UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Modular domain organization of RNase E and PNPase Miao, Xin 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-732118.pdf [ 9.95MB ]
Metadata
JSON: 831-1.0092187.json
JSON-LD: 831-1.0092187-ld.json
RDF/XML (Pretty): 831-1.0092187-rdf.xml
RDF/JSON: 831-1.0092187-rdf.json
Turtle: 831-1.0092187-turtle.txt
N-Triples: 831-1.0092187-rdf-ntriples.txt
Original Record: 831-1.0092187-source.json
Full Text
831-1.0092187-fulltext.txt
Citation
831-1.0092187.ris

Full Text

MODULAR DOMAIN ORGANIZATION OF RNase E AND PNPase by Xin Miao BSc(Hon), The U n i v e r s i t y of New Brunswick, 1993 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF THE DEGREE OF DOCTOR OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES Department of Biochemistry and Molecular B i o l o g y We accept t h i s t h e s i s as conforming to the re q u i r e d standard THE UNIVERSITY OF BRITISH COLUMBIA February, 2002 © X i n Miao, 2002 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada Date / DE-6 (2/88) ABSTRACT mRNA decay i n Escherichia coli i s c a r r i e d out and c o n t r o l l e d by concerted a c t i o n s of a number of ribonucleases and other p r o t e i n f a c t o r s . In order to ga i n i n s i g h t s i n t o the c a t a l y t i c mechanisms and r e g u l a t i o n i n v o l v e d i n t h i s important c e l l u l a r process, we have u t i l i z e d mutational a n a l y s i s to study two key enzymes, RNase E and PNPase. RNase E i s the endoribonuclease that i n i t i a t e s the degradation of bulk mRNA. We constructed a s e r i e s of truncated Rne p r o t e i n s to d e l i n e a t e the domains of RNase E. Our data show that the c a t a l y t i c s i t e of RNase E i s l o c a t e d between residues 208 and 407. The f i r s t 207 residues, encompassing an SI domain, may p l a y a r o l e i n main t a i n i n g s t r u c t u r a l i n t e g r i t y of the p r o t e i n . We have a l s o i d e n t i f i e d a minimal A r g - r i c h RNA-binding s i t e between residues 608 and 622. P r e l i m i n a r y data i n d i c a t e that the RBD plays a r o l e i n f a c i l i t a t i n g degradation and processing of some RNAs. In a d d i t i o n , t h i s study confirms the f i n d i n g s by others that RNase E d i s p l a y s a modular domain o r g a n i z a t i o n . PNPase, a h i g h l y conserved p r o t e i n i n b a c t e r i a and p l a n t s , i s one of two.major 3'-5' exoribonucleases degrading RNA fragments generated by RNase E cleavages. Based on the a v a i l a b l e sequence inf o r m a t i o n , we constructed a s e r i e s of d e l e t i o n mutants to express i n d i v i d u a l domains and to study t h e i r f u n c t i o n s . The data show that the c a t a l y t i c s i t e r e s i d e s w i t h i n the PH domain (residues 312-541). The PH' domain .(residues 1-210), r e l a t e d to the PH domain, i s r e q u i r e d f o r s t r u c t u r a l i n t e g r i t y . I n t e r e s t i n g l y , Rne-binding a c t i v i t i e s are detected i n both N-terminal p o r t i o n (PH' domain plus the l i n k e r ) of the Pnp p r o t e i n and the C-terminal SI domain (residues 622-690). The mode of Pnp-Rne i n t e r a c t i o n i s discussed. Our biochemical evidence c o r r e l a t e s w e l l w i t h the published c r y s t a l s t r u c t u r e of PNPase. T A B L E OF CONTENTS Page Ab s t r a c t - — — — i i L i s t of Figures - „._..vii L i s t of Tables. - - i x L i s t of Abb r e v i a t i o n s -x. Acknowledgements ....xii Chapter I Enzymes of mRNA decay i n Escherichia coli 1 1.1 The endoribonucleases ~ ~ - 3 1.1.1 RNase E - 3 1.1.2 The RNA degradosome - 12 1.1.3 RNase I I I 13 1.2 The 3'-5' exoribonucleases — - - 15 1.2.1 P o l y n u c l e o t i d e phosphorylase (PNPase) - 15 1.2.2 PNPases i n other organisms 23 1.2.2.1 Bacillus subtilis - 24 1.2.2.2 Streptomyces antibioticus..- .._ -..26 1.2.2.3 PNPase i n higher organisms — — - 26 1.2.3 RNase I I 27 1.2.4 Oli g o r i b o n u c l e a s e - - - — - 29 1.3 Other enzymes - 3 0 1.3.1 Poly (A) polymerase 3 0 1.3.2 RhlB 32 1.3.3 CsdA. „ .- - 34 1.4 Models of mRNA decay - 35 1.4.1 The 5 ' - end. -— .- 3 5 1.4.2 The 3 ' - end. — - .- 42 1.5 The scope of the experiments 45 Chapter II M a t e r i a l s and Methods - 4 6 2.1 B a c t e r i a l s t r a i n s , plasmids and commercial sources of enzymes and k i t s — - - - 4 6 2.1.1 B a c t e r i a l s t r a i n s 46 2.1.2 Plasmids ~. - 46 2.1.3 Enzymes and antibodies..- _ 46 2.1.4 B a c t e r i a l growth media..- — 4 9 2.2 Molecular Cloning - - — 4 9 2.2.1 A m p l i f i c a t i o n of DNA..„ — 49 2.2.2 Subcloning and c h a r a c t e r i z a t i o n of recombinant plasmids - 54 2.3 Overexpression and p a r t i a l p u r i f i c a t i o n of Rne and Pnp d e l e t i o n p r o t e i n s 59 2.4 Pr e p a r a t i o n of RNA subs t r a t e s and probes 60 2.5 P r o t e i n b l o t s — — 61 2.5.1 Western b l o t 61 2.5.2 Northwestern b l o t — 62 2.6 A f f i n i t y chromatography ~ 62 2.6.1 P u r i f i c a t i o n of Pnp subfragments 62 2.6.2 P r o t e i n i n t e r a c t i o n assay 63 2.7 P a r t i a l proteolysis..- _ - ~ 64 2 . 8 Co-immunoprecipitation „ 65 2.9 Ribonuclease assays 65 2.9.1 Ribonuclease E a c t i v i t y assay.™ _ _ 65 2.9.2 P o l y n u c l e o t i d e phosphorylase a c t i v i t y assay 66 2.10 Computational methods ~ ~ 66 Chapter I I I The RNA-binding domain of RNase E _ - - 67 3.1 General overview - 67 3.2 R e s u l t s — - 68 3.2.1 C o n s t r u c t i o n and overexpression of Rne d e l e t i o n s 68 3.2.2 Mapping the RNA-binding domain of Rne _ 75 3.2.3 L o c a t i o n of a minimal RNA-binding s i t e w i t h i n the A r g - r i c h r e g i o n _ 77 3.2.4 RNase E a c t i v i t y of Rne d e l e t i o n s _ _ - 84 3.2.4.1 RNase E a c t i v i t y of trun c a t e d Rne proteins...84 3.2.4.2 RNase E assays u s i n g p u r i f i e d Rne p r o t e i n and i t s d e r i v a t i v e s — „ _ 88 3.2.4.3 Competition assays _ _ - 91 3.3 D i s c u s s i o n _ 94 3.3.1 Overexpression of Rne d e l e t i o n s mutants ~.u _ 94 3.3.2 The RNA-binding domain (RBD) of the Rne p r o t e i n .......95 3.3.3 The c a t a l y t i c s i t e of the Rne p r o t e i n _ _ „ 100 Chapter IV S t r u c t u r e - f u n c t i o n r e l a t i o n s h i p s of PNPase domains — _..102 4.1 General overview — - 102 4.2 Results.™ — - — - 104 4.2.1 Sequence a n a l y s i s of the E.coli PNPase 104 4.2.2 The RNA-binding m o t i f s are s u s c e p t i b l e to p r o t e o l y s i s _ _ - — 109 4.2.3 Construction and overexpression of PNPase d e l e t i o n s - -..113 4.2.4 P u r i f i c a t i o n of Pnp subfragments _ _..115 4.2.5 PNPase a c t i v i t y of Pnp subfragments..- 118 4.2.6 Rne-Pnp i n t e r a c t i o n s - — _..122 4.2.6.1 A f f i n i t y chromatography - — 122 4.2.6.2 Co-immunoprecipitation - _ „ 126 4.3 D i s c u s s i o n 129 4.3.1 The Pnp polypeptide i s organized i n two modules.._.„..12 9 4.3.2 Expression and p u r i f i c a t i o n of Pnp subfragments 129 4.3.3 Pnp-Rne i n t e r a c t i o n - — 131 4.3.4 The c a t a l y t i c domain and the s t r u c t u r e of Pnp polypeptide _ - - - — 1 3 9 Chapter V Conclusions and perspect ives 141 5.1 RNase E.._. - — .— -..141 5 . 2 PNPase _ _. - — 144 Appendix — - - - - 14 7 References - — - 151 L I S T OF FIGURES 1.1 Sequence and f u n c t i o n a l f e a t u r e s of the Rne p r o t e i n 6 1.2 The p u t a t i v e RNA-binding residues i n the SI domain 8 1.3 The components of the RNA degradosome 10 1.4 Schematic r e p r e s e n t a t i o n of the Pnp p r o t e i n 19 1.5 Nova2 KH3 domain i n t e r a c t i n g w i t h an RNA h a i r p i n _ „..21 1.6 P r o t e i n - p r o t e i n i n t e r a c t i o n s between KH domains „ — 2 2 1.7 The secondary s t r u c t u r e of the malEF REP RNA. _ 33 1.8 Models of mRNA decay _ 36 1.9 The 5' - t e t h e r i n g model 3 9 .1.10 E f f e c t s of 5'-end secondary s t r u c t u r e s on RNase E-mediated 1.11 Models f o r 3'-5' mRNA decay... 44 2.1 S t r a t e g i e s of PCR subcloning of Rne d e l e t i o n s _ 55 2.2 S t r a t e g i e s of PCR subcloning of RBD d e l e t i o n s _ „ 57 3.1 Domains w i t h i n Rne and N - t e r m i n a l l y truncated Rne p r o t e i n s 69 3.2 C - t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s „ 70 3.3 Overexpression of the Rne d e l e t i o n p r o t e i n s _ 72 3.4 Northwestern b l o t t i n g : i n t e r a c t i o n s between C - t e r m i n a l l y truncated Rne p r o t e i n s and 9S RNA 76 3.5 Northwestern b l o t t i n g : i n t e r a c t i o n s between N - t e r m i n a l l y truncated Rne p r o t e i n s and 9S RNA. „ 78 3.6 A strong RNA b i n d i n g s i t e i s l o c a t e d i n the A r g - r i c h r e g i o n — 80 3.7 Rne d e l e t i o n p r o t e i n s w i t h C-termini w i t h i n the A r g - r i c h r e g i o n _ 82 3.8 Overexpression and Northwestern assays of d e l e t i o n p r o t e i n s w i t h C-termini w i t h i n the RBD _ 83 3.9 RNase E cleavage s i t e s on 9S RNA 85 3.10 RNase E assays u s i n g AS26 f r a c t i o n s „ 86 3.11 RNase E assays u s i n g p u r i f i e d Rne p r o t e i n and i t s d e r i v a t i v e s 89 3.12 Competition assays (I) 92 3.13 Competition assays (II) „ 93 3.14 I d e n t i f i c a t i o n of a minimal RNA bi n d i n g s i t e _ 97 3.15 Sequence comparison of a r g i n i n e - r i c h RNA-binding motifs.™ _ 98 4.1 Sequence alignment of Pnp p r o t e i n s 105 4.2 Sequence alignment of E. c o l i Pnp p r o t e i n and small Pnp p r o t e i n s _ 108 4.3 P a r t i a l p r o t e o l y s i s of His 6-Pnp on a N i 2 + column „ „ 110 4.4 Pnp domain o r g a n i z a t i o n and Pnp d e l e t i o n p r o t e i n s 114 4.5 A f f i n i t y p u r i f i c a t i o n of Pnp subfragments _ 116 4.6 PNPase a c t i v i t y assays of p u r i f i e d Pnp subfragments „ — 1 1 9 4.7 Pnp-Rne i n t e r a c t i o n : a f f i n i t y chromatography 124 4.8 Co-immunoprecipitation of Rne d e l e t i o n p r o t e i n s and Pnp sub fragment s — ~ — 1 2 7 4.9 Induction at 37 °C leads to s i z a b l e amount of i n s o l u b l e Pnp p r o t e i n s ~ _..13 0 4.10 A c i d i c and Bas i c residues of SI RNA-binding domain ....132 4.11 The s t r u c t u r e of PNPase of Streptomyces a n t i b i o t i c u s and Pnp-Rne i n t e r a c t i o n _ 136 5.1 Domain o r g a n i z a t i o n of the Rne p r o t e i n _ _ 142 5.2 Domain o r g a n i z a t i o n of the Pnp p r o t e i n _ 145 L I S T OF T A B L E S 1.1 Ribonucleases i n Escherichia coli „ - 2 2.1 L i s t of b a c t e r i a l s t r a i n s — — ~ -.47 2.2 L i s t of plasmids _ .. 47 2.3 L i s t of a n t i b o d i e s _ 48 2.4 Primers used i n the c o n s t r u c t i o n of Rne d e l e t i o n s „ 51 2.5 Primers used i n the c o n s t r u c t i o n of Pnp d e l e t i o n s — 52 2.6 L i s t of Pnp subfragments produced from the primers i n Table 2.5 53 L I S T OF ABBREVIATIONS a. a. amino a c i d ATP adenosine 5'-triphosphate Arg a r g i n i n e bp base p a i r BSA bovine serum albumin °C degree C e l s i u s C-terminal c a r b o x y l - t e r m i n a l Csp cold-shock p r o t e i n CTP c y t i d i n e 5'-triphosphate dATP deoxyadenosine 5'-triphosphate DEAD aspartate -glutamate -alanine-aspartate DEPC d i e t h y l pyrocarbonate DNA deo x y r i b o n u c l e i c a c i d DNase deoxyribonuclease dNTP deoxyribonucleotide triphosphate dsRNA double-stranded RNA DTT 1 , 4 - d i t h i o t h r e i t o l EDTA ethylenediamine t e t r a a c e t a t e 9 gravity. GPSI' guanosine pentaphosphate synthetase I hr hour HEPES N-2-hydroxy e t h y l piperazine-N'-2-ethanewulfonic a c i d His h i s t i d i n e IPTG is o p r o p y l - P - D - t h i o g a l a c t o p y r a n o s i d e kbp k i l o b a s e p a i r kDa k i l o D a l t o n LB L u r i a - B e r t a n i b roth M molar mA milliampere uCi microCurie microgram UL m i c r o l i t e r min minutes mg m i l l i g r a m mL m i l l i l i t e r mM m i l l i m o l a r mRNA messenger r i b o n u c l e i c a c i d MW molecular weight NDP nucleoside diphosphates ng nanogram NMP nucleoside monophosphate NMR nuclear magnetic resonance NP-40 nonidet P-40 nt n u c l e o t i d e N-terminal amino-terminal PAGE polyacrylamide g e l e l e c t r o p h o r e s i s PAP poly(A) polymerase PCI phenol/chloroform/isoamyl a l c o h o l PCR polymerase•chain r e a c t i o n pmol picomole PMSF p h e n y l n e t h y l s u l f o n y l f l u o r i d e Pnp the pnp gene product PNPase p o l y n u c l e o t i d e phosphorylase poly(A) polyadenylate p s i pounds per square i n c h RBD RNA-binding domain RhlB the rhlB gene product RNase ribonuclease Rne the rne gene product rpm r e v o l a t i o n s per minute rRNA ribosomal r i b o n u c l e i c a c i d S30 supernatant from 30,000xg c e n t r i f u g a t i o n SDS sodium dodecyl s u l f a t e SsRNA si n g l e - s t r a n d e d RNA TAE t r i s - a c e t a t e - N a EDTA TBE t r i s - b o r i c acid-Na EDTA T r i s t r i s ( h y d r o x y n e t h y l ) aminomethane tRNA t r a n s f e r r i b o n u c l e i c a c i d t s t e m p e r a t u r e - s e n s i t i v e UTR u n t r a n s l a t e d r e g i o n UV u l t r a v i o l e t v/v volume/volume w/v weight/volume ACKNOWLEDGEMENTS I would l i k e to express my g r a t i t u d e to my s u p e r v i s o r Dr. George A. Mackie. Without h i s guidance, patience, encouragement and support, none of t h i s work would be p o s s i b l e . S p e c i a l thanks to the former and current members of the Mackie lab f o r t h e i r support both as colleagues and f r i e n d s : Rob Cormack, Michèle Rouleau, J u l i e Genereaux, Stephanie Masterman, Catherine S p i c k l e r , Doug B r i a n t , K r i s t i a n Baker, Annie Prud'homme-Généreux, Janet Hankins plus many current and future Med students and doctors passing-through the l a b . Been the l a s t member of the group, how can I f o r g e t the famed (or notorious) 'Mackie Boys'? Glen Coburn, Anand Rampersaud, Ken Niguma and I had together made a l o t of t r o u b l e f o r George i n the f i r s t couple of years at UBC. I am sure the Reps (Anand and Ken) w i l l c o n t i n u o u s l y ask George f o r money f o r a number of years i n the f u t u r e . I would l i k e to a l s o thank a l l the f r i e n d s I have i n s i d e and outside the department and my cli m b i n g buddies. They are pa r t of my mostly great experiences here i n Vancouver. I am f o r e v e r g r a t e f u l to my parents and my s i s t e r Miao L i and her fam i l y (Wu Liang and l i t t l e Nathan) f o r t h e i r u n c o n d i t i o n a l love and support. A very s p e c i a l thanks to my supportive, understanding and b e a u t i f u l fiancé L i l i f o r sharing her l i f e w i t h me. I would l i k e to dedicate t h i s t h e s i s to my l a t e grandmother who had helped to b r i n g me up i n the f i n e s t Chinese t r a d i t i o n s : honesty, kindness and modesty. Chapter I Enzymes of mRNA decay in Escherichia coli The degradation of messenger RNA (mRNA) i s one of the l a s t aspects of gene r e g u l a t i o n to be f u l l y appreciated. Only during the past decade has i t been r e a l i z e d that 1. the c o n t r o l l e d turnover of mRNAs permits quick response to changes i n i n t e r n a l or e x t e r n a l c o n d i t i o n s ; 2. the degradation process i s not merely an u n s o p h i s t i c a t e d combination of rib o n u c l e a s e a t t a c k s on any a c c e s s i b l e mRNA but an i n t r i c a t e process i n v o l v i n g m u l t i p r o t e i n machines, which are capable of degrading s t r u c t u r e d RNAs; 3. the enzymes of RNA pr o c e s s i n g are a l s o important i n mRNA decay. In Escherichia coli, and q u i t e l i k e l y i n other prokaryotes, the h a l f - l i v e s of mRNAs range from 30 seconds t o 20 minutes, much s h o r t e r than those i n eukaryotes. The r e l a t i v e s t a b i l i t y of a given mRNA exerts s i g n i f i c a n t e f f e c t s on i t s steady-state l e v e l s , c o n t r o l s expression of the corresponding gene ( N i e r l i c h and Murakawa, 1996), c o n t r i b u t e s to d i f f e r e n t i a l e xpression from p o l y c i s t r o n i c mRNAs (Belasco et al., 1985), and a m p l i f i e s negative c o n t r o l of gene expression. There are over twenty ribonuclease (RNase) a c t i v i t i e s i d e n t i f i e d i n Escherichia coli, i n c l u d i n g 15 known ribon u c l e a s e s whose genes are i d e n t i f i e d (reviewed i n Deutscher, 1993b; Cheng et al., 1998; L i et al., 1999; Zuo and Deutscher, 2001; t a b l e 1.1). Two endoribonucleases (RNase E and RNase I I I ) and three exoribonucleases (RNase I I , po l y n u c l e o t i d e phosphorylase and o l i g o r i b o n u c l e a s e ) d i r e c t l y p a r t i c i p a t e i n mRNA decay. A t h i r d endoribonuclease, RNase G, may pl a y a l i m i t e d r o l e . Other RNases are mainly i n v o l v e d i n tRNA p r o c e s s i n g and maturation of ribosomal RNAs and small s t a b l e RNAs such as Ml RNA and Table 1.1 Ribonuclease i n Escherichia coli A c t i v i t y Function Comments Endo-RNases RNase I RNase III a RNase E a RNase G RNase H RNase HII RNase P scavenger mRNA decay rRNA processing mRNA decay rRNA processing 16S rRNA 5'end DNA r e p l i c a t i o n tRNA 5'ends p e r i p l a s m i c dsRNA major endo-RNase ssRNA s p e c i f i c homolog of RNase E removal of RNA Primers ribozyme Exo-RNases RNase II RNase BN RNase D RNase PH RNase R RNase T PNPase3 Oligo-RNase3 mRNA decay tRNA 3'ends tRNA 3'ends tRNA 3'ends ? tRNA, 5S rRNA mRNA decay mRNA decay h y d r o l y t i c • h y d r o l y t i c h y d r o l y t i c p h o s p h o r o l y t i c h y d r o l y t i c h y d r o l y t i c p h o s p h o r o l y t i c h y d r o l y t i c a. Enzymes that are i n v o l v e d i n mRNA decay are i n b o l d face. b. A i l enzymes i n t h i s category are 3' to 5' exonucleases. tmRNA (Deutscher, 1993a; Deutscher and L i , 2000) . Emerging evidence a l s o p o i n t s to the importance of poly(A) polymerase, RNA h e l i c a s e s and p o s s i b l y other p r o t e i n f a c t o r s i n promoting mRNA turnover. This chapter reviews the s t r u c t u r a l and f u n c t i o n a l d e t a i l s of the enzymes of mRNA decay and other p r o t e i n f a c t o r s . In a d d i t i o n , i t disc u s s e s t h e i r r o l e s i n mRNA decay. 1.1 The endoribonucleases 1.1.1 RNase E Over 20 years ago, David A p i r i o n and h i s colleagues f i r s t d e s c r i b e d an e n d o r i b o n u c l e o l y t i c a c t i v i t y which was r e q u i r e d to process 9S RNA to pre-5S RNA, the immediate precursor t o 5S ribosomal RNA (rRNA) (Misra and A p i r i o n , 1979). The same l a b o r a t o r y a l s o i d e n t i f i e d a temp e r a t u r e - s e n s i t i v e mutant, rne-3071, which a b o l i s h e d 9S RNA proc e s s i n g at nonpermissive temperatures (Ghora and A p i r i o n , 1978). In the meantime, Ono and Kuwano independently d i s c o v e r e d another te m p e r a t u r e - s e n s i t i v e mutant, which they termed ams-1 f o r a l t e r e d mRNA s t a b i l i t y (Ono and Kuwano, 1979) . L a t e r , the two mutants were found to be a l l e l i c t o each other (Mudd et a l . , 1990), (Babitzke and Kushnér, 1991) . When the rne gene was f i n a l l y cloned a f t e r s e v e r a l unsuccessful attempts, i t was i n a d v e r t e n t l y named hmpl s i n c e the authors were o r i g i n a l l y l o o k i n g at the problem from a d i f f e r e n t p e r s p e c t i v e (Casaregola et al., 1992 and see t e x t below). For the purpose of c l a r i t y and i n accordance w i t h the standards of the f i e l d , the gene i s r e f e r r e d as rne and i t encodes the Rne pol y p e p t i d e . RNase E r e f e r s to the e n d o n u c l e o l y t i c a c t i v i t y . One of the f i r s t c l u es to the involvement of RNase E i n mRNA decay was the obs e r v a t i o n that the ams-1 mutation s i g n i f i c a n t l y increased the h a l f - l i v e s of bulk mRNA (Ono and Kuwano, 1979). Evidence has since been emerging s t e a d i l y that RNase E i s r e s p o n s i b l e f o r i n i t i a t i o n of turnover of many RNA species, f o r example, RNA I of the ColEI plasmid, phage T4 gene 32 mRNA, ompA mRNA, rpsO mRNA, rpsT mRNA, etc (Coburn and Mackie, 1999 and r e f . t h e r e i n ) . I t has become c l e a r that RNase E i n i t i a t e s bulk mRNA decay i n E. coli. E a r l y attempts to clone the rne gene and to c h a r a c t e r i z e the Rne p r o t e i n were l a r g e l y u n s u c c e s s f u l . The f a c t that RNase E i s s e n s i t i v e to p r o t e o l y s i s and the p r o t e o l y t i c fragments o f t e n r e t a i n r e s i d u a l a c t i v i t y has l e d to confusion about the le n g t h of Rne p r o t e i n . In one extreme case, a p r o t e o l y t i c fragment was mistakenly i d e n t i f i e d as a new endoribonuclease, RNase K. This l a t e r proved to c o n t a i n the N-terminal p o r t i o n of the Rne p r o t e i n (Lundberg et al., 1990; Lundberg et al., 1995) . Several r e p o r t s of the rne gene sequence were a l s o i n a c c u r a t e , c o n t a i n i n g only p a r t i a l sequences (Ray and A p i r i o n , 1980; Chanda et a l . , 1985; C l a v e r i e - M a r t i n et al., 1991). F i n a l l y , the rne gene i n i t s e n t i r e t y was cloned by a group searching f o r a my o s i n - l i k e p r o t e i n (Hmpl) using a yeast anti-myosin heavy chain antibody t o screen an E. coli l i b r a r y (Casaregola et al., 1992). The s u c c e s s f u l c l o n i n g of the rne gene, a f t e r a few a d d i t i o n a l e r r o r s i n the sequence were n o t i c e d and co r r e c t e d , has e s t a b l i s h e d the f u l l l e ngth of the Rne p r o t e i n as 1061 amino a c i d residues (Cormack et a l . , 1993; Casaregola et a l . , 1994). One of the b e n e f i t s of i d e n t i f y i n g the c o r r e c t s i z e of Rne i s that researchers are now able to monitor the i n t e g r i t y of the p r o t e i n during p u r i f i c a t i o n . The problems of p r o t e o l y s i s during p u r i f i c a t i o n can be circumvented by i n c l u d i n g protease i n h i b i t o r s and r a p i d work at 4 °C. Despite these precautions, RNase E a c t i v i t y i s u s u a l l y a s s o c i a t e d w i t h high molecular weight complexes which are prone to aggregation. A method was devised i n our l a b o r a t o r y t o p u r i f y the p r o t e i n on SDS-PAGE p r e p a r a t i v e g e l s and renature the ri b o n u c l e a s e a c t i v i t y (Cormack et al., 1993). Using t h i s method, members of our l a b o r a t o r y have s u c c e s s f u l l y obtained h i g h l y p u r i f i e d Rne p r o t e i n and demonstrated that RNase E a c t i v i t y i s the inherent p r o p e r t y of the 1061 residue Rne p r o t e i n (Cormack et al... , 1993) . The disadvantage of the g e l - p u r i f i c a t i o n method i s that only a f r a c t i o n of the p u r i f i e d Rne p r o t e i n i s f u l l y a c t i v e . Despite e f f o r t s of s e v e r a l groups, producing h i g h l y homogenous and h i g h l y a c t i v e RNase E i s s t i l l p r oblematic. The Rne p r o t e i n i s composed of roughly three f u n c t i o n a l regions (domains) : the N-terminal r e g i o n (residues 1-500) , the c e n t r a l region (residues 500-750), and the C-terminal t a i l (residues 750-1061) (Fig 1.1, a l s o see Chapter I I I ; T a r a s e v i c i e n e et al., 1995; McDowall and Cohen, 1996). I t i s evident that the N-terminal r e g i o n contains the c a t a l y t i c s i t e of RNase E. The two te m p e r a t u r e - s e n s i t i v e mutations, ams-1 and rne-3071, are l o c a t e d at codons 66 and 68, r e s p e c t i v e l y (McDowall et a l . , 1993) . N-terminal regions of RNase E homologs from Haemophilis influenzea Rd, Synechocystis sp, and others share s i g n i f i c a n t i d e n t i t y w i t h that of E. coli RNase E (Fleischmann et al., 1995; Kaberdin et a l . , 1998). More s i g n i f i c a n t l y , recent work shows that RNase G, homologous to the N-terminal r e g i o n of RNase E, d i s p l a y s RNase E - l i k e a c t i v i t y ( L i et a l . , 1999; J i a n g et al., 2000; Tock et a l . , 2000). Data i n Chapter I I I show that an N-terminal d e l e t i o n d e r i v a t i v e of Rne l a c k i n g the f i r s t 207 a.a. r e t a i n s p a r t i a l a c t i v i t y . Another r a m i f i c a t i o n of the d i s c o v e r y of RNase G i s that the 'RNase K' a c t i v i t y i s p o s s i b l y d e r i v e d from RNase G i n s t e a d of a p r o t e o l y s i s fragment of RNase E as p r e v i o u s l y suggested. This can be c l a r i f i e d by t e s t i n g f o r (RNase K' a c t i v i t i e s i n an RNase G" E. coli s t r a i n . N-terminal Central C-terminal Rne S 1 T ams-1 rne-3071 A r g - r i c h D+E 6 0 0 7 5 0 R h l B D 7 3 4 738 e n o l a s e 1 0 6 1 m 7 3 9 8 4 5 P N P a s e [ 8 4 4 1 0 4 5 Figure 1.1 Sequence and functional features of the Rne protein The Rne p r o t e i n i s composed of three regions: N-terminal, c e n t r a l and C-terminal. The c h a r a c t e r i s t i c s of each r e g i o n are denoted above the schematic drawing of the Rne p r o t e i n . The two t s mutations (ams-1 and rne-3071) are i n d i c a t e d . The coordinates of the a r g i n i n e - r i c h (Arg-ri c h ) domain are shown. For the C-terminal r e g i o n , the p o s i t i o n s of i n t e r a c t i o n w i t h RhlB, enolase and PNPase are shown s e p a r a t e l y , based on the data of Vanzo et al.(1998). I n t e r e s t i n g l y , an SI RNA-binding motif i s found between residues 35 and 125. The SI RNA-binding motif, f i r s t i d e n t i f i e d i n 6 repeats i n ribosomal p r o t e i n SI, i s thought to be an ancient n u c l e i c a c i d - b i n d i n g f o l d . A s o l u t i o n s t r u c t u r e of the SI domain i n PNPase has been determined by NMR spectroscopy (Bycroft et a l . , 1997). The s t r u c t u r e i s a f i v e - s t r a n d a n t i p a r a l l e l (3 b a r r e l and p u t a t i v e RNA contacts are assigned to conserved residues on one s i d e of the b a r r e l ( F i g . 1.2; B y c r o f t et al., 1997) . The importance of the SI domain i n RNase E i s dis c u s s e d i n Chapter I I I and i s c u r r e n t l y under f u r t h e r i n v e s t i g a t i o n i n our l a b o r a t o r y (D. B r i a n t , personal communication). The r e g i o n immediately f o l l o w i n g and p a r t i a l l y o v e r l a p p i n g the SI domain i s h i g h l y hydrophobic and was i n i t i a l l y thought to resemble a 'transmembrane' h e l i x [residues 113-131 (Casaregola et al., 1992)]. However, there i s no experimental evidence to s u b s t a n t i a t e t h i s idea. A recent r e p o r t f i n d s that RNA degradosomes (see below), i n which RNase E serves as the s c a f f o l d f o r other components, a s s o c i a t e w i t h the cytoplasmic membrane v i a the N-terminal r e g i o n of RNase E (Liou et al., 2001) . This 'anchoring' e f f e c t i s p o s s i b l y due to i n t e r a c t i o n between one or more exposed hydrophobic regions of Rne and the inner membrane. The prominent f e a t u r e i n the c e n t r a l r e g i o n i s the high c o n c e n t r a t i o n of b a s i c residues (mainly a r g i n i n e s ) . An a r g i n i n e - r i c h RNA-binding domain (RBD) i s l o c a t e d w i t h i n t h i s r e g i o n (Cormack et al., 1993; T a r a s e v i c i e n e et al., 1995; McDowall and Cohen, 1996; see Chapter I I I ) . F i r s t i d e n t i f i e d i n the N p r o t e i n of X phage, a r g i n i n e - r i c h m o t i f s are i n v o l v e d i n many s p e c i f i c RNA-protein i n t e r a c t i o n s . In t h i s case, the RBD binds RNAs r e l a t i v e l y n o n s p e c i f i c a l l y v i a e l e c t r o s t a t i c i n t e r a c t i o n (See Chapter I I I ) . Figure 1.2 The putative RNA-binding residues in the Si domain The NMR s t r u c t u r e of SI domain of the PNPase shows the p o s i t i o n s of p o s s i b l e RNA-binding residues, Phel9, Phe22, His34, Asp64 and Arg68 ( l a b e l l e d by arrows and coloured i n re d ) . The N-and C-terminal e x t r e m i t i e s of the SI domain are als o i n d i c a t e d (Bycroft et al, 1997; PDB entry 1SR0) The C-terminal t a i l of the Rne p r o t e i n i s h i g h l y a c i d i c and s u s c e p t i b l e to p r o t e o l y s i s . The s i g n i f i c a n c e of the C-terminal t a i l was not r e a l i z e d u n t i l the Carpousis group showed that i t f u n c t i o n s as a s c a f f o l d i n g p l a t f o r m f o r the assembly of the RNA degradosome: the RNA h e l i c a s e RhlB binds between residues 734-738; enolase between residues 739-845; PNPase between residues 845-1061 (Vanzo et al., 1998) (Fig.1. 3) . RNase E a c t i v i t y r e q u i r e s Mg2* or other d i v a l e n t metal ions (eg. Mn2+) . I t cleaves AU-rich s i n g l e - s t r a n d e d RNA. A consensus sequence f o r RNase E cleavage s i t e , (A/G)4AUU(A/U) , has been proposed (Mackie, 1991; Ehretsman et a l . , 1992). However, i t i s not s t r i c t l y conserved. The cleavage s i t e i s o f t e n f l a n k e d by stem-loops, which may serve to guide the r e c o g n i t i o n (Mackie and Genereaux, 1993). The preference f o r AU-r i c h sequences has l e d to a c l a i m that RNase E may f u n c t i o n as a deadenylase, trimming the poly(A) t a i l s of mRNAs (Huang et al.,.1998). This a c t i v i t y , however, i s not e x o n u c l e o l y t i c (Walsh et a l . , 2001) and may not be p h y s i o l o g i c a l l y s i g n i f i c a n t (Mohanty and Kushner, 2000b). One of the unexpected f i n d i n g s i n p r o k a r y o t i c mRNA decay i s the dis c o v e r y that RNase E i s a 5'-end-dependent endonuclease (Mackie, 1998; Mackie, 2000). A set of e l e g a n t l y executed experiments demonstrated in vitro that c i r c u l a r d e r i v a t i v e s of n a t u r a l RNAs (rpsT mRNA or 9S RNA) c o n t a i n i n g RNase E cleavage s i t e s are much more r e s i s t a n t to RNase E cleavage than the l i n e a r p a r e n t a l RNAs. A d d i t i o n a l l y , annealing of oligodeoxynucleotides complementary to 5'-ends of l i n e a r RNAs to cre a t e p a r t i a l heteroduplex substrates s i g n i f i c a n t l y impairs RNase E att a c k i n d i s t a l regions of the su b s t r a t e s . Furthermore, 5'-monophosphorylated RNAs are much more RNase E RhlB Enolase PNPase 734-738 739-«45 844-1045 N-terminai domain ARRBD C-terminal interaction domain (catalytic) Figure 1.3 The components of the RNA degradosome A schematic drawing of the RNA degradosome complex shows the r e l a t i v e p o s i t i o n s of the components. RNase E i s shown as a dimer w i t h three f u n c t i o n a l domains ( c a t a l y t i c , RNA-binding and p r o t e i n - i n t e r a c t i o n ) . RhlB i s shown as a dimer, enolase a dimer and PNPase a t r i m e r . s u s c e p t i b l e to RNase E cleavage than 5 ' - t r i p h o s p h o r y l a t e d species (Mackie, 1998) . Jn vi v o , c i r c u l a r RNA s are a l s o 4-6 f o l d more s t a b l e than l i n e a r RNAs (Mackie, 2000). N a t u r a l RNAs c o n t a i n a triphosphate group at t h e i r 5'-ends. This makes i n i t i a l cleavage of t r i p h o s p h o r y l a t e d RNAs the r a t e - l i m i t i n g step. This cleavage r e s u l t s i n a 5'-monophosphate on the 3'-product and a 3'-hydroxyl group on the 5'-product. This a l l o w s r a p i d 'follow-up' cleavages by RNase E and by exonucleases. Some other r a t e - l i m i t i n g steps caused by RNA-binding p r o t e i n s may precede RNase E b i n d i n g to the 5' ends and thus become the rate-determining step. However, i t i s g e n e r a l l y considered that the i n i t i a l RNase E cleavage i s the rate-determining step i n the decay of most i f not a l l mRNA i n E. coli. The f i n d i n g that RNase E i s a 5'-end-dependent endonuclease provides an answer to long-standing mystery of the ' a l l or none' nature of mRNA decay i n E. coli ( N i e r l i c h and Murakawa, 1996; Mackie, 1998). The preference f o r 5'-monophosphate i s the property of the N-terminal r e g i o n of the Rne p r o t e i n and the ex-ter m i n a i r e g i o n i s dispensable (Jiang et al., 2000; Tock et al., 2000). The property of 5'-end-dependence i s now the hallmark of RNase E - l i k e a c t i v i t i e s . RNase E represses i t s own syn t h e s i s by reducing the con c e n t r a t i o n of rne t r a n s c r i p t s in vivo ( J a i n and Belasco, 1995) . This a u t o r e g u l a t i o n i s mediated i n c i s by a conserved stem-loop s t r u c t u r e i n the 5' UTR of the rne t r a n s c r i p t (Diwa et al., 2000). S u r p r i s i n g l y , the N-terminal p o r t i o n of the Rne p r o t e i n (residues 1-498) i s only 3% as e f f e c t i v e i n feedback c o n t r o l as the f u l l - l e n g t h p r o t e i n (Jiang et al., 2000). The C-terminal p o r t i o n of the Rne p r o t e i n , although not re q u i r e d f o r the c a t a l y t i c a c t i v i t y , i s somehow able to enhance the feedback c o n t r o l . This may be a r e f l e c t i o n of the presence of the A r g - r i c h RBD i n the f u l l l e n g t h p r o t e i n (Jiang et al., 2000). Not only i s RNase E an enzyme of mRNA decay, i t i s a l s o important f o r RNA processing. In a d d i t i o n to i t s r o l e i n 9S RNA pro c e s s i n g , RNase E i s now known to be i n v o l v e d i n the 5'-end maturation of 16S rRNA ( L i et a l . , 1999). A f t e r the RNase I l l - c l e a v a g e that separates the two rRNA species, RNase E cleaves 66 nt upstream of the mature 5'-end of 16S rRNA. The r e s u l t a n t 5'-end i s f u r t h e r processed by RNase G ( L i et a l . , 1999). Furthermore, RNase E i s r e q u i r e d f o r 3' p r o c e s s i n g of tmRNA (Lin-Chao et a l . , 1999), Ml RNA, the c a t a l y t i c subunit of RNase P (Kim et a l . , 1999), and l i k e l y most tRNAs. The mu l t i t u d e of fu n c t i o n s of RNase E accounts f o r i t s being e s s e n t i a l f o r c e l l s u r v i v a l . 