Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Optimization of the intracellular delivery properties of non-viral DNA carrier systems Sandhu, Ammen Preat 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-104376.pdf [ 18.3MB ]
Metadata
JSON: 831-1.0092302.json
JSON-LD: 831-1.0092302-ld.json
RDF/XML (Pretty): 831-1.0092302-rdf.xml
RDF/JSON: 831-1.0092302-rdf.json
Turtle: 831-1.0092302-turtle.txt
N-Triples: 831-1.0092302-rdf-ntriples.txt
Original Record: 831-1.0092302-source.json
Full Text
831-1.0092302-fulltext.txt
Citation
831-1.0092302.ris

Full Text

OPTIMIZATION O F T H E I N T R A C E L L U L A R D E L I V E R Y P R O P E R T I E S O F N O N VIRAL DNA C A R R I E R S Y S T E M S  by  AMMEN PREAT SANDHU B S c , Simon Fraser University, 1997  A THESIS SUBMITTED IN PARTIAL F U L F I L M E N T O F T H E R E Q U I R E M E N T S FOR THE D E G R E E OF  DOCTOR OF PHILOSOPHY  in T H E F A C U L T Y O F G R A D U A T E STUDIES Biochemistry and Molecular Biology  T H E UNIVERSITY O F BRITISH C O L U M B I A February 2005  ©Ammen Preat Sandhu, 2005  ABSTRACT A central problem faced by the gene therapy field is the lack of efficient non-toxic methods of delivery of DNA-based macromolecules, such as antisense oligonucleotides and plasmid DNA in vivo. A major reason for this is that currently available non-viral delivery systems are relatively inefficient agents for intracellular delivery of associated DNA. This thesis examines methods to improve the intracellular delivery properties of lipid-based delivery systems for DNA-based macromolecules. In Chapter 2, the efficiency of stabilized antisense-lipid particle (SALP) delivered antisense oligonucleotide (ASODN)-mediated downregulation of a target gene, P K C - a , was evaluated in vitro and in an in vivo mouse model. Results obtained confirmed that significant levels of S A L P encapsulated A S O D N are taken up by cells; however, a majority of the oligonucleotide remains locked in endosomal/lysosomal compartments. Poor intracellular delivery by S A L P systems was also supported by the lack of P K C - a m R N A downregulation following in vitro treatments with SALP-delivered A S O D N targeting P K C - a . The relative efficiency of S A L P delivery of A S O D N in the in vivo liver model was not consistent with the results observed in vitro, since there was evidence of a decrease in P K C - a mRNA levels in the liver tissue following S A L P delivery. However, the levels of antisense activity observed in the in vivo model were complicated by non-sequence-specific effects. In Chapter 3, focus was shifted towards studying the intracellular delivery properties of stabilized plasmid-lipid particles (SPLP) since assays to quantify  delivery of a plasmid encoding for the luciferase reporter gene are more unambiguous, sensitive and relatively straightforward as compared to methods to determine A S O D N activity. The intracellular release parameter (IRP) was employed to examine how changes in the lipid composition and transfection parameters of S P L P affect intracellular delivery. It is shown that the major factor limiting the intracellular delivery properties of the standard S P L P system is the presence of the non-exchangeable P E G - C e r C o molecules. Another major 2  finding is that the addition of 8 mM C a  2 +  into the transfection medium increased  the IRP parameter of S P L P by 100-500 fold regardless of the S P L P lipid composition. In Chapter 4, the significant enhancement in intracellular delivery of S P L P in the presence of C a  2 +  was studied further to determine the underlying  mechanisms behind its activity. It is shown that the C a  2 +  effect could be  modulated by changes in the serum content in the cell culture medium but is not related to modifications in cell uptake levels of S P L P . The C a  2 +  effect is  attributed to the formation of calcium phosphate precipitates during the transfection procedure; however the effect does not involve calcium phosphate mediated destabilization of S P L P . It is also demonstrated that calcium phosphate precipitates enhance the intracellular delivery of neutral macromolecules by facilitating their release from endosomal/lysosomal compartments. In Chapter 5, the strategy to enhance the intracellular delivery properties of S P L P using pH-sensitive polymers was explored. It is demonstrated that co-  administration of poly(ethylacrylic acid) (PEAA) polymers with S P L P increases gene expression by up to 1000-fold in B H K cells. Further, an acylated derivative of the P E A A polymer was successfully post-inserted into the S P L P system at efficiencies of 70-80% without significantly affecting S P L P particle size or DNA protective qualities. Transfections with S P L P containing post-inserted acylated P E A A increased gene expression by up to 80-fold, which was not related to changes in cell uptake levels.  iv  TABLE OF CONTENTS ABSTRACT  ii  TABLE OF CONTENTS  v  LIST O F T A B L E S  ix  TABLE OF FIGURES  x  ABBREVIATIONS  xiii  ACKNOWLEDGEMENTS  xvi  C H A P T E R 1: I N T R O D U C T I O N 1.1  1  O v e r v i e w : C a n c e r G e n e T h e r a p y S t r a t e g i e s a n d Delivery M e t h o d s  1.2 C a n c e r G e n e T h e r a p y S t r a t e g i e s  1 2  1.2.1 E n z y m e / P r o d r u g T h e r a p y 1.2.2 G e n e T h e r a p y D i r e c t e d C e l l C y c l e Control a n d A p o p t o s i s 1.2.3 I m m u n o m o d u l a t o r y G e n e s 1.2.4 Delivery of N u c l e i c A c i d S e q u e n c e s to D o w n r e g u l a t e G e n e s Involved in Tumor Progression 1.3 Viral G e n e T h e r a p y V e c t o r s  2 4 4 5 11  1.3.1 R e t r o v i r u s e s 1.3.2 A d e n o v i r u s e s 1.3.3 H e r p e s S i m p l e x V i r u s e s 1.3.4 A d e n o - A s s o c i a t e d V i r u s e s  11 13 14 14  1.4 N o n - V i r a l N o n - L i p i d B a s e d G e n e Delivery S y s t e m s  15  1.4.1  Direct Injection  16  1.4.2  C a l c i u m P h o s p h a t e Precipitation  16  1.4.3 C a t i o n i c P o l y m e r s  17  1.4.4  18  Synthetic V e c t o r s with Viral C o a t C o m p o n e n t s  1.5 Lipids a n d L i p o s o m e s  18  1.5.1  Naturally O c c u r i n g Lipids  18  1.5.2  Synthetic Lipids  22  1.5.3  Liposomes  23  1.5.4  Lipid P o l y m o r p h i s m  27  1.5.5  Liposomes a s Carrier S y s t e m s  29  1.6 N o n - V i r a l L i p i d - B a s e d G e n e Delivery S y s t e m s for S y s t e m i c A p p l i c a t i o n  32  1.6.1  S y s t e m i c Delivery I s s u e s  32  1.6.2  Stabilized Antisense-Lipid Particles ( S A L P )  33  1.6.3  Stabilized Plasmid-Lipid Particles ( S P L P )  34  v  1.7 Intracellular B a r r i e r s to N o n - V i r a l G e n e Delivery  37  1.7.1  The Endocytosis Pathway  37  1.7.2  F a t e of the C a r r i e r a n d D N A in the C y t o p l a s m  41  1.7.3 Delivery a n d Entry into the N u c l e u s  41  1.8 S t r a t e g i e s to E n h a n c e E n d o s o m a l R e l e a s e  44  1.8.1  Endosomolytic Peptides  45  1.8.2  Endosomolytic Polymers  46  1.8.3  Endosomolytic Lipids  48  1.9 T h e s i s O b j e c t i v e s  50  C H A P T E R 2: E V A L U A T I O N O F T H E I N T R A C E L L U L A R D E L I V E R Y P R O P E R T I E S O F S T A B I L I Z E D A N T I S E N S E - L I P I D P A R T I C L E S IN A N IN VITRO A N D IN VIVO M O D E L SYSTEM 52 2.1  INTRODUCTION  52  2.2 M A T E R I A L S A N D M E T H O D S  56  2.2.1  Materials  56  2.2.2 2.2.3 2.2.4 2.2.5 2.2.5 2.2.6 2.2.7 2.2.8  Antisense Oligonucleotides F o r m a t i o n of l i p i d / D N A l i p o p l e x e s F l u o r e s c e n c e m i c r o s c o p y s t u d i e s of A S O D N in vitro P r e p a r a t i o n of S A L P In vitro t r a n s f e c t i o n s with A S O D N In vivo liver m o d e l treatments with A S O D N R N A isolation R i b o n u c l e a s e Protection A s s a y  56 57 57 58 59 60 61 61  2.3 R E S U L T S  63  2.3.1 S t a b i l i z e d a n t i s e n s e - l i p i d particles are retained in v e s i c u l a r c o m p a r t m e n t s following uptake in vitro 63 2.3.2 A n t i s e n s e e n c a p s u l a t e d in S A L P are inefficient relative to l i p o p l e x e s in effecting target m R N A d o w n r e g u l a t i o n in vitro 65 2.3.4 A n t i s e n s e O D N s d o w n r e g u l a t e P K C - a m R N A in m o u s e liver t i s s u e following intraperitoneal delivery 68 2.3.5 E n c a p s u l a t i o n of O D N s into stabilized antisense-lipid particles d i m i n i s h e s a n t i s e n s e activity in liver t i s s u e in vivo 73 2.4 D I S C U S S I O N  77  C H A P T E R 3: M O D I F I C A T I O N S T O S T A B I L I Z E D P L A S M I D - L I P I D P A R T I C L E S T H A T INFLUENCE INTRACELLULAR DELIVERY: CHARACTERIZATIONS BASED O N T H E INTRACELLULAR RELEASE PARAMETER 82 3.1  INTRODUCTION  82  vi  3.2 M A T E R I A L S A N D M E T H O D S 3.2.1  85  Materials  85  3.2.2 P r e p a r a t i o n of S P L P  85  3.2.3 C e l l t r a n s f e c t i o n s to a s s a y reporter g e n e activity  87  3.2.4 Quantitation of lucife r a s e activity  87  3.2.5 S P L P u p t a k e s t u d i e s  88  3.2.6 In vivo p h a r m a c o k i n e t i c s of L U V s c o m p o s e d of S P L P lipids  89  3.3 R E S U L T S  90  3.3.1 T h e intracellular r e l e a s e p a r a m e t e r ( I R P ) : definition a n d the influence of incubation time, C a a n d post-inserted cationic P E G lipids ( C P L ) o n the I R P of SPLP ...90 3.3.2 A n i n c r e a s e in the cationic lipid content of S P L P d o e s not significantly e n h a n c e intracellular delivery 93 3.3.3 C h a n g e s in the neutral lipid c o m p o s i t i o n of S P L P d o e s not significantly e n h a n c e intracellular delivery 95 3.3.4 T h e P E G - l i p i d c o m p o n e n t of S P L P profoundly affects intracellular delivery properties of S P L P 98 3.3.5 R e d u c t i o n of P E G - C e r C content m o d e r a t e l y r e d u c e s the circulation halflife of S P L P 101 2 +  2 0  3.3.6 D e s i g n of a n S P L P particle with r e d u c e d P E G - C e r C content 3.3.7 In S P L P c o n t a i n i n g P E G - C e r C the p r e s e n c e of D O P C significantly r e d u c e s intracellular delivery 2 0  105  8  3.4 D I S C U S S I O N  110 113  C H A P T E R 4: T H E M E C H A N I S M O F C A L C I U M - I N D U C E D E N H A N C E M E N T IN T H E INTRACELLULAR DELIVERY O F STABILIZED PLASMID-LIPIDPARTICLES 119 4.1 I N T R O D U C T I O N  119  4.2 M A T E R I A L S A N D M E T H O D S  121  4.2.1  Materials  121  4 . 2 . 2 P r e p a r a t i o n of S P L P 4.2.3  4.3  122  R e p o r t e r g e n e activity in the p r e s e n c e of C a  2 +  123  4.2.4 Quantitation of luciferase activity  123  4.2.5  Determination of S P L P uptake into c e l l s  124  4.2.6 Intracellular p r o c e s s i n g of p l a s m i d D N A  125  4.2.7 Intracellular distribution of dextran  126  RESULTS  4.3.1 C a  2 +  127  addition to the transfection m e d i a i n d u c e s a substantial i n c r e a s e in  gene expression  127  4.3.2 C a  129  4.3.3  2 +  i n c r e a s e s the level of intracellular delivery of intact p l a s m i d  The C a  2 +  effect is amplified in the a b s e n c e of s e r u m  131  4.3.4 C a - i n d u c e d i n c r e a s e s in transfection require the p r e s e n c e of p h o s p h a t e . 1 3 3 2 +  4.3.5  Ca  2 +  d o e s not d e s t a b i l i z e S P L P structure  vii  135  4.3.6 C a l c i u m p h o s p h a t e - m e d i a t e d e n h a n c e m e n t s in g e n e e x p r e s s i o n of S P L P are not affected by s e r u m n u c l e a s e s 135 4.3.7 C a l c i u m p h o s p h a t e facilitates the transfer of large m o l e c u l e s t r a p p e d in the e n d o s o m e / l y s o s o m e s into t h e c y t o p l a s m i c c o m p o n e n t of t h e cell 136 4.4 D I S C U S S I O N  140  C H A P T E R 5: p H D E P E N D E N T P O L Y ( 2 - E T H Y L A C R Y L I C A C I D ) P O L Y M E R S F O R THE E N H A N C E M E N T O F INTRACELLULAR DELIVERY O F STABILIZED PLASMID LIPID P A R T I C L E S 142 5.1  INTRODUCTION  142  5.2 M A T E R I A L S A N D M E T H O D S 5.2.1  145  Materials  145  5.2.2 P E A A s y n t h e s i s 5.2.3 S o l v e n t fractionation of P E A A 5.2.4 P r e p a r a t i o n of H P T S / D P X containing l i p o s o m e s 5.2.5 H P T S a n d p D N A r e l e a s e a s s a y s 5.2.6 C e l l t r a n s f e c t i o n s 5.2.7 Quantitation of g e n e e x p r e s s i o n 5.2.8 Alkylation a n d p y r e n e labeling of P E A A 5.2.9 S P L P p r e p a r a t i o n 5.2.10 P r e p a r a t i o n of P E A A - c o n t a i n i n g S P L P 5.2.11 D N a s e r e s i s t a n c e a s s a y 5.2.12 S P L P uptake s t u d i e s 5.3 R E S U L T S  146 146 147 148 149 150 150 151 151 153 154 155  5.3.1 P E A A p o l y m e r s i n d u c e m e m b r a n e l e a k a g e in E P C : C h o l L U V s a n d S P L P systems 155 5.3.2 p H - i n d u c e d m e m b r a n e l e a k a g e a n d e n h a n c e d g e n e delivery by P E A A is m o l e c u l a r weight a n d c o n c e n t r a t i o n - d e p e n d e n t 157 5.3.3 P o l y m e r - e n h a n c e d intracellular delivery of S P L P is d e p e n d e n t o n the order of addition in co-transfection e x p e r i m e n t s with P E A A a n d S P L P 161 5.3.4 d o - P E A A c a n b e post inserted efficiently into S P L P s y s t e m s without significant c h a n g e s in particle s i z e a n d p D N A protection from n u c l e a s e s 164 5.3.5 C - P E A A S P L P d e m o n s t r a t e s significantly higher g e n e e x p r e s s i o n l e v e l s relative to S P L P w h i c h is unrelated to c h a n g e s in particle uptake 169 1 0  5.4 D I S C U S S I O N  174  C H A P T E R 6: S U M M A R Y A N D F U T U R E D I R E C T I O N S  179  REFERENCES  183  viii  LIST OF TABLES  T a b l e 1.1. C h a r a t e r i s t i c s of Viral V e c t o r s  12  T a b l e 5 . 1 . C h a r a c t e r i z a t i o n of S P L P with post inserted C - P E A A 1 0  ix  168  TABLE OF FIGURES F i g u r e 1.1.  V e c t o r s u s e d in g e n e therapy clinical trials to date  3  F i g u r e 1.2.  A n t i s e n s e inhibition of g e n e e x p r e s s i o n  7  F i g u r e 1.3  Potential m e c h a n i s m s of a n t i s e n s e o l i g o n u c l e o t i d e s  8  F i g u r e 1.4.  C h e m i c a l structures of o l i g o n u c l e o t i d e s  9  F i g u r e 1.5  Structures of naturally occurring lipids u s e d in this work  F i g u r e 1.6.  A m p h i p a t h i c lipids in bilayer configuration in a n a q u e o u s environment....21  F i g u r e 1.7  Structures of c o m m o n l y u s e d cationic lipids  24  F i g u r e 1.8.  C l a s s i f i c a t i o n of l i p o s o m e s  26  F i g u r e 1.9.  P o l y m o r p h i c p h a s e s of lipids  28  F i g u r e 1.10.  A s c h e m a t i c d i a g r a m depicting the p a s s i v e a c c u m u l a t i o n of l i p o s o m a l  20  formulations at d i s e a s e d t i s s u e s t h r o u g h the E P R effect  31  F i g u r e 1.11.  Stabilized Plasmid-Lipid Particles  36  F i g u r e 1.12.  M a p of p l a s m i d D N A ( p C M V - L u c ) u s e d in this work  38  F i g u r e 1.13.  S c h e m a t i c of the clathrin m e d i a t e d e n d o c y t o s i s ( C M E ) pathway  42  F i g u r e 1.14.  S c h e m a t i c illustrating the intracellular fate of l i p i d - b a s e d g e n e carrier systems C e l l u l a r uptake a n d location of A S O D N delivered in lipoplexes a s c o m p a r e d to S A L P  Figure 2.1.  43 64  Figure 2.2A.  R P A products following treatment of m a m m a r y epithelial cells with free a n d lipoplex A S O D N 66  Figure 2.2B.  P K C - a r m R N A levels following treatment of m a m m a r y epithelial c e l l s with free a n d lipoplex A S O D N 67  Figure 2.3  P K C - o r m R N A l e v e l s following treatment with S A L P a n d varying c o n c e n t r a t i o n s of c a l c i u m  69  R P A p r o d u c t s following intra-peritoneal treatment with free A S O D N targeting P K C - a m R N A  71  Figure 2.4A.  Figure 2.4B.  P K C - a r m R N A levels following intraperitoneal treatment with free A S O D N . 72  Figure 2.5A.  R P A products from treatment with S A L P e n c a p s u l a t e d a n t i s e n s e in relation to free A S O D N  74  Figure 2.5B.  Efficacy of S A L P e n c a p s u l a t e d a n t i s e n s e in relation to treatment with free oligonucleotide 75  Figure 3.1.  Effect of c a l c i u m , C P L a n d duration of treatment o n the I R P of S P L P  x  94  Figure 3.2A.  Influence of cationic lipid content o n cell uptake a n d g e n e e x p r e s s i o n of SPLP 96  Figure 3.2B.  Influence of cationic lipid content o n the I R P of S P L P  97  F i g u r e 3.3.  Effect of neutral lipid content o n the I R P of S P L P  99  F i g u r e 3.4.  Influence of P E G - C e r C  F i g u r e 3.5.  C i r c u l a t i o n lifetimes of L U V s c o m p o s e d of S P L P lipids with variation in PEG-CerC content 104  2 0  content o n the I R P of S P L P  102  2 0  F i g u r e 3.6.  F i g u r e 3.7.  S c h e m a t i c illustration c o m p a r i n g the original S P L P formulation with a modified s e c o n d - g e n e r a t i o n p a r t i c l e . .  106  Influence of cationic lipid content o n the dialysis c o n d i t i o n s required for efficient e n c a p s u l a t i o n of p D N A into P O P C : D O D A C : P E G - C e r C S P L P . 108 8  F i g u r e 3.8.  Influence of cationic lipid content o n I R P of S P L P c o m p o s e d of P O P C : DODAC: PEG-CerC 109 8  F i g u r e 3.9.  T r a n s f e c t i o n p o t e n c y of s e c o n d - g e n e r a t i o n P O P C S P L P s y s t e m s with the addition of D O P E 112  Figure 4.1.  E n h a n c e d reporter g e n e activity relative to C a content in cell culture m e d i u m during S P L P transfection with a minor affect o n cell uptake of SPLP 128  F i g u r e 4.2.  Influence of C a o n the integrity of S P L P p l a s m i d following uptake of S P L P into B H K c e l l s  130  S e r u m affects the C a delivered p D N A  132  Figure 4.3.  F i g u r e 4.4.  2 +  2 +  2 +  related i n c r e a s e in g e n e e x p r e s s i o n of S P L P  Ca related i n c r e a s e in g e n e e x p r e s s i o n of S P L P d e l i v e r e d p D N A is d e p e n d e n t o n p h o s p h a t e s in the cell m e d i a 2 +  134  Figure 4.5.  C a - p h o s p h a t e e n h a n c e d transfection of S P L P is not affected by s e r u m nucleases 138  Figure 4.6.  C a - p h o s p h a t e m e d i a t e d intracellular r e l e a s e of d e x t r a n s following cell  2 +  2 +  uptake  139  Figure 5.1.  Poly(2-ethylacrylic acid) ( P E A A )  143  F i g u r e 5.2.  R e a c t i o n s c h e m e for the alkylation of P E A A  152  F i g u r e 5.3.  P E A A m e d i a t e d l e a k a g e of l i p o s o m e s relative to p H  156  F i g u r e 5.4.  P o l y m e r i n d u c e d r e l e a s e of p l a s m i d D N A from S P L P relative to p H  158  F i g u r e 5.5.  T r a n s f e c t i o n p o t e n c y of S P L P relative to P E A A c o n c e n t r a t i o n a n d M W . 160  F i g u r e 5.6.  Effect of addition order of P E A A to S P L P o n transfection p o t e n c y  xi  163  F i g u r e 5.7.  S c h e m a t i c of the post-insertion protocol of C  1 0  - P E A A into pre-formed  SPLP  165  F i g u r e 5.8.  C - P E A A m e d i a t e d l e a k a g e of l i p o s o m e s relative to p H  167  F i g u r e 5.9.  Susceptibility of purified C  - P E A A S P L P p l a s m i d D N A to D N a s e s  170  Figure 5.10.  T r a n s f e c t i o n p o t e n c y of C  -PEAA SPLP  172  Figure 5.11.  C e l l uptake of C - P E A A  1 0  1 0  1 0  173  1 0  xii  ABBREVIATIONS  AAV  a d e n o - a s s o c i a t e d virus  AIBN  2,2'-azobis(isobutyronitrile)  ASODN  a n t i s e n s e oligonucleotide  ATP  adenosine triphosphate  AV  adenovirus  BCA  bicinchoninic A c i d Solution  BHK  baby hamster kidney  CHE  c h o l e s t e r y l h e x a d e c y l ether  CCV  clathrin c o a t e d v e s i c l e  Cer  ceramide  CHEMS  cholesteryl hemisuccinate  Choi  cholesterol  cmc  critical micellar c o n c e n t r a t i o n  CME  clathrin mediated endocytosis  CMV  cytomegalovirus  CpG  c y t o s i n e - g u a n o s i n e s e q u e n c e in D N A  CPL  c a t i o n i c p e g y l a t e d lipid  DPBS  D u l b e c c o ' s p h o s p h a t e buffered s a l i n e  DEAE  diethylaminoethyl  DMEM  D u l b e c c o ' s modified E a g l e m e d i u m  DNA  deoxyribonucleic acid  DNase 1  deoxyribonuclease 1  DODAC  N , N - d i o l e y l - N , N - d i m e t h y l a m m o n i u m chloride  DODAP  1,2-dioleoyl-3-dimethylammonium-propane  DOPC  1,2-dioleoyl-sn-Glycero-3-phosphocholine  DOPE  1,2-dioleoyl-sn-Glycero-3-phosphoethanolamine  DODAP  1,2-dioleoyl-3-dimethylammonium propane  DPX  p-xylene-bis-pyridinium b r o m i d e  DSPC  1,2-distearoyl-sn-glycero-3-phosphocholine  EDC  1 ,ethyl-3(3-dimethylaminopropyl) c a r b o d i i m i d e  EDTA  ethylenediaminetetraacetic acid  EE  early e n d o s o m e  :  xiii  EPC  egg phosphatidylcholine  EPR  e n h a n c e d penetration a n d retention  FBS  fetal bovine s e r u m  FITC  f l u o r e s c e i n isothiocyanate  GAPDH  glyceraldehyde-3-phosphate dehydrogenase  GITC  g u a n i d i n e isothiocyante  Glu  glutamic a c i d  HA-2  hemagglutinin subunit 2  HBS  h e p e s buffered s a l i n e  Hn  hexagonal  HIV  h u m a n i m m u n o d e f i c i e n c y virus  HPTS  8-hydroxypyrene-1,3,6-trisulfonic a c i d  HSV  h e r p e s s i m p l e x virus  HSV-tk  h e r p e s s i m p l e x virus t h y m i d i n e - k i n a s e  i.p.  intra-peritoneal  i.v.  intravenous  ICAM-1  intercellular a d h e s i o n molecule-1  INF  influenza  IRP  intracellular r e l e a s e p a r a m e t e r  LE  late e n d o s o m e  Luc  luciferase  LUV  large unilamellar v e s i c l e  MLV  multilamellar v e s i c l e  MPS  mononuclear phagocytic system  mRNA  m e s s e n g e r ribonucleic a c i d  MWCO  m o l e c u l a r weight cut-off  NLS  n u c l e a r localization signal  NMWL  n o m i n a l m o l e c u l a r weight limit  NPC  nuclear pore complex  ODN  oligodeoxynucleotide  OGP  n-octyl-3-D-glucopyranoside  PAGE  polyacrylamide gel electrophoresis  PBS  p h o s p h a t e buffered s a l i n e  PC  phosphatidylcholine  xiv  pDNA  plasmid deoxyribonucleic acid  PEAA  poly(2-ethylacrylic acid)  PEG  poly(ethylene glycol)  PEG-CerC  8  1-0-(2'-(w-methoxypolyethyleneglycol oo)succinoyl)-2-N20  octanoylsphingosine PEG-CerC  1 4  1-0-(2'-(w-methoxypolyethyleneglycol ooo)succinoyl)-2-N2  myristoylsphingosine PEG-CerC  2 0  1-0-(2'-(w-methoxypolyethyleneglycol oo)succinoyl)-2-N20  arachidoylsphingosine PEI  poly(ethyleneimine)  PEO  poly(ethylene oxide)  PKC-a  protein k i n a s e C - a  PLL  poly(L-lysine)  PO  phosphorodiester  POPC  1 -palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine  PS  phosphorothioate; phosphatidylserine  QELS  q u a s i - e l a s t i c light scattering  RES  reticuloendothelial s y s t e m  Rh-DOPE  1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N(lissamine r h o d a m i n e B sulfonyl)  RNA  ribonucleic a c i d  RNase H  ribonuclease H  RPA  r i b o n u c l e a s e protection a s s a y  RV  recycling v e s i c l e  SALP  s t a b i l i z e d a n t i s e n s e - l i p i d particle  SDS  s o d i u m n-dodecyl sulfate  siRNA  s m a l l interfering ribonucleic a c i d  SPLP  s t a b i l i z e d plasmid-lipid particle  SSC  s a l i n e s o d i u m citrate buffer  SUV  s m a l l unilamellar v e s i c l e  SV40  s i m i a n virus 4 0  TAA  tumor a s s o c i a t e d antigen  TLC  thin layer c h r o m a t o g r a p h y  TX-100  t-octylphenoxypolyethoxyethanol  xv  ACKNOWLEDGEMENTS  M o s t importantly, thank y o u Dr. Pieter C u l l i s , for giving m e the opportunity to work u n d e r your s u p e r v i s i o n a n d for providing m e with v a l u a b l e a d v i c e a n d u n w a v e r i n g support o v e r the c o u r s e of m y s t u d i e s --I h a v e g a i n e d s o m u c h admiration for your l e a d e r s h i p in both the a c a d e m i c a n d industrial r e a l m s . T h a n k y o u Dr. K i m W o n g for k e e p i n g the lab o r g a n i z e d a s well a s contributing c o u n t l e s s h o u r s of help s y n t h e s i z i n g the P E A A p o l y m e r -I loved h o w y o u " M a c G y v e r e d " us out of s o m e difficult situations. Dr. D a v e F e n s k e , t h a n k s for your u n w a v e r i n g optimisim a b o u t life, helping m e with publications a n d the great c o n v e r s a t i o n a b o u t m o v i e s . T h a n k s Dr. J o h n F i n n for d i s c u s s i n g all things related to g e n e therapy with m e - g r a d s c h o o l w a s definitely m o r e e n j o y a b l e t h a n k s to y o u b e i n g in the lab a n d I a m s o g l a d w e h a d a c h a n c e to b e c o m e great friends. S p e a k i n g of friends, t h a n k s S u e d e J o n g (who I a m s u r e in a n o t h e r life w a s Indian) for offering help in w h a t e v e r c a p a c i t y y o u w e r e a b l e to, e v e n if it i n v o l v e d p r o c e s s i n g o r g a n s ! K a l e y W i l s o n , I really e n j o y e d our c o n v e r s a t i o n s w h i c h c o v e r e d a wide r a n g e of t o p i c s from formulating S P L P to the b e s t p l a c e to b u y a g o o d pair of s h o e s a n d I will a l w a y s k e e p f o n d m e m o r i e s of w o r k i n g with y o u to maintain lab traditions like " C u l l i s L a b T r i v i a " . M i k e J o h n s t o n t h a n k s for b e i n g a fun a n d s u p p o r t i v e l a b m a t e to h a v e a r o u n d , y o u h a v e s o m u c h information a b o u t s o m a n y s u b j e c t s running through y o u r h e a d ! T h a n k s Dr. Igor Z h i g a l t s e v a n d Dr. C h r i s T u r n e r for providing m e with r e s e a r c h a d v i c e . T h a n k s S o n j a C r e s s m a n for t e a c h i n g m e the b a s i c s a b o u t m a s s s p e c t r o m e t r y . A s p e c i a l thank y o u to T a b i t h a for providing help with formulating S P L P a n d maintaining cell lines. I w o u l d a l s o like to thank m y c o m m i t t e e : Dr. M i c h a e l H o p e a n d Dr. M i c h e l R o b e r g e for providing v a l u a b l e a d v i c e during the c o u r s e of m y t h e s i s work. A l s o a s p e c i a l thank y o u to Dr. M i c h a e l H o p e for your s u p e r v i s i o n during m y early work with a n t i s e n s e o l i g o n u c l e o t i d e s a n d e n c o u r a g i n g m e to a p p l y to g r a d u a t e s c h o o l ! Finally, I w o u l d a l s o like to thank P r o t i v a B i o t h e r a p e u t i c s (esp. Dr. Ian M a c L a c h l a n ) a n d Inex P h a r m a c e u t i c a l s , for providing m e with p l a s m i d D N A , P E G C e r a m i d e lipids a n d a facility to c o n d u c t a n i m a l s t u d i e s . A l s o , I w o u l d like to thank S e a n S e m p l e , Dr. B a r b M u i , Dr. S a m R a n e y , a n d Dr. S a n d y K l i m u k at Inex P h a r m a c e u t i c a l s for m a k i n g m e feel w e l c o m e w h e n I n e e d e d r e s e a r c h a d v i c e .  xvi  Dedicated to:  Mom and Dad -for courageously moving across the world in the hopes of providing your children with a life of limitless opportunities Rob and Sheenie -for inspiring me to keep trying to give you reasons to look up to your older sister My loving husband  Christian  -for your relentless support and inspiring me to never give up  xvii  CHAPTER 1: INTRODUCTION  1.1 Overview: Cancer Gene Therapy Strategies and Delivery Methods A central problem faced by the gene therapy field is the lack of efficient non-toxic methods of delivery of DNA-based macromolecules, such as antisense oligonucleotides and plasmid DNA in vivo. A major reason for this is that currently available non-viral delivery systems are relatively inefficient agents for intracellular delivery of associated DNA. This thesis examines methods to improve the intracellular delivery properties of lipid-based delivery systems for DNA-based macromolecules. In the following sections, a review is presented of gene therapy strategies, including viral and non-viral gene delivery methods, followed by a more detailed background regarding non-viral systems and the intracellular delivery approaches used in this work. The first human gene therapy treatment was conducted in a 4 year-old girl in September 1990, when she was treated with her own white blood cells genetically modified to correct an inherited immune disorder (Thompson, 2000). Since then, there have been 987 gene therapy clinical trials conducted (The Journal of Gene Medicine Website, 2004) without a single regulatory approval for a gene therapy drug. However, a better understanding of the barriers that are hindering the progress of gene therapeutics is now available. To date, the carrier systems investigated have severe toxicological and immune response problems, poor transfection efficiencies and a lack in tissue specificity. In this work, the focus will be on the design of an efficient, systemically administered synthetic delivery system for the intracellular delivery of DNA for the 1  treatment of cancer. The cancer gene therapy field is the most widely studied area in gene therapy. Currently, there have been over 650 clinical trials conducted world wide using gene therapeutics for the treatment of cancer, comprising 70% of the total gene therapy trials carried out to date (Figure 1.1) (The Journal of Gene Medicine Website, 2004).  1.2  Cancer Gene Therapy Strategies  Current cancer gene therapy strategies can be classified as: Enzyme/pro-drug therapies, delivery of genes to induce cell cycle control and apoptosis, delivery of immunomodulatory genes, and treatments with nucleic acid-based molecules to induce the downregulation of genes involved in tumor progression.  1.2.1 Enzyme/Prodrug Therapy Enzyme/pro-drug therapy, also known as "suicide gene therapy" involves the delivery of genes encoding pro-drug converting enzymes followed by the systemic administration of the respective pro-drug. Cells expressing the pro-drug enzyme convert the pro-drug to the active cytotoxic drug, conferring selective cell killing to sites where the pro-drug converting enzyme is expressed. An effective combination used in clinical trials involves transfection with the herpes simplex virus thymidine kinase (HSV-tk) gene and systemic administration of the pro-drug ganciclovir (Immonen et al., 2004). In this combination, ganciclovir is phosphorylated by the active HSV-tk gene producing a nucleotide analog, which, upon incorporation into replicating DNA strands, causes chain termination and  2  Vectors Used in Gene Therapy Clinical Trials  Retrovirus 2 7 % (n=263) Adenovirus 2 6 % ( n = 2 5 8 ) Naked/Plasmid D N A 1 5 % (n=150) Lipofection 8 . 6 % ( n = 8 5 ) Poxvirus 7 . 2 % (n=71) Vaccinia virus 4 . 7 % ( n = 4 7 ) Herpes simplex virus 3 % ( n = 3 0 ) Adeno-associated virus 2 5 % (n=25) R N A f r a n s f e r 1.1 (n=11) Others 2 . 2 % ( n = 2 2 ) N / C 4 . 2 % (n=41)  The Journal ol G e n e M e d i c i n e  £ 2 0 0 4 John Wiley a n d S o m U d  www wiley co.uk/genmed/clinical  Figure 1.1. Vectors used in gene therapy clinical trials to date. Source: http://www.wilev.co.uk/genmed/clinical/  3  DNA single-strand breaks. This strategy has advantages over conventional chemotherapeutic treatments that induce systemic toxicity, thereby limiting the achievable dose at the tumor site. However, enzyme/pro-drug therapy does require a gene delivery system that results in preferential gene expression at a disease site such as a tumor site.  1.2.2 Gene Therapy Directed Cell Cycle Control and Apoptosis Cellular proteins that regulate cell cycle progression and induce apoptosis have been investigated extensively for their potential as cancer therapeutics. In this strategy, cells are transfected with genes that are known to inhibit proliferation and induce apoptosis. An example is the p53 tumor suppressor gene, found to be mutated in approximately 5 0 % of human tumors (Collot-Teixeira et al., 2004; Crawford et al., 1981). In normal cells, p53 is induced in response to genotoxic agents, oxidative stress, hypoxia, and oncogene expression (Levine, 1997). Once induced, p53 activates genes involved in cell-cycle arrest, DNA repair and/or the induction of apoptosis (Levine, 1997). p53 delivery has also been studied in combination with conventional cancer therapies since the induction of tumor cell apoptosis by chemotherapeutics and radiation therapy has been shown to require normal p53 function (Lowe et al., 1993).  1.2.3 Immunomodulatory Genes Cancer immunotherapies are based on stimulating the host immune system to recognize tumor-associated antigens (TAAs) as foreign antigens. Recruiting the  4  immune system is advantageous since cells of the immune system can seek and attack disseminated tumor cells; potentially eliminating both localized and metastatic disease. Immunomodulatory genes explored for application in this form of therapy include cytokines (Barajas et al., 2001; El-Aneed, 2004; Shi et al., 2002), and T A A s (Bubenik, 2001; Strobel et al., 2000).  1.2.4 Delivery of Nucleic Acid Sequences to Downregulate Genes Involved in Tumor Progression A malignant phenotype can also be suppressed by the downregulation of oncogenes and other genes that contribute to tumor progression. This class of gene therapy drugs involves the use of nucleic acid sequences that are designed to bind to and inhibit the transcription or translation of target DNA or R N A sequences that code for proteins that contribute to the malignant phenotype. Currently, such therapies are hindered by insufficient delivery of these molecules into target cells. However, if improved DNA delivery methods were available, these potential therapies have the advantage of being able to regulate the expression of one or more genes in a highly specific manner. One of the most intensively studied drugs of this class are antisense oligonucleotides, which are the focus of some of the studies on DNA delivery systems discussed in this work (Chapter 2). Antisense oligonucleotides (ASODNs) are short stretches of synthetic DNA (typically 12 to 25 bases long) composed of a unique sequence designed to bind to a specific complementary target R N A sequence through Watson-Crick  5  hybridization. The formation of this A S O D N / R N A hybrid disables or activates the destruction of the bound R N A molecule, thereby preventing translation of the target R N A sequence (Figure 1.2). The regulation of gene products by an antisense mechanism is found to occur in cells naturally (Good et al., 2003; Shafranski et al., 1975) and there are a number of potential mechanisms for antisense mediated downregulation of a target gene (Figure 1.3), extensively reviewed elsewhere (Crooke, 1999). The best characterized antisense mechanism involves the recruitment of endogenous cellular nucleases, most notably RNase H (Dean and Bennett, 2003) to the RNA/DNA hybrid, bringing about the cleavage of the target RNA. Other mechanisms include the prevention of ribosomal assembly on the target R N A sequence (Baker et al., 1997) or altering R N A splicing (Dominski and Kole, 1993). Most of the antisense drugs currently in clinical trials utilize an RNase H mechanism (Dean and Bennett, 2003). Unmodified, natural A S O D N s are rapidly degraded in the cellular environment by nucleases that hydrolyze the phosphodiester (PO) linkage between bases. A s a result, considerable efforts have been made to synthesize ODNs with chemical modifications to render them more nuclease resistant without compromising their functionality (Figure 1.4) (Matteucci and Wagner, 1996). The most widely studied and effective analog to the P O chemistry is the phosphorothioate (PS) derivative where the non-bridging oxygen is replaced by a sulfur atom. Although P S A S O D N s demonstrate significant improvements in  6  Antisense Oligonucleotide Translation Antisensem R N A Complex Translation Blocked  Protein Synthesis  Inhibition of Protein Synthesis  Figure 1.2. Antisense inhibition of gene expression. An illustration of antisense mediated inhibition of protein synthesis.  7  DNA  transcnption 5'-Cap polyadenylation  R N A c* .  • AAAA  P  6 Cap •  8  Nucleus  Cytoplasm C3P-  9  • AAAA  10  11  Figure 1.3 Potential mechanisms of antisense oligonucleotides. Antisense oligonucleotides can disrupt a number of mechanisms involved in R N A metabolism and protein expression including: (1) competing with transcription factors, (2) binding to single stranded DNA, (3) binding to double stranded DNA to form a triplex, (4) acting as a substrate for RNase H which recognizes R N A : D N A duplexes and cleaves the R N A sequence, (5) inhibiting 5'-cap formation, (6) inhibiting R N A splicing, (7) inhibiting m R N A polyadenylation, (8) inhibiting R N A export into the cytoplasm, (9) inhibiting 5'-cap recognition, (10) inhibiting the translation process by preventing ribosome function and (11) disrupting protein-RNA interactions. Adapted from Crooke, 1995.  8  pW /  Phosphodiester  R N A 2'-0-Methyl  T  Base  Nil  PNA COKJH,  o =  \  HN  Me  Phosphorothioate  \^  6  P -  Morpholino  N C  N.  0  HN;  \  N3'->P5' Phosphoramidate  Methyl phosphonate  Figure 1.4. Chemical structures of oligonucleotides. Adapted from Dias and Stein, 2002.  nuclease resistance relative to the P O chemistry (Schreiber et al., 1985; Stein and Cohen, 1989), they are known to induce sequence-independent effects on gene expression, attributed to their high affinity for certain cellular proteins (Ho et al., 1991; Rabbani and Wang, 1998). A s a result of these non-sequence specific effects new "second-generation" oligonucleotides have been developed. These second-generation particles also demonstrate resistance to nucleases and hybridize specifically to a target sequence; however, they primarily function by inhibiting gene expression by a non-RNase H mediated pathway (Dias and Stein, 2002). A related therapy that has been gaining much attention recently involves the downregulation of target R N A sequences using siRNAs. This approach involves the introduction of small interfering R N A s (siRNAs) into cells which then form double-stranded structures with complementary R N A molecules, mediating their degradation (Fire et al., 1998). Gene specific suppression has been shown for a number of diverse genes in a number of cell types (Sui et al., 2002) making siRNAs potentially a very effective class of therapeutics. However, as for P O based ODNs, the therapeutic use of s i R N A s is limited by their degradation in blood and extracellular fluids and intracellular delivery issues. To overcome this hurdle, alternative chemistries are being investigated. Another alternative is to transcribe siRNAs from a DNA vector that has been delivered intracellularly (Sui et al., 2002).  10  1.3 Viral Gene Therapy Vectors Vectors for nucleic acid delivery are generally classified as either viral or nonviral delivery systems. Viral systems involve the incorporation of genetic material into the genome of a virus that can then transduce (transfection involving viruses) target cells. For gene therapy purposes a replication-defective viral vector is used which is produced by replacing the coding regions essential for replication with a therapeutic gene. In order to manufacture the replication deficient recombinant virus, the virus is introduced into producer cells engineered to express the missing viral genes; thereby providing the necessary components required to assemble the non-replicating virus particles. A review of the general properties of different classes of viral gene delivery systems is given below and summarized in Table 1.1.  