Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Tumour photodynamic therapy-induced changes of complement gene expression Stott, Don Brandon 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-0656.pdf [ 13.18MB ]
Metadata
JSON: 831-1.0092220.json
JSON-LD: 831-1.0092220-ld.json
RDF/XML (Pretty): 831-1.0092220-rdf.xml
RDF/JSON: 831-1.0092220-rdf.json
Turtle: 831-1.0092220-turtle.txt
N-Triples: 831-1.0092220-rdf-ntriples.txt
Original Record: 831-1.0092220-source.json
Full Text
831-1.0092220-fulltext.txt
Citation
831-1.0092220.ris

Full Text

T U M O U R P H O T O D Y N A M I C T H E R A P Y - I N D U C E D C H A N G E S OF COMPLEMENT GENE EXPRESSION BY D O N B R A N D O N STOTT B . S c , The University of British Columbia, 2001  A THESIS S U B M I T T E D IN P A R T I A L F U L F I M E N T OF T H E R E Q U I R E M E N T S T H E D E G R E E OF M A S T E R OF S C I E N C E IN • F A C U L T Y OF G R A D U A T E STUDIES (Pathology and Laboratory Medicine)  The University of British Columbia June, 2005 © Don Brandon Stott, 2005  FOR  Abstract Photodynamic therapy (PDT), a clinically established modality for treatment o f tumours and other lesions, involves the administration o f a light-activated drug that is activated at the targeted site by exposure to light. Light energy transforms the drug into a chemically active state and, in the presence o f oxygen, leads to the formation o f toxic oxygen derivatives. This oxidative, PDT-inflicted damage elicits a response from the host that plays an important role in the outcome o f therapy. A major element o f this host response is the activation o f the complement system. Complement proteins are produced in the liver and it was presumed until recently that all components were synthesized there and released into the circulation.  Recently, it has  become clear that other cells besides hepatocytes are capable o f synthesizing some or all o f the cascade components.  The purpose o f this study was to examine the origin o f  complement production by the semi-quantitative R T - P C R analysis o f key complement component genes C 3 , C5 and C 9 . Specifically we wanted to determine whether upregulation o f these genes occurred following P D T and i f so, was it happening in the liver or locally at the tumour. Our hypothesis was: P D T results in an increase o f the tumourlocalized expression o f key complement component genes. An  in vivo  time course experiment using Lewis Lung Carcinoma ( L L C ) growing  in C 5 7 B L / 6 J mice examined the local and hepatic expression o f C 3 , C5 and C 9 following P D T . The results indicated no hepatic up-regulation o f these genes but local expression in the tumour significantly increased (3.5 fold for C 3 , 3.2 fold for C5 and 1.7 fold for C9) at 24 hours following P D T light administration. These levels declined but remained elevated until five days post-treatment.  Because this peak time point coincides with  n  immune cell infiltration in vivo we wanted to examine the ability o f macrophages in vitro to respond to PDT-treated L L C cells. This was done by co-incubating macrophages with PDT-treated  L L C cells.  Gene  expression  analysis revealed  that  macrophages  significantly up-regulate the expression o f complement genes C 3 , C5 and C 9 by 8 hours following treatment and that this increase o f gene expression results in a significant increase o f complement protein levels in these cells by 16 hours co-incubation as compared to the control (no P D T ) as determined by F A C S . It was also discovered that malignant L L C cells themselves produce basal levels o f complement proteins, but do not respond to P D T by increasing complement gene expression. Further experiments revealed that PDT-induced complement gene up-regulation was less pronounced in tumours growing in Toll-like receptor 4 ( T L R - 4 ) knockout mice compared to tumours in W T hosts.  Using a series o f specific inhibitors or blocking  antibodies in the in vitro system with macrophages co-incubated with P D T treated tumour cells, it was confirmed that the T L R signaling pathway leading to  NF-KB  activation has a major role in this phenomenon. The results o f this thesis shed light on complement engagement during the local host response which carries implications for the effective treatment o f tumours by this therapy.  These components may be harnessed and  targeted to improve therapy by means o f better controlling the complement response to P D T and therefore controlling a large component o f the critical immune response which is necessary for a positive outcome after therapy.  in  Table of Contents  Abstract  ii  Table o f Contents  iv  List o f Tables  viii  List o f Figures  ix  Abbreviations  •  xi  Acknowledgements  xiii  Introduction  1  Section 1: I. II. III. Section 2: I. II. III. IV. Section 3: I. Section 4: I. II. III.  The History and Current Clinical Uses o f Photodynamic Therapy... History o f Photodynamic Therapy Clinical Trials in Photofrin-based P D T Clinical Trials Using Second-Generation Photosensitizers W h y Photodynamic Therapy? Mechanisms o f Photodynamic Therapy Photosensitizer Localization and Cellular Uptake Drug Delivery Light Sources and Delivery PDT-Induced Events Leading to the Host Response Photodynamic Action Host Response Cell Death, Danger Signals and Signalling Pathways Acute Phase Response Cellular Effectors o f PDT-Induced Host Response a. Neutrophils b. Macrophages c. Lymphocytes IV. Complement a. Complement Activation b. The M a n y Roles o f Complement Proteins 1. Opsonization 2. Anaphylatoxins 3. The Membrane Attack Complex c. Complement Regulators d. Complement Synthesis e. Complement in P D T V. T L R signaling pathways Section 5: Rationale for this Thesis Project  1 1 3 3 5 5 6 8 9 9 9 11 12 14 15 15 16 18 19 20 22 22 22 23 23 24 25 26 28  iv  Hypothesis  29  Specific A i m s  29  Materials and Methods I. Tumour Model  30 30  a. In vivo  b. In vitro Cell Culture Macrophages a. Tumour Associated Macrophages b. Splenic Macrophages III. Photodynamic Therapy I V . Sample Collection a. Tumour Extraction b. Cell Collection c. R N A Isolation and Purification V. Semi-Quantitative R T - P C R a. c D N A Synthesis b. O l i g o - D N A Primers c. Polymerase Chain Reaction d. Polyacrylamide G e l Electrophoresis e. Gel Imaging f. Image Quantification V I . Antibody Staining and Flow Cytometry a. C3 Expression b. Percentage o f Macrophages present after their isolation from tumour or spleen V I I . Experiments a. Hepatic versus tumour localized complement gene expression following photodynamic therapy b. Tumour localized complement gene expression in wild-type mice versus T L R - 4 K O mice and C3 c. Complement gene expression in T A M s co-incubated with untreated L L C cells and PDT-treated L L C cells d. The analysis o f complement gene expression in wild-type or T L R - 4 K O splenic macrophages co-incubated with PDT-treated L L C cells e. Analysis o f complement gene expression in L L C cells in vitro. f. The effect o f various inhibitors on the expression o f C 3 , C5 and C 9 in T A M s co-incubated with PDT-treated L L C cells. g. F A C S analysis to determine whether T A M s co-incubated with PDT-treated L L C cells would increase C3 protein production h. F A C S analysis to determine the percentage o f macrophages (splenic or T A M ) remaining after their deliberate isolation and culture II.  30  31 31 31 32 32 33 33 34 34 35 35 35 36 37 38 38 39 39 39 40 40 40 41  41 42 42  43  43  v  VIII. Statistical Analysis Results Section 1 I. Photofrin-based PDT-induced local increase o f the expression o f complement genes C 3 , C 5 and C 9 II. P D T does not cause an increase o f hepatocyte-derived complement gene expression III. Lack o f hepatic or tumour-localized expression o f complement genes following BPD-based P D T Section 2 I. Procedures used to isolate macrophages ( T A M s and spleen) used in in vitro studies resulted in > 90% o f cells identified as macrophages as determined by F A C S II. P D T induces a significant increase in C3 by spleen-derived macrophages at 8hrs following treatment III. P D T induces a significant increase in the expression o f key complement genes by T A M s co-incubated with PDT-treated L L C cells I V . PDT-induced up-regulation o f complement gene C3 results in an increase in C3 protein expression Section 3 I. Complement gene expression does not increase in PDT-treated or untreated L L C cells Section 4 I. The expression o f C 3 , C 5 and C 9 genes in untreated and PDT-treated tumours growing in wild type, C3 K O and the T L R - 4 K O mice Section 5 I. P D T induces a larger increase in complement gene expression in wild-type compared to T L R - 4 K O derived macrophages Section 6 I. Increase o f complement gene expression by wild type T A M s coincubated with P D T treated L L C cells is attenuated by inhibitors/blockers o f H S P 7 0 , T I R A P , N F - k B and T L R - 4 II. The addition o f an antibody to T L R - 2 reduces the PDT-induced increase in C3 by spleen derived macrophages Discussion  44 45  45 48 49  50 52  54 55  57  60  63  65 67 69  I. II. III. IV.  Hepatic versus tumour-localized complement expression after PDT Macrophages are the source o f PDT-induced increase o f local complement expression T L R signaling pathway is involved in macrophage upregulation of local complement after P D T Summary  70 73 75 79  vi  Conclusion Future Directions References  80 81 82  vii  List of Tables  Table 1 : Description o f oligo-nucleotide primer pairs used in P C R reactions  List of Figures Figure 1: Simplified illustration o f the complement cascade  20  Figure 2: Simplified representation o f T L R signaling pathways  28  Figure 3: Positive and negative P C R controls for G A P D H , C 3 , C5 and C 9  37  Figure 4: Photofrin-based P D T induces a tumour-localized up-regulation o f complement genes at 24 hours following treatment  46  Figure 5: Tumour-localized expression o f key complement genes C 3 , C 5 and C 9 after Photofrin-based P D T  47  Figure 6: Average fold increase o f tumour-localized expression o f key complement genes C 3 , C5 and C 9 at 24 hours following Photofrin-based P D T  48  Figure 7: Hepatic complement gene expression (C3, C 5 , C9) at various time points following Photofrin-based P D T  49  Figure 8: The expression o f complement genes C 3 , C5 and C 9 in tumours and livers after treatment with B P D or Photofrin-based P D T  50  Figure 9: The procedure used for the isolation o f macrophages resulted in 97.6% positive P E + F I T C staining for tumour and >90% positive P E staining from spleen as determined by F A C S  52  Figure 10: P D T induces a significant increase o f C3 expression at 8 hrs following treatment  53  Figure 11: T A M s increase the expression o f complement genes C 3 , C 5 and C 9 following incubation with PDT-treated L L C cells....  55  Figure 12: C3 fluorescence increases in T A M s co-incubated with PDT-treated L L C relative to the control  57  Figure 13a-c: C 3 , C5 and C 9 expression do not increase in L L C cells treated by P D T or in those co-incubated with PDT-treated L L C 58 Figure 14: Complement gene C3 expression o f P D T treated versus untreated tumours growing in wild type, C3 K O and T L R - 4 K O mice  61  Figure 15: Complement gene C5 expression o f P D T treated versus untreated tumours growing in wild type, C3 K O and T L R - 4 K O mice 62  Figure 16: Complement gene C 9 expression o f P D T treated versus untreated tumours growing in wild type, C3 K O and T L R - 4 K O mice  63  Figure 17: Expression o f C 3 , C5 and C 9 genes in wild type and T L R - 4 knockout spleen macrophages co-incubated with PDT-treated L L C cells  65  Figure 18: C 3 , C5 and C 9 expression in T A M s co-incubated with P D T treated L L C cells in the presence and absence o f various inhibitors/blockers 67 Figure 19: The addition o f an antibody to T L R - 2 decreases the PDT-induced increase in C3 expression by spleen-derived macrophages  68  Figure 20: Summary o f the pathway by which complement genes C 3 , C 5 and C 9 are locally up-regulated in the tumour following treatment by P D T 80  x  Abbreviations (ALA) (APAF) (APC) (APS) (ATP) (BPD) (CR) (CRP) (CTL) (DAF) (DEPC) (dNTP) (ERK) (ETC) (FDA) (FITC) (GAPDH) (HBSS) (HpD) (HSP) (ICAM) (IFN) (Ig) (IL) (IRAK) (INK) (KO) (LDL) (LLC) (mAb) (mCRP) (MAC) (MAPK) (MASP) (MBL) (MCP) (MHC) (MIP) (mTHPC) (MyD88) (NaOaC) (NF-kB) (PARP) (PCR)  5-aminolevulinic A c i d Apoptosis Protease Activating Factor Antigen Presenting Cell A m m o n i u m persufate Adenosine Tri-Phosphate Benzoporphyrin Derivative Complement Receptor C-Reactive Protein Cytotoxic T Lymphocyte Decay Accelerating Factor Dietheylpyrocarbonate deoxyNucleotide T r i Phosphate Extracellular Signal Regulated Kinase Electron Transport Chain Food and Drug Administration Fluorescein Isothiocyanate Glyceraldehyde-3-Phosphate Dehydrogenase Hank's Buffered Saline Solution Hematoporphyrin Derivative Heat Shock Protein Intercellular Adhesion Molecule Interferon Immunoglobulin Interleukin Interleukin-1 Receptor Associated Kinase c-Jun N-terminal Kinase Knock Out L o w Density Lipoprotein Lewis L u n g Carcinoma Monoclonal antibody Membrane-bound Complement Regulatory Protein Membrane Attack Complex Mitogen Activated Protein Kinase (MBL)-associated Serine Protease Mannose Binding Lectin Membrane Cofactor Protein Major Histocompatability Complex Macrophage Inflammatory Protein meta-tetrahydroxyphenylchlorin M y e l o i d Differentiation Protein 88 Sodium Acetate Nuclear Factor Kappa B Poly (ADP-Ribose) Polymerase Polymerase Chain Reaction  (PDT) (PE) (PMN) (PRR) (PS) (ROS) (RT-PCR) (SAP) (TAM) (TIR) (TIRAP) (TLR) (TEMED) (TNF) (Tollip) (TRAF) (WT)  Photodynamic Therapy Phycoerythrin Polymorphonuclear Leukocyte Pattern Recognition Receptor Phosphatidyl Serine Reactive Oxygen Species Reverse Transcriptase Polymerase Chain Reaction Serum A m y l o i d P component Tumour Associated Macrophage Toll/IL-IR TIR Domain Containing Adaptor Protein T o l l - L i k e Receptor Tetramethylethylenediamine Tumour Necrosis Factor T o l l Interacting Protein Tumour Necrosis Factor Receptor Associated Factor W i l d Type  Acknowledgements I would like to thank the staff and personnel o f the Cancer Imaging Department for their support and kindness over the last few years. I extend m y deepest gratitude to the staff and students (Krista Cleveland, Baljit Komoh) that comprise the W a n L a m Lab from whom I received guidance, support and friendship. W a n L a m himself must be thanked for his unbelievable cooperation, support and generosity. Finally I would like to thank my supervisory committee; Dr. Haishan Zeng, Dr. Cheryl Helgason, Dr. E d Pryzdial for their patience and helpful direction and o f course m y supervisor Dr. Mladen Korbelik for his guidance and devoted attention to m y progress.  Xlll  Introduction and Literature Review Section 1: The History and Current Clinical Uses of Photodynamic Therapy I. History of Photodynamic Therapy The healing properties o f light have been recognised and applied to treat various skin diseases such as vitiligo, psoriasis, and skin tumours since antiquity (1, 2). However, it was not until more recently, that "phototherapy" began to be used more routinely in medicine (1).  Light has been used in the modern treatment o f rickets, tuberculosis,  scurvy and smallpox (1, 2). Photo-chemotherapy, which combines the application o f a photosensitizing agent followed by exposure to light has also been used by civilizations dating back over 3000 years (1). Psoralens have been used to treat psoriasis and vitiligo by the ancient Egyptians and North American Indians and are still used today i n modern immunotherapy (1). It was not until 1900 however, that Oscar Raab showed that "photochemotherapy" causes cell death. He observed that acridine in combination with light exposure induces death o f Paramecium  in vitro  (1, 2). In 1903 Jesionek and Tappeiner  observed therapeutic effects o f topically applied eosin and white light exposure on skin tumours.  They termed this effect "photodynamic action" which is still used today to  describe the primary and secondary reactions which ensue following "photodynamic therapy" (PDT) (1, 2, 3).  Photodynamic therapy, then, is the use o f photosensitive  compounds i n combination with light to treat disease where cell death is desired. The discovery by Jesionek et al. paved the way for further  investigation into, and  development of, this phenomenon. In 1911 Haussmann characterized the photo-sensitivity changes, photo-toxicity and biological effects o f hematoporphyrin (4). It wasn't until the 1940s that the tumour localizing properties o f hematoporphyrin were described and in the 1950s and 1960s 1  Lipson and Schwartz purified the mixture o f porphyrins that comprise hematoporphyrin and developed Hematoporphyrin Derivative (1, 5, 6).  Hematoporphyrin Derivative  (HpD) could be used i n much lower doses and was more than twice as phototoxic as its predecessor.  It was subsequently found that the extent o f the photoreaction was  dependent upon the drug dose, the time between administration o f the drug and the light exposure, as well as the light dose.  The properties o f H p D were exploited during the  investigation o f tumour therapy and tumour detection using this drug (1,2) Diamond et al. (1972) followed by Dougherty et al. (1975) were the first to utilize the tumour-localizing and phototoxic properties o f H p D to treat cancerous lesions (7, 8). The first human studies followed suit and in 1978 Dougherty and colleagues reported the results o f the first large-scale human study involving photodynamic therapy using H p D . In this study, 113 primary and secondary skin tumours (squamous cell carcinoma and basal cell carcinoma) were treated using H p D and red light. Ninety-eight tumours completely regressed,  13 partly responded and 2 showed no response  (9).  This  pioneering work led to the development o f porphimer sodium "Photofxin"® ( F D A approval, 1993), a purified version o f H p D and the most widely used photosensitizer today, both i n the clinic and i n the lab (14). Photofrin has been approved for clinical use for the palliative treatment o f solid tumours where other treatments failed (10).  It has  also been approved for the treatment o f early and late stage lung cancers, surface gastric tumours, oesophageal adenocarcinoma, bladder and cervical cancers (14). Clinical trials involving Photofrin are currently being carried out i n order to better determine the value of Photofrin-based P D T for the treatment o f prostate cancer, head and neck malignancies, pre-malignant conditions o f the oesophagus, bladder and lung cancers i n addition to many other conditions (11, 12, 14, 15).  2  II. Clinical Trials of Photofrin-based PDT One advantage o f porfimer sodium is that because o f its widespread use, it has been better characterized than other, alternative drugs.  In addition, Photofrin has  consistently shown strong tumour ablation and low toxicity to normal cells i n the absence o f light (14). Clinical trials are ongoing in the evaluation o f Photofrin based P D T for the treatment o f solid tumours. Barrett's esophagus, although already approved for P D T treatment i n Canada, is under investigation using Photofrin and the largest clinical trial published to date was done by Overholt et al. (1999) which demonstrated that i n all patients treated, 80% o f treated Barrett's cells returned to normal squamous cell epithelia (13). Brain tumours are also a target for Photofrin-based P D T . Light is administered using an optical fiber and P D T is done in concert with surgery and immediately following the resection o f malignant glial tumours (12). Headand neck cancers  as well as cancers  o f the oral cavity are also at the forefront o f research in photomedicine involving porfimer sodium and have lessmorbidity and mortality associated with treatments than traditional surgeries or radiation (14).  A clinical study was done using P D T to treat  breast cancer that had progressed to the chest wall.  Patients treated by photodynamic  therapy showed tumour necrosis at the site o f treatment and initial regression o f metastatic disease. It was concluded that Photofrin-based P D T is a good treatment option for this disease and provides good clinical outcome (15). III. Clinical Trials Using Second Generation Photosensitizers M a n y trials have shifted from Photofrin to evaluation o f other photosensitizing drugs, termed "second generation photosensitizers", which show a better depth o f tumour penetration, lower skin sensitivity following treatment and a smaller time period between administration  of  drug  and  light treatment  (1,  11,  14).  Second  generation  3  photosensitizers are being developed with the aim o f creating a pure chemical drug with more effective biological properties that act at a greater tissue depth.  A number o f  clinical trials are being executed using second generation drugs, which have led to their increasing acceptance and characterization in the field o f photomedicine (14). The only systemic second generation drug approved for cancer therapy is temoporhin and it is used primarily for the palliative therapy o f advanced head and neck cancers.  