Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

CD34 and CD43 block mast cell adhesion and are required for optimal mast cell reconstitution Drew, Erin Christina 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-104848.pdf [ 18.19MB ]
Metadata
JSON: 831-1.0092335.json
JSON-LD: 831-1.0092335-ld.json
RDF/XML (Pretty): 831-1.0092335-rdf.xml
RDF/JSON: 831-1.0092335-rdf.json
Turtle: 831-1.0092335-turtle.txt
N-Triples: 831-1.0092335-rdf-ntriples.txt
Original Record: 831-1.0092335-source.json
Full Text
831-1.0092335-fulltext.txt
Citation
831-1.0092335.ris

Full Text

CD34 AND CD43 BLOCK MAST CELL ADHESION AND ARE REQUIRED FOR OPTIMAL MAST CELL RECONSTITUTION By ERIN CHRISTINA DREW B . S c , The University of British Columbia, 2000 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES GENETICS THE UNIVERSITY OF BRITISH COLUMBIA July 2005 © Erin Drew, 2005 ABSTRACT C D 3 4 is a cell sur face s ia lomucin expressed by hematopoie t ic s tem cells (HSC) and vascu la r endothel ia and is widely used for the enr ichment of human hematopoie t ic s tem cells because of its se lect ive express ion on progeni tor cel ls and absence on mature hematopoie t ic cel ls. A l though C D 3 4 was undetectable in all mur ine progeni tor cell l ines tes ted , high express ion was detected in bone mar row-der ived mast cel ls (BMMC) and in per i toneal mast cel ls ana lyzed in vivo. Our results demonst ra te that , cont rary to current d o g m a , C D 3 4 is expressed by one mature hematopoie t ic l ineage: mast cel ls. Our data also demonst ra te that ant igenica l ly , mur ine mast cel ls , and their p recursors , c losely resemble H S C . However , in contrast , human C D 3 4 is not expressed by human mast ce l ls , and this d ichotomy represents a regulatory di f ference for this protein between these two spec ies . Despi te its popular i ty as an H S C marker , the funct ion of C D 3 4 on hematopoie t ic cel ls remains en igmat ic . Here I have addressed this issue by examin ing the behav ior of mutant mast cel ls lacking C D 3 4 , the related s ia lomuc in , C D 4 3 , or both molecu les . Loss of these molecu les leads to a gene-dose-dependen t increase in mast cell homotyp ic aggregat ion with C D 3 4 / C D 4 3 K O s > C D 4 3 K O > C D 3 4 K O > i i wild type. Impor tant ly , re -express ion of C D 3 4 or C D 4 3 in these cel ls caused reversal of this phenotype. Fur thermore , I found that loss of these s ia lomuc ins prevented mast cell repopulat ion and hematopoie t ic precursor reconst i tut ion in W / W v recipients. However , the abi l i ty of these cel ls to reconst i tute lethally i r radiated wild type mice is not impa i red , p resumab ly due to irradiat ion induced di f ferences within the host. Our data provide the first c lear-cut ev idence for a hematopoie t ic funct ion for C D 3 4 and suggest that it acts as a negat ive regulator of cell adhes ion . i i i TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF TABLES viii LIST OF FIGURES ix LIST OF ABBREVIATIONS xi ACKNOWLEDGEMENTS xiv CO-AUTHORSHIP STATEMENT xx CHAPTER 1 1 INTRODUCTION 1 1.1 HEMATOPOIESIS 1 1.2 Hematopoietic Stem Cells 3 1.2.1 History of HSC 3 1.2.2 Identification of the HSC 4 1.2.3 HSC differentiation 4 1.2.3.1 The Traditional paradigm 4 1.2.3.2 Challenges to the traditional paradigm 5 1.2.5 The HSC BM niche 6 1.2.6 HSC adhesion/migration 8 1.2.6.1 Hematopoietic migration during embryogenesis 8 1.2.6.2 Adult HSC migration 9 1.2.6.2.1 HSC migration from blood to BM 9 1.2.6.2.2 HSC Chemotaxis 12 1.2.6.2.3 HSC interactions with the BM niche 13 1.2.6.2.4 HSC mobilization: BM to blood migration 16 1.3 Mast cells 18 1.3.1 Mast cell development 18 1.3.1.1 Hematopoietic origin of mast cells 18 1.3.1.2 The identification of the mast cell precursor 20 1.3.1.3 Types of mast cells 21 1.3.1.4 Mast cell development and microenvironment 23 1.3.1.5 Mast cell growth factors 24 1.3.1.6 Regulation of mast cell frequencies 25 1.3.2 Mast cell Migration 26 1.3.2.1 Mast cell adhesion to ECM 26 1.3.2.2 Mast cell adhesion to other cells 27 1.3.2.3 Tissue specific homing of mast cell progenitors 28 1.3.2.4 Chemotaxis 31 1.3.3 Mast cell function 32 1.3.3.1 Mast cells and Allergies 32 1.3.3.1.1 Mast cells and allergic asthma 34 1.3.3.2 Mast cells in innate immunity 36 1.3.3.2.1 Protection from peritonitis 36 1.3.3.2.5 Phagocytosis 38 1.3.3.2.4 Fim H and CD48 39 1.3.3.2.3 Antigen presentation and lymphocyte interaction 39 iv 1.3.3.3 Mast cells and autoimmunity 40 1.3.3.3.1 Arthritis 41 1.3.3.3.2 Experimental autoimmune/allergic encephalomyelitis 42 1.4 The CD34 family and CD43 44 1.4.1 Introduction 44 1.4.1.1 The CD34 family 44 1.4.1.2 CD43 46 1.4.2 Functions of the CD34 family and CD43 49 1.4.2.1 Differentiation and proliferation 50 1.4.2.2 Adhesion 52 1.4.2.3 Anti-adhesion 54 1.4.3 CD34 and podocalyxin on stem cells 58 1.4.4 CD34 family and CD43 in signal transduction 60 1.4.4.1 CD34 and CrkL 62 1.4.4.2 Podocalyxin/CD43 and ERM proteins 63 1.5 Aims of Study 64 1.6 References 66 CHAPTER 2 101 CD34 is A SPECIFIC MARKER OF MATURE MURINE MAST CELLS 101 2.1 Introduction 101 2.2 Results 103 2.2.1 CD34 mRNA expression by murine progenitor cell lines and cultured primary cells 103 2.2.2 CD34 protein expression on cultured mast cells 104 2.2.3 CD34 protein expression on in vivo mast cells 106 2.2.4 Lineage marker analysis of in vivo mast cells 110 2.3 Discussion 110 2.3.1 CD34 and stem cell purification 110 2.3.2 CD34 and stem cell biology 113 2.3.3 CD34 and mast cell biology 115 2.4 Experimental Procedures 116 2.4.1 BM-derived mast cells 116 2.4.2 Resident peritoneal mast cells 116 2.4.3 Northern blot analysis 117 2.4.4 Reverse transcription-PCR (RT-PCR) 117 2.4.5 Western Blotting 117 2.4.6 Histochemical analyses 118 2.4.7 Flow cytometric analyses 118 2.5 Acknowledgements 119 2.6 References 120 CHAPTER 3 127 MOUSE, BUT NOT HUMAN, MATURE MAST CELLS EXPRESS CD34 127 3.1 Introduction 127 3.2 Results and Discussion 128 3.2.1 mCD34, but not hCD34 protein is expressed by hCD34tg BMMC 128 3.2.2 mCD34, but not hCD34 RNA is expressed by hCD34tg BMMC 129 3.3 Experimental Procedures 131 3.3.1 Mice 131 3.3.2 BM derived mast cells 131 3.3.3 Flow cytometry 131 3.3.4 RT-PCR 132 3.4 Acknowledgements 132 3.5 References 133 v CHAPTER 4 135 CD34 AND CD43 INHIBIT MAST CELL ADHESION AND ARE REQUIRED FOR OPTIMAL MAST CELL RECONSTITUTION 135 4.1 Introduction 135 4.2 Results 138 4.2.1 Loss of CD34 leads to increased homotypic adhesion of BM-derived mast cells (BMMC) 138 4.2.2 Loss of the sialomucin, CD43, also leads to homotypic aggregation/adhesion 142 4.2.3 Homotypic adhesion is divalent cation-dependent and cell autonomous 145 4.2.4 CD34 and/or CD43 are required for optimal mast cell progenitor migration in vivo 147 4.2.5 CD34 and/or CD43 are required for mast cell repopulation of the peritoneal cavity in W / W v mice 150 4.2.6 CD34 is required for progenitor cell repopulation of the BM in W / W v mice 153 4.3 Discussion 155 4.3.1 CD34 as blocker of differentiation, enhancer of proliferation, or homing receptor? 156 4.3.2 CD34 as a pro-adhesion or an anti-adhesion molecule? 157 4.3.3 Function of CD34 and CD43 on mast cells and their progenitors 159 4.3.4 The role of CD34 and CD43 in hematopoietic progenitor cell colonization of BM 160 4.4 Experimental Procedures 163 AAA Mice 163 4.4.2 BM Derived Mast Cells 164 4.4.3 Nucleic Acid Analyses 164 4.4.4 Retroviral infections 166 4.4.5 Homotypic adhesion assays 166 4.4.6 Fibronectin adhesion assay 167 4.4.7 Histology 168 4.4.8 Mast cell precursor limiting dilution analysis 168 4.4.9 Mast cell recovery 169 4.4.10 W / W v reconstitution 170 4.4.11 FACS Analysis 171 4.4.12 Statistical Analysis 171 4.5 Acknowledgements 172 4.6 References 173 CHAPTER 5 181 CD34 AND CD43 ARE NOT REQUIRED FOR RECONSTITUTION OF LETHALLY IRRADIATED RECIPIENTS 181 5.1 Introduction 181 5.2 Results and Discussion 182 5.2.1 CD34KO and CD34/CD43 DKO BM cells reconstitute hematopoiesis under competitive conditions in lethally irradiated recipients 182 5.2.2 Loss of CD34 or CD43 does not cause a selective advantage to reconstitution of particular hematopoietic lineages 185 5.3 Experimental Procedures 189 5.3.1 Mice 189 5.3.2 Sca-1 enrichment and depletion 189 5.3.3 Competitive Reconstitution 190 5.3.4 Antibodies and Flow cytometry 190 5.3.5 Statistical Analyses 191 5.4 Acknowledgements 191 5.5 References 192 CHAPTER 6 194 vi SUMMARY AND PERSPECTIVES 194 6.1 CD34 on mature mast cells 194 6.2 The paradox: CD34 preventing adhesion 196 6.3 CD34 and CD43: proteins promoting mast cell repopulation 196 6.4 CD34 and CD43 function on HPC and HSC 197 6.5 Fueling or fixing the controversy? 198 6.6 How does CD34 signal? 200 6.7 Future models for CD34 and CD43 in mast cell function 201 6.8 References 203 vii LIST OF TABLES C h a p t e r 1 Table 1.1 Types of murine mast cells. Table 1.2 Distribution of C D 3 4 family C h a p t e r 2 No tables C h a p t e r 3 No tables C h a p t e r 4 No tables C h a p t e r 5 No tables C h a p t e r 6 No tables viii LIST OF FIGURES C h a p t e r 1 Figure 1.1 Hematopoiesis 2 Figure 1.2 Interactions of HSC with the bone marrow niche 7 Figure 1.3 Tissue specific homing of mast cell precursors 20 Figure 1.4 Mast cells and type I hypersensitivity 33 Figure 1.5 Mast cells and innate immunity 37 Figure 1.6 The CD34 family: proteins, genes and splicing 45 Figure 1.7 Expression of CD34 and CD43 by hematopoietic cells 48 Figure 1.8 Proposed functions for the CD34 family 50 Figure 1.9 Established and Proposed interactions of CD43 / CD34/Podocalyxin and the cytoskeleton 62 C h a p t e r 2 Figure 2.1 Expression of murine CD34 mRNA and protein by mature bone marrow-derived mast cells 105 Figure 2.2 Expression of murine CD34 antigen by connective tissue-type mast cells in vivo 107 Figure 2.3 Peritoneal mast cells express CD34 109 Figure 2.4 Flow cytometric analysis of lineage marker expression by peritoneal mast cells I l l C h a p t e r 3 Figure 3.1 Murine, but not human CD34 is expressed by hCD34tg BMMC 129 IX C h a p t e r 4 Figure 4.1 Structure of CD34 and CD43 139 Figure 4.2 Loss of CD34 increases homotypic aggregation o fBMMC 141 Figure 4.3 CD34 and CD43 both block BMMC aggregation 143 Figure 4.4 Homotypic adhesion is divalent cation dependent and cell autonomous 146 Figure 4.5 CD34 and CD43 are Essential for Optimal Recovery of Peritoneal Mast Cells 148 Figure 4.6 CD34 and CD43 are required for optimal peritoneal mast cell reconstitution of mast cell-deficient mice 151 Figure 4.7 Loss of CD34 prevents bone marrow engraftment.... 154 C h a p t e r 5 Figure 5.1 Model of competitive reconstitution lethally irradiated mice and reconstitution results for each donor 184 Figure 5.2 The contribution to hematopoietic lineages by wild type CD45.1 and KO CD45.2 donor cells 187 C h a p t e r 6 No figures LIST OF ABBREVIATIONS 5-FU 5-f luorouracil 7 A A D 7-aminoactinomycin D 7 -TMR 7- t ransmembrane helix receptor AGM aortic-gonad-mesonesphros region APC antigen presenting cell ATP adenosine triphosphate bcj/bg1 beige mice (Chediak-Higashi syndrome (giant granules) BI/6 black-6 wild type mice BM bone marrow BMMC bone marrow derived mast cell BSA bovine serum albumin „ 2+ . . Ca calcium CD cluster of differentiation C D 3 4 F L full length C D 3 4 CT C D 3 4 cytoplasmically truncated C D 3 4 CHO Chinese hamster ovary C K 2 casein kinase 2 CFU colony forming unit CLA cutaneous lymphocyte antigen CLP common lymphoid progenitor CLP cecal ligation and puncture CMP common myeloid progenitor CNS central nervous system C O 2 carbon dioxide CSA-SE SNARF-1 carboxylic acid, acetate, succinimidyl ester CTMC connective tissue mast cell DKO double knock-out DNA deoxyribose nucleic acid EAE experimental autoimmune/allergic encephalomyelitis ECM extracellular matrix EDTA disodium ethylenediamine tetraacetate EGTA ethylenebis(oxyethylenenitrilo)-tetraacetic acid ELAM-1 endothelial leukocyte adhesion molecule 1 ERM ezrin-radixin-moesin ES embryonic stem FACS fluorescence activated cell sorter FBS fetal bovine serum FITC fluorescein isothiocyanate G-CSF granulocyte colony stimulating factor xi GFP green fluorescent protein GM-CSF granulocytic macrophage colony stimulating factor GVHD graft-versus-host disease HA hyaluronic acid HBSS Hanks buffered salt solution HEV high endothelial venules HPC hematopoietic progenitor cell HSC hematopoietic stem cell HUVEC human umbilical vein endothelial cells ICAM intercellular cell adhesion molecule IFN-y interferon gamma ig immunoglobulin IL interleukin JAM-A junctional adhesion molecule A KO knock-out LFA-1 leukocyte function-associated antigen-1 LPS lipopolysaccaride LRP low-density lipoprotein receptor-related protein LTB 4 leukotriene B4 L T C 4 leukotriene C4 LT-HSC long-term hematopoietic stem cell MAdCAM-1 mucosal addressin cell adhesion molecule-1 MDCK Madin-Darby canine kidney MCp mast cell precursor MCP-1 monocyte chemoattractant protein-1 M C T human mast cell; tryptase-positive, chymase-negative M C T C human mast cell; tryptase-positive, chymase-positive MMP-9 metalloproteinase-9 MHC major histocompatibility complex M l P - l a macrophage inflammatory protein MMC mucosal mast cell mMCP-1 mouse mast cell protease-1 NHERF2 Na + /H + -exchange regulatory factor 2 NOD/SCID nonobese diabetic/severe combined immunodeficient NK natural killer OVA ovalbumin PAF platelet activating factor PBS phosphate-buffered solution PCR polymerase chain reaction PE phycoerythrin PKC protein kinase C PSGL-1 P-selectin glycoprotein ligand-1 xii RANTES regulated on act ivat ion normal T expressed and secreted RFI relat ive f luorescent intensity RHAMM receptor for hya luronan ac id -med ia ted moti l i ty RNA r ibose nucleic acid RPMI Roswel l Park Memor ia l Inst i tute Sca -1 s tem cell ant igen-1 S C F s tem cell factor S C I D severe combined immunodef ic ient S D F - 1 s t romal der ived factor-1 S g l G S F spermatogen ic immunog lob in super fami ly SI/SI s tee l -d ick ie SP side populat ion S T - H S C shor t - te rm hematopoiet ic s tem cell T B S tr is buffered solut ion TGF-p t ransforming growth factor-beta T N F - a t umor necrosis factor-a lpha TPA 1 2 - 0 - te t radecanoy lphorbo l -13-aceta te V C A M - 1 vascu la r cell adhes ion molecu le-1 V E G F vascu la r endothel ia l growth factor W A S P Wiskot t -A ldr ich synd rome protein w / w v dominant spot t ing/v iab le dominant spott ing (mast ce l l -def ic ient mice) xiii ACKNOWLEDGEMENTS This would not have been possible without so many people that I have had the privilege of having in my life—some longer and some for a short while. Thank-you so much to each one of you. First and foremost to Kelly. Thank-you believing in me even when I did not believe in myself. Things have happened that I never thought possible that would not have occurred had I not been gently pushed by you to do them. Thank-you for showing me how fun science is and for creating an environment that resembles more a family than a workplace. I thank you for your friendship, your encouragement, your advice and your openness. I could not have done this without you— that is certain. Thank-you for making me realize my potential—both scientifically and otherwise. And singing with you guys was a blast! To my parents—who have supported me through everything. Thank-you for your constant love and for your encouragement. I don't know what I would do without you. To Fabio. From SP cell staining to showing me Picasso and Van Gogh, talking philosophy of life walking the streets of Paris, to sailing in the high winds and attending to my dislocated shoulder in emergency. Thank-you for the fun you have brought into my experience as a graduate student and the mentor that you have been to me scientifically. You will always run faster than me, will sail in stronger winds than me and will be more opinionated than me. Thanks for challenging me and putting me in my place when I needed it. xiv To Linda. Thank-you for showing me what a good friend is. I am forever grateful to you for your loyalty throughout everything good and bad that has happened these past few years. I will miss you more than you will know. Thanks for great chats at Nat's pizzeria—about men and money and philosophy. For girl's nights out, to sailing (even if the sail was backwards and we had a little trouble getting the boat in and we took out the wrong boat to begin with), to laughing about life in general. Thank-you for your generosity, for taking care of me, for your support, for yoga, for your drill sergeant encouragement during our regular runs, until I could actually keep up to you. To decorating parties, dinner parties (with line dancing), silly dancing songs at Philphest, camping with a Canada hat to forgetting where we are going because we are talking so much. I cannot thank-you enough. I will miss you so much. Please come and visit me. To Jeff. Thank you for opening me. Your love helped draw me out of myself. Thanks for the fun that we had; for making me laugh; and for your patience as I tried to figure everything out. To Lish. For making me smile. You are so cute! To Shawnah. Thank-you for sharing Quinn with us, from the beginning of the pregnancy and on. Thanks for coffees and for your enthusiasm decorating and shopping and putting on some great parties. You are an inspiration in how you approach life and how you love. X V To John Schrader . Thank -you for your adv ice when I asked for it, for your en thus iasm for sc ience in general and your suppor t th roughout my degree . To Mindy. Thank -you for your f r iendship. From late night on the FACS to "Ou t of the C o l d " , advanced hip-hop dance c lass , to teaching e lementa ry c lasses . It has been real ly fun having you around these past few years . Thanks for your encouragement when I was feel ing unsure and for your suppor t . Thanks to the lab.. .Regis, Jam ie , Jul ie , Sh ier ley , He len , S t e v e , Mindy, Kel ly , Michae l , Poh , Sebast ian and all those that came and went (Le isha, May , And reas , Bas i l , Michael Durr , Joce lyn , S teve Kerfoot...). I apprec ia te your suppor t technical ly and otherwise. I will never forget Tof ino 's and d inners , bir thday cakes and other ce lebrat ions. It has been a pr iv i lege to work with all of you—to learn f rom you and have fun-even if I don' t agree with your taste in mus ic ! Sebas t i an , thanks for the t ime you took to cri t ical ly eva luate my thes is . To Yane . You have been there f rom the beginning "Jane t with a " Y " . " Thanks for your suppor t through my comprehens ive e x a m , and especia l ly more recent ly , your openness in we lcoming me into your life and loving me as part of your fami ly. Thanks for your suppor t dur ing the hard t imes and for celebrat ing with me dur ing successes . Thanks for a lways mak ing the t ime and for the count less t imes you had me over for d inner. From Thai food to mov ies to mov ing to huge burgers , to Phi lphest . You are the best! I would love to go to Peru with you as soon as possib le. xvi And to Lucia for the joy you have brought to me by letting me watch you grow up. I will play Uno with you anytime—even if I always lose. Thanks for sharing your stories. You are so much fun and are so full of life and love. To Sarah Townsend for listening and your advice. You are a brilliant scientist and a thoughtful person whose perspective on life I greatly admire. To Amanda for being there from the beginning of my life until now and in the future. Can you believe where life has taken us?! I am so glad you are still a part of mine. You are a wonderful generous person and a great friend. I will always treasure you and welcome Stewart into our friendship. Thanks for passing on your life lessons to me and having the understanding and patience to let me stubbornly figure them out on my own. I will never forget the Broken Islands, walking in "deserted" Kits after Korea with you and our heart to hearts. To Paul Kubes who was with our lab for a short time. Thanks for your mentorship and the fun times that we all enjoyed during your time in Vancouver. No mention of Mardi Gras or anything else (balloons and wigs included!). Thanks for the interesting e-mails and for welcoming me—whether that be out with the lab on Friday nights, or in Taos. To Janet Kalesnikoff who I often think of as a stellar example of a great scientist who some how makes it look so easy and so fun. To the Michael Smith Foundation which has contributed to my salary and been instrumental in me being able to go to several conferences, xvii which have been the highl ight of my degree. DC , Mont rea l , Par is , New Mex ico , New Or leans—Thanks for your f inancial suppor t , but also for a l lowing me to be a part of such a v ibrant movemen t in m e m o r y of a wonder fu l scient ist and great leader, Dr. Michael Smi th . I would have been happy to meet h im, but am priv i leged to help carry on his legacy. I a lso thank the Heart and St roke Foundat ion that has funded much of my research salary and some of my t ravel ing expenses . To Helen—for mak ing th ings happen and for your posi t ive out look on life. The way you handle so much is an inspir ing examp le . To Regis who has unl imited pat ience I am sure. He must have for me coming in as a green keen student who didn't even know how to use a pipette. I don' t know how you put up with my constant quest ion ing. I learned a lmos t every th ing f rom you the first couple of years . Thank-you for being so pat ient and so enthusiast ic about sc ience. To Brock for helping me find the way to grad school and to Kel ly 's lab. Thanks for your mentorsh ip and the fun t imes that we all sha red . For your suppor t in the beginning and your en thus iasm. And thanks for the truth and putt ing me in l ine. You saw who I was before I d id . To everyone at the B R C . Jul ie , J a s m e e n , S tephane , Mike, Les ley, Dix ie , Nicole, Maureen , Bern ie—everyone real ly. You have created a ste l lar env i ronment to learn and share ideas. It has been great gett ing to know each one of y o u . To Lea and S a m , who I contacted more than anyone I am sure . For doing such a great job at organiz ing all the mice , despi te the move xviii and my late request sometimes, you always did it anyways. I appreciate your flexibility and organization. Thank-you for making my research possible. And thanks to Nicole for keeping together everything I take for granted at the BRC. To Catherine. Thank-you so much for your friendship, your spontaneity and for gently pushing me. For helping me work through my big questions of life, for listening and for your prayers. For talks about men and God and the OC. I can't wait to go to Asia with you. xix CO-AUTHORSHIP STATEMENT Chapter 2 Helen Merkens provided the initial studies showing the CD34 mRNA was expressed by BMMC. The Northern blot shown in Figure 1 was a result of her work. Shierley Chelliah performed the experiments showing the CD34 is expressed by wild type but not cd34~^~ c -k i t + peritoneal mast cells. She also prepared the cells for C D 3 4 + and CD34" cytometric sorts from wild type and cd34~^~ peritoneal washes and analyzed the sorts histochemically. Dr. Regis Doyonnas provided invaluable technical and scientific advice through the course of the work summarized in Chapter 2. Chapter 3 Dr. Daniel Tenen provided us with hCD34tg BM and the sequences for primers towards human CD34. Chapter 4 Jasmeen Merzaban provided important preliminary observations that cd43~^~ mast cells showed greater homotypic adhesion. Wooseok Seo constructed the plasmid containing CD43 for overexpression studies and biotinylated anti-CD43 that was invaluable for flow cytometry. Dr. Hermann Ziltener provided cd43~^~ mice and scientific feedback on the work. X X Chapter 1 Introduction 1.1 Hematopoiesis The hematopoietic system is in constant flux, losing and producing billions of cells everyday (reviewed in Fuchs and Segre, 2000). These cells all originate from self-renewing hematopoietic stem cells (HSC). Progeny of this HSC are of two main types: red blood cells and white blood cells (Janeway, 2001). White blood cells, or leukocytes, can be further divided into the myeloid and lymphoid cell types that arise from the common myeloid progenitor and lymphoid progenitor, respectively (Wagers and Weissman, 2004). The proposed differentiation process from the HSC to the various terminally differentiated hematopoietic cells is schematically shown in Figure 1.1. Common myeloid progenitors (CMP) can differentiate into monocytes or granulocytes. Monocytes differentiate into macrophages, which are important phagocytic cells of the innate immune system. Granulocytes contain cytoplasmic granules and include neutrophils, eosinophils, mast cells and basophils. Neutrophils and eosinophils contribute to innate immunity by fighting bacterial and parasitic infections, respectively. Mast cells and basophils respond to FceRI-bound IgE cross-linking, which causes granule exocytosis and mediator release (Janeway, 2001; Prussin and Metcalfe, 2003). However, despite the similar features of mast cells and basophils, they are derived from separate precursors downstream of the CMP (Janeway, 2001; Mekori and Metcalfe, 2000). Other hematopoietic cells derived from the CMP are the professional antigen-presenting dendritic cells, oxygen-carrying red blood cells and blood clotting platelets (Janeway, 2001) (Figure 1.1). 1 Megakaryocyte Platelets MEP Erythrocyte Figure 1.1 Hematopoiesis. All hematopoietic cells are derived from the HSC (self-renewing) and differentiate along the myleoid and lymphoid lineages into various terminally differentiated hematopoietic cells with various functions. LT-HSC = long-term hematopoietic stem cell; ST-HSC = short-term hematopoietic stem cell; CLP = common lymphoid progenitor; GMP = granulocyte/macrophage progenitor; CMP = common myeloid progenitor; MEP = megakaryocytic-erythroid progenitor Adapted from Wagers et al, Gene Therapy, 2002. 2 The common lymphoid progenitor (CLP) gives rise to B cells and T cells, both of which are important players of the adaptive immune system (Figure 1.1). B cells produce antibodies that react with exposed antigens, and T cells recognize foreign peptides displayed on antigen presenting cells (APC) and promote destruction of the pathogen. T cells differentiate into CD8 cytotoxic cells, which directly kill the infected APC, or CD4 cells which can be further divided into Th l and Th2 cells that bind antigen on and activate macrophages and B cells, respectively (Janeway, 2001). B and T cells are essential to adaptive immunity and allow for specific responses against antigens that evade the innate immune system. 1.2 Hematopoietic Stem Cells 1.2.1 History of HSC As early as 1909, Alexander Maximow expressed the concept of a HSC, (Fliedner, 1998), however, its existence was not demonstrated until 1961, when Till and McCulloch showed that transplanted bone marrow (BM) cells could give rise to spleen colonies in irradiated mice (Till and McCulloch, 1961). In a subsequent study, they irradiated transplanted mice to induce identifiable random chromosomal breaks in the transplanted cells, demonstrating that each spleen colony was clonally derived (Becker et al., 1963). These results showed that the BM contained multipotent hematopoietic progenitors. Furthermore, some of the spleen colony-derived cells could give rise to new spleen colonies and repopulate hematopoiesis in irradiated mice (Siminovitch et al., 1963), indicating the self-renewal potential of these progenitor cells. This pioneering work revolutionized our understanding of the HSC and began the search for the identification of this multipotent, self-renewing hematopoietic cell. 3 1.2.2 Identification of the HSC HSC are rare cells (1 in 10,000 in the BM) (Benveniste et al., 2003). To identify which cells are capable of reconstitution, BM cells have been fractioned according to their cell surface antigen profile using monoclonal antibodies and flow cytometry (reviewed in Weissman, 2002). These studies revealed that most murine HSC are l in"c-k i t + Thyl l 0 / + Sca- l + CD38 + CD34 l 0 / ~ (Ikuta and Weissman, 1992; Muller-Sieburg et al., 1986; Spangrude et al., 1988; Weissman e ta / . , 2001). These cells can be further divided into long term and short term HSC (LT-HSC and ST-HSC), based on their degree of self-renewal capacity (Morrison and Weissman, 1994). The perpetually self-renewing LT-HSC are completely lin" and give rise to ST-HSC, with more limited self-renewal capacity, that are l in " / l o c-k i t + Thy l l o Sca- l h i Mac- l l 0 (Weissman et al., 2001). Human HSC vary slightly from their murine counterparts and are contained within the l in"c-k i t l 0 / Thy- l + CD59 + CD38 l 0 / " CD34 + fraction of cord blood, fetal liver, fetal BM, adult BM and mobilized peripheral blood (Baum e ta / . , 1992; Weissman e ta / . , 2001). Despite these antigenic HSC definitions, the expression of some of markers fluctuate as a result of cell activation and the age of the host (Ogawa, 2002) and there is some controversy surrounding the best antigen-based method for the purification of these cells. However, the phenotypic characterization of HSC, based on antigen markers, has allowed researchers to enrich for HSC and study their differentiation and behavior. 1.2.3 HSC differentiation 1.2.3.1 The Traditional paradigm It has been generally believed that adult HSC can only give rise to blood cells. The traditional paradigm is that these cells differentiate in a linear, non-reversible manner (reviewed in Wagers and Weissman, 2004). As a cell matures, it is thought that its genome is modified irreversibly. This 4 permanent restriction is caused by silencing of certain genes due to the formation of heterochromatin accompanied by DNA methylation and histone deacetylation. This condenses genes in "tight chomatin" so that they are inaccessible to the transcription machinery. Therefore, the possibility of "transdifferentiation", in which a cell "committed" to one lineage, switches to another, is thought not to occur (Wagers and Weissman, 2004). HSC express many lineage markers that are lost as these cells commit to a certain lineage (Ishida et al., 2002). Thus, maturation seems, in part, to be a function of gene restriction, so that increased restriction dictates the differentiation of HSC along a certain lineage (Wagers et al., 2002b). 1.2.3.2 Challenges to the traditional paradigm Many recent papers have reported that given the appropriate conditions, HSC can be coaxed to change their differentiation pathway and contribute to the formation of non-hematopoietic tissues, challenging the traditional model of differentiation (reviewed in Blau et al., 2001). These studies include reports that hematopoietic cells can contribute to: skeletal muscle (Ferrari et al., 1998; Gussoni et al., 1999), endothelial cells (Asahara et al., 1999; Shi et al., 1998), hepatocytes (Alison et al., 2000; Lagasse et al., 2000; Petersen et al., 1999; Theise et al., 2000), osteoblasts (Horwitz et al., 1999), neurons (Brazelton et al., 2000; Mezey et al., 2000) and epithelial cells of the liver, lung, gastrointestinal tract, and skin (Krause et al., 2001). Therefore, it appears that under exceptional circumstances, cells may be forced along a certain lineage and "change" their developmental potential. However, contribution by hematopoietic cells to these tissues is very rare and in many cases requires irradiation and/or injury. Therefore, under normal conditions, the contribution by hematopoietic cells to other tissues is negligible. The mechanism by which these developmental switches occur remains to be clarified but could be due to transdifferentiation, de-differentiation, the existence of a multi/pluripotent stem cell in adult tissues, or cell fusion (reviewed in Wagers and Weissman, 2004). These studies 5 suggest that the microenvironment of a cell, under certain circumstances, may be dominant over their instrinsic developmental pathway. 1.2.5 The HSC BM niche The idea of a stem cell niche, originally proposed by Schofield, hypothesizes that the microenvironment of a HSC controls its behavior (Schofield, 1978). Thus, it is the location of stem cells within this niche that protects their quiescence and differentiation capacity, and movement out of this microenvironment causes proliferation and differentiation (Fuchs and Segre, 2000; Nilsson e ta / . , 2003). The BM stem cell niche is composed of a variety of cells such as fibroblasts, adipocytes, endothelial cells and osteoblasts (Rattis et al., 2004), and the ECM components produced by those cells (Arai et al., 2004; Whetton and Graham, 1999) (Figure 1.2). It is only recently that experiments have started elucidating aspects of this HSC niche and provide support for this hypothesis. Osteoblasts appear to have an important role in the formation of the HSC niche. These cells layer the bone surface and synthesize new bone matrix (Nilsson et al., 1999). By genetically inactivating BMP receptor type IA in mice, Zhang et al. increased the number of osteoblasts and bone formation resulting in an enlarged endosteal surface (Zhang e ta / . , 2003). These mice have double the number of LT-HSC, without significantly altered numbers of other progenitors, and these LT-HSC interact with the spindle-shaped osteogenic cells that line the surface of the bone. Similarly, Calvi et al. (Calvi et al., 2003) genetically altered mice to overexpress the parathyroid hormone receptor in osteoblasts, causing expansion and increased function of osteogenic cells. This also leads to a specific increase in the number of LT-HSC. These results suggest that osteogenic cells are a functionally important component of the HSC niche, and that the number of HSC is regulated by the size of this niche. The roles of other cell types that compose the BM stem cell niche remain to be clarified. 6 Bone Matrix Figure 1.2 Interactions of HSC with the bone marrow niche. HSC migrate through the bloodstream and extravasate into the bone marrow endosteum where they interact with stromal cells, the ECM and the chemokine, SDF-1, through different surface proteins. Adapted from Whetton and Graham, Trends Cell Biol, 1999. The ability of HSC to differentiate into the various hematopoietic lineages and self-renew is maintained by a close interplay of intrinsic and extrinsic factors. Their differentiation is restricted through DNA silencing and the activation of genes through signaling. The communication between HSC and their microenvironment involves binding to other cell types and the ECM, a process that is, at least in part, facilitated by adhesion molecules and their ligands. 7 1.2.6 HSC adhesion/migration Hematopoietic progenitor cells (HPC) and HSC express a wide array of adhesion molecules and cell surface sialomucins that permit binding to other cell types. These interactions are important during embryonic development in the temporal shift of sites for hematopoiesis and in the physiological retention, migration and mobilization of adult HSC (Wagers et al., 2002a). 1.2.6.1 Hematopoietic migration during embryogenesis During murine embryogenesis, HSC arise first in the yolk sac blood islands and aortic-gonad-mesonesphros region (AGM) at around day 7.5. From there hematopoiesis shifts to the fetal liver at day 11, residing there until day 15, and, right before birth, it moves to the BM, which is the site of hematopoiesis throughout adulthood (Lasky, 1996; Whetton and Graham, 1999). These highly ordered sequential shifts in hematopoietic sites suggest that the presence of adhesion molecules and chemokines direct the migration of hematopoietic cells from one site to another by allowing interaction with other cells throughout the developing embryo (Zhu and Emerson, 2004). In human embryogenesis, C D 3 4 + cord blood cells increase expression of adhesion molecules during gestation (Surbek et al., 2000). This suggests that increased expression of these proteins is required for normal hematopoietic development, although it is unclear which molecules are important for developmental migration. In mice, the role of particular molecules can be analyzed, and using chimeric embryos, f31 integrin was shown to be essential for the migration of HSC to the fetal liver and spleen (Hirsch et al., 1996; Potocnik et al., 2000). p i integrin subunits can pair with a4, a5 and a6, among other a subunits. Targeted disruption of oc4 integrin, although embryonic lethal (Yang et al., 1995), does not affect the hematopoietic progenitor colonization of the fetal liver, and there are no hematopoietic defects observed in mice with targeted disruptions of a5 or a6 8 integrins (Arroyo et al., 2000; Arroyo et al., 1999). This indicates that there may be a combinatorial effect of various a subunits or that another a subunit pairs with (31 integrin for the HSC colonization of the fetal liver and spleen (Wagers et a/. , 2002a). It is probable that different adhesion molecules direct the migration of HSC to the various sites of hematopoiesis during development. 1.2.6.2 Adult HSC migration 1.2.6.2.1 HSC migration from blood to BM Since a single HSC can reconstitute hematopoiesis in a lethally irradiated mouse (Osawa et al., 1996), the mechanism of adult HSC homing to the BM does not appear to be random, but rather, a coordinated, highly efficient system that directs this cell to its niche so that it is allowed to self-renew, proliferate and differentiate. This idea is supported by the observation that transplanted whole BM cells or enriched populations of HSC, leave the bloodstream within 1-3 hours and the peripheral tissues (excluding the BM and spleen) after 48 hours (Papayannopoulou et al.f 2003). These cells home to the BM by tethering to the microvascular BM endothelium with subsequent firm adhesion and transmigration into the BM extravascular hematopoietic space (Nilsson e ta / . , 2003; Papayannopoulou e t a / . , 2001). Since transplanted HSC home to the BM, it appears that HSC, in non-transplanted mice, possess an inherent ability to home to the BM (Whetton and Graham, 1999). It is thought that HSC regularly venture out into the periphery briefly and return to the BM, "like young adults, periodically come home after their travels away from the niche" (Fuchs and Segre, 2000). Although the mechanisms that HSC use to migrate to and from the BM are not entirely understood, it appears to involve similar adhesion molecules 9 used for the migration of other hematopoietic cells (Nilsson et al., 2003; Voermans e t a / . , 2000). It is well established that within the bloodstream, leukocytes are recruited to inflamed tissues using a multi-step process involving tethering, rolling and adherence to the vascular endothelium with subsequent extravasation into the tissue (reviewed in Kubes, 2002). Leukocytes use P-selectin glycoprotein ligand-1 (PSGL-1) and oc4(31 integrin to tether and roll on selectins and VCAM-1 on the surface of activated endothelium (Boyce e t a / . , 2002; Johnston et al., 1996). Firm adhesion subsequently occurs using (31 integrins (a4(31 binds VCAM-1 and a4(37 binds VCAM-1 and MAdCAM-1) or (32 integrins that bind ICAM-1 or ICAM-2, on the endothelium (Boyce et al., 2002; Johnston e t a / . , 1996; Kubes, 2002; Papayannopoulou, 2003). Once the leukocytes adhere to the endothelium, they use various molecules including CD31, CD99 and junctional adhesion molecule A (JAM-A) to extravasate between endothelial cells into the tissue and chemotax towards the stimulus (reviewed in Engelhardt and Wolburg, 2004). The selectins are also important in the migration and homing of progenitor cells. HPC express the P-and E-selectin ligand, PSGL-1 (Dercksen et a/ . , 1995; Tracey and Rinder, 1996; Zannettino e ta / . , 1995) and in vitro, bind to P-selectin (Zannettino et al., 1995). In vivo, using intravital microscopy, it was shown that HPC roll in BM venules and sinusoids in a selectin-dependent manner since antibodies against P- and E-selectin inhibit rolling (Mazo e t a / . , 1998). These selectins were deemed responsible for homing and localization of HPC to the BM, since wild type cells are less able to reconstitute hematopoiesis and showed decreased homing to the BM in P- and E-selectin KO mice (Frenette et a/. , 1998; Papayannopoulou et al., 2001). Thus, selectins are important players in the communication of HPC with vascular endothelium during BM homing. 10 Integrins are not only important for the migration of HSC during embryogenesis, but are essential adhesion receptors for the migration of adult HSC (Potocnik et al., 2000). Just as oc4 integrin has been shown to cause rolling of leukocytes on inflamed endothelium (Johnston et al., 1996), it also causes rolling and sticking of HPC to non-inflammed BM microvessels, through its interaction with VCAM-1 (Mazo et al., 1998). Furthermore, upon irradiation, selectins on BM microvessels have been shown to lose their ability to cause rolling of HPC. In contrast, VCAM-1 is upregulated and significantly contributes to this process (Mazo et al., 2002). The importance of (31 integrin in HSC homing was demonstrated by the inability of (31 integrin-deficient BM cells to rescue recipients from lethal irradiation and home to the BM, spleen or thymus (Potocnik et al., 2000). Presumably these defects are due to their inability to bind endothelial cells. (31 integrin can dimerize with a number of a subunits (Wagers e t a / . , 2002a), however, oc4 is of particular interest. a4 integrin KO cells are impaired in homing to the BM and short-term engraftment of these cells is delayed (Scott et al., 2003). Similarly, antibodies towards a4(37 integrin, or its ligand, MAdCAM-1 reduces homing of HPC to the BM (Katayama et al., 2004). These results provide evidence of the importance for integrins in HPC migration to the BM. However, in contrast to these studies, chimeric embryos (E18) show migration of a4 integrin KO progenitors to the spleen and BM (Arroyo et al., 1999). Therefore, it may depend on the context for the role of integrins in HPC migration. Hyaluronic acid (HA) is a major glycosaminoglycan constituent of the ECM in the BM endosteum and is expressed on sinusoidal endothelium (Avigdor et al., 2004; Fraser et al., 1997; Nilsson et al., 2003). One of its ligands, CD44 is expressed by HPC and appears to be important in the migration of these cells (Avigdor et al., 2004). Using NOD/SCID recipients, Avigdor et al. have shown that pre-incubation of human C D 3 4 + cells with anti-CD44 or soluble 11 HA, inhibited their engraftment and their homing to the BM and the spleen, suggesting that CD44-HA adhesion aids HPC migration (Avigdor et al., 2004). These results agree with other studies that have also shown decreased homing of HPC upon ant i -CD44 treatment (Khaldoyanidi et al., 1996; Vermeulen et al., 1998). Despite these observations, CD44-nul l mice show no HPC homing defect (Schmits et al., 1997). They do, however, exhibit accumulation of progenitors in the BM and decreased numbers in the spleen and blood, suggesting that CD44 is required for the migration of HPC from the BM to the blood and that during development these mutant mice are able to seed hematopoiesis in the BM and spleen (Schmits e t a / . , 1997). Thus, CD44 is important in the homing of HSC into and out of the BM, probably through its interaction with HA. 1.2.6.2.2 HSC Chemotaxis Once a recruited leukocyte binds to the endothel ium, it migrates towards a chemotactic gradient (Kubes, 2002). Similar ly, it is thought that once a HSC reaches the BM, it is directed, via chemotaxis, to its niche within the extravascular space. Currently, the only chemokine interaction established as being involved in stem cell homing is that between stromal cell-derived factor-1 (SDF-1) and CXCR4 (Papayannopoulou, 2003 ; Wright et al., 2002a). SDF-1 is produced and secreted by osteoblasts in the endosteum and is also synthesized by BM endothelium (Avigdor et al., 2004). SDF-1 is part of the CXC chemokine family and causes chemotaxis of leukocytes and HPC. The receptor that recognizes this chemokine is CXCR4 , a 7-t ransmembrane helix receptor (7-TMR) that signals through G proteins. CXCR4 initiates multiple signaling pathways including the release of intracellular calc ium, which causes reorganization of the cytoskeleton and chemotaxis towards SDF-1 (Mohle et al., 2001) . In adult mice, CXCR4 KO cells are not optimally retained within the BM after engraftment (Ma et al., 1999). Similar ly, downregulation of CXCR4 leads to mobil ization of HSC (Papayannopoulou, 2003 ; Papayannopoulou et al., 2003). These results 12 suggest that s ignal ing downs t ream of the C X C R 4 - S D F - 1 interact ion is impor tant for homing and retent ion of H S C in the B M . 1.2.6.2.3 HSC interactions with the BM niche The local izat ion of a t ransp lanted hematopoie t ic cell within the ex t ravascu la r space is de termined by its state of matura t ion ; H S C lodge in the endostea l region and more commi t ted cel ls toward the central mar row region (Ni lsson et al., 1997) . There fore , hematopo ies is within the unmanipu la ted BM is thought to coincide with the migrat ion of the s tem cells toward the centre of the bone (Moore and Lemischka , 2 0 0 4 ; Ni lsson et al., 2001) . Within the e n d o s t e u m , or the s tem cell " n i che " , H S C bind to os teob las ts , s t romal cel ls and ECM componen ts (Berr ios e t al., 2001) (Figure 1.2). How these cel ls interact is not well unders tood , but some H S C adhes ion molecu les involved have been identif ied including a4f31 integr in, HA, c-ki t , Notch and N-cadher in . a4f31 integrin is impor tant for the a t tachment , of HPC to f ibronect in and s t romal cel ls (Lasky , 1 9 9 6 ; Whet ton and G r a h a m , 1999) . In vivo, ant ibody blocking of a4(31 integrin or its l igand, V C A M - 1 , causes the re lease of progeni tor cel ls f rom the BM and decreased engraf tment (Craddock et al., 1 9 9 7 ; Lasky , 1 9 9 6 ; Levesque e t a / . , 2 0 0 2 ; Papayannopou lou and Craddock , 1 9 9 7 ; Papayannopou lou et al., 1995) . S imi lar ly , inducible loss of oc4 integrin causes accumula t ion of progeni tors in the circulat ion and spleen (Scott et al., 2003 ) . S imi la r ly , mice with reduced express ion of the V C A M - 1 show increased numbers of progeni tors in the blood (Papayannopou lou et al., 2001 ) . S ince there is defect ive prol i ferat ion and di f ferent iat ion of a4 integr in-def ic ient HPC in the B M , it has been hypothes ized that this integrin may be important in the adhes ion of HPC within the " e x p a n s i o n " BM niche and that loss of this molecule permi ts p remature re lease, prevent ing their prol i ferat ion (Arroyo et al., 1999) . These observat ions provide convinc ing ev idence that cc4 integrin is essent ia l for the retent ion of HPC within the B M . 