Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Functional analysis of the NUP98-Topoisomerase 1 (NUP98-TOP1) fusion gene in the pathogeneis of leukemia Gurevich, Rhonna Michelle 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-103981.pdf [ 12.16MB ]
Metadata
JSON: 831-1.0092272.json
JSON-LD: 831-1.0092272-ld.json
RDF/XML (Pretty): 831-1.0092272-rdf.xml
RDF/JSON: 831-1.0092272-rdf.json
Turtle: 831-1.0092272-turtle.txt
N-Triples: 831-1.0092272-rdf-ntriples.txt
Original Record: 831-1.0092272-source.json
Full Text
831-1.0092272-fulltext.txt
Citation
831-1.0092272.ris

Full Text

Functional analysis ofthe NUP98-Topoisomerase 1 (NUP98-TOP1) fusion gene in the pathogenesis of leukemia. by  RHONNA MICHELLE GUREVICH  B.Sc, The University of Manitoba, 1997 M.Sc., The University of Manitoba, 2000  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  THE FACULTY OF GRADUATE STUDIES (Medical Genetics Graduate Program)  THE UNIVERSITY OF BRITISH COLUMBIA April 2005 © Rhonna M Gurevich, 2005  Abstract  Chromosomal rearrangements of the 1 lpl5 locus have been identified in hematopoietic malignancies, resulting in translocations involving the N-terminal portion of the nucleoporin gene NUP98. Sixteen different fusion partner genes have been identified for NUP98 and over half of these are homeobox transcription factors. By contrast, the NUP98 fusion partner in t(l 1;20) is Topoisomerase I (TOPI), a catalytic enzyme recognized for its key role in relaxing supercoiled DNA. We now show that retrovirally engineered expression of NUP98-TOP1 in murine bone marrow (BM) confers a potent in vitro growth advantage and a block in differentiation in hematopoietic precursors. In a murine BM transplantation model, NUP98TOP1 expression led to a lethal, transplantable acute myeloid leukemia (AML). To ascertain if NUP98-TOP1 acts through a novel pathway, a panel of NUP98-TOP1 mutants was engineered and tested for their sub-cellular localization and their growth promoting effects. Neither the NUP98- 5' nor TOP1-3' portion of the fusion alone, nor a novel VP16-TOP1 fusion had any growth enhancing effects. Moreover, mutants lacking TOPI domains known to be involved in DNA binding were also unable to transform myeloid progenitors. The TOP1-3' mutant exhibited ubiquitous GFP expression, while NUP98-5' and the DNA binding mutants localized to distinct nuclear bodies. In-vitro mutagenesis was employed to mutate the TOPI active-site tyrosine (Y723F), a mutation known to abolish TOPI catalytic activity. Similar to NUP98TOP1, NT-Y723F exhibited a nuclear localization, had an in vitro growth advantage and induced a lethal, transplantable AML, suggesting that NUP98-TOP1 induces its leukemogenic effects independent of TOPI catalytic, isomerase activity. As observed with expression of other translocation fusion products, the long latency of disease onset suggests the acquisition of additional genetic mutations. Two approaches were used to identify potential NUP98-TOP1 collaborating genes. We chose the strong candidate ii  gene Meisl, as it has previously been shown to accelerate leukemia induced by several NUP98HOX fusions. However, no evidence for collaboration between Meisl and NUP98-TOP1 was observed. Our second approach followed the serendipitousfindingof NUP98-TOP1 retroviral integration into the ISCBP locus in a leukemic mouse. Strikingly, NUP98-TOP1 expression in ICSBP deficient bone marrow accelerated disease onset. The results of this thesis add to the recognition of NUP98 fusion genes as an important class of leukemic fusion proteins. These studies further demonstrate the complexity of the molecular pathways involved in leukemogenesis.  in  Table of Contents Title Abstract Table of Contents List of Figures List of Tables Abbreviations Acknowledgements  i ii iv vii viii ix xii  Chapter 1 Introduction 1.1 Overview 1.2 Hematopoiesis 1.2.1 Hematopoietic hierarchy 1.2.2 Ontogeny 1.2.3 Assays for detecting hematopoietic cells '. , 1.2.3.1 Detection of HSCs 1.2.3.2 Detection of progenitor cells 1.2.3.3 Detection of mature cells 1.2.4 Implications of the hematopoietic hierarchy to leukemia 1.3 Leukemia 1.3.1 Acute myeloid leukemia 1.3.2 Cellular changes that give rise to leukemia 1.3.3 Identification of genes involved in leukemia 1.3.3.1 Transcription factors 1.3.4 Chromosomal rearrangements in myeloid leukemias 1.3.4.1 Tyrosine kinase fusions 1.3.4.2 . Core binding factor fusions (AML-1 and CBFR) 1.3.4.3 Retinoic acid receptor fusions 1.3.4.4 MLL fusions 1.4 Translocations involving Nucleoporin NUP98 1.4.1 Discovery of NUP98 translocations and fusion partner genes 1.4.2 The NUP98 partner genes 1.4.3 M/i>P5-homeobox fusions 1.4.3.1 HOXA cluster fusion partners 1.4.3.2 HOXD cluster fusion partners 1.4.3.3 HOXC cluster fusions 1.4.3.4 Novel engineered NUP98-HOXfusions 1.4.3.5 NUP98-PMX1, NUP98-PMX2 1.4.4 The non-homeobox NUP98 fusion partners: 1.4.4.1 DDX10  1 1 2 2 4 5 5 7 8 9 10 10 12 13 13 15 15 16 18 19 20 20 23 25 26 28 29 29 30 31 32  1.4.4.2  LEDGF  32  1.4.4.3 1.4.4.4  NSD1 and NSD3 RAP1GDS1 and Adducin 3  32 33  1.4.5 Topoisomerase 1  1.4.5.1 1.4.5.2  33  Clinical reports of t( 11 ;20)(p 15 ;q 11) Topoisomerase I structure and function iv  34 34  1.4.6 Common themes among the non-homeobox NUP98 fusion partners 1.4.7 Other NUP fusions 1.5 NUP98 1.5.1 The nuclear pore complex 1.5.2 NUP98 and nuclear transport 1.5.2.1 Nuclear import 1.5.2.2 Nuclear export 1.5.3 NUP98 knock out experiments 1.5.4 NUP98 cellular localization 1.6 The multi-hit hypothesis in the pathogenesis of leukemia 1.6.1 The candidate gene approach 1.6.1.1 Collaborating genes for TEL -AML1 1.6.1.2 Genes that collaborating with PML-RARa 1.6.1.3 NUP98-HOX fusion co-operating genes 1.6.2 Mutagenesis 1.6.2.1 ENU-mutagenesis 1.6.2.2 Retroviral mutagenesis 1.7 Thesis objectives Chapter 2 Methods and Materials 2.1 Mice and primary bone marrow cells 2.2 Retroviral constructs 2.2.1 NUP98-TOP1 2.2.2 NUP98-TOP1 mutants 2.2.3 Meisl 2.3 GFP expression vectors 2.4 Generation of retrovirus 2.5 Infection of primary murine bone marrow cells 2.6 In vitro liquid cultures and clonogenic progenitor assays 2.7 Colony forming unit spleen (CFU-S) assay 2.8 DNA and RNA analysis 2.9 Flow cytometry 2.10 Cytospins and PB smears 2.11 Cell transfections and Western blot analysis 2.12 Identification of Retroviral Integration Sites 2.13 Statistical analysis  36 38 39 40 40 40 41 42 42 43 44 44 45 46 47 47 48 49 51 51 51 51 52 53 53 53 53 54 54 55 55 55 56 56 58  Chapter 3 The NUP98-Topoisomerase I AML-associated fusion gene induces a lethal, transplanted AML in murine bone marrow 59 3.1 Introduction 60 3.2 Results 62 3.2.1 NUP98-TOP1 enhances the expansion of hematopoietic cells in vitro 62 3.2.2 NUP98-TOP1 induces a competitive myeloid growth advantage in vivo 66 3.2.3 NUP98-TOP1 induces a lethal myeloid leukemia 69 3.2.4 NUP98-TOP1 leukemia is transplantable and decreases the latency period 72 3.2.5 NUP98-TOP1 fusion exhibits distinct properties compared to NUP98-HOX fusions 75 3.3 Discussion 76 v  Chapter 4 Functional dissection of the NUP98-Topoisomera.se I fusion gene: NUP98-TOP1 has potent leukemogenic activities independent of an engineered catalytic site mutation 81 4.1 Introduction 82 4.2 Results 84 4.2.1 Generation of NUP98-TOP1 mutants 84 4.2.2 Sequences within NUP98 direct its nuclear localization 86 4.2.3 NT-Y723F induces in vitro growth promoting effects 89 4.2.4 NUP98-TOP1 induces a lethal leukemia in the presence of a mutation to the TOPI catalytic active site 92 4.3 Discussion 95 Chapter 5. Investigating potential genes that collaborate with NUP98-TOP1 to accelerate the induction of leukemia 101 5.1 Introduction 102 5.2 Results 103 5.2.1 Analyzing NUP98-TOP1 mice for retroviral integration sites 103 5.2.2 Integration of the NUP98-TOP1 retrovirus into ICSBP 107 5.2.3 Collaboration of NUP98-TOP1 and ICSBP deficiency 109 5.2.4 NUP98-TOP1 induces an in vivo growth advantage that is accelerated on an ICSBP - background 110 5.2.5 The ICSBP' 'background co-operates with NUP98-TOP1 to induce an in vivo myeloproliferation 113 5.2.6 ICSBP' ' BM collaborates with NUP98-TOP1 expression to accelerate the onset of leukemia 114 5.3 Discussion 117 f  1  1  Chapter 6 Discussion 6.1 The NUP98-TOP1 retrovirus had low infection efficiency 6.2 Acceleration of disease in NUP98-TOP1 secondary recipient mice 6.3 Critical domains of the TOPI fusion partner 6.3.1 Requirement for intact DNA binding domains of the TOPI fusion partner 6.3.2 Coiled-coil domain 6.4 Collaborating genes 6.5 Potential mechanisms of NUP98-fusion leukemogenesis 6.5.1 Disrupted nuclear transport: 6.5.2 Dominant negative effects: 6.5.3 Generation of a novel protein 6.6 Unanswered questions  120 120 121 122 122 123 124 126 126 127 127 129  Chapter 7 Bibliography  130  vi  List of Figures Figure 1.1 Schematic overview of hematopoietic hierarchy Figure 1.2 Schematic representation of NUP98 exon breakpoints Figure 1.3 Schematic representation of NUP98, TOPI and NUP98-TOP1 proteins Figure 1.4 Categorization of NUP98 fusion partners Figure 1.5 Generation of the NUP98 proteinfromalternatively spliced mRNA  3 25 35 37 39  Figure 3.1 NUP98-TOP1 fusion protein demonstrates nuclear localization 63 Figure 3.2 Expression of NUP98-TOP1 in murine bone marrow confers in vitro proliferative advantage 65 Figure 3.3 NUP98-TOP1 expression leads to in vivo myeloproliferation 68 Figure 3.4 NUP98-TOP1 expression induces a lethal leukemia 70 Figure 3.5 Immunophenotype of hematopoietic cells from NUP98-TOP1 mice 72 Figure 3.6 Outline of strategy used to transplant BM cells co-expressing NUP98-TOP1 and Meisl 76 Figure 4.1 Schematic representation of NUP98-TOP1 and engineered mutants used in this study 86 Figure 4.2 Fluorescent Microscopy images 88 Figure 4.3 The NT-Y723F mutant displays an in vitro proliferative advantage 90 Figure 4.4 The NT-Y723F mutant displays a similar increase in CFU-S colonies compared to NUP98-TOP1 91 Figure 4.5 NT-Y723F behaves similarly to wild-type NUP98-TOP1 to induce an in vitro and in vivo proliferative advantage 93 Figure 4.6 NT-Y723F behaves similar to NUP98-TOP1 and induces a lethal, transplantable AML 94 Figure 4.7 Immunophenotype of hematopoietic cellsfromNUP98-TOP1 mice 95 Figure 5.1 Schematic representation of the protocol used to identify the genomic locus of NUP98-TOP1 retroviral integrations 104 Figure 5.2 Southern blot analysis of leukemic NUP98-TOP1 mice demonstrating the number of proviral integrations 106 Figure 5.3 NUP98-TOP1 integration into ICSBP 108 Figure 5.4 Schematic outline of NUP98-TOP1 expression i n / C W B M 110 Figure 5.5 ICSBP-/- BM enhances the in vivo proliferative effect of NUP98-TOP1 expression A  Ill  Figure 5.6 ICSBP increases the number of nucleated peripheral blood cell numbers 112 Figure 5.7 ICSBP-/- enhances the short-term myeloproliferation induced by NUP98-TOP1 .. 114 Figure 5.8 The ICSBP""background accelerate the onset of NUP98-TOP1 induced leukemia 116 7  vii  List of Tables Table 1.1 FAB classification of human acute myeloid leukemias Table 1.2 Classification of murine myeloid leukemias Table 1.3 NUP98 fusion partners  11 12 24  Table 3.1 Hematopoietic characteristics of moribund mice Table 3.2 Survival of Secondary Recipients Table 3.3 Survival of primary transplanted mice  69 74 76  Table 5.1 NUP98-TOP1 Retroviral integration sites Table 5.2 Peripheral blood cells values obtained post-transplant  viii  106 113  Abbreviations 5-FU  5-fluorouracil  Abd-B  Abdominal-B  AGM  aorta-gonad-mesonephros  ALL  acute lymphoid leukemia  AML  acute myeloid leukemia  APL  acute promyelocytic leukemia  ATRA  all-trans retinoic acid  BFU-E  burst forming unit - erythroid  BM  bone marrow  C/EBPa  CCAAT/enhancer-binding protein-ce  CBF  core binding factor  CBP  CREB binding protein  CFC  colony forming cell  CFU  colony forming unit  CFU-E  colony forming unit - erythroid  CFU-G  colony forming unit - granuloctye  CFU-GM  colony forming unit - granulocyte-mz  CFU-GEMM colony forming unit - granulocyte, er CFU-M  colony forming unit - macrophage  CFU-S  colony forming unit - spleen  CLP  common lymphoid progenitor  CML  chronic myeloid leukemia  CMP  common myeloid progenitor  CRU  competitive repopulating unit  CSF  colony stimulating factor  DMEM  Dulbecco's modified Eagle medium  ENU  N-ethyl-N-nitrosourea  EVI  ecotropic virus integration  FAB  French-American-British  FACS  fluorescence-activated cell sorting ix  FG  phenylalanine-glycine  FISH  fluorescent in situ hybridization  G- CSF  granulocyte - colony stimulating factor  GEF  guanine nucleotide exchange factor  GFP  green fluorescence protein  GM- CSF  granulocyte macrophage - colony stimulating factor  GMP  granulocyte-macrophage progenitor  HSC  hematopoietic stem cell  ICSBP  interferon consensus sequence binding protein  Ig  immunoglobulin  IL  interleukin  IRES  internal ribosomal entry site  ITD  internal tandem duplication  Kap  karyopherin  LCS  leukemia stem cell  LEDGF  lens epithelium derived growth factor  Lin  lineage markers  LTR  long terminal repeat  MDS  myelodysplastic syndrome  MEP  megakaryocyte - erythroid progenitor  MIG  MSCV-IRES-GFP  MLL  myeloid lymphoid leukemia or mixed lineage leukemia  MMHCC  Mouse Models of Human Cancers Consortium  MPD  myeloproliferative disorder  MSCV  murine stem cell virus  NES  nuclear export signal  NF-1  neurofibromatosis type 1  NK  natural killer  NLS  nuclear localization signal  NPC  nuclear pore complex  NSD  nuclear receptor-binding Su(var), Enhancer of zeste [E(z)], and Trithorax (Trx) (SET) domain protein x  NUP98  nucleoporin-98  PAS  para-aortic-splanchnopleure  PB  peripheral blood  PCR  polymerase chain reaction  PDGF/3-R  platelet-derived growth factor B receptor  PE  phycoerythrin  Pep3B  C57B16/Ly-Pep3b  [PepC3]  Fl hybrid of (C57Bl/6LyPep3b x C3N/HeJ)  PI  propidium iodide  PML  promyelocytic leukemia  RA  retinoic acid  RACE  rapid amplification of cDNA ends  RAR  retinoic acid receptor  RARE  retinoic acid response element  RBC  red blood cell  RISA  retroviral integration site analysis  RT-PCR  reverse-transcriptase polymerase chain reaction  SCF  stem cell factor  Shh  sonic hedgehog  STAT  signal transducer and activator of transcription  TALE  three amino acid loop extension  TOPI  Topoisomerase I  YFP  yellow fluorescence protein  xi  Acknowledgements  I would first and foremost like to thank my supervisor, Dr. R. Keith Humphries for the opportunity to do graduate training in his laboratory. I am grateful for the freedom he gave me to pursue several different aspects of this project, and for his continual support, guidance and wisdom throughout my PhD. I'd like to thank him for the confidence he instilled in me and for the encouragement and support to attend several international conferences. I would also like to acknowledge the helpful discussions and guidance from my graduate committee members, Drs Hugh Brock, Donna Hogge and Rob Kay. I am indebted to Patty Rosten who has a wealth of expertise in molecular biology and who provided technical assistance and friendship throughout this project. I would also like to acknowledge both Jennifer Antonchuk for her patience in teaching me many necessary assays and Nicolas Pineault for many years of teaching, direction and helpful discussions. Thank you to all other graduate students in the Humphries lab whom I've had the pleasure of sharing this experience with (Sharlene, Ben, Silvia and Sanja) and to the many other members of the Humphries lab who made it an enjoyable place to work and provided support on this project. I would like to recognize funding I received from the Natural Sciences Engineering Research Council of Canada and the Michael Smith Foundation for Health Research. Finally I would like to thank my parents Bonnie and Richard, for their unconditional love and support.  xii  Chapter 1  1.1  Introduction  Overview Chromosomal translocations have emerged as the hallmark feature of acute myeloid  leukemias (AMLs). Cloning the translocation breakpoints has often led to the identification of genes involved in the regulation of normal hematopoiesis and has further provided insight into the pathogenesis of leukemogenesis (Look, 1997). Detailed study of genes involved in leukemic translocations has further led to the development of novel therapies in the treatment of the disease (John et al., 2004). An estimated 100 recurring translocations have been cloned to date (Kelly and Gilliland, 2002). It is thus evident that the number of chromosomal translocations far exceeds the number of different leukemic phenotypes. It can be reasoned that similar signaling and transcriptional pathways are activated by different fusion genes. Moreover, it has become increasingly evident that more than one genetic alteration is required for leukemic transformation. As such, identifying common collaborating genes has also become an intriguing topic of investigation. A novel family of fusion genes has recently been identified that are characterized by balanced chromosomal translocations involving the nucleoporin gene NUP98 on chromosome 1 lpl5. To obtain further insight into the role of NUP98 fusion genes in the pathogenesis of leukemia, I studied the NUP98-Topoisomerase I fusion gene associated with acute leukemia. Topoisomerase I (TOP 1) is 1 of 16 distinct fusion partner genes that have to date been identified for NUP98. Unlike HOX genes which comprise over half of the NUP98 fusion partner genes, there is no unique role identified for TOPI in hematopoiesis. Thus it is an intriguing fusion protein to study that could provide novel insights into the pathogenesis of leukemia. Little is known about the mechanism of leukemogenesis associated with the family of NUP98 fusion genes. Moreover it is unknown whether a common mechanism exists for all NUP98 fusions or if 1  the different partners act through different pathways. To this end, we initially ascertained the effects of NUP98-TOP1 expression on both in vitro and in vivo hematopoiesis. A variety of established assays were utilized to ascertain the effect of the fusion on proliferation and differentiation of hematopoietic cells. Moreover, a bone marrow (BM) transplantation model was employed to measure directly the leukemogenic potential of the fusion. We further attempted to delineate the critical domains within each partner gene that contributes to the transforming potential by engineering novel mutations to conserved domains. Lastly, two separate strategies were employed to identify potential collaborating genes for NUP98-TOPL  The following sections provide some key background on hematopoiesis, leukemia and the assays used as a framework for the studies contained within this thesis.  1.2  Hematopoiesis  As leukemia is a malignancy that affects the normal developmental pathway of blood cells, an overview of hematopoietic cell development is presented. 1.2.1  Hematopoietic h i e r a r c h y  Hematopoiesis is the process by which blood cells are produced throughout life. Hematopoietic development is a hierarchical process that originatesfroma multipotent hematopoietic stem cell (HCS) and ultimately gives rise to the mature progeny of all hematopoietic lineages (reviewed in Weissman, 2000). For hematopoiesis to be maintained, a HSC must thus have the ability to self renew as well as differentiate. Our current understanding of the stages in hematopoiesis, originatingfromthe HSC, is depicted in Figure 1.1. A HSC can give rise to more differentiated progenitors of either the myeloid or lymphoid lineages, the common myeloid progenitor (CMP) or common lymphoid progenitor (CLP) respectively. These 2  in turn give rise to more lineage restricted progenitors and in turn to mature end cells comprising B - and T-lymphocytes, natural killer cells, granulocytes/neutrophils, macrophages/monocytes, megakaryocytes/platelets and erythrocytes. Each differentiation decision involves the progressive loss of developmental potential to the other lineages. Mature cells have a finite lifespan and thus must be continuously replenished by proliferation and differentiation of upstream progenitors to maintain normal numbers under steady state conditions.  5  LT-HSC  ST-HSC  NK cells  T-cells  B-cells  Macrophages Granulocytes  Erythrocytes  Megakaryocytes  L y m p h o i d lineage  Figure 1.1 Schematic overview of hematopoietic hierarchy  Myeloid lineage  1.2.2 Ontogeny The physiological sites of murine hematopoiesis change throughout development (reviewed in Dzierzak and Oostendorp, 2001). Hematopoietic cells are derivedfromthe mesoderm layer following gastrulation. In the mouse, the first hematopoietic cells are detected in the extra-embryonic yolk-sac blood islands, at embryonic day 7.5 (E7.5). This stage is referred to as "primitive hematopoiesis" and yields mainly primitive nucleated erythrocytes expressing fetal forms of hemoglobin and endothelial cells, which together form the vasculature. Current evidence suggests that these two cell types are derivedfroma common progenitor termed the "hemangioblast" (Lacaud et al., 2001). Also present in the yolk-sac are erythromyeloid progenitors. Multi-potent erythroid-myeloid-lymphoid progenitors are not detected until E8.5 upon establishment of the circulation between the yolk sac and embryo body. "Definitive hematopoiesis" begins in the para-aortic-splanchnopleure (PAS) and aortagonad-mesonephros (AGM) regions of the embryo proper (~E8.5) where multipotential progenitors and HSCs can be detected. These hematopoietic progenitor and stem cellsfromthe PAS/AGM region then colonize the fetal liver around E10-E11. The fetal liver is the major site of hematopoiesisfromEl 2 until the neonatal period. The spleen is colonized with hematopoietic cells at E16. Fetal liver HSC migrate to the BM around E16-E17. Starting after birth and throughout adult life the BM is the major site of hematopoiesis. The HSC and progenitor cells mature in the BM, while the mature end cells are released into the peripheral blood (PB) circulation. The spleen and thymus are also important sites for hematopoiesis, as developing B - and T-lymphocytes mature in these organs respectively.  4  1.2.3  Assays for detecting hematopoietic cells A current topic of debate is whether leukemia arises from a HSC or from a more  downstream committed progenitor (Cozzio etal., 2003; Jamieson et al., 2004). Central to answering this question is the ability to identify cells at the different stages of the developmental pathway. Numerous strategies are utilized to identify and detect hematopoietic cells having different proliferative and differentiation potentials. Described in this section are some of the more commonly used techniques for the identification of hematopoietic cells at the different developmental stages. 1.2.3.1 Detection of HSCs The most primitive cell of the hematopoietic hierarchy, the HSC, is defined by two properties. First, it is pluripotent and thus has the potential to differentiate into all 8 major lineages; and second it is able to self-renew and thus generate functionally identical daughter cells. Pioneering work from Till and McCullough provided a seminal assay used for the detection of primitive hematopoietic cells (Becker et al., 1963; Till et al., 1964). They discovered a subset of BM cells that when transplanted into lethally irradiated mice giveriseto macroscopic spleen colonies 9-14 days post-transplant. The colonies were found to be clonogenic, derived from a single cell having colony-forming-unit spleen (CFU-S) potential. Based on the following three observations, it was initially thought that the CFU-S represented a HSC. First, CFU-S display extensive proliferative capacity as the colonies contained > 10 cells. 6  Second, the colonies contained cells of 3 myeloid lineages (erythroid, granulocytic and megakaryocyte) and thus the CFU-S displayed the potential for multilineage differentiation. Lastly, transplantation of a spleen colony into a secondary recipient gaveriseto more spleen colonies demonstrating the CFU-S can both differentiate and self-renew, the two defining properties of a stem cell. However, due to the absence of mature lymphoid cells in the spleen 5  colonies the CFU-S is not now considered a HSC but is accepted as a primitive myeloid restricted progenitor (McCulloch, 2002). Today, there are two commonly used assays to detect HSC and they both use the principle of measuring the potential to regenerate and maintain lymphoid, granulocyte and erythroid cells upon transplantation into lethally irradiated recipient mice. The competitive repopulation assay was developed by David Harrison (Harrison, 1980). In this assay, BM cells from a given "test" donor are mixed with a set number of BM cells from a phenotypically distinguishable "competitor" and transplanted into a congenic lethally irradiated recipient mouse. The relative ability of the "test" sample to repopulate the host mouse is compared with the "competitor" cells by calculating the relative repopulation of myeloid and lymphoid cells from the two donor sources at 3 months post-transplant. The second commonly used assay to detect HSCs is the competitive repopulating unit (CRU) assay (Szilvassy et al., 1990). In its initial description, test cells were mixed in varying numbers with a fixed small number of competitive cells that provide radioprotection even in the absence of HSC in the test population. More recently, sublethally irradiated W /W recipients 41  41  are used as a source of endogenous competitor cells (Miller and Eaves, 1997). In current practice, the proportion of animals that contain ^% lymphoid and myeloid cells of donor origin when assayed >12 weeks post-transplant, are considered to be repopulated and used to calculate the CRU frequency using Poisson statistics (Antonchuk et al., 2002). Purification of a population of cells enriched for stem-cell activity can be achieved using fluorescence-activating-cell-sorting (FACS). The stem cell activity is contained with the subset of murine BM cells that are lineage marker " (Lin" ), c-Kit , Sca-1 , Thyl.l (Morrison and /l0  /l0  +  +  10  Weissman, 1994; Uchida and Weissman, 1992). Moreover, using the vital dye Hoescht 33342, a population of HSC-enriched cells was found to reside in the "side-population" fraction that 6  efflux the dye (Goodell et al., 1996). While these FACS based methods may be used to isolate BM populations enriched for HSCs, their quantification requires testing by functional in vivo assays. 1.2.3.2 Detection of progenitor cells FACS based assays have also been used to distinguish several different populations of progenitor cells. In a series of elegant papers by Weissman's group, it was reported that the CMP displays the phenotype (Lin", Thy 1.1", IL-7R", c-Kit , Sca-1", CD34 , FC7R ) (Akashi et hi  +  10  al., 2000) while the CLP can be identified in the (Lin", Thy-11", IL-7R , c-Kit'°, Sca-l'°) fraction +  (Kondo et al., 1997). More restricted myeloid progenitors can also be identified including the GMP (Lin", Thy 1.1", IL-7R", c-Kit , Sca-1", CD34 , FcyR ) and MEP (Lin", Thy 1.1", IL-7R", chi  hi  hi  Kit , Sca-1", CD34", FCTR ). hi  10  While definitive quantification of HSCs requires an in vivo functional assay, the presence of clonogenic progenitor cells can be tested in vitro using the functional colony-forming cell (CFC) assay (Ogawa and Livingston, 2002). Progenitor cells represent a continuum of development and include multipotential and late-committed progenitors. The CFC assay is used to obtain information on the developmental stage and differentiation potential of a progenitor cell giving rise to colony growth. It measures two key parameters; cell proliferation and differentiative potential. Briefly, BM cells are plated in semi-solid media, such as methylcellulose, often supplemented with specific cytokines. The media prevents migration and cells having sufficient proliferative potential will generate clonally derived colonies. Thus the founding cell is called a colony forming unit (CFU). The standard method for scoring colony type is based on the morphological features of the mature cells. For example, CFU-G or CFU-M denotes cells that generate colonies containing only granulocyte or macrophage cells respectively. Erythroid progenitors, either primitive burst forming units (BFU-E) or more 7  mature CFU-E can also be detected in this assay. The CFC assay also allows for the identification of more primitive progenitors having the potential for multi-lineage differentiation. The CFU-GM progenitor gives rise to colonies containing both granulocytes and macrophages while the CFU-GEMM generates macroscopic colonies containing cells of 4 lineages (granulocytes, erythrocytes, megakaryocytes and macrophages). Serial replating of primary clonogenic progenitor colonies into secondary colony assays will provide insight into their self-renewal capacity. Colonies containing terminally differentiated progeny will not generate more colonies upon secondary replating, while blast colonies may have the proliferative potential to undergo several rounds of serial replating. Thus, the CFC assay is a valuable assay for evaluating the differentiation and proliferative potential of cells within the BM. 1.2.3.3  D e t e c t i o n o f m a t u r e cells  Terminally differentiated mature cells are often identified morphologically following treatment with fixative and staining. Some criteria used for identification include relative size, the degree of granulation, the ratio of nuclear to cytosolic size and nuclear shape. As an example, more immature cells have a large nucleus with a smaller cytosol; however as they mature, the nucleus:cytosol ratio decreases so that mature cells have smaller nuclei and more cytosolic space. As with progenitors, mature cells can easily be identified by lineage specific cell surface markers upon FACS analysis. Some common examples include B220 for B-cells, CD4 and CD8 for T-cells, Terl 19 for erythroid cells, and Gr-1 and Mac-1 for granulocytic and macrophage cells of the myeloid lineage respectively.  8  1.2.4  Implications of the hematopoietic hierarchy to leukemia The availability of these quantitative assays for HSC and progenitor cells at all stages of  hematopoietic differentiation has provided theframeworkfor answering a critical question in leukemia research: what is the target cell of leukemic transformation? Does the leukemia stem cell (LSC) arise from a mutation in a HSC or in a more committed down-stream progenitor? Complicating this scenario is the observation that similar to HSC, LSC often acquire the ability to self-renew (reviewed in Warner et al, 2004). As such, leukemias may arisefrommore committed progenitors that have re-acquired the capacity for indefinite self-renewing proliferation through accumulated mutations and/or epigenetic changes. Heterogeneity in the self-renewal potential of LSCs, provided support for the hypothesis that leukemic cells are derivedfromnormal HSCs (Hope et al., 2004). Several groups took advantage of the ability to purify the different progenitor cells by FACS to ascertain the target cell for leukemic transformation. Further support for the HSC as the target cell is garnered from y'w«B-deficient mice in which the LT-HSC was found to be the only developmental stage containing a LSC responsible for the induction of myeloproliferative disease (MPD) (Passegue et al., 2004). However, it was the GMP population within human chronic myeloid leukemia (CML) samples which expressed BCR-ABL and contained the self-renewing, candidate LSCs (Jamieson et al., 2004). Expression of MLL-ENL in HSC, CMP or GMP induced AML with similar latency in murine BM transplantation models, providing further evidence for the ability of progenitors to initiate myeloid leukemias (Cozzio et al., 2003). We can speculate from these experiments, that the initiating transforming event can arise in different cell populations which may be dependent on the nature of the mutation. Although not investigated within this thesis, determining the target cell in which NUP98 translocations can induce leukemia would be an interesting area of future investigation. 