Verteporfin  (Benzoporphyrin Derivative, B P D ) is widely and effectively used for the treatment o f an ophthalmic condition o f the macula termed "macular degeneration". Although not used for the treatment o f cancer, this drug shows properties that could be harnessed for use i n cancer therapy (14). Aminolevulinic acid ( A L A ) is the only topical drug approved ( F D A 1999) for the treatment o f skin cancer (both pre-malignant melanomas and melanomas in addition to actinic keratosis) (14, 16). A L A is a precursor o f protoporphyrin I X which is the reactive component responsible for photodamage when activated by light at 595 nm (14, 17).  A L A has also been used in clinical trials to test the concept o f P D T for  photorejuvination for areas o f skin that have been damaged by the sun (16, 18).  Chlorin  e6 is another photosensitizer which is gaining clinical recognition as an effective method of treating melanoma. In a study by Sheleg et al. it was shown that it was possible to achieve full tumour regression with no recurrence after only one P D T treatment using chlorin e6 (19). Finally, a drug which has received much attention over the last few years in both experimental and clinical trials is meta-tetrahydroxyphenylchlorin ( m T H P C ) .  It  has been used in the study o f many different cancers but most recently in a study done by Hopper et al. (2004) it was used for the treatment o f oral squamous cell carcinoma. This form o f cancer is normally treated by conventional radiotherapy and surgery. However those modalities often result in impaired function o f the treated area.  Following this  4  study involving 114 patients, it was determined that mTHPC-mediated P D T for the treatment o f early oral squamous cell carcinoma is an excellent alternative to traditional modalities and offers very good cosmetic and functional results and a very promising response (20).  Section 2: Why Photodynamic Therapy? P D T is a minimally invasive treatment which can be re-administered a number o f times with no systemic toxicity such as caused by chemotherapy, radiotherapy and surgery. P D T is not toxic to normal or non-targeted cells in the absence o f light and has very few serious side effects.  P D T elicits an immune response against the tumour and  can indeed lead to long term tumour cure and can eliminate metastases when used i n conjunction with surgery. Finally, P D T is an enticing palliative treatment or alternative option to those patients who have not responded well to other mainstream modalities or who exhibit malignancy i n places not accessible to surgery (10-12, 14, 20)  I. Mechanisms of Photodynamic Therapy Photodynamic therapy requires the administration o f a photosensitive drug, light of a specific wavelength and the presence o f molecular oxygen. A t a time following the selective uptake o f drug into the tumour, it is activated by light o f a specific wavelength depending on the properties o f the photosensitizer. The drug, upon absorption o f the light energy can undergo two types o f reactions termed Type I and Type II (10).  Type I  reactions differ from Type II with respect to the initial steps where in Type I reactions, free-radical intermediates, in the presence o f oxygen lead to toxic oxygen products. In Type II reactions, which dominate following P D T , the highly reactive singlet oxygen is produced directly by energy transfer from the triplet-state drug to molecular oxygen (10). 5  Singlet oxygen in addition to other toxic oxygen derivatives like hydrogen peroxide and the hydroxyl radical can be very destructive to the biological integrity o f the cell. These potent species oxidize macromolecules i n their vicinity such as lipids, proteins and nucleic acids which in turn can lead to the loss o f an intact membrane and cause cell death by either apoptosis or necrosis.  This immediate oxygen-mediated trauma can  induce the expression o f a variety o f genes involved i n the response to this damage including early response genes, cytokines, complement, matrix metalloproteinases, and the genes o f the acute phase response (21, 22, 23).  Singlet oxygen, which has been  shown to be the primary cause o f cellular damage following P D T , has a very short lifespan (<0.04us) and radius o f action (<0.02pm) (10, 21). The extent and efficiency o f the cellular damage resulting from photooxidation therefore, is dependent upon the concentration o f drug, the dose o f light and oxygen supply (24). It follows then that the degree o f photosensitizer uptake in tumour-associated cells in addition to the oxygen supply, is o f crucial importance to the level o f photochemical damage received at the site of illumination. II. Photosensitizer localization and CellularUptake The tumour localizing properties o f these light sensitive drugs is what enables their use for the photodynamic treatment or detection o f solid tumours.  The chemical  composition o f the drugs along with the properties o f solid tumours is what enables this preferential localization (10).  Leaky vasculature, high metabolic rate, poor lymphatic  drainage, an elevated number o f low-density lipoprotein ( L D L ) receptors and an increased population o f macrophages are all properties o f solid tumours that lead to the selective increase o f the localization o f photosensitizers to the tumour (10). A n important determinant o f the extent o f Photofrin accumulation is the composition o f a tissue. This  6  is illustrated by comparing Photofrin accumulation i n the spleen versus i n asolid tumour. The spleen shows significantly higher accumulation o f Photofrin than the tumour but it has a much higher number o f cells per gram o f tissue than a solid tumour (24). O n a 'per gram' o f tissue comparison the tumour far outweighs the spleen as to the level o f drug accumulation i n the same animal (25). The extent o f photosensitizer accumulation is not only dependent on tissue composition but more specifically it is related to the cellular distribution within the heterogeneous environment o f the tumour (24, 25).  Further  evidence for photosensitizer heterogeneity beyond its preferential accumulation i n certain cells within the tumour is the variation o f its access to the blood supply which has been shown to rely on the proximity to blood vessels (26).  Host immune cell content in the  tumour, especially resulting from infiltrating macrophages is related directly to the increased retention o f Photofrin i n the tumour (25). Korbelik et al (27) demonstrated that there exists a large population o f host macrophages subverted by the tumour for sustenance and the maintenance o f local homeostasis. A m o n g these tumour-associated macrophages ( T A M s ) there is a sub-population responsible for the elevated accumulation o f Photofrin which at 24 hours post injection was shown to exceed levels in malignant cells by more than three fold (28). The retention i n these macrophages accounts for most o f the drug located within the solid tumour (27).  This T A M sub-population is in an  activated state characterized by increased size and granularity and a high expression o f interleukin-2 receptors (25). Further studies by Korbelik have shown that T A M s contain sometimes more than 13X the levels o f Photofrin retained in the malignant cell population and that the lowest concentrations o f photosensitizer were found i n the nonmacrophage population o f infiltrating immune cells (25, 27, 28). Relative selectivity o f photosensitizer accumulation in T A M s is universal and does not depend on the species o f  7  animal, the origin of the tumour (implanted or spontaneous), the immunogenicity o f the tumour, or the cellular composition o f the tumour (28). Photofrin uptake by macrophages in vitro is greater than the uptake by malignant tumour cells and is related to their phagocytic nature, as was demonstrated by the use o f factors that modify macrophage activity (29). IV. Drug Delivery The localization of photodynamic compounds used in P D T can be a serious limitation to the efficacy o f treatment and therefore there has been research into possible methods to improve delivery which include: o i l dispersions, L D L , liposomes, polymeric particles or hydrophilic polymer-photosensitizer conjugates (10, 30, 31, 32). The most desirable system o f drug delivery would be one which maximizes tumour uptake while minimizing the uptake by normal tissues (10, 30, 31, 32). It has been well documented that Photofrin binds to lipoproteins, plasma albumin and other serum proteins which affect its uptake into cells (31-35). L D L content o f serum and the relative expression o f LDL-receptors on the surface o f tumour cells and normal cells has been examined in order to determine the effect o f these components on photosensitizer retention, clearance and inhibition (31-33).  Photofrin delivered via L D L can increase drug uptake into  tumours due to the increase o f L D L receptors on the surface o f transformed cells (32) but the presence o f high L D L in the serum can prove inhibitory to the uptake o f Photofrin into cells (31).  L D L is perhaps not the only determinant o f the extent o f Photofrin  delivery and uptake by the tumour. Other serum proteins and macromolecules may also play a crucial role as demonstrated by the substantial differences i n composition between mouse serum, human serum and fetal bovine serum which affect photosensitizer delivery (33).  Hence delivery and retention o f Photofrin and other photosensitizing drugs is  8  dependent not only on their intrinsic chemical composition but also on the way in which they interact with the components o f the serum and therefore the design o f these drugs or their carriers must account for all the factors involved (30). V. Light Sources and Delivery P D T is a light-dependent process and therefore requires light to be administered locally to the tumour. Tumours at various sites in the body can be reached by optical fibres coupled to the light source (36, 37). Light sources used for the application o f P D T can vary but are typically either laser or lamp sources emitting in the red region o f the light spectrum, 630-750 nm (36). The wavelength o f light used is dependant on the photosensitizer and is also governed by the depth and location o f the tumour (36, 37). For example, a deeper reaching tumour w i l l require a photosensitizer that can be activated by light o f a longer wavelength, one which can penetrate deeply enough to activate drug localized towards the base o f the tumour.  In addition, tumours located  within the body, like Barrett's esophagus w i l l need to be accessed by a specially designed laser diode attachment.  Section 3 : PDT-induced events leading to the host response I. Photodynamic Action Photodynamic action comprises the direct killing effect o f activated drugs on the cells i n the tumour and the indirect effect caused by a breakdown o f the vasculature and the activation o f the host response (2, 10).  Primary oxidative stress is induced  immediately during and following light administration and is responsible for the initial destruction o f the tumour by (primarily) singlet oxygen (21-23).  Secondary reactions  ensue as a result o f vascular collapse (loss o f oxygen supply) and comprise both the  9  action o f oxidative and nitrosative stress (toxic nitrogen derivatives) generated through the formation o f the superoxide anion, toxic nitrogen species ( N O ) and even activated complement proteins resulting from ischemia reperfusion (2, 10, 38).  Ischemia  reperfusion injury results from the sudden reintroduction o f oxygen to the following a period o f oxygen deprivation. conversion o f xanthine dehydrogenase  tissue  The reintroduction o f oxygen allows the  into the oxidant-producing xanthine oxidase  which induces the formation o f xanthine from hypoxanthine and the consequent release o f a variety o f potent reactive oxygen species (39, 40). Ischemia reperfusion-mediated injury to the vasculature is a potent initiator o f an immune response through complement activation, neutrophil sequestration and the invasion o f other inflammatory cells which can have a very serious impact on the outcome o f therapy (38, 41, 42). Due to the lack o f accumulation o f photosensitizer in nuclei, direct damage to D N A causing mutation at sublethal doses o f P D T tends not to occur, although some strand breaks or chromosomal aberrations have been documented (43, 44). The plasma membrane, lysosomes and mitochondria are all major sites o f the oxidative trauma caused by the primary and secondary reactions o f P D T (45). The extent to which each o f these sites is directly affected by P D T determines at least in part the form o f cell injury and mode o f cell death (45). The uptake o f porphyrins like Photofrin through the plasma membrane is primarily by receptor mediated endocytosis with subsequent distribution to other compartments within the cell (46).  Photofrin and A L A are known to localize  primarily in the mitochondria and therefore inflict P D T damage to the integrity o f the electron transport chain ( E T C ) , leading to decreased levels o f adenosine tri phosphate ( A T P ) and the release o f cytochrome-C which binds to apoptosis protease activating factor ( A P A F - 1 ) , activating caspases that induce apoptosis (10, 47, 48, 49). Reports on  10  the damage to plasma membranes include observations o f swelling, blebbing, and phospholipid scrambling (22, 51, 52). N a7 K  M a n y plasma membrane enzymes such as the  pump are inhibited leading to loss o f membrane transport, an increase o f C a  2 +  concentration, and an increased permeability facilitating more photosensitizer uptake (52, 53, 54). In addition, lipid peroxidation and the regulation o f surface antigen expression are affected and all o f these events lead inevitably to cell death (55, 56, 10).  Section 4: H O S T R E S P O N S E To respond to tissue injury or invasion by a pathogen, the body is equipped with an immune system whose role is to contain and repair damage, destroy the pathogen or altered self cells and protect the body against further intrusion o f non-self/altered-self molecules. Immunity can be divided into two main branches: innate immunity and adaptive immunity. Innate immunity is a non-specific, first line o f defense against injury or invasion.  It consists o f cellular components such as mast cells, neutrophils and  macrophages that express a variety o f pattern recognition receptors (PRRs) that bind conserved motifs on pathogens and endogenous host proteins outside the cell which act as "danger signals". In addition, non-cellular protein components, such as those o f the complement cascade and those o f the acute phase response, execute non-specific action against unprotected entities.  Acute phase reactants promote the release o f cytokines  which serve to alert circulating host cells to migrate to the affected tissue. Complement proteins serve several roles. They bind to the surfaces o f damaged cells or pathogens, flagging them for removal by phagocytic leukocytes (neutrophils and macrophages). They serve as acute phase proteins that amplify the host response, and they form a complex, the membrane attack complex ( M A C ) , which lyses unwanted cells. A l l o f these  11  components help to promote the activation o f the adaptive immune response in order to achieve long-term antigen-specific immunity. The adaptive arm o f the immune response is specific because it is capable o f recognising and targeting specific pathogens or altered self molecules that express unique peptides not expressed by the host. It is comprised primarily o f T and B lymphocytes that interact with the antigen presenting cells like macrophages and dendritic cells which present antigen on M H C molecules expressed on their surface.  This is a very specific  interaction which facilitates the execution o f their antigen-specific responses that lead to long term immunity. PDT-inflicted damage to the tumour results in an abundance o f dead or dying cells and the release o f a variety o f "danger signals". The damage sustained by the body must be contained, damaged cells repaired or removed, dead cells and cell fragments eliminated in order to restore tissue and systemic homeostasis. This is done through the activation o f immune proteins such as those o f the acute phase response and the complement cascade, and by the recruitment leukocytes (neutrophils, monocytes, and dendritic cells) followed by lymphocytes (T-cells and B-cells). I. Cell Death, Danger Signals, and Signalling Pathways Severe PDT-induced trauma leads cells to initiate either a rescue response or to undergo cell death by necrosis (uncontrolled) or apoptosis (controlled) (10, 57, 58, 59). Photofrin is known to localize i n mitochondrial membranes and primarily promotes cell death by apoptosis through the release o f cytochrome C and the activation o f caspase 3 (60, 61) unless initial oxidative damage to respiratory enzymes is too great, then cells undergo necrosis (59).  Apoptosis is a regulated cellular process and as such requires  intracellular signalling cascades and the involvement o f many proteins.  Heat shock  12  proteins (HSPs), molecular chaperones for damaged proteins, have been shown to be induced following P D T (65) and H S P 7 0 for example, has been shown to be expressed on the surface o f PDT-treated cells (66). ligands that activate involves  the  H S P s have been shown to act as extracellular  intracellular signalling pathways.  phosphorylation and  dephosphorylation  regulation o f the stress-induced M A P K pathway.  A widely used mechanism o f tyrosine-kinases  for  the  However, the details o f how this  pathway is activated in P D T have not been completely elucidated (62).  Another  signalling pathway involving protein kinases is one which activates the transcription factor, nuclear factor kappa B ( N F - K B ) which is involved in the activation o f a number o f immune genes and therefore has implications for the host response to P D T (63, 64). Moreover, N F - K B has been reported to be intimately involved with poly(adenosine diphosphate-ribose)  polymerase, or P A R P , which becomes  up-regulated  following  genotoxic stress, ischemia and immune stimulants (67, 68). P A R P is a family o f nuclear enzymes involved i n several different cellular processes involving signalling pathways following stress (68). P A R P - 1 is o f special significance as it has been shown to be a crucial co-activator o f the immune transcription factor N F - K B , which also plays a fundamental role in the activation o f p53 and therefore is a key regulator not only o f cell death by apoptosis or cell survival but is also responsible for the transcription o f proinflammatory genes like interferon-gamma ( I F N - y ) , tumour necrosis factor-a ( T N F - a ) , and adhesion molecules such as intracellular adhesion molecule-1 ( I C A M - 1 ) and Pselectin (67, 68).  This may be o f relevance to PDT-induced cellular stress and the  balance between necrotic and apoptotic cell death and the up-regulation o f genes involved in inflammation and the acute phase response which play a pivotal role i n the curative outcome o f treatment (67).  13  Unlike the events induced by the process o f apoptosis, cell death by necrosis results in the abundant release o f endogenous "danger signals", which promote the activation o f an acute host response through their recognition by immune receptors on surviving tumour-associated leukocytes and those infiltrating from the vasculature (67, 69, 70).  These danger signals include: lipid fragments, heat shock proteins, complement  proteins, and pieces o f the extracellular matrix and plasma proteins, all o f which do not normally exist outside the intact cell and are recognized by infiltrating immune effectors when exogenously present, thereby activating an immune response (67, 71, 72, 73). The PDT-induced immune response resulting from the combination o f events following oxidative trauma involves the production and activity o f several different components which work i n concert and jointly contribute greatly to the overall outcome o f therapy (10, 69, 70, 72, 74). II. A C U T E P H A S E  RESPONSE  P D T elicits a strong acute phase response resulting from the induced production o f pro-inflammatory cytokines, primarily interleukin-6 (IL-6) but also T N F - a and I L - 1 . The expression o f all o f these cytokines is enhanced by the complement system activated by P D T (75).  This is a non-specific host response following tissue trauma which  orchestrates the infiltration o f immune cells like neutrophils, monocytes/macrophages, mast cells and lymphoid cells i n order to remove damaged tissue and to further destroy altered-self material such as remaining tumour cells (72, 75). This initial local response has far-reaching effects on many organs o f the body, most prominently the liver which is the site o f the production o f major acute phase proteins including complement components, pentraxins, C-reactive protein ( C R P ) and serum amyloid P component (SAP) These acute phase proteins accumulate i n P D T -treated tumours where they bind  14  to the damaged elements thereby promoting their removal by phagocytic cells (75, 76, 77-81). III. Cellular Effectors of PDT-Induced Host Response III a. Neutrophils O f hematopoietic origin, neutrophils or polymorphonuclear leukocytes ( P M N s ) enter circulation, acting as sentinels in immune surveillance. They are characterized by the presence o f cytoplasmic granules containing oxidative and cytotoxic agents, which facilitate their role i n the degradation o f dead or foreign materials (82). Following P D T , as a result o f the acute phase response, there is a marked complement- and cytokinedependent increase i n the number o f circulating neutrophils, that respond to these stimuli by efflux from the bone marrow and other non-circulating pools and then they are recruited to the damaged tumour (78). Neutrophils have been identified as an essential component for therapeutic benefit (83). They are the first immune cells to arrive at the tumour and to begin mediating the clearance and degradation o f irreparably damaged tissue (78).  