13 Although p i integrin is required for the migration of HSC to the BM, inducible loss of p i integrin does not affect the retention of HSC within the BM, since there are normal numbers of HPC in the BM and blood of these mice (Brakebusch et al., 2002). However, it has recently been shown that p i integrin may be involved in the adhesion of HSC to osteoblasts through Tie2-Ang-1 ligation (Arai e t a / . , 2004). T ie2 + HSC localize to the stem cell niche in the BM by binding tightly to Ang- l -expressing osteoblasts along the bone surface and this interaction maintains HSC quiescence (Arai e t a / . , 2004). In vitro, exogenous Ang-1 upregulates pl- integrin and blockade of pl- integrin inhibits "cobblestone area formation," a measure of HSC activity (Arai et al., 2004). This suggests that pl- integrin may be downstream of Ang-1-Tie2 induced signaling and facilitate the adhesion of HSC to osteoblasts to inhibit HSC differentiation. Therefore, at least in some situations, pl- integrin may play an important role for the attachment of HSC to the stem cell niche in the BM. Hyaluronic acid (HA) has recently been detected on mouse and human HSC and appears to play a role in the lodgement of HSC in the endosteal region of the BM (Nilsson et al., 2003). Cleavage of HA on HSC with hyaluronidase reduces the number of labeled progenitor cells homing to the endosteum after transplantation and, in vitro, binding of HA on HSC by a surrogate ligand suppressed proliferation and differentiation (Nilsson et al., 2003). Therefore, HA appears to be required for the localization of HSC to the BM stem cell niche and to be important in maintaining HSC quiescence. Although the ligands for HA in this context have not been elucidated, HSC may use HA to interact with RHAMM (Receptor for hyaluronan acid-mediated motility) and CD44, two known ligands for HA (Pilarski e ta / . , 1999). The interaction between c-kit and its ligand, stem cell factor (SCF) is important for the retention of HSC. Membrane bound SCF on stromal cells 14 al lows adhes ion of c -k i t + H S C and mice with mutat ions in c-kit ( W / W v ) or the membrane -bound form of S C F ( S l / S l d ) d isplay defects in hematopo ies is , p resumab ly due to the absence of this interact ion (Whet ton and G r a h a m , 1999) . There is a severe defect in the lodgement of t ransp lanted wild type HPC to the BM endos teum in S l / S l d (defect ive SCF) mice (Dr iessen et al., 2003) and t ransplanted HPC that had been pre- t reated with a neutral iz ing ant i -c-k i t and t ransplanted into wild type mice do not show appropr ia te local izat ion (Dr iessen et al., 2003 ) . There fore , c-kit on H S C is impor tant in their adhes ion to s t romal cel ls within the BM H S C niche. More recent ly , Notch has been impl icated in the local izat ion of H S C to the BM endos teum. Notch is a t r ansmembrane receptor and its s ignal ing is highly act ive in H S C , decreas ing upon dif ferent iat ion and impl icated in the select ive se l f - renewal capaci ty of H S C (Duncan et al., 2 0 0 5 ; Karanu et al., 2 0 0 0 ; St ier e t a / . , 2 0 0 2 ; Va rnum-F inney e t a / . , 2000 ) . Within the BM niche, osteoblasts express J a g g e d - 1 , a l igand for Notch (Calvi et al., 2003) and in vivo, e levated levels of Jagged-1 on osteoblasts corre late with increased H S C Notch act ivat ion and s tem cell expans ion (Calvi et al., 2003 ) . These resul ts suggest that the interact ion of Notch on H S C and Jagged-1 on osteoblasts promotes Notch signal ing and is impor tant in suppor t ing H S C main tenance and growth . N-cadher in is expressed on some H S C and on osteoblasts and is known to form homophi l ic interact ions in cell junct ions (Arai et al., 2 0 0 4 ; Zhu and E m e r s o n , 2004 ) , suggest ing that these two cell types interact through N-cadher in -N-cadher in b inding. Fur thermore , p-catenin is known to assoc ia te with N-cadher in in the format ion of adherens junct ions (Puch et al., 2001 ) . It was recent ly shown that N-cadher in and p-catenin are asymmet r i ca l l y local ized between L T - H S C and osteoblast ic cel ls on the bone sur face (Zhang et al., 2003 ) . There fore , the binding of H S C to osteoblasts through this 15 et al., 2003). Therefore, the binding of HSC to osteoblasts through this interaction may promote HSC self-renewal and maintenance through ®-catenin-mediated signaling and gene activation. Therefore, HSC utilize a variety of adhesion molecules to interact with the various components of the BM HSC niche and function to maintain the quiescence and differentiation capacity of HSC. It is not clear what signals HSC to detach from their niche and how this occurs. Presumably, the niche and/or stem cell receive a signal to induce their release and/or proliferate. Mitosis itself may in fact cause this detachment, since adherent cells "round up" during mitosis (Wright et al., 2001). Alternatively, the signal may cause altered expression and affinity of adhesive receptors (Wright et al., 2001) and this decreased interaction may cause "deadhesion" from their BM microenvironment. Disruption of these niche interactions would cause release of HPC, transmigration through the basement membrane and across endothelial cells, into the sinusoids and bloodstream (Papayannopoulou et al., 1998; Papayannopoulou et al., 2001). The migration of HPC from their niche to the blood is often chemically induced and is referred to as "mobilization". 1.2.6.2.4 HSC mobilization: BM to blood migration Stem cell mobilization involves the action of proteases, adhesion molecules and chemokines (Papayannopoulou, 2004). Mobilization of HPC by administration of G-CSF and/or cyclophosphamide causes neutrophils to release granules that contain various proteases such as matrix metalloproteinase-9 (MMP-9), neutrophil elastase, and cathepsin G (Levesque et al., 2002; Levesque et al., 2004; Papayannopoulou, 2004). These proteases increase shedding of L-selectin, cause up-regulation of C D l l b and cleavage of VCAM-1, c-kit, CXCR4 and its ligand SDF-1 (Levesque et al., 2004; Papayannopoulou, 2004). It is assumed that these changes in integrin expression are responsible for the reduced engraftment 16 of mobilized HSC, compared to non-mobilized cells (Wagers et al., 2002a). The changes induced by mobilization may not only increase release of these cells from the BM, but also inhibit the reentry of these cells into tissues (Wright etal., 2001). In summary, HSC are rare self-renewing cells that have the potential to develop into any of the various hematopoietic lineages and can self-renew. These cells use sialomucins and integrins and chemokine interactions for their appropriate migration and localization within the HSC niche. 17 1.3 Mast cells 1.3.1 Mast cell development Paul Ehrlich was the first to describe mast cells when he presented his doctoral thesis to the Medical Faculty of Leipzig University on June 17, 1878 (Crivellato et al., 2003). During his study of histological dyes, he observed granular cells that stained with aniline dyes that he termed "mastzel len" and he attributed this characteristic as a result of a chemical reaction (Schwartz, 2004). "Mastzel len" is literally translated as "wel l- fed" cell, however, "mast" is derived from the Greek word | iomoa, meaning breast, attributing a nurturing, 'suckl ing' function of mast cells (Crivellato et al., 2003; Theoharides, 2002). 1.3.1.1 Hematopoietic origin of mast cells Ehrlich originally hypothesized that mast cells differentiate from fibroblasts • (Crivellato et al., 2003). However, Kitamura et al. demonstrated that these cells are hematopoietic in origin by transplanting beige (bg3/bgJ) BM into irradiated wild type mice and observing donor-derived bcf/bg3 mast cells (distinguished by giant granules) in the recipient mice after 2-3 months (Kitamura et al., 1977). This was also shown using mice with mutations in c-kit (W/W v ) that are devoid of tissue mast cells (Galli and Kitamura, 1987): Upon injection of spleen and BM hematopoietic colony cells into the skin of W / W v recipients, mast cells appeared at the site of injection (Kitamura and Fujita, 1989). Mast cells are also reconstituted in various tissues of these mice after transplantation of wild type BM (Kitamura et al., 1978). These results unarguably demonstrate that mast cells are hematopoietically derived. The differentiation of mast cells occurs within peripheral tissues and is not well understood (Kitamura et al., 1988). However, using peritoneal mast 18 cell ablation and recovery, Kanakura et al. (Kanakura et al., 1988a) showed that mast cells are repopulated by the influx of precursors and subsequent mast cell differentiation. They demonstrated three stages of mast cell development within the peritoneal cavity, varying in morphology and proliferative potential. Lethally irradiated wild type mice that had been transplanted with bcf/bcf BM, were peritoneally injected with distilled water, which causes mast cells to burst due to osmotic pressure. Repopulating mast cells were donor derived with the most immature large mast cell colony forming cells (L-CFU-Mast) appearing in the peritoneal cavity first, and more mature medium (M-CFU-Mast) and small mast cell colony forming cells (S-CFU-Mast) appearing thereafter (Kanakura et al., 1988a). They showed that the number of M-CFU and S-CFU in S-phase did not increase, suggesting that mast cells were recovered by the differentiation of L-CFU mast cell precursor (MCp) (Figure 1.3). These data show that mast cells are hematopoietically derived, travel to the peritoneal cavity as immature cells and subsequently differentiate in a process that takes many weeks to occur (>20 weeks). Mast cell forming cells travel through the bloodstream. This was shown by Kitamura et al. (Kitamura etal., 1979a) using parabiosed bgi/bg} and normal mice with the appearance of the opposite partners' mast cell type in various tissues. Therefore, either mast cells themselves, or their progenitors, travel from one partner to the other. In another study, injection of blood mononuclear cells into the skin of mast cell deficient mice resulted in the formation of mature mast cells (Sonoda et al., 1982). These data demonstrate that mast cells and/or their progenitors are blood-borne. 19 L-CFU-Mast M-CFU-Mast S-CFU-Mast | M a t u r a t i o n Figure 1.3 Tissue specific homing of mast cell precursors. Mast cell progenitors migrate through the bloodstream, and upon stimulation, may be recuited to tissues via rolling and adhesion through PSGL-1-selectins, and integrins-VCAM-1/ICAM interactions, respectively. The expression of specific integrin pairs are required for localization to specific tissues. a4p7 is required for these cells to migrate to the mucosa, where they mature and interact with epithelial cells and ECM. The expression of aM(32 is essential for migration to the peritoneal cavity. As these peritoneal mast cell precursors mature and lose proliferative ability. MCp = mast cell progenitor; MMC = mucosal mast cell Adapted from Smith and Weis, Immunol Today, 1996; Kanakura era/., Blood, 1988. 1.3.1.2 The identification of the mast cell precursor Since mature mast cells are not detectable in blood, it is the mast cell progenitors that travel through the bloodstream (Sonoda et al., 1982). These cells then complete their differentiation in peripheral tissues (Kitamura et al., 1988). However, the identification of the mast cell progenitor (MCp) has proven to be a difficult task and this cell is currently still largely uncharacterized. The study by Rodewald et al. (Rodewald et al., 1996) is currently the only phenotypic characterization of a monopotent MCp. Using murine fetal blood, they identified this cell as thy-l '°c-kit h 'FceRr. It expresses mast cell 20 protease RNA, has cytoplasmic granules, does not have the capacity to form any other hematopoietic lineage in vitro and can reconstitute peritoneal mast cells in W/W v mice (Rodewald et al., 1996). These data support the idea that MCp are committed to the mast cell linage prior to reaching peripheral tissues. Since the same population could not be identified later on during embryogenesis, it appears that this cell type changes its phenotype during further development. Human MCp are CD34 + c-k i t + CD13 + CD38 + CD14"FceRl (Austen and Boyce, 2001; Kempuraj et al., 1999). However, C D 3 4 + c - k i t + C D 1 3 + cells also give rise to monocytes (Kirshenbaum e ta / . , 1999) and therefore, represent a less mature counterpart to the characterized murine MCp. However, this suggests that mast cells and monocytes arise from a common progenitor. In summary, MCp in the murine and human systems are not well characterized. Their future identification will significantly accelerate our understanding of their behavior and function. 1.3.1.3 Types of mast cells As early as 1906, Maximow observed two different types of rodent mast cells (reviewed in Kitamura, 1989). His observation was based on the different staining characteristics of mucosal mast cells versus mast cells in other tissues. Enerback (Enerback, 1974) extended these observations and developed optimal conditions for fixation and staining of different mast cell populations. For example, staining by berberine sulfate depends on the acidic proteoglycan heparin content in the mast cell, which varies according to the localization of the mast cell. There are currently two main classifications of mast cells in the rodents: mucosal mast cells (MMC) which are located in the mucosa, and connective tissue-type mast cells (CTMC) which are located in the skin, peritoneal cavity and muscularis propria of the stomach, as well as other sites (Kitamura et 21 al., 1988) (Table 1.1). CTMC contain heparin sulfate proteoglycan (berberine sulfate-positive) and high concentrations of histamine (Galli et al., 1984) whereas MMC contain chondroitin sulfate proteoglycan (berberine sulfate-negative) and low concentrations of histamine (Kitamura et al., 1988). Mucosal mast cells Connective tissue mast cells Staining characteristics Berberine sulphate negative Berberine sulphate positive Location Mucosa Skin Peritoneal cavity Musculis propria Granule content Chondroitin sulphate proteoglycan Low histamine Heparin proteoglycan High histamine Growth factors SCF, IL-4 T cell dependent Table 1.1 Types of murine mast cells In contrast to the classification of murine mast cells, which is based on their tissue localization, human mast cells are defined based on their expression of tryptase and chymase, two mast cell proteases (Toru et al., 1998). Morphologically, MC T (tryptase-positive, chymase-negative) have irregularly-shaped granules with discrete scrolls and localize to the alveolar wall and gastric mucosa. M O r c (tryptase-positive, chymase-positive) have more regularly-shaped granules with crystal, grating or lattice substructures and are found in the skin and intestinal submucosa (Craig and Schwartz, 1990; Kambe et al., 2004). Based on localization, MC T are similar to murine mucosal mast cells and MCTc resemble murine CTMC. 22 1.3.1.4 Mast cell development and microenvironment CTMC and MMC arise from a common MCp. This was demonstrated using the BM-derived cell line, V3MC, that was transformed with v-abl virus and bears a unique integration site. This cell line resembles BMMC and was tracked in vivo, using its neomycin and v-abl genes for identification. These cells form CTMC in connective tissues and MMC in the mucosa (Gurish et al., 1995). The existence of a common progenitor for CTMC and MMC was also demonstrated by dividing peritoneally-derived clonal mast cell colonies and injecting them into the skin and stomach of W/W v mice. These cells form CTMC in the skin and muscularis propria of the stomach and MMC in the mucosa (Kobayashi et al., 1986). Therefore, on a clonal level, peritoneal MCp can give rise to both CTMC and MMC. Differentiation of mast cells is "reversible" so that one type can become another type, given the appropriate microenvironment. This was demonstrated by intravenous injection with either cultured mast cells (MMC), or partially purified peritoneal wild type mast cells (CTMC) into W/W v mice intraperitoneally or intravenously. These cells (MMC and CTMC) give rise to both CTMC and MMC (Nakano et al., 1985). The ability of a single CTMC to form MMC and CTMC was shown by the observation that the injection a single peritoneal mast cell (CTMC) into the stomach of a W/W v mouse results in the formation of MMC in the mucosal layer and CTMC in the muscularis propria (Sonoda et al., 1986). This showed that an individual peritoneal mast cell can give rise to both MMC and CTMC. Furthermore, the reversibility of mast cell morphology is "plastic" and can change multiple times. When peritoneally isolated CTMC mast cells are clonally cultured, they become berberine sulfate-negative (CTMC->MMC). The injection of these cells or BMMC (MMC) into the peritoneum of W/W v mice then causes them to become berberine sulfate-positive (MMC->CTMC). These cells can then be reisolated, clonally cultured again and take on MMC 23 characteristics (CTMC-^MMC^CTMC^MMC) (Kanakura et al., 1988b; Kitamura and Fujita, 1989). Thus, mast cells exhibit multiple bidirectional changes in phenotype, depending on the growth factors present in their microenvironment. 1.3.1.5 Mast cell growth factors The interaction of stem cell factor (SCF) and its receptor, c-kit (also known as SCF-R or mast cell growth factor) (Broxmeyer et al., 1991), is important for mast cell development, since mice with mutations in SCF (Sl/Sl d) or c-kit (W/W v) are almost completely devoid of mast cells (Galli and Hammel, 1994; Kitamura et al., 1979b). Although W/W v mice have been shown to contain similar frequencies of MCp in the blood and hematopoietic tissues, these mice contain few or no MCp in the peritoneal cavity, and less in the intestinal mucosa. Therefore in these mice, MCp are unable to efficiently home, proliferate and/or survive (Crapper and Schrader, 1983; Kobayashi et al., 1986). The presence of SCF promotes mast cell differentiation and proliferation. In vivo, administration of recombinant stem cell factor in rats, baboons and monkeys causes expansion of mast cells at various anatomic sites (Galli and Hammel, 1994; Tsai et al., 1991), showing that the presence of SCF promotes mast cell differentiation and proliferation. In vitro, BMMC can be cultured using IL-4 and SCF (Karimi etal., 1999; Levi-Schaffer et al., 1986). These results demonstrate that SCF and c-kit can maintain and promote mast cell populations. Mast cell differentiation is also supported by IL-3 (Gurish and Boyce, 2002; Kitamura e ta / . , 1988). This was originally shown by growth of mucosal-like mast cells in the presence of poke-weed mitogen-stimulated spleen cell-conditioned medium, which contains IL-3 and IL-4 (Kitamura et al., 1988). Although IL-3-deficient animals do not have decreased number of tissue 24 mast cells, IL-3 is required for expansion of intestinal and splenic mast cells upon infection with the intestinal nematode N. brasiliensis (Lantz et al., 1998). Therefore, IL-3 is important for the proliferation of MMC. It has been established that IL-3 is sufficient to grow BMMC in vitro from mice and rats, but it does not select for outgrowth of mast cells when human progenitor cells are used. Instead human cells require the addition of IL-6 and SCF (Gurish and Boyce, 2002), demonstrating that murine and human mast cells differentiation require distinct growth factors. 1.3.1.6 Regulation of mast cell frequencies The overproduction of mast cells is associated with unpleasant effects such as urticaria pigmentosa (a benign skin mast cell tumor) and allergies. This suggests that there may be a mechanism to prevent the overproduction of mast cells (Kitamura and Fujita, 1989). It is currently unclear how the frequency of tissue mast cells is regulated. Upon transplantation of BM into irradiated hosts, skin mast cells remain host type up to 290 days after injection and donor contribution is negligible (Kitamura et al., 1979b). This result showed that mast cells are long-lived and radiation resistant (Gurish and Boyce, 2002), but also suggested that the development of mast cells is hindered by the presence of mature host mast cells. Accordingly, Nakano et al. (Nakano et al., 1985) observed that the frequency of reconstituted mast cell clusters was inversely proportional to the number of existing skin mast cells. This effect was further shown using peritoneal mast cell ablation by distilled water treatment with subsequent injection of mast cells in the peritoneal cavity. Normally, upon ablation with water, mast cells disappear and are reconstituted by BM derived MCp (Kanakura et al., 1988a). However, bgi/bgi BM reconstituted animals did not show donor contribution of 25 peritoneal mast cells if purified wild type mast cells were intraperitoneal^ injected prior to reconstitution (Kanakura et al., 1988a). Thus, there appears to be a mechanism preventing the development of super-normal frequencies of mast cells. This may be due to a limited amount of SCF, since repetitive injection of SCF in the peritoneum increased the number of peritoneal mast cells (Galli et al., 1999). Alternatively, mast cells themselves may secrete a factor that inhibits the over-production of mast cells. 1.3.2 Mast cell Migration Mast cells are unique since they leave the BM as undifferentiated MCp and only mature upon reaching their target tissues. However, the mechanism that these elusive cells use to migrate to peripheral tissues is largely unexplored. The current data suggest that adhesion molecules on mast cells and/or their progenitors are important in their tissue localization and immune responses (Gurish and Boyce, 2002; Rosbottom et al., 2002). Mast cells adhere to the ECM, endothelial cells and other immune cells (Boyce et al., 2002; Inamura et al., 1998; Lorentz et al., 2002). These interactions are regulated by the various factors present in the mast cell progenitor's microenvironment and may represent how mast cells localize to different anatomical locations (Figure 1.3). 1.3.2.1 Mast cell adhesion to ECM The ECM includes fibronectin, laminin, vitronectin and collagen (Lorentz et al., 2002). Mast cells use integrins to bind to these ECM components and these interactions are thought to be important for their migration, maturation and function (Lorentz et al., 2002). This is regulated by SCF, since it is needed for the adhesion of mast cells to fibronectin (Lam et al., 2003) laminin and collagen (Lorentz e ta / . , 2002). Therefore, the interaction 26 of mast cells and the ECM requires appropriate adhesion molecules and the presence of SCF. The environment in which a MCp resides is important in regulating the expression of adhesion molecules and thus, directs its relationship with surrounding cells, the basement membrane and the ECM. This has been implicated in the mast cell response to certain intestinal nematode infections, such as Trichinella spiralis (Gurish and Boyce, 2002). Upon infection, MCp are induced to express mouse mast cell protease-1 (mMCP-1) which indicates their maturation, and migrate intraepithelially through the lamina propria (Rosbottom et al., 2002). In vitro, TGF-p l causes mMCP-1 expression by BMMC, and causes expression of oc7 and aE integrins, which MMC use to bind the basement membrane protein, laminin, and E-cadherin on epithelial cells, respectively (Rosbottom et al., 2002; Wright et al., 2002b). In contrast, these mature MMC lose their ability to bind the ECM molecules vitronectin and fibronectin, and have decreased expression of their corresponding ligands (Rosbottom et al., 2002). It is therefore hypothesized that in vivo, TGF-p l causes migration of MMC to the lamina propria allowing a mast cell-mediated response to Trichinella spiralis. This demonstrates that the MCp microenvironment is important in directing their adhesion and migration. 1.3.2.2 Mast cell adhesion to other cells The interaction of mast cells with other cells is important in their activation and this can be influenced by the cytokines present in their microenvironment. For example, IL-4 induces homotypic adhesion of human cultured mast cells through LFA-1 (al_p2 integrin) (Bianchi e t a / . , 2000) and ICAM-1 (Toru et al., 1997) and activated mast cells bind to activated lymphocytes through ICAM-1 (on mast cells) and LFA-1 (on T cells) (Inamura et al., 1998). This may be functionally relevant since the latter interaction causes mast cell activation and degranulation (Inamura et al., 27 1998). Therefore, the interaction of mast cells with other cell types can influence their behavior and function. The adhesion of mast cells to other cells can also affect the localization of mast cells. Recently, Sg lGSF (spermatogenic immunoglobin superfamily), a member of the immunoglobin superfamily, was shown to be expressed by mast cells (Ito et al., 2003). In vivo, Sg lGSF appears to be important for the migration of MCp. Mice lacking SglGSF had reduced numbers of mast cells in the peritoneal cavity, despite normal mast cells frequencies in the mesentery (Morii et al., 2004). This may be explained by the observation that Sg lGSF increases adhesion and transmigration of mast cells across mesothelium (Watabe et al., 2004). Therefore, Sg lGSF is important in the interaction of mast cells with mesothelial cells and appears to influence the ability of MCp to migrate to the peritoneal cavity. 1.3.2.3 Tissue specific homing of mast cell progenitors It has been hypothesized that BM resident MCp leave their BM niche through the breakage of a receptor-ligand-mediated retention (Smith and Weis, 1996). After they leave the BM, they travel through the bloodstream until they migrate into a peripheral tissue. However, the mechanism by which MCp adhere to the vascular endothelium and extravasate is largely unknown since adult MCp have not been identified. The current data suggest that these cells may use a similar mechanism of tissue recruitment to other hematopoietic cells. It is known that leukocytes use PSGL-1 and a4p l to tether and roll on endothelial expressed P-selectin, E-selectin and VCAM-1 , which is followed by firm adhesion and transmigration (Boyce et al., 2002; Johnston et al., 1996). Similarly, murine mast cells roll on P-selectin (Sriramarao et al., 1996) and cultured human mast cell progenitors adhere to IL-4 activated HUVECs via oc4-integrin-VCAM-l and PSGL- l -E-select in interactions (Boyce et al., 2002). Therefore, mast cell progenitors may use 28 a similar mechanism of migration during development and recruitment, which appears to be influenced by cytokines. It is also unclear whether MCp, like T cells, are directed to a particular tissue, based on the expression of particular adhesion molecules and chemokine receptors (Campbell et al., 2003). Smith and Weis proposed two models of mast cell precursor homing to tissues (Smith and Weis, 1996). The first Yandom' model supposes that these cells survive if, by chance, they find a peripheral niche that supports their survival and differentiation. The second 'regulated' model proposes that MCp home to specific tissues if they express certain receptors. After extravasation from the BM, these cells 'search' for their corresponding ligand as they travel through the bloodstream and home to the tissue that expresses it (Smith and Weis, 1996). To support the second hypothesis, T cells have been shown to be directed to home to the small intestine using a4|37 integrin (which binds MAdCAM-1) (Campbell et al., 2003) and to the skin by cutaneous lymphocyte antigen (CI_A), a specialized form of PSGL-1 , that binds E-selectin (Fuhlbrigge et al., 1997). The current data suggest that the localization of MCp is also regulated by the presence of certain adhesion molecules that direct them to certain tissues. This model suggests that the adhesion molecules expressed by a particular mast cell determines the tissue in which the cell is directed, and ultimately the type of mast cell it will become. Methylcellulose assays have shown that after infection with the intestinal nematode, Nippostrongylus brasiliensis, there is a decreased number of mast cell colony-forming cells in the blood of rats, with a concomitant increase of these cells in the intestine (Kasugai et al., 1995). Similarly, in mice, upon infection with Trichinella spiralis, BM c-kit + cells acquire |37 integrin expression and are released into the blood, after which there is intestinal mastocytosis and resolution of the infection (Pennock and Grencis, 29 2004). This suggests that (37 integrin directs the migration of MCp from the BM to the intestine. Accordingly, mastocytosis in response to Trichinella spiralis is prevented in mice that lack the expression of (37 integrin (Artis et al., 2000). Gurish et al., using a limiting dilution assay, that quantitatively measures the frequency of MCp, found that there was a severe reduction of MCp in the small intestine of (37-integrin-deficient mice, despite normal frequencies of these cells in the BM, lung and spleen (Gurish et al., 2001) and that blocking antibodies towards a4 and a4(37 integrins prevented MCp recovery of the small intestine after irradiation, suggesting that the a4(37 dimer is essential for the migration of mucosal mast cells (Gurish et al., 2001). These results are reminiscent of the requirement for a4(37 integrin in the specific homing of T cells to the intestine (Campbell et al., 2003). Thus, it appears that mast cells use a similar mechanism for their migration to this tissue. Although MCp and mature MMC express (37 integrin, the expression of a4 integrin decreases with maturation and once the mast cell reaches the lamina propria, it may express aE, which may allow its retention in the intraepithelial space through binding to E-cadherin on epithelial cells (Brown e t a / . , 2004; Smith and Weis, 1996) (Figure 1.3). Accordingly, in vivo, mice with ablated aE integrin expression on their MMC do not show recruitment of intestinal MMC upon infection with Trichinella (Brown et al., 2004). Therefore, MCp require a4(37 integin to home to the intestine and aE(37 integrin to migrate to the intestinal epithelium. Mac-1 (ocM(32 integrin) is expressed weakly by peritoneal mast cells (Rosenkranz e t a / . , 1998) and Mac-l-deficient mice have a reduced number of mature mast cells in the peritoneal cavity, the peritoneal wall and in the dorsal skin dermis. However, there are normal numbers of mast cells in the ear skin, the mucosa and the spleen (Rosenkranz et al., 1998). Therefore, Mac-1 is important in the localization of MCp to the peritoneal cavity (Figure 30 1.3). Upon induction of peritonitis, mast cells release mediators that cause neutrophil influx and resolution of the infection. In Mac-l-deficient mice, there is decreased neutrophil accumulation and increased susceptibility to cecal ligation and puncture (CLP), a model of acute peritonitis (Rosenkranz et al., 1998). Although this defect may be due to other non-mast cell related Mac-l-dependent processes, it may reflect the biological importance of the reduced number of peritoneal mast cells in these mice and supports the need for the expression of Mac-1 to allow MCp homing to the peritoneum. These requirements for adhesion molecules for tissue-specific homing of MCp support the 'regulated' model of mast cell progenitor migration (Gurish et al., 2001; Rosenkranz et al., 1998). It will also be of interest to find out what molecules are required for the migration of MCp to other tissues. 1.3.2.4 Chemotaxis Mast cells and their progenitors respond to a variety of chemotaxins that may be important for their migration and recruitment. Murine mast cells migrate towards stem cell factor (Meininger et al., 1992), monocyte chemotactic protein-1 (MCP-1), IL-3 and TGFp (Hartmann et al., 1997). Human mast cells chemotax towards SCF, C3a and C5a (Hartmann et al., 1997), RANTES, IL-8 and TGFp (Olsson et al., 2000) SDF-1 , eotaxin, serum amyloid A and platelet-activating factor (Juremalm et al., 2000). Currently, there have been no studies addressing the role of particular chemokine receptors in the tissue-specific direction of mast cell progenitor homing, although it is quite conceivable that such a mechanism exists for these cells, as it directs tissue-specific homing of T cells (Campbell et al., 2003). In summary, MCp utilize cell surface receptors to localize to specific tissues. Their microenvironment, which includes cytokines and growth factors, appears to regulate the expression of these receptors and regulate their adhesive properties. 31 1.3.3 Mast cell function 1.3.3.1 Mast cells and Allergies If an animal has previously been exposed to an antigen and produced IgE antibodies against it, subsequent encounter with the antigen can elicit an allergic response. A type I hypersensitivity response is initiated when an allergen is presented by antigen presenting cells to T cells, which, in the presence of IL-4, differentiate into Th2 cells. IL-4 and IL-13 secretion by the Th2 cells drives B cell differentiation into plasma cells and induces antigen-specific IgE production. This IgE binds to FceRI on mast cells and is cross-linked by binding of the allergen to the membrane bound IgE (Janeway, 2001). This leads to degranulation of mast cells, with release of mediators that cause vasodilation, recruitment and activation of other immune cells and inflammation of the affected area (Figure 1.4) (Janeway, 2001). Allergic reactions may be divided into two responses, the immediate reaction, which result from the release of pre-formed mediators by the mast cell, and late phase reactions that occurs hours later after de novo synthesis and release of additional mediators by mast cells (Janeway, 2001). The "mast cell-leukocyte cytokine cascade" proposed by Galli et al. proposes that mast cells activated through FceRI, secrete cytokines that contribute to acute and late-phase allergic responses. These cytokines recruit other effector cell types that in turn secrete additional cytokines and these cytokines can act directly on fibroblasts, endothelial cells and other cell types. These effects 32 Eosinophil Plasma cell Figure 1.4 Mast cells and type I hypersensitivity. When a host is reexposed to an allergen, dendritic cells present antigen to CD4 T cells and these cells differentiate into Th2 cells that cause B cells to differentate into IgE producing plasma cells. These allergen specific IgE antibodies bind to FceRI on mast cells and cause ativation and degranulation. Th2 cells and mediators released by degranulated mast cells cause activation of eosinophils. The various mediators released by mast cell and eosinophils lead to inflammation and allergy pathology. Adapted from Wedemeyer and Galli, Curr Opin Immunol, 2000; Brightling etal, Clin Exp Allergy, 2003. lead to tissue remodeling, angiogenesis and fibrosis (reviewed in Williams and Galli, 2000a). Thus, mast cells are instrumental in the pathology of allergic reactions, but other cell types contribute to its pathology. 33 1.3.3.1.1 Mast cells and allergic asthma IgE-mediated allergies can take on many forms, depending on the route of allergen entry, the dose of allergen and the amount of antigen-specific IgE present (Janeway, 2001). One common result of an allergic response is the development of asthma. This occurs when an allergen is inhaled and causes inflammation of the respiratory system and restriction of breathing capacity (Brightling et al., 2003). Asthma affects millions of people worldwide and its prevalence is on the increase (Galli, 1997). It is characterized by an early response with mucosal edema, airway narrowing and smooth muscle constriction. A late phase response can also occur after the initial response and consists of neutrophil, eosinophil and lymphocyte recruitment to the lungs and airways (Wills-Karp, 1999). Asthma/Allergies depends on the environmental factors present and the genetic disposition of an individual, as some mutations are associated with increased incidence of this disease (Galli, 1997). Although it has been thought for many years that mast cells play an important role in the pathology of this disease, their specific role in asthma has not been addressed until recently. Since activation of mast cells causes airway hyperreactivity (increased sensitivity to bronchoactive agonists) (Martin et al., 1993), mast cells were considered to be important in the development of allergy-induced asthma. Wild type and mast cell-reconstituted W/W v mice show higher airway reactivity upon anti-IgE induced degranulation than mast cell-deficient mice (Martin et al., 1993). Hyperreactivity occurs within a time frame too short for the recruitment of other cells. Therefore, mast cells were deemed to be directly responsible for this effect. Since airway hyperreactivity could also be induced with mast cell- and IgE-independent mechanisms (Hamelmann et al., 1999; Mehlhop et al., 1997; Takeda et al., 1997), the role of mast cells in asthma became controversial. To reconcile the debate about their role in this disease, Williams et al. 34 (Williams and Galli, 2000) used two methods of sensitization to induce allergic response; one which resembles a more physiological scenario, and the other a more severe challenge containing an adjuvant. Since W/W v mice lack mast cells, they can be used to assess the degree of mast cell contribution to a disease by comparing their responses to wild type mice. These mice can be selectively reconstituted with cultured mast cells and are referred to as "mast cell knock-in" mice. Using W/W v mast cell-deficient mice, wild type mice and BMMC-reconstituted W/W v mice (Williams and Galli, 2000), they observed that W/W v mice had less airway responsiveness and eosinophilia upon sensitization with ovalbumin (OVA) and challenge without alum. However, when an adjuvant was used, W/W v showed similar responses to wild type and mast cell-reconstituted mice. Therefore, under conditions that more closely resembled physiological allergy-induced asthma, mast cells are essential for the onset of the disease. In a similar study, Kobayashi et al. (Kobayashi et al., 2000) also found less airway reactivity in mast cell deficient mice than in wild type or mast cell reconstituted mice, although there was increased eosinophilia in both genotypes (Kobayashi et al., 2000). These different observations may be due to the different allergenization protocols used. However, both groups showed that mast cells are important in the development of airway hyperreactivity in allergic asthma models. Since anti-IL-5 treatment blocked eosinophil influx, but did not affect the degree of airway reactivity, airway reactivity may be due to mast cell derived factors such as platelet activating factor, leukotrienes, thromboxane A2 and tryptase (Kobayashi e ta / . , 2000). Therefore, airway hyperresponsiveness can occur in the absence of mast cells (Williams and Galli, 2000) or infiltrating leukocytes (Martin et al., 1993). Eosinophilia can also occur by mast cell-independent mechanism (Kobayashi et al., 2000). Furthermore, hyperreactivity and eosinophilia occurs in the absence of IgE (Mehlhop et al., 1997) and hyperreactivity 35 cannot be induced in athymic mice, suggesting an important contribution of T cells (Garssen et al., 1990). Thus, eosinophils, T cells and mast cells can contribute to allergic pathology, depending on the model under investigation. 1.3.3.2 Mast cells in innate immunity Since mast cells contribute to allergic and anaphylactic responses, they have been considered "bad actors" of the immune system (Galli et al., 1999). However, as early as 1878, Ehrich proposed that mast cells helped maintain the health of connective tissues (Maurer et al., 2003). Since much research has been focused on the role of mast cells in contributing to disease, the beneficial role of these cells has been largely ignored until recently. It is becoming clear that these cells have many redeeming qualities and are important in the defense against a variety of different pathogens. Mast cells are particularly prevalent at portals of entry, such as the intestine and skin (Lam et al., 2003). Thus, they are poised in positions to detect incoming pathogens and may be the first immune cell activated upon a pathogen's entry. Mast cells not only directly interact with the incoming pathogen but they also release cytokines important for the recruitment of other cells and act as antigen presenting cells to lymphocytes, thus contributing to the innate and adaptive immune responses to bacteria (Figure 1.5). 1.3.3.2.1 Protection from peritonitis Mast cells provide protection from acute bacterial peritonitis since W/W v mice are more susceptible to death due to peritoneal instillation of enterobacteria than wild type or mast cell reconstituted W/W v mice 36 BLOODFLOW Figure 1.5 Mast cells in innate immunity. Upon a bacterial infection, mast cells can bind and phagocytose bacteria. This leads to TNF-a secretion and activation of the endothelium and transmigration of neutrophils. These neutrophils release anti-bacterial mediators that are essential for resolution of the infection. Adapted from Abraham and Arock, Semin Immunol, 1998. (Malaviya et al., 1996a). Mast cells are the only hematopoietic cell that store pre-formed TNF-a (Gordon and Galli, 1990; Gordon and Galli, 1991) and can release it upon activation (Abraham and Arock, 1998). A burst of TNF-a followed by neutrophil influx can be detected in wild type, but not W /W v mice after inoculation with enterobacteria (Malaviya et al., 1996a) suggesting that mast cell-derived TNF-a is responsible for recruitment of neutrophils and resolution of bacterial infections (Figure 1.5). The involvement of TNF-a was verified using antibodies against TNF-a as well as TNF-a-deficient mice. In both scenerios, the majority of neutrophil influx was prevented and mice had increased susceptibility to acute septic peritonitis (Abraham and Arock, 1998; Henz et al., 2001). These results demonstrate that mast cells and TNF-a are essential for the response to peritoneal bacterial infection. 37 Complement appears to play a role in resolution of peritonitis since C3 and C3b deficient mice are more sensitive to CLP (cecal ligation and puncture, a model of acute peritonitis) (Henz e t a / . , 2001). These mice have decreased degranulation of peritoneal mast cells, TNF-oc production, neutrophil influx and phagocytosis of bacteria, which can be corrected by treatment with purified C3 (Prodeus e t a / . , 1997). Therefore, complement appears to be an important component for the activation of mast cells that leads to a response against acute septic peritonitis. Similarly, McLachlan et al. have recently shown that popliteal lymph node swelling induced by intradermal injection of bacteria into the footpads of mice was mast cell- and TNF-a-dependent (McLachlan et al., 2003). Mice lacking mast cells (W/W v ) and W/W v mice reconstituted with TNF-a-deficient mast cells did not exhibit lymph node enlargement upon infection. Since the number of mast cells did not change in the footpads of injected wild type mice, they hypothesized that preformed mast cell-derived TNF-oc, rather than mast cells themselves, migrated to the popliteal lymph nodes and initiated a response. To support this idea, they found an increase in the level of TNF-oc in lymph nodes after bacterial injection or mast cell degranulation (McLachlan et al., 2003). Therefore, the release of TNF-a by mast cells is important for the response to bacterial infections and initiates an immune response by influencing the behavior of other hematopoietic cells. 1.3.3.2.5 Phagocytosis As early as 1892, Metchnikoff hypothesized that mast cells have a protective phagocytic function (Maurer et al., 2003). However, the phagocytic ability of mast cells was not demonstrated until the 1960's when Padawer showed that mast cells can phagocytose colloidal gold (Padawer, 1968), colloidal thorium dioxide (Padawer, 1969) and zymosan (Padawer and Fruhman, 1968). The physiological role for mast cell-mediated phagocytosis was 38 1968). The physiological role for mast cell-mediated phagocytosis was demonstrated many years later, in 1979, when Sher et al. (1979) showed that mast cells bind Salmonella through complement receptor 3 (Sher et al., 1979). More recently, mast cells have been shown to phagocytose and kill E. coll, E. cloacae and K. pneumoniae (Malaviya et al., 1996b). Therefore, mast cells have the ability to phagocytose a variety of substances and pathogens. 1.3.3.2.4 Fim H and CD48 The mechanisms that mast cells use to bind pathogens is not well defined. However one such interaction between mast cells and bacteria has been identified (McLachlan and Abraham, 2001). CD48, a GPI anchored molecule expressed on mast cells binds FimH, a mannose-binding lectin expressed by many enterobacteria (Malaviya e ta / . , 1999). Binding does not occur in the absence of FimH on the bacteria or when CD48 is cleaved or blocked (Malaviya e ta / . , 1999). Adhesion is followed by internalization that involves caveolae, allowing viability of the pathogen inside the cell in the absence of serum components. This process appears to be distinct from the classical endosome-lysosome pathway (Shin et al., 1999; Shin e ta / . , 2000). Binding of CD48 to FimH causes "piecemeal" rather than anaphylactic degranulation (Malaviya and Abraham, 2001) and this is required for neutrophil influx in response to peritonitis (Malaviya et al., 1996a). Therefore, mast cells possess the ability to recognize pathogenic components of bacteria and this recognition can induce binding, phagocytosis and mast cell activation. 