1.3.1 Retroviruses Retroviruses are enveloped single-stranded R N A viruses found in all vertebrates, and are classified as oncoretroviruses, lentiviruses, and spumaviruses. Following entry into the host cell, the viral R N A is transcribed into a doublestranded DNA and then translocated to the nucleus where the viral protein integrase mediates the integration of the viral DNA into the host genome. Inclusion of the integrase activity in recombinant viral carriers introduces the potential for stable long term expression of the transgene; however, most retroviruses are limited by their ability to integrate into only actively dividing cells, excluding transfection of a significant portion of solid tumors that  11  Table 1.1.  Charateristics of Viral Vectors  (adapted from Kootstra and Verma, 2003)  Viral genome Size of viral genome (kb) Integration Nondividing cells Pre-existing immunity safety concerns  AAV  Onco  ss DNA 4.9 Y/N Y Y Insertions! mutagenesis  RNA 8.8 Y N N  a  Retroviral Lenti RNA 9.6 Y Y N Insertional mutagenesis b  "Integration is inefficient in the absence of rep protein b  With the exception of HIV-1 patients  Y: yes; N: no  12  Foamy RNA dsDNA 12.3 Y Y N  Adenoviral  HSV-1  dsDNA 36 N Y Y Inflammation cytotoxicity  dsDNA 152 N Y Y Inflammation cytotoxicity  characteristically have low growth rates. A s a result, increasing attention has been given to the use of the human immunodeficiency virus-1 (HIV-1), belonging to a class of lentiviral vectors that are able to replicate in non-dividing cells (Lewis et al., 1992). Lentiviral vectors have shown promising results, especially in the treatment of Parkinson's disease in a rhesus monkey model (Kordower et al., 2000). However, despite the use of recombinant HIV strains that include minimal levels of viral sequences, there are concerns over this virus being a serious human pathogen (Kootstra and Verma, 2003).  1.3.2  Adenoviruses  Adenoviruses (AV) are non-enveloped icosahedral particles with the genome encoded in a linear, double-stranded DNA. In humans, wild type adenoviruses cause benign respiratory infections. Recently, A V vectors have been developed that are deprived of almost all of their viral genes (known as "gutless" A V vectors (Sakhuja et al., 2003)) and therefore require a helper virus for replication (Parks et al., 1996). A V vectors have some advantages over retroviral vectors in that A V vectors can transduce most human cell types and can deliver transgenes to both dividing and non-dividing cells. Also, A V vectors do not integrate into the host cell genome, reducing the potential for insertional mutagenesis. A major disadvantage of current A V vectors is that they induce a significant T-cell mediated host immune response, causing local inflammation, especially in the liver (Lieber et al., 1997). Clinical studies with A V vectors were recently halted  13  after the death of a participant in a Phase I trial receiving A V vector therapy (Reid et al., 2002).  1.3.3 Herpes Simplex Viruses Herpes simplex viruses (HSVs) are 20 nm-diameter, enveloped, double-stranded DNA viruses that infect both neural and epithelial tissue. During their life cycle, H S V s infect sensory nerve endings and migrate to neuronal cells, which is a useful feature for the delivery of genes to brain tumors (Parker et al., 2000) that are otherwise very difficult to access. Overall, H S V vectors are ranked as having the highest transgene capacity among viral vectors (El-Aneed, 2004), since they can be engineered to accommodate up to 150 kb of transgene DNA (Spaete and Frenkel, 1982). This high capacity introduces the potential to deliver complex genes or more than one gene per virus. However, a limitation with H S V vectors is that they can become contaminated with helper virus DNA during propagation (Kootstra and Verma, 2003). Also, there is the potential for reversion to the wild type virus during growth in propagating cell lines (Kootstra and Verma, 2003), which is of particular concern with H S V vectors since they are neurovirulent.  1.3.4 Adeno-Associated  Viruses  Adeno-associated viruses (AAVs) are small (20-25 nm), non-enveloped, singlestranded DNA parvoviruses with a genome of approximately 4.7 kb. To propagate recombinant A A V s (rAAVs) in cell culture, rAAVs must be co-infected with adenoviruses to provide the helper function necessary for A A V replication  14  (Kootstra and Verma, 2003). A s a result, the rAAV must then be re-purified from the adenovirus, severely reducing its yield (Monahan and Samulski, 2000). A A V s have a number of advantages over other viral vectors. A lack of genetic material that expresses viral proteins decreases the potential immunogenicity of the rAAV virus (Monahan and Samulski, 2000). Another advantage is that rAAVs transduce both replicating and nonreplicating cells. Furthermore, A A V s have a broad range of host cell types (Summerford and Samulski, 1998). One of the major limitations with A A V vectors is that rAAVs can only accommodate 4 kb of inserted DNA. A A V vectors are also limited by the majority of the population having circulating neutralizing antibodies against A A V s due to natural infection, yielding a strong humoral response against A A V capsid proteins (Chirmule et al., 1999).  1.4 Non-Viral Non-Lipid Based Gene Delivery Systems Viral vectors have evolved very elegant, efficient pathways to enter cells and deliver their DNA to nuclei. However, they suffer many disadvantages (as mentioned above), including the immune recognition of viral proteins leading to destruction of the transduced cells, as well as prevention of repeated viral administration. Also, transduction with viral vectors introduces the possibility for insertional mutagenesis and is faced with transgene size restrictions, as well as major difficulties with large-scale production and purification. A s a consequence of these problems much effort has been put towards developing non-viral  15  delivery systems that avoid the obstacles encountered with viral vectors. In general, non-viral DNA carrier systems consist of predominantly synthetic components which either associate with or encapsulate the genetic material.  1.4.1 Direct Injection The simplest method for in vivo gene transfer that has been investigated is the direct injection of DNA into tissues. Direct injection methods have shown significant levels of gene expression in skeletal and cardiac muscle tissue (Acsadi et al., 1991; Wolff et al., 1990) as well as solid tumors (Nomura et al., 1999), although the mechanism of uptake into these tissues is still unclear. Another related method involves coating DNA onto gold particles which are then directly fired into tissues or target cells by a "gene gun" (Yang et al., 1990). This method has shown some success in preclinical models demonstrating improved survival of tumor-bearing mice treated with cytokine genes (Sun et al., 1995; Turner et al., 1998). Despite these successes, gene gun delivery and direct injection are, in general, limited by low transfection efficiencies and the indiscriminate transfection of both normal and tumor tissue.  1.4.2 Calcium Phosphate Precipitation Efficient in vitro transfection of cells can also be achieved by precipitation of plasmid DNA with calcium phosphate, originally reported by Graham and Van der Eb (1973). Calcium phosphate precipitation involves the complexation of plasmid DNA with calcium phosphate precipitates which, when introduced onto  16  cells, efficiently delivers the plasmid DNA to the nucleus in a number of cell lines (Jordan et al., 1996). There have been investigations in vivo using calcium phosphate precipitates of DNA for delivery into the peritoneal cavity or directly into tissue (Benvenisty and Reshef, 1986; Dubensky et al., 1984); however, this technique suffers from problems with the consistency in precipitate formation (Haberland et al., 1999), leading to irreproducibility. The mechanism by which calcium phosphate facilitates gene delivery to cells is not well understood (Haberland et al., 1999; Yang and Yang, 1997).  1.4.3 Cationic Polymers The most common non-viral vectors for in vivo delivery of DNA are cationic in nature including cationic polymers such as poly(ethylenimine) (PEI) (Boussif et al., 1995; Chemin et al., 1998; Ferrari et al., 1997) and poly(L-lysine) (PLL) (Chiou et al., 1994; Lucas et al., 1999). Cationic polymers complex with DNA spontaneously to form "polyplexes" by charge interaction with the negatively charged DNA. Polyplexes facilitate intracellular delivery of DNA into tumor cells both in culture as well as tumor tissue in mice (Bos et al., 2004; Pollard et al., 1998; Zaric et al., 2004). However cationic polyplexes exhibit toxic side effects particularly upon intravenous administration (Dash et al., 1999; Hwang and Davis, 2001). Significant transfection levels have been observed for lung tissue where most intravenously delivered polyplexes preferentially accumulate (Brown et al., 2001; Rudolph et al., 2000; Verbaan et al., 2001).  17  1.4.4 Synthetic Vectors with Viral Coat Components The higher transfection potency of viral systems as compared to non-viral systems has also prompted some groups to explore the packaging of non-viral DNA into virus-like coats constructed from viral components; thus providing the carrier with efficient cell attachment, internalization and endosomal release properties (Fender et al., 1997; Waelti and Gluck, 1998). However, the introduction of viral components will likely generate immunological responses similar to those experienced with viral vectors.  1.5 Lipids and Liposomes Since the non-viral gene delivery systems studied in this work are lipid-based, a background discussion on the characteristics of lipids and their biophysical nature is included below. The lipids used in this work can be classified into five different categories: phospholipids, sphingolipids, cholesterol, PEG-lipids, and cationic lipids. The first three of these lipids are naturally occurring and the last two are synthetic.  1.5.1 Naturally Occuring Lipids Phospholipids are the most abundant class of lipids in biological membranes. The structure of these lipids, classified as glycerophospholipids, is shown in Figure 1.5. There is great diversity amongst phospholipids arising from the various combinations of fatty acid tails and polar head groups. Phospholipids are  18  named based on their head group composition, and consist of phosphatidylcholines (PC), phosphatidylethanolamines (PE), phosphatidylserines (PS), phosphatidic acids (PA), phosphatidylglycerols (PG), phosphatidylinositols (PI) and cardiolipins (CL). The type of headgroup is a major factor determining their physical properties. Phospholipids can be anionic (PS, P G , PI, and CL) or zwitterionic (PC and PE) according to the charge on the headgroup. Variations in the length and degree of unsaturation of the acyl chains result in additional diversity. Typically phospholipid acyl chains in biological membranes range from 16 to 24 hydrocarbons. Most of these lipids are bilayer forming while others prefer the hexagonal phases (discussed in Section 1.5.4). Phospholipids are a structural constituent of biological membranes. Their amphipathic nature with a hydrophilic region at one end and hydrophobic portion at the other, results in the spontaneous formation of bilayer membranes in aqueous environments, with the hydrophilic headgroups oriented towards the aqueous environment and the hydrophobic tails facing each other in the hydrophobic core region of the membrane (Figure 1.6) (Israelachvili et al., 1977). Cell membranes are asymmetric with certain lipid species restricted to the cytoplasmic or the extracellular leaflet of the plasma membrane (Rothman and Lenard, 1977), where the asymmetry is maintained by lipid transport proteins or flippases. Additional naturally occurring lipids used in this work include sphingolipids and cholesterol. Sphingolipids are based on the long chain amino alcohol  19  0  A.  Phospholipids  Ro'^ y^ v  V  v  0  " 0  Headgroups  A c y l c h a i n s (R,, R ): 2  (X)  Phosphatidylcholine (PC)  0  ^ " \ ^  N  (  C  H  3 > 3  +  Oleoyl (18:1A ): 9  ^.NH,+ Phosphatidylethanolamine ( P E ) P h os p ha tidy (serine ( P S ) '  B.  o M O  ]  ^ MH +  H CH / S  0  H  C.W.f  '  3  Palmityl (16: 0): C H ( C H 2 ) C = 0 3  U  Sphingolipid HO RNH OR" C e r a m i d e : R = C O R " , R' = H , ( R " = hydrocarbon)  SMvslihiieslirii!  Figure 1.5 Structures of naturally occurring lipids used in this work.  20  Hydrophilic  Hydrophobic  Aqueous Buffer 1  f  OCKN?OOOCN?00€>0000 Biological Membrane  Figure 1.6. Amphipathic lipids in bilayer configuration in an aqueous environment.  21  sphingosine (Figure 1.5) and the linkage of a fatty acid to the amino group of sphingosine yields ceramides. Cholesterol is a sterol lipid present as a structural lipid in most eukaryotic membranes (Figure 1.5). In bilayers, cholesterol orients itself with its hydroxyl group in close proximity to phospholipid head groups (Huang, 1977). The effect that cholesterol has on membranes can be complex as it can both enhance the flexibility and mechanical stability of a membrane and can facilitate the destabilization of bilayer membrane structures into non-bilayer phases (Cullis et al., 1978; de Kruijff et al., 1978). In most situations cholesterol serves to decrease the permeability of lipid bilayers.  1.5.2 Synthetic Lipids The two synthetic lipid classes used in this work are the PEG-lipids and cationic lipids. PEG-lipids are designed primarily to protect lipid-based carrier systems from removal from the circulation by the mononuclear phagocytic system (MPS), thereby increasing the circulation lifetime (Allen et al., 1991; Johnstone et al., 2001). PEG-lipids are composed of a poly(ethylene glycol) (PEG) molecule attached to the headgroup of a lipid molecule. For the systems studied in this work the P E G polymer is attached to a ceramide sphingolipid with varying acyl chain lengths (Webb et al., 1998). The variation in chain length affects the dissociation rates of the PEG-ceramide from the lipid membrane, with those containing shorter length ceramides dissociating faster from the bilayer (Webb et al., 1998). By altering the dissociation rates in this way, the PEG-ceramide which inhibits interactions with target cells, can be programmed to leave the  22  liposome while in the circulation. Cationic lipids are extremely rare in biological membranes, found in nature only as sphingosine and stearylamine. The utility of cationic lipids as DNA transfection agents was pioneered by Feigner in 1987 who showed efficient gene delivery when the DNA was complexed to liposomes composed of a synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium  chloride  (DOTMA) (Feigner et al., 1987). Since then, a great number of cationic lipids have been synthesized (Figure 1.7) and studied for gene delivery (Budker et al., 1996; Feigner et al., 1994; Fenske et al., 2001b; G a o and Huang, 1995; Kikuchi et al., 1999; Rosenzweig et al., 2000). The positive charge on cationic lipids is critical for gene delivery systems since it facilitates an interaction with polynucleic acids (e.g. DNA, antisense).  In addition, the positively charged lipid aids in  binding of the carrier to the host cell membrane prior to internalization (da Cruz et al., 2001) and facilitates endosomal release (Hafez et al., 2000).  1.5.3  Liposomes  Liposomes have been a valuable tool as model membrane systems for investigating the physical properties of lipids (Cullis and de Kruijff, 1979) and are also effective carriers for the delivery of both conventional and genetic drugs in vivo (Allen and Cullis, 2004; Engelmann et al., 1999; Gokhale et al., 1997; Tsavaris et al., 2002). Liposomes are classified as multilamellar vesicles (MLVs), large unilamellar vesicles (LUVs) or small unilamellar vesicles (SUVs) (Figure 1.8). MLVs are formed when bilayer forming lipids are dispearsed in aqueous  23  DODAC (N»N-dioteoy{-N.N-dimcthylammoni«m chloride)  DOTAP(N-[2,3-(dio!eoylo>:y)propylJ-N.N,N-tt-im«tb>'lammoniiim chloride)  DOTMA (N-[2,3-<dioIey tos}'}propyl>N,N,N-trime«hyhmmonium chioridc)  D D A B (N,N-disie.iryl-N,N-dimethylanunoniurn bromide)  D_:::r::: ».::::.  :DMR!E{H-[2,3-(dimyrislyloxy)propyl]^N,N-dimrthyl-N-hydroxyct]tylammoni«m bromide):  O  H :::  DC-CHOL {3-5-rN-(N',N*-dimclhylaminoethyl>carbamoyl] cholesterol) Sit  Ml,  DOSPA p,3-<dio!«yloxy>-N-[2-<spermine carboxatnido)eihyllK.N-dimeihyl-l-propanaminium  trifluoroacetafc)  Figure 1.7 Structures of commonly used cationic lipids. Reproduced from Palmer, 2000.  24  media (Bangham et al., 1965) and are comprised of an onion skin arrangement of concentric lamellae having a diameter of 1 to 10 urn with a small entrapped volume (0.5 |iUurnol lipid). L U V s are smaller than M L V s and are composed of a single bilayer and range from 50 to 200 nm in diameter. LUVs can be prepared by a number of different methods including reverse phase evaporation (Szoka and Papahadjopoulos, 1978), detergent dialysis (Zumbuehl and Weder, 1981) and extrusion (Mayer et al., 1986; Olson et al., 1979), and are the most commonly used liposomes for drug delivery applications. S U V s are also single bilayer vesicles; however, they have much smaller diameters than LUVs ranging from 20 to 50 nm. S U V s can be formed by sonication of MLVs (Huang, 1969) or passing MLVs through a French press (Barenholzt et al., 1979). The detergent dialysis method to produce LUVs (mentioned above), was used to formulate S P L P systems (liposomal systems encapsulating plasmid DNA (see Section 1.6.3)) used in this work. Detergents are amphiphilic molecules with a hydrophilic head group and a single hydrophobic tail, existing as a monomeric dispersion in aqueous solution when at low concentrations. At the critical micelle concentration (cmc), detergents aggregate to form micelles. The formation of liposomes using this method involves combining detergent with lipids, forming mixed micelles. By subjecting the mixture to dialysis in membranes of low molecular weight cut off, the detergent in monomer form is removed from the mixed micellar solution. A s the concentration of monomers is decreased, detergent molecules exchange out of the micelles. A s this process continues, intermediate structures including cylindrical micelles, lamellar sheets  25  Multilamellar vesicles (MLVs)  Figure 1.8. Classification of L i p o s o m e s . Schematic representation and freeze fracture electron micrographs of MLVs, LUVs and S U V s . The bar in the E M picture represents 200 nm.  26  and leaky vesicles are formed (Ollivon et al., 1988). Once the detergent has been largely removed, stable L U V s are left. The most suitable detergents for LUV formation are ones with a high cmc value (> 1mM) and small micelle size (Dencherand Heyn, 1978).  1.5.4 Lipid Polymorphism In Chapter 2, particular focus is placed on modifying the levels of lipids in the carrier system that prefer non-bilayer phases. Such lipids facilitate intracellular membrane fusion and destabilization. Below, an introduction into the factors that influence the phase preference of lipids is presented. In aqueous environments, membrane lipids adopt macroscopic phases (Figure 1.9), the most common phase being the bilayer phase, however, lipids also adopt a number of non-bilayer phases such as the hexagonal (H ) or M  isotropic phases. This ability to adopt different phases is referred to as lipid polymorphism. The polymorphic phase adopted by a lipid is primarily determined by the molecular shape of the lipid (Cullis et al., 1986). For example, lipids such as detergents and lysolipids, where the area occupied by the head group is large compared to the tails, can be thought of as having a "cone" shape and tend to form micelles. Lipids adopting the bilayer phase such as P C s tend to have a similar cross-sectional area in the polar headgroup and acyl chain region giving them a "cylindrical" shape. Finally, lipids such as unsaturated P E systems that have a small head group with unsaturated acyl chains can adopt an "inverted cone" shape leading to hexagonal (Hu) phase structure. The shape hypothesis  27  Shape:  Phase Structure:  Inverted Cone  Micellar  Cylinder  Lamellar  Cone  Inverted Micellar  Figure 1.9. Polymorphic phases of lipids. Common shapes and resulting structures: (A) micellar, (B) lamellar and (C) inverted micellar (Hu phase). Reproduced from Cullis and de Kruijff, 1979.  28  can predict the phase behavior of a lipid mixture. For example, equimolar mixtures of nonbilayer micellar lipids (cone shaped) and non bilayer Hn phase preferring lipids (inverted cone shaped) can adopt bilayer phases (Madden and Cullis, 1982). The phase that a given lipid adopts is also influenced by the presence of ions, temperature or pH. For example, the structure of unsaturated P S changes from bilayer to inverted hexagonal phase following a decrease in pH below 4 (Cullis et al., 1986). This change results from the protonation of the negatively charged carboxyl group of the P S headgroup, leading to a smaller effective headgroup and promoting the formation of an Hu phase structure. The polymorphic properties of different lipids have been reviewed by Cullis and de Kruijff (1979), and Gruner et al. (1985).  1.5.5 Liposomes as Carrier Systems Liposomes have been extensively studied as vehicles for the delivery of anticancer drugs to tumor sites. Delivery of drugs encapsulated into liposomes has significant advantages over administration of the free drug since liposomes preferentially accumulate at tumor sites when they are small in size (-100 nm diameter) and have long circulation lifetimes (t-i/ > 5h) (Gabizon et al., 1994; 2  Yuan et al., 1994). Normal vasculature consists of capillaries that have a continuous lining of endothelial cells with an uninterrupted sub-endothelial basement membrane. In contrast, tumor vasculature is more permeable due to large defects in the endothelial layer, including fenestrations, widened inter-  29  endothelial junctions and, in some cases, the presence of only blood channels with little or no endothelial lining at all (Maeda et al., 2000). Consequently, these defects facilitate local leakage and accumulation of small carrier systems at tumor sites, known as the enhanced 'penetration and retention effect' (EPR effect) (Maeda, 2001) (Figure 1.10). Liposomes composed of neutral lipids or protected with a poly(ethylene glycol) (PEG) coating in order to achieve long circulation lifetimes (Allen et al., 1991), lead to maximum tumor accumulation (Sadzuka etal., 1998). Liposomes have shown promise as drug delivery systems for the treatment of cancer for a number of conventional drugs. These include Doxil® or Calyx® (liposomal doxorubicin for metastatic ovarian cancer and advanced Kaposi's sarcoma) and Marquibo® (liposomal vincristine for the treatment of nonHodgkins lymphoma) (Allen and Cullis, 2004; Gelmon et al., 1999; Maurer et al., 2001; Skubitz, 2003). Liposomal systems have a further advantage since they can be modified to incorporate ligands on their surface in order to target their location to a specific tissue type following systemic delivery. A number of target ligands have been explored in combination with a number of strategies for the convenient attachment of the ligand to the surface of the liposome, reviewed elsewhere (Nobs et al., 2004; Park, 2002). The successful application of liposomes for the delivery of conventional drugs, resulting in enhanced tumor accumulation makes them a promising carrier system for the delivery of genetic material to tumor sites. It is this line of reasoning that led to the formulation of stabilized antisense-lipid particles (SALP)  30  Figure 1.10. A schematic diagram depicting the passive accumulation of liposomal formulations at diseased tissues through the EPR effect. (A) Liposomes containing anticancer drug extravasate from the blood through gaps in the vascular endothelial cells and accumulate in solid tumor tissue. (B) Drug is release from the liposome and taken up into the cells. (C) Liposomes containing nucleic acid-based therapeutics such as plasmid DNA or antisense oligonucleotides bind to the cell surface through electrostatic charge interactions or ligand-mediated receptor endocytosis, triggering internalization of the liposomal carrier into the endosomes. A proportion of the encapsulated material escapes the endosome with subsequent intracellular release. Reproduced from (Allen and Cullis, 2004)  31  and stabilized plasmid-lipid particles (SPLP), which are both investigated for their intracellular delivery properties in this work (see Sections 1.6.2 and 1.6.3).  1.6 Non-Viral Lipid-Based Gene Delivery Systems for Systemic Application An ideal gene therapy therapeutic would be one that could be administered intravenously with low toxicity, and that selectively localizes to, and transfects cells at, distal tumor sites. Most current non-viral systems lack the capacity to localize at tumor sites for the treatment of metastatic disease and are most effective when delivered directly to the site of the pathology (Brown et al., 2001; Nabel et al., 1996; Stopeck et al., 1998).  1.6.1 Systemic Delivery Issues Injection of naked DNA into the systemic circulation leads to rapid degradation of the DNA in the blood by serum nucleases (Houk et al., 1999). Cationic lipid and cationic polymer based formulations that complex the DNA through charge interactions offer partial protection to DNA from nucleases (Chiou et al., 1994; Faneca et al., 2002). However, the charged lipid or polymer is often in excess in these formulations yielding a strong net positive charge on the surface of the complex. The excess positive charge causes extensive non-specific interactions with cells, proteins and other macromolecules in the circulation, leading to the formation of large aggregates that can lodge in the microcapillary vessels of the lung (Mahato et al., 1998; Verbaan et al., 2001). A s a result, transfection is  32  largely confined to the lung endothelium, which is the first capillary bed encountered following intravenous injection (Brown et al., 2001; Chollet et al., 2002). Also, injections of particles composed of DNA complexed to positively charged lipids or polymers are often toxic. For example, injections with poly(ethyleneimine) (PEI) DNA complexes induce lung embolisms caused by their aggregation with blood cells in the circulation (Ogris et al., 1999).  1.6.2 Stabilized Antisense-Lipid Particles (SALP) Stabilized antisense-lipid particles (SALP) are antisense delivery systems composed of antisense oligonucleotides (ASODNs) encapsulated inside 80-140 nm diameter lipid vesicles (Semple et al., 2001). The formulation of S A L P particles involves the introduction of a mixture of lipids (containing a cationic lipid) dissolved in ethanol to an aqueous buffer at pH 4 containing the dissolved A S O D N s . The subsequent removal of the ethanol from the mixture by dialysis induces the spontaneous formation of liposome encapsulated A S O D N particles. Critical to this procedure is the use of the ionizable aminolipid (1,2-dioleoyl-3dimethylammonium propane, (DODAP)). D O D A P efficiently interacts with and packages the A S O D N into S A L P particles at low pH where it is positively charged, but at physiological pH D O D A P is neutral; thereby eliminating the unfavorable pharmacokinetic and toxicity properties usually observed with cationic gene carrier systems in vivo. Also, the D O D A P on the external leaflet of the S A L P particle can be neutralized following formulation resulting in release of externally bound A S O D N , facilitating the removal of untrapped A S O D N by anion  33  exchange chromatography. The typical encapsulation efficiency of A S O D N using this method is 70% (Semple et al., 2001). The S A L P formulation used in this work is composed of 1,2-distearoyl-snglycero-3-phosphocholine (DSPC): cholesterol: D O D A P : 1-0-(2'-(wmethoxypolyethyleneglycol)succinoyl)-2-N-myristoylsphingosine  (PEG-CerCu)  (25: 45: 20: 10; mol%). S A L P particles show complete protection of the A S O D N from nucleases and significantly enhanced circulation lifetimes (ti/ ~ 5-6 h) 2  relative to free A S O D N (ti  /2  ~ 5-10 min) and A S O D N cationic lipid complexes (ti/  2  < 5 min) (Semple et al., 2001). S A L P systems have been used to deliver A S O D N to downregulate genes involved in immune stimulation (Semple et al., 2000) as well as tumorigenesis (Leonetti et al., 2001). However it is unclear whether the antisense effects observed in these studies were related to sequence-specific or non-sequence specific A S O D N activity (Bramson et al., 2000; Semple et al., 2004).  1.6.3 Stabilized Plasmid-Lipid Particles (SPLP) Stabilized plasmid-lipid particles (SPLP) are non-viral gene carrier systems composed of a plasmid encapsulated inside a small (-70 nm), well defined lipid vesicle (Figure 1.11) (Wheeler et al., 1999).  S P L P are formed by a detergent  dialysis procedure in which a mixture of lipid and plasmid DNA are suspended in an aqueous buffer solution containing detergent. Removal of the detergent by dialysis results in the formation of the S P L P particle (Wheeler et al., 1999). The S P L P s are purified from untrapped plasmid DNA by anion exchange  34  chromatography, followed by the removal of empty LUVs by sucrose density centrifugation. S P L P particles are typically composed of 3 primary lipids. The major component is the fusogenic, non-bilayer forming phospholipid dioleyl phosphatidylethanolamine (DOPE) (cf. Section 1.5.1) which facilitates fusion and escape from endosomal/lysosomal compartments following cell uptake (Farhood et al., 1995). Also included is the cationic lipid N,N-dioleyl-N,Ndimethylammonium chloride (DODAC) which interacts with the plasmid DNA resulting in encapsulation of the plasmid (cf. Section 1.5.2). Also, D O D A C helps to stabilize the D O P E into a bilayer organization in the S P L P particle. The third lipid component is P E G - C e r C  2 0  (cf. Section 1.5.2). P E G - C e r is incorporated in  order to prevent aggregation during S P L P formation, to further stabilize the D O P E into a bilayer, as well as to improve the circulation lifetime following systemic intravenous administration by preventing the uptake and removal of the S P L P particle from the circulation by the reticuloendothelial system (RES) (Allen et al., 1991; Johnstone et al., 2001). The most commonly used lipid composition of S P L P in this work is D O D A C : D O P E : P E G - C e r C  2 0  (8: 82: 10; mol%). Also the  S P L P used in this work contained a plasmid encoding for the luciferase reporter gene driven by a C M V promoter (Figure 1.12). Systemic intravenous administration of S P L P in mouse tumor models results in significant accumulation of plasmid at distal tumor sites with tumor transfection levels that are over 1000 times higher than in any other tissue (Monck et al., 2000). However the gene expression levels are insufficient for most gene therapy  35  Fusion Regulator  Figure 1.11. Stabilized P l a s m i d - L i p i d Particles. (A) A schematic diagram of an S P L P and (B) Cryoelectron micrograph of a suspension of S P L P (Saravolac et al., 2000). The bar in panel (B) represents 50 nm.  36  applications, a situation which arises due to poor intracellular deliverycharacteristics of the particle. The barriers to efficient intracellular delivery of gene carriers are discussed in detail below.  1.7 Intracellular Barriers to Non-Viral Gene Delivery DNA is generally localized to cell nuclei and there is no mechanism to import DNA from the cell's surroundings. A s a result, introducing DNA into the target cell nucleus in order for gene expression to occur requires overcoming a number of cellular barriers that protect the cell from its external environment and maintain its internal organization. The major barriers are: Internalization and escape from the endocytosis pathway, carrier stability, breakdown of DNA in the cytoplasm, nuclear entry and obstacles following nuclear entry.  1.7.1 The Endocytosis Pathway Essential small molecules such as amino acids, sugars and ions traverse the plasma membrane through membrane protein pumps or channels. Macromolecules, however, are carried into the cell by membrane bound vesicles formed by the invagination and pinching-off of segments of the plasma membrane in a process known as endocytosis. Endocytosis can be classified into two categories based on the mechanism of uptake: Phagocytosis (the uptake of large particles > 0.5 pm in diameter) and pinocytosis (the uptake of fluid  37  Figure 1.12. Map of plasmid D N A (pCMV-Luc) u s e d in this work. The plasmid encodes a cytomegalovirus promoter/enhancer element (CMV), the North American firefly Photinus pyralis luciferase reporter gene (Luciferase), a kanamycin resistance gene (KanR) and the ColE1 origin of replication site (ColE1 Oh).  38  and solutes into smaller vesicles < 0.2 pm in diameter) (Conner and Schmid, 2003) . Phagocytosis is limited to specialized mammalian cells while pinocytosis occurs in all cells by at least four potential mechanisms: macropinocytosis, clathrin-mediated endocytosis (CME), caveoli-mediated endocytosis, and clathrin- and caveolae-independent endocytosis (Conner and Schmid, 2003). Electron microscopy data (Labat-Moleur et al., 1996; Zhou and Huang, 1994) and several other studies demonstrate that internalization of lipid-based gene carriers by cells occurs primarily via the C M E pathway (Friend et al., 1996; Maurer et al., 1999; Zabner et al., 1995; Zelphati and Szoka, 1996a; Zelphati and Szoka, 1996b). The C M E pathway is well understood and occurs constitutively in all mammalian cells (Mellman, 1996). For example, cells such as macrophages and fibroblasts have been estimated to internalize more than 200% of their entire surface area every hour using this process (Steinman et al., 1983). Carrier/DNA complexes associate with the negatively charged cell membrane as a result of nonspecific charge interactions, initiating their internalization (Miller et al., 1998; Pires et al., 1999). A number of negatively charged surface molecules have been proposed to interact with cationic carriers including the most abundant anionic cell surface molecules, sulfated proteoglycans and sialic acids (MacLachlan et al., 1999; Mounkes et al., 1998). The interaction of DNA carriers with proteoglycans can increase (Mounkes et al., 1998) or decrease transfection efficiency (Ruponen et al., 2001), depending on the type of carrier used and the proteoglycan involved (Roth and Sundaram, 2004) . It is still not clear whether non-viral DNA carriers simply bind to  39  proteoglycans and are internalized or whether binding to proteoglycans serves as an anchor for the further presentation of the carrier to secondary receptors that then undergo specific receptor-mediated endocytosis (MacLachlan et al., 1999). Following the binding of the carrier to transmembrane receptors that are subsequently concentrated in clathrin coated pits, C M E is initiated. The coated pits invaginate and then pinch off to form clathrin coated endocytotic vesicles (CCVs). At this point, the C C V s rapidly lose their coats facilitating fusion with early endosomes (EE) maintained at a slightly acidic pH (pH 6.3 - 6.8) by A T P driven pumps (Al-Awqati, 1986; Mellman, 1996). In E E s , ligands and receptors dissociate and the free receptors selectively accumulate in tubular extensions that bud off from E E s to yield recycling vesicles (RVs) that transport receptors back to the plasma membrane. The remaining vesicular structures containing the ligands traverse to the perinuclear region and fuse with late endosomes (LEs) and lysosomes. In L E s and lysosomes, ligands are degraded by lysosomal enzymes in this lower pH environment (pH ~ 5). Recycling from the lysosome is generally a slow process which allows cells to accumulate large amounts of internalized material (Mellman, 1996). The C M E process is diagrammed in Figure 1.13. Often the location of fluorescently labeled lipid-based gene carriers can be visualized as punctate (speckled) patterns in cell micrographs generally accepted to reflect localization to endosomal or lysosomal compartments. For effective delivery, the carrier must escape this pathway before it is degraded in lysosomes (Figure 1.14). Numerous strategies have been developed to induce escape of  40  the carrier system from the endosomal/lysosomal pathway, as discussed in further detail in Section 1.8.  1.7.2 Fate of the Carrier and DNA in the Cytoplasm The studies conducted in this work are focused on the major barrier to effective gene delivery, escape from endosomal/lysosomal compartments. However there are other critical barriers faced by the gene carrier system after release into the cytoplasm. An example is vector unpackaging (Schaffer et al., 2000). The tightness of the packaging of the DNA by the carrier determines the balance between release of the DNA prematurely where it is susceptible to cytoplasmic nuclease degradation and DNA that is too tightly bound to the carrier, hindering transport to the nucleus and functionality of the gene. The location and mechanism of release of the DNA from the carrier are not well understood and further complicated by the dependence on the carrier used.  1.7.3 Delivery and Entry into the Nucleus The nuclear membrane presents a critical barrier to the entry of free and carrier associated DNA. Several studies show that less than 0.1% of cytosolically injected plasmid DNA is transcribed (Dowty et al., 1995; Pollard et al., 1998). Also, following treatment with an effective commercially available lipoplex formulation, less than 1% of cells stain positive for nuclear plasmid despite the presence of cytoplasmic plasmid in 80% of the cells (Liu et al., 2003). Entry through the nuclear pore complex (NPC) may be active or passive, determined  41  Lysosome  Figure 1.13. Schematic of the clathrin mediated endocytosis (CME) pathway. Adapted from Robinson et al., 1996.  42  Figure 1.14. Schematic illustrating the intracellular fate of lipid-based gene carrier systems. Upon endocytosis, the lipid-based carrier system uncouples from cell surface receptors and is either retained in endosomal/lysosomal vesicles where is eventually degraded, or it is released from the endosomal compartment introducing the plasmid DNA to the cytoplasm, from where it can translocate to the nucleus and express the target gene.  43  by the size of the molecule. Molecules smaller than 40 kDa and DNA molecules smaller than 300 bp diffuse through the N P C passively whereas larger molecules in the range of 60 kDa or plasmid DNA requires active transport (Ludtke et al., • 1999). Active transport requires the attachment of a nuclear localization signal (NLS) which is a short amino acid sequence that targets to the nucleus. This N L S can be attached to either the plasmid or the carrier system. A common N L S sequence is the SV40 Tag N L S ; however, more than 100 N L S sequences have been identified (Cokol et al., 2000). The highest transfection rates are generally observed when cells are dividing and the nuclear envelope has disassembled. This is evidenced by experiments comparing transfection efficiencies of cells at various stages in the cell cycle, demonstrating that cells in the G 2 / M phase show up to 500-fold increases in transfection relative to G1 cells when treated with lipoplexes or polyplexes (Brunner et al., 2000; Mortimer et al., 1999). Consequently, the variations in transfection efficiencies observed amongst different cell types may be explained in part by their differences in rates of cell division. In order to avoid the nuclear barrier altogether, research has also been conducted on an autocatalytic cytoplasmic expression system that does not require nuclear delivery of the DNA for gene expression to occur (Finn et al., 2004).  