Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Production of acetic acid by Saccharomyces cerevisiae during icewine fermentations Erasmus, Daniel Jacobus 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-103922.pdf [ 12.73MB ]
Metadata
JSON: 831-1.0092291.json
JSON-LD: 831-1.0092291-ld.json
RDF/XML (Pretty): 831-1.0092291-rdf.xml
RDF/JSON: 831-1.0092291-rdf.json
Turtle: 831-1.0092291-turtle.txt
N-Triples: 831-1.0092291-rdf-ntriples.txt
Original Record: 831-1.0092291-source.json
Full Text
831-1.0092291-fulltext.txt
Citation
831-1.0092291.ris

Full Text

PRODUCTION OF ACETIC ACID BY SACCHAROMYCES CEREVISIAE DURING ICEWINE FERMENTATIONS by DANIEL JACOBUS ERASMUS B.Sc, (Hons) University of Stellenbosch 1997 M.Sc., University of Stellenbosch 2001 A THESIS SUBMITTED IN PARTIAL FULFILMENNT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (FOOD SCIENCE) THE UNIVERSITY OF BRITISH COLUMBIA May 2005 ©Daniel Jacobus Erasmus, 2005 11 Abstract The metabolic pathways in S. cerevisiae during fermentation of Icewine grape must have not been studied and the transcriptional response of this yeast to sugar stress has not been investigated. Global transcriptional analyses showed that the transcription of 589 genes in S. cerevisiae was affected more than two-fold in grape juice containing 40% (w/v) sugars. High sugar stress up-regulated the glycolytic and pentose phosphate pathway genes. Gene expression profiles indicate that the oxidative and non-oxidative branches of the pentose phosphate pathway were up-regulated and might be used to shunt more glucose-6-phosphate and fructose-6-phosphate from the glycolytic pathway into the pentose phosphate pathway, respectively. Structural genes involved in the synthesis of acetic acid from acetaldehyde, and succinic acid from glutamate, were also up-regulated. Genes involved in the de novo biosynthesis of purines, pyrimidines, histidine and lysine were down-regulated by sugar stress. Wine yeast produce acetic acid as a by-product of the hyper osmotic stress response caused by high sugar concentrations (>35 % w/v) in grape must. Seven commercially available wine yeast strains were compared for Icewine production. Yeast strains were evaluated for acetic acid and glycerol formation, fermentation rates and sensory characteristics. Fermentation rates and acetic acid and glycerol formation were significantly different (p<0.05) and linked to the yeast strain. Icewines produced with the different yeast strains showed significant differences for overall quality, perceived sulphur-like aroma and colour (p<0.05). ST, N96 and EC1118 were identified as the most suitable yeast strains for the production of Icewine. S. cerevisiae strain ST produced the lowest amounts of acetic acid and glycerol, while strain VIN7 produced the highest amounts of acetic acid and glycerol. Global gene expression analysis revealed that genes involved in glycerol and acetic acid formation were expressed at higher levels in VIN7 than in ST. PCR analyses showed that approximately 30 Ill kb on the left arm of chromosome XV, close to the telomere, is absent in VIN7. Among the genes absent is YOL159C, a gene whose deletion causes osmosensitivity and an increase in Tyl retrotranspositions, which may cause genetic instability. iv TABLE OF CONTENTS Abstract ii List of Tables xi List of Figures xiii List of Abbreviations .. xvi Preface xviii Acknowledgements xx Chapter 1. The osmotic stress response and subsequent acetic acid formation by 1 Saccharomyces cerevisiae 1.1 Introduction 2 1.2 The origins of S. cerevisiae wine yeast strains 3 1.3 Stresses encountered by S. cerevisiae during wine fermentations 5 1.3.1 Nutrient availability and its contribution to stress 5 1.3.2 Temperature stress 7 1.3.3 Ethanol toxicity and its effect on cell stress 8 1.4 Response of S. cerevisiae to high osmolarity 10 1.4.1 Sinlp branch 10 1.4.2 Sho 1 p(-Msb2p) branch 13 1.4.2.1 Msb2p sensor 15 1.4.3 Feedback control of the HOG MAP kinase cascade 15 1.4.4 Regulation of transcription during osmotic stress 16 1.4.4.1 Hotl protein 17 1.4.4.2 Skol protein 18 1.4.4.3 Msnl protein 19 1.4.4.4 Smpl protein 19 V 1.4.4.5 Sgdlp protein 20 1.4.4.6 Gcn4 protein 20 1.4.5 cAMP-PKA pathway regulates stress responsive genes 21 1.4.6 TOR kinases regulate Msn2/4p mediated transcription 25 1.5 Adaptation ofS. cerevisiae to osmotic stress 28 1.5.1 Glycerol metabolism 29 1.5.1.1 Transcriptional regulation of GPD1 and GPP2 33 1.5.2 Role of trehalose and glycogen in adaptation to stress 34 1.5.2.1 Trehalose and glycogen metabolism 35 1.5.2.2 Stress response through activation of trehalose and glycogen 36 metabolism 1.5.2.3 Glycolysis requires the functioning of TPS1 37 1.5.3 Metabolic adaptation of S. cerevisiae to osmotic stress; formation of 40 acetic acid 1.5.3.1 The ALD2 (YML170C) and ALD3 (YMR169C) genes 40 1.5.3.2 The mitochondrial aldehyde dehydrogenases: ALD4 41 (YOR374W) and ALD5 (YER073W) genes 1.5.3.3 The^LD6(YPL061W) gene 42 1.6 Production of acetic acid in wine 44 1.6.1 High sugar concentrations 44 1.6.2 Effect of wine yeast strains on acetic acid formation 45 1.6.3 Clarification and removal of components in must 46 1.6.4 Fermentation temperature 46 1.6.5 Effect of nitrogen on glycerol and acetic acid formation 47 1.6.6 Effect of sulphur dioxide 48 vi 1.7 Proposed research 49 1.7.1 Significance of research 49 1.7.2 General hypothesis 49 1.7.3 Main objectives 50 1.8 Literature Cited 52 Chapter 2. Genome-wide expression analyses: Metabolic adaptation of 85 Saccharomyces cerevisiae to high sugar stress 2.1 Introduction 86 2.2 Materials and Methods 88 2.2.1 Determination of water activity (Aw) 88 2.2.2 Media preparation, yeast strain and growth conditions 88 2.2.3 RNA extraction and sample preparation 89 2.2.4 Hybridization, fluidics and scanning procedures 89 2.2.5 Data analyses 90 2.2.6 Quantification of acetic acid 90 2.3 Results 91 2.3.1 Regulation of carbohydrate metabolic genes by high sugar 113 concentrations (fold change indicated in brackets) 2.3.2 Genes responsible for the formation of acetic acid from acetaldehyde, 115 and succinate from glutamate, are up-regulated 2.3.3 Genes involved in the de novo purine and pyrimidine biosynthesis are 117 down-regulated 2.3.4 Genes involved in the de novo biosynthesis of histidine, lysine and 117 aromatic amino acids are down-regulated 2.3.5 Sugar stress decreases the growth rate of S. cerevisiae 119 vii 2.4 Discussion 119 2.4.1 Genes involved in glycolysis and the synthesis and dissimilation of 119 glycerol, trehalose and glycogen are up-regulated by sugar stress 2.4.2 The pentose phosphate pathway may act as a shunt to prevent 120 accumulation of fructose-1,6-bisphosphate in the glycolytic pathway 2.4.3 Hyper osmotic stress down-regulates genes involved in the de novo 122 biosynthesis of purines, pyrimidines, histidine and lysine 2.4.4 Sugar stress up-regulates genes in pathways leading to acetic and 122 succinic acids 2.4.5 Concluding remarks 123 2.6 Literature Cited 124 Chapter 3. Impact of yeast strain on the production of acetic acid, 133 glycerol and the sensory attributes of Icewine 3.1 Introduction 134 3.2 Materials and Methods 136 3.2.1 Yeast strains and media 136 3.2.2 Determination of the nitrogen content of Riesling Icewine must 136 3.2.3 Experimental winemaking 137 3.2.4 Quantification of acetic acid, glycerol and ethanol 138 3.2.5 Analysis of colour, viscosity and titratable acidity (TA) of Icewine 138 3.2.6 Sensory Methodology 139 3.2.6.1 Experimental design 139 3.2.6.2 Judges 139 3.2.6.3 Benching 139 3.2.6.4 Training 139 3.2.6.5 Colour/Aroma/Flavour/Quality Assessments 140 Vlll 3.2.7 Statistical analyses 141 3.3 Results 141 3.3.1 Fermentation performance of yeast strains in synthetic grape must 141 3.3.2 Increased sugar concentrations increase the production of acetic acid 143 and glycerol by wine yeast strains in synthetic must 3.3.3 Fermentation rate, and acetic acid and glycerol production in Icewine 143 is yeast strain specific 3.3.4 Physico-chemical and sensory analysis of Icewines produced with 144 different yeast strains 3.4 Discussion 150 3.4.1 Fermentation rate and growth is yeast strain specific 150 3.4.2 Osmotic stress environments accentuate differences among yeast 150 strains 3.4.3 Sensory analysis of Icewines produced with different yeast strains 152 3.5 Conclusions 155 3.6 Literature Cited 155 Chapter 4. Differential expression of genes in enological strains of 159 Saccharomyces cerevisiae affects osmo-sensitivity, acetic acid and glycerol formation during sugar induced osmotic stress 4.1 Introduction 160 4.2 Materials and Methods 162 4.2.1 Yeast strains and media 162 4.2.2 Growth conditions for micro-array analysis 164 4.2.3 RNA extraction and sample preparation 164 4.2.4 Hybridization, fluidics and scanning procedures 164 4.2.5 Data analyses 165 ix 4.2.6 Semi-quantitative reverse transcriptase Real-Time PCR 165 4.2.7 Resistance of ST, VIN7 and BY4741 to rapamycin 167 4.2.8 Sequencing of TOR2 in VIN7 168 4.2.9 PCR analysis of the telomeric region on the left arm on chromosome 168 XV from ST and VIN7 4.2.10 Effect of ald6, zmsl, andzwfl deletions on acetic acid, glycerol and 169 ethanol formation 4.2.11 Quantification of acetic acid, glycerol and ethanol 169 4.3 Results 169 4.3.1 Overview 169 4.3.2 VIN7 is more sensitive to sugar induced osmotic stress than ST 170 4.3.3 Genes involved in diverse biological processes are expressed 172 differentially in VIN7 and ST 4.3.4 PCR Analysis of the telomeric region of chromosome XV of ST and 183 VIN7 4.3.5 Transcription of structural genes involved in glycerol and acetic acid 183 VIN7 and ST 4.3.6 Deletion of ZWF1 and ZMS1 affects acetic acid and glycerol formation 184 by S. cerevisiae 4.4 Discussion 189 4.4.1 Transcriptional adaptation of VIN7 and ST to sugar induced osmotic 189 stress 4.4.2 Deletion of the ZMS1, ALD6 and ZWF1 affect acetic acid and glycerol 193 formation 4.4.3 Genes involved in phospholipid biosynthesis are expressed at lower 195 levels in VIN7 than in ST and may contribute to increased X concentrations of glycerol and acetic acid produced under conditions of osmotic stress 4.5 Cited Literature 196 Chapter 5. Conclusions and Future Perspectives 205 5.1 General Conclusions 206 5.2 Future Perspectives 211 Appendix A 213 Appendix B 217 Appendix C 223 Appendix D 230 Appendix E 244 Appendix F 247 XI List of Tables Table 2.1 Genes in S. cerevisiae that were up-regulated more than two-fold 91 when cells were grown in grape juice containing 40% (w/v) sugars after growing to mid-log phase in grape juice with 22% (w/v) sugars Table 2.2 Genes in S. cerevisiae that were down-regulated more than two-fold 103 when cells were grown in grape juice containing 40% (w/v) sugars after growing to mid-log phase in grape juice with 22% (w/v) sugars Table 3.1 Definitions of sensory attributes evaluated in Icewines 140 Table 3.2 Fermentation time, maximum cell densities and ethanol produced by 142 seven wine yeast strains in 20% and 40% (w/v) sugar synthetic must Table 3.3 Composition of Riesling Icewine must used for evaluating yeast 144 strains Table 3.4 Analysis of sensory properties of Icewines used in sensory analysis 149 Table 3.5 Analysis of physico-chemical properties of Icewines used in sensory 149 analysis Table 4.1. Yeast strains used in this study 163 Table 4.2 Primers used for Real-Time PCR analysis of chromosome XV and 166 sequencing of TOR2 Table 4.3 Comparative expression of ACS1, ALD6, GPD1, GLK1, HSP26, 171 HSP30, YOR315W and ZMS1 in VIN7 and ST grown in Riesling or synthetic grape musts containing 40% (w/v) sugars Table 4.4 Differential expression of genes up-regulated by sugar-induced osmotic 175 stress in VIN7 and ST Table 4.5 Differential expression of genes down-regulated by sugar-induced osmotic 177 stress in VIN7 and ST Table 4.6 Genes regulated by Msn2/4p that are expressed at least two-fold 179 xn differentially between VIN7 and ST Table 4.7 Differential expression of HOG1 regulated genes 180 Table 4.8 Comparison of four orphan gene transcripts in VIN7 and ST 185 Table 7.1 Glycerol and ethanol produced by ST, N96 and EC1118 in synthetic 220 grape must Table 7.2 Correlations matrix among physico-chemical and sensory attributes 222 of icewines produced with five different yeast strains Table 8.1 Genes involved in thiamine biosynthesis are expressed at least two 225 fold lower in VIN7 than in ST Table 8.2 Yeast strains used in this study 228 Table 9.1 Ethanol (g/L) produced by ST, N96 and EC 1118 under different 240 fermentation conditions in 40 °Brix Riesling Icewine grape must Table 9.2 Statistical analyses obtained on acetic acid and glycerol formation 241 normalization to ethanol Table A.l Genes in S. cerevisiae changing less than two-fold when cells were CD grown in grape juice containing 40% (w/v) sugars after growing to mid-log phase in grape juice with 22% (w/v) sugars Table A.2 Genes in S. cerevisiae not changing expression when cells were CD grown in grape juice containing 40% (w/v) sugars after growing to mid-log phase in grape juice with 22% (w/v) sugars Table A.3 Genes expressed higher in VIN7 than ST during the fermentation of CD grape must containing 40 % (w/v) sugars Table A.4 Genes expressed lower in VIN7 than ST during the fermentation of CD grape must containing 40 % (w/v) sugars Table A.5 Genes not expressed diffently between VIN7 and ST during the CD fermentation of grape must containing 40 % (w/v) sugars XIII List of Figures Fig. 1.1 The HOG MAP kinase cascade pathway senses high osmolarity 12 Fig. 1.2 The cAMP-PKA pathway regulates STRE dependent gene expression. 23 Fig. 1.3 TOR regulates Msn2/4p through the cAMP-PKA pathway. 27 Fig. 1.4 Glycolysis in S. cerevisiae and the formation of glycerol, glycogen, 30 trehalose and acetic acid from intermediates in the glycolytic pathway Fig. 2.1 Response of S. cerevisiae VIN13 to a shift from 20% to 40% (w/v) sugars 111 Riesling must Fig. 2.2 Classification of genes into cellular role categories according to YPD™. 112 Fig. 2.3 Regulation of genes involved in the glycolytic, glycerol, trehalose, 114 glycogen and pentose phosphate pathways in S. cerevisiae by sugar stress Fig. 2.4 Schematic presentation of the glutamate catabolic pathway that converts 116 glutamate to succinate in S. cerevisiae under conditions of sugar stress Fig. 2.5 Down-regulation of genes involved in the biosynthesis of nucleotides, 118 histidine and lysine in S. cerevisiae by sugar stress Fig. 3.1 Formation of acetic acid (A) and glycerol (B) by seven different wine 145 yeast strains in synthetic must containing either 20% or 40% (w/v) sugars Fig. 3.2 Comparison of fermentation rates of seven yeast strains in Riesling 146 Icewine must Fig. 3.3 Formation of (A) acetic acid (LSD =0.097) and (B) glycerol (LSD 147 =0.575) by seven different yeast strains in Icewine Fig. 3.4 Principal component analysis of statistically significant (p<0.05) sensory 154 attributes of Icewines produced with five different wine yeast strains. Fig. 4.1 Stress related genes that were expressed two-fold or more differently 174 between VIN7 and ST Fig. 4.2 VIN7 is more rapamycin resistant than ST and BY4741 181 Fig. 4.3 Microarray data indicate that genes involved in biosynthesis of 182 phosphatidylcholine are expressed at lower levels in VIN7 than in ST during the fermentation of Riesling grape must containing 40% (w/v) sugars XIV 186 Fig. 4.4 The telomeric region on the left arm of chromosome XV in S. cerevisiae Fig. 4.5 Expression levels of ALD genes in VIN7 and ST during fermentation of 187 40% (w/v) sugar Riesling grape must Fig. 4.6 Formation of (A) acetic acid, (B) glycerol and (C) ethanol and (D) growth 188 of the laboratory wild type strain BY4741 and its isogenic deletion mutant strains ald6, zwfl and zmsl in YEPD containing 40% (w/v) glucose Fig. 6.1 Determination of the amount of active dry yeast (ADY) to use for Icewine 214 fermentations Fig. 6.2 Growth of VIN13 in 22 °Brix and 40 °Brix Riesling grape juice 215 Fig. 6.3 Formation of succinate by the oxidative and reductive pathways of the 216 tricarboxylic acid (TCA) cycle during fermentation Fig. 7.1 Weigh loss of fermentations conducted with ST, 7IB, N96, VIN7, 217 VIN13, VI116 and EC1118 in synthetic grape must Fig. 7.2 Growth of ST, 71B, N96, VIN7, VIN13, V1116 and EC 1118 in synthetic 218 grape must containing (A) 20 and (B) 40% (w/v) sugars Fig. 7.3 Growth of three wine yeast strains (A) ST, (B) N96 and (C) EC 1118 and 219 (D) weight loss when yeasts fermented 45 % (w/v) and 50 % (w/v) sugars in synthetic grape must Fig. 7.4 Formation of ethanol by seven different wine yeast strains fermenting 40 221 °Brix Riesling Icewine grape must Fig. 8.1 The effect of 1 g/L arginine on the fermentation performance of VIN7 224 and ST in synthetic grape containing 40 % (w/v) sugars Fig. 8.2 The effect of 0.75 mg/L thiamine on the fermentation performance of 227 VIN7 and ST in synthetic grape must containing 40 % (w/v) sugars Fig. 8.3 Deletion of ALD2 ALD3, ALD4 and ALD5 does not affect (A) acetic acid, 229 (B) glycerol and (C) ethanol formation in YEPD containing 40% (w/v) sugars Fig. 9.1 Fermentation times of three yeast strains (ST, N96 & EC 1118) when 234 fermenting 40 °Brix Riesling Icewine must when either 125 mg DAP, 125 mg Fermaid K or sulphur dioxide is added at different time points or when fermenting at 15 °C and 25 °C Fig. 9.2 Effect of timed DAP addition on the formation of (A) acetic acid (Fischer 235 LSD =0.093) and (B) glycerol (Fischer LSD =0.361) by three wine yeast XV strains (ST, N96, and EC 1118) in 40 °Brix Riesling Icewine Fig. 9.3 Effect of timed Fermaid K addition on the formation of (A) acetic acid 236 (Fischer LSD =0.072) and (B) glycerol (Fischer LSD =0.256) by three wine yeast strains (ST, N96, and EC1118) in 40 °Brix Riesling Icewine must Fig. 9.4 Formation of (A) acetic acid (Fischer LSD =0.089) and (B) glycerol 237 (Fischer LSD =0.357) by three wine yeast strains (ST, N96, and EC1118) in 40 °Brix Riesling Icewine at three different temperatures Fig. 9.5 Effect of timed addition and the amount of sulphur dioxide on the 239 formation of (A) acetic acid (Fischer LSD =0.057) and (B) glycerol (Fischer LSD =0.335) by three wine yeast strains (ST, N96, and EC1118) in 40 °Brix Riesling Icewine Fig 10.1 Analyses of acetic acid in Icewines by HPLC with a diode array detector 244 Fig 10.2 Analyses of glycerol in Icewines by HPLC using a refractive index 245 detector Fig 10.3 Analyses of ethanol in Icewines by HPLC using a refractive index 246 detector Fig 11.1 Probe set arrays from selected genes extracted from GeneChips used in 247 replicate one for the transcriptional profiling of S. cerevisiae strains ST and VIN7 List of Abbreviations ADY Active dry yeast AMP Adenosine monophosphate ATP Adenosine triphosphate Aw Water activity cAMP Cyclic adenosine monophosphate CER Common environmental response CRE cAMP response element CREB cAMP response element binding C T Threshold cycle DAG diacylglycerol DAP Diammonium phosphate DEPC Diethyl pyrocarbonate DHA dihydroxyacetone DHAP Dihydroxyacetone phosphate DNA Deoxyribonucleic acid ESR Environmental stress response F-1,6-BP Fructose-1,6-bisphosphate F-6-P Fructose-6-phosphate G-l-P Glucose-1 -phosphate G-6-P Glucose-6-phosphate GAP Glyceraldehyde-3 -phosphate GPCR G-protein coupled receptor HOG High osmolarity glycerol HPLC High performance/pressure liquid chromatography XVll MAP Mitogen activated protein MAPK Mitogen activated protein kinase MAPKK Mitogen activated protein kinase kinase MAPKKK Mitogen activated protein kinase kinase kinase NADH Nicotinamide adenine dinucleotide NADPH Nicotinamide adenine dinucleotide phosphate NCR Nitrogen catabolite repression OQ Overall quality PC phosphatidylcholine PCR Polymerase chain reaction PKA Protein kinase A PPP Pentose phosphate pathway RNA Ribonucleic acid RT Reverse transcriptase SA Sulphur-like aroma SLR Signal log ratio STRE Stress response elements TAG triacylglycerol TCA Tricarboxcylic acid cycle TOR Target of rapamycin UDP Uridine 5'-diphosphate VA Volatile Acidity VQA Vintners Quality Alliance YEPD Yeast extract, peptone, dextrose XV111 Preface The following papers from this thesis have been published: Chapter 2 Erasmus, D. J., van der Merwe, G. K., and van Vuuren, H. J. J. (2003) Genome-wide expression analyses: Metabolic adaptation of Saccharomyces cerevisiae to high sugar stress. FEMS Yeast Res. 3, 375-399. The author and supervisor planned all the experiments and all experiments were conducted by the author. Dr. George van der Merwe was responsible for conducting high density DNA microarrays. The author performed the data analyses and interpretation of the data. The manuscript was written by the author and edited by Drs. H. J. J. van Vuuren and ( K. van der Merwe. Chapter 3 Daniel J. Erasmus, Margaret Cliff, and Hennie J. J. van Vuuren. (2004). Impact of Yeast Strain on the Production of Acetic acid, Glycerol and the Sensory Attributes of Icewine. An J. Enol. Vitic. 55, 371-378. The author and supervisor planned all the experiments and all experiments were conducted by the author. The author executed all the experiments for this manuscript. E Margaret Cliff provided guidance on the planning, and execution of sensory analysis anc assisted in the statistical analysis and interpretation of the sensory data. The manuscript written by the author and edited by Drs. H. J. J. van Vuuren and M. Cliff. XX Acknowledgements I would like to thank Dr. Hennie J. J. van Vuuren, my supervisor, for his supervision and guidance in writing this thesis, financial support over the years and his invitation to follow him to Canada is much appreciated. I am also thankful to my thesis committee members Drs. Christine Seaman, Joerg Bohlmann and Quentin Cronk for their advice and criticism. Special thanks to Drs. George van der Merwe and Margaret Cliff for the collaboration on the two manuscripts that have been published. John Husnik, and my past and present colleagues at the Wine Research Centre for their camaraderie, discussions and critical review of my manuscripts. I would like to acknowledge and thank the British Columbia Wine Institute, NSERC and the AAFC for funding my research. I also wish to thank my parents for all the sacrifices they have made and for their support. I am.also grateful to my family in-law for their support. Finally I would like to thank my wife, Hilary, for her love, trust and support. 1 Chapter 1 The osmotic stress response and subsequent acetic acid formation by Saccharomyces cerevisiae 2 1.1 I n t r o d u c t i o n Saccharomyces cerevisiae has been used extensively as a model organism for the past three decades. This yeast was the first eukaryotic organism whose genome was sequenced. Furthermore, this unicellular fungus is extensively used in the development of new technologies and techniques in the field of systems biology comprising functional genomics, proteomics and metabolomics. In addition to its impact in science, S. cerevisiae is one of the most widely used organisms in industry. Wine making is one of the oldest biotechnological processes. The earliest record of wine making dates back to 6000 BC in Mesopotamia [1]. Since then, wine making has evolved from a mere batch of fermenting rotting grapes, in clay pots, consumed by people with no concept of micro organisms, to a beverage that is produced by university educated people in large volumes in stainless steel fermenters. Today, wine is an integral part of our society's cultural and social interactions. With some 26 billion litres of wine produced annually on all six inhabited continents, wine and activities associated with wine production have become an important economic force [1,2]. In Canada, Icewine has become the premier export product of the Canadian wine industry. Compared to still wine production, Icewine is a relatively recent addition to wine making. Anecdotal evidence suggests that the first Icewine was made in 1794 in Germany. Following a cold and short summer that ruined the grape crop that year, people decided to leave the grapes on the vine. During that ensuing winter German monks decided to harvest some of the grapes, probably out of desperation, which coincidentally froze in the cold winter. The wine produced with these grapes was intense in flavour and very sweet and the monks called this wine "Eiswein". Today Eiswein or Icewine is produced not just in Germany but also in Austria and Canada. In Canada Icewine is produced in British Columbia and Ontario. 3 The Vintners Quality Alliance (VQA) regulates the production of Icewine in Canada. Grapes for Icewine production must be frozen naturally, on the vine, and can only be harvested at temperatures equal to or below -8 °C. This natural freezing process results in grape must with exceptionally high sugar concentrations that can be as high as 50 °Brix (approx 50% w/v sugars). During harvesting no single pressing may produce grape must lower than 32 °Brix (approx 32% w/v sugars) with the final average in the fermentation tank not below 35 °Brix (approx 35% w/v sugars). Therefore, Icewine must contains a much higher concentration of sugars than regular grape must (16-26% w/v) and laboratory media which usually contain only 2% (w/v) sugars. The fact that S. cerevisiae is exposed to high sugar concentrations in nature has largely been ignored by scientists studying this yeast in laboratory media containing 2 % sugars. The high sugar concentrations in still table wine and Icewine fermentations present a mild to a severe osmotic stress environment to S. cerevisiae. From a scientific perspective, research on S. cerevisiae when exposed to sugar concentrations commonly found in Icewine could yield new and valuable information on the biology of this micro organism. This review will focus on the fundamental knowledge generated through years of research on the osmotic stress response and adaptation to osmotic stress by S. cerevisiae and how this knowledge is applicable to wine fermentations, in particular Icewine fermentations. 1.2 The origins of S. cerevisiae wine yeast strains The physical existence of micro organisms was discovered in 1680 by the Dutchman Antonie van Leewenhoek, who built the first microscope and subsequently drew pictures of what he saw. We now know that these first pictures were most likely of yeast cells [1]. The importance of micro organisms to wine making was realized only much later in 1863, when Louis Pasteur postulated that micro organisms are responsible for fermentation activity in 4 grape must. At the time wine fermentations occurred "spontaneously" due to the presence of the native micro flora on the grapes. A major step forward in improving wine quality came in 1890 when Muller-Thurgau introduced the concept of inoculating wine fermentations with selected pure yeast cultures of S. cerevisiae to improve wine quality. However, the use of inoculated yeast strains only came to the forefront in the early 1960's when active dried yeast (ADY) of S. cerevisiae was used for the first time as inoculum to ferment grapes. Today, ADY is routinely used to ferment and produce wine worldwide. The origin of wine yeast strains of S. cerevisiae is still a contested topic. Some studies have shown that S. cerevisiae occurs naturally in the vineyard, but at very low levels [3-6]. Mortimer and Polsinelli (1999) suggested that S. cerevisiae is found on one out of every 1000 undamaged berries; similar results have been published by others [3,4]. However, this number increases dramatically when the grapes are damaged. One possible explanation for this increase has been ascribed to insect vectors that carry S. cerevisiae and other micro organisms on their bodies [3]. Honeybees, fruit flies (Drosophila), and wasps are all attracted by the odours of the damaged berries [3,7-10]. In the vineyard grape berries that are S. cerevisiae positive, can contain anywhere from 100,000 to 1,000,000 cells. The yeast cells on that particular berry seem to be clonal, indicating that they stem from one original ancestor. On the other hand, the occurrence of S. cerevisiae in high numbers on surfaces that come into contact with grape juice, has led to the idea that S. cerevisiae is part of the winery's "residential" flora. Some scientists have suggested that wineries are the natural man-made environment and that S. cerevisiae has no true natural environment [4,6]. Regardless, it is possible that S. cerevisiae was introduced from the vineyard into the winery by insect vectors and S. cerevisiae is present in such high numbers in wineries because the winery "environment" is more favourable than the vineyard. 5 1.3 Stresses encountered by S. cerevisiae during wine fermentations During wine fermentations wine yeasts have to contend with a wide variety of environmental stress conditions. These stresses, such as temperature, hyper-osmotic stress, nutrient availability, and ethanol toxicity, have all been studied in detail in laboratory conditions using laboratory strains of S. cerevisiae. Scientists have developed hypotheses and unravelled mechanisms on how S. cerevisiae senses changes in its environment, and subsequently adjusts its transcriptome, proteome and metabolome to survive. The remodelling of the transcriptome in response to a variety of stress conditions including temperature, oxidative stress, pH, hyper and hypo-osmotic stress, amino acid starvation and nitrogen depletion has been reported [11,12]. Using laboratory yeast and laboratory growth media, Gasch co-workers and Causton et al. identified -900 and 499 genes, respectively, that respond to stress in general. Gasch and co-workers referred to this as the environmental stress response (ESR) whereas Causton and co-workers described this response as the common environmental response (CER). The effect of stress on the physiological adaptation of wine yeast strains during wine fermentations has not been studied at molecular level. Although the focus of this review is on hyper-osmotic stress, a brief overview on the effect of nutrient availability, temperature stress and ethanol toxicity will be discussed. 1.3.1 Nutrient availability and its contribution to stress The major elements or macronutrients required by yeast are carbon, hydrogen, nitrogen, oxygen, phosphorus and sulphur (CHNOPS). Limitation in any of these compounds will stress yeast cells [13,14]. Global gene expression analysis of cells starved either for carbon, nitrogen, phosphorous or sulphur results in the altered expression of 484 genes in the yeast genome [13]. 6 Quantitatively, carbon starvation has the greatest impact on gene expression in yeast [15]. However, carbon starvation is not a problem during alcoholic fermentations, since glucose and fructose are in abundance in grape must. These two sugars are the main sources of carbon, hydrogen and oxygen that form the constituents of most macro molecules in the cell. Although sugars are depleted at the end of fermentation, glycerol and ethanol (products of the fermentation) can also be used as carbon sources in the presence of oxygen. However, the high concentration of ethanol at the end of fermentation becomes toxic to the cell before the yeast can use it as a carbon source. Yeast also requires molecular oxygen (O2) to act as an electron acceptor for fatty acid biosynthesis and energy production by mitochondria when the yeast respires. During fermentation, molecular oxygen is not required for energy metabolism but is still needed by fatty acid desaturase and squalene oxidase for fatty acid synthesis [16,17]. A well-maintained cell membrane promotes ethanol and heat resistance in wine yeast. The lack of sufficient nitrogen is probably the biggest nutrient associated stress problem in wine making. Grape must contains a wide variety of nitrogen sources such as proline, arginine, glutamate, glutamine, serine, threonine, ammonia and gamma-amino-butyric acid [18]. The lack of sufficient assimilable nitrogen in grape musts often leads to sluggish or stuck fermentations [17]. Stuck or sluggish fermentation are usually indicative of nutrient starved/stressed yeast cells, which may lead to the formation of H2S and other off-flavours [18]. Winemakers often supplement fermenting grape musts with nitrogen to prevent the formation of spoilage compounds and sluggish fermentations; the most widely used nitrogen source is diammonium phosphate (DAP). Although S. cerevisiae can utilize a number of different nitrogen sources, it will do so selectively through a mechanism referred to as nitrogen catabolite repression (NCR) [19]. NCR allows yeast to distinguish between good nitrogen sources (ammonia, glutamine, glutamate, asparagines) and poor nitrogen sources (arginine, urea, proline, allantoin) [19]. 7 Good nitrogen sources allow faster growth than poor nitrogen sources. In conditions where both good and poor nitrogen sources are available, the yeast will selectively utilize the good nitrogen sources first. In the presence of a good nitrogen source, transcription of genes involved in the assimilation of poor nitrogen sources is repressed. The predominant phenotype of stressed cells is a slow growth rate with a characteristically longer Gl-phase relative to non-stressed cells. This is illustrated by the fact that cells growing in nutrient poor media have a longer Gl-phase than cells growing in rich media [20]. At a molecular level nutrient levels regulate the duration of Gl-phase through the CLN1/2/3 cyclins. To proceed from the Gl into the S-phase of the cell cycle, requires high level activity of the Cln3-Cdc28p kinase complex [21,22]. Loss of CLN3 prolongs Gl, whereas increased expression of CLN3 shortens the Gl-phase and allows initiation of the cell cycle [22]. Initiation of "start" in the cell cycle depends on the mRNA and protein levels of CLN3 [23]. The maximum induction of CLN3 requires a fermentable carbon source and a good nitrogen source [24]. Although sulphur and phosphorus limitation prolong the Gl-phase, it is CL/V3-independent, but seems to be associated with low levels of CLN1 and CLN2 mRNA. Both CLN1 and CLN2 are cyclins expressed at low levels during the Gl-phase and peak in late Gl to initiate "start" and progression to the S-phase. 1.3.2 Temperature stress Wine fermentations are conducted at different temperatures. Red wine fermentations, in general, are conducted at higher temperatures (18-25°C) to promote the extraction of pigments (anthocyanins) from grape skins [25]. White wine fermentations, on the other hand, are conducted at much lower temperatures (10-15°C) to prevent excessive loss of volatile flavour compounds [25,26]. Futhermore, the plasma membrane fluidity increases with an increase in fermentation temperature, which in turn could affect permeases. Lowering of fermentation temperatures has the opposite effect on cellular membrane fluidity [17,27]. g Yeast responds to heat stress by synthesizing heat shock proteins [28]. As expected, genes encoding heat shock proteins are strongly induced by heat stress [29]. The main purpose of these proteins is to assist in the correct folding of cellular proteins. Heat shock proteins are synthesized not just in response to heat stress, but to a variety of environmental stress conditions. In addition to heat shock proteins, yeast synthesizes and accumulates trehalose to stabilize proteins and membranes [30]. The molecular aspects of trehalose metabolism will be discussed later. Global gene expression analysis on yeast transferred from 30 °C to 45 °C or 4 °C for heat and cold shock, respectively, revealed that more genes respond to heat shock than to cold shock [31]. Genes that were affected by both heat and cold shock contained stress response elements (STREs) in their promoters. During long term exposure to cold temperature (10 °C) yeast has been shown to activate five genes identified as LOT (low temperature response) genes for an extended period of time [32]. These genes, however, do not respond to cold shock but rather to long-term cold stress [31]. Similar observations were made for the TIP and TIR family of proteins known to respond to cold stress [33,34]. 1.3.3 Ethanol toxicity and its effect on cell stress Ethanol becomes toxic to most organisms at concentrations as low as 2 % (v/v) [25]. When ethanol concentrations reach 3-4 %(v/v) in wine fermentations, most wild micro organisms are killed, or their growth is inhibited [35]. At this point Saccharomyces will start to dominate the fermentation and it is for this reason that wine yeasts have been bred and selected to be more tolerant to high ethanol concentrations. Some selected and commercially available wine yeasts are able to produce as much as 18% (v/v) ethanol. Although ethanol addition to a medium will lower water activity (Aw), the addition of 1.6 M ethanol {approx. 6% (v/v)} does not induce GPD1 expression [36]. This suggests that ethanol toxicity is not caused by lowering of the Aw to induce an osmotic stress response, but 9 rather, ethanol affects membrane fluidity, transport of amino acids and hexose sugars, and membrane permeability to protons is increased [17, 37, 38]. Two theories have been suggested describing mechanisms of ethanol toxicity on membranes. (1) Ethanol preferentially accumulates in the hydrophobic bilayer of the membrane thereby disrupting membrane structure/fluidity [38], or (2) the highly polar hydroxyl group of ethanol interacts through hydrogen, dielectric and polar bonds with the polar heads of phospholipids and integral membrane proteins, disrupting membrane structure instead of locating to the hydrophobic lipid bilayer [39]. Regardless of the mechanism, ethanol alters the structure of cellular membranes thereby allowing an increase in passive diffusion of protons from the acidic grape must environment into the neutral cytoplasm causing acidification. H + -ATPases pump these protons out of the yeast cell into the environment, creating a demand on ATP in the cell, leading to the eventual acidification of the cytoplasm [37]. However, cell death apparently occurs before a decrease in the cytoplasmic pH is observed [40]. It seems that ethanol induced leakage of important cytoplasmic components into the environment has a greater effect, than a decrease in cytoplasmic pH [17]. Yeast cells respond to ethanol stress by synthesizing unsaturated fatty acids, ergosterol, heat shock proteins as well as trehalose [17, 38]. There seems to be considerable overlap in the yeast's response to heat and ethanol stress [38]. Several heat shock proteins including: Hsp30p, Hsp70p, Hspl04p, Hsp26p, are up-regulated by ethanol stress [41, 42]. As is the case in heat shock, Hsp's play a role in preventing protein aggregation, assist in refolding and help stabilize cellular proteins. In addition, trehalose accumulation, as in heat stress, assists in stabilizing membranes and cellular proteins during ethanol stress [43]. The yeast cell's transcriptional response to ethanol shock is consistent with the physiological changes that have been observed. Exposure of yeast to ethanol shock {7 % (v/v)} revealed that genes encoding several heat shock proteins, proteins responsible for ionic homeostasis, trehalose biosynthesis and genes involved in energy metabolism, are up-regulated [41]. 10 1.4 Response of S. cerevisiae to high osmolality Eukaryotes sense osmotic changes through conserved signal transduction modules [44,45]. In S. cerevisiae, sensing of hyper osmolarity in the environment is mainly facilitated through the high osmolarity glycerol (HOG) mitogen activated protein (MAP) kinase cascade pathway [44] (Fig. 1.1). Three proteins, Slnlp, Sholp, and Msb2p have been identified as putative osmosensors for the HOG MAP kinase cascade pathway [46-48]. Unlike most sensors, osmosensors do not act as receptors for ligands, but seem to be involved in sensing physico-chemical changes [49]. Osmosensors either sense the external water activity, or sense resulting changes in cell structure due to changes in the environment [50]. All three proteins are located in the plasma membrane [48,51,52]. The HOG MAP kinase cascade pathway consists of two main branches, the Slnlp and the Sholp(-Msb2p) branches. These two branches relay their signals independently from each other to converge on the MAP kinase kinase (MAPKK) Pbs2p (Fig. 1.1). Pbs2p also acts as a scaffold protein for this MAP kinase cascade [46]. Scaffold proteins ensure specificity to prevent inadvertent activation of other sensing/MAP kinase cascade pathways due to osmotic stress, since some proteins in the Sholp(-Msb2p) branch is shared with other MAP kinase cascade pathways [53]. 1.4.1 Slnlp branch The Slnlp is somewhat different from other sensor proteins in S. cerevisiae. It is active during low (hypo) osmolarity (high turgor pressure) and is switched off during high (hyper) osmolarity (low turgor pressure) to allow activation of the HOG MAP kinase cascade pathway [54]. The Sholp branch, on the other hand, does not seem to sense turgor pressure [54]. It seems that Slnlp senses cell swelling caused by hypo-osmolarity and that its activation depends on the balance between hyper- and hypo osmolarity. Slnlp is the only histidine kinase in the S. cerevisiae proteome and is part of a "two-component" phosphorelay 11 system, which is more commonly found in prokaryotes [49, 55, 56]. This protein consists of four distinct domains; two transmembrane domains located in the N-terminal region are connected through a linker region to the histidine kinase domain, followed by the receiver domain or also known as the response regulator domain [57]. 12 High osmolarity environment TRANSCRIPTIONAL ACTIVATION OF OSMOTIC STRESS GENES Fig. 1.1 The HOG MAP kinase cascade pathway senses high osmolarity. Solid lines indicate either activation (|) or repression (-p) and dotted lines indicate movement of proteins between cellular compartments (Modified from 49). 13 Unlike prokaryotic two-component systems where the histidine kinase domain is located on a membrane bound protein and the receiver (response regulator) domain is located on a second protein, Slnlp contains both domains [56, 57]. Indeed, it seems that all eukaryotic "two-component systems" seem to contain both the histidine kinase and the receiver domains on the same protein [49]. Slnlp phosphorylates Ypdlp which in turn phosphorylates Ssklp (Fig. 1.1). Together these three proteins act as a phosphorelay system. The phosphorylation of Ssklp by Ypdlp prevents Ssklp from phosporylating two redundant MAP kinase kinase kinase (MAPKKK) proteins, Ssk2p and Ssk22p, and therefore activation of the HOG pathway (Fig. 1.1) [47, 58-61]. This "switching off of the Slnlp sensor is supported by the fact that deletion of SLN1 or YPD1 is lethal, since it results in over activation of the HOG MAP kinase cascade pathway [47]. During hyper osmotic shock when Slnlp is deactivated, dephosphorylated Ssklp activates Ssk2p and Ssk22p by binding both proteins, which in turn phosphorylate themselves and Pbs2p [47, 61-63]. In hypo-osmotic stress Slnlp-Ypdlp act as a phosphorelay to phosphorylate and activate Skn7p-dependent transcription [59, 64]. This seems to occur through the shuttling of phosphorylated Ypdlp between the nucleus and cytoplasm [65]. Skn7p regulates several cellular functions in response to cell swelling and hypo-osmotic stress [64, 66]. In addition, SKN7 has been implicated in oxidative stress, cell cycle control, cell wall metabolism and heat shock [66-69]. It should be noted that it is not just Slnlp that regulate Skn7p function, sensing pathway like the cell wall integrity pathway regulate Skn7p function as well [70]. 1.4.2 Sholp(-Msb2p) branch The second branch consists of a membrane protein Sholp that transmits its signal via a complex formed with the G-protein Cdc42p and its exchange factor Cdc24p, and two 14 proteins Ste20p and Ste50p [51, 71](Fig. 1.1). This branch seems to monitor osmotic stress during cell expansion and growth [51,71], which is supported by the fact that Sholp localize to areas where active growth occurs [51, 71]. Furthermore, it seems that the Sholp branch is less sensitive to external osmolarity changes than the Slnlp branch [62]. The Sholp consists of four transmembrane domains in its N-terminal region linked via a linker domain to its SH3-domain located in its C-terminal region. The transmembrane domains are responsible for anchoring Sholp in the plasma membrane whereas the SH3-domain acts as a protein interaction domain [46, 71]. The SH3 domain seems to be responsible for recruiting Pbs2p to the cell membrane since its removal does not influence sensing, as long as the Pbs2p is covalently linked to Sholp [71]. This has lead to the suggestion that Sholp is not the sensor in this branch, but merely the anchor protein [49, 71]. During osmotic shock, Sholp translocates to areas of cell growth and initiates a complex formation at the cell surface by recruiting Pbs2p [51, 71]. This localization and complex formation is rapid and transient [51]. This complex also contains the G-protein Cdc42p, its exchange factor Cdc24p as well as Ste50p, Ste20p and Stel lp for signalling [46, 51, 71, 72]. This complex formation leads to the activation of Ste20p and subsequent phosphorylation of the MAPKKK Ste lip which phosphorylates Pbs2p [49]. Interestingly, some of these proteins (Ste20p, Ste50p, Stellp, Cdc24p, and Cdc42p) are also utilized in signal transduction pathways for mating response, pseudohyphal growth and cell wall integrity [49]. The reason for the sharing of components could be due to the fact that the Sholp branch senses osmotic changes during growth, which would require adjustments in the cell wall structure such as shmoo formation. Upon phosphorylation of the MAPKK Pbs2p, Pbs2p phosphorylates the MAPK Hoglp [44, 47, 73, 74]. Activated Hoglp then translocates into the nucleus where it activates transcription of approximately 150 genes [73, 75, 76]. This translocation of phosphorylated Hoglp can occur within one minute after osmotic shock [73]. 15 1.4.2.1 Msb2p sensor. The possibility of a third sensor was proposed due to cross talk between the pheromone and HOG MAP kinase cascade pathways [72]. Exposure of hog I or pbs2 mutants to high osmolarity activates the pheromone response pathway. This cross talk was prevented by deletion of STE11, but only partially by deletion of SHOl. Since Sholp functions upstream of Stel lp, other protein(s) upstream of Stel lp, but independent of Sholp, are probably also sensing osmotic stress. The MSB2 gene was identified in a genetic screen searching for a third sensor. Deletion of MSB2 reduced the residual signalling to the pheromone responsive gene promoter of FUS1 in a hoglshol mutant [48]. The role of Msb2p in osmosensing is further supported by the fact that deletion of MSB2 results in reduced fitness when grown in 1 M NaCl [77]. The importance of this third sensor remains to be seen and is most likely minor since it was identified much later than Sholp and Slnlp. 1.4.3 Feedback control of the HOG MAP kinase cascade Upon phosphorylation of its threonine (T174) and tyrosine (Y176) residues, Hoglp translocates to the nucleus to activate transcription in response to osmotic shock/stress [73, 74]. However, this translocation of Hoglp to the nucleus is transient [73, 78, 79]. When yeast is exposed to mild osmotic stress phosphorylated Hoglp enters the nucleus sooner, but resides in the nucleus for a shorter time period before exiting to the cytoplasm. During exposure to severe osmotic stress, Hoglp takes longer to enter the nucleus to activate transcription, but also stays in the nucleus for a longer time [49]. Of the six identified tyrosine phosphatases in S. cerevisiae, Ptp2p and Ptp3p are known to dephosphorylate Hoglp [80]. The over expression of PTP2 and PTP3 suppresses the lethal phenotype of hyperactive or constitutively activated Hoglp [80, 81]. This transient localization of Hoglp to the nucleus, suggests that dephosphorylation of Hoglp might be responsible for exporting it back to the cytoplasm [78, 79]. On the contrary, it seems that the 16 physical interaction between Ptp2p and Hoglp tethers Hoglp in the nucleus [82]. Ptp2/3p might regulate Hoglp through direct binding rather than by dephosphorylating Hoglp. Localization studies indicated that Ptp2p is predominantly in the nucleus whereas Ptp3p is present in the cytoplasm [83]. Due to its localization, Ptp2p binds and dephosphorylates Hoglp more efficiently than Ptp3p. Contradictory data have been reported on the transcriptional regulation of PTP2 and PTP3 by Hoglp [80, 81]. Its seems that the activation of PTP2 and PTP3 transcription to produce Ptp2/3p to regulate phosphorylation levels of Hoglp, may act as a feed back loop to regulate HOG MAP kinase cascade regulated expression [81]. In addition to the two tyrosine phosphatases, three protein serine/threonine phosphatases Ptclp, Ptc2p and Ptc3p are also known to negatively regulate the HOG MAP kinase cascade pathway by dephosphorylating active Hoglp and possibly Pbs2p as well [84]. Ptclp seems to be the major phosphatase dephosphorylating Hoglp at the Thrl74 residue. Like Ptp2p, Ptclp is located in nucleus and the cytoplasm. Deletion of PTC1 causes constitutive phosphorylation of Hoglp, whereas over expression of PTC1 and PTC3 suppresses the lethal phenotype of over activated Hoglp. 1.4.4 Regulation of transcription during osmotic stress Several transcription factors (Msnlp, Hotlp, Skolp, Smplp and Msn2p and Msn4p) have been shown to regulate gene expression in a HOG MAP kinase cascade dependent manner [49, 75, 79, 85, 86]. In addition genetic and gene expression data revealed that Sgdlp and Gcn4p are also responsible for Hoglp-dependent transcription [79, 87, 88]. Hoglp-dependent transcriptional activation occurs through different mechanisms for the individual transcription factors. Phosphorylation of Smplp will directly activate transcription, whereas phosphorylation of Skolp will convert Skolp from a repressor to an activator [89]. Phosphorylation by Hoglp is not necessarily required for activation of 17 transcription, such as in the case of Hotlp. These transcription factors each mediate HOG-dependent transcription to a subset of genes. Hoglp is also responsible for recruiting the histone deacetylase encoded by RPD3 to active transcription in response to osmotic stress [90]. 1.4.4.1 Hotl protein. The "High Osmolarity induced Transcription" protein (Hotlp) was identified in a two-hybrid screen for proteins that interact with Hoglp [79]. Its involvement in osmotic stress response was confirmed through deletion of the HOT] gene, which partially rescues the lethality caused by over activation of the HOG MAP kinase cascade pathway [79]. Hotlp shares homology with two other transcription factors Gcrlp and Msnlp. These three proteins share homology in a domain predicted to form a helix-loop-helix, which functions as a DNA-binding domain [49]. However, the DNA-binding site for Hotlp is not yet known [49]. Although Hotlp has been implicated in the transcriptional activation of only a few osmotic stress response genes thus far, is seems to be quite important for osmoadaptation, since its deletion cause osmosensitivity [49,75,79,91]. This osmosensitivity is most likely due to severely diminished expression of GPD1 and GPP2 in the hotl mutant [79]. Other known targets for Hotlp include STL1 a sugar transporter-like protein, possibly the most responsive gene to osmotic stress, as well as CHAI, PH084, CTT1, HSP26 YGR043C, YGR052W, and YHR087W [49,75,79,91]. In the case of GPD1 expression, Hotlp seems to be bound to the GPD1 promoter regardless of the osmolarity in the environment [91]. It seems that Hotlp is nuclear in both normal and osmotic stress conditions [79]. The amount of Hotlp that binds to the promoter of GPD1 when exposed to high osmolarity increases. Hotlp will only bind to the promoters of STL1, CTT1 and HSP26 after exposure to osmotic shock. Hotlp requires Hoglp to bind to the promoters of STL1, CTT1 and HSP26, but Hotlp binding to the GPD1 promoter is independent of Hoglp. Although Hoglp phosphorylates Hotlp, the phosphorylation is not required for Hotlp 18 transcriptional activation in response to osmotic stress [92]. Rather, Hotlp recruits Hoglp to the respective promoters, which in turn recruits the RNA Pol II holoenzyme complex for transcription. 