UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placeentas derived… Minor, Agata 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-0276.pdf [ 7.43MB ]
Metadata
JSON: 831-1.0091980.json
JSON-LD: 831-1.0091980-ld.json
RDF/XML (Pretty): 831-1.0091980-rdf.xml
RDF/JSON: 831-1.0091980-rdf.json
Turtle: 831-1.0091980-turtle.txt
N-Triples: 831-1.0091980-rdf-ntriples.txt
Original Record: 831-1.0091980-source.json
Full Text
831-1.0091980-fulltext.txt
Citation
831-1.0091980.ris

Full Text

INVESTIGATION OF CONFINED PLACENTAL MOSAICISM (CPM) AT MULTIPLE SITES IN POST-DELIVERY PLACENTAS DERIVED THROUGH INTRACYTOPLASMIC SPERM INJECTION (ICSI) by AGATA MINOR B.Sc, Simon Fraser University, 2001 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Reproductive and Developmental Sciences) THE UNIVERSITY OF BRITISH COLUMBIA APRIL 2005 © Agata Minor, 2005 ABSTRACT Background: Many post-intracytoplasmic sperm injection (ICSI) births have been reported. However, concerns have been raised regarding a higher incidence of congenital abnormalities and of low birth weight. The incidence of chromosomal abnormalities in the extra-embryonic tissue lineage, such as the placenta, has not yet been examined. Confined placental mosaicism (CPM) is a chromosomal discrepancy between fetal and placental cells. We set out to investigate whether CPM is an underlying cause of negative pregnancy outcome, including intrauterine growth restriction (IUGR) and congenital abnormalities, and whether it is more prevalent in the post-ICSI population than in the general population. Methods: Fifty one post-delivery placentas were collected from patients who had undergone ICSI. These were divided into two groups depending on pregnancy outcome. Group A (n=41) consisted of placentas from pregnancies with a normal outcome, while group B (n=10) consisted of placentas from pregnancies complicated by IUGR or congenital abnormalities. Three sites of each placenta were sampled for chorionic villi. The villi were digested to obtain trophoblast and chorionic stroma, from which DNA was extracted. The DNA was analyzed by comparative genomic hybridization (CGH) for chromosomal imbalances. Flow cytometry was performed on chorionic stromal cells to determine ploidy. Abnormalities detected by CGH or by flow cytometry were confirmed by fluorescence in situ hybridization (FISH). The prevalence of CPM in the general population was obtained from published studies. Results: Fifty of the fifty one placentas analyzed by CGH had a balanced chromosomal constitution. An abnormality was detected in group B (-10%), in a placenta from a child affected by spina bifida. CGH analysis showed a gain of 7q31>qter and a loss of Xp21>pter in the trophoblast at two sites. Flow cytometry analysis showed tetraploidy in two placentas from group A (-5%). The abnormalities were confirmed by FISH analysis. CPM was not detected in pregnancies affected by IUGR. The incidence of CPM in the total post-ICSI population was -6% (3/51). Conclusion: The incidence of CPM did not differ significantly between the two study groups. We did not find a higher incidence of CPM in the ICSI population compared to the general population. TABLE OF CONTENTS Abstract ii Table of Contents iii List of Tables v List of Figures vi List of Abbreviations vii Acknowledgements ix Rational and Objectives CHAPTER I General Introduction 1 1.1. Physiological aspects of human reproduction 1 1.1.1. Gametogenesis 1 1.1.1.1. Meiosis 1 1.1.1.2. Oogenesis 2 1.1.1.3. Spermatogenesis 2 1.1.2. Fertilization 3 1.1.3. Aneuploidy generation 4 1.2. Formation and normal physiology of the placenta 5 1.2.1. Formation of the placenta 5 1.2.2. Placenta physiology 8 1.2.2.1. Transfer function 8 1.2.2.1.1. Gas exchange 8 1.2.2.1.2. Molecule transport 8 1.2.2.2. Immunologic barrier 9 1.2.2.3. Synthetic function 9 1.3. CPM in placentas and its origin 10 1.3.1. CPM at chorionic villus sampling 10 1.3.1.1. CPM and fetal demise 12 1.3.1.2. CPM and IUGR 14 1.3.1.3. CPM and congenital abnormalities 14 1.3.2. CPM in the post-delivery placenta 15 1.3.3. Mechanisms of CPM 17 1.3.3.1. Mitotic 17 1.3.3.2. Meiotic 17 1.4. Male infertility and the genetic aspect 20 1.4.1. CF mutations 20 1.4.2. Y chromosome-microdeletions 21 1.4.3. Chromosome abnormalities 22 1.4.3.1. Somatic chromosome abnormalities. 22 1.4.3.1.1. Autosomal chromosome 22 abnormalities 1.4.3.1.2. Sex chromosome aneuploidies 23 1.4.3.2. Meiotic errors in male infertility 24 1.4.4. Intracytoplasmic sperm injection 25 1.4.4.1. Safety of the ICSI procedure 26 iii 1.5. ICSI pregnancy outcome 27 1.5.1. Chromosomal abnormalities as a result of ICSI 27 1.5.1.1. Preimplantation genetic diagnosis 27 1.5.1.2. Prenatal diagnosis and at birth 27 1.5.2. Pregnancy loss 29 1.5.3. Congenital and developmental abnormalities 29 1.5.4. Multiple births 31 1.5.5. Preterm birth 31 1.5.6. Low birth weight 32 1.6. Chapter Summary 33 CHAPTER II. CGH analysis of CPM in post-delivery placentas obtained from ICSI 34 2.1. Introduction 34 2.2. Materials and Methods 36 2.2.1. Clinical Information 36 2.2.2. Tissue preparation for CGH 36 2.2.2.1. CGH analysis 37 2.2.3. Tissue preparation for FISH 38 2.2.3.1. FISH 38 2.2.4. Digital Image Analysis 39 2.2.4.1. Interpretation of CGH profiles 39 2.2.5. SRY PCR 40 2.2.6. Flow cytometry 40 2.3. Results 41 2.3.1. CGH results 42 2.3.2. Ploidy determination 46 2.3.3. CPM in post-delivery placentas derived through ICSI 50 2.4. Discussion 50 2.4.1. CGH for the study of CPM 51 2.4.2. CPM detected by CGH 52 2.4.3. CPM detected by flow cytometry 54 2.4.4. Association of IUGR with CPM in ICSI pregnancy 57 2.4.5. Association of maternal age with CPM in ICSI 57 derived pregnancies 2.4.6. Summary 57 CHAPTER III Summary and Conclusion 59 3.1. Summary 59 3.2. Conclusion 60 Bibliography 61 iv L I S T O F T A B L E S Table 1.1 CPM detected at CVS associated with fetal demise. 12 Table 1.2 CPM detected at CVS associated with fetal demise in twins. 13 Table 1.3 CPM detected at CVS associated with IUGR. 13 Table 1.4 CPM detected at CVS associated with congenital abnormalities. 14 Table 1.5 Summary of studies evaluating the incidence of CPM in term placentas in 16 pregnancies affected by IUGR and in the general population. Table 1.6 Chromosomal abnormalities at prenatal diagnosis in ICSI pregnancies. 27 Table 1.7 Chromosomal abnormalities in ICSI babies at birth. 29 Table 2.1 FISH probes used in the study. 39 Table 2.2 Clinical information for the study population. 41 Table 2.3 Clinical information of Group A. 42 Table 2.4 Clinical information of Group B. 42 Table 2.5 Summary of CGH results. 43 Table 2.6 Confirmation of gain7q31-ter and lossXp21-ter by FISH analysis in 43 trophoblast cells. Table 2.7 Confirmation of CGH results by FISH for trisomy 2, 16 and 18. 43 Table 2.8 FISH confirmation of tetraploidy detected by flow cytometry in 48 stroma cells. Table 2.9 FISH analysis for tetraploidy of additional stroma sites. 48 Table 2.10 FISH analysis for tetraploidy in trophoblast cells. 48 Table 2.11 FISH analysis for tetraploidy in lymphocytes. 48 Table 2.12 Summary of ploidy results by flow and FISH for groups A and B. 48 Table 2.13 Summary of incidence of CPM in post-delivery ICSI placentas. 50 Table 2.14 The incidence of CPM in ICSI population compared to the general 58 population. v LIST OF FIGURES Fig. 1.1 Origin of placental tissues. 7 Fig. 1.2 Types of confined placental mosaicism. 11 Fig. 1.3 Generation of uniparental disomy (UPD). 19 Fig. 2.1 CGH profiles for a normal male and a normal female. 44 Fig. 2.2 CGH profiles at placental sites one and three. 45 Fig. 2.3 FISH analysis of control and test trophoblast cells. 45 Fig. 2.4 SRY analysis. 47 Fig. 2.5 Flow cytometry results for detected tetraploidy. 