1.3.3.2.3 Antigen presentation and lymphocyte interaction Mast cells present antigen in vitro to T cells through MHC I or MHC II (Frandji et al., 1993; Henz et al., 2001; Malaviya et al., 1996b). In vitro, mast cells can present bacterial antigens to T cells and induce clonal expansion of antigen-specific T cells (Malaviya et al., 1996b). Although 39 upon certain infections, and by stimulation with TNF, IFN-yor LPS (Frandji et al., 1993; Love et al., 1996; Wong et al., 1982). Murine BMMC present exogenous antigens in the presence of IL-4 and IFN-y or IL-4 and GM-CSF (Frandji et al., 1995). Therefore, under certain conditions, such as infection, mast cells may be important for antigen presentation to T cells, although this is yet to be demonstrated in vivo. In addition to the effect on T cells though antigen presentation, mast cells secrete mediators that can promote T cell migration. This may be due to a direct effect through chemotaxis, or by upregulating adhesion molecules such as ICAM-1 and VCAM-1 on vascular endothelium (Galli et al., 2005). These mediators include TNF-oc, IL-4, IL-13, IL-16, LTB 4 , LTC 4 , PDE 2 , histamine, MCP-1, MIP-loc, RANTES and lymphotactin (Abraham and Arock, 1998; Galli etal., 2005; Henz etal., 2001; Mekori and Metcalfe, 2000). This idea is supported by the observation that, in vitro, activated mast cells promote adhesion of T cells to endothelial cells through increased VCAM-1 and ICAM-1 expression and this effect is reduced by treatment with antibodies toward either of these proteins or with anti-TNF-a (Mekori and Metcalfe, 2000). Furthermore, it has recently been reported that mast cell degranulation in vivo increases VCAM-1 expression in draining popliteal lymph nodes, thereby enhancing T cell recruitment (McLachlan et al., 2003). Therefore, mast cells can influence the migration, proliferation, differentiation and activation of T cells by presenting antigen and releasing mediators that influence T cells directly or indirectly (Galli et al., 2005). 1.3.3.3 Mast cells and autoimmunity Mast cells have recently been implicated in the development of autoimmune diseases (Galli et al., 2005). Autoimmunity includes a variety of diseases that are pathologically distinct, however, they are characterized by clonally 40 that are pathologically distinct, however, they are characterized by clonally expanded auto-reactive lymphocytes (Robbie-Ryan and Brown, 2002). These include arthritis and multiple sclerosis, both debilitating diseases that lead to paralysis, and joint dysfunction, respectively. The pathology of these diseases has been recently shown to require mast cells (Lee et al., 2002; Secor etal., 2000). 1.3.3.3.1 Arthritis Given the resident position of mast cells in tissues and the potent mediators they produce, it was hypothesized that they may be important in the development of arthritis (Lee et al., 2002). Accordingly, mast cell accumulation was observed around the joints of arthritis patients and mice (Benoist and Mathis, 2002; Woolley and Tetlow, 2000). Moreover, prevention of mast cell degranulation reduced the progression of induced arthritis (Malfait et al., 1999). Therefore, it was proposed that mast cells contribute to arthritis. To test this hypothesis directly, arthritis was induced in wild type and mast cell-deficient mice (Lee et al., 2002). Shortly after arthritic induction in wild type mice, mast cell degranulation in joints was observed followed by neutrophil influx (Benoist and Mathis, 2002; Lee et al., 2002). Mast cell deficient mice were resistant to inducible arthritis but mast cell reconstituted mice were susceptible. This definitively demonstrated an important role for mast cells in the pathology of arthritis. These results also suggest that mast cell mediators released upon degranulation contribute to arthritis. These mediators include TNF-®, proteases, prostaglandins and leukotrienes (Woolley, 2003) that cause increased permeability, activation of macrophages, stromal cells, chondrocytes and production of additional inflammatory mediators (Woolley, 41 2003). These mast cell initiated effects contribute to the tissue destruction (Lee et al., 2002) that leads to the onset of arthritis. 1.3.3.3.2 Experimental autoimmune/allergic encephalomyelitis Experimental autoimmune/allergic encephalomyelitis (EAE) is an inducible disease in mice that resembles multiple sclerosis (Secor et al., 2000). It is characterized by disruption of the blood-brain barrier, inflammation of the central nervous system (CNS), mononuclear cell infiltration and nerve demyelination causing paralysis (Secor et al., 2000; Tanzola et al., 2003). Demyelination is caused largely by the action of self-reactive CD4 + T cells, but other immune cells are also involved (Tanzola et al., 2003). As early as 1890, Neuman reported the presence of mast cells in the CNS plaques of multiple sclerosis patients (Secor et al., 2000) and in the murine and human diseases, mast cells are localized to sites of demyelination and CNS inflammation (Robbie-Ryan and Brown, 2002). Furthermore, drugs that inhibit degranulation of mast cells decrease disease severity (Robbie-Ryan and Brown, 2002), suggesting that these cells harbor important mediators for the development of this disease. More direct evidence for the role of mast cells in EAE comes from the observation that disease severity is reduced in mast cell deficient W/W v mice and increases upon transplantation of mast cells (Secor et al., 2000). Wild type mice with EAE show infiltration of mast cells in the meninges (Robbie-Ryan and Brown, 2002), however, using reconstituted W/W v mice, Tanzola et al. (2003) showed that peripheral mast cells (outside the CNS) are important for the induction of the disease (Tanzola et al., 2003) and that CNS mast cells are not required. It is unclear how peripheral mast cells contribute to EAE. Regardless of the location of mast cells, it appears that they are important in the pathology of this disease and elicitating the 42 mechanism by which this occurs may give clues to the treatment of the human form of the disease. 43 1.4 The CD34 family and CD43 1.4.1 Introduction 1.4.1.1 The CD34 family Our laboratory has identified a family of cell surface sialomucins that share similar protein structure and genomic organization (Doyonnas et al., 2001). This family consists of three proteins, CD34, podocalyxin (also known as MEP21, thrombomucin and PCLP-1), and endoglycan, with CD34 as the prototypic member (Sassetti et al., 2000) (Figure 1.6). The extracellular domain of these proteins contains a serine-theonine-proline rich highly glycosylated domain, a disulfide-bonded globular domain and a stalk domain which is void of glycosylation. CD34 and podocalyxin can also be sulfated and all three members have highly negatively charged sialic acid residues on their extracellular domain (Doyonnas et al., 2001; Lanza et al., 2001; Takeda et al., 2000). Their cytoplasmic domains are approximately 70 amino acid and bear binding motifs for phosphorylation by casein-kinase 2 (CK2) and protein kinase C (PKC) and a docking site for PDZ domain-containing proteins (DTH/EL terminal sequence). There are eight exons for each member and the exon and intron sizes of these genes are similar with the same exons encoding similar structural regions of each protein, suggesting that they arose from a common ancestral gene. In addition, each member undergoes alternative splicing via an additional exon between exons 7 an 8, which yields a protein with a shortened cytoplasmic tail, resulting from a premature stop codon (Doyonnas e ta / . , 2001; Sassetti e ta / . , 2000) (Figure 1.6). CD34 family members also share a similar tissue distribution (Table 1.2). CD34 is expressed by hematopoietic progenitor cells and on 44 MM •PKC (h)CK2 PKC D T E L J -CK2 J-CK2 CK2 -J C K 2 - | j-PKC | - P K C DTHL DTHL mCD34 Podocalyxin Endoglycan B cd34 podxl endgl 44.0 11.0 0.5 1.3- 7.9 2 3 4 / x 5 12 0.3 2.2 0.3 0.3 A 6 A ] • c 0.3 0.2 ] • t 10.0 m l 5'UTR & Signal peptide 7.5 1.t 7.0 0 8 1.3 0.7 Mucin domain C - C domain 0.5 2.2 • • Stalk J M Cyt. domain : tall 3 'UTR s t o p Long forms | | ™| | ; \ \ CytTailL 7 8 a \ s t o p Truncated forms I I T M | I 5 j f V 8 b 45 Figure 1.6 The CD34 family: proteins, genes and splicing. A) Hypothetical structure of murine CD34 family members (CD34, Podocalyxin and Endoglycan) and CD43 Blue boxes = mucin domains, green boxes = the cysteine-rich domains, pink boxes = glutamic acid-rich region, black circles = potential N-linked carbohydrates, horizontal bars = potential O-linked carbohydrates, arrows = potential sialic acid motifs on O-liked carbohydrates, PKC and CK2 = potential phosphorylation sites. B) Genomic organizationof human Cd34,Podxl and Endgl genes based on sequence contigs identified in the human sequence database. C) Generation of alternatively spliced transcripts of Cd34, Podxl and Endgl: Analyses of EST's primary cDNA clones and genomic loci suggest that, for all three family members, splicing between exons 7 and 8 results in longer cDNAs with premature translation^ stops that lead to truncation of the cytoplasmic domains. Adapted from Doyonnas et al, JEM, 2001; Nielsen ef al, Cells Tissues Organs, 2002. vasculature (reviewed in Krause et al., 1996) (Figure 1.7). It is widely cited that CD34 is downregulated upon differentiation and it is absent on mature hematopoietic cells (Cheng e ta / . , 1996; Felschow eta / . , 2001; Krause e ta / . , 1994; Majdic et al., 1994; Wood et al., 1997). For this reason, CD34 is commonly used as a marker for human HSC (Engelhardt et al., 2002). Podocalyxin is also expressed by HPC/HSC as well as vasculature, nucleated embryonic red blood cells, platelets, podocytes and on mesothelial boundary elements that line the surfaces of the liver, spleen, heart and gut (Doyonnas et al., 2005; Sassetti et al., 2000). Endoglycan is expressed on hematopoietic precursors, monocytes, activated B cells, embryonic erythrocytes, vascular smooth muscle, intestinal epithelia and neurons (Sassetti et al., 2000 and our unpublished data). Given the similar protein characteristics of these family members, they may have redundant functions. In support of this idea, podocalyxin-deficient mice show increased expression of CD34 (Doyonnas et al., 2001). 1.4.1.2 CD43 CD43 (leukosialin, sialophorin) is another sialomucin that is expressed by all hematopoietic cells, except mature B cells and erythrocytes (Cruz-Munoz et al., 2003; Ostberg etal., 1998; Stockton e ta / . , 1998) 46 Distribution Podocalyxin CD34 Endoglycan Multipotent precursors Adult + + + Embryo + + + Monopotent precursors Erythroid + + + Thrombocyte + + ? Myeloid - + +/-Lymphoid + + +? Mature Cel ls B cells - - + T cells Macrophages - -Granulocytes Mast cells - + Eosinophils Erythrocytes - - +* Platelets + - ? Vascular endothelia + + Vascular smooth muscle - - + Podocytes + - +/-Mesothelia + Neurons +" * embryonic only ** eppendymal layer only ** Table 1.2 Tissue Distribution of CD34 family members Modified from tables provided by Kelly McNagny and Helen Merkens 47 LT-HSC ST-HSC MEP Erythrocyte Plasma cell Macrophage Platelets Figure 1.7 Expression of CD34 and CD43 by hematopoietic cells. CD34 is expressed on hematopoietic progenitorss and mast cells. CD43 is on the surface of all hematopoietic cells except mature B cells and erythrocytes. Adapted from Wagers et al, Gene Therapy, 2002 48 (Figure 1.7). Although this protein is not classified within the CD34 family, it shares many of the same characteristics: CD34 and CD43 are both cell-associated mucins with abundant O-glycosylation, sialic acid residues and cytoplasmic PKC and CK2 binding sites (Majdic et al., 1994). CD43 is the largest sialomucin on cells and extends 45 nm from the plasma membrane (Tong et al., 2004), has 75-85 O-linked carbohydrate chains and 100 negatively charged sialic acid residues (Ostberg et al., 1998), making it extremely bulky and highly negatively charged. However, the genomic locus is very different from the CD34 family since it is encoded by a single exon (Cyster et al., 1990). Despite genomic differences, the protein structure of these proteins predicts similar functions. 1.4.2 Functions of the CD34 family and CD43 Loss of either CD34 or CD43 in mice has no significant effect on mouse development or hematopoiesis (Manjunath et al., 1995; Suzuki et al., 1996). However, the absence of podocalyxin results in perinatal lethality (Doyonnas et al., 2001). There have been several proposed functions for the CD34 family (Figure 1.8). These include regulation of differentiation and enhancement of proliferation (Cheng et al., 1996; Fackler et al., 1995), adhesion (Baumhueter et al., 1993) and anti-adhesion/disruption of adherens and tight junctions (Doyonnas et al., 2001; Takeda et al., 2000). Similarly, CD43 has been reported to function as both an adhesion and an anti-adhesion molecule (Ostberg et al., 1998). It is possible that these proteins serve in more than one of these functions, depending on the cell type and activation state of the cell. 49 HEV: Glycosylation-dependent Adhesion Key V L-Selectin * HEV-specific r> „ glycosylation U negative charge contributed by sialic acid or sulfation Integrins/integrin f ligands CD34 or Podocalyxin B Charge/Glycosylation-dependent Anti-adhesion Inhibitor of Differentiation ectopic CD34 Disruption of Tight Junctions Junctional DIsrupaonoT-" complexes junctional complexes Enhancement of Proliferation wild type CD34 KO Figure 1.8 Proposed functions of CD34-like proteins. Schematic showing main proposed functions for CD34-like proteins based on published literature. A) Adhesion. High endothelial venule-specific glycosylation of CD34 and Podocalyxin creates ligands for L-selectin expressed by activated leukocytes. B) Anti-adhesion/disruption of tight junctions. Most vessels express CD34 and Podocalyxin in a form that cannot bind L-selectin. Experiments suggest that Podocalyxin blocks adhesion and disrupts tight junctions, probably through charge repulsion and steric hindrance, preventing interaction of adhesion molecules. C) Block in differentiation and enhancer of proliferation. M1 cells rapidly downregulate CD34 upon differentaition. Cells constiutively expressing full-length CD34 are prevented from inducible differentiation and maintain high level of proliferation, compared to differentiated cells. CD34 null mice exhibit reduced number of progenitor cells and decreased ability of these cells to expand ex vivo. Modified from table provided by Kelly McNagny 1.4.2.1 Differentiation and proliferation Since CD34 expression has been shown to inversely correlate with maturation, CD34 is thought to prevent differentiation. This hypothesis is supported by observations made by Cheng et al. (Cheng et al., 1996) who found decreased erythroid and monocytic/macrophage development of embryoid bodies derived from CD34-deficient ES cells. Reintroduction of wild type, full-length CD34 or truncated CD34 into embryoid bodies 50 corrected this defect. This group also showed that cells derived from CD34-null mice are somewhat deficient in their colony forming ability and in their ability to expand ex vivo. Unfortunately, these defects were not observed for another CD34-deficient strain of mice (Suzuki et al., 1996) and loss of CD34 did not impair hematopoietic recovery after sub-lethal irradiation (Cheng et al., 1996). These data suggest that CD34 may be important for the proliferative ability of cells and/or the maintenance of hematopoietic progenitors. Further evidence for a role of CD34 in blocking differentiation and affecting proliferation was demonstrated by Fackler et al. (Fackler et al., 1995). The myelomonocytic progenitor cell line, M l endogenously expresses this protein and down regulates it when induced to terminally differentiate into macrophages by IL-6. M l cells, that ectopically overexpress full length CD34, but not the naturally occurring truncated form, arrest in an intermediately differentiated state. These overexpressing cells display immature morphology, reduced phagocytosis and enhanced proliferation. This effect, however, was only observed for M l cells and was not observed for U937 or HL60 cell lines. Conversely, loss of CD43 in T cells causes increased proliferation and activation (Manjunath et al., 1995; Thurman et al., 1998). In vivo, loss of CD43 causes a fourfold increase in CTL response to viruses (Manjunath et al., 1995). This has been shown to be dependent upon the intracellular domain of CD43 and may involve signaling and interaction with the cytoskeleton (Walker and Green, 1999). This suggests that CD43 actually decreases proliferation, in contrast to the proposed enhancement of proliferation by CD34. This difference may be due to differences in cell types and experimental conditions or the different sequence of the cytoplasmic tails of these two proteins. 51 1.4.2.2 Adhesion CD34 and podocalyxin, which are expressed on high endothelial venules (HEV), bind L-selectin on circulating leukocytes and are important for tethering infiltrating leukocytes on these cells. This induces rolling on the endothelium with subsequent extravasation into lymph nodes (Baumhueter et al., 1993; Sassetti et al., 1998). However, the recognition of CD34/podocalyxin by L-selectin is dependent on the presence of a highly specific glycosylation is not displayed on these proteins when they are synthesized by hematopoietic cells (Suzuki et al., 1996). Despite this function, CD34-deficient lymphocytes showed normal adhesion to HEV in vitro, leukocyte rolling, lymphocyte homing and extravasation to the peritoneum (Suzuki etal., 1996), which may reflect functional compensation by podocalyxin (Doyonnas et al., 2001). However, eosinophil accumulation in the lungs of allergenized CD34 KO mice is reduced by an unknown mechanism (Suzuki et al., 1996). Interestingly, endoglycan has recently been reported to also bind L-selectin. This interaction uses a different binding mechanism than CD34 and podocalyxin, but suggests that it may also act as an L-selectin ligand in vivo (Fieger et al., 2003). Therefore, all three members of the CD34 family have been shown to bind L-selectin. To establish whether CD34 serves as an adhesive ligand on hematopoietic cells, Healy et al. (Healy et al., 1995) generated mice that overexpress human CD34 specifically on T cells. Although they observed no change in hematopoietic cell development, maturation or distribution, these cells showed increased adhesion to human (but not murine) BM stroma. These results indicate that CD34 may bind to ligands on stromal cells. They also found that cross-linking human CD34 increases T cell binding to stroma, suggesting that CD34 may not directly mediate this interaction and that CD34-mediated signaling may modulate binding by adhesion molecules (Healy etal., 1995). 52 CD43 has also been implicated as an adhesive molecule. In vitro, B cells bind to immobilized CD43 and CD43 antibody inhibits monocyte-endothelial adhesion (McEvoy et al., 1997; Ostberg et al., 1998). CD43 has also been reported to bind ICAM-1 in vitro (Rosenstein et al., 1991), but leukocytes from |32-deficient patients (ccLp2 integrin binds ICAM-1 (Oberyszyn et al., 1998)) show no binding to ICAM-1 despite normal expression of CD43 (Manjunath et al., 1995). CD43 has also been shown to bind C l q (Guan et al., 1991), MHC class I (Stockl etal., 1996), galectin-1 (Baum etal., 1995), Siglec-1 (van den Berg et al., 2001) and E-selectin (Sawada et al., 1994; Zhang etal., 1997), although the functional significance of these interactions has not been demonstrated. Several studies have explored the adhesive effect induced by the addition of CD34/43 antibodies to cells in culture. These cause homotypic adhesion of CD34/43-posit ive cells. This process is dependent on physiological temperature, ATP, divalent cations, tyrosine phosphorylation and an intact cytoskeleton (Majdic et al., 1994; Tada et al., 1999), supporting the notion that it occurs through an active process. Although these results suggest a pro-adhesive function of these molecules (Tada et al., 1999), this antibody-induced polarization may expose otherwise shielded adhesins that may then allow cell-to-cell adherence, rather than CD34/43 directly facilitating adhesion. Therefore, although these results suggest an adhesive function, they are also compatible with an anti-adhesive function: CD34 may normally mask molecules that mediate aggregation and thus act as an anti-adhesive molecule until these proteins are exposed upon cross-linking of CD34/43. In support of this idea, homotypic aggregation by anti-CD43 requires bivalent cross-linking and is not induced by Fab fragments (Cyster and Williams, 1992). Cytoadhesiveness induced by antibody cross-linking appears to involve, at least to some degree, (32 but not (31 integrin function (Majdic et al., 1994) since homotypic adhesion is inhibited by antibodies toward LFA-1 (al_(32 integrin) (Bianchi et al., 2000) or ICAM-1, and is 53 diminished for cells with decreased expression of ICAM-1 (Majdic et al., 1994). Therefore, it appears that the capping of CD34 and CD43 causes binding of al_[32 to ICAM-1 on adjacent cells which may be due to lack of a shielding effect. This could also occur via an indirect mechanism that increases adhesion, possibility through signaling. This latter possibility is supported by the observation that the cytoplasmic tail of CD34 is essential to the homotypic aggregation of cells induced by anti-CD34 (Hu and Chien, 1998). Therefore, antibody-induced capping of CD34 and CD43 may upregulate adhesion molecules that cause homotypic adhesion. Although the role of CD34 and podocalyxin as L-selectin ligands in HEV is firmly established (Baumhueter et al., 1993; Sassetti et al., 1998), the modification necessary for this interaction is not made when these proteins are expressed on other cell types. The evidence that these proteins and CD43 can act as pro-adhesion molecules in other contexts, remain subject to interpretation and may not represent their physiological function. Paradoxically, these proteins have also been implicated as important regulators of adhesion. 1.4.2.3 Anti-adhesion The highly charged extracellular domain of glycoproteins has long been thought to mediate repulsive effects due to their high negative charge (Delia etal., 1993; Ostberg e t a / . , 1998). Previous experiments have shown that mucin-type molecules can block adhesion by steric hindrance (due to glycosylation) and charge repulsion (from sialic acids) (Ostberg etal., 1998; Takeda et al., 2000). In accordance with this hypothesis, CD34 localizes to ' loose' interdigitating surfaces of endothelial cells, and not to tight junctions (Fina e t a / . , 1990) or growing vascular sprouts (Schlingemann e t a / . , 1990). It has been hypothesized that the expression of CD34 on the lumenal junctions of vascular endothelia helps the infiltration of leukocytes into 54 tissues while CD34 on progenitor cells regulates binding to stromal cells and the extracellular matrix (Gordon et al., 1991). Evidence for the anti-adhesive role of CD34 comes from the observation that pro-adhesion molecules show increase expression upon CD34 downregulation. This was shown in vitro, in response to cytokines, and in vivo, in graft-versus-host disease (Delia et al., 1993; Norton et al., 1993). This reciprocal regulation suggests that adhesion molecules and CD34 function antagonistically. Since CD34 and podocalyxin are structurally similar, and the absence of podocalyxin causes increased expression of CD34, it is assumed that they function similarly (Doyonnas et al., 2001). Podocalyxin in kidney podocytes maintains the filtration slits of their tertiary foot processes. Our lab has shown that podocalyxin-deficient mice lack podocyte filtration slits and instead display tight junctions that prevent the formation of urine. These mice die within one day of birth presumably from high blood pressure and anuria that is probably caused by this kidney defect (Doyonnas e ta / . , 2001). Thus, podocalyxin is an important anti-adhesion molecule that maintains podocyte filtration slits, presumably via its charge repulsion. In vitro studies have also suggested the importance of this molecule for anti-adhesion. When overexpressed in CHO and MDCK cells, podocalyxin greatly reduces cellular aggregation in a dose dependent manner. It also decreases the transepithelial resistance of cells grown in a monolayer and alters the distribution of junctional proteins (Takeda et al., 2000). More recently, podocalyxin has been shown to be a marker of invasive breast carcinomas and ectopic expression of podocalyxin in a breast carcinoma cell line disrupts cell-cell junctions and leads to cell shedding from cultured monolayers (Somasiri e ta / . , 2004). These experiments suggest that podocalyxin acts as 55 a "Teflon" molecule that prevents cell adhesion, disrupts the formation of tight junctions and promotes invasion. We have recently shown that the loss of CD34 or podocalyxin decreases the short-term homing of fetal liver HPC in sub-lethally irradiated adult mice and that the absence of both proteins has an additive effect (Doyonnas et al., 2005). This is true for homing to both the BM and spleen in wild type mice. In addition, podocalyxin is expressed on erythroid progenitors during embryogenesis and during hemolytic anemia in adult mice (Doyonnas e t a / . , 2005). These data support a role for podocalyxin in the release of erythroid cells from the yolk sac niche, movement of hematopoiesis in the developing embryo and the migration of erythroid cells to extramedullary sites of hematopoiesis during anemia. In light of the reduced migration of mutant HPC, the movement of erythroid hematopoietic progenitors is probably due to the anti-adhesive effect of this protein. In addition to the potential anti-adhesive role suggested by its structure, CD43 has been shown experimentally to decrease adhesion. CD43 overexpression by HeLa cells decreases adhesion to T cells (CD43-positive) (Ardman et al., 1992) that was otherwise mediated by T cell LFA-1 (aLp2 integrin) (Bianchi e t a / . , 2000) and HeLa ICAM-1 binding. It also decreases aggregation of HeLa cells (Ardman e t a / . , 1992). CD43 prevents aggregation of B cells to T cells presumably causing the immunodeficiency of transgenic mice expressing CD43 on mature B cells (Ostberg et al., 1996). Conversely, loss of CD43 in a T cell line increase homotypic aggregation and adhesion to fibronectin via (31 integrin, suggesting that CD43 normally prevents this interaction (Manjunath et al., 1993) and splenocytes from CD43-null mice showed increased adhesion to fibronectin and ICAM-1 (Manjunath et al., 1995). 56 Intravital microscopy of peripheral lymph nodes was used to show that CD43 negatively regulates migration of lymphocytes to peripheral lymph nodes by interfering with L-selectin-mediated tethering and rolling (Stockton er al., 1998). Woodman et al. observed enhanced rolling in vivo and increased adhesion on immobilized E-selectin for CD43-deficient cells. They also demonstrated that there is reduced leukocyte recruitment upon peritoneal inflammation and impaired emigration out of the vasculature (Woodman et al., 1998). These results implicate CD43 in blocking adhesion and facilitating leukocyte transmigration. Since CD43 is excluded from the T cell-APC complex through its interactions with the cytoplasmic ezrin-radixin-moesin (ERM) adaptor proteins (Tong et al., 2004), it is thought that CD43 may sterically prevent T cell-APC contact. However, a mutant form of CD43 that localizes to the T cell-APC contact, does not inhibit T cell activation, and therefore, CD43 does sterically hinder this interaction (Savage etal., 2002; Tong e ta / . , 2004). Additionally it has been shown that for activated T cells, the cytoplasmic tail of CD43 is necessary and sufficient to prevent homotypic aggregation, suggesting that there are intracellular mechanisms controlling the anti-adhesive effect of CD43 (Walker and Green, 1999). These results challenge the passive "barrier hypothesis" and suggest that the intracellular tail of CD43 is also important in blocking adhesion. CD43 is shed by activated neutrophils, T cells and mast cells and this may regulate the ability of those cells to bind adjacent cells so that in the absence of CD43, adhesion is permitted (Ostberg et al., 1996). In addition, CD43 caps on activated T cells and is internalized in activated dendritic cells, representing other mechanisms to regulate its repulsive effect (Ostberg et al., 1998). 57 These results suggest that steric hindrance and charge repulsion mediated by CD34-like proteins and CD43 are functionally important properties. Additionally, they may further extend to the migratory abilities of cells and prevent inappropriate interactions with tissues/vasculature. Thus in different contexts, these molecules may act as adhesion or anti-adhesion molecules. In the absence of a ligand and the appropriate modification of these proteins, the 'default' function of CD34 family members and CD43 may be for anti-adhesion. 1.4.3 CD34 and podocalyxin on stem cells CD34 has been considered the "defining hallmark of hematopoietic stem and progenitor cells" (Healy et al., 1995; Hu and Chien, 1998) and the enrichment of CD34 + cells is still hailed as "one of the most efficient and effective cell separation methods" (Engelhardt et al., 2002). Historically, after CD34 + BM cells were shown to reconstitute hematopoiesis in baboons (Berenson et al., 1988), CD34 was considered an ideal marker of HSC. It was later shown that CD34 + cells were also capable of long-term repopulation in mice (Morel et al., 1996), and that LT-HSC were 100 times more frequent in the CD34 +Lin" fraction of BM than the CD34"Lin" fraction (Donnelly et al., 1999). Like murine HSC, CD34 was shown to be expressed by human BM hematopoietic progenitors (DiGiusto et al., 1994) and human CD34 + cells repopulated NOD/SCID mice and fetal sheep (Bhatia et al., 1997; Hogan et al., 1997; Sutherland et al., 1996). These results suggest that the majority of HSC and HPC on both species expressed CD34. Despite the wide citation of its specificity to progenitor cells (Cheng et al., 1996; Felschow etal., 2001; Krause etal., 1994; Majdic etal., 1994; Wood et al., 1997), it has recently been shown that CD34 is heterogeneously expressed by HSC (reviewed in Ogawa, 2002). The recent observation that stem cells can be found in the CD34-negative fraction of BM stirred significant controversy since CD34-positive cells have been used in the 58 clinical setting for over a decade. LT-HSC were shown to be equally distributed in the CD34 + and CD34" fractions of t h y - l l o w l i n " / l o w S c a - l + BM (Morel er al., 1998). The existence of CD34" HSC was confirmed with hematopoietic engraftment of mice with a single CD34 l o w L in"Sca- l + BM cell (Osawa et al., 1996). Furthermore, using Hoechst staining to identify the negative side population (SP), highly enriched for HSC, Goodell et al. showed that these cells were CD34" (Goodell et al., 1996; Goodell et al., 1997). Furthermore, the repopulating ability of Lin~c-ki t + Sca-l + BM was found in the CD34" fraction (Sato et al., 1999). Human CD34" cells were shown to also be capable of reconstitution (Bhatia et al., 1998; Zanjani et al., 1998), however they provided only a fraction of hematopoietic engraftment activity (Gao et al., 2001). These data provide striking evidence to refute the original hypothesis that CD34 is the "defining hallmark of HSC". Although anti-CD34 provides a good method of purifying stem cells, its use may inadvertently discard many CD34" stem cells from adult tissue (Ogawa, 2002). These observations can be largely reconciled through the observation that CD34 is developmentally regulated (Ito et al., 2000) and that it is expressed by activated but not quiescent HSC (Dao et al., 2003; Sato et al., 1999). Most HSC express CD34 early in ontogeny, and CD34 expression is maintained on the majority of cells until 7-10 weeks after birth and only 20% of adult murine stem cells express this protein (Ito et al., 2000). Sato et al. (Sato et al., 1999) showed that most adult stem cells are normally CD34", however, they increase their expression of this protein in response to 5-FU (which eliminates cycling cells and activates HSC) or to cytokines in vitro. This process was also shown to be "reversible": When transplanted BM was allowed to reach steady state, the stem cells lost expression of CD34. Therefore, CD34 expression coincides with the active state of HSC that may involve proliferation and migration of these cells from the BM niche. In accordance with this hypothesis, G-CSF mobilized stem cells have 59 been shown to express high levels of this protein (Tajima et al., 2000). The reversibility of CD34 expression has also been shown for human HSC (Dao et al., 2003; Nakamura etal., 1999). Nakamura etal. (Nakamura etal., 1999) showed that CD34" cells give rise to CD34 + cells in vitro. This was further extended when human CD34 + HPC were transplanted into immune-deficient mice and became CD34". These cells were then transplanted into secondary recipients and re-expressed CD34 (Dao et al., 2003). These results support the idea that CD34 is expressed on activated but and not quiescent HSC. Therefore, depending on the age of the mouse under investigation and the method of purification, CD34 expression may be present or absent on the surface of HSC. These results have redefined the phenotypic definition of murine HSC. Although CD34 is still considered to be a marker of human HSC, it is no longer defined as a marker of all murine HSC (Weissman et al., 2001). This was further shown using a transgenic mouse harboring the entire human CD34 genomic locus. In these mice, Okuno eta/ . (Okuno e ta / . , 2002) found that murine LT-HSC expressed human CD34, but not murine CD34. It is currently unknown what elements are responsible for this difference. We have recently shown that podocalyxin, too, is expressed by HSC (Doyonnas et al., 2005). Podocalyxin-positive cells were contained within the l in"c-k i t + Sca- l + fraction of adult BM and these cells are capable of reconstitution of primary, secondary and tertiary recipients. Unlike CD34, podocalyxin expression on HSC remains after 10 weeks of age. Therefore, CD34 and podocalyxin appear to be regulated differently in stem cells. 1.4.4 CD34 family and CD43 in signal transduction Several recent studies have searched for proteins that bind the cytoplasmic tails of CD34, podocalyxin, and CD43 in an effort to find out if and how these proteins cause cellular changes. The first clue that these sialomucins were 60 involved in signaling was the demonstration that their cytoplasmic tails were phosphorylated by PKC (Chatila and Geha, 1988; Fackler er al., 1990) and have been shown to aggregate in response to stimuli. This suggests interaction with the cytoskeleton and implies that these proteins interact with cytoplasmic proteins (Tada et al., 1999). The known and potential interactions of CD34 family members and CD43 with the cytoskeleton are summarized in Figure 1.9. Tada et al. (Tada et al., 1999) made great strides at elucidating the mechanisms of antibody-mediated adhesion. After stimulation with anti-CD34/43, cells exhibit adhesion and long-lived cap formation of CD34/43, which was dependent upon an intact cytoskeleton. This cap co-localizes with F-actin, suggesting an interaction of these sialomucins with the cytoskeleton. This also causes tyrosine phosphorylation of several proteins, including Lyn and Syk, which localizes to the cap. Lyn interacts with two of these phosphorylated proteins and Syk interacts with another, possibly linking CD34/43 to two distinct signaling cascades (Figure 1.9). Interestingly, the truncated version of CD34 also induces tyrosine phosphorylation, suggesting that the 16 amino acids present in its cytoplasmic tail include the important residues of this signaling cascade. These results suggest that CD34 and CD43 have similar pathways and that cross-linking of these receptors is important in cell signaling. The majority of interactions with CD34-like molecules intracellular^ so far indicate linkage to the cytoskeleton. These cytoskeletal changes have potential functions in growth factor induced cell shape changes, cell division, endocytic processes, locomotion and chemotaxis (Bretscher, 1999; Caron, 2002; Mangeat e ta / . , 1999). 61 mPodocalyxin Figure 1.9 Established and proposed interactions of CD43/CD34/Podocalyxin and the cytoskeleton.Shown are the known ligands for the cytoplasmic tails of these proteins and their known and putative interactions with downstream molecules and the cytoskeleton. 1.4.4.1 CD34 and CrkL Felschow et al. (Felschow et al., 2001) demonstrated that the cytoplasmic region of CD34 juxtaposed to the transmembrane domain interacts with the 3' SH3 domain of CrkL (Figure 1.9). CrkL is a member of the Crk family of adaptor proteins, which link receptors that do not contain intrinsic kinase 62 activity, to signaling cascades. CrkL has been shown to be involved in cellular adhesion and associates with other proteins involved in adhesion (Hemmeryckx et al., 2001). It is unclear whether CD34 and CrkL interact directly, although proteins that are known to bind CrkL have not been found to bind to CD34 (Felschow et al., 2001). Cross-linking of CD34 has been shown to phosphorylate Syk, which has also been shown to bind CrkL (Oda et al., 2001; Tada et al., 1999). Therefore, CD34 may signal through CrkL to induce the phosphorylation of Syk, which in turn phosphorylates a downstream effector (Tada et al., 1999). In addition, CrkL has been recently observed to co-immunoprecipitate with Syk and WASP, and a CrkL/WASP/Syk complex was observed as a complex in the cytoskeleton of activated cells (Oda et al., 2001). WASP is involved in cytoskeletal assembly via Arp2/3 (Caron, 2002) and may link CD34 with the cytoskeleton upon cellular activation. 1.4.4.2 Podocalyxin/CD43 and ERM proteins The C-terminal PDZ-binding DTHL sequence of podocalyxin (a CD34 homologue) binds the Na + /H +-exchange regulatory factor 2 (NHERF2) (Takeda et al., 2001) (Figure 1.9). NHERF2 is also an adaptor molecule that interacts with several membrane proteins and links them to the cytoskeleton through ezrin, a cytoskeletal-associated ERM family member. ERM proteins control the membrane distribution of cell surface molecules (Allenspach et al., 2001). Podocalyxin, NHERF2 and ezrin have been shown to co-localize along the apical surface of the foot processes of podocytes suggesting their role in the cytoskeletal arrangement of these structures (Takeda et al., 2001). CD43 has also been shown to link to the cytoskeleton via ERM proteins (Serrador et al., 1998; Yonemura et al., 1993) (Figure 1.9). ERM proteins co-localize with CD43 in rear cellular uropods and ERM is required at the 63 cleavage furrow (Allenspach et al., 2001; Seveau et al., 2000). The ezrin binding sequence on the cytoplasmic tail of CD43 is required for localization of CD43 to the uropod and exclusion from the T cell-APC contact zone (Savage et al., 2002). Therefore, there are at least two potential pathways that link podocalyxin/CD34/CD43 to the cytoskeleton and enable them to effect cell function. The localization of CD34 and podocalyxin in actin-rich structures such as podocytes and miniprocesses further implicate these interactions. 1.5 Aims of Study We originally sought to determine the tissue expression of the three CD34 family members. During this study we were surprised to find that CD34 is expressed by one mature hematopoietic cell, the murine mast cell. Since CD34 expression, prior to this observation, was believed to be confined to the hematopoietic progenitors in the blood system, its function had been difficult to address due to the scarcity of these cells and the difficulty in their purification. We exploited the use of BM-derived cultured mast cells from wild type and knock-out mice to study its function. Since these cells also express CD43, it enabled us to use this in vitro system to explore the function of these proteins on these cells. The function of adhesion molecules on hematopoietic cells has been extensively studied. However, the anti-adhesive molecules that regulate these interactions remain largely unexplored. Based on previous observations for the function of CD34 family proteins and CD43, we sought to find out if CD34 and CD43 attenuate adhesion of mast cells. It was our hypothesis that they act as negative regulators of adhesion through their bulky glycosylation and negative charge and that this inhibits the migration of MCp in vivo. This study represents the first exploration of the function of CD34 and CD43 on mast cells in vivo. Since both proteins are expressed by 64 HSC, we hope by exploring the function of CD34 and CD43 on mast cells, we will be able to extrapolate our results to their elusive function on stem cells. 65 1.6 References Abraham, S. N., and Arock, M. (1998). Mast cells and basophils in innate immunity. Semin Immunol 10, 373-381. Alison, M. R., Poulsom, R., Jeffery, R., Dhillon, A. P., Quaglia, A., Jacob, J . , Novelli, M., Prentice, G., Williamson, J . , and Wright, N. A. (2000). Hepatocytes from non-hepatic adult stem cells. Nature 406, 257. Allenspach, E. J . , Cullinan, P., Tong, J . , Tang, Q., Tesciuba, A. G., Cannon, J. L , Takahashi, S. M., Morgan, R., Burkhardt, J . K., and Sperling, A. I. (2001). ERM-dependent movement of CD43 defines a novel protein complex distal to the immunological synapse. Immunity 15, 739-750. Arai, F., Hirao, A., Ohmura, M., Sato, H., Matsuoka, S., Takubo, K., Ito, K., Koh, G. Y., and Suda, T. (2004). Tie2/angiopoietin-l signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 118, 149-161. Ardman, B., Sikorski, M. A., and Staunton, D. E. (1992). CD43 interferes with T-lymphocyte adhesion. Proc Natl Acad Sci U S A 89, 5001-5005. Arroyo, A. G., Taverna, D., Whittaker, C. A., Strauch, U. G., Bader, B. L , Rayburn, H., Crowley, D., Parker, C. M., and Hynes, R. O. (2000). In vivo roles of integrins during leukocyte development and traffic: insights from the analysis of mice chimeric for alpha 5, alpha v, and alpha 4 integrins. J Immunol 165, 4667-4675. Arroyo, A. G., Yang, J. T., Rayburn, H., and Hynes, R. O. (1999). Alpha4 integrins regulate the proliferation/differentiation balance of multilineage hematopoietic progenitors in vivo. Immunity 11, 555-566. 66 Artis, D., Humphreys, N. E., Potten, C. S., Wagner, N., Muller, W., McDermott, J. R., Grencis, R. K., and Else, K. J. (2000). Beta7 integrin-deficient mice: delayed leukocyte recruitment and attenuated protective immunity in the small intestine during enteric helminth infection. Eur J Immunol 30, 1656-1664. Asahara, T., Masuda, H., Takahashi, T., Kalka, C , Pastore, C , Silver, M., Kearne, M., Magner, M., and Isner, J . M. (1999). Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85, 221-228. Austen, K. F., and Boyce, J. A. (2001). Mast cell lineage development and phenotypic regulation. Leuk Res 25, 511-518. Avigdor, A., Goichberg, P., Shivtiel, S., Dar, A., Peled, A., Samira, S. , Kollet, O., Hershkoviz, R., Alon, R., Hardan, I., et al. (2004). CD44 and hyaluronic acid cooperate with SDF-1 in the trafficking of human CD34+ stem/progenitor cells to bone marrow. Blood 103, 2981-2989. Baum, C. M., Weissman, I. L , Tsukamoto, A. S., Buckle, A. M., and Peault, B. (1992). Isolation of a candidate human hematopoietic stem-cell population. Proc Natl Acad Sci U S A 89, 2804-2808. Baum, L. G., Pang, M., Perillo, N. L , Wu, T., Delegeane, A., Uittenbogaart, C. H., Fukuda, M., and Seilhamer, J . J . (1995). Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J Exp Med 181, 877-887. Baumhueter, S., Singer, M., Henzel, W., Hemmerich, S., Renz, M., Rosen, S., and Lasky, L. A. (1993). Binding of L-selectin to the vascular sialomucin CD34. Science 262, 436. 67 Becker, A. J . , Mc, C. E., and Till, J . E. (1963). Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature 197, 452-454. Benoist, C , and Mathis, D. (2002). Mast cells in autoimmune disease. Nature 420, 875-878. Benveniste, P., Cantin, C , Hyam, D., and Iscove, N. N. (2003). Hematopoietic stem cells engraft in mice with absolute efficiency. Nat Immunol 4, 708-713. Berenson, R. J . , Andrews, R. G., Bensinger, W. I., Kalamasz, D., Knitter, G., Buckner, C. D., and Bernstein, I. D. (1988). Antigen CD34+ marrow cells engraft lethally irradiated baboons. J Clin Invest 81, 951-955. Berrios, V. M., Dooner, G. J . , Nowakowski, G., Frimberger, A., Valinski, H., Quesenberry, P. J . , and Becker, P. S. (2001). The molecular basis for the cytokine-induced defect in homing and engraftment of hematopoietic stem cells. Exp Hematol 29, 1326-1335. Bhatia, M., Bonnet, D., Murdoch, B., Gan, 0. I., and Dick, J. E. (1998). A newly discovered class of human hematopoietic cells with SCID- repopulating activity [see comments]. Nat Med 4, 1038-1045. Bhatia, M., Wang, J . C , Kapp, U., Bonnet, D., and Dick, J. E. (1997). Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice. Proc Natl Acad Sci U S A 94, 5320-5325. Bianchi, E., Denti, S., Granata, A., Bossi, G., Geginat, J . , Villa, A., Rogge, L , and Pardi, R. (2000). Integrin LFA-1 interacts with the transcriptional co-activator JAB1 to modulate AP-1 activity. Nature 404, 617-621. Blau, H. M., Brazelton, T. R., and Weimann, J . M. (2001). The evolving concept of a stem cell: entity or function? Cell 105, 829-841. 