Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Responses of Pseudomonas aeruginosa to sub-inhibitory antibiotics Brazas, Michelle Denise 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-103809.pdf [ 17.52MB ]
Metadata
JSON: 831-1.0092345.json
JSON-LD: 831-1.0092345-ld.json
RDF/XML (Pretty): 831-1.0092345-rdf.xml
RDF/JSON: 831-1.0092345-rdf.json
Turtle: 831-1.0092345-turtle.txt
N-Triples: 831-1.0092345-rdf-ntriples.txt
Original Record: 831-1.0092345-source.json
Full Text
831-1.0092345-fulltext.txt
Citation
831-1.0092345.ris

Full Text

R E S P O N S E S OF PSEUDOMONAS AERUGINOSA T O S U B - I N H I B I T O R Y ANTIBIOTICS  by MICHELLE DENISE BRAZAS B.Sc. (Pharmacology), McMaster University, 1997 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (MICROBIOLOGY AND IMMUNOLOGY) We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA March 2005 © Michelle Denise Brazas, 2005  ABSTRACT  Emergence of resistance is never far behind the introduction of new antimicrobials. In response to antimicrobial challenge, bacteria have the capacity to alter their genomes in order to survive. Antibiotic environments play an important but poorly defined role in mediating such changes. The primary focus of this research was to further define the role of sub-inhibitory antimicrobials in the bacterial response to antimicrobial challenge, with particular attention to adaptive resistance responses. A greater understanding of this biological signature will help in evaluating dosing regimes, understanding mechanism of action and in designing new antimicrobials. The effect of sub-inhibitory ciprofloxacin was studied here, beginning with a global analysis using custom DNA microarray technology. Before conducting this analysis, a custom DNA microarray to 5,378 of the 5,570 open reading frames in the Pseudomonas aeruginosa genome was designed, constructed and validated, along with the accompanying set of RNA isolation, cDNA preparation and labelling, and microarray hybridization protocols. Analysis of the P. aeruginosa transcriptome following exposure to sub-inhibitory ciprofloxacin found expression changes in numerous genes. Prominent among these changes was up-regulation of the SOS DNA-repair response and the R2/F2 pyocin region. These changes were confirmed at both the transcription and protein level. Mutants in the R2/F2 pyocin region were found to be resistant to quinolones as well as other DNA damaging agents like mitomycin C, highlighting a role for this region in mediating susceptibility to DNA damage. I also found that sub-inhibitory ciprofloxacin, particularly 0.3pg/ml ciprofloxacin, induced adaptive resistance responses in P. aeruginosa. Similar responses were not observed in a R2/F2 pyocin mutant strain, although the extent of the role of the R2/F2 pyocin region in mediating adaptive resistance to ciprofloxacin awaits further characterization. Overall, this study indicated that sub-inhibitory concentrations of ciprofloxacin antimicrobial do play an important role in the development of resistance in P. aeruginosa, and highlight the clinical importance of better understanding bacterial-antimicrobial interactions.  ii  TABLE OF CONTENTS ABSTRACT  ii  T A B L E OF CONTENTS  iii  LIST OF TABLES  vii  LIST OF FIGURES  viii  LIST OF ABBREVIATIONS  xi  ACKNOWLEDGEMENTS  xiii  INTRODUCTION  A. a. b. c. d. B.  C.  Cystic Fibrosis and Pseudomonas aeruginosa Genetics of Cystic Fibrosis Pathogenesis of Cystic Fibrosis Infections in Cystic Fibrosis Antibiotic Therapies and Clinical Outcomes Resistance in Pseudomonas aeruginosa  Pyocins in Pseudomonas aeruginosa  E. a. b. c. d.  1 1 2 5 8 10  Quinolone Antibiotics a. Structure and Activity b. Mechanism of Action c. Quinolone Resistance Mechanisms in Pseudomonas aeruginosa d. Effects of Sub-inhibitory Quinolone Concentrations on Pseudomonas aeruginosa....  D.  F.  1  13 13 15 17 18 20  Microarray Analysis of Gene Expression Microarray Platforms: Advantages and Disadvantages Standards in Microarray Experimentation Statistical Analysis of Microarray Data Methods of Confirming Microarray Data Rationale and Aims of this Study  MATERIALS AND METHODS  27 28 29 33 35 36 38  A. B. C.  Bacterial Strains and Growth Conditions Chemicals Optimization and Development of Microarray Parameters a. Genomic DNA Isolation b. PCR amplification from Genomic DNA c. Synthesis of P-labeled Probe d. Preparation of Nylon Membrane DNA Macroarray e. Hybridization and Image Analysis f. Determination of Amplicon Size, Concentration and Volume g. Determination of Hybridization Temperature and Solution D. Microarray Construction a. Primer Design 32  iii  38 38 38 38 40 40 42 43 43 44 45 45  b. c. d. e. f. g.  PCR Amplification, Purification and Amplicon Evaluation Sequencing of Amplicons Re-suspension and Plate Format Transfer Synthesis of Quality Control Genes Additional Microarray Features Microarray Printing and Storage E. Microarray Quality Assessment a. Verification of Microarray Print Run b. Cross Hybridization F. Microarray Method Development a. Determination of RNA Isolation Methods b. Determination of Genomic DNA Treatment c. Determination of Reverse Transcription Reaction d. Determination of Labeling Method G. Experiments on Ciprofloxacin Treated Cultures a. Determination of Minimum Inhibitory Concentrations b. Growth Curve in Sub-inhibitory Ciprofloxacin c. Time-Kill Assay d. Light Microscopy e. Microarray Experimentation i. RNA Isolation and Evaluation ii. Genomic DNA Treatment and RNA Evaluation iii. Reverse Transcription Reaction iv. cDNA Labeling and Purification v. Microarray Slide Preparation and Sample Hybridization vi. Post-hybridization Microarray Handling vii. Scanning and Image Analysis viii. Background Correction and Normalization ix. Statistical Analysis H. Confirmatory Experiments a. Real-time PCR b. Luminescence Assays c. Twitching Assay d. Transmission Electron Microscopy e. Serial Selection of Genomic Loss of Pyocin/Phage Region RESULTS  63  CHAPTER ONE: Design and Construction of a Pseudomonas Custom Microarray A.  :  45 46 46 46 47 49 49 49 50 50 50 52 52 53 55 55 55 55 56 56 56 57 57 57 58 58 58 59 59 59 59 60 60 61 61  Introduction  63 63  B . l . Optimization of Amplicon Size, Concentration and Volume B. 2. Optimization of Hybridization Temperature and Hybridization Solution C. 1. Evaluation of Amplicon Integrity i. Agarose Gel Analysis of Amplicon Size and Uniqueness ii. Sequencing Analysis C.2. Evaluation of Amplicon Concentration i. Agarose Gel Analysis  iv  63 65 67 67 69 69 69  ii. Capillary Electrophoresis Analysis C. 3. Evaluation of Print Run D.  v  71 » 71  Summary  75  CHAPTER TWO: Method Development for the Pseudomonas Custom Microarray  76  A.  Introduction  76  B.  Comparison of RNA Isolation Methods  76  C.  Evaluation of Genomic DNase Treatments  77  D.  Comparison of Reverse Transcription Reactions  80  E.  Comparison of cDNA Labeling Methods  83  F.  Summary  86  CHAPTER THREE: Quinolone Induction of Adaptive Resistance  87  A. B.  Introduction Determination of the Minimum Inhibitory Concentration to Ciprofloxacin  87 87  C.  Growth Profile in Presence of Ciprofloxacin  88  D.  Time-Kill Assays and Microscopy  88  D. 1. Observation of Adaptive Resistance to Sub-Inhibitory Ciprofloxacin D. 2. Verification of Adaptive Resistance to Sub-Inhibitory Ciprofloxacin E.  88 94  Microarray Studies  96  E. 1. Expression Responses following Treatment with Sub-Inhibitory Ciprofloxacin F. G.  Microarray Confirmation Assays Summary  96 103 103  CHAPTER FOUR: Involvement of Pyocin/Phage Expression in Quinolone Resistance  110  A.  Introduction  110  B.  Microarray Studies  110  B. l . Expression Responses of the R2/F2 Pyocin Region to Sub-inhibitory Ciprofloxacin 110 C.  Microarray Confirmation Assays  Ill  C. l . Real-time PCR Analysis of Expression C. 2. Luminescence Analysis of Expression D.  Ill 111  Analysis of Pyocin/Phage Expression  114  D. l . Luminescent Analysis of Pyocin/Phage Expression i. Novobiocin Dose and Time Course ii. Mitomycin Dose and Time Course iii. Ceftazidime Dose and Time Course  114 114 117 117  E.  Electron Microscope Analysis of Pyocin/Phage Release  122  F.  Determination of the Minimum Inhibitory Concentrations for Pyocin/Phage  Mutants  122 G.  Time-Kill Assays for Pyocin/Phage Mutants  124  H.  Serial Selection of Pyocin/Phage Loss with Sub-inhibitory Ciprofloxacin  127  I.  Summary  129  DISCUSSION  A.  Sub-inhibitory ciprofloxacin induces adaptive resistance in P.  133 aeruginosa  133  B. C. D. E. F. G.  Sub-inhibitory ciprofloxacin induces expression of R2/F2 pyocins R2/F2 pyocin induction is related to DNA damage R2/F2 pyocins have a role in adaptive resistance to sub-inhibitory ciprofloxacin R2/F2 pyocin region is a fluoroquinolone susceptibility determinant R2/F2 pyocins play a role in microbial diversity Future directions  134 137 139 141 142 144  APPENDIX I: Sample data tracking of amplicon uniqueness, size and concentration for all open reading frames used in P. aeruginosa custom DNA microarray 167 APPENDIX II: Sample capillary electrophoresis data for all open reading frames used in P. aeruginosa custom DNA microarray 177 APPENDIX III: Genes up- and down-regulated in P. aeruginosa in response to various concentrations of ciprofloxacin  187  APPENDIX IV: Authors contributions to research and development  226  vi  LIST O F T A B L E S  Table 1: Comparison of features of Pseudomonas aeruginosa pyocins Table 2: R2/F2 pyocin-phage operon of Pseudomonas aeruginosa  21 26  Table 3: Bacterial strains used in this study  39  Table 4: Nucleotide sequences of primers used in this study  41  Table 5: Minimum inhibitory concentrations of various antimicrobials against various strains of P. aeruginosa  89  Table 6: Summary of custom DNA microarray findings and trends  97  Table 7: Expression changes in various genes induced by O.lx-, 0.3x- and lx-MIC ciprofloxacin 100 Table 8: Pyocin/phage operon and related genes induced by 0.3x- and lx-MIC ciprofloxacin.. 104 Table 9: Comparison of expression changes for various genes as analyzed by relative real-time PCR and custom P. aeruginosa microarray  112  Table 10: Minimum inhibitory concentrations of various antimicrobials against various strains of P. aeruginosa  125  vii  LIST O F F I G U R E S  Figure 1: Age specific prevalence of airway infections in patients with CF  6  Figure 2: Structure of quinolone core, nalidixic acid and ciprofloxacin  14  Figure 3: S-type pyocin organization  23  Figure 4: Schematic representation of R-type and F-type pyocins  24  Figure 5: Spotting pattern (version 3) for the P.  48  aeruginosa  custom DNA microarray  Figure 6: Effect of varying concentration and amplicon size on hybridization signal Figure 7: Effect of volume and amplicon size on hybridization signal  64 ..66  Figure 8: Effect of temperature and hybridization solution on hybridization signal  68  Figure 9: Sample agarose gel for evaluation of 96 well PCR and corresponding molecular ladder size range  70  Figure 10: Sample capillary electrophoresis digital agarose gel  72  Figure 11: SYBR Green analysis of upper left sub-grids of P.  aeruginosa  microarray  Figure 12: Terminal transferase Cy-3 label analysis of two sub-grids of the  P.  73  aeruginosa  microarray  74  Figure 13: Comparison of RNA isolation methods  78  Figure 14: Comparison of RNA isolation methods with respect to  viii  rpoC  transcript length  79  Figure 15: Comparison of various Ambion DNase-/ree treatment times for removal of genomic DNA contamination  81  Figure 16: Comparison of cDNA preparations from different initial amounts of total RNA  82  Figure 17: Comparison of direct and indirect cDNA labeling methods  84  Figure 18: Comparison of reverse transcriptase enzymes in the indirect labeling method  85  Figure 19: Growth curve of P. aeruginosa grown with various concentrations of ciprofloxacin.90 Figure 20: Survival ability of P. aeruginosa in 2x-MIC ciprofloxacin following growth in subinhibitory concentrations of ciprofloxacin  92  Figure 21: Survival ability of pretreated cultures of P. aeruginosa in 2x-MIC ciprofloxacin over a longer time frame  93  Figure 22: Gram stains of P. aeruginosa before, during and after the adaptive resistance assay.95 Figure 23: Relationship of genes with significant expression changes induced by O.lx-, 0.3x- and lx-MIC ciprofloxacin in P. aeruginosa  101  Figure 24: Analysis of twitch motility of P. aeruginosa cells cultured in the presence or absence of ciprofloxacin  106  Figure 25: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of ciprofloxacin  113  Figure 26: Growth curve of P. aeruginosa in various concentrations of novobiocin  115  ix  Figure 27: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of novobiocin  116  Figure 28: Growth curve of P. aeruginosa in various concentrations of mitomycin  118  Figure 29: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of mitomycin  119  Figure 30: Growth curve of P. aeruginosa in various concentrations of ceftazidime  120  Figure 31: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of ceftazidime  121  Figure 32: Electron micrographs of supernatants from untreated and 0.3x-MIC ciprofloxacin treated P. aeruginosa strain H103 and PA0620::/wx cells  123  Figure 33: Survival ability of P. aeruginosa strain H103 and PA0620::/wx in 2x-MIC ciprofloxacin following growth in 0.3x-MIC ciprofloxacin  126.  Figure 34: Growth curve of P. aeruginosa strain H103 and PA0620::/wx mutant  128  Figure 35: Potential relationships between ciprofloxacin and the development of resistance... 138  x  LIST O F ABBREVIATIONS  ABC  ATP binding cassette  asialoGM-1  asialoganglioside-1  ASL  airway surface liquid  ATCC  American Type Culture Collection  CCFF  Canadian Cystic Fibrosis Foundation  CF  Cystic fibrosis  CFF  Cystic Fibrosis Foundation  CFU  colony forming units  CFTR  cystic fibrosis transmembrane conductance regulator  ENaC  epithelial Na channel  EtBr  ethidium bromide  GFP  green fluorescent protein  IL-  interleukin-  IROMP  iron regulated outer membrane proteins  LB  Luria-Bertani  LPS  lipopolysaccharide  MIC  minimum inhibitory concentration  M-MuLV  Moloney murine leukemia virus  OD  optical density  OM  outer membrane  ORF  open reading frame  PBS  phosphate buffered saline  PCR  polymerase chain reaction  QRDR  quinolone resistance determining region  RLU  relative light unit  RND  resistance-nodule-cell division  rRT-PCR  relative real-time polymerase chain reaction  RT  reverse transcriptase  RT-PCR  reverse transcription polymerase chain reaction  +  XI  SCV  small colony variant  SDS  sodium lauryl sulfate  SSC  Saline sodium citrate  TEM  transmission electron microscopy  TNF-a  tumor necrosis factor  xii  ACKNOWLEDGEMENTS First and foremost, I would like to thank Dr. Robert E. W. Hancock for his guidance and support throughout my project, for without his constant encouragement and confidence, I would never have taken on nor completed this body of work. He saw more in me than I believed possible, and for this I am grateful. I would also like to thank Dr. Robert Brunham, Dr. Rachel Fernandez, and Dr. Brett Finlay for their expertise and mentorship - I can only aspire. And to my friends and colleagues at Jack Bell Gene Array Facility, Xenon Genetics, Pathogenesis Co., and the University of Toronto Microarray Facility - many thanks for the knowledge and experiences. To my family - I consider this degree as much yours as it is mine, for it would not have been possible without your unwavering love and confidence in me. My immense gratitude extends to countless friends both near and far. I would not have survived this degree without the support and friendship of many people, whom I count myself lucky to have met and come to know well: S.F., M.O., M.S., M.K., K B . , C.R., S.M., K.T., J.B. and T.G. This research was funded by a Canadian Cystic Fibrosis Foundation scholarship and a National Science and Engineering Research Council scholarship granted to M.D.B., and by a Genome Canada research grant to R.E.W.H.  xiii  INTRODUCTION  A. Cystic Fibrosis and Pseudomonas  aeruginosa  a. Genetics of Cystic Fibrosis Cystic fibrosis (CF) of the pancreas was first described in 1938 by Andersen (Andersen 1938). The syndrome was noted to occur in children who failed to thrive past two years of age. Autopsy studies found histopathological lesions of the pancreas, yet the established cause of death was found to be from an associated bronchopulmonary infection of Staphylococcus  aureus.  Production of a "thick, tenacious, greenish gray, purulent material" was also found within the airway lumen (Andersen 1938). This early work by Andersen describes the hallmarks of CF disease: pancreatic insufficiency and chronic airway infections with opportunistic bacterial pathogens, both of which are related to production of a viscous secretion. Since then, treatment has focused on combating these pathophysiological problems with great success. Where this disease once routinely killed patients during infancy, significant advances in nutritional and antimicrobial therapy have greatly improved life expectancy to a median survival age of 35.9 years as reported in 2003 (CCFF 2003). Moreover, advanced nutritional management has shifted the clinical manifestation of CF from intestinal blockade and malnutrition, to progressive loss of pulmonary function caused by chronic bacterial infection. Andersen in 1938 realized that CF was a disease of genetic origin (Andersen 1938). Cysticfibrosisis now known to be inherited as an autosomal recessive trait. The gene believed to be responsible for CF however, was only localized to the long arm of chromosome 7 in 1985 (Tsui, Buchwald et al. 1985; Wainwright, Scambler et al. 1985; White, Woodward et al. 1985), and only identified as the cystic fibrosis transmembrane conductance regulator (CFTR) gene in 1989 (Kerem, Rommens et al. 1989; Riordan, Rommens et al. 1989; Rommens, Iannuzzi et al. 1989). CFTR was found to be a member of the ATP binding cassette (ABC) family of proteins, and to function both as a chloride anion channel and channel regulator. Since its characterization, researchers have identified over 1200 mutations in CFTR responsible for CF (CCFF 2003a), the most common mutation being a deletion of phenylalanine at position 508 (AF508); 85% of all individuals with CF in Canada carry at least one copy of AF508 (CCFF 2003a).  1  Discovery of the CFTR gene brought hope of an imminent cure for cystic fibrosis. With one in every 2,500 children born in Canada being afflicted by CF (CCFF 2003a), this landmark finding held great potential for correcting the underlying defect in cellular ion transport. Although substantial progress toward this goal has been made, CF remains one of the most fatal genetic diseases fifteen years later, namely because the relationship between defects in CFTR and hypersusceptibility to bacterial infection has not been fully elucidated. b. Pathogenesis of Cystic Fibrosis A reasonable scientific explanation of why CF patients initially acquire and then fail to eliminate airway infections has plagued researchers for decades. Both immune function and architecture of the CF lung is essentially normal at birth, except for subtle abnormalities in mucus secretion. Whereas normal healthy airways maintain sterility despite a constant challenge from airborne viruses and bacteria, bacterial infection occurs at an early stage in CF airways (Abman, Ogle et al. 1991; Khan, Wagener et al. 1995). It is the pulmonary complications that result from the interplay between these bacterial infections and the inflammatory responses of the CF lung that account for 80% of CF patient morbidity and mortality (CFF 2003). Pathogenesis of CF in the lung likely begins with the airway epithelial layer. The upper respiratory tract is lined with ciliated epithelia, which are bathed on their apical surface by a thin liquid layer. This airway surface liquid (ASL) layer consists of a periciliary sol and a mucus gel, and is propelled upward out of the lung by the coordinated beating of the cilia (Proctor 1977; Lucas 1994). ASL is required for effective mucociliary clearance, which aided by cough, is the first line of defense against inhaled pathogens. ASL composition and volume reflect the salt and water absorptive and secretory functions of airway epithelia. Hence changes in the cellular transport ability of the epithelia are influenced both the composition and volume of the ASL, contributing to airway disease development. By means of altering the ASL composition and/or volume, mutations in CFTR contribute to CF disease progression. Defining how alterations in CFTR function result in ineffective mucociliary defense has led to two disparate hypotheses. In the high salt hypothesis, emphasis is placed on the function of CFTR as an anion channel (Smith, Karp et al. 1994; Smith, Travis et al. 1996; Zabner, Smith et al. 1998). Defective or absent CFTR results in reduced absorption of chloride ions across the apical membrane from the lumen,  2  hence a high salt concentration and consequently a high volume is observed in the ASL. High salt concentrations have been shown to interfere with the natural killing ability of several innate immune mechanisms like defensins (Goldman, Anderson et al. 1997), thereby facilitating bacterial colonization and airway disease development. In the low volume hypothesis, emphasis is placed on the function of CFTR as a channel regulator (Matsui, Grubb et al. 1998). CFTR negatively regulates amiloride-sensitive epithelial Na channels (ENaC) located on the apical +  surface of epithelial cells (Egan, Flotte et al. 1992; Stutts, Rossier et al. 1997; Donaldson, Poligone et al. 2002), preventing sodium reabsorption from the lumen. Defective or absent CFTR, eliminates CFTR's inhibition of ENaC and results in increased Na absorption. Chloride +  ions passively follow along other shunt pathways, leaving a reduced ion concentration in the lumen which drives increased water absorption. The net result of increased fluid absorption is depletion of the ASL volume and mucus dehydration, resulting in impaired mucociliary clearance and airway obstruction, both of which facilitate bacterial colonization and airway disease development. While mucus thickening and airway blockage may initiate CF pathogenesis, they do not explain the tendency of CF airways to become colonized by bacterial pathogens, especially chronic colonization by P. aeruginosa. As previously mentioned, it is the colonization of and subsequent inflammatory response to bacterial pathogens that is directly correlated with decline in CF lung function (CFF 2003). Infections are known to be initiated by bacterial adherence to host receptors, implying that increased adherence of inhaled organisms to airway epithelia may be critical for bacterial colonization. Studies of piliated strains of P. aeruginosa have shown greater adherence to CF epithelial cells compared to control cells (Prince 1992; Imundo, Barasch et al. 1995); adherence was reduced following introduction of wild type CFTR (Davies, Stern et al. 1997). Although clinical isolates of P. aeruginosa from chronically infected patients tend to be mucoid and non-piliated, piliated strains likely initiate the colonization process (Burns, Gibson et al. 2001). Regenerating respiratory epithelial cells from CF patients have also been shown to express increased levels of asialoganglioside-1 (asialoGM-1) glycolipid on their apical surface and consequently exhibit increased adherence of P. aeruginosa (Saiman and Prince 1993; de Bentzmann, Roger et al. 1996). Adherence was reversed by competitive inhibition with asialoGM-1 antibody (de Bentzmann, Roger et al. 1996), indicating direct bacterial interaction with asialoGM-1 glycolipids. The mechanism by which mutations in CFTR result in  3  undersialylation of these receptors is thought to be related to hyperacidification of the transGolgi network in CF epithelial cells (Poschet, Boucher et al. 2001). Again, while asialoGM-1 receptors may not interact with mucoid, non-piliated clinical isolates (Bryan, Kube et al. 1998), these adhesion sites likely play a role in initiating bacterial colonization. CFTR itself has also been shown to be a receptor for P. aeruginosa. Binding of P. aeruginosa lipopolysaccharide (LPS) core oligosaccharide to CFTR results in bacterial internalization and clearance. Cultured airway epithelial cells expressing the AF508 allele of CFTR were found to be defective in uptake of P. aeruginosa (Pier, Grout et al. 1996). Similarly, bacterial load in the lungs of a neonatal mouse model was increased by addition of exogenous oligosaccharide (Pier, Grout et al. 1996) and overexpression of CFTR in transgenic mice markedly accelerated bacterial clearance (Coleman, Mueschenborn et al. 2003), linking normal CFTR to host defense against bacterial colonization of the lung. Moreover, as for the studies on increased adherence to epithelial cells and asialoGM-1 receptors, only laboratory and nonmucoid clinical isolates of P. aeruginosa have been shown to bind to CFTR; mucoid strains of P. aeruginosa fail to bind CFTR and thus are not effectively cleared from the lung (Schroeder, Reiniger et al. 2001). Consistent with all of these findings, adaptation of P. aeruginosa within the CF airway is associated with modifications to the LPS structure (Ernst, Yi et al. 1999) and conversion to mucoidy (Deretic, Martin et al. 1993; Deretic, Schurr et al. 1994). Changes in bacterial adherence coupled with diminished bacterial clearance capabilities, likely predisposes CF patients to higher rates of airway colonization. Other innate immune responses to infection work in concert with mucociliary clearance and epithelial cell phagocytosis in healthy individuals to rid the lung of airborne pathogens. Airway epithelial cells secrete antimicrobial proteins and peptides into the ASL, including lysozyme and lactoferrin, as well as a- and p-defensins and cathelicidins, to protect the lung against colonization. While there is no evidence of defective antimicrobial peptide secretion in CF patients, altered salt concentrations of CF ASL have been shown to inactivate sensitive antimicrobial peptides, thereby permitting bacterial colonization (Smith, Travis et al. 1996; Goldman, Anderson et al. 1997). Furthermore, once infection with bacterial pathogens is initiated, CF airways exhibit an intense inflammatory response. Stimulated epithelial cells and resident macrophages release interleukin-8 (IL-8) (DiMango, Zar et al. 1995; Khan, Wagener et al. 1995), a potent chemoattractant for neutrophil infiltration into the CF lung. Other mediators including tumor necrosis factor-a (TNF-a) and IL-1 (Wilmott, Kassab et al. 1990), mediate  4  further neutrophil influx and provide additional stimulus for IL-8 production, so that neutrophil influx is sustained. Activated neutrophils are the primary effector cells in the pathogenesis of CF lung disease. Their release of massive amounts of elastase and other proteases, overwhelm intrinsic antiproteases (i.e. a-1 antitrypsin, secretory leukocyte protease inhibitor) (Birrer, McElvaney et al. 1994). Lungs of older CF patients are dominated by persistent neutrophil infiltration, and elevated levels of IL-8 and neutrophil elastase (Bonfield, Panuska et al. 1995). Indiscriminant destruction by neutrophil elastase damages airway epithelia, promoting further inflammatory responses in the airway. With respect to acquired immune responses, there is no evidence of any defects in CF patients that might explain the inability of CF patients to clear airway infections. Outside of the respiratory tract, neither infection rates or severity differ between CF and normal patients (Chmiel, Berger et al. 2002). Furthermore, CF patients mount a significant humoral response to P. aeruginosa antigens, to the extent that the early appearance of these antibodies may improve detection methods of P. aeruginosa infections in young children (Burns, Gibson et al. 2001; West, Zeng et al. 2002). Despite this early and sustained immune response to P. aeruginosa, CF patients are unable to clear P. aeruginosa from their airways. The dominant presence of neutrophils and proteases in the CF lung also plays a role in the ineffectiveness of the acquired immune response. Successful antibody mediated killing depends upon intact complement and Fc receptors on phagocytes. The CF lung however, is neutrophil rich and concentrated with proteases  that  work  to  cleave  complement  and  Fc  receptors,  thereby  reducing  opsonophagocytosis (Chmiel, Berger et al. 2002). Coupled with unresolved and persistent inflammation, airways become progressively dilated and bronchiectatic, eventually crippling the ability of the lung to provide respiration. In summary then, failure of CF lungs to clear initial bacterial infections leads to chronic infection and thus persistent inflammation. This damages the lung architecture and leads to bronchiectasis, progressive airway obstruction and ultimately death of the CF patient. c. Infections in Cystic Fibrosis Data gathered from the Cystic Fibrosis Patient Registry highlights patterns in the overall prevalence and age-related distribution of pathogens in the CF population (Figure 1, (CFF  5  Respiratory Infections v s . A g e 100  -i  0 i 0to1  — 2t05  r-  6to10  11to17  18to24  25to34  35to44  45+  Age  Overall Percentage in 2003: P. aeruginosa 57.2%  S. aureus 51.1%  S. maltophilia  B. cepacia 3.1%  Figure 1:  11.0%  H. influenza  16.8%  —MRSA11.8%  Age specific prevalence of airway infections in patients with CF.  Organisms reported to the U.S. Cystic Fibrosis Patient Registry, 2003. Overall percentage of patients (all ages) who had at least one respiratory tract culture (sputum, bronchoscopy, oropharyngeal or nasal) performed in 2003 that was positive for the following organisms: Pseudomonas aeruginosa (red line), 57.2%; Staphylococcus aureus (green line), 51.1%; Haemophilus influenzae (dark blue line), 16.8%; Stenotrophomonas maltophilia (yellow line), 11.0%; Burkholderia cepacia (black line), 3.1%; and methicillin-resistant Staphylococcus aureus (purple line), 11.8%. Reprinted with permission from reference Cystic Fibrosis Foundation Patient Registry Annual Data Report 2003.  6  2003)). Initial cultures from young CF patients are most often positive for S. aureus and Haemophilus influenzae (Figure 1). As initially noted by Andersen in 1938, CF patients failed to thrive past two years of age, the cause of death being attributed to bronchopulmonary infections of S. aureus (Andersen 1938). Introduction of antimicrobial therapies directed against S. aureus has greatly improved patient lifespan (Thomassen, Demko et al. 1987), although recent studies have indicated prophylactic antistaphylococcal therapy in infants and young children with CF enhances colonization with P. aeruginosa (Ratjen, Comes et al. 2001; Stutman, Lieberman et al. 2002). S. aureus and H. influenzae infections are typically followed by P. aeruginosa infections. Of these infecting organisms, P. aeruginosa is the most prevalent and significant pulmonary pathogen. It is the cause of complicating chronic infections in 80% to 90%) of CF patients (Figure 1) (Hutchison and Govan 1999; CFF 2003). The mean age of P. aeruginosa infection is 15 months or 21 months, the difference depending on the method of detection (Burns, Gibson et al. 2001). Significant correlation however exists between acquisition of P. aeruginosa infection and progressive loss of lung function and mortality in CF patients (Nixon, Armstrong et al. 2001; Emerson, Rosenfeld et al. 2002). The source of P. aeruginosa has not been clearly established, although the wide variety of genotypes seen in isolates from CF patients suggests an environmental reservoir (Burns, Gibson et al. 2001). Although the strain initially acquired is typically an environmental isolate (Burns, Gibson et al. 2001), along the course of disease progression, P. aeruginosa alters many of its phenotypic characteristics. Alteration of these phenotypes appears to be selected within the CF airway (Mulvey, Lopez-Boado et al. 1998) and occurs more frequently with increasing length of infection. With 5,570 predicted open reading frames (ORFs), the genetic complexity of the P. aeruginosa genome affords this organism a tremendous ability to adapt to its environment (Stover, Pham et al. 2000). While initial isolates express a 'smooth' LPS, containing O-side chains and little to no extracellular mucoid polysaccharide (alginate) (Pier 1985), later isolates lose the O-side chain on LPS (Hancock, Mutharia et al. 1983) and acquire a distinctive LPS acylation pattern (Ernst, Yi et al. 1999). Late isolates also tend to be more resistant to antibiotics and frequently mucoid. Conversion to mucoidy is an important phenotypic change because establishment of chronic P. aeruginosa infections in the CF lung correlates with transition of the microbe to a mucoid phenotype (Henry, Mellis et al. 1992). Mucoid conversion is  7  chromosomally encoded (Deretic, Schurr et al. 1994) and hypothesized to be selected for by the CF lung (Mulvey, Lopez-Boado et al. 1998). Indeed, mucoid forms of P. aeruginosa account for 90% of P. aeruginosa isolates from CF patients (Pedersen, Hoiby et al. 1992). Other phenotypic changes include loss of flagella dependent motility (Luzar and Montie 1985; Luzar, Thomassen et al. 1985) and increased auxotrophy (Taylor, Hodson et al. 1992; Taylor, Hodson et al. 1993; Thomas, Ray et al. 2000). P. aeruginosa has also recently been shown to adopt a biofdm mode of growth in the CF lung (Singh, Schaefer et al. 2000; Drenkard and Ausubel 2002). Biofdm communities exhibit characteristically slow growth, and are inherently resistant to antibiotics and thus difficult to eradicate even from immunocompotent individuals (Costerton, Stewart et al. 1999), characteristics which parallel those of CF airway infections. More recently, a high frequency of hypermutability has been identified in P. aeruginosa isolates from CF patients (Oliver, Canton et al. 2000). The selective conditions found in the CF lung including a high degree of compartmentalization, a deteriorating lung environment, and continuous immune defense and antimicrobial challenges, are proposed to mediate this rate of evolution. Furthermore, CF isolates of P. aeruginosa have genomes larger than the laboratory strain, indicative of adaptation and thus acquisition of new genes from its environment (Spencer, Kas et al. 2003). In addition to P. aeruginosa infections, CF patients may also become infected with Burkholderia cepacia, Stenotrophomonas maltophilia, Achromobacter xylosoxidans and fungi  including Aspergillus and nontuberculous mycobacteria (Figure 1). Of these organisms, B. cepacia is the most serious, being associated with a more dramatic decline in lung function and increased mortality (Isles, Maclusky et al. 1984; Thomassen, Demko et al. 1985). d. Antibiotic Therapies and Clinical Outcomes The hallmark in CF research and therapy has been the introduction of antibiotics into the CF treatment strategy. Progress in patient management and life expectancy has come predominantly from antibiotic control of pulmonary infections, in particular infections caused by S. aureus and P. aeruginosa. Proper management of CF lung disease however, requires appropriate antimicrobial therapy tailored to the bacterial pathogens isolated from the respiratory tract. Hence, the choice of antibiotic is based on the periodic isolation and identification of  8  pathogens from respiratory secretions and biopsy samples. Antimicrobial treatment regimes are directed against three distinct clinical stages of CF pulmonary disease (Gibson, Burns et al. 2003). In the first stage during early lung disease, CF patients receive antibiotics prophylatically to eradicate any initial infections and to delay onset of chronic colonization with P. aeruginosa. Since P. aeruginosa isolates at this stage tend to be nonmucoid, highly susceptible to antibiotics and planktonic in nature (Burns, Gibson et al. 2001), they are more amenable to eradication by antibiotic therapy, and are treated with aggressive anti-pseudomonal antibiotics. Once bacterial colonization with either S. aureus or P. aeruginosa has occurred, the second stage objective, so called maintenance therapy, is to administer prolonged antibiotic regimes to slow the progression of lung disease, and to increase the interval between pulmonary exacerbations. Where continuous anti-staphylococcal therapy was once standard practice, this practice is no longer recommended since studies found that such patients had a lower prevalence of S. aureus infections, but a significantly higher rate of P. aeruginosa acquisition (Ratjen, Comes et al. 2001; Stutman, Lieberman et al. 2002). Intermittent antistaphylococcal therapy is currently recommended. Although current practices for maintenance therapy of P. aeruginosa infections range from quarterly intravenous treatments, to inhaled antibiotics and oral quinolones (Gibson, Burns et al. 2003), P. aeruginosa maintenance therapy has been shown to stabilize pulmonary function and decrease morbidity (Ramsey, Pepe et al. 1999). Maintenance therapy practices however, have drawn concern from clinicians over the emergence of increased levels of antibiotic resistance among respiratory pathogens in CF patients. Of particular importance is the emergence of quinolone resistant strains of P. aeruginosa and S. aureus associated with longer monotherapy courses (Ball 1990; Dalhoff 1994). However, while prolonged monotherapy courses are discouraged, ciprofloxacin remains the quinolone of choice for P. aeruginosa infections in CF patients (Gibson, Burns et al. 2003). In addition to daily respiratory challenges, CF patients with chronic pulmonary infections of bacterial pathogens like P. aeruginosa, periodically experience episodes of acute exacerbation. Despite the importance of this third clinical stage, there are no defined criteria or set of standards for classifying an acute episode. Furthermore, there are no clearly outlined treatment regimes. Typically, patients are treated on an outpatient basis with either oral or inhaled antibiotics (Noone and Knowles 1999; Gibson, Burns et al. 2003), where choice of antibiotic again depends upon cultures of airway secretions. Cystic Fibrosis Foundation (CFF) guidelines recommend  9  combining two antipseudomonal antibiotics having different mechanism of action in order to achieve synergy and slow the emergence of resistance (CFF 1994; Noone and Knowles 1999). The effectiveness of therapy is measured by improvements in pulmonary function, reduction in sputum bacterial density and improved quality of life, since eradication of the pathogen or resolution of the inflammatory response rarely occurs. B. Resistance in Pseudomonas aeruginosa The difficulty in eradicating P. aeruginosa infections from the CF lung with antibiotic therapy is also a consequence of the organism itself. Like other gram-negative organisms, P. aeruginosa is intrinsically resistant to the common repertoire of antibiotics. Several factors contribute to this intrinsic resistance, beginning with an unusually restricted outer-membrane permeability (Hancock 1997; Nikaido 1998). The outer membrane (OM) of gram-negative bacteria contributes to this intrinsic resistance by serving as a general permeability barrier, slowing down diffusion of solutes and antibiotics. Hydrophilic compounds thus cross the OM barrier via water filled channels called porins. The major porin in Escherichia coli, OmpF, has a small channel size, thereby physically hindering penetration of even small antimicrobials like fluoroquinolones. Porins in the OM of P. aeruginosa are even more inefficient in diffusion than OmpF (Nikaido, Nikaido et al. 1991), further reducing the influx of solutes and antibiotics across its OM. Lipophilic compounds, in contrast, are capable of dissolving into the lipid bilayer domains of the OM, thereby crossing the OM barrier. The outer monolayer of P. aeruginosa however, is made up of highly negatively charged lipopolysaccharides (LPS), which further restrict passage of lipophilic compounds across its OM. Although the outer membrane serves as a general permeability barrier, the cytoplasmic concentration of many antibiotics reaches one half of the extracellular concentration within 30 seconds in P. aeruginosa (Nikaido 1998). Thus the outer membrane alone is not sufficient to produce significant resistance. Coupled with low OM permeability, are various secondary resistance mechanisms which take advantage of the low antibiotic exposure mediated by the low permeability.  These secondary resistance mechanisms include chromosomally encoded p-  lactamases and multidrug efflux pumps. For resistance to early generations of P-lactam compounds, ubiquitous expression of periplasmic P-lactamases provides resistance in synergy to that afforded by low OM permeability. For resistance to other classes of antibiotics however, expression of inducible  10  multiple drug efflux pumps like mexABoprM or mexCDoprJ, provides resistance against a broad spectrum of antibiotics, again acting in concert with the resistance afforded by low OM permeability. P. aeruginosa can also 'acquire resistance' through mutation of the bacterial genome and/or acquisition of new resistance genes through the horizontal transfer of plasmids and transposons (Davies 1997). Chromosomal mutations arise frequently in P. aeruginosa under antibiotic selective pressure (Kohler, Michea-Hamzehpour et al. 1997) and during times of bacterial stress (Foster 1993; Shapiro 1997), resulting in either target modification and thus reduced antibiotic sensitivity, or diminished antibiotic concentration from mutations in the regulation of multidrug efflux pumps. Some mutations may even produce mutator phenotypes in bacteria (LeClerc, Li et al. 1996; Shapiro 1997; Oliver, Canton et al. 2000), affording the organism an increased propensity of acquiring antibiotic resistance through mutation. Hypermutable strains have been shown to be more resistant to antibiotics, pointing to a link between high mutation rates and the evolution of antibiotic resistance (Oliver, Canton et al. 2000). Similarly, antibiotics like fluoroquinolones, induce an SOS response and increase mutability (Mamber, Kolek et al. 1993), further contributing to antibiotic resistance acquired through mutation. Mobile genetic elements like conjugative plasmids and transposons also play an important role in the transfer of antibiotic resistance determinants in P. aeruginosa (Sinclair and Holloway 1982; Vezina and Levesque 1991). Clustering of resistance gene cassettes in integrons is also commonplace in P. aeruginosa (Poirel, Lambert et al. 2001; Riccio, Docquier et al. 2003) and also contributes to acquired resistance in P. aeruginosa. In addition to intrinsic and acquired resistance mechanisms, P. aeruginosa also displays adaptive resistance. Adaptive resistance is defined as an unstable, reversible resistance that is unrelated to genetic mutation (Barclay and Begg 2001). It occurs transiently in an organism under non-lethal selective pressure, and has been well documented for aminoglycosides, as well as quinolones (Barclay and Begg 2001). Despite being a poorly understood phenomenon, it is clinically relevant (Chamberland, Malouin et al. 1990; Barclay, Begg et al. 1996). In one study, CF patients were given a single dose of tobramycin, an aminoglycoside antimicrobial. Sputum samples were taken every hour and colony forming units (CFUs) assessed. No difference in killing ability was noted over time following the single dose of tobramycin. Exposure of cultures for 90min to a second dose of tobramycin, one hour after the first dose, resulted in a transient  11  increase in CFUs, indicative of adaptive resistance in a clinical setting (Barclay, Begg et al. 1996). As previously mentioned, various physiological states of P. aeruginosa also play a role in antibiotic resistance. For example, P. aeruginosa is known to grow as a biofilm in the CF lung (Singh, Schaefer et al. 2000; Drenkard and Ausubel 2002) and many characteristics of biofilms such as slow growth rate, decreased diffusion and low metabolic activity, likely contribute to the antibiotic resistance associated with biofilm communities (Walters, Roe et al. 2003). Recent studies have identified several candidate genes that may be involved in the antibiotic resistant phenotype of biofilms (Whiteley, Bangera et al. 2001; Drenkard and Ausubel 2002; Mah, Pitts et al. 2003). Other studies of P. aeruginosa biofilms have found that while low concentrations of fluoroquinolones eliminate the majority of cells, a small fraction of persisters remains intolerant to antibiotic killing (Brooun, Liu et al. 2000; Spoering and Lewis 2001). Persisters are not mutants and appear to display adaptive resistance-like characteristics, since re-culturing of persisters produces the wild-type population (Brooun, Liu et al. 2000). Although most CF patients chronically infected with P. aeruginosa are colonized with a single genotype, many different phenotypic variants can be recovered, including the mucoid and small colony phenotypes (Zierdt and Schmidt 1964). Small colony variants (SCV) frequently arise within P. aeruginosa populations under selective pressure (Bayer, Norman et al. 1987; Haussler, Tummler et al. 1999; Drenkard and Ausubel 2002; Haussler, Ziegler et al. 2003; von Gotz, Haussler et al. 2004). These SCVs often display an enhanced ability to grow in biofilms and exhibit increased antibiotic resistance. Like persister cells, SCVs are not formed by mutation since the SCV phenotype is reversible upon growth in non-selective media (Massey, Buckling et al. 2001), again similar to adaptive resistance characteristics. Together these antibiotic resistance mechanisms and differing modes of growth contribute to the variable resistance phenotype of P. aeruginosa. Our poor understanding of adaptive resistance and the role of persisters and hypermutators in the overall resistance profile of P. aeruginosa, leaves us with a weak comprehension of the response capabilities of this organism to antimicrobial challenges in general, even for those antimicrobials for which a mechanism of action has been well defined. Yet the development of new antimicrobials and antibiotic resistance prevention methodology are all based upon the completeness of this knowledge.  12  C. Quinolone Antibiotics Of the therapies clinically recommended for maintenance of CF infections of P. aeruginosa, ciprofloxacin and the class of fluoroquinolones remain the antimicrobials of choice (Gibson, Burns et al. 2003) because they can be used on an outpatient basis without the need for further hospitalization of the patient. a. Structure and Activity Since discovery of the first quinolone, nalidixic acid, and its associated antibacterial properties in the early 1960s (Lesher, Froelich et al. 1962), much progress has been made in refining the spectrum and activity of this new class of antimicrobials. Quinolone agents exhibit a bicyclic aromatic core, which contains a carbon at the C-8 position yielding a true quinolone (Gootz 1998) (Figure 2). For antibacterial activity, quinolone agents must also contain a carboxylic acid at C-3, a ketone at C-4 and a substitution at the N - l position. A cyclic diamine is also often present attached through one of its nitrogens to C-7. These first generation quinolones displayed moderate activity against most gram-negative organisms, but often lacked useful activity against gram-positive organisms, P. aeruginosa and anaerobes (Gootz 1998). Addition of fluorine to C-6 of the basic quinolone structure significantly advanced this class of antimicrobials (Koga, Itoh et al. 1980) (Figure 2). Quinolones with this substitution, so named fluoroquinolones, have both increased quinolone activity against the target enzyme DNA gyrase and facilitated penetration into bacterial cells (Domagala, Hanna et al. 1986). Fluoroquinolones then, display improved MIC values against both gram-positive and gram-negative pathogens, with ciprofloxacin displaying the strongest gram-negative spectrum of these second generation quinolones (Wolfson and Hooper 1985). The N - l cyclopropyl group substitution of ciprofloxacin in fact, has been one of the most effective functionalities for providing broad spectrum activity (Gootz 1998).  13  A.  R5  O  COOH  Figure 2:  Structure of quinolone core (A), nalidixic acid (B) and ciprofloxacin (C).  14  b. Mechanism of Action Quinolone antimicrobials target the  essential  bacterial  enzymes, type  II DNA  topoisomerases. Topoisomerases are essential enzymes for maintaining cellular DNA in the appropriate state of supercoiling in both replicating and non-replicating regions of the chromosome. This state is further important in transcription, since the transcription of many genes is sensitive to the state of DNA supercoiling (Graeme-Cook, May et al. 1989; Dorman, Bhriain et al. 1990). Topoisomerases catalyze the passage of one DNA strand through another, and are classified according to whether they introduce a transient single or double strand break for this passage. Type I topoisomerases create a single strand break for DNA passage, while type II enzymes introduce a double strand break for DNA passage. Bacteria possess four DNA topoisomerases, of which only the type II DNA topoisomerases are sensitive to inhibition by fluoroquinolones (Moreau, Robaux et al. 1990). DNA gyrase and topoisomerase IV are both type II topoisomerases. DNA gyrase introduces negative supercoils into DNA and thus relieves the topological stress that arises from the translocation of transcription and replication complexes along DNA (Drlica and Zhao 1997). Topoisomerase IV is a decatenating enzyme and works to resolve linked daughter DNA molecules following replication (Marians 1996; Drlica and Zhao 1997). DNA gyrase, first isolated from E. coli in 1976 (Gellert, Mizuuchi et al. 1976), is encoded by the unlinked gyrA and gyrB genes. It has a tetrameric A 2 B 2 structure, composed of two GyrA subunits and two GyrB subunits (Drlica and Zhao 1997). Introduction of negative supercoils into DNA involves four steps: (i) binding of gyrase to DNA containing a positive supercoil; (ii) cleavage of DNA and formation of a covalent linkage between Tyr-122 of GyrA and the 5' end of the DNA chain; (iii) active passage of DNA through the opened DNA following ATP hydrolysis by GyrB; and (iv) re-ligation of the DNA strands and release of the enzyme (Shen 1993). GyrA thus contains the active site of the DNA gyrase enzyme. Surrounding the Tyr-122 active site is the region termed the quinolone resistance determining region (QRDR) which spans Ala-67 to Gin-106, and contains the residues most frequently mutated in quinolone resistance mutants (Yoshida, Bogaki et al. 1990). The N-terminus of GyrB contains the ATP binding domain, and provides energy for the passage of double stranded DNA through the transient break, mediating introduction of a negative supercoil (Gootz 1998).  