced by V E G F activation of tyrosine kinase receptors in endothelial cells. See text for abbreviations. V E G F binding causes dimerization and phosphorylation of tyrosine kinase receptors and further activation of intracellular mediators.  29  VEGFR-2 activation is required for endothelial and hemopoietic cell fate determination and proliferation (Shalaby et al., 1997; Shalaby et al., 1995), whereas VEGFR-1 activation is more important for proper regulation of endothelial cell migration and adhesion and blood vessel organization (Fong et al., 1996; Fong et al., 1995; Fong et al., 1999). However, the information regarding the signalling cascades induced by VEGFR-1 and VEGFR-2 is still limited. The situation is further complicated by the ability of certain members of the V E G F family to form heterodimers: P1GF-VEGF (DiSalvo et al., 1995) and V E G F - V E G F - B (Olofsson et al., 1996b) for example. VEGFR-1 and VEGFR-2 may also form heterodimers (Bates et al., 1999), thus adding another level of complexity. V E G F stimulation of endothelial cells in culture results in the activation of V E G F receptors 1 and 2 and phosphorylation of a number of downstream proteins, including phospholipase  Cy (PLCy), PI3-kinase, the adaptor protein Nek, and the Ras G A P  complex (Guo et al., 1995; Seetharam et al., 1995) (Figure 5). VEGF-receptor binding triggers a signalling cascade that results in tyrosine phosphorylation and the formation of protein-protein complexes through SH2 domains (Guo et al., 1995). Activation of  PLCy  is accompanied by increases in inositol 1,4,5-trisphosphate (TP3) and diacylglycerol (DAG) production and increased PI3-kinase activity (Xia et al., 1996). However, other investigators do not report increased PI3-kinase activity following V E G F stimulation of endothelial cells (Abedi and Zachary, 1997). PI3-kinase is a heterodimer of an 85 kDa adaptor subunit (p85) and a 110 kDa catalytic subunit (pllO). It is activated by most growth factors and has been implicated as a critical factor in the control of cell proliferation and cell survival (Stephens et al., 1993). PI3-kinase phosphorylates the D-3 position of the inositol ring of phosphoinositides, which in turn act as second messengers.  30  The p85 subunit contains two SH2 domains, which bind to tyrosine-phosphorylated receptors after stimulation of cells with growth factors and in this manner recruits the pi 10 catalytic subunit into the complex at the cell membrane (Stephens et al., 1993). Production of IP3 by PLCy stimulates the release of calcium from intracellular stores (Berridge, 1993). This is consistent with studies showing that V E G F can increase cytosolic calcium (Bates and Curry, 1997; Brock et al., 1991). On the other hand, production of D A G is well known to activate protein kinase C (PKC). It has been postulated that activation of PKC is an important intracellular signalling pathway for cellular growth. Several reports have shown that P K C plays an important role in the VEGF-initiated angiogenesis process (Xia et al., 1996). Indeed, V E G F stimulation has been shown to increase the levels of P K C a and pTI in bovine aortic endothelial cells (Xia et al., 1996). Activation of PKC, through Raf, leads to phosphorylation of extracellularregulated kinase (ERK 1/2), a form of mitogen-activated protein kinase (MAPK) and its subsequent translocation to the nucleus (Mukhopadhyay et a l , 1998). Both VEGFR-1 and VEGFR-2 have been shown to activate the M A P kinase pathway (Sawano et al., 1997; Takahashi and Shibuya, 1997). The formation of a receptor Shc/Grb2/SOS complex is another pathway that can also activate ERK1/2 via the Ras/Raf cascade (Kroll and Waltenberger, 1997). PKC, through Ras, also causes the activation of PI3-kinase, which in turn can activate the protein kinase B (PKB/Akt) pathway. The activation of this downstream effector of PI3-kinase seems to be important in endothelial cell protection against serumstarvation induced apoptosis (Kennedy et al., 1997b). Activation of Akt occurs through  31  the direct binding of the phosphoinositide products of the PI3-kinase reaction to the pleckstrin homology domain of Akt. Phosphoinositol lipids also induce phosphorylation of Akt, resulting in further activation (Franke et al., 1997). In Ratla fibroblasts, activated Akt did not alter Bcl-2 or Bcl-X(L) expression but inhibited caspase activity. Thus, the PI3-kinase/Akt signalling pathway transduces a survival signal that ultimately blocks caspase activity (Kennedy et al., 1997b). It has been shown that VEGF-induced Akt activation and cytoprotection in endothelial cells was suppressed by wortmannin, a PI3kinase inhibitor, indicating that Akt acts downstream of PI3-kinase in the V E G F signalling pathway. In contrast, V E G F mitogenic functions are transduced through protein kinase C , which is not inhibited by wortmannin (Fujio and Walsh, 1999). Taken together, these data suggest that the cytoprotective and mitogenic signals of V E G F are transduced by independent pathways in endothelial cells. Through calcium release, V E G F can also stimulate the phosphorylation of the related adhesion-focal tyrosine kinase (RAFTK/Pyk2) and the focal adhesion kinase (FAX) (Abedi and Zachary, 1997; Mukhopadhyay et al., 1998). R A F T K can activate Rac,  which can activate the stress-activated protein kinase 2 (SAPK-2), leading to  phosphorylation of c-Jun through the activation of c-Jun NF^-terminal kinase (INK) (Mukhopadhyay et al., 1998). The endothelial specific transcription factor (Ets-1) can also be activated following INK phosphorylation (Iwasaka et al., 1996; Tanaka et al., 1998). This transcription factor is known to induce the expression of matrix-degrading proteins, such as gelatinase and collagenase, which enables growing vessels to migrate through the intersitium.  32  Calcium  appears  to  be  implicated  in  microvascular  permeability  and  vasodilatation by activating the endothelial specific nitric oxide synthase (eNOS). eNOS is a functionally important member of the nitric oxide synthase family which includes inducible nitric oxide synthase (iNOS) and the neuronal nitric oxide synthase (nNOS) (Nathan and Xie, 1994). N O is an important mediator of endothelial function that influences vascular tone, platelet aggregation, endothelial cell permeability and vascular cell proliferation (Kroll and Waltenberger, 1998). It has been shown that stimulation of endothelial cells with V E G F rapidly results in the upregulation of eNOS expression and NO release (Hood et al., 1998; Kroll and Waltenberger, 1998). Not only does nitric oxide induce vasodilatation, it can also activate guanylyl cyclase (GC) to cause the production of cyclic GMP (cGMP). cGMP can in turn activate protein kinase G (PKG), which has been shown to be an important regulator of microvascular permeability (Huang and Yuan, 1997; Vaandrager and de Jonge, 1996; Wu et al., 1996). P K G can also act as an activator of Raf, thus contributing to activation of the M A P K pathway (Hood and Granger, 1998). Some studies have also shown that V E G F can activate the p38 M A P kinase pathway (Rousseau et al., 1997). p38 is activated by phosphorylation on both threonine and tyrosine. Three p38 activators have been characterized: SEK1 (which is also an activator of JNK1) M K K 3 and M K K 6 , a p38-specific M A P kinase kinase (Lin et al., 1995). The known downstream targets of p38 are a seryl/threonyl kinase, M A P K activated protein kinase (MAPKAPK) 2, and the transcription factor ATF-2 (Gupta et al., 1995; Rouse et al., 1994). However, the molecular mechanisms connecting tyrosine kinase activation to p38 activation remain to be ascertained. It would seem though, that  33  the p38 pathway stimulation by V E G F is an important component of the signalling network which transduces the migratory signals generated by V E G F , suggesting that it may play an important role in regulating angiogenesis (Rousseau et al., 1997). M A P K A P K 2 activation by p38 could be responsible, at least in part, for the transduction of this migratory signal, since it has been shown to play a role in actin regulation through two of its known substrates, LSP-1 and HSP27, which are actin-binding proteins (Huang and Yuan, 1997; Miron et al., 1991). The level of expression of HSP27 is particularly high in endothelial cells. Thus, it could be a potential downstream effector of p38 in the regulation of VEGF-induced actin rearrangement and the resulting increased cell migration (Rousseau et al., 1997). Since endothelial cells express both VEGFR-1 and VEGFR-2, it is difficult to elucidate the specific responses of each receptor following V E G F stimulation. To counter this problem, cells which do not usually express either receptor have been transfected with either VEGFR-1 or VEGFR-2.  V E G F R - 1  V E G F stimulation results in weak tyrosine phosphorylation that does not generate a mitogenic signal in NIH 3T3 cells transfected with VEGFR-1 (Seetharam et al., 1995). This lack of a mitogenic response following of VEGFR-1 was associated with its inability to stimulate the M A P kinase pathway, even though PLCy and Ras GAP were phosphorylated (Seetharam et al., 1995). These findings agree with other studies showing that P1GF, which binds with high affinity to VEGFR-1 but not to VEGFR-2, lacks direct mitogenic or permeability-enhancing properties, or the ability to effectively stimulate  34  tyrosine phosphorylation in endothelial cells (Park et al., 1994). However, it has been shown that high concentrations of P1GF, sufficient to saturate the binding sites on VEGFR-1, are able to potentiate the effects of V E G F , in vivo and in vitro (Park et al., 1994). This, and the fact that VEGFR-1 knockout mouse embryos display an excessive number of endothelial cells has led to the suggestion that VEGFR-1 is not a signalling receptor, but a ligand binding molecule, able to regulate in a negative way the activity of V E G F on endothelial cells by sequestering this ligand and rendering it less available to VEGFR-2 (Park et al., 1994). To support this hypothesis, it has been demonstrated that a targeted mutation resulting in a VEGFR-1 mutant lacking a tyrosine kinase split domain of this receptor but able to bind V E G F does not result in impaired embryonic development and angiogenesis in mice, while deletion of the receptor results in embryonic lethality (Hiratsuka et al., 1998). Furthermore, endothelial cells isolated from these animals displayed normal mitogenicity in response to V E G F (Hiratsuka et al., 1998). Moreover, V E G F mutants that bind selectively to VEGFR-2 are fully active endothelial cell mitogens (Keyt et al., 1996).  However, other studies show that the  VEGFR-1 is indeed able to be phosphorylated by V E G F and can subsequently interact with many signal transducing proteins, such as PI3-kinase, and generate a mitogenic signal in some transfected cells (Cunningham et al., 1995; Waltenberger et al., 1994). At least some biological responses, such as the migration of monocytes in response to V E G F or P1GF have been shown to be mediated by the VEGFR-1 (Barleon et al., 1996). This macrophage migration induced by V E G F or P1GF was suppressed in mice which have a non-functional tyrosine kinase domain VEGFR-1 (Hiratsuka et al., 1998). VEGFR-1 can also mediate the expression of tissue factor in endothelial cells (Clauss et al., 1996).  35  Finally, the ability of V E G F to inhibit the maturation of dendritic cells has been associated with the activation of VEGFR-1 (Oyama et al., 1998). In addition to the full length receptor, the VEGFR-1 gene can also generate a soluble form containing only 6 Ig domains through alternative splicing. The soluble form of VEGFR-1 also displays strong binding to V E G F , and thereby can act as an antiangiogenic factor (Yamaguchi et al., 2002).  VEGFR-2  VEGFR-2 appears to trigger most of the effects of V E G F in endothelial cells. When activated, VEGFR-2 can induce migration of endothelial cells, extracellular matrix degradation and a mitogenic response on endothelial cells (Waltenberger et al., 1994). Furthermore, VEGFR-2 activation has been shown to be required for the antiapoptotic effects of V E G F for endothelial cells under serum-starved conditions (Gerber et al., 1998a; Gerber et al., 1998b). This antiapoptotic effect appears to be mediated by the PI3kinase/Akt pathway (Gerber et al., 1998b). VEGFR-2 also appears to be responsible for the release of N O and the increased expression of eNOS following stimulation of endothelial cells with V E G F (Kroll and Waltenberger, 1998). Moreover, some studies have suggested that VEGFR-2 is the receptor responsible for the permeability of endothelial cells (Joukov et al., 1998; Murohara et a l , 1998). However, this is contradicted by other studies that show that mutant forms of V E G F that lack the ability to bind VEGFR-2 still retain the ability to induce vascular permeability (Stacker et al., 1999).  VEGFR-2 can be autophosphorylated on at least four tyrosine residues located within the cytoplasmic domains of the protein (Dougher-Vermazen et al., 1994). Two of these residues, tyrosine 1054 and 1059, are located in the activation loop of the tyrosine kinase domains. The other two tyrosine phosphorylation sites at amino acid position 951 and 996 are located in a poorly-conserved region, known as the tyrosine kinase insert loop, that is characteristic of type III receptor tyrosine kinases (Fantl et al., 1993). Phosphorylation of the corresponding tyrosines in PDGF P-receptor provides docking sites for downstream signal transduction proteins (Fantl et al., 1993). V E G F stimulation of KDR-expressing cells is known to result in the phosphorylation of GAP, members of the Src family of protein kinases, and PLCy as well as of p42 M A P kinase (Takahashi and Shibuya, 1997; Waltenberger et al., 1994). It seems that the activation of these proteins through VEGFR-2 could account for most of the effects of V E G F in endothelial cells. Like VEGFR-1, VEGFR-2 gene can also produce a soluble form of VEGFR-2 (sVEGFR-2) by alternative splicing, which can bind V E G F (Ebos et al., 2004). However, the biological relevance of sVEGFR-2 remains unknown.  1.4 VEGF and hematopoiesis 1.4.1 Expression and induction of V E G F and its receptors in normal hematopoiesis V E G F is a critical factor in the development of the hematopoietic system. Its role in developmental hematopoiesis has been demonstrated by the heterozygous embryonic lethality induced by targeted inactivation of the V E G F gene in mice. Absence of V E G F results in impaired blood island formation and angiogenesis (Carmeliet et al., 1996;  37  Ferrara et al., 1996). Disruption of two of its receptors, VEGFR-1 and VEGFR-2 also results in embryonic lethality (Fong et al., 1995; Shalaby et al., 1995). The role of VEGFR-1 during hematopoietic development is unclear because mice lacking the tyrosine kinase domain of VEGFR-1 have no obvious developmental hematopoietic defects (Hiratsuka et al., 1998), although VEGF-induced monocyte migration is strongly suppressed. In contrast, VEGFR-2-deficient embryos die at midgestation (E9.5) because of the absence of blood islands (Shalaby et al., 1995) and of hematopoietic and endothelial progenitors. When differentiated in vitro, VEGFR-2-/- embryonic stem cells retain the capacity to produce hematopoietic cells, suggesting that VEGFR-2 is not involved in hematopoietic commitment per se (Hidaka et al., 1999; Schuh et al., 1999), but might be important for the survival and migration of early mesodermally derived precursors into a microenvironment that is permissive for hematopoiesis. The prenatal lethality of V E G F and its receptors observed in knockout embryos has made it difficult to study the role of these proteins in hematopoiesis in adult settings. Even though the role of V E G F and its receptors in adult hematopoiesis still remains unclear, it has been observed in recent years that these proteins are expressed in a variety of normal and malignant cells ofthe hematopoietic lineage. A variety of hematopoietic cells secrete V E G F . Mohle et al. have demonstrated that megakaryocytes and platelets can secrete different isoforms of V E G F  (VEGF121,  VEGF] 65 and V E G F 189) following stimulation with thrombin or cytokines such as IL-3 and  thrombopoietin (Tpo) (Mohle et al., 1997). Moreover, CD34  +  hematopoietic  progenitors can also secrete V E G F when stimulated with hematopoietic cytokines (SCF, IL-3, GM-CSF, G-CSF) (Bautz et al., 2000). Primitive hematopoietic stem cells have also  38  been reported to secrete V E G F , and this cytokine has been shown to be essential for the ability of stem cells to repopulate lethally irradiated animals (Gerber et al., 2002). V E G F receptors are also present on subsets of hematopoietic cells. VEGFR-2 is expressed on 0.1 to 0.5% of CD34 cells in human postnatal hematopoietic tissues, and it +  has been argued that the pluripotent hematopoietic stem cells are restricted to the CD34+VEGFR-2+ cell fraction (Ziegler et al., 1999). However, in adult mice, the expression levels of VEGFR-2 are low or undetectable in Lin"cKit Sca-l CD34 " cells +  +  low/  as well as Hoechst 33342" cells (side population), which have long-term reconstitution activity,  and neither  CD34  ,ow/  "VEGFR-2  +  nor CD34 VEGFR-2 +  +  have long-term  reconstitution activity in mice (Haruta et al., 2001). In addition, it has been reported that megakaryocytes and platelets express the VEGFR-2 transcript (Katoh et al., 1995), which might help those cells survive following stress such as radiation. In addition to being present on endothelial cells, VEGFR-1 is also expressed on inflammatory cells such as monocytes and macrophages. In fact, the majority of human peripheral blood monocytes express VEGFR-1 as a cell surface marker (Sawano et al., 2001). Using a VEGFR-1 blocking antibody, it has been demonstrated that VEGFR-1 is responsible for VEGF-induced migration of monocytes, which may play a role in inflammation. VEGFR-1 is also present on megakaryocytes, where it can help promote maturation and polyploidization (Casella et al., 2003). Finally, VEGFR-1 was found to be expressed on a significant proportion of human CD34 and mouse Lin"Sca-l c-Kit bone +  +  +  marrow-repopulating stem cells (Hattori et al., 2002; Heissig et al., 2002).  39  1.4.2 Role of V E G F and its receptors in hematopoietic cells The bone marrow microenvironment plays a major role in the proliferation, maintenance and differentiation of hematopoietic stem cells. The bone marrow stroma is a rich source of cytokines, hormones and growth factors, which can have profound effects on hematopoietic homeostasis.  Such cytokines include tyrosine kinase ligands  (SCF, flt-3 ligand), colony stimulating factors (G-CSF, M-CSF, GM-CSF), interleukins, members of the transforming growth factor (TGF) family and angiogenic factors (bFGF, VEGF). Until recently, the effects of V E G F in the bone marrow microenvironment were thought to be limited to modulating neoangiogenesis in hematopoietic malignancies (Fiedler et a l , 2001). It is now clear that V E G F has an important role in adult hematopoiesis.  Gerber et al. have  shown that V E G F  is critical in regulating  hematopoietic stem cell survival during bone marrow repopulation experiments of lethally irradiated recipient mice (Gerber et al., 2002). In these experiments, V E G F deficient  cells  failed  to  repopulate  lethally  irradiated  animals,  despite  the  coadministration of large numbers of wild-type cells. Moreover, VEGF-deficient hematopoietic stem cells failed to repopulate wild-type animals. According to the authors, these findings indicate that a wild type bone marrow microenvironment is not sufficient to promote the survival of VEGF-deficient stem cells and has led to the hypothesis that V E G F can stimulate hematopoietic stem cells through an autocrine private loop. The effects on hematopoietic cells are not limited to the survival of hematopoietic stem cells, but can also direct the expansion and differentiation of more mature hematopoietic progenitors. Long term infusion experiments with V E G F in mice resulted in accumulation of B cells and immature Gr-1 myeloid cells, and dramatically +  40  inhibited dendritic cell development (Gabrilovich et al., 1998). Finally, V E G F can also modulate hematopoiesis indirectly by promoting the release of hematopoietic cytokines by bone marrow endothelial cells. Endothelial cells stimulated with V E G F have been shown to upregulate expression of cytokines such as IL-6 (Dankbar et al., 2000) and G M CSF (Fiedler et al., 1997; Zhang et al., 2004), which can in turn affect the survival, expansion and differentiation of hematopoietic progenitors. The V E G F receptors, which are expressed on subsets of hematopoietic cells, also play significant roles in hematopoiesis. VEGFR-1 regulates gene expression and V E G F induced migration of monocytes, which may be critical in physiological processes such as wound healing (Shibuya, 2001). VEGFR-1 can also convey signals for the recruitment of hematopoietic stem cells and reconstitution of hematopoiesis. P1GF, a VEGFR-1 specific ligand, mediates the early phase bone marrow recovery of irradiated recipients through the mobilization of preexisting V E G F R - 1  +  bone marrow repopulating cells  (Hattori et al., 2002). During the late phase of bone marrow recovery, P1GF promotes hematopoiesis primarily by inducing matrix metalloproteinase 9 (MMP-9), which can release SCF from the extracellular matrix, resulting in enhanced cell motility, cycling and differentiation of V E G F R - 1 long-term repopulating cells (Heissig et al., 2002). +  VEGFR-2 is expressed on a small proportion of hematopoietic cells, and has been argued to be a marker of pluripotent hematopoietic stem cells in human (Ziegler et al., 1999). Although it plays a critical role in embryonic hematopoiesis, its role in post-natal physiological hematopoiesis remains unclear. V E G F R - 2  +  bone marrow cells fail to  repopulate lethally irradiated mice (Haruta et al., 2001). Moreover, mice myeloablated with 5-fluorouracil treated with an anti-VEGFR-2 antibody showed only a transient delay  41  in the recovery of lymphoid and erythroid cells, which might have been caused by the interference of lineage-specific cytokines such as G M - C S F and IL-6 (Hattori et al., 2002). It has therefore been argued that mouse bone marrow V E G F R - 2 cells may mark a +  population of endothelial progenitors (Lyden et al., 2001; Peichev et al., 2000), rather than primitive hematopoietic stem cells. 1.4.3 V E G F and its receptors in hematological malignancies Several reports have demonstrated that there is increased angiogenesis in the bone marrow of patients with various hematological malignancies such as acute myelogenous leukaemia (AML) and multiple myeloma (Litwin et al., 2002; Padro et al., 2000; Pruneri et al., 1999). In addition, emerging data suggests that V E G F and its receptors are expressed in a variety of cell lines derived from hematological malignancies (Bellamy et al, 1999). Table III lists the hematopoietic malignancies in which V E G F was detected.  Table III Expression of V E G F and its receptors in hematopoietic malignancies | Hematopoietic malignancies - Myeloproliferative disorders - Myelodysplastic syndromes - Chronic myelomonocytic leukemia - Leukemia (acute and chronic lymphocytic, acute and chronic myelogenous) - Non-Hogkin's lymphoma - Multiple myeloma  V E G F / V E G F R expression VEGF V E G F , VEGFR-1 V E G F , VEGFR-1, VEGFR-2 V E G F , VEGFR-1, VEGFR-2 (AML); V E G F , VEGFR-1 (ALL); V E G F , VEGFR-2 (CLL); V E G F (CML) VEGF V E G F , VEGFR-1, VEGFR-2  The detection of VEGFR-1 and VEGFR-2 expression in a significant proportion of these cell lines suggests that V E G F might stimulate tumour cells through an autocrine mechanism in hematopoietic malignancies (Bellamy et al., 1999; Bellamy et al., 2001; Santos and Dias, 2004). Alternatively, V E G F can also potentiate signals in hematopoietic  42  malignancies through the paracrine induction of other cytokines and hematopoietic growth factors, which include G-CSF, M-CSF, GM-CSF, SCF and IL-6 (Bellamy et al., 2001; Fiedler et al., 1997). Taken together, these results suggest that anti-angiogenic therapies that interfere with the V E G F / V E G F R pathway may represent novel approaches to effect treatment for certain hematological malignancies. In fact, inhibition of leukaemia growth has been achieved both in vivo and in vitro in animal models, using a variety of anti-angiogenic compounds that include anti-VEGF antibodies (Bellamy et al., 2001), anti-VEGFR-2 antibodies (Dias et al., 2000; Zhang et al., 2004) and receptor tyrosine kinase inhibitors (Mesters et al., 2001). Blockade of V E G F signalling in hematological malignancies has been shown to result in inhibition of hematopoietic cytokine production by bone marrow stroma derived from malignant bone marrow (Bellamy et al., 2001), promotion of differentiation of immature progenitors, inhibition of M M P production and induction of apoptosis in receptor-expressing cells (List, 2001). Moreover, V E G F inhibition can block the formation of leukemic colonies in vitro (Bellamy et al., 2001). Inhibition of VEGFR-1 and VEGFR-2 signalling with small molecular tyrosine kinase inhibitors such as SU5416 and SU6668 has also shown inhibitory effects on the growth of human leukemic blasts, independently of their effects on angiogenesis (Lin et al., 2002; Mesters et al., 2001). However, it must be noted that these inhibitors can also block signalling of other structurally related tyrosine kinase receptors such as c-Kit and PDGFR. Other studies, which used VEGFR-2 blocking antibodies, showed that inhibition of VEGFR-2 signalling inhibited the proliferation of human leukemic cells, both in vivo and in vitro (Santos and Dias, 2004; Zhang et al., 2004; Zhu et al., 2003). Taken together,  43  these results suggest that i n h i b i t i o n o f V E G F  or s i g n a l l i n g through V E G F R - 1  and/or  V E G F R - 2 m a y b e effective i n the treatment o f h e m a t o l o g i c a l m a l i g n a n c i e s , since this w o u l d o n l y interfere w i t h t u m o u r c e l l proliferation, but w o u l d also b l o c k secretion o f paracrine factors elaborated b y the b o n e m a r r o w stroma.  1.5 Rationale and thesis hypotheses R e c e n t e v i d e n c e c l e a r l y u n d e r l i n e d the p r o m i n e n t role o f V E G F i n a variety o f p h y s i o l o g i c a l a n d p a t h o l o g i c a l processes. N u m e r o u s studies have s h o w n the critical role p l a y e d b y this c y t o k i n e i n processes s u c h as w o u n d h e a l i n g , hematopoiesis,  tumour  angiogenesis, v a s c u l o g e n e s i s a n d tumourigenesis. D u e to the n u m e r o u s receptors that c a n interact w i t h V E G F  o n the surface o f cells a n d thus the d i f f i c u l t y o f s t u d y i n g each  receptor i n isolation, few studies have put i n focus the respective r o l e o f e a c h  VEGF  receptor. D u e to the critical importance o f V E G F R - 2 i n e m b r y o n i c hematopoiesis vasculogenesis,  and  a n d the relatively s m a l l amount o f i n f o r m a t i o n a v a i l a b l e o n its role i n  adult hematopoiesis, w e chose to study the effects m o d u l a t e d b y this receptor i n adult hematopoietic settings. V E G F R - 2 (-/-)  e m b r y o s do not f o r m endothelial or hematopoietic cells, a n d this  has b e e n h y p o t h e s i z e d to be due to a lack o f m i g r a t i o n , p r o l i f e r a t i o n a n d s u r v i v a l o f early m e s o d e r m a l cells. T h e first part o f this thesis focuses o n s t u d y i n g specific pathways  a n d b i o l o g i c a l responses,  signalling  s u c h as m i g r a t i o n , p r o l i f e r a t i o n a n d i n d u c t i o n o f  classical endothelial m a r k e r s , triggered b y V E G F R - 2 i n p r i m a r y fibroblasts transduced w i t h the full length V E G F R - 2 c D N A . T h e use o f fibroblasts transduced w i t h V E G F R - 2  44  as a model allowed us to study VEGFR-2 signalling in isolation, since fibroblasts do not express other V E G F receptors, such as VEGFR-1. The second part of this thesis involves studying VEGFR-2 and its effects in adult hematopoietic cells. Since VEGFR-2 is endogenously expressed on subsets of normal and malignant hematopoietic cells, the appreciation of some of the effects triggered by this receptor may prove useful for a better understanding of the mechanisms underlying normal and malignant hematopoiesis. To achieve this, we used a V E G F R - 2 construct that could be specifically activated with a chemical inducer of dimerization. This approach allowed us to specifically study the biological effects of V E G F R - 2  activation in  hematopoietic progenitors in a controlled fashion, by making it possible to induce VEGFR-2 signalling specifically without activating endogenous V E G F receptors present on hematopoietic cells. We studied some of the biological effects triggered by VEGFR-2 in hematopoietic progenitors, including cell survival and proliferation, and differentiation of progenitors. We also investigated specific signalling pathways induced by VEGFR-2 in hematopoietic cells, and how they can affect some biological effects such as cell survival. In a continuation of the second result section of the thesis, the third result section continued to focus on the effects of VEGFR-2 activation in hematopoietic cells, but in an in vivo setting. The transplantation of mice with bone marrow transduced with the inducible VEGFR-2 construct allowed us to study a situation in which a relatively large proportion of bone marrow and blood cells express VEGFR-2, which has been shown to occur in certain hematological disorders (Padro et al., 2002; Schuch et al., 2002;  45  Verstovsek et al., 2002). Therefore, this study allowed us to understand some of the mechanisms by which VEGFR-2 can contribute to normal and malignant hematopoiesis. Recent studies have demonstrated the contribution of cells derived from the bone marrow to the formation of new blood vessels in tumours. The relative contribution of bone marrow-derived endothelial progenitors to tumour vasculature and the mechanisms by which they are mobilized from the bone marrow and differentiate into mature endothelial cells are still under scrutiny. In the last result chapter, we looked at the contribution of bone marrow-derived cells to tumours implanted in the dorsal area of mice transplanted with bone marrow expressing GFP. Since different experimental settings could potentially affect the proportion of bone marrow-derived cells integrated into tumour vasculature, we studied the implication of variables such as the type of bone marrow used for the transplantation (untransduced bone marrow from GFP transgenic mice vs. bone marrow cultured ex vivo for GFP transduction) or tumour type in the relative contribution of bone marrow cells to the formation of tumour blood vessels. Since V E G F has been reported to be critical for the mobilization of endothelial progenitors through activation of VEGFR-2 (Ffattori et al., 2001), we examined whether V E G F overexpression by tumour cells could affect the proportion of endothelial progenitors  that  incorporate in the  tumour vasculature.  Moreover, the  relative  contribution of endothelial progenitors to tumour blood vessels was examined following VEGFR-2 activation in hematopoietic cells. Based on these observations, we were able to propose a possible role for VEGFR-2 in hematopoietic cells during normal and pathological processes.  