1.4.4.2 Skol protein. Gene regulation in response to osmotic stress does not only involve transcriptional activation, but also involves relief of transcriptional repression of some genes [93]. Hoglp deactivates Skolp, a transcriptional repressor of some osmoresponsive genes, in response to osmotic shock [94]. The SKOl gene was identified in two separate genetic screens. Both screens centred around the role of cAMP-protein kinase A (PKA) pathway, and not the HOG MAP kinase cascade pathway, and its effect on regulation [95,96]. The cAMP-PKA pathway, in addition to its other functions (discussed later), regulates transcription via binding of cAMP response elements (CRE) situated in the promoters of cAMP regulated genes. CRE-elements are bound by transcription factors called CRE-binding (CREB) proteins such as Skolp [97]. The first study identified a gene ACR1 (SKOl) [95]. The second genetic screen identified SKOl as a repressor of the GAL1 promoter [96]. PKA regulates Skolp through phosphorylation of three different amino acids: Ser380, Ser393 and Ser399 [94]. High levels of PKA activity are required for translocation of Skolp to the nucleus [98]. Therefore during osmotic stress when PKA activity is low, Skolp will translocate from the nucleus to the cytoplasm [98]. Deletion of SKOl also partially relieves the hogl mutant's sensitivity to osmotic stress, indicating that Skolp acts down-stream of Hoglp [85]. Co-immunoprecipitation studies have shown that Hoglp interacts directly with Skolp [94]. It seems that HOG MAP kinase cascade pathway regulates SKOl activity and its binding to CRE-elements as well [85,88,99]. By interacting with Skolp, Hoglp deactivates repression by phosphorylating the Ser 108, Thrll3 and Serl26 amino acid residues of Skolp [94]. Hoglp will phosphorylate Skolp, which is bound to the promoters of genes such as HAL1 and ENA1 [85,88]. Upon 19 phosphorylation of Skolp, repression of HAL1 and ENA1 is relieved allowing expression during osmotic stress. Both HAL1 and ENA1 are involved in ion homeostasis especially during salt induced osmotic stress [100,101]. The repression activity of Skolp requires involvement of the SSN6-TUP1 general repressor complex [93]. Interestingly, it seems that the phosphorylation of Skolp by Hoglp converts the Skolp-Ssn6p-Tuplp complex into an activator complex by recruiting the SWI/SNF and SAGA complexes, at least for transcriptional regulation of the CRE2 and AHP1 genes [89]. 1.4.4.3 Msnl protein. Msnlp was not initially identified as a transcription factor that is involved in the regulation of osmotic stress genes [102]. MSN1 was first identified in a genetic screen as a multi-copy suppressor of the snfl mutant's inability to grow on carbon sources other than glucose. Msnlp is involved in the transcriptional regulation of genes involved in several biological processes including the response to a variety of stress conditions. Furthermore, genetic screens for mutants in pseudohyphal growth and iron limitation identified MSN1 as PHD2 and FUP1 respectively, when grown in raffinose [103]. Over expression of MSN1 also suppresses the snfl haploid mutants inability to grow invasively in low glucose environments [104]. In addition, the pseudohyphal growth defect caused by the deletion of two ammonium transporters, MEP1 and MEP2, is also suppressed by over expression of MSN1 [105]. The role of Msnlp in osmotic stress is somewhat unclear, but its deletion causes a reduction in expression of classical osmotic stress responsive genes such as GPD1, GPP2, CTT1 and STL1 [49]. Nevertheless its role in osmotic stress seems to be minor [49]. 1.4.4.4 Smpl protein. The Smplp was isolated in a genetic screen using a two-hybrid system to screen for candidates that interact with Hoglp [106]. Deletion of SMP1 causes an increased osmosensitivity and resulted in reduced expression of lacZ when driven by the 20 STL1 and CWP1 promoters (both induced by osmotic stress). This suggests that Smplp acts as a transcriptional activator. However, transcription driven by the promoters from other well-known osmotic stress-induced genes, ALD3 and HXT1, was not affected. It therefore seems that Smplp acts as a transcriptional activator for only a subset of osmotic stress regulated genes. This regulation is, however, Hoglp-dependent; Hoglp phosphorylation of Smplp is essential for its function [106]. In addition to its role during osmotic stress, SMP1 is also required for cell viability in a Hoglp-dependent manner during stationary phase. 1.4.4.5 Sgdlp protein. SGD1, an essential gene, encodes for a nuclear protein that was identified as "Suppressor of Glycerol Defect" [87]. Osmosensitivity caused by deletion of PBS2 and HOG1 is partially relieved by over expression of SGD1 [87]. The cellular localization of Sgdlp is not affected by osmolarity and the protein remains in the nucleus with enriched concentrations in the nucleolus. Although Sgdlp is required for GPD1 expression, no direct evidence have been generated yet to show that Sgdlp binds the promoter of GPD1 or any other osmo-responsive gene [87,107]. 1.4.4.6 Gcn4 protein. The GCN4 gene encodes a transcriptional activator that is associated with general amino acid control [108]. However, recent data implicate this transcription factor in the regulation of HAL1 expression [88]. In normal conditions the Skolp repressor will bind to the CRE cw-acting element in the HAL1 promoter, but during osmotic stress Gcn4p binds to the same element and activates transcription of HALl in a HOG-dependent manner. Activation of the HOG MAP kinase cascade pathway inhibits the Skolp's repression activity allowing Gcn4p to bind to the site previously occupied by Skolp. Furthermore, deletion of GCN4 results in osmosensitivty in both salt (NaCl and KC1) and sorbitol induced osmotic stress [88]. Future research will determine to what extent GCN4 is involved in the osmotic stress response. 21 1.4.5 cAMP-PKA pathway regulates stress responsive genes Although the HOG MAP kinase cascade is the main signal transduction pathway for sensing osmotic stress, the cyclic AMP (cAMP)-dependent protein kinase A (PKA) pathway also contribute to the transcriptional regulation of some genes in response to osmotic stress [109]. The cAMP-PKA pathway plays a central role in the cell, regulating genes in response to nutrient availability and stress in general including oxidative stress, heat stress, nutrient starvation, intracellular acidification and ethanol stress [49, 110, 111]. Furthermore, the cAMP-PKA pathway also known as the RAS-cAMP pathway, is involved in the initiation of the cell cycle, growth rate, sporulation and the ability of yeast cells to form pseudohyphae [110,112,113]. It seems that the cAMP-PKA pathway is involved in coordinating several core biological processes to allow the yeast to mount an appropriate response to a particular stimulus. Therefore, regulation of genes by PKA in response to osmotic stress is due to its role in regulating stress responsive genes in general, and not necessarily to osmotic stress specifically [11,12]. The main components of the cAMP-PKA pathway have been identified (Fig. 1.2) [110]. The Iralp and Ira2p negatively regulate RAS GTPase activity in response to cytoplasmic acidification, heat shock and nitrogen starvation [114]. The RAS1 and RAS2 genes encode for G-protein-like proteins that activate adenylate cyclase encoded by the CYR1/CDC35 gene with SRV2 encoding for the adenylate cyclase associated protein (CAP1) (Fig. 1.2) [115-117]. Adenylate cyclase converts AMP into cAMP, a strong and potent signalling molecule [49,115]. The addition of glucose to cells grown on a non-fermentable carbon source activates adenylate cyclase through activation of a G-protein coupled receptor (GPCR), encoded by GPA2, by Gprlp [110]. The Gprlp-Gpa2p branch seems to function separately from the RAS G-protein branch. Several other membrane bound sensors have also been implicated to 22 provide signal input into the cAMP-PKA pathway to regulate cellular processes. This includes the Mep2p ammonium permease that senses ammonia and the amino acid sensing complex Ptr3p-Ssylp-Ssy5p [118,119]. An increase in cAMP levels causes an increase in PKA activity [49,110]. PKA consists of four proteins encoded by TPK1, TPK2, TPK3 and BCY1 (Fig. 1.2). TPK1/2/3 encode for subunits containing the catalytic subunits of PKA, whereas BCY1 encode for the regulatory subunit of PKA [112,120]. cAMP activates PKA by binding Bcylp causing its dissociation from the PKA (Tpkl,2,3p/Bcylp) complex (Fig. 1.2). This negative regulatory function of Bcylp is supported by the fact that deletion of BCY1 results in elevated levels of active PKA [115]. The cAMP-PKA pathway is also subject to feedback inhibition [110]; cAMP levels are regulated by PKA exerting strong feedback inhibition on adenylate cyclase or by converting cAMP back to AMP. Two phosphodiesterases encoded by PDE1 (low affinity) and PDE2 (high affinity) hydrolyse cAMP to AMP [121,122]. The increase in cAMP levels due to acidification tends to be more long lasting, whereas glucose addition causes a more transient spike [110]. This probably reflects the requirement of having active PKA for different time periods, depending on the situation. High levels of cAMP-PKA activity activate biological processes such as glycolysis, growth rate and progression through the cell cycle [110]. On the other hand, high PKA activity represses genes involved in response to stress adaptation, sporulation and metabolic pathways such as gluconeogenesis and the tricarboxcylic acid (TCA) cycle. The cAMP-pathway does not just target transcriptional regulation, but the activity of some proteins is also activated or inhibited by either lack or presence of high PKA activity [110]. 23 External environment STRE-dependent gene expression Fig. 1.2. The cAMP-PKA pathway regulates STRE-dependent gene expression. Solid lines indicate activation (|) or repression (-p) and dotted lines indicate movement of proteins between cellular compartments . 24 The cAMP-PKA pathway regulates the cellular localization of two transcription factors, Msn2p and Msn4p [123]. MSN2 and MSN4 were initially identified as "multicopy suppressors of snfl" [124]. Over expression of these two genes allows growth of a snfl mutant in non-fermentable carbon sources [124]. Snflp is required for the derepression of many genes when the glucose concentration is low. Although these two transcription factors are redundant, Msn2p seems to have a stronger phenotype, indicating that Msn2p might be the major contributor to transcriptional activation [125]. In favourable environmental conditions, the cAMP-PKA pathway is responsible for the phosphorylation of Msn2/4p promoting the export of these two transcription factors from the nucleus to the cytoplasm [123]. The export of Msn2/4p requires the nuclear export receptor protein Msn5p [126]. However, it is not known if the phosphorylation of Msn2/4p is directly done by PKA [49]. When yeast is exposed to osmotic stress, heat shock or carbon source starvation, Msn2/4p translocates to the nucleus to activate transcription of genes containing stress response elements (STRE) [127]. STRE contain a core of five nucleotides consisting of 5'-CCCCT-3' [111, 128]. Msn2/4p bind these STREs with Cys2His2 zinc finger to activate transcription. This translocation seems to be inversely correlated to PKA activity, suggesting that PKA regulates Msn2/4p cellular localization [123]. Therefore, the transcriptional activation of Msn2/4p is regulated through controlling the cellular localization of Msn2/4p. This is supported by the nuclear localization of Msn2/4p during favourable conditions in mutants that have reduced PKA activity [123]. The dephosphorylation of Msn2/4p is possibly done by the membrane bound Whi2p-Psrl/2p complex [129]. PSR1 and PSR2 encode for two phosphatases [130]. In whi2 and psrlpsr2 mutants, STRE regulated gene expression is reduced causing a defective general stress response and both mutants are heat and osmo sensitive. It is not yet known how the activity of the Whi2p-Psrl/2p complex is regulated. In addition to PKA, SrblOp, a cyclin-25 dependent kinase and part of the mediator complex of RNA holoenzyme II, also phosphorylates Msn2p [126]. Consistent with this is the fact that when SRB10 is deleted, general stress response genes are constitutively activated [131]. It is possible that SrblOp phosphorylates Msn2/4p under optimal environmental conditions and target them to the cytoplasm where PKA maintains the phophorylated state of Msn2/4p until the onset of stress. When exposed to stress, Psrl/2p will dephosphorylate Msn2/4p allowing translocation to the nucleus for transcriptional activation. In addition to the cAMP-PKA pathway, the HOG MAP kinase cascade pathway seems also to influence Msn2/4p-dependent transcription during osmotic stress [75]. The high correlation of genes whose transcription is reduced in a hogl mutant as well as a msn2msn4 mutant when exposed to osmotic stress, has lead to the suggestion that Hoglp might regulate Msn2/4p [75]. Although Hoglp does not affect the cellular localization of Msn2/4p during osmotic stress, Hoglp was found to be required for STRE-dependent transcription [127]. Two such STRE-genes are the CTT1 and HSP26 genes, both are regulated by Msn2/4p but require Hoglp and Hotlp for expression in response to variety of stresses [91]. 1.4.6 T O R kinases regulate M s n 2 / 4 p mediated t ranscr ip t ion Msn2/4p regulated transcription is controlled by the two TOR (target of rapamycin) kinases Torlp and Tor2p [132]. TORI and TOR2 were identified as mutants that are resistant to rapamycin, an immunosuppressant drug, that acts specifically on the TOR kinases [132-134]. Torl/2p contains several functional domains including a FRB domain that interacts' with the prolyl isomerase FKBP12p. Torl/2p also share homology with phosphatidylinositol-3 kinases with a putative lipid kinase domain located on the C-terminal side of the FRB-domain [134]. Rapamycin binds Fkbpl2p, which then binds Torl/2p, thereby inhibiting Torl/2p function. Resistance to rapamycin is not related to gene expression, since deletion of either TORI or TOR2 does not cause resistance [133]. 26 However, mutations in the FRB-domain of TORI and TOR2 cause the yeast to become resistant to rapamycin. Like the cAMP-pathway, Torl/2p (TOR) control a large number of biological functions. Active TOR promotes initiation of translation, active transcription of ribosomal protein genes, tRNA and ribosome biogenesis, and regulates actin organization. TOR also represses transcription of NCR regulated genes, inhibits nutrient permease turnover, autophagy, and entry into stationary phase [135-139]. TOR also controls inputs into the protein kinase C signalling pathway [139]. The addition of rapamycin (i.e. TOR inhibition) to wild type cells represses transcription of ribosomal protein genes, induces genes regulated by NCR, and blocks progression of the cell cycle [135,137,140]. The regulation of translation and repression of NCR genes by TOR acts through the inhibition of the type-2A protein phosphatase Sit4p [140,141]. Sit4p is inhibited by TOR through binding of Tap42 to Sit4p (Fig. 1.3) [141]. Treatment of cells with rapamycin also activates transcription of Msn2/4p regulated genes such as HSP26, CTTJ, and SSA3 [135]. Msn2/4p localize to the nucleus in response to rapamycin treatment [140]. TOR seems to act through the 14-3-3 proteins Bmhlp and Bmh2p. Over expression of BMH1 or BMH2 confers rapamycin resistance and through co-immunoprecipitation experiments Msn2/4p was found to interact with Bmh2p [140,142]. Rapamycin treatment seems to release Msn2/4p from Bmh2p, in the cytoplasm, allowing translocation to the nucleus [140]. It seems that TOR regulates Msn2/4p cellular localization through Bmhl/2p. 27 C/N abundance Ribosome biogenesis Stress response Stress conditions NUCLEAR MEMBRANE ^ R t g 3 ^ ^ ^ G l n 3 ^ NCR gene expression TCA cycle gene expression 0 ( RIm15 J STRE-dependent gene expression Stationary phase Fig. 1.3 TOR regulates Msn2/4p through the cAMP-PKA pathway. Solid lines indicate activation (|) or repression (-[-) and dotted lines indicate movement of proteins. 28 Recently, TOR was implicated to function upstream of the cAMP-PKA pathway to control Msn2/4p regulated transcription [143]. Over activation of the cAMP-PKA pathway causes rapamycin resistance and it blocked the TOR associated rapamycin phenotypes, except for cellular events that have been identified to be regulated through Tap42p/Sit4p (Fig. 1.3). It seems that TOR might act on the cAMP-PKA independent from Tap42/Sit4p. It is not sure how TOR regulates Msn2/4p via the cAMP-PKA pathway though. Does TOR, via PKA, prevent dissociation of the Bmh2p-Msn2/4p complex or does it prevent translocation to the nucleus? (Fig. 1.3). In addition to the combinatorial regulation of Msn2/4p by PKA and TOR, the protein kinase Riml5p is also negatively regulated in conditions of nutrient abundance [144] (Fig. 1.3). The Riml5p kinase is responsible for establishing stationary phase [144, 145]. It seems that TOR and PKA control growth rate and coordinate biological processes so that when exposed to stress, PKA and TOR activity decrease allowing Riml5p to initiate entry into stationary phase (Fig. 1.3). 1.5 Adaptation of S. cerevisiae to osmotic stress Scientists have used NaCl and sorbitol as osmolytes to study the adaptation of S. cerevisiae to high osmolarity. These compounds were preferred since they are not consumed by S. cerevisiae thereby ensuring constant osmotic stress to study the sensing and adaptation of S. cerevisiae to high osmolarity. However, increasing concentrations of sodium ions in the environment are toxic to yeast cells. This may lead to the interpretation of a sodium toxicity specific response as an osmotic stress response. Furthermore, wine yeast seldom, if ever, encounters high concentrations of either NaCl or sorbitol during wine making. On the other hand, wine yeast inevitably finds itself in the presence of high concentrations of sugars (glucose and fructose) in grape must that bind free water and increase the osmolarity. Since 29 S. cerevisiae is found in nature on rotting fruits where it encounters high sugar concentrations, S. cerevisiae has most likely adapted to osmotic stress-induced by high sugar concentrations rather than high salt or sorbitol. Only cells that are able to adapt to this high osmolarity environment, would have survived. S. cerevisiae has developed strategies to survive osmotic stress; this yeast produces increased amounts of glycerol as compatible solute and the production and degradation of trehalose and glycogen is up-regulated (Fig. 1.4) [75, 76, 146]. 1.5.1 Glycerol metabolism Glycerol fulfills in a number of important cellular functions; it is a non-fermentable carbon source, acts as a precursor for phospholipid biosynthesis, maintains the redox balance under anaerobic conditions and acts as a compatible solute during osmotic stress [147-151]. Adaptation of S. cerevisiae to high osmolarity requires the production of a compatible solute. A compatible solute functions by increasing the intracellular osmolarity, lowers the water activity in the cell, and thereby prevents the efflux of water from the cell and the inflow of water into the cell, without affecting biological functions. Although other organisms, including other fungi, can utilize several other compounds (amino acids, other sugar alcohols etc.) as compatible solutes, S. cerevisiae seems to use only glycerol [152,153]. However, S. cerevisiae strains genetically engineered to produce sugar alcohols such as xylitol, mannitol and sorbitol was able to utilize these compounds as compatible solutes in the place of glycerol [154]. Fig. 1.4 Glycolysis in S. cerevisiae and the formation of glycerol, glycogen, trehalose and acetic acid from intermediates in the glycolytic pathway. 31 In the absence of glucose, S. cerevisiae will use glycerol as a carbon source [155]. The first step is catalyzed by glycerol kinase, encoded by the GUT1 gene, which phosphorylates glycerol to form glycerol-3-phosphate (Fig. 1.4). Glycerol-3-phosphate is then converted to dihydroxyacetone phosphate by a mitochondrial linked glycerol-3-phosphate dehydrogenase (Gut2p) encoded by the GUT2 gene. The reaction catalyzed by Gut2p coincides with the concomitant reduction of FAD + to FADH, which is then re-oxidized by the electron transport chain in the mitochondria during respiratory aerobic growth [155]. It seems that this pathway is the main way of utilizing glycerol as a carbon source since mutants defective for either Gutlp or Gut2p cannot use glycerol as a carbon source [156, 157]. During fermentative and anaerobic metabolism yeast does not use oxygen as the terminal electron acceptor for re-oxidation of the excess NADH formed during metabolism. To re-oxidize the excess NADH, S. cerevisiae produces glycerol from dihydroxyacetone phosphate, an intermediary product of glycolysis (Fig. 1.4). The key enzyme in the process of glycerol formation is a NADH-dependent glycerol-3-phosphate dehydrogenase encoded by two isogenes GPD1 and GPD2 [158-162]. Deletion of both GPD1 and GPD2 results in a mutant that is unable to produce glycerol [159]. This enzyme converts dihydroxyacetone phosphate to glycerol-3-phosphate with the concomitant oxidation of NADH to NAD+ [153, 158, 159]. Glycerol-3-phosphate is then converted by glycerol-3-phosphatase to glycerol with the release of phosphate. Glycerol-3-phosphatase is also encoded by two isogenes GPP1 and GPP2 [163]. The isogenes for this two-step pathway are regulated differently and fulfill different roles in the metabolism of the yeast. GPD2, with GPP1, are responsible for maintaining the redox-balance, especially during anaerobic conditions [159, 164, 165]. In contrast, GPD1 and GPP2 respond to osmotic shock/stress and are required for glycerol formation as compatible solute [79, 158, 159]. 32 The osmotolerant yeast Zygosaccharomyces rotaii exhibits both a glycerol dehydrogenase and dihydroxyacetone kinase activity that are stimulated by osmotic stress [166]. Glycerol dehydrogenase activity gradually increases, whereas dihydroxyacetone kinase activity exhibits a transient effect peaking during the first hour after osmotic upshift that decreases during the second hour to a level prior to the onset of the osmotic upshift. As in the case of S. cerevisiae, Z. rouxii accumulates glycerol as compatible solute. Norbeck and Blomberg (1997) identified two genes, GCY1 and DAK1, that were both induced by osmotic stress. GCY1 has substantial similarity to a NADP+-dependent glycerol dehydrogenase from Aspergillus niger [164], and DAK1 has a high homology to the biochemically characterized dihydroxyacetone kinase from Citrobacter freundii. With no transdehydrogenases identified in S. cerevisiae thus far, the presence of GCY1 and DAK1 has led to the hypothesis that the formation of glycerol together with its degradation via dihydroxyacetone (DHA) acts as a transdehydrogenase cycle [167, 168]. One molecule of NADH is converted to NAD+ by Gpdlp, followed by the formation of NADPH from NADP+ by Gcylp when glycerol is converted to DHA (Fig. 1.4). Both GCY1 and DAK1 have homologs in the genome of S. cerevisiae. These two isogenes, YPR1 and DAK2, share 65% and 44% homology with GCYJ and DAK1, respectively. In addition to acting as a transdehydrogenase cycle, Blomberg (2000) proposed that dissimilation of glycerol via DHA may act as an ATP futile cycle to prevent substrate accelerated death (discussed later), since DAKl/2p will consume one ATP [169]. In addition to possibly completing the ATP futile cycle, Daklp and Dak2p have also been implicated to lower DHA concentrations, since DHA is highly toxic to yeast cells [170]. However, DHA toxicity seems to be dependent on the carbon source. Galactose grown cells are highly sensitive to DHA, whereas the addition of glucose to galactose grown cells or glucose grown cells are resistant to even high levels of 0.2 M DHA [170]. 33 1.5.1.1 Transcriptional regulation of GPD1 and GPP2. Deletion of GPD1 results in a mutant that is unable to grow in conditions of high osmolarity, regardless of the osmolyte used [158]. However, the over expression of GPD1 does not increase a cell's resistance to osmotic stress [158]. The transcriptional regulation of GPD1 has been studied in some detail but transcription of GPP2 has not been studied that well. This is most likely due to the fact that GPD1 encodes for the key enzyme in glycerol production during osmotic stress conditions [158]. Induction of GPD1 and GPP2 in response to osmotic stress, seems to follow a transient response that peaks at levels as high as 50-fold higher than expression levels during optimal growth conditions. After the transient spike, transcript levels decreases to about two- to ten-fold in cells that have adapted to the high osmolarity [158,161,163,164]. Osmotic stress-induced expression of GPD1 and GPP2 increases as the severity of the osmotic stress increases [78]. The addition of 0.5 M NaCl induces the expression of GPD1 and GPP2 within a few minutes; induction lasts for about 60 minutes. Addition of higher salt concentrations (1.0 M NaCl) causes a delayed (30-60 minutes), but greater transcriptional response by GPD1 and GPP2 that seems to be sustained for a longer period of time (2-3 hours) [78]. Induction of GPD1 in response to osmotic stress requires the MAP kinase Hoglp [158]. The binding of the GPD1 promoter by Hoglp, however, requires the transcriptional activators Hotlp and Msnlp. This is supported by the reduced glycerol formation in a hotl mutant during osmotic stress [79]. The msnl mutant seems to confer salt sensitivity rather than osmosensitivity since it is not sensitive to osmotic stress-induced by using sorbitol [79]. Unlike Hoglp, which translocates to nucleus in response to osmotic stress, Hotlp is constitutively bound to the GPD1 promoter, but the amount of Hotlp that binds to the promoter of GPD1 increases in response to osmotic stress [91]. The binding of Hotlp to the GPD1 promoter is not affected by the absence of Msnlp. 34 The GPD1 promoter also contains four STRE elements [149] suggesting that Msn2/4p may be involved in regulating GPD1 expression as well. However, Hoglp association with the GPD1 promoter is not affected in a msn2msn4 double deletion mutant [91]. These data are supported by the fact that altered PKA activity does not influence Gpdlp and Gpp2p protein levels in cells adapted to an osmotic stress environment [109]. However, Msnlp, Msn2p and Msn4p seem to be required for the induction of GPD1 in response to heat shock [79]. It seems that these four STRE elements function in response to heat shock and not osmotic stress. Furthermore, the GPD1 promoter also contains three Raplp binds sites in its promoter. Deletion of these sites causes insufficient basal level and osmotic stress-induced expression of GPDL Indeed, gel mobility shift assays have shown that Raplp binds these promoter regions of GPD1 regardless of the degree of osmotic stress [171]. 1.5.2 Role of trehalose and glycogen in adaptation to stress Trehalose is found in yeast, fungi, bacteria and plants but not in vertebrates [172-176]. Trehalose functions as a stress protectant during heat stress and apparently also under severe osmotic stress conditions such as desiccation and freezing [30,173,174,177-179]. Trehalose fulfills in this function by stabilizing cell membranes and increasing the thermal stability of proteins [180,181]. Glycogen serves as a storage carbohydrate not only in S. cerevisiae, but also in higher eukaryotes. In addition, this polysaccharide has also been suggested to be involved in maintaining cell viability during chronological aging [182]. Both trehalose and glycogen accumulate in resting or slow-growing yeast cells [183-186]. Trehalose and glycogen start to accumulate when the Gl phase is prolonged for longer than 5 hours [184]. The accumulation of these two reserve carbohydrates in the Gl phase seems to be C7JV3-dependent. The Cln3/Cdc28 kinase complex regulates the duration of the Gl phase [187]. 35 Trehalose, and to a lesser extent glycogen metabolism, will be discussed due to their role in stress protection and adaptation to stress in general, including osmotic stress. The regulation of trehalose and glycogen metabolism occurs both at transcriptional and post transcriptional level [188]. 1.5.2.1 Trehalose and glycogen metabolism. Trehalose is a non-reducing disaccharide consisting of two glucose molecules linked via an ct(l,l) glycosidic bond. Trehalose is produced by conversion of glucose-6-phosphate to glucose-1-phosphate by phosphoglucomutase (Pgmlp/Pgm2p) and then to UDP-glucose by UDP-glucose pyrophosphorylase (Ugplp) (Fig. 1.4). UDP-glucose and another glucose-6-phosphate molecule is then converted to trehalose-6-phosphate by a complex consisting of four proteins; Tpslp, Tsllp, Tps3p and Tps2p [189,190]. Tpslp contains the trehalose-6-phosphate synthase activity whereas Tsllp and Tps3p are believed to be regulatory or stabilizing subunits [189-192]. Tps2p contains the trehalose-6-phosphate phosphatase activity that dephosphorylates trehalose-6-phosphate to trehalose [193]. Two-hybrid analysis revealed that Tsllp and Tps3p interact with Tpslp and Tps2p, but not with each other [189]. Trehalose is also dissimilated back to glucose by either a vacuolar acid trehalase encoded by ATH1, or by two neutral trehalases encoded by NTH1 and NTH2 [194,195]. Glycogen is a polysaccharide consisting of glucose molecules linked through ot(l,4) and ct(l,6) glycosyl linkages. Glycogen is formed from the glycolytic intermediate glucose-6-phosphate (G-6-P) that is first converted to glucose-1-phosphate (G-l-P) by phosphoglucomutase (Pgml/2p). G-l-P is then converted to UDP-glucose by Ugplp [196] (Fig. 1.4). Glycogen formation is then initiated by glycogenin (Glgl/2p) that autoglycosylates its own Tyr-residues [197]. Elongation, catalyzed by glycogen synthase (Gsyl/2p), occurs through the formation of ot(l,4) chains on the glucose residues attached covalently to Glcl/2p [198]. Two-hybrid analysis suggests that Gsyl/2p are attached to the COOH-terminal of Glgl/2p, and elimination of the COOH-terminal of Glglp impairs 36 glycogen synthase activity [197]. Branching of glycogen occurs through the formation of a(l,6) bonds catalyzed by Glc3p. Degradation of glycogen is catalyzed by the glycogen debranching enzyme (Gdblp) and glycogen phophorylase (Gphlp) into glucose and G-l-P respectively [199]. 1.5.2.2 Stress response through activation of trehalose and glycogen metabolism Exposure of yeast cells to heat, ethanol, hydrogen peroxide, copper sulphate and weak organic acids induces the accumulation of trehalose and glycogen [28, 30, 175]. The response to these stress conditions start with the induction of transcription that is dependent on Msn2/4p [28, 175]. As expected, STRE elements are found in the promoters of TPS1, TPS2, TPSS, TSL1, GLC3, GPH1, and GSY2 [200, 201]. In addition to transcriptional activation by heat stress, the kinetic properties of Tpslp also seem to be enhanced [202]. However, it is not only genes that encode for enzymes facilitating synthesis (of trehalose and glycogen (TPS1, TPS2, TPS3, TSL1 GLG1, GSY1, GSY2, and GLC3), but also genes encoding for the dissimilation of trehalose ad glycogen (NTH1, ATH1, and GPH1) that are induced by multiple stresses including, osmotic stress, oxidative stress, heat stress, and ethanol stress [11, 12, 75]. Several scientists have suggested that some of the trehalose and glycogen formed during exposure to stress is degraded to glucose and G-l-P the same time they are formed in response to stress [28, 175]. This observation is supported by the fact that deletion of NTH1 and GPH1 results in an increase in trehalose and glycogen levels during stress [175, 203]. Global gene expression analysis revealed that both NTH1 and GPH1 respond to several stress conditions including ethanol stress and osmotic stress [41,75]. Furthermore, GPH1 is induced by osmotic stress in a Hoglp-dependent manner and deletion of GPH1 reduce growth of the yeast during osmotic stress [77, 204]. 37 This cycling of trehalose and glycogen was first observed in heat stressed cells [28]. Shifting yeast cells from 27 to 40 °C not only induced trehalose accumulation, but also induced the activity of Tpslp as well as Nthlp [28]. These higher levels of Tpslp and Nthlp are due to activation of transcription of their corresponding genes in response to heat stress [30, 175, 201]. It should be noted that trehalose accumulates during heat stress, which suggests that the rate of trehalose synthesis exceeds the rate of dissimilation. Hottiger and co-workers concluded that there is an ATP consuming futile trehalose cycle [177]. Futile cycles for trehalose and glycogen are not just heat stress specific, but were also observed when hydrogen peroxide or sorbitol/NaCl were added to exponentially growing cells to induce oxidative and osmotic stress respectively [175]. The existence of these ATP futile cycles was later expanded to include glycerol formation and dissimilation via dihydroxyacetone phosphate [169]. Osmotic stress up-regulates both mRNA and protein levels of the GPD1 and GPP2 genes encoding the synthesis of glycerol and its dissimilation via dihydroxyacetone (GCY1, DAK1), which consume one ATP molecule [164]. The purpose of these ATP futile cycles are to prevent what is described as substrate accelerated death [205]. 1.5.2.3 Glycolysis requires the functioning of TPS1. It is generally accepted that S. cerevisiae requires an active trehalose synthase complex to grow on fermentable carbon sources, since deletion of TPS1 results in hyper-accumulation of sugar phosphates, and depletion of ATP and free inorganic phosphate in the cytoplasm [206]. In addition to the role of trehalose in adaptation to stress, trehalose metabolism also regulates the glycolytic flux [205, 207]. These two functions of trehalose metabolism are not necessarily separate, but rather overlapping, since trehalose metabolism is also required for exponentially growing cells in glucose [208]. The addition of 0.5 mM of either glucose or 38 fructose to galactose grown cells inhibits growth of a tpsl mutant [208]. This phenotype of TPS1 has led to several hypotheses: 1. The regulatory effect of trehalose metabolism on glycolysis seems to occur at the level of phosphorylation of hexoses by hexokinase II, since deletion of HXK2, the major hexokinase, alleviates the tpsl mutant phenotype when grown in glucose [209]. This regulation seems to occur through inhibition of hexokinase II activity by trehalose-6-phosphate, at least in vitro [210]. Trehalose-6-phosphate synthase activity is non-competitively inhibited by inorganic phosphate while fructose-6-phosphate act as an activator [211, 212]. In addition to the deletion of HXK2, over expression of FPS1 (glycerol permease) or GPD1, alleviate the phenotype of the tpsl mutant [213]. Increased FPS1 expression results in an increase in glycerol formation. 2. It was suggested that the by-products, inorganic phosphate and NAD+, might stimulate the lower part (glyceraldehydes-3-phosphate dehydrogenase and down stream) of glycolysis to allow a reduction in the levels of sugar phosphates in the upper part of glycolysis [213]. Considering the fact that the first two steps in the lower part utilize NAD + and inorganic phosphate, respectively, this hypothesis seems quite feasible. However, the activities of glyceraldehydes-3-phosphate dehydrogenase and glyceraldehydes-3-phosphate kinase do not increase significantly [214]. 3. It has also been suggested that trehalose-6-phosphate itself can stimulate the lower part of glycolysis. This hypothesis stems from the fact that the tpsl mutant does not ferment fructose but when glucose is added in very low amounts, the mutant is able to ferment fructose [215]. Modelling of unbranched glycolysis revealed that unless the hexosekinase or transport systems are regulated negatively, the flux in the upper part of the pathway will exceed the 39 flux in the lower part due to the so-called "turbo-design" of glycolysis; if not controlled it may lead to substrate accelerated death [205]. Two ATPs are incorporated into the upper part of glycolysis, which stimulate the flux thereby creating an imbalance between the upper and lower parts of the pathway resulting in the accumulation of fructose-1,6-bisphosphate (F-1,6-BP), dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (GAP) [216]. The build-up of sugar phosphates (F-1,6-BP, DHAP and GAP) and depletion of phosphate in the cell becomes toxic resulting in substrate accelerated death, or at least failure to grow [169, 205]. Sugar phosphates, like DHAP and GAP, can spontaneously convert into methylglyoxal, a highly toxic compound [217]. Furthermore, the down-regulation of biosynthetic pathways upon exposure to osmotic stress leads to a decreased demand for and subsequent accumulation of ATP [218]. These high levels of ATP will fuel the upper part of glycolysis due to its turbo design [205]. Observations consistent with this hypothesis have been made in heat stressed cells [28]. Cytoplasmic levels of compounds in the upper part of glycolysis such as glucose (50-fold), ATP (7-fold), G-6-P (3-fold), and UDP-glucose (5-fold) steady state levels all increase substantially in heat shocked cells [28, 214]. Interestingly, enzymes catalyzing the first two steps in the lower part of glycolysis {glyceraldehyde-3 -phosphate dehydrogenase (Tdhl/2/3p) and glyceraldehydes-3-phosphate kinase (Pgklp) did not show a significant increase in activity [214]. It has been suggested that the yeast cell prevents the accumulation of F-1,6-BP by controlling the influx of glucose via three possible mechanisms: (1) inhibition of hexose transporters [209], (2) feedback inhibition of hexokinase by trehalose-6-phosphate that limits phosphorylation of glucose [206, 210, 216, 219], or (3) consuming ATP by activating the glycerol, trehalose and glycogen futile cycles that act as safety valves to prevent substrate accelerated death [169, 188]. The requirement of these futile cycles becomes more prevalent when the yeast is suddenly exposed to stress. Induction of genes encoding for enzymes involved in these futile cycles occur in a number of stresses including ethanol stress, lithium stress and osmotic stress [41, 164, 220]. 40 1.5.3 Metabolic adaptation of S. cerevisiae to osmotic stress; formation of acetic acid The increased formation of glycerol in response to osmotic stress, produces an excess of NAD+. This will eventually cause a shift in the redox balance (NAD+:NADH) in the cell. It has been suggested that 5". cerevisiae can utilize acetic acid as a redox sink to convert NAD+ back to NADH [153, 221, 222]. Several studies have provided evidence for a link between an increase in the concentration of acetic acid and increased glycerol production [221-224]. Deletion of GPD1 or GPD2 result in a decrease in acetic acid formation [223]. Overexpression of GPD1 or GPD2, using the ADH1 promoter led to increased formation of acetic acid by S. cerevisiae [221, 222, 224]. S. cerevisiae produces acetic acid by oxidation of acetaldehyde to acetate by NAD(P)+-dependent (acet)aldehyde dehydrogenases [225, 226]. S. cerevisiae has five isogenes ALD2, ALD3, ALD4, ALD5, and ALD6 that encode NAD(P)+-dependent (acet)aldehyde dehydrogenases [225]. The ALD genes are regulated differently and, therefore, may function under different conditions. DNA microarray analyses have shown that osmotic shock, using NaCl or sorbitol, induced the expression of ALD2, ALD3, ALD4 and ALD6 [75, 76, 146]. 1.5.3.1 The ALD2 (YML170C) and ALD3 (YMR169C) genes. Both the ALD2 and ALD3 genes encode for cytosolic NAD+-dependent aldehyde dehydrogenases [225,227]. This is supported by the increase in NAD+ -dependent aldehyde dehydrogenase activity in wild type cells but not in an ald2ald3 mutant when exposed to osmotic stress [225]. Both PKA and Hoglp have been implicated in the regulation of ALD2 and ALD3. ALD2/3 expression are regulated by Msn2/4p which is only partially dependent on PKA activity [109,127,228]. The regulation by Hoglp has been a contested issue, some studies have indicated that ALD2/3 transcription is Hoglp-dependent [75,227] whereas others have suggested that ALD2/3 induction in response to osmotic stress is Hoglp-independent [225]. 41 More direct evidence for the contribution of ALD2/3 to acetic acid production in response to increase glycerol was obtained in 2% (w/v) galactose grown yeast cells that were exposed to a 10 mM LiCl shock. Acetic acid formation increased in conjunction with glycerol formation [220]. This increase in acetic acid was correlated to ALD2/3 mRNA and protein levels, that were both up-regulated [220]. Furthermore, ALD2I3 expression is also induced in response to an acetaldehyde shock in industrial strains grown in 2% (w/v) glucose [229]. It seems that the cytosolic NAD+-dependent genes, ALD2I3, are responsive to stress conditions. It is, therefore, likely that these genes are responsible for a major portion of acetic acid formed during the fermentation of high sugar grape musts. In addition to catalyzing the conversion of acetaldehyde to acetic acid, ALD2/3 also seems to be involved in other metabolic pathways [230]. Genetic evidence suggests that deletion of ALD2/3 causes a pantothenic acid auxotrophy. Analysis of growth of the ald2ald3 mutant on pantothenic acid pathway intermediates revealed that Ald2/3p might be involved in catalyzing the conversion of 3-aminopropanal to P-alanine [230]. P-alanine is used for biosynthesis of pantothenic acid and coenzyme A. It seems that at least for Ald2/3p, substrate specificity is not limited to acetaldehyde but several compounds containing aldehyde groups can be used as substrate. 1.5.3.2 The mitochondrial aldehyde dehydrogenases: ALD4 (YOR374W) and ALD5 (YER073W) genes. The ALD4 gene encodes for a mitochondrial K + activated NAD(P)+-dependent aldehyde dehydrogenase [231, 232]. Deletion of ald4 results in reduced fitness in osmotic stress conditions [77]. Furthermore, consistent with its mitochondrial localization, the ald4 mutant has no growth phenotype in glucose, but when ethanol or lactate is used as carbon source, the mutant grows at a slower rate [233]. ALD4 is required during respiratory metabolism when ethanol and glycerol are used as carbon sources. During respiration, Ald4p converts acetaldehyde to acetate which in turn is linked by acetyl-CoA synthetase to Co-enzyme A. Acetyl-CoA is then taken up into the glyoxylate and TCA 42 cycles for respiratory metabolism. ALD4 expression is repressed by glucose [229, 234] and mRNA levels of ALD4 are much higher in a hxk2 mutant than in the wild type cells when grown in glucose [235]. Apart from phosphorylating hexose sugars, Hxk2p plays a central role in establishing glucose repression [236]. The contribution of ALD4 to acetic acid formation in high sugar musts is therefore probably limited. However, ALD4 was identified as the second most important aldehyde dehydrogenase for acetic acid formation during the fermentation of 20% (w/v) sugars [226]. Interestingly, when ALD4 is deleted in conjunction with ALD6, acetic acid formation is further reduced in comparison to the ald6 mutant or wild type strains [226]. Deletion of ALD4 on its own seems to have no effect on acetic acid formation [226]. A second mitochondrial ALD gene, ALD5, encodes for a NAD(P)+-dependent aldehyde 4 dehydrogenase [232]. Similarly to ALD4, ALD5 is induced by diauxic shift [234, 237]. The ald5 mutant has similar phenotypes than the ald4 mutant; it has a reduced growth rate on non-fermentable carbon sources such as ethanol and the expression of ALD 5 is repressed by glucose [238]. Although it seems that ALD5 is induced when 1 M NaCl is added to rich media with glucose, expression levels are well below that when grown in rich media with ethanol as carbon source [146, 238]. It therefore seems that ALD4 and ALD5 mainly functions during aerobic respiratory metabolism and not during fermentation. However, recently ALD5 was implicated in acetic acid formation during anaerobic growth in YEPD and synthetic grape must containing 5 % and 20 % (w/v) glucose, respectively [239]. 1.5.3.3 The ALD6 (YPL061W) gene. The ALD6 gene encodes for a Mg2+-activated cytosolic NADP+-dependent acetaldehyde dehydrogenase [232, 240, 241]. Deletion of ALD6 revealed that this gene encodes for the major aldehyde dehydrogenase enzyme [226, 239]. Not only does acetic acid formation decrease in an ald6 mutant, but the formation of compounds such as acetaldehyde, isobutanol, iso-amyl alcohol, 2,3 butanediol, 4-43 hydroxybenzene ethanol and octanoic acid can be affected [224]. Interestingly, ald6 mutants produce more glycerol than wild type cells, with haploid ald6 mutant cells growing slower than wild type cells in rich media containing glucose as carbon source [224, 240]. This difference in growth rate becomes less obvious when ethanol is used as sole carbon source [232], probably because Ald6p function is required to a lesser degree when ethanol is used as carbon source by the yeast. ALD6 is expressed several fold higher when glucose instead of ethanol act as the sole carbon source [229]. Other data seem to suggest that ALD6 is expressed constitutively in the presence of glucose [240, 241]. Aranda and del Olmo (2003) found that when they added 12 % (v/v) ethanol to cells grown in 2% (w/v) glucose, ALD6 was repressed [229]. In a recent study, ALD6 mRNA and protein levels decreased in galactose grown cells shocked with 10 mM LiCI. However, the increased level of acetic acid was linked to Aldp2 and Aldp3 activity [220]. ALD6 is synthetically lethal with ZWF1 [242]. ZWF1 encodes for glucose-6-phosphate dehydrogenase, the first enzyme of the oxidative part of the pentose phosphate pathway (PPP). The oxidative part of the PPP is the major source of NADPH in the cell. This suggests that Ald6p is responsible for generating a substantial portion of NADPH pool in the cell. The reaction catalyzed by Ald6p may become more important when the PPP is unable to supply sufficient NADPH. In the same study ZMS1 was identified as a putative transcriptional activator of ALD6. Over expression of ZMS1 increased ALD6 mRNA levels [242]. ALD6 is also induced by osmotic stress in what appears to be in a Hoglp-dependent manner [75, 76, 243]. Although the ALD6 promoter contains two STRE elements, its induction in response to NaCl induced osmotic stress does not seem to be regulated by PKA [109]. Apart from the fact that Msn2/4p does not affect ALD6 transcription and Zmslp that may act as a transcriptional activator, little is known about trans-acting factors for ALD6 expression [228, 242]. 44 Analysis of aldehyde dehydrogenase activity in different strains of S. cerevisiae fermenting sterile filtered grape musts, revealed that the cytosolic NADP+-dependant aldehyde dehydrogenase activity is different between strains [244]. The maximum activity peaked within the first 4 hours of fermentation [245], after which the activity gradually decreased to a minimum at 24 hours into the fermentation [244]. 1.6 Production of acetic acid in wine The production of high volatile acidity (VA) in wine is often associated with spoilage microorganisms such as acetic acid and lactic acid bacteria and Brettanomyces sp. that produce acetic acid in wine [246, 247]. Despite the fact that high VA in wine constitutes an important problem for wineries, little is known about the effect of environmental conditions on acetic acid formation by wine yeast. For the production of most table wines, wineries use grape juice with relatively low sugar concentrations, too low to result in acetic acid formation by wine yeast that may exceed legal limits. Hence little attention has been paid to manipulation of fermentation conditions to limit acetic acid formation by wine yeast in table wines. It is, however, well documented that S. cerevisiae uses glycerol as compatible solute when exposed to osmostress. It has been suggested that there is a link between glycerol and acetic acid production and it is possible that fermentation conditions affecting glycerol formation may also affect acetic acid formation by wine yeast, especially in high sugar musts. 1.6.1 High sugar concentrations Although spoilage bacteria and non-Saccharomyces yeasts are frequently the cause of high acetic acid levels found in table wines, wine yeast seems to be the major contributor of acetic acid in high sugar musts [248, 249]. Increased acetic acid formation has been correlated to sugar concentrations > 160 g/L [248]. An attempt to isolate acetic acid bacteria 45 from Icewine grape must was unsuccessful [250], suggesting that wine yeast might be the major contributor of acetic acid during Icewine fermentations. By increasing sugar concentrations, more free water in grape must is bound, thereby lowering the water activity (Aw) and increasing the osmolarity [251]. S. cerevisiae produced four-fold more glycerol when grown at low Aw ( 0.971) in comparison to when it was grown at a higher Aw ( 0.994) in continuous cultures [252]. Grape juice used for normal still wine production contains equimolar amounts of glucose and fructose that range from 16% to 26% (w/v) sugars (approx. 16 °Brix to 26 °Brix) [253]. However, grape juice used for Icewine production has to contain at least 35 °Brix {approx 35% (w/v) sugars}. It could, therefore, be expected that the high sugar content of Icewine grape must could stimulate acetic acid production by wine yeast. 1.6.2 Effect of wine yeast strains on acetic acid formation Different wine yeast strains used for specific wine styles or in combination with specific grape varieties, have illustrated the significance of different wine yeast strains on the sensory and chemical characteristics of wine [254-256]. Fermentation of Riesling and Chenin blanc grape musts revealed that the yeast strain had a significant impact on the aroma, flavour and chemical attributes, including acetic acid concentration in the wines [256]. Wines produced from Gamay and Petite Sirah grapes revealed that wine yeast strains produce different amounts of volatile compounds that can affect wine quality [255]. Wine yeast strains vary greatly in their ability to produce acetic acid [257]. Thirty six wine yeast strains were classified as either low (<0.1 g/L), medium (<0.55 g/L) or high (>0.6 g/L) acetate producers in a 20% (w/v) sugars synthetic grape must. Analysis of 19 wine yeast strains in 20% (w/v) synthetic must revealed that strains producing high amounts of glycerol, did not necessarily produce high levels of acetic acid or acetaldehyde [258]. Glycerol 46 formation between strains varied from 6.4 g/L to 8.9 g/L and acetic acid ranged from 0.189 g/L to 0.91 g/L. 1.6.3 Clarification and removal of components in must Grape must, especially white musts, is often clarified to remove insoluble materials [18]. This clarification is done to produce white wines of high quality [259]. However, excessive clarification of grape musts may cause stuck or sluggish fermentations, which may also lead to the production of high amounts of acetic acid by the wine yeast [259]. This is illustrated by the fact that yeast will produce more acetic acid in free run musts than musts produced from crushed grapes [259]. Delfini (1993) hypothesized that the clarification process removes free fatty acids, which originates from grape skins and grape cell membranes. According to Delfini (1993), the lack of free fatty acids in the must leads to de novo synthesis of fatty acids by the yeast. This requires increased synthesis of acetic acid, a precursor of fatty acid synthesis. However, due to the lack of sufficient molecular oxygen, a requirement for fatty acid synthesis, acetic acid will accumulate instead of being incorporated into the aliphatic chains of the fatty acids. This hypothesis is supported by the fact that the addition of unsaturated fatty acids in the form of Tween 80, reduce acetic acid formation in clarified musts [260]. Excessive clarification may also remove growth factors essential for yeast growth. The lack of compounds such as thiamine in grape must leads to lower levels of glycerol, whereas the lack of 4-amino-benzoic acid, biotin, folic acid, nicotinic acid, pantothenic acid, pyridoxine, and riboflavine do not affect glycerol formation by wine yeast [261]. 