15  Quinolone antimicrobials target DNA gyrase, and stabilize the DNA-gyrase complex in its cleaved state thereby inhibiting DNA synthesis or transcription (Sugino, Peebles et al. 1977). It is uncertain whether binding of quinolones to DNA-gyrase complexes involves direct interaction with DNA. Quinolone inhibition of DNA synthesis and thus growth however, are reversible phenomena, whereas quinolone lethality is not (Goss, Deitz et al. 1965; Deitz, Cook et al. 1966). The drug-enzyme-DNA complex is reversibly formed and can dissociate upon washing of cells thereby restoring cell viability (Goss, Deitz et al. 1965; Deitz, Cook et al. 1966). As well, the concentration of quinolone required to block DNA synthesis is lower than that required to kill cells (Goss, Deitz et al. 1965; Chen, Malik et al. 1996). Cell death then, likely arises from release of the DNA ends from the drug-enzyme-DNA complex and the creation of double stranded DNA breaks (Chen, Malik et al. 1996; Drlica and Zhao 1997). Only recently in 1990, was topoisomerase IV, a homolog of DNA gyrase, discovered (Kato, Nishimura et al. 1990). Like DNA gyrase, topoisomerase IV is a tetrameric protein composed of two ParC subunits and two ParE subunits, encoded by the parC and parE genes which share significant identity with gyrA and gyrB, respectively (Kato, Nishimura et al. 1990; Peng and Marians 1993). Topoisomerase IV is the principal enzyme for separating replicated DNA molecules and like DNA gyrase, uses double strand passage of DNA to decatenate DNA molecules. Unlike DNA gyrase though, the decatenation activity of topoisomerase IV does not require DNA wrapping and thus favors intermolecular strand passage (Peng and Marians 1995). This DNA wrapping difference likely contributes to the functional differences observed between DNA gyrase and topoisomerase IV. The mechanistic similarities between DNA gyrase and topoisomerase IV however, indicated that topoisomerase IV was also a likely target for quinolone antimicrobials. Inhibition of the decatenation activity of purified E. coli topoisomerase IV enzymes however, was found to require 15 to 50 times more quinolone than inhibition of DNA gyrase negative supercoiling activity (Peng and Marians 1993; Hoshino, Kitamura et al. 1994). The primary target of quinolones and thus the response to quinolones has since been shown to vary depending on the organism. In E. coli and P. aeruginosa the primary target is DNA gyrase, whereas in S. aureus and S. pneumoniae the primary target is topoisomerase IV (Blanche, Cameron et al. 1996). As for DNA gyrase, drug-enzyme-DNA complexes are formed with quinolones and topoisomerase  16  IV. The interaction of quinolones with topoisomerase IV produces a slow inhibition of DNA synthesis in a mechanism similar to that for DNA gyrase (Hiasa, Yousef et al. 1996). c. Quinolone Resistance Mechanisms in Pseudomonas aeruginosa As with other antimicrobials, extensive use of fluoroquinolones has led to an increase in the appearance of quinolone resistance among bacterial pathogens. While intrinsic resistance mechanisms like low outer membrane permeability, play an important role in mediating resistance during the initial stages of antibiotic exposure, these mechanisms are usually not sufficient for sustained protection against prolonged exposure to the antimicrobials. Bacteria however can become resistant to quinolones by mutations in the target enzymes or by active efflux (Hooper 1999; Hooper 2001); plasmid mediated resistance has also been recently confirmed (Martinez-Martinez, Pascual et al. 1998). In P. aeruginosa, as in other gram-negative bacteria, most of the mutations which confer quinolone resistance occur in the gyrA subunit (Kohler 1998). Furthermore, most of the mutations map to the QRDR, with the most common mutations being Asp87Asn, Asp87Tyr and Thr83Ile (Yonezawa, Takahata et al. 1995). Mutations at both sites 83 and 87 confer a higher degree of resistance to fluoroquinolones compared to mutations at a single site. Resistance mapping to gyrB has also been observed in P. aeruginosa (Mouneimne, Robert et al. 1999; Le Thomas, Couetdic et al. 2001). Additional mutations have been noted in parC (Mouneimne, Robert et al. 1999), where again combinations of topoisomerase mutations were found to confer high-level quinolone resistance relative to single mutation events. Active efflux in P. aeruginosa also plays a critical role in mediating resistance to antimicrobials, including fluoroquinolones. Mutations in the regulators for multidrug efflux pumps affect resistance levels by bringing about overexpression of the respective efflux system. Furthermore, efflux pump overexpression confers cross-resistance to non-quinolone agents as well as quinolones, making development of this type of fluoroquinolone resistance in P. aeruginosa a major clinical problem. The MexAB-OprM efflux system, overexpressed in nalB mutants, confers resistance to nalidixic acid, fluoroquinolones, carbenicillin and tetracycline, and results from mutations in mexR, the repressor of the mexABoprM efflux system (Li, Nikaido et al. 1995; Ziha-Zarifi, Llanes et al. 1999). Similarly, mutants in the nfxB regulator gene  17  overexpress  MexCD-OprJ  and confer  chloramphenicol (Jakics, Iyobe  et al.  (mutants in the positive regulator,  resistance  to quinolones,  1992; Poole, Gotoh  mexT)  et al.  erythromycin and  1996), whereas  nfxC  mutants  overexpress MexEF-OprN and specify resistance to all  quinolones as well as chloramphenicol (Fukuda, Hosaka et al/ 1995; Kohler, MicheaHamzehpour et al. 1997; Kohler, Epp et al. 1999). Quinolone concentration appears to affect which resistance mechanism is selected by P. aeruginosa  in response to quinolone exposure. At concentrations close to the MIC, efflux type  mechanisms were selected almost exclusively in the lab; gyrase type mutations appeared only at concentrations above 4x-MIC (Kohler and Pechere 2001). Conversely, quinolone selection of multigenic mutations rather than single mutation events may better explain the disparate data on the dominant resistance mechanism. Quinolone treatment is also known to induce adaptive resistance responses in P.  aeruginosa  (Chamberland, Malouin et al. 1990; Gould, Milne et al. 1991). Despite being a poorly understood phenomenon, it is clinically relevant (Chamberland, Malouin et al. 1990; Barclay, Begg et al. 1996). While most fluoroquinolone resistance work has focused on better understanding either the target, DNA gyrase, or the multidrug efflux mechanisms, these mutation based resistance mechanisms are obviously not contributing factors in adaptive resistance since removal of the antimicrobial challenge restores the wild type susceptibility profile of the organism (Chamberland, Malouin et al. 1990). As with other antimicrobials, the one drug one target concept is not applicable. Clearly much work needs to be conducted to better define the mechanisms of and role of adaptive resistance to quinolones, before a complete picture of fluoroquinolone resistance in P.  aeruginosa  can be drawn.  d. Effects of Sub-inhibitory Quinolone Concentrations on Pseudomonas  aeruginosa  In addition to studies on the affect of quinolones on the development of resistance, numerous studies have examined the effects of sub-inhibitory fluoroquinolones on P.  aeruginosa  phenotypes. Sub-inhibitory concentrations of antibiotics represent a therapeutically important selective environment. Such concentrations occur at the onset of drug treatment, between dosing intervals and within the thick mucus of the CF lung (Doring, Conway et al. 2000) . With respect to CF patients chronically infected with P.  aeruginosa  18  and being treated with fluoroquinolones to  maintain low infection levels, each of these sub-inhibitory antibiotic environments likely occurs repeatedly over the course of therapy. Amongst the changes altered by treatment with sub-MIC ciprofloxacin are the adhesion characteristics of P. aeruginosa. Sub-MIC ciprofloxacin was found to significantly decrease the adherence of P. aeruginosa to the human larynx carcinoma cell line HEp-2 (Visser, Beumer et al. 1993) and to urinary epithelial cells (Sonstein and Burnham 1993; Zhanel, Kim et al. 1993). Similar observations have been noted for biofilm adherence (Yassien, Khardori et al. 1995). The inhibitory effect of sub-inhibitory quinolones on pili and fimbriae production in P. aeruginosa may be responsible for these observations (Sonstein and Burnham 1993). In contrast to the mucoid converting effect of supra-inhibitory concentrations of fluoroquinolones (Pina and Mattingly 1997), sub-inhibitory concentrations have been found to inhibit alginate production in P. aeruginosa (Trancassini, Brenciaglia et al. 1992; Majtan and Hybenova 1996). Furthermore, no major changes in LPS structure have been noted (Magni, Giordano et al. 1994; McKenney, Willcock et al. 1994). Sub-MIC levels of quinolones have also been found to alter the production of other virulence factors. Decreases in exotoxin A, exoenzyme S, elastase and total protease activity have all been demonstrated (Ravizzola, Pirali et al. 1987; Grimwood, To et al. 1989; Trancassini, Brenciaglia et al. 1992; Sonstein and Burnham 1993) and appear to contribute to a reduction in lung injury during chronic P. aeruginosa lung infections (Grimwood, To et al. 1989; Grimwood, To et al. 1989). Fung-Tome et al. (Fung-Tome, Kolek et al. 1993) also noted an increase in the mutation rate and resistance level of P. aeruginosa following exposure to sub-inhibitory ciprofloxacin, where the rate of resistance development depended upon the concentration and duration of exposure. Prolonged exposure to sub-inhibitory ciprofloxacin was also found to promote the development of low level resistance to structurally unrelated antimicrobial agents. Together, these findings highlight how exposure to sub-inhibitory concentrations of ciprofloxacin can influence the clinical outcome of P. aeruginosa infections in CF patients. In general, these findings seem to suggest that exposure to sub-MIC ciprofloxacin may work to limit some of the deleterious in vivo effects of P. aeruginosa, which in synergy with the mutational effects, works to promote survival of the organism in the selective environment.  19  D. Pyocins in Pseudomonas aeruginosa  Bactericidal protein antibiotics are produced by many bacteria, and those produced by P. aeruginosa are termed pyocins (Jacob 1954). P. aeruginosa produces three types of pyocins: R-, F- and S-type, all of which are encoded on the chromosome rather than on plasmids as in most other bacteria. While spontaneous pyocin production or pyocinogeny is low, pyocin production can be induced upon treatment of cultures with mutagenic agents (Jacob 1954; Kageyama 1964); ciprofloxacin along with other fluoroquinolones is a mutagenic agent (Phillips, Culebras et al. 1987; Clerch, Bravo etal. 1996). Various activity and structural features distinguish each of the pyocin types (Table 1). S-type pyocins are both soluble and protease sensitive. SI, S2, AP41 and S3 pyocins have been identified and isolated from various strains of P. aeruginosa. The sequenced P. aeruginosa strain PAOl (Stover, Pham et al. 2000) contains pyocin S2 and two predicted pyocins, S4 and S5 (Parret and De Mot 2000). All S-type pyocins are composed of two proteins: a small protein which confers immunity protection to the host bacteria and a larger protein which possesses killing activity. Release of S-type pyocins from pyocinogenic cells occurs as an equimolar complex of the killing and immunity proteins, and is thought to occur by the lytic system encoded by the R2 and F2 pyocins (discussed in detail below) (Nakayama, Takashima et al. 2000). Before translocation across the membrane and exertion of their bactericidal activity however, pyocins must bind to specific receptors on the outer membrane of target Gram-negative cells. Based on observations that killing by pyocin SI, S2 and S3 was enhanced under iron limiting conditions, it has been proposed that iron regulated outer membrane proteins (IROMPs) may act as S-type pyocin receptors (Ohkawa, Shiga et al. 1980; Sano, Matsui et al. 1993; Duport, Baysse et al. 1995). Uptake of pyocin S3 for example, has been shown to occur through the ferripyoverdine type II receptor (Baysse, Meyer et al. 1999), and through the tolQRAB-oprL system for uptake of AP41 (Dennis, Lafontaine et al. 1996). The bactericidal activity of the Stype pyocins SI, S2, S3 and AP41 is mediated through endonuclease activity of the C-terminus of the large protein, which causes the breakdown of DNA (Duport, Baysse et al. 1995). Interestingly, the SI and S2 pyocins are also able to inhibit phospholipid synthesis under ironlimiting conditions, activity which is linked to but independent of the DNase domain and activity (Okawa, Maruo et al. 1975; Morse, Jones et al. 1980). AP41 pyocin is also able to induce pyocin  20  Table 1:  Comparison of features of Pseudomonas aeruginosa pyocins.  PyocinType  S-type SI  PAOl Types  Gene Organization & Homology  Mechanism of Action  Soluble; Protease sensitive —  S2  S2  S3  —  S4  S4  S5  S5  Endonuclease  —  Killing protein: PA 1150 Immunity protein: PA1151  Endonuclease Endonuclease  —  Killing protein: PA3866 Immunity protein: PA3865.1 Killing protein: PA0985 Immunity protein: PA0984  — — AP41 R-type -> Protease insensitive; Nuclease insensitive PA0615-PA0632 Inflexible contractile tail R2 R1-R5 Homology to P2 bacteriophage F-type Protease insensitive; Nuclease insensitive PA0633 - PA0648 F2 Flexible, non-contractile tail F1-F3 Homology to X bacteriophage  21  tRNase Pore-forming Endonuclease Depolarize cytoplasmic membrane  production in sensitive targets and phage in lysogenic cells, in a RecA dependent fashion (Sano and Kageyama 1981; Sano 1993). Distinct from the other S-type pyocins, the C-terminal domains of the novel pyocins are predicted to contain tRNase activity in the case of pyocin S4 and pore-forming activity in pyocin S5 (Parret and De Mot 2000). Genetic organization of the S-type pyocins is fairly well conserved amongst this group of pyocins (Figure 3) (Michel-Briand and Baysse 2002). Domain I of the larger protein incorporates the N-terminal 240 amino acids and contains the receptor binding site. Domain II is variably present in S-type pyocins and has of yet an unknown function. Translocation across the outer membrane is mediated by domain III. The C-terminal 130 amino acids of the larger protein provides the DNase and immunity protein binding function of SI, S2, AP41 and S3 pyocins, and is proposed to provide tRNase activity to S4 pyocin (Parret and De Mot 2000). Domain III of S5 pyocin is homologous to the active domain of pore forming colicins (Parret and De Mot 2000), and thus likely mediates the formation of voltage-gated ion channels in a manner similar to colicins la and lb (Wiener, Freymann et al. 1997). Closely linked to each of the large proteins is the corresponding immunity protein, providing specific immunity of the pyocinogenic strain towards its pyocin. Expression of the immunity protein is coupled to that of the larger killing protein through positioning of the ribosome binding site of the immunity protein within the Cterminal region of the killing protein. In this manner, the ribosome comes into contact with both the termination codon of the larger protein and the initiation codon of the immunity protein simultaneously, and likely couples their transcription, thereby providing protection of the pyocinogenic strain towards its own pyocin (Sano, Matsui et al. 1993). In contrast to the S-type pyocins, R-type and F-type pyocins are protease and nuclease insensitive, properties which facilitate their separation from S-type pyocins (Table 1). R-type pyocins resemble inflexible and contractile tails of P2 bacteriophage family (Nakayama, Takashima et al. 2000), and consist of a contractible sheath and core (Figure 4 - R2 and F2 pyocins) (Ishii, Nishi et al. 1965). The contracted sheath form is 46nm long (or 120nm long when extended) and 18nm wide, and exposes a core which is also 120nm long and 5.7nm wide. A baseplate is also visible at the distal end and is associated with six tail fibres, which confer R l R5 subgroup receptor specificity (Yui-Furihata 1972; Michel-Briand and Baysse 2002). The sequenced P. aeruginosa strain PAOl contains the pyocin subgroup R2, which is situated between trpE and the F2 pyocin cluster on the chromosome (Shinomiya, Shiga et al. 1983).  22  killing  regulatory sequences  protein  transcription terminator  I  F box  S2  bp - l l f l  -77  -11  1  2060 2074  GAT(ATTGaaGTI  ©3GA9G  2336  GATATG  TAG  2348 AACAAGCCCCGT-i  TTGTTCaGOGCA-1  SI S2  <tm !Da' afttn') 1  65.600 241  242  216 217  313  239 240  400  276 277  389  248 249  420  ami (Da) *a(n°l 1 ran) : Eat  S3 S4  aa (n°> 1  Figure 3:  6B0 1  639  776 1  637  768 1  87 10,300 90 17,000  .81,000  mm (Da)  87 10,000  81,400  , .,, . k i l l i n g protein  S5  558 83,900  mm (Da) aafn'l 1  618,1  74.000  1  AP41  10,000 487  153 .13,000  664  764  1  112  lnmunity protein  aaln*]  S-type pyocin organization.  Upper panel: The S2-type pyocin is constituted of an ORF1, encoding a killing protein and of an ORF2, encoding an immunity protein. The regulatory sequences constitute the P-box and may be triggered by PrtN protein. SD; Shine Dalgarno sequence, bp; base pair. Lower panel: Molecular mass (mm, Dalton) of the different S-type pyocins and amino acid number (aa) which constitutes the different domains. Reprinted with permission from reference Michel-Briand, Y. and C. Baysse 2002.  23  4  20nm  Figure 4:  Schematic representation of R-type and F-type pyocins.  R-type pyocin: The native form appears as an extended sheath (ES) composed of 34 annuli (a), each in turn composed of six subunits. The contracted sheath (CS) form reveals the core (C) and terminates in a base plate (BP) with tailfibres(TFi). F-type pyocin: It appears as a flexuous non-contractile rod composed of 23 annuli and a distal part (DP) from which extends a fiber part (Fi) composed of threefilamentswith some globular structures. Reprinted with permission from reference Michel-Briand, Y. and C. Baysse 2002.  24  Receptor sites for R-type pyocins involve core oligosaccharides of lipopolysaccharide (Meadow 1978). Following receptor adsorption and contraction of the tail-like structure (Shinomiya, Osumi et al. 1975), the bactericidal activity of R-type pyocins involves depolarization of the cytoplasmic membrane following pore formation (Uratani and Hoshino 1984) and inhibition of macromolecular synthesis (Ohsumi, Shinomiya et al. 1980). Similar to R-type pyocins, F-type pyocins resemble flexible, non-contractile tails of the X bacteriophage family (Table 1) (Nakayama, Takashima et al. 2000). F-type pyocins are also protease and nuclease insensitive. Electron microscope analysis of F-type pyocins has revealed a rod-like structure of 106nm in length, with fibre-like structures located at the distal end (Figure 4) which confer F1-F3 subgroup receptor specificity (Kuroda and Kageyama 1981). The sequenced P. aeruginosa strain PAOl contains the pyocin subgroup F2, which is also situated between the R2 pyocin gene cluster and trpGCD on the chromosome. Comparison of the nucleotide sequence of the R2/F2 pyocin encoding region from P. aeruginosa strain PAOl to those of various bacteriophage, revealed similarities in addition to the aforementioned structural similarities (Nakayama, Takashima et al. 2000). It was determined that the R-type pyocin is derived from a common ancestral origin with P2 phage, and the F-type pyocin from X phage (Nakayama, Takashima et al. 2000). Based on the absence of genes for head formation, replication and integration and the coordinated regulation of the R2/F2 and Stype pyocins however, the R2 and F2 pyocins are regarded as being phage tails that have evolutionarily specialized as bacteriocins, rather than simple defective phages (Nakayama, Takashima et al. 2000). From the results of the sequence comparison, functions for the majority of ORFs identified in the R2/F2 pyocin region have been assigned (Table 2). Of particular interest and relevance are the ORFs encoding for putative holin and lysin genes. Although release of pyocins from the pyocinogenic cell involves lysis, no genes related to lysis have previously been described for any pyocin. These ORFs then constitute the first genes for which lysis function can be attributed. PA0614 was found to be similar to holins of P2 and X phage, while PA0629 was found to have weak but significant similarity to the active domains of chitinases, which hydrolyze N-acetyl-D-glucosamine (Nakayama, Takashima et al. 2000) (Table 2). PA0630 and PA0631 were also found to be similar to the lysis control genes of P2 phage, lysB and lysC (Ziermann, Bartlett et al. 1994) (Table 2). Nakayama et al. (Nakayama, Takashima et al. 2000) further cloned and characterized the activities of PA0614 and PA0629 by expressing  25  Table 2:  R2/F2 pyocin-phage operon of Pseudomonas aeruginosa. ORF  a  Description  Gene Name prtN prtR  b  Transcriptional activator PA0610 Transcriptional repressor PA0611 « PA0612 Homolog of Zn finger protein Conserved hypothetical PA0613 Holin PA0614 hoi Conserved hypothetical PA0615 Homologous to baseplate assembly protein V PA0616 V Homologous to baseplate assembly protein W PA0617 W Homologous to baseplate assembly protein J PA0618 JR2 Homologous to tail protein I PA0619 IR2 Homologous to tail fibre protein H PA0620 HR2 Homologous to tail fibre assembly protein PA0621 Homologous to contractile sheath protein F l PA0622 FI Homologous to tail tube protein FII PA0623 FII Conserved hypothetical PA0624 Homologous to tail length determination protein PA0625 Homologous to tail formation protein U PA0626 UR PA0627 Homologous to tail protein X XR2 Homologous to tail formation protein D PA0628 DR Lytic protein; Homology to predicted chitinase PA0629 lys Hypothetical protein PA0630 Unique hypothetical protein PA0631 PA0632 Unique hypothetical protein PA0633 Homologous to major tail protein V PA0634 Unique hypothetical protein Conserved hypothetical protein PA0635 PA0636 Homologous to tail length determination protein H HF2 PA0637 Homologous to tail fibre protein M M PA0638 Homologous to tail fibre protein L LF2 PA0639 Homologous to tail assembly protein K KF2 PA0640 Homologous to tail assembly protein I IF2 PA0641 Homologous to tail fibre protein J JF2 PA0642 Hypothetical protein PA0643 Homologous to tail fibre domain protein PA0644 Hypothetical protein PA0645 Hypothetical protein PA0646 Homologous to putative tail fibre protein PA0647 Conserved hypothetical protein PA0648 Conserved hypothetical protein a - Genes are identified by ORF designation based on the Pseudomonas genome project (www.pseudomonas.com). b - Genes were named as per Table 1 of Nakayama, K. K. Takashima, et al. 2000 and reflect the homology observed by these authors to phages P2 and X. R2  R2  R2  R2  2  2  F2  26  each of the ORFs alone or in combination in P. aeruginosa. Their work confirmed the cytoplasmic permeabilizing action of PA0614 and lytic ability of PA0629, and indicated that PA0614 and PA0629 respectively encode a holin and lytic enzyme shared by the R2 and F2 pyocins. Furthermore, their work also suggested that this lytic system was likely to be shared by the S-type pyocins, since this group of pyocins lacks any known lysis genes (Nakayama, Takashima et al. 2000). Regulation of pyocin synthesis occurs through a P-box regulatory sequence located upstream of the ribosome binding site. The P-box consensus motif ATTGnn(n)GTnn(n), is repeated twice upstream of the R2 pyocin and four times upstream of the S-type pyocins (Matsui, Sano et al. 1993), with the exception of pyocin S5 which is likely regulated in a manner different from the other pyocins (Parret and De Mot 2000). The P-box motif serves as a binding site for the transcriptional activator protein, PrtN. PrtR protein however, is a repressor protein and functions to downregulate expression from the prtN gene, unless PrtR is inactivated by the action of activated RecA protein. RecA is an SOS responsive protein, and is therefore activated by various stresses including DNA damage induced by UV irradiation or other mutagens like ciprofloxacin (Miller and Kokjohn 1988). Activated RecA protein cleaves PrtR protein, releasing inhibition on the expression of prtN. Binding of PrtN protein to the P-box motif then initiates expression of the associated pyocins (Matsui, Sano et al. 1993) in a manner suggestive of their responsiveness to bacterial stress. E. Microarray Analysis of Gene Expression While the aforementioned work with sub-inhibitory ciprofloxacin has expanded our understanding of the many phenotypic changes induced by sub-MIC quinolones, the effect of sub-MIC quinolones on antibiotic resistance in P. aeruginosa has not been well studied. Such knowledge may improve dosing regimes for CF patients afflicted with persistent P. aeruginosa infections, or aid in the design of quinolone antibiotics which do not induce these resistance mechanisms. However, the thoroughness required of such knowledge is dependent on techniques that elucidate the underlying genetic and biochemical mechanisms on a broader level than current individual gene approaches allow. The availability of the whole P. aeruginosa genome (Stover, Pham et al. 2000) along with the development of microarray technology in the late  27  1990s (Schena, Shalon et al. 1995) has made whole genome expression profiling of the responses of P. aeruginosa to sub-inhibitory ciprofloxacin possible. At the onset of this thesis project however, commercial microarray platforms for P. aeruginosa were unavailable. Furthermore, bacterial microarrays themselves were only just gaining in popularity. Thus, standard methodologies and protocols for bacterial microarrays were not prevalent, necessitating the work outlined in the first sections of this thesis. Several other methods for transcriptome analysis surfaced around the same time (Liang and Pardee 1992; Velculescu, Zhang et al. 1995) but were not considered for this project. a. Microarray Platforms: Advantages and Disadvantages Through specific base pairing interactions, all nucleic acid strands carry the capacity to recognize their complementary sequence with high sensitivity. Complementary base pairing is the basic tenet behind the various microarray platforms: hybridization of an unknown target sample to an ordered array of immobilized DNA molecules of known sequence produces a specific hybridization pattern.  Simultaneous hybridization with a known target results in  competitive hybridization between the two target samples, and facilitates comparison of the differential transcriptome patterns produced from these target samples. While microarrays may vary in any number of ways from the type of solid support used to the type of DNA fragments on the array, essentially only two main microarray platforms exist: in situ synthesized oligonucleotide arrays and spotted glass slides, each with its own advantages and disadvantages. Only those features relevant to this thesis project will be discussed (for reviews in the field refer to (Bowtell 1999; Holloway, van Laar et al. 2002)). In situ synthesized oligonucleotide microarrays, such as Affymetrix GeneChips®, involve the synthesis of single stranded oligonucleotides by use of photolithographic techniques (Lockhart, Dong et al. 1996) and enable the generation of high density microarrays. Although this methodology allows for the reproducible generation of microarrays directly from information in a sequence database, it also requires complex equipment and thus tends to be restricted to commercial manufacturing. For the most part, the associated cost of producing such microarrays prohibits their accessibility for the academic user. An Affymetrix GeneChip® to the P. aeruginosa genome is commercially available, but was not used for this thesis work, even for  28  comparison purposes. Comparisons between the two microarray platforms have shown poor correlation owing to probe GC content, length, and cross hybridization (Kuo, Jenssen et al. 2002). Spotted glass slide microarrays are based on the delivery of prepared genetic material onto a glass slide. Molecules such as cDNAs, PCR products or short oligonucleotides are deposited and attached to the platform using either spotting pin or ink jet printing technologies. In addition to the associated low cost, the flexibility and versatility of such technology makes this particular microarray platform attractive to academics. The main disadvantage of spotted microarrays however is the requirement for synthesis, purification and storage of all genetic material prior to fabrication of the platform. Fabrication of spotted glass microarrays then typically involves robotic printing of purified, highly concentrated probes onto glass slides, which have low inherent fluorescence. These are typically coated with either poly-lysine or amino silane, which enhance both the hydrophobicity of the slide and the adherence of the deposited DNA, as well as limit the spread of the spotted DNA droplet on the slide (Duggan, Bittner et al. 1999). The DNA probe is then cross-linked to the glass slide by ultraviolet irradiation to achieve covalent bond formation between the thymidine residues in DNA and the positively charged group on the slide (Cheung, Morley et al. 1999). The state of the bound DNA probe is poorly defined, although differences in the DNA probe length have been found to mediate differences in hybridization results (Stillman and Tonkinson 2001; Chou, Chen et al. 2004). While shorter oligonucleotides may be more accessible for target hybridization because of their single attachment point to the microarray, their specificity due to truncated size and their variations in melting temperature due to variations in AT-GC composition, are problematic in single oligonucleotide per gene array designs. Longer PCR probes circumvent these issues and offer other advantages like specificity for homologous gene families when designed over the unique regions (Evertsz, Au-Young et al. 2001).  b. Standards in Microarray Experimentation Underscoring any experiment, and in particular any microarray experiment, is the requirement for a sound biological question. Once the biological query has been established,  29  some fundamental .issues of how to design an experiment to ensure that the resulting data is amenable to statistical analysis must be considered (Churchill 2002; Yang and Speed 2002). Microarray data is inherently variable, and it is this variability which affects the significance of the microarray findings. Microarray data variation may be classified as being either experimental or systematic in nature, where each type of variation can be controlled somewhat through various design features of the microarray experiment. Experimental variation is further subdivided into biological and technical variation. Biological variation is intrinsic to all organisms but can be influenced by genetic or environmental factors. Technical variation is introduced during the extraction, labeling and hybridization of the RNA sample (Churchill 2002). With respect to the degree of variation observed from each of these sources, biological replicates introduce a larger degree of variation than technical replicates. While it is tempting to avoid including biological replicates so as to make the data appear more reproducible, inclusion of such replicates is the equivalent of generating independent experimental results. With biological replicates then, any statistically significant findings become more meaningful because they were found to occur across different biological samples. Likewise, inclusion of technical replicates affects the precision of the results, and is generally used to reduce the overall variability of the independent experiments. In general, biological replicates are used to obtain averages of independent data and to validate generalizations of conclusions, while technical replicates are used to assist in reducing the variability of these conclusions (Yang and Speed 2002). Experimental variation may also be addressed through careful consideration of the experimental design or how to pair samples for hybridization. The efficiency of an experimental design for comparing two samples is determined by the length and the number of paths connecting the two samples (Kerr and Churchill 2001; Yang and Speed 2002). For example, comparison of an unknown sample on slide A to a known sample on slide B, is less accurate than comparison of the two samples on the same slide. Hence it is most efficient to make the comparisons of greatest interest directly on the same slide, a so called direct comparison of differential expression. An all-pairs design (Yang and Speed 2002) or loop design (Kerr and Churchill 2001) is ideal, since these direct comparison designs are both efficient in using fewer slides and provide precise comparisons with low variance. These designs combined with a dyeswapping strategy, represent an effective design for the direct comparison of two samples (Kerr  30  and Churchill 2001). When comparing two samples, such a design involves two arrays, where on the first array the control sample is labeled with red fluorophore and the treatment sample is labeled with green fluorophore. On the second array, these fluorophore assignments are switched. This arrangement repeated for a given set of technical samples constitutes a repeated dye-swap experiment, and when replicated for independent biological samples constitutes a replicated dye-swap experiment (Churchill 2002). Such a replicated dye-swap experiment can account for both technical and biological variation. Systematic variation refers to the variation attributable to dust or scratches on the microarray, irregular deposition of probe on the glass slide or biases associated with different fluorescent dyes. All of these affect accurate reading of the fluorescent signals, and thus also affect the significance of the microarray data. Systematic variation is addressed by including various controls on the microarray slide and through the dye-swap experiments previously mentioned. It is well recognized that the Cy3 and Cy5 fluorescent dyes exhibit different quantum yields and are differentially sensitive to photobleaching (Churchill 2002). Furthermore, there has been indication that direct incorporation of these dyes into the cDNA introduces sequence specific artifacts (Kerr and Churchill 2001) because of the differing rates at which the bulky dyes can be incorporated into the cDNA molecule by the reverse transcriptase. Experimental designs which include dye-swaps then, are integral to addressing this type of systematic variation. Other types of systematic variation may be corrected through a process called normalization (Quackenbush 2002). Several methods for normalization exist, but the underlying principle is the requirement for a set of genes that are not affected by the experimental condition and thus remain unchanged between the experimental and control conditions. Global normalization is the most common normalization strategy and assumes that the majority of genes in a microarray experiment do not change their expression and that only a small subset of genes is differentially expressed between the two conditions. Other normalization strategies, which make use of exogenous spike-in controls, are becoming more popular (Benes and Muckenthaler 2003). These strategies facilitate assessment of signal linearity, hybridization specificity and consistency across microarray slides and slide to slide comparisons, all factors to be considered in addressing systematic variation. After establishing an appropriate experimental design for the biological query, all microarray experiments involve four main steps: sample preparation, array hybridization, detection and data handling. Sample preparation involves the isolation and fluorescent labeling of mRNA. Isolation  31  of pure RNA of high quality is the most critical factor in attaining meaningful microarray data. Because the microarray's measurement of the relative transcript abundance between two samples is dependent on high quality mRNA, factors which alter the half life or integrity of the mRNA species therefore will affect the experimental outcome. Bacteria have developed both tight transcriptional control and RNA degradation mechanisms in order to respond very rapidly to changes in the environment, (Bernstein, Khodursky et al. 2002; Hambraeus, von Wachenfeldt et al. 2003). Thus, care must be taken during RNA isolation and all subsequent RNA handling steps, to ensure the immediate cessation of transcription while simultaneously preventing RNA degradation, so that the integrity and accuracy of the mRNA population is adequately maintained. The next step in sample preparation is the fluorescent labeling of mRNA transcripts. This step however is also a major challenge in prokaryotic microarray experiments because the absence of polyadenylation on prokaryotic transcripts makes labeling of an isolated mRNA population difficult. Instead, total RNA is isolated and labeled through a reverse transcription reaction using either a pool of gene specific primers or random oligonucleotide primers. However, with respect to the commonly used random oligonucleotide priming, since rRNA and tRNA make up 95-97% of the total bacterial RNA, most of the dye is incorporated into these species rather than mRNA. The secondary structure of RNA species themselves further inhibits efficient dye incorporation. In spite of these limitations, specific hybridization of mRNA to the microarray can be achieved (de Saizieu, Certa et al. 1998). Following sample preparation, labeled cDNA is hybridized to the microarray slide. Essentially, hybridization is the competition between two sets of transcripts, the unknown and known transcriptomes, for the binding to corresponding sequences on the microarray. This competition is affected by many of the principles which affect other DNA-DNA interactions and include such factors as hybridization temperature and volume, transcript to probe specificity, length of transcript-probe specificity, ratio of probe to transcript, and length of hybridization time; many of these factors are interrelated. These factors however may be loosely divided into probe specific, transcript specific and probe-transcript specific categories. The probe specific factors such as probe sequence, probe length and probe concentration, must be considered in the design and construction of the microarray as previously noted. All transcript specific factors depend upon high quality RNA of good integrity. Ideally, transcripts will be full length and a perfect sequence match to the arrayed probe. Alterations in transcript length in addition to the  32  choice of probe, will therefore affect this sequence specificity. RNA quality and integrity furthermore affect the transcriptome competition associated with hybridization, since an RNA sample of low yield and quality will have fewer sequence specific transcripts available for competition to the sequence specific probe, giving an inaccurate account of the true state of the transcriptome for this sample. Careful consideration of hybridization temperature, volume and time further helps in the optimization of those parameters required to drive the hybridization reaction to completion. For example, larger hybridization volumes allow for more efficient mixing and thus allow for more cDNA targets to come into contact with their cognate probe. Likewise, longer hybridization times offer more opportunity for these interactions to occur. Detection of the differential expression between two samples is dependent on the efficiency of the hybridization reaction, as well as on the detection machinery. With respect to the hybridization reaction, the efficiency of the cDNA labeling reaction is most critical, since differential incorporation of the fluorophores into the two cDNA populations affects the detection results and thus accuracy of the transcriptome findings. Recently, there has been movement towards measuring fluorophore incorporation efficiencies and adjusting the amount of transcript in the hybridization reaction to compensate for any differences, rather than beginning with equal quantities of total RNA and working under the assumption that fluorophore incorporation efficiencies are equal. Binding or hybridization events between the fluorescently labeled target and the cognate probe are detected by scanning the microarray, typically using a confocal laser scanner. A l l slides within an experiment should be scanned using the same scanner to minimize differences in the results introduced by different scanner models.  c. Statistical Analysis of Microarray Data To date, there is no consensus approach to statistical analysis, and thus microarray results tend to be analyzed in a variety of different ways (Slonim 2002). Yet a minimum set of analytical techniques should be applied to correct for the systematic variation introduced during the experiment. Starting with the initial images taken from the scanner, the probe-target interactions are detected, delineated and quantified. Background must be separated from the target signal and its contribution removed in order to generate a measurement of the intensity of hybridization for each gene element on the microarray. A number of data transformations must then be carried out  33  so to adjust the measured intensities to facilitate comparisons between sample conditions, to eliminate low quality measurements and to select genes that are significantly differentially expressed between the sample conditions (Quackenbush 2002). Normalization refers to the adjustment or balancing of the individual signal intensities, and accounts for such systematic variation as unequal quantities of starting RNA and fluorophore incorporation and detection inefficiencies. By normalizing the signal intensities within a slide, meaningful comparisons between the two sample conditions can be made. Locally weighted linear regression (lowess) analysis is the current popular strategy for normalization (Quackenbush 2002), since it can remove intensity dependent effects such as those seen for low intensity spots. Furthermore, lowess normalization is often applied in a local fashion to microarray sub-grids rather than globally to the whole microarray, because local normalization can help correct for such spatial systematic variation such as spotting pin inconsistencies, variability in the slide surface and differences in the hybridization across the microarray (Quackenbush 2002).  Since the relative error increases at low signal intensity where the signal approaches that of the background, data variability increases as the measured signal intensity decreases. Data then is typically trimmed to eliminate these low quality measurements by using significance or percentage based cut-offs below which an element is filtered out. In this manner, only those elements which have signal intensities that are statistically significantly different from the background are considered. Likewise, a ceiling or maximum signal value is set to eliminate saturating elements. Identification of genes that are differentially expressed between two samples is typically the desired outcome of many microarray experiments. In early microarray experiments, a fixed fold change cut-off was often used to identify these genes. A more sophisticated approach, involves calculating the Z-score or the mean and standard deviation of the distribution of the log2 ratios, and defining a global fold-change difference and confidence (Quackenbush 2002). Once the differentially expressed genes have been identified, the data set can be further refined and filtered to better address the biological query. As well, the data set may be mined using hierarchical clustering or similar clustering techniques for expression trends or profiles exhibited by one sample and not the other.  34  d. Methods of Confirming Microarray Data Spending time at the onset to optimize the microarray experiment as previously described, reduces the amount of time and effort spent subsequently to invalidate erroneous expression findings. When evaluating microarray data, two important questions need to be considered. First, is whether the expression results are accurate for the biological query, and second, whether the data fundamentally describes the phenomenon being examined (Chuaqui, Bonner et al. 2002). To ascertain whether the expression results are accurate, it is important to confirm the data using an independent method of gene expression monitoring. Given the volume of data obtained from a microarray experiment however, verification of only a small but relevant subset of transcripts is feasible. There are two approaches to independent confirmation of microarray data: in silico analysis and laboratory based analysis (Chuaqui, Bonner et al. 2002). In silico analysis compares the array results to information publicly available, thereby avoiding further experimentation. Conversely, laboratory based analysis relies on additional independent experimentation to verify the observed transcriptional profile. Commonly used techniques include semi-quantitative reverse transcription PCR (RT-PCR), real-time PCR, northern blot, ribonuclease protection assay and in situ hybridization. The results from these independent validation techniques typically only show similar trends to those found by microarray analysis, since it has been demonstrated that cDNA microarrays consistently underestimate the relative transcript abundance between the known and unknown samples (Benes and Muckenthaler 2003). To ascertain whether the expression results are descriptive of the biological state being examined, a critical set of genes should be examined further in a more extensive set of experiments. For example, finding of a distinct expression profile in the treated group would warrant closer examination of those genes belonging to this profile. Closer examination might involve examining the significance of these genes in the treated group through knock-out studies or various other inhibitory assays. Overall, more extensive experimentation should lead to determination of whether these genes and their expression profiles are accurate representations of the biological state.  35  F. Rationale and Aims of this Study The influence and interaction of antimicrobials on bacterial responses, particularly antibiotic resistance, is poorly understood, yet likely contributes to the persistence of P. aeruginosa infection in chronically infected CF patients. Since the administration of the fluoroquinolone ciprofloxacin to CF patients infected with P. aeruginosa typically only results in the maintenance of low bacterial levels and not elimination of the pathogen, one of the goals of this thesis was to ascertain the effect of sub-inhibitory and inhibitory ciprofloxacin on adaptive resistance. Adaptive resistance is defined as an unstable, reversible resistance that is unrelated to genetic mutation (Barclay and Begg 2001), and occurs transiently in an organism under non-lethal selective pressure. I hypothesized that sub-MIC concentrations of ciprofloxacin could induce adaptive resistance like mechanisms in P. aeruginosa. A second goal of this work was to more closely and broadly examine the effect of sub-inhibitory and inhibitory ciprofloxacin on P. aeruginosa through use of DNA microarray technology. This required the design and construction of a custom DNA microarray to the P. aeruginosa genome and development of its associated experimental protocols and data analysis programs, since commercial platforms were unavailable at the time and bacterial microarrays in general were only beginning to be developed. From the knowledge gained through this global analysis, it was the aim of this thesis to apply these findings to further the current understanding of the effect of sub-inhibitory antibiotics, in particular ciprofloxacin, on the development of antibiotic resistance. Following upon the findings from the initial goal, I hypothesized that sub-inhibitory levels of the synthetic antimicrobial ciprofloxacin would have the ability to modify the antibiotic resistance profile of P. aeruginosa. These more detailed microarray studies revealed some unique findings, namely that sub-inhibitory ciprofloxacin up-regulated expression of the R2/F2 pyocin region in P. aeruginosa. Subsequent analysis of the susceptibility of mutants in this region found that the R2/F2 pyocin region encoded a quinolone susceptibility determinant, leading to a better understanding of the role sub-inhibitory ciprofloxacin antibiotics play in the development of resistance in P. aeruginosa. Overall, the main outcomes of this thesis work were the establishment of a P. aeruginosa custom DNA microarray and its associated protocols, and the characterization of the effect of sub-inhibitory ciprofloxacin on the transcriptional response of P.  36  aeruginosa, features of which can be applied to the design of new antimicrobials or dosing regimes which do not induce similar resistance or response profiles.  37  MATERIALS AND METHODS  A. Bacterial Strains and Growth Conditions All bacterial strains used in this study are described in Table 3. All strains were stored at -70°C until thawed for use. Strains were grown at 37°C in Luria-Bertani broth (LB; 1.0g/l tryptone, 0.5g/l yeast extract, 5g/l NaCl; Difco Laboratories, Detroit, MI). Transposon insertion mutants were cultured overnight in LB broth containing 50pg/ml tetracycline (Sigma-Aldrich Corp., St. Louis, MO). Mutants obtained from the University of Washington Genome Center (Seattle, WA) were grown in LB broth supplemented with 60ug/ml tetracycline. In all experiments, overnight aerobic cultures were grown with agitation in Luria-Bertani broth at 37°C, and used at a 1/1000 dilution to inoculate 50-ml portions of LB broth in 500-ml Erlenmeyer flasks. For ciprofloxacin experiments, P. aeruginosa cultures were either untreated or treated with O.lx-, 0.3x- or lx- of their respective ciprofloxacin MIC (refer to Table 5 in the Results section), and the resulting cultures grown at 37°C with agitation to the mid-logarithmic phase of growth (OD600, 0.5 to 0.6). B. Chemicals Antimicrobials were made fresh daily and were obtained from the following sources: ciprofloxacin hydrochloride (Bayer, UK) enofloxacin (Warner Lambert Co., Ann Arbor, MI), gentamycin sulfate (ICN Biomedicals Inc., Aurora, Ohio), mitomycin, nalidixic acid, norfloxacin and novobiocin (Sigma-Aldrich Corp.), ceftazidime (GlaxoSmithKline Beecham, Inc.), cefepime (Bristol Myers Squibb, New York, NY), and amikacin sulfate (Bristol Laboratories, Belleville, Ont). C. Optimization and Development of Microarray Parameters a. Genomic DNA Isolation 10ml of LB broth was inoculated with an isolated colony of PAOl-HI 03 cells and incubated  38  Table 3:  Bacterial strains used in this study.  Strain  Genotype  Abbreviation  Reference  H103  Wild type P. aeruginosa PAOl  H103  57  PA0611 :IS/acZ/hah derivative of PAOl  prtR::lSlacZ  Jacobs et al., 2003  3501  PA0621 :IS/acZ/hah derivative of PAOl  PA0621::IS/acZ  Jacobs et al., 2003  43080  PA3617 •JSphoA/hah derivative of PAOl  recA::VS>phoA  Jacobs et al., 2003  PA01_Jux _22_ E4  PA0620 •.luxCDABE derivative of HI 03; Tc  R  ?A0620::lux  This study  PA01_ lux..26._H2  PA0641 •.luxCDABE derivative of HI 03; Tc  R  PA0641::/MX  This study  PAOl. lux..24._A3  P A3 866 •.luxCDABE derivative of HI 03; Tc  R  PA3866::/wx  This study  39  with shaking to log phase at 37°C (OD oo, 0.5 to 0.6). Genomic DNA was extracted twice with 6  equal volumes of phenol/chloroform/isoamyl alcohol (25:24:1, Sigma-Aldrich Corp.) and once with an equal volume of chloroform (Sigma-Aldrich Corp.). Genomic DNA was precipitated with 2 volumes ice-cold 100% ethanol and 1/10 volume sodium acetate (3M, pH5.2, Ambion, Inc., Austin, TX). The genomic DNA was washed with ice-cold 70% ethanol, the residual ethanol evaporated and the DNA precipitate resuspended in lOOpl RNase free db^O (Ambion, Inc.). The quality of the genomic DNA was assessed by electrophoresis on a 1% agarose gel containing ethidium bromide (EtBr) in comparison to DNA size markers and visualized under a UV light box (Chemigenus2, Syngene). Samples were quantified by UV absorption at 260nm. b. PCR amplification from Genomic DNA Amplicons of various size (400, 600 and 800 bp) to oprD were generated from genomic DNA isolated from PAO-H103. Primers used here and throughout are listed in Table 4 and were designed based on the published P. aeruginosa sequence (Stover, Pham et al. 2000) (www.pseudomonas.com) using the Primer3 program (Whitehead Institute for Biomedical Research). A l l primers were synthesized and purified by AlphaDNA (Montreal, PQ) unless otherwise stated. Reactions contained lug genomic DNA, 3.5mM MgCb, 200uM each of dATP, dCTP, dGTP and dTTP (Invitrogen Corp., Carlsbad CA), lOOnM each primer (oprD-Rev and oprD-400, oprD-600 or opr£>-800), and 1.25U Taq DNA polymerase in lx PCR buffer (Invitrogen Corp.). Amplification proceeded on a Minicylcer (MJ Research, Inc., Reno, NV) under the following cycling conditions: 2min at 94°C, followed by 30 cycles of lmin at 94°C, lmin at 65°C and lmin at 72°C, and then 5min at 70°C. Amplicons were purified using QIAquick PCR purification kit according to the manufacturer's instructions (Qiagen Inc., Mississauga, Ont), and amplicon quality and molecular size confirmed by electrophoresis on a 1% agarose gel containing EtBr, and visualized using a UV light box. c. Synthesis of P-labeled Probe 32  Randomly  P-radiolabeled DNA probes were prepared from 25ng of various oprD  amplicons (400, 600 and 800bp) and used in subsequent optimization experiments. Various 40  Table 4:  Nucleotide sequences of primers used in this study. Primer Name oprD-Rov oprD-400 oprD-600 oprD-800  T7 pSPORT RUP GFP oprD-Y or oprD-Re\2 rpoC-F 102 rpoC-F239 rpoC-F366 rpoC-f'610 rpoC-FlAO rpoC-F923 rpoC-Y\012 rpoC-F\230 rpoC-Rev rpsL-For rpsL-Rev  Random primer PA3866-For PA3866-Rev PA3617-For PA3617-Rev PA0610-For PA0610-Rev PA0611-For PA0611-Rev PA0621-For PA0621-Rev PA0623-For PA0623-Rev PA0642-For PA0642-Rev PA0648-For PA0648-Rev PA4597-For PA4597-Rev rplF-For  rp/F-Rev  Primer Sequence (5' to 3')  ACGCGGTCTCGGCAACGCCGGCTT CAGCGAATTCGAAGGGCTCGACCTCGAGG GTGATGAACGACGGCAAGCCG AGCAGCCTCGACCTGCTGCTCCGC TAATACGACTCACTATAGG TAGGTGACACTATAGAAGAGC ACAGGAAACAGCTATGACCAT AGACAAGTTGGTAATGGTAGCGA GTACTTGGCTTCGAGGTTGG GCTACCTGGGCCTGAAGC CAGCGAACGCAAGCGTCAG TCCGCGGCGTCGTTCCAG CCAGGTGGAACTCACCCAG ACGTGTTCGAAGGCGAACAG TCGATCCTGGCGGAAATCAG ACCGACGTACCGGCGCAG GCATCACCGTCAAGCGTCAG CGAGCGCGAGCGCTACAAG TTAGTTACCGCTCGAGTTCAG GCAACTATCAACCAGCTGGTG GCTGTGCTCTTGCAGGTTGTG (NS) where N=A,T,C,G and S=C,G CCACTTGTCGTGACCAGAGGA CATCGACCCAGGCTCGTAA GTGAAGAACAAGGTTTCCCCG GAGGATCTGGAACTCGGCCT TAGCACTCCGATTCCACGC CCGAAGATGCGGTAGACCA AGCTTCAACCGCGAGGAATA CATGTCCTCCGGCGAGTACT TTTCCCGTCAGCAACGTAGC GCTGACTATCCCGCCATCTC CCGAGAAGCGCTGAATTTCT CCATTGAAAGCGCTCTGGTC GCTGCACCTCCTGTTCTAGC TCGAACACGAAGTCCATATCC GTGCAGGTGTGGAGACGGAT TCTCTTCGACCTTGGCAAGC TCATCGTCGATGCCGAACTAC TGTTATCCAGGGCCATGTCC AGGTTGCTGCCGAAATTCG CTTGCCTTTGTAAGGCTCCG 5  41  amplicon sizes were radiolabeled to better mimic the hybridization events of subsequent gene expression analyses, where various lengths of cDNA probes would be used in hybridization experiments. All P-labeled probes were prepared according to kit instructions (RediPrime II, 32  Amersham Biosciences, Baie d'Urfe, PQ). In brief, the amplicon was diluted in 45ul lOmM Tris HC1 pH 8.0; 1 mM EDTA in RNase free dH 0 and denatured by heating to 100°C for 5min and 2  cooling on ice for 5min. The denatured amplicon was transferred to a reaction tube, and the addition of 5 pi of fresh  32a  P-dCTP added and mixed by pipetting. Random incorporation of  radioactivity was allowed to occur for lOmin at 37°C, at which point the reaction was stopped with 5 pi of 0.2M EDTA. Radiolabeled DNA probe was stored at -20°C for up to two weeks, the first half-life for the radioisotope. d. Preparation of Nylon Membrane DNA Macroarray For all subsequent development and optimization experiments involving determination of amplicon size, concentration and hybridization temperature and solution, the specified PCR amplicons were crosslinked to nylon membranes. PCR amplicons were suspended at the desired concentration in spotting buffer (0.4M NaOH; lOmM EDTA (pH 8.2) in RNase free dH 0). 