Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Exploring the diversity of ascomycete fungi : evolution of mating systems in Pleospora and discovery… Inderbitzin, Patrik 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-99483x.pdf [ 17.97MB ]
Metadata
JSON: 831-1.0092331.json
JSON-LD: 831-1.0092331-ld.json
RDF/XML (Pretty): 831-1.0092331-rdf.xml
RDF/JSON: 831-1.0092331-rdf.json
Turtle: 831-1.0092331-turtle.txt
N-Triples: 831-1.0092331-rdf-ntriples.txt
Original Record: 831-1.0092331-source.json
Full Text
831-1.0092331-fulltext.txt
Citation
831-1.0092331.ris

Full Text

EXPLORING THE DIVERSITY OF ASCOMYCETE FUNGI: EVOLUTION OF MATING SYSTEMS IN PLEOSPORA AND DISCOVERY OF NEW UNEAGES IN THE DOTHIDEOMYCETES by PATRIK INDERBrrZIN Licence en biologie, University of Lausanne, 1997 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Botany) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA July 2004 © Patrik Inderbitzin, 2004 Statement of co-authorship For Patrik Inderbitzin's PhD thesis: 'Exploring the diversity of ascomycete fungi: Evolution of mating systems in Pleospora and discovery of new lineages in the Dothideomycetes'. Chapter 4: Decorospora. a new genus for the marine ascomycete Pleospora gaudefroyi This chapter was a slightly modified version of the publication: Inderbitzin, P., Volkmann-Kohlmeyer, B., Kohlmeyer, J. & Berbee, M. L. ( 2 0 0 2 ) . Decorospora, a new genus for the marine ascomycete Pleospora gaudefroyi. Mycologia 9 4 , 651-659. To this paper I contributed as follows: I collected the fungus in its natural habitat and initiated the research. I did the molecular work and phylogenetic analyses under the supervision of M. Berbee. The remaining two co-authors were responsible for the morphological part including the illustrations. I was responsible for the final version of the manuscript and its submission, under supervision of M. Berbee. Chapter 5: Aliquandostipitaceae. a new family for two new tropical ascomycetes with unusually wide hyphae and dimorphic ascomata This chapter was a slightly modified version of the publication: Inderbitzin, P., Landvik, S., Abdel-Wahab, M. A. & Berbee, M. L. ( 2 0 0 1 ) . Aliquandostipitaceae, a new family for two new tropical ascomycetes with unusually wide hyphae and dimorphic ascomata. American Journal of Botany 8 8 , 52-61. I contributed to this publication in the following ways: I participated in the collection of the fungi in Thailand together with M. Abdel-Wahab, and China where I initiated the collection effort. I was the main contributor to the morphological studies, being responsible for the characterization of the novel features of these fungi, and writing the descriptions of the new taxa. Together with M. Abdel-Wahab, I took the photographs. I did the molecular lab work and the phylogenetic analyses supervised by S. Landvik and M. Berbee. I wrote up the manuscript and submitted it for publication, under supervision of M. Berbee. Sincerely, Patrik Inderbitzjh For the co-authors: Dr. Mary Berbee Vancouver, 23. September 2004 A B S T R A C T This thesis explored aspects of diversity in the ascomycete genus Pleospora and the new family Aliquandostipitaceae. In Pleospora, the main focus was on mating system evolution. I found that homothallism in Pleospora evolved in three different ways from heterothallism. One origin of homothallism resulted from a horizontal transfer across lineages involving a MAT locus. The approach chosen to investigate mating system evolution in Pleo-spora was based on delimiting the polyphyletic genus Pleospora to Pleospora sensu stricto, inferring a robust species phylogeny of Pleospora sensu stricto and cloning and examining the master regulator locus of sexual development in ascomycetes, the MAT locus. Conclusions were then drawn by integration of the total evidence. Research of mating system evolution in Pleospora was initiated by con-firmation of the monophyly of Pleospora isolates with Stemphylium asexual states. This group contained the type of Pleospora, and was thus called Pleo-spora sensu stricto. Contributing towards a monophyletic genus Pleospora, the marine species P. gaudefroyi collected in British Columbia, and lacking a Stem-phylium asexual state, was transferred to the new genus Decorospora. Phylo-genetic 18S rDNA analyses and Shimodaira-Hasegawa and Kishino-Hasegawa tests rejected the null hypothesis of monophyly for the two taxa. Instead, Pleospora gaudefroyi grouped distantly from P. herbarum, at the base of the family Pleosporaceae confirming the importance of a Stemphylium asexual state for the definition of Pleospora sensu stricto in this case. Since no exist-ing genus was available to accommodate P. gaudefroyi, the new genus Decorospora had to be erected. To generate a species phylogeny of Pleospora sensu stricto, 114 in-group taxa with Stemphylium asexual states were used. Phylogenetic analyses based on ITS, GPD, EF-1alpha and vmaA-vpsA DNA sequences with four differ-ent algorithms showed that Pleospora sensu stricto contained 22 phylogenetic species. Morphological species generally correlated well with phylogenetic spe-cies, except for the type P. herbarum whose phylogenetic species contained the four additional morphological species P. alfalfae, S. vesicarium, P. tomato-nis and P. sedicola. Another conflict between morphological and phylogenetic species concept could arise in the phylogenetic species S. xanthosomatis that also contained an isolate of S. lycopersici, which, however, was not certain to represent the type of the species. Three phylogenetic species, one of which was exclusively collected in British Columbia, did not contain any morphological species and might be new to science. The protein-coding gene EF-1 alpha, parts of which where used for phylogenetic inference in Pleospora sensu stricto, contained an unusual intron ii in the phylogenetic species S. lancipes, S. trifolii and Stemphylium sp. strain P246. The intron was up to 1678 bp long, more than 1400 bp longer than in-trons in other species of Pleospora, it encoded a protein and was delimited at the 5'-end by the non-canonical splice site GGT, instead of GT. The ORF en-coded by the introns of all three Pleospora species was most similar to a hypo-thetical zinc finger protein from the filamentous ascomycete Gibberella zeae. In case of experimental verification, this would be the first report of a 'para-sitic' intron splice site in fungi. To continue investigations of mating system evolution in Pleospora sensu stricto, the MAT locus was PCR amplified using primers targeting the conserved motives alpha box and HMG box on the MAT1-1 and MAT1-2 genes respectively. A chromosome walking approach was then used to recover the MAT flanking regions and neighboring genes. It was shown that Pleospora sensu stricto contained three kinds of MAT regions, comprising either a MAT1-1 or MAT1-2 idiomorph, or both MAT1-1 and MAT1-2 idiomorphs fused end to end, with the inverted MAT1-1 gene placed between ORF1 and MAT1-2. The genes flanking the MAT regions were ORF1 upstream, and BGL1 downstream of the idiomorphs, as in the close relative Cochliobolus. The idiomorphs of Pleospora sensu stricto were well delimited upstream of the MAT genes, terminating 16 or 17 amino acids inside ORF1 for respectively MAT1-1 and MAT1-2. The downstream boundary of the idiomorphs of Pleo-spora sensu stricto was poorly defined. There were no important differences between MAT genes from fused and separate MAT regions of Pleospora sensu stricto. MAT1-1 genes from both separate and fused regions were 1193 bp in length and contained one intron of 53 bp inserted at position 218. MAT1-2 genes were all 1093 bp long and comprised one intron of 55 bp inserted at position 491. The fused MAT regions of Pleospora sensu stricto consisted of MAT1-1 and MAT1-2 idiomorphs fused end to end, with MAT1-1 and flanking regions inverted. The gene arrangement found in the fused MAT regions was hypothe-sized to have evolved from ancestors with separate MAT regions by a cross-over following the inversion of MAT1-1. The crossover was possibly facilitated by a short, 4 bp long stretch of DNA sequence similarity between MAT1-1 and MAT1-2 idiomorphs, resulting from the inversion of MAT1-1 plus flanking re-gions. MAT locus architecture and phylogenetic species correlated well. All phylogenetic species of Pleospora sensu stricto with more than one isolate contained both MAT1-1 and MAT1-2 isolates with separate MAT regions, or only isolates with fused MAT regions. MAT regions also correlated with mating systems in Pleospora sensu stricto. Species with fused MAT regions were homothallic, whereas species with separate MAT regions were heterothallic except one group that was ho-iii mothallic. In all homothallic isolates with separate MAT regions, only MAT1-1 was detected. To evaluate the number of times a switch between mating systems oc-curred in the evolution of Pleospora sensu stricto, the species phylogeny was compared to the MAT phylogenies, in conjunction with the results from struc-tural analyses of the MAT loci. MAT data of Pleospora sensu stricto suggested a single origin of the fused MAT regions from separate MAT regions. The single origin was supported by the monophyly of the fused MAT regions in MAT phylogenies, as well as the complicated structure of the fused MAT regions that was unlikely to have evolved twice independently. Whereas combined MAT evidence suggested a single origin of the fused MAT regions, the species phylogeny suggested at least two independent origins of the fused MAT re-gions. The conflicting evidence between MAT data and the Pleospora sensu stricto species phylogeny was consistent with a single origin of the fused MAT regions followed by a horizontal transfer across lineages, by sexual or asexual means. The one time evolution and subsequent horizontal transfer of the fused MAT region constituted two different evolutionary origins of the ho-mothallics with fused MAT regions. A third origin of homothallism in Pleospora sensu stricto was in the group with a separate MAT locus containing a forward-oriented MAT1-1 gene. Homothallism in this case may be do to unknown mutations in other than the MAT genes, as possibly in the homothallic Neurospora africana. The last part of my thesis dealt with two new species in the new family Aliquandostipitaceae. Both Aliquandostipite khaoyaiensis and A. sunyatsenii were collected in Asia, and comprised several features not previously reported in ascomycetes. Novel morphological features were the presence of two types of fruitbodies side by side on the substrate, and the widest hyphae reported in ascomycetes. Overall morphological appearance suggested that species of Ali-quandostipite were related to members of the order Pleosporales. However, molecular analyses of the 18S rDNA showed that species of Aliquandostipite did not belong to the Pleosporales, but instead grouped with uncertain affinity in the class Dothideomycetes. iv TABLE OF CONTENTS ABSTRACT " TABLE OF CONTENTS v LIST OF TABLES xi LIST OF FIGURES xiii ACKNOWLEDGEMENTS xv CHAPTER 1. GENERAL INTRODUCTION 1 1.1. The ascomycetes 2 1.2. On species concepts in fungi 3 1.3. The ascomycete genus Pleospora 4 1.4. Mating type genes 5 1.5. Thesis theme and objectives 6 1.6. Bibliography 7 CHAPTER 2. PHYLOGENETIC SPECIES OF PLEOSPORA SENSU STRICTO 9 2.1. Introduction 10 2.1.1 Pleospora sensu stricto and hypotheses 10 2.1.2 Loci used for phylogenetic analyses 10 2.1.2.1 Ribosomal internal transcribed spacer region (ITS) 10 2.1.2.2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) 11 2.1.2.3 Elongation factor-1 alpha (EF-1 alpha) 11 2.1.2.4 vmaA-vpsA intergenic spacer 11 2.2. Materials and methods 11 2.2.1 Fungal strains used 11 2.2.2 Fungal isolation and culture conditions 12 2.2.3 Molecular wo rk 12 2.2.3.1 DNA extraction and PGR 12 2.2.3.2 DNA sequencing 13 2.2.3.2.1 Set-up : 13 2.2.3.2.2 Troubleshooting 13 2.2.3.3 Primers and PCR conditions used 13 2.2.3.3.1 Internal transcribed spacer (ITS) 13 2.2.3.3.2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) 13 2.2.3.3.3 Elongation factor-1 alpha (EF-1 alpha) 14 v 2.2 .3 .3 .4 vmaA-vpsA intergenic spacer 15 2 .2 .4 Phylogenetic analyses 16 2.2.4.1 D N A sequences 16 2.3. Results 17 2.3.1 DNA sequences 17 2.3.1.1 Ribosomal internal transcribed spacer region (ITS) 17 2.3 .1 .2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) 17 2 .3 .1 .3 Elongation factor-1 alpha (EF-1 alpha) 17 2.3.1.3.1 Protein encoding EF-1 alpha introns 18 2 .3 .1 .4 vmaA-vpsA intergenic spacer 19 2 .3 .2 Verif ication of results 19 2 .3 .3 Protein sequences 20 2.3.3.1 Glyceraldehyde-3-phosphate dehydrogenase (GPD) 20 2.3 .3 .2 Elongation factor-1 alpha (EF-1 alpha) 20 2 .3 .3 .3 vmaA-vpsA intergenic spacer 20 2 .3 .4 Phylogenetic analyses 20 2.3.4.1 Select ion of representative isolates for vmaA-vpsA sequencing 20 2 .3 .4 .2 Parsimony analyses of single datasets for representative isolates 20 2.3.4.2.1 Ribosomal internal transcribed spacer region (ITS) 21 2.3 .4 .2 .2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) 21 2 .3 .4 .2 .3 Elongation factor-1 alpha (EF-1 alpha) 21 2 .3 .4 .2 .4 vmaA-vpsA intergenic spacer 22 2 .3 .4 .3 Test for combinability of ITS, GPD, EF-1 alpha and vmaA-vpsA datasets 22 2 .3 .4 .4 Analyses of combined ITS, GPD, EF-1 alpha and vmaA-vpsA dataset 22 2.3.4.4.1 Parsimony 22 2.3 .4 .4 .2 Likelihood 22 2 .3 .4 .4 .3 Bayesian analyses 23 2.3 .4 .4 .4 Neighbor joining 23 2.4. Discussion 23 2.4.1 Phylogenetic relationships in Pleospora 23 2.4.1.1 Comparison to other studies 23 2.4 .1 .2 Datasets and phylogenetic signal 25 2 .4 .1 .3 Rooting of phylogenetic t rees 25 2 .4 .1 .4 The internal protein encoding EF-1 alpha intron 26 2 .4 .2 Phylogenetic species in Pleospora 27 2 .4 .3 Delimitation of Pleospora herbarum, the type of Pleospora 28 2 .4 .4 Unidentified phylogenetic species 29 2 .4 .5 Bibliography 68 CHAPTER 3. MATING SYSTEM EVOLUTION IN PLEOSPORA 71 3.1. Introduction 72 3.1.1 The M A T locus in Cochliobolus and hypotheses 72 3.2. Materials and methods 73 3.2.1 Fungal strains used 73 3.2.2 Conditions used for crosses 73 3 .2 .3 Molecular work 73 vi 3.2.3.1 DNA extraction, PCR and DNA sequencing 7 3 .2 .3 .2 Primers and PCR condit ions 7 3.2.3.2.1 Species phylogeny 7 3 .2 .3 .2 .2 Screening for mating type gene arrangement 7 3 .2 .3 .2 .3 Screening for the presence of MAT1-2 in additional isolates of Pleospora sp. strain P56 7 3 .2 .3 .2 .4 Generation of M A T gene DNA sequences and flanking regions 7 3 .2 .3 .3 Phylogenetic analyses 7 3.2.3.3.1 DNA 7 3 .2 .3 .3 .2 Proteins 7 3 .2 .3 .4 Defining idiomorphs by MAT region comparisons 7 3.3. Results 7 3.3.1 Mating type genes 7 3.3.1.1 Mating type screening to investigate M A T locus architecture 7 3 .3 .1 .2 Screening for MAT1-2 in additional isolates of the homothallic Pleospora sp. strain P56 7 3 .3 .1 .3 MAT DNA sequences obtained 7 3 .3 .1 .4 Mapping of mating type regions 7 3.3.1.4.1 MAT1-1 regions 7 3 .3 .1 .4 .2 MAT1-2 regions 7 3 .3 .1 .4 .3 Fused mating type regions with both MAT1-1 and MAT1-2 7 3 .3 .1 .5 Phylogenetic information content in MAT regions.. 7 3 .3 .1 .6 Comparison between separate and fused M A T regions 7 3 .3 .1 .7 Evolution of fused MAT regions 7 3 .3 .1 .8 Delimitation of the idiomorphs £ 3 .3 .1 .9 Phylogenetic analyses £ 3.3.1.9.1 Mating type protein phylogenies £ 3.3.1.9.1.1 MAT1-1 protein analyses £ 3 .3 .1 .9 .1 .2 MAT 1-2 protein analyses £ 3 .3 .1 .9 .2 Idiomorph DNA sequence analyses £ 3.3.1.9.2.1 MAT1-1 idiomorph D N A sequence analyses £ 3 .3 .1 .9 .2 .2 MAT1 -2 idiomorph DNA analyses £ 3.4. Discussion 8 3.4.1 The mating type locus of Pleospora £ 3.4.1.1 Mating type genes £ 3 .4 .1 .2 Idiomorph delimitation £ 3 .4 .1 .3 Conservation of gene order in the M A T locus £ 3 .4 .2 Architecture of the fused M A T regions £ 3 .4 .3 A hypothesis for the evolution of the fused MAT regions £ 3 .4 .4 Phylogenetic information content of the M A T regions £ 3 .4 .5 Incongruence between M A T phylogeny and species phylogeny £ 3 .4 .6 MAT gene arrangements in phylogenetic species £ 3 .4 .7 Mating system in Pleospora species with fused M A T regions £ 3 .4 .8 Mating system in Pleospora species with separate M A T regions £ 3 .4 .9 Mating system evolution in Pleospora £ 3.4.9.1 Single origin of homothallics with a separate MAT1-1 region 9 3.4 .9 .2 Horizontal transfer of the fused M A T region £ 3.4.9.2.1 Convergent evolution £ vii 3.4 .9 .2 .2 Retention of an ancestral character s ta te 92 3 .4 .9 .2 .3 Sexual or asexual horizontal t ransfer 93 3 .4 .9 .3 Three different origins of homothall ics in Pleospora 93 3.5. Bibliography 130 CHAPTER 4.DECOROSPORA, A NEW GENUS FOR THE MARINE ASCOMYCETE PLEOSPORA GAUDEFROYI 133 4.1. Introduction 134 4.2. Materials and methods 134 4.2.1 Molecular work 134 4 .2 .2 Phylogenetic analyses of SSL) rDNA datasets 135 4 .2 .3 Phylogenetic analyses of the ITS rDNA dataset 136 4.3. Results 136 4.3.1 Phylogenetic analyses of the S S U rDNA dataset 136 4 .3 .2 Kishino-Hasegawa tes t 137 4 .3 .3 Shimodaira-Hasegawa tes ts 137 4 .3 .4 Phylogenetic analysis of the ITS rDNA dataset 138 4.4. Discussion 138 4.4.1 Pleospora gaudefroyi transferred to new genus Decorospora 138 4 . 4 . 2 Decorospora, a new genus in the Pleosporaceae 139 4.5. Taxonomy 139 4.5.1 The new genus Decorospora 139 4 .5 .2 Transfer of Pleospora gaudefroyi to Decorospora 139 4 .5 .3 Specimens examined 140 4 .5 .4 Commentary 140 4 .5 .5 Substrates 141 4 .5 .6 Geographic distr ibution 141 4.6. Acknowledgements 141 4.7. Bibliography 149 CHAPTER 5.ALIQUANDOSTIPITACEAE, A NEW FAMILY FOR TWO NEW TROPICAL ASCOMYCETES WITH UNUSUALLY WIDE HYPHAE AND DIMORPHIC ASCOMATA 151 5.1. Introduction 152 5.2. Materials and methods 153 5.2.1 Collect ion, examination and isolation of fungi 153 5 .2 .2 Molecular wo rk -Spec ies of Aliquandostipite 154 5 .2 .3 Additional sequences obtained 155 5.2 .4 Data analysis 155 viii 5.3. Results 156 5.3.1 Taxonomy 156 5.3.1.1 Establishment and definition of the family Al iquandostipitaceae fam. nov..156 5 .3 .1 .2 Establishment and definition of the new genus Aliquandostipite gen. nov. .156 5 .3 .1 .3 Establishment and description of the species A. khaoyaiensis sp . nov 156 5 .3 .1 .4 Establishment and description of the new species A. sunyatsenii sp. nov...158 5 .3 .2 Molecular data 159 5.3.2.1 New sequences obtained 159 5 .3 .2 .2 Phylogenetic analyses 160 5.4. Discussion 162 5.4.1.1 Two new congeneric species 162 5 .4 .1 .2 The new genus Aliquandostipite and new family Al iquandost ipi taceae 162 5 .4 .1 .3 Dimorphic ascomata and the widest hyphae in ascomycetes 163 5.5. Bibliography 174 CHAPTER 6. CONCLUSION 175 6.1. Pleospora: Generic delimitation, phylogenetics and mating system evolution 176 6.1.1 Generic delimitation and phylogenetics of Pleospora sensu st r ic to 176 6.1.1.1 Further research 176 6 .1 .2 The divergent protein-encoding intron in EF-1 alpha 177 6.1.2.1 Further research 177 6 .1 .3 Mating system evolution in Pleospora sensu str ic to 178 6.1.3.1 Further research 178 6.2. The new family Aliquandostipitaceae 179 6.2.1 Further research 180 6.3. Bibliography 180 CHAPTER 7. APPENDICES 182 7.1. DNA, PCR and sequencing 183 7.1.1 DNA extraction, purification and quantif ication 1 8 3 -7.1.1.1 Reagents for DNA extract ion 183 7 .1 .1 .2 Additional reagent for DNA purif ication 183 7 .1 .1 .3 Preparation of fungal material for DNA extract ion 183 7.1.1.3.1 Fresh mycelium and small amounts of herbarium material 183 7 .1 .1 .3 .2 Lyophil ized fungal material for high DNA yield 184 7 .1 .1 .4 Extraction of nucleic acids 184 7 .1 .1 .5 Removal of R N A 185 7 .1 .1 .6 Measuring of extracted DNA concentrat ion 185 7 .1 .2 Preparation of PCR reactions 185 7 .1 .3 Electrophoresis of PCRproduc t s 186 7.1.4 Reamplification of weak PCR bands 186 7 .1 .5 Precipitation of P C R products 186 7.1.6 Measuring of P C R product concentrat ions 186 ix 7.1.7 Preparation of DNA sequencing reactions 187 7.1.8 Precipitation of DNA sequencing products and DNA sequence determination. 187 7.2. Chromosome walking 187 7.2.1 Restriction enzyme digest of DNA 187 7.2.2 Adapter ligation to digested DNA 187 7.2.3 Chromosome walking with touchdown and hot start PCR protocols 188 7.3. Bibliography 188 x LIST OF TABLES Table 2-1. Morphological species included in this study 31 Table 2-2. Fungal isolates used in this study 34 Table 2-3. New primers designed for the Pleospora species phylogeny 42 Table 2-4. Summary of EF-1 alpha internal introns in isolates of Pleospora 43 Table 2-5. Comparison of EF-1 alpha intron encoded zinc finger proteins 44 Table 2-6. Unique TTS/GPD/EF-1 alpha multilocus genotypes for Pleospora isolates 45 Table 2-7. Unique ITS genotypes for Pleospora isolates 47 Table 2-8. Unique GPD genotypes for Pleospora isolates 48 Table 2-9. Unique EF-1 alpha genotypes Pleospora isolates 49 Table 2-10. Unique vmaA-vpsA genotypes for Pleospora isolates 50 Table 2-11. Unique YTS/GPDIEF-1 alpha/vmaA-vpsA Pleospora multilocus genotypes 51 Table 2-12. Bootstrap supports above 70% for Pleospora species phylogenies 52 Table 2-13. Phylogenetic information content of four Pleospora species phylogeny loci 54 Table 2-14. Phylogenetic species of Pleospora obtained in phylogenetic analyses 55 Table 2-15. Phylogenetic species of Pleospora corresponding to morphological species 56 Table 3-1. Al l MAT1-1 region forward primers used 94 Table 3-2. Al l MAT1-1 region reverse primers used 95 Table 3-3. Al l MAT1-2 region forward primers used 96 Table 3-4. Al l MAT 1-2 region reverse primers used 97 Table 3-5. Al l MATl-l; MAT1-2 region forward primers used 98 Table 3-6. Al l MATl-l; MAT1-2 region reverse primers used 99 Table 3-7. PCR conditions for amplification of the MATl-l regions 100 Table 3-8. PCR conditions for amplification of the MAT1-2 regions 103 Table 3-9. PCR conditions for amplification of the fused MATl-l; MAT1-2 regions 104 Table 3-10. MAT loci in phylogenetic species of Pleospora 108 Table 3-11. Comparison of parsimony informative characters between MAT genes 109 Table 3-12. Support values of shared MAT-species phylogeny branches 110 Table 3-13. Support values of contradicting MAT-species phylogeny branches 111 Table 3-14. MAT genes and idiomorphs in Pleospora and other Dothideomycetes 112 Table 3-15. MAT locus and teleomorph formation in phylogenetic species of Pleospora 113 xi Table 4-1. GenBank accession numbers of the sequences used in the Decorospora study 142 Table 5-1. GenBank accession numbers of the sequences in the Aliquandostipite study 165 LIST OF FIGURES Figure 1-1. Diagram of vertical section through fruitbody of a microscopic ascomycete 2 Figure 1-2. Fruitbodies of Pleospora sp. strain P60 on decaying plant material 4 Figure 1-3. Muriform ascospore of Pleospora gigaspora strain PI34 4 Figure 2-1. Ascus of Pleospora sedicola strain P271 containing eight muriform ascospores...59 Figure 2-2. Asexual spore of Stemphylium trifolii strain P244 60 Figure 2-3. Gene diagrams with primers used for Pleospora species phylogeny 61 Figure 2-4. One most parsimonious tree from combined TTS/GPD/EF-1 alpha sequences 62 Figure 2-5. Most parsimonious trees from the four separate analyses 64 Figure 2-6. One most parsimonious tree from combined four loci dataset 66 Figure 3-1. Pleospora species phylogeny, M A T regions and homothallism 115 Figure 3-2. Gene diagrams with main M A T P C R and sequencing primers 116 Figure 3-3. Gene diagrams of longest M A T regions sequenced 117 Figure 3-4. Schematic representation of the M A T loci in Pleospora 118 Figure 3-5. D N A sequences of fusion junctions in the joined MAT1-1; MAT1-2 regions 119 Figure 3-6. Evolutionary scenario leading to the fused M A T region in Pleospora 121 Figure 3-7. Gene diagrams of the M A T idiomorphs in Pleospora 122 Figure 3-8. Figure of MAT1-1 protein phylogeny (Fitch-Margoliash distance tree) 123 Figure 3-9. Figure of MAT1-2 protein phylogeny (Fitch-Margoliash distance tree) 125 Figure 3-10. Figure of MAT1-1 idiomorph most likely tree 126 Figure 3-11. Figure MAT1-2 idiomorph most likely tree 127 Figure 3-12. Gene diagrams of M A T loci and idiomorphs in Dothideomycetes 128 Figure 4-1. Decorospora gaudefroyi. Longitudinal section through ascoma 145 Figure 4-2. Decorospora gaudefroyi. Ascospores enclosed in gelatinous sheaths 145 Figure 4-3. Decorospora gaudefroyi. Immature ascus 145 Figure 4-4. Decorospora gaudefroyi. Mature asci and pseudoparaphyses 145 Figure 4-5. Most parsimonious tree from a S S U r D N A data in the Decorospora study 147 Figure 5-1. Aliquandostipite khaoyaiensis. Stalked ascomata on substrate 166 Figure 5-2. Aliquandostipite khaoyaiensis. Mycel ium on the substrate 166 Figure 5-3. Aliquandostipite khaoyaiensis. Cluster of stalks bearing ascomata 166 Figure 5-4. Aliquandostipite khaoyaiensis. Section of stalked ascomata 166 Figure 5-5. Aliquandostipite khaoyaiensis. Section of basal section of stalked ascomata 166 xiii Figure 5-6. Aliquandostipite khaoyaiensis. Section of apical section of stalked ascomata 166 Figure 5-7. Aliquandostipite khaoyaiensis. Superficial hypha with ascoma on lateral branch 166 Figure 5-8. Aliquandostipite khaoyaiensis. Sections of sessile ascoma with flattened base... 168 Figure 5-9. Aliquandostipite khaoyaiensis. Sections of apical part of sessile ascomata 168 Figure 5-10. Aliquandostipite khaoyaiensis. Superficial view of ascomal wall 168 Figure 5-11. Aliquandostipite khaoyaiensis. Ascus and sterile filaments 168 Figure 5-12. Aliquandostipite khaoyaiensis. Ascospores with detaching sheath 168 Figure 5-13. Aliquandostipite khaoyaiensis. Ascospore with completely detached sheath 168 Figure 5-14. Aliquandostipite sunyatsenii. Vertical cryosection of ascoma 170 Figure 5-15. Aliquandostipite sunyatsenii. Superficial hyphae with stalked ascoma 170 Figure 5-16. Aliquandostipite sunyatsenii. Ascus completely filled by ascospores 170 Figure 5-17. Aliquandostipite sunyatsenii. Ascospores 170 Figure 5-18. Aliquandostipite study. Figure of most likely tree 172 xiv ACKNOWLEDGEMENTS I would like to thank first and foremost Mary Berbee for being my supervisor. Before meeting Mary, I was told she was one of those persons who 'wanted to get things done by tomorrow'. This seemed a lot better than getting nothing done at all, and I was happy to come to Vancouver to begin my grad studies in Mary's lab. I remember how impressed I was getting to know Mary. Mary's broad knowledge, interest and enthusiasm, excellent writing and editorial skills, permanent availability for questions and discussions, and her openness and en-couragements for new projects created an inspiring atmosphere to do re-search, to learn and to get things done. Thanks a lot Mary I'll miss your exper-tise. The Natural Sciences and Engineering Research Council of Canada and the University of British Columbia supported me with scholarships during my thesis. The Mycological Society of America provided funds towards travel ex-penses for meetings in Oslo, Salt Lake City and Asilomar. Thanks to all of them, as well as to my parents for their generous financial support during my studies. I would like to thank Bob Bandoni for bringing in all those freshly col-lected fungi and explaining them. Also, thanks for the useful and entertaining discussions during coffee breaks, collecting walks in the field, or over lunch at his and Alice-Ann's home. Even though I was sometimes too busy to attend coffee breaks in the heyday of fiddling with Eppendorf tubes in the lab, I would like to let Bob know that it wasn't due to lack of interest but solely due to the constraints of molecular work. Thanks also for writing all the letters of recom-mendations, they sure seemed to work. Thanks to Gil Hughes for unfortunately too few discussions on the his-tory of mycology, marine mycology and letting me borrow his books. My committee, Mary Berbee, Jeannette Whitton, Martin Adamson and Fred Ganders I would like to thank for their willingness to share ideas during meetings, as well as feedback on my reports. Without the contributions of Emory Simmons this thesis would not have been possible. I would like to thank Dr. Simmons for providing the many Stem-phylium cultures and accompanying information from his notes. Some of the information was crucial to my thesis. Thanks also for coming to Vancouver to talk Stemphylium, together with Rodney Roberts whom I would like to thank for picking up the tab of the sushi dinner in Salt Lake City where the collabora-tion on the opium poppy fungus Pleospora papaveracea was initiated. Thanks to both Nikki O'Neill and Bob Shoemaker for collaborating on P. papaveracea. Thanks so much to Margaret Barr Bigelow for being my host on Vancou-ver Island. I enjoyed two days of Margaret's company, food and house, while collecting, examining and talking ascomycetes. Also thanks for advice on col-XV lections, sending me specimens of Pleospora and for all the letters answering my questions. For more Pleospora isolates, thanks to B. Andersen, Y. R. Mehta and Jennifer Guojuan Zhang. I would also like to thank Brigitte Volkmann-Kohlmeyer and Jan Kohlmeyer for responding to my letter on Pleospora gaudefroyi, and letting me do molecular work with their favorite fungi. I was glad that Brigitte and Jan came to the MSA meeting in Asheville so that we finally did meet. Thanks to the collaborators of the Aliquandostipite paper, I hope to visit soon and renew our friendships and collaborations. Sara Landvik introduced me to molecular techniques, Mohamed Abdel-Wahab collected fungi in Thailand when I didn't feel like it, and Luo Wen made me appreciate China and organized collecting trips. I was lucky to have excellent assistance in the lab from Sea Ra Lim and Jennifer Harkness. Thanks to Jennifer for starting the mating type work, teaching me how to be organized, and for subculturing my fungi. Thanks to Sea Ra for more culture work, help with cloning in Spathulospora and all the lit-tle things throughout the years. Tamara Allen showed me many of the details of lab operations, thanks Tarn. For help with mating type evolution I would like to thank Sally Otto, and for his information on intron splice sites, Matthew Sachs. Other excellent help came from the Biolmaging Facility under the direc-tion of Elaine Humphrey, the staff of the Botany Office who helped with paper work, Dave Carmean who kept the computers running and the UBC libraries. Their efficient assistance made my life easier, thanks a lot. Thanks to my family. My parents Rolf and Beatrice Inderbitzin for finan-cial support, encouragements and keeping their house open for the occasional holidays in Switzerland. My brother Philipp for company during spring break in Florida. And thanks to my wife Fang Xin for trading her life in China as an archi-tect for life in Vancouver as an English student. Now the favors are on me. xvi CHAPTER 1. General introduction 1 1.1. The ascomycetes Fungi are important ecologically and economically, e. g. as wood degraders, mycorrhizal partners, endophytes, bread, beer, and antibiotics producers, and as human and plant pathogens. Despite these key roles, we know little about fungal diversity. Fungi are the second largest group of eukaryotes, after the insects (Hawksworth, 1991). Of an estimated 1.5 million fungal species, only 5% are currently known to science (Hawksworth, 1991). The knowledge of fungi in British Columbia is similarly poor. A six year survey of the ascomycete group Loculoascomycetes from wood found at least 25% new species in a re-stricted area in Sidney on Vancouver Island (Barr & Huhndorf, 2001). The largest group of fungi are the ascomycetes with more than 32,000 de-scribed species (Hawksworth etal., 1995). Well-known ascomycetes are Baker's yeast, Neurospora, Penicillium, athlete's foot fungus, the truffles and morels. Common to all ascomycetes is the ascus. This is a sac-like structure where karyogamy and meiosis take place, and the sexual spores are formed. The asci containing the sexual spores or ascospores are placed within a small fruitbody made up of tightly interwoven, melanized hyphae (Figure 1-1). Ascospores can be hyaline or pigmented, smooth or ornamented, and can have several transverse and lon-gitudinal septa. Interspersed among the asci are sterile hyphal filaments, the pseudoparaphy-ses. At maturity, the asci elon-gate, and the ascospores are forcibly discharged through a pore at the fruitbody apex. On the appropriate substrate, the ascospores will germinate and give rise to a mycelium that will form asexual spores or conidia. The morphol-ogy of the conidia-forming state or anamorph differs greatly from the sexual state or teleomorph. The two states can also be separated in space and time. For these reasons, the anamorph has often been given a separate name. How-ever, if the sexual state of a fungus is known, its name refers to the entire fungus. This is confusing, and authors are discouraged from creating names for asexual states, if the connection to a sexual state is known (Greuter, 2000). fruitbody wall central cavity sterile filaments ascus sexual spore (ascospore) 300 um Figure 1-1. Diagram of vertical section through fruitbody of a microscopic ascomycete. 2 1.2. On species concepts in fungi A species defined as 'the lowest principal rank in the nomenclatural hierarchy' (Hawksworth et al., 1995), can be erected based on any variable character depending on the biological circumstances (Mishler & Donoghue, 1992), views of the taxonomist or requirements of the end user. In mycology, at least five different species concepts have been used (Hawksworth et al., 1995). Three species concepts are relevant to this thesis and are briefly discussed below. These are the morphological, biological and phylogenetic species concepts. Most fungal species have been described based on morphological char-acters (Hawksworth etal., 1995). In the microscopic ascomycetes, examples of characters used for species definition are ascospore color, dimensions, mor-phology, or fruitbody size and ornamentation. The biological species concept defines species as 'groups of interbreed-ing natural populations that are reproductively isolated from other such groups' (Mayr in Wiley (1981)). Biological species have only been defined in relatively few cases in fungi. Because reproductive isolation is difficult to ob-serve in a natural setting, crossing experiments have been performed under laboratory conditions. In some cases several reproductively isolated groups within one morphological species were found (Korhonen, 1978; Kurtzman, 1 993). This outcome is not unexpected given the relatively few morphological characters available for definition of morphospecies. However, occurrence of mating in the laboratory does not necessarily imply the existence of sexual re-production in nature as sexual compatibility of geographically separate species can be a shared ancestral character. The phylogenetic species concept has become popular in fungi with the easy accessibility to DNA sequence data. As opposed to morphological and biological species concepts, it is not based on a particular type of character, but corresponds to monophyletic groups inferred from any type of character (Donoghue, 1985). Phylogenetic species recognition is the methodology that uses phylogenetic analyses based on DNA data from several loci to detect phylogenetic species (Taylor et al., 2000). Data from the different loci are combined for the inference of a phylogenetic tree. Phylogenetic species are then characterized by incongruence and low bootstrap supports within species due to sexual reproduction, and congruence and high bootstrap supports be-tween species due to reproductive isolation. Phylogenetic species recognition is particularly suitable for fungi, since it overcomes drawbacks of mor-phological and biological species concepts, which respectively are few charac-ters because of simple morphology, and the difficulties of detecting sex in na-ture. The method has been applied successfully a number of times, for exam-ple in the human pathogenic fungus Coccidioides immitis Stiles (Koufopanou et al., 1997). The morphological species C. immitis was thought to be asexual. However, phylogenetic species recognition found that C. immitis contained two 3 groups with a history of reproductive isolation, both of which were reproducing sexually (Burt et al., 1996). It was found that the two phylogenetic species were indistinguishable by morphological characters, but differed in growth rates (Fisher et al., 2002), and might differ in pathogenicity and symptoms caused in patients with coccidioidomycosis (Taylor & Fisher, 2003). The sexual states are still unknown. Thus, neither morphological nor biological species concept would have detected the two species of Coccidioides. 1.3. The ascomycete genus Pleospora Pleospora is a large, heterogenous genus with almost 1000 described species (Holm, 1962). Species of Pleospora are microscopic, to the naked eye the fruitbodies appear as black dots in the substrate (Figure 1-2). The main mor-phological character of Pleospora is the presence of both transverse and vertical septa in the ascospores, called 'muriform' ascospores (Wehmeyer, 1961) (Figure 1-3). Muriform ascospores are relatively rare in ascomycetes. However, it is easy to imagine that muriform ascospores originated repeatedly from the more common transversally septate asco-spores, and that thus Pleospora is poly-phyletic (Holm, 1962). To divide Pleo-spora into natural groupings, additional morphological characters have to be considered, both of the anamorph as well as the teleomorph (Crivelli, 1983; Eriksson, 1967). The type species of Pleospora, P. herbarum (Pers.: Fries) Rabenhorst ex Cesati & de Notaris has a Stemphylium anamorph (Simmons, 1969; 1985; 1989; 2001). As opposed to Pleospora, Stemphylium is monophyletic, and exclu-sively produces Pleospora teleomorphs (Camara et al., 2002). Thus, based on the data currently available, Pleospora is monophyletic and well defined, if re-stricted to species forming a Stemphylium anamorph, which I will refer to as Pleospora sensu stricto. Figure 1-2. Fruitbodies of Pleospora sp. strain P60 on decaying plant material. Figure 1-3. Muriform ascospore of Pleo spora gigaspora strain P134. 4 However, for most of the Pleospora species little information is available, especially about their anamorphs, and this may be one reason that this generic concept has not been published. A relatively small number of Pleospora species that differ morphologi-cally from Pleospora sensu stricto have been transferred to other genera, most of them by Crivelli (1983) and Leuchtmann (1984) who transferred 29 and six species, respectively. However, together with Pleospora sensu stricto, the 'true' Pleospora species with Stemphylium anamorph, these total fewer than 100, so that most of the estimated nearly 1000 described species of Pleo-spora remain to be evaluated (Holm, 1962). In this thesis, unless specified otherwise, Pleospora refers to species with Stemphylium anamorph, Pleospora sensu stricto. 1.4. Mating type genes In ascomycetes, sexual reproduction is controlled by the MAT locus, a master regulator of downstream gene expression (Turgeon et al., 1993). There are two MAT alleles, and only strains with different MAT alleles can mate (Kronstad & Staben, 1997). In the genus Cochliobolus in the family Pleospo-raceae as is Pleospora, the MAT alleles were shown to be necessary for mate recognition, fruitbody and sexual spore formation (Turgeon, 1998). However, exactly how the MAT locus controls gene expression is not yet known in fila-mentous ascomycetes, but is understood in considerable detail in the yeast Saccharomyces cerevisiae (Herskowitz, 1989). As Pleospora, Cochliobolus contains different life histories. There are both outcrossing and selfing species. In fungi, the term used for enforced out-crossing is 'heterothallism', whereas 'homothallism' denotes self-fertility (Hawksworth et al., 1995). In Cochliobolus, hetero- and homothallism is corre-lated with mating type gene arrangement: Heterothallic species either have a MAT1-1 or a MAT1-2 gene at their MAT locus, but homothallic species have both MAT1-1 and MAT1-2 genes. The mating type genes of homothallics in Cochliobolus are arranged in different ways, suggesting multiple evolutionary origins from heterothallics (Yun etal., 1999). In some homothallic species, an unequal crossover between MAT alleles was thought to be responsible for the presence of both MAT regions end to end at the MAT locus (Yun etal., 1999). Crossovers between MAT alleles are rare, since MAT alleles have entirely dif-ferent DNA sequences, and are thus not alleles in the true sense. The term used to describe this situation is ' MAT idiomorphs' (Metzenberg & Glass, 1990). Homothallic ascomycetes are not confined to selfing. Gibberella zeae (Schweinitz) Petch, in the subphylum Pezizomycotina as Pleospora, has both MAT genes present end to end in the genome, and can self (Yun et al., 2000). However, the same fungus has been shown to outcross under laboratory con-5 ditions, and probably does so naturally (Bowden & Leslie, 1999). Thus, the term 'homothallism' is not equivalent to 'selfing', but instead describes a con-dition in which selfing is possible but not necessarily obligate. In ascomycetes, MAT gene arrangement does not always correlate with homothallism as in Cochliobolus, because homothallism can be achieved in al-ternative ways. For example, in the secondary homothallic or pseudohomothal-lic ascomycete Neurospora tetrasperma Shear & Dodge opposite mating types are packaged into one ascospore after meiosis (Metzenberg & Glass, 1990). And in the homothallic N. africana Huang & Backus, only one MAT idiomorph has been detected (Glass etal., 1988) even though the species is self-fertile. The other MAT idiomorph might have escaped detection, or an alteration of the MAT-controlled regulatory cascade might allow the expression of the genes necessary to complete a sexual cycle. 1.5. Thesis theme and objectives My thesis uses phylogenetic DNA analyses as well as morphological examina-tion to answer questions of evolution, diversity and taxonomy in the ascomy-cete class Dothideomycetes. The first two chapters focus on Pleospora spe-cies with Stemphylium anamorphs. In chapter one, I establish a robust multi-gene phylogeny in order to group the Pleospora isolates into phylogenetic spe-cies. Morphological species of Stemphylium are represented by type strains or strains compared to type specimens, so that I can evaluate how well mor-phological species correspond to phylogenetic species. In chapter two, I investigate evolution of hetero- and homothallism in Pleospora. To determine how many times a switch from hetero- to homothal-lism or vice versa occurred, I generate phylogenetic tree topologies from MAT loci, and contrast them to the organismal phylogeny from chapter one. Invok-ing standard mechanisms of DNA rearrangement, I provide a hypothesis for the origin of the MAT gene arrangement found in selfers. In chapter 3, I contribute towards a monophyletic genus Pleospora by transferring the non-Stemphylium producing marine fungus Pleospora gaude-froyi Patouillard to the new genus Decorospora. Using ribosomal DNA se-quences, I test if Decorospora and Pleospora are monophyletic, and determine the phylogenetic placement of Decorospora. In the last chapter, I describe the new family Aliquandostipitaceae with the new genus Aliquandostipite for two novel and unusual fungi. Phylogenetic analyses with ribosomal DNA sequences are used to investigate the suspected close relationship of the two morphologically similar fungi, their relationship to the phenotypically somewhat similar genus Tubeufia, as well as to three orders in the class Dothideomycetes. 6 1.6. Bibliography B a r r , M . E . & Huhndorf , S. M . (2001). Loculoascomycetes. In The Mycota VII Part A, pp. 283-305. Edited by M . M . Lemke. Berlin, Heidelberg: Springer Verlag. Bowden, R . L . & Leslie , J . F . (1999). Sexual recombination in Gibberella zeae. Phytopathol-ogy 89,182-188. B u r t , A . , Car ter , D . A . , Koen ig , G . L . , Whi te , T . J . & Taylor , J . W . (1996). Molecular markers reveal cryptic sex in the human pathogen Coccidioides immitis. Proceedings of the National Academy of Sciences of the United States of America 93, 770-773. Camara , M . P . S., O ' N e i l l , N . R . & B e r k u m , v., P (2002). Phylogeny oi Stemphylium spp. based on ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycolo-gia 94, 660-672. C r i v e l l i , P . G . (1983). Uber die heterogene Ascomycetengattung Pleospora Rabenh.; Vorschlag fur eine Aufteilung. Ph.D. thesis. Eidgenossische Technische Hochschule, Zurich, Switzerland. Donoghue, M . J . (1985). A critique of the biological species concept and recommendations for a phylogenetic alternative. Bryologist 88, 172-181. Er iksson , O . (1967). On graminicolous pyrenomycetes from Fennoscandia. 1. Dictyosporous species. Stockholm: Almqvist & Wiksel l . Fisher , M . C , Koen ig , G . L . , Whi te , T . J . & Taylor , J . W . (2002). Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis. Mycologia 94, 73-84. Glass, N . L . , Vo l lmer , S. J . , Staben, C , Grotelueschen, J . , Metzenberg, R . L . & Yanofsky, C . (1988). D N A s of the two mating-type alleles of Neurospora crassa are highly dis-similar. Science 241, 570-573. Greuter , W . J . (2000). International Code of Botanical Nomenclature (Saint Louis Code) adopted by the Sixteenth International Botanical Congress St. Louis, Missouri, July -August 1999. Konigstein, Germany: Koeltz Scientific Books. Hawkswor th , D . L . (1991). The fungal dimension of biodiversity: Magnitude, significance, and conservation. Mycological Research 95, 641-655. Hawkswor th , D . L . , K i r k , P . M . , Sutton, B . C . & Pegler, D . N . (1995). Dictionary of the Fungi, 8 edn. Wallingford, Oxon, U K : C A B International. Herskowitz , I. (1989). A Regulatory Hierarchy for Ce l l Specialization in Yeast. Nature 342, 749-757. H o l m , L . (1962). Lewis E . Wehmeyer, a world monograph of the genus Pleospora and its seg-regates. Svensk Botanisk Tidskrift 56, 377-381. Korhonen , K . (1978). Interfertility and clonal size in the Armillariella mellea complex. Kar-stenia 18, 31-42. Koufopanou, V . , Bu r t , A . & Taylor , J . W . (1997). Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitits. Proceedings of the National Academy of Sciences of the United States of America 94, 5478-5482. Krons tad , J . W . & Staben, C . (1997). Mating type in filamentous fungi. Annual Review of Genetics 31, 245-276. K u r t z m a n , C . P . (1993). The systematics of ascomycetous yeasts defined from ribosomal R N A sequence divergence: Theoretical and practical considerations. In The Fungal holomorph: Mitotic, meiotic and pleomorphic speciation in Fungal systematics, pp. 271 -279. Edited by D . R. Reynolds & J. W . Taylor. Wallingford: C A B International. Leuchtmann, A . (1984). Uber Phaeosphaeria Miyake und andere bitunicate Ascomyceten mit mehrfach querseptierten Ascosporen. Sydowia 37, 75-194. 7 Metzenberg, R . L . & Glass, N . L . (1990). Mating type and mating strategies in Neurospora. BioEssays 12, 53-59. Mish l e r , B . D . & Donoghue, M . J . (1992). Species concepts: a case for pluralism. In The units of evolution: essays on the nature of species, pp. 121-137. Edited by M . Ereshefsky. Cambridge, M S : M I T Press. Simmons, E . G . (1969). Perfect states of Stemphylium. Mycologia 61,1-26. Simmons, E . G . (1985). Perfect states of Stemphylium. II. Sydowia, Annates Mycologici Ser. II. 38, 284-293. Simmons, E . G . (1989). Perfect states of Stemphylium. III. Memoirs of the New York Botanical Garden 49, 305-307. Simmons, E . G . (2001). Perfect states of Stemphylium: IV . Harvard Papers in Botany 6, 199-208. Taylor , D . L . , Jacobson, D . J . , K r o k e n , S., Kasuga , T. , Geiser, D . M . , Hibbett , D . S. & Fisher, M . C . (2000). Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31, 21-32. Taylor , J . W . & Fisher, M . C . (2003). Fungal multilocus sequence typing - it's not just for bacteria. Current Opinion in Microbiology 6, 351-356. Turgeon, B . G . (1998). Application of mating type gene technology to problems in fungal bi-ology. Annual Review of Phytopathology 36, 115-137. Turgeon, B . G . , Christ iansen, S. K . & Yoder , O . C . (1993). Mating type genes in ascomy-cetes and their imperfect relatives. In The fungal holomorph: mitotic, meiotic and pleo-morphic speciation in fungal systematics, pp. 199-215. Edited by D . R. Reynolds & J. W . Taylor. Wallingford: C A B International. Wehmeyer, L . E . (1961). A world monograph of the genus Pleospora and its segregates. A n n Arbor: The University of Michigan Press. Wi ley , E . O . (1981). Phylogenetics: the theory and practice of phylogenetic analysis. New York: John Wiley & Sons. Y u n , S. H . , Berbee, M . L . , Yoder , O . C . & Turgeon, G . (1999). Evolution of fungal self-fertile reproductive life style from self-sterile ancestors. Proceedings of the National Academy of Sciences of the USA 96, 5592-5597. Y u n , S. H . , A r i e , T. , Kaneko , I., Yoder , O . C . & Turgeon, B . G . (2000). Molecular organi-zation of mating type loci in heterothallic, homothallic, and asexual Gib-berellalFusarium species. Fungal Genetics and Biology 31, 7-20. 8 CHAPTER 2. Phylogenetic species of Pleospora sensu stricto 9 2.1. Introduction 2.1.1 Pleospora sensu stricto and hypotheses Fungi in the genus Pleospora are small, their sexual fruitbodies are black, and generally less than one millimeter in diameter. They have a worldwide distribu-tion, growing as saprotrophs on decaying vegetation, or as pathogens on living plants, causing damage in agriculture. Affected crops are alfalfa, clover, on-ions, garlic, asparagus, tomato, potato, ornamental flowers, and cotton (Camara et al., 2002). Sometimes the damage is severe. For example, in the 1990's in Brazil, Pleospora caused up to 100% field loss in cotton, requiring a change of the cotton cultivar (Mehta, 1998). Members of Pleospora produce both sexual and asexual spores. Sexual spores are muriform (Figure 2-1), and formed within asci that are produced inside a hard, melanized fruitbody. In Pleospora, asexual spores are muriform as well; however, they are not formed within a fruitbody, but at the tips of superficial hyphae (Figure 2-2). The sex-ual and asexual spores are often produced independently of each other in space and time. Due to these circumstances, separate names have been used for the sexual and asexual state of this organism: Stemphylium denotes the asexual state, whereas Pleospora refers to the entire fungus if a sexual state is known. Here, Pleospora is used to collectively refer to all ingroup isolates in-cluded in this study, i. e. Pleospora sensu stricto. Also, for strains without pub-lished names, Pleospora is used if the fungus was isolated from sexual spores, and Stemphylium for the strains derived from asexual spores. The primary goal of this study was to generate a robust phylogenetic hypothesis for Pleospora strains with Stemphylium anamorphs. The second goal was to apply a phylogenetic species concept to species delimitation, fo-cusing especially on the type, P. herbarum. A number of morphological similar species to P. herbarum have been published (Simmons, 1969; Simmons, 1985; Simmons, 2001). An earlier phylogenetic study based on two nuclear genes suggested that those species could not be distinguished from the type (Camara et al., 2002). I wanted to know if by using more loci and isolates, the morphological species concept would agree with the phylogenetic species con-cept. 2.1.2 Loci used for phylogenetic analyses 2.1.2.1 Ribosomal internal transcribed spacer region (ITS) The ITS region situated between the 18S and 28S ribosomal genes, has been extensively used in fungal phylogenetics at the species level. It is present in several hundred copies, homogenized by concerted evolution. In some cases, 1 o more than one ITS type per strain has been found (O'Donnell & Cigelnik, 1997). 2.1.2.2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) GPD is an enzyme involved in glycolysis. Intron-containing partial DNA se-quences of GPD have previously been used by Berbee et al. (1999) for species level phylogenetics in Cochliobolus. No evidence for the presence of multiple GPD copies was found. 2.1.2.3 Elongation factor-1 alpha (EF-1 alpha) EF-1 alpha plays an important role during protein synthesis, by catalyzing the GTP-dependent binding of aminoacyl-transferase RNA to ribosomes. In eu-karyotes, it is the second most abundant protein after actin, constituting 1-2% of the total protein in normal growing cells (Condeelis, 1995). Exonsof EF-1 alpha are highly conserved, and amino acid sequences have been used in eu-karyote phylogenetics (Baldauf & Doolittle, 1997), whereas introns were used successfully to resolve relationships between species of Fusarium (O'Donnell et al., 1998). No evidence for multiple copies of this gene has been found. 2.1.2.4 vmaA-vpsA intergenic spacer During this study, I briefly had access to the Cochliobolus heterostrophus Dre-chsler genome sequence courtesy of Syngenta, through a collaboration with B. G. Turgeon and G. Saenz of the former Torrey Mesa Research Institute in San Diego. Greg Saenz provided me with a C. heterostrophus, single copy inter-genic spacer region of ca. 700 bp in length that I could PCR amplify in Pleo-spora (see results). Blast searches at GenBank (Altschul et al., 1997) revealed that the flanking genes were most similar to the respective Aspergillus oryzae (Ahlburg) Cohn gene for vacuolar membrane ATPase catalytic subunit A (Kuroki et al., 2002), and A. nidulans (Eidam) Winter vpsA gene which is in-volved in vacuolar biogenesis (Tarutani era/., 2001). The intergenic spacer be-tween the vmaA and vpsA genes was used for phylogenetic analyses as a fourth locus. 2.2. Materials and methods 2.2.1 Fungal strains used Most strains included were retrieved from culture collections. They were se-lected to cover the genetic diversity of Pleospora in culture collections, with an emphasis on strains similar to the type species. Only Pleospora strains de-rived from type specimens or considered representative of type specimens by E. G. Simmons were given complete names. Exceptions were P. gigaspora de-termined by P. G. Crivelli, P. triglochinicola and S. astragali collected by the re-11 spective type authors and S. callistephi and S. loti possibly collected by their respective type authors (Table 2-1). For unnamed strains, the teleomorph name Pleospora was only used for strains derived from sexual spores. Unnamed strains derived from asexual spores were named Stemphylium sp., regardless if they formed the sexual state or not (Table 2-2). In total, 115 fungal strains were used for DNA sequencing, 111 were unique (Table 2-2), and four were duplicates included as controls. Most iso-lates were obtained from Dr. Emory Simmons, Crawfordsville, IN, USA. These included 99 strains of Pleospora or Stemphylium, as well as one strain of Alter-naria alternata (Fries) Keissler as an outgroup taxon. Three strains of S. loti and S. callistephi were received from Dr. Nichole O'Neill from the US Depart-ment of Agriculture, Beltsville, MD, USA. Four unnamed strains isolated from diseased cotton were obtained from Dr. Y. R. Mehta, Instituto Agronomico do Parana, Londrina, Brazil. The remaining eight strains were collected locally in British Columbia, Canada. These were Pleospora sp. strains P56, P93, P107, P301, P327, P338, P342 and P343. For the following three isolates, duplicates were included as controls: Isolate EGS 36-118, P. triglochinicola, three replicates derived from three dif-ferent ascospores, as strains P120, P123, and P130. Isolate EGS 08-174, Stemphylium sp., two replicates as strains P201 and P202, and isolate EGS 48-095, P. sedicola, as strains P211 and P271. All duplicates were sequenced for at least one locus, but only one representative per replicate was used for analyses and submitted to GenBank (strains P123, P201 and P271). Eight additional single ascospore isolates not listed in Table 2-2 and de-rived from the material of Pleospora sp. strain P56 were used to screen for MAT 1-2. 2.2.2 Fungal isolation and culture conditions Single, germinated conidia or ascospore were transferred from water agar to V8 agar plates (Hawksworth et al., 1995). All cultures were grown on V8 agar plates at room temperature prior to DNA extraction, and stored on V8 agar slants at 4°C in the refrigerator. For long term storage, strains were grown on water agar, and three mycelium-containing agar cubes of ca. 1 mm3 were placed in a tube with distilled water, and kept in the refrigerator at 4°C (Ban-doni, personal communication; Croan et al. (1999)). 2.2.3 Molecular work 2.2.3.1 DNA extraction and PCR Mycelium was scraped off the surface of a Petri plate, and DNA was extracted using a phenol-chloroform extraction method (Lee & Taylor, 1990). See chap-ter 7.1 for details. PCR reactions were performed with ReadyToGo PCR Beads, 12 or puReTaq Ready-To-Go PCR Beads (Amersham Biosciences, Piscataway, NJ, USA), following the manufacturer's instructions. Or GIBCO BRL Taq DNA po-lymerase (Life Technologies, Inc., Gaithersburg, MD) was used. See chapter 7.1 for details. For touchdown PCR, Expand High Fidelity PCR System Taq was used (Roche Diagnostics GmbH, Mannheim, Germany), on a Perkin Elmer DNA Ther-mal Cycler. Most other PCR reactions were done on a GeneAmp PCR System 9700 (PE Biosystems, Foster City, CA, USA). PCR conditions varied depending on the primers and loci and are described in detail below. 2.2.3.2 DNA sequencing 2.2.3.2.1 Set-up DNA sequencing reactions were set up using 4 ul of Big Dye Terminator Cycle Sequencing Kit v2.0 or 3.0 (Applied Biosystems, Foster City, CA, USA), 100-200 ng of PCR product, and 3.2 pmol of sequencing primer per 20 ul final re-action volume. All PCR products were completely sequenced in both directions. The sequencing PCR program used was 5 minutes initial denaturation at 95°C, 25 cycles of 10 sec at 96°C, 5 sec at 50°C and 4 min at 60°C, on a GeneAmp PCR System 9700 (PE Biosystems, Foster City, CA, USA). 2.2.3.2.2 Troubleshooting Poor DNA sequencing results were a major problem in this study. In case of ambiguous DNA sequence (mostly multiple peaks, weak signals), sequencing primers situated a few base pairs internal to the PCR primers were taken. If that did not help, new PCR and sequencing primers were designed in close proximity. If problems persisted, primer sites were moved 200 - 300 bp away from the initial site. With this approach, all sequencing problems were over-come. The reason for the sequencing anomalies remains unknown. 2.2.3.3 Primers and PCR conditions used 2.2.3.3.1 Internal transcribed spacer (ITS) Ribosomal internal transcribed spacer regions (ITS) were PCR amplified using primers ITS5 and ITS4 (White ef al., 1990), and sequenced with the same primers, or the internal ITS1 (White etal., 1990) or ITS871r (Table 2-3), 1 6 bp internal to ITS4 (Figure 2-3). If that did not work, then ITS5 was substi-tuted by the external ITS1-F (Gardes & Bruns, 1993) for PCR with ITS4, and sequenced with ITS5 or ITS1, and ITS871r. PCR conditions used were 5 min-utes initial denaturation at 95°C, 40 cycles of 10 sec at 95°C, 20 sec at 55°C and 30 sec (+4 sec/cycle) at 72°C, followed by a final extension of seven minutes at 72°C. 2.2.3.3.2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) 1 3 Primers used were GPD1 and GPD2 (Berbee et al., 1999). A new forward primer designed from Stemphylium GPD sequences was GPD2033f (Table 2-3), 17bp downstream of GPD1 (Figure 2-3). Based on Cochliobolus lunatus (Gen-Bank X58718) and C. heterostrophus (GenBank X63516) GPD sequences, the following additional primers were designed: GPD2669r, a reverse primer 28bp downstream of GPD2, and GPD3r, a reverse primer 163 bp downstream of GPD2 (Table 2-3). PCR conditions used were 5 minutes initial denaturation at 95°C, 40 cy-cles of 10 sec at 95°C, 20 sec at 60°C and 30 sec (+4 sec/cycle) at 72°C, followed by a final extension of seven minutes at 72°C. PCR amplifications were done using GPD1 and GPD3r, and sequenced with GPD1 and GPD2, or GPD2033f and GPD2669r if the former primers did not sequence well. 2.2.3.3.3 Elongation factor-1 alpha (EF-1 alpha) Primers used were designed based on EF-1 alpha DNA sequences of Aureobasidium pullulans (GenBank U19723) and Podospora anserina (GenBank X74799) (Table 2-3; Figure 2-3). Forward primers designed were EF446f, EF451f and EF462f at positions 78, 106, and 117 of P. anserina, respectively. Reverse primers were EF1598r, EF1473r, and EF3R at positions 886, 766, 654 of P. anserina, respectively. PCR products were obtained with combina-tions of EF446f/EF1473r or EF1598r. For reamplification of weak PCR bands, one initial PCR primer was substituted with an internal primer. PCR products were sequenced with EF451f or EF462f, and EF3r. In some cases other primer combinations for PCR and sequencing were used to obtain satisfactory DNA sequences. PCR conditions used were 5 minutes initial denaturation at 95°C, 40 cycles of 10 sec at 95°C, 20 sec at 52°C and 30 sec (+4 sec/cycle) at 72°C, followed by a final extension of seven minutes at 72°C. For reamplifica-tion, an annealing temperature of 55°C and 40 cycles were used. For S. lancipes isolate P229, S. trifolii isolate P244, and Stemphylium sp. isolate P246, initial PCR reactions yielded weak bands of ca. 2.5 kbp. To obtain sufficient PCR product for DNA sequencing, two sets of touchdown PCR with hotstart conditions were employed. Each set consisted of 20 cycles with de-creasing annealing temperature, and 20 cycles with stable annealing tempera-ture. In the first set, an initial denaturation step (2 min at 94°C) was followed by 20 cycles of denaturation (10 sec at 94°C), annealing (20 sec first at 70°C, then -0.5° per cycle), and extension steps (first 30 sec, then +4 sec per cycle at 72°C), followed by 20 cycles of denaturation (10 sec at 94°C), an-nealing (20 sec at 60°C), and extension (first 1 min, then +4 sec per cycle at 72°C), and a final extension step of 7 min at 72°C. The second set used inter-nal primers on a 100 times dilution of the PCR product from the first round, and the same PCR conditions as in the first round, except for 5°C lower an-14 nealing temperatures, and a one minute longer extension time for the last 20 cycles. A hotstart protocol was followed in both sets of PCR. The PCR cocktail was prepared without the addition of Taq polymerase. 12.5 ul of template were added, overlaid with a drop of mineral oil and the PCR program started. Once the tubes were heated to 94°C, 0.5 ul of Expand High Fidelity PCR Sys-tem Taq was used (Roche Diagnostics GmbH, Mannheim, Germany), and the PCR program left to run as described above. Primers used for PCR and DNA sequencing of S. lancipes isolate P229, S. trifolii isolate P244, and Stemphylium sp. isolate P246 were as follows: PCR of S. lancipes isolate P229 was with EF446f/EF1473r, reamplified with EF451f/EF1473r, sequenced with EF462f, EFP229f, EfallF2, EfallF, and reverse primers EF3R, EFLr, EFAIIr (Table 2-3). PCR of S. trifolii isolate P244 was with EF446f /EF1473r, reamplification with EF451f/EF3r, and sequenced with EF462f, EFLf, EFAIIf2, EFAIIf, EF3r, EfLr, EFAIIr. PCR of Stemphylium sp. isolate P246 was like S. trifolii isolate P244, sequencing with EF462f, EFP246f, EFAIIF2, EFAIIf, and EF3r, EFLr, EFAIIr. The sequencing of outgroup strain Alternaria alternata isolate P95 was not straightforward. The 5'-end was obtained with primer pair EF451f/EF1473r, and sequenced with EF462f, EF1473r and EF2r (Table 2-3). However, the 3'-end of this sequence was not alignable with the other se-quences, and it was assumed that during PCR, the reverse primer EF1473r bound upstream of its intended site, within the A. alternata isolate P95 intron. To obtain the 3'-end, the primer 95f was designed downstream of the intron 3'-end (Table 2-3; Figure 2-3), and used together for PCR and sequencing with Efr designed ca. 280 bp downstream of EF1598r. 2.2.3.3.4 vmaA-vpsA intergenic spacer The DNA sequences of two adjacent Cochliobolus heterostrophus genes sepa-rated by a spacer of ca. 700 bp were obtained from the former Torrey Mesa Research Institute (G. Saenz and B. G. Turgeon, personal communication). To design primers amplifying the intergenic spacer between the vmaA and vpsA homologs in Pleospora, portions of the adjacent gene flanks were amplified using primers designed based on regions conserved in C. heterostro-phus and sequences retrieved from GenBank. These were the A. oryzae vmaA (GenBank AB073302), and A. nidulans vpsA genes (GenBank AB074883). For the vmaA homolog, an approximately 310 bp portion ca. 480 bp upstream of the 3'-end of the gene, was PCR amplified with primers VATP2949f, and VATP3238r (Table 2-3; Figure 2-3). For the vpsA homolog, approximately 170 bp downstream of the 5'-end, a ca. 530-bp fragment was PCR amplified with primers GTP446f and GTP980r. Subsequently, P/eospora-specific forward and reverse primers were designed on the sequences obtained. For vmaA, 1 5 VATP3195f and AiF were designed 235 and 218 bp upstream of the A. oryzae vmaA gene 3'-end, respectively. Then, based on VATP3195 Pleospora se-quences, AN1 and ATPF2 were designed 179 and 113 bp upstream from the A. oryzae vmaA 3'-end, respectively. For the vpsA gene, GTP604r and GTPr were designed 244 and 57 bp downstream of the A. nidulans vpsA 5'-end, re-spectively. Isolates were initially PCR amplified with primer pair VATP3195f/GTP604r, and sequenced with ATPF2/GTP604r. For isolates that did not sequence well, other primer combinations for PCR and sequencing were used, most successfully PCR with AiF/GTP604r, and sequencing with AiF, GTP604r or GTPr, as well as internal primers AGf, and its reverse complement AGr (Table 2-3; Figure 2-3). 2.2.4 Phylogenetic analyses 2.2.4.1 DNA sequences DNA sequences were assembled using AutoAssembler version 1.4.0 (Applied Biosystems, Perkin Elmer Corp., Norwalk, Connecticut, USA) and DNA sequence alignments were generated by ClustalX (1.8) (Thompson et al., 1997) using default settings, and manually optimized in Se-AI v1.d1 (Rambaut, 1995). Phylogenetic analyses were performed using PAUP* 4.0b10 for parsi-mony, likelihood and Neighbor joining analyses (Swofford, 2002), and MrBayes v3.0b4 for Bayesian analyses of phylogeny (Huelsenbeck & Ronquist, 2003). For the inference of most parsimonious trees, 30 heuristic searches us-ing random taxon addition replicates were done with default settings, including gaps coded as missing characters. Bootstrap support for the branches was based on 500 replicates, using random taxon addition and otherwise default settings. For likelihood analyses, necessary parameters such as base frequencies, transition - transversion ratio, proportion of invariable sites, and gamma shape parameter was estimated from a most parsimonious tree. The gamma distribu-tion was approximated by four rate categories. Most likely trees were esti-mated using 30 heuristic searches with random taxa addition and otherwise default settings. Bootstrap support values were based on a varying number of random taxa addition replicates, with the number of branch rearrangements limited at times to overcome computational limitations. Neighbor joining analyses were done using likelihood modeled distances with parameters estimated on a most parsimonious tree. Branch support was evaluated with 500 bootstrap replicates. For Bayesian analyses, a general time reversible model of evolution was used. Rate heterogeneity across sites was modeled with a gamma distribution. Four chains starting with a random tree were run for one million generations, 16 retaining each 100th tree. The first 1000 trees of the 10,000 collected trees were discarded, and the subsequently calculated consensus trees were based on the remaining 9000 trees. The 50% majority rule consensus tree was cal-culated in PAUP*. 2.3. Results 2.3.1 DNA sequences 2.3.1.1 Ribosomal internal transcribed spacer region (ITS) Pleospora sequences were submitted to GenBank (103 sequences, AY329168 - AY329270). Sequence length was between 482 and 493 bp. Eight homolo-gous regions were retrieved from GenBank. S. callistephi (AF442783), two strains of S. loti (AF442789, AF442788), four Stemphylium sp. sequences (AF203451, AF203448, AF203449, AF203450), and Alternaria alternata (AF347031). The resulting alignment thus contained 111 taxa, was 502 characters in length, and was mapped as follows: Positions 1-166 ITS1, 167-324 5.8S, 325-502 ITS2. 2.3.1.2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) Pleospora sequences were submitted to GenBank (107 sequences, AY316968 - AY316973, AY316975 - AY316978, AY316980, AY316982 - AY316989, AY316991 - AY317074, AY534637 - AY534640). The four Stemphylium sp. strains P406 - 409 sequenced were the same isolates for which ITS sequences were retrieved from GenBank. Sequences were between 500 and 508 bp in length, they corresponded to bases 1069 - 1578 of the C. lunatus DNA GPD sequence from GenBank (X58718). Four homologous regions were retrieved from GenBank for inclusion in the alignment: Stemphylium callistephi (AF443882), two strains of S. loti (AF443888, AF443887) and A. alternata (AY278808). The alignment thus contained 111 taxa and 511 characters. In-tron-exon designations in the GPD alignment were by comparison to the C. lu-natus sequence: Intron positions 1-37, exon 38-101, intron 102-216, exon 217-505. 2.3.1.3 Elongation factor-1 alpha (EF-1 alpha) Pleospora and A. alternata sequences were submitted to GenBank (110 Pleo-spora sequences, AY324671 - AY324776, AY534633 - AY534636, and AY438647 5'-end and AY438648 3'-end of A. alternata). For S. callistephi strain P383, S. loti strains P384 and P385 and A. alternata strain P95 the same isolates were used for which ITS and GPD sequences were retrieved from GenBank. Sequences of Pleospora were between 684 bp and 2313 bp in 1 7 length. To designate position numbers and introns for the Pleospora se-quences, homologous nucleotide positions and homologous introns from Podospora anserina (GenBank X74799) were specified. Stemphylium se-quences started between positions 605 - 628 in intron number 3 (intron ends in P. anserina at position 792), across exon number 4 and intron number 4, to position 1307 in exon number 5. The outgroup A. alternata strain P95 se-quence was 528 bp in length and intron number 4, along with 106 bp of exon number 5 were not sequenced. The alignment was 3145 characters in length. The large difference in size among the Pleospora EF-1 alpha sequences were due to the introns present approximately at the position of intron num-ber 4 in P. anserina, the internal intron in Figure 2-3. The introns at this posi-tion varied in size from 49 - 1678 bp (Table 2-4). Intron lengths were deter-mined using amino acid translations of the adjacent coding regions, and as-suming intron consensus splice sites of 5'-GT and AG-3'. Introns generally di-verged little between closely related isolates, but were too divergent to be aligned between the groups (data not shown). For this reason, intron data could not be analyzed using phylogenetic methods. Introns were instead classi-fied into groups based on their visually assessed similarity. There were eight different groups of intron sequences. Introns from each group were present in one to 67 isolates (Table 2-4). Introns were inserted at four positions, corre-sponding to P. anserina (GenBank X74799) positions 912 or 913 for two groups of isolates, and positions 929 or 932 for the remaining six groups (Table 2-4). Three of the introns contained ORFs from 141 - 1440 bp long. These are described below in detail. 2.3.1.3.1 Protein encoding EF-1 alpha introns The intron of three not closely related Stemphylium isolates encoded a pro-tein. These were the introns from S. lancipes strain P229, S. trifolii strain P244 and Stemphylium sp. strain P246. The introns of these three isolates were all inserted at position 929 of GenBank sequence X74799 (Table 2-4), and were 1501 - 1678 bp in length, containing an ORF of 834 - 1440 bp, which at the 3'-end comprised a protein whose DNA sequence was 507 - 1389 bp in length (Table 2-5). The protein was similar in the three isolates, an alignment of the overlapping translated protein sequences was 160 amino acids in length, with 75% identical sites and two gaps (data not shown). All three proteins were most similar to a hypothetical protein from Gibberella zeae (GenBank XP_381390), with a random match probability equal or smaller than 10'14, and at least 28% amino acid identity (Table 2-5). Using a PFAM protein online search (Bateman et al., 2004), it was determined that the proteins contained a zinc finger domain of the C2H2 type, involved in nucleic acid binding. An EF-1 alpha gene was not present in G. zeae near the gene encoding the hypo-thetical protein (data not shown). 18 The large introns of S. lancipes strain P229, S. trifolii strain P244 and Stemphylium sp. strain P246 also differed from all other sequenced Pleospora introns in that they were not delimited by the standard GT intron splice site at the 5'-end, but by 5'-GGT (data not shown). The 3'-end was a standard AG-3'. All attempts to splice the intron at a 5'-GT resulted in a reading frame shift and an early stop codon (data not shown). 5'-GGT splice sites are known from mammals (Burset et al., 2000). However, experimental evidence for the splic-ing at 5'-GGT in the three Stemphylium isolates is lacking. 2.3.1.4 vmaA-vpsA intergenic spacer Pleospora and A. alternata sequences were submitted to GenBank (53 Pleo-spora sequences, AY329271 - AY329323, and AY329324 from A. alternata). The final alignment was 718 characters in length. It contained the following features: Positions 1-42 vmaA, 43-718 intergenic spacer. 2.3.2 Verification of results Mislabeling, contamination and mixing up of samples is a concern in phyloge-netics. To check for human error, after preliminary phylogenetic analyses (data not shown), seven suspicious strains were reordered from E. G. Simmons, re-isolated as single conidia, and resequenced for ITS, GPD and EF-1 alpha loci. The strains were Stemphylium sp. strain P210, S. lancipes strain P229, S. so-lani P240, S. trifolii strain P244, Stemphylium sp. strain P246, P. paludiscirpi strain P270, Stemphylium sp. strain P303. All sequences were identical to pre-viously obtained ones (data not shown). Using GenBank Blast searches, 39 of my ITS and GPD sequences were compared to homologous sequences from GenBank from identical or conspecific strains. No evidence for major error was found. Some of my sequences differed from the GenBank sequences in single nucleotide positions. Rechecking my data did not require any changes (data not shown). Additionally, identical ITS, GPD and EF-1 alpha DNA sequences of P. triglochinicola strain P123 were independently generated from isolates P120 and P130 derived from three different ascospores from the same ascoma. This is a likely outcome in the case of progeny from the same parents. ITS, GPD, EF-1 alpha and vmaA-vpsA sequences identical to S. astragali strain P201 were obtained from S. astragali strain P202, both of which derived from the same isolate, EGS 08-174. Stemphylium sp. strain P211 and P. sedicola strain P271 were both derived from isolate EGS 48-095, and gave identical ITS, GPD and EF-1 alpha DNA sequences (data not shown). Thus, no evidence for major se-quencing errors was found. 1 9 2.3.3 Protein sequences 2.3.3.1 Glyceraldehyde-3-phosphate dehydrogenase (GPD) There was one amino acid substitution in the GPD dataset. Amino acid number 1, a V is changed to I in S. sarciniforme strain P239, Stemphylium sp. strains P309 and P310, S. sarciniforme strain P247, Stemphylium sp. strain P306, S. solani strain P240, Stemphylium sp. strains P241, P252 and P253, and in S. callistephi strain P383 (data not shown; Figure 2-5). 2.3.3.2 Elongation factor-1 alpha (EF-1 alpha) There was only one amino acid substitution in the EF-1 alpha dataset. Amino acid 84 changed from P to V in the group with S. sarciniforme strain P239, Stemphylium sp. strains P309 and P310, as well as in the group with S. sarcini-forme strain P247, with Stemphylium sp. strain P306 (data not shown; Figure 2-5). 2.3.3.3 vmaA-vpsA intergenic spacer Only for 14 predicted amino acids at the 3'-end of vmaA DNA sequence cov-erage was obtained. Out of the 14 amino acids, four were constant, five were parsimony-uninformative, and five were parsimony-informative (data not shown). However, the low number of characters did not allow the inference of a phylogeny with a well-supported branching order. 2.3.4 Phylogenetic analyses 2.3.4.1 Selection of representative isolates for vmaA-vpsA sequencing ITS, GPD and EF-1 alpha datasets were combined and analyzed with parsimony, gaps were treated as fifth character. The combined dataset contained 111 Pleospora taxa and 1653 characters, the EF-1 alpha internal intron was ex-cluded from analyses. The analysis was aborted after it ran out of memory (data not shown). In order for analyses to be completed, only one genotype from each clade with identical branch length was retained, resulting in a total of 39 unique multilocus genotypes (Table 2-6). The parsimony analysis was repeated with the 39 taxa and gaps were coded as missing data. The analysis resulted in 572 most parsimonious trees, of 471 steps each (CI = 0.735, RI = 0.893) (Figure 2-4). 2.3.4.2 Parsimony analyses of single datasets for representative isolates From the 110 Pleospora isolates for which the ITS, GPD and EF-1 alpha loci were sequenced, 53 representatives were chosen for sequencing of the addi-tional vmaA-vpsA locus (Figure 2-4). The resulting, reduced datasets were first analyzed separately for each locus, in each case using only unique geno-20 types to speed up analyses. The reduced single datasets were then tested for combinability prior to pooling them for combined analyses using four different algorithms. 2.3.4.2.1 Ribosomal internal transcribed spacer region (ITS) The reduced ITS dataset of 53 representative isolates contained all 19 ITS genotypes obtained for the 110 Pleospora isolates (Table 2-7). The alignment thus comprised 19 taxa, and was 502 characters in length. 45 characters were variable (9.0%), of which 13 were parsimony informative (2.6%). The search resulted in 56 most parsimonious trees, 54 steps each (Cl = 0.889, Rl = 0.864). The bootstrap analysis was done with only the informative characters included. Only the grouping of S. sarciniforme strain P239 and S. loti strain P384 received more than 70% bootstrap support (81%) (Figure 2-5). 2.3.4.2.2 Glyceraldehyde-3-phosphate dehydrogenase (GPD) The reduced GPD dataset of 53 representatives contained 27 genotypes, in-cluding all but three genotypes of the 110 Pleospora isolates (Table 2-8). The genotypes of Stemphylium sp. strains P212 and P221 were not included, they were represented by the closely related Pleospora sp. strain P107 (Figure 2-4). The genotype of the Stemphylium sp. strain P407 was represented by S. solani strain P240. The alignment used for phylogenetic analyses thus con-tained 27 taxa, and was 511 characters in length. 130 characters were vari-able (25.4%), of which 89 were parsimony informative (17.4%). The search resulted in 18 most parsimonious trees, 211 steps each (Cl = 0.735, Rl = 0.854). The bootstrap analysis was done with only the informative characters included. Twelve groupings received more than 70% bootstrap support (Figure 2-5). 2.3.4.2.3 Elongation factor-1 alpha (EF-1 alpha) The reduced EF-1 alpha dataset of 53 taxa contained 28 of the 30 EF-1 alpha genotypes from the 110 Pleospora isolates (Table 2-9), not considering the EF-1 alpha internal intron (Figure 2-3). Excluded were Stemphylium sp. strain P221 and S. solani strain P241, close relatives of the included Pleospora sp. strain P107 and S. solani strain P240, respectively. Thus, the dataset used for analyses contained 28 taxa and 640 characters. 123 were variable (19.2%), of which 70 were parsimony informative (10.9%). The search resulted in 64 most parsimonious trees, 191 steps long (Cl = 0.738, Rl = 0.837). The bootstrap analysis was done with only informative characters in-cluded. Thirteen groupings received more than 70% bootstrap support (Figure 2-5). 21 2.3.4.2.4 vmaA-vpsA intergenic spacer The 53 Pleospora isolates sequenced for vmaA-vpsA had 28 unique genotypes (Table 2-10). The alignment used in this single locus analysis thus contained 28 taxa and 718 characters. 247 characters were variable (34.4%), of which 184 were parsimony informative (25.6%). The search resulted in 24 most par-simonious trees, 388 steps long (CI = 0.771, RI = 0.933). The bootstrap analysis was done with only informative characters in-cluded. Thirteen groupings received more than 70% bootstrap support (Figure 2-5). 2.3.4.3 Test for combinability of ITS, GPD, EF-1 alpha and vmaA-vpsA datasets A partition homogeneity test was used to assess the phylogenetic conflict be-tween small ITS, GPD, EF-1 alpha and vmaA-vpsA datasets. Due to limitations of available computational power, only the unique 35 multilocus genotypes (Table 2-11), and informative characters were included in the analyses. The internal EF-1 alpha intron was excluded. The dataset thus contained 35 taxa and 370 characters. The partition homogeneity test judged the four datasets not to be significantly different, as out of 1000 sets of resampled datasets, only 821 were longer than 655 steps, the sum of the single most parsimoni-ous trees based on informative characters (P = 0.179). 2.3.4.4 Analyses of combined ITS, GPD, EF-1 alpha and vmaA-vpsA dataset A combined ITS, GPD, EF-1 alpha and vmaA-vpsA dataset without the second EF-1 alpha introns was investigated for phylogenetic structure. The dataset contained 53 taxa and 2371 characters. For analyses, only unique multilocus genotypes were included, so that the number of taxa was reduced to 35 (Table 2-11). Four different phylogenetic methods were used. These were par-simony, likelihood, Bayesian analyses, and Neighbor joining. 2.3.4.4.1 Parsimony In parsimony analyses, 24 most parsimonious trees of 860 steps each were found (CI = 0.748, RI = 0.886) (Figure 2-6). The most parsimonious trees dif-fered by the disposition of branches with 52% or lower bootstrap support (data not shown). The position of the P. gigaspora strain P129 and S. majus-culum strain P262 containing group was interchanged, and combined with rear-rangements in the sister group to Stemphylium sp. strain P303. Stemphylium sp. strains P272, P273, P277 and the five isolates identical to Stemphylium sp. strain P235 were either polyphyletic or monophyletic, of varying topology. Branches supported by more than 70% of the bootstrap replicates are num-bered in Figure 2-6, and support percentages are listed in Table 2-12. 2.3.4.4.2 Likelihood 22 One most likely trees was obtained (-In likelihood = 8367.9). Its topology was identical to the most parsimonious tree in Figure 2-6. Bootstrap support for the branches was based on the evaluation of 124 replicates. Branch swapping was limited to 10,000 per replicate due to computational limitations. Branches supported by more than 70% of the bootstrap replicates are numbered in Figure 2-6, and support percentages are listed in Table 2-12. 2.3.4.4.3 Bayesian analyses The Bayesian 50% majority rule consensus tree with branch lengths, based on 9000 trees, was identical in topology to one of the 24 most parsimonious trees (data not shown). Differences to the most parsimonious tree shown in Figure 2-6 involved the topology of the sister group to Stemphylium sp. strain P303, among which the monophyly of Stemphylium sp. strains P235 and iden-tical taxa plus Stemphylium sp. strain P277 was supported by 74% posterior probability (data not shown). The remainder of the posterior probabilities above 70% are numbered in Figure 2-6, and values listed in Table 2-12. 2.3.4.4.4 Neighbor joining In Neighbor joining analyses, a maximum likelihood model for distance calcula-tions was used with the same parameters employed as in the likelihood analy-ses. The Neighbor joining tree differed from the most parsimonious tree illus-trated in Figure 2-6 by the following alterations. These were rearrangements in the sister group of Stemphylium sp. strain P303, as well as P. tarda strain P1 plus identical taxa being sole sister group to the taxa ranging from P. eturmi-una strain P269 to Stemphylium sp. strain P235, and S. lancipes strain P229 being sister taxon to S. solani strain P240 plus identical taxa and S. callistephi strain P383. None of these branches was supported by more than 50% of the replicates in the Neighbor joining bootstrap analyses, and thus compatible with the most parsimonious trees. Branches supported by more than 70% of the bootstrap replicates are numbered in Figure 2-6 and the support percentages are listed in Table 2-12. 2 .4. Discussion 2.4.1 Phylogenetic relationships in Pleospora 2.4.1.1 Comparison to other studies Results obtained agreed with other studies of molecular evolution in Pleospora (Camara et al., 2002; Mehta et al., 2002). Camara et al. (2002) used ITS and GPD DNA sequences to analyze phylogenetic relationships for 37 isolates of Pleospora, 20 of which were iden-tical to isolates included in this study. We used 110 isolates that were se-23 quenced for the three loci ITS, GPD and EF-1 alpha, as well as the additional vmaA-vpsA locus for 53 representative isolates. Since this study was based on more loci and isolates than that of Camara et al.'s (2002) and an outgroup was not included, some novel or more highly supported clades were obtained. Camara et al. (2002) recognized five monophyletic groups in Pleospora, A - E. The five groups were also obtained here, each one supported by 100% of the bootstrap replicates in all the multilocus analyses (Figure 2-6). Relevant additions of this study to Pleospora phylogenetics are restricted to groups C, D and E, and are discussed below by comparison to the combined ITS/GPD phylogeny in Camara et al. (2002). Group C contained the type species of Pleospora, P. herbarum. It re-ceived 100% support in all combined four loci analyses in this study, and 72% in Camara et al. (2002). My results added four additional representatives of morphological species (Figure 2-6). These were P. tomatonis strain P268, P. sedicola strain P271, P. gigaspora strains P129, and P. eturmiuna strain P269. Pleospora tomatonis strain P268 and P. sedicola strain P271 grouped with P. herbarum strain P2, P. alfalfae strain P81, S. vesicarium strain P238, as well as unnamed strains, with 100% support in all analyses, as compared to 89% ob-tained by Camara et al. (2002). The sister group to the previous taxa was P. gracilariae strain P243 and Stemphylium sp. strain P315 with at least 86% bootstrap support (Figure 2-6). The next well supported node included all the previous taxa, plus S. majusculum strain P262 with unnamed Stemphylium sp. strain P311, P. gigaspora strains P122 and P129, and S. astragali strain P201 in the combined four loci analyses with at least 90% of the bootstrap repli-cates (Fig. 6). Pleospora eturmiuna strain P269, as well as unnamed taxa were the sister group to all the previous taxa, with 100% support in all combined four loci analyses, as opposed to 72% in Camara et al. (2002). Group D received 100% support in all combined four loci analyses (Figure 2-6), and 76% in Camara et al. (2002). Group E also received maximal support, and 89% in Camara et al. (2002). Group E in this study is more diverse than previously, when it used to contain five lineages (Camara et al., 2002). My results added seven potential new lineages (Figure 2-6), represented by P. paludiscirpi strain P270, Pleo-spora sp. strains P56, P107, and P327, Stemphylium sp. strains P210 and P246, as well as S. sarciniforme strain P247. Pleospora paludiscirpi strain P270, Pleospora sp. strain P327 and another unnamed strain, as well as Stem-phylium sp. strain P210 were monophyletic together with the previously in-cluded P. triglochinicola strain P123 with 100% support in all combined four loci analyses. Pleospora sp. strain P56 grouped with the previously included Stemphylium sp. strain P227, as well as unnamed isolates, with 100% boot-strap support in the ITS/GPD/ EF-1 alpha analyses (vmaA-vpsA was not se-quenced for Stemphylium sp. strain P227) (Figure 2-4). Stemphylium sarcini-24 forme strain P247 and unnamed isolates grouped with maximal support in all combined four loci analyses with S. sarciniforme strain P239 plus unnamed isolates. Stemphylium sp. strain P246 was the most distant one of the new group E taxa, as it did not show any clear affinity to a particular monophyletic group (Figure 2-6). Although included in the Camara et al. (2002) study, S. lancipes strain P229 was not attributed to any of the groups. In this multigene analyses, it was sister taxon to group B, with little support except in the Bayesian analysis (Figure 2-6). The phylogenetic position of S. lancipes strain P229 is thus doubtful, and for the sake of completeness, it is placed in its own group, group F. The four Stemphylium sp. strains P406 to 409, have been used in a phylogenetic study of cotton pathogens in Brazil by Mehta et al. (2002). Stemphylium sp. strain P406 differed from the other three strains in RAPD pattern and ITS sequence. This correlated with our results that place Stem-phylium sp. strain P406 into group A, whereas Stemphylium sp. strains P407 to P409 group with S. solani strain P240 in group D (Figure 2-4). The RAPD pattern of Stemphylium sp. strain P409 differed slightly from Stemphylium sp. strains P407 and P408 (Mehta et al., 2002). This difference is consistent with results from this study, where Stemphylium sp. strains P407 and P408 have identical sequence for ITS, GPD and EF-1 alpha, differing by one substitution from Stemphylium sp. strain P409 (vmaA-vpsA was not sequenced for these isolates). Another difference between Stemphylium sp. strains P407 and P408, and Stemphylium sp. strain P409 are the host and lack of virulence in strain P409 (Mehta et al., 2002). 2.4.1.2 Datasets and phylogenetic signal Combination of the single datasets into one analysis increased the bootstrap support values of the branches, as can be expected (Huelsenbeck et al., 1996). However, the addition of the vmaA-vpsA dataset did not notably im-prove the resolution: All the branches supported with 100% of the bootstrap replicates in the four loci analyses also were supported by 100% in the com-bined YTS/GPD/ EF-1 alpha parsimony analysis (Figure 2-4; Figure 2-6). In single dataset analyses, ITS was the only dataset where not all groups were recog-nized, but only groups B and E (Figure 2-5). This can be explained by the lower information content of ITS as compared to the other loci (Table 2-13). 2.4.1.3 Rooting of phylogenetic trees Camara et al. (2002) used several outgroup taxa to root the Pleospora phyto-genies. They showed that the genus was monophyletic. In this study, rooting was attempted using the outgroup Alternaria alternata strain P95, a possible closest relative to the genus Pleospora (Berbee etal., 1999). However, the A. 25 alternata strain P95 DNA sequences were difficult to align with the ingroup se-quences, prolonged phylogenetic analyses, and lowered bootstrap support val-ues of the branches (data not shown). Thus, the outgroup was omitted. The trees in Figure 2-4, Figure 2-5 and Figure 2-6 are presented as rooted, based on data from mating type phylogenies (see section on MAT protein phyloge-nies on page 81). 