9  Further complicating the hematopoietic hierarchy in the context of disease, are biphenotypic or mixed lineage leukemias in which cells co-express both myeloid and lymphoid antigens (So et al., 2003a). One proposed mechanism suggests the transformation event occurs in an early progenitor of either the myeloid or lymphoid lineage, but the biphenotypic features result from so-called "lineage infidelity" representing aberrant expression of lineage-associated genes. Alternatively, the target hematopoietic cell may have intrinsic multilineage differentiation potential; a HSC, a MPP or progenitors with bi-lineage potential. These biphenotypic leukemias are most often associated with translocations involving the MLL (mixed lineage leukemia) gene. However, our surprise finding of increased B220 expression in several NUP98-TOP1 mice suggests that the hierarchy and lineage markers defined for normal hematopoiesis may require modification in the context of leukemia.  1.3  Leukemia Abnormalities in the normal developmental pathway of blood cells can lead to  hematological disorders including leukemias. Leukemias are a heterogeneous group of cancers that affect the blood cells. Large numbers of abnormal cells are produced that belong to either the myeloid or lymphoid lineage, or both. Leukemias can further be classified in terms of their rate of progression to fulminate disease; a rapid progression is termed acute leukemia while those that progress gradually are termed chronic. 1.3.1 Acute myeloid leukemia Acute myeloid leukemia (AML) involves the clonal expansion of immature hematopoietic progenitor cells with the concomitant loss of functional mature cells. The immature, abnormal cells can be found in the BM, PB, spleen and sometimes infiltrating other organs such as liver and lymph nodes. A French-American-British (FAB) classification has been 10  the standard system that classifies human myeloid leukemias. They are divided into 8 major sub-types depending on the degree of differentiation along a given myeloid lineage as evidenced by morphology and immunophenotype (Table 1.1).  Table 1.1 F A B classification of human acute myeloid leukemias  FAB Subtype  Approximate % of adult AML patients  Name  MO  Undifferentiated AML  5%  M1  Myeloblasts leukemia with minimal maturation  15%  M2  Myeloblasts leukemia with maturation  25%  M3  Promyelocytic leukemia  10%  M4  Myelomonocytic leukemia  20%  M4 eos  Myelomonocytic leukemia with eosinophilia  5%  M5  Monocytic leukemia  10%  M6  Erythroid leukemia  5%  M7  Megakaryoblastic leukemia  5%  Classification of leukemia in murine models has historically not conformed to any standard system. Terminology for describing hematopoietic malignancies has been inconsistent and applied at the discretion of the publishing authors. Thus, similar phenotypes may be described as a MPD in one publication and as an AML in another. To resolve these inconsistencies, the Mouse Models of Human Cancers Consortium (MMHCC) set up guidelines in 2002 which allows investigators to diagnose hematopoietic disorders as defined entities according to accepted criteria (Kogan et al, 2002). Myeloid leukemias are thus defined as leukemias of granulocytes and/or monocytes and their precursors. There are 5 sub-classes of myeloid leukemias which are outlined in Table 1.2. The myeloid leukemias are classified on the 11  extent of differentiation of the neoplastic cell, the presence of monocytic or granulocytic cells and the percentage of blasts in the hematopoietic tissue. When characterizing leukemias induced upon expression of NUP98-TOP1, these guidelines were followed in attempt to properly classify the resulting disease.  Table 1.2 Classification of murine myeloid leukemias  Differentiation status of neoplastic cells  1.3.2  Monocytic  component  >20%  >90% non-lymphoid, non-erythroid hematopoietic cells in hematopoietic tissues are immature forms/blasts  moderately differentiated and neutrophilic  >20%  <90% non-lymphoid, non-erythroid hematopoietic cells in hematopoietic tissues are immature forms/blasts  well differentiated  <20%  Myeloid leukemia without maturation  poorly differentiated and not monocytic  Myeloid leukemia with maturation  MPD-like myeloid leukemia  Neutrophilic  % of immature forms/ blasts in hematopoietic tissue  Myelomonocyic luekemia  moderately differentiated, include monocytic and neutrophilic cells  Monocytic leukemia  Poorly or moderately differentiated and monocytic  >20%  >20%  c  o  m  p  o  n  e  n  •  NO  NO  YES  YES  t  YES  YES  NO  Cellular changes that give rise to leukemia At the cellular level, many changes must occur for a cell to become leukemic. As A M L  is characterized by the accumulation of a large number of immature forms or blasts, a block in the normal differentiation program must occur which essentially allows for increased selfrenewal. For the leukemic clone to become dominant, it must also acquire changes that confer a  12  proliferative and/or survival advantage. The leukemic clone may exhibit an increased survival potential due to changes in the apoptosis pathway. All of the above alterations at the cellular level - blocked differentiation and increased self-renewal, increased proliferation and increased survival, can be explained by mutations that occur at the genetic level. 1.3.3  Identification of genes involved in leukemia Several different approaches have been utilized over the years to identify genes that are  involved in leukemogenesis. The impetus is that specific knowledge of these genes will result in specific and improved treatments. Recent application of large scale expression profiling has allowed for the identification of genes up- or down-regulated in certain sub-sets of leukemia (Golub et al., 1999). Early studies focused on transcription factors that are required for normal hematopoietic differentiation. Several transcription factors were also identified through retroviral integration site analysis. Undoubtedly however, most genes involved in leukemia have been identified through chromosomal rearrangements found in leukemia patients. 1.3.3.1 Transcription factors Many studies of the pathogenesis of leukemia have focused on transcription factors that are required for normal hematopoietic differentiation. The rationale for studying these factors was that the deregulation of factors involved in hematopoietic regulation was likely to contribute to the induction of leukemia. Studies have now conclusively shown that several of these lineage specific transcription factors (e.g. PU.l, GATA-1 and C/EBPa) directly contribute to leukemogenesis in murine models and are found mutated in human leukemias (Ffitzler and Zipursky, 2005; Izraeli, 2004; Orkin et al., 1998; Rosenbauer et al., 2004; Nerlov, 2004). Other transcription factors involved in leukemia were identified through retroviral integration site analysis using the BXH2 and AKXD strains of inbred mice which spontaneously express a B-ecotropic murine leukemia virus and have an elevated incidence of spontaneous 13  myeloid leukemia and B-and T-cell lymphoma respectively (Bedigian et al., 1984; Bedigian et al., 1981). The retrovirus induces leukemia by integrating into the genome and either deregulating the expression of proto-oncogenes or inactivating the expression of tumor suppressor genes. The provirus in a tumor can thus be used as an insertional "tag" which subsequently allows for the identification of the disease gene. Arguably, the most well known family of transcription factors implicated in hematopoiesis to be identified by this technique is the Hox family. Analysis of BXH2 mice revealed proviral integrations in the Hoxal and Hoxa9 locus leading to high level expression of these transcripts (Nakamura et al., 1996b). Moreover, the HOX co-factor Meisl was also identified in these screens. Interestingly, in leukemias with integrations into Meisl, most (>95% among 20 leukemias) also had viral integrations at Hoxa7 or Hoxa9. Numerous studies in murine models have now indicated that abnormal expression of Hoxa7, Hoxa9 and Meisl are associated with the pathogenesis of leukemia. Mice engineered with BM expressing Hoxa9 and Meisl succumb to leukemia within 3 months post-transplant (Kroon et al., 1998). Up-regulation of Hoxa7, Hoxa9 and Meisl is often observed in murine models of MLL-fusion leukemias (Ayton and Cleary, 2003; Zeisig et al., 2004). Moreover, HOXA9 was recently identified as the most highly correlated gene for poor prognosis in human AML (Golub et al., 1999). It is evident that transcription factors are one of the most commonly deregulated classes of genes in leukemia. More than half of the cases of AML display balanced chromosomal rearrangements, and genes encoding transcription factors are almost always found at one of the translocation breakpoints. However, other classes of genes (e.g. nucleoporins, chromatin modifiers) are also found in a proportion of leukemias. Whether these other fusion genes have previous undescribed transcriptional activity, or whether they induce leukemia by different mechanisms are currently being investigated. 14  1.3.4  Chromosomal rearrangements in myeloid leukemias Most genes identified in leukemogenesis have been identified as targets of recurring  chromosomal translocations. Over 50% of AML is characterized by the presence of chromosomal translocations (Look, 1997). There are two major mechanisms by which disruption of these genes can induce leukemia. In acute lymphoid leukemias (ALL), transcription factors are commonly juxtaposed into the vicinity of a strong promoter or an area of open chromatin such as T-cell receptor or immunoglobulin (Ig) genes. This results in the inappropriate over-expression of proto-oncogenes. A classic example is t(8;14) commonly found in Burkitt's lymphoma in which the c-MYC proto-oncogene is translocated into the Ig locus where it becomes transcriptionally activated. In AML, the more common consequence of translocations is the generation of a novel fusion gene encoding a chimeric protein having unique properties. When considering leukemia-associated translocations, it is intriguing to note that often these genes have multiple different fusion partners. Thus it is a small number of genes that account for a large percentage of the chromosomal abnormalities in AML. Cloning and subsequent characterization of the genes disrupted at translocation breakpoints has provided insight into the regulation of both normal and leukemic hematopoiesis. In the following sections I will discuss several classes of translocations that are frequently found in chromosomal rearrangements associated with myeloid leukemias. 1.3.4.1 Tyrosine kinase fusions This class of translocations, identified most often in CML, is characterized by fusion proteins having constitutively active tyrosine kinase activity. The most well known example is the Philadelphia chromosome resulting from t(9;22)(q34;q22) which generates the BCR-ABL fusion protein. This rearrangement, found in >95% of CML patients, leads to deregulated and 15  constitutive activity of the c-Abelson tyrosine kinase. There have been several murine models generated that firmly establish the role of BCR-ABL in the induction of leukemia (Daley, 1993; Ghaffari et al., 1999; Pear et al., 1998). The translocation t(9;12)(q34;pl3) fuses ABL to a second partner, TEL, which contains a highly conserved helix-loop-helix motif (Million et al., 2002). Moreover, TEL is also fused to platelet-derived growth factor B receptor (PDGF/3-R) in t(5;12)(q33;pl3) (Sjoblom et al., 1999). PDGF/3-R is an oncoprotein containing intrinsic tyrosine kinase activity. A proposed mechanism of leukemogenesis for this group of fusion proteins suggests that the role of the amino terminal partner (e.g. BCR or TEL) is to promote homo-oligomerization of the fusion protein leading to activated tyrosine kinase activity of the partner gene (e.g. ABL or PDGF/3-R). In turn, this leads to activation of the RAS signal transduction pathway and phosphorylation of the cytoplasmic STATs (signal transducers and activators of transcription). STAT activation leads to subsequent deregulation of its down-stream target genes which include many hematopoietic growth and differentiation factors involved in regulating normal hematopoiesis (Gilliland, 1998). Of note, identification of a novel 2-phenylaminopyrimidine that can specifically inhibit ABL tyrosine kinase, led to the development of STI571 (Gleevec, Glivec, or imatinib) a therapeutic drug that effectively achieves 96% complete hematological response in phase III clinical trials in patients with chronic phase CML (Druker, 2002). This is a striking example of how studying translocations identified in leukemia and subsequent understanding of their function can lead to the development of therapeutic agents for disease treatment. 1.3.4.2 Core binding factor fusions (AML-1 and CBFB) Another group of translocations identified in leukemia involve the two proteins comprising the core binding factor complex, CBFa (AML1) and CBF/3. The AML1 16  transcription factor wasfirstcloned at the site of t(8:21) found in -12% of AML, which generates the AML1-ETO fusion protein (Licht, 2001). To date there are at least 3 other fusion partners identified for AML1 including MTG16, EVI1 and TEL found in t(16;21), t(13;21) and t(12;21) respectively. CBF/3, the heterodimeric AML1 DNA binding partner is disrupted in inv(16) which generates the CBF-MYH11 fusion protein. AML1 belongs to the RUNX family of proteins which contain a Runt homology domain (RHD) having high similarity to the Drosophila Runt protein. The RHD mediates DNA binding and is necessary for its heterodimerization with CBF/3 which further enhances DNA binding and transcriptional regulation by RUNX family members. There are several genes involved in hematopoietic regulation that have promoters activated by AML1. These include IL-3, GM-CSF, myeloperoxidase and sub-units of the T- and B-cell receptors. As the AML1-ETO fusion gene retains the ability to bind AML1 binding sites, it has been proposed that AML1 fusion genes act in a dominant-negative manner to negatively regulate AML1 target genes and thus disrupt normal hematopoietic development. The importance of AML1 in hematopoiesis is evidenced by several gene knockout experiments. While mice lacking Amll have normal morphogenesis and yolk sac derived primitive erythropoiesis, they fail to develop fetal liver hematopoiesis and survive only until El2.5 succumbing to massive hemorrhaging. This result suggests that Amll is required for definitive hematopoiesis of all lineages (Okuda et al., 1996). The importance of CBF for normal AML1 function is highlighted by C6/knock-out mice having a similar phenotype to Amll' ' 1  (Sasaki et al., 1996). Retroviral over-expression of several AML1 fusions in murine BM induces leukemia with long latency, demonstrating that while expression of AML1 fusion genes is sufficient to perturb normal hematopoiesis, additional mutagenic events are likely required for full 17  leukemogenic transformation (Bernardin et al., 2002; Schwieger et al., 2002).  1.3.4.3 Retinoic acid receptor fusions The retinoic acid receptor-a (RARa) is a nuclear hormone receptor that responds to retinoic acid (reviewed in Pollock et al., 2001; Rego and Pandolfi, 2001). In a complex with retinoid-X receptors, RARa binds specific DNA sequences termed retinoic response elements (RARE). In the absence of retinoic acid, the RARa/RXR complex represses gene transcription via a mechanism involving histone deacetylation. However, in the presence of the ligand, the complex undergoes a conformational change which releases the co-repressors and recruits transcriptional co-activators leading to activation of gene transcription. The most common translocation involving RARa is the PML-RARa fusion resulting from t(15;17) associated with >95% of acute promyelocyte leukemias (APL) (Pollock et al., 2001). The reciprocal fusion RARa -PML is also observed in a large number of cases. As seen with other fusions, PML contains a coiled-coil domain that mediates dimerization of the fusion (Minucci et al., 2000). This dimerization is involved in negatively regulating RARa transcription as the fusion retains the ability to bind RARE, RXR and is responsive to retinoic acid. In fact, pharmacological levels of all-trans retinoic acid (ATRA) convert the fusion proteinfroma transcriptional repressor to co-activator. As such, cells transformed by PML-RARa are released from a differentiation block and undergo terminal differentiation in response to ATRA. The successful treatment of PML with ATRA to induce remission provides another striking example of how deciphering the mechanism of leukemia-associated fusions can lead to novel therapy. Several transgenic mouse models engineered to express PML- RARa demonstrate that the fusion perturbs normal hematopoiesis and induces APL in a percentage of the animals following a long latency (Brown et al., 1997; Grisolano et al., 1994). Retroviral over-expression of PML-RARa in hematopoietic progenitors induced a mono- or oligo-clonal leukemia within 4 18  months following transplantation into irradiated recipient mice (Minucci et al., 2002). These results coupled with the long latency in the transgenic mice, suggest that like AML1 fusions, the PML- RARa  fusion induces a pre-leukemic phase and the leukemia occurs after acquisition of  additional genetic lesions. 1.3.4.4  MLL fusions  The mixed lineage leukemia (MLL) gene was originally identified as the target of translocations involving 1 lq23 and is now known to be involved in over 30 distinct translocations (Ernst et al., 2002). Chromosomal abnormalities involving MLL account for -10% of childhood leukemias and ~5% of adult acute leukemias. MLL is the mammalian homologue of Drosophila trithorax which acts to maintain HOX gene expression. The HOX family of transcription factors plays critical roles in both embryonic development and hematopoietic cell differentiation. It is believed that MZZ-fusion proteins may deregulate normal HOX expression patterns contributing to leukemogenesis. Murine knockout studies have demonstrated that Mil is required for both yolk sac and definitive hematopoiesis (Ernst et al., 2002; Hess et al., 1997). While the mechanism of MZZ-mediated leukemogenesis remains elusive, two recent publications have suggested that similar to tyrosine kinase, AML1 and RARa fusions, dimerization may be important. The MLZ-fusion partners involve both nuclear and cytosolic proteins. So et al. report that dimerization of MLL fusion proteins occurs via the coiled-coil domain of a cytosolic fusion partner protein (So et al., 2003b). This allows aberrant recruitment of cofactor complexes through MLL moieties and subsequent transcriptional deregulation of target genes. In contrast, when MLL is fused to a nuclear partner, the accessory factors are recruited via domains of the partner. Moreover, in a related publication Martin et al. reported that enforced dimerization of MLL was sufficient to transform murine BM cells (Martin et al., 19  2003). Whether dimerization will emerge as a mechanism for other classes of translocations such as NUP98 fusion remains an open question.  1.4  Translocations involving Nucleoporin NUP98. Recently a group of translocations have been identified in leukemia patients which involve  rearrangement of the nucleoporin gene, NUP98, located on chromosome 1 lpl5 (Lam and Apian, 2001; Slape and Apian, 2004). With 16 distinct fusion partners currently identified for NUP98, this novel group of translocations is beginning to rival MLL in terms of the number and diversity of fusion partners. Moreover, unlike most genes deregulated by chromosomal rearrangements, NUP98 has not been identified as a transcription factor. Thus, studying this group of fusions may lead to the identification of novel pathways involved in leukemogenesis. Alternatively, a surprising functional over-lap with transcription factor fusions may be revealed. 1.4.1 Discovery of NUP98 translocations and fusion partner genes The first translocation involving the nucleoporin gene, NUP98, was identified independently by two groups in 1996 who studied AML patients presenting with t(7;l I)(pl5;pl5) (Borrow et al., 1996; Nakamura et al., 1996a). Given that many BXH2 murine leukemias harbor proviral integrations interrupting either Hoxa7 or Hoxa9 and that the human HOXA cluster maps to 7pl5, Nakamura et al. used a murine Hoxa9 probe to analyze 3 t(7;l 1) patients, hypothesizing that the translocation would involve the HOXA cluster (Nakamura et al., 1996a). By Southern blot analysis they demonstrated that HOXA9 DNA was rearranged in all 3 patients thus identifying HOXA9 as one of the fusion partners. Using a combination of phage libraries, somatic cell hybrids and exon trapping, a subclone was identified that shared 98% homology to rat nucleoporin Nup98. RT-PCR using primers specific to NUP98 and HOXA9 and subsequent sequencing confirmed in these patients that t(7;l 1) codes for a fusion product of 20  NUP98 and H0XA9.  Simultaneously, a second group led by Borrow et al. used positional cloning to identify the genes disrupted in t(7;l 1) (Borrow et al., 1996). Having identified HOXA9 as a candidate gene using microsattelite markers, Southern blot analysis of 6 t(7;l 1) patients with a HOXA9 probe revealed aberrant sized junction bands in 5 patients confirming that HOXA9 was the target of the t(7;l 1) translocations. Construction of a cosmid library and subsequent exon trapping again identified the candidate gene on 1 lp 15 as the human homologue of rat Nup98. RT-PCR using primers specific to NUP98 and HOXA9 confirmed in AML samples that these two genes represented the breakpoint on t(7;l 1). The inv(l I)(pl5q22) is associated with de novo and therapy related AML / MDS (Arai et al., 1997). Detection of this rearrangement from a specific YAC clone was possible using fluorescent in situ hybridization (FISH) analysis. Constructing a PI contig-map with STS markers revealed that DDX10, a putative RNA helicase gene, was rearranged. The recent identification ofNUP98 on 1 lpl5 suggested that it might also be implicated in inv(l 1). Southern blot analysis with NUP98 cDNA probes subsequently identified its involvement in this second chromosomal rearrangement. To confirm NUP98 was disrupted in t(2;l 1), FISH and Southern blot analysis were used (Raza-Egilmez et al., 1998). Application of rapid amplification of cDNA ends (RACE) identified HOXD13 as a novel NUP98 fusion partner. With 3 NUP98 fusions already characterized, awareness was heightened that NUP98 was likely rearranged in translocations involving the 1 lpl5 locus. In 1999, 3 more NUP98 fusion partners were identified. All groups used Southern blot analysis to confirm rearrangement of NUP98 and 3' RACE to identify its fusion partner. The t(l;l 1) identified PMX1 (PRRX1) (Nakamura et al, 1999), a non-clustered homeobox gene; t(4;l 1) associated with T-ALL identified RAP1GDS1 (Hussey et al., 1999) 21  and t(ll;20) identified Topoisomerase I (TOPI) (Ahuja et al., 1999). Over the next 3 years LEDGF (Ahuja et al., 2000), NSD1 (Jaju et al., 2001) and NSD3 (Rosati et al., 2002) were similarly identified as novel NUP98 fusion partners in AML patients with t(9;l 1), t(5;l 1) and t(8;l 1) respectively. Using cDNA panhandle PCR, the NUP98HOXD11 transcript, but not NUP98-HOXD13, was identified in an AML patient with t(2;l 1) (Taketani et al., 2002b). Likewise RT-PCR with antisense primers for several HOXA cluster genes revealed that HOXA13, but not HOXA9 was fused to NUP98 in a patient with t(7;ll)(pl5;pl5) (Taketani et al., 2002a). Interestingly, HOXA11 was fused to NUP98 in a CML patient with the same translocation (Fujino et al., 2002). Two HOXC cluster genes, HOXC11 and HOXC13, were identified by RT-PCR as NUP98 fusion partners in t(l 1 ;12)(pl5;ql3) (Panagopoulos et al., 2003; Taketani et al., 2002c). Adducin3 was identified by 3'RACE from a t(10;l I)(q25;pl5) found in a T-ALL patient (Lahortiga et al., 2003). Most recently, PMX2 (PRRX2) was identified by 3'RACE in a patient with t-AML displaying t(9;l I)(q34;pl5) (Gervais et al., 2004). Now that NUP98 has been identified in several chromosomal rearrangements, more partner genes are likely to be discovered. As an example, while no HOXB cluster genes have been reported to date as NUP98 fusion partners at the genetic level, a study on childhood leukemias in Japan identified a t(l I;17)(pl5;q21) at the molecular level which corresponds to the HOXB locus (Nishiyama et al., 1999).  22  1.4.2  The NUP98 partner genes To date over 16 distinct translocations have been identified in leukemia that involves the  N-terminal portion of NUP98 (Table 1.3). The breakpoint in all rearrangements occurs between exon 9 and ex on 16 such that the N-terminal phenylalanine-glycine (FG) repeat motifs are retained in the chimeric protein (Figure 1.2). Of note, over half of the NUP98 fusion partners belong to the homeobox family of transcription factors. However, there are 7 non-homeobox NUP98 partners that lack an obvious common unifying theme and have no known role in hematopoiesis. The NUP98 fusion partners can thus be classified in two distinct sub-groups, the TVI/PPS-homeobox fusions and the non-homeobox or variant fusion partners.  23  Table 1.3 NUP98 fusion partners  Translocation  Fusion Partner  Disease  t(7:ll)(pl5;pl5)  HOXA9  AML, CML, MDS  t(2;ll)(q31;pl5)  HOXD13  AML  inv(ll)(pl5q22)  DDX10  AML, t-MDS/AML  t(ll;20)(pl5;qll)  TOPI  AML, t-MDS/AML  t(l;ll)(q23;pl5)  PMX1  AML  t(4;ll)(q21;pl5)  RAP1GDS1  T-ALL  t(9;ll)(p22;pl5)  LEDGF  AML  t(2;ll)(q31;pl5)  HOXD11  AML  t(7;ll)(pl5;pl5)  HOXA11  AML, C M L  t(7;ll)(pl5;pl5)  HOXA13  AML, MDS  t(ll;12)(pl5;ql3)  HOXC11  AML  t(ll;12)(pl5;ql3)  HOXC13  AML  t(5;ll)(q35;pl5)  NSD1  AML  t(10;ll)(q25;pl5)  NSD3  AML  t(10;ll)(q25;pl5)  Adducin 3  T-ALL  t(9;ll)(q34;pl5)  PMX2  AML  Translocations are listed in order of discovery.  24  LEDGF 10  RAP1GDS1  H0XA9, NSD3, H 0 X D 1 1 , PMX2 12  H0XA9, DDX10, H0XD13, PMX1, R A P 1 G D S 1 , NSD1, H0XD11, H0XA13, H0XA11, H 0 X C 1 1 , ADD3  13 T0P1'  ,15 W16,;-:* "  DDX10, H0XC11  Figure 1.2 Schematic representation of NUP98 exon breakpoints  1.4.3  AT// 96 -homeobox fusions >  >  Over half of the NUP98 fusion genes identified to date belong to the homeobox family of transcription factors and involve both non-clustered as well as several members of the clustered HOX gene family. HOX genes play a pivotal role in embryonic development where they specify cell identity and positioning in the developing embryo (reviewed in Buske and Humphries, 2000; Chiba, 1998). There are 39 HOX genes arranged in 4 clusters (A, B, C, and D) which are located on 4 distinct chromosomes (7, 17, 12 and 2 respectively). HOX genes are characterized by the presence of a conserved 183-nucleotide sequence, the homeobox, which 25  codes for the 61 amino acid homeodomain, a basic-helix-turn-helix motif. There is strong evidence to suggest that HOX genes are key regulators of hematopoiesis and their deregulated expression is involved in leukemic transformation. Clinically, HOX gene expression levels are frequently elevated in AML, and their upstream regulator, MLL, is a common target of chromosomal translocations in both AML and CML. Engineered overexpression of select HOX genes (e.g. Hoxa9 (Kroon et al., 1998), HOXA10 (Thorsteinsdottir et al., 1997), HOXB3 (Sauvageau et al., 1997)) induces leukemia in murine models. The recent identification of 8 HOX genes as NUP98 fusion partners in various hematological malignancies has provided the most striking direct evidence of a role for HOX in leukemogenesis. 1.4.3.1 HOXA cluster fusion partners HOXA9 was the first NUP98 fusion partner identified and NUP98-HOXA9 is the most characterized NUP98 fusion to date. In vitro analysis revealed that NUP98-HOXA9 is a nuclear protein that can transform NIH3T3 cells (Kasper et al., 1999). The transforming potential requires both the DNA binding and PBX1 interaction domains of HOXA9, as well as the FG repeats of NUP98. Furthermore, it was ascertained in fibroblasts that the N-terminal portion of NUP98 can act as a potent transcriptional activator and can further interact with the transcriptional co-activators, CBP/p300, via its FG repeats. In a retroviral over-expression BM transplantation model, mice expressing NUP98HOXA9 develop a chronic MPD and eventually succumb to AML (Kroon et al., 2001). Interestingly, co-expression of the HOX co-factor Meisl and NUP98-HOXA9 accelerated the onset of AML, similar to that previously observed for Hoxa9 and Meisl. Importantly, expression of a NUP98-HOXA9 deletion mutant representing only the HOXA9 portion present in the fusion gene, did not induce any disease in mice alone or in concert with Meisl, demonstrating the importance of NUP98. While Meisl can bind the N-terminus of HOXA9, 26  these sequences are lost upon its fusion with NTJP98. Because Meisl only weakly complemented leukemia induced by NUP98-HOXA9, but strongly collaborates with Hoxa9, Kamps' group hypothesized that the NUP98-HOXA9 fusion "consolidates the collective biochemical functions of Hoxa9 and Meisl" (Calvo et al., 2002). To test this hypothesis, NUP98-HOXA9 was retrovirally over-expressed in murine myeloid progenitors and grown in various cytokine cocktails. While Hoxa9 immortalized progenitors undergo neutrophil differentiation in response to G-CSF and die in the presence of SCF, similar to co-expression of Hoxa9 and Meisl, NUP98-HOXA9 led to a differentiation arrest in the presence of IL-3, GM-CSF or G-CSF, and allowed proliferation in SCF. The similar responses can partially be explained by the induced expression of Hoxa9 and Meisl that is observed upon NUP98-HOXA9 expression. Of interest, expression of NUP98-HOXA9 in Hoxa9~' BM also gave rise to immortalized progenitors in the presence of either G-CSF, GM-CSF or IL-3 and allowed proliferation in SCF, demonstrating that in fact Hoxa9 is not essential for the transforming properties of NUP98-HOXA9. A NUP98-HOXA9 mutant harboring mutations in the PBXinteraction domain of HOXA9 revealed that interaction with PBX is not required for it ability to immortalize myeloid progenitors nor mediate transcription of target genes (e.g. Hoxa9, Hoxa7, Meisl). This is in contrast to the results observed in fibroblasts, suggesting that transformation may occur via different mechanisms in different cell types. Further evidence to support a PBXindependent transformation by NUP98 fusion genes is supported by the observation that other NUP98 fusions (e.g. HOXD13, PMX, HOXA11, andHOXAlS) all lack a PBX-interaction motif. Evidence from gene expression profiling studies supports a model in which NUP98HOXA9 has transcriptional activation activity (Ghannam et al., 2004). Gene expression changes induced by NUP98-HOXA9 were assessed in the K562 myeloid cell line using Affymetrix arrays. This study identified 102 significant changes, 92 genes that were up-regulated and 10 27  down-regulated. The HOXA9 DNA binding domain is likely required for gene regulation as NUP98 alone had no effect on gene expression Moreover, expression of HOXA9 alone revealed only 13 significant changes in gene expression, suggesting that the NUP98-HOXA9 fusion gene has a more potent transcriptional activation function. While other HOXA cluster genes, HOXA 11 and HOXA13, have been identified as NUP98 fusion partners clinically in patients with AML and CML, to date no experimental models have been published. 1.4.3.2 HOXD cluster fusion partners NUP98-HOXD13 was identified in patients with AML and t-AML/MDS harbouring the t(2;l I)(q31;pl5) (Raza-Egilmez et al., 1998). This attracted attention because members of the HOXD cluster normally play key roles in limb morphogenesis and in contrast to the other HOX clusters, are not normally expressed in hematopoietic cells. However, retrovirally engineered expression of NUP98-HOXD13 in murine BM led to impaired differentiation and enhanced proliferation in vitro, while inducing an AML in vivo following a long latency period (Pineault et al., 2003). Both an intact homeodomain and the NUP98 portion were required for the hematopoietic effects. Strikingly, when mice were transplanted with BM co-expressing NUP98HOXD13 and Meisl, they succumbed to a rapid fatal and transplantable AML. Of note, there is no known Meis 1 -interacting domain identified in the HOXD13 sequence. These results suggest that a direct physical interaction between the //QX partner and Meisl does not likely account for the observed collaboration between Meisl and NUP98-HOX fusions. A more likely model involves activation of 2 independent pathways that combine to induce leukemia While another member of the HOXD cluster, HOXD11, has also been identified as a NUP98 fusion partner in AML, to date there are no experimental results to determine its role in leukemogenesis. 