1.1.2 The RNA degradosome The d i s c o v e r y of the RNA degradosome presents a s i g n i f i c a n t f i n d i n g that r a i s e s as many questions as answers. During the course of searching f o r an e f f i c i e n t p u r i f i c a t i o n of RNase E, A.J. Carpousis found that PNPase c o p u r i f i e d w i t h RNase E (Carpousis et a l . , 1994). Lat e r , two other p r o t e i n s , RhlB and enolase, were i d e n t i f i e d as components of l a r g e complex c o n t a i n i n g RNase E and PNPase (Py et a l . , 1996), (Miczak et a l . , 1996). RhlB i s a DEAD-box RNA h e l i c a s e (see s e c t i o n 1.3.2). Enolase i s a g l y c o l y t i c enzyme whose f u n c t i o n i n mRNA decay i s unknown. The complex i s named the RNA degradosome (Py et a l . , 1996) . Other p r o t e i n s such as polyphosphate kinase and DnaK are found i n the degradosome, but i n s u b - s t o i c h i o m e t r i c q u a n t i t i e s w i t h no apparent f u n c t i o n s assigned (Miczak et a l . , 1996; Blum et a l . , 1997). In the degradosome, the C-terminal p o r t i o n of RNase E serves as the s c a f f o l d f o r the assembly of the complex (Vanzo e t a l . , 1998; Kaberdin et a l . , 1998; F i g . 1.3). In vitro, RhlB and PNPase r e a d i l y form a "minimal degradosome' w i t h RNase E i n the absence of the n u c l e o l y t i c a c t i v i t y of RNase E (Coburn et al., 1999). The a c t i o n of the 'minimal degradosome' against high s t r u c t u r e d RNA 3'-ends has been e s t a b l i s h e d (see s e c t i o n 1.5.2). In vivo, however, the r o l e of degradosome i s undefined. The p u z z l i n g observation that a mutant expressing a truncated RNase E l a c k i n g the C-terminal p o r t i o n i s s t i l l v i a b l e and that mRNA turnover i s l a r g e l y u n a f f e c t e d r a i s e s so f a r unanswered questions about the r o l e of the degradosome in vivo (Kido et al. , 1996) . 1.1.3 RNase III RNase I I I i s a unique endoribonuclease that cleaves double-stranded RNAs. F i r s t d iscovered i n E. coli, i t serves a primary r o l e i n the maturation of ribosomal RNAs (reviewed i n Nicholson, 1999). By d i g e s t i n g a h a i r p i n s t r u c t u r e f l a n k i n g the 23S and 16S rRNAs, RNase I I I a c t i v i t y l i b e r a t e s the immediate precursors of 23S and 16S RNAs. This enzyme i s not e s s e n t i a l i n E. coli but i s c r i t i c a l f o r v i a b i l i t y i n B. subtilis (Babitzke et al., 1993; Wang and Bechhofer, 1997). I t s a c t i v i t y i s a l s o important f o r bacteriophage RNA pro c e s s i n g i n E. coli (Nicholson, 1999). The equivalent of RNase I I I i n yeast, Rntlp, plays a key r o l e i n the maturation of snoRNAs (Chanfreau et al., 1998). RNase I I I i s known to i n i t i a t e degradation of some mRNAs. I t cleaves stem-loop s t r u c t u r e s w i t h i n the 5' UTR of the primary t r a n s c r i p t s of the rnc-era-recD, rpsO-pnp, and metY-musA-infB opérons, r e s u l t i n g i n a c c e l e r a t e d turnover (Régnier and Grunberg-Manago, 1990). The a c t i o n of RNase I I I removes 5' s t a b i l i z i n g elements and leaves a 5'-monophosphate, t r i g g e r i n g mRNA decay by other ribonucleases (e.g., RNase E). The cleavage i n the 5' UTR of the RNase I l l - e n c o d i n g rne gene a l s o exerts a feedback a u t o r e g u l a t i o n of RNase I I I a c t i v i t y . In another instance, RNase I I I cleaves a h a i r p i n s t r u c t u r e i n the 3'-UTR of lambda phage i n t e g r a s e mRNA, thus removing an ob s t a c l e f o r 3' exoribonucleases at the 3'-end (Gottesman et a l . , 1982). Sense-antisense RNA duplexes can a l s o be the ta r g e t s of the RNase Ill-dependent degradation process (Wagner and Simons, 1994) . In E. coli, RNase I I I p l a y s at best a minor r o l e i n bulk mRNA turnover, demonstrated by m i l d phenotype of an RNase I I I " s t r a i n and the r a r e occurrence of RNase I I I s i t e s i n mRNAs. Developments i n the phenomenon of RNA i n t e r f e r e n c e (RNAi) have shed l i g h t on an unusual f u n c t i o n of RNase I I I f a m i l y nucleases i n eukaryotes. G e n e - s i l e n c i n g d i r e c t e d by 21-23 nt dsRNA i s a new arena of r e g u l a t i o n of gene expression (Sharp, 1999; Carthew, 2001). T r a n s c r i p t i o n from transgenes or transposons produces RNA templates f o r an RNA-directed RNA polymerase, which i n t u r n generates complementary RNAs which base-pair w i t h t h e i r templates. V i r a l i n f e c t i o n a l s o generates dsRNA. These dsRNAs are di g e s t e d i n t o 21-23 nt long ds fragments, or guide RNAs. The guide RNAs remain a s s o c i a t e d w i t h the nuclease and other cof a c t o r s to form a s t a b l e RNP complex. The RNP complex s p e c i f i c a l l y binds and degrades mRNA under the guidance of antisense s t r a n d of the dsRNA. Recently, B e r n s t e i n et al. have i d e n t i f i e d a Droso p h i l a ribonuclease, d i c e r , which produces the guide RNAs (Be r n s t e i n et al., 2001). D i c e r i s a member of the RNase I I I fa m i l y and i t s homologs are found i n worms, f l i e s , f u n g i , p l a n t s and mammals. In C. elegans, f o r example, the d i c e r homolog, drc-1, generates guide RNAs as a p r e r e q u i s i t e step f o r RNAi-mediated gene r e g u l a t i o n i n germ-line development (Grishok et al., 2001). RNase I I I i s encoded by the rne gene i n E. coli and f u n c t i o n s as a homodimer of two i d e n t i c a l subunits of 25.4 kDa (226 amino a c i d s ) . The p r o t e i n i s modular w i t h d i s t i n c t RNA-binding and c a t a l y t i c domains ( L i and Nicholson, 1996). The atomic s t r u c t u r e of dsRNA-binding domain (dsRBD) of E. coli RNase I I I has been solved by NMR spectroscopy. I t has an aPPPa topology w i t h the three a n t i p a r a l l e l P strands s i t u a t e d on one s i d e packed against the two a h e l i c e s on the other (Kharrat et al., 1995) . A study of the t h i r d dsRBD of Drosophila Staufen p r o t e i n y i e l d e d an NMR s t r u c t u r e of a dsRBD-RNA substrate complex (Ramos et al., 2000). The i n t e r a c t i o n w i t h dsRNA i s on the surface of the two a h e l i c e s . The residues i n the loops connecting Pl~P2 and p3-<x2 make d i r e c t contact w i t h the minor groove and the phosphate backbone of the RNA. Furthermore, the a l h e l i x i s found to i n t e r a c t w i t h the s i n g l e - s t r a n d e d loop r e g i o n of the h a i r p i n s t r u c t u r e . This c o n t r a s t s w i t h some other RNA b i n d i n g surfaces (e.g., SI, KH, RRM) where P-sheet s t r u c t u r e s contact RNA. 1.2 The 3'-5' exoribonucleases U n l i k e eukaryotes, there i s no 5'-3' exoribonuclease a c t i v i t y i n E.coli. Of the three 3'-5' exoribonucleases i n v o l v e d i n mRNA turnover i n E.coli, p o l y n u c l e o t i d e phosphorylase (PNPase) and RNase I I are f u n c t i o n a l l y redundant (Donovan and Kushner, 1986) whereas o l i g o r i b o n u c l e a s e i s e s s e n t i a l f o r c e l l v i a b i l i t y (Ghosh and Deutscher, 1999) . 1.2.1 Polynucleotide phosphorylase (PNPase) P o l y n u c l e o t i d e phosphorylase was o r i g i n a l l y discovered as a p o l y n u c l e o t i d e n u c l e o t i d y l t r a n s f e r a s e which c a t a l y z e s the p o l y m e r i z a t i o n of s i n g l e - s t r a n d e d RNA from n u c l e o t i d e diphosphates w i t h r e l e a s e of i n o r g a n i c phosphate (Grunberg-Manago, 1955; L i t t a u e r , 1982), as de s c r i b e d i n the f o l l o w i n g equation, (p5'N3'OH)M + pp5'N (p5'N3'OH)M+1 + Pi [Equation 1] where p stands f o r 5' phosphate group, N f o r r i b o n u c l e o t i d y l u n i t , OH f o r 3' hydroxyl group, M f o r the l e n g t h of RNA i n n u c l e o t i d e residues, and Pj. f o r i n o r g a n i c phosphate. Before the d i s c o v e r y of recombinant DNA technology PNPase was employed as a major t o o l to synthesize heteropolymers. In p a r t i c u l a r , PNPase was u t i l i z e d f o r the s y n t h e s i s of model mRNAs f o r the e l u c i d a t i o n of the g e n e t i c code. However, the p h y s i o l o g i c a l r o l e of PNPase was opaque (or overlooked) u n t i l Donovan and Kushner d e s c r i b e d that PNPase (along w i t h RNase II) i s e s s e n t i a l f o r mRNA turnover i n E. coli (Donovan and Kushner, 1986). Under p h y s i o l o g i c a l c o n d i t i o n s , the reverse r e a c t i o n i n equation 1 i s favoured: the enzyme phosphorylyzes s i n g l e - s t r a n d e d RNA t o r e l e a s e nucleoside diphosphates. Therefore, in vivo PNPase i s a p r i m a r i l y 3'-exoribonuclease but o c c a s i o n a l l y may f u n c t i o n s y n t h e t i c a l l y (Mohanty and Kushner, 2 000a). Decades a f t e r the enzymatic a c t i v i t y of PNPase was f i r s t d e scribed, Régnier et al. cloned and sequenced the corresponding pnp gene (Régnier et a l . , 1987) . The open reading frame i s l o c a t e d at 69 min on the E. coli chromosome l i n k e d to the rpsO gene, which encodes ribosomal p r o t e i n S15. I t features an UUG s t a r t codon which i s not uncommon f o r expr e s s i o n of E. coli p r o t e i n s (Régnier et a l . , 1987). Thus, the pnp gene encodes a 711 amino a c i d p r o t e i n . There have been r e p o r t s that the p r o t e i n i s composed of 734 amino a c i d s w i t h an AUG s t a r t codon, adding a N-terminal 23-amino-acid i n frame extension to the o r i g i n a l sequence ( B l a t t n e r et a l . , 1997; Symmons et a l . , 2000). This discrepancy i s l i k e l y caused by an annotation e r r o r which overlooked the UUG s t a r t codon. The upstream AUG ' s t a r t codon' has no Shine-Dalgarno sequence whereas there i s a good Shine-Dalgarno sequence 7 nts upstream (5'-AAGGA-3') from the UUG s t a r t codon (Régnier et a l . , 1987) . In a d d i t i o n , the N-terminus of PNPase was sequenced as Met-Leu-?-Pro, corresponding to a p r o t e i n s t a r t i n g from the UUG codon ( L i t t a u e r and Soreq 1982) . Therefore, i n t h i s d i s s e r t a t i o n the 'Régnier sequence' i s used as a b l u e p r i n t f o r f u n c t i o n a l s t u d i e s (Chapter IV) . The molecular weight of PNPase i s c a l c u l a t e d at 77.1 kDa and p i at 5.11 (using ProtPara t o o l at ExPASy; http://ca.expasy.org/cgi-bin/protparam). The a c i d i c nature of the monomer i s e x h i b i t e d by i t s re t a r d e d m i g r a t i o n at 86 kDa on SDS-PAGE g e l s . P u r i f i c a t i o n of PNPase was achieved us i n g s e v e r a l chromatographic methods before the sequence i n f o r m a t i o n was a v a i l a b l e (reviewed i n L i t t a u e r and Soreq, 1982). Based on the p u r i f i c a t i o n data i t was b e l i e v e d that PNPase contained two types of subunits, a and (3 ( P o r t i e r et al., 1973). The (3-subunit proved to be enolase, which a s s o c i a t e s with PNPase to form a 323 kDa a3p2 complex ( P o r t i e r , 1975) . S i g n i f i c a n t l y , a t r i m e r i c complex of a-subunits i s . f u n c t i o n a l l y r e q u i r e d . E l e c t r o n microscopic s t u d i e s have confirmed the t r i a n g u l a r complex with a c e n t r a l channel (Valentine et al., 1969). Recently, the c r y s t a l s t r u c t u r e of Streptomyces a n t i b i o t i c u s PNPase has been solved to provide atomic d e t a i l of the t r i a n g u l a r complex (Symmons et al., 2000; see s e c t i o n 1.2.2.2 and Chapter IV). The Pnp p r o t e i n i s expressed from two mRNAs, one from the promoter of the immediately upstream rpsO gene and the other from i t s own promoter (Régnier and P o r t i e r , 1986) . The expression of the pnp gene i n E.coli i s p o s t - t r a n s c r i p t i o n a l l y autoregulated (Robert-Le Meur and P o r t i e r , 1992) . This feedback c o n t r o l i s mediated by an RNase I I I cleavage i n 5' UTR of the pnp gene ( P o r t i e r et a l . , 1987). This process a f f e c t s both t r a n s c r i p t s e q u a l l y (Régnier and P o r t i e r , 1986). The au t o r e g u l a t i o n appears to occur at two l e v e l s . F i r s t , a pnp-LacZ f u s i o n mRNA c o n t a i n i n g the 5' UTR of the pnp gene remains r e l a t i v e l y s t a b l e even a f t e r RNase I I I p r o c e s s i n g (Robert-Le Meur and P o r t i e r , 1992; Robert-Le Meur and P o r t i e r , 1994). Only e l e v a t e d c e l l u l a r c oncentrations of PNPase s i g n i f i c a n t l y d e s t a b i l i z e s t h i s r e p o r t e r mRNA. Second, PNPase i n t e r a c t s w i t h i t s own mRNA, p o s s i b l y v i a the KH domain (Robert-Le Meur and P o r t i e r , 1994; Garcia-Mena et al., 1999). Mutations i n the ribosome b i n d i n g s i t e are able to a l l e v i a t e the r e p r e s s i o n by PNPase (Robert-Le Meur and P o r t i e r , 1994). Therefore, PNPase i s somehow able to suppress i t s own t r a n s l a t i o n as w e l l . At low temperature (15 °C) , the e f f i c i e n c y of a u t o r e g u l a t i o n decreases t o c o n t r i b u t e to c o l d -shock i n d u c t i o n of PNPase (Mathy et a l . , 2001; Beran and Simons, 2001). PNPase and other Pi-dependent exonucleases, i n c l u d i n g RNase PH, d i s p l a y s i g n i f i c a n t sequence i d e n t i t y , l i k e l y r e f l e c t i n g common o r i g i n s (Mian, 1997). Zuo and Deutscher, i n summarizing and c a t e g o r i z i n g exonuclease f a m i l i e s , have coined the term ' PDX' to de s c r i b e the RNase PH-homology domain and to emphasize the p h o s p h o r y l y t i c nature and wide d i s t r i b u t i o n of PNPase and RNase PH homologs (Zuo and Deutscher, 2001). The d e t a i l s of t h i s homology w i l l be discussed i n Chapter IV. B r i e f l y , the RNase PH-homology domains are l o c a t e d i n tandem between residues 1-541 and are connected by a l i n k e r ( F i g . 1.4) The C-terminus of the Pnp polypeptide contains two known RNA-bi n d i n g m o t i f s ( F i g . 1.4). The f i r s t i s a KH (hnRNP K-Homology) RNA-bi n d i n g motif (residues 551-591) (Burd and Dreyfuss, 1994). The s i z e of a KH motif i s normally 45-50 amino a c i d s ( A d i n o l f i et al., 1999; G r i s h i n , 2001) . KH mo t i f s o f t e n e x i s t i n m u l t i p l e copies, such as i n P H ' l inker PH P n p K H S1 591 622 210 310 312 541 551 D 690 Figure 1.4 Schematic representation of the Pnp protein Based on the sequence a n a l y s i s , the p u t a t i v e f u n c t i o n a l domains of the Pnp p r o t e i n are shown. In p a r t i c u l a r , the p o s i t i o n s of the RNA-binding mo t i f s KH and SI at the C-terminus are i n d i c a t e d . The d e t a i l s of the PH-homology re g i o n w i l l be discussed i n Chapter IV. v i g i l i n , or adjacent to other conserved sequence ( A d i n o l f i et al., 1999) . Such an arrangement i s thought to provide an extended RNA-b i n d i n g surface to bind n o n s p e c i f i c RNAs. In eukaryotes, there are se v e r a l examples of w e l l - d e f i n e d s t r u c t u r e s of KH m o t i f s . The f i r s t atomic s t r u c t u r e of KH motif solved i s from human F r a g i l e X syndrome-a s s o c i a t e d FRM1 p r o t e i n , d i s p l a y i n g a s t a b l e pacxPPcx f o l d (Musco et al., 1996.) . Based on a v a i l a b l e s t r u c t u r e s , G r i s h i n has p o i n t e d out that s t r u c t u r a l l y there are two types of KH domains ( G r i s h i n , 2001 and r e f therein) . Both types share a core Pctap f o l d w i t h type I c o n t a i n i n g a C-te r m i n a l Pa e x t e n s i o n and type I I an N-terminal cxp e x t e n s i o n ( G r i s h i n , 2001). An important f e a t u r e l i e s i n a f l e x i b l e loop connecting the two adjacent a h e l i c e s , an i n v a r i a n t Gly-X-X-Gly sequence (X i s u s u a l l y Arg, Lys or Gly) (Musco et al., 1996; Garcia-Mena et al., 1999). This element may be par t of a RNA-protein i n t e r f a c e which i s un s t r u c t u r e d i n i s o l a t e d form but acquires r i g i d i t y upon b i n d i n g RNA ( A d i n o l f i et al., 1999). Steven Burley's group has c r y s t a l l i z e d two KH-containing neuronal p r o t e i n s , Nova-1 and Nova-2 (Lewis et a l . , 1999). Each p r o t e i n contains three KH m o t i f s . The c r y s t a l s t r u c t u r e s of the KH3 domain of each p r o t e i n c l e a r l y show the exposed loop w i t h the Gly-X-X-Gly sequence. L a t e r , the Nova-2 KH3 motif was a l s o c o - c r y s t a l l i z e d w i t h an RNA h a i r p i n (Lewis et a l . , 2000 and F i g . 1.5). The s t r u c t u r e shows s p e c i f i c c o n t a c t s between the Gly-X-X-Gly motif and an UCAU t e t r a n u c l e o t i d e , o f f e r i n g a r a t i o n a l e f o r a s p e c i f i c KH-RNA i n t e r a c t i o n ( A d i n o l f i et a l . , 1999; Lewis et a l . , 2000). In a d d i t i o n , i n the c r y s t a l l a t t i c e the KH3 domains are arranged i n a tetramer, i n d i c a t i n g a p o t e n t i a l s e l f - a s s o c i a t i o n among arrayed KH m o t i f s ( F i g . 1.6). Figure 1.5 Noxra.2 KH3 domain interacting with an RNA hairpin A RasMol backbone r e p r e s e n t a t i o n shows Nova2 KH3 domain i n t e r a c t i n g w i t h a 20-mer RNA h a i r p i n . KH domains are i n grey and the RNAs i n blue. The loop c o n t a i n i n g the Gly-X-X-Gly consensus sequence i s i n d i c a t e d w i t h an arrow (Lewis et al., 2000; PDB entry 1EC6). Figure 1.6 Protein-protein interactions between KH domains The Nova KH3 domains are arranged i n a te t r a m e r i c formation i n the c r y s t a l , suggesting p o s s i b l e i n t e r a c t i o n between i n d i v i d u a l KH domains. The p o s i t i o n s of the loops c o n t a i n i n g the Gly-X-X-Gly sequence are i n d i c a t e d by arrows ( s l i g h t l y m odified from Lewis et al., 1999). As f a r as the E.coli PNPase KH motif i s concerned, a pnp-71 mutant produces a G to A t r a n s i t i o n which changes the f i r s t Gly of the Gly-X-X-Gly to Asp (Garcia-Mena et al., 1999). In vivo, the mutant PNPase increases the decay of a r e p o r t e r galK mRNA (encoding galactokinase) whose t r a n s c r i p t i o n i s moderated by a X sibl element placed between the promoter and the gene. On the other hand, a r e p o r t e r galK mRNA without the sibl element i s s t a b i l i z e d i n the pnp-71 background. The pnp-71 mutant a l s o causes accumulation of the mutant polypeptide because of an au t o r e g u l a t i o n d e f e c t . The mutation l i k e l y changes the RNA-binding c a p a c i t y of the Pnp polypeptide that leads to changes i n a f f i n i t y f o r d i f f e r e n t mRNAs. The mutant po l y p e p t i d e i n c e l l e x t r a c t s a l s o migrates d i f f e r e n t l y r e l a t i v e to the wi l d - t y p e PNPase i n na t i v e g e l s (Garcia-Mena et a l . , 1999). The authors argue that the change of e l e c t r o p h o r e t i c behaviour i n d i c a t e s a change i n p r o t e i n -p r o t e i n i n t e r a c t i o n by PNPase which may generate a d i f f e r e n t complex. I t could a l s o be a r e s u l t of su b t l e s t r u c t u r a l s h i f t s , s i n c e the loops c o n t a i n i n g Gly-X-X-Gly i n Nova KH3 tetramer appear to face away from each other (Lewis et a l . , 1999; Fig.1.6). Nonetheless, the evidence shows importance of the KH domain i n PNPase f u n c t i o n s (see t e x t below). The second RNA-binding motif i n PNPase i s the SI domain (residues 622-690). As discussed e a r l i e r , the SI domain assumes a f i v e - s t r a n d e d a n t i -p a r a l l e l P-barrel (Bycroft et al., 1997). The arrangement of KH and SI domains next to each other i s p a r t i c u l a r l y advantageous f o r RNA-binding. The t r a n s c r i p t i o n f a c t o r NusA of Thermotoga maritima contains an array of one SI domain and two KH domains i n i t s C-terminal h a l f (Worbs et al., 2001). I t s c r y s t a l s t r u c t u r e r e v e a l s that an N-terminal oc/p p o r t i o n and the three RNA-binding motifs generate an unbroken patch of p o s i t i v e charges (Worbs et al., 2001). The authors suggest that t h i s type of c l u s t e r arrangement, as s i m i l a r l y observed i n Nova p r o t e i n s , i s a paradigm f o r an extended RNA-binding surface formed by m u l t i p l e copies of RNA-binding motifs such as those i n SI ribosomal p r o t e i n (6 SI domains), human/chicken v i g i l i n (14 KH domains) and i n t h i s case, PNPase (1 KH domain and 1 SI domain) . The SI domain of PNPase may a l s o p l a y a r o l e i n c o l d shock adaptation. A mutant c o n t a i n i n g a quadruple d e l e t i o n of Csp genes (cspA, B, E and G) can be rescued by the PNPase SI domain (Xia et al., 2001). The P-barrel s t r u c t u r e of SI, s i m i l a r to those of CspA and CspB, may enable i t to f u n c t i o n as an RNA chaperone, a known r o l e of the Csp pr o t e i n s ( S c h i n d e l i n et a l . , 1994; J i a n g et al., 1997). C u r i o u s l y , PNPase i s a l s o a cold-shock i n d u c i b l e p r o t e i n (Jones et a l . , 1987) . In response to low temperature (10-15 °C) , the l e v e l of pnp t r a n s c r i p t s increases by as much as 10- f o l d and the t r a n s l a t i o n of the Pnp p r o t e i n increases g r a d u a l l y during the a c c l i m a t i o n phase (Zangrossi et a l . , 2000). Recently, i t has been found that c o l d shock i n d u c t i o n of PNPase i n E.coli and Y. e n t e r o c o l i t i c a c o n t r i b u t e s to s e l e c t i v e degradation of mRNAs encoding s p e c i f i c c o l d shock p r o t e i n s (CSPs) at the end of the a c c l i m a t i o n phase (Neuhaus et al., 2000; Yamanaka and Inouye, 2001). This demonstrates the n u c l e o l y t i c importance of PNPase at low temperature. 1.2.2 PNPases i n other organisms 1.2.2.1 Bacillus subtilis E a r l y s t u d i e s have demonstrated that 90% of the e x o r i b o n u c l e o l y t i c a c t i v i t y i n E. coli i s h y d r o l y t i c , w i t h PNPase accounting f o r only 10% of exonuclease a c t i v i t y (Chaney and Boyer, 1972; Deutscher and Reuven, 1991). In B. subtilis, the s i t u a t i o n i s l a r g e l y reversed. There i s no RNase I I equivalent i n B. subtilis. Rather, the e x o n u c l e o l y t i c mechanism i s l a r g e l y p h o s p h o r o l y t i c to recapture the energy of the phosphodiester bond. Thus, PNPase was proposed to take as prominent r o l e as RNase I I i n E. coli (Duffy et al. 1972; Deutscher and Reuven, 1991). I n t r i g u i n g l y , a B. subtilis s t r a i n w i t h the pnpA gene (encoding PNPase) de l e t e d i s s t i l l v i a b l e , although accumulation of RNA intermediates i s observed (Wang and Bechhofer, 1996) . A search f o r other exonucleases has l e d t o the suggestion that more than one enzyme may complement PNPase a c t i v i t y (Oussenko and Bechhofer, 2000) . These exonucleases are expressed at low l e v e l s and may be st i m u l a t e d i n the absence of PNPase. There i s a l s o no RNase E equivalent i n B. subtilis. An endonuclease, RNase M5, i s i n v o l v e d i n the maturation of 5S rRNA but i t i s n o n e s s e n t i a l (Condon et al., 2001) . The main endonuclease i s the double-strand s p e c i f i c RNase I I I , an e s s e n t i a l enzyme i n B. subtilis (Herskovitz and Bechhofer, 2000). Thus, mRNA decay i n B a c i l l i s presents a much d i f f e r e n t p i c t u r e than that i n E. coli. PNPases of E. coli and B. subtilis do share f u n c t i o n a l c h a r a c t e r i s t i c s besides high sequence s i m i l a r i t i e s (see Chapter IV) . Growth defects i n both E. coli and B. subtilis PNPase" s t r a i n s are rescued by recombinant B. subtilis PNPase (Wang and Bechhofer, 1996). B. subtilis PNPase i s unable to degrade a stem-loop s t r u c t u r e found i n a bacteriophage SP82 RNA both in vitro and i n vivo (Farr et a l . , 1999) . Although mRNA decay and i t s p a r t i c i p a n t s i n B. subtilis are not as w e l l understood as i n E. coli, i t would be i n t e r e s t i n g to see how a c e l l adapts i t s f u n c t i o n s to d i f f e r e n t energy environments and how a conserved enzyme such as PNPase behaves a c c o r d i n g l y . 1.2.2.2 Streptomyces antibioticus Another remarkable example of PNPase i s found i n Streptomyces antibioticus (Jones and Bibb, 1996). O r i g i n a l l y i d e n t i f i e d as guanosine pentaphosphate synthetase I (GPSI) , part of the Streptomyces a n t i b i o t i c - p r o d u c i n g mechanism, the p u r i f i e d enzyme i s able to c a t a l y z e the p o l y m e r i z a t i o n of ADP and phosphorolysis of poly (A) . The E. coli PNPase, on the other hand, does not synthesize pppGpp under the co n d i t i o n s favored by GPSI (Jones and Bibb, 1996). I n t e r e s t i n g l y , the GSPI a c t i v i t y i s a c t i v a t e d by l i m i t e d t r y p s i n p r o t e o l y s i s of the p r o t e i n and both GPSI and E. coli PNPase share a s i m i l a r t r y p t i c d i g e s t i o n p a t t e r n according to which the C-terminal RNA-binding motifs are severed (Jones, 1994 and see Chapter IV) . I t i s tempting to speculate that PNPase/GPSI of S. antibioticus e x i s t s i n two enz y m a t i c a l l y a c t i v e forms: a f u l l - l e n g t h form c o n t a i n i n g PNPase a c t i v i t y whereas a p r o t e o l y t i c fragment (without the C-terminal RNA-bin d i n g motifs) d e l i v e r s the GPSI f u n c t i o n ( s ) . Such a hypothesis p o i n t s to a s i g n i f i c a n t r o l e of the RNA-binding motifs i n the n u c l e o l y t i c mechanism of PNPase. A l t e r n a t i v e l y , the GPSI a c t i v i t y may be an a r t i f a c t (G. Jones, personal communication). More s i g n i f i c a n t l y , the s t r u c t u r e of PNPase/GPSI has been solved by X-ray c r y s t a l l o g r a p h y , • a f i r s t f o r the PNPase f a m i l y (Symmons et al., 2000). The s t r u c t u r e provides i n s i g h t s on s e v e r a l outstanding is s u e s which w i l l be discussed i n Chapter IV. 1.2.2.3 PNPase i n higher organisms In spinach, a c h l o r o p l a s t - l o c a l i z e d PNPase homologue, the plOO p r o t e i n , was p r e v i o u s l y thought to form a RNA 3'-end processing/decay complex w i t h an endoribonuclease, p67, and other components (Hayes et al., 1996). S p e c u l a t i o n about a p l a n t degradosome and the exi s t e n c e of the complex can no longer be s u b s t a n t i a t e d (G. Schuster, personal communication) . Nonetheless, PNPase does p l a y a r o l e i n RNA turnover i n the c h l o r o p l a s t . In garden pea, t h i s nuclear-encoded PNPase homologue i s a part of a novel c h l o r o p l a s t poly(A) polymerase complex, i n c l u d i n g a 43kDa p r o t e i n that c r o s s - r e a c t s w i t h antibody a g a i n s t yeast poly(A) polymerase ( L i et a l . , 1998). P o l y a d e n y l a t i o n a c c e l e r a t e s mRNA decay by the complex, drawing a c o r r e l a t i o n w i t h the process i n E.coli (Hayes et al., 1999). In the cytoplasm, mRNA decay employs a completely d i f f e r e n t set of mechanisms, i n v o l v i n g decapping, deadenylation, a 5' to 3' exoribonuclease ( X r n l ) , and the exosome (Gut i e r r e z et al., 1999), ( M i t c h e l l and T o l l e r v e y , 2001). Thus, cytoplasmic mRNA decay i n p l a n t s i s d i s t i n c t i v e l y e u k a r y o t i c , while i n s i d e the c h l o r o p l a s t the mechanism i s more a l i g n e d w i t h that i n E. coli. This l i k e l y r e f l e c t s the pr o k a r y o t i c l i n e a g e of the c h l o r o p l a s t . 1.2.3 RNase II In E. coli, RNase I I and PNPase are the 3'-5' exoribonucleases responsible f o r removal of RNA fragments generated by i n i t i a l e n d o n u c l e o l y t i c a t t a c k s . In cont r a s t to PNPase, RNase I I hydrolyzes s i n g l e - s t r a n d e d RNA p r o c e s s i v e l y from the 3'-end, r e l e a s i n g r i b o n u c l e o s i d e 5'-monophosphates. RNase I I a l s o shoulders the m a j o r i t y of t h i s task, accounting f o r over 90% of e x o n u c l e o l y t i c a c t i v i t i e s i n crude c e l l e x t r a c t s (Deutscher and. Reuven, 1991) . In a d d i t i o n , both enzymes, i n a d d i t i o n to m u l t i p l e exoribonucleases not i n v o l v e d i n the mRNA decay process, can p a r t i c i p a t e i n 3'-end maturation of sm a l l , s t a b l e RNAs (tRNAs, 5S rRNA, tmRNA, Ml RNA, etc) i n a l i m i t e d f a s h i o n ( L i and Deutscher, 1996; L i et al., 1998a). A double mutant s t r a i n (RNase I I C s , PNPase") i s i n v i a b l e and degradative intermediate are s t a b i l i z e d at non-permissive temperature, whereas a s i n g l e mutation ( e i t h e r RNase I I " or PNPase") i s not l e t h a l to the c e l l (Donovan and Kushner, 1986; Arraiano et a l . , 1988). This i l l u s t r a t e s the primary-r o l e of RNase I I and PNPase i n mRNA metabolism. U n l i k e RNase E or PNPase, the h i s t o r y of RNase I I research i s not as checkered. RNase I I i s encoded by the rnb gene, which has been s u c c e s s f u l l y cloned and sequenced (Zilhâo et al., 1993). A f t e r only minor c o r r e c t i o n s , the gene was found to code f o r a 644 amino a c i d p r o t e i n w i t h a molecular mass of 72.5 kDa (Coburn and Mackie, 1996). A prominent feature of the RNase I I sequence i s the presence of an SI RNA-binding domain at i t s C-terminus (Bycroft et a l . , 1997). A l s o , u n l i k e PNPase, RNase I I i s a monomer and i s not known to a s s o c i a t e w i t h other p r o t e i n s . RNase I I a c t i v i t y r e q u i r e s Mg2* and i s s t i m u l a t e d by monovalent ions such as K+ (Coburn and Mackie, 1996). I t p r e f e r s poly(A) and poly(U) over p o l y ( C ) , p o s s i b l y due to the l a t t e r ' s a b i l i t y to form secondary s t r u c t u r e s (Cannistraro and Kennell, 1994) . RNase I I d i s s o c i a t e s from i t s substrate when RNAs are only 10-15 n u c l e o t i d e s long. These o l i g o n u c l e o t i d e s i n turn can be degraded to 2-4 n u c l e o t i d e s i n a non-processive f a s h i o n by RNase I I (Cannistraro and K e n n e l l , 1994) Although i t has been p u r i f i e d from non-overexpressing s t r a i n s , more r e c e n t l y RNase I I has been s u c c e s s f u l l y overexpressed w i t h a 300-f o l d increase i n a c t i v i t y i n crude c e l l e x t r a c t s (Coburn and Mackie, 1996) . The recombinant p r o t e i n was r a p i d l y p u r i f i e d to homogeneity v i a a s e r i e s of chromatographic methods i n c l u d i n g a blue-agarose a f f i n i t y chromatography ( A f f i - G e l blue) as the f i r s t step (Coburn and Mackie, 1996). Minor improvements i n t h i s procedure have enabled the growth of small c r y s t a l s (S. Mosimann and P. Ling, personal communication). Not s u r p r i s i n g l y , l e v e l s of RNase I I i n the c e l l are a f f e c t e d by PNPase l e v e l s (Zilhâo et al., 1996). In PNPase" s t r a i n s , RNase I I a c t i v i t y i s r a i s e d 2 to 2.5-fold, whereas i n PNPase-overexpressing s t r a i n s the amount of rnb mRNA and RNase I I a c t i v i t y both drop. Vice versa, the PNPase a c t i v i t y i n RNase I I " c e l l s i s observed t o increase 2-f o l d . The balan c i n g act between the two exoribonuclease i s par t of a mechanism i n which the enzymes can s u b s t i t u t e f o r one another desp i t e s i g n i f i c a n t d i f f e r e n c e s i n c a t a l y t i c c h a r a c t e r i s t i c s . RNase I I l e v e l s are a l s o modulated by growth c o n d i t i o n s and by the product of an E.coli gene, gmr (Cairrao et a l . , 2001). The gmr gene does not appear to a f f e c t RNase I I at the mRNA l e v e l but at the l e v e l of p r o t e i n s t a b i l i t y . In gmr' c e l l s , the turnover of RNase I I p r o t e i n i s slower. 