The activation o f complement and the release o f I L - 1 , IL-8 and T N F - a  contribute to the up-regulation o f adhesion molecules like P and E selectins as well as I C A M - 1 on the surface o f endothelial cells lining the damaged site and thus facilitates the migration o f neutrophils from the circulation into the tissues (84). The rapid invasion o f neutrophils into the tumour i n response to the presence o f pro-inflammatory mediators is sustained by further production o f pro-inflammatory cytokines by the neutrophils themselves. Their ability to rapidly produce and release cytokines, in addition to toxic derivatives, makes them essential not only to the destruction o f abnormal or dead cells but also to the recruitment o f monocytes/macrophages, mast cells and T-cells which further mediate the immune response (85, 86, 87).  15  Neutrophils represent a potent inflammatory weapon i n tissue injury and thus an essential component in the response to P D T (78-80, 88). It is in a complement-dependent manner that neutrophils followed by monocytes/macrophages and lymphocytes migrate in high numbers to contain the damage, destroy the tumour and mediate inflammation. Moreover, a role in antigen-specific immune responses is indicated by the  surface  expression o f M H C II molecules on neutrophils i n PDT-treated tumours (78, 79). This indicates that neutrophils are recognizing non-self (tumour-specific) molecules and presenting them to T lymphocytes in the context o f M H C peptides.  This could have a  significant impact on the activation o f long-term tumour resistance by means o f adaptive immunity. I l l b. Macrophages Macrophages are a specialized phagocytic leukocyte that, unlike neutrophils, are long-lived and found as residents in many tissues in the absence o f inflammation where they localize upon differentiation from monocytes (87). T w o types o f macrophages exist where type-1 is IL-12, IL-23 producing and immune-promoting and type-2 is IL-10 producing and promotes immuno-tolerance (89). M a n y o f their functions overlap with those o f neutrophils. However, macrophages often play a housekeeping role throughout the body by digesting dead or dying cells and maintaining tissue homeostasis (87, 88). The uptake or phagocytosis o f apoptotic cells by macrophages, which is generally antiinflammatory and primarily complement dependent, is critical to the proper regulation o f the immune system, particularly through their ability to present signals o f tolerance to Tcells (90).  Macrophages are equipped with a multitude o f surface receptors which  facilitate their vast and specialized role in immunity and tissue homeostasis. include integrins, scavenger receptors, complement receptors (CRs),  These  i n addition to a  16  number o f P R R s such as Toll-like receptors and C D 1 4 which signal the activation o f several immune genes through  N F - K B (71, 87-91).  Macrophages share a common origin  with dendritic cells and are specialized for antigen presentation.  Because o f their  interaction with other leukocytes and lymphocytes and their wide tissue distribution they are integral to the development o f both local and systemic inflammatory responses ( 8 7 ) . Macrophages comprise a major cellular portion  (-30%)  o f untreated  solid  tumours and accumulate a large proportion o f tumour-localized Photofrin ( 2 6 , 2 8 ) . In addition they are the most numerous leukocyte to infiltrate the tumour  following  treatment by P D T and are thought to play a major role in the curative outcome o f therapy ( 8 0 , 8 5 ) . Macrophages possess many cell surface receptors (ie PPvRs) designed to detect foreign material such as bacteria and viruses. However these same receptors have been shown to bind materials that are not normally found outside the cell, such as heat shock proteins (HSPs), phosphatidyl serine (PS), lipid fragments and other intracellular proteins which are released by apoptotic and necrotic cells following P D T ( 5 5 , 5 6 , 7 1 ) . These latter components are characterized as 'danger signals' which alert macrophages through their receptors and activate them ( 7 1 , 9 2 ) .  Activated macrophages are capable o f  synthesizing all o f the complement components ( 9 3 ) and can restore humoral immunity in complement deficient mice through bone marrow transplantation ( 9 4 ) .  They also  secrete o f a number o f pro-inflammatory as well as anti-inflammatory cytokines and can both amplify the immune response through positive feedback or repress it through receptor mediated intracellular signalling ( 8 7 , 9 5 ) . In P D T they play an important role i n the removal o f dead macrophages.  or critically damaged  tumour cells, neutrophils and  other  The activity o f macrophages is important for continuing the immune  response and links it to the activation o f the adaptive immune system through antigen  17  presentation.  Therefore, they contribute to long term tumour immunity following P D T  (71, 80, 96). I l l c. Lymphocytes Adaptive immunity enables long-term, antigen-specific immunity executed by T and B lymphocytes. Naive T-cells develop in the thymus as either C D 4 + or C D 8 + and move into the circulation once mature (97).  C D 8 + T-lymphocytes are known as  cytotoxic T-cells and are M H C - I resctricted and therefore associate with virally infected cells expressing viral antigen associated with M H C - I . In addition, C T L s that are tumourspecific play a role in immune surveillance and the elimination o f tumour cells as they arise (97). In P D T , C T L s have been shown to become activated and are o f interest i n research concerning tumour vaccines (69). C D 4 + T-lymphocytes are known as T-helper cells and can be o f type T 1 or T 2 . These cells are M H C - I I restricted and associate with H  H  antigen presenting cells like dendritic cells, macrophages and B lymphocytes. C D 4 + T 1 H  cells activate macrophages through their production o f IFN-y, I L - 2 , and TNF-p whereas 1  C D 4 + T 2 cells are responsible for stimulating B-cells to differentiate by secreting IL-4, H  IL-5, IL-6, IL-10 and IL-13 (97).  In P D T , the depletion o f C D 8 + cells impaired  therapeutic outcome more than did the depletion o f C D 4 + cells indicating that C T L ' s contribute more to the therapeutic benefit o f P D T than do C D 4 + T-cells (80).  Finally,  natural killer T-cells ( N K ) make up less then 10% o f circulating lymphocytes and were named for their tumouricidal abilities in the absence o f M H C restriction (97). B lymphocytes are generated i n the bone marrow independent o f antigen and migrate to secondary lymphoid organs where they encounter antigen (97). Those B-cells whose antigen receptors encounter an antigen to which they are specific w i l l remain in the secondary lymphoid organ where the B-cells become activated either to secrete  18  antibody in association with antigen-specific T-cells (CD4+ T 2 ) or to become memory H  B-cells. B-cells that bind a complement-immune complex have dramatically increased signalling leading to increased activity (97). Tumour cure rates drop drastically in S C I D mice deficient in lymphoid cell populations indicating that therapeutic efficacy is dependant on the proper functioning o f adaptive immunity (98, 99). IV. Complement Complement proteins and the complement cascade are major components o f the innate immune system and are also thought to be necessary for effective activation o f the adaptive immune response (100).  The complement system comprises more than 30  proteins including plasma proteins and receptors.  It is involved i n the recognition and  elimination o f pathogens and altered host cells through several mechanisms (100, 101). Activation o f the system can occur through three separate pathways: the classical pathway, the lectin pathway, or the alternative pathway (Figure 1).  Each o f these  pathways is initiated by different recognition molecules( 100).  19  Lectin Pathway  Classical pathway  Alternative Pathway  Figure 1: Simplified representation of the complement cascade (adapted from source 114).  IV a. Complement Activation The classical pathway o f complement activation occurs with the binding of circulating C l q to the activating complex (z'e altered-self, pathogen) and the binding o f an I g M heavy chain to the bound C l q (100, 102). Binding of at least two C l q molecules to the immune complex causes autoactivation o f the associated serine protease C l r that in turn cleaves and activates C l s . Activated C l s subsequently cleaves the next component C4 into C4a and C4b.  C 4 a is an anaphylatoxin with chemotactic abilities and C4b  opsonizes or targets the activator for phagocytosis.  C4b is bound by the active  component o f cleaved C 2 , C2a. This complex C4b2a is a C3 convertase which is able to cleave the central component of the complement cascade, C3 (100, 102). The lectin pathway o f complement activation is activated by the presence o f carbohydrate structures that become expressed/uncovered on apoptotic cells, and by high  20  mannose-containing polysaccharides common to many pathogens (100). The binding o f mannose-binding lectin ( M B L ) to the activating surface, along with its binding to (MBL)-associated serine protease-1 ( M A S P - 1 ) , and M A S P - 2 proteins, leads to cleavage and activation o f C4 and C 2 and the formation o f the C3 convertase (100). The alternative pathway o f complement activation occurs through the low-level spontaneous cleavage o f C3 to C 3 a and C3b. C3a is a potent anaphylatoxin capable o f augmenting the immune response and complement production whereas C3b bound to plasma protein factor B forms a C3 convertase (100).  This pathway becomes truly  activated or amplified when C3b binds an activator which lacks complement regulatory proteins. This is a major amplification step governed by a positive feedback loop where the more C3 cleaved, the more C3b bound to factor B is produced and the more C3 is cleaved (100). Activating complexes like pathogens and altered self molecules lack the complement regulatory proteins necessary to suppress this pathway and provoke full activation (100). These three initial activation pathways are all routes to the formation o f C3 convertase and the activation o f C3 by its cleavage to C 3 a and C3b. Once C3 has been cleaved, the terminal pathway o f the complement system can be activated through a series o f sequential cleavages by proteases, leading to the formation o f the membrane attack complex ( M A C ) , assembled by the sequential recruitment o f terminal proteins C5b, C 6 , CI, C 8 and C 9 (100, 103). A l l o f these proteins must be present on the surface o f the activation complex in order for M A C formation and lysis o f the pathogen or altered host cell (100, 102, 103).  IV b. The multiple roles of complement proteins IV b-1. Opsonization Some complement proteins are involved in the opsonization or 'flagging' o f altered host cells or pathogens for phagocytosis by macrophages and neutrophils which recognize the deposited complement proteins through specific complement receptors. C l q , and C3 fragments C3b and iC3b, all covalently bind to the surface o f their targets which become recognized and phagocytosed by leukocytes expressing the C R 1 , C R 3 and/or C R 4 complement receptors (100, 102, 104). Macrophages bound to opsonized surfaces show up to a 10-fold increase in engulfing activity (105). IV b-2. Anaphylatoxins Active members o f the complement system which play a major role in the amplification o f the immune response and inflammation are the anaphylatoxins (99, 102). C3a, C 4 a and most especially C 5 a are potent instigators o f myeloid cell sequestration through interaction with their receptors (C3aR, C 4 a R and C5aR) and initiate strong positive feedback mechanisms to induce further complement production and the synthesis of cytokines and chemokines (ze IL-8 and I L - i p ) and are often the major culprits i n complement-related autoimmunity (100-102, 106-107).  C 3 a and C 5 a (and to a lesser  degree, C4a) initiate intracellular responses in macrophages, mast cells and neutrophils through interaction with their receptors C 3 a R and C 5 a R respectively (100).  These  anaphylactic proteins can mediate the release o f lysosomal enzymes from leukocytes, the release o f histamine from mast cells and the recruitment o f these cells from circulation (100, 108-110).  The acute phase response is largely mediated by the activation o f  anaphylatoxins C 3 a and C 5 a which induce the synthesis o f T N F - a , I L - i p , and 11-6, all o f which have important roles i n the regulation o f expression o f acute phase proteins such as  22  C-Reactive Protein ( C R P ) and Serum A m y l o i d P component ( S A P ) (111). Furthermore, C5a is largely responsible for the early recruitment o f T-cells to the affected tissue and their sensitization to the activator complex. A l o n g with their receptors, C 3 a and C5a also help regulate B - c e l l functions. This represents one area where complement is responsible for the bridging o f innate immunity with acquired immunity (112-114). IV b-3. The Membrane Attack Complex M A C is the aggregation o f complement components C5b to C 9 to form the C5b9 complex on the surface o f pathogenic or altered host cells. C5b is able to bind to C 6 and form a metastable bimolecular complex. This complex is able to bind to C 7 to form C5b67.  C5b-7 is able to insert itself into the membrane lipid bilayer o f cells.  Each  inserted C5b-7 complex is able to bind a C 8 which stabilizes the insertion and causes small pores to form. This complex o f C5b-8 becomes a C 9 acceptor and can bind up to 16 C9s to complete the M A C .  The assembly o f these components leads to cell lysis  because o f the loss o f membrane integrity caused by the formation o f pores (100, 101). The receptor-independent binding o f this complex also activates numerous signalling pathways such as those leading to activation of N F - K B (115, 116). A high level of M A C formation in tissues is representative o f complement activation and is indicative o f its procession to completion. IV c. Complement Regulators Due to the systemic presence o f circulating complement under normal conditions and its potent pro-inflammatory and destructive abilities, tight control o f the system is crucial to prevent normal host cells from succumbing to complement-mediated attack (100). The host has defences against complement deposition on normal cells mediated by complement regulators that can be either secreted plasma inhibitors or membrane-bound  23  inhibitors (117-118). These complement inhibitor proteins prevent the formation o f the C3 convertases or o f the M A C .  Soluble inhibitors include: C I inhibitor, C4b binding  protein, factor I, factor H , and S protein, whereas membrane-bound regulatory proteins (mCPvPs) include: membrane cofactor protein ( M C P , CD46), decay accelerating factor ( D A F ) and protectin (CD59) (117).  m C R P s are found in most tissues and on all  circulating cells and have been shown to be up-regulated in tumour cells thereby allowing them to escape immune surveillance (118, 119).  During complement activation,  complement binds to cells not displaying these inhibitory molecules and w i l l exceed the concentration o f soluble inhibitors thereby allowing its sequential and significant activity in innate and adaptive immune activation (119). I V d . Complement Synthesis Plasma concentrations o f complement proteins range from 2 (j.g/mL (factor D o f the alternative pathway) to 2 mg/mL (C3) and are primarily synthesized in the liver by hepatocytes and released into the circulation (120).  In the late 1960s it was found that  plasma C proteins increase i n concentration i n response to inflammation and are implicated in the acute phase response which further demonstrates their liver-derivation (121). Later, it was determined that hepatocytes are not the only source o f complement. Discovery that C l q , factor D and C 7 were not found in the liver led to the search for the source o f extrahepatic production o f complement proteins (93, 122, 123).  Sources o f  extra-hepatic complement production may contribute to plasma levels as well as be important to tissue homeostasis, as well as provide an immediate local defence against altered host cells or invading pathogens (93, 123, 124-126). Cells that have been shown to produce complement proteins include; endothelial cells, epithelial cells (GI and lung), fibroblasts,  adipocytes, brain cells (astrocytes, microglia and neurons) and leukocytes  24  (macrophages, neutrophils) (122). Because of its variety of roles it is not surprising that local and hepatic complement synthesis are differentially regulated (93).  Local  complement production by macrophages and neutrophils may be of critical importance in inflammation.  Macrophages have been shown to be capable of synthesizing all  components of the complement system and are thought to be of major importance in local production of complement (122). Wild-type bone marrow transplanted into complementdeficient knock-out mice restored humoral immunity by local synthesis by macrophages thus revealing the extent and importance of local complement production by macrophages (94). I V e. Complement in P D T  PDT-treated cells are the targets of complement proteins C3b, iC3b and C5b which act as opsonins, flagging them for recognition by innate immune recognition receptors on the surfaces of immune cells (71, 96, 126). Opsonization of PDT-damaged cells can attract circulating and resident macrophages, neutrophils, dendritic cells and lymphoid cells. Complement receptors on the surfaces of these cells trigger intracellular signalling pathways which result in the up-regulation of expression of pro-inflammatory cytokines (71). In addition, it has been shown that complement plays a significant role during the induction of PDT-induced neutrophilia (41, 96).  Complement components  C3a and C5a have also been shown to be of importance in the curative outcome of PDT since the blockage of their receptors resulted in decreased cure rates of Lewis Lung Carcinoma tumours (126). Complement activation at the treated tumour site results in an increase of MAC formation as detected by immuno-histochemisty to C5b-9 and further supports the role of complement in the host response to PDT (41). In addition, nearby immune cells displaying complement receptors or other innate immune receptors such  25  T L R - 2 and T L R - 4 are able to detect breakdown products o f the extracellular matrix, fibronectin, lipid fragments and exogenous proteins like HSP70 among other danger signals massively released by the PDT-treated tumour (71). T L R s are innate P R R s that have the  ability to recognize  danger signals  and initiate intracellular signalling  mechanisms in coordination with other receptors (like complement receptors) and adaptor molecules like myeloid differentiation factor 88 (MyD88) and T I R domain containing adaptor protein ( T I R A P ) , that lead to the up-regulation o f various pro-inflammatory cytokines and chemokines through the activation o f  NF-KB  (71).  In the case o f P D T ,  T L R s on the surface o f resident or infiltrating immune cells such as macrophages may play an important role during the host response to PDT-induced damage (126, 66). Oxidative damage to P D T treated tumour cells either directly by the action o f singlet oxygen or indirectly by PDT-induced ischemia reperfusion injury causes activation o f the complement system (128, 129).  Following its initial activation at the tumour site an  increase o f C3 has been demonstrated both in the tumour and i n the blood, following treatment by P D T . V . T L R signalling pathways T L R s are intimately involved i n innate immunity as P R R s that are capable o f detecting a wide range o f danger signals and signalling the activation o f transcription factors that control the expression o f more than 2000 genes whose products include inflammatory proteins (Figure 2) (130). There are at least 13 o f these receptors ( T L R 1 T L R 1 3 ) , found primarily on the surfaces o f immune cells (71, 128).  T L R s are type I  transmembrane receptors characterized by extracellular leucine-rich repeats and an intracellular domain called T o l l / I L - I R (TIR) domain which shares homology with the interleukin-1 receptor (IL-1R) (130).  In most cases, intracellular adaptor proteins like  26  M y D 8 8 are required for signalling the  NF-KB  pathways.  M y D 8 8 interacts with T L R s  through its T I R domain and also contains a death domain which enables its interaction with IL-1 receptor-associated kinase ( I R A K ) .  