46  Chapter 2  Materials and Methods  2.1 Cell culture HMEC-1  endothelial cells (Center for Disease Control and Prevention, Atlanta, GA)  were cultured in M C D B 131 medium (Gibco, Burlington, O N , Canada) supplemented with 10% FBS, 10 lag/ml recombinant human Epidermal growth factor (EGF) (Sigma) and 100 U each of penicillin and streptomycin/ml. Phoenix-AMPHO cells (G. Nolan), NIH 3T3 and GP+E86 cells (Markowitz et al., 1988) were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS, 2mM glutamine and 100 U each of penicillin and streptomycin/ml. B6RV2 cells and B6RV2 cells transduced with the human V E G F cDNA (B6RV2-VEGF) were cultured in RPMI supplemented with 10% FBS and lOOU/ml penicillin/streptomycin. Lewis lung carcinoma cells (LLC) were cultured in D M E M supplemented with 1.5 g/L sodium bicarbonate, 10%FBS, 2mM glutamine and 100 U/ml of penicillin and streptomycin. Human foreskin fibroblasts (HFF) were isolated from freshly circumcised foreskins. Briefly, foreskins were cut finely using a scalpel blade in D M E M supplemented with 5% fetal bovine serum. The minced tissue was incubated in a solution of 0.01% collagenase (Sigma) at 37°C for 2 hours. The tissue was then washed twice with D M E M containing 5% FBS, resuspended in  DMEM  supplemented  with 20%  FBS, 100  units/ml penicillin,  100  ug/ml  streptomycin, and plated in a 60 mm tissue culture dish. After 48 hours, the medium was removed and cells were washed twice with PBS to remove debris and excess tissue. The cells were fed with D M E M supplemented with 10% FBS until they reached confluence.  2.2 Plasmid construct The intracellular domain of VEGFR-2, which exhibits tyrosine kinase activity, was fused to a modified FKBP12 domain that can dimerize in response to an analog of FK1012,  48  AP20187 (Ariad Pharmaceuticals, Inc, Cambridge, MA). The construct used in this thesis contained a myristoylation sequence, two modified FKBP12 domains (F36v), the signalling domain of VEGFR-2, and a C-terminal hemagglutinin HA epitope tag. A chimeric fusion protein containing an amino-terminal myristoylation signal, two copies of a mutated FKBP12, followed by a carboxy terminal HA epitope tag was released from the PC4M-Fv2E vector (Ariad) using EcoRI and BamHI, and inserted into the pEGFP-Cl plasmid (Clontech, Mississauga, ON). An Spel tinkered fragment encoding the intracellular domain of human VEGFR-2 was PCR-amplified from the full length cDNA (gift of C. Patterson, Carolina Cardiovascular Biology Center, Chapel Hill, North Carolina)  using  the  following  primer  GACTAGTAAGCGGGCC AATGGAGGG-3'  and  pairs:  5'5'-  GACTAGTAACAGGAGGAGAGCTCAGTG-3'. The amplicon was digested with Spel, gel purified, and subcloned into £/?e/-digested pBluescript. After sequence confirmation, thefragmentwas released from pBluescript by Spel digestion, gel purified, and subcloned into the Spel site of the pEGFPCl-FKBP12 plasmid. The FKBP-VEGFR-2fragmentwas released using Hindlll-Xbal digestion, overhanging ends filled in with Klenow fragment of DNA polymerase I, and cloned into the Hpal site of a previously described MSCVIRES-GFP vector based on an original vector kindly provided by R. Hawley (American Red Cross, Rockville, Maryland) (Antonchuk et al, 2001). 2-3 Gene transfer  HMEC-1, HFF, GP+E86 and B6RV2 cells were retrovirally transduced using amphotropic packaged virus obtained by harvesting the supernatant of Phoenix-AMPHO cells transfected with vector plasmids 48 hours prior to supernatant collection. Ecotropic  49  packaged virus was generated using the following procedure: Phoenix-AMPHO cells were transfected with the vector plasmids using Fugene (Roche, Laval, QC, Canada) according to the instructions of the manufacturer. Medium was changed after 24 hours, and transfected cells were cultured for another 24 hours in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS). Supernatant was then harvested, filtered, and used for repeated infections of GP+E86 ecotropic packaging cells (Markowitz et al., 1988) in the presence of 8 u,g/ml polybrene (Sigma, Oakville, ON, Canada). After sorting for GFP expression, transduced GP+E86 cells were plated at limiting dilution. Individual clones were tested, and the highest titer clone was selected O  by titration of supernatants on NLH 3T3 cells. 2-4 HFF proliferation assay Cells (5000/well) were seeded in 96-well plates and, 18 hours later, were washed in serum-free medium and incubated overnight in serum-free medium containing 0.1% BSA to render them quiescent. Cells were then incubated with increasing concentrations of recombinant human VEGF (0-50 ng/ml) for 48 hours in serum-free medium and cell number estimated by MTT assay. Briefly, medium was removed and replaced with medium containing 1 mg/ml MTT and incubated for 4 h. The medium was then aspirated, and the formazan product was solubilized with dimethyl sulfoxide (DMSO). Absorbance at 630 nm was subtracted (to reduce background absorbance) from absorbance at 570 nm for each well. 2-5 Migration assays Cell migration was assessed using a modified Boyden chamber assay as described (Kuzuya and Kinsella, 1994). Polycarbonate filters (Transwell®) were coated with 1  50  mg/ml collagen (type I) for 18 hours at room temperature. Serum-free medium supplemented with 0.1% B S A and recombinant human V E G F (20 ng/ml) or FGF-2 (5 ng/ml) was added to the lower chamber, and the upper chamber was seeded with 50,000 cells in serum-free medium containing 0.1% BSA. After 8 hours of incubation (37°C, 5% CO2), filters were removed, fixed with glutaraldehyde and stained with crystal violet. After adherent cells were removed from the upper side of the filter with a cotton swab, cells that had migrated and adhered to the underside of the filter were quantified by counting three random high power fields (40X). We observed that 6 high power fields cover the whole area ofthe filter. 2-6 In vitro MAP Kinase assay Confluent cells were starved for 18 hours in serum-free medium containing 0.1 % BSA, after which they were stimulated with 20 ng/ml recombinant human V E G F for various times (0-30 min). For Erkl/2 immunoprecipitation, cell lysates (500 ug protein) in NEFT buffer (1M NaCl, 5mM E D T A , 50 mM NaF, 50 mM Tris-HCl pH7.4) supplemented with 6% NP-40 were incubated with an anti-Erkl/2 antibody overnight at 4°C, followed by a 1 hour incubation with protein A-sepharose. After washes, immunoprecipitates were assayed for Erkl/2 M A P kinase activity by incubating with 1 iag/ml myelin basic protein (MBP) and 5 uCi of [y- P] A T P for 20 min at 30°C. Following SDS-PAGE, proteins 32  were transferred to nitrocellulose membranes, which were exposed to X-Ray film at 80°C. Filters were reprobed with anti-Erkl/2 to confirm equal sample loading.  2-7 Isolation of murine bone marrow cells Bone marrow cells were extracted from the femurs and tibias of C3Pep mice (Ly5.1/Ly5.2, cross between C3H/HeJ and Pep3b) treated 4 days previously with 150  51  mg/kg 5-fluorouracil (Pharmacia & Upjohn, Mississauga, O N ) and cultured for 48 hours in Iscove's M o d i f i e d Dulbecco's M e d i u m ( I M D M ) supplemented with a serum substitute (BIT (BSA, Insulin, Transferrin) (Stem C e l l technologies ltd., Vancouver, B C , Canada)), 10" M 2-mercaptoethanol, 40 u.g/ml low-density lipoproteins ( L D L , Sigma), 1 ng/ml 4  recombinant human flfi-ligand, 300 ng/ml recombinant mouse stem cell factor (SCF) and 20 ng/ml recombinant human interleukin-11 (Stem C e l l Technologies). For transduction, bone marrow cells were harvested and infected by either cocultivation with irradiated (1500 cGy, X-ray) GP+E86 viral producer cells or by the addition o f virus-containing supernatant from the GP+E86 producer cells in fibronectin-coated dishes. Both infection protocols involved 48 hr growth on tissue culture plates with the above cytokine combination and with the addition o f 5 ug/ml protamine sulfate (Sigma). Following infection, bone marrow cells were plated in the same medium for another 2 days. Cells were then sorted for G F P expression ( F A C S 440, Becton Dickinson).  2-8 Animals 2-8-1 Bone marrow transplant Previously transduced and sorted bone marrow cells (1 x 10 G F P 6  injected into the tail vein o f lethally irradiated (900 cGy, using a  1 3 7  +  cells/animal) were  C s source) B 6 C 3 mice  (Ly5.2, cross between C3H/HeJ and C57B1/6J) within 24 hours o f irradiation. M i c e were housed i n microisolator units and provided with sterilized food, water, and bedding. Irradiated animals were additionally provided with acidified water (pH 3.0) and 100 mg/L  ciprofloxacin. Transplanted animals were allowed to reconstitute their bone  marrow for 4 to 8 weeks before any experiments were performed. Peripheral blood and bone marrow cells were harvested from the mice to check for G F P engraftment. For bone  52  marrow collection, mice were anaesthetised using isoflurane gas (Associated Veterinary Purchasing, Abbotsford, BC) supplied by a vaporizer (Ohio medical products, Madison, WI), and a 22 gauge needle was inserted into the knee joint. Bone marrow was aspirated into a syringe containing phenol-free medium supplemented with 2% FBS. Blood was also collected by making a small incision on the tail using a sterile scalpel blade. Blood was harvested into a capillary tube coated with heparin. Red blood cells were lysed by hypotonic shock using red blood cell lysis buffer (0.8% ammonium chloride, 0.1 m M EDTA). Both bone marrow cells and blood mononuclear cells were then processed for flow cytometry analysis. Mice were then treated with AP20187 or vehicle for 10 days, after which they were sacrificed by C 0 inhalation. Peripheral blood was obtained by 2  heart puncture, while bone marrow was obtained by flushing the four long bone of the limbs with HMDM supplemented with 2% FBS. 2-8-2 Single cell transplants Hoechst staining of bone marrow cells for side-population cell analysis was done as previously described (Goodell et al., 1997). Briefly, 2 x 10 bone marrow cells/ml from 6  GFP CD45.1 C57BL/6 mice were incubated at 37°C, in the presence of 5 /tg/ml of +  Hoechst 33342 (Sigma). After 90 min, cells were washed and antibody staining (c-Kitphycoerythrin, Lineage markers (CD3 (Clone no. 145-2C11), B220 (RA3-6B2), Gr-1 (RB6-8C5), Mac-1 (Ml/70) and terll9 (Terll9)), Sca-l-allophycocyanin) was done in cold Hank's Balanced Salt Solution (HBSS). Detection of lineage markers was assessed using streptavidin-phycoerythrin-Texas red from Caltag Laboratories. Cells were doublesorted on a FACSVantage SE (BD Biosciences), at 1 cell/well, into 96-well plates containing 50 /xl of PBS. Individual wells were screened by light and fluorescence  53  microscopy with GFP and Hoechst filters. In a typical experiment, >90% of the wells were found to contain single cells, and the remaining wells were empty. Wells containing two cells were found with an approximate frequency of 1 in 200. Only wells containing a single cell were used for transplantation. To guarantee the survival of the recipients during the lag phase between the injection of the donor cell and the development of sufficient functional single cell-derived peripheral blood cells, stem cell-depleted bone marrow from GFP" congenic mice was coinjected with the single hematopoietic stem cells. Stem cell-depleted bone marrow was obtained by removal of Sca-1 cells using +  Sca-l-phycoerythrin (clone D7, PharMingen), followed by anti-phycoerythrin magnetic beads (Miltenyi Biotec) and an automated magnetic cell sorter (autoMACS, Miltenyi Biotec). One million of these helper cells were added to each well containing a single hematopoietic stem cell, and the total volume of the well was injected into lethally irradiated (950 cGy) CD45.2 C57BL/6 mice. 2-8-3 CFU-Spleen (CFU-S ) assay t2  Transduced G F P bone marrow cells were cultured in EVIDM supplemented with 10% +  FBS with or without 100 nM AP20187 for 7 days. 25,000 cells were injected into the tail vein of lethally irradiated B6C3 mice. 12 days later, mice were sacrificed and spleens were harvested,  fixed  in Telleyesniczky's  fixative  (ethanol  70%:glacial  acetic  acid:formalin / 20:1:1) and hematopoietic colonies counted. 2-9 AP20187 formulation AP20187 was a gift from Ariad Pharmaceuticals. Lyophilized AP20187 was dissolved in 100% ethanol at a concentration of 62.5 mg/ml and stored at - 2 0 ° C . For in vitro use, the ethanol stock was diluted in complete culture medium to the desired concentration  54  immediately before use. The final concentration of ethanol in the culture medium was below 0.5%. For in vivo use, peritoneal injections were prepared from the 62.5 mg/ml ethanol stock diluted to 2.5 mg/ml in an injection solution consisting of 4% ethanol, 10% PEG-400, and 1.7% Tween 20 in water. A l l injections were administered to mice within 30 min of dilution into the injection solution. The volume of injection solution was adjusted according to mouse body weight to deliver 10 mg AP20187 per kg mouse. The average injection volume was 100 ul per mouse. For in vivo experiments, mice were injected with AP20187 daily for 10 consecutive days.  2-10 Antibody staining for Fluorescence Activating Cell Sorting (FACS) analysis After red blood cells lysis, cells from bone marrow and peripheral blood were washed and resuspended in PBS containing 4% goat serum (Sigma) followed by monoclonal primary antibody staining for 1 hour at room temperature. Antibodies used for analysis were  anti-Mac-1/CDllb  (monocytes),  anti-Gr-1  (granulocytes),  anti-B220  (B  lymphocytes), anti-CD5 (T lymphocytes), anti-Terll9 (erythroid progenitors), antiCD 144/VE-cadherin and anti-VEGFR-2 (BD Pharmingen). Isotype rat IgG was used for negative control. Cells were then washed in PBS containing 4% goat serum and incubated for 30 minutes with phycoerythrin (PE)-conjugated secondary antibody. After subsequent washes, cells were resuspended in PBS for FACS analysis. Samples were run on an EPICS ELITE-ESP flow cytometer (Beckman Coulter), and data were analyzed with FCS Express, version 2 (De Novo softwares, Thornhill, ON).  55  2-11 Preparation of cDNA and reverse transcription-polymerase chain reaction (RT-PCR) Total cellular R N A was extracted from murine bone marrow using Qiagen RNeasay Quick spin columns (QIAGEN) as described by the manufacturer. The purified total R N A prep was used as a template to generate first strand cDNA synthesis using random hexamer (Invitrogen) priming and reverse transcriptase (Superscript II; Invitrogen). PCR was performed using the following primer pairs: Table IV Murine primers and PCR conditions used in this thesis Target M-CSF Tpo SCF Flt3-ligand IL-6 GM-CSF VEGF BMP-2 BMP-4 Jagged-1 Delta-1 Delta-4 GAPDH  Sense  Anti-sense  Tm(°C)  Cycles  Size (bp)  agctgcttcaccaaggactatgag tgtggactttagcctgggagaatg ctgcgggaatcctgtgactgataa gacacctgactgttacttcagcca gttctctgggaaatcgtgga cttggaagcatgtagaggccatca gctttactgctgtacctccaccat atcaactagaagccgtggaggaac cagaaatggttcctggacacctca aatggagactccttcacctgt tggttctctcagagttagcagag gcattgtttacattgcatcctg gcatggccttccgtgt  ctctgtcaacggcctgtctgttat ttgactctgaatccctgaagcctg cgggacctaatgttgaagagagca acgaatcgcagacattctggtagg tgtactccaggtagctatgg cttgtgtttcacagtccgtttccg atctctcctatgtgctggctttgg catggttagtggagttcaggtggt cacaatccaatcattccagcccac cgtccattcaggcactgg agacccgaagtgcctttgta gtagctcctgcttaatgccaaa gggccgagttgggatagg  55 55 55 55 53 55 55 55 55 53 55 55 53  35 35 35 35 35 35 35 35 32 35 35 30 22  737 491 430 290 207 254 319 686 415 383 409 473 256  PCR products were detected by electrophoresis on 2.0% agarose gels.  2-12 ELISA Murine GM-CSF levels were determined by standard sandwich ELISA according to the instructions of the manufacturer (R&D Systems, Minneapolis, M N , limit of detection: 1 pg/ml). For detection of human  VEGF165  in mouse serum, the following protocol was  used: a 96-well plate (Costar) was coated with an anti-VEGF capture antibody (R&D Systems, Minneapolis, MN) overnight. Wells were blocked for 1 hour with blocking  56  buffer (PBS containing 1% BSA, 5% sucrose and 0.05% sodium azide) and then were incubated with serum samples or V E G F standards for 2 hours at room temperature. Wells were washed 3 times with PBS containing 0.05% Tween, and a biotinylated anti-VEGF detection antibody (R&D Systems) was added and incubated at room temperature for 2 hours. After washing, the plate was incubated with a streptavidin-Horseradish peroxidase (HRP)  conjugate (Vector Laboratories, Burlingame, CA) and incubated at room  temperature for 20 min. Plates were washed and incubated with a substrate solution (0.1 mg/ml 3,5,3',5'-tetramethylbenzidine (TMB)  and 0.05% H2O2 in sodium acetate buffer  pH 5.5). The colorimetric reaction was stopped by addition of 50 ul stop solution (1M H2SO4). Absorbance at 450 nm was read on a microplate reader with wavelength correction set at 540 nm. Good linear correlation was observed with standards in the range between 7.8 and 1000 pg/ml.  2-13 Bone marrow cells viability assays Sorted bone marrow cells were plated in IMDM supplemented with 10% FBS with or without the addition of 100 n M AP20187. Cells were harvested at various times and counted on a hemacytometer.  2-14 Hematopoietic colonies assay For in vitro assays, transduced G F P bone marrow cells were grown in vitro in JJVIDM +  supplemented with 10% FBS, with or without 100 n M AP20187, for 7 and 14 days. At these time points, hematopoietic clonogenic progenitor frequencies were determined by plating 20,000 bone marrow cells in methylcellulose medium containing 50 ng/ml SCF, 10 ng/ml IL-3, 10 ng/ml IL-6 and 3 U/ml erythropoietin (Methocult G F M3434, Stem Cell Technologies). For quantitation of in vivo murine progenitors, G F P and GFP" bone +  57  marrow cells were sorted for GFP expression and plated in methylcellulose medium. Resultant colonies were scored after 10 days of incubation. 2-15 Immunofluorescence and microscopy  For BrdU staining, sorted G F P bone marrow cells were cultured in EVIDM supplemented +  with 10% FBS for 2 days, then treated for 2 hours with 10 uM BrdU with or without 100 nM AP20187. Cytospin preparations of bone marrow cells were fixed with 4% paraformaldehyde for 5 minutes, washed with PBS, and permeabilized with ice cold methanol for 1 min. Slides were then incubated for 20 min at 37°C with 2N HC1 to denature DNA. Slides were blocked in PBS containing 5% Goat serum and 0.1% Triton X-100 for ten minutes, followed by 1 hour incubation with primary antibody (Anti-BrdU conjugated with AlexaFluor 594 (Molecular Probes, Eugene, OR), 1:50 dilution in PBS containing 5% goat serum and 0.1% Triton X-100). After washing, nuclear D N A was stained with DAPI (1 u.g/ml), and slides were mounted in anti-fading solution. For activated caspase 3 staining, cytospin preparations of hematopoietic progenitors grown in culture for 14 days in I M D M containing 10% FBS were stained using the same protocol as above (DNA denaturation step was omitted) and the following antibodies were used: anti-activated caspase 3 (BD Pharmingen, San Diego, CA) and goat anti-rabbit Ig conjugated with Texas Red (Molecular Probes). ). Cells were visualized through a 40x Neofluor objective (numerical objective 0.75) using a Zeiss Axioplan II Imaging inverted microscope (Carl Zeiss, Toronto, Canada), and images were captured with a 1350EX cooled charge-coupled device (CCD) digital camera (Qlmaging, Burnaby, B C , Canada) using Northern Eclipse software (Empix Imaging, Mississauga, ON, Canada).  58  2-16 Immunoblotting Proteins from total cellular extracts were separated by SDS-PAGE and assessed by immunoblotting.  Antibodies  against  phosphorylated  VEGFR-2  and  total  and  phosphorylated Akt and Erk M A P kinase were obtained from Cell Signalling Technology (Mississauga, ON). Anti-HA antibody was obtained from B A B C O (Richmond, CA). The kinase inhibitors LY294002 and U0126 were obtained from Calbiochem (La Jolla, CA).  2-17 Endothelial progenitor assays Human mononuclear cells were obtained from umbilical cord blood. Cord blood samples, which were collected during standard or caesarean delivery of full-term infants, were harvested in 200 ml plastic bottles containing 40 ml of I M D M containing 800 U/ml heparin. Ammonium chloride lysis was  performed to remove red blood cells.  Mononuclear cells were either selected for the surface marker CD133 using anti CD133coupled magnetic micro-beads (Miltenyi Biotech) as indicated by the company or lineage depleted (Lin-) using lineage panel antibodies (CD2, CD3, C D 14, C D 16, C D 19, CD24, CD56, CD66b, Glycophorin A; Stem cell technologies,  Vancouver, Canada) and  separated using a magnetic separation device, StemSep (Stem Cell technologies) or further used without selection. For endothelial progenitor assays, cells were plated onto tissue culture dishes in MCDB131 medium supplemented with 20% FBS, endothelial cell growth supplement (ECGS, Sigma), heparin, 5 ng/ml human bFGF and 30 ng/ml human V E G F . For 3 consecutive days, non-adherent cells were replated onto a new tissue culture dish in order to remove any contaminating endothelial cells. After 3 days, nonadherent cells were harvested, counted and resuspended in fresh medium and plated onto tissue culture dishes coated with 0.2% gelatin. Half of the medium was replaced twice  59  weekly. Endothelial colonies were scored after 4 weeks, as identified by staining with the P1H12 antibody (Chemicon).  2-18 Tumour tissue immunohistochemical staining Tumour tissues were fixed overnight at -20°C in 2% paraformaldheyde / 30% glycerol. After washing with PBS, tumours were embedded in O C T compound and sectioned with a cryostat. Sections (8 Lim) were stained with antibodies against VE-cadherin, CD31 and C D l l b (BD pharmingen). Secondary antibodies were either Alexa 594- or Alexa 633conjugated (Molecular Probes).  2-19 lacZ and hPLAP staining Tumour tissues were fixed in 4% paraformaldehyde for 4 h, and cryopreserved by incubating overnight in 15% sucrose in PBS at 4°C. The samples were washed in PBS before being embedded in OCT compound. Sections were fixed in 0.2% glutaraldehyde for 10 min, washed in 100 mM sodium phosphate (pH7.3) and washing buffer solution (2 m M MgCb, 0.01% sodium deoxycholate and 0.02% NP-40 in lOOmM sodium phosphate pH 7.3) and stained in fresh X-gal solution (0.5 mg/ml X-gal, 5mM potassium ferrocyanide, 5mM potassium ferricyanide in washing buffer solution) at 37°C overnight. For alkaline phosphatase staining, slides were washed three times in PBS for 5 min, and endogenous alkaline phosphatase was inactivated by incubating slides at 70°C in PBS for 30 min. Slides were rinsed in PBS, washed in alkaline phosphatase buffer (100 m M TrisH C l pH9.5, 100 mM NaCl, 10 mM MgCl ) and incubated in NBT/BCIP stain (Sigma) for 2  15 to 40 min at room temperature, in the dark. Slides were washed in PBS and either stained for VE-cadherin or dehydrated through an ethanol series and mounted with coverslips.  60  2-20 Statistical Analysis Results were analyzed by analysis of variance (ANOVA) to ascertain differences between groups, followed by a Tukey test for multiple comparisons. P<0.05 was considered significant.  61  Chapter 3  Biological effects and signalling pathways induced by VEGFR-2 isolation  3.1 Introduction The effects o f V E G F on a variety o f cell types have been studied i n recent years. V E G F stimulates angiogenesis by induction o f endothelial cell proliferation and b y prevention o f endothelial cell death, i.e., anti-apoptotic effects (Ruhrberg, 2003). It was shown that V E G F stimulation leads to the activation o f signalling pathways such as the PI3-kinase/Akt-signalling pathway and the E r k 1/2 M A P kinase pathway, which mediate V E G F effects (Ferrara, 1999b). Due to the fact that numerous receptors can bind V E G F ( V E G F R - 1 , V E G F R - 2 , V E G F R - 3 , neuropilin-1 and neuropilin-2) and that most cell types responsive to V E G F express more than one receptor, the role o f each receptor i n transmitting V E G F signals and biological effects remains unclear. Due to the critical importance o f V E G F R - 2 i n the generation o f the endothelial and hematopoietic lineages, and the increasing evidence o f its role i n adult vasculogenesis, angiogenesis hematopoiesis, we chose to study the biological effects triggered b y V E G F R - 2  and in  isolation. In the first part o f this thesis, we studied the specific signalling pathways and some o f the biological effects triggered by V E G F R - 2 activation.  W e used primary  fibroblasts transduced with V E G F R - 2 to analyze the role o f this receptor in endothelial differentiation, proliferation and migration. Primary fibroblasts were used as a model since they do not express endogenous V E G F receptors, which makes studying V E G F R - 2 signalling without the interference o f other V E G F receptors possible. Furthermore, fibroblasts have been reported to be able to transdifferentiate into endothelial cells in vivo (Kon and Fujiwara, 1994). Others have shown that adenoviral-mediated M y o D gene transfer into cultured human fibroblasts induces myogenic conversion (Lattanzi et al.,  63  1998). Since VEGFR-2 is critical in the establishment of the endothelial lineage, we also studied whether signals transmitted through VEGFR-2 are sufficient to promote an endothelial phenotype in fibroblasts.  3.2 Results 3.2.1 VEGFR-2 transmits a mitogenic signal in response to V E G F stimulation in primary fibroblasts. To determine the biological responses induced by VEGFR-2 in the absence of other V E G F receptors, we generated a cell line of primary human foreskin fibroblasts expressing  VEGFR-2  (HFF-VEGFR-2)  by retroviral transduction. Expression of  VEGFR-2 in transduced HFF was verified by Western blot (Figure 6). Phase contrast micrographs of the cell lines are seen in Figure 6B.  64  Figure 6 Generation of a primary human foreskin fibroblast cell line expressing V E G F R 2. (A) Human foreskin fibroblasts (HFF) were transduced with either the empty L N C X retroviral vector or L N C X containing the VEGFR-2 cDNA. Level of protein expression was determined by Western blot of cellular extracts from H M E C , HFF-Neo and HFFVEGFR-2 cells. (B) Phase contrast micrographs showing the morphology of monolayers of HFF-Neo and HFF-VEGFR-2 cells incubated with 20 ng/ml V E G F for four days.  In all experiments, HFF transduced with the empty vector p L N C X (HFF-Neo) were used as a negative control. Several studies indicate that VEGFR-2, rather than VEGFR-1 stimulation is responsible for the mitogenic effect of V E G F in endothelial cells (Meyer et al., 1999; Takahashi and Shibuya, 1997). To assess this, we examined the proliferative effect of V E G F in HFF-VEGFR-2 cells. HFF-VEGFR-2 cells were found to increase in number, when stimulated with increasing concentrations of V E G F for 48 hours (Figure 7A). By contrast, HFF-Neo cells did not show a proliferative response when stimulated  65  with V E G F for the same amount of time. These results were confirmed by BrdU incorporation assays (Figure 7B).  0.50  10  HFF-Neo  20 30 VEGF (ng/ml)  HFF-Neo +VEGF  HFFVEGFR-2  : 40  50  HFFVEGFR-2 +VEGF  Figure 7 V E G F induces a proliferative response in HFF-VEGFR-2 cells but not in HFFNeo cells. The proliferative effect of V E G F on HFF-Neo and HFF-VEGFR-2 was measured by either M T T assay (A) or BrdU incorporation assay (B). (A) HFF-Neo (•) and HFF-VEGFR-2 cells (•) (5000 cells/well) were incubated in serum-free medium in the presence of V E G F for 48 hours. Relative cell number in each well was estimated by measuring absorbance at 570 nm following incubation with M T T . (B) Quiescent cells were incubated with BrdU with or without V E G F for 48 hours, then fixed and stained as described. The extent of D N A synthesis was evaluated by counting the number of cells that stained positive for BrdU. Data represent the mean of four independent experiments ±SEM.  3.2.2 V E G F is chemotactic for HFF-VEGFR-2 but not HFF-Neo cells Several reports have shown that V E G F can induce endothelial chemotaxis (Albini et al., 1996; Meyer et a l , 1999). Using a modified Boyden chamber assay, we studied the  66  chemotactic response of H M E C , HFF-Neo and HFF-VEGFR-2 cells to V E G F . V E G F (20 ng/ml) induced a significant increase of H M E C and HFF-VEGFR-2  migration  relative to the control ( D M E M + 0.1%BSA), causing a 3.5 and a 5-fold increase, respectively, 8 hrs post-treatment (Figure 8). Again, V E G F did not induce chemotaxis in HFF-Neo cells. FGF-2, used as a positive control, was chemotactic for all three cell types.  HMEC  HFF-Neo  HFF-VEGFR-2  Figure 8 V E G F simulates migration of H M E C and HFF-VEGFR-2 cells, but not HFFNeo cells. Serum free-medium with or without V E G F or FGF-2 was placed in the lower chamber of a 24-well Transwell. A total of 5 x 10 cells/well were seeded in the upper chamber, and cells were allowed to migrate for 8 h through the collagen-coated polycarbonate membrane. Cells that had migrated were quantified by counting three random high power fields/well. Data represent the mean of three independent experiments + SEM. s  3.2.3 V E G F activates Erkl/2 and p38 M A P Kinases in HFF-VEGFR-2, but not in HFFNeo cells We next examined whether the M A P kinase cascade, a convergent pathway in the mitogenic action of many growth factors, including V E G F , can be mediated through the activation of VEGFR-2 alone (Kroll and Waltenberger, 1997; Mukhopadhyay et al., 1998). Serum-starved cells were stimulated with V E G F (20 ng/ml) for 0 to 30 min, and Erk was immunoprecipitated from cell lysates. Using an anti-phospho-Erk antibody, we observed that Erk phosphorylation increased in response to V E G F stimulation in HFF-  67  VEGFR-2 cells, but not in HFF-Neo cells (Figure 9A). Maximum phosphorylation of Erk peaked at 15 min in HFF-VEGFR-2 cells. The kinetics of Erk phosphorylation was mirrored by Erk activity as assayed by in vitro phosphorylation of MBP (Figure 9B). We observed an increase in Erk activation after 10 minutes in HFF-VEGFR-2 cells. As with the phosphorylation, activation of Erk peaked at 15 minutes in HFF-VEGFR-2 cells. No Erk activation was detected in HFF-Neo cells following V E G F stimulation.  Time (min)  B 0  5  10  15  20  30  Figure 9 V E G F induces phosphorylation and activation of Erkl/2 M A P kinase in HFFVEGFR-2 but not HFF-Neo cells. Quiescent cells were incubated with 20 ng/ml V E G F for 0 to 30 minutes as indicated. (A) Phosphorylation of Erkl/2 was determined by Western blotting using an antibody specific to phosphorylated Erkl/2 (upper panel, PErk-1). Membranes were reprobed with an anti-Erk antibody as a loading control. (B) Activity of Erkl/2 was determined by an in vitro kinase assay using MBP as a substrate. Expression of Erkl/2 was determined by Western blotting. Data show one experiment of four independent experiments.  We also examined the effect of V E G F on p38 phosphorylation for transduced fibroblasts by Western blot using an anti-phospho-p38 antibody. We found that V E G F  68  stimulation resulted in p38 phosphorylation in HFF-VEGFR-2 cells, but had no effect in HFF-Neo cells (Figure 10). Maximum phosphorylation of p38 was detected after 15 minutes in HFF-VEGFR-2 cells. Again, V E G F had no effect in mock-transduced cells. Time (min) 0  5  10  15  20  30  P-p38 p38 P-p38 p38  }~ HFF-Neo  }  HFFVEGFR-2  Figure 10 V E G F induces phosphorylation of p38 M A P kinase in HFF-VEGFR-2 but not HFF-Neo cells. Quiescent cells were incubated with 20 ng/ml V E G F for 0 to 30 minutes as indicated. Phosphorylation of p38 was determined by Western blotting using an antibody specific to phosphorylated p38 ( P-p38). Data represent one experiment of three independent experiments.  