1.2.4 Ol igoribonuclease O l i g o r i b o n u c l e a s e i s another 3'-5' exoribonuclease whose p r o p e r t i e s remained unexplored f o r a long p e r i o d of time d e s p i t e i t s e a r l y d i s c o v e r y (Niyogi and Datta, 1975) . I t i s encoded by the orn gene and s t r u c t u r a l l y i s an a2 dimer of i d e n t i c a l 20.7 kDa subunits (Zhang et al., 1998). Oligoribonuclease i s s t i m u l a t e d by d i v a l e n t c a t i o n s (Mn2+, Mg2+) and i s most a c t i v e a g a i n s t short o l i g o r i b o n u c l e o t i d e s (-4 nts) (Niyogi and Datta, 1975) . Olig o r i b o n u c l e a s e i s e s s e n t i a l f o r c e l l s u r v i v a l as i n a c t i v a t i o n of the orn gene leads to c e l l death (Zhang et al., 1998). O l i g o r i b o n u c l e o t i d e s (2-5 nt) accumulate i n orn mutant c e l l s at non-permissive temperature (Ghosh and Deutscher, 1999) . These observations i n d i c a t e that o l i g o r i b o n u c l e a s e i s req u i r e d f o r removal of l i m i t r i b o n u c l e o t i d e s generated by RNase I I and PNPase and f o r the completion of the decay process. 1.3 Other enzymes 1.3.1 Poly(A) polymerase P o l y a d e n y l a t i o n at 3'-ends of p r o k a r y o t i c RNAs i s a r e l a t i v e l y r e c e n t l y recognized event (reviewed i n Sarkar, 1997). Although p u r i f i c a t i o n of the E. coli poly(A) polymerase was reported i n the 60's (August et a l . , 1962) and despite the presence of polyadenylated RNAs, po l y a d e n y l a t i o n i n prokaryotes a t t r a c t e d much l e s s a t t e n t i o n than t h a t i n eukaryotes (Sarkar, 1997 and references t h e r e i n ) . Shorter poly(A) t r a c t s i n prokaryotes (15-60A compared to 80-200A i n eukaryotes) and t h e i r r e l a t i v e l y infrequent occurrence ( i n only 1-40% of mRNAs) made i t d i f f i c u l t to a s c e r t a i n the p h y s i o l o g i c a l r o l e of p r o k a r y o t i c p o l y a d e n y l a t i o n (Sarkar, 1997) . The f i n d i n g s that the pcnB gene encodes poly(A) polymerase and that a mutation i n pcnB a f f e c t s the s t a b i l i t y of RNAI, the antisense r e g u l a t o r of colEI-type r e p l i c o n s , were the f i r s t i n t e r e s t i n g h i n t s of the r o l e of p o l y a d e n y l a t i o n i n mRNA decay (Cao and Sarkar, 1992; Xu et a l . , 1993). Poly(A) polymerase c a t a l y z e s the i n d i s c r i m i n a t e s e q u e n t i a l a d d i t i o n of adenylate residues to 3' hydoxyl groups of an RNA molecule. The r e a c t i o n f o l l o w s the equation: RNA+ATP—»RNA(A)n+PPi and r e q u i r e s Mg2+. The p r o t e i n has a molecular weight of 52 kDa and i s organized i n t o an N-terminal c a t a l y t i c domain, a C-terminal RNA-binding domain and s i t e s f o r p o t e n t i a l p r o t e i n - p r o t e i n i n t e r a c t i o n s (Raynal and Carpousis, 1999). Poly(A) polymerase i s a l s o r e f e r r e d to as poly(A) polymerase I (PAP I) to suggest that there may be a d d i t i o n a l p o l y a d e n y l a t i n g enzymes i n E. coli. A second poly(A) polymerase a c t i v i t y , PAP I I , found i n a pen' background, was claimed to be encoded by the fl30 gene (Cao et a l . , 1996). However, t h i s n o t i o n was disproven by others (Mohanty and Kushner, 1999b) . I t i s more l i k e l y that 'PAP I I ' i s tRNA n u c l e o t i d y l t r a n s f e r a s e . PNPase may a l s o be able to extend an RNA's 3' t a i l under favorable, c o n d i t i o n s a l b e i t w i t h non-homogenous t r a c t s i n c l u d i n g C and U i n a d d i t i o n to A (Mohanty and Kushner, 2000a). The s i g n i f i c a n c e of these a d d i t i o n a l poly(A) polymerase a c t i v i t i e s i s not yet c l e a r . In c o n t r a s t to the s i t u a t i o n i n eukaryotes, p o l y a d e n y l a t i o n i n prokaryotes leads to d e s t a b i l i z a t i o n of mRNAs. In vivo, overproduction of PAP I r e s u l t s i n a decrease i n h a l f - l i v e s of t o t a l RNAs and s p e c i f i c a l l y , i n the h a l f - l i v e s of rpsO, Ipp, trxA, ompA and rpsT mRNAs (Coburn and Mackie, 1998; Mohanty and Kushner, 1999a). I n t e r e s t i n g l y , mRNAs f o r RNase E and PNPase are s t a b i l i z e d . Prolonged overproduction of PAP I can lead to c e l l death. The 3'-ends of 23S rRNAs are extended by PAP I a c t i v i t i e s and thus the otherwise s t a b l e rRNAs may be d e s t a b i l i z e d (Mohanty and Kushner, 1999a). Moreover, the poly(A) l e v e l s i n the c e l l are modulated d i r e c t l y by RNase I I and PNPase. RNase E provides i n d i r e c t r e g u l a t i o n by generating new 3'-ends f o r po l y a d e n y l a t i o n (Feng and Cohen, 2000; Mohanty and Kushner, 2000b). Indeed, p o l y a d e n y l a t i o n s i t e s are not r e s t r i c t e d to t r u e 3'-ends of mRNA, as m u l t i p l e s i t e s are found w i t h i n the 3'-UTR or i n the coding sequence, r e s u l t i n g from e n d o n u c l e o l y t i c or e x o n u c l e o l y t i c processing (Haugel-Nielsen et al., 1996). A l t e r n a t i v e l y , RNase E may cleave poly(A) t a i l s e n d o n u c l e o l y t i c a l l y (Huang et al., 1998; Walsh et al., 2001). In the s t r a i n overproducing PAP I, the a d d i t i o n a l poly(A) t a i l s provide a d d i t i o n a l (excess) t a r g e t s f o r RNase E, l e a d i n g to i t s overproduction by r e l i e f of i t s a u t o r e g u l a t i o n (Mohanty and Kushner, 1999a). This could e x p l a i n the observation that h a l f - l i v e s of bulk mRNA are decreased i n t h i s s t r a i n . C u r i o u s l y , small s t a b l e RNAs such as 5S rRNA, Ml RNA and tmRNA can a l s o be polyadenylated at t h e i r 3'-ends i n a m u l t i p l e e x o n u c l e a s e - d e f i c i e n t background. Under such c o n d i t i o n s , these RNAs are not p r o p e r l y matured and are r a p i d l y degraded, a s s i s t e d by p o l y a d e n y l a t i o n ( L i et a l . , 1998a). 1.3.2 RhlB The presence of s t a b l e s t r u c t u r a l elements w i t h i n RNA sequences ( i n t e r n a l or at 3'-ends) that p o t e n t i a l l y could impede the a c t i o n of the p r o c e s s i v e 3' exoribonucleases has generated questions about the need f o r RNA h e l i c a s e s to unwind stem-loops and overcome these b a r r i e r s . The f i r s t p iece of evidence that an RNA h e l i c a s e i s i n v o l v e d i n mRNA decay i n E. coli was the f i n d i n g that RhlB, a p u t a t i v e DEAD-box h e l i c a s e , c o p u r i f i e s w i t h the RNA degradosome (Miczak et a l . , 1996; Py et a l . , 1996). RhlB i s a member of a p r o t e i n superfamily c o n t a i n i n g the motif DEAD (Asp-Glu-Ala-Asp) (Schmid and Linder, 1992).. This p r o t e i n f a m i l y a l s o i n c l u d e s a DEXH subfamily. The DEAD/DEXH motif i s thought to be capable of ATP-binding and h y d r o l y s i s (Schmid and L i n d e r , 1992). Other members of the f a m i l y are in v o l v e d i n a v a r i e t y of processes i n c l u d i n g ribosomal assembly (DbpA, N i c o l and F u l l e r - P a c e , 1995), t r a n s l a t i o n i n i t i a t i o n (eIF4A, Rogers et a l . , 1999) and RNA s p l i c i n g (Prp22p, Schwer and Gross, 1998) . Py et a l . f i r s t showed the ATP-dependent degradation of the h i g h l y s t r u c t u r e d malEF REP RNA ( F i g . 1.7) by p u r i f i e d degradosomes (Py et a l . , 1996). An t i b o d i e s against RhlB i n h i b i t e d the ATP-dependent degradation (Py et a l . , 1996). In our l a b o r a t o r y , Glen Coburn has demonstrated that in vitro ATP-dependent RhlB a c t i v i t y d i r e c t l y a s s i s t s d i g e s t i o n of h i g h l y s t r u c t u r e d RNA elements by PNPase i n the degradosome (Coburn et a l . , 1999). RNase E, whose c a t a l y t i c a c t i v i t y i s not re q u i r e d , serves as a s c a f f o l d (Vanzo et a l . , 1998; Coburn et a l . , A A G A c C c • G A A -U A A A . It C • G A . 11 '•I- A C - G €• G G • C G. C , c c G U u- A G U 0 • A 1] . A C s G 1 _ A c CG G C c- r. A * U A G c U G a C c - G G G U C C c; G c U - A A- U G c ^ G r _ A C G c- G Ci C G A U A G C G A G . C G C A A A.U A * t. A.U G U Au U-A G G C C A.U U-A c e G . C c,g c e _ -  C G C-G> AAAU • AGIlUGmiGUC- G — Ù - AAGAA . UACCGAGCUCGAAUtl 3' t t RSR * Figure 1.7 The secondary structure of the malEF REP RNA The complex stem-loops of the malEF REP element are shown. 'RSR' represents s t a l l i n g of PNPase at the base of the s t a b l e h a i r p i n i n the absence of the degradosome complex. i n d i c a t e s an intermediate s t a l l i n g p o i n t (Py et al., 1996; Coburn et al., 1999). 1999) . Remarkably, The i n t e r a c t i o n w i t h RNase E s t i m u l a t e s RhlB h e l i c a s e a c t i v i t y 1 5 - f o l d (Vanzo et al., 1998). Two more examples of DEAD/DEXH box p r o t e i n s i n v o l v e d i n RNA decay are found i n yeast. In yeast mitochondria, the 3'-5' exoribonuclease complex mtEXO contains a DEXH-box p r o t e i n Suv3p (Margossian et a l . , 1996). The mtEXO complex removes exci s e d group I i n t r o n s . D e l e t i o n of the SUV3 gene r e s u l t s i n the accumulation of s e v e r a l group I i n t r o n s (Margossian et al., 1996). The second example i n v o l v e s the exosome, a complex of small 3'-5' RNase I I - l i k e , RNase D - l i k e , and RNase PH-like exoribonucleases ( M i t c h e l l et a l . , 1997). In S. cerevisiae, exosome-mediated 3'-5' d i r e c t i o n a l degradation of mRNA r e q u i r e s the c o f a c t o r Ski2p, a DEVH-box p r o t e i n (Jacobs et al., 1998). Ski2p a l s o forms a complex w i t h Ski3p and Ski8p in vivo (Brown et al., 2000) . Both examples support the model that RNA h e l i c a s e s unwind RNA secondary s t r u c t u r e to f a c i l i t a t e the a c t i o n of s i n g l e s t r a n d - s p e c i f i c 3' exoribonucleases (Py et al., 1996), (Coburn and Mackie, 1998). 1.3.3 CsdA CsdA i s a 70 kDa cold-shock induced DEAD-box p r o t e i n (Jones et a l . , 1996). Formerly known as DeaD (Toone et al., 1991), CsdA can unwind dsRNA even i n the absence of ATP (Jones et al., 1996). I t s a s s o c i a t i o n w i t h ribosomes at low temperature has prompted the hypothesis that CsdA increases t r a n s l a t i o n a l e f f i c i e n c y by unwinding s t a b i l i z e d mRNA s t r u c t u r e (Jones et a l . , 1996). Evidence f o r involvement of CsdA i n mRNA s t a b i l i t y i s found i n a csdA n u l l mutant i n which Csp (cold-shock pr o t e i n ) mRNAs are s i g n i f i c a n t l y s t a b i l i z e d at low temperature (15 °C) (Yamanaka and Inouye, 2001) . Moreover, the s t a b i l i t y of cspA mRNA i s c o n t r o l l e d by PNPase (Yamanaka and Inouye, 2001) . This has r a i s e d the i n t e r e s t i n g concept of the exi s t e n c e of a 'cold-shock RNA degradosome' i n which RhlB i s re p l a c e d by CsdA. In vitro evidence has shown that CsdA forms a f u l l y f u n c t i o n a l complex w i t h RNase E and PNPase (A. Prud'homme-Généreux, perso n a l communication). Further s t u d i e s are underway t o evaluate t h i s phenomenon. In a d d i t i o n , poly(A) polymerase i s a l s o capable of i n t e r a c t i n g w i t h the DEAD-box p r o t e i n s CsdA, RhlE and SmrB (Raynal and Carpousis, 1999). The s i g n i f i c a n c e of these s u r p r i s i n g connections i s unclear. 1.4 Models of mRNA decay-David A p i r i o n f i r s t d escribed a simple model f o r mRNA decay i n E. coli ( F i g . 1.8A): mRNA decay i s i n i t i a t e d by r a t e - l i m i t i n g e n d o n u c l e o l y t i c c l e a v a g e ( s ) . This i s fol l o w e d by r a p i d removal of RNA intermediates by 3' exonucleases (RNase I I and PNPase). However s i m p l i s t i c , the A p i r i o n model a c c u r a t e l y p o i n t s out two main events which would be the major f o c i of subsequent research. Tremendous progress has been made i n the f i e l d ( F i g 1.8B) . In the f o l l o w i n g s e c t i o n s I w i l l attempt to make a concise summary on what i s known about the events i n mRNA turnover i n E.coli. 1.4.1 The 5'-end RNase E i s a 5 '-end-dependent enzyme (Mackie, 1998), (Mackie, 2000) . This property e x p l a i n s the importance of the s t a t u s of the RNA 5'-ends i n determining mRNA s t a b i l i t y . A 5 ' - t e t h e r i n g model was conceived by George Mackie before the d i s c o v e r y of 5'-dependence of RNase E (Coburn and Mackie, 1999). The model makes s e v e r a l p r e d i c t i o n s that the Rne p r o t e i n e x i s t s as a dimer i n the degradosome, that the Figure 1 . 8 Models of mRNA decay Panel A d e p i c t s the o r i g i n a l A p i r i o n model of mRNA decay. The endo-RNase was u n i d e n t i f i e d and the exo-RNases were b e l i e v e d to be RNase I I and PNPase. Panel B shows current t h i n k i n g . RNase E c a t a l y z e s the i n i t i a l r a t e - l i m i t i n g e n donucleolytic cleavages; i t s a c t i o n i s ac c e l e r a t e d by 5'-monophosphates on the i n i t i a l cleavage products. The secondary s t r u c t u r e at the 3'-end of many RNAs i s r e s i s t a n t to exo-RNases, but can be extended by PAP I and then degraded by PNPase i n the degradosome. The Apirion model of mRNA decay ^ Endo Q 5'-D • 11 V 5 . 3, (slow) I Endo 5._: 0 H 5..p.(fast) J , RNase ll/PNPase ^ Endo 5' > j Repeat the endo-exo cycle 1 V Mono and limit oligonucleotides The best current model 5'-ppp 1 (slow) ^ RNase E O 5-.ppp OH 5'-p • 1' 3-(fast) ^ RNase ll/PNPase (fast) ^ RNase E + Exos 5 , P P P £) Q Mono and limit oligonucleotides I R o ) y ( A ) p o | y m e r a s e • + ATP Mono and limit oligonucleotides 5'-p 11 AAAAAAAn Î ^ PNPase + RhlB + ATP * \ If (Degradosome) _n /jS) 5'-D ^ A A A A > ) PNPase RhlB / \ V — X ATP ADP+Pi c a t a l y t i c and RNA-binding s i t e s on each subunit of the dimer are a l t e r n a t i v e l y engaged i n a 'looping' a c t i o n and that a f t e r the endo n u c l e o l y t i c cleavage by RNase E, the RNA products may be r e t a i n e d by the degradosome f o r f u r t h e r a c t i o n by PNPase (5' product)(Coburn and Mackie, 1999). An a l t e r n a t i v e v e r s i o n of t h i s model p r e d i c t s that a 'phosphate pocket', which p r e f e r s 5'-monophosphate to triphosphate, i s d i s t i n c t from the c a t a l y t i c s i t e . As shown i n F i g . 1.9, RNase E f i r s t binds to a s i t e at or near the 5'-end ( s i t e 1). A s t r e t c h of si n g l e - s t r a n d e d RNA i s important f o r t h i s contact (Bouvet and Belasco, 1992; Mackie, 1998) . This step i s r a t e - l i m i t i n g due to the 5'-triphosphate and/or the presence of the secondary s t r u c t u r e at the 5'-end (Arnold et a l . , 1998; Mackie, 1998; B r i c k e r and Belasco, 1999) . As the mRNA i s tethere d by the f i r s t subunit, the second subunit of RNase E would recognize and cleave a d i s t a l s i t e ( s i t e 2). The newly generated 3'-end becomes the subs t r a t e of a conveniently s i t u a t e d PNPase or RNase I I . The 5'-monophosphate would be t i g h t l y bound the 'phosphate pocket' of the second subunit. The process of 'looping' would then repeat r a p i d l y ( S p i c k l e r et a l . , 2001). This model i s c o n s i s t e n t with the v e c t o r i a l nature of mRNA decay and an 'all-or-none' phenomenon ( N i e r l i c h and Murakawa, 1996; Coburn and Mackie, 1999). The presence of secondary s t r u c t u r e or b a s e - p a i r i n g at or near the 5'-end i s known to reduce the a b i l i t y of RNase E to i n t e r a c t w i t h i n t a c t RNA and thus s t a b i l i z e s mRNA substrates in vivo and in vitro (Arnold et al., 1998; Mackie, 1998; B r i c k e r and Belasco, 1999). Such a b a r r i e r can be removed by RNase I I I cleavage of stem of the h a i r p i n , r e l e a s i n g a monophosphorylated 5'-end to w a i t i n g RNase E (Régnier and Grunberg-Manago, 1990; F i g 1.10A). A l t e r n a t i v e l y , i f there i s a d i s t a l s i t e s t r o n g l y favored by the enzyme, RNase E may be able to 'bypass' Figure 1.9 The 5'-tethering model RNase E i s shown as a dimer ( e l l i p s o i d ) i n a s i m p l i f i e d d e p i c t i o n of the degradosome, which i n c l u d e s two t r i m e r s of PNPase (black c i r c l e s ) and two dimers of RhlB (pale blue ovals) . High a f f i n i t y RNA-binding domains are shown on both Rne subunits (hatched boxes). For s i m p l i c i t y , the RNA s u b s t r a t e i s d e p i c t e d as a ' s t r a i g h t ' l i n e w i t h open boxes representing RNase E rec o g n i t i o n / c l e a v a g e s i t e s . S'PPPI Step I: Binding of site 1 to degradosome «•nnn 8 1 , 6 1 S PPP l — l <£5 Slte2 SHB3 Step II: 'Looping1 and contact between site 2 and second subunlt Sltel 5 PPP i — i  - s Site2 Site3 Step III: Endonucleolytlc cleavage at site2, producing ^-monophosphate and a new 3'-end 3lte3 Sltel 5 PPP i—i  Slte2 Mononucteotides-Hlmit oligos c Slte3 5= Slte2 P Ï Repeat step I through step IV Figure 1.10 Effects of 5'-end secondary structure on RNase E-mediated decay Panel A: S t r u c t u r a l b a r r i e r removed by RNase I I I . Panel B: 'Bypassing' of a s t r u c t u r e d 5'-end f o r a d i s t a l RNase E s i t e . A l l symbols are described i n the legend to Figure 1.9 the 5'-end e n t i r e l y (K. Baker, personal communication, F i g . 1.10B). Presumably, the RBD of RNase E would r e t a i n the s u b s t r a t e on the enzyme so the enzyme can 'scan' f o r RNase E s i t e s (Kaberdin et a l . , 2000) . 1.4.2 The 3 '-end As f o r the 5'-end, a h i g h l y s t r u c t u r e d 3'-end poses a formidable b a r r i e r to s i n g l e - s t r a n d s p e c i f i c enzymes, i e , RNase I I and PNPase. Well s t u d i e d model RNAs i n c l u d i n g RNAI_5, malEF REP RNA and the 3'-end p o r t i o n of rpsT mRNA are a l l r e s i s t a n t to e x o n u c l e o l y t i c d i g e s t i o n (Xu and Cohen, 1995; Py et a l . , 1996; Coburn et a l . , 1999). Both enzymes are able to att a c k 3'-ends with 6-nucleotide extensions (Braun et a l . , 1996; Coburn and Mackie, 1996). However, both RNase I I and PNPase can be blocked by s t a b l e stem-loops w i t h 7, 9 or 11 G-C p a i r s or e q u i v a l e n t l y s t a b l e s t r u c t u r a l elements ( S p i c k l e r and Mackie, 2000) . The exoribonucleases s t a l l at the base of the stem and d i s s o c i a t e from the RNA sub s t r a t e . Poly(A) polymerase would extend the 3'-end w i t h a poly(A) t a i l , generating 'toeholds' f o r the exoribonucleases (Carpousis et a l . , 1999) . Weaker stem-loops may undergo t r a n s i e n t m e l t i n g at the base of the stem (Fig 1.11). This may provide an o p p o r t u n i t y f o r the exoribonucleases to bind to p a r t i a l l y or f u l l y - m e l t e d RNA and to overcome the s t r u c t u r a l b a r r i e r ( S p i c k l e r and Mackie, 2000). On the other hand, the repeating c y c l e of e x o n u c l e o l y t i c d i g e s t i o n , s t a l l i n g , d i s s o c i a t i o n and pol y a d e n y l a t i o n at the base of a s t a b l e h a i r p i n may repress the 3'-5' RNA decay process (Coburn and Mackie, 1999) ( F i g . 1.11). This i s r e f l e c t e d i n the observation that RNase I I mediates the s t a b i l i z a t i o n of fragments of rpsO and RNA-OUT (Pepe et a l . , 1994; Braun et al., 1996) . Figure 1.11 Models for 3'-5' mRNA decay This model i s s i m i l a r to F i g 1.8B but emphasises the events at the 3'-end of the s u b s t r a t e . The i n i t i a l RNase E cleavage i s represented by a s c i s s o r s . The exonucleases (RNase I I or PNPase) are represented by 'pacman' symbols. The secondary s t r u c t u r e at the 3'-end of the substrate i s s i m p l i f i e d w i t h a stem-loop. A l s o f o r reasons of s i m p l i c i t y , the degradosome i s not shown. The RNA h e l i c a s e RhlB i s denoted as a t r i a n g l e at the base of the stem. slow 5'ppp ^ 1 l 0 H 3 ' 5'ppp O H 3 ' £ ) 5'p. Although f u n c t i o n a l l y redundant, there i s a marked d i f f e r e n c e between RNase I I and PNPase. PNPase i s t i g h t l y a s s o c i a t e d w i t h RNase E and RhlB i n the degradosome (Carpousis et a l . , 1994; Py et a l . , 1996) . In the degradosome, RhlB i s a c t i v a t e d by the i n t e r a c t i o n w i t h RNase E (Vanzo et a l . , 1998) . I t unwinds RNA secondary s t r u c t u r e , p r e s e n t i n g the ssRNA to PNPase p o s i t i o n e d nearby v i a i n t e r a c t i o n w i t h RNase E (Coburn et a l . , 1999). A 3'-terminal h a i r p i n w i t h no or short unpaired extension r e q u i r e s p o l y a d e n y l a t i o n by poly(A) polymerase to create a p l a t f o r m f o r the degradosome complex to b i n d (Coburn et a l . , 1999) ( F i g . 1.11). 1.5 The scope of the experiments This d i s s e r t a t i o n focuses on s t r u c t u r e - f u n c t i o n r e l a t i o n s h i p s i n RNase E and PNPase. At the beginning of the p r o j e c t , there were s e v e r a l issues we wanted to address. F i r s t , although v a r i o u s regions on RNase E or PNPase were i m p l i c a t e d i n c a t a l y s i s , the a c t u a l c a t a l y t i c s i t e s were not defined. Second, the r o l e and l o c a t i o n of the RNA-binding domain (RBD) of RNase E was not c l e a r . F i n a l l y , the RNA degradosome was not yet i d e n t i f i e d and consequently n e i t h e r were the d e t a i l s of the Rne-Pnp i n t e r a c t i o n . To answer these questions, truncated d e r i v a t i v e s of both enzymes were generated us i n g common molecular b i o l o g y methods. These d e r i v a t i v e s were used to i d e n t i f y domains of RNase E and PNPase, t h e i r v a r i o u s f u n c t i o n s , and t h e i r mutual i n t e r a c t i o n s . Chapter II Materials and Methods 2.1 B a c t e r i a l s t r a i n s , plasmids and commercial sources of enzymes and k i t s A l l chemicals were of regent grade and purchased from commercial sources. Various a p p l i c a t i o n k i t s f o r molecular b i o l o g y were obtained from the denoted manufacturers (see below). 2.1.1 B a c t e r i a l s t r a i n s B a c t e r i a l s t r a i n s and t h e i r genotypes are l i s t e d i n Table 2.1. 2.1.2 Plasmids Recombinant plasmids which served as templates f o r PCR ( s e c t i o n 2.2.1) or in vitro t r a n s c r i p t i o n ( s e c t i o n 2.4) were c o n s t r u c t e d by the members of Mackie l a b o r a t o r y and are l i s t e d i n Table 2.2. 2.1.3 Enzymes and antibodies R e s t r i c t i o n and modifying enzymes were obtained commercially from a v a r i e t y of companies: Amersham-Pharmacia, Gibco-BRL, New England B i o l a b s (NEB), Promega, Stratagene, e t c . They were used as s p e c i f i e d by the manufacturer. A n t i b o d i e s , e i t h e r r a i s e d i n our l a b o r a t o r y or purchased from a commercial source, are l i s t e d i n Table 2.3. A n t i b o d i e s were r a i s e d by intramuscular i n j e c t i o n of New Zealand white r a b b i t s w i t h crushed, e m u l s i f i e d s l i c e s of polyacrylamide c o n t a i n i n g denatured f u l l l e n g t h Rne p r o t e i n or Pnp p r o t e i n (Niguma, 1997) ex c i s e d from a p r e p a r a t i v e Table 2.1 L i s t of b a c t e r i a l s t r a i n s S t r a i n Genotype  JM109 endAl, r e c A l , gyrA96, t h i , hsdRll ( r K ~ , mK+) , r e l A l , supE44, A (lac-proAB) , [F', traD36, proAB, lagI qZAM15] DH5a™ F", <)>80dlacZAM15, A(lacZYA-argF)U16 9, deoR, r e c A l , endAl, hsdR17(r K", mK+) , phoA, supE44, X", t h i - 1 , gyrA96, r e l A l MV1190 A(lac-proAB), thi, supE44, A( s r l - r e c A ) 306 : :Tnl0, [F':traD36, proAB, l a d q A ( lacZ) M15] BL21(DE3) F" ompT hsdS B(r B", mB")o;al dcm X(DE3) Table 2.2 L i s t of plasmids Name Comment  pGM102 D e r i v a t i v e of pET-11 c o n t a i n i n g the complete rne gene (Cormack et a l . , 1993). pGC4 00 pET-11 c o n t a i n i n g the complete pnp gene (Coburn and Mackie, 1998) . pJG9S Encoding 9S RNA, a 246-nt precursor of 5S ribosomal RNA (Cormack and Mackie, 1992) pJG175p(A) Encoding RNA su b s t r a t e rpT(268-447)-poly(A), nts 268-447 of the rpsT gene pl u s a 3 0-polyadenylate t r a c t at 3' end (Coburn and Mackie, 1998). Table 2.3 L i s t of antibodies Primary a n t i b o d i e s Comment Rabbit anti-Rne Rabbit anti-Pnp Mouse a n t i - H i s 6 p o l y c l o n a l (see text) p o l y c l o n a l (see text) monoclonal (Amersham-Pharmacia) Secondary a n t i b o d i e s Comment Goat a n t i - r a b b i t IgG Goat anti-mouse IgG A l k a l i n e phosphatase conjugate, or Horse r a d i s h peroxidase conjugate (Gibco-BRL) Horse r a d i s h peroxidase conjugate (Gibco-BRL) SDS-PAGE g e l . B r i e f l y , each s l i c e contained approximate 250-750 ng of p u r i f i e d p r o t e i n and was e m u l s i f i e d i n Freund's complete adjuvant. A t e s t bleed was performed before the f i r s t immunization and a f t e r each subsequent boost. Rabbits were exsanguinated, the blood allowed to c l o t , and the serum s t o r e d f r o z e n . Working p o r t i o n s were s t o r e d at -20 °C i n 50% g l y c e r o l . 2.1.4 B a c t e r i a l growth media C e l l growth was c a r r i e d out i n e i t h e r L u r i a - B e r t a n i b r o t h (LB) or M9ZB. LB: 1% (w/v) bactotryptone, 0.5% (w/v) yeast e x t r a c t , and 86 mM NaCl. M9ZB: 18 mM NH4C1, 22 mM KH 2P0 4, 42 mM Na 2HP0 4, 1% (w/v) N-Z-amine (Humco-Sheffield, L t d ) , and 86 mM NaCl. 2.2 Molecular Cloning Common molecular b i o l o g i c a l procedures such as r e s t r i c t i o n d i g e s t i o n , DNA l i g a t i o n , plasmid transformation, plasmid e x t r a c t i o n , and g e l e l e c t r o p h o r e s i s were performed according to Sambrook et al. (1989) w i t h minor m o d i f i c a t i o n s . 2.2.1 Amplification of DNA A m p l i f i c a t i o n of s p e c i f i c DNA sequences u s i n g the polymerase chain r e a c t i o n (PCR, M u l l i s et al., 1986) was performed us i n g an MJ Research Inc. programmable thermal c y c l e r . PCR r e a c t i o n s were c a r r i e d out i n a 100 uL volume c o n t a i n i n g up to 0.5 ug of DNA template, 100 pmoles each of forward and reverse primers, 0.2 mM each of the four deoxyribonucleotide triphosphates, and 5 u n i t s of Tag DNA polymerase (Proraega) i n a b u f f e r of 10 mM T r i s - H C l , pH 9.0, 1.0-2.0 mM MgCl 2 (1.5 mM i n most cases), 50 mM KC1, 1% Triton®X-100 and 5% Tween®20. Plasmid pGM102 contains the complete rne coding sequence (Cormack et a l . , 1993) . 5'-terminal d e l e t i o n s i n the rne gene were c o n s t r u c t e d by PCR a m p l i f i c a t i o n of P s t l - l i n e a r i z e d pGM102. The unique P s t I s i t e l i e s i n the v e c t o r outside the rne coding sequence. An Ndel s i t e was introduced i n t o a l l forward primers, R1-R6, to e s t a b l i s h an ATG s t a r t codon and to f a c i l i t a t e the subsequent c l o n i n g (Table 2.4) . An Xhol s i t e was i n c l u d e d i n the reverse primer RR which was complementary to 3' terminus of the rne gene (Table 2.4). Likewise, d e l e t i o n s w i t h i n the RNA B i n d i n g Domain (RBD, see s e c t i o n 3.2.3) were made by PCR a m p l i f i c a t i o n of regions of rne i n P s t l - l i n e a r i z e d pGM102. Primer R l served as the forward primer, i n t r o d u c i n g an Ndel s i t e . An Xhol s i t e was i n c o r p o r a t e d i n t o a l l reverse primers, RR1-RR5 (Table 2.4). Plasmid pGC400 contains the e n t i r e pnp gene w i t h a C-»G t r a n s i t i o n , r e s u l t i n g i n a s i n g l e amino a c i d change, Arg3 57-»Gly357 (Coburn and Mackie, 1998) . Regions of the pnp gene were a m p l i f i e d by PCR from P s t l - l i n e a r i z e d pGC400. A BamHI s i t e was i n c l u d e d i n a l l primers to f a c i l i t a t e the c l o n i n g (Table 2.5 and Table 2.6). A l l PCR products were separated by e l e c t r o p h o r e s i s on a 0.8% agarose g e l and v i s u a l i z e d by s t a i n i n g w i t h ethidium bromide and UV i r r a d i a t i o n . Appropriate bands c o n t a i n i n g PCR products were e x c i s e d and DNA fragments were p u r i f i e d using a QIAquick g e l e x t r a c t i o n k i t (QIAGEN). Table 2.4 Primers used i n the construction of Rne deletions P r i m e r 3 P r o d u c t s P l a s m i d P r o t e i n R l CGGACATATGCATCAGGAGAGCAACGTAATC pXMl, RneAN2 08 b R2 GCAGCATATGGAAGAAACCGCGTTTAACACT pXM2, RneAN315 b R3 GCAGCATATGTCTGGTACTGGCACCGTGCGT pXM3 , RneAN4 08 b R4 GCAGCATATGCGTCGCAAGCCTCGTCAGAAC pXM4, RneAN608 b R5 GCAGCATATGCAGCGTCGCTATCGTGACGAG pXM5, RneAN722 b R6 GCAGCATATGCGTCGTCGCTATCGTGACGAG pXM6, RneAN813 b RR CGTCCTCGAGCTAATTATTACTCAACAGGTTG Reverse p r i m e r 0 RR1 GCAGCTCGAGTTTGGTTTCTTCACCACCGCT pXM7, RneAN2 08/590 d RR2 GCAGCTCGAGCGGTTTCGCTTCTGCTTTCGG pXM8, RneAN208/602 d RR3 GCAGCTCGAGACGAGGCTTGCGACGATCCTG pXM9, RneAN208/612 d RR4 GCAGCTCGAGGCGCTCATTACGGTCACGGCG pXMlO, RneAN208/622 d RR5 GCAGCTCGAGGCCTTCAGTACGTTCACTACG p X M l l , RneAN2 08/632 d a. A l l primer sequences are i n the 5' to 3 ' o r i e n t a t i o n . The Ndel and Xhol s i t e s i n the primer sequences are und e r l i n e d . b. Primers R1-R6 are the forward primers f o r the l i s t e d plasmids and corresponding Rne d e l e t i o n s . c. Primer RR serves as the reverse primer f o r forward primers 1-6. d. Primers RR1-RR5 are the reverse primers f o r the l i s t e d plasmids and corresponding RBD d e l e t i o n s . The forward primer i s R l . Table 2.5 Primers used i n the construction of Pnp deletions Forward P r i m e r s 3 PI GCTTAATCCGATGGATCCTAAATTCCAG P3 GATTGCAGCGACGGATCCCGAGAAAGCG P5 GCCGCGTGTGGATCCTTCTGAGTTC P7 GCGTACTGGATÇÇCGAACCGCG Reverse P r i m e r 3 P2 GCATGTTTCGGATCCTCGCCGTC P4 GCCCTGTTCAGGATCCGGAGCAGG P6 GAACTCAGATGGATCCTCACGCGG P8 CACGGATCGGATÇCTTTTCACG a. A l l primer sequences are i n 5' to 3' o r i e n t a t i o n . The BamHI s i t e s are u n d e r l i n e d . Table 2.6 L i s t of Pnp subfragments produced from the primers i n Table 2.5 P r i m e r s 3 P l a s m i d P r o t e i n a.a. c o o r d i n a t e s 1 3 P I , P2 pPN Pnp-PN 8-602 P3, P4 pPC Pnp-PC 603-705 P I , P6 pPA Pnp-PA 8-545 P5, P4 pPB Pnp-PB 549-705 p7, P4 pPD Pnp-PD 313-705 p7, P6 pPE Pnp-PE 313-602 P I , P8 pPL Pnp-PL 8-320 a. From Table 2.5. b. Amino a c i d sequence coordinates of the Pnp subfragments. 2.2.2 Subcloning and characterization of recombinant plasmids To co n s t r u c t 5'-terminal Rne d e l e t i o n s , the ends of appropriate PCR fragments were f i l l e d u sing T4 DNA polymerase i n the presence of dNTP and phosphorylated w i t h T4 p o l y n u c l e o t i d e kinase (Sambrook et al., 1989) . The ' u t i l i t y ' v e c t o r pUC18 was l i n e a r i z e d w i t h Smal to generate blunt ends. To prevent spontaneous r e l i g a t i o n of the v e c t o r , the bl u n t ends were subsequently dephosphorylated w i t h c a l f i n t e s t i n a l a l k a l i n e phosphatase (CIAP) under c o n d i t i o n s s p e c i f i e d by the manufacturer. Then the processed PCR products were l i g a t e d i n d i v i d u a l l y i n t o the l i n e a r i z e d pUC18. Desired fragments were then e x c i s e d by d i g e s t i o n w i t h Ndel/Xhol and l i g a t e d i n t o pET-24b ( F i g . 2.1). S i m i l a r but more d i r e c t approaches were used to make RBD d e l e t i o n s . Untreated PCR products were f i r s t l i g a t e d i n t o pGEM®-T vector (Promega) to take advantage of the template-independent additon of 3' t e r m i n a l deoxyadenosine residues by Taq polymerase (Clark, 1988). The regions of i n t e r e s t were e x c i s e d w i t h Ndel/Xhol d i g e s t i o n and l i g a t e d i n t o pET-24b. To generate Pnp d e l e t i o n s from pGC400, p u r i f i e d PCR products were d i r e c t l y d i g e s t e d w i t h BamEI. The expression v e c t o r pET-l6b was l i n e a r i z e d w i t h BamHI and t r e a t e d w i t h CIAP. The PCR products were l i g a t e d i n t o the v e c t o r u s i n g standard methods. The o r i e n t a t i o n of each i n s e r t was v e r i f i e d by r e s t r i c t i o n d i g e s t i o n (Sambrook et al., 1989). Clones c o n t a i n i n g recombinant plasmids were p u r i f i e d and plasmids prepared from small c u l t u r e s by the a l k a l i n e l y s i s method. A l l plasmids c a r r y i n g i n s e r t s were transformed i n t o b a c t e r i a l s t r a i n s , JM109, MV1190 or DH5cx™, f o r c h a r a c t e r i z a t i o n and maintenance (Table 2.1). Working Figure 2.1 Strategies of subcloning of Rne deletions A s i m p l i f i e d flow-chart shows the steps of subcloning. I .The rne gene encoded by pGM102 was used as PCR template. The r e l a t i v e p o s i t i o n s of 6 forward primers (R1-R6) and the reverse primer (RR) are shown. I I . The Tag polymerase generated PCR products c o n t a i n i n g 3' template-independent A overhangs, which were r e p a i r e d . The PCR fragments were l i g a t e d w i t h S m a l - l i n e a r i z e d pUC18. I I I . The Ndel and Xhol s i t e s were e f f i c i e n t l y cleaved to generate cohesive ends. I V - V . pET-24b was d i g e s t e d w i t h Ndel/Xhol. The PCR fragments were l i g a t e d w i t h the l i n e a r i z e d v e c t o r to y i e l d e xpression plamsids (pXMl-pXM6), encoding N - t e r m i n a l l y truncated Rne p r o t e i n s R1 R2 R3 R4 R5 W PCR A 3 5-Ends f i l l ed , L igated in pUC18 /5ma l Figure 2.2 Strategies of subcloning of RBD deletions The flow-chart shows the major steps of subcloning of d e l e t i o n s w i t h i n RBD. I .The rne gene encoded by pGM102 was used as PCR template. The r e l a t i v e p o s i t i o n s of the forward primers (R) and 5 reverse primer (RR) are shown. I I . The Tag polymerase generated PCR products c o n t a i n i n g 3' template-independent A overhangs, which were l i g a t e d w i t h l i n e a r i z e d pGEMÔ-T v e c t o r . 