47 Fig. 2.6 Confirmation of tetraploidy in stroma cells by FISH. 49 Fig. 2.7 Evaluation of tetraploidy in trophoblast cells by FISH. 49 vi LIST OF ABBREVIATIONS Abn Abnormal Amnio Amniocentesis AZF Azoospermia factor region CBAVD Congenital bilateral absence of vas deferens CF Cystic fibrosis CFTR Cystic fibrosis transmembrane conductance CPM Confined placental mosaicism CVS Chorionic villus sampling DAPI 4',6'-Diamidino-2-phenylinode Del deletion DHEA Dehydroepinandrosterone DNA Deoxyribonucleic acid EDTA Ethylenediamine tetra-acetic acid FISH Fluorescence in situ hybridization FITC Fluorescein-12-dUTP FSH Follicle stimulating hormone GnRH Gonadotropin-releasing hormone hCG Human chorionic gonadotrophin HLA Human leukocyte antigen hPL Human placental lactogen ICSI Intracytoplasmic sperm injection ID Infant death IUD Intrauterine death IUGR Intrauterine growth restriction IVF In vitro fertilization MI Meiosis I Mil Meiosis II MESA Microsurgical epididymal sperm aspiration mRNA Messenger ribonucleic acid NA Not available ND Neonatal death NDJ Non-disjunction vu NOA Nonobstructive azoospermia LB Live birth LBW Low birth weight LH Luteinizing hormone LTC Long term culture OA Obstructive azoospermia OAT Oligoasthenoteratozoospermia P Short chromosome arm PBS Phosphate buffered saline PD Perinatal death PGH Placental growth hormone POC Product of conception PP Placental protein q Long chromosome arm UPD Uniparental disomy SRY Sex-determining region Y gene STC Short term culture SA Spontaneous abortion SB Stillbirth SD Standard deviation SDS Sodium dodecyl sulphate SSC Standard saline citrate TE Tris-EDTA TESE Testicular sperm extraction TRITC Tetramethylrhodamine-5-dUTP VLBW Very low birth weight Wks weeks A C K N O W L E D G E M E N T S I would like to thank my supervisor, Dr. Sai Ma, and the supervisory committee members, Dr. Peter McComb (Chair), Dr. Dagmar Kalousek and Dr. Basil Ho Yuen, for their guidance and support over the last two years. I would also like to thank Dr. Barbara McGillivray for serving as the external examiner. I would like to thank Dr. Wendy Robinson for letting me use a figure from her web site (Fig. 1.3) and for bringing to my attention some of the studies listed in Table V. I would also like to thank staff and students from Dr. Ma's lab; Chiho Hatakeyama, Haijun Gao, Karynn Harmer, Nicole Peters, Snezana Arsovska and Steven Tang for their support but also for making my last two years more enjoyable. I am also very grateful to Brenda Lomax for her ongoing technical advice and to Angela Wong for her advice of flow cytometry. And finally I would like to thank my family for supporting me and for always encouraging me. The study was supported by The Hospital for Sick Children Foundation (Grant No. XG 02-086, awarded to Dr. Sai Ma). ix RATIONALE AND OBJECTIVES Rationale Over the last ten years intracytoplasmic sperm injection (ICSI) has been successfully used for the treatment of male factor infertility (Palermo et al., 1992; Ma and Ho Yuen 2001). This process involves the micro-injection of a single sperm directly into the oocyte cytoplasm. Because ICSI bypasses the oocyte's natural selection barriers to achieve fertilization, concerns have been brought up regarding the safety of the ICSI technique. The association of ICSI with an increased risk for congenital abnormalities remains argued in the literature (Bonduelle et al., 1999). Higher incidences of low birth weight (Schieve et al., 2002) and of chromosomal abnormalities among babies born through ICSI (Bonduelle et al., 2002) have been well documented. Currently, only non-mosaic chromosomal abnormalities in embryonic tissues have been identified. Mosaicism, limited to extraembryonic tissues, such as the placenta, may exist in ICSI pregnancies. Studies have not yet evaluated this possibility. Chromosomal discrepancies between the fetal cells andplacental cells occur in 1 to 2% of pregnancies studied by chorionic villi sampling (CVS) at 9 to 11 weeks of gestation (Johnson et al., 1990). The chromosomal dichotomy is referred to as confined placental mosaicism (CPM) (Kalousek and Vekemans, 1996). CPM may be confined to trophoblast, stroma or affect both placental cell types, while fetal tissues remain normal (Kalousek and Vekemans, 1996). CPM may be associated with a negative pregnancy outcome, such as intrauterine growth restriction (IUGR) (Wolstenholme, 1996; Lestou and Kalousek, 1998). CPM is either of meiotic or mitotic origin. Meiotic origin of CPM occurs when a trisomic zygote undergoes a selective loss of the extra chromosome from embryonic tissues, while the abnormality remains in the placental tissue lineage. This event is called trisomy rescue (Kalousek et al., 1991; Robinson et al., 1997). Mitotic CPM can results from a non-disjunction event in a diploid embryo (Simoni and Sirchia, 1994; Lestou and Kalousek, 1998). Meiotic CPM is mostly associated with a negative pregnancy outcome, such as IUGR (Wolshenholme, 1996). CPM has been successfully studied by a molecular technique, comparative genomic hybridization (CGH) (Lomax et al., 1998; Amiel et al., 2002; Lestou et al., 1999). CGH allows the simultaneous analysis of the entire genome. It does not detect polyploidy levels; therefore flow cytometry needs to be used in conjunction. Couples undergoing ICSI may be at a higher risk for generating aneuploid conceptions. The increased risk comes from higher aneuploidy levels in sperm from infertile men (Shi and Martin, 2001; Tang et al., 2004), and a higher chance of using an aneuploid oocyte for the procedure, since couples undergoing ICSI are more likely to be affected by advanced maternal age (Van Steirteghem et al., 2002). Advanced maternal age is a known risk factor for aneuploidy (Simoni and Sirchia, 1994; Ma et al., 2001). Consequently, we think these couples may be at a higher risk for having a pregnancy affected by CPM. CPM may result if fertilization leads to an aneuploid zygote and if trisomy rescue occurs (Robinson et al., 1997). In addition, chromosomal mosaicism is often observed in embryos from ICSI procedures (Murine et al, 1994). An additional risk factor is the higher incidence of low birth weight among babies born through ICSI (Schieve et al., 2002). Low birth weight has been shown to be associated with CPM (Wolstenholme, 1996; Lestou and Kalousek, 1998). Perhaps, the higher incidence of low birth weight seen in the ICSI population may be associated with the presence of CPM. We hypothesized that CPM will be more frequently found in placentas derived through ICSI compared to spontaneous pregnancies, reported in published studies. Also, CPM in the ICSI pregnancies will be more prevalent in pregnancies complicated by low birth weight and congenital malformations than in ICSI pregnancies with a normal outcome. We therefore conducted a study on post-delivery placentas derived from ICSI pregnancies. Placentas from pregnancies with a normal pregnancy outcome and those affected by a negative pregnancy outcome were collected. The study of CPM in ICSI pregnancies may have implications for pregnancy outcome and may also clarify the relationship between ICSI and low birth weight. Objectives Short-term Objectives: • To determine the incidence of CPM in placentas derived through ICSI. • To determine whether negative pregnancy outcome is associated with CPM Long-term Objectives: • To further assess safety of ICSI procedure in creating healthy pregnancies and producing healthy offspring. • To produce data that may be useful for obstetric management and for genetic counseling in ICSI pregnancies. xi CHAPTER I. GENERAL INTRODUCTION 1.1. Physiological aspects of human reproduction 1.1.1. Gametogenesis Gametogenesis is the transformation of diploid cells into specialized haploid cells capable of fertilization. Gametogenesis consists of four main steps: the origin and migration of germ cells, population growth by mitotic divisions, creation of haploid gametes by meiosis, and maturation into functional germ cells (Carlson, 2004). Primordial germ cells are progenitors of gametes and first appear 24 days after fertilization in the yolk sac. They then migrate to the genital ridge through the dorsal mesentery (Bellve, 1998; Carlson, 2004). Primordial germ cells then divide to produce germinal stem cells, oogonia in the female and spermatogonia in the male. These cells undergo meiosis to produce the next generation of germ cells (Carlson, 2004). 