2  Samples were then heated to 100°C for lOmin to denature the DNA and immediately placed on ice. Following a brief spin at 4°C, samples were spotted onto positively charged nylon membranes (Boehringer Mannheim) at the desired volume and allowed to air dry. Dried membranes were overlaid onto filter paper soaked with alkaline denaturing solution (1.5M NaCl; 0.5M NaOH in RNase free dH 0) for lOmin, and then neutralizing solution (1M NaCl; 0.5M 2  Tris HC1 (pH 7.0) in RNase free dH 0) for 5 minutes. Membranes were allowed to dry and were 2  then baked for 30 minutes at 80°C in a Tek Star Jr. hybridization oven (Bio/Can Scientific). To crosslink the denatured amplicons to the membrane, the membranes were wrapped in transparent plastic wrap and exposed to UV light for 30 seconds (the time being calculated specifically for the UV source according to the formula in Current Protocols in Molecular Biology, 3.19.5 (Ausubel 1997)). Membranes were stored between filter papers at 4°C for up to three months.  42  e. Hybridization and Image Analysis Hybridization experiments followed the standard protocol outlined in Current Protocols in Molecular Biology, 4.9.7 (Ausubel 1997). Briefly, the DNA membrane was placed in a hybridization tube and incubated at 45°C for 3 hours with 5ml of prehybridization solution (5X SSC; 5X Denhardt solution; 50% w/v formamide; 1% w/v sodium lauryl sulfate (SDS); lOOug/ml denatured salmon sperm DNA) to block nonspecific binding. The desired P-labeled 32  probe (400, 600 or 800bp oprD amplicons) was heated to 100°C for 5min and then chilled on ice for 5min to denature the probe. As per kit instructions (RediPrime II), 14pl of radiolabeled probe was added to the hybridization tube and the membrane incubated overnight at 42°C. The membrane was subsequently washed twice each in 5ml of 2X SSC/0.1%> SDS and 0.2X SSC/0.1%) SDS, while rotating at room temperature for 5min. Two further washes in 5ml of 0.2X SSC/0.1%) SDS were then performed while rotating at 45°C for 15 minutes. Membranes were wrapped in transparent plastic wrap and placed overnight in a photoimager cassette for autoradiographic imaging. A Phosphoimager SI (Molecular Dynamics) and ImageQuant vl.2 (Molecular Dynamics) software were used to visualize and quantify the hybridization signals. Local median background was subtracted from the volume of the rectangle drawn around each pair of gene spots on the membrane and divided by the rectangular area. The hybridization signals for each pair of gene spots were averaged to reduce errors in spotting technique or hybridization efficiency. The hybridization signal of one membrane was then compared to the respective spots on another membrane analyzed in an identical fashion.  f. Determination of Amplicon Size, Concentration and Volume To determine which size, concentration and volume of PCR amplicon would yield the best signal when hybridized to different sizes of P-labeled DNA probe, 400, 600 and 800bp 32  amplicons of oprD were PCR amplified and purified (as previously described) and spotted in duplicate onto positively charged nylon membranes. For size/concentration experiments, 1, 3, 5 and lOng of each amplicon was spotted at a 0.5 pi volume and hybridized with various sized probes (400, 600 and 800bp) in standard hybridization solution at 42°C.  For size/volume  experiments, 0.5, 1,2 and 5pi volumes of each amplicon was spotted at a lOng concentration and 43  hybridized with various sized probes (400, 600 and 800bp) in standard hybridization solution at 42°C. Amplicons were crosslinked to the membranes as previously described. g. Determination of Hybridization Temperature and Solution Various hybridization solutions and temperatures were examined to determine which set of conditions resulted in the best hybridization signal between 600bp P-labeled oprD and 0.5pl 32  microspots containing lOng of 600bp OprD amplicon cross linked to nylon membranes (as previously described). UltraHyb (Ambion, Inc.), EpressHyb (Clontech) and a standard hybridization solution (5X SSC; 5X Denhardt solution; 50% w/v formamide; 1% w/v SDS; lOOpg/ml denatured salmon sperm DNA) were compared. For hybridization experiments with UltraHyb solution, the solution was preheated to 68°C until all precipitate dissolved. 5ml of hybridization solution was added to the hybridization tube containing a DNA membrane, and the membrane allowed to prehybridize for 30 minutes at 42°C while rotating. 14pl of P-labeled 32  oprD was added to the hybridization solution and the membrane incubated overnight at 42°C while rotating. The membrane was then washed twice each in 5ml of 2X SSC/0.1% SDS and 0.1X SSC/0.1% SDS at 42°C for five minutes and 15 minutes, respectively, and analyzed as previously described. For hybridization experiments with ExpressHyb solution, the solution was preheated to 68°C until all precipitate dissolved. 5ml of hybridization solution was added to the hybridization tube containing a DNA membrane, and the membrane allowed to prehybridize for 30 minutes at 42°, 55° or 68°C while rotating. 14ul of P-labeled oprD was added to the 32  hybridization solution and the membrane incubated for lhour at 42°, 55° or 68°C while rotating. The membrane was then washed thrice each in 5ml of 2X SSC/0.05% SDS and 0.1X SSC/0.1% SDS at room temperature for 15 minutes and at 50°C for 20 minutes, respectively. Hybridization experiments with the standard hybridization solution were as described in the 'Hybridization and Image Analysis' section.  44  D. Microarray Construction The Pseudomonas aeruginosa strain PAOl custom microarray described herein was made in collaboration with Chiron Co. (formerly PathoGenesis Co.; Seattle, WA). a. Primer Design Based on the publicly available sequence (Stover, Pham et al. 2000) of P. aeruginosa strain PAOl, primers were designed to every open reading frame (ORF) in the genome by SigmaGenosys (Woodlands, TX). Care was taken to ensure the uniqueness of each primer sequence and amplicon. b. PCR Amplification, Purification and Amplicon Evaluation Each ORE in the P. aeruginosa strain PAOl genome was PCR amplified in a lOOpL reaction on Microseal skirted 96-well plates (MJ Research, Inc.) in reactions containing: 2 ng genomic DNA, 8 mM dNTP mix (Invitrogen Co.), 5% DMSO (Sigma-Aldrich Corp.), and 2.5 U Takara ExTaq polymerase (Invitrogen Co.). 40 uM primers were added last and pipette mixed. A hotstart reaction on the PTC-225 DNA Engine Tetrad cycler (MJ Research, Inc.) was cycled for: 94°C for 90sec, 10 cycles of 94°C for 30sec, 65°C for 90sec, 72°C for 90sec, and then 25 cycles of 94°C for 30sec, 60° for 90sec, 72°C for 90sec, followed by 72°C for 7min. Genomic DNA used in this set of PCR reactions was isolated from the sequenced strain PAOl, using the Bacterial Genomic DNA Purification System (Edge BioSystems; Gaithersburg, MD). Each amplicon was amplified three times in order to generate substantial volume and concentration for each of the collaborating facilities, and then pooled. Amplicons (2pl load) were checked by 1.5% agarose gel electrophoresis for yield and molecular weight, as compared to 5ul Bioline HyperLadder IV (Bioline, Randolph, MA) mass size markers. Primers yielding less than 80lOOng product or high primer-dimer ratios or more than one amplicon, were re-synthesized by Sigma-Genosys. Amplicons were purified using the Millipore Multiscreen PCR filter plate at PathoGenesis Co. (Seattle, WA).  45  Later, amplicon yield and molecular weight were re-evaluated by capillary electrophoresis using the Caliper LabChip 90 electrophoresis system (Caliper, Hopkinton, MA). c. Sequencing of Amplicons All Amplicons were sequenced at Chiron Co. (Emeryville, WA) using an ABI 3100 Automated Capillary DNA Sequencer (Applied Biosystems, Foster City, CA). d. Re-suspension and Plate Format Transfer Following completion of the PCR amplification, purification and sequencing of the P. aeruginosa ORFs, amplicons were resuspended in 6x SSC and were transferred from a 96-well format to 384-well polystyrene plates (Nalge Nunc International, Rochester, NY) through use of the Hydra II (Robbins Scientific, Sunnyvale CA) at Xenon Genetics Inc. (Vancouver, Canada). Amplicons were diluted with distilled H2O (dH20) to achieve a final printing concentration of 25-50ng/pL in 3x SSC. For storage of source plates at -70°C, the plates were spun down and dried at 45°C and 1200 RPM in a Savant SpeedVac Plus SC210A (Telechem International, Inc., Sunnyvale, CA). e. Synthesis of Quality Control Genes A set of control genes and spots were also generated. These controls included amplicons of lysA, thrC, dapB, pheB and trpD from Bacillus subtilis (ATCC# 87482, 87483, 874844, 87485 and 87486) which were used as positive control genes on the microarray since known concentrations of complimentary spike RNA would be added to the reverse transcription reaction. These positive control amplicons were generated by PCR in reactions which contained: lOng plasmid DNA, 10 mM dNTP mix, 2% DMSO, 25pM each of T7 primer and pSPORT primer (Table 4), and 0.5U Takara ExTaq polymerase in lx PCR buffer. The PCR reaction proceeded under the following cycling conditions: 95°C for 90sec, 35 cycles of 95°C for 30sec, 55°C for 90sec and 72° for 90sec, and then 72°C for 7min. Complimentary spike transcripts were generated from plasmids isolated from overnight cultures of the ATCC clones by QIAprep  46  Miniprep columns (Qiagen, Inc.). Purified plasmids were linearized by digestion with NotI (Invitrogen Co.) and in vitro transcribed using the MEGAscript T7 kit (Ambion, Inc.) according to manufacturer's instructions. Transcribed RNA samples were treated with DNase-/ree for 15 min at 37°C to remove residual plasmid DNA and purified by RNeasy Protect Mini column (Qiagen, Inc.). The purity and quantity of RNA transcripts was evaluated by UV spectrophotometry, and RNA transcript size and integrity assessed by 2% agarose gel stained with EtBr and visualized by UV light box. Presence of RNA nucleic acid was confirmed by 2% agarose gel of samples digested with RNase I (Ambion, Inc.) according to manufacturer's instructions. As well, amplicons of the green fluorescent protein (GFP) gene were generated and utilized as sub-grid markers on the microarray since labeled GFP amplicon would be added to the labeled cDNA mix. These amplicons were generated by PCR in reactions which contained: 250ng GFP plasmid (generously donated by Gene Array Facility, Vancouver, BC), 2% DMSO, 25uM each of RUP primer and GFP primer (Table 4) and 0.5 U Takara ExTaq polymerase in lx PCR buffer. The PCR reaction proceeded under the following cycling conditions: 95°C for 2min, 35 cycles of 95°C for 30sec, 55°C for 90sec, and 72°C for 60sec, and then 72°C for 7min. GFP amplicons were purified by QIAquick PCR purification columns as above, quantified by UV spectrophotometry and resuspended for printing as for the P. aeruginosa ORF amplicons. Complimentary spike GFP amplicons were labeled using the Ready-to-Go DNA Labeling Beads dCTP kit (Amersham Pharmacia Biotech). 25ul of purified GFP amplicon at 50ng/ul was added to 24ul dH 0 and incubated for 3-5min at 95°C, at which point a labeling bead and lul of Cy2  dCTP (Amersham Pharmacia Biotech) was added. The labeling reaction proceeded for lhour at 37°C, after which the labeled GFP was cleaned using a MicroSpin G-50 spin column (Amersham Pharmacia Biotech) according to the manufacturer's instructions.  f. Additional Microarray Features Other controls included empty spots which served as negative controls and spots containing only 3x SSC which served as spotting solution controls. A spotting pattern was created (Figure 5) to ensure that neighbouring ORFs were not spotted adjacent to each other, and that each subgrid was delineated at the corners by the GFP sub-grid marker.  47  2  1  1  123  123  124  124  125  125  126  126  127  127  128  128  2  116  116  117  117  118  118  119  119  120  120  121  121  122  122  1  0  108  108  109  109  110  110  111  111  112  112  113  113  114  114  115  115  100  100  101  101  102  102  103  103  104  104  105  105  106  106  107  107  92  92  93  93  94  94  95  95  96  96  97  97  98  98  99  99  84  84  85  85  86  86  87  87  88  88  89  89  90  90  91  91  76  76  77  77  78  78  79  79  80  80  81  81  82  82  83  83  69  69  70  70  71  71  72  72  73  73  1  1  74  74  75  75  67  68  68 60  61  61  62  62  63  63  64  64  65  65  66  66  67  54  54  55  55  56  56  0  0  57  57  58  58  59  59  60  46  46  47  47  48  48  49  49  50  50  51  51  52  52  53  53  41  42  42  0  0  43  43  44  44  45  45  39  39  40  40  41  31  31  32  32  33  33  34  34  35  35  36  36  37  37  38  38  23  23  24  24  25  25  26  26  27  27  28  28  29  29  30  30  16  16  17  17  0  0  18  18  19  19  20  20  21  21  22  22  1  9  9  10  10  11  11  12  12  13  13  14  14  15  15  1  Figure 5:  Spotting pattern (version 3) for the P. aeruginosa custom DNA microarray.  Numbers refer to quadrants on the set of 384 well plates, where each plate contains 8-48 well quadrants.  48  g. Microarray Printing and Storage All amplicons were spotted in duplicate according to the configured spotting pattern (Figure 5). Within fifteen 384-well plates and one control 384-well plate, there were a total of 122 quadrants (48-pin head areas) to be spotted (Figure 5). Using a BioRobotics Microspot 10K print tool (Genomic Solutions, Ann Arbor, MI) and BioRobotics MicroGrid II printer (Genomic Solutions) at the Gene Array Facility (Vancouver, BC), amplicons were spotted onto ArraylT superamine slides (TeleChem International Inc.). Printed slides were crosslinked in a UV Stratalinker 1800 oven (Stratagene, La Jolla, CA) set at 1200 uJoules. All printed microarray slides were stored in a cool, dry place until use. E. Microarray Quality Assessment All printed microarray slides were examined for overall grid layout, spot morphology and glass imperfections like scratches or chips, by examination of each slide under a light microscope. Slides not possessing greater than 95% spot or slide integrity were noted, and removed from the print run. This quality control process was aimed at removing any abhorrent slides from the batch prior to hybridization. a. Verification of Microarray Print Run Microarray slides were labeled with SYBR Green II (Battaglia, Salani et al. 2000) and examined under 488nm blue (argon) laser to assess the quality and quantity of the printed material. A microarray from each print batch was stained by immersion for 2min in a solution of SYBR Green II (Molecular Probes, Eugene, OR) diluted in 1:10,000 in TBE solution, pH 8.0. After staining, the slide was washed in TBE, dF^O and air dried. Scanned microarrays were examined for uniformity of spot size and printing pattern. In another assay, the spotted DNA material was terminally labeled with Cy-3 fluorophore to detect the extent, concentration and uniformity of bound material. In brief, 5x terminal transferase buffer (Roche Applied Science, Indianapolis, IN) was combined with 4pl Cy-3 dCTP (Amersham Pharmacia Biotech), 5mM CoCb, 1600U terminal transferase (added last) and dFFiO  49  to a final volume of 80pl. The entire volume was placed onto a printed microarray slide, covered with a HybriSlip hybridization cover (Grace Bio Labs, Bend, OR) and placed in a Corning hybridization chambers (Corning Life Sciences, Acton, MA) for hybridization at 37°C for 30min to lhr. Coverslips were removed by floatation in O.lx SSC, and the slide washed three times in O.lx SSC/0.1% SDS at 42°C, once in O.lx SSC at room temperature and then spun dry for 5min at 500rpm. Slides were then scanned under 543nm laser using the ScanArray Express scanner (Perkin Elmer, Wellesley, MA). b. Cross Hybridization The extent of cross hybridization was examined through hybridization of Cy-5 fluorophore (Amersham Pharmacia Biotech) labeled oprD amplicon, since oprD belongs to a large family of homologous outer membrane proteins in P. aeruginosa (Stover, Pham et al. 2000). oprD amplicons were generated by PCR from genomic DNA isolated from PAO-H103 as previously described, with oprD-For and oprD-Rev2 primers listed in Table 4. Amplicons were purified as before, and amplicon quality and molecular size confirmed as before. Amplicons were purified as previously outlined using the QIAquick PCR purification kit, and labeled in the same manner as described for GFP amplicons. Following the hybridization protocols outlined below in the 'Microarray Hybridization' section, 0.25pl, 0.5pl and lpl of labeled oprD (approximately lOng) was hybridized overnight and analyzed.  F. Microarray Method Development a. Determination of RNA Isolation Methods Standard RNase free precautions were observed throughout. For comparison purposes, equivalent volumes of logarithmic phase cells were used for all total RNA isolation methodologies examined. Total RNA was isolated using SV Total RNA Isolation System (Promega), RNeasy Mini and RNeasy MIDI kits (Qiagen, Inc.) as well as phenol chloroform based methods and cesium chloride (CsCl) methods. Manufacturer's instructions were followed for all kit isolations, and total RNA eluted from the respective columns with RNase free water  50  containing ANTI-RNase RNase inhibitor (Ambion, Inc.). Total RNA samples were evaluated on a 2% agarose gel containing lOug/ml EtBr for the presence of genomic DNA contamination, RNA degradation and overall RNA yield. Samples were also evaluated for purity and quantified by UV absorption at 260nm and 280nm. For phenol based total RNA isolation, cell pellets were resuspended in Trizol and sonicated for lOsec. Following incubation at room temperature for 5min, chloroform was added, vigorously mixed and allowed to incubate a further 3min at room temperature. Isolates were centrifuged maximally for 15min at 4°C, and the aqueous phase removed. Isopropanol was added, samples incubated for lOmin at room temperature and then centrifuged at 4000rpm for 45min at 4°C. Pellets were washed with 70% EtOH, air dried and then resuspended in RNase free water containing ANTI-RNase RNase inhibitor and analyzed as noted above. For CsCl total RNA isolation, cell pellets were resuspended in 4M guanidinium isothiocyanate, containing 0.1M Tris-HCl (pH8.0) and 1% P-mercaptoethanol. The sample was layered over a cushion of 5.7M CsCl in 0.01M EDTA (pH 7.5) and centrifuged for 22hrs at 56,000 rpm at 20°C. The RNA pellet was resuspended in RNase free water, washed with 70% EtOH air dried and again resuspended in RNase free water containing ANTI-RNase RNase inhibitor and analyzed as noted above. Total RNA samples from each of the isolation methodologies were DNase treated to remove contaminating genomic DNA and then evaluated for their ability to generate RNA of high integrity. With the exception of total RNA isolated using the SV Total RNA Isolation System where genomic DNA was treated on the column prior to elution as per manufacturer's instructions, total RNA samples were treated for lhr at 37°C with DNA-free (Ambion, Inc.) according to manufacturer's recommendations, and re-evaluated by 2% agarose gel and UV spectrophotometry as above. Total RNA from each of the isolated samples was then reverse transcribed (RT) as follows: lpg total RNA and 50pmol random primer (Table 4) were heated for lOmin at 70°C; 30U ANTI-RNase (Ambion, Inc.), Ix reverse transcriptase buffer (Invitrogen, Co.), lOmM DTT, and lOmM dNTPs (Invitrogen, Co.) were added and incubated for 2min at 25°C, after which 200U Superscript™ II Reverse Transcriptase (Invitrogen, Co.) was added and the reaction allowed to proceed for lhr at 48°C and then 15min at 70°C. In a second step, varying lengths of rpoC (full transcript length is 1230bp) were amplified from the various cDNA samples to ascertain the integrity and size of the RNA transcripts recovered during sample  51  handling and RNA extraction. PCR amplification was performed as follows: RT reactions were diluted 1:2 in RNase free water, and 5ul of diluted cDNA template used with lOmM dNTPs, lOpmol each of various rpoC-Vox and rpoC-Rev primers (Table 4), 5% DMSO and 0.5U Takara ExTaq polymerase in lx PCR buffer. PCR cycling conditions were: 95°C for 90sec, 35 cycles of 95°C for 45sec, 55°C for 45sec and 72°C for 90sec, then 72°C for lOmin. Amplification was assessed by 1% agarose gel as previously described. b. Determination of Genomic DNA Treatment Contaminating genomic DNA was removed from isolated RNA samples using DNA-free (Ambion, Inc.). The length of DNase treatment was evaluated using the same concentration and sample of total RNA, and proceeded according to manufacturer's instructions except for the treatment time, which was varied to include 15min, 30min, 45min and 60min. Efficiency of genomic DNA removal and quality of remaining total RNA was evaluated by 2% agarose gel as previously described. The efficiency of the DNase treatment was also evaluated by two step RTPCR amplification of a high abundance, ubiquitous transcript rpsL, ribosomal protein SI2. Parallel RT reactions with and without reverse transcriptase were performed as outlined for rpoC using the various DNase treated total RNA samples. The second step PCR proceeded as for rpoC except using rpsL-For and rpsL-Rev primers (Table 4) and 60°C extension temperature. RNA that is free of all genomic DNA should not yield a product when amplified in the absence of reverse transcriptase enzyme. Presence or absence of rpsL amplicons was evaluated by 1% agarose gel as previously described.  c. Determination of Reverse Transcription Reaction Various amounts (10, 12 and 15 pg) of total RNA from the same extraction were assessed in parallel RT reactions for cDNA quality and yield. RT reactions proceeded as follows: DNase treated (as above) total RNA and random primer (Table 4) were incubated at 70°C for lOmin and 25°C for lOmin; lx RT buffer, lOmM DTT, lOmM dNTPs, 30 U SUPERase-IN (Ambion, Inc.) and 1500 U Superscript™ II reverse transcriptase was added and incubated for lOmin at 25°C, 37°C for lhr, 42°C for lhr and 70°C for lOmin. Residual RNA was removed from the cDNA  52  sample by treatment with 1/3 volume IN NaOH for 30min at 65°C, followed by neutralization with IN HC1. cDNA was visualized on a 1% agarose gel stained with SYBR Gold nucleic acid gel stain according to manufacturer's instructions (Molecular Probes) and quantified by U V spectrophotometry at A260. d. Determination of Labeling Method Both direct and indirect (amino-allyl) Cy-dye incorporation methodologies were evaluated for overall expression intensity. Amino-allyl labeling was further characterized using various reverse transcriptase enzymes. For direct labeling of cDNA with fluorophores by direct method #1, 12ug of DNase treated total RNA was reverse transcribed as follows: total RNA, random primer (Table 4), lx RT buffer, lOmM DTT, 6.7mM each of dATP, dTTP, dGTP, 2mM dCTP and ImM Cy-3 or Cy-5 dUTP (Amersham Pharmacia Biotech) were added and incubated at 65°C for 5min, then at 42°C for 5min. 400U Superscript™ II reverse transcriptase and 30U SUPERase-In (Ambion, Inc.) was added and the reaction incubated a further 3hrs at 42°C and then lOmin at 70°C. Residual RNA was removed through addition of 1M NaOH, incubation at 65°C for 15min and neutralization with 1M HC1 and 1M Tris-Cl (pH 7.5). Labeled cDNA samples were combined and purified from unincorporated fluorophore on a QIAquick PCR purification column as per manufacturer's instructions. Labeled GFP (sub-grid marker labeled as previously described) was spiked into the purified cDNA sample, which was then salt ethanol precipitated and resuspended in 50pl hybridization buffer #1 (50% formamide, 5x SSC, 0.1% SDS, 20ug salmon sperm DNA (Ambion, Inc.) and 25pg yeast tRNA (Ambion, Inc.) for hybridization. For direct labeling of cDNA by direct method #2, 12pg of DNase treated total RNA was reverse transcribed as follows: total RNA and random primer (Table 4) were incubated at 70°C for lOmin and 25 °C for lOmin. lx RT buffer, lOmM DTT, 3.75mM each of dATP, dTTP, dGTP, 1.875mM dCTP, O.lmM Cy-3 or Cy-5 dCTP (Amersham Pharmacia Biotech), 30U SUPERaseIn and 1500U Superscript™ II reverse transcriptase were added and incubated for lOmin at 25°C, 60min at 37°C, 60min at 42°C and then lOmin at 70°C. Labeled cDNA samples were treated for residual RNA, combined and purified, spiked with labeled GFP and salt ethanol precipitated as for direct method #1. Samples from direct method #2 were resuspended in 50ul  53  hybridization buffer #2 (50% formamide, 5x SSC, 1% SDS and lOug salmon sperm DNA) for hybridization. For indirect labeling of cDNA by indirect method #3, 12pg of DNase treated total RNA was reverse transcribed in the same manner as direct method #2 except lOmM each of dATP, dCTP, dGTP, 3mM dTTP and 3mM 5-(3-aminoallyl)-dUTP (Ambion, Inc.) was substituted. Residual RNA was removed and cDNA salt ethanol precipitated. cDNA pellets were resuspended in 0.2M NaHC0 (pH 9.0) and labeled with 3pi of either Cy-3 or Cy-5 mono-Reactive dye (Amersham 3  Pharmacia Biotech) resuspended in 45pi DMSO, for lhr at room temperature. Labeling reactions were stopped by incubating for 15min at room temperature in 4M hydroxylamine. Labeled cDNA samples were combined and purified by QIAquick PCR purification column as above, spiked with labeled GFP, salt ethanol precipitated and resuspended in 50pl hybridization buffer #2. In a subsequent experiment, various reverse transcriptase enzymes were evaluated in the indirect labeling method #3. Reactions followed the procedures outlined above, except for the replacement of 1500U Superscript™ II reverse transcriptase with 400U M-MuLV reverse transcriptase (New England Biolabs, Beverly, MA). In these comparison series, all labeling methods followed the same hybridization and image analysis procedures. Microarray slides were washed twice in 0.1%> SDS for 5min, five times in dld^O and air dried. Labeled probe sets were denatured for 3min at 95°C and placed on ice for 3min before addition of probe to the slide. HybriSlip hybridization covers were placed on top of the sample and slides placed in Corning hybridization chambers for overnight hybridization at 42°C. Coverslips were removed in 42°C 0.2x SSC and slides washed thrice for 5min in O.lx SSC, 0.1% SDS and thrice for 5min in O.lx SSC at room temperature. Slides were spun for 5min at 2000rpm and then scanned and analyzed as outlined below in the 'Scanning and Image Analysis' section.  54  G. Experiments on Ciprofloxacin Treated Cultures a. Determination of Minimum Inhibitory Concentrations The MIC of ciprofloxacin and the other antibiotics against the various P. aeruginosa strains was measured by the broth microdilution technique (Amsterdam 1991). Briefly, serial dilutions of each antibiotic were made in LB broth in 96-well polypropylene microtitre plates (Costar, Cambridge, MA). Wells were inoculated with 5pl LB medium containing approximately 10  5  CFU/ml of the test organism. In parallel, samples of the inoculum were spread on LB plates to ensure the CFU/ml range. The MIC was determined after 24hr incubation at 37°C, and was visually scored as the lowest concentration of antibiotic which inhibited bacterial growth. Results are the mode of four independent experiments. b. Growth Curve in Sub-inhibitory Ciprofloxacin For purposes of determining mid-logarithmic phase, growth curves were completed for P. aeruginosa grown in each of the ciprofloxacin treatment conditions being studied (Ox-, O.lx-, 0.3x- and lx-MIC). Overnight cultures of P. aeruginosa were sub-cultured as previously described, and UV absorption measurements at OD600 taken at half hour intervals to determine the growth dynamics of the cultures. c. Time-Kill Assay The ability of ciprofloxacin to induce adaptive resistance was evaluated using a modified time-kill assay. Briefly, P. aeruginosa strain HI03 or FA0620::luxCDABE was grown to midlogarithmic phase in the presence or absence of their respective concentrations of ciprofloxacin (O.lx-, 0.3x- or lx-MIC). At mid-logarithmic phase, cells were pelleted by centrifugation. Supernatants were discarded and pellets washed in 10-ml phosphate buffered saline (pH 7.4) (PBS, Invitrogen, Co.; pre-warmed to 37°C). Cells were again pelleted by centrifugation and the supernatant decanted. Pellets were resuspended in 50-ml LB broth (pre-warmed to 37°C) containing the appropriate 2x-MIC ciprofloxacin, adjusted to an equivalent optical density and  55  transferred to new 500-ml Erlenmeyer flasks for incubation with shaking at 37°C. Samples were taken every 15min or 20min for 2hrs to 9hrs, and plated at various dilutions on LB agar plates for colony counts. Plates were incubated at 37°C overnight and colony forming units (CFU) counted the next day. All assays were repeated in quadruplicate. d. Light Microscopy From the time-kill assay cultures for strain HI03, microscope slides were inoculated with a small loop-full of bacteria taken from the untreated strain H103, and strain H103 treated with O.lx- or 0.3x-MIC ciprofloxacin. Samples were taken before and after the PBS wash, and every 15min thereafter throughout the modified time-kill assay. Cells were heat fixed and Gram stained. Cells were then examined at lOOOx magnification on Zeiss AxioLab (Zeiss Canada, Toronto, ONT), where the length of 6-10 random cells was measured in microns. e. Microarray Experimentation P. aeruginosa strain HI03 was cultured in Ox-, O.lx-, 0.3x- and lx-MIC ciprofloxacin as previously stated. A l l microarray experiments were performed as outlined below on three independent cultures and repeated at least twice per culture sample. i. RNA Isolation and Evaluation Bacterial cultures were collected at the mid-logarithmic growth phase (OD600, 0.5 to 0.6) and pelleted by centrifugation. Cells were treated as recommended by the manufacturer's mechanical disruption and lysis protocol for RNA isolation with the RNeasy MIDI columns (Qiagen, Inc.). RNA purity and quantity was assessed by UV spectrophotometry, and RNA integrity monitored by 2% agarose gel electrophoresis containing EtBr and visualized by UV light box.  56  ii. Genomic DNA Treatment and RNA Evaluation Total RNA was eluted from the RNeasy column in RNase-free water containing ANTIRNase and purified from residual DNA by using DNA-/ree at 37°C for at least 15min (Ambion, Inc.). Total RNA was re-evaluated by UV spectrophotometry and electrophoresis to ensure high quality and quantity RNA was maintained through the genomic DNA treatment process. iii. Reverse Transcription Reaction cDNAs were generated by using random primers (Table 4) for reverse transcription. Primers were annealed at 70°C for 10 min, followed by 25°C for 10 min to lOug total RNA and to 5 exogenous transcripts (generated as noted above by in vitro transcription for ATCC# 87482, 87483, 87484, 87485 and 87486) that were added to each sample. Spike RNA transcripts served as a control for monitoring transcriptional efficiency, Cy-dye incorporation and array performance. The reverse transcription reaction proceeded at 37°C for 60 min, 42°C for 120 min, and 70°C for 10 min in a total reaction volume of 60pl containing 1500U Superscript™ II reverse transcriptase, lx Superscript™ II RT buffer, lOmM DTT, 3mM 5-(3-aminoallyl)-dUTP, 3mM dTTP, lOmM each of dATP, dCTP, dGTP, and 30U SUPERase-In. Residual RNA was removed by alkaline treatment with 1M NaOH at 65°C for 15 min, followed by neutralization with 1M HC1; cDNA was then salt-ethanol precipitated for > lhr at -70°C. iv. cDNA Labeling and Purification Precipitated cDNA was resuspended in 0.2M NaHC03 (pH 9.0) and labeled with Cy-3 or Cy-5 mono-Reactive dye resuspended in DMSO. Labeling reactions proceeded as noted above for indirect method #3. Labeled sample pairs for a given microarray experiment were combined, spiked with 0.25ul labeled GFP and purified by QIAquick PCR purification column. The combined cDNA sample was again salt-ethanol precipitated for > lhr at -70°C.  57  v. Microarray Slide Preparation and Sample Hybridization The custom P. aeruginosa microarray slides were prepared for hybridization by washing two times for 5min in 0.1% SDS and five times for lmin in water, followed by boiling for 3min in 95°C water to denature the double strand probes and air drying. The combined cDNA pellet was resuspended in 4ul lOmM EDTA, denatured for 3min at 95°C and added to 71 pi of prepared hybridization buffer #2 (Ambion, Inc.) according to the manufacturer's instructions. The entire sample volume was applied to the prepared microarrays, overlaid with a LifterSlip coverslip (Electron Microscopy Sciences, Fort Washington, PA) and sealed in a Corning hybridization chamber and covered in foil for overnight hybridization in a 42°C waterbath. vi. Post-hybridization Microarray Handling Following overnight hybridization, glass coverslips were removed by flotation in 42°C prewarmed 0.2x SSC. Hybridized slides were washed thrice for 5min in 25ml 0.5x SSC/0.5% SDS and thrice for 5min in 25ml 0.5x SSC, and then spun dry at 2000 rpm for 5min in 50ml conical tubes. Dried microarray slides were stored in the dark until scanning and image analysis. vii. Scanning and Image Analysis Individual microarrays were scanned on a ScanArray Express scanner (Perkin Elmer, Wellesley, MA). All slides for a given microarray experiment were scanned at the same laser and PMT settings. Typically this setting was 95% laser and 90%> PMT gain for Cy-3, and 95% laser and 95% PMT gain for Cy-5. Scanner images were analyzed using the spot finding program ImaGene v5.0 (BioDiscovery, Inc., Marina Del Rey, CA), and textual output data imported into either GeneSpring software v5.5 (Silicon Genetics, Redwood City, CA) or various R scripts developed by D. Aeschlimann and J. Bryan (Dept. Statistics, UBC) for further analysis.  58  viii. Background Correction and Normalization Following image and spot finding analysis, the resulting text files were subjected to background correction (R code developed by Doug Hoffart and Jochen Brumm; Gene Array Facility at VGH, Vancouver), which takes the lowest 10th percent of signal for each sub-grid as the background and subtracts this value out from each signal within that sub-grid. The background corrected output files were then compared and analyzed by various R scripts because the extensive loop design and dye swapping did not allow use of the in house ArrayPipe program. All microarrays were normalized using the R package vsn (Huber, Von Heydebreck et al. 2002) to correct for differences due to dye bias and other hybridization effects, and to stabilize the error variance across the range of expression levels. Pairwise comparisons were made between all genes in all treatment groups, and the baseline or untreated condition. ix. Statistical Analysis Two sample t-statistics and permutation p-values were computed for each pair. Permutation p-values shuffle the data for a given gene and compute p-values as the percentage of simulated means which are greater than the actual observed means relative to the number of simulated samples. Genes exhibiting permutation p-values < 0.05 were considered differentially expressed and subjected to further confirmatory analysis. Data was also analyzed using GeneSpring v5.5 as a secondary analysis method. The fold changes presented herein, were derived from GeneSpring analysis, and are only for those genes with statistically significant expression changes as computed from R analysis. H. Confirmatory Experiments a. Real-time PCR Differential expression of genes was examined by relative real-time PCR (rRT-PCR) using the ABI Prism 7000 Sequence Detection System (Applied Biosystems). Primers were designed using gene sequences from the Pseudomonas database (www.pseudomonas.com) and the ABI  59  Primer Express program v2.0 in the default mode. SYBR Green I dye chemistry was used for detection of PCR products. Primer sequences used for rRT-PCR are listed in Table 4. De novo cDNAs from the same RNA used in microarray target preparation were employed for all real-time PCR analyses. All cDNA samples were diluted 1/1000 fold in TE buffer, and 5ul cDNA was used for each 25pl rRT-PCR reaction (lx SYBR Master mix, Applied Biosystems; 50nM of each primer). All reactions were performed in triplicate using the following cycling parameters: 95°C for lOmin, and 40 cycles of 95°C for 15sec, 60°C for lmin. Dissociation curves were obtained following completion of the reaction. Raw data was analyzed by using the ABI Sequence Detection software (Applied Biosystems). Relative fold changes were calculated according to the formula:  [(GOI nknown/ENDOunknown)/(GOI ntroi/ENDOcontroi)], U  CO  where GOI is the  gene of interest, ENDO is the endogenous control gene, and unknown and control are respective samples being assayed for expression. b. Luminescence Assays Induction and thus transcription from the various luxCDABE fusions of P. aeruginosa (Table 3) was examined in LB broth supplemented with 0, 0.01, 0.03 or O.lpg/ml ciprofloxacin. Cells were grown as previously described, and lOOpl samples removed hourly for analysis by luminescence. Luminescence was measured hourly using a SPECTRAFluorPlus luminometer (Tecan, San Jose, CA). Luminescence was corrected for growth by simultaneously monitoring the absorbance at 620 nm. The assay was repeated in triplicate. c. Twitching Assay Twitching motility was assayed on plates containing 25ml of 1% LB agar ± ciprofloxacin (0.01 or 0.03ug/ml). Following growth of P. aeruginosa strain H103 to mid-logarithmic phase in the presence or absence of ciprofloxacin as before, the culture to be tested was stab inoculated through the corresponding agar. Following overnight growth at 37°C, the zone of twitching (radiating from the point of inoculation) located between the agar and the petri dish was measured. The assay was repeated in triplicate.  60  d.  Transmission Electron Microscopy  Pyocin/phage like particles were isolated from strains H103 and PA0620::/WA; grown until mid-logarithmic phase in the presence or absence of their respective 0.3x-MIC ciprofloxacin concentrations. Particles were isolated as previously described (Yamamoto, Alberts et al. 1970). Briefly, cell lysis was achieved by the addition of chloroform. Cell lysates were treated with DNase I (Invitrogen, Co.) for lhr at 37°C and cell debris removed by centrifugation. Supernatants were incubated with 10% w/v PEG 6000 for lhr at 4°C to sediment out the phage particles, and then centrifuged down at 10,000g for 15min at 4°C. Pellets were resuspended in Buffer B (0.001M phenylmethyl sulfonyl fluoride, 0.1M NaCl, 0.01M phosphate pH 6.8) and insoluble material removed by centrifugation at 5,000g for 5min at 4°C. Samples were then ultracentrifuged for lhr at 70,000g at 4°C and the resulting pellets again resuspended in Buffer B. Phage particle components were retrieved from the 15% sucrose fraction of a sucrose gradient, and were concentrated by dialysis (Slide-A-Lyzer Cassette, 10,000 M W C O ; Pierce Biotechnology, Inc., Rockford, IL) against Buffer B (Yamamoto, Alberts et al. 1970). Samples were prepared on Formvar (Marivac, Halifax, N.S.) carbon stabilized grids, and negatively stained by 1% phosphotungstate. Prepared samples were examined by transmission electron microscopy (Hitachi H7600 TEM) under standard operating conditions at the UBC Biosciences E M lab facility.  e. Serial Selection of Genomic Loss of Pyocin/Phage Region  Overnight L B cultures of P. aeruginosa strain HI 03 and ArecA were sub-cultured at 1/1000 dilution into 5ml fresh L B in the presence or absence of their respective 0.3x-MIC ciprofloxacin concentrations. Cultures were grown overnight at 37°C with shaking. The dilution and treatment condition was repeated for 5 consecutive days, after which lOpl of culture was spread plated onto their respective lOx-MIC ciprofloxacin L B plates. Plates were incubated overnight at 37°C and the resulting colonies assessed for the presence or absence of the R2/F2 pyocin region by colony PCR. Colony PCR was performed for PA0623, PA0642 and PA0648 genes as follows: l x PCR buffer (Invitrogen Co.), 2mM M g C l , 4% DMSO, 200pM each of dATP, dCTP, dGTP and 2  dTTP (Invitrogen Co.), 100 n M each primer (Table 4), and 1.25U Tag D N A polymerase  61  (Invitrogen Co.). Template was added by dipping a pipette tip into the colony and pipette mixing into the PCR mixture. Amplification proceeded on a Minicylcer (MJ Research, Inc.) under the following cycling conditions: 5min at 94°C, followed by 50 cycles of 30sec at 94°C, 30sec at 55°C and 30sec at 72°C, and then lOmin at 72°C. Presence or absence of amplicon was checked by electrophoresis on a 1% agarose gel containing EtBr, and visualized using a UV light box.  62  RESULTS  CHAPTER ONE: Design and Construction of a Pseudomonas Custom Microarray A. Introduction  Completion of the genome sequence for P. aeruginosa strain PAOl (Stover, Pham et al. 2000) afforded researchers the unparalleled opportunity for high throughput and global screening of the organism at the gene or protein level. Around the same time, DNA and oligonucleotide microarrays (Schena, Shalon et al. 1995; Lockhart, Dong et al. 1996) were being developed and becoming increasingly popular as a method of transcriptional analysis. Since commercial P. aeruginosa GeneChips® from Affymetrix were not yet available, and were predicted to be prohibitively costly, it was decided that our own research interests would be best addressed by manufacturing our own custom DNA microarray for P. aeruginosa. The experiments in this chapter describe the strategy and approach to the design and construction of the custom DNA microarray to P. aeruginosa. Work in the latter part of this chapter was done in collaboration with the P. aeruginosa group at PathoGenesis Co. (subsequently acquired by Chiron Co., Seattle, WA). B. Microarray Design  B . l . Optimization of Amplicon Size, Concentration and Volume The extent of DNA-DNA hybridization depends upon the length of molecules being hybridized, since shorter DNA probes are less available for hybridization and since a minimum number of bases are required to interact with the microarray surface (Stillman and Tonkinson 2001) . To determine the size of amplicon best suited for generating intense hybridization signals, various lengths of oprD were spotted on nylon membranes; volume and hybridization temperature were kept constant, while concentration of the spotted probe and length of labeled probe were varied. A notable increase in signal intensity was observed for spotted probes of 600bp and 800bp within the concentration range of 3-10ng (Figure 6). Since concentration of  63  • 400bp spot + 400bp probe 3 400bp spot + 600bp probe • 400bp spot + 800bp probe • 600bp spot + 400bp probe • 600bp spot + 600bp probe • 600bp spot + 800bp probe • 800bp spot + 400bp probe B 800bp spot + 600bp probe B 800bp spot + 800bp probe  I 5  3  10  Concentration (ng)  Figure 6:  Effect of varying concentration and amplicon size on hybridization signal.  0.5ul of 400, 600 and 800bp oprD amplicons at varying concentrations were crosslinked to positively charged nylon membrane and hybridized to 400, 600 or 800bp oprD probes at 42°C in standard hybridization solution.  64  spotted DNA material also affects the hybridization reaction by altering the rate of hybridization and number of available binding sites for the hybridizing probe (Stillman and Tonkinson 2001), various spotting concentrations were simultaneously evaluated. Intense hybridization signals were observed for 600bp and 800bp spotted probes spotted in lOng amounts (Figure 6). lOng as a spotting amount was thus selected for further study. The extent of DNA-DNA hybridization also depends on the volume spotted onto the array platform. Larger spotting volumes present problems with respect to spot bleeding and uniformity, and reduced microarray probe density. To determine the volume of amplicon best suited for generating intense hybridization signals, various volumes of oprD amplicon were spotted on nylon membranes; concentration and hybridization temperature were kept constant, while volume of spotted probe and length of probe were varied. As the volume of spot was increased from 0.5(0.1 to 5pl, the hybridization signal decreased (Figure 7). As well, spot uniformity was found to decline with increasing spot size (data not shown). A spotting volume of 0.5pi was thus selected for further study since this volume would also allow for a high density of spots on the microarray. It was again noted that signal intensities were high for spotted probes of 600bp and 800bp length in comparison to the signal from 400bp length spotted probes (Figure 7). Overall, signal intensity was consistently highest for 600bp spotted probes whether these probes were hybridized to labeled probes of equal or greater length. Spotted probes of 600bp length were chosen for all subsequent analyses. B.2. Optimization of Hybridization Temperature and Hybridization Solution Base composition has a known effect on hybridization given the lower stability of A-T versus G-C pairs (Southern, Mir et al. 1999; Herwig, Schmitt et al. 2000; Stomakhin, Vasiliskov et al. 2000). GC-content of the amplicon is thus an important factor to consider in determining hybridization temperature because probes with an increased GC-content will have an increased hybridization stability due to the increased number of these stable base pairs. Hybridization temperature was thus varied to determine the optimal temperature for the generation of intense hybridization signal; volume, concentration and spotted probe length were kept constant, while hybridization temperature and solution were varied. Strong and consistent signals were detected  65  • 400bp spot + 400bp probe H 400bp spot + 600bp probe H 400bp spot + 800bp probe • 600bp spot + 400bp probe • 600bp spot + 600bp probe • 600bp spot + 800bp probe • 800bp spot + 400bp probe B 800bp spot + 600bp probe B 800bp spot + 800bp probe  0.5  2  1  Volume (ul)  Figure 7:  Effect of volume and amplicon size on hybridization signal.  lOng of 400, 600 and 800bp oprD amplicons at varying volumes were crosslinked to positively charged nylon membranes and hybridized to 400, 600 or 800bp oprD probes at 42°C in standard hybridization solution.  66  from those hybridizations carried out at 42°C in comparison to hybridizations at either 55°C or 68°C (Figure 8). Hybridization at 42°C was selected for all subsequent microarray experiments. Similarly, the composition of the hybridization solution, in particular the stringency or salt concentration (Southern, Mir et al. 1999), affects the molecular interactions on the microarray. In order to find the hybridization solution which would generate the best hybridization signal, various formulations of hybridization solution were compared; again, volume, concentration and spotted probe length were kept constant, while hybridization solution and temperature were varied. The standard hybridization solution and UltraHyb solution (Ambion, Inc.) were found to perform optimally at 42°C (Figure 8). Ambion's UltraHyb solution was selected as the optimal hybridization solution because it performed marginally better with labeled probes of shorter length and did not require technical composition, thereby eliminating the introduction of further technical errors into the microarray experiment. C. Microarray Construction and Validation  C . l . Evaluation of Amplicon Integrity Using primers uniquely designed against each ORE in the P. aeruginosa strain PAOl genome and designed such that each ORF had approximately the same GC content (designed in collaboration with PathoGenesis Co. and synthesized by Sigma-Genosys), PCR amplification conditions were worked out to allow for amplification of each ORF in a high-throughput fashion. Amplification was completed in triplicate for each ORF and pooled before analysis of integrity. Pooled amplicons were also purified and re-evaluated. i. Agarose Gel Analysis of Amplicon Size and Uniqueness To ascertain the quality of the PCR reactions, pooled PCR reactions were analyzed by gel electrophoresis. Amplified products were required to be of the correct predicted size, be present as a predominant single band on the gel and fall above the minimum concentration of 35ng/ul in order to be considered successful. Given the high-throughput nature of the project, if the amplification reactions within a 96-well plate fell below an 80% first pass success rate (<77 of  67  Figure 8:  Effect of temperature and hybridization solution on hybridization signal.  Positively charged nylon membranes crosslinked with 0.5pl of lOng 600bp oprD amplicon were hybridized to 400, 600 or 800bp oprD probes at various hybridization temperatures and with various hybridization solutions.  68  96 wells), then the entire set of 96-wells was either reamplified or the failed ORFs targeted for primer redesign. A sample 96-well electrophoresis gel image displaying 100% amplification success is shown in Figure 9. Overall, the success rate offirstpass PCR was 95.58%, with only a total of 248 ORFs requiring primer redesign and amplification. With respect to amplicon size and uniqueness, 111  (1.98%)  ORFs did not amplify on first pass, 7 (0.12%) PCR reactions  contained more than one band and 11 (0.20%) PCR reactions were of the wrong molecular size. Data tracking of the PCR amplification uniqueness, size and concentration for each ORF is summarized in Appendix I. ii. Sequencing Analysis Following purification of the pooled PCR reactions, amplicons were analyzed by sequencing and sequences analyzed by BLAST (Altschul, Gish et al. 1990) to the published P. aeruginosa  strain PAOl genome (Stover, Pham et al. 2000) (work completed in collaboration  with PathoGenesis Co. and Chiron Co.). Amplicons which failed to produce sequence that corresponded to the appropriate ORF were sent for primer redesign. Overall, the success rate of the sequencing reactions was 99.61%), with only 22 (0.39%) ORFs requiring primer redesign and amplification. Data tracking of the sequencing reactions is also summarized in Appendix I. C.2. Evaluation of Amplicon Concentration i. Agarose Gel Analysis In addition to evaluating amplicon size and uniqueness, agarose gels were also used to estimate the concentration by comparison to a mass size marker (Figure 9; details of the specific concentrations for each marker band are available from Bioline). A minimum concentration of 35ng/ul was required for the PCR reaction to be considered successful. The majority of PCR reactions (98.27%) fell well above this minimum cut-off, with only 97 (1.73%) PCR reactions falling below the minimum yield requirements (refer to Appendix I).  69  Figure 9: Sample agarose gel for evaluation of 96 well P C R a n d corresponding molecular ladder size range.  All PCR reactions performed in 96 well plate format were evaluated for yield, uniqueness and molecular size by 1.5% agarose gel electrophoresis stained with EtBr in comparison to ladder (L) molecular size markers.  