5' T overhangs I I I . The Ndel and Xhol s i t e s were e f f i c i e n t l y cleaved to generated cohesive ends and fragments were l i g a t e d i n t o N d e l / X h o I - l i n e a r i z e d pET-24b to y i e l d e xpression plamsids (pXM7-pXMll). q u a n t i t i e s of p u r i f i e d plasmids were prepared u s i n g a l k a l i n e l y s i s method (Sambrook et al., 1989). Ends of the i n s e r t s i n the plasmids were sequenced to confirm that the i n s e r t s were inframe (Sambrook et al. , 1989) . 2.3 Overexpression and p a r t i a l p u r i f i c a t i o n of Rne and Pnp deletion proteins P u r i f i e d plasmids were transformed i n t o the expression s t r a i n BL21(DE3) (Table 2.1) . A small s c a l e experiment was used to t e s t the overexpression of t a r g e t p r o t e i n s . 10 mL LB b r o t h supplemented with 0.2% glucose, 1 mM MgS04, and 50 ug/mL a n t i b i o t i c (kanamycin f o r Rne d e l e t i o n s t r a i n s and a m p i c i l l i n f o r Pnp d e l e t i o n s t r a i n s ) was i n o c u l a t e d w i t h a f r e s h overnight c u l t u r e of the appropriate BL21 d e r i v a t i v e s , incubated w i t h shaking at 30 °C t o e a r l y l o g phase, and then induced w i t h 0.5 mM isopropyl-(3-D-l-thiogalactopyranoside (IPTG) f o r 1.5 hrs. C e l l s from 1 mL induced c u l t u r e were c o l l e c t e d by c e n t r i f u g a t i o n and l y s e d by b o i l i n g i n 120 uL SDS sample b u f f e r (120 mM T r i s - H C l , pH 6.8, 3% SDS, 50 mM d i t h i o t h r e i t o l [DTT], 10% g l y c e r o l ) . Larger s c a l e p r e p a r a t i o n of overexpressed p r o t e i n was t y p i c a l l y conducted i n 100 mL of c u l t u r e c o n t a i n i n g the appropriate s t r a i n s growing i n M9ZB medium (Studier et a l . , 1990) supplemented with 0.2% glucose, 1 mM MgS04, 100 ug/mL thiamine and 50 ug/mL of the appropriate a n t i b i o t i c . The c u l t u r e s were incubated at 30 °C w i t h a g i t a t i o n to an OD600-0.6, d i l u t e d w i t h 100 mL supplemented growth medium, and induced w i t h IPTG at a f i n a l c o n c e n t r a t i o n of 0.5 mM. The c o n d i t i o n s f o r i n d u c t i o n were 3 0 °C and 2-3 hrs f o r Rne d e l e t i o n s and room temperature and 5-6 hrs, i n some cases overnight, f o r Pnp d e l e t i o n s . C e l l s were then c h i l l e d to 4 °C, harvested by b r i e f c e n t r i f u g a t i o n , resuspended i n B u f f e r A (50 mM T r i s - H C l , pH 7.6, 10 mM MgCl 2, 60 raM NH4C1, 0.5 mM EDTA, 5% g l y c e r o l , 1 mM DTT), and passed twice through a French Press C e l l at 8,000-10,000 p s i . C e l l l y s a t e s were supplemented w i t h 0.1 mM p henylmethylsulfonyl f l u o r i d e (PMSF), 2 ug/ml a p r o t i n i n , 0.8 ug/ml le u p e p t i n , 0.8 ug/ml p e p s t a t i n A and 20 ug/ml DNase I f o r 15 minutes on i c e . Soluble p r o t e i n s were separated from i n s o l u b l e m a t e r i a l by c e n t r i f u g a t i o n at 30,000xgr. The r e s u l t i n g supernatant was r e t a i n e d as the S30 f r a c t i o n . Rne d e l e t i o n p r o t e i n s were f u r t h e r enriched by p r e c i p i t a t i n g S30 f r a c t i o n s w i t h 26% (w/v) ammonium s u l f a t e to y i e l d the AS26 f r a c t i o n s (Mackie, 1991). P r o t e i n samples were subjected to SDS-PAGE and v i s u a l i z e d by e i t h e r Coomassie Blue s t a i n i n g , s i l v e r s t a i n i n g u s i n g a Bio-Rad s i l v e r s t a i n plus k i t , or Western b l o t t i n g ( s e c t i o n 2.5.1). P r o t e i n concentrations were measured against a BSA standard u s i n g a Bio-Rad p r o t e i n assay k i t (Bradford, 1976) or estimated from the i n t e n s i t y of the bands on Coomassie blue s t a i n e d g e l s a gainst a known standard. 2.4 Preparation of RNA substrates and probes L i n e a r i z e d plasmids (e.g. pJG9S/PstI) served as the template f o r in vitro t r a n s c r i p t i o n r e a c t i o n s . 3 2 P - l a b e l l e d RNA s u b s t r a t e s were synthesized u s i n g SP6 or T7 RNA polymerase depending on the promoter d r i v i n g the t r a n s c r i p t i o n . T y p i c a l l y , a 100 (iL r e a c t i o n mixture included 2 ug of l i n e a r DNA template, 60 u n i t s of RNA polymerase, 30-40 u n i t s of RNAguard® (Pharmacia) , and 40 uCi of [a 3 2P] -CTP (NEN or Amersham) i n a b u f f e r c o n t a i n i n g 40 mM T r i s - H C l , pH 7.9, 6 mM MgCl 2, 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 0.5 mM each of ATP, GTP, and UTP, and 0.1 mM CTP. The r e a c t i o n was stopped a f t e r i n c u b a t i o n at 37 °C f o r 90 min by adding 10 uL of 0.2 mM EDTA, 100 uL of 8 M ammonium acetate, and DEPC-t r e a t e d s t e r i l e water to a f i n a l volume of 400 uL. The mixture was e x t r a c t e d twice w i t h equal volume of phenol/chloroform/isoamyl a l c o h o l (25/24/1 v/v/v) (PCI), p r e c i p i t a t e d twice i n 2 M ammonium acetate w i t h 2.5 volumes of ethanol at -20 °C f o r no l e s s than 1 hr and the products were resuspended i n s t e r i l e water to a f i n a l c o n c e n t r a t i o n of 2 x i o - 7 M. For the sy n t h e s i s of RNA probes, the c o n c e n t r a t i o n of u n l a b e l l e d CTP was reduced to 5 uM and the r e a c t i o n was stopped w i t h 10 u n i t s of RNase-free DNase I and a d d i t i o n a l 10 min i n c u b a t i o n at 37 °C. S i m i l a r l y , the mixture was e x t r a c t e d w i t h PCI, p r e c i p i t a t e d , and the RNA was resuspended i n 100 uL of DEPC-treated s t e r i l e water. 2.5 Protein b l o t s 2.5.1 Western b l o t P r o t e i n samples (-1-2 ug) were b o i l e d i n SDS sample b u f f e r , a p p l i e d to a polyacrylamide g e l (7%, 10%, or 12% 36:1 acrylamide:bis-acrylamide), and separated by e l e c t r o p h o r e s i s . The p r o t e i n s were e l e c t r o b l o t t e d onto a n i t r o c e l l u l o s e membrane i n a carbonate t r a n s f e r b u f f e r (3 mM Na 2C0 3, 10 mM NaHC03, and 20% methanol, Dunn, 1986) at a constant current of 250 mA f o r 1.5 hrs at 4 °C. Marker lanes were e x c i s e d and s t a i n e d w i t h 0.2% Ponceau S i n 3% t r i c h l o r o a c e t i c a c i d . The membranes were incubated i n PTBN b u f f e r (20 mM Na-phosphate, pH 7.0, 0.1 mm bovine serum albumin [BSA], 0.85% NaCl, 0.05% Tween®20, 1 mM NaN3) c o n t a i n i n g 5% c a s e i n and p r o p e r l y d i l u t e d a n t i b o d i e s (1:10,000 f o r anti-Rne a n t i b o d i e s , 1:5,000 f o r anti-Pnp a n t i b o d i e s or 1:3,000 f o r a n t i - H i s 6 a n t i b o d i e s , Table 2.3) f o r 1 hr at ambient temperature (Rouleau et a l . , 1994). The p r o t e i n b l o t s were washed three times i n PBS (pH 7.4, Sambrook et a l . , 1989) before a 45-min i n c u b a t i o n w i t h secondary a n t i b o d i e s d i l u t e d i n PBS (1:3,000, Table 2.3). The b l o t s were subjected to three 5 min washes i n PBS, the l a s t of which contained 1 M NaCl, and a i r - d r i e d . Immunoreactive p r o t e i n s were v i s u a l i z e d by two methods, c o l o r i m e t r i c d e t e c t i o n u s i n g 5-bromo-4-c h l o r o - 3 - i n d o y l phosphate p - t o l u i d i n e s a l t and p - n i t r o blue t e t r a z o l i u m c h l o r i d e (BCIP/NBT, Bio-Rad), or chemiluminescent d e t e c t i o n u s i n g ECL™ immunoblot reagents (Amersham-Pharmacia). 2.5.2 Northwestern b l o t Northwestern b l o t t i n g experiments were modif i e d s l i g h t l y from p r e v i o u s l y d e s c r i b e d (Cormack et a l . , 1993). P r o t e i n s were separated by SDS-PAGE, e l e c t r o b l o t t e d onto a n i t r o c e l l u l o s e membrane as d e t a i l e d above ( s e c t i o n 2.5.1). I n d i v i d u a l b l o t s were submerged i n 15 mL b i n d i n g b u f f e r (TEN50 [10 mM T r i s - H C l , pH 8.0, 1 mM EDTA, 50 mM NaCl] , l x Denhardt's s o l u t i o n [0.02% F i c o l l 400, 0.02% p o l y v i n y l p y r r o l i d o n e , 0.02% BSA], 250 ug/mL yeast RNA) and incubated at 44 °C f o r 1 hr with slow a g i t a t i o n (-100 rpm) . 9S RNA probes generated from i n v i t r o t r a n s c r i p t i o n ( s e c t i o n 2.4) were added (- 5 x 10 5 cpm/mL) and b l o t s were incubated at 44 °C f o r a d d i t i o n a l 90 min w i t h g e n t l e shaking. The b l o t s were washed at ambient temperature w i t h g e n t l e shaking f o r 10 min i n TEN50, 10 min i n TEN200 (200 mM NaCl), and 10 min i n TEN500 (500 mM NaCl). The a i r - d r i e d b l o t s were exposed e i t h e r t o Kodak x-ray f i l m s or to a phosphorimager screen (Molecular Dynamics). 2.6 A f f i n i t y chromatography 2.6.1 P u r i f i c a t i o n of Pnp subfragments S30 f r a c t i o n s (~2 mg/mL t o t a l protein) of Pnp subfragments expressed from pnp d e l e t i o n plasmids were prepared e s s e n t i a l l y as desc r i b e d i n s e c t i o n 2.3 but i n l x Binding b u f f e r (20 mM T r i s - H C l , pH7.9, 5 mM immidazole, 500 mM NaCl) from a Novagen His»Bind® k i t i n s t e a d of b u f f e r A. The f o l l o w i n g procedures were performed at 4 °C. The His»Bind® r e s i n was charged with N i 2 * and e q u i l i b r a t e d w i t h l x Bindin g b u f f e r according to manuals su p p l i e d by the manufacturer. 1 mL of S3 0 f r a c t i o n c o n t a i n i n g an i n d i v i d u a l Pnp subfragment was mixed with 2 ml charged r e s i n i n a 50 mL Falcon tube. The volume was brought up to 10-12 mL w i t h l x Bi n d i n g b u f f e r . A f t e r 60 min i n c u b a t i o n w i t h end-to-end r o t a t i o n , the mixture was poured i n t o a 15 mL g r a v i t y column. The column was dra i n e d and washed with 10 bed volumes each of l x Binding b u f f e r and l x Washing b u f f e r (20 mM T r i s - H C l , pH 7.9, 60 mM imidazole, 500 mM NaCl). The bound p r o t e i n s were then e l u t e d w i t h 7.5 bed volumes of l x E l u t i n g b u f f e r (20 mM T r i s - H C l , pH 7.9, 1 M imidazole, 500 mM NaCl) . The e l u a t e s were c o l l e c t e d i n 1 mL f r a c t i o n s . 100 uL of each f r a c t i o n was p r e c i p i t a t e d w i t h 5 volumes of acetone at -20 °C overnight. The p r o t e i n s were recovered by c e n t r i f u g a t i o n and subjected to SDS-PAGE and Coomassie Blue or s i l v e r s t a i n i n g . Several f r a c t i o n s of greatest p u r i t y and c o n c e n t r a t i o n ( u s u a l l y f r a c t i o n s 2-4) were pooled and d i a l y z e d e x t e n s i v e l y , f i r s t against b u f f e r A (without DTT) and then against 25 mM Hepes-NaOH, pH 7.5, 100 mM NaCl, 5% g l y c e r o l , 1 mM DTT, 0.1 mM EDTA. 2.6.2 Protein i n t e r a c t i o n assay The p r o t e i n i n t e r a c t i o n assays were conducted at a smaller s c a l e u s i n g the His«Bind® k i t . I n d i v i d u a l r e a c t i o n s were assembled i n a 1.5 mL screw-cap m i c r o c e n t r i f u g e tube. 100 uL of an S30 f r a c t i o n of an appropriate Pnp subfragment (-200 ug t o t a l p r o t e i n s ) was incubated w i t h 30 uL charged, e q u i l i b r a t e d His«Bind® r e s i n i n 500 uL l x Bi n d i n g b u f f e r at 4 °C f o r 1 hr on a Nutator mixer. A f t e r a g e n t l e c e n t r i f u g a t i o n (3 min at 600 rpm), the l i q u i d was withdrawn and the r e s i n was washed once w i t h 1 mL of l x Bindi n g b u f f e r and incubated w i t h the AS26 f r a c t i o n of an appropriate Rne d e l e t i o n p r o t e i n (-200 ug t o t a l p r o t e i n s ) f o r 1 hr. The r e s i n was then washed s e q u e n t i a l l y w i t h 1 mL of l x Bi n d i n g b u f f e r and 1 mL of l x Washing b u f f e r . The bound p r o t e i n s were recovered by e l u t i n g w i t h 500 uL of l x E l u t i n g b u f f e r , 100 uL of which was p r e c i p i t a t e d w i t h 5 volumes of acetone at -20 °C overnight. The recovered p r o t e i n s were r e s o l v e d by SDS-PAGE and v i s u a l i z e d Coomassie Blue s t a i n i n g . 2.7 P a r t i a l p r o t e o l y s i s These p a r t i c u l a r experiments were conducted i n combination w i t h N i 2 * - c h e l a t i o n chromatography. C e l l e x t r a c t s ( c o n t a i n i n g -200 ug of t o t a l p r o t e i n s ) of s t r a i n s overexpressing N - t e r m i n a l l y His-tagged Pnp p r o t e i n (see s e c t i o n 4.2.2) were incubated w i t h 30 uL of charged His«Bind® r e s i n . The r e s i n was p e l l e t e d by ge n t l e s p i n n i n g , and l i q u i d was withdrawn as des c r i b e d ( s e c t i o n 2.6.2). 10 ug t y p s i n or chymotypsin was added to the r e s i n i n 200 uL of p r o t e o l y s i s r e a c t i o n b u f f e r c o n t a i n i n g 25 mM T r i s - H C l , pH7.9, 50 mM KC1, and 0.1 mM EDTA. The p r o t e o l y s i s was c a r r i e d out at ambient temperature f o r 1-1.5 h r s . The r e a c t i o n was stopped by adding 10 uL of 100 mM PMSF. The p r o t e i n s on the r e s i n were p u r i f i e d and analyzed i n accordance w i t h the procedures i n s e c t i o n 2.6.2 2.8 Co-immunoprecipitation Co-immunoprecipitaion experiments were performed as p r e v i o u s l y d e s c r i b e d (Coburn et al., 1999). B r i e f l y , p o l y c l o n a l anti-Rne or monoclonal a n t i - H i s 6 a n t i b o d i e s were bound to p r o t e i n A-agarose beads (Gibco-BRL) i n CLB b u f f e r (20 mM Na 2HP0 4 (, 5 mM Na2HP04, 0.2 mM NaCl, 0.5 mM EDTA) by g e n t l e mixing at 4 °C. Bound ant i b o d i e s were then cross-l i n k e d to the beads i n CLB b u f f e r supplemented with 1% glutaraldehyde. The beads were washed e x t e n s i v e l y i n CLB b u f f e r and b u f f e r A without DTT (50 mM T r i s - H C l , pH 7.6, 10 mM MgCl 2, 60 mM NH4C1, 0.5 mM EDTA). Various combinations of c e l l e x t r a c t s (-100 ug t o t a l p r o t e i n each) c o n t a i n i n g overexpressed d e l e t i o n p r o t e i n s were incubated w i t h the beads i n b u f f e r A (no DTT) f o r 1 hr with ge n t l e shaking at 4 °C. Unbound p r o t e i n s were removed by 3 washes with b u f f e r A l a c k i n g DTT, using low speed c e n t r i f u g a t i o n to pack the beads a f t e r each wash. The immunopurfied p r o t e i n s were e l u t e d by heating at 55 °C f o r 10 min i n SDS b u f f e r (120 mM T r i s - H C l , 3% SDS, 10% g l y c e r o l ) l a c k i n g DTT. The recovered p r o t e i n s were analyzed by Western b l o t t i n g . 2.9 Ribonuclease assays 2.9.1 Ribonuclease E a c t i v i t y assay RNase E a c t i v i t y was assayed as described p r e v i o u s l y (Mackie, 1991). For a 30 u l r e a c t i o n , 0.6 pmoles of RNA substrate was renatured by heating at 50 °C f o r 2 min, 37 °C f o r 10 min, and c h i l l e d on i c e wh i l e b u f f e r e d i n 25 mM Hepes-NaOH, pH 7.5, 5 mM MgCl 2, 0.1 mM DTT, 125 mM NH4C1, 60 mM KC1, 50 ug/ml yeast RNA and 5% g l y c e r o l . Cleavage of the su b s t r a t e was i n i t i a t e d w i t h 100 ng of p u r i f i e d p r o t e i n or 200 ng of AS26 f r a c t i o n , 0.075% Triton®X-100 and 8% polyethylene g l y c o l and incubated at 3 0 °C. A l i q u o t s of 4 ( i l were withdrawn at predetermined time i n t e r v a l s . Samples were b o i l e d i n 3 volumes of b u f f e r c o n t a i n i n g 90% d e i o n i z e d formamide and t r a c k i n g dyes, and separated on a 6% polyacrylamide g e l . Gels were v i s u a l i z e d and analyzed using a phosphorimager (Molecular Dynamics). 2.9.2 Polynucleotide phosphorylase a c t i v i t y assay Assays of PNPase were performed e s s e n t i a l l y as p r e v i o u s l y described (Coburn and Mackie, 1998). A 40 u l r e a c t i o n t y p i c a l l y contained 100 ng of p u r i f i e d p r o t e i n , 8 nmoles of RNA s u b s t r a t e i n a b u f f e r of 2 0 mM T r i s - H C l , pH 7.5, 2 0 mM KC1, 1 mM MgCl 2, and 1.5 mM DTT supplemented w i t h 10 mM n e u t r a l i z e d Na-phosphate. P r i o r to the a d d i t i o n of the enzyme source, RNA s u b s t r a t e s were renatured u s i n g the heating regime d e s c r i b e d f o r the RNase E assay ( s e c t i o n 2.9.1). A l i q u o t s of 4 u l were withdrawn and analyzed as d e s c r i b e d above. 2.10 Computational methods Sequence alignments were produced us i n g BLAST 2 Sequences (http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) and ClustalW (http://www2.ebi.ac.uk/clustalw/) programs i n d e f a u l t s e t t i n g s . Manipulations of p u b l i s h e d atomic s t r u c t u r e s were conducted w i t h RasMol Molecular Graphic V i s u a l i z a t i o n Tool, v2.7.1.1 (http://www.openrasmol.org). Chapter III The RNA-binding domain of RNase E 3.1 General overview As d e t a i l e d i n Chapter I, RNase E has long been considered as the main endoribonuclease r e s p o n s i b l e f o r i n i t i a t i n g bulk mRNA degradation i n E. coli (Mudd et a l . , 1990; Higgins et a l . , 1992). During e a r l y attempts at c l o n i n g the rne gene and p u r i f y i n g the a c t i v i t y , i t became evident that the Rne p r o t e i n i s p r o t e o l y t i c a l l y unstable (Roy and A p i r i o n , 1983; C l a v e r i e - M a r t i n et a l . , 1991). Some p r o t e o l y t i c fragments of the Rne p r o t e i n , missing a p o r t i o n of i t s C-terminus, d i s p l a y at l e a s t p a r t i a l endonuclease a c t i v i t y , which i n tu r n l e d to i t s m i s i d e n t i f i c a t i o n as 'RNase K' (Lundberg et a l . , 1990; Lundberg et a l . , 1995). This f i n d i n g , however, p o i n t s to the N-terminal p o r t i o n as co n t a i n i n g the c a t a l y t i c domain(s). Moreover, two temperature-sensitive mutations, ams-1 and rne-3071, have been mapped near the N-terminus to codons 66 and 68, r e s p e c t i v e l y (Babitzke and Kushner, 1991; McDowall et a l . , 1993). F i n a l l y , an E. coli mutant which contains a shortened v e r s i o n of rne gene e x h i b i t s an unexpectedly m i l d phenotype (Kido et a l . , 1996). The mutant expresses a truncated Rne p r o t e i n which lacks the C-terminal p o r t i o n . Taken together, i t i s evident that the c a t a l y t i c s i t e i s s i t u a t e d away from the C-terminus of the polypeptide at or near the N-terminus (McDowall and Cohen, 1996) . A l a r g e p r o t e i n (1061 amino a c i d s ) , the Rne polypeptide d i s p l a y s s e v e r a l amino a c i d sequence features which are separated s p a t i a l l y . Near the N-terminus, overlapping the two t s mutations, there l i e s a reg i o n (residues 35-120) homologous to SI RNA -binding motif (Bycroft et a l . , 1997) . This i s followed by a s t r e t c h of sequence r i c h i n hydrophobic r e s i d u e s , p a r t i c u l a r l y a p r o l i n e - r i c h r e g i o n l o c a t e d between residues 482-602 (23 p r o l i n e s i n 120 r e s i d u e s ) . In the middle of the polypeptide, there i s a high c o n c e n t r a t i o n of a r g i n i n e s from residues (21%) 600 to 750. The p o s i t i v e l y charged a r g i n i n e s are the p r i n c i p l e c h a r a c t e r i s t i c s of the A r g - r i c h RNA-binding motif, c h a r a c t e r i z e d i n many other RNA-binding p r o t e i n s (reviewed i n Burd and Dreyfuss, 1994). Hence, the A r g - r i c h r e g i o n of Rne i s p o t e n t i a l l y r e s p o n s i b l e f o r the strong a f f i n i t y f o r 9S RNA d i s p l a y e d by the g e l -p u r i f i e d Rne polypeptide (Cormack et al., 1993). The C-terminal t a i l , i n t e r e s t i n g l y , possesses many a c i d i c r esidues and l a c k s s i m i l a r i t y to. known p r o t e i n s . This chapter i s based on the aforementioned experimental data and sequence a n a l y s i s . Members of our l a b o r a t o r y had alr e a d y constructed a s e r i e s of C-terminal d e l e t i o n mutants i n the rne gene and cloned them i n t o an expression v e c t o r (see below) . In order to probe the domain o r g a n i z a t i o n of the Rne pol y p e p t i d e , a set of N-terminal d e l e t i o n mutants was made to complement the C-terminal s e t . A l l mutant polypeptides were overexpressed and t h e i r p r o p e r t i e s were i n v e s t i g a t e d . 3.2 Results 3.2.1 Construction and overexpression of Rne deletions To d e l i n e a t e p o t e n t i a l f u n c t i o n a l domains i n the Rne polypeptide, we constructed N-terminal d e l e t i o n s i n expression plasmids encoding the rne gene. The s t r a t e g y used PCR to s y s t e m a t i c a l l y d e l e t e 100 residues at a time ( s e c t i o n 2.2.2 and F i g . 2.1). D i f f i c u l t i e s were encountered i n o b t a i n i n g a l l the d e s i r e d PCR products and/or m a i n t a i n i n g the 1 S1 Rne sms-1 rne-3071 A r g - r i c h D + E 1061 S\\\\ 600 750 820 i-ii-nvi-ii'ii'bi RneAN208 208 RneAN315 315 RneAN408 408 RneAN608 608 \\w\C RneAN722 722 RneAN813 813 Figure 3.1 Domains within Rne and N-terminally truncated Rne proteins The l i n e a r o r g a n i z a t i o n of p u t a t i v e domains i n the Rne p r o t e i n i s i l l u s t r a t e d based on analyses of i t s sequence ( s e c t i o n 1.1.1). The r e l a t i v e l o c a t i o n s of the SI motif (SI; s o l i d b a r ) , a r g i n i n e - r i c h region ( A r g - r i c h ; cross-hatch) and the a c i d i c t a i l (D+E; s t i p p l e d ) are i n d i c a t e d i n d i f f e r e n t f i l l - i n p a t t e r n s . The l o c a t i o n s of two tempera t u r e - s e n s i t i v e mutations, ams-1 and rne-3071 are a l s o shown. The coordinates of the N-terminal end of the truncated Rne p r o t e i n s are i n d i c a t e d . S1 Rne RneAC132 T ams-1 rns-3071 132 A r g - r i c h D + E 1061 Isssssa taaaaa&a RneAC237 237 RneAC250 250 RneAC370 370 RneAC517 517 RneAC590 590 • RneAC632 632 RneAC643 643 RneAC697 697 Figure 3.2 C -terminally truncated Rne proteins The C - t e r m i n a l l y truncated Rne p r o t e i n s w i t h t h e i r s i z e s r e l a t i v e to the i n t a c t Rne p r o t e i n are shown. The coordinates of the C-terminal ends of the truncated Rne p r o t e i n s are i n d i c a t e d . corresponding plasmids i n host s t r a i n s , but s i x N-terminal d e l e t i o n s were u l t i m a t e l y obtained (Table 2.4 and F i g . 2.1). When expressed i n the host BL21(DE3), the constructed plasmids gave r i s e to s i x d e l e t i o n p r o t e i n s , namely, RneAN208, RneAN315, RneAN408, RneAN608, RneAN722, and RneAN813, where N represents the nature of d e l e t i o n s and the number i n d i c a t e s the most N-terminal amino a c i d i n the Rne amino a c i d sequence which i s r e t a i n e d i n the d e l e t i o n ( F i g . 3.1). Another s e r i e s of C-terminal d e l e t i o n s was p r e v i o u s l y constructed i n our l a b (T. J . E l l i s and R. S. Cormack, unpublished data). A 5' overhang was generated by r e s t r i c t i o n d i g e s t i o n i n the vec t o r sequence f o l l o w i n g the 3'-end of a p a r t i a l rne gene c a r r i e d by a plasmid pGMlOl, (Cormack et a l . , 1993) . The p a r t i a l gene i n question contains an i n t a c t 5'-end but l a c k s residues 3' to a unique BamHI s i t e i n the rne coding region, corresponding to amino acids C-terminal to residue 844. The 3' overhang of the BamHI s i t e created a substrate f o r exonuclease I I I d i g e s t i o n i n t o the gene from i t s 3'-end. Varying i n c u b a t i o n p e r i o d l e d to d e l e t i o n s of d i f f e r e n t lengths (see Appendix). Nine C-terminal d e l e t i o n s were made by exonuclease I I I d i g e s t i o n and subsequent f u s i o n i n frame w i t h sequences i n the vec t o r . The encoded d e l e t i o n p r o t e i n s were named as RneACxxx with C representing the C-terminal d e l e t i o n and xxx, the end p o i n t of the d e l e t i o n i n the Rne amino a c i d sequence ( F i g . 3.2) Cult u r e s of the appropriate s t r a i n s were induced i n e a r l y or mid l o g phase growth w i t h 0.5 mM IPTG f o r 90 min. Whole c e l l l y s a t e s were separated by SDS-PAGE and v i s u a l i z e d by s t a i n i n g w i t h Commassie B r i l l i a n t blue. A l l d e l e t i o n p r o t e i n s were s u c c e s s f u l l y overexpressed and the bands corresponding to the truncated Rne p r o t e i n s represent the most abundant species ( F i g . 3.3A [N-terminally deleted p r o t e i n s ] and F i g u r e 3 .3 Overexpression of the Rne deletion proteins C u l t u r e s of s t r a i n s harbouring Rne d e l e t i o n mutants were grown at 37 °C to e a r l y l o g phase and then induced by 0.5 mM IPTG f o r 1.5 hr. C e l l s from 1 ml of c u l t u r e were c o l l e c t e d by c e n t r i f u g a t i o n , ruptured by b o i l i n g i n 12 0 ul of SDS sample b u f f e r . 2.5 | i l of each l y s a t e were loaded on a SDS-PAGE polyacrylamide g e l (7% g e l f o r N- t e r m i n a l l y truncated p r o t e i n s , 10% g e l f o r C - t e r m i n a l l y truncated p r o t e i n s ) . D u p l i c a t e g e l s were run simultaneously. One was s t a i n e d w i t h Coomassie B r i l l i a n t blue (panels A and C) . P r o t e i n s i n the second g e l were e l e c t r o b l o t t e d onto a n i t r o c e l l u l o s e membrane which was then subjected to Western b l o t t i n g u s i n g anti-Rne a n t i b o d i e s (panels B and D) . The membrane was developed c o l o r i m e t r i c a l l y ( s e c t i o n 2.5.1) . Panels A and B, overexpression of N - t e r m i n a l l y trunacted Rne p r o t e i n s . Lane 1: RneAN2 0 8 ; lane2: RneAN315; lane 3: RneAN4 0 8 ; lane 4: RneAN608; lane 5: RneAN722; lane 6: RneAN813. Panels C and D, overexpression of C-t e r m i n a l l y truncated Rne p r o t e i n s . Lane 1: RneAC132, lane 2: RneAC237; lane 3: RneAC250; lane 4: RneAC370; lane 5: RneAC517; lane 6: RneAC590; lane 7: RneAC632; lane 8: RneAC643; lane 9: RneAC697. The p o s i t i o n s of the C - t e r m i n a l l y truncated Rne p r o t e i n s i n each lanes are i n d i c a t e d by arrowheads (panel C). In a d d i t i o n , the p o s i t i o n of RneAC132 i s i n d i c a t e d by an arrowhead i n lane 1 of panel D. MW: molecular weight standards. S i z e s of the molecular weight standard are i n d i c a t e d i n kDa. Figure 3 .3 A, B c MW 1 2 3 4 5 6 7 8 9 Figure 3 . 3 C , D 3.3C [ C - t e r m i n a l l y d e l e t e d p r o t e i n s ] ) . I d e n t i c a l samples were separated simultaneously, e l e c t r o b l o t t e d onto a n i t r o c e l l u l o s e membrane and probed with p o l y c l o n a l anti-Rne a n t i b o d i e s . As shown i n F i g . 3.3B (N-t e r m i n a l l y d e l e t e d p r o t e i n s ) and 3.2D ( C - t e r m i n a l l y d e l e t e d p r o t e i n s ) , a l l overexpressed d e l e t i o n p r o t e i n s react w i t h the antiserum. Several p r o t e i n species of lower molecular weight a l s o r e a c t w i t h the antiserum and presumably represent degradation products ( F i g . 3.3D lanes 6-9). 3.2.2 Mapping the RNA-binding domain of Rne A s t r a i g h t f o r w a r d assay (Northwestern b l o t t i n g ) f o r probing RNA-p r o t e i n i n t e r a c t i o n s was devised i n our l a b o r a t o r y to detect a p u t a t i v e RNA-binding domain i n the Rne polypeptide (Cormack et al., 1993) . In a Northwestern b l o t , p r o t e i n samples e l e c t r o b l o t t e d onto a n i t r o c e l l u l o s e are probed w i t h 3 2 P - l a b e l l e d RNAs i n s t e a d of a n t i b o d i e s (see s e c t i o n 2.5.2). Cormack et a l . (1993) o r i g i n a l l y demonstrated that the f u l l -l ength Rne p o l y p e p t i d e and the f i r s t 844 residues encoded by pGMlOl i n t e r a c t w i t h a 9S RNA probe. To l o c a t e the RNA-binding domain (RBD) of the p r o t e i n , we t e s t e d the p r o t e i n product (s) of each d e l e t i o n i n an RNA b i n d i n g assay. B o i l e d whole e x t r a c t s were r e s o l v e d by SDS-PAGE, t r a n s f e r r e d onto a membrane, renatured in situ and were probed w i t h 3 2P-l a b e l l e d 9S RNA i n the presence of competitor yeast RNA (Cormack et al., 1993). Among C - t e r m i n a l l y d e l e t e d p r o t e i n s shown i n F i g . 3.4, RneAC632 (lane6) and RneAC643 (lane 7) d i s p l a y strong RNA b i n d i n g s i g n a l s , whereas d e l e t i o n p r o t e i n s s m a l l e r than RneAC632, such as RneAC517 (lanes 1, 2) and RneAC590 (lane 3, 4 ) , f a i l to b i n d s i g n i f i c a n t amounts of probe, although approximately equal amounts of p r o t e i n were loaded i n each lane of the g e l . Figure 3.4 Northwestern blotting: interactions between C-terminally truncated Rne pro teins and 9 S RNA Whole c e l l e x t r a c t s of induced or uninduced c u l t u r e s harboring appropriate C - t e r m i n a l l y truncated Rne mutants were separated on a 7% SDS-PAGE polyacrylamide g e l , e l e c t r o b l o t t e d onto a n i t r o c e l l u l o s e membrane, and probed with 3 P - l a b e l l e d 9S RNA ( s e c t i o n 2.5.2). The b l o t was exposed to a Phosphorstorage screen. The s t a t u s of i n d u c t i o n i s i n d i c a t e d on the top of the panel by '+' or x-'. Lanes 1, 2: RneAC517; lanes 3, 4: RneAC590; lanes 5, 6: RneAC632; lanes 7, 8: RneAC643. Notice that the two lanes f o r RneAC632 are reversed. To minimize n o n - s p e c i f i c b i n d i n g of the RNA to abundant p r o t e i n s as w e l l as to o b t a i n a r e l a t i v e measure of a f f i n i t y f o r RNA, e x t r a c t s c o n t a i n i n g s e l e c t e d N-terminal d e l e t i o n s were d i l u t e d 1:5 and 1:25 i n SDS sample, b u f f e r p r i o r to sep a r a t i o n and r e n a t u r a t i o n . As shown i n F i g . 3.5A, d e l e t i o n p r o t e i n s RneAN208 (lanes 1 and 6), RneAN315 (lanes 2 and 7), RneAN408 (lanes 4 and 8), and RneAN608 (lane 4 and 9) bind 9S RNA s t r o n g l y . The r e l a t i v e s t r e n g t h of each s i g n a l c o r r e l a t e s w e l l w i t h the d i l u t i o n (compare lanes 1-4 to lanes 6-9 i n F i g . 3.4A). The d e l e t i o n p r o t e i n RneAN722, on the other hand, d i s p l a y s a weak RNA binding a c t i v i t y at 1:5 d i l u t i o n ( F i g . 3.5A, lane 5) which disappears when e x t r a c t s are d i l u t e d 1:25 p r i o r to a n a l y s i s ( F i g . 3.5A, lane 10). E x t r a c t s c o n t a i n i n g d e l e t i o n p r o t e i n RneAN822 do not d i s p l a y a b i n d i n g s i g n a l even without d i l u t i o n ( F i g . 3.5B, lane 5). The i n t e n s e band (*) near the bottom of the g e l i n F i g . 3.5B represents b i n d i n g of the probe to a chromosomally encoded p r o t e i n which has been run o f f g e l s i n the preceeding f i g u r e s . These data enable us to d e f i n e the approximate boundaries of the RNA b i n d i n g domain. The N-terminal boundary of ,the RBD i s l o c a t e d between residues 590 and 632 sin c e RneAC590 l a c k s RNA binding a c t i v i t y whereas RneAC632 r e t a i n s i t . The C-terminal boundary of the RBD r e s i d e s between residues 643 and 722 although there may be a weak s i t e between residues 722 and 813 ( F i g . 3.6). 