68 Boyce, J. A., Mellor, E. A. , Perkins, B., Lim, Y. C , and Luscinskas, F. W. (2002). Human mast cell progenitors use alpha4-integrin, VCAM-1, and PSGL-1 E-selectin for adhesive interactions with human vascular endothelium under flow conditions. Blood 99, 2890-2896. Brakebusch, C , Fillatreau, S., Potocnik, A. J . , Bungartz, G., Wilhelm, P., Svensson, M., Kearney, P., Korner, H., Gray, D., and Fassler, R. (2002). Betal integrin is not essential for hematopoiesis but is necessary for the T cell-dependent IgM antibody response. Immunity 16, 465-477. Brazelton, T. R., Rossi, F. M., Keshet, G. I., and Blau, H. M. (2000). From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290, 1775-1779. Bretscher, A. (1999). Regulation of cortical structure by the ezrin-radixin-moesin protein family. CurrOpin Cell Biol 11, 109-116. Brightling, C. E., Bradding, P., Pavord, I. D., and Wardlaw, A. J . (2003). New insights into the role of the mast cell in asthma. Clin Exp Allergy 33, 550-556. Brown, J . K., Knight, P. A., Pemberton, A. D., Wright, S. H., Pate, J . A., Thornton, E. M., and Miller, H. R. (2004). Expression of integrin-alphaE by mucosal mast cells in the intestinal epithelium and its absence in nematode-infected mice lacking the transforming growth factor-betal-activating integrin alphavbeta6. Am J Pathol 165, 95-106. Broxmeyer, H. E., Maze, R., Miyazawa, K., Carow, C , Hendrie, P. C , Cooper, S., Hangoc, G., Vadhan-Raj, S., and Lu, L. (1991). The kit receptor and its ligand, steel factor, as regulators of hemopoiesis. Cancer Cells 3, 480-487. Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J . M., Olson, D. P., Knight, M. C , Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F. R., etal. (2003). 69 Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425, 841-846. Campbell, D. J . , Debes, G. F., Johnston, B., Wilson, E., and Butcher, E. C. (2003). Targeting T cell responses by selective chemokine receptor expression. Semin Immunol 15, 277-286. Caron, E. (2002). Regulation of Wiskott-Aldrich syndrome protein and related molecules. Curr Opin Cell Biol 14, 82-87. Chatila, T. A., and Geha, R. S. (1988). Phosphorylation of T cell membrane proteins by activators of protein kinase C. J Immunol 140, 4308-4314. Cheng, J . , Baumhueter, S., Cacalano, G., Carver-Moore, K., Thibodeaux, H., Thomas, R., Broxmeyer, H. E., Cooper, S., Hague, N., Moore, M., and Lasky, L. A. (1996). Hematopoietic defects in mice lacking the sialomucin CD34. Blood 87, 479-490. Craddock, C. F., Nakamoto, B., Andrews, R. G. , Priestley, G. V., and Papayannopoulou, T. (1997). Antibodies to VLA4 integrin mobilize long-term repopulating cells and augment cytokine-induced mobilization in primates and mice. Blood 90, 4779-4788. Craig, S. S., and Schwartz, L. B. (1990). Human MCTC type of mast cell granule: the uncommon occurrence of discrete scrolls associated with focal absence of chymase. Lab Invest 63, 581-585. Crapper, R. M., and Schrader, J. W. (1983). Frequency of mast cell precursors in normal tissues determined by an in vitro assay: antigen induces parallel increases in the frequency of P cell precursors and mast cells. J Immunol 131, 923-928. Crivellato, E., Beltrami, C , Mallardi, F., and Ribatti, D. (2003). Paul Ehrlich's doctoral thesis: a milestone in the study of mast cells. Br J Haematol 123, 19-21. 70 Cruz-Munoz, M. E., Salas-Vidal, E., Salaiza-Suazo, N., Becker, I., Pedraza-Alva, G., and Rosenstein, Y. (2003). The CD43 coreceptor molecule recruits the zeta-chain as part of its signaling pathway. J Immunol 171, 1901-1908. Cyster, J . , Somoza, C , Killeen, N., and Williams, A. F. (1990). Protein sequence and gene structure for mouse leukosialin (CD43), a T lymphocyte mucin without introns in the coding sequence. Eur J Immunol 20, 875-881. Cyster, J . G., and Williams, A. F. (1992). The importance of cross-linking in the homotypic aggregation of lymphocytes induced by anti-leukosialin (CD43) antibodies. Eur J Immunol 22, 2565-2572. Dao, M. A., Arevalo, J . , and Nolta, J . A. (2003). Reversibility of CD34 expression on human hematopoietic stem cells that retain the capacity for secondary reconstitution. Blood 101, 112-118. Delia, D., Lampugnani, M. G., Resnati, M., Dejana, E., Aiello, A., Fontanella, E., Soligo, D., Pierotti, M. A., and Greaves, M. F. (1993). CD34 expression is regulated reciprocally with adhesion molecules in vascular endothelial cells in vitro. Blood 81, 1001-1008. Dercksen, M. W., Weimar, I. S., Richel, D. J . , Breton-Gorius, J . , Vainchenker, W., Slaper-Cortenbach, C. M., Pinedo, H. M., von dem Borne, A. E., Gerritsen, W. R., and van der Schoot, C. E. (1995). The value of flow cytometric analysis of platelet glycoprotein expression of CD34+ cells measured under conditions that prevent P-selectin-mediated binding of platelets. Blood 86, 3771-3782. DiGiusto, D., Chen, S., Combs, J . , Webb, S., Namikawa, R., Tsukamoto, A., Chen, B. P., and Galy, A. H. (1994). Human fetal bone marrow early progenitors for T, B, and myeloid cells are found exclusively in the population expressing high levels of CD34. Blood 84, 421-432. 71 Donnelly, D. S., Zelterman, D., Sharkis, S., and Krause, D. S. (1999). Functional activity of murine CD34+ and CD34- hematopoietic stem cell populations. Exp Hematol 27, 788-796. Doyonnas, R., Kershaw, D. B., Duhme, C , Merkens, H., Chelliah, S., Graf, T., and McNagny, K. M. (2001). Anuria, omphalocele, and perinatal lethality in mice lacking the CD34- related protein podocalyxin. J Exp Med 194, 13-27. Doyonnas, R., Nielsen, J . S., Chelliah, S., Drew, E., Hara, T., Miyajima, A., and McNagny, K. M. (2005). Podocalyxin is a CD34-related marker of murine hematopoietic stem cells and embryonic erythroid cells. Blood. Driessen, R. L , Johnston, H. M., and Nilsson, S. K. (2003). Membrane-bound stem cell factor is a key regulator in the initial lodgment of stem cells within the endosteal marrow region. Exp Hematol 31, 1284-1291. Duncan, A. W., Rattis, F. M., Dimascio, L. N., Congdon, K. L , Pazianos, G., Zhao, C , Yoon, K., Cook, J. M., Willert, K., Gaiano, N., and Reya, T. (2005). Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol. Enerback, L. (1974). Berberine sulphate binding to mast cell polyanions: a cytofluorometric method for the quantitation of heparin. Histochemistry 42, 301-313. Engelhardt, B., and Wolburg, H. (2004). Mini-review: Transendothelial migration of leukocytes: through the front door or around the side of the house? Eur J Immunol 34, 2955-2963. Engelhardt, M., Lubbert, M., and Guo, Y. (2002). CD34(+) or CD34(-): which is the more primitive? Leukemia 16, 1603-1608. Fackler, M. J . , Civin, C. I., Sutherland, D. R., Baker, M. A., and May, W. S. (1990). Activated protein kinase C directly phosphorylates the CD34 antigen on hematopoietic cells. J Biol Chem 265, 11056-11061. 72 Fackler, M. J . , Krause, D. S., Smith, O. M., Civin, C. I., and May, W. S. (1995). Full-length but not truncated CD34 inhibits hematopoietic cell differentiation of M l cells. Blood 85, 3040-3047. Felschow, D. M., McVeigh, M. L , Hoehn, G. T., Civin, C. I., and Fackler, M. J . (2001). The adapter protein CrkL associates with CD34. Blood 97, 3768-3775. Ferrari, G., Cusella-De Angelis, G., Coletta, M., Paolucci, E., Stornaiuolo, A., Cossu, G., and Mavilio, F. (1998). Muscle regeneration by bone marrow-derived myogenic progenitors. Science 279, 1528-1530. Fieger, C. B., Sassetti, C. M., and Rosen, S. D. (2003). Endoglycan, a member of the CD34 family, functions as an L-selectin ligand through modification with tyrosine sulfation and sialyl Lewis x. J Biol Chem 278, 27390-27398. Fina, L., Molgaard, H. V., Robertson, D., Bradley, N. J . , Monaghan, P., Delia, D., Sutherland, D. R., Baker, M. A., and Greaves, M. F. (1990). Expression of the CD34 gene in vascular endothelial cells. Blood 75, 2417. Fliedner, T. M. (1998). Prologue to characteristics and potentials of blood stem cells, Stem Cells volume 16, supplement 1. Stem Cells 16, 357-360. Frandji, P., Oskeritzian, C , Cacaraci, F., Lapeyre, J . , Peronet, R., David, B., Guillet, J . G., and Mecheri, S. (1993). Antigen-dependent stimulation by bone marrow-derived mast cells of MHC class II-restricted T cell hybridoma. J Immunol 151, 6318-6328. Frandji, P., Tkaczyk, C , Oskeritzian, C , Lapeyre, J . , Peronet, R., David, B., Guillet, J . G., and Mecheri, S. (1995). Presentation of soluble antigens by mast cells: upregulation by interleukin-4 and granulocyte/macrophage colony-stimulating factor and downregulation by interferon-gamma. Cell Immunol 163, 37-46. 73 Fraser, J . R., Laurent, T. C , and Laurent, U. B. (1997). Hyaluronan: its nature, distribution, functions and turnover. J Intern Med 242, 27-33. Frenette, P. S., Subbarao, S., Mazo, I. B., von Andrian, U. H., and Wagner, D. D. (1998). Endothelial selectins and vascular cell adhesion molecule-1 promote hematopoietic progenitor homing to bone marrow. Proc Natl Acad Sci U S A 95, 14423-14428. Fuchs, E., and Segre, J . A. (2000). Stem cells: a new lease on life. Cell 100, 143-155. Fuhlbrigge, R. C , Kieffer, J . D., Armerding, D., and Kupper, T. S. (1997). Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skin-homing T cells. Nature 389, 978-981. Galli, S. J. (1997). Complexity and redundancy in the pathogenesis of asthma: reassessing the roles of mast cells and T cells. J Exp Med 186, 343-347. Galli, S. J . , Dvorak, A. M., and Dvorak, H. F. (1984). Basophils and mast cells: morphologic insights into their biology, secretory patterns, and function. Prog Allergy 34, 1-141. Galli, S. J . , and Hammel, I. (1994). Mast cell and basophil development. Curr Opin Hematol 1, 33-39. Galli, S. J . , and Kitamura, Y. (1987). Genetically mast-cell-deficient W/Wv and Sl/Sld mice. Their value for the analysis of the roles of mast cells in biologic responses in vivo. Am J Pathol 127, 191-198. Galli, S. J . , Maurer, M., and Lantz, C. S. (1999). Mast cells as sentinels of innate immunity. Curr Opin Immunol 11, 53-59. Galli, S. J . , Nakae, S., and Tsai, M. (2005). Mast cells in the development of adaptive immune responses. Nat Immunol 6, 135-142. 74 Gao, Z., Fackler, M. J . , Leung, W., Lumkul, R., Ramirez, M., Theobald, N., Malech, H. L., and Civin, C. I. (2001). Human CD34+ cell preparations contain over 100-fold greater NOD/SCID mouse engrafting capacity than do CD34- cell preparations. Exp Hematol 29, 910-921. Garssen, J . , van Loveren, H., van der Vliet, H., and Nijkamp, F. P. (1990). T cell mediated induction of bronchial hyperreactivity. Br J Clin Pharmacol 30 Suppl 1, 153S-155S. Goodell, M. A., Brose, K., Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806. Goodell, M. A., Rosenzweig, M., Kim, H., Marks, D. F., DeMaria, M., Paradis, G., Grupp, S. A., Sieff, C. A., Mulligan, R. C , and Johnson, R. P. (1997). Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species. Nat Med 3, 1337-1345. Gordon, J . R., and Galli, S. J. (1990). Mast cells as a source of both preformed and immunologically inducible TNF-alpha/cachectin. Nature 346, 274-276. Gordon, J . R., and Galli, S. J. (1991). Release of both preformed and newly synthesized tumor necrosis factor alpha (TNF-alpha)/cachectin by mouse mast cells stimulated via the Fc epsilon RI. A mechanism for the sustained action of mast cell-derived TNF-alpha during IgE-dependent biological responses. J Exp Med 174, 103-107. Gordon, M. Y., Atkinson, J . , Clarke, D., Dowding, C. R., Goldman, J . M., Grimsley, P. G., Siczkowski, M., and Greaves, M. F. (1991). Deficiency of a phosphatidylinositol-anchored cell adhesion molecule influences haemopoietic progenitor binding to marrow stroma in chronic myeloid leukaemia. Leukemia 5, 693-698. 75 Guan, E. N., Burgess, W. H., Robinson, S. L , Goodman, E. B., McTigue, K. J . , and Tenner, A. J. (1991). Phagocytic cell molecules that bind the collagen-like region of C l q . Involvement in the Clq-mediated enhancement of phagocytosis. J Biol Chem 266, 20345-20355. Gurish, M. F., and Boyce, J. A. (2002). Mast cell growth, differentiation, and death. Clin Rev Allergy Immunol 22, 107-118. Gurish, M. F., Pear, W. S., Stevens, R. L , Scott, M. L , Sokol, K., Ghildyal, N., Webster, M. J . , Hu, X., Austen, K. F., Baltimore, D., and et al. (1995). Tissue-regulated differentiation and maturation of a v-abl-immortalized mast cell-committed progenitor. Immunity 3, 175-186. Gurish, M. F., Tao, H., Abonia, J . P., Arya, A., Friend, D. S., Parker, C. M., and Austen, K. F. (2001). Intestinal mast cell progenitors require CD49dbeta7 (alpha4beta7 integrin) for tissue-specific homing. J Exp Med 194, 1243-1252. Gussoni, E., Soneoka, Y., Strickland, C. D., Buzney, E. A., Khan, M. K., Flint, A. F., Kunkel, L. M., and Mulligan, R. C. (1999). Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401, 390-394. Hamelmann, E., Tadeda, K., Oshiba, A., and Gelfand, E. W. (1999). Role of IgE in the development of allergic airway inflammation and airway hyperresponsiveness—a murine model. Allergy 54, 297-305. Hartmann, K., Henz, B. M., Kruger-Krasagakes, S., Kohl, J . , Burger, R., Guhl, S., Haase, I., Lippert, U., and Zuberbier, T. (1997). C3a and C5a stimulate chemotaxis of human mast cells. Blood 89, 2863-2870. Healy, L , May, G., Gale, K. a., Grosveld, F., Greaves, M., and Enver, T. (1995). The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion. Proc Natl Acad Sci U S A 92, 12240-12244. 76 Hemmeryckx, B., van Wijk, A., Reichert, A., Kaartinen, V., de Jong, R., Pattengale, P. K., Gonzalez-Gomez, I., Groffen, J . , and Heisterkamp, N. (2001). Crkl enhances leukemogenesis in BCR/ABL P190 transgenic mice. Cancer Res 61, 1398-1405. Henz, B. M., Maurer, M., Lippert, U., Worm, M., and Babina, M. (2001). Mast cells as initiators of immunity and host defense. Exp Dermatol 10, 1-10. Hirsch, E., Iglesias, A., Potocnik, A. J . , Hartmann, U., and Fassler, R. (1996). Impaired migration but not differentiation of haematopoietic stem cells in the absence of betal integrins. Nature 380, 171-175. Hogan, C. J . , Shpall, E. J . , McNiece, I., and Keller, G. (1997). Multilineage engraftment in NOD/LtSz-scid/scid mice from mobilized human CD34+ peripheral blood progenitor cells. Biol Blood Marrow Transplant 3, 236-246. Horwitz, E. M., Prockop, D. J . , Fitzpatrick, L. A., Koo, W. W., Gordon, P. L , Neel, M., Sussman, M., Orchard, P., Marx, J. C , Pyeritz, R. E., and Brenner, M. K. (1999). Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat Med 5, 309-313. Hu, M. C , and Chien, S. L. (1998). The cytoplasmic domain of stem cell antigen CD34 is essential for cytoadhesion signaling but not sufficient for proliferation signaling. Blood 91, 1152-1162. Ikuta, K., and Weissman, I. L. (1992). Evidence that hematopoietic stem cells express mouse c-kit but do not depend on steel factor for their generation. Proc Natl Acad Sci U S A 89, 1502-1506. Inamura, N., Mekori, Y. A., Bhattacharyya, S. P., Bianchine, P. J . , and Metcalfe, D. D. (1998). Induction and enhancement of Fc(epsilon)RI-dependent mast cell degranulation following coculture with activated T cells: dependency on 77 ICAM-1- and leukocyte function-associated antigen (LFA)-l-mediated heterotypic aggregation. J Immunol 160, 4026-4033. Ishida, A., Zeng, H., and Ogawa, M. (2002). Expression of lineage markers by CD34(+) hematopoietic stem cells of adult mice. Exp Hematol 30, 361-365. Ito, A., Jippo, T., Wakayama, T., Morii, E., Koma, Y., Onda, H., Nojima, H., Iseki, S., and Kitamura, Y. (2003). SglGSF: a new mast-cell adhesion molecule used for attachment to fibroblasts and transcriptionally regulated by MITF. Blood 101, 2601-2608. Ito, T., Tajima, F., and Ogawa, M. (2000). Developmental changes of CD34 expression by murine hematopoietic stem cells. Exp Hematol 28, 1269-1273. Janeway, C. (2001). Immunobiology : the immune system in health and disease, 5th edn (New York, Garland Pub.). Johnston, B., Issekutz, T. B., and Kubes, P. (1996). The alpha 4-integrin supports leukocyte rolling and adhesion in chronically inflamed postcapillary venules in vivo. J Exp Med 183, 1995-2006. Juremalm, M., Hjertson, M., Olsson, N., Harvima, I., Nilsson, K., and Nilsson, G. (2000). The chemokine receptor CXCR4 is expressed within the mast cell lineage and its ligand stromal cell-derived factor-lalpha acts as a mast cell chemotaxin. Eur J Immunol 30, 3614-3622. Kambe, N., Hiramatsu, H., Shimonaka, M., Fujino, H., Nishikomori, R., Heike, T., Ito, M., Kobayashi, K., Ueyama, Y., Matsuyoshi, N., et al. (2004). Development of both human connective tissue-type and mucosal-type mast cells in mice from hematopoietic stem cells with identical distribution pattern to human body. Blood 103, 860-867. Kanakura, Y., Kuriu, A., Waki, N., Nakano, T., Asai, H., Yonezawa, T., and Kitamura, Y. (1988a). Changes in numbers and types of mast cell colony-78 forming cells in the peritoneal cavity of mice after injection of distilled water: evidence that mast cells suppress differentiation of bone marrow-derived precursors. Blood 71, 573-580. Kanakura, Y., Thompson, H., Nakano, T., Yamamura, T., Asai, H., Kitamura, Y., Metcalfe, D. D., and Galli, S. J . (1988b). Multiple bidirectional alterations of phenotype and changes in proliferative potential during the in vitro and in vivo passage of clonal mast cell populations derived from mouse peritoneal mast cells. Blood 72, 877-885. Karanu, F. N., Murdoch, B., Gallacher, L , Wu, D. M., Koremoto, M., Sakano, S., and Bhatia, M. (2000). The notch ligand jagged-1 represents a novel growth factor of human hematopoietic stem cells. J Exp Med 192, 1365-1372. Karimi, K., Redegeld, F. A., Heijdra, B., and Nijkamp, F. P. (1999). Stem cell factor and interleukin-4 induce murine bone marrow cells to develop into mast cells with connective tissue type characteristics in vitro. Exp Hematol 27, 654-662. Kasugai, T., Tei, H., Okada, M., Hirota, S., Morimoto, M., Yamada, M., Nakama, A., Arizono, N., and Kitamura, Y. (1995). Infection with Nippostrongylus brasiliensis induces invasion of mast cell precursors from peripheral blood to small intestine. Blood 85, 1334-1340. Katayama, Y., Hidalgo, A., Peired, A., and Frenette, P. S. (2004). Integrin alpha4beta7 and its counterreceptor MAdCAM-1 contribute to hematopoietic progenitor recruitment into bone marrow following transplantation. Blood 104, 2020-2026. Kempuraj, D., Saito, H., Kaneko, A., Fukagawa, K., Nakayama, M., Toru, H., Tomikawa, M., Tachimoto, H., Ebisawa, M., Akasawa, A., et al. (1999). Characterization of mast cell-committed progenitors present in human umbilical cord blood. Blood 93, 3338-3346. 79 Khaldoyanidi, S., Denzel, A., and Zoller, M. (1996). Requirement for CD44 in proliferation and homing of hematopoietic precursor cells. J Leukoc Biol 60, 579-592. Kirshenbaum, A. S., Goff, J . P., Semere, T., Foster, B., Scott, L. M., and Metcalfe, D. D. (1999). Demonstration that human mast cells arise from a progenitor cell population that is CD34(+), c-kit(+), and expresses aminopeptidase N (CD13). Blood 94, 2333-2342. Kitamura, Y. (1989). Heterogeneity of mast cells and phenotypic change between subpopulations. Annu Rev Immunol 7, 59-76. Kitamura, Y., and Fujita, J . (1989). Regulation of mast cell differentiation. Bioessays 10, 193-196. Kitamura, Y., Go, S., and Hatanaka, K. (1978). Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation. Blood 52, 447-452. Kitamura, Y., Hatanaka, K., Murakami, M., and Shibata, H. (1979a). Presence of mast cell precursors in peripheral blood of mice demonstrated by parabiosis. Blood 53, 1085-1088. Kitamura, Y., Kanakura, Y., Kuriu, A., Fujita, J . , and Nakano, T. (1988). Unique features in differentiation of mast cells. IARC Sci Publ, 11-19. Kitamura, Y., Shimada, M., Go, S., Matsuda, H., Hatanaka, K., and Seki, M. (1979b). Distribution of mast-cell precursors in hematopoeitic and lymphopoietic tissues of mice. J Exp Med 150, 482-490. Kitamura, Y., Shimada, M., Hatanaka, K., and Miyano, Y. (1977). Development of mast cells from grafted bone marrow cells in irradiated mice. Nature 268, 442-443. Kobayashi, T., Miura, T., Haba, T., Sato, M., Serizawa, I., Nagai, H., and Ishizaka, K. (2000). An essential role of mast cells in the development of 80 airway hyperresponsiveness in a murine asthma model. J Immunol 164, 3855-3861. Kobayashi, T., Nakano, T., Nakahata, T., Asai, H., Yagi, Y., Tsuji, K., Komiyama, A., Akabane, T., Kojima, S., and Kitamura, Y. (1986). Formation of mast cell colonies in methylcellulose by mouse peritoneal cells and differentiation of these cloned cells in both the skin and the gastric mucosa of W/Wv mice: evidence that a common precursor can give rise to both "connective tissue-type" and "mucosal" mast cells. J Immunol 136, 1378-1384. Krause, D. S., Fackler, M. J . , Civin, C. I., and May, W. S. (1996). CD34: structure, biology, and clinical utility. Blood 87, 1-13. Krause, D. S., Ito, T., Fackler, M. J . , Smith, O. M., Collector, M. I., Sharkis, S. J . , and May, W. S. (1994). Characterization of murine CD34, a marker for hematopoietic progenitor and stem cells. Blood 84, 691-701. Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O., Hwang, S., Gardner, R., Neutzel, S., and Sharkis, S. J. (2001). Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105, 369-377. Kubes, P. (2002). The complexities of leukocyte recruitment. Semin Immunol 14, 65-72. Lagasse, E., Connors, H., Al-Dhalimy, M., Reitsma, M., Dohse, M., Osborne, L., Wang, X., Finegold, M., Weissman, I. L , and Grompe, M. (2000). Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med 6, 1229-1234. Lam, V., Kalesnikoff, J . , Lee, C. W., Hernandez-Hansen, V., Wilson, B. S., Oliver, J . M., and Krystal, G. (2003). IgE alone stimulates mast cell adhesion 81 to fibronectin via pathways similar to those used by IgE + antigen but distinct from those used by Steel factor. Blood 102, 1405-1413. Lantz, C. S., Boesiger, J . , Song, C. H., Mach, N., Kobayashi, T., Mulligan, R. C , Nawa, Y., Dranoff, G., and Galli, S. J. (1998). Role for interleukin-3 in mast-cell and basophil development and in immunity to parasites. Nature 392, 90-93. Lanza, F., Healy, L., and Sutherland, D. R. (2001). Structural and functional features of the CD34 antigen: an update. J Biol Regul Homeost Agents 15, 1-13. Lasky, L. A. (1996). Hematopoiesis: wandering progenitor cells. Curr Biol 6, 1238-1240. Lee, D. M., Friend, D. S., Gurish, M. F., Benoist, C , Mathis, D., and Brenner, M. B. (2002). Mast cells: a cellular link between autoantibodies and inflammatory arthritis. Science 297, 1689-1692. Levesque, J. P., Hendy, J . , Takamatsu, Y., Williams, B., Winkler, I. G., and Simmons, P. J. (2002). Mobilization by either cyclophosphamide or granulocyte colony-stimulating factor transforms the bone marrow into a highly proteolytic environment. Exp Hematol 30, 440-449. Levesque, J . P., Liu, F., Simmons, P. J . , Betsuyaku, T., Senior, R. M., Pham, C , and Link, D. C. (2004). Characterization of hematopoietic progenitor mobilization in protease-deficient mice. Blood 104, 65-72. Levi-Schaffer, F., Austen, K. F., Gravallese, P. M., and Stevens, R. L. (1986). Coculture of interleukin 3-dependent mouse mast cells with fibroblasts results in a phenotypic change of the mast cells. Proc Natl Acad Sci U S A 83, 6485-6488. 82 Lorentz, A., Schuppan, D., Gebert, A., Manns, M. P., and Bischoff, S. C. (2002). Regulatory effects of stem cell factor and interleukin-4 on adhesion of human mast cells to extracellular matrix proteins. Blood 99, 966-972. Love, K. S., Lakshmanan, R. R., Butterfield, J. H., and Fox, C. C. (1996). IFN-gamma-stimulated enhancement of MHC class II antigen expression by the human mast cell line HMC-1. Cell Immunol 170, 85-90. Ma, Q., Jones, D., and Springer, T. A. (1999). The chemokine receptor CXCR4 is required for the retention of B lineage and granulocytic precursors within the bone marrow microenvironment. Immunity 10, 463-471. Majdic, O., Stockl, J . , Pickl, W. F., Bohuslav, J . , Strobl, H., Scheinecker, C , Stockinger, H., and Knapp, W. (1994). Signaling and induction of enhanced cytoadhesiveness via the hematopoietic progenitor cell surface molecule CD34. Blood 83, 1226-1234. Malaviya, R., and Abraham, S. N. (2001). Mast cell modulation of immune responses to bacteria. Immunol Rev 179, 16-24. Malaviya, R., Gao, Z., Thankavel, K., van der Merwe, P. A., and Abraham, S. N. (1999). The mast cell tumor necrosis factor alpha response to FimH-expressing Escherichia coli is mediated by the glycosylphosphatidylinositol-anchored molecule CD48. Proc Natl Acad Sci U S A 96, 8110-8115. Malaviya, R., Ikeda, T., Ross, E., and Abraham, S. N. (1996a). Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-alpha. Nature 381, 77-80. Malaviya, R., Twesten, N. J . , Ross, E. A., Abraham, S. N., and Pfeifer, J . D. (1996b). Mast cells process bacterial Ags through a phagocytic route for class I MHC presentation to T cells. J Immunol 156, 1490-1496. Malfait, A. M., Malik, A. S., Marinova-Mutafchieva, L., Butler, D. M., Maini, R. N., and Feldmann, M. (1999). The beta2-adrenergic agonist salbutamol is a 83 potent suppressor of established collagen-induced arthritis: mechanisms of action. J Immunol 162, 6278-6283. Mangeat, P., Roy, C , and Martin, M. (1999). ERM proteins in cell adhesion and membrane dynamics. Trends Cell Biol 9, 187-192. Manjunath, N., Correa, M., Ardman, M., and Ardman, B. (1995). Negative regulation of T-cell adhesion and activation by CD43. Nature 377, 535-538. Manjunath, N., Johnson, R. S., Staunton, D. E., Pasqualini, R., and Ardman, B. (1993). Targeted disruption of CD43 gene enhances T lymphocyte adhesion. J Immunol 151, 1528-1534. Martin, T. R., Takeishi, T., Katz, H. R., Austen, K. F., Drazen, J. M., and Galli, S. J. (1993). Mast cell activation enhances airway responsiveness to methacholine in the mouse. J Clin Invest 91, 1176-1182. Maurer, M., Theoharides, T., Granstein, R. D., Bischoff, S. C , Bienenstock, J . , Henz, B., Kovanen, P., Piliponsky, A. M., Kambe, N., Vliagoftis, H., et al. (2003). What is the physiological function of mast cells? Exp Dermatol 12, 886-910. Mazo, I. B., Gutierrez-Ramos, J. C , Frenette, P. S., Hynes, R. O., Wagner, D. D., and von Andrian, U. H. (1998). Hematopoietic progenitor cell rolling in bone marrow microvessels: parallel contributions by endothelial selectins and vascular cell adhesion molecule 1. J Exp Med 188, 465-474. Mazo, I. B., Quackenbush, E. J . , Lowe, J . B., and von Andrian, U. H. (2002). Total body irradiation causes profound changes in endothelial traffic molecules for hematopoietic progenitor cell recruitment to bone marrow. Blood 99, 4182-4191. McEvoy, L. M., Jutila, M. A., Tsao, P. S., Cooke, J . P., and Butcher, E. C. (1997). Anti-CD43 inhibits monocyte-endothelial adhesion in inflammation and atherogenesis. Blood 90, 3587-3594. 84 McLachlan, J . B., and Abraham, S. N. (2001). Studies of the multifaceted mast cell response to bacteria. Curr Opin Microbiol 4, 260-266. McLachlan, J. B., Hart, J . P., Pizzo, S. V., Shelburne, C. P., Staats, H. F., Gunn, M. D., and Abraham, S. N. (2003). Mast cell-derived tumor necrosis factor induces hypertrophy of draining lymph nodes during infection. Nat Immunol 4, 1199-1205. Mehlhop, P. D., van de Rijn, M., Goldberg, A. B., Brewer, J. P., Kurup, V. P., Martin, T. R., and Oettgen, H. C. (1997). Allergen-induced bronchial hyperreactivity and eosinophilic inflammation occur in the absence of IgE in a mouse model of asthma. Proc Natl Acad Sci U S A 94, 1344-1349. Meininger, C. J . , Yano, H., Rottapel, R., Bernstein, A., Zsebo, K. M., and Zetter, B. R. (1992). The c-kit receptor ligand functions as a mast cell chemoattractant. Blood 79, 958-963. Mekori, Y. A., and Metcalfe, D. D. (2000). Mast cells in innate immunity. Immunol Rev 173, 131-140. Mezey, E., Chandross, K. J . , Harta, G., Maki, R. A., and McKercher, S. R. (2000). Turning blood into brain: cells bearing neuronal antigens generated in vivo from bone marrow. Science 290, 1779-1782. Mohle, R., Bautz, F., Denzlinger, C , and Kanz, L. (2001). Transendothelial migration of hematopoietic progenitor cells. Role of chemotactic factors. Ann N Y Acad Sci 938, 26-34; discussion 34-25. Moore, K. A., and Lemischka, I. R. (2004). "Tie-ing" down the hematopoietic niche. Cell 118, 139-140. Morel, F., Galy, A., Chen, B., and Szilvassy, S. J. (1998). Equal distribution of competitive long-term repopulating stem cells in the CD34+ and CD34-fractions of Thy-l lowLin-/lowSca-l+ bone marrow cells. Exp Hematol 26, 440-448. 85 Morel, F., Szilvassy, S. J . , Travis, M., Chen, B., and Galy, A. (1996). Primitive hematopoietic cells in murine bone marrow express the CD34 antigen. Blood 88, 3774-3784. Morii, E., Ito, A., Jippo, T., Koma, Y., Oboki, K., Wakayama, T., Iseki, S., Lamoreux, M. L , and Kitamura, Y. (2004). Number of mast cells in the peritoneal cavity of mice: influence of microphthalmia transcription factor through transcription of newly found mast cell adhesion molecule, spermatogenic immunoglobulin superfamily. Am J Pathol 165, 491-499. Morrison, S. J . , and Weissman, I. L. (1994). The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity 1, 661-673. Muller-Sieburg, C. E., Whitlock, C. A., and Weissman, I. L. (1986). Isolation of two early B lymphocyte progenitors from mouse marrow: a committed pre-pre-B cell and a clonogenic Thy-l- lo hematopoietic stem cell. Cell 44, 653-662. Nakamura, Y., Ando, K., Chargui, J . , Kawada, H., Sato, T., Tsuji, T., Hotta, T., and Kato, S. (1999). Ex vivo generation of CD34(+) cells from CD34(-) hematopoietic cells. Blood 94, 4053-4059. Nakano, T., Sonoda, T., Hayashi, C , Yamatodani, A., Kanayama, Y., Yamamura, T., Asai, H., Yonezawa, T., Kitamura, Y., and Galli, S. J . (1985). Fate of bone marrow-derived cultured mast cells after intracutaneous, intraperitoneal, and intravenous transfer into genetically mast cell-deficient W/Wv mice. Evidence that cultured mast cells can give rise to both connective tissue type and mucosal mast cells. J Exp Med 162, 1025-1043. Nilsson, S. K., Dooner, M. S., Tiarks, C. Y., Weier, H. U., and Quesenberry, P. J. (1997). Potential and distribution of transplanted hematopoietic stem cells in a nonablated mouse model. Blood 89, 4013-4020. 86 Nilsson, S. K., Dooner, M. S., Weier, H. U., Frenkel, B., Lian, J. B., Stein, G. S., and Quesenberry, P. J. (1999). Cells capable of bone production engraft from whole bone marrow transplants in nonablated mice. J Exp Med 189, 729-734. Nilsson, S. K., Haylock, D. N., Johnston, H. M., Occhiodoro, T., Brown, T. J . , and Simmons, P. J. (2003). Hyaluronan is synthesized by primitive hemopoietic cells, participates in their lodgment at the endosteum following transplantation, and is involved in the regulation of their proliferation and differentiation in vitro. Blood 101, 856-862. Nilsson, S. K., Johnston, H. M., and Coverdale, J . A. (2001). Spatial localization of transplanted hemopoietic stem cells: inferences for the localization of stem cell niches. Blood 97, 2293-2299. Norton, J . , Sloane, J. P., Delia, D., and Greaves, M. F. (1993). Reciprocal expression of CD34 and cell adhesion molecule ELAM-1 on vascular endothelium in acute cutaneous graft-versus-host disease. J Pathol 170, 173-177. Oberyszyn, T. M., Conti, C. J . , Ross, M. S., Oberyszyn, A. S., Tober, K. L , Rackoff, A. I., and Robertson, F. M. (1998). Beta2 integrin/ICAM-1 adhesion molecule interactions in cutaneous inflammation and tumor promotion. Carcinogenesis 19, 445-455. Oda, A., Ochs, H. D., Lasky, L. A., Spencer, S., Ozaki, K., Fujihara, M., Handa, M., Ikebuchi, K., and Ikeda, H. (2001). CrkL is an adapter for Wiskott-Aldrich syndrome protein and Syk. Blood 97, 2633-2639. Ogawa, M. (2002). Changing phenotypes of hematopoietic stem cells. Exp Hematol 30, 3-6. Okuno, Y., Iwasaki, H., Huettner, C. S., Radomska, H. S., Gonzalez, D. A., Tenen, D. G., and Akashi, K. (2002). Differential regulation of the human 87 and murine CD34 genes in hematopoietic stem cells. Proc Natl Acad Sci U S A 99, 6246-6251. Olsson, N., Piek, E., ten Dijke, P., and Nilsson, G. (2000). Human mast cell migration in response to members of the transforming growth factor-beta family. J Leukoc Biol 67, 350-356. Osawa, M., Hanada, K., Hamada, H., and Nakauchi, H. (1996). Long-term lymphohematopoietic reconstitution by a single CD34- low/negative hematopoietic stem cell. Science 273, 242-245. Ostberg, J. R., Barth, R. K., and Frelinger, J . G. (1998). The Roman god Janus: a paradigm for the function of CD43. Immunol Today 19, 546-550. Ostberg, J. R., Dragone, L. L , Driskell, T., Moynihan, J. A., Phipps, R., Barth, R. K., and Frelinger, J . G. (1996). Disregulated expression of CD43 (leukosialin, sialophorin) in the B cell lineage leads to immunodeficiency. J Immunol 157, 4876-4884. Padawer, J . (1968). Ingestion of colloidal gold by mast cells. Proc Soc Exp Biol Med 129, 905-907. Padawer, J. (1969). Uptake of colloidal thorium dioxide by mast cells. J Cell Biol 40, 747-760. Padawer, J . , and Fruhman, G. J. (1968). Phagocytosis of zymosan particles by mast cells. Experientia 24, 471-472. Papayannopoulou, T. (2003). Bone marrow homing: the players, the playfield, and their evolving roles. Curr Opin Hematol 10, 214-219. Papayannopoulou, T. (2004). Current mechanistic scenarios in hematopoietic stem/progenitor cell mobilization. Blood 103, 1580-1585. Papayannopoulou, T., and Craddock, C. (1997). Homing and trafficking of hemopoietic progenitor cells. Acta Haematol 97, 97-104. 88 Papayannopoulou, T., Craddock, C , Nakamoto, B., Priestley, G. V., and Wolf, N. S. (1995). The VLA4/VCAM-1 adhesion pathway defines contrasting mechanisms of lodgement of transplanted murine hemopoietic progenitors between bone marrow and spleen. Proc Natl Acad Sci U S A 92, 9647-9651. Papayannopoulou, T., Priestley, G. V., Bonig, H., and Nakamoto, B. (2003). The role of G-protein signaling in hematopoietic stem/progenitor cell mobilization. Blood 101, 4739-4747. Papayannopoulou, T., Priestley, G. V., and Nakamoto, B. (1998). Anti-VLA4/VCAM-l-induced mobilization requires cooperative signaling through the kit/mkit ligand pathway. Blood 91, 2231-2239. Papayannopoulou, T., Priestley, G. V., Nakamoto, B., Zafiropoulos, V., and Scott, L. M. (2001). Molecular pathways in bone marrow homing: dominant role of alpha(4)beta(l) over beta(2)-integrins and selectins. Blood 98, 2403-2411. Pennock, J. L , and Grencis, R. K. (2004). In vivo exit of c-kit+/CD49d(hi)/beta7+ mucosal mast cell precursors from the bone marrow following infection with the intestinal nematode Trichinella spiralis. Blood 103, 2655-2660. Petersen, B. E., Bowen, W. C , Patrene, K. D., Mars, W. M., Sullivan, A. K., Murase, N., Boggs, S. S., Greenberger, J . S., and Goff, J . P. (1999). Bone marrow as a potential source of hepatic oval cells. Science 284, 1168-1170. Pilarski, L. M., Pruski, E., Wizniak, J . , Paine, D., Seeberger, K., Mant, M. J . , Brown, C. B., and Belch, A. R. (1999). Potential role for hyaluronan and the hyaluronan receptor RHAMM in mobilization and trafficking of hematopoietic progenitor cells. Blood 93, 2918-2927. 89 Potocnik, A. J . , Brakebusch, C , and Fassler, R. (2000). Fetal and adult hematopoietic stem cells require betal integrin function for colonizing fetal liver, spleen, and bone marrow. Immunity 12, 653-663. Prodeus, A. P., Zhou, X., Maurer, M., Galli, S. J . , and Carroll, M. C. (1997). Impaired mast cell-dependent natural immunity in complement C3-deficient mice. Nature 390, 172-175. Prussin, C , and Metcalfe, D. D. (2003). IgE, mast cells, basophils, and eosinophils. J Allergy Clin Immunol 111, S486-494. Puch, S., Armeanu, S., Kibler, C , Johnson, K. R., Muller, C. A., Wheelock, M. J . , and Klein, G. (2001). N-cadherin is developmentally regulated and functionally involved in early hematopoietic cell differentiation. J Cell Sci 114, 1567-1577. Rattis, F. M., Voermans, C , and Reya, T. (2004). Wnt signaling in the stem cell niche. Curr Opin Hematol 11, 88-94. Robbie-Ryan, M., and Brown, M. (2002). The role of mast cells in allergy and autoimmunity. Curr Opin Immunol 14, 728-733. Rodewald, H. R., Dessing, M., Dvorak, A. M., and Galli, S. J . (1996). Identification of a committed precursor for the mast cell lineage. Science 271, 818-822. Rosbottom, A., Scudamore, C. L , von der Mark, H., Thornton, E. M., Wright, S. H., and Miller, H. R. (2002). TGF-beta 1 regulates adhesion of mucosal mast cell homologues to laminin-1 through expression of integrin alpha 7. J Immunol 169, 5689-5695. Rosenkranz, A. R., Coxon, A., Maurer, M., Gurish, M. F., Austen, K. F., Friend, D. S., Galli, S. J . , and Mayadas, T. N. (1998). Impaired mast cell development and innate immunity in Mac-1 (CD l lb /CD18 , CR3)-deficient mice. J Immunol 161, 6463-6467. 90 Rosenstein, Y., Park, J . K., Hahn, W. C , Rosen, F. S., Bierer, B. E., and Burakoff, S. J . (1991). CD43, a molecule defective in Wiskott-Aldrich syndrome, binds ICAM-1. Nature 354, 233-235. Sassetti, C , Tangemann, K., Singer, M. S., Kershaw, D. B., and Rosen, S. D. (1998). Identification of podocalyxin-like protein as a high endothelial venule ligand for L-selectin: parallels to CD34. J Exp Med 187, 1965-1975. Sassetti, C , Van Zante, A., and Rosen, S. D. (2000). Identification of endoglycan, a member of the CD34/podocalyxin family of sialomucins. J Biol Chem 275, 9001-9010. Sato, T., Laver, J . H., and Ogawa, M. (1999). Reversible expression of CD34 by murine hematopoietic stem cells. Blood 94, 2548-2554. Savage, N. D., Kimzey, S. L , Bromley, S. K., Johnson, K. G., Dustin, M. L , and Green, J. M. (2002). Polar redistribution of the sialoglycoprotein CD43: implications for T cell function. J Immunol 168, 3740-3746. Sawada, R., Tsuboi, S., and Fukuda, M. (1994). Differential E-selectin-dependent adhesion efficiency in sublines of a human colon cancer exhibiting distinct metastatic potentials. J Biol Chem 269, 1425-1431. Schlingemann, R. O., Rietveld, F. J . , de Waal, R. M., Bradley, N. J . , Skene, A. I., Davies, A. J . , Greaves, M. F., Denekamp, J . , and Ruiter, D. J . (1990). Leukocyte antigen CD34 is expressed by a subset of cultured endothelial cells and on endothelial abluminal microprocesses in the tumor stroma. Lab Invest 62, 690-696. Schmits, R., Filmus, J . , Gerwin, N., Senaldi, G., Kiefer, F., Kundig, T., Wakeham, A., Shahinian, A., Catzavelos, C , Rak, J . , er al. (1997). CD44 regulates hematopoietic progenitor distribution, granuloma formation, and tumorigenicity. Blood 90, 2217-2233. 91 Schofield, R. (1978). The relationship between the spleen colony-forming cell and the haemopoietic stem cell. Blood Cells 4, 7-25. Schwartz, R. S. (2004). Paul Ehrlich's magic bullets. N Engl J Med 350, 1079-1080. Scott, L. M., Priestley, G. V., and Papayannopoulou, T. (2003). Deletion of alpha4 integrins from adult hematopoietic cells reveals roles in homeostasis, regeneration, and homing. Mol Cell Biol 23, 9349-9360. Secor, V. H., Secor, W. E., Gutekunst, C. A., and Brown, M. A. (2000). Mast cells are essential for early onset and severe disease in a murine model of multiple sclerosis. J Exp Med 191, 813-822. Serrador, J. M., Nieto, M., Alonso-Lebrero, J . L., del Pozo, M. A., Calvo, J . , Furthmayr, H., Schwartz-Albiez, R., Lozano, F., Gonzalez-Amaro, R., Sanchez-Mateos, P., and Sanchez-Madrid, F. (1998). CD43 interacts with moesin and ezrin and regulates its redistribution to the uropods of T lymphocytes at the cell-cell contacts. Blood 91, 4632-4644. Seveau, S., Keller, H., Maxfield, F. R., Piller, F., and Halbwachs-Mecarelli, L. (2000). Neutrophil polarity and locomotion are associated with surface redistribution of leukosialin (CD43), an antiadhesive membrane molecule. Blood 95, 2462-2470. Sher, A., Hein, A., Moser, G., and Caulfield, J . P. (1979). Complement receptors promote the phagocytosis of bacteria by rat peritoneal mast cells. Lab Invest 41, 490-499. Shi, Q., Rafii, S., Wu, M. H., Wijelath, E. S., Yu, C , Ishida, A., Fujita, Y., Kothari, S., Mohle, R., Sauvage, L. R., et al. (1998). Evidence for circulating bone marrow-derived endothelial cells. Blood 92, 362-367. 92 Shin, J. S., Gao, Z., and Abraham, S. N. (1999). Bacteria-host cell interaction mediated by cellular cholesterol/glycolipid-enriched microdomains. Biosci Rep 19, 421-432. Shin, J . S., Gao, Z., and Abraham, S. N. (2000). Involvement of cellular caveolae in bacterial entry into mast cells. Science 289, 785-788. Siminovitch, L , McCulloch, E. A., and Till, J . E. (1963). The Distribution of Colony-Forming Cells among Spleen Colonies. J Cell Physiol 62, 327-336. Smith, T. J . , and Weis, J . H. (1996). Mucosal T cells and mast cells share common adhesion receptors. Immunol Today 17, 60-63. Somasiri, A., Nielsen, J. S., Makretsov, N., McCoy, M. L , Prentice, L , Gilks, C. B., Chia, S. K., Gelmon, K. A., Kershaw, D. B., Huntsman, D. G., er al. (2004). Overexpression of the anti-adhesin podocalyxin is an independent predictor of breast cancer progression. Cancer Res 64, 5068-5073. Sonoda, S., Sonoda, T., Nakano, T., Kanayama, Y., Kanakura, Y., Asai, H., Yonezawa, T., and Kitamura, Y. (1986). Development of mucosal mast cells after injection of a single connective tissue-type mast cell in the stomach mucosa of genetically mast cell-deficient W/Wv mice. J Immunol 137, 1319-1322. Sonoda, T., Ohno, T., and Kitamura, Y. (1982). Concentration of mast-cell progenitors in bone marrow, spleen, and blood of mice determined by limiting dilution analysis. J Cell Physiol 112, 136-140. Spangrude, G. J . , Heimfeld, S., and Weissman, I. L. (1988). Purification and characterization of mouse hematopoietic stem cells. Science 241, 58-62. Sriramarao, P., Anderson, W., Wolitzky, B. A., and Broide, D. H. (1996). Mouse bone marrow-derived mast cells roll on P-selectin under conditions of flow in vivo. Lab Invest 74, 634-643. 93 Stier, S., Cheng, T., Dombkowski, D., Carlesso, N., and Scadden, D. T. (2002). Notchl activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 99, 2369-2378. Stockl, J . , Majdic, O., Kohl, P., Pickl, W. F., Menzel, J . E., and Knapp, W. (1996). Leukosialin (CD43)-major histocompatibility class I molecule interactions involved in spontaneous T cell conjugate formation. J Exp Med 184, 1769-1779. Stockton, B. M., Cheng, G. , Manjunath, IN., Ardman, B., and von Andrian, U. H. (1998). Negative regulation of T cell homing by CD43. Immunity 8, 373-381. Surbek, D. V., Steinmann, C , Burk, M., Hahn, S., Tichelli, A., and Holzgreve, W. (2000). Developmental changes in adhesion molecule expressions in umbilical cord blood CD34 hematopoietic progenitor and stem cells. Am J Obstet Gynecol 183, 1152-1157. Sutherland, D. R., Yeo, E. L , Stewart, A. K., Nayar, R., DiGiusto, R., Zanjani, E., Hoffman, R., and Murray, L. J. (1996). Identification of CD34+ subsets after glycoprotease selection: engraftment of CD34+Thy-1+Lin- stem cells in fetal sheep. Exp Hematol 24, 795-806. Suzuki, A., Andrew, D. P., Gonzalo, J. A., Fukumoto, M., Spellberg, J . , Hashiyama, M., Takimoto, H., Gerwin, N., Webb, I., Molineux, G., et al. (1996). CD34-deficient mice have reduced eosinophil accumulation after allergen exposure and show a novel crossreactive 90-kD protein. Blood 87, 3550-3562. Tada, J . , Omine, M., Suda, T., and Yamaguchi, N. (1999). A common signaling pathway via Syk and Lyn tyrosine kinases generated from capping of the sialomucins CD34 and CD43 in immature hematopoietic cells. Blood 93, 3723-3735. 94 Tajima, F., Sato, T., Laver, J. H., and Ogawa, M. (2000). CD34 expression by murine hematopoietic stem cells mobilized by granulocyte colony-stimulating factor. Blood 96, 1989-1993. Takeda, K., Hamelmann, E., Joetham, A., Shultz, L. D., Larsen, G. L , Irvin, C. G., and Gelfand, E. W. (1997). Development of eosinophilic airway inflammation and airway hyperresponsiveness in mast cell-deficient mice. J Exp Med 186, 449-454. Takeda, T., Go, W. Y., Orlando, R. A., and Farquhar, M. G. (2000). Expression of podocalyxin inhibits cell-cell adhesion and modifies junctional properties in madin-darby canine kidney cells [In Process Citation]. Mol Biol Cell 11, 3219-3232. Takeda, T., McQuistan, T., Orlando, R. A., and Farquhar, M. G. (2001). Loss of glomerular foot processes is associated with uncoupling of podocalyxin from the actin cytoskeleton. J Clin Invest 108, 289-301. Tanzola, M. B., Robbie-Ryan, M., Gutekunst, C. A., and Brown, M. A. (2003). Mast cells exert effects outside the central nervous system to influence experimental allergic encephalomyelitis disease course. J Immunol 171, 4385-4391. Theise, N. D., Nimmakayalu, M., Gardner, R., Illei, P. B., Morgan, G., Teperman, L., Henegariu, O., and Krause, D. S. (2000). Liver from bone marrow in humans. Hepatology 32, 11-16. Theoharides, T. C. (2002). Mast cells and stress—a psychoneuroimmunological perspective. J Clin Psychopharmacol 22, 103-108. Thurman, E. C , Walker, J . , Jayaraman, S., Manjunath, N., Ardman, B., and Green, J. M. (1998). Regulation of in vitro and in vivo T cell activation by CD43. Int Immunol 10, 691-701. 95 Till, J . E., and McCulloch, E. A. (1961). A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiat Res 14, 213-222. Tong, J . , Allenspach, E. J . , Takahashi, S. M., Mody, P. D., Park, C , Burkhardt, J. K., and Sperling, A. I. (2004). CD43 regulation of T cell activation is not through steric inhibition of T cell-APC interactions but through an intracellular mechanism. J Exp Med 199, 1277-1283. Toru, H., Eguchi, M., Matsumoto, R., Yanagida, M., Yata, J . , and Nakahata, T. (1998). Interleukin-4 promotes the development of tryptase and chymase double-positive human mast cells accompanied by cell maturation. Blood 91, 187-195. Toru, H., Kinashi, T., Ra, C , Nonoyama, S., Yata, J . , and Nakahata, T. (1997). Interleukin-4 induces homotypic aggregation of human mast cells by promoting LFA-l/ ICAM-1 adhesion molecules. Blood 89, 3296-3302. Tracey, J. B., and Rinder, H. M. (1996). Characterization of the P-selectin ligand on human hematopoietic progenitors. Exp Hematol 24, 1494-1500. Tsai, M., Shih, L. S., Newlands, G. F., Takeishi, T., Langley, K. E., Zsebo, K. M., Miller, H. R., Geissler, E. N., and Galli, S. J . (1991). The rat c-kit ligand, stem cell factor, induces the development of connective tissue-type and mucosal mast cells in vivo. Analysis by anatomical distribution, histochemistry, and protease phenotype. J Exp Med 174, 125-131. van den Berg, T. K., Nath, D., Ziltener, H. J . , Vestweber, D., Fukuda, M., van Die, I., and Crocker, P. R. (2001). Cutting edge: CD43 functions as a T cell counterreceptor for the macrophage adhesion receptor sialoadhesin (Siglec-1). J Immunol 166, 3637-3640. Varnum-Finney, B., Xu, L , Brashem-Stein, C , Nourigat, C , Flowers, D., Bakkour, S., Pear, W. S., and Bernstein, I. D. (2000). Pluripotent, cytokine-96 dependent, hematopoietic stem cells are immortalized by constitutive Notchl signaling. Nat Med 6, 1278-1281. Vermeulen, M., Le Pesteur, F., Gagnerault, M. C , Mary, J. Y., Sainteny, F., and Lepault, F. (1998). Role of adhesion molecules in the homing and mobilization of murine hematopoietic stem and progenitor cells. Blood 92, 894-900. Voermans, C , Rood, P. M., Hordijk, P. L., Gerritsen, W. R., and van der Schoot, C. E. (2000). Adhesion molecules involved in transendothelial migration of human hematopoietic progenitor cells. Stem Cells 18, 435-443. Wagers, A. J . , Allsopp, R. C , and Weissman, I. L. (2002a). Changes in integrin expression are associated with altered homing properties of Lin(-/ lo)Thyl.l( lo)Sca-l(+)c-kit(+) hematopoietic stem cells following mobilization by cyclophosphamide/granulocyte colony-stimulating factor. Exp Hematol 30, 176-185. Wagers, A. J . , Christensen, J. L., and Weissman, I. L. (2002b). Cell fate determination from stem cells. Gene Ther 9, 606-612. Wagers, A. J . , and Weissman, I. L. (2004). Plasticity of adult stem cells. Cell 116, 639-648. Walker, J . , and Green, J . M. (1999). Structural requirements for CD43 function. J Immunol 162, 4109-4114. Watabe, K., Ito, A., Koma, Y., Wakayama, T., Iseki, S., Shinomura, Y., and Kitamura, Y. (2004). Distinct roles for the SglGSF adhesion molecule and c-kit receptor tyrosine kinase in the interaction between mast cells and the mesentery. Biochem Biophys Res Commun 324, 782-788. Weissman, I. L. (2002). The road ended up at stem cells. Immunol Rev 185, 159-174. 