2.4.1.4 The internal protein encoding EF-1 alpha intron It is puzzling that the internal EF-1 alpha intron encoded a similar protein in three not closely related isolates of Stemphylium. Additionally, the respective introns had other unique features in common, such as their unusual length, and delimitation by a non-standard intron splice site. The internal intron of S. lancipes strain P229, S. trifolii strain P244 and Stemphylium sp. strain P246 was 1501 - 1678 bp in length, much longer than the S. callistephi strain P383 intron with 199 bp, the longest EF-1 alpha inter-nal intron of the remaining isolates (Table 2-4). EF-1 alpha introns were also much shorter in other fungi. In Aureobasidium pullulans and Neurospora crassa, also members of the subphylum Pezizomycotina, the introns in the EF-1 alpha gene were below 250 bp in length (Ichiishi & Inoue, 1995; Thornewell era/., 1995). In Saccharomyces cerevisiae (Cottrelle era/., 1985), there were no in-trons in the EF-1 alpha gene, and in the basidiomycete Schizophyllum com-mune, the longest EF-1 alpha intron was 55 bp in length (Wendland & Kothe, 1997). Another shared feature of the internal intron of the three isolates was the non-canonical GTT splice site at the intron 5'-end. Splice sites of this kind are known from only nine cases in mammals (Burset etal., 2000). They were nicknamed 'parasitic' splice sites, because the conventional 5'-GT was hy-pothesized to be 'exploited' by the 5'-GGT site for the assemblage of the splicing machinery (Burset etal., 2000). The third shared feature was the similar, intron encoded protein. It con-tained a zinc finger domain of the C2H2 type that is involved in nucleic acid binding and was most similar to an unknown protein in the ascomycete Gib-berella maydis with a random match probability as low as 9 x 102 7 (Table 2-5). The G. maydis protein was not encoded in an EF-1 alpha intron. It is not known if the zinc finger protein is expressed in the three Stemphylium isolates, or what its origin is, especially since the isolates concerned are not closely re-lated (Figure 2-6). It might be suspected that the unusual intron length, the presence of the intron-encoded protein, and 'parasitic' intron splice site interfere with the expression of EF-1 alpha, the second most abundant protein in eukaryotes (Condeelis, 1995). However, the growth rates of cultures of S. lancipes strain P229, S. trifolii strain P244 and Stemphylium sp. strain P246 were not obvi-26 ( ously different from other Pleospora isolates. No evidence for more than one copy of EF-1 alpha was found in this study. 2.4.2 Phylogenetic species in Pleospora In this study, 22 phylogenetic species were found using the phylogenetic spe-cies recognition approach (Table 2-14). This methodology has been used in mycology to detect reproductively isolated groups within morphological spe-cies (Taylor et al., 2000). It involves the generation of gene phylogenies with a taxon sampling covering the genetic diversity of the species in question. Datasets are combined for phylogenetic analyses, and strains that group to-gether with high support are designated phylogenetic species. Phylogenetic species are groups of individuals that have shared a history of sexual repro-duction, as opposed to biological species that are groups of presently sexually compatible individuals (Mayr in Wiley (1 981)). On the level of phylogenetic trees, a shared history of sexual recombination manifests itself in discordant topologies within phylogenetic species, and concordance of the branching or-der among phylogenetic species. New phylogenetic species have successfully been defined with, for instance, 17-46 isolates, and 4 -5 loci (Geiser et al., 1998; Kasugaefa/., 1999; Koufopanou et al., 1997). In this study, 110 isolates were used for sequencing of three loci, of which 53 representatives were chosen for the sequencing of an additional fourth locus. However, the intent of the taxon sampling was not to cover the entire diversity of Pleospora in detail, but it was focused on the diversity around the type of Pleospora, P. herbarum strain P2. Thus, of the 22 phyloge-netic species found, only four contained more than five isolates, and in five cases, single isolates were designated phylogenetic species (Table 2-14). These isolates were designated as separate phylogenetic species because they seemed too divergent to be included in phylogenetic species together with re-lated isolates. In order to prove the status of most postulated phylogenetic species as constituting natural, reproductively isolated groups, additional studies with more isolates are necessary. When investigating the relationships between morphological and phylo-genetic species, it is crucial to include representatives of morphological spe-cies in the phylogenetic analyses. In this way, phylogenetic species can be tied to morphological species, preferably directly to type material. If type material of morphological species is not available for DNA sequencing, then a represen-tative has to be chosen by morphological comparison with the original type material. In agreement with Camara et al. (2002), in Pleospora morphological and phylogenetic species correlated rather well. Of the 22 phylogenetic species, nine contained just one isolate representative of the type of a morphological species (Table 2-14). The phylogenetic species P. herbarum comprised five 27 types, and the phylogenetic species S. xanthosomatis might contain S. ly-copersici which has no known type (E. G. Simmons, personal communication) (Table 2-14). Five phylogenetic species contained isolates that may or may not have been compared with the respective types (Table 2-15), and the re-maining six phylogenetic species did not contain any named isolates (Table 2-14). In Table 2-15, details are given on how the 16 isolates linking phyloge-netic species to morphological species relate to the respective types. For the two phylogenetic species that might be in conflict with morphological species, isolates of P. herbarum and S. xanthosomatis were chosen as representatives, since P. herbarum is the type of Pleospora and no type species is known from S. lycopersici (Table 2-1). 2.4.3 Delimitation of Pleospora herbarum, the type of Pleospora Pleospora herbarum could not be differentiated from closely related morpho-logical species. Both P. alfalfae, S. vesicarium, P. tomatonis, P. sedicola as well as 42 unnamed isolates fell within the phylogenetic species P. herbarum (Figure 2-4, Figure 2-6). Due to its central taxonomic role, Pleospora herbarum has been well studied. Its type material has been located, the link to its asexual state estab-lished, and representative cultures have been chosen (Simmons, 1985). At least four morphological species similar to P. herbarum in both anamorph and teleomorph characters have been described (Simmons, 1969; Simmons, 1985; Simmons, 2001). Camara et al. (2002) included two of those species, P. alfal-fae and S. vesicarium in phylogenetic analyses based on ITS and GPD datasets, in addition to the type species of Pleospora, P. herbarum. They could not dif-ferentiate P. herbarum, P. alfalfae and S. vesicarium, and concluded that mo-lecular support was lacking for the distinction of those morphological species (Camara et al., 2002). Because the genetic circumscription of the type species of Pleospora is important, we wanted to investigate if we could find phyloge-netic species underlying the morphological species P. herbarum, P. alfalfae and S. vesicarium. We included in our study 42 unnamed isolates with morphologi-cal affinity to P. herbarum, and sequenced the three loci ITS, GFDand EF-1 al-pha for all of them. Results showed that all 42 unnamed isolates grouped to-gether with the named isolates P. herbarum strain P2, P. alfalfae strain P81, S. vesicarium strain P238, as well as two additional representatives of morpho-logical species, P. tomatonis strain P268 and P. sedicola strain P271 (Figure 2-4), yielding a most parsimonious topology requiring only three steps. Based on the ITS, GPD and EF-1 alpha analyses, 17 isolates comprising all morphological species as well as covering the genetic diversity of the group were chosen for sequencing of the additional fourth locus vmaA-vpsA. This did not add any notable variation (Figure 2-6). As can be seen in the phylogenetic 28 trees for the isolates selected for vmaA-vpsA sequencing in Figure 2-5, the phylogenetic structure of the EF-1 alpha and vmaA-vpsA trees in the phyloge-netic species P. herbarum is not identical. Thus, in addition to being genetically closely related, there seems to be no shared phylogenetic structure that cor-responds to the described morphological species. On the other hand, the mo-nophyly of the phylogenetic species P. herbarum is well supported in combined analyses of all four loci (Figure 2-6). This means that the phylogenetic species P. herbarum is genetically isolated from neighboring species, and due to the lack of concordant internal phylogenetic structure, represents thus only one phylogenetic species according to the phylogenetic species recognition ap-proach (Taylor ef al., 2000). It could be argued that the loci used in this study were not variable enough to differentiate between the morphological species. However, mor-phological characters supported the close phylogenetic relationships of Pleo-spora herbarum, P. alfalfae, P. tomatonis, P. sedicola and S. vesicarium. In all five species, the following morphological features fell within the respective range given: Sexual fruitbodies were between 0.35 - 1 mm in diameter, and contained yellow-brown sexual spores, 28 - 45 um long and 8 - 18 um wide, with seven to nine transverse septa with 1 - 3 vertical septa per cell. Asexual spores were 25 - 48 um long and 12 - 27 um wide, with 1-7 transverse septa and 1-3 vertical septa per cell, and were yellow-brown with a warted wall (Simmons, 1969; Simmons, 1985; Simmons, 2001). The morphological char-acters were not stable for one species. For example, the number of transverse septa of the asexual spores of S. vesicarium ranged from one to six (Simmons, 1969). There is evidence outside P. herbarum that in Pleospora morphological groupings did not always correspond to phylogenetic entities. Camara et al. (2002) mentioned the example of Stemphylium sp. strain P227 in group E. This isolate had morphological features similar to S. globuliferum, but did not group with the morphologically similar isolates which were placed in group B instead. Thus, based on our data, the five morphological species P. herbarum, P. alfalfae, P. sedicola, P. tomatonis and S. vesicarium constitute one phyloge-netic species. Additional investigations using a population genetics approach are needed to test for reproductive boundaries in the phylogenetic species P. herbarum (Zhan et al., 2002), and whether they correspond to described mor-phological species. 2.4.4 Unidentified phylogenetic species As many as six potentially new species were obtained. In six cases, strains or groups of strains did not cluster with a named isolate, or in the case of S. sar-ciniforme strain P247, might be sufficiently different from a named isolate 29 (Figure 2-6). Three of these phylogenetic species contained isolates collected in British Columbia. These were Pleospora sp. strains P56, P107, and P327. To name all phylogenetic species, considerable research would be neces-sary, as up to 1000 species of Pleospora have been described (Holm, 1962). The slide collection vouchering Wehmeyer's work (1961), documenting about 1200 collections of Pleospora and P/eospora-like fungi, would be a starting point. 30 Table 2-1. Morphologica l species included i n this study. The names of both anamorphs and teleomorphs are given together wi th their P strain numbers (see Table 2-2). Relations of the isolates to type specimens for both sexual and asexual states as well as literature references to the type descriptions are also given. ' T y p e ' refers to collections judged equivalent to type material , 'ex type' are strains derived from type collections. See section on fungal strains on page 11 for rationale of applying names to strains. 31 Morphologica l spe-cies: Teleomorph Morpholog ica l species: A n a m o r p h Represen-tative strain Relat ion to type Reference P. alfalfae Simmons S. alfalfae Simmons P81 ex type Simmons (1985) P. eturmiuna S im-mons S. eturmiuna S im-mons P269 ex type Simmons (2001) P. gigaspora Karsten Stemphylium sp. P129 unknown 1 Karsten (1884) P. gracilariae S im-mons & Schatz S. gracilariae Simmons P243 ex type Simmons (1989) P. herbarum (Pers.: Fries) Rabenhorst ex Cesati & de Notaris S. herbarum S im-mons P2 type/ ex type Simmons (1985) P. paludiscirpi Sim-mons S. paludiscirpi Simmons P270 ex type Simmons (2001) P. sedicola Simmons S. sedicola S im-mons P271 ex type Simmons (2001) P. tarda Simmons S. botryosum W a l l -roth PI ex type / type Simmons (1985) P. tomatonis Sim-mons S. tomatonis S im-mons P268 ex type Simmons (2001) P. triglochinicola Webster S. triglochinicola Sutton & Pirozyn-ski P123 unknown 2 Webster (1969) Pleospora sp. S. astragali Yoshi i P201 unknown 3 Yamamoto (1960); Yoshi i (1929) Pleospora sp. S. majusculum Simmons P262 type 4 Simmons (1969); Pleospora sp. S. vesicarium (Wallroth) Sim-mons P238 type 4 Simmons (1969) unknown S. callistephi Baker & Davis P383 unknown 5 Baker and Davis (1950) unknown S. lancipes (Ellis & Everhart) Simmons P229 type 6 Simmons (1969) unknown S. loti J. H . Graham P384 unknown Graham (1953) unknown S. lycopersici (En-joji) W . Yamamoto P242 type 7 Yamamoto (1960) unknown S. sarciniforme F. Cavara P239 type 8 Cavara (1890) unknown S. solani G . F . We-ber P240 type 8 Weber (1930) unknown S. trifolii J. H . Gra-ham P244 type 8 Graham (1957) unknown S. xanthosomatis Huguenin P232 ex type 9 Huguenin (1965) 32 1 Identified by Crivelli (1983). 2 Sent to Simmons by J. Webster, author of type (E. G. Simmons, personal communication). 3 Sent to Simmons by H. Yoshii, author of type (E. G. Simmons, personal communication). 4 Simmons, personal communication. 5 Collected by K. Baker (Camara et al, 2002) who might be identical to the author of the type. 6 Excellent representative of type (E. G. Simmons, personal communication). 7 Simmons' concept of this species, no type specimen known (E. G. Simmons, personal com-munication). 8 Compared to type by Simmons (E. G. Simmons, personal communication). 9 Isolated ex type by type author and sent to Simmons (E. G. Simmons, personal communica-tion). 33 Table 2-2. Isolates used in this study, with substrates and locations of or ig in, grouped ac-cording to their P strain numbers. Regardless of or ig in, al l isolates received a P number, which was used in the text throughout. Or ig ina l strain identifiers, i f existing, are listed as well. F o r strains collected in this study, P numbers also refer to my fungar ium. Stra in P95 is Alternaria alternata, the remaining strains are Pleospora. Specific epithets were only used for isolates for which a l ink to type materia l could be established (see Table 2-1 and p. 11). In the case of unnamed strains, the teleomorph name Pleospora was only used for strains derived f rom sexual spores. Unnamed strains derived f rom asexual spores were named Stemphylium sp., regardless i f they formed the sexual state or not. 34 p # Pleospora teleo-morph Stem-phylium anamorph St ra in identi-fiers Substra-tum Count ry Loca l i ty 1 tarda botryosum E G S 08-069 1 Medicago sativa L . U S A N H 2 herbarum herbarum E G S 36-138 1; IMI276975 2 Medicago sativa L . India Jhansi 56 sp. sp. SA1.17 3 decaying leaf of Phragmites or similar plant Canada South A r m Marshes Wildlife Management Area, Ladner, B C 1 3 81 alfalfae alfalfae E G S 36-088 1; I M I 2696832 2 Medicago sativa L . Australia W A 93 sp. sp. SA2.28 3 decaying stalk of as-teraceous plant Canada South A r m Marshes Nature Reserve, Lad-ner, B C 1 4 95 - alternata E G S 34-016 1 - - -107 sp. sp. N1.8 3 decaying herbaceous dicot. Canada Along White Rapids Rd , South of Nanaimo, B C 1 4 122 gigaspora sp. E G S 37-016 1; ZT9127 4 Minuartia hybrida (Vi l l . ) Schischkin Switzer-land Lucomagno, TI 123 triglochini-cola triglochini-cola E G S 36-118 1 Triglochin maritima L . G B Dawlish Warren, De-von 126 sp. sp. E G S 37-149 1; ZT9122 4 Rumex acetosa L . Switzer-land Meride, TI 129 gigaspora sp. E G S 37-017 1; ZT9127 4 Minuartia hybrida (Vil l . ) Schischkin Switzer-land Lucomagno, TI 201 - astragali E G S 08-174 1 Astragalus sp. Japan Fukuoka 203 - sp. E G S 27-1941 1 Astragalus sinicus L . Japan Tominaga, Tokushima 204 - sp. E G S 27-1942 1 Astragalus sinicus L . Japan Tominaga, Tokushima 205 - sp. E G S 29-062 1; IFO 7244 5 Astragalus sp. Japan -206 - sp. E G S 30-181 1 Medicago sativa L . New Zealand Palmerston 207 - sp. E G S 48-074 1 Medicago sativa L . New Zealand Auckland 35 208 - sp. E G S 48-075 1 Medicago saliva L . New Zealand Auckland 209 - sp. E G S 48-087 1 Pistacia vera L . U S A Kern County, C A 210 - sp. E G S 48-089 1 Pistacia vera L . U S A Kern County, C A 212 - sp. E G S 48-097 1 Passiflora edulis Sims New Zealand Auckland 213 - sp. E G S 48-099 1 Medicago lupulina L . New Zealand -214 - sp. E G S 48-101 1 Vicia sativa L . New Zealand Auckland 215 - sp. E G S 48-102 1 Trifolium pratense L . New Zealand Auckland 216 - sp. E G S 48-103 1 Medicago sativa L . New Zealand Papakura 217 - sp. E G S 48-104 1 Medicago sativa L . New Zealand Central Otago 218 - sp. E G S 48-105 1 Medicago sativa L . New Zealand Central Otago 219 - sp. E G S 35-190 1; IMI265269 2 Pisum sati-vum L . G B -220 - sp. E G S 38-089 1 Cicer arietinum L . U S A W A 221 sp. E G S 38-090 1 Lens culi-naris Medik. U S A W A 222 sp. E G S 38-091 1 Lens culi-naris Medik. U S A W A 223 - sp. E G S 40-038 1 Medicago sativa L . U S A K S 224 - sp. E G S 41-194 1 Cheiranthus cheiri L . Italy -226 - sp. E G S 42-022 1 Euphorbia esula L . Canada Saskatchewan 227 sp. E G S 42-138 1 Malus sylvestris (L.) Mi l l e r Australia W A 228 sp. E G S 44-149 1 Malus x domestica Borkh. New Zealand 229 - lancipes E G S 46-182 1 Aquilegia sp. New Zealand -230 - sp. E G S 47-132 1 Passiflora edulis Sims New Zealand -231 - sp. E G S 47-135'; I M I 98083 2 Dianthus sp. U S A C A 3 6 232 xanthoso-matis E G S 17-137' Xanthosoma sagittifo-lium (L.) Schott New Caledo-nia 233 - sp. E G S 35-163' Brassica oleracea L . U S A A Z 234 - sp. E G S 35-169' Digitalis purpurea L . G B -235 - sp. E G S 35-170' Digitalis purpurea L . G B -236 - sp. E G S 35-171' Digitalis purpurea L . G B -237 sp. E G S 35-187'; I M I 264212 2 Trigonella foenum-graecum L . G B 238 sp. vesicarium E G S 37-067'; IMI 278459 2 Medicago sp. South Africa -239 - sarciniforme E G S 38-121' Trifolium pratense L . U S A M A 240 solani E G S 41-135' Lycopersi-con escu-lentum L . U S A I N 241 solani E G S 42-027' Lycopersi-con escu-lentum L . U S A I N 242 lycopersici E G S 46-001' Lycopersi-con escu-lentum L . Domini-can Re-public 243 gracilariae gracilariae E G S 37-073'; A T C C 66972 Gracilaria sp. Israel -244 - trifolii E G S 12-142' Trifolium repens L . U S A P A 245 sp. E G S 29-161' Capsicum frutescens L . U S A F L 246 - sp. E G S 31-008' Chrysan-themum sp. New Zealand -247 - sarciniforme E G S 29-188' Cicer arietinum L . Iran -248 - sp. E G S 46-183' Salvia offi-cinalis L . New Zealand -249 sp. E G S 47-197' Helianthus argophyllus Torr. & Gray Australia Q L D 250 sp. E G S 45-031 1 Chrysan-themoides monilifera (L.) Nor-lindh Australia N S W 251 sp. E G S 45-036 1 Chrysan-themoides monilifera (L.) Nor-lindh Australia N S W 252 sp. E G S 42-055 1 Euphorbia marginata Pursh U S A K S 253 sp. E G S 44-070 1 Capsicum frutescens L . U S A I N 262 sp. majusculum E G S 16-0681; IMI135459 2 Lathyrus maritimus (L.) Bige-low U S A N Y 268 tomatonis tomatonis E G S 29-089 1; I M I 386968 2 Lycopersi-con escu-lentum L . U S A Central Valley, C A 269 eturmiuna eturmiunum E G S 29-099 1; I M I 386969 2 Lycopersi-con escu-lentum L . New Zealand 270 paludis-cirpi paludiscirpi EGS31-016 1 ; IMI 386966 2 Scirpus sp. U S A Point Judith, RI 271 sedicola sedicola E G S 48-095 I M I 386967 2 Sedum spectabile Boreau New Zealand Auckland 272 - sp. E G S 48-163 1; N Y - T o - 1 6 Allium cepa L . U S A Ithaca, N Y 273 - sp. E G S 48-165 1; N Y - O r : o 6 Allium cepa L . U S A Orange County, N Y 274 - sp. E G S 48-167 1; M X - S L P - p 6 Allium cepa L . Mexico San Luis Potosi State 275 - sp. E G S 48-168 1; M X - T : r 6 Allium cepa L . Mexico Tamaulipas State 276 - sp. E G S 48-169 1; M X - T : s6 Allium cepa L . Mexico Tamaulipas State 277 - sp. E G S 48-170 1; N Y - O s : S b l 6 Allium cepa L . U S A Oswego County, N Y 278 - sp. E G S 48-171 1; N Y - O s : Sb6 6 Allium cepa L . U S A Oswego County, N Y 279 - sp. E G S 48-172 1; N Y - O s : Sb7 6 Allium cepa L . U S A Oswego County, N Y 38 280 - sp. E G S 48-173 1; N Y - O s : u 6 Allium cepa L . U S A Oswego County, N Y 281 - sp. E G S 48-175 1; N Y - O s : 700b 6 Allium cepa L . U S A Oswego County, N Y 301 sp. Brassica oleracea L . Canada Acadia Park Resi-dences, U B C Campus, Vancouver, B C 1 5 302 - sp. E G S 49-029 1; IBT8213 7 ;#1 8 - - -303 - sp. E G S 49-030 1; IBT8214 7 ; #28 Trigonella sp. Egypt -306 - sp. E G S 49-033 1; IBT8217 7 ; #58 Cicer arietinum L . Iran -307 - sp. E G S 49-034 1; IBT8218 7 ;#6 8 Medicago sativa L . Canada Ontario 308 - sp. E G S 49-035'; IBT8220 7 ; #78 - Italy -309 - sp. E G S 49-036 1; IBT8221 7 ; #88 - Iran -310 - sp. E G S 49-037 1; IBT8222 7 ; #98 Trifolium pratense L . U S A Lafayette, I N 311 sp. E G S 49-038 1; IBT8223 7 ; #108 Lathyrus maritimus (L.) Bige-low U S A Suffolk County, N Y 312 sp. E G S 49-039 1; IBT8224 7 ; #118 Brassica napus L . Italy 313 sp. E G S 49-040 1; IBT8225 7 ; #128 Medicago sativa L . Canada Ontario 314 sp. E G S 49-041 1; IBT8226 7 ; #138 Brassica napus L . Italy 315 sp. E G S 49-042 1; IBT8227 7 ; #148 Brassica napus L . Italy 316 sp. E G S 49-043'; IBT8228 7 ; #158 Indone-sia Bogor, Java 317 sp. E G S 49-044 1; IBT8231 7 ; #188 Lycopersi-con escu-lentum L . Greece Crete 318 sp. E G S 49-045'; IBT8232 7 ; #198 Medicago sativa L . India Uttar Pradesh 319 - sp. E G S 49-046'; #228 Brassica napus L . Italy -39 320 - sp. E G S 49-047 1; #258 Brassica napus L . Italy -321 - sp. E G S 49-048 #268 Brassica napus L . Italy -322 - sp. E G S 49-050 1; #288 - Korea -323 - sp. E G S 49-051 #308 Hordeum vulgare L . - -324 - sp. E G S 49-052 1; #318 - Italy -325 sp. E G S 49-053 1; IBT7159 7 ; #328 soil 326 - sp. E G S 49-054 1; #348 - Korea -327 sp. sp. - Salicornia sp. Canada Near Roberts Bank Port, B C 1 6 338 sp. sp. Salicornia sp. Canada On the beach of Cape Gurney, Hornby Island, B C 1 6 342 sp. sp. MEBan-10382 9 Lactuca muralis (L.) Gaertner Canada Sidney, B C 1 7 343 sp. sp. M E B a r r l 0 3 8 0 9 Geum macro-phyllum W i l l d . Canada Sidney, B C 1 7 383 - callistephi N O 536 1 0 - U S A C A 384 - loti N O 770 1 0 Trifolium pratense L . U S A Geneva, N Y 385 - loti N O 1364 1 0 Lotus sp. U S A Mif f l in , P A 406 sp. S S I 1 1 ; T-1953 1 2 Lycopersi-con escu-lentum L . Brazi l Botucatu, SP 407 - sp. SS21 1 1 Gossypium sp. Brazil Goioere, P R 408 - sp. SS28 1 1 Gossypium sp. Brazil Terra Nova d'Oeste, P R 409 - sp. SS31 1 1 Gossypium sp. Brazi l Goias 1 refers to the E . G . Simmons private culture collection. 2 refers to the fungal culture collection at C A B I Bioscience, U K . 3 refers to the P. Inderbitzin private fungarium. 4 see Crivel l i (1983). 5 refers to N I T E Biological Resource Center culture collection, Chiba, Japan. 6 refers to Stemphylium isolates in de Jesus Yanez Morales (2001). 7 refers to the fungal culture collection of the Technical University of Denmark, Lyngby. 8 refers to Stemphylium isolates in Andersen (1995). 4 0 9 refers to the M . E . Barr private herbarium. 1 0 see Camara et al. (2002). 1 1 seeMehta (2001). 1 2 see Mehta & Brogin (2000). 1 3 collected by A . & R. Bandoni, S. Landvik and P. Inderbitzin. 1 4 collected by P. Inderbitzin. 1 5 collected and isolated by Jennifer Guojuan Zhang. 1 6 collected by A . & R. Bandoni. 1 7 collected by M . E . Barr. 4 1 Table 2-3. New primers designed for this study. V v ' is locus vmaA-vpsA. F o r pr imer map see Figure 2-3. Region P r imer name P r i m e r sequence ITS ITS871r 5'-GCT TAA GTT CAG CGG GTA-3' GPD GPD2033f 5'-TTG GCC GTA TCG TCT TCC GC-3' GPD GPD2669r 5'-CTT GTC GTG GAT GAC CTT GGC-3' GPD GPD3r 5'-ACC AGT GCT GCT GGG AATG-3' EF-1 alpha EF446f 5'-TCA CTT GAT CTA CAA GTG CGG TGG-3' EF-1 alpha EF451f 5'-GAC AAG CGT ACC ATC GAG A A G TTC G-3' EF-1 alpha EF462f 5'-CAT CGA GAA GTT CGA GAA GG-3' EF-1 alpha EF1598r 5'-CGT GGT GCA TCT CGA CGG-3' EF-1 alpha EF1473r 5'-CGA TCT TGT AGA CAT CCT GGA GG-3' EF-1 alpha EF3r 5'-CTT GGT CTC CTT CTC CC-3' EF-1 alpha EFP229f 5'-TGG AGG AGC TTT ACG ACG CC-3' EF-1 alpha EfallF2 5'-CGC CTC CGA GCC CGC TTC C-3' EF-1 alpha EfallF 5'-GTT CCG ATG CGA GKT CTG TG-3' EF-1 alpha EFLr 5'-TCA CAG AMC TCG CAT CGG AAC-3' EF-1 alpha EFAIIr 5'-AGA GGT GCG TCG CTG ACC AC-3' EF-1 alpha EFLf 5'-TGR TGC TGC TGC CTC RGG AC-3' EF-1 alpha EFP246f 5 'TTC AGC ATG ATG CTG CTA CC-3' EF-1 alpha EF2r 5'-TAG TGA TAC CAC GCT CAC GC-3' EF-1 alpha 95f 5'-CAA GAA CAT GAT CAC TGG TAC-3' EF-1 alpha Efr 5'-TCA CCA GAC TTG ATG AAC TTG GG-3' v-v VATP2949f 5'-TCG ATC AGT TAC AGC A A G TAC-3' v-v VATP3238r 5'-GCC TTC TGC GCT TCG TCG TGG-3' v-v GTP446f 5'-TTC GGT GCT TGA GAA CAT TG-3' v-v GTP980r 5'-GCC A A A TCG GTG TTG GCG GC-3' v-v VATP3195f 5'-CGC TCT GGA AGA CTG AGT GG-3' v-v AiF 5'-TGG ATG ATG A A G AAC ATG ATG-3' v-v AN1 5'-CAG A A G GCT GTC TCC CAA GG-3' v-v ATPF2 5'-CAG CTC CGA TCA ATG A A G TTC G-3' v-v GTP604r 5'-ATG AGC TGG AGA ATG AGC GG-3' v-v GTPr 5'-GGG TAA TTA GCC CCG GGT CG-3' v-v AGf 5'-CTG ACG ACG CTG TTT CGC GTC-3' 42 Table 2-4. EF-1 alpha internal introns i n isolates oi Pleospora. F o r gene map see Figure 2-3. Posit ion is in t ron insertion site on Podospora anserina EF-1 alpha D N A sequence from GenBank (X74799). Intron length, phylogenetic distr ibution, variabi l i ty , and pres-ence of O R F and GenBank match are given. Isolates sharing a s imi lar in t ron were gener-ally close relatives (Figure 2-4), except for 5. loti strain P384 with an in t ron as P. triglo-chinicola strain P123, P. paludiscirpi s train P270, plus three unnamed isolates, and the similar , long, protein encoding in t ron of 5. lancipes s train P229, S. trifolii s train P244 and Stemphylium sp. s train P246. Introns were excluded f rom phylogenetic analyses due to high divergence. F o r information on strain numbers see Table 2-2. Posi-tion Length (bp) Isolates Var iab i l i ty (bp or %) O R F >100 bp O R F - Gen-B a n k match 912 49 Group B - N A 913 59 Group C 5 - N A 929 155 S. sarciniforme strain P239 plus four unnamed isolates (strains P247, P306, P309, P310) 2 141 929 199 S. callistephi strain P383 N A 183 -929 1501 1567 1678 S. lancipes strain P229 S. trifolii strain P244 Stemphylium sp. strain P246 36.8% 1440 1077 834 Hypothetical G. zeae protein XP_381390 with zinc fin-ger domain 932 5 2 / 5 3 Group A ; S. loti strains P384, P385; P. triglochinicola strain P123, P. paludiscirpi strain P270, plus three unnamed iso-lates (strains P210, P327, P338) 13 N A 932 54 Pleospora sp. strain P56, plus six other unnamed isolates (strains P107, P212, P221, P227, P342, P343) 2 N A 932 119 Group D , except S. callistephi strain P383 1 - N A 43 Table 2-5. Compar ison of in t ron encoded zinc finger proteins. The internal EF-1 alpha in t ron of S. lancipes s train P229, S. trifolii s train P244 and Stemphylium sp. s train P246 contained a hypothetical zinc finger protein most s imilar to Gibberella zeae protein XP_381390 f rom GenBank . Expect values (number of hits expected by chance), identities (identical amino acids), and positives (similar amino acids) are from GenBank protein-protein Blast searches (Altschul et al, 1997). Isolates Prote in length (bp) Expect Value Identities Positives S. lancipes strain P229 1389 9e-27 98/297 (32%) 141/297 (47%) S. trifolii strain P244 921 3e-24 85/259 (32%) 141/297 (47%) Stemphylium sp. strain P246 507 le-14 71/249 (28%) 110/249 (44%) 4 4 Table 2-6. Unique ITS/GPD/EF-1 alpha multilocus genotypes. A total of 39 combined multilocus genotypes were obtained from 110 isolates of Pleospora. O n l y one represents tive per genotype was included i n phylogenetic analyses. F o r information on strain num bers see Table 2-2. 45 Representative isolates Genotype groups P. tarda strain PI P1,P216, P307, P313 P. herbarum strain P2 P2, P81, P126, P206, P208, P209, P213, P215, P217, P219, P220, P222, P223, P226, P228, P231, P233, P234, P237, P238, P268, P271, P274, P275, P276, P278, P279, P280, P281, P308, P314, P318, P322, P324, P326 Pleospora sp. strain P56 P56 Pleospora sp. strain PI07 P107 P. gigaspora strain PI29 P122, P129 P. triglochinicola strain PI23 P123 5. astragali strain P201 P201.P203, P204,P205 Stemphylium sp. strain P207 P207 Stemphylium sp. strain P210 P210 Stemphylium sp. strain P214 P214 Stemphylium sp. strain P212 P212 Stemphylium sp. strain P221 P221 S. lancipes strain P229 P229 5. xanthosomatis strain P232 P232, P249 Stemphylium sp. strain P93 P93, P218, P230, P235, P236, P277, P301, P323, P325 5. sarciniforme strain P239 P239, P309, P310 5. solani strain P240 P240, P252, P253, P409 5. solani strain P241 P241 Stemphylium sp. strain P242 P242,P245, P251.P316 P. gracilariae strain P243 P243, P315, P319 5. fn/b/« strain P244 P244 Stemphylium sp. strain P246 P246 5. sarciniforme strain P247 P247, P306 Stemphylium sp. strain P248 P248 Stemphylium sp. strain P250 P250, P406 5. majusculum strain P262 P262, P311 P. eturmiuna strain P269 P224, P269, P312, P317, P320, P321 P. paludiscirpi strain P270 P270 Stemphylium sp. strain P272 P272 Stemphylium sp. strain P273 P273 Stemphylium sp. strain P302 P302 Stemphylium sp. strain P303 P303 Pleospora sp. strain P327 P327 Pleospora sp. strain P338 P338 Pleospora sp. strain P342 P227, P342, P343 5. callistephi strain P383 P383 5. fori strain P384 P384 5. /ori strain P385 P385 Stemphylium sp. strain P407 P407, P408 46 Table 2-7. Unique ITS genotypes. A total of 19 ITS genotypes were obtained f rom 110 isolates of Pleospora. On ly one representative per genotype was included i n phylogenetic analyses. F o r information on strain numbers see Table 2-2. Representative isolates Genotype groups P. tarda strain P l P1,P216, P307, P313 P. herbarum strain P2 P2, P81, P93, P126, P206, P208, P209, P213, P215, P217, P218, P219, P220, P222, P223, P226, P228, P230, P231, P233, P234, P235, P236, P237, P238, P268, P271, P272, P273, P274, P275, P276, P277, P278, P279, P280, P281, P301, P308, P314, P318, P322, P323, P324, P325, P326 Pleospora sp. strain P56 P56, P107, P212, P221, P227, P342, P343 P. gigaspora strain P129 P122, P129 P. triglochinicola strain P123 P123 S. astragali strain P201 P201, P203, P204, P205, P243, P262, P311, P315, P319 P. eturmiuna strain P269 P207, P214, P224, P269, P302, P312, P317, P320, P321 Stemphylium sp. strain P210 P210 S. xanthosomatis strain P232 P232, P242, P245, P248, P249, P250, P251, P316, P406 S. sarciniforme strain P239 P239, P247, P306, P309, P310 S. solani strain P240 P240, P229, P241, P252, P253, P407, P408, P409 S. trifolii strain P244 P244 Stemphylium sp. strain P246 P246 P. paludiscirpi strain P270 P270 Pleospora sp. strain P303 P303 Pleospora sp. strain P327 P327 Pleospora sp. strain P338 P338 S. callistephi strain P383 P383 S. loti strain P384 P384, P385 4 7 Table 2-8. Unique GPD genotypes. A total of 30 GPD genotypes were obtained from 110 isolates of Pleospora. On ly one representative per genotype was included i n phylogenetic analyses. Genotypes i n bold were not sequenced for vmaA-vpsA, but were represented i n combined analyses by the closely related Pleospora sp. s train P107 for Stemphylium sp. strains P212 and P221, or S. solani s train P240 for the Stemphylium sp. strain P407 geno-type (Figure 2-4). F o r information on strain numbers see Table 2-2. Representatives Genotype groups P. tarda strain P l P l , P216, P307, P313 P. herbarum strain P2 P2, P81, P93, P126, P206, P208, P209, P213, P215, P217, P218, P219, P220, P222, P223, P226, P228, P230, P231, P233, P234, P235, P236, P237, P238, P268, P271, P272, P273, P274, P275, P276, P277, P278, P279, P280, P281, P301, P303, P308, P314, P318, P322, P323, P324, P325, P326 Pleospora sp. strain P56 P56 Pleospora sp. strain P107 P107 P. gigaspora strain P129 P122,P129 P. triglochinicola strain P123 P123 S. astragali strain P201 P201,P203, P204, P205 Stemphylium sp. strain P207 P207 Stemphylium sp. strain P210 P210 Stemphylium sp. strain P212 P212 Stemphylium sp. strain P221 P221 S. lancipes strain P229 P229 S. xanthosomatis strain P232 P232, P248, P249 S. sarciniforme strain P239 P239, P309, P310 5. solani strain P240 P240, P241, P252, P253, P409 P. gracilariae strain P243 P243,P315,P319 S. trifolii strain P244 P244 Stemphylium sp. strain P246 P246 S. sarciniforme strain P247 P247, P306 Stemphylium sp. strain P250 P242, P245, P250, P251, P316, P406 S. majusculum strain P262 P262, P311 P. eturmiuna strain P269 P214, P224, P269, P312, P317, P320, P321 P. paludiscirpi strain P270 P270 Stemphylium sp. strain P302 P302 Pleospora sp. strain P327 P327, P338 Pleospora sp. strain P342 P227, P342, P343 S. callistephi strain P383 P383 S. loti strain P384 P384 S. loti strain P385 P385 Stemphylium sp. strain P407 P407, P408 48 Table 2-9. Unique EF-1 alpha genotypes. A total of 30 unique EF-1 alpha genotypes were obtained from 110 Pleospora isolates. The internal in t ron was not considered. Genotypes i n bold were not sequenced for vmaA-vpsA, and were represented i n the combined analy-ses by the closely related Pleospora sp. s train P107 and 5. solani s train P240, respectively (Figure 2-4). F o r information on strain numbers see Table 2-2. Representatives Genotype groups P. tarda strain PI P1,P216,P307, P313 P. herbarum strain P2 P2, P81, P126, P206, P208, P209, P213, P215, P217, P219, P220, P222, P223, P226, P228, P231, P233, P234, P237, P238, P268, P271, P274, P275, P276, P278, P279, P280, P281, P303, P308, P314, P318, P322, P324, P326 Pleospora sp. strain P56 P56 Pleospora sp. strain PI07 P107, P212 P. gigaspora strain PI29 P122,P129 P. triglochinicola strain PI23 P123 S. astragali strain P201 P201,P203,P204, P205 Stemphylium sp. strain P210 P210 Stemphylium sp. strain P221 P221 S. lancipes strain P229 P229 S. xanthosomatis strain P232 P232, P249, P250, P406 Stemphylium sp. strain P235 P93, P218, P230, P235, P236, P277, P301, P323, P325 S. sarciniforme strain P239 P239, P309, P310 S. solani strain P240 P240, P252, P253, P407, P408, P409 S. solani strain P241 P241 P. gracilariae strain P243 P243,P315, P319 S. trifolii strain P244 P244 Stemphylium sp. strain P245 P242, P245, P248, P251, P316 Stemphylium sp. strain P246 P246 S. sarciniforme strain P247 P247, P306 S. majusculum strain P262 P262, P311 P. eturmiuna strain P269 P207, P224, P269, P312, P317, P320, P321 P. paludiscirpi strain P270 P270 Stemphylium sp. strain P272 P272 Stemphylium sp. strain P273 P273 Stemphylium sp. strain P302 P302, P214 Pleospora sp. strain P327 P327, P338 Pleospora sp. strain P342 P227, P342, P343 S. callistephi strain P383 P383 S. loti strain P384 P384, P385 49 Table 2-10. Unique vmaA-vpsA genotypes. A total of 28 unique vmaA-vpsA genotypes were obtained from 53 Pleospora isolates. F o r information on strain numbers see Table 2-2. Representatives Genotype groups P. tarda strain P I P1,P216 P. herbarum strain P2 P2, P238, P272, P273, P277, P303, P314, P318 Pleospora sp. strain P56 P56 Pleospora alfalfae strain P81 P81.P237, P268, P271 Pleospora sp. strain P107 PI 07 P. gigaspora strain PI29 P122, P129 P. triglochinicola strain PI23 PI 23 5. astragali strain P201 P201 Stemphylium sp. strain P207 P207, P269 Stemphylium sp. strain P210 P210 S. lancipes strain P229 P229 S. xanthosomatis strain P232 P232 Stemphylium sp. strain P235 P235, P236, P301, P323, P325 S. sarciniforme strain P239 P239, P310 S. solani strain P240 P240, P252, P253 P. gracilariae strain P243 P243 5. trifolii strain P244 P244 Stemphylium sp. strain P245 P245,P250, P316 Stemphylium sp. strain P246 P246 S. sarciniforme strain P247 P247, P306 S. majusculum strain P262 P262, P311 P. paludiscirpi strain P270 P270 Stemphylium sp. strain P302 P302 Stemphylium sp. strain P315 P315 Pleospora sp. strain P327 P327 Pleospora sp. strain P342 P342 S. callistephi strain P383 P383 S. loti strain P384 P384, P385 50 Table 2-11. Unique TTS/GPD/EF-1 alphalvmaA-vpsA multilocus genotypes. A total of 35 unique multilocus genotypes were obtained from 53 isolates of Pleospora. O n l y one repre sentative per genotype was included i n phylogenetic analyses. F o r information on strain numbers see Table 2-2. Representative Genotype group P. tarda strain P l P1,P216 P. herbarum strain P2 P2, P238, P314,P318 Pleospora sp. strain P56 P56 Pleospora alfalfae strain P81 P81,P237,P268,P271 Pleospora sp. strain P107 P107 P. gigaspora strain P129 P122, P129 P. triglochinicola strain P123 P123 S. astragali strain P201 P201 Stemphylium sp. strain P207 P207 Stemphylium sp. strain P210 P210 S. lancipes strain P229 P229 S. xanthosomatis strain P232 P232 Stemphylium sp. strain P235 P235, P236, P301, P323, P325 S. sarciniforme strain P239 P239, P310 S. solani strain P240 P240, P252, P253 P. gracilariae strain P243 P243 S. trifolii strain P244 P244 Stemphylium sp. strain P245 P245, P316 Stemphylium sp. strain P246 P246 S. sarciniforme strain P247 P247, P306 Stemphylium sp. strain P250 P250 5. majusculum strain P262 P262, P311 P. eturmiuna strain P269 P269 P. paludiscirpi strain P270 P270 Stemphylium sp. strain P272 P272 Stemphylium sp. strain P273 P273 Stemphylium sp. strain P277 P277 Stemphylium sp. strain P302 P302 Stemphylium sp. strain P303 P303 Stemphylium sp. strain P315 P315 Pleospora sp. strain P327 P327 Pleospora sp. strain P342 P342 5. callistephi strain P383 P383 S. loti strain P384 P384 S. loti strain P385 P385 5 1 Table 2-12. Bootstrap support values above 70% for the branches of the Pleospora species phytogenies i n Figure 2-5 and Figure 2-6 on pages 64 and 66, respectively. Node numbers listed here are present by the nodes of the I T S , GPD, EF-1 alpha and vmaA-vpsA single loci phylogenies i n Figure 2-5 and by the nodes of the combined four loci phylogeny i n Figure 2-6. F o r the single gene phylogenies based on I T S , GPD, EF-1 alpha and vmaA-vpsA i n Figure 2-5, only parsimony bootstrap support percentages are given. F o r the four loci combined phylogeny i n Figure 2-6, support percentages are given for parsimony, l ikel ihood, Bayesian and Neighbor jo in ing analyses i n this order. A l l trees were congruent at a 70% support level, except a minor alteration wi th in the phylogenetic species P. herba-rum i n the Bayesian analyses (see page 23), and node 28 that was only present i n the vmaA-vpsA tree (Figure 2-5). Support i n the combined analyses was generally higher than i n the single dataset analyses. Branches receiving 100% support i n the combined analyses and marked with an asterisk are due to the inclusion i n Figure 2-6 of duplicate multilocus genotypes. 5 2 Node Single loci phylogenies sup- Combined four Node num- port values (Figure 2-5, page loci phylogeny num-ber 64) 1 support values ber I T S GPD EF1-alpha vmaA-vpsA (Figure 2-6, page 66) 2 1 100 - - - -i-mi- 1 2 - - - - 100* 2 3 - 100 97 99 100 3 4 100 100 100 100 100 4 5 - - 77 - 92/86/100/99 5 6 - - - - 100* 6 7 - - - - -i-mi- 7 8 - - - - 100* 8 9 - - 78 - 76A/98/85 9 10 - - - - 90/94/100/92 10 11 - 96 - 99 100/100/100/99 11 12 - - 77 98 100 12 13 - - - - 100* 13 14 - - - - 71/-/99/- 14 15 - - - - -/-/98/- 15 16 - - - - 100* 16 17 - 99 83 99 100 17 18 - - - - 74/-/84A 18 19 - 84 - - -A/99/74 19 20 - 99 88 92 100 20 21 - 95 85 95 100/100/100/89 21 22 100 99 97 100 100/100/100/- 22 23 - - - - 100* 23 24 - - - - 100* 24 25 100 100 100 100 100 25 26 100 100 100 100 100 26 27 - - - - -1-1991- 27 28 - - - 91 - 28 29 - - - - 90/-/92/- 29 30 - - - - 97/98/100/99 30 31 - - - - -/88/100/- 31 32 - 100 89 100 100 32 33 - 100 98 100 100 33 34 - - - - 94/98/100/99 34 1 Support values are bootstrap support percentages. 2 Support values are for parsimony, likelihood, Bayesian and Neighbor joining analyses in this order. 5 3 Table 2-13. Phylogenetic information content of the four loci used for the Pleospora spe-cies phylogeny. F o r the single, 53 taxa datasets (Figure 2-5), the percentages of variable and parsimony informative characters are given, as well as the groups resolved. Dataset Var iab le charac-ters Parsimony informative charac-ters Groups resolved ITS 9% 2.6% B, E GPD 25.4% 17.4% All EF I-alpha 19.2% 10.9% All vmaA-vpsA 34.4% 25.6% All 54 Table 2-14. Phylogenetic species of Pleospora. There were 22 phylogenetic species in Pleo-spora. For each phylogenetic species, the representative isolates and culture identifiers are given (Table 2-2), as well as the group affiliations, and the number of isolates (Figure 2-4) and morphological types contained (Table 2-15). See section on phylogenetic species on page 27 for naming of the two phylogenetic species potentially conflicting with morpho-logical species (P. herbarum, S. xanthosomatis). Representative isolate Culture IDs Group Number of isolates Number of types S. xanthosomatis strain P232 EGS 17-137 A 9 21 P. tarda strain PI EGS 08-069 B 4 1 P. eturmiuna strain P269 EGS 29-099 C 9 1 P. gigaspora strain PI29 EGS 37-016 C 2 -P. gracilariae strain P243 EGS 37-073 C 3 1 P. herbarum strain P2 EGS 36-138 C 47 5 S. astragali strain P201 EGS 08-174 C 4 -S. majusculum strain P262 EGS 16-068 C 2 1 S.callistephi strain P383 NO 0536 D 1 -5. solani strain P240 EGS 41-135 D 7 1 P. paludiscirpi strain P270 EGS 31-016 E 1 1 P. triglochinicola strain PI23 EGS 36-118 E 1 -Pleospora sp. strain PI07 P107 E 3 NA Pleospora sp. strain P327 P327 E 2 NA Pleospora sp. strain P56 P56 E 4 NA S. loti strain P384 NO 0770 E 2 -S. sarciniforme strain P239 EGS 38-121 E 3 1 S. sarciniforme strain P247 EGS 29-188 E 2 NA Stemphylium sp. strain P210 EGS 48-089 E 1 NA Stemphylium sp. strain P246 EGS 31-008 E 1 NA S. trifolii strain P244 EGS 12-142 E 1 1 S. lancipes strain P229 EGS 46-182 F 1 1 *S. lycopersici strain P242 also fell within the phylogenetic species S. xanthosomatis (see Figure 2-4). However, S. lycopersici has no known type specimen (E. G. Simmons, personal communication) (see Table 2-1). 55 Table 2-15. Phylogenetic species containing morphological species. Sixteen of a total of 22 phylogenetic species could be l inked to morphological species. F o r morphological species underlying the phylogenetic species, author names of teleomorphs and anamorphs are given, as well as the relation of the strains to the respective type material from Table 2-1. See section on fungal strains on page 11 for rationale of applying names to strains and section on phylogenetic species on page 27 for naming of the two phylogenetic species po-tentially conflicting with morphological species (P. herbarum, S. xanthosomatis). Publ ica-tions refer to the or iginal descriptions. F o r numbers of morphological species contained per phylogenetic species see Table 2-14. 56 Phylogenetic spe-cies: Teleomorph Phylogenetic spe-cies: Anamorph P# Culture IDs Relation to type Reference P. eturmiuna Sim-mons S. eturmiuna Simmons P269 EGS 29-099 ex type Simmons (2001) P. gigaspora Karsten Stemphylium sp. P129 EGS 37-016 unknown1 Karsten (1884) P. gracilariae Sim-mons & Schatz S. gracilariae Simmons P243 EGS 37-073 ex type Simmons (1989) P. herbarum (Pers.: Fries) Rabenhorst ex Cesati & de Notaris S. herbarum Sim-mons P2 EGS 36-138 type/ ex type Simmons (1985) P. paludiscirpi Sim-mons 5. paludiscirpi Simmons P270 EGS 31-016 type Simmons (2001) P. tarda Simmons S. botryosum Wallroth P l EGS 08-069 ex type/ type Simmons (1985) P. triglochinicola Webster S. triglochinicola Sutton & Pirozyn-ski P123 EGS 36-118 unknown2 Webster (1969) Pleospora sp. S. astragali Yoshii P201 EGS 08-174 unknown3 Yamamoto (1960); Yo-shii (1929) Pleospora sp. S. majusculum Simmons P262 EGS 16-068 type4 Simmons (1969) unknown S. callistephi Baker & Davis P383 NO 0536 unknown5 Baker and Davis (1950) unknown S. lancipes (Ellis & Everhart) Sim-mons P229 EGS 46-182 type6 Simmons (1969) unknown S. loti Graham . P384 NO 0770 unknown Graham (1953) unknown S. sarciniforme F. Cavara P239 EGS 38-121 type7 Cavara (1890) unknown S. solani G. F. Weber P240 EGS 41-135 type7 Weber (1930) unknown S. trifolii Graham P244 EGS 12-142 type7 Graham (1957) unknown 5. xanthosomatis Huguenin P232 EGS 17-137 ex type8 Huguenin (1965) 5 7 1 Identified by Crivelli (1983). 2 Sent to Simmons by J. Webster, author of type (Simmons, personal communication). 3 Sent to Simmons by H. Yoshii, author of type (Simmons, personal communication). 4 Simmons, personal communication. 5 Collected by K. Baker (Camara et al, 2002), who might be identical to the author of the type. 6 Excellent representative of type (Simmons, personal communication). 7 Compared to type by Simmons (Simmons, personal communication). 8 Isolated ex type by type author and sent to Simmons (E. G. Simmons, personal communica-tion). 58 59 Figure 2-2. Asexual spore of Stemphylium trifolii strain P244 developing at the t ip of a conidiogenous cell. 60 ITS 1. ITS ITS [ ^ * _ I T S 8 7 1 r ^ * _ I T S 4 ] G P D 2 0 3 3 f _ ^ G P D 1 _ ^ G P D 2 - G P D 2 6 6 9 r ^ * _ G P D 3 r GPD EF462f_fc. E F 4 5 1 f - w E F 4 4 6 f - w .EF3r .EF1473R ^ - _ E F 1 5 9 8 r EF1-alpha A G f - w A T P F 2 _ ^ A N t ^ w A i F L ^ V A T P 3 1 9 5 E - W ^ _ A G r V A T P 2 9 4 9 F - W ^ L . V A T P 3 2 3 8 R vmaA G T P 4 4 6 f - w - * _ G T P 6 0 4 r ^ _ G T P r ^ _ G T P 9 8 0 r 500 bp Figure 2-3. Positions of primers used for P C R amplification and D N A sequencing to gen-erate Pleospora species phylogeny. Gene diagrams approximately to scale. Black boxes represent coding regions, gray boxes introns, and white boxes intergenic spacers. Specific primers designed for Alternaria alternata, S. lancipes isolate P229, S. trifolii isolate P244 and Stemphylium sp. isolate P246 are not shown. In EF-1 alpha, the small intron was ex-cluded from analyses due to high divergence. In the text, the small intron is referred to as 'internal intron' since it was the only EF-1 alpha intron that was entirely sequenced. 