1.1.1.1. Meiosis Meiosis consists of two stages; meiosis one (MI) and meiosis two (Mil). Before entering MI, chromosome homologues duplicate at interphase to produce two identical sister chromatids, having a doubled DNA content. MI separates the homologues into two daughter cells and Mil further separates the sister chromatids, giving rise to four haploid cells. Both are made up of four distinct stages: prophase, metaphase, anaphase and telophase (Alberts et al., 1983) The prophase of MI is a prolonged phase which is made up of five stages; leptotene, zygotene, pachytene, diplotene and diakenesis. Leptotene begins when chromatin condenses to form chromosomes, each containing two sister chromatids which are tightly bound. At zygotene the two chromosome homologues pair up, or synapse. This process is facilitated by the formation of a synaptonemal complex. The synaptonemal complex keeps homologous chromosomes together so that crossing over can later occur between non-sister chromatids. Once synapsis is completed, the cells enter pachytene where recombination occurs between the two non-sister chromatids (one from each parent), forming a chiasma at each recombination site. Desynapsis begins at the diplotene stage where the synaptonemal complex disappears, allowing for the homologous chromosomes to separate. However, the homologous chromosomes remain joined at the chiasmata. At diakenesis, the chromosomes condense and with the progression into metaphase they align at the equatorial plate. The chromosome homologues separate into two daughter cells at anaphase. Mil is a shorter process which separates the sister chromatids into 1 four haploid cells (Alberts et al., 1983). Certain parts of MI differ between oogenesis and spermatogenesis, and will be mentioned in the sections ahead. 1.1.1.2. Oogenesis Oogenesis starts in the second month of pregnancy in the embryonic ovary as oogonia undergo mitotic division to increase in numbers. However, only a select few will undergo meiosis as most oogonia will die. The oogonia produce primary oocytes, which enter the first meiotic division and become arrested at the diplotene stage of prophase I. During this phase, the primary oocyte becomes surrounded by a zona pellucida and cortical granules. It also synthesizes molecules needed for growth and development. MI will only be completed at ovulation, with the first polar body being extruded (Alberts et al., 1983). At birth the primary oocyte is surrounded by a primordial follicle which grows and envelopes the oocyte. The cells are interconnected by gap junctions that permit transfer of amino acids and glucose to nourish the growing oocyte. The follicle cells also secrete meiosis inhibiting factors, which prevent the oocyte from completing MI. The primary follicle becomes surrounded by membrana granulosa, and a theca folliculi. The theca folliculi differentiates into theca interna and theca externa (Alberts et al., 1983). However, the maturation of the follicle is dependent on gonadotropic hormones, follicle stimulating hormone (FSH) and luteinizing hormone (LH). These two hormones are produced by the pituitary gland upon stimulation with hypothalamic gonadotropin-releasing hormone (GnRH) (Bellve, 1998). At puberty, FSH stimulates granulosa cells to mature, where a secondary follicle develops characterized by a fluid filled cavity. LH stimulates the theca interna to produce androgens, which are transformed into estradiol by the granulosa cells, making the granulosa cells responsive to LH. At menstruation, before ovulation, an LH surge disrupts the gap junctions. This disruption cuts off the supply of the meiosis inhibiting factors, allowing the primary oocyte to complete MI about ten hours before its release. Upon MI completion, the first polar body is extruded, and the oocyte enters MIL Mil will only be completed upon fertilization. The second polar body will then be extruded, completing oocyte maturation (Alberts et al., 1983). 1.1.1.3. Spermatogenesis Once the primordial germ cells reach the genital ridge, the expression of the sex-determining region Y (SRY) gene in Sertoli cells initiates male gonadal differentiation (Bellve, 1998). Sertoli cells play an important role in gonad formation and in spermatogenesis. FSH and 2 testosterone stimulate testicular growth and maintain spermatogenesis by acting on Sertoli cells (Bellve, 1998). Spermatogenesis is controlled by LH and FSH. LH controls the production of testosterone by acting on Leydig cells in the testis. LH is also thought to promote spermatid differentiation into a spermatozoon, called spermiogenesis. The role of FSH with respect to spermatogenesis is not clear (Bellve, 1998). Spermatogenesis is the process by which spermatogonial stem cells in the male divide and differentiate to produce spermatids (Dym, 1994). This process occurs in the seminiferous tubules of the testis. In the Sertoli cells, type A spermatogonial stem cells either die or divide. Up to 60% of them die by apoptosis, whereas the surviving cells divide to either increase their population, present throughout life, or to produce type B spermatogonia. Type B spermatogonia differentiate into meiotic preleptotene primary spermatocytes (Dym, 1994). Meiosis in males begins after puberty, when the primary spermatocytes complete meiosis in the Sertoli cells. At this time, there is an increase of messenger ribonucleic acid (mRNA) production, especially of protamine mRNA which will be later needed at the spermatid stage for chromatin compaction (Carlson, 2004). The primary spermatocyte gives rise to two secondary spermatocytes after the first meiotic division. Upon completion of the second meiotic division each secondary spermatocyte produces two immature haploid spermatids. It is at the spermatid stage when spermiogenesis begins (Carlson, 2004). Spermiogenesis is characterized by a reduction of the spermatid nucleus, condensation of chromatin with protamines, the creation of an enzyme filled acrosome and the growth of a flagellum equipped with mitochondria, giving sperm motility. Throughout mitosis and meiosis, sperm cells are interconnected by cytoplasmic bridges, which provide the necessary environment and nutrition for cell development. It takes approximately 64 days to complete spermatogenesis. After puberty spermatogenesis occurs continuously. A mature spermatozoon contains a head and a tail. The head is made up of a nucleus and an acrosome. The tail contains a neck, a mitochondrial sheath and a flagellum. The spermatozoa are transported from the seminiferous tubules to the epididymis, where the final maturation occurs. The spermatozoa acquire a glycoprotein coat rendering them capable of fertilization. Throughout development sperm cells are mixed with fluids from the seminiferous tubules, the prostate gland and seminal vesicles (Carlson, 2004; Alberts et al., 1983). 1.1.2. Fertilization 3 In response to the secretions found in the female genital tract, the sperm undergoes capacitation, a process which alters the lipid composition of the sperm plasma membrane enabling it to fertilize the oocyte. Fertilization occurs in the fallopian tube one to two days after an ovum is released from the follicle (Norwitz et al., 2001). The capacitated sperm binds to the zona pellucida by a major glycoprotein. The attachment triggers the acrosomal reaction whereby the contents of the acrosome, mainly enzymes, are released and allow the sperm to penetrate the egg. The sperm activates the egg by a process of depolarization, by changing ion concentration within the ooplasm. This process prevents other sperm from entering the oocyte. A second block comes from the cortical reaction, which creates a calcium influx into the ooplasm and a change of surface glycoproteins, preventing other sperm cells from binding the zona pellucida. This reaction also initiates oocyte development. The entrance of the sperm into the oocyte stimulates the oocytes to finish Mil and to form a pronucleus. It also causes the sperm to undergo decondensation of its chromatin. The two pronuclei approach and undergo the first mitotic division (Carlson, 2004; Alberts et al., 1983). 1.1.3. Aneuploidy generation Chromosomal abnormalities occur most often by non-disjunction at MI, from an inappropriate separation of either the homologues or of the chiasmata. Aneuploidy can be created due to the failure of chiasmata to separate between the homologous chromosomes at anaphase I. Aneuploidy can also result from the premature separation of the chiasmata, causing three chromatids to go to one pole and only one to the other. The absence of chiasmata can lead to the segregation of all four chromatids to one pole. Similarly, both homologues can migrate to only one pole (Ffassold and Hunt, 2001). The less common errors at Mil mainly occur because the sister chromatids have failed to separate (Hassold and Hunt, 2001). Non-disjunction may also occur due to a shift in the position where the chiasma normally forms, such as the formation of the chiasma too close to the centromere (Hassold et al., 1995). The most common type of errors of maternal origin are MI errors of the autosomes. These increase with age as the MI arrest of oocytes is prolonged, which is likely to be directly linked with the prevalence of the chromosomal errors (Hassold and Hunt, 2001). It is thought that with age, spindles needed for proper segregation deteriorate (Hawley et al., 1994) and that chiasmata become more susceptible to non-disjunction (Lamb et al., 1996). Non-disjunction of the sex chromosomes is mostly generated through paternal errors (Jacobs et al., 1988). The influence of paternal age on non-disjunction is still debated (Nicolaidis and Petersen, 1998). 