97 Weissman, I. L , Anderson, D. J . , and Gage, F. (2001). Stem and progenitor cells: origins, phenotypes, lineage commitments, and transdifferentiations. Annu Rev Cell Dev Biol 17, 387-403. Whetton, A. D., and Graham, G. J. (1999). Homing and mobilization in the stem cell niche. Trends Cell Biol 9, 233-238. Williams, C. M., and Galli, S. J. (2000). Mast cells can amplify airway reactivity and features of chronic inflammation in an asthma model in mice. J Exp Med 192, 455-462. Wills-Karp, M. (1999). Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev Immunol 17, 255-281. Wong, G. H., Clark-Lewis, I., McKimm-Breschkin, J. L., and Schrader, J. W. (1982). Interferon-gamma-like molecule induces la antigens on cultured mast cell progenitors. Proc Natl Acad Sci U S A 79, 6989-6993. Wood, H. B., May, G., Healy, L., Enver, T., and Morriss-Kay, G. M. (1997). CD34 expression patterns during early mouse development are related to modes of blood vessel formation and reveal additional sites of hematopoiesis. Blood 90, 2300-2311. Woodman, R. C , Johnston, B., Hickey, M. J . , Teoh, D., Reinhardt, P., Poon, B. Y., and Kubes, P. (1998). The functional paradox of CD43 in leukocyte recruitment: a study using CD43-deficient mice. J Exp Med 188, 2181-2186. Woolley, D. E. (2003). The mast cell in inflammatory arthritis. N Engl J Med 348, 1709-1711. Woolley, D. E., and Tetlow, L. C. (2000). Mast cell activation and its relation to proinflammatory cytokine production in the rheumatoid lesion. Arthritis Res 2, 65-74. 98 Wright, D. E., Bowman, E. P., Wagers, A. J . , Butcher, E. C , and Weissman, I. L. (2002a). Hematopoietic stem cells are uniquely selective in their migratory response to chemokines. J Exp Med 195, 1145-1154. Wright, D. E., Cheshier, S. H., Wagers, A. J . , Randall, T. D., Christensen, J . L , and Weissman, I. L. (2001). Cyclophosphamide/granulocyte colony-stimulating factor causes selective mobilization of bone marrow hematopoietic stem cells into the blood after M phase of the cell cycle. Blood 97, 2278-2285. Wright, S. H., Brown, J . , Knight, P. A., Thornton, E. M., Kilshaw, P. J . , and Miller, H. R. (2002b). Transforming growth factor-betal mediates coexpression of the integrin subunit alphaE and the chymase mouse mast cell protease-1 during the early differentiation of bone marrow-derived mucosal mast cell homologues. Clin Exp Allergy 32, 315-324. Yang, J. T., Rayburn, H., and Hynes, R. O. (1995). Cell adhesion events mediated by alpha 4 integrins are essential in placental and cardiac development. Development 121, 549-560. Yonemura, S., Nagafuchi, A., Sato, N., and Tsukita, S. (1993). Concentration of an integral membrane protein, CD43 (leukosialin, sialophorin), in the cleavage furrow through the interaction of its cytoplasmic domain with actin-based cytoskeletons. J Cell Biol 120, 437-449. Zanjani, E. D., Almeida-Porada, G., Livingston, A. G., Flake, A. W., and Ogawa, M. (1998). Human bone marrow CD34- cells engraft in vivo and undergo multilineage expression that includes giving rise to CD34+ cells. Exp Hematol 26, 353-360. Zannettino, A. C , Berndt, M. C , Butcher, C , Butcher, E. C , Vadas, M. A., and Simmons, P. J. (1995). Primitive human hematopoietic progenitors adhere to P-selectin (CD62P). Blood 85, 3466-3477. 99 Zhang, J . , Niu, C , Ye, L , Huang, H., He, X., Tong, W. G., Ross, J . , Haug, J . , Johnson, T., Feng, J . Q., et al. (2003). Identification of the haematopoietic stem cell niche and control of the niche size. Nature 425, 836-841. Zhang, K., Baeckstrom, D., Brevinge, H., and Hansson, G. C. (1997). Comparison of sialyl-Lewis a-carrying CD43 and MUC1 mucins secreted from a colon carcinoma cell line for E-selectin binding and inhibition of leukocyte adhesion. Tumour Biol 18, 175-187. Zhu, J . , and Emerson, S. G. (2004). A new bone to pick: osteoblasts and the haematopoietic stem-cell niche. Bioessays 26, 595-599. 100 Chapter 2 CD34 is a Specific Marker of Mature Murine Mast Cells 2.1 Introduction HSC are a rare population of self-renewing cells that have the capacity to give rise to all cell lineages in adult blood (Metcalf, 1999; Spangrude er al., 1991). Their ability to reconstitute the hematopoietic compartment of deficient recipients have made them a prized commodity for basic research and for the clinical treatment of a number of deficiencies, including anemia resulting from myeloablative therapy (Geffen et al., 2001; Sweetenham era/ . , 1999). In adult vertebrates, HSC reside predominantly within the BM and coexist with a broad range of other cell types including stromal cells, fibroblasts, endothelial cells and more mature hematopoietic cells. Because of their extremely low frequency, elaborate schemes are required to enrich for these cells. This is usually achieved by exploiting their unique pattern of cell surface antigen expression (Spangrude er al., 1991; Sutherland er al., 1993). Typical purification schemes involve a depletion step in which most committed hematopoietic cells are eliminated using antibodies to cell surface antigens restricted to T, B, erythroid and myelomonocytic cells. Subsequently, the remaining cells are enriched for stem cells by their selective expression of progenitor antigens. Three commonly used markers for enrichment of mouse HSC are the transmembrane glycoprotein c-kit (CD117) A version of this chapter has been published. Drew E, Merkens H, Chelliah S, Doyonnas R, McNagny KM. CD34 is a specific marker of mature murine mast cells. Exp Hematol. 2002 Oct;30(10):1211-1218. 101 (Ikuta and Weissman, 1992), Sca-1 (Ly6A/E) (Aihara et al., 1986) and the cell surface sialomucin, CD34 (reviewed in Krause etal., 1996). CD34 was the first marker to be discovered and employed in the sorting of human HSC. Sorted CD34 + cells from BM and umbilical cord blood have been shown to be dramatically enriched in monopotent and multipotent hematopoietic progenitors in vitro (Greaves et al., 1992; Simmons and Torok-Storb, 1991). Subsequently, human C D 3 4 + cells from BM, cord blood and mobilised peripheral blood have been widely used for transplantation and have successfully resulted in engraftment and normal hematopoiesis in vivo (Bensinger et al., 1996; Berenson etal., 1988; Dunbar et al., 1995; Krause et al., 1996; To etal., 1997). Despite these initial observations, several recent studies have questioned the utility of CD34 as a marker of the earliest hematopoietic precursors. Studies with human BM progenitors have clearly documented the existence of a CD34 population of cells that can also give rise to all hematopoietic lineages (Bhatia et al., 1998). In addition, elegant studies in mouse have suggested that CD34 expression changes with the activation/cell cycle state of stem cells (Ito et al., 2000; Sato e ta / . , 1999; Tajima e ta / . , 2000). In addition, recent experiments suggest that there is a developmental switch in CD34 expression; prior to 8 weeks of age, most HSC are C D 3 4 + , while after 8 weeks most are CD34 (Ogawa, 2002). These studies suggest that although the earliest adult hematopoietic progenitors lack surface CD34, its expression is induced as these cells become activated and proliferate. Later, when these cells become quiescent, they again lose expression of CD34. Thus, CD34 expression may reflect the age and activation-state of HSC. 102 Recently, our laboratory and others have identified two additional molecules that are closely related to CD34: podocalyxin (also called PCLPl/MEP21/Thrombomucin) and endoglycan (Doyonnas et al., 2001; McNagny et al., 1997; Sassetti et al., 2000). Biochemical analysis of these three proteins and genomic analysis of their encoding genes suggest that CD34, podocalyxin and endoglycan comprise a closely related gene family and probably share similar functions in modulating cell adhesion (Doyonnas et al., 2001; Takeda et al., 2000). We therefore have begun a detailed analysis of the expression of each of these family members within the hematopoeitic system. During this survey we found that, in contrast to accepted dogma, CD34 is expressed at high levels by one mature mouse hematopoietic lineage: mast cells. Our results also show for the first time that, in addition to the expression of the stem cell and mast cell antigen, c-kit (Linnekin, 1999), mast cells express the stem cell antigen, Sca-1. Thus, our data suggest that these three molecules are ineffective in distinguishing between stem cells and mast cells and may have implications for isolation of stem cells and the function of CD34. 2.2 Results 2.2.1 CD34 mRNA expression by murine progenitor cell lines and cultured primary cells In order to more clearly define the expression pattern of murine CD34-related genes in hematopoietic cells, we obtained RNA from a variety of mouse cell lines and cultured primary hematopoietic cells and analysed them by Northern blot (Figure 2.1A). Despite the expression of CD34 by normal monopotent and multipotent hematopoietic progenitors in BM (Osawa et al., 1996; Sato et al., 1999), we found that CD34 mRNA was undetectable in all corresponding cell lines tested. These included the early multilineage progenitor cell lines GM979, B6Sut, and 32D. Although normal fetal liver cells express CD34 at significant levels (data not shown), Hox-11 transformed fetal liver cells do not express 103 CD34 mRNA. The observations that these cells and cell lines do not express CD34, suggest that upon transformation, cells shut off CD34 transcription. Surprisingly, despite the absence of CD34 mRNA in the mast cell line, MC9, an intense 2.7kb CD34 band was observed for primary BM-derived mast cells (BMMC) (Figure 2.1A). This was true for BMMC cultured in either IL-3 or IL-3 plus GM-CSF. 2.2.2 CD34 protein expression on cultured mast cells To confirm CD34 expression at the protein level, BMMC cultures (closely resembling mucosal-type in vivo mast cells (Karimi et al., 1999)) were established from wild type (cd34+^+) or from cd34 ^ mice that have been genetically modified by homologous recombination to inactivate the cd34 gene (Suzuki et al., 1996). RT-PCR analysis confirmed that mast cells express CD34 mRNA and cd34 ^ cells lack expression, despite equal expression of the housekeeping gene, HPRT (Figure 2.IB). Furthermore, protein detection by Western blot and FACS analysis showed that BMMC from cd34+/f+ cultures expressed high levels of CD34, while BMMC from cd34~^~ mice showed no expression of this protein (Figure 2.1C and ID). BMMC did not express MEP21/podocalyxin or endoglycan, eliminating the possibility that antibody reactivity was due to the presence of these related molecules (data not shown) (Doyonnas et al., 2001). Mast cell cultures were maintained for four months during which all wild type mast cells maintained high level expression of CD34. Toluidine Blue stain (Figure 2.ID), which stringently identifies mast cell 104 Relative Log Fluorescence Intensity Figure 2.1 Expression of murine CD34 mRNA and protein by mature BMMC. A) Northern blot analysis of total RNA isolated from murine cell lines and primary cells. Lane 1 = R1 embryonic stem cells, lane 2 = GM979 murine erythroleukemia cell line, lane 3 = 32D multilineage progenitor line, lane 4 = T28 T cell lymphoma line, lane 5 -B6Sut multilineage progenitor line, lane 6 = spleen cells cultured with IL-3 and anti-CD3 antibody, lane 7 = FD5 macrophage line, lane 8 = MC9 mast cell line, lane 9 = WEHI231 B cell line, lane 10 = Hox11 -transformed fetal liver cells, lane 11 = C57BI/6 BMMC cultured in IL-3, lane 12 = C57BI/6 BMMC in IL-3 and GM-CSF. B) RT-PCR analysis wild type and CD34KO BMMC using primers for CD34 and HPRT. C) Western blot of wild type and CD34KO BMMC. Immunoblotting was performed with polyclonal rabbit anti-mouse CD34 1202 and goat anti-rabbit Ig-HRP. D) FACS and histologic analysis of wild type and CD34KO BMMC. BMMC were stained for cell surface CD34, Sca-1 and c-kit expression. Red lines = phycoerythrin-conjugated streptavidin alone, green lines = CD34 antibody stain, blue lines = Sca-1 antibody stain, orange lines = c-kit antibody stain. Mast cell content of both wild type and CD34-deficient cultures were shown by Toluidine Blue staining of cytocentrifuged cells (bottom panel). 105 morphology, confirmed that the bulk of the cells from both cd34 and cd34 ^ cultures, after four weeks, were mature, granule-positive mast cells (50% and 4 7 % respectively, with remaining cells as less mature, more sparsely granulated, or non-granulated mast cell precursors). Homogenous expression of the high affinity receptor for IgE (FceRI) on cd34+/^+ and cd34 ^ cultured cells also confirmed their affiliation with the mast cell lineage (data not shown). There was no obvious morphological difference between cd34+^+ and cd34 ^ mast cells, nor did we observe any differences in their ability to proliferate or to degranulate in response to C a 2 + ionophores or FcDRI crosslinking (data not shown). In addition to CD34, all BMMC expressed very high levels of two other well-characterised markers of HSC: Sca-1 (Stem cell antigen-1) and c-kit (Figure 2.ID). 2.2.3 CD34 protein expression on in vivo mast cells To test whether in vivo, resident, connective tissue-type mast cells express CD34, peritoneal wash cells were stained for CD34 antigen expression and bright antibody-reactive cells were sorted in an attempt to enrich for mast cells. Because peritoneal wash cells contain a high number of Fc-receptor-positive cells that can lead to non-specific staining, we performed sorts from both cd34+^+ and cd34 ^ mice using identical sort windows and protocols. After sorting CD34-positive and CD34-negative fractions from peritoneal wash, the enriched fractions were stained for the presence of granules with Giemsa (Figure 2.2). In this case, Giemsa was used rather than Toluidine Blue (Figure 2.ID) so that the frequency of other hematopoietic cells in the CD34 sorts could also be evaluated. In both cd34+^+ and cd34~^~ mice, mast cells represented 4 -6% of the total unsorted peritoneal cells. As shown in Figure 2.2, sorting of the most brightly stained peritoneal cells from cd34~//~ mice 106 Figure 2JZ Expression of murine CD34 antigen by connective tissue-type mast ceils in vivo. Cell sorting and histologic analysis of CD34-positive and CD34-negative peritoneal wash cells. Cells were isolated from wild type and CD34KO mice and stained with a bio tin-conjugated anti-CD34 antibody followed by streptavidin-FrrC. "CD34+ sort" indicates cells enriched by flow cytometric sorting of the top approximately 5% of FlTC-positive cells from wild type and CD34KO mfce."CD34- sort" indicates cells depleted of these brightly stained cells. Cells from each fraction were cytocentrifuged onto glass slides and Giemsa stained. resulted in a selective enrichment of monocytic cells but failed to deplete mast cells from the "CD34-negative" fraction. This suggests a low level of non-specific antibody reactivity with myeloid cells from cd34 * mice. In contrast, identical sorts from wild type mice led to specific enrichment of mature granular mast cells (28.8%) (as well as non-specific enrichment of some 107 myeloid cells). Mast cells were selectively depleted to 1.9% in the CD34-negative fraction of cd34+^+ mice. Thus, our data suggest that CD34 is expressed by normal mast cells in vivo. To further establish that resident mast cells express CD34, we isolated cells from the peritoneum and performed two-colour immunofluorescence analysis using antibodies to c-kit and CD34 (Figure 2.3A). Cells were stained with a biotinylated antibody to CD34 followed by FITC-conjugated streptavidin and then with the phycoerythrin-conjugated antibody to c-kit. We then selectively gated on the c-kit-positive cells and assessed CD34 expression. As can be seen in Figure 2.3A, essentially all c-kit-positive cells from cd34+^+ mice expressed CD34 protein on their surface while all c-kit-positive cells from cd34~ ^" mice did not react with the CD34 antibody. Gating of c-kit-positive cells prior to evaluation of reactivity with anti-CD34 eliminated the non-specific antibody reactivity observed when cells were stained with only anti-CD34 (Figure 2.2). Furthermore, since mast cells characteristically express the high affinity IgE receptor, we also analyzed FceRI-positive wild type peritoneal cells and found that the majority of these cells (82%) highly express CD34 (Figure 2.3C). All c - k i t b r ' 9 h t cells were also FceRI-positive, suggesting that individually, these two antigens are equally effective at identifying mast cells (data not shown). In addition, these same cells were found to highly express Sca-1 (Figure 2.3B). These data confirm that in vivo mast cells express three stem cell antigens; Sca-1 , c-kit and CD34. To establish the level of CD34 on mast cells compared to BM progenitor cells, we performed side-by-side analyses of CD34 staining intensity by these two populations using the same flow cytometric settings (Figure 2.3C). FceRI-positive peritoneal cells were identified using anti-DNP-IgE followed by anti-108 Figure 2.3 Peritoneal mast cells express CD34 A) FACS analysis of resident peritoneal cells isolated from wild type and CD34 mice. Peritoneal cells were stained with biotinylated anti-CD34 plus streptavidin-FITC and subsequently stained with phycoerythrin-conjugated antibody to c-kit. Cells that stained positive for c-kit (2-3%) were gated and CD34 staining of these cells is shown. Red lines = control antibody, green lines = CD34 staining. B) Expression of the stem cell antigen, Sca-1, on peritoneal mast cells. Cells were stained with biotinylated anti-c-kit or biotinylated rat lgG2b isotype control followed by streptavidin-FITC and phycoerythrin-conjugated anti-Sca-1. C) Analysis of staining intensity for CD34 by peritoneal mast cells and bone marrow progenitor cells. Cells were stained with anti-DNP-lgE followed by FITC-conjugated anti-mouse IgE, to detect cells that express FceRI. Cells were also stained with anti-CD34-biotin or biotinylated isotype control (ratlgG2a) plus streptavidin-phycoerythrin. FceRI-positive cells were gated and analysed for CD34 expression. Bone marrow cells were analysed for CD34 expression without prior gating. Percentages shown represent the percentage of cells that stained with anti-CD34. Other numbers show the relative fluorescent intensity (RFI) of CD34 staining above cell-specific background fluorescence. IgE-FITC and CD34 was detected on these cells and ungated BM cells using biotinylated anti-CD34 followed by phycoerythrin-conjugated streptavidin. BM cells had a small population of CD34 positive cells that weakly expressed this antigen (7%). After subtraction of cell-specific background fluorescence, mast cells gave a relative fluorescence intensity (RFI) of 218 with anti-CD34 compared to a RFI of 55 for BM cells. These data suggest that, in a side by 109 side analysis, mast cells exhibit four times the number of CD34 molecules on their surfaces as BM progenitor cells. 2.2.4 Lineage marker analysis of in vivo mast cells Most of the commonly used HSC-purification regimes rely on an initial depletion step to remove committed hematopoietic cells, followed by an enrichment step using progenitor markers. In mice, mature cells are typically depleted using a cocktail of antibodies including anti-Mac-1 (for macrophages), anti-Gr-1 (for granulocytes), anti-B220 (for B cells), ant i -Ter l l9 (for erythroid cells), anti-CD5 (for T and some B cells) and anti-7-4 (for neutrophils). To test whether such a depletion step would also deplete mast cells, we performed FACS analysis on peritoneal mast cells using these antibodies either singly or in a cocktail. As seen in Figure 2.4, c-kit-positive peritoneal mast cells do not express any of these markers at high levels which suggests that, in vivo, mast cells are antigenically indistinguishable from HSC when antibodies widely used for stem cell preparation are utilised. 2.3 Discussion In this study we have demonstrated that in mice, the stem cell antigen, CD34, is also a selective marker of both murine mucosal- and connective tissue-type mast cells. Our results have important practical implications for the use of murine CD34 as a stem cell purification antigen, for CD34 function, and for stem cell and mast cell biology. 2.3.1 CD34 and stem cell purification Although current reports (and our own unpublished data) suggest that human mast cells do not express CD34 (Kirshenbaum et al., 1999; Rottem et al., 1994; Welker et al., 2000), we have shown conclusively that murine mast cells 110 C l CM + CD CM o 1 co CD CD CO CO CD C c-kit Figure 2.4 Flow cytometric analysis of lineage marker expression by peritoneal mast cells. Peritoneal mast cells were identified using phycoerythrin-conjugated anti-c-kit (shown in red) Cells were subsequently stained with biotinylated antibodies against lineage markers or biotinylated control antibodies followed by FITC-conjugated streptavidin. A) Staining with rat lgG2a isotype anti-B220 or isotype control. B) Profiles showing staining of rat lgG2b antibodies towards Gr-1, Mac-1 and Ter119 or isotype control. C) Reactivity of mast cells with the Murine Progenitor Enrichment Cocktail containing antibodies for Gr-1 (rat lgG2b), Mac-1 (rat lgG2b), B220 (rat lgG2a), Ter119 (rat lgG2b), CD5 (rat lgG2a) and 7-4 (rat lgG2a) or rat lgG2a plus rat lgG2b isotype control antibodies. I l l do express this antigen. Since a monoclonal antibody to murine CD34 only recently became available (Morel et al., 1996), the use of this antigen as a phenotypic marker and enrichment reagent for murine HSC has only now become prevalent. Several recent observations have focused new attention on its use in the murine system. Recently it was shown that although CD34 is expressed by LT-HSC in young mice, there is a developmental shift in its expression, and that after 8 weeks of postnatal life, most LT-HSC lack CD34 expression (Ogawa, 2002). In addition, it has been shown that murine CD34 expression by HSC probably reflects the activation-state of these cells with the most primitive and quiescent cells being CD34-negative and those contributing to engraftment rapidly upregulating its expression (Ito et al., 2000; Nakamura et al., 1999; Sato et al., 1999; Tajima et al., 2000). Finally, CD34 has recently been proposed to play a role in the homing of HSC to the BM and subsequent participation in BM engraftment (Krause etal., 2001). Most of these studies have been rigorous in showing in vivo hematopoietic reconstitution activity of CD34-enriched fractions which is the only true test of stem cell function. Our data strongly suggest, however, that future studies need to be equally rigorous in assessing stem cell purity based on functional analyses in vivo, and not solely on the basis of their l i n , C D 3 4 + , S c a - 1 + and c-ki t + expression, as these are equally useful for the enrichment of mast cells and their committed precursors. Not only do these two cell-types share similar antigenic profiles, but they also have similar growth responses to two cytokines commonly used for in vitro culture of HSC: IL-3 and kit-ligand/SCF. Thus, in terms of their cell surface phenotype and growth requirements, it is extremely difficult to distinguish HSC from mast cells and their precursors. These data show the importance of including additional techniques during stem cell enrichments such as the efflux dyes Hoechst and rhodamine that identify a negative cell population that contains HSC activity (Goodell et al., 1996; Park et al., 2002). Antibodies which may be useful for excluding mast cells or their 112 precursors from stem cells include; anti-Flk-2, which stains short-term reconstituting stem cells (Christensen and Weissman, 2001) but not more mature hematopoietic cells (Matthews et al., 1991; Orlic et al., 1993), or Thy 1.1 which stains stem cells at a low level, however, this antigen is not expressed by cells derived from wild type C57BI/6 mice (Weissman et al., 2001). We further suggest that the appropriate morphological criteria (Giemsa, Toluidine Blue) should be utilised in order to confirm that "purified progenitor cells" from BM and mobilised peripheral blood are not selectively enriched in mast cells. Since mast cells are heavily granulated cells, they present a high side scatter FACS profile compared to HSC. Therefore, this could also potentially be used to distinguish between these cell types. However, HSC are commonly purified from the BM, which harbor MCp, but not mature mast cells. Since MCp and HSC have similar side scatter profiles, this could not be used to differentiate between these two cell types and other means are necessary to separate these populations. 2.3.2 CD34 and stem cell biology Remarkably little is known about CD34 function (Krause et al., 1996), although it has been speculated that CD34 may function as a blocker of differentiation (Cheng et al., 1996; Fackler et al., 1995), an adhesion molecule (Baumhueter et al., 1993; Healy et al., 1995; Hu and Chien, 1998) and an anti-adhesion molecule (Delia et al., 1993; Doyonnas e ta / . , 2001). Our demonstration of the expression of CD34 by mature murine mast cells has implications for several of these proposed functions in stem cell biology. Overexpression of CD34 in the differentiation-inducible myelomonocytic cell line, M l had previously been shown to inhibit the ability of these cells to mature in response to IL-6, thus implying a role for CD34 in blocking cell maturation (Fackler et al., 1995). Although it is possible that CD34 expression inhibits myelomonocytic differentiation, our observation that terminally differentiated mast cells express the antigen, would suggest that CD34 does not play a global role in blocking the maturation of hematopoietic cells. 113 Alternatively, CD34 has been proposed to play a role in hematopoietic cell adhesion and, potentially, stem cell homing specifically to the BM (Baumhueter et a/., 1993; Healy et al., 1995; Hu and Chien, 1998; Krause et al., 2001). When expressed by high endothelial venules (HEV), CD34 has been shown to act as an adhesive ligand for L-selectin on activated lymphocytes, and therefore there is a precedent for its role in cell adhesion (Baumhueter et al., 1993). However, the L-selectin/CD34 interaction is strictly dependent on the appropriate HEV-specific glycosylation of CD34 and the glycoforms of CD34 expressed by HSC and mast cells do not bind L-selectin ((Lanza et al., 2001) and unpublished data, 2001). In addition, the observation that mast cell precursors rapidly exit the BM, undergo terminal maturation in the peripheral tissues and rarely return, would argue against a global role for CD34 in homing of hematopoietic cells to the BM microenvironment. Thus our data would argue against a direct role for CD34 in BM adhesion. Previously, we and others have shown that a close relative of CD34, podocalyxin, can function as a blocker of cell aggregation and junctional complex formation in adherent cells (Doyonnas et al., 2001; Takeda et al., 2000). This was shown to be dependent upon the highly charged mucin domain of podocalyxin, which is also present in CD34, and serves as a molecular "teflon" to inhibit cell-cell contact. By analogy, it is possible that on HSC, CD34 and podocalyxin play a similar role in helping these cells exit the specialised, sub-endosteal niches in the BM that harbour the most primitive cells. Thus, when these quiescent cells are activated, they upregulate expression of CD34 molecules which aids in their movement to new microenvironments where they proceed to mature. Although it has been shown that CD34-positive cells have an enhanced ability to engraft irradiated hosts over CD34-negative cells (Donnelly et al., 1999; Gao et al., 2001; Krause et al., 2001) this may reflect a general requirement for these molecules in migration/mobility rather than a specific requirement in homing. In this 114 regard it is intriguing that HSC mobilised into the peripheral blood by treatment with G-CSF express high levels of CD34 while their more quiescent counterparts in BM are largely CD34-negative. 2.3.3 CD34 and mast cell biology What is the role of CD34 on mast cells? Our observation that mast cells exhibit four times the staining intensity with anti-CD34 than BM progenitor cells (Figure 2.3C) suggests that mast cells upregulate CD34 upon differentiation. Since BM progenitor cells have been reported to have 50,000 CD34 molecules per cell (Fackler et al., 1992), we estimate that mast cells display up to 2 X 10 5 CD34 molecules on their surface. Therefore, we suspect that CD34 plays an important role on mast cells. It has been shown that mast cells arise from CD34 + cells (Kirshenbaum et al., 1999), but it is unclear why this cell type retains the expression of this protein, even after terminal differentiation. Our data suggest that mast cells from CD34-deficient mice have no obvious defect in maturation, proliferation or degranulation in vitro. This would therefore argue for a more subtle role in mast cell function. One possibility is that, similar to the role we have postulated for stem cells, CD34 is important for making these cells more mobile and invasive. Thus CD34 expression may be required for aiding mast cell migration into tissues at the site of an infection. In this regard, it is noteworthy that the CD34-deficient mice have previously been reported to have an impaired recruitment of eosinophils to lungs in response to allergens (Suzuki et al., 1996). Since mast cell activation usually precedes eosinophil migration to the site of allergic response, and since mast cells release mediators that may serve to enhance eosinophil recruitment (Wills-Karp, 1999), it is possible that the observed defects in CD34-deficient mice are due to a defect in mast cell migration. We are currently exploring this possibility 115 further and are testing whether human mast cells, which lack CD34, instead express another closely related CD34 family member (Doyonnas etal., 2001). 2.4 E x p e r i m e n t a l P rocedure s 2.4.1 BM-derived mast cells BM was flushed from the femurs of 6-8 week old C 5 7 B I / 6 or C 5 7 B I / 6 cd34'/' mice (the latter kindly provided by Dr. T.W. Mak (Suzuki et al., 1996) with PBS using a 25-gauge needle. Red blood cells were lysed using 0 . 5 M NH 4CI; the remaining cells were washed in PBS and then resuspended in RPMI 1640, 10% fetal calf serum with penicillin/streptomycin, sodium pyruvate, glutamine and 16 U/ml IL-3 (from WEHI-3 conditioned media), at a density of 1 x 10 6 cells/ml (Tsuji et al., 1991). Cells were transferred to new flasks periodically during culture to remove adherent cells. Four weeks after culture initiation, a monoculture of mast cells was achieved as determined by Giemsa or Toluidine Blue staining. Flow cytometry revealed that the majority of cells in these cultures (>90%) expressed FceRI and c-kit. 2.4.2 Resident peritoneal mast cells Mice were sacrificed by inhalation of C O 2 . Ten millilitres of FACS buffer (PBS, 10% fetal calf serum and 0.05% sodium azide) was injected into the mice intraperitoneally, and the abdomen was massaged for one minute. The buffer, containing resident cells, was then extracted using an 18-gauge needle and syringe. The cells were washed once with FACS buffer and then stained for immunofluorescence analysis. 116 2.4.3 Northern blot analysis R N A was isolated from murine cell lines and primary cells using TRIZOL® (Gibco). Approximately 5 ug of each RNA was resolved on a denaturing 1% agarose-formaldehyde gel and was transferred to a nylon membrane (Biodyne A Membrane, Pall BioSupport) as described previously (Sambrook et al., 1989). Probes were labelled with [a- 3 2 P]dCTP using random hexamer priming (RTS Rad prime DNA labelling system, Gibco) as described (Feinberg and Vogelstein, 1983). Hybridisation was performed in buffer containing NaHPC>4 and SDS (Church and Gilbert, 1984) with CD34 cDNA (Brown et al., 1991) (430 bp B a m H l fragment) and GAPDH cDNA (Dugaiczyk, 1983) (1000 bp PstI fragment) as probes. 2.4.4 Reverse transcription-PCR (RT-PCR) Total mRNA was extracted from wild type and CD34-deficient BMMC using TRIZOL® (Gibco) and was subsequently reverse transcribed (Thermoscript RT-PCR System, Invitrogen). Primers used for CD34 analysis by PCR were: fo rwa rd - 5'- CTCTAG ATC AC AGTTCTGTGTCAG C- 3' and reverse-5'-TAGCACAGAACTTCCCAGCAAAC-3' . Hypoxanathinephospho-ribosyltransferase (HPRT), used as a loading control, was amplified with the primers: f o rwa rd - 5'- CTCG AAGTGTTG G ATACAG G - 3' and reverse-5'-TGGCCTATAGGCTCATAGTG-3' . PCR comprised 30 cycles of 94°C for 45 seconds, 58°C for 55 seconds and 72°C for 2 minutes. PCR products were then separated on a 1% agarose gel and were detected by staining with ethidium bromide. 2.4.5 Western Blotting BMMC from wild type and CD34-deficient mice were lysed on ice for 30 minutes with lysis buffer (150mM NaCI, 50mM Tris pH 7.5, 0 .5% NP-40 containing complete protease inhibitor cocktail tablets, EDTA-free (Roche)) and were separated on a 4 -12% Bis-Tris gel (Invitrogen). Proteins were 117 transferred to a nitrocellulose membrane (0.45 \xrr\, Schleicher & Schuell) and were blocked with 5% BSA in TBS. The membrane was then incubated with rabbit polyclonal anti-mouse CD34 antibody 1202 (kindly provided by Dr. Diane Krause) diluted in 1% BSA in TBS overnight, washed three times in TBS containing 0.05% NP-40 (TBS/N) and subsequently incubated with goat anti-rabbit Ig-HRP (Dako). Excess antibody was washed off with TBS/N and the membrane was incubated with Western Lightning Chemiluminescence Reagent Plus (Perkin Elmer) and exposed to film. 2.4.6 Histochemical analyses For histochemical analysis, cells were cytocentrifuged onto glass slides, fixed in methanol and stained with modified Giemsa (DiffQuick) or 0.1% Toluidine Blue as described previously (Graf et al., 1992). 2.4.7 Flow cytometric analyses Cells were prepared as previously described (Yamaguchi et al., 1997), and were analysed using a FACScan, FACSCalibur or FACSVantage (Becton Dickinson). Incubations were performed for 15-20 minutes on ice in the dark in V-bottom 96-well plates. The following mAbs were used: anti-dinitrophenyl-IgE (clone SPE-7) (Sigma), fluorescein isothiocyanate (FITC)-goat anti-mouse Ig(H+L) (Southern Biotechnology), phycoerythrin(PE)-anti-c-kit (Ikuta and Weissman, 1992) (rat IgG 2 b ) , PE-anti-Sca-1 (van de Rijn er al., 1989) (rat IgG 2 a ) , biotin-anti-CD34 (Osawa er al., 1996) (RAM34) (rat IgG 2 a ) , FITC-anti-mouse IgE, biotin-anti-Gr-1 (rat IgG 2 D), biotin-anti-Mac-1 (rat IgG 2 D ) , biotin-anti-B220 (rat IgG 2 a) and biotin-anti-Terll9 (rat IgG 2 D) (Pharmingen). Murine Progenitor Enrichment Cocktail (Stem Cell Technologies), containing biotinylated antibodies towards Gr-1, Mac-1, B220, T e r l l 9 , CD5 (rat IgG 2 a) and 7-4 (rat IgG 2 a ) , was used for lineage analysis. Staining with biotinylated antibodies was detected with phycoerythrin or FITC-conjugated streptavidin (Pharmingen). Prior to antibody staining, peritoneal-derived mast cells, in all 118 experiments, were incubated with ant i-mCD16/32 (clone 2.4G2) (Unkeless, 1979) (Pharmingen) to block FcyRII/III receptors. Isotype matched control antibodies (biotinylated rat IgG2a and/or rat IgG 2 b) were used at appropriate antibody concentrations (5 u.g/ml for individual markers and 1.5 u.g/ml of each for lineage cocktail staining, Cedarlane Laboratories). Non-viable cells were gated out of profiles using 2 ucj/ml 7-aminoactinomycin D (Molecular Probes). 2.5 Acknowledgements The authors wish to thank Dr. Rob Kay and Dr. James Wieler for RNA samples, Dr. Vince Duronio for assistance in Northern blot analysis, Philip Owen and Geoffrey Osborne for assistance in cell sorting analysis, and Dr. Gerald Krystal, Dr. John Schrader, Dr. Fabio Rossi, Janet Kalesnikoff, Michael DCirr and Julie Nielsen for constructive suggestions and critical evaluation of the data in this manuscript. We would also like to thank Dr. Diane Krause for kindly providing us with polyclonal anti-mouse CD34 1202. KMM is a Canadian Institute of Health Research Scholar. This work was funded by the Canadian Institute of Health Research grant *MT-15477, the Heart and Stroke Foundation of British Columbia and the Yukon and the Michael Smith Foundation. 119 2.6 References Aihara, Y., Buhring, H. J . , Aihara, M., and Klein, J. (1986). An attempt to produce "pre-T" cell hybridomas and to identify their antigens. Eur J Immunol 16, 1391-1399. Baumhueter, S., Singer, M., Henzel, W., Hemmerich, S., Renz, M., Rosen, S., and Lasky, L. A. (1993). Binding of L-selectin to the vascular sialomucin CD34. Science 262, 436. Bensinger, W. I., Buckner, C. D., Shannon-Dorcy, K., Rowley, S., Appelbaum, F. R., Benyunes, M., Clift, R., Martin, P., Demirer, T., Storb, R., er al. (1996). Transplantation of allogeneic CD34+ peripheral blood stem cells in patients with advanced hematologic malignancy. Blood 88, 4132-4138. Berenson, R. J . , Andrews, R. G., Bensinger, W. I., Kalamasz, D., Knitter, G. , Buckner, C. D., and Bernstein, I. D. (1988). Antigen CD34+ marrow cells engraft lethally irradiated baboons. J Clin Invest 81, 951-955. Bhatia, M., Bonnet, D., Murdoch, B., Gan, O. I., and Dick, J. E. (1998). A newly discovered class of human hematopoietic cells with SCID- repopulating activity [see comments]. Nat Med 4, 1038-1045. Brown, J . , Greaves, M. F., and Molgaard, H. V. (1991). The gene encoding the stem cell antigen, CD34, is conserved in mouse and expressed in haemopoietic progenitor cell lines, brain, and embryonic fibroblasts. Int Immunol 3, 175-184. Cheng, J . , Baumhueter, S., Cacalano, G., Carver-Moore, K., Thibodeaux, H., Thomas, R., Broxmeyer, H. E., Cooper, S., Hague, N., Moore, M., and Lasky, L. A. (1996). Hematopoietic defects in mice lacking the sialomucin CD34. Blood 87, 479-490. Christensen, J . L., and Weissman, I. L. (2001). Flk-2 is a marker in hematopoietic stem cell differentiation: a simple method to isolate long-term stem cells. Proc Natl Acad Sci U S A 98, 14541-14546. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc Natl Acad Sci U S A 81, 1991-1995. 120 Delia, D., Lampugnani, M. G., Resnati, M., Dejana, E., Aiello, A., Fontanella, E., Soligo, D., Pierotti, M. A., and Greaves, M. F. (1993). CD34 expression is regulated reciprocally with adhesion molecules in vascular endothelial cells in vitro. Blood 81, 1001-1008. Donnelly, D. S., Zelterman, D., Sharkis, S., and Krause, D. S. (1999). Functional activity of murine CD34+ and CD34- hematopoietic stem cell populations. Exp Hematol 27, 788-796. Doyonnas, R., Kershaw, D. B., Duhme, C., Merkens, H., Chelliah, S., Graf, T., and McNagny, K. M. (2001). Anuria, omphalocele, and perinatal lethality in mice lacking the CD34- related protein podocalyxin. J Exp Med 194, 13-27. Dugaiczyk, A. (1983). Cloning and sequencing of a deoxyribonucleic acid copy of glyceraldehyde-3-phosphate dehydrogenase messenger ribonucleic acid isolated from chicken muscle. Biochemistry 22, 1605-1613. Dunbar, C. E., Cottier-Fox, M., O'Shaughnessy, J. A., Doren, S., Carter, C , Berenson, R., Brown, S., Moen, R. C , Greenblatt, J . , Stewart, F. M., and et al. (1995). Retrovirally marked CD34-enriched peripheral blood and BM cells contribute to long-term engraftment after autologous transplantation. Blood 85, 3048-3057. Fackler, M. J . , Civin, C. I., and May, W. S. (1992). Up-regulation of surface CD34 is associated with protein kinase C- mediated hyperphosphorylatioh of CD34. J Biol Chem 267, 17540-17546. Fackler, M. J . , Krause, D. S., Smith, O. M., Civin, C. I., and May, W. S. (1995). Full-length but not truncated CD34 inhibits hematopoietic cell differentiation of M l cells. Blood 85, 3040-3047. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132, 6-Gao, Z., Fackler, M. J . , Leung, W., Lumkul, R., Ramirez, M., Theobald, N., Malech, H. L., and Civin, C. I. (2001). Human CD34+ cell preparations contain over 100-fold greater NOD/SCID mouse engrafting capacity than do CD34- cell preparations. Exp Hematol 29, 910-921. Geffen, D. B., Benharroch, D., Yellin, A., Ariad, S., Or, R., and Cohen, Y. (2001). Multimodal treatment of metastatic thymic carcinoma including high-dose chemotherapy with autologous stem cell transplantation: report of a case with more than 4-year disease-free survival. Am J Clin Oncol 24, 566-569. Goodell, M. A., Brose, K., Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806. Graf, T., McNagny, K., Brady, G., and Frampton, J . (1992). Chicken "erythroid" cells transformed by the gag-myb-ets-encoding E26 leukemia virus are multipotent. Cell 70, 201-213. Greaves, M. F., Brown, J . , Molgaard, H. V., Spurr, N. K., Robertson, D., Delia, D., and Sutherland, D. R. (1992). Molecular features of CD34: a hemopoietic progenitor cell-associated molecule. Leukemia 6, 31-36. Healy, L., May, G., Gale, K. a., Grosveld, F., Greaves, M., and Enver, T. (1995). The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion. Proc Natl Acad Sci U S A 92, 12240-12244. Hu, M. C , and Chien, S. L. (1998). The cytoplasmic domain of stem cell antigen CD34 is essential for cytoadhesion signaling but not sufficient for proliferation signaling. Blood 91, 1152-1162. Ikuta, K., and Weissman, I. L. (1992). Evidence that hematopoietic stem cells express mouse c-kit but do not depend on steel factor for their generation. Proc Natl Acad Sci U S A 89, 1502-1506. Ito, T., Tajima, F., and Ogawa, M. (2000). Developmental changes of CD34 expression by murine hematopoietic stem cells. Exp Hematol 28, 1269-1273. Karimi, K., Redegeld, F. A., Heijdra, B., and Nijkamp, F. P. (1999). Stem cell factor and interleukin-4 induce murine BM cells to develop into mast cells with connective tissue type characteristics in vitro. Exp Hematol 27, 654-662. 122 Kirshenbaum, A. S., Goff, J . P., Semere, T., Foster, B., Scott, L. M., and Metcalfe, D. D. (1999). Demonstration that human mast cells arise from a progenitor cell population that is CD34(+), c-kit(-t-), and expresses aminopeptidase N (CD13). Blood 94, 2333-2342. Kohn, D. B., Bauer, G. , Rice, C. R., Rothschild, J . C , Carbonaro, D. A., Valdez, P., Hao, Q., Zhou, C , Bahner, I., Kearns, K., e ra / . (1999). A clinical trial of retroviral-mediated transfer of a rev-responsive element decoy gene into CD34(+) cells from the BM of human immunodeficiency virus-1-infected children. Blood 94, 368-371. Kohn, D. B., Hershfield, M. S., Carbonaro, D., Shigeoka, A., Brooks, J . , Smogorzewska, E. M., Barsky, L. W., Chan, R., Burotto, F., Annett, G., e ta / . (1998). T lymphocytes with a normal ADA gene accumulate after transplantation of transduced autologous umbilical cord blood CD34+ cells in ADA- deficient SCID neonates. Nat Med 4, 775-780. Krause, D. S., Fackler, M. J . , Civin, C. I., and May, W. S. (1996). CD34: structure, biology, and clinical utility. Blood 87, 1-13. Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O., Hwang, S., Gardner, R., Neutzel, S., and Sharkis, S. J. (2001). Multi-organ, multi-lineage engraftment by a single BM-derived stem cell. Cell 105, 369-377. Lanza, F., Healy, L., and Sutherland, D. R. (2001). Structural and functional features of the CD34 antigen: an update. J Biol Regul Homeost Agents 15, 1-13. Linnekin, D. (1999). Early signaling pathways activated by c-Kit in hematopoietic cells. Int J Biochem Cell Biol 31, 1053-1074. Matthews, W., Jordan, C. T., Wiegand, G. W., Pardoll, D., and Lemischka, I. R. (1991). A receptor tyrosine kinase specific to hematopoietic stem and progenitor cell-enriched populations. Cell 65, 1143-1152. McNagny, K. M., Pettersson, I., Rossi, F., Flamme, I., Shevchenko, A., Mann, M., and Graf, T. (1997). Thrombomucin, a novel cell surface protein that defines thrombocytes and multipotent hematopoietic progenitors. J Cell Biol 138, 1395-1407. 123 Metcalf, D. (1999). Cellular hematopoiesis in the twentieth century. Semin Hematol 36, 5-12. Morel, F., Szilvassy, S. J . , Travis, M., Chen, B., and Galy, A. (1996). Primitive hematopoietic cells in murine BM express the CD34 antigen. Blood 88, 3774-3784. Nakamura, Y., Ando, K., Chargui, J . , Kawada, H., Sato, T., Tsuji, T., Hotta, T., and Kato, S. (1999). Ex vivo generation of CD34(+) cells from CD34(-) hematopoietic cells. Blood 94, 4053-4059. Ogawa, M. (2002). Changing phenotypes of hematopoietic stem cells. Exp Hematol 30, 3-6. Orlic, D., Fischer, R., Nishikawa, S. , Nienhuis, A. W., and Bodine, D. M. (1993). Purification and characterization of heterogeneous pluripotent hematopoietic stem cell populations expressing high levels of c-kit receptor. Blood 82, 762-770. Osawa, M., Hanada, K., Hamada, H., and Nakauchi, H. (1996). Long-term lymphohematopoietic reconstitution by a single CD34- low/negative hematopoietic stem cell. Science 273, 242-245. Park, I. K., He, Y., Lin, F., Laerum, O. D., Tian, Q., Bumgarner, R., Klug, C. A., Li, K., Kuhr, C , Doyle, M. J . , et al. (2002). Differential gene expression profiling of adult murine hematopoietic stem cells. Blood 99, 488-498. Rottem, M., Okada, T., Goff, J . P., and Metcalfe, D. D. (1994). Mast cells cultured from the peripheral blood of normal donors and patients with mastocytosis originate from a CD34+/Fc epsilon RI- cell population. Blood 84, 2489-2496. Sambrook, J . , Fritsch, E. F., and Maniatus, T. (1989). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY, Cold Spring Harbor Laboratory). Sassetti, C , Van Zante, A., and Rosen, S. D. (2000). Identification of endoglycan, a member of the CD34/podocalyxin family of sialomucins. J Biol Chem 275, 9001-9010. Sato, T., Laver, J . H., and Ogawa, M. (1999). Reversible expression of CD34 by murine hematopoietic stem cells [see comments]. Blood 94, 2548-2554. 124 Simmons, P. J . , and Torok-Storb, B. (1991). CD34 expression by stromal precursors in normal human adult BM. Blood 78, 2848-2853. Spangrude, G. J . , Smith, L , Uchida, N., Ikuta, K., Heimfeld, S., Friedman, F., and Weissman, I. L. (1991). Mouse hematopoietic stem cells. Blood 78, 1395-1402. Sutherland, D. R., Stewart, A. K., and Keating, A. (1993). CD34 antigen: molecular features and potential clinical applications. Stem Cells 11 Suppl 3, 50-57. Suzuki, A., Andrew, D. P., Gonzalo, J. A., Fukumoto, M., Spellberg, J . , Hashiyama, M., Takimoto, H., Gerwin, N., Webb, I., Molineux, G v et al. (1996). CD34-deficient mice have reduced eosinophil accumulation after allergen exposure and show a novel crossreactive 90-kD protein. Blood 87, 3550-3562. Sweetenham, 3. W., Carella, A. M., Taghipour, G., Cunningham, D., Marcus, R., Delia Volpe, A., Linch, D. C , Schmitz, N., and Goldstone, A. H. (1999). High-dose therapy and autologous stem-cell transplantation for adult patients with Hodgkin's disease who do not enter remission after induction chemotherapy: results in 175 patients reported to the European Group for Blood and Marrow Transplantation. Lymphoma Working Party. J Clin Oncol 17, 3101-3109. Tajima, F., Sato, T., Laver, J . H., and Ogawa, M. (2000). CD34 expression by murine hematopoietic stem cells mobilized by granulocyte colony-stimulating factor. Blood 96, 1989-1993. Takeda, T., Go, W. Y., Orlando, R. A., and Farquhar, M. G. (2000). Expression of podocalyxin inhibits cell-cell adhesion and modifies junctional properties in madin-darby canine kidney cells [In Process Citation]. Mol Biol Cell 11, 3219-3232. To, L B., Haylock, D. N., Simmons, P. J . , and Juttner, C. A. (1997). The biology and clinical uses of blood stem cells. Blood 89, 2233-2258. 125 Tsuji, K., Zsebo, K. M., and Ogawa, M. (1991). Murine mast cell colony formation supported by IL-3, IL-4, and recombinant rat stem cell factor, ligand for c-kit. J Cell Physiol 148, 362-369. Unkeless, J. C. (1979). Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors. J Exp Med 150, 580-596. van de Rijn, M., Heimfeld, S., Spangrude, G. J . , and Weissman, I. L. (1989). Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6 antigen family. Proc Natl Acad Sci U S A 86, 4634-4638. Weissman, I. L., Anderson, D. J . , and Gage, F. (2001). Stem and progenitor cells: origins, phenotypes, lineage commitments, and transdifferentiations. Annu Rev Cell Dev Biol 17, 387-403. Welker, P., Grabbe, J . , Zuberbier, T., Guhl, S., and Henz, B. M. (2000). Mast cell and myeloid marker expression during early in vitro mast cell differentiation from human peripheral blood mononuclear cells. J Invest Dermatol 114, 44-50. Wills-Karp, M. (1999). Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev Immunol 17, 255-281. Yamaguchi, M., Lantz, C. S., Oettgen, H. C , Katona, I. M., Fleming, T., Miyajima, I., Kinet, J . P., and Galli, S. J . (1997). IgE enhances mouse mast cell Fc(epsilon)RI expression in vitro and in vivo: evidence for a novel amplification mechanism in IgE-dependent reactions. J Exp Med 185, 663-672. 126 Chapter 3 Mouse, but not human, mature mast cells express CD34 3.1 Introduction Human CD34 is widely used in clinical and research settings as a marker of hematopoietic progenitor and stem cells (Gratama er al., 2001). We have shown that mature murine mast cells express CD34 and are antigenically similar to HSC (Drew et al., 2002). In the present study, we sought out to determine whether human mast cells express CD34, and if the isolation of human hematopoietic cells based on the expression of this antigen, could cause contamination with mast cells. Previous studies have reported the absence of CD34 expression on mature human mast cells in vitro (Rottem et al., 1994; Welker et al., 2000) and on tissue mast cells in vivo (Valent e ta/ . , 2001). However, it remained possible that CD34 was unable to be detected using these methods, due to culture conditions, fixation techniques and the various glycoforms of CD34 that cannot be detected with some CD34 antibodies (Lanza et al., 2001). We therefore, performed a more detailed analysis to carefully examine whether the human CD34 gene contains the appropriate regulatory elements for expression in mature mast cells. Recently mice have been generated that harbor a 160 kb human genomic fragment that contains human cd34 with 5' and 3' flanking regions (hCD34tg) (Radomska eta/ . , 2002). This has been shown to be sufficient to A version of this chapter is in press. Drew E, McNagny KM. CD34 expression by mast cells: Of mice and men Blood (letter). 2005. 127 drive human CD34 (hCD34) expression in mice in a pattern similar to the expression observed in humans (Radomska et al., 2002), Thus, this gene was expressed in vasculature and hematopoietic progenitors and declined sharply with hematopoietic maturation into more committed progenitors. We derived cultured mast cells from the BM of these mice to find out if hCD34tg mast cells express hCD34. Our results show that, in contrast to the expression of endogenous mCD34 by transgenic mast cells, these cells do not express the hCD34 transgene. These results suggest that although human and murine CD34 are expressed in the hematopoietic progenitors in these mice, mCD34, but not hCD34 expression is maintained upon mast cell differentiation. Thus, human and mouse cd34 are differentially regulated in mature mast cells. 3.2 Results and Discussion 3.2.1 mCD34, but not HCD34 protein is expressed by hCD34tg BMMC To find out whether hCD34 was expressed in murine mast cells, we cultured wild type and hCD34tg BM in IL-3 to give rise to BM derived mast cells (BMMC). Using flow cytometry, we observed expression of mCD34 by wild type and hCD34tg BMMC (Figure IA). In contrast, hCD34tg mast cells did not express hCD34 on their surface. As a positive control for hCD34 expression, we used K G l a cells, which are known to express high levels of this antigen (Figure IA). These cells were analyzed for the expression of mast cell markers to confirm their differentiation, and, as expected, the vast majority of both wild type and transgenic BMMC expressed c-kit and FceRI (Figure IB). Therefore, the 128 mouse CD34 FcERI human CD34 c-kit Figure 3.1 Murine, but not human CD34 is expressed by hCD34tg BMMC. A) FACS analysis of wild type and hCD34tg BMMC for mCD34 and hCD34. KG 1a cells were used as a positive control for hCD34 expression.B) hCD34tg BMMC mature normally along the mast cell lineage. Red = secondary alone; orange = Kg1a; blue = wild type BMMC; green = hCD34tg BMMC. FACS plots showing expression of c-kit and FceRI on wild type and hCD34tg BMMC. Red = secondary alone; blue = wild type BMMC; green = hCD34tg BMMC. C) hCD34tg mast cells do not express hCD34 mRNA. RT-PCR analysis of wild type and hCD34tg BMMC showing of murine CD34 but not hCD34 transcripts. presence of the human genomic locus and the human cd34 gene in hCD34tg cells does not affect the ability of these cells to develop normally along the mast cell lineage. 3.2.2 mCD34, but not HCD34 RNA is expressed by hCD34tg BMMC Although the antibody we used for flow cytometry is reported to detect all glycoforms of CD34 (Lanza et al., 2001), we also assessed whether hCD34tg BMMC expressed hCD34 mRNA. To do this, we reverse transcribed mRNA from wild type and hCD34tg BMMC and subsequently used PCR with primers towards mCD34 and hCD34 (Figure 1C). Our results confirmed that wild type and hCD34tg BMMC express both the full length and cytoplasmically truncated isoforms of mCD34 (Drew et al., 2002). In contrast, there was no expression of hCD34 for either population after 30 PCR cycles, although a hCD34 band was evident for hCD34tg cells after 40 cycles (data not shown). This was probably due to a low level of HPC that remained in the cultured 129 population, and/or a low level of transcript that remained within the differentiated mast cells. As a positive control, we used Kg l a cells and found high level of expression of hCD34. Therefore, mCD34, but not hCD34 is significantly transcribed in hCD34tg mast cells. These results suggest that murine and human CD34 are regulated differentially in mature mast cells, despite the ability of the 160 bp fragment of the human genome to drive expression of hCD34 in endothelium and hematopoietic progenitor cells (Radomska et al., 2002). The most likely explanation for these results is that there is either a repressor element present in the flanking regions of the human cd34 gene that is absent in murine cd34 locus, or that there is an enhancing element present for murine cd34 gene, but not the human cd34 gene. In similar studies, Okuno er al. (Okuno et al., 2002) have recently shown that there are slight differences in the expression of hCD34 and mCD34 in murine HSC. LT-HSC of hCD34tg mice express hCD34, but not mCD34. In addition, the downregulataion of mCD34 and hCD34 upon differentiation varies slightly. Our results extend these observations and show that, in addition to the aforementioned differences, murine and human cd34 are differentially regulated in the mast cell lineage. Despite the absence of hCD34 on human mast cells, caution should still be exercised when using CD34 + cells to isolate hematopoietic progenitor cells. Although mature mast cells are seldom found in the BM and peripheral blood (Sonoda et al., 1982), mast cell progenitors, which have been reported to express this protein (Kirshenbaum et al., 1999; Rottem eta / . , 1994; Welker et al., 2000) are present and because of their morphology and antigenic profile, these cells may contaminate human HSC preparations if CD34 is used as a reagent to purify stem cells. 130 In summary, our results confirm previous studies showing that CD34 is not expressed by human mast cells, although it is expressed at high levels by murine mast cells (Drew et al., 2002). These observations suggest regulatory differences of this gene between species. Further work on the mechanism of the expression of CD34 in this hematopoietic lineage would be of interest to find out how this gene is regulated. 3.3 Experimental Procedures 3.3.1 Mice C57BI/6 wild type mice were maintained under pathogen-free conditions at the Biomedical Research Centre transgenic mouse unit and procedures involving mice were approved by the University of British Columbia Animal Care Committee. 3.3.2 BM derived mast cells BM was flushed from the femurs of wild type mice. hCD34tg BM was extracted, sent on ice overnight (kindly provided by Dr. Daniel Tenen) and used the next morning. Red blood cells were lysed using 0.1 M NH4CI, and the remaining cells were washed and resuspended in RPMI 1640 with penicillin/streptomycin, sodium pyruvate, glutamine, 10% fetal bovine serum and 16 U/ml IL-3 obtained from WEHI-3B conditioned media (Tsuji et al., 1991). Cells were transferred to new flasks periodically during culture to remove adherent cells and they were grown for a minimum of four weeks to allow for mast cell differentiation (Tsuji et al., 1991). 3.3.3 Flow cytometry Cells were blocked with anti-CD16/32 clone 2.4G2 (Pharmingen) and goat serum prior to staining. The following antibodies were used for flow 131 cytometry: phycoerythrin-conjugated anti-c-kit (Pharmingen), anti-DNP (IgE) (Sigma), anti-IgE-FITC (Pharmingen), biotinylated-anti-mouse CD34 (RAM34) (Pharmingen), anti-human CD34 (8G12) (BD), goat anti-mouse Alexa (Molecular Probes). Biotinylated antibody was detected using phycoerythrin-conjugated streptavidin (Pharmingen). Cells were stained on ice for 15-20 min at 4°C in the dark and were analyzed using a FACScan or a FACSCalibur (Beckton-Dickinson) and data were acquired using Cell Quest software and analyzed using Flow Jo software. 3.3.4 RT-PCR mRNA was isolated from BMMC using U.MACS mRNA isolation kit (Miltenyi Biotech) and was subsequently reverse transcribed. (Thermoscript RT-PCR System; Invitrogen). Primers used for PCR were as follows: for mouse CD34 5'- CTCTAG ATC ACAGTTCTGTGTC AGC - 3' and reverse 5'-TAGCACAGAACTTCCCAGCAAAC-3' and for human CD34 forward 5' TG G G CG AAG ACCCTTATTAC ACGG AAAA- 3' and reverse 5' TCTCTcGGACACTgcccag-3'. PCR consisted of 30 cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 2 min. PCR products were separated on a 1.5% agarose gel and detected by staining with ethidium bromide. 3.4 Acknowledgements This work was supported by an operating grant from the Canadian Institutes of Health Research. KMM is a CIHR and a Michael Smith Foundation for Health Research Scholar. ED is supported by a Michael Smith Foundation for Health Research Trainee Scholarship and a Heart and Stroke Foundation Doctoral Scholarship. 132 3.5 References Drew, E., Merkens, H., Chelliah, S., Doyonnas, R., and McNagny, K. M. (2002). CD34 is a specific marker of mature murine mast cells. Exp Hematol 30, 1211. Gratama, J. W., Sutherland, D. R., and Keeney, M. (2001). Flow cytometric enumeration and immunophenotyping of hematopoietic stem and progenitor cells. Semin Hematol 38, 139-147. Kirshenbaum, A. S., Goff, J . P., Semere, T., Foster, B., Scott, L. M., and Metcalfe, D. D. (1999). Demonstration that human mast cells arise from a progenitor cell population that is CD34(+), c-kit(+), and expresses aminopeptidase N (CD13). Blood 94, 2333-2342. Lanza, F., Healy, L., and Sutherland, D. R. (2001). Structural and functional features of the CD34 antigen: an update. J Biol Regul Homeost Agents 15, 1-13. Okuno, Y., Iwasaki, H., Huettner, C. S., Radomska, H. S., Gonzalez, D. A., Tenen, D. G. , and Akashi, K. (2002). Differential regulation of the human and murine CD34 genes in hematopoietic stem cells. Proc Natl Acad Sci U S A 99, 6246-6251. Radomska, H. S., Gonzalez, D. A., Okuno, Y., Iwasaki, H., Nagy, A., Akashi, K., Tenen, D. G., and Huettner, C. S. (2002). Transgenic targeting with regulatory elements of the human CD34 gene. Blood 100, 4410-4419. Rottem, M., Okada, T., Goff, J. P., and Metcalfe, D. D. (1994). Mast cells cultured from the peripheral blood of normal donors and patients with mastocytosis originate from a CD34+/Fc epsilon RI- cell population. Blood 84, 2489-2496. Sonoda, T., Ohno, T., and Kitamura, Y. (1982). Concentration of mast-cell progenitors in bone marrow, spleen, and blood of mice determined by limiting dilution analysis. J Cell Physiol 112, 136-140. 133 Tsuji, K., Zsebo, K. M., and Ogawa, M. (1991). Murine mast cell colony formation supported by IL-3, IL-4, and recombinant rat stem cell factor, ligand for c-kit. J Cell Physiol 148, 362-369. Valent, P., Schernthaner, G. H., Sperr, W. R., Fritsch, G., Agis, H., Willheim, M., Buhring, H. J . , Orfao, A., and Escribano, L. (2001). Variable expression of activation-linked surface antigens on human mast cells in health and disease. Immunol Rev 179, 74-81. Welker, P., Grabbe, J . , Zuberbier, T., Guhl, S., and Henz, B. M. (2000). Mast cell and myeloid marker expression during early in vitro mast cell differentiation from human peripheral blood mononuclear cells. J Invest Dermatol 114, 44-50. 134 Chapter 4 CD34 and CD43 Inhibit Mast Cell Adhesion and are Required for Optimal Mast Cell Reconstitution 4.1 Introduction CD34 is a highly glycosylated transmembrane protein that is expressed by HSC, hematopoietic progenitors and vascular endothelia. Since its discovery almost 20 years ago, it has become the most widely used marker for the enrichment of human hematopoietic progenitors (reviewed in Gratama etal., 2001; Krause et al., 1996). More recently its use for the enrichment of the most primitive hematopoietic progenitors/stem cells has come into question with the discovery that both CD34 + and CD34~ cells have the capacity to reconstitute all hematopoietic lineages in irradiated murine recipients (Bhatia et al., 1998; Ogawa, 2002). Interestingly, CD34 expression by HSC has been found to fluctuate as a function of mammalian development and cell activation (Dao et al., 2003; Ogawa, 2002; Zanjani et al., 2003). Thus, it is likely that the differences in the expression of CD34 by HSC reflect their activation or developmental status. Given the widespread use of CD34 as a progenitor cell marker, it is remarkable that little is known about the function of this antigen. In the literature, CD34 has alternatively been proposed to act as: 1) an enhancer of proliferation, 2) a blocker of differentiation, 3) a BM homing receptor, 4) a cell adhesion molecule, A version of this chapter has been published. Drew E, Merzaban JS, Seo W, Ziltener HJ and McNagny KM. CD34 and CD43 Inhibit Mast Cell Adhesion and are Required for Optimal Mast Cell Reconstitution. Immunity. 2005 Jan;22( l ) :43-57. 135 and 5) a blocker of cell adhesion (Baumhueter et al., 1993; Cheng etal., 1996; Delia er al., 1993; Fackler er al., 1995; Krause er al., 2001). Gene targeting experiments have further obscured this issue; deletion of the CD34-encoding gene in mice by two separate laboratories has revealed only subtle phenotypes, with different and opposing observations made for the independent strains (Cheng et al., 1996; Suzuki et al., 1996). The discovery of two additional CD34-related genes (podocalyxin and endoglycan) with overlapping expression patterns, suggests that the minor phenotypes observed in CD34-deficient mice may reflect functional compensation by these related molecules (Doyonnas et al., 2001; Nielsen et al., 2002; Sassetti et al., 1998; Sassetti et al., 2000). Thus, the use of mutant animals to delineate a function for CD34 would require either the generation of compound mutant mice lacking these related family members or a focused analysis of tissues that normally express CD34, but not its homologues. In a recent survey of the expression pattern of CD34-related genes we made an unexpected observation: CD34, but not podocalyxin or endoglycan, is expressed at high levels by murine mast cells (Drew et al., 2002). Despite their notoriety in the pathogenesis of diseases such as asthma, allergies and autoimmune disease (Benoist and Mathis, 2002), mast cells are also important players in innate and adaptive immune responses (Galli and Nakae, 2003; Kawakami and Galli, 2002; Smith and Weis, 1996). Murine mast cells can be broadly classified into two distinct groups based on their morphology, granule protease content and tissue localization: connective tissue-type mast cells (CTMC) and mucosal mast cells (MMC) (Gurish and Boyce, 2002). CTMC reside predominantly in the skin and peritoneum and are important sentinels in responding to bacterial infections, while MMC reside in the intestinal mucosa and play a key role in responses to certain helminth infections (Gurish et al., 2001). Mast cells are known to phagocytose, present antigen and secrete cytokines and other inflammatory mediators (Mekori and Metcalfe, 2000). 136 Therefore, these cells are important in immune responses to a variety of pathogens. Mast cells arise in the BM from HSC and are unusual in that they leave the BM as immature precursors to enter peripheral tissues where they undergo terminal differentiation (Kawakami and Galli, 2002). Little is known of the process that leads to their maturation, but, in vivo, it is critically dependent upon signaling through the stem cell factor receptor (SCF), c-kit (also known as SCF-R and mast cell growth factor receptor) (Galli, 2000). The development and differentiation of a mast cell, including its granule content, size and sensitivity to stimulants is dependent upon growth factors and cytokines present in its local microenvironment (Gurish and Boyce, 2002; Mekori and Metcalfe, 2000). The W/W v mouse possesses two mutations for c-kit and is widely used for the study of mast cell function, since these mice virtually lack tissue mast w cells (Galli, 2000). c-kit encodes a shortened protein, lacking the transmembrane domain, thereby ablating its expression on the cell surface (Hayashi et al., 1991; Waskow et al., 2004). These mice also harbor the c-kitWv allele, a missense mutation at position 660 in the kinase domain (threonine to methionine) (Dastych et al., 1998; Nocka et al., 1990), resulting in weak kinase activity and poor response to SCF (Waskow et al., 2004). W/W v mice have a normal number of stem cells but decreased numbers of progenitor cells and are anemic (Migliaccio et al., 1999). These mice can be transplanted with wild type BM to restore mast cell populations and cure their anemia (Williams and Galli, 2000). Since wild type progenitor cells respond to SCF better than endogenous W/W v cells, they have an engraftment advantage in colonizing stem cell niches in W/W v recipients (Migliaccio et al., 1999). 137 To explore the function of CD34 on hematopoietic cells, we have exploited our observation that this protein, but not its closest homologs, is expressed by murine mast cells. We compared BMMC from wild type and cd34// mice and observed a clear increase in the homotypic adhesiveness of CD34-deficient mast cells. In an attempt to exacerbate this phenotype, we generated compound mutant mice lacking CD34 and the distantly related, sialomucin, CD43 (Figure 4.1). CD43 is expressed by most hematopoietic cells, and while it has previously been shown to play a role in blocking leukocyte adhesion, (Manjunath et al., 1995; Ostberg et al., 1998) its function has never been examined on mast cells. Our results show that mast cells lacking CD34 and/or CD43 show increased aggregation, with mast cells lacking both sialomucins showing the most profound aggregation. This increased aggregation was reversible by the ectopic re-expression of CD34 or CD43. To assess the role of these molecules in vivo, we measured the ability of wild type and mutant cells to repopulate a mast cell niche, using two experimental model systems. These experiments revealed a complete impairment of cd34~//~ / cd43~^~ cells to repopulate peritoneal mast cells. Interestingly, in one of these experimental models, we observed a similar decreased ability of mutant cells to reconstitute BM hematopoietic progenitors. Our results show that CD34 and CD43 play a key role in blocking mast cell adhesion and suggest that their function on these cells is to enhance their ability to migrate to new microenvironments. 4.2 Results 4.2.1 Loss of CD34 leads to increased homotypic adhesion of BM-derived mast cells (BMMC) To test the function of CD34 on mast cells and their precursors, BM from cd34~/~ mice (Suzuki et al., 1996) and wild type mice was cultured in vitro 138 mCD34 F L mCD34 C T mCD43 Figure 4.1 Structure of CD34 and CD43 Schematic structure of full-length murine CD34 (CD34FL), the naturally occurring truncated form (CD34CT) and CD43 based on predicted protein sequences. Blue boxes = mucin domains, green boxes = cysteine-rich domain, black circles = potential N-linked carbohydrates, horizontal bars = potential O-linked carbohydrates, PKC, CK2 and TK = potential phosphorylation sites, DTEL = potential PDZ-domain docking motif. under conditions that select for the outgrowth and maturation of mast cells. Although loss of CD34 had no effect on the kinetics of mast cell differentiation, proliferation or degranulation (Drew et al., 2002 and data 139 not shown), light microscopic analyses of cultures from wild type and cd34~/~ littermates revealed one consistent difference: CD34-deficient mast cells had an increased propensity to aggregate. Wild type cultures consistently grew as single cell suspensions while mast cells lacking the CD34 antigen showed small aggregates (8 + 2 cells per aggregate) with 16 + 7% of cells involved in homotypic adhesion (Figure 4.2A). Greater than 1500 cells were counted in this and subsequent assays to ensure these differences were consistent. Similar results were obtained when cells were mechanically dissociated into single cell suspensions, plated at the same density and observed after overnight incubation. To verify that loss of CD34 was responsible for this observed aggregation, cd34 ^ BM cells were infected with a GFP-containing retrovirus alone (pMXpie), or with the same retrovirus expressing either full-length (CD34 F L ) or C T cytoplasmically-truncated CD34 (CD34 ). The latter form corresponds to a naturally occurring splice variant of CD34 and results in the deletion of the bulk of the cytoplasmic domain via a premature stop codon ((Nakamura et al., 1993) and see Figure 4.1). Cells were cultured for at least six weeks in medium containing IL-3 and puromycin and sorted by flow cytometry for GFP expression, prior to the assessment of GFP-positive cells for homotypic adhesion by fluorescence microscopy (Figure 4.2B). For cells infected with the vector alone, 19 + 7% of cells formed aggregates with 7 + 2 cells per clump. Strikingly, virtually no clumping was observed for cells expressing either C D 3 4 F L (2 + 5% aggregation and 2 + 3 cells per clump) or C D 3 4 C T (0.1 + 0.3% aggregates, with 1 + 1 cell per clump). The re-expression of recombinant CD34 by these cells after infection was confirmed by flow cytometry (data not shown). Our data suggest that CD34 is necessary and sufficient to inhibit mast cell aggregation. 140 B 30 20 10 • % cells in aggregates • # cells/aggregate n=2240 n=3404 cd34'/- + pMXpie cd34->- + CD34 F L cd34'/- + CD34C T • % cells in aggregates • # cells/aggregate n=2681 n=1577 n=1704 Figure 4.2 Loss of CD34 increases homotypic aggregation of BMMC Bar graphs represent the percentage of cells involved in aggregates (open bars) and the average number of cells per aggregate (filled bars) with standard deviation error bars. Values are indicated as significantly different from wild type or vector alone with ** (p<0.01).(A) BMMC from littermate and sex-matched wild type and CD34KO mice. Graphs show degree of aggregation from two independently derived sets of littermate-matched mast cells. (B) CD34KO BMMC expressing the GFP-containing retrovirus pMXpie alone or pMXpie containing CD34FL or CD34CT. Data shows aggregation quantification for two independent infections. 141 4.2.2 Loss of the sialomucin, CD43, also leads to homotypic aggregation/adhesion Our observation that CD34 confers an anti-adhesive function on blood cells is reminiscent of previous reports showing that CD43, a distantly related sialomucin expressed on most hematopoietic lineage cells, also is capable of blocking adhesion (Ardman etal., 1992; Manjunath etal., 1995; Ostberg et al., 1998; Walker and Green, 1999). Although CD43 lacks many of the biochemical motifs associated with the CD34 family (Doyonnas et al., 2001), it shares a large extracellular mucin domain (Figure 4.1). To test whether this molecule plays a similar role in blocking mast cell aggregation, we established mast cell cultures from the BM of cd43~^~ and cd34~j/~ / cd43~^~ double-deficient mice. Although we found no difference in the ability of CD43-deficient mast cells to differentiate (data not shown), these cells were much more prone to aggregation than either cd34~^~ or wild type mast cells (70 + 20%, versus 16 + 7% or 3 + 2% respectively, Figure 4.3A). In addition, the size of these aggregates was much larger than those observed in cultures of either cd34~//~ or wild type mast cells (30 + 15 cells/aggregate versus 8 + 2 and 4 + 2, respectively). Interestingly, loss of CD34 and CD43 had an additive effect on homotypic adhesion: 94 + 7% of the cd34~^~ / cd43~^~ mast cells were in aggregates and the size of these aggregates was much larger than mast cell aggregates formed in cultures lacking either cd43~^~ or cd34~//~ (94 + 50 cells/aggregate versus 30 + 15 and 8 + 2, respectively, Figure 4.3A). Again, we saw no obvious defect in the proliferation or differentiation capacity of these double-deficient cells. To test whether the increased aggregation reflects a general increase in non-specific cell adhesion, we examined the ability of wild type and cd34^ / cd43^ mast cells to bind to fibronectin in vitro. Cd34~^~ / cd43 ^ mast cells had a higher propensity to bind this extracellular matrix, 142 143 • % cells in aggregates • # cells/aggregate n=2810 n=5120 n=1838 n=1279 Figure 4.3 CD34 and CD43 both block BMMC aggregation Bar graphs represent the percentage of cells involved in aggregates (open bars) and the average number of cells per aggregate (solid bars) with standard deviation error bars. Values are indicated as significantly different from wild type or vector alone with * (p<0.05) or ** (p<0.01). (A) Aggregation of CD43KO and CD34/CD43 DKO BMMC. Mast cells were independently derived from two mice of each genotype. (B) Aggregation of CD43KO BMMC expressing the GFP-containing retrovirus pMXpie alone with pMXpie containing CD34FL or CD34CT. Data show results from two independent infections. (C) Aggregation of CD34/CD43 DKO BMMC expressing pMXpie alone or pMXpie containing CD34FL, CD34CT or CD43. without stimulation, than wild type mast cells (data not shown). We conclude that CD34 and CD43 both play a role in blocking cell aggregation and that the loss of both molecules has an additive effect on cell adhesion. To test whether CD34 and CD43 are functionally redundant on mast cells, cd43 BM was infected with either a control virus vector or with a vector expressing C D 3 4 F L or C D 3 4 C T (Figure 4.3B). Ectopic expression of C D 3 4 F L and C D 3 4 C T led to a partial reversal of the aggregation phenotype over controls with a decrease from 76 + 6% aggregation and 31 ± 10 cells per aggregate (vector alone cells), to 41 ± 19% for C D 3 4 F L (14 + 5 cells per aggregate) and 27 + 2% for CT CD34 (14 +_ 6 cells per aggregate). CD43 was also introduced into cells using pMXpie and showed complete reversion of aggregation (data not shown). 144 Overexpression of CD34 in cd34 / cd43 mast cells also led to a decrease in aggregation from 98 + 1% and 45 + 11 cells per aggregate (vector control) to 74 + 17% and 31 + 16 cells per aggregate (Figure 4.3C). C D 3 4 C T decreased adhesion to 6 + 4% aggregation (4 + 2 cells per aggregate, Figure 4.3C). Ectopic CD43 expression lead to complete disaggregation of cd34~^~ / cd43~^~ mast cells to 2.3 + 0.9% (Figure 4.3C). In summary, our data suggest that on mast cells, CD34 and CD43 have overlapping functions in blocking adhesion and that the loss of either, or both of these molecules can be reversed by the ectopic re-expression of CD34 or CD43. 4.2.3 Homotypic adhesion is divalent cation-dependent and cell autonomous Cellular adhesion mediated by integrins is dependent upon the presence of divalent cations (Leitinger et al., 2000). In an effort to determine whether the enhanced aggregation of mucin-deficient mast cells is cation-dependent, mast cells were cultured in media supplemented with ImM EDTA and/or ImM EGTA in vitro. After 10 minutes in culture, cd34 ^ / cd43 ^ cells showed no aggregation in the presence of either or both chelating agents compared to controls and aggregates failed to accumulate during overnight incubation in the presence of these compounds (Figure 4.4A). Thus, homotypic adhesion of sialomucin-deficient mast cells is a process that is dependent upon divalent cations and may involve integrins. A similar effect was also observed for cd34~ / _ and cd43~/~ BMMC (data not shown). In an effort to determine which adhesion protein mediates this aggregation, cd43 ^ or cd34 ^ / cd43 ^ cells were disaggregated mechanically and 145 C634-I-1 cd43'/-no EDTA/EGTA Cd34-'-1 cd43-/-1 mM EDTA & EGTA Figure 4.4 Homotypic adhesion is divalent cation dependent and cell autonomous (A) Cellular aggregation is completely lost upon addition of 1 mM EDTA and/or EGTA. Micrographs show double-deficient CD34/CD43 DKO BMMC in the absence and presence of these chelators. (B) CD34/CD43 DKO cells or CD34KO cells were labeled with CSA-SE and were mixed with GFP-positive CD34CT expressing BMMC. Cells were allowed to aggregate overnight and were observed under fluorescence microscopy to assess degree of mixed aggregation. incubated with blocking antibodies to pi-, pV, fM-integrins, ICAM-1 or Sg lGSF (Ito et al., 2003). None of these antibodies were able to disrupt re-aggregation of these BMMC (data not shown). This suggests that either another molecule is responsible for this aggregation, or, that several adhesive receptors are 146 involved and this effect cannot be overcome by blocking only one of these proteins. To test whether this anti-adhesive activity on wild type mast cells was cell autonomous, we labeled either cd34~^~ / cd43~jf~ or cd34~^~ BMMC with the red fluorescent dye, CSA-SE, and mixed them with cd34~//~ mast cells infected with GFP and C D 3 4 C T . None of the GFP/CD34-positive cells aggregated with CSA-SE-positive cd34^ / cd43~^~ or cd34~^~ cells (Figure 4.4B). From these experiments we conclude that the negative regulation of cellular adhesion by CD34 is cell autonomous and that it is unable to lead to the disaggregation of cells in trans. 4.2.4 CD34 and/or CD43 are required for optimal mast cell progenitor migration in vivo To determine whether the loss of CD34 and CD43 affect the ability of mast cell precursors to migrate to peripheral tissues, we quantified the number of mature mast cells within different tissues of wild type, cd34^~, cd43^~ and cd34~^~ / cd43 ^ mice. CTMC were enumerated using Toluidine blue and Giemsa stains, in the skin of the ear and back, and in the peritoneal cavity, respectively. MMC were quantified as alcian blue-positive cells in the mucosa of the intestine. Surprisingly, we found a similar number of connective tissue and mucosal mast cells in each tissue examined, regardless of their cd34 or cd43 genotype (Figure 4.5A). Thus, our data suggest that, despite the profound differences in mast cell adhesion observed in vitro, CD34- and/or CD43-deficient mast cell progenitors migrate to tissues during development in sufficient numbers to result in the appropriate frequency of mature tissue mast cells in adult 147 Figure 4.5 CD34 and CD43 are Essential tor Optimal Recovery of Peritoneal Mast Cells (A) Mast cell numbers in vivo are similar in wild type and CD34K0, CD43K0 and CD34/CD43 DKO mice. Ear and back skin was sectioned and stained with toluidine blue. The number of purple, granular-positive mast cells per field is shown. Peritoneal lavage cells were cytocentrifuged and Giemsa stained to identify mast cells. For mucosal mast cells, intestines were sectioned and stained with alcian blue and safranin. Alcian blue positive mast cells were quantified per villus for each mouse. Error bars show standard deviation values. (B) The frequency of mast cell progenitors per 10 mononuclear cells is similar in wild type, CD34KO, CD43KO and CD34/CD43 DKO bone marrow and spleen. Cells from each tissue was plated in a limited dilution analysis with IL-3 and analyzed after 14 days for mast cell colony growth. The frequency of MCp in bone marrow and spleen was measured in three independent experiments. Error bars show standard deviation values.(C) Number of peritoneal mast cells from wild type CD34KO, CD43KO and CD34/CD43 DKO mice at various time points after ablation of mast cells by intraperitoneal injection of water. Each symbol represents one mouse. Average for each genotype is shown as a horizontal line. Blue diamonds = wild type, green squares = CD34KO, orange circles = CD43 and red triangles = CD34/CD43 DKO. Values are indicated as significantly different from wild type with ** (p<0.01). 148 mice. We also assessed the frequency of mast cell progenitors (MCp) per 10 mononuclear cells (MNC) in adult mice under normal conditions, using a limiting dilution analysis (Crapper and Schrader, 1983; Gurish e ta / . , 2001). There was no significant difference observed for the BM or spleen between wild type, cd34~/~, cd34~/~ and cd34~/~ /cd43~/~ mice (Figure 4.5B). In order to evaluate the kinetics of mast cell precursor migration into adult tissues, we used intraperitoneal injection of distilled water to ablate the local CTMC and then monitored the mast cell repopulation of this compartment over time. This technique has been previously shown to eradicate peritoneal mast cells (about 2% of the resident peritoneal hematopoietic cell population) and stimulate the influx of mast cell progenitors from the BM, without drastically altering the total number of peritoneal cells (Kanakura et al., 1988). Distilled water was injected into the peritoneum of wild type, cd34 ^ , cd43 ^ , and cd34 ^ I cd43 ^ mice and the frequency of resident mast cells in peritoneal lavage was assessed at 2, 6, 12, 16 and 21 weeks after injection (Figure 4.5C). Wild type mice showed an immediate ablation of mast cells after water injection, and required 21 weeks to recover a near-normal frequency of mast cells. Cd34 ^ / cd43^ mice showed a near complete absence of mast cell recovery even after 21 weeks (p=0.002). Although the recovery of mast cells in cd34 ^ or cd43 ^ single-deficient mice fell between wild type and cd34 ^ / cd43 ^ levels, it was not low enough to be considered statistically different from wild type mice (p=0.61 and 0.06, respectively, Figure 4.5C). We conclude that although cd34 ^ I cd43 ^ mice show no dramatic decrease in the frequency of mast cells in adult tissues at steady state, after mast cell ablation, they display a clear defect in the kinetics of mast cell progenitor migration into the peritoneum, consistent with a requirement for these molecules for efficient homing in vivo. 149 4.2.5 CD34 and/or CD43 are required for mast cell repopulation of the peritoneal cavity in W/W v mice W / W v mice, which bear mutations in c-kit, virtually lack tissue mast cells, and have been widely used as a model system for testing the ability of mutant mast cells to repopulate adult tissues (Galli, 2000). Here we used these mice as a permissive system for measuring the ability for mutant BM precursors to compete with wild type cells for reconstitution of a mast cell niche in vivo. W / W v mice were sub-lethally irradiated and injected with wild type BM cells mixed with equal numbers of either cd34^~', cd43~^~ or cd34~^~ f cd43~^~ BM cells, in a competitive repopulation assay. As a control, W / W v mice were also injected with cd34~^~ / cd43~^~ BM cells alone (Figure 4.6A). To distinguish between the two donor populations, some mice were injected with CD45.1 wild type cells and mutant cells (CD45.2). CD45.1 is a variant of CD45, a pan-hematopoietic marker, and is commonly used for distinguishing between donor populations in stem cell transplantation experiments (Hasumura etal., 2003). Eleven to twelve weeks after injection, the frequency of peritoneal mast cells was evaluated by flow cytometry based on their distinctive high side scatter properties (as a measure of cell granularity) and their high expression of c-kit h i (Figure 4.6B). C-kit peritoneal cells from non-reconstituted wild type mice were positive for FceRI, confirming their identity as mast cells (data not shown). Wild type, cd34~^~ / cd43~^~ and W / W v mice were used as controls. As expected, high side scatter, c-k i t h i peritoneal cells were virtually undetectable in non-reconstituted W / W v mice (Figure 4.6B). Interestingly, mice non-competitively reconstituted with cd34~^~ / cd43~//~ BM alone did not show significant peritoneal mast cell reconstitution (Figure 4.6B) suggesting a potent 150 A B o cr, CO o C O i ' . sub-lethal irradiation wild type BM: CD34KO/CD43KO/DKO BM in V or DKO BM alone ^ NON-RECONST. MICE DKO 11 weeks analysis of contribution to peritoneal mast cell population rf rf rf rf * RECONST. W/W MICE WT:34KO WT:DKQ DKO .aE:: L - J rf rf rf rf c-kit NON-RECONST. MICE NON-RECONST. MICE n=4 n=4 n=8 n=5 RECONST W W M C E COMP. RECONST. W / W MICE WT:43KO WT:34KO WT:DKO FSC ** •mil CD43+ PREDICTED WT:43KO WT:DKO „ „ . „ EQUAL « . , PREDICTED WT34KO WT:DKO EQUAL , : 1 1 ; 1 RECONST 1:1 DONOR CELLS 151 Figure 4.6 CD34 and CD43 are Required for Optimal Peritoneal Mast Cell Reconstitution of Mast Cell-Deficient Mice (A) Schematic showing experimental design of competitive reconstitution of WA/VV mice. Sub-lethally irradiated mice were intravenously injected with a 1:1 mixture of wild type and either CD34KO, CD43KO or CD34 / CD43 DKO bone marrow cells, or CD34 / CD43 DKO alone. Eleven to twelve weeks later, mast cell reconstitution was assessed. (B) Percentage of peritoneal mast cells was evaluated for non-reconstituted wild type, CD34 /CD43 DKO and for W7WV mice, for competitively reconstituted W/W v mice (with wild type and either CD34KO, CD43KO or CD34 / CD43 DKO bone marrow) and non-. competitively reconstituted CD34 / CD43 DKO bone marrow. Mast cells were identified as c-kit SSC ' cells. Error bars show standard deviations. Value is indicated as significantly different from the average percentage of c-kit-positive cells resulting from competitive reconstitution with ** (p<0.01). (C) Flow cytometric analysis of c-kit SSG peritoneal cells from non-reconstituted wild type and CD34 / CD43 DKO mice (as controls) and competitively reconstituted W7WV mice that were injected with a 1:1 mixture of wild type and either CD34KO, CD43KO or CD34/CD43 DKO bone marrow. The bar graphs show the relative reconstitution of CD43 + and CD34 + mast cells for mice reconstituted with CD43 + and CD34 + bone marrow alone, and mice competitively reconstituted with wild type and knock-out cells. Also shown is the predicted frequency of CD43 + and CD34 + cells assuming equal contribution of wild type and CD34 / CD43 DKO cells (grey bars). Error bars show standard deviations. Values are indicated as significantly different from the predicted values for equal reconstitution with ** (p<0.01). defect in their ability to populate vacant mast cell niches in the peritoneum. In contrast, significant numbers of mast cells were found in W/W v mice that had been competitively reconstituted with wild type and cd34 ^ , cd43 ^ or CC734 ^ / cd43~/~ BM (Figure 4.6B). To determine the frequency of wild type and mutant mast cells in the peritoneal cavity after competitive reconstitution of W/W v mice, these cells were tested for the presence or absence of CD34 and CD43 on their surface. As controls for CD34 and CD43 expression, non-reconstituted wild type and cd34 ^ / cd43 ^ mice were analyzed in a parallel experiment (Figure 4.6C). Virtually all mast cells resulting from competitive reconstitution by wild type and cd34~^~ / cd43~/f~ cells were of wild type origin (CD43 + CD34 + ) . These cells repopulated peritoneal mast cells to similar frequencies as mice that had been solely reconstituted with C D 4 3 + or C D 3 4 + cells (The higher number of C D 3 4 + cells and higher level of expression of CD34 and CD43 for reconstituted mice may reflect upregulation of this protein under reconstitution conditions, Figure 4.6C). Accordingly, for mice competitively injected with wild type CD45.1 and 152 cd34 I cd43 BM, >90% of the resulting peritoneal mast cells were CD45.1 (data not shown). Mice reconstituted with wild type and cd43 ^ BM cells did not display a significant advantage for wild type cells to reconstitute the peritoneal mast cell niches, showing a similar frequency of C D 4 3 + mast cells to that predicted for an equal contribution by wild type and cd43 ^ cells (Figure 4.6C). Competitive reconstitution by wild type and cd34^ cells showed the same number of C D 3 4 + mast cells as reconstitution by C D 3 4 + cells alone, however this was not significantly different to the predicted equal contribution (Figure 4.6C). Our results suggest that under competitive and non-competitive conditions, cd34 ^ / cd43 ^ cells are severely defective in their ability to reconstitute peritoneal mast cells. 4.2.6 CD34 is required for progenitor cell repopulation of the BM in W / W v mice Our observation that loss of CD34 and CD43 prevents mast cell reconstitution of the peritoneal cavity of W /W v mice does not necessitate a mast cell precursor defect per se, but could also be explained by a stem cell defect of mutant cells within the BM. This idea was not supported by our observation that there was no competitive advantage for wild type or mutant BM cells to contribute to multilineage reconstitution in lethally irradiated wild type mice (data not shown). However, since mice with mutations in c-kit have been shown to be particularly sensitive to engraftment after sublethal irradiation (Benveniste et al., 2003; Vecchini et al., 1993), we examined the frequency of wild type and mutant hematopoietic progenitors in the BM of competitively reconstituted W/W v recipients. Since c-kit expression was not detected using flow cytometry on BM (or spleen) cells from W/W v mice (either due to decreased number of progenitors 153 O 20 2 n=2 n=2 n=5 B g 80 n=3 WT DKO W/W WT34KO WT43KO WTDKO DKO 1:1 1:1 1:1 NON-RECONST MICE RECONST WIW" MICE EQUAL RECONST 1:1 PREDICTED WT:34KO WT43KO WTDKO 1:1 RECONST W/Wv MICE C IN VITRO IN VIVO Wild type CD34 or CD43 KO CD34/CD4.1 KO Peritoneal Cavity • 9 - Ectopic CD34 or CD43 Defect!** In W/Wv competitive reconstitution Defective after local mast1 cell ablation Figure 4.7 Loss of CD34 prevents bone marrow engraftment (A) Graphical representation for the percentage of c-kit-positive bone marrow cells, assessed using flow cytometry, in the bone marrow of non-reconstituted wild type, CD34KO/CD43 DKO and WVWv mice. Also shown is the number of c-kit-positive cells that resulted from competitive reconstitution of W/Wv mice by wild type and either CD34KO, CD43KO or CD34KO/ CD43 DKO bone marrow or non-competitive reconstitution with CD34KO/CD43 DKO bone marrow alone. Error bars show standard deviations. Values are indicated as significantly different from the predicted values for equal reconstitution with ** (p<0.01 ).