1.6.4 Fermentation temperature Little is known about the effect of temperature on acetic acid formation by S. cerevisiae during wine fermentations. However, higher temperatures in general seem to increase 47 glycerol formation [262]. It is therefore not surprising that in general, red wines fermented at higher temperatures contain higher levels of glycerol than white wines. Rankine and co-workers found that when the temperature was increased from 15 °C to 25 °C, glycerol increased by 1 g/L [263]. However, different wine yeast strains respond differently to increased fermentation temperatures [264, 265]. When the fermentation temperature is increased from 18 °C to 28 °C, yeast strains producing low amounts of glycerol were less affected than yeast strains producing high amounts [258]. Others have suggested that the optimum temperature for glycerol production by wine yeast seems to be between 20 °C and 25 °C [155, 264]. 1.6.5 Effect of nitrogen on glycerol and acetic acid formation There seems to be a moderate inverse relationship between the initial nitrogen content and acetic acid formation in grape musts containing more than 35 °Brix [266]. Ammonium sulphate additions to must with assimilable nitrogen levels below 200 mg N/L reduced acetic acid formation, but when the initial concentration exceeded 200 mg N/L, more acetic acid was produced [266]. Furthermore, addition of ammonium sulphate during the beginning of the alcoholic fermentation, led to decreased acetic acid concentrations but the addition of ammonium sulphate during the late stages of fermentation increased acetic acid formation. An initial assimilable nitrogen level of 190 mg N/L seems to be optimum for low levels of acetic acid formation. However, it has been suggested that 140 mg N/L of assimilable nitrogen is the threshold level to prevent stuck and sluggish fermentations [267]. The level of 190 mg/L is quite close to the threshold level for stuck and sluggish fermentations. Interestingly Bely and co-workers [266] observed no effect of must nitrogen concentration on glycerol formation. Ammonium grown yeast cells seem to produce more than double the amount of glycerol than cells grown in a mixture of amino acids as the nitrogen source [268]. This 48 increase in glycerol is attributed to the formation of NADH as a by-product of ammonium stimulated amino acid biosynthesis. The increase in glycerol formation may result in increased acetic acid levels. The effect of must nitrogen content on glycerol formation is also yeast strain-dependent [258]. The addition of nitrogen to synthetic grape must with 300 mg/L assimilable nitrogen, did not affect glycerol formation [258]. 1.6.6 Effect of sulphur dioxide Sulphur dioxide is added regularly to grape musts to prevent chemical oxidation of flavour compounds and to inhibit the growth of wild yeasts and bacteria that may spoil the wine [18]. Sulphur dioxide either binds acetaldehyde to form adducts with, or inhibits the activity of alcohol dehydrogenases [155, 269], preventing acetaldehyde from accepting electrons donated by cytosolic NADH to produce ethanol. Instead of ethanol formation from acetaldehyde to oxidize NADH, glycolysis is steered in the direction of glycerol formation. Therefore, the addition of sulphur dioxide increases glycerol production by yeast [262]. This phenomenon was used during the first half of the twentieth century to increase glycerol yields by S. cerevisiae. At the time glycerol was used for munitions production. The use of S. cerevisiae in biotransformations to produce glycerol was later replaced with cheaper and more effective chemical techniques [262]. Wine yeast is, in general, more resistant to sulphur dioxide than other micro organisms found in wineries, except Brettanomyces spp. Resistance to sulphur dioxide differs among strains of S. cerevisiae, for example enology strains are more resistant than baker's yeast strains [264]. The addition of 150 mg/L sulphur dioxide inhibits both wine and baker's yeast strains. Attempts to increase glycerol production in wine by the addition of sulphur dioxide revealed that the effect is also strain-dependent [263, 265]. Certain yeast strains can increase glycerol production by as much as 20% whereas others showed no increase in response to sulphur dioxide additions above 200 mg/L [265]. When ethanol is present, wine yeast strains 49 seem to become more sensitive to sulphur dioxide [264]. It is possible that an increase in osmotic stress may have a similar effect than ethanol in sulphur dioxide sensitivity in wine yeast. Fermentation conditions, such as temperature, have little effect on the sensitivity of yeast strains to sulphur dioxide. 1.7. Proposed research 1.7.1. Significance of research High levels of acetic acid are undesirable in wine since it has a negative impact on the sensory quality of wine. Icewines often contain levels of acetic acid that exceed the legal limit of 0.13 % (w/v) of volatile acidity calculated as acetic acid in Canada (Canadian Food and Drug Act section B.02.101.). Research in this thesis will address (1) important fundamental questions on the transcriptional response of wine yeast to sugar-induced osmotic stress, (2) the phenotypic comparison of seven industrial yeast strains with the aim to identify yeast strains that can be used successfully for the production of Icewine, and (3) the molecular characterization of yeasts that produce low and high amounts of acetic acid in response to osmotic stress. The outcomes could lead to a better understanding of the effect of sugar-induced osmotic stress on the transcriptome of wine yeasts, and improved Icewine vinification procedures resulting in a reduction of financial losses to wineries in Canada. 1.7.2. General hypothesis The metabolism of hexoses by S. cerevisiae via the Embden-Meyerhof pathway leads to the production of dihydroxyacetone phosphate and glyceraldehyde-3-phosphate as intermediary products. Glycerol is synthesized by reduction of dihydroxyacetone phosphate to glycerol-3-phosphate. This reaction is catalyzed by an NADH-dependant cytosolic glycero 1-3-phosphate dehydrogenase. An increase in cytoplasmic glycerol formation under conditions of osmotic stress requires an equimolar amount of cytoplasmic NADH; this 50 requirement seems to be partially met by increased oxidation of acetaldehyde to acetate. Moreover, the yeast strain, addition of inorganic nitrogen and sulphites, and the fermentation temperature have all been reported to affect the production of glycerol during alcoholic fermentation. Most studies investigating the effect of osmotic stress on S. cerevisiae have been done with genetically characterized haploid strains of this yeast and NaCl or sorbitol as osmolytes. Furthermore, little or no attention was paid to the production of acetic acid in these studies. My hypotheses are that (1) sugar as an osmolyte may affect transcription of genes thus far not detected under conditions of NaCl or sorbitol induced osmotic stress (2) other enzymes or metabolic pathways in the yeast may play a role to reset the redox balance, and (3) the choice of yeast strain could limit the amount of acetic acid produced during Icewine fermentations. 1.7.3. Main objectives 1. To study the effect of sugar-induced osmotic stress on the transcriptome of a wine yeast during fermentation, the global transcriptional response of an industrial wine yeast fermenting 40 % (w/v) sugars will be compared to its transcriptional response in 22 % (w/v) sugars. The transcriptional response of genes involved in trehalose, glycogen, glycerol, acetic acid, nucleotide and amino acid biosynthesis as well as the pentose phosphate pathway will be analyzed to obtain a global view to develop an understanding, and formulate hypotheses on how wine yeast respond and adapt in Icewine grape must. 2. To evaluate the impact of wine yeast strains on fermentation rates, acetic acid and glycerol formation, and sensory properties of Icewine. Synthetic grape must, as well as commercially available Riesling Icewine grape must will be used to compare seven commercially used wine yeast strains. Three yeast strains that produce the lowest amounts of acetic acid and the best quality 51 Icewine will be further analysed to determine which strain is best suited for Icewine production. In addition, the effect of increased sugar concentration, timed addition of diammonium phosphate, Fermaid K, sulphur dioxide as well as fermentation temperature on acetic acid and glycerol formation in Icewine will be determined. To study the molecular basis of acetic acid production in yeast stains that produce relatively low and high amounts of acetic acid during exposure to osmotic stress. The transcriptomes of two strains (one producing high amounts of acetic acid and glycerol, the other producing relatively low amounts of these compounds) will be compared during the fermentation of Riesling grape must containing 40% (w/v) sugars. Previously published data on genes regulated by Hoglp and Msn2/4p, as well as data from Objective 1, will be used to determine which strain is more sensitive to sugar-induced osmotic stress. The expression of the genes involved in acetic acid and glycerol formation will be analysed to develop a clearer understanding as to why individual wine strains of S. cerevisiae produce different amounts of acetic acid and glycerol during Icewine fermentations. 52 1.8 Literature Cited [1] Pretorius, I.S. (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking. Yeast 16, 675-729. [2] Bisson, L.F., Waterhouse, A. L., Ebeler, S. E., Walker,M .A., and Lapsley, J. T. (2002) The present and future of the international wine industry. Nature 418, 696-699. [3] Mortimer, R., and Polsinelli, M. (1999) On the origins of wine yeast. Res. Microbiol. 150, 199-204. [4] Vaughan-Martini, A., and Martini, A. (1995) Facts, myths and legends on the prime indutrial microoganism. J. Ind. Microbiol. 15, 514-522. [5] Torok, T., Mortimer, R., Romano, P., Suzzi, G., and Polsinelli, M. (1996) Quest for wine yeast- an old story revisited. J. Ind. Microbiol. 17, 303-313. [6] Martini, A. (1993) The origin and domestication of the wine yeast Saccharomyces cerevisiae. J. Wine Res. 4, 165-176. [7] Lachance, M., A., Gilbert, D. G., and Starmer, W. T. (1994) Yeast communities assciated with Drosophila species and related flies in eastern oak-pine forests: a comparison with western communities. J. Ind. Microbiol. 14, 484-494. [8] Phaff, H.J., and Knapp, E. P. (1956) The taxonomy of yeasts found in exudates of certain trees and other natural breeding sites of some species of Drosophila. Antonie van Leeuwenhoek 22, 117-130. [9] Phaff, H.J., Miller, M.W., and Shifrine, M. (1956) The taxonomy of yeasts isolated from Drosophila in the Yosemite region of California. Antonie van Leeuwenhoek 22, 145-161. [10] Phaff, H.J., Miller, M.W., Reccda, J. A., Shifrine, M. and Mrak, E. M. (1956) Studies on the ecology of Drosophila in the Yosemite region of California. Ecology 37, 533-538. [11] Causton, H.C., Ren, B., Koh, S. S., Harbison, C. T., Kanin, E., Jennings, E. G., Lee, T. I., True, H. L., Lander, E.S., and Young, R. A. (2001) Remodeling of yeast genome expression in response to environmental changes. Mol. Biol. Cell. 12, 323-337. [12] Gasch, A.P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G., Botstein, D., and Brown, P.O. (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol. Biol. Cell. 11, 4241-4257. [13] Boer, V. M., de Winde, J. H., Pronk, J. T., and Piper, M. D. (2003) The genome-wide transcriptional responses of Saccharomyces cerevisiae grown on glucose in aerobic chemostat cultures limited for carbon, nitrogen, phosphorus, or sulfur. J. Biol. Chem. 278, 3265-3274. [14] Lange, H. C , and Heijnen, J. J. (2001) Statistical Reconciliation of the Elemental and Molecular Biomass Compposition of Saccharomyces cerevisiae. Biotechnol. Bioeng. 75,334-344. [15] Wu, J., Zhang, N., Hayes, A., Panoutsopoulou, K., and Oliver, S. G. (2004) Global analysis of nutrient control of gene expression in Saccharomyces cerevisiae during growth and starvation. Proc. Natl. Acad. Sci. USA. 101, 3148-3153. [16] Visser, W., Scheffers, W. A., Batenburg-van der Vegte, W. H., and van Dijken, J. P. (1990) Oxygen requirements of yeasts. Appl. Environ. Microbiol. 56, 3785-3792. [17] Bisson, L. F. (1999) Stuck and Sluggish fermentations. Am. J. Enol. Vitic. 50, 107-119. [18] Boulton, R. B., Singleton, V. L., Bisson, L. F., and Kunkee, R. E. (1996) in: The Chapman and Hall Enology Library Chapman and Hall, New York, NY. [19] Cooper, T.G. (1982) in: The Molecular Biology of the Yeast Saccharomyces cerevisiae: Metabolism and Gene Expression, pp. 39-99 (Strathern, J.N., Jones, E. W. 54 and Broach, J. R., Ed.) Cold Spring Harbor Laboratory, New York, Cold Spring Harbor. Jagadish, M. N., and Carter, B. L. A. (1977) Genetic control of cell division in yeast cultured at different growth rates. Nature 269, 145-147. Cross, F.R. (1988) DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mol. Cell. Biol. 8, 4675-4684. Tyers, M., Tokiwa, G , Nash, R., and Futcher, B. (1992) The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation. Embo J. 11, 1773-1784. Polymenis, M., and Schmidt, E. V. (1997) Coupling of cell division to cell growth by translational control of the Gl cyclin CLN3 in yeast. Genes Dev. 11, 2522-2531. Parviz, F., and Heideman, W. (1998) Growth-independent regulation of CLN3 mRNA levels by nutrients in Saccharomyces cerevisiae. J. Bacteriol. 180, 225-230. Bauer, F. F., and Pretorius, I. S. (2000) Yeast stress response and Fermentation Efficiency: How to survive the Making of Wine - A review. S. Afr. J. Enol. Vitic. 21, 27-51. Killian, R.E., and Ough, C. S. (1979) Fermentation esters - formation and retention as effected by fermentation temperature. Am. J. Enol. Vitic. 30, 301-305. Suutari, M., Liukkonen, K., and Laakso, S. (1990) Temperature adaptation in yeast. J. Gen. Microbiol. 136, 1469-1474. Hottiger, T., Schmuts, P., and Wiemken, A. (1987) Heat-Induced Accumulation and Futile Cycling of trehalose in Saccharomyces cerevisiae. J. Bacteriol. 169, 5518-5522. Craig, E.A. (1992) in: The Molecular Biology of the Yeast Saccharomyces, pp. 501-537 (Jones, E.W., Pringle, J. R., and Broach, J. R., Ed.) Cold Spring Harbor Laboratory Press., Cold Spring Harbor. 55 Attfield, P.V. (1987) Trehalose accumulates in Saccharomyces cerevisiae during exposure to agents that induce heat shock response. FEBS Lett. 225, 259-263. Becerra, M., Lombardia, L. J., Gonzalez-Siso, M. I., Rodriguez-Belmonte, E., Hauser, N. C , and Cerdan M. E. (2003) Genome-wide analysis of the yeast transcriptome upon heat and cold shock. Comp. Funct. Genom. 4, 366-375. Zhang, L., Ohta, A., Horiuchi, H., Takagi, M., and Imai, R. (2001) Multiple mechanisms regulate expression of low temperature responsive (LOT) genes in Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 283, 531-535. Homma, T., Iwahashi, H., and Komatsu, Y. (2003) Yeast gene expression during growth at low temperature. Cryobiology. 46, 230-237. Kondo, K., and Inouye, M. (1991) TIP1, a cold shock inducible gene of Saccharomyces cerevisiae. J. Biol. Chem. 266, 17537-17544. Rainieri, S., and Pretorius, I. S. (2000) Selection and improvement of wine yeast. Ann. Rev. Microbiol. 50, 15-31. Tamas, M. J., Rep, M., Thevelein, J. M., and Hohmann, S. (2000) Stimulation of the yeast high osmolarity glycerol (HOG) pathway: evidence for a signal generated by a change in turgor rather than by water stress. FEBS Lett. 472, 159-165. Alexandre, H., Rousseaux, I., and Charpentier, C. (1994) Ethanol adaptation mechanisms in Saccharomyces cerevisiae. Biotechnol. Appl. Biochem. 20, 173-183. Piper, P.W. (1995) The heat shock and ethanol stress responses of yeast exhibit extensive similarity and functional overlap. FEMS Microbiol Lett. 134, 121-127. Jones, R.P., and Greenfield, P. F. (1987) Ethanol and the fluidity of the yeast plasma membrane. Yeast. 3, 223-232. Rosa, M.F., and Sa-Correia, I. (1996) Intracellular acidification does not account for inhibition of Saccharomyces cerevisiae growth in the presence of ethanol. FEMS Microbiol. Lett. 135, 271-274. 56 Alexandre, H., Ansanay-Galeote, V., Dequin, S., and Blondin, B. (2001) Global gene expression during short-term ethanol stress in Saccharomyces cerevisiae. FEBS Lett. 498, 98-103. Piper, P. W., Talreja, K., Panaretou, B., Moradas-Ferreira, P., Byrne, K., Praekelt, U. M., Meacock, P., Recnacq, M., and Boucherie, H. (1994) Induction of major heat-shock proteins of Saccharomyces cerevisiae, including plasma membrane Hsp30, by ethanol levels above a critical threshold. Microbiology 140, 3031-3038. Mansure, J. J., Panek, A., Crowe, L. M., and Crowe, J. L. (1994) Trehalose inhibits ethanol effects on intact yeast cells and liposomes. Biochem Biophys Acta. 1191, 309-316. Brewster, J. L., de Valoir, T., Dwyer, N. D., Winter, E., and Gustin, M. C. (1993) An Osmosensing Signal Transduction Pathway in Yeast. Science 259, 1760-1763. Gustin, M. C. A., J., Alexander, M., and Davenport, K. (1998) MAP kinase pathways in yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62, 1264-1300. Posas, F. and Saito, H. (1997) Osmotic activation of the HOG MAPK pathway via Stel lp MAPKKK: scaffold role of Pbs2p MAPKK. Science 276, 1702-1705. Maeda, T., Wurgler-Murphy, S. M. and Saito, H. (1994) A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369, 242-245. O'Rourke, S.M., and Herskowitz, I. (2002) A third osmosensing branch in Saccharomyces cerevisiae requires the Msb2 protein and functions in parallel with the Shol branch. Mol. Cell. Biol. 22, 4739-4749. Hohmann, S. (2002) Osmotic Stress Signalling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev. 66, 300-372. Wood, J.M. (1999) Osmosensing by Bacteria: Signals and Membrane based Sensors. Microbiol. Mol. Biol. Rev. 63, 230-262. [51] Reiser, V., Salah, S.M. and Ammerer, G. (2000) Polarized localization of yeast Pbs2 depends on osmostress, the membrane protein Shol and Cdc42. Nat. Cell. Biol. 2, 620-627. [52] Ostrander, D.B., and Gorma, J. A. (1999) The extracellular domain of the Saccharomyces cerevisiae Slnlp membrane osmolarity sensor is necessary for kinase activity. J. Bacteriol. 181, 2527-2534. [53] Harris, K., Lamson, R. E., Nelson, B., Hughes, T. R., Marton, M. J., Roberts, C. J., Boone, C , and Pryciak, P. M. (2001) Role of scaffolds in MAP kinase pathway specificity revealed by custom design of pathway-dedicated signaling proteins. Curr. Biol. 11, 1815-1824. [54] Reiser, V., Raitt, D. C , and Saito, H. (2003) Yeast osmosensor Slnl and plant cytokinin receptor Crel respond to changes in turgor pressure. J. Cell Biol. 161, 1035-1040. [55] Saito, H. (2001) Histidine phosphorylation and two-component signalling in eukaryotic cells. Chem. Rev. 101, 2497-2509. [56] Stock, A.M., Robinson, V. L., and Goudreau, P. N. (2000) Two-component signal transduction. Annu. Rev. Biochem. 69, 183-215. [57] Ota, I. M., and Varshavsky, A. (1993) A yeast protein similar to bacterial two-component regulators. Science 262, 566-569. [58] Janiak-Spens, F., and West, A. H. (2000) Functional roles of conserved amino acid residues surrounding the phosphorylatable histidine of the yeast phosphorelay protein YPD1. Mol. Microbiol. 37, 136-144. [59] Janiak-Spens, F., Sparling, D. P., and West, A. H. (2000) Novel Role for an HPt Domain in Stabilizing the Phosphorylated State of a Response Regulator Domain. J. Bacteriol. 182, 6673-6678. 58 Janiak-Spens, F., Sparling, J. M., Gurfinkel, M., and West, A. H. (1999) Differential stabilities of phosphorylated response regulator domains reflect functional roles of the yeast osmoregulatory SLN1 and SSK1 proteins. J. Bacteriol. 181, 411-417. Posas, F., Wurgler-Murphy, S.M., Maeda, T., Witten, E.A., Thai, T.C. and Saito, H. (1996) Yeast HOG1 MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN1-YPD1-SSK1 "two-component" osmosensor. Cell 86, 865-875. Maeda, T., Takekawa, M. and Saito, H. (1995) Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3- containing osmosensor. Science 269, 554-558. Posas, F., and Saito, H. (1998) Activation of the yeast SSK2 MAPKKK by SSK1 two-component response regulator. Embo J. 17, 1385-1394. Li, S., Ault, A., Malone, C. L., Raitt, D., Dean, S., Johnston, L. H., Deschenes, R. J., and Fassler, J. S. (1998) The yeast histidine protein kinase, Slnlp, mediates phosphotransfer to two response regulators, Ssklp and Skn7p. Embo J. 17, 6952-6962. Lu, J.M., Deschenes, R.J., and Fassler, J. S. (2003) Saccharomyces cerevisiae histidine phosphotransferase Ypdlp shuttles between the nucleus and cytoplasm for SLN1 -dependent phosphorylation of Ssklp and Skn7p. Eukaryotic Cell 2, 1304-1314. Bouquin, N., Johnson, A. L., Morgan, B. A., and Johnston, L. H. (1999) Association of the cell cycle transcription factor Mbpl with the Skn7 response regulator in budding yeast. Mol. Biol. Cell. 10, 3389-3400. Raitt, D.C., Johnson, A. L., Erkine, A. M., Makino, K , Morgan, B., Gross, D. S., and Johnston, L. H. (2000) The Skn7 response regulator of Saccharomyces cerevisiae interacts with Hsfl in vivo and is required for the induction of heat shock genes by oxidative stress. Mol. Biol .Cell. 11, 1335-2347. [68] Morgan, B.A., Banks, G. R., Toone, W. M., Raitt, D., Kuge, S., and Johnston, L. H. (1997) The Skn7 response regulator controls gene expression in the oxidative stress response of the budding yeast Saccharomyces cerevisiae. Em bo J. 16, 1035-1044. [69] Brown, J.L., North, S., and Bussey, H. (1993) SKN7, a yeast multicopy suppressor of a mutation affecting cell wall beta-glucan assembly, encodes a product with domains homologous to prokaryotic two-component regulators and to heat shock transcription factors. J. Bacteriol., 6908-6915. [70] Brown, J.L., Bussey, H., and Stewart, R. C. (1994) Yeast Skn7p functions in a eukaryotic two-component regulatory pathway. Embo J. 13, 5186-5194. [71] Raitt, D.C., Posas, F. and Saito, H. (2000) Yeast Cdc42 GTPase and Ste20 PAK-like kinase regulate Shol-dependent activation of the Hogl MAPK pathway. Embo J. 19, 4623-4631. [72] O'Rourke, S.M. and Herskowitz, I. (1998) The Hogl MAPK prevents cross talk between the HOG and pheromone response MAPK pathways in Saccharomyces cerevisiae. Genes Dev. 12, 2874-2886. [73] Ferrigno, P., Posas, F., Koepp, D., Saito, H. and Silver, P.A. (1998) Regulated nucleo/cytoplasmic exchange of HOG1 MAPK requires the importin beta homologs NMD5 zn&XPOl. Embo J. 17, 5606-5614. [74] Reiser, V., Ruis, H. and Ammerer, G. (1999) Kinase activity-dependent nuclear export opposes stress-induced nuclear accumulation and retention of Hogl mitogen-activated protein kinase in the budding yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 10, 1147-1161. [75] Rep, M., Krantz, M., Thevelein, J.M. and Hohmann, S. (2000) The transcriptional response of Saccharomyces cerevisiae to osmotic shock. Hotlp and Msn2p/Msn4p are required for the induction of subsets of high osmolarity glycerol pathway-dependent genes". J. Biol. Chem. 275, 8290-8300. 60 Posas, F., Chambers, J.R., Heyman, J.A., Hoeffler, J.P., de Nadal, E. and Arino, J. (2000) The transcriptional response of yeast to saline stress. J. Biol .Chem. 275, 17249-17255. Giaever, G , Chu, A. M., Ni, L., Connelly, C , Riles, L., Veronneau, S., Dow, S., Lucau-Danila, A., Anderson, K., Andre, B., Arkin, A. P., Astromoff, A., El-Bakkoury, M., Bangham, R., Benito, R., Brachat, S., Campanaro, S., Curtiss, M., Davis, K., Deutschbauer, A., Entian, K. D., Flaherty, P., Foury, F., Garfinkel, D. J., Gerstein, M., Gotte, D., Guldener, U., Hegemann, J. H., Hempel, S., Herman, Z., Jaramillo, D. F., Kelly, D. E., Kelly, S. L., Kotter, P., LaBonte, D., Lamb, D. C , Lan, N., Liang, H., Liao, H., Liu, L., Luo, C , Lussier, M., Mao, R., Menard, P., Ooi, S. L., Revuelta, J. L., Roberts, C. J., Rose, M., Ross-Macdonald, P., Scherens, B., Schimmack, G , Shafer, B., Shoemaker, D. D., Sookhai-Mahadeo, S., Storms, R. K, Strathern, J. N., Valle, G , Voet, M , Volckaert, G , Wang, C. Y., Ward, T. R, Wilhelmy, J., Winzeler, E. A., Yang, Y., Yen, G , Youngman, E., Yu, K, Bussey, H., Boeke, J. D., Snyder, M., Philippsen, P., Davis, R. W., and Johnston, M. (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418, 387-391. Rep, M.A., J., Thevelein, J. M., Prior, B. A., and Hohmann, S. (1999) Different signalling pathways contribute to the control of GPD1 expression by osmotic stress in Saccharomyces cerevisiae. Microbiology 145, 715-727. Rep, M., Reiser, V., Gartner, U., Thevelein, J.M., Hohmann, S., Ammerer, G , and Ruis, H. (1999) Osmotic stress-induced gene expression in Saccharomyces cerevisiae requires Msnlp and the novel nuclear factor Hotlp. Mol. Cell. Biol. 19, 5474-5485. Wurgler-Murphy, S.M., Maeda, T., Witten, E. A., and Saito, H. (1997) Regulation of the Saccharomyces cerevisiae HOG1 mitogen-activated protein kinase by the PTP2 and PTP3 protein tyrosine phosphatases. Mol. Cell. Biol. 17, 1289-1297. 61 Jacoby, T., Flanagan, H., Faykin, A., Seto, A. G., Mattison, C , and Ota, I. (1997) Two protein-tyrosine phosphatases inactivate the osmotic stress response pathway in yeast by targeting the mitogen-activated protein kinase, Hogl. J. Biol. Chem. 272, 17749-17755. Mattison, CP., and Ota, I. M. (2000) Two protein tyrosine phosphatases, Ptp2 and Ptp3, modulate the subcellular localization of the Hogl MAP kinase in yeast. Genes Dev. 14, 1229-1235. Mattison, CP., Spencer, S. S., Kresge, K. A., Lee, J., and Ota, I. M. (1999) Differential Regulation of the Cell Wall Integrity Mitogen-Activated Protein Kinase Pathway in Budding Yeast by the Protein Tyrosine Phosphatases Ptp2 and Ptp3. Mol. Cell. Biol. 19, 7651-7660. Warmka, J., Hanneman, J., Lee, J., Amin, D., and Ota, I. (2001) Ptcl, a type 2C Ser/Thr phosphatase, inactivates the HOG pathway by dephosphorylating the mitogen-activated protein kinase Hogl. Mol. Cell. Biol. 21, 51-60. Pro ft, M., and Serrano, R. (1999) Repressors and upstream repressing sequences of the stress-regulated ENAl gene in Saccharomyces cerevisiae.pZIP protein Skolp confers HOG-dependent osmotic regulation. Mol. Cell. Biol. 19, 537-546. Schuller, C , Brewster, J. L., Alexander, M. R., Gustin, M. C , and Ruis, H. (1994) The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene. Embo J. 13, 4382-4389. Akhtar, N.P., A. K, Larsson, K, Corbett, A. H., and Adler, L. (2000) SGD1 encodes an essential nuclear protein of Saccharomyces cerevisiae that affects expression of the GPD1 gene for glycerol-3-phosphate dehydrogenase. FEBS Lett. 483, 87-92. [88] Pascual-Ahuir, A., Serrano, R., and Proft, M. (2001) The Skolp repressor and Gcn4p activator anatogonistically modulate stress-regulated transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 21, 16-25. [89] Profit, M., and Struhl, K. (2002) Hogl kinase converts the Skol-Cyc8-Tupl repressor complex into an activator that recruits SAGA and SWI/SNF in response to osmotic stress. Mol. Cell. 9, 1307-1317. [90] De Nadal, E., Zapater, M., Alepuz, P. M., Sumoy, L., Mas, G., and Posas, F. (2004) The MAPK Hogl recruits Rpd3 histone deacetylase to activate osmoresponsive genes. Nature 427, 370-374. [91] Alepuz, P.M., Jovanovic, A., Reiser, V., and Ammerer, G. (2001) Stress-induced map kinase Hogl is part of transcription activation complexes. Mol. Cell. 7, 767-777. [92] Alepuz, P.M., De Nadal, E., Zapater, M., Ammerer, G., and Posas, F. (2003) Osmostress-induced transcription by Hotl depends on a Hogl-mediated recruitment of the RNA Pol II. Embo J. 22, 2433-2442. [93] Marquez, J.A., Pascual-Ahuir, A., Proft, M., and Serrano, R. (1998) The Ssn6-Tupl repressor complex of Saccharomyces cerevisiae is involved in the osmotic induction of HOG-dependent and independent genes. Embo J. 17, 2543-2553. [94] Proft, M.P.-A., A., de Nadal, E., Arino, J., Serrano, R., and Posas, F. (2001) Regulation of the Skol transcriptional repressor by the Hoglp MAP kinase in response to osmotic stress. Embo J. 20, 1123-1133. [95] Vincent, A.C., and Struhl, K. (1992) ACR1, a yeast ATF/CREB repressor. Mol. Cell. Biol. 12, 5394-5405. [96] Nehlin, J. O., Carlberg, M., and Ronne, H. (1992) Yeast SKOl gene encodes a bZIP protein that binds to the CRE motif and acts as a repressor of transcription. Nucleic Acids Res. 20, 5271-5278. [97] De Cesare, D., and Sassone-Corsi, P. (2000) Transcriptional regulation by cyclic AMP-responsive factors. Prog. Nucleic Acid Res. Mol. Biol. 64, 343-369. [98] Pascual-Ahuir, A. P., F., Serrano, R., and Proft, M. (2001) Multiple Levels of Control Regulate the Yeast cAMP-response element-binding Protein Repressor Skolp in Response to Stress. J. Biol. Chem. 276, 37373-37378. [99] Rep, M., Proft, M., Remize, F., Tamas, M., Serrano, R., Thevelein, J. M., and Hohmann, S. (2001) The Saccharomyces cerevisiae Skolp transcription factor mediates HOG pathway-dependent osmotic regulation of a set of genes encoding enzymes implicated in protection from oxidative damage. Mol. Microbiol. 40, 1067-1083. [100] Tsuji, E., Tsuji, Y., Misumi, Y., Fujita, A., Sasaguri, M., Ideishi, M., and Arakawa, K. (1996) Molecular cloning of a novel rat salt-tolerant protein by functional complementation in yeast. Biochem. Biophys. Res. Commun. 229, 134-138. [101] Martinez, R., Latreille, M. T., and Mirande, M. (1991) A PMR2 tandem repeat with a modified C-terminus is located downstream from the KRS1 gene encoding lysyl-tRNA synthetase in Saccharomyces cerevisiae. Mol. Gen. Genet. 227, 149-154. [102] Estruch, F., and Carlson, M. (1990) Increased dosage of the MS7V7 gene restores invertase expression in yeast mutants defective in the SNF1 protein kinase. Nucleic Acids Res. 18, 6959-6964. [103] Eide, D., and Guarente, L. (1992) Increased dosage of a transcriptional activator gene enhances iron- limited growth of Saccharomyces cerevisiae. J. Gen. Microbiol. 138, 347-354. [104] Cullen, P.J., and Sprague, G. F. Jr . (2000) Glucose depletion causes haploid invasive growth in yeast. Proc. Natl. Acad. Sci. USA. 97, 13619-13624. [105] Lorenz, M. C , and Heitman, J. (1998) Regulators of pseudohyphal differentiation in Saccharomyces cerevisiae identified through multicopy suppressor analysis in ammonium permease mutant strains. Genetics 150, 1443-1457. [106] de Nadal, E., Casadome, L., and Posas, F. (2003) Targeting the MEF2-Uke Transcription Factor Smpl by the Stress-Activated Hogl Mitogen-Activated Protein Kinase. Mol. Cell. Biol. 23, 229-237. [107] Lin, H., Nguyen, P., and Vancura, A. (2002) Phospholipase C interacts with Sgdlp and is required for expression of GPD1 and osmoresistance in Saccharomyces cerevisiae. Mol. Genet. Genomics 267, 313-320. [108] Hinnebusch, A.G., and Fink, G. R. (1983) Positive regulation in the general amino acid control of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA. 80, 5374-5378. [109] Norbeck, J., and Blomberg, A (2000) The level of cAMP-dependent protein kinase A activity strongly affect osmotolerance and osmo-instigated gene expression changes in Saccharomyces cerevisiae. Yeast 16, 121-137. [110] Thevelein, J.M., and de Winde, J. H. (1999) Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 33, 904-918. '. [111] Marchler, G., Schuller, C , Adam, G., and Ruis, H. (1993) A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. Embo J. 12, 1997-2003. [112] Toda, T., Cameron, S., Sass, P., Zoller, M., and Wigler, M. (1987) Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase. Cell 50, 277-287. [113] Robertson, L. S., and Fink, G. R. (1998) The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc. Natl. Acad. Sci. USA. 50, 13783-13787. [114] Tanaka, K., Matsumoto, K., and Toh-EA. (1989) IRA1, an inhibitory regulator of the RAS-cyclic AMP pathway in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 757-768. [115] Matsumoto, K., Uno, I., Oshima, Y., and Ishikawa, T. (1982) Isolation and characterization of yeast mutants deficient in adenylate cyclase and cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA. 79, 2355-2359. [116] Broek, D., Samiy, N., Fasano, O., Fujiyama, A., Tamanoi, F., Northup, J., and Wigler, M. (1985) Differential activation of yeast adenylate cyclase by wild-type and mutant RAS proteins. Cell 41, 763-769. [117] Fedor-Chaiken, M., Deschenes, R. J., and Broach, J. R. (1990) SRV2, a gene required for RAS activation of adenylate cyclase in yeast. Cell 61, 329-340. [118] Gagiano, M., Bauer, F. F., and Pretorius, I. S. (2002) The sensing of nutritional status and the relationship to filamentous growth in Saccharomyces cerevisiae. FEMS Yeast Res. 2, 433-470. [119] Lorenz, M.C., and Heitman, J. (1998) The MEP2 ammonium permease regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Embo J. 17, 1236-1247. [120] Kuret, J., Johnson, K. E., Nicolette, C , and Zoller, M. J. (1988) Mutagenesis of the regulatory subunit of yeast cAMP-dependent protein kinase. Isolation of site-directed mutants with altered binding affinity for catalytic subunit. J. Biol. Chem. 263, 9149-9154. [121] Uno, I., Matsumoto, K., and Ishikawa, T. (1983) Characterization of a cyclic nucleotide phosphodiesterase-deficient mutant in yeast. J. Biol. Chem. 258, 3539-3542. [122] Wilson, R.B., and Tatchell, K. (1988) SRA5 encodes the low-Km cyclic AMP phosphodiesterase of Saccharomyces cerevisiae. Mol. Cell. Biol. 8, 505-510. [123] Gorner, W., Durchschlag, E., Martinez-Pastor, M. T., Estruch, F., Ammerer, G., Hamilton, B., Ruis, H., and Schuller, C. (1998) Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12, 586-597. [124] Estruch, F., and Carlson, M. (1993) Two homologous zinc finger genes identified by multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae. Mol. Cell. Biol. 13,3872-3881. [125] Schmitt, A.P., and McEntee, K. (1996) Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA. 93, 5777-5782. [126] Chi, Y., Huddleston, M. J., Zhang, X., Young, R. A., Annan, R. S., Carr, S. A., and Deshaies, R. J. (2001) Negative regulation of Gcn4 and Msn2 transcription factors by SrblO cyclin-dependent kinase. Genes Dev. 15, 1078-1092. [127] Martinez-Pastor, M.T., Marchler, G., Schuller, C , Marchler-Bauer, A., Ruis, H. and Estruch, F. (1996) The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). Embo J. 15, 2227-2235. [128] Kobayashi, N., and McEntee, K. (1993) Identification of cis and trans components of a novel heat shock stress regulatory pathway in Saccharomyces cerevisiae. Mol. Cell. Biol. 13, 248-256. [129] Kaida, D., Yashiroda, H., Toh-e, A., and Kikuchi, Y. (2002) Yeast Whi2 and Psrl-phosphatase form a complex and regulate STRE-mediated gene expression. Genes Cells 7, 543-552. [130] Siniossoglou, S., Hurt, E. C , and Pelham, H. R. B. (2000) Psrlp/Psr2p, two plasma membrane phosphatases with an essential DXDX(T/V) motif required for sodium stress response in yeast. J. Biol. Chem. 275, 19352-19360. [131] Holstege, F. C. P., Jennings, E. G., Wyrick, J. J., Lee, T. I., Hengartner, C. J., Green, M. R., Golub, T. R., Lander, E. S., and Young, R. A. (1998) Dissecting the Regulatory Circuitry of a eukaryotic genome. Cell 95, 717-728. [132] Heitman, J., Movva, N. R., and Hall, M. N. (1991) Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253, 905-909. [133] Cafferkey, R., Young, P. R., McLaughlin, M. M., Bergsma, D. J., Koltin, Y., Sathe, G. M., Faucette, L., Eng, W. K., Johnson, R. K., and Livi, G. P. (1993) Dominant missense mutations in a novel yeast protein related to mammalian phosphatidylinositol 3-kinase and VPS34 abrogate rapamycin cytotoxicity. Mol. Cell. Biol. 13, 6012-6023. [134] Kunz, J., Henriquez, R., Schneider, U., Deuter-Reinhard, M., Movva, N. R., and Hall, M. N. (1993) Target of rapamycin in yeast, TOR2, is an essential phosphatidylinositol kinase homolog required for Gl progression. Cell 73, 585-596. [135] Barbet, N.C., Schneider, U., Helliwell, S. B., Stansfield, I., Tuite, M. F., and Hall, M. N. (1996) TOR controls translation initiation and early Gl progression in yeast. Mol. Biol. Cell. 7, 25-42. [136] Schmidt, A., Bickle, M., Beck, T., and Hall, M. N. (1997) The yeast phosphatidylinositol kinase homolog TOR2 activates RHOl and RH02 via the exchange factor ROM2. Cell. 88, 531-542. [137] Powers, T., and Walter, P. (1999) Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae. Mol. Biol. Cell. 10, 97-1000. [138] Hardwick, J.S., Kuruvilla, F. G., Tong, J. K., Shamji, A. F., and Schreiber, S. L. (1999) Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proc. Natl. Acad. Sci. USA. 96, 14866-14870. [139] Schmelzle, T., and Hall, M. N. (2000) TOR, a Central Controller of Cell Growth. Cell 103, 253-262. [140] Beck, T., and Hall, M. N. (1999) The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402, 689-692. [141] Di Como, C.J., and Arndt, K. T. (1996) Nutrients, via the Tor proteins, stimulate the association of Tap42 with type 2A phosphatases. Genes Dev. 10, 1904-1916. [142] Bertram, P.G., Zeng, C , Thorson, J., Shaw, A. S., and Zheng, X. F. (1998) The 14-3-3 proteins positively regulate rapamycin-sensitive signalling. Curr. Biol. 8, 1259-1267. [143] Schmelzle, T., Beck, T., Martin, D. E., and Hall, M. N. (2004) Activation of the RAS/cyclic AMP pathway suppresses a TOR deficiency in yeast. Mol. Cell. Biol. 24, 338-351. [144] Pedruzzi, I., Dubouloz, F., Cameroni, E., Wanke, V., Roosen, J., Winderickx, J., and De Virgilio, C. (2003) TOR and PKA signaling pathways converge on the protein kinase Riml5 to control entry into GO. Mol. Cell. 12, 1607-1613. [145] Reinders, A., Burckert, N., Boiler, T., Wiemken, A , and DeVirgilio, C. (1998) Saccharomyces cerevisiae cAMP-dependent protein kinase controls entry into stationary phase through the Riml5p protein kinase. Genes Dev. 12, 2943-2955. [146] Yale, J. and Bohnert, H.J. (2001) Transcript expression in Saccharomyces cerevisiae at high salinity. J. Biol. Chem. 276,15996-6007. [147] Athenstaedt, K., Weys, S., Paltauf, F. and Daum, G. (1999) Redundant systems of phosphatidic acid biosynthesis via acylation of glycerol-3-phosphate or 69 dihydroxyacetone phosphate in the yeast Saccharomyces cerevisiae. J. Bacteriol. 181, 1458-1463. [148] Prior, B.A., and Hohmann, S. (1997) Glycerol production and osmoregulation in: Yeast Sugar Metabolism, (Zimmermann, F.K. and Entian, K. D., Ed.) Technomic, Lancaster, pp.313-337 [149] Nevoigt, E. and Stahl, U. (1997) Osmoregulation and glycerol metabolism in the yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 21, 231-241. [150] Racenis, P.V., Lai, J. L., Das, A. K., Mullick, P. C , Hajra, A. K. and Greenberg, M. L. (1992) The acyl dihydroxyacetone phosphate pathway enzymes for glycerolipid biosynthesis are present in the yeast Saccharomyces cerevisiae. J Bacteriol. 174, 5702-5710. [151] Van Dijken, J.P., and Scheffers, W. A (1986) Redox balance in the metabolism of sugars by yeasts. FEMS Microbiol. Rev. 32, 199-224. [152] Brown, A. D., and Edgley, M. (1979) Osmoregulation in yeast. Basic Life Sci. 14, 75-90. [153] Blomberg, A., and Adler, L. (1989) Roles of glycerol and glycerol-3-phosphate dehydrogenase (NAD+) in acquired osmotolerance of Saccharomyces cerevisiae. J. Bacteriol. 171, 1087-1092. [154] Shen, B., Hohmann, S., Jensen, R. G., and Bohnert, H. J. (1999) Roles of sugar alcohols in osmotic stress adaptation. Replacement of glycerol by mannitol and sorbitol in yeast. Plant Physiol. 121, 45-52. [155] Wang, Z.-X., Zhuge, J., Fang, H., and Prior, B. A. (2001) Glycerol production by microbial fermentation: A review. Biotechnol. Adv. 19, 201-223. [156] Pavlik, P., Simon, M., Schuster, T., and Ruis, H. (1993) The glycerol kinase (GUT1) gene of Saccharomyces cerevisiae: cloning and characterization. Curr. Genet. 24, 21-25. 70 [157] Ronnow, B., and Kielland-Brandt, M. C. (1993) GUT2, a gene for mitochondrial glycerol 3-phosphate dehydrogenase of Saccharomyces cerevisiae. Yeast. 9, 1121-1130. [158] Albertyn, J., Hohmann, S., Thevelein, J. M., and Prior, B. A. (1994) GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14, 4135-4144. [159] Ansell, R., Granath, K., Hohmann, S., Thevelein, J. M., and Adler, L. (1997) The two isoenzymes for yeast NAD+-dependent glycerol 3-phosphate dehydrogenase encoded by GPD1 and GPD2 have distinct roles in osmoadaptation and redox regulation. Embo J. 16,2179-2187. [160] Bjorkqvist, S., Ansell, R., Adler, L., and Liden, G. (1997) Physiological response to anaerobicity of glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 63, 128-132. [161] Larsson, K., Ansell, R., Eriksson, P., and Adler, L. (1993) A gene encoding sn-glycerol 3-phosphate dehydrogenase (NAD+) complements an osmosensitive mutant of Saccharomyces cerevisiae. Mol Microbiol. 10, 1101-1111. [162] Eriksson, P., Andre, L., Ansell, R., Blomberg, A., and Adler, L. (1995) Cloning and characterization of GPD2, a second gene encoding sn- glycerol 3-phosphate dehydrogenase (NAD+) in Saccharomyces cerevisiae, and its comparison with GPDL Mol. Microbiol. 17, 95-107. [163] Norbeck, J., Pahlman, A.K., Akhtar, N., Blomberg, A. and Adler, L. (1996) Purification and characterization of two isoenzymes of DL-glycerol-3- phosphatase from Saccharomyces cerevisiae. Identification of the corresponding GPP1 and GPP2 genes and evidence for osmotic regulation of Gpp2p expression by the osmosensing 71 mitogen-activated protein kinase signal transduction pathway. J. Biol. Chem. 271, 13875-13881. [164] Norbeck, J., and Blomberg, A. (1997) Metabolic and regulatory changes associated with growth of Saccharomyces cerevisiae in 1.4 M NaCl. Evidence for osmotic induction of glycerol dissimilation via the dihydroxyacetone pathway. J. Biol. Chem. 272, 5544-5554. [165] Pahlman, A.K., Granath, K., Ansell, R., Hohmann, S., and Adler, L. (2001) The yeast glycerol 3-phosphatases Gpplp and Gpp2p are required for glycerol biosynthesis and differentially involved in the cellular responses to osmotic, anaerobic, and oxidative stress. J. Biol. Chem. 276, 3555-3563. [166] Van Zyl, P.J., Prior, B. A., and Killian, S. G. (1991) Regulation of glycerol metabolism in Zygosaccharomyces rouxii in response to osmotic stress. Appl. Microbiol. Biotechnol. 36, 369-374. [167] Bruinenberg, P.M., Jonker, R., Van Dijken, J. P., and Scheffers, W. A. (1985) Utilization of formate as an additional energy source by glucose-limited chemostat cultures of Candida utilis CBS 621 and Saccharomyces cerevisiae CBS 8066. Evidence for the absence of transdehydrogenase activity in yeasts. Arch. Microbiol. 142, 302-306. [168] Nissen, T. L., Anderlund, M., Nielsen, J., Villadsen, J., and Kielland-Brandt, M. C. (2001) Expression of a cytoplasmic transdehydrogenase in Saccharomyces cerevisiae results in formation of 2-oxoglutarate due to depletion of the NADPH pool. Yeast 18, 19-32. [169] Blomberg, A. (2000) Metabolic surprises in Saccharomyces cerevisiae during adaptation to saline conditions: questions, some answers and a model. FEMS Microbiol. Lett. 182, 1-8. 72 [170] Molin, M., Norbeck, J., and Blomberg, A. (2003) Dihydroxyacetone kinases in Saccharomyces cerevisiae are involved in detoxification of dihydroxyacetone. J. Biol. Chem. 278, 1415-1423. [171] Eriksson, P., Alipour, H., Adler, L., and Blomberg, A (2000) Raplp-binding sites in the Saccharomyces cerevisiae GPD1 promoter are involved in its response to NaCl. J. Biol. Chem. 275, 29368-293676. [172] Kempf, B., and Bremer, E. (1998) Uptake and synthesis of compatible solutes as microbial stress responses to high-osmolarity environments. Arch. Microbiol. 170, 319-330. [173] Strom, A.R., and Kaasen, I. (1993) Trehalose metabolism in Escherichia coli: stress protection and stress regulation of gene expression. Mol. Microbiol. 8, 205-210. [174] Hounsa, C.-H., Brandt, E. V., Thevelein, J., Hohmann. S., and Prior, B. A. (1998) Role of trehalose in survival of Saccharomyces cerevisiae under osmotic stress. Microbiology 144, 671-680. [175] Parrou, J. L., Teste, M-A., Francois, J. (1997) Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose. Microbiology 143, 1891-1900. [176] Gancedo, C , and Flores, C-L. (2004) The importance of a functional trehalose biosynthetic pathway for the life of yeasts and fungi. FEMS Yeast Res. 4, 351-359. [ 177] Hottiger, T., Boiler, T., and Wiemken, A. (1987) Rapid changes in heat and dessication tolerance correlated with changes of trehalose content in Saccharomyces cerevisiae cells subjected to temperature shifts. FEBS Lett. 220, 113-115. [178] Sano, F., Asakawa, Y., Inoue, Y., and Sakurai, M. (1999) A dual role for intracellular trehalose in the resistance of yeast cells to water stress. Cryobiology 39, 80-87. [179] Singer, M.A., and Lindquist, S. (1998) Thermotolerance in Saccharomyces cerevisiae: the yin and yang of trehalose. Trends Biotechnol. 16, 460-468. [180] Crowe, J.H., Crowe L. M., and Chapman, D. (1994) Preservation of membranes in anhydrobiotic organisms: the role of trehalose. Science 223, 701-703. [181] Hottiger, T., de Virgilio, C , Hall, M. N., Boiler, T., and Wiemken, A. (1994) The role of trehalose synthesis for the acquisition of thermotolerance in yeast. II. Physiological concentrations of trehalose increase the thermal stability of proteins in vitro. Eur. J. Biochem. 219, 187-193. [182] Samokhvalov, V., Ignatov, V., and Kondrashova, M. (2004) Reserve carbohydrates maintain the viability of Saccharomyces cerevisiae cells during chronological aging. Mech. Ageing Dev. 125, 229-235. [183] Francois J., Villanueva, M. E., and Hers, H. G. (1988) The control of glycogen metabolism in yeast. 1. Interconversion in vivo of glycogen synthase and glycogen phosphorylase induced by glucose, a nitrogen source or uncouplers. Eur. J. Biochem. 174, 551-559. [184] Paalman, J.W., Verwaal, R., Slofstra, S. H., Verkleij, A. J., Boonstra, J., and Verrips, C. T. (2004) Trehalose and glycogen accumulation is related to the duration of the Gl phase of Saccharomyces cerevisiae. FEMS Yeast Res. 3, 261-268. [185] Sillje, H. H., ter Schure, E. G., Rommens, A. J., Huls, P. G., Woldringh, C. L., Verkleij, A. J., Boonstra, J., and Verrips, C. T. (1997) Effects of different carbon fluxes on Gl phase duration, cyclin expression, and reserve carbohydrate metabolism in Saccharomyces cerevisiae. J. Bacteriol. 179, 6560-6565. [186] Sillje, H. H., Paalman, J. W., ter Schure, E. G., Olsthoorn, S. Q., Verkleij, A. J., Boonstra, J., and Verrips, C. T. (1999) Function of trehalose and glycogen in cell cycle progression and cell viability in Saccharomyces cerevisiae. J. Bacteriol. 181, 396-400. [187] Mendenhall, M.D., and Hodge, A. E. (1998) Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62, 1191-1243. [188] Francois, J., and Parrou, J. L. (2001) Reserve carbohydrates metabolism in the yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25, 125-145. [189] Reinders, A., Burckert, N., Hohmann, S., Thevelein, J. M., Boiler, T., Wiemken, A., and De Virgilio, C. (1997) Structural analysis of the subunits of the trehalose-6-phosphate synthase/phosphatase complex in Saccharomyces cerevisiae and their function during heat shock. Mol. Microbiol. 24, 687-695. [190] Bell, W., Sun, W., Hohmann, S., Wera, S., Reinders, A., De Virgilio, C , Wiemken, A., and Thevelein, J. M. (1998) Composition and functional analysis of the Saccharomyces cerevisiae trehalose synthase complex. J. Biol. Chem. 273, 33311-33319. [191] Bell, W., Klaassen, P., Ohnacker, M., Boiler, T., Herweijer, M., Schoppink, P., Van der Zee. P., and Wiemken, A. (1992) Characterization of the 56-kDa subunit of yeast trehalose-6-phosphate synthase and cloning of its gene reveal its identity with the product of CIF1, aregulator of carbon catabolite inactivation. Eur. J. Biochem. 209, 951-959. [192] Vuorio, O.E., Kalkkinen, N., and Lodesborough, J. (1993) Cloning of two related genes encoding the 56-kDa and 123-kDa subunits of trehalose synthase from the yeast Saccharomyces cerevisiae. Eur. J. Biochem. 216, 849-861. [193] De Virgilio, C , Burckert, N , Bell, W., Jeno, P., Boiler, T., and Wienken, A , (1993) Disruption of TPS2, the gene encoding the 100-kDa subunit of the trehalose-6-phosphate synthase/phosphatase complex in Saccharomyces cerevisiae, causes accumulation of trehalose-6-phosphate and loss of trehalose-6-phosphate phosphatase acitivity. Eur. J. Biochem. 212, 315-323. [194] App, H., and Holzer, H. (1989) Purification and characterization of neutral trehalase from the yeast ABYS1 mutant. J. Biol. Chem. 264, 17583-17588. [195] Nwaka, S., Kopp, M., and Holzer, H. (1995) Expression and function of the trehalase genes NTH1 and YBR0106 in Saccharomyces cerevisiae. J. Biol. Chem. 240, 10193-10198. [196] Daran, J.M., Dallies, N., Thines-Sempoux, D., Paquet, V., and Francois, J. (1995) Genetic and biochemical characterization of the UGP1 gene encoding the UDP-glucose pyrophosphorylase from Saccharomyces cerevisiae. Eur. J. Biochem. 233, 520-530. [197] Mu, J., Cheng, C , and Roach, P. J. (1996) Initiation of glycogen synthesis in yeast. Requirement of multiple tyrosine residues for function of self-glycosylating Gig proteins in vivo. J. Biol. Chem. 271, 26554-26560. [198] Farkas, I., Hardy, T.A., Goebl., M. G , and Roach, P. J. (1991) Two glycogen synthase isoforms in Saccharomyces cerevisiae are coded by distinct genes that are differentially controlled. J. Biol. Chem. 266, 15602-15607. [199] Hwang, P. K., Tugendreich, S., and Fletterick, R. J. (1989) Molecular analysis of GPHI, the gene encoding glycogen phosphorylase in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 1659-1666. [200] Varela, J.C., Praekelt, U. M., Meacock, P. A., Planta, R. J., and Mager, W. H. (1995) The Saccharomyces cerevisiae HSP12 gene is activated by the high-osmolarity glycerol pathway and negatively regulated by protein kinase A. Mol. Cell. Biol. 15, 6232-6245. [201] Winderickx, J., de Winde, J. H., Crauwels, M., Hino, A., Hohmann, S., Van Dijck, P., and Thevelein, J. M. (1996) Regulation of genes encoding subunits of the trehalose synthase complex in Saccharomyces cerevisiae: novel variations of STRE-mediated transcription control? Mol. Gen. Genet. 252, 470-482. [202] Neves, M.J., and Francois, J. (1992) On the mechanism by which a heat shock induces trehalose accumulation in Saccharomyces cerevisiae. Biochem. J. 288, 859-864. [203] Nwaka, S., Mechler, B., Destruelle, M., and Holzer, H. (1995) Phenotypic features of trehalase mutants in Saccharomyces cerevisae. FEBS Lett. 360, 286-290. [204] Wohler Sunnarborg, S., Miller, S. P., Unnikrishnan, I., and LaPorte, D. C. (2001) Expression of the yeast glycogen phosphorylase gene is regulated by stress-response elements and by the HOG MAP kinase pathway. Yeast 18, 1505-1514. [205] Teusink, B., Walsh, M. C , van Dam, K. and Westerhoff, H. V. (1998) The danger of metabolic pathways with turbo design. Trends Biochem Sci. 23, 162-169. [206] Van Aelst, L., Hohmann, S., Zimmermann, F. K., Jans, A. W. and Thevelein, J. M. (1991) A yeast homologue of the bovine lens fibre MIP gene family complements the growth defect of a Saccharomyces cerevisiae mutant on fermentable sugars but not its defect in glucose-induced RAS-mediated cAMP signalling. Embo J. 10, 2095-2104. [207] Thevelein, J. M., and Hohmann, S. (1995) Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem. Sci. 20, 3-10. [208] Neves, M.J., Hohmann, S., Bell, W., Dumortier, F., Luyten, K., Ramos, J., Cobbaert, P., de Koning, W., Kaneva, Z., and Thevelein, J. M. (1995) Control of glucose influx into glycolysis and pleiotropic effects studied in different isogenic sets of Saccharomyces cerevisiae mutants in trehalose biosynthesis. Curr. Genet. 