Another adaptor protein, Tollip (Toll-  interacting protein) helps to recruit I R A K to T L R (130). T I R A P facilitates a M y D 8 8 independent T L R signalling for  NF-KB  activation and may be responsible for providing  downstream signalling specificity for T L R s (131). Activation o f T L R s by exogenous ligands recruits the cytoplasmic adaptor proteins that mediate the activation o f I R A K which i n turn interacts with tumour necrosis factor receptor associated factor 6 ( T R A F 6 ) that leads to the activation o f N F - K B , or I N K (c-jun-N-terminal kinase), E R K (extracellular signal regulated kinase), and p38 which facilitate the formation o f the gene transcription complex A P - 1 (activating protein 1) through the M A P K cascade (71). P D T results in the massive release o f danger signals from PDT-treated tumours which could engage the activity o f T L R s expressed in myeloid and lymphoid cells that have the ability to activate the transcription o f genes associated with and necessary for the host response to this damage (66).  27  LPS  HSP70  Bacterial products  lipoproteins HSPs  Other TLRs  /  ^Proinflammatory cytokines: IL-1, IL-6, IL-12, T N F - a , complement (??) etc.  Extra-cellular  Figure 2: Simplified representation of T L R signalling pathways (adapted from source 130).  Section 5: Rationale for the thesis project The  complement cascade is a critical component o f innate immunity and  important for bridging innate and adaptive immune responses which have been shown to play crucial roles in the host response to P D T . Complement is up-regulated following P D T and is known to be an important factor in the therapeutic outcome o f this type o f rumour treatment.  However, many questions as to its role the host-response to this  treatment remain and discoveries are needed to answer remaining questions regarding its functions and may be valuable i n devising ways to improve responses to PDT.  28  Hypothesis: PDT causes an increase in the tumour-localized expression of key complement component genes.  Specific Aims of This Project: 1. To determine the source of increased complement gene expression following PDT 2. To determine the cells responsible for the increase of local complement gene expression using in vitro models with tumour cells and macrophages 3. To investigate cellular signaling pathways underlying the PDT-induced up-regulation of complement genes  29  Materials and Methods The mice used in the experiments were 8-12 week old C57B1/6J, B 6 . 1 2 9 S 4 - C 3 ( C 3 K O ) , or B 6 . K B 2 - C l n 8  n m d  TMLCRR  / M s r J ( T L R - 4 K O ) males/females, and were kept in the  Joint A n i m a l Facility at the B . C . Cancer Research Centre where they were provided with food and water ad libitum.  The A n i m a l Ethics Committee o f the University o f British  Columbia approved all protocols. LTumour Model: a. In Vivo Lewis  Lung  immunocompetent  Carcinoma C57BL/6J  ( L L C ) tumours  (132)  were  grown  in  syngenic,  mice and were maintained in vivo by tumour brei  inoculation. M i c e were sacrificed using C O 2 gas and tumours were extracted aseptically from the hind legs using forceps and a #22 scalpel blade.  Tumours were minced by  chopping and cutting using two #22 scalpel blades and, for brei, were passed successively through a 20 and 22 gauge needle. The brei was then suspended in phosphate buffered saline solution (PBS) at 5 X the volume o f tumour. 0.2 m L o f tumour brei was injected into the hind legs o f anaesthetised mice using a 22-gauge needle For experiments, minced tumour tissue was placed in an enzyme cocktail consisting o f 0.3 m L each o f collagenase Type I V (Sigma-Aldrich C o . , St. Louis M O ) (0.24 mg/mL), Dispase (Boerhinger, Mannheim, Germany) (0.18 mg/mL), and D N A a s e Type I (Sigma), (0.6 mg/mL), diluted to a final volume o f 5 m L with cold P B S . The suspension was rotated and incubated at 37°C for 30 minutes at which time the suspension was immediately forced through a 100 micron filter using a 6 cc syringe and pelleted by centrifugation at 800 rpm for 10 minutes. The supernatant was discarded and the tumour cells counted using a hemocytometer and re-suspended in P B S to yield a concentration o f  30  2-3 X 10 tumour cells/0.04 m L for subcutaneous injection into the sacral dorsal region 6  of each recipient. A l l subcutaneous tumours were treated with P D T at approximately 8-9 days postinoculation when the tumours reached 8-10 m m in diameter, slightly larger than the optimal PDT-size. b. In vitro culture L L C cells were cultured at 37°C, 5% CO2 and 95% humidity, in alpha-minimal essential medium (Sigma) supplemented with heat inactivated 10% fetal bovine serum (Hyclone Laboratories Inc., Logan, Utah, U S A ) , lOOug/mL streptomycin and 100 Units/mL penicillin (Sigma) where they adhered to the bottom o f T 7 5 c m tissue culture 2  flasks.  Cells were allowed to grow until near confluent and then were treated for 3-5  minutes with T r y p s i n - E D T A (Sigma) and washed with complete medium, collected by centrifugation at 800 rpm and resuspended in P B S at a concentration o f 3 X 10 cells/0.04 6  m L for subcutaneous injection into the sacral dorsal region o f recipient mice. In the case o f  in vitro studies, a predetermined number o f cells was plated into 3 cm  diameter Petri dishes so that there would be approximately 1 x 10 cells at the time o f 6  treatment.  Just prior to PDT-treatment the cells were washed twice with P B S and  resuspended i n 0.5 m L o f protein-free and serum-free medium (S8284, Sigma).  II. Macrophages a. Tumour-associated Macrophages T A M s were obtained from subcutaneous L L C tumours by preparing a tumour cell suspension as described above.  3 X 10 cells were plated into 3 cm diameter Petri dishes 6  in 2 m L serum-free medium and incubated for 20 minutes at 37°C to allow the macrophages to preferentially adhere to the Petri dish. Non-adherent cells (cancer and  31  stromal cells) were aspirated off and the atached macrophages were washed once with PBS  and left in 2 m L o f complete medium.  Before being co-incubated with  treated/untreated L L C cells they were washed once with P B S and overlaid with l m L o f protein-free and serum-free medium. This differential attachment procedure is routinely used i n our laboratory (27). b. Splenic Macrophages Splenic macrophages were obtained from the spleens o f mature female mice by scraping the spleens with forceps and the dull side o f a scalpel blade i n P B S followed by centrifugation at 800 rpm. The cells were then suspended in a hypotonic lysis buffer solution (10 r n M K H C O 3 , 150 m M N H C 1 , 0.1 m M E D T A (pH 8)) to remove red blood 4  cells, incubated on ice for 20 minutes, centrifuged and resuspended i n complete medium (26).  4 x 10 cells were plated into 3 c m diameter Petri dishes i n 2 m L o f complete 6  medium overnight until needed. Just prior to treatment the cells were washed once with P B S and resuspended i n 1 m L o f protein-free and serum-free medium.  III. Photodynamic Therapy Photofrin® obtained from A x c a n Pharma Inc. (Mont-Saint-Hilaire, Quebec, Canada), was reconstituted i n 5% dextrose i n H 0 and used i n the photodynamic therapy 2  of all in vivo and in vitro tumours.  For in vivo experiments, Photofrin® was injected  intravenously through the tail vein at a concentration o f 10 mg/kg (0.2 mL/20 g mouse). For in vitro experiments it was added to the 25 m m diameter culture inserts with a 0.02 pm anapore membrane base (Nalge Nunc International, Naperville, I L . , U S A ) at a concentration o f 20 |xg/mL where 16 p i o f a 2.5 pg/mL stock was added per tissue culture insert (2.0 m L ) . The drug was administered 24 hours before light treatment for both the  32  in vivo and in vitro experiments.  Light o f 630+/-10 nm (the absorption peak for  Photofrin), generated from a 150W Q T H lamp equipped high thorough-put  fiber  illuminator (Sciencetech Inc., London, Ontario, Canada), was delivered through an 8 m m core diameter liquid light guide (model 77638, Oriel instruments, Stratford, C T , U S A ) . In vivo tumours received a light dose o f 150 J / c m and in vitro cells received a dose o f 1 2  J/cm . 2  In  selected  experiments,  the  effects  of  P D T based  on  photosensitizer  benzoporphyrin derivative (BPD), provided by Q L T Phototherapeutics Inc. was also tested.  In this case, B P D (2.5 mg/kg i.v.) was administered 3 hours before tumour  illumination (100 J/cm ). 2  Animals given light treatment were restrained unanesthetized in lead holders exposing only the dorsal sacral region where the tumours were located.  IV. Sample Collection for R N A Isolation  a.Tumour Extraction A t the appropriate time following light treatment (or no treatment) mice were sacrificed using C O 2 gas. Tumours were excised using surgical scissors and forceps and immediately placed in 1 m L o f cold T R I ® Reagent (Sigma).  The sample was then  homogenised for approximately 1 minute (until the tissue was sufficiently broken up) and incubated at room temperature for 5 minutes before being put on ice. A l l samples were frozen i n T R I reagent (Sigma) at - 8 0 ° C before R N A isolation. Livers were harvested and homogenized in the same way as the tumours.  b . C e l l Collection Macrophages or tumour cells were collected by adding 1 m L o f Trizol (Invitrogen Co., Carlsbad, California, U S A ) to the Petri dish and scraping the cells gently with a rubber policeman. The cells were collected with a pipette and transferred to a 1.5 m L centrifuge tube and frozen at - 8 0 ° C for later R N A isolation. c. R N A I s o l a t i o n a n d  Purification  Workspace and pipettes were cleaned using RNase-Zap (Sigma) and all pipetting was done with aerosol-free, plugged A R T pipette tips (Sigma). Samples i n T R I reagent were removed from the - 8 0 ° C freezer, thawed at 37°C in a water bath and then placed on ice. They were then transferred from 5 m L tubes to smaller 1.5 m L centrifuge tubes (in vivo samples) and spun at 12,000 rpm for 10 minutes at 4°C. Samples were placed on ice and the clear aqueous supernatants collected and transferred to another tube containing 200 ul o f chloroform containing isoamyl alcohol. The samples were vortexed for 15 seconds and left at room temperature for 10 minutes, again spun at  12,000 rpm for 10 minutes at 4°C, and the aqueous phase then  wastransferred to another tube. Using acid phenol (pH 5) and chloroform, the samples were "cleaned" and excess protein and T R I reagent/Trizol was removed.  A n equal  volume o f acid phenol was added to the aqueous phase (containing R N A ) and 1/5 the total volume o f chloroform was added.  Samples were vortexed for 15 seconds,  centrifuged at 12,000 rpm at 4°C and the aqueous supernatant transferred to a new tube for the process to be repeated.  After phenol cleansing, samples were precipitated with  10% 3 M N a O a C (pH 5.2) and 100% ethanol (2.5X volume) and incubated for 1 hour at 20°C. Following this incubation the samples were centrifuged at 12,000 rpm for 20 minutes at 4°C. The supernatant was discarded and only the R N A pellet remained at the  34  bottom o f the tube. One m L o f 75% ethanol was added to each tube with gentle shaking and the R N A was again pelleted by centrifugation at 12,000 rpm for 10 minutes at 4°C. The  supernatant  was  discarded and the  pellet was  dried at room  temperature  (approximately 10 minutes). Finally the pellet was resuspended and dissolved i n D E P C (dietheylpyrocarbonate) treated water and kept at - 8 0 ° C until use.  V. Semi-Quantitative R T - P C R a. cDNA Synthesis Complementary strand D N A ( c D N A  was synthesised from 1 pg o f total R N A  using products from Invitrogen. One u.g o f R N A was added to a P C R tube along with 1 u L d N T P m i x (10 m M each o f d A T P , dTTP, d G T P , d C T P ) and 1 u L o f oligo (dT)12-18 (500 u.g/mL) primers and topped to a total o f 12 p L with D E P C water.  This was  incubated at 65°C for 5 minutes in the thermocycler ( M J Research, Waltham, M A , U S A ) and immediately chilled on ice. Eight uT o f master m i x (4 p.1 Superscript II buffer (5X), 2 p L D T T (0.1M), 0.1 ul R N A s e inhibitor-cloned (10 U / u L ) , 0.9 jul D E P C water, and 1 u.L superscript II reverse transcriptase (200 U / u L per 20 |xL reaction) was added to each tube. This was spun down using a P C R mini centrifuge and left at room temperature for 10 minutes followed by 50 minutes at 42°C and 70°C for 10 minutes in the thermocycler. b. Oligo Nucleotide Primers The complete c D N A sequences for the four genes o f interest (mouse complement components C3, C5, C9 and the housekeeping gene glyceraldehydes-3-phosphate dehydrogenase, GAPDH)  were found on N C B I ' s Genbank (www.ncbi.nlm.nih.gov).  Primers designed to be specific to the 3' end o f the m R N A sequence o f the genes o f interest were constructed to be 18-22 nucleotides in length and were ordered from Qiagen  35  (Qiagen Inc., Valencia, C A , U S A ) .  Table 1 shows the respective primer pair sequences,  their melting temperatures (Tm), and their product size.  Table 1: Description of oligo-nucleotide primer pairs used in P C R reactions.  gene GAPDH C3 C5 C9  primer sequence (5'-3')  alignment  Tm©  PCR product size  TGGCCTCCAAGAGTAAGAA GGCCCTCCTGTTATTATGG GAAAAGCCCAACACCAGC GGACAACCATAAACCACCATAG CCTCTGGCTTGGAAACCTA ACCAACACCCCTGACTGCTA T T G GA A A A G G C T G T T GA A G A C CACTGCCCATCCAGAAGAAT  left right left right left right left right  63.4 62.7 56.3 57.2 59.2 60.1 57.2 57.2  147bp 151 bp 157bp 109bp  c. Polymerase Chain Reaction (PCR) A l l P C R reactions were performed in a PTC-100 Thermal Cycler (MJ Research). P C R was done using reagents from Invitrogen and according to their outlined procedure. For a 20 pX reaction, 2 uX o f magnesium-free 10X P C R buffer [200mM T r i s - H C l , 5 0 0 m M KC1], 0.6 u L o f M g 2 + (50mM), 0.4 pX d N T P mix (10 m M each), 1 p X o f each o l i g o - D N A primer (10 m M ) (Qiagen), 1 uX o f c D N A , 0.2 uX Taq D N A polymerase (units) and 13.8 uX o f sterile DEPC-treated d d H 2 0 . A master m i x was made for all primer sets and 19 u X added to 1 uX o f c D N A i n 0.15 m L P C R tubes ( V W R ) . 30 cycles with the following parameters were done: Step 1-95°C for 2 minutes, Step 2-95°C for 30 seconds, step 3-54°C (C3, CP), 55°C (C5), 58°C (GAPDH), 72°C for 7 minutes, step 6-4°C for 10 minutes.  step 4-72°C 1 minute, step 5-  The results o f the P C R under these  parameters on both a positive control (mouse D N A ) and a negative control (water) are shown in figure 3.  36  parameters on both a positive control (mouse D N A ) and a negative control (water) are shown in figure 3.  GAPDH +  -  C3 +  -  C5  C9  +  +  • •  1 —  200bp lOObp  F i g u r e 3 : Positive and negative controls to demonstrate the proper functioning o f the Polymerase Chain Reaction and its parameters for the primer pairs designed to amplify G A P D H , and the complement component genes C 3 , C5 and C 9 . G A P D H , C 3 , C5 and C9 were amplified from mouse D N A using the primer sets described in Table 1 under the conditions discussed above. These are designated + as they represent the positive control for this reaction. The negative control is designated -, where the P C R template is water.  d. Poly-acrylamide G e l Electrophoresis A 50% acrylamide/bis-acrylamide stock (73.05 g acrylamide + 1.95 g bisacrylamide in 150 m L ) was used to make a 12% acrylamide gel. For each gel 12 m L o f 50% acrylamide stock was added to 10 m L o f 5 X T B E (108 g TRIS buffer + 55 g Boric acid + 40 m L o f 0.5M E D T A in 2 L o f ddH 0) topped with d d H 0 to a volume o f 50 m L . 2  2  To polymerize the acrylamide 100 u,L o f tetramethylethylenediamine ( T E M E D ) and 50 LIL o f 20% A P S (ammonium persulfate) was added and the solution mixed by inverting 3 times. It was poured into the plates and the plates were left for about 1 hour or until the gel was polymerised.  37  Two uX o f 10X loading buffer (dye) was added to the 20 p.L P C R products and 10 u L was loaded into the gel. The gel was run at 160 volts for approximately 1 hour and 45 minutes at which time the gels were stained with SYBR-green nucleic acid stain (Invitrogen). Fourty u.L o f S Y B R green (lu.OOOX) were diluted in 400mL o f d d H 0 and 2  the gels were stained for 40 minutes before being scanned. e. Gel Imaging Gels were scanned on the S T O R M (Amersham) Imager. They were placed on the scanner bed over plastic wrap and removed from the glass plate gently using water and adherence to the plastic wrap. A i r bubbles were removed gently by pushing them to the sides then scanner properties were selected.  The area o f scan was entered and the  phospho-blue selection was picked. The scan took between 7 and 10 minutes depending on the area selected.  The images generated were used i n the quantification o f gene  expression. f. Image Quantification Gene  expression was  quantified using ImageQuant  software  (Amersham  Biosciences, Piscataway, N J , U S A ) . Individual band intensity was measured in terms o f pixels per unit area compared to the background intensity. For each sample the intensity of the gene o f interest (C3, C5 and CP) was normalized against the intensity o f G A P D H for that same sample thus giving a new "normalized" value for gene intensity which can be used for the analysis o f gene expression.  38  VI. Antibody Staining and Flow Cytometry F l o w cytometry was done using the Coulter Epics Elite E S P apparatus from Coulter Electronics (Hialeah, F L ) . A 488 n m laser was used to excite the fluorescent dye fluorescein  isothiocyanate  (FITC) and phycoerythrin (PE) whose  emissions  recorded through 530 +/- 15 and 580 +/- 10 nm bandpass filters respectively.  were 20,000  cells were analyzed per sample and dead cells were eliminated on the basis o f side and forward light scatter. a. C 3 expression F l o w cytometry was used to detect the levels o f C3 protein in T A M s coincubated for 16 hours with untreated L L C cells or with PDT-treated L L C cells.  T A M s were  collected in 500 u L o f cold P B S , centrifuged at 800 rpm and resuspended i n 500 u L Hanks Buffer. The cells were fixed and permeabilized using Cytofix/Cytoperm solution (PharMingen, B D Biosciences, Mississauga, Ontario, Canada).  The cells were then  suspended in 200 j i L o f wash solution and split into two aliquots.  The samples were  centrifuged, the supernatants discarded and each antibody diluted in Perm/Wash buffer provided in the kit added.  Aliquot A received 150 \iL o f FITC-conjugated-goat-anti  mouse-C3 (Cappel, I C N Pharmaceuticals Inc., Aurora, O H , U S A ) and Aliquot B received 150 \xL o f FITC-chromePure goat IgG (Jackson Immune Research Laboratories, West Grove, P A , U S A ) for background staining used as a control. Samples were incubated on ice, away from light, for 30 minutes before being spun down and re-suspended i n 400 uU o f H B S S prior to sorting. b. Percentage of macrophages present after their isolation from tumour or spleen.  39  F l o w cytometry was used to measure the percentage o f macrophages remaining after their isolation by adherence, from tumours or spleens.  Suspended in 500 u L o f  H B S S and following the brief procedure outlined above, cells were stained with a m A b to the macrophage marker F4/80 conjugated to P E (Serotec Inc, Oxford, U K ) prior to sorting.  VII. Experiments: a.  Hepatic versus tumour-localized complement gene expression following photodynamic therapy. To analyze the expression o f complement genes C 3 , C 5 and C 9 in the livers and  tumours o f mice treated with P D T the following experiment was done. The livers and tumours o f 24 mature wild-type C57B1/6J mice in 6 groups o f 4, bearing 8-10 m m L L C tumours growing subcutaneously were harvested from control (untreated) and P D T (Photofrin)-treated mice at 3 hrs, 6 hrs, 8 hrs, 24 hrs and 5 days following treatment. The livers and tumours were homogenized in T R I reagent (Sigma) and total R N A isolated for semi-quantitative R T - P C R analysis o f hepatic and tumour-localized expression o f the key complement component genes C 3 , C5 and C 9 .  b. Tumour-localized complement gene expression in wild type mice versus T L R - 4 K O mice, and C 3 K O mice.  Two groups each o f 3 mature wild-type C57B1/6J, B6.KB2-cln8mnd/msrJ ( T L R - 4 knock-out), and B 6 . 1 2 9 5 4 - C 3  tmlcrT  (C3 knock-out) mice were inoculated subcutaneously  with L L C cells from in vitro culture. A l l tumours were grown to 8-10 m m as the largest diameter and 1 group from each mouse strain was treated by P D T . The other group was left untreated and used as control.  A t 24 hours following light treatment the tumours  were harvested and homogenized in T R I reagent (Sigma) for total R N A isolation. Semi-  40  quantitative R T - P C R was performed in order to determine the expression patterns o f complement components C 3 , C 5 and C 9 i n each mouse type before and after P D T treatment. c. Complement gene expression in T A M s co-incubated with untreated L L C cells and PDT-treated L L C cells.  There were six treatment groups, each plated i n triplicate: a) untreated T A M s , b) untreated L L C cells, c) PDT-treated T A M s , d) PDT-treated L L C cells, e) untreated T A M s with untreated L L C cells i n insert, f) untreated T A M s with PDT-treated L L C cells in inserts. Following 8 hrs incubation in protein and serum-free medium at 37°C, cells were collected in T R I reagent (Sigma) and semi-quantitative R T - P C R was performed on the total R N A to examine the expression o f complement genes C 3 , C 5 and C 9 .  