70  ii. Capillary Electrophoresis Analysis Following transfer of 96 well plates to 384 well plate format suitable for printing (performed at Xenon Genetics, Vancouver, BC) and following several initial print runs (Gene Array Facility, Vancouver, BC), concentrations were re-evaluated by capillary electrophoresis. This assay uses nl volumes of sample to electronically compute a representative agarose gel from which concentration is estimated (Figure 10). Complete results of this analysis are summarized in Appendix II. In comparison to the agarose gel electrophoresis data, where 95.58% of the ORFs netted a yield greater than the required spotting concentration of lOng/pl (Appendix I), the capillary electrophoresis data found only 73.32%> of ORFs had a concentration greater than lOng/pl (Appendix II). Because maintaining a high concentration of probe for spotting is necessary to achieve good quality microarray results, loss of probe concentration over successive print runs was deemed unacceptable. At this point, microarray printing was switched to a different facility (Microarray Centre, University of Toronto, Toronto, ONT) and the back-up set of 384 well plates employed. C.3. Evaluation of Print Run In light of some of the many factors which may affect microarray quality (Eisen and Brown 1999), the uniformity of DNA deposition on the microarray plays a key role in array performance and as such, evaluation of the printed microarray has become an important point of control. To assess the quality and quantity of the printed material, microarrays were labeled with SYBR Green (Battaglia, Salani et al. 2000). Spots were found to be of uniform size and concentration, and evenly spaced with minimal tailing effect (Figure 11). Later, microarrays were terminal transferase labeled with Cy-3 fluorophore and again evaluated for quality and quantity of the printed material. Spots were again found to be of uniform size, concentration and distribution (Figure 12). In general, demonstration of high quality print runs was taken to be indicative of their capability of providing high quality data.  71  L  Figure 10:  1  2  3  4  5  6  7  8  9  10  11  12  Sample capillary electrophoresis digital agarose gel.  Digital interpretation of the raw data output for the first 12 columns from the first row of 384 well plate C4PS01-P3-0001-BL008-001 from the Caliper LabChip 90 electrophoresis system.  72  Figure 11: SYBR Green analysis of upper left sub-grids of the P. aeruginosa microarray. Microarray printed at Gene Array Facility (Vancouver, BC).  73  m  t  «  •  •a  *  41 • n *>  •  .*  -a  •  •  •*  •  » a * »  1  -  #  •  *  •  • :*>  •  •  •  A  0  •  ...  <  -is"J  e  i:  i  ;  p  i  •  n  0  •  •  *  r  p  *  r  «  61  •  •  *  p  • •..  0  •  e  •  •  *  ».  #  • i  &  *  0  •  i  ft •s 0  P p  A'  *•  -»  c  -  ••• 5"  C*  4 #  ;»  *=  r c  e  v.-  p # •  *  «»  <e  fe •  G  •• • • fc  -* ?  •  e  o  Q ••  Figure 1 2 : Terminal transferase Cy-3 label analysis of two sub-grids of the aeruginosa microarray. Microarray printed at the Microarray Centre (Toronto, ONT).  74  D. Summary  In this chapter, many of the parameters in the design and construction of a microarray which affect the performance of the microarray itself were evaluated. Length of amplicon, concentration and volume of spotted amplicon, as well as hybridization temperature and hybridization solution were investigated. It was found that 0.5ul of a lOng amplicon solution were ideal spotting parameters. 600bp amplicon fragments were also found to produce intense hybridization signals, findings in agreement with recently published work (Stillman and Tonkinson 2001). With respect to hybridization, the UltraHyb spotting solution (Ambion, Inc.) at a hybridization temperature of 42°C was found to produce optimal signal intensities, parameters similar to those subsequently used by Affymetrix P. aeruginosa GeneChip® users. These findings were used in the subsequent construction of the custom P. aeruginosa strain PAOl DNA microarray. Several quality control checks were implemented throughout the construction of the DNA microarray. These included evaluation of the amplicon size, uniqueness and concentration, as well as validation of the amplicon sequence, and assessment of the print run. The success rate of the high-throughput strategy for PCR amplification and evaluation of the amplicons was extremely good (95.58%) for the first pass. Amplicons were found to be amplified in sufficient quantity (>10ng/pl) for subsequent microarray printing, and were found by sequence analysis to be correctly amplified from the desired target ORF. Microarray print runs were found to contain uniform and clean amplicon spots, arranged in an organized fashion, eliminating the microarray itself as a source of error in subsequent microarray experimentation. The design and construction of a custom DNA microarray is a constantly changing field. Standards in design, printing and quality assessment of custom microarrays are continuously evolving (Hessner, Wang et al. 2003; Gordon and Sensen 2004; Rimour, Hill et al. 2004) and where possible these new techniques have been incorporated into the overall P. aeruginosa microarray design. However, because these parameters are still under flux, they will need to be periodically re-evaluated to maintain the integrity and quality of the current P. aeruginosa custom DNA microarray.  75  CHAPTER TWO: Method Development for the Pseudomonas Custom Microarray A. Introduction  The complimentary methods for conducting microarray experiments using bacterial transcripts were poorly defined or lacking at the start of this project. At the time, protocols for only Helicobacter pylori,  Mycobacterium  tuberculosis and Bacillus subtilis microarray  experimentation were available (Wilson, DeRisi et al. 1999; Salama, Guillemin et al. 2000; Ye, Tao et al. 2000) and were used as guidelines in the development of microarray protocols for P. aeruginosa. Protocols for the commercial P. aeruginosa GeneChip® were available on a betatesting basis, but were not relevant here because of the significant differences in platform technology between Affymetrix and custom DNA microarrays. Furthermore, given the differences between eukaryotic and prokaryotic RNA species, many of the procedures implemented in mammalian microarray studies (particularly reverse transcription with oligo dT) were not applicable to P. aeruginosa. As well, several of the microarray procedures were only novel and not standard in the microarray field at the time (Manduchi, Scearce et al. 2002), and thus required evaluation and comparison to the proven techniques. The experiments in this chapter thus describe the development of the methodology for conducting custom DNA microarray experiments using P. aeruginosa.  B. Comparison of RNA Isolation Methods  Since separation of mRNA from rRNA within bacterial species cannot be achieved through use of the poly-A tail on mRNA as is the case for mammalian cells, total RNA must be isolated and used with random or gene specific priming to generate cDNA. The low abundance (<2%) of mRNA relative to the total RNA species is a further limitation on bacterial microarray studies when considering total RNA reverse transcription with random primers, since the ratio of mRNA:rRNA will be maintained in the resulting cDNA population reducing the likelihood of mRNA hybridization to the spotted probe. While amplification of mRNA species has been possible for mammalian transcripts for some time, methodologies for amplification of bacterial mRNA have only recently been developed (Ambion 2004). Thus, the aim of the RNA isolation  76  method comparison was to achieve consistent isolation of high yield total RNA. Total RNA was isolated from P. aeruginosa cultures grown to mid-logarithmic phase using a variety of isolation methodologies. Various isolation strategies were evaluated for their ability to generate high yields of total RNA of good purity and integrity, as well as for consistency and ease of use, and were evaluated by agarose gel analysis, UV spectrophotometry and amplification of full length rpoC transcript. RNA isolation using the CsCl method proved difficult, time consuming and inconsistent (Figure 13, lane 2). RNA isolated using either the ProMega or Qiagen kits was easy, quick and yielded consistent results (Figure 13, lanes 3-5). The phenol based method also gave high yields and included isolation of small RNA species (tRNA, 5S rRNA) which were absent from the column based methods (Figure 13, lanes 6-7), but was found to be difficult to achieve consistent results. Of the isolation strategies evaluated, the Qiagen QMIDI RNeasy kit was chosen for all subsequent RNA isolations because it consistently yielded abundant total RNA of good quality and integrity (as noted below). The ProMega kit which also produced high yields of good quality total RNA, was not chosen as the RNA isolation method because the genomic DNA treatment step prior to elution from the column did not always produce consistent genomic DNA free total RNA samples (as noted below in the 'Evaluation of Genomic DNase Treatments' section). To better evaluate the quality and integrity of total RNA isolated by the various strategies, total RNA samples were reverse transcribed to cDNA and the transcript length of rpoC assessed by PCR. If the RNA isolation strategy was robust then the full length of a long transcript like rpoC should be attainable; the full transcript length of rpoC is 1323bp. For all isolation strategies, except the CsCl method which was not evaluated in this regard because it gave poor RNA (Figure 13, lane 2), transcripts of 1230bp were generated (Figure 14), demonstrating that all RNA isolation methods evaluated were robust in their ability to produce RNA of high integrity.  C. Evaluation of Genomic DNase Treatments  Presence of genomic DNA in the total RNA sample would affect both the RT reaction by binding the nucleotides and primers required for cDNA synthesis, and the microarray hybridization reaction by competing for binding to the complimentary spotted probes, thus  77  Figure 13:  Comparison of RNA isolation methods.  Logarithmic cultures of P. areuginosa isolated by: Lane 1 - lOObp ladder; Lane 2 - CsCl; Lane 3 - ProMega SV Total R N A Isolation System; Lane 4 - Qiagen RNeasy QMIDI Kit pre-genomic DNase treatment; Lane 5 - Qiagen RNeasy QMIDI Kit post-genomic DNase treatment; Lane 6 Trizol method pre-genomic DNase treatment; and Lane 7 - Trizol method post-genomic DNase treatment. R N A samples were run in a 2% agarose gel containing lOpg/ml EtBr for 45min at 90V.  78  1 2 3 4 5 6  Figure 14: length.  7 8 9  1  2 3 4 5 6 7 8 9  12  34  5 6 7 8 9  Comparison of RNA isolation methods with respect to rpoC transcript  Total RNA was treated with DNase to remove genomic D N A . reverse transcribed into cDNA and various lengths of rpoC transcript PCR amplified. Panel A - Trizol method; Panel B ProMega SV Total R N A Isolation System; and Panel C - Qiagen QMIDI RNeasy kit. For all panels lanes are organized as follows: 1, lOObp ladder; 2, rpoC 102bp; 3, rpoC 239bp; 4, rpoC 366bp; 5, rpoC 610bp; 6, rpoC 740bp; 7, rpoC 923bp; 8, rpoC 1072bp; and 9. rpoC 1230bp. PCR products were run on a 1% agarose gel containing lOug/ml EtBr for 45min at 90V.  79  limiting binding of the labeled cDNA and accurate measurement of the expression level. Contaminating genomic DNA was thus removed from total RNA preparations by treatment with DNase I. Various lengths of treatment time were evaluated to ascertain the minimum time required, as evaluated by the inability to PCR amplify the 3OS ribosomal subunit protein rpsL from the RNA preparation post-genomic DNA treatment. Based on agarose gel electrophoresis analysis of DNase treated samples, 15min appeared to be sufficient for complete removal of genomic DNA contamination (Figure 15). This observation was confirmed by the absence of rpsL products when DNase treated total RNA samples were then used as template for amplification of rpsL (data not shown as the agarose gel is blank). Thus, a minimum of 15min was required for removal of genomic DNA contamination from total RNA preparations.  D. Comparison of Reverse Transcription Reactions  Since GC base pairs form more stable base pairing interactions (Southern, Mir et al. 1999; Herwig, Schmitt et al. 2000), it was hypothesized that the reverse transcriptase enzyme may have more difficulty in synthesizing cDNA from the P. aeruginosa total RNA template which has a GC content of 66.6%. Incomplete denaturation of RNA secondary structure during cDNA synthesis step thus could halt the polymerase, resulting in shorter cDNA copies of target mRNA (Gupta, Cherkassky et al. 2003). Thus, a greater amount of total RNA reverse transcribed would not necessarily yield a greater amount of cDNA from the RT reaction. To ascertain these possibilities, various amounts of total RNA were used as template in the reverse transcription reaction. From SYBR Gold stained agarose gel electrophoresis analysis of the cDNA product, it appeared that equal amounts of cDNA were produced from lOug and 12pg total RNA, while 15ug total RNA yielded visibly more cDNA (Figure 16). cDNA prepared from 15ug of total RNA also seemed to contain longer transcripts than either of the other preparations. To confirm these observations, cDNA preparations were quantified by UV spectrophotometry at A260. From lOpg of total RNA, the cDNA yield was 364ng/ul, from 12ug it was 480ng/ul and from 15pg it was 650ng/pl. Thus, as the starting amount of template was increased, the amount of cDNA synthesized by the RT reaction was also increased irrespective of the high GC content of P. aeruginosa transcripts, and was most significant for 15pg total RNA. While 15pg of total RNA would be the ideal choice for RT reactions, this amount and concentration of RNA was not  80  Figure 15: Comparison of various Ambion DNase-/ree treatment times for removal of genomic DNA contamination. Genomic D N A treatments were all performed on total R N A isolated from P. aeruginosa and were conducted at 37°C for the following time frames: lanes 1, lOObp ladder; 2, 15min treatment; 3, 30min treatment; 4, 45min treatment; 5, 60 min treatment; and 6, untreated total RNA. R N A samples were run on a 2% agarose gel containing lOpg/ml EtBr for 45min at 90V.  HI  Figure 16: RNA.  Comparison of cDNA preparations from different initial amounts of total  Various amounts of total R N A isolated from P. aeruginosa was reverse transcribed into cDNA as follows: lanes 1, lOObp ladder; 2, lOug total R N A ; 3, 12pg total R N A ; and 4, 15pg total R N A . cDNA samples were run on a 1% agarose gel for 45min at 90V and stained with SYBR Gold nucleic acid gel stain.  82  consistently achievable from the RNA isolation strategies employed. Furthermore, when such concentrations were achieved, the total amount of RNA isolated from logarithmic cultures was not sufficient to allow for technical repetition of the microarray experiment or downstream confirmatory analyses. Thus, a minimum of lOug of total RNA was used for all subsequent reverse transcription reactions, since this amount and concentration could consistently be attained by the RNA isolation method and was sufficient to allow for further experimentation. E. Comparison of cDNA Labeling Methods  For a microarray experiment to be successful in defining an expression pattern, it must be both sensitive and accurate. Efficient and accurate incorporation into or attachment of a detectable label to the cDNA is thus of critical importance. Of the available cDNA labeling methods (Nimmakayalu, Henegariu et al. 2000; Stears, Getts et al. 2000; Karsten, Van Deerlin et al. 2002; Ramakrishnan, Dorris et al. 2002; Richter, Schwager et al. 2002; Francois, Bento et al. 2003), the direct and indirect fluorescent labeling methods were not prohibitively costly and were compared herein. In the direct labeling method, a Cy3 or Cy5 fluorescently labeled nucleotide is directly incorporated during cDNA synthesis. Critics of this method highlight its main shortcoming, enzyme introduced labeling and sequence bias (Gupta, Cherkassky et al. 2003). This limitation is addressed by the indirect fluorescent labeling method, where aminoallyl modified nucleotides rather than fluorescently labeled nucleotides, are incorporated during cDNA synthesis. In a subsequent step, Cy3 or Cy5 dyes are coupled to the reactive amine groups incorporated in the cDNA. Overall, comparison of the direct and indirect labeling methods found that the indirect method provided superior labeling. As is evident from the hybridization images (Figure 17), direct labeling method #1 yielded negligible amounts of labeled cDNA, whereas direct labeling method #2 yielded more intensely labeled cDNA spots. Although the slide image shown had high background, the indirect labeling method #3 produced the most uniformly labeled spots of the methods tested (Figure 17). The indirect labeling method was therefore pursued further, and different reverse transcriptase enzymes evaluated. When total RNA was reverse transcribed using the indirect labeling method with Superscript™ II RT, better hybridization images were observed than when total RNA was reverse transcribed with M-MuLV (Figure 18); hybridized  83  Figure 17:  Comparison of direct and indirect cDNA labeling methods.  Total RNA from P. aeruginosa was reverse transcribed and labelled using: A, direct labelling method #1; B, direct labelling method #2; and C, indirect labelling method #3. The same four subgrids are visible in each image.  84  A - Superscript™ II R T  ^^^^M  B - M-MuLV RT  .^^^B^^l  .-'•,**.,-*-•••>••• .  .  .  .  .  .  .  -  J  C -  *- * " "  « ^• # » •  ' ."  r -»**•.'• •  - * • ,.-*'*""•> ,  -t- .  •  .  .«••'*;....-.,  •. •  .  ..............  .  *  •  .  .  .  *  .  .  .  .  «  •  •• -  • .  • . . . , . » .  ...  .  4  »  ...  -| :  #• . ;  •*  ^ «  -.*.. •- *• • J,  • .  r  * • • . . ! .  m  in  .  . a |  •  **  ' V  . . . .  ...,....„  • •  Figure 18: method.  Comparison of reverse transcriptase enzymes in the indirect cDNA labeling  Total RNA isolated from P. aeruginosa was reverse transcribed using: A, Superscript™ II reverse transcriptase; and B, M-MuLV reverse transcriptase.  85  spots were more intense, uniform and distributed. Since M - M u L V also contains RNase H activity, indirect labeling using Superscript™ II ( M - M u L V RNase H ) reverse transcriptase was used for all subsequent microarray experiments, and the techniques practiced and fine tuned until the standard operating protocols described in the 'Methods' section were finalized.  F. Summary  In this chapter many of the methodological details of microarray experimentation were evaluated. These details affect the performance of the microarray experiment overall and included evaluation of R N A isolation strategies, R N A quality assessment, genomic D N A treatment, and c D N A synthesis and labeling strategies. O f the R N A isolation protocols examined, total R N A isolated using the QMIDI RNeasy kit (Qiagen) proved to be the most consistent with respect to yield, purity and integrity, and as well, was easy and quick to use. Although total R N A isolation was not specific for R N A over D N A , contaminating genomic D N A was found to be effectively removed by treatment with DNase-free (Ambion, Inc.) for a minimum of 15min at 37°C. While higher amounts of total R N A template in the reverse transcription reaction were found to yield better amounts of cDNA, the inability of the R N A isolation strategy to consistently yield amounts of total R N A large enough to complete a set of microarray and confirmatory experiments, prohibited use of template amounts of total R N A greater than lOug. lOug of total R N A however is fairly standard amongst other bacterial microarray studies (Ye, Tao et al. 2000; Schembri, Kjaergaard et al. 2003). cDNA labeling for microarray hybridization was best achieved through indirect labeling methods using the Superscript™ II reverse  transcriptase  enzyme, rather than through direct fluorophore  incorporation methods. Similarly, indirect labeling methods with Superscript™ II RT have also become standard in bacterial microarray experimentation (Postier, Wang et al. 2003).  86  CHAPTER THREE: Quinolone Induction of Adaptive Resistance A. Introduction  Microarray experiments provide a global perspective on the response of an organism to particular environmental stimuli, knowledge which is not achievable by more focused studies. Such transcriptome analyses thus provide a more holistic view of how an organism responds to its environment and allows for more directed follow-up research. While exposure to antimicrobials is known to induce bacterial resistance mechanisms (Daikos, Jackson et al. 1990; Giwercman, Lambert et al. 1990; Eung-Tomc, Kolek et al. 1993), the full extent of bacterial responses to such stimuli are only beginning to be investigated (Betts, McLaren et al. 2003; Shaw, Miller et al. 2003; Utaida, Dunman et al. 2003; Hutter, Schaab et al. 2004). Of particular importance to CF patients chronically infected with P. aeruginosa is the response of the organism to antibiotic challenges, which occur continuously over the course of CF therapy. Fluoroquinolones, namely ciprofloxacin, are commonly prescribed to CF patients on an outpatient basis to help maintain low levels of P. aeruginosa infection. It was hypothesized that exposure to ciprofloxacin would induce resistance in P. aeruginosa, particularly adaptive resistance-like mechanisms since isolates of P. aeruginosa from CF patients during ciprofloxacin therapy display a resistance level not seen in isolates either before or after the therapy (Chamberland, Malouin et al. 1990). Adaptive resistance is defined as an unstable, reversible resistance that is unrelated to genetic mutation (Barclay and Begg 2001). It occurs transiently in an organism under non-lethal selective pressure, and has been well documented for aminoglycosides, as well as quinolones (Gould, Milne et al. 1991; Barclay and Begg 2001). The effect of sub-inhibitory and inhibitory concentrations of ciprofloxacin on the development of adaptive resistance in P. aeruginosa was thus examined on a global scale. Custom DNA microarrays were thus used to identify the response signature of P. aeruginosa to ciprofloxacin.  B. Determination of the Minimum Inhibitory Concentration to Ciprofloxacin  Prior to characterizing the effect of various concentrations of ciprofloxacin on the expression response of P. aeruginosa, it was necessary to define the inhibitory concentration so that sub-  87  inhibitory concentrations  could be appropriately calculated. The minimum inhibitory  concentration (MIC) for ciprofloxacin was found to be O.lpg/ml (Table 5; Table 5 also includes the MIC values for various other strains). This value was comparable to other ciprofloxacin sensitive strains (Fung-Tome, Kolek et al. 1993) and was used to compute the 0.3x-MIC and 0.lx-MIC concentrations of 0.03 and 0.01 ug/ml, respectively. C. Growth Profile in Presence of Ciprofloxacin  Before conducting global analyses on the effect of ciprofloxacin on P. aeruginosa, it was necessary to determine the point in ciprofloxacin exposure which would be best suited for this analysis. This point should show no appreciable affect on the growth ability of the organism across the various concentrations of ciprofloxacin being examined, so that the expression profile would not be confounded by expression changes due to growth differences. Cultures of P. aeruginosa were therefore grown in various concentrations of ciprofloxacin to ascertain their effect on the growth profile. The growth rate of P. aeruginosa was not appreciably affected by either 0.01 or 0.03pg/ml ciprofloxacin (Figure 19). As expected, the inhibitory concentration (O.lpg/ml) of ciprofloxacin severely limited the growth of strain HI03, although it did not completely result in killing even after 7.5 hours. At 2.5 hours however, the growth rate of P. aeruginosa in the presence of lxMIC ciprofloxacin was analogous to the growth rates of P. aeruginosa cultured with O.lx- and 0.3x-MIC ciprofloxacin (Figure 19). This time point was therefore taken for all further analyses. Cultures at this time point were also in the mid-logarithmic phase of growth, and thus particularly amenable to microarray analysis since transcript levels would be high.  D. Time-Kill Assays and Microscopy  D. 1. Observation of Adaptive Resistance to Sub-Inhibitory Ciprofloxacin Sub-inhibitory concentrations of antibiotic occur at the onset of drug therapy, between dosing intervals and within the thick mucus of the CF lung (Doring, Conway et al. 2000). The effect of sub-inhibitory concentrations of antibiotic on P. aeruginosa however has not been well  88  Table 5:  Minimum inhibitory concentrations of various antimicrobials against various  strains of P. aeruginosa. Cultures were grown in LB medium and represent the mode of 4 independent experiments. Cipro, ciprofloxacin; Eno, enofloxacin; Nor, norfloxacin; Nal, naldixic acid; Ami, amikacin, Genta, gentamicin and Cefe, cefepime. ND, not determined. MIC (ug/ml) Strain  Cipro  Eno  Nor  Nal  Ami  H103  0.06  0.3  0.15  15.6  0.4  1.75  0.6  PA0620::/wx  0.5  1.56  >2.5  250  0.4  0.875  2.5  PA0621::IS/acZ  0.5  >5  >2.5  250  0.2  0.875  0.3  PA0641::/wx  0.5  1.56  1.25  125  0.4  1.75  1.25  PA3866::/wx  0.06  0.3  0.15  31.25  0.4  ND  0.6  prtRvlSlacZ  0.06  0.3  0.15  31.25  0.4  0.875  0.6  recAr.ISlacZ  0.5  3.125  >2.5  250  0.4  0.875  0.6  89  Genta Cefe  10 -,  - • - H I 03 - B - H 1 0 3 + 0.0lug/ml ciprofloxacin  Hours  Figure 19: Growth curve of P. aeruginosa grown with various concentrations ciprofloxacin.  90  characterized apart from studies evaluating various phenotypes like adherence (Sonstein and Burnham 1993; Visser, Beumer et al. 1993; Zhanel, Kim et al. 1993) or virulence factor production (Ravizzola, Pirali et al. 1987; Grimwood, To et al. 1989; Trancassini, Brenciaglia et al. 1992; Sonstein and Burnham 1993). Fung-Tome et al. (Fung-Tome, Kolek et al. 1993) also noted an increase in the mutation rate and resistance level of P. aeruginosa following exposure to sub-inhibitory ciprofloxacin. No studies however have addressed the adaptive resistance response of P. aeruginosa to sub-inhibitory concentrations of fluoroquinolones. Given the highly compartmentalized lung environment, the thick mucus of the CF lung, and the propensity for P. aeruginosa to covert to mucoidy and grow in biofilms, it was hypothesized that sub-inhibitory ciprofloxacin mediates adaptive resistance in P. aeruginosa. To test this hypothesis, the time-tokill assay was modified to include a pre-incubation step prior to the time-to-kill curve. CFUs were measured as they more accurately reflect viable cells rather than OD measures. In this manner, the effect of exposure to various concentrations of ciprofloxacin on the survival or adaptation of P. aeruginosa to subsequent supra-inhibitory ciprofloxacin could be examined. Cells pretreated with sub-inhibitory concentrations of ciprofloxacin, washed and then resuspended in 2x-MIC ciprofloxacin, grew better than untreated P. aeruginosa cells (Figure 20). In particular, cells pretreated with 0.3x-MIC ciprofloxacin outperformed all other pretreatment groups by approximately one logio of growth. This difference in survival became most distinctive at 75 minutes post supra-inhibitory exposure. P. aeruginosa cultures pretreated with lx-MIC ciprofloxacin are not displayed because these cells were not observed at detectable levels in subsequent exposure to 2x-MIC ciprofloxacin over the time frame examined (but did survive if left overnight in 2x-MIC ciprofloxacin; data not shown). Thus, exposure of P. aeruginosa to sub-inhibitory concentrations of ciprofloxacin to the mid-logarithmic phase induces mechanisms which aid the organism's survival in supra-inhibitory concentrations of ciprofloxacin. The adaptive resistance assay was also followed for an extended time course beginning at 2 hours post exposure to 2x-MIC ciprofloxacin (Figure 21). As the length of time cultures were exposed to 2x-MIC ciprofloxacin increased, the difference in survival noted for sub-inhibitory pretreated cultures compared to untreated cultures remained (Figure 21). Thus adaptive resistance in P. aeruginosa is sustained for the duration of exposure to supra-inhibitory ciprofloxacin. Similar prolonged adaptive resistance observations have been noted in both in  91  .00E+06 15  30  45  60  75  90  105  120  Time (minutes)  Figure 20: Survival ability of P. aeruginosa in 2x-MIC ciprofloxacin following growth in sub-inhibitory concentrations of ciprofloxacin.  Cultures of P. aeruginosa strain HI 03 were grown in the presence or absence of sub-inhibitory concentrations of ciprofloxacin until mid-logarithmic phase, washed and then exposed to 0.2pg/ml ciprofloxacin. Colony forming units were counted every 15 minutes for 2 hours. Data representative of three separate experiments are shown.  92  l.OOE+05 i  g  1.00E+04  DD O  J  - • - H I 0 3 - Untreated - B - H 1 0 3 +0.01ug/ml ciprofloxacin —A—H103 +0.03ug/ml ciprofloxacin l.OOE+03  Time (hrs)  Figure 21: Survival ability of pretreated ciprofloxacin over a longer time frame.  cultures  of P. aeruginosa in 2 x - M I C  Cultures of P. aeruginosa strain HI03 were grown in the presence or absence of sub-inhibitory concentrations of ciprofloxacin until mid-logarithmic phase, washed and then exposed to 0.2pg/ml ciprofloxacin. Colony forming units were counted for 7 hours. Data representative of two separate experiments are shown.  93  vitro (Barclay, Begg et al. 1992) and in vivo (Daikos, Lolans et al. 1991) assays assessing adaptive resistance in P. aeruginosa elicited by aminoglycosides. D.2. Verification of Adaptive Resistance to Sub-Inhibitory Ciprofloxacin Ciprofloxacin at supra-inhibitory concentrations is known to induce conversion of P. aeruginosa to a mucoid phenotype (Pina and Mattingly 1997). Although sub-inhibitory concentrations have not been found to induce similar phenotypic switches (Trancassini, Brenciaglia et al. 1992; Majtan and Hybenova 1996) or result in major changes in LPS structure (Magni, Giordano et al. 1994; McKenney, Willcock et al. 1994), mucoid growth was also examined to eliminate the possibility that the increase in CFUs for pretreated cultures resulted from mechanical disruption of mucoid cells. In comparison to the shiny, mucoid appearance of P. aeruginosa continuously grown in supra-inhibitory ciprofloxacin (Pina and Mattingly 1997), P. aeruginosa cultures exposed to sub-inhibitory ciprofloxacin were not found to be mucoid. Thus, the higher bacterial counts observed during the adaptive resistance assay were not a result of the spreading of ciprofloxacin converted-mucoid cells. Gram stains of untreated and pretreated cultures before and during the adaptive resistance assay however showed that pretreatment of strain HI03 with sub-inhibitory ciprofloxacin only slightly reduced cell division (Figure 22, panels A. and B.). For comparison purposes, the dramatic inhibition resultant from pretreatment of P. aeruginosa cells with inhibitory ciprofloxacin is shown (Figure 22, panels A.4. and B.4.). Cell lengths were measured to be 2.8, 3.0, 3.6 and 6.5 microns in panel A and 4.8, 5.4, 7.0 and 11.3 microns in panel B, for untreated, O.lx-, 0.3x- and lx-MIC ciprofloxacin treated cultures, respectively. In contrast to the effect of mucoidy on CFUs, inhibition of cell division instead indicates that the adaptive resistance timekill assay underestimated the colony counts for the ciprofloxacin pretreated groups since cells were not dividing as rapidly as the untreated group. Thus, the overall difference in bacterial counts observed during the adaptive resistance assay would be larger if inhibition of cell division is taken into account. Following completion of the adaptive resistance assay, culturing of P. aeruginosa cells in drug free media resulted in the return of wild type cell morphology (Figure 22, panel C ) , illustrating the transiency of the effect. Cell lengths for panel C were measured to  94  Ciprofloxacin Untreated  0.01 ug/ml  0.03ug/ml  it •-  i  I- JS 3 ©  o JL * u £  A  oa  p  i  2.  A.l.  3.  4.  X*  I uS  «5  i—  *  '3 i  2 •= a  O.lpg/ml  f  _  II—  fed CJ  :>  -  ^v  i  =  *  it  B.l.  S iL Q.  2.  3.  2.  3.  -  "f^"*'  4.  1  W  2 a.  5  z  C.l.  Figure 22: Gram stains of P. aeruginosa before, during and after the adaptive resistance assay. Ciprofloxacin interferes with P. aeruginosa cell division as evident from Gram stains prior to (A) and post 1.5hrs (B) growth in 2x MIC ciprofloxacin. Cells cultured for an additional 3hrs in drug free media (C) were not inhibited. (1) PAO-H103 untreated; (2) PAO-H103 pre-treated in 0.01pg/ml ciprofloxacin; (3) PAO-H103 pre-treated in 0.03pg/ml ciprofloxacin; and (4) PAO-H103 pre-treated in 0.1 pg/ml ciprofloxacin. A l l micrographs are at lOOOx magnification. Cell lengths were measured to be 2.8, 3.0, 3.6 and 6.5 microns in panel A , 4.8, 5.4, 7.0 and 11.3 microns in panel B , and 3.6, 3.0 and 3.3 microns in panel C for untreated, O.lx-, 0.3x- and lx-MIC ciprofloxacin treated cultures, respectively.  95  be 3.6, 3.0 and 3.3 microns for untreated, O.lx-, 0.3x- and lx-MIC ciprofloxacin treated cultures, respectively. E. Microarray Studies  E. 1. Expression Responses following Treatment with Sub-Inhibitory Ciprofloxacin Having established that sub-inhibitory concentrations of ciprofloxacin induce adaptive resistance in P. aeruginosa, custom DNA microarrays to P. aeruginosa were used to better define how sub-inhibitory ciprofloxacin affects the expression response of this organism in an attempt to define the molecular mechanisms behind adaptive resistance. Microarrays were performed on cultures of P. aeruginosa following growth to the mid-logarithmic phase in the presence or absence of various concentrations of ciprofloxacin as before. The complete set of genes exhibiting significant (p< 0.05) expression changes is provided in Appendix III, where they have been separated into up-regulated and down-regulated gene lists, and sorted according to functional classification. Magnitudes of transcript inhibition or activation expressed as fold change were calculated using untreated cultures as baseline; fold changes in gene expression are rounded to two significant figures. Changes in the control spike transcript intensities were found to be less than two-fold for all comparisons, indicating that the efficiency of cDNA synthesis and labeling was similar from sample to sample. Overall, as the concentration of ciprofloxacin was increased, the number of genes exhibiting significant expression changes increased in parallel (Appendix III and summarized in Table 6). Exposure to 0.lx-MIC ciprofloxacin resulted in significant expression changes in 566 genes. This number increased to 941 and 1230 following exposure to 0.3x-MIC and lx-MIC ciprofloxacin, respectively. Overall though, many of the expression changes were fairly subtle, with the majority of significant expression changes falling below 2-fold (Appendix III and Table 6). Each of the gene lists was further analyzed with respect to magnitude of fold change. Of the 566 genes identified as being affected by 0.lx-MIC ciprofloxacin, only 148 genes (26%) showed increases or decreases of more that 2-fold (Table 6). This value of 26%> did not change with the increase in ciprofloxacin concentration (24% and 29%> for 0.3x- and lx-MIC ciprofloxacin, respectively). Comparable numbers of genes exhibiting >2-fold and >5-fold expression changes,  96  Table 6:  Summary of custom DNA microarray findings and trends. Ciprofloxacin O.lx-MIC  0.3x-MIC  lx-MIC  Total # Genes with Significant Expression Changes (p < 0.05)  566  941  1230  Total # Genes Up-regulated Total # Genes Down-regulated  332 234  554 387  743 487  # Genes with Fold Change -2> % < 2  418  717  870  99  133  207  49  91  153  7  8  55  0  8  8  3  2  30  0  2  4  1 0  1 1  16 4  278  432  579  5 3 1  12 3 2  20 7 6  # Genes with Fold Change > +2 (inclusive of 5-, 10- and 15-fold changes) # Genes with Fold Change > -2 (inclusive of 5-, 10- and 15-fold changes) # Genes with Fold Change > +5 (inclusive of 10- and 15-fold changes) # Genes with Fold Change > -5 (inclusive of 10- and 15-fold changes) # Genes with Fold Change > +10 (inclusive of 15-fold changes) # Genes with Fold Change > -10 (inclusive of 15-fold changes) # Genes with Fold Change > +15 # Genes with Fold Change > -15 # Genes with Hypothetical/ Putative Classification # Hypo. Genes |> 5| Fold Change # Hypo. Genes > 10| Fold Change # Hypo. Genes |> 15| Fold Change  97  however, have been observed after imipenem treatment of P. aeruginosa by another microarray user (Bagge, Schuster et al. 2004). While the percentage of genes exhibiting greater than 2-fold expression changes did not vary across the treatment conditions, the extent of the expression change did vary. At the inhibitory concentration of ciprofloxacin, the number of genes having fold changes larger than 5-fold, 10-fold or 15-fold increased substantially in comparison to the O.lx- and 0.3x-MIC treatment groups, which had comparable numbers of genes in each of these categories (Table 6). Whereas the O.lx- and 0.3x-MIC groups had 7 or 16 genes respectively with expression changes greater than 5-fold, the lx-MIC group had 63 genes with expression changes greater than 5-fold. Thus, as the concentration of ciprofloxacin was increased from subinhibitory to inhibitory, the expression changes in P. aeruginosa became more intense in response to the increasingly challenging growth environment. With few exceptions, where expression changes were noted in more than one treatment group, the trend in expression was the same for both groups, such that if inhibition of expression was noted for an ORF in the 0.3x-MIC group, the extent of inhibition of expression remained the same or was enhanced in the lx-MIC group (Appendix III). As observed by other P. aeruginosa microarrays users (Affymetrix), where genes formed an operon such as the trp cluster (PA0649 to PA0651), the changes for the first gene in the operon were much greater than the changes for the downstream genes (Appendix III) (Ochsner, Wilderman et al. 2002; Schuster, Lostroh et al. 2003; Wagner, Bushnell et al. 2003). As well, as noted by others, not all genes within an operon had statistically significant changes in transcript expression. For example, at least three genes involved in motility and attachment, pilA, pilB, and pilC, exhibited statistically significant decreases in transcript expression across the sub-inhibitory concentrations of ciprofloxacin, but other genes in this operon did not change. Separating the genes exhibiting significant expression changes on the basis of functional classification also revealed some interesting results. In general, as the concentration of ciprofloxacin was increased, the number of genes within each functional category also increased (Appendix III). As well, it was found that approximately half of all differentially expressed genes in all treatment groups were functionally classified as either 'hypothetical, unclassified protein' or 'putative enzyme' (Appendix III and Table 6). Furthermore, the expression changes for these ORFs tended to be fairly large. These genes, rather than the annotated genes, constituted many of the genes previously noted as exhibiting expression changes greater than 5-fold, 10-fold or 15-  98  fold (Table 6). Together these findings illustrate that a large proportion of genes responsive to ciprofloxacin remain to be fully characterized. Their large expression changes also underscore the importance of these uncharacterized ORFs in the cellular response of P. aeruginosa to ciprofloxacin challenge. Other noteworthy functional categories include the 'DNA replication, recombination, modification and repair' and 'chaperones and heat shock proteins' categories (Appendix III). These categories were of particular interest because they include the targets for ciprofloxacin, and function in the SOS DNA-repair response induced by fluoroquinolone antimicrobials (Phillips, Culebras et al. 1987; Lewin, Howard et al. 1989). Genes with ciprofloxacin-modified expression from these functional categories included lexA, recA, recN, mutS, mutL and mutY, as well as groEL and groES among others (Appendix III and Table 7). Expression levels of many of these DNA repair genes were up-regulated with increasing ciprofloxacin concentration. Each concentration of ciprofloxacin contained a number of ORFs differentially expressed only at that particular concentration (Appendix III and Figure 23). Again, the number of such genes was found to increase with increasing concentration of ciprofloxacin. Of interest were the ORFs present only in the 0.3x-MIC treatment group, since these genes may be responsible for the observed adaptive resistance response induced by pretreatment with 0.3x-MIC ciprofloxacin. However, the descriptions for these 271 ORFs did not provide any significant leads, although subtle expression changes were noted for several members of the multidrug efflux pumps including mexD, oprJ and mexB and opmB (Table 7). Changes in these genes however were inconsistent (i.e. showing increased expression of oprJ but decreased expression of mexD) and not amenable to any theory of resistance. With specific reference to the genes known to be altered by sub-inhibitory ciprofloxacin, like genes involved in pili and fimbriae production (Sonstein and Burnham 1993) and thus mediating bacterial-host cell adherence (Sonstein and Burnham 1993; Visser, Beumer et al. 1993; Zhanel, Kim et al. 1993), many of the ORFs functionally classified as being involved in 'motility and attachment' were found to be down-regulated with increasing concentration of ciprofloxacin (Appendix III and Table 7). With reference to the specific virulence factors known to be downregulated by sub-inhibitory ciprofloxacin (Ravizzola, Pirali et al. 1987; Grimwood, To et al. 1989; Trancassini, Brenciaglia et al. 1992; Sonstein and Burnham 1993), only exoenzyme S, exoS, the secretory component of phospholipase C,plcR and hydrogen cyanide synthase B, hcnB  99  Table 7: Expression changes in various genes induced by O.lx-, 0.3x- and lx-MIC ciprofloxacin.  ORF  Gene name  PA4385 PA4386 PA3617 PA3620 PA4763 PA4946 PA5147 PA3007  groEL groES recA mutS recN mutL mutY lexA  PA0426 PA4598 PA0004 PA4596 PA0427 PA2525 PA3522 PA4208 PA4597  mexB mexD gyrB  Fold change in PAO-H103 Ciprofloxacin O.lx MIC 0.3xMIC l x M I C  2.03 1.86 1.82  1.60  PA2194 hcnB PA0843 plcR P A3 841 exoS PA0396 pilU PA0408 pilG PA0410 pill PA0994 PA4525 pilA PA4526 pilB PA4527 pilC PA0763 mucA PA0762 algU PA4002 rodA PA4003 pbpA PA4418 ftsl  1.20 2.55  2.11 1.51 1.48 3.58  1.40 -1.36 -1.61 1.79  1.53 2.51  oprM opmB opmD oprJ  2.83 1.49 1.59  1.30 2.12 4.55  -2.58 -1.57 1.34  1.88 1.47  -1.56  -1.62 -1.80  -1.91  -1.57  2.11  Functional Classification  Chaperones & heat shock proteins Chaperones & heat shock proteins DNA replication, recombination and repair DNA replication, recombination and repair DNA replication, recombination and repair DNA replication, recombination and repair DNA replication, recombination and repair Translation, post-trans.modification,degrad Antibiotic resistance and susceptibility Antibiotic resistance and susceptibility DNA replication, recombination and repair Transcriptional regulators Transport of small molecules Transport of small molecules Transport of small molecules Transport of small molecules Transport of small molecules  -3.35 -3.80 -1.79  Central intermediary metabolism Secreted Factors (toxins, enzymes,alginate) Secreted Factors (toxins, enzymes,alginate)  -1.45 -1.84 -1.27 -4.34 -2.81 -1.42 -1.69  Motility Motility Motility Motility Motility Motility Motility  2.16 2.06  Secreted Factors (toxins, enzymes,alginate) Transcriptional regulators  1.77 1.46 1.06  Cell wall / LPS / capsule Cell wall / LPS / capsule Cell wall / LPS / capsule  100  & Attachment & Attachment & Attachment & Attachment & Attachment & Attachment & Attachment  O.lx-MIC  0.3x-MIC  Figure 23: Relationship of genes with significant expression changes induced by 0.1 0.3x- and lx-MIC ciprofloxacin in P. aeruginosa.  101  were found to be inhibited by increasing concentrations of ciprofloxacin (Appendix III and Table 7). In corroboration with the above findings on mucus production, many of the genes involved in the regulation and production of alginate were not found to have significant expression changes compared to the untreated condition. Although expression of the main alternative sigma factor algU was increased with lx-MIC ciprofloxacin, the ability of this gene to induce alginate production is modulated by the corresponding increase in expression of the anti-sigma factor mucA, data which mirrors the known mechanisms of alginate biosynthesis regulation (Schurr, Yu et al. 1996). As well, in corroboration with the above findings on filamentation, a few of the genes known to be involved in cell division (Errington, Daniel et al. 2003) were found to be upregulated only at the inhibitory ciprofloxacin condition, namely ftsl, rodA and pbpA (Appendix III and Table 7). Many of the other key components in cell division however, were not detected. It is important to note though that the inhibition of cell division was not visibly noticeable until approximately 2 hours post-exposure to 2x-MIC ciprofloxacin, rather than after growth to the mid-logarithmic phase in sub-inhibitory ciprofloxacin; slight inhibition of cell division was only visible for the inhibitory ciprofloxacin condition at this point in time (Figure 22, panel A.4.). So, more dramatic changes in cell division genes would be expected from transcriptional analysis of cultures following the adaptive resistance time-to-kill assay. Of the genes known to contribute to ciprofloxacin resistance, no significant expression changes were observed (Appendix III and Table 7). A modest decrease in expression of gyrB was noted but only for the 0.lx-MIC ciprofloxacin treatment condition. Significant expression differences were not noted for the other topoisomerases, parC or parE. Comparatively, more changes were noted in the multidrug efflux mechanisms. Expression of nfxB, the negative regulatory gene for the resistance-nodule-cell division (RND) multidrug efflux system mexCDoprJ was undetected, although PA4596, which is 74% similar to nfxB of P. aeruginosa, was modestly increased in the O.lx- and 0.3x-MIC treatment conditions, with an average fold change of 1.7. Expression of the outer membrane protein oprJ increased only in the presence of 0.3x-MIC ciprofloxacin, and only by 1.5 fold. Other members of the OprM family of outer membrane proteins were also altered including oprM, opmD and opmB, but again only in the 0.3x-MIC condition.  102  The region between PA0609 and PA0651 was most striking because every gene was affected (Appendix III and Table 8). PA0613 to PA0648 represents a region of the P. aeruginosa genome which is related to various bacteriophage (Nakayama, Takashima et al. 2000). This region is described in more detail in the following chapter. F. Microarray Confirmation Assays  Confirmation of the expression changes in the R2/F2 pyocin region are discussed in more detail in the next chapter. The involvement of type IV pili in twitching motility was investigated since many of the genes in type IV fimbriae biogenesis (Aim and Mattick 1997) were found to be down-regulated by custom DNA microarray analysis (Appendix III). The twitching motility of P. aeruginosa cultures exposed to sub-inhibitory concentrations of ciprofloxacin was found to be inhibited compared to untreated cultures (Figure 24), confirming the microarray findings. G. Summary  The effects of sub-inhibitory concentrations of ciprofloxacin were examined in this chapter. Since these concentrations commonly occur at the onset of drug therapy, between dosing intervals and within the thick compartmentalized mucoid environment of the CF lung (Doring, Conway et al. 2000), they likely play an important role in priming P. aeruginosa to its environment. Sub-inhibitory concentrations of ciprofloxacin were not found to appreciably affect the growth ability of P. aeruginosa, although as expected inhibitory concentrations of ciprofloxacin were found to dramatically affect the growth of the organism. Similar instances of incomplete killing with inhibitory concentrations of ciprofloxacin have been previously noted and have been proposed to result from the presence of persister cells (Keren, Kaldalu et al. 2004). Pretreatment of P. aeruginosa cultures with sub-MIC ciprofloxacin was found to enhance the survival of the organism when subsequently challenged with supra-inhibitory ciprofloxacin. The reduction in kill was approximately one logio for 0.3x-MIC exposed cultures, a value consistent with previous work (Gould, Milne et al. 1991). In contrast to previous work (Gould, Milne et al.  103  Table 8: R2/F2 Pyocin-phage operon and related genes induced by 0.3x- and lx-MIC ciprofloxacin . 3  ORF  Gene Name PA0610 prtN PA0611 prtR  b  PA0612 PA0613 PA0614 PA0615 PA0616 PA0617 PA0618 PA0619 PA0620 PA0621 PA0622 PA0623 PA0624 PA0625 PA0626 PA0627 PA0628 PA0629 PA0630 PA0631 PA0632 PA0633 PA0634 PA0635 PA0636 PA0637 PA0638 PA0639 PA0640 PA0641 PA0642 PA0643 PA0644 PA0645 PA0646 PA0647 PA0648  hoi V  R2  w  R2  JR.2 IR2 HR2 FI FIIR R2  2  UR XR2 DR 2  2  lys  V  F2  HF2 MF2 LF2 K2 F  h2 JF2  Fold change in 0.3x-MIC  Fold change in lx-MIC  2.0 1.3  6.8 3.0 8.5 19.3 15.3 7.2 13.0 13.9 10.0 14.7 12.1 16.7 10.3 12.8 12.8 14.1 9.8 10.8 10.0 8.7 10.6 16.2 21.2 16.4 15.8 15.9 10.0 11.0 8.5 15.9 16.4 9.8 12.9 8.9 18.0 15.8 13.4 23.0 8.2  e  4.0 3.3 1.7 2.9 3.0 2.1 3.2 2.7 4.3 2.4 2.9 2.7 2.5 1.8 2.3 1.8 2.2 1.6 2.4 3.4 4.3 3.2 2.0 2.1 2.7 —  3.0 3.1 2.4 2.7 1.9 4.0 1.8 3.1 3.8 —  Description  Transcriptional activator Transcriptional repressor Homolog of Zn finger protein Conserved hypothetical Holin Conserved hypothetical Homologous to baseplate assembly protein V Homologous to baseplate assembly protein W Homologous to baseplate assembly protein J Homologous to tail protein I Homologous to tail fibre protein H Homologous to tail fibre assembly protein Homologous to contractile sheath protein Fl Homologous to tail tube protein FII Conserved hypothetical Homologous to tail length determination protein Homologous to tail formation protein TJ Homologous to tail protein X Homologous to tail formation protein D Lytic protein; Homology to predicted chitinase Hypothetical protein Unique hypothetical protein Unique hypothetical protein Homologous to major tail protein V Unique hypothetical protein Conserved hypothetical protein Homologous to tail length determination protein H Homologous to tail fibre protein M Homologous to tail fibre protein L Homologous to tail assembly protein K Homologous to tail assembly protein I Homologous to tail fibre protein J Hypothetical protein Homologous to tail fibre domain protein Hypothetical protein Hypothetical protein Homologous to putative tail fibre protein Conserved hypothetical protein Conserved hypothetical protein  104  PA0985 PA1150 PA3617 P A3 866  pys5 pys2 recA pys4  4.5 —  2.8 13.9  18.1 5.4 4.6 51.3  Pyocin S5 Pyocin S2 Recombinase for DNA recombination and repair Pyocin S4  a - Only genes identified as being affected by sub-inhibitory (0.3 ug/ml) or inhibitory (1 ug/ml) ciprofloxacin relative to untreated strain HI03, and that were relevant to pyocin/phage are included. A list of all genes identified as being affected by these concentrations of ciprofloxacin is available in Appendix III. Genes are identified by ORF designation, gene name or alternative gene name and homology description based on the Pseudomonas genome project (www.pseudomonas.com). b - Genes were named as per Table 1 of Nakayama, K., K. Takashima et al. 2000 and reflect the homology observed by these authors to phages P2 and X. c - "—" means no significant change in expression detected.  105  2.50  -,  PAO-H103 Untreated  PAO-H103 + O.lx-MIC ciprofloxacin  PAO-H103 + 0.3x-MIC ciprofloxacin  Figure 24: Analysis of twitch motility of P. aeruginosa cells cultured in the presence or absence of ciprofloxacin.  Twitch zones were measured where they occurred between the plate and agar interface. Results are the average of three independent experiments.  