27, 110-122. [209] Hohmann, S., Neves, M.J., de Koning, W., Alijo, R., Ramos, J. and Thevelein, J. M. (1993) The growth and signalling defects of the ggsl (fdpl/bypl) deletion mutant on glucose are suppressed by a deletion of the gene encoding hexokinase PH. Curr. Genet. 23,281-289. 77 [210] Blazquez, M. A., Lagunas, R., Gancedo, C. and Gancedo, J.M. (1993) Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexokinases. FEBS Lett. 329, 51-54. [211] Vandercammen, A., Francois, J., and Hers, H. G. (1989) Characterization of trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase of Saccharomyces cerevisiae. Eur. J. Biochem. 182, 613-620. [212] Londesborough, J., and Vuorio, O. E. (1993) Purification of trehalose synthase from Baker's yeast. Its temperature-dependent activation by fructose-6-phosphate and inhibition by phosphate. Eur. J. Biochem. 216, 841-848. [213] Luyten, K., Albertyn, J., Skibbe, W. F., Prior, B. A., Ramos, J., Thevelein, J. M„ and Hohmann, S. (1995) Fpsl, a yeast member of the MIP family of channel proteins, is a facilitator for glycerol uptake and efflux and is inactive under osmotic stress. Embo J. 14, 1360-1371. [214] Winkler, K., Kienle, I., Burgert, M., Wagner, J-C, and Holzer, H. (1991) Metabolic regulation of trehalose content of vegetative yeast. FEBS Lett. 291, 269-272. [215] Boles, E., Heinisch, J., and Zimmermann, F. K. (1993) Different signals control the activation of glycolysis in the yeast Saccharomyces cerevisiae. Yeast 9, 761-770. [216] Teusink, B. et al. (2000) Can yeast glycolysis be understood in terms of in vitro kinetics of the constituent enzymes? Testing biochemistry. Eur. J. Biochem. 267, 5313-5329. [217] Phillips, S.A., and Thornalley, P. J. (1993) The formation of methylglyoxal from triose phosphates. Investigation using a specific assay for methylglyoxal. Eur. J. Biochem. 212, 101-105. [218] Blomberg, A. (1995) Global changes in protein synthesis during adaptation of the yeast Saccharomyces cerevisiae to 0.7 M NaCl. J. Bacteriol. 177, 3563-3572. 78 [219] Luyten, K., de Koning, W., Tesseur, I., Ruiz, M.C., Ramos, J., Cobbaert, P., Thevelein, J. M. and Hohmann, S. (1993) Disruption of the Kluyveromyces lactis GGS1 gene causes inability to grow on glucose and fructose and is suppressed by mutations that reduce sugar uptake. Eur. J. Biochem. 217, 701-713. [220] Bro, C , Regenberg, B., Lagniel, G., Labarre, J., Montero-Lomeli, M., and Nielsen, J. (2003) Transcriptional, proteomic, and metabolic responses to lithium in galactose-grown yeast cells. J. Biol. Chem. 278, 31141-32149. [221] Michnick, S., Roustan, J.L., Remize, F., Barre, P. and Dequin, S. (1997) Modulation of glycerol and ethanol yields during alcoholic fermentation in Saccharomyces cerevisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3-phosphate dehydrogenase. Yeast 13, 783-793. [222] Remize, F., Roustan, J.L., Sablayrolles, J.M., Barre, P. and Dequin, S. (1999) Glycerol overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes in by-product formation and to a stimulation of fermentation rate in stationary phase. Appl. Environ. Microbiol. 65, 143-149. [223] Valadi, H., Larsson, C. and Gustafsson, L. (1998) Improved ethanol production by glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 50, 434-439. [224] Eglinton, J. M., Heinrich, A.J., Pollnitz, A. P., Langridge, P., Henschke, P. A. and de Barros Lopes, M. (2002) Decreasing acetic acid accumulation by a glycerol overproducing strain of Saccharomyces cerevisiae by deleting the ALD6 aldehyde dehydrogenase gene. Yeast 19, 295-301. [225] Navarro-Avino, J. P., Prasad, R., Miralles, V. J., Benito, R. M. and Serrano, R. (1999) A proposal for nomenclature of aldehyde dehydrogenases in Saccharomyces cerevisiae and characterization of the stress-inducible ALD2 and ALD3 genes. Yeast 15, 829-842. [226] Remize, F., Andrieu, E. and Dequin, S. (2000) Engineering of the pyruvate dehydrogenase bypass in Saccharomyces cerevisiae: role of the cytosolic Mg(2+) and mitochondrial K(+) acetaldehyde dehydrogenases Ald6p and Ald4p in acetate formation during alcoholic fermentation. Appl. Environ. Microbiol. 66, 3151-3159. [227] Miralles, V.J., and Serrano, R. (1995) A genomic locus in Saccharomyces cerevisiae with four genes up-regulated by osmotic stress. Mol. Microbiol. 17, 653-662. [228] Boy-Marcotte, E., Perrot, M., Bussereau, F., Boucherie, H., and Jaquet, M. (1998) Msn2p and Msn4p Control a Large Number of Genes Induced at the Diauxic Transition Which Are Repressed by Cyclic AMP in Saccharomyces cerevisiae. J. Bacteriol. 180, 1044-1052. [229] Aranda, A., and Del Olmo M, M. (2003) Response to acetaldehyde stress in the yeast Saccharomyces cerevisiae involves a strain-dependent regulation of several ALD genes and is mediatedby the general stress response pathway. Yeast 20, 747-759. [230] White, W.H., Skatrud, P. L., Xue, Z., and Toyn, J. H. (2003) Specialization of Function Among Aldehyde Dehydrogenases. The aldl and aldS genes are required for beta-alanine biosynthesis in Saccharomyces cerevisiae. Genetics 163, 69-77. [231] Tessier, W. D., Meaden P. G., Dickinson, F. M., and Midgley, M. (1998) Identification and disruption of the gene encoding the K+-activated acetaldehyde dehydrogenase of Saccharomyces cerevisiae. FEMS Microbiol. Lett. 164, 29-34. [232] Wang, X.P., Mann, C. J , Bai, Y. L., Ni, L., and Weiner, H. (1998) Molecular cloning, characterization, and potential roles of cytosolic and mitochondrial aldehyde dehydrogenases in ethanol metabolism in Saccharomyces cerevisiae. J. Bacteriol. 180,822-830. [233] Boubekeur, S., Camougrand, N., Bunoust, O., Rigoulet, M., and Guerin, B. (2001) Participation of acetaldehyde dehydrogenases in ethanol and pyruvate metabolism of the yeast Saccharomyces cerevisiae. Eur. J. Biochem. 268, 5057-5065. [234] Ohlmeier, S., Kastaniotis, A. J., Hiltunen, J. K., and Bergmann, U. (2004) The yeast mitochondrial proteome, a study of fermentative and respiratory growth. J. Biol. Chem. 279, 3956-3979. [235] Raamsdonk, L.M., Diderich, J. A., Kuiper, A., van Gaalen, M., Kruckberg, A. L., Berden, J. A., and Van Dam, K. (2001) Co-consumption of sugars or ethanol and glucose in a Saccharomyces cerevisiae strain deleted in the HXK2 gene. Yeast 18, 1023-1033. [236] Erickson, J.R., and Johnston, M. (1994) Suppressors reveal two classes of glucose repression genes in the yeast Saccharomyces cerevisiae. Genetics 136, 1271-1278. [237] Kal, A. J., van Zonneveld, A. J., Benes, V., van den Berg, M., Koerkamp, M. G., Albermann, K., Strack, N., Ruijter, J. M., Richter, A., Dujon, B., Ansorge, W., and Tabak, H. F. (1999) Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources. Mol. Biol. Cell. 10, 1859-1872. [238] Kurita, O., and Nishida, Y. (1999) Involvement of mitochondrial aldehyde dehydrogenase ALD5 in maintenance of the mitochondrial electron transport chain in Saccharomyces cerevisiae. FEMS Microbiol Lett. 181, 281-287. [239] Saint-Prix, F., Bonquist, L., and Dequin, S. (2004) Functional analysis of the ALD gene family of Saccharomyces cerevisiae during anaerobic growth on glucose: the NADP+-dependent Ald6p and Ald5p isoforms play a major role in acetate formation. Microbiology 150, 2209-2220. [240] Meaden, P.G., Dickinson, F. M., Mifsud, A., Tessier, W., Westwater, J., Bussey, H., and Midgley, M. (1997) The ALD6 gene of Saccharomyces cerevisiae encodes a cytosolic, Mg2+-activated acetaldehyde dehydrogenase. Yeast 13, 1319-1327. 81 [241] Dickinson, F.M. (1996) The purification and some properties of the Mg(2+)-activated cytosolic aldehyde dehydrogenase of Saccharomyces cerevisiae. Biochem. J. 315, 393-399. [242] Grabowska, D., and Chelstowska, A. (2003) The ALD6 gene product is indispensable for providing NADPH in yeast cells lacking glucose-6-phosphate dehydrogenase activity. J. Biol. Chem. 278, 13984-13988. [243] Akhtar, N., Blomberg, A., and Adler, L. (1997) Osmoregulation and protein expression in a pbs2delta mutant of Saccharomyces cerevisiae during adaptation to hypersaline stress. FEBS Lett. 403, 173-180. [244] Millan, C , and Ortega, J. M. (1988) Production of Ethanol, Acetaldehyde, and Acetic acid in Wine by various Yeast Races: Role of Alcohol and Aldehyde dehydrogenase. Am. J. Enol. Vitic. 39, 107-112. [245] Millan, C , Maurico, J. C , and Ortega, J. M. (1990) Alcohol and aldehyde dehydrogenase from Saccharomyces cerevisiae: specific activity and influence on the production of acetic acid, ethanol and higher alcohols in the first 48h of fermentation of grape must. Microbios 64, 93-101. [246] Drysdale, G.S., and Fleet, G.H. (1988) Acetic acid bacteria in winemaking: A review. Am. J. Enol. Vitic. 39, 143-154. [247] Fleet, G.H., and Heard, G.M. (1993) in: Wine Microbiology and Biotechnology, pp. 27-54 (Fleet, G.H., Ed.) Harwood Academic Publishers, Chur. [248] Monk, P.R., and Cowley, P. J. (1984) Effect of nicotinic acid and sugar concentration of grape juice and temperature on accumulation of acetic acid during yeast fermentation. J. Ferment. Technol. 62, 515-521. [249] Shimazu, Y., and Watanabe, M. (1981) Effects of yeast strains and environmental conditions on the formation of organic acids in must fermentation. J. Ferm. Tech. 59, 27-32. [250] Subden, R.E., Husnik, J. I., van Twest, R., van der Merwe, G. K., and H. J. J. van Vuuren (2003) Autochthonous microbial population in a Niagara Peninsula Icewine must. Food Res. Int. 36, 747-751. [251] Fennema, O.R. (1996) Food Chemistry. Marcel Dekker Inc., New York, NY. [252] Kenyon, CP., Prior, B.A. and van Vuuren, H.J.J. (1986) Water relations of ethanol fermentation by Saccharomyces cerevisiae: glycerol production under solute stress. Enzyme Microbial. Technol. 8, 461-464. [253] Margalit, Y. (1997) Concepts in Wine Chemistry. The Wine appreciation Guild Ltd., San Francisco, CA. [254] Fundira, M., Blom, M., Pretorius, I. S., and van Rensburg, P. (2002) Selection of yeast starter culture strains for the production of marula fruit wines and distillates. J. Agric. Food. Chem. 50, 1535-1542. [255] Patel, S., and Shibamoto, T. (2002) Effect of different strains of Saccharomyces cerevisiae on production of volatiles in Napa Gamay wine and Petite Sirah wine. J. Agric. Food Chem. 50, 5649-5653. [256] Reynolds, A. G , Edwards, C. G , Cliff, M. A., Thorngate III, J. H., and Marr, J. C. (2001) Evaluation of Yeast strains during Fermentation of Riesling and Chenin blanc musts. Am. J. Enol. Vitic. 52, 336-343. [257] Delfini, C , and Cervetti, F. (1991) Metabolic and technological factors affecting acetic acid production by yeasts during alcoholic fermentation. Vitic. Enol. Sci. 46, 142-150. [258] Remize, F., Sablayrolles, J. M., and Dequin, S. (2000) Re-assessment of the influence of yeast strain and environmetal factors on glycerol production in wine. J. Appl. Microbiol. 88, 371-378. [259] Delfini, C , and Costa, A. (1993) Effects of grape must lees and insoluble materials on the alcoholic fermentation rate and the production of acetic acid, pyruvic acid, and acetaldehyde. Am. J. Enol. Vitic. 44, 86-92. [260] Garcia Moruno, E., Delfini, C , Pessione, E., and Giunta, C. (1993) Factors affecting acetic acid production by yeasts in strongly clarified grape musts. Microbios 74, 249-256. [261] Radler, F., and Schuts, H. (1982) Glycerol production of various strains of Saccharomyces cerevisiae. Am. J. Enol. Vitic. 33, 36-40. [262] Scanes, K. T., Hohmann, S., and Prior, B. A. (1998) Glycerol Production by the Yeast Saccharomyces cerevisiae and its Relevance to Wine: A Review. S. Afr. J. Enol. Vitic. 19, 17-24. [263] Rankine, B. C , and Bridson, D. A. (1971) Glycerol in Australian wines and factors influencing its formation. Am. J. Enol. Vitic. 22, 6-12. [264] Gardner, N., Rodrigue, N., and Champagne, C. P. (1993) Combined effects of sulphites, temperature, and agitation time on production of glycerol in grape juice by Saccharomyces cerevisiae. Appl. Environ. Microbiol. 59, 2022-2028. [265] Ough, C. S., Fong, D., and Amerine, M. A. (1972) Glycerol in wine: determination and some factors affecting. Am. J. Enol. Vitic. 23, 1-5. [266] Bely, M., Rinaldi, A., and Dubourdieu, D. (2003) Influence of assimilable nitrogen on volatile acidity production by Saccharomyces cerevisiae during high sugar fermentation. J. BioSc. Bioeng. 96, 507-512. [267] Agenbach, W.A. (1977) A study of must nitrogen content in relation to incomplete fermentations, yeast production and fermentation activity in: Proc. S. Afr. Soc. Enol. Vitic, pp. 66-87 Stellenbosch S. A., Cape Town. 84 [268] Albers, E., Larsson, C , Liden, G., Niklasson, C , and Gustafsson, L. (1996) Influence of the nitrogen source on Saccharomyces cerevisiae anaerobic growth and product formation. Appl. Environ. Microbiol. 62, 3187-3195. [269] Frivik, S. K., and Ebeler, S. E. (2003) Influence of sulfur dioxide on the formation of aldehydes in white wine. Am. J. Enol. Vitic. 54, 31-38. 85 Chapter 2 Genome-wide expression analyses: Metabolic adaptation of Saccharomyces cerevisiae to high sugar stress Part of this work was published in FEMS Yeast Research as: Daniel J. Erasmus, George K. van der Merwe, and Hennie J. J. van Vuuren. (2003) Genome-wide expression analyses: Metabolic adaptation of Saccharomyces cerevisiae to high sugar stress. FEMS Yeast Res. 3, 375-399. 86 2.1 Introduction The regulatory circuits of the yeast Saccharomyces cerevisiae are being analyzed extensively using DNA microarray technology and the transcriptional response of laboratory strains of S. cerevisiae to salt or sorbitol stress is well documented [1-3]. These pioneering studies have yielded valuable and novel data on how the yeast adapts to these stress conditions. Studies on laboratory strains of S. cerevisiae have served us well and we have accumulated a vast amount of information on the genetics and physiology of this yeast. However, for most part laboratory strains are derived from an exceedingly small number of progenitors, which have been crippled by successive mutations. In addition, laboratory media and growth conditions are vastly different from those that wild type yeast strains encounter in nature or some commercial applications. S. cerevisiae is routinely used for the production of wine and it also encounters high concentrations of sugars in its natural environment of rotting fruits. Grape must used for wine production usually contains 16% to 26% (w/v) sugars [4]. For the production of noble late harvest or ice wines, however, sugar concentrations may be as high as 50% (w/v). The metabolic pathways in S. cerevisiae under these fermentative conditions have not been studied and the transcriptional response of this yeast to sugar stress has not been investigated. The osmoregulatory response in S. cerevisiae has been well characterized [1,5-20]. In addition to the HOG pathway, the RAS-cAMP PKA pathway is involved in regulating cell growth, carbon storage and stress response [21-24]. S. cerevisiae adapts to increased osmotic stress by enhanced production of intracellular glycerol as the main compatible solute to counter-balance the osmotic pressure (for reviews see [10,25-27]). The key step of glycerol synthesis is catalyzed by an NADH-dependent cytosolic glycerol-3-phosphate dehydrogenase that converts dihydroxyacetone phosphate to glycerol-3-phosphate with the production of NAD + . Two isoforms of this enzyme are encoded by the GPD1 [28] and GPD2 [29] genes. GPD1 is strongly induced by osmotic stress [29-32]. An increase in glycerol formation 87 requires an equimolar increase of cytoplasmic NADH [10,33]. Under high osmotic stress, this requirement seems to be partially met by decreased reduction of acetaldehyde to ethanol on the one hand, and an increased oxidation to acetate on the other [34]. Under conditions of stress, acetate formation, therefore, plays an important role in maintaining the redox balance in yeast cells [10,33]. Modelling of unbranched glycolysis revealed that unless the hexose kinase or transport systems are regulated negatively, the flux in the upper part of the pathway exceeds that in the lower part due to the so-called "turbo-design" of glycolysis [35]. Two ATPs are incorporated into the upper part of glycolysis thereby stimulating the flux and creating an imbalance between the upper and lower parts of the pathway resulting in the accumulation of fructose-1,6-bisphosphate, dihydroxyacetone phosphate and glyceraldehyde-3-phosphate [36]. Furthermore, the down-regulation of biosynthetic pathways upon exposure to osmotic stress leads to a decreased demand for and subsequent accumulation of ATP [37]. The build-up of sugar phosphates and depletion of phosphate in the cell results in substrate accelerated death or at least failure to grow [35,38]. It has been suggested that the yeast cell prevents this accumulation of fructose-1,6-bisphosphate by controlling the influx of glucose by inhibition of hexose transporters [39], by feedback inhibition of hexokinase by trehalose-6-phosphate limiting phosphorylation of glucose [36,40-43] or by creating a demand for ATP by activating the glycerol, trehalose and glycogen futile cycles which act as safety valves to prevent substrate accelerated death [38,44]. We studied the effect of 40% (w/v) sugars in Riesling grape juice on the transcriptional response of a polyploid industrial wine yeast strain. Genome-wide expression analyses revealed that the transcription of 589 genes was affected by more than two-fold. In addition to the genes involved in the glycerol, trehalose and glycogen futile cycles, we found that genes involved in the glycolytic and pentose phosphate pathways were up-regulated. Furthermore, the genes involved in production of acetic acid from acetaldehyde, and 88 succinate from glutamate, were up-regulated. Yeast produced 1.35 g/L acetic acid in Riesling grape juice containing 40% (w/v) sugars compared to 0.3 g/L in Riesling grape juice with 22% (w/v) sugars. Genes involved in the de novo synthesis of purines, pyrimidines, histidine and lysine were down-regulated. 2.2 Materials and Methods 2.2.1 Determination of water activity (Aw) Solutes and ions tie up water in solution and affect the growth of microorganisms. The tolerance of bacteria, yeasts and molds is often expressed in terms of water activity (Aw). The A w of YEPD [45] medium containing 0.7 M, 1.4 M or 2 M NaCl, and Riesling grape juice containing 22% and 40% (w/v) sugars, was determined with an Aqualab Series 3 water activity meter (Decagon Devices, Pullmann, WA). Measurements were done in triplicate. 2.2.2 Media preparation, yeast strain and growth conditions Riesling grape juice (Okanagan Valley, BC, Canada) containing 22% (w/v) sugars (equimolar amounts of glucose and fructose) was treated with 0.02 mL/L pectinase (Pec5L, Scott Labs) for 3 hours at 40 °C. Gelatine was added to a final concentration of 0.2 g/L and incubated at 7 °C for 12 hrs to precipitate particulate matter. The juice was then filter sterilized using a 0.22 micron filter (Millipore). The grape juice was diluted with sterile deionized water (1:2) to rehydrate active dry yeast (Vinl3, Anchor Yeast, South Africa) at 40 °C for 30 min. Equimolar amounts of glucose and fructose were added to grape juice (22% w/v sugars) to obtain a grape juice with 40% (w/v) sugars. 89 One-litre batches of Riesling grape juice containing 22% and 40% (w/v) sugars were inoculated with the rehydrated yeast to a final concentration of 6 x 106 cells/mL. Growth of each culture was monitored over a period of 470 hours by measuring the optical density (^600nm)-Cultures used for RNA extraction were grown in 22% (w/v) sugar grape juice to mid-log phase (Amnm = 2.0) at 20 °C. The culture was divided into two 500 mL batches in 1 L flasks. To one batch, 500 mL of the same 22% (w/v) sugar juice was added (control). To the second batch, 500 ml grape juice containing 60% (w/v) sugars was added to yield a final concentration of approximately 40% (w/v) sugars. Both flasks were further incubated stationary at 20 °C for 2 hours. Yeast cells were rapidly harvested, washed and stored at -80 °C until RNA extraction [45]. All experiments were done in duplicate with independently grown cells. 2.2.3 RNA extraction and sample preparation Total RNA was extracted using the hot phenol method [45]. Methods for poly(A)+ RNA purification, amplification and labelling and cRNA fragmentation have been described previously [46]. The only modification to these procedures was the use of 15 pg cRNA, instead of 10 ug, in the cRNA fragmentation reaction. 2.2.4 Hybridization, fluidics and scanning procedures Four oligonucleotide yeast genome arrays (YGS98, Affymetrix, Santa Clara, CA) were used as targets for hybridization. Procedures for hybridization, washing, staining and scanning have been described previously [46]. The following modifications to these procedures applied: hybridizations were performed at 45°C and the arrays were read at 3 |xm using the Agilent G2500A GeneArray Scanner (Agilent Technologies, Palo Alto, CA). The EukGE-WS2v3 fluidics protocol of the Affymetrix MASv5.0 software (Affymetrix, Santa 90 Clara, CA) was used to perform staining and washing procedures. The arrays were subsequently read with a confocal GeneArray Scanner. 2.2.5 Data analyses Data were analyzed using MASv5.0. All tunable parameters were set to default values (Affymetrix Statistical Algorithm Reference Guide, Affymetrix, Santa Clara, CA). The changes in gene expression levels were determined with the Wilcoxon sign-rank test. Genes responding the same in both experiments and with change p-values of < 0.003 (genes with an increased call) or >0.997 (genes with a decreased call), were considered to be statistically significant. Average Signal Log (base 2) Ratio (SLR) values were used to calculate the fold change. Data were further analyzed and genes grouped into cellular roles using YPD™ [47,48]. 2.2.6 Quantification of acetic acid Wine samples (1 mL) were taken after 470 hours of fermentation to determine the acetic acid concentration. Samples were filter sterilized (0.22 micron) and stored at -30 °C until analyzed. A Waters 6000A HPLC with a Waters Lambda-Max 281 UV detector connected to a Hewlett-Packard Integrator/printer HP3396 series II was used. The UV detector was set at lambda =210 nm. A 10 uL sample was injected via a Rheodyne type 70 injector valve onto a Supelcogel C610H analytical cation exchange column (Supelco, cat #: 59320-U) and a Supelguard C610H column (Supelco, cat #: 59319). Analyses were done at ambient temperature. A degassed, 0.22 micron-filtered 10 mM H3PO4 mobile phase was used. L-maleic acid (0.002 g/L) was used as internal standard. A flow rate of 0.3 mL/min was used to quantify acetic acid in the wine containing a high residual sugar concentration. The wine samples were diluted 1:14 with 10 mM H3PO4. 91 Due to the low amount of acetic acid in wine obtained from 22% (w/v) Riesling grape juice, acetic acid was quantified by using the external standard method and an increased flow rate of 0.5 mL/min to reduce band broadening. The samples were diluted 2.5-fold with 10 mM H3PO4. Other parameters were the same as previously described. 2.3 Results Microarray data revealed that sugar-induced osmotic stress greatly affects the yeasts transcriptome; of the 4592 genes analyzed, the expression of 589 genes changed more than 2-fold when yeast cells were grown in grape juice containing 40% (w/v) sugars (equimolar amounts of glucose and fructose). Of these 589 genes, 346 genes were up-regulated and 243 were down-regulated (Tables 2.1 and 2.2). Genes that did not change their expression patterns more than two-fold as well as those genes that did not change expression patterns in response to increased sugar concentrations, are listed in Tables A.l and A.2 (Compact disk). Table 2.1 Genes in S. cerevisiae that were up-regulated more than two-fold when cells were grown in grape juice containing 40% (w/v) sugars after growing to mid-log phase ingrape juice with 22% (w/v) sugars. Genes were grouped into cellular role categories according to YPD . Fold Gene name ORF Description SLR" Changeb 1. Aging NCA3 YJL116C Protein of unknown function 2.4 5.3 PDE1 YGL248W 3',5'-cyclic-nucleotide phosphodiesterase 1.0 2.0 TPK1 YJL164C Catalytic subunit of cAMP-dependent PKA 1.6 2.9 2. Amino acid metabolism ALD2 YMR170C Aldehyde dehydrogenase 1.4 2.6 . ARG3 YJL088W Ornithine carbamoyltransferase 1.1 2.1 ARO10 YDR380W Protein of unknown function 2.7 6.3 AR09 YHR137W Aromatic amino acid aminotransferase II 3.3 9.5 BAP2 YBR068C Branched chain amino acid permease 3.6 11.7 CHA1 YCL064C Threonine dehydratase 1.3 2.5 GAD1 YMR250W Glutamate decarboxylase 2.5 5.5 GAT I YFL021W Transcription factor 1.2 2.3 GDH3 YAL062W Glutamate dehydrogenase (NADP+) 1.5 2.7 MET13 YGL125W Putative methylenetetrahydrofolate reductase 1.3 2.5 PUT2 YHR037W 1 -Pyrro 1 ine-5-carboxy 1 ate dehydrogenase 1.1 2.1 PUT4 YOR348C Proline-specific permease 3.1 8.6 TKL2 YBR117C Transketolase 3.6 12.1 92 UGAl YGR019W 4-Aminobutyrate aminotransferase 2.7 6.5 UGA2 YBR006W Succinate-semialdehyde dehydrogenase (NAD(P)+) 1.7 3.2 VPS36 YLR417W Protein involved in vacuolar sorting 1.6 2.9 3. Carbohydrate metabolism ALD4 YOR374W Aldehyde dehydrogenase (NAD(P)+) 4.0 15.5 ALD6 YPL061W Acetaldehyde dehydrogenase (NADP+) 1.9 3.7 AMS1 YGL156W Alpha-mannosidase 2.3 4.8 ATH1 YPR026W Alpha,alpha-trehalase 1.2 2.2 CAT8 YMR280C Transcription factor 2.9 7.2 CYB2 YML054C L-Lactate dehydrogenase (cytochrome) 2.2 4.6 DOG2 YHR043C 2-Deoxyglucose-6-phosphatase 1.0 2.0 GCY1 YOR120W Aldo-keto reductase(putative glycerol dehydrogenase) 2.5 5.7 GLK1 YCL040W Glucokinase 1.1 2.1 GLOl YML004C Lactoylglutathione lyase 1.1 2.1 GL02 YDR272W Hydroxyacylglutathione hydrolase 1.5 2.7 GL04 YOR040W Hydroxyacylglutathione hydrolase 1.1 2.1 GND2 YGR256W Phosphogluconate dehydrogenase 2.1 4.3 GPD1 YDL022W Glycerol-3-phosphate dehydrogenase (NAD+) 1.1 2.1 GPH1 YPR160W Glycine amidinotransferase 1.3 2.5 GRE3 YHR104W Induced by osmotic stress 2.2 4.6 GSC2 YGR032W 1,3-Beta-glucan synthase 1.5 2.8 GSYJ YFR015C Glycogen synthase 1.2 2.2 GPP2 YER062C DL-glycerol-3-phosphatase 3.5 11.3 HXT5 YHR096C Hexose transporter 2.6 6.1 KHA1 YJL094C Putative K +/H + antiporter 1.2 2.3 MLS1 YNL117W Malate synthase 1.5 2.8 MSS11 YMR164C Multicopy Suppressor of STA10 - 11 1.0 2.0 NTH1 YDR001C Alpha,alpha-trehalase 1.5 2.8 PDC6 YGR087C Pyruvate decarboxylase 4.7 26.0 PGM2 YMR105C Phosphoglucomutase 1.6 2.9 PIG1 YLR273C Regulatory subunit, interacts with Gsy2p 1.2 2.2 PYCl YGL062W Pyruvate carboxylase 1.5 2.7 SFA1 YDL168W Acylglycerone-phosphate reductase 1.0 2.0 SOLI YNR034W Possible 6-phosphogluconolactonase 1.4 2.5 SOL4 YGR248W Possible 6-phosphogluconolactonase 1.3 2.5 TKL2 YBR117C Transketolase 3.6 12.1 TPS1 YBR126C Alpha,alpha-trehalose-phosphate synthase 1.3 2.5 TPS2 YDR074W Trehalose phosphatase 2.5 5.5 TSLl YML100W Alpha,alpha-trehalose-phosphate synthase 2.4 5.3 YBR056W YBR056W Protein of unknown function 1.2 2.3 YDR516C YDR516C Protein of unknown function 1.3 2.4 XYL2 YLR070C Xylitol Dehydrogenase 1.3 2.4 4. Cell cycle control PCL1 YNL289W Cyclin-dependent protein kinase 1.2 2.3 PCL5 YHR071W Cyclin-dependent protein kinase 1.4 2.5 TFS1 YLR178C Putative lipid binding protein 2.0 4.0 YAK1 YJL141C Serine-threonine protein kinase 1.2 2.2 5. Cell stress AAD4 YDL243C Putative aryl-alcohol dehydrogenase 1.4 2.5 ATH1 YPR026W Alpha,alpha-trehalase 1.2 2.2 CRS5 YOR031W Metallothionein-like protein 1.0 2.0 CTA1 YDR256C Catalase 1.5 2.7 93 CTTl YGR088W Catalase 3.3 9.8 CUP2 YGL166W Transcriptional activator 1.5 2.8 DAK1 YML070W Glycerone kinase 1.8 3.5 DDR48 YMR173W Protein of unknown function Aldo-keto reductase(putative glycerol 1.7 3.1 GCY1 YOR120W dehydrogenase) 2.5 5.7 GL01 YML004C Lactoylglutathione lyase 1.1 2.1 GPD1 YDL022W Glycerol-3-phosphate dehydrogenase (NAD+) 1.1 2.1 GPH1 YPR160W Glycine amidinotransferase 1.3 2.5 GPX2 YBR244W Glutathione peroxidase 1.8 3.5 GRE2 Y0L151W Induced by osmotic stress 3.8 13.9 GTS1 YGL181W Putative zinc-finger transcription factor 1.1 2.1 GTT1 YIR038C Glutathione transferase 1.3 2.5 HAL5 YJL165C . Protein kinase homolog 1.1 2.1 GPP2 YER062C DL-glycerol-3-phosphatase 3.5 11.3 H0R7 YMR251W-A Hyperosmolarity-responsive gene 1.1 2.1 HSP104 YLL026W Heat shock protein 1.5 2.8 HSP12 YFL014W Heat shock protein 3.6 11.7 HSP26 YBR072W Heat shock protein 2.3 4.8 HSP30 YCR021C Heat shock protein 1.5 2.8 HSP42 YDR171W Chaperone 2.4 5.3 HSP78 YDR258C Chaperone 2.1 4.3 HSP82 YPL240C Heat shock protein 2.2 4.4 ' KHA1 YJL094C Putative K+/H+ antiporter 1.2 2.3 NTH1 YDR001C Alpha,alpha-trehalase 1.5 2.8 PAI3 YMR174C Endopeptidase inhibitor 2.4 5.3 PNC1 YGL037C Nicotinamidase 1.7 3.2 . PPZ2 YDR436W Protein serine/threonine phosphatase 1.5 2.8 PTP2 YOR208W Protein tyrosine phosphatase 1.2 2.2 SFA1 YDL168W Acylglycerone-phosphate reductase 1.0 2.0 SHC1 YER096W Sporulation-specific protein similar to Skt5p 1.5 2.8 SIP 18 YMR175W Salt-Induced Protein 2.2 4.4 SLT2 YHR030C MAP kinase 1.1 2.1 SSA3 YBL075C Heat shock protein 1.8 3.5 SSA4 YER103W Chaperone 3.6 11.7 TPS1 YBR126C Alpha,alpha-trehalose-phosphate synthase 1.3 2.5 TPS2 YDR074W Trehalose phosphatase 2.5 5.5 TRX3 YCR083W Thioredoxin 1.1 2.1 TSL1 YMLIOOW Alpha,alpha-trehalose-phosphate synthase 2.4 5.3 TTR1 YDR513W Glutaredoxin 1.2 2.3 UBI4 YLL039C Protein degradation tagging 2.2 4.4 XBP1 YIL101C Transcriptional repressor 1.8 3.4 YAK1 YJL141C Serine-threonine protein kinase 1.2 2.2 YBL064C YBL064C Thioredoxin peroxidase 1.6 2.9 YDR453C YDR453C Protein of unknown function 1.9 3.6 YGR086C YGR086C Protein of unknown function 1.4 2.5 YNL077W YNL077W Protein of unknown function 1.2 2.2 YNL194C YNL194C Protein of unknown function 4.9 29.9 PIN3 YPR154W [PSI+] induction 1.6 3.0 VRP1 YLR337C Actin binding 1.3 2.4 YSC84 YHR016C Protein of unknown function 1.0 2 6. Cell wall maintenance CHS1 YNL192W Chitin synthase 1.3 2.5 CWP1 YKL096W Cell wall mannoprotein 1.2 2.3 94 DDR48 ! YMR173W Protein of unknown function 1.7 3.1 ECM29 YHL030W Protein of unknown function 1.1 2.1 ECM4 YKR076W Protein of unknown function 1.9 3.7 GSC2 YGR032W 1,3-Beta-glucan synthase 1.5 2.8 HALS YJL165C Protein kinase homolog 1.1 2.1 KTR2 YKR061W Mannosyltransferase 1.4 2.5 PIR3 YKL163W Cell wall structural protein 1.0 2.0 SHC1 YER096W Sporulation-specific protein similar to Skt5p 1.5 2.8 SLT2 YHR030C MAP kinase 1.1 2.1 SPI1 YER150W Has similarity to Sedlp 3.1 8.6 STE11 YLR362W MAP kinase kinase kinase 1.2 2.3 STF2 YGR008C ATPase stabilizing factor 2.5 5.5 7. Chromatin/chromosome structure HAT I YPL001W Histone acetyltransferase 1.1 2.1 HPA2 YPR193C Histone acetyltransferase 2.2 4.6 RAD50 YNL250W Involved in DNA repair 1.0 2 RAD52 YML032C Involved in DNA repair 1.3 2.5 SP013 YHR014W Meiosis-specific protein 1.3 2.5 8. Cytokinesis CTS1 YLR286C Chitinase 1.0 2.0 VRP1 YLR337C Actin binding 1.3 2.4 9. Differentiation APG7 YHR171W ubiquitin-like conjugating enzyme 1.0 2.0 MSS11 YMR164C Multicopy Suppressor of STA10 - 12 1.0 2.0 SGA1 YIL099W Glucan 1,4-alpha-glucosidase ' 1.5 2.8 SHC1 YER096W Sporulation-specific protein similar to Skt5p 1.5 2.8 SPOl YNL012W Phospholipase 1.1 2.1 SPOJ3 YHR014W Meiosis-specific protein 1.3 2.5 STE11 YLR362W MAP kinase kinase kinase 1.2 2.3 10. DNA repair DDR48 YMR173W Protein of unknown function 1.7 3.1 DNL4 YOR005C DNA ligase (ATP) 1.4 2.6 MAGI YER142C DNA-3-methyladenine glycosidase II 2.2 4.6 MGT1 YDL200C 6-O-methylguanine-DNA methylase 1.1 2.1 MMS21 YEL019C Protein involved in DNA repair 4.2 18.4 PHR1 YOR386W Deoxyribodipyrimidine photolyase Structure-specific single-stranded DNA 1.2 2.2 RAD2 YGR258C endonuclease 1.1 2.1 RAD50 YNL250W Involved in DNA repair 1.0 2 RAD52 YML032C Involved in DNA repair 1.3 2.5 RAD59 YDL059C Involved in mitotic recombination 1.6 3.0 THI4 YGR144W Protein of unknown function 1.9 3.7 11. Energy generation COX5B YIL111W Cytochrome-c oxidase 1.6 2.9 CYB2 YML054C L-lactate dehydrogenase (cytochrome) 2.2 4.6 CYC7 YEL039C Iso-2-cytochrome c 2.0 3.9 STF1 YDL130W-A ATPase stabilizing factor 1.3 2.5 YEL020C YEL020C Protein of unknown function 1.5 2.8 YLR164W YLR164W Protein of unknown function 1.7 3.2 YLR327C YLR327C Protein of unknown function 2.7 6.5 YMR118C YMR118C Protein of unknown function 1.9 3.6 12. Lipid, fatty-acid and sterol metabolism 95 CHOI YER026C CDP-diacylglycerol-serine 0-phosphatidyltransferase 1.0 2 CH02 YGR157W Methylene-fatty-acyl-phospholipid synthase 1.7 3.2 ECU YLR284C Dodecenoyl-CoA delta-isomerase 1.3 2.4 F0X2 YK.R009C 3-Hydroxyacyl-CoA dehydrogenase 2.4 5.3 MCT1 YOR221C Malonyl-CoA:ACP transferase 1.3 2.5 0PI3 YJR073C Phosphatidylethanolamine N-methyltransferase 1.8 3.5 OYE3 YPL171C NADPH dehydrogenase 2.7 6.5 PDC6 YGR087C Pyruvate decarboxylase 4.7 26.0 PDR1 YGL013C Transcription factor 1.3 2.5 P0T1 YIL160C Acetyl-CoA C-acyltransferase 1.7 3.1 YDCl YPL087W Alkaline dihydroceramidase 1.3 2.4 YEL020C YEL020C Protein of unknown function 1.5 2.8 13. Mating response AFR1 YDR085C Receptor signaling protein 1.2 2.3 CMK2 YOL016C Calcium/calmodulin-dependent protein kinase 2.1 4.1 PTP2 YOR208W Protein tyrosine phosphatase 1.2 2.2 STE11 YLR362W MAP kinase kinase kinase 1.2 2.3 14. Meiosis APG1 YGL180W Protein serine/threonine kinase 2.0 3.9 AUT7 YBL078C Microtubule binding 1.3 2.5 RAD50 YNL250W Involved in DNA repair 1.0 2 RAD52 YML032C Involved in DNA repair 1.3 2.5 RAD59 YDL059C Involved in mitotic recombination 1.6 3.0 SAE3 YHR079C-A Protein of unknown function 2.1 4.1 SMA1 YPL027W Protein of unknown function 1.3 2.5 SPOl YNL012W Phospholipase 1.1 2.1 SP013 YHR014W Meiosis-specific protein 1.3 2.5 SP07J YDR104C Protein involved in spore wall formation 1.0 2.0 TPS1 YBR126C Alpha,alpha-trehalose-phosphate synthase 1.3 2.5 XBP1 YIL101C Transcriptional repressor 1.8 3.4 15. Membrane fusion PEP12 YOR036W t-SNARE 1.7 3.2 YHR138C YHR138C Homologous to PBI2 2.0 4.0 16. Mitosis RAD52 YML032C Involved in DNA repair 1.3 2.5 17. Nuclear-cytoplasmic transport GSP2 YOR185C GTP-binding protein 2.7 6.3 NPL4 YBR170C Structural protein 1.5 2.8 18. Nucleotide metabolism DAL1 YIR027C Allantoinase 1.2 2.2 FUI1 YBL042C Uridine permease 1.3 2.4 THI 11 YJR156C Involved in thiamine utilization pathway 1.6 3.0 URA10 YMR271C Orotate phosphoribosyltransferase 1.4 2.5 YNK1 YKL067W Nucleoside-diphosphate kinase 1.0 2 19. Other metabolism BTN2 YGR142W Protein of unknown function 2.0 4.0 CWP1 YKL096W Cell wall mannoprotein 1.2 2.3 HSP30 YCR021C Heat shock protein 1.5 2.8 XBP1 YIL101C Transcriptional repressor 1.8 3.4 AAD4 YDL243C Putative aryl-alcohol dehydrogenase 1.4 2.5 ALD3 YMR169C aldehyde dehydrogenase 2.6 5.9 ARG3 YJL088W Ornithine carbamoyltransferase 1.1 2.1 AR09 YHR137W Aromatic amino acid aminotransferase II 3.3 9.5 96 C0Q4 YDR204W Involved in ubiquinone biosynthesis 1.1 2 CTA1 YDR256C Catalase 1.5 2.7 DAL1 YIR027C Allantoinase 1.2 2.2 DAL3 YIR032C Ureidoglycolate hydrolase 1.5 2.8 FRE4 YNR060W Protein of unknown function 2.3 5 GAT I YFL021W Transcription factor 1.2 2.3 Aldo-keto reductase(putative glycerol GCY1 YOR120W dehydrogenase) 2.5 5.7 PNC} YGL037C Nicotinamidase 1.7 3.2 THI4 YGR144W Protein of unknown function 1.9 3.7 UGA1 YGR019W 4-Aminobutyrate aminotransferase 2.7 6.5 YAL061W YAL061W Putative polyol dehydrogenase 2.1 4.3 YFL057C YFL057C Protein of unknown function 1.4 2.6 YMR226C YMR226C Protein of unknown function 1.1 2.1 YNL274C YNL274C Protein of unknown function 1.0 2.0 20. Pol II transcription CAF17 YJR122W CCR4 transcriptional complex component 1.1 2.1 CAT8 YMR280C Transcription factor 2.9 7.2 CUP2 YGL166W Transcription factor 1.5 2.8 GAT1 YFL021W Transcription factor 1.2 2.3 GTS1 YGL181W Putative zinc-finger transcription factor 1.1 2.1 PDR1 YGL013C Transcription factor 1.3 2.5 YER064C YER064C Protein of unknown function 1.2 2.3 YGL131C YGL131C Protein of unknown function 1.3 2.4 21. Protein complex assembly UMP1 YBR173C Involved in ubiquitin-mediated proteolysis 1.2 2.2 22. Protein degradation APG1 YGL180W Protein serine/threonine kinase 2.0 3.9 APG5 YPL149W Involved in autophagy 1.7 3.1 APG7 YHR171W Ubiquitin-like conjugating enzyme 1.0 2.0 AUT7 YBL078C Microtubule binding 1.3 2.5 LAP4 YKL103C Vacuolar aminopeptidase I 1.3 2.5 MDJ1 YFL016C Heat shock protein 1.4 2.5 PA/3 YMR174C Proteinase inhibitor 2.4 5.3 RPT5 YOR117W Adenosinetriphosphatase 1.0 2.0 SNX4 YJL036W Protein of unknown function 1.2 2.3 TFS1 YLR178C Putative lipid binding protein 2.0 4.0 UBC5 YDR059C Ubiquitin conjugating enzyme 1.4 2.5 UBC8 YEL012W Ubiquitin conjugating enzyme 1.2 2.2 UB14 YLL039C Protein degradation tagging 2.2 4.4 UBP5 YER144C Ubiquitin-specific protease 1.1 2.1 UBP6 YFR010W Ubiquitin-specific protease 1.2 2.2 UFD1 YGR048W Molecular function unknown 1.3 2.4 UMP1 YBR173C Involved in ubiquitin-mediated proteolysis 1.2 2.2 YDR330W YDR330W Protein of unknown function 1.5 2.8 YLR387C YLR387C Protein of unknown function 1.3 2.5 23. Protein folding CPR6 YLR216C Peptidyl-prolyl isomerase 1.4 2.5 Involved in protein disulfide bond formation in EROl YML130C the ER 1.2 2.2 HSP104 YLL026W Heat shock protein 1.5 2.8 HSP12 YFL014W Heat shock protein 3.6 11.7 97 HSP26 YBR072W Heat shock protein 2.3 4.8 HSP30 YCR021C Heat shock protein 1.5 2.8 HSP42 YDR171W Chaperone 2.4 5.3 HSP78 YDR258C Chaperone 2.1 4.3 HSP82 YPL240C Heat shock protein 2.2 4.4 MDJ1 YFL016C Heat shock protein 1.4 2.5 SSA1 YAL005C Adenosine triphosphatase 1.1 2.1 SSA3 YBL075C Heat shock protein 1.8 3.5 SSA4 YER103W Chaperone 3.6 11.7 SSE2 YBR169C Heat shock protein 2.0 3.9 YNL077W YNL077W Protein of unknown function 1.2 2.2 24. Protein modification HAT1 YPL001W Histone acetyltransferase 1.1 2.1 HPA2 YPR193C Histone acetyltransferase 2.2 4.6 KHA1 YJL094C Putative K~7H+ antiporter 1.2 2.3 KTR2 YKR061W Mannosyl transferase 1.4 2.5 PGM2 YMR105C Phosphoglucomutase 1.6 2.9 UBC8 YEL012W Ubiquitin conjugating enzyme 1.2 2.2 UBP15 YMR304W Ubiquitin-specific protease 1.1 2.1 UBP5 YER144C Ubiquitin-specific protease 1.1 2.1 UBP6 YFR010W Ubiquitin-specific protease 1.2 2.2 25. Protein synthesis MRP8 YKL142W Structural protein of ribosomes 1.9 3.6 YGR201C YGR201C Protein of unknown function 1.5 2.7 26. Protein translocation APG7 YHR171W Ubiquitin-like conjugating enzyme 1.0 2.0 HSP78 YDR258C Chaperone 2.1 4.3 PEX18 YHR160C Protein binding 1.8 3.4 SSA1 YAL005C Adenosine triphosphatase 1.1 2.1 SSA3 YBL075C Heat shock protein 1.8 3.5 SSA4 YER103W Chaperone 3.6 11.7 27. Recombination MMS21 YEL019C Protein involved in DNA repair 4.2 18.4 RAD50 YNL250W Involved in DNA repair 1.0 2 RAD52 YML032C Involved in DNA repair 1.3 2.5 RAD59 YDL059C Involved in mitotic recombination 1.6 3.0 28. RNA processing/modification NCA3 YJL116C Protein of unknown function 2.4 5.3 NGR1 YBR212W Negative growth regulatory protein 1.9 3.7 REX3 YLR107W 3'-5' Exonuclease 1.0 2.0 SOLI YNR034W Possible 6-phosphogluconolactonase 1.4 2.5 SYF2 YGR129W Involved in pre-mRNA splicing 1.2 2.3 YGR250C YGR250C Protein of unknown function 1.6 2.9 YTH1 YPR107C Polyadenylation factor subunit 1.1 2.1 ISF1 YMR081C Protein of unknown function 1.5 2.8 SYF2 YGR129W Involved in pre-mRNA splicing 1.2 2.3 29. Signal transduction BAG7 YOR134W GTPase activating protein 5.5 43.7 CMK1 YFR014C Calmodulin-dependent protein kinase I 1.1 2.1 PDE1 YGL248W 3',5'-Cyclic-nucleotide phosphodiesterase 1.0 2.0 PPZ2 YDR436W Protein serine/threonine phosphatase 1.5 2.8 PTP2 YOR208W Protein tyrosine phosphatase 1.2 2.2 SLT2 YHR030C MAP kinase 1.1 2.1 98 STEll YLR362W MAP kinase kinase kinase 1.2 2.3 TPK1 YJL164C Protein serine/threonine kinase 1.6 2.9 YGR043C YGR043C Transaldolase 3.5 11 30. Small molecule transport BAP2 YBR068C Branched chain amino acid permease 3.6 11.7 COX5B YIL111W Cytochrome-c oxidase 1.6 2.9 EN A 2 YDR039C Putative Na+ pump 1.2 2.3 ENA5 YDR038C Na+ ATPase 1.2 2.2 FRE4 YNR060W Protein of unknown function 2.3 4.8 FUI1 YBL042C Uridine permease 1.3 2.4 HXT5 YHR096C Hexose transporter 2.6 6.1 KHA1 YJL094C Putative K+/H+ antiporter 1.2 2.3 ODC1 YPL134C Oxodicarboxylate carrier 1.4 2.5 PDR1 YGL013C Transcription factor 1.3 2.5 PDR10 YOR328W member of ATP-binding casette (ABC) family 1.2 2.3 PTK2 YJR059W Putative serine/threonine protein kinase 1.4 2.6 PUT4 YOR348C Proline-specific permease 3.1 8.6 RAV2 YDR202C Regulator of (H+)-ATPase in Vacuolar membrane 1.1 2.1 STL1 YDR536W Sugar transporter-like protein 6.5 87.4 VPS36 YLR417W Protein involved in vacuolar sorting 1.6 2.9 YBR241C YBR241C putative hexose transporter 2.0 4.0 YER119C YER119C Protein of unknown function 1.3 2.4 YIL166C YIL166C Protein of unknown function 1.3 2.4 YKL146W YKL146W Protein of unknown function 1.0 2.0 YLR004C YLR004C Protein of unknown function 1.1 2.1 31. Genes of unknown function ADY2 YCR010C Protein of unknown function 1.2 2.3 CSR2 YPR030W Protein of unknown function 1.6 2.9 DGA1 YOR245C DiacylGlycerol Acyltransferase 1.2 2.2 FMS1 YMR020W Protein of unknown function 1.5 2.8 FYV10 YIL097W Protein of unknown function 1.3 2.4 GPM2 YDL021W Phosphoglycerate mutase 1.3 2.4 GRE1 YPL223C Osmotic stress induced 3.1 8.3 KKQ8 YKL168C Protein kinase 1.1 2.1 MGA1 YGR249W Heat shock transcription factor homolog 1.4 2.6 MPM1 YJL066C Mitochondrial membrane protein 1.1 2.1 MSC1 YML128C Protein of unknown function 2.7 6.3 NGL3 YML118W Protein of unknown function 1.1 2.1 OM45 YIL136W 45 kDa mitochondrial outer membrane protein 1.9 3.7 PHM7 YOL084W Protein of unknown function 2.5 5.5 PHM8 YER037W Protein of unknown function 2.7 6.3 PRM10 YJL108C Pheromone-regulated membrane protein 2.4 5.3 PST2 YDR032C Protein of unknown function 1.1 2.1 R101 YOR119C Protein of unknown function 1.1 2.1 RTA1 YGR213C Involved in 7-aminocholesterol resistance 1.4 2.5 SDS24 YBR214W Protein of unknown function 1.4 2.6 SLZ1 YNL196C Sporulation-specific protein 4.0 15.5 SPG1 YGR236C Protein of unknown function 2.3 4.9 SPS100 YHR139C Involved in spore wall formation, 2.8 6.7 SRL3 YKR091W Protein of unknown function Confers leflunomide resistance when 1.3 2.4 SSH4 YKL124W overexpressed 1.9 3.6 TOS3 YGL179C Putative serine/threonine protein kinase 1.2 2.2 TOS5 YKR011C Protein of unknown function 2.0 3.9 99 UGX2 YDL169C Protein of unknown function 2.2 4.4 WHI4 YDL224C Putative RNA binding protein 2.3 4.9 YAR027W YAR027W Protein of unknown function 2.3 4.9 YBL048W YBL048W Protein of unknown function 1.6 3.0 YBL049W YBL049W Protein of unknown function 2.0 4.0 YBL065W YBL065W Protein of unknown function 1.8 3.5 YBR005W YBR005W Protein of unknown function 1.2 2.3 YBR047W YBR047W Protein of unknown function 1.7 3.1 YBR053C YBR053C Protein of unknown function 1.3 2.5 YBR062C YBR062C Protein of unknown function 1.0 2.0 YBR085c-a YBR085c-a Protein of unknown function 2.4 5.1 YBR116C YBR116C Protein of unknown function 2.8 6.7 YBR137W YBR137W Protein of unknown function 1.2 2.2 YBR230C YBR230C Protein of unknown function 2.1 4.3 YBR280C YBR280C Protein of unknown function 1.2 2.3 YCL042W YCL042W Protein of unknown function 1.7 3.2 YCL044C YCL044C Protein of unknown function 1.3 2.5 YCR082W YCR082W Protein of unknown function 1.1 2.1 YCR105W YCR105W Protein of unknown function 1.0 2.0 YDL113C YDL113C Protein of unknown function 1.1 2.1 YDL124W YDL124W Protein of unknown function 3.3 9.5 YDL204W YDL204W Protein of unknown function 1.9 3.7 YDL218W YDL218W Protein of unknown function 1.8 3.5 YDL222C YDL222C Protein of unknown function 2.6 6.1 YDL223C YDL223C Protein of unknown function 2.7 6.3 YDR034W-B YDR034W-B Protein of unknown function 1.9 3.7 YDR036C YDR036C Protein of unknown function 1.1 2.1 YDR070C YDR070C Protein of unknown function 3.0 7.7 YDR247W YDR247W Protein of unknown function 1.3 2.5 YDR306C YDR306C Protein of unknown function 1.1 2.1 YDR366C YDR366C Protein of unknown function 2.4 5.1 YDR391C YDR391C Protein of unknown function 1.1 2.1 YDR425W YDR425W Protein of unknown function 1.3 2.4 YDR476C YDR476C Protein of unknown function 1.2 2.3 YDR540C YDR540C Protein of unknown function 1.9 3.7 YER028C YER028C Protein of unknown function 2.6 5.9 YER034W YER034W Protein of unknown function 1.4 2.6 YER067W YER067W Protein of unknown function 1.2 2.2 YER079W YER079W Protein of unknown function 2.0 4.0 YER121W YER121W Protein of unknown function 2.0 4.0 YET1 YKL065C Yeast BAP31 homolog 1.3 2.4 YFL030W YFL030W Protein of unknown function 1.8 3.4 YFL044C YFL044C Protein of unknown function 1.1 2.1 YFR003C YFR003C Protein of unknown function 1.6 2.9 YFR017C YFR017C Protein of unknown function 2.0 3.9 YGL045W YGL045W Protein of unknown function 1.1 2.1 YGL121C YGL121C Protein of unknown function 2.6 5.9 YGL144C YGL144C Protein of unknown function 1.3 2.4 YGL157W YGL157W Protein of unknown function 1.3 2.4 YGL185C YGL185C Protein of unknown function 1.0 2.0 YGR052W YGR052W Protein of unknown function 1.7 3.2 YGR066C YGR066C Protein of unknown function 1.6 2.9 YGR110W YGR110W Protein of unknown function 1.8 3.5 100 YGR131W YGR131W Protein of unknown function 1.7 3.1 YGR146C YGR146C Protein of unknown function 1.3 2.4 YGR161C YGR161C Protein of unknown function 1.6 3.0 YGR237C YGR237C Protein of unknown function 1.2 2.3 YGR243W YGR243W Protein of unknown function 3.4 10.6 YGR268C YGR268C Protein of unknown function 1.9 3.7 YHL021C YHL021C Protein of unknown function 3.5 10.9 YHR033W YHR033W Protein of unknown function 2.7 6.3 YHR087W YHR087W Protein of unknown function 4.7 26.0 YHR097C YHR097C Protein of unknown function 1.4 2.6 YHR122W YHR122W Protein of unknown function 1.0 2.0 YHR140W YHR140W Protein of unknown function 1.6 3.0 YHR159W YHR159W Protein of unknown function 1.2 2.2 YHR198C YHR198C Protein of unknown function 1.0 2 YHR199C YHR199C Protein of unknown function 1.3 2.5 YHR209W YHR209W Protein of unknown function 2.1 4.1 YIL055C YIL055C Protein of unknown function 1.8 3.5 YIL057C YIL057C Protein of unknown function 2.1 4.3 YIL077C YIL077C Protein of unknown function 1.0 2.0 YIL108W YIL108W Protein of unknown function 1.6 3.0 YIL113W YIL113W protein tyrosine phosphatase 3.5 10.9 YIR014W YIR014W Protein of unknown function 1.4 2.5 YJL107C YJL107C Protein of unknown function 2.7 6.5 YJL144W YJL144W Protein of unknown function 2.3 4.8 YJL161W YJL161W Protein of unknown function 2.2 4.6 YJL185C YJL185C Protein of unknown function 2.1 4.3 YJL213W YJL213W Protein of unknown function 2.6. 