d. The analysis of complement gene expression in W T or T L R - 4 K O splenic macrophages co-incubated with PDT-treated L L C .  To demonstrate that complement activation in response to co-incubation with PDT-treated L L C cells was not unique to T A M s , splenic macrophages harvested from either W T or T L R - 4 K O mice were co-incubated with PDT-treated or untreated L L C cells.  Macrophages from spleens incubated alone or co-incubated with untreated L L C  cells served as controls and then were compared to macrophages co-incubated with P D T treated L L C cells (20 ug/mL Photofrin, 1 J/cm ). A t 8 hrs following PDT-treatment and 2  co-incubation the macrophages  were collected i n TRI-reagent (Sigma) and semi-  quantitative R T - P C R was performed to determine the effect o f exposure to PDT-treated L L C on the expression o f complement genes C 3 , C 5 and C 9 . A n additional group with w i l d type macrophages incubated for 8 hours with lipopolysacharride ( L P S ) derived from E . coli 0111 :B4 (Sigma) at 0.1 p g / m L was also included. 41  e. Analysis of complement gene expression by L L C cells in vitro. Twelve groups o f 1 X 10 L L C cells were plated in triplicate. One group was 6  used as a control and left untreated.  Another control group was co-incubated with  untreated L L C cells. O f the 10 remaining groups, 5 were treated with P D T and collected for R T - P C R analysis at 3 hrs, 6 hrs, 9 hrs, 12 hrs and 16 hrs. The last 5 groups were left untreated but were co-incubated with L L C treated with P D T and collected at 3 hrs, 6 hrs, 9 hrs, 12 hrs and 16 hrs post-treatment.  Semi-quantitative R T - P C R was used to  determine the ability o f PDT-treated L L C cells to poduce complement C 3 , C5 and C 9 .  f. The effect of various inhibitors on the expression of C3, C5 and C9 in T A M coincubated with PDT-treated L L C in vitro.  Ten groups o f W T T A M s were plated in triplicate. A l l T A M s were left untreated but were co-incubated with untreated L L C (control), and PDT-treated cells alone or P D T treated L L C cells with the addition o f the following inhibitors of: H S P 7 0 (polyclonal K 20 blocking antibody) (20 j^g/mL) from Santa Cruz Biotechnology Inc., San Diego, C A , U S A ) , selective N F - k B inhibitor SN50 (Calbiochem 481480) (10 ug/mL), blocking peptide o f T I R A P (co-adaptor molecule necessary for T L R - 4 signalling) (150 ug/mL) (Calbiochem 613570), T L R - 4 blocking antibody M T S 510 (20 ^ g / m L ) (Santa Cruz Biotechnolgy). Controls included the antibody control isotype anti-rat IgG (20 u.g/mL), antibody isotype anti-chicken I g Y (20 p.g/mL) and 10 p i D M S O .  Cells were co-  incubated for 8hrs following P D T treatment (20 ug/mL Photofrin, 1 J/cm ), collected i n 2  T R I reagent (Sigma) and R T - P C R was done on total R N A for analysis o f the expression o f complement genes C 3 , C5 and C 9 in addition to G A P D H (control).  The same  experiment was done using spleen-derived macrophages and the effects o f an antibody to 42  T L R - 2 (clone T 2.5 from H y C u l t Biotechnology bv, Hornby, O N ) on complement gene expression at 8 hours following P D T treatment was tested (Santa Cruz Biotechnology).  g. F A C S analysis to determine whether T A M s co-incubated with PDT treated L L C increase C3 protein production.  One experiment consisting o f two groups o f wild-type T A M s were plated in quadruplicate and co-incubated with either untreated or PDT-treated L L C cells. Twelve hours before the end o f the incubation, GolgiPlug protein transporter (an inhibitor based on brefeldin A ; B D Pharmingen, San Diego, C a , U S A ) was added to each sample at a concentration o f 1 ug/mL in order to prevent protein from being secreted from the cells. After 16 hrs o f incubation, T A M s were collected in 1 m L o f P B S and prepared for F A C S analysis as described previously. paraformaldehyde-fixed  Intracellular staining for C 3 was  done with  and saponin-permeabilized cells by flow cytometry  where  intracellular C3 protein was detected using FITC-conjugated anti-C3 antibody. h. F A C S analysis to determine the purity of macrophage populations (splenic or T A M ) following their isolation and culture.  F l o w cytometry was used to measure the percentage o f macrophages remaining after their isolation from tumours or spleens by sorting cells positive for F4/80. Following the isolation procedure, mentioned previously, cells were scraped from the Petri dish using a rubber policeman and suspended i n 500 u l H B S S .  Samples were  centrifuged for 10 minutes at 1000 rpm and then were stained with the appropriate m A b (PE-conjugated anti-F4/80 antibody + FITC-conjugated antibody to G R - 1 or  the  immunoglobulin isotype control) (PharMingen) by incubating for 30 minutes on ice in the dark before being re-suspended in 400 u l o f H B S S prior to sorting for F4/80 + G R - 1 positive cells. 43  VIII. Statistical Analysis A l l data represented graphically are shown as the mean + standard deviation. A non-paired student's Mest was done to compare the difference between two means. Differences were considered significant when p<0.05.  44  Results Section 1 I. Photofrin-based PDT-induced local increase in the expression of complement genes C 3 , C 5 and C 9 Twenty-four mice bearing subcutaneous L L C tumours were divided into 6 groups. One group was not treated with P D T and was used as a control. The other 5 groups were treated with P D T and the tumours and livers were harvested at 3 hrs, 6 hrs, 8 hrs, 24 hrs and 5-days post-treatment.  Total R N A was isolated and a l l samples were  analyzed for the expression o f complement genes C 3 , C5 and C 9 as well as the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase ( G A P D H ) for comparison using semi-quantitative R T - P C R . The data were derived from gels as shown in Figure 4 which visually demonstrates the intensity o f expression o f the P C R products resulting from the amplification o f G A P D H , C 3 , C 5 and C 9 transcripts by R T - P C R performed on the total R N A isolated from untreated and PDT-treated tumours at 24 hours following therapy.  45  M  G  C3  C5  C9  G crzi  C3  C5  1=1  i=z:  C9 r=i  200bp w  lOObp  _  ^  W  Untreated Tumour  Tumour at 24hrs Post-PDT  Figure 4: Photofrin-based P D T induces a tumour localized up-regulation of complement genes at 24 hours following treatment. L L C tumours growing subcutaneously in C 5 7 B L / 6 J mice were treated with Photofrin-based P D T (Photofrin 10 mg/kg i.v. followed 24 hours later by 150 J/cm ), and excised 24 hours after P D T treatment. Total R N A isolated from this and control tumours was used for R T - P C R based analysis o f the expression o f selected genes. The 10% polyacrylamide gel stained with S Y B R green nucleic acid stain shows the expression o f complement genes before and at 24 hours after treatment by P D T . Depicted above is the expression profile o f one representative profile from each group. G A P D H (G) is the housekeeping gene expressed constitutively in all cells, while C 3 , C 5 and C 9 are key complement genes whose expression is compared to that o f G A P D H and M is the 100 bp ladder.  The results shown in Figure 5 depict the average normalized, (compared to G A P D H ) , expression o f C 3 , C5 and C 9 in untreated tumours, and PDT-treated tumours at 3 hrs, 6 hrs, 8 hrs, 24 hrs and 5-days post-treatment.  The results indicate that expression  of the complement genes C 3 , C 5 and C 9 does not increase in untreated tumours but shows an increasing trend from 3 hrs, 6 hrs to 8 hrs following treatment. However a significant increase was evident o f C 3 , C5 and C 9 expression in tumours at 24 hrs following treatment by P D T with levels o f expression remaining higher than normal at 5days post treatment.  46  The average fold-increase in gene expression for C 3 , C5 and C 9 at 24 hrs posttreatment is shown in Figure 6. C 3 expression increased to as high as 5.7 times greater than in untreated tumours and both C5 and C 9 increased significantly with levels as high as 4.8 and 1.9 times levels seen in untreated tumours respectively.  C3  C5  C9  complement g e n e  Figure 5: Tumour-localized expression of key complement genes C 3 , C5 and C9 after Photofrin-based PDT. Subcutaneous L L C tumours were either untreated or P D T treated as described for Figure 2. The tumours were harvested and homogenized in T R I reagent (Sigma) at 3 hrs, 6 hrs, 8 hrs, 24 hrs and 5 days following treatment. Semiquantitative R T - P C R was done to determine the expression pattern o f complement genes C 3 , C 5 and C9. Data is presented as the mean intensity o f expression normalized against the housekeeping gene G A P D H + standard deviation, *p< 0.05 compared to untreated control.  47  complement gene  Figure 6: Average fold increase of tumour-localized expression of key complement genes C3, C5 and C9 at 24 hours following Photofrin-based photodynamic therapy. The data for 24 hours post P D T from Figure 3 are presented as the average fold increase + standard deviation for C 3 , C 5 and C 9 compared to the untreated control.  II. Photofrin-based PDT does not cause an increase of the expression of hepatocytederived complement genes C3, C5 and C9 The livers from the same mice whose L L C tumours were analyzed were also harvested at 3 hrs, 6 hrs, 8 hrs, 24 hrs, and 5-days following treatment using P D T . Four mice comprised each group and 4 mice were used as controls where no treatment was applied. The results show no significant difference o f hepatic expression o f C 3 , C 5 and C 9 at any time tested following P D T treatment as compared to the untreated control (Figure 7).  48  5  4.5  3.5  s in  C3  C 5  C9  complement gene  Figure 7: Hepatic complement gene expression (C3, C5, C9) at various time points following Photofrin-based P D T C57B1/6J mice bearing subcutaneous L L C tumours were treated by tumour-localized P D T as described for Figure 2. Livers collected from control and PDT-treated mice were homogenized i n T R I reagent (Sigma). Data is represented as expression o f C 3 , C5 and C 9 normalized to G A P D H . Bars represent standard deviation.  III. There is no increase of either hepatic or tumour-localized expression of complement genes following BPD-based PDT. Two groups o f 4 mice were used in this experiment where 1 group acted as a control and the other group was treated with P D T . Livers and tumours were harvested from untreated control mice and from those treated with BPD-based P D T 24 hours posttreatment.  Results shown i n Figure 8 demonstrate that there was no up-regulation o f  complement component genes C 3 , C 5 and C 9 at 24 hours after P D T treatment either in the liver or in the tumour. This is in contrast to the results obtained with Photofrin-PDT where there was a significant up-regulation o f all 3 genes in the tumour at 24 hours following treatment. 49  • Untreated • 24hr(bpd) • 24hr(P)  Tumor  Liver  C3  Liver  Tumor  Liver  Tumor  C5  C9  Gene Figure 8: The expression of complement genes C3, C5 and C9 in tumours and livers after treatment with BPD or Photofrin-based PDT. Subcutaneous L L C tumours were treated with either BPD-based P D T ( B P D 2.5 mg/kg, 100 J/cm ) or Photofrin-based P D T as described for Figure 2. Tumours and livers were excised and homogenized in T R I reagent, total R N A was isolated and semi-quantitative R T - P C R analysis was performed. Results are shown as the normalized intensity o f expression compared to G A P D H . Bars are standard deviation. *p<0.05 compared to untreated control. 2  Section 2 I. Procedures used to isolate macrophages (TAMs and splenic) used in in vitro studies resulted in > 90% of cells identified as macrophages as determined by F A C S Macrophages for use in our in vitro studies were isolated from either tumours or spleens. To confirm that our procedure did indeed result in the isolation o f macrophages and not other cells, a simple F A C S experiment was done.  The F A C S  analysis  demonstrates that 97.6% o f cells isolated are macrophages ( T A M s ) from tumour cell 50  suspension as indicated by positive P E staining with the mature myeloid macrophage cell surface marker F4/80 plus F I T C staining for myeloid cell surface marker G R - l a s shown in Figure 9 A . Figure 9B shows cells isolated by our procedure from spleens resulted in > 90% o f cells identified as macrophages using P E conjugated antibody to F4/80. Figure 9C is a plot o f cell number versus fluorescence intensity.  51  Figure 9: The procedure used for the isolation of macrophages resulted in 97.6% positive PE + F I T C staining for tumour and > 90% PE staining from spleen as determined by F A C S . A ) Cells from a L L C tumour cell suspension were plated in serum-free medium on a 3 m m Petri dish and incubated for 20 minutes at 37°C to allow adherence o f macrophages to the Petri dish. Subsequently, the dish was washed once with cold P B S and the remaining cells were incubated in complete media before being used in the experiment. For flow cytometry analysis, the cells were detached using a rubber policeman and stained for the macrophage marker F4/80 using a P E conjugated antibody and for GR-1 using a F I T C conjugated antibody. Shown is a representative dot plot obtained by flow cytometry. B ) The spleen macrophages were detached using a rubber policeman and stained with PE-conjugated antibody raised against mouse macrophage marker F4/80. Shown is a representative dot plot graph obtained by flow cytometry analysis o f these cells. C ) A representative graph o f cell count versus P E log fluorescence for isotype control (anti-mouse IgG in blue) and for cells positive for F4/80 in green.  II. PDT induces a significant increase of C3 by spleen-derived macrophages at 8 hours following treatment  To identify the optimal time point for complement gene up-regulation in vitro using spleen-derived macrophages, a time course experiment analyzing C3 expression was  52  performed. Macrophages were isolated from the spleens o f C57B1/6J mice and plated in triplicate.  They were then co-incubated with non-treated (8 hrs) or PDT-treated L L C  cells for 3 hours, 5 hours, 8 hours and 16 hours at which times macrophages were harvested, total R N A extracted, and R T - P C R analysis was done. Figure 10 shows a peak time point o f 8 hours where there was a significant up-regulation o f C3 by spleen-derived macrophages co-incubated with PDT-treated L L C cells  in  vitro.  1  1.6 i  (-  1.4  NT  3hr  5hr  16hr  8hr  treatment  Figure 10: PDT induces a significant increase of C3 at 8 hours following light treatment. C 3 expression by spleen-derived macrophages co-incubated with non-PDTtreated L L C cells and with PDT-treated (20 ug/mL Photofrin, 150 J/cm light) L L C cells at 3 hrs, 5 hrs, 8 hrs and 16 hrs after light treatment. R T - P C R was done on total R N A . Data are presented as the C 3 band intensity relative to control (NT). * p<0.05 compared to non-treated group (NT). 2  53  III. PDT induces a significant increase of the expression of key complement genes by macrophages co-incubated with PDT-treated L L C cells. To determine whether tumour-associated macrophages ( T A M s ) are stimulated to upregulate complement gene expression when i n the presence o f PDT-treated tumour cells, the following experiment was performed.  T A M s were isolated from a cell suspension  made from subcutaneous L L C tumours growing on the backs o f C57B1/6J mice, and plated i n triplicate. They were then co-incubated with PDT-treated or untreated L L C cells. A s controls, triplicates o f untreated T A M s and L L C cells were plated alone. In addition, for comparison, triplicates o f T A M s alone and L L C cells alone were treated with P D T . A l l cells were harvested at 8 hrs post-treatment in T R I reagent (Sigma) and R T - P C R was performed on total R N A to analyze the expression o f complement genes C 3 , C 5 and C 9 . A s shown i n Figure 11, L L C cells alone (untreated and treated), T A M s alone (untreated and treated) and T A M s co-incubated with untreated L L C cells displayed almost identical levels o f basal C 3 , C 5 and C 9 expression. Therefore P D T had no effect on complement gene expression in T A M s or L L C cells alone. Results indicate however, that T A M s co-incubated for 8 hrs with PDT-treated L L C show a significantly higher expression o f all three complement component genes.  54  7  I  <> / c CD  •T A M N T  C T3 C  • TAM-PDT •L L C N T T  ro  • LLC-PDT  -a  • TAM/LLC-NT  N  HTAM/LLC-PDT!  E  o c  C o m p l e m e n t gene Figure 11: Tumour associated macrophages increase the expression of complement genes C3, C5 and C9 following incubation with PDT-treated L L C cells. Complement gene expression was compared in 6 groups o f triplicates. T A M s alone, L L C alone and T A M s coincubated with L L C cells were either treated with 20ug/mL Photofrin and U / c m o f light (PDT), or left untreated (NT). After 8hrs o f incubation cells were collected in l m L o f T R I reagent (Sigma), and semi-quantitative R T P C R was performed on total R N A . Data are presented as complement gene expression intensity normalized to the control gene, G A P D H , + standard deviation. * p< 0.05 compared to non-treated T A M s alone. 2  IV. PDT induced up-regulation of complement gene C3 results in an increase in C3 protein expression in T A M s co-incubated with PDT-treated L L C . Results shown in Figure 11 indicate that T A M s co-incubated with PDT-treated L L C cells are stimulated to significantly increase the expression of key complement genes C 3 , C5 and C 9 . W e determined whether this increase o f gene expression translated into an increase o f protein production levels. T w o groups o f T A M s were plated in triplicate.  55  One group was co-incubated for 16 hrs with PDT-treated L L C cells and the other group with untreated L L C cells. After the first 6 hours o f incubation, GolgiPlug (PharMingen) was added to prevent protein from exiting the cells. A t 16 hrs post-treatment the T A M s were collected and stained intracellularly with either FITC-conjugated antibody to C3 or to IgG (control) in preparation for flow cytometry. The results demonstrate an increase of fluorescence intensity for the T A M s incubated with treated L L C cells compared to the control, indicating a significant increase o f C 3 protein expression i n T A M s co-incubated with PDT-treated LLffiells (Figure  12). Therefore the increase o f C3 gene expression i n  T A M s co-incubated with PDT-treated L L C cells is associated with an increase o f C 3 protein levels.  56  A  B  1.8  i n u n i i mm  i irrin  100  C3 FLUORESCENCE  Figure 12: C3 protein levels increase in T A M s co-incubated with PDT-treated L L C cells relative to the control. T A M s derived from L L C tumours were plated in quadruplicate and one group co-incubated with untreated L L C cells and the other with PDT-treated L L C cells (Photofrin 20 ug/mL and 1 J/cm ). T A M s were collected after 16 hrs and stained with a control antibody or with an antibody to C 3 . Samples were analyzed by flow cytometry. A ) C 3 fluorescence relative to the control is shown indicating a 1.6 fold increase o f protein expression intensity (*p<0.05 compared to untreated control). Bar is standard deviation. B) C3 fluorescence in untreated samples (dotted line) versus treated samples (solid line). 2  Section 3 I. The expression of C 3 , C5 or C9 does not increase over time in PDT-treated L L C cells alone or in untreated L L C cells co-incubated with PDT-treated L L C cells. After results indicated that L L C cells in vitro were capable of producing C 3 , C5 and C 9 it was necessary to determine the extent o f that production in order to better understand the localized up-regulation o f complement genes in PDT-treated tumours in vivo. 12 groups o f L L C cells were plated in triplicate and treated with 20 p.g/mL Photofrin and U / c m o f light except for 2 control groups left untreated. Another 6 groups 2  of triplicate L L C cells plates were left untreated and co-incubated with control L L C cells and with PDT-treated L L C cells.  A t 3 hrs, 6 hrs, 9 hrs, 12 hrs and 16 hrs following  57  treatment the cells were collected in TRl-reagent (Sigma), and R T - P C R was performed on total R N A to determine the expression pattern o f C 3 , C 5 and C 9 . Figure 13a, Figure 13b and Figure 13c demonstrate that in both the L L C cells alone treated with P D T and untreated  L L C co-incubated with treated L L C there is no significant increase o f  complement gene C 3 , C 5 or C 9 expression.  Therefore P D T has no effect on the  expression o f complement genes C 3 , C5 and C 9 in L L C cells in vitro.  •LLC -LLC/LLC  untreated  :-3hrs  :-6hrs  >-9hrs  12hrs  16hrs  treatment time  58  c 0.35  o  untreated  >-3hrs  -6hrs  >-9hrs  12hrs  16hrs  Time after PDT treatment Figure 13a-c: Complement gene expression does not increase in L L C cells treated by PDT or in those co-incubated with PDT-treated L L C . 18 groups of L L C cells were plated in triplicate. 8 groups were left untreated and 10 were treated with 20 ug/mL Photofrin and 1 J/cm of light. 