3.2.4 V E G F does not induce expression of endothelial markers in primary fibroblasts transduced with VEGFR-2 A previous study has suggested that fibroblasts can transdifferentiate into endothelial cells (Kon and Fujiwara, 1994). Others have shown that VEGFR-2expressing cells isolated from chick gastrula can differentiate into either hematopoietic or endothelial lineages and that the presence of V E G F in the culture medium is absolutely required for endothelial differentiation (Eichmann et al., 1997). To assess whether VEGFR-2 activation is sufficient for induction of expression of endothelial markers in fibroblasts, HFF-VEGFR-2 and HFF-Neo cells were incubated in the presence of 10 ng/ml V E G F for 4 days, after which expression of various endothelial markers was assayed by Western blot. We were not able to detect expression of endothelial markers such as VEGFR-1, Tie-1, Tie-2 and eNOS, as shown by Western blot (Figure 11). Expression of eNOS (Kroll and Waltenberger, 1998) and Tie-1 (McCarthy et a l , 1998)  69  have been shown to be increased following V E G F stimulation o f endothelial cells. However, we did not observe any increase in expression o f these markers in the presence o f V E G F , even i n H M E C . A s seen in Figure 6 A , we did not observe any morphologic changes in H F F - V E G F R - 2 relative to H F F - N e o cells.  o LU >  O o LU  5 X  •-, •7 O  a>  z  W  Cc LL  O  a  z  LU  >  (  W  QL LL S O LU  >  VEGFR-1 Tubulin  Tie-1  ,  Tubulin  -  Tie-2 Tubulin  eNOS  Tubulin  Figure 11 V E G F does not induce expression o f endothelial markers in H F F - V E G F R - 2 cells. Cells were incubated with V E G F for four days before cell extracts were collected and processed for western blotting. Endothelial markers examined included V E G F R - 1 , Tie-1, Tie-2 and e N O S . Membranes were reprobed with an anti-tubulin antibody as a loading control. Data represent one experiment repeated at least three times with similar results.  Thus, even though V E G F / V E G F R - 2  interactions appear to be required for  endothelial development from mesodermal precursors, these results suggest that V E G F R 2 alone is not sufficient to induce expression o f endothelial markers in primary fibroblasts.  70  3.3 Discussion The  vascular system forms through a combination of vasculogenesis and  angiogenesis. In vasculogenesis, vessels form de novo via the assembly of endothelial precursors called angioblasts, whereas in angiogenesis new vessels arise by migration and proliferation of endothelial cells from preexisting vessels (Risau and Flamme, 1995). VEGFR-2 is required for the embryonic production of cells of the hemangioblastic lineage, and for vascular development in the embryo and adult (Eichmann et al., 1997; Risau and Flamme, 1995; Shalaby et al., 1997). Of the endothelial receptor tyrosine kinases identified so far, VEGFR-2 is the only receptor whose function is absolutely required for the determination ofthe endothelial lineage (Shalaby et al., 1997; Shalaby et al., 1995). Whether it acts as a switch that triggers endothelial differentiation or is only required for the migration and survival of early mesodermal precursors remains to be shown. Because it has been difficult to express VEGFR-2 in heterologous cells, to study the specific signalling pathways and biological effects triggered by VEGFR-2, we used a retroviral vector to transduce primary human foreskin fibroblasts with VEGFR-2. Two major biological activities of V E G F are to induce vascular endothelial cell proliferation, and to stimulate cell migration (Barleon et al., 1996; Connolly et al., 1989; Ferrara and Henzel, 1989; Rousseau et al., 1997). However, the mechanisms underlying these diverse processes are still not well characterized. We examined whether VEGFR-2 was able to elicit a proliferative response in the absence of other V E G F receptors. M T T and BrdU incorporation assays showed that V E G F was indeed able to cause the proliferation of HFF-VEGFR-2 cells whereas it had no effect on HFF-Neo cells. These results indicate  71  that the VEGF-induced proliferative response can be transmitted solely through the activation of VEGFR-2. This confirms the finding of another study in which NUT 3T3 cells transduced with VEGFR-2 showed a proliferative response in the presence of V E G F (Takahashi and Shibuya, 1997). A separate study showed that V E G F did not cause proliferation of VEGFR-1-transduced NIH 3T3 cells (Seetharam et al., 1995). Thus, it is likely that VEGFR-2 is the main receptor responsible for transducing VEGF-induced mitogenic signals. Erkl/2 M A P kinase is a central signalling molecule that is activated by many growth factor receptors (Waskiewicz and Cooper, 1995). Erk activation has also been associated with cell proliferation. It is possible that the mitogenic effect of VEGFR-2 may be mediated through Erk activation. We therefore investigated whether activation of VEGFR-2 by V E G F could activate the Erkl/2 M A P kinase pathway in the absence of other V E G F receptors. We found that V E G F had the capacity to induce Erkl/2 phosphorylation and activation in HFF-VEGFR-2 cells, indicating that VEGFR-2 can activate this pathway in isolation. Endothelial cell migration plays a critical role in angiogenesis. Several cytokines, such as V E G F and angiopoietin-1 have been shown to act as chemoattractants for endothelial cells (Neufeld et al., 1999; Witzenbichler et al., 1998). Furthermore, it has been hypothesized that V E G F may be critical for embryonic hematopoiesis and vasculogenesis by promoting the migration of early precursors (Traver and Zon, 2002). Using a modified Boyden chamber assay, we also demonstrated that V E G F can cause directed migration of HFF-VEGFR-2 cells, indicating that VEGFR-2 is indeed implicated in cell migration. Other studies have shown that VEGFR-1 can also direct cell migration  72  of monocytes (Barleon et al., 1996; Sawano et al., 2001). It is not known whether VEGFR-1 activates the same pathways as VEGFR-2 to induce cell migration. However, since HFF-VEGFR-2 showed a similar chemotactic response to V E G F as H M E C , it is likely that activation of both receptors is not required to induce cell migration. We then examined the p38 signal transduction pathway elicited by VEGFR-2 in response to V E G F stimulation. It has already been shown that V E G F stimulation of endothelial cells can result in phosphorylation of p38 M A P kinase (Rousseau et al., 1997). Activation of p38 results in activation of M A P kinase activated protein kinase-2/3 and phosphorylation of the F-actin polymerization modulator, heat shock protein 27 (HSP27) (Hedges et al., 1999; Kato et al., 1999). The p38 pathway conveys the V E G F signal to microfilaments inducing rearrangements of the actin cytoskeleton that regulate cell migration (Hedges et al., 1999; Kato et al., 1999; Rousseau et al., 1997). By modulating cell migration, p38 may thus be an important regulator of angiogenesis. Here we find that the p38 pathway, as with Erkl/2 activation, can be activated by VEGFR-2 alone. Therefore, cell migration induced by V E G F in HFF-VEGFR-2 could be a consequence of the activation of the p38 pathway. It has been reported in vivo that fibroblasts have the potential to differentiate into endothelial cells, and may play a role in angiogenesis, as progenitors of endothelial cells in newly formed blood vessels (Kon and Fujiwara, 1994). However, the mechanisms by which this occurs is unknown. Moreover, fibroblasts transduced with the MyoD gene have been reported to transdifferentiate into muscle cells (Weintraub et al., 1989). Thus, it seems that, under the proper conditions, fibroblasts may have a plasticity that allows them to transdifferentiate into other cell types. Since VEGFR-2 is critical in endothelial  73  development, it is possible that activation of this receptor by V E G F could trigger induction of endothelial markers in primary fibroblasts. However, when incubated with V E G F for several days, HFF-VEGFR-2 cells did not display an endothelial phenotype, as shown by the lack of expression of endothelial markers such as VEGFR-1, tie-1, tie-2 and eNOS. HFF-VEGFR-2 also did not adopt an endothelial cobblestone morphology. This contrasts with the findings of Eichmann and colleagues, who have demonstrated that in uncommitted precursors VEGF/VEGFR-2  interactions  will upregulate  endothelial  markers (Eichmann et al., 1997). Although HFF-VEGFR-2 cells were found to be signalling competent, other components of endothelial signalling pathways may be required for differentiation. In addition to VEGFR-2, other membrane receptors, intracellular signalling molecules or transcription factors are also likely necessary for endothelial differentiation. Alternatively, it is also possible  that VEGFR-2  is not required for endothelial  differentiation, but that its role is limited to drive the survival, proliferation and /or migration of early mesodermal precursors (Habeck et al., 2002).  74  Chapter 4  Effects of V E G F R - 2 activation in murine bone marrow cells in vitro  75  4.1 Introduction V E G F and its receptors have been shown to play an important role in adult hematopoiesis. VEGFR-2 has been found to be expressed on a subset of hematopoietic stem cells that can differentiate into hematopoietic or vascular endothelial cells depending on the culture conditions (Gehling et al., 2000; Peichev et al., 2000; Ziegler et al., 1999). Because of the increasing amount of data that supports a role of VEGFR-2 signalling in adult hematopoietic cells, both normal and malignant, we decided to study the effects of VEGFR-2 signalling in isolation in murine hematopoietic cells. However, since subsets of hematopoietic cells express V E G F receptors, we chose not to use hematopoietic cells transduced with the full length VEGFR-2, as stimulation of those cells with V E G F may activate the endogenous V E G F receptors present on some of those cells, which in turn may mask or interfere with VEGFR-2 signalling. Moreover, it has been shown that neuropilin-1 is a receptor for V E G F and acts as a co-receptor that enhances the function of V E G F  through VEGFR-2  (Zachary and Gliki, 2001).  Furthermore, VEGFR-2 has been shown to heterodimerize with VEGFR-1 (Kendall et al., 1996). We therefore chose to rely on a strategy that allowed us to specifically activate VEGFR-2 with a chemical compound. The strategy we used allows us to study the unique signalling properties of VEGFR-2,  without any interference from other  endogenous V E G F receptors, allowing us to exclude the effects of neuropilin, or heterodimerization with VEGFR-1. The strategy we used to study VEGFR-2 signalling has recently been used to study the unique signalling effects of some hematopoietic receptors (flt-3, M P L , granulocyte-colony stimulating factor receptor, c-kit) (Jin et al., 1998a; Jin et a l , 2000;  76  Otto et al., 2001b). The biological effects triggered by those receptors have been studied by fusing the signalling domain of these receptors to an FK506 binding protein (FKBP) that can be specifically activated using synthetic FKBP ligands (Blau, 1999; Blau et al., 1997; Jin et al., 1998a; Jin et al., 1998b; Jin et al., 2000; Otto et al., 2001b; Richard et al., 2000). This system has permitted the demonstration that the  self-renewal  and  differentiation of hematopoietic progenitors can be influenced through distinct, receptorinitiated signalling pathways (Zeng et al., 2001). In this chapter, we used this inducible dimerization strategy to specifically study the biological effects of VEGFR-2  signalling on hematopoietic  progenitors. To  specifically study the unique signalling effects of VEGFR-2, we fused the cytoplasmic domain of this receptor, which contains the split tyrosine kinase domain, to a mutated FKBP 12 domain that harbours a phenylalanine to valine mutation at amino acid 36. Although other studies have shown the signalling effects of VEGFR-2 by using V E G F R 2 specific ligands, such as V E G F - E (Meyer et al., 1999), the use of a non-toxic chemical inducer of dimerization, AP20187 (Ariad Pharmaceuticals), allowed us to study with high specificity VEGFR-2 signalling pathways and biological effects in a cell autonomous manner. This strategy also allowed us to rule out any potential signalling effects that could be triggered by neuropilin-1, which acts as a co-receptor for V E G F , enhancing its binding to VEGFR-2 (Zachary and Gliki, 2001).  4.2 Results 4.2.1 Activation of VEGFR-2 delays loss of murine hematopoietic progenitors We cloned the intracellular domain of VEGFR-2 and fused it to a modified FKBP domain that can be specifically dimerized with a chemical inducer, AP20187 (Figure  77  12A). When transduced into HMEC-1 cells or murine bone marrow cells, this construct gave a 100 kDa protein (Figure 12B), which mainly localized to the cytoplasmic membrane when unstimulated (Figure 12C). Stimulation of HMEC-1 cells with 10 n M AP20187 for 0 to 30 minutes, resulted in progressive translocation of the fused VEGFR-2 construct from the cytoplasmic membrane to the cytoplasm. Phosphorylation of the construct was observed as early as 30 seconds after stimulation with 10 n M AP20187 in H M E C cells, and remained over a period of at least 30 minutes (Figure 12D).  78  A LTR j*  HlRE^r^GFPlm FKBP 12 • - Myristoylation signal •  V E G F R - 2 cytoplasmic domain  • - HA Epitope tag  B  $ 3 p110  HMEC-1  Bone marrow  Unstimulated  2Q min  Figure 12 MIG-FKBP/VEGFR-2 fusion construct. (A) The construct includes the intracellular domain of VEGFR-2 fused to a modified FKBP 12 domain. A hemagglutinin (HA) epitope tag was included at the C-terminus and a myristoylation sequence at the N terminus. (B) Immunoblotting of HMEC-1 and bone marrow cells demonstrates expression of a 110 kDa protein, consistent with the predicted size of the VEGFR-2 construct. (C) Immunofluorescent staining of HMEC-1 cells reveals that the fusion protein localizes mainly to the cytoplasmic membrane when unstimulated. Stimulation with 10 n M AP20187 resulted over a period of 30 minutes resulted in partial translocation of the fusion protein to the cytoplasm. (D) HMEC-1 cells were incubated with 10 nM AP20187 for 0 to 30 minutes. Phosphorylation of FKBP/VEGFR-2 fusion protein was determined by immunoblotting using an antibody specific to phosphorylated VEGFR-2 (Tyr 951). The membrane was reprobed with anti-HA antibody as a loading control. The fusion protein was detected in HMEC-1 cells using an anti-HA monoclonal antibody for both immunoblotting and immunofluorescence.  79  To investigate the effect of VEGFR-2 in hematopoietic cells, bone marrow from mice treated with 5-fluorouracil to activate bone marrow precursor cells was harvested and transduced with the VEGFR-2 fusion construct. As a control, the empty M S C V IRES-GFP (MIG) vector was used. After sorting, transduced G F P cells were plated in +  EMDM medium supplemented with 10% FBS with or without 100 n M AP20187, and cells were counted at days 5, 7 and 14. For all experiments, only transduced G F P cells +  were used. We found that the number of viable cells decreased rapidly in the absence of cytokines. However, in marrow cells in which the VEGFR-2 construct was dimerized by the addition of AP20187, we observed a smaller decrease in cell number (Figure 13A). After 2 weeks in culture, cell numbers in bone marrow control cultures were 2.5 fold lower than the ones in which VEGFR-2 was dimerized. This effect was not observed in VEGFR-2 transduced cells that did not receive AP20187, indicating that dimerization of VEGFR-2 is required for maintaining hematopoietic cell numbers. We next tested whether dimerization of VEGFR-2 had an additive effect on medium supplemented with hematopoietic cytokines that provide optimal growth conditions (Thorsteinsdottir et al., 1999). Transduced bone marrow cells were cultured in medium containing cytokines that are known to induce hematopoietic cell proliferation (IL-3, IL-6, SCF), with or without 100 n M AP20187 (Figure 13B). With these growth conditions, we did not observe any significant change when VEGFR-2 was dimerized in comparison to the control cells, suggesting that VEGFR-2 does not signal a proliferative or anti-apoptotic effect that is synergistic with these hematopoietic cytokines.  80  -i-MIG  80000  I MIG-FKBP/VEGFR-2  A MIG+AP20187 —3-- MIG-FKBP/VEGFR-2 +AP20187  5  B  10  15  Time (days)  800000  * 600000 |  400000  z 200000  5  10  15  Time (days)  Figure 13 VEGFR-2 maintains hematopoietic cell number. MIG or MIG-FKBP/VEGFR2-transduced bone marrow cells were incubated in IMDM supplemented with 10% FBS with or without 100 n M AP20187 in the absence (A) or the presence (B) of hematopoietic cytokines (IL-3, IL-6, SCF) for 0 to 14 days. Cells were harvested at specific time points as indicated and cell number was determined. Data represent the mean ± S E M of three independent experiments. * P O . 0 5 .  To test whether VEGFR-2 can preserve the viability and activity of hematopoietic progenitors in the absence of hematopoietic cytokines, VEGFR-2 and control cells were cultured in cytokine-free medium for 7 and 14 days with or without addition of dimerizer, after which cells were plated in methylcellulose medium to assay for hematopoietic  81  progenitors. We found that dimerization of VEGFR-2  maintained hematopoietic  progenitor potential in liquid culture to a certain extent. Over a 2-week period in culture, we observed an 8-fold decrease in the number of progenitors in control bone marrow cultures. In contrast, when the FKBP-VEGFR-2 construct was dimerized with AP20187, we observed a 3-fold increase in the maintenance of progenitors over control cultures, consistent with the findings in Figure 13 (Figure 14A). Although VEGFR-2 dimerization maintained the hematopoietic progenitor population for a period of two weeks in the absence of other cytokines, we did not observe a significant change in the proportion of different hematopoietic progenitors as measured by the C F C assay (Figure 14B). This result suggests that VEGFR-2 promotes hematopoietic cell survival and/or proliferation, but does not affect differentiation of hematopoietic progenitors.  82  50  CMIG  45 • MIG-FKBP/VEGFR-2  40  O LL.  o  35  • MIG+AP20187  30  n— O i— GJ -O  E  • MIG-FKBP/VEGFR-2  25  +AP20187  20 15 10 5 0  DayO  B Hi  100% 80% 60% 40% 20% 0%  I  •  III  MIG  •  CFU-Mix  •  BFU-E  •  CFU-GM  •  CFU-M  • CFU-G MIGFKBPA/EGFR-2  Day 7  MIG+AP20187  MIGMIGFKBP/VEGFR-2 FKBP/VEGFR-2 •AP20187  D a y 14 100% 80% 60% 40% 20% 0%  MMM MIG+AP20187  MIGMIGFKBP/VEGFR-2 FKBP/VEGFR-2 •AP20187  Figure 14 VEGFR-2 delays the loss of CFCs. Hematopoietic progenitors transduced with MIG- or MIG-FKBP/VEGFR-2 were grown in IMDM containing 10% FBS for 7 or 14 days, and then plated in complete methylcellulose medium to test for progenitor activity as measured by C F C number after 10 days (A). Dimerization of VEGFR-2 did not affect the proportion of different progenitors over time as measured by scoring for the type of colonies formed in the C F C assay (B). Data represent the mean ± S E M of three independent experiments. * PO.05.  S3  To  confirm that  VEGFR-2  can independently  maintain the  hematopoietic progenitor population, we utilized the CFU-Spleen  multipotent  (CFU-S12)  assay  following liquid culture of bone marrow cells for 7 days in cytokine-free medium. Colonies were enumerated in each of the spleens harvested 12 days following injection of bone marrow cells (Figure 15A). As seen in Figure 15B, VEGFR-2 dimerization resulted in a 5-fold increase in the proportion of  CFU-S12  cells, compared to bone control marrow  cultures. These results suggest that VEGFR-2 can maintain the activity and viability of primitive hematopoietic progenitors in the absence of other exogenous cytokines.  84  A  MIG  MIG-FKBP/VEGFR-2  Figure 15 VEGFR-2 dimerization maintains the number of multipotential bone marrow progenitors. Hematopoietic primitive myeloid progenitors cultured for 7 days in IMDM + 10%FBS, with or without AP20187, were injected into lethally irradiated B6C3 mice, and spleen colonies were counted after 12 days (A, B ) . Data represent the mean ± SEM of three independent experiments. * P<0.05.  4.2.2 VEGFR-2 does not increase S-phase entry in hematopoietic precursors It is known that, in endothelial cells, V E G F can induce cell proliferation. It has been suggested that this effect is mainly mediated through VEGFR-2 (Ferrara, 1999a). Moreover, we have demonstrated in the previous chapter that VEGFR-2 can induce proliferation of primary fibroblasts. We tested whether dimerization of VEGFR-2 also resulted in bone marrow cell proliferation, which could account in part for the delay in  85  the loss of hematopoietic progenitors that we observed. Bone marrow cells were grown in cytokine-free medium for 2 days, then exposed to BrdU with or without AP20187 for 2 hours. Cytospin preparations of cells were then labelled with an anti-BrdU antibody (Figure 16A). We found that dimerization of VEGFR-2 did not result in a greater proportion of cells which incorporated BrdU, indicating that VEGFR-2 signalling alone may not be sufficient to induce proliferation of hematopoietic progenitors (Figure 16B).  A  Figure 16 VEGFR-2 dimerization does not increase BrdU uptake in hematopoietic progenitors. MIG- or MIG-FKBP/VEGFR-2-transduced bone marrow cells cultured for 2 days in I M D M supplemented with 10% FBS were treated for 2 hours with 10 n M BrdU with or without 100 n M AP20187 and cytospin preparations were stained with an antiBrdU antibody conjugated with Alexa 594. DAPI staining was used to identify nuclei (A). The number of BrdU* cells were quantitated and expressed as a percent of total nuclei counted (B). 200-300 cells were counted per cytospin preparation. Data represent the mean ± S E M of three independent experiments.  86  4.2.3 VEGFR-2 activation reduces the number of apoptotic cells in hematopoietic precursors It has been shown that V E G F can induce anti-apoptotic signalling through PI3kinase in endothelial cells subjected to serum deprivation (Gerber et al., 1998b). Since we observed a delay in loss of progenitors when VEGFR-2 is dimerized, we postulated that this effect was caused by an inhibition of apoptosis since VEGFR-2 dimerization alone did not affect proliferation of hematopoietic progenitors. It has been shown that caspase 3 is present in hematopoietic precursor cells and is activated during apoptosis (Nicholson and Thornberry, 1997; Zermati et al., 2001). To test whether VEGFR-2 inhibits hematopoietic cell apoptosis, transduced bone marrow cells were subjected to cytokine deprivation, and incubated with or without AP20187 for 14 days. At this point, cytospins were made and stained for the activated form of caspase-3 (Figure 17A). We found that the proportion of apoptotic cells was 2-fold lower in bone marrow cells in which VEGFR-2 was dimerized compared to bone marrow control cultures (Figure 17B). Hence, inhibition of apoptosis through VEGFR-2 signalling would explain in part the maintenance of hematopoietic progenitors observed.  87  No A P 2 0 1 8 7  B  1100 n M A P 2 0 1 8 7  jfl 15  TJ > «J S 10 ffl "(fl  >0 a  o •  <<?  - « S? (A  c  5  n  a R  MIG  MIG-FKBP/VEGFR-2  Figure 17 VEGFR-2 dimerization inhibits apoptosis of cytokine-starved hematopoietic progenitors. Cytospin preparations of MIG- or MIG-FKBP/VEGFR-2-transduced bone marrow cells cultured for 14 days in I M D M containing 10% FBS with or without 100 nM AP20187 were stained with an anti-activated caspase 3 antibody. Nuclei were counterstained with DAPI (A). Cells with activated caspase 3 were quantitated and expressed as a percent of total cells counted ( B ) . 200-300 cells were counted per cytospin preparation. Data represent the mean ± S E M of four independent experiments. * P<0.05.  4.2.4 VEGFR-2 activates the P13-kinase and Erk M A P kinase pathways Since VEGFR-2 dimerization reduces the proportion of apoptotic cells, we examined signalling pathways known to be induced by V E G F in endothelial cells. In particular, the PI3-kinase/Akt and the M A P kinase pathways are both implicated in V E G F signalling and have potential roles in cell survival (Gerber et al., 1998b; Thakker et a l , 1999). To detennine the kinetics of activation of Akt and Erkl/2 by VEGFR-2,  88  endothelial cells transduced with MIG or MIG-FKBP/VEGFR-2 were starved overnight in medium supplemented with 5%FBS, and then treated with AP20187 for 0 to 60 minutes. Membranes were reprobed with total Akt or Erk as a loading control. Following dimerization of VEGFR-2, we found that both Akt and Erkl/2 were activated. Akt phosphorylation peaked between 10 and 20 minutes (Figure 18 A), whereas maximum Erk 1/2 phosphorylation was observed between 20 and 30 minutes (Figure 18B). Activation of Akt was biphasic, with a second peak of phosphorylation after 60 minutes (Figure 18 A). This biphasic activation of Akt in response to VEGFR-2 dimerization was observed in three independent experiments. We next checked whether the Akt and Erk 1/2 pathways were also induced in murine bone marrow cells. Transduced G F P bone +  marrow cells were incubated for 2 days in cytokine-free medium, then stimulated for 20 minutes with 100 nM AP20187. As with endothelial cells, we also observed activation of Akt (Figure 18C) and Erkl/2 (Figure 18D) in bone marrow following VEGFR-2 dimerization. Either of these kinases could account, at least in part, for the survival that we observed in response to VEGFR-2 dimerization, since induction of these signalling pathways by other hematopoietic cytokines, such as SCF and erythropoietin has been implicated in hematopoietic cell survival (Kinoshita et al., 1997; Liu et al., 1997; Sui et al., 2000).  89  H M E C MIG AP20187  0  5  10  20  30  60  min  P-Akt [ Total Akt  p59  H M E C MIGFKBP/VEGFR-2 AP20187 ._0  5  10  20  30  60  min  P-Akt  pp59  Total Akt  p59  B  HMEC MIG AP20187  0  5  10  20  30  60  min pp44 pp42  P-Erk I  • p44 • p42  Total Erk H M E C MIGFKBP/VEGFR-2 AP20187  0  5  10  20  30  60  min PP44 pp42  P-Erk  p44 p42  Total Erk MIG  FKBP/VEGFR2 f  AP20187 LY294002  + + - + -  +  -  •>  +  + • pp59  P-Akt Total Akt  -p59  MIG AP20187 U0126 P-Erk Total Erk  FKBP/VEGFR2  '- + + - - + t  pp44 pp42  i  Up44 r  p 4 2  Figure 18 VEGFR-2 dimerization activates Akt and Erkl/2 M A P kinases in hematopoietic progenitors. Quiescent HMEC-1 cells were incubated with 10 n M AP20187 for 0 to 60 minutes as indicated (A, B). Cytokine-starved MIG- or MIGFKBP/VEGFR-2-transduced bone marrow progenitors were treated for 20 minutes with 100 nM AP20187 (C, D). Phosphorylation of Akt (A, C) or Erkl/2 (B, D) was determined by immunoblotting using antibodies specific to phosphorylated Akt or Erkl/2. Lanes: 1,4: untreated; lanes 2,5: 100 nM AP20187 for 20 min; lanes 3,6: pretreatment with 20 LUM LY294002 (Akt) or 10 u M U0126 (Erk) for 90 min, then treated with 100 n M AP20187 for 20 min. Membranes were reprobed with anti-Akt or antiErkl/2 antibodies as loading controls. Data represent one experiment of three independent experiments showing similar findings.  90  To specifically study the above signalling pathways in mediating hematopoietic progenitor survival, we used specific inhibitors of each signalling pathway. LY294002 is an inhibitor of PI3-kinase, which activates Akt, while U0126 has been shown to block Erk 1/2 M A P kinase phosphorylation by specific inhibition of M E K (Davies et al., 2000). To determine whether VEGFR-2 mediated survival was mediated through Akt and/or Erkl/2, transduced G F P bone marrow cells were incubated with or without 100 n M +  AP20187 in the presence of the PI3-kinase inhibitor LY294002, or the M E K inhibitor U0126 at concentrations that blocked each of these kinases (Figure 18C, D). Cell number was monitored over a period of 14 days. We found that inhibition of PI3-kinase blocked the anti-apoptotic effect of VEGFR-2 dimerization induced by cytokine deprivation, indicating the essential role of this pathway in VEGFR-2-mediated survival in bone marrow cells (Figure 19A). Blockade of PI3-kinase also inhibited the survival of hematopoietic progenitors induced by VEGFR-2 dimerization (Figure 19B), further demonstrating the critical role of this pathway in survival of hematopoietic progenitors. In contrast, blockade of the M A P kinase pathway with U0126 did not inhibit VEGFR-2 induced cell survival (Figure 19C). Interestingly, despite minimal effect on cell survival, inhibition of Erkl/2 partially inhibited hematopoietic progenitor activity mediated by VEGFR-2 (Figure 19D). This discrepancy suggests that hematopoietic progenitors are more dependent  on the Erkl/2  M A P kinase pathway  for survival than more  mature/differentiated cells such as macrophages, which constitute the majority of cells present after 14 days in liquid culture (data not shown).  91  "  80000 -| 70000  -MIG  -A-MIG  -MIG+LY294002  -A-MIGHJ0126  -MIGMP20167  -6-MIG+AP20187  -MIGMP20187HY294002  -t-MIG+AP20187*U0126l - • - MIG-FKBP/VEGFR-2 -o-MIG-FKBP/VEGFR-2  •J 60000 a . 50000 O <- 40000 V g  30000  -MIG-FKBP/VEGFR-2  ^  20000  - MIG-FKBP/VEGFR-2 H Y 2 94002 MIG-FKBP/VEGFR-2 •AP20187  10000 0 5  10  - MIG-FKBP/VEGFR-2 •AP20187+LY294002  Time (days)  MIG  •  MIG  •  MIG-H.Y294002  •  MIG*U0126  •  MIG»AP20187  •  MIG+AP20187  B  MIG+AP20187+LY294002  •  MIG+AP20187+U0126  DI MIG-FKBP/VEGFR-2  El MIG-FKBP/VEGFR-2  D  El MIG-FKBP/VEGFR-2 •U0126  B  Day 14  •AP20187 - « - MIG-FKBP/VEGFR-2 •AP20187*110126  •  MIG-FKBP/VEGFR-2 •LY294002  Day 7  •U0126 -B-MIG-FKBPA/EGFR-2  MIG-FKBP/VEGFR-2 +AP20187  B  MIG-FKBP/VEGFR-2 •AP20187*LY294002  Fl MIG-FKBP/VEGFR-2 •AP20187 n  MIG-FKBP/VEGFR-2 •AP20187HJ0126  Figure 19 Effect of PI3-kinase or M E K inhibition on hematopoietic progenitor survival. MIG- or MIG-FKBP/VEGFR-2-transduced hematopoietic progenitors were cultured in IMDM supplemented with 10% FBS with or without 100 nM AP20187 in the presence or in the absence of 20 u M of the PI 3-kinase inhibitor, LY294002 (A, B), or the M E K inhibitor, U0126 (C, D), for 0 to 14 days. Cells were harvested at specific time points and cell number was determined (A, C). Cells were collected after 7 and 14 days and plated in methylcellulose medium to assay for hematopoietic progenitor activity (B, D). Data represent the mean ± S E M of three independent experiments. * P<0.05.  4.3 Discussion Although many studies postulate that V E G F mediates most of its effects through VEGFR-2, it is difficult to make a clear statement about this because of the complexity of the V E G F - V E G F R system. To specifically study the effects of VEGFR-2 signalling, we used a strategy that allowed the specific activation of the VEGFR-2 signalling domain by using a chemical inducer of dimerization. A similar strategy has previously shown that  92  the thrombopoietin (Tpo) receptor c-mpl can induce long term proliferation of murine hematopoietic progenitors, whereas the effects of flt-3 and G-CSFR are much more modest (Zeng et al., 2001). In this study, the VEGFR-2 construct was localized to the cytoplasmic membrane in unstimulated HMEC-1 cells, and translocated into the cytosol with concomitant phosphorylation following stimulation with AP20187, a phenomenon observed with many endogenous hematopoietic receptors. Interestingly, however, Otto et al. (Otto et al., 2001a) have shown that membrane localization of the thrombopoietin receptor, mpl, is not required for the full range of c-mpl function in hematopoietic cells. We were interested in the role of VEGFR-2 in hematopoietic progenitors since little is known about the effects of this receptor on hematopoiesis. In murine bone marrow, our results indicate that VEGFR-2 can maintain hematopoietic progenitor potential following dimerization, since cells fail to survive in the absence of AP20187. It is interesting to note that when hematopoietic progenitors were cultured in the presence of hematopoietic cytokines (IL-3, IL-6, SCF), there was no effect of VEGFR-2 dimerization on cell number. This would suggest that VEGFR-2 does not induce a proliferative signal in hematopoietic progenitors that is distinct from IL-3, IL-6 and SCF. Although Erkl/2 M A P kinase was activated, VEGFR-2 dimerization failed to induce proliferation of bone marrow progenitors, indicating that signals provided by other factors may be necessary for the proliferation of hematopoietic cells. It is likely then that the delay in cell loss observed through VEGFR-2 dimerization reflects an effect on cell survival. This was verified when we found that VEGFR-2 signalling decreased the fraction of apoptotic cells, when hematopoietic progenitors were cultured in the absence of exogenous cytokines.  