5.9 YJR008W YJR008W Protein of unknown function 1.5 2.8 YJR096W YJR096W Protein of unknown function 1.9 3.6 YJR119C YJR119C Protein of unknown function 1.3 2.5 YKL034W YKL034W Protein of unknown function 1.2 2.3 YKL071W YKL071W Protein of unknown function 1.7 3.1 YKL086W YKL086W Protein of unknown function 3.2 8.9 YKL107W YKL107W Protein of unknown function 4.1 16.6 YKL123W YKL123W Protein of unknown function 1.1 2.1 YKL151C YKL151C Protein of unknown function 1.9 3.7 YKL161C YKL161C Protein of unknown function 1.1 2.1 YKR049C YKR049C Protein of unknown function 1.6 3.0 YLR042C YLR042C Protein of unknown function 3.6 11.7 YLR054C YLR054C Protein of unknown function 1.4 2.6 YLR080W YLR080W Protein of unknown function 1.1 2.1 YLR132C YLR132C Protein of unknown function 1.3 2.5 YLR149C YLR149C Protein of unknown function 1.8 3.5 YLR194C YLR194C Protein of unknown function 1.5 2.7 YLR202C YLR202C Protein of unknown function 1.1 2.1 YLR225C YLR225C Protein of unknown function 1.1 2.1 YLR247C YLR247C Protein of unknown function 1.3 2.4 YLR251W YLR251W Protein of unknown function 2.5 5.7 YLR252W YLR252W Protein of unknown function 2.4 5.3 YLR257W YLR257W Protein of unknown function 1.1 2.1 YLR270W YLR270W Protein of unknown function 1.7 3.1 YLR271W YLR271W Protein of unknown function 1.7 3.1 YLR323C YLR323C Protein of unknown function 1.2 2.2 101 YLR346C YLR346C Protein of unknown function 1.2 2.3 YLR350W YLR350W Protein of unknown function 1.0 2.0 YLR408C YLR408C Protein of unknown function 1.1 2.1 YLR414C YLR414C Protein of unknown function 1.7 3.1 YLR454W YLR454W Protein of unknown function 1.1 2.1 YML083C YML083C Protein of unknown function 1.3 2.4 YMR034C YMR034C Protein of unknown function 1.1 2.1 YMR040W YMR040W Protein of unknown function 1.9 3.6 YMR090W YMR090W Protein of unknown function 2.2 4.6 YMR103C YMR103C Protein of unknown function 1.1 2.1 YMR107W YMR107W Protein of unknown function 2.3 4.9 YMR114C YMR114C Protein of unknown function 1.1 2.1 YMR173W-A YMR173W-A Protein of unknown function 1.1 2.1 YMR181C YMR181C Protein of unknown function 1.1 2.1 YMR191W YMR191W Protein of unknown function 1.5 2.8 YMR196W YMR196W Protein of unknown function 1.8 3.4 YMR210W YMR210W Protein of unknown function 1.2 2.2 YMR315W YMR315W Protein of unknown function 2.3 4.8 YMR318C YMR318C Protein of unknown function 1.0 2.0 YMR322C YMR322C Protein of unknown function 1.9 3.6 YNL092W YNL092W Protein of unknown function 3.5 11.3 YNL094W YNL094W Protein of unknown function 1.3 2.4 YNL115C YNL115C Protein of unknown function 1.2 2.2 YNL134C YNL134C Protein of unknown function 1.4 2.5 YNL195C YNL195C Protein of unknown function 1.6 2.9 YNL200C YNL200C Protein of unknown function 1.4 2.5 YNR014W YNR014W Protein of unknown function 2.6 5.9 YNR034w-a YNR034w-a Protein of unknown function 1.5 2.8 YOL032W YOL032W Protein of unknown function 2.0 3.9 YOL048C YOL048C Protein of unknown function 1.0 2.0 YOL083W YOL083W Protein of unknown function 1.9 3.6 YOL131W YOL131W Protein of unknown function 5.4 42.2 YOL150C YOL150C Protein of unknown function 1.6 3.0 YOL161C YOL161C Protein of unknown function 1.4 2.6 YOR019W YOR019W Protein of unknown function 1.4 2.5 YOR049C YOR049C Protein of unknown function 1.6 2.9 YOR052C YOR052C Protein of unknown function 1.2 2.3 YOR054C YOR054C Protein of unknown function 1.3 2.5 YOR062C YOR062C Protein of unknown function 1.3 2.5 YOR137C YOR137C Protein of unknown function 1.5 2.8 YOR173W YOR173W Protein of unknown function 2.8 6.7 YOR220W YOR220W Protein of unknown function 2.6 6.1 YOR289W YOR289W Protein of unknown function 1.6 2.9 YOR338W YOR338W Protein of unknown function 2.7 6.5 YOR385W YOR385W Protein of unknown function 1.5 2.7 YPL004C YPL004C Protein of unknown function 1.1 2.1 YPL047W YPL047W Protein of unknown function 1.1 2.1 YPL052W YPL052W Protein of unknown function 1.3 2.5 YPL070W YPL070W Protein of unknown function 1.2 2.3 YPL113C YPL113C Protein of unknown function 3.0 8.0 YPL168W YPL168W Protein of unknown function 1.0 2 YPL222W YPL222W Protein of unknown function 2.1 4.1 YPL247C YPL247C Protein of unknown function 1.1 2.1 102 YPR093C YPR093C Protein of unknown function 1.1 2.1 YPR127W YPR127W Protein of unknown function 1.6 3.0 ZTA1 YBR046C Zeta-crystalline homolog 1.9 3.6 32. Vesicular transport APG1 YGL180W Protein serine/threonine kinase 2.0 3.9 APG5 YPL149W Involved in autophagy 1.7 3.1 Protein involved in targeting of plasma AST2 YER101C membrane [H+] ATPase 1.0 2.0 AUT7 YBL078C Microtubule binding 1.3 2.5 DDI1 YER143W T- and V- snare complex binding protein 1.7 3.1 GYP7 YDL234C GTPase-activating protein 1.4 2.6 PEP 12 YOR036W t-SNARE 1.7 3.2 VPS36 YLR417W Protein involved in vacuolar sorting 1.6 2.9 YKL091C YKL091C Protein of unknown function 1.2 2.3 a SLR- Signal Log (base 2) Ratio, average of two sets of data. b Fold change calculated from average SLR. 103 Table 2.2 Genes in S. cerevisiae that were down-regulated more than two-fold when cells were grown in grape juice containing 40% (w/v) sugars after growing to mid-log phase in grape juice with 22% (w/v) sugars. Genes were grouped into cellular role categories according to YPD™. Fold Gene name ORF Description SLR" Changeb SIM1 YIL123W Involved in control of DNA replication -1.6 -2.9 2. Amino acid metabolism ACOl YLR304C Aconitate hydratase -1.2 -2.2 AGP1 YCL025C Amino acid permease -1.2 -2.2 AROl YDR127W 3-dehydroquinate dehydratase -1.5 -2.7 ASP1 YDR321W Asparaginase -1.7 -3.1 BAP3 YDR046C Branched chain amino acid permease -1.4 -2.5 GCV1 YDR019C Aminomethyltransferase -2.7 -6.5 GCV2 YMR189W Glycine dehydrogenase (decarboxylating) -1.9 -3.7 GLT1 YDL171C Glutamate synthase -1.4 -2.6 HIS1 YER055C ATP Phosphoribosyltransferase -1.5 -2.7 H1S3 YOR202W Imidazoleglycerol-phosphate dehydratase -1.4 -2.5 H1S4 YCL030C Histidinol dehydrogenase -1.4 -2.6 HIS7 YBR248C Imidazoleglycerol-phosphate synthase -1.4 -2.5 HOM3 YER052C Aspartate kinase -1.0 -2.0 ILV6 YCL009C Acetolactate synthase -1.1 -2.1 Saccharopine dehydrogenase (NAD+, L-lysine LYS1 YIR034C forming) -1.8 -3.5 LYS12 YIL094C Homo-isocitrate dehydrogenase -1.4 -2.6 LYS2 YBR115C Aminoadipate-semialdehyde dehydrogenase -1.6 -3.0 LYS4 YDR234W Homoaconitate hydratase -1.5 -2.8 Saccharopine dehydrogenase (NADP+, In- glutamate LYS9 YNR050C forming) -1.4 -2.5 5-methyltetrahydropteroyltriglutamate-MET6 YER091C homocysteine S-methyltransferase -1.5 -2.8 MISl YBR084W Formate-tetrahydrofolate ligase -1.1 -2.1 SAM1 YLR180W Methionine adenosyltransferase -1.3 -2.5 SAM4 YPL273W AdoMet-homocysteine methyltransferase -1.3 -2.4 SER2 YGR208W Phosphoserine phosphatase -1.3 -2.5 SER3 YER081W Phosphoglycerate dehydrogenase -1.7 -3.1 SHM2 YLR058C Glycine hydroxymethyltransferase -2.5 -5.5 BNA4 YBL098W Kynurenine 3-mono oxygenase -1.9 -3.7 YDR111C YDR111C Protein of unknown function -1.1 -2.1 YOR108W YOR108W Protein of unknown function -1.9 -3.6 3. Carbohydrate metabolism ACOl YLR304C Aconitate hydratase -1.2 -2.2 ADH3 YMR083W Acylglycerone-phosphate reductase -1.0 -2.0 CAT5 YOR125C Regulator of gluconeogenic enzymes -1.3 -2.5 HXT3 YDR345C Hexose transporter -1.6 -2.9 HXT4 YHR092C Hexose transporter -2.8 -7.0 MA EI YKL029C Malate dehydrogenase -1.7 -3.2 MNNI YER001W Alpha-1,3-mannosyltransferase -1.2. -2.2 PDC5 YLR134W Pyruvate decarboxylase -1.3 -2.5 PYC2 YBR218C Pyruvate carboxylase -1.1 -2.1 RK11 YOR095C Ribose-5-phosphate ketol-isomerase -1.3 -2.5 YJR024C YJR024C Protein of unknown function -1.0 -2.0 4. Cell adhesion 104 AGAl YNR044W Cell adhesion receptor -1.1 -2.1 5. Cell cycle control CBF2 YGR140W Centromere binding factor -1.0 -2.0 CDC21 YOR074C Thymidylate synthase -1.2 -2.3 CLB2 YPR119W G2/M-specific cyclin -1.0 -2.0 CLB6 YGR109C Cyclin -1.7 -3.2 EGT2 YNL327W Protein of unknown function -2.1 -4.3 FAR! YJL157C Cyclin-dependent protein kinase inhibitor -3.2 -8.9 FKH1 YIL131C Protein of unknown function -1.5 -2.7 GNA1 YFL017C Glucosamine-phosphate N-acetyltransferase -1.3 -2.4 HSL7 YBR133C Protein kinase inhibitor -1.0 -2.0 MCD1 YDL003W Protein of unknown function -2.0 -3.9 PCL9 YDL179W Cycl in-dependent protein kinase -2.0 -3.9 PDS1 YDR113C Control of anaphase -1.1 -2.1 SDA1 YGR245C Protein of unknown function -1.4 -2.6 S1M1 YIL123W Involved in control of DNA replication -1.6 -2.9 YBR242W YBR242W Protein of unknown function -1.1 -2.1 6. Cell Dolaritv FKH1 YIL131C Protein of unknown function -1.5 -2.7 IST2 YBR086C Similarity to Ca and Na channel proteins -1.0 -2.0 SPA2 YLL021W Cytoskeletal regulatory protein binding -1.3 -2.4 7. Cell stress CST13 YBR158W Protein of unknown function -1.6 -2.9 HTB2 YBL002W Histone H2B -1.1 -2.1 IST2 YBR086C Similarity to Ca and Na channel proteins -1.0 -2.0 MTOl YGL236C Protein of unknown function -1.0 -2.0 SUN4 YNL066W Protein of unknown function -2.0 -4.0 ZRC1 YMR243C Di-, tri-valent inorganic cation transporter -1.2 -2.3 8. Cell structure SDA1 YGR245C Protein of unknown function -1.4 -2.6 9. Cell wall maintenance ECM13 YBL043W Protein of unknown function -1.5 -2.8 ECM22 YLR228C Protein of unknown function -1.2 -2.2 FEN1 YCR034W Putative 1,3-beta-glucan synthase subunit -1.4 -2.6 FL09 YAL063C Putative cell wall protein involved in flocculation -2.3 -4.8 GNAJ YFL017C Glucosamine-phosphate N-acetyltransferase -1.3 -2.4 MUC1 YIR019C Glucan 1,4-alpha-glucosidase -2.6 -6.1 PLB2 YMR006C Lysophospholipase -2.1 -4.1 PMT4 YJR143C Dolichyl-phosphate-mannose-protein mannosyltransferase -1.1 -2.1 sewn YGL028C Soluble cell wall protein -1.4 -2.5 TIR4 YOR009W Protein of unknown function -1.2 -2.3 YFL051C YFL051C Protein of unknown function -1.6 -2.9 YMR215W YMR215W Protein of unknown function -3.0 -8.0 10. Chromatin/chromosome structure CBF2 YGR140W Centromere binding factor -1.0 -2.0 CDC45 YLR103C DNA replication factor -1.2 -2.3 ESC4 YHR154W Protein of unknown function -1.5 -2.8 FKH1 YIL131C Protein of unknown function -1.5 -2.7 HHOl YPL127C Histone HI -1.9 -3.6 HTB2 YBL002W Histone H2B -1.1 -2.1 MCD1 YDL003W Protein of unknown function -2.0 -3.9 POL2 YNL262W Epsilon DNA polymerase -1.4 -2.5 105 STU2 YLR045C Structural protein of cytoskeleton -1.1 -2.1 YHL050C YHL050C Protein of unknown function -1.3 -2.5 YHM2 YMR241W Protein of unknown function -1.6 -2.9 11. Differentiation ASH! YKL185W Specific transcriptional repressor -1.1 -2.1 EGT2 YNL327W Protein of unknown function -2.1 -4.3 HMS2 YJR147W Transcription factor -1.6 -3.0 MEP2 YNL142W Ammonium transporter -1.2 -2.3 MUC1 YIR019C Glucan 1,4-alpha-glucosidase -2.6 -6.1 SPA2 YLL021W Cytoskeletal regulatory protein binding -1.3 -2.4 12. DNA repair MSH6 YDR097C Required for mismatch repair in mitosis & meiosis -1.4 -2.5 PDS1 YDR113C Control of anaphase -1.1 -2.1 PMS1 YNL082W Required for mismatch repair in mitosis and meiosis-1.0 -2.0 POL2 YNL262W Epsilon DNA polymerase -1.4 -2.5 RNH35 YNL072W Ribonuclease H -1.8 -3.5 13. DNA synthesis CDC45 YLR103C DNA replication factor -1.2 -2.3 CDC47 YBR202W Chromatin binding -1.0 -2.0 POLJ YNL102W Alpha DNA polymerase -1.4 -2.6 POL2 YNL262W Epsilon DNA polymerase -1.4 -2.5 RNH35 YNL072W Ribonuclease H -1.8 -3.5 14. Energy generation AAC3 YBR085W ATP/ADP antiporter -2.1 -4.1 ACOl YLR304C Aconitate hydratase -1.2 -2.2 CAT5 YOR125C Regulator of gluconeogenic enzymes -1.3 -2.5 CEM1 YER061C 3-Oxoacyl-[acyl-carrier protein] synthase -1.6 -2.9 COQ2 YNR041C Para hydroxybenzoate: polyprenyl transferase -1.1 -2.1 HAP4 YKL109W Transcriptional activator -1.4 -2.6 MAE1 YKL029C Malate dehydrogenase -1.7 -3.2 MTOl YGL236C Protein of unknown function -1.0 -2.0 YPR004C YPR004C Protein of unknown function -1.0 -2.0 15. Lipid, fatty-acid and sterol metabolism CEM1 YER061C 3-Oxoacyl-[acyl-carrier protein] synthase -1.6 -2.9 CPT1 YNL130C Diacylglycerol cholinephosphotransferase -1.1 -2.1 ECM22 YLR228C Protein of unknown function -1.2 -2.2 FEN1 YCR034W Putative 1,3-beta-glucan synthase subunit -1.4 -2.6 LAC1 YKL008C LAG1 longevity gene homolog -1.1 -2.1 PLB2 YMR006C Lysophospholipase -2.1 -4.1 SUR2 YDR297W Sphingosine hydroxylase -1.7 -3.2 SUR4 YLR372W Protein of unknown function -1.3 -2.4 16. Mating response AGA1 YNR044W Cell adhesion receptor -1.1 -2.1 FAR1 YJL157C Cyclin-dependent protein kinase inhibitor -3.2 -8.9 MFA2 YNL145W a-factor mating pheromone precursor -1.9 -3.7 PRY3 YJL078C Protein of unknown function -1.2 -2.3 17. Meiosis BBP1 YPL255W Structural protein of cytoskeleton -1.3 -2.5 ISC 10 YER180C Protein required for spore formation -1.0 -2.0 SPS1 YDR523C Required for spore wall formation -1.1 -2.1 STU2 YLR045C Structural protein of cytoskeleton -1.1 -2.1 TYS1 YGR185C Tyrosine-tRNA ligase -1.3 -2.5 WTM2 YOR229W Transcriptional modulator -1.0 -2.0 18. Mitosis 106 ASEl YOR058C Microtubule binding -1.0 -2.0 BBPl YPL255W Structural protein of cytoskeleton -1.3 -2.5 CBF2 YGR140W Centromere binding factor -1.0 -2.0 CIN2 YPL241C Protein of unknown function -1.1 -2.1 MCD1 YDL003W Protein of unknown function -2.0 -3.9 NUD1 YOR373W Structural protein of cytoskeleton -1.0 -2.0 NUF1 YDR356W Structural protein of cytoskeleton -1.1 -2.1 PDS1 YDR113C Control of anaphase -1.1 -2.1 SCP160 YJL080C RNA-binding protein -1.2 -2.3 STU2 YLR045C Structural protein of cytoskeleton -1.1 -2.1 19. Nuclear-cytoplasmic transport KAPJ22 YGL016W Karyopherin beta family member -1.1 -2.1 KAP123 YER110C Karyopherin beta family member -1.7 -3.1 TYS1 YGR185C Tyrosine-tRNA ligase -1.3 -2.5 20. Nucleotide metabolism AAH1 YNL141W Adenine deaminase -3.3 -9.5 ADE1 YAR015W Phosphoribosylaminoimidazole-succinocarboxamide synthase -3.0 -7.7 ADE12 YNL220W Adenylosuccinate synthase -1.3 -2.4 ADE13 YLR359W Adenylosuccinate lyase -1.7 -3.1 ADE17 YMR120C IMP cyclohydrolase -2.8 -6.7 ADE2 YOR128C Phosphoribosylaminoimidazole carboxylase -1.9 -3.7 ADE4 YMR300C Amidophosphoribosyltransferase -3.1 -8.3 . ADE5.7 YGL234W Phosphoribosylformylglycinamidine cyclo-ligase -1.7 -3.2 ADE6 YGR061C Phosphoribosylformylglycinamidine synthase -2.5 -5.7 ADE8 YDR408C Phosphoribosylglycinamide formyltransferase -1.7 -3.2 CDC21 YOR074C Thymidylate synthase -1.2 -2.3 DUT1 YBR252W dUTP pyrophosphatase -1.4 -2.6 FCY2 YER056C Purine-cytosine permease -1.4 -2.6 FUN26 YAL022C Protein of unknown function -1.3 -2.5 FUR1 YHR128W Uracil phosphoribosyltransferase -1.8 -3.4 GUA1 YMR217W GMP synthase (glutamine hydrolyzing) -1.1 -2.1 GUK1 YDR454C Guanylate kinase -1.1 -2.1 HPT1 YDR399W Hypoxanthine phosphoribosyltransferase -1.8 -3.4 IMD1 YAR073W IMP dehydrogenase -1.4 -2.5 IMD4 YML056C IMP dehydrogenase -1.4 -2.5 MIS1 YBR084W Formate-tetrahydrofolate ligase -1.1 -2.1 MTD1 YKR080W Methylenetetrahydrofolate dehydrogenase (NAD+) -2.9 -7.2 RNR1 YER070W Ribonucleoside-diphosphate reductase -1.6 -3.0 URA1 YKL216W Dihydroorotate oxidase -1.1 -2.1 URA2 YJL130C Aspartate carbamoyltransferase -1.1 -2.1 URA3 YEL021W Orotidine-5'-phosphate decarboxylase -1.0 -2.0 URA7 YBL039C CTP synthase -1.1 -2.1 21. Other metabolism ATF2 YGR177C Alcohol O-acetyltransferase -1.5 -2.8 COQ2 YNR041C Para hydroxybenzoate: polyprenyl transferase -1.1 -2.1 DPH5 YLR172C Diphthine synthase -1.6 -2.9 FRE2 YKL220C Ferric reductase -1.5 -2.8 HEM13 YDR044W Coproporphyrinogen oxidase -1.0 -2.0 HEM3 YDL205C Hydroxymethylbilane synthase -1.2 -2.2 MEP2 YNL142W Ammonium transporter -1.2 -2.3 SAM4 YPL273W AdoMet-homocysteine methyltransferase -1.3 -2.4 SSU1 YPL092W Sulfite transporter -1.7 -3.1 BNA4 YBL098W Kynurenine 3-mono oxygenase -1.9 -3.7 107 22. PhosDhate metabolism PHOll YAR071W Acid phosphatase -1.0 -2.0 PH04 YFR034C Transcription factor -1.4 -2.5 23. Pol I transcription RPA135 YPR010C DNA-directed RNA polymerase I -1.7 -3.2 RPA190 YOR341W DNA-directed RNA polymerase I -1.5 -2.8 RPB8 YOR224C DNA-directed RNA polymerase III -1.4 -2.5 RPC10 YHR143W-A DNA-directed RNA polymerase III -1.1 -2.1 RRN7 YJL025W RNA polymerase I transcription factor -2.2 -4.6 SRP40 YKR092C Chaperone -1.0 -2.0 24. Pol 11 transcription ASH1 YKL185W Specific transcriptional repressor -1.1 -2.1 ECM22 YLR228C Protein of unknown function -1.2 -2.2 HAP4 YKL109W Transcriptional activator -1.4 -2.6 HTB2 YBL002W Histone H2B -1.1 -2.1 RPB8 YOR224C DNA-directed RNA polymerase III -1.4 -2.5 RPC10 YHR143W-A DNA-directed RNA polymerase III -1.1 -2.1 SPT21 YMR179W Involved in trascriptional regulation of Tyl LTRs -1.1 -2.1 SSU72 YNL222W Complex assembly protein -1.5 -2.7 WTM2 YOR229W Transcriptional modulator -1.0 -2.0 25. Pol III transcription RPB8 YOR224C DNA-directed RNA polymerase III -1.4 -2.5 RPC10 YHR143W-A DNA-directed RNA polymerase III -1.1 -2.1 RPC11 YDR045C DNA-directed RNA polymerase III -1.5 -2.7 SRP40 YKR092C Chaperone -1.0 -2.0 26. Protein complex assembly NUF1 YDR356W Structural protein of cytoskeleton -1.1 -2.1 27. Protein folding FPR4 YLR449W Peptidyl-prolyl isomerase -1.2 -2.3 ZUOl YGR285C Chaperone -1.0 -2.0 28. Protein modification DPH5 YLR172C Diphthine synthase -1.6 -2.9 HSL7 YBR133C Protein kinase inhibitor -1.0 -2.0 KTR3 YBR205W Mannosyltransferase -1.2 -2.2 MAK3 YPR051W N-acetyltransferase -1.0 -2.0 MNN1 YER001W Alpha- 1,3-mannosyltransferase -1.2 -2.2 Dolichyl-phosphate-mannose-protein PMT4 YJR143C mannosyltransferase -1.1 -2.1 29. Protein synthesis GCD6 YDR211W Translation initiation factor -1.0 -2.0 GIS2 YNL255C Transcription factor -1.1 -2.1 MTOJ YGL236C Protein of unknown function -1.0 -2.0 RPS22B YLR367W Structural protein of ribosome -1.4 -2.6 TEF4 YKL081W Translation elongation factor -1.2 -2.3 T1F4631 YGR162W Translation initiation factor -1.3 -2.4 TYS1 YGR185C • Tyrosine-tRNA ligase -1.3 -2.5 YDR341C YDR341C Arginine-tRNA ligase -1.2 -2.2 ZUOl YGR285C Chaperone -1.0 -2.0 30. Recombination CLB6 YGR109C Cyclin -1.7 -3.2 PMS1 YNL082W Required for mismatch repair in mitosis and meiosis-1.0 -2.0 31. RNA processing/modification 108 DBP2 YNL112W RNA helicase -2.2 -4.4 GAR1 YHR089C Small nuclear ribonucleoprotein -1.1 -2.1 HAS1 YMR290C RNA helicase -2.1 -4.1 HRP1 YOL123W Putative polyadenylated-RNA-binding protein -2.3 -4.8 MAK16 YAL025C Putative nuclear protein -1.5 -2.8 NIP7 YPL211W Protein binding -1.4 -2.6 NOP1 YDL014W Small nuclear ribonucleoprotein -1.4 -2.5 NOP13 YNL175C Protein of unknown function -1.4 -2.6 RNH35 YNL072W Ribonuclease H -1.8 -3.5 RRP5 YMR229C RNA binding -1.3 -2.4 SCP160 YJL080C RNA-binding protein -L2 -2.3 TRM1 YDR120C tRNA (guanine-N2-)-methyltransferase -1.2 -2.3 ZUOl YGR285C Chaperone -1.0 -2.0 32. RNA splicing and turnover MRS2 YOR334W Magnesium ion transporter -1.1 -2.1 RNH35 YNL072W Ribonuclease H -1.8 -3.5 33. Septation SUN4 YNL066W Protein of unknown function -2.0 -4.0 34. Sianal transduction MEP2 YNL142W Ammonium transporter -1.2 -2.3 MFA2 YNL145W a-factor mating pheromone precursor -1.9 -3.7 RPI1 YIL119C Small GTPase regulatory/interacting protein -1.6 -2.9 YBR242W YBR242W Protein of unknown function -1.1 -2.1 35. Small molecule transport AAC3 YBR085W ATP/ADP antiporter -2.1 -4.1 AGP I YCL025C Amino acid permease -1.2 -2.2 AUS1 YOR011W Protein involved in Uptake of Sterols -1.5 -2.7 BAP3 YDR046C Branched chain amino acid permease -1.4 -2.5 CTP1 YBR291C Tricarboxylate carrier -2.5 -5.7 FCY2 YER056C Purine-cytosine permease -1.4 -2.6 FET4 YMR319C Iron transporter -1.2 -2.3 FRE2 YKL220C Ferric reductase -1.5 -2.8 FUN26 YAL022C Protein of unknown function -1.3 -2.5 HXT3 YDR345C Hexose transporter -1.6 -2.9 HXT4 YHR092C Hexose transporter -2.8 -7.0 IST2 YBR086C Similarity to Ca and Na channel proteins -1.0 -2.0 MEP2 YNL142W Ammonium transporter -1.2 -2.3 MRS2 YOR334W Magnesium ion transporter -1.1 -2.1 ODC2 YOR222W Mitochondrial 2-oxodicarboxylate transporter -1.7 -3.2 OPT2 YPR194C Oligopeptide transporter -4.1 -16.6 PH03 YBR092C Acid phosphatase -1.7 -3.1 PH091 YNR013C Low-affinity phosphate tranporter -1.0 -2.0 SSU1 YPL092W Sulfite transporter -1.7 -3.1 YBT1 YLL048C Similarity to mammalian bile transporter -1.5 -2.8 YDR119W YDR119W Protein of unknown function -1.7 -3.1 YGR096W YGR096W Protein of unknown function -1.1 -2.1 YHM2 YMR241W Protein of unknown function -1.6 -2.9 YHR032W YHR032W Protein of unknown function -1.8 -3.4 YMC2 YBR104W Mitochondrial carrier protein -1.5 -2.7 ZRC1 YMR243C Di-, tri-valent inorganic cation transporter -1.2 -2.3 ZRT2 YLR130C Low-affinity zinc ion transporter -1.3 -2.5 36. Genes of unknown 109 FYV14 YDL213C Protein of unknown function -1.3 -2.5 KEL3 YPL263C Kelch-repeat protein -1.0 -2.0 KRR1 YCL059C Involved in cell division and spore germination -2.0 -4.0 MKC7 YDR144C Aspartyl protease related to Yap3p -1.3 -2.4 NEW1 YPL226W Protein of unknown function -1.1 -2.1 PPT1 YGR123C Protein serine/threonine phosphatase -1.0 -2.0 RLI1 YDR091C Required for vegetative growth and sporulation -1.3 -2.5 RRP13 YGR103W Protein of unknown function -1.3 -2.4 TOS2 YGR221C Protein of unknown function -2.0 -3.9 TOS4 YLR183C Protein of unknown function -1.5 -2.8 YAL065C YAL065C Protein of unknown function -2.7 -6.5 YAR064W YAR064W Protein of unknown function -1.5 -2:7 YAR068W YAR068W Protein of unknown function -1.5 -2.7 YAR075W YAR075W Protein of unknown function -1.0 -2.0 YBL028C YBL028C Protein of unknown function -1.5 -2.8 YBL029W YBL029W Protein of unknown function -1.6 -2.9 YBL032W YBL032W Protein of unknown function -1.0 -2.0 YBL095W YBL095W Protein of unknown function -1.9 -3.6 YBR028C YBR028C Protein of unknown function -1.5 -2.8 YBR074W YBR074W Protein of unknown function -1.5 -2.7 YBR075W YBR075W Protein of unknown function -1.7 -3.2 YBR147W YBR147W Protein of unknown function -1.3 -2.4 YBR206W YBR206W Protein of unknown function -1.0 -2.0 YBR300C YBR300C Protein of unknown function -1.1 -2.1 YCR051W YCR051W Protein of unknown function -1.5 -2.7 YCR087C-A YCR087C-A Protein of unknown function -2.1 -4.1 YCR087W YCR087W Protein of unknown function -1.0 -2.0 YDL121C YDL121C Protein of unknown function -1.0 -2.0 YDR020C YDR020C Protein of unknown function -1.9 -3.7 YDR089W YDR089W Protein of unknown function -2.2 -4.4 YDR133C YDR133C Protein of unknown function -1.0 -2.0 YER156C YER156C Protein of unknown function -1.3 -2.5 YGL101W YGL101W Protein of unknown function -1.3 -2.4 YGR001C YGR001C Protein of unknown function -1.0 -2.0 YGR068C YGR068C Protein of unknown function -1.7 -3.1 YGR280C YGR280C Protein of unknown function -1.5 -2.7 YHL026C YHL026C Protein of unknown function -1.5 -2.7 YHR149C YHR149C Protein of unknown function -1.5 -2.7 YIL064W YIL064W Protein of unknown function -1.3 -2.5 YIL096C YIL096C Protein of unknown function -1.1 -2.1 YIL158W YIL158W Protein of unknown function -1.7 -3.2 YJL097W YJL097W Protein of unknown function -1.3 -2.5 YJL118W YJL118W Protein of unknown function -1.4 -2.6 YJL200C YJL200C Putative aconitate hydratase -1.8 -3.5 YJL218W YJL218W Protein of unknown function -1.1 -2.1 YJR030C YJR030C Protein of unknown function -1.8 -3.4 YJR070C YJR070C Protein of unknown function -2.0 -3.9 YLR049C YLR049C Protein of unknown function -1.3 -2.4 YLR106C YLR106C Protein of unknown function -1.4 -2.6 YLR154C YLR154C Protein of unknown function -1.1 -2.1 YLR446W YLR446W Protein of unknown function -3.3 -9.5 YLR455W YLR455W Protein of unknown function -1.7 -3.2 YMR003W YMR003W Protein of unknown function -1.6 -3.0 110 YMR209C YMR209C Protein of unknown function -1.5 -2.8 YMR317W YMR317W Protein of unknown function -1.6 -2.9 YMR321C YMR321C Protein of unknown function -1.3 -2.5 YNL087W YNL087W Protein of unknown function -1.3 -2.5 YNL174W YNL174W Protein of unknown function -1.1 -2.1 YNL246W YNL246W Protein of unknown function -1.2 -2.3 YNR009W YNR009W Protein of unknown function -2.0 -3.9 YNR065C YNR065C Protein of unknown function -1.3 -2.5 YOL155C YOL155C Protein of unknown function -1.1 -2.1 YOR243C YOR243C Protein of unknown function -1.3 -2.4 YOR315W YOR315W Protein of unknown function -2.6 -5.9 YPL056C YPL056C Protein of unknown function -1.3 -2.5 YPL158C YPL158C Protein of unknown function -1.0 -2.0 YPL264C YPL264C Protein of unknown function -1.0 -2.0 YPR157W YPR157W Protein of unknown function -1.1 -2.1 YVH1 YIR026C Protein tyrosine phosphatase -1.3 • -2.4 37. Vesicular transport AKR2 YOR034C Involved in constitutive endocytosis of Ste3p -1.0 -2.0 EMP70 YLR083C Protein of unknown function -1.3 -2.4 GEA1 YJR031C ARF small monomeric GTPase -1.2 -2.3 LAC1 YKL008C LAG1 longevity gene homolog -1.1 -2.1 SVL3 YPL032C Protein of unknown function -1.3 -2.4 a SLR- Signal Log (base 2) Ratio, average of two sets of data. b Fold change calculated from average SLR. Rep and co-workers identified 48 genes whose transcription were reduced by more than 75% in a hogl mutant when exposed to osmotic stress [1]. Forty-two Hoglp-dependent genes were up-regulated and one Hoglp-dependent genes were down- regulated in response to sugar-induced osmotic stress (Fig. 2.1). In addition, 73% of the 181 genes regulated by Msn2/4p were up-regulated by exposure of yeast cells to 40% (w/v) sugars of the (Fig. 2.1) [49]. To establish which biological processes were the most affected by the sugar induced osmotic stress, genes were grouped into "cellular role" categories according to the YPD™ database [47]. The expression of a large number (228) of genes with unknown functions was regulated more than 2-fold. Other major responses included genes involved with cell stress and small molecule transport as well as carbohydrate, nucleotide, and amino acid metabolism (Fig. 2.2). I l l Fig. 2.1 Response of S. cerevisiae VEND to a shift from 22% to 40% (w/v) sugars Riesling must. (A) Number of genes regulated by Hoglp [1]. (B) Number of genes regulated by Msn2/4p [49]. (C) Number of genes up-regulated by 40% (w/v) sugars. (D) Number of genes down-regulated by 40% (w/v) sugars. 112 Fig. 2.2 Classification of genes into cellular role categories according to YPD . Bars indicate the number of genes classified in a particular cellular role changing two-fold or more. A, Cell stress; B, Small molecule transport; C, Carbohydrate metabolism; D, Nucleotide metabolism; E, Amino acid metabolism; F, Other metabolism; G, Cell wall maintenance; Ff, Protein degradation; I, Lipid and fatty-acid and sterol metabolism; J, RNA processing/modification; K, Pol II transcription; L, Protein folding; M, Meiosis; N, Cell cycle control; O, Vesicular transport; P, Protein modification; Q, DNA repair Protein translocation; R, Energy generation; S, Differentiation; T, Chromatin/chromosome structure; U, Protein synthesis; V, Signal transduction. 113 2.3.1 Regulation of carbohydrate metabolic genes by high sugar concentrations (fold change indicated in brackets) Growth of the yeast in 40% (w/v) sugars down-regulated transcription of two of the hexose transport genes, HXT3 (-2.9) and HXT4 (-7.0). However, the HXT1 (+1.8) and.HXT5 (+6.1) genes encoding hexose transporters, and the STL1 (+87.0) and YBR241C (+4.0) genes, encoding sugar transport-like proteins, were up-regulated in response to high sugar concentrations. Several genes involved in glycolysis, GLK1 (+2.1), GLK1 homolog YDR516C (+2.4), TDH1 (+1.7), GPM2 (+2.3), ENOl (+1.3), PYK2 (+1.7) and PDC6 (+26) were up-regulated by sugar stress. HXK2 (-1.8), PDC5 (-2.5) and ADH3 (-1.9) were down-regulated. PGR, PFK2, FBA1, TPII, PGK1, EN02, ADH1 and ADH2 showed no change in expression levels when yeast cells were grown in grape juice containing 40% (w/v) sugars. ZWF1 (+1.7), SOLI (+2.5), SOL4 (+2.5), GND2 (+4.3), TKL2 (+12.1), TALI (+1.5), and the TALI homolog YGR043C (+11) involved in the pentose phosphate pathway were up-regulated (Fig. 2.3). However, the RPE1 (-1.6) and RKI1 (-2.5) genes were down-regulated. These two genes encode for D-ribulose-5-phosphate 3-epimerase and D-ribose-5-phosphate ketol-isomerase, which link the oxidative and non-oxidative branches of the pentose phosphate pathway. The down-regulation of these two genes by sugar stress might decrease the flow of carbon from the oxidative to the non:Oxidative part of the pentose phosphate pathway. 114 Trehalose TPS2 +5.5 T-6-P NTM +2.8 ATM +2.2 Glucose GLK1 +2.1 YDR516C +2.4 PRPP A SOU +2.5 ZWF1 +1.7 S 0 L 4 + 2 5 7PS3 +1.7 G-6-P TSL1 +5.3 , i TPS) +2.5 / PGI1 NC UDP UDP-Glucose P G M ¥ + ™ " / F-6-P —G-1-P UGP1 +1.4 PRS1 -1.7 PRS2 NC 6WD2 +4.3 PRS3 -1.9 Ribulose-5-P PRS4 NC J \ PRS5 -1.4 RPE1 •1.6/ \RKI1 -2.5, PFK2 NC F8PJ +1.7 9 \ GSY1 +2.2 SSV2 +1.8 Glycogen^ Glycogen,, GPM +2.5 Glucose + G-1-P F-16-BP FBA1 NC DHAP GPD1 +2.1 G-3-P 6PP2 +11.3 Glycerol DHAP -GAP y>Hi+i.7 \PGK1 NC ^GPM2 +2.3 EN01 + 1 . 3 ^ 0 2 NC DAK1 +3.5 DHA Y^K2+1.7 Pyruvate PDC1 NC PDC5 -2.5 PDC6 +26 GCY1 +5.7 Acetaldehyde ADM NC ADH3-1.9 Xylulose-5-P Ribose-5-P TKL2 +12.1 Ribose-1-P PGM2 +2.9 \R6K7 +1.5 Ribose GAP Sedoheptulose-7-P TAL1 +1.5 YGR043C +11 2F-6-P 2 Erythrose-5-P 7KL2 +12.1 V l R 0 4 -1.8 \AR01 -2.7 GAP Xylulose-5-P Aromatic amino acids >4LD2 +2.6 ALD3 +5.9 ALD4 +15.5 ADH2 NC /\LD6 +3.7 Acetate Ethanol Fig. 2.3 Regulation of genes involved in the glycolytic, glycerol, trehalose, glycogen and pentose phosphate pathways in S. cerevisiae by sugar stress. Gene names are followed by fold-change. Abbreviations: NC, no change; G-6-P, glucose-6-phosphate; F-6-P, fructose-6-phosphate; F-1,6-BP, fructose-1,6-bisphosphate; DHAP, dihydroxyacetone phosphate; GAP, Glyceraldehyde-3-phosphate; G-3-P, glycerol-3-phosphate; DHA, dihydroxyacetone; T-6-P, trehalose-6-phosphate; PRPP, 5-phosphoribosyl-l -pyrophosphate. 115 Our data showed. that genes involved in the biosynthetic and dissimilatory pathways for glycerol {GPD1 (+2.1), GPP2 (+11.3), GCY1 (+5.7) and DAK1 (+3.5)}, trehalose, {TPS1 (+2.5), TPS3 (+1.7), TSL1 (+5.3), PGM2 (+2.9), TPS2 (+5.5), NTH1 (+2.8) and ATH1 (+2.2)} and glycogen {GSY1 (2.2), GSY2 (+1.8), GZC3 (+1.9), and GPH1 (+2.5)} are up-regulated by sugar stress. These genes have previously been shown to respond to salt stress [1-3]. The up-regulation of the FBP1 (+1.7) gene, responsible for the conversion of fructose-1,6-bisphosphate to fructose-6-phosphate during gluconeogenesis, is intriguing and unexpected (Fig. 2.3). It has previously been shown that the FBP1 gene is repressed by 2% (w/v) glucose [50]. In addition, the FBP26 gene encoding fructose-2,6-bisphosphatase, was also up-regulated (+1.7). 2.3.2. Genes responsible for the formation of acetic acid from acetaldehyde, and succinate from glutamate, are up-regulated Four isogenes, ALD2 (+2.6), ALD3 (+5.9), ALD4 (+15.5) and ALD6 (+3.7), encoding NAD(P)+-dependent aldehyde dehydrogenases, were up-regulated (Fig. 2.3). It has previously been shown that Ald4p and Ald6p convert acetaldehyde to acetate [51]. Yeast grown in the 40% (w/v) sugar juice produced 1.35 g/L acetic acid compared to 0.3 g/L acetic acid at the lower sugar concentration (22% w/v). Genes involved in the conversion of glutamate to succinate via 4-aminobutanoate and succinate-semialdehyde were all up-regulated (Fig. 2.4). The GAD1 gene encoding for glutamate decarboxylase was induced 5.5-fold, transcription of the UGA1 gene encoding for 4-aminobutyrate amino-transferase increased 6.5-fold, and the UGA2 (UGA5) gene encoding for the NADP+-dependent succinate-semialdehyde dehydrogenase, was up-regulated 3.2-fold. Genes encoding enzymes in the main oxidative and minor reductive reactions of the tricarboxylic acid cycle used by yeast for the formation of succinic acid during fermentation [52] were not affected by osmotic stress (Appendix A, Fig. 6.3). 116 NADPH NADP NAD NADH \ ^ G P H 3 t2^y^ V ^ S i T f -2.6 N H / + aKg < ^ ^ _ Glutamate GDH2 *1.9 NADH NAD Glutamine GLN1 NC G A D ) * 5 . 5 URA2-2.1 | C P A 2 - 1 . 6 4-Aminobutanoate Succinate-semialdehyde N A D P - * ^ Pyrimidine biosynthesis J UGH2*3 NADPH-* Succinate Fig. 2.4 Schematic presentation of the glutamate catabolic pathway that converts glutamate to succinate in S. cerevisiae under conditions of sugar stress (adapted from [53]}. Gene names are followed by fold change. 117 2.3.3 Genes invo lved in the de novo pur ine and py r im id ine biosynthesis are d o w n -regulated Genes encoding proteins that incorporate pentose phosphate pathway intermediates into nucleotides {PRS1 (-1.7), PRS3 (-1.9), PRS5 (-1.4)} were down-regulated (Fig. 2.3). Genes involved in purine biosynthesis from phosphoribosyl-pyrophosphate (PRPP) were down-regulated in response to sugar-induced osmotic stress. The ADE4 (-8.3), ADE5,7 (-3.2), ADE8 (-3.2), ADE6 (-5.7), ADE2 (-3.7), ADE1 (-7.7), ADE13 (-3.1), ADE17 (-6.7), ADE12 (-2.4) , IMD4 (-2.5) and GUA1 (-2.1) genes encoding for enzymes responsible for the de novo synthesis of GMP and AMP were down-regulated (Fig. 2.5). A further three genes, AAH1 (-9.5) , GUK1 (-2.1) and RNR1 (-3), involved in biosynthetic pathways down-stream of GMP and AMP, were also down-regulated. In addition, the URA2 (-2.1), CPA2 (-1.6), URA5 (-1.9), URA3 (-2), FUR1 (-3.4) and URA7 (-2.1) genes in the pyrimidine biosynthetic pathway were also down-regulated (Fig. 2.5). 2.3.4 Genes invo lved in the de novo biosynthesis of h ist id ine, lysine and aromat ic amino acids are down-regulated Five of the seven genes involved in de novo biosynthesis of histidine, HIS1 (-2.7), HIS4 (-2.6), HIS7 (-2.5), HIS3 (-2.5) and HIS5 (-1.8), were down-regulated in response to osmotic stress (Fig. 2.5). Genes encoding enzymes involved in five of the eight steps of lysine biosynthesis (Fig. 2.5) were down-regulated: LYS20 (-1.7), LYS4 (-2.8), LYS21 (-1.5), LYS12 (-2.6), LYS1 (-3.5), LYS2 (-3) and LYS9 (-2.5). TheAR04 (-1.8) and AROl (-2.7) genes involved in the biosynthesis of aromatic amino acids were also down-regulated (Fig. 2.3). 118 Fig. 2.5 Down-regulation of genes involved in the biosynthesis of nucleotides, histidine and lysine in S. cerevisiae by sugar stress (adapted from YPD [47], KEGG [54], [55]}. Gene names are followed by fold change. Abbreviations: PRPP, phosphoribosyl pyrophosphate; AICAR, 5'-Phosphoribosyl-5-amino-4-imidazolecarboxamide, IMP, inosine 5'-monophosphate; AMP, Adenosine 5'-monophosphate; GMP, Guanosine 5'-monophosphate; CTP, Cytidine 5'-triphosphate; a-Kg, a-Ketoglutarate. 119 2.3.5 Sugar stress decreases the growth rate of S. cerevisiae The growth rate of the yeast in grape juice with the low Aw (40% w/v sugars) was considerably slower (umax= 0.023) compared to the growth rate in grape juice with only 22% (w/v) sugars (umax= 0.071) (Appendix A, Fig. 6.2). The final optical density (/46oonm) of yeast grown in 22% and 40% (w/v) sugars were 6.0 and 2.70, respectively. The A w of Riesling grape juice containing 22% (w/v) sugars and YEPD medium supplemented with 0.7M NaCl were almost identical (0.982 and 0.981, respectively). The Aw of the 40% (w/v) sugar Riesling grape juice was 0.939 and the YEPD media containing 1.4 M and 2 M NaCl had Aws of 0.952 and 0.918, respectively. 2.4 Discussion 2.4.1 Genes involved in glycolysis and the synthesis and dissimilation of glycerol, trehalose and glycogen are up-regulated by sugar stress Sugar induced osmotic stress regulated the expression of six genes encoding hexose transporters and transport-like proteins. The HXT3 and HXT4 genes were down-regulated and the HXT1, HXT5, STL1 and YBR241C genes were up-regulated. The latter four genes are also up-regulated by salt or sorbitol stress [1] and these genes seem to respond to osmotic stress rather than the type of osmolyte present. The GLK1, YDR516C, GPDl, GPP2, TDH1, GPM2, ENOl, PYK2, and PDC6 genes were all up-regulated while the expression of the PGI1, PFK2, FBA1, TPI1, PGK1, EN02, ADH1 and ADH2 genes remained unchanged (Fig. 2.3). Three isogenes, PDC1, PDC5 and PDC6, encode for pyruvate decarboxylase that converts pyruvate into acetaldehyde and CO2. Deletion of the PDC1 and PDC5 genes results in the inability of the yeast to ferment low concentrations of glucose (8% w/v) [56,57]. The PDC1 gene is regarded as the major pyruvate decarboxylase, and its expression as well as Pdclp activity, are induced by glucose [58,59]. Deletion of PDCS does not substantially 120 reduce pyruvate decarboxylase activity in active fermenting yeast cells [59,60]. PDC6 does not contribute to pyruvate decarboxylase activity in either 2% ethanol or 8% glucose [59]. However, Hohmann [53] reported that PDC6 is required for pyruvate decarboxylase activity in media with ethanol and galactose but not in the fermentation of glucose. In grape juice containing 40% (w/v) sugars (equimolar amounts of glucose and fructose), PDC6 was up-regulated 26-fold compared to growth in 22% (w/v) sugars. Expression of PDC1 was unaffected and PDC5 was down-regulated under these conditions. Salt and sorbitol stress do not induce PDC6 expression and its response seems to be specific to sugar stress. Modelling of unbranched glycolysis revealed a requirement for at least a 6-fold increase in pyruvate decarboxylase activity to attain a stable steady state [36]. Our data indicate that pyruvate decarboxylase activity from the highly induced Pdc6 isozyme may provide additional pyruvate decarboxylase activity required for steady state levels of pyruvate while yeast cells are fermenting high concentrations of sugar. The hitherto regarded minor form of these three pyruvate decarboxylases seems to contribute to pyruvate decarboxylase activity under high sugar stress conditions. It has been well documented that S. cerevisiae forms glycerol and trehalose during salt or sorbitol stress [31,34,61] and that futile cycles of glycerol, trehalose and glycogen [38,44] are operational under these conditions. Our data confirms the up-regulation of genes in these futile cycles, that act as glycolytic safety valves, under conditions of high sugar stress as well 2.4.2 The pentose phosphate pathway may act as a shunt to prevent accumulation of fructose-l,6-bisphosphate in the glycolytic pathway The phosphorylation of glucose to glucose-6-phosphate, and fructose-6-phosphate to fructose-1,6-bisphosphate, leads to an increased flux in the upper part of glycolysis [62,63]. The accumulation of fructose-1,6-bisphosphate [35,38,40,43] depletes the cell of its phosphate pool and may lead to cell death [38]. Furthermore, modelling of unbranched 121 glycolysis revealed that fructose-1,6-bisphosphate, dihydroxyacetone phosphate and glyceraldehyde-3-phosphate accumulate when the flux upstream of fructose-1,6-bisphosphate exceeds the flux downstream of glyceraldehyde-3-phosphate [36]. This accumulation of sugar phosphates in unbranched glycolysis might lead to cell death, or at least interfere with growth. It has been suggested that the accumulation of fructose-1,6-bisphosphate can be circumvented in the yeast cell by down-regulating the HXT genes thereby limiting the glucose flux in glycolysis [39]. Alternatively, feedback inhibition of HXK1 by trehalose-6 phosphate could limit the glucose-6-phosphate concentration in the cell [41,42]. Gene expression profiles obtained in this study indicate that ZWF1 (+1.7), SOLI (+2.5), SOLA (+2.5) and GND2 (+4.3) genes in the oxidative part of the pentose phosphate pathway that encode enzymes responsible for the conversion of glucose-6-phosphate to ribulose-5-phosphate, were all up-regulated by sugar stress. If proteins and metabolic regulators follow suit, more glucose-6-phosphate may be shunted from the glycolytic pathway into the pentose phosphate pathway. The RPE1 (-1.6) and RKI1 (-2.5) genes, however, were down-regulated which could limit the flux of ribulose-5-phosphate from the oxidative part to the non-oxidative part of the pentose phosphate pathway, thus theoretically leading to the accumulation of ribulose-5-phosphate. Furthermore, transcription of the TKL2, YGR034C, and TALI genes in the non-oxidative part of the pentose phosphate pathway were all significantly up-regulated under conditions of severe sugar stress (Fig. 2.3). These results suggest that the non-oxidative part of the pentose phosphate pathway may function as a shunt to remove fructose-6-phosphate and glyceraldehyde-3-phosphate from the glycolytic pathway. If glucose-6-phosphate and fructose-6-phosphate indeed flow into the pentose phosphate pathway under conditions of severe osmotic stress, it could limit the build-up of fructose-1,6-bisphosphate during glycolysis. It is conceivable that fructose-6-phosphate and glyceraldehyde-3-phosphate will flow back into the glycolytic pathway during the later stages of fermentation when sugar stress is no longer severe. 122 2.4.3 Hyper osmotic stress down-regulates genes involved in the de novo biosynthesis of purines, pyrimidines, histidine and lysine Osmotic stress reduced the growth rate of S. cerevisiae in Riesling grape juice containing 40% (w/v) sugars (wmax= 0.023 vs 0.071 at 22% sugars). Growth arrest of yeast that occurs upon transfer to high osmolarity medium results in a decreased demand for de novo biosynthesized metabolites [1,64]. Down-regulation of the pathway can be implemented by the sudden decrease in ATP consumption for biosynthetic purposes due to growth arrest [38]. Increased AMP levels act via ADP or ATP to repress genes involved in purine and histidine biosynthesis [65]. Our data indicate that genes in the pathways leading to the de novo biosynthesis of purines, pyrimidines, histidine and lysine were down-regulated by osmotic stress (Fig. 2.5). Purine and histidine biosynthesis share 5-aminoimidazole-4-carboxamide ribotide (AICAR) as an intermediate [66] and these pathways are co-regulated by Baslp, Bas2p as well as Gcn4p [55,66-70]. 2.4.4 Sugar stress up-regulates genes in pathways leading to acetic and succinic acids It has often been speculated that bacterial contaminants are responsible for the production of acetic acid during ice wine production. Our data show conclusively that sugar stress up-regulates four isogenes encoding aldehyde dehydrogenases (Fig. 2.3). Under conditions of severe sugar stress encountered during ice wine production, the yeast produced 1.35 g/L of acetic acid compared to 0.3 g/L in grape must with only 22% (w/v) sugars. Under conditions of stress, acetate formation plays an important role in maintaining the redox balance in yeast cells since they require NAD+ for this reaction to proceed [10]. Succinic acid is the main carboxylic acid produced by S. cerevisiae during wine fermentations [71] and its production is stimulated by the presence of glutamate [72]. According to Radler [51], wine yeast produces succinic acid from glutamate via 2-oxo-123 glutarate and succinyl-CoA, or from sugars via oxalacetate, L-malate and fumarate. However, our data showed that the pathway for the production of succinic acid from glutamate in grape must which is most activated by high sugar stress, is via 4-aminobutanoate and succinate-semialdehyde (Fig. 2.4). Sugar stress increased the transcription of all genes involved in the production of succinic acid from glutamate in this pathway. 2.4.5 Concluding remarks S. cerevisiae has developed extensive regulatory mechanisms to cope with osmotic stress. In addition to the synthesis of glycerol as a compatible solute, glycerol, glycogen and trehalose futile cycles act as safety valves to avoid substrate accelerated death. Our data show that when the yeast finds itself under severe sugar stress, control of carbon flux through the glycolytic and the pentose phosphate pathways might be more complex than was previously thought. By shunting more glucose-6-phosphate and fructose-6-phosphate into the oxidative and non-oxidative branches of the pentose phosphate pathway, respectively, the yeast cell may prevent the accumulation of fructose-1,6-bisphosphate in the glycolytic pathway and concomitant depletion of phosphate resulting in substrate accelerated death. Kinetic data and the quantification of intermediates in these pathways are required to confirm this hypothesis. Laboratory conditions previously used were inappropriate to detect expression of the Pdc6 isozyme. This isozyme, previously thought to be a minor isozyme, functions under conditions of sugar stress in which the yeast cell regularly finds itself. It is clear that the yeast, and not bacterial contaminants as was previously thought, produces additional acetic acid during the fermentation of grape musts with high sugar concentrations. It is also evident that the yeast has evolved more than one mechanism to control the redox balance in the cell; activation of trehalose synthesis and degradation, possible up-regulation of the pentose phosphate pathway, and increased acetic acid and succinic acid production are some of the options open 124 to yeast growing under osmotic stress. The growth of S. cerevisiae was inhibited under conditions of severe sugar stress and genes in the pathways leading to purine, pyrimidine, histidine and lysine biosynthesis were down-regulated. This makes intuitive sense since the yeast no longer require these macromolecules when growth is inhibited. We have made good progress to unravel the molecular response of S. cerevisiae to osmotic stress. However, we will not fully understand the molecular mechanisms that this yeast have evolved to cope with stress until we have elucidated the functions of at least some of the 228 orphan genes regulated by sugar induced osmotic stress. Genomics will yield new insights into fermentation processes and its control only if we study S. cerevisiae under fermentation conditions using high sugar concentrations that this yeast normally encounters in nature. 2.6 Literature Cited [1] Rep, M., Krantz, M., Thevelein, J.M. and Hohmann, S. (2000) The transcriptional response of Saccharomyces cerevisiae to osmotic shock. Hotlp and Msn2p/Msn4p are required for the induction of subsets of high osmolarity glycerol pathway-dependent genes. J. Biol. Chem. 275, 8290-8300. [2] Posas, F., Chambers, J.R., Heyman, J.A., Hoeffler, J.P., de Nadal, E. and Arino, J. (2000) The transcriptional response of yeast to saline stress. J. Biol. Chem. 275, 17249-17255. [3] Yale, J. and Bohnert, H.J. (2001) Transcript expression in Saccharomyces cerevisiae at high salinity. J. Biol. Chem. 276, 15996-16007. [4] Margalit, Y. (1997), The Wine appreciation Guild Ltd., San Francisco, CA. [5] Brewster, J.L., de Valoir, T., Dwyer, N. D., Winter, E., and Gustin, M. C (1993) An Osmosensing Signal Transduction Pathway in Yeast. Science. 259, 1760-1763. [6] Maeda, T., Wurgler-Murphy, S.M. and Saito, H. (1994) A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature. 369, 242-245. [7] Schuller, C , Brewster, J.L., Alexander, M.R., Gustin, M.C. and Ruis, H. (1994) The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene. Embo J. 13, 4382-4389. [8] Maeda, T., Takekawa, M. and Saito, H. (1995) Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3- containing osmosensor. Science. 269, 554-558. [9] Martinez-Pastor, M.T., Marchler, G., Schuller, C , Marchler-Bauer, A., Ruis, H. and Estruch, F. (1996) The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). Embo J. 15, 2227-2235. [10] Nevoigt, E. and Stahl, U. (1997) Osmoregulation and glycerol metabolism in the yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 21, 231-241. [11] Posas, F. and Saito, H. (1997) Osmotic activation of the HOG MAPK pathway via Stel lp MAPKKK: scaffold role of Pbs2p MAPKK. Science. 276, 1702-1705. [12] Ferrigno, P., Posas, F., Koepp, D., Saito, H. and Silver, P.A. (1998) Regulated nucleo/cytoplasmic exchange of HOG1 MAPK requires the importin beta homologs NMD5 and XPOJ. Embo J. 17, 5606-5614. [13] Gorner, W., Durchschlag, E., Martinez-Pastor, M.T., Estruch, F., Ammerer, G., Hamilton, B., Ruis, H. and Schuller, C. (1998) Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12, 586-597. [14] O'Rourke, S.M. and Herskowitz, I. (1998) The Hogl MAPK prevents cross talk between the HOG and pheromone response MAPK pathways in Saccharomyces cerevisiae. Genes Dev. 12, 2874-86. 126 Posas, F., Witten, E.A. and Saito, H. (1998) Requirement of STE50 for osmostress-induced activation of the STE11 mitogen-activated protein kinase kinase kinase in the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 18, 5788-5796. Profit, M. and Serrano, R. (1999) Repressors and upstream repressing sequences of the stress-regulated ENA1 gene in Saccharomyces cerevisiae: bZIP protein Skolp confers HOG- dependent osmotic regulation. Mol. Cell. Biol. 19, 537-546. Reiser, V., Ruis, H. and Ammerer, G. (1999) Kinase activity-dependent nuclear export opposes stress-induced nuclear accumulation and retention of Hog 1 mitogen-activated protein kinase in the budding yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 10, 1147-1161. Rep, M., Reiser, V., Gartner, U., Thevelein, J.M., Hohmann, S., Ammerer, G. and Ruis, H. (1999) Osmotic stress-induced gene expression in Saccharomyces cerevisiae requires Msnlp and the novel nuclear factor Hotlp. Mol. Cell. Biol. 19, 5474-5485. Reiser, V., Salah, S.M. and Ammerer, G. (2000) Polarized localization of yeast Pbs2 depends on osmostress, the membrane protein Shol and Cdc42. Nat. Cell. Biol. 2, 620-627. Rep, M., Proft, M., Remize, F., Tamas, M., Serrano, R., Thevelein, J.M. and Hohmann, S. (2001) The Saccharomyces cerevisiae Skolp transcription factor mediates HOG pathway-dependent osmotic regulation of a set of genes encoding enzymes implicated in protection from oxidative damage. Mol. Microbiol. 40, 1067-1083. Cameron, S., Levin, L., Zoller, M. and Wigler, M. (1988) cAMP-independent control of sporulation, glycogen metabolism, and heat shock resistance in & cerevisiae. Cell. 53, 555-566. Broach, J.R. and Deschenes, R.J. (1990) The function of ras genes in Saccharomyces cerevisiae. Adv Cancer Res. 54, 79-139. [23] Gimeno, C.J., Ljungdahl, P.O., Styles, CA. and Fink, G.R. (1992) Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell. 68, 1077-1090. [24] Smith, A., Ward, M.P. and Garrett, S. (1998) Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. Embo J. 17, 3556-3564. [25] Blomberg, A. and Adler, L. (1992) Physiology of osmotolerance in fungi. Adv. Microb. Physiol. 33, 145-212. [26] Hohmann, S. (1997) in: Yeast Stress Responses, pp. pp.101-146 (Hohmann, S.a.M., H., Ed.) Springer, New York, NY. [27] Prior, B.A.a.H., S. (1997) in: Yeast Sugar Metabolism, pp. pp.313-337 (Zimmermann, F.K.a.E., K. D., Ed.) Technomic, Lancaster. [28] Larsson, K., Ansell, R., Eriksson, P. and Adler, L. (1993) A gene encoding sn-glycerol 3-phosphate dehydrogenase (NAD+) complements an osmosensitive mutant of Saccharomyces cerevisiae. Mol. Microbiol. 10, 1101-111. [29] Eriksson, P., Andre, L., Ansell, R., Blomberg, A. and Adler, L. (1995) Cloning and characterization of GPD2, a second gene encoding sn- glycerol 3-phosphate dehydrogenase (NAD+) in Saccharomyces cerevisiae, and its comparison with GPD1. Mol. Microbiol. 17, 95-107. [30] Varela, J.C, van Beekvelt, C , Planta, R.J. and Mager, W.H. (1992) Osmostress-induced changes in yeast gene expression. Mol.Microbiol. 6, 2183-2190. [31] Albertyn, J , Hohmann, S, Thevelein, J.M. and Prior, B.A. (1994) GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14, 4135-4144. [32] Hirayama, T., Maeda, T., Saito, H. and Shinozaki, K. (1995) Cloning and characterization of seven cDNAs for hyperosmolarity- responsive (HOR) genes of Saccharomyces cerevisiae. Mol. Gen. Genet. 249, 127-138. [33] Van Dijken, J.P., and Scheffers, W. A (1986) Redox balance in the metabolism of sugars by yeasts. FEMS Microbiol. Rev. 32, 199-224. [34] Blomberg, A. and Adler, L. (1989) Roles of glycerol and glycerol-3-phosphate dehydrogenase (NAD+) in acquired osmotolerance of Saccharomyces cerevisiae. J. Bacteriol. 171, 1087-1092. [35] Teusink, B., Walsh, M.C., van Dam, K. and Westerhoff, H.V. (1998) The danger of metabolic pathways with turbo design. Trends Biochem. Sci. 23, 162-169. [36] Teusink, B. et al. (2000) Can yeast glycolysis be understood in terms of in vitro kinetics of the constituent enzymes? Testing biochemistry. Eur. J. Biochem. 267, 5313-5329. [37] Blomberg, A. (1995) Global changes in protein synthesis during adaptation of the yeast Saccharomyces cerevisiae to 0.7 M NaCl. J. Bacteriol. 177, 3563-3572. [38] Blomberg, A. (2000) Metabolic surprises in Saccharomyces cerevisiae during adaptation to saline conditions: questions, some answers and a model. FEMS Microbiol. Lett. 182, 1-8. [39] Hohmann, S., Neves, M.J., de Koning, W., Alijo, R., Ramos, J. and Thevelein, J.M. (1993) The growth and signalling defects of the ggsl (fdpl/bypl) deletion mutant on glucose are suppressed by a deletion of the gene encoding hexokinase PII. Curr. Genet. 23, 281-289. [40] Van Aelst, L., Hohmann, S., Zimmermann, F.K., Jans, A.W. and Thevelein, J.M. (1991) A yeast homologue of the bovine lens fibre MIP gene family complements the growth defect of a Saccharomyces cerevisiae mutant on fermentable sugars but not its defect in glucose-induced RAS-mediated cAMP signalling. Embo J. 10, 2095-2104. 129 Blazquez, M.A., Lagunas, R., Gancedo, C. and Gancedo, J.M. (1993) Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexokinases. FEBS Lett. 329, 51-54. Luyten, K., de Koning, W., Tesseur, I., Ruiz, M.C., Ramos, J., Cobbaert, P., Thevelein, J.M. and Hohmann, S. (1993) Disruption of the Kluyveromyces lactis GGS1 gene causes inability to grow on glucose and fructose and is suppressed by mutations that reduce sugar uptake. Eur. J. Biochem. 217, 701-713. Thevelein, J.M. and Hohmann, S. (1995) Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem. Sci. 20, 3-10. Francois, J. and Parrou, J.L. (2001) Reserve carbohydrates metabolism in the yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25, 125-45. Ausubel, F.M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1995) in: Current Protocols in Molecular Biology John Wiley & Sons Inc., New York, NY. Jelinsky, S.A. and Samson, L.D. (1999) Global response of Saccharomyces cerevisiae to an alkylating agent. Proc. Natl. Acad. Sci. USA. 96, 1486-1491. Costanzo, M.C. et al. (2001) YPD, PombePD and WormPD: model organism volumes of the BioKnowledge library, an integrated resource for protein information. Nucleic Acids Res. 29, 75-79. Hodges, P.E., McKee, A.H., Davis, B.P., Payne, W.E. and Garrels, J.I. (1999) The Yeast Proteome Database (YPD): a model for the organization and presentation of genome-wide functional data. Nucleic Acids Res. 27, 69-73. Gasch, A.P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G., Botstein, D., and Brown, P.O. (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol. Biol. Cell. 11, 4241-4257. [50] Zaragoza, O., Vincent, O. and Gancedo, J.M. (2001) Regulatory elements in the FBP1 promoter respond differently to glucose- dependent signals in Saccharomyces cerevisiae. Biochem. J. 359, 193-201. [51] Remize, F., Andrieu, E. and Dequin, S. (2000) Engineering of the pyruvate dehydrogenase bypass in Saccharomyces cerevisiae: role of the cytosolic Mg(2+) and mitochondrial K(+) acetaldehyde dehydrogenases Ald6p and Ald4p in acetate formation during alcoholic fermentation. Appl. Environ. Microbiol. 66, 3151-9. [52] Radler, F. (1994) in: Wine Microbiology and Biotechnology (Fleet, G.H., Ed.) Harwood academic publishers, Chur, Switzerland. [53] Coleman, S.T., Fang, T.K., Rovinsky, S.A., Turano, F.J. and Moye-Rowley, W.S. (2001) Expression of a glutamate decarboxylase homologue is required for normal oxidative stress tolerance in Saccharomyces cerevisiae. J. Biol. Chem. 276, 244-250. [54] Ogata, H., Goto, S., Sato, K., Fujibuchi, W., Bono, H. and Kanehisa, M. (1999) KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 27, 29-34. [55] Springer, C , Kunzler, M., Balmelli, T. and Braus, G.H. (1996) Amino acid and adenine cross-pathway regulation act through the same 5'- TGACTC-3' motif in the yeast HIS7 promoter. J. Biol. Chem. 271, 29637-429643. [56] Hohmann, S. and Cederberg, H. (1990) Autoregulation may control the expression of yeast pyruvate decarboxylase structural genes PDC1 and PDC5. Eur. J. Biochem. 188, 615-621. [57] Hohmann, S. (1991) PDC6, a weakly expressed pyruvate decarboxylase gene from yeast, is activated when fused spontaneously under the control of the PDC1 promoter. Curr. Genet. 20, 373-378. [58] Boy-Marcotte, E., Tadi, D., Perrot, M., Boucherie, H. and Jacquet, M. (1996) High cAMP levels antagonize the reprogramming of gene expression that occurs at the diauxic shift in Saccharomyces cerevisiae. Microbiology 142, 459-467. 131 Flikweert, M.T, Van Der Zanden, L , Janssen, W.M, Steensma, FLY, Van Dijken, J.P. and Pronk, J.T. (1996) Pyruvate decarboxylase: an indispensable enzyme for growth of Saccharomyces cerevisiae on glucose. Yeast 12, 247-257. Hohmann, S. (1991) Characterization of PDC6, a third structural gene for pyruvate decarboxylase in Saccharomyces cerevisiae. J. Bacteriol. 173, 7963-7969. Parrou, J.L, Teste, M.A. and Francois, J. (1997) Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose. Microbiology. 143, 1891-1900. Heinrich, R, Montero, F, Klipp, E , Waddell, T.G. and Melendez-Hevia, E. (1997) Theoretical approaches to the evolutionary optimization of glycolysis: thermodynamic and kinetic constraints. Eur. J. Biochem. 243, 191-201. Melendez-Hevia, E , Waddell, T.G, Heinrich, R. and Montero, F. (1997) Theoretical approaches to the evolutionary optimization of glycolysis— chemical analysis. Eur. J. Biochem. 244, 527-543. Norbeck, J. and Blomberg, A. (1997) Metabolic and regulatory changes associated with growth of Saccharomyces cerevisiae in 1.4 M NaCl. Evidence for osmotic induction of glycerol dissimilation via the dihydroxyacetone pathway. J. Biol. Chem. 272, 5544-5554. Rebora, K , Desmoucelles, C , Borne, F , Pinson, B. and Daignan-Fornier, B. (2001) Yeast AMP pathway genes respond to adenine through regulated synthesis of a metabolic intermediate. Mol. Cell. Biol. 21, 7901-1792. Daignan-Fornier, B. and Fink, G.R. (1992) Coregulation of purine and histidine biosynthesis by the transcriptional activators BAS1 and BAS2. Proc. Natl. Acad. Sci. USA. 89, 6746-6750. 