61 Figure 2-4. One most parsimonious tree from combined I T S , GPD and EF-1 alpha D N A sequences. Analyses were done with 39 unique multilocus genotypes, the remaining iso-lates were added after analyses (Table 2-6). Values by the branches are bootstrap support percentages above 70. Branches i n bold were supported by 100% of the bootstrap repl i -cates. The 53 boxed isolates were chosen for sequencing of the additional vmaA-vpsA lo-cus. B lack vertical lines on the right indicate subgeneric groups following C a m a r a et a l . (2002) and this study. F o r information on strain numbers see Table 2-2. 62 9 isolates (P93, P218, P230, il|pi771FP5irn 93 91 Vleosaora herbarum P21 Vleospora alfalfae P811 ystemphylium vesicarium P238I IPleosoora tomatonis P268 I Pleospora sedicola P2711 30 isolates (P126, P206, P208 P209, P213, P215, P217.P219, P220, P222, P223, P226. P228. P231, P233, P234, IP237I P274, P275, P276. P278. P279, P280. P281, P308.IP314lp318l P322, P324, P326) iPleosoora gracilariae P243I IP3151 P319 ^Stemphylium maiusculum P262] [Pleospora gigaspora P122 JPleospoi Stemphylium astragali P201 P203 P204 P205 -IP5571 j P214 P224 Pleospora eturmiuna P269I P312 P317 P320 P321 Vleospora tarda PI 1 P216I P307 P313 Group C • | Group B • ystemphylium lancipes P229I | Group F VStemphvlium solani P240I Stemphylium solani P241 P552-IE252. P407 1 P408 P409 • Stemphylium callistephi P383 | Group D - \Ploospora triglochinicola P1231 —•— \Pleospora paludiscirpi P2701 TIP§27I ^ ^ " 1 P338 r-EIl P338 IP2101 P227 P212 [FW1 P221 stemphylium sarclni. P2391 P309 Aemphvlium sarclni. P247I BJotf P384 I |g,te(/PM5 I fStemphylium trifolii P244 I Q -* o c m Stemphylium lycopersici P242 5 changes P406 IP249 '[Stemphylium xanthosomatis P232J Group A 63 Figure 2-5. Mos t parsimonious trees from separate I T S , GPD, EF-1 alpha and vmaA-vpsA analyses. Analyses were performed using only unique genotypes for which vmaA-vpsA was sequenced (Table 2-11). Add i t iona l isolates were added to the trees after analyses. N u m -bers by the branches reflect bootstrap support percentages above 70, given i n Table 2-12. Branches i n bold were supported by 100% of the bootstrap replicates. Sol id vertical lines represent phylogenetic species (Table 2-14). G r a y vertical lines are groups A - F following C a m a r a et a l . (2002) and this study. Note that phylogenetic species are congruent between a l l datasets. Phylogenetic trees have different scales, for a comparison of the information content between the datasets see Table 2-13. F o r information on strain numbers see Table 2-2. 64 P. tarda P1 I I Group B P. herbarum P2 . P. alfalfae P81 4JP235 P272 P273 P277 . P303 _ |4j Pgracilariae P2431 | Group C P. gigaspora P129 I H S. majusculum P262 I S. astragali P201 I P207 I P. eturmiuna P269 I P302 • 22IP56 I n P 3 4 2 l 1 'P107| 25 ITS 26 P246I S. trifolii P244I P. triglochinicola P123 • P210I P. paludiscirpi P2701 P327I s. lancipes P229I I Group F S. so/anf P2401 1 n S. callistephi P3S3 I I Group D ^ S. sarciniforme P239 I S. sarciniforme P247 I 1 S. /of/ P384I S. /ot/P38Sl o -T o c TJ m P245 P250 S. xanthosomatis P232 — 1 change I I Group A p. tarda PI | I Group B P. herbarum P2" P. affatfae P81 3]P235 "P272 P273 P277 P303 —1 P. gracilariae P243I 4 P31S I S. majusculum P2621 S. gigaspora P129 • — S. astragali P201 I ITP207 I 11] P. eturmiuna P269 I P302 I G P D Group C -22--\ P3421 _2fi_ P56 I P107I _f S. sarc. P2391 S. sarc. P2471 -T S./otf P384I S. loti P3S5 I _29_ "P246I R51 P. trigloch. P123 I — P.pa/u. P270I O - i o c m UP245 1 P250 S. xanthosomatis P232 5 changes "P210I "P327I ~S.tr/fo/HP244l " S. lancipes P229I | Group F • S.ao/an,P240. { | G r o u p Q " S. callistephi P3S3I ! | | Group A 'P. tarda P1l I Group B S. lancipes P229 I | GrOUp F J 2 _ P. herbarum P2 P. alfalfae P81 E F - 7 a /pha Group C P235 P277 P272 "P273 P303 I—|P.grac7/ariaeP243| _4'P315 I P. gigaspora PI 291 S. as(raga//P201l S. majusculum P2621 [JP207 I TP. eturmiuna P269I P302 I • S. solani P240I B _ _ S. callistephi P383I I Group D 21-P56 I P342I P107I P. triglochinicola P1231 20 n -P327I P. paludiscirpi P2701 P210I „ { S. sarciniforme P239I S. sarciniforme P247I 2 6 I S. /of/ P3841 S./o(/P385l S. xanthosomatis P232 ~ 6 changes S. trifo/// P244I 11 Group A 0 o c •o P. tarda P11 B Group B " S. lancipes P22911 Group F I P. herbarum P2| U P. a/fa/fee P81 ' P235 P272 P273 P277 P303 Lif P. gracilariae P243I P315 I vmaA-vpsA Group C P. gigaspora P129I ||~ S. majusculum P262 | S. astragali P201I MP207 | VT! P - eturmiuna P269I LP302 I S. so/an/ P240I I r^__,,„ r> S. callistephi P383 | J Group D _ W f 6 6 f rrsj P342I J 2 2 1 — P1Q7I 2? « IS. /otz" P384I S. /Ob' P385I lj-|P245 H 'P2S0 3 3 S. xanthosomatis P232 5 changes I I sarciniforme P239f S. sarciniforme P247 | S. frffo/// P244I P. triglochinicola P1231 P. paludiscirpi P270| P210| P327I 20[P21I Group A 65 Figure 2-6. One most parsimonious tree from combined I T S , GPD, EF-1 alpha and vmaA-vpsA analyses. O n l y 35 unique multilocus genotype were included i n analyses (Table 2-11), the remaining isolates were added to the tree after completion of the analyses. V a l -ues by the branches indicate bootstrap support percentages above 70 for parsimony, l ike-l ihood, Bayesian and Neighbor jo in ing analyses, and are given i n Table 2-12. Branches i n bold are supported by 100% of the replicates with a l l algorithms. T h i n vertical lines on the right represent phylogenetic species (Table 2-14). G r a y vert ical lines are groups A - F following C a m a r a et a l . (2002) and this study. F o r information on strain numbers see Table 2-2. 6 6 15 10 12 17 P235 P236 P301 P323 P325 P277 L P273 P272 Pleospora herbarum P2 Pleospora alfalfae P81 P237 Pleospora tomatonis P268 Pleospora sedicola P271 Stemphylium vesicarium P238 I P314 P318 P303 r Pleospora gracilariae P243 L P315 l£j Pleospora gigaspora P122 I ~ Pleospora gigaspora P129 I 8j Stemphylium majusculum P262 ^ P311 Stemphylium astragali P201 I 111 P207 L—] Pleospora eturmiuna P269 L P302 13 Group C Pleospora tarda | QrOUp B Stemphylium lancipes P229 | | GrOUP F 16 Stemphylium solani P240 P252 P253 Stemphylium callistephi P383 I Group D 18 34 32 P245 P316 P250 Stemphylium xanthosomatis P232 33 1£r - Pleospora triglochinicola P123 I - Pleospora paludiscirpi P2701 P327I 30 31 22 P210 I 21 f P56 -I P342 1 P107 I 25 27 29 26 P246I S. trifolii P2M I 22J S. sarcinifo. P2391 P310 I S. sarcinif. P247 I ~ P306 I r S. tof/P384 I S. loti P385 I O c m Group A 10 changes 67 2.4.5 Bibliography Altschu l , S. F . , M a d d e n , T . L . , Schaffer, A . A . , Zhang , J . , Zhang , Z . , M i l l e r , W . & L i p -man, D . J . (1997). Gapped BLAST and PSI-BLAST: a new generation of protein data-base search programs. Nucleic Acids Research 25, 3389-3402. Andersen, B . (1995). Characterization of cereal-borne Alternaria and Stemphylium. Ph.D. the-sis. Ph.D. Thesis. The Mycology Group, Department of Biotechnology, Technical Uni-versity of Denmark. Baker , K . F . & Davis , L . H . (1950). Stemphylium leaf spot of China Aster. Mycologia 42, 477-486. Baldauf, S. L . & Doolittle, W . F . (1997). Origin and evolution of the slime molds (Myceto-zoa). Proceedings of the National Academy of Sciences of the United States of America 94, 12007-12012. Bateman, A . , C o i n , L . , D u r b i n , R . , F i n n , R . D . , H o l l i c h , V . , Griffiths-Jones, S., K h a n n a , A . , M a r s h a l l , M . , M o x o n , S., Sonnhammer, E . L . , Studholme, D . J . , Yeats, C . & E d d y , S. R . (2004). The Pfam protein families database. Nucleic Acids Research 32, D138-D141. Berbee, M . L . , Pirseyedi, M . & H u b b a r d , S. (1999). Cochliobolus phylogenetics and the ori-gin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91, 964-977. Burset, M . , Seledtsov, I. A . & Solovyev, V . V . (2000). Analysis of canonical and non-canonical splice sites in mammalian genomes. Nucleic Acids Research 28, 4364-4375. Camara , M . P . S., O ' N e i l l , N . R . & B e r k u m , v., P (2002). Phylogeny of Stemphylium spp. based on ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycolo-gia 94, 660-672. Cavara , F . (1890). Macrosporium sarcinaeforme Cav. Nuovo parassita del trifoglio. La Difesa dai Parassiti 4, 3-8. Condeelis, J . (1995). Elongation factor 1 alpha, translation and the cytoskeleton. Trends Bio-chem Sci. 20,169-170. Cottrelle, P . , Thiele, D . , Pr ice , V . L . , Memet , S., M i c o u i n , J . - Y . , M a r c k , C , Buhle r , J . - M . , Sentenac, A . & Fromageot, P . (1985). Cloning, nucleotide sequence, and expression of one of two genes coding for yeast elongation factor 1 alpha. The Journal of Biological Chemistry 260, 3090-3096. C r i v e l l i , P . G . (1983). Uber die heterogene Ascomycetengattung Pleospora Rabenh.; Vorschlag fur eine Aufteilung. Ph.D. thesis. Eidgenossische Technische Hochschule, Zurich, Switzerland. Croan , S. C , Burdsa l l , H . H . & Rentmeester, R . M . (1999). Preservation of tropical wood-inhabiting basidiomycetes. Mycologia 91, 908-916. de Jesus Yanez Morales , M . (2001). Molecular and morphological analyses of Alternaria and Stemphylium from onion. Ph.D. thesis. Cornell University. Gardes, M . & Bruns , T . D . (1993). ITS primers with enhanced specificity of basidiomycetes: application to the identification of mycorrhizae and rusts. Molecular Ecology 2, 113-118. Geiser, D . M . , Pit t , J . I. & Taylor , J . W . (1998). Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proceedings of the National Academy of Sciences of the United States of America 95, 388-393. G r a h a m , J . H . (1953). A disease of Birdsfoot Trefoil caused by a new species of Stemphylium. Phytopathology 43, 577-579. 68 G r a h a m , J . H . (1957). A Stemphylium disease of Ladino white clover. Phytopathology 47, 213-215. Hawkswor th , D . L . , K i r k , P . M . , Sutton, B . C . & Pegler, D . N . (1995). Dictionary of the Fungi, 8 edn. Wallingford, Oxon, UK: CAB International. H o l m , L . (1962). Lewis E. Wehmeyer, a world monograph of the genus Pleospora and its seg-regates. Svensk Botanist Tidskrift 56, 377-381. Huelsenbeck, J . P . & Ronquist , F . (2003). MrBayes: Bayesian analysis of phylogeny: Dis-tributed by the authors. Huelsenbeck, J . P . , B u l l , J . J . & Cunningham, C . W . (1996). Combining data in phyloge-netic analysis. Trends Ecol. Evol. 11,152-158. Huguenin , B . (1965). Mycromycetes du pacifique sud. Troisieme contribution. Ddmatiees de Nouvelle-Caledonie. Bulletin de la Societe Mycologique de France 81, 694-698. Ichiishi , A . & Inoue, H . (1995). Cloning, Nucleotide-Sequence, and Expression of Tef-1, the Gene Encoding Translation Elongation-Factor 1-Alpha (Ef-l-Alpha) ofNeurospora crassa. Japanese Journal of Genetics 70, 273-287. Kars ten , P . A . (1884). Fragmenta mycologica XI. Hedwigia 23, 37-39. Kasuga, T. , Taylor , J . W . & White , T . J . (1999). Phylogenetic relationships of varieties and geographical groups of the human pathogenic fungus Histoplasma capsulatum Darling. Journal of Clinical Microbiology 37, 653-663. Koufopanou, V . , Bur t , A . & Taylor , J . W . (1997). Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitits. Proceedings of the National Academy of Sciences of the United States of America 94, 5478-5482. K u r o k i , Y . , Juvvadi , P . R . , A r i o k a , M . , Naka j ima, H . & Ki tamoto , K . (2002). Cloning and characterization of vmaA, the gene encoding a 69-kDa catalytic subunit of the vacuolar H+- ATPase during alkaline pH mediated growth of Aspergillus oryzae. Ferns Microbi-ology Letters 209, 277-282. Lee, S. B . & Taylor , J . W . (1990). Isolation of DNA from fungal mycelia and single spores. In PCR Protocols, pp. 282-287. Edited by M . A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White. San Diego: Academic Press, Inc. Mehta , Y . R . (1998). Severe outbreak of Stemphylium leaf blight, a new disease of cotton in Brazil. Plant Disease 82, 333-336. Mehta , Y . R . (2001). Genetic diversity among isolates of Stemphylium solani from cotton. Fi-topathologia Brasileira 26, 703-709. Mehta , Y . R . & Brog in , R . L . (2000). Phytotoxicity of a culture filtrate produced by Stem-phylium solani of cotton. Plant Disease 84, 838-842. Mehta , Y . R . , Meh ta , A . & Rosato, Y . B . (2002). ERIC and REP-PCR banding patterns and sequence analysis of the internal transcribed spacer of rDNA of Stemphylium solani isolates from cotton. Current Microbiology 44, 323-328. O'Donnel l , K . & Cigelnik , E . (1997). Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phyloge-netics and Evolution 7,103-116. O 'Donne l l , K . , Kis t le r , H . C , Cigelnik , E . & Ploetz, R . C . (1998). Multiple evolutionary ori-gins of the fungus causing Panama disease of banana: Concordant evidence from nu-clear and mitochondrial gene genealogies. Proceedings of the National Academy of Sci-ences of the United States of America 95, 2044-2049. Rambaut , A . (1995). Se-Al vl.dl, Version 1.0 alpha edn. Oxford, U.K: Department of Zool-ogy, University of Oxford. Simmons, E . G . (1969). Perfect states of Stemphylium. Mycologia 61,1-26. 6 9 Simmons, E . G . (1985). Perfect states of Stemphylium. II. Sydowia, Annates Mycologici Ser. II. 38, 284-293. Simmons, E . G . (1989). Perfect states of Stemphylium. III. Memoirs of the New York Botanical Garden 49, 305-307. Simmons, E . G . (2001). Perfect states of Stemphylium: IV. Harvard Papers in Botany 6, 199-208. Swofford, D . L . (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Meth-ods). Version 4. Sunderland, Massachusetts: Sinauer Associates. Tarutani , Y . , Ohsumi , K . , A r i o k a , M . , Naka j ima, H . & Ki tamoto , K . (2001). Cloning and characterization of Aspergillus nidulans vpsA gene which is involved in vacuolar bio-genesis. Gene 268, 23-30. Taylor , D . L . , Jacobson, D . J . , K r o k e n , S., Kasuga , T. , Geiser, D . M . , Hibbett , D . S. & Fisher , M . C. (2000). Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31, 21-32. Thompson, J . D . , Gibson, T . J . , Plewniak, F . , Jeanmougin, F . & Higgins, D . G . (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. In Nucleic Acids Research, pp. 4876-4882: Distributed by the authors. Thornewell , S. J . , Peery, R . B . & Skat rud , P . L . (1995). Cloning and characterization of the gene encoding translation elongation factor 1-alpha from Aureobasidium pullulans. Gene 162, 105-110. Weber , G . F . (1930). Gray leaf spot of tomato caused by Stemphylium solani, sp. nov. Phyto-pathology 20, 513-518. Webster, J . (1969). The Pleospora state of Stemphylium triglochinicola. Transactions of the British Mycological Society 53, 478-482. Wehmeyer, L . E . (1961). A world monograph of the genus Pleospora and its segregates. Ann Arbor: The University of Michigan Press. Wendland, J . & Kothe , E . (1997). Isolation of tefl encoding translation elongation factor EF1 alpha from the homobasidiomycete Schizophyllum commune. Mycological Research 101, 798-802. White , T . J . , Bruns , T. , Lee, S. & Taylor , J . (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, pp. 315-322. Edited by M . A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White. San Diego: Academic Press, Inc. Wiley , E . O . (1981). Phylogenetics: the theory and practice of phylogenetic analysis. New York: John Wiley & Sons. Yamamoto , W . (1960). Synonymous species of Alternaria and Stemphylium in Japan [in Japa-nese]. Transactions of the Mycological Society of Japan 2, 88-93. Yosh i i , H . (1929). A leaf spot disease of Astragalus sinicus L [in Japanese]. Journal of Plant Protection 16, 533-537. Z h a n , J . , Pettway, R . E . & M c D o n a l d , B . A . (2002). The global genetic structure of the wheat pathogen Mycosphaerella graminicola is characterized by high nuclear diversity, low mitochondrial diversity, regular recombination, and gene flow. Fungal Genetics and Biology 38, 286-297. 70 CHAPTER 3. Mating system evolution in Pleospora sensu stricto 7 1 3.1. Introduction 3.1.1 The MAT locus in Cochliobolus and hypotheses Sexual reproduction in ascomycetes is controlled by the MAT locus, a master regulator of downstream gene expression (Turgeon et al., 1993b). To be sexually compatible, individuals of one species have to differ at their MAT lo-cus (Turgeon & Yoder, 2000). Opposite mating types evolved early in ascomy-cete history, since they are shared among all major groups of ascomycetes. MAT loci consist of MAT genes and flanking regions. Since MAT alleles are too divergent to be aligned, they are not alleles in the true sense and are thus called idiomorphs instead (Metzenberg & Glass, 1990). In Cochliobolus which as Pleospora is in the family Pleosporaceae, there are two MAT idiomorphs, each containing a MAT1-1 or MAT1-2 gene. Mating type genes can be ar-ranged in different ways in Cochliobolus, correlating with different life history strategies. Heterothallic species either have a MAT1-1 or a MAT1-2 gene at their MAT locus, whereas homothallic species have both. The MAT regions can either be fused end to end as in C. luttrellii or in reversed order in C. homo-morphus, or their arrangement can be more complex. In C. kusanoi MAT1-1 is fragmented, and in C. cymbopogonis, the MAT genes were still present in the same genome, but not near each other (Yun etal., 1999). An unequal cross-over between MAT1-1 and MAT1 -2 strains was suspected to be responsible for the fusion of the adjacent MAT genes. For the more complicated MAT gene arrangements, no explanation was yet possible (Yun etal, 1999). Phylogenetic analyses showed that homothallism evolved several times in Cochliobolus (Berbee etal., 1999), and most likely from heterothallism. Whereas it is theoretically possible that homothallism was the ancestral state in Cochliobolus, and heterothallism was derived, it is hard to imagine how the homothallic MAT gene arrangement could have broken down to yield the ar-rangement in the heterothallics (Yun et al., 1999). As in Cochliobolus, Pleospora contains both heterothallic and homothallic species, and is thus amenable to the same kind of studies as in Cochliobolus. In this chapter, I address the following mating type related questions. What is the architecture of the MAT locus in species of Pleospora? Do the mating type genes in Pleospora correlate with mating system as they do in Cochliobolus? How many times did a switch between heterothallics and homothallics occur in the evolution of Pleospora? My approach was to first generate a robust species phylogeny based on four non-MAT loci (see Chapter 2). I then screened all isolates for the presence of MAT1-1 and MAT1-2 genes, and determined the mating type arrangement of representative isolates by DNA sequencing. To investigate a correlation be-tween mating system and MAT locus architecture, I compared the mating type 72 arrangements in Pleospora with evidence for selfing and outcrossing for the phylogenetic species. Finally, to determine the number of mating system changes in the evolution of Pleospora, I generated mating type gene phyloge-nies, and compared them to the species phylogeny. Supported by MAT gene arrangement data, the results suggested the occurrence of a lateral gene transfer in the evolution of Pleospora and the evolution of three kinds of self-ers from outcrossers. 3.2. Materials and methods 3.2.1 Fungal strains used All 110 strains of Pleospora (Table 2-2) were screened for presence of mating type genes. A representative selection of 37 isolates was chosen for se-quencing of the entire mating type region (Figure 3-1). 3.2.2 Conditions used for crosses In crosses within phylogenetic species of S. xanthosomatis and S. solani, iso-lates of differing mating types were paired on V8 agar plates (Hawksworth et al., 1995) to which autoclaved, previously dried alfalfa stems were added. Plates were sealed with parafilm, and left on a laboratory bench for three months, subject to both natural and artificial light during working hours and darkness at night. 3.2.3 Molecular work 3.2.3.1 DNA extraction, PCR and DNA sequencing See page 12. 3.2.3.2 Primers and PCR conditions 3.2.3.2.1 Species phylogeny The combined ITS, GPD, EF-1 alpha, and vmaA-vpsA multigene species phylogeny in Figure 3-1 was taken from Chapter 2 (Figure 2-6). 3.2.3.2.2 Screening for mating type gene arrangement To screen Pleospora isolates for presence and arrangement of mating type genes, mating type specific primers in conserved regions were designed. Con-served regions were the DNA binding motives alpha box on MAT1-1, and the HMG box on MAT1-2. Primers were based on Pleospora sequences contained in the thesis of de Jesus Yanez Morales (2001). The MAT1-1, alpha box specific forward and reverse primers were Jenlf and Jenlr, and the MAT1-2, HMG box specific primers were Jen2f and Jen2r (Table 3-1 to Table 3-4). PCR conditions 73 used were 5 minutes initial denaturation at 95°C, 40 cycles of 10 sec at 95°C, 20 sec at 52°C and 30 sec (+4 sec/cycle) at 72°C, followed by a final exten-sion of seven minutes at 72°C. For isolates that had both alpha and HMG boxes, the orientation of the mating type genes was probed by PCR amplifica-tion using combinations of alpha with HMG box primers, with identical PCR con-ditions. 3.2.3.2.3 Screening for the presence of MAT1-2 in additional isolates of Pleospora sp. strain P56 Primer sets Alphal 81 f/Jen1 ri and Jen2f/Jen2r (see Figure 3-2) were used to screen the eight additional single ascospore isolates from the material of Pleo-spora sp. strain P56 for MAT1-1 and MAT1-2, respectively. The additional iso-lates were not listed in Table 2-2. 3.2.3.2.4 Generation of M A T gene DNA sequences and flanking regions To determine DNA sequences of the entire mating type genes and flanking re-gions, the chromosome walking kit Vectorette was used (Sigma-Genosys, The Woodlands, Texas, USA). For detailed protocols, see chapter 7.2. The proce-dure involved a digest of the fungal DNA using the respective restriction en-zymes BamHI, EcoRlox C/a/(Roche Diagnostics GmbH, Mannheim, Germany). Adapters were then ligated to the DNA fragments using a T4 DNA ligase (Roche Diagnostics GmbH, Mannheim, Germany). In PCR reactions, an adapter specific primer was used with a Pleospora specific primer to generate PCR fragments of up to ca. 6 kpb (Table 3-8). For chromosome walking off the MAT genes, Pleospora primers were de-signed in the previously sequenced DNA binding motives of the mating type genes. Two or three primers pointing in the same direction were designed at least ca. 20 bp apart. In a first set of PCR reactions, the outer Pleospora primer was used together with the outer adapter primer, nicknamed 'Vec'. The resulting PCR product was used diluted 100 times in a second set of PCR reac-tions, generally with an internal MAT primer, and the internal adapter primers, 'VecN'. The resulting PCR products were sequenced with the PCR primers, or internal MAT primers, and additional forward and reverse sequencing primers were designed to reach the desired overlapping sequencing coverage in both directions. If necessary, chromosome walking was repeated to further extend sequencing coverage. Hotstart and touchdown PCR protocols were followed in both sets of chromosome walking PCRs. The PCR cocktail was prepared without the addition of Taq polymerase. 12.5 pl of template were added, overlaid with a drop of mineral oil and the PCR program started. Once the tubes were heated to 94°C, 0.5 pl of Expand High Fidelity PCR System Taq was used (Roche Diagnostics GmbH, Mannheim, Germany), and the PCR program left to run with the follow-74 ing parameters. At first, 20 cycles with decreasing annealing temperature, followed by 20 cycles with stable annealing temperature. The initial denatura-tion step (2 min at 94°C) was followed by 20 cycles of denaturation (10 sec at 94°C), annealing (20 sec first at 70°C, then -0.5° per cycle), and extension steps (first 30 sec then +4 sec per cycle at 72°C), followed by 20 cycles of denaturation (10 sec at 94°C), annealing (20 sec at 60°C), and extension (first 1 min, then +4 sec per cycle at 72°C), and a final extension step of 7 min at 72°C. The second set of PCR reactions used internal primers on a 100 times dilution of the PCR product from the first set, and the same PCR condi-tions as in the first set, except for 5°C lower annealing temperatures and a one minute longer extension time for the last 20 cycles, on a GeneAmp PCR Sys-tem 9700 (PE Biosystems, Foster City, CA, USA). On the DNA sequences obtained from chromosome walking in selected isolates, additional primers were designed in conserved sites to PCR amplify and sequence the MAT regions of additional isolates. A total of 93 different primers were used in PCR amplifications and sequencing. The positions of the most frequently used primers are shown on the gene diagrams in Figure 3-2. For exact positions of all primers and primer sequences, see Table 3-1 and Table 3-2 for the MAT1-1 region, Table 3-3 and Table 3-4 for the MAT1-2 re-gion and Table 3-5 and Table 3-6 for the fused MAT regions. For primers and PCR conditions used for each isolate, see Table 3-7 for the MAT1-1 regions, Table 3-8 for the MAT1-2 regions, and Table 3-9 for the fused MAT regions. Conditions for conventional PCR were as follows, with the respective annealing temperature and number of cycles from Table 3-7 - Table 3-9. 5 minutes initial denaturation at 95°C, X cycles of 10 sec at 95°C, 20 sec at Y°C and 30 sec (+4 sec/cycle) at 72°C, followed by a final extension of seven minutes at 72°C, on a GeneAmp PCR System 9700 (PE Biosystems, Foster City, CA, USA). 3.2.3.3 Phylogenetic analyses 3.2.3.3.1 D N A For DNA sequence analyses, see Chapter 2, page 1 6. 3.2.3.3.2 Proteins For parsimony analyses, the PHYLIP 3.572 package was used (Felsenstein, 2001). Most parsimonious trees were inferred using PROTPARS. Default op-tions were used, except that input order was randomized, and 30 random se-quence additions were used (jumble set to 30). Strict consensus trees were calculated and drawn using PAUP* (Swofford, 2002). For bootstrap analyses, 500 random datasets were created using SEQBOOT with default settings, and analyzed in PROTPARS with one random taxon addition per dataset (jumble set to 1). 75 For distance trees, a likelihood estimated distance matrix was obtained with TREE-PUZZLE 5.0 (Strimmer & von Haeseler, 1996). Default settings were utilized, except that 10,000 puzzling steps were used with a HKY substitution model, the proportion of variable sites and transition-transversion ratio were estimated from the dataset, and the gamma distributed substitution rates were approximated by four rate categories. The resulting distance matrix was imported into the FITCH component of PHYLIP 3.572 (Felsenstein, 2001) to construct and optimize the tree topology using a Fitch-Margoliash method with default settings, except that the global optimization option was in effect and the input order was randomized with the jumble option set to 30. The result-ing tree was manipulated in MacClade 4.03 (Maddison & Maddison, 2001), and printed in PAUP* (Swofford, 2002). 3.2.3.4 Defining idiomorphs by MAT region comparisons To define idiomorph boundaries, pairs of MAT1-1 and MAT1-2 region DNA se-quences were aligned for each species using ClustalX (1.8) (Thompson et al., 1997). The beginning of the idiomorphs was expected to be marked by a sud-den drop of DNA sequence similarity between MAT1-1 and MAT1-2 regions. The computer program SWAN (1.0b) (Proutski & Holmes, 1998) was used to plot the percentage similarity of the DNA sequences. Settings were default ex-cept for a window size of 10 bp and a shift of 10 bp. 3.3. Results 3.3.1 Mating type genes 3.3.1.1 Mating type screening to investigate MAT locus architecture Out of the 110 isolates of Pleospora screened, 24 isolates had MAT1-1 only, ten had MAT1-2 only, and the remaining 76 isolates had both MAT1-1 and MAT1-2 genes (Table 3-10). All Pleospora isolates were initially screened with the MAT1-1 and MAT1-2 specific primer sets. For MAT1-1, the diagnostic fragment was expected to be ca. 206 bp in length, and the MAT1-2 specific fragment ca. 225 bp (de Jesus Yanez Morales, 2001). In ten cases, primer JenlF had to be replaced by primer BPH04d, 15 bp upstream of the JenlF 3'-end (data not shown; Table 3-1). For isolates that had both alpha and HMG boxes, the orientation of the mating type genes was probed by PCR amplifica-tion using all different combinations of alpha with HMG box primers. The suc-cessful combination was primers Jen1 r and Jen2f yielding a PCR product of ca. 1.6 kb, indicating that the mating type genes were located in close proximity, and that one was reversed. It was determined that all isolates with both MAT1-1 and MAT1-2 diagnostic PCR fragments also had the ca. 1.6 kb Jenlr and Jen2f PCR fragment indicating that the MAT genes in homothallics were all ar-7 6 ranged in the same way with respect to each other (data not shown). Mating type loci with both MAT genes are referred to as 'MAT1-1; MAT1-2 (Lee et al., 2003), as opposed to 'MAT1-V and lMAT1-2 where only one MAT gene is present at the MAT locus (Turgeon & Yoder, 2000). 3.3.1.2 Screening for MAT1-2 in additional isolates of the homothallic Pleospora sp. strain P56 In all eight additional single ascospore isolates of Pleospora sp. strain P56, only MAT1-1 was detected (data not shown). 3.3.1.3 MAT DNA sequences obtained A total of 14 MAT1-1, six MAT1-2, and 17 MAT1-1; MAT1-2 region DNA se-quences were generated. Isolates were chosen to reflect the genetics of the isolates used in this study (Figure 3-1). This was done to confirm PCR MAT screening results, to find genes flanking the MAT loci, and to determine the orientation of the MAT genes with respect to neighboring genes. A chromo-some walking PCR approach and DNA sequencing was used with the following isolates. Pleospora sp. strain P56, S. lancipes strain P229, Stemphylium sp. strain P245 and S. lancipes strain P247 for isolates with only MAT1-1. The se-quences generated were between 8455 and 2831 bp in length. For isolates with only MAT1-2, chromosome walking was used for S. xanthosomatis strain P232 and Stemphylium sp. strains P250 and P252, with DNA sequences gen-erated ranging in size from 4707 - 7248 bp. For isolates with both MAT genes, chromosome walking was used for P. tarda strain P1 and P. herbarum strain P2, where sequences of 6102 bp and 3997 bp were generated respec-tively. All DNA sequences were aligned to find conserved sequence regions common to all isolates suitable for primer design. The resulting primers were used to PCR amplify 10 more MAT1-1 regions, three more MAT1-2 regions, and 15 more fused MAT regions. The sequence lengths ranged from 2203 bp to 2475 bp in MAT1-1 isolates, 2571 - 2607 bp in MAT1-2 isolates, and 3851 - 4099 bp in isolates with both MAT genes. Thus, a total of 14 MAT1-1, six MAT1-2, and 17 MAT1-1; MAT1-2 region DNA sequences were generated. Homologous DNA sequences were easily alignable between isolates with only MAT1-1 or MAT1-2, and isolates with both MAT genes (data not shown). 3.3.1.4 Mapping of mating type regions 3.3.1.4.1 MAT1-1 regions The longest MAT1-1 region DNA sequence obtained was the one of Pleospora sp. strain P56, 8455 bp in length. Using DNA sequence comparison to the ho-mologous region in the closely related Cochliobolus heterostrophus (AF029913), it was determined that it contained the following genes (Figure 3-3). GTPase activating protein homolog GAP1 (positions 1 - 637 in Pleospora 77 sp. strain P56), 0RF1 (1184 - 1801), MAT1-1 (2451 - 3643), and beta gluco-sidase homolog BGL1 (8146 - 8455). Thus, the genes and gene arrangement in the Pleospora sp. strain P56 mating region were identical to the one in C. heterostrophus (Turgeon etal., 1993a). The remaining 13 MAT1-1 region DNA sequences (Figure 3-1) started between 34 and 280 bp inside the ORF1 and extended between 322 and 2373 bp beyond MAT1-1. In all isolates, the MAT1-1 gene was 1193 bp in length, with an intron of 53 bp from position 218 - 270. Thus, the exon was 1140 bp in length. 3.3.1.4.2 MAT1-2 regions The longest MAT1-2 region DNA sequence was from S. xanthosomatis strain P232, 7248 bp in length. Using DNA sequence comparison to the homologous regions in C. heterostrophus (AF027687), it was mapped as follows (Figure 3-3): ORF1 (positions 1-321), MAT1-2 (1352 - 2444), beta glucosidase ho-molog BGL1 (6958 - 7248). Thus, as in MAT1-1, the genes and gene ar-rangement in the S. xanthosomatis strain P232 mating region were identical to the one in C. heterostrophus (Turgeon etal., 1993a). The remaining five iso-lates (Figure 3-1) extended 21 - 320 bp into ORF1, and 397 - 2265 bp be-yond the MAT1-2 gene. In all isolates, the MAT1-2 gene was 1093 bp in length, with an intron of 55 bp from position 491 - 545. Thus, the exon was 1038 bp in length. 3.3.1.4.3 Fused mating type regions with both MATl-l mdMATl-2 The longest DNA sequence containing both MAT1-1 and MAT1-2 genes was from P. tarda strain P1, and was 6102 bp long. It was compared to homolo-gous regions from C. heterostrophus (AF029913, AF027687) and was mapped as follows (Figure 3-3). GAP1 gene (positions 1-255), ORF1 618 bp in length (802-1419), inverted MAT1-1 1193 bp in length (2040-3232), and MAT1-2, 1093 bp in length (3710-4802). The sequences of the remaining 16 fused MAT regions (Figure 3-1) started 44 - 167 bp within the ORF1 and ter-minated 418 - 464 bp downstream of MAT1-2. No length variation within the mating type genes or introns was present. The MAT exons and genes were of equal lengths, and contained introns at the same positions as the MAT genes of the outcrossers. However, the fused MAT regions did fall into two groups lengthwise, due to a deletion of 201 bp 97 bp upstream of the MAT1-2 5'-end in isolates P. tarda strain P1, P. herbarum strain P2, P. alfalfae strain P81, P gigaspora strain P129, S. astragali strain P201, Stemphylium sp. strain P207, S. vesicarium strain P238, P. gracilariae strain P243, S. majusculum strain P262, P. tomatonis strain P268, P. eturmiuna strain P269, P. sedicola strain P271, and Stemphylium sp. strain P303. Isolates P. triglochinicola strain P123, Stemphylium sp. strain P210, P. paludiscirpi strain P270 and Pleospora sp. strain P327 did not have this deletion (data not shown). 78 3.3.1.5 Phylogenetic information content in MAT regions Homologous DNA sequences from separate and fused MAT regions were aligned, and the content of parsimony informative characters determined using PAUP* (Swofford, 2002) (Table 3-11). Sequences evaluated corresponded to the idiomorph portion of the inverted MAT1-1 regions and the MAI'1-2 idio-morph present in the fused MAT regions. 3.3.1.6 Comparison between separate and fused MAT regions The MAT1-1 gene of the fused MAT regions was inverted. DNA sequence com-parison of fused mating type regions to separate MAT regions showed that the fused MAT regions were arranged as shown in Figure 3-4. An inverted MAT1-1 gene was present between the ORF1 and MAT1-2. In detail, the MAT1-1 region was in the usual forward orientation found in separate MAT1-1 idiomorphs, 326 - 335 bp downstream of ORF1, depending on the isolate. There it was cut upstream of an 'ATG' motive and fused to an inverted MAT1-1 fragment of 1710 - 1797 bp in length, carrying the MAT1-1 gene and flanking regions. The flanking regions were 204 - 288 and 310 - 316 bp in length, downstream and upstream of the MAT1-1 gene, respectively. The inverted MAT 1-1 region was then fused to a forward MAT1-2 region, 159-362 bp upstream of the MAT1-2 gene. The MAT1-2 region, from the fusion point to MAT1-1 downstream, was as in separate MAT1-2 regions. In summary, the fused MAT regions contained two complete mating type genes. The MAT1-1 region, spanning from the ORF1 ca. 2000 bp downstream, was as in separate homologs, except that the ORF1 distal ca. 1850 bp were inverted, and fused to a MAT1-2 region. 3.3.1.7 Evolution of fused MAT regions A possible scenario for the evolution of the fused MAT regions is based on the following observations. At the fusion junction between all MAT1-1 and MAT1-2 regions, the four nucleotide motive 'CCAT' was present (Figure 3-5). This mo-tive was also present at homologous position in separate MAT1-2 regions, and as reverse complement in separate MAT1-1 regions. This allowed for the theo-retical possibility of a crossover between separate MAT regions following an inversion in MAT1-1, leading to the fused MAT regions found in Pleospora (Figure 3-6). The 'CCAT motive was not present in all the isolates, but in four out of the six MAT1-2 regions sequenced (S. xanthosomatis strains P232, Stemphylium sp. strains P250 and P252, and S. loti strain P385), as a reverse complement in five out of 14 MAT1-1 regions (S. solani strain P240, S. trifolii strain P244, Stemphylium sp. strains P245, P253, P316) and in all of the fused MAT regions (Figure 3-5). 79 3.3.1.8 Delimitation of the idiomorphs MAT alleles are called idiomorphs for lack of any compelling DNA similarity (Metzenberg & Glass, 1990). To delimit the idiomorphs in Pleospora, all MAT regions were aligned. It was found that the similarity between MAT1-1 and MAT1-2 regions dropped to a random level 16 or 17 amino acids upstream of the ORF1 stop codon for MAT1-2 and MAT1-1 respectively. Thus, the 5'-end of the idiomorph was within the adjacent ORF1 (Figure 3-7). The delimitation of the 3'-end of the idiomorph was less distinct, islands of similarity between MAT1-1 and MAT1-2 appeared gradually. The 3'-end of the idiomorph was chosen to be upstream of the motive TT(T/C)(T/C)(T/C), shared between MAT1-1 and MAT1-2 (Figure 3-7). In fused MAT regions, the 5'-end of this motive was 100 or 175 bp downstream of MAT1-1 and 176 bp downstream of MAT1-2. In separate MAT regions, it was 175 bp downstream of MAT1-1 and 173 - 176 bp downstream of MAT1-2, depending on the iso-lates. The entire idiomorphs were sequenced for the following five separate MAT1-1 regions. Pleospora sp. strain P56, S. lancipes strain P229, S. sarcini-forme strain P247, and Stemphylium sp. strains P246 and P316, they were be-tween 2029 - 2078 bp long. For the remaining nine isolates only the 3'-idiomorph border was reached. For the separate MAT1-2 regions, complete idiomorphs were obtained for S. xanthosomatis strain P232 and strains Stem-phylium sp. P250 and P252, all 2349 bp in length. For the remaining three isolates, only the 3'-idiomorph border was reached. For fused MAT1-1 regions, the 5'-idiomorph border was reached in P. tarda strain P1, P. herbarum strain P2, P. alfalfae strain P81, S. majusculum strain P262, P. paludiscirpi strain P270 and P. sedicola strain P271. For the MAT1-2 genes from the fused re-gions, the 5'-idiomorph end was not present, due to fusion to the inverted MAT1-1 region. The 3'-idiomorph border was reached in all 17 fused MAT re-gions. An idiomorph length as for separate MAT regions was not possible to define in the selfers, since the inverted portion of the MAT1-1 region extended 108 - 114 bp beyond the idiomorph downstream of MAT1-1 (Figure 3-7). The choice of idiomorph boundary had implications on the outcome of phylogenetic idiomorph analyses. Including DNA characters beyond the idio-morphs where crossovers are not suppressed will introduce phylogenetic error. To examine the phylogenetic information present around the chosen idiomorph 3'-end, an alignment of all DNA sequences downstream of the MAT genes was made. Phylogenetic parsimony analyses showed that the MAT - idiomorph 3'-end region separated MAT1-1 and MAT1-2 with 100% bootstrap support. This is expected in the case of idiomorphs. The 162 positions from the 3' idio-morph end downstream to the end of the inverted MAT 1-1 region in selfers, separated MAT1-1 and MAT1-2 with only 66% bootstrap support (data not shown). This might be evidence for recombination beyond the idiomorph 3'-80 end, gradually introducing a phylogenetic signal grouping according to species instead of mating types. 3.3.1.9 Phylogenetic analyses Two sets of analyses were done. To test for monophyly of Pleospora and de-termination of the basal lineage within Pleospora, MAT1-1 and MAT1-2 protein sequences were analyzed. Amino acid comparisons showed that from the ho-mologous sequences available in GenBank, only Cochliobolus and Alternaria protein sequences were similar enough to Pleospora to be aligned with confi-dence (data not shown). Thus, to test for monophyly of Pleospora, four repre-sentatives of Cochliobolus, and one of Alternaria alternata were chosen for in-clusion in the analyses. In a second round of analyses, to increase the phyloge-netic resolution within Pleospora, DNA sequences of MAT genes and flanking regions were used. The taxon sampling was restricted to Pleospora, and the trees were rooted based on results from protein analyses. 3.3.1.9.1 Mating type protein phylogenies 3.3.1.9.1.1 MATl-l protein analyses All 31 MAT1-1 protein sequences from both separate and fused MAT regions were used for phylogenetic analyses with likelihood, parsimony, and distance algorithms. To test for monophyly of Pleospora, five taxa of the family Pleo-sporaceae retrieved from GenBank were added. These were Alternaria alter-nata (AB009451), Cochliobolus cymbopogonis (AF129744), C. heterostro-phus (AF029913), C. ellisii (AF129746) and C. sativus (AF275373). Only one representative per amino acid sequence was included. Thus, excluded from analyses were the following five taxa: S. sedicola strain P271 and Stemphylium sp. strain P303 (both identical to P. herbarum strain P238), P. tomatonis strain P268 (identical to P. alfalfae strain P81), Pleospora sp. strain P207 (identical to P. eturmiuna strain P269), Stemphylium sp. strain P316 (identical to Stemphylium sp. strain P245). The alignment used for analyses thus con-tained 31 taxa and 429 characters. Three different algorithms were used for inference of phylogenetic pro-tein trees. The Fitch-Margoliash method yielded a distance tree. It is illustrated in Figure 3-8, with the five excluded taxa added, and thus comprising all 31 in-group taxa. Parsimony analyses yielded 50 most parsimonious trees of 1012 steps each. Bootstrap support values above 70% are shown in Figure 3-8 by the branches in first position or in Table 3-12 and Table 3-13. On a 70% bootstrap support level, the most parsimonious trees were identical to the distance tree (data not shown). 81 In likelihood analyses using quartet puzzling one tree was obtained. Sup-port for branches above 70% are shown by the branches in second position in Figure 3-8 or in Table 3-12 and Table 3-13. On a 70% bootstrap support level, the quartet puzzling tree was congruent with the distance tree (data not shown). 3.3.1.9.1.2 MAT1-2 protein analyses All 23 MAT1-2 protein sequences were used for phylogenetic protein analyses. Other MAT1-2 sequences from GenBank were used from the same five taxa as in the MAT1-1 dataset. These were A. alternata (AB009452), C. cymbopogo-nis (AF129745), C. heterostrophus (AF027687), C. ellisii (AF129747), C. sa-tivus (AF275374). Excluded from analyses were S. vesicarium strain P238, P. tomatonis strain P268, P. sedicola strain P271 and Stemphylium sp. P303 (all identical to P. alfalfae strain P81). Thus, the dataset contained 24 taxa and 365 characters. The same three algorithms as for MAT1-1 were used for inference of phylogenetic MAT1-2 protein trees. In distance analyses, a Fitch-Margoliash distance tree was obtained. It is illustrated in Figure 3-9, with the four excluded taxa added and thus compris-ing all 23 MAT1-2 protein sequences obtained. Parsimony analyses yielded 50 most parsimonious trees of 754 steps each. Bootstrap support percentages above 70% are given by the branches in first position in Figure 3-9 or in Table 3-12 and Table 3-13. The strict consen-sus tree of the most parsimonious trees was compatible with the topology of the distance tree in Figure 3-9, on a 70% bootstrap support level (data not shown). Likelihood analyses with quartet puzzling yielded one tree. Support for compatible branches above 70% are shown in second position in the distance tree of Figure 3-9 or in Table 3-12 and Table 3-13. The quartet puzzling tree was compatible with the distance tree in Figure 3-9, except that the phyloge-netic species P. eturmiuna and P. tarda were monophyletic with 76% branch support (data not shown). 3.3.1.9.2 Idiomorph DNA sequence analyses 3.3.1.9.2.1 MAT1-1 idiomorph DNA sequence analyses These analyses based on DNA sequences were aimed at improving the branch support within Pleospora. Only Pleospora taxa were used. The MAT1-1 DNA sequences included for analyses corresponded to the inverted part of the MAT1-1 idiomorph in fused MAT regions, and homologous regions in separate MAT regions. Excluded were P. sedicola strain P271, Stemphylium sp. strain P303 (both identical to S. vesicarium strain P238) and Stemphylium sp. strain 82 P316 (identical to Stemphylium sp. strain P245). Thus, the dataset used for analyses contained 28 taxa and 1688 characters. For phylogenetic analyses, both likelihood, parsimony, Bayesian analyses and Neighbor joining were used. Likelihood analyses yielded one most likely tree (-In likelihood = 8500.90814). It is illustrated in Figure 3-10, with the three excluded taxa re-added. Bootstrap branch support percentages were based on 217 replicates and are listed in Table 3-12 and Table 3-13. In parsimony analyses, four most parsimonious trees were obtained of 1145 steps each (CI = 0.768, RI = 0.851). Parsimony bootstrap supports above 70% are listed in Table 3-12 and Table 3-13. The most parsimonious trees differed among each other as follows. The phylogenetic species S. as-tragali was either sister group to P. eturmiuna or P. gigaspora plus ingroup, or the branching order of the three groups was unresolved. These rearrange-ments were combined with P. gigaspora and S. majusculum being mono-phyletic, or S. majusculum plus ingroup being sister to P. gigaspora. On a 70% bootstrap support level, the most parsimonious trees were compatible with the most likely tree in Figure 3-10. In Bayesian analyses, one consensus phylogram was obtained. Except for failing to resolve the poorly supported branching order of P. triglochinicola strain P123, Stemphylium sp. strain P210 and P. paludiscirpistrain P270, its topology was identical to the most likely tree in Figure 3-10. The posterior probabilities above 70% are shown in Table 3-12 and Table 3-13. One Neighbor joining tree was obtained. Neighbor joining bootstrap sup-port above 70%, and compatible with the most likely tree, are listed in Table 3-12 and Table 3-13. The Neighbor joining tree differed from the most likely tree in Figure 3-10 in that P. gigaspora and S. majusculum were monophyletic supported with 77% of the bootstrap replicates. Stemphylium trifolii was sister taxon to the phylogenetic species Pleospora sp. strain P107 plus ingroup with 82% bootstrap support (data not shown). Otherwise, on a 70% bootstrap support level, the Neighbor joining tree was compatible with the most likely tree in Figure 3-10 (data not shown). 