28  1.4.3.3 HOXC cluster fusions Two members of the HOXC cluster, HOXC11 and HOXC13, have been found in NUP98 translocations in leukemia patients. In vitro trans-regulatory studies using a GAL4 reporter system demonstrated that NUP98-HOXC11 had trans-activating activity while HOXC11 alone exhibited trans-repressing activity (Gu et al., 2003). While more experimental data is required to determine the effect of this fusion on hematopoietic growth and differentiation, these in vitro transcription assays are consistent with the evidence from the expression profiling studies of NUP98-HOXA9 and further provide evidence that NUP98-HOX fusions act as deregulated transcription factors. 1.4.3.4 Novel engineered NUP98-HOX fusions Intriguingly, only Abdominal-B (Abd-B) HOX genes from paralogs 9-13 have been so far reported as NUP98 fusion partners in hematological malignancies, and moreover only from paralogs 9, 11 and 13. To test whether other HOX genes may harbour the potential to form oncogenic fusion genes with NUP98, Pineault et al. engineered novel NUP98 fusion genes to test their oncogenic potential alone and in concert with Meisl (Pineault et al., 2004). Mice engineered to express NUP98-HOXA10 succumbed to AML with disease kinetics closely resembling those observed for NUP98-HOXD13, suggesting that members of the HOX pamlog 10 can form leukemic oncogenes with NUP98 and that Abd-B like HOX genes share common, overlapping leukemogenic properties. NUP98 fusions were also engineered with HOXB3 and HOXB4. NUP98-HOXB4 did not induce disease, consistent with HOXB4 having no leukemogenic potential on its own but which induces a marked HSC expansion (Antonchuk et al., 2002). However, 1 of 2 NUP98-HOXB3 mice developed leukemia, again concordant with previous reports showing expression of HOXB3 can be leukemogenic (Sauvageau et al., 1997). Together these results demonstrate that the intrinsic leukemogenic potential of NUP98-HOX is 29  related to leukemic properties of the 7/OXpartner and is not restricted to the Abd-B like homo logs. When co-expressed with Meisl, all 3 novel NUP98 fusions, including the nonleukemogenic NUP98-HOXB4 as well as HOXB4 alone, rapidly induced leukemia. These results suggest that many HOX genes may have functional overlap in their leukemic potential. The mechanism of NUP98-HOX induced leukemia remains unclear. The nuclear localization observed for NUP98-HOXA9 and NUP98-HOXD13 suggests that these fusions may act as deregulated transcription factors. Work in fibroblasts demonstrated that NUP98 interacts with the transcriptional co-factors CJ3P/p300 (Kasper et al., 1999). This led to a model in which the DNA binding is mediated by the HOX fusion partner and recruitment of transcriptionary machinery occurs via NTJP98. However other potential mechanisms need to be examined. As HOX genes have been implicated as key regulators of hematopoiesis, deregulation of downstream //OX-responsive genes may occur when NUP98 replaces the N-terminal transcriptional activity of HOX. Furthermore, disruption of normal protein-protein interactions may contribute to the pathogenesis of leukemia. HOX proteins co-operatively bind DNA with Meisl and PBX, 2 members of the TALE (three amino acid loop) family of homeodomain containing proteins (Shanmugam et al., 1999). Meisl mutant mice have recently been shown to have hematopoietic defects (Hisa et al., 2004). As the Meisl binding site is abolished upon HOXA9 fusion to NUP98, generation of NUP98-HOX fusions may induce hematopoietic defects relating to deregulated expression of Meisl. 1.4.3.5 NUP98-PMX1, NUP98-PMX2 Besides class I HOX genes, 2 non-clustered homeobox genes have been identified as NUP98 fusion partners. The class II homeobox gene PMX1 was identified as a NUP98 fusion partner in t(l;l I)(q23;pl5) (Nakamura et al., 1999). PMX1 was previously identified as a cofactor of a serum response factor, and binds to the muscle creatine kinase gene enhancer 30  element. While murine Pmxl is mainly expressed in the embryonic mesoderm and in adult heart and skeletal muscle, the human transcript was identified in heart, muscle, thymus, prostate, testis, and ovary. Interestingly, and like HOXD13, no expression was detected in hematopoietic cells. Moreover, no defects were reported in the hematopoietic system of mice homozygous for a mutant Pmxl allele, although they had defects in the formation and growth of chondrogenic and osteogenic precursors and defective skeletogenesis. Similar to HOX genes, when fused to NUP98,  the breakpoint in PMX1 occurs such that the homeodomain is retained in the fusion  protein. Moreover, in transient transfection assays, PMX1 alone exhibited weak transcriptional repressing activity while both NUP98-PMX1 and NUP98 alone were strong transactivators. Transgenic mice generated by placing NUP98-PMX1 under the control of the hCG promoter, developed a phenotype resembling CML (Wang et al., 2004). Most recently PMX2 (PRRX2) was identified in a patient with t-AML as the NUP98 fusion partner in t(9;l I)(q34;pl5) (Gervais et al., 2004). Like PMX1, PMX2 is a DNA binding transcription factor and is required for fetal development. Pmxl and Pmx2 were shown in double mutant mice to be upstream regulators of sonic hedgehog (Shh). As Shh has recently been identified as an inducer of hematopoietic stem cell proliferation, interaction of these pathways deserves further attention (Bhardwaj et al., 2001). 1.4.4  The non-homeobox NUP98 fusion partners: In addition to the homeobox genes, 7 other NUP98 fusion partners have been described  that exhibit a wide range of biological activity. To date these include DDX10, TOPI, LEDGF, NSD1, RAP1GDS1, NSD3  and Adducin 3. So far the information is fragmentary at best, but  there are some intriguing suggestions of at least a partial degree of overlap within this group and perhaps even with homeobox genes.  31  1.4.4.1 DDX10 The inv(l I)(pl5q22) has been identified in both de novo and t-AML/MDS and generates 2 chimeric transcripts: NUP98 exon 12 fused to DDX10 exon 6, and NUP98 exon 14 fused to DDX10 exon 7 (Arai et al., 1997). Although the reciprocal DDX10-NUP98 transcript is predicted, only NUP98-DDX10 has been observed in patients. DDX10 was initially identified by a cDNA screen of the ataxia-telangiectasia locus and codes for a putative ATP-dependent DEAD-box RNA helicase. While its precise function is unknown, DDX10 is predicted to play a role in RNA metabolism including splicing, translation and ribosome assembly. 1.4.4.2 LEDGF In t(9;l I)(p22;pl5) identified in AML, NUP98 is fused to LEDGF (lens epithelium derived growth factor) encoding the transcriptional co-activators p52 and p75 both of which are derived by alternate splicing (Ahuja et al., 2000). Both NUP98-p52 and NUP98-p75 transcripts were identified in the leukemic cells. p52 is a potent general transcriptional co-activator and is thought to mediate functional interactions between upstream sequence-specific activators and the general transcription apparatus. It has also been shown to interact with the pre-mRNA splicing factor ASF/SF2, an interaction also described for TOPI. Compared to p52, p75 is a less potent coactivator and does not functionally interact with ASF/SF2. However, it has been shown to act as a growth and survival factor for lens epithelial cells, keratinocytes, and skin fibroblasts. 1.4.4.3 NSD1 and NSD3 The gene NSD1 (nuclear receptor-binding Su(var), Enhancer of zeste [E(z)], and Trithorax (Trx) (SET) domain protein 1) was identified as the NUP98 fusion partner in t(5;l I)(q35;pl5.5) (Jaju et al., 2001). NSD1 is the human homologue of murine Nsdl, a bifunctional transcriptional intermediary factor having both co-activator and co-repressor activities. Murine Nsdl contains 2 nuclear receptor interaction domains, 5 PHD fingers, a SET 32  domain and a SAC (SET domain-associated cysteine-rich) domain (Kurotaki et al., 2001). NSD1 mutations have recently been identified in Sotos and Weavers childhood overgrowth syndromes (Douglas et al., 2003). Interestingly, Sotos syndrome is associated with several cancers including acute lymphoblastic leukemia and lymphomas. Another NSD family member, NSD3 was fused to NUP98 in the AML-associated t(8;l l)(pl 1.2;pl5) (Rosati et al., 2002). NSD3 is also amplified in several breast cancer cell lines and primary breast carcinomas providing evidence for NSD family members in malignancies (Angrand et al., 2001). 1.4.4.4  RAP1GDS1 a n d Adducin 3  Two NUP98 fusions have been identified in lymphoid leukemias. In T-ALL, NUP98 is fused to RAP1GDS1 in t(4;l I)(q21;pl5) (Hussey et al, 1999) and in t(10;l I)(q25;pl5) to Adducin-3 (Lahortiga et al., 2003). RAP1GDS1 codes for smgGDS, a ubiquitously expressed guanine nucleotide exchange factor (GEF) that stimulates the conversion of small GTPases from the inactive GDP-bound form to the active GTP-bound form. smgGDS acts on GTPases that contain C-terminal polybasic region (PBR) including k-Ras, racl and rac2. smgGDS is composed of tandem repeats of the armadillo motif, believed to mediate protein-protein interactions, making it unique among GEF's. Except for the initial methionine, the entire coding sequence ofRAPlGDSl  is fused to NUP98.  Adducin3 is the ubiquitously expressed subunit gamma of the adducin protein which is hypothesized to play an important role in the skeletal organization of the cell membrane. 1.4.5  Topoisomerase I Topoisomerase I (TOPI) was identified as the NUP98 fusion partner in  t(l 1 ;20)(pl5;ql 1) found in two patients with AML and t-AML/MDS (Ahuja et al., 1999). The clinical findings of this fusion gene and the normal role of TOP I will be discussed in the 33  following sections. 1.4.5.1 Clinical reports of t(ll;20)(pl5;qll) To date there are only 12 documented reports of this rare but recurrent translocation in hematological malignancies. The first report of this genetic rearrangement was in 1972 in a patient with polycythemia vera (Berger, 1972). Three patients with FAB subtype M2 (myeloblastic with maturation) (Betts et al., 1998; Mitelman et al., 1988; Prigogina et al., 1986), a child with t-AML (Felix et al, 1995), one with t-MDS (Felix et al., 1998) and another with an unspecified subclass of AML (Raimondi et al., 1999) were all subsequently reported as having the t(ll;20)(pl5;qll) rearrangement. In 1999, Dr. Peter Aplan's group at NIH first reported that this translocation coded for a fusion between NUP98 and TOPI upon cloning the translocations observed in the above mentioned patients with t-AML and t-MDS (Ahuja et al., 1999). Two patients with AML-M5 (acute monocytic leukemia) were subsequently reported with t(l l;20)(pl5;ql 1.2) (Kakazu et al.,2001) (Chen et al., 2003) one definitively generating the NUP98-TOP1 chimera. Interestingly, a further report of a t-MDS patient with a three-way translocation t(10;21;l l)(q24;ql l;pl5) revealed fusion between NUP98 and TOPI (Panagopoulos et al., 2002). Both NUP98-TOP1 and the reciprocal fusion TOP1-NUP98 were detected in two patients with M2 AML (Iwase et al., 2003; Potenza et al., 2004). While NUP98TOP1 is a rare translocation, it is found in a wide spectrum of hematological malignancies. The fusion has been detected both de novo and therapy related AML/MDS and is evident in both childhood and adult leukemias. 1.4.5.2 Topoisomerase I structure and function Topoisomerases catalyze a series of reactions in which individual DNA strands or double helices are passaged through one another to relieve topological stress along the double helix (reviewed in Pommier et al., 1998; Wang, 2002). Type I enzymes like TOPI, transiently 34  cleave a single strand of DNA and remain bound to the DNA via a covalent phosphodiester bond between the 3'-hydroxyl residue on the DNA and a tyrosine residue in the TOPI catalytic domain. TOPI subsequently releases itself by transesterification onto the free 5'-hydroxyl end. The TOPI protein consists of four distinct domains (Figure 1.3) (Yang and Champoux, 2002); (i) an N-terminal domain containing a nuclear localization signal, believed to be dispensable for in vitro TOPI catalytic function, (ii) a conserved core domain which mediates binding to supercoiled DNA, (iii) a non-conserved "linker" domain and (iv) a C-terminus catalytic region containing the active tyrosine and also having sequences that bind DNA. Because of its role in altering DNA topology, TOPI has been implicated in many cellular processes including DNA replication, transcription, recombination and chromosome condensation. Upon fusion to NUP98, the N-terminal domain of TOPI containing multiple nuclear localization signals (NLS) is lost, while the core and C-terminal domains which contain motifs required for DNA binding and the catalytic activity are retained.  Figure 1.3 Schematic representation of NUP98, TOPI and NUP98-TOP1 proteins TOPI functional domains comprise: N-terminal NLS, core domain (solid box), linker (checkered) and Cterminus (open box). Functional domains of NUP98 include: F X F G repeats (hatched bars), GLEBS domain (open box) and RNP-binding domain (vertical stripes). Fusion breakpoints are indicated with vertical arrows.  35  Besides its catalytic activity, TOPI has specific kinase activity which maps to the Cterminal domain (Rossi et al., 1996; Rossi et al., 1998). It phosphorylates the splicing factors ASF/SF2 and has thus been implicated to play a role in RNA splicing. Moreover, TOPI interacts both in vivo and in vitro with two tumor-suppressor genes. Interaction with pl4  ARF  increases the DNA relaxing activity of TOPI (Karayan et al., 2001) while p53 activates both the catalytic DNA relaxation and SR-kinase activity (Albor et al., 1998). Notably, p53 and ARF act in the same pathway; ARF binding of the p53-regulator MDM2, mediates MDM2 relocalization resulting in increased p53 stability. How these functions of TOPI contribute to the pathogenesis of NUP98-TOP1-induced leukemia and perhaps normal hematopoiesis awaits future investigation. 1.4.6  Common themes among the non-homeobox NUP98 fusion partners A categorization of the non-homeobox NUP98 fusion partner genes based on known key  functions of the partner, is summarized in Figure 1.4. While DDX10, a putative RNA helicase and TOPI, a DNA topoisomerase are very distinct proteins, they share some functional similarities in their biological role as they both alter the topological state of RNA and DNA respectively. Other NUP98 fusion partners can be broadly categorized for their involvement in transcription. LEDGF is a general transcriptional co-activator while both NSD1 and NSD3 based on their domain structures may define a novel class of bi-functional transcriptional intermediary factors. Of note, all of these proteins are nuclear. The two partners found in lymphoid leukemias, Adducin3 and RAPGDS1, are both cytosolic proteins involved in signaling.  36  Figure 1.4 Categorization of NUP98 fusion partners The NUP98 fusion partner genes identified in myeloid leukemias (open shapes) can be broadly categorized as transcription factors (the homeobox containing partners), transcriptional regulators or DNA/RNA modifying enzymes. The partner genes identified in lymphoid leukemias are represented in a hatched shape.  A common feature to all NUP98 non-homeobox fusion partners is the presence of a sequence predicted to adopt a coiled -coil domain (Hussey and Dobrovic, 2002). Coiled-coiled domains are a-helical structural motifs that mediate oligomerization of many proteins. It remains to be determined whether these domains are essential for oncogenic transformation induced by the NUP98 fusions as has been observed for other translocation products. Moreover whether a common mechanism of leukemogenesis exists among all the NUP98 fusion genes or if distinct mechanisms perhaps exist for the homeobox versus non- homeobox fusion partners also awaits further discovery.  37  1.4.7 Other NUP fusions It is intriguing to note that NUP98 is not the only nucleoporin gene found in leukemic translocations. NUP214 (also termed CAN) has been identified in 3 distinct translocations. The recurring t(6;9)(p23;ql5) associated with AML and MDS generates fusions between NUP214 and either DEK or SET (won Lindern et al., 1992). While NUP98 fusions involve the N-terminal portion of the protein, the C-terminus of NUP214 is involved in these translocations. However, like NUP98, the FG-repeat rich sequences are retained, as well as a leucine zipper and a predicted coiled-coil domain. NUP214 is normally localized to the nuclear and cytoplasmic face of the nuclear envelope consistent with its role in the nuclear pore complex, whereas the NUP214-DEK fusion protein has a nuclear localization (Boer et al., 1998). More recently NUP214 was identified in a fusion involving ABL1 (Graux et al., 2004), the 5Ci?-fusion partner found in >95% of CML. Interestingly, this fusion was detected on amplified episomes in a patient with T-ALL. Unlike the other NUP214 fusions, this fusion involved the N-terminal of the protein retaining the coiled-coil domain, but not the FG repeats. Moreover, like BRC-ABL1 and ETV6-ABL1 fusions, NUP214-ABL1 is a constitutively active tyrosine kinase that is sensitive to imatinib. The identification of leukemic translocations involving two distinct nucleoporin genes both having multiple fusion partners is likely not a serendipitous finding and begs further investigation as to potential roles of nucleoporin genes in both normal and leukemic hematopoiesis. While the translocations involving HOX genes may be leukemogenic by way of deregulated HOX expression, 7 NUP98 fusion proteins involve partners that have no known unique roles in hematopoiesis. As the common partner to now 16 leukemic chromosomal rearrangements, NUP98 deserves critical evaluation to elucidate its potential contributions to leukemogenesis. 38  1.5  NUP98  Nucleoporin NUP98, is a 98 kDa protein comprising several functional domains (Figure 1.3). In the N-terminus are 2 domains comprising several phenylalanine-glycine (FG) repeat domains (GLFG, FG, FXFG) that presumable act as docking sites for transport cargo (Radu et al., 1995). These domains are split by a GLEBS-like domain that mediates binding to RAE1 (Pritchard et al., 1999a). In the C-terminus is a sequence that codes for a putative RNP binding domain. Two major NUP98 transcripts have been detected (Fontoura et al., 1999). The llpl5.5 locus produces 2 alternatively spliced transcripts; one encoding NUP98 and one encoding a NUP98-NUP96 precursor (Figure 1.5). These mRNAs are translated into 98 and 186 kDa precursor proteins respectively, which are both post-translationally cleaved after phenylalanine 863. The former generates the functional NTJP98 protein and an 8 kDa C-terminal fragment. The 186 kDa precursor also forms NUP98 as well as the C-terminal NUP96.  5' UTR  A  NUP98  3' UTR  NUP98 mRNA 5 UTR 1  NUP98  NUP96  3' UTR  NUP98-NUP96 precursor mRNA Phe 863 |  920  NUP98 precursor Protein (98 kDa)  NUP98-NUP96 precursor protein (186 kDa)  Phe 863 j 915 NUP98  1712  NUP96  Figure 1.5 Generation of the NUP98 protein from alternatively spliced mRNA (A) The l l p l 5 . 5 locus encodes 2 major alternatively spliced transcripts. One mRNA codes for NUP98 and the other for a NUP98-NUP96 precursor. (B) The 98 kDa precursor is post-translationally cleaved at Phe863 to form the functional NUP98 protein. The 186 kDA precursor is also cleaved at Phe863 to form NUP98 and NUP96  39  1.5.1  The nuclear pore complex NUP98 is one of 50-100 proteins comprising the nuclear pore complex (NPC), a large (120  x 10 Daltons) multi-protein complex required for nuclear / cytosolic transport (reviewed in 6  Fahrenkrog and Aebi, 2003; Vasu and Forbes, 2001). Molecules > 30-40 kDa cannot passively diffuse across nuclear envelope and must be selectively transported between the nucleus and cytoplasm. The structure of the NPC consists of a central transporter surrounded by a scaffold of 8 symmetrical spokes, 8 cytoplasmic filaments and 8 nuclear filaments which intersect at a distalring,called the nuclear basket. NTJP98 is located on the nucleoplasmic side of the NPC in a sub-complex with GLE2 as part of the nuclear basket. Of note, NUP214 is located in the cytoplasmic filaments, thus these 2 proteins belong to different structures in the NPC. 1.5.2  NUP98 and nuclear transport NUP98 belongs to a subgroup of NPC proteins which contain FXFG, FG or GLFG repeats  in the N-terminus that act as docking sites for transport receptors. This presumably allows movement of cargo through the pore by docking via a series of association and dissociation reaction to the repeats of the various NUPs which are found the entire length of the NPC. 1.5.2.1 Nuclear import Transport of many RNAs and proteins across the nuclear pore involves transport receptors termed Karyopherins (Kaps) and RanGTPase (Kau et al., 2004). In the cytosol the transport receptor karyopherin-a (Kap-a) binds the classical nuclear localization signal (NLS) of transport cargo forming a complex. Karyopherin-/31 (Kap-/31) binds to the Kap-a/NLScontaining protein and the trimeric complex is targeted through the nuclear pore by a yet undefined mechanism. Once in the nucleus, RanGTP binds to Kap-/31 to dissociate the complex and release the NLS protein. The concentration of RanGTP remains high in the nucleus through hydrolysis of RanGDP by RanGEF (RCC1). Kap-/31 and RanGTP are recycled back to the 40  cytoplasm while Kap-o; is bound by CAS, a nuclear export receptor and is shuttled back in a complex with RanGTP. Other members of the Kap-/3 family act as import receptors for other classes of proteins that have the non-classical NLS. Of particular interest is Kap-/32 which binds directly to the NLS of hnRNP Al (Fontoura et al., 2000). This NLS, termed M9, has a sequence rich in glycine and aromatic residues. NUP98 competes with the hnRNPAl M9 sequence for binding to Kap(32, suggesting that NUP98 can dissociate the cargo from Kap-/32. Moreover, RanGEF binds to NUP98 at a site adjacent to the Kap-/32 binding site. Fontoura et al. proposed a model in which the import substrate is released from Kap-/32 in the nucleus by competitive binding of NUP98 to the M9-like site (Fontoura et al., 2000). The NUP98-bound RanGEF catalyzes the formation of RanGTP which subsequently dissociates Kap-/?2 from NUP98 allowing repetition of the import cycle. Whether this role of NUP98 in nuclear import is involved in leukemogenesis awaits further experimentation. However, one can hypothesize that if some protein required for normal hematopoietic differentiation is not properly imported, its disrupted expression may promote transformation. 1.5.2.2 Nuclear export Nucleoporins also have a specific role in nuclear export. Cargoes to be exportedfromthe nucleus contain a leucine-rich nuclear export signal (NES) and are subsequently recognized by the export receptor CRM1, a member of the karyopherin-/3 family (Kau et al., 2004). RanGTP forms a complex with cargo-bound CRM1 and is transported through the nuclear pore into the cytosol. Hydrolysis of RanGTP to RanGDP via RanGAP, promotes complex dissociation and CRM1 and the NES-containing protein are released. It has been demonstrated that both DEKNUP214 and SET-NUP214 fusions interact with the hCRMl export factor. Moreover, nuclear export of an hCRMl regulated protein was prevented in cells that express SET-NUP214 (Saito 41  et al., 2004). While it has not been formally tested, we can hypothesize that cells expressing NUP98 fusions may also aberrantly affect nuclear export thus preventing proper expression of a protein required for normal hematopoiesis. 1.5.3  NUP98 knock out experiments Targeted knock out of murine Nup98, demonstrates that Nup98 is essential for mouse  gastrulation (Radu et al., 1995; Wu et al., 2001). Homozygous mutant mice were embryonic lethal at E8.5, however, this early time of lethality precluded any examination of hematopoietic defects. The Nup98~'~ E8.5 embryos displayed significantly delayed development, having a similar size to E6.5 -7.5 day old embryos. Moreover, histological analysis revealed the embryos to be highly disorganized having defects in morphogenesis, proliferation and pattern formation. In vitro culture of E8.5 Nup98~'~ embryos gave rise to epithelium-like cell lines over a long period of time (80-100 days vs. 10-20 days for Nup98  +/+  embryos) demonstrating that Nup98 is  not essential for basal cell growth. Many transport receptors including Kap-a, Kap-/5, Crml, Kap/32 had reduced efficiency for targeting to the nuclear pores of Nup98~'~ cells. Moreover, nuclear import of proteins containing both the classical SV40-like and M9-like NLS, was lower in the Nup98 mutant cells. While other nucleoporins may partially compensate for lack of Nup98, we cannot rule out that a hemizygous state such as that resulting from translocations may alter nuclear shuttling. No phenotype has been described for NUP98 heterozygotes, thus the effects of having only one functional allele are unknown. 1.5.4  NUP98 cellular localization NUP98 is localized within the cell both at the nuclearrimand within the nucleus (Griffis et  al., 2002; Radu et al., 1995). Within the nucleus it has been shown to associate with novel nuclear bodies defined as GLFG bodies, as the repeat domain of NUP98 is required for its nuclear localization. Whether these bodies are novel structures or are self aggregates of NUP98 42  is yet undetermined. The subcellular localization of several NUP98 fusions has been reported as nuclear (Kroon et al., 2001) (and results contained in this thesis), with no evidence of a nuclear rim stain or nuclear body aggregates. That NTJP98 fusions are not localized to sites of NTJP98 suggests that these fusions may have a novel function to that of NTJP98. Moreover, NUP98 is a mobile protein that shuttles within cells between the nucleus and the nuclear pore, and its movement is dependent on ongoing RNA transcription (Griffis et al., 2002). Further studies revealed that unlike most nucleoporins which are localized exclusively to one side of the nuclear pore, NUP98 can be found on both the nuclear and cytosolic face of the nuclear pore (Griffis et al., 2003). The C-terminal portion of NUP98 contains sequences that are likely responsible for its binding to the pore. As this portion is lost in the leukemic fusion genes, it further suggests that NUP98 fusions cannot function like wild-type NUP98 and consequently have a novel function.  1.6  The multi-hit hypothesis in the pathogenesis of leukemia It has been proposed that more that one genetic alteration is required for the pathogenesis of  acute leukemia. Expression of a single genetic abnormality such as a chromosomal translocation has often been insufficient to generate the full leukemic effect in murine models. Dr. D. Gary Gilliland proposed a two-hit model of pathogenesis (Kelly and Gilliland, 2002). He proposes that leukemia occurs as the consequence of collaboration between two distinct classes of mutations. The Class I mutations confers a survival or proliferative advantage to hematopoietic progenitors. Included in this class would be the tyrosine kinase fusion genes (BCR-ABL, TELPDGFB.R) or constitutively activated FLT3. The Class II mutations act to impair hematopoietic differentiation and to prevent the subsequent apoptosis of cells that fail to undergo terminal differentiation. This class of mutations includes fusion genes such as AML1-ETO, CBF- MYH11 43  and NUP98-HOXA9, as well as mutations to hematopoietic transcription factors such as AML1 and C/EBPa. According to this hypothesis, leukemogenesis occurs as the collaborative effect of 2 "hits", one from each of these complementation groups. Several strategies have been employed to search for complementing or co-operating genes that synergize in the pathogenesis of leukemia. In the following sections I describe select examples of fusion genes that alone are insufficient to induce a rapid leukemia, and the strategies that were utilized to identify collaborating genetic events. 1.6.1  The candidate gene approach  1.6.1.1 Collaborating genes for TEL -AML1 The TEL-AML1 fusion is one of the most common translocations observed in pediatric leukemias, seen in about 25% of childhood ALL (Romana et al., 1995). The fusion gene occurs during fetal hematopoiesis and is believed to be the first "hit" that is necessary but not sufficient for the overt leukemia. The additional secondary mutations are believed to occur in the postnatal period. Evidence that expression of TEL-AML1 requires additional co-operating mutations is garnered from retroviral expression of the fusion in murine BM (Bernardin et al., 2002). Transplanted mice develop an ALL, however it is with a long latency and does not occur in 100% of the mice. Inactivation or deletion of the overlapping tumor suppressor genes  pl6  INK4a  and p l ^ occurs in a large percentage of B- and T-cell leukemias. The TEL-AML1 fusion was thus introduced into BM lacking expression of the pl6  ,NK4a  and p!9  ARF  genes to ascertain the  collaborative potential. Strikingly, the incidence and rapidity of ALL was increased in TELAMLl/pl6/pl9 mice compared with expression of the fusion in normal BM. Thus, in accordance with the clinical observations, TEL-AML1 alone is insufficient for leukemogenesis. To gain further insight into the first-hit function of TEL-AML 1, a murine model was generated and analyzed for alterations in B-cell development (Tsuzuki et al., 2004). These results suggest 44  that the first "hit" induced by TEL-AML1 is to inhibit the differentiation pathway of Blymphocytes and thus acting as a Class II mutation. 1.6.1.2 Genes that collaborating with PML-RARa The PML-RARa fusion gene is the result of t(15;17) associated with > 95% of the cases of acute promyelocyte leukemia (APL). Transgenic mice generated by expressing the PMLRARa fusion gene under the control of the cathepsin G promoter developed a non-fatal MPD (Grisolano et al, 1997). Following a latency of 6-13 months, 15-20% of the animals developed an APL-like disease. This incomplete penetrance coupled with the long latency suggests that expression of the PML-RARa transgene alone is not sufficient to directly cause AML in mice and that acquisition of additional genetic changes is necessary for the full leukemogenic effect. The candidate gene approach was utilized to test several genes for their ability to collaborate with PML-RARa in the induction of APL. The reciprocal fusion, RARa-PML, is found in -70-80% of t(15;17) patients, suggesting that its expression may collaborate with PML-RARa induce APL. However, while the penetrance increased to 60% when both transgenes were expressed in myeloid cells of mice, no decrease in the disease latency was observed (Pollock et al., 1999). This suggested that RARa-PML does not act as a classical second hit in the induction of APL associated with PML-RARa. Recent reports have shown that activating mutations to the FLT3 receptor tyrosine kinase are present in -40% of t(15; 17) patients (Pollock et al., 1999). These include internal tandem duplications (ITD) in FLT3 (FLT3-ITD) which generates constitutively activated FLT3 tyrosine kinases and are found with high frequency in AML cases. The collaborative potential of PML-RARa and FLT3-ITD was tested by expressing FLT3-ITD in BM harvested from transgenic PML-RARa mice, followed by transplantation into syngeneic recipient mice (Kelly et al., 2002). Strikingly, 100% of the mice succumbed to an APL-like disease with a significantly 45  reduced latency (40-210 days) compared to mice receiving BM expressing PML-RARa alone or PML-RARa transduced with control virus. These results demonstrate that FLT3-ITD cooperates with PML-RARa in the induction of APL and further highlights the power of the candidate approach to test potential collaborating genes. 