1.8 Strategies to Enhance Endosomal Release A s mentioned above, the main process for cellular uptake of non-viral DNA  44  delivery systems is endocytosis. The inability of non-viral gene carriers to efficiently escape the endosomal pathway is one of the single most difficult barriers currently faced by the gene therapy field (Brown et al., 2001; Feigner, 1997; Maurer et al., 1999; Roth and Sundaram, 2004; Schatzlein, 2001). Consequently, considerable efforts have been focused on modifying non-viral systems that facilitate release from these compartments. Most of these modifications exploit the unique characteristics of endosomal/lysosomal compartments, such as their low pH environment and the high percentage of negatively charged lipids in the inner leaflet of these vesicles (Daleke and Lyles, 2000). Molecules incorporated in gene carriers to induce endosomal release include peptides, polymers and lipids, and are discussed in further detail below.  1.8.1 Endosomolytic Peptides The exploitation of the acidic pH of the endosome for escape into the cytoplasm is a strategy employed by viruses and bacteria. Viruses and bacteria have an innate ability to escape from the endocytotic pathway with the help of protein domains found in their envelopes (Dimitrov, 2000). A common feature in these domains is the presence of an a-helical segment that gives these proteins their membrane-disruptive capacity (Pecheur et al., 1999). A well studied example is the N-terminal sequence of the influenza virus hemagglutinin subunit HA-2 which changes conformation in acidic conditions allowing the a-helical portion to insert into the lipid bilayer, causing membrane fusion (Doms et al., 1985; Qiao et al., 1998). The change in conformation is attributed to the presence of negatively  45  charged side chains such as glutamic acid residues that at higher pH repel each other, but in acidic conditions are neutralized due to protonation where upon they collapse into an oc-helix. The a-helical peptide inserts into the endosomal membrane leading to fusion or pore formation and eventually, endosomal release. Numerous peptides based on repeating sequences of weak acids have been explored including the G A L A peptide (Haenslerand Szoka, 1993; Parente et al., 1988; Simoes et al., 1998; Simoes et al., 1999; Subbarao et al., 1987) which consists of the repeating peptide motif Glu-Ala-Leu-Ala, the N-terminus of human adenovirus fibre protein (da Costa and Chaimovich, 1997; Hahn and Kim, 1991; Zhang et al., 1999a) and the N-terminus of hemaglutinin (INF peptides from influenza) (Plank et al., 1994; Wagner et al., 1992). pH-sensitive peptides have demonstrated reasonable intracellular delivery properties but suffer from difficult preparation procedures, high cost and problems of enhanced humoral and T-cell mediated immune responses (Horvath et al., 1998; Kalyan et al., 1994), limiting in vivo applications.  1.8.2 Endosomolytic Polymers pH dependent membrane disruptive polymers can be classified into weak acid or weak base polymers. Weak acid polymers that carry a negative charge at neutral pH such as poly(Glu) and poly(ethylacrylic acid) (PEAA) both demonstrate membrane disruptive properties in acidic conditions (Asokan and Cho, 2002). For example, P E A A forms cation selective aqueous pores in lipid membranes when introduced at low concentrations and complete micellation of  46  the membranes at higher concentrations (Murthy et al., 1999; Thomas and Tirrell, 2000). Polyanionic polymers with differing degrees of hydrophobicity and optimal pH ranges for activity have also been synthesized (Murthy et al., 1999; Stayton et al., 2000). These modified polymers exhibit different optimal pH ranges for activity introducing the possibility to develop customized delivery systems able to act at an early or late endosomal stage (Murthy et al., 1999). Also, acylacrylic acid polymers have been shown to enhance the intracellular release characteristics of both neutral liposomes and cationic non-viral carriers delivering a wide range of cargo including plasmid DNA and streptavidin-antibody complexes (Cheung et al., 2001; Jones et al., 2003; Lackey et al., 2002). Currently, the most widely used weak base polymer under investigation is the poly(ethyleneimine) (PEI). PEI can be synthesized as a linear or branched cationic polymer with every third amino nitrogen atom having the capacity for protonation giving the polymer buffering capacity at almost any pH value, often referred to as a "proton sponge" effect (Boussif et al., 1995; Ferrari et al., 1997). The proton sponge effect has been proposed to facilitate the escape of PEI systems from endosomal compartments by causing the endosome to swell due to the osmotic imbalance created by their buffering capacity (Boussif et al., 1995). Dendrimers composed of polyamidoamines also facilitate release from endosomes by this proton sponge mechanism (Tang et al., 1996). Intracellular delivery systems based on pH sensitive polymers have clear advantages over systems based on pH sensitive peptides in that such polymers can exhibit rapid membrane destabilization at well-defined pH values, are stable  47  and are relatively inexpensive to manufacture (Chung, 1996b; Kono et al., 1994; Meyer et al., 1998; Roux et al., 2002; Thomas and Tirrell, 1992; Zignani et al., 2000). Also, unlike pH-sensitive lipids and lipid-derivatives, synthetic polymers do not show a significant reduction in pH sensitivity in the presence of serum (Cheung et al., 2001; Forrest et al., 2004).  1.8.3 Endosomolytic Lipids Most studies with pH-sensitive lipids have focused on mixtures of D O P E stabilized into a bilayer organization by weakly acidic lipids such as oleic acid (Collins et al., 1990; Duzgunes et al., 1985) or cholesteryl hemisuccinate (CHEMS) (Ellens et al., 1985; Lai et al., 1985; Slepushkin et al., 1997). Fusogenic lipids such as oleic acid (Duzgunes et al., 1985) and cholesteryl hemisuccinate (Ellens et al., 1985; Hafez et al., 2000; Lai et al., 1985) contain weak acids as head groups. When incorporated into liposomes they induce pH dependent fusion as a result of their head group becoming neutralized at low pH, potentially triggering fusion between the liposomal and endosomal membranes. However, such systems are inherently leaky and are unstable in biological media. PEG-derivatized lipids help circumvent the instability of D O P E systems in serum (Guo and Szoka, 2001) but display significantly reduced pH sensitivity (Slepushkin et al., 1997). Enhanced intracellular delivery has also been observed with pH-sensitive detergents that become micellar once protonated (Chen et al., 2003; Liang and Hughes, 1998; Mandersloot et al., 1975) and pHlabile lipid derivatives such as plasmalogens that hydrolyze at low pH resulting in  48  increased liposome permeability (Gerasimov et al., 1997). However, there is a tendency for pH-sensitive detergents to partition out of the membrane; reducing the degree of membrane destabilization possible (Chen et al., 2003). Also, processes depending on pH-sensitive lipid lability tend to be relatively slow, leading to inefficient intracellular delivery properties (Gerasimov et al., 1997). A s discussed above (cf. Section 1.5.2), cationic lipids promote cellular delivery of nucleic acids due to cationic charge interactions with the negatively charge cell membrane. In addition, cationic lipids have also been shown to facilitate endosomal release by interacting with negatively charged lipids in the endosome and anionic membrane-associated moieties such as proteoglycans (Kopatz et al., 2004). The interaction between oppositely charged lipids leads to charge neutralization and can trigger a lamellar-to-hexagonal phase transition potentially promoting fusion between the liposomal and cellular membranes (Hafez et al., 2001). Examples of cationic lipids which have shown the successful delivery of plasmid DNA to the cytoplasm include D O D A P (da Cruz et al., 2001; de Lima et al., 1999) and amphiphilic imidazole-containing lipids (Budker et al., 1996). Like weak acid lipids, these cationic weak base lipids are also most active in the presence of fusogenic hexagonal phase preferring lipids such as D O P E (Asokan and Cho, 2002; Bentz et al., 1985). Imidazole lipids with a single akyl chain have also been synthesized to partition into and permeabilize the endosomal membrane once protonated (Chen et al., 2003). Initial studies with these molecules have demonstrated hemolytic activity; however, they currently have not shown significant improvements in the cytoplasmic delivery of  49  nucleic acids (Chen et al., 2003). Lipid conjugates have also been developed for insertion into lipid-based carrier systems to facilitate endosomal release. The insertion of the lipid into the liposomal carrier system forms a pro-carrier, which in the presence of acidic compartments hydrolyzes producing a lipid conjugate with membrane disruptive properties. For example, P E G linked to distearoylglycerol via an ester linkage can be used to stabilize D O P E into liposomes (Guo and Szoka, 2001). Once hydrolyzed in acidic conditions, the P E G moiety is released disrupting the bilayer configuration of the liposomal carrier, promoting the D O P E to fuse with the endosomal membrane, resulting in cytosolic delivery of the liposomal contents (Guo and Szoka, 2001).  1.9 Thesis Objectives There are clearly significant problems in the design of an effective gene therapy system for the treatment of cancer. This work focuses on understanding factors that affect the intracellular delivery properties of lipid-based DNA carrier systems; which is a major factor limiting the efficiency of non-viral gene therapeutics.  In  Chapter 2 the relative efficiency of free or S A L P delivered antisense oligonucleotide (ASODN) mediated downregulation of a target gene P K C - a is evaluated in vitro and in a mouse model. Observation of the intracellular fate of A S O D N s following delivery and quantitation of the relative levels of downregulation of the target P K C - a m R N A sequence demonstrated that S A L P  50  systems do not efficiently deliver antisense molecules intracellular^. In Chapter 3, focus is shifted towards studying the intracellular delivery properties of stabilized plasmid-lipid particles (SPLP) since assays to quantify delivery of a plasmid encoding for the luciferase reporter gene are more unambiguous, sensitive and relatively straightforward as compared to methods to determine A S O D N activity. Changes in lipid composition and transfection parameters of S P L P are studied for their effects on intracellular delivery. Factors affecting cell uptake and binding are differentiated from modifications that affect intracellular delivery by relating gene expression to the amount of carrier taken up by the cell. It was determined from these studies that the incorporation of P E G - C e r and C a  2 +  had the most significant effect on the intracellular delivery properties of S P L P . Chapter 4 further explores the significant enhancements in intracellular delivery of S P L P in the presence of C a  2 +  as well as investigating the underlying  mechanisms that lead to enhanced gene delivery in the presence of C a . These 2 +  experiments demonstrated that the C a the C a  2 +  2 +  effect is modulated by serum and that  effect involves the formation of Ca -phosphate precipitates that 2+  facilitate endosomal release of macromolecules taken up by the cell. Finally, in Chapter 5 the use of pH-sensitive polymers is explored to enhance the intracellular delivery properties of S P L P . Transfection studies with S P L P and a pH-dependent polymer demonstrated dramatic enhancements to gene expression by S P L P which could not be attributed to polymer-related modifications to the S P L P system or the effects on cell uptake.  51  CHAPTER 2 : EVALUATION OF THE INTRACELLULAR DELIVERY PROPERTIES OF STABILIZED ANTISENSE-LIPID PARTICLES IN AN IN VITRO AND IN VIVO MODEL SYSTEM  2.1 INTRODUCTION Polynucleic acid drugs are prominent examples of an emerging class of novel therapeutics that require intracellular delivery to enable activity. Plasmid vectors for gene therapy and antisense O D N represent the most active areas of polynucleic acid drug development. In order to create clinically relevant delivery vehicles for these molecules appropriate animal models are required in which activity can be assayed directly. Such assays include gene expression for plasmid vectors and reductions in target protein or mRNA levels for antisense O D N . The objective of the work described in this chapter is to characterize a murine model where liver concentrations of protein kinase C-oc (PKC-a) can be used to assess the effectiveness of intracellular delivery vehicles for murine P K C - a antisense O D N . The concept of antisense drugs is elegantly simple. A short sequence of DNA (15 to 25 bases long) is designed to bind to a single chain mRNA through Watson and Crick base pairing, the resulting R N A / D N A heterodimer is either cleaved by intracellular enzymes such as R N A s e H or physically blocks m R N A translation to protein (Crooke, 2004; Dean and Bennett, 2003). Antisense O D N s thus have the potential of being highly specific therapeutic agents for the treatment of diseases characterized by over-expression or inappropriate expression of genes, or genes that are expressed by invading microorganisms.  52  The sequence of the human genome combined with an increasing understanding of which genes are involved in the progression of diseases, means that if antisense drugs can be made to work in vivo they would represent a direct path for drug discovery and development. However, since the inception of this technology 15 to 20 years ago, only one antisense O D N has been approved for clinical use, a drug to treat cytomegalovirus retinitis (Orr, 2001), and it is administered directly into the eye. Results from many clinical trials testing intravenous or oral administration of antisense drugs to treat a broad spectrum of diseases have so far been disappointing (Agrawal and Kandimalla, 2000; Flaherty et al., 2001; Lysik and Wu-Pong, 2003). The two main barriers to the successful development of clinically active antisense drugs are (1) preventing degradation by serum nucleases and (2) delivering nuclease-stable O D N into the cytoplasm of target cells. Making O D N resistant to nucleases has been relatively straightforward to achieve through chemical modification of the phosphate backbone and/or bases (Opalinska and Gewirtz, 2002). The first generation antisense O D N molecules most commonly have phosphorothioate (PS) backbones in which the non-bridging oxygens of the natural phosphodiester (PO) configuration are replaced with sulphur atoms, making the molecule much more resistant to nuclease degradation. This was the earliest modification and so P S O D N are the most common antisense drugs currently used in clinical trials. However, it is now known that P S O D N s exhibit a greater tendency to bind non-specifically to serum and cellular proteins compared to native P O O D N molecules (Opalinska and Gewirtz, 2002; Wang et  53  al., 2003). These interactions are thought to contribute to immune stimulation and other unwanted side effects following intravenous administration (Agrawal, 1999; Galbraith et al., 1994). Second and third generation chemistries have since been designed that further increase nuclease resistance but also reduce non-specific binding; these molecules are currently undergoing clinical testing (Mani et al., 2003; Zellweger et al., 2001; Zheng, 1999). Successful intracellular delivery to target cells in vivo has proven to be a much more difficult problem to resolve. In vitro, antisense O D N are generally introduced into cells by the process of lipofection. This technique involves mixing O D N with cationic liposomes to form lipid/DNA complexes, which are then endocytosed by cells in culture. The lipid composition of these complexes is critical for the subsequent release of O D N from endosomes into the cytoplasm from where the molecules rapidly diffuse into the nucleus (see Introduction) (Brignole et al., 2003; Hope et al., 1998; Leamon et al., 2003).  Unfortunately,  lipid/DNA complexes that are effective in vitro are unstable in vivo (Dass, 2004; de Lima et al., 1999), and are unable to deliver therapeutic doses of antisense molecules or plasmid DNA into target cells in animal models.  Interestingly,  recent work from our group has demonstrated that liposome-based delivery systems that are unable to disrupt endosomes and deliver antisense O D N into the cytoplasm of cells in vitro, because they lack the required fusogenic "helper" lipids (Hope et al., 1998; Mui et al., 2000), can enhance the biological response to some antisense O D N following intravenous administration in murine models of inflammation (Klimuk et al., 2000; Klimuk et al., 1999) and cancer (Leonetti et al.,  54  2001). It is probable that the anti-inflammatory and anti-tumor effects observed in these studies are the result of sequence-specific immune stimulation by O D N , which is enhanced by liposome encapsulation as a result of the increased delivery to effector cells such as macrophages (Mui et al., 2001), rather than sequence-specific antisense effects. The objective of the studies described in this chapter was to establish an in vivo animal model in which the successful cytoplasmic delivery of an antisense molecule could be determined directly through measuring reductions in target mRNA and protein concentrations rather than indirectly through a more complex biological response that may not be mediated through an antisense mechanism. Once characterized, the model would then be used to compare the effectiveness of different lipid-based delivery vehicles. Initial attempts were made using a P S O D N targeting murine ICAM-1 mRNA, one of the most studied antisense molecules (Bennett et al., 1997; Crooke, 2004; Kumasaka et al., 1996; Yacyshyn et al., 1998), and an ear inflammation model previously described by Klimuk et al. (Klimuk et al., 2000; Klimuk et al., 1999). mRNA extractions from ear tissue rich in collagen, however, were not reproducible. Therefore, focus was shifted to a model targeting mouse protein kinase C - a (PKC-a) expression. A P S O D N homologous to a region near the start codon of murine P K C - a m R N A has been described in the literature with compelling evidence for a sequence-specific, dose-dependent downregulation of the targeted P K C isozyme m R N A in liver tissue following intravenous administration (Dean and McKay, 1994).  55  2.2  MATERIALS AND METHODS  2.2.1 Materials  Distearylphosphatidylcholine (DSPC) and 1,2-dioleoyl-3-dimethylammoniumpropane (DODAP) were purchased from Avanti Polar Lipids (Pelham, AL, USA). Cholesterol, citrate, NaCI, Hepes and DEAE-Sepharose CL-6B were purchased from Sigma-Aldrich (St. Louis, MO, USA). 1-0-(2'-(wmethoxypolyethyleneglycol)succinoyl)-2-A/-myristoylsphingosine (PEG-CerCu) was synthesized by Dr. Zhao Wang at Inex Pharmaceuticals Corp. (Burnaby, BC, Canada) as described elsewhere (Webb et al., 1998). N,N-dioleyl-N,Ndimethylammonium chloride (DODAC) was obtained from Dr. S. Ansell at Inex Pharmaceuticals (Burnaby, BC, Canada). 1,2-dioleoyl-sn-glycero-3phosphoethanolamine (DOPE) was purchased from Northern Lipids (Vancouver, BC, Canada)  2.2.2 Antisense Oligonucleotides  All ODN were purchased from Hybridon Specialty Products (Worcester, MA, USA) synthesized with phosphorothioate (PS) backbone chemistry. The name, mRNA targets, and 5'->3' sequences of ODNs used in PKC-a models are as follows:  Control Sequence: (scrambled control of human protein kinase C-a; (Rao et al., 2004), GGTTTTACCATCGGTTCTGG Active Sequence: (target: murine protein kinase C-a; (Dean and McKay, 1994), CAGCCATGGTTCCCCCCAAC 56  Extinction coefficients used to determine the oligonucleotide concentrations were calculated from the pairwise extinction values for individual nucleotides, taking into account nearest neighbor interactions.  2.2.3 Formation of lipid/DNA lipoplexes Equimolar quantities of the cationic lipid D O D A C and D O P E were mixed in chloroform and dried under a stream of nitrogen gas. The thin lipid film was exposed to high vacuum for approximately 2 h to remove residual solvent before hydration in distilled water to form multilamellar vesicles, typically at a concentration of 40 mM total lipid. The vesicles were freeze-thawed five times utilizing liquid nitrogen and warm water cycles and then extruded through threestacked 0.1 urn pore-sized polycarbonate filters using an Extruder (Northern Lipids, Vancouver, B C , Canada) to generate large unilamellar vesicles (Hope et al., 1985). Cationic liposomes were mixed with equal volumes of O D N at the specified concentrations in distilled water and incubated on ice for 10-20 min before use.  2.2.4 Fluorescence microscopy studies of ASODN in vitro J774 cells (ATCC, Manassas, VA, USA), were plated in D M E M medium supplemented with 10% (vol/vol) fetal bovine serum (FBS) (Invitrogen Inc., Burlington, O N , Canada) 18 h prior to treatment at a concentration of 1 X 1 0  5  cells/well in 24 well plates containing coverslips placed in each well prior to cell plating. Fluorescein isothiocyanate (FITC)-labeled A S O D N (15-mer with a 5'  57  label synthesized at the Nucleic Acid and Protein Synthesis Unit at the University of British Columbia, Vancouver, B C , Canada) was applied to the cells in free or lipid/DNA lipoplex form (described above) at a final concentration of 400 nM A S O D N : 14.5 pM lipid or encapsulated in S A L P form at an O D N concentration of 6 u.M and a lipid concentration of 500 uM in the cell culture well. Cells were incubated with the O D N for 6 h, washed 2 times with D P B S (Invitrogen Inc.), fixed for 20 min in a 3% paraformaldehyde solution in P B S , followed by 2 washings with distilled water, and then mounted onto glass slides. Micrographs of the cell specimens were taken using a Nikon Diaphot 300 epifluorescence microscope under 400X magnification.  2.2.5 Preparation of SALP Phosphorothioate A S O D N were encapsulated in lipid particles composed of D S P C : Cholesterol: D O D A P : P E G - C e r C (25: 45: 20: 10; molar ratio) using an u  ethanol dialysis procedure and ionizable aminolipid, D O D A P , as previously described (Semple et al., 2000).  Briefly, the oligonucleotides were dissolved to  a concentration of 3.33 mg/mL O D N in 20 mM citrate (pH 4.5), warmed to 80°C for 5 min (to ensure the A S O D N was in the monomer form by disrupting potential inter- and intra-molecuiar hybridizations), and then added to the lipids dissolved in ethanol. The initial A S O D N to lipid ratio was 0.25 (wt/wt ratio). The ASODN/lipid mixture was freeze-thawed 5 times and then passed 10 times through three-stacked 100 nm polycarbonate filters (Osmonics, Livermore, C A , USA) using a thermobarrel Extruder (Northern Lipids, Vancouver, B C , Canada)  58  maintained at approximately 65°C. The mixture was dialyzed in 12-14,000 M W C O tubing in 400 mM citrate buffer pH 4.5 for 2 h to remove the ethanol and then dialyzed overnight in H B S (10 mM Hepes, 145 mM NaCI, pH 7.5), followed by DEAE-sepharose CL-6B anion exchange chromatography to remove the nonencapsulated A S O D N . The mean diameter and size distribution of the S A L P particles was typically 110-120 nm in diameter and monodisperse, determined using quasi-elastic light scattering (QELS) with a NICOMP Model 370 submicron particle sizer (Santa Barbara, C A , U S A ) . Encapsulation efficiency was typically 70% determined by comparing the initial and final ratios of lipid/ASODN in the S A L P particle. To determine the ratio, the lipid and A S O D N components were separated from S A L P by Bligh-Dyer lipid extraction (Bligh and Dyer, 1959). The O D N concentration was determined by A 6o and lipid concentration was 2  determined by a phosphate assay (Bartlett and Lewis, 1970) of the D S P C lipid content. The total lipid concentration was then extrapolated based on the assumption that there was 25 mol% D S P C in the total lipid mixture.  2.2.5 In vitro transfections with ASODN C127:LT (ATCC) or Raw 264.7 (ATCC) cells were plated in D M E M media fortified with 10% F B S (vol/vol) 18 h prior to transfection at a concentration of 1X10 and 3 X 1 0 cells/well respectively. Cells were treated with free O D N at a 6  5  concentration of 400 nM or with lipid/DNA lipoplexes (described above) prepared in distilled water at a charge ratio of 2.0 (cationic lipid: DNA; mol: mol), yielding a final O D N concentration in the cell culture wells of 400 nM. All transfections were  59  conducted in reduced-serum medium (Optimem  , Invitrogen). At specified time  points, cells were washed 2 X with D P B S and then stored in lysis buffer (RLT buffer provided in the RNeasy™ kit, QIAGEN) prior to R N A isolation for analysis of m R N A levels (see below).  2.2.6 In vivo liver model treatments with ASODN Seven to eight week old Balb/C mice (inbred strain) were obtained from Harlan Sprague Dawley (Indianapolis, Indiana, USA) for this study. Animals were quarantined for 3 weeks prior to the experiment.  Mice were injected intra-  peritoneally (i.p.) with A S O D N in the free or encapsulated form at the desired A S O D N dose. Multiple injections were conducted as required with a 24 h interval period between injections. Twenty four hours following the last injection, mice were euthanized by CO2 asphyxiation followed by cervical dislocation, and then livers were dissected from the animals and immediately frozen in test tubes immersed in N (l). For further assays, segments of liver tissue were removed 2  from the liver while frozen and added to FastRNA™ tubes containing a lysing matrix suitable for R N A isolation from tissue (MP Biomedical, Irvine, C A , USA). RLT™ tissue lysis buffer (QIAGEN, Germantown, MD, USA) was added to the tubes and samples were homogenized using the FastPrep™ system (MP Biomedical). The homogenates were stored at -70°C and thawed immediately before R N A isolation.  60  2.2.7 RNA isolation Following in vitro and in vivo treatments with the A S O D N , cell lysates or liver tissue segments were processed using the RNeasy™ Kit (QIAGEN) involving a guanidine isothiocyante (GITC) and selective silica gel R N A isolation procedure. The isolation and purification of R N A was conducted as described in the protocols provided with the RNeasey™ kit for isolation from animal cells and animal tissue. The purified R N A was stored at -70°C in RNase-free water (provided with the kit) and thawed on ice immediately before ribonuclease protection assays were conducted.  2.2.8 Ribonuclease Protection Assay The purified total R N A from in vitro or in vivo experiments (described above) was assayed following treatment for antisense efficacy by determination of the target mRNA levels in the treated cells or liver tissue, respectively. Target m R N A levels were quantified using a ribonuclease protection assay (RPA) kit (BD Riboquant™, N J , USA). Briefly, probes for the target m R N A sequence as well as G A P D H and L32 housekeeping genes (included to normalize the mRNA levels to the total amount of R N A used in the assay and applied on the gel) were generated by DNA-dependent T7 R N A polymerase transcription of the target sequences cloned into a T7 promoter driven plasmid. P-oc-UTP was included in 32  the nucleotide pool to generate radioactive probes. The probe was then incubated with 20-25 pg of purified RNA producing dsRNA. s s R N A was removed from the mixture by introducing ribonuclease A and T1 which are specific to  61  ssRNA. The remaining protected R N A was then re-purified and separated on sequencing polyacrylamide gel containing urea. The gel was dried under vacuum and then imaged using a Typhoon 8600 Phospholmager apparatus (Amersham Biosciences, Piscataway, N J , U S A ) . The relative density of the bands was quantified using ImageQuant software (Amersham Biosciences).  62  2.3 RESULTS  2.3.1 Stabilized antisense-lipid particles are retained in vesicular compartments following uptake in vitro. Antisense O D N s predominantly function in the nucleus to downregulate the target gene of interest. In the nucleus, A S O D N s are in physical proximity to their target DNA or R N A sequence and are accessed by RNases, primarily responsible for catalyzing hydrolysis of target R N A once it is hybridized to an A S O D N molecule (Crooke, 1999; Vickers et al., 2003). Microscopy studies of fluorescently labeled antisense molecules were conducted in vitroXo further our understanding of the fate of S A L P encapsulated antisense at the cellular level. Macrophage-derived J774 cells were treated with free, S A L P and lipoplex associated FITC-labeled 15-mer A S O D N s for 6 hours. Following treatment, cells were washed with P B S to remove external A S O D N and then observed for the intracellular location and intensity of the cell-associated FITC-labeled O D N . Very low levels of intracellular O D N were observed following treatment with free O D N (data not shown). Following 6 h treatment with both S A L P and lipoplex particles (Figure 2.1A and 2.1B), antisense was present in punctate structures in the cytoplasmic and perinuclear region of the cell. However, in cells treated with lipoplexes (Figure 2.1 B), the majority of the fluorescent signal was detected outside of these punctate structures with a high degree of fluorescence in the nuclear region as well as diffuse fluorescence throughout the cytoplasmic region of the cell. These results provide visual evidence that S A L P particles are  63  Figure 2.1. Cellular uptake and location of ASODN delivered in lipoplexes as compared to SALP. J 7 7 4 macrophage-like cells were treated for 6 h with FITC-labelled A S O D N encapsulated in S A L P (6 uM dose) (A) or complexed to D O P E : D O D A C LUVs ( 4 0 0 nM dose) (B). Following incubation, cells were washed 2 X with normal medium to remove external O D N and then observed under a fluorescence microscope ( 4 0 0 X magnification).  64  primarily sequestered into endosomal/lysosomal vesicles and are unable to escape into the cytoplasm.  2.3.2 Antisense encapsulated in SALP are inefficient relative to lipoplexes in effecting target mRNA downregulation in vitro. An in vitro model using a cell line that has constitutively high expression of P K C a (Dean and McKay, 1994) was used to quantify the relative potency of antisense delivered in the free, lipoplex and encapsulated form. The A S O D N target m R N A sequence in this model is a murine P K C - a , previously demonstrated to effectively and specifically downregulate P K C - a m R N A expression (Dean and McKay, 1994). A control sequence O D N of the same length and chemistry (see Materials and Methods) was also included in these studies. Initially, assays were conducted with antisense delivered in lipoplex form, a well-established method to efficiently transfect cultured cells with O D N (Dean and McKay, 1994). These studies with O D N delivered complexed to cationic liposomes enabled us to establish a dose range and confirm that the sequence was effective in C127:LT mammary epithelial and R A W 264.7 murine macrophage cell lines. In the mammary epithelial cells, optimal downregulation of the P K C - a m R N A occurred following an 8 or 24 h treatment with lipoplexes containing the active antisense sequence, yielding an 80-85% reduction in P K C a m R N A levels (Figure 2.2B). Results were similar in the macrophage-like cell line; however, the baseline levels of P K C - a were lower, making A S O D N related  65  24h  8h  _j  X  CL  U  -  U  8  >  .  24h  > 8 0_ 1 — 1 — 1 — I  Q-  —I—i  PKC-a  m>  L32  W •  r^f~\Lj  J___L  Jb _ ____  W  W  W JH^I^^^  . ^ ^ ^ ^ ^  ^^^^^^^  i ^ ^ ^ ^ ^  j ^ ^ j ^ ^ -  ________  _ ^ _ ^ ^ ^  Figure 2.2A. RPA products following treatment of mammary epithelial cells with free and lipoplex ASODN. C127:LT cells were treated with 400 nM of the active P K C - a or a control A S O D N in free (F) or lipoplex (L) ( D O P E : D O D A C ; 1:1 mol%) form for 8 and 24 h. For the 8 h treatment, cells were washed and then replenished with fresh media for the remainder of the 24 h incubation. Results from control treatments with H B S and D O D A C : D O P E LUVs (LUVs) without O D N were also included. P K C - a m R N A expression was assessed by R P A analysis of 5 pg of total R N A following 24 h incubation. The hybridized products were separated by P A G E and then scanned for - P activity using a Phospholmager. 3 2  66  Figure 2.2B. P K C - a mRNA levels following treatment of mammary epithelial cells with free and lipoplex ASODN. Quantitation of the percentage of P K C - a m R N A levels relative to untreated cells was generated by normalizing levels of P K C - a hybridized products for each treatment to G A P D H and L32 housekeeping gene hybridized products. P K C - a m R N A levels were expressed as a percentage in relation to the untreated control cells. Data points represent the mean ± standard deviation (n=3)  67  changes in P K C - a m R N A harder to quantify (data not shown). Treatment with free antisense O D N s at a 400 nM concentration did not induce any m R N A reduction (Figure 2.2B). Also, transfections with the free or lipoplex control sequences did not significantly affect the P K C - a mRNA levels (Figure 2.2B), indicating that the downregulation observed with the active O D N was a sequence-specific effect. Once the activity of the P K C - a O D N was confirmed, a comparative study of the relative efficiency of S A L P systems to lipoplexes was conducted. C127:LT cells were transfected with S A L P encapsulated antisense and lipoplexes for 24 h. Treatments with up to 6.6 pM A S O D N (a 15X higher dose of active O D N than lipoplexes) did not affect the P K C - a m R N A levels as compared to the baseline P K C - a m R N A levels in untreated cells (Figure 2.3). The inefficient delivery by S A L P systems prompted the introduction of calcium in the 8-12 mM range into the transfection medium; which has previously been demonstrated to enhance the transfection potency of non-viral systems, presumably by enhancing cytoplasmic delivery of the genetic material following endocytosis (Lam and Cullis, 2000). Transfections with as high as 20 mM calcium in the transfection medium did not affect the P K C - a m R N A levels to any significant degree (Figure 2.3).  2.3.4 Antisense ODNs downregulate PKC-a mRNA in mouse liver tissue following intraperitoneal delivery. Experiments were then conducted to establish A S O D N efficacy as a function of  68  70 60 50 40 30 20 10 0  control PKC-a  0  5  10  15  20  25  Calcium in Transfection Media (mM)  Figure 2.3 P K C - a m R N A levels following treatment with S A L P and varying concentrations of c a l c i u m . C127:LT cells were treated for 24 h with 6.6 uM of the active P K C - a or control A S O D N in S A L P encapsulated form with varying levels of calcium in the transfection media. P K C - a m R N A levels were assessed by R P A analysis of 25 pg of total R N A extracted from the harvested cells following 24 h incubation. Quantitation of percentage of P K C - a m R N A levels relative to untreated cells was generated by normalizing P K C - a hybridized products for each treatment to G A P D H and L32 housekeeping gene hybridized products and then expressed as a percentage in relation to the untreated control cells.  69  the mode of delivery in an in vivo model. The mouse liver was chosen as a target organ for this model, since both phosphorothioate ODNs and non-viral lipid-based delivery systems were shown previously to accumulate in significant levels in the liver, while being cleared by the reticulo-endothelial system (Butler et al., 1997; Cullis and Chonn, 1998). Since these systems are not actively targeted to a desired tissue type, considerations were made to select a site known to significantly accumulate the A S O D N systems studied here. Balb-C mice were injected intraperitoneally with A S O D N targeting mouse P K C - a , or with a control sequence O D N (see Materials and Methods) for 1, 4 or 7 consecutive days. At 24 h following the last injection, mouse livers were harvested and assayed for P K C - a m R N A expression. A s shown in Figure 2.4B, there was a decrease in P K C - a m R N A in direct proportion to dosage of the active O D N sequence, with the highest reduction observed following treatment of 50 mg/kg of the active sequence for 4 days. This dose regimen was used for all further in vivo studies. There was no clear correlation between number of treatments and downregulation, with the most effective number of treatments appearing to be as low as 1 day at 100 mg/kg to 4 days at a 50 mg/kg dose (Figure 2.4B). Treatment with the control sequence was halted after 3 days due to lethal toxicity to the mouse at 50 mg/kg and 100 mg/kg doses and therefore, control sequence results were not included in the R P A analysis. It was later noted that the control sequence contained a C p G motif, which has been shown to have a strong immunogenic effect and is likely highly toxic at doses as high as  70  7 day Dose (mg/Kg):  1  10  50  4 day 100  1  10  50  1 day 100  1  10  50  100  HBS  P K C - a — Mi  Li2—  GAPDH—  if Iff f I f f l R l l l l Figure 2.4A. R P A products following intra-peritoneal treatment with free A S O D N targeting P K C - a m R N A . Mice were treated daily with a 1, 10, 50, and 100 mg/kg intra-peritoneal injection of a P K C - a or a control A S O D N for 1, 4, and 7 days. 24 h following the last injection, livers were harvested and tissue sections were subject to an R N A isolation/purification procedure described in Materials and Methods. R P A analysis was conducted on 15 pg of purified total RNA for each liver section using a -P-labelled P K C - a c D N A probe (Materials and Methods). The hybridized products from the R P A assay were separated on a sequence P A G E gel and the resulting - P labelled bands were visualized on a phosphoimager. Data for the control sequence were not available since the control A S O D N was fatally toxic following 3 injections; also, the 4-day control point was terminated after 3 injections. The non-digested probes which are relatively shorter by approximately 50 base pairs are included in the left-most lane to indicate the positions of P K C - a hybridized products as well as the housekeeping gene products for L32 and G A P D H . 32  3 2  71  _  140  i  120  c  100  •  1day  • 4 day •  7day  3  in >  80 60  E P  o  40 20  0.  1 mg/kg  10mg/kg  50mg/kg  100mg/kg  HBS (7day)  Figure 2.4B. P K C - a m R N A levels following intraperitoneal treatment with free A S O D N . To relate P K C - a m R N A levels quantitatively, the quantity of P K C a hybridized products (which correspond directly to m R N A quantity) were normalized for each treatment to G A P D H and L32 housekeeping gene m R N A levels and then expressed as a percentage in relation to the untreated control mouse.  72  50 and 100 mg/kg in mice (Gokhale et al., 2002; Wang et al., 2003). Treatment with free active A S O D N caused some moderate mottling of the liver tissue following 4 and 7 day injections however; there was no other evidence of toxicity during the treatment period.  