5 groups o f untreated L L C were co-incubated with 5 groups of treated L L C , 5 groups o f PDT-treated L L C were left alone, 1 group o f untreated L L C was left alone and the other one was co-incubated with untreated L L C . Cells were collected at 3 hrs, 6 hrs, 9 hrs, 12 hrs and 16 hrs post-PDT treatment. Data are represented as mean (normalized to G A P D H ) intensity o f C 3 , C5 or C 9 expression + standard deviation. *p<0.05 compared to PDT-treated L L C cells alone 2  59  Section 4 I. There is a significant increase of the local expression of complement gene C3 in tumours 24 hrs post-PDT treatment in both wild-type and TLR-4 knock out mice but not in C3 knock out mice. To further investigate the mechanisms underlying local production o f complement components in tumours following P D T wild-type C57B1/6J ( W T ) and knock out ( K O ) mutant mice o f the same genetic background were used (4 mice per treatment group). C 3 K O mice were used i n order to confirm that C3 upregulation in W T mice is due to host cells and that P D T does not upregulate C3 i n these K O s . T L R - 4 K O mice were used in order to investigate one o f the possible pathways  through which  PDT-induced  complement gene expression occurs and whether this pathway is implicated in the regulation o f any or all o f C 3 , C5 and C 9 . This K O was used because T L R - 4 is known to be implicated i n the control o f a number o f genes involved i n the host response through NF-KB  signalling. A l l mice were bearing L L C tumours on their backs and 1 group o f  each genotype were treated with 10 mg/kg Photofrin and 150 J / c m o f light and the other 2  group was left untreated and used as a control. Tumours were extracted at 24 hours following P D T light treatment, immediately homogenized and total R N A was isolated for R T - P C R analysis o f the expression o f C 3 , C5 and C 9 . Figure 14 shows the normalized expression (relative to G A P D H ) o f C3 i n W T , C 3 K O , and T L R - 4 K O mice. Results indicate that i n W T mice there is a significant increase although to a lesser degree o f the local expression o f C3 which is i n accordance with the data shown in Figure 5. They further show evidence for the expression o f C3 in the C3 K O mice i n both the P D T treated tumours and the untreated tumours. There was no significant difference in C3 expression in these two groups.  Since the C3 gene is knocked out i n these hosts, the  detected C3 expression obviously originated from the L L C cells.  Finally, the results 60  indicate a significant increase o f the tumour localized expression o f C3 in PDT-treated compared to untreated T L R - 4 K O mice.  I untreated I treated  wild type  C3K0  TLR-4 KO  treatment  Figure 14: Complement gene C 3 expression of P D T treated versus untreated tumours growing in wild type, C 3 K O and T L R - 4 K O mice. T w o groups each o f wild-type, C3 knock-out and T L R - 4 knock-out mice bore L L C tumours on their backs. One group o f each was treated with 10 mg/kg Photofrin and 150 J/cm o f light and the other was left untreated. Semi-quantitative R T - P C R was done on the total R N A isolated from the tumours excised at 24 hours post P D T . The data are represented as the mean C3 expression normalized to G A P D H + standard deviation. * p<0.05 complared to untreated control. 2  Figure 15 shows the normalized expression (relative to G A P D H ) o f C5 in untreated and PDT-treated L L C tumours growing in wild-type, C3 K O , and T L R - 4 K O mice. Results indicate that in W T mice there is a marked increase o f the local expression of C5 which is in accordance with the data shown in Figure 5. They further indicate that there was an increase o f localized expression o f C5 in C3 knock-out mice while no increase o f the expression o f C5 was detected in the T L R - 4 knock-out mice.  61  I untreated I treated  wild type  C3  KO  TLR-4 KO  treatment  Figure 15: Complement gene C5 expression of P D T treated versus untreated tumours growing in wild type, C3 K O and T L R - 4 K O mice. The expression o f C5 was determined employing semi-quantitative R T - P C R on the total R N A from the same tumours as used for the C3 expression analysis described for Figure 14. The data are represented as the mean C5 expression normalized to G A P D H + standard deviation. * p<0.05  Following the same procedure as listed previously for analysis o f C3 and C5 expression, the expression of C 9 was also analyzed. The data represented in Figure 16 demonstrated  a local increase o f the expression of C 9 in PDT-treated compared to  untreated L L C tumours growing in W T mice which is in accordance with the data shown in Figure 5. However, there was no increase o f tumour-localized expression o f C 9 in C3 K O or T L R - 4 K O mice.  62  0.16  0.14  • untreated • treated  wild type  C3 KO  TLR-4 KO  treatment  Figure 16: Complement gene C9 expression of PDT treated versus untreated tumours growing in wild type, C3 K O and T L R - 4 K O mice. A s in the procedure described in Figures 14 and 15 the results obtained by semi-quantitative R T - P C R for C 9 are presented as the mean normalized expression + standard deviation. *p<0.05 compared to untreated control.  Section 5 I. PDT induces a larger increase of complement gene expression by W T spleenderived macrophages co-incubated with PDT-treated L L C cells than by T L R - 4 K O cells Macrophages isolated from the spleens o f W T or T L R - 4 K O mice were plated in triplicate and co-incubated with untreated L L C cells (control) or with PDT-treated L L C cells for 8 hours to determine the expression o f complement component genes C 3 , C5 and C 9 in response to signals expressed by PDT-treated tumour cells.  Following co-  incubation, the macrophages were collected in T R I reagent and semi-quantitative R T P C R was done on the total R N A .  Figure 17 shows the expression o f C 3 , C5 and C 9 by  spleen-derived macrophages ( W T (A) and T L R - 4 K O (B)) co-incubated with untreated and PDT-treated L L C cells.  There was an increase o f the expression o f these key 63  complement genes by wild-type spleen macrophages exposed to PDT-treated L L C cells after 8 hrs co-incubation confirming previous results. It is also evident that there was an increase of the expression of these genes byTLR -4 K O macrophages co-incubated with PDT-treated L L C cells.  However, this increase was not as pronounced as that by W T  macrophages. For example, C 3 increased by almost 40% in W T macrophages  after  exposure to PDT-treated L L C cells but only by 20% in T L R - 4 K O macrophages.  64  Figure 17: Expression of C3, C5 and C9 genes by W T and T L R - 4 K O spleen macrophages co-incubated with PDT-treated L L C cells. The spleen-derived macrophages were co-incubated with untreated L L C cells or with PDT-treated L L C cells. Samples were collected at 8 hrs post treatment in T R I reagent and R T - P C R was done on the total R N A . The above expression levels are for C 3 , C5 and C 9 by both W T (A) and T L R - 4 K O (B) macrophages alone, or co-incubated with either untreated L L C cells or PDT-treated L L C cells and the data are presented compared to the control (untreated macrophages alone). * p<0.05 when compared to non-treated macrophages alone.  Section 6 I. The marked PDT-induced increase of complement gene expression by W T T A M s co-incubated with PDT treated L L C cells is attenuated by the addition of inhibitors of HSP70, TIRAP, NF-kB and T L R - 4 . Our previous results have demonstrated that P D T induces a significant increase o f the expression o f complement genes C 3 , C5 and C 9 in vivo and in vitro by macrophages co-incubated with PDT-treated L L C cells. To investigate the cellular signalling pathways involved in the local up-regulation of these genes following treatment by P D T , T A M s were co-incubated with PDT-treated L L C cells with or without the addition of various  65  inhibitors or blocking antibodies. Some o f the proteins involved in T L R signalling were targeted due to the possible PDT-induced up-regulation o f complement genes through NF-KB.  If an inhibitor/blocker o f one o f these proteins stops the PDT-induced increase  o f complement expression then it is likely that this protein is, at least partially, involved in the signalling for this increase. Inhibitors o f the transcription factor N F - k B , the T o l l receptor  adaptor protein T I R A P ,  antibodies blocking H S P 7 0 or T L R - 4 , or their  associated controls ( D M S O used as a solvent for the T I R A P blocking peptide, and antibody isotype controls anti-chicken I g Y and anti-rat IgG) were added to the Petri dishes containing T A M and PDT-treated L L C cells i n the inserts. The results i n Figure 18 show, as expected, a large increase o f the expression o f C 3 , C5 and C 9 in T A M s coincubated with P D T treated L L C cells alone. A n increase o f expression was also seen in the control samples containing D M S O or the isotype antibody controls. This increase o f gene expression was attenuated by the use o f the tested inhibitors/blockers. A n t i - H S P 7 0 and the N F - k B inhibitor diminished the increase o f the induced C3 and C5 expression and completely blocked the up-regulation o f C 9 . The T I R A P blocking peptide and antiT L R - 4 also inhibited the induced up-regulation o f C3 and prevented any significant induction o f C5 and C 9 up-regulation.  66  3.5  TAM  TAM + NfT  TAM+  LLC  PDT LLC  anti-NF-kB  anti  IgY  HSP70  chicken  anti TIRAP  DMSO  anti TLR-4  IgG rat  treatment  Figure 18: C3, C5 and C9 expression by T A M co-incubated with PDT treated L L C cells in the presence or absence of various inhibitors/blockers. Ten groups of wildtype T A M s were plated in triplicate. One group was incubated alone and another with untreated L L C cells to serve as controls. The remaining groups were co-incubated with PDT-treated L L C cells with the addition o f inhibitors/blockers to N F - k B , HSP70, T L R - 4 and T I R A P , or appropriate control agents ( D M S O ( T I R A P ) , chicken IgY (HSP70) or rat IgG (TLR-4)). Macrophages were collected in T R I reagent after 8 hrs and semiquantitative R T - P C R was done on total R N A . The results are presented as the normalized intensity o f expression relative to the control ( T A M s alone). *p<0.05 for P D T induced effect relative to T A M alone. p<0.05 for inhibitor/blocker induced effect compared to its isotype control. A  II. The addition of an antibody to T L R - 2 reduces the PDT induced increase of C3 by spleen-derived macrophages  Finally, the effect o f an antibody to T L R - 2 on PDT-induced complement gene expression was tested. Spleen-derived macrophages were co-incubated with non-treated and PDT-treated L L C cells for 8 hours. C3 expression increased significantly by 8 hours  67  in the absence o f antibody and with the addition o f antibody isotype control (mouse IgG). The addition o f the antibody to T L R - 2 prevented this significant increase o f C3 showing expression levels not significantly different from the non-treated sample (Figure 19).  1C3  TLR-2  treatment  Figure 19: The addition of an antibody to TLR-2 decreases the PDT-induced increase of C3 by spleen-derived macrophages. Macrophages were isolated from spleen cells, plated in triplicate and co-incubated for 8 hours with non-treated or P D T treated L L C cells with and without the addition o f antibody isotype control to mouse IgG or to T L R - 2 . Total R N A was extracted and semi-quantitative R T - P C R analysis was done to determine the expression o f C3. The data are represented as band intensity relative to control. *p<0.05 compared to control (NT). p<0.05 compared to isotype control. A  68  Discussion The destruction o f solid tumours caused by the biological and chemical reactions of P D T induces a rapid and powerful host response which includes activation o f the acute phase response, leading to inflammation with the activation o f circulating leukocytes, lymphocytes, and the amplification o f the innate immune response resulting, optimally in adaptive immunity and long term tumour control (69, 71, 80). O f significant importance and with various roles in the immune response, is the complement cascade. Proteins o f the complement system have been shown to increase i n concentration following P D T in both the blood and the tumour (126). A rise i n C3 protein levels occurs following P D T (71, 126). A l s o , assembly o f the terminal M A C was detected both in vivo and in vitro on the surfaces o f P D T treated cells (41, 127).  Results obtained from the depletion o f  complement using cobra venom factor cause a reduction o f tumour cure rates.  The  opposite effect is seen with activators o f complement (133). The role o f complement in P D T has not been completely elucidated.  However, it is obvious that it plays a  significant and positive role when stimulated following treatment. Its potential effects in P D T include the marking o f apoptotic cells and cell debris for phagocytosis by infiltrating neutrophils and macrophages, the recruitment o f these immune cells by chemotaxis and by the stimulation o f cytokine release, the direct lysis o f target tumour cells and the activation o f T-cells through enhanced antigen presentation by antigen presenting cells ( A P C s ) (71, 96, 126).  Because o f its wide range o f action, complement  is o f great importance to the host response which is activated i n P D T .  69  I. Hepatic versus tumour localized complement expression after P D T Complement is synthesized primarily i n the liver, but it can be made by other cells in a local environment (93, 122). The results from our experiments demonstrate that there is a high level o f constitutive expression but no increase o f the expression o f key complement component genes C 3 , C 5 and C 9 in the livers o f tumour-bearing mice following treatment by P D T . However, there is localized expression of C 3 , C 5 and C 9 in the untreated tumour and following Photofrin-based P D T treatment there is a significant increase o f the expression o f all three complement genes tested 24 hours post-treatment with levels remaining high at 5 days post treatment. Expression levels increased by more than 3-fold for both C3 and C5 at 24 hrs post-treatment and 2-fold for C 9 . Furthermore, when the level o f expression was compared to that in the liver at the same time point, tumour-localized expression reached almost double that o f hepatic expression at 24 hrs post-treatment. Complement gene expression possibly becomes increased in the tumour at 24 hours following light treatment because o f the time it takes for circulating neutrophils and monocytes to be recruited from the blood and tissue storage pools to the tumour.  It has been shown previously in our lab (78, 79) that neutrophil levels i n the  blood and in the tumour increase as early as 1 hour following P D T and infiltrate the tumour i n high numbers until 24 hours following treatment. Because most cells in the tumour are destroyed immediately by direct P D T inflicted injury, there are no local cells able to produce complement until they have been recruited from other areas. In contrast, P D T using B P D did not result i n any increase o f complement gene expression locally i n the tumour or by hepatocytes i n the liver.  This finding may be  explained by the location o f action o f these photosensitizers which have different properties. The effectiveness o f B P D depends on its high concentration in the circulation  70  and therefore it exerts its damage on the tumour vasculature.  Photofrin, however,  localizes more to the tumour parenchyma and exerts its effects there in addition to the vasculature (133). It could be that there is a greater stimulation o f local complement gene expression when damage is inflicted to the tumour parenchyma rather than to the vasculature. It is apparent from these results that there is significant stimulation o f complement gene expression locally at the PDT-treated tumour when Photofrin is used as the photosensitizer. This local response may be o f critical importance to the host response to P D T and may contribute more to the effectiveness complement.  o f P D T than does systemic  Because o f the drastic increase in the levels o f complement gene  expression locally at the tumour, some protein product maybe be entering the circulation and contributing to the rise o f humoral C3 content that has been documented (126, 127). The liver is comprised o f three distinct cell types: hepatocytes which are generally involved i n metabolism; Kupffer cells which play a role in immunomodulation by synthesizing immunostimulatory and inhibitory factors; and endothelial cells which generally contribute to pro-inflammatory signals by producing IL-1 and IL-6 (134). Hepatocytes have receptors for a variety o f secreted factors including T N F , IL-1, and I L 6, that when bound, can increase the expression o f complement proteins and acute phase reactants (134, 135). These cells however, are strongly regulated by cross-talk signals from Kupffer cells that can limit the systemic response (134). For example, in response to sepsis, a condition o f excess bacteria in the blood, the liver is stimulated to produce a large amount o f T N F and to up-regulate IL-1 and IL-6 gene expression. This increases the production o f acute phase reactants, including some complement proteins. However, Kupffer cells can downregulate this response and are involved in the uptake and  71  clearance o f these factors (134). This highly modulated response indicates that there is a control mechanism to prevent an excessive host response which can potentially have negative consequences to the system. Evidence for an increase o f C3 gene expression has been documented i n both hepatocytes and macrophages in response to L P S or IL-1 indicating that regulation is pre-translational (135, 136). This same effect was not seen for other complement factors tested; C 2 and factor B (136), indicating that differential regulation o f these proteins occurs and that the responses seen may be specific not only to the individual protein but also to the activating source. W e have no evidence to indicate that the liver is contributing (at the level o f transcriptional up-regulation) to an increase o f circulating complement proteins or to complement active at the tumour site which increases following P D T (126). It could be that signals released in response to localized PDT-induced damage do not elicit pretranslational control o f complement in the liver. Translational control could be exerted there by increasing protein synthesis and release without an increase o f m R N A synthesis. It is possible that regulatory mechanisms increase the speed o f complement m R N A degradation in order to prevent the negative consequences o f over activation. In addition, it may be that hepatocytes contain intracellular storage pools for complement proteins which can be quickly released for an immediate systemic response.  It has been  documented that neutrophils contain these storage pools for complement receptor proteins to aid in augmenting phagocytic efficiency when they are stimulated by activating structures (137).  B y the same logic it might be that hepatocytes also have  cytoplasmic or membrane-bound complement storage pools. These could all be reasons for why we did not see any up-regulation o f complement genes in the liver following P D T , where it would have been expected due to the nature o f the signals released at the  72  damaged tumour and the documented increases o f C3 levels i n the blood (71, 126). Further studies using hepatic cells in vitro co-incubated with PDT-treated tumour cells might help to clarify what we have documented. II. Macrophages are the source of PDT-induced increase by local complement expression Tumour-localized up-regulation o f C 3 , C 5 and C 9 did occur to a significant degree by 24 hours following treatment by P D T . We wanted to determine which cells in the tumour were responsible for this up-regulation o f complement genes after P D T . A n experiment using W T and C 3 K O mice was done in vivo where the data obtained show that compared to wild-type mice, which showed a significant increase o f tumourlocalized C 3 , C5 and C 9 gene expression at 24 hrs post-treatment, C3 K O mice, as expected showed no increase o f C3 expression and only a slight increase o f both C5 and C 9 revealing that a host-cell type responds to P D T by up-regulating complement. W e see small levels o f complement gene expression in C3 K O mice compared to W T mice. There was a significant increase o f C5 gene expression but no significant up-regulation o f C 9 m R N A in C3 K O tumours. Although the increase in C5 expression was significant, it was slight and it is likely that these genes are not activated to the same extent following P D T i n C3 K O mice because their products can not be cleaved and activated without activated C3 products. Therefore it is possible that the activation o f these key terminal complement genes is positively regulated in part by C 3 .  To further determine which  cells were responsible for this increased expression in the PDT-treated tumours and to identify an optimum time point in vitro at which an increase o f C 3 occurs, a time course experiment was done using spleen-derived macrophages co-incubated with L L C cells. This experiment revealed that a significant increase o f C3 expression by spleen-derived macrophages occurs after 8 hours o f co-incubation with PDT-treated L L C cells. Further 73  in vitro experiments using tumour-associated macrophages ( T A M s ) and L L C cells were done using a time point o f 8 hours. These in vitro studies revealed that untreated T A M s exposed to P D T treated L L C cells significantly up-regulate the expression o f C 3 , C5 and C 9 at 8 hours post-treatment and that this correlates to an increase o f local C 3 protein levels at 16 hours post-treatment.  