3.2.3 Location of a minimal RNA-binding s i t e within the Arg-rich region The sharp c o n t r a s t i n RNA b i n d i n g a c t i v i t i e s between RneAC590 and RneAC632 (Fig. 3.4, lanes 3 and 6) i m p l i e s that a strong RNA b i n d i n g Figure 3.5 Northwestern .blotting; interactions between N-terminally truncated Rne proteins and 9S RNA Whole c e l l l y s a t e s of c u l t u r e s c o n t a i n i n g a p p r o p r i a t e N - t e r m i n a l l y truncated Rne p r o t e i n s were d i l u t e d 1:5 or 1:25 i n SDS sample b u f f e r , resol v e d on a SDS-PAGE polyacrylamide g e l , t r a n s f e r r e d to a n i t r o c e l l u l o s e membrane, and probed with 3 2 P - l a b e l l e d 9S RNA ( s e c t i o n 2.5.2). The b l o t s were exposed to a Phosphorstorage screen. Panel A, 7% polyacrylamide g e l ; lanes 1-5, 1:5 d i l u t i o n s ; lanes 6-10, 1:25 d i l u t i o n s ; lanes 1, 6, RneAN208; lanes 2, 7, Rne AN315; lanes 3, 8, RneAN4 0 8 ; lanes 4, 9, RneAN6 08; lanes 5, 10, RneAN722. Panel B, 10% polyacrylamide g e l ; u n d i l u t e d samples; lanes 1, 2, RneAN408; lanes 3, 4, RneAN608; lanes 5, 6, RneAN813 w i t h i t s p o s i t i o n i n d i c a t e d by an arrow head. The s t a t u s of IPTG i n d u c t i o n i s i n d i c a t e d on the top of the panels. P o s i t i o n s of bands corresponding to d e l e t i o n p r o t e i n s are i n d i c a t e d on the r i g h t of the panels. IPTG + + + + + + + + + + RneAN208 RneAN315 RneAN408 RneAN608 RneAN722 1 2 3 4 5 6 7 8 9 10 + 1:5 • «« 1:25 • Dilution S1 Rne T ams-1 rne-3071 Arg- r ich D+E 3SSSSS3 RNA b ind ing s i te RNA b i n d i n g ac t i v i t y RneAC590 590 RneAN608 608 sssssf RneAC632 632 5 RneAC643 643 Î3 RneAN722 722 Figure 3.6 A strong RNA-binding site is located in the Arg-rich region The r e s u l t s of Northwestern b l o t t i n g , summarized on the r i g h t w i t h estimated s i g n a l strength, i n d i c a t e that there i s a strong RNA b i n d i n g s i t e i n the A r g - r i c h region, shown by double-headed arrow. The N-terminal boundary of the s i t e r e s i d e s between residues 590 and 632 while the C-terminal boundary i s l o c a t e d between residues 643 and 722. s i t e f o r 9S RNA l i e s w i t h i n the 42 amino acid s spanning residues 590-632. To p i n p o i n t the residues which are i n v o l v e d i n RNA b i n d i n g , we have constructed f i n e r d e l e t i o n s w i t h i n t h i s 42-amino-acid region. Because a small polypeptide might be p o o r l y expressed or might not bind to n i t r o c e l l u l o s e w e l l , we based our c o n s t r u c t s on RneAN208, an Rne d e l e t i o n which possesses l i t t l e RNase E a c t i v i t y (see below) but binds RNA e f f i c i e n t l y . F ive such d e l e t i o n s were made by PCR a m p l i f i c a t i o n using primers w i t h appropriate stop codons (Table 2.4 and F i g . 3.7) and are designated as RneAN208/xxx w i t h xxx r e p r e s e n t i n g the C-terminal extremity i n the Rne amino a c i d sequence. Whole c e l l l y s a t e s of the appropriate s t r a i n s were prepared f o l l o w i n g i n d u c t i o n by IPTG and were res o l v e d by SDS-PAGE. A l l d e l e t i o n p r o t e i n s were s u c c e s s f u l l y overexpressed ( F i g . 3.8A) and were assayed f o r RNA b i n d i n g . As shown i n F i g . 3.8B, d e l e t i o n p r o t e i n s RneAN206/590 (lane 1), RneAN208/602 (lane 2) and RneAN2 08/612 (lane 3) do not b i n d the probe. In c o n t r a s t , d e l e t i o n p r o t e i n s RneAN208/622 (lane 4) and RneAN208/632 (lane 5) r e t a i n RNA b i n d i n g a c t i v i t y w i t h the l a t t e r ' s being e q u i v a l e n t to that of i n t a c t Rne. The data i n d i c a t e that amino a c i d residues to the C-t e r m i n a l s i d e of residue 622 are s u f f i c i e n t t o generate a strong i n t e r a c t i o n w i t h 9S RNA. Since the d e l e t i o n p r o t e i n RneAN608 a l s o d i s p l a y s e f f i c i e n t RNA b i n d i n g a c t i v i t y i n the Northwestern assay, the region between residues 608 and 632 c o n s t i t u t e s a minimal RNA b i n d i n g s i t e w i t h s i g n i f i c a n t RNA-binding a c t i v i t y between residues 608 and 622(see s e c t i o n 3.3.2 and F i g . 3.14). S1 Rne T ams-1 rne-3071 Arg-rich S W V s Ç D+E 1061 RneAN208 208 RneAN208/590 590 RneAN208/602 602 RneAN208,612 612 RneÀN208/622 622 RneAN208/632 632 Figure 3.7 Rne deletion proteins with C-termini within the Arg-rich region Five d e l e t i o n s were constructed based on RneAN208. The r e s u l t i n g d e l e t i o n p r o t e i n s a l l i n i t i a t e at residue 208 and terminate at a newly-introduced stop codon w i t h i n the A r g - r i c h region. The coordinates of the C-termini are shown. The r e l a t i v e s i z e s of the d e l e t i o n p r o t e i n s i s expanded to i l l u s t r a t e the d e t a i l s of t h e i r C-termini. A Figure 3.8 Overexpression and Northwestern assays of deletion proteins with C-termini within the RBD Whole c e l l l y s a t e s of c u l t u r e s of appropriate s t r a i n s induced wit h IPTG were r e s o l v e d by SDS-PAGE (10% polyacrylamide g e l ) . The gels were subjected to s t a i n i n g (panel A) or Northwestern b l o t t i n g a gainst 32p-l a b e l l e d 9S RNA (panel B) (sec t i o n 2.5.2). Lane 1: RneAN208/590; lane 2: RneAN208/602; lane 3: RneAN208/612; lane 4: RneAN208/622; lane 5: RneAN208/632. *, see the t e x t (page 76). 3.2.4 RNase E a c t i v i t y of Rne deletions I t has been e s t a b l i s h e d that RNase E a c t i v i t y i s con f e r r e d by a s i n g l e polypeptide (Rne) encoded by the E. coli rne gene (Cormack et a l . , 1993). This permitted us to examine the nuclease a c t i v i t y of se v e r a l Rne d e l e t i o n p r o t e i n s . A t y p i c a l s u bstrate used i n the RNase E a c t i v i t y assays i s 9S RNA (Cormack and Mackie, 1992; Cormack et al., 1993). F i g 3. 9A i l l u s t r a t e s a schematic r e p r e s e n t a t i o n of 9S RNA. T r a n s c r i p t i o n from pJG9S produces the 246-nt 9S RNA (Table 2.2). RNase E cleavages at both s i t e s 'a' and (b' l i b e r a t e s p5S RNA (126 nts) between the s i t e s . 4S RNA (81 nts) i s the fragment 5' to s i t e 'a' wh i l e the fragment 3' to s i t e 'b' i s the 2S RNA (39 n t s ) , which normally are run o f f 6% g e l s . There are two prominent intermediates of RNase E processing of 9S RNA. 7S RNA (165 nts) i s a product of RNase E cleavage only o c c u r r i n g at s i t e 'a' and 8S RNA (207 n t s ) , cleavage only at s i t e 'b' ( F i g . 3.9A). 3.2.4.1 RNase E a c t i v i t y of truncated Rne proteins AS26 f r a c t i o n s have proven to be good sources of RNase E a c t i v i t y (Mackie, 1991) and are easy to o b t a i n (see s e c t i o n 2.3). Therefore, we f i r s t assayed the RNase E a c t i v i t y of s e l e c t e d Rne d e l e t i o n s p r o t e i n s i n AS26 f r a c t i o n s . 200 ng of t o t a l p r o t e i n was' used i n a 30uL r e a c t i o n (see s e c t i o n s 2.4 and 2.9.1). As shown i n F i g . 3.10A, the AS26 f r a c t i o n from s t r a i n GM4 02, which overexpresses the f u l l - l e n g t h Rne p r o t e i n (Cormack et al., 1993), d i s p l a y s strong RNase E a c t i v i t y . Most of 9S RNA substrate i s converted to 5S RNA a f t e r 5 minutes of i n c u b a t i o n (lane 2) and no 9S RNA i s present a f t e r 10 minutes (lane 3) . The AS26 B 8S 7S p5S 4S 2S G * A A G G A A - U ft ft G«U G A U U 0 0 C - G A - U U C U - A G-C G 5 S G G - C G A G A A A A - U C - G A A C A C - G G-C C - G G - C U » G G-C G-C G*U C - G I U C - G C - G G - C U»G A G G - C G - C U - A A - U G - C A - U U A G-C U-ft ft-U U-ft A - U C - G A - U G-C C - G A C - G H G - C U - A U - A i G-C x C - G 5'GAAGC-GAUUAAA-UAAARCAGftAUUU-ftUCAAAUftftftft-U3 ftft Ï Figure 3.9 RNase E cleavage sites on 9S RNA Panel A shows a schematic r e p r e s e n t a t i o n of the 9S RNA. The p o s i t i o n s of the two RNase E cleavage s i t e s are denoted w i t h l e t t e r s 'a' and (b' i n a d d i t i o n to arrows. The v a r i o u s cleavage products (2S-8S) are i n d i c a t e d on the r i g h t . Panel B shows the sequence and secondary-s t r u c t u r e of the 9S RNA (Cormack and Mackie, 1992). The 5S sequence i s l o c a t e d i n the stem and loop of the t h i r d h a i r p i n from the 5'-end. Two RNase E cleavage s i t e are shown. Figure 3.10 RNase E assays using AS26 fra c t i o n s AS26 f r a c t i o n s from s t r a i n s expressing f u l l - l e n g t h Rne p r o t e i n (Panel A) , RneAN208 (Panel B), and RneAN408 (Panel C) were assayed against 3 2P-l a b e l e d 9S RNA at 30 °C (s e c t i o n 2.9.1). 200 ng of t o t a l p r o t e i n was using i n each 30 uL r e a c t i o n . A l i q u o t s of 4 uL were withdraw at 0 min (Lane 1) , 5 min (Lane 2) , 10 min (Lane 3) , 20 min (Lane 4) , 40 min (Lane 5), and 60 min (Lane 6). Samples were quenched w i t h formamide and res o l v e d on 6% denaturing g e l s . Gels were exposed to Phosphorstorage screens. A 1 2 3 4 5 6 B 1 2 3 4 5 6 4; % ^. «fc. «m» <É^  •«- 9S - 8S •*- 7S - p5S 4S 1 2 3 4 5 6 9S f r a c t i o n from a s t r a i n expressing RneA208 d i s p l a y s very l i t t l e RNase E a c t i v i t y ( F i g . 3.10B). A f t e r 60 minutes of i n c u b a t i o n , only a f a c t i o n of 9S RNA i s cleaved ( F i g . 3.10B, lane 6). Most of products are r e s u l t s of s i n g l e RNase E cleavage, i n d i c a t e d by the r e l a t i v e l y prominent bands corresponding to 7S and 8S RNA. In c o n t r a s t , the AS26 f r a c t i o n from a s t r a i n expressing RneA408 f a i l s to cleave the s u b s t r a t e ( F i g . 3.10C) 3.2.4.2 RNase E assays using p u r i f i e d Rne protein and i t s derivatives Members of our l a b o r a t o r y have used the r e n a t u r a t i o n method to o b t a i n p u r i f i e d f u l l - l e n g t h Rne, RneAN208 and RneAN408 p r o t e i n s (Coburn et al., 1999) . Although Rne p r o t e i n p u r i f i e d by t h i s method i s not f u l l y a c t i v e (15% recovery of a c t i v i t y , Cormack et a l . , 1993), the p r o t e i n i s h i g h l y homogenous and f r e e of any a s s o c i a t e d p r o t e i n s (Cormack et a l . , 1993; Coburn et al., 1999). These p r o t e i n p r e p a r a t i o n s were assayed f o r RNase E a c t i v i t y on 9S RNA. 100 ng of each p u r i f i e d p r o t e i n was used i n a 30 uL r e a c t i o n . The f u l l - l e n g t h Rne p u r i f i e d from s t r a i n GM402 i s a c t i v e . A f t e r 2.5 min of i n c u b a t i o n , small amounts of the product, p5S RNA, are already present ( F i g . 3.11A, lane 2). A f t e r an hour of i n c u b a t i o n about 58% of the substrate i s converted i n t o product p5S and intermediates 7S and 8S RNAs ( F i g . 3.11A, lane 6). In c o n t r a s t , the RNase E a c t i v i t y of RneAN208 i s very l i m i t e d ( F i g . 3.11B). A f t e r an hour of i n c u b a t i o n , no p5S RNA i s generated ( F i g . 3.11B, lane 6) but intermediates 7S and 8S RNAs are produced i n small q u a n t i t i e s . The RneAN208 p r o t e i n i s apparently o n l y able to make a s i n g l e cleavage at e i t h e r s i t e 'a' or s i t e 'b' w i t h a preference f o r s i t e 'a' as the band corresponding to 7S RNA i s more intense than that Figure 3.11 RNase E assays using purified Rne protein and its derivatives F u l l - l e n g t h Rne p r o t e i n (Panel A) , RneAN208 (Panel B) and RneAN408 (Panel C) were p u r i f i e d u s i n g the r e n a t u r a t i o n method (Corburn et al., 1999) and assayed f o r RNase E a c t i v i t y a g ainst 9S RNA ( s e c t i o n 2.9.1). 100 ng of p u r i f i e d p r o t e i n were used i n each 30 |iL r e a c t i o n . A l i q u o t s were taken at 0 min (Lane 1), 2.5 min (Lane 2), 5 min (Lane 3), 10 min (Lane 4), 3 0 min (Lane 5), and 6 0 min (Lane 6). 1 2 3 4 5 6 w «an» «^ ** 9S 8S 7S p5S 4S B 1 2 3 4 5 6 9S 8S 7S pSS 4S 1 2 3 4 5 6 of 8S RNA ( F i g . 3.11B, lane 6 and F i g . 3.9). D e l e t i o n p r o t e i n RneAN408 i s completely i n a c t i v e against the 9S RNA s u b s t r a t e ( F i g . 3.11C). These r e s u l t s agree f u l l y w i t h the data obtained i n F i g . 3.10 u s i n g much cruder f r a c t i o n s . 3.2.4.3 Competition assays We sought to determine whether the c a t a l y t i c a l l y i n a c t i v e N-t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s would suppress RNase E a c t i v i t y of the f u l l - l e n g t h Rne p r o t e i n . In the f o l l o w i n g assays, an AS26 f r a c t i o n prepared from GM402 was combined w i t h AS26 f r a c t i o n s from s e v e r a l s t r a i n s expressing Rne d e l e t i o n p r o t e i n s . RNase E a c t i v i t y was assayed against 9S RNA s u b s t r a t e s . The r e s u l t s shown i n F i g . 3.12 are RNase E assays u s i n g 200 ng of Rne AS26 (Panel A) , 200 ng of Rne AS26 p l u s 100 ng of RneAN208 AS26 (Panel B) , 200 ng of Rne AS26 plu s 200 ng of RneAN208 AS26 (Panel C) , and 200 ng of Rne AS26 plus 400 ng of RneAN208 AS26 (Panel D) . The increase i n the p r o p o r t i o n of the AS26 f r a c t i o n from RneAN208 added to the r e a c t i o n does not appear to a f f e c t the RNase E a c t i v i t y of the f u l l - l e n g t h Rne p r o t e i n . A f t e r 5 minutes of i n c u b a t i o n , the m a j o r i t y of the s u b s t r a t e s i s converted to p5S product (see lane 2 of each panel i n F i g . 3.12). A f t e r 10 minutes of i n c u b a t i o n , a l l s u b s t r a t e s are f u l l y cleaved (lane 3 of each p a n e l ) . The increase i n p r o t e i n c o n c e n t r a t i o n (up to 600 ng of t o t a l p r o t e i n i n 30 uL re a c t i o n ) i n the assays has no e f f e c t on RNase E a c t i v i t y . There i s some cleavage of the substrates at 0 minute of the i n c u b a t i o n (Lane 1 of each panel) . This i s l i k e l y due to the delay between enzyme a d d i t i o n and sampling. 1 2 3 4 5 6 B 1 2 3 4 5 6 1 2 3 4 5 6 D 1 2 3 4 5 6 TP-** % •:?•>• ^ 9S •*- pSS -«- 9S pSS Figure 3.12 Compétition assays (I) An AS26 f r a c t i o n from s t r a i n GM402 was combined with various amounts of an AS26 f r a c t i o n from the s t r a i n overexpressing RneAN208. The mixtures were assayed against 9S RNA as described i n the legend to Figure 3.10 and s e c t i o n 2.9.1. Panel A: 200 ng of Rne AS26; panel B: 200 ng of Rne AS26 + 100 ng of RneAN208 AS26; panel C: 200 ng of Rne AS26 + 200 ng of RneAN208 AS26; panel D: 200 ng of Rne AS26 + 400 ng of RneAN208 AS26. A 1 2 3 4 5 6 B 1 2 3 4 5 6 9S pSS 1 2 3 4 5 6 « - 9S « - pSS * - 9S p5S 1 2 3 4 5 6 •- 9S •- PSS Figure 3.13 Competition assays (II) An AS26 f r a c t i o n from s t r a i n GM402 was combined with various amounts of an AS26 f r a c t i o n from the s t r a i n overexpressing RneAN408. The mixtures were assayed against 9S RNA as described i n the legend to Figure 3.10 and s e c t i o n 2.9.1. Panel A: 200 ng of Rne AS26; panel B: 200 ng of Rne AS26 + 50 ng of RneAN408 AS26; panel C: 200 ng of Rne AS26 + 100 ng of RneAN408 AS26; panel D: 200 ng of Rne AS26 + 200 ng of RneAN208 AS26. An AS26 f r a c t i o n prepared from a s t r a i n expressing RneAN408 was a l s o combined w i t h an AS26 f r a c t i o n form GM402 and assayed against 9S RNA (F i g . 3.13). As shown i n F i g . 3.13A and B, a d d i t i o n of 50 ng of AS26 f r a c t i o n from RneAN408 does not n o t i c e a b l y a f f e c t the RNase E a c t i v i t y (compare lanes 1-3 of F i g . 3.13A and B) . However, a d d i t i o n of 100 ng of AS26 f r a c t i o n from RneAN408 decreases the r a t e of pro c e s s i n g . A f t e r 10 minutes of in c u b a t i o n , 20% of f u l l - l e n g t h s u b s t r a t e remains (F i g . 3.13C, lane 3), whereas without e x t r a c t mixing, a l l the 9S substrate i s converted to p5S RNA a f t e r 10 minutes ( F i g . 3.13A, lane 3). A d d i t i o n of 200 ng of an AS26 f r a c t i o n from RneAN408 exe r t s a more pronounced e f f e c t : a f t e r 10 minutes of i n c u b a t i o n , only -50% of the substrate i s cleaved ( F i g . 3.13D, lane 3). Therefore, RneAN408 p r o t e i n shows an i n h i b i t o r y e f f e c t on the RNase E a c t i v i t y of the f u l l - l e n g t h Rne p r o t e i n , suggestive of dominant-negative behaviour. 3.3 Discussion 3.3.1 Overexpression of Rne deletions mutants We achieved a high degree of overexpression of the N - t e r m i n a l l y truncated Rne p r o t e i n s , accounting f o r a s u b s t a n t i a l q u a n t i t y of the t o t a l p r o t e i n ( F i g . 3.3A and B). This c o n t r a s t s to the ob s e r v a t i o n that the overexpression of plasmid-borne f u l l l e ngth Rne p r o t e i n i s very l i m i t e d (Cormack et a l . , 1993). The f a c t that the N - t e r m i n a l l y Rne p r o t e i n s g e n e r a l l y l a c k RNase E a c t i v i t y permits t h e i r strong expression without e l i c i t i n g t o x i c i t y . The C - t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s , on the other hand, d i s p l a y e d more l i m i t e d overexpression (Fi g . 3.3C and D) . On a Coomassie b l u e - s t a i n e d g e l of whole c e l l e x t r a c t s , the bands rep r e s e n t i n g the C - t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s do not a t t a i n the same prominence as the N - t e r m i n a l l y truncated p r o t e i n s . In some cases, the expression i s v i r t u a l l y -inconspicuous i f not compared to c e l l e x t r a c t s from uninduced c u l t u r e s or c u l t u r e s c o n t a i n i n g no corresponding rne d e l e t i o n s (e.g., RneAC132, RneAC237, RneAC250, RneAC517, RneAC643 and RneAC697; F i g . 3.3C lanes 1, 2, 3, 5, 8 and 9) . The l e s s e r degree of overexpression of the C-t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s can be a t t r i b u t e d to the RNase E a c t i v i t y r e s i d i n g i n the N-terminal p o r t i o n of the polypeptide. Consequently, t o x i c i t y i s r a i s e d by the h i g h - l e v e l expression of the truncated p r o t e i n . A l t e r n a t i v e l y , the C - t e r m i n a l l y truncated Rne p r o t e i n s may be turned over r a p i d l y , preventing t h e i r accumulation. 3.3.2 The RNA-binding domain (RBD) of the Rne protein The f u l l - l e n g t h Rne p r o t e i n d i s p l a y s strong RNA-binding a c t i v i t y i n Northwestern RNA b i n d i n g assays (Cormack et al., 1993) . The Northwestern assay allows a q u a l i t a t i v e d e t e c t i o n of RNA-binding of a p o l y p e p t i d e without p u r i f y i n g i t . The assay depends on the a b i l i t y of the f u l l - l e n g t h Rne polypeptide to be renatured in situ to an extent which r e t a i n s or regains the RNA-binding c a p a c i t y . The assumption i s a p p l i c a b l e to Rne d e r i v a t i v e s constructed i n t h i s study. The N-t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s RneAN208, RneAN315, RneAN408 and RneAN608 a l l d i s p l a y e d strong RNA-binding a c t i v i t i e s a f t e r being subjected to 5 - f o l d or 2 5 - f o l d d i l u t i o n i n the presence of competitor RNA (250 ug/ml yeast RNA) . This i n d i c a t e s that a strong RNA-binding domain i s l o c a t e d i n the residues beyond residue 608. The sequence N-t e r m i n a l to r e s i d u e 608 i s not r e q u i r e d to r e c o n s t i t u t e RNA-binding a c t i v i t y . The i n t e r e s t i n g sharp c o n t r a s t w i t h the l a c k of b i n d i n g by RneAN590 and the strong RNA-binding of RneAC632 suggests that the 42 amino a c i d s between residues 590 and 632 are r e s p o n s i b l e f o r i n t e r a c t i n g w i t h 9S RNA. These 42 amino acid s are a part of the a r g i n i n e - r i c h r e g i o n of the Rne p r o t e i n (Taraseviciene et a l . , 1995), (McDowall and Cohen, 1996) . RneAN722 i s a p e c u l i a r case. D i l u t i o n of a whole c e l l l y s a t e f i v e - f o l d i n SDS b u f f e r r a i s e d a much weaker RNA-bind i n g s i g n a l ( F i g . 3.5A lane 5). Further i n s p e c t i o n of the amino a c i d sequence revealed an a r g i n i n e c l u s t e r beyond re s i d u e 722 (residue 776-816). RneAN813, which contains only p a r t of t h i s c l u s t e r and a la r g e number of n e g a t i v e l y charged residues, f a i l e d to b i n d any 9S probe. Further d i s s e c t i o n of the re g i o n between re s i d u e s 590 and 632 revealed a minimal RNA-binding s i t e . Since RneAN208/622 e x h i b i t s RNA-bind i n g c a p a c i t y comparable to that by RneAN608 whereas RneAN208/612 does not bind 9S RNA, the sequence spanning residues 608 and 622 i s the minimal requirement (Fig.3.14) The minimal s i t e 'RRKPRQNNRRDRNER', i n c l u d i n g 7 a r g i n i n e s and 1 l y s i n e , bears the hallmark of an a r g i n i n e -r i c h RNA-binding motif (ARM)(Burd and Dreyfuss, 1994). The a r g i n i n e - r i c h RNA-binding m o t i f s are a c l a s s of r e l a t i v e l y short RNA-binding sequences w i t h a high content of a r g i n i n e s and other p o s i t i v e l y charged residues (Burd and Dreyfuss, 1994). There i s no d e f i n i n g consensus sequence ( F i q . 3.15). The two b e s t - s t u d i e d prototype ARMs are found i n the Rev and Tat p r o t e i n s of human immunodeficiency v i r u s type 1 (HIV-1) (Roy et a l . , 1990; Tan et a l . , 1993). L i k e most ARMs, both i n t e r a c t i n s o l u t i o n w i t h s p e c i f i c RNA s t r u c t u r a l elements, i e . stemloops. The RNA stemloops possess e i t h e r an i n t e r n a l loop ( B a r t e l et a l . , 1991) or an i n t e r n a l bulge ( P u g l i s i et a l . , 1993) to open up the otherwise narrow major groove of the RNA double h e l i x ( B a t t i s t e et a l . , 1996). ARMs adopt d i f f e r e n t conformations depending on the RNA s i t e . The peptide c o n t a i n i n g Rev ARM adopts an a - h e l i c a l R n e S1 ams-1 rne-3071 Arg-r ich -ve 1061 RNA b ind ing act iv i ty R n e A N 2 C S 6 1 2 R n e A N 2 0 8 . 6 2 2 R n e A N 6 0 8 612 622 608 BSSSSC m RRKPRQNHRRDRNER Figure 3.14 Identification of a minimal RNA binding site Combining Northwestern b l o t t i n g data, shown on r i g h t , the region between residues 608 and 622 represents a minimal RNA-binding s i t e . Of the t o t a l of 15 res i d u e s , 8 are p o s i t i v e l y charged res i d u e s : 7 a r g i n i n e s and 1 l y s i n e (underlined). H I V R e v T R Q A R R N R R R R W R E R Q R H I V T a t Y G R K K R R Q R R R P B I V T a t S G P R P R G T R G K G R R I R R X N G S M D A Q T R R E R R A E K Q A Q W K A A N R n e R R K P R Q N N R R D R N E R Figure 3.15 Sequence comparison of arginine-rich RNA-binding motifs Sequences of a r g i n i n e - r i c h RNA-binding m o t i f s from human immunodeficiency v i r u s type 1 Rev and Tat p r o t e i n s , bovine immunodeficiency v i r u s Tat p r o t e i n , bacteriophage X N p r o t e i n and the E. coli Rne p r o t e i n are l i s t e d . A r g i n i n e (R) and l y s i n e (K) residues are underlined. The sequences vary i n length, i n spacing of b a s i c residues, and i n content of b a s i c r e s i d u e s . There i s no consensus sequence. s t r u c t u r e i n s o l u t i o n (Tan et al., 1993), whereas the peptide c o n t a i n i n g Tat ARM i s unstructured i n the absence of RNA and adopts an a - h e l i c a l conformation upon b i n d i n g to RNA (Calnan et a l . , 1991; Tan and F r a n k e l , 1995) . The conformational v e r s a t i l i t y of ARMs i s a l s o demonstrated by the ARM peptide from bovine immunodeficiency v i r u s Tat p r o t e i n which forms an i r r e g u l a r (3-hairpin conformation upon b i n d i n g an RNA i n t e r n a l bulge ( P u g l i s i et al., 1995). Nearly a l l ARM-RNA i n t e r a c t i o n s s t u d i e d to date show va r i o u s RNA groove b i n d i n g s t r a t e g i e s i n which the RNA r e c o g n i t i o n s i t e s are A-form double h e l i x e s i n t e r r u p t e d by mismatches, bulges, or loops (Draper, 1999) . As the general endoribonuclease i n i t i a t i n g bulk mRNA decay, RNase E i s p r i m a r i l y s i n g l e - s t r a n d - s p e c i f i c and the RNase E-RNA i n t e r a c t i o n may not n e c e s s i t a t e a high degree of s p e c i f i c i t y . In the case of the RBD-9S i n t e r a c t i o n , the accepted 9S RNA secondary s t r u c t u r e contains four stemloops, r e p r e s e n t i n g s e v e r a l p o t e n t i a l b i n d i n g s i t e s f o r ARMs (Fi g . 3.9B). Kaberdin et a l . (2000) have shown that an RNase E d e r i v a t i v e (residues 498-844) binds to 9S processing intermediates 7S RNA and the non-overlapping 4S RNA but not d i r e c t l y to the RNase E cleavage s i t e s . The contacts do not appear to be r e s t r i c t e d to a p a r t i c u l a r s i t e . Therefore, the RNA-binding mechanism of the minimal a r g i n i n e - r i c h RNA-binding s i t e may be a simple e l e c t r o s t a t i c i n t e r a c t i o n between p o s i t i v e l y charged residues (Arg and Lys) and n e g a t i v e l y charged RNA backbone phosphates, r a t h e r than the p r e c i s e m u l t i p l e c ontacts between s p e c i f i c a r g i n i n e s and bases/backbone phosphates of t a r g e t RNA employed by v i r a l Rev and Tat p r o t e i n s . This i n t e r a c t i o n may a l s o be t r a n s i e n t but i s able t o strengthen the a f f i n i t y of RNase E f o r i t s s u b s t r a t e s . We have shown that the A r g - r i c h minimal RNA-binding s i t e i s r e q u i r e d f o r i n t e r a c t i n g w i t h 9S RNA. To determine whether i t i s s u f f i c i e n t f o r RNA-binding and to i n v e s t i g a t e i t s s p e c i f i c i t y , one of the f u t u r e s t r a t e g i e s would be to fuse t h i s short peptide to a p r o t e i n w i t h no RNA-binding a c t i v i t y such as GST or maltose-binding p r o t e i n and t e s t the f u s i o n p r o t e i n i n RNA-binding assays. 3.3.3 The c a t a l y t i c s i t e of the Rne protein I t i s apparent from t h i s work that the N-terminal p o r t i o n of the Rne p r o t e i n contains the c a t a l y t i c s i t e . This corroborates f i n d i n g s by many others (Taraseviciene et a l . , 1995; McDowall and Cohen, 1996; Kaberdin et al., 1998; J i a n g et al., 2000). The c a t a l y t i c a l l y i n a c t i v e RneAN408 i n d i c a t e s that the f i r s t 407 amino a c i d s of the Rne p r o t e i n c o n t r i b u t e d i r e c t l y or i n d i r e c t l y to the c a t a l y t i c domain which must l i e i n the f i r s t 427 aa (Ow et a l . , 2000). Furthermore, p u r i f i e d RneAN208 d i s p l a y e d p a r t i a l a c t i v i t y . This suggests t h a t the c a t a l y t i c s i t e i s l o c a t e d between residues 208 and 407. C u r i o u s l y , RneAN208 can only make s i n g l e cleavages on 9S RNA. The mono-phosphorylated 3' cleavage product appears to be s t a b l e during the course of the experiment. In c o n t r a s t , i n the a c t i v i t y assay u s i n g f u l l - l e n g t h Rne, s u b s t a n t i a l amounts of p5S RNA are produced when the percentage of RNase cleavage i s s i m i l a r ( F i g . 3.11, compare lane 2 or 3 of panel A to lane 6 of panel B) . Therefore, RneAN208 has l i k e l y l o s t the 5'-end-dependence of RNase E (Mackie, 1998). The key r e s i d u e s which c o n s t i t u t e the proposed "phosphate pocket' ( S p i c k l e r et a l . , 2001, see s e c t i o n 1.5.1) may, t h e r e f o r e , r e s i d e w i t h i n the f i r s t 207 a.a. (Jiang et a l . , 2000; Tock et a l . , 2000), p o s s i b l y i n the SI domain. The N-terminal 207 residues may a l s o p l a y a r o l e i n maintaining the s t r u c t u r a l i n t e g r i t y of the c a t a l y t i c s i t e . S i m i l a r l y , mutations ams-1 and rne-3071 l i k e l y d i s r u p t t h i s s t r u c t u r a l i n t e g r i t y and l e a d to l o s s of f u n c t i o n under nonpermissive temperatures (McDowall et al., 1993). The c o m p e t i t i o n assays have provided a d d i t i o n a l c o r r o b o r a t i n g evidence f o r the c a t a l y t i c s i t e and the r o l e of the RBD. RneAN208, although much l e s s a c t i v e than the f u l l - l e n g t h Rne p r o t e i n , does generate 5' mono-phosphorylated RNA species which i n t u r n are r a p i d l y processed by the f u l l - l e n g t h Rne. RneAN408, however, i s completely i n a c t i v e . . I t s t i l l possesses strong RNA-binding a c t i v i t y equal to that of RneAN208. Thus, RneAN408 l i k e l y competes with the f u l l - l e n g t h Rne p r o t e i n f o r b i n d i n g s u b s t r a t e s . A l t e r n a t i v e l y , the truncated RneAN408 may form mixed oligomers w i t h the f u l l - l e n g t h Rne p r o t e i n . This would imply that RNase E can d i s s o c i a t e under assay c o n d i t i o n s and that i t f u n c t i o n s as a dimer or higher oligomer. A l l enzymatic assays shown here were done i n a q u a l i t a t i v e manner. From t h i s work we have i d e n t i f i e d a r e gion where the c a t a l y t i c s i t e r e s i d e s and l a i d the foundation f o r f u r t h e r i n v e s t i g a t i o n s such as s i t e - d i r e c t e d mutagenesis. I t w i l l be necessary to c a l c u l a t e s p e c i f i c k i n e t i c parameters (eg. Km; Vraax; c a t a l y t i c e f f i c i e n c y ) of any proposed mutants i n q u a n t i t a t i v e assays to c o n c l u s i v e l y c h a r a c t e r i z e the c a t a l y t i c domain of RNase E. Chapter IV Structure-function relationships of PNPase domains 4.1 General overview Since i t s di s c o v e r y i n the 1950's (Grunberg-Manago, 1955), va r i o u s f u n c t i o n s have been a t t r i b u t e d to p o l y n u c l e o t i d e phosphorylase (PNPase), i n c l u d i n g p h o s p h o r y l y t i c 3'-exonuclease (Donovan and Kushner, 1986), template-independent RNA polymerase ( L i t t a u e r , 1982) and c o l d -shock p r o t e i n (Jones et al., 1987). As f a r as mRNA turnover i s concerned, PNPase i s one of two major 3' exoribonucleases (RNase I I i s the other) degrading mRNA fragments generated by the i n i t i a l e n d o n u c l e o l y t i c c l e a v a g e ( s ) . I t accounts f o r -10% of exoribonuclease a c t i v i t y i n mRNA turnover under normal p h y s i o l o g i c a l c o n d i t i o n s (Deutscher and Reuven, 1991). Though c a t a l y t i c a l l y d i f f e r e n t , both PNPase and RNase I I are s i n g l e - s t r a n d s p e c i f i c . T h e i r a c t i o n s are e a s i l y impeded by s t a b l e RNA secondary s t r u c t u r e such as stem-loops at 3' ends ( S p i c k l e r and Mackie, 2000). Continuous a d e n y l a t i o n of 3' ends of t a r g e t RNAs by poly(A) polymerase circumvents these o b s t a c l e s by p r o v i d i n g e n t r y p o i n t s f o r exonucleases (Coburn and Mackie, 1998). As a member of the degradosome, PNPase supports another mechanism to overcome h i g h l y s t r u c t u r e d RNA 3'-ends. An important f e a t u r e f o r t h i s mechanism i s p r o t e i n - p r o t e i n i n t e r a c t i o n s w i t h i n the degradosome, i . e . between RNase E and PNPase and between RNase E and RhlB (Vanzo et a l . , 1998). The C-terminal p o r t i o n of RNase E serves as a s c a f f o l d to b r i n g RhlB and PNPase i n a c l o s e p r o x i m i t y . The RNA h e l i c a s e a c t i v i t y of RhlB i s a c t i v a t e d by the RNase E-RhlB i n t e r a c t i o n (Vanzo et a l . , 1998). The stem of an RNA h e l i x i s thus unwound and subsequently the newly generated ssRNA i s exposed to PNPase. N - t e r m i n a l l y truncated Rne p r o t e i n s , RneAN208 and RneAN408, r e s p e c t i v e l y , are capable of forming a 'minimal degradosome' w i t h p u r i f i e d PNPase and RhlB in vitro (Coburn et al., 1999). These minimal degradosomes are f u n c t i o n a l l y a c t i v e as 3' exonucleases and r e a d i l y d i g e s t RNAs wi t h h i g h l y s t r u c t u r e d 3'-ends such as malEF and rpsT(268-447)-poly (A) i n the presence of ATP and Na-phosphate (Coburn et al., 1999). This 3'-dégradâtive a c t i v i t y i s independent of RNase E a c t i v i t y , f o r RneAN208 has very l i m i t e d e n d o n u c l e o l y t i c a c t i v i t y w h i l s t RneAN408 i s c a t a l y t i c a l l y i n a c t i v e (see s e c t i o n 3.2.4). Conversely, degradosomal i n t e r a c t i o n s appear to be dispensable f o r RNase E-mediated c a t a l y s i s . Rne mutants l a c k i n g the C-te r m i n a l 400 residues d i s p l a y the c h a r a c t e r i s t i c 5'-end-dependent e n d o n u c l e o l y t i c a c t i v i t y of RNase E (Jiang et al., 2000; Tock et al., 2000). While RNase E c l e a r l y d i s p l a y s a modular, s e p a r a t e l y - f o l d e d domain s t r u c t u r e ( c a t a l y t i c N-terminus, c e n t r a l RNA-binding, p r o t e i n -i n t e r a c t i n g C-terminus), there was l i m i t e d i n f o r m a t i o n regarding the domain s t r u c t u r e of PNPase u n t i l the very recent determination of the s t r u c t u r e of PNPase from Streptomyces antibioticus to 2.6 À r e s o l u t i o n ( L i t t a u e r , 1982; Symmons et a l . , 2000). There are two well-recognized RNA-binding m o t i f s at the C-terminus of the Pnp polypeptide, the KH and the SI m o t i f s . These RNA-binding mo t i f s may c o n t r i b u t e to the preference of PNPase f o r p d l y ( A ) - r i c h RNAs ( L i s i t s k y et a l . , 1997). The C-terminal RNA-binding m o t i f s are a l s o s e n s i t i v e to p r o t e o l y s i s and expendable f o r c a t a l y s i s ( L i t t a u e r , 1982). The atomic s t r u c t u r e s of the KH domain of human FMR1 p r o t e i n and the SI domain of E. coli PNPase have been so l v e d i n d i v i d u a l l y (Musco et a l . , 1996; B y c r o f t et al., 1997) . However, they do not provide more i n s i g h t i n t o how PNPase i s organized. Since PNPase and RNase PH are the o n l y p h o s p h o r o l y t i c exonucleases. i n E.coli and the two a l s o share a 41% s i m i l a r i t y (23% i d e n t i t y ) i n amino a c i d sequence, i t i s conceivable that the RNase PH-homology r e g i o n of PNPase represents the c a t a l y t i c s i t e . Although a c r y s t a l s t r u c t u r e f o r PNPase i s now a v a i l a b l e (Symmons et a l . , 2000), t h i s p r o j e c t was begun w e l l before the r e l e a s e of the coordinates. There i s s u f f i c i e n t sequence data a v a i l a b l e i n p u b l i s h e d form and on the I n t e r n e t to p r e d i c t the boundaries of domains i n the Pnp p r o t e i n . In t u r n , a set of mutants was c o n s t r u c t e d to i s o l a t e p r e d i c t e d domains from one another. Thus i t was p o s s i b l e to a s s i g n f u n c t i o n s to domains i n f u n c t i o n a l assays and to c o r r e l a t e the r e s u l t s w i t h the c r y s t a l s t r u c t u r e when i t became a v a i l a b l e . 