2.3.5 Encapsulation of ODNs into stabilized antisense-lipid particles diminishes antisense activity in liver tissue in vivo. Once the dose range for the P K C - a antisense was established, experiments were then designed to define the activity of S A L P encapsulated A S O D N as compared to the free oligonucleotide. Balb-c mice were treated with a daily intraperitoneal injection of a 50 mg/kg dose of free or S A L P encapsulated O D N for 4 days. Livers were harvested 24 h following the last injection and assayed for P K C - a m R N A levels. Before reporting the relative effectiveness of the different delivery systems, the data obtained for the control ODNs has to be addressed. Comparison of the levels of normalized P K C - a mRNA suggests that the free control treatment induced a 60% reduction in P K C - a mRNA levels as compared to the levels observed in the untreated liver (Figure 2.5B). This can be attributed to a non-sequence specific downregulation of the target mRNA, which is a problem that is ubiquitous in the antisense field (Lysik and Wu-Pong, 2003; Stein et al., 1991) however, closer analysis of the expression level of the housekeeping proteins G A P D H and L32, suggests a different interpretation. Upon inspection of the hybridized products obtained following an R P A of the free  73  PKC-a  F-control  F-PKC-a  SALP-control  50  50  50  100  100  100  SALP-PKC-a 50  100  HBS  —  L32 GAPDH  «  W  •  W  •  mm  mm  mm mm mm  » mm  Figure 2.5A. R P A products from treatment with S A L P encapsulated antisense in relation to free A S O D N . Mice were treated daily with a 50, and 100 mg/kg intra-peritoneal injection of active P K C - a or a control A S O D N for 4 days. 24 h following the last injection, livers were harvested and tissue sections were subject to an R N A isolation/purification procedure. R P A analysis was conducted on 25 pg of purified total R N A from each liver section as described in the Materials and Methods section. The hybridized products from the R P A assay were separated on a sequence P A G E gel and the resulting - P labelled bands were visualized on a Phosphoimager. Lanes 1 and 2 containing hybridized products of free control O D N treatment show a 1.5 - 2 fold increase in L32 and G A P D H products. This does not reflect gel loading error since this was observed for all R P A s conducted with the free control A S O D N treatments. 3 2  74  140 f  • 50mg/Kg  120  n 100mg/Kg  1 100 00  3  >  or  E  80 60  9  40  QL  20  o  I control free  n  "  P K C - a free  control S A L P  PKC-a SALP  Figure 2.5B. Efficacy of SALP encapsulated antisense in relation to treatment with free oligonucleotide. The percentage of P K C - a m R N A levels relative to untreated mice was generated by normalizing P K C - a hybridized products for each treatment to G A P D H and L 3 2 housekeeping gene hybridized products and then expressed as a percentage in relation to the untreated control mice.  75  control treatments (Figure 2.5A), it is apparent that the level of these two housekeeping proteins is higher than the other sample lanes. It is possible that variations in loading of hybridized probes in each lane in the gel can account for up to a 3 0 % variation in final m R N A levels assayed; it cannot explain however, a 50% higher level of G A P D H and L32 m R N A in the free control treatments. A s a result, the more likely conclusion is that the free control O D N is affecting the G A P D H and L32 levels in the harvested liver tissue. This is supported by the observation that when the P K C - a m R N A levels are normalized to these housekeeping gene levels, the P K C - a m R N A levels appear to show a significant reduction. It should also be noted that the free control mouse livers were highly . necrotic following treatment. Re-assessment of the levels of P K C - a mRNA following treatment to levels observed in the untreated control liver, treatment with free active oligonucleotide induces a 60% reduction in P K C - a m R N A levels at both 50 mg/kg and 100 mg/kg doses (Figure 2.5B). The treatment of encapsulated active O D N induces up to a 70% reduction in potency at 50 mg/kg, and no reduction at the 100 mg/kg dose. Also, the encapsulated control O D N does not affect P K C - a m R N A at both the 50 and 100 mg/kg dose. The change in G A P D H and L32 levels observed following treatment with free control O D N was not observed in the encapsulated control group and there was no evidence of damage to the liver tissue. This may be attributed to the reduced capacity of the phosphorothioate O D N s to induce immune responses and tissue damage in encapsulated form as compared to treatment with the free O D N .  76  2.4 DISCUSSION The results from this section demonstrate that the S A L P carrier system is not optimized for efficient intracellular delivery of A S O D N .  Experiments tracking the  movement of SALP-encapsulated fluorescently labeled A S O D N clearly demonstrate that significant levels of A S O D N are taken up by cells. However, a majority of the oligonucleotide remains locked in endosomal/lysosomal compartments (Figure 2.1) thereby preventing it from reaching the nucleus where it can induce cleavage of its target m R N A sequence. Inefficient release of S A L P encapsulated A S O D N from intracellular vesicles directly correlated with the observation that there were non-detectable levels of P K C - a m R N A downregulation following the treatment of cells constitutively expressing P K C - a with A S O D N targeting murine P K C - a m R N A (Figure 2.3).  In contrast, similar  doses of P K C - a A S O D N delivered in lipoplex form induced up to an 8 5 % reduction in P K C - a levels (Figure 2.2). Semple et al. previously demonstrated an efficient method for the encapsulation of A S O D N into S A L P particles which considerably improves the pharmacokinetic and toxicity characteristics of P S - O D N when administered intravenously (Semple et al., 2001). Efficient encapsulation of the O D N is facilitated by incorporation of D O D A P , a cationic pH sensitive ionizable lipid (pKa of 6.7) that associates with the negatively charged DNA at low pH during liposomal formation. Following the encapsulation process, the untrapped O D N is conveniently removed from the liposomes by raising the pH to 7.4. A pH of 7.4 converts most of the D O D A P to its neutral form, reducing affinity of D O D A P for  77  the O D N . This ionizable lipid also confers a pH-dependent surface charge on the membrane, such that it is expected to be neutral at pH 7 in circulation and cationic once internalized into acidic compartments such as endosomes and lysosomes in the cell. The 20 mol% cationic charge in the S A L P membrane (when in endocytotic vesicles), introduces the potential for ion pairing with negatively charged phospholipids found in relatively higher concentrations in the endosomal membrane; thereby, inducing membrane destabilization and fusion events (Hafez et al., 2001). Despite this potential, the in vitro studies demonstrate that the S A L P system was not able to destabilize endosomal membranes to facilitate release (Figure 2.1 and Figure 2.3). It is possible that the poor intracellular delivery characteristics of S A L P may be related to the other lipid components in the membrane. Specifically, the composition includes 70 mol% D S P C : cholesterol (25: 45; molar ratio), which is a stable lipid composition that does not readily form non-bilayer structures that are intrinsic intermediates during membrane destabilization and/or fusion (Mui et al., 2000). Also, the S A L P membrane contains 10 mol% P E G - C e r C i , which is 4  expected to create a hydrophilic coating around the liposome, inhibiting close apposition and fusion of liposomes with neighbouring membranes (Holland et al., 1996). Furthermore, we propose that the presence of P E G on the surface of the membrane further reduces the potential for ion-pairing induced membrane destabilization discussed above. The relative efficiencies of free, lipoplex and S A L P delivery of A S O D N in the in vivo liver model was not consistent with the results observed in vitro.  78  Contrary to the lack of uptake and activity observed in vitro by free A S O D N , intravenous delivery of P K C - a A S O D N was the most effective mode of delivery, yielding up to a 7 0 % reduction in P K C - a m R N A in the liver following a single treatment of 50 mg/kg A S O D N (Figure 2.4). These conflicting results between in vitro and in vivo potency of free A S O D N are consistent with observations of other groups with phosphorothioate (PS) A S O D N treatments (Bennett, 1995; Dean and McKay, 1994). It has been speculated that the highly charged P S - O D N s adsorb proteins in the blood following injection, that facilitate their binding and uptake into cells, which does not occur in vitro. Also, we observed that lipoplexes are limited in their potential for in vivo application despite their efficient delivery of O D N in vitro. This difference is attributed to severe toxicity issues experienced when administered in therapeutic dose ranges and a predominant distribution of the O D N to organs such as the lung and the spleen (Bennett, 1995). In our studies, the mice treated with lipoplex A S O D N experienced lethal toxicity a few hours after injection and therefore could not be assayed for liver P K C - a downregulation. In vivo, treatment with SALP-encapsulated antisense induced up to a 60% downregulation of P K C - a in the liver; which was in contrast to the non-detectable changes in P K C - a mRNA in vitro. However, the reduction was lower or equal to the efficacy observed with the free antisense. These results were unexpected, since we postulated that the protection of the O D N inside lipid carrier systems reduces the degree of antisense loss to excretion as compared to free O D N ; thereby causing a higher degree of accumulation in the liver tissue. One  79  potential rationale for sub-optimal delivery characteristic of S A L P in vivo is that S A L P are primarily uncharged at physiological pH and may not interact as strongly as free P S O D N s with proteins in circulation and the extracellular milieu that may be critical for efficient cellular uptake. Another possible explanation is that the majority of the antisense administered in the free or lipid-encapsulated form is taken up in the liver by Kupffer cells as opposed to the hepatocytes or endothelial tissue. Kupffer cells have a higher affinity for charged particles as opposed to particles with a low surface charge, increasing the potential for higher uptake levels of the free O D N as opposed to O D N delivered in S A L P particles (Liu et al., 1995).  Finally, the uptake levels may have been similar; however,  differences in the intracellular processing of the S A L P system compared to the free O D N may have resulted in more of the free O D N releasing from endosomal compartments than SALP-encapsulated O D N . The degree of toxicity and non-sequence related activity of P S O D N s relative to the different modes of delivery was more predictable. In the in vivo experiments, treatment with the free control O D N increased the expression of G A P D H and L32 mRNA, as well as inducing lethal toxicity following a 50mg/kg dose treatment for 3 or more days. When the mice were treated with the same dose of encapsulated control A S O D N , no toxicity was observed and the G A P D H and L32 levels were not altered in relation to the untreated mouse liver (Figure 2.3A). Upon closer inspection, it was found that the sequence of the control ODN contained a C p G motif which has been well established as immunostimulatory (Krieg, 2002). Here we demonstrate that by encapsulation of  80  the immunostimulatory sequence into S A L P there is no evidence for toxicity at similar doses of the O D N administered in the free form. Also, the encapsulated O D N did not affect m R N A levels of the G A P D H and L32 housekeeping genes, suggesting that encapsulating O D N into S A L P reduced non-sequence specific effects on other m R N A levels in the liver tissue. In conclusion, although S A L P have optimized pharmacokinetics and clearance properties in vivo, close inspection of the lipid composition of the system along with in vitro transfection data supports the conclusion that it is not optimized to release its contents intracellularly. Also, these studies emphasize that A S O D N activity has to be examined carefully for potential effects on the mRNA levels of non-targeted genes and activation of the immune system, which can lead to misinterpretation of A S O D N potency.  81  CHAPTER 3: MODIFICATIONS TO STABILIZED PLASMID-LIPID PARTICLES THAT INFLUENCE INTRACELLULAR DELIVERY: CHARACTERIZATIONS BASED ON THE INTRACELLULAR RELEASE PARAMETER  3.1 INTRODUCTION The results of Chapter 2 indicate that in vivo delivery of antisense oligonucleotides encapsulated in the S A L P lipid-based delivery system does not result in significant down-regulation of target gene expression even in tissues where S A L P preferentially accumulate. There are a number of possible reasons for this; however the most obvious one is related to the inability of S A L P to downregulate target genes even under in vitro conditions, indicating that the intracellular delivery properties of the S A L P system are poor. In this chapter factors that may influence the intracellular delivery capabilities of S A L P and related delivery systems are investigated. In order to conduct these studies it was decided not to employ the S A L P system directly. The major reason for this is the high degree of variability noted in antisense activity between experiments and the tedious nature of the assays involved. Instead, the related "stabilized plasmidlipid particle" (SPLP) system was employed which contains plasmid rather than antisense oligonucleotides. By employing plasmid coding for expression of luciferase, an unambiguous, sensitive and relatively straightforward assay for intracellular delivery could be achieved. S P L P s are a well characterized gene delivery system that exhibit long circulation lifetimes following intravenous administration, resulting in preferential accumulation at disease sites such as tumors and relatively tumor-specific gene  82  expression in vivo (Fenske et al., 2002; Monck et al., 2000). S P L P are made employing a detergent dialysis procedure, are 70-80 nm in diameter and consist of a lipid bilayer composed of D O P E : D O D A C : P E G - C e r C  2 0  (82:8:10; mol%)  surrounding a single plasmid (Wheeler et al., 1999). These particles have been optimized with regard to their stability in circulation and ability to accumulate at tumor sites following intravenous injection, rather than their intracellular delivery properties. Factors that influence gene expression of these systems are included under the umbrella of intracellular delivery including: uptake into the cell, escape from the endosome or lysosome following uptake, and delivery of the DNA to the nucleus (see Figure 1.14 in Introduction). It has been determined by studies on cationic lipid-based gene carriers that S A L P and S P L P type systems enter cells mainly by charge-mediated interactions with proteoglycans or receptor-mediated endocytosis; in both cases, leading to uptake into vesicular compartments that ultimately deliver their contents to lysosomes (Davis, 2002). The poor intracellular delivery properties of S P L P and S A L P carriers are likely due to the limitation in their ability to escape the endosomal/lysosomal compartments following uptake. Assuming that we have the same amount of uptake of a gene delivery system into a cell, the actual amount of gene expression should be proportional to the amount of plasmid that escapes the endosome or lysosome. In this chapter we use this concept to introduce the "intracellular release parameter" (IRP) that is a measure of the gene expression normalized to the amount of DNA taken up into the cell. S P L P with lipid  83  compositions that facilitate release of plasmid from the endosome or lysosome will lead to higher values of the IRP. Similarly, the addition of other factors, such as C a , that can influence transfection will also lead to increases in the IRP 2 +  value. Measures of the IRP between S P L P with varied lipid compositions allow optimization to achieve maximum intracellular release and can be used to identify factors that inhibit such release.  84  3.2  MATERIALS AND METHODS  3.2.1 Materials. N,N-dioleyl-N,N-dimethylammonium chloride (DODAC) was obtained from Dr. S. Ansell at Inex Pharmaceuticals (Burnaby, B C , Canada) or purchased from Northern Lipids (Vancouver, B C , Canada) and 1-0-(2-(comethoxyethyleneglycol)succinoyl)-2-N-arachidoylsphingosine (PEG-CerC2o) was synthesized by Dr. Z. Wang, at Inex Pharmaceuticals or Dr. J . Hayes at Protiva Biotherapeutics (Vancouver, B C , Canada). 1,2-dioleoyl-sn-glycero-3phosphoethanolamine (DOPE) was purchased from Northern Lipids (Vancouver, B C , Canada). 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Lissamine Rhodamine B Sulfonyl) (Rh-DOPE) was purchased from Avanti Polar Lipids (Pelham, AL, USA). D E A E Sepharose C L - 6 B anionic-exchange column, octylglucopyranoside (OGP), Triton X100, sodium dodecyl sulfate (SDS), H E P E S , CaCl2, sucrose and NaCI were obtained from Sigma Chemical (St. Louis, M O , USA). Plasmid DNA (pCMV-Luc) coding for the luciferase reporter gene under the control of the human C M V immediate early promoter-enhancer element was obtained from Protiva Biotherapeutics (Burnaby, B C , Canada).  3.2.2 Preparation of SPLP. S P L P were prepared as described by Wheeler et al. (Wheeler et al., 1999) with some modifications. Briefly, a total of 10 umoles of D O D A C , D O P E , P E G C e r C o , R h o d - D O P E (8:81.5:10:0.5; mol%) were dissolved in chloroform and 2  85  dried under a stream of nitrogen gas. S P L P prepared with modified lipid compositions were prepared similarly with stocks of lipids dissolved in chloroform aliquoted in the desired ratios and then dried under nitrogen gas. Residual solvent was removed under high vacuum for 2 h. The resulting lipid film was hydrated in 1 ml of H B S buffer (20 mM H E P E S and 150 mM NaCI, pH 7.5) containing 0.2 M O G P with continuous vortexing. Plasmid DNA (400 u.g/ml) was added to the hydrated lipids and the mixture was dialyzed in 12-14,000 M W C O dialysis tubing (Spectrum Laboratories; Rancho Dominguez, C A , USA) against H B S buffer for 48 h with 2 buffer changes. Non-encapsulated plasmid was removed by D E A E anion exchange chromatography and empty lipid vesicles were removed by employing a sucrose density gradient, as previously described (Zhang et al., 1999b). Following sucrose gradient separation, the purified S P L P was dialyzed in H B S buffer for 24 h to remove residual sucrose from the sample and then concentrated in 100,000 N M W L centrifugal filtration units (Millipore; Billerica, MA, USA). S P L P were characterized with respect to plasmid entrapment as described previously (Zhang et al., 1999b) employing a dye that fluoresces upon DNA binding (PicoGreen; Molecular Probes); the exclusion of the dye from the DNA indicates that the DNA is bound and protected. The particle mean diameter was determined using a submicron quasi-elastic light scattering particle sizer (Nicomp; Santa Barbara, C A , USA). S P L P formulations used in this study demonstrated a maximum of 5-10% untrapped plasmid following purification, with particle sizes of 80-90 nm in diameter.  86  3.2.3 Cell transfections to assay reporter gene activity. Prior to transfection, bovine hamster kidney (BHK) cells (ATCC; Rockville, MD, USA) maintained as a monolayer cultured in Dulbecco's modified Eagle medium (DMEM) supplement with 10% fetal bovine serum (FBS), 100 U/ml of penicillin and 100 u.g/ml of streptomycin (Invitrogen; Carlsbad, C A , USA), were plated at a density of 8.75 x 10 cells per well in a 96-well plate or 1.75 x 10 cells per well in 3  4  a 48 well plate 18 h prior to transfection. 1-3 fig plasmid DNA encapsulated in S P L P was used per well of transfection. S P L P was added at appropriate concentrations to culture media and then added to cells at a final transfection volume of 125 u.l/well or 250 pL/well in a 96 or 48 well plate respectively. The final volume contained 2 0 % vol buffer and S P L P mixtures and 80% vol culture media.  3.2.4 Quantitation of luciferase activity. In all experiments, cells were incubated with the transfection complexes for the appropriate time periods and then washed 2X with D P B S (Invitrogen) and then lysed with D P B S + 0.1% TX-100. Aliquots of the lysate were assayed for luciferase activity with a luciferase assay kit (Promega; Madison, W l , USA) and detected using a Centra LB 960 microplate luminometer (Berthold; Bad Wildbad, Germany).  Luciferase expression was determined by comparing cell lysate  activity to the activity of luciferase enzyme standards of known concentrations under the same conditions (Monck et al., 2000). Luciferase activity was normalized against cell protein concentration in the lysate determined with the  87  Micro B C A protein assay reagent kit (Pierce; Rockford, IL, USA).  3.2.5 SPLP uptake studies. BHK cells were plated at 8.75 x 10 cells per well in a 96-well plate or 1.75 x 10 3  4  cells per well in a 48 well plate the day prior to the experiment. Cellular uptake determination was performed by incorporating 0.5 mol% R h - D O P E into the lipid formulations. S P L P s were prepared using the detergent dialysis method as described above. Particles were added to cells at a set lipid dose of approximately 100 pM lipid concentration or a set plasmid dose, since the lipid dose correlated directly with the plasmid concentration of the sample, independent of the specific lipid composition used (the ratio of lipid to pDNA was 1 pmol lipid/65 pg plasmid DNA encapsulated). Cells were incubated for 24 h, washed 2X with Delbucco's phosphate buffered saline (DPBS) (Invitrogen) and lysed by adding D P B S containing 0.1% TX-100. Aliquots of lysate were added to microplates, and rhodamine fluorescence resulting from cell-associated S P L P was measured on a fluorescence imager, Typhoon 8600 (Molecular Dynamics; Piscataway, N J , USA), using X x laser of 532 nm and k e  em  of 580 nm. Lipid uptake  was quantified by comparing cell lysate fluorescence to that of a fluorescent lipid standard of known concentration and then normalized to the total cellular protein concentration in the lysate determined with the Micro B C A protein assay reagent kit (Pierce).  88  3.2.6 In vivo pharmacokinetics of LUVs composed of SPLP lipids. Chloroform stocks of lipids were aliquoted to make samples containing 4 or 8 mol% D O D A C (x), 90 - (x) mol% D O P E and either 10 mol% P E G - C e r C mol% P E G - C e r C  2 0  2 0  or 6.5  and 3.5 mol% P E G - C e r C s . The chloroform was evaporated  under a nitrogen stream and then vacuum dried for 2 h. The lipid films were hydrated in H B S containing 200 mM octyl-glucopyranoside (OGP) detergent and then dialyzed against 1000 volumes of H B S with 2 buffer changes. All liposomal formulations contained 100 pCi H - C H E / 1 0 0 pmol of lipid. ICR mice were dosed 3  intravenously with the LUVs at 100 pmol/kg. At 1, 4 and 16 h, mice were anesthetized with an intra-peritoneal injection of a 10 mL/kg volume of saline containing a mixture of ketamine (320 mg/kg) /xylazine (40 mg/kg), blood was collected by cardiac puncture and added to EDTA containing Vacutainer tubes. The blood was then centrifuged (500g for 10 min at 4°C) to isolate the plasma component, and aliquots of the plasma were assayed for H - C H E levels. In 3  these experiments individual mouse weights were determined in order to calculate the blood volume (4.5% of the mouse weight), which was then applied to determine the concentration of lipid in circulation before and after injection.  89  3.3 RESULTS  3.3.1 The intracellular release parameter (IRP): definition and the influence of incubation time, C a  2 +  and post-inserted cationic PEG lipids (CPL) on the  IRP of SPLP. Numerous previous studies have been conducted demonstrating that the transfection potency of S P L P is affected by changes to lipid composition and transfection conditions (Monck et al., 2000; Palmer et al., 2003; Saravolac et al., 2000); however, there is an overall lack in understanding of the mechanism by which these factors affect potency at the cellular level. In this section gene expression will be examined more closely by delineating factors affecting gene expression due to binding and uptake as opposed to those factors affecting intracellular release of the particle. For each factor analyzed, gene expression levels will be normalized relative to the uptake levels of the S P L P (labeled S P L P lipid component), yielding a numeric ratio referred to as the intracellular release parameter (IRP):  Luciferase Expression / cell IRP= S P L P uptake / cell  The ratio of transfection to uptake will aid in identifying modifications in the carrier composition or transfection parameters that are affecting potency by improving  90  carrier uptake as opposed to facilitating escape from endosomal/lysosomal compartments. For example, if a modification is affecting gene expression without alteration in uptake/binding of the particle we should observe a change in the IRP value, indicating an effect on the intracellular release properties of the particle. Alternatively, it is expected that the IRP value will not change if a modification is affecting the uptake/binding of the particle since the change in gene expression will be in direct proportion to alterations in uptake, leaving the IRP ratio unaffected. As an example of the utility of the IRP assay, we studied the effect of C a , 2 +  cationic P E G lipid (CPL) and transfection time on the IRP values of S P L P .  Ca  2 +  was included in these assays to further our understanding of previous work showing that the addition of C a  2 +  to S P L P before transfection can dramatically  enhance the transfection potency of S P L P but does not substantially influence uptake (Sandhu, 2005). Also, studies were conducted to further investigate the findings by Palmer et al. (Palmer et al., 2003) demonstrating that transfection levels are enhanced upon the insertion of cationic P E G lipid (CPL) into the S P L P system (transfections with C P L also included C a  2 +  since it was found to  effectively prevent aggregation of the S P L P following C P L insertion ) (Palmer et al., 2003). Finally, the time point where peak expression is occurring can depend on a number of factors such as the efficiency of release from endosomal compartments or the efficiency of DNA delivery to the nucleus; which in turn may depend on the rate of cell division or the cytoplasmic composition of a given cell line. Since it is critical for the IRP studies that reporter gene activity is measured  91  during peak levels of gene expression, luciferase activity and uptake for these modifications were monitored over a period of 2 to 24 h. S P L P was formulated with a rhodamine-PE lipid label, encapsulating a pCMV-Luc plasmid encoding the luciferase reporter gene and then purified to remove un-encapsulated lipid particles using sucrose density centrifugation (Materials and Methods). For the post-inserted C P L - S P L P treatments, C P L S P L P particles were prepared as described elsewhere (Palmer et al., 2003) by incubation of S P L P with C P L micelles for 2 h at 65°C.  Non-inserted C P L was  removed by size exclusion chromatography and the bound C P L was detected by fluorescence measurements of the dansyl-label present on the C P L molecule. For this study S P L P contained 4 mol% C P L post-inserted since it was previously determined that 4 mol% C P L post-inserted into S P L P showed optimal transfection results (Palmer et al., 2003). Transfections were conducted on B H K cells with S P L P , S P L P + 8 mM calcium and S P L P containing 4 mol% C P L postinserted into the membrane + 8 mM calcium (calcium was included in the C P L treatment samples to prevent S P L P aggregation observed following C P L post insertion (Palmer et al., 2003)) at a dose of 1 pg pDNA/2X10 cells. Following 4  treatment for 2, 4, 8, 12 and 24 h, the cells were washed 2X in P B S and then assayed for luciferase reporter gene activity and S P L P uptake by detection of rhodamine-PE lipid fluorescence associated with the cells. IRP values were generated by calculating the ratio of luciferase expression to lipid uptake/binding. The luciferase expression and lipid uptake were both normalized to cell protein assayed prior to calculating the IRP ratio.  92  A s demonstrated in Figure 3.1, the IRP was enhanced by two orders of magnitude by introducing 8 mM calcium into the transfection medium with a further 5-fold increase if 4 mol% C P L was inserted into the S P L P (Figure 3.1). Optimal gene expression was observed following 24 h incubation for all treatments (Figure 3.1); consequently all future transfections were assayed following 24 h incubation unless indicated otherwise. The IRP values resulting from these modifications demonstrate that C a  2 +  significantly increases gene  expression by affecting an intracellular delivery step other than uptake/binding.  3.3.2 An increase in the cationic lipid content of SPLP does not significantly enhance intracellular delivery. It was hypothesized that the retention of S P L P in endocytotic vesicles is dictated by the lipid composition of the S P L P . It has been demonstrated previously that there is a direct relationship between S P L P cationic lipid content and the transfection potency in vitro as well as in vivo employing an intraperitoneal tumor model (Saravolac et al.). To further investigate the influence of cationic lipid content in the S P L P membrane, S P L P carriers were formulated (described in Materials and Methods) with variations in cationic lipid content: 8, 12, 16 and 20 mol% D O D A C . B H K cells were then treated with S P L P at 1 pg plasmid DNA dose per 2 X 1 0 cells for 24h. Following treatment, the cells were washed 2X in 4  P B S and then assayed for luciferase reporter gene activity and cell  93  1.E+06 -,  1.E+00 -I  , 2  ,  ,  4  8  , 12  24  Time (h)  Figure 3 . 1 . Effect of calcium, CPL and duration of treatment on the IRP of SPLP. S P L P w e r e f o r m u l a t e d w i t h D O D A C : D O P E : P E G - C e r C ( 8 : 8 2 : 1 0 , m o l a r 2 0  ratio). A l l S P L P s a m p l e s c o n t a i n e d e n c a p s u l a t e d p C M V - L u c p l a s m i d a n d a r h o d a m i n e - P E lipid label, a n d w e r e purified to r e m o v e e m p t y l i p o s o m e s  using  sucrose density centrifugation (Materials and Methods). B H K cells were treated at a d o s e of 1 p g p l a s m i d D N A / 2 X 1 0 c e l l s . T h e a c t i v i t y o f : S P L P ( • ) , S P L P 4  +  8 m M c a l c i u m ( • ) a n d S P L P c o n t a i n i n g 4 m o l % C P L p o s t - i n s e r t e d into t h e m e m b r a n e + 8 m M c a l c i u m (A), w a s d e t e r m i n e d at 2, 4 , 8, 1 2 a n d 2 4 h a f t e r treating the cells.  F o l l o w i n g t r e a t m e n t , t h e c e l l s w e r e w a s h e d 2 X in P B S a n d  t h e n a s s a y e d f o r l u c i f e r a s e r e p o r t e r g e n e a c t i v i t y a n d c e l l u p t a k e of S P L P a s d e s c r i b e d in M a t e r i a l s a n d M e t h o d s . I R P v a l u e s w e r e g e n e r a t e d b y c a l c u l a t i n g t h e ratio of l u c i f e r a s e e x p r e s s i o n ( n o r m a l i z e d t o c e l l s a s s a y e d ) t o l i p i d uptake/binding ( n o r m a l i z e d to cells a s s a y e d ) . D a t a points r e p r e s e n t t h e m e a n ± s t a n d a r d e r r o r (n=3).  94  uptake/binding. The data are presented in two parts in order to clearly demonstrate that IRP effectively reflects the relationship between the level of uptake/binding to gene expression: Figure 3.2A shows the data generated for gene expression (I) and uptake/binding (II) of the S P L P separately and Figure 3.2B presents the IRP values generated from the results in Figure 3.2A. Increasing the D O D A C content from 8 mol% in the membrane to 20 mol% demonstrated an approximate 2-5 fold increase in both luciferase expression and cell uptake levels (Figure 3.2A). On average this yielded an enhancement of approximately 2-fold in the IRP value; indicating that the cationic lipid content is not significantly improving the intracellular release property of the carrier (Figure 3.2B). This demonstrates the utility of the IRP parameter for characterization of enhancements of gene expression that are primarily related to enhanced uptake.  3.3.3 Changes in the neutral lipid composition of SPLP does not significantly enhance intracellular delivery. Numerous studies with non-viral lipid delivery systems have demonstrated that the neutral lipid component of the carrier has a dramatic effect on the transfection efficiency of cationic lipid-based gene delivery systems (Farhood et al., 1995; Hui et al., 1996; Mui et al., 2000). To explore how various helper lipid compositions affect intracellular delivery of the particle, IRP analysis was conducted on S P L P systems with modifications to the neutral lipid composition. It was of particular interest to understand the degree to which the presence of fusogenic lipids such as cholesterol and D O P E help to facilitate  95  I)  I2 _ c  600  5  • w/o Ca2+  500  • w/ Ca2+  a  ^ o  400  O)  300  O  200  ?.  100  ra  0 12  16  20  DODAC (mol%) 2.5  II)  I  • w/o Ca2+ • w/ Ca2+  2  0)  u 0)1.5 a. o E S 1  1  0.5 a.  mmm, 12  16  20  DODAC (mol /.) 0  Figure 3.2A. Influence of cationic lipid content on cell uptake and gene expression of SPLP. S P L P particles were formulated with variations in D O D A C (x): 8,12,16 and 20 mol%, and also contained 90 - (x) mol% D O P E and 10 mol% PEG-CerC o- All S P L P samples encapsulated pCMV-Luc plasmid and contained a rhodamine-PE lipid label, and were purified to remove empty liposomes using sucrose density centrifugation. BHK cells were then treated with S P L P (1 pg plasmid D N A / 2 X 1 0 cells) with and without 8 mM calcium in the transfection medium for 24 h. Following treatment, the cells were washed 2X in P B S and then assayed for (I) luciferase reporter gene activity and (II) cell uptake. Data points represent the mean ± standard deviation (n=3). 2  4  96  • w/o Ca2+  1.E+07  • w/Ca2+  O 1.E+06 i  a 1.E+01 BE  1.E+00 \  1  1 8  1  1  1 12  1  1  1 16  1  ,  1 20  DODAC (mol%)  Figure 3.2B. Influence of cationic lipid content on the IRP of SPLP. The intracellular release parameter (IRP) was determined by calculating a ratio of luciferase expression results to lipid uptake/binding data in Figure 3.2A. The luciferase expression and lipid uptake were both normalized to cell protein amounts in the assayed sample prior to calculating the IRP ratio. Data points represent the mean ± standard deviation (n=3).  97  intracellular release. S P L P were prepared with the 82 mol% D O P E in the original formulation replaced with 82 mol% D O P C , or with 20 or 40 mol% cholesterol (DOPE: cholesterol ratios formulated were: 62:20 mol% and 42: 40 mol%). B H K cells were then transfected in the presence and absence of C a  2 +  (included in order to raise luciferase activity to above baseline, thereby reducing variability in the gene expression data) for 24 h and then assayed for luciferase activity and uptake/binding. The replacement of the fusogenic D O P E content with a more bilayer stable lipid D O P C , or the introduction of 20 or 40 mol% cholesterol, did not alter the IRP value significantly (Figure 3.3). In addition, these results are in agreement with the data in Figure 3.1 and 3.2, demonstrating that regardless of the lipid composition of the S P L P , IRP values showed the most significant increase (200-500 fold), upon the addition of 8 mM calcium in the transfection media.  3.3.4 The PEG-lipid component of SPLP profoundly affects intracellular delivery properties of SPLP. The observation that modification of the cationic or neutral lipid content did not affect the IRP values (Figure 3.2 and Figure 3.3) suggests that the poor intracellular delivery properties of S P L P system may be related to another factor. The P E G - C e r component confers a number of critical properties to the particle including: prevention of particle aggregation during formulation and stabilization of the hexagonal HH phase (non-bilayer) of D O P E into a bilayer  98  1.E+05  1.E+04  I 1.E+03  1.E+02 D O P E (82%)  D O P C (82%)  DOPE:Chol (62%:20%)  DOPE:Chol (42%:40%)  Neutral L i p i d Content (mol%)  Figure 3.3. Effect of neutral lipid content on the IRP of SPLP. S P L P were formulated 8 mol% D O D A C , 10 mol% PEG-CerC2o and with variations in neutral lipid content: 82 mol% D O P E , 82 mol% D O P C and D O P E : Cholesterol combinations of 62: 20 and 42:40 molar ratios. All S P L P preparations contained encapsulated pCMV-Luc plasmid and a rhodamine-PE lipid label and were purified to remove empty liposomes using sucrose density centrifugation. B H K cells were then treated with S P L P at 1 pg plasmid DNA dose per 2X10 cells for 24 h. Following treatment, the cells were washed 2X in P B S and then assayed for luciferase reporter gene activity and cell uptake. IRP was determined by calculating a ratio of luciferase expression to lipid uptake/binding. The luciferase expression and lipid uptake were both normalized to cell protein in the assayed volume prior to calculating the IRP ratio. Data points represent the mean ± standard deviation (n=3). 4  99  (Fenske et al., 2002). Another feature of the P E G - C e r C o molecule is that it 2  contains a long ceramide acyl chain (20 carbon units in length). A s a result, it does not dissociate from the S P L P membrane following intravenous injection leading to the formulation's high stability in circulation (t-i/ = 6h) (Tarn et al., 2  2000). Thus, the S P L P particle retains most, if not all, of the original 10 mol% of the P E G - C e r C o for the duration of a 24 h in vitro transfection. This potentially 2  inhibits the intracellular delivery properties of the particle by shielding charge interaction between the cationic lipid and the negatively charged plasma membrane, and averts DOPE-induced destabilization of the particle by stabilizing the D O P E in a non-fusogenic bilayer state. To assay the effect of ceramide chain length of the P E G on IRP, S P L P particles were formulated with varying quantities of P E G - C e r C o in combination 2  with P E G - C e r C (shorter chain ceramide consisting of 8 carbon units with a half8  time of dissociation (ti/ ) from L U V s of 1.2 min (Zhang et al., 1999b)), maintaining 2  a total of 10 mol% P E G - C e r lipids in the S P L P formulation. It is important to note that it is critical to have approximately 10 mol% P E G - C e r lipids in the formulation in order to form S P L P by the detergent dialysis and for stabilization of D O P E into a bilayer membrane (Mok, 1998); and is the reason for the inclusion of P E G C e r C to yield a final concentration of 10 mol% P E G - C e r lipid. S P L P was 8  formulated with 0, 1, 2, 3,4,5,7.5 and 10 mol% P E G - C e r C . The total P E G - C e r 20  lipid in the membrane was maintained at 10 mol% with the addition of P E G CerC . 8  All of the formulations contained a rhodamine-PE lipid label,  encapsulating a pCMV-Luc plasmid encoding the luciferase reporter gene and  100  then purified to remove un-encapsulated lipid particles using sucrose density centrifugation. B H K cells were then treated with S P L P at 1 pg plasmid DNA dose per 8.75 X 1 0 cells for 24 h. Following treatment, the cells were washed 2X 3  in P B S and then assayed for luciferase reporter gene activity and cell uptake/binding. IRP analysis of these preparations demonstrates that the P E G - C e r C o 2  content dramatically affects the IRP value of the particle. The IRP value was inversely related to the amount of P E G - C e r C o in the membrane with a decrease 2  in IRP of approximately 2 orders of magnitude between particles containing 0 to 10 mol% P E G - C e r C o (Figure 3.4). This result is in agreement with studies that 2  have demonstrated that P E G inserted into a membrane interferes with the fusogenicity of liposomal membranes at levels as low as 2-3 mol% P E G - C e r C  2 0  (Chams et al., 1999; Holland et al., 1996).  