4 A feature common to MI errors studied is the reduction of recombination, occurring for autosomes and sex chromosomes in both parents (Hassold and Hunt, 2001). For example, 67% and 85% of 47,XXY individuals resulted from the failure of the X and Y chromosomes to recombine in the pseudoautosomal region located on Xp and Yp (Thomas et al., 2000; Hassold et al., 1991). This occurs because the area on the two chromosomes that is available for recombination is small (Thomas et al., 2000). Reduced recombination as a cause of non-disjunction has been reported primarily for the smaller chromosomes, where paired chromosomes with fewer chiasmata are more likely to separate prematurely (Cupisti et al., 2003). Such events may cause inappropriate chiasmata migration, mentioned earlier. Larger chromosomes are thought to cause aneuploidy through the mechanism of anaphase lag, defined as the loss of a homologue at division (Cupisti et al., 2003). Additional reasons for aneuploidy include the possible presence of gonadal mosaicism for a trisomic cell line (Cupisti et al., 2003) and mitotic post-zygotic non-disjunction errors (Antonarakis et al., 1993). These are not associated with advanced maternal age and do not show preference for parental origin (Antonarakis et al., 1993). 1.2. Formation and normal physiology of the placenta 1.2.1. Formation of the placenta Following fertilization, the embryo is transported to the uterus and undergoes cell division. It reaches the uterine cavity two to three days later as a morula, a cell cluster of 12 to 16 cells (Norwitz et al., 2001). With additional cell divisions the morula reaches the blastocyst stage, a 64 cell cluster (Norwitz et al., 2001; Crane and Cheung 1988). Around three days after having entered the uterus the embryo hatches, being released from the zona pellucida (Norwitz et al., 2001). At this time the first tissue lineages become apparent. The outer layer of the blastocyst, the trophoectoderm, will give rise to the trophoblast, a major component of the placenta. The inner cell mass will mainly give rise to extraembryonic tissues, including the yolk sac, amnion, chorion and the mesoderm core of chorionic villi. Only a few cells within the inner cell mass will give rise to the fetus (Fig. 1.1) (Norwitz et al., 2001; Rossant and Cross, 2001; Crane and Cheung 1988). Around six days after fertilization, implantation occurs. The blastocyst attaches by the embryonic pole, most often to the posterior wall of the uterus (Crane and Cheung 1988; Norwitz et al., 2001). For implantation to occur the uterus must be receptive to the blastocyst, marked by increased vascularization and the development of uterine projections called pinopodes (Norwitz et al., 2001). Around the inner cell mass, the trophoectoderm gives 5 rise to the cytotrophoblast which divide without cytokinesis to form multinucleated syncytiotrophoblast (Tarrade et al., 2001). The syncytiotrophoblast allow the blastocyst to make contact with the uterine wall via microvilli which adhere to the pinopodes (Norwitz et al., 2001; Rossant and Cross, 2001). This process is followed by increased interaction between the blastocyst and the uterus epithelium, consequently leading to the initial invasion of the epithelium by the syncytiotrophoblast (Norwitz et al., 2001). The syncytiotrophoblast thickens and vacuoles develop among the trophoblast to form lacunae (Khong, 2004). These lacunae become the initial blood source for the placenta as maternal blood seeps into them. They later become the intervillous space into which maternal blood is delivered. The implantation process causes stromal endometrium cells to swell and to accumulate glycogen and lipid. These steps begin the decidual reaction where endometrial stroma cells become the decidua, the maternal part of the placenta (von Wolfe et al., 2003). As invasion progresses the blastocyst becomes embedded within uterine stromal cells and after three to four days the implantation site becomes fully covered (Norwitz et al., 2001). Seven days after fertilization, the embryonic disk forms. It contains the epiblast and the hypoblast. The hypoblast will give rise to the yolk sac (Fig. 1.1) (Crane and Cheung, 1988), from which the extra-embryonic mesoderm will develop (Bianchi et al., 1993). The extra-embryonic mesoderm fuses with trophoblast endoderm to give rise to the chorion (Rossant and Cross, 2001), which will surround the embryo, amnion and the umbilical cord (Crane and Cheung, 1988). The extra-embryonic mesoderm also forms the mesodermal core of villi (or stroma) (Crane and Cheung, 1988) and the allantois (Rossant and Cross, 2001). The allantois in humans gives rise to feto-placental blood vessels and generates the fetal component of the placental vascular network (Rossant and Cross, 2001). The epiblast gives rise to the embryo (Crane and Cheung, 1988). An amniotic cavity develops within the epiblast, from which the dorsal cells give rise to the amniotic membrane when they fuse with mesoderm (Bianchi et al., 1993). As the primitive body plan is being established, primary villi are also established. Primary villi begin to form as the cytotrophoblast invades the syncytiotrophoblast (Khong, 2004). The maternal tissues are further invaded, including the endometrium and a part of the myometrium (Norwitz et al., 2001). The cytotrophoblast cells are able to erode their way through the endometrial stroma using secretory proteolytic enzymes, including matrix metalloproteinases (Fisher et al., 1989). The invasive nature of cytotrophoblast cells is only present in the early stages of pregnancy. It is absent in the second or third trimester as the 6 amniotic ectoderm epiblast „ primiiive embryonic Snchyme streak ~ ,—A^A ^ streak endoderm (cultured amnion) inner cell mass amniotic epithelium embryonic ectoderm • . % . . (uncultured amnion) ~ hypobla* — - > - • .SSS" * \ ^ (chorionic stroma) trophoectoderm cytotrophoblast — ^ . syncytiotrophoblast Fig 1.1. Origin of placental tissues. (adapted from Bianchi et al., 1993; Crane and Cheung, 1988; Carlson, 2004; Robinson et al., 2002). expression of metalloproteinases is developmental^  regulated (Fisher et al., 1989). Primary villi become secondary villi once the extra-embryonic mesoderm (or stroma) invades the trophoblast (Crane and Cheung, 1988). The mesenchymal core develops into capillaries, forming the tertiary villi at around the third week of gestation. The capillaries conduct blood flow, important for gas and nutrient exchange (Khong, 2004). The cytotrophoblast also invade the uterine vasculature. An important part of placentation is the development of the vascular system that will support the fetus during the pregnancy. The maternal arteries that supply blood to the placenta are the spiral arteries in the endometrium. Their growth is hormonally regulated beginning with the menstrual cycle (Khong, 2004). In order to increase blood flow during the pregnancy, the arteries are transformed by the invading trophoblast to become of low resistance (Khong, 2004). Once the spiral arteries have been invaded, blood is able to escape and enter the trophoblast lacunae, which have now become the intervillous spaces, bathing the villi to allow exchange reactions to occur (Fisher et al., 1989; Rossant and Cross, 2001). The villus vessels become interconnected, delivering blood to the placenta, and the fetus via the umbilical vessels, two arteries and one vein (Khong, 2004; Rossant and Cross, 2001). The result is the formation of the human hemochorial placenta where villi are directly bathed in maternal blood (Fisher et al., 1989). The basic placental unit is formed by the twentieth gestation week (Rurak, 2001). Chorionic villi consist of an outer layer of syncytiotrophoblast, a cytotrophoblast layer and an 7 inner layer of mesoderm. Three main types of villi are found in the placenta (Cross and Rossant, 2001). The floating villi are found in the intervillous space and are responsible for nutrient and gas exchange. The anchoring villi attach to the decidua. Extravillous villi develop from the anchoring villi as cytotrophoblast cells migrate outside the villi deeper into the decidua (Cross and Rossant, 2001; Rurak, 2001). The extravillous villi also invade the maternal spiral arteries (Cross and Rossant, 2001). 