132 Arndt, K.T., Styles, C. and Fink, G.R. (1987) Multiple global regulators control HIS4 transcription in yeast. Science 237, 874-880. Mosch, H.U., Scheier, B., Lahti, R., Mantsala, P. and Braus, G.H. (1991) Transcriptional activation of yeast nucleotide biosynthetic gene ADE4 by GCN4. J. Biol. Chem. 266, 20453-20456. Stotz, A., Muller, P.P. and Linder, P. (1993) Regulation of the ADE2 gene from Saccharomyces cerevisiae. Curr. Genet. 24, 472-480. Guetsova, M.L., Lecoq, K. and Daignan-Fornier, B. (1997) The isolation and characterization of Saccharomyces cerevisiae mutants that constitutively express purine biosynthetic genes. Genetics 147, 383-397. Thoukis, G., Ueda, M., and Wright, D. (1965) The formation of succinic acid during alcoholic fermentation. Am. J. Enol. Vitic. 16, 1-8. Heerde, E., and Radler, F. (1978) Metabolism of the anaerobic formation of succinic acid by Saccharomyces cerevisiae. Archives of Microbiology 117,269-276. 133 C h a p t e r 3 I m p a c t o f Y e a s t S t r a i n o n the P r o d u c t i o n o f A c e t i c a c i d , G l y c e r o l a n d the Sensory A t t r i b u t e s o f I cewine This chapter has been published in the American Journal of Enology and Viticulture as: Daniel J. Erasmus, Margaret Cliff, and Hennie J. J. van Vuuren. (2004) Impact of Yeast Strain on the Production of Acetic acid, Glycerol and the Sensory Attributes of Icewine. Am. J. Enol. Vitic. 55, 371-378. Copyright C2004 by the American Society for Enology and Viticulture. Reprinted by permission. All rights reserved. 134 3.1 Introduction Icewine, or Eiswein, was first produced in Germany in 1794. Grapes were left on the vines until they froze. Freezing of berries concentrates both the sugars and flavor compounds in the grapes leading to wines with intense aroma and flavor notes with high residual sugar concentrations [1]. Today, Icewines are produced in Germany, Austria and Canada, predominantly from Riesling grapes. In Canada, the Vintners Quality Alliance (VQA) regulates the production of Icewine. Grapes for Icewine production must be frozen naturally, on the vine, and can only be harvested at temperatures equal to or below -8 °C. The natural freezing process results in grape must with exceptionally high sugar concentrations that can be as high as 50 °Brix. During harvesting no single pressing may produce grape must lower than 32 °Brix with the final average in the fermentation tank not below 35 °Brix [2]. The production of Icewine is often problematic; protracted and stuck alcoholic fermentations and the occurrence of high volatile acidity (VA) are some of the major problems experienced by wineries. International and Canadian laws regulate the maximum level of VA that may be present in Icewine. The maximum VA allowed in wine according to Canadian Federal regulation is 1.3 g/L. Canadian Icewines often contain more than 1.3 g/L of VA (mainly acetic acid) resulting in financial losses to wineries. Microbiological agents associated with VA can be divided into three groups: spoilage bacteria [3], non-Saccharomyces yeasts [4] and wine yeasts {Saccharomyces sp.) used as starter cultures for wine production. Although the former two groups are more frequently the cause of high VA in table wines, wine yeast seems to be a major contributor of VA in high Brix musts [5,6]. During growth in Icewine grape musts, S. cerevisiae is exposed to extreme conditions of osmotic stress. The water activity (Aw) of 40% (w/v) sugars grape juice is approximately 0.939 compared to Aw =0.981 for 22% (w/v) sugars grape juice [6]. High density DNA microarrays showed that the transcription of 589 genes in wine yeast was affected more than two-fold in grape juice containing 40% (w/v) sugars when compared to 22% (w/v) sugars [6]. 135 This sugar-induced osmotic stress up-regulated the structural genes involved in the synthesis of acetic acid from acetaldehyde and glycerol from dihydroxyacetone phosphate. The osmoregulatory response in S. cerevisae has been well characterized [7]. Yeast cells adapt to osmotic stress environments by producing glycerol as compatible solute. Glycerol prevents the efflux of water from the cell into the environment, thereby preventing dehydration of the yeast. The key enzyme in the process of glycerol formation is a NADH-dependent glycerol-3-phosphate dehydrogenase that converts dihydroxyacetone phosphate to glycerol-3-phosphate with the concomitant oxidation of NADH to NAD+- The shift in redox balance (NADH:NAD+ ratio) caused by increased formation of glycerol utilize acetic acid as a redox sink to convert NAD + back to NADH [8,9]. Wine yeasts produce acetic acid by the oxidation of acetaldehyde to acetate by NAD(P)+-dependent (acet)aldehyde dehydrogenases [10]. Several studies have linked the production of acetic acid to increased glycerol production [9,11,12]. The glycerol concentration in table wines ranges from 3-12 g/L, but in general approximately 7 g/L is present [13,14]. Wine yeast strains vary greatly in their ability to form acetic acid [15]. The overproduction of glycerol during wine fermentations for its positive sensory attributes, leads to an increase in acetic acid levels [9]. However, the degree of acetic acid formation was yeast strain dependent. Although Remize and co-workers used the same strategy for all the yeast strains, acetic acid and glycerol production varied greatly among the strains. It is therefore conceivable that yeast strains experiencing the same osmotic pressure will respond differently by producing not only increased amounts, but also different amounts of glycerol and acetic acid. In the case of Icewine, the choice of yeast strain might, therefore, determine if a wine will be accepted or rejected due to legal requirements. To our knowledge, yeast strains have not yet been evaluated for Icewine production. 136 The aim of this study was to compare seven different wine yeast strains for (i) acetic acid and glycerol formation (ii) fermentation rates in synthetic and Icewine grape must (iii) impact on sensory characteristics of Icewine. 3.2 Materials and Methods 3.2.1 Yeast strains and media Seven commercially available yeast strains were used in this study. Vinl3, N96 and Vin7 (Anchor Yeast, Industria, South Africa), ECU 18, VI116 and 71B (Lallemand, Montreal, Canada) and Zymaflore ST (J. Laffort & Cie, Bordeaux, France). The recommended rehydration method for Vinl3, N96 and Vin7 is a 7 °Brix must for 30 minutes at 37-40 °C; ECU 18, VI116 and 71B is sterile tap water for 30 minutes at 40 °C and Zymaflore ST a sucrose solution with water (100 g/L) at 38-40 °C for 30 minutes. Synthetic grape must used in this study contained equimolar amounts of glucose and fructose at final concentrations of 20% (w/v) 40% (w/v), 45% (w/v) or 50%(w/v), 4.5 g/L L-malic acid, 0.3 g/L citric acid, 4.5 g/L tartaric acid, 2 g/L ammonium sulfate, 1.7 g/L Yeast Nitrogen Base (w/o ammonium sulfate or amino acids), 1 mL/L Tween 80 and 5 mg/L oleic acid [16]. The pH of the synthetic must was adjusted to 3.2 with 0.5 N KOH and filter sterilized (0.22 micron). Riesling Icewine juice of 40 °Brix was obtained from a commercial vineyard in Ontario, Canada. Icewine juice was stored in 1 L batches at -30 °C until use. 3.2.2 Determination of the nitrogen content of Riesling Icewine must An enzymatic kit was used to determine the ammonium concentration in the must according to the manufacturer's instructions (Ammoniak/Ammonia kit, Roche Molecular Biochemicals, Laval, QC, Canada). Free a-amino nitrogen was measured with a spectrophotometer using o-phthaldialdehyde and TV-acetyl-L-cysteine (Dukes and Butzke, 1996). 137 3.2.3 Experimental winemaking All musts were inoculated with active dry yeast (ADY) to a final concentration of 6 x 106 cells/mL and fermented at 20 °C. Fermentation progress was followed by weight loss. Since Icewine contains approximately 11% (v/v) ethanol, fermentations were stopped when the ethanol concentration reached approx. 11% ± 0.5 % (v/v) ethanol. Fifty milliliter samples for analyses of acetic acid, glycerol and ethanol were centrifuged for 5 minutes 5000 rpm at 4 °C (Sorvall RC5C plus, rotor #: SLA300, Newtown, CT), filter sterilized (0.22 micron) and stored at -30 °C until analysed. To study the impact of yeast strain on the production of acetic acid, glycerol and fermentation rate, two types of media were used: synthetic grape must and Riesling Icewine grape must. The synthetic grape must containing either 20% (w/v) or 40% (w/v) sugars was aliquoted in 200 mL batches into 250 mL Kimax bottles fitted with fermentations locks. ADY were rehydrated in 20% (w/v) synthetic grape must diluted 1:2 with deionized water and incubated at 40 °C for 30 minutes. Fermentations were slowly stirred for 1 minute on a magnetic stirrer before samples were taken to monitor cell growth by spectrophotometry using absorbance (A=600nm). Fermentations were conducted in triplicate. Icewine fermentations were conducted using 500 mL batches of Riesling Icewine grape must in 500 mL Kimax bottles fitted with fermentation locks. The seven yeast strains were rehydrated in 2 ways, according to their recommended method and by diluting Icewine grape must down to 7 °Brix with deionized water. Since the recommended rehydration method for Vinl3, Vin7 and N96 is 7 °Brix, sterile tap water was used as second method. Rehydrated cultures were incubated for 30 minutes at 40 °C before the Icewine grape must was inoculated. Fermentations were conducted twice in duplicate. Icewine for sensory analysis was produced as described above, except that fermentations took place in 2 L fermentation flasks. Fermentations were done in duplicate at 138 20 °C and fermentation rate was monitored by weight loss. Fermentations were stopped by transferring the flasks to 4 °C, with the headspace of the fermentation vessel filled with N2-gas. As soon as the yeast cells settled to the bottom of the flask, 150 mg/L SO2 was added. Prior to bottling, a further 50 mg/L SO2 was added followed by filtration through a 0.45 micron filter into 375 ml screw top bottles. Wines were bottle-aged for five months. To avoid any possible bottle-to-bottle variation, two bottles (375 mL) were combined to form a composite sample for sensory evaluation for each of the yeast strains. 3.2.4 Quantification of acetic acid, glycerol and ethanol Acetic acid, glycerol and ethanol were quantified by injecting 10 uL of diluted Icewine (12-fold) and synthetic must samples [9-fold for 40% (w/v) and 6-fold for 20% (w/v) sugars synthetic must] into an Agilent 1100 series HPLC with photo diode array and refractive index detectors. The photo diode array detector was set at A, =210 nm and the refractive index detector was maintained at 35 °C. The HPLC was fitted with Supelcogel C610H (Supelco, cat #: 59320-U) analytical cation exchange column and Supelguard C610H (Supelco, cat #: 59319) column and operated at 30 °C. A degassed 0.22 micron filtered 10 mM H3PO4 mobile phase was applied to the column at a flow rate of 0.5 ml/min. The run time of samples was 35 minutes. Compounds were quantified using external standards dissolved in 10 mM H3PO4. Analyses were done at least in duplicate. 3.2.5 Analysis of colour, viscosity and titratable acidity (TA) of Icewine The colour of the Icewines was determined by CIELAB tristimulus values, L (lightness), a (redness) and b (yellowness) using a scanning spectrophotometer (Beckman, DU640B). The viscosity of 16 mL Icewines samples was determined with a Brookfield viscometer Model DV-II (Brookfield Engineering Labs, Stoughton, MA) equipped with a LV spindle. The viscometer was set at 60 rpm at 25 °C. Calibration of the viscometer was 139 confirmed with a 4.3 mPa.s viscosity standard. T.A. was determined according to A.O.A.C. method number 926.12 and expressed as g/L tartaric acid. 3.2.6 Sensory Methodology 3.2.6.1 Experimental design. Icewines were evaluated in duplicate according to a complete randomized design. Wines were coded with 3-digit random numbers and presented in random order to the judges. Different codes were assigned for each of the colour, aroma, flavour and quality assessments. Each of the assessments was conducted on a separate scorecard. Wine samples (20 mL) for visual (colour) assessment were placed in plastic petri-dishes and evaluated under natural light against a white background. Aroma, flavour and quality were assessed using 25 mL Icewine samples at room temperature in 210 mL INAO-ISO glasses covered with plastic petri dishes. All assessments were conducted in individual tasting booths. 3.2.6.2 Judges. Twelve judges, eleven from the Pacific Agriculture and Agri-Food Research Centre (PARC) and one from the Wine Research Centre (WRC) participated in the study. All judges were experienced with wine quality and sensory evaluations. 3.2.6.3 Benching. Five of the twelve judges participated in an initial benching session to identify possible sensory attributes and screen the wines. During this session, two Icewines (7IB, Vin7) were determined to be excessively oxidized and were dropped from further evaluation and some were identified to have a high perceived sulphur-like aroma. The judges felt it would be advantageous to dissipate the sulphur-like aroma, by swirling the glass, in order to better evaluate underlying fruity character. 3.2.6.4 Training. All twelve judges participated in the training session. During this session, the judges revised and refined the sensory attributes until a consensus was obtained as listed in Table 3.1. Judges were also familiarized with the 'tasting/rinsing' protocol and given an opportunity to practice the use of the unstructured line scales. The judges were 140 required to follow a strict 'tasting/rinsing' protocol which consisted of: swirling and sniffing the glass for the aroma assessments, to sip and swirl the wine in their mouth for the flavour/quality evaluations, and to rinse with sparkling and still water between assessments. Table 3.1. Definitions of sensory attributes evaluated in Icewines Attribute Definition Sulphur-like The intensity of any sulphur-like aroma (H2S, mercaptan, rubbery, aroma garlic, onion, diesel) ranging from low to high. Fruity Intensity of fruit-like aroma and taste (peach, apricot, honey, citrus, dried fruit, jam) notes ranging from low to high. Acidity The intensity of sour taste in the wine ranging from low to high Mouth feel (body) The degree of mouth feel coating or body ranging from thin (low body) to thick (viscous). Aftertaste The duration of flavour sensations that remain in the mouth after expectoration ranging from short to long. Overall quality A composite response of all sensations (visual, aroma, taste, aftertaste) ranging from low quality to high quality. 3.2.6.5 Colour/Aroma/Flavour/Quality Assessments. Evaluations took place on two successive mornings. Each tasting consisted of two sessions (08:30 to 09:00 and 10:30 to 11:30). During the first session judges evaluated the colour and aroma attributes (sulphur-like aroma 1, fruity character 1), on scorecards one and two. Once completed, the lids were removed and the glasses swirled three times (09:45, 10:00 and 10:15) to dissipate sulphur-like aromas. Two hours later the judges returned for the second session. At this session, judges evaluated the aroma (sulphur-like aroma 2, fruity character 2), flavour (fruitiness, acidity, mouth feel, aftertaste) and overall quality on scorecards three, four and five, respectively. Judges were requested to take a 5-minute break between the acidity and mouth feel attributes. All assessments were conducted in individual tasting booths. Judges scored each attribute on a 10 cm unstructured line scale, anchored at 1 cm and 9 cm with low (short, 141 thin) and high (long, thick), respectively. Data were quantified by measuring the distance of the judge's mark from the origin. 3.2.7 Statistical analyses A two-factor analysis of variance (ANOVA) was used to evaluate the effect of yeast strain and rehydration method on acetic acid and glycerol production. Differences among yeast strains were determined using a Fisher's least significant difference (LSD) test (p<0.05). Two-factor ANOVA with replication (MS Excel, Seattle) was used to evaluate the effect of judge, wine and judgeXwine for each of the sensory attributes. Differences among wines were determined using a Fisher's LSD test (p<0.05). A paired T-test was used to evaluate the changes in perceived sulphur-like and fruity aromas from the first session to the second session. Principal component analyses (PCA) (Minitab) were performed using the correlation matrix on the mean sensory scores for the statistically significant attributes. Preliminary evaluation of judgeXwine interactions showed that judges scored consistently except for the sulphur-like aroma for the second session. However, this did not influence the significance of the F-value, when examined using the techniques described by [17]. A Pearson-correlation matrix analysis was performed between physico-chemical and sensory attributes. 3.3 Results 3.3.1 Fermentation performance of yeast strains in synthetic grape must Yeast strains N96 and Vin7 were the fastest fermentors at 20% (w/v) sugars followed by ECU 18 and Vinl3, VI116, 71B and ST. The order of completion to produce approximately 11% ethanol (v/v) from 40% (w/v) sugars was N96, Vinl3, ECU 18 and VI116, Vin7 and ST, and 71B (Table 3.2). As expected, the yeast strains also grew to lower 142 cell densities and fermented slower in 40% (w/v) synthetic must (SM) in comparison to 20% (w/v) SM (Table 3.2). ST grew to the highest cell densities of all the yeast strains in fermentations conducted with 20% (w/v) sugars SM (Table 3.2). ST was followed by (from high to low cell densities): EC1118, VI116, N96, Vinl3, 71B, and Vin7. 71B and Vin7 grew to substantially lower cell densities than ST, N96, VI116 and Vinl3 at 20% (w/v) sugar SM (Table 3.2). Analysis of cell densities in fermentations conducted using 40% (w/v) sugars SM revealed that N96 and ST grew to higher cell densities than VI116, Vinl3, ECU 18, 71B and Vin7. Vin7 grew to much lower cell densities, not only in 20% (w/v) sugars SM but also in 40% (w/v), compared to the other strains (Table 3.2). Table 3.2. Fermentation time, maximum cell densities and ethanol produced by seven wine yeast strains in 20% and 40% (w/v) sugar synthetic must Strains Fermentation time Maximum Cell Ethanol (hours) Densities (ODeoonm) % (v/v) 20% 40% 20% 40% 20% 40% ST 336 432 7.5 + 0.1 3.8 ±0.2 10.9 ±0.04 11.0 ±0.06 N96 192 288 6.5 ±0.1 3.9 ±0.04 10.5 ±0.15 10.9 ±0.22 Vinl3 216 404 6.4 ±0.4 3.2 ±0.1 10.8 ±0.12 11.5 ± 0.12 EC1118 216 404 6.7 ±0.1 3.4 ±0.1 10.7 ±0.22 10.5 ±0.31 V1116 264 404 6.6 ±0.2 3.7 ±0.3 10.9 ±0.07 11.5 ±0.42 71B 336 504 5.4 ±0.2 3.0 ±0.1 11.0 ±0.22 10.8 ±0.12 Vin7 192 432 5.2 ±0.1 2.7 ±0.1 10.6 ±0.32 10.5 ±0.16 Values are the means of three fermentations ± standard deviation 143 3.3.2 Increased sugar concentrations increase the production of acetic acid and glycerol by wine yeast strains in synthetic must All seven yeast strains produced more acetic acid and glycerol in SM containing 40% (w/v) sugars compared to SM with only 20% (w/v) sugars (Fig. 3.1 A, and J3)(Appendix E). Depending on the yeast strain, acetic acid increased by approximately 3 to 6-fold: ST (3.7-fold), Vinl3 (4.5-fold), N96 (5.6-fold), V1116 (2.7-fold), EC1118 (4.2-fold), 71B (3.7-fold), Vin7 (3.0-fold). N96 produced the lowest amount of acetic acid at 20% (w/v) sugars followed by ST, Vinl3, EC1118, 7IB, VI116, and Vin7. ST produced the lowest amount at 40% (w/v) sugars followed by Vinl3, N96, EC1118, VI116, 71B and Vin7. Glycerol production by ST at 40% (w/v) sugars was the lowest followed by, from low to high, N96, ECU 18, Vinl3, VI116, 71B and Vin7 (Fig. 3.1 B). At 20% (w/v) sugars, glycerol formation by N96 was the lowest followed by VI116, Vinl3, ST, EC1118, Vin7 and 71B. Regardless of the yeast strain used, acetic acid and glycerol concentrations were found to be directly related to the sugar concentration; the higher the sugar concentration, the more acetic acid and glycerol were produced. This relationship was linear since the correlation coefficients for all three yeast strains were >0.950 for both acetic acid and glycerol (Figs. 3.1 C and D). 3.3.3 Fermentation rate, and acetic acid and glycerol production in Icewine is yeast strain specific Riesling Icewine must (Table 3.3) fermentations were completed (approximately 11.0% v/v ethanol produced) after 17 days by N96 followed by ECU 18, VI116, Vinl3 and ST. Vin7 and 71B were not able to ferment the desired amount of sugars to produce approximately 11% (v/v) ethanol, even after 49 days (Fig. 3.2). Formation of acetic acid (F 144 =75.43, p<0.0001) and glycerol (F =57.84, pO.OOOl) by the different yeast strains were significantly different (Figs. 3.3 A, and B) with ST producing the lowest and Vin7 the highest amount of acetic acid. Icewines fermented with Vinl3, N96, ECU 18 and VI116 did not differ significantly with respect to the amount of acetic acid produced. ST produced significantly less glycerol and Vin7 produced significantly higher amounts of glycerol than all the other yeast strains. Vinl3, ECU 18 and N96 did not produce significantly different levels of glycerol. VI116 and 71B did not differ significantly as far as glycerol production was concerned. Table 3.3. Composition of Riesling Icewine must used for evaluating yeast strains Soluble solids (°Brix) 40 pH 3.2 Titratable acidity (g/L) 10.9 Ammonia (mg N/L) 145 Free amino nitrogen (FAN) (mg N/L) 370 Yeast assimilable nitrogen (YAN) (mg N/L) 515 3.3.4 Physico-chemical and sensory analysis of Icewines produced with different yeast strains The mean physico-chemical and sensory data of the composite Icewines are listed in Tables 3.4 and 3.5. Icewines produced by yeast strains N96 and ECU 18 had the highest mean scores for overall quality (OQ) followed by ST, VI116 and Vinl3 (Table 3.4). Icewine produced by Vinl3 was significantly lower in quality than Icewines produced by N96 and EC1118 (F=3.28, p<0.05), while Icewines produced by Vinl3, ST and VI116 did not differ significantly. Icewines produced with N96, EC1118, ST and VI116 were the highest in OQ and not significantly different from one another. OQ assessment had a significant correlation with spectrophotometric colour measurements: lightness (r =0.873, p<0.1), redness (r =-0.817, p<0.1) and yellowness (r =-0.903, p<0.05). 145 1.6 1.4 •a '§ 0-8 •S 0.6 .§ 0.4 0.2 0.0 A a 20% sugars B 40% sugdr* xl n ST Vin13 N96 EC1118 V1116 71B Vir>7 ST Vin13 N96 EC1118 V1116 71B Vin7 0% 10% 20% 30% 40% 50% Sugar concentration (w/v) 20% 30% 40% 50% Sugar concentration (w/v) Fig. 3.1 Formation of acetic acid (A) and glycerol (B) by seven different wine yeast strains in synthetic must containing either 20% or 40% (w/v) sugars. The results are the mean values ± standard deviation from three fermentations. A linear relationship was found for (C) acetic acid {ST r= 0.966, N96 r= 0.970, EC1118 r= 0.959} and (D) glycerol {ST r= 0.990, N96 r= 0.972, EC1118 r= 0.989} with increasing sugar concentrations. 146 100 Time (days) Fig. 3.2 Comparison of fermentation rates of seven yeast strains in Riesling Icewine must. The results are the mean values from six different fermentations. Difference between replicates was <10%. 147 - i — • — 1 — i — • 1 i ST Vin13 N96 EC1118 V1116 71B Vin7 16 14- B DJ10-d O 8-CD „ o 6-O 4-2 -I 1 — I I ST Vin13 N96 EC1118 V1116 71B Vin7 Fig. 3.3 Formation of (A) acetic acid (LSD =0.097) and (B) glycerol (LSD =0.575) by seven different yeast strains in Icewine. The results are the mean values ± standard deviation from six fermentations. 148 Colour assessments by the judges revealed that Icewine from Vinl3 was significantly (F =31.8, p<0.0001) more intense yellow in colour than the other Icewines. ECU 18 produced Icewine that was significantly darker in colour than Icewines produced with VI116 and ST, but not N96. Icewines from ST and VI116 were significantly lighter in colour than those produced by Vinl3 and ECU 18, but not N96. The physico-chemical and sensory analysis of colour showed high correlations indicating that the evaluations were tracking the same underlying phenomenon. Lightness had an inverse correlation (r =-0.960, p<0.05), whereas redness (r =0.957, p <0.05) and yellowness (r =0.838, p<0.1) were positively correlated with colour assessments by the judges. Furthermore a statistically significant correlation was found between redness and yellowness (r =0.955, p <0.05). Aroma differences among the Icewines produced by the yeast strains were limited to sulphur-like aroma (SA). Icewine produced with ECU 18 had significantly (F =5.151, p<0.01) lower mean scores than ST and VI116 for SA during the first session (sulphur-like aroma 1, Table 4). There was no significant difference between the Icewines with respect to fruity aroma, acidity, mouth feel, aftertaste and fruity flavour. The swirling of the glasses only decreased SA significantly for Icewines produced with N96 (t =2.64, p <0.05) and VI116 (t =2.84, p<0.001). Icewines fermented with EC1118, VI116 and N96 were judged to have significantly (F =5.058, p<0.01) lower perceived SA notes than wine made with ST during the second session (sulphur-like aroma 2, Table 3.4). SA from the second session had an inverse correlation with acetic acid concentration in the Icewine (r = -0.925, p <0.05). Acetic acid had a significant correlation (r =0.868, p<0.1) with ethanol. 149 Table 3.4. Analysis of sensory properties of Icewines used in sensory analysis ST Vinl3 N96 EC1118 V1116 Overall quality 49.8ab 38.5b 52.2a 52.0a 46.3ab Colour 27.1° 57.8a 35.3bc 41.7b 31.6C Sulphur-like aroma 1 50.8a 39.5ab 45.5abA 33.5b 50.6^ Sulphur-like aroma 2 47.3a 41.3ab 33.3bB 34.2b 34.8bB Fruity aroma 1 40.7a 43.7a 43.9a 42.9a 42.5a Fruity aroma 2 40.5a 42.4a 46.9a 48.1a 40.8a Fruity flavour 40.9a 41.0a 37.9a 39.5a 39.6a Acidity 59.4a 55.2a 62.2a 58.1a 56.1a Mouth feel/body 56.1' 49.2a 49.6a 48.8a 46.8a Aftertaste 55.8a 47.9a 55.r 49.6a 55.4a Values are the means of twelve determinations a, b and c superscripts indicate statistical difference between yeast strains for a sensory attribute using Fisher LSD (p<0.05) A, B indicate statistical difference between session 1 and session 2 for a particular aroma attribute Table 3.5. Analysis of physico-chemical properties of Icewines used in sensory analysis ST Vinl3 N96 EC1118 V1116 TA (g/L) 10.0 ±0.08 10.1 ±0.06 10.2 ±0.06 10.2 ±0.06 9.83 ± 0.08 pH 3.641 3.609 3.639 3.632 3.593 Viscosity (mPa.s) 3.28 ±0.01 3.43 ±0.01 3.43 ±0.04 3.21 ±0.00 3.40 ±,0.01 Color assessment L (lightness) 96.16 94.99 95.98 95.87 95.94 ±0.005 ±0.006 ±0.021 ±0.005 ±0.020 a (redness) -2.10 -1.63 -2.12 -1.93 -2.06 ±0.010 ±0.006 ±0.200 +0.017 ±0.004 b (yellowness) 18.86 21.17 18.10 19.35 19.27 ±0.021 ±0.064 ±0.202 ±0.045 ±0.103 Values are the means of three determinations ± standard deviation 150 3.4 Discussion The choice of yeast strain can contribute to the consistent production of high quality wines with unique styles and characteristics. Therefore, the identification of wine yeast strain(s) that produce small amounts of acetic acid, conduct fermentations efficiently and produce Icewine with ideal sensory characteristics is crucial for the production of high quality Icewines. 3.4.1 Fermentation rate and growth is yeast strain specific The seven yeast strains differed with respect to the time required to produce at least 11% ethanol (v/v) from 20% and 40% (w/v) sugars. Vin7, ST and 71B were the slowest fermentors at 40% sugars. The other yeast strains all finished in approximately the same order at both 20% and 40% (w/v) sugars. Moreover, 71B and Vin7 produced the highest amounts of acetic acid. Slow fermentation rates and high amounts of acetic acid formation; indicate that these two strains are unsuitable for Icewine fermentations. N96 grew to high cell densities and fermented the fastest at both 20 and 40% (w/v) sugars in synthetic must. Vin7 and 71B both grew to lower cell densities and fermented slower. ST, however, grew to high cell densities but fermented slower than the other yeasts in SM at both sugar concentrations. Despite the fact that ST is a slow fermentor, this yeast produced the lowest amount of acetic acid. N96 was the fastest fermentor and produced relatively low amounts acetic acid. Vinl3, ECU 18 and VI116 fermented at an acceptable rate and produced moderate amounts of acetic acid. 3.4.2 Osmotic stress environments accentuate differences among yeast strains Data obtained with 40% (w/v) sugar SM and 40 °Brix Icewine must showed remarkable similar trends. N96 was the fastest fermentor and ST, although a slow fermentor, produced the lowest amount of acetic acid. Vin7 and 7IB were both the slowest fermentors and 151 produced the highest amounts of acetic acid in both the SM and Riesling Icewine must. Vinl3, ECU 18, and VI116 followed a similar pattern in the Icewine fermentations as in the 40% (w/v) sugars SM of being moderate fermentors and acetate producers. However, unlike in the synthetic must, 71B was not able to produce 11% (v/v) ethanol. Vin7 and 7IB both produced the highest levels of acetic acid as well as the highest amounts of glycerol. This might indicate that these two strains require larger amounts of glycerol to adapt to high osmolarity or they have a decreased ability to retain glycerol as a compatible solute in the cytoplasm, hence the higher levels of glycerol in the media. In contrast, ST produced the lowest amounts of glycerol but was a slow fermentor. This may be due to the insufficient formation of glycerol to act as compatible solute and therefore may be the cause of the observed low metabolic activity (slow fermentation) and acetic acid formation by ST cells. N96, EC1118, Vinl3 and VI116 produced more glycerol than ST but less than 71B and Vin7. N96, ECU 18, Vinl3 and VI116 fermented much faster than ST, 71B and Vin7. It therefore seems that N96, ECU 18, VI116 and Vinl3 are able to adapt better to stress environments than ST, 71B and Vin7. It is interesting to note that the two S. bay anus strains (N96 and EC1118) were the fastest fermentors in Icewine grape must. The use of synthetic grape must to evaluate yeast strains for Icewine production provided reliable analytical data, but does not allow for the evaluation of these strains for their sensory characteristics during Icewine production. Furthermore, Icewine grape must used in commercial wineries are not sterile-filtered and contain other organisms that may influence acetic acid levels. Analysis of Icewine produced with non-sterile Icewine grape must revealed significant differences (p<0.05) for acetic acid levels when using different wine yeast strains (Fig. 3.3 A). This indicates that even if non-sterile Icewine must is used, wine yeast is still the major factor that contributes to high VA in high °Brix musts. 152 3.4.3 Sensory analysis of Icewines produced with different yeast strains Principal component analysis (PCA) of sensory attributes that were significantly different (p<0.05) revealed 99.3% of the total variation in 3 PC (Fig. 3.4). PC I explained 55.1% of the variation in the data set, it was weighted in the positive and negative directions with OQ and colour, respectively. PC II explains an additional 34.9%, which was primarily due to the presence or absence of SA, and PC III 9.3% (data not shown). Icewines produced with N96 and ECU 18 were located in the lower right quadrant and seem to be associated with high quality Icewine. Icewines produced with ST and VI116 were characterized by higher perceived SA. Vinl3 located to the left of the PCA plot produced Icewine with a darker yellow colour. The statistically significant positive correlation between OQ and spectrophotometric analysis indicate that high quality Icewine was associated with a light yellow colour. N96, ST and VI116 produced Icewine with a lighter yellow colour than Vinl3 and ECU 18. The high correlation between a (redness) and b (yellowness) indicate that as yellow increase, red colour will increase as well. This is consistent with Cliff and co-workers who reported that both yellow and brown colour increase simultaneously for British Columbia, Ontario and German Icewines [1]. The redness factor can be perceived as a brownish colour in "white" wine. Brown colour is usually associated with oxidized wines. It is not clear how the choice of yeast strain contributed to this aspect, since great care was taken by the authors to treat all the wines in the same way. Longer fermentations may lead to oxidized/brownish coloured wines. However, yeast strains such as ST that required longer fermentation time, produced lighter coloured Icewine than Vinl3 and EC1118. The almost 180° angle for OQ and SA of the second session indicate an inverse correlation between SA and OQ (Fig. 3.4), suggesting that SA detract from OQ. The near 90° angle between OQ and SA of the first session indicate that these two vectors had no correlation. High levels of hydrogen sulphide quite often cause SA in wine. The production 153 of this compound is associated with sluggish or stuck fermentations, mostly due to lack of nitrogen in the must. Nitrogen levels of 140 mg N/L seems sufficient to prevent stuck or sluggish fermentations [18]. Bely and co-workers (2003) suggest that 190 mg N/L is an optimal concentration to limit acetic acid formation in high °Brix musts [19]. The addition of nitrogen to fermentations has also been shown to reduce hydrogen sulphide formation [20]. The Riesling Icewine must used in this study had sufficient nitrogen (515 mg N/L) to prevent stuck or sluggish fermentations. The fact that ST is a slow fermentor and produced Icewine with high perceived SA indicate this strain might have a greater demand for nitrogen than N96, ECU 18 and Vinl3. Interestingly, a negative correlation was found for SA from the second session and acetic acid. These two flaws do not seem to occur simultaneously in the Icewine. The positive correlation between acetic acid and ethanol formation indicates that as more sugar is consumed, the yeast could potentially form more acetic acid. Wine makers can possibly prevent acetic acid formation by stopping Icewine fermentations as soon as sufficient ethanol is produced. Glycerol is responsible for viscosity and mouth feel in dry table wine. Glycerol only increases perceived viscosity at high levels (> 25 g/L) in table wines [21]. Since the levels of glycerol in the Icewine during this study was well below 25 g/L (a maximum of 13.8 g/L produced by Vin7), it is doubtful if it had an effect on viscosity or mouth feel. Since Icewines have residual sugar concentrations in excess of 150 g/L [1] it is doubtful if glycerol can influence this property of Icewine, even if the levels exceeded 25 g/L. The residual sugar content most likely has a greater effect on viscosity than glycerol. Due to the high residual sugar concentration it is also doubtful if glycerol would contribute to sweetness of Icewine as well. 154 0.8 Sulfur-like aroma 2 rj.6 • \ 0.4-\ 0 . 2 • Vin13 \ • \ Sulfur-like aroma 1 / s T / "V1116 -o.8 -6.6 -6.4 - r i a^" ^ ^ ^ ^ -0.2-Color -0.4--0.6 r \ d 2 0.4 0.6 0.8 N 9 6 \ ^ ^ Overall Quality • E C 1 1 1 8 P C I (55.1%) Fig. 3.4 Principal component analysis of statistically significant (p<0.05) sensory attributes of Icewines produced with five different wine yeast strains. 155 3.5 Conclusions This study illustrated the effect of wine yeast strain on the production of high VA in Icewine and emphasized the importance of the choice of yeast strain for Icewine production. Two of the seven yeast strains produced acetic acid at levels above the legal limit of 1.3 g/L under the conditions employed. However, it would be prudent to select strains that produce as little as possible acetic acid in Icewine, since fermentation conditions/practices and grape must composition vary between wineries and between vintages. ST, N96 and ECU 18 were identified as the three strains most suitable for Icewine production. ST produced the lowest levels of acetic acid, but was a slow fermentor and had high-perceived sulphur-like aroma. N96 and ECU 18 produced higher quality Icewines, had lower levels of perceived sulphur-like aroma, and showed faster fermentation rates. However, N96 and ECU 18 produced significantly higher amounts of acetic acid than ST but the levels were still below the legal limit of 1.3 g/L. Analyses on the effect of timed diammoniumphosphate (DAP), Fermaid K, and sulphur dioxide additions, and fermentation temperature, on acetic acid formation in Icewine, revealed that the choice of yeast strain was the most critical factor to limit acetic acid formation (Appendix D). Only DAP and sulphur dioxide additions (200 mg/L at 25% sugars fermented) significantly increased acetic acid formation. Yeast strains N96 and ECU 18 were least affected by a change in the fermentation conditions. Therefore, N96 and EC1118 seem the most suited for Icewine production of the seven yeast strains tested. 3.6 Literature Cited [1] Cliff, M.A., Yuksel, D., Girard, B., and King, M. (2002) Characterization of Canadian Ice Wines by Sensory and Compositional Analyses. Am. J. Enol. Vitic. 53, 46-53. [2] B.C. Wine Institute (2000) Standards and Regulations. BC Wine Institute., pp.29. 156 Drysdale, G. S, and Fleet, G. H. (1988) Acetic acid bacteria in winemaking: A review. Am. J. Enol. Vitic. 39, 143-154. Fleet, G. H , and Heard, G. M. (1993) in: Wine Microbiology and biotechnology, pp. 27-54 (Fleet, G.H, Ed.) Harwood Academic Publishers, Chur. Shimazu, Y , and Watanabe, M. (1981) Effects of yeast strains and environmental conditions on the formation of organic acids in must fermentation. J. Ferm. Tech. 59, 27-32. Erasmus, D.J, van der Merwe, G.K, and van Vuuren, H.J.J. (2003) Genome-wide expression analyses: Metabolic adaptation of Saccharomyces cerevisiae to high sugar stress. FEMS Yeast Res. 3, 375-399. Hohmann, S. (2002) Osmotic stress signaling and osmoadaptation in yeasts. Microbiol Mol Biol Rev. 66, 300-72. Michnick, S, Roustan, J.L, Remize, F , Barre, P, and Dequin, S. (1997) Modulation of glycerol and ethanol yields during alcoholic fermentation in Saccharomyces cerevisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3-phosphate dehydrogenase. Yeast 13, 783-793. Remize, F , Roustan, J.L, Sablayrolles, J.M, Barre, P, and Dequin, S. (1999) Glycerol overproduction by engineered saccharomyces cerevisiae wine yeast strains leads to substantial changes in By-product formation and to a stimulation of fermentation rate in stationary phase. Appl. Environ. Microbiol. 65, 143-149. Remize, F , Andrieu, E , and Dequin, S. (2000) Engineering of the pyruvate dehydrogenase bypass in Saccharomyces cerevisiae: role of the cytosolic Mg(2+) and mitochondrial K(+) acetaldehyde dehydrogenases Ald6p and Ald4p in acetate formation during alcoholic fermentation. Appl. Environ. Microbiol. 66, 3151-3159. [11] Valadi, H., Larsson, C , and Gustafsson, L. (1998) Improved ethanol production by glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 50, 434-439. [12] Eglinton, J.M., Heinrich, A.J., Pollnitz, A.P., Langridge, P., Henschke, P.A., and de Barros Lopes, M. (2002) Decreasing acetic acid accumulation by a glycerol overproducing strain of Saccharomyces cerevisiae by deleting the ALD6 aldehyde dehydrogenase gene. Yeast 19, 295-301. [13] Mattick, L.R., and Rice, A. C. (1970) Quantitative determination of lactic acid and glycerol in wines by gas chromatography. Am. J. Enol. Vitic. 21, 205-212. [14] Rankine, B.C., and Bridson, D.A. (1971) Glycerol in Australian wines and factors influencing its formation. Am. J. Enol. Vitic. 22, 6-12. [15] Delfini, C , and Cervetti, F. (1991) Metabolic and technological factors affecting acetic acid production by yeasts during alcoholic fermentation. Vitic. Enol. Sci. 46, 142-150. [16] Husnik, J. I. (2001) M.Sc. Thesis, Department of Food Science University of Guelph, Guelph. [17] Cliff, M.A. and Dever, M.A. (1996) Sensory and Compositional profiles of British Columbia Chardonnay and Pinot noir wines. Food Res. Int. 29, 317-323. [18] Agenbach, W.A. (1977) A study of must nitrogen content in relation to incomplete fermentations, yeast production and fermentation activity. Proc. S. Afr. Soc. Enol. Vitic, 66-87. [19] Bely, M., Rinaldi, A., and Dubourdieu, D. (2003) Influence of Assimilable Nitrogen on Volatile Acidity Production by Saccharomyces cerevisiae during High Sugar fermentation. J. BioSci. Bioeng. 96, 507-512. [20] Vos, P. J. A., Zeeman, W., and Heymann, H. (1979) The effect on wine quality of di-ammonium phosphate additions to musts. Proc. S. Afr. Soc. Enol. Vitic, 87-104. 158 Noble, A.C, and Bursick, G. F. (1984) The Contribution of Glycerol to Perceived Viscosity and Sweetness in White Wine. Am. J. Enol. Vitic. 35, 110-112. 159 Chapter 4 Differential expression of genes in enological strains of Saccharomyces cerevisiae affects osmo-sensitivity, acetic acid and glycerol formation during sugar induced osmotic stress 160 4.1 Introduction During the alcoholic fermentation of grape must, Saccharomyces cerevisiae is exposed to multiple stresses, including osmotic stress, ethanol toxicity, nutrient availability, and temperature stress [1]. Osmotic stress during wine fermentations is caused by the high sugar concentrations (16 to 26 % w/v) of grape must [2]. In some extreme cases such as Icewine fermentations, the sugar concentration in the must is at least 35 % (w/v) but can be as high as 50 % (w/v). For the production of Icewine, grape berries are left on the vine to freeze; the berries can only be harvested at temperatures equal to or below -8 °C. This freezing process concentrates sugars and other grape constituents resulting in must with a thick syrupy appearance. The high sugar concentration in Icewine must results in the production of relatively high levels of glycerol and acetic acid by yeast in Icewine (Chapter 3). Acetic acid levels in Icewines often exceed the legal limit in Canada (0.13 % w/v, Canadian Food and Drug Act section B.02.101) resulting in financial losses to wineries. The adaptation of S. cerevisiae to osmotic stress has been studied in great detail [for review see 3]. Yeast senses high osmolarity mainly through the HOG MAP kinase cascade resulting in a transcriptional response to allow for the production of glycerol as compatible solute. Glycerol formation prevents the efflux of water from the cell into the environment, thereby preventing dehydration of the yeast. The key enzyme in glycerol formation is a NADH-dependent glycerol-3-phosphate dehydrogenase, encoded by GPD1 that converts dihydroxyacetone phosphate to glycerol-3-phosphate with the concomitant oxidation of NADH to NAD+. High levels of glycerol formation during osmotic stress lead to a redox imbalance in the yeast cell (NADH:NAD+). To compensate for this redox shift, it has been suggested that yeast may utilize acetic acid as a redox sink to convert NAD+ back to NADH [4-7]. Wine yeasts produce acetic acid by the oxidation of acetaldehyde to acetate by NAD(P)+-dependent (acet)aldehyde dehydrogenases [8]. S. cerevisiae has five AID 161 isogenes; ALD2 ALD3, ALD4, ALD5, and ALD6 that encode acetaldehyde dehydrogenases that possibly catalyze the oxidation of acetaldehyde to acetate [9]. Ald2p and Ald3p are both cytosolic and use NAD + as cofactor. During NaCl induced osmotic stress, the NAD-dependent aldehyde dehydrogenase activity increases in wild type cells, but not in an ald2ald3 mutant [9]. Furthermore, both ALD2 and ALD3 are regulated by the two general stress transcription factors Msn2/4p [10]. Ald4p and Ald5p are located in mitochondria and require NAD(P)+ and NADP+, respectively. Ald6p is located in the cytoplasm and is NADP+ dependent [46]. For acetic acid to function as redox sink, ALD2 and ALD3 have to respond to the shift in redox balance caused by excess glycerol formation. Indeed, acetic acid formation has been linked to increased ALD2 and ALD3 mRNA and protein levels in response to the redox imbalance caused by glycerol formation [15]. Furthermore, acetaldehyde, the precursor of acetic acid, causes induction of ALD2 and ALD3 [16]. Since S. cerevisiae lacks transdehydrogenases [17,18], it is has been assumed that the cytosolic NAD+-dependent genes, ALD2 and ALD3, are mainly responsible for the formation of acetic acid during the fermentation of high sugar grape musts. However, it has recently been observed that ALD4 and ALD6 are the major contributors of acetate formation during wine fermentations [5, 8]. ALD2, ALD3, ALD4 and ALD6 are induced in response to osmotic stress [11-14]. It has also been suggested that Utrlp (NAD+-kinase) phosphorylates NAD+, which can then be used by Ald6p [19]. The current literature, therefore, is confusing and even contradictory as to which ALD genes are responsible for acetic acid formation. In Chapter 3, two wine yeast strains of S. cerevisiae, ST and VIN7, were identified that have opposite phenotypes in a sugar induced osmotic stress environment; ST grows faster than VIN7, but produces significantly less acetic acid and glycerol than VIN7 (Chapter 3, Appendix B, Fig. 6.2 C). ST and VTN7 seem to ferment 40% (w/v) sugars in a synthetic grape must at similar rates, but at lower sugar concentrations (20% w/v) VTN7 ferments at a faster rate than ST (Chapter 3). Depending on the wine style, acetic acid levels above 0.7 g/L 162 detract from the quality of wine [20]. Therefore, it is important to use wine yeast strains that produce relatively low amounts of acetic acid, especially in high sugar musts. The purpose of this study was to investigate the transcriptional response of S. cerevisiae strains VIN7 and ST that produce relatively high and low amounts of acetic acid during the fermentation of grape must, respectively. Data obtained in this study indicate that 337 genes were expressed at least two-fold differently between ST and VIN7. The transcriptome of VIN7 resembles an osmotic stress response more closely than that of ST; MSN2/4 and HOG1 -regulated genes are expressed at higher levels in VIN7 than in ST. Furthermore, VTN7 was found to be more resistant to rapamycin and the expression of ribosomal protein genes at lower levels in VIN7 suggests that TOR activity is lower in VIN7 than in ST. In addition, ACS transcripts levels, encoding acetyl-CoA synthetase, are lower in VIN7 than in ST. The ZMS1 gene, encoding the putative transcriptional activator of ALD6, is expressed at higher levels in "VTN7 than in ST. Furthermore, PCR analysis of the left arm of chromosome XV of ST and VIN7 indicate a deletion of genes in chromosome XV in both strains. Among the genes absent in VFN7 are two orphan genes, YOL160W and YOL159C, whose deletions are known to cause osmosensitivity in laboratory strains of S. cerevisiae. 4.2 Materials and Methods 4.2.1 Yeast strains and media Riesling grape juice (Okanagan Valley, BC, Canada) containing approx. 22 % (w/v) sugars (see Chapter 2 section 2.2.2) were used. Equimolar amounts of glucose and fructose were added to a portion of the grape juice (22 % w/v sugars) to obtain a grape juice with 60% (w/v) sugars. Synthetic grape must used in this study contained equimolar amounts of glucose and fructose at final concentrations of 20% or 60% (w/v sugars), 4.5 g/L L-malic acid, 0.3 g/L citric acid, 4.5 g/L tartaric acid, 2 g/L ammonium sulphate, 1.7 g/L Yeast Nitrogen Base (w/o 163 ammonium sulphate or amino acids), 1 mL/L Tween 80 and 5 mg/L oleic acid. The pH of the synthetic must was adjusted to 3.2 with 0.5 N KOH and fdter sterilized using a 0.22-micron filter. S. cerevisiae strains ST (J. Laffort & Cie, Bordeaux, France) and VIN7 (Anchor Yeast, Industria, South Africa) were used. To rehydrate active dry yeast (ADY), 10 mL 22% (w/v) grape juice was diluted with sterile deionized water (1:2). ADY was rehydrated at 40 °C for 30 min. Yeast deletion strains in the S288C genetic background were obtained from Invitrogen, Carlsbad, CA (Table 4.1); these yeast strains were grown in YEPD (yeast extract, peptone, dextrose) with either 2% or 40% (w/v) dextrose. Table 4.1. Yeast strains used in this study Yeast s t ra in Source Genotype Enological strains S. cerevisiae VIN7 S. cerevisiae ST Anchor Yeast, South Africa J .Laffort & Cie, Bordeaux, France unknown unknown Laboratory strains of S. cerevisiae BY4743 BY4741 BY4741Ac7/Jf5::G418 BY4741Azw//::G418 BY4741Azms7::G418 Invitrogen, Carlsbad, CA .) ? ) ? 9 ? 9 ) mata/a (BY4741/BY4742) mata his3 leu2 metl ura3 5 ) > ? 164 4.2.2 Growth conditions for micro-array analysis ADY of ST and VIN7 were used to inoculate 500 mL Riesling grape juice containing 22 % (w/v) sugars to a final concentration of 6 x 106 cells/mL. Yeast cultures were grown at 20 °C in 1 L Kimax bottles to mid-log phase (Aeoonm = 2.0). Once in mid-log phase, 500 ml grape juice containing 60% (w/v) sugars was added to both bottles to yield a final concentration of approximately 40% (w/v) sugars. Both flasks were further incubated stationary at 20 °C for 2 hours. Yeast cells were harvested by centrifugation for 5 minutes at 5000 rpm at 4 °C. Cells were then washed once at 4°C with DEPC treated ddH20 and stored at -80 °C until RNA extraction. Microarray analysis was done in triplicate, each time with independently grown cells. 4.2.3 RNA extraction and sample preparation Total RNA was extracted using the hot phenol method [21]. Methods for poly(A)+ RNA purification, amplification and labelling and cRNA fragmentation were the same as described in Chapter 2 section 2.2.3. 4.2.4 Hybridization, fluidics and scanning procedures Oligonucleotide yeast genome arrays (YGS98, Affymetrix, Santa Clara, CA) were used as targets for hybridization. Preparation of hybridization solution, hybridization, and washing, staining and scanning of yeast arrays were done as described by the manufacturer (Eukaryotic Arrays GeneChip Expression Analysis and Technical Manual, Affymetrix, Santa Clara, CA, USA). The EukGE-WS2v4 fluidics protocol of the Affymetrix MASv5.0 software (Affymetrix, Santa Clara, CA) was used to perform staining and washing procedures. Experiments were conducted in triplicate, with independently grown cells. 165 4.2.5 Data analyses Data were analyzed using MASv5.0 and DMT (Affymetrix, Santa Clara, CA). All tenable parameters were set to default values (Affymetrix Statistical Algorithm Reference Guide, Affymetrix, Santa Clara, CA). Genes with change p-values of < 0.003 (genes with an increased call) or >0.997 (genes with a decreased call), were considered reproducible and statistically significant. The average of the Signal Log (base 2) Ratio (SLR) values were used to calculate the fold change. Genes were linked to their gene ontology (GO) annotations using the "orf_geneontology.tab" table (http://www.yeastgenome.org/gene list.shtml; 12 December 2003). Microarray data obtained were compared to previously published data to determine the number of MSN2/4 [22] regulated genes, sugar induced osmotic stress genes [14], and genes regulated by HOG1 [13] that were expressed differently in VIN7 and ST. Genes whose expression levels decreased by more than 75% in a hogl deletion strain during osmotic stress [13] were considered as HOG1 dependent. 4.2.6 Semi-quantitative reverse transcriptase Real-Time PCR Yeasts were cultured as described in 4.2.2 except that synthetic grape juice, instead of Riesling grape must, was used. Yeast cells were rapidly harvested, washed and stored at -80 °C until RNA extraction. Total RNA was extracted using the hot phenol method followed by treatment with DNase I "on column" according to manufacturer's instructions using a Qiagen RNeasy RNA isolation kit (cat. #: 74104, Qiagen, Valencia, CA). 