93  The importance of cell survival in the maintenance of hematopoietic progenitors was further demonstrated by blocking the PI3-kinase pathway. This signalling pathway, through Akt, has been shown to play a crucial role in cytokine-mediated survival (Cantley, 2002; Gerber et al., 1998b), as well as in the self-renewal of primary multipotential hematopoietic progenitors (Zhao et al., 2002). Blockade of PI3-kinase completely abolished the maintenance of hematopoietic  progenitors mediated by  VEGFR-2, indicating that this pathway is critical for VEGFR-2 mediated survival in bone marrow progenitor cells. In contrast, we did not observe a significant effect on cell survival mediated by VEGFR-2 when the Erkl/2 M A P kinase pathway was blocked using the M E K inhibitor, U0126. This would imply that, although the Erkl/2 M A P kinase pathway has been shown to play a role in apoptosis prevention (Franklin and McCubrey, 2000), the PI3-kinase pathway through Akt is the main regulator of V E G F R 2-induced survival signalling in hematopoietic progenitors. However, it is noteworthy that inhibition of Erkl/2 activation did reduce the number of hematopoietic progenitors as measured by the C F C assay. This effect may be explained by the fact that most cells remaining after  14 days in culture in the absence of exogenous cytokines are  differentiated, and studies have shown that the cytokine-induced survival of differentiated cells, such as macrophages, is mediated mainly by the PI3 -kinase pathway and not the Erkl/2 M A P kinase pathway (Jaworowski et al., 1999; Xaus et al., 2001). Thus, this may indicate that hematopoietic progenitors are more dependent on the Erkl/2 M A P kinase pathway for VEGFR-2-induced survival than more mature cells. Although VEGFR-2 signalling promoted survival of hematopoietic progenitors and maintained their progenitor potential, it did not seem to affect the differentiation of  94  those progenitors. In contrast, other hematopoietic  c y t o k i n e receptors, s u c h as m p l ,  i n d u c e a dramatic e x p a n s i o n o f multipotential progenitors a n d m e g a k a r y o c y t e s ( R i c h a r d et a l . , 2000; Z e n g et a l . , 2001). A recent study has demonstrated that a c o m b i n a t i o n o f signals, J A K 2 p l u s either c-kit o r flt-3 together c a n support extensive hematopoietic progenitor c e l l self-renewal even t h o u g h neither o f these receptors c a n sustain the g r o w t h o f b o n e m a r r o w cells alone ( Z h a o et a l . , 2002). W h e t h e r V E G F R - 2 requires additional signals to i n d u c e c e l l p r o l i f e r a t i o n i n hematopoietic cells r e m a i n s u n k n o w n a n d further studies w o u l d b e needed to assess this issue. T h e strategy u s e d i n the present study a l l o w e d us to demonstrate that V E G F R - 2 can activate the PI3-kinase a n d E r k l / 2 pathways, without interaction w i t h other V E G F receptors s u c h as the n e u r o p i l i n s o r V E G F R - 1 , i n hematopoietic progenitors. T h e s e results s h o w that V E G F R - 2 c a n i n d u c e maintenance o f h e m a t o p o i e t i c progenitors i n the absence o f e x o g e n o u s hematopoietic cytokines. T h i s m a y help to e x p l a i n , at least i n part, the critical role o f V E G F R - 2 not o n l y i n e m b r y o n i c hematopoiesis, but also i n adult hematopoiesis, b o t h n o r m a l a n d malignant.  95  Chapter 5  Activation of VEGFR-2 in bone marrow cells leads to accumulation of myeloid cells in vivo: role of GM-CSF  96  5.1 Introduction V E G F may play an important role in the development of haemopoietic cells, but available data do not provide a definitive answer to this question. For example, although murine embryos with inactivating VEGFR-2 mutations remain 'bloodless' it is unclear if this is due to a primary stem cell defect or defective vascularization and blood island formation (Shalaby et al., 1997). In addition, it has been reported that V E G F and SCF costimulate the development of common precursors for primitive and definitive murine haemopoiesis (Kennedy et al., 1997a) and that V E G F is essential for the reconstitution of hematopoiesis in lethally irradiated animals (Gerber et al., 2002). VEGFR-2 is expressed on a significant proportion of normal and malignant hematopoietic cells.  Moreover, it has been shown that pluripotent hematopoietic stem  cells are restricted to the CD34 VEGFR-2 cell fraction in human cells (Ziegler et al., +  +  1999). However, it has also been reported that neither VEGFR-2 CD34 +  VEGFR-2 CD34 +  +  low/  " cells nor  cells have long-term reconstitution capacity in mice (Haruta et al.,  2001). Hematopoietic  malignancies  often  result from impaired control of early  hematopoietic stem cell survival, proliferation and self-renewal. V E G F is expressed in cell lines derived from various hematological malignancies (Bellamy et al., 1999). R N A for both V E G F receptors have been detected in some but not all hematopoietic malignancies (Bellamy et al., 2001; Fiedler et al., 1997; Padro et al., 2002). In addition, several reports have documented inhibitory effects by various classes of small molecule inhibitors targeting VEGFR-1 and VEGFR-2 on the growth of human myeloid leukaemia cell lines and in acute myeloid leukaemia blasts independently of their effects on  97  angiogenesis (Mesters et al., 2001). Moreover, Dias et al. have shown that neutralisation of human VEGFR-2 with specific monoclonal antibodies prolonged survival in mice xenotransplanted with human V E G F R - 2  +  leukemic cell lines (Dias et al., 2001).  Therefore, understanding the effects of V E G F and its receptors on hematopoietic cells will prove essential for the development of new therapies targeting the growth of hematopoietic malignancies. Most groups studying the effects of V E G F signalling in normal and malignant hematopoietic cells have used strategies to block V E G F signalling by using either blocking antibodies or small molecule kinase inhibitors. In the present study, we have used the opposite approach by activating VEGFR-2 in normal bone marrow cells, and investigating its effects on hematopoiesis.  By using the VEGFR-2 fusion protein  mentioned in the previous chapter, we studied the hematopoietic effects that arise when VEGFR-2 is expressed and activated in a relatively large proportion of hematopoietic cells in vivo. AP20187 is well tolerated in vivo, which allows its use in studying specific signalling pathways, and evaluate its potential use in therapeutic strategies. We examined bone marrow progenitors and the proportion of mature hematopoietic cells in the blood and bone marrow of mice following VEGFR-2 activation. Furthermore, we also looked at the expression of some hematopoietic growth factors triggered by VEGFR-2 and their potential role in mediating VEGFR-2 effects.  98  5.2 Results 5.2.1 Activation of VEGFR-2 induces expansion of bone marrow myeloid cells Although VEGFR-2 plays a critical role in the formation of the hematopoietic system, its role in adult hematopoiesis remains unclear (Gerber and Ferrara, 2003). V E G F and its receptors have been reported to be expressed in a variety of hematopoietic malignancies, and such expression is usually associated with poor prognosis (Verstovsek et al., 2003). We have demonstrated in the previous chapter that VEGFR-2 dimerization in murine bone marrow results in hematopoietic progenitor survival in vitro. To investigate the role of VEGFR-2 activation in in vivo, murine bone marrow was transduced with the MIG-FKBP-VEGFR-2 construct, which can be dimerized with the chemical inducer of dimerization AP20187. The empty vector M I G was used as control. We have previously demonstrated that the MIG-FKBP-VEGFR-2 construct is signalling-competent when stimulated with AP20187 in vitro, and can induce biological responses in murine bone marrow cells. Transduced bone marrow was used to transplant lethally irradiated B6C3 mice. Four to six weeks after transplantation, bone marrow and peripheral blood were obtained from mice to determine baseline engraftment of transduced cells (based on GFP expression). Following this, mice were injected in the peritoneal cavity with 10 mg/kg/day AP20187 or vehicle (4% EtOH, 10% PEG-400, and 1.7% Tween 20 in water) for 10 days, after which they were sacrificed. Peripheral blood and bone marrow were harvested and the proportion of G F P cells was determined by +  flow cytometry. To confirm that the cells which express the FKBP-VEGFR-2 construct were indeed G F P , cells from the bone marrow were stained with LY5.1 and LY5.2 to +  confirm the donor/recipient origin of the bone marrow cells. We found in a typical  99  experiment that >90% of GFP" cells were LY5.1", and therefore recipient-derived, which therefore implies that the vast majority of GFP" cells do not express the FKBP-VEGFR-2 construct in the FKBP-VEGFR-2-transplanted animals. We observed, on average, a 3.5-fold increase in the proportion of G F P cells in +  the bone marrow of the mice in which the VEGFR-2 construct was dimerized with AP20187 (Figure 20). By contrast, no significant changes were observed in the proportion of G F P cells in the peripheral blood of these mice. Mice in which VEGFR-2 +  was not dimerized (mice that were transplanted with empty vector bone marrow or received vehicle) did not show any changes in the proportion of G F P cells in either bone +  marrow or peripheral blood.  0  i marrow  4.5  1 * £ 3.5  a  3"  S  2 •  • •  1.5 d  T  1 i  ^  1  Vocflw +AP2O107  5  t  o  FKBIW8GFR2  FK0FA/EGFR2 •AP2Q!fl7  Peripheral blood  14 0.  u-  0  1  1  fo  3  2  1 •!  0.  0  j  m  m  •  FKEP/VEGFR2  Vector  FKBPWEGFR2 •ARM 187  Figure 20 VEGFR-2 induces expansion of retrovirally transduced hematopoietic cells in vivo. Ratios of the proportion of G F P cells post-treatment relative to pre-treatment are shown for bone marrow (top panel) and peripheral blood (lower panel). Data ± S E M shows average of 8 to 10 mice per group. * P< 0.01. +  This result indicates that VEGFR-2  activation can elicit a marked expansion of  transduced hematopoietic cells in the bone marrow, but interestingly, this expansion of  100  G F P cells in the bone marrow does not translate into an increase in the proportion of +  G F P cells in the peripheral blood during the time frame of the experiment. +  We next determined the phenotype of cells responding to AP20187 in mice transplanted with MIG-FKBP-VEGFR-2-transduced marrow cells. AP20187 treatment did not result in significantly increased numbers of leukocytes or erythrocytes in the peripheral blood of mice transplanted with MIG-FKBP-VEGFR-2 (Table V). Table V Peripheral blood counts Red blood cell counts (xlO cells/L)  Mice  12  6.77 7.93 7.31 9.26  Vector Vector+ AP20187 FFBP/VEGFR-2 FKBP/VEGFR-2 + AP20187  ± ± ± ±  1.08 1.88 1.24 1.83  White blood cell counts (xl0 cells/L) 9  5.42 3.82 4.77 5.67  ± 0.90 ±0.46 ±0.91 ±0.34  Cells from bone marrow (Figure 21) and peripheral blood (Figure 22) of MIG or MIGFKBP-VEGFR-2 transplanted mice injected with AP20187 or vehicle for 10 days were stained for the myeloid markers CD l i b (monocyte/macrophage) and Gr-1 (granulocyte), lymphoid markers CD5 (T-cells) and B220 (B-cells) or an erythroid marker (Terll9) to determine whether VEGFR-2 activation affects the proportion of specific hematopoietic populations. VEGFR-2 dimerization induced a significant increase in the proportion of GFP  +  myeloid cells ( C D l l b  +  and Gr-1 ; 1.5-fold-increase on average) in the bone +  marrow of transplanted mice (Figure 21). It is interesting to note that when the percentage of cells of different subsets of the bone marrow (lymphoid, myeloid and erythroid) are added, the total exceeds 100% in the FKBP-VEGFR-2 transplanted mice stimulated with AP20187. This did not apply for any of the other subgroups tested. One possible explanation for this phenomenon lies in the fact that expression of some of the markers used is not absolutely restricted for the specific lineage for which it was tested.  101  For example, C D l l b is expressed on subsets of activated B and T lymphocytes, eosinophils and Natural Killer (NK) cells in addition to being expressed in mature and immature myeloid cells (Cabanas and Sanchez-Madrid, 1999). Moreover, B220 is expressed on dendritic cell precursors (Asselin-Paturel et al., 2001; del Hoyo et al., 2002) and monocyte precursors (Dannaeus et al., 1999) in addition to B lymphocytes. This could indicate that VEGFR-2 activation can affect, to a certain extent, the differentiation and expansion of immature cells, which have been shown to co-express lymphoid and myeloid markers (Lu et al., 2002). We also observed a moderate increase in the G F P proportion of myeloid cells +  compared to the GFP" population in the peripheral blood (Figure 22), but this increase was not as marked as observed in the bone marrow. These results suggest that V E G F elicited myeloid expansion can be mediated solely through VEGFR-2 (Gabrilovich et al., 1998; Melani et al., 2003). However, VEGFR-2 activation did not significantly affect the levels of lymphoid or erythroid cells in the bone marrow or peripheral blood.  102  A  Vector  Vector + AP20187  FKBP/VEGFR2 +AP20187  FKBP/VEGFR2  CDIIb  Gr-1  CD5  10 • ™ 10  4  HI  id  i r j  17 10r  1?.0£>%  0  B220  i' f :  id *r0  id  1  id  " KSSff  Ter119  iri  B  1 SO .J80  8,40  Am S 20  g 0io  *  trf  sif  ,J  ,rf  ,<f  i i i i SbixiJ  V  V+A  F  F*A  V  V*A  F  F«-A  1MI V  V*A  F  F+A  Figure 21 VEGFR-2 induces expansion of myeloid cells, but not of erythroid and lymphoid cells in the bone marrow. B6C3 mice transplanted with bone marrow transduced with either MIG or MIG-FKBP-VEGFR-2 were injected with vehicle or AP20187 for 10 days. Cells were harvested from bone marrow and labeled for specific myeloid (Gr-1, C D l l b ) , lymphoid (CD5, B220) or erythroid markers (Terll9). (A) Representative flow cytometry dot plots. (B) Average proportion of specific markers in the G F P and GFP" bone marrow populations post AP20187 treatment. Data ± S E M represents average of at least 5 mice per group. Legend: V=Vector; F=FKBP-VEGFR/2; A=AP20187. *P<0.05. +  103  A  Vector+AP20187  Vector  19 a % •  FKBP/VEGFR2 +AP20187  FKBP/VEGFR2  5.75%  19.5'  %  4.61%  CDIlb  11.13%  f  id  IIT FMT210O  id  id  5.32%  1.87  Gr-1  fiBHj^ d  id  to  3428% id  1-4 0 %  id  'd  ,«  ,d  id  id  id  1431%  CD5  B220  GFP  B  ja  GO  850 a 3 40  j. S 35 40  CD11b  u 30  25  ^20 810  T *  V*A  F  F+A  km CD5  I  50  30  § 2 0 o #  10 0  1  10 0.  < S V  S  M  I I 20  &30  V  V+A  F  F+A  5  5  V  V+A  F  F+A  V+A  F  F+A  B220  V  Figure 22 FKBP-VEGFR-2-transduced cells are not mobilized in the peripheral blood in response to AP20187. B6C3 mice transplanted with bone marrow transduced with either MIG or MIG-FKBP-VEGFR-2 were injected with vehicle or AP20187 for 10 days. Cells were harvested from peripheral blood and labeled for specific myeloid (Gr-1, CD lib) or lymphoid markers (CD5, B220). (A) Representative flow cytometry dot plots. (B) Average proportion of specific markers in the G F P and GFP" peripheral blood populations post AP20187 treatment. Data ± S E M represents average of at least 5 mice per group. Legend: V=Vector; F=FKBP-VEGFR/2; A=AP20187. * indicates a significant difference with # (P < 0.05). Groups marked with a # are not statistically different from other groups except those marked with an *. +  104  5.2.2 VEGFR-2 increases the proportion of myeloid progenitors in bone marrow To assess whether VEGFR-2 induces expansion of myeloid progenitors, bone marrow was harvested from AP20187 or vehicle-treated mice, and the GFP  and GFP"  populations were collected separately and plated in methylcellulose to quantitate myeloid progenitors. AP20187-induced VEGFR-2 dimerization produced an increase in bone marrow myeloid progenitors in both the G F P and GFP" populations (Figure 23). +  GFP-positive bone marrow  Vector  Vector +AP20187  FKBP/VEGFR2  FK8P/VEGFR2 +AP20187  Vector  Vector +AP20187  FKBPA/EGFR2  FKBPA/EGFR2 +AP20187  Figure 23 VEGFR-2 induces expansion of bone marrow myeloid progenitors in vivo. B6C3 mice transplanted with bone marrow transduced with either MIG or MIG-FKBPVEGFR-2 were injected with vehicle or AP20187 for 10 days. Bone marrow was harvested, sorted for GFP expression, and the G F P and GFP" cells were plated in methylcellulose supplemented with cytokines (SCF, IL-3, IL-6 and Erythropoietin) for colony assays. Colonies were enumerated after 10 days. Data ± S E M represents average of 6 independent experiments. * P < 0.05. +  The fact that we did not observe any increase in the proportion of Gr-1 or CD1 l b cells +  +  in the GFP" population, whereas we observed an increase in myeloid progenitors, which  105  are Gr-1 and/or C D l l b , may be due to the low proportion of progenitors in the bone +  +  marrow. Therefore, an increase of progenitors would not be reflected in the proportion of CDllb  +  and Gr-1 cells in the bone marrow. Surprisingly, the expansion of GFP" +  progenitors was even greater than the one observed in the G F P population. Since GFP" +  cells do not express the FKBP-VEGFR-2 construct (over 85% of GFP" cells were Ly5.1" in a typical experiment, and therefore recipient-derived; data not shown) and do not respond to AP20187, it is likely that VEGFR-2 dimerization in the G F P cells induced +  expression of a factor that can positively modulate myeloid progenitor expansion in the GFP" population, indicating that VEGFR-2 activation can promote myelopoiesis in part through a paracrine mechanism.  5.2.3 VEGFR-2 activation induces GM-CSF expression and secretion To identify the potential paracrine factor in VEGFR-2-mediated hematopoietic effects, semi-quantitative RT-PCR was performed on murine bone marrow cells to detect the effect of VEGFR-2 activation on the mRNA levels of various growth factors and cytokines known to modulate hematopoiesis. Among these, we assayed for expression of cytokines such as stem cell factor (SCF), Flt-3-ligand, interleukin-6 (IL-6), macrophagecolony stimulating factor (M-CSF), GM-CSF, thrombopoietin (Tpo) and V E G F . We also examined the expression of Notch ligands, Delta-1, Delta-4 and Jagged-1, and the bone morphogenetic proteins, BMP-2 and BMP-4, which are known to modulate myelopoiesis. After retroviral transduction, bone marrow cells were sorted for GFP expression, plated in cytokine free-medium and stimulated with 100 n M AP20187 for 1 hour, after which R N A was harvested and processed for RT-PCR (Figure 24).  106  J  A  GM-CSF SCF M-CSF Tpo Flt3-ligand VEGF IL-6 BMP-4 Delta-1 Delta-4 Jagged-1 GAPDH  B  LM i -L& , r-  •  • III V  V+A  F  F+A  • i l l V  V+A  F  F+A  I I I I V  • V  V+A  F  V+A  F  F+A  III  F+A  F + A  Figure 24 Effects of VEGFR-2 activation on expression of hematopoietic factors in murine bone marrow cells. (A) Bone marrow cells transduced with MIG or MIG-FKBPVEGFR-2 were incubated with or without 100 n M AP20187 for 60 minutes. R N A was harvested, and RT-PCR was performed using primers specific for mouse hematopoietic factors. (B) Densitometric analysis of RT-PCR results, normalized to GAPDH. Data ± SEM represents average of 3 independent experiments. Legend: V=Vector; F=FKBPVEGFR/2; A=AP20187. * P < 0.05.  VEGFR-2 activation did not induce any changes in the levels of expression of the Notch ligands or BMP-4. BMP-2 could not be detected in any of the bone marrow R N A  107  samples. However, among the cytokines tested, we found that VEGFR-2 dimerization induced a significant increase of GM-CSF at the mRNA level (2.5-fold), whereas it did not significantly affect the levels of the other cytokines tested. To determine whether GM-CSF was also up-regulated at the protein level, we collected supernatant from transduced bone marrow cells stimulated with AP20187  for 48  hours. Protein  concentration determined by ELISA demonstrated a significant increase of G M - C S F protein in the medium of cultured bone marrow cells when VEGFR-2 is activated in the presence of AP20187 (Figure 25A). These results confirm that V E G F , through V E G F R 2, is able to stimulate cells in the bone marrow to up-regulate GM-CSF. To determine whether AP20187-induced VEGFR-2 activation can increase levels of GM-CSF in vivo, levels of GM-CSF were assayed in serum and found to be significantly increased when VEGFR-2 was dimerized in vivo compared to control mice (Figure 25B).  108  A  Vector  Vector +AR20187  Vector  Vector +AP20187  FKBP/VB3FR2  FKBP/VEGFR2 +AP20187  B  FKBP/VEGFR2  FKBPA/EGFR2 +AP20187  Figure 25 VEGFR-2 dimerization increases expression of G M - C S F at the protein level in murine bone marrow in vitro (A) and in vivo (B). (A) Bone marrow cells transduced with either M I G or MIG-FKBP-VEGFR-2 were incubated in the presence of 100 n M AP20187. Cell supernatant was harvested after 48 hours. (B) Serum was collected from mice transplanted with MIG or MIG-FKBP-VEGFR-2 which had been stimulated for 10 days with or without 10 mg/kg/day AP20187. Data ± S E M represents average of 3 independent experiments (A) or 5 mice per group (B). * P < 0.05.  To determine whether GM-CSF was primarily responsible for the VEGFR-2induced paracrine effects on hematopoietic progenitors, we tested whether blocking the activity of G M - C S F was sufficient to abolish VEGFR-2-induced paracrine activity on hematopoietic progenitors. Bone marrow cells transduced with either M I G or MIG-  109  FKBP-VEGFR-2 were co-cultured with untransduced primary bone marrow at a 1:1 ratio, with or without AP20187, in the presence or absence of a blocking GM-CSF antibody (1 ug/ml) and the following cytokine combination: Flt3-ligand (1 ng/ml), SCF (10 ng/ml) and IL-11 (1 ng/ml). After 10 days, cells were sorted based on GFP expression. The proportion of G F P  +  cells in the cultures after 10 days revealed that  VEGFR-2 activation could expand transduced cells in the presence of the above cytokines as there was a 1.32±0.20-fold increase in the proportion of G F P cells relative +  to the GFP" cells in the FKBP-VEGFR-2+AP20187 cultures (data not shown). It is interesting to note that the addition of the GM-CSF blocking antibody could partially block VEGFR-2-mediated expansion of transduced cells as we observed only a 1.1±0.1fold increase in the proportion of G F P cells in the FKBP-VEGFR-2+AP20187+GM+  CSF blocking antibody cultures. In contrast, the GM-CSF blocking antibody in untreated cultures or cultures transduced with the empty vector did not affect the proportion of GFP  +  cells.  These results  suggest that VEGFR-2  has the potential to expand  hematopoietic cells in the presence of Flt3-ligand, SCF and IL-11. This effect was not observed in the presence of IL-3, IL-6 and SCF (chapter 4, Figure 13B). The fact that blocking GM-CSF partially inhibited the expansion of transduced cells suggests that this cytokine may play a role in VEGFR-2-mediated cell expansion. G M - C S F up-regulation may also help explain why VEGFR-2 activation did not affect cell expansion in the presence of IL-3, IL-6 and SCF while it did in the presence of Flt3-ligand, SCF and IL11. The redundancy between IL-3 and GM-CSF signalling, which share the common /3chain receptor signalling unit (Martinez-Moczygemba and Huston, 2003), may help explain why VEGFR-2 does not potentiate the expansion of hematopoietic cells when IL-  110  3 is present, while it could promote cell expansion in the absence of IL-3, through the release of GM-CSF. Activation of the /3-chain receptor signalling unit by IL-3 or G M CSF may therefore be necessary, but not sufficient since VEGFR-2 activation alone could not induce hematopoietic cell proliferation (Figure 13A), to induce hematopoietic cell proliferation. For each culture condition, the G F P  +  and GFP" populations were plated in  methylcellulose to assay progenitor activity. VEGFR-2 dimerization resulted in an increase in the number of progenitors in both the G F P and GFP" populations of bone +  marrow cells in the presence of the previously mentioned cytokines, indicating that VEGFR-2 signalling is not redundant with that of the specific cytokines in the assay medium (Figure 26).  Ill  GFP-positive  V+G  V+A  V+G+A  F  F+G  F+A F+G+A  GFP-negative 350  V  V + G  V + A  V + G + A  F  F + G  F + A  F + G + A  Figure 26 Blocking of GM-CSF inhibits VEGFR-2-induced expansion of myeloid progenitors. Transduced (GFP ) and untransduced (GFP") bone marrow cells were cocultured for 10 days with or without lOOnM AP20187 and/or 1 ng/ml G M - C S F blocking antibody or isotype control. After 10 days, G F P and GFP" cells were separated by FACS and plated in methylcellulose medium for progenitor assays. Data ± S E M represents average of 3 independent experiments. Legend: V=Vector; F=FKBP-VEGFR/2; G=GMCSF blocking antibody; A=AP20187. * Indicates a significant difference with other treated cultures (P < 0.05), except for the one marked with &#(P- 0.17). Group marked with # is not significantly different from other treated cultures. +  +  However, addition of the GM-CSF blocking antibody resulted in a significant reduction (P = 0.031) in the number of progenitors in the GFP" cells co-cultured with VEGFR-2-transduced cells in the presence of AP20187, indicating that GM-CSF is responsible at least in part for the increase in the number of progenitors observed when  112  VEGFR-2 is dimerized. Although blocking GM-CSF also decreased the number of progenitors in the G F P population when VEGFR-2 was dimerized, this decrease was not +  as marked as the one observed in the GFP- population and was not found to be statistically significant (P = 0.17), which suggests that VEGFR-2 can promote expansion of myeloid progenitors through other mechanisms, in addition to up-regulating GM-CSF. The findings suggest that VEGFR-2 promotes myeloid progenitor activity to a certain extent in a cell autonomous manner, independent of GM-CSF. A n alternate explanation may be that G F P cells are in part stimulated by GM-CSF through an internal private +  autocrine loop, which has been reported (Lang et al., 1987; Young and Griffin, 1986).  5.3 Discussion VEGF  and its  receptors  are expressed  in both normal and malignant  hematopoietic cells. Although the mechanisms by which V E G F regulates hematopoiesis remain to be further elucidated, recent data have shown that V E G F can have profound effects on hematopoiesis. V E G F can inhibit dendritic cell development and increase the production of B cells and the generation of immature myeloid cells (Gabrilovich et al., 1998; Hattori et al., 2001). Moreover, it has been shown that VEGF-deficient bone marrow cells fail to repopulate lethally irradiated hosts, and also fail to form colonies in vitro (Gerber et al., 2002). Since subsets of hematopoietic cells express VEGFR-1 and VEGFR-2, it can be difficult to identify the respective role of each receptor, and how they can specifically mediate V E G F effects. Using a strategy that allowed us to specifically activate VEGFR-2, we have demonstrated in the previous chapter that VEGFR-2 was able to mediate hematopoietic progenitor survival in vitro by activating  113  the PI3-kinase pathway. Here, we demonstrate that VEGFR-2 activation in bone marrow cells elicits the expansion of myeloid cells in vivo. After a 10 day-regimen of AP20187, there was a net increase in the proportion of C D l l b  +  and Gr-1 cells in the G F P +  +  population of the bone marrow of FKBP-VEGFR-2-transduced mice. The GFP" population of these mice did not display changes in the proportion of C D l l b and Gr-1 +  +  cells. However, when we examined at level of myeloid progenitors, we observed a different trend, such that the cells of the GFP" population had a marked increase in progenitor activity when VEGFR-2 was dimerized. Proteins that could potentially act in a paracrine manner to promote myelopoiesis include ligands that activate the Notch pathway (Bigas et al., 1998; Jonsson et al., 2001; Schroeder et al., 2003; Ye et al., 2004), the bone morphogenetic proteins (Zon, 2001), and the hematopoietic cytokines SCF, Flt3-ligand, IL-6, M-CSF and GM-CSF (Barreda et al., 2004). O f all the hematopoietic factors examined, we found that VEGFR-2 only upregulated G M - C S F in bone marrow cells. Dimerization of the FKBP-VEGFR-2 construct in murine endothelial cells also upregulated GM-CSF (data not shown), suggesting that the hematopoietic effects of V E G F in vivo, may include stromal regulation of cytokines. G M - C S F has pleiotropic and widespread effects on hematopoietic cells, and exhibits overlapping activities on hematopoietic progenitors with other cytokines including M-CSF, G-CSF, IL-3, IL-6 and SCF (Barreda et al., 2004). Our data suggest that VEGFR-2-induced upregulation of G M CSF is a significant paracrine mechanism in the proliferation of myeloid progenitors. It is worthwhile mentioning that VEGFR-2-induced up-regulation of G M - C S F may also occur through an indirect mechanism. GM-CSF is normally secreted by subsets of T lymphocytes, fibroblasts, vascular endothelial cells and mast cells (Gasson, 1991).  