1.6.1.3 NUP98-HOX fusion co-operating genes As mentioned previously, leukemia induced by retroviral over-expression of either NUP98-HOXA9 or NUP98-HOXD13 in a BM transplantation model has a relatively long latency (Kroon et al., 2001; Pineault et al., 2003). Meisl was chosen as a candidate collaborating gene for NUP98-homeobox fusions based on several lines of supporting evidence. Firstly, a leukemogenic collaboration between Meisl and Hox genes is suggestedfromthe BXH-2 mice as Meisl along with Hoxa7 or HoxaP is afrequenttarget of endogenous retroviral insertional activation in the leukemic cells of these mice (Nakamura et al., 1996b). Secondly, Meisl has previously been shown to accelerate the onset of leukemia induced by Hoxa9 (Kroon et al., 1998) and HOXB3 (Sauvageau et al., 1997). Emphasizing the power of selecting candidate genes, co-expression of Meisl accelerated the onset of leukemia induced by either NUP98-HOX13 or NUP98-HOXA9. Whether Meisl acts as a specific collaborating gene for NUP98-HOX fusions or whether its expression is a general "second hit" in the induction of leukemia is currently unknown. It will thus be of interest to examine the collaborative potential of Meisl with other NUP98-non-HOX fusions such as NUP98-TOP1. Further evidence to support the "2 hit model of leukemogenesis" is garnered from experiments co-expressing BCR-ABL and NUP98-HOXA9 (Dash et al., 2002; Mayotte et al., 2002). The former is a representative of the Class I type of mutation known to confer a proliferative advantage and the latter can be considered a Class II mutation as it blocks the differentiation of myeloid precursors. Although it is rare, the NUP98-HOXA9 transcript has also 46  been identified in patients during the blast crisis of Philadelphia chromosome positive CML (Ahuja et al., 2001), thus BCR-ABL was chosen as a second candidate gene to potentially accelerate NUP98-HOXA9 induced leukemia. Two independent groups confirmed that BCRABL rapidly accelerates the onset of NUP98-HOXA9 leukemia (Dash et al, 2002; Mayotte et al., 2002). Co-expression of both fusions led to a rapid (21 days post transplant), fatal leukemia resembling the myeloid blast crisis of CML. When transplanted alone, NUP98-HOXA9 and BCR-ABL induced disease in >22 and 5-17 weeks respectively. Moreover, NUP98-HOXA9 cooperated with other tyrosine kinase fusion genes such as TEL-PDGFBR to induce a rapid myeloid blast crisis. These results coupled with the observation of a rapid leukemia with coexpression of Meisl, supports a model in which NUP98 fusions require additional genetic changes for pathogenic leukemia. 1.6.2 Mutagenesis 1.6.2.1 ENU-mutagenesis The CBF-MYH11 fusion genes resultingfrominv(16) is associated with AML subtype M4. A murine knock-in model demonstrated that homozygous expression of the fusion is embryonic lethal (Castilla et al., 1996). In contrast, chimeras expressing the fusion from only one allele have a defect in myeloid and lymphoid differentiation, but do not develop leukemia by one year (Castilla et al., 1999). To test whether additional genetic mutations are required for full leukemogenic transformation, chimeric mice where treated with N-ethyl-N-nitrosourea (ENU), a DNA alkylating agent that produces single base mutations with highfrequency(6 x 10" to 1.5 3  x 10"). Strikingly, 84% of chimeras treated with ENU several weeks after birth developed leukemia within 2-6 months of treatment. The AML1-ETO fusion gene resultingfromt(8;21) is one of the most common chromosomal translocations identified in AML patients. AML1-ETO knock-in mice died at 47  E13.5 from the absence of fetal liver definitive hematopoiesis owing to the dominant negative effects of the fusion on Amll function (Okuda et al., 1996; Yergeau et al., 1997). A conditional AML1-ETO knock in mouse line was generated to circumvent this lethality and to further study the effects of the fusion on adult hematopoiesis (Higuchi et al., 2002). Efficient expression of the transgene was achieved in adult BM cells, where it enhanced the replating efficiency of myeloid progenitors but failed to induce a block in their differentiation. Interestingly however, conditional expression oiAMLl-ETO  itself was insufficient to induce leukemia. To test whether  additional genetic events could induce leukemia, mice were treated with the ENU mutagen. Between 2-10 months following treatment, nearly 50% ofthe AML1-ETO mice developed hematopoietic malignancies compared to control treated mice lacking AML1-ETO expression. Taken together, these experiments provide evidence that co-operating mutations are required for core-binding factor induced leukemia. 1.6.2.2 Retroviral mutagenesis As mentioned previously, retroviral integration has been used successfully to identify novel genes involved in the pathogenesis of leukemia. Similar strategies of retroviral induced mutagenesis have been employed to identify co-operating genes involved in the multi-step progression of leukemia. As mentioned above, studies with the CBF-MYH11 chimeras demonstrate that while this fusion participates in leukemogenesis, additional co-operating events are required. In an attempt to identify which genes can co-operate with CBF-MYH11 in AML development, neonatal chimeras were inoculated with an amphotropic murine leukemia virus known to weakly induce hematopoietic malignancies (Castilla et al., 2004). Around 6 months post-treatment, 63% of the chimeric mice succumbed to leukemia while control inoculated mice remained disease free. The retroviral integration sites were cloned in attempt to identify cooperating genes. Of the 54 candidate genes identified, 6 were common insertion sites. This 48  screen provided novel evidence for the involvement ofPlag-1 and Plag-2 in leukemia as well as other genes previously implicated in pathways involved in apoptosis, cell cycle and cancer. In contrast to the BM transplantation model in which expression of NUP98-HOXA9 led to a lethal AML in all mice, only 10% of transgenic mice generated by expressing the fusion gene in the myeloid lineage developed AML (Iwasaki et al., 2005). To identify additional cofactors required for complete leukemogenesis, the transgenic mice were crossed with BXH2 mice harbouring an endogenous ecotropic murine leukemia virus. Retroviral integration site analysis was then used to identify possible novel co-factors. Besides Meisl, whose identification validated this approach, 50 other integration sites were identified, 5 of which are common sites leading to the identification of 6 novel candidate genes. These include Fcgr2b and Fcrl, Dnalc4, Conl and Con2. Future work to determine whether these or other novel targets collaborate with NUP98-HOXA9 to induce leukemia awaits further investigation. While it is clear that expression of fusion genes alone is sufficient to perturb normal hematopoietic development additional co-operating mutations are required for a rapid onset of leukemia.  1.7  Thesis objectives The NUP98-TOP1 fusion gene is an intriguing representative of the 16 fusion genes  identified for the diverse group of translocations involving NUP98. Most interesting is that unlike other genes commonly identified in leukemic translocations, neither NUP98 nor TOPI are transcription factors. Moreover, there is no known unique role identified for either NUP98 or TOPI in hematopoiesis. As such, elucidating the mechanisms of NUP98-TOP1 induced leukemia may provide novel insights into the pathogenesis of disease. Alternatively, the observation of overlapping functions with NUP98-HOX ox other fusions would suggest that 49  seemingly different genes can activate similar pathways and that some common mechanisms exists among the various fusion genes. Accordingly, the first aim of my thesis was to ascertain the effect of NUP98-TOP1 expression on in vitro and in vivo hematopoietic growth and differentiation. This would provide the first evidence of whether A I/P°S-non-homeobox fusions could induce similar leukemogenic /  effects to those documented for NUP98-HOX fusions. The second aim was to gain some functional insight into the mechanism of NUP98-TOP1 induced leukemogenesis. To this end a series of mutants were engineered to elucidate the critical domains required for its leukemogenic potential. Moreover, the sub-cellular localization of NUP98-TOP1 and the engineered mutants were assessed. The final aim of this thesis was to assess whether full leukemogenic potential of NUP98-TOP1 is dependent on collaborating genes and what genes might provide such collaboration. We first tested the candidate gene Meisl as it has previously been documented to accelerate the onset of leukemia induced by several NUP98-HOX fusions (Kroon et al., 2001; Pineault et al., 2003). Retroviral-integration site analysis provided us with evidence that disruption of ICSBP expression may collaborate with NUP98-TOP1, thus we tested whether expression ofNUP98-TOPl  on an ICSBP' ' background would accelerate disease onset. 1  50  Chapter 2 Methods and Materials 2.1  Mice and primary bone marrow cells Mice were bred and maintained in micro-isolator cages in the Joint Animal Facility of the  British Columbia Cancer Research Centre. All procedures were approved by the Animal Care Council of the University of British Columbia in accordance with the guidelines set forth by the Canadian Council on Animal Care. Donors of primary bone marrow cells were (C57Bl/6LyPep3b x C3H/HeJ)Fl ((PepC3)Fl) mice and recipients of this BM were (C57B1/6J x C3H/HeJ)Fl ((B6C3)F1) mice. Bone marrow was harvested from ICSBP""-C57BL/6J-Ly5.2 /  mice, frozen and shipped on dry ice (Collaboration with Dr. Carol Stocking, Hamburg, Germany). BM harvested from C57BL/6J-Ly5.2 mice was used as a control. C57BL/6J- Ly5.1Pep3b mice were used as recipients for this BM. For bone marrow transplantation experiments, recipient mice were lethally irradiated with 950 cGy from a Cs source prior to intravenous injection with 1- 5 x 10 transduced donor 137  5  bone marrow cells.  2.2  Retroviral constructs  2.2.1 NUP98-TOP1 The NUP98-TOP1 cDNA was composed of nucleotides 33-1686 of the NUP98 reference sequence (NM 139132.1) fused in frame to nucleotides 828-2580 of the TOPI reference sequence (NM 003286.2). This cDNA was cloned as an 3.3 kb EcoKl fragment upstream of an IRES - GFP linked cassette in a murine stem cell virus (MSCV) derived retroviral vector (Hawley et al., 1994) using standard procedures. An MSCV vector (MIG) carrying the LRES-GFP cassette only was used as a control. (GFP CTL) as previously described (Pineault et al, 2003). To generate a flag-tagged version of NUP98-TOP1, the flag sequence 51  within the pSuperCatch plasmid (Clontech, Palo Alto, CA, USA) was excised as a Hindlll Xhol fragment and cloned into the Hindlll site of pBlueScript vector (Stratagene, La Jolla, CA, USA) in which the BstXl-EcoKV  fragment was previously removed (pBS-flag). Using primers  to NUP98-TOP1 (Fwd 5'AGA CTC ATT TTG GGA TCC TT AAC AAA 3'; and Rev -5'AGA ACT CTG CCT CTC GAG ACT 3') the NUP98-TOP1 cDNA was inserted as a BamRl I Xhol fragment into pBS-flag, excised by Sstl /Xhol and ligated into the MIG vector. 2.2.2  NUP98-TOP1 mutants The catalytic mutant of NUP98-TOP1 engineered to abolish the TOPI active site (NT-  Y723F), was constructed using the QuikChange Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA USA) and primers designed to convert amino acid 723 of TOPI from tyrosine to phenylalanine (Fwd 5'ACC TCC AAA CTC AAT TTT CTG GAC CCT AGG ATC 3'; Rev 5'GAT CCT AGG GTC CAG AAA ATT GAG TTT GGA GGT 3'). The NUP98 5' and TOPI 3'portions of the fusion and NT AC-term mutant were amplified by polymerase chain reaction (PCR)frompBS-flag-NT as BamHl-Xhol fragments using the primers (NUP98 5'; Fwd, M13 fwd; and Rev, 5'-GGG TTT TTT CAA CTC GAG TTA CTC TTC CTT-3'; TOPI 3'; Fwd, 5'-CCT AAG AAG AAG GGA TCC GAT GGT-3'; and Rev, Ml 3 rev, and NT AC-term; Fwd, Ml 3 fwd; Rev, 5'-TGT CAG CTC GAG TAG CTA CTG CTG TAG-3'). The NTACD mutant was amplified as 2 fragments frompBS-flag-NT (NT CD 5' Fwd, M13F; Rev, 5'-TAG GAA TTT CCA CTT GGC GCC TTC-3'; and NT CD 3' Fwd, 5'-TGT AAC CAT CAG AGG GGA GAA CCA-3'; Rev, Ml 3 rvs) digested with BamRl-Narl or NarlXhol, respectively, and ligated into MIG. To generate the VP16-TOP1 fusion, the portion of TOPI found in the NUP98-TOP1 fusion was amplified by PCRfrompBS-flag-NT (VP16-TOP1 5' Fwd, 5'-CCT AAG AAG 52  GAA TTC GAT GGT AAA-3'; and Rev, Ml3 rev), digested with EcoRl-Xhol and ligated into the EcoKl-Sall sites of the pVP16 plasmid (Clontech). The VP16-TOP1 in frame fusion was excised as Bglll-Pstl fragment, blunted and ligated into the Hpal sites of the MIG vector. 2.2.3  Meisl The MSCV-IRES-YFP-Meisl construct was as described in (Pineault et al., 2003).  Briefly, a hemagglutinin (HA)-epitope tagged version of the Meisl a cDNA was cloned upstream of the enhanced yellow fluorescence protein (YFP) (Clontech) in an MSCV-LRES vector.  2.3  GFP expression vectors For fluorescent microscopy visualization, the 3.3-kb NUP98-TOP1 cDNA insert (or  mutant forms as described in this section) was excised as a BamHI-Xhol fragment from pBSflag and ligated in-frame (BglU-SalT) to the C-terminus of enhanced GFP (EGFP) in the pEGFPCl vector (Clontech).  2.4  Generation of retrovirus Helper free recombinant retrovirus was generated using supernatants from transfected  amphotropic Phoenix packaging cell line (Kinsella and Nolan, 1996) to transduce the ecotropic GP+E86 (Markowitz et al., 1988) packaging cell line as previously described (Kalberer et al., 2002).  2.5  Infection of primary murine bone marrow cells Bone marrow cells were harvested from mice treated 4 days prior with 150 mg / kg of 5-  fluorouracil (Pharmacia and Upjohn, Mississauga, ON, Canada) and prestimulated for 48 hours 53  in DMEM supplemented with 15% FBS in the presence of 6 ng/ml mIL-3, 10 ng/ml hIL-6 and 100 ng/ml mSCF. BM cells were transduced by co-cultivation for an additional 48 hours with irradiated (1500cGy X-ray) GP+E86 viral producer cells in the presence of 5 pg/ml protamine sulphate (Sigma, Oakville ON, Canada). Loosely adherent and non-adherent cells were recovered and injected immediately into the tail vein of recipient mice, used for in vitro assays as described below or cultured for an additional 48 hours to allow expression of GFP. All media components including growth factors were from StemCell Technologies Inc (STI), Vancouver BC, Canada.  2.6  In vitro liquid cultures and clonogenic progenitor assays For liquid culture assays, 1 x 10 cells were placed in DMEM supplemented with serum 5  and cytokines as described above. Every few days cultures were harvested, total cell numbers were evaluated, the proportion of GFP expressing cells was measured by flow cytometric analysis (FACSort, Becton-Dickinson, Mississauga, ON, Canada) and cells were plated back into culture at a density less than 2 x 10 cells/ml. Colony forming cells (CFC) were assayed in 5  methylcellulose (Methocult M3234, STI) supplemented with 10 ng/ml mIL-3, 10 ng/ml hIL-6, 50 ng/ml mSCF and 3 U/ml EPO. Colonies were scored microscopically 9-11 days after plating using standard criteria.  2.7  Colony forming unit spleen (CFU-S) assay Transduced (GFP ) donor BM cells were isolated 48 hours post-infection by FACS +  (FACS Vantage, Becton-Dickinson, Mississauga, ON, Canada) and their CFU-S content (Day 0) measured by transplanting 5000 GFP cells per lethally irradiated recipient mice. CFU-S +  numbers following 8 days of culture were determined by injecting the progeny of 250 - 2 x 10  5  54  input (Day 0) cells. Macroscopic spleen colonies were counted 12-days post injection following fixation in Telleyesnickzky solution (Dzierzak and de Bruijn, 2002).  2.8  DNA and RNA analysis Southern blot analysis was used to assess the presence and number of pro-viral  integrations using standard techniques. Genomic DNA was isolated with DNAzol (Invitrogen, Burlington ON, Canada) and digested with Xbal which cuts in the LTRs to release the provirus, or digested with EcoRX (GFP ctl) or Bglll (NUP98-TOP1 and NT-Y723F) to assess the presence of different clones. Total cellular RNA was isolated using Trizol (Invitrogen), and analyzed by Northern blot using standard techniques. Membranes were probed with a 731 base pair PCR generated fragment of pEGFP-Cl vector (Clontech, Palo Alto, CA) labelled with p dCTP. 32  2.9  Flow cytometry Flow cytometric analysis was performed using a FACsort. The red cells in peripheral  blood (PB) and single cell suspensions of BM or spleen were lysed with ammonium chloride and recovered nucleated cells were rinsed then incubated on ice with primary PE-labelled antibodies (Gr-1, Mac-1, B220, CD4/CD8, Ly5.1, Terl 19) purchasedfromPharmingen, San Diego CA.  2.10 Cytospins and PB smears Morphologic analysis of PB, BM and spleen cells was carried out on modified WrightGeimsa stained smears and cytospin preparations.  55  2.11 Cell transfections and Western blot analysis NUP98-TOP1 (and mutants) was expressed in 293T cells by calcium-phosphate transfection (CellPhect Transfection Kit, Amersham Biosciences, Buckinghamshire England). Whole cell lysates were solubilized 48 hours post-transfection with SDS sample buffer, electrophoresed on 8% SDS-PAGE gel and blotted to PVDF membranes (Pall Corporation, Ann Arbor MI). Membranes were probed with an anti-GFP monoclonal antibody (Roche Diagnostics, Indianapolis, IN) and donkey HRP-conjugated antimouse antibody (Jackson ImmunoResearch Lab, West Grove PA). Protein expression was detected with Western Lightning Chemilluminescence Reagent Plus (Perkin Elmer, Boston MA). To assess the subcellular localization of NUP98-TOP1, 293T cells were grown on polyL lysine (Sigma) treated coverslips and transfected as described above. Cells were fixed with 4% para-formaldehyde and stained with 2 ng/ml of DAPI. Cells were visualized with a Zeiss axioplan microscope and analysed with Applied Imaging software (Santa Clara, CA).  2.12 Identification of Retroviral Integration Sites This protocol was adapted from the method previously reported by (Riley et al., 1990). Genomic DNA (1/ig) from leukemic NTJP98-TOP1 mice was digested with PstI and the fragments were ligated overnight at room temperature to a double stranded bubble linker (PstI linker Top 5'CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTCCTGCA - 3' and PstI linker bottom 5'AAGGAGAGGACGCTGTCTGTCGAAGGGTAAGGAACGGACGAGAGAAGGGAGAG3').The bubble linker contains a 29-nucleotide non-homologous sequence (underlined) that prevents binding of the linker primer in the absence of minus strand generated by the GFP56  specific primer corresponding to the GFP sequence within the MSCV retroviral vector. Nested PCR was performed on one tenth of the ligation products. PCR-A used a linker specific primer (Vectorette primer 224 5' - CGAATCGTAACCGTTCGTACGAGAATCGCT -3' and a GFPspecific primer (GFP-A 5'- ACTTCAAGATCCGCCACAAC -3') under the following conditions: one cycle of 94 C for 2 minutes, 30 cycles of 94 C for 30 seconds, 65 C for 30 0  0  0  sec, 72° C for 2 minutes, and 1 cycle of 72 ° C for 2 minutes. A 1 fil aliquot of PCR-A reaction product (one-twenty-fifth) was used as a template for the second nested PCR (PCR-B) using Nested Linker Primer B (5'- TACGAGAATCGCTGTCCTCTCCTT -3') and a GFP-specific primer (GFP-C 5'- ACATGGTCCTGCTGGAGTTC -3') under the same conditions described for PCR-A. The products of PCR-B were separated by gel electrophoresis on a 1.5% Agarose / TAE gel. Individual bands > 550 base pairs were excised and purified using the Qiaex II Gel Extraction Kit (QIAGEN) then subcloned into the PCR4 vector using the PCR4 TOPO Cloning Kit according to the manufacturer's protocol. The TOPO ligation product was transformed with 25 pi TOP 10 Chemically Competent Cells. DNA was extracted from Ampicillin resistant colonies by standard procedures and digested with Kpnl and EcoRI to select for LTR containing clones. Digestion with Kpnl and PstI was performed to determine orientation and to aid in selection of sequencing primers. Positive clones were sequenced from either the T3 or T7 primers depending on orientation. Sequence results that contained both the PstI linker sequence and the MSCV 3'LTR were believed to contain captured genomic DNA sequence which was further analysed by BLAT Search using the UCSC Mouse Database: (http://www.genome.ucsc.edu/).  57  2.13 Statistical analysis Data was analysed statistically using the Students T-test (Microsoft Excel). Differences of p<.05 were considered statistically significant.  58  Chapter 3  The NUP98-Topoisomerase I AML-associated fusion gene induces  a lethal, transplanted A M L in murine bone marrow.  The material presented in this chapter has been reported in the manuscript: Gurevich RM, Apian PD, Humphries RK. The NUP98-Topoisomerase / AML-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation. Blood. 2004 Aug 15;104(4):1127-36.  59  3.1  Introduction A heterogenous group of hematopoietic malignancies have recently been described which  are characterized by chromosomal translocations that create fusion genes involving the Nterminal portion of the nucleoporin gene, NUP98, on chromosome 1 lpl5 (Lam and Apian, 2001). To date, 15 distinct fusion partners have been identified in NUP98 translocations. The most frequently observed fusion partners for NUP98 belong to the homeobox family of transcription factors and include HOXA9, (Borrow et al., 1996; Nakamura et al., 1996a), HOXD13 (Raza-Egilmez et al., 1998), HOXD11 (Taketani et al., 2002b), HOXA11 (Suzuki et al., 2002a), HOXA13 (Fujino et al., 2002; Taketani et al., 2002a), HOXC11 (Taketani et al., 2002c) and HOXC13 (Panagopoulos et al., 2003) as well as the non-clustered homeobox gene PMX1 (Nakamura et al., 1999). Recent studies in murine model systems have clearly demonstrated that both NUP98-HOXA9 and NUP98-HOXD13 play a causal and overt role in the pathogenesis of leukemia (Kroon et al., 2001; Pineault et al., 2003). Furthermore, the disease onset can be greatly accelerated in these models by co-expression of the NUP98-HOX fusion gene and the HOX co-factor Meisl. These reports are consistent with the observations that HOX genes play key roles in the regulation of hematopoiesis and that over-expression of select HOX genes (e.g. HOXA10 (Thorsteinsdottir et al., 1997), HOXB3 (Sauvageau et al., 1997)) lead to leukemia. In addition to the HOX genes, seven "variant" partner genes that are associated with a wide range of biological functions have been identified in fusion with NUP98 in hematopoietic malignancies. These include DDX10 (Arai et al., 1997; Ikeda et al., 1999), RAP1GDS1 (Hussey et al., 1999; Mecucci et al, 2000), Topoisomerase I (Ahuja et al., 1999), LEDGF(Ah\i)a et al., 2000), NSD1 (Jaju et al., 2001), NSD3 (Rosati et al., 2002) and Adducin 3 (Lahortiga et al., 2003). These NUP98 fusion partner genes are diverse in function and, in contrast to the HOX 60  fusion partners, are not known to have a specific or unique function in hematopoiesis. An intriguing example of one such non-HOXpartner is Topoisomerase I (TOPI), a ubiquitous enzyme identified as the NUP98 fusion partner in t(l l;20)(pl5;ql 1) (Ahuja et al., 1999). The t(l 1;20) translocation has been described in patients with polycythemia vera, t-MDS, and acute myeloid leukemia (Berger, 1972; Betts et al., 1998; Chen et al., 2003; Felix et al, 1995; Felix et al., 1998; Iwase et al., 2003; Mitelman et al., 1988; Prigogina et al., 1986; Raimondi et al., 1999). TOPI is a ubiquitously expressed protein initially recognized for its role in the unwinding or relaxing of supercoiled DNA (reviewed in Pommier et al., 1998; Wang, 1996; Wang, 2002). This activity is dependent on an active site tyrosine located in the Cterminus, (Madden and Champoux, 1992) which forms a phosphodiester bond with the 3' strand of DNA and generates transient, single stranded DNA breaks. Through the generation of DNA topological transformations, TOPI has been implicated in cellular processes including DNA replication, transcription, recombination and chromosome condensation, and has further been targeted clinically by the anti-cancer agent camptothecin and its derivatives (Pommier et al., 1998). Interestingly, TOPI has also been reported to function independent of the active site tyrosine and catalytic unwinding activity as a splicing factor kinase (Rossi et al., 1996; Rossi et al., 1998), a transcriptional co-factor (Kretzschmar et al., 1993; Merino et al., 1993; Shykind et al., 1997) and a p53 interacting protein (Albor et al., 1998; Gobert et al., 1996). The contribution of NUP98 to leukemic transformation is largely unknown. While many genes recurrently rearranged in leukemia encode transcription factors, NUP98 is a ubiquitously expressed member of the nuclear pore complex (NPC) and functions in the nuclear-cytosolic transport of RNA and protein complexes (Radu et al., 1995). Intriguingly, all NUP98 fusions reported to date retain the FG repeat motif in the N-terminus, known for their role in the docking of import substrates. 61  In the NUP98-TOP1 fusion protein generated from t(l 1 ;20), the N-terminal portion of NUP98 (amino acid 1-514) is fused to the majority of TOPI (amino acids 170-765) including the core, linker and catalytic domains (Figure 3.1 A). Given the seemingly different function of TOPI compared to HOX genes, we wished to ascertain whether NUP98-TOP1 as a single agent is sufficient to perturb hematopoietic growth and differentiation.  3.2 3.2.1  Results NUP98-TOP1 enhances the expansion of hematopoietic cells in vitro The NUP98-TOP1 cDNA used in this study represents the fusion gene found in the  tMDS/AML- associated t(l l;20)(pl5;ql 1) (Ahuja et al., 1999). The integrity of the cDNA was confirmed by DNA sequencing and by transfection of NUP98-TOP1 as a GFP-C-terminal fusion into 293T cells (Figure 3. IB). Fluorescent microscopy analysis of these cells revealed a primarily nuclear localization for GFP-NUP98-TOP1, in contrast to GFP alone or a fusion between GFP and the signaling molecule SHIP used as a control for pancellular and cytosolic localization respectively (Figure 3.1C). To study the impact of NUP98-TOP1 expression on hematopoietic growth and differentiation, the fusion gene was introduced into primary murine BM using an MSCV-based retrovirus carrying the NUP98-TOP1 cDNA upstream of an LRES-linked GFP selectable marker (Figure 3.ID).  62  CORE  LINK  180  C-TERM  130 —  FXFG  GLEBS  CORE  FXFG  LINK  C-TERM  100 — 35 — 22—  A  B  1  X  D  G  X  I  |M| 1  pEGFPCI  GFPNUP98-TOP1  DAPI & GFP  GFP  DAPI  GFP  SB  CTL  | LTR  I |  1 I R E S [ GFP  |  | LTR  |  1  NUP98-TOPl|_tTg_|—(NUP98-TOPI|-H E S j G F P | I R  1 LTR |  i  GFP-SHIP  Figure 3.1 NUP98-TOP1 fusion protein demonstrates nuclear localization. (A) Schematic representation of NUP98, TOPI and NUP98-TOP1. Fusion breakpoints are indicated with vertical arrows. Functional domains of NUP98 include: F X F G repeats (hatched bars), GLEBS domain (open box) and RNP-binding domain (vertical stripes). TOPI functional domains comprise: N-terminal nuclear localization signals (NLS), core domain (solid box), linker (open box) and C-terminus (checkered). (B) Western blot analysis of total cell lysates from calcium-phosphate transfected 293T cells detected by antiGFP antibody. Cells were transfected with GFP-fusion constructs as described in Materials and Methods. Arrows indicate the size of the expected full-length NUP98-TOP1 protein (150 kDA) and a smaller processed fragment. (C) Fluorescent microscopy images of 293T cells transfected as in (B). Panels A, D, G depict cells stained with DAPI for visualization of nuclei; panels B, E, H show visualization of GFP expression; C, F, I shows the overlay of DAPI and GFP. Top row (A-C) results with empty pEGFP-Cl vector demonstrating pan-cellular GFP expression in nucleus and cytosol. Second row (D-F) results with GFP-NUP-TOP1 fusion showing that NUP98-TOP1 directs nuclear expression. Bottom row (G-I) results with GFP-SHIP used as positive control for cytosolic localization. (D) Retroviral vectors used to express NUP98-TOP1 in murine bone marrow. The expected sizes of full length pro-viral transcripts are indicated. Abbreviations: LTR, long terminal repeats; GFP, green fluorescent protein; IRES, internal ribosomal entry site.  63  Immediately following retroviral infection and without any pre-selection, BM cells transduced with GFP control or NUP98-TOP1 were plated in liquid culture suspensions supplemented with mIL-3, hIL-6 and mSCF. As depicted in Figure 3.2A, the proportion of GFP cells in the control cultures remained similar to input levels following extended culture. In +  contrast, NUP98-TOP1 GFP cells comprising -1% of the population at the time of infection, +  strongly out-competed the growth of non-transduced cells, expanding to >80% of the culture by 28 days. This was a cell autonomous effect evidenced by a decreased doubling time for NUP98TOP1 GFP transduced cells, while the non-transduced (GFP") cells in the NUP98-TOP1 culture +  cells had a doubling time similar to the GFP and GFP" populations in the control culture +  (Figure 3.2B). Following 4 weeks of culture, NUP98-TOP1 cells displayed a blast-like morphology on cytospin preparations (Figure 3.2C) suggesting that NUP98-TOP1 induces a block in differentiation. Metaphase spreads were prepared from control uninfected, NUP98HOXD13 and NUP98-TOP1 infected BM cells cultured for greater than 4 weeks. No abnormalities in chromosome number or gross chromosomal rearrangements were observed, suggesting that expression of NUP98-TOP1 does not induce obvious genomic instability (data not shown).  64  Figure 3.2 Expression of NUP98-TOP1 in murine bone marrow confers in vitro proliferative advantage. (A) NUP98-TOP1 expression results in expansion of transduced (GFP+) B M cells in liquid cultures. Graph is representative of 3 independent experiments. (B) Expression of NUP98-TOP1 leads to decreased doubling time (Td) calculated from the slope of the curve representing change in cell number over time. (C) Representative Wright-Geimsa stained cytospin preparation of GFP C T L (left) or NUP98-TOP1 (right) transduced bone marrow cultured for 4 weeks (Original magnification, x 600).  65  The proliferative effect of NUP98-TOP1 was further evident in hematopoietic precursors assayed for colony formation in methylcellulose. No statistically significant differences were observed in CFC numbers or colony type between control and NUP98-TOP1 GFP purified BM +  cells plated immediately following sorting. However, upon secondary replating, NUP98-TOP1 cells gave rise to large granulo-monocytic (GM) colonies (1394.5 ± 427 secondary colonies per primary colony; ~5% of plated cells harvestedfromthe primary culture gave rise to secondary colonies), in contrast to mast cell colonies derivedfromGFP control cells (data not shown). 3.2.2 NUP98-TOP1 induces a competitive myeloid growth advantage in vivo To assess the effects of NUP98-TOP1 expression in vivo, mice were transplanted with 5 x 10  5  unselected BM cells 48 hours post infection. The initial proportion of GFP cells in the +  transplant inoculum rangedfrom7-55 % for GFP control and -1-4% for NUP98-TOP1 in four independent experiments. In mice transplanted with GFP control transduced BM, the proportion of GFP cells in the PB remained relatively constant over time (Figure 3.3A). In contrast, +  analysis of mice transplanted with NUP98-TOP1 transduced cells revealed a large increase in the proportion of GFP PB cells, expandingfroman initial transplantfrequencyof less than 4% +  to greater than 40% by 4 weeks and rising ultimately to greater than 80% at 24 weeks post transplant. This increase in the proportion of GFP PB cells in NUP98-TOP1 mice was associated +  with a progressive increase in the number of circulating white blood cells (Figure 3.3B). As early as 2 months post-transplant, NUP98-TOP1 mice displayed a significant increase (p<.05) in the average number of circulating white blood cells (mean 15.8 x 10 cells/ml; range 6.3-30 x 6  10 cells/ml) compared to control GFP mice (mean, 7.0 x 10 cells/ml; range, 3.1-8.6 x 10 6  6  6  cells/ml). By 6 months post-transplant, the WBC numbers in NUP98-TOP1 mice increased  66  further, reaching an average of 75.6 x 10 cells/ml (range, 9.1- 201 x 10 cells/ml). 