3.3.1.9.2.2 MAT1-2 idiomorph DNA analyses As for MAT1-1, analyses were restricted to Pleospora. The region used corre-sponded to the MAT1-2 idiomorph present in fused MAT regions, and homolo-gous regions in separate MAT regions. Excluded taxa were P. tomatonis strain P268, P. sedicola strain P271 (both identical to P. alfalfae P81) and Stem-phylium sp. strain P303 (identical to S. vesicarium strain P238). Thus, the dataset used for analyses contained 20 taxa and 1632 characters. For phylogenetic analyses, both likelihood, parsimony, Bayesian analyses and Neighbor Joining were used. 83 Likelihood yielded one most likely tree (- In likelihood = 6301.35211). It is illustrated in Figure 3-11 with the three excluded taxa re-added. Bootstrap support percentages were based on 363 bootstrap replicates, and are listed in Table 3-12 and Table 3-13 for the ones above 70%. In parsimony analyses, two most parsimonious trees were obtained of 750 steps each (Cl = 0.854, Rl = 0.877). One tree was identical in topology to the most likely tree in Figure 3-11, the other differed in the position of the phylogenetic species P. eturmiuna which was sister group to S. astragali plus ingroup (data not shown). The bootstrap support values of more than 70% are listed in Table 3-12 and Table 3-13. In Bayesian analyses, the topology of the consensus phylogram from 9000 trees was identical in topology to the most likely tree in Figure 3-11 (data not shown). The posterior probabilities above 70% are listed in Table 3-12 and Table 3-13. One Neighbor joining tree was obtained. Bootstrap supports of more than 70% are listed in Table 3-12 and Table 3-13. The Neighbor joining tree differed from the most likely tree in Figure 3-11 by P. eturmiuna and S. as-tragali plus sister group being monophyletic supported by 82% of the boot-strap replicates, and other branches supported by less then 70% (data not shown). 3.4. Discussion These studies of mating system evolution showed that the three groups of homothallics in Pleospora evolved in three different ways. One homothallic lineage evolved by fusion of the MAT1-1 and MAT1-2 loci, a second homothal-lic clade originated by horizontal transfer of the fused MAT locus, and a third origin resulted in a clade of homothallics with only a single detectable forward-pointing MAT1-1 idiomorph. The evolution of homothallism by horizontal trans-fer as in Pleospora has never been reported before. All findings are discussed in detail below. 3.4.1 The mating type locus of Pleospora There were three different types of idiomorphs present at the MAT locus in Pleospora. They contained either a MAT1-1 or MAT1-2 gene, or both MAT1-1 and MAT1-2 genes (Figure 3-4). The organization of the MAT locus in Pleo-spora was thus similar to other fungi in the class Dothideomycetes, such as Cochliobolus. However, it differed from all of them in the length of the idio-morphs and MAT genes, as well as the architecture of the fused MAT regions. 3.4.1.1 Mating type genes The mating type genes in Pleospora were similar to other fungi in the class Do-thideomycetes (Table 3-14). There were no major differences within homolo-84 gous mating type genes from separate and fused MAT regions. All MAT1-1 genes were 1193 bp long, and had an intron of 53 bp inserted at position 218. This was similar to other members of the Dothideomycetes, where the MAT1-1 genes were between 995 - 1368 bp in length, with one intron of 45 -55 bp (Table 3-14). Mycosphaerella graminicola was the only species with an additional intron (see Table 3-14). All M4 77-2 genes in Pleospora were 1093 bp in length and had one in-tron of 55 bp inserted at position 491 (Table 3-14). This fell within the range of MAT1-2 genes of other fungi in the Dothideomycetes, where MAT1-2 genes ranged from 1083 - 1255 bp in length, with an intron of 48 - 55 bp. 3.4.1.2 Idiomorph delimitation Sexual reproduction in ascomycetes is controlled by the MAT locus, a master regulator of downstream gene expression (Turgeon et al., 1993b). MAT loci consist of MAT genes and flanking regions. Since MAT alleles are too divergent to be aligned, they are not alleles in the true sense and are thus called idio-morphs instead (Metzenberg & Glass, 1990). As in all other ascomycetes, the mating type genes in Pleospora were embedded in idiomorphs. The idiomorphs were well delimited upstream of the MAT genes, and poorly delimited downstream of the MAT genes (Figure 3-7). The 5'-limits of the idiomorphs were clearly recognizable by abrupt return to high levels of sequence identity, and lay within the ORF1 gene, 51 or 54 bp upstream of the ORF1 3'-end in MAT1-2 or MAT1-1, respectively. Idiomorphs in the class Dothideomycetes varied widely in their extent at the 5'-end (Figure 3-12). Idiomorphs reaching into the upstream gene were also present in P. nodorum and in L maculans. In P. nodorum, the idiomorph covered about half of ORF1, whereas in L. maculans, the idiomorph extended well beyond ORF1, 130 bp into GAP1. It is noteworthy that the amino acid se-quence of ORF1 was more similar than the DNA sequence between idiomorphs, with respectively 12% and 30% variable sites (data not shown). This might in-dicate an evolutionary constraint for function in ORF1. In other species of the Dothideomycetes, the idiomorph did not reach the upstream gene (Figure 3-12). This was the case for A. alternata and C. heterostrophus. Whereas the idiomorph of A. alternata stopped just 4 bp short of ORF1, the idiomorph in C. heterostrophus barely extended beyond the mat-ing types genes, with 47 and 37 bp upstream of MAT1-1 and MAT1-2, respec-tively. This might be due to the isogenic nature of these lab strains obtained by repeated inbreeding (Leach etal., 1982). The idiomorph was poorly delimited downstream of the MAT genes in Pleospora. Thus, the 3' idiomorph end was chosen conservatively close to the MAT genes, in order not to introduce error in phylogenetic idiomorph analyses. The 3'-end of the idiomorphs was thus selected upstream of the first stretch 85 of DNA sequence similarity between MAT1-1 and MAT1-2, 100 - 176 bp downstream of the MAT gene 3'-end, depending on the isolate (Figure 3-7). Downstream of the chosen 3' idiomorph end, the DNA sequence dissimilarity between MAT1-1 and MAT1-2 isolates of one phylogenetic species gradually disappeared. It might be possible to define an 'idiomorph transition zone' be-tween the idiomorph proper, and the intergenic spacer beyond the influence of recombination suppression. However, sequencing coverage of the entire spacer would be necessary. The idiomorph end downstream of the mating type genes was also poorly delimited in other taxa of the Dothideomycetes. In P. nodorum, the idiomorph was defined as the region containing less then ca. 90% similar se-quences between MAT1-1 and MAT1-2 (Bennett et al., 2003). Using the pro-gram SWAN (Proutski & Holmes, 1998) as Bennett et al. (2003) did for P. no-dorum, I found other poorly defined 3'-idiomorph boundaries in A. alternata and L. maculans (data not shown). 3.4.1.3 Conservation of gene order in the MAT locus The genes flanking the mating type region in Pleospora were homologous with the ones in equivalent position in Cochliobolus heterostrophus (Turgeon et al., 1993a) (Figure 3-12). A gene of unknown function, ORF1, and a GTPase acti-vating protein homolog, GAP1, were upstream, and a beta glucosidase ho-molog BGL1 was downstream. The three genes were not sequenced in all Pleo-spora isolates, but were only determined to be adjacent to the separate MAT1-1 region in Pleospora sp. strain P56. However, the presence of GAP1 upstream of ORF1 was confirmed in the fused MAT region of P. tarda strain P1, and BGL1 downstream of the separate MAT1-2 region in S. xanthosomatis strain P232 (Figure 3-3). The mating type region sequences of the remaining isolates were shorter, extending from 21 - 320 bp inside ORF1, to 322 - 2373 bp downstream of the 3'-end of the MAT genes. However, all DNA sequences were readily alignable beyond the idiomorphs, so that it is likely that all had flanking genes identical to Pleospora sp. strain P56 as shown in Figure 3-3. Like species of Pleospora, Alternaria alternata and Phaeosphaeria no-dorum had an ORF1 upstream of the MAT genes. However, the downstream genes in these two fungi are unknown (Arie et al., 2000; Bennett et al., 2003). Other members of the Dothideomycetes had different flanking genes (Figure 3-12). In Leptosphaeria maculans, downstream of the mating type genes was a DNA lyase, whereas the upstream gene was ORF1, as in Pleospora (Cozijnsen & Howlett, 2003). As opposed to L. maculans, in Mycosphaerella graminicola the upstream gene was a DNA lyase, so that in this fungus the MAT genes might have been inverted as compared to L. maculans (Waalwijk et al., 2002). The MAT downstream gene in M. graminicola is unknown. 86 3.4.2 Architecture of the fused MAT regions The fused MAT regions in Pleospora were unique, containing both MAT1-1 and MAT1-2 genes rearranged in the following way. In all cases, the sequence con-taining the MAT1-1 gene plus flanking regions was inverted, and fused to a MAT1-2 idiomorph, upstream of the MAT1-2 gene (Figure 3-4). The idiomorph in selfers was thus delimited by the 5' and 3' ends of MAT1-1 and MAT1-2 idiomorphs, respectively (Figure 3-7). The 5' MAT1-2 idiomorph end that was situated in a non-coding region was not present, since it was truncated by the fusion with the inverted MAT1-1 idiomorph. The 3' MAT1-1 idiomorph end was present, however, between ORF1 and MAT1-1, since the inverted MAT1-1 re-gion extended beyond the 3' idiomorph end. Thus, between ORF1 and the in-verted MAT 1-1 gene, the idiomorph in selfers was interrupted on a stretch of 108 - 114 bp, depending on the isolate (Figure 3-7). Fused MAT regions were also known in Cochliobolus. However, as op-posed to Pleospora, the MAT genes in Cochliobolus were arranged in different ways (Yun et al., 1999). For example, in both C. luttrellii and C. homomorphus, the MAT1-1 and MAT1-2 were fused, but in different order. In C. kusanoi, the arrangement was complex with MAT1-1 being fragmented, and in C. cym-bopogonis, both MAT regions were present in one genome, but not fused (Yun et al., 1999). 3.4.3 A hypothesis for the evolution of the fused MAT regions The fused MAT regions of Pleospora may have evolved by a gene inversion creating a short stretch of DNA sequence identity between MAT1-1 and MAT1-2, allowing a crossover to occur (Figure 3-6). In this hypothesis, the gene inversion took place in an ancestor and af-fected MAT1-1 and flanking regions. Since the entire MAT1-1 was inverted, the gene remained functional, and the ancestor retained the ability to out-cross. During sexual reproduction, at meiosis an unequal crossover to a for-ward oriented MAT1-2 region resulted in a fused MAT region passed on to progeny. The occurrence of a crossover is supported by a shared, 4 bp motive located between the fused MAT1-1 and MAT1-2 idiomorphs, and at homolo-gous position in some MAT1-1 and MAT1-2 genes from separate MAT regions (Figure 3-5). The motive is only 4 nucleotides in length. However, in S. cere-visiae, four nucleotides similarity is sufficient for a crossover to occur (Schiestl & Petes, 1991). Pleospora isolates with separate MAT1-1 regions carrying an inverted MAT1-1 gene would support this evolutionary hypothesis, but none are known. A crossover is also thought to be responsible for fused MAT ar-rangements found in species of Cochliobolus (Yun et al., 1999). 8 7 3.4.4 Phylogenetic information content of the MAT regions As suspected by Turgeon & Berbee (1998), the mating type region was more variable than other regions, such as ITS or GPD. In this study, the idiomorph portion downstream of the MAT1-1 gene contained about 17 times more par-simony informative characters on a percent basis than the ITS region, or al-most 1.8 times as many as the vmaA-vpsA intergenic spacer region (Table 2- 13, Table 3-11). However, the resolving power of this MAT1-1 idiomorph re-gion might not be superior to vmaA-vpsA, as the alignment comprised only 174 characters. Another drawback of using idiomorphs for phylogenetics is that separate analyses for each mating type are necessary. 3.4.5 Incongruence between MAT phylogeny and species phylogeny All mating type phylogenies disagreed with the species phylogeny, but were congruent among each other for relevant nodes. Whereas in the species phylogeny fused MAT regions were found in separate groups (Figure 3-1), in the MAT phylogenies they were monophyletic (Figure 3-8 - Figure 3-11). All other changes with regard to the species phylogeny were either minor, or con-cerned poorly supported branches in the species phylogeny (Table 3-12, Table 3- 13). Thus, the topologies of the mating type phylogenies were essentially congruent to a species phylogeny with all fused MAT genes constrained to be monophyletic within group E. Entirely congruent MAT and species phylogenies were found in Fusarium (O'Donnell et al., 2004). The rooted protein phylogenies both showed Pleospora to be mono-phyletic with high bootstrap support in all analyses. This agreed with results by Camara et al. based on ITS, GFDand EF-1 alpha datasets (2002). In the out-group, the genus Cochliobolus was monophyletic agreeing with Berbee et al. (1 999), and Alternaria alternata was sister taxon to Pleospora. However, it was not clear if Alternaria was closer related to Pleospora than Cochliobolus, due to the exclusion from analyses of other close relatives, such as Se-tosphaeria and Pyrenophora (Berbee etal., 1999). Thus, the closest relative of Pleospora was still uncertain. 3.4.6 MAT gene arrangements in phylogenetic species Mating type gene arrangements correlated with phylogenetic species. Each of the 22 phylogenetic species either had only one MAT gene at the mating type locus, or the fused MAT gene arrangement instead (Figure 3-1). 3.4.7 Mating system in Pleospora species with fused MAT regions In Cochliobolus, as Pleospora in the Pleosporaceae, species with both MAT re-gions combined into one genome are homothallic (Yun etal., 1999). In Pleospora, nine of the 11 phylogenetic species with fused MAT re-gions were homothallic (Table 3-15). The remaining two species, Pleospora sp. 88 strain P327 and P. triglochinicola did not form the sexual state in culture, but are known to form the sexual state in their natural habitats (Table 3-15). Fruiting can be difficult to induce under laboratory conditions. Substrate type, temperature, light exposure and humidity all can play a role (Schmiedeknecht, 1962). Fungal strains can also lose their ability to reproduce sexually after frequent subculturing. Thus under appropriate conditions, Pleo-spora sp. strain P327 and P. triglochinicola might form the sexual states in the laboratory, as would be expected based on their MAT locus shared with spe-cies that do fruit in culture. Homothallic ascomycetes are not restricted to selfing, but in some cases can also outcross, as has been shown in the filamentous ascomycete Gib-berella zeae (Bowden & Leslie, 1999). Just as in homothallic species of Pleo-spora, the MAT locus of G. zeae contains all MAT genes found in heterothallics (Yun et al., 2000). Is there evidence that homothallic species in Pleospora do outcross? The evidence for outcrossing is based on the single EF-1 alpha and vmaA-vpsA gene genealogies obtained in the last chapter (Figure 2-5). In clonal species, all genes are expected to give identical topologies, since all are effectively linked. In outcrossing species, the topologies from different genes vary within species due to recombination (Burt era/., 1996). The topologies within group C of the EF-1 alpha and vpsA-vmaA trees obtained in Figure 2-5 are incongruent. In EF-1 alpha, Stemphylium sp. strain P235 has the same al-lele as Stemphylium sp. strain P277, whereas in vmaA-vpsA, Stemphylium sp. strain P235 is most similar to P. alfalfae strain P81, sharing one apomorphy. However, this is not conclusive proof, since the synapomorphy might instead be a homoplasy. To assess the contribution of outcrossing to the population structure of the homothallic species of Pleospora, population genetic studies are necessary (Milgroom, 1996; Zhan etal., 2002). 3.4.8 Mating system in Pleospora species with separate MAT regions Species of Cochliobolus with separate MAT regions are all heterothallic (Yun et al., 1999). In Pleospora, unlike Cochliobolus, species with separate MAT re-gions are either heterothallic or homothallic. Homothallism in Pleospora is also possible in the presence of only one MAT gene, as in the filamentous ascomy-cete Neurospora africana (Glass etal., 1988). The Pleospora homothallics with separate MAT regions are the phyloge-netic species Pleospora sp. strains P56 and P107 (Table 3-15). In both of them, only MAT1-1 regions have been detected. Assuming a randomly recombining population, mating type genes are expected to occur in equal proportions (Milgroom, 1996). But all seven iso-lates derived from sexual spores of the phylogenetic species Pleospora sp. strain P56 and Pleospora sp. strain P107 included in phylogenetic analyses had MAT1-1 only. From eight additional single ascospore isolates from the phylo-89 genetic species Pleospora sp. strain P56, only MAT1-1 was found. Thus, a total of 15 isolates may contain only MAT1-1. Assuming that MAT1-1 and MAT1-2 genes segregated in equal proportions in the sexual fruitbodies, randomly se-lecting 15 ascospores with MAT1-1 in a row would be expected to occur once in 32,768 attempts, a rare event (P < 0.0001). Alternatively, it would be pos-sible that MAT1-2 was present in the genome, but could not be detected by PCR. We know that MAT1-2 was not close to the MAT1-1 gene in Pleospora sp. strain P56. DNA sequence analysis of more than 2kpb upstream and 4.5 kpb downstream of the MAT1-1 gene showed that MAT1-2 was absent. Alter-natively, MAT1-2 could be located elsewhere in the genome, as in the ho-mothallics C. cymbopogonis (Yun etal., 1999) and Aspergillus nidulans (Dyer et al., 2003). The mating systems in the phylogenetic species Pleospora sp. strains P56 and P107 might be similar to the one in N. africana, as they all seem to lack MAT1-2. In N. africana only MAT A, the equivalent to MAT1-1 in Pleo-spora, has been found (Glass etal., 1988). Further studies are needed to in-vestigate potential similarities between the mating systems of Pleospora sp. strains P56 and P107, and N. africana. For the remaining Pleospora species with separate MAT regions, no sex-ual states have been reported, nor obtained in this study. However, there is evidence that they might reproduce sexually, and be heterothallics. All five phylogenetic species comprising more than one strain had both MAT1-1 and MAT1-2 isolates, which is expected in outcrossing species (Milgroom, 1996). Additional evidence for outcrossing was found in the phylogenetic species S. solani, where three of the four possible allele combinations between GPD and EF1-alpha were found, resulting in incongruent phylogenies (Figure 2-5). More research is needed to find the sexual states and confirm heterothallism in spe-cies where MAT1-1 and MAT1-2 idiomorphs are present in different isolates. 3.4.9 Mating system evolution in Pleospora The Pleospora species phylogeny shows four groups of homothallics (Figure 3-1), suggesting four possible independent origins of homothallics from het-erothallics. However, the MAT idiomorph phylogenies only show one or two groups of homothallics (Figure 3-10, Figure 3-11). So how many times did homothallism evolve in Pleospora? In the closely related Cochliobolus, as in Pleospora, homothallics are polyphyletic (Yun et al., 1999). Homothallism in Cochliobolus evolved inde-pendently multiple times from heterothallic ancestors through rearrangements at the master regulator locus of sexual development, the MAT locus. Combina-tion of both MAT1-1 and MAT 1-2 idiomorphs into one genome repeatedly led to homothallism in Cochliobolus (Yun etal., 1999). In homothallics of Pleo-spora, there are two different types of MAT loci suggesting two independent 90 origins of homothallism from heterothallism (Figure 3-4). How can this be rec-onciled with the four groups of homothallics in the Pleospora species phylogeny (Figure 3-1) and the one or two groups of homothallics in the MAT idiomorph phylogenies (Figure 3-10, Figure 3-11)? 3.4.9.1 Single origin of homothallics with a separate MATl-l region Species and MAT phylogenies agree on the origin of the homothallics with a single, forward-oriented MAT1-1 gene in group SP. Group SP is well-supported in the Pleospora species phylogeny (Figure 3-1), as well as in the MAT1-1 idiomorph phylogeny (Figure 3-10). This is consistent with a single origin of the homothallics in group SP from heterothallic ancestors. 3.4.9.2 Horizontal transfer of the fused MAT region The species phylogeny recognizes three groups of homothallics with fused MAT regions (Figure 3-1), whereas the MAT phylogenies only recognize one group of homothallics with fused MAT regions (Figure 3-10, Figure 3-11). What are the reasons for this topological conflict, and what are its implications on the evolution of homothallism in Pleospora? The Pleospora species phylogeny shows homothallics with the fused MAT regions in groups B, C and TP (Figure 3-1). There is no support for inde-pendent origin of groups B and C. However, the closest relatives of group TP are isolates with separate MAT regions, and not groups B and C, so that the fused MAT regions appear to have evolved twice. However, Avise (1994) lists seven explanations for the origin of discon-tinuous distributions of character states, such as the fused MAT regions in Pleospora. Not discussed in detail are the three possibilities of mistaken spe-cies phylogeny, extreme rate heterogeneity of loci used for phylogenetic analyses, and the use of paralogous loci for phylogenetic inference (Avise, 1994). There was no evidence in the data for extreme differences in substitu-tion rates between isolates, nor were there any paralogous gene copies de-tected. This was supported by separate analysis of the four datasets used for Pleospora species phylogenies, which resulted in congruent trees (Figure 2-5). Also, phylogenetic species were defined based on phylogenetic analyses, and not a priori assumptions. Following Avise (1994), this leaves four possibilities to account for the discontinuous distribution of the fused MAT regions in Pleospora which are convergent evolution, retention of ancestral polymorphisms and horizontal transfer by asexual or sexual means. 3.4.9.2.1 Convergent evolution Convergent evolution is the independent, multiple origin of a character state. With regard to Pleospora, this implies that the fused MAT regions originated at 91 least twice: In an ancestor of groups B and C, and in an ancestor of the TP group (Figure 3-1). However, this scenario is not compatible with the MAT gene phylogenies. Both MAT1-1 and MAT1-2 analyses show that a switch be-tween fused and separate MAT regions occurred only once (Figure 3-10, Figure 3-11). This is supported by the hypothesis proposed for the evolution of the fused MAT region (Figure 3-6). The inversion of the MAT1-1 gene, and fusion to a MAT1-2 region by means of a crossover is unlikely to occur more than once at exactly the same sites (Figure 3-5). As to the direction of evolu-tion, the fused MAT regions most likely is derived from ancestors with sepa-rate MAT regions, because the opposite, the break up and distribution of fused MAT regions into separate individuals, together with the reconstitution of a forward orientated MAT region, lacks any credible mechanisms. It would also contradict the phylogenetic protein analyses, where the fused MAT genes are derived from separate MAT regions (Figure 3-8, Figure 3-9). Thus, convergent evolution does not seem likely, and alternative possibilities requiring only one switch from separate to fused MAT regions have to be considered. 3.4.9.2.2 Retention of an ancestral character state Retention of an ancestral state implies a single origin of a character state that subsequently is retained in different lineages, resulting in a polyphyletic distri-bution pattern. For Pleospora this implies that the fused MAT regions evolved only once, and were driven to fixation in the lineages B, C and TP (Figure 3-1). Consequentially, in the lineages leading to these groups, both separate and fused MAT regions would have coexisted in recombining populations. Ho-mothallics with fused MAT regions can recombine (Bowden & Leslie, 1999), but it is unknown if that included frequent outcrossing to isolates with sepa-rate MAT regions. In any case, the data do not suggest retention of the fused MAT re-gions. Had it occurred, then the fused MAT regions would have evolved before the divergence of the lineages leading to groups B, C and E, thus at the base of the species phylogeny (Figure 3-1). In the phylogenetic MAT protein analy-ses, this early evolution would have resulted in a placement of the root half way between the separate and fused MAT regions. However, this is not the case. The root in the MAT protein trees was placed at a branch within the separate MAT regions (Figure 3-8, Figure 3-9). Furthermore, the maximal ge-netic distances within the fused and separate MAT region clades would be similar in case of a single evolution and retention of the fused MAT regions. However, the maximal genetic distance in the separate MAT region clade, for example between S. callistephi strain P383 and S. trifolii strain P244, was much larger than the maximal distance in the separate MAT region clade, for example between P. paludiscirpi strain P270 and P. herbarum strain P2 (Figure 3-10, Figure 3-11). Together with the evidence from the root placement in 92 the MAT trees, this indicates that the fused MAT regions were more likely de-rived from separate MAT regions after the divergence of the lineages B, C and TP in Figure 3-1. 3.4.9.2.3 Sexual or asexual horizontal transfer The third and forth options considered to account for the discontinuous distri-bution of the fused MAT regions are horizontal transfer by sexual or asexual means. Hybridization, sexual recombination between lineages, resulting in transfer of genes, is known to occur in fungi occasionally, for example in Fusarium (O'Donnell et al., 2000). However, if hybridization occurred in Pleo-spora, the hybrid progeny would be expected to receive half the genetic in-formation from either parent. In phylogenetic analyses done separately for all genes, the hybrids would be expected to group with either parent approxi-mately the same number of times. However, all genes sampled for the Pleo-spora species phylogeny were congruent for groups B, C and TP (Figure 2-5). This might be due to the small number of genes sampled, or a linkage between the genes. Alternatively, the particular chromosome combination of the hy-brids might have been favorable to hybrid survival (Greig et al., 2002). Equal parental chromosome contribution would also be expected for 'parasexual hybridization'. Parasexuality is the random elimination of supernu-merary chromosomes following nuclear fusion, leading to a return to the hap-loid state (Caten, 1981). However, parasexuality is not known to occur natu-rally. Asexual transfer between lineages of a fragment of DNA containing the fused MAT regions is the last option. A fragment of at least 11 kb has been transferred between a bacterial endosymbiont and an insect host (Kondo et al., 2002). The fused MAT region in Pleospora measured less than 10 kb and was thus not unreasonably long to be transferred asexually. 3.4.9.3 Three different origins of homothallics in Pleospora To conclude, topological conflict between species and MAT phylogenies, as well as MAT region arrangements lead to the conclusion that homothallism in Pleospora evolved independently three times from heterothallic ancestors. Through unknown genetic alterations in ancestors of the group where only a forward-oriented MAT1-1 was detected, through rearrangements at the MAT locus resulting in the fused MAT regions, and by horizontal transfer across lineages of the fused MAT region by sexual or asexual means. 93 Table 3-1. A l l MATl-l region forward primers used. P r imer names are given, together wi th the position of the 5'-end on the sequence of Pleospora sp. s train P56 (AY339851). Name 5'-end sequence 5'-> 3' G A P f -49 G T C A C C C G T C T T C A C A C G G G A P F 2 625 G T G G G G C G T T C A T T G C G G ORF556f 1691 G T G G T C A A G G T C C G T G A C G G ORF589f 1724 T G G A A G G G C C A G G T G C G A G M A T l r 2231 A A T G C A C T G A C G C T C T C G C C B P H 0 4 d 2648 T G C B T T Y G T Y G G A T T Y C G S T G T A A G Jen lF 2665 G C T G T A A G T C T A A T T C T T A C T G C Alpha l81f 2749 G C A A T G G C C C A T G A A G A A G C Alpha l91f 2767 G C T C T C C A A C C T C A T T G G G C P2F3 3362 C R T T R C T C G A C C A C T G C T C C P2F2 3399 C C A A T C C G T T C T A C G A C G G Jen 1 Fa 3593 G C C A A C G A A G A T G T T A C T C T T C C M P 5 6 f 4333 C T G C A G T T G G A A G G A T T T G G M245f 4968 C C A C T T C T C C A T T G A C A G C C MP56F2 5161 C G G T G T T G G T T T C T T G G C G M245F1 5170 T G A C T T G G C G G A T G T C T T G C MP56F3 5811 C T C C A T G G A G C G G T A C C A C M245F2 ca. 5966 T T G C A T C A G A C C T A C A C G C C M a t l 6296 C G C G A C A C C C G A A C A C G G C M a t l a f 6358 T T G A T T C C G C T G C G T C G C T G M a t l F l 6398 G A C A C T A G C G G C G G T A T G G C 56f 7149 A G A T C A T A G G T C C A C T G A G C 56F2 7875 T T G C C T T G A C T A G C G C A T C C 9 4 Table 3-2. A l l MAT1-1 region reverse primers used. P r i m e r names are given, together wi th the position of the 5'-end on the sequence oi Pleospora sp. strain P56 (AY339851). Name 5'-end sequence 5'-> 3' Br +44 C C G T C T T G C A A A C A G A G C T G B G L r 7943 A C C C C G C A A C A C C A A G C C B G L R 2 7481 T G G T G T A G A T T G C G A T G G C G B G L R 3 6855 G A T C S T T C T G C T T G C A G A C C MP56r 5795 C A C T G A C T C A T T T G G T A C T G C P245R2900 5376 T C A G T A T T C C A C C A C C A G A G S3r 5364 T T A T C C C T T G C A G A A G A T A G G M P 5 6 R 2 5180 T C G C C A A G A A A C C A A C A C C G S2R10 4816 T C G G T C A T R T G C G A C R C R A G C T G Sr 4805 C G A C A T G A A C T G C A T C C A G C C S 2 R N 4802 C A C R A G C T G C A T C C A G T C Sr2 ca. 4794 G C G T C C A G T C C A G C T C G C T C M245R1 4431 G C C A A G T C A C G A C C A T C C MP56R3 4415 A A G C G C A G G T T A A G A G C A G G L r 4205 T A G C G T A G A T A G T A G T A G T C C M247R1 3850 C G A G C C G A T C A A G T C G T G G MP56r l71 3806 C C A C G T C G A A C A T C G A G A G G P2R 3615 G G A A G A G T A A C A T M T T C G T T G P2R2 3614 G G A G A G T A A C A T A T T C A T T G G M245R2 3590 C G A G A C G G A A A G C C T C A T G G MP56R4 ca. 3222 T G T A C T A C C G A G G C A G A A C C Jenlr 2871 T C C T T G C C G A T T T G A T C A C G J e n l R i 2865 C C G A T T T G A T C A C G A A T A G T C G M i r 2250 G G C G A G A G C G T C A G T G C A T T C M a t l f 2246 A G A G C G T C A G T G C A T T C A C C cORF589f 1742 C T C G C A C C T G G C C C T T C C A cORF556f 1710 C C G T C A C G G A C C T T G A C C A C cORF413f 1567 G G A A G T C G A G T A C A T R T C T T C T C C A O R F r 796 G C A G G T G A T G C T T T G G G C G 95 Table 3-3. A l l MAT1-2 region forward primers used. P r i m e r names are given, together with the position of the 5'-end on the sequence of S. solani strain P232 (AY340940). Name 5'-end sequence 5'-> 3' ORF556f 214 G T G G T C A A G G T C C G T G A C G G P232F1015 647 C T G G T A C A T G A G C A C A Y C T C G P232F1681 1318 C T S T T C G T T G C A C A T A C A C C Jen2F 1766 T G T T G G A T C A T C T T C C G A G H M G 8 5 f 1782 G A G A T G T G A T G C A C A A G C A G C H M G 9 7 f 1795 C A A G C A G C T C A A R G C T G A G C 2nf 2229 T C A A C G A G C T T T C A T G A G G 2F 2352 A C A T T C G C C T T G T T C A A T G A C G P232F2844 2481 A A C G Y T C C C G A A G C A T G T T C P232f 3133 T C G C C A C C G A T G C C A C C P232F2 3881 G A T T G A A A T G C T C A A T T C A C G G Mat2f 4580 G T A C C T C A T T G G C G T T G T G C M a t 2 F l 4593 G T T G T G C T T A C C A T G C C A C G 232f 5301 T G C C C C G A T G A C G C C A C G 232F2 6032 C A C A A C C G A G C C C G G T A G C 232F3 6803 C G C C C G T T C T G A G G G T T C G G 96 Table 3-4. A l l MAT1-2 region reverse primers used. P r imer names are given, together wi th the position of the 5'-end on the sequence of S. solani strain P232 (AY340940). Name 5'-end sequence 5'-> 3' Br +62 C C G T C T T G C A A A C A G A G C T G B G L r 6758 A C C C C G C A A C A C C A A G C C B G L R 2 6272 T G G T G T A G A T T G C G A T G G C G B G L R 3 5643 G A T C S T T C T G C T T G C A G A C C P232R4600 4074 T A T C A A T G C G C C G T C T C C G C S3r 3429 T T A T C C C T T G C A G A A G A T A G G P232R1 3356 G A T A A G G C G C C C C G T C G C M 2 R 2950 T T G C A G A T G G A C C T T G C A G T G P232R2b 2563 G C G A A Y G A G T G A C G T T C G T G 2nr 2485 A C G T T C G T G A A T A C G A G G 2r 2373 C G T C A T T G A A C A A G G C G A A T G T Jen2R 1990 C G A A G G T G C T C T T C T T T T G C H M G 9 7 r 1832 G G A C T G T G A G A T T G G G G A G C P232R1662 1337 G G T G T A T G T G C A A C G A A S A G S M r 1266 G A A G A G A G A A G T G A G A T G A T T C 383r 1266 T A A G A G A G A A G T G A G A C G A T T G P232R995 667 C G A G R T G T G C T C A T G T A C C A G 97 Table 3-5. A l l MATl-l; MAT1-2 region forward primers used. P r imer names are given, together wi th the position of the 5'-end on the sequence of P. tarda s train P l (AY335164). Name 5'-end sequence 5'-> 3' GAPf -362 GTC ACC CGT CTT CAC ACG G GAPF2 243 GTG GGG CGT TCA TTG CGG GAPF3 978 TTC ACC AGC CCG TCC AGC ORF413f 1161 TGG AGA AGA YAT GTA CTC GAC TTC C ORF556f 1309 GTG GTC A A G GTC CGT GAC GG CH013 1333 ATT GCA GAT TGG A A A GGC CAA GT 1 MAT1825f 1435 GGA TTC GAC CGG TGC AAT GG Plf 2112 GTC AAT CAG GTT CGA CAT GC Jenlr 2812 TCC TTG CCG ATT TGA TCA CG JenlRi 2818 CCG ATT TGA TCA CGA ATA GTC G Matlf 3441 AGA GCG TCA GTG CAT TCA CC MatlAf 3853 TCA AGA CAA CAT CCC ACA GC Jen2f 4124 TGT TGG ATC ATC TTC CGA G HMG85f 4140 GAG ATG TGA TGC ACA AGC AGC HMG97f 4153 CAA GCA GCT CAA RGC TGA GC 2f 4710 ACA TTC GCC TTG TTC AAT GAC G P1F2914 4908 CAT TAC TTA TTT GCG CAC GCC PlEndf 5546 AAC GTC GCT GTT TGC TCC 'From Berbee et al. (2003) 98 Table 3-6. A l l MATl-l; MAT1-2 region reverse primers used. P r i m e r names are given, together with the position of the 5'-end on the sequence of P. tarda strain P l (AY335164). Name 5*-end sequence 5'-> 3' S3r 5780 T T A T C C C T T G C A G A A G A T A G G Mat4707r 5438 T A C A G A G C G T T T G A C C T C G G M 2 r 5308 T T G C A G A T G G A C C T T G C A G T G P1R2 4786 A A G A A C G C T G G C A G A G T T G C 2r 4731 C G T C A T T G A A C A A G G C G A A T G T Jen2r 4348 C G A A G G T G C T C T T C T T T T G C M a t l A r 3869 G T G G G A T G T T G T C T T G A A G G M a t l r 3456 A A T G C A C T G A C G C T C T C G C C Jen lF 3018 G C T G T A A G T C T A A T T C T T A C T G C Alpha l81f 2934 G C A A T G G C C C A T G A A G A A G C Alpha l91f 2916 G C T C T C C A A C C T C A T T G G G C Mat2642r 2265 A C T C A C T A A C C T C T T A T C C G G P l r 2130 C A T G T C G A A C C T G A T T G A C C Jen 1 Fa 2090 G C C A A C G A A G A T G T T A C T C T T C C cORF589f 1360 C T C G C A C C T G G C C C T T C C A cORF556f 1328 C C G T C A C G G A C C T T G A C C A C cORF413f 1185 G G A A G T C G A G T A C A T R T C T T C T C C A O R F r 414 G C A G G T G A T G C T T T G G G C G 99 Table 3-7. MAT1-1 region primers and P C R conditions used. P r imer pairs used i n in i t ia l P C R for respective strains are given i n column ' P C R 1% with reamplification primers un-der ' P C R 2 \ P C R conditions employed are i n columns ' C o n d . 1' and ' C o n d . 2 ' , referring to P C R 1 and P C R 2 , respectively. F o r standard P C R , conditions are annealing tempera-ture/number of cycles. Chromosome walk ing P C R conditions are marked by ' V , followed by ' 1 ' and restriction enzyme for p r imary P C R , and ' 2 ' followed by approximate size of the resulting P C R product for secondary P C R . Respective forward and reverse sequenc-ing primers are given i n the last two columns. F o r complete P C R and sequencing condi-tions see text. 1 0 0 Strain P C R 1 f o n d . J P C R 2 Cond. 2 Sequ. Forward Sequ..Re1?ers/ P56 cORF589f, Vec VI EcoRI cORF556f, VecN V2/5K GAPf, GAPF2 cORF413f, ORFr P56 Jenlr, Vec V I BamHI JenlRi, VecN V2/1.8K VecS, MATlr JenlRi, MAT If P*h P*f, \lphal81f, \lP56rl71 48/40 Alphal91f, MP56rl71 V2 Alphal 9 If, MP56R4 Mphal81f, Vec VI EcoRI JenlFa, VecN V2/2.8K JenlFa, MP56f, MP56F2, MP56F3 VecN, MP56r, MP56R2, MP56R3 ps<> PUP Matl, Vec VI Clal Matlaf, VecN V2/3.4K MatlFl , 56f, 56F2 Br, BGLr, BGLR2, BGLR3 ORF556f, Jenlr 52/30 - - ORF589f, MATlr JenlRi, M i r P107 Alphal81f, S2RN 60/40 Alphal91f, S2RN 60/40 Alphal91f, P2F2 S2RN, Lr, P2R P22«) JenlR, Vec VI BamHI JenlRi, VecN V2/1.4K VecN, MATlr JenlRi, MAT i f P229 ^^^^^^^ Alphal 8 If, S2R10 60/30 Alphal91f, P2F2 S2R10, MP56rl71, P2R P229 Alphal81f, Vec V I BamHI JenlFa, VecN V2/1.4K JenlFa VecN P2 *»J ORF556f, Jenlr 52/30 - - ORF556f, MATlr JenlRi, M i r P239 P240 Alphal 8 If, S2R10 60/30 - - Alphal91f, P2F3 S2R10, P2R ORF556f, Jenlr 52/30 - - ORF556f, MATlr JenlR, M i r rP24() P244r Alphal 8 If, S2R10 60/30 - - Alphal91f, P2F3 Sr2, P2R ORF556f, Jenlr 52/30 - - ORF589f, MATlr JenlRi, M i r P244 Alphal81f, S2R10 55/30 - - Alphal 8 If, P2F3 S2R10, P2R ^^^^^^^^ ORF556f, Jenlr 52/40 - - ORF556f, MATlr JenlRi, MAT i f P245 Alphal81f, Vec VI EcoRI Alphal91f, VecN V2/3.3K Alphal91f, JenlFa, M245f, M245F1, M245F2 VecN, P245R2900, M245R1, M245R2 P246 ORF556f, Jenlr 52/40 - - ORF556f, MATlr JenlRi, M i r P24d Alphal8If, S3r 55/40 - - Alphal91f, P2F3 Sr, P2R2 1 0 1 ORF556f, Jenlr 52/30 - - ORF556f, MATl r JenlRi, M l r P24" Alphal8If, Vec VI EcoRI Alphal91f, VecN V2/1.8K Alphal 9 If, Jen 1 Fa VecN, M247R1 P25^ ORF556f, Jenlr 52/40 - - ORF589f, JenlRi, MAT If MATlr P253 Alphal 8 If, S2R10 60/30 - - Alphal91f, P2F3 S2R10, P2R [M|d ORF556f, Jenlr 52/40 - - ORF556f, MATlr JenlRi, M l r P316 Alphal 8 If, S2R10 60/30 - - Alphal91f, P2F2 S2R10, P2R P342 ORF556f, Jenlr 52/30 - - ORF589f, MATlr JenlRi, M l r P312 Alphal 8 If, S2RN 60/40 Alphal91f, S2RN 60/40 Alphal91f, P2F2 S2RN, Lr, P2R P383 ORF556f, Jenlr 52/40 ORF556f, 52/40 ORF589f, JenlRi, MAT If JenlRi MATlr P W Alphal 8 If, S2R10 55/30 Alphal 8 If, S2R10 55/30 Alphal 9 If, P2F3 S2R10, P2R P W ORF556f, Jenlr 52/30 - - ORF589f, MATlr JenlRi, M l r P*M Alphal 8 If, S2R10 55/40 Alphal 8 If, S2R10 55/30 Alphal91f, P2F3 S2R10, P2R 102 Table 3-8. MAT1-2 region primers and P C R conditions used. P r imer pairs used i n in i t ia l P C R for respective strains are given i n column ' P C R 1', wi th reamplification primers un-der ' P C R 2'. P C R conditions employed are i n columns ' C o n d . 1' and ' C o n d . 2', referring to PCR1 and PCR2, respectively. F o r standard P C R , conditions are annealing tempera-ture/number of cycles. Chromosome walk ing P C R conditions are marked by ' V , followed by '1' and restriction enzyme for p r imary P C R , and '2' followed by approximate size of the resulting P C R product for secondary P C R . Respective forward and reverse sequenc-ing primers are given i n the last two columns. F o r complete P C R and sequencing condi-tions see text. Strain P C R 1 Gond. 1 P C R 2 Cond. 2 mm/am » . R^orse Jen2R, Vec V I BamHI H M G 9 7 r , V e c N V 2 / 2 K V e c N , P232F1015, H M G 9 7 r , P232R1662, P232F1681 P232R995 P2 *2 H M G 8 5 f , Vec V I BamHI H M G 9 7 f , V e c N V2/2 .6K H M G 9 7 f , P232F2844, P232f, P232F2 V e c N , P232R4600, P232R1, P232R2b Mat2f, Vec V I C l a l M a t 2 F l , V e c N V2/4 .8K M a t 2 F l , 232F, 232F2, 232F3 Br , B G L r , B G L R 2 , B G L R 3 P250 Jen2R, Vec V I H M G 9 7 R , V2 /1 .8K V e c N , H M G 9 7 r , BamHI V e c N P232F1015, P232F1681 P232R1662, P232R995 P250 H M G 8 5 f , Vec V I BamHI HMG97f , V e c N V2/2 .9K HMG97f , P232F2844, P232f, P232F2 VecS, P232R4600, P232R1, P232R2b P252 Jen2R, Vec V I BamHI H M G 9 7 r , V e c N V 2 / 2 K VecS, P232F1015, H M G 9 7 r , P232R1662, P232F1681 P232R995 P252~ i Jen2F, Jen2R 52/40 - - Jen2F Jen2R P252 HMG85f , Vec V I C l a l H M G 9 7 f , V e c N V2/2 .4K H M G 9 7 f , V e c S , P 2 3 2 R l , P232F2844, P232R2b ^^^^^^^^ P232F, P232F2 P : S : Jen2R, Vec V I C l a l H M G 9 7 r , V e c N V 2 / 6 K - H M G 9 7 r PKHi <)RF556f, Jen2R 52/40 ORF556f, P232F1015, P232F1681 Jen2R, S M r P W o Jen2F, S3r 55/30 - - Jen2F, 2F M 2 R , 2r P310 N B ORF556f, 52/40 - - ORF556f, Jen2R, S M r Jen2R P232F1015 P310 Jen2F, S3r 52/40 - - Jen2F, 2F M 2 R , 2r P W ORF556f, 52/40 - - ORF556f, Jen2R, 383r WB*W$88m& Jen2R P232F1015 £ 3 8 5 Jen2f, S3r 52/40 - - Jen2F, 2nf M 2 R , 2nr 103 Table 3-9. Fused MATl-l; MAT1-2 region primers and P C R conditions used. P r i m e r pairs used i n in i t ia l P C R for respective strains are given i n column ' P C R 1% wi th reampli-fication primers under ' P C R 2\ P C R conditions employed are i n columns ' C o n d . 1' and ' C o n d . 2', referring to PCR1 and PCR2, respectively. F o r standard P C R , conditions are annealing temperature/number of cycles. Chromosome walking P C R conditions are marked by ' V , followed by '1' and restriction enzyme for p r imary P C R , and '2' followed by approximate size of the resulting P C R product for secondary P C R . Respective for-wa rd and reverse sequencing primers are given i n the last two columns. F o r complete P C R and sequencing conditions see text. 1 0 4 Strain P( K 1 Cond. I P C R 2 ( o n d . 