114  Cytokines such as IL-12 (Hou et al., 2003), V E G F (Zhang et al., 2004), T N F - a and IL-1/3 (Burg et al., 2002) have also been shown to up-regulate the expression of G M - C S F in T lymphocytes (IL-12) and endothelial cells of the bone marrow stroma (VEGF, T N F - a and IL-1/3) . Therefore, if VEGFR-2 activation increases production of those cytokines it is possible that cytokine-stimulated hematopoietic cells (T lymphocytes) or bone marrow stroma cells (endothelial cells) may account at least in part for the increased levels of GM-CSF. Although we confirmed that VEGFR-2 activation did not up-regulate V E G F , further testing will be required to determine whether VEGFR-2 can up-regulate other cytokines that may be implicated in the indirect expression of G M - C S F by bone marrow stroma cells. The paracrine activity of GM-CSF on hematopoietic progenitors cannot, however, explain all the effects that VEGFR-2 has on hematopoiesis. The observation that blockade of G M - C S F did not inhibit expansion of progenitors expressing VEGFR-2 significantly suggest that VEGFR-2 also has a direct effect on the expansion of myeloid progenitors, which could be due in part to VEGFR-2-dependent increased survival. It could also indicate that G M - C S F can stimulate V E G F R - 2 progenitors via an internal +  autocrine loop. Such an autocrine loop has previously been described for G M - C S F (Lang et al., 1987; Young and Griffin, 1986). Furthermore, it is also possible that VEGFR-2 can up-regulate molecules we did not test for. Such molecules may include other hematopoietic cytokines (IL-1/3, IL-3, IL-5, IL-11) (Krishnaswamy et al., 1999; Mangi and Newland, 1999; Mordvinov and Sanderson, 2001) or signalling molecules (sonic hedgehog, wnt) (Bhardwaj et a l , 2001; Yamane et al., 2001). Up-regulation of some of  115  these molecules could potentially account for some of the VEGFR-2-induced effects on myeloid cells. We observed that VEGFR-2 activation increased the proportion of Gr-1 and +  CD1 l b cells in the G F P population of the bone marrow but not in the GFP" population, +  +  whereas the increase in progenitors was more marked in the GFP" population than the G F P population. It therefore appears that, in the G F P population, VEGFR-2 signalling +  +  in combination with G M - C S F drives the rapid expansion and differentiation of myeloid progenitors, whereas in the GFP" population, the progenitors show increased self-renewal accompanied by a more modest cell expansion. Since we have previously shown that VEGFR-2 by itself cannot induce proliferation of hematopoietic progenitors, it is likely that V E G F acts synergistically with other hematopoietic growth factors to promote expansion and differentiation of hematopoietic progenitors. Since VEGFR-2 activation upregulates GM-CSF, VEGFR-2 autocrine signalling combined with G M - C S F could drive the rapid expansion of myeloid cells in the G F P population. Although no data +  exists on synergistic signalling between GM-CSF and V E G F , both V E G F (Gerritsen et al., 2003; Xin et al., 2001) and GM-CSF (Lennartsson et al., 2004; Miyazawa et al., 1991; Piacibello et al., 1995) have been shown to synergize with other cytokines. G M CSF signals through the recruitment and the activation of Janus kinase (JAK)-2 and signal transducers and activators of transcription (STAT)-3 and -5 (Lehtonen et al., 2002; Valdembri et al., 2002). The JAK/STAT pathway is involved in embryonic stem cell selfrenewal and has been hypothesized to be an important hallmark of self-renewal capabilities in general (Bruno et al., 2004; Ramalho-Santos et al., 2002). G M - C S F can act synergistically with SCF, whose receptor c-Kit is part of the same receptor family as  116  VEGFR-2, to promote the growth and differentiation of primitive hematopoietic cells (Lund-Johansen et al., 1999). It is therefore possible that the signals provided by VEGFR-2, which activates the M A P kinase and PB-kinase pathways, complement those generated by G M - C S F to drive the rapid expansion and differentiation of myeloid progenitors. This could account, at least in part, for the differences observed in the proportion of bone marrow Gr-1 and C D l l b +  +  cells observed between the G F P  +  population and the GFP" population. Increased accumulation of immature myeloid cells and C D l l b  +  macrophages in  the bone marrow, lymphoid organs and spleens of mice implanted with tumours that secrete V E G F has previously been reported (Melani et al., 2003; Young et al., 1987). More recently, increased production of a more defined population of G r - l / C D l l b +  +  immature myeloid cells has been described in several mouse tumour models (Bronte et al., 2000; Kusmartsev et al., 2000). Increased production of these cells might be triggered by different soluble tumour-derived factors such as V E G F , GM-CSF, M-CSF, IL-6 and IL-10 (Kusmartsev and Gabrilovich, 2002). Treatment of mice with V E G F resulted in dramatic accumulation of Gr-1 cells in peripheral lymphoid organs (Gabrilovich et al., +  1998). Similarly, in a preliminary study, we observed that VEGFR-2 induced a marked increase in the proportion of Gr-1 and CD1 l b cells in the bone marrow and spleen (data +  +  not shown) of transplanted mice. These effects are likely to be the result of VEGFR-2 signalling in hematopoietic cells and the subsequent increase in production of GM-CSF. The contribution of G M - C S F might be essential in this process, since blocking GM-CSF signalling inhibited the expansion of myeloid progenitors in cells not expressing V E G F R 2.  117  It has been demonstrated that VEGFR-2 is expressed in A M L , and that blockade of VEGFR-2 signalling can inhibit human leukaemia growth in an animal model (Dias et al., 2001; Fiedler et a l , 1997). In light of the results we present here, it is possible that VEGF-induced autocrine and paracrine stimulation has the potential to induce rapid expansion of leukemic blasts expressing VEGFR-2. VEGFR-2 activation in leukemic cells could drive upregulation of GM-CSF, which could in turn synergize with V E G F signalling to drive rapid leukemic cell expansion. It will therefore be of interest to further study the effects of VEGFR-2 in both normal and malignant hematopoietic cells.  118  Chapter 6  Implication of bone marrow-derived cells in tumour neovasculature formation  119  6.1 Introduction Until  recently,  tumour vasculature was  thought  to  arise solely through  angiogenesis, a mechanism by which new blood vessels form from pre-existing vessels through endothelial cell migration and proliferation (Ruoslahti, 2002). However, recent studies have provided evidence that tumour neovasculature can also arise though vasculogenesis, a process by which endothelial progenitors are recruited and differentiate in situ into mature endothelial cells to form new blood vessels (Reyes et al., 2002). Evidence for the existence of such endothelial progenitors has come from studies demonstrating the ability of bone marrow-derived cells to incorporate into tumour vasculature. However, the exact nature of such endothelial progenitors remains controversial. A population of endothelial precursors have been shown to exist among human peripheral blood, bone marrow and cord blood cells (Lin et al., 2000; Peichev et al., 2000). Moreover, expression of CD34, CD133 and VEGFR-2 on hematopoietic cells from bone marrow, peripheral blood or umbilical cord blood is usually associated with a population of endothelial progenitors (Peichev et al., 2000). When plated in culture in the presence of angiogenic factors such as V E G F or bFGF, endothelial progenitors become adherent and proliferate to form colonies of mature endothelial cells, which express markers such as von Willebrand factor (vWF), VE-cadherin, CD31 (PECAM-1) and can uptake acetylated L D L (Lin et al., 2000; Quirici et al., 2001). Additional studies have also reported that the  CD34" monocyte/macrophage-containing  mononuclear cell  population can differentiate into endothelial-like cells in vitro (Rehman et al., 2003). Because of the lack of definitive markers of endothelial progenitors, the in vivo contribution of endothelial progenitors to tumour neovascularization remains unclear.  120  Studies have reported that for some tumour types, about 90% of blood vessels are composed of bone marrow-derived endothelial cells (Lyden et al., 2001). However, other groups have reported that they were not able to observe any contribution of endothelial progenitors to the formation of tumour blood vessels (De Palma et al., 2003; Gothert et al., 2004b). This lack of consensus may be explained in part by different experimental settings such as the type of cells used to transplant animals (whole bone marrow vs purified primitive stem cells), tumour type, the time frame ofthe experiment, methods of endothelial cell identification and the propensity of different models to induce cell fusion. In this chapter, the existence of a potential hemangioblast was examined both in vivo and in vitro. For in vivo experiments, models of bone marrow transplants were used to quantify the proportion of bone marrow-derived cells incorporating into tumour vasculature. Moreover, we used different transplant settings to determine whether endothelial progenitors are derived from primitive hematopoietic stem cells and arise by differentiation. We also looked at the effects of V E G F and VEGFR-2 activation in hematopoietic cells to examine whether it could promote the recruitment of bone marrow-derived cells in tumour blood vessels. Since the incorporation of endothelial progenitors in tumour vasculature was found to be such a rare event, we determined the proportion of endothelial progenitors in different subsets of mononuclear cells using a differentiation assay.  121  6.2 Results 6.2.1 Determination ofthe existence of bone marrow-derived endothelial cells To quantify endothelial progenitor activity in vivo, chimeric mice reconstituted with G F P bone marrow were generated. To determine the presence of bone marrow+  derived endothelial cells in GFP-transplanted mice, they were implanted with tumour cells (B6RV2 lymphoma) sub-cutaneously in the dorsal area. Ten days post-implantation, mice were sacrificed and blood vessels were analyzed in tumour tissue sections by fluorescence microscopy. Endothelial cells were detected using antibodies against CD31 or VE-cadherin. Most studies examining the contribution of bone marrow-derived cells have used either CD31 or vWF (Bailey et al., 2004; Lyden et al., 2001). However, although both are strongly expressed in endothelial cells, they are also expressed on subsets of hematopoietic cells such as monocytes/macrophages (CD31), granulocytes (CD31) and platelets (vWF, CD31) (Newman, 1997; Rugged, 2003). Since leukocytes and platelets can be found in close association with the vascular wall, it may be difficult to differentiate  vWF  +  or CD31  +  bone marrow-derived leukocytes  from tumour  endothelial cells, thereby leading to incorrect identification of bone marrow-derived endothelial cells. In order to avoid such misinterpretation, we also used VE-cadherin, which is specific to vascular endothelial cells (Vincent et al., 2004), to stain blood vessels. To account for different levels of G F P cell engraftment in transplanted animals, +  results were normalized for the proportion of G F P cells in the peripheral blood of the +  mice at the time of sacrifice. Between 300 and 500 blood vessels per section were counted, and 3 sections per tumours were quantified. G F P bone marrow-derived cells +  could be detected in tumour blood vessels, although at a very low frequency. Figure 27A  122  displays some representative images of CD31 and VE-Cadherin blood vessels which +  +  contained at least one bone marrow-derived cell. Since macrophages can reside in close contact with blood vessels, and could therefore be misinterpretated as endothelial cells, tumour slides were co-stained with both the  monocyte/macrophage  marker C D l i b  and VE-cadherin  to  avoid  such  a  misinterpretation (Figure 27B). Double staining for VE-cadherin and C D l l b was not observed in G F P  +  bone marrow-derived cells in the vessels walls, ruling out the  possibility of macrophages being misinterpreted as endothelial cells, and thereby confirming the presence of bone marrow-derived endothelial cells in B6RV2 tumours.  123  A  CD31  >^  CD31  VE-Cadherin  ^  VE-Cadherin  k  V  ft \ -  1  m  •  -S  VE-Cadherln+CDilb  B  h >*"'  "Six, Jn^.  VE-CadheriiHCDIIb  . If  •  y  \  •% Jt  J  •  ,  '•-4  4  *  '  \  .  * / *  P  i  *  \  VE-CadherirnCDIIb  VE-Cadherin-MZDIIb  Figure 27 Bone marrow derived endothelial cells incorporate into tumour vasculature. (A) Tumour sections (~8 urn) were stained with either CD31 or VE-cadherin (red) and were examined for the presence of bone marrow-derived cells (GFP , green) present as part of the blood vessels. DAPI was used to counterstain nuclei (blue). (B) To confirm the phenotype of bone marrow-derived endothelial cells, B6RV2 tumour sections were stained with CD1 lb labeled with PE (red) and VE-cadherin-Alexa 350 (blue). +  We then quantified the relative contribution of bone marrow cells to the formation of B6RV2 blood vessels. As a source of G F P bone marrow cells in transplanted animals, +  124  we either used cells obtained from G F P transgenic mice (Okabe et al., 1997) that were +  injected into lethally irradiated recipients immediately after harvesting (Figure 28A), or by harvesting bone marrow cells from C3Pep mice that were expanded ex vivo (2 days) before transduction with a retroviral vector encoding GFP (MIG) (Figure 28B).  A  2  CJ  u  1.8  > '55 o a.  1.6 1.4  • DL  LL.  1.2  JZ  1  O  w a cn cn a> >  0.8 0.6 0.4  TJ O 0.2 O  03  0 CD31  B  VE-Cadherin  8  2 > 1-8  1a.  16  a. 1.4 LL. 1.2  o s  1 0.8  85 o.6 in  5  2 o  T3  OQ  0.4 0.2 0  CD31  VE-Cadherin  Figure 28 Bone marrow-derived endothelial cells have a relatively small contribution to the formation of blood vessels in B6RV2 lymphomas. B6RV2 tumours were implanted sub-cutaneously in the dorsal area of B6C3 mice previously transplanted with G F P bone marrow from GFP transgenic donors (A) or with bone marrow transduced ex vivo with a GFP-encoding vector (MIG) (B). Data ± S E M represents the average of the quantification of 4 tumours per group. +  125  This approach allowed us to determine whether ex vivo culture of bone marrow cells can have deleterious effects on the endothelial progenitor pool potentially present in bone marrow cells. Contribution of bone marrow cells to the formation of tumour blood vessels was minimal. In both cases, less than 1% of B6RV2 blood vessels were found to have incorporated G F P bone marrow-derived endothelial cells. Ex vivo transduction of +  bone marrow cells prior to transplantation did not result in significant differences in the levels of tumour vasculature bone marrow-derived endothelial cells compared to mice transplanted with unmanipulated bone marrow cells, indicating that in vitro culture of bone marrow cells does not result in loss of endothelial progenitor activity within the time frame of this experiment.  6.2.2 Determination of the existence of an adult hemangioblast Bone marrow cells have been shown to be able to fuse with other cell types such as hepatocytes (Grompe, 2003) and this has lead some authors to believe that hematopoietic cells may not be as multipotent as once thought, since cell fusion could in fact be responsible for some of the reported plasticity of stem cells (Terada et al., 2002). Analysis of D N A content of bone marrow-derived endothelial cells in liver tissue has previously shown that they can arise by differentiation of bone marrow cells, and not by cell fusion (Bailey et al., 2004). However, D N A content analysis can be misleading, as fused cells have been shown to lose cellular D N A , which could potentially lead to inaccurate interpretation of results (Nowak, 1985; Pratt et al., 1992; Zheng et al., 1995). To determine whether the bone marrow-derived endothelial cells observed in B6RV2 tumours arise by differentiation or fusion, we used a strategy that allowed us to visually  126  determine cell fusion in mice. The following strategy was used: bone marrow cells were harvested from Z/AP double reporter transgenic mice. These mice express a transgene consisting of the lacZ gene flanked by two loxP sites (Lobe et a l , 1999). Therefore, bone marrow from these animals express the lacZ reporter gene before Cre-mediated excision occurs. Cre excision, however, removes the lacZ gene, allowing expression of the second reporter, the human alkaline phosphatase gene (hPLAP). To determine whether bone marrow-derived endothelial cells arise by fusion or differentiation, we transplanted bone marrow harvested from Z/AP mice into mice that constitutively express the Cre recombinase (pCX-NLS-Cre). Therefore, if bone marrow-derived endothelial cells result from differentiation of bone marrow cells, they will express the lacZ gene, and stain blue in the presence of X-gal reagent. However, if bone marrow cells fuse with endothelial cells from the recipient mice (PCX-NLS-Cre), the Cre recombinase will excise the lacZ gene, therefore allowing expression of the human alkaline phosphatase. Fused cells will therefore appear purple when stained for alkaline phosphatase with the NBT/BCEP reagent.  B6RV2 tumours harvested from PCX-NLS-Cre mice transplanted with bone  marrow harvested from Z/AP mice were cyosectioned and stained with X-gal (lacZ) and NBT/BCLP (hPLAP), followed by CD31 staining with diamino-benzidine (DAB) (Figure 29).  127  Figure 29 Bone marrow-derived endothelial cells arise by differentiation and not by cell fusion. (A) B6RV2 tumours were harvested from PCX-NLS-Cre mice transplanted with Z/AP bone marrow. Tumour sections were stained with X-gal (blue), NBT/BCIP (purple) and CD31 (brown). Arrows highlight stained bone marrow-derived endothelial cells. No NBT/BCIP cells were detected in the tumour sections examined. (B) As control for cell fusion, spleen sections were stained with NBT/BCIP. +  Since D A B produces a brown color that could potentially mask the purple color generated by NBT/BCIP, tumour sections were carefully examined after NBT/BCIP staining and before CD31 staining. In tumour sections obtained from 5 different animals, we were able to observe a rare proportion of blood vessels containing lacZ cells (Figure +  29A),  indicating that differentiation of bone marrow-derived endothelial precursors  contributes to the formation of tumour blood vessels. By contrast, no hPLAP endothelial +  cells were observed, allowing us to rule out cell fusion or engulfment of hematopoietic cells as a mechanism implicated in the generation of bone marrow-derived endothelial  128  cells. Since no hPLAP cells could be detected in tumour tissues, spleen sections from the +  same mice were stained with the NBT/BCIP reagent and used as a positive control (Figure 29B). Studies have suggested that, in the embryo, a single cell known as the hemangioblast can give rise to cells of both the hematopoietic and endothelial lineages. In adult bone marrow, however, the existence of the hemangioblast remains controversial. To determine whether adult bone marrow contains a hemangioblast, mice were transplanted with a single G F P hematopoietic stem cell as previously decribed (Corbel et +  al., 2003), and we examined whether it could give rise to G F P tumour endothelial cells. +  To confirm that single cells injected were indeed hematopoietic stem cells, their ability to reconstitute all blood lineages was tested. At various times after transplantation, 150 JX\ of peripheral blood was collected from the tails of recipients and red blood cells were lysed. Nucleated cells were stained with^ biotin-conjugated rat antibodies to IgG2a, IgG2b, B220, Gr-1 and Mac-1, followed by phycoerythrin-conjugated streptavidin (Caltag), and analyzed by flow cytometry. Animals with >15% G F P blood leukocytes (35%, 38% and +  48% G F P  +  blood leukocytes) and showing contribution of G F P  +  cells to all blood  lineages were chosen for further analysis and were implanted with either 5 x 10 L L C and 6  B6RV2 tumour cells. In extensive analyses of B6RV2 and L L C tumours from single cell transplanted mice, we found low numbers of blood vessels (around 1%) from either B6RV2 or L L C tumours that incorporated bone marrow-derived cells that stained positive for either CD31 or VE-cadherin (Figure 30).  129  B6RV2 "3  O  0  ^  $ 1.8 1 1.6 9-1.4  CD31  VE-Cadherin  Lewislungcarcinoma 1  2 % 1.8 I 1.6 I 1.4  T  VE-Cadherin  A single hematopoietic stem cell can give rise to endothelial progenitor cells that incorporate into tumour blood vessels. Tumours (B6RV2-upper panel; LLC-bottom panel) were implanted in the dorsal area of mice transplanted with a single GFP primitive hematopoietic stem cell. Tumour sections were quantified for the presence of GFP bone marrow-derived cells present into blood vessels stained with either CD31 or VE-cadherin. Data ± SEM represents the average of the quantification of 3 tumours per group. Figure 30  +  +  Interestingly, the proportion of bone marrow-derived endothelial cells incorporating into tumour blood vessels was similar to that of whole bone marrow transplants. The presence of bone marrow-derived endothelial progenitors that incorporated into the vasculature of  130  animals transplanted with a single hematopoietic stem cell indicates that primitive hematopoietic stem cells have the potential to give rise to endothelial cells in addition to hematopoietic cells, and may therefore represent a population of adult hemangioblasts.  6.2.3 Role of V E G F and VEGFR-2 in the mobilization and differentiation of bone marrow-derived endothelial cells V E G F is a potent inducer of both angiogenesis and vasculogenesis, and has been reported to mobilize V E G F R - 2 endothelial progenitors from the bone marrow (Hattori et +  al., 2001). To determine whether increased V E G F secretion by tumour cells could lead to an increase in the contribution of bone marrow-derived endothelial progenitors to the tumour vasculature, B6RV2 cells were transduced with a retroviral vector encoding the human  V E G F i  6  5  cDNA  (MSCVneo-VEGFi  6 5  ).  Human  V E G F i  6  5  has previously been  shown to be biologically active in mice (Redaelli et al., 2004; Yang et al., 2003). Tumour cells were implanted in the dorsal area of transplanted mice, and after 10 days were harvested, cryosectioned, stained with either CD31 or VE-cadherin and quantified. Although  B6RV2-VEGF  tumours had an increased growth rate and displayed increased  vascularity compared to B6RV2 wild-type tumours (Figure 31C), we did not observe an increase in the contribution of bone marrow cells to blood vessel formation compared to wild-type B6RV2 tumours (Figure 31 A, B).  131  CD31  B6RV2-VEGF  VE-Cadherin  B6RV2  Figure 31 V E G F secretion by tumour cells does not increase the contribution of bone marrow-derived cells to the formation of tumour blood vessels. B6RV2-VEGF tumours were implanted sub-cutaneously in the dorsal area of C3Pep mice previously transplanted with G F P bone marrow from GFP transgenic donors (A) or with bone marrow transduced ex vivo with a GFP-encoding vector (MIG) (B). (C) Photograph displaying the increase tumour mass of B6RV2-VEGF tumours (left) compared to B6RV2 tumours (right). Data ± S E M represents the average of the quantification of 4 tumours per group. +  132  To ensure that the V E G F secreted by tumour cells was able to perfuse the bone marrow, V E G F ELISA was performed on the serum of mice implanted with B6RV2-VEGF tumours 10 days previously. Human  VEGF165  was detected in the serum of mice  implanted with B6RV2-VEGF tumours (28.0 ± 4.7 pg/ml). By comparison, no detectable levels of  VEGF165  were detected in the serum of mice implanted with wild-type B6RV2  tumours. These results indicate that, in our model, increased V E G F secretion by tumour cells does not result in increased proportion of bone marrow-derived cells incorporating into tumour blood vessels, even though angiogenesis was markedly increased and tumours grew faster. Since serum V E G F levels produced by B6RV2-VEGF tumours may not have been sufficient to mobilize bone marrow endothelial progenitors, we used the strategy described in the previous chapters to selectively activate VEGFR-2 with a chemical inducer of dimerization in bone marrow cells, and examine whether activation of this receptor was sufficient to mobilize endothelial progenitors from the bone marrow and recruit them into B6RV2 vasculature. Briefly, bone marrow cells from C3Pep mice were transduced with a MIG-FKBP/VEGFR-2 construct and used to transplant lethally irradiated B6C3 mice. Four to six weeks after transplant, mice were implanted with B6RV2 tumours and were injected daily for 10 days with 10 mg/kg AP20187 or vehicle in order to dimerize the FKBP/VEGFR-2 construct. We have shown in the previous chapter that this strategy increases myeloid progenitor activity and expands the myeloid cell population (CD1 l b , Gr-1 ) in the bone marrow and peripheral blood of transplanted +  +  mice. However, VEGFR-2 activation in hematopoietic cells did not result in increased levels of V E G F R - 2  +  VE-cadherin  +  endothelial progenitors in the bone marrow or  133  peripheral blood of transplanted mice (Figure 32A, B), nor did it result in increased contribution of bone marrow-derived endothelial cells to the vasculature of B6RV2 tumours (Figure 32C). It therefore appears that the V E G F / V E G F R - 2 pathway may not be sufficient for the recruitment and/or expansion of endothelial progenitor cells to the tumour vasculature.  134  A  FKBP-VEGFR2 +AP20187  FKBP-VEGFR2  VEGFR2 3  VE-Cadherin;;  id  id  -GFP-  B  FKBP-VEGFR2  id  id  id  id  FKBP-VEGFR2 +AP20187  VE-Cadherin  GFP  CD31  *  08  • • FKBPA/EGFR2  FKBP/VEGFR2*AP20187  s 2 VE-Cadherin S  1,8  FKBP/VEGFR2  FKBP/VEGFR2*AP20187  Figure 32 VEGFR-2 activation in bone marrow cells does not result in endothelial progenitor mobilization or recruitment into tumour vasculature. Mice transplanted with FKBP/VEGFR-2 were injected with or without AP20187 for 10 consecutive days. Following this, bone marrow cells (A) and peripheral blood (B) were harvested and stained with VEGFR-2 or VE-cadherin to detect endothelial progenitors. (C) B6RV2 tumour sections from the same mice were stained with CD31 or VE-cadherin to detect G F P bone marrow cells incorporated into tumour vasculature. Data ± S E M represents the average of the quantification of 4 tumours per group. +  135  6.2.4 Determination of the proportion of endothelial progenitors in human umbilical cord blood Since incorporation of bone marrow-derived endothelial progenitors into tumour vasculature is such a rare event, it is likely that endothelial progenitors are present in exceedingly low numbers in the circulation. To determine the proportion of circulating endothelial progenitors in humans using a rich source of hematopoietic stem cells, we examined umbilical cord blood using a functional assay. CD133 cells, Lin" cells and +  total mononuclear cells from umbilical cord blood were cultured for up to 6 weeks following plating of non-adherent cells over 3 days in endothelial cell medium supplemented with angiogenic cytokines (VEGF, bFGF). Serial plating of non-adherent cells ensured that we measured only transplantable endothelial progenitors, and not mature endothelial cells (Lin et al., 2000). After 3 to 4 weeks, colonies of adherent cells appeared and were quantified by counting the total number of colonies. The number of endothelial colonies was normalized to the total number of cells originally plated. Endothelial colonies adopted a cobblestone morphology and stained for endothelial markers such as vWF and the antigen marker P1H12 (Figure 33A). Analysis of endothelial colonies following expansion revealed that the cells express endothelial specific nitric oxide synthase (eNOS), Tie-1, Tie-2 and VEGFR-2 (Figure 33B, C), therefore confirming their endothelial phenotype. We observed a 16-fold enrichment of endothelial colonies in the CD133-purified cells over total mononuclear cells and a 2.7fold increase over Lin" cells (Figure 3 3D), indicating that the CD133 cells are markedly +  enriched for endothelial progenitors, which is consistent with the observation that CD133 VEGFR-2 +  +  cells are associated with a population of endothelial progenitors  136  (Peichev et al., 2000). Nevertheless, the frequency of endothelial progenitors was less than 1 in 10 cells of the total mononuclear cell population, highlighting the rarity of this 7  cell population.  Mononuclear cells  Lineage negative  AC133-positive  Figure 33 Rarity of endothelial progenitors in post-natal human mononuclear cells. Cells from umbilical cord blood (CD133 , Lin", total mononuclear cells) were plated in medium supplemented with V E G F and bFGF. Endothelial colonies, which appeared 3 to 4 weeks after plating, stained positive for the endothelial markers vWF and PI HI 2 (immunostaining) (A) expressed eNOS, Tie-1 and Tie-2 by immunoblotting (B) and VEGFR-2 as determined by flow cytometry (C). Four weeks after plating, colonies were quantified by counting the total number of PI H I 2 colonies, and expressed as the total number of endothelial progenitors normalized to the original number of cells plated for each subset of mononuclear cells. Data represents the average of 7 to 12 independent experiments for each subset of mononuclear cells. * indicates a significant difference with # (P < 0.05). +  +  137  6.3 Discussion  Classically, tumour neovascularization has been thought to be limited to angiogenesis. Prior research has demonstrated this process to be mediated through the release of angiogenic factors such as V E G F , bFGF, PDGF and N O (Folkman and Shing, 1992). However, recent advances in vascular biology have led scientists to revisit this conventional concept. In vitro studies have demonstrated that subsets of cells isolated from bone marrow, peripheral blood or umbilical cord blood have the potential to give rise to mature endothelial cells (Lin et al., 2000). These endothelial progenitors, or angioblasts, have also been detected in vivo in bone marrow transplant models (Bailey et al., 2004; Lyden et al., 2001). Studies have shown that bone marrow-derived endothelial progenitors may contribute to neovascularization during ischemic conditions or tumour angiogenesis (Isner and Asahara, 1999; Lyden et al., 2001; Murayama et al., 2002). However, the relative levels of contribution of endothelial progenitors remain unclear, as some studies have argued that it is essential to tumour neovascularization (Asahara et al., 1999; Lyden et al., 2001), while other groups failed to detect any significant contribution (De Palma et al., 2003; Gothert et al., 2004b). The endothelial  purpose of this paper was to definitively demonstrate the existence progenitors  in vivo and examine  their potential  link  to primitive  hematopoietic stem cells. Using mice transplanted with bone marrow expressing GFP, we demonstrated that bone marrow-derived endothelial cells can contribute to the formation of new blood vessels in B6RV2 tumours. The incorporation of bone marrow-derived endothelial cells into tumour blood vessels remained a rare event however, as, on average, less than 1% of CD31- or VE-cadherin-stained blood vessels exhibited  138  incorporation of bone marrow-derived endothelial cells. These results contrast with those of Lyden et al., who have reported that around 90% of blood vessels in B6RV2 tumours are composed of bone marrow-derived endothelial cells (Lyden et al., 2001). This discrepancy may be due to different analytical methods such as the use of /3-galactosidase instead of GFP as a marker for bone marrow-derived cells and different antibodies used to identify endothelial cells. Furthermore, the close proximity of leukocytes, such as platelets, to the tumour endothelium could have led to false identification of bone marrow-derived endothelial cells, since vWF was used to identify bone marrow-derived endothelial cells. Recent studies have demonstrated that transplanted bone marrow cells can turn into unexpected lineages including myocytes, hepatocytes, neurons and many others. A potential problem, however, is that reports discussing such differentiation in vivo tend to conclude donor origin of transdifferentiated cells on the basis of the existence of donorspecific markers such as lacZ, GFP or the Y chromosome (Asari et al., 2004; Trotman et al., 2004). In recent years, studies have shown that bone marrow cells have the potential to fuse with different cell types such as hepatocytes and myocytes. It has therefore been argued that some of the transdifferentiation events reported for bone marrow cells may in fact be caused by cell fusion (Terada et al., 2002). In this study, we demonstrate definitively  that  bone  marrow-derived endothelial  cells  originate  through cell  differentiation of a progenitor. The origin of those progenitors, their place in the hematopoietic hierarchy and their link to primitive hematopoietic stem cells remained unclear however.  