6  6  Differential counts performed on Wright-Geimsa stained peripheral blood smears revealed that NUP98-TOP1 induced a significant increase in the proportion of mature myeloid cells by 2 months post transplant (59.2 ± 15.2% vs. 27.8 ± 7.5 in ctl, p<.005) which was further exacerbated at 6 months (83.5 ± 6.8% vs. 21.9 ± 6.1% in ctl, p<.005) (Figure 3.3C). Morphologically, the PB cells were predominantly segmented neutrophils consistent with a myeloproliferative-like disorder (Figure 2.4E). Flow cytometric analysis of PB with lineage specific markers confirmed that NUP98-TOP1 expression led to an increase in the proportion of transduced (GFP ) myeloid cells (Mac-1 and Gr-1 ), which resulted in an increase in the +  +  +  absolute numbers of circulating myeloid cells (Figure 3.3D and data not shown). While the proportion of GFP transduced B-cells (B220 ) and T-cells (CD4 /CD8 ) in the NUP98-TOP1 +  +  +  +  mice were significantly reduced compared to control, the absolute numbers of circulating lymphoid cells were comparable to control (p=.06) (Figure 3.3D). Moreover, while some NUP98-TOP1 mice showed increased numbers of GFP B220 circulating cells, this population +  +  of cells exhibited a different profile (B220 ) on FACS analysis and were further determined to 10  be Mac-1 /B220 . +  +  67  B  p=.04  1.E+09 p=.04  1.E+08  •  •  t *  1.E+07 | :  o  • A  p= 03 *  •  1  •  0  •  g  0  1.E+06  50 100 150 Days post transplant Differential counts  200  68  132 173 Days post transplant  D  B220  Mac-1 1x10i_  GFP CTL  NUP98-TOP1  GFP CTL  2 I mo O>1X10«-  GFP" GFP*  GFP CTL E  1 2 3 4 5 6 7 8 9  NUP98TOP1  Sr. * ••  10  1 2 3 4 5 6 7 8 9  10  0  0%  *0 Figure 3.3 NUP98-TOP1 expression leads to in vivo myeloproliferation. (A) NUP98-TOP1 leads to in vivo proliferative advantage as assessed by increased peripheral blood GFP+ content at various times post transplant. Graph is representative of 4 independent experiments with at least 4 mice in each group (mean ± SD). Open, GFP CTL; Filled, NUP98-TOP1 (B) NUP98-TOP1 leads to a progressive increase in PB white cell counts. Results are shown for individual mice in a representative experiment. Median values are depicted with a horizontal line. Open, GFP CTL mice; Filled, NUP98-TOP1 mice. (C) Differential counts performed on Wright-Geimsa stained PB smears of mice at 2 (upper) and 6 (lower) months post-transplant. Counts are the average of 3 or 5 C T L GFP or NUP98-TOP1 mice respectively. Hatched, Lymphoid cells; Filled, Myeloid. (D) Representative experiment depicting PB of 5 mice stained with antibodies to Mac-1 and B220 at 2 months (upper panel) and 6 months (lower panel) post transplant. Solid bars represent transduced (GFP+) cells, hatched bars are GFP-. Mice # 1-5, GFP CTL; mice # 6-10, NUP98-TOP1. (E) Representative Wright-Geimsa stained PB smear of NUP98-TOP1 mouse at 6 months post-transplant. Original magnification x 1000. See Figure 3.5B for control.  68  The NUP98-TOP1 mice became progressively anemic with an average red cell count of 2.20 ± 3.4 x 10 cell/ml at 6 months (p<.002) (Table 3.1). In four independent experiments, 9  13/17 mice did not show any transduced (GFP ) red cells, while 4 mice had RBCs that were +  equal in GFP content to that observed in the white cells. These observations provide evidence that in vivo, NUP98-TOP1 induces a strong proliferative advantage to non-erythroid myeloid cells.  Table 3.1 Hematopoietic characteristics of moribund mice  NUP98-TOP1  C F U - S per femur x 10  1.13 ± .75  .15 ± .06  3.47 ± .47  1.4 ± . 7  .22 + .34  .67 ±.24  72 ± 6 4  9.8 ± 8 . 9  RBC/ml xlO  7.16 + 2.23 152 ± 210  6  GFP C T L  (g)  C F C per femur x 10  WBC/ml x 10  1 0  Spleen Weight  4  3  ND - Not done Values indicate mean SD  3.2.3 NUP98-TOP1 induces a lethal myeloid leukemia Ultimately, all NUP98-TOP1 mice (n=17) became moribund and were sacrificed or died with a median survival of 233.5 days (range 149-321 days) post transplant (Figure 3.4A). Southern and Northern blot analysis of diseased mice revealed full-length NUP98-TOP1 proviral integration and expression (Figure 3.4B, C). The disease was mono- or oligo-clonal in nature (Figure 3.4D), however, this may in part be due to the initial low gene transfer efficiency.  69  P  NUP98-TOP1 EXP 2-7 •jo  2°  2°  EXP 9-7 1° 2°  EXP 9-9 1° 2°  Figure 3.4 NUP98-TOP1 expression induces a lethal leukemia. (A) Survival curve for mice transplanted with CTL GFP transduced cells (dashed line n=10) or NUP98TOP1 transduced cells (solid line n=17, average latency 225 ± 56 days). Secondary recipients transplanted with 102-106 primary B M cells succumbed to disease with reduced latency (42-147 days). (B) Southern blot analysis of genomic DNA from primary mice reveals full length proviral integration. DNA was digested with Xbal which cuts once in each LTR. (C) Northern blot analysis of total RNA from NUP98-TOP1 mice. (D) Southern blot analysis reveals that NUP98-TOP1 induces mono- or oligo-clonal disease which is transplantable to secondary recipients. The labeling indicates the experiment number and the mouse used to transplant secondary recipients. Genomic DNA from moribund mice was digested with Bglll (NUP98-TOP1) or EcoRI (NT-Y723F) which cut once in the provirus sequence. Membranes were hybridized with a probe specific to GFP.  70  Flow cytometric analysis of moribund NUP98-TOP1 mice demonstrated an increased proportion of myeloid cells (Gr-1 , Mac-l ).in the PB, BM and spleen, and a reduction in +  +  Terl 19 BM cells (Figure 3.5A). Interestingly, several mice (n=5) had BM cells that were >90% +  for B220, however these cells exhibited a lower fluorescent intensity than control B220 cells +  suggesting they are of a different population, and we thus describe them as B220 . Many of the lo  NUP98-TOP1 PB, BM and spleen cells were morphologically "immature forms/blasts", consistent with the diagnosis of a myeloid leukemia (Kogan et al., 2002) (Figure 3.5B). The BM from NUP98-TOP1 mice showed greatly increased numbers of both CFC (20-fold; p<.004) and spleen-colony-forming cells (5-fold increased; p<.03) compared to controls and the mice had marked splenomegaly (0.67 ± .24 grams) (Table 3.1).  71  B  PB h  GFP  BM  GFP CTL  GFP CTL  PB  t  ;II  1  o  1 o'  10  1  if  CM  03  i  * o o& o «V °° ° l l •<>• 0  BM  rf  1, 9'  »TS  >  9  •.  s  f  NUP98-TOP1  NUP98-TOP1  I  1*.  CTL  #  If..  SPL  —  GFP  GFP  Figure 3.5 Immunophenotype of hematopoietic cells from NUP98-TOP1 mice. (A) Representative FACS profiles of PB (left panel) and B M (right panel) from a GFP control and diseased NUP98-TOP1 mouse. (B) Wright-Geimsa stained PB smear, B M and spleen cytospin (original magnification, 600X).  3.2.4  NUP98-TOP1  l e u k e m i a is t r a n s p l a n t a b l e a n d d e c r e a s e s t h e l a t e n c y p e r i o d  The NUP98-TOP1 induced leukemia was transplantable with all secondary recipients showing greatly elevated numbers of circulating GFP nucleated cells having an immature +  myeloid/monocytic blast-like morphology. The disease course in secondary animals was accelerated compared to primary recipients (Figure 3.4A), with a maximum survival of less than 77 days and less than 147 days with a transplant dose of 1 x 10 or 1 x 10 BM cells, 5  3  respectively (Table 3.1). Southern blot analysis confirmed full length pro-viral transmission in secondary recipients and revealed that the same clone present in primary donors was present and un-rearranged in secondary animals (Figure 3.4D). Moreover, transplanting as few as 100 BM cells from a diseased primary animal along with 5 x 10 helper cells was sufficient to induce a 5  72  lethal disease in secondary recipients within 88 days post-transplant, demonstrating that the frequency of the "leukemia-propagating cell" is greater than 1 in 100. The aggressiveness of the secondary disease was further evident as transplanting 1 x 10 BM cells from a leukemic 6  primary mouse into non-myeloablated secondary recipients was sufficient to induce a lethal disease within 85 days post-transplant. These observations indicate that NUP98-TOP1 is sufficient to induce a lethal, transplantable myeloid leukemia.  73  Table 3.2 Survival of Secondary Recipients  Secondary recipients Primary mouse  Tx dose (cells)  WBCt (cells/ml) x 10  RBCt (cells/ml) x 10  Survival (days)  6  EXP 2  GFP CTL  1 X 106  6.8511.2  1.41.04  > 6 months  NUP98-TOP1  1 x 10  402±9.0  .471.16  46.317.5  1 x 105  286±45  .511.30  60113.9  1 x 10  156154  .791.44  76.311.5  1 x 10  60.6154  .111.02  105.3158.7  GFP CTL  1 x 10  6  9.81.87  1.21.05  > 6 months  NUP98-TOP1  1 x 10  3  14.512.1  .771.30  76.3111  1 x 102  19.817.0  .921.26  79.7112  1 x 10  1.21.60  1.21.10  126.7124  s  4  3  EXP 3  EXP 9  10  NUP98-TOP1  3  t Exp 2 values taken at 4 weeks post tx Exp 3,9 values taken at 8 weeks post tx Values are mean i S D  74  3.2.5 NUP98-TOP1 fusion exhibits distinct properties compared to NUP98-HOX fusions To ascertain whether NUP98-TOP1 has some overlapping mechanisms with NUP98HOX fusions, a bone marrow transplant experiment was performed using BM co-expressing Meisl (linked to YFP) and NUP98-TOP1 (linked to GFP). As outlined in Figure 3.6, a novel 2stage infection strategy was devised to co-express both transgenes, as the transduction efficiency of NUP98-TOP1 is too low to efficiently co-transduce 2 genes. The possibility existed that BM harvested from the NUP98-TOP1 primary mice was already pre-leukemic and that transplantation into the secondary mice would increase the onset of disease as observed in Section 3.2.4. To this end we included a second arm of the experiment in which BM was harvested from mice transplanted with Meisl transduced cells. As early as 28 days posttransplant in the secondary mice, there was readily detectable repopulation by doubly transduced cells in the majority of the mice (GFP /YFP ; 6.8 -22.7%). While 5 of 8 mice were +  +  reconstituted with both GFP /YFP peripheral blood (Figure 3.6) the median survival of these +  +  mice was 242 days post-transplant, similar to that previously observed for expression of NUP98-TOP1 alone (Table 3.3). Moreover, in this experiment 2 mice receiving NUP98-TOP1 BM without Meisl had a comparable survival (175 and 187 days), further suggesting that in this model, Meisl does not accelerate NUP98-TOP1 induced leukemogenesis.  75  Initial infection (Day 6-8)  Primary Tx (Day 8)  Harvest B M (Day 44)  Second infection Secondary Tx (Day 46) (Day 48)  P B analysis (Day 146)  NUP98TOP1 " (GFP) Meisl _ (YFP)  w  1?  W  GFP  Figure 3.6 Outline of strategy used to transplant BM cells co-expressing NTJP98-TOP1 and Meisl. 5-FU BM was harvested, transduced and transplanted into primary mice as described in Methods and Materials. 5 weeks post transplant, non-5-FU treated BM was harvested from the primary mice, transduced and lxlO cells were transplanted into secondary mice along with 3x10 helper cells. FACS profiles are representative of PB at 98 days post secondary transplant. Upper plot: NUP98-TOP1 BM infected with Meisl; Lower; Meisl BM infected with NUP98-TOP1. 6  s  Table 3.3 Survival of primary transplanted mice  3.3  Survival > 300 days  Median Survival (Range) (days)  GFP CTL  10/10  >365  NUP98-TOP1  3/17  233.5 (149-321  NT & Meisl  0/5  242 (143-264)  Discussion Our findings reveal potent and rapid perturbations in hematopoiesis induced by  engineered expression of NUP98-TOPI, the fusion recognized in t(l l;20)(pl5ql 1). The observed effects included a potent in vitro growth advantage, a multi-log increase in generation 76  of spleen colony forming cells and induction of a lethal, transplantable myelomonocytic leukemia in mice. To date, over 16 different partner genes have been identified in translocations involving the nucleoporin gene, NUP98' on chromosome 1 lpl5 (Lam and Apian, 2001). Over half of the partners are homeobox genes, with seven belonging to paralogs 9, 11 and 13 ofthe AbdominalB cluster of HOX. Moreover at least 2 such fusions, NUP98-HOXA9 and NUP98-HOXD13 have been shown to have direct, potent effects on hematopoiesis and induce a lethal MPD/AML in mice (Kroon et al., 2001; Pineault et al., 2003). Leukemia induced by expression of NUP98-HOX fusions is consistent with the mounting evidence that HOX transcription factors play an integral role in hematopoiesis and their altered expression and/or function are leukemogenic (Buske and Humphries, 2000; Chiba, 1998; van Oostveen et al., 1999). The mechanism driving NUP98-TOP1 induced leukemia is more enigmatic given that TOPI has no known unique role in hematopoiesis. Whether the active site tyrosine required for TOPI catalytic activity is dispensable for leukemic transformation awaits further investigation. Moreover, we cannot yet exclude the possibility that NUP98-TOP1 has a dominant-negative effect on topoisomerase activity. However, TOPI is necessary for growth and development of Drosophila melanogaster and homozygous mutant murine embryos are embryonic lethal between the 4 and 16-cell stage, demonstrating that TOPI is essential for cell growth (Lee et al., 1993; Morham et al., 1996). Furthermore, increased levels of TOPI have been observed in cancer cells (Giovanella et al., 1989), and TOPI inhibitors are widely used clinically in the treatment of leukemia and other cancers (Pommier et al., 1998). These observations strongly argue against a dominant-negative effect on TOPI, as decreased levels of TOPI are inconsistent with a malignant phenotype. Moreover, no gross chromosomal abnormalities were observed in NUP98-TOP1 BM cells cultured for >4 weeks, suggesting that 77  NUP98-TOP1 expression does not interfere with normal TOPI activity generating genomic instability. Our experimental observations suggest that some key domains and/or functions of TOPI retained in the fusion may play essential roles in the leukemogenic effects of NUP98-TOP1. TOPI consists of 4 conserved domains (Figure 3.1 A); an N-terminal domain containing several nuclear targeting signals, a core domain necessary for DNA binding, a non-conserved linker domain and a C-terminal domain that is also required for DNA binding and further contains the active site tyrosine in position 723 and a kinase domain implicated in phosphorylation of SF2/ASF splicing factors. TOPI has also been identified as a co-activator of transcription, enhancing basal transcriptionfroma TATA promoter in the presence of an activator and is able to directly interact with TATA binding protein in the TFIID transcriptional complex (Kretzschmar et al., 1993; Merino et al., 1993; Shykind et al., 1997). Moreover, a TOPI mutant (Y723F) lacking DNA relaxing activity was equally active in enhancing transcription. This transcriptional coactivator property of TOPI provides a possible functional similarity to HOX genes and other nuclear NUP98 fusion partners such as NSD1, NSD3 and LEDGF. We can hypothesis that NUP98 fusions act as aberrant transcription factors with binding to DNA occurring via the NUP98 fusion partner gene, and recruitment of the transcriptional machinery occurring via recruiting CBP/p300 or other unknown transcription co-activators through NUP98 (Kasper et al., 1999). However, other contributions of NUP98 remain to be ruled out. Support for the hypothesis of NUP98-TOP1 as an aberrant transcription factor is backed by the observation of its nuclear localization. Other NUP98 fusions including HOXA9 (Kasper et al., 1999), PMX1 (Nakamura et al., 1999) and RAP1GDS1 (Hussey et al., 2000) are similarly observed to reside in the nucleus. Intriguingly, many of the non-HOXNUP98 fusion partners also contain domains 78  predicted to adopt a coiled-coil conformation (Hussey and Dobrovic, 2002) and this domain has been verified for TOPI by x-ray crystallography (Redinbo et al., 1998; Stewart et al., 1998). Whether this domain promotes dimerization or is required for leukemic transformation, as is observed for several MLL-fusions (So et al., 2003b), awaits further investigation. Also intriguing is the observation of PB and BM from NUP98-TOP1 leukemic mice that exhibit high proportion of B220 cells. A bi-phenotypic leukemia exhibiting the phenotype (c10  kit /B220 /Mac-l /CD197Gr-l") has recently been reported upon expression of several MLL +  +  +  fusion genes (So et al., 2003a; Zeisig et al, 2003). Whether NUP98-TOP1 similarly transforms a novel progenitor capable of bi-phenotypic differentiation, or NUP98-TOP1 transformed progenitors simply exhibit aberrant expression of lineage associated genes, will be of interest to dissect in future experiments. It is intriguing that many of the in vitro and in vivo effects induced by NUP98-TOP1 expression are similar to those observed following expression of NUP98-HOXA9 and NUP98HOXD13 (Kroon et al., 2001; Pineault et al., 2003). For example, in vitro, all fusions are associated with an increased proliferative capacity of transduced BM as measured in CFC, spleen colony assay and/or liquid culture assays. In vivo, NUP98-TOP1 induced a progressive and ultimately lethal leukemia in all transplant recipients characterized by elevated WBC counts, splenomegaly and a long latency, behavior similar to that documented for both NUP98HOXA9 and NUP98-HOXD13. The long survival period observed for diseased NUP98-TOP1 primary mice, coupled with the accelerated onset of secondary disease suggests the possible acquisition of additional genetic changes. However, the nature of this second hit is unclear. Of note, a rapid and lethal AML could be induced upon co-expression of either NUP98-HOXA9 or NUP98-HOXD13 with the HOX-cofactor Meisl (Kroon et al., 2001; Pineault et al., 2003). However, when mice were transplanted with BM co-expressing both NUP98-TOP1 and Meisl, 79  there was no obvious decrease in mouse survival compared to NUP98-TOP1 alone suggesting distinctive transforming properties compared to NUP98-HOX fusions. Our study provides a mouse model and an initial characterization of the leukemia associated fusion NUP98-TOP1. It suggests that NUP98-TOP1 shares similar in vitro and in vivo hematopoietic effects with other NUP98-HOX fusions, and may provide unique insights into the molecular pathogenesis of NUP98 fusions.  80  Chapter 4  Functional dissection of the NUP98-Topoisomerase I fusion gene:  NUP98-TOP1 has potent leukemogenic activities independent of an engineered catalytic site mutation  Work in this chapter describing the biological effects of the engineered NUP98-TOP1 mutants (with the exception of VP16-TOP1) has been included in the manuscript: Gurevich RM, Apian PD, Humphries RK. The NUP98-Topoisomera.se I AML-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation. Blood. 2004 Aug 15;104(4):1127-36.  81  4.1  Introduction To date over 16 distinct chromosomal translocations have been identified in hematopoietic  malignancies that involve the N-terminal portion of the NUP98 protein on 1 lpl5 (Lam and Apian, 2001; Slape and Apian, 2004). Over half of the NUP98 fusion partners are homeodomain-containing proteins mostly belonging to the HOX family of transcription factors. In all NUP98-HOXfusions, the breakpoint occurs before exon 2 (Borrow et al., 1996; Fujino et al., 2002; Gervais et al., 2004; Nakamura et al., 1996a; Nakamura et al., 1999; Panagopoulos et al., 2003; Raza-Egilmez et al., 1998; Taketani et al., 2002a; Taketani et al., 2002b; Taketani et al., 2002c), thus retaining the homeodomain in the chimeric protein. Recent data has demonstrated that expression of NUP98-HOXA9 (Kroon et al., 2001) and NUP98-HOXD13 (Pineault et al., 2003) induces a lethal AML in a murine BM transplantation model. In vitro, mutations to the HOXA9 homeodomain that abolish the ability of NTJP98-HOXA9 to bind DNA or to interact with PBX, also abrogated its ability to transform fibroblasts (Kasper et al., 1999). Moreover a mutation to homeodomain of HOXD 13 known to eliminate the DNA binding activity similarly abrogated the growth promoting effects of NUP98-HOXD13 as assessed in a spleen colony forming assay (Pineault et al., 2003). Further evidence to support the idea that the NUP98 fusion partner requires DNA binding ability is garneredfromengineered fusions in which NUP98 is fused to select HOX genes (e.g. HOXA10, HOXB3 (Pineault et al., 2004)). Moreover, when NUP98 was fused to only the homeobox sequences of HOXD13 or HOXA10, these fusions were just as potent as NUP98-HOXD13 and NUP98-HOXA10 in causing leukemia in collaboration with Meisl. Together these results suggest a model in which the DNA binding ability of the NUP98 partner gene may be required for leukemic transformation. The t(l 1;20) fuses NUP98 to Topoisomerase I (Ahuja et al., 1999) a catalytic enzyme that removes supercoils along the DNA double helix (Pommier et al., 1998; Wang, 1996). TOPI 82  consists of 4 domains (Figure 4.1). The N-terminal (amino acids (aa) 1-214) contains several nuclear localization signals and interaction sites for other cellular proteins. The core domain (aa 215-633) is highly conserved and contains sites required for DNA binding. There is a small poorly conserved linker domain (aa 636-712) and a C-terminal domain (aa 713-765) which contains residues that bind DNA as well as the active site tyrosine (Tyr 723) required for the catalytic, unwinding activity of TOPI. There are four steps to TOPI catalytic cycle. First is the enzyme binding to double stranded DNA. Resolution of the crystal structure determined that TOPI binds DNA like a clamp with residues from the core and C-terminal domains making direct contact with DNA (Redinbo et al., 1998; Stewart et al., 1998). The second step is DNA cleavage mediated by the active site tyrosine (Tyr723), which generates a single strand nick via a transesterification reaction to create a phosphodiester link between the tyrosine and 3' phosphate, leaving a free 5' end. This is followed by single-strand passage in which the cleaved strand undergoes rotation around the stationary intact strand, changing the linking number by 1. And finally a second transesterification reaction occurs in which the exposed 5' hydroxyl group of the cleaved DNA strand now attacks the phosphotyrosine to religate the DNA. Mutating the active site tyrosine to phenylalanine (Y723F) abrogates that DNA unwinding ability of the enzyme (Madden and Champoux, 1992). It can still effectively bind DNA but cannot cleave DNA. Subcellular localization studies in HeLa cells demonstrate that TOPI localizes to the nucleus with nucleolar localization present in 15% of the cells (Mo et al., 2000). Of note, a catalytic mutant (Y723F) displays the same nuclear localization. NTJP98 is a nucleoporin protein containing 4 domains that is involved in bi-directional nuclear-cytosolic transfer (Radu et al., 1995). The N-terminal portion consists of 2 domains containing FG and GLFG repeats which is separated by a GLEBS domain serving as a Rael/GLE2 binding site (Pritchard et al, 1999b). The C-terminus contains a putative RNP 83  binding site and has autoproteolyic activity to generate either NUP98 or NUP96 (Fontoura et al., 1999). NUP98 is localized to the nucleus, specifically to novel structures termed GLFG bodies, as the GLFG repeat domain is necessary for its targeting to this structure (Griffis et al., 2002). In the NUP98-TOP1 fusion, the breakpoint occurs at aa 514, thus the FG repeats are retained in the chimeric protein, as is observed for all NUP98 fusions reported to date. In attempt to gain further mechanistic insight into the leukemogenesis induced by NUP98-TOP1, we selectively deleted or mutated conserved domains of both the NUP98 and TOPI partner genes. The subcellular localization of the mutants was determined by generating GFP-fusion constructs and visualization by fluorescent microscopy. Further, the ability to transform murine bone marrow was assessed in liquid culture assays. Strikingly, a mutation to the TOPI active site to inactivate the catalytic, unwinding activity, left unaltered the growth promoting and leukemogenic effects of NUP98-TOP1. Moreover, our results suggest that both NUP98 and TOPI are required for correct nuclear localization and in vitro transformation, and that NUP98 cannot be functionally replaced by VP 16. Interestingly, similar to results observed for NUP98-HOX fusions, deletion of TOPI domains known to be involved in DNA binding further abrogated in vitro transformation.  4.2 Results 4.2.1 Generation of NUP98-TOP1 mutants A series of NUP98-TOP1 deletion mutants was tested in vitro in an attempt to functionally dissect the contributing domains of each fusion partner to the leukemogenesis (Figure 4.1). To ascertain whether a partner gene is required, a mutant construct was engineered encoding the N-terminal portion of NUP98 (NUP98-5 *) corresponding to the segment found in the fusion gene. To further assess the contribution of the TOPI fusion partner, the C-terminal 84  portion of TOPI (TOP1-3 *) was assayed. To determine whether NTJP98 contributes some inherent unique function or simply a transactivation domain as suggested by Kasper et al. (Kasper et al., 1999), the NUP98 portion of NUP98-TOP1 was replaced by the VP16 activation domain to generate a VP16-TOP1 fusion. It has been hypothesized that NUP98-HOX fusions act as aberrant transcription factors, evidenced by the concomitant loss of in vitro proliferative advantage with mutation to the DNA binding homeodomain (Kasper et al., 1999; Pineault et al., 2003). TOPI binds to DNA like a clamp with portions of the core domain and C-terminal domain forming the upper and lower halves, respectively (Redinbo et al., 1998; Stewart et al., 1998). To ascertain whether these DNA binding domains are necessary for NUP98-TOP1 transformation, mutant constructs were engineered that deleted either the TOPI core domain (NT ACD) or the C-terminal domain (NTAC-term). The most well characterized function of TOPI is the unwinding of supercoiled DNA. It has been well documented that mutating Tyr723 to phenylalanine (Y723F) abrogates the catalytic ability of TOPI, rendering it unable to relax supercoiled DNA (Madden and Champoux, 1992). To test whether the myeloproliferative effects of NUP98-TOP1 were dependent on TOPI isomerase activity, in vitro mutagenesis was utilized to change the corresponding tyrosine residue in the NUP98-TOP1 fusion to phenylalanine, herein called NT-Y723F.  85  T0P1  NUP98  FXFG  Core  FXFG  Link  C-term  NUP98-TOP1 NT Y723F  m  NUP98 5' TOP1 3' VP16-TOP1 NT ACD NT AC-term  Figure 4.1 Schematic representation of NUP98-TOP1 and engineered mutants used in this study.  4.2.2  Sequences within NUP98 direct its nuclear localization Consistent with the hypothesis that NUP98 fusions act as deregulated transcription  factors, Kasper et al. reported that NUP98-HOXA9 displays a nuclear localization (Kasper et al., 1999). We generated GFP- fusion constructs of both NUP98-HOXD13 and NUP98-PMX1 and confirmed that they also localized to the nucleus (Figure 4.2A). Moreover, we have previously reported that NUP98-TOP1 exhibits a nuclear localization (Chapter 3.2.1 and (Gurevich et al., 2004b) suggesting a common link among the NUP98 fusion proteins. In an attempt to define which sequences within the NUP98-TOP1 fusion are responsible for the nuclear localization, the various mutant isoforms were expressed as GFP-fusion constructs in 293T cells and analyzed by fluorescent microscopy. Consistent with previous observations by Griffis et al. (Griffis et al., 2002), the NUP98 portion of the fusion (NUP98-5') localized within the nucleus to discrete nuclear bodies (Figure 4.2B). These novel structures 86  have been termed GLFG bodies, as the FG repeat motifs of NUP98 are required for this localization pattern. It has been previously documented that full length TOPI exhibits both nuclear and nucleolar localization (Mo et al., 2000). Interestingly, the TOPI portion (TOP1-3') of the NUP98-TOP1 fusion displayed a very heterogeneous localization. Its expression was detected in both the nucleus and the cytosol. These observations suggest that fusion to NUP98 leads to mis-expression of the TOPI protein in a sub-cellular compartment in which it is not normally expressed. The VP16-TOP1 mutant displayed the expected nuclear localization pattern as the SV40 nuclear localization signals are found in the VP 16 sequence. If binding to DNA is required for transformation, as is suggested from NUP98-HOX fusions, one could hypothesize that removal of these domains from NUP98-TOP1 would abrogate the normal nuclear localization of the protein. The protein would thus be misexpressed in another cellular compartment and no longer able to activate the program necessary for transformation. Accordingly, both mutants designed to remove TOPI DNA binding sequences (NTACD and NTAC-term) displayed the same speckled nuclear localization as the Nterminus of NUP98 (Figure 4.2B). These observations suggest that the DNA binding sequences of TOPI are required for proper expression of the chimeric protein. Interestingly, as observed for NUP98-TOP1, mutating the active site tyrosine of TOPI to generate the NT-Y723F catalytic mutant did not alter the nuclear localization.  87  Figure 4.2 Fluorescent Microscopy images Fluorescent microscopy images of 293T cells transfected with various GFP-fusion constructs as described in methods and materials. Left hand panels depict cells stained with DAPI for visualization of nuclei. Centre panels show visualization of GFP expression and right hand panels show overlay of DAPI and GFP. (A) NTJP98-HOXD13 (i-iii) and NUP98-PMX1 (iv-vi) display nuclear localization. (B) The various mutant isoforms of NUP98-TOP1. Top row (vii-ix) results with GFP-NT-Y723F demonstrating that similar to NUP98-TOP1, NT-Y723F also exhibits a nuclear localization. Second row (x-xii) NUP98-5' localizes to discrete nuclear bodies. Third row (xiii-xv) TOPI 5' has ubiquitous expression in both the nucleus and cytosol. Fourth (xvi-xviii) and fifth (xix-xxi) rows results show that removal of TOPI DNA binding sequences abrogate the nuclear localization and proteins are expressed in nuclear bodies. Bottom row (xxii-xxiv) VP16TOP1 is expressed in the nucleus.  88  4.2.3  NT-Y723F induces in vitro growth promoting effects. To ascertain their effects on hematopoietic growth and differentiation, the various  NUP98-TOP1 mutants were engineered into IRES-GFP-linked MSCV retroviral constructs and expressed in murine BM. Expression of NUP98-TOP1 leads to a marked in vitro growth promoting advantage, as measured by its ability to out-compete the growth of non-transduced (GFP") cells in liquid culture. Neither the NUP98 (NUP98 5') portion, the TOPI (TOPI 3') portion of the fusion alone were sufficient to induce the growth advantage observed for NUP98TOP1 in liquid culture assays, (Figure 4.3A), demonstrating that each partner contributes an essential function required for leukemogenesis. Moreover, the VP16-TOP1 fusion did not demonstrate any growth-promoting activity further providing evidence that NUP98 contributes a unique function more than a transactivation domain (Figure 4.3 A). The NUP98-TOP1 mutants lacking the domains required for DNA binding (NTACD and NT CA term) also failed to exhibit any in vitro growth promoting activity as assayed in competitive liquid culture assays (Figure 4.3A) or spleen colony forming cell expansion assays (data not shown). These results are in agreement with those observed for several NUP98-HOX fusions (Kasper et al., 1999; Pineault et al., 2003), suggesting a requirement for DNA-binding by the NUP98 partner gene. Strikingly, NT-Y723F had the same growth promoting activity as NUP98-TOP1 in liquid culture assays, out-competing the growth of non-transduced cells and increasing the proportion of GFP cells 82.5 ±4.0 fold above input over 38 days (Figure 4.3B). +  At the end of the culture period, the NT-Y723F cells morphologically resembled blast-like cells upon Wright-Geimsa staining (Figure 4.3C).  89  Figure 4.3 The NT-Y723F mutant displays an in vitro proliferative advantage. (A) Fold increase in the proportion of GFP+ cells in liquid culture measured 4 weeks after culture initiation. Representative graph of n=2 independent experiments with each sample plated in triplicate (Avg± SD). (B) NT-Y723F induces an increase in the proportion of transduced (GFP+) B M cells in liquid cultures similar to that observed for NUP98-TOP1. Graph is representative of 3 independent experiments. Values are mean ± SD of single experiment plated in triplicate. (C) Wright-Geimsa stained cytospin preparation taken at Day 28. Original magnification x 100.  90  Both NUP98-TOP1 and NT- Y723F resulted in a dramatic increase in the yield of spleencolony-forming cell output after 8 days in culture, increasing some 210-fold and 250-fold respectively, compared to GFP control (Figure 4.4). Transplanting the progeny of as few as 500 NUP98-TOP1 or NT-Y723F cells cultured for 8 days, gave rise to a massive enlargement in spleen size 12 days post-transplant. This preliminary data suggested that NUP98-TOP1 may not require the TOPI catalytic activity for leukemic transformation, thus the NT-Y723F mutant was further studied in vivo.  1000  a  Day 0  Day 8  Figure 4.4 The NT-Y723F mutant displays a similar increase in CFU-S colonies compared to NUP98-TOP1 Frequency of Day 12 CFU-S colonies obtained immediately after FACS sorting (Day 0; left) or following 8 days of liquid culture (Day 8; right) (mean ± SD; n>2). Inset, representative pictures of day 12 spleens following injection of transduced cells cultured for 8 days. GFP C T L spleen (left) was derived from a culture initiated with 2 x 10 cells; in contrast both NUP98-TOP1 (centre) and NT-Y723F (right) gave rise to enlarged spleen from only 500 input cells. 