4.2 Results 4.2.1 Sequence analysis of the E.coli PNPase PNPase i s widely d i s t r i b u t e d i n b a c t e r i a and p l a n t s . There are 30 e n t r i e s i n SWISS-PROT/TrEBML and more than 70 e n t r i e s i n GeneBank, some of which are redundant (websites: http://www.ncbi.nlm.nih.gov, http://expasy.cbr.nrc.ca/sprot). The E.coli PNPase c o n s i s t s of 711 amino a c i d s , and most of i t s counterparts i n other b a c t e r i a are of s i m i l a r l e n g t h (600-700 a.a.) w i t h some exceptions (see below). Alignments of 6 b a c t e r i a l and 2 p l a n t (one c h l o r o p l a s t , one c y t o s o l ) PNPase p r o t e i n sequences show extensive s i m i l a r i t y at the l e v e l of amino a c i d sequence ( F i g 4.1) . In f a c t , the sequences from the four gram-negative b a c t e r i a are almost i d e n t i c a l ( F i g . 4.1, the f i r s t f our sequences). The sequence s i m i l a r i t y among the PNPases i s a l s o manifested i n domain o r g a n i z a t i o n s . For example, the N-terminal p o r t i o n Figure 4.1 Sequence alignment of Pnp proteins Amino a c i d sequences of s i x b a c t e r i a l and 2 p l a n t Pnp p r o t e i n s are a l i g n e d u s i n g ClustalW i n d e f a u l t s e t t i n g s (http://www2.ebi.ac.uk/clustalw/). Residues conserved among a l l 8 sequences are shaded black. P a r t i a l l y conserved residues are shaded grey. The residues that c o n s t i t u t e the proposed phosphate b i n d i n g s i t e are shaded green and denoted by A . The three conserved Asp residues are shaded red and denoted by • . ECOLI: E.coli. YEREN: Yersinia enterocolitica. PHOLU: Photorhabdus luminescens. HAEIN: Haemophilus influenzae. STRAN: Streptomyces antibioticus. BACSU: B a c i l l u s subtilis. SPIOL: Spinacia oleracea. PISSA: Pisum sativum. E C O L I : M g N Y E R E N : Y K D T I L g T P H O L U : M g N H A E I N : J JN S T R A N : M E N E T H Y A E B A C S U : M G Q E B P I O L I 8 S L T H B C P H 8 B T L P 8 8 H 8 K N C K I L L 8 A S A L S R Y R T F K T L A S L H R L L P T N B H G K K F N V R A M A Q T H V S Q K H A H D S g Q P I S S A : M L A C T N B I F H G P A T F H R Q B H P B K F L L B K P L L F P R L P R W N F G K L K F N 8 H F B S K N B C - R R F N V K S S V N 8 B S E V L E B I D V S V P H S S g Q E C O L I Y E R E N P H O L U H A E X N S T R A N B A C S U S P I O L P X S S A P I B R K F Q H P X H R K F Q R P I S R K F Q R P I S K Q F K Q A V B D N G P Y S V K I P ™ K H S L K I P V A K l T A S T A S I M S D X P S E P S L N D T P 8 E P S g s S K A I T K D H I | H E Q Q Q > E Q Q Q ^ D Q Q Q A Q Q Q Q \ ;DAAKPFI1 H E E X K R | D A V R J D M D W - Q P E P V N E A g D W - H A E P V N E A g D M - V P E P V N Q A H D W - V A P Q P N T D H T G E F P V P B B T T R T T S E I - K L F E I D E E j ? I D - A I K L P P P E g I D - A I K L P P P E ? N A R H A A Q Q E A R I B DJSY R | H A R B A E J A A R I G D W F H D R K A E R E S R I G D B Y R U x N K R K A 3 5 E A R H G D J Y R | S E A I B A A V R P E I S A Q L N E K I K A ^ E S D I L K Q I Y K H B E E W J G D E B V H H L ' Y K H | E E S ^ D E | V K V L Q | | f g S E T I A T ^ L A Q D S T L D E N R • a A D J T E A H L A » D D T L D > S D E S T A A H L E H D ^ T L E E J ) D ™ I A Q H T A H D3 E X 8 E G K M A A E K B L em F S J G R - E F M A B V A K F E D ^ E H D E D T I K g E K f f l V D l f f l T Q R G Y V G - K S V A T V X P E T L P D L Y V D E E E D - E g V W D G E R Q L K I Q T B N G F V I D I 8 T P R S N A E T I A E I L E D E D - E S V I V D G I S A  | K Q  I D E G D V H I K I D E G D V H I K E C O L I Y E R E N P H O L U H A E X N S T R A N B A C S U S P X O L P X 8 S A L G S J H E K D v S B s [ i G B ^ E K N v H g S A Y R PW P S S 8 8 A E ES K E S V K N E K E T T S K Y . . . K E J S T S K F U G D V S D K Q M C " D N E 3 K £ E C O L X Y E R E N P H O L U H A E X N S T R A N B A C S U S P X O L P I S 8 A E C O L X Y E R E N P H O L U H A E X N S T R A N B A C S U S P X O L P X S S A E C O L I Y E R E N P H O L U H A E I N S T R A N B A C S U S P I O L P I S S A T T — 3 E M G P i •• ; T \ !• 1 A Q T T T — I D ^ A D O T I K I A B T T T — D O T V K T A B T T 8 — B D 3 D 5 D O T V h" I A H V A E — HT 3 3 D O T I s I G Ç A V K — i •• w i 3 1 S S T V E A B P T ^ E D G T V V X T J R X E A B D T f â B f-1 F Q K 1 E K A K H A I R F i D K A K H A I R F ; E K A K H A I E ]8 N A A K N V H G R • P A A E A A R A T B JE B G N Q K A K K I | J L E S L E K S K I L E K S K A l l 6 1 3 £ 1 6 6 1 3 6 1 2 6 4 0 6 1 4 7 4 3 V 5 Q A D K A D K A D K A E E R K L A G G K A L E S P S Y J S S G W E C O L X T E Q 8 Q P A A A P E A P A A B Q G E 7 1 1 Y E R E N T T P D A E A P A P E A A E : 7 1 1 P H O L U T A G T A V E E A P P A P Q 8 A E 7 0 9 H A E I N : A P K Q E T E I N Q E D S V E E Q E - : 7 0 9 S T R A N I E G E E A A 8 D E K K O D A B Q : 7 4 0 B A C S U : L R E B K B K B B Q Q S 7 0 5 S P X O L : L : 6 2 2 P I S S A : L P D A D B D N S N : B 4 0 of the E.coli PNPase contains two r e l a t e d domains, PH' (residues 1-210) and PH (residues 312-541), connected v i a a l i n k e r (residues 211-310) unique to PNPase f a m i l y p r o t e i n s . The highest s i m i l a r i t y occurs i n the PH and PH' domains w i t h r e l a t i v e long s t r e t c h e s of i d e n t i c a l residues ( F i g . 4.1) . The PH domain i s homologous to the smaller RNase PH. The two PH domains share 44% s i m i l a r i t y , prompting the suggestion that PNPase i s d e r i v e d from a s e l f - d u p l i c a t i o n of the gene f o r RNase PH (Mian, 1997) . The l i n k e r region, on the other hand, v a r i e s from one species to another w i t h only l i m i t e d s i m i l a r i t y i n the sequences examined. However, i t i s more conserved among gram-negative b a c t e r i a ( F i g . 4.1, the f i r s t f o u r sequences). The C-terminal p o r t i o n of PNPase contains two RNA-binding mo t i f s , KH (residues 551-591) and SI (residues 622-690) , whose atomic s t r u c t u r e s have been w e l l c h a r a c t e r i z e d (Musco et a l . , 1996; B y c r o f t et a l . , 1997). The KH and the SI domain are a l s o conserved. The sequence alignment suggests that the o r g a n i z a t i o n of the p r o t e i n and the mechanisms of PNPase enzymatic func t i o n s are s i m i l a r i n d i f f e r e n t s p e c i e s . Not a l l PNPases are large (600-700 amino acids) p r o t e i n s . There are two i n t e r e s t i n g examples of smaller PNPases. The Dichelobacter nodosus PNPase i s composed of 251 amino a c i d s , and the Staphylococcus aureus PNPase, 277 amino a c i d s . Both p r o t e i n s are i d e n t i f i e d as PNPase but not as RNase PH because of high homology to the E. coli PNPase (-60% i d e n t i t y ) , more s p e c i f i c a l l y , to the PH domain (Fig. 4.2). In a d d i t i o n , n e i t h e r d i s p l a y s strong resemblance to the E. coli RNase PH though i t i s of s i m i l a r s i z e (238 a.a.). The f i n d i n g that the PH domain e x i s t s i n a tandem p a i r or as a s i n g u l a r e n t i t y i n various known PNPases r e i n f o r c e s the s p e c u l a t i o n that i t c o n s t i t u t e s the c a t a l y t i c E C O L I : RGETQg^TAOTGTARDAtW<«|i:EffMGHRnDTnBFtl>'«}IJJPt'i--t'fe: DICNO : S T A A U : B Ï S V C J B A P L G E Et!lBM\^^Kl:l:H<^!tfR(>AKraGaLA!B!nDMDKj-i'A4>i:WisB ^RAt^dJJallijifiJAniGEl^lAnAQnn-SEEDiJ-i'JiitiiJWlAB 430 B l E C O L I DICNO S T A A U S L A L M D A G V P I R PV AG I AM G L I KE ET LALHDAGV P I K A 8 V A G I A M G L \ •'AGI AMGLVKEGDNYmVL S DILGDE HLGDM F K V A G S B D G I SALQM I K I E G I T F g I L T D I L G D E HLGDM FKVAGsJJ^GVTALQM I K i J g i T I L T D i H c A e HLGDM! F K V A G T K D G I T A L Q M I K I Q G I T 516 79 167 E C O L I D I C N O S T A A U 602 165 253 E C O L I D I C N O S T A A U Q L E V D R Q G R I R L S I K S -688 242 277 E C O L I : I K E A T E Q S Q P . D I C N O : S T A A U : E G P A A E Q G E : 711 RQGSTFN— : 251 Figure 4.2 Sequence alignment of E. coli Pnp protein and small Pnp proteins The amino a c i d sequence of E. coli Pnp p r o t e i n i s a l i g n e d with the sequences of two small b a c t e r i a l PNPases. ECOLI: E.coli. DICNO: Dichelobacter nodosus. STAAU: Staphyloccus aureus. The three conserved Asp residues are shaded red and denoted by • . The sequence of E. coli Pnp p r o t e i n that d i d not score any alignment (residues 1-345) i s not shown. s i t e of the PNPase and the c a t a l y t i c mechanism i s a l s o conserved among d i f f e r e n t s p e cies. 4.2.2 The RNA-binding motifs are susceptible to proteolysis P a r t i a l p r o t e o l y s i s i s a proven method to determine s t r u c t u r a l boundaries of n a t i v e , f o l d e d p r o t e i n s (Muhlberg and Schmid, 2000) . Therefore, i t was chosen to probe the domain o r g a n i z a t i o n of the Pnp polypeptide i n p r e l i m i n a r y experiments. Plasmid pEPal8, a d e r i v a t i v e of pET-14b encoding the f u l l - l e n g t h Pnp p r o t e i n fused to an N-terminal H i s 6 tag (His 6-Pnp, k i n d l y provided by Dr. C. Higgins [Py et a l . , 1994]), was the primary source of w i l d type PNPase. The His s-Pnp p r o t e i n was overexpressed i n BL21(DE3) c e l l s a f t e r i n d u c t i o n by IPTG. PNPase i n whole c e l l e x t r a c t s was p a r t i a l l y p u r i f i e d by p r e c i p i t a t i o n with 35% w:v ammonium s u l f a t e . The H i s 6 - t a g feature was u t i l i z e d to anchor the N-terminus to His»Bind® N i 2 + - r e s i n . Indeed, His s-Pnp p r o t e i n was r e a d i l y r e t a i n e d on the N i 2 + r e s i n ( F i g . 4. 3A lanes 1-4; Py et a l . , 1994) and migrated as an 85 kDa species (Soreq and L i t t a u e r , 1977) . The bound p r o t e i n s were then subjected to moderate p r o t e o l y s i s by t r y p s i n or chymotrypsin at ambient temperature f o r 1-1.5 hrs (see s e c t i o n 2.7). The p r o t e i n s or p r o t e i n fragments remaining on the r e s i n a f t e r the protease treatment were p u r i f i e d by the same procedures used f o r f u l l -l e n g t h His 6-Pnp p r o t e i n ( s e c t i o n 2.6.1). The r e s u l t s of p a r t i a l t y p s i n d i g e s t i o n are shown i n F i g . 4. 3A lanes 5-9; those f o r chymotypsin d i g e s t i o n , F i g . 4.3B lanes 1-5. The f r a c t i o n s produced from the p u r i f i c a t i o n were analyzed by SDS-PAGE and Commassie blue s t a i n i n g . The t r y p t i c d i g e s t i o n was much more complete than that by chymotrypsin as the f u l l - l e n g t h His 6-Pnp p r o t e i n was s t i l l present i n the r e t a i n e d f r a c t i o n a f t e r the chymotrypsin treatment ( F i g . 4.3B, lane 5, denoted F i g u r e 4 . 3 Partial proteolysis of Hisç-Pnp on a Ni2+ column. Recombinant His s-Pnp p r o t e i n was p u r i f i e d from c e l l e x t r a c t s c o n t a i n i n g -200 ug t o t a l p r o t e i n s on 30 u l of Ni2+ r e s i n . A f t e r adsorption of PNPase onto the beads, e i t h e r t r y p s i n or chymotrypsin was introduced at 0. 5 mg/ml i n p r o t e o l y s i s r e a c t i o n b u f f e r (panel A, lane 6 and panel B, lane 2) The p r o t e o l y s i s proceeded f o r 1-1.5 hr at room temperature and was stopped by adding PMSF (see s e c t i o n 2.7) . The products were washed and e l u t e d according to s e c t i o n 2.7. Samples were p r e c i p i t a t e d and re s o l v e d by SDS-PAGE on 7% acrylamide g e l s and subjected to Coomassie blue s t a i n i n g and Western b l o t t i n g . Panel A, lanes 1-4, p u r i f i c a t i o n of His 6-Pnp without p r o t e o l y s i s ; lanes 6-9, p r o t e o l y s i s by t r y p s i n ; lanes 1, 5, flow-through; lane 6, flow-through a f t e r t r y p t i c d i g e s t i o n ; lanes 2, 7, l x B i n d i n g b u f f e r wash; lanes 3, 8, l x Washing b u f f e r wash; lanes 4, 9, e l u a t e s . Panel B, p r o t e o l y s i s by chymotrypsin; lane 1, flow-through; lane 2, flow-through a f t e r chymotryptic d i g e s t i o n ; lane 3, l x Bindin g b u f f e r wash; lane 4, l x Washing b u f f e r wash; lane 5, elu a t e s . The stages where proteases were added (+) are shown at the bottom of each panel. MW: molecular weight standard i n kDa. Panel C, Western b l o t of e l u t e d f r a c t i o n s from panels A and B usin g a n t i - H i s 6 antibody; lane 1, His 6-Pnp without treatment; lane 2, His 6-Pnp t r e a t e d w i t h t r y p s i n (the f r a c t i o n corresponding to lane 9 of panel A); lane 3, His 6-Pnp t r e a t e d w i t h chymotrypsin (the f r a c t i o n corresponding to lane 5 of panel B. On the r i g h t , the p o s i t i o n of i n t a c t His 6-Pnp p r o t e i n i s denoted by *, the 68 kDa p r o t e o l y t i c product by arrows and the secondary 75 kDa product by broken arrows. MW 1 2 3 4 5 6 7 8 9 Trypsin MW 1 PNPase 75 kDa 68 kDa Chymotrypsin PNPase 75 kDa 68 kDa by * ) . Nonetheless, both t r y p s i n and chymotrypsin d i g e s t i o n s y i e l d e d a major p r o t e o l y t i c product of -68 kDa which was r e t a i n e d on the r e s i n ( s o l i d arrow, F i g . 4.3A, lane 9; F i g . 4.3B, lane 5). Since the 68 kDa p r o t e o l y t i c fragment was r e t a i n e d on the r e s i n and thus s t i l l possessed the H i s 6 - t a g , the N-terminal tagged Pnp p r o t e i n must have l o s t a -16 kDa C-terminal fragment to p r o t e o l y s i s . This 16 kDa fragment corresponds approximately to the combined s i z e of the KH and the SI m o t i f s . The complete chymotypsin d i g e s t i o n a l s o y i e l d s a secondary product of -75 kDa, p o s s i b l y r e s u l t i n g from a p a r t i a l or complete removal of the SI domain (broken arrow, F i g . 4.3B, lane 5). The data i n d i c a t e that the region between the PH domain and the KH domain was exposed to protease a t t a c k s i n the n a t i v e , f o l d e d PNPase enzyme. To confi r m that the N-termini of the His 6-Pnp p r o t e i n s were i n t a c t a f t e r the protease treatment, each r e t a i n e d f r a c t i o n from the p u r i f i c a t i o n of His 6-Pnp t r e a t e d w i t h e i t h e r protease was v i s u a l i z e d by Western b l o t t i n g u s i n g a n t i - H i s 6 antibody. As shown i n F i g . 4.3C, the His s-Pnp p r o t e i n w i t h no treatment i s i n t a c t (Lane 1) . The 68 kDa p r o t e o l y t i c fragment from t r y p t i c d i g e s t i o n i s detected by the a n t i -His6 antibody (Lane 2) . In lane 3, both the 68 kDa fragment and the 75 kDa secondary fragment are detected along w i t h the f u l l - l e n g t h His s-Pnp p r o t e i n . Some minor fragments are a l s o v i s u a l i z e d , p o s s i b l y contaminants or r e s u l t i n g form minor chymotryptic d i g e s t i o n i n s i d e the N-terminal p o r t i o n . The r e s u l t s of p a r t i a l p r o t e o l y s i s g ive r i s e t o the i n t e r e s t i n g n o t i o n that the N-terminal p o r t i o n of the Pnp p r o t e i n (the tandem PH domains pl u s the l i n k e r ) i s f o l d e d as a separate e n t i t y from the C-t e r m i n a l RNA-binding m o t i f s . 4.2.3 Construction and overexpression of PNPase deletions To s u b s t a n t i a t e more f u l l y the p u t a t i v e domain s t r u c t u r e of PNPase, subfragments of the pnp gene were made by a m p l i f y i n g p o r t i o n s of a plasmid-borne E.coli pnp gene using PCR. S p e c i f i c primers were designed to generate PCR products encompassing d i f f e r e n t combinations of m o t i f s (see s e c t i o n 2.2 and tab l e s 2.5 and 2.6). The PCR products were cloned i n t o the BamHI s i t e of the expression v e c t o r pET-16b. Cloned plasmids w i t h c o r r e c t l y o r i e n t e d i n s e r t s were t r a n s f e r r e d i n t o BL21(DE3) and overexpressed a f t e r i n d u c t i o n w i t h IPTG. Consequently, a l l PNPase d e l e t i o n p r o t e i n s contain a 10-residue H i s - t a g at t h e i r N-t e r m i n i and a d d i t i o n a l residues encoded by the vect o r sequence f l a n k i n g the BamH I s i t e . The sequences of r e s u l t i n g polypeptides are summarized as the f o l l o w i n g : MG-H10-SSGHIEGRHMLE-Pnp derivative sequence-PAANKARKEAELAAATAEQ In a l l , seven d e l e t i o n p r o t e i n s were produced ( F i g . 4.4). Pnp-PN encompasses residues 8-602, l a c k i n g the seven residues at N-terminus, the e n t i r e SI domain (residues 622-690) and the l a s t 15 residues at the C-terminus ( F i g . 4.4, lane 2). Pnp-PA a l s o i n i t i a t e s at residue 8 but extends only to residue 545, e l i m i n a t i n g the KH, SI domains and C-ter m i n a l r e s i d u e s (Fig.4.4, lane 4). Pnp-PL, l i k e the two proceeding t r u n c a t i o n s , i n i t i a t e s at residue 8 and extends to residue 320, encompassing j u s t the PH' domain and the l i n k e r (Fig.4.4, lane 6). The two subfragments, Pnp-PD (313-705) and Pnp-PE (313-602), both i n i t i a t e at residue 313 and inc l u d e the PH and KH domains. Pnp-PD, however, extends to the normal C-terminus, r e t a i n i n g the SI domain as w e l l (Fig 4.4, lane 8). F i n a l l y , two small C-terminal subfragments Pnp-PB (549-705) and Pnp-PC (603-705) were designed to express the SI domain with or without, r e s p e c t i v e l y , the KH domain (Fig 4.4, lanes 3, 5). A l l Pnp PN PC PA PB PH' linker PH KH S1 591622 • 210 310 312 541 551 602 ^ ^ ^ ^ 545 549 690 603 705 705 PL 320 PE 313 602 PD 313 705 Figure 4.4 Pnp domain organization and Pnp deletion proteins The p u t a t i v e domain o r g a n i z a t i o n of the Pnp polypeptide i n lane 1 i s i l l u s t r a t e d based on the sequence a n a l y s i s (see s e c t i o n 4.2.1). The names and boundaries of domains are l i s t e d and domains are shaded d i f f e r e n t l y to d i s t i n g u i s h them from each other. The 7 d e l e t i o n p r o t e i n s are shown w i t h t h e i r N- and C-terminal coordinates. seven d e l e t i o n s are r e a d i l y overexpressed i n BL21(DE3) and are responsive to Western B l o t t i n g by anti-Pnp or a n t i - H i s 6 antibodies (see below). 4.2.4 P u r i f i c a t i o n of Pnp subfragments A l l Pnp subfragments are expressed with an N-terminal tag of 10 h i s t i d i n e s . This fe a t u r e f a c i l i t a t e s the quick p u r i f i c a t i o n of the overexpressed Pnp p r o t e i n s using a Qiagen His»bind® k i t . A one-step chromatographic procedure was devised based on the manufacturer's recommendations. The overexpression of Pnp subfragments was c a r r i e d out i n BL21(DE3) c e l l s a f t e r i n d u c t i o n by IPTG at 30 °C. Some of the in d u c t i o n s were allowed to proceed overnight (-16 hrs) at ambient temperature to maximize the y i e l d . C e l l s were ruptured i n a French press and s o l u b l e p r o t e i n s were c o l l e c t e d by high speed c e n t r i f u g a t i o n (30,000xg). The overexpressed Pnp subfragments i n the c e l l e x t r a c t s were p u r i f i e d w i t h a His«bind® N i 2 + column at 4 °C and f r a c t i o n s were c o l l e c t e d (see s e c t i o n 2.6.1). F i g . 4. 5A shows the chromatographic p r o f i l e of Pnp-PN(8-602) . Most of p r o t e i n s i n the c e l l e x t r a c t are i n the flow-through f a c t i o n (lane 1) . There i s a s i z a b l e amount of Pnp-PN(8-602) a l s o i n the flow-through, i n d i c a t i n g the s a t u r a t i o n of the r e s i n by the e x t r a c t . Some contaminants and Pnp-PN are present i n the wash f r a c t i o n s (lanes 2-5). The main species i n the e l u t e d f r a c t i o n s i s Pnp-PN(8-602) (arrow, lanes 6-9) with only tr a c e amounts of the endogenous Pnp p r o t e i n c o - e l u t i n g i n the f i r s t e l u t e d f r a c t i o n (lane 6, denoted by * ) . This a f f i n i t y p u r i f i c a t i o n has proven to be e f f e c t i v e f o r sev e r a l s e l e c t e d Pnp subfragments. T y p i c a l l y , e l u t e d f r a c t i o n s 7 to 9 were Figure 4.5 Affinity purification of Pnp subfragments S30 f r a c t i o n s c o n t a i n i n g overexpressed Pnp subfragments were incubated with His»bind® N i 2 + r e s i n . The h i s - t a g Pnp p r o t e i n s were p u r i f i e d as described ( s e c t i o n 2.6.1). Panel A, p u r i f i c a t i o n p r o f i l e of Pnp-PN(8-602). Lane 1, flow-through; lanes 2 and 3, l x Bindi n g b u f f e r wash; lanes 4 and 5, l x Washing b u f f e r wash; lanes 6-9; e l u t e d f r a c t i o n s . The p o s i t i o n of Pnp-PN(8-602) i s i n d i c a t e d by an arrow and the p o s i t i o n of endogenous Pnp by *. Panel B, s i l v e r s t a i n i n g of p u r i f i e d Pnp subfragments. Lane 1, Pnp-PN(8-602); lane 2, Pnp-PA(8-545); lane 3, Pnp-PD(313-602); lane 4, Pnp-PE(313-705) ; lane 5, Pnp-PL(8-320) . The p o s i t i o n s of Pnp subfragments are i n d i c a t e d by arrows. MW: molecular weight standards i n kDa. MW 1 2 3 4 5 6 7 8 9 pooled and d i a l y z e d f i r s t against b u f f e r A without DTT to prevent the re d u c t i o n of r e s i d u a l N i 2 + and i t s subsequent p r e c i p i t a t i o n . Once the N i 2 * was removed, the p u r i f i e d p r o t e i n s were d i a l y z e d against a second d i a l y s i s b u f f e r (see s e c t i o n 2.6.1). To t e s t the p u r i t y , samples of p u r i f i e d p r o t e i n s were separated on a 10% SDS-PAGE g e l and subjected to s i l v e r s t a i n i n g . As shown i n F i g . 4.5B, Pnp-PN(8-602) (lane 1) and Pnp-PL(8-320) (lane 5) achieve near homogeneity. On the other hand, samples of Pnp-PA(8-545) (lane 2), Pnp-PD(313-602) (lane 3) and Pnp-PE(313-545) (lane 4) d i s p l a y a d d i t i o n a l bands of contaminants i n c l u d i n g a -25 kDa species. However, the Pnp subfragments represent the predominant species. 4.2.5 PNPase a c t i v i t y of Pnp subfragments Since the PH domain c l o s e l y resembles RNase PH, the other p h o s p h o r o l y t i c exoribonuclease i n E. coli, the c a t a l y t i c s i t e of PNPase l i k e l y r e s i d e s i n the RNase PH homology domains. We sought to determine the general l o c a t i o n of the c a t a l y t i c s i t e by performing PNPase a c t i v i t y assays u s i n g p u r i f i e d Pnp d e l e t i o n p r o t e i n s . We chose a w e l l -c h a r a c t e r i z e d RNA s u b s t r a t e rpsX(268-447)-poly(A), which contains the 3' h i g h l y s t r u c t u r e d p o r t i o n of the rpsT mRNA wi t h a 30-residue poly(A) t a i l (Coburn et al., 1999). PNPase alone or a s s o c i a t e d with the degradosome without ATP trims the poly(A) t a i l i n the presence of P0 4 2" to y i e l d a s t a b l e 180 nt product ( F i g 4. 6A) . This corresponds to d i g e s t i o n to w i t h i n -5-8 residues of a s t a b l e stem-loop ( S p i c k l e r and Mackie, 2000) . PNPase can d i g e s t past t h i s secondary s t r u c t u r e only when RhlB i n the degradosome i s a c t i v a t e d by RNase E i n the presence of ATP (Coburn et a l . , 1999). D e l e t i o n s Pnp-PN(8-602) and Pnp-PA(8-545) Figure 4 . 6 PNPase activity assays of purified Pnp subfragments P u r i f i e d degradosomes and Pnp subfragments (100 ng) were assayed against rpsT(268-447)-poly(A) as described i n s e c t i o n 2.9.2. A l i q u o t e s were withdrawn at time i n t e r v a l s i n d i c a t e d on the top of each panel, r e s o l v e d on 6% polyacrylamide g e l s , and v i s u a l i z e d using a Phosphorlmager®. The p o s i t i o n s of the substrates and the shortened products are i n d i c a t e d on the r i g h t of each panel. Panel A: Degradosome; panel B: Pnp-PN (8-602); panel C: Pnp-PA (8-545); panel D: Pnp-PE (313-602); panel E: Pnp-PD (313-602); panel F: Pnp-PL (8-320). A m i n 0 5 10 30 60 6^—^AAAAAAAAAAAAA3' 6» "AAA3' Degradosome Figure 4.6 A, B, C 10 30 60 m m 0 ... V * 6»—— J I AAAAAAAAAAAAA3 ' s 5 » ^'AAA3' Pnp-PE 10 30 60 à # i§ 5*——"AAAAAAAAAAAAA3' ^6» ^'AAA3' Pnp-PD 10 30 Pnp-PL i AAAAAAAAAAAAA3 ' Figure 4.6 D, E, showed s i g n i f i c a n t PNPase a c t i v i t y . The poly(A) t a i l of the subs t r a t e was removed w i t h i n 5 minutes and the -180 nt product remained s t a b l e over the f u l l course of the assay ( F i g . 4. 6B and 4.6C). D e l e t i o n s Pnp-PE(313-602) and Pnp-PD(313-705) a l s o d i s p l a y e d d e t e c t a b l e PNPase a c t i v i t y ( F i g . 4.6D and 4.6E). However, the rat e s were much slower than those generated by Pnp-PN, Pnp-PA and f u l l - l e n g t h PNPase. Only minute amounts of the -180 nt product appear a f t e r 5 minutes of i n c u b a t i o n . At 60 minutes, d e l e t i o n Pnp-PE converted one t h i r d of the su b s t r a t e i n t o the -180 nt product while d e l e t i o n Pnp-PD d i g e s t e d 40% of the substrate. D e l e t i o n Pnp-PL (8-320) f a i l e d to shorten the su b s t r a t e even a f t e r 60 min of in c u b a t i o n ( F i g . 4.6F). 4.2.6 Rne-Pnp interactions A n a l y s i s of the r o l e of the Rne p r o t e i n i n the RNA degradosome, both in vivo and in vitro, shows that the C-terminal p o r t i o n of RNase E serves as a s c a f f o l d to anchor PNPase, RhlB and enolase (Vanzo et a l . , 1998; Kaberdin et a l . , 1998; Coburn et a l . , 1999; Lopez et a l . , 1999). In p a r t i c u l a r , PNPase i s bound to the l a s t 200 or so amino a c i d s at the C-terminus of RNase E. RNase E d e l e t i o n p r o t e i n s RneAN208 and RneAN408 have been shown to i n t e r a c t w i t h f u l l length PNPase and to support RhlB-dependent 3' e x o n u c l e o l y t i c a c t i v i t y (Coburn et a l . , 1999). To a s c e r t a i n which PNPase domain i s c r i t i c a l f o r Rne-Pnp assembly, we te s t e d i n t e r a c t i o n s between PNPase t r u n c a t i o n p r o t e i n s and s e l e c t e d RNase E d e l e t i o n s using two complementary methods: co-immunoprecipitation and a f f i n i t y chromatography ( P h i z i c k y and F i e l d s , 1995) . 4.2.6.1 A f f i n i t y chromatography The 10-residue h i s t i d i n e tag at the N-termini of a l l Pnp subfragments not only f a c i l i t a t e d t h e i r p u r i f i c a t i o n , but a l s o was used to anchor Pnp subfragments to N i 2 " r e s i n as b a i t to ' p u l l down' any p o t e n t i a l l i g a n d s . Selected c e l l e x t r a c t s c o n t a i n i n g overexpressed Pnp subfragments were incubated with charged His»Bind® r e s i n to a l l o w c h e l a t i o n of N i 2 + by His-tags. A f t e r the r e s i n was washed w i t h 5 mM imidazole and 500 mM NaCl to minimize contaminants, AS26 f r a c t i o n s c o n t a i n i n g Rne d e l e t i o n p r o t e i n s were passed over the column (see s e c t i o n 2.6.2). The r e s i n was then e x t e n s i v e l y washed. The p r o t e i n s r e t a i n e d on the r e s i n were recovered and analyzed by SDS-PAGE and Coomassie blue s t a i n i n g . As shown i n F i g . 4. 7A (lanes 6 and 11) and B (lanes 5 and 10), both Pnp-PN(8-602) and Pnp-PC (603-705) are chromatographically p u r i f i e d , although s i g n i f i c a n t amounts of ' b a i t ' p r o t e i n s (Pnp-PN) are present i n flow-through and wash f r a c t i o n s ( F i g . 4.7A, lanes 1 and 2; F i g 4.7B, lane 1). This leakage i s probably due to s a t u r a t i o n of the r e s i n by c e l l e x t r a c t s and was observed when Pnp subfragments were i n d i v i d u a l l y p u r i f i e d (see s e c t i o n 4.2.4). Importantly, RneAN208 co-elutes w i t h Pnp-PN(8-602) (lane 6), and s u r p r i s i n g l y , a l s o w i t h Pnp-PC(603-705) (lane 11), a f t e r extensive washes i n high s a l t (~ 20 volumes of 500 mM NaCl f o r an hour) . A s i m i l a r e l u t i o n p r o f i l e i s observed when RneAN813 i s t e s t e d . RneAN813 i s r e t a i n e d by both Pnp-PN(8-602) ( F i g . 4.7B, lane 5) and Pnp-PC(603-705) ( F i g . 4.7B, lane 10). The more pronounced presence of RneAN813 i n other f r a c t i o n s ( F i g . 4.7B, lanes 2-4 and 7-9) i s caused by the high l e v e l of the Rne species from an e f f i c i e n t expression system ( F i g . 3. 3A) . Notably, Pnp-PN (8-602) i s able to r e t a i n equal amounts of Rne both d e l e t i o n p r o t e i n s t e s t e d (Fig.4.7A lane 6 and Fig.4.7B lane 5). F i g u r e 4 . 7 Pnp-Rne interaction: affinity chromatography Selected Pnp subfragments were anchored to a N i 2 + r e s i n by i n c u b a t i n g c e l l e x t r a c t s (200 ug t o t a l protein) c o n t a i n i n g overexpressed p r o t e i n w i t h 3 0 ( i l of the r e s i n f o r 1 hr. The r e s i n was washed once w i t h 1ml of l x Binding b u f f e r and AS26 f r a c t i o n s (200 ug t o t a l p r o t e i n ) c o n t a i n i n g a s e l e c t e d Rne d e l e t i o n p r o t e i n were introduced. A f t e r 1 hr i n c u b a t i o n , the r e s i n was washed and p r o t e i n s were recovered as described i n s e c t i o n 2.6.2.- P r o t e i n samples were r e s o l v e d by SDS-PAGE on a 15% acrylamide g e l and s t a i n e d w i t h Coomassie b r i l l i a n t b l ue. Panel A, lanes 1-6: Pnp-PN+RneAN2 08; lanes 7-11: Pnp-PC+RneAN2 08; lanes 1,7, flow-through of Pnp subfragments; lanes 2, 4, 9, l x Bind i n g b u f f e r wash; lanes 3, 8, flow-through of Rne d e l e t i o n p r o t e i n s ; lanes 5, 10. l x Washing b u f f e r wash; lanes 6, 11, e l u t e d f r a c t i o n s . Panel B, lanes 1-5: Pnp-PN+RneAN813; lanes 6-10: Pnp-PC+RneAN813; lanes 1, 6, flow-through of Pnp subfragments; lanes 2, 7, flow-through Rne d e l e t i o n p r o t e i n s ; lanes 3, 8, l x Binding b u f f e r wash; lanes 4, 9, l x Washing b u f f e r wash; lanes 5, 10, e l u t e d f r a c t i o n s . Samples of some l x b i n d i n g b u f f e r wash f r a c t i o n s a f t e r the Pnp subfragment in c u b a t i o n s were not loaded. MW: molecular weight standard i n kDa. Pnp subfragments are i n d i c a t e d by , and Rne d e l e t i o n p r o t e i n s by ^ RneAN208 Pnp-PN(8-602) Pnp-PC(603-705) ' B a h ' MW 1 2 3 4 5 6 7 8 9 10 11 RneAN20B Pnp-PN +- Pnp-PC RneAN813 Pnp-PN (B-602) Pnp-PCp3-705) 1 2 3 4 5 6 7 8 9 10 'Bait' Pnp-PN RnaûN813 •4- Pnp-PC The N - t e r m i n a l l y truncated Rne p r o t e i n s c o n t a i n no i n t e r n a l h i s t i d i n e residue c l u s t e r or His-tagged t a i l s . Therefore, they do not b i n d to the N i 2 * r e s i n (not shown). However, a f f i n i t y chromatography may present an inherent problem. Since a l l the N - t e r m i n a l l y t r u n c a t e d Rne p r o t e i n s presumably c o n t a i n considerable negative charge at t h e i r C-termini, these p r o t e i n s may posses a tendency to adhere to the N i 2 + r e s i n . 4.2.6.2 Co-immunoprecipitation Co-immunoprecipitation i s e s s e n t i a l l y a ' p u l l down' experiment (see s e c t i o n 2.8). However, some care was needed i n i t s a p p l i c a t i o n to confirm Pnp-Rne i n t e r a c t i o n . Anti-Pnp a n t i b o d i e s would i n e v i t a b l y b i n d to endogenous f u l l - l e n g t h Pnp i n a d d i t i o n to Pnp subfragments. Moreover, the f u l l - l e n g t h Pnp would p u l l down any N - t e r m i n a l l y truncated Rne p r o t e i n s because of the presence of the C-terminal t a i l . Thus, anti-Pnp a n t i b o d i e s could not be used. To confir m the r e s u l t s obtained by co-chromatography, p a r t i a l l y p u r i f i e d Rne d e l e t i o n p r o t e i n s (RneAN608 or RneAN813) were bound to immobilized anti-Rne a n t i b o d i e s at 4 °C. C e l l e x t r a c t s c o n t a i n i n g overexpressed Pnp d e l e t i o n p r o t e i n s were then incubated w i t h the beads. A f t e r extensive washing, p r o t e i n s r e t a i n e d on the beads were recovered and subsequently analyzed by Western b l o t t i n g using a n t i b o d i e s s p e c i f i c f o r PNPase (see s e c t i o n 2.8). The endogenous f u l l - l e n g t h PNPase was r e a d i l y r e t a i n e d i n a l l cases and serves as an i n t e r n a l p o s i t i v e c o n t r o l (Fig.4.8A, B, C) . As shown i n F i g . 