This same effect was not seen i n T A M s co-incubated  with non-treated L L C cells thereby indicating that the PDT-treated tumour contains or releases signals that stimulate complement gene expression i n macrophages (66, 71, 96). This indicates an important role for T A M s , either remaining resident T A M s not killed by P D T (less likely) or newly infiltrating T A M s (24 hours post-treatment), in the local production o f complement proteins in the PDT-treated tumour. Neutrophils have been shown to infiltrate the tumour early following light treatment with increasing numbers toward 10 hours and macrophages ( T A M s ) follow usually within 6 hours (78, 79). If we assume that macrophages are significantly infiltrating the tumour at about 16 hours following P D T treatment and we have shown that complement expression significantly increases at 24 hours post-treatment in vivo, then it followsthat these T A M s in vitro produce complement after 8 hours o f exposure to PDT-induced danger signals.  This  local production by macrophages infiltrating the tumour, as demonstrated by the significant increase in vivo at 24 hrs post P D T treatment, and in vitro after 8 hours coincubation with  PDT-treated L L C cells, may be  o f critical  importance to  the  inflammatory process leading to tumour immunity and effective therapy. This increase of gene expression by T A M s in vitro was most prominent for C 3 where levels rose to more than double the basal level seen in the controls. Demonstrating that this ability o f tumour associated macrophages to respond to PDT-treated tumour cells by increasing the expression o f complement genes C 3 , C5 and  74  C 9 was not unique to T A M s , a similar experiment was performed using wild-type macrophages isolated from spleens.  This experiment showed that wild-type splenic  macrophages also respond to signals released from PDT-treated L L C cells by upregulating the expression o f complement genes C 3 , C5 and C 9 . This further supports our notion that it is the exposure o f newly recruited macrophages to PDT-induced signals that up-regulates complement transcription. Notably, in vitro experiments also demonstrated the ability o f L L C cells to synthesize all o f these complement components.  When examined further it was  determined that the extent o f complement transcription by L L C cells is minimal and does not increase following P D T . L L C cells themselves do not respond to signals released from PDT-damaged cells, possibly because they do not possess the necessary receptors for the PDT-induced danger signals (66, 71, 96). This is in accordance with other reports noting that malignant cells, more specifically epithelial cells i n the lung, are capable o f synthesizing complement proteins (138). III. T L R signalling pathway is involved in macrophage upregulation of local complement after P D T The experiments presented in this thesis thus far have shown that there is a tumour-localized increase o f the expression o f key complement genes C 3 , C 5 and C 9 following P D T . It was demonstrated that macrophages respond to signals from P D T treated cells and are responsible for the increase o f expression o f complement genes. The questions that arise are what signals are they responding to and by which pathway are they signalled to up-regulate complement genes? Macrophages express a large number o f different cell-surface receptors including complement receptors and T L R s , both P R R s , which are capable o f innate immune recognition o f conserved bacterial sequences and more importantly i n P D T , endogenous 75  host danger signals (66, 71, 127).  Signals that may lead to the activation o f the host  response to P D T include H S P s (HSP70, H S P 6 0 and GRP78), complement-opsonised materials, membrane lipid fragments caused by the activation o f phospholipases, and products o f membrane degradation (fibronectin, laminin, and collagen) (71). H S P 7 0 is released from PDT-damaged cells and is up-regulated i n cells under stress (66, 71, 139, 140). H S P 7 0 normally resides inside the cell where it acts as a protein chaperone. When cells undergo necrosis or are under severe stress such as that resulting from PDT-induced trauma, H S P 7 0 may escape, or be released from the cell (66, 141).  H S P 7 0 existing  outside the cell is a potent danger signal which can be recognized by immune receptors like T L R - 4 and T L R - 2 on the surfaces o f macrophages (140, 141). T L R - 4 is an innate immune recognition receptor largely responsible, in coordination with other receptors like C D 14, for intracellular signalling resulting in the up-regulation o f inflammatory genes (142-144). H S P 7 0 / T L R - 4 binding has been implicated in the signalling through the inflammatory transcription factor N F - K B  which is responsible for activating a  plethora o f immune genes including IFN-y, T N F - a , and interleukins (141, 145) (Figure 19). In fact, recent work in our laboratory has shown that upon co-incubation with P D T treated tumour cells, macrophages elevate their production o f T N F - a as a consequence o f the  TLR-NF-KB  signalling triggered by the released H S P 7 0 (66). The T L R signalling  pathways could therefore play an important role i n the outcome o f P D T (71, 144). Could this pathway be responsible for locally up-regulating complement genes C 3 , C5 and C 9 in macrophages following P D T treatment? To determine whether T L R - 4 might be involved in the signalling leading to the up-regulation o f C 3 , C 5 and C 9 in vivo, an experiment was done involving W T mice, and T L R - 4 K O mice. In T L R - 4 K O mice, there was a significant increase o f C3 expression,  76  a slight increase o f C 9 expression but interestingly there was no increase o f C 5 expression. These results indicate that T L R - 4 may have a role in the stimulation o f some local complement synthesis, namely, C 5 , however from this data it may not be essential to the signalling leading to the expression o f C 3 . To further investigate the response seen in vivo it was necessary to perform an in vitro study o f a similar nature. Results obtained from splenic macrophages isolated from T L R - 4 K O mice co-incubated with PDT-treated L L C cells indicate a very similar pattern to what was seen in vivo, further supporting our claim that T L R - 4 plays a role i n the outcome o f P D T and illustrating its involvement i n complement gene regulation. From these data it appears as though C5 up-regulation is more dependent on T L R - 4 signalling than are C3 and C 9 . Not much is known about the transcriptional control o f complement genes and whether they have N F - K B binding sites or N F - K B controlled genes and therefore it is difficult to draw conclusions that can be related to the literature. These questions are currently being addressed (146). Finally, to determine whether or not H S P 7 0 signalling via T L R - 4 and N F - K B is responsible for the increase o f complement production by macrophages following P D T , an in vitro experiment was done involving W T T A M s co-incubated with P D T treated L L C cells in the presence or absence o f inhibitors/blockers o f H S P 7 0 , N F - K B , T I R A P and T L R - 4 .  Results from this experiment demonstrate a significant increase o f the  expression o f complement genes C 3 , C5 and a marked rise o f C 9 in wild-type T A M s following 8 hours o f co-incubation with PDT-treated L L C cells. This increase o f gene expression was significantly reduced by inhibitors/blockers of, N F - K B and HSP-70, and T I R A P but not by anti-TLR-4 which significantly inhibited only C 5 expression.  These  results are similar to those obtained in vivo and to those obtained using K O macrophages in vitro where PDT-induced C3 expression significantly increased i n T L R - 4 K O  77  macrophages/mice  i n contrast  to C 5 which did not  increase  as it did in W T  mice/macrophages/TAM. These results indicate that indeed the increase o f tumourlocalized complement gene expression (C3, C5 and C9) in macrophages is a product o f the T L R - 4 / N F - K B pathway.  It occurs possibly, at least i n part, through the binding o f  T L R - 4 on the surface o f tumour associated macrophages to exogenous H S P 7 0 released from PDT-damaged cells. This signalling activates the transcription factor N F - K B which localizes to the nucleus where it activates the transcription o f key complement genes C 3 , C 5 and C 9 .  The fact that C 3 and i n some cases C 5 and C 9 up-regulation was not  completely blocked by these inhibitors/blockers could be explained either by the incomplete action o f these interfering agents, or by the existence contributory signalling independent o f the T L R - 4 - N F - K B pathway.  o f additional  Despite the lack o f  significant complement gene up-regulation i n the presence o f these inhibitors/blockers, there was still a lower level o f gene expression comparable to that seen in untreated tumours.  Some o f this may be due to incomplete blockage by each o f the  inhibitors/blockers thereby allowing a small amount o f transcription to occur. It could also be the product o f the action o f another transcription factor (not N F - K B ) or perhaps due to alternative signalling receptors.  Possible receptors contributing to the regulation  o f complement gene expression include other T L R s , complement receptors, i n addition to other immune receptors  on the surfaces  signalling like I L , I F N and T N F receptors.  o f macrophages  capable o f intracellular  To examine the role o f T L R - 2 in the P D T  induced up-regulation o f complement one final experiment was done using spleenderived macrophages co-incubated with PDT-treated L L C cells. The results obtained for C3 using R T - P C R demonstrate that the PDT-induced increase o f C3 by macrophages is  78  prevented b>the addition o f an antibody to T L R -2, indicating a shared role with T L R - 4 in the activation o f complement synthesis in macrophages following P D T . IV. Summary The results presented in this thesis help to explain the role o f macrophages in the host response to PDT-inflicted injury on solid tumours.  It has been documented that  complement proteins are a necessary factor i n innate immunity and inflammation which in turn has a role in the proper activation o f T-cells and B-cells thus bridging innate immunity to adaptive immunity (105-121).  In P D T , for effective cures and good  therapeutic outcome it is necessary that the host response be intact and that neutrophils are sequestered to the tumour along with other immune cells like macrophages and lymphocytes. The sequestration o f neutrophils to the tumour is complement dependent and when complement is depleted, the therapeutic benefit o f P D T decreases and lower tumour cure rates are achieved (80, 96). This could be due to the lack o f complement directly or it could be due to the lack o f complement mediated effects. For this reason it is important to reveal the origin o f complement that is produced following P D T so that it might be harnessed during therapy to improve tumour cures and to better understand the mechanism by which P D T destroys the solid tumour (147). The results presented in this paper unveil the origin o f complement following P D T , revealing that a significant local production o f C 3 , C5 and C 9 in the tumour does occur. W e further demonstrated that this production occurs in macrophages and is at least i n part mediated by N F - K B activation occurring through T L R - 4 / T L R - 2 signalling engaged by the binding o f H S P 7 0 released from PDT-damaged cells. Figure 19 shows a summary diagram o f the results presented in this thesis.  79  PDT  Oxidative damage  Massive release of danger signals  TUMOUR C U R E  Complement mediated effects  7\  | Expression of C3, C5, C9  Infiltrating macrophage  cytokines Tumour  Figure 20: Summary of the pathway by which complement genes C3, C5 and C9 are locally up-regulated in the tumour following treatment by P D T .  Conclusions The application o f P D T to solid tumours inflicts large physical and chemical damage at the tumour site. The body responds to this injury by mounting a host response to contain and repair the damaged tissue. In this process, tumour cells are recognized and destroyed by various components o f the innate and adaptive immune systems resulting in long term tumour control. Without an intact and powerful host response the benefit o f therapy becomes greatly reduced. The results presented in this thesis demonstrate that there is a tumour-localized up-regulation o f the key complement genes C 3 , C5 and C 9 by TAMs.  They implicate the role o f H S P 7 0 released by P D T damaged cells through its  interaction with T L R - 4 receptors on the surfaces o f macrophages which can signal intracellularly via  NF-KB  to increase complement gene expression. The results o f this  study further clarify the involvement o f the complement cascade in the host response to PDT-inflicted injury.  This represents another stepping stone in the path leading to the  understanding o f the PDT-elicited responses that are essential to its success as a cancer therapy.  Future Directions Future  studies  stemming  from  this  research  could  include  the  further  characterization o f the pathways involved i n the up-regulation o f complement genes following P D T so that these processes may be harnessed for increasing the efficacy of therapy.  In addition, the characterization o f other immune components, such as those  involved in the acute phase response (pentraxins) activated following P D T would benefit the overall understanding o f the multitude o f processes that ensue following the P D T inflicted injury to the tumour.  Furthermore it would benefit our understanding o f the  complement system in general i f more o f its components were studied, both at the level o f gene expression and at the level o f protein expression both locally and in the liver. For example, it would be pertinent to study the expression levels o f complement receptors and inhibitors i n the liver and in the tumour before and after P D T treatment. In addition the expression profiles for T L R s should be studied to better understand the whole process leading to complement up-regulation i n tumours following P D T treatment.  81  References 1) A c k r o y d R., Kelty C , B r o w n N . , and Reed M . , The history o f photodynamic therapy, Photochemistry and Photobiology, V o l . 74 (5): 656-669 (2001) 2) Dennis E.J.G.J. Dolmans, D a i Fukumura and Rakesh K . Jain, Photodynamic therapy for cancer, Nature Reviews Cancer, V o l . 3 (2003) 3) Jesionek A , von Tappenier H . Zur behandlung der Hautkarcinome mit fluorescierenden stiffen. Munchen M e d Wochenscher, 47, 2042-2051 (1903) 4) Haussman W , Die sensibiliserende Wirkung des Hematoporphyrins, Biochem Z 30, 276-316(1911) 5) Schwartz S.K., A b o l o n K , Vermund H , Some relationships o f porphyrins, X-rays and tumours, Univ. M i n n . M e d . B u l l . V o l . 27, 7-8 (1955) 6) Lipson R. L . and E . J. Baldes, The Photodynamic properties o f a particular hematoporphyrin derivative. A r c h . Dermatol., V o l . 82, 508-516 (1960) 7) Diamond M . , Photodynamic Therapy o f malignant tumours, Lancet, V o l . 2, 11751177,(1972) 8) Dougherty T.J., Grindey G . B . , Fiel R., Weishaupt K . R . and Boyle D . G . , Photoradiation Therapy II; Cure o f animal tumours with hematoporphyrin and light. J. Natl. Cancer Inst., V o l . 55, 115-121, (1975) 9) Dougherty T.J., Photoradiation therapy for the treatment o f malignant tumours. Cancer Res., V o l . 36, 2628-2635, (1978) 10) Dougherty T.J., Gomer C.J., Henderson B . W . , JoriG. , Kessel D . , Korbelik M . , M o a n J., Peng Q., Photodynamic Therapy: Review, Journal o f the National Cancer Institute, V o l . 90(12), (1998) 11) Hopper C , Photodynamic therapy: a clinical reality in the treatment o f cancer, The Lancet oncology, V o l . 1, (2000) 12) M c B r i d e G . , Studies expand potentialuses o f photodynamic therapy, Journal o f the National Institute o f Cancer (News), V o l . 94(23), (2002) 13) Overholt, B . F . , M . Pamjehpour and J . M . Haydek, Photodynamict herapy for Barrett's esophagus: follow up in 100 patients, Gastrointestinal Endoscopy, V o l . 49, 1-7,(1999) 14) B r o w n S.B., B r o w n E . A . , and Walker I., The present and future role o f photodynamic therapy in cancer treatment. The Lancet oncology, V o l . 5, (2004) 15) Cuenca R . E , A l l i s o n R . R , Sabata C , Downie G . H , Breast cancer with chest wall progression: treatment with photodynamic therapy, Annals o f Surgical Oncology, V o l . 11(3), 223-227 (2002) 16) Morton C . A , Editorial: photodynamic therapy for non-melanoma skin cancer-and more?, Archives in Dermatology, V o l . 140, (2004) 17) Kennedy J.C., Pottier R . H . , Pross D . C . , photodynamic therapy with endogenous protoporphyrin I X : basic principles and present clinical experience, J Photochem Photobiol B , 6, 143-148, (1990) 18) Ruiz-Rodriguez R., Sanz-Sanchez T, and Codoba S., Photodynamic Rejuvination, Dermatol Surg, V o l . 28, 742-744, (2002) 19) Sheleg S.V., Zhavrid E . A , Khodina T . V , Kochubeev G . A . , Istomin Y . P . , Chalov V . M . , Zhuravkin I.N., photodynamic therapy with Chlorin e6 for skin metastases o f melanoma, Photodermatol Photoimmunol Photomed, V o l . 20, 21-26, (2004)  82  20) Hopper C , Kubler A . , Lewis H . , B i n g Tan I., Putnam G . , and the Foscan 01 Study Group, m - T H P C mediated photodynamic therapy for early oral squamous cell carcinoma, Int. J. Cancer, V o l . I l l , 138-146, (2004) 21) Ryter S.W., and Tyrrell R . M . , Singlet Molecular Oxygen ( ' 0 ) : A ossible effector of eukaryotic gene expression, Free Radical Biology and Medicine, V o l 24 (9), 1520-1534(2004). 22) . Hilarius P . M , Ebbing I.G., Dekkers D . W . C . , . Lagerberg J . W . M , de Korte D . and Verhoeven A . J . , Generation o f singlet oxygen induces phospholipid scrambling in human erythrocytes, Biochemistry, V o l . 43, 4012-4019 (2004) 23) Sakharov D . V . , Bunschoten A . , V a n Weelden H . , and Wirtz K . W . A . , Photodynamic treatment and H 0 - i n d u c e d oxidative stress result in different patterns o f cellular protein oxidation, Eur. J. Biochem, V o l . 270, 4859-4865 (2003) 24) Henderson, B . W . , Bellnier, D . A . , Tissue localization o f photosensitizers and the mechanism o f photodynamic tissuedestruction. Ciba Found. Symp., V o l . 146, 112, (1989) 25) Korbelik M . , Krosl G . , Photofrin Accumulation in malignant and host cell populations o f a murine fibrosarcoma, Photochem. Photobiol., V o l . 62 (1), 162-168 (1995) 26) Korbelik M . , K r o s l G . , Cellular levels o f photosensitizers in tumours: the role o f the proximity to the blood supply. B r . J. Cancer, V o l . 70, 604-610, (1994) 27) Korbelik M . , K r o s l G . , Olive P . L . , Chaplin D.J., Distribution o f Photofrin between tumour cells and tumour associated macrophages. B r . J. Cancer, V o l . 64, 508-512, (1991) 28) Korbelik M . , K r o s l G . , Photofrin Accumulation in malignant and host cell populations ofVarious tumours. B r . J. Cancer, V o l . 73, 506-513, (1996) 29) Niamien Konan Y . , Gurny R., Allemann E., State o f the art in the delivery o f photosensitizers for photodynamic therapy. J Photochem Photobiol B , V o l . 66, 89106, (2002) 30) Korbelik M . , K r o s l G . , Chaplin D . J., Photofrin uptake by murine macrophages, Cancer Research, V o l . 51, 2251-2255 (1991) 31) Korbelik M . , Hung J., L a m S., Palcic B . , The effects o f low density lipoproteins on uptake o f Photofrin II, Photochem. Photobiol., V o l . 51 (2), 191-196 (1990) 32) Polo, L . , Valduga, G . , Jori, G . , Reddi, E . , L o w density lipoprotein receptors in the uptake o f tumour photosensitzers by human and rat transformed fibroblasts, Int. J. Biochem. C e l l B i o l . , V o l . 34, 10-23 (2003) 33) Korbelik, M . , Cellular delivery and retention o f Photofrin II: The effects o f human versus mouse and bovine Serum, Photochem. Photobiol., V o l . 56 (3), 391-397 (1992) 34) Jori, G . , In Vivo Transport and pharmacokinetic behavior o f tumour photosensitizers, Ciba, Found. Symp., V o l . 146 (1989) 35) M o a n , J., Rimington, C . and Western, A . , The binding o f dihematoporphyrin ether (Photofrin II) to human serum albumin, C l i n . Chim. Acta., V o l . 145, 227-236 (1985) 36) Brancaleon, L . , Moseley, H . , Laser and non-laser sources for photodynamic therapy, Lasers M e d . Sci., V o l . 17, 173-186 (2002) 37) Grossweiner, L.I., Photodynamic Therapy, J. Laser A p p l . , V o l . 7 (1), 51-7 (1995) 38) Korbelik, M . , Sun, J., Zeng, H . , Ischemia reperfusion injury in photodynamic therapy-treated mouse tumours, B . J. C a n e , V o l . 88, 760-766 (2003) 2  2  2  83  39) Parks, D . A . , Williams, T . K . , Beckman, J.C., Conversion o f Xanthine Dehydrogenase to oxidase i n ischemic intestine: reevaluation, A m . J. Physiol, V o l . 254, G768-G774 (1988) 40) Parkins, C.S., Holder, A . L . , Dennis, M . F . , Stratford, M . R . , Chaplin, D.J., Involvement o f oxygen free radicals i n ischemia-reperfusion injury to murine tumours: role o f nitric oxide, Cancer Res., V o l . 