2 Sequ^forwatd! jSeqli. Reverse PI • n. V I EcoRI cORF556f, VecN V2/2 .2K GAPf, GAPF2, GAPF3 cORF413f, ORFr Ijjjlj MphalMI \ m V I BamHI Jen 1 Fa, VecN V2 /1K VecN Jen 1 Fa iiSp C H O I * Mat2642r Isll IS IH 55/40 - - MAT1825f -PI OR14IM \ l ph aIMI • 55/40 ORF413f, A l -phal91f 55/40 Plf -PI OKI W»| 55/40 - - - JenlF SEE Jmli kn2r i i 55/40 - - JenlRi Jen2r PI kn l i k*n2r 55/40 JenlRi, Jen2r 55/40 Matlf, MatlAf Mat 1 Ar, Matlr H \ l ( , ^ l W V I BamHI HMG97f, VecN V 2 / 2 K HMG97f, P1F2914, PlEndf VecS, Mat4707r, P1R2 P2 MphalSl l \ ec i V I BamHI Jen 1 Fa, VecN V2/1K VecS Jen 1 Fa P2~~ o K u m \ i ph.il9lt I 55/40 - - ORF556f, P l f Alphal91f, Mat2642r P2 Tv_iiIT kn2r s Wm 55/40 JenlRi, Jen2r 55/40 JenlRi, Matlf, MatlAf Jen2r, MatlAr, Matlr P2 kn2l S^i m 52/40 - - Jen2f, 2f M2r, 2r P81 " OKI 4Ml \ l plu IMI Wm r. 50/40 ORF413f, A l -phal91f 55/40 ORF556f, P l f Alphal91f, Plr I M knit kn2i 55/40 JenlRi, Jen2r 55/40 JenlRi, Matlf, MatlAf Jen2r, MatlAr, Matlr P8l kn2t S^i 52/40 - - Jen2f, 2f M2r, 2r PI21 OKI MM \ l p h a l M l • HI 50/40 ORF413f, A l -phal91f 55/40 ORF556f, P l f Alphal91f, Plr P 1 2 T " knh kn2t 11 55/40 - - JenlRi, Matlf, MatlAf Jen2r, MatlAr, Matlr PVZY kn2] S M w 52/40 - - Jen2f, 2f M2r, 2r P129~ OKI 4 HI \I phalMl 1 50/40 ORF413f, A l -phal91f 55/40 ORF556f, P l f Alphal91f, Plr P l 2 9 ~ knl i kn2t 111 • 55/40 - - JenlRi, Matlf, MatlAf Jen2r, MatlAr, Matlr P129 kn2t Sli 11 52/40 - - Jen2f, 2f M2r, 2r P202 OKI m i \ l philMI 1 50/40 ORF413f, A l -phal91f 55/40 ORF556f, P l f Alphal91f, Plr P202 Ion It, k'ii2i 55/40 - - JenlRi, Matlf, MatlAf Jen2r, MatlAr, Matlr 1*202 k'n2l M i 52/40 - - Jen2f, 2f M2r, 2r P20" O R I 4 M I \1 plulSII 1 50/40 ORF413f, A l -pha^ If 55/40 ORF556f, P l f Alphal91f, Plr P207 knlr ku2i 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, 105 ;1 MatlAf Matlr P207 Iui2l S*i 52/40 - - Jen2f, 2f M2r, 2r P2I0 \ l - 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr phal81f i 1 phal91f P2I0 Jen 11 Icn H 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, MatlAf Matlr P2~T() " lon^l ~S*i • 52/40 - - Jen2f, 2f M2r, 2r P238 " OKI 41 3| 1 i 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr pha!81f_ i phal91f P238~~ Ji.nli Ten in § 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, lilllill 1 MatlAf Matlr P2*h Jen21. S3t i 52/40 - - Jen2f, 2f M2r, 2r P21* (iR14~l M P 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr phalSII 8 phal91f P24* Icn 11 Icn Hi II 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, MatlAf Matlr P24< Icn2t S V Si 52/40 - Jen2f, 2f M2r, 2r P2fi"1 ORH4I *l M & 1 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr jphais 11 phal91f P2'»2 Ion 11 Jul 2r~ fi 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, MatlAf Matlr P262 _ r lcn:l S*i s 52/40 - - Jen2f, 2f M2r, 2r P26S OR! 4 Ml Al i 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr phalSM ! phal91f P2hs kl l l l III) g 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, r MatlAf Matlr P26S kn2l s<i i 52/40 - - Jen2f, 2f M2r, 2r P2fi«) (IRI4I M \ i I 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr ntaaJJJlf/ i phal91f P2M Lul l li.n H | 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, 1 MatlAf Matlr P2o9 Ien2l S*i 1 52/40 - - Jen2f, 2f M2r, 2r P27H OKI 41 M \ i §§ 50/40 ORF413f, A l - 55/40 ORF556f, P l f Jenlf, Plr phalMl p phal91f P2"T() k n 11 Ion 2r"~ A 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, H MatlAf Matlr P270 Itii2l S*r 1 52/40 - - Jen2f, 2f M2r, 2r P27I ORr-41 11 \ l t 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr pli.il Ml s phal91f p r i kill I k*ll Hi B 55/40 - - JenlRi, Matlf, Jen2r, MatlAr, MatlAf Matlr P271 It-nil SV i 52/40 - - Jen2f, 2f M2r, 2r OR141 M \ l - 50/40 ORF413f, A l - 55/40 ORF556f, P l f Alphal91f, Plr pha IMI i phal91f P303~ kll l l k'll 55/40 - - JenlRi, Matlf Jen2r, MatlAr, Matlr PKH kn2l S V 1 52/40 - - Jen2f, 2f M2r, 2r 1 0 6 P327 ORF413LAI- 1 phal81J 1 50/40 ORF413f, A l -phal91f 55/40 ORF556f, P l f Alphal91f, Plr JenJi, len2r | 55/40 - - JenlRi, Matlf, MatlAf Jen2r, MatlAr, Matlr P327 fJen2i-S3i 52/40 - - Jen2f, 2f M2r, 2r 107 Table 3-10. M A T loci i n phylogenetic species oi Pleospora. F o r phylogenetic species with only one type of M A T locus and more than one isolate, numbers of isolates are given i n -stead of P strain numbers. F o r groups, see Figure 3-1. F o r details on phylogenetic species, see Table 2-14. Phylogenetic species G r o u p MATl-l MAT1-2 MATl-l; MAT1-2 P. eturmiuna C - - 9 P. gigaspora C - - 2 P. gracilariae C - - 3 P. herbarum C - - 47 P. paludiscirpi E / T P - - P270 Pleospora sp. strain P56 E /SP 4 - -Pleospora sp. strain P107 E / S P 3 - -Pleospora sp. strain P327 E / T P - - 2 P. tarda B - - 4 P. triglochinicola E / T P - - P123 S. astragali C - - 4 S .callistephi D P383 - -S. lancipes F P229 - -S. loti E P384 P385 -S. majusculum C - - 2 S. sarciniforme strain P239 E P239 P309, P310 -5. sarciniforme strain P247 E P247 P306 -S. solani D P240,P241, P253, P407, P408, P409 P252 Stemphylium sp. strain P210 E / T P - - P210 Stemphylium sp. strain P246 E P246 - -S. trifolii E P244 -S. xanthosomatis A P245, P248, P316, P406 P232, P242, P249, P250, P251 108 Table 3 - 1 1 . Compar ison of parsimony informative characters. The M A T genes, was well as up and downstream regions are compared. The compared regions correspond to the inverted MATl-l id iomorph port ion, and the MAT1-2 id iomorph present i n the fused M A T regions. Region Upstream M A T gene Downstream MATl-l 24.3% 23.6% 45.4% MAT1-2 24.2% 18.9% 36.6% 109 Table 3-12. B r a n c h supports of mating type phylogenies compatible wi th species phylogeny. Numbers of branches taken from species phylogeny i n Figure 3-1. F o r protein phylogenies, support values are for parsimony and l ikel ihood. F o r idiomorphs, support values are l ikel ihood, parsimony, Bayesian and Neighbor jo in ing i n this order. Values i n bold were supported by 100% i n al l analyses. Supported groups were D (branch 17) and A (branch 33). Groups B and F were distinct, but only had one member. Groups C and E were not supported. Other supported branches were inside group C (branches 3-11), group D (branch 16) and group E (branches 21-30). B r a n c h MATl-l proteins (Figure 3-8) MAT1-2 proteins (Figure 3-9) MATl-l idiomorphs (Figure 3-10) MAT1-2 idiomorphs (Figure 3-11) Supported clades 3 99/95 100/72 100 100 P. herbarum 5 - - 89/93/100/- - Branch 3 plus 5. gracilariae 9 84/76 - 99/97/100/94 95/93/100/82 Branch 5 plus S. majus-culum and S. gigaspora 10 - - - 97/96/100/94 Branch 9 plus S. as-tragali 11 - 97/- 100 100 P. eturmiuna 16 100/100 - 100 - S. solani 17 96/100 - 100 - Group D 21 100/87 - 100 - Pleospora spp. strains P56 and P342 22 98/78 - 100 - Branch 21 plus Pleo-spora sp. strain P107 25 - 100/81 100 100 S. sarciniforme strain P239 and P247 27 - -/96 -/-/-/82 100 Branch 25 plus S. loti 29 73/- - 100 - Branch 27 plus Stem-phylium sp. strain P246 30 - - -/-/78/- - Branches 22 plus 29 33 - 100/77 100 100 Group A 1 1 0 Table 3-13. B r a n c h supports of mating type phylogenies contradicting species phylogeny. F o r protein phylogenies (Figure 3-8 and Figure 3-9), support values are for parsimony and l ikel ihood. F o r id iomorph phylogenies (Figure 3-10 and Figure 3-11), support values are l ikel ihood, parsimony, Bayesian and Neighbor jo in ing i n this order. Values i n bold were supported by 100% i n al l analyses. The genus Pleospora was monophyletic i n the protein phylogenies where outgroups were included (branch 16). The M A T phylogenies differed from the species phylogeny mainly i n the monophyly of the fused M A T regions (branch N12). M i n o r , frequently poorly supported topological differences were wi th in group C (branches N l - N8) , or were i n relation to the monophyly of the fused M A T re-gions (branches N 9 - N13). The branching order of groups A , D and F with separate M A T regions was resolved as opposed to the species phylogeny (branches N14 - N15). Branches MATl-l M A 77-2 MATl-l MAT1-2 Supported clades proteins Figure 3-8 proteins Figure 3-9 idiomorphs Figure 3-10 idiomorphs Figure 3-11 N l -/87 - - - S. astragali, P. eturmiuna, group B N 2 -115 -I-I9QI- P. herbarum, P. gracilariae, S. majuscu-lum N3 -I-I9M- within P. herbarum N 4 88/85/100/95 within P. herbarum N5 - - - 100 within P. herbarum N 6 - - - 86/85/100/91 within P. herbarum N7 - - - -/-/87/- within P. herbarum N8 - - - -I-I1M- within P. herbarum N 9 - - 100 100 Groups B and C N10 - - - 89/78/99/78 Stemphylium sp. P210 plus branch N9 N i l - - - -11X1901- P. triglochinicola plus branch N10 N12 100/99 98/95 100 100 fused M A T regions N13 88/81 -/96 100 100 Groups E , C, B N14 99/98 -/85 100 100 Groups A , D , F N15 - - 100 - Groups D , F N16 100/92 100/98 - - Pleospora 1 1 1 Table 3-14 . Compar ison of M A T genes and idiomorphs i n Pleospora to other members of the Dothideomycetes. Gene, exon, in t ron and id iomorph lengths are given. F o r diagrams of the extents of the idiomorphs see Figure 3 -12 . Species Gene Length Exon Intron 1 Intron II Idio- Acc. No. bp bp Length 5'-end Length 5'-end morph bp Alternaria al- MAT1-1 1 2 1 7 1 1 7 0 4 7 2 4 8 - - 2 2 8 5 A B 0 0 9 4 5 1 ternata Cochliobolus MAT1-1 1 2 0 5 1 1 5 2 5 2 2 1 8 - - 1 2 9 7 A F 0 2 9 9 1 3 heterostro-phus Leptosphaeria MAT1-1 1 3 6 8 1 3 2 3 4 5 2 5 4 - - 3 7 2 3 A Y 1 7 4 0 4 8 maculans My- MAT1-1 9 9 5 891 5 5 3 2 0 4 9 4 1 4 2 8 5 1 A F 4 4 0 3 9 9 cosphaerella graminicola Phaeosphaeria MAT1-1 1 0 9 0 1 0 3 5 5 5 221 - - 4 3 0 6 A Y 2 1 2 0 1 8 nodorum Pleospora spp. MAT1-1 1 1 9 3 1 1 4 0 5 3 2 1 8 - - 2057 -2 1 0 6 .1 Alternaria al- MAT t-2 1 0 8 3 1 0 2 9 5 4 4 8 2 - - 2 5 9 9 A B 0 0 9 4 5 2 ternata Cochliobolus MAT t-2 1 0 8 7 1 0 3 2 5 5 4 8 5 - - 1 172 A F 0 2 7 6 8 7 heterostro-phus Leptosphaeria MAT t-2 1 2 5 5 1 2 0 0 5 5 4 6 7 - - 4 2 2 7 A Y 1 7 4 0 4 9 maculans My- MAT t-2 1 2 3 3 1 1 8 5 4 8 6 3 5 - - 2 7 8 3 A F 4 4 0 3 9 8 cosphaerella graminicola Phaeosphaeria MAT 1-2 1091 1 0 3 8 5 3 491 - - 4 5 3 0 A Y 2 1 2 0 1 9 nodorum Pleospora spp. MAT 1-2 1 0 9 3 1 0 3 8 5 5 491 - - 2 3 7 6 .2 1 Isolates for which entire idiomorphs were sequences are Pleospora sp. strain P56 (AY339851), 5. lancipes strain, P229 (AY339853), Stemphylium sp. strain P246 (AY339858), S. sarciniforme strain P247 (AY339859) and Stemphylium sp. strain P316 (AY339861). 2 Isolates for which entire idiomorphs were sequenced are S. xanthosomatis strain P232 (AY340940), Stemphylium sp. strain P250 (AY340941) and Stemphylium sp. strain P252 (AY340942). 1 1 2 Table 3-15. M A T locus and teleomorph formation i n phylogenetic species of Pleospora. Phylogenetic species, groups (see Figure 3-1), M A T locus arrangements, presence of the teleomorphs, and the capabilities to form teleomorphs i n culture are given. A H cultures were derived from single spores, so that teleomorph formation i n culture is proof of ho-mothall ism. F o r phylogenetic species where teleomorph formation is reported for the first time, teleomorph-forming strains are listed. 113 Phylogenetic species G r o u p M A T locus Teleomorph Teleomorph formation i n culture P. eturmiuna C fused +1 + P. gigaspora C fused +2 + P. gracilariae c fused +3 + P. herbarum c fused +4 + P. paludiscirpi E / T P fused +1 + Pleospora sp. strain P56 E / S P MATl-l + Pleospora sp. strain P107 E / S P MATl-l + +6 Pleospora sp. strain P327 E / T P fused +7 -P. tarda B fused +4 + P. triglochinicola E / T P fused +8 -S. astragali C fused + +9 S. callistephi D MATl-l - -S. lancipes F MATl-l - -S. loti E MATl-l or MAT1-2 - -S. majusculum C fused + 1 0 + S. sarciniforme strain P239 E MATl-l or MAT1-2 - -5. sarciniforme strain P247 E MATl-l or MA77-2 - -S. solani D MATl-l or MAT1-2 - -Stemphylium sp. strain P210 E / T P fused + Stemphylium sp. strain P246 E MATl-l - -S. trifolii E MATl-l - -S. xanthosomatis A MATl-l or MAT1-2 - -'Simmons (2001). 2 Crive l l i (1983) . 3 Simmons (1989). 4 Simmons (1985). 5 Teleomorph forming isolates were Stemphylium sp. strain P227 and Pleospora sp. strains P342 and P343. 6 Teleomorph forming isolates were Stemphylium sp. strains P212 and P221. 7 Teleomorph only obtained in natural habitat. 8 Webster (1969). 9 Teleomorph forming isolate was Stemphylium sp. strain P203. 1 0 Simmons (1969). 1 1 Teleomorph forming isolate was Stemphylium sp. strain P210. 1 1 4 10 15 13 P235 P236 P301 P323 P325 P277 P273 P272 Pleospora herbarum P2 Pleospora alfalfae P81 P237 Pleospora tomatonis P268 Pleospora sedicola P271 Stemphylium vesicarium P238 P314 P318 P303 Pleospora gracilariae P243 1 P315 |£j Pleospora gigaspora P122 ~ Pleospora gigaspora P129 ^ Stemphylium majusculum P262 ^ P311 Stemphylium astragali P201 P207 Pleospora eturmiuna P269 P302 • Pleospora tarda P1 'P216 Group C | | Group B | Fused MAT regions (groups C & B) Group = homothallics 17 Stemphylium lancipes PiSS: 1 | Group F Stemphylium solani P240:1 P252:2 I _ n P253:1 I G r o u P D Stemphylium callistephi P3S3:1 18 rf 32 — Pleospora triglochinicola P123 - Pleospora paludiscirpi P270 P327 22 P210 21 30 31 34 33 I l j P 2 4 5 : 1 L ! fP316:1 U IP250: 2 j L Stemphylium xanthosomatis P232:2 £\r- P56: 1 I r \ i— P342:1 I 1 P107:1 I Group S P I 25 27 29 26 2 3 i S. sarcinifo. P239:1 1 P310: 2 i S . sarcinif. P247:1 24 ' P306: 2 S . loti P384:1 1 S . totfP385:2 T7i i P246:1 S. Mfoff; P244:1 Fused \MAT regions | (group TP) Group A 10 changes Figure 3-1. Pleospora species phylogeny and distr ibution of M A T regions and mating sys-tems. Tree based on four loci (see Figure 2-6). Numbers by the branches reflect bootstrap supports above 70%. Values are given i n Table 2-12. B o l d branches had maximal support i n a l l analyses. T h i n vertical lines on the right indicate groups according to C a m a r a et a l . (2002) and this paper. Sol id vertical lines indicate distr ibution of fused M A T regions. The remaining groups a l l have either MATl-l or MAT1-2 indicated behind the taxon name as *1' or ' 2 ' . F o r mating types of a l l isolates screened see Table 3-10. Boxed groups are ho-mothall ic. T a x a i n bold were chosen for sequencing of the M A T region. F o r details on isolate numbers, see Table 2-1. 1 1 5 ORF589U*. M A T 1 r _ k ^ " " M 1 r ORF556L*. Alpha191f-Alphal 81 f-*-- J e n l r i P2F3, ^_P2r* - t .S2R10* P232H015-ORF556L*. _SMr* Jen2f_ 2ft*. .Jen2r .2r* ^d_M2r* ^*_S3r* MAT1-2 ORF556f_*. ORF413f_*w P1f_*w .P1r Jenlr i . Jen1r_ MAT1-1 . . . T 1 , MAT1 r M A U L * . MATIAf-*. 2f*_^^- 2 r* ^*_Alpha191f - * - M A U A r ^ t _ » . ^-_Alpha181f Jen2f -k . ^_Jen2r -*_M2r* ^t_S3r* 500 bp Figure 3-2. Main primers used for PCR amplification and DNA sequencing for MATl-l, MAT 1-2 and fused M A T regions. Gene diagrams approximately to scale. Tips of arrows indicate approximate 3'-end of primers. Black boxes are coding sequences, gray boxes are introns and white boxes are intergenic spacers. Half arrow heads indicate the direction of transcription. Primers with asterisk had to be replaced by alternative primers in some isolates, due to high DNA sequence variability at the primer site. For a complete list of primers and primer sequences, including primers used for chromosome walking, see Table 3-1 - Table 3-6. 1 1 6 G T f l | C R F , I \MAT1-1 BGL1 °RF1{[ BGL1 GAP1 I fe*w fcw 0RF1 MAT1-1 1 0 0 0 bp Figure 3-3. Longest MAT regions sequenced. These were from top to bottom Pleospora sp. strain P56, S. xanthosomatis strain P232 and P. tarda strain Pl , respectively 8455 bp, 7248 bp and 6102 bp in length. Gene diagrams are to scale. Black boxes are coding regions, gray boxes are introns and white boxes are intergenic spacers. Half arrow heads indicate direction of transcription. Shark teeth delimit incompletely sequenced genes. 117 Figure 3-4. Schematic representation of the M A T loci. In the fused M A T region, the MATl-l gene plus flanking region is inverted, and fused to a MAT1-2 region. White boxes are genes, half arrow heads indicate direction of transcription. Narrow boxes are inter-genic spacers which are pattern coded with shades of gray for the MATl-l spacers, and lines for the MAT1-2 spacers to illustrate the organization of the fused M A T region. ' O l ' is flanking gene ORF1. 118 Figure 3-5. DNA sequences ofMATl-1; MAT1-2 fusion areas. The ORF1 ('Ol') proximal fusion region is at the top, the ORF1 distal region at the bottom. Vertical lines on the left mark MAT regions and phylogenetic groups. DNA sequences of fused and separate MAT regions are aligned. Dots indicate identical nucleotides to top rows. In the top diagram, a column of blanks separates forward and reverse MAT regions. Shaded nucleotides repre-sent the putative crossover site, in forward orientation in the presumptive MAT1-1 ances-tors in the top diagram, in the bottom diagram in reverse orientation in four presumptive MAT1-2 ancestors, as well as in all fused MAT regions. 119 T P I S P | F I "I A | P2 P81 P129 P202 P238 P262 P268 P271 P303 P243 P207 P269 PI P210 P270 P123 P327 P56 P107 P342 P239 P247 P244 P384 P246 P229 P383 P24 0 P253 P245 P316 GC&GGATCACCAATACTACAGCAATTTCTCTTCCCTCTCACC ATGAACTTGGTAAAGCGAGGGGCGGTGCAAGAGCAAGGGG .A. .A. . T . . . T . . T . . . T . . T . . . T . .C . .G. G. .G. G. T--A G. A G. A G. AT. . .G. . . . .AT. . .G. . .C.T T . C . . . . . .T T. . . . . T C . T G . . . . T . . . . T . . . C T G T . C T G T . C T G . . . .T . . .TG. . . .T . . . T G . . . .T . .A T A. . . .G.A.A.GTTACC G. . GT . . AAAGT. GCGAT. AA. TCTCCACT. TTTC. . TAA G. . .C . . .AAGT. GCGAT. AA. TCTCCACT. TTTC. .TAA G. . GT . . AAAGT. GCGAT. AA. TCTCCACT. TTTC . . TAA G. .GTT. . AA. C. GCGATAAA. TTTCCACT. TTTC . .TAA G. .GTT. .AA.C. GCGATAAA. TTTCCACT. TTTC. .TAA . . . GT . . . AAGTGGCGAT. AA. TCTCCACT. TTTC . . TAA G. .GTT. .AC.CTCGAT.AA.TTCCCACT.TC.C. .TAA G. .G.T. . A A . C GCGAT. ATTTTTCCACT. TTTC. .TAA . . AGTT. GAAGCGGCGAT. AA. TCTCCACT. TTTCC. AAA . .AGTTCGAAGCGGCGAT.AA.TCTCCACTATTTC. .AAA 3TTCGAAGCGGCGAT.AA.TCTCCACC.TTTC..AA §TTCGAAGCGGCGAT.AA.TCTCCACCTTTC . .AA R^SLTT. GAAGC. GCGAT. AA. TACCCACTACTTC. . AAA 3TT. GAAGC. GCGAT. AA. TACCCACTACTTC. . AAA MAT1-2 1 MAT1-2 T P | E D A P2 P81 P129 P202 P207 P238 P243 P262 P268 P269 P271 P303 PI P123 P210 P270 P327 P306 P310 P3 85 P252 P250 P232 TACTGAAACAGTGGAGAATTCATCGCCACCTAAAACEA'ICATTAGGATCACACTTCACCCGCTTCCTCACAGTCGCTCT G . . G . . . . . G f§»*P . . a A. . . G w» I AG _ . _ ..a... C tw i C. . . . .T. . . . G . . . .TA. . T. . T. . . . .C. . . G . . . .G. .A T.G . .C. . . G . . . T. . . .C. . . G . . . CTGGCTTCA.T. TTACC CAGCGTTAGTGAC TTBTp? T. . . . . - T . . A . .C. . . G . . . CTGGCTTCA.C. TTACC CAGCGTTAGTGAC TTOTS T. . . A . .C. . . G . . . CTGGTTTCACC. CTACC CAGCGTTAGTGAC I R T. . . . . . . A. . . .A. . . -C. . . G . . . C.GGTTCCA.CG TT.CC CAGCGTTGGTGGCTTC h.. .G. T. . . .c.. . . .C. . . G . . . C.GGTTCTA.C TC.CC CAGCGTTAGTGAC TCHSf *TC G G T T. . . c . .C. .AG. . . C.GGTTCTA.C. TC.CC CAGCGTTAGTGAC TC*^- foe..G. . 0 T T. . . c . .C. .AG. . . 120 Ea-ccATHE^^ MAT1-2 •uvw SCAT-EBBSJ MAT1-2 Figure 3-6. Evolution of fused M A T regions. In an ancestor, a portion of the idiomorph containing the entire MAT1-1 gene is inverted. The ' A T G G ' motive at the 5'-end of the inverted fragment is now present as inverse complement ' C C A T ' at the O R F 1 distal fu-sion site. Assuming that the inverted MAT 1-1 gene is functional, during mating a cross-over to a separate MAT1-2 gene at the shared ' C C A T ' motive would yield the fused M A T locus. 121 MAT1-1 I P ' t a r d a MAT1~1'' MAT1-2: ORF 1 -RIADWKGQVRDW A V T S D I E V P T I N G T Q A S * I s . solani MATl-l: O R F 1 - I * MAT1-2%S' s o l a n i MATl-2: O R F 1 - R. SERM. D A L T . . . PS* MS. xanthosomatis MATl-2: O R F 1 - R. SERMQDTTT. . ISS* O f ) R _ F » > R F \ © | — 500bp MAT1-1 I P . t a r d a MATl-l CGACGGGGTAGGGGTAATA TTTTTGCGCCTCTTACCTGACTT S . solani MATl-l . T . C G . C . . C A . . C C . A C . MAT1-2 I S. solani MAT1-2 T C T A . T T . . C . . C T . T T C C . . . . C A . A G . C . . . C G A . A . . G C P. tarda MATl-2 T C T A T T A . . T A . C T . T T A C . . . C T A T A G . C . . . T A A . . . A A C Figure 3-7. M A T idiomorphs. Gene diagrams approximately to scale. The dark portions are the idiomorphs comprising the M A T genes. The white portions are the idiomorph flanking regions, such as ORF 1 and intergenic spacers. Sequences of MAT idiomorph boundaries are aligned, dots indicate nucleotide identity to top rows. Alignments are at (1) the 5'-end within ORF1, and at (2) the 3'-end downstream of the MAT genes. Hori-zontal arrows above alignments indicate the extension of the idiomorphs. At the 5'-end, the ORF1 amino acid translations are given, and DNA sequences at the 3'-end. The idio-morph was distinctly delimited at the 5'-end, regardless of separate or fused M A T re-gions, such as P. tarda strain P l . The downstream idiomorph border at (2) was chosen conservatively upstream of the first shared nucleotide motive between MATl-l and MATl-2 regions. (3) Shows the idiomorphs in fused M A T regions. The idiomorph was not continuous, as the inverted portion of MATl-l extended beyond the MATl-l downstream idiomorph boundary. 122 Figure 3-8. MAT1-1 protein phylogeny (Fi tch-Margol iash distance tree). The tree is rooted wi th species of Cochliobolus and Alternaria. Ver t i ca l lines on the right ma rk phylo-genetic groups and M A T regions. Boxed groups contain homothallics, and large black ar-rows indicate evolution of homothall ism. F o r the ingroup, branches supported by more than 70% i n either parsimony or l ikel ihood (quartet puzzling) are numbered and listed i n Table 3-12 and Table 3-13. Numbers preceded by ' N ' indicate nodes that are not con-tained i n the species phylogeny i n Figure 3-1. F o r important nodes supporting the mono-phyly of Pleospora or contradicting the species phylogeny, branch supports are given. 123 ro 1 I I 3 35' o c T3 -n Tl ro |Group S P J |Group T P JGroup C | Group E Separate MA T regions Fused MAT regions Group = homothall ics V = evolution of homothall ism N12 N13 N16 100/98 0/96 Pleospora tarda P1 | JGroup B | l~ Pleospora gigasporaPi29 Stemphylium majusculum P262 Pleospora herbarum P2 Pleospora alfalfae P81 Stemphylium vesicarium P238 Pleospora tomatonis P268 Pleospora sedicola P271 Stemphylium sp. P303 Pleospora gracilariae P243 S. astragali P201 11 - Stemphylium sp. P207 Pleospora eturmiuna P269 - Pleospora triglochinicola P123 I— Pleospora paludiscirpi P270 Pleospora sp. P327 25 27 Stemphylium sp. P210 r- Stemphylium sarciniforme P306 Stemphylium sarciniforme P310 — S. tof/P385 33 N14 0/85 Stemphylium xanthosomatis P232 Stemphylium sp. P250 — Stemphylium sp. P252 | Group D < Q. g CD • Alternaria alternata 100/100 100 /99 C. cymbopogonis Cochliobolus ellisii 100/100 Cochliobolus heterostrophus Cochliobolus sativus • 10 changes Figure 3-9. MATl-2 protein phylogeny (Fi tch-Margol iash distance tree). The tree is rooted wi th species of Cochliobolus and Alternaria. Ver t i ca l lines on the right m a r k phylo-genetic groups and M A T regions. Boxed groups are homothallics. Large black ar row marks evolution of homothall ism. F o r the ingroup, branches supported by more than 70% i n either parsimony or l ikel ihood (quartet puzzling) are numbered and listed i n Table 3-12 and Table 3-13. Numbers preceded by ' N ' indicate nodes that are not con-tained i n the species phylogeny i n Figure 3-1. F o r important nodes supporting the mono-phyly of Pleospora or contradicting the species phylogeny, branch supports are given. 125 I Group I = homothallics N13 = evolution of homothallism N12 22 .30 27 29 N14 0.01 substitutions/site N9 N11L N2 P. tarda PI J[Group¥j Stemphylium sp. P207 P. etutmiuna P269 - S. astragali P201 P. herbarum P2 S. vesicarium P238 P. sedicola P271 Stemphylium sp. P303 P. alfalfae PM P. tomatonis P268 P. gracilariae P243 N3 21 S. majusculum P262 P. gigaspora P129 - P. triglochinicola P123 P. paludiscirpi P270 • Stemphylium sp. P210 — Pleospora sp. P327 Pleospora sp. P56 25 Pleospora sp. P342 Pleospora sp. P107 S. sarciniforme P239 & sarciniforme P247 - S. fofr'P384 S. sp. P246 S. trifolii P2AA UJ Q. s CD N15 17 S. lancipes P229 J Group F 16 i S. solani P240 S. sp. P253 33 S. callistephi P383 Stemphylium sp. P245 1 < 3 2 o Stemphylium sp. P316 Q. 3 g CD Figure 3-10. MATl-l id iomorph most l ikely tree. The unrooted tree is presented as rooted according to the MATl-l protein phylogeny i n Figure 3-8. Ver t i ca l lines on the right ma rk phylogenetic groups and M A T regions. Boxed groups are homothallic. Large black ar-rows indicate the evolution of homothall ism. Branches supported by more than 70% i n either l ikel ihood, parsimony, Bayesian or Neighbor jo in ing analyses are numbered and listed i n Table 3-12 and Table 3-13. Numbers preceded by ' N ' indicate nodes that are not contained i n the species phylogeny i n Figure 3-1. Branches with 100% support i n a l l analyses are i n bold . 126 I Group | = homothallics evolution of homothallism N9 N10 N11 N12 N13 10 P. tarda P11 |Group B | r P. herbarum 92 N6 N7 N8 11 P . alfalfae P81 P . tomatonis P268 P . sedicola P271 S. vesicarium P238 N5 Stemphylium sp. P303 — P . gigaspora P129 — P . gracilariae P243 — S. majusculum P262 — S. astragali P201 r Stemphylium sp. P207 L P . eturmiuna P269 Stemphylium sp. P210 P . triglochinicola P123 25 P . paludiscirpi P270 — Pleospora sp. P327 — Stemphylium sp. P306 27 1— Stemphylium sp. P310 — S. toff P385 N14 33 • 0.01 substitutions/site LU Q. o C3 (0 c o "5> <u i _ < (5 i _ 3 O (0 <5 Q . a> (/) Stemphylium sp. P252 | Group D i— S. xanthosomatis P232 Stemphylium sp. P250 Figure 3-11. MATl-2 id iomorph most l ikely tree. The unrooted tree is presented as rooted according to the MATl-2 protein phylogeny i n Figure 3-9. Ver t i ca l lines on the right ma rk phylogenetic groups and M A T regions. Boxed groups are homothallic. Large black ar row indicates evolution of homothall ism. Branches supported by more than 70% i n either l ikel ihood, parsimony, Bayesian or Neighbor jo in ing analyses are numbered and listed i n Table 3-12 and Table 3-13. Numbers preceded by ' N ' indicate nodes that are not con-tained i n the species phylogeny i n Figure 3-1. Branches with 100% support i n a l l analyses are i n bold . 127 Figure 3-12. The M A T loci and the extent of the idiomorphs in fungi of the Dothideomy-cetes. Gene diagrams of known D N A sequence regions that include the M A T genes, ap-proximately to scale (for GenBank accession numbers see Table 3-14). White boxes are M A T genes, with positions of introns indicated by vertical lines, gray boxes are f lanking genes, hal f arrow heads are directions of transcr ipt ion and black boxes intergenic spacers. Hatched lines above the gene diagrams indicate the extent of the idiomorphs. The sepa-rate M A T locus in Pleospora i l lustrated here was most s imi lar to Cochliobolus heterostro-phus. The extent of the id iomorphs var ied widely between the species of the Dothideomy-cetes. 1 2 8 Pleospora spp. Altemaria alternata MAT1-1 Phaeosphaeria nodorum \\MAT1-1) MA\)TI-2 Leptosphaeria maculans \\MAT1-1**^I Mycosphaerella graminicola j M4r | |T -2^ 1 2 9 3.5. Bibliography A r i e , T. , Kaneko , I., Yosh ida , T. , Noguchi , M . , N o m u r a , Y . & Yamaguch i , I. (2000). Mat-ing-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Molecular Plant-Microbe Interactions 13, 1330-1339. Avise , J . C . (1994). Molecular markers, natural history & evolution. New York: Chapman & Hal l . Bennett, R . S., Y u n , S. H . , Lee , T. Y . , Turgeon, B . G . , Arseniuk , E . , Cunfer , B . M . & Berg-strom, G . C . (2003). Identity and conservation of mating type genes in geographically diverse isolates of Phaeosphaeria nodorum. Fungal Genetics and Biology 40, 25-37. Berbee, M . L . , Pirseyedi, M . & H u b b a r d , S. (1999). Cochliobolus phylogenetics and the ori-gin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91, 964-977. Berbee, M . L . , Payne, B . P . , Zhang , G . , Roberts, R . G . & Turgeon, B . G . (2003). Shared ITS D N A substitutions in isolates of opposite mating type reveal a recombining history for three presumed asexual species in the filamentous ascomycete genus Alternaria. Mycological Research 107, 169-182. Bowden, R . L . & Lesl ie , J . F . (1999). Sexual recombination in Gibberella zeae. Phytopathol-ogy W, 182-188. Bur t , A . , Car ter , D . A . , Koen ig , G . L . , Whi te , T . J . & Taylor , J . W . (1996). Molecular markers reveal cryptic sex in the human pathogen Coccidioides immitis. Proceedings of the National Academy of Sciences of the United States of America 93, 770-773. Camara , M . P . S., O ' N e i l l , N . R . & B e r k u m , v., P (2002). Phylogeny of Stemphylium spp. based on ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycolo-gia 94, 660-672. Caten, C . E . (1981). Parasexual processes in fungi. In The fungal nucleus, pp. 191-214. Edited by K . Gu l l & S. G . Oliver. Cambridge: Cambridge University Press. Cozijnsen, A . J . & Howlett , B . J . (2003). Characterisation of the mating-type locus of the plant pathogenic ascomycete Leptosphaeria maculans. Current Genetics 43, 351-357. C r i v e l l i , P . G . (1983). Uber die heterogene Ascomycetengattung Pleospora Rabenh.; Vorschlag fur eine Aufteilung. Ph.D. thesis. Eidgenossische Technische Hochschule, Zurich, Switzerland. de Jesus Yanez Mora les , M . (2001). Molecular and morphological analyses of Alternaria and Stemphylium from onion. Ph.D. thesis. Cornell University. Dyer , P . S., Paoletti , M . & Arche r , D . B . (2003). Genomics reveals sexual secrets of Asper-gillus. Microbiology 149, 2301-2303. Felsenstein, J . (2001). P H Y L I P : phylogeny inference package. Seattle: Distributed by the author, Department of Genetics, University of Washington. Glass, N . L . , Vo l lmer , S. J . , Staben, C , Grotelueschen, J . , Metzenberg, R . L . & Yanofsky, C . (1988). D N A s of the two mating-type alleles of Neurospora crassa are highly dis-similar. Science 241, 570-573. Gre ig , D . , Lou i s , E . J . , Borts , R . H . & Travisano, M . (2002). Hybrid speciation in experi-mental populations of yeast. Science 298, 1773-1774. Hawkswor th , D . L . , K i r k , P . M . , Sutton, B . C . & Pegler, D . N . (1995). Dictionary of the Fungi, 8 edn. Wallingford, Oxon, U K : C A B International. K o n d o , N . , N i k o h , N . , I j ichi , N . , Shimada, M . & Fukatsu , T . (2002). Genome fragment of Wolbachia endosymbiont transferred to X chromosome of host insect. Proceedings of the National Academy of Sciences of the United States of America 99, 14280-14285. 130 Leach , J . , L a n g , B . R. & Yoder , O . C . (1982). Methods for selection of mutants and in vitro culture of Cochliobolus heterostrophus. Journal of General Microbiology 128, 1719-1729. Lee, J . , Lee, T. , Lee, Y . - W . , Y u n , S. H . & Turgeon, B . G . (2003). Shifting fungal reproduc-tive mode by manipulation of mating type genes: obligatory heterothallism of Gib-berella zeae. Molecular Microbiology 50, 145-152. Maddison , D . R. & Maddison , W . P . (2001). MacClade 4: Analysis of Phylogeny and Char-acter Evolution. Version 4.03. Sunderland, Massachusetts, USA: Sinauer Associates. Metzenberg, R. L. & Glass, N . L. (1990). Mating type and mating strategies in Neurospora. BioEssays 12, 53-59. M i l g r o o m , M . G . (1996). Recombination and the multilocus structure of fungal populations. Annual Review of Phytopathology 34, 457-477. O 'Donnel l , K . , Kis t le r , H . C , Tacke, B . K . & Casper, H . H . (2000). Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proceedings of the National Academy of Sciences of the United States of America 97, 7905-7910. O'Donnel l , K . , W a r d , T . J . , Geiser, D . M . , Kis t l e r , H . C . & A o k i , T . (2004). Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genetics and Biology 41, 600-623. Proutsk i , V . & Holmes, E . C . (1998). SWAN: sliding window analysis of nucleotide sequence variability. Bioinformatics 14, 467-468. Schiestl, R. H . & Petes, T . D . (1991). Integration of DNA fragments by illegitimate recombi-nation in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 88, 7585-7589. Schmiedeknecht, M . (1962). Pseudothecien-Entwicklung bei Pleospora papaveracea (de Not.) Sacc. Zeitschriftfur Pilzkunde 27 (1961), 62-67. Simmons, E . G . (1969). Perfect states of Stemphylium. Mycologia 61,1-26. Simmons, E . G . (1985). Perfect states of Stemphylium. II. Sydowia, Annales Mycologici Ser. II. 38, 284-293. Simmons, E . G . (1989). Perfect states of Stemphylium. III. Memoirs of the New York Botanical Garden 49, 305-307. Simmons, E . G . (2001). Perfect states of Stemphylium: IV. Harvard Papers in Botany 6,199-208. Str immer, K . & von Haeseler, A . (1996). Quartet puzzling: A quartet maximum likelihood method for reconstructing tree topologies. Molecular Biology and Evolution 13,964-969. Swofford, D . L. (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Meth-ods). Version 4. Sunderland, Massachusetts: Sinauer Associates. Thompson, J . D . , Gibson, T . J . , Plewniak, F . , Jeanmougin, F . & Higgins, D . G . (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. In Nucleic Acids Research, pp. 4876-4882: Distributed by the authors. Turgeon, B . , Bohlmann , H . , Ciuffetti , L., Christ iansen, S., Y a n g , G . , Schaffer, W . & Y o -der, O . (1993a). Cloning and analysis of the mating type genes from Cochliobolus het-erostrophus. Mol Gen Genet 238, 270 - 284. Turgeon, B . G . & Berbee, M . L . (1998). Evolution of pathogenic and reproductive strategies in Cochliobolus and related genera. In Molecular Genetics of host-specific toxins in 131 plant disease. Edited by K . a. Y . Kohmoto, O C . The Netherlands: Kluwer Academic Publishers. Turgeon, B . G . , Christ iansen, S. K . & Yoder , O . C . (1993b). Mating type genes in ascomy-cetes and their imperfect relatives. In The fungal holomorph: mitotic, meiotic and pleo-morphic speciation in fungal systematics, pp. 199-215. Edited by D . R. Reynolds & J. W . Taylor. Wallingford: C A B International. Turgeon, G . & Yoder , O . C . (2000). Proposed nomenclature for mating type genes of fila-mentous ascomycetes. Fungal Genetics and Biology 31, 1-5. Waa lwi jk , C , Mendes, O. , Verstappen, E . C . P . , de W a a r d , M . A . & K e m a , G . H . J . (2002). Isolation and characterization of the mating-type idiomorphs from the wheat septoria leaf blotch fungus Mycosphaerella graminicola. Fungal Genetics and Biology 35, 277-286. Webster, J . (1969). The Pleospora state of Stemphylium triglochinicola. Transactions of the British Mycological Society 53, 478-482. Y u n , S. H . , Berbee, M . L . , Yoder , O . C . & Turgeon, G . (1999). Evolution of fungal self-fertile reproductive life style from self-sterile ancestors. Proceedings of the National Academy of Sciences of the USA 96, 5592-5597. Y u n , S. H . , A r i e , T. , Kaneko , I., Yoder , O . C . & Turgeon, B . G . (2000). Molecular organi-zation of mating type loci in heterothallic, homothallic, and asexual Gib-berellalFusarium species. Fungal Genetics and Biology 31, 7-20. Z h a n , J . , Pettway, R . E . & M c D o n a l d , B . A . (2002). The global genetic structure of the wheat pathogen Mycosphaerella graminicola is characterized by high nuclear diversity, low mitochondrial diversity, regular recombination, and gene flow. Fungal Genetics and Biology 38, 286-297. 132 CHAPTER 4. Decorospora, a new genus for the marine as-comycete Pleospora gaudefroyi* 1 This chapter is a slightly altered version of the article: Inderbitzin, P., Volkmann-Kohlmeyer, B., Kohlmeyer, J. & Berbee, M. L. (2002). Decorospora, a new genus for the marine ascomycete Pleospora gaudefroyi. Mycologia 9 4, 651-659. It was a collaboration with Jan Kohlmeyer and Brigitte Volkmann-Kohlmeyer, Institute of Marine Sciences, University of North Carolina at Chapel Hill, Morehead City, North Carolina. The contributions of the co-authors are gratefully acknowledged. 1 3 3 4.1. Introduction Pleospora gaudefroyi Patouillard is a marine ascomycete described in 1886 from the northern coast of France. Morphological characters of P. gaudefroyi include black ascomata becoming superficial on the substrate at maturity (Figure 4-1), septate and branched pseudoparaphyses (Figure 4-4), fissituni-cate, clavate asci (Figure 4-3, Figure 4-4), as well as yellow-brown ascospores (Figure 4-2) with seven transverse septa and one to three longitudinal septa in each segment (Kohlmeyer, 1962). Ascospores in P. gaudefroyi produce a characteristic gelatinous sheath that is thought to be exosporial in origin, hav-ing a tripartite outer boundary (Yusoff era/., 1993). Upon release from the ascus, this hyaline layer swells once in contact with water, and transforms into a thick sheath, generally bearing two extensions at each polar region of the ascospores. One pair of extensions is formed on either side of the pole in a plane through the long axis of the ascospore. The planes stand at a 90° angle to each other, so that in side view only three of the extensions are visible. They are about as wide and long as the ascospore, and taper towards the apex (Kohlmeyer, 1962). At one point, P. gaudefroyi was considered to be a synonym of Pleo-spora herbarum (Pers.: Fr.) Rabenhorst ex Cesati & de Notaris, the type spe-cies of the genus Pleospora (Wehmeyer, 1961). However, even though Pleo-spora herbarum and P. gaudefroyi are morphologically similar, an anamorph is unknown for P. gaudefroyi, and P. herbarum ascospores lack the sheath char-acteristic of P. gaudefroyi. Kohlmeyer (1962) reestablished P. gaudefroyi ar-guing that the presence of the ascospore sheath with its apical extensions, as well as the marine habitat of P. gaudefroyi, are sufficient to keep it separate from P. herbarum. In this study, we are using phylogenetic analyses of partial SSU and ITS ribosomal DNA sequences to investigate the following questions: Are P. gaude-froyi and P. herbarum conspecific, congeneric, or should they be placed in dis-tinct genera? In case P. gaudefroyi could not be retained in Pleospora, in which genus should it be placed instead? 4.2. Materials and methods 4.2.1 Molecular work The culture of Pleospora gaudefroyi used for DNA extraction was derived from specimen J.K. 817 (on Salicornia, France) illustrated and discussed by Kohlmeyer (1962). We obtained the culture from the Centraalbureau voor Schimmelcultures (CBS), Baarn, The Netherlands (CBS 332.63), where it had been deposited in 1963 by J. Kohlmeyer. DNA was isolated with a standard phenol-chloroform extraction (Lee & Taylor, 1990) from mycelium scraped off 134 a PDA Petri dish. The SSU ribosomal DNA region was PCR amplified by NS1 and clTS5, the complement to ITS5 (White et al., 1990). Sequencing reactions were performed with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems, Mississauga, Canada) using NS1, NS2, and clTS5 (White etal., 1990), NS19 (Gargas & Taylor, 1992), MB1, MB2, and Bas3 (Inderbitzin et al., 2001). The ITS ribosomal DNA region was PCR amplified and sequenced by ITS4 / ITS5 (White et al., 1990). Sequences were determined automatically on an ABI 377XL Automatic Sequencer (Perkin Elmer Corp., Norwalk, USA), and assembled in AutoAssembler Version 1.4 (Applied Biosys-tems, Perkin Elmer Corp., Norwalk, USA). 4.2.2 Phylogenetic analyses of SSU rDNA datasets In a BLAST search, the SSU ribosomal DNA (SSU rDNA) sequence of Pleospora gaudefroyi had highest percentage similarity to species of Pyrenophora, Coch-liobolus, Pleospora, Setosphaeria, and Alternaria in that order. A representative of each of these genera was included in the phylogenetic analyses. The re-mainder of the taxa retrieved from GenBank were chosen to represent the mo-nophyletic sister group to Rhytidhysteron rufulum (Liew et al., 2000; Winka & Eriksson, 1998). Thus, a total of 27 partial SSU rDNA sequences were re-trieved from GenBank (Table 4-1). The sequences were manually aligned with the homologous sequence of Pleospora gaudefroyi using Se-AI v1.d1 (Rambaut, 1995). The resulting data matrix contained 28 taxa and 1720 char-acters. The following 14 sequences were approximately 1060 bp in length: Trematosphaeria hydrela, Mycosphaerella citrullina, Sporormiella australis, Pseudotrichia aurata, Pleomassaria siparia, Phaeodothis winter!, Montagnula opulenta, Massariosphaeria phaeospora, Melanomma pulvis-pyrius, Massarina australiensis, Massaria platani, Leptospora rubella, Didymella exigua, and Delitschia winteri. The sequence of Rhytidhysteron rufulum was approximately 1600 bp in length, whereas the remaining 13 sequences, including P. gaude-froyi, were around 1700 bp long. The data matrix was analysed in PAUP* 4.0b3 (Swofford, 2001) using parsimony and Neighbor joining with default settings, unless noted otherwise. Rhytidhysteron rufulum was used as out-group. This alignment was submitted to TreeBASE (M1158). Parsimony trees were inferred in 30 heuristic searches with random addi-tion of taxa. All characters were weighted equally, and gaps were treated as missing data. In Neighbor joining analyses, the Jukes-Cantor distance correc-tion was used, since the estimated pairwise Jukes-Cantor distances between the taxa were around 0.05 substitutions per site (Kumar etal., 1993): Out of 378 possible pairwise comparisons for the 28 taxa, 13 were above 0.05 sub-stitutions per site. The maximal estimated pairwise distance was 0.058 substi-tutions per site between P. gaudefroyi and Phaeodothis winteri. Bootstrap support for the branches was based on 500 replicates with random taxon ad-1 3 5 dition. The parsimony-based Kishino-Hasegawa test was applied using default settings in PAUP* (Swofford, 2001). For computational reasons, a smaller dataset comprising the taxa of the Pleosporaceae (Alternaria alternata, Cochliobolus sativus, Pleospora herbarum, Pyrenophora tritici-repentis, Setosphaeria rostrata) and P. gaudefroyi was used in the likelihood-based, non-parametric Shimodaira-Hasegawa tests (SHT) as implemented in the program SHTests v1.0 (Rambaut, 2000). A Jukes-Cantor model of evolution was used. The number of bootstrap replicates was 500. The topology of the most likely tree needed for the SHT was obtained in PAUP* (Swofford, 2001) using a Jukes-Cantor model of evolution. 4.2.3 Phylogenetic analyses of the ITS rDNA dataset Species of Alternaria were closest matches to the ITS ribosomal DNA (ITS rDNA) sequence of P. gaudefroyi in a BLAST search. Clustal W (1.74) (Thompson era/., 1994) was used for aligning the P. gaudefroyiITS rDNA se-quence with homologous regions from the following taxa retrieved from Gen-Bank (Table 4-1): Alternaria alternata, Cochliobolus sativus, two different se-quences named Leptosphaeria maculans, Pleospora herbarum, Pyrenophora tritici-repentis, and Setosphaeria rostrata. The resulting dataset contained 8 taxa and 625 characters. Parsimony analyses were performed as described for the large SSU rDNA dataset. Leptosphaeria maculans (M96384) was used as outgroup. 4.3. Results 4.3.1 Phylogenetic analyses of the SSU rDNA dataset The SSU ribosomal DNA dataset consisting of 28 taxa was subjected to parsi-mony analyses, with Rhytidhysteron rufulum as the outgroup. Out of the 1720 characters, 215 were variable (12.5%), of which 117 were parsimony informa-tive (6.8%). One most parsimonious (MP) tree was obtained, measuring 348 steps (CI = 0.690, RI = 0.794). This study focused on the placement of P. gaudefroyi which in both MP and Neighbor joining (NJ) trees was unambiguous: Pleospora gaudefroyi grouped with 100% support as the sister group to the Pleosporaceae (Figure 4-5). The monophyly of the Pleosporaceae without P. gaudefroyi was sup-ported by 94% bootstrap support in both MP and NJ analyses. Outside the P. 5fat/defroy/-Pleosporaceae group, at a 60% bootstrap support-level, the branching order of the NJ tree did not contradict results obtained in other studies (data not shown) (Liew etal., 2000; Winka & Eriksson, 1998). The MP tree differed by the disposition of Massariosphaeria phaeospora, which was sis-ter taxon to a poorly supported clade, containing taxa from Didymella exigua to P. herbarum (Figure 4-5). 136 The topology obtained within the Pleosporaceae excluding P. gaudefroyi in MP and NJ tree was conflicting: Whereas Alternaria alternata grouped with 94% bootstrap support with Pleospora herbarum in the MP analyses (Figure 4-5), A. alternata was basal in the NJ tree (data not shown). The next taxa to branch off in the NJ tree were Setosphaeria rostrata, then P. herbarum, fol-lowed by Cochliobolus sativus and Pyrenophora tritici-repentis. The bootstrap supports ranged from 58 to 74% (data not shown). The conflict between NJ and MP trees was consistent with previous work which also provided contradicting information about the branching order within the Pleosporaceae: Based on ITS and GPD sequences, Berbee et al. (1999) found that the relationship between species of Pleospora and A. alternata could not be resolved. 4.3.2 Kishino-Hasegawa test To investigate the possibility of a monophyletic genus Pleospora, P. gaudefroyi was constrained to the group with P. herbarum in the large dataset. In this scenario, nine most parsimonious trees were obtained, measuring 359 steps each, 11 steps more than the MP tree. According to the parsimony-based Ki-shino-Hasegawa test (KHT), all of the constrained MP trees were significantly worse than the unconstrained MP tree (P < 0.05). 4.3.3 Shimodaira-Hasegawa tests The KHT was designed to compare the fit of two a priori specified tree topolo-gies to a dataset (Goldman et al., 2000). However, we wanted to test if a pri-ori topologies with a monophyletic genus Pleospora were significantly different from the best tree derived from the dataset. The appropriate test to use in this case was the likelihood-based non-parametric Shimodaira-Hasegawa tests (SHT) (Goldman et al., 2000). This test allowed multiple comparisons of a pri-ori hypotheses to the ML tree inferred from the dataset. For the small dataset containing six taxa, 15 a priori hypotheses could be formulated corresponding to the 15 unrooted tree topologies with P. herbarum and P. gaudefroyi as sis-ter taxa. Subsequently, the number of a priori hypotheses was reduced to three, since we considered Cochliobolus sativus and Setosphaeria rostrata to be sister taxa. This assumption was based on a study by Berbee et al. (1999) where the phylogenetic relationships of species of Alternaria, Cochliobolus, Pleospora, Pyrenophora, and Setosphaeria, were investigated using a dataset with ITS and GPD sequences. The results showed members of Cochliobolus and Setosphaeria to be sister groups with 72% bootstrap support. This agreed with results from RAPD data, where representatives of Cochliobolus and Se-tosphaeria were more similar to one another than either one of them to Pyrenophora (Bakonyi et al., 1995). Pyrenophora also differed ecologically from both Cochliobolus and Setosphaeria: Members of Pyrenophora were pre-137 dominantly found on grasses of the Pooideae, whereas Cochliobolus and Se-tosphaeria occurred generally on members of the Chloridoideae (Alcorn, 1983; Watson & Dallwitz, 1992). Thus, using the program SHTests v1.0 (Rambaut, 2000), the three a priori hypotheses were compared to the ML tree obtained in PAUP*. All three were significantly worse than the ML tree (P < 0.02). 4.3.4 Phylogenetic analysis of the ITS rDNA dataset The ITS rDNA dataset consisting of eight taxa was subjected to a parsimony analysis with Leptosphaeria maculans (M96384) as outgroup. Out of 625 characters, 198 were variable (32%), of which 113 were parsimony informa-tive (18%). One most parsimonious (MP) tree was obtained, measuring 410 steps (CI = 0.759, RI = 0.434). Pleospora gaudefroyi grouped with 100% bootstrap support with Alternaria alternata, Cochliobolus sativus, Pleospora herbarum, Pyrenophora tritici-repentis, and Setosphaeria rostrata (data not shown). The latter five taxa formed a monophyletic group with 61% bootstrap support. The remaining bootstrap support percentages were below 50% (data not shown). The ITS alignment contained many ambiguously aligned sites, so that we chose to emphasize results based on easily alignable SSU rDNA data. However, the placement of P. gaudefroyi in ITS rDNA analyses was consistent with results from SSU rDNA data. 4.4. Discussion 4.4.1 Pleospora gaudefroyi transferred to new genus Decorospora Phylogenetic analyses of SSU and ITS rDNA data, as well as test results of SSU rDNA datasets supported morphological and ecological data suggesting that P. gaudefroyi and P. herbarum were distinct species. The molecular analyses fur-ther revealed that P. gaudefroyi should be transferred to another genus. In both parsimony and Neighbor joining analyses of the SSU rDNA dataset, repre-sentatives of the Pleosporaceae without P. gaudefroyi clustered together with 100% bootstrap support (Figure 4-5). In an ITS rDNA analysis, P. gaudefroyi clustered with 100% bootstrap support with members of the Pleosporaceae as well (data not shown). However, constraining the genus Pleospora to be mo-nophyletic resulted in significantly worse trees as evaluated by the Kishino-Hasagewa and Shimodaira-Hasegawa tests using SSU rDNA datasets. Thus, P. gaudefroyi was excluded from Pleospora, and transferred to the new genus Decorospora. The establishment of a new genus was necessary due to the lack of any existing genus in the Dothideomycetes characterized by a Pleospora-like morphology combined with ornamented ascospores. 138 4.4.2 Decorospora, a new genus in the Pleosporaceae Phylogenetic analyses indicated that of all included taxa, D. gaudefroyi was closest related to members of the Pleosporaceae sensu Eriksson (1999): In both parsimony and Neighbor joining analyses, D. gaudefroyi and the remainder of the Pleosporaceae formed a monophyletic group with 100% bootstrap sup-port (Figure 4-5). Thus, Decorospora is placed in the Pleosporaceae. 