106  1991) however, inhibitory ciprofloxacin was not found to induce adaptive resistance in P. aeruginosa. This is likely due to the short two hour time frame used in the kill assay; others have shown adaptive resistance with supra-inhibitory ciprofloxacin but only after two hours (Gould, Milne et al. 1991). Indeed, inhibitory ciprofloxacin pretreated cultures were viable after overnight growth (data not shown). Adaptive resistance in P. aeruginosa to 0.3x-MIC ciprofloxacin was observed to occur for more than 7 hours, a time frame comparable to but longer than that noted for adaptive resistance in response to 8x-MIC ciprofloxacin (Gould, Milne et al. 1991) and may be related to the lower second exposure concentration (2x-MIC compared to 8x-MIC). Thus, although adaptive resistance is defined as unstable, in the continued presence of drug, adaptive resistance was enhanced and prolonged (Daikos, Jackson et al. 1990). No effect of sub-inhibitory ciprofloxacin on mucus production was found, in contrast to the known effects of inhibitory ciprofloxacin on conversion of P. aeruginosa to mucoidy (Pina and Mattingly 1997). Mucus production therefore was not responsible for this measured enhancement. It was found however that ciprofloxacin inhibits cell division, findings which indicate that the extent of adaptive resistance observed for the O.lx- and 0.3x-MIC ciprofloxacin pretreatment groups relative to the untreated  pretreatment group, was likely being  underestimated. From custom DNA microarray analysis of ciprofloxacin exposed P. aeruginosa cultures, it was discovered that as the concentration of ciprofloxacin was increased, the number of genes exhibiting significant differential expression increased in parallel, as did their level of expression. Although changes in the first gene of an operon were often larger than changes in downstream genes, other microarray studies have observed similar results (Ochsner, Wilderman et al. 2002; Schuster, Lostroh et al. 2003; Wagner, Bushnell et al. 2003). RNA degradation from the 3' end of the transcript is one explanation for this phenomenon. It is also possible that such an operon is under coordinated expression, whereby transcription of the first gene occurs prior to transcription of downstream genes, as is the case for type III secretion systems (Hueck 1998). Also noted by other microarray users was the inconsistency of all genes within an operon to have statistically significant changes in transcript expression (Ochsner, Wilderman et al. 2002; Wagner, Bushnell et al. 2003). This observation has several explanations. While this discrepancy may be partially explained by the absence of some genes on the microarray (due to an inability to amplify the genes to a high enough concentration for spotting), differences in transcript levels  107  between replicates were also observed. Thus, biological variation and/or RNA degradation may have also increased the standard deviation of some operon genes, thereby forcing their exclusion from the gene lists. As well, the intensities of poorly expressed transcripts were often close to the background intensity calculated for the associated sub-grid, and thus these transcripts were defined as absent, again excluding such operon genesfromfurther analysis. Of all the functional classifications observed to change following exposure to sub-inhibitory ciprofloxacin, the greatest numbers of genes were designated as hypothetical or putative, and their expression changes tended to be fairly large compared to the remaining annotated genes. Since none of the known ciprofloxacin resistance mechanisms were found to exhibit significant differential expression changes, these uncharacterized ORFs may contribute in as yet unidentified ways to the observed response of the P. aeruginosa to ciprofloxacin. In accordance with the ability of fluoroquinolones to provoke the SOS DNA-repair response, ciprofloxacin treatment resulted in expression changes in many DNA repair genes (Appendix III). Induction of the SOS response is known to involve the genes for RecA, RecBCD and LexA; many of these genes were found to exhibit increased expression levels. Others have also shown the ability of ciprofloxacin but not novobiocin, a gyrase B subunit inhibitor, to elicit the SOS response (Gmuender, Kuratli et al. 2001). These results thus highlight the SOS DNA-repair system in the response of P. aeruginosa to the DNA damaging effects of ciprofloxacin. Many of the genes previously identified as being affected by sub-inhibitory ciprofloxacin were confirmed by the microarray study. These included genes involved in filamentation and alginate production, as well as virulence factors and motility/attachment genes. The inhibition of type IV fimbriae gene expression was further confirmed by a reduction in twitch zones for P. aeruginosa cultures exposed to sub-inhibitory ciprofloxacin. Together, this confirmation of earlier phenotypic work on sub-inhibitory ciprofloxacin treated P. aeruginosa cultures was taken as validation of the design and construction of this custom DNA microarray, and its associated methods and analysis programs. Although expression changes in many of the known ciprofloxacin resistance genes were not observed, interestingly, this may be a result of the concentrations of ciprofloxacin studied since quinolone concentration appears to affect which resistance mechanism is selected by P. aeruginosa in response to quinolone exposure. At concentrations close to the MIC, efflux type mechanisms were selected almost exclusively in the lab with gyrase type mutations appearing  108  only at concentrations above 4x-MIC (Kohler and Pechere 2001). Since only the MIC and lower concentrations of ciprofloxacin were examined here, the absence of up-regulation of classical resistance genes may be related to the dose. Similar absentia observations have been made by others characterizing the response of Haemophilus influenzae to lx- and lOx-MIC ciprofloxacin (Gmuender, Kuratli etal. 2001). The striking expression changes in the R2/F2 pyocin region are discussed in the next chapter. The role of this region in the response of P. aeruginosa to ciprofloxacin however is unknown.  109  CHAPTER FOUR: Involvement of Pyocin/Phage Expression in Quinolone Resistance A. Introduction  Pyocins are bactericidal compounds produced by P. aeruginosa (Jacob 1954). While spontaneous pyocin production or pyocinogeny is low, pyocin production can be induced upon treatment of cultures with mutagenic agents (Jacob 1954; Kageyama 1964); ciprofloxacin along with other fluoroquinolones, is a mutagenic agent (Phillips, Culebras et al. 1987; Clerch, Bravo et al. 1996). Thus, up-regulation of pyocin expression in response to ciprofloxacin exposure was not unexpected. P. aeruginosa produces three types of pyocins: R-, F- and S-type, all encoded on the chromosome, rather than on plasmids as in other bacteria. From the microarray findings, the most striking results were seen for the R2/F2 pyocin region, where the entire region was upregulated in response to 0.3x- and lx-MIC ciprofloxacin treatment (data presented and discussed in this chapter). While up-regulation of this pyocin region was anticipated, its role in the response of P. aeruginosa to ciprofloxacin and its potential role in mediating the observed adaptive resistance response to sub-inhibitory ciprofloxacin, remain unclear. These roles were examined more extensively in this chapter. B. Microarray Studies  B . l . Expression Responses of the R2/F2 Pyocin Region to Sub-inhibitory Ciprofloxacin Of all the expression changes observed in response to ciprofloxacin challenge, the region between PA0609 and PA0651 was most striking because every gene was affected (Appendix III and Table 8). PA0613 to PA0648 represents a region of the P. aeruginosa genome which is related to various bacteriophages (Nakayama, Takashima et al. 2000). The genes flanking this region correspond to the anthranilate synthesis genes (PA0609, PA0649, PA0650 and PA0651), and were independently affected by ciprofloxacin. Other notable genes relating to regulation of expression of this region include prtR, prtN (PA0610, 0611) and recA (PA3617) (Matsui, Sano et al. 1993). These genes were affected appropriately with respect to regulation of the pyocin  110  genes, as were other pyocins regulated by the same mechanisms, pyocin S2 (pys2, PA1150), pyocin S4 (PA3866) and pyocin S5 (PA0985). Expression of these genes and regions all increased in parallel with increases in the concentration of ciprofloxacin (Appendix III and Table 8). C. Microarray Confirmation Assays  CA. Real-time PCR Analysis of Expression Expression changes for a variety of pyocin/phage genes were confirmed by real time PCR. Overall, the expression changes identified by relative real-time PCR followed the same trends as those found by custom DNA microarray analysis (Table 9). Expression changes determined by relative real-time PCR however tended to be of a higher magnitude than that found by microarray analysis, data which is common since real-time PCR in general is more sensitive to transcript levels (Yuen, Wurmbach et al. 2002; Park, Cao et al. 2004). C.2. Luminescence Analysis of Expression Expression changes for the R2/F2 pyocin region were also confirmed by following the luminescence from several mini-Tn5 luxCDABE transcriptional fusions (Table 3) over a three hour time course in the presence of various concentrations of ciprofloxacin (Figure 25). Luminescence, indicative of transcription from lux fusions, was found to increase over the time period examined and with increasing ciprofloxacin concentration. These expression trends were similar to those noted by custom DNA microarray analysis for mid-logarithmic phase P. aeruginosa cells treated with ciprofloxacin (Appendix III and Table 8). For example, expression of PA0620 was induced 3-fold and 2.7-fold following exposure to 0.3x-MIC ciprofloxacin for 3 hours, as detected by the luminescence assay and microarray, respectively. PA0641 was induced 2-fold and 2.4-fold after exposure to 0.3x-MIC ciprofloxacin for 3 hours, as detected by the luminescence assay and microarray, respectively.  Ill  Table 9: Comparison of expression changes for various genes as analyzed by relative real-time PCR and custom P. aeruginosa microarray. Fold change in PAO-H103 0.3x-MIC Ciprofloxacin ORF  Gene Name  Custom Microarray  Real-time PCR  PA0610 PA0611 PA0621 PA3617 PA3866  prtN prtR  2.0  10.0  1.3  11.4  4.3 2.8 13.9  3.0 3.9 22.5  recA pys3  112  4000  A.  • PA0620::lux Untreated • PA0620::lux + 0.1 x-MIC ciprofloxacin • PA0620::lux + 0.3x-MIC ciprofloxacin 3000  s S  •c  a  o g 2000 s  OX  1000  Time (hours)  B. 1000 • PA0641 lux Untreated • PA0641 lux + 0.1 x-MIC ciprofloxacin • PA0641 lux + 0.3x-MIC ciprofloxacin  500  Time (hours)  Figure 25: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of ciprofloxacin. (A) and PA0641-.-.luxCDABE (B) were grown for three hours in the presence of O.Olpg/ml and 0.03pg/ml ciprofloxacin. Expression is defined as the average luminescence of three wells corrected for culture density measured at OD oo- Results are the average of 4 independent experiments. PA0620::luxCDABE  6  113  D. Analysis of Pyocin/Phage Expression  DA. Luminescent Analysis of Pyocin/Phage Expression As presented above, the ability of ciprofloxacin and other DNA gyrase inhibitors to induce expression of the R2/F2 pyocin region was investigated using luxCDABE transcriptional fusions to various genes in the R2/F2 operon (Table 3). Other DNA damaging agents and antibiotics were used for comparison. As previously demonstrated for ciprofloxacin (Figure 25), these fusions allow for the measurement of expression through the production of light. i. Novobiocin Dose and Time Course Like quinolones, DNA gyrase is the target of the coumarin group of antibacterials, of which novobiocin is a member. Coumarins are known to inhibit the ATPase activity of gyrase by binding to the 24-kDa N-terminal sub-domain of gyrase B protein (Ali, Jackson et al. 1993; Maxwell 1993; Gilbert and Maxwell 1994) whereas fluoroquinolones like ciprofloxacin are known to interact with gyrase A protein. The effect of novobiocin on pyocin expression was therefore examined to determine if different gyrase subunit inhibitors could induce similar expression changes. For comparison purposes to ciprofloxacin, O.lx- and 0.3x-MIC novobiocin (see Table 10) were examined. These concentrations of novobiocin were found to not appreciably inhibit the growth of P. aeruginosa (Figure 26). Expression levels increased 2.5-fold for both the R2 and F2 pyocin mutants after 3 hour exposure to 0.3x-MIC novobiocin (Figure 27); in comparison, expression levels increased 3-fold and 2-fold for PA0620::/«x and PA0641::/ux, respectively, after 3 hour exposure to 0.3x-MIC ciprofloxacin (Figure 25). Thus, increasing concentrations of novobiocin were found to stimulate transcription from the pyocin/phage lux fusions as measured by increases in luminescence. Expression was also found to increase with length of exposure to novobiocin, from 700 or 300 units after 1 hour exposure to 2800 or 700 units for PA0620::/w;t and PA0641::/wx mutants respectively, after 3 hour exposure (Figure 27). Thus, gyrase B subunit inhibitors like novobiocin also induce expression of the R2/F2 pyocin region.  114  HI03 - Untreated H103 + 0.lx-MIC novobiocin HI03 + 0.3x-MIC novobiocin  3  4  Time (hrs)  Figure 26:  Growth curve of P. aeruginosa in various concentrations of novobiocin.  115  A.  6000 • PA0620::lux - Untreated • PA0620::lux + 0 . l x - M I C novobiocin • PA0620::lux + 0.3x-MIC novobiocin  4000  5  o .-_ E s -  2000  B.  Time (hours) 1000 • PA0641 ::lux - Untreated • PA0641:: lux + 0.1 x-MIC novobiocin • PA0641::lux + 0.3x-MIC novobiocin  o 0 500  Time (hours)  Figure 27: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of novobiocin. PA0620::luxCDABE (A) and PA0641 y.luxCDABE (B) were grown for three hours in the presence of 50pg/ml and 150pg/ml novobiocin. Expression is defined as the average luminescence of three wells corrected for culture density measured at OD oo- Results are the average of 4 independent experiments. 6  116  ii. Mitomycin Dose and Time Course Since ciprofloxacin is a known mutagen (Phillips, Culebras et al. 1987; Clerch, Bravo et al. 1996), the ability of this antimicrobial to induce expression of the R2/F2 pyocin region was compared to the potent DNA damaging agent mitomycin. Exposure of P. aeruginosa to O.lx- or 0.3x-MIC mitomycin (Table 5) was not found to affect the growth capabilities of the organism, at least not over the three hour time frame examined in the luminescence assay (Figure 28). Exposure of the lux transcriptional fusions to O.lx- and 0.3x-MIC mitomycin however, was found to induce extensive expression responses from PA0620::/wx and PA0641::/«x (Figure 29). These responses were considerably larger than those induced by ciprofloxacin at both the O.lxand 0.3x-MIC concentration. For example, after 3 hour exposure to 0.3x-MIC, relative light units for PA0620::/wx were 6300 and 2300 for mitomycin and ciprofloxacin, respectively; for PA0641::/wx relative light units were 1400 and 500 for mitomycin and ciprofloxacin, respectively. The untreated response was similar for both mitomycin and ciprofloxacin for both mutants (900 and 300 units respectively for PA0620::/wx and PA0641::/«x; Figures 25 and 29). Overall, expression responses from the PA0641::/wx fusion, a mutant in the F2 pyocin, were not as large as those from PA0620::/wx, a mutant in the R2 pyocin, regardless of induction by mitomycin, ciprofloxacin or novobiocin (Figures 25, 27 and 29). Thus, expression of the R2/F2 pyocin region is responsive to DNA damage.  iii. Ceftazidime Dose and Time Course To confirm that expression of the R2/F2 pyocins was in response to DNA damage as would be the result from gyrase inhibition, ceftazidime, a P-lactam antibiotic not known to inhibit DNA gyrase or cause DNA damage, was used in the luminescence assay. No effect on growth ability was seen for either O.lx- or 0.3x-MIC ceftazidime (Figure 30). No differences in expression from either PA0620::/wx or PA0641::/«x were observed with either increasing concentration of ceftazidime or over length of treatment (Figure 31). Basal expression levels were similar to those previously observed for all other agents (700 or 300 units for PA0620::/wx and PA0641::/wx, respectively). Thus, the expression changes observed for the R2/F2 pyocins are  117  10 - • - H I 0 3 - Untreated - B - H103 + 0.1 x-MIC mitomycin - H103 + 0.3x-MIC mitomycin  o o  vo  O  1  BID O  J  0.1 3  4  Time (hrs)  Figure 28:  G r o w t h curve of P. aeruginosa in various concentrations of mitomycin.  118  10000  A.  • PA0620::lux - Untreated • PA0620::Iux + 0.1x-MIC mitomycin • PA0620::lux + 0.3x-MIC mitomycin 8000  6000  2 C E = -J 4000  2000  • Time (hours)  B. 2000 • PA0641 ::lux - Untreated • PA0641 ::lux + 0.1 x-MIC mitomycin • PA0641 ::lux + 0.3x-MIC mitomycin 1500  Q  O  1000  >  500  CD Time (hours)  Figure 29: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of mitomycin. PA0620:\luxCDABE (A) and ?A064\::luxCDABE (B) were grown for three hours in the presence of 0.25pg/ml and 0.75pg/ml mitomycin. Expression is defined as the average luminescence of three wells corrected for culture density measured at OD oo- Results are the average of 4 independent experiments. 6  119  -H103 - Untreated -H103 + 0.lx-MIC ceftazidime •HI03 + 0.3x-MIC ceftazidime  3  4  Time (hours)  Figure 30:  Growth curve of P. aeruginosa in various concentrations of ceftazidime.  120  6000 -i • PA0620::lux - Untreated • PA0620::lux + 0.1 x-MIC ceftazidime • PA0620::lux + 0.3x-MIC ceftazidime  4000 -  e S  c c E  2000  • ri i  Time (hours)  B. 1000 • PA0641::Iux - Untreated • PA0641::lux + 0.1 x-MIC ceftazidime • PA0641 ::lux + 0.3x-MIC ceftazidime  500  Time (hours)  Figure 31: Analysis of luminescence from luxCDABE transcriptional fusions grown in the presence of various concentrations of ceftazidime. ?A0620::luxCDABE (A) and PA0641 v.luxCDABE (B) were grown for three hours in the presence of O.lpg/ml and 0.3pg/ml ceftazidime. Expression is defined as the average luminescence of three wells corrected for culture density measured at OD6oo- Results are the average of 4 independent experiments. 121  in response to DNA damaging agents like mitomycin, ciprofloxacin and novobiocin and not antimicrobial treatment in general.E. Electron Microscope Analysis of Pyocin/Phage Release  Increases in transcript abundance for the R2/F2 pyocins, is not necessarily indicative of increased pyocin proteins. Studies have shown that mRNA expression levels do not correlate with protein expression even in bacteria (Gmuender, Kuratli et al. 2001). Isolation and purification of the R2/F2 pyocins was completed on the basis of their structural similarity to phage tails (Yamamoto, Alberts et al. 1970; Nakayama, Takashima et al. 2000). While spontaneous pyocin production occurs in P. aeruginosa at a low level (Jacob 1954; Kageyama 1964), transmission electron microscopy of untreated and 0.3x-MIC ciprofloxacin treated P. aeruginosa clearly differentiated the presence and increase of phage tail proteins in the extracts from sub-inhibitory ciprofloxacin treated P. aeruginosa cells (Figure 32A and B). These particles were absentfromPA0620::/ux cultures either untreated or treated with ciprofloxacin (Figure 32C and D), indicating that exposure to sub-inhibitory ciprofloxacin was both inducing transcriptional and translational expression changes. Long filamentous-like structures were also visible in both the P. aeruginosa and PA0620::/ux cultures.  F. Determination of the Minimum Inhibitory Concentrations for Pyocin/Phage Mutants  The striking expression changes in the R2/F2 pyocin region following exposure to ciprofloxacin and other DNA damaging agents but not other antimicrobials, indicated that this region possibly played an important role in some response of the organism to these environmental challenges. These findings therefore were followed up with further susceptibility analyses of various mutants in this region (Table 3). MIC values to ciprofloxacin, as well as other fluoroquinolones, antimicrobials and DNA damaging agents were re-evaluated for all mutants in this region. Interestingly, all mutants in the R2/F2 pyocin region exhibited at least an 8-fold higher MIC for all fluoroquinolones but not other antimicrobials as compared to wild type P. aeruginosa strain HI 03 (Table 5). Consistent with this trend, mutation of the repressor protein PrtR (prtRy.lSlacZ) had no effect on the ciprofloxacin MIC (Table 5), since this strain would still  122  + 0.3x-MIC ciprofloxacin  Untreated  D  o o  < ON  Figure 32: Electron micrographs of supernatants from untreated and 0.3x-MIC ciprofloxacin treated P. aeruginosa strain H103 and PA0620::/«* cells. (A) Untreated strain HI03 cells; (B) 0.3x-MIC ciprofloxacin treated strain HI03 cells; (C) Untreated strain ?A0620::luxCDABE cells; and (D) 0.3x-MIC ciprofloxacin treated ?A0620::luxCDABE cells showing absence of R-type pyocin tail structures. Structures in A and C are likely F-type pyocins or flagella. Arrows point to the presence of pyocin/phage tail structures.  123  be capable of producing viable pyocin/phage. Mutation of the regulatory component recA::lSlacZ resulted in resistance to fluoroquinolones (Table 5), data which is also consistent with the regulatory control of R2/F2 pyocin expression (Matsui, Sano et al. 1993). Interestingly, mutation of the S-type pyocin encoded by PA3866 did not result in a similar resistance profile as for mutation of the R2/F2 pyocin region (Table 5). These findings then suggest that induction of the R2/F2 pyocin region but not other pyocin regions, contribute to the fluoroquinolone susceptibility of P. aeruginosa at the MIC. In parallel to these MIC trends for ciprofloxacin, the pyocin/phage and recAy.ISlacZ mutants exhibited increased MICs to the DNA damaging agent mitomycin (Table 10). MIC values to novobiocin were more variable but also tended to be increased; MICs were unchanged for ceftazidime, a P-lactam with no known gyrase inhibition or DNA damaging effects (Table 10). Together, these results indicate that the R2/F2 pyocin region not only contributes to the fluoroquinolone susceptibility of P. aeruginosa, but to the general susceptibility of the organism to DNA damage. G. Time-Kill Assays for Pyocin/Phage Mutants  If the R2/F2 pyocin region were important in mediating the adaptive resistance response to sub-inhibitory ciprofloxacin through its role as a fluoroquinolone or DNA damage susceptibility determinant, it would be predicted that mutants in the R2/F2 pyocin region would not be capable of eliciting the same adaptive resistance response as previously observed for wild type P. aeruginosa. To test this hypothesis the PA0620::/wx transcriptional fusion mutant was used in the adaptive resistance assay and compared to wild type P. aeruginosa strain HI03. The concentrations of ciprofloxacin used in the assay were calculated based on the strain respective MIC (Table 5). As previously demonstrated (Figure 20), wild type P. aeruginosa cultures exposed to 0.3x-MIC ciprofloxacin, exhibit enhanced survival ability compared to untreated cultures (Figure 33). Interestingly, both the untreated and sub-inhibitory ciprofloxacin treated mutant cultures grew better than the 0.3x-MIC ciprofloxacin treated P. aeruginosa HI03 culture in supra-inhibitory ciprofloxacin, even recovering growth ability after initial killing in suprainhibitory ciprofloxacin (Figure 33). This enhanced survival was not attributable to any significant growth advantage of the PA0620::/wx mutant over wild type P. aeruginosa (Figure  124  Table 10:  Minimum inhibitory concentrations of various antimicrobials against various  strains of P. aeruginosa. Cultures were grown in LB medium and represent the mode of four independent experiments. Novo, novobiocin; Ceft, ceftazidime; Mito, mitomycin; Cipro, ciprofloxacin. MIC (pg/ml) Strain  Novo  Ceft  Mito  Cipro  H103  500  1  2.5  0.06  prtRy.lSlacZ  500  1  1.25  0.06  PA0620::/wx  >1600  2  20  0.5  250  0.5  20  0.5  PA0641::/ux  >1600  2  20  0.5  recAv.lSlacZ  250  1  10  0.5  PA0621::IS/acZ  125  1.00E+08  1.00E+03 -i  1 0  . 20  1 40  1 60  1 80  1 100  1 120  1 160  Time (minutes)  Figure 33: Survival ability of P. aeruginosa strain H103 and PA0620::/«JC in 2x-MIC ciprofloxacin following growth in 0.3x-MIC ciprofloxacin.  Cultures of P. aeruginosa strain H103 and PA0620::/wx were grown in the presence or absence of 0.3x-MIC ciprofloxacin until mid-logarithmic phase, washed and then exposed to 2x-MIC ciprofloxacin. Concentrations of ciprofloxacin were calculated based on the respective strain's MIC. Colony forming units were counted every 20min for >2hours. Data representative of three separate experiments are shown.  126  34). There was no appreciable difference in growth between untreated and 0.3x-MIC ciprofloxacin treated mutant cultures, indicating that the mutants no longer had the capacity to exhibit differential survival or adaptive resistance. Thus, the R2/F2 pyocin region appears to play a role in mediating the adaptive resistance response of P. aeruginosa to ciprofloxacin. Absence of R2/F2 pyocin expression instead appears to allow the organism to eventually recover growth in supra-inhibitory ciprofloxacin. H. Serial Selection of Pyocin/Phage Loss with Sub-inhibitory Ciprofloxacin  Up-regulation of the R2/F2 pyocin region was observed following exposure to sub-inhibitory ciprofloxacin, conditions also found to induce an adaptive resistance-like response in P. aeruginosa. Yet strains lacking expression from the R2/F2 pyocin region were found not to exhibit adaptive resistance-like responses following exposure to sub-inhibitory ciprofloxacin. Furthermore, the R2/F2 pyocin region was found to be involved in fluoroquinolone and DNA damage susceptibility; its absence conferred fluoroquinolone and mitomycin resistance. These findings are disparate; up-regulation of the R2/F2 pyocins results in resistance in one case, while absence of expression results in resistance in another. If expression of the R2/F2 pyocin region does contribute to the antimicrobial susceptibility of P. aeruginosa, then ubiquitous absence of this operon would be expected. Interestingly, the pyocin/phage operon has been reported to be absent in the vast majority of isolates of P. aeruginosa, including a wide variety of clinical and environmental isolates (Ernst, D'Argenio et al. 2003; Wolfgang, Kulasekara et al. 2003). Studies of clinical isolates have also shown progressive loss of pyocin production and inhibition of phage replication (Holloway, Rossiter et al. 1973; Romling, Fiedler er al. 1994). Given that clinical and environmental isolates of P. aeruginosa often lack the R2/F2 pyocin region and that similar mutant strains used herein were found to be more resistant to fluoroquinolones, it was hypothesized that exposure to sub-inhibitory ciprofloxacin induces expression of the R2/F2 pyocins, which in turn select for the loss of this regionfromthe genome and thus increased fluoroquinolone resistance. There is precedence for colicin, the E. coli equivalent of pyocins, involvement in such microbial dominance. After seven days of co-culture, flasks initially containing a mixed population of colicin-sensitive, -producing and -resistant  127  Time (hours)  Figure 34:  Growth curve of P. aeruginosa strain H103 and PA0620::/«x mutant.  128  strains were only found to contain the colicin-resistant strain (Kerr, Riley et al. 2002; Kirkup and Riley 2004). Although not examined on a mutational level, these findings at least demonstrate a selection pressure in favor of colicin-resistant strains. To test this hypothesis, P. aeruginosa strains were serially cultured for five days in 0.3x-MIC ciprofloxacin and then plated on lOxMIC ciprofloxacin. Only untreated wild type P. aeruginosa strain HI03 was found to not grow on lOx-MIC ciprofloxacin plates; all other conditions predictably produced colonies on lOx-MIC plates (data not shown). Colony PCR of the resulting colonies found that there was ubiquitous presence of both the R2 and F2 pyocins within the genomes of all P. aeruginosa strains regardless of sub-inhibitory ciprofloxacin exposure condition (data not shown). It was anticipated however that either only one or none of the pyocin regions would be found in the genome of sub-inhibitory ciprofloxacin treated wild type P. aeruginosa strain HI 03 colonies.  I. Summary  While the overall response of P. aeruginosa to sub-inhibitory ciprofloxacin appears to be a collection of subtle expression changes, expression of the entire R2/F2 pyocin region was dramatically up-regulated in response to 0.3x- and lx-MIC ciprofloxacin. This striking result was confirmed by real-time PCR, as well as expression analysis from lux transcriptional fusions to ORFs in this region cultured under similar sub-inhibitory ciprofloxacin conditions. The role of the R2/F2 pyocin region in the response of P. aeruginosa to ciprofloxacin however is unknown. In an attempt to better understand the R2/F2 pyocin expression response to sub-inhibitory ciprofloxacin, a series of experiments was conducted on various lux transcriptional fusions to genes within this region. Firstly, the responsiveness of the R2/F2 pyocin region to different classes of gyrase inhibitors was compared to general DNA damaging agents and antimicrobials not known to either inhibit DNA gyrase or cause DNA damage,,to ascertain the specificity of this response. Analysis of the transcriptional response over a time and dose course of treatment revealed that the expression responses of the R2/F2 pyocin region were related to DNA damage and not antimicrobial challenge in general. This finding confirms previous work showing pyocin induction by mutagenic agents (Jacob 1954; Kageyama 1964). The analysis also showed that the extent of DNA damage induced by the gyrase inhibitors was much less than that observed for  129  mitomycin. Expression responses were also found to increase with both time and concentration of the drug. Differences in expression level were observed however between the two transcriptional fusions analyzed. This difference in expression level between PA0620::/ux and PA0641::/wx likely reflects the genetic organization and regulation of the R2/F2 pyocin region. Induction of RecA cleavage of PrtR by DNA damage, releases the repression of PrtR on prtN expression (Matsui, Sano et al. 1993). Binding of PrtN to the P-box motif located upstream of PA0613 and PA0633 (according to Nakayama et al. (Nakayama, Takashima et al. 2000) or within PA0632 according to analyses conducted herein) promotes expression of the corresponding R2 and F2 pyocin operons. The consensus sequence for the P-box motif (ATTGnn(n)GTnn(n)) is known to be repeated twice for the R2 pyocin and four times for the S-type pyocins (Matsui, Sano et al. 1993; Sano, Matsui et al. 1993). However, this consensus sequence is repeated only once for the F2 pyocin (personal communication with W. Hsiao and F. Brinkman, SFU) and is located within the sequence for PA0632. Since the P-box is responsible for the activation of the promoters of the pyocin genes by the prtN gene, but is not crucial for the promoter activity itself (Matsui, Sano et al. 1993), the P-box motif within PA0632 may either not be effective at promoter activation or may not be a strong binding motif compared to the multiplicity of sequences seen for the S-type or R2 pyocins. Hence the difference in P-box motif between R2 and F2 pyocins may contribute to the differential expression of the R2 and F2 pyocins. It is also possible that the lack of substantial expression changes in the lux mutants, particularly the PA0641::/wx mutant, reflects use of the incorrect ciprofloxacin concentration, since the concentration used to induce expression in the lux mutant strains in this assay were relevant to PAO-H103, rather than the mutant concentrations computed later to be much higher than PAO-H103. Because transcriptional changes do not always correlate with changes at the protein level, pyocin expression and production was confirmed by TEM. Comparison of the supernatants from wild type P. aeruginosa and the pyocin mutant PA0620::/«x clearly demonstrated induction of pyocin expression by exposure of wild type P. aeruginosa to sub-inhibitory ciprofloxacin. Similar induction responses in the pyocin mutant were not observed, indicating that the transcriptional response of P. aeruginosa to sub-inhibitory ciprofloxacin was being translated into changes at the protein level. The longfilamentousfibres also noted by TEM are likely the F2 pyocin, since expression of this pyocin would not be affected by transposon insertion into  130  PA0620, a Pv2 pyocin gene, and since spontaneous pyocin production does occur at a low level (Jacob 1954; Kageyama 1964). These structures may also represent flagella cleaved off from the bacterial surface, although this is not likely given the isolation and purification procedure (Yamamoto, Alberts et al. 1970). Since sub-inhibitory ciprofloxacin exposure to the mid-logarithmic phase induced both expression changes in the R2/F2 pyocin region and was found to elicit enhanced growth in the adaptive resistance assay, a possible role of the R2/F2 pyocins in the adaptive resistance response was investigated further. Following treatment with sub-inhibitory ciprofloxacin, the ability of pyocin mutants to survive in supra-inhibitory ciprofloxacin was compared to wild type P. aeruginosa. Interestingly, it was found that the mutant strain grew better than wild type P. aeruginosa in supra-inhibitory ciprofloxacin, the PA0620::/wx mutant exhibiting a delay before resuming growth. Thus, while exposure to sub-inhibitory ciprofloxacin no longer produced differences in survival to supra-inhibitory ciprofloxacin in the pretreated versus untreated mutants, the pyocin/phage mutant was better able to cope with and resist the supra-inhibitory ciprofloxacin challenge, suggesting a novel role for the R2/F2 pyocin region in mediating ciprofloxacin susceptibility/resistance in P. aeruginosa. Whether secondary mutations, such as those likely to occur through ciprofloxacin induction of SOS dependent mutagenesis (Power and Phillips 1993), contributed to the eventual ability of the mutant strains to overcome the suprainhibitory ciprofloxacin condition was not determined. Given that ciprofloxacin in the previous chapter was demonstrated to induce the SOS response, it seems that the SOS response either through induction of the R2/F2 pyocin region or through its own mutagenic capabilities, plays an important role in the response of P. aeruginosa to ciprofloxacin. The pyocin transcriptional mutants were also evaluated with respect to their antimicrobial susceptibility pattern. Surprisingly, all of the mutants examined displayed 8-fold or higher MICs to fluoroquinolones but not to other classes of antibiotics; the susceptibility patterns of mutants in the R2/F2 pyocin regulatory elements were consistent with these findings. Moreover, the pyocin/phage mutants also displayed higher MICs to mitomycin and novobiocin, other DNA damaging agents. Together, these results indicate a novel role for the R2/F2 pyocin region in the fluoroquinolone and/or DNA damage susceptibility of P. aeruginosa. But these results also present a contradiction in roles: the R2/F2 pyocins seem to be important in mediating both adaptive resistance and susceptibility to fluoroquinolones. Recent  131  studies on P. aeruginosa offer some insights into how these two roles may be related. It has been shown that the genomes of various clinical and environmental isolates of P. aeruginosa do not always contain the R2/F2 pyocin region (Ernst, D'Argenio et al. 2003; Wolfgang, Kulasekara et al. 2003). Other work has shown a role for colicins in promoting microbial diversity (Kerr, Riley et al. 2002; Kirkup and Riley 2004). While this work does not demonstrate colicin selection of mutations that produce colicin-resistant strains, it does demonstrate a selection pressure in favor of colicin-resistant strains, a selection pressure similar to that of sub-inhibitory ciprofloxacin. In the adaptive resistance assay, the pyocin mutant strains were able to grow better than wild type P. aeruginosa in supra-inhibitory ciprofloxacin (calculated from the respective strain MIC), findings which support this selection pressure theory, since pyocin mutants are able to outcompete pyocin producing strains on growth advantage. Examination of the ability of serial exposures to sub-inhibitory ciprofloxacin to select for loss of the R2/F2 pyocin region from the genome and thus for increased resistance, however, was unsuccessful. However, other options resulting in diminished pyocin expression after serial selection are also possible, such as mutations in the regulatory region affecting expression of the pyocin region. It is also possible that the ability of the strains to grow on lOx-MIC ciprofloxacin plates was attributable to mutations leading to other resistance mechanisms, such as mutations in either gyrase or the regulatory elements of multidrug efflux pumps, mutations which are also known to confer fluoroquinolone resistance. Whether the selection methodology was inappropriate or there were compensatory secondary resistance mechanisms or other mechanisms such as regulatory mutations leading to reduced pyocin expression, remains to be determined.  132  DISCUSSION  That antibiotic challenge eventually leads to the development of resistance is well established. Studies of bacterial resistance mechanisms however, tend to focus on either intrinsic or acquired resistance to the exclusion of adaptive resistance. Yet adaptive resistance is also clinically relevant, having been observed for both aminoglycoside and quinolone antimicrobials (Chamberland, Malouin et al. 1990; Gould, Milne et al. 1991; Barclay, Begg et al. 1996). Defined as an unstable, reversible resistance that is unrelated to genetic mutation (Barclay and Begg 2001), it occurs transiently in an organism under non-lethal selective pressure. The molecular mechanisms responsible for the development of adaptive resistance responses to aminoglycosides and quinolones however, are poorly understood at best. The aim of this project was to address these knowledge deficits for the quinolone ciprofloxacin from a global perspective using DNA microarray technology to P. aeruginosa. A. Sub-inhibitory ciprofloxacin induces adaptive resistance in P. aeruginosa While previous work on quinolone induced adaptive resistance has established that such resistance occurs following first exposure to 8x-MIC ciprofloxacin (Gould, Milne et al. 1991), achieving this concentration in the CF lung seems unrealistic given the mucoid and compartmentalized conditions of the CF lung. The ability of sub-inhibitory ciprofloxacin to elicit adaptive resistance in P. aeruginosa was therefore examined herein, since these concentrations are more likely to accurately reflect drug levels in the CF lung. Sub-inhibitory ciprofloxacin (0.3x-MIC) was found to induce one logio difference in survival compared to untreated cultures challenged with supra-inhibitory ciprofloxacin. In addition to the findings of Gould et al. (Gould, Milne et al. 1991), this work shows that a full range of ciprofloxacin concentrations induce adaptive resistance-like mechanisms  in P. aeruginosa.  Sub-inhibitory first exposure  concentrations were furthermore found to induce prolonged adaptive resistance responses. Taken together with previous work, these findings underscore the importance of ciprofloxacin at any concentration in eliciting extended adaptive resistance responses, and stress the need to better understand this type of resistance. This has obvious and important implications in the clinic and in the design of dosing regimes, since exposure of the pathogen to any concentration of  133  ciprofloxacin can induce mechanisms which allow the organism to survive subsequent ciprofloxacin challenges. Such resistance has already been observed in the clinic; strains of P. aeruginosa isolated from a patient receiving oral ciprofloxacin therapy exhibited transient resistance to ciprofloxacin as measured by MIC (Chamberland, Malouin et al. 1990). B. Sub-inhibitory ciprofloxacin induces expression of R2/F2 pyocins Although the importance of adaptive resistance in the clinic and dosing regimes is appreciated, it is unclear how exposure to ciprofloxacin elicits adaptive resistance. To date, no research has sufficiently addressed the molecular mechanisms underlying this type of resistance. Given the transient nature of adaptive resistance (Barclay, Begg et al. 1996), transcriptomes of P. aeruginosa were analyzed by custom DNA microarray analysis in an attempt to better define adaptive resistance at a molecular yet global level. Exposure of P. aeruginosa to sub-inhibitory and inhibitory concentrations of ciprofloxacin to the mid-logarithmic phase was found to induce numerous expression changes. Overall, many of the expression changes were fairly subtle, the majority of significant expression changes falling below 2-fold. Included in this category were many of the genes expected to change following treatment with ciprofloxacin, including the target DNA gyrase and various multidrug efflux pumps. Expression changes in these genes were expected since mutations in these genes or their regulatory elements confer resistance to ciprofloxacin (Li, Nikaido et al. 1995; Poole, Gotoh et al. 1996; Kohler, Epp et al. 1999; Mouneimne, Robert et al. 1999; Le Thomas, Couetdic et al. 2001). Absence of large expression changes in these known ciprofloxacin resistance genes may be related to the effective concentration within the cell. The intrinsically low outer membrane permeability of P. aeruginosa serves to decrease the rate of uptake of antibiotics into the cell, thereby allowing secondary resistance mechanisms like antibiotic efflux or degradation enzymes, to work effectively in eliminating the antibiotic from within the cell (Hancock and Speert 2000). Thus, the concentration of ciprofloxacin available within the cell may be considerably smaller than the original dose, to the extent that it has no discernible effect on the organism beyond a myriad of subtle expression changes. Certainly as the concentration of ciprofloxacin was increased, the extent and number of expression changes was found to increase correspondingly,  134  with SOS response genes figuring more prominently than resistance genes with increasing concentration (Appendix III). Absence of known ciprofloxacin resistance genes may also be a result of the concentrations of ciprofloxacin studied, since concentration affects which resistance mechanism is selected by P. aeruginosa in response to quinolone exposure. At concentrations close to the MIC, efflux type mechanisms were selected almost exclusively in the lab; gyrase type mutations appeared only at concentrations above 4x-MIC (Kohler and Pechere 2001). Since only the MIC and not higher concentrations of ciprofloxacin were examined, absence of resistance genes is also likely related to the dose. Absence of large expression changes in the known ciprofloxacin resistance genes may also be reflective of the early time point examined. Resistance responses may require longer exposure times than the 2.5 hours examined and may follow induction of SOS responses. Similar absentia results were observed by Gmuender et al. in their evaluation of gene expression changes triggered by H. influenzae in response to ciprofloxacin (Gmuender, Kuratli et al. 2001). lx-MIC ciprofloxacin conditions were likewise not found to induce expression changes in either the target or other known resistance mechanisms following 1 hour of exposure. Only when lOx-MIC ciprofloxacin conditions were evaluated did expression of the DNA gyrase A and B subunits change, and even then only by <2.0 fold after 1 hour of exposure. SOS response genes however were rapidly induced following 30min exposure to inhibitory ciprofloxacin (Gmuender, Kuratli et al. 2001). These results support the notion that P. aeruginosa responses to ciprofloxacin are time sensitive and hierarchal with respect to SOS and resistance. Since higher doses of ciprofloxacin are also known to elicit adaptive resistance responses (Gould, Milne et al. 1991), it may be argued that such concentrations should have been examined instead. But in addition to the biological interest of low dose ciprofloxacin and early time points with respect to adaptive resistance, transcriptome analysis of sub-inhibitory ciprofloxacin treated cells at mid-log reduced the amount of complicating microarray data resulting from inhibition of secondary targets within the cell and downstream effects resulting from inhibition of the primary target (Shaw and Morrow 2003). Of the significantly differentially expressed ORFs, no molecular mechanism of adaptive resistance was apparent. Outside of the aforementioned known quinolone resistance genes, not even general resistance genes were observed to exhibit noteworthy expression changes. Again, similar absentia results were noted by others (Gmuender, Kuratli et al. 2001). The lack of an  135  apparent molecular mechanism underlying adaptive resistance is further compounded by the observation that most ORFs which did exhibit large fold changes were classified as either 'hypothetical protein' or 'putative enzyme' (Table 6 and Appendix III). Thus, many of the genes likely to be important in mediating the adaptive resistance response in P. aeruginosa, as indicated by their large expression response, remain to be fully characterized. Certainly the study of these ORFs offers unprecedented potential for discovering novel resistance mechanisms and drug targets. Nonetheless, some interesting results were identified through the microarray studies. Striking expression changes were observed for all genes between PA0613 and PA0648 (Table 8), a region of the genome which encodes the R2/F2 pyocins (Nakayama, Takashima et al. 2000). As the concentration of ciprofloxacin was increased, the number of ORFs within this region and their fold changes also increased. Based on the mutagenic nature of ciprofloxacin (Phillips 1987; Debnath, de Compadre et al. 1992; Fort 1992), expression changes in this region and in other pyocins was expected since regulatory elements of the pyocins are known to be responsive to cellular stress through the SOS response (Matsui, Sano et al. 1993). The correlation between pyocin expression and the adaptive resistance response of P. aeruginosa to sub-inhibitory ciprofloxacin however was not obvious. The dramatic up-regulation of R2/F2 pyocins by subinhibitory ciprofloxacin suggested at least, that the mechanism of action of ciprofloxacin may not be as well defined as previously thought. Downstream effects such as up-regulation of R2/F2 pyocin expression resulting from inhibition of the primary DNA gyrase target are apparent. Noteworthy expression changes were also observed for genes involved in the SOS response of the cell to ciprofloxacin induced DNA damage. Induction of the SOS response itself may also play a role in mediating the adaptive resistance response to ciprofloxacin, since induction of the SOS response is known to have two consequences (Drlica and Zhao 1997). One is quinolone induced mutagenesis which could be very important if it contributes to the acquisition of quinolone resistance mutations (Drlica and Zhao 1997). Given the nature of adaptive resistance however, such mutagenesis would result in stable resistance rather than transient adaptive resistance. The other consequence is enhanced survival in the presence of fluoroquinolones, since mutations that block SOS induction have been shown to increase the susceptibility of cells to fluoroquinolones (Howard, Pinney et al. 1993). Thus, ciprofloxacin induction of the SOS  136  system may promote enhanced survival of P. aeruginosa in supra-inhibitory ciprofloxacin conditions (Figure 35). Overall, the microarray findings presented here provide a snapshot signature of the expression response of P. aeruginosa at the mid-logarithmic phase to sub-inhibitory and inhibitory ciprofloxacin. Understanding the organism's physiological changes on a global level can assist in defining the mechanism of resistance (Shaw and Morrow 2003). As well, understanding the organism's responses can help better define the mechanism of action of an inhibitor. As seen in this study for example, observations of changes to non-target genes or pathways, as noted above for the R2/F2 pyocins, can yield information that might not have been discovered by single gene molecular approaches. C. R2/F2 pyocin induction is related to DNA damage If activating expression of pyocins is a novel component in the mechanism of action for ciprofloxacin, this ability was hypothesized to be attributable to ciprofloxacin's mutagenic activity rather than secondary target activity, since the prtR and prtN pyocin regulatory elements are known to be responsive to the SOS system (Matsui, Sano et al. 1993). Indeed, transcriptional fusions to genes in the R2/F2 pyocin region showed that expression was inducible by both the mutagenic activity of novobiocin, another class of DNA gyrase inhibitors acting on the gyrase B subunit, and mitomycin, a potent DNA damaging agent. No induction of R2/F2 pyocin expression was observed for ceftazidime, a P-lactam with no known gyrase activity or DNA damage activity. Thus, pyocin expression was shown to be sensitive to the DNA damage resultant from inhibition of DNA gyrase, and not a secondary target of ciprofloxacin. A connection between the DNA damage induced SOS response and R2/F2 pyocin expression though, suggested that such expression changes in response to sub-inhibitory ciprofloxacin may be related to the organism's overall stress response and not just DNA damage stress. This however does not seem likely since other P. aeruginosa microarray experiments examining various other stress inducing conditions like treatment with imipenem (Bagge, Schuster et al. 2004), did not find similar changes in the R2/F2 pyocin region. Expression changes in the R2/F2 pyocin region thus seem to be directly related to the response of P. aeruginosa to ciprofloxacin and its DNA damaging effects.  137  '5K^  v  D  N  A  +  D  N  A  gy  r a s e  Quinolone (Ciprofloxacin)  I rf^-k  d s D N A Breaks  1 Activation of R e c A I S O S Response s  I. Quinolone Induced Mutagenesis -> Acquire quinolone resistance mutations  2. recA dependent recombination & SOS induction -> Enhance survival in quinolones  ^ R 2 / F 2 Pyocins ^Mutation events -> Alter genetic control (prtRN) to ^/R2/¥2 -> Quinolone 1 SOS -> Transient mutators -> Persister Cells -> Quinolone tolerance  R  s  ADAPTIVE RESISTANCE -> Enhanced survival in Ciprofloxacin  Sustained Challenge  9• 1 SOS -> f Mutators alleles (i.e. ^mutS) -> 1 mutation rate i^SOS -> hR2/F2 -> Colicin/pyocin selection of R2/F2 resistant strains s  s  /  MUTATIONAL RESISTANCE  Figure 35: Potential relationships between ciprofloxacin and development of resistance.  138  the  D. R2/F2 pyocins have a role in adaptive resistance to sub-inhibitory ciprofloxacin Whether the expression changes in the R2/F2 pyocin region played a role in mediating the adaptive resistance response seen upon subsequent exposure of cultures to supra-inhibitory ciprofloxacin however was not yet clear. Mutants in the R2/F2 pyocin region were thus reevaluated in the adaptive resistance assay. Care was taken to calculate the sub-inhibitory and supra-inhibitory concentrations of ciprofloxacin appropriately using the strain specific MIC values. Mutants exposed to sub-inhibitory ciprofloxacin, however, were no longer found to exhibit a difference in survival between sub-MIC ciprofloxacin treated and untreated cultures upon exposure to supra-inhibitory ciprofloxacin, implying a potential role for the R2/F2 pyocin in adaptive resistance. Interestingly, growth of the mutants in supra-inhibitory ciprofloxacin regardless of the pretreatment condition was found to be quicker than either of the wild type strain conditions, and to eventually even overcome the supra-inhibitory condition. This difference was not attributable to any growth advantage afforded by an increased ciprofloxacin resistance profile, since suprainhibitory concentrations for each strain were calculated from the strain specific MIC. Instead, the growth advantage is likely due to the improved fitness of mutants, which no longer have to contend with lytic events related to the release of pyocins. While the transcriptional units of the R2 and F2 pyocins have not been fully elucidated, based on the location of the P-box motifs required for prtN activation of pyocin expression upstream of PA0613 (R2 pyocin) and within PA0632 (F2 pyocin) (Matsui, Sano et al. 1993; Nakayama, Takashima et al. 2000), disruption of PA0620 would introduce a polar mutation in the operon. Since there appears to be only one lytic system responsible for release of all pyocins in P. aeruginosa encoded by PA0614 and PA0629 (Nakayama, Takashima et al. 2000), such a polar mutation would render the lytic system incomplete, and would prevent the cell lysis associated with pyocin release. Thus without cell lysis, mutants in the R2/F2 pyocin region would exhibit a growth advantage over wild type strains containing both the pyocin and functional lytic system. Whether secondary mutations contributed to the ability of the mutant strains to eventually overcome the supra-inhibitory ciprofloxacin condition was not determined. How expression of the R2/F2 pyocin region would contribute to the adaptive resistance response of P. aeruginosa is not obvious. Expression of the R2/F2 pyocin region and the  139  resulting cell lysis and pyocin release would reduce the overall cell population, rather than enhance it or allow for its survival. Thus, expression of the R2/F2 pyocin region would not be expected to result in an adaptive resistance response as was observed. While the adaptive resistance response was observed for wild type P. aeruginosa producing pyocin, and not for pyocin mutant strains, the enhanced survival of wild type cells in supra-inhibitory ciprofloxacin may be explained if expression of the R2/F2 pyocin region were down-regulated or if a genetic mutation in wild type P. aeruginosa resulting in either a pyocin or lytic mutant strain had occurred. Such an event would be predicted to yield growth advantages parallel to those seen for the pyocin mutant strain in supra-inhibitory ciprofloxacin conditions. Bacteria possess mechanisms and strategies for responding to the constant changes in their environment. These include phenotypic acclimation, by which an individual organism modifies some aspect of its behavior, morphology or metabolism in response to environmental change, and genetic adaptation, whereby the genetic composition of a population may change as a result of natural selection (Moxon, Rainey et al. 1994). Acclimation is achieved by such mechanisms as feedback loops and two-component sensory systems, which ultimately regulate gene expression in response to some environmental change. When confronted with a persisting unfavorable environment for which classical regulation of gene expression is inadequate however, bacteria must adapt genetically by natural selection or face extinction (Moxon, Rainey etal 1994). It is important to note that increased expression of the R2/F2 pyocins was measured with microarrays at the mid-logarithmic phase, prior to supra-inhibitory ciprofloxacin exposure. R2/F2 pyocin expression was not measured during the adaptive resistance assay (i.e. at 90min), thus proof of decreased expression of the R2/F2 pyocins resulting from such events is not available. However, extension of the transcriptional fusion exposure assays showed that expression of the R2/F2 pyocins decreased after 4 hours of exposure to 0.3x-MIC ciprofloxacin (data not shown). This concentration did not substantially alter the growth ability of the organism even after 4 hours, and was the same concentration for which adaptive resistance was observed. These observations support the theory that down-regulation of the initial R2/F2 pyocin gene expression during prolonged exposure to ciprofloxacin could be important in the adaptive resistance assay.  