55, 271-281 (1998) 41) Cecic, I., Korbelik, M . , Mediators of peripheral blood neutrophelia induced by photodynamic therapy o f solid tumours, Cancer Lett, V o l . 18, 43-51 (2002) 42) Kilgore, K . S . , Todd, III R . F . , Lucchesi, B . R . , Reperfusion Injury. In Inflammation:Basic Principles and Clinical Correlations, G a l i n , J.I., Snyderman,  R. (eds), pp 1047-1060. Philadelphia: Lippincott Williams & Wilkins (1999) 43) L i n , G.S., Al-Dakan, A . A . , Gibson, D.P., Inhibition o f D N A and protein synthesis and cell division by photoactivated Haematoporphyrin Derivative in hamster ovary cells, B r . J. Cancer, V o l . 53, 265-269 (1986) 44) Davies, C . L . , Ranheim, T., Rofstad, E . K . , Moan, J., Lindmo, T., Relationship between changes in antigen expression and protein synthesis in human melanoma cells after hypothermia and photodynamic treatment, B r . J. Cancer, V o l . 58, 306313 (1988) 45) Christensen, T., Moan, J., Smedshammer, L . , Influence o f Hematoporphyrin Derivative and light on the attahment o f cells to the substratum, Photochem. Photobiophys., V o l . 10, 53 (1985). 46) Kessel, D . , Sites of photosensitisation by derivatives o f Hematoporphyrin, Photochem. Photobiol., V o l . 44, 489-493 (1986) 47) Hilf, R., Smail, D . B . , Murant, R.S., Hematoporphyrin Derivative-induced photosensitivity o f mitochondrial succinate dehydrogenase and selected cytosolic enzymes o f R 3 2 3 0 A C mammary adenocarcinoma o f Rats, Cancer Res., V o l . 44, 1483-1488 (1984) 48) Hilf, R., Murant, R.S., Narayanan, U . , Relationship o f mitochondrial function and cellular adenosine triphosphate levels to Hematoporphyrin Derivative-induced photosensitization in R 3 2 3 0 A C mammary tumours, Cancer Res., V o l . 46, 211-217 (1986) 49) Oleinick, N . , Apoptosis in response to photodynamic therapy, Photodynamic News, V o l . 1 (2) (1998) 50) Moan, J., Petterson, E . O . , Christensen, T., The mechanism o f photodynamic inactivation o f human cells in vitro in the presence o f Hematoporphyrin, B r . J. Cancer, V o l . 39, 398-407 (1979) 51) Volden, G . , Christensen, T., Moan, J., Photodynamic membrane damage o f Hematoporphyrin Derivative-treated N H I K 3025 cells in vitro, Photochem. Photobiophys., V o l . 3, 105-111 (1981) 52) M o a n , J., M c G h i e , J., Jacobsen, P . B . , Photodynamic effects on cells in vitro exposed to Hematoporphyrin Derivative and light, Photochem. Photobiol., V o l . 37, 599-604 (1983) 53) M o a n , J, Christensen, T., Cellular uptake and photodynamic effect o f hematoporphyrin, Photochem. Photobiophys., V o l . 2, 291-299 (1981) 54) Joshi, P . G . , Joshi, K . J . , Mishra, S., Joshi, N . K . , C a influx induced by photodynamic actio in human cerebral plioma ( U - 8 7 M G ) cells: possible involvement o f a calcium channel, Photochem. Photobiol., V o l . 60, 244-248 (1994) 2 +  84  55) Thomas, J.P, Girotti, A . W . , Role o f lipid peroxidation in Hematoporphyrin Derivative-sensitized photokilling o f tumour cells: protective effects o f glutathione peroxidase, Cancer Res., V o l . 49, 1682-1686 (1989) 56) Davies, C . L . , Western, A . , Lindmo, T., Moan, J., Changes in antigen expression on human F M E melanoma cells afer exposure to photoactivated Hematoporphyrin derivatives, Cancer Res., V o l . 46, 6068-6072 (1986) 57) Agarwal, M . L . , Larkin, H . E . , Zaidi, S.I., Mukhtar, H . , Oleinick, N . L . , Phospholipase activation triggers apoptosis in photosensitized mouse lymphoma cells, Cancer Res., V o l . 53, 5897-5902 (1993) 58) Oleinick, N . L . , Evans, H . H . , The Photobiology o f photodynamic therapy: cellular targets and mechanisms, Radiat. Res., V o l . 150, S146-S156 (1998) 59) Ochsner, M . , Photophysical and photobiological processes in the photodynamic therapy o f tumours, J. Photochem. Photobiol. B , V o l . 39 (1), 1-18 (1997) 60) Varnes, M . E . , Chiu, S . M . , X u e , L . Y . , Oleinick, N . L . , Photodynamic therapyinduced apoptosis i n lymphoma cells: translocation o f cytochrome C causes inhibition o f respiration as well as caspasea ctivation, Biochem. Biophys. Res. C o m m u n , V o l . 255, 673-679 (1999) 61) Kessel, D . , L u o , Y . , Photodynamic therapy: A mitochondrial inducer o f apoptosis, C e l l Death Differ., V o l . 6, 28-35 (1999) 62) Moor, A . C . E . , Signalling pathways in celldeath and survival after photodynamic therapy, J. Photochem. Photobiol. B , V o l . 57, 1-13 (2000) 63) Matroule, J.Y., B o n i z z i , G . , Morliere, P., Paillous, N . , Santus, R., Bours, V . , Piette, J., Pyropheophorbide-a M e t h y l Ester-mediated photosensitization activates transcription factor N F - K B through the interleukin-1 receptor-dependant signalling pathway, J. B i o l . Chem., V o l . 274, 2988-3000 (1999) 64) Volanti, C , Matroule, J., Piette, J., Involvement o f oxidative stress i n N F - K B activation in endothelialc ells treated by photodynamic therapy, Photochem. Photobiol., V o l . 75 (1), 36-45 (2002) 65) Gomer, C.J., Ryter, S.W., Ferrario, A . , Rucker, N . , Wong, S., Fisher, A . M . , Photodynamic therapy-mediated oxidative stress can induce expression o f heat shock proteins, Cancer Res., V o l . 56, 2355-2360 (1996) 66) Korbelik, M . , Sun, J., Cecic, I., Photodynamic therapy-induced cells urface expression and release o f heat shock proteins:r elevance for tumor response. Cancer Res., V o l . 65 (3), 1018-1026 (2005) 67) Korbelik, M . , Sun, J., Payne, P.W., Activation o f Poly(adenosine diphosphateribose) polymerase i n mouse tumorst reated by photodynamic therapy, Photochem. Photobiol., V o l . 78 (4), 400-406 (2003) 68) Chiarugi, A . , Poly (ADP-ribose) Polymerase: killer or conspirator? The 'suicide hypothesis' revisited, T R E N D S in Pharmacol. Sci., V o l . 23 (3), 122-129 (2002) 69) Korbelik, M . , Dougherty, G.J., Photodynamic therapy-mediated immuner esponse against subcutaneous mouse tumours, Cancer Res., V o l . 59, 1941-1946 (1999) 70) Canti, G . , De Simone, A . , Korbelik, M . , Photodynamic therapy and the immune system in experimental oncology, Photochem. Photobiol. Sci., V o l . 1, 79-80 (2002) 71) Cecic, I., Stott, B . , Sun, J., Korbelik, M . , Relevance o f innate immunity recognition of altered self in the induction o f host response associated with photodynamic therapy, Recent Res. Devel. Cancer, V o l . 6, 153-161 (2004) 72) Korbelik, M . , Cecic, I., Sun, J., Relevance o f PDT-induced inflammatory response for the outcome o f photodynamic therapy, Proc. SPIE, V o l . 4257, 19-24 (2001) 85  73) Gallucci, S., Matzinger, P., Danger signals: SOS to the immune system, Curr. Opin. Immunol., V o l . 13, 114-119 (2001) 74) Norval, M . , What's new in photoimmunology?, Photodermatol. Photoimmunnol. Photomed., V o l . 19, 313-315 (2003) 75) Kushner, I., Rzewnicki, D . , Acute phase response in: Inflammation: Basic Principles and Clinical Correlates, Gallin, J., Snyderman, R., 3 E d , Lippincott Williams and Wilkins, Philadelphia © 1 9 9 9 76) Herman, S., Kalechman, Y . , Sredni, B . , Gafter, U . , M a l i k , Z . , Photofrin II induces cytokine secretion by mouse spleen cells and human peripheral mononuclear cells, Immunopharmacology, V o l . 31, 195-204 (1996) 77) Gollnick, S.O., Henderson, B . , Owczarczak, B . , Maier, P., Vaughn, L . , Evans, S., Wang, W . , Unger, E . , Baumann, H . , Role o f cytokines in photodynamic therapyinduced local and systemic inflammation, B r . J. Cancer, V o l . 88, 1772-1779 (2003) 78) Cecic, I., Korbelik, M . , Parkins, C , Induction o f systemic neutrophil response i n mice by photodynamic therapy o f solid tumours, Photochem. Photobiol., V o l . 74 (5), 712-720 (2001) 79) Sun, J., Cecic, I., Korbelik, M . , Parkins, C , Neutrophils as inflammatory and immune effectors in photodynamic therapy-treated mouse S C C V I I tumours, Photochem. Photobio. Sci., V o l . 1, 690-695 (2002) 80) Korbelik, M . , Cecic, I., Contribution o f myeloid and lymphoid host cells to the curative outcome o f mouse sarcoma treatment b y photodynamic therapy, Cancer L e t t , V o l . 137,91-98 (1999) 81) Monsinjon, T., Gasque, P., Chan, P., Ischenko, A . , Brady, J., Fontaine, M . , Regulation b y complement C3a and C 5 a anaphylatoxins o f cytokine production i n human umbilical vein endothelial cells, F A S E B J., V o l . 17, 1003-1014 (2003) 82) Bainton, D.F., Developmental biology o f neutrophils and eosinophils, in: r d  Inflammation: Basic Principles and Clinical Correlates, 3  r d  E d . , G a l l i n , J.,  Snyderman, R., Lippincott Williams and Wilkins, Philadelphia © 1999 83) De Vree, W . , Essers, M . , de Brujin, H . , Star, W . , Koster, J., Sluiter, W . , Evidence for an important role o f neutrophils i n the efficacy o f photodynamic therapy in vivo, Cancer Res., V o l . 56, 2908-2911 (1996) 84) Smith, W . C . , Endothelial adhesion molecules and their role i n inflammation, Can. J., Physiol. Pharmacol., V o l . 71, 76-87 (1993) 85) K r o s l , G . , Korbelik, M . , Dougherty, G.J., Induction o f immune cell infiltration into murine S C C V I I tumour by Photofrin-based photodynamic therapy, B r . J . Cancer, V o l . 71, 549-555 (1995) 86) Weiss, S.J., Tissue destruction by neutrophils, N . Engl. J. M e d . , V o l . 320, 365-376 (1989) 87) Gordon, S., Development and distribution o f mononuclear phagocytes: relevance to inflammation, in: Inflammation: Basic Principles and Clinical Correlates. 3  r d  Edition, Gallin, J.I. and Snyderman, R., Lippincott Williams & Wilkins, Philadelphia © 1 9 9 9 88) Gregory, C D . , Devitt, A . , The macrophage and the apoptotic cell: an innate immune interaction viewed symplistically?, Immunology, V o l . 113, 1-14 (2004) 89) Verrek, F., de Boer, T., Langenberg, D . , Hoeve, M . , Kramer, M . , Vaisberg, E . , Kastelein, R., K o l k , A . , de Waal-Malefyt, R., Ottenhoff, X , Human IL-23producing type-1 macrophages but IL-10-producing type-2 macrophages subvert immunity to (myco)bacteria. P N A S , V o l . 101 (13), 4560-4565 (2004) 86  90) Mevorach, D . , Mascarenhas, J., Gershov, D . , Elkon, K . , Complement-dependant clearance o f apoptotic cells by human macrophages, J. Exp. Med., V o l . , 188 (12), 2313-2320(1998) 91) Ezekowitz, A . , Sim, R . B . , H i l l , M . , Gordon, S., Local opsonization by secreted macrophage complement components, J. E x p . M e d . , V o l . 159, 244-260 (1983) 92) Dempsey, P . W . , Vaidya, S.A., Cheng, G . , The art o f war: innate and adaptive immune responses, C M S L , Cell. M o l . Life Sci., V o l 60, 2604-2621 (2003) 93) Vabulas, R., Ahmad-Nejad, P., Ghose, S., Kirschning, C , Issels, R., Wagner, H . , H S P 7 0 as endogenous stimulus o f the Toll/Interleukin-1 receptor signal pathway, J. B i o l . Chem., V o l . 277 (17), 15107-15112 (2002) 94) Laufer, J., Passwell, J.H., Katz, Y . , Extrahepatic synthesis o f complement proteins in inflammation, M o l . Immunol., V o l . 38, 221-229 (2001) 95) Gadjeva, M . , Verschoor, A . , Brockman, M . , Jezak, H . , Shen, L . , Knipe, D . , Carroll, M . , Macrophage-derived complement component C 4 can restore humoral Immunity in C 4 deficient mice, J. I m m u n o l , V o l . 169, 5489-5495 (2002) 96) Aderem, A . , Role o f Toll-like receptors i n inflammatory response i n macrophages, Crit. Care Med., V o l . 29, SI6-18 (2001) 97) Hale, L . P., Haynes, B . F., Chapter 8: overview o f development and function o f lymphocytes i n Inflammation: Basic Principles and Clinical Correlates, 3  r d  ed.  Edited by Gallin, J. I. and Snyderman, R., Lippincott Williams and Wilkins, P h i l a d e l p h i a © 1999 98) Korbelik, M . , Cecic, I., Mechanism o f tumour destruction by photodynamic therapy, in Handbook of Photochemistry and Photobiology, V o l . 4, ed. H . S . N a l w a ,  American Scientific Publishers, Stevenson Ranch, C A , 39-77 (2003) 99) Korbelik, M . , Krosl, G . , K r o s l J., Dougherty, G . J., The role o f host lymphoid polulations i n the response o f mouse E M T 6 tumours to photodynamic therapy. Cancer Res., V o l . 56 (24), 5647-5652 (1996). 100) Cooper N . R . , Biology o f the Complement System, in Inflammation: Basic Principles and Clinical Correlates, 3 E d . Edited by Gallin, J.I., and Snyderman, R., Lippincott Williams and Wilkins, Philadelphia © 1999 101) Song, W . C . , Sarrias, M . R . , Lambris, J.D., Complement and innate immunity, immunopharmacology, V o l . 49, 187-189 (2000) 102) Hack, E . C . , The Regulation o f C I activation and its role i n disease, i n Therapeutic Interventions in the Complement System, edited by Lambris, J.D. and Holers, V . M . , Humana Press Inc., N e w Jersey © 2000 103) Gasque, P., Complement: a unique innate immune sensor for danger signals, Molecular Immunology, V o l . 41, 1089-1098 (2004) 104) Ehlers, M . R . , C R 3 : a General purpose adhesion-recognition receptor essential for innate immunity, Microb. Infect., V o l . 2, 289-294 (2000) 105) Guan, E . , Robinson, S.L., Goodman, E . B . , Tenner, A . J . , C e l l surface protein identified on phagocytic cells modulates the Clq-mediated enhancement o f Phagocytosis, J. Immunol., V o l . 152, 4005-4016 (1994) 106) Jauneau, A - C , Chan, P., Fontaine, M . , Ischenko, A . , Complement component anaphylatoxins upregulate chemokine expression by human astrocytes, F E B S Lett., V o l . 537, 17-22 (2003) 107) Chushakova, N . , Skokowa, J., Schulman, J., Baumann, U . , Zwirner, J., Schmidt, R . E . , Gessner, E . , C5a anaphylatoxin is a major regulator o f activating versus r d  87  inhibitory F C y R s i n immune complex-induced lung disease, J. C l i n . Ivest., V o l . 110, 1823-1830(2002) 108) Monsinjon, T., Gasque, P., Chan, P., Ischenko, A . , Brady, J.J., Fontaine, M . , Regulation by complement C3a and C 5 a anaphylatoxins o f cytokine production in human umbilical vein endothelial cells, F A S E B J . , V o l . 17, 1003-1014 (2003) 109) Ember, J.A., Jagels, M . A . , Hugh, T.E., in: Characterization of Complement Anaphylatoxins and their Biological Responses, Volanakis, J.E., Frank, M . M . ,  Editors, Dekker M . Inc., 241-284 110) Erdei, A . , Andrasfalvy, M . , Peterfy, H . , Toth, G . , Pecht, I., Regulation o f mast cell activatbn by complement derived p eptides, Immunol. Lett., V o l . 92, 39-42 (2004) 111) Szalai, A . J . , van Ginkel, F . W . , Wang, Y . , McGhee, J.R., Volanakis, J.E., Complement-dependant acute phase expression o f C-Reactive Protein and Serum A m y l o i d P-Component, J. Immunol., V o l . 165 112) Tsuji, R., Kawikova, I., Ramabhadran, R., Akahira-Azuma, M . , Taub, D . , Hugli, T . E . , Gerard, C , Askenase, P . W . , Early local generation o f C5a initiates the elicitation o f contact sensitivity by leading to early T-cell recruitment, J. Immunol., V o l . 165, 1588-1598 (2000) 113) Carroll, M . C . , The Complement system i n regulation o f adaptive immunity, Nature Immunology, V o l . 5 (10), 981-986 (2004) 114) Erdei, A . , Prechl, J., Isaak, A . , Molnar, E . , Regulation o f B-cell activaton by complement receptors C D 2 1 and C D 3 5 , Curr. Pharm. Des., V o l . 9, 1849-1860 (2003) 115) Bohana-Kashtan, O., Ziporen, L . , Donin, N . , Kraus, S., Fishelson, Z . , C e l l signals transduced by complement, M o l . Immunol., V o l . 41, 583-597 (2004)] 116) Cybuleski, A . , Takano, T., Papillon, J., Khadir, A . , L i u , J., Peng, PL, Complement C5b-9 membrane attack complex increases expression o f endoplasmic reticulum stress proteins in glomerular epithelial cells, J. o f B i o l . Chem., V o l . 277 (44), 41342-41351 (2002) 117) Morgan, B.P., Complement regulatory molecules-application to therapy and transplantation, Immunol. Today, V o l . 16, 257-259 (1995) 118) Gorter,A., M e r i , S., Immune evasion o f tumor cells using membrane-bound complement regulatory proteins, Immunol. Today, 20 (12), 576-582 (1999) 119) Fishelson, Z . , Donin, N . , Zell, S., Schultz, S., Kirschfink, M . , Obstacles to cancer immunotherapy: expression o f membrane complement regulatory proteins (mCRPs) in tumors, Molec. Immunol., V o l . 40, 109-123 (2003) 120) Alper, C . A . , Johnson, A . M . , Birtch, A . G . , Moore, R . D . , Human C 3 : Evidence for the liver as the primary site o f synthesis, Science, V o l . 163, 286-288 (1969) 121) Giclas, P.C., Strunk, R . C . , Manthei, U . , The Acute phase response o f C 3 , C 5 , ceruloplasmin and C-Reactive Protein induced by turpentine pleurisy in the rabbit, A m . J. Pathol., V o l . 120, 146-156 (1985) 122) Morgan, B . P . , Gasque, P., Extrahepatic complement biosynthesis: where, when and why?, C l i n . E x p . I m m u n o l , V o l . 107, 1-7 (1997) 123) Kitano, E . , Kitamura, H . , Synthesis o f factor D b y gastric cancer-derived cell lines, International immunopharmacology, V o l . 2, 843-848 (2002) 124) Colten, H.R., Tissue specific regulation o f inflammation, J. A p p l . Physiol., V o l . 72, 1-7(1993)  88  125) Mevorach, D . , Mascarenhas, J.O., Gershov, D . , Elkon, K . B . , Complementdependant clearance o f apoptotic cells by human macrophages, J. E x p . Med., V o l . 188 (12), 2313-2320(1998) 126) Cecic, I., Serrano, K . , Gyongyossy-Issa, M . , Korbelik, M . , Characteristics o f complement activation in mice bearing Lewis Lung Carcinoma treated by photodynamic therapy, Cancer Lett. (2004) 127) Cecic, I., Korbelik, M . , Deposition o f complement proteins on cells treated by photodynamic therapy in vitro. J. Env. Path., Toxic. Oncol. (2005, in press) 128) Hart, M . L . , Walsh, M . C . , Stahl, G . L . , Initiation o f complementa ctivatin following oxidative stress. In Vitro and In V i v o Observations, Molec. Immunol., V o l . 4 1 , 165-171 (2004) 129) Collard, C D . , Vakeva, A . , Morrissey, M . A . , Agah, A . , Rollins, S.A., Reenstra, W . R . , Buras, J.A., M e r i , S., Stahl, G . L . , Complement activation after oxidative stress, role o f the lectin complement pathway, A m . J. Path., V o l . 156 (5), 15491566 (2000) 130) Lien, E . , Ingalls, R. R., Toll-like receptors, Crit. Care Med., V o l . 30 (1), S l - S l l (2002) 131) Horng, T., Barton, G . , Flavell, R., Medzhitov, R., The adaptor molecule T I R A P provides signaling specificity for Toll-like receptors. Nature, V o l . 420, 329-332, (2002) 132) Sugiura K . , Stock C , Effect o f O-diazoacetyl-L-serine (azaserine) on growth o f various mouse and rat tumors, Proc. Soc. Expt. B i o l . M e d . V o l . 88 (1), 127-129 (1955) 133) Korbelik, M . , Sun, J., Posakony, J., Interaction between Photodynamic Therapy and B C G immunotherapy responsible for the reduced recurrence o f treated mouse tumours. Photochem. P h o t o b i o l , V o l . 73 (4), 403-409 (2001)(7) Suppl., S42-S47 134) Dhainaut, J., Marin, N . , Mignon, A . , Vinsonneau, C , Hepatic response to sepsis: interaction between coagulation and inflammatory processes, Crit. Care M e d . , V o l . 29 (2001) 135) Ramadorl, G . , Sipe, J.D., Dinarello, C , M i z e l , B . , Colten, H.R., Pretranslational modulation o f acute phase hepatic synthesis by murine recombinant interleukin 1 (IL-1) and purified human IL-1. J. E x p . Med., V o l . 162, 930-942 (1985) 136) Strunk, R., Whitehead, A . , Cole, F., Pretranslational regulation o f the synthesis o f the third component o f complement in human mononuclear phagocytes by the lipid A portion o f lipopolysaccharide. J. C l i n . Invest., V o l . 76, 985-990 (1985) 137) O'Shea, J., Brown, E . , Seligmann, B . , Metcalf, J., Frank, M . , Gallin, J., Evidence for distinct intracellular pools o f receptors for C3b and C3bi in human neutrophils. J. Immunol., V o l . 134 (4), 2580-2587 (1985) 138) Ajona, D . , Castano, Z . , Garayoa, M . , Zudaire, E . , Pajares, M . , Martinez, A . , Cuttitta, F., Montuenga, L . , Pio, R., Expression o f complementf actor H by lung cancer cells: effects on the activation o f the alternative pathway o f complement. Cancer Res., V o l . 64, 6310-6318 (2004) 139) Stuhlmeier, K . M . , Activation and regulation o f H S P 3 2 and HSP70, Eur. J. Biochem., V o l . 267, 1161-1167 (2000) 140) Dybdahl, B . , Wahba, A . , Lien, E . , F l o , X , Waage, A . , Qureshi, N . , Sellevold, O., Espevik, X , Sundan, A . , Inflammatory response after open heart surgery: release o f Heat-Shock Protein 70 and signalling through Toll-like receptor-4. Circulation, V o l . 105, 685-690 (2002) 89  141) Asea, A . , Rehli, M . , Kabingu, E . , Boch, J., Bare, O., Auron, P., Stevenson, M . A . , Calderwood, S., N o v e l signal transduction pathway utilized bye xtracellular HSP70: role o f Toll-liker eceptor-2 and 4. J. B i o l . Chem., V o l . 277 (17), 15028-15034 142) Iwasaki, A . , Medzhitov, R., Toll-like receptor control o f the adaptive immune responses. Nature Immunology, V o l . 5 (10), 987-995 (2004) 143) Mukhopadhyay, S., Herre, J., Brown, G . D . , Gordon, S., The potential for Toll-like receptors to collaborate with other innate immune receptors. Immunology, V o l . 112, 521-530(2004) 144) Korbelik, M . , Role o f Toll-like receptors in photodynamic therapy-elicited host response. Proc. SPIE, V o l . 5319 (2004, i n press) 145) Malhotra, V . , Wong, H . , Interactions between the heat shock response and the nuclear factor-kB signaling pathway. Crit. Care M e d . , V o l . 30 (1 suppl.), (2002) 146) Tian, B . , Brasier, A . R . , Identification o f a nuclear factor kappa B-dependent gene network, Recent Prog. Horm. Res., V o l . 58, 95-130 (2003) 147) Korbelik, M . , Sun, J., Cecic, I., Serrano, K . , Adjuvant treatment for complement activation increases the effectiveness o f photodynamic therapy o f solid tumors. Photochem. Photobiol. Sci., V o l . 3, 812-816 (2004)  90  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092220/manifest

Comment

Related Items