3.3.5 Reduction of PEG-CerC20 content moderately reduces the circulation half-life of SPLP. A s mentioned in the Introduction, S P L P are optimized for long circulation lifetimes and high levels of accumulation at the target site, mainly attributed to the P E G - C e r C  2 0  content.  Based on the results in Figure 3.4, however, it is  apparent that reducing the P E G - C e r C o content may improve the intracellular 2  delivery properties of the particle. It was of interest to determine how reducing the P E G - C e r C  2 0  content would affect the circulation half-life of S P L P .  Previous  clearance studies demonstrate that S P L P formulated with the faster exchanging  101  1.E+06 o E  1.E+02 -  I—  1  0  I  I 1  I  I  J  2  I 3  J  L 4  J  I 5  I  I  I  7.5  10  PEG-CerC20 (mol%)  Figure 3.4. Influence of P E G C e r C content on the IRP of SPLP. S P L P were formulated with 8 mol% D O D A C , 82 mol% D O P E and variations in P E G C e r C content: 0, 1,2,3,4,5,7.5 and 10 mol% in combination with P E G C e r C to yield a total of 10 mol% PEG-Ceramide lipids. All S P L P preparations contained encapsulated pCMV-Luc plasmid and a rhodamine-PE lipid label and were purified to remove empty liposomes using sucrose density centrifugation. B H K cells were then treated with S P L P at 1 pg plasmid DNA dose per 1X10 cells for 24 h. Following treatment, the cells were washed 2X in P B S and then assayed for luciferase reporter gene activity and cell uptake, determined by rhodamine fluorescence. IRP was determined by calculating a ratio of luciferase expression to lipid uptake/binding. The luciferase expression and lipid uptake were both normalized to cell protein assayed prior to calculating the IRP ratio. Each data point represents the mean ± standard deviation (n=3). 20  2 0  8  4  102  P E G - C e r C s lipid has a clearance time of 0.5 h, limiting it to local application treatments in vivo (Wheeler et al., 1999). Also, it was of interest to determine to what degree the cationic charge becomes a significant factor in the clearance times of S P L P if the P E G - C e r C  2 0  is reduced.  To assay clearance rates of different lipid compositions, LUVs were formulated using the detergent dialysis method (see Materials and Methods) with D O D A C : D O P E : P E G - C e r C : P E G - C E R C at the following molar ratios: 20  8  8:82:10:0, 4:86:10:0, 8:82:3.5:6.5 and 4:86:3.5:6.5. All liposomal formulations contained a H - C H E lipid label in order to determine clearance rates from the 3  blood. ICR mice were dosed intravenously with the L U V s at 100 pmol/kg which relates to the approximate lipid dose used previously to demonstrate in vivo efficacy of S P L P with the same lipid composition (Tarn et al., 2000). At 1, 4 and 16 h mice were anesthetized; blood was collected by cardiac puncture and then centrifuged to isolate the plasma component. Aliquots of the plasma were assayed for the percentage of liposomes in circulation relative to the injected dose, measured by comparing H - C H E levels. 3  Data presented in Figure 3.5 demonstrates that reducing the P E G - C e r C o 2  from 10 mol% to 3.5 mol% reduced the half-life in circulation of the LUVs from 9 h to approximately 4.5 h. Interestingly, there were insignificant differences in clearance times of particles containing 8 vs. 4 mol% cationic lipid if the P E G CerC o content was 10 mol% (Figure 3.5). This data suggests that there is 2  potential for S P L P particles containing lower P E G - C e r C  103  2 0  levels to accumulate  0  5  10  15  Time (h)  Figure 3.5. Circulation lifetimes of LUVs composed of SPLP lipids with variation in PEG-CerC o content. LUVs were formulated using a detergent dialysis method with D O D A C : D O P E : P E G - C e r C : P E G - C E R C at the following molar ratios: 8:82:10:0 (•), 4:86:10:0 (•), 8:82:3.5:6.5 (•) and 4:86:3.5:6.5 (O). All liposomal formulations contained a 3 H - C H E lipid label in order to determine clearance rates from the blood. ICR mice were dosed intravenously with the L U V s at 100 pmol/kg. At 1, 4 and 16 h mice were anesthetized and blood was collected by cardiac puncture and added to E D T A containing Vacutainer tubes. The blood was then centrifuged to isolate the plasma component and aliquots of the plasma were assayed for the % of liposomes in circulation relative to the injected dose, measured by comparing H-CHE levels. Data points represent the mean ± standard deviation (n=4). 2  20  104  8  at a distal tumor site since they do remain in circulation for a reasonable length of time.  3.3.6 Design of an SPLP particle with reduced PEG-CerC2o content. As mentioned above the P E G - C e r C o is included in the lipid composition of S P L P 2  to aid in the formulation process as well as stabilize these systems for effective intravenous delivery. In the previous study (Figure 3.4) it is evident that the most important lipid component affecting the IRP of S P L P is the P E G - C e r C o content. 2  This motivated the attempt to redesign the S P L P formulation with a lipid composition that has little or no P E G - C e r C  2 0  without compromising S P L P stability  in the circulation. To meet these demands, P E G - C e r C  2 0  was replaced with a highly  diffusible P E G - C e r C . Unlike P E G - C e r C , the P E G - C e r C leaves the 8  2 0  8  membrane very quickly after exposure to serum (Webb et al., 1998). To maintain the stability of S P L P with the anticipated rapid loss of the P E G - C e r C , the D O P E 8  was replaced with a bilayer stable lipid, P O P C . Finally, the loss of P E G - C e r C in 8  the membrane in the circulation increases the potential for the cationic lipid content to reduce the circulation lifetime since it is known that systems with a surface charge are cleared more quickly (Gabizon and Papahadjopoulos, 1992; Nomura et al., 1998). The D O D A C content was therefore reduced to minimal levels required for efficient encapsulation of the plasmid. A visual comparison of this second-generation particle concept with the original S P L P is described in Figure 3.6.  105  DOPE PEG-CerC  2 0  DODAC protein surface  modified system: POPC PEG-CerCs DODAC  +  protein surface  Figure 3.6. Schematic illustration comparing the original SPLP formulation with a modified second-generation particle. This diagram provides a visual contrast between the lipid components of the original vs. the modified concept. Of particular interest is that the P E G - C e r o is expected to remain in the S P L P membrane at the cell surface in the original formulation as opposed to the modified concept where the P E G - C e r C will have diffused away from the particle before reaching the cell surface. 2  8  106  In Figure 3.7 it is demonstrated that S P L P can be formulated with 82 + (8 x) mol% P O P C , 10 mol% P E G - C e r C and cationic lipid content as low as x = 2 8  mol% D O D A C by reducing the NaCI concentration of the detergent dialysis buffer. These conditions yielded a minimum of 4 0 % plasmid encapsulation efficiency of 100 pg pDNA/10 pmol lipid with monodisperse particle formation having an average particle size of 78 nm in diameter (chi of < 2) (Figure 3.7). 2  BHK cells were then treated with these P O P C containing S P L P with 2, 4 and 8 mol% D O D A C at 2 pg plasmid DNA dose per 1.5 X 1 0 cells for 24h. The original 4  D O P E containing S P L P formulation was included in the study for comparison. Following 24 h incubation, the cells were washed 2X in P B S and then assayed for luciferase reporter gene activity and cell uptake/binding. IRP was calculated based on the luciferase expression and lipid uptake/binding of rhodamine-PE normalized to cell protein assayed. IRP analysis of these preparations demonstrates that there is an insignificant reduction of approximately 2-fold in IRP values for 2 mol% D O D A C samples as compared to 8 mol% (Figure 3.8); also, the IRP value increased by less than 2-fold between the original D O P E formulation containing 10 mol% P E G - C e r C o and the P O P C formulation 2  containing 10 mol% P E G - C e r C s (Figure 3.8). After a 2 h incubation period, all of the P O P C S P L P treatment wells contained aggregated S P L P throughout the media not evident in the D O P E S P L P treatment wells. It was found that the incorporation of a minimum of 2.5-3 mol% P E G - C e r C o in exchange for P E G 2  C e r C (maintaining the total P E G - C e r lipid at 10 mol%), prevented aggregation 8  and yielded similar IRP values as obtained in Figure 3.8 (data not shown). All  107  Figure 3.7. Influence of cationic lipid content on the dialysis conditions required for efficient encapsulation of pDNA into POPC:DODAC: PEGCerC SPLP. S P L P particles were formulated to contain D O D A C (x): 2, 4, and 8 mol%, 90 - (x) mol% P O P C and 10 mol% P E G - C e r C . Particles were formulated by detergent dialysis with 10 pmol lipid/100 pg pCMV-Luc plasmid DNA. Dialysis was conducted in buffer containing 20 mM Hepes pH 7.40 and varied NaCI concentrations to determine optimal salt concentration for high plasmid encapsulation efficiency (> 40% ) and the formation of small (80 - 100 nm) particles with a chi of <2. 8  8  2  108  1.E+04  o E  I  a  Z) T3  a  1.E+03  0) <0  o 3  CL  or 1.E+02 D O P E : D O D A C (8%): C20  P O P C : D O D A C (2%): C8  POPC:DODAC C8  (4%):  P O P C : D O D A C (8%): C8  Figure 3.8. Influence of cationic lipid content on IRP of SPLP composed of POPC: DODAC: PEG-CerC . S P L P composed of P O P C : D O D A C : P E G - C e r C (90 - (x) mol%: (x) mol%: 10 mol%) were prepared with increasing amounts of D O D A C (x) = 2, 4, 8 mol%. All S P L P preparations contained encapsulated pCMV-Luc plasmid and a rhodamine-PE lipid label and were purified to remove empty liposomes using sucrose density centrifugation. B H K cells were then treated with these S P L P formulations as well as S P L P composed of D O P E : D O D A C : P E G - C e r C (82:8:10, molar ratio) for comparison. B H K cells were treated with 2 pg pDNA/1.5 X 1 0 cells for 24 h. Following treatment, the cells were washed 2X in P B S and then assayed for luciferase reporter gene activity and cell uptake. IRP was determined by calculating a ratio of luciferase expression to lipid uptake/binding. The luciferase expression and lipid uptake were both normalized to cell protein assayed prior to calculating the IRP ratio. Each data point represents the mean ± standard deviation (n=4). 8  8  2 0  4  109  future experiments were conducted on P O P C S P L P containing 2.5 - 3 mol% P E G - C e r C 2 o in the formulation.  3.3.7 In SPLP containing PEG-CerC  the presence of DOPC significantly  8  reduces intracellular delivery. The main objective for reformulation of the S P L P system with P O P C and P E G CerCs was to increase the intracellular delivery properties of the carrier. It is evident from the transfection results in Figure 3.8 that there is insignificant enhancement in the IRP of these second-generation S P L P particles. Previously, it was demonstrated that in P E G - C e r C o systems, exchange of D O P E with a 2  more bilayer stable D O P C phospholipid does not significantly affect IRP (Figure 3.3). However, high degree of stability due to the slow diffusion of PEG-CerC2o from the membrane outweighs differences in the bilayer stability of the neutral lipid component.  In the second-generation S P L P particle, P E G - C e r C diffuses 8  rapidly from the membrane, making the neutral lipid composition a greater factor in the stability and fusogenicity of the particle following endosomal uptake. To explore the role of bilayer stability of neutral lipids in the secondgeneration P E G - C e r C systems, S P L P were formulated with neutral lipid 8  compositions of: 82 mol% P O P C , 42: 40 mol% P O P C : D O P E and 22: 60 mol% P O P C : D O P E . S P L P prepared with D O P E and P E G - C e r C were also included 8  as a comparison in this study. B H K cells were then treated with these formulations at 2 pg plasmid D N A dose per 1.5 X 1 0 cells for 24h. Following 24 4  h incubation, the cells were washed 2X in P B S and then assayed for luciferase  110  reporter gene activity and cell uptake/binding. IRP was calculated based on the luciferase expression and lipid uptake/binding of rhodamine-PE normalized to cell protein assayed. The introduction of up to 60 mol% D O P E into the S P L P did not affect the IRP values in relation to the 82 mol% P O P C containing system (Figure 3.9). However, replacement of P O P C with D O P E enhanced the IRP value by approximately 300-fold. It is apparent from this data that upon replacement of the P E G - C e r C  2 0  with P E G - C e r C , the bilayer stability of the neutral lipid 8  component becomes a major factor in the intracellular delivery property of the S P L P system.  111  1.E+06  1  1.E+05  D  '5. •  1 .E+04  e (A (3  O 3  d. 1.E+03  T  a. a.  1 .E+02 POPC (82%)  POPC: DOPE (42: 40%)  DOPE (82%)  POPC: DOPE (22: 60%)  Figure 3.9. Transfection potency of second-generation POPC SPLP systems with the addition of DOPE. B H K cells were treated with S P L P formulations containing 8 mol% D O D A C , 2 . 5 mol% P E G C e r C o : 7.5 mol% P E G C e r C : and varied neutral lipid composition: 8 2 mol% P O P C , 8 2 mol% D O P E , and a combination of P O P C : D O P E at 4 2 : 4 0 and 22: 6 0 mol% ratios. Following treatment, the cells were washed 2 X in P B S and then assayed for luciferase reporter gene activity and cell uptake, determined by rhodamine fluorescence. IRP was determined by calculating a ratio of luciferase expression to lipid uptake/binding. The luciferase expression and lipid uptake were both normalized to cell protein assayed prior to calculating the IRP ratio. Data points represent the mean ± standard deviation (n=4). 2  8  112  3.4 DISCUSSION The results of this chapter illustrate the utility of the intracellular release parameter (IRP) to investigate the influence of alterations in S P L P composition on intracellular delivery properties. These investigations point out the difficulties involved in developing a system that exhibits good intracellular delivery properties that can also exhibit the long circulation lifetimes required for accumulation at disease sites such as tumors. In particular, the results show that the major factor limiting the intracellular delivery properties of the standard S P L P system is the presence of the non-exchangeable PEG-CerC2o molecules. Substitution of PEG-CerC2o by exchangeable P E G - C e r C molecules requires 8  substitution of D O P E by D O P C in order to achieve particles that could be stable in the circulation. However, replacing D O P E with D O P C leads to inhibition of intracellular delivery. These results highlight how modifications to lipid composition that significantly enhance the intracellular release properties generally have a detrimental impact on the pharmacokinetics of the particle following intravenous delivery. W e will elaborate on each of these points below. Normalizing gene expression relative to the uptake of the pDNA carrier yields a numeric ratio referred to here as the intracellular release parameter (IRP). The rationale behind use of the IRP is that factors that modulate the gene expression without altering the uptake levels of the particle must be, by process of elimination, affecting the fate of the pDNA particle once taken up by the cell. Conversely, any modifications primarily to the uptake of the particle should  113  translate into a directly proportionate change in the gene expression levels, thereby causing little or no significant change in the IRP value. Initial studies to determine the validity of this approach were conducted by investigating how modifications to pre-formed S P L P such as the addition of C a  2 +  affect the intracellular delivery of S P L P . Previous studies demonstrate that the addition of C a  2 +  can enhance gene expression of cationic lipoplex delivery  systems by 3-20 fold, attributed to both enhanced uptake as well as increased intracellular delivery of intact plasmid (Lam and Cullis, 2000). Here we find that the addition of 8 mM calcium into the transfection medium increased the IRP parameter by 100-500 fold regardless of the S P L P lipid composition (Figure 3.1 and Figure 3.2). Interpretation of these significant increases in IRP values suggests that the primary cause for calcium mediated enhancement in gene delivery of S P L P is due to increases in intracellular delivery of the particle as opposed to effects on uptake/binding. Calcium enhanced intracellular delivery has also been observed with a number of other polycation-mediated gene transfer systems (Haberland et al., 2000; Haberland et al., 1999). The possible mechanisms leading to the calcium effect is that it facilitates endosomal/lysosomal membrane fusion or disruption in the presence of phosphates, which will be explored further in Chapter 4. The IRP analysis was further validated by demonstrating that the addition of cationic lipid into S P L P during formulation or by post-insertion, did not significantly affect the IRP value of S P L P (Figure 3.1 and Figure 3.2). This is in accordance with the observation that cationic lipid has a major effect on the  114  efficiency of gene delivery of a carrier system by increasing uptake/binding (Palmer et al., 2003; Zabner, 1997). It should be recognized, however, that in membranes containing high cationic lipid content in the range of 50 mol%, the positively charged lipid contributes to the intracellular release capacity of the carrier due to an ion-pairing induced destabilization of the endosomal membrane (Hafez et al., 2001; Wattiaux et al., 1997; Xu and Szoka, 1996). Based on the IRP data, this effect was not observed in these studies, explained by the fact that the cationic lipid levels in our studies was much lower (up to 20 mol%). Also, the P E G - C e r C o in the S P L P extends beyond the cationic lipid on the surface of the 2  particle, shielding it from charge-mediated interactions with intracellular membranes. One of the major outcomes of the IRP investigations was that the ceramide chain length of the PEG-ceramide component is the major factor affecting S P L P ( D O P E : D O D A C : PEG-ceramide (82: 8: 10; mol%)) transfection potency.  W e found that the presence of 10 mol% P E G - C e r C o in the formulation 2  reduced the IRP value by 2 orders of magnitude (Figure 3.4) as compared to S P L P formulated with 10% P E G - C e r C . This is explained by the faster diffusion 8  rates of P E G - C e r C s from the membrane as compared to the P E G - C e r C o 2  molecule. The retention of bulky hydrophilic groups on the membrane surface of the S P L P following uptake into the cell is expected to interfere with close apposition of membranes required for fusion to occur. Spacing measurements between individual bilayers in MLVs formed with D S P E - P E G 1 9 0 0 indicate that the PEG1900  polymer extends out approximately 5 nm beyond the bilayer surface  115  (Needham et al., 1992), whereas for fusion to occur the bilayers must approach to within 1-2 nm before contact can be established (Holland et al., 1996; Pedroso de Lima etal., 2001). This reduction in intracellular delivery as a result of the PEG-CerC2o content led us to revisit the original formulation to determine whether it was possible to reduce PEG-Ceramide in the S P L P membrane prior to its entry into the cell. Before considering the composition of a modified S P L P carrier, clearance studies with liposomes composed of the S P L P lipid composition containing intermediate levels of PEG-CerC2o were conducted to ensure that the optimal pharmacokinetic properties of the original formulation (DOPE: D O D A C : PEG-CerC2o (82: 8: 10; molar ratio)) were not severely compromised. It has been determined in previous experiments that S P L P systems with 10% P E G CerCs in place of 10 mol% PEG-CerC2o reduces the circulation half life to a few minutes, limiting such formulations to regional in vivo applications (Zhang et al., 1999b). W e found that reducing the P E G - C e r C o levels to 3.5 mol% which 2  corresponded to a 15-30 fold increase in IRP relative to 10 mol% PEG-CerC2o systems in vitro (Figure 3.4) reduced the circulation half-life from 9 h to 4.5 h (Figure 3.5). Based on these clearance studies of L U V s composed of S P L P lipids, it was determined that the intermediate range in circulation half-life of 3.5 mol% PEG-CerC2o systems retains their potential for significant accumulation at distal tumor sites in vivo. At this point a modified particle was proposed based on the IRP studies thus far. In order to significantly enhance intracellular delivery of S P L P , P E G -  116  CerCao was replaced by PEG-CerCe. To maintain stability of the particle, the substitution for P E G - C e r C required replacement of the unstable fusogenic 8  D O P E component with a more bilayer stable lipid, which does not depend on the P E G - C e r for retention in the S P L P membrane. To achieve this, P O P C was introduced in place of D O P E . The next consideration was that the loss of P E G C e r C during serum exposure is expected to reduce shielding of the cationic lipid 8  from contact with serum proteins, thereby increasing the potential for shorter clearance times following intravenous delivery. A s a result, formulation experiments were conducted to determine the minimal amounts of cationic lipid required to achieve efficient encapsulation of plasmid DNA into S P L P . W e established dialysis conditions that allowed for the reduction of D O D A C content to 2 mol% of the total S P L P lipid composition (Figure 3.7) that still demonstrated efficient encapsulation of 100 pg of plasmid DNA/10 pmol of lipid, producing monodisperse particles in the range of 75 nm in size. It is expected that these particles possess very low surface charge since the cationic lipid content is at limiting levels required to pre-condense the plasmid DNA for particle formation. Transfections with this proposed second generation particle produced disappointing results. There was no improvement in IRP values for systems containing 10 mol% PEG-CerCe as opposed to 10 mol% PEG-CerC2o- This can be explained by the P E G - C e r C systems having been redesigned to contain the 8  non-fusogenic P O P C in place of the more fusogenic D O P E phospholipid (Figure 3.9). This lowered activity indicates that the relative fusogenic nature of the lipid becomes a critical factor, which was not apparent when the P E G - C e r content  117  was PEG-CerC o2  W e also found that there was an approximate 2-orders of  magnitude reduction in IRP values between P E G - C e r C systems with D O P E as 8  the helper lipid as opposed to systems containing mixtures of D O P E and P O P C , where the P O P C was only constituting 22 mol% of the membrane (Figure 3.10). This loss in the fusogenic nature of the D O P E in the presence of approximately 20% P O P C is consistent with the observation that approximately 25 mol% egg phosphatidylcholine is sufficient to stabilize D O P E into a non-fusogenic bilayer phase (Kruijff, 1984). It should be mentioned that even if there was some improvement in the IRP of systems with P O P C in the range of 20 mol%, the P O P C is not at sufficient levels to stabilize S P L P particles in vivo when the system contains predominantly PEG-CerCe. In conclusion, studies comparing the IRP of various lipid compositions and modifications to S P L P suggest that enhancement by modification of lipid composition may not be possible without compromising stability in the circulation. Consequently, the next chapters will investigate modifications other than altering lipid composition of S P L P to improve IRP. Such modifications include calcium as well as pH-sensitive fusogenic polymers.  118  CHAPTER 4: THE MECHANISM OF CALCIUM-INDUCED ENHANCEMENT IN THE INTRACELLULAR DELIVERY OF STABILIZED PLASMID-LIPID PARTICLES.  4.1 INTRODUCTION As shown in Chapter 3, modifications of the lipid composition of S P L P to enhance its intracellular delivery properties are difficult without affecting the stability of the particle in vivo. However, it was determined by the intracellular release parameter studies in Chapter 3 that the addition of 8 mM C a  2 +  into the  transfection media increased the gene expression quite substantially without affecting the uptake of the particle, regardless of the lipid composition of the S P L P . This observation prompted further investigation as to how calcium is functioning to enhance gene expression and whether it provided a viable method to improve the intracellular delivery characteristics of S P L P . In previous work it has been shown that C a c a n enhance the transfection 2 +  potency of plasmid DNA-cationic lipid complexes by 20-fold or more (Lam and Cullis, 2000). This enhanced potency was ascribed to increased cell uptake of the complexes when C a  2 +  is present. Calcium has also been studied as a co-  factor in a number of polycation-mediated gene delivery systems including DNA complexed with the nuclear protein histone H1, polylysine and commercial transfection agents (Haberland et al., 2000; Haberland et al., 1999). Although it is clear that calcium can increase gene expression of these systems, the mechanism involved is still unclear. In the present work we demonstrate that C a  119  2 +  also enhances the  transfection activity of S P L P . It is shown that the addition of C a  can result in up  to 60-100 fold enhancement in S P L P transfection potency. In addition, under conditions where serum is absent during the initial incubation period, gene expression is increased by an additional 60-fold in B H K cells. It is also demonstrated that these effects are dependent on the presence of physiological levels of phosphate in the medium. The results are discussed in terms of the mechanism of calcium phosphate transfection and methods of improving the transfection properties of the S P L P system.  120  4.2 M A T E R I A L S A N D M E T H O D S  4.2.1 Materials. N,N-dioleyl-N,N-dimethylammonium chloride (DODAC) was obtained from Dr. S . Ansell and  1-0-(2-(o>methoxyethyleneglycol)succinoyl)-2-N-  arachidoylsphingosine (PEG-CerC o) was synthesized by Dr. Z. Wang, at Inex 2  Pharmaceuticals Corporation (Burnaby, BC). 1,2-dioleoyl-sn-glycero-3phosphoethanolamine (DOPE) was purchased from Northern Lipids (Vancouver, BC). 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Lissamine Rhodamine B Sulfonyl) (Rh-DOPE) was purchased from Avanti Polar Lipids (Alabaster, AL). D E A E Sepharose C L - 6 B anionic-exchange column, octylglucopyranoside (OGP), Triton X100, sodium dodecyl sulfate (SDS), H E P E S , Tris, C a C I , MgCI , sucrose 2  2  and NaCI were obtained from Sigma Chemical C o . (St. Louis, MO). 12-14,000 M W C O dialysis tubing was purchased from Spectrum Laboratories (Rancho Dominguez, CA) and 100,000 N M W L centrifugal filtration units were purchased from Millipore (Billerica, MA). The luciferase assay kit was purchased from Promega Corp. (Madison, Wl). PicoGreen dsDNA detection reagent and Alexa Fluor 488 labeled 10,000 molecular weight dextran was purchased from Molecular Probes (Eugene, O R ) . Plasmid DNA (pCMV-Luc) coding for the luciferase reporter gene under the control of the human C M V immediate early promoter-enhancer element was obtained from Protiva Biotherapeutics (Vancouver, BC). Bovine hamster kidney (BHK) cells were obtained from the American Tissue Culture Collection (ATCC CCL-10, Rockville, MD) and cultured  121  in Dulbecco modified Eagle medium (DMEM) supplement with 10% fetal bovine serum (FBS), 100 U/ml of penicillin and 100 u,g/ml of streptomycin were purchased from Invitrogen (Carlsbad, CA).  4.2.2 Preparation of SPLP. S P L P were prepared as described by Wheeler et al. (Wheeler et al., 1999) with some modifications. Briefly, a total of 10 umoles of lipid with a composition of D O D A C , D O P E , P E G - C e r C , Rhod-DOPE (8:81.5:10:0.5; mol%) were dissolved 2 0  in chloroform and dried under a stream of nitrogen gas. Residual solvent was removed under high vacuum for 2 h. The resulting lipid film was hydrated in 1 ml of H B S buffer (20 mM H E P E S and 150 mM NaCI, pH 7.5) containing 0.2 M O G P with continuous vortexing. Plasmid DNA (400 u.g/ml) was added to the hydrated lipids and the mixtures were dialysed against H B S buffer for 36 to 48 h with 2 buffer changes. Non-encapsulated plasmid was removed by D E A E anion exchange chromatography and empty lipid vesicles were removed by employing a sucrose density gradient as previously described (Wheeler et al., 1999). S P L P were characterized with respect to plasmid entrapment using a previously described PicoGreen assay (Zhang et al., 1999b), and particle mean diameter using a submicron quasi-elastic light scattering particle sizer (Nicomp, Santa Barbara, CA). S P L P formulations used in this study demonstrated a maximum of 5-10% untrapped plasmid following purification with particle sizes of 80-90 nm in diameter.  122  4.2.3 Reporter gene activity in the presence of Ca *. 2  Prior to transfection, BHK cells maintained as a monolayer at 37°C in a humidified atmosphere containing 5.0% CO2 were plated at a density of 8.75 x 10 cells per well in a 96-well plate overnight. A 500 mM C a C I stock solution 3  2  was prepared in d H 0 and sterilized using a 200 nm syringe filter. The 2  encapsulated plasmid DNA concentration was 0.5-1.0 pg per well of transfection. S P L P were first added to appropriate concentrations of C a  2 +  as required by the  experiment, after which culture media was added to the mixture to obtain a final transfection volume of 125 pl/well ( C a  2 +  concentration was calculated with  respect to the final volume of the transfection medium applied to cells). The final volume contained 2 0 % vol C a In non-serum studies, the C a  2 +  2 +  and S P L P mixtures and 8 0 % vol culture media. and S P L P mixture was mixed with non-serum  containing D M E M for the appropriate incubation period and then F B S was added to replenish the serum content to 10% vol. Experiments to investigate the effect of phosphates in the cell media employed the same procedure as indicated; however, the D M E M media used was a phosphate free formulation (Invitrogen). Nuclease sensitivity experiments were conducted by assaying gene expression following incubation with cells in D M E M containing F B S that was heated to 65°C for 1 hr (to deactivate serum nucleases) and media containing serum that was not heat inactivated prior to preparing the cell media for transfection.  4.2.4 Quantitation of luciferase activity. In all experiments, cells were incubated with the transfection complexes for the  123  appropriate time periods and then washed 2X with DPBS (Invitrogen) and then lysed with DPBS + 0.1% TX-100. Aliquots of the lysate were assayed for luciferase activity with a luciferase assay kit (Promega; Madison, Wl, USA) and detected using a Centra LB 960 microplate luminometer (Berthold; Bad Wildbad, Germany). Luciferase expression was determined by comparing cell lysate activity to the activity of luciferase enzyme standards of known concentrations under the same conditions (Wheeler et al., 1999). Luciferase activity was normalized against cell protein concentration in the lysate determined with the Micro BCA protein assay reagent kit (Pierce; Rockford, IL, USA).  4.2.5 Determination of SPLP uptake into cells. BHK cells were plated at 8.75 x 10 cells per well in a 96-well plate overnight the 3  day prior to the experiment. Determination of the cellular uptake levels of SPLP was performed by incorporating 0.5 mol% Rh-DOPE into the lipid formulations (DODAC/DOPE/PEG-CerC /Rh-DOPE; 8:81.5:10:0.5; molar ratio). SPLPs were 20  prepared using the detergent dialysis method as described previously. Particles were mixed with increasing concentrations of C a  2 +  (0 to 14 mM) and added to  cells at a lipid dose of 12.6 nmoles in complete media (125 pi final volume). Cells were incubated at 37 °C for 24 h, washed 2X with Delbucco phosphate buffered saline (DPBS) (Invitrogen; Carlsbad, CA) and then lysed with the addition of DPBS containing 0.1% TX-100. Rhodamine fluorescence resulting from cell associated SPLP was measured on a Molecular Dynamics Typhoon 8600 fluorescence imager (Piscataway, NJ) using A . laser of 532 nm and 2i m of e x  124  e  580 nm. Lipid uptake was quantified by comparing lysate fluorescence to that of a fluorescent lipid standard of known concentration and then normalized to the total cellular protein concentration in the lysate.  4.2.6 Intracellular processing of plasmid DNA. BHK cells were plated at 3 x 10 cells per well in 6-well plates 18h prior to the 5  experiment. 2.5 pg plasmid DNA encapsulated in S P L P s were incubated with cells for 2, 4, and 8 h, in the absence or presence (8 mM) of C a . 2 +  At the  appropriate time points, cells were washed with D P B S and external S P L P s removed by trypsinization. Trypsinized cells were pelleted by centrifugation and cells were resuspended and washed with isotonic buffer (250 mM sucrose, 3 mM MgCI , 50 mM H E P E S , pH 7.2). Subsequently, pelleted cells were lysed by 2  incubating with 250 pl of lysis buffer (10 mM Tris, pH 7.5, 0.5% S D S , 1 mM EDTA) containing Pronase E at 1 mg/ml (Sigma) overnight at 37°C. DNA (genomic DNA and delivered plasmid DNA) was extracted as described previously (Sambrook et al., 1989). DNA recovery was determined by measuring the absorbance at 260 nm. 6 pg of total DNA from each sample was either dot blotted onto a nylon transfer membrane (Amersham, Piscataway, NJ) with a set of pCMV-Luc standards (0 to 5 pg) or loaded into a 1 % agarose gel and size fractionated at 60 V for 2 h for the Southern analysis. Both blots were hybridized overnight at 68°C to a P-labeled plasmid DNA probe, which was prepared with 32  Pstl cut-pCMV-Luc plasmid using the ^QuickPrime™ Kit (Amersham Pharmacia Biotech). Blots were washed 3 times with 2x S S C containing 0.1 % S D S , and  125  were then exposed on a Phospholmager screen which was subsequently scanned (Phospholmager™SI, Amersham).  4.2.7 Intracellular distribution ofdextran. BHK cells were plated at 3.5 x 1 0 cells per well in Lab-TekTM II chambered 4  coverglass plates (Nuncbrand, Rochester, NY) 18 h prior to transfection. 70 nmols of 10,000 mol.wt. Alexa Fluor 488 labeled dextran was added to H B S with 0 or 50 mM C a  2 +  and then diluted with non-serum containing D M E M media to  yield 0 or 8 mM C a  2 +  in the media applied to the cells. Cells were incubated in  this mixture for 30 min. and then F B S was added to yield 10% vol. serum. After 2 h, the sample medium was removed, cells were washed 2X with D P B S and fresh complete media was added for an additional 10 h. At the 2 h and 12 h time points, cells in live culture were observed for green fluorescence under 400X magnification using a Zeiss Axiovert S100 inverted microscope (Thornwood, NY).  126  4.3 RESULTS  4.3.1 Ca * addition to the transfection media induces a substantial increase 2  in gene expression. Initial experiments characterized the influence of C a  2 +  on gene expression in  BHK cells following incubation with S P L P . Following transfection for 24 h the cells were washed 2X with D P B S and then assayed for luciferase reporter gene expression. The data presented in Figure 4.1 A demonstrate that very low levels of expression were observed until the C a  2 +  concentration was at least 6 mM.  Gene expression peaked at approximately 10 mM C a  2 +  yielding up to a 30-fold  increase in expression and then declined at levels of 12 mM and above. Replacing C a  2 +  with other cations including magnesium and sodium at similar  concentrations did not affect gene expression (Figure 4.1 A). evidence for changes to cell viability resulting from the C a  2 +  Also, there was no addition in this  concentration range, determined both visually as well as by quantitation of cell protein/well (data not shown). A potential cause for enhanced gene expression is increased cell uptake of S P L P in the presence of C a . Cells were treated with the same range of C a 2 +  concentrations as described above for experiments conducted in Figure 4.1 A. Following 24 h incubation, cells were washed 2X with D P B S and then assayed for uptake of S P L P . Uptake was measured by quantitation of a rhodaminelabeled P E phospholipid included in the S P L P membrane. The maximum  127  2 +  o  5  10  Calcium Concentration (mM)  B  0.0001  TJ 0.00005  '5.  0.00004 2  4  6  8  10  12  14  Calcium Added to Cell Culture Medium (mM)  Figure 4.1. Enhanced reporter gene activity relative to Ca content in cell culture medium during SPLP transfection with a minor affect on cell uptake of SPLP. B H K c e l l s w e r e plated 18 h prior to transfection. Immediately before treatment, C a C I w a s a d d e d to S P L P a n d then diluted with cell culture m e d i u m , yielding a final C a c o n c e n t r a t i o n of 0 - 2 0 m M . T h e c e l l s w e r e treated at a d o s e of 12.6 nmol S P L P lipid/well ( D O D A C : D O P E : P E G - C : R h o d - D O P E , 8: 8 1 . 5 : 10: 0.5; molar ratio) e q u a l to a 1 u g S P L P e n c a p s u l a t e d p D N A d o s e / w e l l . F o l l o w i n g 2 4 h incubation, cells w e r e w a s h e d 2 X in D P B S a n d then l y s e d in 0 . 1 % T X - 1 0 0 D P B S solution. T o determine g e n e e x p r e s s i o n (A) T h e lysate w a s a s s a y e d for l u c i f e r a s e e x p r e s s i o n a n d S P L P uptake (B) w a s d e t e r m i n e d b y a s s a y i n g the lysate for R h o d - D O P E related f l u o r e s c e n c e , w h i c h w a s c o r r e l a t e d to dilutions of R h o d - D O P E S P L P of k n o w lipid c o n c e n t r a t i o n . All d a t a p r e s e n t e d w a s n o r m a l i z e d to cell protein content in the lysate a n d represent the m e a n ± s t a n d a r d deviation (n=4). 2  2 +  2 0  128  increase in uptake was in the range of 60% and cannot therefore account for the 30-fold increase in expression levels (Figure 4.1 B).  4.3.2 Ca * increases the level of intracellular delivery of intact plasmid. 2  If S P L P plasmid can escape from the endosome more readily in the presence of C a , it should avoid breakdown in the lysosomal pathway and more intact 2 +  intracellular plasmid DNA should be available to migrate to the nucleus. A dot blot assay was employed to measure intracellular delivery of plasmid DNA, and the integrity of the plasmid was examined by using Southern blot analyses. Cells were incubated with S P L P in the absence or presence of 8 mM C a  2 +  for 2, 4, and  8 h. The levels of intact, intracellular plasmid DNA for the different systems were compared after isolation of DNA from the cells as described in Materials and Methods, and the results are shown in Figure 4.2. A s shown in Figure 4.2A, when cells were transfected with the S P L P in the presence of C a , the amount 2 +  of intact plasmid in the B H K cells was increased by approximately 5-fold after an 8 h incubation period. This is also reflected by the Southern analysis, which showed that more intact plasmid DNA was present in cells transfected with S P L P prepared in the presence of C a  2 +  (Figure 4.2B). Such enhanced levels of intact  plasmid DNA were not observed when M g demonstrating the specificity of C a  2 +  2 +  was substituted for C a ,  (Figure 4.2B).  