4  91  4.2.4 NUP98-TOP1 induces a lethal leukemia in the presence of a mutation to the TOPI catalytic active site To ascertain the effect of NT-Y7'23F expression on in vivo hematopoiesis, 5-FU treated murine BM was infected with retrovirus for 48 hours then 5xl0 unselected cells were 5  transplanted into lethally irradiated recipient mice. Following transplantation, NT-Y723F transduced BM behaved essentially identically to NUP98-TOP1 transduced BM, yielding an increased proportion of GFP myeloid PB cells over time. The initial transplant inoculum +  contained less than 1% of GFP transduced cells, however the proportion of GFP cells in the +  +  PB progressively increased over time expanding to more than 55% by 8 weeks and ultimately rising to more than 90% by 30 weeks post transplant (Figure 4.5A). The increase in proportion ofGFP PB cells was associated with a progressive increase in the number of circulating white +  blood cells. At 13 weeks after transplant there was a significant increase (p=.03) in circulating WBC numbers compared to GFP control mice (mean, 13.0 ± 2.6 x 10 vs. 9.0 ± 1.5 x 10 cells / 6  6  ml in control) and reaching 120 ± 77.2 x 10 cells/ml in three surviving mice at 34 weeks post 6  transplant (Figure 4.5B). The phenotype of PB cells was analysed by FACS and revealed that similar to NTJP98-TOP1 mice, NT-Y723F mice had an increased proportion of transduced circulating myeloid cells (Gr-1 and Mac-1 ) and a decrease in the proportion of B- and T-cells +  +  evidenced by B220 and CD4/CD8 staining respectively (Figure 4.5C). This myeloproliferation is evident on Wright-Geimsa stained PB smears where mature neutrophils as well as immature blasts are seen at 237 days post transplant (Figure 4.5D).  92  Figure 4.5 NT-Y723F behaves similarly to wild-type NUP98-TOP1 to induce an in vitro and in vivo proliferative advantage. (A) Similar to NUP98-TOP1, NT-Y723F leads to in vivo proliferative advantage as assessed by increased peripheral blood G F P content at various times post transplant. Graph represents a single experiments with at least 4 mice in each group (mean ± SD). Open, GFP CTL; Filled, NUP98-TOP1; Grey, NT-Y723F (B) NTY723F leads to a progressive increase in PB white cell counts over time. (C) Representative FACS profiles of PB stained with various lineage markers, taken ~4 months post-transplant (D) Representative WrightGeimsa stained PB smear of NT-Y723F mouse at 8 months post-transplant. Original magnification x 1000. See Figure 3.5B for control. +  NT-Y723F mice became moribund with a median survival of 270.5 days (n=4) (Figure 4.6A) and the disease was transplantable to secondary recipients with kinetics essentially identical to that observed for NUP98-TOP1 mice. Southern blot analysis confirmed correct proviral integrity and suggested the disease was mono- or oligo-clonal (Figure 4.6B).  93  Flow cytometric analysis of leukemic mice demonstrated an increased proportion of myeloid cells in the hematopoietic organs with a concomitant reduction of Terl 19 cells in the +  BM and spleen (Figure 4.7A). Morphologically, the BM contained a large proportion of immature blast-like cells while the spleen consisted of myeloid cells at all stages of differentiation (Figure 4.7B). Together, this data strongly argues that the leukemia resulting from NUP98-TOP1 expression occurs independent of TOPI catalytic activity.  GFP CTL NUP98-TOP1 NT Y723F  100  200  300  400  Days Post Transplant  B O  a. o  O-  CO CM  CO CM  >  >  Li. CO CM  Ll_ CO CM  NT-Y723F 14  o  1°  2°  12 Kb  6.3 kbp 12Kbp  2.8 kbp  7Kbp  —  5Kbp  —  Xbal EcoRI  Figure 4.6 NT-Y723F behaves similar to NUP98-TOP1 and induces a lethal, transplantable A M L . (A) Survival curve for mice transplanted with CTL GFP transduced cells (dashed line n=10) or NUP98TOP1 transduced cells (solid line n=17, average latency 225 ± 56 days) or NY-Y723F (grey line, n=4, average latency 256 ± 56. (B) Southern blot analysis of genomic DNA from primary mice reveals full length proviral integration. DNA was digested with Xbal which cuts once in each LTR (Right panel). Southern blot analysis reveals that NT-Y723F induces mono- or oligo-clonal disease which is transplantable to secondary recipients (Centre and left panels). Genomic DNA from moribund mice was digested EcoRI which cuts once in the provirus sequence. Membranes were hybridized with a probe specific to GFP.  94  GFP CTL  NT Y723F  B  0 Gr-1  Mac-1  B220  Ter 119  m GFP  Figure 4.7 Immunophenotype of hematopoietic cells from NUP98-TOP1 mice. (A) Representative FACS profiles of B M from a GFP control and diseased NT-Y723F mouse. (B) WrightGeimsa stained B M (upper) and spleen (lower) cytospin (original magnification, 600X).  4.3  Discussion To date 16 distinct translocations involving NUP98 have been reported in hematological  malignancies, however, they remain largely uncharacterized (Lam and Apian, 2001; Slape and Apian, 2004). Over one half of the NUP98 fusion partners are homeobox containing genes. Consistent with recent evidence implicating HOX transcription factors as integral regulators of normal hematopoiesis (Buske and Humphries, 2000), it is reasonable their deregulated expression upon fusion with NUP98 induces leukemia. More provocative however, is the leukemia induced by the other NUP98 fusions including NUP98-TOP1, as neither NUP98 nor 95  TOPI have known unique roles in hematopoiesis. In murine BM transplantation models, NUP98-HOXA9 (Kroon et al., 2001), NUP98-HOXD13 (Pineault et al., 2003) and NUP98TOP1 (Gurevich et al., 2004b) all induce a lethal, transplantable MPD/AML. Whether these fusions act through common pathways or whether distinct mechanisms exist for NUP98-HOX versus NUP98-non-HOX fusions remains to be elucidated. Structure-function analysis was performed to define domains within the NUP98-TOP1 fusion gene that contribute to the pathogenesis of leukemia. Intriguingly, our data reveals that the catalytic unwinding activity of TOPI, its key biological activity, does not play a role in NUP98-TOP1-induced leukemogenesis. An engineered mutation to the TOPI active site known to abrogate the enzyme's catalytic activity, did not alter the proliferative or leukemic potential of NUP98-TOP1.  The observation that the active site tyrosine that is required for TOPI activity is dispensable for NUP98-TOPJ-induced  leukemia, suggests that this fusion does not act through up-regulated  DNA-unwinding activity. While we cannot rule out the possibility that NUP98-TOP1 has dominant-negative activity on TOPI activity, there are several lines of evidence to argue against this possibility. Knockout experiments reveal that TOPI is necessary for growth and development of Drosophila melanogaster (Lee et al., 1993) and homozygous mutant mice are embryonic lethal between the 4-16 cell stage (Morham et al., 1996). Moreover, elevated levels of TOPI have been observed in multiple cancers (Giovanella et al., 1989) and TOPI inhibitors are commonly used in the treatment of leukemia and other cancers (Pommier et al., 1998). This evidence argues against a dominant-negative effect on TOPI activity, as decreased levels of TOPI are inconsistent with a malignant phenotype. As the key biological function of TOPI is dispensable for leukemogenesis, we investigated whether other conserved domains of NUP98 or TOPI play a role in NUP98-TOP1 induced 96  transformation. When assayed alone, neither the NUP98-5' portion of the fusion, nor the TOP13' portion demonstrated the in vitro growth promoting effects observed for full-length NUP98TOP1. These results suggest that both partners contribute essential functions required for transformation and are consistent with those observed for both NUP98-HOXD13 and NUP98HOXA9. In those experiments, neither the truncated HOXD13 nor HOXA9 (lacking NUP98) nor the NUP98 portion of the fusion conferred any proliferative advantage or leukemogenic effects (Kroon et al., 1998; Pineault et al., 2003). These experiments underscore the important contribution of NUP98. In vitro fibroblast transformation assays using NUP98-HOXA9 demonstrated that NUP98 can functionally be replaced by either the FG repeat portion of NUP214 or by the VP16 transactivation domain (Kasper et al., 1999). However, when assayed in murine BM, replacing NUP98 by VP 16 to generate fusions with either TOPI or HOXD13 (unpublished results) had no proliferative effect. While transformation may occur by different mechanisms in different cell types, the results using murine BM suggest that NUP98 contributes a unique role to leukemogenesis other than providing transactivation potential. Many of the in vitro and in vivo effects observed upon expression of NUP98-TOP1 are similar to those seen upon expression of NUP98-HOXA9 and NUP98-HOXD13. It has been demonstrated that the transforming potential of these NUP98-HOX fusions are dependent on intact DNA binding domains, as mutations to the HOXA9 or HOXD13 homeodomain known to abrogate its ability to bind DNA resulted in loss of transforming potential of the fusion gene. To ascertain if common properties exist among all NUP98 fusions, we selectively removed the key TOPI domains that are involved in the enzyme binding to DNA to assess whether the requirement for DNA binding is critical for NUP98-TOP1 induced transformation. Deletion of either the core- or C-terminal domains of TOPI resulted in complete loss of NUP98-TOP1 growth promoting effects. These results suggest some common, overlapping feature with 97  NUP98-HOX fusions and support the hypothesis that NUP98 fusions act as aberrant transcription factors with DNA binding occurring via NUP98 fusion partner and recruitment of CBP/p300 or other transcriptional machinery occurring through NUP98. However, TOPI has no consensus DNA binding sequence, thus bringing the question of specificity into this model. Moreover, removal of the core and C-terminal domains deleted large portions of the gene. While the expected full length proteins were confirmed by Western blot, we cannot rule out structural changes in the protein that may account for the observed loss of function. It has been demonstrated for several AML1, RARcx (Minucci et al., 2000) and MLL (Martin et al., 2003; So et al., 2003b) fusions that the partner genes contain coiled-coiled domains which induce dimerization of the fusion and subsequent activation or repression of target genes. The presence of sequence with a significant probability of adopting a coiled-coil conformation has been identified in all NUP98-non homeobox partner genes (Hussey and Dobrovic, 2002). Moreover, one of the predicted coiled-coil domains in TOPI (aa 638-718) has been confirmed by x-ray crystallography (Stewart et al., 1998). It is currently unknown whether these domains play a role in leukemia induced by NUP98 fusions. A specific role for the coiled-coil domains of TOPI were never investigated in NUP98-TOP1 induced transformation. However, several residues of the known coiled-coil domain were lost upon generation of the C-terminal mutant and the other predicted domains (aa 310-338 and 577-605) would have been lost in the coredomain mutant. Thus our fusions intended to abrogate DNA binding also abolished coiled-coil domains. We can thus speculate that similar to other fusions, these coiled-coil domains were the critical moieties required for transformation. Full length NUP98 has been localized to the nuclearrimwhere it acts as part of the nuclear pore complex to shuttle RNA and protein between the nucleus and cytosol (Kasper et al., 1999; Radu et al., 1995). As well, NUP98 has been found in the nucleus where it associates with a 98  novel complex termed GLFG bodies (Griffis et al., 2002). Targeting of NUP98 to these nuclear bodies is dependent on the N-terminal GLFG repeats (aa 221-504), which are retained in the NUP98 fusion genes. Consistent with this report, we observed that the NUP98-5' mutant localized to discrete nuclear bodies. NUP98 dynamically moves between the nuclear rim and the nuclear interior and its movement is dependent of ongoing RNA transcription suggesting a link between RNA transcription and RNA export via the nuclear pores (Griffis et al., 2002). A nuclear localization has been demonstrated for many NTJP98 fusion proteins including NTJP98HOXA9 (Kasper et al., 1999), NUP98-HOXD13, NUP98-PMX1 and NUP-TOP1 as well as the catalytic mutant NT-Y723F. These observations are consistent with the hypothesis that these fusions act as aberrant transcription factors. However, the nuclear localization observed for VP16-TOP1 coupled with its lack of transforming potential despite having the strong transactivating domain, argues that NTJP98 is providing some unique function that cannot be functionally replaced by VP 16. That the nuclear localization observed for these NTJP98 fusions is distinct from nuclear rim or nuclear body localization reported for NUP98 suggests that NUP98 fusions do not act in a dominant-negative manner to deregulate nuclear trafficking. Of note, removing the TOPI DNA binding domains, also resulted in the fusion localizing to nuclear bodies, indicating that binding to DNA may be required for proper subcellular targeting of NUP98 fusions. This study provides insight into the mechanism of leukemogenesis induced by the NUP98TOP1 fusion gene. Strikingly, the catalytic isomerase activity of TOPI is dispensable for the leukemic effects. Similar to other leukemic NUP98 fusions, this NT-Y23F mutant is a nuclear protein. Of great interest is the observation that similar to NUP98-HOX fusions, domains involved in TOPI binding to DNA are required for leukemic transformation and may be important for correct targeting of the protein to the nucleus. Thus although functionally TOP lis 99  a seemingly different protein compared to HOX, some functional overlap exists among these partners as they both require D N A binding motifs for leukemic transformation.  100  Chapter 5 Investigating potential genes that collaborate with NUP98-TOP1 to accelerate the induction of leukemia.  The identification of pro-viral integration sites and PCR was performed by Patricia M. Rosten.  101  5.1  Introduction As revealed by studies presented in Chapter 3, expression of NUP98-TOP1 in murine BM  induces a progressive myeloproliferative-like disease that with long latency progress to a lethal AML (average; 225 ± 56 days) (Gurevich et al., 2004b). However, following transplantation of BM from leukemic mice into secondary recipients, there was a significant decrease in the time of disease onset (42-147 days). Moreover, the disease was mono- or oligoclonal in both primary and secondary recipients. Together, these results suggest that additional genetic changes were required for progression to the full leukemia. This is consistent with evidence from several mouse models demonstrating that expression of a translocation fusion product alone is not sufficient to cause rapid disease onset and that additional mutations are required (Grisolano et al., 1997; Rhoades et al., 2000; Yuan et al., 2001). Identification of collaborating genes would be of clinical interest as they could provide additional targets for therapy and for use in the prevention of oncogenic progression of pre-malignant lesions having a known primary genetic alteration. We were interested in trying to identify possible genes that would collaborate with NUP98-TOP1 in leukemogenesis. In Chapter 3.2.5 we used the candidate gene approach to test the collaborative potential of Meisl, as Meisl has been shown to collaborate with several NUP98-HOXfusions (e.g. HOXA9 (Kroon et al., 2001), HOXD13 (Pineault et al, 2003), HOXA10 (Pineault et al., 2004)). However, unlike the decrease in disease latency observed for co-expression of Meisl and NUP98-HOX fusions, there was no overt collaboration observed for NUP98-TOP1 and Meisl.  Our second strategy to identify potential co-operating genes was to investigate the genomic sites into which the NUP98-TOP1 provirus integrated in the hematopoietic cells of leukemic mice. This approach was based on the possibility that coincident with the integration 102  of the NUP98-TOP1 virus, was activation of a cellular oncogene or inactivation of a tumor suppressor gene. In the course of examining 4 leukemic mice, and 5 integration sites, we found a leukemic mouse in which the NTJP98-TOP1 retrovirus inserted into the second intron of the ICSBP (interferon consensus sequence binding protein) gene. This was particularly provocative given that ICSBP has been characterized as a tumor suppressor gene as evidenced by a high percentage of human AML and CML lacking ICSBP transcripts (Schmidt et al., 1998) and by 7G£#P-deficient mice which develop a CML-like disease (Holtschke et al., 1996). We thus explored whether inactivation of ICSBP could collaborate with NUP98-TOP1 to accelerate onset of leukemia by expressing the NUP98-TOP1 fusion in ICSBP deficient BM.  5.2 5.2.1  Results Analyzing NUP98-TOP1 mice for retroviral integration sites To investigate potential genes that can accelerate the onset of NUP98-TOP1 induced  leukemia, mice that succumbed to leukemia upon by retroviral over-expression of NUP98TOP1 (See Chapter 3.2) were analyzed for the genomic sites of retroviral integration. A schematic representation of the protocol used to identify proviral insertion sites is illustrated in Figure 5.1. Briefly, genomic DNA purifiedfromsplenocytes or BM of leukemic mice was digested with PstI and thefragmentsligated to a vectorette containing a double stranded "bubble" linker sequence (as described in detail in Chapter 2.12). A nested PCR was performed that would ultimately amplify genomic DNA sequence flanking the 5' LTR of the pro-virus. The products of the PCR can be sequenced and their identity and genomic location can be ascertained. This technique allowed identification of the genomic location of NUP98-TOP1 retroviral integration.  103  Genomic DNA with Integrated provirus  j  p  p  p  .1  I  I  p  I  PstI Digestion  1  p p*  P  JP  L  p  L p J  Ligation of Bubble Linker - 56 nt Linker with Psfl end - 30 nt of non-homology creates "bubble" -Bubble primer =  - Psfl generates short fragments (approx 500 bp) - Bubble primer can anneal to ANY fragment with Psfl ends  ii)  P  Proviral DNA 3' LTR  iii)  Genomic DNA  PCR  B 5' Flanking genomic DNA  5' LTR PCR-A: - Extension from GFP-A primer and linker specific primer synthesizes minus (-) strand DNA and complement of bubble sequence  O. - Synthesis of plus (+) strand from bubble primer  PCR-B: - Nested primers from GFP and linker sequence are used to amplify genomic DNA and 5' LTR  Agarose gel Electrophoresis TOPO cloning into PCP.4 vector Sequencing Identification by BLAT search  Figure 5.1 Schematic representation of the protocol used to identify the genomic locus of NUP98-TOP1 retroviral integrations. (A) Genomic DNA from leukemic NUP98-TOP1 mice was digested with PstI and ligated to a linker containing non-homologous sequence. Three potential PstI fragments could be generated that contain either (i) Genomic sequence downstream of the 5' LTR, (ii) Proviral sequence before the 3' LTR and (iii) Genomic sequence with no pro-viral elements. (B) Nested PCR using GFP and linker specific primers is used to amplify the genomic DNA flanking the 5'LTR. Fragments were sequenced and analyzed in a BLAT search.  104  A total of 12 leukemic NUP98-TOP1 and NT-Y723F mice were analyzed from 3 independent experiments. However, PCR products were not successfully amplified from all mice. This may be due to the closest 5' PstI site located too far downstream to allow successful amplification of a PCR fragments, or the presence of sequence that is difficult for PCR amplification such as GC rich sequence. A total of 5 genomic sites flanking the LTR were successfully identified from 4 independent mice representing 2 separate experiments. All integration sites were different and mapped to introns of predicted or known genes (Table 5.1). Southern blot analysis was performed on DNAfrom3 out of 4 mice to verify the number of proviral integrations (Figure 5.2). As seen with PCR, 2 integrations were present in mouse 9.11 and a single integration in mouse 9.14. However while 2 integrations were observed by Southern blot in mouse 9.9, only 1 integration site was successfully amplified by PCR. Southern blot analysis was not performed on DNA from mouse 4.6. One proviral integration occurred in a predicted gene and 1 occurred in a gene with unknown function. Two integrations occurred in genes that have no known role in transformation or hematopoiesis and none of these sites were followed further. Of interest was one mouse (herein called NT 9.11) which had a retroviral integration in the second intron of the Interferon consensus sequence binding protein (ICSBP) gene. ISCBP is a tumor suppressor gene that exhibits decreased expression levels in several human leukemias. Moreover, ICSBP knock out mice manifest a hematopoietic abnormality that is similar to CML (Holtschke et al., 1996). Further studies were conducted to assess the possible functional relevance of this integration.  105  Table 5.1 NTJP98-TOP1 Retroviral integration sites Mouse  Chromosome  Intron /  ( E X P #, m o u s e ID)  #  Exon  4.6  1  Intron 1  Gene  Survival ( D a y s post-tx)  4733401011RIK  209  Amyotrophic Lateral Sclerosis 2 homolog (Human) 9.9  2  Intron 2  R I K E N clone  176  G630032A08 (unknown function) 9.11  5  Intron  m S S H - L 1 (Murine  321  Slingshot-Like)  9.14  8  Intron 2  Icsbpl  2  Intron 3  Predicted G e n e  240  (NT-Y723F)  9.9 9.11 9.12 9.14  Figure 5.2 Southern blot analysis of leukemic NTJP98-TOP1 mice demonstrating the number of proviral integrations. Genomic DNA was digested with EcoRI which cuts once in proviral sequence. Mouse 9.9 has 2 integrations but only 1 site was amplified by PCR. Mice 9.11 and 9.14 had 2 and 1 integrations respectively. No PCR bands were successfully amplified from mouse 9.12 and Southern blot analysis was not performed on mouse 4.6.  106  5.2.2  Integration of the NUP98-TOP1 retrovirus into ICSBP PCR was performed to confirm that the NUP98-TOP1 pro virus integrated into the  ICSBP locus. As illustrated in Figure 5.3A, primers were designed specific to ICSBP that would amplify a 200 bp bandfroman intact ICSBP gene. Additional primers were designed that are specific to the GFP sequence within the retroviral vector and specific to ICSBP which would amplify an 800 bp band only if the NUP98-TOP1 retroviral vector had integrated within the ICSBP locus. As illustrated in Figure 5.3B an intact ICSBP allele (represented by a 200 bp band) was detected in a control mouse and NT9.11 plus all secondary mice transplanted with BMfromthe NT9.11 mouse. In contrast, using the GFP/ICSBP primer pairs, the NUP98-TOP1 retrovirus is only evident in NT9.11 plus its secondary recipients and not in control splenocytes. These results demonstrate that NUP98-TOP1 integrated into the ICSBP gene but left intact the other allele. In an attempt to determine whether integration of NUP98-TOP1 disrupted the ICSBP transcript, Northern blot was performed using RNAfromthe spleens of NT9.11 secondary recipients (Figure 5.3C). Using an ISCBP cDNA probe, it can be demonstrated that a full-length ISCBP transcript is present in these mice. Although a truncated transcript cannot be detected, the predicted size of a transcript coding the first 2 exons is 194 bp and would be too small to be detected on the gel. Moreover the absence of a second truncated transcript could indicate that the proviral insert generated a non-sense transcript that was consequently degraded. Of note, when ICSBP knock out mice were generated, the PGK-neo cassette was inserted into the second exon, similar to the 5' region where NUP98-TOP1 integrated. We can thus predict that this integration resulted in disrupted ICSBP expression, leading to heterozygous expression of the gene.  107  LTR  LTR  ^ H ^ ^ — D — D 1 2  200 bp 3  5  4  7  6  8  9  x NT  IRES  GFP 800 bp  B -7-  _j  O  O  Z  r  O)  Ol  N  lO  O?  CT  j  0>  O)  0)  O)  Ol  O)  0)  r - l - H H H I - H ^ I - l - t - l - l - l - l - - . Z  Z  Z  Z  Z  ^  O  Z  Z  Z  Z  Z  Z  J  ,  800 bp — • -4—200 bp  NTf9.11 spl (-) 1 2 4 6  293T  Figure 5.3 NUP98-TOP1 integration into ICSBP (A) Schematic representation of PCR strategy to confirm NUP98-TOP1 integrated into an allele of ICSBP. (B) PCR results confirming that NUP98-TOP1 integrated into ICSBP and that one ICSBP allele is intact. (C) Northern blot analysis with an ICSBP probe.  108  5.2.3  Collaboration of NUP98-TOP1 and ICSBP deficiency Disruption of ICSBP by retroviral integration may have provided an additional genetic  mutation required for NUP98-TOP1 to induce leukemia. Of note, 9% of: ICSBP"  /+  mice and  33% of ICSBP' ' mice succumb to leukemia with a long latency. To ascertain whether reduced 1  expression of ICSBP can collaborate with NUP98-TOP1 to accelerate the onset of leukemia, we expressed NUP98-TOP1 in ICSBP deficient bone marrow (ICSBP'''). Although the integration pattern in our mouse would have generated heterozygous (ICSBP' ) expression, we wished to /+  initially ascertain the collaborative potential in the most extreme setting i.e. in ICSBP knock-out BM. The experimental design is depicted in Figure 5.4. In a collaboration with Dr. Carol Stocking in Hamburg, Germany, 5-FU treated BM was harvested from ICSBP''' mice (described in Holtschke et al., 1996; Schwieger et al., 2002), frozen and shipped on dry ice for use in the following experiments. As controls, BM was harvested from 5-FU treated PepC3 and C57B1/6 mice; the former strain was used to conduct experiments with NUP98-TOP1 as described in Chapters 3 and 4, and the latter strain is the background on which the ICSBP' ' mice were engineered. At the time of harvest, the ICSBP' ' 1  1  BM cells were thawed and all three types of BM were prestimulated for 48 hours. Each type of BM was transduced with NUP98-TOP1 and GFP control retrovirus for 48 hours, as described in Chapter 3. Lethally irradiated recipient mice received 2xl0 BM cells with no pre-selection for 5  GFP transduced cells, along with 2xl0 helper cells to provide immediate radiation protection. +  5  Recipient mice were; B6C3 for PepC3 donor BM, and Pep3B for C57B1/6 and ICSBP " donor 7  BM.  109  Day  4  Day  Pre-stimulation  6  Day 8  Infection  Transplant mice  Pep3B  B6C3  Pep3B  Figure 5.4 Schematic outline otNUP98-TOPl expression in ICSBP BM BM was harvested following 4 days of 5-FU treatment from ICSBP " mice, PepC3 mice (the strain used in the original experiments) and C57B1/6 mice (the background on which the ICSBP-/- were generated). Note: the boxed section indicates the BM was frozen following harvesting and shipped to Vancouver where it was thawed on Day 4 of the other experimental arms. All BM was pre-stimulated for 2 days then transduced with either GFP control or NUP98-TOP1 retrovirus for 2 days. 2x10 unselected, transduced cells were transplanted into lethally irradiated mice along with 2x10 helper cells. V  s  s  5.2.4  NUP98-TOP1 induces an in vivo growth advantage that is accelerated on an ICSBF background  A  To assess the effect of ICSBP' ' and NUP98-TOP1 expression in vivo, we monitored 1  changes in the PB of transplanted mice at various times post transplant. The initial infection efficiency of NUP98-TOP1 in BM from all 3 strains of mice was consistently low (3.7% into PepC3, 3.6% into C57B1/6 and 1.9% into ICSBP""), while higher levels were achieved with the 7  control GFP transduction (56.3%, 71.6% and 31.8% respectively). Over time, the proportion of GFP cells in the PB of GFP-control transplant recipients remained relatively constant for the +  110  PepC3 and C57B1/6 mice, while the proportion in the ICSBP"" mice decreased (Figure 5.5). In contrast, analysis of mice transplanted with NUP98-TOP1 transduced cells revealed a progressive increase in the proportion of GFP PB cells over time. Notably, as early as one +  month post-transplant mice that received PepC3 and C57B1/6 NUP98-TOP1 transduced marrow displayed an approximate 10-fold increase in percentage of GFP cells compared to the +  percentage in the transplant inoculum. Strikingly, this effect was exaggerated in mice that received NUP98-TOP1 transduced ICSBP' ' BM. An approximate 44-fold increase in the 1  percentage of transduced cells was observed at one-month post-transplant compared to the initial transduction frequency (Figure 5.5C). These results demonstrate that the in vivo proliferative advantage previously documented for NUP98-TOP1 is accelerated in the ICSBP' ' 1  background. A  B  Days post-transplant  C  Days post-transplant  D  a  y  s  p o s H r a  nsplant  Figure 5.5 ICSBP-/- B M enhances the in vivo proliferative effect of NTJP98-TOP1 expression The proportion of G F P cells in the PB of transplanted mice was analyzed at various times post-transplant. Panels (A), (B) and (C) depict mice transplanted with donor B M from PepC3, C57B1/6 and ICSBP" " mice respectively. Shaded; NUP98-TOP1, Open; GFP control. Graph represents a single experiment with n=3 GFP control mice and n=6 NUP98-TOP1 mice in each arm. +  7  The increase in the proportion of GFP cells was associated with an increase in the +  absolute number of circulating white blood cells. While NUP98-TOP1 induces a progressive increase in the WBC numbers, the effect was again exacerbated in ICSBP' ' BM. As illustrated 1  in Figure 5.6A and Table 5.2, at 1 month post-transplant white cell counts in NUP98T0P1/ICSBP " mice were increased significantly compared to GFP-control/ICSBP " (54.6 ± 72 7  7  111  x 10 vs. 3.9 ± 1.6 x 10 cells / ml; p=.005) as well as compared to NUP98-TOP1 mice 6  6  transplanted with ICSBP BM. (PepC3, 9.5 ± 6.6 x 10 cells / ml p=.007; C57B1/6, 9.2 ± 5.0 x +/+  6  10 cells / ml, p=.008.). At 4 months post-transplant, the white blood cell numbers were still 6  elevated in NUP98-TOP1 mice compared to control mice for each strain (Figure 5.6B) and moreover NUP98-TOPl/ICSBP""mice had elevated numbers compared to ICSBP mice. /  +/+  These results demonstrate that reduced expression of ICSBP co-operated with NUP98-TOP1 to induce an immediate increase in PB cell counts which persists for several months posttransplant.  A  B 1.D-09  1.E+09  1.E+08  PepC3  C57BI/6 Donor BM  PepC3  ICSBP"'"  C57BI/6 Donor BM  ICSBP"'"  Figure 5.6 ICSBP increases the number of nucleated peripheral blood cell numbers The number of nucleated peripheral blood cells was counted at 1-month (A) and 4-months (B) post transplant. NUP98-TOP1 induced an increase in cell numbers compared to control in each strain of donor B M , however the effect was more exaggerated in ICSBP"'" B M . Hatched- GFP control; shaded- NUP98TOP1.  112  Table 5.2 Peripheral blood cells values obtained post-transplant. 4 months post-transplant  1 month post-transplant WBC / ml ,„« x10 6  PepC3  C57BI/6  ICSBP-/-  MIG  7.1 ± 4.4  NUP98-TOP1  9.5 ± 6.6  MIG  3.9 ± .92  NUP98-TOP1  9.2 ± 5.0  MIG  3.9 ± 1.6  NUP98-TOP1  WBC / ml X10  p-value  6  p-value  7.415.3  -~| .33  11.9 ±4.5  17  -,  8.3 ±2.8 -~| .03  .008  15.4 ±13.4 .007  -]" J 005  54.6 ± 72,  .04  6.0 ±2.1  .10  27.4 ± 17.8  Values represent mean± stdev.  5.2.5  The ICSBF ' background co-operates with NUP98-TOP1 to induce an in vivo 1  myeloproliferation Flow cytometric analysis was performed to ascertain the effect of ICSBP deficiency on lineage cell distribution. At 1 month post-transplant it was evident that an ICSBP deficiency enhanced the myeloproliferative effect induced by NUP98-TOP1. In each strain of mouse, there was an increased proportion of circulating myeloid cells (Gr-1 and Mac-1 ) in the NTJP98+  +  TOP1 compared to the GFP control mice (Figure 5.7A). Notably, in the NUP98-TOP1/ICSBP " 7  mice, 75% of the cells expressed myeloid markers compared to <40% in either of the NUP98TOPl/ICSBP mice (p <005). Examining the proportion of transduced cells (GFP ) in the +/+  +  lineage positive cells revealed that it was the NUP98-TOP1 transduced cells that were contributing to the myeloproliferation (Figure 5.7B,C). Moreover, there was minimal contribution of NUP98-TOP1 transduced cells to B- or T-lymphocytes (B220 and CD4/CD8 +  respectively) (Figure 5.7C,D). These results are consistent with our previous analysis of NUP98-TOP1 expression, but highlight that a more dramatic myeloproliferative effect is observed at an earlier time point in the absence of ICSBP expression.  