4 .5. Taxonomy 4.5.1 The new genus Decorospora Decorospora Inderbitzin, Kohlm. et Volkm.-Kohlm. gen. nov. Genus Pleosporacearum. Ascomata subglobosa ad ellipsoidea, immersa, ostio-lata, epapillata vel breve papillata, carbonacea, nigra. Peridium cellulis pachy-dermis luminibus grandis, in sectione longitudinali texturam angularem forman-tibus. Hamathecium pseudoparaphysibus septatis, ramosis. Asci octospori, clavati, breve pedunculati, pachydermi, fissitunicati, sine apparatu apicale. As-cosporae biseriatae, ellipsoideae, muriformes, brunneae, tunica gelatinosa tec-tae; tunica extensa ad apices ambos in 2 vel 3 protuberationes subconicas. A genus of Pleosporaceae. Ascomata subglobose to ellipsoidal, im-mersed, ostiolate, epapillate or short papillate, carbonaceous, black (Figure 4-1). Peridium composed of thick-walled cells with large lumina, forming a tex-tura angularis in longitudinal section. Hamathecium composed of septate, ra-mose pseudoparaphyses (Figure 4-4). Asci eight-spored, clavate, short pedun-culate, thick-walled, fissitunicate, without apical apparatuses (Figure 4-3, Figure 4-4). Ascospores biseriate, ellipsoidal, muriform, brown, covered by a gelatinous sheath that is slightly constricted around the center and drawn out at each apex into 2 or rarely 3 subconical extensions (Figure 4-2). Type species. Decorospora gaudefroyi (Pat.) Inderbitzin, Kohlm. & Volkm.-Kohlm. Etymology. From the Latin decorus: beautiful, and sporus: spore, in ref-erence to the ornate ascospores. 4.5.2 Transfer of Pleospora gaudefroyi to Decorospora Decorospora gaudefroyi (Pat.) Inderbitzin, Kohlm. et Volkm.-Kohlm., comb, nov., Figure 4-1 - Figure 4-4. Basionym: Pleospora gaudefroyi Pat., Tabulae Analyticae Fungorum, Paris, Deuxieme Ser., p. 40, No. 602, 1886. = Pleospora salsolae Fuckel var. schoberiae Sacc, Michelia 2, 69. 1880. = Pleospora schoberiae (Sacc.) Berl., Icon. Fung. 2, 23. 1895. = Pleospora lignicola J. Webster & M. T. Lucas, Trans. Brit. Mycol. Soc. 44, 431. 1961. 139 = Pleospora salicorniae Jaap, Verh. Bot.Ver. Prov. Brandenburg 49, 16. 1907 (non Pleospora salicorniae P. A. Dang. 1888). = Pleospora herbarum (Fr.) Rabenh. var. salicorniae (Jaap) Jaap, Ann. Mycol. 14, 17. 1916 (non Pleospora herbarum f. salicorniae Auersw. in Rabenhorst, Fungi Europaei Exsiccati, Cent. 2, No. 145. 1860, invalid name). 4.5.3 Specimens examined FRANCE. PAS DE CALAIS: Marais de la Pointe de Touquet, near Etaples, 56°12'30"N, 0°48'40"W, on Suaeda maritima, 15 Aug. 1879, O. Harlot (HOLOTYPE PC); sub Pleospora salsolae f. schoberiae, from Herb. E. Gaudefroy. CROATIA: Island of Rab, Lopar, 44°49'N, 14°45'E, on Halimione portulacoides, 16 Oct. 1971, J. & E. Kohlmeyer J.K. 2903 (IMS); same location and date, on Salicornia sp., J. & E. Kohlmeyer J.K. 2904 (IMS). ARGENTINA. BUENOS AIRES: Near Villa del Mar, SE of Bahia Blanca, 38°49'S, 62°19'W, on Salicornia sp., 23 Oct. 1973, J. & E. Kohlmeyer J.K. 3520 & 3522 (IMS); same location and date, on Salicornia ambigua, J. & E. Kohlmeyer J.K. 3521 (IMS). CANADA. BRITISH COLUMBIA: On small island in Malaspina Inlet near Lund, ca. 50°03'N, 124°47'W, on Salicornia virginica, P. Inderbitzin P162 (UBC F14076). Data on other collections has already been reported in the literature (see paragraph on Geographic Distribution). 4.5.4 Commentary Decorospora gaudefroyi has been fully described and illustrated by Kohlmeyer & Kohlmeyer (Kohlmeyer & Kohlmeyer, 1964; 1979). Yusoff et al. (1993) de-scribed the ultrastructure of D. gaudefroyi ascospores with surrounding sheath while still in the ascus (i.e., without the unfolded sheath extensions), and Hyde et al. (1 986) depicted an ascospore with extended sheath in SEM. Ascospore ornamentations, found among many marine ascomycetes (Kohlmeyer & Volk-mann-Kohlmeyer, 1991) are considered adaptations to the marine habitat, en-hancing the attachment of spores to submerged substrates (Hyde et al., 1986). Because of its characteristically ornamented ascospores (Figure 4-2), D. gaudefroyi cannot be confused with any other marine ascomycete. A super-ficially similar species is Nimbospora octonae Kohlm. (Halosphaeriales) which, however, has ascospores with a gelatinous sheath, enclosing a number of subulate appendages (Kohlmeyer, 1985). Other marine species with somewhat extended ascospore sheaths are Frondicola tunitricuspis K.D. Hyde and Carinis-pora nypae K.D. Hyde (1992), whereas the sheath in Massarina armatispora K.D. Hyde, Vrijmoed, Chinnaraj & E. B. G. Jones appears simply drawn out at the poles (Hyde etal., 1992). Ascospore sheaths without extensions occur frequently also in terrestrial ascomycetes, e.g. in Phaeosphaeria and Mas-sariosphaeria (Eriksson, 1967; Leuchtmann, 1984). 140 4.5.5 Substrates Decorospora gaudefroyi is an obligate marine fungus, growing at or above the high water mark. It is not host-specific, as it occurs on a variety of cellulosic substrates, such as dead marsh plants, driftwood and pilings. Among the host plants found so far are Halimione portulacoides (L.) Aellen, Salicornia ambigua Michx., Salicornia virginica L, Salicornia spp., and Suaeda maritima (L.) Dum. The species is able to grow under conditions of high salinity, as it was found in a salina in southern France with a salinity of 60%o, and formed ascomata even on the salt-encrusted top of a piling (Kohlmeyer, 1962). In pure culture D. gaudefroyi grows well, decomposes balsa wood, and even dissolves cellulose of a tunicate mantle (Kohlmeyer, 1962). 4.5.6 Geographic distribution Decorospora gaudefroyi appears to be restricted to temperate waters. In Europe it was collected at the northern coast of France (Patouillard, 1886), at the Mediterranean coast of France (Kohlmeyer, 1962), at the North Sea coast of England (Webster & Lucas, 1961), at the German coast of the North Sea (Jaap, 1907), and in Croatia (this paper). In North America the species was found in Massachusetts, USA (Gessner & Lamore, 1978) and in Canada (British Columbia, this paper). The only collections of D. gaudefroyi from the southern hemisphere are from Argentina (this paper). Decorospora gaudefroyi can be compared in its habitat and geographical distribution with Passeriniella obiones (P. Crouan & H. Crouan) K. D. Hyde & Mouzouras. The latter grows also on de-caying marsh plants and wood, and occurs throughout Europe, on the United States east coast, in British Columbia and Argentina (Kohlmeyer & Kohlmeyer, 1979). 4.6. Acknowledgements This work was paid for in part by a NSERC operating grant (principal investiga-tor M. L. Berbee). The first author was supported by a University of British Columbia Graduate Fellowship, as well as by Rolf and Beatrice Inderbitzin. 141 Table 4-1. GenBank accession numbers and classification of the species used i n this study. New sequences are i n bold . 142 Taxon Accession N o . S S U r D N A Accession N o . I T S r D N A O r d e r / F a m i l y " Alternaria alternata (Fr.:Fr.) Keissler U05194 AF071346 Pleosporales / Pleosporaceae b Cochliobolus sativus (Ito & K u -rib.) Drechsler ex Dasturin U42479 AF071325 Pleosporales / Pleosporaceae Decorospora gaudefroyi (Pat.) Inderbitzin, Kohlm. & Volkm. -Kohlm. AF394542 AF394541 Pleosporales / Pleosporaceae c Delitschia winteri W . Phillips & Plowr. AF164354 - Pleosporales / Delitschiaceae Didymella exigua (Niessl) Sacc. AF164355 - incertae sedis Didymosphaerella opulenta (De Not.) Checa & M . E . Barr AF164370 - incertae sedis / Montagnulaceae Herpotrichia diffusa (Schw.) El l i s & Everh. U42484 - Pleosporales / L o -phiostomataceae Kirschsteiniothelia elaterascus Shearer AF053727 - Pleosporales / Pleosporaceae Leptosphaeria maculans (Desm.) Ces. & De Not. U04233 M96383 / M96384 Pleosporales / Leptosphaeriaceae Leptospora rubella (Pers.:Fr.) Rabenh. AF164361 - incertae sedis Lophiostoma crenatum (Pers.:Fr.) Fuckel U42485 - Pleosporales / L o -phiostomataceae Massaria platani Ces. AF164363 - Pyrenulales b / Massariaceae b Massarina australiensis K . D . Hyde AF164364 - Pleosporales / L o -phiostomataceae Massariosphaeria phaeospora (Mull.) Criv. AF164368 - Pleosporales / L o -phiostomataceae Melanomma pulvis-pyrius (Pers.:Fr.) Fuckel AF164369 - Pleosporales / Melanommataceae Mycosphaerella citrullina (C. 0 . Sm.) Grossenb. U79487 incertae sedis / Mycosphaerel-laceae Phaeodothis winteri (Niessl) Aptroot AF164371 incertae sedis / Phaeosphaeriaceae b Phaeosphaeria nodorum (E. Mul l . ) Hedj. U04236 - incertae sedis / Phaeosphaeriaceae Pleomassaria siparia (Berk. & Broome) Sacc. AF164373 - incertae sedis / Pleomassariaceae Pleospora herbarum (Pers.rFr.) Rabenh. ex Ces. & De Not. U05201 AF071344 Pleosporales / Pleosporaceae 143 Pseudotrichia aurata (Rehm) Wehm. AF164374 - Pleosporales / Melanommataceae Pyrenophora tritici-repentis (Died.) Drechsler U42486 AF071348 Pleosporales / Pleosporaceae Rhytidhysteron rufulum (Spreng.) Speg. AF201452 - Patellariales / Pa-tellariaceae Setosphaeria rostrata K . J. Leonard U42487 AF071342 Pleosporales / Pleosporaceae Sporormia lignicola W . Phillips & Plowr. U42478 - incertae sedis / Sporormiaceae Sporormiella australis (Speg.) Ahmed & Cain U79483 - incertae sedis / Sporormiaceae Trematosphaeria hydrela (Rehm) Sacc. AF164376 - Pleosporales / Melanommataceae Westerdykella dispersa (Clum) Cejp & M i l k o U42488 - incertae sedis / Sporormiaceae a According to Eriksson et al. (2001). b According to GenBank. 0 This paper. 144 Figure 4-1. Decorospora gaudefroyi f rom Salicornia sp., Argent ina . Longi tudina l section (20 urn) through ascoma ( J . K . 3521). F r o m Kohlmeyer , Bioscience 25:89,1975, reprinted wi th permission. B a r = 50 j i m . Figure 4-2. Decorospora gaudefroyi f rom Salicornia sp., Argent ina . Ascospores enclosed i n gelatinous sheaths with apical extensions ( J . K . 3520). F r o m Kohlmeyer , M c l l v a i n e a 6:46, 1984, reprinted with permission. Both i n Nomarsk i interference contrast B a r = 20 pan. Figure 4-3. Decorospora gaudefroyi f rom Salicornia sp., Croa t ia . Immature ascus, asco-spores enclosed i n gelatinous sheaths ( J . K . 2904). F r o m Kohlmeyer , M c l l v a i n e a 6:46, 1984, reprinted wi th permission. B a r = 20 um. Figure 4-4.4. Decorospora gaudefroyi f rom Suaeda maritima, France. M a t u r e asci and pseudoparaphyses ( H O L O T Y P E ) . Both i n Nomarsk i interference contrast. B a r = 25 p m . 1 4 5 146 Figure 4-5. Single most parsimonious tree obtained from a S S U r D N A dataset containing 28 taxa and 1720 characters, using Rhytidhysteron rufulum as outgroup (tree length = 348 steps; C I = 0.690; R I = 0.794). Higher taxonomic levels are given on the right, and follow Er iksson et a l . (2001) for the most part (see Table 4-1 for details). Numbers by the branches are bootstrap support percentages i n parsimony and Neighbor jo in ing analyses. Branches wi th 100% bootstrap support i n both analyses are i n bold . Decorospora gaude-froyi and Pleospora herbarum were the focus of this study and are therefore i n bold . Decorospora gaudefroyi grouped wi th 100% bootstrap support i n both analyses wi th taxa i n the Pleosporaceae. Note that D. gaudefroyi and P. herbarum were not closest relatives: The Pleosporaceae without D. gauderoyi were supported by 94% of the bootstrap repl i -cates i n both analyses. Exclus ion of D. gaudefroyi from Pleospora was also suggested by results from both Kishino-Hasegawa and Shimodaira-Hasegawa tests which showed that constraining the genus Pleospora to be monophyletic yielded significantly worse trees (see text for details). 147 Rhytidhysteron rufulum 100/100 82/ 7 4 / 8 0 62/ Decorospora gaudefroyi 9 4 / 9 4 r Cochliobolus sativus Pyrenophora tritici-repentis Pleospora herbarum — Alternaria alternata fi 94 / - Setosphaeria rostrata r- Leptosphaeria maculans Phaeosphaeria nodorum — Leptospora rubella 73 / 7 8 7 7 / 82 Mycosphaerella citmllina r Pseudotrichia aurata Didymella exigua — Massariosphaeria phaeospora Kirschsteiniothelia elaterascus — Phaeodothis winteri Didymosphaerella opulenta 99 / 99| 8 5 / 9 3 100/100 - Massaria platani Herpotrichia diffusa Melanomma pulvis-pyrius - Pleomassaria siparia 99 / 100 r Lophiostoma crenatum Massarina australiensis 80 / 89 r~ Sporormia lignicola I Sporormiella australis 6 2 / Westerdykella dispersa Trematosphaeria hydrela - Delitschia winteri 5 changes 148 4.7. Bibliography A l c o r n , J . L . (1983). Generic concepts in Drechslera, Bipolaris and Exserohilum. Mycotaxon 17, 1-86. Bakony i , J . , Pomaz i , A . , F i sch l , G . & Hornok , L . (1995). Comparison of selected species of Bipolaris, Drechslera and Exserohilum by random amplification of polymorphic DNA. Acta Microbiologica et Immunologica Hungarica 42, 355-366. Berbee, M . L . , Pirseyedi, M . & H u b b a r d , S. (1999). Cochliobolus phylogenetics and the ori-gin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91, 964-977. Er iksson , O . (1967). On graminicolous pyrenomycetes from Fennoscandia. 2. Phragmosporous and scolecosporous species. Arkiv for Botanik 6, 381-441. Er iksson , O . E . (1999). Outline of Ascomycota - 1999. Myconet 3, 1-88. Er iksson , O . E . , B a r a l , H . - O . , C u r r a h , R . S., Hansen, K . , K u r t z m a n , C . P . , Rambo ld , G . & Laess0e, T . (2001). Outline of Ascomycota - 2001. Myconet (published on the internet). Gargas, A . & Taylor , J . W . (1992). Polymerase Chain Reaction (PCR) primers for amplifying and sequencing nuclear 18S rDNA from lichenized fungi. Mycologia 84, 589-592. Gessner, R . V . & Lamore , B . J . (1978). Fungi from Nantucket salt marshes and beaches. Rhodora 80, 581-586. Goldman , N . J . , Anderson, P . & Rodr igo , A . G . (2000). Likelihood-based tests of topologies in phylogenetics. Systematic Biology 49, 652-670. Hyde, K . D . (1992). Fungi from decaying intertidal fronds of Nypafruticans, including three new genera and four new species. Botanical Journal of the Linnean Society 110, 95-110. Hyde, K . D . , Jones, E . B . G . & Moss , S. T . (1986). How do fungal spores attach to surfaces? In Biodeterioration 6, pp. 584-589. Edited by H. D. Barry S, Llewelyn GC, O'rea CE. London: Commonwealth Agricultural Bureau and the Biodeterioration Society. Hyde, K . D . , Vr i jmoed , L . L . P . , Chinnara j , S. & Jones, E . B . G . (1992). Massarina arma-tispora sp. nov., a new intertidal ascomycete from mangroves. Botanica Marina 35, 325-328. Inderbitzin, P . , L a n d v i k , S., Abde l -Wahab , M . A . & Berbee, M . L . (2001). Aliquandostipi-taceae, a new family for two new tropical ascomycetes with unusually wide hyphae and dimorphic ascomata. American Journal of Botany 88, 52-61. Inderbitzin, P . , Volkmann-Kohlmeyer , B . , Kohlmeyer , J . & Berbee, M . L . (2002). Decorospora, a new genus for the marine ascomycete Pleospora gaudefroyi. Mycologia 94, 651-659. Jaap, O . (1907). Zweites Verzeichnis zu meinem Exsiccatenwerk "Fungi selecti exsiccati", Serien V-VIII (Nummern 101-200), nebst Beschreibungen neuer Arten und Bemerkun-gen. Verb Bot Ver Prov Brandenburg 49, 7-29. Kohlmeyer , J . (1962). Uber Pleospora gaudefroyi Patouillard. Willdenowia 3, 315-324. Kohlmeyer , J . (1985). Nimbospora octonae, a new marine ascomycete from Hawaii. Canadian Journal of Botany 63, 1122— 1125. Kohlmeyer , J . & Kohlmeyer , E . (1964). Icones Fungorum Maris. Fasc I. Weinheim: J. Cramer. Kohlmeyer , J . & Kohlmeyer , E . (1979). Marine mycology: the higher fungi. New York: Aca-demic Press. Kohlmeyer , J . & Volkmann-Kohlmeyer , B . (1991). Illustrated key to the filamentous higher marine fungi. Botanica Marina 34, 1-61. 149 K u m a r , S., Tamura , K . & N e i , M . (1993). MEGA: Molecular Evolutionary Genetics Analy-sis, version 1.01: The Pennsylvania State University, University Park, P A 16802. Lee, S. B . & Taylor , J . W . (1990). Isolation of D N A from fungal mycelia and single spores. In PCR Protocols, pp. 282-287. Edited by M . A . Innis, D . H . Gelfand, J. J. Sninsky & T. J. White. San Diego: Academic Press, Inc. Leuchtmann, A . (1984). Uber Phaeosphaeria Miyake und andere bitunicate Ascomyceten mit mehrfach querseptierten Ascosporen. Sydowia 37, 75-194. L i e w , E . C . Y . , Aptroot , A . & Hyde , K . D . (2000). Phylogenetic significance of the pseu-doparaphyses in Loculoascomycete taxonomy. Molecular Phylogenetics and Evolution 16, 392-402. Patoui l lard , N . (1886). Tabulae Analyticae Fungorum. Paris: Klincksieck. Rambaut , A . (1995). Se-Al vl.dl, Version 1.0 alpha edn. Oxford, U . K : Department of Zool -ogy, University of Oxford. Rambaut , A . (2000). Shimodaira and Hasegawa Tests of Phylogenetic Hypotheses SHTests v l . 0 . Swofford, D . L . (2001). PAUP*. Phylogenetic analysis using parsimony (*and other methods). Version 4.0b5. Sunderland, Massachusetts: Sinauer Associates. Thompson, J . D . , Higgins, D . G . & Gibson , T . J . (1994). C L U S T A L W : improving the sen-sitivity of progressive multiple sequence alignment through sequence weighting, posi-tions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22,4673-4680. Watson, L . & Dal lwi tz , M . J . (1992). The grass genera of the world. Wallingford, Oxon, U K : C A B International. Webster, J . & Lucas , M . T . (1961). Observations on British species of Pleospora. II. Trans-actions of the British Mycological Society 44, 417-436. Wehmeyer, L . E . (1961). A world monograph of the genus Pleospora and its segregates. A n n Arbor: The University of Michigan Press. Whi te , T . J . , Bruns , T. , Lee, S. & Taylor , J . (1990). Amplification and direct sequencing of fungal ribosomal R N A genes for phylogenetics. In PCR Protocols, pp. 315-322. Edited by M . A . Innis, D . H . Gelfand, J. J. Sninsky & T. J. White. San Diego: Academic Press, Inc. W i n k a , K . & Er iksson , O . E . (1998). Molecular evidence for recognizing the Chaetothyriales. Mycologia 90, 822-830. Yusoff, M . , Moss , S. T . & Jones, E . B . G . (1993). Ascospore ultrastructure of Pleospora gaudefroyi. Canadian Journal of Botany 12, 1-6. 150 CHAPTER 5. Aliquandostipitaceae, a new family for two new tropical ascomycetes with unusually wide hyphae and dimorphic ascomata 2 2 This chapter is a slightly modified version of the article: Inderbitzin, P., Landvik, S., Abdel-Wahab, M. A., & Berbee, M. L. (2001). Aliquan-dostipitaceae, a new family for two new tropical ascomycetes with unusually wide hyphae and dimorphic ascomata. American Journal of Botany 8 8: 52-61. It was a collaboration with Sara Landvik, a postdoc in our lab, and Mohamed A. Abdel-Wahab from the Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong Special Administra-tive Region, People's Republic of China. I would like to thank the collaborators for their contributions. 151 5 .1. Introduction Microfungi are rarely collected and poorly known. The majority of known micro-fungi belong to the Ascomycota, the largest phylum of the fungi with more than 30,000 described species (Hawksworth etal., 1995). Hawksworth et al. (1997) estimated that the total number of known Fungi constitute only 5% of the existing mycota. For the Ascomycota alone, that would leave 570,000 species to be discovered. This lack of knowledge of microfungal diversity greatly hampers our capability of correctly inferring and understanding many aspects of fungal biology and phylogeny. Not surprisingly, taxonomic studies of microfungi from little explored ar-eas regularly yield high numbers of undescribed species. For instance, in a monograph of the Coronophorales (Ascomycetes) from India, Subramanian and Sekar(1990) found that ten out of 23 fungi (43%) collected from the West-ern Ghats were new to science (Hawksworth, 1991). On two short surveys of ascomycetous, fruitbody-forming microfungi on decaying wood in Thailand and southern China, we found a total of six species. Only one fungus could be named with certainty, and five seemed to be unde-scribed. The time invested in collecting decaying wood in the field and the amount of material returned to the laboratory for microscopic examination were minimal: less than 1 h was spent collecting and approximately half the volume of a large backpack of decaying wood was returned to the laboratory. The number of existing Fungi worldwide has been estimated to 1.5 mil-lion species, based on the 1:6 ratio of vascular plants to fungi on the British Isles (Hawksworth, 1991). For a country like China, with ~ 27,000 species of vascular plants (Eriksson & Yue, 1988), and ~ 7000 species of Fungi (Tai, 1979), it follows that 155,000 Fungi or more than 90% of the mycota pre-sent in China would yet have to be found. For Thailand, no comparable reliable data were available (R. Bandoni, personal communication, Ladner, British Co-lumbia, Canada). Two of the new fungi that we found, one from Thailand and one from China, were particularly interesting. They are described here as members of the new genus Aliquandostipite, placed in the new family Aliquandostipitaceae. Initial examination of hyphae and ascomata (organs of sexual sporo-genesis in ascomycetes) suggested the two new fungi were strikingly different from known ascomycetes. Both species of Aliquandostipite were characterized by the presence of hyphae that were five times wider than the widest hyphae known in ascomycetes. In ascomycetes in general, ascomata form superficially or immersed in the substrate, becoming superficial at maturity. In species of Aliquandostipite, however, ascomata seemed to be either borne by thick hy-phae, which function as stalks, or were unstalked and erumpent from the sub-stratum at maturity. The conventional, sessile ascomata and the stalked as-152 comata, resembling a tiny moss sporophyte more than a fungus, were present side by side on the substratum. By comparing the morphology of ascomata from nature and observing ascomata in culture, we investigated whether stalked and sessile forms represented dimorphisms within a species. Initial observation suggested that species of Aliquandostipite belong to the Dothideomycetes (Eriksson & Winka, 1998), a group of ascomycetes for-merly referred to as Loculoascomycetes. Members of this group are charac-terized by the presence of a functionally bilayered ascus wall developing in a lysogenic cavity, the centrum, within a compact hyphal body, called the as-coma. Fungi of the Dothideomycetes have traditionally been separated into orders based on the morphology of their centrum tissue (Barr, 1987). The centrum tissue consists of asci containing sexual spores and sterile filaments, which sometimes are present intermingled among the asci. The presence or absence of the sterile filaments is taxonomically important. Among the orders with bilayered ascus wall, the Dothideales lack sterile filaments in their centrum, while filaments are present in the Pleosporales and Patellariales (Barr, 1987). Ascomata of most orders of the Dothideomycetes open by a pore at maturity, through which the ascospores are released. In the Patellariales, however, the ascomata open by an apical cleft, and the outer wall recurves, detaches from the hamathecium, and reveals the centrum. In the latest system of classification, the Pleosporales and the Do-thideales are united in the Dothideomycetes, but the affinity of the Patellari-ales is unclear (Eriksson & Winka, 1998). Morphology suggests that species of Aliquandostipite belong in the Pleosporales, but molecular evidence contradicts this placement. In this paper, we describe two new species in the new genus Aliquan-dostipite, show that they are closely related based on morphological and mo-lecular characters, and infer their phylogenetic relationship to the three orders of Dothideomycetes outlined above. 5.2. Materials and methods 5.2.1 Collection, examination and isolation of fungi Decaying branches were collected and stored in plastic bags until return to the laboratory. Fungi were located with an Olympus ZH10 or a Leica Wild M3Z ste-reomicroscope. Semi-thin cryosections of material embedded in Jung tissue-freezing medium were cut with a Jung CM 1500 cryostat. Cryosections and squash mounts of fungal material in water or glycerol were examined with an Olympus BH-2 or a Leica Leitz DMRB microscope. Photographs were taken with an Olympus C-35AD-4 or a Leica Wild MPS 48/52 photoautomat using Kodak TMAX 100 film. 153 To obtain cultures derived from single ascospores, ascomata were cut open with a razor blade, and the centrum tissue containing ascospores was removed with sterile forceps and placed in sterile tap water. Small drops of this ascospore suspension were placed on Corn Meal Agar (Becton Dickinson Microbiology Systems, Cockeysville, Maryland, USA) petri dishes and incubated at 25°C in the dark. Germinated ascospores were transferred to new Potato Dextrose Agar (Difco Laboratories, Detroit, Michigan, USA) petri dishes with sterile forceps and incubated at 25°C in the dark or at room temperature on a laboratory bench subject to artificial and day light and darkness at night. 5.2.2 Molecular work-Species of Aliquandostipite DNA was extracted from the mycelium of Aliquandostipite khaoyaiensis scraped off the surface of a PDA petri dish, and from the centrum tissue of a single ascoma of A. sunyatsenii stored in DNA lysis buffer (Lee and Taylor, 1990) for ~ 4 mo. A QIAamp Tissue Kit (Qiagen Inc., Mississauga, Ontario, Canada) was used for DNA extractions. From A. khaoyaiensis, the small subunit (SSU) ribosomal DNA (rDNA) gene was amplified by polymerase chain reaction (PCR) with the primers SL1 (Landvik, 1996) and NS8 (White etal., 1990). The internal transcribed spacer (ITS) 1 and ITS2 regions, including 5.8 S rDNA, were amplified by ITS5 and ITS4 (White et al., 1990). Ready-To-Go PCR beads (Amersham Pharmacia Bio-tech, Uppsala, Sweden) with a reaction volume of 25 uL were used. The PCR protocol consisted of 5 min at 95°C followed by 30 cycles of 1 min at 95°C, 1 min at 56°C, and 1 min with a time extension of 4 s per cycle at 72°C, and a final extension at 72°C for 7 min PCR products were purified by QIAquick PCR Purification Kit (Qiagen Inc., Mississauga, Ontario, Canada). Sequencing was performed with the AmpliTaq DNA Polymerase FS Dye Terminator Cycle Se-quencing kit (Perkin Elmer Corp., Norwalk, Connecticut, USA) in a reaction vol-ume of 20 uL containing ~ 90 ng of purified PCR product and 3.2 pmol of the sequencing primer according to the following PCR protocol: rapid thermal ramp to 96°C, followed by 25 cycles of 30 s at 96°C, 15 s at 50°C, and 4 min at 60°C. Primers used for sequencing were NS2, NS3, NS4 (White et ai, 1990), SL 1, SL344 and SL887 (Landvik, 1996) for the SSU rDNA region, and primers ITS5 and ITS3 for the ITS region (White et al., 1990). For A. sunyatsenii, parts of the SSU region and the ITS2 region of the rDNA gene were amplified with the primer pairs SL1 / NS4 and ITS3 / ITS4, re-spectively, and purified. PCR products were cloned following the instructions of the TOPO TA Cloning kit (Invitrogen, Carlsbad, California, USA). Ten bacterial colonies containing the respective PCR product insertions were transferred into 1.5-mL centrifuge tubes aliquoted with 1 mL of LB medium and 50 u.g/mL ampicillin prepared according to the manufacturer's instructions. The tubes were incubated at room temperature overnight and then centrifuged at 3000 154 rpm for 5 min The supernatants were removed, and the bacterial pellets were resuspended in 200 pl TE buffer (White et al., 1990) and incubated at 95°C for 10 min Two microlitres of each bacterial suspension were used for a PCR reaction either with the primer pair SL1 / NS2 or ITS3 / ITS4. The PCR prod-ucts were purified and sequenced, using the primers SL1 and ITS3 for the SSU and ITS products, respectively. All sequenced products were purified by etha-nol precipitation (95% EtOH, 7.5 mol/L NaOAc) prior to processing by an ABI 377XL Automatic Sequencer (Perkin Elmer Corp., Norwalk, Connecticut, USA). 5.2.3 Additional sequences obtained Tubeufia helicoma (Phill. & Plowr.) Pirozynski was collected 7 February 1999 by A. & R. Bandoni, S. Landvik, and P. Inderbitzin in South Arm Marshes Nature Reserve, Ladner, British Columbia, Canada, on a decaying decorticated log on the ground. A dried culture was deposited at the herbarium of the University of British Columbia, Vancouver, Canada (UBC F13877). Rhytidhysteron rufulum (Spreng.: Fr.) Petrak was collected 6 June 1999 by M. A. Abdel-Wahab, at Pat Heung, New Territories, Hong Kong, on a decay-ing branch on the ground. The material and a dried culture were deposited at the herbarium of the University of British Columbia, Vancouver, Canada (UBC F13903). Molecular work was carried out as described above. DNA was iso-lated from a culture derived from a single ascospore, and the SSU rDNA was sequenced in both directions with the following primers: NS1, NS2, and cITS 5, NS19 (Gargas & Taylor, 1992), SL344 and SL887, MB20 (Winka & Eriksson, 1 998), MB1 (5'-GGA GTA TGG TCG CAA GGC TG-3'), MB2 (5'-GTG AGT TTC CCC GTG TTG AG-3'), Bas3 (5'-AGA GTG TTC AAA GCA GGC-3'), and cBas3. 5.2.4 Data analysis New sequences were assembled using AutoAssembler Version 1.4 (Applied Biosystems, Perkin Elmer Corp., Norwalk, Connecticut, USA). Thirty SSU rDNA sequences were retrieved from GenBank (Table 5-1). Most of them were longer than 1700 bp, with the exceptions of Sphaerophorus globosus and Botryosphaeria rhodina (around 1650 bp), Peltigera neopolydactyla and Solorina crocea (1567 bp), and Tubeufia helicomyces (357 bp). 45 bp at the 3'-end of Lecanora dispersa were removed due to ambiguous alignment. The first 20 positions at the 5'-end of Aliquandostipite khaoyaiensis, the introns in T. helicoma and Monodyctis castaneae were excluded from analysis. Sequences were manually aligned using Se-AI Version 1.0 alpha 1 (Rambaut, 1995). Datasets were analyzed using PAUP Version 4.0b3 (Swofford, 2000) on a Power Macintosh G3 (Apple Computer, Inc., Cupertino, California, USA). Unless otherwise noted, default settings were used. Most parsimonious trees were generated in PAUP with 30 replicated heu-ristic searches and random taxon addition. Support for the branches was based 155 on 500 bootstrap replicates. Most likely trees were found with 30 replicated heuristic searches with random addition of taxa; or with a heuristic search us-ing the most likely of the parsimony trees as the starting tree. Support for the branches was based on 100 bootstrap replicates. The Kishino-Hasegawa test was used as implemented by PAUP. Neighbor joining analysis generated a dis-tance-based tree. Neighbor joining branch support was based on 500 boot-strap-replicates. 5.3. Results We first formally describe the following new taxa of ascomycetes: the new family Aliquandostipitaceae, based on the new genus Aliquandostipite, which contains the two new species A. khaoyaiensis (holotype species), and A. sun-yatsenii. The short Latin diagnoses are followed by extensive descriptions in English. Then we present the data from molecular work, including new se-quences obtained and results from phylogenetic analyses. 5.3.1 Taxonomy 5.3.1.1 Establishment and definition of the new family Aliquandostipitaceae fam. nov. Aliquandostipitaceae Inderbitzin fam. nov. Characteribus genere typico Ali-quandostipite Inderbitzin gen. nov. Characters like the holotype genus Aliquandostipite Inderbitzin gen. nov. 5.3.1.2 Establishment and definition of the new genus Aliquandostipite gen. nov. Aliquandostipite Inderbitzin gen. nov. Etymology: from Latin aliquando, some-times, and stipite, with a stalk. Ascomata immersa-erumpentia vel superficialia. Hamathecium pseu-doparaphyses. Asci bitunicati, fissitunicati. Hyphae usque ad 50 pm latas, ali-quando ascoma ferentem. Generitypus Aliquandostipite khaoyaiensis Inder-bitzin sp. nov. Ascomata immersed-erumpent or superficial. Hamathecium comprising pseudoparaphyses. Asci bitunicate, fissitunicate. Mycelium visible on the sub-stratum, comprising up to 50 pm wide hyphae, which may bear ascomata. Holotype species Aliquandostipite khaoyaiensis Inderbitzin sp. nov. 5.3.1.3 Establishment and description of the new species A. khaoyaiensis sp. nov. Aliquandostipite khaoyaiensis Inderbitzin sp. nov. (Figure 5-1 - Figure 5-13). Etymology: from the type locality, Khao Yai National Park in Thailand. Ascomata globosa vel subglobosa, ~ 250 pm diameter, papillata. Pseu-doparaphyses septatae, ramosae, persistentes. Asci clavati, ~ 167 X 46 pm. Ascosporae uniseptatae, ovales, ~ 62 X 16 pm, appendiculatae. Mycelium 1 5 6 praesens in pagina substrato. Hyphae usque ad 42 pm latas, aliquando ascoma ferentem. Holotypus: in ligno emortuo, Khao Yai, KY3.4 (UBC F13875). Sessile ascomata singly immersed to erumpent or superficial on old, de-corticated branch lying on the ground in a tropical rain forest, globose to broadly ellipsoidal, 216-290 pm high, 220-344 pm wide, papillate, appearing pale brown when young or dark brown with age beneath stereomicroscope (Figure 5-8, Figure 5-9). Ascomal wall membranous, one-layered, in surface view pallid brown, forming a textura angularis-globulosa, in vertical section cells rounded to elongate (Figure 5-8 - Figure 5-1 0). Ascomal wall in basal part 6-16 pm thick, 1-2 cells wide, cells 3-15 pm in diameter, in apical part 13-31 pm thick, 2-4 cells wide, cells up to 22.5 pm in diameter (Figure 5-8, Figure 5-9). Cell walls of outermost cells up to 3.5 pm thick and refractive and the largest cells may protrude up to 8 pm (Figure 5-9). Papilla ~ 50 pm high, 70 pm wide (Figure 5-9). Hamathecium pseudoparaphyses, septate, sparsely branched, up to 3.5 pm wide (Figure 5-8, Figure 5-11). Asci 136-194 X 36-58 pm (166.67 X 45.57 pm on average, N = 30), eight-spored, clavate, bituni-cate, fissitunicate, with thickened apical region, spores variably arranged, small pedoncle observed at times (Figure 5-11). Ascospores oval in outline, 49.6-70 X 12.8-20 pm (61.80 X 16.27 pm on average, N = 50), one-septate, con-stricted at the septum and there 11.2-16.8 pm wide (15.59 pm on average, N = 50), upper cell slightly longer and narrower than lower cell, smooth, pale brown, guttulate or not, sheathed (Figure 5-11 - Figure 5-13). Sheath first ap-pressed to the wall, gradually expanding and detaching from the polar regions towards the septum, then balloon-like at the poles, finally surrounding the en-tire ascospore, ~ 150 X 50 pm (Figure 5-12 - Figure 5-13). Superficial mycelium: consisting of light to dark brown, up to 40 pm wide hyphae, septate every 40-100 pm, wall refractive in vertical section, 4-6 pm thick (Figure 5-2, Figure 5-7). In substrate repeatedly branching into narrower, finally ~ 2 pm wide hyphae. Single hyphae may bear ascomata (Figure 5-1, Figure 5-3). Stalked ascomata: stalk up to 1.6 mm long and 42 pm wide, wall up to 15 pm thick, arising singly from superficial hypha (Figure 5-7), or singly or gregariously from substrate (Figure 5-1, Figure 5-3). Apical segment of stalk broadening to up to 3 times the width of the one beneath, and comprising several rounded cells, ~ 25 pm in diameter in basal part, diminishing in size and merging with the peridium in the upper part (Figure 5-4, Figure 5-5). Asco-mata globose to oval and then tapering towards the stalk, 140-320 pm high, 100-320 pm wide (Figure 5-4, Figure 5-5). Papilla up to 40 pm high, 110 pm wide (Figure 5-6). Ascomal wall a textura angularis-globulosa in surface view. In vertical section 1-3 cells wide, in basal part ~ 10 pm thick consisting of hya-line, thin-walled cells, 15-25 pm thick in apical part, cell walls 1-4 pm thick and refractive (Figure 5-4, Figure 5-5). Asci 116-180 X 30-46 pm (146.60 X 157 39.17 pm on average, N = 30). Ascospores 54.4-66.4 X 12.8-20.8 pm (61.46 X 16.73 pm on average, N = 50), at the septum 12.4-17.6 pm wide (14.67 pm on average, N = 50). Ascospores from sessile ascomata germinated on CMA petri dishes overnight in the dark at 25°C. Germination hyphae were up to 16 pm wide, constricted at the septa and there up to 10 pm wide. Germinated ascospores were transferred to PDA petri dishes and incubated on a laboratory bench ex-posed to artificial and daylight, and darkness at night. After 5 wk, colonies measured 2-4 pm in diameter, and the mycelium was immersed in the agar and dark olive-brown to black. After 10 mo, colonies measured up to 4 cm in di-ameter. At the margin, the mycelium was immersed in the agar and comprised up to 20 pm wide hyphae. Towards the center, the mycelium was erumpent from the agar, forming a dark-brown, prosenchymatous stroma intermixed with agar. Stalked ascomata formed on the stroma. The stalks were up to ~ 500 pm long and 30 pm wide, bearing globose ascomata up to ~ 400 pm in diame-ter. Ascomata contained pseudoparaphyses and sterile asci. A culture was de-posited at CBS. Habitat and distribution: on decaying branch lying on the ground in tropical rain forest in Khao Yai National Park, Thailand. Specimen examined: KY3.4, holotype (UBC F13875), on decaying branch, Khao Yai National Park, Thailand, July 1998, leg. A. M. Abdel-Wahab. 5.3.1.4 Establishment and description of the new species A. sunyatsenii sp. nov. Aliquandostipite sunyatsenii Inderbitzin sp. nov. (Figure 5-14 - Figure 5-17). Etymology: after Dr. Sun Yat-Sen, a native of Zhongshan. Ascomata globosa, ~ 350 pm diameter, papillata. Pseudoparaphyses septatae, ramosae, persistentes. Asci elongati, ~ 145 X 52 pm. Ascosporae uniseptatae, ellipsoideae, ~ 49 X 20 pm, appendiculatae. Mycelium praesens in pagina substrate Hyphae usque ad 50 pm latas, aliquando ascoma ferentem. Holotypus: in ligno emortuo, Wu Gui Shan, Z1.2 (UBC F13876). Sessile ascomata singly erumpent from decorticated branch immersed in small stream, rounded, 300-400 pm in diameter, papillate, ostiolate, light to dark brown, membranous (Figure 5-14). Ascomal wall one-layered, 25-40 pm thick, 2-5 cells wide, forming a textura globulosa-angularis in surface view. Outermost cells rounded to elongate, up to 30 pm in diameter, some protrud-ing up to 13 pm above surrounding cells (Figure 5-14), inner cells elongate and laterally compressed, cell walls 1-5 pm thick, refractive (Figure 5-14). Cells at the base and towards papilla dark pigmented at times. Ostiole apically lined by elongate cells, ~ 10 X 5 pm (Figure 5-14). Pseudoparaphyses persistent, sep-tate, branched, - 2.5 pm wide. Asci originating from a cushion-shaped ascoge-nous tissue at the base of the ascomata, 128-193 X 45-57.5 pm (145 X 51.5 pm on average, N = 20). When young, saccate with thick-walled apex, ocular 158 chamber and short stalk, completely filled by ascospores and ovoid to elongate when mature, bitunicate, fissitunicate, eight-spored. Ascospores straight or slightly curved (39-) 46-52 X 16-23 pm (49 X 19.5 pm on average, N = 30), one-septate up to 5 pm above or 4 pm below the middle (0.3 pm above on average, N = 30), upper hemispore up to 3 pm wider than lower hemispore (1 pm wider on average, N = 30), constricted at the septum, light brown, heavily guttulate (Figure 5-16, Figure 5-17). Two helmet-shaped appendages are pre-sent on either side of both upper and lower poles, tending to unite over the respective pole (Figure 5-17). Superficial mycelium dark brown, up to 35 pm wide, septate at intervals of 35-45 pm, carrying single presumptive ascoma primordia at times (Figure 5-15). Connections between sessile ascomata and superficial hyphae seen. Stalked ascoma: one stalked ascoma was found, ~ 350 pm in diameter, originating from the apex of a concolorous stalk (Figure 5-15). Stalk septate at intervals of 30-40 pm, thick-walled (up to 7.5 pm), 50 pm wide and 0.5 mm long, at the base branching into 15 pm wide hyphae. Asci contained were 137.5-142.5 X 45-62.4 pm, and ascospores 50-52.5 X 17.5-20 pm (both N = 4) (Figure 5-15). Ascospores failed to germinate in culture. Habitat and distribution: on decaying branches immersed in a small stream at Wu Gui Shan, near Zhongshan, Guangdong Province, People's Repub-lic of China. Specimen examined: Z1.2, holotype (UBC F13876), on decaying branch at Wu Gui Shan, 15 km south of Zhongshan, Guangdong Province, China, 11 November 1998, leg. Eduardo M. Leano and P. Inderbitzin. 5.3.2 Molecular data 5.3.2.1 New sequences obtained From the following species, new SSU rDNA sequences were obtained and sub-mitted to GenBank: Aliquandostipite khaoyaiensis (AF201453), 1739 bp cor-responding to positions 17-1716 of Saccharomyces cerevisiae Meyen ex E. C. Hansen from GenBank (V01335), A. sunyatsenii (AF201454), 440 bp corre-sponding to positions 130-571 of S. cerevisiae, Tubeufia helicoma (AF201455), 2110 bp corresponding to positions 65-1690 of S. cerevisiae, and Rhytidhysteron rufulum (AF201452), 1616 bp corresponding to positions 51-1665 of S. cerevisiae. In T. helicoma, introns of 81 and 402 bp were pre-sent at positions 467 and 565, respectively. From the following taxa, se-quences from the ITS rDNA-region were obtained and submitted to GenBank: 548 bp of ITS1, 5.8S rDNA, and ITS2-region of A. khaoyaiensis (AF201728), and 395 bp of the 5.8 rDNA and ITS2-region for A. sunyatsenii (AF201727). The latter two sequences were too divergent to be aligned. 159 SSU rDNA sequences of A. khaoyaiensis and A. sunyatsenii were more similar to one another than to any other sequence. Their overlapping region of 438 unambiguous sites differed in 1.8% of the sites. Among the other taxa included in the analyses, the homologous region in Botryosphaeria ribis was most similar to taxa of Aliquandostipite, differing from A. khaoyaiensis in 4.5% of the sites. Aliquandostipite khaoyaiensis and A. sunyatsenii clustered to-gether with high bootstrap support (Figure 5-18). Since a complete SSU rDNA sequence of a member of the Tubeufiaceae was not available from GenBank, we sequenced the SSU rDNA region of T. heli-coma. This new sequence differed in 0.8% of the sites from the homologous partial sequence of T. helicomyces retrieved from GenBank (Table 5-1). This was comparable to the degree of variability in homologous regions of other closely related taxa of the Dothideomycetes included in this study, such as Se-tosphaeria rostrata and Pleospora herbarum, which differed in 0.8% of the sites. On the other hand, the homologous regions of the most divergent taxa in the Dothideomycetes in this study, P. herbarum and Aureobasidium pullu-lans, differed by 7.2%. Tubeufia helicoma clustered with the 357 bp sequence of T. helicomyces with bootstrap support (Figure 5-18). Similarly, a complete sequence of the SSU rDNA region of a member of the Patellariales was not available, and so we sequenced the gene from R rufulum. The phylogenetic placement of R. rufulum inferred in this study agreed with results of previous studies (Winka & Eriksson, 1998) and con-firmed the identity of our new sequence. A fragment of R. rufulum retrieved from GenBank (U20506) differed from ours in the overlapping region of 1046 bp in five (0.48%) sites, and another sequence (AF164375) differed from ours in 11 (1.03%) of the 1063 overlapping sites. The latter two fragments differed in 12 (1.15%) of the 1046 overlapping sites. As a comparison, Pleo-spora herbarum and Setosphaeria rostrata (Figure 5-18) differed in 0.36% of 1046 sites. 5.3.2.2 Phylogenetic analyses The new SSU rDNA sequences of A. khaoyaiensis, A. sunyatsenii, T. helicoma and R. rufulum were aligned with 30 sequences retrieved from GenBank, using Boletus satanas as an outgroup (Table 5-1). Hence, the data matrix contained 34 taxa and 1799 characters. The alignment was submitted to TreeBase. Am-biguous sites were excluded from analyses. These included 72 characters in the following positions: 35-39, 99-105, 141-160, 452-458, 1336-1361, 1484-1490. Of the remaining 1727 characters 1255 were constant, 211 of the variable characters were parsimony uninformative, and 261 were parsi-mony informative. Characters were weighted equally, gaps were ignored. Parsimony and likelihood trees inferred from a data matrix with ambigu-ous sites included were not significantly different from the analyses with am-160 biguous sites excluded, based on a Kishino-Hasegawa test (P > 0.05). How-ever, 88 MPTs were found (data not shown). For this reason, ambiguous sites were excluded in all the following analyses. In 30 heuristic searches using parsimony, two MPTs, each requiring 964 steps, were found (Consistency Index = 0.623, Retention Index = 0.661). The two MPTs differed in the arrangement of taxa within a clade of the Pleospo-rales: Leptosphaeria maculans appeared as sister taxon to either Septoria no-dorum or Cucurbitaria elongata. The overall tree topology agrees with results from other authors (Winka & Eriksson, 1998). The most likely MPT (-In likeli-hood = 8204) differed from the most likely tree in Figure 5-18 by the rear-rangement of branches receiving less than 50% bootstrap support: Chae-tomium elatum was sister taxon to the Chaetothyriales, the Lecanorales formed a sister group to the Peltigerales, and Aureobasidium pullulans, Do-thidea insculpta, Coccodinium bartschii, and Aliquandostipite were sister group to the remainder of the Dothideomycetes. The most likely tree of the two MPTs was used as the starting tree in a likelihood analysis, which yielded the same tree topology as 30 likelihood heu-ristic searches with taxa added by random stepwise addition. The most likely tree (-In likelihood = 8198) was 965 steps long, one step longer than the MPTs, and not significantly different from either MPT (P > 0.6). Clades sup-ported by at least 50% of the bootstrap replicates in either most likely tree or MPTs were present in both trees. Based on a Kishino-Hasegawa test, the Neighbor joining tree was signifi-cantly worse than the most likely tree (P < 0.05), and thus is not discussed here in detail. Clades with relevance in this study and high likelihood, parsimony, and Neighbor joining bootstrap support include: Pleosporales, with 99, 95, and 87% support in the respective analyses, Pleosporales and R. rufulum with 95, 89, and 58% support, species of Aliquandostipite with 100, 92, and 100% support, and species of Tubeufia with 91, 73, and 83% bootstrap support (Figure 5-18). In neither analysis did the Dothideales, i.e. Dothidea insculpta, Coccodinium bartschii, Aureobasidium pullulans, and species of Botryosphaeria receive support as a monophyletic group. The Dothideomycetes consisting of Pleosporales and Dothideales formed a monophyletic group in both parsimony and likelihood analyses, receiving the highest support in the likelihood analysis with 63% of the bootstrap replicates. The morphologically related taxa in Pleo-sporales, Patellariales, Tubeufiaceae, and species of Botryosphaeria formed a monophyletic group in all analyses, with a maximum bootstrap support of 58% in the likelihood analysis. Constraining species of Aliquandostipite to the Pleosporales, yielded four trees that were 11 steps longer than the MPTs and significantly worse than either one of them (P < 0.05), as evaluated by the Kishino-Hasegawa test. 161 5.4 . Discussion In the previous section, we gave evidence that the new species of Aliquan-dostipite have morphologically dimorphic ascomata within one species, that they are closely related based on morphological and molecular data, and dis-tant from their presumptive closest relatives based on morphology. In the following, we justify the inclusion of both new species in one ge-nus, the establishment of the new genus Aliquandostipite and the new family Aliquandostipitaceae. Finally, we show that the stalked and sessile ascomata present side by side on the substratum belong to the same species and dis-cuss another distinguishing feature of both new species, the unusually wide hyphae. 