129  2 +  0  4  2  6  8  10  Time (h)  1  I  2h 2  3  1 I  4  5  4h 6  1 I  7  8  8 Ii 9  10  1  I  11  8h  1  12 13 14 15  Figure 4.2. Influence of C a on the integrity of S P L P p l a s m i d following uptake of S P L P into B H K c e l l s . S P L P ( D O D A C / D O P E / P E G - C e r C , 7:83:10; molar ratio) containing 2.5 pg plasmid DNA was used to transfect BHK cells as described in Materials and Methods. At appropriate time points (2 h, 4 h, and 8 h), DNA was extracted from the cells and intracellular plasmid DNA was detected by hybridization to a specific P-labeled plasmid DNA probe. (A) Levels of plasmid DNA uptake in the absence of (•) and in the presence of (•) C a as determined by dot blot analysis described in Materials and Methods. (B) Integrity of intracellular plasmid DNA using the Southern blot analysis. Lanes 1 and 11: pCMV-Luc control; lanes 2, 5, 8 and 12: non-transfected control; lanes 3, 6, 9 and 13: cells transfected with S P L P ; lanes 4, 7, 10 and 14: cells transfected with S P L P and 8 mM C a ; and lane 15: cells transfected with S P L P and 8 mM M g (n=3) ± 1 standard deviation (data shown in this figure was originally presented by Lam, 2000). z +  20  32  2 +  2 +  2 +  130  4.3.3 The Ca * effect is amplified in the absence of serum. 2  It has been previously established that the presence of serum can have a significant influence on the efficiency of non-viral gene transfer (Escriou et al., 1998; Haberland et al., 2000; Yang and Huang, 1998; Zaric et al., 2004). To determine the effect of serum on gene expression in the presence of calcium, cells were transfected with S P L P in the presence and absence of 8 mM C a  2 +  in cell culture media that contained levels of serum ranging from 0 to  10% (vol/vol). After a 30 min incubation period, additional serum was added where required to yield 10% serum in all of the sample wells. At 24 h, cells were washed 2X in D P B S and then assayed for luciferase expression. In Figure 4.3A it is demonstrated that a complete absence of serum in the presence of 8 mM C a  2 +  for 30 min enhances gene expression by an additional  60-fold as compared to cells treated in the presence of 10% serum and C a . 2 +  The presence of as little as 2 % serum for the initial 30 min incubation yields expression levels similar to that observed for 10% serum treatments (Figure 4.3A). Cell survival and division was reduced when cells were treated with 0% serum in the presence of C a . No evidence for changes in cell morphology or 2 +  growth rate in the absence of C a  2 +  were observed when the serum content was  in the range of 0 - 1 0 % (data not shown). In order to minimize the reduction in cell growth rates observed in the presence of 0% serum and 8 mM C a , we attempted to establish the shortest 2 +  incubation period required to induce increased expression. The data in Figure 4.3B relates the time in non-serum media to the observed C a  131  2 +  induced increase  1.E+06 i  A  e  (-) calcium  (+) 8mM  calcium  Figure 4 . 3 . S e r u m affects the C a related increase in gene e x p r e s s i o n of S P L P delivered pDNA. BHK cells were plated 18 h prior to transfection. Immediately before treatment, C a C I was added to S P L P to yield a final C a concentration of 0-20 mM and then diluted with non-serum containing media. The cells were treated with this mixture at a dose of 1 pg S P L P (DODAC: D O P E : P E G - C , 8: 82:10; mol%) encapsulated pDNA/well for (A) 30 min; (B) 0, 5, 10, 30, and 60 min. Following this treatment period, F B S was added to yield 10% vol in the media. Cells were incubated for an additional 23.5 h, and then washed 2X in D P B S followed by lysis in 0.1% TX-100 D P B S solution. The lysate was assayed for luciferase expression. Gene expression data presented was normalized to cell protein content in the lysate and data points represent the mean ± standard deviation (n=3). 2 +  2 +  2  2 0  132  in gene expression after 24 h. The lack of serum in the cell media for 10 min or longer resulted in the same level of enhancement in transfection levels. However, if serum is added within 30 sec to the cell medium, the expression was similar to that observed in the presence of 10% serum. In the non- C a  2 +  containing controls, there was no increase in expression resulting from exposure to non-serum conditions.  4.3.4 Ca *-induced increases in transfection require the presence of 2  phosphate. It is well known that calcium phosphate can stimulate transfection using naked plasmid (Chowdhury et al., 2003).  In order to determine whether calcium  phosphate would be playing a role in the Ca -dependent increases in 2+  expression observed for S P L P , the transfection levels of S P L P and C a  2 +  mixtures were assayed in both phosphate-containing and phosphate-free D M E M cell culture media. Cells were transfected with S P L P and C a  2 +  for 24 h. C a 2 +  free controls were included to ensure that the expression levels were not affected by the lack of phosphate. In Figure 4.4 it is demonstrated that transfections conducted in phosphate-free media reduced expression to levels observed in wells containing phosphate but no C a . Also, there was no significant difference 2 +  in the Ca -free controls when treated in the presence as compared to the 2+  absence of phosphate. The cell morphology or growth rates were not affected by the absence of phosphate in the medium for duration of this 24 h experiment.  133  Figure 4.4. C a related increase in gene expression of SPLP delivered pDNA is dependent on phosphates in the cell media. B H K cells were treated as described in Figure 4.3 with S P L P at a dose of 1ug S P L P (DODAC: D O P E : PEG-C o> 8:82:10; molar ratio) encapsulated pDNA/well for 24 h. Following the 24 h treatment, cells were washed 2X in D P B S followed by lysis in 0.1% TX-100 D P B S solution. The lysate was assayed for luciferase expression. Gene expression data presented was normalized to cell protein content in the lysate and data points represent the mean ± standard deviation (n=3). 2 +  2  134  4.3.5 Ca * does not destabilize SPLP structure. 2  S P L P with the P E G - C e r C o coating are highly stable systems that exhibit 2  extended circulation times in vivo, protect encapsulated plasmid from external nucleases and do not interact readily with cells (Fenske et al., 2001a; Mok et al., 1999; Tarn et al., 2000). However, it is important to demonstrate that the enhanced transfection properties of S P L P in the presence of C a  2 +  do not arise  due to destabilization of the S P L P leading to the release of free plasmid for which calcium phosphate is well known to enhance transfection. The stability of the S P L P in the presence of C a  2 +  was examined employing quasi-elastic light  scattering (QELS) to detect changes in size, and the Picogreen fluorophore assay to detect DNA leakage. For the Q E L S experiments, C a C I was added to 2  the S P L P suspension to achieve concentrations as high as 50 m M . No change in the S P L P size or size distribution was observed (results not shown). For the plasmid release experiments, S P L P were incubated at 37 °C in H B S buffer containing 10% F B S in the presence or absence of 8 mM C a . Plasmid release 2 +  was assayed over 24 h employing the Picogreen assay. No plasmid release was observed (results not shown).  4.3.6 Calcium phosphate-mediated enhancements in gene expression of SPLP are not affected by serum nucleases. A calcium phosphate dependent enhancement in transfection by naked plasmid requires that the plasmid be protected from serum nucleases ubiquitous in the blood. To explore the effect of nucleases on calcium phosphate transfection of  135  plasmid DNA, we conducted calcium phosphate transfections of free and S P L P encapsulated plasmid DNA in cell medium containing active serum nucleases and medium containing serum that has been heat inactivated to reduce serum nuclease activity. At 24 h, cells were washed 2X in D P B S and then assayed for luciferase expression. Gene expression following transfection with free plasmid resulted in a 120-fold reduction in the nuclease containing media (Figure 4.5). In contrast, the presence or absence of nuclease activity in the media did not affect gene expression of the encapsulated system (Figure 4.5).  4.3.7 Calcium phosphate facilitates the transfer of large molecules trapped in the endosome/lysosomes into the cytoplasmic component of the cell. To more specifically understand the underlying mechanism behind C a  2 +  phosphate transfection, we conducted experiments to identify differences in cell distribution of S P L P following uptake. Cells were transfected with Rhod-DOPElabeled S P L P and C a  2 +  and then observed by fluorescence microscopy over a 24  h time period. Visual evidence for differences in the distribution of S P L P in the cell in the presence or absence of C a  2 +  was subtle with indication of a C a  2 +  related increase in lipid content in the cells, and much larger punctate structures where most of the particles were accumulated (data not shown). For more definitive visual evidence a 10,000 molecular weight fluorescently labeled dextran was employed to investigate differences in cellular distribution following uptake when C a  2 +  is present. Dextran was selected since it resists biological  degradation and is known to enter the cell primarily via phagocytotic and  136  endocytotic pathways, similar to the route of entry for non-viral systems (Berlin and Oliver, 1980). Cells seeded in chambered coverglass were incubated with Alexa Fluor 488-labeled dextran and C a  2 +  in non-serum containing media for 30  min and then serum was added to yield 10% (vol/vol) serum in the cell chamber well. Following 2 h, the cells were washed 2X in D P B S , and then fresh medium was added and cells were left to incubate for a further 10 h period. Following 2 washes with D P B S at the 2 h and 12 h time points, cells were observed under 400X magnification for cellular distribution of the fluorescently labeled dextran. In Figure 4.6A and C it is evident that after 2 h, the cells treated with and without C a  2 +  take up dextran which is limited to punctate structures distributed in  the cytoplasmic region of the cell. After 12 h, the cells treated with C a  2 +  show  distribution of dextran in a more diffuse pattern throughout the cytoplasm of the cell as well as in very large punctate structures (Figure 4.6D). Conversely, in the absence of C a  2 +  very low levels of dextran remained in the cell, still evident in  small punctate structures in the cytoplasmic region (Figure 4.6B).  137  1.E+05 • free DNA (- nuclease)  c '5 o  • free DNA (+ nuclease) 1.E+04 A  a.  • S P L P (- nuclease) • S P L P (+ nuclease)  o a 1" 1.E+03 o  § 1.E+02o  1.E+01 0 mM  8 mM  Figure 4.5. Ca -phosphate enhanced transfection of S P L P is not affected by serum nucleases. B H K cells were treated as described in Figure 4.3 with S P L P at a dose of 1ug S P L P (DODAC: D O P E : P E G - C , 8:82:10; molar ratio) encapsulated pDNA/well for 24 h min in nuclease deficient and nuclease containing D M E M media. After 24 h, cells were washed 2X in D P B S followed by lysis in 0.1% TX-100 D P B S solution. The lysate was assayed for luciferase expression. Gene expression data presented was normalized to cell protein content in the lysate assayed and data points represent the mean ± standard deviation (n=3). 2 0  138  Figure 4.6. Calcium phosphate-mediated intracellular release of dextrans following cell uptake. BHK cells were treated with a mixture of C a and Alexa Fluor 488 labeled 10,000 mol. wt. dextran as described in Materials and Methods. Treatments were conducted in the presence and absence of 8 mM C a . Serum was absent for the first 30 min in all wells, after which additional F B S was added to yield 10% vol in the media. Cells were incubated for an additional 1.5 h, and then washed 2X in D P B S and incubated in serum containing media for an additional 10 h. Micrographs were taken at the 2 h (A, B) and 12 h (C, D) time points to compare dextran distribution in the presence (C, D) and absence of C a (A, B) under 400X magnification using an inverted fluorescence microscope. 2 +  2 +  2 +  139  4.4  DISCUSSION  The results presented in this work demonstrate that C a  2 +  can dramatically  stimulate the transfection potency of the S P L P system in vitro, that this effect appears to depend on the presence of calcium phosphate and that this effect is not related to calcium phosphate-dependent destabilization of the S P L P structure. W e discuss these areas in turn. The addition of C a  2 +  enhances S P L P potency by 60-100 fold in conditions  where serum is present, and up to 6000-fold when serum is absent from the media for the initial 10 min period of the transfection procedure. This C a  2 +  effect  occurs only in the presence of phosphates, providing strong evidence to support that the increase is related to the presence of calcium phosphate precipitates. The C a  2 +  and phosphate concentrations required are similar to others utilizing  calcium phosphate transfection protocols (Chowdhury et al., 2003; Zaitsev et al., 2002). Interestingly, the C a  2 +  concentrations required to achieve this increase in  gene expression fall over a narrow range. The reduction in expression at levels above the optimal peak concentration of C a  2 +  is commonly attributed to the  formation of calcium phosphate precipitates that become too large for effective delivery (Chowdhury et al., 2003; Jordan et al., 1996). The observation that C a  2 +  does not cause detectable destabilization of the  S P L P system suggests that the calcium phosphate-dependent enhancement in transfection levels does not result from direct interaction with S P L P plasmid DNA.  It is possible that small calcium phosphate precipitates could adsorb to the  S P L P surface. In this regard the S P L P purification yields particles with  140  approximately 5 % of the plasmid exposed to the extracellular environment that cannot be removed by further purification on a D E A E column (data not shown). Alternatively, it is possible that calcium phosphate directly causes destabilization of the endosomal membrane without direct association with the S P L P particle. This possibility is further supported by our results showing that calcium phosphate directly enhances the intracellular delivery of fluorescently labeled dextran. Dextran, which lacks a positive charge, would not be expected to coprecipitate with calcium phosphate. This observation correlates with the hypothesis that the precipitates are acting primarily as lysosomotrophic agents which, at lower pH, encourage destabilization of endosomal/lysosomal membranes (Zaitsev et al., 2 0 0 2 ) . The potential utility of this calcium phosphate effect to enhance transfection properties of S P L P in vivo is questionable. The ability of the S P L P system to protect encapsulated plasmid from degradation by serum nucleases, while maintaining sensitivity to calcium phosphate, clearly extends the utility of the method. However, methods to locally generate calcium phosphate precipitates to enhance transfection at disease sites such as a tumor site are not available. In conclusion, the data presented provides much needed further understanding into the underlying mechanism behind C a  2 +  phosphate  transfection and introduces a well-characterized protocol to enhance the potency of a highly stable non-viral system shown previously to demonstrate clinically relevant levels of localization and expression in in vivo tumor models.  141  CHAPTER 5: pH DEPENDENT POLY (2-ETHYL ACRYLIC ACID) POLYMERS FOR THE ENHANCEMENT OF INTRACELLULAR DELIVERY OF STABILIZED PLASMID LIPID PARTICLES.  5.1 INTRODUCTION In a final attempt to improve the intracellular delivery properties of S P L P , the effects of pH sensitive polymers were investigated. In general, pH sensitive peptides and polymers disrupt endosomal/lysosomal membranes following charge neutralization in acidic compartments. Neutralization of the molecule renders it hydrophobic, facilitating interaction with and insertion into neighbouring lipid membranes. Viral-based pH-sensitive peptides have demonstrated reasonable intracellular delivery properties (Haenslerand Szoka, 1993; Simoes et al., 1998; Wagner et al., 1992) but suffer intrinsic limitations of stability, cost and immunogenicity (Horvath et al., 1998). pH sensitive polymers on the other hand, have clear advantages over systems based on pH sensitive peptides in that polymers can be specifically designed to function at well-defined pH values (Jones et al., 2003), are stable, are relatively straightforward to manufacture (Linhardt et al., 1999) and display pH sensitivity in the presence of serum (Cheung etal., 2001). Of particular interest is poly (2-ethyl acrylic acid) (PEAA) (Figure 5.1). P E A A systems are negatively charged at neutral pH due to the presence of a carboxylate ion on each monomer unit. Once protonated in acidic compartments at a threshold pH of 6.5, the polymers partition into the membrane and disrupt  142  CH CH 2  CH  2  3  C n  CO H 2  Figure 5.1. Poly (2-ethylacrylic acid) (PEAA). Chemical structure of the repeated units in PEAA.  143  the bilayer, inducing micellization of the membrane (Thomas et al., 1996). P E A A has been well characterized in terms of its ability to destabilize synthetic membrane systems in a very specific pH range without detectable activity at pH 7.4 (Thomas et al., 1996). Also, previous work in this laboratory has led to the development of a simple one step process to coat preformed L U V with P E A A . This process utilized modified polymers containing a low density of alkyl chains that spontaneously associate with L U V on incubation (Chen et al., 2004). It was demonstrated that P E A A - L U V prepared by this method exhibit proton induced membrane destabilization and fusion with liposomal membranes and within intracellular compartments (Chen et al., 2004). Alkyl acrylic acid polymers such as P E A A have rarely been investigated for gene therapy systems thus far. The systems they have been incorporated in are generally lipoplex type carriers (Cheung et al., 2001; Jones et al., 2003) that are not appropriate for intravenous delivery to regions such as distal tumor sites. In this chapter, application of P E A A polymers to improve the intracellular delivery properties of S P L P will be studied. The polymer will be characterized for its pH dependent membrane leakage properties including its ability to induce release of a small fluorophore as well as plasmid DNA from S P L P . Co-transfections of S P L P and the polymer will be conducted to determine the polymer's potential in enhancing gene expression of S P L P . Finally, S P L P systems with the derivative acyl-PEAA post-inserted into the membrane will be characterized and investigated for cell uptake and transfection potency.  144  5.2 MATERIALS AND METHODS 5.2.7 Materials. Diethyl ethylmalonate, 1-aminopyrene, diethylamine and formalin were purchased from Aldrich Chemical C o . (St. Louis, M O , USA). 2,2'azobis(isobutyronitrile) (AIBN) was provided by Dr. Perrin in the Chemistry Department at the University of British Columbia (Vancouver, B C , Canada). 1alkylamine was purchased from ( R N H , R=CioH i) Fluka (St. Louis, M O , USA). 2  2  N,N-dioleyl-N,N-dimethylammonium chloride (DODAC) was obtained from Dr. S . Ansell at Inex Pharmaceuticals (Burnaby, B C , Canada) or purchased from Northern Lipids (Vancouver, B C , Canada) and 1 -0-(2-(o> methoxyethyleneglycol)succinoyl)-2-N-arachidoylsphingosine ( P E G - C e r C ) was 20  synthesized by Dr. J . Hayes at Protiva Biotherapeutics (Vancouver, B C , Canada). 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) was purchased from Northern Lipids (Vancouver, B C , Canada). 1,2-dioleoyl-snglycero-3-phosphoethanolamine-N-(Lissamine Rhodamine B Sulfonyl) (RhDOPE) was purchased from Avanti Polar Lipids (Alabaster, A L , USA). M e O H , C H C I , triethylamine, ethyl acetate, magnesium sulfate, diethyl ether and HCI 3  were ordered from Fisher Chemicals (Fairlawn, N J , USA). 1 ,ethyl-3(3dimethylaminopropyl) carbodiimide (EDC), ninhydrin, H E P E S , M E S , NaCI and NaOH were purchased from Sigma Chemical C o . (St. Louis, M O , USA). 8hydroxypyrene-1,3,6-trisulfonic acid (HPTS), p-xylene-bis-pyridinium bromide (DPX) and PicoGreen™ were purchased from Molecular Probes (Eugene, O R , USA). Plasmid DNA (pCMV-Luc) coding for the luciferase reporter gene under  145  the control of the human C M V immediate early promoter-enhancer element was obtained from Protiva Biotherapeutics.  5.2.2 PEAA synthesis. Synthesis of ethyl acrylic acid and subsequent free radical polymerization of ethyl acrylic acid (using 2,2'-azobis(isobutyronitrile) (AIBN) as the initiator) to yield poly(2-ethylacrylic acid) (PEAA) polymers of an average molecular weight of 20 kDa was synthesized based on a method described elsewhere (Ferritto, 1992). Briefly, 1 g (10 mmol) of vacuum distilled 2-ethylacrylic acid was placed in an ampule with 33 mg (2 mol%) of AIBN. The ampoule was subjected to 3 freezedegas-thaw cycles and sealed under vacuum. The sealed ampoule was heated at 65°C for 12-14 h, cooled and the resulting slurry was poured into excess ethyl acetate. The polymer was isolated by gravity filtration and dried under high vacuum for 2 h.  5.2.3 Solvent fractionation of PEAA. The polymer was separated by a solvent fractionation procedure using methanol as the solvent and diethyl ether as the non-solvent described by Linhardt et al. (Linhardt et al., 1999). Briefly, P E A A was dissolved in M e O H at a concentration of 50 mg/mL and precipitated by slow dropwise addition of diethyl ether while stirring vigorously. Successive fractions of the polymer were precipitated by taking the filtrate and adding more ether. The fraction that was insoluble in mixtures of diethyl ether: methanol (1:1) was isolated since it was previously  146  determined that P E A A in the size range of 23 kDa precipitates out at this ratio (Linhardt et al., 1999). The average molecular weight of the product was 16.3 kDa with 76.7% of the polymer having a molecular weight of 20.8 kDa determined by Neil Gibson at Vizon SciTec (Vancouver, B C , Canada) using aqueous gel phase permeation chromatography (GPC) calibrated with poly(ethylene oxide) (PEO) standards.  5.2.4 Preparation of HPTS/DPX containing liposomes. Egg phosphatidylcholine (EPC) and cholesterol were mixed at a ratio of 3:1 in chloroform and dried under a stream of nitrogen gas. The thin lipid film was exposed to high vacuum for approximately 2 h to remove residual solvent before hydration in buffer containing: 20 mM Hepes (pH 7.50), 35 mM H P T S , 50 mM D P X and 85 mM NaCI to form multilamellar vesicles, at a concentration of 10 mM total lipid. The vesicles were freeze-thawed five times utilizing liquid nitrogen and warm water cycles and then extruded through three-stacked 0.1 pm pore-sized polycarbonate filters using an Extruder (Lipex Biomembranes, Vancouver, B C , Canada) generating large unilamellar vesicles (Hope et al., 1985). Nonentrapped H P T S and D P X were removed by chromatography using a 1.1 x 20 cm Sepharose CL-6B column (Sigma Chemical Co.) equilibrated with H B S (20 mM Hepes, 150 mM NaCI, pH 7.5) buffer.  147  5.2.5 HPTS and pDNA release assays. Fluorescent detection assays of polymer-induced release of H P T S (described elsewhere: (Daleke et al., 1990)) and pDNA from liposomes and S P L P respectively, were conducted in order to demonstrate the pH sensitivity of the free and acylated polymers used in the transfection experiments. E P C : C h o l (75:25; molar ratio) LUVs were prepared with fluorescent aqueous H P T S (35 mM) co-encapsulated into L U V s with a cationic quencher D P X (50 mM) (described above). For H P T S release studies, 18 nmol of LUVs with the entrapped H P T S / D P X were added to 2 mL aliquots of buffer at pH 5.5 (20 mM M E S , 150 mM NaCI), 6.5 (20 mM M E S , 150mM NaCI) or 7.5 (20 mM Hepes, 150 mM NaCI) in a quartz cuvette under constant stirring. For the pDNA release assays, approximately 1.0 pg of pDNA encapsulated into S P L P (prepared as described above) was added to similar M E S and Hepes buffers described for the H P T S assay with the addition of 1% (vol/vol) PicoGreen™ dye which fluoresces upon intercalation with exposed pDNA. After approximately 25 s, 250 pmol polymer was added to the L U V or S P L P buffer mixture and observed for changes in fluorescence intensity over a 60 s period using a luminescence spectrofluorometer (Perkin Elmer LS-50; Boston, MA, USA). The emission wavelength was set at 511 nm (slit width 2.5 nm) to detect H P T S fluorescence (fluorescence of H P T S is independent of pH when excited at this wavelength) under steady-state excitation at 413 nm (slit width 2.5 nm) and PicoGreen fluorescence was detected at 520 nm (slit width 5.0 nm) with a steady state excitation wavelength of 485 nm (slit width 5.0 nm).  148  The maximum fluorescence intensity ( F  m a x  ) , representing complete  release of encapsulated H P T S or pDNA, was determined following solubilization of the vesicles with Triton X-100 (0.1% vol/vol).  The percentage of contents released was calculated using the following equation:  % Release =  Ft -  F  0  Fmax " F  x 100 Q  where F is the fluorescence intensity at time t and F is the initial background t  0  fluorescence intensity.  5.2.6 Cell transfections. BHK cells (ATCC; Manassas, V A , USA) were cultured in D M E M media (Invitrogen; Burlington, O N , Canada) supplemented with 10% F B S at 5% C O 2 and 37°C. The cells were plated at 7-9 x 1 0 cells/well in 96-well plates 18 h prior 3  to treatments. For the free polymer transfections, S P L P particles (prepared as described above) were mixed with media before or after the addition of 17, 8 or 1.2 kDa P E A A as indicated, and then added to the cell media for a 24 h incubation period. For transfections with post-inserted C10-PEAA S P L P , the C10P E A A S P L P were mixed with media to yield a pDNA concentration of 0.5-1.0 pg plasmid/well and incubated with the cells for 24 h.  149  5.2.7 Quantitation of gene expression. Following transfection, cells were washed 2X with D P B S (Invitrogen) and then lysed with D P B S + 0.1% TX-100 (vol/vol). Aliquots of the lysate were assayed for luciferase activity using a luciferase assay kit (Promega; Madison, W l , USA) and detected using a Centra LB 960 microplate luminometer (Berthold; Bad Wildbad, Germany). Luciferase expression was determined by comparing cell lysate activity to the activity of luciferase enzyme standards of known concentrations under the same conditions (Wheeler et al., 1999). Luciferase activity was normalized against cell protein concentration in the lysate, determined with the Micro B C A protein assay reagent kit (Pierce; Rockford, IL, USA).  5.2.8 Alkylation and pyrene labeling of PEAA. The P E A A polymer (1.65 mmol of 20 kDa) was reacted with 0.0495 mmol of 1aminopyrene in methanol. A methanol solution of E D C (20 mg/ml) was slowly added to the reaction mixture until all the 1-aminopyrene had reacted. The reaction was monitored under UV for pyrene label attachment to the non-mobile polymer phase by thin-layer chromatography (solvent was 100% CHCI3). The reaction was continued until there was only trace amounts of free pyrene evident on the T L C plate. The pyrene labeled P E A A was precipitated by adjusting the pH of the solution to pH 2-3. The supernatant was removed and the pellet was washed with diethyl ether to remove the non-reacted 1-aminopyrene. The outline for the synthesis of the acylated derivative of pyrene-PEAA is shown in Figure  150  5.2. 105 mg (1.02 mmol unit, unit MW = 103 with pyrene label) of pyrene-labeled P E A A and 0.03 mmol of 1-alkylamine ( R N H , R= C10H21) were dissolved in water 2  (pH 7.0). A solution of E D C in d H 0 (20 mg/ml) was slowly added to the reaction 2  mixture until all the amine had reacted. The reaction was monitored by thin-layer chromatography ( C H C I 3 : M e O H : triethylamine = 8:2:0.2; amine was visualized employing ninhydrin). The resulting derivative was precipitated by adjusting the pH of the solution to pH 2-3. The supernatant was removed and the pellet was re-dissolved in a 2 M N a O H solution, stirred for 0.5 h and the pH re-adjusted to pH 2-3. The suspension was centrifuged and the resulting pellet was washed 3-5 times in water and lyophilized.  5.2.9 SPLP preparation. S P L P were prepared as described in Chapter 3  5.2.10 Preparation of PEAA-containing SPLP. Aliquots of rhodamine-PE containing S P L P particles in H B S (20 mM Hepes, 150 mM NaCI, pH 7.4) were incubated with pyrene labeled C10-PEAA polymer overnight at room temperature at the derivatized P E A A : S P L P lipid molar ratio indicated (in the range of 0.0032 - 0.020). Excess free polymer was separated from SPLP-associated polymer by chromatography on a Sepharose C L - 6 B column (1.5 x 20 cm) and the fractions were assayed for lipid (rhodamine-PE fluorescence) and polymer content (pyrene fluorescence).  151  o  x  CI H I +  POLYMEtT^OH  +  H.C.  N=C=N. CH, EDC  O  X.  POLYMER  H C 3  CI" H I +  O  I  CH,  N-C=N_  O - A c y l i s o u r e a active intermediate R-NH  2  (alkylamine)  Isourea o POLYMER  N  I  H  A n c h o r e d polymer CH (CH,) 3  9  Figure 5.2. Reaction scheme for the alkylation of P E A A . Purified 20 kDa P E A A is conjugated to alkylamine by coupling to the carboxylic acid groups of P E A A mediated by E D C .  152  5.2.11 DNase resistance assay. Encapsulated DNA in the S P L P systems were assayed for nuclease resistance following C-io-PEAA polymer post-insertion by incubating the particles in purified DNase I. Five micrograms of free or S P L P encapsulated plasmid DNA was incubated with 100 - 750 units of DNase I (Invitrogen) for 30 min at 37°C in a total volume of 120 pL. Following incubation, D N A was extracted by adding 120 pL phenokchloroform: isoamyl alcohol ((25:24:1) saturated with 10 mM Tris, pH 8.0), vortexed and then centrifuged at 13,000 rpm in a microcentrifuge for 30 s. The upper aqueous layer was isolated and then re-extracted with an additional 120 pL of phenol: chloroform isoamyl alcohol mixture. 10 pL of 3 M sodium acetate and 220 pL of cold 100% ethanol was added to the extracts and then stored at -70°C for at least 15 min to precipitate the DNA. The samples were then centrifuged in a microfuge (Eppendorf; Hamburg, Germany) at 4°C for 10 min at 13,000 rpm to pellet the DNA. The pellet was washed with 500 pL 7 0 % ethanol and re-centrifuged for 2 min at maximum speed for 2 min. The supernatant was gently removed and the pellet was resuspended in T E buffer (10 mM Tris-CI, 1mM EDTA). Digests of free pDNA, free pDNA + LUVs, S P L P , and C10-PEAA S P L P were separated by electrophoresis on a 0.8% agarose gel (containing 5 pg ethidium bromide/mL agarose) run at 100 volts for 50 min and then photographed with a Polaroid camera under UV. The sizes of the pDNA were determined by comparing migration of the DNA extracts to a 1 kb D N A ladder (Invitrogen).  153  5.2.72 SPLP uptake studies. C-io-PEAA S P L P s containing rhodamine-PE were prepared using the detergent dialysis method as described above. Particles were added to cells at a set lipid dose of approximately 100 pM lipid concentration and then incubated for 24 h, washed 2X with Delbucco phosphate buffered saline (DPBS) (Invitrogen) and lysed by adding D P B S containing 0.1% TX-100. Aliquots of lysate were added to microplates and rhodamine fluorescence resulting from cell associated S P L P was measured on a fluorescence imager, Typhoon 8600 (Molecular Dynamics; Piscataway, N J , USA), using  ?i  e x  laser of 532 nm and A, of 580 nm. Lipid uptake em  was quantified by comparing lysate fluorescence to that of a fluorescent lipid standard of known concentration and then normalized to the total cellular protein concentration in the lysate, determined with the Micro B C A protein assay reagent kit (Pierce).  154  5.3  RESULTS  5.3.1 PEAA polymers induce membrane leakage in EPC:Chol LUVs and SPLP systems. P E A A polymers have been well characterized for their ability to induce leakage/destabilization of liposomal membranes and disrupt red blood cell membranes. To confirm the pH-dependent activity of the batches of polymer synthesized for these experiments (see Materials and Methods), liposomal and S P L P content release assays were conducted. Initially, E P C : Choi (3:1; molar ratio) LUVs co-encapsulating 35 mM H P T S fluorophore with a cationic quencher D P X were added to buffers pH'd to 5.5, 6.5 and 7.5. The 20 kDa polymer was then added to the liposome mixtures and observed for changes in fluorescence of H P T S over time, which was compared to the total fluorescence of H P T S when the L U V s are completely disrupted with 1% (vol/vol) TX-100 detergent. Increases in H P T S fluorescence served as an indicator that leakage of liposomal contents was occurring leading to the dilution of the D P X so that it was no longer effective in quenching the H P T S signal. We found that the polymer induced immediate release of H P T S / D P X from the liposomes at pH 5.5 (Figure 5.3). At pH 6.5 there was also evidence of leakage; however, it was slower than the activity observed at pH 5.5. The polymer did not induce any detectable levels of H P T S / D P X release at pH 7.5. Similar levels of P E A A polymer were then added to 1.0 pg S P L P encapsulated plasmid DNA suspended in pH 5.5, 6.5 and 7.5 buffers containing 1% (vol/vol) Picogreen™ dye which fluoresces upon intercalation with pDNA.  155  pH 5.5  0  10  20  30  40  50  60  70  Time (sec)  Figure 5.3. P E A A mediated leakage of l i p o s o m e s relative to p H . LUVs (18 nmol lipid) with the entrapped H P T S / D P X were added to 2 mL aliquots of buffer at pH 5.5, 6.5 or 7.5 in a quartz cuvette under constant stirring. Following approximately 25 s, 250 pmol polymer was added. The sample was observed for changes in fluorescence intensity over a 30 s period. At approximately 55 s, TX100 was added to 1% (vol/vol) to determine the total H P T S in the liposomes. Emission wavelength was set at 511 nm (slit width 2.5 nm) under steady-state excitation at 413 nm (slit width 2.5 nm). % Release of H P T S was calculated as described in Materials and Methods.  156  Similar to the H P T S / D P X leakage experiments, we found that 250 pmol P E A A induced the highest levels of disruption of the S P L P system at pH 5.5, exposing approximately 4 5 % of the encapsulated pDNA to PicoGreen (Figure 5.4). At pH 6.5 approximately 2 0 % of the DNA was exposed and at pH 7.5, the encapsulated plasmid was fully protected. Interestingly, additions of 2 or 3 times additional polymer to the S P L P did not induce further exposure of the pDNA (data not shown), suggesting that the interaction of the cationic lipid with the plasmid DNA is strong enough that the polymer could not fully disrupt the condensed DNA particle. Overall, these results confirm that the polymer is active and maximally disrupts membranes at pH ranges of 5.5 with little to no activity at neutral pH.  5.3.2 pH-induced membrane leakage and enhanced gene delivery by PEAA is molecular weight and concentration-dependent. The next step was to determine the concentrations of polymer required to destabilize liposomal membranes as well as the molecular weight (MW) of the polymer that is optimal for inducing membrane disruption (molecular weight of the monomer (ethylacrylic acid) is 100). Linhartd et al. previously demonstrated that the average molecular weight of the polymer affects the pH range at which the polymer becomes active (Linhardt et al., 1999). Also, it is anticipated that there will be a concentration-dependence on the degree of membrane destabilization induced by the polymer. To determine the molecular weightdependence on potency of the polymer, 5 nmol of 1.2 and 17 kDa polymer was added to 100 nmol H P T S / D P X LUVs and the H P T S fluorescence was observed.  157  Figure 5.4. P o l y m e r induced release of plasmid D N A from S P L P relative to pH. Approximately 1.0 pg of pDNA encapsulated into S P L P (prepared as described in Materials and Methods) was added to 2 mL aliquots of buffer at pH 5.5, 6.5 or 7.5 with the addition of 1% (vol/vol) PicoGreen™ dye in a quartz cuvette under constant stirring. Following approximately 10 s, 250 pmol polymer was added to the S P L P and observed for changes in fluorescence intensity over a 90 s period and then disrupted with 1% TX-100 (vol/vol) to determine the fluorescence at 100% pDNA release. Emission wavelength for PicoGreen fluorescence was detected at 520 nm (slit width 5.0 nm) with a steady state excitation wavelength of 485 nm (slit width 5.0 nm). % DNA release was determined as described in Materials and Methods.  158  fluorescence at pH 5.5, as described above. It was found that for an equivalent number of molecules, the 17 kDa P E A A is much more effective than the 1.2 kDa P E A A in disrupting L U V membranes (Figure 5.5A). However, when 50 nmol or 10-fold higher amounts of 1.2 kDa polymer was added, full release of H P T S contents occurred immediately upon the addition of the polymer (Figure 5.5A); demonstrating that the critical factor may not be the concentration of the polymer, rather the concentration of the monomer units available. The leakage experiments described in Figure 5A with E P C : C h o l liposomes demonstrated that the polymer is most effective when the molar ratio of the polymer to lipid is approximately 1:20 for the 17 kDa polymer and 1:2 for the 1.2 kDa polymer. Transfection studies were then conducted to observe how the results from the leakage studies correlate to intracellular delivery of pDNA, evidenced by changes in gene expression when S P L P were co-transfected with P E A A . S P L P were prepared with a lipid composition of D O D A C : D O P E : P E G CerC2o (8: 82: 10; molar ratio) encapsulating plasmid DNA encoding for the luciferase enzyme (pCMV-Luc) as described in Materials and Methods. Polymers (1.2, 8.4 and 17 kDa) were mixed with S P L P and then added to B H K cells for 24 h. Following transfection, the cells were washed with P B S and then lysed to determine luciferase activity. Data presented in Figure 5.5B demonstrate that enhancement in transfection of S P L P by P E A A correlates to the M W of the P E A A polymer. The 1.2 kDa polymer did not enhance gene expression despite the introduction of concentrations as high as 1 X 1 0 molecules per S P L P , relating to approximately 6  159  A  no  Time (sec)  0  10  100  1000  10000  100000 1000000  PEAA: S P L P  Figure 5.5. Transfection potency of S P L P relative to P E A A concentration and MW. Release study of 1.2 and 17 kDa P E A A induced leakage of H P T S / D P X LUVs (A) was conducted as described in Figure 5.3. 0, 5 or 50 nmol polymer was added to 100 nmol (lipid) H P T S / D P X LUVs. The sample was observed for changes in fluorescence intensity over a 50 s period. At approximately 50 s, TX-100 was added to 1% (vol/vol) to determine the total H P T S in the liposomes. The transfection potency of S P L P co-transfected with the polymer is demonstrated in (B). S P L P were prepared with a lipid composition of D O D A C : D O P E : P E G - C e r C (8: 82: 10; molar ratio) encapsulating plasmid DNA encoding for the luciferase enzyme (pCMV-Luc) as described in Materials and Methods. 1.2, 8.4 and 17 kDa polymers were mixed with S P L P encapsulating 1.0pg pCMV-Luc at the described polymer/SPLP particle ratios and then added to BHK cells for 24 h. Following transfection, the cells were washed with P B S and then lysed to determine luciferase activity. Luciferase activity was normalized against cell protein concentration in the lysate. Data points represent the mean ± standard deviation (n=4). 