It has been previously demonstrated that single  adult human  hematopoietic stem/progenitor cells give rise to endothelial cells in vitro following serial  139  passage of these cells in long-term culture (Pelosi et al., 2002). Moreover, Bailey et al. have shown that they can detect v W F  +  and CD31 bone marrow-derived cells in the +  vasculature of mice transplanted with a single hematopoietic stem cell (Bailey et al., 2004). In our study, we show that tumours implanted into mice transplanted with a single hematopoietic stem cell showed rare bone marrow-derived VE-cadherin and CD31 +  +  cells incorporating into the vasculature. The use of VE-cadherin as a specific marker for endothelial cells allowed us to demonstrate definitively that these bone marrow-derived cells were of endothelial origin, therefore confirming the existence of an adult hemangioblast in vivo. Moreover, bone marrow-derived endothelial cells were detected in B6RV2 tumours implanted in serially transplanted animals, confirming the long term repopulating capacity of endothelial progenitors (data not shown). Even though the percentage of endothelial progenitor incorporation was very low, these results confirm the existence of cells with hemangioblastic activity in post-natal bone marrow. It is interesting to note that hematopoietic stem cells in the single cell-transplanted animals used in this study could also participate to the regeneration of damaged skeletal myofibers (Corbel et al., 2003), therefore confirming the multilineage potential of those primitive hematopoietic stem cells. Since the levels of incorporation of bone marrow-derived cells into tumour vasculature are low, it is likely that the differentiation of cells with hemangioblastic activity towards the endothelial lineage is a relatively rare event, which would make endothelial progenitors a rare cell population in comparison to other hematopoietic mononuclear cells. Indeed, we show here that endothelial progenitors are extremely rare among umbilical cord blood mononuclear cells, consisting of less than 1 in 10 cells. The  140  proportion of endothelial progenitors we observed here was much lower than those previously reported (Peichev et al., 2000; Quirici et al., 2001), which could be due to the fact that we determined this proportion using a functional differentiation assay to determine the proportion of endothelial progenitors in contrast to an assay that examines expression of cell surface markers. The cell surface markers CD34, C D 133 and V E G F R 2, which are used to detect endothelial precursors, are also present on other cell subsets in blood and bone marrow cells and could therefore explain the higher proportion of endothelial progenitors observed in those papers. Endothelial progenitors are enriched in the CD133 population of mononuclear cells however, which also marks a population of +  primitive hematopoietic stem cells (Bhatia, 2001). However, whether CD133 cells +  constitute a population of adult hemangioblast remains to be demonstrated at the clonal level. V E G F and its receptor VEGFR-2 have been shown to be critical in the differentiation and proliferation of endothelial progenitors in vitro (Fons et al., 2004). Moreover, increased levels of V E G F in mice in vivo have been associated with mobilization of endothelial progenitors through activation of VEGFR-2 (Hattori et al., 2001). Since endothelial progenitor incorporation into tumour vasculature is such a rare event, we were interested in determining whether V E G F was able to increase levels of incorporation of VE-cadherin and CD31 cells into the tumour vasculature. However, +  +  when we examined the role of V E G F in the in vivo recruitment of bone marrow-derived endothelial progenitors, we found that overexpression of V E G F by tumour cells, even though it resulted in increased angiogenesis and tumour growth, did not cause any increase in the levels of incorporation of bone marrow-derived endothelial cells into the  141  tumour vasculature. These results do not correlate with those of Hattori et al. (Hattori et al., 2001), which reported rapid mobilization of V E G F R - 2  +  circulating endothelial  precursor cells in response to increased serum levels of V E G F . However, the V E G F serum levels that they observed in their model were much higher than the ones we measured in our system. It is therefore possible that higher V E G F serum concentrations are required in order to mobilize bone marrow-derived endothelial cells, even though those levels we measured are sufficient to promote tumour angiogenesis. Alternatively, it is possible that local V E G F secretion by tumour cells may increase endothelial progenitor recruitment and local angiogenesis to equivalent proportion, in contrast to intravenous V E G F injection, which produces increased concentration of V E G F in the serum, which may be more potent to mobilize endothelial progenitors. Furthermore, even though V E G F may be important for the mobilization of endothelial progenitors, other cytokines such as angiopoietin-1 and bFGF may be important in the subsequent differentiation of those progenitors (Young, 2004). However, activation of VEGFR-2 in bone marrow cells did not expand or mobilize VEGFR-2 VE-cadherin +  +  endothelial progenitors, nor did it  increase the levels of incorporation of endothelial progenitors into the tumour vasculature, even though we observed that VEGFR-2 was able to expand and partially mobilize a population of bone marrow Gr-1 C D l l b +  +  myeloid cells. It is therefore  possible that VEGFR-2 activation alone is not sufficient to induce recruitment of endothelial progenitors into the tumour vasculature. The lack of VEGFR-2 induced mobilization or expansion of endothelial progenitors could suggest a requirement for the activation of other receptors in VEGF-induced expansion and/or mobilization of endothelial progenitors. This lack of mobilization could also be a result of the  142  experimental settings used in this experiment, since we only examined the activation of the kinase activity of VEGFR-2. Furthermore, it is possible that cells will respond differently to AP20187, which can penetrate inside the cells, compared to V E G F which will bind the extracellular portion of the receptor. Therefore, the pharmacokinetics of AP20187 would prevent the formation of an extracellular ligand gradient, which may be necessary in order to induce cell migration. Thus, it is possible that the extracellular domain of VEGFR-2 is required in order for endothelial progenitor cells to migrate in response to a V E G F gradient. Alternatively, this may represent a requirement for VEGFR-1 signaling, or VEGFR-1 /VEGFR-2 heterodimerization, in order to recruit endothelial progenitors. Our  findings  demonstrate  that there is an adult hemangioblast,  but the  differentiation of a marrow stem cell towards the endothelial lineage is a rare event, and V E G F stimulation does not enhance this process. Understanding the factors that regulate contributions from primitive hematopoietic stem cells and their circulating progenitors to new vessel formation may ultimately provide additional ways to influence the process of neovascularization, which may prove beneficial in treating conditions such as diabetic retinopathy and cancer.  143  Chapter 7  Conclusions and future prospectives  VEGF  and its receptors, particularly VEGFR-2, have been implicated in  neovascularisation processes. The fact that most tumours secrete V E G F suggests that its importance may be greatest in the context of tumour angiogenesis. Moreover, tumour endothelium is believed to express increased levels of VEGFR-2 (Takahashi et al., 1995). Experimental data also shows that V E G F acts in a paracrine manner on endothelial cells, resulting in the expansion of the tumour vasculature and the tumour mass. By contrast to the relatively large amount of information on the role of V E G F in solid tumours, little is known of its effects in "liquid tumours" such as leukemias and lymphomas. V E G F and its receptors have been shown to be present on a variety of hematopoietic malignancies. Moreover, VEGFR-2 expression in some hematological disorders has been shown to be associated with poor prognosis (Verstovsek et al., 2002). Before the significance of V E G F and VEGFR-2 expression in malignancies can be fully appreciated however, it is important to have a better understanding of the signalling pathways and the biological effects triggered by VEGFR-2 when it is activated by V E G F . The main goal of the research presented in this thesis was to acquire a better understanding of VEGFR-2 signalling effects. However, it has proven hard to study VEGFR-2 signalling in isolation due to the numerous V E G F receptors and ligands. To overcome this problem, we relied on various strategies to study VEGFR-2 signalling, without having to worry about the possible interference of other V E G F receptors. In the first part of this study, we used retroviral transduction to express VEGFR-2 in fibroblasts, which do not express other endogenous V E G F receptors. This model has allowed us to elucidate some of the signalling pathways induced following VEGFR-2 activation. In particular, we have shown that VEGFR-2 can activate the Erk 1/2 and p38 M A P kinase  145  pathways, Moreover, we also demonstrated that VEGFR-2 activation resulted in cell proliferation and migration. Even though it was previously known that V E G F could induce these signalling pathways and biological effects in endothelial cells, this study allowed us to confirm that VEGFR-2 activation alone was sufficient to induce them. However, even though VEGFR-2 is critical in the establishment of the endothelial lineage, we were not able to detect expression of endothelial markers in fibroblasts following its activation. These results could be interpreted in different ways: it could mean that either VEGFR-2 does not act as a switch that can promote the appearance of an endothelial phenotype, or that fibroblasts are too differentiated to be able to adopt an endothelial phenotype, even though they have been reported to transdifferentiate to other cell types such as endothelial cells (Kon and Fujiwara, 1994) and myocytes (Lattanzi et al., 1998). It is interesting however that VEGFR-2 was able to induce cell migration in response to V E G F . It was already known that VEGFR-1 can induce cell migration in response to V E G F , particularly in monocytes (Barleon et al., 1996), but here we show that VEGFR-2 activation can also trigger migration. This VEGFR-2 migration might play an important role in endothelial migration during angiogenesis. Moreover, it could be critical in the establishment of the endothelial and hematopoietic lineages by promoting the migration of early mesodermal precursors in response to V E G F gradients during early embryonic stages. Even though studying VEGFR-2 signalling in fibroblasts provided us with some answers concerning some of the functions of this receptor, we were interested in studying its function in compartments in which it is endogenously  expressed, particularly  hematopoietic cells. Other than the fact that it is expressed on subsets of normal and  146  malignant hematopoietic cells, little is known about the potential role of VEGFR-2 in these cells. However, studying VEGFR-2 signalling in hematopoietic cells in isolation would prove difficult, since subsets of hematopoietic cells have been shown to express VEGFR-1, and therefore stimulating VEGFR-2-transduced hematopoietic cells with VEGF  would result  in a certain degree  of  endogenous VEGFR-1  signalling  "contamination". To overcome this problem, we used a VEGFR-2 construct that could be selectively activated with a chemical inducer of dimerization, which prevented interference  from  endogenous V E G F  receptors.  This  VEGFR-2  construct  was  phosphorylated in the presence of AP20187, and could induce a signalling cascade that resulted in Erk 1/2 M A P kinase and Akt phosphorylation in vitro. More importantly, we were able  to  demonstrate  that VEGFR-2  activation could induce  survival of  hematopoietic cells though the PI3-kinase pathway, a mechanism that may be important in some hematopoietic malignancies. In this part of the study, we only used sorted, transduced G F P bone marrow cells for all experiments, and therefore, we were not able +  to identify a potential paracrine mechanism that could be triggered by VEGFR-2 activation. To have a better overview of the role of VEGFR-2 in hematopoietic cells, we used bone marrow transduced with the same VEGFR-2 construct to transplant mice. This approach allowed us to simulate a situation in which a relatively large proportion of hematopoietic cells express VEGFR-2, which has been shown to occur in some hematological malignancies. We observed that VEGFR-2 was able to promote the expansion of myeloid progenitors, not only among the cells that expressed the actual receptor, but also in untransduced cells, which led us to hypothesize that VEGFR-2 could promote myeloid cell expansion in a cell autonomous fashion and a paracrine fashion.  147  We confirmed the induction of a paracrine mechanism by showing that VEGFR-2 was able to up-regulate GM-CSF. Based on our in vitro and in vivo observations, we were able to propose a model for the effects of VEGFR-2 in hematopoietic cells (Figure 34).  Figure 34 Hypothetical model for the possible effects induced by VEGFR-2 activation in hematopoietic cells.  According to this model, autocrine or paracrine stimulation of VEGFR-2 by V E G F would result in activation of signalling pathways such as Erk 1/2 M A P kinase and PI3kinase, which would promote cell survival in a cell autonomous manner. Moreover, VEGFR-2 activation would induce expression of GM-CSF. The secreted GM-CSF could in turn stimulate V E G F R - 2 G M - C S F R +  +  cells via an autocrine loop. It is therefore  possible that the signalling pathways induced by VEGFR-2 and G M - C S F would  148  synergise, which would result in the rapid expansion of myeloid cells expressing VEGFR-2. Moreover, the GM-CSF secreted by V E G F R - 2 cells could in turn stimulate +  GM-CSFR cells in a paracrine manner. It is likely that this mechanism may be important in promoting the expansion and survival of malignant hematopoietic cells that express VEGFR-2, since blocking VEGFR-2 can inhibit leukemic cell growth (Dias et al., 2000). However, further studies will be required in order to determine the relative importance of VEGFR-2 signalling in physiological hematopoiesis. More specifically, due to its expression on primitive hematopoietic stem cells, it will be interesting to study the effects of VEGFR-2 on the self-renewal, proliferation and differentiation of hematopoietic stem cells. Finally, we examined the contribution of bone marrow cells in the formation of the vascular network of tumours. Due to the conflicting reports published on this topic in the recent years, it is difficult to evaluate the specific role of bone marrow-derived cells in the formation of tumour blood vessels. Even though we were able to detect bone marrow-derived endothelial cells in the vascular network of tumours, their contribution was minimal. Furthermore, we were able to demonstrate that bone marrow-derived endothelial cells arise by differentiation, and not by fusion of bone marrow-derived cells and endothelial cells. We were able to show that primitive hematopoietic stem cells have the potential to give rise to endothelial progenitors, therefore confirming the existence of an adult hemangioblast. The contribution of bone marrow-derived endothelial cells to the tumour vascular network was so minimal however that it is unlikely that these cells play an important role in the elaboration of tumour blood vessels. We therefore examined whether V E G F could increase the contribution of bone marrow-derived endothelial cells  149  to tumour blood vessel formation, since it has been reported that V E G F can recruit endothelial progenitors from the bone marrow. V E G F alone however did not influence this process. To further evaluate the role of this cytokine in adult vasculogenesis, many important questions must be answered. Based on our results and previously published work, it is likely that V E G F is essential to promote the survival of endothelial progenitors. But it is unlikely that it is sufficient to promote the differentiation of these cells to mature endothelial cells. Therefore, what supplementary set of signals are required to induce the maturation of endothelial progenitors? More importantly, what is the physiological relevance of endothelial progenitors, since their in vivo occurrence is so rare? The answers to these questions would provide invaluable insights into the understanding of blood vessel formation and new clues for potential therapeutic strategies.  150  Bibliography Abedi, H., and Zachary, I. (1997). Vascular endothelial growth factor stimulates tyrosine phosphorylation and recruitment to new focal adhesions of focal adhesion kinase and paxillin in endothelial cells. J Biol Chem 272, 15442-15451. Achen, M . G . , Jeltsch, M . , Kukk, E., Makinen, T., Vitali, A . , Wilks, A . F., Alitalo, K . , and Stacker, S. A . (1998). Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases V E G F receptor 2 (Flkl) and V E G F receptor 3 (Flt4). Proc Natl Acad Sci U S A 95, 548-553. Albini, A . , Soldi, R., Giunciuglio, D., Giraudo, E . , Benelli, R., Primo, L., Noonan, D., Salio, M . , Camussi, G., Rockl, W., and Bussolino, F. (1996). The angiogenesis induced by HIV-1 tat protein is mediated by the Flk-l/KDR receptor on vascular endothelial cells. Nat Med 2, 1371-1375. Antonchuk, J., Sauvageau, G., and Humphries, R. K. (2001). HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation. Exp Hematol 29, 1125-1134. Artavanis-Tsakonas, S., Rand, M . D., and Lake, R. J. (1999). Notch signaling: cell fate control and signal integration in development. Science 284,11Q-116. Asahara, T., Masuda, H . , Takahashi, T., Kalka, C , Pastore, C , Silver, M . , Kearne, M . , Magner, M . , and Isner, J. M . (1999). Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85, 221-228. Asahara, T., Murohara, T., Sullivan, A., Silver, M . , van der Zee, R., L i , T., Witzenbichler, B., Schatteman, G., and Isner, J. M . (1997). Isolation of putative progenitor endothelial cells for angiogenesis. Science 275, 964-967. Asari, S., Okada, S., Ohkubo, Y., Sakamoto, A., Arima, M . , Hatano, M . , Kuroda, Y., and Tokuhisa, T. (2004). Beta-galactosidase of ROSA26 mice is a useful marker for detecting the definitive erythropoiesis after stem cell transplantation. Transplantation 78, 516-523. Asselin-Paturel, C , Boonstra, A., Dalod, M . , Durand, I., Yessaad, N . , DezutterDambuyant, C , Vicari, A., O'Garra, A., Biron, C , Briere, F., and Trinchieri, G. (2001). Mouse type I EFN-producing cells are immature APCs with plasmacytoid morphology. Nat Immunol 2, 1144-1150. Athanassiades, A . , and Lala, P. K. (1998). Role of placenta growth factor (PIGF) in human extravillous trophoblast proliferation, migration and invasiveness. Placenta 19, 465-473.  151  Bailey, A . S., Jiang, S., Afentoulis, M . , Baumann, C. I., Schroeder, D. A . , Olson, S. B., Wong, M . H., and Fleming, W. H . (2004). Transplanted adult hematopoietic stems cells differentiate into functional endothelial cells. Blood 103, 13-19. Barleon, B., Hauser, S., Schollmann, C , Weindel, K., Marme, D., Yayon, A . , and Weich, H. A. (1994). Differential expression ofthe two V E G F receptors fit and K D R in placenta and vascular endothelial cells. J Cell Biochem 54, 56-66. Barleon, B., Sozzani, S., Zhou, D., Weich, Ff. A . , Mantovani, A., and Marme, D. (1996). Migration of human monocytes in response to vascular endothelial growth factor (VEGF) is mediated via the V E G F receptor flt-1. Blood 87, 3336-3343. Baron, M . H . (2003). Embryonic origins of mammalian hematopoiesis. Exp Hematol 31, 1160-1169. Barreda, D. R., Hanington, P. C , and Belosevic, M . (2004). Regulation of myeloid development and function by colony stimulating factors. Dev Comp Immunol 28, 509554. Bates, D. O., and Curry, F. E. (1997). Vascular endothelial growth factor increases microvascular permeability via a Ca(2+)-dependent pathway. A m J Physiol 273, H687694. Bates, D. O., Lodwick, D., and Williams, B. (1999). Vascular endothelial growth factor and microvascular permeability. Microcirculation 6, 83-96. Bautz, F., Rafii, S., Kanz, L., and Mohle, R. (2000). Expression and secretion of vascular endothelial growth factor-A by cytokine-stimulated hematopoietic progenitor cells. Possible role in the hematopoietic microenvironment. Exp Hematol 28, 700-706. Bellamy, W. T., Richter, L . , Frutiger, Y . , and Grogan, T. M . (1999). Expression of vascular endothelial growth factor and its receptors in hematopoietic malignancies. Cancer Res 59, 728-733. Bellamy, W. T., Richter, L., Sirjani, D., Roxas, C , Glinsmann-Gibson, B., Frutiger, Y . , Grogan, T. M . , and List, A. F. (2001). Vascular endothelial cell growth factor is an autocrine promoter of abnormal localized immature myeloid precursors and leukemia progenitor formation in myelodysplastic syndromes. Blood 97, 1427-1434. Berridge, M . J. (1993). Inositol trisphosphate and calcium signalling. Nature 361, 315325. Bhardwaj, G., Murdoch, B., Wu, D., Baker, D. P., Williams, K. P., Chadwick, K., Ling, L. E., Karanu, F. N . , and Bhatia, M . (2001). Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat Immunol 2, 172-180.  152  Bhatia, M . (2001). AC133 expression in human stem cells. Leukemia 15, 1685-1688. Bielenberg, D. R., Bucana, C. D., Sanchez, R., Donawho, C. K . , Kripke, M . L . , and Fidler, I. J. (1998). Molecular regulation of UVB-induced cutaneous angiogenesis. J Invest Dermatol 111, 864-872. Bigas, A., Martin, D. I., and Milner, L . A. (1998). Notchl and Notch2 inhibit myeloid differentiation in response to different cytokines. Mol Cell Biol 18, 2324-2333. Blau, C. A . (1999). In vivo selection of genetically modified bone marrow cells. Prog Exp Tumor Res 36, 162-171. Blau, C. A., Peterson, K. R., Drachman, J. G., and Spencer, D. M . (1997). A proliferation switch for genetically modified cells. Proc Natl Acad Sci U S A 94, 3076-3081. Brauchle, M . , Funk, J. O., Kind, P., and Werner, S. (1996). Ultraviolet B and H202 are potent inducers of vascular endothelial growth factor expression in cultured keratinocytes. J Biol Chem 271, 21793-21797. Brieger, J., Weidt, E. J., Schirmacher, P., Storkel, S., Huber, C , and Decker, H. J. (1999). Inverse regulation of vascular endothelial growth factor and V H L tumor suppressor gene in sporadic renal cell carcinomas is correlated with vascular growth: an in vivo study on 29 tumors. J Mol Med 77, 505-510. Brock, T. A . , Dvorak, H . F., and Senger, D. R. (1991). Tumor-secreted vascular permeability factor increases cytosolic Ca2+ and von Willebrand factor release in human endothelial cells. A m J Pathol 138, 213-221. Bronte, V., Apolloni, E., Cabrelle, A., Ronca, R., Serafini, P., Zamboni, P., Restifo, N . P., and Zanovello, P. (2000). Identification of a CDllb(+)/Gr-l(+)/CD31(+) myeloid progenitor capable of activating or suppressing CD8(+) T cells. Blood 96, 3838-3846. Bruno, L., Hoffmann, R., McBlane, F., Brown, J., Gupta, R., Joshi, C , Pearson, S., Seidl, T., Heyworth, C , and Enver, T. (2004). Molecular signatures of self-renewal, differentiation, and lineage choice in multipotential hemopoietic progenitor cells in vitro. Mol Cell Biol 24, 741-756. Burg, J., Krump-Konvalinkova, V . , Bittinger, F., and Kirkpatrick, C. J. (2002). GM-CSF expression by human lung microvascular endothelial cells: in vitro and in vivo findings. Am J Physiol Lung Cell Mol Physiol 283, L460-467. Busslinger, M . (2004). Transcriptional control of early B cell development. Annu Rev Immunol 22, 55-79. Cabanas, C , and Sanchez-Madrid, F. (1999). C D l l b (leukocyte integrin CR3 alpha subunit). J Biol Regul Homeost Agents 13, 130-133.  153  Cai, H., and Reed, R. R. (1999). Cloning and characterization of neuropilin-1-interacting protein: a PSD- 95/Dlg/ZO-l domain-containing protein that interacts with the cytoplasmic domain of neuropilin-1. J Neurosci 19, 6519-6527. Cantley, L. C. (2002). The phosphoinositide 3-kinase pathway. Science 296, 1655-1657. Carmeliet, P., and Collen, D. (1999). Role of vascular endothelial growth factor and vascular endothelial growth factor receptors in vascular development. Curr Top Microbiol Immunol 237, 133-158. Carmeliet, P., Ferreira, V . , Breier, G., Pollefeyt, S., Kieckens, L . , Gertsenstein, M . , Fahrig, M . , Vandenhoeck, A . , Harpal, K . , Eberhardt, C, et al. (1996). Abnormal blood vessel development and lethality in embryos lacking a single V E G F allele. Nature 380, 435-439. Casella, I., Feccia, T., Chelucci, C , Samoggia, P., Castelli, G., Guerriero, R., Parolini, I., Petrucci, E . , Pelosi, E . , Morsilli, O., et al. (2003). Autocrine-paracrine V E G F loops potentiate the maturation of megakaryocyte precursors through Fltl receptor. Blood 101, 1316-1323. Chedotal, A., Del Rio, J. A., Ruiz, M . , He, Z., Borrell, V . , de Castro, F., Ezan, F., Goodman, C. S., Tessier-Lavigne, M . , Sotelo, C , and Soriano, E . (1998). Semaphorins III and IV repel hippocampal axons via two distinct receptors. Development 125, 43134323. Chen, H . , Chedotal, A . , He, Z., Goodman, C. S., and Tessier-Lavigne, M . (1997). Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III. Neuron 19, 547-559. Chen, H . , He, Z., Bagri, A., and Tessier-Lavigne, M . (1998). Semaphorin-neuropilin interactions underlying sympathetic axon responses to class III semaphorins. Neuron 21, 1283-1290. Choi, K., Kennedy, M . , Kazarov, A . , Papadimitriou, J. C , and Keller, G. (1998). A common precursor for hematopoietic and endothelial cells. Development 125, 725-732. Clauss, M . , Weich, H . , Breier, G., Knies, U., Rockl, W., Waltenberger, J., and Risau, W. (1996). The vascular endothelial growth factor receptor Flt-1 mediates biological activities. Implications for a functional role of placenta growth factor in monocyte activation and chemotaxis. J Biol Chem 271, 17629-17634. Cohen, T., Nahari, D., Cerem, L . W., Neufeld, G . , and Levi, B. Z. (1996). Interleukin 6 induces the expression of vascular endothelial growth factor. J Biol Chem 271, 736-741. Connolly, D. T., Heuvelman, D. M . , Nelson, R., Olander, J. V . , Eppley, B. L., Delfino, J. J., Siegel, N . R., Leimgruber, R. M . , and Feder, J. (1989). Tumor vascular permeability factor stimulates endothelial cell growth and angiogenesis. J Clin Invest 84, 1470-1478.  154  Corbel, S. Y . , Lee, A., Y i , L., Duenas, J., Brazelton, T. R., Blau, H . M . , and Rossi, F. M . (2003). Contribution of hematopoietic stem cells to skeletal muscle. Nat Med 9, 15281532. Coulombel, L . (2004). Identification of hematopoietic stem/progenitor cells: strength and drawbacks of functional assays. Oncogene 23, 7210-7222. Crosby, J. R., Kaminski, W. E., Schatteman, G., Martin, P. J., Raines, E . W., Seifert, R. A., and Bowen-Pope, D. F. (2000). Endothelial cells of hematopoietic origin make a significant contribution to adult blood vessel formation. Circ Res 87, 728-730. Cunningham, S. A . , Waxham, M . N., Arrate, P. M . , and Brock, T. A . (1995). Interaction of the Flt-1 tyrosine kinase receptor with the p85 subunit of phosphatidylinositol 3kinase. Mapping of a novel site involved in binding. J Biol Chem 270, 20254-20257. Dahl, R., and Simon, M . C. (2003). The importance of P U . l concentration in hematopoietic lineage commitment and maturation. Blood Cells Mol Dis 31, 229-233. Dankbar, B., Padro, T., Leo, R., Feldmann, B., Kropff, M . , Mesters, R. M . , Serve, H . , Berdel, W. E., and Kienast, J. (2000). Vascular endothelial growth factor and interleukin6 in paracrine tumor-stromal cell interactions in multiple myeloma. Blood 95, 2630-2636. Dannaeus, K., Johannisson, A., Nilsson, K., and Jonsson, J. I. (1999). Flt3 ligand induces the outgrowth of Mac-1+B220+ mouse bone marrow progenitor cells restricted to macrophage differentiation that coexpress early B cell-associated genes. Exp Hematol 27, 1646-1654. Davies, S. P., Reddy, H., Caivano, M . , and Cohen, P. (2000). Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351, 95-105. De Palma, M . , Venneri, M . A . , Roca, C , and Naldini, L . (2003). Targeting exogenous genes to tumor angiogenesis by transplantation of genetically modified hematopoietic stem cells. Nat Med 9, 789-795. de Vries, C , Escobedo, J. A., Ueno, H . , Houck, K., Ferrara, N . , and Williams, L . T. (1992). The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science 255, 989-991. del Hoyo, G. M . , Martin, P., Vargas, H. H., Ruiz, S., Arias, C. F., and Ardavin, C. (2002). Characterization of a common precursor population for dendritic cells. Nature 415, 10431047. Deroanne, C. F., Hajitou, A . , Calberg-Bacq, C. M . , Nusgens, B. V . , and Lapiere, C. M . (1997). Angiogenesis by fibroblast growth factor 4 is mediated through an autocrine upregulation of vascular endothelial growth factor expression. Cancer Res 57, 5590-5597.  155  Dias, S., Hattori, K., Heissig, B., Zhu, Z., Wu, Y . , Witte, L., Hicklin, D. J., Tateno, M . , Bohlen, P., Moore, M . A . , and Rafii, S. (2001). Inhibition of both paracrine and autocrine V E G F / VEGFR-2 signaling pathways is essential to induce long-term remission of xenotransplanted human leukemias. Proc Natl Acad Sci U S A 98, 10857-10862. Dias, S., Hattori, K., Zhu, Z., Heissig, B., Choy, M . , Lane, W., Wu, Y . , Chadburn, A . , Hyjek, E . , Gill, M., et al. (2000). Autocrine stimulation of VEGFR-2 activates human leukemic cell growth and migration. J Clin Invest 106, 511-521. DiSalvo, J., Bayne, M . L . , Conn, G., Kwok, P. W., Trivedi, P. G., Soderman, D. D., Palisi, T. M . , Sullivan, K. A . , and Thomas, K. A . (1995). Purification and characterization of a naturally occurring vascular endothelial growth factor.placenta growth factor heterodimer. J Biol Chem 270, 7717-7723. Dougher-Vermazen, M . , Hulmes, J. D., Bohlen, P., and Terman, B. I. (1994). Biological activity and phosphorylation sites of the bacterially expressed cytosolic domain of the K D R VEGF-receptor. Biochem Biophys Res Commun 205, 728-738. Dumont, D. J., Jussila, L . , Taipale, J., Lymboussaki, A . , Mustonen, T., Pajusola, K . , Breitman, M . , and Alitalo, K. (1998). Cardiovascular failure in mouse embryos deficient in V E G F receptor-3. Science 282, 946-949. Dvorak, H . F. (2002). Vascular permeability factor/vascular endothelial growth factor: a critical cytokine in tumor angiogenesis and a potential target for diagnosis and therapy. J Clin Oncol 20, 4368-4380. Dvorak, H . F., Detmar, M . , Claffey, K. P., Nagy, J. A . , van de Water, L., and Senger, D. R. (1995). Vascular permeability factor/vascular endothelial growth factor: an important mediator of angiogenesis in malignancy and inflammation. Int Arch Allergy Immunol 107, 233-235. Dzierzak, E . , Medvinsky, A . , and de Bruijn, M . (1998). Qualitative and quantitative aspects of haematopoietic cell development in the mammalian embryo. Immunol Today 19, 228-236. Ebos, J. M . , Bocci, G . , Man, S., Thorpe, P. E . , Hicklin, D. J., Zhou, D., Jia, X . , and Kerbel, R. S. (2004). A naturally occurring soluble form of vascular endothelial growth factor receptor 2 detected in mouse and human plasma. Mol Cancer Res 2, 315-326. Eichmann, A., Corbel, C , Nataf, V . , Vaigot, P., Breant, C , and Le Douarin, N . M . (1997). Ligand-dependent development of the endothelial and hemopoietic lineages from embryonic mesodermal cells expressing vascular endothelial growth factor receptor 2. Proc Natl Acad Sci U S A 94, 5141-5146.  156  Ema, M . , Faloon, P., Zhang, W. J., Hirashima, M . , Reid, T., Stanford, W. L . , Orkin, S., Choi, K., and Rossant, J. (2003). Combinatorial effects of Flkl and Tall on vascular and hematopoietic development in the mouse. Genes Dev 17, 380-393. Ema, M . , and Rossant, J. (2003). Cell fate decisions in early blood vessel formation. Trends Cardiovasc Med 13, 254-259. Fantl, W. J., Johnson, D. E., and Williams, L. T. (1993). Signalling by receptor tyrosine kinases. Annu Rev Biochem 62, 453-481. Ferrara, N . (1999a). Molecular and biological properties of vascular endothelial growth factor. J Mol Med 77, 527-543. Ferrara, N . (1999b). Vascular endothelial growth factor: molecular and biological aspects. Curr Top Microbiol Immunol 237, 1-30. Ferrara, N., Carver-Moore, K., Chen, H . , Dowd, M . , Lu, L., KS, O. S., Powell-Braxton, L., Hillan, K. J., and Moore, M . W. (1996). Heterozygous embryonic lethality induced by targeted inactivation of the V E G F gene. Nature 380, 439-442. Ferrara, N . , and Henzel, W. J. (1989). Pituitary follicular cells secrete a novel heparinbinding growth factor specific for vascular endothelial cells. Biochem Biophys Res Commun 161, 851-858. Fiedler, W., Graeven, U . , Ergun, S., Verago, S., Kilic, N . , Stockschlader, M . , and Hossfeld, D. K . (1997). Vascular endothelial growth factor, a possible paracrine growth factor in human acute myeloid leukemia. Blood 89, 1870-1875. Fiedler, W., Staib, P., Kuse, R., Duhrsen, U . , Flasshove, M . , Cavalli, F., Hossfeld, D. K., and Berdel, W. E . (2001). Role of angiogenesis inhibitors in acute myeloid leukemia.  