5.4.1.1 Two new congeneric species Molecular evidence for a close relationship of species of Aliquandostipite in-cluded the high support that their clade received in phylogenetic analyses of the SSU rDNA sequences using different methods. Both Neighbor joining and maximum likelihood clustered A. khaoyaiensis and A. sunyatsenii together with 100% bootstrap support (Figure 5-18). Bootstrap values obtained with parsi-mony support the Aliquandostipite clade with 92% (Figure 5-18). Morphologi-cal characters common to both species of Aliquandostipite were a light-colored, one-layered ascomal wall, downward-growing sterile filaments, func-tionally two-layered asci completely filled by ascospores at maturity, and one-septate, sheathed ascospores. The habitats and ecology of both species of Aliquandostipite were similar. They were found on old, decorticated branches in very humid and warm habitats: Aliquandostipite khaoyaiensis on branches lying on the ground of a tropical rain forest in Thailand, A. sunyatsenii on a branch immersed in a stream in subtropical southern China. Hence, morphological and ecological characters supported SSU rDNA data and indicated a close relationship of A. khaoyaiensis and A. sunyatsenii. Even though the ITS rDNA sequences of the species of Aliquandostipite were too different to be aligned, the inclusion of both species into one genus seemed most appropriate at present. 5.4.1.2 The new genus Aliquandostipite and new family Aliquandostipitaceae Species of Aliquandostipite did not group with any significant support with other taxa included in the phylogenetic analyses. In the most likely tree, the genus Aliquandostipite was sister group to the Dothideomycetes (Figure 5-18). The Dothideomycetes comprise fungi traditionally placed in the Do-thideales and Pleosporales. The morphological characters of species of Ali-quandostipite, the presence of bitunicate asci, and the presence of sterile filaments, both developing in a stroma, are consistent with a placement in the Dothideomycetes. 162 Except for the stalked ascomata, all morphological features of species of Aliquandostipite are encountered in the Pleosporales, the light-colored ascomal wall suggesting a possible affinity with the family Tubeufiaceae (M. E. Barr, personal communication, Sidney, British Columbia, Canada). In phylogenetic analyses, however, species of Aliquandostipite did not cluster within the Pleo-sporales. Rhytidhysteron rufulum in the Patellariales, appeared as sister taxon to the Pleosporales, excluding both Tubeufia and Aliquandostipite. The genera Tubeufia and Aliquandostipite were as similar to other filamentous ascomy-cetes as to one another, and did not form a monophyletic group (Figure 5-18). Constraining the genus Aliquandostipite to be within the Pleosporales, yielded significantly worse trees than the most parsimonious tree (P < 0.05). The Dothideales are defined morphologically by the absence of sterile filaments (Barr, 1987), and the presence of sterile filaments excludes Aliquan-dostipite from this group. In the likelihood analysis, the Dothideales did not cluster together (Figure 5-18). In the parsimony analysis, Aureobasidium pul-lulans, Dothidea insculpta, and Coccodinium bartschii of the Dothideales, and Aliquandostipite formed a monophyletic group without significant support. However, molecular data provided little support for membership of Aliquan-dostipite in the Dothideales, but poor resolution of branching order made a monophyletic relationship of Aliquandostipite and Dothideales impossible to exclude. Hence, the genus Aliquandostipite could neither be included in the Do-thideales nor in the Pleosporales. The lack of morphological and molecular af-finity to taxa known to us justified the establishment of the new family Ali-quandostipitaceae and the new genus Aliquandostipite for the two new species of A. khaoyaiensis and A. sunyatsenii. 5.4.1.3 Dimorphic ascomata and the widest hyphae in ascomycetes Besides the characters mentioned above, the new family Aliquandostipitaceae is supported by the presence in both species of two unique features, distin-guishing them from all other Euascomycetes. These are the widest hyphae re-ported in the ascomycetes and the formation of both sessile and stalked as-comata side by side on the substratum. Stalked ascomata are atypical among ascomycetes. In species of Ali-quandostipite, stalked and sessile ascomata are present side by side on the substratum. Stalked ascomata are rounded to elongate and lack the flattened base of the sessile, dome-shaped ascomata. The stalks originate either directly from the substratum (Figure 5-3) or from a superficial hypha (Figure 5-7). In A. sunyatsenii, superficial hyphae were observed to be connected to sessile ascomata as well. Hence, both stalked and sessile ascomata may have issued from the same mycelium. This situation is identical to what is encountered in 163 culture: Single ascospore isolates from sessile ascomata of A. khaoyaiensis produced both sessile and stalked ascomata. Microscopic features of the centrum tissue and ascomal wall in stalked and sessile ascomata vary only to a degree to be expected within one species. In A. khaoyaiensis, the ascospores of both stalked and sessile ascomata are nearly identical in size and the dimensions of the asci clearly overlap, being on average 12% longer and 14% narrower in the sessile than in the stalked asco-mata. In A. sunyatsenii, dimensions of asci and ascospores overlap as well, and their means are very close. A more detailed comparison is not possible, be-cause of the fact that only few asci and ascospores from one stalked asco-mata could be measured. Vertical sections of stalked and sessile ascomata in A. khaoyaiensis show the same type of sterile filaments, which are apically at-tached and seem to have grown downwards (Figure 5-4 - Figure 5-6, Figure 5-8). The ascomal wall is one-layered and light colored, and the constituting cells are largest at the exterior of the ascoma, and diminish in size towards the inside. Some of the outermost cells in sessile ascomata of A. khaoyaiensis and A. sunyatsenii were observed to protrude up to 13 pm above the surrounding cells (Figure 5-9, Figure 5-14). This was not observed in stalked ascomata of A. khaoyaiensis. In A. sunyatsenii, stalked ascomata were not sectioned. Species of Aliquandostipite produce the widest hyphae of any known as-comycete. The ascomal stalks, which are single hyphae, are up to 50 pm wide and 1.6 mm long. This is five times wider than the widest hyphae previously reported in the ascomycetes. So far, the widest hyphae in lignicolous ascomy-cetes were known from species in the genus Botryosphaeria, reaching a width of 10 pm (M. E. Barr, personal communication, Sidney, British Columbia, Can-ada). In the lignicolous genus Wolfiporia of the basidiomycetes, hyphae may in rare cases reach a width of 20 pm (L. Ryvarden, personal communication, Uni-versity of Oslo, Norway). In lamellae of certain Basidiomycetes, 30 pm wide hyphae are possible (H. Clemengon, personal communication, University of Lausanne, Switzerland). The results of this study are surprising, in that two short surveys in geographically distant localities yielded two new, closely related species that cannot be placed in a known family. We hope these results will encourage fur-ther study of fungal diversity in little explored areas of the world. 164 Table 5-1. Fungal species and GenBank accession numbers for S S U r D N A sequences from GenBank used i n phylogenetic analyses. O r d i n a l classification used i n this paper following B a r r (1987), and Er iksson and W i n k a (1998). Supraordinal classification fol-lows Er iksson and W i n k a (1998). Species Accession Orde r Class Aspergillus fumigatus Fresen. M60300 Eurotiales Eurotiomycetes Aureobasidium pullulans (de Bary) G . Arnaud M55639 Dothideales Dothideomycetes Boletus satanas Lenz M94337 Boletales -Botryosphaeria rhodina (Berk. & Curtis) Arx U42476 Dothideales Dothideomycetes Botryosphaeria ribis Grossenb. & Dug-gar U42477 Dothideales Dothideomycetes Bulgaria inquinans Fries AJ224362 Leotiales Leotiomycetes Capronia mansonii (Schol-Schwarz) Mueller & al. X79318 Chaetothyriales Chaetothyriomycetes Ceramothyrium linnaeae (Dearness) Hughes AF022715 Chaetothyriales Chaetothyriomycetes Chaetomium elatum Kunze M83257 Sordariales Sordariomycetes Coccodinium bartschii A . Massal. U77668 Dothideales Dothideomycetes Cucurbidothis pityophila (Schmidt & Kunze) Petrak U42480 Pleosporales Dothideomycetes Cucurbitaria elongata (Fr.) Grev. U42482 Pleosporales Dothideomycetes Dothidea insculpta Wallr . U42474 Dothideales Dothideomycetes Eurotium rubrum Koenig & al. U00970 Eurotiales Eurotiomycetes Lecanora dispersa (Pers.) Sommerf. L37535 Lecanorales Lecanoromycetes Leptosphaeria maculans (Des.) Ces. & de Not. U04233 Pleosporales Dothideomycetes Lophiostoma crenatum (Pers.) Fuckel U42485 Pleosporales Dothideomycetes Malbranchea filamentosa Sigler & Carmichael L28065 Onygenales Eurotiomycetes Monodictys castaneae (Wallr.) Hughes Y11715 Pleosporales Dothideomycetes Morchella elata Fries U42641 Pezizales Pezizomycetes Pleospora herbarum (Pers.) Rabenh. U05201 Pleosporales Dothideomycetes Pleospora rudis Berl . U00975 Pleosporales Dothideomycetes Peltigera neopolydactyla (Gyeln.) Gyeln. X89218 Peltigerales Lecanoromycetes Septoria nodorum E . Mul ler U04236 Pleosporales Dothideomycetes Setosphaeria rostrata Leonard U42487 Pleosporales Dothideomycetes Sphaerophorus globosus (Huds.) Vain . L37532 Lecanorales Lecanoromycetes Solorina crocea (L.) A c h . X89220 Peltigerales Lecanoromycetes Tubeufia helicomyces von Hohnel L35296 Pleosporales Dothideomycetes Uncinocarpus reesii Sigler & Orr L27991 Onygenales Eurotiomycetes Westerdykella dispersa (Clum) Cejp & M i l k o U42488 Pleosporales Dothideomycetes 165 Stalked ascomata and hyphae of Aliquandostipite khaoyaiensis. Features of stalked asco-mata and wide hyphae. Figure 5-1. Stalked ascomata on substrate. Figure 5-2. M y c e l i u m on the substrate. Note thick, branching hyphae. Figure 5-3. Cluster of stalks bearing ascomata. Figure 5-4. Ver t i ca l cryosection of stalked ascomata mounted i n glycerol. Figure 5-5. Ver t ica l cryosection of basal section of stalked ascomata mounted i n glycerol. Note the stalk formed by a single hypha with thick, refractive walls, and the widening apical segment of the stalk merging with the ascomal wal l . Figure 5-6. Ver t i ca l cryosection of apical section of stalked ascomata mounted i n glycerol. Note papi l la and apically attached, branched and septate sterile filaments. F igure 5-7. Squash mount i n glycerol of superficial hypha bearing an ascoma on a lateral branch. Scale bars: Figure 5-1, Figure 5-3 = 0.5 m m , Figure 5-2, Figure 5-4, Figure 5-7 = 100 u m , Figure 5-5, Figure 5-6 = 50 um. Figure 5-1 - Figure 5-3 i n brightfield wi th stereomicro-scope, Figure 5-4 - Figure 5-6 i n Nomarsk i inference contrast, F igure 5-7 i n phase con-trast. 166 167 Sessile ascomata, asci and ascospores of Aliquandostipite khaoyaiensis. Figure 5-8. Ver t i ca l cryosections of sessile dome-shaped sessile ascoma wi th flattened base, mounted i n glycerol. Figure 5-9. Ver t i ca l cryosections of apical section of sessile ascomata wi th papi l la and pro-truding ascomal wal l cell (arrow), mounted i n glycerol. F igure 5-10. Superficial view of ascomal wal l . Note the light-colored, thick-walled cells, mounted i n glycerol. F igure 5-11. Ascus and sterile filaments. Squash mount i n glycerol. F igure 5-12. Ascospores with detaching sheath. Note the appressed sheath (arrow) i n the equatorial region, detaching towards the poles. Squash mount i n glycerol. Figure 5-13. Ascospore i n water wi th completely detached sheath. Scale bars: Figure 5-8 = 100 p.m, Figure 5-9 - Figure 5-13 = 10 um. Figure 5-8 - Figure 5-13 i n Nomarsk i inference contrast. 168 169 Ascomata, asci and ascospores of Aliquandostipite sunyatsenii mounted i n glycerol. Figure 5-14. Ver t i ca l cryosection of ascoma. Note rounded ascoma, large prot ruding cells of ascomal wa l l , and dark cells at basal ascomal wal l . Figure 5-15. Squash mount of superficial hypae wi th stalked ascoma. Stalked, elongate ascoma liberating asci and ascospores, superficial hyphae of different sizes, presumptive ascoma-primordia borne by a thin hypha. Figure 5-16. Ascus completely filled by ascospores. Figure 5-17. Ascospores. Note polar, none-detaching appendages. Scale bars: Figure 5-14, Figure 5-15 = 100pm, Figure 5-16, Figure 5-17 = 10 pm. Figure 5-14 - Figure 5-17 i n Nomarsk i inference contrast. 170 171 Figure 5-18. Mos t l ikely tree (-In l ikel ihood = 8198). Bootstrap support percentages are shown above the branches. The first numbers are l ikelihood bootstrap percentages based on 100 replicates, and the second numbers are parsimony bootstrap percentages based on 500 replicates. O n l y bootstrap percentages higher than 50% i n both analyses were i n -cluded. F o r groups relevant to this study, bootstrap percentages are given i n boldface and Neighbor jo in ing bootstrap percentages (based on 500 replicates) are given last i n the se-ries of numbers. Branches of Dothideomycetes and Patellariales are i n boldface. Species for which new sequences were obtained are also i n boldface. Note the well-supported clades of Aliquandostipite spp. and Tubeufia spp., clustering outside the clade comprising Rhytidhysteron rufulum and Pleosporales. 172 Boletus satanas 76/55 Morchella elata inquinans 100/100 100/100 Aspergillus fumigatus Eurotium rubrum 99/100 Malbranchea filamentosa I Pezizales I Helotiales Eurotiales 100/100 Uncinocarpus reesii Ceramothyrium linnaeae Capronia mansonii Chaetomium elatum 100/100 BO/56 •fZ Peltigera neopolydactyla - Solorina crocea Sphaerophorus globosus - Lecanora dispersa |—— Rhytidhysteron rufulum loo/loo r~* 95/89/59 50/58 85/87 99/95/88 Pleospora herbarum Setosphaeria rostrata n61^- CL 72 Leptosphaeria maculans Septoria nodorum ucurbitaria elongata Pleospora rudis Cucurbidothis pityophila Westerdykella dispersa Monodictys castaneae 57/54 Lophiostoma crenatum 91/73/881 Tubeufia helicoma * Tubeufia helicomyces Botryosphaeria rhodina Chaetothyriales i Microascales j Peltigerales Lecanorales Patel lar ia les P l e o s p o r a l e s 10 changes Botryosphaeria ribis Coccodinium bartschii — Dothidea insculpta - Aureobasidium pullulans 10092/100 T Aliquandostipite khaoyaiensis Aliquandostipite sunyatsenii T u b e u f i a c e a e D o t h i d e a l e s A l i q u a n d o s t i p i t a c e a e 173 5.5. Bibliography B a r r , M . E . (1987). Prodromus to class Loculoascomycetes. Amherst, Massachusetts: Pub-lished by the author. Er iksson , O . E . & Y u e , J.-z. (1988). The Pyrenomycetes of China, an annotated checklist. Umea: University of Umea. Er iksson , O . E . & W i n k a , K . (1998). Families and higher taxa of Ascomycota. Myconet 1,17-24. Gargas, A . & Taylor , J . W . (1992). Polymerase Chain Reaction (PCR) primers for amplifying and sequencing nuclear 18S r D N A from lichenized fungi. Mycologia 84, 589-592. Hawkswor th , D . L . (1991). The fungal dimension of biodiversity: Magnitude, significance, and conservation. Mycological Research 95, 641-655. Hawkswor th , D . L . , K i r k , P . M . , Sutton, B . C . & Pegler, D . N . (1995). Dictionary of the Fungi, 8 edn. Wallingford, Oxon, U K : C A B International. Hawkswor th , D . L . , M i n t e r , D . W . , Kinsey , G . C . & Cannon, P . F . (1997). Inventorying a tropical fungal biota: intensive and extensive approaches. In Tropical Mycology, pp. 29-50. Edited by K . K . Janardhanan, C . Rajendran, K . Natarajan & D . L . Hawksworth. En-field, New Hamphshire: Science Publishers, Inc. L a n d v i k , S. (1996).Phylogenetic r D N A studies of Discomycetes (Ascomycota): Department of Ecological Botany, Umea University. Rambaut , A . (1995). Se-Al vl.dl, Version 1.0 alpha edn. Oxford, U . K : Department of Zool -ogy, University of Oxford. Subramanian, C . V . & Sekar, G . (1990). Coronophorales from India - A Monograph. Kavaka 18,19-90. Swofford, D . L . (2000).PAUP*. Phylogenetic analysis using parsimony (*and other methods). Sunderland, Massachusetts: Sinauer Associates. T a i , F . L . (1979). Sylloge Fungorum Sinicorum. Beijing: Science Press, Academia Sinica. Whi te , T . J . , Bruns , T. , Lee, S. & Taylor , J . (1990). Amplification and direct sequencing of fungal ribosomal R N A genes for phylogenetics. In PCR Protocols, pp. 315-322. Edited by M . A . Innis, D . H . Gelfand, J. J. Sninsky & T. J. White. San Diego: Academic Press, Inc. W i n k a , K . & Er iksson , O . E . (1998). Molecular evidence for recognizing the Chaetothyriales. Mycologia 90, 822-830. 174 CHAPTER 6. Conclusion The research presented in this thesis contributes to the knowledge of ascomy-cete diversity in the genus Pleospora and the new family Aliquandostipitaceae, both in the class Dothideomycetes. In the concluding statement, the thesis re-sults are discussed in relation to each other and to the field of study, and fur-ther research is suggested. 6 . 1 . Pleospora: Generic delimitation, phylogenetics and mating sys-tem evolution The main part of this thesis was centered on the investigation of mating sys-tem evolution in Pleospora. This required a well-supported phylogeny, restric-tion of the genus Pleospora to isolates with the Stemphylium asexual state, and the delimitation of 22 phylogenetic species. Subsequently, the sex regu-lating master locus MAT that contains the mating type idiomorphs was cloned from Pleospora and used for phylogenetic analyses as well as structural analy-ses. The combined evidence from all data led to the conclusion that homothal-lism in Pleospora is polyphyletic with three independent evolutionary origins. 6.1.1 Generic delimitation and phylogenetics of Pleospora sensu stricto Pleospora is a vast and polyphyletic genus (Crivelli, 1983; Holm, 1962). Camara et al. (2002) showed that the type species of Pleospora, P. herbarum, formed a monophyletic group with other Pleospora species that have a Stem-phylium asexual state, together constituting Pleospora sensu stricto. These re-sults were confirmed in chapter 3 with MAT protein analyses. In chapter 4 I contributed to the monophyly of Pleospora by removing the marine species P. gaudefroyi that lacks a sexual state, to the new genus Decorospora. Chapters 2 and 3 dealt with the phylogenetic relationships within Pleo-spora sensu stricto. My results confirmed the phylogenetic findings by Camara et al. (2002), generally increased the statistical support of the tree nodes, and revealed the relationships of additional species that were not included in the Camara et al. (2002) study. The sampling of Pleospora strains used in this thesis was biased towards examination of the delimitation of the type species of Pleospora, P. herbarum. Camara et al. (2002) found that P. herbarum could not be distinguished from closely related morphological species based on phylogenetic analyses of two loci. The studies in chapter 2 with four loci confirmed their results. 6.1.1.1 Further research A considerable amount of work remains necessary for a complete phylogenetic and taxonomic treatment of Pleospora. The hypothesis of the delimitation of Pleospora sensu stricto as a monophyletic group characterized by the Stem-phylium asexual state has to be confirmed through study of additional species, 176 and all Pleospora species that do not fall into this group have to be placed in appropriate alternative genera. Wehmeyer's (1961) slide collection from his monographic work on Pleospora could serve as backbone and starting point for further morphological study. Fresh collections of additional Stemphylium spe-cies are needed for molecular investigations. The phylogenetic species of Pleospora sensu stricto obtained in chapter 2 have to be reexamined. All but the phylogenetic species P. herbarum con-tained fewer than ten isolates. Of the 22 recognized phylogenetic species, 18 contained fewer than five isolates. Thus, to prove a history of genetic isolation for all phylogenetic species, more research with a larger sample size is neces-sary, as for example in Kroken & Taylor (2001). Gene flow within the phylogenetic species P. herbarum remains an issue. Pleospora herbarum is the type species of Pleospora, and its phylogenetic spe-cies contains several described morphological species. Whether these all fall within one phylogenetic species, sharing a very recent history of sexual repro-duction and gene flow could be tested with a population genetics approach, for example using RFLP markers. This was done by Zhan et al. (2003) where a regularly recombining population structure was detected in the outcrosser My-cosphaerella graminicola (Fuckel) Schroeter based on a sample size of 1673 strains. 6.1.2 The divergent protein-encoding intron in EF-1 alpha The gene EF-1 alpha of which intron and exon DNA sequences were used for phylogenetic analyses, contained an unusual intron in the phylogenetic species S. lancipes, S. trifolii and Stemphylium sp. strain P246. The intron in these three phylogenetic species was distinct from all other introns found in this study. It was up to 1678 bp long, more than 1400 bp longer than in other Pleospora isolates, encoded a protein and was delimited at the 5'-end by the non-canonical splice site GGT instead of GT. The ORF encoded by the introns of all three species was most similar to a hypothetical zinc-finger protein from the filamentous ascomycete Gibberella zeae. Non-canonical, 5'-GGT splice sites have not been reported in fungi before. 6.1.2.1 Further research In case of experimental verification, the long, EF-1 alpha introns in the phylo-genetic species S. lancipes, S. trifolii and Stemphylium sp. strain P246 could be the first 'parasitic' splice sites in fungi (Burset et al., 2000). Similar 'parasitic' splice sites were also found in EF-1 alpha of the divergent Pleospora species P. papaveracea, but were not confirmed experimentally (Inderbitzin, O'Neill, Shoemaker and Berbee, unpublished). To prove involvement of these putative fungal 'parasitic' intron splice sites in mRNA maturation, absence of the re-1 7 7 spective introns in EF-1 alpha mRNA could be assayed by PCR amplification of a cDNA library using specific primers. 6.1.3 Mating system evolution in Pleospora sensu stricto, in the following re-ferred to as Pleospora Combined evidence from the species phylogeny in chapters 2 and mating type evidence from chapter 3, led to the conclusion that the three groups of ho-mothallics in Pleospora evolved in three different ways. One homothallic line-age evolved by fusion of the MAT1-1 and MAT1-2 loci, a second homothallic clade originated by horizontal transfer of the fused MAT locus, and a third ori-gin resulted in a clade of homothallics with only a single detectable forward-pointing MAT1-1 idiomorph. The evolution of homothallism by horizontal trans-fer as in Pleospora has never been reported before. Throughout chapter 3, the mating system in Pleospora was compared to the one in Cochliobolus that is in the same family as Pleospora. Unlike Pleo-spora, Cochliobolus homothallics evolved repeatedly and independently from heterothallics, by the inclusion of both MAT loci within one genome (Yun et al., 1999). A recent study of the B trichothecene-producing clade of Fusarium found that, unlike Cochliobolus and Pleospora, all homothallics of this group evolved once from heterothallics (O'Donnell et al., 2004). This was supported by the fact that all homothallics shared the same fused MAT locus arrange-ment. 6.1.3.1 Further research Mating system evolution should be investigated in other ascomycete groups. The Nectria haematococca-Fusarium solani species complex and the two in-termingled genera Neurospora and Gelasinospora would be appropriate sub-jects for studies of mating type gene evolution because MAT locus sequences are available for some species in each group. The phylogenetic distribution of homothallics in the Nectria haemato-cocca-Fusarium solani species complex is discontinuous (O'Donnell, 2000), as in Pleospora or Cochliobolus. Examination of the MAT locus and phylogenetic analyses would be necessary in this case to decide if the discontinuous distri-bution is due to vertical or lateral transfer. The two intermixed genera Neurospora and Gelasinospora also contain both heterothallics and homothallics (Dettman etal., 2001). A broader taxon sampling, clarification of generic limits, and additional structural information about the MAT loci would be needed to determine mating system evolution in this case. Pleospora represents an ideal genus in which to investigate the effects of different mating systems on genetic structure of populations and species. 178 Pleospora contains three homothallic mating systems, each of which evolved independently from a heterothallic system. Using population genetics ap-proaches, some of the questions that can be addressed are as follows. The homothallic Gibberella zeae (Schwein.) Petch can outcross (Bowden & Leslie, 1999). Do homothallics of Pleospora outcross, and how does the outcrossing rate compare to closely related heterothallics? In Pleospora, Cochliobolus and the B trichothecene-producing clade of Fusarium, homothallics are derived from heterothallics. Does the genetic structure of homothallic fungal popula-tions differ from the ones of heterothallic close relatives? The homothallic phylogenetic species P. herbarum has a global distribu-tion, including the campus of the University of British Columbia (Stemphylium sp. strain P301, see Table 2-2). This distribution would allow for an assess-ment of the genetic structure at different levels, from populations to conti-nents. Genetic structures of heterothallic Pleospora species could also be de-termined, and compared to homothallic genetic structures for different levels. To assess the importance of outcrossing and other evolutionary forces to the population structure of heterothallics and homothallics, mark-release-recapture experiments can be done in conjunction with computer simulations (Zhan & McDonald, 2004). 6.2. The new family Aliquandostipitaceae Chapter 5 of my thesis is a morphological and phylogenetic study of two new species from Thailand and China (Inderbitzin et al., 2001). This chapter is linked to the previous ones in that it investigated questions of diversity and evolution, but in a more fundamental sense. Whereas the genus Pleospora was described and well-known prior to the beginning of my studies, morphological features present in Aliquandostipite had never been reported in the ascomy-cetes. Characters reported for the first time for Aliquandostipite included the dimorphic fruitbodies with both morphological types side by side on the sub-strate, and the widest hyphae ever reported in ascomycetes. The overall mor-phological features were of the order Pleosporales. However, phylogenetic analyses showed that species of Aliquandostipite did not belong to the Pleo-sporales, but represented a previously unknown in the class Dothideomycetes. Because of the phylogenetic placement and the novel morphological features, the two new species were placed in the new family Aliquandostipitaceae. After the publication of the manuscript reprinted in chapter 5, Pang et al. (2002) showed that Aliquandostipite was related to fungi in the genus Jah-nula. Reinterpretation of the Jahnula morphology showed that it also contained the fruitbody dimorphism and the wide hyphae of the Aliquandostipitaceae. Pang et al. (2002) showed in phylogenetic analyses that one species of Aliquandostipite, A. sunyatsenii, was more closely related to species with mor-179 phological similarity to the type of Jahnula, than to the type of Aliquan-dostipite. Thus, they transferred A. sunyatsenii to Jahnula. 6.2.1 Further research Jahnula and Aliquandostipite are ideal genera for a study of phylogenetic sig-nificance of morphological characters. Unlike Pleospora for example, they con-tain a considerable amount of morphological diversity that can be used for taxonomic purposes. Morphological variation occurs in the shape of the asci, presence of an apical ring and an ocular chamber in the ascus apex, ascospore shape and color, ascospore appendage type, presence of both stalked and sessile ascomata and several apomorphic morphological characters (Hyde, 1999; Inderbitzin etal., 2001; Pang etal., 2002). A comprehensive study addressing the taxonomic confusion in the two genera would be fruitful at this point. The study should include morphological and phylogenetic analyses of at least the type specimens of both genera, to-gether with additional species to represent the morphological diversity of the entire group. Protein coding genes, in addition to ribosomal genes, could pro-vide additional phylogenetic resolution. 6.3. Bibliography Bowden, R . L . & Leslie, J . F. (1999). Sexual recombination in Gibberella zeae. Phytopathol-ogy 89,182-188. Burset, M . , Seledtsov, I. A . & Solovyev, V . V . (2000). Analysis of canonical and non-canonical splice sites in mammalian genomes. Nucleic Acids Research 28, 4364-4375. Camara , M . P . S., O ' N e i l l , N . R . & B e r k u m , v., P (2002). Phylogeny of Stemphylium spp. based on ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycolo-gia 94, 660-672. C r i v e l l i , P . G . (1983). Uber die heterogene Ascomycetengattung Pleospora Rabenh.; Vorschlag fur eine Aufteilung. Ph.D. thesis. Eidgenossische Technische Hochschule, Zurich, Switzerland. Dettman, J . R . , Ha rb insk i , F. M . & Taylor , J . W . (2001). Ascospore morphology is a poor predictor of the phylogenetic relationships of Neurospora and Gelasinospora. Fungal Genetics and Biology 34,49-61. H o l m , L . (1962). Lewis E. Wehmeyer, a world monograph of the genus Pleospora and its seg-regates. Svensk Botanisk Tidskrift 56, 377-381. Hyde, K . D . (1999). Tropical Australian Freshwater Fungi. XV. The ascomycete genus Jah-nula, with five new species and one new combination. Nova Hedwigia 68, 489-509. Inderbitzin, P . , L a n d v i k , S., Abde l -Wahab , M . A . & Berbee, M . L . (2001). Aliquandostipi-taceae, a new family for two new tropical ascomycetes with unusually wide hyphae and dimorphic ascomata. American Journal of Botany 88, 52-61. K r o k e n , S. & Taylor , J . W . (2001). A gene genealogical approach to recognize phylogenetic species boundaries in the lichenized fungus Letharia. Mycologia 93, 38-53. O 'Donnel l , K . (2000). Molecular phylogeny of the Nectria haematococca-Fusarium solani species complex. Mycologia 92,919-938. 180 O'Donnell, K., Ward, T. J., Geiser, D. M., Kistler, H. C. & Aoki, T. (2004). Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genetics and Biology 41, 600-623. Pang, K.-L., Abdel-Wahab, M. A., Sivichai, S., El-Sharouney, H. M. & Jones, E. B. G. (2002). Jahnulales (Dothideomycetes, Ascomycota): a new order of lignicolous fresh-water ascomycetes. Mycological Research 106, 1031-1042. Wehmeyer, L. E. (1961). A world monograph of the genus Pleospora and its segregates. Ann Arbor: The University of Michigan Press. Yun, S. H., Berbee, M. L., Yoder, O. C. & Turgeon, G. (1999). Evolution of fungal self-fertile reproductive life style from self-sterile ancestors. Proceedings of the National Academy of Sciences of the USA 96, 5592-5597. Zhan, J. & McDonald, B. A. (2004). The interaction among evolutionary forces in the patho-genic fungus Mycosphaerella graminicola. Fungal Genetics and Biology 41, 590-599. Zhan, J., Pettway, R. E. & McDonald, B. A. (2003). The global genetic structure of the wheat pathogen Mycosphaerella graminicola is characterized by high nuclear diversity, low mitochondrial diversity, regular recombination, and gene flow. Fungal Genetics and Biology 38, 286-297. 181 CHAPTER 7. Appendices 7.1. DNA, PCR and sequencing 7.1.1 DNA extraction, purification and quantification The DNA extraction, purification and quantification protocols given below were used in this thesis. Only for chromosome walking, DNA was purified by removal of RNA, and the DNA concentration was measured. Otherwise, the unpurified DNA extract was used directly for PCR, diluted ten or 100 times. DNA extraction was based on Lee & Taylor (1990) with modifications suggested by M. Berbee and S. Landvik (personal communications). DNA puri-fication and measurement was based on a Qiagen Inc. handbook (Anonymous, 2000), and a Spectral Genomics Inc. protocol (Anonymous, 2002a). 7.1.1.1 Reagents for DNA extraction - DNA extraction buffer: 50 mM Tris-HCI (pH 7.2), 50 mM EDTA, 3% SDS, with 1% beta-mercaptoethanol added just before extraction. - Phenol : Chloroform = 1:1. - Chloroform. - Sodium acetate 3 M, pH 8.0. - Isopropanol. - Ethanol 70%. - TE buffer with low EDTA concentration: 10 mM Tris-HCI, 0.1 mM EDTA pH 8.0. Liquid nitrogen if needed. 7.1.1.2 Additional reagent for DNA purification RNase A stock solution (100 mg/ml) from Qiagen DNeasy Plant Mini Kit (Qiagen Inc., Mississauga, ON, Canada). 7.1.1.3 Preparation of fungal material for DNA extraction The DNA extraction protocol consisted of two main parts. Preparation of the material and extraction of the nucleic acids, DNA plus RNA. Preparation for ex-traction depended on the kind of material and the desired quantity of DNA re-quired. 7.1.1.3.1 Fresh mycelium and small amounts of herbarium material Step 1. Mycelium was scraped off a Petri dish with a spatula, deposited into 30 pi lysis buffer in a 1.5 ml-Eppendorf tube and ground with a few turns of a micropestle treated with HCI. Step 2. 670 pi lysis buffer were added and the Eppendorf tube incu-bated at 65°C for one hour. Step 3. Tube was stored in freezer or directly used in DNA extraction in step 4, see below. 183 7.1.1.3.2 Lyophilized fungal material for high DNA yield Step 1. Fungi were grown in liquid culture on a shaker. The harvested mycelium was filtered, rinsed with distilled water, frozen in liquid nitrogen and lyophilized without delay. Mycelial pellets of ca. 1 cm3 required two days for completion of lyophilization. Lyophilized material was stored in airtight con-tainers. Step 2. Lyophilized mycelium was ground in liquid nitrogen with pre-chilled mortar and pestle. Ground mycelium was added to a 1.5 ml-Eppendorf tube, up to one third of the conical portion (20 to 60 mg). 700 pl of lysis buffer was added, homogenized by vortexing and incubated at 65^ 0 for one hour. Step 3. Tube was stored in the freezer or directly used in DNA extrac-tion in step 4, see below. Remaining powdered mycelium was stored in airtight container. 7.1.1.4 Extraction of nucleic acids Step 4. To Eppendorf tube, 700 pl of phenol : chloroform = 1:1 was added, homogenized by vortexing, and spun in a microcentrifuge for 15 min-utes. Step 5. A maximal volume of supernatant was transferred to a new tube containing an equal volume of chloroform, homogenized by vortexing and spun in a microcentrifuge for 15 minutes. Step 6. A maximal volume of supernatant (y pl) was transferred to a new tube, preferably a tube with a non-sticky inner surface (e. g. Eppendorf Flex-Tubes 1.5 mL, distributed by Brinkmann Instruments Ltd., Mississauga, ON, Canada). 10 pl of 3 M sodium acetate (pH 8.0) was added, followed by y pl times 0.54 isopropanol (see below) and gently homogenized by inversion of the tube. For herbarium material, tube was placed in a freezer over night for precipitation (Ristaino etal., 2001). For non-problematic materials, this step was omitted, and tubes were directly spun in a microcentrifuge for 2 minutes. The isopropanol was carefully removed by pipetting without disturbing the pellet. For y pl of supernatant, the following amounts of isopropanol were used: y = 300 pl isopropanol = 162 pl y = 350 pl isopropanol = 189 pl y = 400 pl isopropanol = 216 pl y = 450 pl isopropanol = 243 pl y = 500 pl isopropanol = 270 pl y = 550 pl isopropanol = 297 pl y = 600 pl isopropanol = 324 pl Step 7. 700 pl 70% ethanol was added, gently inverted to mix and spun in a microcentrifuge for 2 minutes. 1 8 4 Step 8. As much liquid as possible was removed by slowly pipetting it out using a small pipette tip. The pellet was dried at room temperature for 5-10 minutes, overdrying was avoided. Step 9. If DNA was intended for PCR amplification, 200 pi of TE buffer was added and incubated at 65°C for one hour to resuspend DNA. If DNA was to be purified, 700 pi of TE buffer was added. 7.1.1.5 Removal of RNA RNA was only removed when the DNA was used for chromosome walking, in order to measure the concentration of DNA with a spectrophotometer. Step 10. Per 100 pi of nucleic acid extract, 1 pi of RNase A stock solu-tion (100 mg/ml) from Qiagen DNeasy Plant Mini Kit (Qiagen Inc., Mississauga, ON, Canada) was added, aiming for a final RNase concentration of 1 mg/ml. The tube was then slowly turned end-over-end by hand for a while to homoge-nize, and incubated 30 minutes at 37°C. Then steps 4-9 were followed, except that the solutions were mixed gently by hand, DNA was left to precipitate for 15 minutes at room temperature after addition of sodium acetate and DNA was suspended in 100 pi of TE buffer by gentle pipetting prior to measuring the DNA concentration. 7.1.1.6 Measuring of extracted DNA concentration Step 11. Serial dilutions from RNase treated DNA stock were made. Spectrophotometer readings had to fall between 0.1 and 1.0 to be accurate. An absorbency of 1.0 at 260 nm corresponded to 50 pg of DNA/ml. Pure DNA had a A260/A280 ratio of 1.7-1.9. After measurement, two to 10 pi of DNA were electrophoresed on an agarose gel. Non-degraded, ethydium bromide stained DNA was visible under UV light as a wide band in the upper part of the DNA ladder. If the DNA was degraded, the band was less distinct, and there was a smear towards the bottom of the DNA ladder. Contaminating RNA was visible as a smear with highest intensity in the bottom part of the DNA ladder (ca. 100-500 bp). 7.1.2 Preparation of PCR reactions PCR amplifications were done in 25 pi final reaction volumes, including 12.5 pi of DNA extract using ReadyToGo PCR Beads, or puReTaq Ready-To-Go PCR Beads (Amersham Biosciences, Piscataway, NJ, USA), following the manufac-turer's instructions, or self-prepared master mix with GIBCO BRL Taq DNA po-lymerase (Life Technologies, Inc., Gaithersburg, MD) (dNTP 0.2 mM each, primer 0.5 uM each, MgCI 0.75 mM, Taq 0.625 units per reaction, enzyme buffer). 185 7.1.3 Electrophoresis of PCR products 4 pl PCR product was separated by electrophoresis in TAE running buffer (0.1 M Tris, 12.5 mM sodium acetate, 1 mM EDTA, pH8.1) on a 1% agarose gels (SeaKem GTG agarose, Cambrex Bio Science Walkersville, Inc, Walkersville, MD, USA) and stained in an ethydium bromide solution for 15 minutes (from 10 mg/ml ethydium bromide stock, 10 pl were added to distilled water tray hold-ing one gel). For small PCR products below 400 bp in length, 3% agarose gels formu-lated to resolve small bands were used. The 3% gels containing one third SeaKem GTG agarose (Cambrex Bio Science Walkersville, Inc, Walkersville, MD, USA) and two thirds NuSieve GTP agarose (FMC Bioproducts, Rockland, ME, USA), a low-melting agarose. 7.1.4 Reamplification of weak PCR bands Weak PCR bands were cut out of the gel with a razor blade under UV illumina-tion, melted in 50 pl TE buffer (2 min at 95°C), diluted 10 and 100 times, and reamplified with the initial PCR primers or internal primers, with ca. 3°C higher annealing temperature. 7.1.5 Precipitation of PCR products For DNA sequencing, PCR products were cleaned by sodium acetate - ethanol precipitation. To a 1.5 ml-Eppendorf centrifuge tube with non-stick inner sur-face, 2 pl of sodium acetate (3 M, pH 4.5) were added, followed by the re-maining 21 pl of PCR product and 57.5 pl 95% ethanol, and mixed by vortex-ing. The tube was placed directly on ice in the freezer for 20 minutes, followed by a 10-minute spin in the microcentrifuge. The liquid was removed by pipet-ting using a tip with small opening, without touching the pellet. To remove ex-cess sodium acetate, 700 pl of 75% ethanol were added, the tube gently in-verted to mix and spun in the centrifuge for 5 minutes. All ethanol was re-moved by pipetting, and the pellet dried under vacuum in a speed vac for 5 minutes. The pellet was resuspended in 12 pl of PCR quality water at room temperature. To concentrate PCR products, several PCR reactions were pooled for precipitation, with sodium acetate and 95% ethanol adjusted accordingly. 7.1.6 Measuring of PCR product concentrations To give accurate measurements of DNA concentration, the spectrophotometer reading had to fall within 0.1 and 1.0. By addition of 5 pl purified PCR product to 95 pl of water, a spec reading of at least 0.150 could be expected. This corresponded to 150 ng/pl of DNA (DNA concentration = spec reading x dilu-tion x 50). 186 7.1.7 Preparation of DNA sequencing reactions Sequencing reactions had a final volume of 20 pi, consisting of 4 pi Big Dye Terminator Cycle Sequencing Kit v2.0 or 3.0 (Applied Biosystems, Foster City, CA, USA), 3 pi primer (1 uM) and 13 pi PCR product adjusted to 10 ng/pl DNA. A quick centrifuge spin was used for homogenization. 7.1.8 Precipitation of DNA sequencing products and DNA sequence determina-tion To each sequencing reaction, 2 pi sodium acetate (3 M, pH 4.5) and 50 pi 95% ethanol were added, and precipitated at room temperature for 15 min-utes. The remainder was as for PCR products. The dried pellet was stored in the freezer until DNA sequence determination by the Nucleic Acids Protein Services (NAPS) Unit of the University of British Columbia. 7 .2. Chromosome walking For chromosome walking, DNA extracted from lyophilized mycelium and puri-fied by RNase treatment was used. However, Sara Landvik was successful with DNA extracted from wet mycelium, without RNase treatment (S. Landvik, per-sonal communication). The DNA was digested, and adapters for primer sites were then ligated to the digested DNA. The following protocols are slightly modified after the original Vectorette chromosome walking protocol (Anonymous, 2002b). 7.2.1 Restriction enzyme digest of DNA To a 0.5 or 1.5 ml-Eppendorf tube, 33 pi PCR quality water and 5 pi restriction enzyme buffer were added, as well as 10 pi DNA visible on a gel as a bright band. Finger vortexing was used to mix, followed by a quick centrifuge spin. Then, 2 pi or ca. 20 units restriction enzyme were added, finger vortexed and spun down, followed by incubation at 37°C for 2h. To check the digest, 10 pi were run on an agarose gel. 7.2.2 Adapter ligation to digested DNA To a 0.5 or 1.5 ml-Eppendorf tube, 15 pi DNA digest were added as well as 1.5 pi Vectorette adapter units (0.9 pmol), 0.5 pi 100 mM ATP, and 0.5 pi 100 mM DTT, finger vortexed to mix, and placed in the centrifuge for a quick spin. Then 0.5 pi DNA ligase was added (0.5 units), finger vortexed to mix, and quickly spun in a microcentrifuge. Three cycles of incubation at 20°C for one hour, followed by 37°C for half an hour were used for effective ligation of di-gested DNA to adapters. To stop enzymatic reactions, 60 pi of PCR quality water was added after completion of the three cycles. 187 7.2.3 Chromosome walking with touchdown and hot start PCR protocols For higher yield and specificity, decreasing annealing temperature and addition of the Taq enzyme to heated PCR mixture were used. In the first set of PCR reactions, the ligated DNA was diluted 50 times, and 12.5 pl was added to each PCR reaction containing only 12.0 pl PCR cocktail, overlayed with a drop of mineral oil. The PCR program was started with a heating step to 94°C where 0.5 pl Expand High Fidelity PCR System Taq was added (Roche Diagnostics GmbH, Mannheim, Germany). The products of the first PCR reactions were di-luted 50 times in PCR quality water, and 12.5 pl was used per reaction in a second round of PCR with touchdown conditions and hot start. For details on PCR programs, see section 3.2.3.2.4 on page 74. 7.3. Bibliography Anonymous (2000). DNeasy Plant Mini Kit and DNeasy Plant Maxi Kit Handbook, August 2000 edn. Mississauga, Ontario, Canada: Qiagen Inc. Anonymous (2002a). DNA Clean up protocol, pp. 1-2: Spectral Genomics Inc. Anonymous (2002b). The Vectorette System, pp. 1-28. The Woodlands, Texas, USA: Sigma-Genosys. Lee, S. B. & Taylor, J. W. (1990). Isolation of DNA from fungal mycelia and single spores. In PCR Protocols, pp. 282-287. Edited by M . A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White. San Diego: Academic Press, Inc. Ristaino, J. B., Groves, C. T. & Parra, G. R. (2001). PCR amplification of the Irish potato famine pathogen from historic specimens. Nature 411, 695-697. 188 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092331/manifest

Comment

Related Items