1.2.2. Placenta physiology The placenta has three main functions during the pregnancy; (I) a transfer function, including gas exchange, nutrients supply and waste removal from the fetus; (II) a synthetic function, including hormone and growth factor production necessary for the maintenance and progression of the pregnancy, and (III) an immunosuppressive function, providing immune protection to the fetus from the maternal system (Rossant and Cross, 2001). 1.2.2.1. Transfer function 1.2.2.1.1. Gas exchange The placenta is responsible for gas exchange between the mother and the fetus. Oxygen is brought in via the umbilical arteries while carbon dioxide is transported away by the umbilical vein. The transfer of these gases across the placenta occurs by diffusion. Hemoglobin in the fetus is more concentrated and has a higher intrinsic oxygen affinity. This makes the fetal oxygen saturation higher to make up for the low fetal oxygen pressure (Rurak, 2001). In addition, the fetal cardiac output is higher than in the mother, resulting in higher oxygen delivery rates to fetal tissues (Rurak, 2001). However, the rate of oxygen diffusion is also dependent on environmental, maternal, and placental factors. Environmental factors include atmospheric pressure. Maternal factors include maternal cardiac output, hemoglobin concentration, and degree of vascularization of the uterus. Placental factors include placental blood flow rate, degree of vascularization of placental tissues and the amount of villi available for gas exchange (Owens et al., 1997). Carbon dioxide is produced by fetal tissue at the same rate as oxygen is used up and leaves the fetal circulation as a dissolved gas (Rurak, 2001). 1.2.2.1.2. Molecule transport Glucose and amino acids represent the major source of fetal nutrient supply. Glucose is transported across the placenta from the maternal circulation to the fetus through facilitated diffusion using a glucose specific transporter, Glut 1 (Bell et al., 1990). The glucose is broken 8 down to lactate and fructose by the placenta, with lactate being released to both the maternal and fetal circulations. In contrast, fructose is directed only to the fetus (Rurak, 2001). In addition to being an energy source for the fetus, glucose is also metabolized by the placenta to fulfill its various functions (Battaglia and Meschia, 1988). Amino acids are the primary source of nutrients for the fetus (Battaglia and Meschia, 1988). They are transported across the placenta by active transport by specific transporters (Cetin et al., 1993), and are the major source of nitrogen for the fetus. The placenta does not synthesize essential amino acids, thus transport remains an important source of amino acids throughout the pregnancy (Cetin et al., 1993). Fatty acids can easily cross the placenta and their concentration in the fetal circulation increases in late gestation as the fetus stores more fat (Rurak, 2001). Fatty acids are released from maternal triglycerides by enzymes in the placenta, lipases, and are then transferred to the fetus (Battaglia and Meschia, 1988). Cholesterol is also taken up by the placenta from the maternal circulation by receptor-mediated endocytosis (Rurak, 2001). Free cholesterol is then released to the fetus, some of which is also utilized by the placenta to produce steroid hormones (Rurak, 2001). 1.2.2.2. Immunologic barrier The placenta protects the fetus from the maternal immune system. Trophoblast cells lack major histocompatibility antigens, therefore the maternal immune system does not recognize them as foreign (Rurak, 2001). Instead, trophoblast cells express special human leukocyte antigens (HLA's), HLA-G, which avoid maternal detection (Tarrade et al., 2001). In addition, the placenta produces compounds which have immunosuppressive properties including human chorionic gonadotropin (hCG) (Kayisli et al., 2003), progesterone, prostaglandins and placental proteins (Rurak, 2001). 1.2.2.3. Synthetic function The placenta synthesizes compounds that are necessary for the maintenance and progression of the pregnancy including many hormones such as steroid and protein hormones, and placental proteins. The syncytiotrophoblasts produce hCG (Tarrade et al., 2001), which maintains the corpus luteum of the ovary so that it produces progesterone. Progesterone is needed to maintain the early pregnancy (Cedard, 1997). An hCG increase can be detected soon after conception and rises during the first trimester, at which time the syncytiotrophoblast produce the necessary amount of progesterone, replacing the function of the corpus luteum (Tarrade et al., 2001). Progesterone is synthesized by syncytiotrophoblast from maternal cholesterol (Winkel et al., 1980). Progesterone is not only released into maternal circulation to maintain pregnancy and to keep the uterus receptive, but also into the fetal circulation where it is transformed into fetal adrenal steroids such as Cortisol and dehydroepinandrosterone (DHEA) (Cedard, 1997). The placenta also synthesizes estrogen, but does not have the necessary enzymes to convert progesterone to androgen for estrogen production. Instead, estrogen is synthesized from androgen precursors such as DHEA, received from both the maternal and fetal circulation (Cedard, 1997). Estrogen plays a role in implantation, vasodilation of the spiral arteries and in mammary gland development (Cedard, 1997). In addition, hCG stimulates the differentiation of cytotrophoblast into syncytiotrophoblast (Kliman et al., 1986). Human placental lactogen (hPL) is also synthesized by syncytiotrophoblast (Tarrade et al., 2001). hPL has lactogenic effects (Cedard, 1997) and may also be involved in maternal adaptation to pregnancy (Rurak, 2001). The placental growth hormone (PGH) is also produced by the syncytiotrophoblast and gradually replaces the pituitary growth hormone (Alsat et al., 1998). Its function remains unclear but it is thought to alter maternal metabolism so as to increase nutrient availability to the developing fetus (Lacroix et al., 2002; Alsat et al., 1998). GnRH, produced by trophoblast cells, stimulates hCG and progesterone secretion (Cedard, 1997), thus playing a role in the maintenance of the pregnancy. Leptin, also produced by the syncytiotrophoblast (Tarrade et al., 2001), has been shown to have a regulatory effect on GnRH (Islami et al., 2003), in addition to acting as a growth factor for the fetus (Linnemann et al., 2001). Placental proteins (PP) are only detected in pregnancy and include different types; PP-5, PP-12 and PP-14. They function as anticoagulants, protease inhibitors and are involved in homeostasis (Cedard, 1997). 1.3. CPM in placentas and its origin 1.3.1. CPM at chorionic villus sampling Chorionic villus sampling (CVS) is a prenatal test performed in the first trimester, between 9 and 12 weeks of gestation (Johnson et al., 1990; Roland et al., 1994). The most common indication for CVS is advanced maternal age, defined as maternal age at or over the age 10 of 35 at delivery (in up to 90% of cases, Hogge et al., 1986). CVS is performed under sonographic guidance transcervically (Hogge et al., 1986) or transabdominally (Johnson et al., 1990); a few milligrams of villi are retrieved via a large bore needle or catheter (Hogge et al., 1986). The villi are then cultured for cytogenetic evaluation. Two types of cultures can be established, direct and long-term, stimulating the growth of trophoblast and stroma, respectively, from which chromosomal preparations can be obtained (Crane and Cheung, 1988). The incidence of chromosomal abnormalities at CVS can reach 5.6%, with mosaicism detected in 1 to 2% cases (Hogge et al., 1986; Johnson et al., 1990; Leschot et al., 1996). Mosaicism often involves trisomy and monosomy X (Hogge et al., 1986). Triploidy and tetraploidy also have been reported (Johnson et al., 1986). Mosaicism is defined by the presence of two cell lines with different chromosomal constitutions, such as a diploid cell line in conjunction with a chromosomally abnormal cell line (Hogge et al., 1986). General mosaicism occurs when the abnormal cell line is present in both the placental tissue and the fetus (Leschot et al., 1996). However, mosaicism can be limited to extraembryonic tissues. Confined placental mosaicism (CPM) occurs when a chromosomal abnormality is present in chorionic villi, but absent in fetal cells (Kalousek and Vekemans, 1996). CPM has been classified into three types, chorionic stroma Fig 1.2. Three types of confined placental mosaicism. The outer layer (trophoblast) and the inner layer (chorionic stroma) are represented in the cross section of the chorionic villi. Shaded tissues are chromosomally abnormal. Type I mosaicism affects only trophoblast cells, type II is limited to the stroma, while type III affects both the trophoblast and the stroma. The fetus is normal in all three, (reproduced with permission from the BMJ Publishing Group. Kalousek and Vekemans (1996) J Med Genet, 33, 529-533.) 