Cancer J 7 Suppl 3, SI29-133. Fina, L . , Molgaard, H . V . , Robertson, D., Bradley, N . J., Monaghan, P., Delia, D., Sutherland, D. R., Baker, M . A., and Greaves, M . F. (1990). Expression of the CD34 gene in vascular endothelial cells. Blood 75, 2417-2426. Finch, C. A . , Harker, L . A . , and Cook, J. D. (1977). Kinetics of the formed elements of human blood. Blood 50, 699-707. Finkenzeller, G . , Sparacio, A . , Technau, A., Marme, D., and Siemeister, G . (1997). Spl recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factor-induced gene expression. Oncogene 15, 669-676. Folkman, J. (1995). Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 7,27-31.  157  Folkman, J., and Shing, Y . (1992). Angiogenesis. J Biol Chem 267, 10931-10934. Fong, G. H . , Klingensmith, J., Wood, C. R., Rossant, J., and Breitman, M . L . (1996). Regulation of flt-1 expression during mouse embryo genesis suggests a role in the establishment of vascular endothelium. Dev Dyn 207, 1-10. Fong, G. H., Rossant, J., Gertsenstein, M . , and Breitman, M . L . (1995). Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature 376, 66-70. Fong, G. H . , Zhang, L . , Bryce, D. M . , and Peng, J. (1999). Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice. Development 126, 3015-3025. Fons, P., Herault, J. P., Delesque, N., Tuyaret, J., Bono, F., and Herbert, J. M . (2004). VEGF-R2 and neuropilin-1 are involved in VEGF-A-induced differentiation of human bone marrow progenitor cells. J Cell Physiol 200, 351-359. Frank, S., Stallmeyer, B., Kampfer, H., Kolb, N., and Pfeilschifter, J. (1999). Nitric oxide triggers enhanced induction of vascular endothelial growth factor expression in cultured keratinocytes (HaCaT) and during cutaneous wound repair. Faseb J 13, 2002-2014. Franke, T. F., Kaplan, D. R., and Cantley, L . C. (1997). PI3K: downstream AKTion blocks apoptosis. Cell 88, 435-437. Franklin, R. A . , and McCubrey, J. A . (2000). Kinases: positive and negative regulators of apoptosis. Leukemia 14, 2019-2034. Friedman, A . D. (2002). Transcriptional regulation of myelopoiesis. Int J Hematol 75, 466-472. Fuh, G., Li, B., Crowley, C , Cunningham, B., and Wells, J. A . (1998). Requirements for binding and signaling of the kinase domain receptor for vascular endothelial growth factor. J Biol Chem 273, 11197-11204. Fujio, Y . , and Walsh, K. (1999). Akt mediates cytoprotection of endothelial cells by vascular endothelial growth factor in an anchorage-dependent manner. J Biol Chem 274, 16349-16354. Gabrilovich, D., Ishida, T., Oyama, T., Ran, S., Kravtsov, V., Nadaf, S., and Carbone, D. P. (1998). Vascular endothelial growth factor inhibits the development of dendritic cells and dramatically affects the differentiation of multiple hematopoietic lineages in vivo. Blood 92, 4150-4166.  158  Galloway, J. L., and Zon, L. I. (2003). Ontogeny of hematopoiesis: examining the emergence of hematopoietic cells in the vertebrate embryo. Curr Top Dev Biol 53, 139158. Gasson, J. C. (1991). Molecular physiology of granulocyte-macrophage colonystimulating factor. Blood 77, 1131-1145. Gehling, U . M . , Ergun, S., Schumacher, U., Wagener, C , Pantel, K., Otte, M . , Schuch, G., Schafhausen, P., Mende, T., Kilic, N., et al. (2000). In vitro differentiation of endothelial cells from AC133-positive progenitor cells. Blood 95, 3106-3112. Gerber, H. P., Condorelli, F., Park, J., and Ferrara, N . (1997). Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Fit-1, but not Flk-l/KDR, is up-regulated by hypoxia. J Biol Chem 272, 23659-23667. Gerber, H. P., Dixit, V., and Ferrara, N . (1998a). Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bcl-2 and A l in vascular endothelial cells. J Biol Chem 273, 13313-13316. Gerber, H. P., and Ferrara, N . (2003). The role of VEGF in normal and neoplastic hematopoiesis. J Mol Med 81, 20-31. Gerber, H. P., Malik, A. K., Solar, G. P., Sherman, D., Liang, X. H., Meng, G., Hong, K., Marsters, J. C , and Ferrara, N . (2002). VEGF regulates haematopoietic stem cell survival by an internal autocrine loop mechanism. Nature 417, 954-958. Gerber, H. P., McMurtrey, A., Kowalski, J., Yan, M . , Keyt, B. A., Dixit, V., and Ferrara, N. (1998b). Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flkl/KDR activation. J Biol Chem 273, 30336-30343. Gering, M . , Rodaway, A. R., Gottgens, B., Patient, R. K., and Green, A. R. (1998). The SCL gene specifies haemangioblast development from early mesoderm. Embo J 17, 4029-4045. Gerritsen, M . E., Tomlinson, J. E., Zlot, C , Ziman, M . , and Hwang, S. (2003). Using gene expression profiling to identify the molecular basis of the synergistic actions of hepatocyte growth factor and vascular endothelial growth factor in human endothelial cells. Br J Pharmacol 140, 595-610. Giger, R. J., Urquhart, E. R., Gillespie, S. K., Levengood, D. V., Ginty, D. D., and Kolodkin, A. L. (1998). Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity. Neuron 21, 1079-1092.  159  Gill, M . , Dias, S., Hattori, K., Rivera, M . L., Hicklin, D., Witte, L., Girardi, L., Yurt, R., Himel, H., and Rafii, S. (2001). Vascular trauma induces rapid but transient mobilization of VEGFR2(+)AC133(+) endothelial precursor cells. Circ Res 88, 167-174. Gitay-Goren, H . , Halaban, R., and Neufeld, G. (1993). Human melanoma cells but not normal melanocytes express vascular endothelial growth factor receptors. Biochem Biophys Res Commun 190, 702-708. Goodell, M . A . , Brose, K . , Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806. Goodell, M . A . , Rosenzweig, M . , Kim, H . , Marks, D. F., DeMaria, M . , Paradis, G., Grupp, S. A., Sieff, C. A., Mulligan, R. C , and Johnson, R. P. (1997). Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species. Nat Med 3, 1337-1345. Gothert, J. R., Gustin, S. E., Van Eekelen, J. A . , Schmidt, U . , Hall, M . A., Jane, S. M . , Green, A . R., Gottgens, B., Izon, D. J., and Begley, C. G. (2004b). Genetically tagging endothelial cells in vivo: bone marrow-derived cells do not contribute to tumor endothelium. Blood 104, 1769-1777. Graeven, U., Fiedler, W., Karpinski, S., Ergun, S., Kilic, N., Rodeck, U . , Schmiegel, W., and Hossfeld, D. K. (1999). Melanoma-associated expression of vascular endothelial growth factor and its receptors FLT-1 and KDR. J Cancer Res Clin Oncol 125, 621-629. Grompe, M . (2003). The role of bone marrow stem cells in liver regeneration. Semin Liver Dis 23, 363-372. Guo, D., Jia, Q., Song, H . Y . , Warren, R. S., and Dormer, D. B. (1995). Vascular endothelial cell growth factor promotes tyrosine phosphorylation of mediators of signal transduction that contain SH2 domains. Association with endothelial cell proliferation. J Biol Chem 270, 6729-6733. Gupta, S., Campbell, D., Derijard, B., and Davis, R. J. (1995). Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267, 389-393. Haar, J. L . , and Ackerman, G. A . (1971). A phase and electron microscopic study of vasculogenesis and erythropoiesis in the yolk sac of the mouse. Anat Rec 170, 199-223. Habeck, H., Odenthal, J., Walderich, B., Maischein, H., and Schulte-Merker, S. (2002). Analysis of a zebrafish V E G F receptor mutant reveals specific disruption of angiogenesis. Curr Biol 12, 1405-1412. Harper, J. A., Yuan, J. S., Tan, J. B., Visan, I., and Guidos, C. J. (2003). Notch signaling in development and disease. Clin Genet 64, 461-472.  160  Haruta, H., Nagata, Y . , and Todokoro, K. (2001). Role of Flk-1 in mouse hematopoietic stem cells. FEBS Lett 507, 45-48. Hattori, K . , Dias, S., Heissig, B., Hackett, N. R., Lyden, D., Tateno, M . , Hicklin, D. J., Zhu, Z., Witte, L., Crystal, R. G., et al. (2001). Vascular endothelial growth factor and angiopoietin-1 stimulate postnatal hematopoiesis by recruitment of vasculogenic and hematopoietic stem cells. J Exp Med 193, 1005-1014. Hattori, K., Heissig, B., Wu, Y . , Dias, S., Tejada, R., Ferris, B., Hicklin, D. J., Zhu, Z., Bohlen, P., Witte, L., et al. (2002). Placental growth factor reconstitutes hematopoiesis by recruiting VEGFR1(+) stem cells from bone-marrow microenvironment. Nat Med 8, 841-849. Hatva, E . , Bohling, T., Jaaskelainen, J., Persico, M . G., Haltia, M . , and Alitalo, K. (1996). Vascular growth factors and receptors in capillary hemangioblastomas and hemangiopericytomas. A m J Pathol 148, 763-775. He, Z., and Tessier-Lavigne, M . (1997). Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell 90, 739-751. Hedges, J. C , Dechert, M . A., Yamboliev, I. A., Martin, J. L., Hickey, E . , Weber, L . A., and Gerthoffer, W. T. (1999). A role for p38(MAPK)/HSP27 pathway in smooth muscle cell migration. J Biol Chem 274, 24211-24219. Heissig, B., Hattori, K., Dias, S., Friedrich, M . , Ferris, B., Hackett, N . R., Crystal, R. G., Besmer, P., Lyden, D., Moore, M . A., et al. (2002). Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell 109, 625-637. Herold-Mende, C , Steiner, H . H., Andl, T., Riede, D., Buttler, A . , Reisser, C , Fusenig, N. E . , and Mueller, M . M . (1999). Expression and functional significance of vascular endothelial growth factor receptors in human tumor cells. Lab Invest 79, 1573-1582. Hidaka, M . , Stanford, W. L., and Bernstein, A. (1999). Conditional requirement for the Flk-1 receptor in the in vitro generation of early hematopoietic cells. Proc Natl Acad Sci U S A 96, 7370-7375. Hilbe, W., Dirnhofer, S., Oberwasserlechner, F., Schmid, T., Gunsilius, E . , Hilbe, G . , Woll, E . , and Kahler, C. M . (2004). CD133 positive endothelial progenitor cells contribute to the tumour vasculature in non-small cell lung cancer. J Clin Pathol 57, 965969. Hiratsuka, S., Minowa, O., Kuno, J., Noda, T., and Shibuya, M . (1998). Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice. Proc Natl Acad Sci U S A 95, 9349-9354.  161  Hood, J., and Granger, H . J. (1998). Protein kinase G mediates vascular endothelial growth factor-induced Raf-l activation and proliferation in human endothelial cells. J Biol Chem 273, 23504-23508. Hood, J. D., Meininger, C. J., Ziche, M . , and Granger, H . J. (1998). V E G F upregulates ecNOS message, protein, and N O production in human endothelial cells. A m J Physiol 274, H1054-1058. Hou, R., Goloubeva, O., Neuberg, D. S., Strominger, J. L . , and Wilson, S. B. (2003). Interleukin-12 and interleukin-2-induced invariant natural killer T-cell cytokine secretion and perforin expression independent of T-cell receptor activation. Immunology 110, 3037. Houck, K. A., Ferrara, N., Winer, J., Cachianes, G., Li, B., and Leung, D. W. (1991). The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol Endocrinol 5, 1806-1814. Houck, K. A., Leung, D. W., Rowland, A. M . , Winer, J., and Ferrara, N . (1992). Dual regulation of vascular endothelial growth factor bioavailability by genetic and proteolytic mechanisms. J Biol Chem 267, 26031-26037. Huang, Q., and Yuan, Y . (1997). Interaction of P K C and NOS in signal transduction of microvascular hyperpermeability. A m J Physiol 273, H2442-2451. Isner, J. M . , and Asahara, T. (1999). Angiogenesis and vasculogenesis as therapeutic strategies for postnatal neovascularization. J Clin Invest 103, 1231-1236. Iwasaka, C , Tanaka, K . , Abe, M . , and Sato, Y . (1996). Ets-1 regulates angiogenesis by inducing the expression of urokinase- type plasminogen activator and matrix metalloproteinase-1 and the migration of vascular endothelial cells. J Cell Physiol 169, 522-531. Izon, D. J., Punt, J. A . , and Pear, W. S. (2002). Deciphering the role of Notch signaling in lymphopoiesis. Curr Opin Immunol 14, 192-199. Jaworowski, A., Wilson, N . J., Christy, E., Byrne, R., and Hamilton, J. A . (1999). Roles of the mitogen-activated protein kinase family in macrophage responses to colony stimulating factor-1 addition and withdrawal. J Biol Chem 274, 15127-15133. Jelen, F., Oleksy, A., Smietana, K., and Otlewski, J. (2003). PDZ domains - common players in the cell signaling. Acta Biochim Pol 50, 985-1017. Jin, L . , Asano, H . , and Blau, C. A . (1998a). Stimulating cell proliferation through the pharmacologic activation of c-kit. Blood 91, 890-897.  162  Jin, L . , Siritanaratkul, N . , Emery, D. W., Richard, R. E . , Kaushansky, K., Papayannopoulou, T., and Blau, C. A . (1998b). Targeted expansion of genetically modified bone marrow cells. Proc Natl Acad Sci U S A 95, 8093-8097. Jin, L., Zeng, H., Chien, S., Otto, K. G., Richard, R. E., Emery, D. W., and Blau, C. A. (2000). In vivo selection using a cell-growth switch. Nat Genet 26, 64-66. Jonsson, J. I., Xiang, Z., Pettersson, M . , Lardelli, M . , and Nilsson, G. (2001). Distinct and regulated expression of Notch receptors in hematopoietic lineages and during myeloid differentiation. Eur J Immunol 31, 3240-3247. Joukov, V . , Kumar, V . , Sorsa, T., Arighi, E . , Weich, H . , Saksela, O., and Alitalo, K. (1998). A recombinant mutant vascular endothelial growth factor-C that has lost vascular endothelial growth factor receptor-2 binding, activation, and vascular permeability activities. J Biol Chem 273, 6599-6602. Joukov, V . , Pajusola, K., Kaipainen, A., Chilov, D., Lahtinen, I., Kukk, E . , Saksela, O., Kalkkinen, N . , and Alitalo, K. (1996). A novel vascular endothelial growth factor, V E G F - C , is a ligand for the Flt4 (VEGFR-3) and K D R (VEGFR-2) receptor tyrosine kinases. Embo J 15, 290-298. Jussila, L . , Valtola, R., Partanen, T. A., Salven, P., Heikkila, P., Matikainen, M . T., Renkonen, R., Kaipainen, A., Detmar, M . , Tschachler, E., et al. (1998). Lymphatic endothelium and Kaposi's sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-3. Cancer Res 58, 1599-1604. Kabrun, N . , Burning, H . J., Choi, K., Ullrich, A., Risau, W., and Keller, G . (1997). Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development 124, 2039-2048. Kallianpur, A . R., Jordan, J. E . , and Brandt, S. J. (1994). The SCL/TAL-1 gene is expressed in progenitors of both the hematopoietic and vascular systems during embryogenesis. Blood 83, 1200-1208. Karsan, A., Yee, E . , Poirier, G. G., Zhou, P., Craig, R., and Harlan, J. M . (1997). Fibroblast growth factor-2 inhibits endothelial cell apoptosis by Bcl-2- dependent and independent mechanisms. A m J Pathol 151, 1775-1784. Kato, K., Ito, H., Kamei, K., and Iwamoto, I. (1999). Selective stimulation of Hsp27 and alphaB-crystallin but not Hsp70 expression by p38 M A P kinase activation. Cell Stress Chaperones 4, 94-101. Katoh, O., Tauchi, H., Kawaishi, K . , Kimura, A . , and Satow, Y . (1995). Expression of the vascular endothelial growth factor (VEGF) receptor gene, KDR, in hematopoietic cells and inhibitory effect of V E G F on apoptotic cell death caused by ionizing radiation. Cancer Res 55, 5687-5692.  163  Kawasaki, T., Kitsukawa, T., Bekku, Y., Matsuda, Y., Sanbo, M . , Yagi, T., and Fujisawa, H. (1999). A requirement for neuropilin-1 in embryonic vessel formation. Development 126, 4895-4902. Keck, P. J., Hauser, S. D., Krivi, G., Sanzo, K., Warren, T., Feder, J., and Connolly, D. T. (1989). Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science 246, 1309-1312. Kendall, R. L., Rutledge, R. Z., Mao, X., Tebben, A . J., Hungate, R. W., and Thomas, K . A. (1999). Vascular endothelial growth factor receptor K D R tyrosine kinase activity is increased by autophosphorylation of two activation loop tyrosine residues. J Biol Chem 274, 6453-6460. Kendall, R. L., Wang, G . , and Thomas, K. A. (1996). Identification of a natural soluble form of the vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR. Biochem Biophys Res Commun 226, 324-328. Kennedy, M . , Firpo, M . , Choi, K . , Wall, C , Robertson, S., Kabrun, N . , and Keller, G. (1997a). A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature 386, 488-493. Kennedy, S. G., Wagner, A. J., Conzen, S. D., Jordan, J., Bellacosa, A . , Tsichlis, P. N., and Hay, N. (1997b). The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic signal. Genes Dev 11, 701-713. Keyt, B. A., Nguyen, H . V., Berleau, L. T., Duarte, C. M . , Park, J., Chen, H . , and Ferrara, N. (1996). Identification of vascular endothelial growth factor determinants for binding K D R and FLT-1 receptors. Generation of receptor-selective V E G F variants by sitedirected mutagenesis. J Biol Chem 271, 5638-5646. Kieser, A., Weich, H . A . , Brandner, G., Marme, D., and Kolch, W. (1994). Mutant p53 potentiates protein kinase C induction of vascular endothelial growth factor expression. Oncogene 9, 963-969. Kinoshita, T., Shirouzu, M . , Kamiya, A., Hashimoto, K . , Yokoyama, S., and Miyajima, A. (1997). Raf/MAPK and rapamycin-sensitive pathways mediate the anti-apoptotic function of p21Ras in IL-3-dependent hematopoietic cells. Oncogene 15, 619-627. Kitsukawa, T., Shimizu, M . , Sanbo, M . , Hirata, T., Taniguchi, M . , Bekku, Y . , Yagi, T., and Fujisawa, H . (1997). Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice. Neuron 19, 995-1005. Kitsukawa, T., Shimono, A . , Kawakami, A . , Kondoh, H . , and Fujisawa, H . (1995). Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121, 4309-4318.  164  Kon, K . , and Fujiwara, T. (1994). Transformation of fibroblasts into endothelial cells during angiogenesis. Cell Tissue Res 278, 625-628. Koury, M . J., Sawyer, S. T., and Brandt, S. J. (2002). New insights into erythropoiesis. Curr Opin Hematol 9, 93-100. Krause, D. S. (2002). Regulation of hematopoietic stem cell fate. Oncogene 21, 32623269. Rremer, C , Breier, G . , Risau, W., and Plate, K. H . (1997). Up-regulation of flk1/vascular endothelial growth factor receptor 2 by its ligand in a cerebral slice culture system. Cancer Res 57, 3852-3859. Krishnaswamy, G . , Kelley, J., Yerra, L . , Smith, J. K . , and Chi, D. S. (1999). Human endothelium as a source of multifunctional cytokines: molecular regulation and possible role in human disease. J Interferon Cytokine Res 19, 91-104. Kroll, J., and Waltenberger, J. (1997). The vascular endothelial growth factor receptor K D R activates multiple signal transduction pathways in porcine aortic endothelial cells. J Biol Chem 272, 32521-32527. Kroll, J., and Waltenberger, J. (1998). V E G F - A induces expression of eNOS and iNOS in endothelial cells via V E G F receptor-2 (KDR). Biochem Biophys Res Commun 252, 743746. Kroll, J., and Waltenberger, J. (1999). A novel function of V E G F receptor-2 (KDR): rapid release of nitric oxide in response to V E G F - A stimulation in endothelial cells. Biochem Biophys Res Commun 265, 636-639. Kukk, E . , Lymboussaki, A . , Taira, S., Kaipainen, A., Jeltsch, M . , Joukov, V., and Alitalo, K. (1996). V E G F - C receptor binding and pattern of expression with VEGFR-3 suggests a role in lymphatic vascular development. Development 122, 3829-3837. Kumaravelu, P., Hook, L . , Morrison, A . M . , Ure, J., Zhao, S., Zuyev, S., Ansell, J., and Medvinsky, A . (2002). Quantitative developmental anatomy of definitive haematopoietic stem cells/long-term repopulating units (HSC/RUs): role of the aorta-gonad-mesonephros (AGM) region and the yolk sac in colonisation of the mouse embryonic liver. Development 129, 4891-4899. Kusmartsev, S., and Gabrilovich, D. I. (2002). Immature myeloid cells and cancerassociated immune suppression. Cancer Immunol Immunother 51, 293-298. Kusmartsev, S. A . , L i , Y . , and Chen, S. H . (2000). Gr-1+ myeloid cells derived from tumor-bearing mice inhibit primary T cell activation induced through CD3/CD28 costimulation. J Immunol 165, 779-785.  165  Kuzuya, M . , and Kinsella, J. L . (1994). Induction of endothelial cell differentiation in vitro by fibroblast-derived soluble factors. Exp Cell Res 215, 310-318. Kyba, M . , Perlingeiro, R. C , and Daley, G. Q. (2002). HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell 109, 29-37. Lajtha, L . G., Gilbert, C. W., and Guzman, E . (1971). Kinetics of haemopoietic colony growth. Br J Haematol 20, 343-354. Lang, R. A . , Metcalf, D., Cuthbertson, R. A., Lyons, I., Stanley, E . , Kelso, A., Kannourakis, G., Williamson, D. J., Klintworth, G. K . , Gonda, T. J., and et al. (1987). Transgenic mice expressing a hemopoietic growth factor gene (GM-CSF) develop accumulations of macrophages, blindness, and a fatal syndrome of tissue damage. Cell 51, 675-686. Lattanzi, L., Salvatori, G., Coletta, M . , Sonnino, C , Cusella De Angelis, M . G., Gioglio, L., Murry, C. E . , Kelly, R., Ferrari, G., Molinaro, M . , et al. (1998). High efficiency myogenic conversion of human fibroblasts by adenoviral vector-mediated MyoD gene transfer. A n alternative strategy for ex vivo gene therapy of primary myopathies. J Clin Invest 101, 2119-2128. Lecuyer, E., and Hoang, T. (2004). SCL: from the origin of hematopoiesis to stem cells and leukemia. Exp Hematol 32, 11-24. Lehtonen, A . , Matikainen, S., Miettinen, M . , and Julkunen, I. (2002). Granulocytemacrophage colony-stimulating factor (GM-CSF)-induced STAT5 activation and targetgene expression during human monocyte/macrophage differentiation. J Leukoc Biol 71, 511-519. Lennartsson, J., Shivakrupa, R., and Linnekin, D. (2004). Synergistic growth of SCF and GM-CSF involves kinase-dependent and independent contributions from c-kit. J Biol Chem 12,12. Leung, S. Y . , Chan, A . S., Wong, M . P., Yuen, S. T., Cheung, N . , and Chung, L . P. (1997). Expression of vascular endothelial growth factor and its receptors in pilocytic astrocytoma. A m J Surg Pathol 21, 941-950. Levy, A . P., Levy, N . S., Wegner, S., and Goldberg, M . A . (1995). Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J Biol Chem 270, 13333-13340. Lin, A., Minden, A., Martinetto, H . , Claret, F. X., Lange-Carter, C , Mercurio, F., Johnson, G. L . , and Karin, M . (1995). Identification of a dual specificity kinase that activates the Jun kinases and p38-Mpk2. Science 268, 286-290.  166  Lin, B., Podar, K., Gupta, D., Tai, Y . T., Li, S., Weller, E., Hideshima, T., Lentzsch, S., Davies, F., Li, C , et al. (2002). The vascular endothelial growth factor receptor tyrosine kinase inhibitor PTK787/ZK222584 inhibits growth and migration of multiple myeloma cells in the bone marrow microenvironment. Cancer Res 62, 5019-5026. Lin, Y . , Weisdorf, D. J., Solovey, A., and Hebbel, R. P. (2000). Origins of circulating endothelial cells and endothelial outgrowth from blood. J Clin Invest 105, 71-77. List, A. F. (2001). Vascular endothelial growth factor signaling pathway as an emerging target in hematologic malignancies. Oncologist 6, 24-31. Litwin, C , Leong, K. G., Zapf, R., Sutherland, H . , Naiman, S. C , and Karsan, A. (2002). Role of the microenvironment in promoting angiogenesis in acute myeloid leukemia. Am J Hematol 70, 22-30. Liu, Q., Schacher, D., Hurth, C , Freund, G. G., Dantzer, R., and Kelley, K. W. (1997). Activation of phosphatidylinositol 3'-kinase by insulin-like growth factor-I rescues promyeloid cells from apoptosis and permits their differentiation into granulocytes. J Immunol 159, 829-837. Liu, Y . , Cox, S. R., Morita, T., and Kourembanas, S. (1995). Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer. Circ Res 77, 638-643. Lobe, C. G . , Koop, K. E . , Kreppner, W., Lomeli, H . , Gertsenstein, M . , and Nagy, A . (1999). Z/AP, a double reporter for cre-mediated recombination. Dev Biol 208, 281-292. Lu, M . , Kawamoto, H . , Katsube, Y . , Ikawa, T., and Katsura, Y . (2002). The common myelolymphoid progenitor: a key intermediate stage in hemopoiesis generating T and B cells. J Immunol 169, 3519-3525. Lund-Johansen, F., Houck, D., Hoffman, R., Davis, K., and Olweus, J. (1999). Primitive human hematopoietic progenitor cells express receptors for granulocyte-macrophage colony-stimulating factor. Exp Hematol 27, 762-772. Lyden, D., Hattori, K., Dias, S., Costa, C , Blaikie, P., Butros, L., Chadburn, A., Heissig, B., Marks, W., Witte, L., et al. (2001). Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nat Med 7, 1194-1201. Machein, M . R., Renninger, S., de Lima-Hahn, E . , and Plate, K. H . (2003). Minor contribution of bone marrow-derived endothelial progenitors to the vascularization of murine gliomas. Brain Pathol 13, 582-597.  167  Maglione, D., Guerriero, V . , Viglietto, G., Delli-Bovi, P., and Persico, M . G. (1991). Isolation of a human placenta cDNA coding for a protein related to the vascular permeability factor. Proc Natl Acad Sci U S A 88, 9267-9271. Maisonpierre, P. C , Suri, C , Jones, P. F., Bartunkova, S., Wiegand, S. J., Radziejewski, C., Compton, D., McClain, J., Aldrich, T. H . , Papadopoulos, N., et al. (1997). Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277, 55-60. Mangi, M . H . , and Newland, A . C. (1999). Interleukin-3 in hematology and oncology: current state of knowledge and future directions. Cytokines Cell Mol Ther 5, 87-95. Markowitz, D. G., Goff, S. P., and Bank, A. (1988). Safe and efficient ecotropic and amphotropic packaging lines for use in gene transfer experiments. Trans Assoc A m Physicians 101, 212-218. Martinez-Moczygemba, M . , and Huston, D. P. (2003). Biology of common beta receptorsignaling cytokines: IL-3, IL-5, and GM-CSF. J Allergy Clin Immunol 112, 653-665. Matsumoto, K., Ohi, H . , and Kanmatsuse, K. (1997). Interleukin 10 and interleukin 13 synergize to inhibit vascular permeability factor release by peripheral blood mononuclear cells from patients with lipoid nephrosis. Nephron 77, 212-218. Matsuoka, S., Tsuji, K., Hisakawa, H . , Xu, M . , Ebihara, Y . , Ishii, T., Sugiyama, D., Manabe, A . , Tanaka, R., Dceda, Y., et al. (2001). Generation of definitive hematopoietic stem cells from murine early yolk sac and paraaortic splanchnopleures by aorta-gonadmesonephros region-derived stromal cells. Blood 98, 6-12. Matthews, W., Jordan, C. T., Gavin, M . , Jenkins, N. A., Copeland, N . G., and Lemischka, I. R. (1991). A receptor tyrosine kinase cDNA isolated from a population of enriched primitive hematopoietic cells and exhibiting close genetic linkage to c-kit. Proc Natl Acad Sci U S A 88, 9026-9030. McCarthy, M . J., Crowther, M . , Bell, P. R., Brindle, N . P., Takahashi, T., Shirasawa, T., Miyake, K., Yahagi, Y . , Maruyama, N., Kasahara, N., et al. (1998). The endothelial receptor tyrosine kinase tie-1 is upregulated by hypoxia and vascular endothelial growth factor Protein tyrosine kinases expressed in glomeruli and cultured glomerular cells: Flt-1 and V E G F expression in renal mesangial cells. FEBS Lett 423, 334-338. Medvinsky, A . , and Dzierzak, E. (1996). Definitive hematopoiesis is autonomously initiated by the A G M region. Cell 86, 897-906.  168  Melani, C , Chiodoni, C , Forni, G., and Colombo, M . P. (2003). Myeloid cell expansion elicited by the progression of spontaneous mammary carcinomas in c-erbB-2 transgenic B A L B / c mice suppresses immune reactivity. Blood 102, 2138-2145. Melder, R. J., Koenig, G. C , Munn, L. L . , and Jain, R. K. (1996a). Adhesion of activated natural killer cells to tumor necrosis factor- alpha-treated endothelium under physiological flow conditions. Nat Immun 15, 154-163. Melder, R. J., Koenig, G. C , Witwer, B. P., Safabakhsh, N . , Munn, L . L . , and Jain, R. K. (1996b). During angiogenesis, vascular endothelial growth factor and basic fibroblast growth factor regulate natural killer cell adhesion to tumor endothelium. Nat Med 2, 992997. Mergia, A . , Tischer, E . , Graves, D., Tumolo, A., Miller, J., Gospodarowicz, D., Abraham, J. A . , Shipley, G . D., and Fiddes, J. C. (1989). Structural analysis of the gene for human acidic fibroblast growth factor. Biochem Biophys Res Commun 164, 11211129. Messner, H . A . (1998). Human hematopoietic progenitor in bone marrow and peripheral blood. Stem Cells 16 Suppl 1, 93-96. Mesters, R. M . , Padro, T., Bieker, R., Steins, M . , Kreuter, M . , Goner, M . , Kelsey, S., Scigalla, P., Fiedler, W., Buchner, T., and Berdel, W. E . (2001). Stable remission after administration of the receptor tyrosine kinase inhibitor SU5416 in a patient with refractory acute myeloid leukemia. Blood 98, 241-243. Meyer, M . , Clauss, M . , Lepple-Wienhues, A., Waltenberger, J., Augustin, H . G., Ziche, M . , Lanz, C , Buttner, M . , Rziha, H . J., and Dehio, C. (1999). A novel vascular endothelial growth factor encoded by Orf virus, V E G F - E , mediates angiogenesis via signalling through VEGFR-2 (KDR) but not VEGFR-1 (Flt-1) receptor tyrosine kinases. Embo J 18, 363-374. Miao, H . Q., Soker, S., Feiner, L . , Alonso, J. L., Raper, J. A . , and Klagsbrun, M . (1999). Neuropilin-1 mediates collapsin-l/semaphorin III inhibition of endothelial cell motility: functional competition of collapsin-1 and vascular endothelial growth factor-165. J Cell Biol 146, 233-242. Migdal, M . , Huppertz, B., Tessler, S., Comforti, A . , Shibuya, M . , Reich, R., Baumann, H., and Neufeld, G. (1998). Neuropilin-1 is a placenta growth factor-2 receptor. J Biol Chem 273, 22272-22278. Mildner, M . , Weninger, W., Trautinger, F., Ban, J., and Tschachler, E . (1999). U V A and U V B radiation differentially regulate vascular endothelial growth factor expression in keratinocyte-derived cell lines and in human keratinocytes. Photochem Photobiol 70, 674-679.  169  Miron, T., Vancompernolle, K., Vandekerckhove, J., Wilchek, M . , and Geiger, B. (1991). A 25-kD inhibitor of actin polymerization is a low molecular mass heat shock protein. J Cell Biol 7/4, 255-261. Miyazawa, K., Hendrie, P. C , Mantel, C , Wood, K., Ashman, L . K., and Broxmeyer, H . E. (1991). Comparative analysis of signaling pathways between mast cell growth factor (c-kit ligand) and granulocyte-macrophage colony-stimulating factor in a human factordependent myeloid cell line involves phosphorylation of Raf-1, GTPase-activating protein and mitogen-activated protein kinase. Exp Hematol 19, 1110-1123. Mohle, R., Green, D., Moore, M . A., Nachman, R. L., and Rafii, S. (1997). Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets. Proc Natl Acad Sci U S A 94, 663-668. Moore, M . A . , and Metcalf, D. (1970). Ontogeny of the haemopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br J Haematol 18, 279-296. Mordvinov, V . A . , and Sanderson, C. J. (2001). Regulation of IL-5 expression. Arch Immunol Ther Exp (Warsz) 49, 345-351. Mukhopadhyay, D., Nagy, J. A., Manseau, E . J., and Dvorak, H . F. (1998). Vascular permeability factor/vascular endothelial growth factor- mediated signaling in mouse mesentery vascular endothelium. Cancer Res 58, 1278-1284. Muller, A . M . , Medvinsky, A . , Strouboulis, J., Grosveld, F., and Dzierzak, E . (1994). Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1, 291301. Murayama, T., Tepper, O. M . , Silver, M . , Ma, H . , Losordo, D. W., Isner, J. M . , Asahara, T., and Kalka, C. (2002). Determination of bone marrow-derived endothelial progenitor cell significance in angiogenic growth factor-induced neovascularization in vivo. Exp Hematol 30, 967-972. Murohara, T., Horowitz, J. R., Silver, M . , Tsurumi, Y . , Chen, D., Sullivan, A . , and Isner, J. M . (1998). Vascular endothelial growth factor/vascular permeability factor enhances vascular permeability via nitric oxide and prostacyclin. Circulation 97, 99-107. Mustonen, T., and Alitalo, K. (1995). Endothelial receptor tyrosine kinases involved in angiogenesis. J Cell Biol 129, 895-898. Nathan, C , and Xie, Q. W. (1994). Regulation of biosynthesis of nitric oxide. J Biol Chem2f59, 13725-13728. Nerlov, C , and Graf, T. (1998). P U . l induces myeloid lineage commitment in multipotent hematopoietic progenitors. Genes Dev 12, 2403-2412.  