4.8 (panels A and B) , both RneAN608 and RneAN813 r e s p e c t i v e l y are able to r e t a i n Pnp-PD(313-705) (lane 2) but not Pnp-PE(313-602) (lane 1). Since PNPase-PD and PNPase-PE d i f f e r o n l y by the presence of the SI domain i n PNPase-PD (Fig.4.4), t h i s suggests that the SI domain of PNPase i s i n v o l v e d i n Rne-binding. S u r p r i s i n g l y , when F i g u r e 4 . 8 Co-immunoprecipitation of Rne deletion proteins and Pnp subfragments Co-immunoprecipitation assays were conducted as d e s c r i b e d i n s e c t i o n 2.8. B r i e f l y , p o l y c l o n a l anti-Rne antibodies were c r o s s - l i n k e d to p r o t e i n A-agarose beads to anchor Rne d e l e t i o n p r o t e i n RneAN608 (panel A, lanes 1 and 2; panel C, lane 1) or RneAN813 (panel B, lanes 1 and 2 ; panel C, lane 2) as ' b a i t s ' . Selected Pnp subfragments were incubated w i t h the beads. Pnp-PE (313-602) : panel A, lane 1 and panel B, lane 1; Pnp-PD (313-705) : panel A, lane 2 and panel B, lane 2; Pnp-PL (8-320) : panel C, lanes 1 and 2. Pr o t e i n s were recovered and subjected to Western b l o t t i n g using p o l y c l o n a l anti-Pnp a n t i b o d i e s . V i s i b l e bands are i d e n t i f i e d on the r i g h t of each panel. The approximate p o s i t i o n s of Pnp-PE are i n d i c a t e d by arrows on the l e f t of panels A and B. RneAN608 + + Pnp-PE + Pnp-PD - + ««— Pnp < - Pnp-PD 1 2 Pnp-PE RneAN813 Pnp-PE Pnp-PD Pnp-PE + + + -- + Pnp Pnp-PD 1 2 RneAN608 RneAN813 Pnp-PL + -- + c e l l e x t r a c t s c o n t a i n i n g Pnp-PL(8-320) were used i n the co-immunoprecipitation, Pnp-PL was a l s o recovered along w i t h the endogenous f u l l - l e n g t h PNPase (Fig.4.8C). These data suggest that both the N-terminal region and the C-terminal SI domain are i n v o l v e d i n b i n d i n g to Rne. Since Pnp-PE, encompassing PH and KH domains, was not ' p u l l e d down', these two domains appear not to p a r t i c i p a t e i n i n t e r a c t i n g w i t h Rne. 4.3 Discussion 4.3.1 The Pnp polypeptide i s organized i n modules The p a r t i a l p r o t e o l y s i s data have demonstrated that the C-t e r m i n a l t a i l of the Pnp p r o t e i n i s s u s c e p t i b l e to protease d i g e s t i o n , c o n s i s t e n t w i t h the previous f i n d i n g that the RNA-binding m o t i f s are p r o t e o l y t i c a l l y s e n s i t i v e ( L i t t a u e r , 1982). The N-terminal p o r t i o n of the p r o t e i n remained r e s i s t a n t to p r o t e o l y s i s a f t e r a long i n c u b a t i o n w i t h t r y p s i n or chymotrypsin (1-1.5 h r ) . This suggests that the general f o l d i n g of the Pnp polypeptide y i e l d s an exposed r e g i o n l i n k i n g two organized modules. The N-terminal tandem PH homology domains appear to be t i g h t l y arranged. The C-terminal t a i l of RNA-binding m o t i f s may e x i s t w i t h more freedom of movement, c o r r e l a t i n g w i t h the c r y s t a l l o g r a p h i c data (Symmons et a l . , 2000; see s e c t i o n 4.3.5). 4.3.2 Expression and p u r i f i c a t i o n of Pnp subfragments Seven Pnp subfragments were designed according the sequence a n a l y s i s and the data of p a r t i a l p r o t e o l y s i s and cloned i n t o expression v e c t o r pET-16b ( F i g . 4.4). The expression system provided to be very e f f i c i e n t . However, care had to be taken to adjust the growth temperature during i n d u c t i o n . Higher temperature such as the MW 1 2 F i g u r e 4.9 Induction at 37 °C leads to sizable amount of insoluble Pnp proteins A s t r a i n expressing His 6-Pnp was grown to e a r l y l o g phase and induced w i t h IPTG at 37 °C as described i n s e c t i o n 2.3. C e l l s were ruptured by French press and s o l u b l e p r o t e i n s (S30 f r a c t i o n s ) were separated from i n s o l u b l e m a t e r i a l s ( p e l l e t ) by c e n t r i f u g a t i o n ( s e c t i o n 2.3). MW: molecular weight standard i n kDa, lane 1: S30 f r a c t i o n , lane 2: S30 p e l l e t . conventional 30 °C or 37 °C would cause a high r a t e of expression of the cloned sequence, p o t e n t i a l l y r e s u l t i n g i n m i s f o l d i n g of nascent polypeptides of f u l l - l e n g t h Pnp or longer mutants. In f a c t , s i z a b l e q u a n t i t i e s of f u l l - l e n g t h His 6-Pnp were found to be ' i n s o l u b l e ' ( F i g . 4.9, lane 2 ). Growth at ambient temperature (20-25 °C) minimizes the occurrence of i n s o l u b l e target p r o t e i n s . This a l s o m i r r o r s the f a c t that expression of wt PNPase i s favoured under low temperature (Zangrossi et al., 2000). 4 . 3 . 3 Pnp-Rne i n t e r a c t i o n Vanzo et al. (1998) have determined that the C-terminal t a i l of the Rne polypeptide i s responsible f o r bi n d i n g PNPase i n the RNA degradosome complex. The present study has reached the s u r p r i s i n g c o n c l u s i o n that both the N- and C-terminal p o r t i o n s of the Pnp p r o t e i n can i n t e r a c t w i t h Rne d e r i v a t i v e s which c o n t a i n the C-terminal Pnp-bi n d i n g domain. The b i n d i n g of Rne by the two p a r t s of the Pnp p r o t e i n appears to occur independently of the other and of c a t a l y s i s . The Rne-bin d i n g s i t e i n the N-terminus occurs w i t h i n the PH' domain and the l i n k e r . The SI RNA-binding motif at the C-terminus (residues 622-690) has a c a l c u l a t e d t h e o r e t i c a l p i of 9.77. This supports the n o t i o n that the i n t e r a c t i o n i s due, at l e a s t i n pa r t , to e l e c t r o s t a t i c a t t r a c t i o n between the p o s i t i v e l y charged Pnp SI domain and the n e g a t i v e l y charged Rne C-terminal t a i l (pi 4.5). The s o l u t i o n s t r u c t u r e of PNPase SI domain, which i s the sum of 20 NMR models (Bycroft et al., 1997, F i g . 4.10), provides some cl u e s regarding the p u t a t i v e e l e c t r o s t a t i c i n t e r a c t i o n . The s t r u c t u r e d i s p l a y s conformational v a r i a t i o n s mainly at the N- and C-terminal e x t r e m i t i e s and at the turns connecting the P-strands, e s p e c i a l l y Figure 4.10 Acidic and Basic residues of SI RNA-binding domain. The NMR s o l u t i o n s t r u c t u r e s of the PNPase SI RNA-binding domain (Bycroft et a l . 1997, P r o t e i n Data Bank entry 1SR0) are i l l u s t r a t e d using RasMol i n the 'dots' mode. Panel B shows the opposite side of Panel A. The a c i d i c r e s i d e s are l a b e l e d i n red and the b a s i c residues are l a b e l e d i n blue u s i n g RasMol (www.openrasmol.org). The p o s i t i o n s of the N-terminal e x t r e m i t i e s of the SI domain are i n d i c a t e d by N i n each panel. In panel A, the p o s i t i o n of the C-terminal e x t r e m i t y of the SI domain i s denoted as C. The p o s i t i o n of the C-terminal extremity i n panel B i s obscured. The patch of p o s i t i v e charges, which i s p o s t u l a t e d to p a r t i c i p a t e i n the p r o t e i n - p r o t e i n i n t e r a c t i o n w i t h Rne, i s shown by an arrow. Panel C shows another view of the SI domain w i t h only the basi c residues i n d i c a t e d (Arg i n red and i n 'dots' mode; Lys i n yellow and denoted by ) . The three a r g i n i n e residues near the turn connecting strands 4 and 5 are i n d i c a t e d by arrows. Figure 4.10 A, B Figure 4.10 C between strands 4 and 5 (counting from the N-terminus) . W i t h i n the p~ strands, the conformations of the 20 models are c o n s i s t e n t . Are there 'patches' of p o s i t i v e charges on the surface of PNPase which would serve as contact p o i n t s w i t h Rne? Using the RasMol molecular graphics v i s u a l i z a t i o n t o o l (version 2.7.2.1, http://www.openrasmol.org/), the b a s i c residues were assigned the colour red and a c i d i c r e s i d u e s blue i n F i g . 4.10A and B. In the 'dots' mode, which creates dotted spheres around i n d i v i d u a l atoms, a prominent red 'patch' i s observed at the t u r n between strands 4 and 5 (Fig. 4.10A and B, arrow). Three a r g i n i n e residues (Arg681, Arg684 and Arg686 of E.coli PNPase) are l o c a t e d i n and near the t u r n ( F i g . 4.IOC). Their p o s i t i o n s are r e l a t i v e l y i s o l a t e d and separated from the negative charges ( F i g . 4.10 A and B, blue patches) . This 'patch' i s generated from a c o l l e c t i o n of 2 0 v a r i a n t s and thus the t r u e s i z e of the p o s i t i v e l y charge area on the surface i s l i k e l y s m a l l e r . On the other hand, the variances among the models at the t u r n between stran d 4 and 5 suggest that t h i s p a r t i c u l a r p o r t i o n of the domain enjoys more degrees of freedom of movement. This freedom of movement presumably allows the a r g i n i n e residues to contact the negative charges of RNase E C-terminal t a i l w i t h l e s s s t r u c t u r a l i n t e r f e r e n c e . Other b a s i c residues are confined i n more r i g i d conformations or are c l o s e to a c i d i c residues (Fig 4.IOC). Therefore, those b a s i c r e s i d e s may not c o n t r i b u t e to the proposed e l e c t r o s t a t i c i n t e r a c t i o n between Rne and Pnp p r o t e i n s . We have obtained p r e l i m i n a r y data that the N-terminal PH' domain and the l i n k e r a l s o i n t e r a c t w i t h the C-terminus of the Rne p r o t e i n . F i g . 4.11 shows a model f o r how the Rne p r o t e i n could contact both the PH' and SI domain. The s p e c i f i c i t y of the Pnp-Rne i n t e r a c t i o n i s l i k e l y provided by the s u b t l e s t r u c t u r a l d e t a i l s of both p r o t e i n , which Figure 4.11 The structure of PNPase of Streptomyces antibïoticus and Pnp-Rne interaction Panel A i s a s p a c e f i l l i n g model of a PNPase t r i m e r adopted from Symmons et al. (2000, http://www-cryst.bioc.cam.ac.uk/structures/pnpase2.html). The KH and SI domains (not w e l l order i n the c r y s t a l , Symmons et a l . , 2000) are not shown to i l l u s t r a t e the subunit i n t e r a c t i o n around the c e n t r a l channel. Subunit 1 i s coloured g o l d (PH') and red (PH), subunit 2 purple (PH') and blue (PH) , subunit 3 dark green (PH') and l i g h t green (PH). In the next two panels, s i m p l i f i e d v e r s i o n s of the s t r u c t u r e i n panel A are used. Panel B shows a schematic r e p r e s e n t a t i o n (side view) of the C-terminus t a i l of the Rne p r o t e i n i n t e r a c t i n g w i t h both PH' and SI domains of the same subunit. Panel C shows a top view of the C-terminus t a i l of the Rne p r o t e i n i n t e r a c t i n g w i t h the PH' domain and an SI domain from the adjacent subunit. PNPase i s depict e d w i t h three subunits w i t h a c e n t r a l channel. The subunits are separated by s o l i d l i n e s w h i l s t the PH' domains are separated from the PH domain of the same subunit by dotted l i n e . The approximate p o s i t i o n s of the KH (blue) and the SI (red) are i n d i c a t e d according to Symmons et al. (2000) . For s i m p l i c i t y , not a l l KH and SI domains are shown i n panel B. A Subunit 3 Figure 4.11 A B r e q u i r e s f u r t h e r i n depth i n v e s t i g a t i o n . In a d d i t i o n , these s p a t i a l arrangements a l l o w the remaining two SI domains to contact RNA substrates. 4 . 3 . 4 The c a t a l y t i c domain and the structure of Pnp polypeptide As c i t e d above, Symmons et a l . (2000) have r e c e n t l y c r y s t a l l i z e d the PNPase from Streptomyces a n t i b i o t i c u s (also known as GPSI, see s e c t i o n 1.2.2.2) with the phosphate analog tungstate ( F i g 4.11A). The s t r u c t u r e c l e a r l y shows a t r i m e r w i t h a c e n t r a l channel, c o n f i r m i n g the previous EM f i n d i n g (Valentine et al., 1969). The c r y s t a l s t r u c t u r e i s somewhat incomplete s i n c e the C-terminal RNA-binding m o t i f s are p o o r l y ordered and do not generate a workable d i f f r a c t i o n p a t t e r n : only a small part of the KH motif i s ordered. Thi s r e f l e c t s the f a c t that the C-terminus of the Pnp polypeptide has a higher degree of freedom of movement and i s more a c c e s s i b l e i n the s o l u t i o n , i n agreement w i t h our p r o t e o l y s i s data. The s t r u c t u r e of GPSI d i s p l a y a 'core' composed of two t o p o l o g i c a l l y i d e n t i c a l domains, corresponding to the two PH domains of E. coli PNPase (Symmons et a l . , 2000). More im p o r t a n t l y , the b i n d i n g s i t e of the phosphate analog, tungstate, i s l o c a t e d i n the second core domain. A conserved GS(S/T)S (Gly-Ser-[Ser/The]-Ser) motif (residue 460-463) i s part of the b i n d i n g s i t e ( F i g . 4.1) . A d d i t i o n a l contact with the imidazole r i n g of His427 was observed i n the s t r u c t u r e model (Symmons et al., 2000). The s t r u c t u r a l i n t e g r i t y of the b i n d i n g s i t e i s a l s o maintained i n p a r t by the f i r s t core domain (Symmons et al., 2000). In a d d i t i o n , the authors a l s o suggested that three conserved a s p a r t i c a c i d residues (Asp514, Asp520 and Asp536) are candidates to coordinate Mg 2 + ions r e q u i r e d f o r the PNPase a c t i v i t y . These observations agree w i t h our f i n d i n g that the c a t a l y t i c s i t e of the PNPase r e s i d e s i n the PH domain. But the PH' domain i s a l s o r e q u i r e d . The corresponding E. coli PNPase residues to the aforementioned GPSI residues are His403, Gly436, Ser437, Ser438, Ser439, Asp486, Asp492 and Asp508. These residues are h i g h l y conserved ( F i g . 4.1) and are s u i t a b l e t a r g e t s f o r f u r t h e r mutational s t u d i e s . Chapter V Conclusions and perspectives 5.1 RNase E Several independent experimental approaches show that the domain o r g a n i z a t i o n of RNase E i s modular (McDowall et a l . ; 1993; Cormack et a l . , 1993; Taraseviciene et al., 1995; McDowall and Cohen, 1996; Vanzo et al., 1998; and F i g 5.1). By c o n s t r u c t i n g a s e r i e s of Rne d e l e t i o n p r o t e i n s , we have determined that the c a t a l y t i c s i t e of RNase E i s l i k e l y l o cated between residues 208 and 407. The N-terminal 207 residues ( i n c l u d i n g the SI domain) are l i k e l y r e s p o n s i b l e f o r 5'-end-dependence of RNase E a c t i v i t y . The N-terminal SI domain may a l s o be important f o r the s t r u c t u r a l i n t e g r i t y of the c a t a l y t i c s i t e . This r e f l e c t s the observations that ams-1 and rne-3071 mutants are not f o l d e d c o r r e c t l y (Carpousis et a l . , 1994). The N-terminal p o r t i o n of the Rne p r o t e i n i s homologous to RNase G, a r e c e n t l y i d e n t i f i e d E. coli ribonuclease which i s important f o r 5' maturation of 16S rRNA ( L i et al., 1999). RNase G shares s i g n i f i c a n t sequence i d e n t i t y (35%) w i t h the N-terminal p o r t i o n (residues 1-498) of the Rne p r o t e i n (McDowall et al., 1993). I t i s a l s o a 5'-end dependent enzyme (Jiang et al., 2000; Tock et a l . , 2000). Sequence alignment between RNase E and RNase G performed by members of our l a b o r a t o r y i d e n t i f i e d conserved residues (D. B r i a n t and G. A. Mackie, personal communication). Among these residues, Asp303, Asp346 and Asp349 are candidates to coordinate Mg2+ ions. The a r g i n i n e - r i c h RNA-binding domain, f i r s t i d e n t i f i e d by Cormack et al. (1993), was i n i t i a l l y l o c a t e d i n the middle r e g i o n of the Rne p r o t e i n (Taraseviciene et a l . , 1995; McDowall and Cohen, 1996). We have S1 Arg-r ich D+E 1061 R n e R R K P R Q N N R R D R N E R Minimal RNA-binding site First 207aa aa 208-407 RBD Protein Phosphate Catalytic Autoregulation interaction pocket? s i t e enhancer Figure 5.1 Domain organization of the Rne protein The domains of the Rne p r o t e i n are i l l u s t r a t e d based on the f i n d i n g s of t h i s d i s s e r t a t i o n and the work of others. The f i r s t 207 a.a., where the SI motif r e s i d e s , are not c r i t i c a l f o r RNase E a c t i v i t y . There i s a minimal RNA-binding s i t e between residues 608 and 622 w i t h i n the Arg-r i c h region. The strong RNA-binding a c t i v i t y l i k e l y enhances the feedback c o n t r o l of Rne synthesis (Jiang et a l . , 2000) . The C-terminal t a i l i s r e s p o n s i b l e f o r degradosome assembly (Vanzo et al., 1998). narrowed the l o c a t i o n of t h i s domain s i g n i f i c a n t l y by i d e n t i f y i n g a minimal RNA-binding s i t e between residues 608 and 622 (Fi g . 5.1). Our understanding of the r o l e of the a r g i n i n e - r i c h RBD (ARRBD) remains l i m i t e d . Although not e s s e n t i a l f o r c e l l s u r v i v a l (Kido et a l . , 1996), the RBD-RNA i n t e r a c t i o n may allow the f u l l - l e n g t h enzyme t o r e t a i n i t s substrate and make m u l t i p l e cleavages (see s e c t i o n 1.4.1). In t h i s regard, Kaberdin et a l . (2000) have suggested that the ARRBD i n t e r a c t s with RNA substrates and enhances cleavage at 'b' s i t e i n 9S RNA. In a s i m i l a r f a s h i o n , the ARRBD plays a r o l e i n the a u t o r e g u l a t i o n of RNase E synthesis. The feedback c o n t r o l of RNase E gene expression i s ef f e c t e d by an RNase E-mediated cleavage of i t s own mRNA. This cleavage i s d i r e c t e d by a stem-loop s t r u c t u r e i n 5' UTR of the rne mRNA (Diwa et a l . , 2000). The N-terminal p o r t i o n of RNase E (residues 1-498) i s only 3% as e f f e c t i v e i n feedback c o n t r o l as the f u l l - l e n g t h v e r s i o n (Jiang et a l . , 2000) . I n t e r e s t i n g l y , the truncated form of RNase E expressed i n the 'Kido' s t r a i n a l s o l a c k s the RNA-binding domain. This v e r s i o n of RNase E i s d e f i c i e n t i n feedback c o n t r o l of i t s own synthe s i s and i s subsequently overproduced (Jiang et a l . , 2000). One p o s s i b l e explanation f o r these observations i s that the absence of the RBD decreases the a f f i n i t y of the enzyme f o r rne t r a n s c r i p t s . Thus the res i s t a n c e of the autoregulatory cleavage s i t e to RNase E i s enhanced. In the 'Kido' s t r a i n , the h a l f - l i f e of mukB RNA a l s o increases. Therefore, the ARRBD plays a r o l e i n f a c i l i t a t i n g degradation or processing of some RNAs. The C-terminal p o r t i o n of the Rne p r o t e i n serves as an assembly pla t f o r m f o r the RNA degradosome (Vanzo et a l . , 1998). The i n t e r a c t i o n with PNPase may be e l e c t r o s t a t i c since the PNPase-binding s i t e i n Rne i s h i g h l y a c i d i c . However, the nature of the Rne-RhlB or Rne-enolase i n t e r a c t i o n s i s not known. The assembly of the degradosome i s independent of the c a t a l y t i c a c t i v i t y of RNase E (Coburn et a l . , 1999). On the other hand, the C-terminal p o r t i o n i s dispensable f o r c a t a l y s i s and i s not e s s e n t i a l f o r c e l l v i a b i l i t y (Kido et al.,-1996). 5.2 PNPase Parts of the sequence of the Pnp p r o t e i n e x h i b i t s i m i l a r i t y to seve r a l known sequences or sequence mot i f s i n c l u d i n g RNase PH and the KH and SI domains. We took advantage of the a v a i l a b l e computational t o o l s on the I n t e r n e t (see s e c t i o n 2.10) to determine the boundaries of pr e d i c t e d domains ( F i g . 5.2). Using t h i s i n f o r m a t i o n , we constructed a s e r i e s of d e l e t i o n mutants i n the pnp gene to express i n d i v i d u a l domains. Each was t e s t e d f o r i t s f u n c t i o n s . The tandem PH domains are c r i t i c a l f o r a c t i v i t y . S p e c i f i c a l l y , c a t a l y s i s l i k e l y occurs i n the PH domain w h i l s t the PH' domain i s important f o r the s t r u c t u r a l i n t e g r i t y of the c a t a l y t i c s i t e . The c r y s t a l s t r u c t u r e of S. a n t i b i o t i c u s PNPase agrees with our f i n d i n g s (Symmons et al., 2000). The two PH domains form a 'core' c a t a l y t i c domain w i t h p u t a t i v e key residues l o c a t e d i n the second PH domain (e.g. His427, Asp514, Asp520, Asp536). Not s u r p r i s i n g l y , these residues are a l s o l o c a t e d i n a h i g h l y conserved region of the p r o t e i n (Fig.4.1). Their E. coli PNPase counterparts are His403, Asp486, Asp492 and Asp508. Consequently, these residues are good candidates f o r f u r t h e r mutational s t u d i e s . P r o t e i n - p r o t e i n i n t e r a c t i o n a c t i v i t i e s were found i n the PH' domain and unexpectedly i n the SI domain. We have suggested candidate a r g i n i n e residues (Arg661, Arg664 and Arg668) i n the SI domain which may serve as contact p o i n t s f o r the n e g a t i v e l y charged Rne C-terminal t a i l ( F ig. 4.10). The RNA-binding motifs (KH and SI) are dispensable f o r PNPase c a t a l y t i c a c t i v i t y as Pnp-PA d i s p l a y s w t - l e v e l s of a c t i v i t y . PH' linker PH KH S1 591 622 Pnp 210 310 312 541 551 • 690 HIUOS A i p « « A i p « J AlpSOB ArgSSI ArgS84 ArgSS Prote in interact ion Catalyt ic site Prote in interact ion v i a e lect rostat ic potent ia l Figure 5.2 Domain organization of the Pnp protein The functions of Pnp domains are summarized. The PH' domain i s p o s s i b l e involved i n i n t e r a c t i n g w i t h the Rne p r o t e i n . The c a t a l y t i c s i t e i s located i n the PH domain w i t h p u t a t i v e key residues His403, Asp486 ( Asp492 and Asp508 (Symmons et a l . , 2000). The SI domain l i k e l y binds to Rne v i a e l e c t r o s t a t i c i n t e r a c t i o n . Three a r g i n i n e s , Arg681, Arg684 and Arg686, are candidates f o r contact p o i n t s w i t h the C-terminus of RNase E. I t has been suggested that these motifs are r e s p o n s i b l e f o r PNPase p r o c e s s i v i t y ( L i t t a u e r , 1982; Symmons et a l . , 2000). In vitro, t h i s hypothesis could be t e s t e d using the Pnp d e l e t i o n p r o t e i n l a c k i n g the RNA-binding mo t i f s (Pnp-PN or Pnp-PA). In the next few years i t should be p o s s i b l e t o g a i n a much b e t t e r understanding of the biochemical and p h y s i c a l bases f o r mRNA decay. Current and f u t u r e c r y s t a l s t r u c t u r e s and mutational a n a l y s i s w i l l l i k e l y provide e x c i t i n g new i n s i g h t s i n t o mechanisms and r e g u l a t i o n of t h i s important process. Appendix The C-terminal Rne d e l e t i o n s were generated by Tannis E l l i s and Rob Cormack. Components of a Promega Erase-a-Base® k i t were used. The k i t u t i l i z e s the unique feature of exonuclease I I I (Exo I I I ) whose enzymatic a c t i o n i s i n h i b i t e d by 3' overhangs on DNA strands but not by 5' p r o truding or b l u n t ends. The uniform r a t e of d i g e s t i o n of Exo I I I a l s o allows the i n v e s t i g a t o r to create d e l e t i o n s of s p e c i f i c length by removing samples at predetermined time i n t e r v a l s . A s e r i e s of truncated forms of any given sequence can thus be c o n s t r u c t e d i n a short time. A schematic flow-chart i l l u s t r a t e s the steps of d e l e t i o n c o n s t r u c t i o n . pGMIOl, a d e r i v a t i v e of pET-11, contains a truncated form of the rne gene which only extends to a BarriHI s i t e at nt 2527. The plasmid was l i n e a r i e d by BamHI d i g e s t i o n and the ends were f i l l e d w i t h T4 DNA polymerase and dNTPs. The M13 p o l y l i n k e r of pUC18 was e x c i s e d by EcoRI and H i n d l l l and ends were r e p a i r e d (EcoRI' and H i n d l l l ' represent the r e p a i r e d ends). The fragment was l i g a t e d i n t o the r e p a i r e d BamHI s i t e (BamHI') of pGMIOl to y i e l d pGMlOlL i n which the p o l y l i n k e r was p o s i t i o n e d i n reverse o r i e n t a t i o n ( H i n d l l l to EcoRI) of the rne reading frame. pGMlOlL was then cleaved by Xbal and Kpnl, whose s i t e s are unique w i t h i n the p o l y l i n k e r . The Xbal s i t e p r o v i d e d the 5' overhang s u s c e p t i b l e to Exo I I I d i g e s t i o n , and the Kpnl s i t e y i e l d e d the 3' overhang r e s i s t a n t to Exo I I I d i g e s t i o n i n the opposite d i r e c t i o n . Thus, Exo I I I would only delete the rne sequence from i t s 3'-end. The time of i n c u b a t i o n w i t h Exo I I I was v a r i e d to generate d e l e t i o n s of various lengths. The s i n g l e strands were removed by SI nuclease d i g e s t i o n and the ends were r e l i g a t e d . The d e l e t i o n s s t i l l contained the T7 promoter, lac operator and ribosomal b i n d i n g s i t e i n h e r i t e d from pET-11. No e f f o r t was made to i n s e r t a t e r m i n a t i o n codon; r a t h e r i n frame t e r m i n a t i o n codons occur i n the v e c t o r sequence d i s t a l to the rne sequence and the p o l y l i n k e r . Eco RI Kpn\ Xbsi Hind\\\ N \ / Eco R VHind II I d gesti on Ends repaired Eco RI' Kpn\ Xba\ Htnd\\Y / rne' BsmH\ p G A M 1 0 1 BamH I d gestion Ends repaired B lun t -end l i ga t i on H/rîdlll' Xba\ KpniEcoRY rne' \ \ p G A M 1 0 1 L Xb3\IKpn\ d igest ion rne' •5' y-\ rne' Exo H i d gestion Al iquots removed at various tirnepd nts rne' .5' 3 S1 nuclease Religation C-terniinal Rne deletions References A d i n o l f i , S., Bagni, C , C a s t i g l i o n e M o r e l l i , M.A., F r a t e r n a l i , F., Musco, G. and Pastore, A. (1999) Novel RNA-binding motif: the KH module. Biopolymers, 51 , 153-64. Arnold, T.E., Yu, J . and Belasco, J.G. (1998) mRNA s t a b i l i z a t i o n by the ompA 5' u n t r a n s l a t e d r e g i o n : two p r o t e c t i v e elements hinder d i s t i n c t pathways f o r mRNA degradation. RNA, 4, 319-30. Arraiano, C.M., Yancey, S.D. and Kushner, S.R. (1988) S t a b i l i z a t i o n of d i s c r e t e mRNA breakdown products i n ams pnp rnb m u l t i p l e mutants of Escherichia coli K-12. J Bacterid, 170, 4625-33. August, J . , O r t i z , P. and Hurwitz, J . (1962) R i b o n u c l e i c acid-dependent r i b o n u c l e o t i d e i n c o r p o r a t i o n . J Biol Chem, 237, 3786-93. Babitzke, P. and Kushner, S.R. (1991) The Ams ( a l t e r e d mRNA s t a b i l i t y ) p r o t e i n and ri b o n u c l e a s e E are encoded by the same s t r u c t u r a l gene of Es c h e r i c h i a c o l i . Proc N a t l Acad Sci USA, 88, 1-5. Babitzke, P., Granger, L. , Olszewski, J . and Kushner, S.R. (1993) An a l y s i s of mRNA decay and rRNA processing i n Escherichia coli m u l t i p l e mutants c a r r y i n g a d e l e t i o n i n RNase I I I . J Bacteriol, 175 , 229-39. B a r t e l , D.P., Zapp, M.L., Green, M.R. and Szostak, J.W. (1991) HIV-1 Rev r e g u l a t i o n i n v o l v e s r e c o g n i t i o n of non-Watson-Crick base p a i r s i n v i r a l RNA. Cell, 67, 529-36. B a t t i s t e , J.L., Mao, H. , Rao, N.S., Tan, R. , Muhandiram, D.R., Kay, L.E., Frankel, A.D. and Williamson, J.R. (1996) Alpha helix-RNA major groove r e c o g n i t i o n i n an HIV-1 rev peptide-RRE RNA complex. Science, 273, 1547-51. Belasco, J.G., Beatty, J.T., Adams, C.W., von Gabain, A. and Cohen, S.N. (1985) D i f f e r e n t i a l expression of photosynthesis genes i n R. capsulata r e s u l t s from segmental d i f f e r e n c e s i n s t a b i l i t y w i t h i n the p o l y c i s t r o n i c rxcA t r a n s c r i p t . Cell, 40 , 171-81. Beran, R.K. and Simons, R.W. (2001) Cold-temperature i n d u c t i o n of Escherichia coli p o l y n u c l e o t i d e phosphorylase occurs by r e v e r s a l of i t s au t o r e g u l a t i o n . Mol Microbiol, 39, 112-25. Bernstein, E., Caudy, A.A., Hammond, S.M. and Hannon, G.J. (2001) Role f o r a bi d e n t a t e ribonuclease i n the i n i t i a t i o n step of RNA in t e r f e r e n c e . Nature, 409 , 363-6. B l a t t n e r , F.R., P l u n k e t t , G. , 3rd, Bloch, C.A., Perna, N.T., Burland, V., R i l e y , M., Collado-Vides, J . , Glasner, J.D., Rode, C.K., Mayhew, G.F., Gregor, J . , Davis, N.W., K i r k p a t r i c k , H.A., Goeden, M.A., Rose, D.J., Mau, B. and Shao, Y. (1997) The complete genome sequence of Escherichia coli K-12. Science, 277 , 1453-74. Blum, E. , Py, B., Carpousis, A.J. and Higg i n s , C.F. (1997) Polyphosphate kinase i s a component of the Escherichia coli RNA degradosome. Mol Microbiol, 26 , 387-98. Bouvet, P. and Belasco, J.G. (1992) Control of RNase E-mediated RNA degradation by 5'-terminal base p a i r i n g i n E. coli. Nature, 360, 488-91. Bradford, M.M. (1976) A r a p i d and s e n s i t i v e method f o r the q u a n t i t a t i o n of microgram q u a n t i t i e s of p r o t e i n u t i l i z i n g the p r i n c i p l e of p r o t e i n -dye b i n d i n g . Anal Biochem, 72 , 248-54. Braun, F., Hajnsdorf, E. and Régnier, P. (1996) Po l y n u c l e o t i d e phosphorylase i s r e q u i r e d f o r the r a p i d degradation of the RNase E-processed rpsO mRNA of Escherichia coli devoid of i t s 3' h a i r p i n . Mol Microbiol, 19 , 997-1005. B r i c k e r , A.L. and Belasco, J.G. (1999) Importance of a 5' stem-loop f o r l o n g e v i t y of papA mRNA i n Escherichia coli. J Bacterid, 181 , 3587-90. Brown, J.T., B a i , X. and Johnson, A.W. (2000) The yeast a n t i v i r a l p r o t e i n s Ski2p, Ski3p, and Ski8p e x i s t as a complex in vivo. RNA, 6, 449-57. Burd, C.G. and Dreyfuss, G. (1994) Conserved s t r u c t u r e s and d i v e r s i t y of f u n c t i o n s of RNA-binding p r o t e i n s . Science, 265 , 615-21. B y c r o f t , M. , Hubbard, T.J., P r o c t o r , M., Freund, S.M. and Murzin, A.G. (1997) The s o l u t i o n s t r u c t u r e of the SI RNA b i n d i n g domain: a member of an ancient n u c l e i c a c i d - b i n d i n g f o l d . Cell, 88, 235-42. Cai r r a o , F., Chora, A., Zilhâo, R., Carpousis, A.J. and Arraiano, CM. (2001) RNase I I l e v e l s change according to the growth c o n d i t i o n s : c h a r a c t e r i z a t i o n of gmr, a new Escherichia coli gene i n v o l v e d i n the modulation of RNase I I . Mol Microbiol, 39, 1550-61. Calnan, B.J., Biancalana, S., Hudson, D. and F r a n k e l , A.D. (1991) A n a l y s i s of a r g i n i n e - r i c h peptides from the HIV Tat p r o t e i n reveals unusual features of RNA-protein r e c o g n i t i o n . Genes Dev, 5, 201-10. Cannistraro, V.J. and Ke n n e l l , D. (1994) The pro c e s s i v e r e a c t i o n mechanism of ribo n u c l e a s e I I . J Mol Biol, 243, 930-43. Cao, G.J. and Sarkar, N. (1992) I d e n t i f i c a t i o n of the gene f o r an Escherichia coli p o l y (A) polymerase. Proc Natl Acad Sci USA, 89, 10380-4. Cao, G.J., Pogliano, J . and Sarkar, N. (1996) I d e n t i f i c a t i o n of the coding region f o r a second poly(A) polymerase i n Escherichia coli. Proc Natl Acad Sci USA, 93, 11580-5. Carpousis, A.J., Van Houwe, G. , Ehretsmann, C. and K r i s c h , H.M. (1994) C o p u r i f i c a t i o n of E. c o l i RNAase E and PNPase: evidence f o r a s p e c i f i c a s s o c i a t i o n between two enzymes important i n RNA processing and degradation. Cell, 76 , 889-900. Carpousis, A.J., Vanzo, N.F. and Raynal, L.C. (1999) mRNA degradation. A t a l e of poly(A) and m u l t i p r o t e i n machines. Trends Genet, 15, 24-8. Carthew, R.W. (2001) Gene s i l e n c i n g by double-stranded RNA. Curr Opin Casaregola, S., Jacq, A., Laoudj, D., McGurk, G., Margarson, S., Tempête, M., N o r r i s , V. and Holland, I.B. (1992) C l o n i n g and a n a l y s i s of the e n t i r e Escherichia coli ams gene, ams i s i d e n t i c a l to hmpl and encodes a 114 kDa p r o t e i n that migrates as a 18 0 kDa p r o t e i n . J Mol Biol, 228, 30-40. Casaregola, S., Jacq, A., Laoudj, D., McGurk, G., Margarson, S., Tempête, M., N o r r i s , V. and Holland, I.B. (1994) C l o n i n g and a n a l y s i s of the e n t i r e Escherichia coli ams gene, ams i s i d e n t i c a l to hmpl and encodes a 114 kDa p r o t e i n that migrates as a 180 kDa p r o t e i n ( c o r r e c t i o n ) . J Mol Biol, 238, 867. Chanda, P.K., Ono, M., Kuwano, M. and Kung, H. (1985) C l o n i n g , sequence a n a l y s i s , and expression of a l t e r a t i o n of the mRNA s t a b i l i t y gene (ams*) of Escherichia coli. J Bacterid, 161, 446-9. Chaney, S.G. and Boyer, P.D. (1972) I n c o r p o r a t i o n of water oxygens i n t o i n t r a c e l l u l a r n u c l e o t i d e s and RNA. I I . Predominantly h y d r o l y t i c RNA turnover i n E s c h e r i c h i a c o l i . J Mol Biol, 64, 581-91. Chanfreau, G., Legr a i n , P. and Jac q u i e r , A. (1998) Yeast