140  Outside of gene regulation of R2/F2 pyocin expression, mutation events in the R2/F2 pyocins are not only possible but prevalent under selective conditions such as antimicrobial environments. Recent work has pointed to the existence of transient mutators, whose mutator alleles revert to normal mutator status through reversion (Oliver, Baquero et al. 2002) or recombination (Brown, LeClerc et al. 2001). Such transient mutators are thought to exist within persister populations (Chopra, O'Neill et al. 2003). Persister populations exhibit tolerance, meaning that cells do not grow in the presence of antibiotics but do not die either (Keren, Kaldalu et al. 2004). In conditions where P. aeruginosa is non-dividing or growing slowly, such elevated mutation frequencies have been observed (Alonso, Campanario et al. 1999). These growth conditions are similar to the adaptive resistance assay, since exposure to supra-inhibitory ciprofloxacin would not be conducive to growth. Moreover, it has been suggested that fluoroquinolones, like ciprofloxacin, likely create transient mutator phenotypes through induction of the SOS response (Livermore 2003), a response prominent in the cultures studied herein. Furthermore, Fung-Tome et al. have demonstrated that sub-inhibitory ciprofloxacin exposure increases the mutation rate and thus resistance of P. aeruginosa (Fung-Tome, Kolek et al. 1993). The microarray findings herein corroborate this data and show diminished expression of mutS with increasing ciprofloxacin concentration, a gene whose inactivation leads to a mutator phenotype (Oliver, Baquero et al. 2002). Other researchers have also shown that low concentrations of antibiotics, as in sub-inhibitory ciprofloxacin, contribute to the problem of elevated mutation frequencies by selecting mutator alleles (Giraud, Matic et al. 2002; Negri, Morosini et al. 2002). Taken together, the observed adaptive resistance response of 0.3x-MIC ciprofloxacin pretreated cultures may be attributable to a transient hypermutator state affording mutation of wild type P. aeruginosa producing the R2/F2 pyocins into a pyocin mutant strain (Figure 35).  E. R2/F2 pyocin region is a fluoroquinolone susceptibility determinant Whatever the mechanism underlying decreased expression of the R2/F2 pyocins, there seemed to be no apparent logic for decreased expression, beyond the adaptive resistance response of a moderately improved growth profile or eventual survival in supra-inhibitory ciprofloxacin. Re-evaluation of the susceptibility profiles of the R2/F2 pyocin mutants however  141  revealed some very interesting and novel findings in this regard. All of the R27F2 pyocin mutants exhibited at least an 8-fold increase in fluoroquinolone resistance; MIC values to various other antimicrobials were unchanged. Corresponding to the known regulation of R2/F2 pyocin expression (Matsui, Sano et al. 1993), a recA mutant but not a mutant in the negative regulator prtR, exhibited similar altered susceptibility profiles. Similar observations with respect to fluoroquinolone MIC for recA have been noted by others (Walters, Piddock et al. 1989). Furthermore, similar susceptibility trends were not seen for mutants in other pyocins like the Stype pyocins. The R2/F2 pyocin mutants also exhibited increases in mitomycin and novobiocin resistance, other DNA damaging agents. Together these findings suggest that the R2/F2 pyocin region plays a role in mediating fluoroquinolone and/or DNA damage susceptibility at the MIC in P. aeruginosa. Furthermore, these findings indicate why wild type P. aeruginosa producing pyocin would want to decrease expression of the R2/F2 pyocins or convert into a non-producing phenotype. In addition to the moderate enhancement in growth profile afforded by lack of R2/F2 pyocin production, such strains of P. aeruginosa would also be resistant to the DNA damage induced by fluoroquinolones, and thus better able to tolerate growth in the face of continued ciprofloxacin/DNA damaging exposure.  F. R2/F2 pyocins play a role in microbial diversity Having established the R2/F2 pyocin region as a fluoroquinolone/DNA damage susceptibility determinant in P. aeruginosa, it was hypothesized that prolonged induction of the adaptive resistance response with ciprofloxacin could lead to or select for more stable resistance types, like mutational resistance. Thus, it was hypothesized that sustained exposure to ciprofloxacin could lead to mutation events in the R2/F2 pyocin region, resulting in either loss of expression or lysis or deletion of the region itself, and conferring fluoroquinolone resistance to the organism. Certainly such transient mutator states are possible both within P. aeruginosa and with the antimicrobial challenges explored herein, as noted previously (Fung-Tome, Kolek et al. 1993; Livermore 2003). Furthermore, recent genome analyses have reported the absence of the R2/F2 pyocin region in the vast majority of clinical and environmental isolates of P. aeruginosa (Ernst, D'Argenio et al. 2003; Wolfgang, Kulasekara et al. 2003). Other studies of clinical isolates have also shown progressive loss of pyocin production and inhibition of phage replication (Holloway,  142  Rossiter et al. 1973; Romling, Fiedler et al. 1994). Together these findings support the notion that the R2/F2 pyocin region is a region easily mutated or expended from the genome under certain conditions, possibly such as ciprofloxacin selective conditions. Expression of the R2/F2 pyocins themselves may play a further role in selecting for such mutational resistance. Recent work on colicins (pyocins of E. coli) and their role in biodiversity, have identified colicins as having the ability to promote microbial diversity in static or localized environments, in a manner similar to the game rock-paper-scissors (Kerr, Riley et al. 2002; Kirkup and Riley 2004). In this model, strains that produce colicin kill sensitive strains, which outcompete resistant strains, which in turn, outcompete colicin producing strains on the basis of growth-rate advantage. However, in well-mixed or large spatial environments, the resistant strain predominates over time. Although not examined on a mutational level, these findings at least demonstrate a selection pressure in favor of colicin resistant strains based on growth advantage. Such selection pressure is akin to that of the sub-inhibitory to supra-inhibitory ciprofloxacin environment shift of the adaptive resistance assay. Furthermore, similar growth and survival advantage for non-pyocin producing strains has already been observed in the adaptive resistance assay. Thus, a sustained adaptive resistance response and/or up-regulation of R2/F2 pyocins induced by continuous ciprofloxacin challenge, may lead to mutational resistance (Figure 35). Genetic analysis of the R2/F2 pyocin region of P. aeruginosa cultures grown under successive sub-inhibitory ciprofloxacin conditions and then exposed to supra-inhibitory ciprofloxacin however, did not reveal loss of either the R2 or F2 pyocin region. Evaluation of the susceptibility profiles of various clinical and environmental isolates variably containing the R2/F2 pyocin region (Ernst, D'Argenio et al. 2003; Wolfgang, Kulasekara et al. 2003) was also inconclusive with respect to correlating absence of a pyocin region and fluoroquinolone resistance (data not shown). While unfortunate, this result is not conclusive in that other types of mutation events were not explored. For example, mutation events in either the positive regulator prtN, resulting in a dysfunctional transcriptional activator, or mutation of the negative regulator prtR, resulting in constitutive repression, could also abolish expression of the R2/F2 pyocins without affecting the genomic content. Similarly, mutation events in the lysis genes or introduction of a premature stop codon in any of the pyocin ORFs could result in lack of pyocin release or functional pyocin production, respectively.  143  Nonetheless, it is intriguing to speculate that the absence of the R2/F2 pyocin region in clinical isolates of P. aeruginosa results from selection and survival of the pyocin resistant (nonproducing) strain. For an isolate from a CF patient receiving fluoroquinolone antibiotics, selection and survival of the pyocin resistant strain would be equivalent to inheriting ciprofloxacin resistance. As mentioned above, evidence of development, survival and existence of such pyocin non-producing strains has been well documented  (Holloway, Rossiter et al.  1973; Romling, Fiedler et al. 1994; Ernst, D'Argenio et al. 2003; Wolfgang, Kulasekara et al. 2003). Thus, sub-inhibitory concentrations of ciprofloxacin play an important role in both the adaptive resistance response of P. aeruginosa and possibly in mediating the development of more stable fluoroquinolone resistance through expression and/or genomic changes in the fluoroquinolone susceptibility determining R2/F2 pyocin region. Sub-inhibitory concentrations of antimicrobials, in particular ciprofloxacin, then present an important therapeutic challenge not adequately addressed in current clinical settings.  G. Future directions Microbial genomics has revolutionized our capacity for antimicrobial drug discovery and resistance research. Based on the wealth of genomic information, DNA microarray technology has allowed researchers to confirm the validity of existing drug targets, to identify new targets and to detect the cellular responses to treatment, yielding some very interesting findings. Using the information from these transcriptional profiling studies, we are only now beginning to understand the complexity of responses of bacterial pathogens to antimicrobials. This study and others have indicated that there is no single target or mechanism of action for a given antimicrobial and as a result, have opened up new target areas for research. Several obvious future research questions arise from the data presented in this thesis. These include: (1) identification of the expression signature for the adaptive resistance response of P. aeruginosa and comparison to the expression signatures obtained herein, (2) conclusive confirmation that the up-regulation of the R2/F2 pyocin region can lead to the loss of either R2/F2 pyocin expression or the region's genomic content altogether, and (3) investigation of the mechanism by which such loss could occur. Further microarray studies could be used for comparative analysis of the present expression profiles with those taken during the adaptive  144  resistance response, to ascertain the signature of adaptive resistance as induced by sub-inhibitory ciprofloxacin conditions. Work with various R2/F2 pyocin mutant constructs could be used to characterize the mechanisms underlying the regulatory or functional loss of the R2/F2 pyocin region. Some exciting new prospects for how this regulation or loss might be achieved come from the area of bacteriophage research. While it is known that DNA gyrase cleaves at sequence specific sites in the genome (Fisher, Mizuuchi et al. 1981), gyrase specific sites are also important for transposition of certain bacteriophage. For example, the bacteriophage Mu genome contains a centrally located strong gyrase binding site (SGS) that is required for efficient transposition of the phage (Pato, Howe et al. 1990). A consensus SGS sequence has been established, and preliminary analysis of the P. aeruginosa genome shows that this site is present in the middle of the R2/F2 pyocin region at PA0626 (data not shown). Whether similar transposition events occur in the R2/F2 pyocin region are not known, but may be possible given the homology of this region to various phage (Nakayama, Takashima et al. 2000). Such transposition events present an intriguing mechanism for loss of the R2/F2 region from the P. aeruginosa genome and require further investigation.  145  REFERENCES  Abman, S. H., J. W. Ogle, et al. (1991). "Early bacteriologic, immunologic, and clinical courses of young infants with cystic fibrosis identified by neonatal screening." J Pediatr 119(2): 211-7. Ali, J. A., A. P. Jackson, et al. (1993). "The 43-kilodalton N-terminal fragment of the DNA gyrase B protein hydrolyzes ATP and binds coumarin drugs." Biochemistry 32(10): 2717-24. Aim, R. A. and J. S. Mattick (1997). "Genes involved in the biogenesis and function of type-4 fimbriae in Pseudomonas aeruginosa." Gene 192(1): 89-98. Alonso, A., E. Campanario, et al. (1999). "Emergence of multidrug-resistant mutants is increased under antibiotic selective pressure in Pseudomonas aeruginosa." Microbiology 145(Pt 10): 2857-62. Altschul, S. F., W. Gish, et al. (1990). "Basic local alignment search tool." J Mol Biol 215(3): 403-10. Ambion, I. (2004). Bacterial Whole Genome Array Analysis. www.ambion.eom/techlib/tn/114/8.html Amsterdam, D. (1991). Susceptibility testing of antimicrobials in liquid media. Antibiotics in laboratory medicine. V. Lorian. Baltimore, Md., Williams & Wilkins: 72-78. Andersen, D. H. (1938). "Cystic fibrosis of the pancreas and its relation to celiac disease: a clinical and pathologic study." Am J Pis Child 56: 344-399. Ausubel, F. M., Roger Brent, Robert E. Kingston, David D. Moore, J.G. Seidman, John A. Smith and Kevin Struhl, Ed. (1997). Current protocols in molecular biology. New York, Greene Pub. Associates ; Wiley-Interscience. Bagge, N., M . Schuster, et al. (2004). "Pseudomonas aeruginosa biofilms exposed to imipenem exhibit changes in global gene expression and beta-lactamase and alginate production." Antimicrob Agents Chemother 48(4): 1175-87. Ball, P. (1990). "Emergent resistance to ciprofloxacin amongst Pseudomonas aeruginosa and Staphylococcus aureus: clinical significance and therapeutic approaches." J Antimicrob Chemother 26(Suppl F): 165-79. Barclay, M . L. and E. J. Begg (2001). "Aminoglycoside adaptive resistance: importance for effective dosage regimens." Drugs 61(6): 713-21. Barclay, M . L., E. J. Begg, et al. (1992). "Adaptive resistance following single doses of gentamicin in a dynamic in vitro model." Antimicrob Agents Chemother 36(9): 1951-7.  146  Barclay, M . L., E. J. Begg, et al. (1996). "Adaptive resistance to tobramycin in Pseudomonas aeruginosa lung infection in cysticfibrosis."J Antimicrob Chemother 37(6): 1155-64. Battaglia, C , G. Salani, et al. (2000). "Analysis of DNA microarrays by non-destructive fluorescent staining using SYBR green II." Biotechniques 29(1): 78-81. Bayer, A. S., D. C. Norman, et al. (1987). "Characterization of impermeability variants of Pseudomonas aeruginosa isolated during unsuccessful therapy of experimental endocarditis." Antimicrob Agents Chemother 31(1): 70-5. Baysse, C , J. M . Meyer, et al. (1999). "Uptake of pyocin S3 occurs through the outer membrane ferripyoverdine type II receptor of Pseudomonas aeruginosa." J Bacteriol 181(12): 384951. Benes, V. and M . Muckenthaler (2003). "Standardization of protocols in cDNA microarray analysis." Trends Biochem Sci 28(5): 244-9. Bernstein, J. A., A. B. Khodursky, et al. (2002). "Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays." Proc Natl Acad Sci U S A 99(15): 9697-702. Betts, J. C , A. McLaren, et al. (2003). "Signature gene expression profiles discriminate between isoniazid-, thiolactomycin-, and triclosan-treated Mycobacterium tuberculosis." Antimicrob Agents Chemother 47(9): 2903-13. Birrer, P., N. G. McElvaney, et al. (1994). "Protease-antiprotease imbalance in the lungs of children with cystic fibrosis." Am J Respir Crit Care Med 150(1): 207-13. Blanche, F., B. Cameron, et al. (1996). "Differential behaviors of Staphylococcus aureus and Escherichia coli type II DNA topoisomerases." Antimicrob Agents Chemother 40(12): 2714-20. Bonfield, T. L., J. R. Panuska, et al. (1995). "Inflammatory cytokines in cystic fibrosis lungs [published erratum appears in Am J Respir Crit Care Med 1996 Oct; 154(4 Pt l):following 12171." Am J Respir Crit Care Med 152(6 Pt 1): 2111-8. Bowtell, D. D. (1999). "Options available—from start tofinish—forobtaining expression data by microarray." Nat Genet 21(1 Suppl): 25-32. Brooun, A., S. Liu, et al. (2000). "A dose-response study of antibiotic resistance in Pseudomonas aeruginosa biofilms." Antimicrob Agents Chemother 44(3): 640-6. Brown, E. W., J. E. LeClerc, et al. (2001). "Phylogenetic evidence for horizontal transfer of mutS alleles among naturally occurring Escherichia coli strains." J Bacteriol 183(5): 1631-44.  147  Bryan, R., D. Kube, et al. (1998). "Overproduction of the CFTR R domain leads to increased levels of asialoGMl and increased Pseudomonas aeruginosa binding by epithelial cells." Am J Respir Cell Mol Biol 19(2): 269-77. Burns, J. L., R. L. Gibson, et al. (2001). "Longitudinal assessment of Pseudomonas aeruginosa in young children with cystic fibrosis." J Infect Pis 183(3): 444-52. CCFF (2003). 2003 Canadian Cystic Fibrosis Foundation Annual Report. Toronto, ONT, Canadian Cystic Fibrosis Foundation: 1-12. CCFF (2003a). Facts about CF, Canadian Cystic Fibrosis Foundation. http://www.cysticfibrosis.ca/page.asp?id=21 CFF (1994). Microbiology and infectious disease in cystic fibrosis. Cystic Fibrosis Foundation: Concepts of care. Bethesda, M P , Cystic Fibrosis Foundation. V section 1: 1-26. CFF (2003). Cystic Fibrosis Foundation Patient Registry Annual Pata Report 2003. Bethesda, MP, Cystic Fibrosis Foundation. Chamberland, S., F. Malouin, et al. (1990). "Persistence of Pseudomonas aeruginosa during ciprofloxacin therapy of a cystic fibrosis patient: transient resistance to quinolones and protein F-deficiency." J Antimicrob Chemother 25(6): 995-1010. Chen, C. R., M . Malik, et al. (1996). "PNA gyrase and topoisomerase IV on the bacterial chromosome: quinolone-induced PNA cleavage." J Mol Biol 258(4): 627-37. Cheung, V. G., M . Morley, et al. (1999). "Making and reading microarrays." Nat Genet 21(1 Suppl): 15-9. Chmiel, J. F., M . Berger, et al. (2002). "The role of inflammation in the pathophysiology of CF lung disease." Clin Rev Allergy Immunol 23(1): 5-27. Chopra, I., A. J. O'Neill, et al. (2003). "The role of mutators in the emergence of antibioticresistant bacteria." Prug Resist Updat 6(3): 137-45. Chou, C. C , C. H. Chen, et al. (2004). "Optimization of probe length and the number of probes per gene for optimal microarray analysis of gene expression." Nucleic Acids Res 32(12): e99. Chuaqui, R. F., R. F. Bonner, et al. (2002). "Post-analysis follow-up and validation of microarray experiments." Nat Genet 32(Suppl): 509-14. Churchill, G. A. (2002). "Fundamentals of experimental design for cONA microarrays." Nat Genet 32(Suppl): 490-5.  148  Clerch, B., J. M . Bravo, et al. (1996). "Analysis of the ciprofloxacin-induced mutations in Salmonella typhimurium." Environ Mol Mutagen 27(2): 110-5. Coleman, F. T., S. Mueschenborn, et al. (2003). "Hypersusceptibility of cystic fibrosis mice to chronic Pseudomonas aeruginosa oropharyngeal colonization and lung infection." Proc Natl Acad Sci U S A 100(4): 1949-54. Costerton, J. W., P. S. Stewart, et al. (1999). "Bacterial biofilms: a common cause of persistent infections." Science 284(5418): 1318-22. Daikos, G. L., G. G. Jackson, et al. (1990). "Adaptive resistance to aminoglycoside antibiotics from first-exposure down-regulation." J Infect Pis 162(2): 414-20. Daikos, G. L., V. T. Lolans, et al. (1991). "First-exposure adaptive resistance to aminoglycoside antibiotics in vivo with meaning for optimal clinical use." Antimicrob Agents Chemother 35(1): 117-23. Dalhoff, A. (1994). "Quinolone resistance in Pseudomonas aeruginosa and Staphylococcus aureus. Development during therapy and clinical significance." Infection 22(Suppl 2): SI 11-21. Davies, J. C , M . Stern, et al. (1997). "CFTR gene transfer reduces the binding of Pseudomonas aeruginosa to cystic fibrosis respiratory epithelium." Am J Respir Cell Mol Biol 16(6): 657-63. Davies, J. E. (1997). "Origins, acquisition and dissemination of antibiotic resistance determinants." Ciba Found Symp 207: 15-27; discussion 27-35. de Bentzmann, S., P. Roger, et al. (1996). "Asialo GM1 is a receptor for Pseudomonas aeruginosa adherence to regenerating respiratory epithelial cells." Infect Immun 64(5): 1582-8. de Saizieu, A., TJ. Certa, et al. (1998). "Bacterial transcript imaging by hybridization of total RNA to oligonucleotide arrays." Nat Biotechnol 16(1): 45-8. Debnath, A. K., R. L. de Compadre, et al. (1992). "Mutagenicity of quinolines in Salmonella typhimurium TA100. A QSAR study based on hydrophobicity and molecular orbital determinants." Mutat Res 280(1): 55-65. Deitz, W. H., T. M . Cook, et al. (1966). "Mechanism of action of nalidixic acid on Escherichia coli. 3. Conditions required for lethality." J Bacteriol 91(2): 768-73. Dennis, J. J., E. R. Lafontaine, et al. (1996). "Identification and characterization of the tolQRA genes of Pseudomonas aeruginosa." J Bacteriol 178(24): 7059-68.  149  Deretic, V., D. W. Martin, et al. (1993). "Conversion to mucoidy in Pseudomonas aeruginosa." Biotechnology (N Y) 11(10): 1133-6. Deretic, V., M . J. Schurr, et al. (1994). "Conversion of Pseudomonas aeruginosa to mucoidy in cystic fibrosis: environmental stress and regulation of bacterial virulence by alternative sigma factors." J Bacteriol 176(10): 2773-80. DiMango, E., H. J. Zar, et al. (1995). "Diverse Pseudomonas aeruginosa gene products stimulate respiratory epithelial cells to produce interleukin-8." J Clin Invest 96(5): 2204-10. Domagala, J. M., L. D. Hanna, et al. (1986). "New structure-activity relationships of the quinolone antibacterials using the target enzyme. The development and application of a DNA gyrase assay." J Med Chem 29(3): 394-404. Donaldson, S. H., E. G. Poligone, etal. (2002). "CFTR regulation of ENaC." Methods Mol Med 70: 343-64. Doring, G., S. P. Conway, et al. (2000). "Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus." Eur Respir J 16(4): 749-67. Dorman, C. J., N. N. Bhriain, et al. (1990). "DNA supercoiling and environmental regulation of virulence gene expression in Shigella flexneri." Nature 344(6268): 789-92. Drenkard, E. and F. M . Ausubel (2002). "Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation." Nature 416(6882): 740-3. Drlica, K. and X. Zhao (1997). "DNA gyrase, topoisomerase IV, and the 4-quinolones." Microbiol Mol Biol Rev 61(3): 377-92. Duggan, D. J., M . Bittner, et al. (1999). "Expression profiling using cDNA microarrays." Nat Genet 21(1 Suppl): 10-4. Duport, C , C. Baysse, et al. (1995). "Molecular characterization of pyocin S3, a novel S-type pyocin from Pseudomonas aeruginosa." J Biol Chem 270(15): 8920-7. Egan, M., T. Flotte, et al. (1992). "Defective regulation of outwardly rectifying CI- channels by protein kinase A corrected by insertion of CFTR." Nature 358(6387): 581-4. Eisen, M . B. and P. O. Brown (1999). "DNA arrays for analysis of gene expression." Methods Enzvmol 303: 179-205. Emerson, J., M . Rosenfeld, et al. (2002). "Pseudomonas aeruginosa and other predictors of mortality and morbidity in young children with cystic fibrosis." Pediatr Pulmonol 34(2): 91-100.  150  Ernst, R. K., D. A. D'Argenio, et al. (2003). "Genome mosaicism is conserved but not unique in Pseudomonas aeruginosa isolates from the airways of young children with cystic fibrosis." Environ Microbiol 5(12): 1341-9. Ernst, R. K., E. C. Y i , etal. (1999). "Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa." Science 286(5444): 1561-5.  Errington, J., R. A. Daniel, et al. (2003). "Cytokinesis in bacteria." Microbiol Mol Biol Rev 67(1): 52-65, table of contents. Evertsz, E. M., J. Au-Young, et al. (2001). "Hybridization cross-reactivity within homologous gene families on glass cDNA microarrays." Biotechniques 31(5): 1182, 1184, 1186 passim. Fisher, L. M., K. Mizuuchi, etal. (1981). "Site-specific interaction of DNA gyrase with DNA." Proc Natl Acad Sci U S A 78(7): 4165-9. Fort, F. L. (1992). "Mutagenicity of quinolone antibacterials." Drug Saf 7(3): 214-22. Foster, P. L. (1993). "Adaptive mutation: the uses of adversity." Annu Rev Microbiol 47: 467504. Francois, P., M . Bento, et al. (2003). "Comparison of fluorescence and resonance light scattering for highly sensitive microarray detection of bacterial pathogens." J Microbiol Methods 55(3): 755-62. Fukuda, H., M . Hosaka, et al. (1995). "nfxC-type quinolone resistance in a clinical isolate of Pseudomonas aeruginosa." Antimicrob Agents Chemother 39(3): 790-2. Fung-Tome, J., B. Kolek, et al. (1993). "Ciprofloxacin-induced, low-level resistance to structurally unrelated antibiotics in Pseudomonas aeruginosa and methicillin-resistant Staphylococcus aureus." Antimicrob Agents Chemother 37(6): 1289-96. Gellert, M., K. Mizuuchi, et al. (1976). "DNA gyrase: an enzyme that introduces superhelical turns into DNA." Proc Natl Acad Sci U S A 73(11): 3872-6. Gibson, R. L., J. L. Burns, et al. (2003). "Pathophysiology and management of pulmonary infections in cystic fibrosis." Am J Respir Crit Care Med 168(8): 918-51. Gilbert, E. J. and A. Maxwell (1994). "The 24 kDa N-terminal sub-domain of the DNA gyrase B protein binds coumarin drugs." Mol Microbiol 12(3): 365-73. Giraud, A., I. Matic, et al. (2002). "Mutator bacteria as a risk factor in treatment of infectious diseases." Antimicrob Agents Chemother 46(3): 863-5.  151  Giwercman, B., P. A. Lambert, et al. (1990). "Rapid emergence of resistance in Pseudomonas aeruginosa in cystic fibrosis patients due to in-vivo selection of stable partially derepressed beta-lactamase producing strains." J Antimicrob Chemother 26(2): 247-59. Gmuender, H., K. Kuratli, et al. (2001). "Gene expression changes triggered by exposure of Haemophilus influenzae to novobiocin or ciprofloxacin: combined transcription and translation analysis." Genome Res 11(1): 28-42. Goldman, M. J., G. M . Anderson, et al. (1997). "Human beta-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis." Cell 88(4): 553-60. Gootz, T. D., Brighty, K. E. (1998). Chemistry and Mechanism of Action of the Quinolone Antibacterials. The Quinolones. V. T. Andriole. San Diego, Academic Press: 29-80. Gordon, P. M . and C. W. Sensen (2004). "Osprey: a comprehensive tool employing novel methods for the design of oligonucleotides for DNA sequencing and microarrays." Nucleic Acids Res 32(17): el33. Goss, W. A., W. H. Deitz, et al. (1965). "Mechanism of action of nalidixic acid on Escherichia coli. II. Inhibition of deoxyribonucleic acid synthesis." J Bacteriol 89: 1068-74. Gould, I. M., K. Milne, et al. (1991). "Ionic binding, adaptive resistance and post-antibiotic effect of netilmicin and ciprofloxacin." J Antimicrob Chemother 27(6): 741-8. Graeme-Cook, K. A., G. May, et al. (1989). "Osmotic regulation of porin expression: a role for DNA supercoiling." Mol Microbiol 3(9): 1287-94. Grimwood, K., M . To, et al. (1989). "Inhibition of Pseudomonas aeruginosa exoenzyme expression by subinhibitory antibiotic concentrations." Antimicrob Agents Chemother 33(1): 41-7. Grimwood, K., M . To, et al. (1989). "Subinhibitory antibiotics reduce Pseudomonas aeruginosa tissue injury in the rat lung model." J Antimicrob Chemother 24(6): 937-45. Gupta, V., A. Cherkassky, et al. (2003). "Directly labeled mRNA produces highly precise and unbiased differential gene expression data." Nucleic Acids Res 31(4): el3. Hambraeus, G., C. von Wachenfeldt, et al. (2003). "Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs." Mol Genet Genomics 269(5): 70614. Hancock, R. E.W. and D. P. Speert (2000). "Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and impact on treatment." Drug Resist Updat 3(4): 247-255. Hancock, R. E. W. (1997). "The bacterial outer membrane as a drug barrier." Trends Microbiol 5(1): 37-42.  152  Hancock, R. E. W., L. M . Mutharia, et al. (1983). "Pseudomonas aeruginosa isolates from patients with cystic fibrosis: a class of serum-sensitive, nontypable strains deficient in lipopolysaccharide O side chains." Infect Immun 42(1): 170-7. Haussler, S., B. Tummler, et al. (1999). "Small-colony variants of Pseudomonas aeruginosa in cystic fibrosis." Clin Infect Pis 29(3): 621-5. Haussler, S., I. Ziegler, et al. (2003). "Highly adherent small-colony variants of Pseudomonas aeruginosa in cystic fibrosis lung infection." J Med Microbiol 52(Pt 4): 295-301. Henry, R. L., C. M . Mellis, et al. (1992). "Mucoid Pseudomonas aeruginosa is a marker of poor survival in cystic fibrosis." Pediatr Pulmonol 12(3): 158-61. Herwig, R., A. O. Schmitt, et al. (2000). "Information theoretical probe selection for hybridisation experiments." Bioinformatics 16(10): 890-8. Hessner, M . J., X. Wang, et al. (2003). "Use of a three-color cPNA microarray platform to measure and control support-bound probe for improved data quality and reproducibility." Nucleic Acids Res 31(11): e60. Hiasa, H., P. O. Yousef, et al. (1996). "PNA strand cleavage is required for replication fork arrest by a frozen topoisomerase-quinolone-PNA ternary complex." J Biol Chem 271(42): 26424-9. Holloway, A. J., R. K. van Laar, et al. (2002). "Options available—from start to finish—for obtaining data from P N A microarrays II." Nat Genet 32(Suppl): 481-9. Holloway, B. W., H. Rossiter, et al. (1973). "Aeruginocin tolerant mutants of Pseudomonas aeruginosa." Genet Res 22(3): 239-53. Hooper, P. C. (1999). "Mechanisms of fluoroquinolone resistance." Prug Resist Updat 2(1): 3855. Hooper, P. C. (2001). "Emerging mechanisms of fluoroquinolone resistance." Emerg Infect Pis 7(2): 337-41. Hoshino, K., A. Kitamura, et al. (1994). "Comparison of inhibition of Escherichia coli topoisomerase IV by quinolones with PNA gyrase inhibition." Antimicrob Agents Chemother 38(11): 2623-7. Howard, B. M., R. J. Pinney, et al. (1993). "Function of the SOS process in repair of PNA damage induced by modern 4-quinolones." J Pharm Pharmacol 45(7): 658-62. Huber, W., A. Von Heydebreck, et al. (2002). "Variance stabilization applied to microarray data calibration and to the quantification of differential expression." Bioinformatics 18(Suppl 1): S96-S104.  153  Hueck, C. J. (1998). "Type III protein secretion systems in bacterial pathogens of animals and plants." Microbiol Mol Biol Rev 62(2): 379-433. Hutchison, M . L. and J. R. Govan (1999). "Pathogenicity of microbes associated with cystic fibrosis." Microbes Infect 1(12): 1005-14. Hutter, B., C. Schaab, et al. (2004). "Prediction of mechanisms of action of antibacterial compounds by gene expression profiling." Antimicrob Agents Chemother 48(8): 283844. Imundo, L., J. Barasch, et al. (1995). "Cystic fibrosis epithelial cells have a receptor for pathogenic bacteria on their apical surface [published erratum appears in Proc Natl Acad Sci U S A 1995 Nov 21 ;92(24): 11322]." Proc Natl Acad Sci U S A 92(7): 3019-23. Ishii, S. I., Y. Nishi, etal. (1965). "The fine structure of apyocin." J Mol Biol 13(2): 428-31. Isles, A., I. Maclusky, et al. (1984). "Pseudomonas cepacia infection in cystic fibrosis: an emerging problem." J Pediatr 104(2): 206-10. Jacob, F. (1954). "[Induced biosynthesis and mode of action of a pyocine, antibiotic produced by Pseudomonas aeruginosa.}." Ann Inst Pasteur (Paris) 86(2): 149-60. Jacobs, M.A., A. Alwood, et al. (2003). "Comprehensive transposon mutant library of Pseudomonas aeruginosa." Proc Natl Acad Sci U S A 100(24): 14339-44. Jakics, E. B., S. Iyobe, et al. (1992). "Occurrence of the nfxB type mutation in clinical isolates of Pseudomonas aeruginosa." Antimicrob Agents Chemother 36(11): 2562-5. Kageyama, M . (1964). "Studies of a pyocin. I. Physical and chemical properties." J Biochem (Tokyo) 55: 49-53. Karsten, S. L., V. M . Van Deerlin, et al. (2002). "An evaluation of tyramide signal amplification and archived fixed and frozen tissue in microarray gene expression analysis." Nucleic Acids Res 30(2): E4. Kato, J., Y. Nishimura, et al. (1990). "New topoisomerase essential for chromosome segregation in E. coli." CeU 63(2): 393-404. Kerem, B., J. M. Rommens, et al. (1989). "Identification of the cystic fibrosis gene: genetic analysis." Science 245(4922): 1073-80. Keren, I., N. Kaldalu, et al. (2004). "Persister cells and tolerance to antimicrobials." FEMS Microbiol Lett 230(1): 13-8. Kerr, B., M . A. Riley, et al. (2002). "Local dispersal promotes biodiversity in a real-life game of rock-paper-scissors." Nature 418(6894): 171-4.  154  Kerr, M . K. and G. A. Churchill (2001). "Experimental design for gene expression microarrays." Biostatistics 2(2): 183-201. Khan, T. Z., J. S. Wagener, et al. (1995). "Early pulmonary inflammation in infants with cystic fibrosis." Am J Respir Crit Care Med 151(4): 1075-82. Kirkup, B. C. and M . A. Riley (2004). "Antibiotic-mediated antagonism leads to a bacterial game of rock-paper-scissors in vivo." Nature 428(6981): 412-4. Koga, H., A. Itoh, et al. (1980). "Structure-activity relationships of antibacterial 6,7- and 7,8disubstituted l-alkyl-l,4-dihydro-4-oxoquinoline-3-carboxylic acids." J Med Chem 23(12): 1358-63. Kohler, T., S. F. Epp, etal. (1999). "Characterization of MexT, the regulator of the MexE-MexFOprN multidrug efflux system of Pseudomonas aeruginosa." J Bacteriol 181(20): 63005. Kohler, T., M . Michea-Hamzehpour, et al. (1997). "Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa." Mol Microbiol 23(2): 345-54. Kohler, T., M. Michea-Hamzehpour, et al. (1997). "Differential selection of multidrug efflux systems by quinolones in Pseudomonas aeruginosa." Antimicrob Agents Chemother 41(11): 2540-3. Kohler, T. and C. Pechere (2001). "In vitro selection of antibiotic resistance in Pseudomonas aeruginosa." Clin Microbiol Infect 7(Suppl 5): 7-10. Kohler, T. a. P., J. C. (1998). Bacterial Resistance to Quinolones. The Quinolones. V. T. Andriole. San Diego, CA, Academic Press: 117-142. Kuo, W. P., T. K. Jenssen, et al. (2002). "Analysis of matched mRNA measurements from two different microarray technologies." Bioinformatics 18(3): 405-12. Kuroda, K. and M . Kageyama (1981). "Comparative study of F-type pyocins of Pseudomonas aeruginosa." J Biochem (Tokyo) 89(6): 1721-36. Le Thomas, I., G. Couetdic, et al. (2001). "In vivo selection of a target/efflux double mutant of Pseudomonas aeruginosa by ciprofloxacin therapy." J Antimicrob Chemother 48(4): 553-5. LeClerc, J. E., B. Li, et al. (1996). "High mutation frequencies among Escherichia coli and Salmonella pathogens." Science 274(5290): 1208-11. Lesher, G. Y., E. J. Froelich, etal. (1962). "1,8-Naphthyridine derivatives. A new class of chemotherapeutic agents." J Med Pharm Chem 91: 1063-5.  155  Lewin, C. S., B. M . Howard, etal. (1989). "4-quinolones and the SOS response." JMed Microbiol 29(2): 139-44. Li, X. Z., H. Nikaido, et al. (1995). "Role of mexA-mexB-oprM m antibiotic efflux in Pseudomonas aeruginosa." Antimicrob Agents Chemother 39(9): 1948-53. Liang, P. and A. B. Pardee (1992). "Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction." Science 257(5072): 967-71. Livermore, D. M . (2003). "Bacterial resistance: origins, epidemiology, and impact." Clin Infect PJs36(Suppl 1): SI 1-23. Lockhart, D. J., H. Dong, et al. (1996). "Expression monitoring by hybridization to high-density oligonucleotide arrays." Nat Biotechnol 14(13): 1675-80. Lucas, A. M. a. L. C. D. (1994). "Principles underlying ciliary activity in the respiratory tract. II. A comparison of nasal clearance in man, monkey and other mammals." Arch Otolaryngol 230: 518-541. Luzar, M . A. and T. C. Montie (1985). "Avirulence and altered physiological properties of cystic fibrosis strains of Pseudomonas aeruginosa." Infect Immun 50(2): 572-6. Luzar, M . A., M. J. Thomassen, et al. (1985). "Flagella and motility alterations in Pseudomonas aeruginosa strains from patients with cystic fibrosis: relationship to patient clinical condition." Infect Immun 50(2): 577-82. Magni, A., A. Giordano, et al. (1994). "Effects of continuous exposure to ciprofloxacin on the outer membrane of P. aeruginosa." New Microbiol 17(4): 307-12. Mah, T. F., B. Pitts, et al. (2003). "A genetic basis for Pseudomonas aeruginosa biofdm antibiotic resistance." Nature 426(6964): 306-10. Majtan, V. and D. Hybenova (1996). "Inhibition of Pseudomonas aeruginosa alginate expression by subinhibitory concentrations of antibiotics." Folia Microbiol (Praha) 41(1): 61-4. Mamber, S. W., B. Kolek, et al. (1993). "Activity of quinolones in the Ames Salmonella TA102 mutagenicity test and other bacterial genotoxicity assays." Antimicrob Agents Chemother 37(2): 213-7. Manduchi, E., L. M . Scearce, et al. (2002). "Comparison of different labeling methods for twochannel high-density microarray experiments." Physiol Genomics 10(3): 169-79. Marians, K. J. (1996). Replication fork propogation. E.coli and Salmonella Cellular and Molecular Biology. F. C. Neidhardt. Washington, D C , American Society for Microbiology. 1: 749-763.  156  Martinez-Martinez, L., A. Pascual, et al. (1998). "Quinolone resistance from a transferable plasmid." Lancet 351(9105): 797-9. Massey, R. C , A. Buckling, etal. (2001). "Phenotypic switching of antibiotic resistance circumvents permanent costs in Staphylococcus aureus." Curr Biol 11(22): 1810-4. Matsui, H., B. R. Grubb, et al. (1998). "Evidence for periciliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airways disease." Cell 95(7): 1005-1015. Matsui, H., Y. Sano, et al. (1993). "Regulation of pyocin genes in Pseudomonas aeruginosa by positive (prtN) and negative (prtR) regulatory genes." J Bacteriol 175(5): 1257-63. Maxwell, A. (1993). "The interaction between coumarin drugs and DNA gyrase." Mol Microbiol 9(4): 681-6. McKenney, D., L. Willcock, et al. (1994). "Effect of sub-MIC antibiotics on the cell surface and extracellular virulence determinants of Pseudomonas cepacia." J Appl Bacteriol 76(2): 190-5. Meadow, P. M . and P.L. Wells. (1978). "Receptor sites for R-type pyocins and bacteriophage E79 in the core part of the lipopolysaccharide of Pseudomonas aeruginosa PAC1." Journal of General Microbiology 108: 339-343. Michel-Briand, Y. and C. Baysse (2002). "The pyocins of Pseudomonas aeruginosa." Biochimie 84(5-6): 499-510. Miller, R. V. and T. A. Kokjohn (1988). "Expression of the recA gene of Pseudomonas aeruginosa PAO is inducible by DNA-damaging agents." J Bacteriol 170(5): 2385-7. Moreau, N. J., H. Robaux, et al. (1990). "Inhibitory effects of quinolones on pro- and eucaryotic DNA topoisomerases I and II." Antimicrob Agents Chemother 34(10): 1955-60. Morse, S. A., B. V. Jones, etal. (1980). "Pyocin inhibition ofNeisseria gonorrhoeae: mechanism of action." Antimicrob Agents Chemother 18(3): 416-23. Mouneimne, H., J. Robert, et al. (1999). "Type II topoisomerase mutations in ciprofloxacinresistant strains of Pseudomonas aeruginosa." Antimicrob Agents Chemother 43(1): 626. Moxon, E. R., P. B. Rainey, et al. (1994). "Adaptive evolution of highly mutable loci in pathogenic bacteria." Curr Biol 4(1): 24-33. Mulvey, M . A., Y. S. Lopez-Boado, etal. (1998). "Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli." Science 282(5393): 1494-7.  157  Nakayama, K., K. Takashima, et al. (2000). "The R-type pyocin of Pseudomonas aeruginosa is related to P2 phage, and the F-type is related to lambda phage." Mol Microbiol 38(2): 213-31. Negri, M. C , M . I. Morosini, et al. (2002). "Very low cefotaxime concentrations select for hypermutable Streptococcus pneumoniae populations." Antimicrob Agents Chemother 46(2): 528-30. Nikaido, H. (1998). "The role of outer membrane and efflux pumps in the resistance of gramnegative bacteria. Can we improve drug access?" Drug Resist Updat 1: 93-98. Nikaido, H., K. Nikaido, et al. (1991). "Identification and characterization of porins in Pseudomonas aeruginosa." J Biol Chem 266(2): 770-9. Nimmakayalu, M., O. Henegariu, et al. (2000). "Simple method for preparation of fluor/haptenlabeled dUTP." Biotechniques 28(3): 518-22. Nixon, G. M., D. S. Armstrong, et al. (2001). "Clinical outcome after early Pseudomonas aeruginosa infection in cystic fibrosis." J Pediatr 138(5): 699-704. Noone, P. G. and M . Knowles (1999). Standard therapy of CF lung disease. Cystic fibrosis in adults. J. Yankaskas and M . Knowles. Philadelphia, PA, Lippincott-Raven: 145-175. Ochsner, U. A., P. J. Wilderman, et al. (2002). "GeneChip expression analysis of the iron starvation response in Pseudomonas aeruginosa: identification of novel pyoverdine biosynthesis genes." Mol Microbiol 45(5): 1277-87. Ohkawa, I., S. Shiga, et al. (1980). "Effect of iron concentration in the growth medium on the sensitivity of Pseudomonas aeruginosa to pyocin S2." J Biochem (Tokyo) 87(1): 323-31. Ohsumi, M., T. Shinomiya, et al. (1980). "Comparative study on R-type pyocins of Pseudomonas aeruginosa." J Biochem (Tokyo) 87(4): 1119-25. Okawa, I., B. Maruo, etal. (1975). "Preferential inhibition of lipid synthesis by the bacteriocin pyocin S2." J Biochem (Tokyo) 78(1): 213-23. Oliver, A., F. Baquero, et al. (2002). "The mismatch repair system (mutS, mutL and uvrD genes) in Pseudomonas aeruginosa: molecular characterization of naturally occurring mutants." Mol Microbiol 43(6): 1641-50. Oliver, A., R. Canton, et al. (2000). "High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection." Science 288(5469): 1251-4. Park, P. J., Y. A. Cao, et al. (2004). "Current issues for DNA microarrays: platform comparison, double linear amplification, and universal RNA reference." J Biotechnol 112(3): 225-45.  158  Parret, A. and R. De Mot (2000). "Novel bacteriocins with predicted tRNase and pore-forming activities in Pseudomonas aeruginosa PAOl." Mol Microbiol 35(2): 472-3. Pato, M . L., M . M . Howe, et al. (1990). "A DNA gyrase-binding site at the center of the bacteriophage Mu genome is required for efficient replicative transposition." Proc Natl Acad Sci U S A 87(22): 8716-20. Pedersen, S. S., N . Hoiby, et al. (1992). "Role of alginate in infection with mucoid Pseudomonas aeruginosa in cystic fibrosis." Thorax 47(1): 6-13. Peng, H. and K. J. Marians (1993). "Escherichia coli topoisomerase IV. Purification, characterization, subunit structure, and subunit interactions." J Biol Chem 268(32): 24481-90. Peng, H. and K. J. Marians (1995). "The interaction of Escherichia coli topoisomerase IV with DNA." J Biol Chem 270(42): 25286-90. Phillips, I. (1987). "Bacterial mutagenicity and the 4-quinolones." J Antimicrob Chemother 20(6): 771-3. Phillips, I., E. Culebras, et al. (1987). "Induction of the SOS response by new 4-quinolones." J Antimicrob Chemother 20(5): 631-8. Pier, G. B. (1985). "Pulmonary disease associated with Pseudomonas aeruginosa in cystic fibrosis: current status of the host-bacterium interaction." J Infect Pis 151(4): 575-80. Pier, G. B., M . Grout, et al. (1996). "Role of mutant CFTR in hypersusceptibility of cystic fibrosis patients to lung infections." Science 271(5245): 64-7. Pina, S. E. and S. J. Mattingly (1997). "The role of fluoroquinolones in the promotion of alginate synthesis and antibiotic resistance in Pseudomonas aeruginosa." Curr Microbiol 35(2): 103-8. Poirel, L., T. Lambert, et al. (2001). "Characterization of Class 1 integrons from Pseudomonas aeruginosa that contain the bla(VIM-2) carbapenem-hydrolyzing beta-lactamase gene and of two novel aminoglycoside resistance gene cassettes." Antimicrob Agents Chemother 45(2): 546-52. Poole, K., N. Gotoh, et al. (1996). "Overexpression of the mexC-mexD-oprJ efflux operon in nfxB-type multidrug-resistant strains of Pseudomonas aeruginosa." Mol Microbiol 21(4): 713-24. Poschet, J. F., J. C. Boucher, et al. (2001). "Molecular basis for defective glycosylation and Pseudomonas pathogenesis in cystic fibrosis lung." Proc Natl Acad Sci U S A 98(24): 13972-7.  159  Postier, B. L., H. L. Wang, et al. (2003). "The construction and use of bacterial DNA microarrays based on an optimized two-stage PCR strategy." BMC Genomics 4(1): 23. Power, E. G. and I. Phillips (1993). "Correlation between umuC induction and Salmonella mutagenicity assay for quinolone antimicrobial agents." FEMS Microbiol Lett 112(3): 251-4. Prince, A. (1992). "Adhesins and receptors of Pseudomonas aeruginosa associated with infection of the respiratory tract." Microb Pathog 13(4): 251-60. Proctor, D. F. (1977). "The upper airways. I. Nasal physiology and defense of the lungs." Am Rev Respir Pis 115(1): 97-129. Quackenbush, J. (2002). "Microarray data normalization and transformation." Nat Genet 32(Suppl): 496-501. Ramakrishnan, R., P. Porris, et al. (2002). "An assessment of Motorola CodeLink microarray performance for gene expression profiling applications." Nucleic Acids Res 30(7): e30. Ramsey, B. W., M . S. Pepe, et al. (1999). "Intermittent administration of inhaled tobramycin in patients with cystic fibrosis. Cystic Fibrosis Inhaled Tobramycin Study Group." N Engl J Med 340(1): 23-30. Ratjen, F., G. Comes, et al. (2001). "Effect of continuous antistaphylococcal therapy on the rate of P. aeruginosa acquisition in patients with cystic fibrosis." Pediatr Pulmonol 31(1): 136. Ravizzola, G., F. Pirali, et al. (1987). "Reduced virulence in ciprofloxacin-resistant variants of Pseudomonas aeruginosa strains." J Antimicrob Chemother 20(6): 825-9. Riccio, M . L., J. P. Pocquier, et al. (2003). "Novel 3-N-aminoglycoside acetyltransferase gene, aac(3)-Ic, from a Pseudomonas aeruginosa integron." Antimicrob Agents Chemother 47(5): 1746-8. Richter, A., C. Schwager, et al. (2002). "Comparison of fluorescent tag P N A labeling methods used for expression analysis by P N A microarrays." Biotechniques 33(3): 620-8, 630. Rimour, S., P. Hill, et al. (2004). "GoArrays: highly dynamic and efficient microarray probe design." Bioinformatics 5: 5. Riordan, J. R., J. M . Rommens, et al. (1989). "Identification of the cystic fibrosis gene: cloning and characterization of complementary PNA." Science 245(4922): 1066-73. Romling, U., B. Fiedler, et al. (1994). "Epidemiology of chronic Pseudomonas aeruginosa infections in cystic fibrosis." J Infect Pis 170(6): 1616-21.  160  Rommens, J. M., M . C. Iannuzzi, et al. (1989). "Identification of the cystic fibrosis gene: chromosome walking and jumping." Science 245(4922): 1059-65. Saiman, L. and A. Prince (1993). "Pseudomonas aeruginosa pili bind to asialoGMl which is increased on the surface of cystic fibrosis epithelial cells." J Clin Invest 92(4): 1875-80. Salama, N., K. Guillemin, et al. (2000). "A whole-genome microarray reveals genetic diversity among Helicobacter pylori strains." Proc Natl Acad Sci U S A 97(26): 14668-73. Sano, Y. (1993). "The inherent DNase of pyocin AP41 causes breakdown of chromosomal DNA." J Bacteriol 175(3): 912-5. Sano, Y. and M . Kageyama (1981). "Purification and properties of an S-type pyocin, pyocin AP41." J Bacteriol 146(2): 733-9. Sano, Y., H. Matsui, et al. (1993). "Molecular structures and functions of pyocins SI and S2 in Pseudomonas aeruginosa." J Bacteriol 175(10): 2907-16. Schembri, M . A., K. Kjaergaard, et al. (2003). "Global gene expression in Escherichia coli biofilms." Mol Microbiol 48(1): 253-67. Schena, M., D. Shalon, et al. (1995). "Quantitative monitoring of gene expression patterns with a complementary DNA microarray." Science 270(5235): 467-70. Schroeder, T. H., N. Reiniger, et al. (2001). "Transgenic cystic fibrosis mice exhibit reduced early clearance of Pseudomonas aeruginosa from the respiratory tract." J Immunol 166(12): 7410-8. Schurr, M . J., H. Yu, et al. (1996). "Control of AlgU, a member of the sigma E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis." J Bacteriol 178(16): 4997-5004. Schuster, M., C. P. Lostroh, et al. (2003). "Identification, timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis." J Bacteriol 185(7): 2066-79. Shapiro, J. A. (1997). "Genome organization, natural genetic engineering and adaptive mutation." Trends Genet 13(3): 98-104. Shaw, K. J., N. Miller, et al. (2003). "Comparison of the changes in global gene expression of Escherichia coli induced by four bactericidal agents." J Mol Microbiol Biotechnol 5(2): 105-22. Shaw, K. J. and B. J. Morrow (2003). "Transcriptional profiling and drug discovery." Curr Opin Pharmacol 3(5): 508-12.  161  Shen, L. L. (1993). Quinolone-DNA Interaction. Quinolone Antimicrobial Agents. D. C. a. W. Hooper, J. S. Washington, DC, American Society for Microbiology: 77-95. Shinomiya, T., M . Osumi, et al. (1975). "Defective pyocin particles produced by some mutant strains of Pseudomonas aeruginosa." J Bacteriol 124(3): 1508-21. Shinomiya, T., S. Shiga, et al. (1983). "Genetic determinant of pyocin R2 in Pseudomonas aeruginosa PAO. I. Localization of the pyocin R2 gene cluster between the trpCD and trpE genes." Mol Gen Genet 189(3): 375-81. Sinclair, M. I. and B. W. Holloway (1982). "A chromosomally located transposon in Pseudomonas aeruginosa." J Bacteriol 151(2): 569-79. Singh, P. K., A. L. Schaefer, et al. (2000). "Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms.".Nature 407(6805): 762-764. Slonim, D. K. (2002). "From patterns to pathways: gene expression data analysis comes of age." Nat Genet 32(Suppl): 502-8. Smith, J. J., P. H. Karp, et al. (1994). "Defective fluid transport by cysticfibrosisairway epithelia." J Clin Invest 93(3): 1307-11. Smith, J. J., S. M. Travis, et al. (1996). "Cystic fibrosis airway epithelia fail to kill bacteria because of abnormal airway surface fluid." Cell 85(2): 229-36. Sonstein, S. A. and J. C. Burnham (1993). "Effect of low concentrations of quinolone antibiotics on bacterial virulence mechanisms." Diagn Microbiol Infect Pis 16(4): 277-89. Southern, E., K. Mir, etal. (1999). "Molecular interactions on microarrays." Nat Genet 21(1 Suppl): 5-9. Spencer, D. H., A. Kas, et al. (2003). "Whole-genome sequence variation among multiple isolates of Pseudomonas aeruginosa." J Bacteriol 185(4): 1316-25. Spoering, A. L. and K. Lewis (2001). "Biofilms and planktonic cells of Pseudomonas aeruginosa have similar resistance to killing by antimicrobials." J Bacteriol 183(23): 6746-51. Stears, R. L., R. C. Getts, et al. (2000). "A novel, sensitive detection system for high-density microarrays using dendrimer technology." Physiol Genomics 3(2): 93-9. Stillman, B. A. and J. L. Tonkinson (2001). "Expression microarray hybridization kinetics depend on length of the immobilized DNA but are independent of immobilization substrate." Anal Biochem 295(2): 149-57.  162  Stomakhin, A. A., V. A. Vasiliskov, et al. (2000). "DNA sequence analysis by hybridization with oligonucleotide microchips: MALDI mass spectrometry identification of 5mers contiguously stacked to microchip oligonucleotides." Nucleic Acids Res 28(5): 1193-8. Stover, C. K., X. Q. Pham, et al. (2000). "Complete genome sequence of Pseudomonas aeruginosa PAOl, an opportunistic pathogen." Nature 406(6799): 959-64. Stutman, H. R., J. M . Lieberman, et al. (2002). "Antibiotic prophylaxis in infants and young children with cystic fibrosis: a randomized controlled trial." J Pediatr 140(3): 299-305. Stutts, M . J., B. C. Rossier, et al. (1997). "Cystic fibrosis transmembrane conductance regulator inverts protein kinase A-mediated regulation of epithelial sodium channel single channel kinetics." J Biol Chem 272(22): 14037-40. Sugino, A., C. L. Peebles, et al. (1977). "Mechanism of action of nalidixic acid: purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme." Proc Natl Acad Sci U S A 74(11): 4767-71. Taylor, R. F., M . E. Hodson, et al. (1992). "Auxotrophy of Pseudomonas aeruginosa in cystic fibrosis." FEMS Microbiol Lett 71(3): 243-6. Taylor, R. F., M . E. Hodson, et al. (1993). "Adult cystic fibrosis: association of acute pulmonary exacerbations and increasing severity of lung disease with auxotrophic mutants of Pseudomonas aeruginosa." Thorax 48(10): 1002-5. Thomas, S. R., A. Ray, et al. (2000). "Increased sputum amino acid concentrations and auxotrophy of Pseudomonas aeruginosa in severe cystic fibrosis lung disease." Thorax 55(9): 795-7. Thomassen, M . J., C. A. Demko, et al. (1987). "Cystic fibrosis: a review of pulmonary infections and interventions." Pediatr Pulmonol 3(5): 334-51. Thomassen, M . J., C. A. Demko, et al. (1985). "Pseudomonas cepacia colonization among patients with cystic fibrosis. A new opportunist." Am Rev Respir Pis 131(5): 791-6. Trancassini, M., M . I. Brenciaglia, et al. (1992). "Modification of Pseudomonas aeruginosa virulence factors by sub-inhibitory concentrations of antibiotics." J Chemother 4(2): 7881. Tsui, L. C , M . Buchwald, et al. (1985). "Cystic fibrosis locus defined by a genetically linked polymorphic P N A marker." Science 230(4729): 1054-7. Uratani, Y. and T. Hoshino (1984). "Pyocin R l inhibits active transport in Pseudomonas aeruginosa and depolarizes membrane potential." J Bacteriol 157(2): 632-6.  