11 type I, II and III, depending on the specific placental tissues affected. Type I mosaicism affects only trophoblast cells, type II is limited to the stroma while in type III, the abnormal cell line is present in both the trophoblast and the stroma (Fig. 1.2) (Kalousek and Vekemans, 1996; Simoni andSirchia, 1994). The significance of CPM is not always clear. However, CPM can be associated with a negative pregnancy outcome, such as fetal demise, intrauterine growth restriction (IUGR) and congenital fetal abnormalities. Initially diagnosed at CVS, CPM is also documented and studied in placentas after delivery. 1.3.1.1 CPM and fetal demise Pregnancy and neonatal loss associated with CPM includes spontaneous abortion, intrauterine death, neonatal death and stillbirth (Table 1.1). The incidence of spontaneous abortion associated with the presence of CPM has been reported to be between 4.7% and 33% (Qumsiyeh, 1998; Griffin et al., 1997; Johnson et al, 1990; Hogge et al., 1986). CPM has also been associated with stillbirth and neonatal death in 4.8%, and 2.4% of cases, respectively (Johnson et al., 1990). Table 1.1. CPM detected at CVS associated with fetal demise Study Cytogenetic result Follow up Pregnancy trophoblast stroma outcome Johnson et al., 1990 48,XXY,+2 46,XY POC: 46,XY SA 13wks 47,XX,+3 46,XX Skin: 46,XX SA 17wks 46,XY/47,XY,+9 46,XY NA SA 19wks 47,XX,+16 46,XX Skin: 46,XX IUD 38 wks 46,XX 46,XX/47,XX,+9 Villi: 47,XX,+9 SA 13 wks Leschot et al., 1996 92,XXXX(100)** Amnio and blood ND, micrognathia 47,XY,+10 (63) diploid (both) ID 7wks, heart defect Farra et al., 2000 Trisomy 9 (30) Trisomy 13 (10) Trisomy 16(80) All diploid by amnio All SA Griffin et al., 1997* 47,XY,+16(75) 46,XY (100) 46,XX (100) 46,XY (100) 47,XY,+16 (100) 47,XY,+13 (100) 46, XX,i(8q) (63) 47, XY,+15 (100) NA All SA Qumsiyeh, 1998* 45,X (100) 47,XY,+16 (100) Cord blood: diploid (both) All SA Wolstenholme et al., Diploid/+mar/+mar,+mar NA Diploid placenta IUD at 18 wks 1994 Diploid/bal t(4;17) Diploid NA SB at 32 wks Trisomy 16 NA Diploid blood SB at 26 wks Kennerknecht et al., 47,XX,+18 Normal phenotype IUD at 31 wks 1993 POC products of conception, SA spontaneous abortion, IUD intrauterine death, SB stillborn, ND neonatal death, amnio amniocentesis, NA not available, ID infant death * study evaluated CPM in tissues from SA, **percentage of cells affected by abnormality, where available 12 The pregnancy loss rates differ between singleton and twin pregnancies affected by CPM. Fetal loss was observed in 12.8% of singleton pregnancies affected by CPM compared to 66.7% in pregnancies with multiple gestations (Table 1.2, Johnson et al., 1990). This suggests that either twin pregnancies are more sensitive to CPM or that CVS results in a higher incidence of fetal loss in those pregnancies. Table 1.2. CPM detected at CVS associated with fetal demise in twins. Study Twin Cytogenetic result Follow up Pregnancy outcome trophoblast stroma Johnson etal. 1990 1A 46,XY/47,XY,+8 46,XY Amnio: 46,XY IUD IB 46,XY 46,XY Amnio: 46,XY LB 25wks, normal phenotype 2A 46,XY/47,XY,+3 NA NA Neonatal death 2B 46,XY NA NA Neonatal death amnio amniocentesis, LB live birth, IUD intrauterine death Table 1.3. CPM detected at CVS associated with IUGR Study Cytogenetic result Follow up Growth trophoblast stroma percentile Leschot et al., 1996 47,XX,+3 (31)* All diploid by amnio <2.3 47,XX,+8 (100) <2.3 47,XY,+13 (54) <2.3 47,XX,+13 (13) 5-10 47,XX,+16(100) 5-10 47,XX,+22 (95) 2.3-5 45,X (89) <2.3 45,X (100) 5-10 48,XX,+20,+21 (53) 5-10 48,XX,+5,+13 (100) 5-10 46,XX,der(5) (13) 5-10 Kalousek et al., Trisomy 2 (2) Trisomy 2 (7) All diploid by amnio AIKIO"1 1991 Trisomy 7 (53) Trisomy 7 (96) percentile Trisomy 7 (24) Trisomy 7 (73) Trisomy 15 (10) diploid Tetraploidy (33) diploid Schuring-Blom et Trisomy 8 (100) Diploid by amnio 5 al., 1993 Monosomy X (100) 5-10 Farra et al., 2000 Trisomy 2 (40) All diploid by amnio Not defined Trisomy 2 (40) Double triploidyl3, 16 (48) Wolstenholme et Double trisomy 2, 15 (70) Diploid blood A1K3"1 al., 1994 Trisomy 9 (100) Trisomy 9 (100) Diploid placenta percentile Trisomy 16(100) Diploid blood Trisomy 16 (30) Diploid amnio, SB 26wks r Trisomy 16(100) Diploid blood del(13)(ql3)(100) Diploid Diploid blood trisomy 22(100) Diploid amnio Kennerknecht et 47,XY,+18(100) Normal All <10% al., 1993 92,XXXX (78) IUD centile 49,XX,+6, Normal girl, +21,+22 (3.2) Diploid blood IUD intrauterine death, SB stillborn, amnio amniocentesis, •percentage of cells affected by abnormality 13 1.3.1.2. CPM and IUGR Another problem associated with CPM is intrauterine growth restriction (IUGR), defined as birth weight below the 10th percentile for gestational age (Leschot et al, 1996). The incidence of CPM in pregnancies affected by IUGR has been reported to range between 6.5% and 16% (Wolstenholme et al., 1994; Leschot et al., 1996; Kennerknecht et al., 1993). Chromosomal abnormalities commonly observed are listed in Table 1.3 The problem associated with many of these studies is they analyze only one tissue type, thus decreasing their detection rate. 1.3.1.3. CPM and congenital abnormalities Congenital abnormalities have also been documented in pregnancies affected by CPM (Table 1.4), but their incidence has not been estimated. Micrognathia, congenital heart defects, and single umbilical artery have been found in association with tetraploidy, trisomy 10 and mosaicism for partial deletion of the 15q arm, respectively (Leschot et al., 1996). Bilateral microphthalmia, microcephaly and IUGR have been observed in a live child from a pregnancy affected by CPM for trisomy 2 that was detected by CVS (Farra et al., 2000). Wolstenholme et al. (1994) detected multiple abnormalities in association with CPM for chromosome 22 and a deletion of 13q. CPM for chromosome 16 was detected in a child affected by hypospadias and IUGR (Kennerknecht et al, 1993). Table 1.4. Mosaic chromosomal abnormalities detected at CVS associated with congenital abnormalities Study Cytogenetic result Follow up Congenital abnormality Pregnancy outcome trophoblast stroma Leschot et al., 92,XXXX (100)* All diploid Micrognathia ND 1996 47,XY,+10 (40) Congenital heart defect ID, 7wks 46,XY,del(15q) (53) single umbilical artery LB Farra et al., 47,XX,+2 (40) diploid Bilateral microphthalmia, LB 2000 microcephaly, IUGR Wolstenholme del(13)(ql3) (100) Diploid All diploid Abn ears, oedema, IUGR ND et al., 1994 trisomy 22 (100) Truncus arteriosis, interrupted aortic arch, oedema, IUGR PD, 5 days Kennerknecht 47,XY,+16(5) diploid Hypospadia III, IUGR LB and well at 2.5 etal., 1993 years LB live birth, abn abnormal, IUGR intrauterine growth restriction, wks weeks, del deletion, ND neonatal death, ID infant death, PD perinatal death *percentage of cells affected by abnormality It is difficult to determine whether the observed congenital abnormalities are related to the trisomy present in the placenta or whether they are the result of low levels of chromosomal mosaicism in the child. Mosaicism would be difficult to confirm as the chromosomal 14 abnormality may be limited to just a few tissue types. Normally only lymphocyte cultures are performed with just fifteen metaphases being analyzed routinely (example Farra et al., 2000). 