2 0  160  12:1 (molar ratio) of polymers: S P L P lipid molecules, based on the assumption that there are approximately 82,000 lipid molecules/SPLP particle (Figure 5.5B). This approximation is based on the surface area of each leaflet of the liposomal bilayer (Aux ) of the S P L P particle having a diameter of 100 nm, an average 2  surface area of each phospholipid of 70 A, and bilayer thickness of approximately 40 A. Alternatively, both the 8.4 and 17 kDa polymers raised gene expression by over 3-orders of magnitude when introduced at concentrations of 1X10  5  molecules per S P L P (approximately a 1:1 polymer: lipid molar ratio) (Figure 5.5B). The 17 kDa polymer enhanced gene expression only in the 1 X 1 0 / S P L P 5  range since levels as high as 1 X 1 0 did not increase gene expression further 6  (Figure 5.5B). This reduction at 1 X 1 0 / S P L P may be related to toxicity, since cell 6  growth was dramatically reduced at this concentration range for the 17 kDa polymer (data not shown). However, a reduction in gene expression at the 1X10 polymers/liposome dose was not evident with the 8.4 kDa polymer. 6  Overall, these experiments demonstrate that co-transfection of S P L P with P E A A polymers in the 17 and 8.4 kDa size range dramatically improves the transfection potency of S P L P .  5.3.3 Polymer-enhanced intracellular delivery of SPLP is dependent on the order of addition in co-transfection experiments with PEAA and SPLP. The results presented in Figure 5.4 indicate that it is possible to enhance gene expression of S P L P if co-transfected with P E A A . To further substantiate that the polymer is acting by disrupting endosomal membranes as opposed to modifying  161  the S P L P system due to a non-specific interaction, transfections were conducted with polymer introduced to the cells concurrently with S P L P or after the cells have taken up the S P L P . Specifically, B H K cells were transfected for 24 h with S P L P particles encapsulating a luciferase reporter gene (pCMV-Luc) in the following conditions: (1) polymer was added to S P L P and then mixed with serumcontaining media prior to addition to cells, (2) S P L P was mixed with serum containing media and then the polymer was added and then applied to the cells or (3) cells were incubated with S P L P in serum containing media for 4 h, washed 2X with P B S and then incubated with P E A A in media for the remaining 20 h period. The results presented in Figure 5.6 demonstrate that the order of addition affects the polymer activity quite substantially. The addition of the polymer to S P L P either after introducing the particle to serum containing media or after the S P L P has been taken up by the cell, induces the highest increases in gene expression of the carrier (up to 100-fold). Interestingly, the lowest activity was observed if the polymer was added to the S P L P prior to mixing the particles with media (Figure 5.6). Also, the potency of the polymer was highest at 1X10 P E A A 5  molecules/SPLP which is in agreement with the previous study (Figure 5.5B). These results suggest that the interaction of the polymer with the S P L P system reduces the potency of P E A A . Also, by demonstrating that transfection can be enhanced by introducing the polymer after the cell has taken up the S P L P suggests that the polymer can potentially facilitate release of any type of cargo introduced into the cell that is trapped in endosomal/lysosomal compartments.  162  Figure 5.6. Effect of addition order of PEAA to SPLP on transfection potency. S P L P were prepared with a lipid composition of D O D A C : D O P E : P E G CerC o (8: 82: 10; molar ratio) encapsulating plasmid DNA encoding for the luciferase enzyme (pCMV-Luc) as described in Materials and Methods. 8.4 kDa polymers were mixed with S P L P encapsulating 1.0 pg pCMV-Luc in the following conditions: (1) polymer was added to S P L P and then mixed with serum containing media prior to addition to cells, (2) S P L P was mixed with serum containing media and then the polymer was added and then applied to the cells or (3) cells were incubated with S P L P in serum containing media for 4 h, washed 2X with P B S and then incubated with P E A A in media. The total time for all transfections was 24 h. Following transfection, the cells were washed with P B S and then lysed to determine luciferase activity. Luciferase activity was normalized against cell protein concentration in the lysate. Data points represent the mean ± standard deviation (n=4). 2  163  5.3.4 do-PEAA can be post inserted efficiently into SPLP systems without significant changes in particle size and pDNA protection from nucleases. The transfections with the free polymer have demonstrated that it is possible to induce intracellular delivery of pDNA from S P L P by introducing polymer into the transfection medium. This is a viable method for transfections in cell culture; however, it is inefficient since much of the polymer is not expected to reach intracellular vesicles where S P L P is sequestered due to polymer interactions with the extracellular and serum proteins in the media. To attach the polymer to the S P L P to improve polymer efficiency, P E A A was post-inserted into the S P L P membrane. Post-insertion was achieved by acylating 3 % of the P E A A carboxylic acid groups with a C10 aminoalkyl group. The method to acylate the polymer (described in Materials and Methods and depicted in Figure 5.2) as well as the conditions required for post-insertion into liposomal membranes were previously determined (Chen et al., 2004), shown schematically in Figure 5.7. The acylated polymer was assayed for potency and pH sensitivity to ensure that the addition of the pyrene label and alkyl group did not alter the functionality of the polymer. To study the C10-PEAA for activity, it was introduced to H P T S / D P X containing E P C : Choi liposomes as described in Section 5.2.3 above at a molar ratio of 30: 1 (lipid : acylated polymer). Similar to the activity observed for non-acylated polymer, the C10-PEAA demonstrated almost complete leakage of H T P S at pH 5.5 and slightly slower release kinetics when  164  Figure 5.7. S c h e m a t i c of the post-insertion protocol of C10-PEAA into preformed S P L P . S P L P were mixed with the C - P E A A polymer overnight at room temperature. The uninserted polymer was removed by separation on a Sepharose CL6B sizing column and then assayed for P E A A to lipid ratio before and after the column to determine the % polymer inserted/ S P L P lipid. 1 0  165  introduced at pH 6.5 (Figure 5.8). Up to 8% of the H P T S leaked from the liposomes at pH 7.5. Once it was established that the C10-PEAA was functional, it was postinserted into S P L P and assayed for particle size and insertion efficiency. It was found that the polymer could be successfully inserted into pre-formed S P L P particles by co-incubation of the C - P E A A with the S P L P overnight at room 1 0  temperature. The non-inserted polymer was removed by separation on a Sepharose C L 4 B column equilibrated in H B S (see Materials and Methods). Insertion efficiency was determined for polymer: S P L P lipid molar ratios of 0.0032, 0.0064, 0.0128 and 0.0191. W e found that the insertion efficiency was approximately 70-80% for ratios up to 0.0128 but was reduced significantly for the 0.0191 ratio to approximately 37% (Table 5.1). W e also determined that the particle size increased by approximately 15-20 nm after polymer insertion which agrees with the expectation that the surface of the particle will be extended by the insertion of a 17 kDa polymer into the membrane surface. Finally, to ensure that the pDNA was still protected in the S P L P system following C10-PEAA insertion, the particles were added to H B S containing PicoGreen to assay for fluorescence intensity changes to determine whether the pDNA was accessible. It was found that the PicoGreen could access a majority of the pDNA encapsulated (data not shown). To ensure that the S P L P was still effectively protecting the encapsulated pDNA from nucleases following C10-PEAA post-insertion, the C10-PEAA S P L P particles were incubated with DNase I for 30 min at 37°C. A s controls, free pDNA, pDNA + L U V s and S P L P were also subject  166  0 0  20  40  60  80  100  Time (sec)  Figure 5.8. C10-PEAA mediated leakage of l i p o s o m e s relative to p H . LUVs with entrapped H P T S / D P X were added to 2 mL aliquots of buffer at pH 5.5, 6.5 or 7.5 in a quartz cuvette under constant stirring. Following approximately 30 s, C10-PEAA was added at a molar ratio of 30: 1 lipid to acylated polymer. The sample was observed for changes in fluorescence intensity over a 50 s period. At approximately 80 s, TX-100 was added to 1 % (vol/vol) to determine the total H P T S in the liposomes. Emission wavelength was set at 511 nm (slit width 2.5 nm) under steady-state excitation at 413 nm (slit width 2.5 nm). % Release of H P T S was calculated as described in Materials and Methods.  167  Table 5 . 1 . Characterization of SPLP with post inserted C10-PEAA  Post-insertion efficiency  Polymer: SPLP particles  Size of SPLP with postinserted C10-PEAA  (molar ratio)  (% inserted)  (# polymers/liposome)  (nm ± stdev.,chP))  0  -  -  99.2 ±27.7, (1.0)  0.0032  70  180  121.6 ±33.4, (0.7)  0.0064  80  420  115.6 ±38.1, (2.1)  0.0128  66.5  700  120.2 ±34.4, (1.1)  0.0191  36.6  575  113.9±29.8, (1.1)  Polymer: lipid  a  a  c  ratio expresses the molar ratio of C - P E A A added to S P L P (lipid concentration of the particle) 10  S P L P were incubated with C - P E A A (molar ratio indicated in ) overnight at room temperature and free C PEAA was removed by Sepharose CL-6B column chromatography.  b  a  10  1 0  Polymer association is expressed in as # of polymers per S P L P vesicle. The number of S P L P / lipid concentration was calculated based on: the number of lipids per S P L P particle determined from the particle size and the average surface area of a phospholipid of 70 A m™*™. «ix»  c  2  168  to DNAse I exposure. Following DNase I digestions, the pDNA was extracted by phenol: C H C I : isoamyl alcohol addition and then subject to precipitation with 3  ammonium acetate and ethanol. The pellets were washed, re-suspended in T E and then separated on a 0.8% agarose gel to determine the integrity of the plasmid. The results in Figure 5.9 indicate that the plasmid was protected in the C10-PEAA S P L P systems regardless of the amount of polymer post-inserted (lanes 4-7). The DNase I was introduced at sufficient levels since the free plasmid and plasmid + L U V controls were both completely digested after the 30 min exposure (lanes 2 and 3).  5.3.5 Cw-PEAA SPLP demonstrates significantly higher gene expression levels relative to SPLP which is unrelated to changes in particle uptake. Once it was determined that C10-PEAA could be successfully post-inserted into S P L P without affecting the particle size and DNA protection from nucleases, transfection experiments were conducted with S P L P containing approximately 180, 420 and 700 C10-PEAA molecules inserted into the S P L P membrane. B H K cells were treated with S P L P and C10-PEAA S P L P s containing a rhodamine-PE lipid label encapsulating pCMV-Luc at a dose of 1.0 pg encapsulated pDNA/well in a 96 well plate. The cells were incubated with the carrier systems for 24 h, then washed 2X with P B S and lysed to determine luciferase expression and levels of uptake of the particle based on the rhodamine fluorescence in the lysates.  169  free  LUVs  SPLP  SPLP + C -PEAA 1 0  180  420  700  Figure 5.9. Susceptibility of purified C - P E A A S P L P plasmid D N A to D N a s e s . C-io-PEAA S P L P particles containing varying amounts of polymer (lanes 5 -7) were incubated with DNase I for 30 min at 37°C. A s controls, free pDNA (lane 2), pDNA + LUVs (lane 3) and S P L P (lane 4) were also subject to DNAse I exposure. Following DNase I digestions, the pDNA was extracted by phenol: C H C b : isoamyl alcohol addition and then subject to precipitation with ammonium acetate and ethanol. The pellets were washed, re-suspended in T E and then separated on a 0.7% agarose gel to determine the integrity of the plasmid. 1 0  170  Transfection potency of the S P L P containing varying levels of C10-PEAA was directly related to the amount of polymer post-inserted. Insertion of 420 as opposed to 180 polymers raised gene expression by 2-fold (Figure 5.10). The highest levels of expression were observed with 420 or 700 molecules inserted, raising the gene expression by 80-fold relative to S P L P without P E A A postinsertion (Figure 5.10). The increase in expression was not due to polymer related changes to particle uptake, since there was a maximum of an approximately 2-fold increase in uptake of S P L P relative to C10-PEAA containing S P L P over the range of 180-700 polymers post-inserted (Figure 5.11).  171  160  c "5 140 o Q.  =  120 ]  tf) at  fi  60  Q. X LU  0 0  180  420  700  Molecules C - P E A A Post-Inserted into S P L P 10  Figure 5.10. Transfection potency of C10-PEAA S P L P . Transfection experiments in B H K cells were conducted with S P L P containing approximately 180, 420 and 700 C10-PEAA molecules inserted into the S P L P membrane. B H K cells were treated with S P L P and C10-PEAA S P L P s containing a rhodamine-PE lipid label encapsulating pCMV-Luc at a dose of 1.0 pg encapsulated pDNA/well in a 96 well plate. The cells were incubated with the carrier systems for 24 h, then washed 2X with P B S and lysed to determine luciferase expression. Luciferase activity was normalized against cell protein concentration in the lysate. Data points represent the mean ± standard deviation (n=5).  172  0.014  I 0.012 4—<  O a.  5  o.oi  o  =3 0.008 D.  0.006  0)  ro 0.004 Q. 3 - 0.002 Q. CO 180  420  780  Molecules C -PEAA Post-Inserted into SPLP 10  Figure 5.11. Cell uptake of C10-PEAA S P L P . C10-PEAA S P L P s containing rhodamine-PE were prepared as described in Materials and Methods. Particles were added to cells at a lipid dose of approximately 100 pM lipid concentration and then incubated for 24 h, washed and then lysed by adding D P B S containing 0.1 % TX-100. Aliquots of lysate were added to microplates and rhodamine fluorescence resulting from cell associated S P L P was measured on a fluorescence imager. Lipid uptake was quantified by comparing lysate fluorescence to that of a fluorescent lipid standard of known concentration and then normalized to the total cellular protein concentration in the lysate. Data points represent the mean ± standard deviation (n=5).  173  5.4 DISCUSSION In this chapter we have shown that P E A A polymers very effectively increase the intracellular delivery properties of S P L P . The level of activity is specific to pH and the average molecular weight of the polymer used. Also, we show the polymer can be post-inserted into the S P L P membrane without compromising particle size and DNA protection from nucleases. The ability to conveniently post-insert the polymer into S P L P systems significantly reduces the polymer: S P L P ratios required to elicit endosomal/lysosomal release and creates a viable approach to delivering genes in vivo with improved intracellular delivery properties relative to S P L P systems. In the free form the P E A A polymer was not active at neutral pH; requiring pH ranges of 6.5 and below to induce membrane leakage in liposomes (Figure 5.3). Also, the P E A A destabilized S P L P systems by exposing the encapsulated DNA to a fluorophore when introduced at pH of 6.5 or 5.5 (Figure 5.4). Interestingly, a maximum of 4 0 % of the pDNA could be exposed by the polymer which could not be increased despite further additions of polymer to the S P L P (Figure 5.4). Failure to fully destabilize S P L P in the presence of P E A A may be explained by the inability of the polymer to compete with the strong interaction of the cationic lipid D O D A C with the negatively charged pDNA. The P E A A synthesis procedure used for these experiments yields polymers of varied molecular weights. Specific size ranges of polymer can then be isolated using a solvent fractionation procedure (Linhardt et al., 1999). Here it is demonstrated that smaller polymers with an average molecular weight of 1.2  174  kDa were much less efficient in inducing membrane leakage as compared to 17 kDa polymers, requiring 10 times the amount of polymer in order to induce leakage in liposomal membranes (Figure 5.5A). The leakage in the presence of low levels of P E A A results from pore formation across the membrane (Chung, 1996a), in agreement with the theoretical approximations made by Thomas and Tirrell (2000) that suggest that a segment of 14 neutralized carboxylate ions extends approximately 35 A, which is the approximate thickness of a bilayer membrane. Consequently, polymers containing an average of 12 monomeric units (1.2 kDa polymer; 1 monomer = 100 Da) are expected to result in reduced levels of leakage relative to larger polymers in the range of 17 kDa. Having characterized the pH and molecular weight-dependent membrane destabilization properties of P E A A , co-transfection experiments with S P L P and P E A A were conducted. It is shown that the molecular weight dependence on the leakage of liposomes also correlated with transfection potency. Small (1.2 kDa) polymers do not enhance gene expression of S P L P over a concentration range of up to 1 X 1 0 polymers per S P L P particle (Figure 5.5B) and were inhibitory at 6  concentrations of 1X10 and above. However, 8 and 17 kDa P E A A showed 5  increases in gene expression by up to 3-orders of magnitude with the 8 kDa demonstrating the highest level of reporter gene activity at 1X10 polymers per 5  S P L P (Figure 5.5B). These enhancements in gene expression support observations by other groups that poly(alkylacrylic acids) are capable of inducing the intracellular delivery of macromolecules of up to 260 kDa (Lackey et al., 2002) as well as plasmid DNA in cationic lipid complexes (Cheung et al., 2001).  175  P E A A does not enhance levels of gene expression in lipoplex transfections (Jones et al., 2003), in contrast to the high levels of gene expression observed with P E A A co-transfected with S P L P systems observed here. A possible rationale for the differences may be that the higher positive charge exposed on the surface of lipoplexes as opposed to S P L P , nonspecifically interacts with the free carboxylate ions on the polymer; thereby reducing the availability of the polymer to insert and destabilize intracellular membranes. Interesting attributes of P E A A polymers are that they are active in serum and can be delivered separately from the carrier system. For example, B H K cells pre-treated with S P L P for 4 h, washed with fresh medium and then exposed to P E A A demonstrated the highest levels of gene expression resulting from free polymer treatments (Figure 5.6). These results are of importance because they indicate that the polymer is acting to destabilize the systems when internalized by the cell as opposed to indirectly influencing gene delivery by modifying the vector itself. The observation that acylated P E A A can be post-inserted into S P L P membranes and that these modified S P L P exhibit improved transfection properties is of interest. The polymer can be inserted at efficiencies of 70 -80% with no evidence of particle aggregation and a small increase in size (15-20 nm) without altering the monodispersity of the population (Table 5.1). Also, nuclease protection assays confirmed that the post-inserted polymer did not affect the DNA protective qualities of the S P L P system (Figure 5.9). The modified S P L P  176  result in enhanced gene expression by up to 80-fold (Figure 5.10) with approximately 420 polymers inserted/SPLP, or relative to the total lipid content of the S P L P particle, the polymer inserted is 0.5 mol%. These higher levels of gene expression could not be explained by increases in uptake indicating that the postinserted polymer was affecting intracellular delivery after the S P L P were taken up by the cell. It is likely that the C10-PEAA S P L P system, in common with other negatively charged liposomal systems (Chonn et al., 1992) will be rapidly cleared from the circulation by the mononuclear phagocytic system following intravenous administration, thus hindering the ability of these systems to access disease sites such as tumor sites. In this context the most useful applications could lie in intracellular delivery to the fixed and free macrophages of the M P S to upregulate or downregulate specific immune responses, and these avenues are currently under investigation. Alternatively, acyl-linked P E A A conjugated S P L P systems may also have utility in direct tissue injection therapies (Laurema et al., 2003) and intratumoral injection of S P L P carrying immunomodulatory genes, which have already been shown to evoke a powerful destructive response to tumor cells (Nomura et al., 1999). In conclusion, the results reported here indicate that P E A A functions as a very potent means to enhance the intracellular delivery properties of an otherwise very stable DNA-lipid particle. P E A A was shown to be effective when co-administered with S P L P or post-inserted directly into the S P L P membrane. By minimizing the amount of polymer required to induce effective levels of gene  177  expression, the post-insertion of C10-PEAA systems holds promise for potential applications in vivo.  178  CHAPTER 6: SUMMARY AND FUTURE DIRECTIONS  This thesis examined methods to improve the intracellular delivery properties of lipid-based delivery systems for DNA-based macromolecules such as antisense oligonucleotides and plasmid DNA. In Chapter 2 , the efficiency of SALP-delivered antisense oligonucleotide (ASODN)-mediated downregulation of a target gene was evaluated in vitro and in an in vivo mouse model. Microscopy results demonstrated that significant levels of SALP encapsulated ASODN is taken up by cells; however, a majority of the oligonucleotide remains locked in endosomal/lysosomal compartments. Poor intracellular cytoplasmic delivery by SALP systems was also supported by the lack in target mRNA downregulation following in vitro treatments with SALP delivered ASODN. The relative efficiency of SALP delivery of ASODN in the in vivo liver model was not consistent with the results observed in vitro, since there was evidence of a decrease in target gene mRNA levels in the liver tissue following SALP delivery. However, the levels of antisense activity observed in the in vivo model were complicated by non-sequence specific effects. In Chapter 3, focus was shifted towards studying the intracellular delivery properties of SPLP since assays to quantify delivery of a plasmid encoding for the luciferase reporter gene are more unambiguous, sensitive and relatively straightforward as compared to methods to determine ASODN activity. The intracellular release parameter (IRP) was employed to examine how changes in the lipid composition and transfection parameters of SPLP affect intracellular delivery. In particular, it was shown that the major factor limiting the intracellular 179  delivery properties of the standard S P L P system is the presence of the nonexchangeable P E G - C e r C o molecules. Another major finding was that the 2  addition of 8 mM C a  2 +  into the transfection medium increased the IRP parameter  of S P L P by 100-500 fold regardless of the S P L P lipid composition. In Chapter 4, the significant enhancement in intracellular delivery of S P L P in the presence of C a  2 +  was studied further to determine the underlying  mechanisms behind its activity. It was shown that the C a  2 +  effect could be  modulated by changes in the serum content in the medium but was not related to modifications in cell uptake levels of S P L P . The C a  2 +  effect was attributed to the  formation of calcium phosphate precipitates during the transfection procedure; however, it was shown that the effect does not involve calcium phosphate mediated destabilization of S P L P . It is also shown that calcium phosphate precipitates enhance the intracellular delivery of neutral macromolecules by facilitating their release from endosomal/lysosomal compartments. In Chapter 5, the strategy to enhance the intracellular delivery properties of S P L P using pH-sensitive polymers was explored. It was demonstrated that co-administration of P E A A polymers with S P L P increased gene expression by up to 1000-fold in B H K cells. Also, it was shown that an acylated derivative of the P E A A polymer could be successfully post-inserted into the S P L P system at efficiencies of 70-80% without significantly affecting S P L P particle size or DNA protective qualities. Transfections with S P L P containing post-inserted acylated P E A A increased gene expression by up to 80-fold, which was not related to changes in cell uptake levels; thus offering a viable approach to improve the  180  intracellular delivery properties of S P L P in vivo. In summary, this work improves our understanding of factors that influence the intracellular delivery properties of lipid-based DNA delivery systems and outlines some effective strategies to improve the intracellular delivery properties of otherwise very stable carrier systems optimized for systemic delivery applications. Future work should focus on the optimization of the S P L P system with post-inserted pH sensitive polymer. It is possible that the intracellular delivery properties of these systems can be improved by modifying both the composition of the derivatized polymer as well as the S P L P formulation. With regard to the polymer, the number of sites that have been acylated on the P E A A molecule may be reduced without altering the insertion efficiency into the S P L P . These reductions in the degree of modifications on the polymer may improve its ability to access and destabilize the S P L P membrane as well as neighbouring endosomal/lysosomal membranes once activated. It is also possible that the cationic charges on the surface of the S P L P membrane may have an affinity for the carboxylic acid groups on the polymer, consequently, reducing its degree of freedom on the surface of the S P L P system. Therefore, modifications in the S P L P formulation to reduce this potential association may also improve its activity. Improvements in the intracellular delivery properties of S P L P and S A L P may also be achieved by taking the approach of co-administering them with liposomal systems encapsulating potent membrane disruptive agents. For  181  example, it may be possible to encapsulate high concentrations of calcium phosphate or P E A A into separate liposomes that can then be co-administered with the S P L P system since both systems are expected to accumulate into the same compartments during the endosomal/lysosomal pathway following cell uptake. Upon entry into the endosomal/lysosomal compartments, the liposomes containing the membrane disruptive agents are expected to degrade, releasing the membrane disruptive molecules into the vesicular compartments. Once exposed to the vesicular compartment, the molecules are then available to induce the release of the S P L P contents as well as disrupt the endosomal membrane.  182  REFERENCES Acsadi, G., Jiao, S.S., Jani, A., Duke, D., Williams, P., Chong, W., and Wolff, J A . 1991. Direct gene transfer and expression into rat heart in vivo. New Biol. 3:71-81. Agrawal, S. 1999. Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides. Biochim Biophys Acta. 1489:53-68. Agrawal, S., and Kandimalla, E.R. 2000. Antisense therapeutics: is it as simple as complementary base recognition? Mol Med Today. 6:72-81. Al-Awqati, Q. 1986. Proton-translocating ATPases. Annu Rev Cell Biol. 2:179-99. Allen, T.M., and Cullis, P.R. 2004. Drug delivery systems: entering the mainstream. Science. 303:1818-22. Allen, T.M., Hansen, C , Martin, F., Redemann, C , and Yau-Young, A. 1991. Liposomes containing synthetic lipid derivatives of poly(ethylene glycol) show prolonged circulation half-lives in vivo. Biochim Biophys Acta. 1066:29-36. Asokan, A., and Cho, M.J. 2002. Exploitation of intracellular pH gradients in the cellular delivery of macromolecules. J Pharm Sci. 91:903-13. Baker, B.F., Lot, S.S., Condon, T.P., Cheng-Flournoy, S., Lesnik, E.A., Sasmor, H.M., and Bennett, C F . 1997. 2'-0-(2-Methoxy)ethyl-modified antiintercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 m R N A level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J Biol Chem. 272:11994-2000. Bangham, A.D., Standish, M.M., and Watkins, J . C . 1965. Diffusion of univalent ions across the lamellae of swollen phospholipids. J Mol Biol. 13:238-52. Barajas, M., Mazzolini, G . , Genove, G., Bilbao, R., Narvaiza, I., Schmitz, V., Sangro, B., Melero, I., Qian, C , and Prieto, J . 2001. Gene therapy of orthotopic hepatocellular carcinoma in rats using adenovirus coding for interleukin 12. Hepatology. 33:52-61. Barenholzt, Y., Amselem, S., and Lichtenberg, D. 1979. A new method for preparation of phospholipid vesicles (liposomes) - French press. FEBS Lett. 99:210-4.  183  Bartlett, E.M., and Lewis, D.H. 1970. Spectrophotometric determination of phosphate esters in the presence and absence of orthophosphate. Anal Biochem. 36:159-67. Bennett, C F . 1995. Intracellular delivery of oligonucleotides with cationic liposomes. In Delivery Strategies for Antisense Oligonucleotide Therapeutics. S . Akhtar, editor. C R C Press Inc., Boca Raton. 223-229. Bennett, C.F., Kornbrust, D., Henry, S., Stecker, K., Howard, R., Cooper, S., Dutson, S., Hall, W., and Jacoby, H.I. 1997. An ICAM-1 Antisense Oligonucleotide Prevents and Reverses Dextran Sulfate Sodium-Induced Colitis in Mice. J Pharmacol Exp Ther. 280:988-1000. Bentz, J . , Ellens, H., Lai, M.Z., and Szoka, F.C., Jr. 1985. On the correlation between HII phase and the contact-induced destabilization of phosphatidylethanolamine-containing membranes. Proc Natl Acad Sci U S A. 82:5742-5. Benvenisty, N., and Reshef, L. 1986. Direct introduction of genes into rats and expression of the genes. Proc Natl Acad Sci USA. 83:9551 -5. Berlin, R.D., and Oliver, J . M . 1980. Surface functions during mitosis. II. Quantitation of pinocytosis and kinetic characterization of the mitotic cycle with a new fluorescence technique. J Cell Biol. 85:660-71. Bligh, E.G., and Dyer, W . J . 1959. A rapid method of total lipid extraction and purification. Can J Med Sci. 37:911 -7. Bos, G.W., Kanellos, T., Crommelin, D.J., Hennink, W . E . , and Howard, C.R. 2004. Cationic polymers that enhance the performance of HbsAg DNA in vivo. Vaccine. 23:460-9. Boussif, O., Lezoualc'h, F., Zanta, M.A., Mergny, M.D., Scherman, D., Demeneix, B. , and Behr, J . P . 1995. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci US A. 92:7297-301. Bramson, J.L., Bodner, C.A., Johnson, J . , Semple, S., and Hope, M.J. 2000. Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells. Antisense Nucleic Acid Drug Dev. 10:217-24. Brignole, C , Pagnan, G . , Marimpietri, D., Cosimo, E., Allen, T.M., Ponzoni, M., and Pastorino, F. 2003. Targeted delivery system for antisense oligonucleotides: a novel experimental strategy for neuroblastoma treatment. Cancer Lett. 197:231-5.  184  Brown, M.D., Schatzlein, A . G . , and Uchegbu, I.F. 2001. Gene delivery with synthetic (non viral) carriers. IntJ Pharm. 229:1-21. Brunner, S., Sauer, T., Carotta, S., Cotten, M., Saltik, M., and Wagner, E. 2000. Cell cycle dependence of gene transfer by lipoplex, polyplex and recombinant adenovirus. Gene Ther. 7:401-7. Bubenik, J . 2001. Genetically engineered dendritic cell-based cancer vaccines (review). IntJ Oncol. 18:475-8. Budker, V., Gurevich, V., Hagstrom, J . E . , Bortzov, F., and Wolff, J.A. 1996. pHsensitive, cationic liposomes: a new synthetic virus-like vector. Nat Biotechnol. 14:760-4. Butler, M., Stecker, K., and Bennett, C F . 1997. Cellular distribution of phosphorothioate oligodeoxynucleotides in normal rodent tissues. Lab Invest. 77:379-88. Chams, V., Bonnafous, P., and Stegmann, T. 1999. Influenza hemagglutinin mediated fusion of membranes containing poly(ethylene-glycol) grafted lipids: new insights into the fusion mechanism. FEBS Lett. 448:28-32. Chemin, I., Moradpour, D., Wieland, S., Offensperger, W.B., Walter, E., Behr, J . P . , and Blum, H.E. 1998. Liver-directed gene transfer: a linear polyethlenimine derivative mediates highly efficient DNA delivery to primary hepatocytes in vitro and in vivo. J Viral Hepat. 5:369-75. Chen, F.J., Asokan, A., and Cho, M.J. 2003. Cytosolic delivery of macromolecules: I. Synthesis and characterization of pH-sensitive acyloxyalkylimidazoles. Biochim Biophys Acta. 1611:140-50. Chen, T., Mcintosh, D., He, Y., Kim, J . , Tirrell, D.A., Scherrer, P., Fenske, D.B., Sandhu, A . P . , and Cullis, P.R. 2004. Alkylated derivatives of poly(ethylacrylic acid) can be inserted into preformed liposomes and trigger pH-dependent intracellular delivery of liposomal contents. Mol MembrBiol. 21:385-93. Cheung, C.Y., Murthy, N., Stayton, P.S., and Hoffman, A . S . 2001. A pH-sensitive polymer that enhances cationic lipid-mediated gene transfer. Bioconjug Chem. 12:906-10. Chiou, H.C., Tangco, M.V., Levine, S.M., Robertson, D., Kormis, K., W u , C . H . , and W u , G.Y. 1994. Enhanced resistance to nuclease degradation of nucleic acids complexed to asialoglycoprotein-polylysine carriers. Nucleic Acids Res. 22:5439-46.  185  Chirmule, N., Proper!, K., Magosin, S., Qian, Y., Qian, R., and Wilson, J . 1999. Immune responses to adenovirus and adeno-associated virus in humans. Gene Ther. 6:1574-83. Chollet, P., Favrot, M.C., Hurbin, A., and Coll, J.L. 2002. Side-effects of a systemic injection of linear polyethylenimine-DNA complexes. J Gene Med. 4:84-91. Chonn, A., Semple, S.C., and Cullis, P.R. 1992. Association of blood proteins with large unilamellar liposomes in vivo. Relation to circulation lifetimes. J Biol Chem. 267:18759-65. Chowdhury, E.H., Sasagawa, T., Nagaoka, M., Kundu, A.K., and Akaike, T. 2003. Transfecting mammalian cells by DNA/calcium phosphate precipitates: effect of temperature and pH on precipitation. Anal Biochem. 314:316-8. Chung, J . C . G . , D. J . ; Thomas, J . L ; Tirrell, D. A.; Opsahl-ong, L. R. 1996a. pHsensitive, cation-selective channels formed by a simple synthetic polyelectrolyte in artificial bilayer membranes. Macromolecules. 29:46364641. Chung, J . G . , D J ; Thomas, J L ; Tirrell, DA; Opsahl-ong, LR. 1996b. pH-sensitive, cation-selective channels formed by a simple synthetic polyelectrolyte in artificial bilayer membranes. Macromolecules. 29:4636-4641. Cokol, M., Nair, R., and Rost, B. 2000. Finding nuclear localization signals. EMBO Rep. 1:411-5. Collins, D., Connor, J . , Ting-Beall, H.P., and Huang, L. 1990. Proton and divalent cations induce synergistic but mechanistically different destabilizations of pH-sensitive liposomes composed of dioleoyl phosphatidylethanolamine and oleic acid. Chem Phys Lipids. 55:339-49. Collot-Teixeira, S., Bass, J . , Denis, F., and Ranger-Rogez, S. 2004. Human tumor suppressor p53 and DNA viruses. Rev Med Virol. 14:301-19. Conner, S.D., and Schmid, S.L. 2003. Regulated portals of entry into the cell. Nature. 422:37-44. Crawford, L.V., Pirn, D . C , Gurney, E.G., Goodfellow, P., and TaylorPapadimitriou, J . 1981. Detection of a common feature in several human tumor cell l i n e s - a 53,000-dalton protein. Proc Natl Acad Sci USA. 78:415.  186  Crooke, S T . 1999. Molecular mechanisms of action of antisense drugs. Biochim Biophys Acta. 1489:31 -44. Crooke, S T . 2004. Progress in antisense technology. Annu Rev Med. 55:61-95. Cullis, P.R., and Chonn, A. 1998. Recent advances in liposome technologies and their applications for systemic gene delivery. Adv Drug Deliv Rev. 30:7383. Cullis, P.R., and de Kruijff, B. 1979. Lipid polymorphism and the functional roles of lipids in biological membranes. Biochim Biophys Acta. 559:399-420. Cullis, P.R., Hope, M.J., and Tilcock, C P . 1986. Lipid polymorphism and the roles of lipids in membranes. Chem Phys Lipids. 40:127-44. Cullis, P.R., van Dijck, P.W., de Kruijff, B., and de Gier, J . 1978. Effects of cholesterol on the properties of equimolar mixtures of synthetic phosphatidylethanolamine and phosphatidylcholine. A 31P N M R and differential scanning calorimetry study. Biochim Biophys Acta. 513:21-30. da Costa, M.H., and Chaimovich, H. 1997. Structure-activity relationships in the fusion of small unilamellar phosphatidylcholine vesicles induced by a model peptide. Biochimie. 79:509-16. da Cruz, M.T., Simoes, S., Pires, P.P., Nir, S., and de Lima, M . C 2001. Kinetic analysis of the initial steps involved in lipoplex-cell interactions: effect of various factors that influence transfection activity. Biochim Biophys Acta. 1510:136-51. Daleke, D.L., Hong, K., and Papahadjopoulos, D. 1990. Endocytosis of liposomes by macrophages: binding, acidification and leakage of liposomes monitored by a new fluorescence assay. Biochim Biophys Acta. 1024:352-66. Daleke, D.L., and Lyles, J.V. 2000. Identification and purification of aminophospholipid flippases. Biochim Biophys Acta. 1486:108-27. Dash, P.R., Read, M.L., Barrett, L.B., Wolfert, M.A., and Seymour, L.W. 1999. Factors affecting blood clearance and in vivo distribution of polyelectrolyte complexes for gene delivery. Gene Then 6:643-50. Dass, C R . 2004. Lipoplex-mediated delivery of nucleic acids: factors affecting in vivo transfection. J Mol Med. 82:579-91. Davis, M.E. 2002. Non-viral gene delivery systems. Curr Opin Biotechnol. 13:128-31.  187  de Kruijff, B., van den Besselaar, A . M . , Cullis, P.R., van den Bosch, H., and van Deenen, L.L. 1978. Evidence for isotropic motion of phospholipids in liver microsomal membranes. A 31P N M R study. Biochim Biophys Acta. 514:18. de Lima, M . C , Simoes, S., Pires, P., Gaspar, R., Slepushkin, V., and Duzgunes, N. 1999. Gene delivery mediated by cationic liposomes: from biophysical aspects to enhancement of transfection. Mol Membr Biol. 16:103-9. Dean, N.M., and Bennett, C F . 2003. Antisense oligonucleotide-based therapeutics for cancer. Oncogene. 22:9087-96. Dean, N.M., and McKay, R. 1994. Inhibition of protein kinase C-alpha expression in mice after systemic administration of phosphorothioate antisense oligodeoxynucleotides. Proc Natl Acad Sci USA. 91:11762-6, Dencher, N.A., and Heyn, M.P. 1978. Formation and properties of bacteriorhodopsin monomers in the non-ionic detergents octyl-beta-Dglucoside and Triton X-100. FEBS Lett. 96:322-6. Dias, N., and Stein, C A . 2002. Antisense oligonucleotides: basic concepts and mechanisms. Mol Cancer Ther. 1:347-55. Dimitrov, D.S. 2000. Cell biology of virus entry. Cell. 101:697-702. Dominski, Z., and Kole, R. 1993. Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proc Natl Acad Sci USA. 90:8673-7. Doms, R.W., Helenius, A., and White, J . 1985. Membrane fusion activity of the influenza virus hemagglutinin. The low pH-induced conformational change. J Biol Chem. 260:2973-81. Dowty, M.E., Williams, P., Zhang, G . , Hagstrom, J . E . , and Wolff, J.A. 1995. Plasmid DNA entry into postmitotic nuclei of primary rat myotubes. Proc Natl Acad Sci USA. 92:4572-6. Dubensky, T.W., Campbell, B.A., and Villarreal, L.P. 1984. Direct transfection of viral and plasmid DNA into the liver or spleen of mice. Proc Natl Acad Sci USA. 81:7529-33. Duzgunes, N., Straubinger, R.M., Baldwin, P.A., Friend, D.S., and Papahadjopoulos, D. 1985. Proton-induced fusion of oleic acidphosphatidylethanolamine liposomes. Biochemistry. 24:3091-8.  