163  Utaida, S., P. M . Dunman, et al. (2003). "Genome-wide transcriptional profiling of the response of Staphylococcus aureus to cell-wall-active antibiotics reveals a cell-wall-stress stimulon." Microbiology 149(Pt 10): 2719-32. Velculescu, V. E., L. Zhang, et al. (1995). "Serial analysis of gene expression." Science 270(5235): 484-7. Vezina, G. and R. C. Levesque (1991). "Molecular characterization of the class II multiresistance transposable element Tnl403 from Pseudomonas aeruginosa." Antimicrob Agents Chemother 35(2): 313-21. Visser, M . R., H. Beumer, et al. (1993). "Changes in adherence of respiratory pathogens to HEp2 cells induced by subinhibitory concentrations of sparfloxacin, ciprofloxacin, and trimethoprim." Antimicrob Agents Chemother 37(4): 885-8. von Gotz, F., S. Haussler, et al. (2004). "Expression analysis of a highly adherent and cytotoxic small colony variant of Pseudomonas aeruginosa isolated from a lung of a patient with cysticfibrosis."J Bacteriol 186(12): 3837-47. Wagner, V. E., D. Bushnell, et al. (2003). "Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment." J Bacteriol 185(7): 2080-95. Wainwright, B. J., P. J. Scambler, et al. (1985). "Localization of cysticfibrosislocus to human chromosome 7cen-q22." Nature 318(6044): 384-5. Walters, M . C , 3rd, F. Roe, et al. (2003). "Contributions of antibiotic penetration, oxygen limitation, and low metabolic activity to tolerance of Pseudomonas aeruginosa biofilms to ciprofloxacin and tobramycin." Antimicrob Agents Chemother 47(1): 317-23. Walters, R. N., L. J. Piddock, et al. (1989). "The effect of mutations in the SOS response on the kinetics of quinolone killing." J Antimicrob Chemother 24(6): 863-73. West, S. E., L. Zeng, et al. (2002). "Respiratory infections with Pseudomonas aeruginosa in children with cystic fibrosis: early detection by serology and assessment of risk factors." Jama 287(22): 2958-67. White, R., S. Woodward, et al. (1985). "A closely linked genetic marker for cystic fibrosis." Nature 318(6044): 382-4. Whiteley, M., M . G. Bangera, et al. (2001). "Gene expression in Pseudomonas aeruginosa biofilms." Nature 413(6858): 860-4. Wiener, M., D. Freymann, et al. (1997). "Crystal structure of colicin la." Nature 385(6615): 4614.  164  Wilmott, R. W., J. T. Kassab, et al. (1990). "Increased levels of interleukin-1 in bronchoalveolar washings from children with bacterial pulmonary infections." Am Rev Respir Pis 142(2): 365-8. Wilson, M., J. PeRisi, et al. (1999). "Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization." Proc Natl Acad Sci U S A 96(22): 12833-8. Wolfgang, M . C , B. R. Kulasekara, et al. (2003). "Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa." Proc Natl Acad Sci U S A 100(14): 8484-9. Wolfson, J. S. and P. C. Hooper (1985). "The fluoroquinolones: structures, mechanisms of action and resistance, and spectra of activity in vitro." Antimicrob Agents Chemother 28(4): 581-6. Yamamoto, K. R., B. M . Alberts, et al. (1970). "Rapid bacteriophage sedimentation in the presence of polyethylene glycol and its application to large-scale virus purification." Virology 40(3): 734-44. Yang, Y. H. and T. Speed (2002). "Pesign issues for cPNA microarray experiments." Nat Rev Genet 3(8): 579-88. Yassien, M., N. Khardori, et al. (1995). "Modulation of biofilms of Pseudomonas aeruginosa by quinolones." Antimicrob Agents Chemother 39(10): 2262-8. Ye, R. W., W. Tao, et al. (2000). "Global gene expression profiles of Bacillus subtilis grown under anaerobic conditions." J Bacteriol 182(16): 4458-65. Yonezawa, M., M. Takahata, et al. (1995). "PNA gyrase gyrA mutations in quinolone-resistant clinical isolates of Pseudomonas aeruginosa." Antimicrob Agents Chemother 39(9): 1970-2. Yoshida, H., M . Bogaki, et al. (1990). "Quinolone resistance-determining region in the P N A gyrase gyrA gene of Escherichia coli." Antimicrob Agents Chemother 34(6): 1271-2. Yuen, T., E. Wurmbach, et al. (2002). "Accuracy and calibration of commercial oligonucleotide and custom cPNA microarrays." Nucleic Acids Res 30(10): e48. Yui-Furihata, C. (1972). "Structure of pyocin R. II. Subunits of sheath." J Biochem (Tokyo) 72(1): 1-10. Zabner, J., J. J. Smith, et al. (1998). "Loss of CFTR chloride channels alters salt absorption by cystic fibrosis airway epithelia in vitro." Mol Cell 2(3): 397-403.  165  Zhanel, G. G., S. O. Kim, et al. (1993). "Effect of subinhibitory concentrations of Ciprofloxacin and gentamicin on the adherence of Pseudomonas aeruginosa to Vero cells and voided uroepithelial cells." Chemotherapy 39(2): 105-11. Zierdt, C. H. and P. J. Schmidt (1964). "Dissociation in Pseudomonas aeruginosa." J Bacteriol 87(5): 1003-10. Ziermann, R., B. Bartlett, etal. (1994). "Functions involved in bacteriophage P2-induced host cell lysis and identification of a new tail gene." J Bacteriol 176(16): 4974-84. Ziha-Zarifi, I., C. Llanes, et al. (1999). "In vivo emergence of multidrug-resistant mutants of Pseudomonas aeruginosa overexpressing the active efflux system MexA-MexB-OprM." Antimicrob Agents Chemother 43(2): 287-91.  166  A P P E N D I X I: Sample data tracking of amplicon uniqueness, size and concentration for all reading frames used in P.  aeruginosa  custom DNA microarray  167  UBC_PlateNumber UBC_BarCode MasterCoordinate ORF_Name ProductLength GelName UBC 01 AR0060 A01 PA0001 747 PG01CL13 UBC 01 AR0060 A02 PA0011 797 PG01CL13 UBC 01 PA0021 AR0060 A03 709 PG01CL13 A04 PA0032 711 UBC_01 AR0060 PG01CL13 A05 354 PG01CL13 UBC_01 AR0060 PA0046 UBC 01 AR0060 A06 PA0065 645 PG01CL13 UBC 01 A07 AR0060 PA0075 718 PG01CL13 UBC 01 AR0060 A08 PA0090 715 PG01CL13 UBC_01 AR0060 A09 PA0101 710 PG01CL13 UBC 01 AR0060 A10 PA0111 579 PG01CL13 UBC_01 AR0060 A11 PA0123 734 PG01CL13 UBC 01 A12 AR0060 PA0143 656 PG01CL13 UBC_01 AR0060 B01 PA0002 717 PG01CL13 B02 PA0012 267 UBC_01 AR0060 PG01CL13 UBC_01 AR0060 B03 PA0023 667 PG01CL13 UBC_01 B04 PA0033 366 PG01CL13 AR0060 UBC 01 384 PG01CL13 AR0060 B05 PA0048 UBC 01 AR0060 B06 PA0066 543 PG01CL13 B07 791 UBC 01 AR0060 PA0078 PG01CL13 UBC 01 AR0060 B08 PA0092 285 PG01CL13 UBC 01 AR0060 B09 PA0102 631 PG01CL13 PA0112 UBC 01 AR0060 B10 608 PG01CL13 B11 PA0124 282 UBC_01 AR0060 PG01CL13 B12 PG01CL13 UBC_01 AR0060 PA0146 775 771 PG01CL13 UBC_01 AR0060 C01 PA0003 C02 PA0014 PG01CL13 UBC_01 AR0060 273 UBC 01 PA0024 PG01CL13 AR0060 C03 630 C04 UBC 01 AR0060 PA0035 750 PG01CL13 UBC_01 AR0060 C05 PA0049 697 PG01CL13 AR0060 C06 PA0067 671 PG01CL13 UBC_01 UBC 01 C07 797 AR0060 PA0079 PG01CL13 UBC_01 AR0060 C08 PA0093 774 PG01CL13 UBC 01 AR0060 C09 PA0103 733 PG01CL13 C10 PA0113 773 PG01CL13 UBC_01 AR0060 UBC_01 AR0060 C11 PA0127 501 PG01CL13 C12 PA0147 765 PG01CL13 UBC_01 AR0060 UBC_01 AR0060 D01 PA0004 768 PG01CL13 D02 PA0015 318 PG01CL13 UBC_01 AR0060 772 UBC 01 AR0060 D03 PA0026 PG01CL13 UBC_01 AR0060 D04 PA0036 800 PG01CL13 UBC_01 AR0060 D05 PA0050 141 . PG01CL13 UBC 01 AR0060 D06 PA0069 788 PG01CL13 722 UBC_01 AR0060 D07 PA0081 PG01CL13 PA0094 435 PG01CL13 UBC_01 AR0060 D08 PA0105 750 PG01CL13 UBC_01 AR0060 D09 UBC 01 AR0060 D10 PA0114 610 PG01CL13  LaneNumber ExcludedWell 2 FALSE FALSE 3 4 FALSE FALSE 5 FALSE 6 7 FALSE 8 FALSE FALSE 9 FALSE 10 11 FALSE 12 FALSE FALSE 13 14 FALSE FALSE 15 FALSE 16 FALSE 17 18 FALSE 19 FALSE FALSE 20 21 FALSE 22 FALSE 23 FALSE 24 FALSE 25 FALSE 28 FALSE 29 FALSE 30 FALSE FALSE 31 32 FALSE 33 FALSE 34 FALSE FALSE 35 FALSE 36 37 FALSE FALSE 38 39 FALSE FALSE 40 41 FALSE 42 FALSE FALSE 43 FALSE 44 FALSE 45 FALSE 46 47 FALSE 48 FALSE FALSE 49  ExclusionCriteria  UBC 01 UBC 01 UBC_01 UBC_01 UBC_01 UBC_01 UBC_01 UBC 01 UBC 01 UBC_01 UBC 01 UBC_01 UBC 01 UBC_01 UBC 01 UBC_01 UBC_01 UBC 01 UBC_01 UBC_01 UBC_01 UBC_01 UBC_01 UBC 01 UBC 01 UBC 01 UBC 01 UBC_01 UBC_01 UBC 01 UBC_01 UBC_01 UBC_01 UBC 01 UBC_01 UBC_01 UBC_01 UBC 01 UBC_01 UBC 01 UBC 01 UBC 01 UBC 01 UBC_01 UBC_01 UBC_01 UBC_01  AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060' AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060 AR0060. AR0060 AR0060 AR0060 AR0060  D11 D12 E01 E02 E03 E04 E05 E06 E07 E08 E09 E10 E11 E12 F01 F02 F03 F04 F05 F06 F07 F08 F09 F10 F11 F12 G01 G02 G03 G04 G05 G06 G07 G08 G09 G10 G11 G12 H01 H02 H03 H04 H05 H06 H07 H08 H09  PA0130 PA0148 PA0006 PA0016 PA0027 PA0038 PA0051 PA0070 PA0082 PA0097 PA0106 PA0117 PA0132 PA0149 PA0007 PA0018 PA0029 PA0041 PA0053 PA0071 PA0084 PA0098 PA0108 PA0119 PA0133 PA0150 PA0008 PA0019 PA0030 PA0042 PA0054 PA0072 PA0088 PA0099 PA0109 PA0120 P A0136 PA0151 PA0009 PA0020 PA0031 PA0045 PA0063 PA0074 PA0089 PA0100 PA0110  800 724 537 730 751 216 793 762 729 719 773 718 613 546 775 719 764 779 255 764 641 790 726 695 718 786 707 507 644 396 549 723 694 620 210 675 635 685 701 620 774 687 624 709 696 708 785  PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13 PG01CL13  50 51 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100  FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  LOW PRODUCT YIELD (<50ng/ul)  LOW PRODUCT YIELD (<50ng/ul)  o  UBC_01 UBC_01 UBC_01 UBC_02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC 02 UBC_02 UBC_02 UBC 02 UBC 02 UBC 02 UBC 02 UBC 02 UBC 02 UBC_02 UBC 02 UBC 02 UBC 02 UBC_02 UBC_02 UBC 02 UBC_02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02 UBC 02 UBC_02 UBC_02 UBC 02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02  AR0060 AR0060 AR0060 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071  H10 H11 H12 A01 A02 A03 A04 A05 A06 A07 A08 A09 A10 A11 A12 B01 B02 B03 B04 B05 B06 B07 B08 B09 B10 B11 B12 C01 C02 C03 C04 C05 C06 C07 C08 C09 C10 C11 C12 D01 D02 D03 D04 D05 D06 D07 D08  PA0121 PA0137 PA0153 PA0155 PA0172 PA0187 PA0202 PA0214 PA0226 PA0239 PA0252 PA0261 PA0276 PA0290 PA0305 PA0156 PA0175 PA0190 PA0203 PA0215 PA0227 PA0240 PA0254 PA0262 PA0277 PA0291 PA0307 PA0159 PA0176 PA0194 PA0204 PA0216 PA0228 PA0241 PA0255 PA0265 PA0278 PA0293 PA0308 PA0161 PA0178 PA0195 PA0205 PA0217 PA0230 PA0243 PA0256  721 744 701 743 668 800 627 766 763 667 288 498 516 798 758 655 757 725 628 405 783 779 729 693 695 797 612 732 785 657 734 716 686 673 611 606 691 660 715 153 684 746 609 747 701 669 799  PG01CL13 PG01CL13 PG01CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 . UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13  101 102 103 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47  FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE  BLANK LANE  INCORRECT BAND SIZE  BLANK LANE  UBC 02 UBC 02 UBC 02 UBC_02 UBC_02 UBC_02 U B C 02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC 02 UBC_02 UBC 02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC_02 UBC 02 UBC_02 UBC_02 UBC 02 UBC_02 UBC_02 UBC_02 UBC_02  AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071 AR0071  D09 D10 D11 D12 E01 E02 E03 E04 E05 E06 E07 E08 E09 E10 E11 E12 F01 F02 F03 F04 F05 F06 F07 F08 F09 F10 F11 F12 G01 G02 G03 G04 G05 G06 G07 G08 G09 G10 G11 G12 H01 H02 H03 H04 H05 H06 H07  PA0268 PA0282 PA0297 PA0309 PA0162 PA0180 PA0196 PA0207 PA0219 PA0231 PA0244 PA0257 PA0269 PA0284 PA0298 PA0313 PA0164 PA0182 PA0197 PA0208 PA0222 PA0233 PA0246 PA0258 PA0272 PA0285 PA0299 PA0314 PA0165 PA0183 PA0198 PA0209 PA0223 PA0234 PA0247 PA0259 PA0274 PA0286 PA0300 PA0316 PA0169 PA0184 PA0200 PA0211 PA0224 PA0237 PA0248  762 658 687 655 793 752 780 769 749 771 693 774 438 183 770 668 800 753 710 780 703 601 650 186 800 691 703 627 702 643 720 767 712 763 800 749 606 793 792 724 644 757 213 778 783 707 715  UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13  48 49 50 51 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98  FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  LOW PRODUCT YIELD (<50ng/ul)  —1  to  UBC_02 UBC_02 UBC_02 UBC 02 UBC 02 UBC 03 UBC_03 UBC_03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC_03 UBC 03 UBC 03 UBC 03 UBC 03 UBC 03 UBC_03 UBC_03 UBC 03 UBC 03 UBC 03 UBC_03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC_03 UBC.03 UBC_03 UBC 03 UBC_03 UBC_03 UBC 03 UBC 03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03  AR0071 AR0071 AR0071 AR0071 AR0071 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009  H08 H09 H10 H11 H12 A01 A02 A03 A04 A05 A06 A07 A08 A09 A10 A11 A12 B01 B02 B03 B04 B05 B06 B07 B08 B09 B10 B11 B12 C01 C02 C03 C04 C05 C06 C07 C08 C09 C10 C11 C12 D01 D02 D03 D04 D05 D06  PA0260 PA0275 PA0287 PA0304 PA0317 PA0318 PA0331 PA0342 PA0357 PA0368 PA0383 PA0399 PA0411 PA0429 PA0437 PA0453 PA0470 PA0320 PA0334 PA0343 PA0359 PA0370 PA0385 PA0400 PA0413 PA0430 PA0438 PA0455 PA0471 PA0322 PA0336 PA0346 PA0360 PA0372 PA0388 PA0401 PA0414 PA0431 PA0439 PA0456 PA0472 PA0323 PA0337 PA0347 PA0361 PA0373 PA0390  755 661 669 705 643 625 659 740 645 760 653 623 710 716 778 668 679 351 695 798 345 597 324 682 607 780 773 687 749 734 480 363 640 800 420 702 777 555 613 210 519 796 643 727 774 773 642  UB02CL13 UB02CL13 UB02CL13 UB02CL13 UB02CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13  99 100 101 102 103 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45  FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC 03 UBC 03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC_03 UBC 03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC 03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC 03 UBC_03 UBC_03  AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009  D07 D08 D09 D10 D11 D12 E01 E02 E03 E04 E05 E06 E07 E08 E09 E10 E11 E12 F01 F02 F03 F04 F05 F06 F07 F08 F09 F10 F11 F12 G01 G02 G03 G04 G05 G06 G07 G08 G09 G10 G11 G12 H01 H02 H03 H04 H05  PA0402 PA0416 PA0432 PA0440 PA0461 PA0473 PA0326 PA0338 PA0348 PA0363 PA0375 PA0393 PA0403 PA0424 PA0433 PA0441 PA0462 PA0477 PA0327 PA0339 PA0349 PA0364 PA0378 PA0395 PA0406 PA0425 PA0434 PA0442 PA0463 PA0478 PA0328 PA0340 PA0353 PA0366 PA0381 PA0396 PA0407 PA0426 PA0435 PA0443 PA0464 PA0479 PA0329 PA0341 PA0356 PA0367 PA0382  756 696 800 773 698 637 650 800 698 480 644 680 513 444 435 718 705 785 788 704 722 757 691 788 791 800 783 117 653 477 800 800 758 611 772 638 687 797 624 714 617 714 333 766 730 639 672  PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13  46 47 48 49 50 51 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96  FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  BLANK LANE  UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_03 UBC_04 UBC 04 UBC_04 UBC 04 UBC_04 UBC 04 UBC_04 UBC 04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC 04 UBC_04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC_04 UBC 04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC 04  AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0009 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010  H06 H07 H08 H09 H10 H11 H12 A01 A02 A03 A04 A05 A06 A07 A08 A09 A10 A11 A12 B01 B02 B03 B04 B05 B06 B07 B08 B09 B10 B11 B12 C01 C02 C03 C04 C05 C06 C07 C08 C09 C10 C11 C12 D01 D02 D03 D04  PA0397 PA0408 PA0428 PA0436 PA0452 PA0465 PA0480 PA0482 PA0495 PA0509 PA0529 PA0543 PA0554 PA0568 PA0581 PA0595 PA0606 PA0618 PA0631 PA0483 PA0499 PA0510 PA0531 PA0544 PA0555 PA0572 PA0582 PA0596 PA0607 PA0619 PA0632 PA0484 PA0500 PA0516 PA0532 PA0546 PA0557 PA0573 PA0584 PA0598 PA0608 PA0620 PA0635 PA0487 PA0501 PA0518 PA0533  753 408 800 621 707 659 785 730 602 771 701 689 342 459 570 780 792 795 258 444 695 672 673 719 800 635 354 703 625 534 231 516 772 697 507 763 622 336 705 638 764 757 255 729 772 315 771  PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 PG03CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13  97 98 99 100 101 102 103 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43  FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE  L O W P R O D U C T YIELD (<50ng/ul)  L O W P R O D U C T Y I E L D (<50ng/ul)  L O W P R O D U C T Y I E L D (<50ng/ul)  B O R D E R L I N E YIELD (50 to 60ng/ul) - H A N D R E J E C T  UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC_04 UBC 04 UBC_04 UBC 04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC_04 UBC 04 UBC 04  •  AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010 AR0010  D05 D06 D07 D08 D09 D10 D11 D12 E01 E02 E03 E04 E05 E06 E07 E08 E09 E10 E11 E12 F01 F02 F03 F04 F05 F06 F07 F08 F09 F10 F11 F12 G01 G02 G03 G04 G05 G06 G07 G08 G09 G10 G11 G12 H01 H02 H03  PA0547 PA0558 PA0574 PA0587 PA0599 PA0609 PA0621 PA0636 PA0490 PA0502 PA0519 PA0536 PA0548 PA0560 PA0575 PA0588 PA0600 PA0611 PA0622 PA0638 PA0491 PA0504 PA0520 PA0539 PA0549 PA0562 PA0577 PA0590 PA0602 PA0614 PA0625 PA0639 PA0492 PA0506 PA0523 PA0540 PA0550 PA0564 PA0578 PA0593 PA0604 PA0615 PA0626 PA0640 PA0494 PA0507 PA0525  775 755 680 800 800 753 459 642 294' 702 744 696 635 489 720 727 765 620 700 637 742 687 741 780 765 634 768 679 770 450 686 625 682 674 441 387 785 752 450 619 624 516 785 603 749 784 682  UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13 UB04CL13  44 45 46 47 48 49 50 51 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94  FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  L O W P R O D U C T Y I E L D (<50ng/ul)  ON  UBC_58 UBC 58 UBC_58 UBC_58 UBC_58 UBC_58 UBC 58 UBC 58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC.58 UBC 58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC 58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC 58 UBC_58 UBC 58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC_58 UBC 58 UBC 58  AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126 AR0126  C07 C08 C09 C10 C11 C12 D01 D02 D03 D04 D05 D06 D07 D08 D09 D10 D11 D12 E01 E02 E03 E04 E05 E06 E07 E08 E09 E10 E11 E12 F01 F02 F03 F04 F05 F06 F07 F08 F09 F10 F11 F12 G01 G02 G03 G04 G05  PA1984 PA3993 PA4277 PA1280 PA2458 PA5343 PA5453 PA5477 PA5501 PA5545 PA5567 PA1901 PA2291 PA4022 PA4625 PA1605 PA2460 PA0497 PA5456 PA5482 PA5505 PA5546 PA0040 PA1902 PA2319 PA4212 PA4797 PA1632 PA4125 PA0498 PA5459 PA5486 PA5508 PA5548 PA0263 PA1903 PA2463 PA4213 PA0167 PA1968 PA4190 PA0886 PA5461 PA5489 PA5515 PA5551 PA0445  743 766 755 450 675 671 798 773 675 742 800 754 742 743 688 758 227 606 696 162 762 742 786 624 766 754 766 55 335 505 739 594 794 739 519 733 786 624 631 98 669 172 318 614 501 510 766  PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A PG58CL13A  34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 80 81 82 83 84  FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  BLANK LANE  BLANK LANE  BLANK LANE  L O W P R O D U C T YIELD (<50ng/ul)  APPENDIX II: Sample capillary electrophoresis data for all open reading frames used in P. aeruginosa custom DNA microarray  177  J B 384 Well Plate B a r c o d e C4PS01-P3-0001-BL008-001  Sample  Size(bp)  Concentration(ng/ul)  x4  384WellPlatelD  A1  718  15.3  61.2  384-01  PA0001  A2  773  7.6  30.4  384-01  PA0155  A3  845  8.8  35.2  384-01  PA0011  A4  663  13.2  52.8  384-01  PA0172  A5  700  20.7  82.8  384-01  PA0021  A6  791  14.3  57.2  384-01  PA0187  A7  690  21.9  87.6  384-01  PA0032  A8  677  11.6  46.4  384-01  PA0202  A9  405  19.1  76.4  384-01  PA0046  A10  800  15.9  63.6  384-01  PA0214  A11  677  20.5  82  A12  384-01  PA0065  745  A13  20.2  80.8  384-01  PA0226  782  18.3  73.2  384-01  PA0075  680  17.5  70  384-01  PA0239  693  14.1  56.4  384-01  PA0090  327  10.1  40.4  384-01  PA0252  670  22.2  88.8  384-01  PA0101  A19  547  8.3  33.2  384-01  PA0261  623  16.4  65.6  384-01  A20  570  15.9  63.6  384-01  PA0111 PA0276  A21  718  16.8  67.2  384-01  PA0123  A22  736  16  64  384-01  PA0290  A23  660  20.3  81.2  384-01  PA0143  A24  755  7.4  29.6  384-01  PA0305  B1  661  8.6  34.4  384-01  PA0318  B2  745  3.6  14.4  384-01  PA0482  B3  688  6.8  27.2  384-01  PA0331  B4  676  9.6  38.4  B5  384-01  PA0495  755  B6  12.3  49.2  384-01  PA0342  782  B7  2.9  11.6  384-01  PA0509  688  4.4  17.6  384-01  PA0357  700  5.7  22.8  384-01  PA0529  855  11.2  44.8  384-01  PA0368  718  9.7  38.8  384-01  PA0543  718  9.3  37.2  384-01  PA0383  389  5.2  20.8  384-01  PA0554  A14 A15 A16 A17 A18 !  B8 B9 B10 B11 B12  ORF_Nam  B13 B14 B15 B16 B17 B18 B19 B20 B21 B22 B23 B24 C1 C2 C3 C4 C5 C6 C7 C8 C9 C10 C11 C12 C13 C14 C15 C16 C17 C18 C19 C20 C21 C22 C23 C24 D1  669 500 709 618 736 809 818 800 736 882 782 295 747 675 299 747 683 765 419 719 433 457 596 747 812  12.5 7 12.6 7.8 9.1 2.3 12.9 13.2 14.3 4.5 10.2 4.1 16.3 14.9 5.4 5.6 12.4 10.6 12.6 12.6 13 12.3 11.9 9.9 14.2 -  320 774 700 747 667 719 316 849 802 654 400  12 12 16.7 11 16 8.5 5.2 7.2 14.5 10.3 6.8  50 28 50.4 31.2 36.4 9.2 51.6 52.8 57.2 18 40.8 16.4 65.2 59.6 21.6 22.4 49.6 42.4 50.4 50.4 52 49.2 47.6 39.6 56.8 0 48 48 66.8 44 64 34 20.8 28.8 58 41.2 27.2  384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01  PA0399 PA0568 PA0411 PA0581 PA0429 PA0595 PA0437 PA0606 PA0453 PA0618 PA0470 PA0631 PA0002 PA0156 PA0012 PA0175 PA0023 PA0190 PA0033 PA0203 PA0048 PA0215 PA0066 PA0227 PA0078 PA0240 PA0092 PA0254 PA0102 PA0262 PA0112 PA0277 PA0124 PA0291 PA0146 PA0307 PA0320  D2 D3 D4 D5 D6 D7 D8 D9 D10 D11 D12 D13 D14 D15 D16 D17 D18 D19 D20 D21 D22 D23 D24 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 E12 E13 E14  483 696 784 821 691 398 747 649 774 376 858 737 709 653 407 821 821 821 666 747 602 867 275 795 824 311 767 665 710 729 776 729 767 687 696 805 1373  2.1 11.8 8 8.2 10.7 6.1 4.8 9 10.4 7.8 9.7 8.7 12.1 11 7 10.6 9.1 7.2 5.3 10.8 6.2 8 3.2 12.1 16.7 4.1 11.9 17.9 14.4 14.3 11 10.8 10.7 16.9 15.4 13.5 4  8.4 47.2 32 32.8 42.8 24.4 19.2 36 41.6 31.2 38.8 34.8 48.4 44 28 42.4 36.4 28.8 21.2 43.2 24.8 32 12.8 48.4 66.8 16.4 47.6 71.6 57.6 57.2 44 43.2 42.8 67.6 61.6 54 16  384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01  PA0483 PA0334 PA0499 PA0343 PA0510 PA0359 PA0531 PA0370 PA0544 PA0385 PA0555 PA0400 PA0572 PA0413 PA0582 PA0430 PA0596 PA0438 PA0607 PA0455 PA0619 PA0471 PA0632 PA0003 PA0159 PA0014 PA0176 PA0024 PA0194 PA0035 PA0204 PA0049 PA0216 PA0067 PA0228 PA0079 PA0241  E15  767  13.7  54.8  384-01  PA0093  E16  661  5.6  22.4  384-01  PA0255  E17  767  17.5  70  384-01  PA0103  E18  652  10.3  41.2  384-01  PA0265  E19  862  11.7  46.8  384-01  PA0113  E20  738  6.4  25.6  384-01  PA0278  E21  539  11.6  46.4  384-01  PA0127  E22  691  2.5  10  384-01  PA0293  E23  814  14.5  58  384-01  PA0147  E24  738  6  24  384-01  PA0308  F1  788  18.4  73.6  384-01  PA0322  F2  593  2.7  10.8  384-01  PA0484  F3  553  7.5  30  384-01  PA0336  F4  817  9.9  39.6  384-01  PA0500  F5  418  4.5  18  384-01  PA0346  F6  749  6.2  24.8  384-01  PA0516  F7  687  7.7  30.8  384-01  PA0360  F8  567  10.8  43.2  384-01  PA0532  F9  876  12.8  51.2  384-01  PA0372  F10  817  10.1  40.4  384-01  PA0546  F11  468  12.3  49.2  384-01  PA0388  F12  673  9.3  37.2  384-01  PA0557  F13  749  13.3  53.2  384-01  PA0401  F14  399  6.8  27.2  384-01  PA0573  F15  837  13.8  55.2  384-01  PA0414  F16  798  16.4  65.6  384-01  PA0584  F17  633  12  48  384-01  PA0431  F18  700  7.6  30.4  384-01  PA0598  F19  696  4.5  18  384-01  PA0439  F20  827  12.4  49.6  384-01  PA0608  F21  247  2.2  8.8  384-01  PA0456  F22  895  2.8  11.2  384-01  PA0620  F23  584  12.2  48.8  384-01  PA0472  F24  290  2.7  10.8  384-01  PA0635  G1  827  15.4  61.6  384-01  PA0004  G2  191  5.8  23.2  384-01  PA0161  G3  367  6.7  26.8  384-01  PA0015  G4 G5 G6 G7 G8 G9 G10 G11 G12 G13 G14 G15 G16 G17 G18 G19 G20 G21 G22 G23 G24 H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14 H15 H16  739 837 837 856 686 181 837 837 720 798  17.5 17.5 12.2 14.5 13.9 7.9 11.2 13.7 8.4 9.5  477 856 788 885 664 686 885 739 768 691 846 788 686 827 807 360 817 856 846 837 690 856 895 749 720 846  9.6 6.4 12.4 11.6 12.2 13.7 13.7 6.9 13.9 12.9 9.3 1.4 4.9 7.5 11.8 4.9 10 10.3 8.8 9.3 11.4 7.2 12.5 7.6 10 12.3  70 70 48.8 58 55.6 31.6 44.8 54.8 33.6 38 0 38.4 25.6 49.6 46.4 48.8 54.8 54.8 27.6 55.6 51.6 37.2 5.6 19.6 30 47.2 19.6 40 41.2 35.2 37.2 45.6 28.8 50 30.4 40 49.2  384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01  P A0178 PA0026 PA0195 PA0036 PA0205 PA0050 PA0217 PA0069 PA0230 PA0081 PA0243 PA0094 PA0256 PA0105 PA0268 PA0114 PA0282 PA0130 PA0297 PA0148 PA0309 PA0323 PA0487 PA0337 PA0501 PA0347 PA0518 PA0361 PA0533 PA0373 PA0547 PA0390 PA0558 PA0402 PA0574 PA0416 PA0587  H17  876  11  44  384-01  PA0432  H18  885  11.6  46.4  384-01  PA0599  H19  866  11.8  47.2  384-01  PA0440  H20  837  6.4  25.6  384-01  PA0609  H21  788  10.1  40.4  384-01  PA0461  H22  498  3.3  13.2  384-01  PA0621  H23  676  5.9  23.6  384-01  PA0473  H24  695  8  32  384-01  PA0636  11  590  14.5  58  384-01  PA0006  12  880  15.5  62  384-01  PA0162  13  750  7.9  31.6  384-01  PA0016  14  800  8.8  35.2  384-01  PA0180  15  61  1.2  4.8  384-01  PA0027  16  810  10.9  43.6  384-01  PA0196  17  256  4.6  18.4  384-01  PA0038  18  840  14.2  56.8  384-01  PA0207  19  910  12.5  50  384-01  PA0051  110  740  12.9  51.6  384-01  PA0219  111  860  12.1  48.4  384-01  PA0070  112  890  9.1  36.4  384-01  PA0231  113  730  14.9  59.6  384-01  PA0082  114  760  14.3  57.2  384-01  PA0244  115  750  15.9  63.6  384-01  PA0097  116  960  6.3  25.2  384-01  PA0257  117  820  13.6  54.4  384-01  PA0106  118  492  9.6  38.4  384-01  PA0269  119  770  11.2  44.8  384-01  PA0117  I20  223  5.2  20.8  384-01  PA0284  121  667  12.4  49.6  384-01  PA0132  I22  820  9.2  36.8  384-01  PA0298  I23  595  14.3  57.2  384-01  PA0149  I24  700  8  32  384-01  PA0313  J1  685  12.3  49.2  384-01  PA0326  J2  347  5.8  23.2  384-01  PA0490  J3  833  13.6  54.4  384-01  PA0338  J4  731  7.7  30.8  384-01  PA0502  J5  772  9.8  39.2  384-01  PA0348  J6 J7 J8 J9 J10 J11 J12 J13 J14 J15 J16 J17 J18 J19 J20 J21 J22 J23 J24 K1 K2 K3 K4 K5 K6 K7 K8 K9 K10 K11 K12 K13 K14 K15 K16 K17 K18  782 520 772 695 710 762 563 568 721 494 772 484 864 803 690 772 762 885 700 864 895 782 813 885  2.1 12.4 8.1 9.4 9.8 12.1 3.9 7.3 9.1 7.6 9.3 8.9 10.1 10.6 10.8 9.5 5.3 13.9 3.7 20.4 11.9 18.3 11.6 20  864 874 288 772 813 680 671 731 844 223 792 864  12 13.1 7.2 14.9 8.7 10.2 12.9 14.5 13.9 4.9 11 12  8.4 49.6 32.4 37.6 39.2 48.4 15.6 29.2 36.4 30.4 37.2 35.6 40.4 42.4 43.2 38 21.2 55.6 14.8 81.6 47.6 73.2 46.4 80 0 48 52.4 28.8 59.6 34.8 40.8 51.6 58 55.6 19.6 44 48  384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 • 384-01 384-01 384-01 384-01 384-01 384-01  PA0519 PA0363 PA0536 PA0375 PA0548 PA0393 PA0560 PA0403 PA0575 PA0424 PA0588 PA0433 PA0600 PA0441 PA0611 PA0462 PA0622 PA0477 PA0638 PA0007 PA0164 PA0018 PA0182 PA0029 PA0197 PA0041 PA0208 PA0053 PA0222 PA0071 PA0233 PA0084 PA0246 PA0098 PA0258 PA0108 PA0272  K19 K20 K21 K22 K23 K24 L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12 L13 L14 L15 L16 L17 L18 L19 L20 L21 L22 L23 L24 M1 M2 M3 M4 M5 M6 M7  772 741 864 710 844 656 870 830 810 790 820 860 850 870 780 860 810 720 850 880 870 770 910 820  11.9 9.6 8.7 8 6.9 6.5 13.4 4.3 17.8 3.9 12.4 6.9 15.8 10.2 12.2 9 11.5 10.4 12.5 10.4 11.6 10.5 11.3 8.6  494 720 760 530 685 813 792 556 695 679 782 464  9.1 13.6 3.4 4.6 7.3 11 5.2 9.3 6.4 14.3 7.7 7.5  47.6 38.4 34.8 32 27.6 26 53.6 17.2 71.2 15.6 49.6 27.6 63.2 40.8 48.8 36 46 41.6 50 41.6 46.4 42 45.2 34.4 0 36.4 54.4 13.6 18.4 29.2 44 20.8 37.2 25.6 57.2 30.8 30  384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01 384-01  PA0119 PA0285 PA0133 PA0299 PA0150 PA0314 PA0327 PA0491 PA0339 PA0504 PA0349 PA0520 PA0364 PA0539 PA0378 PA0549 PA0395 PA0562 PA0406 PA0577 PA0425 PA0590 PA0434 PA0602 PA0442 PA0614 PA0463 PA0625 PA0478 PA0639 PA0008 PA0165 PA0019 PA0183 PA0030 PA0198 PA0042  023 024 P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 P19 P20 P21 P22 P23 P24  732 569  6.6 4.3  665  2  606  5.1  808  1.2  405  0.57  26.4 17.2 0 0 8 0 20.4 0 4.8 0 2.28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0  "#ofOs="  640  "Total# genes="  5608  384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15 384-15  PA4936 PA2954 PA3458 BLANK PA3955 BLANK PA4399 BLANK PA5323 BLANK PA5169 BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK BLANK 152  "=Blanks"  A P P E N D I X III: Genes up- and down-regulated in P. aeruginosa in response to various concentrations of ciprofloxacin  187  Genes which are Up-regulated in Response to Ciprofloxacin ORF  PA0595 PA 1008 PA 1432 PA2622 PA3625 PA4235 PA4743 PA4760 PA5241 PA5338 PA0331 PA0390 PA0609 PA0649 PA0650 PA1684 PA1750 PA1756 PA2943 PA3175 PA3537 PA4695 PA4756 PA4759 PA4930 PA4976 PA5013 PA5035 PA5036 PA5039 PA5066 PA5141 PA5142 PA5172 PA5302 PA5323 PA5413 PA0426 PA0350 PA0381 PA0551 PA1505 PA1546 PA1674  Fold change In PAO-H103 Ciprofloxacin  Gene name  1.24  1.38  Adaptation, protection  46% similar to organic solvent tolerance Protein O s t A [E. coli].  3.02  2.96  3.33  Adaptation, protection  52% similar to bacterioferritin comigratory Protein [E. coli]  1.19  1.43  Adaptation, protection  100% identical to Autoinducer synthesis Protein Lasl [P.aeruginosa]  Adaptation, protection  71% similar to c s p D gene product of [E. coli].  lasl cspD  Description  0.3x MIC  OStA bcp  Function 1xMIC  0.1XMIC  2.09  1.37  Adaptation, protection  64% similar to S u r E Protein [E. coli]  bfrA  1.52  Adaptation, protection  88% similar to bacterioferritin [P. putida]  rbfA  1.42  Adaptation, protection  68% similar to ribosome-binding factor A [ E . coli]  dnaJ  1.34  1.37  Adaptation, protection  78% similar to dnaJ gene product [E. coli].  PPX  1.47  2.11  Adaptation, protection  60% similar to ppx gene product of [E. coli]  spoT  1.42  1.65  Adaptation, protection  73% similar to (p)ppGpp 3'-pyrophosphohydrolase [E. coli]  ilvA1  1.81  1.61  A m i n o acid biosynthesis and metabolism  70% similar to threonine deaminase llvA [E. coli].  metX  1.49  A m i n o acid biosynthesis and metabolism  67% similar to homoserine O-acetyltransferase MetX [Leptospira meyeri]  trpE  1.65  A m i n o acid biosynthesis and metabolism  100% identical to anthranilate synthase component I [P.aeruginosa]  trpG  5.95  A m i n o acid biosynthesis and metabolism  99% similar to anthranilate synthase component II T r p G [P.aeruginosa]  2.68  A m i n o acid biosynthesis and metabolism  surE  1.38  trpD 1.59  1.41  A m i n o acid biosynthesis and metabolism  73% similar to E-2/E-2' Protein of [Klebsiella oxytoca]  1.30  1.21  A m i n o acid biosynthesis and metabolism  73% similar to E. coli aroF gene product.  cysH  1.27  Amino acid biosynthesis and metabolism  99% similar to P A C y s H ; 73% similar to A P S reductase [A. thaliana]  1.25  A m i n o acid biosynthesis and metabolism  69% similar to E. coli aroF gene product.  1.45  1.72  A m i n o acid biosynthesis and metabolism  2.58  2.71  Amino acid biosynthesis and metabolism  64% similar to ornithine carbamoyltransferase [B. subtilis]  ilvH  1.34  1.42  A m i n o acid biosynthesis and metabolism  84% similar to Acetolactate synthase isozyme III [S. typhimurium]  carB  1.20  argF  2.61  A m i n o acid biosynthesis and metabolism 1.41  A m i n o acid biosynthesis and metabolism  92% similar to P. syringae dihydrodipicolinate reductase.  air  1.66  A m i n o acid biosynthesis and metabolism  57% similar to S. typhimurium air biosynthetic alanine racemase.  aspC  1.32  A m i n o acid biosynthesis and metabolism  57% similar to A s p aminotransferase [Thermus aquaticus thermophilus]  A m i n o acid biosynthesis and metabolism  68% similar to branched-chain amino acid aminotransferase (ilvE) [E. coli]  dapB  1.58  ilvE  gito  1.27  1.40 1.54  A m i n o acid biosynthesis and metabolism  100% identical to gltD from P A 0 1 ; 80% similar to gltD from E. coli  1.38  A m i n o acid biosynthesis and metabolism  99% identical to gltB from P A 0 1 ; 75% similar to gltB from E. coli  1.18  1.41  A m i n o acid biosynthesis and metabolism  71% similar to E. coli shikimate kinase I (AroK)  1.98  2.58  A m i n o acid biosynthesis and metabolism  94% similar to N-terminal of phosphoribosyl c - A M P hydrolase [A.chroococ  1.27  1.47  A m i n o acid biosynthesis and metabolism  49% similar to E. coli hisA gene product.  1.74  A m i n o acid biosynthesis and metabolism  50% similar to hisH gene product of [Azospirillum brasilense]  gltB  1.27  aroK hisl hisA hisM arcB dadX  1.60  A m i n o acid biosynthesis and metabolism  1.13  A m i n o acid biosynthesis and metabolism  65% similar to catabolic alanine racemase of [E. coli].  1.60  A m i n o acid biosynthesis and metabolism  61% similar to B. stearothermophilus acetylglutamate kinase.  ItaA  1.21  A m i n o acid biosynthesis and metabolism  94% similar to low specificity L-threonine aldolase [P. sp.].  mexB  1.40  Antibiotic resistance and susceptibility  99% similar to M e x B [P.aeruginosa]  argB  1.37  folA  1.46  Biosynthesis of cofactors, prosthetic groups and carriers  61 % similar to dihydrofolate reductase type I [E. coli]  thiG  1.47  Biosynthesis of cofactors, prosthetic groups and carriers  64% similar to thiamin biosynthesis, thiazole moiety T h i G [E. coli]  1.66  Biosynthesis of cofactors, prosthetic groups and carriers  72% similar to g a p B gene product of E. coli  Biosynthesis of cofactors, prosthetic groups and carriers  56% similar to molybdopterin co-factor synthesis Protein M o a A [A.nicotin  epd  1.47  moaA2  1.20  hemN  1.63  -1.78  Biosynthesis of cofactors, prosthetic groups and carriers  99% similar to oxygen-independent coproporphyrinogen III dehyrogenase  3.14  3.47  Biosynthesis of cofactors, prosthetic groups and carriers  70% similar to G T P cyclohydrolase I [Rattus norvegicus]  folE2  3.00  oo vo  PA1758 PA1796 PA2908 PA2909 PA2947 PA3029 PA3030 PA3627 PA3650 PA3915 PA3916 PA3976 PA3977 PA3997 PA4007 PA4047 PA4280 PA4529 PA4561 PA4893 PA4919 PA4920 PA5063 PA5065 PA5223 PA5243 PA5516 PA0208 PA0214 PA0228 PA0230 PA0231 PA0555 PA0608 PA0792 PA0810 PA1950 PA2098 PA2321 PA2343 PA2509 PA2512 PA2517 PA4901 PA4905 PA5057 PA5350 PA5416  1.51  1.68  Biosynthesis of cofactors, prosthetic groups and carriers  60% similar to p-aminobenzoate synthetase, component I PabB [S. typh  folD  1.15  1.23  Biosynthesis of cofactors, prosthetic groups and carriers  80% similar to E. coli folD gene product  cbiD  1.64  Biosynthesis of cofactors, prosthetic groups and carriers  57% similar to putative cobalamin biosynthesis Protein CbiD [B.mega  pabB  1.71  1.53  1.84  Biosynthesis of cofactors, prosthetic groups and carriers  55% similar to putative precorrin-6x reductase CobK [R.erythropolis]  1.43  Biosynthesis of cofactors, prosthetic groups and carriers  49% similar to cobE Protein [P. denitrificans].  1.32  Biosynthesis of cofactors, prosthetic groups and carriers  73% similar to molybdopterin biosynthesis. Protein B [E. coli].  1.24  1.19  Biosynthesis of cofactors, prosthetic groups and carriers  47% similar to molybdoterin-guanine dinucleotide biosynthesis Protein A  2.84  Biosynthesis of cofactors, prosthetic groups and carriers  79% similar to ygbB gene product of [E. coli]  dxr  1.89  3.68  3.37  Biosynthesis of cofactors, prosthetic groups and carriers  71 % similar to yaeM gene product of [E. coli]  moaB1  1.22  Biosynthesis of cofactors, prosthetic groups and carriers  72% similar to E. coli moaB gene product  moaE  8.36  7.90  7.69  Biosynthesis of cofactors, prosthetic groups and carriers  70% similar to molybdopterin converting factor subunit 2 [E. coli]  thiE  4.34  2.04  3.17  Biosynthesis of cofactors, prosthetic groups and carriers  52% similar to thiamine-phosphate pyrophosphorylase ThiC [B. subtilis].  hemL  1.57  1.67  Biosynthesis of cofactors, prosthetic groups and carriers  lipB  1.54  moaB2  ygbB  1.76  Biosynthesis of cofactors, prosthetic groups and carriers  70% similar to lipoate biosynthesis Protein B [E. coli]  proA  1.52  1.94  Biosynthesis of cofactors, prosthetic groups and carriers  68% similar to gamma-glutamylphosphate reductase [E. coli]  ribA  1.46  Biosynthesis of cofactors, prosthetic groups and carriers  76% similar to GTP cyclohydrolase II of [E. coli]  birA  1.70  Biosynthesis of cofactors, prosthetic groups and carriers  56% similar to bifunctional Protein BirAJE. coli].  Biosynthesis of cofactors, prosthetic groups and carriers  83% similar to yacE DNA repair Protein [P. putida]  1.44  Biosynthesis of cofactors, prosthetic groups and earners  83% similar to Riboflavin kinase (flavokinase) [P. fluorescens]  1.16  Biosynthesis of cofactors, prosthetic groups and earners  83% similar to urease accessory Protein G [Klebsiella aerogenes].  Biosynthesis of cofactors, prosthetic groups and carriers  69% similar to pncB gene product of S. typhimurium  coaE  1.31  ribF  1.30  ureG pncB1  1.33  nadE  1.17  ubiE  1.18  ubiB ubiH  Biosynthesis of cofactors, prosthetic groups and carriers  65% similar to nadE gene product of E. coli  1.31  Biosynthesis of cofactors, prosthetic groups and carriers  84% similar to ubiE gene product of [E. coli]  1.69  Biosynthesis of cofactors, prosthetic groups and carriers  70% similar to putative ubiquinone biosynthesis Protein AarF [E. coli]  Biosynthesis of cofactors, prosthetic groups and carriers  56% similar to ubiH gene product of [E. coli]  1.19  hemB  1.28  Biosynthesis of cofactors, prosthetic groups and carriers  77% similar to hemB gene product of [Bradyrhizobium japonicum]  pdxY  1.60  Biosynthesis of cofactors, prosthetic groups and carriers  72% similar to pyridoxamine kinase [E. coli].  mdcA  1.21  Carbon compound catabolism  85% similar to malonate decarboxylase alpha subunit MdcA [K. pneumon  1.49  Carbon compound catabolism  73% similar to malonate decarboxylase transacylase component MdcH  Carbon compound catabolism  91% similar to PcaF [P. putida].  1.29  pcaF pcaB  1.69 1.22  1.24  prpD  rbsK  1.36 mtlY catB  1.44  1.54  antA xylY  1.67 1.84  1.26  Carbon compound catabolism  97% similar to fda gene product of [P. stutzeri]  1.55  Carbon compound catabolism  57% similar to phosphoglycolate phosphatase [E. coli].  1.42  Carbon compound catabolism  73% similar to prpD gene products of E. coli and S. typhimurium  2.55  Carbon compound catabolism  41% similar to Had1, 2-haloalkanoic acid dehalogenase I [P. sp.]  1.43  Carbon compound catabolism  Similar to other ribokinase genes from multiple genera  1.27  Carbon compound catabolism  56% similar to acetylhydrolase [Streptomyces hygroscopicus]  1.38  Carbon compound catabolism  57% similarity to gntK; 55% similarity to gntV gene products of [E. coli]  1.88  Carbon compound catabolism  76% similar to xylulose kinase [P. fluorescens].  1.76  Carbon compound catabolism  83% similar to muconate cycloisomerase I [P. putida].  1.68  Carbon compound catabolism  85% similar to anthranilate dioxygenase large subunit [Acinetobacter sp.]  Carbon compound catabolism  89% similar to toluate 1,2-dioxygenase beta subunit [Plasmid pWWO].  1.79  1.39  Carbon compound catabolism  76% similar to benzoylformate decarboxylase [P. putida]  1.91  Carbon compound catabolism  69% similar to vanillate O-demethylase oxidoreductase [P. sp.].  Carbon compound catabolism  100% similar to PHA-depolymerase [P.aeruginosa]  1.33  1.41 1.77  1.82  Carbon compound catabolism  86% similar to rubredoxin of [Acinetobacter calcoaceticus]  1.72  1.61  1.40  Carbon compound catabolism  75% similar to sarcosine oxidase beta subunit [Corynebacterium sp.].  phaD  soxB  63% similar to B-ketoadipate enol-lactone hydrolase [B. japonicum].  1.70  mdIC vanB  87% similar to 3-carboxy-cis,cis-muconate cycloisomerase [P. putida].  Carbon compound catabolism  1.34  pcaD fda  Carbon compound catabolism  VO  o  PA0857 PA4479 PA4751 PA4752 PA4941 PA4942 PA5565 PA3160 PA3999 PA4002 PA4003 PA4418 PA4545 PA4662 PA4700 PA4947 PA4988 PA5009 PA5010 PA5011 PA5012 PA5077 PA5161 PA5163 PA5164 PA5276 PA0654 PA2356 PA2393 PA3471 PA4068 PA4626 PA4864 PA4868 PA5060 PA5421 PA5435 PA5436 PA0538 PA1068 PA2477 PA2614 PA3221 PA4083 PA4176 PA4385 PA4386 PA4761  1.82  bolA mreD  1.86  Cell division  64% similar to BolA Protein [E. coli]  Cell division  54% similar to mreD [E. coli]  1.43  Cell division  81 % similar to FtsH gene product of E. coli  1.52  Cell division  74% similar to FtsJ gene product of E. coli  2.92 1.22  ftsH ftsJ hftC  1.79  1.76  2.61  Cell division  59% similar to HfIC [E. coli].  hflK  1.51  1.94  2.61  Cell division  59% similar to Protein HflK [E. coli].  1.52  Cell division  81% similar to glucose-inhibited division Protein A [E. coli]  1.61  Cell wall / L P S / capsule  dacC  1.36  Cell wall / L P S / capsule  66% similar to D-alanyl-D-alanine carboxypeptidase; P B P 6 ( D a c C )  rodA  1.77  Cell wall / L P S / capsule  73% similar to the rod-shape-determining Protein of [E. coli].  pbpA  1.46  Cell wall / L P S / capsule  63% similar to the Penicillin-binding Protein 2 of [E. coli].  ftsl  1.06  Cell wall / L P S / capsule  45% identical, 62% similar to E. coli pbp3  comL  1.81  Cell wall / L P S / capsule  62% similar to peptidoglycan-linked lipoprotein precursor C o m L [N.gono  1.44  Cell wall / L P S / capsule  58% similar to glutamate racemase[E. coli]  2.15  Cell wall / L P S / capsule  61% similar to peptidoglycan synthetase; penicillin-binding Protein 1B  amiB  1.51  Cell wall / L P S / capsule  56% similar to N-acetylymuramoyl-l-alanine amidase A m i C precursor  waaA  1.29  Cell wall / L P S / capsule  67% similar to Kdo transferase W a a A (former kdtA) [E. coli]  1.40  1.49  Cell wall / L P S / capsule  72% similar to w a a P (rfaP) gene product of [E. coli].  1.91  2.16  Cell wall / L P S / capsule  66% similar to rfaG gene product of [E. coli].  1.33  1.42  Cell wall / L P S / capsule  99% similar to heptosyl transferase I [P.aeruginosa].  2.78  Cell wall / L P S / capsule  100% similar to heptosyl transferase II [P.aeruginosa].  2.32  2.16  Cell wall / L P S / capsule  76% similar to mdoH [E.coli]  rmlB  1.32  1.60  Cell wall / L P S / capsule  73% similar to rfbB gene product of [E. coli]  rmlA  1.18  1.33  Cell wall / L P S / capsule  87% similar to rfbA gene product of [E. coli]  rmIC  1.20  1.34  Cell wall / L P S / capsule  75% similar to rfbC gene product of [E. coli]  3.31  Cell wall / L P S / capsule  1.70  Central intermediary metabolism  gidA 1.51  wzz  murl  1.37  mrcB  2.09  waaP waaG  1.58  waaC  2.33  waaF mdoH  2.48  IppL speD msuD  1.56  Central intermediary metabolism  1.75  Central intermediary metabolism  1.99  81 % similar to S-adenosylmethionine decarboxylase S p e D [E. coli].  Central intermediary metabolism  80% similar to putative NAD-linked malate dehydrogenase (malic enzyme  1.93  Central intermediary metabolism  60% similar to hypothetical UDP-glucose 4-epimerase of [P. horikoshii] 61% similarity to hprA gene product of [Methylobacterium extorquens].  hprA  1.37  1.45  Central intermediary metabolism  ureD  2.20  2.18  Central intermediary metabolism  51% similar to urease accessory Protein [Klebsiella aerogenes].  1.55  Central intermediary metabolism  83% similar to urease subunit C [Klebsiella aerogenes].  1.29  Central intermediary metabolism  100% identical to fragment of hypothetical Protein 4 (phaC2 3' region)  Central intermediary metabolism  92% similar to glutathione-independent formaldehyde dehydrogenase  Central intermediary metabolism  75% similar to L.pneumophila oadA homolog  Central intermediary metabolism  71 % similar to biotin carboxylase [B. subtilis]  ureC phaF  1.13  fdhA  1.46 1.27  1.23  1.36 dsbB  2.18 2.77  2.50  1.89  1.68  2.05  2.03  dnaK  2.09  C h a p e r o n e s & heat shock proteins  C-terminal portion 48% similar to putative thiol 51% similar to lipoprotein carrier Protein precursor LolA [E. coli].  2.17  5.11  C h a p e r o n e s & heat shock proteins  68% similar to molecular chaperonin C s a A [B. subtilis].  C h a p e r o n e s & heat shock proteins  57% similar to FimB chaperone-like Protein [Bordetella pertussis].  1.55  1.58  C h a p e r o n e s & heat shock proteins  67% similar to ppiC gene product [E. coli]  1.30  C h a p e r o n e s & heat shock proteins  2.12  C h a p e r o n e s & heat shock proteins  2.59  C h a p e r o n e s & heat shock proteins  groEL groES  47% similar to heat shock Protein HtpG, chaperone Hsp90, heat shock  C h a p e r o n e s & heat shock proteins  1.36 ppiC2  51 % similar to disulfide bond formation Protein D s b B [E. coli].  C h a p e r o n e s & heat shock proteins  1.31  lolA csaA  2.71  C h a p e r o n e s & heat shock proteins  1.81  87% similar to hsp70 Protein (dnaK gene) [E. coli]  PA4762 PA4845 PA5053 PA5054 PA5195 PA5256 PA0180 PA0415 PA2788 PA4844 PA4954 PA0382 PA0577 PA1534 PA1686 PA1815 PA3617 PA3620 PA3640 PA3777 PA3989 PA4232 PA4234 PA4316 PA4763 PA4931 PA4946 PA5050 PA5147 PA5296 PA5319 PA0330 PA0362 PA0511 PA0512 PA0519 PA0525 PA0552 PA0607 PA1481 PA1482 PA1483 PA1551 PA1555 PA1556 PA1557 PA1581 PA1582  2.12  C h a p e r o n e s & heat shock proteins  63% similar to grpE gene product [E. coli]  dipZ  1.42  C h a p e r o n e s & heat shock proteins  94% similar to P A dipZ gene product.  hsIV  177  C h a p e r o n e s & heat shock proteins  100% similar to heat shock Protein hslV[E. coli]  1.29  grpE  hsIU  1.93  2.03  3.27  C h a p e r o n e s & heat shock proteins  84% similar to heat shock Protein HsIU [E. coli].  2.15  2.19  2.13  C h a p e r o n e s & heat shock proteins  67% similar to no-longer-hypothetical yrfH gene product [E. coli]  1.28  1.54  C h a p e r o n e s & heat shock proteins  51% similar to dsbB gene product (disulfide oxidoreductase) of [B.cepa  Chemotaxis  43% similar to C-terminus of aerotaxis sensor receptor [E. coli]  dsbH 1.35  1.38 1.47 motA  1.43  Chemotaxis  1.33  Chemotaxis  1.28  Chemotaxis  53% similar to chemotactic transducer [P.aeruginosa]  1.54  Chemotaxis  67% similar to MotA [S. typhimurium]  56% similar to hypothetical transducer [P.aeruginosa].  micA  1.25  D N A replication, recombination, modification and repair  74% similar to [micA] gene products [E. coli]  dnaG  2.10  D N A replication, recombination, modification and repair  80% similar to D n a G gene product of [P. putida]  recR  1.30  D N A replication, recombination, modification and repair  79% similar to recombination Protein R e c R [E. coli]  alkA  1.44  D N A replication, recombination, modification and repair  52% similar to (inducible) 3-methyl-adenine D N A glycosylase II [E. coli].  rnhA  1.75  D N A replication, recombination, modification and repair  76% similar to ribonuclease H [E. coli]  4.55  D N A replication, recombination, modification and repair  recA  1.86  2.83  mutS  1.82  1.49  D N A replication, recombination, modification and repair  93% similar to D N A mismatch repair Protein MutS [Azotobacter vinelandi  dnaE  1.19  D N A replication, recombination, modification and repair  73% similar to d n a E gene product of [E. coli]  xseA  1.48  D N A replication, recombination, modification and repair  61 % similar to x s e A gene product [E. coli]  holA  1.25  D N A replication, recombination, modification and repair  50% similar to holA gene product of [E. coli]  ssb  1.99  D N A replication, recombination, modification and repair  uvrA  1.47  D N A replication, recombination, modification and repair  87% similar to E. coli uvrA gene product.  sbcB  1.15  D N A replication, recombination, modification and repair  66% similar to exonuclease I [E. coli] 61% similar to recN gene product [E. coli]  recN  1.59  2.11  D N A replication, recombination, modification and repair  dnaB  1.33  1.37  D N A replication, recombination, modification and repair  79% similar to dnaB gene product of [E. coli].  1.51  D N A replication, recombination, modification and repair  60% similar to mismatchrepair Protein mutL [S. typhimurium]  mutL priA  2.00  mutY  1.20  rep radC  1.60  rpiA  1.45  fdxl nirJ  D N A replication, recombination, modification and repair  64% similar to priA gene product (primosomal Protein N') of [E. coli]  1.48  D N A replication, recombination, modification and repair  67% similar to mutY gene product of [E. coli]  1.61  D N A replication, recombination, modification and repair  71 % similar to rep gene product of [E. coli]  1.55  D N A replication, recombination, modification and repair  68% similar to D N A repair Protein R a d C of [E. coli]  1.90  Energy metabolism  78% similar to rpiA gene product of [E. coli]  2.39  Energy metabolism  85% similar to ferredoxin [Chromatium vinosum]  2.22  1.32  Energy metabolism  1.21 nirS  1.30  -1.54  1.35  79% similar to NirH Protein [P. stutzeri].  Energy metabolism  100% identical to NITRITE R E D U C T A S E P R E C U R S O R [P.aeruginosa]  Energy metabolism  100% identical to hypothetical Protein downstream of norCB [P.aerugino  1.37  Energy metabolism  82% similar to pgk gene product of E. coli  1.89  1.33 pgk  Energy metabolism  rpe  1.27  Energy metabolism  84% similar to the rpe gene product of [E. coli]  ccmG  2.44  Energy metabolism  83% similar to Thiol  ccmH  1.56  Energy metabolism  74% similar to Cytochrome C-type biogenesis Protein C y c L [P. fluoresc  Energy metabolism  70% similar to Cytochrome C-type biogenesis Protein C y c H [P. fluoresc  Energy metabolism  56% similar to FixG Protein [Bradymizobium japonicum]  cycH  2.04 1.27  1.24 1.06  1.63  -2.02  1.89  Energy metabolism  51 % similar to C c o P [Paracoccus denitrificans]  Energy metabolism  64% similar to fixO Protein - Rhizobium meliloti  • '1.25  -1.60  Energy metabolism  78% similar to the CytN gene product of [Azospirillum brasilense].  sdhC  1.48  1.58  1.30  Energy metabolism  72% similar to s d h C gene product of [E. coli]  sdhD  1.52  1.50  1.54  Energy metabolism  61 % similar to sdhD gene product of [E. coli]  to  PA1583 PA1584 PA1587 PA1883 PA2290 PA2297 PA2637 PA2640 PA2644 PA2649 PA2995 PA2999 PA3491 PA3873 PA3875 PA4061 PA4571 PA4640 PA4748 PA4771 PA4809 PA4810 PA4812 PA4922 PA4971 PA5015 PA5016 PA5300 PA5332 PA5490 PA5491 PA5559 PA5560 PA5561 PA0005 PA0286 PA3013 PA3673 PA4813 PA0030 PA0046 PA0053 PA0054 PA0055 PA0061 PA0064 PA0065 PA0068  sdhA  IpdG  Energy metabolism  81% similar to sdhA gene product of [E. coli].  Energy metabolism  83% similar to sdhB gene product of [E. coli].  -1.40  Energy metabolism  - 1 0 0 % identity with lipoamide dehydrogenase from P. fluorescens  1.11  Energy metabolism  73% similar to N A D H dehydrogenase I chain A NuoA [E. coli].  1.59  Energy metabolism  65% similar to gcd gene product of [E. coli]  1.24  sdhB  1.26 1.29 1.00  gcd 3.70  4.54  Energy metabolism  nuoA  1.66  Energy metabolism  72% simialr to N A D H dehydrogenase I chain A [E. coli]  nuoE  1.42  Energy metabolism  81% similar to N A D H dehydrogenase I chain E [E. coli]  1.62  Energy metabolism  85% similar to N A D H dehydrogenase I chain I [E. coli]  1.79  Energy metabolism  81% similar to N A D H dehydrogenase I chain N [E. coli].  Energy metabolism  84% similar to Na-translocating N A D H  Energy metabolism  72% similar to N A D H  nuol  1.15  nuoN nqrE  1.06  nqrA  3.02  2.01  2.85  2.54  narj narG  278 3.63  2.02  2.46  Energy metabolism  58% similar to RnfC Protein [Rhodobacter capsulatus]  3.60  Energy metabolism  63% SIMILAR T O E. C O L I narJ gene product.  3.21  Energy metabolism  83% similar to E. coli narG gene product.  1.58  Energy metabolism  52% similar to hypothetical ybbN gene product of [E. coli]  Energy metabolism  62% similar to cytochrome c of [Acetobacter europaeus]  Energy metabolism  69% similar to L-malate dehydrogenase (acceptor) [C. glutamicum]  Energy metabolism  67% similar to Tpi gene product of [E. coli]  Energy metabolism  92% similar to L-lactate dehydrogenase [E. coli]  1.27 mqoB  1.12  tpiA  1.28  lldD  1.37  1.82  fdhE  1.59  Energy metabolism  55% similar to fdhE Protein [E. coli]  fdnl  1.21  Energy metabolism  65% similar to formate dehydrogenase-N g a m m a subunit [E. coli] 79% similar to formate dehydrogenase-O, major subunit [E. coli]  fdnG  1.20  Energy metabolism  azu  1.40  Energy metabolism  100% similar to azu gene product of P.aeruginosa  Energy metabolism  66% similar to adenosine diphosphate sugar pyrophosphatase [E. coli]  aspP aceE  1.61 1.37  1.60  Energy metabolism  aceF  1.29  cycB  1.46  1.72  Energy metabolism  crc  1.25  1.60  Energy metabolism  1.47  Energy metabolism  82% similar to cytochrome c4 precursor [P. stutzeri].  1.61  3.00  Energy metabolism  56% similar to cytochrome c 5 [Azotobacter vinelandii].  1.45  1.24  Energy metabolism  79% similar to atpE gene product of E. coli  atpB  1.24  Energy metabolism  66% similar to atpB gene product of E. coli  atpl  1.63  Energy metabolism  79% similar to atpl homolog of P. putida; only 53% similar to E. coli atpl  1.39  Fatty acid and phospholipid metabolism  56% similar to putative 1-acyl-sn-glycerol-3-phosphate acyltransferase  1.89  Fatty acid and phospholipid metabolism  85% similar to stearoyl-CoA desaturase [Azotobacter vinelandii]  Fatty acid and phospholipid metabolism  95% similar to fatty-acid oxidation complex beta-subunit [P. fragi].  