1.3.2. CPM in the post-delivery placenta CPM can persist to term if a large proportion of cells was aneuploid at CVS. Kalousek et al. (1991) detected CPM in term placentas in which at least 35% of cells were affected by aneuploidy at CVS. Levels of aneuploidy at CVS may remain similar to term (Kalousek et al., 1991), or may decrease significantly (Schubert et al., 1996; Schuring-Blom et al., 1993). For example, Schwinger et al. (1989) were able to confirm mosaicism in only one of four term placentas, in a case with a high level of tetraploidy at CVS (93%). The degree of aneuploidy in the other three placentas was significantly reduced, possibly indicating a growth disadvantage for the abnormal cells. The prevalence of aneuploidy in term placentas may vary in different areas (Schubert et al., 1996; Kalousek et al., 1991). Spatial variation of aneuploidy has been shown to range from 5% to 60% depending on the site (Schwinger et al., 1989). In addition, there does not appear to be an area of the placenta that is preferentially affected by an abnormality (Schubert et al., 1996). Pregnancy complications were most often observed if CPM persisted to term. The most common complication associated with the presence of CPM at term is IUGR (Kalousek et al., 1991; Schuring-Blom et al., 1993). Studies have evaluated CPM in term placentas without the previous diagnosis of CPM at CVS. The incidence of CPM in the general population as well as in the general population affected by IUGR has been established in the literature by eleven studies (Table 1.5). The summary of studies in Table 1.5 shows that the incidence of IUGR among pregnancies affected by CPM at term is 14.3%, which is higher than the observed background rate of 1.49%. Only two studies did not identify CPM in any of the IUGR pregnancies studied (Kennerknecht et al., 1993; Verp and Unger, 1990). These studies only identified chromosome abnormalities in single cells. Cases from the studies which indicated possible general mosaicism (Stipoljev et al., 2001; Wilkins-Haug et al., 1995), and unconfirmed multiple partial aberrations (Amiel et al., 2002) were excluded from the calculation of incidence. In some of the studies, control groups were matched for gestational age and maternal age. Most of the studies excluded pregnancies where there was another possible explanation for IUGR, such as babies affected by chromosomal abnormalities, maternal smoking, pre-eclampsia and fetal infection. Multiple pregnancies were also excluded. IUGR was either observed at birth or suspected by ultrasound. Either single or multiple placental sites were analyzed, using 15 Table 1.5. Summary of studies evaluating the incidence of CPM in term placentas in pregnancies affected by IUGR and in the general population. IUGR* Background IUGR Sites Method Chromosomal abnormalities Study rate* definition sampled detected (%ile) (n) (% aneuploidy) Krishnomoorthy 4/26 0/30 <10U1 1 Culture villi (2) monsomy21(>15) et al. 1995 (15.4) actual 30cells/ (1) monosomy 3 (>15) 3-6 FISH (1) multiple aneuploidies (>15) Mastuzaki et al, 9/50(18) None <5th 2 Culture (1) trisomy 22 (80) 2004 Villi (1) trisomy 2 (84) 50 cells (1) trisomy 7 (68) others not stated Kalousek and 2/9 0/9 Not 1 Culture (1) trisomy 22 Dill, 1983 (22.2) specified Chorion (1) trisomy X 100 cells Cowles et al., 1/20 (5) 0/20 <10th 2 Culture (1) tetraploidy(100/40) 1996 Villi 20 cells Artan et al., 6/10 (60) 0/115 <10th 10 Culture (1) trisomy 14(17) 1995 chorion, villi (1) trisomy 18(52) 10-15 cells (2) trisomy 21 (17/54) (1) monosomy X (59) (1) tetraploidy (54) Kennerknecht et 0/71 0/24 <10th 2 STC/LTC None al., 1993 Culture <10* 20cells Wilkins-Haug 3/12 (25) 2/24 (8.3) Up to 8 Culture (1) trisomy 17,21 (46) etal., 1995 Chorion, villi (1) tetraploidy (38) >5 cells controls: FISH (1) trisomy 10(53) (1) tetraploidy (14) Stipolijev et al. 2/20 (10) 0/20 <10th 1 Culture (1) trisomy 15(26) 2001 Chorion/ (1) mosaic 16p- (67) Villi, >10cells Amiel et al., 8/16(50) 0/6 Not 3 CGH (1) trisomy 8, disomy Y 2002 specified villi (1) disomy XY (1) monosomy 16, 17 (1) monosomy 17 (3) disomy X (1) disomy Y Barrett et al., None 5/219(2.3) Not 1 CGH (1) trisomy 2 (21) 2001** specified Villi, chorion, (1) trisomy 4 (17) trophoblast (1) trisomy 12(15) (1) trisomy 13(13) <10th (1) trisomy 18(77) Verp and Unger 0/11 0/2 1 Culture None 1990 chorion 10 cells Total 35/245 7/469(1.49) (14.3) STC short term culture, LTC long term culture •incidence expressed as cases with chromosomal abnormalityper total analyzed (%), if more than one tissue was analyzed per site, the incidence of aneuploidy is an average of the abnormalities found in the different tissues. **includes results from study by Lestou et al. (2000) 16 different techniques including molecular analysis. Recently CGH has been introduced for the study of CPM (Amiel et al., 2002; Barrett et al., 2001; Lestou et al., 2000), but is still limited. These studies were the first to show the usefulness of CGH for evaluating CPM. FISH was also used to confirm the abnormalities detected by CGH and to determine the level of mosaicism present. However, it should be pointed out that none of the three studies performed flow cytometry to detect the level of polyploidy, not detectable by CGH, and could have therefore missed polyploidy in the placentas. 1.3.3. Mechanisms of CPM There are two mechanisms that can give rise to CPM, mitotic and meiotic. 1.3.3.1. Mitotic Trisomy can result from mitotic errors in an originally normal zygote. The distribution of the chromosomal abnormality and the tissues it affects are dependent on the timing of the non-disjunction event that gave rise to the abnormality (Wolstenholme, 1996; Simoni and Sirchia, 1994). Mitotic errors may give rise to all three types of mosaicism, although type II and a mosaic type I are expected (Wolstenholme, 1996). The less likely type III could only result from a very early non-disjunction event affecting both tissue lineages, but fewer cells would be affected than in a meiotic type III. Spatial variation is likely to result from a mitotic error because the error may occur later in development and affect a limited number of cells. The distribution of abnormal cells later in development would depend on whether they have a growth advantage or are selected against, with normal cells taking over (Wolstenholme, 1996). Most of non-disjunction errors that occur are of mitotic origin, with the exception of chromosome 16, which has been documented to be of meiotic origin in the majority of CPM cases (Wolstenholme, 1996). 1.3.3.2. Meiotic Meiotic errors originate from paternal or maternal MI or Mil errors in the sperm or oocyte, and result in a trisomic zygote (Simoni and Sirchia, 1994). The chromosomally abnormal zygote may undergo trisomy rescue (Robinson et al., 1997). Because a meiotic error occurs early in development, high levels of aneuploidy are expected, particularly in the trophoblast. The stroma may also be involved. Type I or type III mosaicism may be created, but type II would be unlikely (Wolstenholme, 1996). 17 A complication of trisomy rescue is the generation of uniparental disomy (UPD) in the fetus, where both of the chromosome homologues have originated from one parent (Simoni and Sirchia, 1994). There are two types of UPD, isodisomy and heterodisomy. Heterodisomy results from a non-disjunction error at MI, where the two different chromosome homologues from the same parent are present. Isodisomy results from a non-disjunction event occurring at Mil, where the chromosome homologues from the parent are identical (Fig. 1.3) (Simoni and Sirchia, 1994). Statistically there is a one in three chance for UPD to result from trisomy rescue (Robinson et al., 1997). UPD can be associated with problems when imprinted genes, expressed from only one parent, are present on the chromosome involved. This leads to gene dosage differences, which can have negative outcomes since many imprinted genes are developmentally important (Robinson et al., 1997). The effects may become obvious early in development, such as developmental failure at different stages, or later in development, such as imprinting defects seen only in young children. A recent review of the literature by Kotzot (2002) revealed that UPD was identified in 14.2% (47/ 332) of CPM cases and in 49% of cases of meiotic origin. The presence of UPD was chromosome specific (Kotzot, 2002). UPD was identified in pregnancies affected by high levels of mosaicism in placental tissue, particularly in the trophoblast cells (Robinson et al., 1997; Benn, 1998). A negative pregnancy outcome was often present in such cases (Robinson et al., 1997; Benn, 1998). Some studies have identified multiple congenital abnormalities and IUGR in association with UPD (Wolstenholme et al., 2001; Hansen et al., 1997; Kuchinka et al., 2001; Kalousek et al., 1996), whereas others have not (Kotzot et al., 2000; Gibbons et al., 1997; Shaffer et al., 1996; Roberts et al., 2003). The impact CPM has on a pregnancy depends upon the tissue type affected, the percentage of cells affected and the chromosome involved, as certain chromosomes may carry genes that are responsible for placental function or intrauterine development (Wolstenholme, 1996). It has been shown that amino acid transport in IUGR pregnancies is reduced (Cetin et al., 1993), possibly resulting from a reduced amino acid uptake by the syncytiotrophoblast from growth retarded tissue documented in vitro (Dicke and Henderson, 1988). Reduced blood flow across the placenta has been observed in pregnancies affected by IUGR (Myatt et al., 1993). This suggests that IUGR may result from altered placental function. The effect of CPM remains to be determined. 