170  Neufeld, G., Cohen, T., Gengrinovitch, S., and Poltorak, Z. (1999). Vascular endothelial growth factor (VEGF) and its receptors. F A S E B J 13, 9-22. Neufeld, G., Tessler, S., Gitay-Goren, H . , Cohen, T., and Levi, B. Z. (1994). Vascular endothelial growth factor and its receptors. Prog Growth Factor Res 5, 89-97. Newman, P. J. (1997). The biology of PECAM-1. J Clin Invest 99, 3-8. Nicholson, D. W., and Thornberry, N . A. (1997). Caspases: killer proteases. Trends Biochem Sci 22, 299-306. Nieda, M . , Nicol, A., Denning-Kendall, P., Sweetenham, J., Bradley, B., and Hows, J. (1997). Endothelial cell precursors are normal components of human umbilical cord blood. Br J Haematol 98,115-111. Nowak, J. S. (1985). Loss of antibody production accompanied by chromosome loss in a cloned hybrid line secreting antibodies to sheep red blood cells. Experientia 41, 88-89. Ogawa, M . (1993). Differentiation and proliferation of hematopoietic stem cells. Blood 81, 2844-2853. Ogawa, S., Oku, A . , Sawano, A., Yamaguchi, S., Yazaki, Y . , and Shibuya, M . (1998). A novel type of vascular endothelial growth factor, V E G F - E (NZ-7 VEGF), preferentially utilizes KDR/Flk-1 receptor and carries a potent mitotic activity without heparin-binding domain. J Biol Chem 273, 31273-31282. Ohishi, K., Katayama, N . , Shiku, H . , Varnum-Finney, B., and Bernstein, I. D. (2003). Notch signalling in hematopoiesis. Semin Cell Dev Biol 14, 143-150. Ohishi, K., Varnum-Finney, B., Serda, R. E . , Anasetti, C , and Bernstein, I. D. (2001). The Notch ligand, Delta-1, inhibits the differentiation of monocytes into macrophages but permits their differentiation into dendritic cells. Blood 98, 1402-1407. Okabe, M . , Ikawa, M . , Kominami, K., Nakanishi, T., and Nishimune, Y . (1997). 'Green mice' as a source of ubiquitous green cells. FEBS Lett 407, 313-319. Okada, F., Rak, J. W., Croix, B. S., Lieubeau, B., Kaya, M . , Roncari, L., Shirasawa, S., Sasazuki, T., and Kerbel, R. S. (1998). Impact of oncogenes in tumor angiogenesis: mutant K-ras up-regulation of vascular endothelial growth factor/vascular permeability factor is necessary, but not sufficient for tumorigenicity of human colorectal carcinoma cells. Proc Natl Acad Sci U S A 95, 3609-3614.  171  Olofsson, B., Korpelainen, E . , Pepper, M . S., Mandriota, S. J., Aase, K . , Kumar, V . , Gunji, Y . , Jeltsch, M . M . , Shibuya, M . , Alitalo, K . , and Eriksson, U . (1998). Vascular endothelial growth factor B (VEGF-B) binds to V E G F receptor-1 and regulates plasminogen activator activity in endothelial cells. Proc Natl Acad Sci U S A 95, 1170911714. Olofsson, B., Pajusola, K., Kaipainen, A., von Euler, G., Joukov, V., Saksela, O., Orpana, A., Pettersson, R. F., Alitalo, K., and Eriksson, U . (1996a). Vascular endothelial growth factor B, a novel growth factor for endothelial cells. Proc Natl Acad Sci U S A 93, 25762581. Olofsson, B., Pajusola, K., von Euler, G . , Chilov, D., Alitalo, K . , and Eriksson, U . (1996b). Genomic organization of the mouse and human genes for vascular endothelial growth factor B (VEGF-B) and characterization of a second splice isoform. J Biol Chem 271, 19310-19317. Otto, K. G., Broudy, V . C , Lin, N . L., Parganas, E., Luthi, J. N., Drachman, J. G., Rile, J. N., and Blau, C. A . (2001a). Membrane localization is not required for Mpl function in normal hematopoietic cells. Blood 98, 2077-2083. Otto, K. G., Jin, L., Spencer, D. M . , and Blau, C. A . (2001b). Cell proliferation through forced engagement of c-Kit and Flt-3. Blood 97, 3662-3664. Oyama, T., Ran, S., Ishida, T., Nadaf, S., Kerr, L., Carbone, D. P., and Gabrilovich, D. I. (1998). Vascular endothelial growth factor affects dendritic cell maturation through the inhibition of nuclear factor-kappa B activation in hemopoietic progenitor cells. J Immunol 160, 1224-1232. Padro, T., Bieker, R., Ruiz, S., Steins, M . , Retzlaff, S., Burger, H., Buchner, T., Kessler, T., Herrera, F., Kienast, J., et al. (2002). Overexpression of vascular endothelial growth factor (VEGF) and its cellular receptor K D R (VEGFR-2) in the bone marrow of patients with acute myeloid leukemia. Leukemia 16, 1302-1310. Padro, T., Ruiz, S., Bieker, R., Burger, H., Steins, M . , Kienast, J., Buchner, T., Berdel, W. E., and Mesters, R. M . (2000). Increased angiogenesis in the bone marrow of patients with acute myeloid leukemia. Blood 95, 2637-2644. Pai, S. Y., Truitt, M . L., Ting, C. N., Leiden, J. M . , Glimcher, L. H., and Ho, I. C . (2003). Critical roles for transcription factor GATA-3 in thymocyte development. Immunity 19, 863-875. Pal, S., Claffey, K. P., Dvorak, H . F., and Mukhopadhyay, D. (1997). The von HippelLindau gene product inhibits vascular permeability factor/vascular endothelial growth factor expression in renal cell carcinoma by blocking protein kinase C pathways. J Biol Chem 272, 27509-27512.  172  Palis, J., Robertson, S., Kennedy, M . , Wall, C , and Keller, G. (1999). Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development 126, 5073-5084. Palis, J., and Yoder, M . C. (2001). Yolk-sac hematopoiesis: the first blood cells of mouse and man. Exp Hematol 29, 927-936. Pardanaud, L . , Altmann, C., Kitos, P., Dieterlen-Lievre, F., and Buck, C. A. (1987). Vasculogenesis in the early quail blastodisc as studied with a monoclonal antibody recognizing endothelial cells. Development 100, 339-349. Park, J. E., Chen, H. H., Winer, J., Houck, K. A . , and Ferrara, N . (1994). Placenta growth factor. Potentiation of vascular endothelial growth factor bioactivity, in vitro and in vivo, and high affinity binding to Flt-1 but not to Flk-l/KDR. J Biol Chem 269, 25646-25654. Park, J. E., Keller, G. A . , and Ferrara, N. (1993). The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound V E G F . Mol Biol Cell 4, 1317-1326. Partanen, T. A., Makinen, T., Arola, J., Suda, T., Weich, H . A . , and Alitalo, K. (1999). Endothelial growth factor receptors in human fetal heart. Circulation 100, 583-586. Patterson, C , Perrella, M . A . , Endege, W. O., Yoshizumi, M . , Lee, M . E . , and Haber, E . (1996). Downregulation of vascular endothelial growth factor receptors by tumor necrosis factor-alpha in cultured human vascular endothelial cells. J Clin Invest 98, 490496. Peault, B. M . , Thiery, J. P., and Le Douarin, N . M . (1983). Surface marker for hemopoietic and endothelial cell lineages in quail that is defined by a monoclonal antibody. Proc Natl Acad Sci U S A 80, 2976-2980. Peichev, M . , Naiyer, A . J., Pereira, D., Zhu, Z., Lane, W. J., Williams, M . , Oz, M . C , Hicklin, D. J., Witte, L., Moore, M . A., and Rafii, S. (2000). Expression of VEGFR-2 and A C 133 by circulating human CD34(+) cells identifies a population of functional endothelial precursors. Blood 95, 952-958. Pelosi, E . , Valtieri, M . , Coppola, S., Botta, R., Gabbianelli, M . , Lulli, V . , Marziali, G., Masella, B., Muller, R., Sgadari, C , et al. (2002). Identification ofthe hemangioblast in postnatal life. Blood 100, 3203-3208. Pertovaara, L . , Kaipainen, A., Mustonen, T., Orpana, A., Ferrara, N., Saksela, O., and Alitalo, K. (1994). Vascular endothelial growth factor is induced in response to transforming growth factor-beta in fibroblastic and epithelial cells. J Biol Chem 269, 6271-627'A.  173  Petrie, H . T. (2003). Cell migration and the control of post-natal T-cell lymphopoiesis in the thymus. Nat Rev Immunol 3, 859-866. Piacibello, W., Fubini, L., Sanavio, F., Brizzi, M . F., Severino, A., Garetto, L., Stacchini, A., Pegoraro, L . , and Aglietta, M . (1995). Effects of human FLT3 ligand on myeloid leukemia cell growth: heterogeneity in response and synergy with other hematopoietic growth factors. Blood 86, 4105-4114. Plouet, J., and Bayard, F. (1994). Regulations of vasculatropin/vascular endothelial growth factor bioavailability. Horm Res 42, 14-19. Poltorak, Z., Cohen, T., Sivan, R., Kandelis, Y., Spira, G., Vlodavsky, I., Keshet, E., and Neufeld, G. (1997). VEGF145, a secreted vascular endothelial growth factor isoform that binds to extracellular matrix. J Biol Chem 272, 7151-7158. Pratt, C. I., Wu, S. Q., Bhattacharya, M . , Kao, C , Gilchrist, K. W., and Reznikoff, C. A. (1992). Chromosome losses in tumorigenic revertants of EJ/ras-expressing somatic cell hybrids. Cancer Genet Cytogenet 59, 180-190. Pruned, G., Bertolini, F., Soligo, D., Carboni, N . , Cortelezzi, A . , Ferrucci, P. F., Buffa, R., Lambertenghi-Deliliers, G., and Pezzella, F. (1999). Angiogenesis in myelodysplastic syndromes. Br J Cancer 81, 1398-1401. Quirici, N., Soligo, D., Caneva, L . , Servida, F., Bossolasco, P., and Deliliers, G. L . (2001) . Differentiation and expansion of endothelial cells from human bone marrow CD133(+) cells. Br J Haematol 115, 186-194. Rafii, S., Heissig, B., and Hattori, K. (2002). Efficient mobilization and recruitment of marrow-derived endothelial and hematopoietic stem cells by adenoviral vectors expressing angiogenic factors. Gene Ther 9, 631-641. Rajantie, I., Ilmonen, M . , Alminaite, A., Ozerdem, U., Alitalo, K., and Salven, P. (2004). Adult bone marrow-derived cells recruited during angiogenesis comprise precursors for periendothelial vascular mural cells. Blood 10, 10. Ramalho-Santos, M . , Yoon, S., Matsuzaki, Y . , Mulligan, R. C , and Melton, D. A . (2002) . "Sternness": transcriptional profiling of embryonic and adult stem cells. Science 298, 597-600. Redaelli, C. A., Semela, D., Carrick, F. E., Ledermann, M . , Candinas, D., Sauter, B., and Dufour, J. F. (2004). Effect of vascular endothelial growth factor on functional recovery after hepatectomy in lean and obese mice. J Hepatol 40, 305-312. Rehman, J., L i , J., Orschell, C. M . , and March, K. L . (2003). Peripheral blood "endothelial progenitor cells" are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation 107, 1164-1169.  174  Rekhtman, N., Radparvar, F., Evans, T., and Skoultchi, A . I. (1999). Direct interaction of hematopoietic transcription factors P U . l and GATA-1: functional antagonism in erythroid cells. Genes Dev 13, 1398-1411. Reyes, M . , Dudek, A . , Jahagirdar, B., Koodie, L . , Marker, P. H . , and Verfaillie, C. M . (2002) . Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 109, 337-346. Ria, R., Roccaro, A. M . , Merchionne, F., Vacca, A . , Dammacco, F., and Ribatti, D. (2003) . Vascular endothelial growth factor and its receptors in multiple myeloma. Leukemia 77, 1961-1966. Richard, D. E., Berra, E., and Pouyssegur, J. (1999). Angiogenesis: how a tumor adapts to hypoxia. Biochem Biophys Res Commun 266, 718-722. Richard, R. E . , Wood, B., Zeng, H . , Jin, L . , Papayannopoulou, T., and Blau, C. A . (2000). Expansion of genetically modified primary human hemopoietic cells using chemical inducers of dimerization. Blood 95, 430-436. Risau, W. (1997). Mechanisms of angiogenesis. Nature 386, 671-67'4. Risau, W., and Flamme, I. (1995). Vasculogenesis. Annu Rev Cell Dev Biol 77, 73-91. Ristimaki, A . , Narko, K . , Enholm, B., Joukov, V . , and Alitalo, K. (1998). Proinflammatory cytokines regulate expression of the lymphatic endothelial mitogen vascular endothelial growth factor-C. J Biol Chem 273, 8413-8418. Robb, L . , Elwood, N . J., Elefanty, A . G., Kontgen, F., L i , R., Barnett, L . D., and Begley, C. G. (1996). The sci gene product is required for the generation of all hematopoietic lineages in the adult mouse. E M B O J 75, 4123-4129. Robb, L . , Lyons, I., L i , R., Hartley, L . , Kontgen, F., Harvey, R. P., Metcalf, D., and Begley, C. G. (1995). Absence of yolk sac hematopoiesis from mice with a targeted disruption ofthe sci gene. Proc Natl Acad Sci U S A 92, 7075-7079. Robinson, C. J., and Stringer, S. E . (2001). The splice variants of vascular endothelial growth factor (VEGF) and their receptors. J Cell Sci 114, 853-865. Rouse, J., Cohen, P., Trigon, S., Morange, M . , Alonso-Llamazares, A., Zamanillo, D., Hunt, T., and Nebreda, A . R. (1994). A novel kinase cascade triggered by stress and heat shock that stimulates M A P K A P kinase-2 and phosphorylation of the small heat shock proteins. Cell 78, 1027-1037.  175  Rousseau, S., Houle, F., Landry, J., and Huot, J. (1997). p38 Map kinase activation by vascular endothelial growth factor mediates actin reorganization and cell migration in human endothelial cells. Oncogene 15, 2169-2177. Ruggeri, Z. M . (2003). Von Willebrand factor, platelets and endothelial cell interactions. J Thromb Haemost 1, 1335-1342. Ruhrberg, C. (2003). Growing and shaping the vascular tree: multiple roles for V E G F . Bioessays 25, 1052-1060. Ruoslahti, E. (2002). Specialization of tumour vasculature. Nat Rev Cancer 2, 83-90. Ryuto, M . , Ono, M . , Izumi, H., Yoshida, S., Weich, H . A., Kohno, K., and Kuwano, M . (1996). Induction of vascular endothelial growth factor by tumor necrosis factor alpha in human glioma cells. Possible roles of SP-1. J Biol Chem 271, 28220-28228. Saito, H., Tujitani, S., Dceguchi, M . , Maeta, M . , and Kaibara, N . (1999). Neoangiogenesis and relationship to nuclear p53 accumulation and vascular endothelial growth factor expression in advanced gastric carcinoma. Oncology 57, 164-172. Salven, P., Mustjoki, S., Alitalo, R., Alitalo, K . , and Rafii, S. (2003). VEGFR-3 and CD 133 identify a population of CD34+ lymphatic/vascular endothelial precursor cells. Blood 101, 168-172. Santos, S. C , and Dias, S. (2004). Internal and external autocrine V E G F / K D R loops regulate survival of subsets of acute leukemia through distinct signaling pathways. Blood 103, 3883-3889. Sawano, A . , Iwai, S., Sakurai, Y . , Ito, M . , Shitara, K . , Nakahata, T., and Shibuya, M . (2001) . Fit-1, vascular endothelial growth factor receptor 1, is a novel cell surface marker for the lineage of monocyte-macrophages in humans. Blood 97, 785-791. Sawano, A . , Takahashi, T., Yamaguchi, S., and Shibuya^ M . (1997). The phosphorylated 1169-tyrosine containing region of fit-1 kinase (VEGFR-1) is a major binding site for PLCgamma. Biochem Biophys Res Commun 238, 487-491. Schroeder, T., Kohlhof, H . , Rieber, N . , and Just, U . (2003). Notch signaling induces multilineage myeloid differentiation and up-regulates P U . l expression. J Immunol 170, 5538-5548. Schuch, G., Machluf, M . , Bartsch, G., Jr., Nomi, M . , Richard, H., Atala, A., and Soker, S. (2002) . In vivo administration of vascular endothelial growth factor (VEGF) and its antagonist, soluble neuropilin-1, predicts a role of V E G F in the progression of acute myeloid leukemia in vivo. Blood 100, 4622-4628.  176  Schuh, A . C , Faloon, P., Hu, Q. L . , Bhimani, M . , and Choi, K. (1999). In vitro hematopoietic and endothelial potential of flk-1 (-/-) embryonic stem cells and embryos. Proc Natl Acad Sci U S A 96, 2159-2164. Seetharam, L . , Gotoh, N . , Maru, Y . , Neufeld, G., Yamaguchi, S., and Shibuya, M . (1995). A unique signal transduction from F L T tyrosine kinase, a receptor for vascular endothelial growth factor V E G F . Oncogene 10, 135-147. Semenza, G. L . , Agani, F., Iyer, N., Kotch, L . , Laughner, E . , Leung, S., and Yu, A. (1999). Regulation of cardiovascular development and physiology by hypoxia- inducible factor 1. Ann N Y Acad Sci 874, 262-268. Senger, D. R., Galli, S. J., Dvorak, A. M . , Perruzzi, C. A., Harvey, V . S., and Dvorak, H . F. (1983). Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science 219, 983-985. Sensebe, L . , Deschaseaux, M . , L i , J., Herve, P., and Charbord, P. (1997). The broad spectrum of cytokine gene expression by myeloid cells from the human marrow microenvironment. Stem Cells 15, 133-143. Shalaby, F., Ho, J., Stanford, W. L . , Fischer, K. D., Schuh, A . C , Schwartz, L . , Bernstein, A., and Rossant, J. (1997). A requirement for Flkl in primitive and definitive hematopoiesis and vasculogenesis. Cell 89, 981-990. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M . , Wu, X . F., Breitman, M . L., and Schuh, A . C . (1995). Failure of blood-island formation and vasculogenesis in Flk-1 deficient mice. Nature 376, 62-66. Shen, B. Q., Lee, D. Y . , Gerber, H . P., Keyt, B. A., Ferrara, N . , and Zioncheck, T. F. (1998). Homologous up-regulation of KDR/Flk-1 receptor expression by vascular endothelial growth factor in vitro. J Biol Chem 273, 29979-29985. Shen, B. Q., Lee, D. Y . , and Zioncheck, T. F. (1999). Vascular endothelial growth factor governs endothelial nitric-oxide synthase expression via a KDR/Flk-1 receptor and a protein kinase C signaling pathway. J Biol Chem 274, 33057-33063. Shepard, J. L., and Zon, L . I. (2000). Developmental derivation of embryonic and adult macrophages. Curr Opin Hematol 7, 3-8. Shi, Q., Rafii, S., Wu, M . H., Wijelath, E . S., Yu, C , Ishida, A . , Fujita, Y . , Kothari, S., Mohle, R., Sauvage, L . R., et al. (1998). Evidence for circulating bone marrow-derived endothelial cells. Blood 92, 362-367. Shibuya, M . (2001). Structure and dual function of vascular endothelial growth factor receptor-1 (Flt-1). Int J Biochem Cell Biol 33, 409-420.  177  Shibuya, M . , Ito, N . , and Claesson-Welsh, L . (1999). Structure and function of vascular endothelial growth factor receptor-1 and -2. Curr Top Microbiol Irnmunol 237, 59-83. Shivdasani, R. A . , Mayer, E . L., and Orkin, S. H . (1995). Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-l/SCL. Nature 373, 432-434. Shore, V . H . , Wang, T. H . , Wang, C. L., Torry, R. J., Caudle, M . R., and Torry, D. S. (1997). Vascular endothelial growth factor, placenta growth factor and their receptors in isolated human trophoblast. Placenta 18, 657-665. Siemeister, G., Weindel, K., Mohrs, K., Barleon, B., Martiny-Baron, G . , and Marme, D. (1996). Reversion of deregulated expression of vascular endothelial growth factor in human renal carcinoma cells by von Hippel-Lindau tumor suppressor protein. Cancer Res 56,2299-2301. Smith, E., and Sigvardsson, M . (2004). The roles of transcription factors in B lymphocyte commitment, development, and transformation. J Leukoc Biol 75, 973-981. Soker, S., Takashima, S., Miao, H . Q., Neufeld, G., and Klagsbrun, M . (1998). Neuropilin-1 is expressed by endothelial and tumor cells as an isoform- specific receptor for vascular endothelial growth factor. Cell 92, 735-745. Stacker, S. A . , Vitali, A., Caesar, C , Domagala, T., Groenen, L . C , Nice, E., Achen, M . G., and Wilks, A . F. (1999). A Mutant Form of Vascular Endothelial Growth Factor (VEGF) That Lacks V E G F Receptor-2 Activation Retains the Ability to Induce Vascular Permeability. J Biol Chem 274, 34884-34892. Stainier, D. Y., Weinstein, B. M . , Detrich, H . W., 3rd, Zon, L . I., and Fishman, M . C. (1995). Cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development 121, 3141-3150. Stein, I., Itin, A., Einat, P., Skaliter, R., Grossman, Z., and Keshet, E. (1998). Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. Mol Cell Biol 18, 3112-3119. Stein, I., Neeman, M . , Shweiki, D., Itin, A., and Keshet, E . (1995). Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes. Mol Cell Biol 15, 5363-5368. Stephens, L . R., Jackson, T. R., and Hawkins, P. T. (1993). Agonist-stimulated synthesis of phosphatidylinositol(3,4,5)- trisphosphate: a new intracellular signalling system? Biochim Biophys Acta 1179, 27-75. Sui, X., Krantz, S. B., and Zhao, Z. J. (2000). Stem cell factor and erythropoietin inhibit apoptosis of human erythroid progenitor cells through different signalling pathways. Br J Haematol 110, 63-70.  178  Suri, C , Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C , Davis, S., Sato, T. N., and Yancopoulos, G. D. (1996). Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 87, 1171-1180. Suzuki, H . , Seto, K . , Shinoda, Y . , Mori, M . , Ishimura, Y . , Suematsu, M . , and Ishii, H . (1999). Paracrine upregulation of V E G F receptor mRNA in endothelial cells by hypoxiaexposed hep G2 cells. A m J Physiol 276, G92-97. Takahashi, A., Kono, K . , Ichihara, F., Sugai, H . , Fujii, H . , and Matsumoto, Y . (2004). Vascular endothelial growth factor inhibits maturation of dendritic cells induced by lipopolysaccharide, but not by proinflammatory cytokines. Cancer Immunol Immunother 53, 543-550. Takahashi, K . , and Naito, M . (1993). Development, differentiation, and proliferation of macrophages in the rat yolk sac. Tissue Cell 25, 351-362. Takahashi, T., and Shibuya, M . (1997). The 230 kDa mature form of KDR/Flk-1 (VEGF receptor-2) activates the PLC-gamma pathway and partially induces mitotic signals in NIH3T3 fibroblasts. Oncogene 14, 2079-2089. Takahashi, Y . , Kitadai, Y . , Bucana, C. D., Cleary, K. R., and Ellis, L . M . (1995). Expression of vascular endothelial growth factor and its receptor, KDR, correlates with vascularity, metastasis, and proliferation of human colon cancer. Cancer Res 55, 39643968. Tanaka, K . , Oda, N . , Iwasaka, C , Abe, M . , and Sato, Y . (1998). Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol 176, 235-244. Terada, N . , Hamazaki, T., Oka, M . , Hoki, M . , Mastalerz, D. M . , Nakano, Y . , Meyer, E . M . , Morel, L . , Petersen, B. E . , and Scott, E . W. (2002). Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 416, 542-545. Terman, B. I., Dougher-Vermazen, M . , Carrion, M . E., Dimitrov, D., Armellino, D. C , Gospodarowicz, D., and Bohlen, P. (1992). Identification of the K D R tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem Biophys Res Commun 187, 1579-1586. Thakker, G. D., Hajjar, D. P., Muller, W. A., and Rosengart, T. K . (1999). The role of phosphatidylinositol 3-kinase in vascular endothelial growth factor signaling. J Biol Chem 274, 10002-10007. Thorsteinsdottir, U . , Sauvageau, G., and Humphries, R. K. (1999). Enhanced in vivo regenerative potential of HOXB4-transduced hematopoietic stem cells with regulation of their pool size. Blood 94, 2605-2612.  179  Tischer, E . , Gospodarowicz, D., Mitchell, R., Silva, M . , Schilling, J., Lau, K., Crisp, T., Fiddes, J. C , and Abraham, J. A. (1989). Vascular endothelial growth factor: a new member of the platelet- derived growth factor gene family. Biochem Biophys Res Commun 165, 1198-1206. Tischer, E . , Mitchell, R., Hartman, T., Silva, M . , Gospodarowicz, D., Fiddes, J. C , and Abraham, J. A . (1991). The human gene for vascular endothelial growth factor. Multiple protein forms are encoded through alternative exon splicing. J Biol Chem 266, 1194711954. Tonini, T., Rossi, F., and Claudio, P. P. (2003). Molecular basis of angiogenesis and cancer. Oncogene 22, 6549-6556. Tran, J., Rak, J., Sheehan, C , Saibil, S. D., LaCasse, E., Korneluk, R. G., and Kerbel, R. S. (1999). Marked induction of the LAP family antiapoptotic proteins survivin and XIAP by V E G F in vascular endothelial cells. Biochem Biophys Res Commun 264, 781-788. Traver, D., and Zon, L. I. (2002). Walking the walk: migration and other common themes in blood and vascular development. Cell 108, 731-734. Trotman, W., Beckett, T., Goncz, K. K . , Beatty, B. G., and Weiss, D. J. (2004). Dual Y chromosome painting and in situ cell-specific immunofluorescence staining in lung tissue: an improved method of identifying donor marrow cells in lung following bone marrow transplantation. Histochem Cell Biol 121, 73-79. Tsai, F. Y . , Keller, G., Kuo, F. C , Weiss, M . , Chen, J., Rosenblatt, M . , Alt, F. W., and Orkin, S. H . (1994). A n early haematopoietic defect in mice lacking the transcription factor G A T A - 2 . Nature 371, 221-226. Tsopanoglou, N . E . , and Maragoudakis, M . E . (1999). On the mechanism of thrombininduced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up- regulation of its receptors. J Biol Chem 274, 23969-23976. Tuder, R. M . , Flook, B. E . , and Voelkel, N. F. (1995). Increased gene expression for V E G F and the V E G F receptors KDR/Flk and Fit in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide. J Clin Invest 95, 1798-1807. Vaandrager, A . B., and de Jonge, H . R. (1996). Signalling by cGMP-dependent protein kinases. Mol Cell Biochem 157, 23-30. Valdembri, D., Serini, G . , Vacca, A., Ribatti, D., and Bussolino, F. (2002). In vivo activation of JAK2/STAT-3 pathway during angiogenesis induced by GM-CSF. F A S E B J 16, 225-227.  180  van der Geer, P., Hunter, T., and Lindberg, R. A . (1994). Receptor protein-tyrosine kinases and their signal transduction pathways. Annu Rev Cell Biol 10, 251-337. Varnum-Finney, B., Xu, L., Brashem-Stein, C , Nourigat, C , Flowers, D., Bakkour, S., Pear, W. S., and Bernstein, I. D. (2000). Pluripotent, cytokine-dependent, hematopoietic stem cells are immortalized by constitutive Notchl signaling. Nat Med 6, 1278-1281. Verstovsek, S., Estey, E., Manshouri, T., Giles, F. J., Cortes, J., Beran, M . , Rogers, A., Keating, M . , Kantarjian, H . , and Albitar, M . (2002). Clinical relevance of vascular endothelial growth factor receptors 1 and 2 in acute myeloid leukaemia and myelodysplastic syndrome. Br J Haematol 118, 151-156. Verstovsek, S., Lunin, S., Kantarjian, H., Manshouri, T., Faderl, S., Cortes, J., Giles, F., and Albitar, M . (2003). Clinical relevance of V E G F receptors 1 and 2 in patients with chronic myelogenous leukemia. Leuk Res 27, 661-669. Vincent, P. A., Xiao, K., Buckley, K. M . , and Kowalczyk, A . P. (2004). VE-cadherin: adhesion at arm's length. A m J Physiol Cell Physiol 286, C987-997. Waltenberger, J., Claesson-Welsh, L . , Siegbahn, A., Shibuya, M . , and Heldin, C. H . (1994). Different signal transduction properties of K D R and Fltl, two receptors for vascular endothelial growth factor. J Biol Chem 269, 26988-26995. Waltenberger, J., Mayr, U . , Pentz, S., and Hombach, V . (1996). Functional upregulation ofthe vascular endothelial growth factor receptor K D R by hypoxia. Circulation 94, 16471654. Waskiewicz, A. J., and Cooper, J. A. (1995). Mitogen and stress response pathways: M A P kinase cascades and phosphatase regulation in mammals and yeast. Curr Opin Cell Biol 7, 798-805. Watt, S. M . , Gschmeissner, S. E., and Bates, P. A. (1995). PECAM-1: its expression and function as a cell adhesion molecule on hemopoietic and endothelial cells. Leuk Lymphoma 17, 229-244. Weintraub, H., Tapscott, S. J., Davis, R. L., Thayer, M . J., Adam, M . A . , Lassar, A . B., and Miller, A . D. (1989). Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc Natl Acad Sci U S A 86, 5434-5438. Wise, L. M . , Veikkola, T., Mercer, A. A . , Savory, L. J., Fleming, S. B., Caesar, C , Vitali, A., Makinen, T., Alitalo, K., and Stacker, S. A. (1999). Vascular endothelial growth factor (VEGF)-like protein from orf virus NZ2 binds to VEGFR2 and neuropilin-1. Proc Natl Acad Sci U S A 96, 3071-3076.  181  Witzenbichler, B., Maisonpierre, P. C , Jones, P., Yancopoulos, G. D., and Isner, J. M . (1998). Chemotactic properties of angiopoietin-1 and -2, ligands for the endothelialspecific receptor tyrosine kinase Tie2. J Biol Chem 273, 18514-18521. Wognum, A . W., Eaves, A. C , and Thomas, T. E . (2003). Identification and isolation of hematopoietic stem cells. Arch Med Res 34, 461-475. Wong, P. M . , Chung, S. W., Chui, D. H . , and Eaves, C. J. (1986). Properties of the earliest clonogenic hemopoietic precursors to appear in the developing murine yolk sac. Proc Natl Acad Sci U S A 83, 3851-3854. Wu, H . M . , Huang, Q., Yuan, Y . , and Granger, H . J. (1996). V E G F induces N O dependent hyperpermeability in coronary venules. Am J Physiol 271, H2735-2739. Xaus, J., Comalada, M . , Valledor, A. F., Cardo, M . , Herrero, C , Soler, C , Lloberas, J., and Celada, A. (2001). Molecular mechanisms involved in macrophage survival, proliferation, activation or apoptosis. Immunobiology 204, 543-550. Xia, P., Aiello, L . P., Ishii, H . , Jiang, Z. Y . , Park, D. J., Robinson, G . S., Takagi, H . , Newsome, W. P., Jirousek, M . R., and King, G. L . (1996). Characterization of vascular endothelial growth factor's effect on the activation of protein kinase C, its isoforms, and endothelial cell growth. J Clin Invest 98, 2018-2026. Xin, X . , Yang, S., Ingle, G., Zlot, C , Rangell, L., Kowalski, J., Schwall, R., Ferrara, N., and Gerritsen, M . E. (2001). Hepatocyte growth factor enhances vascular endothelial growth factor-induced angiogenesis in vitro and in vivo. A m J Pathol 158, 1111-1120. Xu, M . J., Matsuoka, S., Yang, F. C , Ebihara, Y . , Manabe, A., Tanaka, R., Eguchi, M . , Asano, S., Nakahata, T., and Tsuji, K. (2001). Evidence for the presence of murine primitive megakaryocytopoiesis in the early yolk sac. Blood 97, 2016-2022. Yamada, Y . , Warren, A . J., Dobson, C , Forster, A., Pannell, R., and Rabbitts, T. H . (1998). The T cell leukemia L I M protein Lmo2 is necessary for adult mouse hematopoiesis. Proc Natl Acad Sci U S A 95, 3890-3895. Yamaguchi, S., Iwata, K . , and Shibuya, M . (2002). Soluble Flt-1 (soluble VEGFR-1), a potent natural antiangiogenic molecule in mammals, is phylogenetically conserved in avians. Biochem Biophys Res Commun 291, 554-559. Yamane, T., Kunisada, T., Tsukamoto, H . , Yamazaki, H . , Niwa, H . , Takada, S., and Hayashi, S. I. (2001). Wnt signaling regulates hemopoiesis through stromal cells. J Immunol 167, 765-772.  182  Yang, G. Y., Xu, B., Hashimoto, T., Huey, M . , Chaly, T., Jr., Wen, R., and Young, W. L . (2003). induction of focal angiogenesis through adenoviral vector mediated vascular endothelial cell growth factor gene transfer in the mature mouse brain. Angiogenesis 6, 151-158. Ye, Q., Shieh, J. H., Morrone, G., and Moore, M . A . (2004). Expression of constitutively active Notch4 (Int-3) modulates myeloid proliferation and differentiation and promotes expansion of hematopoietic progenitors. Leukemia 18,111-12,1. Yoder, M . C., and Hiatt, K. (1997). Engraftment of embryonic hematopoietic cells in conditioned newborn recipients. Blood 89, 2176-2183. Yoder, M . C., Hiatt, K., Dutt, P., Mukherjee, P., Bodine, D. M . , and Orlic, D. (1997a). Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac. Immunity 7, 335-344. Yoder, M . C , Hiatt, K., and Mukherjee, P. (1997b). In vivo repopulating hematopoietic stem cells are present in the murine yolk sac at day 9.0 postcoitus. Proc Natl Acad Sci U S A 94, 6776-6780. Young, D. C , and Griffin, J. D. (1986). Autocrine secretion of G M - C S F in acute myeloblastic leukemia. Blood 68, 1178-1181. Young, M . R. (2004). Tumor skewing of CD34+ progenitor cell differentiation into endothelial cells. Int J Cancer 109, 516-524. Young, M . R., Newby, M . , and Wepsic, H . T. (1987). Hematopoiesis and suppressor bone marrow cells in mice bearing large metastatic Lewis lung carcinoma tumors. Cancer Res 47,100-105. Young, P. E . , Baumhueter, S., and Lasky, L . A . (1995). The sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development. Blood 85, 96-105. Zachary, I., and Gliki, G. (2001). Signaling transduction mechanisms mediating biological actions of the vascular endothelial growth factor family. Cardiovasc Res 49, 568-581. Zeng, H . , Masuko, M . , Jin, L., Neff, T., Otto, K. G., and Blau, C. A . (2001). Receptor specificity in the self-renewal and differentiation of primary multipotential hemopoietic cells. Blood 98, 328-334. Zermati, Y . , Garrido, C , Amsellem, S., Fishelson, S., Bouscary, D., Valensi, F., Varet, B., Solary, E . , and Hermine, O. (2001). Caspase activation is required for terminal erythroid differentiation. J Exp Med 193, 247-254.  183  Zhang, H., L i , Y . , Li, H . , Bassi, R., Jimenez, X . , Witte, L., Bohlen, P., Hicklin, D., and Zhu, Z. (2004). Inhibition of Both the Autocrine and the Paracrine Growth of Human Leukemia with a Fully Human Antibody Directed Against Vascular Endothelial Growth Factor Receptor 2. Leuk Lymphoma 45, 1887-1897. Zhao, S., Zoller, K., Masuko, M . , Rojnuckarin, P., Yang, X . O., Parganas, E . , Kaushansky, K., Ihle, J. N . , Papayannopoulou, T., Willerford, D. M., et al. (2002). JAK2, complemented by a second signal from c-kit or flt-3, triggers extensive self-renewal of primary multipotential hemopoietic cells. E M B O J 21, 2159-2167. Zheng, Y., McNeill, K., Rector, E . S., and Froese, A . (1995). Phenotypic changes among hybrid rat mast cells. Int Arch Allergy Immunol 108, 231-239. Zhu, Z., Hattori, K., Zhang, H., Jimenez, X., Ludwig, D. L., Dias, S., Kussie, P., Koo, H., Kim, H . J., Lu, D., et al. (2003). Inhibition of human leukemia in an animal model with human antibodies directed against vascular endothelial growth factor receptor 2. Correlation between antibody affinity and biological activity. Leukemia 17, 604-611. Ziegler, B. L . , Valtieri, M . , Porada, G. A., De Maria, R., Muller, R., Masella, B., Gabbianelli, M . , Casella, I., Pelosi, E . , Bock, T., et al. (1999). K D R receptor: a key marker defining hematopoietic stem cells. Science 285, 1553-1558. Zon, L . I. (2001). Self-renewal versus differentiation, a job for the mighty morphogens. Nat Immunol 2, 142-143.  184  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092380/manifest

Comment

Related Items