1.93  Fatty acid and phospholipid metabolism  58% similar to E. coli PIsB, sn-glycerol-3-phosphate acyltransferase  2.00  1.88  Fatty acid and phospholipid metabolism  100% identical to lipase LipC [P.aeruginosa]  5.52  5.99  5.61  Hypothetical, unclassified, unknown  1.38  1.87  Hypothetical, unclassified, unknown  1.43  1.74  Hypothetical, unclassified, unknown  1.52  Hypothetical, unclassified, unknown  1.34  Hypothetical, unclassified, unknown  1.32  Hypothetical, unclassified, unknown  1.64  Hypothetical, unclassified, unknown  cc4  1.40  atpE  foaB  1.36  pIsB HpC  Energy metabolism  2.25  80% similar to cytochrome c 5 of [Azotobacter vinelandii].  74% similar to hypothetical Protein Yjil [E. coli].  Hypothetical, unclassified, unknown  1.60  Hypothetical, unclassified, unknown  54% similar to hypothetical Protein Rv2233 [M. tuberculosis]  VO  PA0070 PA0071 PA0072 PA0076 PA0077 PA0081 PA0082 PA0083 PA0084 PA0085 PA0086 PA0087 PA0092 PA0093 PA0094 PA0095 PA0104 PA0126 PA0127 PA0160 PA0201 PA0222 PA0250 PA0255 PA0277 PA0290 PA0309 PA0315 PA0317 PA0319 PA0332 PA0338 PA0340 PA0344 PA0351 PA0387 PA0392 PA0394 PA0422 PA0423 PA0446 PA0451 PA0454 PA0457 PA0460 PA0462 PA0466 PA0541  1.41  1.95  Hypothetical unclassified, unknown  2.05  Hypothetical unclassified, unknown  1.28  Hypothetical unclassified, unknown  1.67  Hypothetical unclassified, unknown  2.13  Hypothetical unclassified, unknown  40% similar to IcmF Protein [Legionella pneumophila].  1.40  Hypothetical unclassified, unknown  41% similar to a region of circumsporozoite Protein [Plasmodium berghei].  1.53  Hypothetical unclassified, unknown  3.47  Hypothetical unclassified, unknown  61% similar to putative 19.5 k D a Protein [Edwardsiella ictaluri].  1.81  Hypothetical unclassified, unknown  66% similar to putative 54.5 k D a Protein [Edwardsiella ictaluri].  1.48  2.30  Hypothetical unclassified, unknown  47% similar to putative 17.8 k D a Protein [Edwardsiella ictaluri]  1.24  2.03  Hypothetical unclassified, unknown  2.04  Hypothetical unclassified, unknown  1.99  Hypothetical unclassified, unknown  1.28  1.75  1.61  Hypothetical unclassified, unknown  2.30  Hypothetical unclassified, unknown  3.23  Hypothetical unclassified, unknown  1.59  Hypothetical unclassified, unknown  1.40  Hypothetical unclassified, unknown  1.33 1.42  1.50  Hypothetical unclassified, unknown  1.36  Hypothetical unclassified, unknown  2.11  50% similar to V g r E and V g r G Proteins [E. coli].  49% similar to hypothetical Protein [Clostridium beijerinckii].  Hypothetical unclassified, unknown  50% similar to putative mannopine-binding periplasmic Protein MotA  Hypothetical unclassified, unknown  60% similar to hypothetical Protein Rv2406c [M. tuberculosis].  1.80  Hypothetical unclassified, unknown  65% similar to hypothetical Protein [Sinorhizobium meliloti]  3.62  Hypothetical unclassified, unknown  74% similar to hypothetical Proteins Y c a L [E. coli] and Y g g G (E. coli].  Hypothetical unclassified, unknown  54% similar to C-terminus of P l e D [Caulobacter crescentus]  3.57  1.45  45% similar to putative 18.8 kDa Protein [Edwardsiella ictaluri].  Hypothetical unclassified, unknown 1.54  1.43 2.93  42% similar to a region of endo-xylanase XylR [B. stearothermophilus].  1.21  1.20  3.31  2.84  3.60  Hypothetical unclassified, unknown  1.39  Hypothetical unclassified, unknown  2.17  2.21  2.40  Hypothetical unclassified, unknown  1.74  Hypothetical unclassified, unknown  1.41  1.81  Hypothetical unclassified, unknown  1.44  1.56  Hypothetical unclassified, unknown  50% similar to pleD gene product of [Synechocystis sp.]  1.44  1.55  Hypothetical unclassified, unknown  57% similar to H. influenzae hypothetical Protein HI0902.  1.46 1.14  53% similarity to Aip2 g e n e product of S a c c h a r o m y c e s cerevisiae.  Hypothetical unclassified, unknown 1.57  Hypothetical unclassified, unknown  57% similar to conserved Protein [Methanobacterium thermoautotrophic  1.29  3.84  Hypothetical unclassified, unknown  70% similar to putative ribosomal Protein Y g g V [E. coli)  1.12  1.63  Hypothetical unclassified, unknown  65% similar to hypothetical Protein [Vibrio alginolyticus]  1.48  Hypothetical unclassified, unknown  100% identical to hypothetical 24.5kD Protein; PilT [P.aeruginosa]  1.73  Hypothetical unclassified, unknown  78% similar to putative cytochrome [E. coli]  1.28  Hypothetical unclassified, unknown  84% similar to hypothetical Protein Ycel [E. coli]  1.41  Hypothetical unclassified, unknown  68% similar to an unknown Protein from [Sphingomonas aromaticivorans]  1.27  Hypothetical unclassified, unknown  65% similar to NfeD gene product of [Rhizobium etli]  1.74  Hypothetical unclassified, unknown  58% similar to hypothetical Protein Y c c S [E. coli].  1.41  Hypothetical unclassified, unknown  1.61  Hypothetical unclassified, unknown  1.38  Hypothetical unclassified, unknown  1.42  1.59  1.30  1.37  1.55  1.85  2.02  Hypothetical unclassified, unknown 2.17  Hypothetical unclassified, unknown  4^  PA0554 PA0559 PA0563 PA0565 PA0587 PA0596 PA0612 PA0613 PA0614 PA0615 PA0653 PA0663 PA0670 PA0671 PA0673 PA0737 PA0790 PA0808 PA0819 PA0822 PA0907 PA0908 PA0909 PA0910 PA0911 PA0912 PA0921 PA0940 PA0947 PA1055 PA1058 PA1061 PA1063 PA1064 PA1065 PA1069 PA1091 PA1096 PA1152 PA1154 PA1166 PA1213 PA1307 PA1374 PA1415 PA1433 PA1494 PA1499  1.97  Hypothetical unclassified, unknown  1.28  1.51  Hypothetical unclassified, unknown  70% similar to YhiN gene products of E. coli and H. influenzae  1.95  6.50  Hypothetical unclassified, unknown  64% similarity to Y h a H gene product of E. coli  Hypothetical unclassified, unknown  79% similar to conserved hypothetical Protein HI1053 [H. influenzae Rd].  1.62  2.06  Hypothetical unclassified, unknown  75% similar to hypothetical Protein Y e a H [E. coli]  1.17  Hypothetical unclassified, unknown  41% similar to orfT [Chlorobium tepidum]. 59% similar to hypothetical Protein Ybil [E. coli]  8.45  Hypothetical unclassified, unknown  3.99  19.29  Hypothetical unclassified unknown  3.32  15.33  Hypothetical unclassified unknown  1.72  7.21  Hypothetical unclassified unknown  2.65  Hypothetical unclassified unknown  1.49  Hypothetical unclassified unknown  1.96  Hypothetical unclassified unknown  1.52  Hypothetical unclassified unknown  1.17  1.47  Hypothetical unclassified unknown  1.70  6.14  Hypothetical unclassified unknown  1.73  Hypothetical unclassified unknown  2.44  Hypothetical unclassified unknown  1.21  1.47  1.73  1.37  1.65  1.74  1.72  Hypothetical unclassified unknown  2.15  Hypothetical unclassified unknown  1.87  Hypothetical unclassified unknown  3.39  Hypothetical unclassified unknown  7.14  Hypothetical unclassified unknown  5.83  Hypothetical unclassified unknown  6.18  Hypothetical unclassified unknown  7.30  Hypothetical unclassified unknown  1.52  Hypothetical unclassified unknown  2.28  2.23  69% similar to hypothetical Protein YhfA [E. coli].  52% similar to cell division inhibitor SulA [Serratia marcescens].  42% similar to hypothetical Protein [Haemophilus influenzae Rd].  57% similar to orflO [P.aeruginosa phage phi C T X ]  Hypothetical unclassified unknown 4.84  Hypothetical unclassified unknown  74% similar to putative D N A replication factor [E. coli]  1.49  Hypothetical unclassified unknown  71% similar to p h a C [Sinorhizobium meliloti]  1.88  Hypothetical unclassified unknown  74% similar to phaF [Sinorhizobium meliloti].  1.99  Hypothetical unclassified unknown  72% similar to hypothetical Protein Rv3684 [M. tuberculosis]  2.22  2.15  Hypothetical unclassified unknown  1.72  Hypothetical unclassified unknown  1.23 1.69  Hypothetical unclassified unknown 1.51  2.11 2.61  69% similar to hypothetical gene product y e a O of [E. coli]  Hypothetical unclassified unknown Hypothetical unclassified unknown  53% similar to C-terminal fragment of R b f C [Riftia pachyptila endosymbio  Hypothetical unclassified unknown  67%) similarity to putative Protein (Orf4) [P.aeruginosa strain DG1]  3.90  Hypothetical unclassified unknown  1.60  Hypothetical unclassified unknown  65% similar to hypothetical Protein Y a f M [E. coli]  Hypothetical unclassified unknown  50% similar to small basic Protein S b p A [Legionella pneumophila]  1.50 1.39  Hypothetical unclassified unknown  1.39  Hypothetical unclassified unknown  75% similar to hypothetical Protein YafJ [E. coli]  1.55  Hypothetical unclassified unknown  51% similar to hypothetical Protein Rv3095 [M. tuberculosis].  1.38  Hypothetical unclassified unknown 2.21  2.13 2.74  2.84  3.08  Hypothetical unclassified unknown  43% similar to c-di-GMP phosphodiesterase A [Acetobacter xylinus]  Hypothetical unclassified unknown  43% similar to hypothetical Protein AF068721 [Caenorhabditis elegans]  Hypothetical unclassified unknown  65% similar to putative hydroxypyruvate reductase; inducible by tartrate  VO  PA1509 PA1530 PA1536 PA1539 PA1540 PA1548 PA1550 PA1573 PA1577 PA1612 PA1645 PA1652 PA1657 PA1699 PA1702 PA1711 PA1761 PA1765 PA1767 PA1769 PA1774 PA1789 PA1791 PA1824 PA1825 PA1889 PA1891 PA1892 PA1893 PA1907 PA2077 PA2112 PA2120 PA2175 PA2207 PA2209 PA2243 PA2269 PA2274 PA2285 PA2287 PA2288 PA2292 PA2304 PA2353 PA2358 PA2361 PA2365  1.26  Hypothetical unclassified, unknown  1.59  1.85  Hypothetical unclassified, unknown  3.08  3.27  Hypothetical unclassified, unknown  55% similar to hypothetical Protein Rv2295 [M. tuberculosis].  1.50  1.69  Hypothetical unclassified, unknown  53% similar to a region of hypothetical Protein YijC [E. coli].  1.64 1.77  Hypothetical unclassified, unknown  80% similar to putative ethidium bromide resistance Protein [E. coli].  Hypothetical unclassified, unknown  64% similar to fixS gene product [Bradymizobium japonicum]  1.38  1.42  1.23  1.39  1.48  Hypothetical unclassified, unknown  3.00  2.73  2.24  Hypothetical unclassified, unknown  1.76  1.83  4.88  Hypothetical unclassified, unknown  Hypothetical unclassified, unknown 1.68  Hypothetical unclassified, unknown  1.50  Hypothetical unclassified, unknown  1.68  Hypothetical unclassified, unknown  68% similar to unknown Protein [E. coii]  3.14  Hypothetical unclassified, unknown  69% similar to Y o p secretion and targeting control Protein [Y. pestis]  Hypothetical unclassified, unknown  60% similar to Y s c Y [Yersinia enterocolitica]  1.93 3.02  Hypothetical unclassified, unknown  1.42 2.16  Hypothetical unclassified, unknown  1.74  2.14  Hypothetical unclassified, unknown  1.46  1.45  Hypothetical unclassified, unknown  1.81  1.76  1.67 1.49  Hypothetical unclassified, unknown  1.34  11.70  Hypothetical unclassified, unknown 2.03  Hypothetical unclassified, unknown  1.74  1.92  Hypothetical unclassified, unknown  1.36  Hypothetical unclassified, unknown  1.47  Hypothetical unclassified, unknown  1.15  Hypothetical unclassified, unknown  2.35  Hypothetical unclassified, unknown  1.16  Hypothetical unclassified, unknown  1.33  1.72  Hypothetical unclassified, unknown  2.06  1.91  Hypothetical unclassified, unknown  8.83  1.84  Hypothetical unclassified, unknown 1.91  51% similar (with gaps) to hypothetical gene product y d a A of [E. coli]  54% similar to putative structural Protein Y f c A [E. coli].  41 % similar to penicillin acylase precursor [P. sp.].  63% similar to an unknown O R F of [Bordetella pertussis]  Hypothetical unclassified, unknown  2.49  Hypothetical unclassified, unknown  2.59  Hypothetical unclassified, unknown  3.15  68% similar to hypothetical Protein YdiA [E. coli]  Hypothetical unclassified, unknown  1.65  3.76  2.19  77% similar to hypothetical gene product yijF of [E. coli]  57% similar to hypothetical Protein [Agrobacterium vitis].  Hypothetical unclassified, unknown  1.59  Hypothetical unclassified, unknown  49% similar to hypothetical Protein Rv3537 [M. tuberculosis].  1.81  2.00  Hypothetical unclassified, unknown  66% similar to hypothetical Protein S C 9 B 1 0 . 2 5 c of [S.coelicolor].  11.95  6.56  10.50  Hypothetical unclassified, unknown  1.28  Hypothetical unclassified, unknown  1.85  2.23  2.70  Hypothetical unclassified, unknown  1.76  Hypothetical unclassified, unknown  3.98  Hypothetical unclassified, unknown  1.18  3.52  2.98  1.33  Hypothetical unclassified, unknown  51% similar to syringomycin biosynthesis e n z y m e [P. syringae].  1.66  Hypothetical unclassified, unknown  51% similar to hypothetical Protein Y h c M [E. coli].  1.56  Hypothetical unclassified, unknown  2.51 1.33  2.04  Hypothetical unclassified, unknown Hypothetical unclassified, unknown  71% similar to putative 19.5 k D a Protein Eip20 [Edwardsiella ictaluri].  VO ON  PA2380 PA2389 PA2404 PA2405 PA2406 PA2418 PA2455 PA2471 PA2569 PA2576 PA2604 PA2609 PA2625 PA2632 PA2685 PA2708 PA2720 PA2728 PA2729 PA2746 PA2761 PA2765 PA2772 PA2773 PA2782 PA2785 PA2786 PA2792 PA2793 PA2797 PA2808 PA2880 PA2883 PA2898 PA2902 PA2916 PA2919 PA2937 PA2980 PA3008 PA3009 PA3010 PA3017 PA3023 PA3033 PA3040 PA3066 PA3084  2.38  2.32  2.16  2.03  Hypothetical unclassified, unknown  2.12  1.79  Hypothetical unclassified, unknown  1.93  1.73 1.38  1.22  Hypothetical unclassified, unknown Hypothetical unclassified, unknown  2.94  Hypothetical unclassified, unknown Hypothetical unclassified, unknown  2.18  2.31  Hypothetical unclassified, unknown  1.79  Hypothetical unclassified. unknown  69% similar to hypothetical Protein [Sphingomonas sp. RW5]  48% similar to hypothetical Protein YxxF [B. subtilis].  Hypothetical unclassified, unknown  69% similar to putative carrier/transport Protein Y c c A [E. coli].  1.20  Hypothetical unclassified, unknown  49% similar to phosphoribosylanthranilate transferase [Aquifex aeolicus]  Hypothetical unclassified unknown  55% similar to hypothetical Protein Y G L 0 6 7 w [E. coli).  1.27  Hypothetical unclassified unknown  1.60  1.56  Hypothetical unclassified unknown  3.22  Hypothetical unclassified unknown  1.64  Hypothetical unclassified unknown  1.65  Hypothetical unclassified unknown  1.23  Hypothetical unclassified unknown  2.54  52% similar to V g r G Protein [E. coli]; 51% similar to V g r E Protein [E. coli]  46% similar to a region of D N A helicase related Protein [M. thermoauto  Hypothetical unclassified unknown 1.85  1.41  Hypothetical unclassified unknown 1.57  Hypothetical unclassified unknown  1.97  Hypothetical unclassified unknown  1.91  Hypothetical unclassified unknown  1.32  Hypothetical unclassified unknown  1.31  Hypothetical unclassified unknown  1.21  Hypothetical unclassified unknown  1.36  52% similar to a region of hypothetical Protein [E. coli].  73% similar to hypothetical Protein Y o z G [B. subtilis].  Hypothetical unclassified unknown 1.14  Hypothetical unclassified unknown  1.32  Hypothetical unclassified unknown  1.92  Hypothetical unclassified unknown 1.78  2.23  Hypothetical unclassified unknown Hypothetical unclassified unknown  1.77  1.65  Hypothetical unclassified unknown  2.00  Hypothetical unclassified unknown  42% similar to amino acid A B C transporter(yckK) [H. pylori 26695]  1.27  Hypothetical unclassified unknown  43% similar to hypothetical Protein YfiK [E. coli].  1.67  Hypothetical unclassified unknown  2.48  Hypothetical unclassified unknown  5.78 2.77  52% similar to nuclear Protein pirin [Homo sapiens].  1.41  5.12  1.45  51% similar to putative membrane Protein [E. coli].  Hypothetical unclassified, unknown  1.22  1.34 2.24  Hypothetical unclassified, unknown  Hypothetical unclassified unknown  75% similar to hypothetical Protein Y c a R [E. coli].  5.22  6.50  Hypothetical unclassified unknown  C-terminal 120 amino acids 50% similar to sulA of [S. marcescens]  3.15  4.20  Hypothetical unclassified unknown  1.33  Hypothetical unclassified unknown  1.53  Hypothetical unclassified unknown  60% similar to hypothetical Protein 146 [Coxiella burnetii].  1.09  Hypothetical unclassified unknown  59% similar to hypothetical Protein Y e g S [E. coli].  1.28  Hypothetical unclassified unknown  1.40 1.74  1.82 1.27  Hypothetical unclassified unknown  60% similar to hypothetical Protein YqjD [E. coli].  Hypothetical unclassified unknown  66% similar to hypothetical y e c D gene product [E. coli]  Hypothetical unclassified unknown  PA3085 PA3091 PA3178 PA3180 PA3196 PA3203 PA3208 PA3275 PA3306 PA3322 PA3369 PA3373 PA3379 PA3400 PA3413 PA3414 PA3432 PA3474 PA3499 PA3505 PA3530 PA3552 PA3580 PA3611 PA3616 PA3623 PA3634 PA3649 PA3661 PA3663 PA3716 PA3722 PA3726 PA3730 PA3731 PA3732 PA3748 PA3750 PA3756 PA3773 PA3775 PA3779 PA3784 PA3787 PA3789 PA3794 PA3796 PA3799  1.86  1.62  1.98  1.94  1.41  Hypothetical unclassified, unknown 1.84  Hypothetical unclassified, unknown  2.10  Hypothetical unclassified, unknown  1.62  Hypothetical unclassified, unknown  1.42  Hypothetical unclassified, unknown  1.43  Hypothetical unclassified, unknown 1.37  Hypothetical unclassified, unknown  62% similar to E. coli ydjA hypothetical gene product.  1.34  Hypothetical unclassified, unknown  56% similar to hypothetical Protein YnfA [E. coli].  1.28  Hypothetical unclassified, unknown  1.77  Hypothetical unclassified, unknown  1.53  Hypothetical unclassified, unknown 1.47  1.49  2.08  56% similar to phnH gene product [E. coli] 45% similar to conserved hypothetical integral membrane Protein [H. pylor  4.18  Hypothetical unclassified, unknown  55% similar to hypothetical Protein Y e b G [E. coli]  1.47  Hypothetical unclassified, unknown Hypothetical unclassified, unknown  57% similar to hypothetical Protein YohJ [E. coli].  1.46  Hypothetical unclassified, unknown  70% similar to hypothetical Protein YigM [E. coli].  1.27  Hypothetical unclassified, unknown  5.55  Hypothetical unclassified, unknown  48% similar to a conserved Protein of [M.thermoautotrophicum]  Hypothetical unclassified, unknown  66% similar to Bacterioferritin-associated ferTedoxin Bfd [E. coli]  Hypothetical unclassified, unknown  80% similar to hypothetical Protein YfbE [E. coli]  Hypothetical unclassified, unknown  100% identical to OrfX of [PA01]  3.00 1.53 1.72 1.14  1.43  Hypothetical unclassified, unknown  2.05  3.09  Hypothetical unclassified, unknown  82% similar to R e c X [P. fluorescens].  Hypothetical unclassified, unknown  56% similar to lipoprotein D precursor [E. coli]  1.61 1.67  1.57  1.26  Hypothetical unclassified, unknown  55% similar to hypothetical ygbQ gene product of [H. influenzae]  1.27  Hypothetical unclassified, unknown  63% similar to hypothetical y a e L gene product of [E. coli]  1.34  Hypothetical unclassified, unknown  1.71  1.24 1.49  1.42  Hypothetical unclassified, unknown 1.25  Hypothetical unclassified, unknown  2.07  Hypothetical unclassified, unknown  1.20  Hypothetical unclassified, unknown  1.54  Hypothetical unclassified, unknown  1.52  Hypothetical unclassified, unknown  3.36  Hypothetical unclassified, unknown  54% similar to hypothetical Protein Yjfl [E. coli].  Hypothetical unclassified, unknown  64% similar to hypothetical YfjD gene product [E. coli]  1.26 1.47  1.56  Hypothetical unclassified, unknown  1.78  2.02  Hypothetical unclassified, unknown  1.59  Hypothetical unclassified, unknown  1.53 1.33  58% similar to HisP-like nucleotide binding Protein P h n N [E. coli]  Hypothetical unclassified, unknown  2.25 1.71  Hypothetical unclassified, unknown Hypothetical unclassified, unknown  1.57 1.62  72% similar to a region of hypothetical Protein Y e a C [E. coli].  1.55  1.34  1.34 1.23  53% similar to hypothetical Protein Y a e Q [E. coli].  57% similar to putative alpha helical Protein YjfJ [E. coli].  45% similar to hypothetical 28.0 KD Protein in G m h A - D i n J intergenic  Hypothetical unclassified, unknown 1.60  Hypothetical unclassified, unknown  1.59  Hypothetical unclassified, unknown  51% similar to hypothetical 36.0 K D Protein Y i a O [E. coli]  1.34  Hypothetical unclassified, unknown  1.37  Hypothetical unclassified, unknown  2.22  Hypothetical unclassified, unknown  1.77  Hypothetical unclassified, unknown  52% similar to hypothetical 13.8 KD Protein Y i d B in IbpA-GyrB intergenic  Hypothetical unclassified, unknown  76% similar to hypothetical gene product yfgK[E. coli].  49-52% similar to putative Protein from [Aquifex aeolicus]  VO  oo  PA3806 PA3819 PA3850 PA3854 PA3881 PA3882 PA3884 PA3886 PA3892 PA3904 PA3905 PA3911 PA3912 PA3934 PA3944 PA3949 PA3952 PA3953 PA3955 PA3958 PA3962 PA3966 PA3967 PA3971 PA3979 PA3980 PA3981 PA3982 PA3983 PA3992 PA3998 PA4004 PA4005 PA4013 PA4028 PA4046 PA4058 PA4065 PA4075 PA4090 PA4093 PA4099 PA4149 PA4163 PA4164 PA4181 PA4182 PA4183  1.20  1.54  Hypothetical, unclassified unknown  73% similar to 43.1 kDa hypothetical Protein (YfgB) in ndk-gcpE interge  1.76  Hypothetical, unclassified unknown  78% similar to hypothetical Protein YcfJ [E. coli]  1.66  Hypothetical, unclassified unknown  1.26  Hypothetical, unclassified unknown  1.21  Hypothetical, unclassified unknown  2.49  Hypothetical, unclassified unknown 1.75  1.94  1.90  54% similar to 11.3kb hypothetical Protein Y h b Q in SohA-Mtr intergenic  47% similar to Picea glauca emb34 gene product  Hypothetical, unclassified unknown  1.66  Hypothetical, unclassified unknown  43% similar to hypothetical Protein [Rickettsia prowazekii].  1.70  Hypothetical, unclassified unknown  61% similar to putative membrane Protein Y d h J [E. coli].  1.25  1.76  Hypothetical unclassified unknown  2.50  2.92  Hypothetical unclassified unknown  1.46  Hypothetical  unclassified unknown  65% similar to hypothetical Protein Y h b T [E. coli].  1.59  1.70  Hypothetical, unclassified unknown  65% similar to hypothetical Protein YhbV [E. coli].  1.21  1.33  Hypothetical  unclassified unknown  69% similar to hypothetical Protein [Haemophilus influenzae Rd].  1.54  Hypothetical  unclassified unknown  68% similar to probable acetyl transferase of [Proteus mirabilis]  1.45 1.25  1.41  Hypothetical unclassified unknown  1.41  Hypothetical, unclassified unknown  1.50 2.15 1.47 1.09 1.71  2.08  Hypothetical  unclassified unknown  Hypothetical  unclassified unknown  1.50  Hypothetical, unclassified unknown  1.11  Hypothetical  unclassified unknown  2.78  Hypothetical  unclassified unknown  1.54  Hypothetical, unclassified unknown  1.70  1.63  1.60  Hypothetical  2.18  2.27  3.13  Hypothetical, unclassified unknown  45% similar to hypothetical Protein YtfP [B. subtilis]  55% similar to hypothetical Protein Y r d C [B. subtilis]  unclassified unknown  1.14  1.30  Hypothetical, unclassified unknown  80% similar to putative tRNA-thiotransferase M i a B [S. typhimurium].  1.48  1.70  1.77  Hypothetical, unclassified unknown  76% similar to the P H O H - L I K E Protein of [E. coli]  1.32  1.51  Hypothetical, unclassified unknown  73% similar to the hypothetical Protein HI0004 of [H. influenzae].  2.13  2.75  Hypothetical, unclassified unknown  71% similar to the hypothetical 33.3 KD Protein in cutE-asnB intergenic  1.82  Hypothetical, unclassified unknown  48-50% similarity to portions of lytic transglycosylases  1.46  Hypothetical, unclassified unknown  58% similar to Y b e D , hypothetical 9.8 K D Protein in lipB-dacA intergenic  2.28  Hypothetical, unclassified unknown  77% similar to conserved hypothetical Protein y b e A of [E. coli]  2.22  2.77  Hypothetical, unclassified unknown  73% similar to hypothetical Protein ybeB of [E. coli]  1.24  1.38  Hypothetical, unclassified unknown  63% similar to hypothetical yohK gene product of [E. coli]  1.58 1.29  Hypothetical 1.58  Hypothetical, unclassified unknown  1.35  Hypothetical  unclassified unknown  Hypothetical  unclassified unknown  41% similar to conserved hypothetical integral membrane Protein [T. palli  Hypothetical  unclassified unknown  43% similar to hypothetical Protein Rv1597 [M. tuberculosis]  2.48 2.51  unclassified unknown  2.85  2.83  Hypothetical, unclassified unknown 1.41  1.44  Hypothetical  unclassified unknown  3.03  2.83  Hypothetical  unclassified unknown  36% similar to porin O p r D [P.aeruginosa]  1.54  Hypothetical  unclassified unknown  80% similar to hypothetical acoX gene product of [P. putida].  1.23  Hypothetical  unclassified unknown  38% similar to putative amidase [Streptomyces coelicolor]  Hypothetical  unclassified unknown  1.91  Hypothetical  unclassified unknown  1.25  Hypothetical  unclassified unknown  51% similar to hypothetical Protein Y K L 0 7 0 w [S.cerevisiae].  2.06  Hypothetical  unclassified unknown  50% similar to a region of hypothetical Protein S C 1 E6.02c [S. coelicolor].  1.77  PA4205 PA4220 PA4279 PA4308 PA4317 PA4318 PA4319 PA4323 PA4326 PA4335 PA4340 PA4359 PA4392 PA4399 PA4405 PA4451 PA4459 PA4473 PA4486 PA4488 PA4489 PA4490 PA4491 PA4492 PA4510 PA4517 PA4521 PA4523 PA4532 PA4534 PA4535 PA4536 PA4541 PA4573 PA4578 PA4582 PA4601 PA4608 PA4617 PA4620 PA4627 PA4631 PA4634 PA4636 PA4637 PA4638 PA4639 PA4642  4.66  2.77  1.65  4.69  Hypothetical unclassified, unknown  1.69  Hypothetical unclassified, unknown  100% similar to probable fptB Protein [P.aeruginosa]  1.43  Hypothetical unclassified, unknown  42% similar to a region of Bvg accessory factor [Bordetella pertussis].  Hypothetical unclassified, unknown  67% similar to hypothetical Protein YjgR [E. coli]  1.48  1.61  2.24  2.11  Hypothetical unclassified, unknown  1.91  Hypothetical unclassified, unknown  50% similar to hypothetical Protein Rv3695 [M. tuberculosis]  2.68  Hypothetical unclassified, unknown  45% similar to hypothetical Protein[Synechocystis sp.].  1.21  Hypothetical unclassified, unknown  50% similar to hypothetical Protein[Synechocystis sp.].  1.31  Hypothetical unclassified, unknown 1.41  Hypothetical unclassified, unknown  1.47  1.44  1.87  Hypothetical unclassified, unknown  2.50  2.02  2.14  Hypothetical unclassified, unknown  80% similar to F e o A (iron(ll) transport system Protein) [E. coli]  Hypothetical unclassified, unknown  63% similar to hypothetical Protein Y b a Z [E. coli].  1.31  Hypothetical unclassified, unknown  60% similar to hypothetical Protein YvqK [B. subtilis).  1.83  Hypothetical unclassified, unknown  2.35  1.36  1.37  2.07  Hypothetical unclassified, unknown  92% similar to toluene tolerance Protein Ttg2F [P. putida]  2.00  Hypothetical unclassified, unknown  42% similar to hypothetical Protein YrbK [E. coli].  1.93  Hypothetical unclassified, unknown  59% similar to yjgA gene product [E. coli]  1.44  Hypothetical unclassified, unknown  66% similar to 4-carboxymuconolactone decarboxylase P c a C [A. calco  1.57  Hypothetical unclassified, unknown  64% similar to hypothetical Protein [E. coli]  1.26  Hypothetical unclassified, unknown  71% similar to b2228 (putative membrane Protein) [E. coli]  1.49  Hypothetical unclassified, unknown  90% similar to hypothetical O R F b2229 [E. coli] (mature Protein).  1.81  Hypothetical unclassified, unknown  61% similar to yfaA (b2230  1.44  Hypothetical unclassified, unknown  57% similar to hypothetical O R F b2225 [E. coli] (mature Protein).  Hypothetical unclassified, unknown  58% similar to hypothetical Protein [Pyrococcus horikoshii].  1.26 1.65  1.63  1.67  Hypothetical unclassified, unknown  74% similar to hypothetical Protein YijP [E. coli]  1.90  1.94  2.00  Hypothetical unclassified, unknown  40% similar to signalling Protein A m p E [E. coli].  1.42  1.55  1.53  Hypothetical unclassified, unknown  1.36  1.47  Hypothetical unclassified, unknown  2.24  Hypothetical unclassified, unknown  1.41  1.52  1.54  1.49  1.46  Hypothetical unclassified, unknown  1.49  1.77  Hypothetical unclassified, unknown  2.29  1.84  1.12  1.15  Hypothetical unclassified, unknown  33% similar to P E - P G R S (glycine rich Protein) [M. tuberculosis]  Hypothetical unclassified, unknown Hypothetical unclassified, unknown 1.15  Hypothetical unclassified, unknown  70% similar to hypothetical Protein [Anabaena variabilis].  1.13  Hypothetical unclassified, unknown  61 % similar to putative nitrogen fixation positive activator Protein [Synec  1.71  Hypothetical unclassified, unknown  1.53  Hypothetical unclassified, unknown  58% similar to hypothetical Protein YgjO [E. coli].  1.74  1.76  Hypothetical unclassified, unknown  52% similar to 4-Hydroxybenzoyl-CoA reductase gamma-subunit [T. aro  1.14  1.47  Hypothetical unclassified, unknown  53% similar to putative enzyme YjjT [E. coli].  1.53  1.78  Hypothetical unclassified, unknown  44%> similar to putative dihydroflavonol 4-reductase [Synechocystis sp.].  2.17  2.42  Hypothetical unclassified, unknown  48% similar to hypothetical Protein Rv3226c [M. tuberculosis].  1.17  1.33  Hypothetical unclassified, unknown  1.84  Hypothetical unclassified, unknown  1.67  1.87  Hypothetical unclassified, unknown  2.03  1.73  Hypothetical unclassified, unknown  1.60  1.64 2.24  Hypothetical unclassified, unknown  PA4643 PA4650 PA4652 PA4656 PA4681 PA4685 PA4686 PA4689 PA4690 PA4692 PA4697 PA4701 PA4704 PA4714 PA4716 PA4717 PA4746 PA4774 PA4779 PA4780 PA4782 PA4791 PA4798 PA4799 PA4800 PA4801 PA4834 PA4841 PA4842 PA4857 PA4872 PA4874 PA4877 PA4879 PA4883 PA4884 PA4916 PA4917 PA4918 PA4925 PA4926 PA4927 PA4928 PA4933 PA4939 PA4940 PA4948 PA4949  1.41  Hypothetical unclassified, unknown  2.98  Hypothetical unclassified, unknown 2.01  Hypothetical unclassified, unknown  38% similar to outer membrane usher Protein A f a C [E. coli].  1.35  Hypothetical unclassified, unknown  70% similar to putative sugar nucleotide epimerase [E. coli]  1.41  Hypothetical unclassified, unknown  1.43 1.47  Hypothetical unclassified, unknown  1.35  1.41  Hypothetical unclassified, unknown  1.39  1.48  Hypothetical unclassified, unknown  49% similar to Paraquat-inducible Protein B [E. coli].  1.76  1.93  Hypothetical unclassified, unknown  48% similar to paraquat-inducible Protein A [E. coli].  1.80  2.95  Hypothetical unclassified, unknown  66% similar to putative reductase [E. coli]  1.45  Hypothetical unclassified, unknown  1.21  Hypothetical unclassified, unknown  53% similar to hypothetical Protein [Synechocystis s p ]  1.35  Hypothetical unclassified, unknown  42% similar to regulatory subunit of cAMP-dependent histone kinase  1.42  1.57  Hypothetical unclassified, unknown  55% similar to putative Protein [Aquifex aeolicus]  1.54  1.50  1.51  Hypothetical unclassified, unknown  45% similar to putative Phenzine biosynthesis Protein phzF [P. fluores  1.31  1.46  1.33  1.48  1.54  Hypothetical unclassified, unknown  62% similar to hypothetical Protein [E. coli]  3.19  Hypothetical unclassified, unknown  69% similar to hypothetical Protein Y h b C [E. coli].  1.56  Hypothetical unclassified, unknown  56% similar to s p e E gene product (spermidine synthase) [E. coli]  1.22  Hypothetical unclassified, unknown  52% similar to hypothetical Protein Y d e D [E. coli]  1.29  Hypothetical unclassified, unknown  48% similar to hypothetical Protein ZK632.3 IN C h r o m o s o m e III [C.elegan  1.66  Hypothetical unclassified, unknown  1.75  Hypothetical unclassified, unknown  1.57  2.24  2.28  1.55  1.65  1.17  Hypothetical unclassified, unknown  53% similar to a region of hypothetical Protein Y q k A [B. subtilis].  1.26  Hypothetical unclassified, unknown  49% similar to FlaR Protein [Listeria monocytogenes].  1.24  Hypothetical unclassified, unknown  44% similar to Met(adenosyl) methyltransferase [S. erythraea].  1.27  Hypothetical unclassified, unknown  1.60  Hypothetical unclassified, unknown  52% similar to hypothetical integral membrane Protein [T. pallidum].  1.22  Hypothetical unclassified, unknown  59% similar to putative regulator [E. coli].  2.71  Hypothetical unclassified, unknown  2.02  Hypothetical unclassified, unknown  55% similar to hypothetical Protein [Methanococcus jannaschii].  1.73  Hypothetical unclassified, unknown  47% similar to carboxyphosphonoenolpyruvate phosphonomutase  Hypothetical unclassified, unknown  64% similar to phosphate starvation-inducible Protein P s i F [E. coli].  1.92  1.23  1.52  Hypothetical unclassified, unknown  1.78  Hypothetical unclassified, unknown  67% similar to hypothetical Protein YhjG [E. coli].  2.06  Hypothetical unclassified, unknown  44% similar to hydrogenase, cytochrome subunit [H. pylori J99].  1.73  Hypothetical unclassified, unknown  1.84  1.96  Hypothetical unclassified, unknown  2.05  2.13  Hypothetical unclassified, unknown  1.91  2.41  1.26  1.39  Hypothetical unclassified, unknown 2.58  Hypothetical unclassified, unknown  50% similar to putative transport Protein Y g g B [E. coli].  1.49  Hypothetical unclassified, unknown  53% similar to hypothetical Protein Rv2569c [M. tuberculosis].  1.38  Hypothetical unclassified, unknown  51 % similar to hypothetical Protein Rv2567 [M. tuberculosis].  2.09  Hypothetical unclassified, unknown  N-terminus 78% similar to hypothetical Protein YgiR of [E. coli]  1.16  Hypothetical unclassified, unknown  1.22  1.37 1.30  51% similar to hypothetical Protein [Synechocystis sp.].  1.24  Hypothetical unclassified, unknown  47% similar to putative histidyl-tRNA synthetase HisS [B. subtilis]  18.16  15.77  Hypothetical unclassified, unknown  61% similar to hypothetical Protein YjeT [E. coli].  1.50  1.95  Hypothetical unclassified, unknown  70% similar to hypothetical Protein YjeE (E. coli]  1.44  Hypothetical unclassified, unknown  60% similar to hypothetical Protein YjeF [E. coli]  PA4950 PA4952 PA4955 PA4962 PA4963 PA4972 PA4991 PA4993 PA4998 PA4999 PA5001 PA5002 PA5003 PA5006 PA5007 PA5022 PA5024 PA5026 PA5027 PA5037 PA5047 PA5055 PA5061 PA5078 PA5081 PA5086 PA5088 PA5108 PA5109 PA5114 PA5120 PA5133 PA5138 PA5146 PA5176 PA5178 PA5184 PA5225 PA5226 PA5228 PA5229 PA5232 PA5237 PA5244 PA5245 PA5247 PA5248 PA5251  1.20 1.65  1.39  1.16 1.52  2.30  1.72  1.72  1.96  1.31  Hypothetical unclassified, unknown  75% similar to hypothetical Protein YjeS [E. coli]  2.05  Hypothetical unclassified. unknown  65% similar to conserved hypothetical Protein Y j e Q [H. influenzae Rd]  1.16  Hypothetical unclassified, unknown  1.39  Hypothetical unclassified. unknown  1.47  Hypothetical unclassified unknown  1.21  Hypothetical unclassified. unknown  1.43  Hypothetical unclassified unknown  1.36  Hypothetical unclassified unknown  1.83  Hypothetical unclassified unknown  66% similar to putative toluene tolerance Protein Ttg8 [P. putida].  2.23  Hypothetical unclassified unknown  46% similar to hypothetical Protein Ttn [P. putida].  1.89  Hypothetical unclassified unknown  2.72  Hypothetical unclassified unknown  1.71  Hypothetical unclassified unknown  1.72  Hypothetical unclassified unknown  1.40  Hypothetical unclassified unknown  100%> similar to putative heptose kinase W a p Q [P.aeruginosa].  1.76  Hypothetical unclassified unknown  59% similar to hypothetical Protein AefA [E. coli].  2.06  Hypothetical unclassified unknown  63% similar to YtnM [B. subtilis]  1.22  Hypothetical unclassified unknown  1.33  Hypothetical unclassified unknown  1.83  Hypothetical unclassified unknown  1.64  Hypothetical unclassified unknown  2.34  2.70  Hypothetical unclassified unknown  1.55  1.58  Hypothetical unclassified unknown  82%) similar to m d o G gene product of [E. coli]  Hypothetical unclassified unknown  47% similar to a hypothetical mutT-like Protein of [Streptomyces lividans]  1.24 1.63  2.17  1.54  75%) similar to phal Protein [P. oleovorans]  Hypothetical unclassified unknown Hypothetical unclassified unknown Hypothetical unclassified unknown  1.63  Hypothetical unclassified unknown  1.62  Hypothetical unclassified unknown  1.04  Hypothetical unclassified unknown  1.75  Hypothetical unclassified unknown  1.50  Hypothetical unclassified unknown  1.40  Hypothetical unclassified unknown  1.96  Hypothetical unclassified unknown  66% similar to hypothetical yrfE gene product of [E. coli]  1.71  Hypothetical unclassified unknown  72% similar to a hypothetical Protein [E. coli]  Hypothetical unclassified unknown  46% similar to chorismate mutase [Erwinia herbicola].  Hypothetical unclassified unknown  46% similar to hypothetical ygfB gene product of [E. coli]  1.58 1.31  54% similar to putative membrane Protein Y i b P [E. coli].  Hypothetical unclassified unknown 1.66  2.26  Hypothetical unclassified unknown  55%) similar to putative ligase YgfA [E. coli].  Hypothetical unclassified unknown  63% similar to a hypothetical Protein of [Synechocystis sp.]  Hypothetical unclassified unknown  78%) similar to putative membrane Protein Yhil [E. coli].  1.52  1.49  Hypothetical unclassified unknown  87% similar to hypothetical yigC gene product of [E. coli]  1.26  1.33  Hypothetical unclassified unknown  55%> similar to hypothetical y o h D gene product of [E. coli]  1.35  1.35  Hypothetical unclassified unknown  79% similar to sigma cross-reacting Protein 2 7 A of [E. coli]  1.32  Hypothetical unclassified unknown  58% similar to hypothetical yail gene product of [E. coli]  1.59  Hypothetical unclassified unknown  1.57  Hypothetical unclassified unknown  1.43  1.29  46% similar to unknown O R F of [Myxococcus xanthus]  1.43  1.33  1.83  43% similar to hypothetical Protein [Methanococcus jannaschii].  1.51  1.25  2.10  45%> similar to putative transcription activator Mig-14 [S. typhimurium].  Hypothetical unclassified unknown 1.41  1.44  68%> similar to hypothetical Protein Ybcl [E. coli]  1.47 1.46  47% similar to a region of putative transport Protein Y g g B [E. coli].  PA5257 PA5269 PA5279 PA5285 PA5286 PA5289 PA5305 PA5335 PA5392 PA5395 PA5396 PA5406 PA5414 PA5441 PA5446 PA5462 PA5463 PA5464 PA5465 PA5469 PA5471 PA5480 PA5481 PA5485 PA5486 PA5487 PA5488 PA5494 PA5515 PA5526 PA5527 PA5528 PA5532 PA5533 PA5537 PA5539 PA0345 PA1669 PA2286 PA4224 PA4370 PA4586 PA4757 PA5264 PA5478 PA1085 PA3805 PA4528  4.04  3.90  Hypothetical, unclassified, unknown  1.85  Hypothetical, unclassified, unknown  1.19  Hypothetical, unclassified, unknown  1.22 4.63  Hypothetical, unclassified, unknown  72% similar to hypothetical yjbQ gene product of [E. coli]  1.91  Hypothetical, unclassified, unknown  60% similar to C-terminal end of hypothetical yqiC gene product [E. coli]  Hypothetical, unclassified, unknown  54% similar to hypothetical ydbL gene product of [E. coli]  1.38  Hypothetical, unclassified, unknown  66% similar to hypothetical Protein YicC [H. influenzae] & [E. coli].  1.17  Hypothetical, unclassified, unknown  55% similar to hypothetical Protein 1 (vnfA 5' region) [A.vinelandii].  1.52  1.64  Hypothetical, unclassified, unknown  73% similar to hypothetical Protein [Streptomyces lividans].  Hypothetical, unclassified, unknown  51% similar to hypothetical membrane dipeptidase [P. horikoshii].  1.49  1.46  Hypothetical, unclassified, unknown  1.37  1.40  Hypothetical, unclassified, unknown  1.41  1.79  Hypothetical, unclassified, unknown  1.27 1.33  2.01  Hypothetical, unclassified, unknown  1.71  1.74  3.42  Hypothetical, unclassified, unknown  1.93  1.98  2.60  Hypothetical, unclassified, unknown  1.45  Hypothetical, unclassified, unknown  1.44  Hypothetical, unclassified, unknown  1.40  Hypothetical, unclassified, unknown  76% similar to hypothetical transmembrane Protein Y g d Q [H. influenzae  2.01  Hypothetical, unclassified, unknown  44% similar to hypothetical Protein [E. coli)  1.43  Hypothetical, unclassified, unknown  1.54 1.29  Hypothetical, unclassified, unknown 1.33  1.58  Hypothetical, unclassified, unknown  56% similar to hypothetical Protein A m p D [E. coli).  1.56  Hypothetical, unclassified, unknown  64% similar to hypothetical Protein YhgN [E. coli].  1.33  Hypothetical, unclassified, unknown  64% similar to a region of hypothetical Protein [Aquifex aeolicus]  1.29  Hypothetical, unclassified, unknown  1.27  1.77  1.36  pchG icmP  Hypothetical, unclassified, unknown 1.66  Hypothetical, unclassified, unknown  3.44  Hypothetical, unclassified, unknown  1.62  Hypothetical, unclassified, unknown  1.49  Hypothetical, unclassified, unknown  1.23  Hypothetical, unclassified, unknown  1.81  Hypothetical, unclassified, unknown  1.76  Hypothetical, unclassified, unknown  4.42  Hypothetical, unclassified, unknown  1.29  M e m b r a n e proteins  41% similar to putative membrane Protein [Synechococcus P C C 7 9 4 2 ) .  2.16  M e m b r a n e proteins  44% similar to IcmF Protein [Legionella pneumophila]  1.80  M e m b r a n e proteins  1.39  M e m b r a n e proteins  99% similar to P c h G [P.aeruginosa]  M e m b r a n e proteins  100% similar to metalloProteinase [P.aeruginosa]  4.48  1.44  M e m b r a n e proteins  1.41  M e m b r a n e proteins  55% similar to putative spore maturation Protein A [B. subtilis).  Motility & Attachment  43% similar to flagellar basal body Protein FlgJ [S. typhimurium]  1.51 1.34  70% similar to E. coli y e a S hypothetical gene product.  1.39  4.25  pilF pilD  M e m b r a n e proteins M e m b r a n e proteins  1.24  N-terminal end is 64% similar to hypothetical Protein YeiR [E. coli].  1.47  1.28 2.94  flgJ  78% similar to O R F 240 of [P. fluorescens]  Hypothetical, unclassified, unknown  1.26  1.48  48% similar to (hypothetical?) hemY gene product of [E. coli]  Motility & Attachment  100% identical to PilF [P.aeruginosa]  Motility & Attachment  99% similar to pilD [P.aeruginosa]  O  PA4550 PA5043 PA5044 PA0148 PA0336 PA0441 PA0444 PA0590 PA3050 PA3527 PA3654 PA3770 PA4314 PA4670 PA4758 PA4854 PA4855 PA5129 PA5425 PA0677 PA0678 PA1692 PA1693 PA1696 PA1698 PA1720 PA1724 PA3405 PA4144 PA4276 PA4747 PA5068 PA5069 PA0219 PA0249 PA0298 PA0299 PA0372 PA0421 PA0531 PA0656 PA0657 PA0658 PA0779 PA0817 PA0863 PA0954 PA1046  fimU  1.55  1.27  Motility & Attachment  pilN  1.19  -1.23  Motility & Attachment  pilM  1.28  ygdP dht  2.04  Identical to pilM gene product of P A O L  1.40  Nucleotide biosynthesis and metabolism  46% similar to adenosine deaminase [E. coli]  1.78  1.82  Nucleotide biosynthesis and metabolism  81% similar to putative invasion Protein Y g d P [E. coli].  2.36  1.92  Nucleotide biosynthesis and metabolism  95% similar to D-hydantoinase [P. putida]  1.45  Nucleotide biosynthesis and metabolism  55% similar to DL-hydantoinase (N-carbamyl-L-amino acid amidohydrola  1.39  Nucleotide biosynthesis and metabolism  64% similar to E. coli a p a H gene product.  1.54  Nucleotide biosynthesis and metabolism  71% similar to E. coli dehydroorotate dehydrogenase.  1.23  Nucleotide biosynthesis and metabolism  66% similar to pyrC gene product of [E. coli]  apaH pyrO  1.28  pyrC pyrH  1.33  guaB purU1  1.30 1.63  prs carA purH  80% similar to PyrH gene product of [E. coli]  Nucleotide biosynthesis and metabolism  81%> similar to E. coli guaB gene product  1.63  Nucleotide biosynthesis and metabolism  67% similar to formyltetrahydrofolate deformylase [Aquifex aeolicus]  1.75  Nucleotide biosynthesis and metabolism  82% similar to phosphoribosylpyrophosphate synthetase of [E. coli].  Nucleotide biosynthesis and metabolism  1.61  purD got  Nucleotide biosynthesis and metabolism 1.42  1.19 1.46  1.42 1.11  purK  1.66 2.03  3.40  popN  1.50  pscG pscK  66% similar to grxC gene product of [E. coli].  Nucleotide biosynthesis and metabolism 43% similar to general secretory pathway Protein J [B. pseudomallei].  Protein secretion/export apparatus  50% similar to general secretory pathway Protein H [B. pseudomallei].  Protein secretion/export apparatus  88% similar to Y o p Proteins translocation Protein Y s c S [Y. pseudotuber  Protein secretion/export apparatus  90% similar to Y o p Proteins translocation Protein R homolog [Y. pestis]  Protein secretion/export apparatus  57% similar to Y s c O translocation Protein [Yersinia pseudotuberculosis]  2.71  3.12  1.45  hasE  1.42  secE  81% similar to E. coli purD gene product.  Nucleotide biosynthesis and metabolism  Protein secretion/export apparatus  1.81  1.98  78% similar to phosphoribosylaminoimidazolecarboxamideformyltransfera  Nucleotide biosynthesis and metabolism  1.71  1.68  pscO  Nucleotide biosynthesis and metabolism  1.19  1.66 pscR  Identical to pilN gene product of P A 0 1 .  Motility & Attachment  2.03 1.54  Protein secretion/export apparatus  64% similar to Y o p N [Yersinia enterocolitica]  Protein secretion/export apparatus  69% similar to y s c G gene product [Yersinia enterocolitica]  Protein secretion/export apparatus  86% similar to P s c K [P.aeruginosa]  Protein secretion/export apparatus  77% similar to metalloprotease transporter H a s E [Serratia marcescens].  Protein secretion/export apparatus  49% similar to secretion Protein C y a E [Bordetella pertussis].  1.75  Protein secretion/export apparatus  65% similar to preProtein translocase S e c E [E. coli]  secG  1.54  Protein secretion/export apparatus  67% similar to S e c G gene product of E. coli  tatA  1.73  Protein secretion/export apparatus  62% similar to TatA Protein [E. coli]  2.02  Protein secretion/export apparatus  66% similar to O R F 4 [Azotobacter chroococcum]  1.31  Putative e n z y m e s  68% similar to aldehyde dehydrogenase AldH [E. coli].  Putative e n z y m e s  54% similar to hypothetical Protein Y i a C [E. coli]  1.41  Putative e n z y m e s  50% similar to putative glutamine synthetase Y c j K [E. coli]  1.49  Putative e n z y m e s  53% similar to beta-alanine-pyruvate transaminase [P. putida]  1.58  Putative e n z y m e s  53%) similar to hypothetical zinc protease Y 4 W A [Rhizobium sp. NGR234]  1.14  Putative e n z y m e s  43%) similar to monoamine oxidase B [Homo sapiens].  tatB  1.70  2.50  2.04  1.14  2.76  1.47  Putative e n z y m e s  58%) similar to hypothetical Protein [Synechocystis sp.].  2.52  Putative e n z y m e s  72% similar to histidine triad nucleotide-binding Protein (HINT) [O. cunicul 57% similar to putative cell division cycle Protein [Synechocystis sp.].  1.56  Putative e n z y m e s  1.80  3.22  Putative e n z y m e s  56%o similar to hypothetical Protein Rv1544 [M. tuberculosis].  2.10  2.23  Putative e n z y m e s  61%) similar to mitochrondial ATP-dependentprotease [Homo sapiens]  1.41  1.79  Putative e n z y m e s  71% similar to hypothetical Protein [Bordetella pertussis].  2.71 1.42 1.88  1.33  Putative e n z y m e s  50% similar to putative zinc-binding dehydrogenase [S.pombe].  Putative e n z y m e s  68% similar to putative acylphosphatase A c y P [E. coli]  Putative e n z y m e s  48% similar to beta-agarase B (AgaB) [Vibrio sp.]  PA1535 PA1565 PA1576 PA1654 PA1737 PA1828 PA1990 PA2124 PA2125 PA2263 PA2302 PA2333 PA2402 PA2499 PA2631 PA2891 PA2922 PA3001 PA3035 PA3368 PA3444 PA3534 PA3774 PA3798 PA3803 PA4079 PA4089 PA4217 PA4330 PA4401 PA4619 PA4621 PA4715 PA4786 PA4819 PA4899 PA4907 PA4943 PA4980 PA5000 PA5004 PA5005 PA5008 PA5048 PA5084 PA5312 PA5384 PA5386  1.64  1.44  Putative e n z y m e s  56% similar to long chain acyl-CoA dehydrogenase [Rattus norvegicus]  1.44  Putative enzymes  58% similar to P R O B A B L E O X I D O R E D U C T A S E O r d L [E. coli]  1.59  1.70 .  1.19 1.67 1.30 1.28  3.09  1.21 2.42  Putative e n z y m e s  70% similar to putative fatty oxidation Protein [Streptomyces coelicolor].  Putative e n z y m e s  59% similar to 7-alpha-hydroxysteroid dehydrogenase [Eubacterium sp.]. 51% similar to hypothetical Protein of [Synechocystis s p ]  1.53  Putative e n z y m e s  46-50% similar to many dehydrogenases  1.43  Putative e n z y m e s  56% similar to glycine betaine aldehyde dehydrogenase [B. subtilis]  Putative e n z y m e s  68% similar to yiaE gene product (putative dehydrogenase) [E. coli].  Putative enzymes  50% similar to regions of tnicrocystin synthase M c y A [M. aeruginosa].  Putative enzymes  49% similar to phosphonate monoester hydrolase [B. caryophylli].  Putative enzymes  54% similar to bacitracin synthetase 3 [B. licheniformis]  1.87  Putative e n z y m e s  61% similar to hypothetical Protein YkoA [B. subtilis]  1.78  Putative e n z y m e s  59% similar to hypothetical Protein YjcF [B. subtilis].  Putative e n z y m e s  60% similar to M. tuberculosis B c c A 63% similar to hippurate hydrolase [Campylobacter jejuni].  1.63  1.69  64% similar to O R F 4 2 of [Yersinia pestis]  Putative e n z y m e s  1.99  1.29  53% similar to 3-hydroxyisobutyrate dehydrogenase [P.aeruginosa]  Putative enzymes  1.88  1.52  2.35  Putative enzymes  1.46  1.35  1.37  1.41  1.49  Putative e n z y m e s  2.41  2.33  Putative e n z y m e s  76% similar to putative glyceraldehyde-3-phosphate dehydrogenase  Putative e n z y m e s  60% similar to G S T A Protein [Rhizobium leguminosarum].  2.49  Putative e n z y m e s  1.68 1.58  1.69  1.51 1.47  gcpE  1.86  45% similar to hypothetical Protein Rv0197[M. tuberculosis]  Putative e n z y m e s  56% similar to hypothetical Protein AF0130[Archaeoglobus fulgidus].  1.87  Putative e n z y m e s  69% similar to putative aminotransferase Y b d L [E. coli].  Putative e n z y m e s  85% similar to E. coli G c p E Protein  1.67  Putative enzymes  - 5 0 % similar to several putative dehydrogenases from diverse organisms.  1.48  1.91  Putative e n z y m e s  58% similar to 3-oxoacyl-[acyl-carrier-Protein] reductase [E. coli].  1.63  2.16  Putative e n z y m e s  46% similar to hypothetical Protein [Bordetella pertussis].  Putative e n z y m e s  51% similar to putative enoyl-CoA isomerase P a a G [ E . coli].  2.18  2.07  Putative e n z y m e s  47% similar to hypothetical glutathione S-transferase Y f c F [E. coli].  1.97  2.26  Putative e n z y m e s  53% similar to cytochrome c553 [Gluconobacter suboxydans].  1.31  1.46  Putative e n z y m e s  2.08  2.45  Putative e n z y m e s  94% similar to putative aminotransferase [E. coli].  1.34  1.39  Putative e n z y m e s  66% similar to putative 3-oxoacyl-[acyl-carrier Protein] reductase F a b G 4  Putative e n z y m e s  65% similar to SLL0501 hypothetical Protein [Synechocystis sp.]  Putative e n z y m e s  77% similar to aldehyde dehydrogenase [P. putida]  2.24  Putative e n z y m e s  70% similar to putative oxidoreductase Y d f G [E. coli].  2.78  Putative e n z y m e s  73% similar to putative G T P a s e [E. coli]  1.42  Putative e n z y m e s  51% similar to putative enzyme P a a G [E. coli].  1.48 2.49  95% similar to putative FmnH2-dependent monooxygenase S s u D  Putative e n z y m e s 1.42  1.70  2.40  Putative e n z y m e s  1.53 2.62 1.61  1.37  1.33  1.62  Putative e n z y m e s  54% similar to mucus-inducible Protein MigA [P.aeruginosa].  3.08  1.74  2.48  Putative e n z y m e s  45-48% similar to several Proteins involved capsule or L P S biosynthesis. 50% similar to M O D U L A T I O N Protein NolO [Rhizobium sp. NGR234]  1.22  1.31  Putative e n z y m e s  1.46  1.81  1.94  Putative e n z y m e s  100% similar to putative heptose kinase W a p P [P.aeruginosa].  1.42  1.41  1.37  Putative e n z y m e s  53% similar to thermonuclease of [Staphylococcus intermedius]  1.41  1.43  Putative e n z y m e s  55% similar to d a d A gene product of [E. coli]  Putative e n z y m e s  71% similar to aldH gene product of [E. coli]  1.26  Putative e n z y m e s  53% similar to putative lipase Lipl [M. tuberculosis].  1.25  Putative e n z y m e s  56% similar to putative 3-hydroxyacyl-CoA dehydrogenase [A. fulgidus].  1.27  PA0616 PA0617 PA0618 PA0619 PA0620 PA0621 PA0622 PA0623 PA0624 PA0625 PA0626 PA0627 PA0628 PA0629 PA0630 PA0631 PA0632 PA0633 PA0634 PA0635 PA0636 PA0637 PA0638 PA0639 PA0640 PA0641 PA0642 PA0643 PA0644 PA0645 PA0646 PA0647 PA0648 PA0763 PA0985 PA1150 PA1900 PA3319 PA3542 PA3866 PA4457 PA1294 PA2976 PA3528 PA3744 PA3861 PA4238 PA4544  2.37  1.61  2.91  13.04  Related to phage, transposon, or plasmid  50% similar to putative baseplate Protein [P.aeruginosa phage phi C T X ] .  3.02  13.86  Related to phage, transposon, or plasmid  65% similar to M Protein [Bacteriophage 186].  2.13  9.97  Related to phage, transposon, or plasmid  69% similar to baseplate assembly Protein J (GpJ) [Bacteriophage P2].  3.19  14.72  Related to phage, transposon, or plasmid  77% similar to orf19 [P.aeruginosa phage phi C T X ] .  2.66  12.10  Related to phage, transposon, or plasmid  80% similar to orf20 [P.aeruginosa phage phi C T X ] .  4.31  16.68  Related to phage, transposon, or plasmid  55% similar to orf21 [P.aeruginosa phage phi C T X ]  2.42  10.25  Related to phage, transposon, or plasmid  91 % similar to contractile tail sheath Protein (gpFI) [Bacteriophage PS17).  2.88  12.84  Related to phage, transposon, or plasmid  84% similar to contractile tail tube Protein [bacteriophage PS17].  2.66  12.78  Related to phage, transposon, or plasmid  2.50  14.10  Related to phage, transposon, or plasmid  1.81  9.75  Related to phage, transposon, or plasmid  2.34  10.75  Related to phage, transposon, or plasmid  56% similar to on*8 [P.aeruginosa phage phi C T X ] .  9.95  Related to phage, transposon, or plasmid  48% similar to essential tail Protein G p D [Bacteriophage P2].  1.80 2.21 1.59 2.39 3.39 1.96  4.35  Related to phage, transposon, or plasmid Related to phage, transposon, or plasmid  16.20  Related to phage, transposon, or plasmid  21.20  Related to phage, transposon, or plasmid  16.37  Related to phage, transposon, or plasmid Related to phage, transposon, or plasmid  15.89  Related to phage, transposon, or plasmid  9.99  Related to phage, transposon, or plasmid  11.02  Related to phage, transposon, or plasmid  53% similar to gp17 [Bacteriophage N15]  8.45