2pg total RNA was used to synthesize cDNA using Omniscript RT and a random hexamer primer mix (2.5 uM) according manufacturer's instructions (cat #: 205110, Qaigen, Valencia, CA). At the end of the reaction, 480 uL deionized water was added and then stored at -30 °C until analyzed. Semi quantitative real-time PCR was conducted using QuantiTect SYBR Green PCR kit (cat. #: 204243, Qaigen, Valencia, CA) and an ABI PRISM 7000 instrument. PCR reactions were conducted in triplicate using 2 uL cDNA as template for both of the genes of interest. IPP1 166 was used as a control gene since this gene is not affected by osmotic stress [23]. IPP1 was also expressed at the same levels in ST and VIN7. Samples were cycled 40 times between 95 °C for 15 seconds and 57 °C for 1 minute. To calculate the fold change, the CT value of IPP1 was subtracted from the gene of interest in the same cDNA sample (e.g. GeneXsT -IPPIST) to yield ACT value. The CT value was set manually by selecting the cycle number where a clear increase (logarithmic increase) in fluorescence was observed. The ACT value was then subtracted from the ACT value of the gene of interest from the other cDNA sample (e.g. GeneXviN7 - GeneXsi) to yield the AACT value. Primers used for Real-Time PCR are listed in Table 4.2. Table 4.2 Primers used for Real-Time PCR analysis of chromosome XV and sequencing of TOR2. Name Sequence Real-time RT PCR GLKlfrt 5'-AGACCAGACCTCTCTAAACTCC-3' GLKlrrt 5'-•ACCCTGAGCGCTTAATTGC-3' GPDlfrt 5'--CC AGAAGTTTTCGCTCC AATAGTA-3' GPDlrrt 5'-•AGCAACCAAATTGTCGGGTAG A-3' HSP30frt 5'-•GCCTGGATATGCAC ATTACC-3' HSP30rrt 5'--CGCAATGAAGAACATCACAAC-3' IPPlfrt 5'--AC AGC AAGGGTATTGATTTGACCA-3' IPPlrrt 5' -AAGCTGGTGGGATGGC ATCA-3' ACS 15 5' -CCCTCTGCCGTACAATCATC-3' ACS 13 5' -TAAC AGGCGTTTAATTGGCC-3' ALD65 5' -GCCATGACTAAGCTAC ACTTTGAC-3' ALD63 5' -TC AACATCTTC AGTGGTGGC-3' HSP265 5' -GC ATGTC ATTTAACAGTCC ATTTT-3' HSP263 5' -C AGATGGGAACAGGGAC AAG-3' YPL222wfrt 5' -GGACAATAATCAAAGCGCTG-3' YPL222wrrt 5' -AATGCAAAATGAGCCCCCTG-3' YPL071wfrt 5' -TTATCATCGGTGGTAGCCGT-3' YPL071wrrt 5' -CAGATACTGCAGAACATGCG-3' YAL061wfrt 5' -GAGAGCCTTAGCGTATTTCG-3' YAL061wrrt 5' -CCTGTGGCAATGGGTTATGA-3' YOR315wfrt 5' -GGGCTTGTAATACCCAGTAC-3' YOR315wrrt 5' -CC AGGACTGACAATATTCCG-3' YOL159cfrt 5' -TATGTTGATATCACCAGCGG-3' YOL159crrt 5'-ATCAAAGATTGCTGATCGCC-3' GPP2FRT 5' -GGGATTGACTACTAAACCTC-3' GPP2RRT 5' -TGGAGCGAACTTAGCAATGG-3' ZMS1FRT 5' -ATGGAACCGTTCGCATTTGG-3' ZMS1RRT 5' -GAG AGAGGC AATGTTTAACG-3' 167 PCR analysis of Chromosome XV YOL164WF YOL164WR Sth-YOL163W-5 Sth-YOL163W-3 160-W-5' 160-W-3' 159-A-5' 159-A-3' YOL159CF1000 YOL159CR1000 ENB1F ENB1R YOL157CF YOL157CR HXT11-5' HXT11-3' Sth-ZPSl-5 Sth-ZPSl-3 DCP1-5' DCP1-3' Sequencing of TOR2 TOR25FULL TOR2Rseq TOR2Fseq TOR2A TOR2B TOR2C TOR2D TOR2E TOR2FRBF TOR23FULL 5' -TC ACTGTCTC ACTAC ACAACCGGAT-3' 5' -TC AAGTTTCTCGCCGATTTCTG-3' 5'-GACCATCTACTTTCCATCAC-3' 5' -TTCGGTTATC AGC AGTGTC A-3' 5' -GCACGATTCTATATGACAGTTTTG-3' 5' - AAAGC ACGC ATCTATGTG ATGG-3' 5'-ACCAAACCAATACCATTTGTGG-3' 5' -A AC AGAGCTAGC ATACGCATGAATC-3' 5' -GCCCATGTC ATTTTTGTGC A-3' 5' -C ATTGAACAGCTC AGG AGAA-3' 5' -AAGTGCTCGTGAATGTCTCTCTG AA-3' 5 '-TTTGTATCGCTAGTACTCTCCAGC-3' 5' -C ATAAAGAAAAGAAAGC AACGTAC A-3' 5' -AATCTTGTCGTCAC AATC ATC A-3' 5 '-GTTCTAAACGCTTTTGTTATTACTC-3' 5'-CCAATTTACCGAAAACTAGAAGA-3' 5' -GCTG ATC ATTG AGTGCC AAA-3' 5' -TTCTCCCCC AATGAC AGTAA-3' 5' -TTTGC AAC AC ATC AC AAGAAAAGC-3' 5' -ATTCTC ACTTGGGC ATCTC ACCT-3' 5' -TAACAAATACACCACGCC ACC-3' 5' -CGGGGTTG AC AGA ACTC AAT-3' 5 '-ATGAGGATTCGTCTGTCAGA-3' 5' -TATTAGGCCCCATGTCG AGA-3' 5' -CCAGAGCCTTAGATATCGAT-3' 5'-TGGGATGAAATAGCCCAGTA-3' 5' -GTAACTAG AAGATCCCTTGC ATT-3' 5' -CGTCATCC AG ACCCTC ATCA-3' 5 '-CTCTCTCACGACAGAAAGCAGC-3' 5' -C AGAATGG AC ACC AACCGATA-3' 4.2.7 Resistance of ST, VIN7 and BY4741 to rapamycin ST, VIN7 and BY4741 were inoculated from freshly streaked YEPD-agar plates into 5 mL YEPD media. Cultures were grown overnight at 30 °C. Cells were then diluted to OD6oonm=: 0.1 from which ten-fold serial dilutions were made. Ten microliters was taken from each serial dilution and spotted onto YEPD plates with or without 100 ng/mL rapamycin, followed by incubation at 30 °C. Plates without rapamycin were photographed after one day, and plates containing rapamycin after 2 days. 168 4.2.8 Sequencing of TOR2 in VIN7 Sequencing of TOR2 in Vin7 was done using PCR fragments generated from genomic DNA isolated from VIN7. The following primers pairs was used to generate PCR fragments: set 1 -TOR25FULL and TOR2Rseq to generate a 2050 bp PCR fragment, set 2 -TOR2Fseq and TOR2B to generate a 1289 bp PCR fragment, set 3 -TOR2A and TOR2D to generate a 1561 bp PCR fragment, set 4 -TOR2C and TOR2E to generate a 1449 bp PCR fragment, set 5 -TOR2FRBF and TOR23FULL to generate a 1654 bp PCR fragment. The primers used to generate the PCR fragments were also used for sequencing. Sequencing was done on both strands in the Nucleic Acid Protein Service (NAPS) in the Michael Smith laboratories at the University of British Columbia. Primers used for sequencing are listed in Table 4.2. 4.2.9 PCR analysis of the telomeric region on the left arm on chromosome XV from ST and VIN7 Genomic DNA from BY4743 (S288C derivative), ST and VIN7 was used as template for PCR. Genomic DNA from BY4743 was used as control for the PCR reactions. Taq DNA polymerase (MBI Fermentas) was used to generate DNA fragments using primers listed in Table 4.2. Primers YOL164WF and YOL164WR were used to generate a 1997 bp PCR product for YOL164W, Sth-YOL163w-5 and Sth-YOL163W-3 to yield a 420 bp PCR fragment for YOL163W, 160-W-5' and 160-W-3' to yield a 400 bp PCR product for YOL160W, 159-A-5' and 159-A-3' to yield a 342 bp PCR product for YOL159C-A, YOL159C F1000 and YOL159CR1000 to produce a 2515 bp fragment for YOL159C, ENB1F and ENB1R to yield a 1871 bp PCR product for ENB1, YOL157CF and YOL157CR to yield a 1818 bp PCR product for YOL157C, HXT11-5' and HXT11-3' to yield a 1758 bp PCR product for HXT11, SthZPSl-5 and SthZPSl-3 to produce a 467 bp PCR product for ZPS1 and DCPI-5' and DCP1-3' to yield a 757 bp PCR product for DCP1 (Table 4.2). DNA fragments were fractionated and visualized on 0.7% agarose gels. 169 4.2.10 Effect of ald6, zmsl, and zwfl deletions on acetic acid, glycerol and ethanol formation The laboratory yeast strain BY4741 and its isogenic null mutants ald6, zmsl, and zwfl (Table 4.1), were grown overnight in 5 mL YEPD. Cells from these cultures were used to inoculate 10 mL YEPD containing 40% (w/v) glucose in test tubes to a final concentration of 1 x 106 cells/mL. Cultures were then grown aerobically at 30 °C for 3 days. Media were harvested by centrifugation at 5000 rpm for 5 minutes, followed by filter sterilization using 0.22 micron syringe filters. Filtered media were stored at 4 °C until samples were analyzed by HPLC. Cultures were grown twice, each time in duplicate. 4.2.11 Quantification of acetic acid, glycerol and ethanol Acetic acid, glycerol and ethanol was quantified by injecting 10 u.L of diluted media (12-fold) into an Agilent 1100 series HPLC with photo diode array and refractive index detectors. Procedures were previously described (Chapter 3, section 3.2.4). 4.3 Results 4.3.1 Overview Global expression analyses were conducted on two commercial S. cerevisiae wine yeast strains with different phenotypes; ST cells grow faster and produce less glycerol and acetic acid than VTN7 in synthetic must containing 40% (w/v) sugars (see Chapter 3). However, these two yeast strains ferment at similar rates in synthetic must containing 40% (w/v) sugars (Appendix B). Comparison of high density DNA microarray data revealed that 337 genes were expressed two-fold or more differently in ST and VIN7 when grown in Riesling grape must containing 40% (w/v) sugars; 169 genes were expressed at higher levels in VTN7 and 168 170 genes were expressed at lower levels than in ST. Microarray data were highly reproducible; regression analysis between ST replicates were (n= 3) 0.956 ± 0.021, between VTN7 replicates (n= 3) 0.977 ± 0.002, and VIN7 compared to ST (n= 3) 0.882 ± 0.010. A complete data set is available as supplementary data (Tables A.3, A.4, A.5, Compact disk, Appendix F). Robustness of the data was confirmed by semi-quantitative reverse transcriptase Real-Time PCR of ACS 1, ALD6, GPD1, GLK1, HSP26, HSP30, YOR315W and ZMS1 when VTN7 and ST were grown in synthetic grape must (Table 4.3). 4.3.2 VIN7 is more sensitive to sugar-induced osmotic stress than ST The differential expression of 337 genes between ST and VIN7 can be attributed to two main factors (1) the sugar-induced osmotic stress environment and (2) genetic polymorphisms between the two yeast strains. Global gene expression profiles of VIN7 fermenting Riesling grape must containing 40% (w/v) sugars, resemble a stress response more closely than the transcriptional profile of ST (Fig. 4.1). Sixty of the 169 genes that were expressed at higher levels in VTN7 are known to be up-regulated in response to sugar-induced osmotic stress (see Chapter 2, Fig. 4.1, and Table 4.4) [14]. In contrast, only 10 genes responsive to sugar induced osmotic stress (see Chapter 2) [14] were expressed at higher levels in ST than in VTN7 (Fig. 4.1, and Table 4.4). Of the 168 genes expressed at a lower level in VTN7 than in ST, 42 genes are known to be down-regulated by sugar induced osmotic stress (Fig. 4.1, and Table 4.5). 171 Table 4.3 Comparative expression of ACS1, ALD6, GPD1, GLK1, HSP26, HSP30, YOR315W and ZMS1 in VTN7 and ST grown in Riesling or synthetic grape musts containing 40% (w/v) sugars*. Gene name Riesling grape must8 Synthetic grape must" ACS1 -2.4 -2.1 ALD6 1.9 3.7 GPD1 1.4 2.2 GLK1 2.0 2.0 HSP26 3.1 6.0 HSP30 6.5 -1.6 YOR315W -22.2 -1.3 ZMS1 -1.8 7.8 * Values indicate the fold differences (VIN7 vs. ST) a High density DNA micro-array data b Semi-quantitative Real-Time RT-PCR data Gasch and co-workers identified 181 genes that are regulated by the two transcriptional activators Msn2/4p in response to environmental stress [22]. Thirty-three of the 169 genes that were expressed more than two-fold higher in VIN7 are regulated by Msn2/4p; only one Msn2/4p-regulated gene was expressed at a lower level in VIN7 than in ST (Fig 4.1 and Table 4.6). The HOG1 gene encodes the MAP kinase in the signal transduction pathway for osmotic stress [24]. Of the 49 genes known to be Hoglp-regulated during osmotic stress [13], seven (GREl, SPS100, TFS1, YAL061W, YGR043C, YKL151C, and YMR090W) 172 were expressed at higher levels in VIN7 than in ST; only one Hoglp-regulated gene (AR09) was expressed lower in VIN7 than in ST (Table 4.7). 4.3.3 Genes involved in diverse biological processes are expressed differentially in VIN7 and ST Genes involved in several major biological processes were expressed at lower levels in VIN7 than in ST; seventy-eight genes involved in translation and protein biosynthesis had lower transcript levels in VIN7, 12 of these genes MRPL31 (-2.0 fold), NAM9 (-2.0 fold), RPL13A (-2.1 fold), RPL17B (-2.0 fold), RPL18B (-2.7 fold), RPL40B (-2.0 fold), RPL7B (-2.0 fold), RPS10B (-3.5 fold), RPS16A (-2.0 fold), RPS26B (-2.8 fold), and SR09 (-2.5 fold) were expressed at least two-fold lower. The TORI and TOR2 (Target of Rapamycin) gene products play a central role in the transcriptional regulation of genes encoding ribosomal proteins [25, 26]. Twenty-two of the 78 genes involved in translation and protein biosynthesis that are expressed at lower levels in VTN7 than in ST, encode for ribosomal proteins. VIN7 was found to be more resistant to rapamycin than both ST and the laboratory strain BY4741 (Fig. 4.2). Sequencing of TOR2 in VIN7 revealed a single nucleotide polymorphism at position 3187; this C to T substitution caused an amino acid change from proline to serine. In addition TORI (-1.62 fold) and TOR2 (-2.1 fold) transcript levels were lower in VIN7 than in ST. In addition, 33 genes involved amino acid biosynthesis and 17 genes involved in nucleotide biosynthesis were also down-regulated in VIN7. However, six genes LYS5 (1.7 fold), HIS2 (1.6 fold), CPA1 (4.2 fold), ARG1 (2.9 fold), ARG3 (3.2 fold), and CAR! (2.0fold) involved in amino acid metabolism were expressed at higher levels in VIN7. Four of these six genes (CPA1, ARG1, ARG3, and CAR1) are involved in arginine metabolism. Furthermore, eight genes involved in thiamine metabolism were expressed at least two-fold lower in VIN7 (Appendix C, Table 8.1). Although metabolic pathway genes involved in 173 arginine or thiamine metabolism were expressed lower in VIN7, the addition of these two compounds to VIN7 or ST fermenting 40% (w/v) synthetic grape must had no influence on acetic acid, glycerol, or fermentation rate (Appendix C, Figs. 8.1 and 8.2), indicating that there was an adequate supply of these amino acids. Phosphatidylcholine (PC), a diacylglycerol (DAG), is an important intermediate for triacylglycerol synthesis (TAG) and this compound constitutes a major phospholipid in cellular membranes. AYR1, SLC1, CDS1, CHOI, PSD1, OPI3, CKI1, PCT1, and CPT1, that encode enzymes required for the biosynthesis of PC from glycerol-3-phosphate, dihydroxyacetone phosphate (DHAP) and choline, were expressed at lower levels in VTN7 than in ST (Fig. 4.3). 174 Fig. 4.1 Stress related genes that were expressed two-fold or more differently between VIN7 and ST. A. Genes up-regulated by sugar induced osmotic stress [Chapter 2 and 14]. B. Genes down-regulated by sugar induced osmotic stress (Chapter 2). C. Genes regulated by Msn2/4p [22]. D. Genes with higher transcript levels in VTN7 compared to ST. E. Genes with lower transcript levels in VIN7 compared to ST. 175 Table 4.4 Differential expression of genes up-regulated by sugar-induced osmotic stress in VIN7 and ST. Only genes whose expression levels differed by more than two-fold were listed. Fold difference5. Gene ORF Cellular process SLR" V I N 7 v*. 1. Genes expressed at higher levels in VIN7 than in ST TRX3 YCR083W response to oxidative stress 1.290 2.4 GRE1 YPL223C response to stress 2.053 4.2 HSP26 YBR072W response to stress 1.630 3.1 HSP30 YCR021C response to stress 2.693 6.5 GCY1 YOR120W salinity response 1.273 2.4 PDE1 YGL248W cAMP-mediated signaling 1.287 2.4 PCL5 YHR071W cell cycle 1.110 2.2 GSC2 YGR032W cell wall organization and biogenesis 1.120 2.2 PIR3 YKL163W cell wall organization and biogenesis 1.783 3.4 CYB2 YML054C electron transport 1.073 2.1 CYC7 YEL039C electron transport 1.390 2.6 PDC6 YGR087C ethanol metabolism 1.790 3.5 GPH1 YPR160W glycogen catabolism 1.353 2.6 HPA2 YPR193C histone acetylation 1.457 2.7 FRE4 YNR060W iron-siderochrome transport 1.250 2.4 SPOl YNL012W meiosis 1.677 3.2 YNL274C YNL274C metabolism 0.993 2.0 KTR2 YKR061W N-linked glycosylation 1.313 2.5 YDR247W YDR247W protein amino acid phosphorylation 1.783 3.4 PEX18 YHR160C protein-peroxisome targeting 1.477 2.8 YGL121C YGL121C signal transduction 1.497 2.8 BAG7 YOR134W small GTPase mediated signal transduction 2.020 4.1 SMA1 YPL027W spore wall assembly (sensu Saccharomyces) 1.057 2.1 SPS100 YHR139C spore wall assembly (sensu Saccharomyces) 1.073 2.1 THI 11 YJR156C thiamin biosynthesis 3.607 12.2 DAL1 YIR027C allantoin catabolism 1.457 2.7 COX5B YIL111W anaerobic respiration 1.210 2.3 YJR096W YJR096W arabinose metabolism 1.157 2.2 ARG3 YJL088W arginine biosynthesis 1.667 3.2 DAN3 YBR301W biological process unknown 1.693 3.2 FUN 19 YAL034C biological process unknown 1.043 2.1 PAU1 YJL223C biological process unknown 1.383 2.6 PAU5 YFL020C biological process unknown 1.887 3.7 PAU7 YAR020C biological process unknown 1.857 3.6 PHM8 YER037W biological process unknown 1.553 2.9 UGX2 YDL169C biological process unknown 1.220 2.3 YAL061W YAL061W biological process unknown 2.653 6.3 176 YAL068C YAL068C biological process unknown 1.430 2.7 YBL049W YBL049W biological process unknown 1.747 3.4 YCL042W YCL042W biological process unknown 1.337 2.5 YDL124W YDL124W biological process unknown 1.233 2.4 YDR542W YDR542W biological process unknown 1.413 2.7 YFR017C YFR017C biological process unknown 1.237 2.4 YGL261C YGL261C biological process unknown 1.423 2.7 YGR043C YGR043C biological process unknown 1.597 3.0 YJL161W YJL161W biological process unknown 1.960 3.9 YKL071W YKL071W biological process unknown 3.480 11.2 YKL151C YKL151C biological process unknown 1.093 2.1 YMR090W YMR090W biological process unknown 1.040 2.1 YMR103C YMR103C biological process unknown 1.760 3.4 YMR181C YMR181C biological process unknown 1.363 2.6 YMR196W YMR196W biological process unknown 1.287 2.4 YMR322C YMR322C biological process unknown 1.720 3.3 YNL134C YNL134C biological process unknown 1.357 2.6 YOL047C YOL047C biological process unknown 2.027 4.1 YOR173W YOR173W biological process unknown 1.613 3.1 YOR338W YOR338W biological process unknown 2.297 4.9 YPL222W YPL222W biological process unknown 2.810 7.0 YPR093C YPR093C biological process unknown 1.103 2.1 YPR127W YPR127W biological process unknown 1.320 2.5 2. Genes expressed at lower levels in VIN7 than in ST YCR105W YCR105W alcohol metabolism -1.230 -2.3 BAP2 YBR068C amino acid transport -1.690 -3.2 AR09 YHR137W aromatic amino acid family metabolism -1.650 -3.1 ARO10 YDR380W leucine catabolism -1.247 -2.4 ADY2 YCR010C meiosis -2.113 -4.3 CH02 YGR157W phosphatidylcholine biosynthesis -1.153 -2.2 GPX2 YBR244W response to oxidative stress -1.630 -3.1 FUI1 YBL042C uridine transport -1.143 -2.2 YDL218W YDL218W biological process unknown -2.043 -4.1 YLR327C YLR327C biological process unknown -1.203 -2.3 a SLR- Signal Log (base 2) Ratio, average of three sets of data b Fold difference calculated from average SLR 177 Table 4.5 Differential expression of genes down-regulated by sugar-induced osmotic stress in VIN7 and S T . Only genes whose expression levels differed by more than two-fold were listed. Fold differenceb. Gene ORF Cellular process S L R a VIN7 vs. ST 1. Genes expressed at higher levels in VTN7 than in S T HXT3 YDR345C hexose transport 1.460 2.8 HXT4 YHR092C hexose transport 1.697 3.2 YNR065C YNR065C biological process unknown 1.360 2.6 2. Genes expressed at lower levels in VIN7 than in S T YGR280C YGR280C 35S primary transcript processing -1.697 -3.2 TYS1 YGR185C amino acid activation -1.033 -2.0 PCL9 YDL179W cell cycle -1.110 -2.2 YOL155C YOL155C cell wall organization and biogenesis -1.697 -3.2 PLB2 YMR006C glycerophospholipid metabolism -2.277 -4.8 YOR108W YOR108W leucine biosynthesis -1.703 -3.3 LYS12 YIL094C lysine biosynthesis -1.200 -2.3 lysine biosynthesis, aminoadipic LYS2 YBR115C pathway -1.183 -2.3 lysine biosynthesis, aminoadipic LYS9 YNR050C pathway -1.007 -2.0 ODC2 YOR222W mitochondrial transport -1.087 -2.1 CYC8 YBR112C negative regulation of transcription -1.010 -2.0 RKJ1 YOR095C pentose-phosphate shunt -2.363 -5.1 CPT1 YNL130C phosphatidylcholine biosynthesis -1.047 -2.1 URA7 YBL039C phospholipid biosynthesis -2.060 -4.2 SR09 YCL037C protein biosynthesis -1.313 -2.5 YNL246W YNL246W protein-vacuolar targeting -1.073 -2.1 FUR1 YHR128W pyrimidine salvage -1.843 -3.6 MAE1 YKL029C pyruvate metabolism -1.483 -2.8 RRP13 YGR103W ribosomal large subunit biogenesis -1.427 -2.7 RRP5 YMR229C rRNA processing -1.190 -2.3 FEN1 YCR034W sphingolipid biosynthesis -1.073 -2.1 ATF2 YGR177C steroid metabolism -1.120 -2.2 PH03 YBR092C thiamin transport -2.850 -7.2 178 RPA135 YPROIOC transcription from Pol I promoter -1.127 -2.2 RPA190 YOR341W transcription from Pol I promoter -1.147 -2.2 RPC11 YDR045C transcription from Pol III promoter -1.110 -2.2 TEF4 YKL081W translational elongation -1.373 -2.6 TIF4631 YGR162W translational initiation -1.400 -2.6 YHM2 YMR241W tricarboxylic acid transport -1.170 -2.3 DBP2 YNL112W biological process unknown -1.683 -3.2 FL09 YAL063C biological process unknown -1.587 -3.0 HAS1 YMR290C biological process unknown -1.327 -2.5 IMD4 YML056C biological process unknown -1.467 -2.8 NOP 13 YNL175C biological process unknown -1.120 -2.2 RLI1 YDR091C biological process unknown -1.107 -2.2 YDR119W YDR119W biological process unknown -1.267 -2.4 YDR133C YDR133C biological process unknown -1.770 -3.4 YGL101W YGL101W biological process unknown -1.227 -2.3 YHR149C YHR149C biological process unknown -2.607 -6.1 YJL200C YJL200C biological process unknown -1.653 -3.1 YJR070C YJR070C biological process unknown -1.367 -2.6 YOR315W YOR315W biological process unknown -4.473 -22.2 YPL183C YPL183C biological process unknown -0.993 -2.0 a SLR- Signal Log (base 2) Ratio, average of three sets of data b Fold difference calculated from average SLR 179 Table 4.6 Genes regulated by Msn2/4p that are expressed at least two-fold differentially between VIN7 and ST. _ _ _ Fold difference11. Gene ORF Cellular process SLR" VIN7 vs. ST 1. Genes expressed at higher levels in VIN7 than in ST GPX1 YKL026C response to oxidative stress 1.423 2.7 TRX3 YCR083W response to oxidative stress 1.290 2.4 GRE1 YPL223C response to stress 2.053 4.2 HSP26 YBR072W response to stress 1.630 3.1 GCY1 YOR120W salinity response 1.273 2.4 PIR3 YKL163W cell wall organization and biogenesis 1.783 3.4 PRM8 YGL053W conjugation with cellular fusion 3.543 11.7 CYC7 YEL039C electron transport 1.390 2.6 GPH1 YPR160W glycogen catabolism 1.353 2.6 YNL274C YNL274C metabolism 0.993 2.0 DIA3 YDL024C pseudohyphal growth 1.800 3.5 TFS1 YLR178C regulation of proteolysis and peptidolysis 1.503 2.8 YGL121C YGL121C signal transduction 1.497 2.8 BAG7 YOR134W small GTPase mediated signal transduction 2.020 4.1 SPS100 YHR139C spore wall assembly (sensu Saccharomyces) 1.073 2.1 YJR096W YJR096W arabinose metabolism 1.157 2.2 YCL042W YCL042W biological process unknown 1.337 2.5 YDL124W YDL124W biological process unknown 1.233 2.4 YGR043C YGR043C biological process unknown 1.597 3.0 YJL017W YJL017W biological process unknown 1.563 3.0 YJL161W YJL161W biological process unknown 1.960 3.9 YKL151C YKL151C biological process unknown 1.093 2.1 YMR090W YMR090W biological process unknown 1.040 2.1 YMR181C YMR181C biological process unknown 1.363 2.6 YMR196W YMR196W biological process unknown 1.287 2.4 YNL134C YNL134C biological process unknown 1.357 2.6 YOR173W YOR173W biological process unknown 1.613 3.1 YOR338W YOR338W biological process unknown 2.297 4.9 YPR127W YPR127W biological process unknown 1.320 2.5 YPS5 YGL259W biological process unknown 2.223 4.7 YPS6 YIR039C biological process unknown 1.890 3.7 2. Gene that was expressed at lower levels in VIN7 than in ST YLR327C YLR327C biological process unknown -1.203 -2.3 a SLR- Signal Log (base 2) Ratio, average of three sets of data b Fold difference calculated from average SLR 180 Table 4.7 Differential expression of HOG1 regulated genes. Only genes whose expression differed by at least two-fold in VIN7 and ST were listed. Fold differenceb. Gene ORF Cellular process SLR" VIN7 vs. ST 1. Genes expressed at higher levels in VIN7 than in ST GRE1 YPL223C response to stress 2.053 4.2 SPS100 YHR139C spore wall assembly (sensu Saccharomyces) 1.073 2.1 TFS1 YLR178C regulation of proteolysis and peptidolysis 1.503 2.8 YAL061W YAL061W biological process unknown 2.653 6.3 YGR043C YGR043C biological process unknown 1.597 3.0 YKL151C YKL151C biological process unknown 1.093 2.1 YMR090W YMR090W biological process unknown 1.040 2.1 2. Gene expressed at lower levels in VIN7 than in ST AR09 YHR137W aromatic amino acid family metabolism -1.650 -3.1 SLR- Signal Log (base 2) Ratio, average of three sets of data b Fold difference calculated from average SLR 181 A B i 1 Fig. 4.2 VIN7 is more rapamycin resistant than ST and BY4741. (A) Growth on YEPD without rapamycin after 1 day. (B) Growth after two days on YEPD containing 100 ng/mL rapamycin. Cells were diluted to OD6oonm= 0.1 from which ten-fold serial dilutions were made. Ten microliters was taken from each serial dilution and spotted onto YEPD plates. 182 Glycerol -3-phosphate Dihydroxyace tone phosphate AYR1 (-1.6) 1 -acyl-Glycerol-3-phosphate SLC1 (-1.6) Phosphat id ic ac id CDS1 (-1.7) CH01 (-2.2) PSD1 (-1.5) CH02 (-2.2) OPI3 (-1.4) OPI3 (-1.4) Phospha t idy lcho l ine Cho l ine CKI1 (-4.2) PCT1 (-1.5) C D P - c h o l i n e CPT1 (-2.1) Fig. 4.3 Microarray data indicate that genes involved in biosynthesis of phosphatidylcholine are expressed at lower levels in VIN7 than in ST during the fermentation of Riesling grape must containing 40% (w/v) sugars. Fold difference are given in brackets (VTN7 vs. ST). 183 4.3.4 PCR Analysis of the telomeric region of chromosome XV of ST and VIN7 An arbitrary cut-off of five-fold difference in expression levels (VIN7 vs. ST) was used to identify orphan genes that may contribute to the VIN7 phenotype. Four orphan genes, YAL061W, YKL071W, YOL159C and, YPL222W that responded to osmotic stress were found (Table 4.8). Three of the four genes were expressed in both ST and VIN7. However, no transcripts were found for YOL159C in VIN7. The transcriptional response of these orphan genes obtained with micro-array technology in Riesling grape must were confirmed in synthetic grape must using semi-quantitative reverse transcriptase Real-Time PCR (Table 4.8). The expression of YAL061W, YKL071W and YPL222W was confirmed, but no transcript was detected for YOL159C implying that YOL159C was not expressed, or was absent in the genome of VFN7. PCR analyses on the genomes of VIN7, ST and BY4743 using primers specific for YOL164W, YOL163W, YOL160W, YOL159C-A, YOL159C, ENB1, YOL157C, HXT11, ZPS1 and DCP1 suggest that the left arms on chromosome XV of ST and VIN7 were depleted (Fig. 4.4); YOL164W, YOL163W and HXT11 were absent in both ST and VIN7. In addition, YOL164W, YOL163W, YOL160W, YOL159C-A, YOL159C, ENB1, and YOL157C were absent in VIN7 (Fig. 4.4). 4.3.5 Transcription of structural genes involved in glycerol and acetic acid VIN7 and ST VIN7 produce significantly more glycerol (13.8 g/L vs. 9.62 g/L) and acetic acid (1.72 g/L vs. 0.932 g/L) than ST in Riesling Icewine must containing approx. 40 % sugars (40 °Brix) (see Chapter 3). Consistent with these observations, GPD1 as well as ALD3, ALD4 and ALD6 were expressed at higher levels in VIN7 compared to ST (Table 4.3 and Fig. 4.5). However, transcript levels of GPP2 and ALD2 were similar in these two yeast strains, but ALD5 was expressed at a lower level in VIN7 than in ST. ACS1, which encodes for acetyl-CoA synthethase, was expressed at a lower level in VIN7. ZMS1 is a putative transcriptional 184 activator of ALD6. This gene was expressed at a lower level in VIN7 according to the micro-array data, however, semi-quantitative reverse transcriptase Real-Time PCR data indicated that ZMS1 was expressed at a higher level in VIN7 than in ST (Table 4.3). An increase in ZMS1 expression could result in increased levels ofALD6 mRNA [27]; higher mRNA levels of ZMS1 (as determined by Real-Time RT- PCR) are consistent with the higher ALD6 mRNA detected and the increased amount of acetic acid produced by VIN7 (Table 4.3 and Fig. 4.5). 4.3.6 Deletion oiZWFl and ZMS1 affects acetic acid and glycerol formation by S. cerevisiae Deletion of ZMS1 and ALD6 in a laboratory strain of S. cerevisiae resulted in reduced levels of acetic acid and ethanol, but a slightly higher level of glycerol in comparison to the wild type strain in YEPD containing 40% (w/v) glucose (Fig. 4.6). Deletion of ALD2, ALD3, ALD4, or ALD5 individually, had no effect on acetic acid, glycerol, or ethanol formation (Appendix C, Fig. 8.3). The zwfl null mutant produced more acetic acid and ethanol than the wild type without affecting glycerol formation. 185 Table 4.8 Comparison of four orphan gene transcripts in VIN7 and ST. Gene Riesling grape must8 Synthetic grape mustb Phenotype or transcriptional response YAL061W 6.3 3.4 Induced by salt [12] and sugar-induced osmotic stress [14] YKL071W 11.2 4.5 Induced by sugar-induced osmotic stress [14] YOL159C Absent in Absent in Null mutant is osmo-sensitive [29] VIN7 VIN7 YPL222W 7.0 16.4 Null mutant is osmo-sensitive [29] and transcription is induced by sugar- induced osmotic stress [14] - Values represent the fold difference Vin7 vs. ST a Fold difference derived from high density DNA micro-array data b Fold difference derived from semi-quantitative reverse transcriptase Real-Time PCR data 186 V O L 1 S S C V O I 1 S 3 C C R E 2 D C P 1 -C V O L 1 5 D C IV V VI VII VIII IX X B BY4743 S T VIN7 Fig. 4.4 (A) The telomeric region on the left arm of chromosome XV in S. cerevisiae. Genes absent in both ST and VIN7 are shaded in green, Genes absent in VEN7 but present in ST are shown in red. Genes present in both ST and VEN7 are presented in yellow. PCR analyses were not done on genes shown in grey due to a high AT content in the ORFs (>60 %). (B) PCR amplification of (i) YOL164W, (ii) YOL163W, (iii) YOL160W, (iv) YOL159C-A, (v) YOL159C, (vi) ENB1, (vii) YOL157C, (viii) HXT11, (ix) ZPS1, and (x) DCP1 located on chromosome XV of S. cerevisiae strains BY4743, ST and VIN7. 187 ALD2 ALD3 ALD4 ALD5 ALD6 Fig. 4.5 Expression levels ofALD genes in VIN7 and ST during fermentation of 40% (w/v) sugar Riesling grape must. Expression levels were determined by DNA micro-arrays. The results are the mean values ± standard deviation (n=3). 188 wt ald6 zmsl zwfl wt ald6 zmsl zwfl 70 Fig. 4.6 Formation of (A) acetic acid, (B) glycerol and (C) ethanol and (D) growth of the laboratory wild type strain BY4741 and its isogenic deletion mutant strains ald6, zwfl and zmsl in YEPD containing 40% (w/v) glucose. The results are the mean values ± standard deviation (n=4). 189 4.4 Discussion The transcriptional response of S. cerevisiae to osmotic stress, including the formation of glycerol as compatible solute, is mainly regulated through the HOG MAP kinase cascade pathway. The MAP kinase, Hoglp, has been shown to function under enological conditions where high sugar concentrations present an osmotic stress environment for S. cerevisiae [28]. High levels of glycerol formation during osmotic stress lead to a redox imbalance in the yeast cell (NADH:NAD+) [4]. Furthermore, several studies have linked acetic acid formation to glycerol formation [6, 7]. It has been suggested that yeast may utilize the oxidation of acetaldehyde to acetic acid as a redox sink to convert NAD + back to NADH [4-7]. Furthermore, there is a direct correlation between the sugar concentration in grape juice and the amounts of glycerol and acetic acid produced (see Chapter 3). 4.4.1 Transcriptional adaptation of VIN7 and ST to sugar induced osmotic stress To adapt to osmotic stress and changing conditions during wine fermentations, S. cerevisiae has to rapidly reprogram its transcriptional response in order to adjust its metabolism accordingly. Genes involved in glycerol formation (GPD1 and GPP2) as well as the genes involved in acetic acid formation (ALD2, ALD3, ALD4, and ALD6) are up-regulated by osmotic stress when sugar, salt or sorbitol is present as an osmolyte (see Chapter 2) [13, 14]. VTN7 produced the highest levels of glycerol (13.8 g/L) and acetic acid (1.72 g/L), whereas ST produced the lowest amounts of glycerol (9.62 g/L) and acetic acid (0.932 g/L) in Icewine (see Chapter 3). The differential expression of genes between VIN7 and ST can be attributed mainly to genetic polymorphisms in the two yeast strains that result in differential expression of genes. Five hundred and eighty nine genes were identified to respond either positively or negatively to sugar-induced osmotic stress (see Chapter 2) [14]. VIN7 was more sensitive to sugar-induced osmotic stress (transcriptional response to 40% vs. 190 22% (w/v) sugars) than ST (Fig. 4.1); transcript levels of most Hoglp and Msn2/4p regulated genes were higher in VIN7 than in ST (Fig. 4.1). In addition to the HOG MAP kinase cascade pathway that regulates Msn2/4p dependent gene expression in response to osmotic stress [13, 30], the cAMP-PKA pathway and Torl/2p (TOR-target of rapamycin) also regulate Msn2/4p dependent transcription [31-34]. Unlike the HOG pathway, which is active when cells are stressed, the cAMP-PKA and TOR pathways are active in unstressed cells, and promote retention of Msn2/4p in the cytoplasm [33] thereby preventing Msn2/4p dependent activation of gene transcription. TOR regulates several essential growth related biological processes in yeast including organization of the actin cytoskeleton, membrane trafficking, protein degradation, PKC signalling, regulation of nitrogen metabolism, initiation of translation and transcriptional regulation of ribosomal protein genes [26, 35-38]. When TOR activity increases, the expression of ribosomal protein genes increases; a lack of TOR activity results in a decrease in the expression of ribosomal protein genes [26]. The TORI and TOR2 genes were originally identified in mutants that were resistant to the immunosuppressant rapamycin [25]. Rapamycin binds Fkbpl2p, which in turn regulates TOR function by binding to the FRB-domain in either Torlp or Tor2p [25, 26, 38-41]. Rapamycin inhibits TOR activity causing, among other changes, the repression of the transcription of ribosomal protein genes [26]. Several domains have been identified in the N-terminal region of Torlp and Tor2p; two HEAT repeat motifs, that mediate protein-protein interactions and cellular localization of TOR, and a FAT domain for which no function has been assigned, have been identified. On the C-terminal side of the FAT domain the FRB-domain, putative kinase domain and a FATC domain located at the C-terminus were identified [for a review see 35]. Resistance of S. cerevisiae to rapamycin is caused by an amino acid substitution of serine at position 1972 or 1975 in the FRB domains of Torlp or Tor2p, respectively [39, 40]. The resistance of VTN7 to rapamycin suggests that TOR activity might be lower in VIN7 than in ST (Fig. 4.3). A lower TOR activity is supported by 191 the large number of ribosomal protein genes that are expressed at lower levels in VIN7 than in ST. Sequencing of the FRB domains of the TORI and TOR2 genes of VTN7 revealed no mutations. However, a SNP was found in Tor2p at position 1063 resulting in an amino acid substitution on the N-terminal side of the FRB-domain; the proline at position 1063 was substituted by a serine in VIN7. Proline is a hydrophobic amino acid, often found in beta turns, whereas serine is polar and often the target site of phosphorylation. This mutation occurred in the second HEAT repeat motif of Tor2p spanning residues 560 to residues 1220. Protein modelling did not reveal any secondary structural changes in Tor2p due to the amino acid substitution but the impact of the amino acid change in Tor2p on TOR activity in Vin7 needs to be further investigated. It is important to note that TOR2, unlike TORI, is an essential gene [40, 41]. The lower activity of TOR in VIN7 might also be ascribed to the fact that both TORI and TOR2 were expressed at lower levels in VIN7 (see section 4.3.4). Lower TOR activity in VIN7 might be responsible for the greater number of Msn2/4p regulated genes being expressed at higher levels in V1N7 than in ST. Chromosome length polymorphisms are common in wine yeast strains; this phenomenon is routinely used in the karyotyping of strains. PCR analyses on the left arm of chromosome XV confirmed microarray data and indicated that YOL159C is absent in the genome of VIN7. This prompted us to investigate if any other genes flanking YOL159C were absent. PCR data revealed that approximately 30 kb was absent in VIN7, including the following genes: YOL164W, YOL163W, YOL160W, YOL159C-A, YOL157c, ENB1 and HXT11 (Fig. 4.4). The absence of the orphan genes YOL160W and YOL159C causes slower growth in laboratory strains when exposed to osmotic stress [29]. It is, therefore, likely that deletion of YOL160W and YOL159C in the genome of VIN7 could contribute to this strain being more sensitive to osmotic stress; the slower growth rate of VIN7 in media containing 40 % (w/v) sugars is consistent with these data (Appendix B, Fig. 7.2 B). The function of YOL160W and YOL159C in S. cerevisiae has not yet been elucidated, but it is documented 192 that deletion of YOL159C in laboratory strains increases Tyl retro transpositions [42]. The increase in retro transpositions may increase genetic drift and effect the genetic stability of a strain. VIN7 has previously been reported to be genetically unstable (Dr. Hennie J.J. van Vuuren, Wine Research Centre, UBC, personal communication). The orphan genes YOL164W, YOL163W, YOL159C-A, and YOL157C, as well as ENB1 that encodes for an endosomal ferric enterobactin transporter and HXT11 that encodes for a hexose transporter, have not been linked to osmosensitivity in laboratory strains. HXT11, YOL164W and YOL163W were absent in ST (Fig. 4.4). None of these three genes have been implicated to play a role during osmotic stress. The function of YOL164W and YOL163W has not been elucidated. It is possible that a hxtll, yoll64w, yol!63w triple mutant might be more sensitive to osmotic stress. However the absence of these three genes did not affect the ability of ST to ferment Icewine must. Transcription of GPD1, ALD3, ALD4, and ALD6 has been reported to be up-regulated by sugar, salt or sorbitol induced osmotic stress (see Chapter 2)[13, 14]. The elevated expression of GPD1, ALD3, ALD4, and ALD6 in VIN7 is therefore consistent with the greater osmosensitivity of VIN7 and its tendency to produce increased amounts of glycerol and acetic acid (see Chapter 3). The formation of glycerol from the glycolytic pathway intermediate DHAP, however, is catalyzed by two enzymes encoded by GPD1 and GPP2 [43, 44]. Both GPD1 and GPP2 have been shown to respond to sugar induced osmotic stress (see Chapter 2). However, only GPD1 was expressed at higher levels in VIN7 than in ST (Table 4.3); GPP2 was expressed at a similar level in VTN7 and ST (Table A.5, Compact disk, Appendix F). GPD1 encodes for the key enzyme in this two-step process, not just under laboratory conditions, but also in enological conditions [28, 43, 45]. The metabolism of hexoses by & cerevisiae via the Embden-Meyerhof pathway leads to the production of dihydroxyacetone phosphate and glyceraldehyde-3-phosphate as intermediary products. Glycerol is synthesized by reduction of dihydroxyacetone phosphate 193 to glycerol-3-phosphate. This reaction is catalized by an NADH-dependant cytosolic glycerol-3-phosphate dehydrogenase. An increase in cytoplasmic glycerol formation under conditions of osmotic stress requires an equimolar amount of cytoplasmic NADH; this requirement seems to be partially met by increased oxidation of acetaldehyde to acetate. The most widely accepted hypothesis of acetic acid formation by yeast during osmotic stress is that the formation of acetic acid from acetaldehyde functions as a redox sink to reduce NAD+ back to NADH [4]. S. cerevisiae has five ALD isogenes; ALD2, ALD3, ALD4, ALD5, and ALD6 that encode acetaldehyde dehydrogenases that can possibly catalyze the oxidation of acetaldehyde to acetate [9]. Ald2p and Ald3p are both cytosolic and use NAD + as cofactor. Ald4p and Ald5p are mitochondrial and utilise NAD(P)+ and NADP+, respectively. Ald6p is cytosolic and uses NADP+ as co-factor. Ald6p has been reported to be responsible for a major portion of acetic acid produced during wine fermentations [5, 8, 46]. ALD3, ALD4 and ALD6 were expressed at higher levels in VIN7 than in ST, with ALD6 being expressed at the highest level in both strains (Fig. 4.5). If transcript levels correlate with the enzyme levels of the particular ALD genes, then ALD6 seems to be a major contributor to acetic acid production in Icewines. However, Ald6p utilises NADP+ and not NAD + [46]. If the purpose of acetic acid formation under conditions of osmotic stress is to reset the redox balance and reduce NAD+ produced during glycerol formation back to NADH, then the NAD + dependent Ald2p and/or Ald3p should be the major enzymes involved in the production of acetic acid. Based on transcript levels, our data indicate that ALD2 and ALD3 in VTN7 might not be responsible for the high levels of acetic acid produced by VIN7. It raises an intriguing question how NAD + produced during glycerol formation is reduced back to NADH. 4.4.2 Deletion of the ZMS1, ALD6 and ZWF1 affect acetic acid and glycerol formation ZMS1 encodes for a putative zinc-finger transcription factor that increases the expression of ALD6 [27]. Although ZMS1 does not respond to sugar-induced osmotic stress 194 in Vinl3 (Table A.2, Compact disk, Appendix F), its deletion has been reported to cause osmo-sensitivity in S. cerevisiae [29] Furthermore, zmsl deletion mutants produce approx. 50% less acetic acid than the corresponding wt strain (Fig. 4.6). ZMS1, therefore, seems to be indirectly involved in the formation of acetic acid. Contradictory data for ZMS1 transcript levels were obtained by micro-array and Real-Time PCR techniques in this study: -1.8 fold and 7.8 fold, respectively. Higher levels of ZMS1 mRNA in VTN7 would be consistent with higher ALD6 mRNA levels and higher acetic acid levels observed under conditions of osmotic stress in this study. During osmotic stress, the NAD-dependent aldehyde dehydrogenase activity increases in wild type cells, but not in an ald2ald3 mutant when grown in 2 % (w/v) glucose [9]. The redox link between glycerol and acetic acid formation is supported by the fact that when S. cerevisiae is grown in a galactose containing medium and then exposed to 15 mM LiCl, glycerol and acetic acid formation increase in conjunction with GPD1, ALD2 and ALD3 mRNA and protein levels, whereas ALD6 mRNA and protein levels decrease [15]. However, the roles of ALD2 and ALD3 when S. cerevisiae is exposed to osmotic stress under enological conditions were not investigated [15]. In contrast to these data, our data obtained with deletion mutants of individual ALD genes in the S288C genetic background, revealed that ALD6, the NADP+-dependent isoform, was responsible for the major portion of acetic acid when yeast cells are exposed to sugar (40 % w/v)-induced osmotic stress (Fig 4.6) (Appendix C, Fig. 8.3). Furthermore, the fact that the deletion of the cytosolic NAD+-dependent genes, ALD2 and ALD3, does not affect acetic acid formation during sugar-induced osmotic stress suggests that biological processes other than increased glycerol formation influence acetic acid formation as well. ALD6 utilizes NADP+ and glycerol formation yields NAD+; with no transdehydrogenase identified in yeast [18, 46, 47], it raises the question of how increased glycerol formation results in an increase in acetic acid formation if Ald6p requires NADP+. 195 One explanation by Butcher and Schreiber suggests that NAD+ is phophorylated by Utrlp, a NAD+-kinase [19]. Deletion of ALD6 and ZWFl is synthetically lethal in S. cerevisiae [27]. ZWFl encodes for glucose-6-phosphate dehydrogenase, which catalyzes the first irreversible step in the oxidative part of the pentose phosphate pathway (PPP). The oxidative part of the PPP is the major source of NADPH in the yeast cell [58]. NADPH is primarily used in biosynthetic pathways such as nucleotide, amino acid and phospholipid biosynthesis. Deletion of ZWFl will result in no formation of NADPH by the PPP. Both Ald6p and Zwflp are involved in NADPH formation [27]. Under conditions of osmotic stress, S. cerevisiae produce more acetic acid when ZWFl is deleted (3.3 g/L vs. 2.5 g/L, Fig. 4.6). Transcription of several genes encoding enzymes in the oxidative and non-oxidative part of the PPP was affected when S. cerevisiae was exposed to osmotic stress (see Chapter 2). If these changes in mRNA transcript levels result in increased or decreased enzyme levels that affects the flow of carbon in the PPP and reduces NADPH production, yeast cells could experience a shortage of NADPH. The conversion of acetaldehyde to acetic acid by Ald6p under conditions of osmotic stress, might, therefore, compensate for this shortage of NADPH. Further research focussing on proteins and metabolites, and the flux of carbon in the PPP will yield valuable data on the possible role of the PPP in the generation of NADPH that might force yeast cells to produce more acetic acid mediated by Ald6p under conditions of osmotic stress. 4.4.3 Genes involved in phospholipid biosynthesis are expressed at lower levels in VIN7 than in ST and may contribute to increased concentrations of glycerol and acetic acid produced under conditions of osmotic stress The link between fatty acid synthesis and acetic acid production has previously been established; a lack of free fatty acids in strongly clarified grape musts increases acetic acid 196 formation by wine yeast [57]. In contrast, addition of unsaturated free fatty acids causes a reduction in acetic acid formation [57]. The formation of acetyl-CoA from acetic acid and Co-enzyme A, catalyzed by acetyl-CoA synthetase encoded by ACS1, is the first step in the formation of the long chain aliphatic fatty acids. Data published by Verduyn and co-workers suggest that yeast strains that produce more acetic acid, have lower acetyl-CoA synthetase activity than yeast strains producing low levels of acetic acid [56]. Genes involved in the phosphatidylcholine biosynthesis pathway are expressed at lower levels in VIN7 than in ST (Fig. 4.3). Furthermore, ACS1 transcripts were lower in VIN7 than in ST (Table 4.3). However, ACS1 does not respond to osmotic stress in an industrial strain of S. cerevisiae Vinl3 subjected to high sugar concentrations (see Chapter 2). The lower transcript levels of ACS1 in VIN7 under conditions of osmotic stress might be due to the osmosensitivity of VIN7 caused by the deletion of YOL159C and YOL160W (Fig. 4.4). If transcript levels correlate with protein activity and the concentration of metabolic intermediates in VIN7 and ST, a lower rate of phospholipid biosynthesis in VIN7 may result in the consumption of less acetic acid required for the synthesis of phospholipids. Furthermore, high ALD6 transcript levels might also stimulate acetic acid production. The high acetic acid levels produced by VIN7 might thus be due to a combination of less acetic acid consumed by Acslp for fatty acid synthesis, and enhanced formation of acetic acid by Ald6p, which would yield more NADPH. 4.5 Literature Cited [1 ] Bauer, F.F, and Pretorius, I. S. (2000) Yeast stress response and fermentation efficiency: How to survive the making of wine - A review. S. Afr. J. Enol. Vitic. 21, 27-51. 197 Margalit, Y. (1997) Concepts in Wine Chemistry. The Wine appreciation Guild Ltd., San Francisco, CA. Hohmann, S. (2002) Osmotic Stress Signalling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev. 66, 300-372. Blomberg, A., and Adler, L. (1989) Roles of glycerol and glycerol-3-phosphate dehydrogenase (NAD+) in acquired osmotolerance of Saccharomyces cerevisiae. J. Bacteriol. 171, 1087-1092. Eglinton, J.M., Heinrich, A.J., Pollnitz, A.R, Langridge, P., Henschke, P.A. and de Barros Lopes, M. (2002) Decreasing acetic acid accumulation by a glycerol overproducing strain of Saccharomyces cerevisiae by deleting the ALD6 aldehyde dehydrogenase gene. Yeast 19, 295-301. Valadi, H., Larsson, C. and Gustafsson, L. (1998) Improved ethanol production by glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 50, 434-439. Remize, F., Roustan, J.L., Sablayrolles, J.M., Barre, P. and Dequin, S. (1999) Glycerol overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes in by-product formation and to a stimulation of fermentation rate in stationary phase. Appl. Environ. Microbiol. 65, 143-149. Remize, F., Andrieu, E. and Dequin, S. (2000) Engineering of the pyruvate dehydrogenase bypass in Saccharomyces cerevisiae: role of the cytosolic Mg(2+) and mitochondrial K(+) acetaldehyde dehydrogenases Ald6p and Ald4p in acetate formation during alcoholic fermentation. Appl. Environ. Microbiol. 66, 3151-3159. Navarro-Avino, J.P., Prasad, R., Miralles, V.J., Benito, R.M. and Serrano, R. (1999) A proposal for nomenclature of aldehyde dehydrogenases in Saccharomyces cerevisiae and characterization of the stress-inducible ALD2 and ALD3 genes. Yeast 15, 829-842. 198 [10] Martinez-Pastor, M.T, Marchler, G , Schuller, C , Marchler-Bauer, A , Ruis, H. and Estruch, F. (1996) The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). Embo J. 15, 2227-2235. [11] Posas, F , Chambers, J.R, Heyman, J.A, Hoeffler, J.P, de Nadal, E. and Arino, J. (2000) The transcriptional response of yeast to saline stress. J. Biol. Chem. 275, 17249-17255. [12] Yale, J. and Bohnert, H.J. (2001) Transcript expression in Saccharomyces cerevisiae at high salinity. J. Biol. Chem. 276, 15996-16007. [13] Rep, M , Krantz, M , Thevelein, J.M. and Hohmann, S. (2000) The transcriptional response of Saccharomyces cerevisiae to osmotic shock. Hotlp and Msn2p/Msn4p are required for the induction of subsets of high osmolarity glycerol pathway-dependent genes. J. Biol. Chem. 275, 8290-8300. [14] Erasmus, D. J , van der Merwe, G. K, and van Vuuren, H. J. J. (2003) Genome-wide expression analysis: Metabolic adaptation of Saccharomyces cerevisiae to high sugar stress. FEMS Yeast Res. 3, 375-399. [15] Bro, C , Regenberg, B , Lagniel, G , Labarre, J , Montero-Lomeli, M , and Nielsen, J. (2003) Transcriptional, proteomic, and metabolic responses to lithium in galactose-grown yeast cells. J. Biol. Chem. 278, 31141-32149. [16] Aranda, A , and Del Olmo Ml, M. (2003) Response to acetaldehyde stress in the yeast Saccharomyces cerevisiae involves a strain-dependent regulation of several ALD genes and is mediated by the general stress response pathway. Yeast 20, 747-759. [17] Bruinenberg, P.M., van Dijken, J. P, and Scheffers, W. A. (1983) A theoretical analysis of NADPH production and consumption in yeasts. J. Gen. Microbiol. 129, 953-964. 199 Nissen, T.L., Anderlund, M., Nielsen, J., Villadsen, J., and Kiel land-Brandt, M. C. (2001) Expression of a cytoplasmic transhydrogenase in Saccharomyces cerevisiae results in formation of 2-oxoglutarate due to depletion of the NADPH pool. Yeast 18, 19-32. Butcher, R.A., and Schreiber, S. L. (2004) Identification of Ald6p as the target of a class of small-molecule suppressors of FK506 and their use in network dissection. Proc. Natl. Acad. Sci. U S A. 101, 7868-7873. Lambrechts, M.G., and, Pretorius, I. S. (2000) Yeast and its Importance to Wine Aroma - A review. S. Afr. J. Enol. Vitic. 21, 97-129. Ausubel, F.M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1995) in: Current Protocols in Molecular Biology John Wiley & Sons Inc., New York, NY. Gasch, A.P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G., Botstein, D., and Brown, P.O. (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol. Biol. Cell. 11, 4241-4257. Rep, M.A., J., Thevelein, J. M., Prior, B. A. and Hohmann, S. (1999) Different signalling pathways contribute to the control of GPD1 expression by osmotic stress in Saccharomyces cerevisiae. Microbiology 145, 715-727. Brewster, J.L., de Valoir, T., Dwyer, N. D., Winter, E., and Gustin, M. C. (1993) An osmosensing signal transduction pathway in yeast. Science 259, 1760-1763. Heitman, J., Movva, N. R., and Hall, M. N. (1991) Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253, 905-909. Powers, T., and Walter, P. (1999) Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae. Mol. Biol. Cell 10, 97-1000. 200 Grabowska, D., and Chelstowska, A. (2003) The ALD6 gene product is indispensable for providing NADPH in yeast cells lacking glucose-6-phosphate dehydrogenase activity. J. Biol. Chem. 278, 13984-13988. Remize, F., Cambon, B., Barnavon, L., and Dequin, S. (2003) Glycerol formation during wine fermentation is mainly linked to Gpdlp and is only partially controlled by the HOG pathway. Yeast 20, 1243-1253. Giaever, G., Chu, A. M., Ni, L., Connelly, C , Riles, L., Veronneau, S., Dow, S., Lucau-Danila, A., Anderson, K., Andre, B., Arkin, A. P., Astromoff, A., El-Bakkoury, M., Bangham, R., Benito, R., Brachat, S., Campanaro, S., Curtiss, M., Davis, K., Deutschbauer, A., Entian, K. D., Flaherty, P., Foury, F., Garfinkel, D. J., Gerstein, M., Gotte, D., Guldener, U., Hegemann, J. H., Hempel, S., Herman, Z., Jaramillo, D. F., Kelly, D. E., Kelly, S. L., Kotter, P., LaBonte, D., Lamb, D. C , Lan, N., Liang, H., Liao, H., Liu, L., Luo, C , Lussier, M., Mao, R., Menard, P., Ooi, S. L., Revuelta, J. L., Roberts, C. J., Rose, M., Ross-Macdonald, P., Scherens, B., Schimmack, G., Shafer, B., Shoemaker, D. D., Sookhai-Mahadeo, S., Storms, R. K., Strathern, J. N., Valle, G., Voet, M., Volckaert, G., Wang, C. Y., Ward, T. R., Wilhelmy, J., Winzeler, E. A., Yang, Y., Yen, G., Youngman, E., Yu, K., Bussey, H., Boeke, J. D., Snyder, M., Philippsen, P., Davis, R. W., Johnston, M. (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418, 387-391. Schuller, C , Brewster, J.L., Alexander, M.R., Gustin, M.C. and Ruis, H. (1994) The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene. Embo J. 13, 4382-4389. Marchler, G., Schuller, C , Adam, G., and Ruis, H. (1993) A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. Embo J. 12, 1997-2003. 