(B) C-kit positive cells were gated for competitively-reconstituted W/Wv mice and analyzed for expression of CD45.1 (wild type) and/or CD43, to determine which donor these cells were derived from. Error bars show standard deviations. Values are indicated as significantly different from the predicted values for equal reconstitution with ** (p<0.01). (C) Proposed model for the function of CD34 and CD43 in vitro and in vivo. Loss of CD34 or CD43 results in increased adhesion of mast cells in vitro with the loss of both these molecules increasing this adhesion, which can be reversed by ectopic expression of CD34 or CD43. The lack of CD34 in vivo causes decreased bone marrow engraftment and the loss of CD34 and CD43 impairs the recovery of peritoneal mast cells from endogenous bone marrow-derived precursors. (Migliaccio et al., 1999) and/or decreased level of expression (Hayashi et al., 1991; Waskow et al., 2004)) (Figure 4.7 and data not shown), all c-kit-positive BM cells in reconstituted mice were donor derived. We could therefore enumerate the frequency of wild type and mutant hematopoietic progenitors simply by quantifying the frequency of c - k i t + C D 4 5 . 1 + / C D 4 3 + and c-k i t + C D 4 5 . l " / C D 4 3 " cells, respectively. 154 In wild type and cd34 / cd43 mice, approximately 20% of BM cells express c-kit (Figure 4.7A). Although there was no expression of c-kit on BM cells from non-reconstituted W/W v , upon competitive transplantation with wild type and cd34~^~, cd43~^~or cd34~^~ / cd43~^~ BM cells, c-kit-positive cells were detected at the same frequency as wild type BM (Figure 4.7A). Interestingly, W/W v mice repopulated with only cd34 ^ / cd43 ^ BM cells (no wild type competitors) did not have any detectable c-kit-positive cells in the BM (Figure 4.7A). This suggests that CD34 and/or CD43 are essential for stem cell engraftment in this W/W v model. To determine the donor origin of c-kit-positive cells in competitively reconstituted mice, these cells were analyzed for CD43 and/or CD45.1 expression. For mice reconstituted with wild type CD45 .1 + and cd34 ^ CD45.1" cells, we found that virtually all c-ki t + cells were C D 4 5 . 1 + , suggesting that cd34 ^ cells were unable to engraft the BM (Figure 4.7B). In contrast, mice reconstituted with wild type CD45 .1 + and cd43^~ CD45.1" cells showed equal contribution from each population, implying that there was no disadvantage for cd43^ cells (Figure 4.7B). In mice competitively reconstituted with wild type and cd34~/' / cd43~^~ cells, virtually all c-kit-positive cells expressed CD45.1 and/or CD43, indicating wild type origins (Figure 4.7B). Therefore, in this model, CD34 itself is essential for hematopoietic progenitor engraftment. 4.3 Discussion Despite the widespread use of CD34 as a selective marker of hematopoietic precursor cells over the last two decades, its function on hematopoietic cells has remained elusive. Here we have taken advantage of our observation that 155 CD34 is a marker of murine mast cells to address the hematopoietic function of this antigen. Our results provide compelling evidence that CD34, as well as the distantly-related sialomucin, CD43, are negative regulators of mast cell/mast cell progenitor adhesion in vitro and in vivo. 4.3.1 CD34 as blocker of differentiation, enhancer of proliferation, or homing receptor? The speculation in the literature that CD34, when expressed by hematopoietic cells, can act as a blocker of differentiation or enhancer of proliferation, stems from three observations. Firstly, CD34 is normally expressed at the highest levels by rapidly proliferating multipotent hematopoietic progenitors and is progressively lost as these mature (reviewed in Krause et al., 1996). Thus, its expression pattern correlates with a potential role in these processes. Secondly, one strain of cd34 knock-out mice was found to have a decreased number of progenitor cells in embryonic and adult tissues and adult-derived progenitor cells were somewhat defective in their ability to proliferate in vitro (Cheng et al., 1996). Finally, ectopic expression of CD34, in a myelomonocytic cell line that is inducible for macrophage differentiation (Ml ) , was shown to block terminal differentiation into macrophages, and to maintain cells in a highly proliferative "immature" state (although it was incapable of blocking the differentiation of two other differentiation-inducible cell lines (Fackler et al., 1995)). Although these experiments are indirect, they are consistent with a role for CD34 in maintaining hematopoietic progenitors in an undifferentiated state or in enhancing their proliferation prior to terminal differentiation. Our observation that cd34 ^ and wild type mast cells mature and differentiate at identical rates would argue strongly against a significant, global role for CD34 in these processes (Drew et al., 2002) (although a selective role in some lineages is still a formal possibility). Based on our observation that cells lacking CD34 tend to exhibit enhanced adhesion, we propose that the previous reports of an effect on proliferation and differentiation could reflect downstream effects due to inappropriate cell adhesion. 156 More recently it has been argued that CD34 may act as a specific BM homing receptor. This is based on the fact that, in short-term homing assays, cd34 ^ hematopoietic progenitors migrate poorly to the BM and tend to be recovered more frequently from the spleen than their wild type counterparts (Krause et al., 2001). However, the inability of cd34 ^ hematopoietic cells to home to the BM in short term assays (Krause et al., 2001), may, in fact, reflect increased adhesion of these cells in peripheral tissues (eg. the spleen) rather than the loss of a specific homing receptor. Our observation that terminally differentiated mast cells express high levels of CD34 (Drew eta / . , 2002), would argue strongly against a global role for this molecule as a specific, BM homing receptor. In mice, mast cell precursors leave the BM as undifferentiated progenitors prior to terminal differentiation into mature mast cells in the peripheral tissues (Galli, 2000). Since mature mast cells are virtually undetectable in adult mouse BM, the data do not support a role for CD34 in BM on mast cells. However, our observation that the absence of CD34 on hematopoietic progenitors prevents BM engraftment (Figure 4.7A and 4.7B), supports the possibility that CD34 is important for BM homing when it is expressed on progenitor cells. 4.3.2 CD34 as a pro-adhesion or an anti-adhesion molecule? Although there was initially speculation that CD34 could act as an anti-adhesion molecule, based on its similar structure to other anti-adhesion molecules, reciprocal expression with adhesion molecules and ultrastructural localization on endothelial cells (Delia et al., 1993), this hypothesis quickly lost favor with the discovery that, on high endothelial venules (HEV), CD34 acts as a pro-adhesive ligand for L-selectin (Baumhueter et al., 1993). Elegant experiments have shown that, when expressed by HEV, CD34 and its close relative, podocalyxin, undergo specific posttranslational modifications that endow them with the ability to bind to L-selectin expressed on the surface of migrating 157 lymphocytes (Baumhueter er al., 1993; Bistrup et al., 1999; Sassetti et al., 1998). This leads to lymphocyte tethering to this specialized endothelium, followed by integrin-dependent firm adhesion and extravasation into lymph nodes (Hickey er al., 2000). Based on these data, it has been proposed that CD34 may serve a similar function in tethering hematopoietic cells to the BM microenvironment. An important caveat to this hypothesis is that L-selectin binding to CD34 and podocalyxin is critically dependent upon the appropriate HEV-specific glycosylation of these antigens. Since these posttranslational modifications are exquisitely tissue specific and undetectable on CD34 or podocalyxin expressed by the vast majority of vascular endothelial cells or by hematopoietic cells, it is likely that CD34's pro-adhesive role on HEV is an important exception rather than the rule. Nevertheless, in apparent support of this "pro-adhesion hypothesis", several studies have shown that antibodies to human CD34 (and CD43) induce antigen capping and homotypic aggregation of CD34/CD43-expressing progenitor cells (Majdic et al., 1994; Tada et al., 1999). Although these results can be interpreted to suggest an activation-dependent adhesive function for CD34 we propose an equally plausible alternative hypothesis: capping of CD34/CD43 with bivalent antibodies leads to the "unmasking" of adhesion molecules and this results in cell aggregation. It is noteworthy that in these antibody crosslinking studies, homotypic aggregation required P2-integrin activation and divalent cations (Majdic et al., 1994)). Thus, it is likely that the local clearing of CD34 and CD43 in the plasma membrane leads to enhanced integrin function due to the unmasking of these molecules rather than pro-adhesive function conferred directly by CD34 and CD43. We have yet to clarify whether these molecules are responsible for the homotypic aggregation in cd34~^~ / cd43~^~ BMMC, but our observation that aggregation is divalent cation-dependent is consistent with this hypothesis (Leitinger e ta / . , 2000). 158 4.3.3 Function of CD34 and CD43 on mast cells and their progenitors The mechanistic details of mast cell progenitor migration remain to be clarified. However, there has been a recent demonstration that these cells require 04(37 integrin to home to the intestine and Mac-1 to home to the peritoneum (Gurish et al., 2001; Rosenkranz er al., 1998). Our results suggest that it is not only the presence of adhesion molecules that are important for the proper localization of mast cell progenitors to tissues, but also the presence of anti-adhesion molecules that prevent inappropriate adhesion during migration, and/or permit the initial release of mast cell precursors from the BM. Since cd34~^~', cd43~^~ and cd34~^~ / cd43 ^ mutant mice have normal numbers of tissue mast cells at steady state (Figure 4.5A), our data may suggest that mutant mast cell precursors have the ability to seed peripheral tissues during embryogenesis and that these precursors persist in the tissues to adulthood without a requirement for recolonization unless they are depleted. The ability of these precursors to seed peripheral tissues early in development could therefore reflect several factors including phenotypic difference between fetal and adult mast cell precursors (Rodewald et al., 1996) or differences in the mechanisms that allow colonization early in life. It has been previously shown, using chimeric mice, that in the adult, mast cell progenitors originate in the BM, migrate to the peritoneum and subsequently differentiate (Kanakura er al., 1988). Our results show a lack of peritoneal mast cell recovery in cd34~^~ / cd43~^~ mice, despite normal frequencies of BM MCp (Figure 4.5B and 4.5C), and suggest, that there is a defect in the migration of mast cell precursors to peripheral tissues in response to challenge. Furthermore, we have found that in vitro, mutant mast cells show no difference in the kinetics of maturation or viability (Drew et al., 2002 and data not shown), excluding the possibility that this observation is due to a defect in survival or differentiation. Together, our results support the hypothesis that 159 the impairment in peritoneal repopulation is due to retention of mutant precursors within the BM or inappropriate adhesion to the vasculature, thereby preventing these cells from reaching the peritoneal cavity. 4.3.4 The role of CD34 and CD43 in hematopoietic progenitor cell colonization of BM Intriguingly, we also found that, in a competitive BM reconstitution assay of W/W v mice, the resulting peritoneal mast cells were derived predominantly from wild type donors (Figure 4.7A and 4.7B). This observation could be due to a functional lesion at a variety of stages in mast cell development including: 1) a BM progenitor cell defect; 2) a mast cell lineage survival defect; or 3) a migratory defect of the mast cell progenitors. Our data, showing that under competitive and non-competitive conditions, cd34 ^ / cd43 ^ BM cells fail to reconstitute c-kit positive cells in the BM of W/W v mice (Figure 4.7A), fit most closely with the first hypothesis. Although we have not previously observed a significant defect in the ability of mutant cells to competitively reconstitute lethally irradiated wild type mice, the available niches in sub-lethally irradiated W/W v mice are more limiting, and therefore, would cause tight competition between the two donor populations. Our results suggest that wild type cells seed the BM more efficiently in the latter, more sensitive system. Interestingly, we found CD34 to be more important than CD43 for BM repopulation in this W/W v model (Figure 4.7B). While this explains the defect in mutant mast cell colonization of the peritoneum in this model, it also points to an important role of CD34 in hematopoietic progenitor cell engraftment of the BM and is consistent with a previous report showing impaired short term homing of cd34^ progenitors to the BM (Krause et al., 2001). It also closely correlates with the observed upregulation of CD34 in BM reconstitution 160 experiments (Sato et al., 1999). The decreased ability for cd34 cells to engraft could be due to: 1) increased inappropriate adhesion or 2) the requirement for CD34 binding an unknown ligand within the BM environment. However, since the loss of CD34 does not affect the ability of progenitor cells to bind P-/E-/or L-selectin (data not shown), this excludes these selectins as potential ligands for CD34 in this context. In light of our in vitro observations showing that CD34 and CD43 block mast cell adhesion and are required for optimal mast cell recovery after ablation, we propose a failure to block non-specific adhesion to be the most likely mechanism for impaired BM engraftment of mutant cells. Since W/W v mice are derived from a cross of WB/Re-kitW/+ and C57BL/kitWv/+ that have H2 b and H2 j haplotypes, respectively, they have a mixed H2 b / j haplotype (Tanzola et al., 2003) and W/W v T cells should not recognize BI/6 MHC as non-self. However, despite the presence of only "self" MHC molecules on BI/6 BM cells in W/W v recipients, it has been previously shown that parental strain BM cells undergo rejection in F l MHC hybrid recipients (Cudkowicz and Bennett, 1971). Accordingly, we did not observe 100% engraftment of transplanted BI/6 cells into W/W v mice, suggesting that the transplanted cells underwent some degree of rejection (data not shown). Since allogenic grafts are rejected in SCID mice, which lack T and B cells (Murphy et al., 1987), and depletion of host natural killer (NK) cells decreases rejection (Davenport et al., 1995), NK cells are deemed responsible for this response. Therefore, the sub-optimal level of reconstitution that we observed is likely due to NK cell-mediated rejection of BI/6 donors cells. This lack of engraftment was especially pronounced for cd34 ^ or cd34 ^ / cd43^ in the BM of W/W v mice, compared to wild type cells. Hence, it is 161 tempting to speculate that sialomucins may normally provide a protective function for NK cell-mediate lysis. However, since cd43^ cells reconstituted to the same level as wild type cells under competitive conditions, it is unlikely that this is the case. Furthermore, podo^' cells show superior engraftment to wild type cells in the same assay (data not shown). Therefore, there does not seem to be a protective function of sialomucins against NK cell activity and this does not likely account for the difference that we observe between cd34 ^ and wild type cells. In summary, our results show that CD34 and CD43 are important in preventing adhesion of mast cells in vitro and are important in the migration of their precursors to the peritoneum (Figure 4.7C). In addition, our results provide evidence for the importance of CD34 on BM stem cells, suggesting that under conditions of limited number of niches, these mutant cells are at a disadvantage compared to their wild type counterparts (Figure 4.7C). We propose that CD34, and its homologues, can act as both pro-adhesive and anti-adhesive molecules, depending on the context of their expression and posttranslational modifications (Doyonnas er al., 2001; Nielsen et al., 2002). In the specialized case of HEV, we propose that CD34 family members may have a dual function. As has been shown previously, these molecules may first act as pro-adhesives to tether lymphocytes to HEV via L-selectin recognition of HEV-specific glycosylations decorating CD34-type proteins (Baumhueter et al., 1993; Sassetti et al., 1998). Subsequently, these molecules may be induced to move to the junctions between vascular endothelial cells where they may act as anti-adhesives and aid in the disruption of cell-cell interactions, thereby enhancing lymphocyte extravasation. In support of this model, it has recently been shown that overexpression of one CD34 homologue, podocalyxin, in adherent monolayers leads to the disruption of adherens junctions (Takeda et al., 2000). Conversely, we have shown that deletion of this family member in mice leads to perinatal lethality due to enhanced adherens and tight junction 162 formation between kidney glomerular epithelial cells and excessive adhesion between mesothelial layers during embryogenesis (Doyonnas eta/ . , 2001). We propose that on mature hematopoietic cells and most vascular endothelia, CD34 and/or CD43 act as blockers of cell-cell interactions and prevent inappropriate adhesion by blocking the binding of adhesive molecules to adjacent cells via their bulky, highly negatively charged extracellular domains. On hematopoietic progenitors, these proteins may provide a means of releasing cells from one niche and allowing them to migrate to new microenvironmental niches for maturation or, in the most extreme cases (during embryogenesis or during mobilization of stem cells with G-CSF), endow these cells with the ability to enter the peripheral blood and seed new tissues. Our results provide the first demonstration to support the original, and largely abandoned hypothesis, that CD34 inhibits cellular adhesion (Delia et al., 1993) and represents the first definitive demonstration for the function of CD34 on hematopoietic cells both in vitro and in vivo. 4.4 Experimental Procedures 4.4.1 Mice All mice were maintained under pathogen-free conditions at the Biomedical Research Centre transgenic mouse unit and procedures involving mice were approved by the University of British Columbia Animal Care Committee. SJL -/-C57BI/6 and CD45.1 (BI/6 ) mice were used as wild type mice. Cd34 mice (on a C57BI/6 background) were kindly provided by Dr. T.W. Mak (Suzuki et al., 1996), and cd43~^ mice (also on a C57BI/6 background) were kindly provided by Dr. Blair Ardman (Carlow et al., 2001; Manjunath et al., 1995). Cd43^ mice were identified by CD43 cell surface staining of peripheral blood cells using anti-CD43 mAb S7 and flow cytometry (Carlow et al., 2001). Cd34~ 163 / cd43 double-deficient mice were generated by first crossing cd34 and cd43 ^ single-deficient mice to produce cd34+^ / cd43+^ F l heterozygotes and subsequently crossing siblings to generate double homozygous double-null mice. Female WBB6Fl/J-kitW/kitW-v(W/W v) mice were purchased from The Jackson Laboratory. 4.4.2 BM Derived Mast Cells BM was flushed from the femurs of homozygous mutant or wild type mice. Red blood cells were lysed using 0.1 M NH4CI, and the remaining cells were washed and resuspended in RPMI 1640 with penicillin/streptomycin, sodium pyruvate, glutamine (RPMI+), 10% fetal bovine serum and 16 U/ml IL-3 obtained from WEHI-3B conditioned media (Tsuji et al., 1991). Cells were transferred to new flasks periodically during culture to remove adherent cells and they were grown for a minimum of four weeks to allow for mast cell differentiation (Tsuji et al., 1991). 4.4.3 Nucleic Acid Analyses Genotypic analysis of wild type and cd34 ^ littermates were performed using ear punches digested with proteinase K in lysis buffer (50 mM Tris pH 8.0, 2 mM NaCI, 10 mM EDTA 1% SDS with 1 mg/ml proteinase K) at 55°C for 40 minutes. Tissue samples were then diluted with water, heated for 10 minutes at 100°C, then further diluted prior to use as a template for polymerase chain reactions (PCR). PCR was performed using the following primers (kindly provided by Dr. Stephane Corbel, Biomedical Research Centre, Vancouver Canada): forward 5'- CC ATCTTG G G CAC C ACTG GTTATT- 3' and reverse 5'-TCTTCCCAACAGCCATCAAGGTTC-3' for the wild type cd34 allele, and forward 5'-AG AACCTG CGTGC AATCC ATC- 3' and reverse 5'-164 CACTGTCCTGTCTAGGTTGAACC-3' for analysis of the neomycin cassette used for homologous recombination of the targeted locus (Suzuki et al., 1996). PCR was performed for 40 cycles of 94°C for 45 seconds, 58°C for 55 seconds and 72°C for 2 minutes. Products were resolved on a 2% agarose gel and were visualized using ethidium bromide. Wild type mice were identified by a 600 bp CD34 band but no neomycin band and cd34 ^ mice with no wild type CD34 band and a 1 kb neomycin-CD34 band. To generate full-length mouse CD34 expression constructs (CD34 F L ) , CD34 cDNA (the kind gift of Dr. Mel Greaves, Chester Beatty Laboratories, London, UK) was excised from pBluescript with NotI and Xhol and inserted into pMXpie (a kind gift of Dr. Alice Mui, Jack Bell Research Centre, Vancouver, Canada). The viral LTRs of this vector drive expression of CD34 and EGFP (enhanced green fluorescent protein) via a bicistronic mRNA containing an IRES element. C T To generate cytoplasmically-truncated CD34 (CD34 ) corresponding to the naturally occurring CD34 splice variant (Nakamura et al., 1993), PCR was performed using the following primers: forward-5'-ACGACTCACTATAGGGCGAAT-3' and reverse-5'-TGCTCTAG AATTC AAG GTTCC AG CTCCAGCCTTTCTCCTGTAG - 3' using the full-length CD34 cDNA in pBluescript as a template. Sequencing confirmed correct amplification of a cDNA with an identical coding sequence to this splice variant. The resulting band was excised, digested with Xhol and Xbal and was inserted into pBluescript KS+ which was subsequently cut with Xhol and NotI and the gene was inserted into the retroviral expression vector, pMXpie. CD43 was amplified from mouse kidney cDNA using the following primers: forward-5'-GTTAAACCACAAGATGGGCTTGGCAGTTGG-3' and reverse-5'-GTATGGATGGATGGATGGACGGATTTGGTC-3'. A Flag® sequence followed by two glycine residues and a Clal site was added after the signal peptide, and the fragment was cloned into pMXpie using BamHI and EcoRI. 165 4.4.4 Retroviral infections BOSC cells were transfected overnight with pclECO, using lipofectamine PLUS (Invitrogen), encoding for retroviral packaging proteins (Naviaux ef al., 1996), and either empty pMXpie-GFP vector or pMXpie-GFP co-expressing C D 3 4 F L , CD34 C T or CD43. BM was isolated the next day from cd34~/~, cd43~/~ or cd34~/~ / cd43 ^ mice and cultured overnight in RPMI+ with 15% fetal bovine serum, 8U/ml IL-3 (from WEHI-3B conditioned media), 10 ng/ml rmIL-6 (R&D) and 15% stem cell factor (SCF) conditioned media (from baby hamster kidney cells transfected with mouse SCF, kindly provided by Dr. Stephane Corbel, Biomedical Research Centre, Vancouver, Canada). The next day BOSC cells were irradiated with 5000 rads and 7 X 10 6 BM cells were added with 6 u.g/ml polybrene for two days. Finally, non-adherent cells were removed and replated in RPMI+ with 10% fetal bovine serum, 16 U/ml IL-3 from WEHI-3B conditioned media, to induce mast cell differentiation, and puromycin (0.8 fi-g/ml) was included to select for infected cells. To ensure ectopic gene expression, GFP-positive cells were sorted using a FACSVantage (Becton-Dickinson) and/or visualized by fluorescence microscopy (Olympus). Mast cell differentiation was confirmed by homogenous high expression of c-kit detected using flow cytometry (FACSCalibur, Becton-Dickinson) and exhibition of granules detected by staining cytospun cells with modified Giemsa (Diffquick). 4.4.5 Homotypic adhesion assays Homotypic adhesion was determined by counting the number of single cells and the number of cells in aggregates within a microscopic field of view. Percentage aggregation was calculated as the number of cells in aggregates (number of aggregates times the average number of cells per aggregate) over the total number of cells counted in each assay. For all aggregation assays, at 166 least 1500 cells were counted. For assessment of cation-dependence of cell aggregates, 1 mM EDTA (Disodium Ethylenediamine Tetraacetate, Fisher) and/or EGTA (Ethylenebis(oxyethylenenitrilo)-tetraacetic acid, Boehringer) were added to BMMC. For cell mixing experiments, cd34~^~ or cd34~^~ / cd43~^ BMMC were stained for 7 minutes at room temperature with 10 |a,M CSA-SE (SNARF-1 carboxylic acid, acetate, succinimidyl ester, Molecular Probes), washed three times in RPMI+ 10% FBS and then passed through a 26-gauge needle ten times to create a single cell suspension. These were then mixed - / - C T with GFP-positive cd34 mast cells ectopically expressing CD34 and were incubated overnight to allow the formation of cell aggregates. Cells were examined under an inverted fluorescence microscope (Olympus) using blue and green filters, to examine GFP-positive and CSA-SE stained cells, respectively. Digital photographs of fluorescent cells were taken with a Sensys l401E camera (Roper Scientific) using MetaVue (Universal Imaging Corporation) or RSImage Software. Images were formatted and figures were created using Adobe Photoshop® and Adobe Illustrator®. Blocking experiments were performed with antibodies towards p2 - / (M-integrins, ICAM-1 (10 u.l/ml, Pharmingen) and Sg lGSF (50 ^g /ml , kindly provided by Dr. Yukihiko Kitamura). Cells were treated with blocking antibodies overnight, after which, aggregation of cells was quantified. Isotype-matched hamster IgG2 (Pharmingen), rat IgG2b and rat I g G l (Cedarlane) were used at the appropriate concentrations for controls. 4.4.6 Fibronectin adhesion assay 24-well plates (Nunc) were coated overnight with 50 jig/ml fibronectin (Sigma) at 37°C. The next day, wells were washed with PBS and cells were washed with RPMI (no FBS) and cells were plated in triplicate in RPMI on the coated plates with no stimulation or with 100 nM TPA at 3 X 1 0 5 cel ls/ml. After 60 minutes, the number of suspension cells were counted using a hemocytometer and the percentage of adherent cells was calculated. 167 4.4.7 Histology To quantify the number of tissue mast cells, sections of ear and dermal skin and the intestine were prepared as follows. Hair was removed from the dermal skin with a depilatory cream, and skin sections were fixed in neutral buffered formalin or 3:1 methanokglacial acetic acid. Intestinal sections were fixed in 3:1 methanokglacial acetic acid, were sliced longitudinally and wrapped in a pinwheel manner. Tissues were embedded in paraffin, sectioned at 3u,m, deparaffinized, rehydrated and stained. Toluidine blue or Giemsa were used to detect CTMC, as described previously (Drew et al., 2002) and were identified as dark purple granular cells. Intestinal sections were stained with alcian blue (1% w/v in 0.7M HCI, pH 0.3) for 60 minutes and counterstained with safranin (0.5% w/v in 0.125M HCI, pH 1.0) for 30 seconds, as described previously (Madden et al., 1991) and MMC were identified as small alcian blue-positive cells. Sections were observed under a Zeiss Axioplan2 microscope and the number of mast cells per field of view (CTMC) or per villus (MMC) was determined. Peritoneal cells were harvested by peritoneal lavage using 10 ml FACS buffer (PBS, 10% FBS, 0.05% sodium azide) injected with a 26-gauge needle and harvested with an 18-gauge needle. Cells were cytocentrifuged, Giemsa stained and examined using a Zeiss Axioplan2 microscope. 4.4.8 Mast cell precursor limiting dilution analysis To assess the frequency of mast cell progenitors (MCp), a limiting dilution analysis was performed as previously described (Crapper and Schrader, 1983; Gurish et al., 2001). Briefly, BM was flushed and spleens were harvested using HBSS 2% FBS, from wild type, cd34~^~, cd43~^~ and cd34~/f~ I cd43^ mice. Spleens were broken up gently between frosted glass slides 168 and filtered. BM and spleen cells were then resuspended in 44% Percoll (Amersham) and overlayed on 67% Percoll and samples were spun for 20 minutes at 400 g at 4°C. The interface was harvested, washed and resuspended in medium (RPMI 1640, 10% FBS, glutamine, penicillin/streptomycin, sodium pyruvate, non-essential amino acids, lOmM HEPES, 2-mercaptoethanol). Cells were counted, serially diluted 2-fold, and 100 pi of each dilution (8 X 10 2-1 X 10 2 cells per well for BM cells and 8 X 3 3 10 -1 X 10 for splenic cells) was aliquoted into 96-well plates. Each well was supplemented with 10 5 irradiated wild type helper spleen cells (3000 rads) and 10 ng/ml rmIL-3 (R&D). Plates were incubated for 14 days, and were examined under an inverted microscope. MCp colonies were identified as non-adherent, medium-sized cells, as previously reported (Crapper and Schrader, 1983; Gurish et al., 2001) and the number of wells that contained one or more MCp colonies were scored as positive for each plate. The number of MNC plated that resulted in 37% of the wells negative for a MCp colony was estimated using the trend function on Microsoft Excel from the plot of the log of the fraction of non-responding cultures and the cell number plated. 4.4.9 Mast cell recovery Wild type and cd34 ^ , cd43 ^ and cd34 ^ / cd43 ^ mice were injected intraperitoneal^ with 3 ml sterile distilled water as previously described (Kanakura et al., 1988). For each genotype and time point, three to seven mice were evaluated (the sum of three separate experiments). At various time points after injection, mice were sacrificed and the peritoneal lavage was extracted (see above), cytospun and Giemsa stained. Greater than 1500 cells were counted blindly for each animal at each time point, using a Zeiss Axioplan2 microscope and the number of mast cells per mouse was quantified. 169 4.4.10 W / W v reconstitution BM was extracted from the femurs and tibias of wild type or CD45.1, cd34 ^ , cd43 ^ and cd34^ / cd43 ^ mice with a needle and syringe containing HBSS with 2% FBS. Red blood cells were lysed in 0.1M NH4CI and white blood cells were counted using a hemocytometer with eosin to exclude dead cells. W/W v mice were sublethally irradiated with 400 rads and injected intravenously with 1X10 7 wild type (or CD45.1) and 1X10 7 knock-out BM cells, mixed prior to injection, or 1X10 7 cd34 ^ / cd43 ^ cells alone. Mice were sacrificed 11-12 weeks after injection and were analyzed for donor-derived hematopoiesis. The degree of contribution by wild type and knock out donor cells was determined by assessing the number of c-kit-positive cells expressing CD34, CD43 and/or CD45.1 in the peritoneum and BM. C D 3 4 + and C D 4 3 + peritoneal mast cells resulting from competitive reconstitution were compared to mice that had been reconstituted with only C D 3 4 + or C D 4 3 + cells, to determine the relative contribution by wild type cells. The predicted equal contribution was determined as half of the number of cells expressing the antigen from mice reconstituted with C D 3 4 + or C D 4 3 + cells. Results were compared to the predicted equal contribution to determine if wild type cells contributed more than knock out cells to the resulting mast cell population, or to c-ki t + BM cells. 170 4.4.11 FACS Analysis BM and spleen cells underwent a red blood cell lysis procedure prior to staining (see above) and all samples were treated with ant i -CD16/32 (1 ucj/ml) (Cedarlane) to block FcyRII/III binding. Antibodies used were phycoerythrin-conjugated anti-c-kit (2 (ig/ml, Pharmingen), biotinylated-anti-CD43 ( S l l ) (Baecher-Allan et al., 1993) (3 (ig/ml, kindly provided by Wooseok Seo), biotinylated-anti-CD43 (S7) (5 ug/ml, Pharmingen), biotinylated-anti-CD34 (RAM34) (5 u.g/ml, Pharmingen) and FITC-conjugated anti-CD45.1 (2.5 ucj/ml, Pharmingen). Streptavidin-allophycocyanin was used to detect biotinylated antibodies (0.25 u.g/ml, Pharmingen). To verify that c-kit-positive peritoneal cells were mast cells, cells were double-stained with phycoerythrin-conjugated anti-c-kit, anti-dinitrophenyl-IgE (clone SPE-7) (Sigma) and FITC-anti-mouse IgE (Pharmingen). Staining was performed on ice in the dark for 15-30 minutes. Non-viable cells were gated out using 2 |ig/ml 7-aminoactinomycin D (Molecular Probes). Samples were TM analyzed using a FACSCalibur (Becton-Dickinson) and CellQuest or FlowJo software. 4.4.12 Statistical Analysis Data were analyzed for averages and standard deviations using Microsoft Excel. The measurement of statistical differences was evaluated using a two-sample unpaired student's t-test for unequal variances. Results were considered to be statistically significant for p<0.05(*) and p<0.01(**) . 4.5 A c k n o w l e d g e m e n t s The authors wish to thank Dr. Stephane Corbel for generation of cd34~^~ / cd43~^~ mice, Dr. Xuecui Guo for technical assistance with retroviral 171 4.5 Acknowledgements The authors wish to thank Dr. Stephane Corbel for generation of cd34^~ / cd43 ^ mice, Dr. Xuecui Guo for technical assistance with retroviral infections, Andrew Johnson for flow cytometry and Shierley Chelliah for help with genotypic analysis. We would also like to thank Julie Chow in the Department of Pathology and Laboratory Services at the University of British Columbia for paraffin embedding and sectioning of tissues and Dr. Yukihiko Kitamura for generously providing us with antibodies toward SglGSF. Lastly, we would like to extend our thanks to Dr. Michael Gurish for his technical advice for the limiting dilution analysis and Dr. Sebastian Furness for his critical evaluation of the manuscript. KMM is a Michael Smith Foundation for Health Research (MSFHR) and a Canadian Institute for Health Research (CIHR) Scholar and is a member of the Stem Cell Network Centre of Excellence. ED was supported by a Michael Smith Foundation for Health Research Trainee Scholarship and a Heart and Stroke Foundation Doctoral Scholarship. This work was funded by CIHR grant #117220 and #15477 and a grant in aid from the Heart and Stroke Foundation of British Columbia and the Yukon. 172 4.6 References Ardman, B., Sikorski, M. A., and Staunton, D. E. (1992). CD43 interferes with T-lymphocyte adhesion. Proc Natl Acad Sci U S A 89, 5001-5005. Baecher-Allan, C. M., Kemp, J. D., Dorfman, K. S., Barth, R. K., and Frelinger, J . G. (1993). Differential epitope expression of Ly-48 (mouse leukosialin). Immunogenetics 37, 183-192. Baumhueter, S., Singer, M., Henzel, W., Hemmerich, S., Renz, M., Rosen, S., and Lasky, L. A. (1993). Binding of L-selectin to the vascular sialomucin CD34. Science 262, 436. Benoist, C , and Mathis, D. (2002). Mast cells in autoimmune disease. Nature 420, 875-878. Benveniste, P., Cantin, C , Hyam, D., and Iscove, N. N. (2003). Hematopoietic stem cells engraft in mice with absolute efficiency. Nat Immunol 4, 708-713. Bhatia, M., Bonnet, D., Murdoch, B., Gan, O. I., and Dick, J. E. (1998). A newly discovered class of human hematopoietic cells with SCID- repopulating activity. Nat Med 4, 1038-1045. Bistrup, A., Bhakta, S., Lee, J. K., Belov, Y. Y., Gunn, M. D., Zuo, F. R., Huang, C. C , Kannagi, R., Rosen, S. D., and Hemmerich, S. (1999). Sulfotransferases of two specificities function in the reconstitution of high endothelial cell ligands for L-selectin. J Cell Biol 145, 899-910. Carlow, D. A., Corbel, S. Y., and Ziltener, H. J . (2001). Absence of CD43 fails to alter T cell development and responsiveness. J Immunol 166, 256-261. Cheng, J . , Baumhueter, S., Cacalano, G., Carver-Moore, K., Thibodeaux, H., Thomas, R., Broxmeyer, H. E., Cooper, S., Hague, N., Moore, M., and Lasky, 173 L. A. (1996). Hematopoietic defects in mice lacking the sialomucin CD34. Blood 87, 479-490. Crapper, R. M., and Schrader, J. W. (1983). Frequency of mast cell precursors in normal tissues determined by an in vitro assay: antigen induces parallel increases in the frequency of P cell precursors and mast cells. J Immunol 131, 923-928. Cudkowicz, G., and Bennett, M. (1971). Peculiar immunobiology of bone marrow allografts. II. Rejection of parental grafts by resistant F 1 hybrid mice. J Exp Med 134, 1513-1528. Dao, M. A., Arevalo, J . , and Nolta, J . A. (2003). Reversibility of CD34 expression on human hematopoietic stem cells that retain the capacity for secondary reconstitution. Blood 101, 112-118. Dastych, J . , Taub, D., Hardison, M. C , and Metcalfe, D. D. (1998). Tyrosine kinase-deficient Wv c-kit induces mast cell adhesion and chemotaxis. Am J Physiol 275, C1291-1299. Davenport, C , Kumar, V., and Bennett, M. (1995). Rapid rejection of H2k and H2k/b bone marrow cell grafts by CD8+ T cells and NK cells in irradiated mice. J Immunol 155, 3742-3749. Delia, D., Lampugnani, M. G., Resnati, M., Dejana, E., Aiello, A., Fontanella, E., Soligo, D., Pierotti, M. A., and Greaves, M. F. (1993). CD34 expression is regulated reciprocally with adhesion molecules in vascular endothelial cells in vitro. Blood 81, 1001-1008. Doyonnas, R., Kershaw, D. B., Duhme, C , Merkens, H., Chelliah, S., Graf, T., and McNagny, K. M. (2001). Anuria, omphalocele, and perinatal lethality in mice lacking the CD34- related protein podocalyxin. J Exp Med 194, 13-27'. 174 Drew, E., Merkens, H., Chelliah, S., Doyonnas, R., and McNagny, K. M. (2002). CD34 is a specific marker of mature murine mast cells. Exp Hematol 30, 1211. Fackler, M. J . , Krause, D. S., Smith, O. M., Civin, C. I., and May, W. S. (1995). Full-length but not truncated CD34 inhibits hematopoietic cell differentiation of M l cells. Blood 85, 3040-3047. Galli, S. J. (2000). Mast cells and basophils. Curr Opin Hematol 7, 32-39. Galli, S. J . , and Nakae, S. (2003). Mast cells to the defense. Nat Immunol 4, 1160-1162. Gratama, J. W., Sutherland, D. R., and Keeney, M. (2001). Flow cytometric enumeration and immunophenotyping of hematopoietic stem and progenitor cells. Semin Hematol 38, 139-147. Gurish, M. F., and Boyce, J. A. (2002). Mast cell growth, differentiation, and death. Clin Rev Allergy Immunol 22, 107-118. Gurish, M. F., Tao, H., Abonia, J . P., Arya, A., Friend, D. S., Parker, C. M., and Austen, K. F. (2001). Intestinal mast cell progenitors require CD49dbeta7 (alpha4beta7 integrin) for tissue-specific homing. J Exp Med 194, 1243-1252. Hasumura, M., Imada, C , and Nawa, K. (2003). Expression change of Flk-2/Flt-3 on murine hematopoietic stem cells in an activating state. Exp Hematol 31, 1331-1337. Hayashi, S., Kunisada, T., Ogawa, M., Yamaguchi, K., and Nishikawa, S. (1991). Exon skipping by mutation of an authentic splice site of c-kit gene in W/W mouse. Nucleic Acids Res 19, 1267-1271. Hickey, M. J . , Forster, M., Mitchell, D., Kaur, J . , De Caigny, C , and Kubes, P. (2000). L-selectin facilitates emigration and extravascular locomotion of 175 leukocytes during acute inflammatory responses in vivo. J Immunol 165, 7164-7170. Ito, A., Jippo, T., Wakayama, T., Morii, E., Koma, Y., Onda, H., Nojima, H., Iseki, S., and Kitamura, Y. (2003). SglGSF: a new mast-cell adhesion molecule used for attachment to fibroblasts and transcriptionally regulated by MITF. Blood 101, 2601-2608. Kanakura, Y., Kuriu, A., Waki, N., Nakano, T., Asai, H., Yonezawa, T., and Kitamura, Y. (1988). Changes in numbers and types of mast cell colony-forming cells in the peritoneal cavity of mice after injection of distilled water: evidence that mast cells suppress differentiation of bone marrow-derived precursors. Blood 71, 573-580. Kawakami, T., and Galli, S. J. (2002). Regulation of mast-cell and basophil function and survival by IgE. Nat Rev Immunol 2, 773-786. Krause, D. S., Fackler, M. J . , Civin, C. I., and May, W. S. (1996). CD34: structure, biology, and clinical utility. Blood 87, 1-13. Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O., Hwang, S., Gardner, R., Neutzel, S., and Sharkis, S. J. (2001). Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105, 369-377. Leitinger, B., McDowall, A., Stanley, P., and Hogg, N. (2000). The regulation of integrin function by Ca(2+). Biochim Biophys Acta 1498, 91-98. Madden, K. B., Urban, J . F., Jr., Ziltener, H. J . , Schrader, J. W., Finkelman, F. D., and Katona, I. M. (1991). Antibodies to IL-3 and IL-4 suppress helminth-induced intestinal mastocytosis. J Immunol 147, 1387-1391. Majdic, O., Stockl, J . , Pickl, W. F., Bohuslav, J . , Strobl, H., Scheinecker, C , Stockinger, H., and Knapp, W. (1994). Signaling and induction of enhanced 176 cytoadhesiveness via the hematopoietic progenitor cell surface molecule CD34. Blood 83, 1226-1234. Manjunath, N., Correa, M., Ardman, M., and Ardman, B. (1995). Negative regulation of T-cell adhesion and activation by CD43. Nature 377, 535-538. Mekori, Y. A., and Metcalfe, D. D. (2000). Mast cells in innate immunity. Immunol Rev 173, 131-140. Migliaccio, A. R., Carta, C , and Migliaccio, G. (1999). In vivo expansion of purified hematopoietic stem cells transplanted in nonablated W/Wv mice. Exp Hematol 27, 1655-1666. Murphy, W. J . , Kumar, V., and Bennett, M. (1987). Rejection of bone marrow allografts by mice with severe combined immune deficiency (SCID). Evidence that natural killer cells can mediate the specificity of marrow graft rejection. J Exp Med 165, 1212-1217. Nakamura, Y., Komano, H., and Nakauchi, H. (1993). Two alternative forms of cDNA encoding CD34. Exp Hemat 21, 236-242. Naviaux, R. K., Costanzi, E., Haas, M., and Verma, I. M. (1996). The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. J Virol 70, 5701-5705. Nielsen, J. S., Doyonnas, R., and McNagny, K. M. (2002). Avian models to study the transcriptional control of hematopoietic lineage commitment and to identify lineage-specific genes. Cells Tissues Organs 171, 44-63. Nocka, K., Tan, J. C , Chiu, E., Chu, T. Y., Ray, P., Traktman, P., and Besmer, P. (1990). Molecular bases of dominant negative and loss of function mutations at the murine c-kit/white spotting locus: W37, Wv, W41 and W. Embo J 9, 1805-1813. 177 Ogawa, M. (2002). Changing phenotypes of hematopoietic stem cells. Exp Hematol 30, 3-6. Ostberg, J. R., Barth, R. K., and Frelinger, J . G. (1998). The Roman god Janus: a paradigm for the function of CD43. Immunol Today 19, 546-550. Rodewald, H. R., Dessing, M., Dvorak, A. M., and Galli, S. J. (1996). Identification of a committed precursor for the mast cell lineage. Science 271, 818-822. Rosenkranz, A. R., Coxon, A., Maurer, M., Gurish, M. F., Austen, K. F., Friend, D. S., Galli, S. J . , and Mayadas, T. N. (1998). Impaired mast cell development and innate immunity in Mac-1 (CD l lb /CD18 , CR3)-deficient mice. J Immunol 161, 6463-6467. Sassetti, C , Tangemann, K., Singer, M. S., Kershaw, D. B., and Rosen, S. D. (1998). Identification of podocalyxin-like protein as a high endothelial venule ligand for L-selectin: parallels to CD34. J Exp Med 187, 1965-1975. Sassetti, C , Van Zante, A., and Rosen, S. D. (2000). Identification of endoglycan, a member of the CD34/podocalyxin family of sialomucins. J Biol Chem 275, 9001-9010. Sato, T., Laver, J . H., and Ogawa, M. (1999). Reversible expression of CD34 by murine hematopoietic stem cells. Blood 94, 2548-2554. Smith, T. J . , and Weis, J . H. (1996). Mucosal T cells and mast cells share common adhesion receptors. Immunol Today 17, 60-63. Suzuki, A., Andrew, D. P., Gonzalo, J. A., Fukumoto, M., Spellberg, J . , Hashiyama, M., Takimoto, H., Gerwin, N., Webb, I., Molineux, G., et al. (1996). CD34-deficient mice have reduced eosinophil accumulation after allergen exposure and show a novel crossreactive 90-kD protein. Blood 87, 3550-3562. 178 Tada, J . , Omine, M., Suda, T., and Yamaguchi, N. (1999). A common signaling pathway via Syk and Lyn tyrosine kinases generated from capping of the sialomucins CD34 and CD43 in immature hematopoietic cells. Blood 93, 3723-3735. Takeda, T., Go, W. Y., Orlando, R. A., and Farquhar, M. G. (2000). Expression of podocalyxin inhibits cell-cell adhesion and modifies junctional properties in madin-darby canine kidney cells [In Process Citation]. Mol Biol Cell 11, 3219-3232. Tanzola, M. B., Robbie-Ryan, M., Gutekunst, C. A., and Brown, M. A. (2003). Mast cells exert effects outside the central nervous system to influence experimental allergic encephalomyelitis disease course. J Immunol 171, 4385-4391. Tsuji, K., Zsebo, K. M., and Ogawa, M. (1991). Murine mast cell colony formation supported by IL-3, IL-4, and recombinant rat stem cell factor, ligand for c-kit. J Cell Physiol 148, 362-369. Vecchini, F., Patrene, K. D., and Boggs, S. S. (1993). Purified murine hematopoietic stem cells function longer on nonirradiated W41/Wv than on +/+ irradiated stroma. Blood 81, 1489-1496. Walker, J . , and Green, J . M. (1999). Structural requirements for CD43 function. J Immunol 162, 4109-4114. Waskow, C , Terszowski, G., Costa, C , Gassmann, M., and Rodewald, H. R. (2004). Rescue of lethal c-KitW/W mice by erythropoietin. Blood 104, 1688-1695. Williams, C. M., and Galli, S. J. (2000). The diverse potential effector and immunoregulatory roles of mast cells in allergic disease. J Allergy Clin Immunol 105, 847-859. 179 Zanjani, E. D., Almeida-Porada, G., Livingston, A. G., Zeng, H., and Ogawa, M (2003). Reversible expression of CD34 by adult human bone marrow long term engrafting hematopoietic stem cells. Exp Hematol 31, 406-412. 180 Chapter 5 CD34 and CD43 are not required for reconstitution of lethally irradiated recipients 5.1 Introduction CD34 is routinely used to purify HPC and HSC (Gratama etal., 2001), but its function on these cells is unknown. Our results showing that there is increased adhesion of mast cells in the absence of CD34 or CD43 (see Chapter 3), suggests that CD34 (and CD43) may also modulate adhesion of hematopoietic progenitors and alter their ability to reconstitute hematopoiesis. CD34 has been shown to be expressed by activated stem cells, and mobilized HPC (Sato er al., 1999; Tajima et al., 2000). Mobilization causes release of cytokines and proteases that disrupt the interaction of stem cells and the BM niche (Levesque et al., 2004; Papayannopoulou, 2004) and causes downregulation of a2, a4 and (31 integrins on HSC (Wagers et al., 2002). Since CD43 promotes detachment from high endothelial venules and negatively regulates T cell tethering by L-selectin in vivo (Stockton et al., 1998), it has been hypothesized that the interaction of cellular interactions require an equilibrium between pro- and anti-adhesion molecules. Therefore, since adhesion molecules such as c-kit, integrins and CD44 are required on stem cells to home to and be retained in the BM niche (Nilsson etal., 2003; Whetton and Graham, 1999; Wright etal., 2001), it is plausible that anti-adhesion molecules regulate these interactions and promote "deadhesion" from the BM in response to signals for HSC mobilization/migration. 