RNase I I I as a key processing enzyme i n small n u c l e o l a r RNAs metabolism. J Mol Biol, 284, 975-88. Cheng, Z.F., Zuo, Y., L i , Z., Rudd, K.E. and Deutscher, M.P. (1998) The vacB gene r e q u i r e d f o r v i r u l e n c e i n Shigella flexneri and Escherichia coli encodes the exoribonuclease RNase R. J Biol Chem, 273 , 14077-80. Clark, J.M. (1988) Novel non-templated n u c l e o t i d e a d d i t i o n r e a c t i o n s catalyzed by p r o c a r y o t i c and eu c a r y o t i c DNA polymerases. Nucleic Acids Res, 16, 9677-86. C l a v e r i e - M a r t i n , F. , Diaz-Torres, M.R., Yancey, S.D. and Kushner, S.R. (1991) A n a l y s i s of the a l t e r e d mRNA s t a b i l i t y (ams) gene from Escherichia coli. N u c l e o t i d e sequence, t r a n s c r i p t i o n a l a n a l y s i s , and homology of i t s product t o MRP3, a mi t o c h o n d r i a l ribosomal p r o t e i n from Neurospora c r a s s a . J Biol Chem, 266, 2843-51. Coburn, G.A. and Mackie, G.A. (1996) Overexpression, p u r i f i c a t i o n , and pr o p e r t i e s of Escherichia coli ribonuclease I I . J Biol Chem, 271 , 1048-53 . Coburn, G.A. and Mackie, G.A. (1998) R e c o n s t i t u t i o n of the degradation of the mRNA f o r ribosomal p r o t e i n S20 wi t h p u r i f i e d enzymes. J Mol Biol, 279, 1061-74. Coburn, G.A., Miao, X., B r i a n t , D.J. and Mackie, G.A. (1999) R e c o n s t i t u t i o n of a minimal RNA degradosome demonstrates f u n c t i o n a l c o o r d i n a t i o n between a 3 ' exonuclease and a DEAD-box RNA h e l i c a s e [published erratum appears i n Genes Dev 2000 May 1;14(9) : 1167] . Genes Dev, 13, 2594-603. Coburn, G.A. and Mackie, G.A. (1999) Degradation of mRNA i n Escherichia coli: an o l d problem with some new t w i s t s . Progr Nucleic Acid Res Mol Biol, 62, 55-108. Condon, C., Brechemier-Baey, D., Beltchev, B., Grunberg-Manago, M. and Putzer, H. (2001) I d e n t i f i c a t i o n of the gene encoding the 5S ribosomal RNA maturase i n B a c i l l u s subtilis-. mature 5S rRNA i s dispensable f o r ribosome f u n c t i o n . Rna, 7, 242-53. Cormack, R.S. and Mackie, G .A. (1992) S t r u c t u r a l requirements f o r the processing of Escherichia coli 5 S ribosomal RNA by RNase E in vitro. J Mol Biol, 228, 1078-90. Cormack, R.S., Genereaux, J.L. and Mackie, G.A. (1993) RNase E a c t i v i t y i s conferred by a s i n g l e polypeptide: overexpression, p u r i f i c a t i o n , and pr o p e r t i e s of the ams/rne/hmpl gene product. Proc Natl Acad Sci USA, 90, 9006-10. Cormack, R.S. (1994) Ribosomal RNA-protein i n t e r a c t i o n s in Escherichia coli: binding of ribosomal protein S20 to 16 S rRNA and processing of 5 S rRNA by ribonuclease E. F a c u l t y of Graduate Studies U n i v e r s i t y of Western Ontario, London, Ont. Deutscher, M.P. and Reuven, N.B. (1991) Enzymatic b a s i s f o r h y d r o l y t i c versus p h o s p h o r o l y t i c mRNA degradation i n Escherichia coli and Bacillus subtilis. Proc Natl Acad Sci USA, 88, 3277-80. Deutscher, M.P. (1993) Ribonuclease m u l t i p l i c i t y , d i v e r s i t y , and complexity. J Biol Chem, 268, 13011-4. Deutscher, M.P. (1993) Promiscuous exoribonucleases of Escherichia coli. J Bacterid, 175, 4577-83. Deutscher, M.P. and L i , Z. (2000) Exoribonucleases and t h e i r m u l t i p l e r o l e s i n RNA metabolism. Prog Nucleic Acid Res Mol Biol, 66 , 67-105. Diwa, A., B r i c k e r , A.L., J a i n , C. and Belasco, J.G. (2000) An e v o l u t i o n a r i l y conserved RNA stem-loop f u n c t i o n s as a sensor that d i r e c t s feedback r e g u l a t i o n of RNase E gene expression. Genes Dev, 14, 1249-60. Donovan, W.P. and Kushner, S.R. (1986) P o l y n u c l e o t i d e phosphorylase and ribonuclease I I are r e q u i r e d f o r c e l l v i a b i l i t y and mRNA turnover i n Escherichia coli K-12. Proc N a t l Acad S c i USA, 83, 120-4. Draper, D.E. (1999) Themes i n RNA-protein r e c o g n i t i o n . J Mol Biol, 293, 255-70. Duffy, J . J . , Chaney, S.G. and Boyer, P.D. (1972) I n c o r p o r a t i o n of water oxygens i n t o i n t r a c e l l u l a r n u c l e o t i d e s and RNA. I. Predominantly non-h y d r o l y t i c RNA turnover i n B a c i l l u s s u b t i l i s . J Mol Biol, 64, 565-79. Dunn, S.D. (1986) E f f e c t s of the m o d i f i c a t i o n of t r a n s f e r b u f f e r composition and the r e n a t u r a t i o n of p r o t e i n s i n g e l s on the r e c o g n i t i o n of p r o t e i n s on Western b l o t s by monoclonal a n t i b o d i e s . Anal Biochem, 157, 144-53. Ehretsmann C P . , Carpousis A.J., and K r i s c h H.M. (1992) S p e c i f i c i t y of Escherichia coli endoribonuclease RNase E: i n v i v o and i n v i t r o a n a l y s i s of mutants i n a bacteriophage T4 mRNA pr o c e s s i n g s i t e . Genes Farr, G.A., Oussenko, I.A. and Bechhofer, D.H. (1999) P r o t e c t i o n against 3'-to-5' RNA decay i n Bacillus subtilis. J Bacterid, 181, 7323-30. Feng, Y. and Cohen, S.N. (2000) Unpaired t e r m i n a l n u c l e o t i d e s and 5' monophosphorylation govern 3 ' po l y a d e n y l a t i o n by Escherichia coli poly(A) polymerase I. Proc Natl Acad Sci USA, 97, 6415-20. Fleischmann, R.D., Adams, M.D., White, O. , C layton, R.A., Kirkness, E.F., Kerlavage, A.R., B u l t , C.J., Tomb, J.F., Dougherty, B.A., Merrick, J.M. and et a l . (1995) Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science, 269 , 496-512. Garcia-Mena, J . , Das, A., S a n c h e z - T r u j i l l o , A., P o r t i e r , C. and Montanez, C. (1999) A novel mutation i n the KH domain of p o l y n u c l e o t i d e phosphorylase a f f e c t s a u t o r e g u l a t i o n and mRNA decay i n Escherichia coli. Mol Microbiol, 3 3 , 235-48. Ghora, B.K. and A p i r i o n , D. (1978) S t r u c t u r a l a n a l y s i s and i n v i t r o processing to p5 rRNA of a 9S RNA molecule i s o l a t e d from an rne mutant of E. c o l i . Cell, 15 , 1055-66. Ghosh, S. and Deutscher, M.P. (1999) O l i g o r i b o n u c l e a s e i s an e s s e n t i a l component of the mRNA decay pathway. Proc Natl Acad Sci USA, 96, 4372-7. Gottesman, M. , Oppenheim, A. and Court, D. (1982) R e t r o r e g u l a t i o n : c o n t r o l of gene expr e s s i o n from s i t e s d i s t a l to the gene. Cell, 29, 727-8. G r i s h i n , N.V. (2001) KH domain: one motif, two f o l d s . Nucleic Acids Res, 29, 638-43. Grishok, A., P a s q u i n e l l i , A.E., Conte, D. , L i , N. , P a r r i s h , S., Ha, I . , B a i l l i e , D.L., F i r e , A., Ruvkun, G. and Mello, C.C. (2001) Genes and mechanisms r e l a t e d to RNA i n t e r f e r e n c e r e g u l a t e e x p r e s s i o n of the small temporal RNAs that c o n t r o l C. elegans developmental t i m i n g . Cell, 106, 23-34. Grunberg-Manago, M., and Ochoa, S. (1955) Enzymic s y n t h e s i s and breakdown of p o l y n u c l e o t i d e s : p o l y n u c l e o t i d e phosphorylase. J. Am. Chem. Soc, 77 , 3165-3166. G u t i e r r e z , R.A., Macintosh, G.C. and Green, P.J. (1999) Current perspectives on mRNA s t a b i l i t y i n p l a n t s : m u l t i p l e l e v e l s and mechanisms of c o n t r o l . Trends Pl a n t Sci, 4, 429-438. Haugel-Nielsen, J . , Hajnsdorf, E. and Régnier, P. (1996) The rpsO mRNA of Escherichia coli i s polyadenylated at m u l t i p l e s i t e s r e s u l t i n g from endo n u c l e o l y t i c p r o c e s s i n g and e x o n u c l e o l y t i c degradation. Embo J, 15, 3144-52. Hayes, R., Kudla, J . , Schuster, G., Gabay, L., Maliga, P. and Gruissem, W. (1996) C h l o r o p l a s t mRNA 3'-end processing by a hi g h molecular weight p r o t e i n complex i s re g u l a t e d by nuclear encoded RNA b i n d i n g p r o t e i n s . Hayes, R., Kudla, J . and Gruissem, W. (1999) Degrading c h l o r o p l a s t mRNA: the r o l e of p o l y a d e n y l a t i o n . Trends Biochem Sci, 24, 199-202. Her s k o v i t z , M.A. and Bechhofer, D.H. (2000) Endoribonuclease RNase I I I i s e s s e n t i a l i n B a c i l l u s subtilis. Mol Microbiol, 38 , 1027-33. Higgins, C F . , P e l t z , S.W. and Jacobson, A. (1992) Turnover of mRNA i n prokaryotes and lower eukaryotes. Curr Opin Genet Dev, 2, 739-47. Huang, H., L i a o , J . and Cohen, S.N. (1998) P o l y ( A ) - and poly(U)-s p e c i f i c RNA 3' t a i l s hortening by E. c o l i r ibonuclease E. .Nature, 391, 99-102. Jacobs, J.S., Anderson, A.R. and Parker, R.P. (1998) The 3' to 5 ' degradation of yeast mRNAs i s a general mechanism f o r mRNA turnover that r e q u i r e s the SKI2 DEVH box p r o t e i n and 3 ' t o 5 ' exonucleases of the exosome complex. EMBO J, 17, 1497-506. J a i n , C. and Belasco, J.G. (1995) RNase E autoregulates i t s synthesis by c o n t r o l l i n g the degradation ra t e of i t s own mRNA i n Escherichia coli: unusual s e n s i t i v i t y of the rne t r a n s c r i p t to RNase E a c t i v i t y . Genes Dev, 9, 84-96. Jia n g , W. , Hou, Y. and Inouye, M. (1997) CspA, the major cold-shock p r o t e i n of Escherichia coli, i s an RNA chaperone. J Biol Chem, 272, 196-202. Jia n g , X., Diwa, A. and Belasco, J.G. (2000) Regions of RNase E important f o r 5'-end-dependent RNA cleavage and autoregulated sy n t h e s i s . J Bacteriol, 182, 2468-75. Jones, P.G., VanBogelen, R.A. and Neidhardt, F.C. (1987) Induction of pro t e i n s i n response to low temperature i n Escherichia coli. J Bacteriol, 169 , 2092-5. Jones, G.H. (1994) A c t i v a t i o n of ATP :GTP 3'-pyrophosphotransferase (guanosine pentaphosphate synthetase) i n Streptomyces antibioticus. J Bacteriol, 176, 1482-7. Jones, G.H. and Bibb, M.J. (1996) Guanosine pentaphosphate synthetase from Streptomyces a n t i b i o t i c u s i s a l s o a p o l y n u c l e o t i d e phosphorylase. J Bacteriol, 178, 4281-8. Jones, P.G., M i t t a , M. , Kim, Y. , J i a n g , W. and Inouye, M. (1996) Cold shock induces a major ribosomal-associated p r o t e i n that unwinds double-stranded RNA i n Escherichia coli. Proc Natl Acad Sci USA, 93, 76-80. Kaberdin, V.R., Miczak, A., Jakobsen, J.S., Lin-Chao, S., McDowall, K.J. and von Gabain, A. (1998) The e n d o r i b o n u c l e o l y t i c N-terminal h a l f of Escherichia coli RNase E i s e v o l u t i o n a r i l y conserved i n Synechocystis sp. and other b a c t e r i a but not the C-terminal h a l f , which i s s u f f i c i e n t f o r degradosome assembly. Proc N a t l Acad Sci USA, 95, 11637-42. Kaberdin, V.R., Walsh, A.P., Jakobsen, T., McDowall, K.J. and von Gabain, A. (2000) Enhanced cleavage of RNA mediated by an i n t e r a c t i o n between substrates and the a r g i n i n e - r i c h domain of E. coli ribonuclease E. J Mol Biol, 301, 257-64. Kharrat, A., Macias, M.J., Gibson, T.J., N i l g e s , M. and Pastore, A. (1995) S t r u c t u r e of the dsRNA bi n d i n g domain of E. coli RNase I I I . EMBO J, 14, 3572-84. Kido, M., Yamanaka, K. , M i t a n i , T., N i k i , H., Ogura, T. and Hiraga, S. (1996) RNase E poly p e p t i d e s l a c k i n g a c a r b o x y l - t e r m i n a l h a l f suppress a mukB mutation i n Escherichia coli. J Bacterid, 178, 3917-25. Kim, S., Sim, S. and Lee, Y. (1999) In vitro a n a l y s i s of processing at the 3 1 -end of precursors of Ml RNA, the c a t a l y t i c subunit of Escherichia coli RNase P: m u l t i p l e pathways and steps f o r the processing. Nucleic Acids Res, 27 , 895-902. Lewis, H.A., Chen, H. , Edo, C , Buckanovich, R.J., Yang, Y.Y., Musunuru, K. , Zhong, R. , D a r n e l l , R.B. and Burley, S.K. (1999) C r y s t a l s t r u c t u r e s of Nova-1 and Nova-2 K-homology RNA-binding domains. S t r u c t u r e Fold Des, 7, 191-203. Lewis, H.A., Musunuru, K. , Jensen, K.B., Edo, C , Chen, H., D a r n e l l , R.B. and Burley, S.K. (2000) Sequence-specific RNA b i n d i n g by a Nova KH domain: i m p l i c a t i o n s f o r pa r a n e o p l a s t i c disease and the f r a g i l e X syndrome. Cell, 100, 323-32. L i , H. and Nicholson, A.W. (1996) D e f i n i n g the enzyme b i n d i n g domain of a ribonuclease I I I pr o c e s s i n g s i g n a l . E t h y l a t i o n i n t e r f e r e n c e and hydroxyl r a d i c a l f o o t p r i n t i n g using c a t a l y t i c a l l y i n a c t i v e RNase I I I mutants. EMBO J, 15 , 1421-33. L i , Z. and Deutscher, M.P. (1996) Maturation pathways f o r E. coli tRNA precursors: a random multienzyme process in vivo. Cell, 86, 503-12. L i , Q.S., Gupta, J.D. and Hunt, A.G. (1998) P o l y n u c l e o t i d e phosphorylase i s a component of a novel p l a n t poly(A) polymerase. J Biol Chem, 273 , 17539-43. L i , Z., Pandit, S. and Deutscher, M.P. (1998a) 3' e x o r i b o n u c l e o l y t i c trimming i s a common f e a t u r e of the maturation of s m a l l , s t a b l e RNAs i n Escherichia coli. Proc Natl Acad Sci USA, 95, 2856-61. L i , Z., Pandit, S. and Deutscher, M.P. (1998b) P o l y a d e n y l a t i o n of sta b l e RNA precur s o r s i n vivo. Proc Natl Acad Sci USA, 95, 12158-62. L i , Z., Pandit, S. and Deutscher, M.P. (1999) RNase G (CafA protein) and RNase E are both r e q u i r e d f o r the 5' maturation of 16S ribosomal RNA. EMBO J, 18 , 2878-85. Lin-Chao, S., Wei, C.L. and L i n , Y.T. (1999) RNase E i s re q u i r e d f o r the maturation of ssrA RNA and normal ssrA RNA peptide-tagging a c t i v i t y . Proc Natl Acad Sci USA, 96, 12406-11. Liou, G.G., Jane, W.N., Cohen, S.N., L i n , N.S. and Lin-Chao, S. (2001) RNA degradosomes e x i s t i n v i v o i n Escherichia coli as multicomponent complexes a s s o c i a t e d w i t h the cytoplasmic membrane v i a the N-terminal region of ri b o n u c l e a s e E. Proc Natl Acad Sci USA, 98, 63-8. L i s i t s k y , I . , K o t l e r , A. and Schuster, G. (1997) The mechanism of p r e f e r e n t i a l degradation of polyadenylated RNA i n the c h l o r o p l a s t . The exoribonuclease lOORNP/polynucleotide phosphorylase d i s p l a y s high binding a f f i n i t y f o r poly(A) sequence. J Biol Chem, 272, 17648-53. L i t t a u e r , Y.Z., and Soreq, H. (1982) P o l y n u c l e o t i d e phosphorylase. In Boyer, P. (ed.) The Enzymes. Academic Press, New York, V o l . XV, pp. 517-553 . Lopez, P.J., Marchand, I . , Joyce, S.A. and Dreyfus, M. (1999) The C-terminal h a l f of RNase E, which organizes the Escherichia coli degradosome, p a r t i c i p a t e s i n mRNA degradation but not rRNA processing i n v i v o . Mol Microbiol, 33 , 188-99. Lundberg, U. , von Gabain, A. and Melefors, Ô. (1990) Cleavages i n the 5' region of the ompA and bla mRNA c o n t r o l s t a b i l i t y : s t u d i e s w i t h an E. coli mutant a l t e r i n g mRNA s t a b i l i t y and a novel endoribonuclease. EMBO J, 9, 2731-41 . Lundberg, U., Mele f o r s , Ô., Sohlberg, B., G e o r g e l l i s , D. and von Gabain, A. (1995) RNase K: one l e s s l e t t e r i n the alphabet soup. Mol Microbiol, 17 , 595-6. Mackie, G.A. (1991) S p e c i f i c e n d o n u c l e o l y t i c cleavage of the mRNA f o r ribosomal p r o t e i n S20 of Escherichia coli r e q u i r e s the product of the ams gene i n v i v o and i n v i t r o . J Bacterid, 173 , 2488-97. Mackie, G.A. and Genereaux, J.L. (1993) The r o l e of RNA s t r u c t u r e i n determining RNase E-dependent cleavage s i t e s i n the mRNA f o r ribosomal p r o t e i n S20 i n v i t r o . J Mol Biol, 234, 998-1012. Mackie, G.A. (1998) Ribonuclease E i s a 5 1-end-dependent endonuclease. Nature, 395, 720-3. Mackie, G.A. (2000) S t a b i l i z a t i o n of c i r c u l a r rpsT mRNA demonstrates the 5 1-end dependence of RNase E a c t i o n in vivo. J Biol Chem, 275, 25069-72. Margossian, S.P., L i , H. , Zassenhaus, H.P. and Butow, R.A. (1996) The DExH box p r o t e i n Suv3p i s a component of a yeast m i t o c h o n d r i a l 3 1 - t o-5' exoribonuclease that suppresses group I i n t r o n t o x i c i t y . Cell, 84, 199-209. Mathy, N. , J a r r i g e , A.C., Robert-Le Meur, M. and P o r t i e r , C. (2001) Increased e x p r e s s i o n of Escherichia coli p o l y n u c l e o t i d e phosphorylase at low temperatures i s l i n k e d to a decrease i n the e f f i c i e n c y of aut o c o n t r o l . J Bacterid, 183 , 3848-54. McDowall, K.J., Hernandez, R.G., Lin-Chao, S. and Cohen, S.N. (1993) The ams-1 and rne-3071 temperature-sensitive mutations i n the ams gene are i n cl o s e p r o x i m i t y to each other and cause s u b s t i t u t i o n s w i t h i n a domain that resembles a product of the Escherichia coli mre locus. J Bacteriol, 175, 4245-9. McDowall, K.J. and Cohen, S.N. (1996) The N-terminal domain of the rne gene product has RNase E a c t i v i t y and i s non-overlapping wit h the a r g i n i n e - r i c h RNA-binding s i t e . J Mol Biol, 255, 349-55. Mian, I.S. (1997) Comparative sequence a n a l y s i s of ribonucleases HII, I I I , I I PH and D. Nucleic Acids Res, 25 , 3187-95. Miczak, A., Kaberdin, V.R., Wei, C.L. and Lin-Chao, S. (1996) P r o t e i n s associated w i t h RNase E i n a multicomponent r i b o n u c l e o l y t i c complex. Proc N a t l Acad Sci USA, 93, 3865-9. Misra, T.K. and A p i r i o n , D. (1979) RNase E, an RNA pro c e s s i n g enzyme from Escherichia coli. J Biol Chem, 254, 11154-9. M i t c h e l l , P., P e t f a l s k i , E., Shevchenko, A., Mann, M. and T o l l e r v e y , D. (1997) The exosome: a conserved eukaryotic RNA processing complex con t a i n i n g m u l t i p l e 3'-->5' exoribonucleases. Cell, 91 , 457-66. M i t c h e l l , P. and T o l l e r v e y , D. (2001) mRNA turnover. Curr Opin Cell Biol, 13, 320-5. Mohanty, B.K. and Kushner, S.R. (1999a) A n a l y s i s of the f u n c t i o n of Escherichia coli poly(A) polymerase I i n RNA metabolism. Mol Microbiol, 34, 1094-108. Mohanty, B.K. and Kushner, S.R. (1999b) R e s i d u a l p o l y a d e n y l a t i o n i n poly(A) polymerase I (pcnB) mutants of Escherichia coli does not r e s u l t from the a c t i v i t y encoded by the f310 gene. Mol Microbiol, 34, 1109-19. Mohanty, B.K. and Kushner, S.R. (2000a) P o l y n u c l e o t i d e phosphorylase functions both as a 3'->5' exonuclease and a p o l y (A) polymerase i n Escherichia coli. Proc Natl Acad Sci USA, 97, 11966-71. Mohanty, B.K. and Kushner, S.R. (20 0 0b) P o l y n u c l e o t i d e phosphorylase, RNase I I and RNase E p l a y d i f f e r e n t r o l e s i n the i n v i v o modulation of polya d e n y l a t i o n i n Escherichia coli. Mol Microbiol, 36 , 982-94. Mudd, E.A., K r i s c h , H.M. and Higgins, C F . (1990) RNase E, an endoribonuclease, has a general r o l e i n the chemical decay of Es c h e r i c h i a c o l i mRNA: evidence that rne and ams are the same genetic locus. Mol Microbiol, 4, 2127-35. Muhlberg, A.B. and Schmid, S.L. (2000) Domain s t r u c t u r e and f u n c t i o n of dynamin probed by l i m i t e d p r o t e o l y s i s . Methods, 20 , 475-83. M u l l i s , K., Faloona, F., Scharf, S., S a i k i , R., Horn, G. and E r l i c h , H. (1986) S p e c i f i c enzymatic a m p l i f i c a t i o n of DNA in vitro: the polymerase chain r e a c t i o n . Cold Spring Harb Symp Quant Biol, 51 , 263-73. Musco, G., S t i e r , G. , Joseph, C , C a s t i g l i o n e M o r e l l i , M.A., N i l g e s , M., Gibson, T.J. and Pastore, A. (1996) Three-dimensional s t r u c t u r e and s t a b i l i t y of the KH domain: molecular i n s i g h t s i n t o the f r a g i l e X syndrome. Cell, 85, 237-45. Neuhaus, K., Rapposch, S., F r a n c i s , K.P. and Scherer, S. (2000) Restart of exponential growth of cold-shocked Yersinia e n t e r o c o l i t i c a occurs a f t e r down-regulation of cspAl/A2 mRNA. J Bacteriol, 182, 3285-8. Nicholson, A.W. (1999) Function, mechanism and r e g u l a t i o n of b a c t e r i a l r ibonucleases. FEMS Microbiol Rev, 23 , 371-90. N i c o l , S.M. and F u l l e r - P a c e , F.V. (1995) The "DEAD box" p r o t e i n DbpA i n t e r a c t s s p e c i f i c a l l y w i t h the p e p t i d y l t r a n s f e r a s e center i n 23S rRNA. Proc Natl Acad Sci USA, 92, 11681-5. N i e r l i c h , D.P. and Murakawa, G.J. (1996) The decay of b a c t e r i a l messenger RNA. Prog Nucleic Acid Res Mol Biol, 52, 153-216. Niguma, K. (1997) Studies on Ribonuclease E of ESCHERICHIA COLI and its association with the enzyme Polynucleotide phosphorylase. U n i v e r s i t y of B r i t i s h Columbia, [Vancouver]. N i y o g i , S.K. and Datta, A.K. (1975) A novel o l i g o r i b o n u c l e a s e of Escherichia coli. I. I s o l a t i o n and p r o p e r t i e s . J Biol Chem, 250, 7307-12. Ono, M. and Kuwano, M. (197 9) A c o n d i t i o n a l l e t h a l mutation i n an Escherichia coli s t r a i n w i t h a longer chemical l i f e t i m e of messenger RNA. J" Mol Biol, 129, 343-57. Oussenko, I.A. and Bechhofer, D.H. (2000) The yvaJ gene of Bacillus subtilis encodes a 3'-to-5' exoribonuclease and i s not e s s e n t i a l i n a s t r a i n l a c k i n g p o l y n u c l e o t i d e phosphorylase. J Bacteriol, 182, 2639-42. Ow, M.C., L i u , Q., and Kushner, S.R. (2000) A n a l y s i s of mRNA decay and rRNA processing i n Escherichia coli i n the absence of RNase E-based degradosome assembly. Mol Microbiol, 38 , 854-66 Pepe, CM., Maslesa-Galic, S. and Simons, R.W. (1994) Decay of the IS10 antisense RNA by 3' exoribonucleases: evidence that RNase I I s t a b i l i z e s RNA-OUT against PNPase at t a c k . Mol Microbiol, 13 , 1133-42. Phadtare, S., A l s i n a , J . and Inouye, M. (1999) Cold-shock response and cold-shock p r o t e i n s . Curr Opin Microbiol, 2, 175-80. P h i z i c k y , E.M. and F i e l d s , S. (1995) P r o t e i n - p r o t e i n i n t e r a c t i o n s : methods f o r d e t e c t i o n and a n a l y s i s . Microbiol Rev, 59, 94-123. P o r t i e r , C , van Rapenbusch, R., Minh Nguy, T. and Grunberg-Manago, M. (1973) Quaternary s t r u c t u r e of p o l y n u c l e o t i d e phosphorylase from Escherichia coli. Eur J Biochem, 40, 77-87. P o r t i e r , C. (1975) Quaternary s t r u c t u r e of p o l y n u c l e o t i d e phosphorylase from Escherichia coli: evidence of a complex between two types of polypeptide chains. JSur J Biochem, 55, 573-82. P o r t i e r , C , Dondon, L., Grunberg-Manago, M. and Régnier, P. (1987) The f i r s t step i n the f u n c t i o n a l i n a c t i v a t i o n of the Escherichia coli p o l y n u c l e o t i d e phosphorylase messenger i s a ribonuclease I I I processing at the 5' end. EMBO J, 6, 2165-70. P u g l i s i , J.D., Chen, L., Frankel, A.D. and Williamson, J.R. (1993) Role of RNA s t r u c t u r e i n a r g i n i n e r e c o g n i t i o n of TAR RNA. Proc Natl Acad Sci USA, 90, 3680-4. P u g l i s i , J.D., Chen, L., Blanchard, S. and Fr a n k e l , A.D. (1995) S o l u t i o n s t r u c t u r e of a bovine immunodeficiency v i r u s Tat-TAR peptide-RNA complex. Science, 270, 1200-3. Py, B., Causton, H., Mudd, E. A. and Higgins, C F . (1994) A p r o t e i n complex mediating mRNA degradation i n Escherichia coli. Mol Microbiol, 14, 717-29. Py, B. , Higgins, C F . , K r i s c h , H.M. and Carpousis, A.J. (1996) A DEAD-box RNA h e l i c a s e i n the Escherichia coli RNA degradosome. Nature, 381, 169-72 . Ramos, A., Grunert, S., Adams, J . , Micklem, D.R., Pro c t o r , M.R., Freund, S., B y c r o f t , M. , St Johnston, D. and Var a n i , G. (2000) RNA re c o g n i t i o n by a Staufen double-stranded RNA-binding domain. EMBO J, 19, 997-1009. Ray, A. and A p i r i o n , D. (1980) Cloning the gene f o r ribonuclease E, an RNA processing enzyme. Gene, 12, 87-94. Raynal, L.C. and Carpousis, A.J. (1999) Poly(A) polymerase I of Escherichia coli: c h a r a c t e r i z a t i o n of the c a t a l y t i c domain, an RNA binding s i t e and regions f o r the i n t e r a c t i o n w i t h p r o t e i n s i n v o l v e d i n mRNA degradation. Mol Microbiol, 32, 765-75. Régnier, P. and P o r t i e r , C. (1986) I n i t i a t i o n , a t t e n u a t i o n and RNase I I I processing of t r a n s c r i p t s from the Escherichia coli operon encoding ribosomal p r o t e i n S15 and p o l y n u c l e o t i d e phosphorylase. J Mol Biol, 187, 23-32. Régnier, P., Grunberg-Manago, M. and P o r t i e r , C. (1987) Nucleotide sequence of the pnp gene of Escherichia coli encoding p o l y n u c l e o t i d e phosphorylase. Homology of the primary s t r u c t u r e of the p r o t e i n w i t h the RNA-binding domain of ribosomal p r o t e i n SI. J Biol Chem, 262, 63-8. Régnier, P. and Grunberg-Manago, M. (1990) RNase I I I cleavages i n non-coding leaders of Escherichia coli t r a n s c r i p t s c o n t r o l mRNA s t a b i l i t y and genetic expression. Biochimie, 72, 825-34. Robert-Le Meur, M. and P o r t i e r , C. (1992) E.coli p o l y n u c l e o t i d e phosphorylase exp r e s s i o n i s autoregulated through an RNase I l l -dependent mechanism. EMBO J, 11 , 2633-41. Robert-Le Meur, M. and P o r t i e r , C. (1994) P o l y n u c l e o t i d e phosphorylase of Escherichia coli induces the degradation of i t s RNase I I I processed messenger by pr e v e n t i n g i t s t r a n s l a t i o n . Nucleic Acids Res, 22, 3 97-403 . Rogers, G.W., J r . , R i c h t e r , N.J. and Merrick, W.C (1999) Biochemical and k i n e t i c c h a r a c t e r i z a t i o n of the RNA h e l i c a s e a c t i v i t y of eu k a r y o t i c i n i t i a t i o n f a c t o r 4A. J Biol Chem, 274, 12236-44. Rouleau, M., Smith, R.J., Bancroft, J.B. and Mackie, G.A. (1994) P u r i f i c a t i o n , p r o p e r t i e s , and s u b c e l l u l a r l o c a l i z a t i o n of f o x t a i l mosaic p o t e x v i r u s 26-kDa p r o t e i n . Virology, 204, 254-65. Roy, M.K. and A p i r i o n , D. (1983) P u r i f i c a t i o n and p r o p e r t i e s of ribonuclease E, an RNA-processing enzyme from Escherichia coli. Biochim Biophys Acta, 747 , 200-8. Roy, S., P a r k i n , N.T., Rosen, C. , I t o v i t c h , J . and Sonenberg, N. (1990) S t r u c t u r a l requirements f o r trans a c t i v a t i o n of human immunodeficiency v i r u s type 1 long t e r m i n a l r e p e a t - d i r e c t e d gene expression by t a t : importance of base p a i r i n g , loop sequence, and bulges i n the t a t -responsive sequence. J Virol, 64, 1402-6. Sambrook, J . , F r i t s c h , E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. Sarkar, N. (1997) Po l y a d e n y l a t i o n of mRNA i n prokaryotes. Annu Rev Biochem, 66, 173-97. S c h i n d e l i n , H. , J i a n g , W. , Inouye, M. and Heinemann, U. (1994) C r y s t a l s t r u c t u r e of CspA, the major c o l d shock p r o t e i n of Escherichia coli. Proc Natl Acad Sci USA, 91, 5119-23. Schmid, S.R. and Lin d e r , P. (1992) D-E-A-D p r o t e i n f a m i l y of p u t a t i v e RNA h e l i c a s e s . Mol Microbiol, 6, 283-91. Schwer, B. and Gross, C.H. (1998) Prp22, a DExH-box RNA h e l i c a s e , plays two d i s t i n c t r o l e s i n yeast pre- mRNA s p l i c i n g . EMBO J, 17 , 2086-94. Sharp, P.A. (1999) RNAi and double-strand RNA. Genes Dev, 13 , 139-41. Soreq, H. and L i t t a u e r , U.Z. (1977) P u r i f i c a t i o n and c h a r a c t e r i z a t i o n of p o l y n u c l e o t i d e phosphorylase from Escherichia coli. Probe f o r the a n a l y s i s of 3' sequences of RNA. J Biol Chem, 252, 6885-8. S p i c k l e r , C. and Mackie, G .A. (2000) A c t i o n of RNase I I and po l y n u c l e o t i d e phosphorylase against RNAs c o n t a i n i n g stem-loops of defined s t r u c t u r e . J Bacteriol, 182, 2422-7. S p i c k l e r , C , Stronge, V. and Mackie, G.A. (2001) P r e f e r e n t i a l cleavage of degradative intermediates of rpsT mRNA by the Escherichia coli RNA degradosome. J Bacteriol, 183, 1106-9. Stu d i e r , F.W., Rosenberg, A.H., Dunn, J . J . and Dubendorff, J.W. (1990) Use of T7 RNA polymerase to d i r e c t expression of cloned genes. Methods Enzymol, 185, 60-89. Symmons, M.F., Jones, G.H. and L u i s i , B.F. (2000) A d u p l i c a t e d f o l d i s the s t r u c t u r a l b a s i s f o r pol y n u c l e o t i d e phosphorylase c a t a l y t i c a c t i v i t y , p r o c e s s i v i t y , and r e g u l a t i o n . S t r u c t u r e Fold Des, 8, 1215-26. Tan, R., Chen, L., Buettner, J.A., Hudson, D. and Fr a n k e l , A.D. (1993) RNA r e c o g n i t i o n by an i s o l a t e d alpha h e l i x . Cell, 73 , 1031-40. Tan, R. and F r a n k e l , A.D. (1995) S t r u c t u r a l v a r i e t y of a r g i n i n e - r i c h RNA-binding pe p t i d e s . Proc Natl Acad Sci USA, 92, 5282-6. Taraseviciene, L., Bjôrk, G.R. and U h l i n , B.E. (1995) Evidence f o r an RNA b i n d i n g r e g i o n i n the Escherichia coli processing endoribonuclease RNase E. J Biol Chem, 270, 26391-8. Tock, M.R., Walsh, A.P., C a r r o l l , G. and McDowall, K.J. (2000) The CafA p r o t e i n r e q u i r e d f o r the 5 1-maturation of 16 S rRNA i s a 5'-end-dependent r i b o n u c l e a s e that has context-dependent broad sequence s p e c i f i c i t y . J Biol Chem, 275, 8726-32. Toone, W.M., Rudd, K.E. and Fr i e s e n , J.D. (1991) deaD, a new Escherichia coli gene encoding a presumed ATP-dependent RNA h e l i c a s e , can suppress a mutation i n rpsB, the gene encoding ribosomal p r o t e i n S2. J Bacteriol, 173 , 3291-302. Va l e n t i n e , R.C., Thang, M.N. and Grunberg-Manago, M. (1969) E l e c t r o n microscopy of Escherichia coli p o l y n u c l e o t i d e phosphorylase molecules and p o l y r i b o n u c l e o t i d e formation. J Mol Biol, 39 , 389-91. Vanzo, N.F., L i , Y.S., Py, B., Blum, E., Higgins, C F . , Raynal, L .C, K r i s c h , H.M. and Carpousis, A.J. (1998) Ribonuclease E organizes the p r o t e i n i n t e r a c t i o n s i n the Escherichia coli RNA degradosome. Genes Dev, 12, 2770-81. Wachi, M., Umitsuki, G. and Nagai, K. (1997) F u n c t i o n a l r e l a t i o n s h i p between Escherichia coli RNase E and the CafA p r o t e i n . Mol Gen Genet, 253, 515-9. Wagner, E.G. and Simons, R.W. (1994) Antisense RNA c o n t r o l i n b a c t e r i a , phages, and plasmids. Annu Rev Microbiol, 48 , 713-42. Walsh, A.P., Tock, M.R., Malien, M.H., Kaberdin, V.R., Gabain Av, A. and McDowall, K.J. (2001) Cleavage of poly(A) t a i l s on the 3 1-end of RNA by ribonuclease E of Escherichia coli. Nucleic Acids Res, 29 , 1864-1871. Wang, W. and Bechhofer, D.H. (1996) P r o p e r t i e s of a B a c i l l u s subtilis p o l y n u c l e o t i d e phosphorylase d e l e t i o n s t r a i n . J" Bacteriol, 178, 2375-82 . Wang, W. and Bechhofer, D.H. (1997) Bacillus subtilis RNase I I I gene: c l o n i n g , f u n c t i o n of the gene i n Escherichia coli, and c o n s t r u c t i o n of Bacillus subtilis s t r a i n s w i t h a l t e r e d rne l o c i . J Bacteriol, 179, 7379-85 . Worbs, M. , Bourenkov, G.P., Bartunik, H.D., Huber, R. and Wahl, M.C (2001) An Extended RNA Binding Surface through Arrayed SI and KH Domains i n T r a n s c r i p t i o n Factor NusA. Mol Cell, 7, 1177-89. X i a , B., Ke, H. and Inouye, M. (2001) Acquirement of c o l d s e n s i t i v i t y by quadruple d e l e t i o n of the cspA f a m i l y and i t s suppression by PNPase SI domain i n Escherichia coli. Mol Microbiol, 40 , 179-88. Xu, F., Lin-Chao, S. and Cohen, S.N. (1993) The Escherichia coli pcnB gene promotes a d e n y l y l a t i o n of antisense RNAI of C o l E l - t y p e plasmids i n v i v o and degradation of RNAI decay intermediates. Proc N a t l Acad Sci U S A, 90, 6756-60. Xu, F. and Cohen, S.N. (1995) RNA degradation i n E s c h e r i c h i a c o l i r egulated by 3' a d e n y l a t i o n and 5' phosphorylation. Nature, 374, 180-3. Yamanaka, K. and Inouye, M. (2001) S e l e c t i v e mRNA degradation by po l y n u c l e o t i d e phosphorylase i n c o l d shock adaptation i n Escherichia coli. J Bacteriol, 183, 2808-16. Zangrossi, S., B r i a n i , F., G h i s o t t i , D., Regonesi, M.E., Tortora, P. and Deho, G. (2000) T r a n s c r i p t i o n a l and p o s t - t r a n s c r i p t i o n a l c o n t r o l of po l y n u c l e o t i d e phosphorylase during c o l d a c c l i m a t i o n i n Escherichia coli. Mol Microbiol, 36 , 1470-80. Zhang, X., Zhu, L. and Deutscher, M.P. (1998) Oli g o r i b o n u c l e a s e i s encoded by a h i g h l y conserved gene i n the 3'-5' exonuclease superfamily. J Bacteriol, 180, 2779-81. Zhou, Z. and Deutscher, M.P. (1997) An e s s e n t i a l f u n c t i o n f o r the phosphate-dependent exoribonucleases RNase PH and pol y n u c l e o t i d e phosphorylase. J Bacteriol, 179, 4391-5. Zilhào, R., Camelo, L. and Arraiano, CM. (1993) DNA sequencing and expression of the gene rnh encoding Escherichia coli ribonuclease I I . Mol Microbiol, 8, 43-51. Zilhâo, R., C a i r r a o , F., Régnier, P. and Arraiano, CM. (1996) PNPase modulates RNase I I expression i n Escherichia coli: i m p l i c a t i o n s f o r mRNA decay and c e l l metabolism. Mol Microbiol, 20, 1033-42. Zuo, Y. and Deutscher, M.P. (2001) Exoribonuclease s u p e r f a m i l i e s : s t r u c t u r a l a n a l y s i s and phylogenetic d i s t r i b u t i o n . Nucleic Acids Res, 29, 1017-26. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0092187/manifest

Comment

Related Items