201 [32] Gorner, W, Durchschlag, E , Martinez-Pastor, M.T, Estruch, F , Ammerer, G , Hamilton, B , Ruis, H. and Schuller, C. (1998) Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12, 586-597. [33] Beck, T , and Hall, M. N. (1999) The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402, 689-692. [34] Mayordomo, I, Estruch, F , and Sanz, P. (2002) Convergence of the target of rapamycin and the Snfl protein kinase pathways in the regulation of the subcellular localization of Msn2, a transcriptional activator of STRE (Stress Response Element-regulated genes. J. Biol. Chem. 277, 35650-35656. [35] Schmelzle, T, and Hall, M. N. (2000) TOR, a Central Controller of Cell Growth. Cell 103, 253-262. [36] Schmidt, A , Bickle, M , Beck, T., and Hall, M. N. (1997) The yeast phosphatidylinositol kinase homolog TOR2 activates RHOl and RH02 via the exchange factor ROM2. Cell 88, 531-542. [37] Barbet, N.C, Schneider, U , Helliwell, S. B , Stansfield, I, Tuite, M. F , and Hall, M. N. (1996) TOR controls translation initiation and early Gl progression in yeast. Mol. Biol. Cell. 7, 25-42. [38] Hardwick, J.S, Kuruvilla, F. G , Tong, J. K , Shamji, A. F , and Schreiber, S. L. (1999) Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proc. Natl. Acad. Sci. USA. 96, 14866-14870. [39] Cafferkey, R, Young, P. R, McLaughlin, M. M , Bergsma, D. J , Koltin, Y , Sathe, G. M , Faucette, L , Eng, W. K , Johnson, R. K , and Livi, G. P. (1993) Dominant missense mutations in a novel yeast protein related to mammalian 202 phosphatidylinositol 3-kinase and VPS34 abrogate rapamycin cytotoxicity. Mol. Cell. Biol. 13, 6012-6023. Kunz, J , Henriquez, R, Schneider, U , Deuter-Reinhard, M , Movva, N. R, and Hall, M. N. (1993) Target of rapamycin in yeast, TOR2, is an essential phosphatidylinositol kinase homolog required for Gl progression. Cell 73, 585-596. Helliwell, S.B, Wagner, P, Kunz, J , Deuter-Reinhard, M , Henriquez, R, and Hall, M. N. (1994) TORI and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast. Mol. Biol. Cell. 5, 105-118. Griffith, J. L , Coleman, L. E , Raymond, A. S, Goodson, S. G , Pittard, W. S, Tsui, C , and Devine, S. E. (2003) Functional Genomics Reveals Relationships Between the Retro virus-Like Tyl Element and Its Host Saccharomyces cerevisiae. Genetics 164, 867-879. Albertyn, J , Hohmann, S, Thevelein, J. M. and Prior, B. A. (1994) GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14, 4135-4144. Norbeck, J , Pahlman, A. K, Akhtar, N , Blomberg, A. and Adler, L. (1996) Purification and characterization of two isoenzymes of DL-glycerol-3- phosphatase from Saccharomyces cerevisiae. Identification of the corresponding GPP1 and GPP2 genes and evidence for osmotic regulation of Gpp2p expression by the osmosensing mitogen-activated protein kinase signal transduction pathway. J. Biol. Chem. 271, 13875-13881. Nevoigt, E , and Stahl, U. (1996) Reduced pyruvate decarboxylase and increased glycerol-3-phosphate dehydrogenase [NAD+] levels enhance glycerol production in Saccharomyces cerevisiae. Yeast 12, 1331-1337. 203 Wang, X.P., Mann, C. J., Bai, Y. L., Ni, L., and Weiner, H. (1998) Molecular cloning, characterization, and potential roles of cytosolic and mitochondrial aldehyde dehydrogenases in ethanol metabolism in Saccharomyces cerevisiae. J. Bacteriol. 180, 822-830. Meaden, P.G., Dickinson, F. M., Mifsud, A., Tessier, W., Westwater, J., Bussey, H., and Midgley, M. (1997) The ALD6 gene of Saccharomyces cerevisiae encodes a cytosolic, Mg2+-activated acetaldehyde dehydrogenase. Yeast 13, 1319-1327. Norbeck, J. and Blomberg, A. (1997) Metabolic and regulatory changes associated with growth of Saccharomyces cerevisiae in 1.4 M NaCl. Evidence for osmotic induction of glycerol dissimilation via the dihydroxyacetone pathway. J. Biol. Chem. 272, 5544-5554. Blomberg, A. (2000) Metabolic surprises in Saccharomyces cerevisiae during adaptation to saline conditions: questions, some answers and a model. FEMS Microbiol. Lett. 182, 1-8. Teusink, B., Walsh, M.C., van Dam, K. and Westerhoff, H.V. (1998) The danger of metabolic pathways with turbo design. Trends Biochem Sci. 23, 162-169. Van Aelst, L., Hohmann, S., Zimmermann, F.K., Jans, A.W. and Thevelein, J.M. (1991) A yeast homologue of the bovine lens fibre MIP gene family complements the growth defect of a Saccharomyces cerevisiae mutant on fermentable sugars but not its defect in glucose-induced RAS-mediated cAMP signalling. Embo J. 10, 2095-2104. Thevelein, J.M. and Hohmann, S. (1995) Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem. Sci. 20, 3-10. Millan, C , Maurico, J. C , and Ortega, J. M. (1990) Alcohol and aldehyde dehydrogenase from Saccharomyces cerevisiae: specific activity and influence on the production of acetic acid, ethanol and higher alcohols in the first 48h of fermentation of grape must. Microbios 64, 93-101. 204 Millan, C , and Ortega, J. M. (1988) Production of Ethanol, Acetaldehyde, and Acetic acid in Wine by various Yeast Races: Role of Alcohol and Aldehyde dehydrogenase. Am. J. Enol. Vitic. 39, 107-112. Bely, M., Rinaldi, A., Dubourdieu, D. (2003) Influence of assimilable nitrogen on volatile acidity production by Saccharomyces cerevisiae during high sugar fermentation. J. BioSc. Bioeng. 96, 507-512. Verduyn, C , Postma, E., Scheffers, A., and van Dijken, J. P. (1990) Physiology of Saccharomyces cerevisiae in anaerobic glucose-limited chemostat cultures. J. Gen. Microbiol. 136, 395-403. Garcia Moruno, E., Delfini, C., Pessione, E., and Giunta, C. (1993) Factors affecting acetic acid production by yeasts in strongly clarified grape musts. Microbios 74, 249-256. Alberts, B., Bray, D., Lews, J., Raf, M., Roberts, K., and Watson, J. D. (1994) Molecular Biology of the Cell. Garland Publishing Inc., New York, NY. 205 Chapter 5 Conclusions and Future Perspectives 206 5.1. General conclusions High levels of volatile acids (VA), consisting mainly of acetic acid, are often found in Icewine. Wine yeast produce acetic acid as a by-product of the hyper osmotic stress response caused by the high sugar concentrations (>35% w/v) in Icewine grape must. The acetic acid level in Canadian Icewines often exceeds the legal limit of 1.3 g/L. To shed more light on the production of acetic acid during Icewine fermentations, I investigated (1) the global transcriptional response of S. cerevisiae to osmotic stress encountered during Icewine fermentations, (2) established the suitability of seven commercially available wine yeast strains for the production of Icewine, and (3) compared the global transcriptional response of a yeast that produced low amounts of acetic acid and a yeast that produced relatively high amounts of acetic acid. The transcriptional response of laboratory strains of S. cerevisiae to salt or sorbitol stress has been well studied. These studies have yielded valuable data on how the yeast adapts to these stress conditions. However, S. cerevisiae is a saccharophylic fungus and in its natural environment this yeast encounters high concentrations of sugars. For the production of dessert wines, the sugar concentration may be as high as 50% (w/v). The metabolic pathways in S. cerevisiae under these fermentative conditions have not been studied and the transcriptional response of this yeast to sugar stress has not been investigated. High density DNA microarrays showed that the transcription of 589 genes in an industrial strain of S. cerevisiae was affected more than two-fold in grape juice containing 40% (w/v) sugars (equimolar amounts of glucose and fructose) compared to 22% sugars. To survive high sugar containing environments, yeast has developed mechanisms (HOG-pathway) for sensing osmotic stress, which transduce the necessary signals to mount an appropriate transcriptional response. The transcriptional response of S. cerevisiae to 40% (w/v) sugars was clearly that of an osmotic stress response, since a high percentage of Hoglp- and Msn2/4p regulated genes was up-regulated. 207 The growth of S. cerevisiae was inhibited under conditions of severe sugar stress and genes in the pathways leading to purine, pyrimidine, histidine and lysine biosynthesis were down-regulated. This makes intuitive sense since the yeast no longer requires these molecules when growth is inhibited. Genes encoding enzymes involved in both the synthesis and degradation of glycerol, trehalose and glycogen were up-regulated by sugar stress. It seems that the synthesis and degradation of glycerol, trehalose and glycogen act as ATP futile cycles to avoid substrate-accelerated death during adaptation to osmotic stress as was previously suggested by others. Gene expression profiles indicate that the oxidative and non-oxidative branches of the pentose phosphate pathway were up-regulated and might be used to shunt more glucose-6-phosphate and fructose-6-phosphate from the glycolytic pathway into the pentose phosphate pathway, respectively. In addition to the ATP futile cycles, the pentose phosphate pathway may also be involved in preventing substrate-accelerated death. By shunting more fructose-6-phosphate and glyceraldehydes-3-phosphate into the non-oxidative branch of the pentose phosphate pathway, the yeast cell may prevent the accumulation of sugar phosphates, such as fructose-1,6-bisphosphate, in the glycolytic pathway and the concomitant depletion of phosphate, which may result in substrate, accelerated death. The two isogenes, TKL2 (transketolase homolog) and YGR043C (transaldolase homolog), of the structural genes involved in the non-oxidative part of the pentose phosphate pathway were highly up-regulated (12.1-fold and 11-fold, respectively). In addition, the PDC6 gene, previously thought to encode a minor isozyme of pyruvate decarboxylase, was induced 26-fold under these conditions. Expression of the PDC6 gene under osmotic stress has not been reported before. Apart from these isogenes, the expression of 229 orphan genes was also affected by 40 % (w/v) sugars. Structural genes involved in the synthesis of acetic acid from acetaldehyde, and succinic acid from glutamate, were also up-regulated. The up-regulation of the genes involved in acetic acid formation by 40 % (w/v) sugars is consistent 208 with higher levels of acetic acid in Icewine. Microarray data need to be confirmed by analyses of the proteome and metabolome before definite conclusions can be made. After establishing that Icewine fermentations constitute an osmotic stress environment to yeast, seven commercially available wine yeast strains (ST, N96, VTN13, VIN7, EC1118, 7IB, VI116) were evaluated for acetic acid and glycerol formation, fermentation rates and sensory characteristics of Icewine. The yeast strains fermented Riesling Icewine must at different rates and fermentations were completed in 17 to 49 days, depending on yeast strain. Acetic acid and glycerol formation was significantly different (p<0.05) and linked to the yeast strain. Sensory analysis of the Icewines produced with the different yeast strains showed significant differences for overall quality, perceived sulphur-like aroma and colour (p<0.05). ST, N96 and ECU 18 were initially identified as the three strains most suitable for Icewine production. ST produced the lowest levels of acetic acid, but was a slow fermentor and produced Icewine perceived to have a high sulphur-like aroma. It seems that ST has a greater demand for both nitrogen and sulphur than N96 and ECU 18 during Icewine fermentation, since DAP/Fermaid K and sulphur dioxide (50 mg/L and 100 mg/L) additions decreased fermentation time of ST, but did not affect N96 or EC1118. On the contrary, N96 and ECU 18 produced higher quality Icewines, had lower levels of perceived sulphur-like aroma, and showed faster fermentation rates. However, N96 and ECU 18 produced significantly higher amounts of acetic acid than ST, but the levels were still below the legal limit of 1.3 g/L. The effect of timed addition of DAP, Fermaid K and sulphur dioxide on acetic acid was secondary to the choice of yeast strain under the conditions employed. Increasing sugar concentrations showed a high linear correlation with both acetic acid and glycerol formation, regardless of the yeast strain used. Decreasing the fermentation temperature from 20 °C to 15 °C had no impact on acetic acid formation, but it at least doubled the time required to ferment the required amount of sugar; it was predictable that the 209 fermentations would take longer to ferment to completion, but such a big increase in fermentation time was not expected. This fact is quite relevant since Icewine grapes are pressed at temperatures equal to or below -8 °C. Winemakers often have difficulty raising the temperature of the Icewine must during the cold winter months, leading to protracted Icewine fermentations that take months to complete. The most important factors to limit acetic acid formation during Icewine fermentations are choice of yeast strain (N96 and EC 1118) and the initial sugar concentration of the Icewine grape must. Differences in the phenotypes of ST (low acetic acid and glycerol producer) and VTN7 (high acetic acid and glycerol producer) became apparent when fermenting grape must containing 40% (w/v) sugars. Different amounts of acetic acid and glycerol produced by these two yeast strains can probably be attributed to the differential expression of the structural (GPD1, ALD6) and regulatory (ZMS1) genes involved in acetic acid formation. In addition, several genes involved in phospholipid biosynthesis were expressed at lower levels in VTN7 compared to ST. De novo phospholipid biosynthesis may also contribute to the high acetic acid and glycerol levels in Icewine produced with VTN7, since both acetic acid and glycerol are used as substrates for de novo phospholipid biosynthesis. Furthermore, a mutation, P1063S, in the TOR2 encoding a protein involved in sensing environmental signals may affect the adaptation to stress. Our data suggest that TOR activity in VTN7 is lower than in ST. Furthermore, the 30 kb deletion close to the telomere on the left arm of chromosome XV of VIN7 that contains the orphan gene YOL159C, not only increases osmosensitivity of VEN7, but may also increase Tyl retro-transpositions in the genome of VIN7. This may affect genetic stability and will increase the rate of genetic drift over time in a particular strain. Genetic stability of wine yeast strains is essential to produce quality wine. VIN7 has previously been reported to be genetically unstable. The most widely accepted hypothesis of acetic acid formation by yeast during osmotic stress is that the formation of acetic acid from acetaldehyde functions as a redox sink to 210 reduce NAD + back to NADH. However, this might be an oversimplified explanation for the high levels of acetic acid formation by yeast in Icewine since ALD6, the major ALD gene, requires NADP+ and not NAD+ as co-factor. Furthermore, data obtained in this thesis (Chapter 4) indicate that the deletion of ZWFl results in an increase in acetic acid production, suggesting that the PPP may also influence acetic acid formation. This is consistent with the hypothesis proposed in Chapter 2 that fructose-6- phosphate and glyceraldehyde-3-phosphate may be shunted into the PPP to prevent substrate-accelerated death. To allow for the incorporation of fructose-6-phosphate and glyceraldehyde-3-phosphate into the non-oxidative part of the PPP, the metabolic flux through the upper oxidative part needs to be reduced, which, may lead to reduced NADPH formation in the PPP, insufficient for the needs of the cell under osmotic stress. NADPH formation catalyzed by Ald6p activity should compensate for the lack of NADPH, with the concomitant formation of acetic acid. The role of the PPP in preventing substrate-accelerated death requires metabolomic and proteomic data to confirm this hypothesis. It is evident that the yeast has evolved more than one mechanism to control its metabolism and redox balance in the cell under conditions of osmotic stress; activation of the synthesis and degradation of glycerol, trehalose and glycogen, possible up-regulation of the pentose phosphate pathway, and increased acetic production are some of the options open to yeast. In conclusion, data in Chapters 2, 3, and 4 suggest that the high levels of acetic found in Icewine can be attributed to three main factors. Firstly, the sugar concentration of grape must used for Icewine fermentations, secondly, the transcriptional response of wine yeast to osmotic stress, and thirdly, the genetic variation between wine yeast strains that result in a difference in osmosensitivity that leads to the production of higher levels of acetic acid. 211 5.2. Future Perspectives Over the past three decades, S. cerevisiae has served a model eukaryote and extensive studies have been conducted in many laboratories around the world. The full genome was sequenced and published in 1997. The function of approximately 2800 of the 5600 genes has been elucidated. More recently, high throughput technologies such as transcriptomics, proteomics and metabolomics have been developed and are now being applied to obtain a global picture of how this yeast responds to many stresses. Most of these studies were conducted on haploid laboratory yeast strains derived from a few progenitors and yeast strains were cultured in standardized laboratory media. This approach has served us well and S. cerevisiae is currently the best-characterized eukaryotic cell. S. cerevisiae has, however, been used for centuries to produce alcoholic beverages such as wine, beer, a variety of distilled spirits, fuel alcohol and bread. The industrial conditions under which this yeast has to adapt, flourish and survive, are very different from those that it is exposed to in the laboratory. It is well documented that S. cerevisiae adapts to new and stressful conditions by initiating or suppressing transcription of genes. However, it is also documented that the metabolism of yeast can be regulated at the post transcriptional level; mRNA turnover appears to play an important role in the proper regulation of gene expression and post translational modifications of enzymes play an important role in the regulation of yeast metabolism. Global analyses of the transcriptome of industrial yeast strains described in this thesis yielded novel data on how the yeast adapts to osmotic stress during Icewine fermentations (see Chapters 2 and 4). However, these data need to be confirmed and expanded at the protein and metabolite level. Analyses of the yeast transcriptome, proteome and metabolome throughout a wine fermentation should allow us to establish temporal expression profiles that will provide a much better understanding of how the regulatory 212 circuits S. cerevisiae function under osmotic stress. Furthermore, the flux of carbon through the glycolytic and pentose phosphate pathways should be measured to confirm that futile cycles indeed operate to prevent substrate-accelerated death under certain conditions. Finally, Chapters 3 and 4 in this thesis focused on the phenotypic and genotypic differences between wine yeast strains and it's impact on the production of acetic acid during sugar-induced osmotic stress. There are currently approximately 100 commercially available wine yeast strains. Analyses of their genomes by comparative genomic hybridization (CGH) using microarrays wil l (1) yield a better understanding of the dynamics of genome rearrangements that lead to differentiation of strains, (2) lead to the development of strains that are more resistant to fermentation stresses, and (3) improve our ability to develop/breed strains with tailored characteristics to produce specific wine styles. 213 Appendix A 1. Determination of yeast population in active dry yeast to be used in fermentations Objective. Determine the number of yeast cells per milligram of active dry yeast (ADY) to ensure that equal numbers of yeast cells are used as inoculum for each yeast strain. Experimental procedures. 100 mg ADY was weighed into 50 mL Falcon conical tubes to which 20 mL distilled water containing 35 mg/L cycloheximide was added. Cells were re-hydrated at 40 °C for 30 minutes and vortexed every 5 minutes for 30 seconds. After re-hydration cells were shaken in a shaker waterbath (New Brunswick) at 50 rpm and vortexed every 30 minutes until cells were separated from each other. Samples were then diluted three-fold and counted in a hemacytometer (Hausser Scientific, Horsham, PA) under a microscope. For each yeast strain, ten samples were used. Each sample was counted twice. 214 7.00E+07 6.00E+07 C) 5.00E+07 < g 4.00E+07 | 3.00E+07 -| uj a> 2.00E+07 o 1.00E+07 0.00E+00 i ST 71B N96 Vin7 Vin13 V1116 EC1118 ST 71B N96 Vin7 Vin13 V1116 EC1118 Fig. 6.1. Determination of the amount of active dry yeast (ADY) to use for Icewine fermentations. A) The number of ST, 71B, N96, VIN7, VIN13, VI116 and EC1118 cells in 100 mg active dry yeast. B) Amount of ADY added to 500 mL medium to yield an inoculum size of approximately 6 x 106 cells/mL. Values are the means often samples counted twice. 215 2. Growth of Vinl3 in 22 % (w/v) and 40 % (w/v) sugars Riesling grape juice Time (hours) Fig. 6.2. Growth of VIN13 in Riesling grape juice 22 % and 40 % (w/v) sugars. Values the means of duplicate fermentations. 216 Reductive pathway Aspartate (Kaloaoettte MDH1 (+1.3) MDH2(+\X) . L-Malate Pyruvate : Acetyl-CoA Oxidative pathway Citrate Glutamate TCA cycle S7)//_?(+1.3) SL)H4(+\.S) Isocitrate ^|||||||: Ii a-Keto-»lutarate KGD1 (NC) KGD2 (NC) / , / LPZ)/ (NC)/&„/ •Succinate' Succinyl-CoA LSC2 (+1.7) Fig. 6.3. Formation of succinate by the oxidative and reductive pathways of the tricarboxylic acid (TCA) cycle during fermentation. Fold change is indicated in brackets. NC- no change 217 Appendix B Fermentations conducted in synthetic grape must* *(Data not included in Chapter 3 or in the manuscript published in the American Journal of Enology and Viticulture) 400 0 100 200 300 400 500 600 Time (hours) Fig. 7.1. Weigh loss of fermentations conducted with ST, 71B, N96, VIN7, VIN13, VI116 and EC1118 in synthetic grape must. (A) Synthetic grape must containing 20% and (B) 40% (w/v) sugars. Data are the means of three fermentations. 218 Fig. 7.2 Growth of ST, 71B, N96, VIN7, VIN13, VI116 and EC1118 in synthetic grape must containing (A) 20 and (B) 40% (w/v) sugars. Data are the means of three fermentations. 219 Fig. 7.3 Growth of three wine yeast strains (A) ST, (B) N96 and (C) EC1118 and (D) weight loss when yeasts fermented 45 % (w/v) and 50 % (w/v) sugars in synthetic grape must. Data are the means of three fermentations ± standard deviation. 220 Table 7.1 Glycerol and ethanol produced by ST, N96 and EC1118 in synthetic grape must. Sugar concentration of synthetic grape must 45 % (w/v) ' 50 % (w/v) Glycerol (g/L) ST 8.915 ±0.121 (1.4) 10.04 ±0.169 (1.7) N96 11.41 ±0.270 (2.4) 11.88 ±0.237 (2.0) EC1118 10.72 ±0.140 (1.3) 11.59 ±0.114 (1.0) Ethanol (g/L) ST 106.3 ± 2.898 (2.7) 102.5 ±2.123 (2.1) N96 126.7 ±2.916 (2.3) 104.4 ±2.202 (2.1) EC1118 109.4 ± 1.271 (1.2) 98.8 ±0.483 (0.5) Values are the means of three fermentations ± the standard deviation and coefficient of variation in brackets 221 o e £ L U 160 140 120 100 80 60 40 20 0 • ill I V i n 1 3 ST N96 E C 1 1 1 8 V 1 1 1 6 7 1 B Vin7 Fig. 7.4 Formation of ethanol by seven different wine yeast strains fermenting 40 % (w/v) Riesling Icewine grape must. Values are the means of six fermentations ± standard deviation. 222 Table 7.2. Correlations matrix among physico-chemical and sensory attributes of icewines produced with five different yeast strains. Mouth- Fruity OQ Colour SCA1 SCA 2 FA 1 FA 2 feel Aftertaste Acidity flavour Viscosity pH L a b Acetate Glycerol Ethanol TA OQ 1 Colour -0.708 1 SCA1 0.047 -0.697 1 SCA 2 -0.619 0.274 0.162 1 FA 1 0.009 0.535 -0.599 0.187 1 FA 2 0.529 0.209 -0.725 -0.660 0.567 1 Mouthfeel 0.220 -0.390 0.342 0.618 0.261 -0.317 1 Aftertaste 0.524 -0.925** 0.871* -0.227 -0.526 -0.333 0.321 1 Acidity 0.800 -0.529 0.179 -0.399 0.356 0.472 0.382 0.541 1 Fruity flavour -0.635 0.284 0.028 0.905** -0.053 -0.666 0.422 -0.347 -0.672 1 Viscosity -0.526 0.271 0.364 0.018 -0.051 -0.273 -0.366 0.108 -0.086 -0.200 1 pH 0.624 -0.240 -0.142 0.021 0.685 0.469 0.671 0.141 0.814* -0.226 -0.405 1 L 0.873* -0.960** 0.479 -0.425 -0.383 0.059 0.347 0.821* 0.644 -0.418 -0.428 0.390 1 a -0.817* 0.957** -0.603 0.478 0.397 -0.024 -0.268 -0.916** -0.706 0.542 0.175 -0.336 -0.964** 1 b -0.903** 0.838* -0.412 0.584 0.143 -0.286 -0.231 -0.801 -0.865* 0.706 0.168 -0.516 -0.909** 0.955** 1 Acetate 0.395 -0.024 -0.388 -0.925** -0.229 0.641 -0.797 -0.075 0.055 -0.703 -0.098 -0.254 0.181 -0.183 -0.265 1 Glycerol -0.281 0.740 -0.677 -0.432 0.343 0.595 -0.814* -0.651 -0.209 -0.390 0.369 -0.281 -0.624 0.549 0.370 0.591 1 Ethanol 0.160 0.405 -0.787 -0.679 0.141 0.772 -0.760 -0.546 -0.129 -0.452 -0.204 -0.169 -0.198 0.255 0.108 0.868* 0.790 1 TA 0.298 0.408 -0.724 -0.197 0.915** 0.849* 0.051 -0.474 0.483 -0.355 -0.201 0.699 -0.178 0.211 -0.077 0.153 0.469 0.447 1 OQ, Overall Quality; SCA, Sulfur-like Compound Aroma; FA, Fruity Aroma; TA, Titratable Acidity *, ** , significant atp <0.1, p <0.05, respectively 223 Appendix C 1. Effect of arginine on acetic acid and glycerol formation, and growth and fermentation rates of ST and VIN7 in 40% (w/v) sugars synthetic grape must Objective. To determine if arginine addition affects acetic acid formation by VTN7 and ST. Experimental procedures. ADY of VIN7 and ST were inoculated to a final concentration of 6 xlO6 cells/mL into 200 mL of synthetic grape must (40% w/v sugars) in 250 mL Kimax bottles fitted with fermentations locks. Fermentations were conducted with or without 1 g/L arginine. ADY was rehydrated in 20% (w/v) synthetic grape must diluted 1:2 with deionized water and incubated at 40 °C for 30 minutes. Fermentation progress was followed by weight loss and fermentations were stopped when the ethanol concentration reached approx. 11± 0.5 % (v/v) ethanol. Fifty milliliter samples were centrifuged for 5 minutes 5000 rpm at 4 °C (Sorvall RC5C plus, rotor #: SLA300), filter sterilized (0.22 micron) and stored at -30 °C until analysed for acetic acid, glycerol and ethanol. Fermentations were slowly stirred for 1 minute on a magnetic stirrer before samples were taken to monitor cell growth by spectrophotometry using absorbance (A.=600 nm). Fermentations were conducted in duplicate. Fig. 8.1 The effect of 1 g/L arginine on the fermentation performance of VIN7 and ST in synthetic grape containing 40 % (w/v) sugars. (A) Weight loss during the fermentation. (B) Growth with or without arginine (C) Acetic acid, (D) glycerol, and (E) ethanol formation. Values are the means of duplicate fermentations. 225 Table 8.1. Genes involved in thiamine biosynthesis are expressed at least two fold lower in V I N 7 than in S T Gene ORF Molecular Function SLR" Fold difference" THI2 YBR240C transcriptional activator activity -1.2 -2.4 THI20 YOL055C phosphomethylpyrimidine kinase activity -1.7 -3.3 THI21 YPL258C phosphomethylpyrimidine kinase activity -1.1 -2.1 THI3 YDL080C transcriptional activator activity -1.2 -2.4 THI6 YPL214C hydroxyethylthiazole kinase activity -1.1 -2.2 THI80 YOR143C thiamin pyrophosphokinase activity -1.0 -2.0 PH03 YBR092C Thiamine transport/acid phosphatase activity -2.9 -7.2 THI7 YLR237W thiamin transporter activity -2.2 -4.7 a SLR- Signal Log (base 2) Ratio, average of three sets of data b Fold change calculated from average SLR 226 2. Effect of thiamine on acetic acid, and glycerol formation, and growth and fermentation rate of ST and VTN7 in synthetic grape must containing 40% (w/v) sugars. Objective. To determine if thiamine addition affects acetic acid formation by VIN7 and ST. Experimental procedures. ADY of VTN7 and ST were inoculated to a final concentration of 6 xlO6 cells/mL into 200 mL of synthetic grape must (40% w/v sugars) in 250 mL Kimax bottles fitted with fermentations locks. Fermentation was conducted with or without 0.75 mg/L thiamine. ADY was rehydrated in 20% (w/v) synthetic grape must diluted 1:2 with deionized water and incubated at 40 °C for 30 minutes. Fermentation progress was followed by weight loss and fermentations were stopped when the ethanol concentration reached approx. 11± 0.5 % (v/v) ethanol. Fifty milliliter samples were centrifuged for 5 minutes 5000 rpm at 4 °C (Sorvall RC5C plus, rotor #: SLA300), filter sterilized (0.22 micron) and stored at -30 °C until analysed for acetic acid, glycerol and ethanol. Fermentations were slowly stirred for 1 minute on a magnetic stirrer before samples were taken to monitor cell growth by spectrophotometry using absorbance (A.=600 nm). Fermentations were conducted in duplicate. 227 s < 0.6 • plus Thiamine • n o Thiamine E t 1 0 0 o c ! 75 Vin7* Thi Vln7 no Thi 200 300 Time (hours) Optus Thiamine Dno Thiamine H i B D I 2 8.0 o ° 6.0 4.0 20 0.0 •plus Thiamine • no Thiamine Fig. 8.2 The effect of 0.75 mg/L thiamine on the fermentation performance of VfN7 and ST in synthetic grape must containing 40 % (w/v) sugars. (A) Weight loss during the fermentation. (B) Growth of VIN7 and ST with or without thiamine. (C) acetic acid, (D) glycerol, and (E) ethanol formation. Values are the means of duplicate fermentations. 228 3. Deletion of ALD2, ALD3, ALD4 and ALD5 in S. cerevisiae does not affect acetic acid, glycerol and ethanol production in a YEPD medium containing 40% (w/v) sugars. Experimental procedures. The laboratory yeast strain BY4743 and its isogenic null mutants ald2, ald3, ald4, ald5 and ald6 (Table C.2) were grown overnight in 5 ml YEPD medium. Cells from these cultures were used to inoculate 10 mL YEPD containing 40% (w/v) glucose in test tubes. The final yeast cell concentration after inoculation was lxl06 cells/mL. Cultures were then grown on a cell culture roller drum (New Brunswick Scientific, Edison, NJ) at 30 °C for 3 days. Yeast cells were removed by centrifugation at 5000 rpm for 5 minutes followed by filter sterilization of the medium using 0.22 micron syringe filters. Filtered media were stored at 4 °C until HPLC analyses. Cultures were grown twice, each time in duplicate. Table 8.2. Yeast strains used in this study Yeast strain Source/Reference Genotype BY4743 (Wild type) BY4743*4oW2::G418 BY4743zkzW3::G418 BY4743zto/<5W::G418 BY4743A?W5::G418 BY4743AoWf5::G418 Invitrogen, Carlsbad, CA mat a/a (BY4741/BY4742) mat a/a his3 leu2 metl ura3 9 9 9 5 5 9 9 9 229 3 2.5 H I 2 •a o < 1 -0.5 -0 • J , HI HE-• s t • p i Bill M B Sllll i f j | | H i 8 § I 118 •iiiii li^ lllllili wt ald2 ald3 ald4 ald5 B 16 14 ~ 1 2 B) 10 0) u 8 6 4 2 H 0 wt ald2 ald3 BliilSI S B HP ald4 ald5 100 T 90 80 ~ 70 3 60 50 40 ffi 30 20 H 10 0 o c mm IBi Sill jjlg • wt ald2 ald3 ald4 ald5 . 8.3 Deletion of ALD2 ALD3, ALD4 and ALD5 does not affect (A) acetic acid, (B) lycerol and (C) ethanol formation in YEPD containing 40% (w/v) sugars. 230 A p p e n d i x D T h e effect o f t i m e d D A P , F e r m a i d K , a n d s u l p h u r d i o x i d e add i t i ons a n d f e rmen ta t ion t e m p e r a t u r e o n acet ic a c i d a n d g l y c e r o l f o r m a t i o n i n Icewine D . l I n t r o d u c t i o n In Chapter 3 we illustrated the effect of wine yeast strain on acetic acid formation in Icewine. Three candidates strains ST, N96 and EC1118 were identified as possible strains for the production of commercial Icewines. ST produced the lowest levels of acetic acid but ST is a considerably slower fermentor than N96 and EC1118. Furthermore, Icewine produced with ST was judged to have a high perceived sulphur-like aroma. N96 and EC1118 produced significantly higher amounts of acetic acid than ST, but lower levels of perceived sulphur-like aroma notes were detected and the Icewines produced by these two strains were judged to be superior to that produced by ST. Both N96 and EC1118 showed much faster fermentation rates than ST. During the production of Icewine, winemakers add di-ammonium phosphate (DAP), Fermaid K, and sulphur dioxide. In addition the fermentation temperature might also affect the production of acetic acid by wine yeasts. We therefore investigated the addition and timing of DAP, Fermaid K, sulphur dioxide, and fermentation temperature on the ability of ST, N96 and EC1118 to produce acetic acid. D . 2 M a t e r i a l s a n d M e t h o d s D.2 .1 Yeast strains and media Three commercially available yeast strains, ST, N96 and ECU 18 that performed best during the initial fermentation trails (see Chapter 3) were used. Riesling Icewine juice containing 40 °Brix was obtained from a commercial vineyard in Canada. Icewine juice was stored in 1 L batches at -30 °C until used. 231 D.2.2. Experimental design All fermentations were inoculated with active dry yeast (ADY) to a final concentration of approx. 6 xlO6 cells/mL and fermented at 20 °C (except when temperature was tested). ADY was prepared by resuspending in 7 °Brix must for 30 minutes at 40°C. Fermentation progress was followed by weight loss until at least 11 ±0.5% (v/v) alcohol was produced. Once the fermentations were completed, 50 mL samples were centrifuged for 5 minutes at 5000 rpm (Sorvall RC5C plus, rotor #: SLA300), filter sterilized (0.22 micron), and stored at -30 °C until analysed for acetic acid, glycerol and ethanol. Fermentations were conducted in triplicate for each yeast strain and for all conditions tested. D.2.2.1. Effect of nutrient additions. Di-ammonium phosphate (125 mg) or Fermaid K™ (125 mg), a commonly used yeast nutrient supplement, was added to 500 mL Icewine must at the beginning of the fermentation, or after 15 % and 30 % sugars were fermented. D.2.2.2. Effect of fermentation temperature. Icewine grape must (500 mL) was inoculated as previously discussed (D.2.2) and fermented at 15°C and 25°C. D.2.2.3. Effect of sulphur dioxide addition. Potassium meta-bisulphite was dissolved in deionised water to make a 10 % (w/v) stock solution from this stock; one two and four milliliters was added to 500 mL of fermenting Icewine juice to yield 50 mg/L, 100 mg/L and 200 mg/L sulphur dioxide, respectively. Sulphur dioxide was added at 10% or 25 % sugars fermented as determined by weight loss. D.2.3. Quantification of acetic acid, glycerol and ethanol HPLC analysis was done according to Chapter 3 section 3.2.4. 232 D.2.4. Data analyses Data obtained were normalized to ethanol produced in the fermentations conducted at 20 °C without the addition of DAP, Fermaid or sulphur dioxide. Normalization was done according to the following formula: E= Ethanol produced in (DAP/Fermaid/Sulphur dioxide/15 °C/25 °C experiments') Ethanol produced in control with no additions at 20 °C E was used to normalize acetic acid and glycerol concentrations by dividing the acetic acid and glycerol concentrations by E. After normalization, the effect of yeast strain and fermentation conditions on acetic acid and glycerol levels was determined by two-factor analysis of variance (ANOVA) to determine statistically significant differences (p=0.05). Fisher's LSD was used post hoc to determine significant differences (p= 0.05). D.3 Results D.3.1 Effect of DAP addition The addition of DAP only affected the fermentation time for ST (Fig. 9.1). Addition, as well as the timing of DAP addition, significantly increased acetic acid formation regardless of the choice of yeast strain (Fig. 9.2 A). However, ST, N96 and EC1118 reacted differently to DAP addition. Unlike the effect of DAP addition on acetic acid, glycerol formation was not affected, but glycerol formation was dependent on the yeast strain used (Fig. 9.2 B). Although glycerol formation by ST and EC1118 was unaffected, it seems that only N96 was affected significantly (p<0.05), producing less glycerol when DAP was added (Fig. 9.2 B). 233 D.3.2 Effect of Fermaid K addition The addition of Fermaid K only affected fermentation time for ST and not for ECU 18 and N96 (Fig. 9.1). Unlike DAP addition, timed Fermaid K addition did not affect the overall acetic acid formation, but the effect of timed Fermaid K addition on acetic acid seems to be dependent on the yeast strain. Whereas acetic acid formation by N96 was not affected, both ST and EC1118 produced signifcantly higher levels of acetic acid (Fig. 9.3 A). On the other hand, regardless of yeast strains used, glycerol formation was reduced significantly when Fermaid K was added (Fig. 9.3 B). D.3.3 Effect of fermentation temperature Increasing the fermentation temperature from 20 °C to 25 °C reduced fermentation times for all three yeast strains (Fig. 9.1). Conversely, fermentations conducted at 15 °C slowed down the fermentation rate for all three yeast strains (Fig. 9.1). EC1118 and ST were the most severely affected; EC1118 required more than 84 days and ST more than 98 days to produce at least 11% (v/v) ethanol (Fig. 9.1 and Table 9.1). Although significant differences were observed between strains at different temperatures, no significant trend for acetic acid formation was found between fermentation temperatures that ranged from 15 °C to 25 °C (Fig. 9.4. A). However, glycerol formation increased significantly when the temperature was increased (Fig. 9.4. B). 234 • ST • N96 • EC1118 Control DAP Begin DAP 15% DAP 30% Fermaid Fermaid Fermaid 50mg/L 50mg/L 100mg/L 200mg/L Begin 15% 30% S0210% S02 25% S0210% S02 25% 15C 20C 25C Fig. 9.1 Fermentation times of three yeast strains (ST, N96 & ECU 18) when fermenting 40 °Brix Riesling Icewine must when either 125 mg DAP, 125 mg Fermaid K or sulphur dioxide was added at different time points or when fermenting at 15 °C and 25 °C. DAP begin- DAP added at the beginning of the fermentation, DAP 15%- DAP added at 15% sugars fermented, DAP 30%- DAP added at 30% sugars fermented, Fermaid Begin- Fermaid added at the beginning of the fermentation, Fermaid 15%- Fermaid added at 15% sugars fermented, Fermaid 30%- Fermaid added at 30% sugars fermented, 50 mg/L S02 10%- 50 mg/L sulphur dioxide added at 10% sugars fermented, 50 mg/L S02 25%- 50 mg/L sulphur dioxide added at 25% sugars fermented, 100 mg/L S02 10%- 100 mg/L sulphur dioxide added at 10% sugars fermented, 200 mg/L S02 25%- 200 mg/L sulphur dioxide added at 10% sugars fermented. The sugars fermented was calculated according to weight loss. 235 3 •a a n o a> o < B 2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 18 16 14 en r 10 o 8 6 4 2 0  O C bed Control a a drlT* B A a a bed e,-*-, be b fe 5 h T DAP 0% b ab ab c e H E -DAP 15% DAP 30% b ab • ST • N96 OEC1118 Control DAP 0% DAP 15% DAP 30% Fig. 9.2 Effect of timed DAP addition on the formation of (A) acetic acid (Fischer LSD =0.093) and (B) glycerol (Fischer LSD =0.361) by three wine yeast strains (ST, N96, EC1118) in 40 °Brix Riesling Icewine. Acetic acid and glycerol were normalized to the amount of ethanol produced in the control (no DAP added). DAP was added at either 0 %, 15 % or 30 % sugars fermented as determined by weight loss. 236 1.4 S 1-2 S 1.0 1 0.8 u ••g 0.6 o < 0.4 0.2 0.0 cd cd cd "*1 abed b d • ST • N96 • EC1118 I I Control Fermaid 0% Fermaid 15% Fermaid 30% B 14 12 „ 10 S 8 u -\ r a a B c b B r d B fg cd b • ST • N96 • EC1118 Control Fermaid 0% Fermaid 15% Fermaid 30% Fig. 9.3 Effect of timed Fermaid K addition on the formation of (A) acetic acid (Fischer LSD =0.072) and (B) glycerol (Fischer LSD =0.256) by three wine yeast strains (ST, N96, and EC1118) in 40 °Brix Riesling Icewine must. Acetic acid and glycerol were normalized to the amount of ethanol produced in the control (no Fermaid K added). Fermaid K was added at either 0 %, 15 % or 30 % sugars fermented as determined by weight loss. 237 B 1.6 i 1.4 -1.2 -_ J 1 -•o o (0 0.8 -o '-#-» 0) 0.6 -u < 0.4 0.2 0 -14 12 „ 10 S 8 u d d ir 15C B 6 r* d cd 20C (Control) a a 15C 20C (Control) be b ab • ST : DN96 [•EC1118 1 1 25C a a • ST • N96 • EC1118 25C Fig. 9.4 Formation of (A) acetic acid (Fischer LSD =0.089) and (B) glycerol (Fischer LSD =0.357) by three wine yeast strains (ST, N96, and ECU 18) in 40 °Brix Riesling Icewine at three different temperatures. Acetic acid and glycerol were normalized to the amount of ethanol produced in the control fermented at 20 °C. 238 D.3.4 Effect of sulphur dioxide additions The addition of 50 and 100 mg/L of sulphur dioxide decreased the time required by ST to produce at least 11 % (v/v) ethanol (Fig. 9.1). In contrast, the addition of sulphur dioxide had no effect on the fermentation rate of N96 or EC1118. The addition of 200 mg/L sulphur dioxide at 25% sugars fermented prolonged fermentation times for all three yeast strains (Fig. 9.1). The addition of 50 mg/L and 200 mg/L sulphur dioxide at 10% and 25% sugars fermented, respectively, increased acetic acid formation regardless of the yeast strain used (Fig. 9.5 A). The addition of 200 mg/L sulphur dioxide resulted in the highest amounts of acetic acid formation by all three yeast strains. The addition of 50 mg/L or 100 mg/L sulphur dioxide at 10% or 25% sugars fermented to the Icewine fermentations did not increase acetic acid formation significantly, regardless of yeast strain used (Fig. 9.5 A). The addition of 50 mg/L or 100 mg/L sulphur dioxide, caused a significant decrease in glycerol content regardless of yeast strain (Fig. 9.5 B). Glycerol formation increased significantly for ST and EC1118 only when 200 mg/L sulphur dioxide was added at 25% sugars fermented (Fig. 9.5 B). 239 1.6 1.4 3 1.2 I 1 0.8 £ 0.6 < 0.4 0.2 0 f ef B f d T f § x BC be BC cd a b b r * • ST • N96 • EC1118 Control 50mg/L 10% 50mg/L 25% 100mg/L 200mg/L 10% 25% B A B 14 12 10 O) 8 '—' o <5 u 6 >. O 4 b b de de de b b a de cd cde Control 50mg/L 10% 50mg/L 25% 100mg/L 200mg/L 10% 25% Fig. 9.5 Effect of timed addition and the amount of sulphur dioxide on the formation of (A) acetic acid (Fischer LSD =0.057) and (B) glycerol (Fischer LSD =0.335) by three wine yeast strains (ST, N96, and ECU 18) in 40 °Brix Riesling Icewine. Acetic acid and glycerol were normalized to the amount of ethanol produced in the control. Sulphur dioxide was added at 10 % or 25 % sugars fermented as determined by weight loss. 240 Table 9.1. Ethanol (g/L) produced by ST, N96 and EC1118 under different fermentation conditions in 40 °Brix Riesling Icewine grape must. Condition Control (20 °C) Diammonium phosphate added at: 0 % sugars fermented 15 % sugars fermented 30 % sugars fermented Fermaid K added at: 0 % sugar fermented 15 % sugars fermented 30 % sugars fermented Sulphur dioxide added at: 50 mg/L at 10% sugars fermented 50 mg/L at 25% sugars fermented 100 mg/L at 10% sugars fermented 200 mg/L at 25% sugars fermented Fermentation temperature 15 °C 25 °C Values are the means of three fermentations ± the standard deviation and coefficient of variation in brackets. ST N96 EC1118 110.2 ± 15.14 116.2 ±8.939 121.2 ± 12.50 (13.7) (7.7) (10.3) 118.3 ±3.00 120.1 ±5.167 114.9 ±3.584 (2.5) (4.3) (3.1) 129.2 ± 1.610 135.8 ±6.192 119.7 ±0.674 (1.2) (4.6) (0.6) 115.7 ± 5.991 120.1 ±2.406 120.6 ± 1.910 (5.2) (2.0) (1.6) 128.2 ± 1.018 132.9 ±3.45 129.3 ± 1.035 (0.8) (2.6) (0.8) 129.3 ±0.951 135.5 ±0.351 126.9 ±0.695 (0.7) (0.3) (0.5) 128.9 ±0.472 136.7 ±3.042 129.3 ± 1.514 (0.4) (2.2) (1.2) 126.5 ±3.594 127.9 ±2.662 128.0 ±6.508 (2.8) (2.1) (5.1) 129.1 ±0.835 129.9 ±0.852 127.8 ±0.788 (0.6) (0.7) (0.6) 129.0 ± 1.276 127.6 ±4.166 124.5 ± 2.227 (1.0) (3.3) (1.8) 105.5 ±0.734 117.3 ± 1.667 119.2 ±2.554 (0.7) (1.4) (2.1) 115.0 ±2.203 130.0 ± 1.553 120.8 ±2.790 (1.9) (1.2) (2.3) 114.9 ±5.728 125.0 ±4.308 119.2 ±2.554 (5.0) (3.4) (2.1) 241 Table 9.2. Statistical analyses obtained on acetic acid and glycerol formation normalization to ethanol F-critical F-value p-value Acetic acid Effect of yeast strain when using DAP 5.143 8.623 0.0172 Addition and timing of DAP 4.757 4.831 0.04847 Effect of yeast strain when using Fermaid K 5.143 7.889 0.02091 Addition and timing of Fermaid K 4.757 3.202 0.10475 Effect of yeast strain when using at diff. temp 6.944 4.712 0.08879 Effect of fermentation temperature 6.944 6.295 0.05813 Effect of yeast strain when using sulphur dioxide 4.459 16.762 0.00138 Addition, timing and amount of sulphur dioxide 3.838 15.358 0.0008 Glycerol Effect of yeast strain when using DAP 5.143 94.577 2.9E-05 Addition and timing of DAP 4.757 4.081 0.06748 Effect of yeast strain when using Fermaid K 5.143 162.759 5.9E-06 Addition and timing of Fermaid K 4.757 12.077 0.00593 Effect of yeast strain when using at diff. temp 6.944 57.473 0.00113 Effect of fermentation temperature 6.944 15.577 0.01295 Effect of yeast strain when using sulphur dioxide 4.459 105.749 1.8E-06 Addition, timing and amount of sulphur dioxide 3.838 27.338 0.0001 242 D . 4 D i s c u s s i o n The lack of assimilable nitrogen in grape musts often lead to stuck or sluggish fermentations. As a precautionary measure, wine makers add nitrogen in the form of DAP or Fermaid K to grape musts to prevent stuck or sluggish fermentations. The effect of nitrogen (DAP and Fermaid K) addition on acetic acid formation might be dependent on the yeast strain. It seems that ST requires more nitrogen than N96 and EC1118, since the addition of DAP and Fermaid K reduced the fermentation time of only ST. Although ST produced the lowest amount of acetic acid (see Chapter 3), the addition of DAP and Fermaid K resulted in the production of increased amounts of acetic acid by ST. The lowest amounts of acetic acid were produced when fermentations were conducted at 20 °. However, N96 produced the same amount of acetic acid at 15 °C and 20 °C. The slow fermentation times exhibited by all three yeast strains when fermenting at 15 °C were expected. This is quite important since Icewine grape are pressed at -8 °C and grape must is therefore often inoculated by wine makers at cold temperatures which most likely contributes to protracted Icewine fermentations. A fermentation temperature of 25 °C resulted in much faster fermentations but also elevated levels of acetic acid in the Icewine. Interestingly, glycerol formation by ST was not affected by fermentation temperature. N96 and EC1118 produced lower amounts of glycerol at 15 °C than at 20 °C or 25 °C. The effect of sulphur dioxide addition was explored due to its ability to bind acetaldehyde that results in increased formation of glycerol. Due to the redox link between glycerol and acetic acid formation, sulphur dioxide may also affect acetic acid formation. Regardless of the amount of sugars fermented, the addition of 50 or 100 mg/L of sulphur dioxide increased the fermentation rate of ST. This is interesting because sulphur dioxide usually inhibits growth and fermentation rate. However, ST as well as N96 and EC1118 were indeed inhibited when 200 mg/L sulphur dioxide was added. N96 and EC1118 were not affected by the addition of 243 50 and 100 mg/L of sulphur dioxide. The affect on acetic acid formation was strain dependent; N96 was not affected unless 200 mg/L of sulphur dioxide was added. ECU 18 increased acetic acid formation when 50 and 200 mg/L sulphur dioxide was added at 25 % sugars fermented. The addition of 50 and 100 mg/L of sulphur dioxide at 10 % sugars fermented did not affect acetic acid formation by EC1118. ST increased its acetic acid formation regardless of the timing or the amount of sulphur dioxide addition. Glycerol formation by ST was not affected, except when 200 mg/L sulphur dioxide was added when 25 % sugars was fermented; under these conditions increased levels of glycerol were produced. The addition of 50 and 100 mg/L of sulphur dioxide, regardless of amount of sugars fermented, resulted in the production of decreased levels of glycerol by N96 and EC1118. The addition of 200 mg/L of sulphur dioxide did not affect glycerol formation by N96 and EC1118. Therefore, ST seems to be more sensitive than N96 and EC1118 to sulphur dioxide addition. However, ST still produced significantly lower levels than EC1118. Although fermentation conditions affected acetic acid formation, the choice of yeast strain was important to limit acetic acid formation. Sugar concentration and yeast strain seem to be the most important factors to limit the formation of acetic acid. 244 Appendix E Fig 10.1 Analyses of acetic acid in Icewines by HPLC with a diode array detector. A) Calibration curve of peak area vs. acetic acid concentration (g/L). B) Chromatogram of acetic acid standard (0.065 g/L) with a retention time of 20.8 minutes. C) Chromatogram of Icewine produced with S. cerevisiae strain ST. D) Chromatogram of Icewine produced with S. cerevisiae strain VIN7. 245 Glycerol, RID1 A Area = 132228.118-Amt +1345.5059 -\Re\. Res%(1):2.3623e-1 Correlation: 0.99904 AmountfQ/ll RID1 A, Refractive Index Signal (DANIEUCEWINEWHR3039.D) nftlU E 7CD00 6C0OO 5C0OO 4CD00 30000 2C000 1CD00 10 15 20 25 30 D RID1 A, Refractive Index Signal (DANIEUCEWINEWHR3026.D) nSlU S 15 20 25 30 Fig 10.2 Analyses of glycerol in Icewines by HPLC using a refractive index detector. A) Calibration curve of peak area vs. glycerol (g/L). B) Chromatogram of glycerol standard (0.65 g/L) with a retention time of 18.2 minutes. C) Chromatogram of Icewine produced with S. cerevisiae strain ST. D) Chromatogram of Icewine produced with S. cerevisiae strain VIN7. 246 B Ethanol, RID1 A Area = 52390.9672-Amt +5209.3064 Rel. Res%(1): 2.813 Correlation: 0.99963 Amountfg/lll Fig 10.3 Analyses of ethanol in Icewines by HPLC using a refractive index detector. A) Calibration curve of peak area vs. ethanol (% v/v). B) Chromatogram of ethanol standard (0.65 % {v/v}) with a retention time of 27.9 minutes. C) Chromatogram of Icewine produced with S. cerevisiae strain ST. D) Chromatogram of Icewine produced with S. cerevisiae strain VIN7. 247 Appendix F IPP1 GPD1 GPP2 i ALD2 ALD3 ALD4 ALD6 ACS1 GLK1 YAL061W YKL071W YOL159C YPL222W PGK1 ADH1 ST ••BnBSBBysyyBn Vin7 u oinoBnaniiipii i i i n i i i i i i i i r .1 rmm® n n is 1: i 1 • # I _ 1 • n • •11 H i • -r ni 1 mM 11 I I I I I! II n inamMniirani"" in "LMkWLM m m sssssssssss; ! • • • • • • • • I i [ n 11 • j J r i i j n o m a * r n M I L J J I I J rmnrr • nnnnnrnnn \MMM» • i II mm mm Fig 11.1 Probe set arrays from selected genes extracted from GeneChips used in replicate one for the transcriptional profiling of & cerevisiae strains ST and VIN7. " f l f l . I. JBULJUHIL. n PERMISSION TO USE COPYRIGHTED MATERIAL As a graduate student at the University of British Columbia, I am preparing my thesis, which will be microfilmed by the National Library of Canada, and copies of the film will be reproduced, lent or sold through University Microfilms International (UMI). I am requesting permission to use in my thesis, the excerpts from your publication(s) described below. I would be very grateful for your favorable consideration of this request. Thank you for your assistance. Permission is hereby granted to _ (Author of thesis) the University of British Columbia and the National Library of Canada to reproduce the following: Figure or page numbers: Title of article/book: Journal name, issue number, year: Book place, publisher, year: Signature(s) of Copyright holder: Date: (yyyy/mm/dd) Address: Title of Thesis: U B C Degree: Graduating Year: grad.ubc.ca/forms page 1 of 1 last updated: September 10 2004 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092291/manifest

Comment

Related Items