181 Although cd34~/~ mice exhibit a normal ability of endogenous progenitors to reconstitute hematopoiesis after sublethal irradiation, the ability of CD34-deficient cells to reconstitute hematopoiesis competitively with wild type cells has never been examined in lethally irradiated recipients. Similarly, the role of CD43 in hematopoietic engraftment has not been previously reported. To this end, we lethally irradiated and reconstituted mice with wild type and cd34/~, cd43~/~ or cd34~/~ / cd43'/~ BM and assessed the frequency of cells from each donor population at various time points. To distinguish between donors and recipients, we utilized GFP mice and mice with different alleles of the cell surface pan-hematopoietic marker, CD45: CD45.1 and CD45.2 (van Os et al., 2001). We also assessed the degree of contribution to myeloid and lymphoid lineages in order to determine if KO cells preferentially gave rise to a particular lineage. Our results suggest that despite the role of CD34 and CD43 on mast cells, these molecules are not essential for the engraftment of lethally irradiated recipients. We were surprised to find, however, a selective advantage of CD45.2 cells over CD45.1 donor cells, regardless of their CD34/CD43 genotype. In addition, we found increased contribution of CD45.1 cells to the T cell lineage and decreased contribution of these cells to the B cell lineage. 5.2 Results and Discussion 5.2.1 CD34KO and CD34/CD43 DKO BM cells reconstitute hematopoiesis under competitive conditions in lethally irradiated recipients To determine if CD34 and CD43 alter the engraftment ability of HPC/HSC, we isolated BM from CD45.1GFP wild type mice, cd34~/~ and cd34~/~ / cd43'/' 182 mice (CD45.2) and FACS sorted S c a - 1 + HPC to competitively reconstitute lethally irradiated CD45.1 mice. CD45.1GFP mice showed 100% expression of GFP in hematopoietic cells (data not shown). Wild type CD45.1GFP and either cd34v~ or cd34~/~ / cd43~/~ce\\s were mixed at a 1:1 ratio and 1.5 X 10 4 cells were injected into lethally irradiated CD45.1 recipients. Sca-1" helper CD45.1 BM cells (3.75 X 105) were co-injected with the donor cells to allow survival of the recipients prior to the expansion of the Sca -1 + stem cell fraction donor cells (Figure 5.1A). We also performed competitive reconstitution assays with unfractioned BM from CD45.1GFP wild type and either cd34'/' or cd34v~ / cd43'/' mice into CD45.1 irradiated recipients (Figure 5.IB). Mice were bled at various time points after injection and the degree of donor chimerism was determined (Figure 5.1 A and B). Wild type donor cells were identified as GFP + and KO donors by expression of CD45.2. For mice competitively reconstituted with Sca -1 + cells, there was slightly higher contribution by CD45.1GFP wild type cells, but this difference was not statistically significant (Figure 5.1A). However, when unfractioned BM was used, there was a dramatic decrease in the ability of CD45.1GFP wild type cells to contribute to hematopoiesis (Figure 5.IB) (p<0.0005 at week 18). Importantly, when CD45.2 wild type BM was competed with CD45.1 wild type BM, the CD45.2 BM showed similar reconstitution to KO cells (Figure 5.IB), suggesting that this difference is irrespective of the CD34/CD43 genotype. Rather, it suggests that CD45.1 cells are defective in their ability to compete with CD45.2 for engraftment. The percentage of donor cells did not always add up to 100% due to the prescence of a significant number of endogenous hematopoietic cells. Competition of Sca -1 + and unfractioned BM were each performed in two independent experiments. 183 100 4 6 8 10 12 17 Week 100 4 6 8 10 12 1 8 / 1 9 Week 1 00 5 12 16 Week Figure 5.1 Model of competitive reconstitution of lethally irradiated mice and analysis of donor engraftment. A) Lethally irradiated CD45.1 mice were reconstituted with CD45.1GFP Sca-1 + and either CD34KO, CD34/CD43 DKO CD45.2 Sca-1 + bone marrow cells, along with CD45.1 (non-GFP) Sca-1" helper cells. Mice were bled at various time points and the number of GFP+ wild type and CD45.2+ KO cells were determined using flow cytometry. B) CD45.1 mice were reconstituted with CD45.1 GFP and either wild type, CD34KO, CD34/CD43 DKO CD45.2 unfractioned bone marrow cells. Mice were bled at various time points and the number of GFP+ wild type and CD45.2+ KO cells were determined using flow cytometry. C) CD45.1GFP mice were reconstituted with CD45.1 (non-GFP) and either CD34KO, CD43KO, CD34/CD43 DKO CD45.2 unfractioned bone marrow cells. Mice were bled at various time points and the number of CD45.1+ (non-GFP) wild type and CD45.2+ KO cells were determined using flow cytometry. One possible explanation for the decreased engraftment by CD45.1GFP cells is that CD45.1 mice have a decreased number of HPC. Thus, an equal number of BM cells from these mice would have less progenitor cells than their CD45.2 counterpart. Alternatively, GFP could be slightly toxic to the wild type cells and decrease their ability to reconstitute. Our results suggest 184 that the loss of CD34 or CD43 does not affect the ability of cell to contribute to hematopoiesis in a highly selective lethal irradiation assay. To find out the effect of GFP on reconstitution, we used CD45.1GFP mice as recipients, rather than donors (Figure 5.1C). Mice were reconstituted competitively with CD45.1 (non-GFP) wild type and cd34~/~, cd43~/~ or cd34~/~ I cd43~/~ CD45.2 unfractioned BM. Wild type cells were identified as CD45.1 +GFP" with KO cells identified as CD45.2 + cells. Again, we observed a competitive advantage of CD45.2 cells, although this was not statistically significant (which may reflect the limited number of mice used). We therefore concluded that the enhanced engraftment of CD45.2 cells is at least partly due to differences between CD45.2 and CD45.1 mice, be that CD45.1 itself, or another gene mutation that hinders their ability to contribute to hematopoiesis. This gene may be in close proximity to the CD45.1 allele, and may have not undergone mitotic cross-over during backcrossing of these mice. Since CD45.2 cells did not show a significant advantage over CD45.1 cells in this model (Figure 5.1C), the presence of GFP in CD45.1 donor cells in the previous models (Figure 5.1 A and B) may be at least partially responsible for their decreased ability to reconstitute, due to cellular toxicity. 5.2.2 Loss of CD34 or CD43 does not cause a selective advantage to reconstitution of particular hematopoietic lineages To determine whether CD34 and/or CD43 provide a selective advantage for engraftment to a particular hematopoietic lineage, donor cells were gated and analyzed for their contribution to lymphoid and myeloid lineages. We used CD4 and CD8 as markers of the T cell lineage, Gr-1 and Mac-1 as markers of the myeloid lineage, and B220 as a marker of B cells (Klug et al., 1998). The reconstitution capacity of myeloid cells was similar for both donors in all mice examined; however, we observed that CD45.2 cells 185 contributed more often to CD4 and CD8 lineages and less often to B220 cells. This was true for CD45.1 mice reconstituted with Sca -1 + or unfractioned BM (Figure 5.2A and B). Since competition of wild type CD45.1GFP and wild type CD45.2 cells also showed this trend (Figure 5.2B), our results suggest that this phenomenon is due to differences between these two strains and does not reflect differences due to the loss of CD34 and/or CD43. Since CD45.1GFP mice reconstituted with non-GFP CD45.1 wild type and CD45.2 KO cells showed the same results (at least for CD4 and CD8 cells) (Figure 5.2C), the effect of GFP on the ability of cells to contribute to lymphoid cells seems minimal. Therefore, our attempt to reveal the function of CD34 and CD43 in hematopoietic reconstitution of lethally irradiated recipients was confounded by the differential engraftment abilities of CD45.1 and CD45.2 BM. Our results lend support to a previous observation that engraftment by CD45.1 cells in CD45.2 recipients leads to lower levels of engraftment than a mismatched intracellular marker, probably due to an immune related response (van Os et al., 2001). This disparity was reduced when higher levels of irradiation and numbers of donor cells were used, which may dampen the immune response (van Os et al., 2001). However, since the reconstitution with wild type CD45.2 cells under competitive conditions with wild type CD45.1 cells, showed similar contribution to various lineages to KO cells, under the same conditions, we have indirectly demonstrated that neither CD34 nor CD43 affect reconstitution of lethally irradiated mice under competitive conditions with wild type cells. Our results support the observations that mice with mutations in CD34 or CD43 develop normally and display normal hematopoiesis (Manjunath et al., 1995; Suzuki et al., 1996) and that cd34~/~ mice are able to recover normally from sub-lethal irradiation, despite the reported decrease of hematopoietic progenitors (Cheng et al., 1996). It is important to note that another KO 186 O DO > Figure 5.2 The contribution to hematopoietic lineages by wild type CD45.1 and KO CD45.2 donor cells. Wild type donor cells were gated (GFP+ for A and B or CD45.1 + GFP" for C) and KO cells were gated :;: (CD45.2+). The degree of contribution by each donor population is shown as a percentage of the total lineage population. Reconstituted mice were analyzed for donor contribution of T cells (CD4, CD8), myeloid cells (Gr-1, Mac-1) and B cells (B220). A) Sca-1+CD45.1 GFP wild type and either CD34KO or CD34/CD43 DKO CD45.2 BM were used as donor cells. B) Unfractionated CD45.1 GFP wild type and either CD34KO or CD34/CD43 DKO CD45.2 BM were used as donor cells. C) Unfractionated CD45.1 (non-GFP) wild type and either CD34KO, CD43KO or CD34/CD43 DKO CD45.2 BM were used as donor cells. mouse for CD34 did not have a decreased number of hematopoietic progenitors (Suzuki et al., 1996). It is unclear what the reasons are for these different observations. In sublethally irradiated W/W v recipients (Chapter 3) we found that the absence of CD34 prevented hematopoietic reconstitution under competitive conditions with wild type BM cells. Furthermore, the absence of CD34 and CD43 prevented reconstitution under non-competitive conditions. The mechanisms leading to the different outcomes in these assays is uncertain, however, it may be due to the limiting number of niches available in the second system, compared to the presumed abundance of niches created under lethal irradiation conditions. Alternatively, the amount of irradiation could have affected the recruitment of wild type and KO HPC. Total body irradiation causes endothelial breakdown and HPC use different molecules for rolling and sticking to non-irradiated and irradiated BM microvessels (Mazo et al., 2002). Therefore, if CD34 and CD43 prevent adhesion and facilitate migration, as has been shown for CD43 in other contexts (Woodman et al., 1998) the anti-adhesion function of these molecules may be overridden in the event of endothelial breakdown. Therefore, in the lethal irradiation model, HPC would be able to easily cross the endothelial barrier despite their CD34/CD43 phenotype. However, in the context of W/W v sublethal irradiation, the endothelial barrier is presumably more intact and HPC wild type cells may be more able to migrate into the BM extravascular region. Thus, CD34 and CD43 may be important in regulating the migration of HSC to their BM niche, however, in 188 the context of severe irradiation induced damage these molecules may no longer be required to serve their normal function. This study provides an important subtlety to the study of CD34 and CD43 in hematopoietic recovery since they show normal or supernormal survival and reconstitution to wild type cells in lethal assays. Therefore, the absence of reconstitution in the W/W v recipients appears to be due to a homing defect, rather than cell survival. 5.3 Experimental Procedures 5.3.1 Mice The following mice were used in experiments: BI/6 S J L (non-GFP and GFP) (CD45.1 wild type) (the latter kindly provided by Dr. Fabio Rossi), C57BI/6 (CD45.2 wild type), cd34~,~ (kindly provided by Dr. Tak Mak) (Suzuki et al., 1996), cd43~/~ (generated by Dr. Blair Ardman (Manjunath et al., 1995)) and cd34~/~/cd43~/~ (generated by Dr. Stephane Corbel). All mice were kept in the transgenic facility at the Biomedical Research Centre and procedures involving mice were approved by the University of British Columbia Animal Care Committee. 5.3.2 Sca-1 enrichment and depletion Mice for donor BM were sacrificed using CO2. BM was isolated from mice using a needle and syringe in HBSS with 2% FBS. Red blood cells were lysed using 0.1M NH4CI for 2 minutes at 37°C. For Sca-1 enrichment, BM cells were stained with anti-Sca-l-PE (Pharmingen, 2 |xg/ml) and Sca -1 + or Sca-1 + GFP + were sorted using a FACSVantage (Beckton-Dickinson). For helper cells, CD45.1 BM was stained with anti-Sca-l-PE and anti-PE magnetic beads (Miltenyi Biotec, 100>l per sample). Staining was performed for 15 minutes at 4°C. Sca-1 cells were depleted twice using the AutoMACS 189 program DEPLETE-S (Miltenyi Biotec). Depletion of Sca -1 + cells was checked using flow cytometry. 5.3.3 Competitive Reconstitution For Sca -1 + competition, 7.5 X 10 3 CD45.1 Sca-1 + GFP + and 7.5 X 10 3 KO Sca-1 + BM cells were mixed and injected intravenously into lethally irradiated (900 rads) CD45.1 recipients in 200 ul PBS with 3.75 X 10 5 Sca-1" CD45.1 helper cells. For unfractioned BM, 5 X 10 5 CD45.1 (GFP or non-GFP) were mixed with an equal number of KO CD45.2 cells and injected into irradiated CD45.1 or CD45.1GFP recipients. Mice were bled into PBS with ImM EDTA at various time points after reconstitution. Red blood cells were lysed using 0.1M NH4CI for 2 minutes at 37°C prior to staining. 5.3.4 Antibodies and Flow cytometry The following antibodies were used to analyze reconstituted CD45.1 (non-GFP) recipients: anti-CD45.2-phycoerythrin (Pharmingen, 2 ug/ml), anti-CD4-biotin (Pharmingen, 5 [xg/ml), anti-CD8a-allophycocyanin (Cedarlane, 2 ug/ml), anti-Gr-l-biotin (BRC, 10 ug/ml), anti-Mac-l-biotin (BRC, 10 ug/ml) and anti-B220-biotin (Pharmingen, 5 ug/ml). Biotinylated antibodies were detected by coupling to Streptavidin-allophycocyanin (Pharmingen, 0.25 ug/ml). 7AAD (2 ug/ml) was used to exclude dead cells from analysis. The following antibodies were used to analyze reconstituted CD45.1 (GFP) recipients: anti-CD45.1-phycoerythrin (1 ug/ml), anti-CD45.2-allophycocyanin (BD Bioscience, 1 ug/ml), anti-CD4-biotin (Pharmingen, 5 ug/ml), anti-CD8a-biotin (Cedarlane, 2 ug/ml), anti-Gr-l-biotin (BRC, 10 ug/ml), anti-Mac-l-biotin (BRC, 10 ug/ml) and anti-B220-biotin (Pharmingen, 5 ug/ml). Biotinylated antibodies were detected by coupling to 190 streptavidin-CyChrome (Pharmingen, 1:400). Dead cells were excluded using forward and side scatter rather than 7AAD. Cells were stained on ice for 15-30 minutes and were acquired using a FACSCalibur (Beckton-Dickinson). Analysis was performed with CellQuest software. 5.3.5 Statistical Analyses The difference between two groups was determined to be significantly different by a two-tailed t-test for unequal variances p<0.05. 5.4 Acknowledgements I would like to thank Lesley So, Stephane Corbel, Dr. Fabio Rossi, Jasmeen Merzaban and Dr Hermann Zilterener for their generosity in sharing different antibodies for flow cytometry and for technical advice. I would also like to thank May Kazem, Poh Tan, Leisha Leclair and Shierley Chelliah for help with irradiating and bleeding mice. 191 5.5 References Cheng, J . , Baumhueter, S., Cacalano, G., Carver-Moore, K., Thibodeaux, H., Thomas, R., Broxmeyer, H. E., Cooper, S., Hague, N., Moore, M., and Lasky, L. A. (1996). Hematopoietic defects in mice lacking the sialomucin CD34. Blood 87, 479-490. Gratama, J. W., Sutherland, D. R., and Keeney, M. (2001). Flow cytometric enumeration and immunophenotyping of hematopoietic stem and progenitor cells. Semin Hematol 38, 139-147. Klug, C. A., Morrison, S. J . , Masek, M., Hahm, K., Smale, S. T., and Weissman, I. L. (1998). Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes. Proc Natl Acad Sci U S A 95, 657-662. Levesque, J. P., Liu, F., Simmons, P. J . , Betsuyaku, T., Senior, R. M., Pham, C , and Link, D. C. (2004). Characterization of hematopoietic progenitor mobilization in protease-deficient mice. Blood 104, 65-72. Manjunath, N., Correa, M., Ardman, M., and Ardman, B. (1995). Negative regulation of T-cell adhesion and activation by CD43. Nature 377, 535-538. Mazo, I. B., Quackenbush, E. J . , Lowe, J. B., and von Andrian, U. H. (2002). Total body irradiation causes profound changes in endothelial traffic molecules for hematopoietic progenitor cell recruitment to bone marrow. Blood 99, 4182-4191. Nilsson, S. K., Haylock, D. N., Johnston, H. M., Occhiodoro, T., Brown, T. J . , and Simmons, P. J. (2003). Hyaluronan is synthesized by primitive hemopoietic cells, participates in their lodgment at the endosteum following transplantation, and is involved in the regulation of their proliferation and differentiation in vitro. Blood 101, 856-862. Papayannopoulou, T. (2004). Current mechanistic scenarios in hematopoietic stem/progenitor cell mobilization. Blood 103, 1580-1585. 192 Sato, T., Laver, J . H., and Ogawa, M. (1999). Reversible expression of CD34 by murine hematopoietic stem cells. Blood 94, 2548-2554. Stockton, B. M., Cheng, G., Manjunath, N., Ardman, B., and von Andrian, U. H. (1998). Negative regulation of T cell homing by CD43. Immunity 8, 373-381. Suzuki, A., Andrew, D. P., Gonzalo, J. A., Fukumoto, M., Spellberg, J . , Hashiyama, M., Takimoto, H., Gerwin, N., Webb, I., Molineux, G., et al. (1996). CD34-deficient mice have reduced eosinophil accumulation after allergen exposure and show a novel crossreactive 90-kD protein. Blood 87, 3550-3562. Tajima, F., Sato, T., Laver, J . H., and Ogawa, M. (2000). CD34 expression by murine hematopoietic stem cells mobilized by granulocyte colony-stimulating factor. Blood 96, 1989-1993. van Os, R., Sheridan, T. M., Robinson, S., Drukteinis, D., Ferrara, J . L., and Mauch, P. M. (2001). Immunogenicity of Ly5 (CD45)-antigens hampers long-term engraftment following minimal conditioning in a murine bone marrow transplantation model. Stem Cells 19, 80-87. Wagers, A. J . , Allsopp, R. C , and Weissman, I. L. (2002). Changes in integrin expression are associated with altered homing properties of Lin(-/ lo)Thyl.l( lo)Sca-l(+)c-kit(+) hematopoietic stem cells following mobilization by cyclophosphamide/granulocyte colony-stimulating factor. Exp Hematol 30, 176-185. Whetton, A. D., and Graham, G. J . (1999). Homing and mobilization in the stem cell niche. Trends Cell Biol 9, 233-238. Woodman, R. C , Johnston, B., Hickey, M. J . , Teoh, D., Reinhardt, P., Poon, B. Y., and Kubes, P. (1998). The functional paradox of CD43 in leukocyte recruitment: a study using CD43-deficient mice. J Exp Med 188, 2181-2186. Wright, D. E., Cheshier, S. H., Wagers, A. J . , Randall, T. D., Christensen, J. L., and Weissman, I. L. (2001). Cyclophosphamide/granulocyte colony-stimulating factor causes selective mobilization of bone marrow hematopoietic stem cells into the blood after M phase of the cell cycle. Blood 97, 2278-2285. Chapter 6 Summary and perspectives The data summarized in this thesis shed light on two commonly held assumptions in the literature for CD34 distribution and function: firstly, that it is restricted to progenitor cells in the hematopoietic compartment (Krause et al., 1996), and secondly, that its only known function is as an adhesive ligand (Baumhueter et al., 1994). These assumptions have blinded researchers to the possibility that CD34 is expressed on mature hematopoietic cells and that it may not function as an adhesive ligand on hematopoietic cells. Here, we have shown that CD34 is a marker of mature murine, but not human mast cells (Chapter 2 and 3), that CD34 and CD43 block mast cell adhesion and that their absence prevents mast cell reconstitution (Chapter 4). In addition, we have shown that neither of these molecules are required for hematopoietic reconstitution of lethally irradiated mice under competitive conditions with wild type cells (Chapter 5), but that in more subtle reconstitution assays in W/W v mice, they play an essential role (Chapter 4). 6.1 CD34 on mature mast cells Chapter 2 shows that, despite the expression of CD34 on hematopoietic progenitor cells and reported absence on mature hematopoietic cells (Cheng etal., 1996; Felschow etal., 2001; Krause etal., 1994; Majdic et al., 1994; Wood et al., 1997), CD34 mRNA was not detected in many hematopoietic progenitor cell lines and was detected at high levels by cultured mast cells. This was shown to be physiologically relevant in vivo, since isolated mature peritoneal mast cells high expression of CD34. Therefore, mast cells and their progenitors, express CD34, Sca-1 and c-kit, all markers of at least some HSC. In addition, mast cells do not express lineage markers used for 194 the depletion of mature cells. These results reveal the previously unrecognized antigenic similarities between mast cells, MCp and HSC. This observation has led to the initiation of a collaboration with the Stem Cell Network to try to identify cell surface molecules to distinguish between mast cells, MCp and HSC. Jamie Haddon, a graduate student in our lab is currently performing microarray analyses to find differential gene expression between these populations. Jamie is also producing antibodies against mast cells and MCp to develop reagents to separate mast cells from their progenitors in hopes to identify and isolate the elusive adult MCp. Interestingly, the expression of CD34 by mature human mast cells has not been observed. This is based on three lines of evidence: firstly, cultured human mast cell cultures downregulate this protein upon maturation (Welker er al., 2000); second, CD34 has not been detected in tissue mast cells using histochemistry (Valent et al., 2001), and thirdly, BMMC derived from transgenic mice expressing human CD34 and the flanking regions required for its regulation (Okuno er al., 2002), do not express CD34 (Chapter 3). Our results showing the absence of hCD34 on mast cells suggests differential regulation of this gene between these two species. Functionally, if CD34 is involved in allowing the migration of mast cell precursors to travel from the BM to the tissues, as our results suggest in Chapter 4, the absence of CD34 on mature human mast cells may be irrelevant. It is known that mast cells travel as immature cells, and human mast cell precursors are known to express CD34 (Rottem er al., 1994; Welker er al., 2000). Therefore, the absence of CD34 on mature mast cells should not affect their localization. It is unclear why human, but not mouse CD34 is downregulated upon differentiation, and it would be of interest to find out which regulatory elements are responsible for this differential expression in mast cells. 195 6.2 The paradox: CD34 preventing adhesion The observation that mast ceils express CD34, allowed us to use these cells to study the function of this protein. Prior to this observation, studies on CD34 relied on cell lines that may not reflect the phenotype and behavior of normal cells, or rare HPC that are hard to isolate and study. To further obscure studying CD34, many HPC co-express podocalyxin that may functionally compensate for the loss of CD34 (Doyonnas et al., 2001). Since mast cells do not express the other CD34 family members, and can be grown easily, they are useful to study the function of CD34. As described in Chapter 4, by analyzing the cultured mast cells, we found that CD34 and CD43 are both important in preventing homotypic adhesion. Our data also revealed that the interaction between these cells was divalent cation dependent and could not be blocked with a variety of antibodies to candidate adhesion molecules. It is still unclear what mediates the adhesive interaction between mast cells, although we know that it is cation dependent. Future work using antibody blocking and immunohistochemistry of homotypic interactions may shed light on the nature of this interaction. It was proposed over a decade ago, based on the structure of CD34 that it may act as an anti-adhesion molecule (Delia e ta / . , 1993). This was largely ignored until the present study, since shortly after this hypothesis was proposed, it became clear that CD34 acts as an adhesion molecule on HEV (Baumhueter et al., 1994). Therefore, the data within this thesis provide the first direct evidence to support this original idea and may cause re-evaluation for the function of CD34 on normal vasculature and HPC. 6.3 CD34 and CD43: proteins promoting mast cell repopulation Chapter 4 also shows that the absence of both CD34 and CD43 prevents the recovery of locally ablated peritoneal mast cells, despite normal numbers of 196 resting state tissue mast cells. Since it has been shown that ablated mast cells are recovered by the influx of MCp from the BM (Kanakura et al., 1988), and the frequency of BM MCp is normal in cd34j/ / cd43^ mice, our results suggest that cd34 ^ / cd43 ^ MCp are defective in their ability to migrate to peripheral tissues. This is the first demonstration for the requirement of particular proteins in the recovery of mast cells and may reflect inappropriate adhesion in the BM and/or vasculature. This is reminiscent of the observation that the loss of CD43 increases L-selectin mediated rolling of T cells (Stockton er al., 1998). Thus, anti-adhesion, as well as adhesion molecules are important in the migration ability of hematopoietic cells and this study serves to highlight this importance. How mast cell progenitors are recruited to tissues is currently an area that is not well understood. Although some proteins have been implicated in the binding of mast cell progenitors to the endothelium (Boyce et al., 2002), it is still unclear whether these represent physiologically relevant interactions. We are currently generating mice that contain GFP specifically in mast cells in collaboration with Dr. Paul Kubes (University of Calgary, Canada) so that we can visualize which molecules are important in their migration, using blocking antibodies to prevent their recruitment during immune responses. These mice will also be useful for genetic crosses to elucidate which molecules are involved in this process and whether mast cell progenitors are directed to certain tissues based on the expression of particular integrin molecules, as had been suggested by previous studies (Gurish et al., 2001; Rosenkranz et al., 1998; Smith and Weis, 1996). 6.4 CD34 and CD43 function on HPC and HSC Our results also showed that the absence of CD34 and CD43 prevent hematopoietic recovery of W/W v mice under competitive conditions with wild 197 type cells. The data presented in Chapter 5, showing that CD34 and CD43 KO and DKO cells are capable of hematopoietic reconstitution in lethally irradiated recipients, are important since the absence of engraftment in W/W v mice could be due to decreased survival. Thus, our results show that the absence of engraftment is not due to apoptosis, but rather a defect in the ability of cells to reach the BM. With the recent attention to the HSC and its BM niche, it would be interesting to find out whether CD34, as well as podocalyxin and CD43, regulate the interaction of HSC with the BM endosteum. If CD34 is important for the ability of HSC to reach the BM, then it is possible that CD34 may be important in the release of HSC from their BM niche. This possibility is further supported by the observation that CD34 is upregulated upon mobilization with G-CSF (Tajima et al., 2000). Since the BM niche contains quiescent, unactivated HSC (Nilsson et al., 2003), and CD34 expression correlates with the activated state of HSC (Sato et al., 1999), it is possible that CD34 is involved in overcoming retentive forces within the BM niche. Thus, our data support the idea that it is not only the cleavage of adhesion molecules on hematopoietic cells that leads to the release of HSC. 6.5 Fueling or fixing the controversy? There is some controversy about the function of CD34, since there are differing and opposing observations made of two independent cd34 ^ strains (Cheng et al., 1996; Suzuki e ta / . , 1996). Our results may help resolve this controversy. It has been hypothesized that the CD34 prevents hematopoietic differentiation. This hypothesis is based on three lines of evidence: firstly that CD34 is restricted to HPC, second, that overexpression of CD34 decreases the inducible maturation of M l cells (Fackler et al., 1995), and thirdly, that in one strain of cd34 ^ mice, there was a decrease in the number of hematopoietic progenitor 198 cells (Cheng et al., 1996). Our observation that mature mast cells express this protein provides strong evidence that this protein does not universally function as a blocker of maturation. Secondly, our results show a very different function for CD34 than the previously described adhesive function on HEV. In fact, we believe that our observed anti-adhesion effect by CD34 is its "default" function: in the absence of the appropriate modifications present only in HEV that permit its binding to L-selectin, its bulky, negatively charged nature prevents adhesion. Thus, CD34 regulates adhesion positively or negatively, depending on its context. Our data are in apparent contradiction to a decade old observation showing that overexpression of human CD34 causes increased adhesion to stromal cells (Healy ef al., 1995). However, there are notable differences between these studies. Firstly, these authors analyzed the function of human CD34 on T cells and showed that there was increased adhesion to human, but not mouse stroma. Since they also found that there was increased adhesion upon CD34 crosslinking, it implies an indirect mechanism of adhesion through CD34. Thus, this observation could be due to an indirect effect by CD34-mediated signalling that causes increased adhesion of these transfected cells. Our data, showing that CD34 blocks mast cell adhesion, are similar to the anti-adhesive function of the CD34-related protein, podocalyxin. Overexpression and knock-out studies have shown that Podoclayxin is important in blocking adhesion on kidney cells and non-hematopoietic cells lines (Doyonnas er al., 2001; Somasiri er al., 2004; Takeda er al., 2000). These data align nicely with our recent observation that the loss of CD34 and podocalyxin decreases the homing efficiency of transplanted fetal liver HPC (Doyonnas et al., 2005). Therefore, it appears that these molecules are important in preventing adhesion on a variety of different cell types. 199 The observations within this thesis strongly agree with the observation that CD43 can negatively regulate adhesion on hematopoietic cells (Stockton et al., 1998; Woodman et al., 1998). In vitro, loss of CD43 in a T cell line also increases homotypic aggregation (Manjunath et al., 1993), similar to our observation in BMMC. In vivo, absence of CD43 causes increased adhesion of leukocytes to endothelium (Stockton et al., 1998; Woodman et al., 1998). Therefore, CD43 appears to function in a similar manner on mast cells as well as other hematopoietic cells. 6.6 How does CD34 signal? The cytoplasmic tail of CD34 is phosphorylated by PKC (Fackler et al., 1990) and binds CrkL (Felschow et al., 2001), but the physiological consequences of these interactions are unclear. Studies performed in our lab by Helen Merkens and Poh Tan have revealed that although the CD34 family members have a similar DTH/EL motif at the terminal end of their cytoplasmic tail, podocalyxin and endoglycan (both DTHL), but not CD34 (DTEL) binds NHERF1 (unpublished observations). Related to this, podocalyxin has been shown to be linked to the cytoskeleton through the binding of NHERF2 to ezrin (Takeda, 2003). NHERF1 may act in a similar manner and studies are currently underway to establish if this occurs. It appears that the glutamic acid residue of CD34 prevents interaction with NHERF1. It will be interesting to find out whether CD34, instead, binds a similar adaptor molecule that allows interaction with the cytoskeleton. It will also be of interest to find out if CD34 is involved in signaling. Tada et al. (1999), suggested that CD34 and CD43 are involved in a common signaling pathway induced by cross-linking using antibodies (Tada et al., 1999). Our lab is currently using peptides of the cytoplasmic tail of CD34 and performing mass spectrometry analysis to elucidate the identity of any interacting proteins. Our results in chapter 4 show that the truncated version of CD34 is a more potent blocker of adhesion to the full-length form. This is particularly 200 interesting in light of the possibility that CD34 may link to the cytoskeleton and could potentially permit regulated protein polarization. Thus, the truncated version of CD34 may block adhesion more effectively since it cannot be polarized, providing a constitutive block for adhesive interactions. This possibility is supported by the observation that podocalyxin is polarized on a chicken stem cell line after stimulation with TPA, which coincides with phosphorylation of its cytoplasmic tail (unpublished observations). It will now be of interest to establish whether mast cells expressing only C D 3 4 F L CT can polarize and whether this is prevented when cells only express CD34 . 6.7 Future models for CD34 and CD43 in mast cell function Mast cells are involved in a variety of immune responses (Galli et al., 2005). These include resolution of bacterial and nematode infections, allergies, anaphylaxis and autoimmunity (Fukao et al., 2002; Galli et al., 2005; Gurish and Boyce, 2002; Henz etal., 2001; Robbie-Ryan and Brown, 2002; Woolley, 2003). The loss of CD34 and/or CD43 may alter the mast cell function in one or more of these inducible responses. Therefore, testing these models in wild type mice and single and double-deficient mice would be useful to further elucidate the function of these proteins on mast cells and their progenitors. We are currently collaborating with Dr. Brett Finlay (University of British Columbia, Canada) to find out whether CD34 and CD43 are involved in the response of mice to Salmonella infections. Testing the responses of KO mice to aerosolized allergens may be useful in explaining reduced eosinophil influx in response to allergens, observed in on strain of cd34^ mice (Suzuki et al., 1996). In light of our observations that CD34 is expressed by mast cells, and given that mast cells contribute to eosinophilia in asthmatic allergies (Williams and Galli, 2000), this observation may represent an upstream defect of mast cells. One possibility is that mast cell precursors are recruited to the site of inflammation 201 and this is not permitted in cd34 mice. These studies should be extended to evaluate the importance of CD34 (and CD43) in allergic responses. In conclusion, these studies have shown the importance of anti-adhesive molecules in regulating the interaction between mast cells/MCp and their microenvironment. This represents an important step in understanding how MCp migrate to the periphery during adult hood. It recognizes the antigentic similarities between HSC and mast cells and expands our understanding of the function of CD34. 202 6.8 References B a u m h u e t e r , S . , D y b d a l , N . , K y l e , C , and Lasky , L. A . ( 1 9 9 4 ) . G loba l vascu la r exp ress ion of mur ine C D 3 4 , a s i a lomuc in - l i ke endothe l ia l l igand for L -se lec t in . B lood 84, 2 5 5 4 - 2 5 6 5 . B o y c e , J . A . , Mel lor , E. A . , Pe rk ins , B. , L i m , Y. C . , and Lusc inskas , F. W. (2002 ) . H u m a n mas t cel l p rogen i to rs use a l pha4 - i n teg r i n , V C A M - 1 , and P S G L - 1 E-se lect in for adhes i ve in terac t ions wi th h u m a n v a s c u l a r endo the l i um under f low cond i t ions . B lood 9 9 , 2 8 9 0 - 2 8 9 6 . C h e n g , J . , B a u m h u e t e r , S . , C a c a l a n o , G . , C a r v e r - M o o r e , K., T h i b o d e a u x , H . , T h o m a s , R., B r o x m e y e r , H. E. , C o o p e r , S . , H a g u e , N . , M o o r e , M . , and Lasky , L. A . ( 1996 ) . Hematopo ie t i c de fec ts in m ice lack ing the s ia lomuc in C D 3 4 . B lood 87, 4 7 9 - 4 9 0 . De l i a , D. , L a m p u g n a n i , M. G . , Resna t i , M . , D e j a n a , E. , A ie l l o , A . , Fon tane l la , E . , S o l i g o , D., P iero t t i , M. A . , and G r e a v e s , M. F. ( 1 9 9 3 ) . C D 3 4 exp ress ion is regu la ted rec iproca l ly wi th adhes ion mo lecu les in vascu la r endothe l ia l ce l ls in v i t ro . B lood 81, 1 0 0 1 - 1 0 0 8 . D o y o n n a s , R., K e r s h a w , D. B. , D u h m e , C , M e r k e n s , H . , Che l l i ah , S . , Gra f , T. , and M c N a g n y , K. M. ( 2001 ) . A n u r i a , o m p h a l o c e l e , and per inata l lethal i ty in m ice lack ing the C D 3 4 - re la ted prote in podoca l yx in . J Exp Med 194, 1 3 - 2 7 . D o y o n n a s , R., N ie l sen , J . S . , C h e l l i a h , S . , D r e w , E. , H a r a , T . , M i y a j i m a , A . , and M c N a g n y , K. M. ( 2005 ) . Podoca lyx in is a C D 3 4 - r e l a t e d m a r k e r of mur ine hematopo ie t i c s tem cel ls and e m b r y o n i c e ry th ro id ce l ls . B lood . 203 Fackler, M. J . , Civ in, C. I., Sutherland, D. R., Baker, M. A . , and May, W. S. (1990). Activated protein kinase C directly phosphorylates the CD34 antigen on hematopoietic cells. J Biol Chem 265, 11056-11061. Fackler, M. J . , Krause, D. S . , Smi th , O. M., Civ in, C. I., and May, W. S. (1995). Full-length but not truncated CD34 inhibits hematopoietic cell differentiation of M l cells. Blood 85, 3040-3047. Felschow, D. M., McVeigh, M. L , Hoehn, G. T., Civ in, C. I., and Fackler, M. J . (2001). The adapter protein CrkL associates with CD34. Blood 97, 3768-3775. Fukao, T., Yamada, T., Tanabe, M., Terauchi, Y . , Ota, T., Takayama, T., Asano, T., Takeuchi, T., Kadowaki, T., Hata J i , J . , and Koyasu, S. (2002). Selective loss of gastrointestinal mast cells and impaired immunity in PI3K-deficient mice. Nat Immunol 3, 295-304. Gal l i , S. J . , Nakae, S . , and Tsai , M. (2005). Mast cells in the development of adaptive immune responses. Nat Immunol 6, 135-142. Gurish, M. F., and Boyce, J . A. (2002). Mast cell growth, differentiation, and death. Clin Rev Allergy Immunol 22 , 107-118. Gurish, M. F., Tao, H., Abonia, J . P., Arya, A . , Friend, D. S . , Parker, C. M., and Austen, K. F. (2001). Intestinal mast cell progenitors require CD49dbeta7 (alpha4beta7 integrin) for t issue-specif ic homing. J Exp Med 194, 1243-1252. Healy, L , May, G . , Gale, K. a . , Grosveld, F., Greaves, M., and Enver, T. (1995). The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion. Proc Natl Acad Sci U S A 92, 12240-12244. 204 Henz , B. M . , Maurer , M . , L ipper t , U . , W o r m , M . , and B a b i n a , M. ( 2001 ) . Mas t cel ls as in i t ia tors of i m m u n i t y and host de fense . Exp Derma to l 10, 1-10. K a n a k u r a , Y . , Ku r i u , A . , W a k i , N . , N a k a n o , T . , A s a i , H . , Y o n e z a w a , T . , and K i t a m u r a , Y . ( 1 9 8 8 ) . C h a n g e s in n u m b e r s and t ypes of m a s t cel l co lony - fo rm ing ce l ls in the per i tonea l cav i ty of m ice af ter in ject ion of d ist i l led wate r : ev idence tha t m a s t ce l ls supp ress d i f ferent ia t ion of bone m a r r o w - d e r i v e d p recurso rs . B lood 71, 5 7 3 - 5 8 0 . K r a u s e , D. S . , Fack le r , M. J . , C i v i n , C . I., and M a y , W. S . ( 1996 ) . C D 3 4 : s t ruc tu re , b io logy , and cl inical ut i l i ty. B lood 87, 1-13. K r a u s e , D. S . , I to, T . , Fack le r , M. J . , S m i t h , O . M . , Co l lec to r , M. I., S h a r k i s , S . J . , and May , W . S . ( 1 9 9 4 ) . Charac te r i za t i on of mur ine C D 3 4 , a m a r k e r for hematopo ie t i c p rogen i to r and s tem ce l ls . B lood 84, 6 9 1 - 7 0 1 . Ma jd ic , O . , S toc k l , J . , P ick l , W. F., Bohus lav , J . , S t r ob l , H . , S c h e i n e c k e r , C , S tock inge r , H . , and K n a p p , W. ( 1 9 9 4 ) . S igna l ing and induct ion of enhanced cy toadhes i veness v ia the hematopo ie t i c p rogen i to r cel l sur face mo lecu le C D 3 4 . B lood 83, 1 2 2 6 - 1 2 3 4 . M a n j u n a t h , N . , J o h n s o n , R. S . , S t a u n t o n , D. E . , Pasqua l i n i , R., and A r d m a n , B. ( 1 9 9 3 ) . Ta rge ted d is rup t ion of C D 4 3 gene e n h a n c e s T l ymphocy te a d h e s i o n . J I m m u n o l 151, 1 5 2 8 - 1 5 3 4 . N i l sson , S . K., Hay lock , D. N . , J o h n s t o n , H. M . , Occh iodo ro , T . , B r o w n , T. J . , and S i m m o n s , P. J . ( 2003 ) . Hya lu ronan is syn thes i zed by pr imi t ive hemopo ie t i c ce l l s , par t ic ipa tes in the i r l odgmen t at the e n d o s t e u m fo l lowing t ransp lan ta t i on , a n d is i nvo l ved in the regu la t ion of the i r pro l i ferat ion and d i f ferent ia t ion in v i t ro . B lood 101, 8 5 6 - 8 6 2 . 205 O k u n o , Y . , Iwasak i , H . , Huet tner , C . S . , R a d o m s k a , H. S . , G o n z a l e z , D. A . , T e n e n , D. G . , and A k a s h i , K. ( 2 0 0 2 ) . Di f ferent ia l regu la t ion of the h u m a n and mur ine C D 3 4 g e n e s in hematopo ie t i c s t e m ce l ls . Proc Natl A c a d Sci U S A 9 9 , 6 2 4 6 - 6 2 5 1 . R o b b i e - R y a n , M . , and B r o w n , M. ( 2 0 0 2 ) . The role of m a s t cel ls in a l le rgy and a u t o i m m u n i t y . Cu r r Op in I m m u n o l 14, 7 2 8 - 7 3 3 . R o s e n k r a n z , A . R., C o x o n , A . , Maure r , M . , G u r i s h , M. F., A u s t e n , K. F., F r i end , D. S . , Ga l l i , S . J . , and M a y a d a s , T. N. ( 1 9 9 8 ) . Impa i red m a s t cell d e v e l o p m e n t and innate i m m u n i t y in Mac -1 ( C D l l b / C D 1 8 , C R 3 ) -def ic ient m ice . J I m m u n o l 161, 6 4 6 3 - 6 4 6 7 . R o t t e m , M . , O k a d a , T . , Goff , J . P., and Metca l fe , D. D. ( 1994 ) . Mas t cel ls cu l tured f rom the per iphera l b lood of no rma l donors and pat ien ts wi th mas tocy tos i s o r ig ina te f rom a C D 3 4 + / F c eps i lon R I - cel l popu la t ion . B lood 84, 2 4 8 9 - 2 4 9 6 . S a t o , T . , Lave r , J . H . , and O g a w a , M. ( 1 9 9 9 ) . Revers ib le exp ress ion of C D 3 4 by mur ine hematopo ie t i c s t e m ce l ls . B lood 9 4 , 2 5 4 8 - 2 5 5 4 . S m i t h , T. J . , and W e i s , J . H. ( 1 9 9 6 ) . Mucosa l T cel ls and m a s t cel ls sha re c o m m o n adhes ion receptors . I m m u n o l T o d a y 17, 6 0 - 6 3 . S o m a s i r i , A . , N ie l sen , J . S . , M a k r e t s o v , N . , M c C o y , M. L., Pren t i ce , L., G i l k s , C . B . , C h i a , S . K., G e l m o n , K. A . , Ke rshaw , D. B. , H u n t s m a n , D. G v etal. ( 2004 ) . O v e r e x p r e s s i o n of the an t i - adhes in podoca lyx in is an i ndependen t pred ic tor of b reas t c a n c e r p rog ress ion . C a n c e r Res 64, 5 0 6 8 - 5 0 7 3 . 206 Stockton, B. M., Cheng, G . , Manjunath, N., Ardman, B., and von Andrian, U. H. (1998). Negative regulation of T cell homing by CD43. Immunity 8, 373-381. Suzuki , A . , Andrew, D. P., Gonzalo, J . A . , Fukumoto, M., Spel lberg, J . , Hashiyama, M., Takimoto, H., Gerwin, N., Webb, I., Molineux, G v et al. (1996). CD34-deficient mice have reduced eosinophil accumulation after allergen exposure and show a novel crossreactive 90-kD protein. Blood 87, 3550-3562. Tada, J . , Omine, M., Suda, T., and Yamaguchi , N. (1999). A common signaling pathway via Syk and Lyn tyrosine kinases generated from capping of the sialomucins CD34 and CD43 in immature hematopoietic cells. Blood 93, 3723-3735. Taj ima, F., Sato, T., Laver, J . H., and Ogawa, M. (2000). CD34 expression by murine hematopoietic stem cells mobilized by granulocyte colony-stimulating factor. Blood 96, 1989-1993. Takeda, T. (2003). Podocyte cytoskeleton is connected to the integral membrane protein podocalyxin through Na+/H+-exchanger regulatory factor 2 and ezrin. Clin Exp Nephrol 7, 260-269. Takeda, T., Go, W. Y . , Orlando, R. A . , and Farquhar, M. G. (2000). Expression of podocalyxin inhibits cell-cell adhesion and modifies junctional properties in madin-darby canine kidney cells [In Process Citation]. Mol Biol Cell 11, 3219-3232. Valent, P., Schernthaner, G. H., Sperr, W. R., Fritsch, G . , Agis, H., Wil lheim, M., Buhring, H. J . , Orfao, A . , and Escribano, L. (2001). Variable expression of activation-l inked surface antigens on human mast cells in health and disease. Immunol Rev 179, 74-81 . Welker, P., Grabbe, J . , Zuberbier, T., Guhl , S . , and Henz, B. M. (2000). Mast cell and myeloid marker expression during early in vitro mast cell differentiation from human peripheral blood mononuclear cells. J Invest Dermatol 114, 44-50. Wil l iams, C. M., and Gal l i , S. J . (2000). Mast cells can amplify airway reactivity and features of chronic inflammation in an asthma model in mice. J Exp Med 192, 455-462. Wood, H. B., May, G . , Healy, L , Enver, T., and Morr iss-Kay, G. M. (1997). CD34 expression patterns during early mouse development are related to modes of blood vessel formation and reveal additional sites of hematopoiesis. Blood 90, 2300-2311. Woodman, R. C , Johnston, B., Hickey, M. J . , Teoh, D., Reinhardt, P., Poon, B. Y. , and Kubes, P. (1998). The functional paradox of CD43 in leukocyte recruitment: a study using CD43-deficient mice. J Exp Med 188, 2181-2186. Woolley, D. E. (2003). The mast cell in inflammatory arthritis. N Engl J Med 348, 1709-1711. 208 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092335/manifest

Comment

Related Items