113  +  Figure 5.7 ICSBP-/- enhances the short-term myeloproliferation induced by NUP98-TOP1 The lineage distribution of the peripheral blood cells was assessed by flow cytometry at one month posttransplant. Panel (A) represents the total proportion of lineage markers in peripheral blood of the recipient mice. Panels B-D represent the proportion of lineage positive cells in either the GFP" (hatched) or GFP (solid) populations. Values are mean ± stdev. +  5.2.6 ICSBF  1  BM collaborates with NUP98-TOP1 expression to accelerate the onset of  leukemia. In our previous experiments, expression of NUP98-TOP1 induced a lethal AML with long latency (average 225 ± 56 days). The earliest time point that a mouse became moribund was 149 days post-transplant. Strikingly, when expressed in the ICSBP' ' background, NUP981  TOP1 induced disease in one mouse at 33 days post-transplant. This mouse had extremely elevated white cell counts (>2xl0 cells / ml) but was only mildly anemic (5.2x10 cells / ml). 114  FACS analysis revealed that the PB cells were >95% GFP . Moreover, >95% of the cells +  stained positive for myeloid markers (Gr-1 and Mac-1) and most were negative (<3%) for +  lymphoid markers (B220 and CD4\CD8). Wright-Geimsa stained PB smears revealed the presence of immature/ blast-like forms (Figure 5.8 A). The mouse had a hunched posture and was lethargic, thus it was sacrificed for further analysis. Post-mortem analysis revealed splenomegaly (.48g) and pale femurs. FACS analysis of the BM and spleen demonstrated the transduced cells were highly positive for myeloid markers and negative for both B-cell and erythroid markers (Figure 5.8B). These features are consistent with the diagnosis of leukemia At 130 days post-transplant, 2 more NUP98-TOPl/ICSBP""mice were showing signs of /  hematological distress including elevated PB cell numbers, myeloproliferation and the presence of circulating blast cells. These mice were sacrificed in accordance with animal facility guidelines and further analysis of these mice again confirmed the onset of leukemia. While NUP98-TOP1/ ICSBP mice were beginning to show signs of mild +/+  myeloproliferation at 130 days post-transplant as assessed by FACS analysis, the PB cell numbers were not significantly elevated compared to controls and there were no overt behavioral signs indicating distress. These results are consistent with those previously reported for NUP98-TOP1 expression. Thus, these early time points of leukemia onset in ICSBP' ' BM 1  demonstrate that it collaborates with NUP98-TOP1 expression to accelerate the onset of disease. Moreover, these experiments demonstrate the power of retroviral integration site analysis for discovering novel collaborating genes.  115  Figure 5.8 The ICSBP" background accelerate the onset of NUP98-TOP1 induced leukemia (A) A peripheral blood smear of a leukemic NTJP98-TOP1/ICSBP"'" mouse at 33 days post transplant reveals the presence of circulating blast cells. (B) FACS analysis of the B M and spleen cells from the leukemic mouse.  116  5.3  Discussion Our previous results demonstrate that expression of NUP98-TOP1 alone is clearly  sufficient to perturb the normal differentiation and proliferative pathways in hematopoiesis. However, the long latency for mice to succumb to AML coupled with significantly reduced disease latency in secondary mice suggests that additional genetic alterations may be required for the full leukemogenic transformation. In Chapter 3.2.5, we used the candidate gene approach to test the collaborative potential of Meisl, and found that unlike select NUP98-HOX fusions (Kroon et al., 2001; Pineault et al., 2003), there was no overt acceleration of AML upon coexpression of Meisl and NUP98-TOP1.  In this chapter we used retroviral integration site analysis in attempt to identify novel potential collaborating genes for NUP98-TOP1. We followed the serendipitous finding of NUP98-TOP1 integration into the locus of the ICSBP tumor suppressor gene. Although the course of disease in the NUP98-TOP1 mouse with the ICSBP integration was not significantly different from any other leukemic NUP98-TOP1 mouse, we chose to exploit this finding as ICSBP has previously been implicated in leukemogenesis. Strikingly, expression of NUP98TOP1 in ICSBP''' BM accelerated the onset of myeloproliferation and fatal AML when compared to its expression in ICSBP  +/+  BM.  The finding of collaboration is consistent with previous reports on ICSBP function. Down-regulation of ICSBP is observed in human leukemia patients (Schmidt et al., 1998) and knock-out mice exhibit a CML-like disease (Holtschke et al., 1996). Moreover, over-expression of ICSBP inhibits the transforming capacity of BCR-ABL (Tamura et al., 2003). Notably, expression of the AML1-ETO fusion gene has also been reported to synergize with an ICSBP deficiency (Schwieger et al, 2002). Mice that received AML1-ETO transduced ICSBP ' BM 1  showed marked granulopoiesis, increased blast cell formation in the BM and the development of 117  granulocytic sarcomas, compared to mice that received control transduced ICSBP'' BM. However, mice survived up to 1 year of age with no signs of morbidity and only 1 out of 3 sacrificed animals displayed blast infiltration into non-hematopoietic organs. While this evidence suggests that an ICSBP deficiency may act as a general collaborator with multiple fusion genes, its collaboration with NUP98-TOP1 is much stronger than observed with AML1-ETO. NUP98-TOP1 /ICSBP"" mice succumbed to AML as early as 1 month post7  transplant with 3/6 mice moribund in 4 months. Moreover, the myeloproliferative effects of NUP98-TOP1 were greatly enhanced in the ICSBP' ' BM (compared to ICSBP 1  +/+  BM) as  evidenced by the increased proportion of circulating myeloid cells and increased numbers of WBCs. These observations emphasize power of retroviral integration site analysis to aid in the identification of novel or potential collaborating genes. A striking example of the power of retroviral integration to induce leukemia stems from a recent gene therapy trial for SCID-X1 (Hacein-Bey-Abina et al., 2003). Children in this study were cured by autologous BM transplants with CD34 BM cells ex vivo infected with IL2RGcontaining retrovirus. Unfortunately, 3 years following therapy, 2 of the children developed Tcell leukemia. Both patient's leukemias had the retrovirus integrate into the proximity of the LM02 oncogene leading to its aberrant expression. Recently a database has been developed to manage the high-throughput insertional mutagenesis screening projects that are currently being employed in the post-genome-sequence era (Akagi et al., 2004). Using high throughput inverse PCR a team led by Neal Copeland cloned and analyzed sequences of nearly 900 retroviral integration sites (RIS) obtained mostly from a tumor panel generatedfromAKXD mice. Comparing these sequences to those previously clonedfromBXH-2 mice, they identified 150 loci that are considered common integration sites (i.e. loci that contain retroviral integrations in >1 tumor) and thus likely encode 118  a leukemia-associated gene (Suzuki et al., 2002b). Interestingly, most of the identified genes can be classified into groups commonly associated with cancer such as transcription factors, chromatin remodeling proteins. It will be of interest to validate each gene to assess its potential for leukemogenesis. These findings coupled with the results presented in this chapter argue merit in the careful analysis of all retroviral integration sites. Although to date we have not conducted follow-up experiments to ascertain the contribution of the other integration sites, it can be hypothesized that these integrations also contribute to the resulting leukemia. As most of the leukemias analysed in NUP98-TOP1 mice were clonal, we can hypothesize that a particular clone becomes dominant due to an additional survival signal provided via the retroviral integration. Of note, most genes identified through integration site analysis in BXH2 mice and other experimental models have been proto-oncogenes which become activated upon the retroviral insertion. In contrast, we describe here an integration that leads to a knock-out of the ICSBP gene. To our knowledge, these results provide the first example of insertional mutagenesis leading to reduced expression of a tumor-suppressor gene.  119  Chapter 6 Discussion Chromosomal translocations involving the nucleoporin gene, NUP98, on chromosome 1 lpl5 represent a novel class of translocations recently identified in AML. Since the identification of NUP98-HOXA9 in 1996, 16 distinct fusion partners have been reported for NUP98. Curiously, over half of the NUP98 fusion partners identified to date belong to the homeobox family of transcription factors. Molecular characterization to date has been limited to two NUP98-HOX genes. In this thesis, I present the initial characterization of the NUP98-TOP1 fusion gene associated with t(l l;20)(pl5;ql 1). Notably, this is the first description of a NUP98 non-homeobox fusion gene. I describe key findings pertaining to the expression of the NUP98TOP1 fusion gene in murine BM, delineation of key domains necessary for its leukemiainducing potential and examine candidate genes to assess their collaborative potential in accelerating the induction of NUP98-TOP1 induced leukemia. 6.1  The NUP98-TOP1 retrovirus had low infection efficiency To date, only a handful of leukemia patients have been reported in the literature as  harbouring the t(l 1;20) translocation. However, NUP98 translocations are increasingly being identified in leukemias and the same clinical disease is observed following its fusion to seemingly unrelated genes. Thus, gaining an understanding of NUP98-TOP1 induced leukemia may provide further insight into the mechanism of NUP98 fusions in general. We initially wished to ascertain whether NUP98-TOP1 alone is sufficient to perturb hematopoiesis in vitro and in vivo, and to confirm that this rearrangement is the causal event in leukemogenesis. To this end we expressed the fusion gene in murine BM using a retroviral vector linked to a GFP-selectable marker. It was both interesting and discouraging to note that the infection efficiency of NTJP98-TOP1 was consistently low (-1% GFP cells in n>5 +  independent experiments). However, this was not the first documented report of a fusion gene 120  having low transduction efficiency. Retroviral expression of MLL-CBP (Lavau et al., 2000) was similarly was only able to transduce ~1% of its target BM while TEL-AML1 retrovirus has titers 2-fold lower than control (Bernardin et al., 2002). One can speculate enforced expression of fusion genes may be toxic to cells, and this wider-spread phenomenon perhaps goes unreported. Moreover, it has been reported that expression of TOPI alone is toxic to cells. Some unpublished observations I obtained following examination of DAPI stained transfected cells revealed a higher incidence of fragmented nuclei in NUP98-TOP1 transfected cells than in control, consistent with the induction of apoptosis. When considering the course of disease in human patients, it is important to remember that the translocation will initially arise in only a single cell. This cell then acquires the ability to self-renew, proliferate and clonally give rise to its progeny. The low gene transfer efficiency in our experiments only targets the fusion gene to a small number of cells, or perhaps even a single cell, and thus essentially mimics the disease course in human patients.  6.2  Acceleration of disease in NUP98-TOP1 secondary recipient mice Following a long latency, mice expressing NUP98-TOP1 succumb to an acute myeloid  leukemia. The disease is transplantable to secondary recipients which develop AML with a significantly reduced latency. We can speculate this may be a dosage effect as only -1% of the transplanted BM cells initially expressed NUP98-TOP1 in the primary recipients, while almost 100% of the cells transplanted into secondary recipients expressed the fusion. To test this hypothesis, one could transplant varying doses of transduced cells into the recipient mice and look for a correlation in time of disease onset. While the low gene transfer efficiency of NTJP98TOP1 precluded any further experiments of this nature in the primary recipients, a correlation between cell dose and disease onset was observed in secondary recipients. An alternative 121  hypothesis is that the BM cells in the primary mice initially only carried a single hit (NUP98TOP1) and required time to acquire additional mutations. However, the leukemic cells transplanted into the secondary mice were fully transformed and thus able to induce disease in a shorter time.  6.3  Critical domains of the TOPI fusion partner Of great interest was the observation that a mutation to the TOPI active site, known to  abolish the catalytic, unwinding activity of TOP, did not alter the leukemogenic effects of the NUP98-TOP1 fusion protein. That removing the key biological function of the TOPI partner gene did not prevent leukemogenesis, suggests that other properties or domains of the protein may be involved in the pathogenesis of disease. We attempted to define the required domains by selectively deleting the known structural domains established for TOPI and testing the biological effects. Although not investigated within this thesis, a complementary approach to ascertain the required domains of TOPI would have been to fuse the individual domains of TOPI to NUP98. Alternatively, sequential deletions beginning from either the 5' or 3' end could have been performed to determine the minimal sequence required for transformation. 6.3.1  Requirement for intact DNA binding domains of the TOPI fusion partner In vitro and in vivo it was reported that mutations to the HOX homeodomain abrogated  the transforming potential of the NUP98-HOX fusions. These mutations were engineered to key residues that are known to abolish DNA binding. It could thus been hypothesized that a requirement of the NUP98-fusion partner is the ability to bind DNA. To ascertain if this requirement held true for NUP98-TOP1, we attempted to engineer a similar DNA-binding defective mutation in TOPI. However, unlike HOX proteins, there are no specific point mutations published that are known to abrogate TOPI DNA binding. Thus we selectively 122  deleted the 2 critical domains of TOPI that contain residues involved in the enzyme binding to DNA. The TOPI enzyme binds DNA like a clamp, with residues from the core domain and cterminal domain contacting the DNA. We engineered NUP98-TOP1 mutants in which the core domain (NTACD) and C-terminal (NTAC-term) domain were individually deleted. When tested in liquid culture assays, both the NTACD and NT AC-term mutants failed to exhibit the growth promoting effects of "wild-type" NUP98-TOP1. These experiments suggest that similar to NUP98-HOX fusions, the leukemogenic transforming ability of NUP98-TOP1 depends on the ability of the TOPI fusion partner gene to bind DNA. As these were large deletions that removed 420 and 53 bp respectively, we cannot rule out that removal of certain residues, or other domains, contributed to the loss of transforming potential. Moreover we further cannot rule out aberrant protein folding, although the expected protein size was obtained by Western Blot. However, our results are consistent with those observed for NUP98-HOX fusions and suggest DNA binding ability as a common requirement of the NUP98 partner gene. To definitively prove that the NUP98 partner gene requires DNA binding ability, it would be necessary to fuse NUP98 to domains other than the homeodomain that are capable of binding DNA (e.g. to a zinc finger or leucine zipper domain, or to other domains found in transcription factors). 6.3.2  Coiled-coil domain A common theme among the 7 non-homeodomain containing NUP98 fusion partners  identified to date, is the presence of sequence predicted to adopt a coiled-coil domain (Hussey and Dobrovic, 2002). Resolution of the crystal structure has confirmed the presence of this domain for TOPI (Stewart et al., 1998). Intriguingly, aNUP98 fusion involving Topoisomerase IIB has recently been identified in an AML patient with t(3;l I)(p24;pl5) (K. Humphries, personal communication). Protein analysis revealed the presence of 2 potential coiled-coil 123  domains in the C-terminus of TOP2 which would be retained in the NUP98-TOPIIB fusion. Coiled-coil domains are ubiquitous protein folding and assembly motifs comprised of alpha-helices. They are principally involved in mediated protein-protein interactions. As discussed in Chapter 1.3.4, there are several leukemic fusion proteins in which dimerization mediated via the coiled-coil domain of the fusion partner is necessary for the leukemogenesis. Besides the tyrosine kinase and MLL fusions, the transforming ability of the PML-RARa and AML1-ETO fusion genes has similarly been shown to be dependent on the coiled-coil protein dimerization domain of the PML and ETO partner genes respectively. The coiled-coil domain induces dimerization of the fusion protein which subsequently represses transcription through histone deacetylation by recruitment of several nuclear receptor co-repressors (Minucci et al., 2000; Rego and Pandolfi, 2001). Whether the coiled-coil domains of NUP98 fusion partner proteins induce dimerization, and whether it is necessary for the transforming potential awaits further investigation. To ascertain whether a coiled-coil domain is necessary and/or sufficient for NUP98 transformation, a pharmacologically dimerizable NUP98 fusion protein could be engineered. Similar to experiments conducted withMZZ (Martin et al., 2003), the FK506 binding protein (FKBP12) which homo-dimerizes in the presence of the dimerizer AP20187, could be fused to NUP98 and tested for its ability to transform murine BM.  6.4  Collaborating genes While evidence in the literature suggested Meisl was a strong candidate gene, results  reported in Chapter 3.2.5 (and other experiments not contained within this thesis) demonstrate that co-expression of Meisl does not collaborate with NUP98-TOP1 in the induction of leukemia. This distinguishes NUP98-TOP1 from the NUP98-HOX fusions and encourages a search for novel collaborating genes. 124  Using a clue from retroviral integration into the ICSBP locus, we tested the collaborative potential of NUP98-TOP1 expression in ICSBP' ' BM and found rapid acceleration of disease 1  onset. These results are in agreement with the 2 hit-model of leukemogenesis described in Chapter 1.6. It can be reasoned that NUP98-TOP1 would fall into the same complementation class as NUP98-HOXA9 which has been classified as a Class II mutation (those that impair hematopoietic differentiation). Moreover, AML1-ETO, another Class II fusion, also collaborates with an ICSBP deficiency, providing further support that NUP98-TOP1 would be classified in the same group. Whether ICSBP deficiency accelerates leukemia induced by other NUP98 fusions would be interesting to ascertain. This again would provide insight into whether this group of fusions has common or distinct mechanisms of leukemia. Moreover, whether ICSBP expression is decreased in patients with NUP98-TOP1 translocations or other NUP98 translocations would be of clinical interest to ascertain. ICSBP is implicated in the interferon regulatory pathway and interferon alpha is used clinically in disease treatment. Thus we can envision a scenario where a first hit mutation of NUP98-TOP1 could be treated with interferon induction therapy. The results from our retroviral integration site analysis further argue that it may be fruitful to intentionally induce insertional mutations by infection with virus such as the control MSCV vector used in this thesis. To this end, we generated BM cell lines expressing GFPlinked NUP98-TOP1. These cell lines exhibited significant levels of short-term in vivo myelorepopulating ability when transplanted into lethally irradiated recipients, but did not induce overt leukemia (Gurevich et al., 2004a). In attempt to identify collaborating genes that would allow for long term engraftment of the cell line and the induction of leukemia in recipient mice, the cell line was infected with a yellow fluorescent protein (YFP)-linked MSCV retrovirus. The rationale, similar to results presented in Chapter 5, is that retroviral insertional mutagenesis may 125  activate or inactivate a collaborating gene required for leukemogenesis. While 10/11 mice failed to express any long-term donor derived cells, strikingly, 1 mouse expressed high levels of doubly-transduced GFP /YFP cells for >5 months post-transplant. The mouse became +  +  moribund with an AML-like disease which was transplantable to secondary recipients. The genomic site of retroviral integration is currently being investigated. Identification of the gene at this site may provide additional insight into novel collaborating pathways for NUP98-TOP1.  6.5  Potential mechanisms of NUP98-fusion leukemogenesis Studies characterizing NUP98-TOP1 and NUP98 fusions as a group are in their infancy.  While no model has been identified for their mechanism of leukemogenesis, several models can be hypothesized. 6.5.1  Disrupted nuclear transport: As NUP98 is disrupted in > 16 distinct translocations, it can be hypothesized that  deregulated NUP98 activity contributes to leukemic transformation. As a member of the nuclear pore complex, a role for NTJP98 has been established in nuclear trafficking (Wu et al., 2001) One can hypothesize that disruption of NUP98 may prevent proper nuclear-cytosolic shuttling. If some gene or transcription factor required for normal hematopoietic differentiation is not properly imported to or exportedfromthe nucleus, its disrupted expression may promote leukemogenesis. Accordingly, it has been demonstrated that both NUP214 (CAN) fusions (SET-NUP214 and DEK-NUP214) interact with the hCRMl export factor (Boer et al., 1998; Saito et al., 2004). Moreover, nuclear export of an hCRMl-regulated protein was prevented in cells that express SET-CAN. While it has not been formerly tested, we can hypothesize, that cells expressing NUP98 fusions may also aberrantly affect nuclear export thus preventing proper expressing of a protein required for normal hematopoiesis. 126  6.5.2 Dominant negative effects: Deregulated NUP98 by chromosomal rearrangement may lead to dominant-negative effects either on NUP98 or on the partner gene. As discussed in Chapter 3, it can be hypothesized that NUP98-TOP1 has dominant negative effects on TOPI leading to genomic instability. While we cannot exclude this possibility, several lines of evidence suggest against a dominant-negative effect on topoisomerase activity. Foremost, TOPI is essential for cell growth as evidenced in Drosophila melanogaster and murine knock-out models (Lee et al., 1993; Morham et al., 1996). Furthermore, decreased levels of TOPI are inconsistent with a leukemic phenotype as elevated levels of TOPI have been observed in cancer cells (Giovanella et al., 1989), and TOPI inhibitors are widely used clinically in the treatment of leukemia and other cancers (Pommier et al., 1998). Moreover, no gross chromosomal abnormalities were observed in NUP98-TOP1 BM cells cultured for >4 weeks, suggesting that NUP98-TOP expression does not interfere with normal TOPI activity generating genomic instability. Whether NUP98 fusions act in a dominant-negative manner on NUP98 remains to be determined. Targeted knock out of murine Nup98, demonstrates that Nup98 is essential for mouse gastrulation suggesting that a dominant-negative effect is unlikely (Wu et al., 2001). While other nucleoporins may partially compensate for lack of NUP98, we cannot rule out that a hemi-zygous state such as that resultingfromtranslocations may alter nuclear shuttling. 6.5.3  Generation of a novel protein A third possibility for the mechanism of NUP98-induced leukemia is that these chimeric  proteins generate a neomorph, or a protein having a novel function independentfromthat described for either partner gene. Evidence for this is supportedfromexamination of NUP98 sub-cellular localization. NUP98 is localized within the cell both at the nuclearrimand within the nucleus (Griffis et al., 2002; Kasper et al., 1999; Radu et al., 1995) Within the nucleus it has 127  been shown to associate with novel nuclear bodies defined by Griffins et al as GLFG bodies, as the repeat domain of NUP98 is required for its nuclear localization. The subcellular localization of several NUP98 fusions has been reported as nuclear, with no evidence of a nuclear rim stain or nuclear body aggregates (Gurevich et al., 2004b; Kasper et al., 1999). That NUP98 fusions are not localized to sites of NTJP98 suggests that these fusions may have a novel function to that identified for NTJP98. Moreover, the C-terminal portion of NUP98 contains sequences that are likely responsible for its binding to the pore (Griffis et al., 2003). As this portion is lost in the leukemic fusion genes further suggests that NUP98 fusions cannot function like wild-type NUP98 and consequently have a novel function. It has been proposed that NUP98 fusion proteins act as aberrant transcription factors. DNA binding and specificity is mediated by the partner gene (HOXA9) and recruitment of accessory factors occurs via domains in NTJP98. The FG repeats of NUP98 have been shown to activate transcription and interact with the transcriptional accessory proteins, CBP and p300. These studies were performed in fibroblasts and further demonstrated that the NUP98 domain could be functionally replaced by NTJP214 FG repeats or the VP 16 transactivation domain. Support for this model is evidenced in expression profiling studies that revealed NUP98HOXA9 induces gene transcription in myeloid K562 cells. However, contradictory results were also obtained as expression of NUP98 alone had no effect on gene transcription (Ghannam et al., 2004). Moreover, as illustrated in this thesis, generation of a VP16-TOP1 fusion did not retain any transforming potential when expressed in murine BM. Similar unpublished results were obtained with VP16-HOXD13. Together, these results suggest that NUP98 contributes some unique function to the fusion that cannot be functionally replaced by a transcriptional activation domain. Further studies to determine whether the FG repeats interact with transcriptional machinery in hematopoietic cells awaits further investigation. 128  6.6  Unanswered questions  While several NUP98 fusion proteins have now been characterized in vitro and in vivo, there are still many unanswered questions. While we can speculate on proposed mechanisms, experiments specifically directed at determining a model need to be performed. It is still unknown whether proper nuclear / cytosolic shuttling occurs in cells expressing NUP98 fusion genes. As NUP98 is known to specifically interact with the M9 nuclear localization signal, it would be of interest to determine whether any known cytokines, growth or transcription factors involved in regulating hematopoiesis contain this sequence. The functional role (if any) of the coiled-coil domain predicted for the non-homeobox partners also remains to be determined. However, as it has been demonstrated as a key domain necessary for transformation of PMLRARo; and AML1-ETO fusion proteins, one would predict that coiled-coil domains are not a coincidental occurrence in NUP98 fusions partners and they do have a functional significance. Lastly, as several lines of evidence suggest that NUP98 fusions act as transcription factors, delineation of the target genes remains a critical area of investigation. It is my hope that by furthering the understanding of the basic mechanism of NUP98TOP1 induced leukemogenesis, one can gain insight into leukemias induced by other NUP98 fusions. This will hopefully translate to therapies ultimately aimed at curing myeloid leukemias.  129  Chapter 7  Bibliography  Ahuja, H. G., Felix, C. A., and Apian, P. D. (1999). The t(l l;20)(pl5;ql 1) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98TOP1 fusion. Blood 94, 3258-3261. Ahuja, H. G., Hong, J., Apian, P. D., Tcheurekdjian, L., Forman, S. J., and Slovak, M. L. (2000). t(9;l I)(p22;pl5) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75- lens epithelium-derived growth factor (LEDGF). Cancer Res 60, 6227-6229. Ahuja, H. G., Popplewell, L., Tcheurekdjian, L., and Slovak, M. L. (2001). NUP98 gene rearrangements and the clonal evolution of chronic myelogenous leukemia. Genes Chromosomes Cancer 30, 410-415. Akagi, K., Suzuki, T., Stephens, R. M., Jenkins, N. A., and Copeland, N. G. (2004). RTCGD: retroviral tagged cancer gene database. Nucleic Acids Res 32 Database issue, D523-527. Akashi, K., Traver, D., Miyamoto, T., and Weissman, I. L. (2000). A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature 404, 193-197. Albor, A., Kaku, S., and Kulesz-Martin, M. (1998). Wild-type and mutant forms of p53 activate human topoisomerase I: a possible mechanism for gain of function in mutants. Cancer Res 58, 2091-2094. Angrand, P. O., Apiou, F., Stewart, A. F., Dutrillaux, B., Losson, R., and Chambon, P. (2001). NSD3, a new SET domain-containing gene, maps to 8pl2 and is amplified in human breast cancer cell lines. Genomics 74, 79-88. Antonchuk, J., Sauvageau, G., and Humphries, R. K. (2002). HOXB4-induced expansion of adult hematopoietic stem cells ex vivo. Cell 109, 39-45. Arai, Y., Hosoda, F., Kobayashi, H., Arai, K., Hayashi, Y., Kamada, N., Kaneko, Y., and Ohki, M. (1997). The inv(l I)(pl5q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10. Blood 89, 3936-3944. Ayton, P. M., and Cleary, M. L. (2003). Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa7 and Hoxa9. Genes Dev 17, 2298-2307. Becker, A. J., Mc, C. E., and Till, J. E. (1963). Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature 197, 452-454. Bedigian, H. G., Johnson, D. A., Jenkins, N. A., Copeland, N. G., and Evans, R. (1984). Spontaneous and induced leukemias of myeloid origin in recombinant inbred BXH mice. J Virol 51, 586-594. Bedigian, H. G., Taylor, B. A., and Meier, H. (1981). Expression of murine leukemia viruses in the highly lymphomatous BXH-2 recombinant inbred mouse strain. J Virol 39, 632-640. 130  Berger, R. (1972). Translocation t(l 1;20) et polyglobulie primitive. Nouv Presse Med 4: 1972 4. Bernardin, F., Yang, Y., Cleaves, R., Zahurak, M., Cheng, L., Civin, C. I., and Friedman, A. D. (2002). TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia, induces acute leukemia in mice. Cancer Res 62, 3904-3908. Betts, D. R., Greiner, J., Feldges, A., and Niggli, F. K. (1998). A further case of a t(ll;20)(pl5;ql 1.2) translocation in an acute myeloid leukemia (FAB M2). J Pediatr Hematol Oncol 20,91-93. Bhardwaj, G., Murdoch, B., Wu, D., Baker, D. P., Williams, K. P., Chadwick, K., Ling, L. E., Karanu, F. N., and Bhatia, M. (2001). Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat Immunol 2, 172-180. Boer, J., Bonten-Surtel, J., and Grosveld, G. (1998). Overexpression of the nucleoporin CAN/NUP214 induces growth arrest, nucleocytoplasmic transport defects, and apoptosis. Mol Cell Biol 18, 1236-1247. Borrow, J., Shearman, A. M., Stanton V.P, J., Becher, R., Collins, T., Williams, A. J., Dube, I., Katz, F., Kwong, Y. L., Morris, C, et al. (1996). The t(7;l I)(pl5;pl5) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet 12, 159-167. Brown, D., Kogan, S., Lagasse, E., Weissman, I., Alcalay, M., Pelicci, P. G., Atwater, S., and Bishop, J. M. (1997). A PMLRARalpha transgene initiates murine acute promyelocytic leukemia. Proc Natl Acad Sci U S A 94, 2551-2556. Buske, C , and Humphries, R. K. (2000). Homeobox genes in leukemogenesis. Int J Hematol 71, 301-308. Calvo, K. R., Sykes, D. B., Pasillas, M. P., and Kamps, M. P. (2002). Nup98-HoxA9 immortalizes myeloid progenitors, enforces expression of Hoxa9, Hoxa7 and Meisl, and alters cytokine-specific responses in a manner similar to that induced by retroviral co-expression of Hoxa9 and Meisl. Oncogene 21, 4247-4256. Castilla, L. H., Garrett, L., Adya, N., Orlic, D., Dutra, A., Anderson, S., Owens, J., Eckhaus, M., Bodine, D., and Liu, P. P. (1999). The fusion gene Cbfb-MYHl 1 blocks myeloid differentiation and predisposes mice to acute myelomonocytic leukaemia. Nat Genet 23, 144-146. Castilla, L. H., Perrat, P., Martinez, N. J., Landrette, S. F., Keys, R., Oikemus, S., Flanegan, J., Heilman, S., Garrett, L., Dutra, A., et al. (2004). Identification of genes that synergize with Cbfb-MYHl 1 in the pathogenesis of acute myeloid leukemia. Proc Natl Acad Sci U S A 101, 4924-4929. Castilla, L. H., Wijmenga, C , Wang, Q., Stacy, T., Speck, N. A., Eckhaus, M., Marin-Padilla, M., Collins, F. S., Wynshaw-Boris, A., and Liu, P. P. (1996). Failure of embryonic hematopoiesis and lethal hemorrhages in mouse embryos heterozygous for a knocked-in leukemia gene CBFB-MYH11. Cell 87, 687-696.  