188  El-Aneed, A. 2004. Current strategies in cancer gene therapy. Eur J Pharmacol. 498:1-8. Ellens, H., Bentz, J . , and Szoka, F.C. 1985. H+- and Ca2+-induced fusion and destabilization of liposomes. Biochemistry. 24:3099-106. Engelmann, C , Panis, Y., Bolard, J . , Diquet, B., Fabre, M., Nagy, H., Soubrane, O., Houssin, D., and Klatzmann, D. 1999. Liposomal encapsulation of ganciclovir enhances the efficacy of herpes simplex virus type 1 thymidine kinase suicide gene therapy against hepatic tumors in rats. Hum Gene Ther. 10:1545-51. Escriou, V., Ciolina, C , Lacroix, F., Byk, G . , Scherman, D., and Wils, P. 1998. Cationic lipid-mediated gene transfer: effect of serum on cellular uptake and intracellular fate of lipopolyamine/DNA complexes. Biochim Biophys Acta. 1368:276-88. Faneca, H., Simoes, S., and de Lima, M.C. 2002. Evaluation of lipid-based reagents to mediate intracellular gene delivery. Biochim Biophys Acta. 1567:23-33. Farhood, H., Serbina, N., and Huang, L. 1995. The role of dioleoyl phosphatidylethanolamine in cationic liposome mediated gene transfer. Biochim Biophys Acta. 1235:289-95. Feigner, J.H., Kumar, R., Sridhar, C . N . , Wheeler, C . J . , Tsai, Y . J . , Border, R., Ramsey, P., Martin, M., and Feigner, P.L. 1994. Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J Biol Chem. 269:2550-61. Feigner, P.L. 1997. Nonviral strategies for gene therapy. Sci Am. 276:102-6. Feigner, P.L., Gadek, T.R., Holm, M., Roman, R., Chan, H.W., Wenz, M., Northrop, J . P . , Ringold, G . M . , and Danielsen, M. 1987. Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci USA. 84:7413-7. Fender, P., Ruigrok, R.W., Gout, E., Buffet, S., and Chroboczek, J . 1997. Adenovirus dodecahedron, a new vector for human gene transfer. Nat Biotechnol. 15:52-6. Fenske, D.B., MacLachlan, I., and Cullis, P.R. 2001a. Long-circulating vectors for the systemic delivery of genes. Curr Opin Mol Ther. 3:153-8. Fenske, D.B., MacLachlan, I., and Cullis, P.R. 2002. Stabilized plasmid-lipid particles: a systemic gene therapy vector. Methods Enzymol. 346:36-71.  189  Fenske, D.B., Palmer, L.R., Chen, T., Wong, K.F., and Cullis, P.R. 2001b. Cationic poly(ethyleneglycol) lipids incorporated into pre-formed vesicles enhance binding and uptake to B H K cells. Biochim Biophys Acta. 1512:259-72. Ferrari, S., Mora, E., Pettenazzo, A., Behr, J.P., Zacchello, F., and Scarpa, M. 1997. ExGen 500 is an efficient vector for gene delivery to lung epithelial cells in vitro and in vivo. Gene Ther. 4:1100-6. Ferritto, M.S.a.T., D. A. 1992. Poly(2-Ethylacrylic Acid). Synthesis. 11:59-62.  Macromolecular  Finn, J . , Lee, A . C . , MacLachlan, I., and Cullis, P. 2004. An enhanced autogenebased dual-promoter cytoplasmic expression system yields increased gene expression. Gene Ther. 11:276-83. Fire, A., X u , S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C . C . 1998. Potent and specific genetic interference by double-stranded R N A in Caenorhabditis elegans. Nature. 391:806-11. Flaherty, K.T., Stevenson, J . P . , and O'Dwyer, P.J. 2001. Antisense therapeutics: lessons from early clinical trials. Curr Opin Oncol. 13:499-505. Forrest, M.L., Meister, G . E . , Koerber, J.T., and Pack, D.W. 2004. Partial acetylation of polyethylenimine enhances in vitro gene delivery. Pharm Res. 21:365-71. Friend, D.S., Papahadjopoulos, D., and Debs, R.J. 1996. Endocytosis and intracellular processing accompanying transfection mediated by cationic liposomes. Biochim Biophys Acta. 1278:41-50. Gabizon, A., Isacson, R., Libson, E., Kaufman, B., Uziely, B., Catane, R., BenDor, C . G . , Rabello, E., C a s s , Y., Peretz, T., and et al. 1994. Clinical studies of liposome-encapsulated doxorubicin. Acta Oncol. 33:779-86. Gabizon, A., and Papahadjopoulos, D. 1992. The role of surface charge and hydrophilic groups on liposome clearance in vivo. Biochim Biophys Acta. 1103:94-100. Galbraith, W . M . , Hobson, W . C . , Giclas, P.C., Schechter, P.J., and Agrawal, S. 1994. Complement activation and hemodynamic changes following intravenous administration of phosphorothioate oligonucleotides in the monkey. Antisense Res Dev. 4:201-6.  190  Gao, X., and Huang, L. 1995. Cationic liposome-mediated gene transfer. Gene Ther. 2:710-22. Gelmon, K.A., Tolcher, A., Diab, A.R., Bally, M.B., Embree, L , Hudon, N., Dedhar, C , Ayers, D., Eisen, A., Melosky, B., Burge, C , Logan, P., and Mayer, L.D. 1999. Phase I study of liposomal vincristine. J Clin Oncol. 17:697-705. Gerasimov, O.V., Schwan, A., and Thompson, D.H. 1997. Acid-catalyzed plasmenylcholine hydrolysis and its effect on bilayer permeability: a quantitative study. Biochim Biophys Acta. 1324:200-14. Gokhale, P.C., Soldatenkov, V., Wang, F.H., Rahman, A., Dritschilo, A., and Kasid, U. 1997. Antisense raf oligodeoxyribonucleotide is protected by liposomal encapsulation and inhibits Raf-1 protein expression in vitro and in vivo: implication for gene therapy of radioresistant cancer. Gene Ther. 4:1289-99. Gokhale, P.C., Zhang, C , Newsome, J.T., Pei, J . , Ahmad, I., Rahman, A., Dritschilo, A., and Kasid, U.N. 2002. Pharmacokinetics, toxicity, and efficacy of ends-modified raf antisense oligodeoxyribonucleotide encapsulated in a novel cationic liposome. Clin Cancer Res. 8:3611-21. Good, L., Shafranski, P., Zagorski, V., Khrobochek, I., and zagorska, P. 2003. Translation repression by antisense sequences. [The ratio of coat protein to bacteriophage f2 R N A in the translational repressor complex]. Cell Mol Life Sci. 60:854-61. Graham, F.L., and van der Eb, A . J . 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 52:456-67. Gregoriadis, G . 1993. Liposome Technology. C R C Press Inc., Boca Raton. Gruner, S . M . , Cullis, P.R., Hope, M.J., and Tilcock, C P . 1985. Lipid polymorphism: the molecular basis of nonbilayer phases. Annu Rev Biophys Biophys Chem. 14:211 -38. Guo, X., and Szoka, F . C , Jr. 2001. Steric stabilization of fusogenic liposomes by a low-pH sensitive PEG-diortho ester-lipid conjugate. Bioconjug Chem. 12:291-300. Haberland, A., Knaus, T., Zaitsev, S.V., Buchberger, B., Lun, A., Haller, H., and Bottger, M. 2000. Histone H1-mediated transfection: serum inhibition can be overcome by Ca2+ ions. Pharm Res. 17:229-35.  191  Haberland, A., Knaus, T., Zaitsev, S.V., Stahn, R., Mistry, A.R., Coutelle, C , Haller, H., and Bottger, M. 1999. Calcium ions as efficient cofactor of polycation-mediated gene transfer. Biochim Biophys Acta. 1445:21-30. Haensler, J . , and Szoka, F.C., Jr. 1993. Polyamidoamine cascade polymers mediate efficient transfection of cells in culture. Bioconjug Chem. 4:372-9. Hafez, I.M., Ansell, S., and Cullis, P.R. 2000. Tunable pH-sensitive liposomes composed of mixtures of cationic and anionic lipids. Biophys J. 79:143846. Hafez, I.M., Maurer, N., and Cullis, P.R. 2001. On the mechanism whereby cationic lipids promote intracellular delivery of polynucleic acids. Gene Ther. 8:1188-96. Hahn, K.H., and Kim, H. 1991. Fusion and fragmentation of phospholipid vesicles by apohemoglobin at low pH. J Biochem (Tokyo). 110:635-40. Ho, P.T., Ishiguro, K., Wickstrom, E., and Sartorelli, A . C . 1991. Non-sequencespecific inhibition of transferrin receptor expression in HL-60 leukemia cells by phosphorothioate oligodeoxynucleotides. Antisense Res Dev. 1:329-42. Holland, J.W., Hui, C , Cullis, P.R., and Madden, T.D. 1996. Polyethylene glycol)-lipid conjugates regulate the calcium-induced fusion of liposomes composed of phosphatidylethanolamine and phosphatidylserine. Biochemistry. 35:2618-24. Hope, M.J., Bally, M.B., Webb, G . , and Cullis, P.R. 1985. Production of large unilamellar vesicles by a rapid extrusion procedure. Characterization of size distribution, trapped volume and ability to maintain a membrane potential. Biochimica et Biophysica Acta (BBA) - Biomembranes. 812:5565. Hope, M.J., Mui, B., Ansell, S., and Ahkong, Q.F. 1998. Cationic lipids, phosphatidylethanolamine and the intracellular delivery of polymeric, nucleic acid-based drugs (review). Mol Membr Biol. 15:1-14. Horvath, A., Toth, G.K., Gogolak, P., Nagy, Z., Kurucz, I., Pecht, I., and Rajnavolgyi, E. 1998. A hemagglutinin-based multipeptide construct elicits enhanced protective immune response in mice against influenza A virus infection. Immunol Lett. 60:127-36. Houk, B.E., Hochhaus, G . , and Hughes, J.A. 1999. Kinetic modeling of plasmid DNA degradation in rat plasma. AAPS PharmSci. 1:E9.  192  Huang, C. 1969. Studies on phosphatidylcholine vesicles. Formation and physical characteristics. Biochemistry. 8:344-52. Huang, C H . 1977. A structural model for the cholesterol-phosphatidylcholine complexes in bilayer membranes. Lipids. 12:348-56. Hui, S.W., Langner, M., Zhao, Y.L., Ross, P., Hurley, E., and Chan, K. 1996. The role of helper lipids in cationic liposome-mediated gene transfer. Biophys J. 71:590-9. Hwang, S . J . , and Davis, M.E. 2001. Cationic polymers for gene delivery: designs for overcoming barriers to systemic administration. Curr Opin Mol Ther. 3:183-91. Immonen, A., Vapalahti, M., Tyynela, K., Hurskainen, H., Sandmair, A., Vanninen, R., Langford, G . , Murray, N., and Yla-Herttuala, S . 2004. AdvHSV-tk gene therapy with intravenous ganciclovir improves survival in human malignant glioma: a randomised, controlled study. Mol Ther. 10:967-72. Israelachvili, J.N., Mitchell, D.J., and Ninham, B.W. 1977. Theory of selfassembly of lipid bilayers and vesicles. Biochim Biophys Acta. 470:185201. Johnstone, S.A., Masin, D., Mayer, L , and Bally, M.B. 2001. Surface-associated serum proteins inhibit the uptake of phosphatidylserine and poly(ethylene glycol) liposomes by mouse macrophages. Biochim Biophys Acta. 1513:25-37. Jones, R.A., Cheung, C.Y., Black, F.E., Zia, J.K., Stayton, P.S., Hoffman, A . S . , and Wilson, M.R. 2003. Poly(2-alkylacrylic acid) polymers deliver molecules to the cytosol by pH-sensitive disruption of endosomal vesicles. Biochem J. 372:65-75. Jordan, M., Schallhorn, A., and Wurm, F.M. 1996. Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation. Nucleic Acids Res. 24:596-601. Kalyan, N.K., Lee, S . G . , Wilhelm, J . , Pisano, M.R., Hum, W.T., Hsiao, C.L., Davis, A.R., Eichberg, J.W., Robert-Guroff, M., and Hung, P.P. 1994. Immunogenicity of recombinant influenza virus haemagglutinin carrying peptides from the envelope protein of human immunodeficiency virus type 1. Vaccine. 12:753-60.  193  Kikuchi, A., Aoki, Y., Sugaya, S., Serikawa, T., Takakuwa, K., Tanaka, K., Suzuki, N., and Kikuchi, H. 1999. Development of novel cationic liposomes for efficient gene transfer into peritoneal disseminated tumor. Hum Gene Ther. 10:947-55. Klimuk, S.K., Semple, S.C., Nahirney, P.N., Mullen, M.C., Bennett, C . F . , Scherrer, P., and Hope, M.J. 2000. Enhanced anti-inflammatory activity of a liposomal intercellular adhesion molecule-1 antisense oligodeoxynucleotide in an acute model of contact hypersensitivity. J Pharmacol Exp Ther. 292:480-8. Klimuk, S.K., Semple, S.C., Scherrer, P., and Hope, M.J. 1999. Contact hypersensitivity: a simple model for the characterization of disease-site targeting by liposomes. Biochim Biophys Acta. 1417:191-201. Kono, K., Zenitani, K., and Takagishi, T. 1994. Novel pH-sensitive liposomes: liposomes bearing a poly(ethylene glycol) derivative with carboxyl groups. Biochim Biophys Acta. 1193:1 -9. Kootstra, N.A., and Verma, I.M. 2003. Gene therapy with viral vectors. Annu Rev Pharmacol Toxicol. 43:413-39. Kopatz, I., Remy, J . S . , and Behr, J . P . 2004. A model for non-viral gene delivery: through syndecan adhesion molecules and powered by actin. J Gene Med. 6:769-76. Kordower, J.H., Emborg, M.E., Bloch, J . , Ma, S.Y., Chu, Y., Leventhal, L , McBride, J . , Chen, E.Y., Palfi, S., Roitberg, B.Z., Brown, W.D., Holden, J . E . , Pyzalski, R., Taylor, M.D., Carvey, P., Ling, Z., Trono, D., Hantraye, P., Deglon, N., and Aebischer, P. 2000. Neurodegeneration prevented by lentiviral vector delivery of G D N F in primate models of Parkinson's disease. Science. 290:767-73. Krieg, A . M . 2002. C p G motifs in bacterial DNA and their immune effects. Annu Rev Immunol. 20:709-60. Kruijff, B.d.C., P. R.; Verkleij, A. J . ; Hope, M. J . ; van Echteld, C. J . A.; Taraschi, T.F. 1984. Lipid Polymorphism and Membrane Fusion. In Enzymes of Biological Membranes. A. Martinosi, editor. Plenum Press, New York. pp. 131-204.  194  Kumasaka, T., Quinlan, W . M . , Doyle, N.A., Condon, T P . , Sligh, J . , Takei, F., Beaudet, A.L., Bennett, C . F . , and Doerschuk, C M . 1996. Role of the Intercellular Adhesion Molecule-1 (ICAM-1) in Endotoxin-induced Pneumonia Evaluated Using ICAM-1 Antisense Oligonucleotides, antiICAM-1 Monoclonal Antibodies, and ICAM-1 Mutant Mice. J. Clin. Invest. 97:2362-2369. Labat-Moleur, F., Steffan, A . M . , Brisson, C , Perron, H., Feugeas, O., Furstenberger, P., Oberling, F., Brambilla, E., and Behr, J . P . 1996. An electron microscopy study into the mechanism of gene transfer with lipopolyamines. Gene Ther. 3:1010-7. Lackey, C.A., Press, O.W., Hoffman, A . S . , and Stayton, P.S. 2002. A biomimetic pH-responsive polymer directs endosomal release and intracellular delivery of an endocytosed antibody complex. Bioconjug Chem. 13:9961001. Lai, M.Z., Vail, W . J . , and Szoka, F . C 1985. Acid- and calcium-induced structural changes in phosphatidylethanolamine membranes stabilized by cholesteryl hemisuccinate. Biochemistry. 24:1654-61. Lam, A . M . 2000. Thesis Title: Influence of calcium on the transfection properties of lipid-based gene delivery systems. In Biochemistry and Molecular Biology. University of British Columbia, Vancouver. 119. Lam, A . M . , and Cullis, P.R. 2000. Calcium enhances the transfection potency of plasmid DNA-cationic liposome complexes. Biochim Biophys Acta. 1463:279-90. Laurema, A., Heikkila, A., Keski-Nisula, L., Heikura, T., Lehtolainen, P., Manninen, H., Tuomisto, T.T., Heinonen, S., and Yla-Herttuala, S. 2003. Transfection of oocytes and other types of ovarian cells in rabbits after direct injection into uterine arteries of adenoviruses and plasmid/liposomes. Gene Ther. 10:580-4. Leamon, C P . , Cooper, S.R., and Hardee, G . E . 2003. Folate-liposome-mediated antisense oligodeoxynucleotide targeting to cancer cells: evaluation in vitro and in vivo. Bioconjug Chem. 14:738-47. Leonetti, C , Biroccio, A., Benassi, B., Stringaro, A., Stoppacciaro, A., Semple, S . C , and Zupi, G . 2001. Encapsulation of c-myc antisense oligodeoxynucleotides in lipid particles improves antitumoral efficacy in vivo in a human melanoma line. Cancer Gene Ther. 8:459-68. Levine, A . J . 1997. p53, the cellular gatekeeper for growth and division. Cell. 88:323-31.  195  Lewis, P., Hensel, M., and Emerman, M. 1992. Human immunodeficiency virus infection of cells arrested in the cell cycle. Embo J . 11:3053-8. Liang, E., and Hughes, J . 1998. Characterization of a pH-sensitive surfactant, dodecyl-2-(1'-imidazolyl) propionate (DIP), and preliminary studies in liposome mediated gene transfer. Biochim Biophys Acta. 1369:39-50. Lieber, A., He, C.Y., Meuse, L., Schowalter, D., Kirillova, I., Winther, B., and Kay, M.A. 1997. The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors. J Virol. 71:8798-807. Linhardt, J . G . , Thomas, J.L., and Tirrell, D.A. 1999. Free-radical synthesis of poly(2-ethylacrylic acid)fractions of low polydispersity: Effects of molecular weight and polydispersity on the pH-dependent conformational transition in aqueous solutions. Macromolecules. 32:4457-4459. Liu, D., Liu, F., and Song, Y . K . 1995. Recognition and clearance of liposomes containing phosphatidylserine are mediated by serum opsonin. Biochim Biophys Acta. 1235:140-6. Liu, G., Li, D., Pasumarthy, M.K., Kowalczyk, T.H., Gedeon, C.R., Hyatt, S.L., Payne, J . M . , Miller, T.J., Brunovskis, P., Fink, T.L., Muhammad, O., Moen, R.C., Hanson, R.W., and Cooper, M.J. 2003. Nanoparticles of compacted DNA transfect postmitotic cells. J Biol Chem. 278:32578-86. Lowe, S.W., Schmitt, E.M., Smith, S.W., Osborne, B.A., and Jacks, T. 1993. p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature. 362:847-9. Lucas, P., Milroy, D.A., Thomas, B.J., Moss, S.H., and Pouton, O W . 1999. Pharmaceutical and biological properties of poly(amino acid)/DNA polyplexes. J Drug Target. 7:143-56. Ludtke, J . J . , Zhang, G., Sebestyen, M.G., and Wolff, J.A. 1999. A nuclear localization signal can enhance both the nuclear transport and expression of 1 kb DNA. J Cell Sci. 112 ( Pt 12):2033-41. Lysik, M.A., and Wu-Pong, S . 2003. Innovations in oligonucleotide drug delivery. J Pharm Sci. 92:1559-73. MacLachlan, I., Cullis, P., and Graham, R.W. 1999. Progress towards a synthetic virus for systemic gene therapy. Curr Opin Mol Ther. 1:252-9.  196  Madden, T.D., and Cullis, P.R. 1982. Stabilization of bilayer structure for unsaturated phosphatidylethanolamines by detergents. Biochim Biophys Acta. 684:149-53. Maeda, H. 2001. The enhanced permeability and retention (EPR) effect in tumor vasculature: the key role of tumor-selective macromolecular drug targeting. Adv Enzyme Regul. 41:189-207. Maeda, H., W u , J . , Sawa, T., Matsumura, Y., and Hori, K. 2000. Tumor vascular permeability and the E P R effect in macromolecular therapeutics: a review. J Control Release. 65:271-84. Mahato, R.I., Anwer, K., Tagliaferri, F., Meaney, C , Leonard, P., Wadhwa, M.S., Logan, M., French, M., and Rolland, A. 1998. Biodistribution and gene expression of lipid/plasmid complexes after systemic administration. Hum Gene Ther. 9:2083-99. Mandersloot, J . G . , Reman, F.C., Van Deenen, L.L., and De Gier, J . 1975. Barrier properties of lecithin/lysolecithin mixtures. Biochim Biophys Acta. 382:226. Mani, S., Goel, S., Nesterova, M., Martin, R.M., Grindel, J.M., Rothenberg, M.L., Zhang, R., Tortora, G., and Cho-Chung, Y . S . 2003. Clinical studies in patients with solid tumors using a second-generation antisense oligonucleotide ( G E M 231) targeted against protein kinase A type I. Ann N YAcad Sci. 1002:252-62. Matteucci, M.D., and Wagner, R.W. 1996. In pursuit of antisense. Nature. 384:20-2. Maurer, N., Fenske, D.B., and Cullis, P.R. 2001. Developments in liposomal drug delivery systems. Expert Opin Biol Ther. 1:923-47. Maurer, N., Mori, A., Palmer, L., Monck, M.A., Mok, K.W., Mui, B., Akhong, Q.F., and Cullis, P.R. 1999. Lipid-based systems for the intracellular delivery of genetic drugs. Mol Membr Biol. 16:129-40. Mayer, L.D., Hope, M.J., and Cullis, P.R. 1986. Vesicles of variable sizes produced by a rapid extrusion procedure. Biochim Biophys Acta. 858:1618. Mellman, I. 1996. Endocytosis and molecular sorting. Annu Rev Cell Dev Biol. 12:575-625.  197  Meyer, O., Papahadjopoulos, D., and Leroux, J . C . 1998. Copolymers of Nisopropylacrylamide can trigger pH sensitivity to stable liposomes. FEBS Lett. 421:61-4. Miller, C.R., Bondurant, B., McLean, S.D., McGovern, K.A., and O'Brien, D.F. 1998. Liposome-cell interactions in vitro: effect of liposome surface charge on the binding and endocytosis of conventional and sterically stabilized liposomes. Biochemistry. 37:12875-83. Mok, K.W., Lam, A . M . , and Cullis, P.R. 1999. Stabilized plasmid-lipid particles: factors influencing plasmid entrapment and transfection properties. Biochim Biophys Acta. 1419:137-50. Mok, K.W.C. 1998. Lipid Based DNA Delivery Systems. In Biochemistry and Molecular Biology. University of British Columbia, Vancouver. 169. Monahan, P.E., and Samulski, R.J. 2000. A A V vectors: is clinical success on the horizon? Gene Ther. 7:24-30. Monck, M.A., Mori, A., Lee, D., Tarn, P., Wheeler, J . J . , Cullis, P.R., and Scherrer, P. 2000. Stabilized plasmid-lipid particles: pharmacokinetics and plasmid delivery to distal tumors following intravenous injection. J Drug Target. 7:439-52. Mortimer, I., Tarn, P., MacLachlan, I., Graham, R.W., Saravolac, E.G., and Joshi, P.B. 1999. Cationic lipid-mediated transfection of cells in culture requires mitotic activity. Gene Ther. 6:403-11. Mounkes, L.C., Zhong, W., Cipres-Palacin, G., Heath, T.D., and Debs, R.J. 1998. Proteoglycans mediate cationic liposome-DNA complex-based gene delivery in vitro and in vivo. J Biol Chem. 273:26164-70. Mui, B., Ahkong, Q.F., Chow, L., and Hope, M.J. 2000. Membrane perturbation and the mechanism of lipid-mediated transfer of DNA into cells. Biochim Biophys Acta. 1467:281 -92. Mui, B., Raney, S . G . , Semple, S.C., and Hope, M.J. 2001. Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles. J Pharmacol Exp Ther. 298:1185-92. Murthy, N., Robichaud, J.R., Tirrell, D.A., Stayton, P.S., and Hoffman, A . S . 1999. The design and synthesis of polymers for eukaryotic membrane disruption. J Control Release. 61:137-43.  198  Nabel, G.J., Gordon, D., Bishop, D.K., Nickoloff, B.J., Yang, Z.Y., Aruga, A., Cameron, M.J., Nabel, E.G., and Chang, A . E . 1996. Immune response in human melanoma after transfer of an allogeneic class I major histocompatibility complex gene with DNA-liposome complexes. Proc Natl Acad Sci USA. 93:15388-93. Needham, D., Mcintosh, T.J., and Lasic, D.D. 1992. Repulsive interactions and mechanical stability of polymer-grafted lipid membranes. Biochim Biophys Acta. 1108:40-8. Nobs, L , Buchegger, F., Gurny, R., and Allemann, E. 2004. Current methods for attaching targeting ligands to liposomes and nanoparticles. J Pharm Sci. 93:1980-92. Nomura, T., Koreeda, N., Yamashita, F., Takakura, Y., and Hashida, M. 1998. Effect of particle size and charge on the disposition of lipid carriers after intratumoral injection into tissue-isolated tumors. Pharm Res. 15:128-32. Nomura, T., Yasuda, K., Yamada, T., Okamoto, S., Mahato, R.I., Watanabe, Y., Takakura, Y., and Hashida, M. 1999. Gene expression and antitumor effects following direct interferon (IFN)-gamma gene transfer with naked plasmid DNA and DC-chol liposome complexes in mice. Gene Ther. 6:121-9. Ogris, M., Brunner, S., Schuller, S., Kircheis, R., and Wagner, E. 1999. PEGylated DNA/transferrin-PEI complexes: reduced interaction with blood components, extended circulation in blood and potential for systemic gene delivery. Gene Ther. 6:595-605. Ollivon, M., Eidelman, O., Blumenthal, R., and Walter, A. 1988. Micelle-vesicle transition of egg phosphatidylcholine and octyl glucoside. Biochemistry. 27:1695-703. Olson, F., Hunt, C.A., Szoka, F.C., Vail, W.J., and Papahadjopoulos, D. 1979. Preparation of liposomes of defined size distribution by extrusion through polycarbonate membranes. Biochim Biophys Acta. 557:9-23. Opalinska, J.B., and Gewirtz, A . M . 2002. Nucleic-acid therapeutics: basic principles and recent applications. Nat Rev Drug Discov. 1:503-14. Orr, R.M. 2001. Technology evaluation: fomivirsen, Isis Pharmaceuticals Inc/CIBA vision. Curr Opin Mol Ther. 3:288-94.  199  Palmer, L.R., Chen, T., Lam, A . M . , Fenske, D.B., Wong, K.F., MacLachlan, I., and Cullis, P.R. 2003. Transfection properties of stabilized plasmid-lipid particles containing cationic P E G lipids. Biochim Biophys Acta. 1611:20416. Parente, R.A., Nir, S., and Szoka, F.C., Jr. 1988. pH-dependent fusion of phosphatidylcholine small vesicles. Induction by a synthetic amphipathic peptide. J Biol Chem. 263:4724-30. Park, Y . S . 2002. Tumor-directed targeting of liposomes. Biosci Rep. 22:267-81. Parker, J.N., Gillespie, G.Y., Love, C.E., Randall, S., Whitley, R.J., and Markert, J . M . 2000. Engineered herpes simplex virus expressing IL-12 in the treatment of experimental murine brain tumors. Proc Natl Acad Sci USA. 97:2208-13. Parks, R.J., Chen, L., Anton, M., Sankar, U., Rudnicki, M.A., and Graham, F.L. 1996. A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc Natl Acad Sci USA. 93:13565-70. Pecheur, E.I., Sainte-Marie, J . , Bienven e, A., and Hoekstra, D. 1999. Peptides and membrane fusion: towards an understanding of the molecular mechanism of protein-induced fusion. J Membr Biol. 167:1-17. Pedroso de Lima, M . C , Simoes, S., Pires, P., Faneca, H., and Duzgunes, N. 2001. Cationic lipid-DNA complexes in gene delivery: from biophysics to biological applications. Adv Drug Deliv Rev. 47:277-94. Pires, P., Simoes, S., Nir, S., Gaspar, R., Duzgunes, N., and Pedroso de Lima, M.C. 1999. Interaction of cationic liposomes and their DNA complexes with monocytic leukemia cells. Biochim Biophys Acta. 1418:71-84. Plank, C , Oberhauser, B., Mechtler, K., Koch, C , and Wagner, E. 1994. The influence of endosome-disruptive peptides on gene transfer using synthetic virus-like gene transfer systems. J Biol Chem. 269:12918-24. Pollard, H., Remy, J.S., Loussouarn, G., Demolombe, S., Behr, J . P . , and Escande, D. 1998. Polyethylenimine but not cationic lipids promotes transgene delivery to the nucleus in mammalian cells. J Biol Chem. 273:7507-11. Qiao, H., Pelletier, S.L., Hoffman, L., Hacker, J . , Armstrong, R.T., and White, J . M . 1998. Specific single or double proline substitutions in the "springloaded" coiled-coil region of the influenza hemagglutinin impair or abolish membrane fusion activity. J Cell Biol. 141:1335-47.  200  Rabbani, L.E., and Wang, W . 1998. Phosphorothioate Oligodeoxynucleotide Inhibition of Restenosis. J Thromb Thrombolysis. 5:125-128. Rao, S., Watkins, D., Cunningham, D., Dunlop, D., Johnson, P., Selby, P., Hancock, B.W., Fegan, C , Culligan, D., Schey, S., Morris, T.C., Lissitchkov, T., Oliver, J.W., and Holmlund, J.T. 2004. Phase II study of ISIS 3521, an antisense oligodeoxynucleotide to protein kinase C alpha, in patients with previously treated low-grade non-Hodgkin's lymphoma. Ann Oncol. 15:1413-8. Reid, T., Warren, R., and Kirn, D. 2002. Intravascular adenoviral agents in cancer patients: lessons from clinical trials. Cancer Gene Ther. 9:979-86. Rosenzweig, H.S., Rakhmanova, V.A., Mcintosh, T.J., and MacDonald, R.C. 2000. O-Alkyl dioleoylphosphatidylcholinium compounds: the effect of varying alkyl chain length on their physical properties and in vitro DNA transfection activity. Bioconjug Chem. 11:306-13. Roth, C M . , and Sundaram, S . 2004. Engineering synthetic vectors for improved DNA delivery: insights from intracellular pathways. Annu Rev Biomed Eng. 6:397-426. Rothman, J.E., and Lenard, J . 1977. Membrane asymmetry. Science. 195:74353. Roux, E., Francis, M., Winnik, F.M., and Leroux, J . C . 2002. Polymer based pHsensitive carriers as a means to improve the cytoplasmic delivery of drugs. IntJPharm. 242:25-36. Rudolph, C , Lausier, J . , Naundorf, S., Muller, R.H., and Rosenecker, J . 2000. In vivo gene delivery to the lung using polyethylenimine and fractured polyamidoamine dendrimers. J Gene Med. 2:269-78. Ruponen, M., Ronkko, S., Honkakoski, P., Pelkonen, J . , Tammi, M., and Urtti, A. 2001. Extracellular glycosaminoglycans modify cellular trafficking of lipoplexes and polyplexes. J Biol Chem. 276:33875-80. Sadzuka, Y., Hirotsu, S., and Hirota, S . 1998. Effect of liposomalization on the antitumor activity, side-effects and tissue distribution of C P T - 1 1 . Cancer Lett. 127:99-106. Sakhuja, K., Reddy, P.S., Ganesh, S., Cantaniag, F., Pattison, S., Limbach, P., Kayda, D.B., Kadan, M.J., Kaleko, M., and Connelly, S . 2003. Optimization of the generation and propagation of gutless adenoviral vectors. Hum Gene Ther. 14:243-54.  201  Sambrook, J . , Fritsch, E.F., and Maniatis, T. 1989. Extraction and purification of plasmid DNA. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 1.21-1.52 pp. Sandhu, A.P.L., A.M.I; Fenske, D. B.; Palmer, L.R.; Johnston, M.; Cullis, P.R. 2005. Calcium enhances the transfection potency of stabilized plasmidlipid particles. Anal Biochem. In press. Saravolac, E.G., Ludkovski, O., Skirrow, R., Ossanlou, M., Zhang, Y . P . , Giesbrecht, C , Thompson, J . , Thomas, S., Stark, H., Cullis, P.R., and Scherrer, P. 2000. Encapsulation of plasmid DNA in stabilized plasmidlipid particles composed of different cationic lipid concentration for optimal transfection activity. J Drug Target. 7:423-37. Schaffer, D.V., Fidelman, N.A., Dan, N., and Lauffenburger, D.A. 2000. Vector unpacking as a potential barrier for receptor-mediated polyplex gene delivery. Biotechnol Bioeng. 67:598-606. Schatzlein, A . G . 2001. Non-viral vectors in cancer gene therapy: principles and progress. Anticancer Drugs. 12:275-304. Schreiber, G . , Koch, E.M., and Neubert, W . J . 1985. Selective protection of in vitro synthesized c D N A against nucleases by incorporation of phosphorothioate-analogues. Nucleic Acids Res. 13:7663-72. Semple, S.C., Harasym, T.O., Clow, K.A., Ansell, S . M . , Klimuk, S.K., and Hope, M.J. 2004. Immunogenicity and Rapid Blood Clearance of Liposomes Containing Polyethylene Glycol-Lipid Conjugates and Nucleic Acid. J Pharmacol Exp Ther. Semple, S.C., Klimuk, S.K., Harasym, T.O., Dos Santos, N., Ansell, S.M., Wong, K.F., Maurer, N., Stark, H., Cullis, P.R., Hope, M.J., and Scherrer, P. 2001. Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures. Biochim Biophys Acta. 1510:152-66. Semple, S.C., Klimuk, S.K., Harasym, T.O., and Hope, M.J. 2000. Lipid-based formulations of antisense oligonucleotides for systemic delivery applications. Methods Enzymol. 313:322-41. Shafranski, P., Zagorski, V., Khrobochek, I., and zagorska, P. 1975. [The ratio of coat protein to bacteriophage f2 R N A in the translational repressor complex]. Mol Biol (Mosk). 9:78-85.  202  Shi, F., Rakhmilevich, A.L., Heise, C P . , Oshikawa, K., Sondel, P.M., Yang, N.S., and Mahvi, D.M. 2002. Intratumoral injection of interleukin-12 plasmid DNA, either naked or in complex with cationic lipid, results in similar tumor regression in a murine model. Mol Cancer Ther. 1:949-57. Simoes, S., Slepushkin, V., Gaspar, R., de Lima, M . C , and Duzgunes, N. 1998. Gene delivery by negatively charged ternary complexes of DNA, cationic liposomes and transferrin or fusigenic peptides. Gene Ther. 5:955-64. Simoes, S., Slepushkin, V., Pires, P., Gaspar, R., de Lima, M.P., and Duzgunes, N. 1999. Mechanisms of gene transfer mediated by lipoplexes associated with targeting ligands or pH-sensitive peptides. Gene Ther. 6:1798-807. Skubitz, K.M. 2003. Phase II trial of pegylated-liposomal doxorubicin (Doxil) in sarcoma. Cancer Invest. 21:167-76. Slepushkin, V.A., Simoes, S., Dazin, P., Newman, M.S., Guo, L.S., Pedroso de Lima, M . C , and Duzgunes, N. 1997. Sterically stabilized pH-sensitive liposomes. Intracellular delivery of aqueous contents and prolonged circulation in vivo. J Biol Chem. 272:2382-8. Spaete, R.R., and Frenkel, N. 1982. The herpes simplex virus amplicon: a new eucaryotic defective-virus cloning-amplifying vector. Cell. 30:295-304. Stayton, P.S., Hoffman, A . S . , Murthy, N., Lackey, C , Cheung, C , Tan, P., Klumb, L.A., Chilkoti, A., Wilbur, F.S., and Press, O.W. 2000. Molecular engineering of proteins and polymers for targeting and intracellular delivery of therapeutics. J Control Release. 65:203-20. Stein, C.A., and Cohen, J . S . 1989. Antisense compounds: potential role in cancer therapy. Important Adv Oncol:79-97. Stein, C.A., Tonkinson, J.L., and Yakubov, L. 1991. Phosphorothioate oligodeoxynucleotides-anti-sense inhibitors of gene expression? Pharmacol Ther. 52:365-84. Steinman, R.M., Mellman, I.S., Muller, W.A., and Cohn, Z.A. 1983. Endocytosis and the recycling of plasma membrane. J Cell Biol. 96:1-27. Stopeck, A T . , Hersh, E.M., Brailey, J.L., Clark, P.R., Norman, J . , and Parker, S . E . 1998. Transfection of primary tumor cells and tumor cell lines with plasmid DNA/lipid complexes. Cancer Gene Ther. 5:119-26.  203  Strobel, I., Krumbholz, M., Menke, A., Hoffmann, E., Dunbar, P.R., Bender, A., Hobom, G . , Steinkasserer, A., Schuler, G., and Grassmann, R. 2000. Efficient expression of the tumor-associated antigen M A G E - 3 in human dendritic cells, using an avian influenza virus vector. Hum Gene Ther. 11:2207-18. Subbarao, N.K., Parente, R.A., Szoka, F.C., Jr., Nadasdi, L , and Pongracz, K. 1987. pH-dependent bilayer destabilization by an amphipathic peptide. Biochemistry. 26:2964-72. Sui, G., Soohoo, C., Affar el, B., Gay, F., Shi, Y., and Forrester, W . C . 2002. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA. 99:5515-20. Summerford, C., and Samulski, R.J. 1998. Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. J Virol. 72:1438-45. Sun, W.H., Burkholder, J.K., Sun, J . , Culp, J . , Turner, J . , Lu, X . G . , Pugh, T.D., Ershler, W.B., and Yang, N.S. 1995. In vivo cytokine gene transfer by gene gun reduces tumor growth in mice. Proc Natl Acad Sci USA. 92:2889-93. Szoka, F., Jr., and Papahadjopoulos, D. 1978. Procedure for preparation of liposomes with large internal aqueous space and high capture by reversephase evaporation. Proc Natl Acad Sci USA. 75:4194-8. Tarn, P., Monck, M., Lee, D., Ludkovski, O., Leng, E.C., Clow, K., Stark, H., Scherrer, P., Graham, R.W., and Cullis, P.R. 2000. Stabilized plasmid-lipid particles for systemic gene therapy. Gene Ther. 7:1867-74. Tang, M.X., Redemann, C.T., and Szoka, F.C., Jr. 1996. In vitro gene delivery by degraded polyamidoamine dendrimers. Bioconjug Chem. 7:703-14. The_Journal_of_Gene_Medicine_Website. 2004. Gene Therapy Clinical Trials Worldwide. Wiley Publishers. Thomas, J.L., Devlin, B.P., and Tirrell, D.A. 1996. Kinetics of membrane micellization by the hydrophobic polyelectrolyte poly(2-ethylacrylic acid). Biochim Biophys Acta. 1278:73-8. Thomas, J.L., and Tirrell, D.A. 1992. Polyelectrolyte-sensitized phospholipid vesicles. Acc. Chem. Res. 25:336-42.  204  Thomas, J.L., and Tirrell, D.A. 2000. Polymer-induced leakage of cations from dioleoyl phosphatidylcholine and phosphatidylglycerol liposomes. J Control Release. 67:203-9. Thompson, L. 2000. Human Gene Therapy, Harsh Lessons, High Hopes. U S Food and Drug Administration. Tsavaris, N., Kosmas, C., Vadiaka, M., Giannouli, S., Siakantaris, M.P., Vassilakopoulos, T., and Pangalis, G.A. 2002. Pegylated liposomal doxorubicin in the C H O P regimen for older patients with aggressive (stages lll/IV) non-Hodgkin's lymphoma. Anticancer Res. 22:1845-8. Turner, J . G . , Tan, J . , Crucian, B.E., Sullivan, D.M., Ballester, O.F., Dalton, W . S . , Yang, N.S., Burkholder, J.K., and Y u , H. 1998. Broadened clinical utility of gene gun-mediated, granulocyte-macrophage colony-stimulating factor cDNA-based tumor cell vaccines as demonstrated with a mouse myeloma model. Hum Gene Ther. 9:1121-30. Verbaan, F.J., Oussoren, C , van Dam, I.M., Takakura, Y., Hashida, M., Crommelin, D.J., Hennink, W . E . , and Storm, G . 2001. The fate of poly(2dimethyl amino ethyl)methacrylate-based polyplexes after intravenous administration. Int J Pharm. 214:99-101. Vickers, T.A., Koo, S., Bennett, C.F., Crooke, S T . , Dean, N.M., and Baker, B.F. 2003. Efficient reduction of target R N A s by small interfering R N A and RNase H-dependent antisense agents. A comparative analysis. J Biol Chem. 278:7108-18. Waelti, E.R., and Gluck, R. 1998. Delivery to cancer cells of antisense L-myc oligonucleotides incorporated in fusogenic, cationic-lipid-reconstituted influenza-virus envelopes (cationic virosomes). Int J Cancer. 77:728-33. Wagner, E., Plank, C., Zatloukal, K., Cotten, M., and Birnstiel, M.L. 1992. Influenza virus hemagglutinin HA-2 N-terminal fusogenic peptides augment gene transfer by transferrin-polylysine-DNA complexes: toward a synthetic virus-like gene-transfer vehicle. Proc Natl Acad Sci USA. 89:7934-8. Wang, L., Prakash, R.K., Stein, C.A., Koehn, R.K., and Ruffner, D.E. 2003. Progress in the delivery of therapeutic oligonucleotides: organ/cellular distribution and targeted delivery of oligonucleotides in vivo. Antisense Nucleic Acid Drug Dev. 13:169-89. Wattiaux, R., Jadot, M., Warnier-Pirotte, M.T., and Wattiaux-De Coninck, S. 1997. Cationic lipids destabilize lysosomal membrane in vitro. FEBS Lett. 417:199-202.  205  Webb, M.S., Saxon, D., Wong, F.M., Lim, H.J., Wang, Z., Bally, M.B., Choi, L.S., Cullis, P.R., and Mayer, L.D. 1998. Comparison of different hydrophobic anchors conjugated to poly(ethylene glycol): effects on the pharmacokinetics of liposomal vincristine. Biochim Biophys Acta. 1372:272-82. Wheeler, J . J . , Palmer, L , Ossanlou, M., MacLachlan, I., Graham, R.W., Zhang, Y . P . , Hope, M.J., Scherrer, P., and Cullis, P.R. 1999. Stabilized plasmidlipid particles: construction and characterization. Gene Ther. 6:271-81. Wolff, J.A., Malone, R.W., Williams, P., Chong, W., Acsadi, G., Jani, A., and Feigner, P.L. 1990. Direct gene transfer into mouse muscle in vivo. Science. 247:1465-8. Xu, Y., and Szoka, F.C., Jr. 1996. Mechanism of DNA release from cationic liposome/DNA complexes used in cell transfection. Biochemistry. 35:561623. Yacyshyn, B.R., Bowen-Yacyshyn, M.B., Jewell, L., Tami, J.A., Bennett, C . F . , Kisner, D.L., and Shanahan, W.R., Jr. 1998. A placebo-controlled trial of ICAM-1 antisense oligonucleotide in the treatment of Crohn's disease. Gastroenterology. 114:1133-42. Yang, J . P . , and Huang, L. 1998. Time-dependent maturation of cationic liposome-DNA complex for serum resistance. Gene Ther. 5:380-7. Yang, N.S., Burkholder, J . , Roberts, B., Martinell, B., and McCabe, D. 1990. In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment. Proc Natl Acad Sci USA. 87:9568-72. Yang, Y.W., and Yang, J . C . 1997. Calcium phosphate as a gene carrier: electron microscopy. Biomaterials. 18:213-7. Yuan, F., Leunig, M., Huang, S.K., Berk, D.A., Papahadjopoulos, D., and Jain, R.K. 1994. Microvascular permeability and interstitial penetration of sterically stabilized (stealth) liposomes in a human tumor xenograft. Cancer Res. 54:3352-6. Zabner, J . 1997. Cationic lipids used in gene transfer. Adv Drug Deliv Rev. 27:17-28. Zabner, J . , Fasbender, A . J . , Moninger, T., Poellinger, K.A., and Welsh, M.J. 1995. Cellular and molecular barriers to gene transfer by a cationic lipid. J Biol Chem. 270:18997-9007.  206  Zaitsev, S., Buchwalow, I., Haberland, A., Tkachuk, S., Zaitseva, I., Haller, H., and Bottger, M. 2002. Histone H1-mediated transfection: role of calcium in the cellular uptake and intracellular fate of H1-DNA complexes. Acta Histochem. 104:85-92. Zaric, V., Weltin, D., Erbacher, P., Remy, J . S . , Behr, J.P., and Stephan, D. 2004. Effective polyethylenimine-mediated gene transfer into human endothelial cells. J Gene Med. 6:176-84. Zellweger, T., Miyake, H., Cooper, S., Chi, K., Conklin, B.S., Monia, B.P., and Gleave, M.E. 2001. Antitumor activity of antisense clusterin oligonucleotides is improved in vitro and in vivo by incorporation of 2 - 0 (2-methoxy)ethyl chemistry. J Pharmacol Exp Ther. 298:934-40. Zelphati, O., and Szoka, F.C., Jr. 1996a. Intracellular distribution and mechanism of delivery of oligonucleotides mediated by cationic lipids. Pharm Res. 13:1367-72. Zelphati, O., and Szoka, F.C., Jr. 1996b. Mechanism of oligonucleotide release from cationic liposomes. Proc Natl Acad Sci USA. 93:11493-8. Zhang, F., Andreassen, P., Fender, P., Geissler, E., Hernandez, J.F., and Chroboczek, J . 1999a. A transfecting peptide derived from adenovirus fiber protein. Gene Ther. 6:171-81. Zhang, Y . P . , Sekirov, L , Saravolac, E.G., Wheeler, J . J . , Tardi, P., Clow, K., Leng, E., Sun, R., Cullis, P.R., and Scherrer, P. 1999b. Stabilized plasmidlipid particles for regional gene therapy: formulation and transfection properties. Gene Ther. 6:1438-47. Zheng, R. 1999. Technology evaluation: G E M - 9 2 , Hybridon Inc. Curr Opin Mol Ther. 1:521-3. Zhou, X., and Huang, L. 1994. DNA transfection mediated by cationic liposomes containing lipopolylysine: characterization and mechanism of action. Biochim Biophys Acta. 1189:195-203. Zignani, M., Drummond, D . C , Meyer, O., Hong, K., and Leroux, J . C . 2000. In vitro characterization of a novel polymeric-based pH-sensitive liposome system. Biochim Biophys Acta. 1463:383-94. Zumbuehl, O., and Weder, H.G. 1981. Liposomes of controllable size in the range of 40 to 180 nm by defined dialysis of lipid/detergent mixed micelles. Biochim Biophys Acta. 640:252-62.  207  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092302/manifest

Comment

Related Items