131  Chen, S., Xue, Y., Chen, Z., Guo, Y., Wu, Y., and Pan, J. (2003). Generation of the NUP98TOP1 fusion transcript by the t(l 1;20) (pl5;qll)ina case of acute monocytic leukemia. Cancer Genet Cytogenet 140, 153-156. Chiba, S. (1998). Homeobox genes in normal hematopoiesis and leukemogenesis. Int J Hematol 68, 343-353. Cozzio, A., Passegue, E., Ayton, P. M., Karsunky, H., Cleary, M. L., and Weissman, I. L. (2003). Similar MLL-associated leukemias arisingfromself-renewing stem cells and short-lived myeloid progenitors. Genes Dev 17, 3029-3035. Daley, G. Q. (1993). Animal models of BCR/ABL-induced leukemias. Leuk Lymphoma 11 Suppl 1, 57-60. Dash, A. B., Williams, I. R., Kutok, J. L., Tomasson, M. H., Anastasiadou, E., Lindahl, K., Li, S., Van Etten, R. A., Borrow, J., Housman, D., et al. (2002). A murine model of CML blast crisis induced by cooperation between BCR/ABL and NUP98/HOXA9. Proc Natl Acad Sci U S A 99, 7622-7627. Douglas, J., Hanks, S., Temple, I. K., Davies, S., Murray, A., Upadhyaya, M., Tomkins, S., Hughes, H. E., Cole, T. R., and Rahman, N. (2003). NSD1 mutations are the major cause of Sotos syndrome and occur in some cases of Weaver syndrome but are rare in other overgrowth phenotypes. Am J Hum Genet 72, 132-143. Druker, B. J. (2002). Inhibition of the Bcr-Abl tyrosine kinase as a therapeutic strategy for CML. Oncogene 21, 8541-8546. Dzierzak, E., and de Bruijn, M. (2002). Isolation and Analysis of Hematopoietic Stem Cells from Mouse Embryos. In Hematopoietic Stem Cell Protocols, C. A. Klug, and C. T. Jordan, eds. (Totowa, New Jersey, Humana Press), pp. 1-14. Dzierzak, E., and Oostendorp, R. (2001). Hematopoietic stem cell development in mammals. In Hematopoiesis: A developmental approacj., L. Zon, ed. (New York, Oxford Univeristy Press Inc), pp. 209-217. Ernst, P., Wang, J., and Korsmeyer, S. J. (2002). The role of MLL in hematopoiesis and leukemia. Curr Opin Hematol 9, 282-287. Fahrenkrog, B., and Aebi, U. (2003). The nuclear pore complex: nucleocytoplasmic transport and beyond. Nat Rev Mol Cell Biol 4, 757-766. Felix, C. A., Hosier, M. R., Winick, N. J., Masterson, M., Wilson, A. E., and Lange, B. J. (1995). ALL-1 gene rearrangements in DNA topoisomerase II inhibitor-related leukemia in children. Blood 85, 3250-3256.  132  Felix, C. A., Walker, A. H., Lange, B. J., Williams, T. M., Winick, N. J., Cheung, N. K., Lovett, B. D., Nowell, P. C , Blair, I. A., and Rebbeck, T. R. (1998). Association of CYP3A4 genotype with treatment-related leukemia. Proc Natl Acad Sci U S A 95, 13176-13181. Fontoura, B. M., Blobel, G., and Matunis, M. J. (1999). A conserved biogenesis pathway for nucleoporins: proteolytic processing of a 186-kilodalton precursor generates Nup98 and the novel nucleoporin, Nup96. J Cell Biol 144, 1097-1112. Fontoura, B. M., Blobel, G., and Yaseen, N. R. (2000). The nucleoporin Nup98 is a site for GDP/GTP exchange on ran and termination of karyopherin beta 2-mediated nuclear import. J Biol Chem 275, 31289-31296. Fujino, T., Suzuki, A., Ito, Y., Ohyashiki, K., Hatano, Y., Miura, I., and Nakamura, T. (2002). Single-translocation and double-chimeric transcripts: detection of NUP98-HOXA9 in myeloid leukemias with HOXA11 or HOXA13 breaks of the chromosomal translocation t(7;ll)(pl5;pl5). Blood 99, 1428-1433. Gervais, C , Mauvieux, L., Perrusson, N., Helias, C , Struski, S., Leymarie, V., Lioure, B., and Lessard, M. (2004). A new translocation t(9;l I)(q34;pl5) fuses NUP98 to a novel homeobox partner gene, PRRX2, in a therapy-related acute myeloid leukemia. Leukemia. Ghaffari, S., Daley, G. Q., and Lodish, H. F. (1999). Growth factor independence and BCR/ABL transformation: promise and pitfalls of murine model systems and assays. Leukemia 13, 1200-1206. Ghannam, G., Takeda, A., Camarata, T., Moore, M. A., Viale, A., and Yaseen, N. R. (2004). The oncogene Nup98-HOXA9 induces gene transcription in myeloid cells. J Biol Chem 279, 866-875. Gilliland, D. G. (1998). Molecular genetics of human leukemia. Leukemia 12 Suppl 1, S7-12. Giovanella, B. C , Stehlin, J. S., Wall, M. E., Wani, M. C , Nicholas, A. W., Liu, L. F., Silber, R., and Potmesil, M. (1989). DNA topoisomerase I-targeted chemotherapy of human colon cancer in xenografts. Science 246, 1046-1048. Gobert, C , Bracco, L., Rossi, F., Olivier, M., Tazi, J., Lavelle, F., Larsen, A. K., and Riou, J. (1996). Modulation of DNA topoisomerase I activity by p53. Biochemistry 35, 5778-5786. Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C , Gaasenbeek, M., Mesirov, J. P., Coller, H., Loh, M. L., Downing, J. R., Caligiuri, M. A., et al. (1999). Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 256', 531-537. Goodell, M. A., Brose, K., Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806. Graux, C , Cools, J., Melotte, C , Quentmeier, H., Ferrando, A., Levine, R., Vermeesch, J. R., Stul, M., Dutta, B., Boeckx, N., et al. (2004). Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia. Nat Genet 36, 1084-1089. 133  Griffis, E. R., Altan, N., Lippincott-Schwartz, J., and Powers, M. A. (2002). Nup98 is a mobile nucleoporin with transcription-dependent dynamics. Mol Biol Cell 13, 1282-1297. Griffis, E. R., Xu, S., and Powers, M. A. (2003). Nup98 localizes to both nuclear and cytoplasmic sides of the nuclear pore and binds to two distinct nucleoporin subcomplexes. Mol Biol Cell 14, 600-610. Grisolano, J. L., Sclar, G. M., and Ley, T. J. (1994). Early myeloid cell-specific expression of the human cathepsin G gene in transgenic mice. Proc Natl Acad Sci U S A 91, 8989-8993. Grisolano, J. L., Wesselschmidt, R. L., Pelicci, P. G., and Ley, T. J. (1997). Altered myeloid development and acute leukemia in transgenic mice expressing PML-RAR alpha under control of cathepsin G regulatory sequences. Blood 89, 376-387. Gu, B. W., Wang, Q., Wang, J. M., Xue, Y. Q., Fang, J., Wong, K. F., Chen, B., Shi, Z. Z., Shi, J. Y., Bai, X. T., et al. (2003). Major form of NUP98/HOXC11 fusion in adult AML with t(ll;12)(pl5;ql3) translocation exhibits aberrant trans-regulatory activity. Leukemia 17, 18581864. Gurevich, R. M., Apian, P. D., and Humphries, R. K. (2004a). Generation of a Pre-Leukemic, Transplantable Cell Line from the AML-Associated NUP98-TOP1 Fusion Gene as a New Model To Test Potential Collaborating Genes. Blood 104. Gurevich, R. M., Apian, P. D., and Humphries, R. K. (2004b). NUP98-topoisomerase I acute myeloid leukemia-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation. Blood 104, 1127-1136. Hacein-Bey-Abina, S., Von Kalle, C , Schmidt, M., McCormack, M. P., Wulffraat, N., Leboulch, P., Lim, A., Osborne, C. S., Pawliuk, R., Morillon, E., et al. (2003). LM02associated clonal T cell proliferation in two patients after gene therapy for SCLD-X1. Science 302,415-419. Harrison, D. E. (1980). Competitive repopulation: a new assay for long-term stem cell functional capacity. Blood 55, 77-81. Hawley, R. G., Lieu, F. H., Fong, A. Z., and Hawley, T. S. (1994). Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1, 136-138. Hess, J. L., Yu, B. D., Li, B., Hanson, R., and Korsmeyer, S. J. (1997). Defects in yolk sac hematopoiesis in Mil-null embryos. Blood 90, 1799-1806. Higuchi, M., O'Brien, D., Kumaravelu, P., Lenny, N., Yeoh, E. J., and Downing, J. R. (2002). Expression of a conditional AML1-ETO oncogene bypasses embryonic lethality and establishes a murine model of human t(8;21) acute myeloid leukemia. Cancer Cell 1, 63-74. Hisa, T., Spence, S. E., Rachel, R. A., Fujita, M., Nakamura, T., Ward, J. M., Devor-Henneman, D. E., Saiki, Y., Kutsuna, H., Tessarollo, L., et al. (2004). Hematopoietic, angiogenic and eye defects in Meisl mutant animals. Embo J 23, 450-459.  134  Hitzler, J. K., and Zipursky, A. (2005). Origins of leukaemia in children with Down syndrome. Nat Rev Cancer 5, 11-20. Holtschke, T., Lohler, J., Kanno, Y., Fehr, T., Giese, N., Rosenbauer, F., Lou, J., Knobeloch, K. P., Gabriele, L., Waring, J. F., et al. (1996). Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene. Cell 87, 307-317. Hope, K. J., Jin, L., and Dick, J. E. (2004). Acute myeloid leukemia originates from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol 5, 738-743. Hussey, D. J., Albanese, N. O., and A., D. (2000). Nuclear and cytoplasmic localisation of hte leukemia associated NUP98-RAP1GDS1 fusion protein. Blood 96, 85a. Hussey, D. J., and Dobrovic, A. (2002). Recurrent coiled-coil motifs in NUP98 fusion partners provide a clue to leukemogenesis. Blood 99, 1097-1098. Hussey, D. J., Nicola, M., Moore, S., Peters, G. B., and Dobrovic, A. (1999). The (4;11)(q21;pl5) translocation fuses the NUP98 and RAP 1 GDS 1 genes and is recurrent in T-cell acute lymphocytic leukemia. Blood 94, 2072-2079. Ikeda, T., Ikeda, K., Sasaki, K., Kawakami, K., and Takahara, J. (1999). The inv(l I)(pl5q22) chromosome translocation of therapy-related myelodysplasia with NUP98-DDX10 and DDX10NUP98 fusion transcripts. Int J Hematol 69, 160-164. Iwasaki, M., Kuwata, T., Yamazaki, Y., Jenkins, N. A., Copeland, N. G., Osato, M., Ito, Y., Kroon, E., Sauvageau, G., and Nakamura, T. (2005). Identification of cooperative genes for NUP98-HOXA9 in myeloid leukemogenesis using a mouse model. Blood 105, 784-793. Iwase, S., Akiyama, N., Sekikawa, T., Saito, S., Arakawa, Y., Horiguchi-Yamada, J., and Yamada, H. (2003). Both NUP98/TOP1 and TOP1/NUP98 transcripts are detected in a de novo AML with t(ll;20)(pl5;qll). Genes Chromosomes Cancer 38, 102-105. Izraeli, S. (2004). Leukaemia — a developmental perspective. Br J Haematol 126, 3-10. Jaju, R. J., Fidler, C , Haas, O. A., Strickson, A. J., Watkins, F., Clark, K., Cross, N. C , Cheng, J. F., Apian, P. D., Kearney, L., et al. (2001). A novel gene, NSD1, is fused to NUP98 in the t(5;l I)(q35;pl5.5) in de novo childhood acute myeloid leukemia. Blood 98, 1264-1267. Jamieson, C. H., Ailles, L. E., Dylla, S. J., Muijtjens, M., Jones, C , Zehnder, J. L., Gotlib, J., Li, K., Manz, M. G., Keating, A., et al. (2004). Granulocyte-macrophage progenitors as candidate leukemic stem cells in blast-crisis CML. N Engl J Med 351, 657-667. John, A. M., Thomas, N. S., Mufti, G. J., and Padua, R. A. (2004). Targeted therapies in myeloid leukemia. Semin Cancer Biol 14, 41-62.  135  Kakazu, N., Shinzato, I., Arai, Y., Gotoh, S., Matsushita, A., Ishikawa, T., Nagai, K., Takahashi, T., Ohno, T., Tsuchiya, T., et al. (2001). Involvement of the NUP98 gene in a chromosomal translocation t(l 1 ;20)(pl5;ql 1.2) in a patient with acute monocytic leukemia (FAB-M5b). Int J Hematol 74, 53-57. Kalberer, C. P., Antonchuk, J., and Humphries, R. K. (2002). Genetic Modification of Murine Hematopoietic Stem Cells by Retroviruses. In Hematopoietic Stem Cell Protocols, C. A. Klug, and C. T. Jordan, eds. (Totowa, New Jersey, Humana Press), pp. 231-242. Karayan, L., Riou, J. F., Seite, P., Migeon, J., Cantereau, A., and Larsen, C. J. (2001). Human ARF protein interacts with topoisomerase I and stimulates its activity. Oncogene 20, 836-848. Kasper, L. H., Brindle, P. K., Schnabel, C. A., Pritchard, C. E., Cleary, M. L., and van Deursen, J. M. (1999). CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity. Mol Cell Biol 19, 764-776. Kau, T. R., Way, J. C , and Silver, P. A. (2004). Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer 4, 106-117. Kelly, L. M., and Gilliland, D. G. (2002). Genetics of myeloid leukemias. Annu Rev Genomics Hum Genet J, 179-198. Kelly, L. M., Kutok, J. L., Williams, I. R., Boulton, C. L., Amaral, S. M., Curley, D. P., Ley, T. J., and Gilliland, D. G. (2002). PML/RARalpha and FLT3-ITD induce an APL-like disease in a mouse model. Proc Natl Acad Sci U S A 99, 8283-8288. Kinsella, T. M., and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther 7, 1405-1413. Kogan, S. C , Ward, J. M., Anver, M. R., Berman, J. J., Brayton, C , Cardiff, R. D., Carter, J. S., de Coronado, S., Downing, J. R., Fredrickson, T. N., et al. (2002). Bethesda proposals for classification of nonlymphoid hematopoietic neoplasms in mice. Blood 100, 238-245. Kondo, M., Weissman, I. L., and Akashi, K. (1997). Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91, 661-672. Kretzschmar, M., Meisterernst, M., and R.G., R. (1993). Identification of human DNA topoisomerase I as a cofactor for activator-dependent transcription by RNA polymerase II. Proc Natl Acad Sci U S A 90, 11508-11512. Kroon, E., Krosl, J., Thorsteinsdottir, U., Baban, S., Buchberg, A. M., and Sauvageau, G. (1998). Hoxa9 transforms primary bone marrow cells through specific collaboration with Meislabut not Pbxlb. Embo J 17, 3714-3725. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., and Sauvageau, G. (2001). NUP98HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. EMBO J 20, 350-361.  136  Kurotaki, N., Harada, N., Yoshiura, K., Sugano, S., Niikawa, N., and Matsumoto, N. (2001). Molecular characterization of NSD 1, a human homologue of the mouse Nsdl gene. Gene 279, 197-204. Lacaud, G., Robertson, S., Palis, J., Kennedy, M., and Keller, G. (2001). Regulation of hemangioblast development. Ann N Y Acad Sci 938, 96-107; discussion 108. Lahortiga, I., Vizmanos, J. L., Agirre, X., Vazquez, I., Cigudosa, J. C , Larrayoz, M. J., Sala, F., Gorosquieta, A., Perez-Equiza, K., Calasanz, M. J., and Odero, M. D. (2003). NUP98 is fused to adducin 3 in a patient with T-cell acute lymphoblastic leukemia and myeloid markers, with a new translocation t(10;l I)(q25;pl5). Cancer Res 63, 3079-3083. Lam, D. H., and Apian, P. D. (2001). NUP98 gene fusions in hematologic malignancies. Leukemia 75, 1689-1695. Lavau, C , Du, C , Thirman, M., and Zeleznik-Le, N. (2000). Chromatin-related properties of CBP fused to MLL generate a myelodysplastic-like syndrome that evolves into myeloid leukemia. EMBO J 19, 4655-4664. Lee, M. P., Brown, S. D., Chen, A., and Hsieh, T. S. (1993). DNA topoisomerase I is essential in Drosophila melanogaster. Proc Natl Acad Sci U S A 90, 6656-6660. Licht, J. D. (2001). AML1 and the AML1-ETO fusion protein in the pathogenesis of t(8;21) AML. Oncogene 20, 5660-5679. Look, A. T. (1997). Oncogenic transcription factors in the human acute leukemias. Science 278, 1059-1064. Madden, K. R., and Champoux, J. J. (1992). Overexpression of human topoisomerase I in baby hamster kidney cells: hypersensitivity of clonal isolates to camptothecin. Cancer Res 52, 525532. Markowitz, D., Goff, S., and Bank, A. (1988). A safe packaging line for gene transfer: separating viral genes on two different plasmids. J Virol 62, 1120-1124. Martin, M. E., Milne, T. A., Bloyer, S., Galoian, K., Shen, W., Gibbs, D., Brock, H. W., Slany, R., and Hess, J. L. (2003). Dimerization of MLL fusion proteins immortalizes hematopoietic cells. Cancer Cell 4, 197-207. Mayotte, N., Roy, D. C , Yao, J., Kroon, E., and Sauvageau, G. (2002). Oncogenic interaction between BCR-ABL and NUP98-HOXA9 demonstrated by the use of an in vitro purging culture system. Blood 100, 4177-4184. McCulloch, E. A. (2002). CFU-S: An assay for pluripotent Myelopoietic Stem Cells. In Hematopoieic Stem Cell Protocols, C. A. Klug, and C. T. Jordan, eds. (Totowa, New Jersey, Humana Press), pp. 153-160.  137  Mecucci, C , La Starza, R., Negrini, M., Sabbioni, S., Crescenzi, B., Leoni, P., Di Raimondo, F., Krampera, M., Cimino, G., Tafuri, A., et al. (2000). t(4;ll)(q21;pl5) translocation involving NUP98 and RAP1GDS1 genes: characterization of a new subset of T acute lymphoblastic leukaemia. Br J Haematol 109, 788-793. Merino, A., Madden, K. R., Lane, W. S., Champoux, J. J., and Reinberg, D. (1993). DNA topoisomerase I is involved in both repression and activation of transcription. Nature 365, 227232. Miller, C. L., and Eaves, C. J. (1997). Expansion in vitro of adult murine hematopoietic stem cells with transplantable lympho-myeloid reconstituting ability. Proc Natl Acad Sci U S A 94, 13648-13653. Million, R. P., Aster, J., Gilliland, D. G., and Van Etten, R. A. (2002). The Tel-Abl (ETV6-Abl) tyrosine kinase, product of complex (9; 12) translocations in human leukemia, induces distinct myeloproliferative disease in mice. Blood 99, 4568-4577. Minucci, S., Maccarana, M., Cioce, M., De Luca, P., Gelmetti, V., Segalla, S., Di Croce, L., Giavara, S., Matteucci, C., Gobbi, A., et al. (2000). Oligomerization of RAR and AML1 transcription factors as a novel mechanism of oncogenic activation. Mol Cell 5, 811-820. Minucci, S., Monestiroli, S., Giavara, S., Ronzoni, S., Marchesi, F., Insinga, A., Diverio, D., Gasparini, P., Capillo, M., Colombo, E., et al. (2002). PML-RAR induces promyelocyte leukemias with high efficiency following retroviral gene transfer into purified murine hematopoietic progenitors. Blood 100, 2989-2995. Mitelman, F., Prigogina, E. L., Fleischman, E. W., Frenkel, M. A., Garwicz, S., Heim, S., Ilyinskaya, G. W., Kristoffersson, U., Mandahl, N., and Volkova, M. A. (1988). A new specific chromosomal rearrangement, t(l 1 ;20)(pl5;ql 1), in myeloblastic leukemia with maturation. Leukemia 2, 430-432. Mo, Y. Y., Wang, P., and Beck, W. T. (2000). Functional expression of human DNA topoisomerase I and its subcellular localization in HeLa cells. Exp Cell Res 256, 480-490. Morham, S. G., Kluckman, K. D., Voulomanos, N., and Smithies, O. (1996). Targeted disruption of the mouse topoisomerase I gene by camptothecin selection. Mol Cell Biol 16, 6804-6809. Morrison, S. J., and Weissman, I. L. (1994). The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity 1, 661-673. Nakamura, T., Largaespada, D. A., Lee, M. P., Johnson, L. A., Ohyashiki, K., Toyama, K., Chen, S. J., Willman, C. L., Chen, I. M., Feinberg, A. P., et al. (1996a). Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;l I)(pl5;pl5) in human myeloid leukaemia. Nat Genet 12, 154-158. Nakamura, T., Largaespada, D. A., Shaughnessy, J. D., Jr., Jenkins, N. A., and Copeland, N. G. (1996b). Cooperative activation of Hoxa and Pbxl-related genes in murine myeloid leukaemias. Nat Genet 12, 149-153. 138  Nakamura, T., Yamazaki, Y., Hatano, Y., and Miura, I. (1999). NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(l;ll)(q23;pl5). Blood 94,1AX-1A1. Nerlov, C. (2004). C/EBPalpha mutations in acute myeloid leukaemias. Nat Rev Cancer 4, 394400. Nishiyama, M., Arai, Y., Tsunematsu, Y., Kobayashi, H., Asami, K., Yabe, M., Kato, S., Oda, M., Eguchi, H., Ohki, M., and Kaneko, Y. (1999). 1 lpl5 translocations involving the NUP98 gene in childhood therapy-related acute myeloid leukemia/myelodysplastic syndrome. Genes Chromosomes Cancer 26, 215-220. Ogawa, m., and Livingston, a. (2002). Hematopoietic Colony-Forming Cells. In Hematopoieic Stem Cell Protocols, C. A. Klug, and C. T. Jordan, eds. (Totowa, New Jersey, Humana Press), pp.113-122. Okuda, T., van Deursen, J., Hiebert, S. W., Grosveld, G., and Downing, J. R. (1996). AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84, 321-330. Orkin, S. H., Shivdasani, R. A., Fujiwara, Y., and McDevitt, M. A. (1998). Transcription factor GATA-1 in megakaryocyte development. Stem Cells 16 Suppl 2, 79-83. Panagopoulos, I., Fioretos, T., Isaksson, M., Larsson, G., Billstrom, R., Mitelman, F., and Johansson, B. (2002). Expression of NUP98/TOP1, but not of TOP1/NUP98, in a treatmentrelated myelodysplastic syndrome with t(10;20;l l)(q24;ql l;pl5). Genes Chromosomes Cancer 34, 249-254. Panagopoulos, I., Isaksson, M., Billstrom, R., Strombeck, B., Mitelman, F., and Johansson, B. (2003). Fusion of the NUP98 gene and the homeobox gene HOXC 13 in acute myeloid leukemia witht(ll;12)(pl5;ql3). Genes Chromosomes Cancer 36, 107-112. Passegue, E., Wagner, E. F., and Weissman, I. L. (2004). JunB deficiency leads to a myeloproliferative disorder arisingfromhematopoietic stem cells. Cell 119, 431-443. Pear, W. S., Miller, J. P., Xu, L., Pui, J. C , Soffer, B., Quackenbush, R. C , Pendergast, A. M., Bronson, R., Aster, J. C , Scott, M. L., and Baltimore, D. (1998). Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood 92, 3780-3792. Pineault, N , Abramovich, C , Ohta, H., and Humphries, R. K. (2004). Differential and common leukemogenic potentials of multiple NUP98-Hox fusion proteins alone or with Meisl. Mol Cell Biol 24, 1907-1917. Pineault, N., Buske, C , Feuring-Buske, M., Abramovich, C , Rosten, P., Hogge, D. E., Apian, P. D., and Humphries, R. K. (2003). Induction of acute myeloid leukemia in mice by the human leukemia-specific fusion gene NUP98-HOXD13 in concert with Meisl. Blood 101, 4529-4538.  139  Pollock, J. L., Westervelt, P., Kurichety, A. K., Pelicci, P. G., Grisolano, J. L., and Ley, T. J. (1999). A bcr-3 isoform of RARalpha-PML potentiates the development of PML-RARalphadriven acute promyelocytic leukemia. Proc Natl Acad Sci U S A 96, 15103-15108. Pollock, J. L., Westervelt, P., Walter, M. J., Lane, A. A., and Ley, T. J. (2001). Mouse models of acute promyelocytic leukemia. Curr Opin Hematol 8, 206-211. Pommier, Y., Pourquier, P., Fan, Y., and Strumberg, D. (1998). Mechanism of action of eukaryotic DNA topoisomerase I and drugs targeted to the enzyme. Biochim Biophys Acta 1400, 83-105. Potenza, L., Sinigaglia, B., Luppi, M., Morselli, M., Saviola, A., Ferrari, A., Riva, G., Zucchini, P., Giacobbi, F., Emilia, G., et al. (2004). A t(l 1 ;20)(pl5;ql 1) may identify a subset of nontherapy-related acute myelocytic leukemia. Cancer Genet Cytogenet 149, 164-168. Prigogina, E. L., Fleischman, E. W., Puchkova, G. P., Mayakova, S. A., Volkova, M. A., Protasova, A. K., and Frenkel, M. A. (1986). Chromosomes in acute nonlymphocytic leukemia. Hum Genet 73, 137-146. Pritchard, C. E., Fornerod, M., Kasper, L. H., and van Deursen, J. M. (1999a). RAE1 is a shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex through multiple domains. J Cell Biol 145, 237-254. Pritchard, C. E., Fornerod, M., Kasper, L. H., and van Deursen, J. M. (1999b). RAE1 is a shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex through multiple domains. J Cell Biol 145, 237-254. Radu, A., Moore, M. S., and Blobel, G. (1995). The peptide repeat domain of nucleoporin Nup98 functions as a docking site in transport across the nuclear pore complex. Cell 81, 215222. Raimondi, S. C , Chang, M. N , Ravindranath, Y., Behm, F. G., Gresik, M. V., Steuber, C. P., Weinstein, H. J., and Carroll, A. J. (1999). Chromosomal abnormalities in 478 children with acute myeloid leukemia: clinical characteristics and treatment outcome in a cooperative pediatric oncology group study-POG 8821. Blood 94, 3707-3716. Raza-Egilmez, S. Z., Jani-Sait, S. N., Grossi, M., Higgins, M. J., Shows, T. B., and Apian, P. D. (1998). NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia. Cancer Res 58, 4269-4273. Redinbo, M. R., Stewart, L., Kuhn, P., Champoux, J. J., and Hoi, W. G. (1998). Crystal structures of human topoisomerase I in covalent and noncovalent complexes with DNA. Science 279, 1504-1513. Rego, E. M., and Pandolfi, P. P. (2001). Analysis of the molecular genetics of acute promyelocytic leukemia in mouse models. Semin Hematol 38, 54-70.  140  Rhoades, K. L., Hetherington, C. J., Harakawa, N., Yergeau, D. A., Zhou, L., Liu, L. Q., Little, M. T., Tenen, D. G., and Zhang, D. E. (2000). Analysis of the role of AML1-ETO in leukemogenesis, using an inducible transgenic mouse model. Blood 96, 2108-2115. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C , and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res 18, 2887-2890. Romana, S. P., Mauchauffe, M., Le Coniat, M., Chumakov, I., Le Paslier, D., Berger, R., and Bernard, O. A. (1995). The t(12;21) of acute lymphoblastic leukemia results in a tel-AMLl gene fusion. Blood 85, 3662-3670. Rosati, R., La Starza, R., Veronese, A., Aventin, A., Schwienbacher, C., Vallespi, T., Negrini, M., Martelli, M. F., and Mecucci, C. (2002). NTJP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;ll)(pll.2;pl5). Blood 99, 3857-3860. Rosenbauer, F., Wagner, K., Kutok, J. L., Iwasaki, FL, Le Beau, M. M., Okuno, Y., Akashi, K., Fiering, S., and Tenen, D. G. (2004). Acute myeloid leukemia induced by graded reduction of a lineage-specific transcription factor, PU.l. Nat Genet 36, 624-630. Rossi, F., Labourier, E., Forne, T., Divita, G., Derancourt, J., Riou, J. F., Antoine, E., Cathala, G., Brunei, C., and Tazi, J. (1996). Specific phosphorylation of SR proteins by mammalian DNA topoisomerase I. Nature 381, 80-82. Rossi, F., Labourier, E., Gallouzi, I. E., Derancourt, J., Allemand, E., Divita, G., and Tazi, J. (1998). The C-terminal domain but not the tyrosine 723 of human DNA topoisomerase I active site contributes to kinase activity. Nucleic Acids Res 26, 2963-2970. Saito, S., Miyaji-Yamaguchi, M., and Nagata, K. (2004). Aberrant intracellular localization of SET-CAN fusion protein, associated with a leukemia, disorganizes nuclear export. Int J Cancer 111, 501-507. Sasaki, K., Yagi, EL, Bronson, R. T., Tominaga, K., Matsunashi, T., Deguchi, K., Tani, Y., Kishimoto, T., and Komori, T. (1996). Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta. Proc Natl Acad Sci U S A 93, 12359-12363. Sauvageau, G., Thorsteinsdottir, U., Hough, M. R., Hugo, P., Lawrence, H. J., Largman, C , and Humphries, R. K. (1997). Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation. Immunity 6, 13-22. Schmidt, M., Nagel, S., Proba, J., Thiede, C , Ritter, M., Waring, J. F., Rosenbauer, F., Huhn, D., Wittig, B., Horak, I., and Neubauer, A. (1998). Lack of interferon consensus sequence binding protein (ICSBP) transcripts in human myeloid leukemias. Blood 91, 22-29. Schwieger, M., Lohler, J., Friel, J., Scheller, M., Horak, I., and Stocking, C. (2002). AML1ETO inhibits maturation of multiple lymphohematopoietic lineages and induces myeloblast transformation in synergy with ICSBP deficiency. J Exp Med 196, 1227-1240. 141  Shanmugam, K., Green, N . C., Rambaldi, I., Saragovi, H . U . , and Featherstone, M . S. (1999). P B X and MEIS as non-DNA-binding partners in trimeric complexes with H O X proteins. Mol Cell Biol 19, 7577-7588. Shykind, B. M . , Kim, J., Stewart, L., Champoux, J. J., and Sharp, P. A . (1997). Topoisomerase I enhances TFIID-TFIIA complex assembly during activation of transcription. Genes Dev 11, 397-407. Sjoblom, T., Boureux, A., Ronnstrand, L., Heldin, C. H., Ghysdael, J., and Ostman, A . (1999). Characterization of the chronic myelomonocytic leukemia associated TEL-PDGF beta R fusion protein. Oncogene 18, 7055-7062. Slape, C , and Apian, P. D. (2004). The role of NUP98 gene fusions in hematologic malignancy. Leuk Lymphoma 45, 1341-1350. So, C. W., Karsunky, H., Passegue, E., Cozzio, A., Weissman, I. L., and Cleary, M . L. (2003a). M L L - G A S 7 transforms multipotent hematopoietic progenitors and induces mixed lineage leukemias in mice. Cancer Cell 3, 161-171. So, C. W., Lin, M . , Ayton, P. M . , Chen, E. H., and Cleary, M . L . (2003b). Dimerization contributes to oncogenic activation of M L L chimeras in acute leukemias. Cancer Cell 4, 99-110. Stewart, L., Redinbo, M . R., Qiu, X . , Hoi, W. G., and Champoux, J. J. (1998). A model for the mechanism of human topoisomerase I. Science 279, 1534-1541. Suzuki, A., Ito, Y . , Sashida, G., Honda, S., Katagiri, T., Fujino, T., Nakamura, T., and Ohyashiki, K . (2002a). t(7;l I)(pl5;pl5) Chronic myeloid leukaemia developed into blastic transformation showing a novel NUP98/HOXA11 fusion. Br J Haematol 116, 170-172. Suzuki, T., Shen, H., Akagi, K., Morse, H . C , Malley, J. D., Naiman, D. Q., Jenkins, N . A., and Copeland, N . G. (2002b). New genes involved in cancer identified by retroviral tagging. Nat Genet 32, 166-174. Szilvassy, S. J., Humphries, R. K., Lansdorp, P. M . , Eaves, A . C , and Eaves, C. J. (1990). Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc Natl Acad Sci U S A 87, 8736-8740. Taketani, T., Taki, T., Ono, R., Kobayashi, Y . , Ida, K., and Hayashi, Y . (2002a). The chromosome translocation t(7;l I)(pl5;pl5) in acute myeloid leukemia results in fusion of the NUP98 gene with a H O X A cluster gene, HOXA13, but not H O X A 9 . Genes Chromosomes Cancer 34, 431-443. Taketani, T., Taki, T., Shibuya, N . , Ito, E., Kitazawa, J., Terui, K., and Hayashi, Y . (2002b). The HOXD11 gene is fused to the NTJP98 gene in acute myeloid leukemia with t(2;ll)(q31;pl5). Cancer Res 62, 33-37. Taketani, T., Taki, T., Shibuya, N . , Kikuchi, A., Hanada, R., and Hayashi, Y . (2002c). Novel NUP98-HOXC11 fusion gene resulted from a chromosomal break within exon 1 of HOXC11 in acute myeloid leukemia with t(l I;12)(pl5;ql3). Cancer Res 62, 4571-4574. 142  Tamura, T., Kong, H. J., Tunyaplin, C , Tsujimura, H., Calame, K., and Ozato, K. (2003). ICSBP/ERF-8 inhibits mitogenic activity of p210 Bcr/Abl in differentiating myeloid progenitor cells. Blood 102, 4547-4554. Thorsteinsdottir, U., Sauvageau, G., Hough, M. R., Dragowska, W., Lansdorp, P. M., Lawrence, H. J., Largman, C , and Humphries, R. K. (1997). Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 17, 495-505. Till, J. E., McCulloch, E. A., and Siminovitch, L. (1964). A Stochastic Model of Stem Cell Proliferation, Based on the Growth of Spleen Colony-Forming Cells. Proc Natl Acad Sci U S A 51, 29-36. Tsuzuki, S., Seto, M., Greaves, M., and Enver, T. (2004). Modeling first-hit functions of the t(12;21) TEL-AML 1 translocation in mice. Proc Natl Acad Sci U S A 101, 8443-8448. Uchida, N., and Weissman, I. L. (1992). Searching for hematopoietic stem cells: evidence that Thy-l.llo Lin- Sca-1+ cells are the only stem cells in C57BL/Ka-Thy-l.l bone marrow. J Exp Med 175, 175-184. van Oostveen, J., Bijl, J., Raaphorst, F., Walboomers, J., and Meijer, C. (1999). The role of homeobox genes in normal hematopoiesis and hematological malignancies. Leukemia 13, 16751690. Vasu, S. K., and Forbes, D. J. (2001). Nuclear pores and nuclear assembly. Curr Opin Cell Biol 13, 363-375. von Lindern, M., Fornerod, M., van Baal, S., Jaegle, M., de Wit, T., Buijs, A., and Grosveld, G. (1992). The translocation (6;9), associated with a specific subtype of acute myeloid leukemia, results in the fusion of two genes, dek and can, and the expression of a chimeric, leukemiaspecific dek-can mRNA. Mol Cell Biol 12, 1687-1697. Wang, J. C. (1996). DNA topoisomerases. Annu Rev Biochem 65, 635-692. Wang, J. C. (2002). Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 3, 430-440. Wang, Y., Gu, M. M., Tan, Y., Lu, S. Y., Wang, L., Kong, H., Sun, Y. P., Lu, Z. Y., Chen, S. J., Wang, Z. Y., and Wang, Z. G. (2004). [Development of human myeloid leukemia-like phenotype in NUP98-PMX1 transgenic mice]. Zhonghua Xue Ye Xue Za Zhi 25, 262-265. Warner, J. K., Wang, J. C , Hope, K. J., Jin, L., and Dick, J. E. (2004). Concepts of human leukemic development. Oncogene 23, 7164-7177. Weissman, I. L. (2000). Stem cells: units of development, units of regeneration, and units in evolution. Cell 100, 157-168.  143  Wu, X., Kasper, L. H., Mantcheva, R. T., Mantchev, G. T., Springett, M. J., and van Deursen, J. M. (2001). Disruption of the FG nucleoporin NUP98 causes selective changes in nuclear pore complex stoichiometry and function. Proc Natl Acad Sci U S A 98, 3191-3196. Yang, Z., and Champoux, J. J. (2002). Reconstitution of enzymatic activity by the association of the cap and catalytic domains of human topoisomerase I. J Biol Chem 277, 30815-30823. Yergeau, D. A., Hetherington, C. J., Wang, Q., Zhang, P., Sharpe, A. H., Binder, M., MarinPadilla, M., Tenen, D. G., Speck, N. A., and Zhang, D. E. (1997). Embryonic lethality and impairment of haematopoiesis in mice heterozygous for an AML1-ETO fusion gene. Nat Genet 15, 303-306. Yuan, Y., Zhou, L., Miyamoto, T., Iwasaki, H., Harakawa, N., Hetherington, C. J., Burel, S. A., Lagasse, E., Weissman, I. L., Akashi, K., and Zhang, D. E. (2001). AML1-ETO expression is directly involved in the development of acute myeloid leukemia in the presence of additional mutations. Proc Natl Acad Sci U S A 98, 10398-10403. Zeisig, B. B., Garcia-Cuellar, M. P., Winkler, T. H., and Slany, R. K. (2003). The oncoprotein MLL-ENL disturbs hematopoietic lineage determination and transforms a biphenotypic lymphoid/myeloid cell. Oncogene 22, 1629-1637. Zeisig, B. B., Milne, T., Garcia-Cuellar, M. P., Schreiner, S., Martin, M. E., Fuchs, U., Borkhardt, A., Chanda, S. K., Walker, J., Soden, R., et al. (2004). Hoxa9 and Meisl are key targets for MLL-ENL-mediated cellular immortalization. Mol Cell Biol 24, 617-628.  144  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092272/manifest

Comment

Related Items