18 N D J M I N D J M i l / \ r j i sperm ess Trisomic zyMoto trisomy rescue Anaphase lag fetus with U P D placenta (heterodisomy) trisomic zygote fetus with U P D placenta (isodisomy) Figure 1.3. Generation o f uniparental disomy (UPD). U P D can arise through M I and M i l errors with the subsequent loss of the extra chromosome by trisomy rescue in fetal tissues, while a trisomic cell line remains in extraembryonic tissues, (reproduced with permission from Dr. Wendy Robinson from www.medgen.ubc.ca/wrobinson/mosaic/tri_how.htm and www.medgen.ubc.ca/wrobinson/mosaic/upd.htm) 19 CPM may originate from parental meiotic errors, which is when it is most often associated with pregnancy complications. One of the causes of infertility, discussed in the section ahead, is aneuploidy in the gametes of the parents, generating a trisomic zygote upon fertilization. Therefore couples suffering from infertility may be at a higher risk of having a pregnancy affected by CPM, and consequently incur a negative pregnancy outcome. 1.4. Male infertility and the genetic aspect Couples are said to be affected by infertility if they have been unable to conceive after one year of regular unprotected intercourse. Up to 15% of couples will experience infertility (Sertic et al., 2001) with male factor infertility affecting up to 40% of the couples (Bhasin and DeKrester, 1994). Sperm from semen samples are analyzed based on three parameters; concentration, motility and morphology (WHO, 1992). Based upon these male factor infertility is diagnosed as oligozoospermia, when low sperm concentration is present (below <20 million sperm permilliliter); asthenozoospermia, when less than 50% of sperm are motile; and teratozoospermia, when less than 70% of sperm are morphologically normal. The types of infertility are not mutually exclusive and can be present in combinations. When spermatozoa are not present in the sample, azoospermia is diagnosed. Azoospermia is further subdivided into non-obstructive (NOA) or obstructive (OA) (Jeyendran, 2000). Although male factor infertility is multifactorial, specific genetic causes will be discussed, including cystic fibrosis (CF), Y chromosome deletions and chromosomal abnormalities, both somatic and meiotic. Treatment for male factor infertility and its consequences will also be discussed. 1.4.1. CF mutations Ten percent of obstructive azoospermia is congenital and caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (Gazvani and Lewis-Jones, 2004). Mutations in the gene prevent its proper expression and give rise to CF. This is characterized by thickened mucosal secretions and is one of the most common autosomal recessive genetic disorder in the Caucasian population (Jarzabek et al., 2004). The CFTR gene is involved in chloride ion transport across the respiratory epithelium (Knowles et al., 1983) and the sweat ducts (Quinton, 1983). Also, the association of CFTR with infertility suggests that it is involved in the development of the epididymis and the vas deferens, and that it may play a role in spermatogenesis or sperm maturation (van der Ven et al., 1996). To date, 1000 mutations have 20 been identified in the CFTR gene. The most common is the AF508 mutation, a deletion of a phenylalanine (Jarzabek et al., 2004). Ninety seven to ninety nine percent of men affected by CF also have congenital bilateral absence of vas deferens (CBAVD), blocking transport of spermatozoa from the testis or epididymis to the ejaculate, causing obstructive azoospermia (Van der Ven et al.,1996; Blau et al, 2002). However, CBAVD may also be found in males not affected by CF (Blau et al., 2002; Chillon et al., 1995). An estimated 1.5% of infertile men have CBAVD as the underlying cause of infertility (Jequier et al., 1985). Chillon et al. (1995) identified a CFTR mutation in 53% of men with CBAVD. However, the factor that differentiates men with CBAVD affected by CF from men with CBAVD not affected by CF may be the presence of a polymorphism at the 5th thymidine (5T) in the CFTR intron 8-splice acceptor site. This is found in 63% of men with CBAVD not affected by CF and constitutes the second mutation (Chillon et al., 1995). Costes et al. (1995) identified the 5T variant in 86% of azoospermic men with CBAVD. The 5T variant causes a reduction of the normal levels of CFTR mRNA, but is still mild enough not to cause CF (Chu et al, 1993). From these men, sperm can be obtained by microsurgical sperm retrieval with subsequent high pregnancy rates since spermatogenesis is normal in such males (McCallum et al., 2000). However, one of the CF mutations will be passed on to children conceived through ICSI of men with CBAVD (Patrizio et al., 1993). Therefore it is recommended for couples to be screened for CF mutations before undergoing infertility treatments (Gazvani and Lewis-Jones, 2004). 1.4.2. Y chromosome-microdeletions Different Y chromosome microdeletions can result in infertility. Vogt et al. (1996) were the first to map three different azoospermia factor (AZF) regions to the proximal, middle and distal parts of Yql 1, namely AZFa, AZFb and AZFc, respectively. Mutations in these regions are associated with different types of male factor infertility and result in spermatogenesis failure with very few or no sperm in the ejaculate (Vogt et al., 1996). Deletions encompassing the AZFa region are associated with a Sertoli cell only type I phenotype, possibly resulting from a pre-pubertal spermatogenic arrest. Deletions of the AZFb region are associated with premeiotic disruption at the spermatocyte stage, resulting in a maturation arrest at puberty at or during meiosis. Consequently there are no postmeiotic germ cells in their testis, whereas patients with AZFc mutations have a variable phenotype of either severe oligozoospermia or azoospermia 21 (Vogt et al., 1996). Candidate genes have been proposed that encode testis specific RNA binding proteins. The AZFa, AZFb and AZFc regions are thought to encode the DFFRY, RBM1 and, DAZ and SPGY genes, respectively (Brown et al., 1998; Vogt et al., 1996). At least one Y chromosome microdeletion was detected in 3.5% (13/370) of men affected by azoospermia or severe oligospermia, with an otherwise unknown cause of infertility (Vogt et al., 1996). AZFc deletions have been identified in 20% (10/51) azoospermic patients, of whom 50% had spermatozoa in the testis (Silber et al., 1998). Similar results were found by Mulhall et al. (1997). Deletions were further detected in 13% (4/30) of severe oligospermic patients (Silber et al., 1998). Pregnancy was achieved by most men (56%) with identified microdeletions (Silber et al., 1998) with the probability of all sons inheriting the deletion (Page et al., 1999). However, in patients with deletions extending outside the AZFc region, spermatozoa were absent from the testis (Silber et al., 1998) as deletions of the AZFb result in a more severe phenotype in up to 54% of patients (Brandell et al, 1998). Therefore it has been suggested that prior to invasive testicular sperm extraction procedures, patients should be screened for Y chromosome deletions to determine the chances of finding sperm in testicular tissue (Brandell et al., 1998). Challenging the significance of Y chromosome microdeletions are studies which have also identified deletions in patients with known causes of infertility as well as in the fertile male population (Krausz et al., 2001). 1.4.3. Chromosome abnormalities Reduced fertility can result from chromosome abnormalities; either somatic, of the autosomes and sex chromosome; and meiotic, defined as chromosomal abnormalities present in the sperm. 1.4.3.1. Somatic chromosome abnormalities. 1.4.3.1.1. Autosomal chromosome abnormalities The types of autosomal chromosomal abnormalities that are found in infertile men include mainly balanced structural rearrangements; although inversions, supernumerary marker chromosomes and rings have also been observed in infertile men (Gekas et al., 2001). A study of 2,196 men undergoing intracytoplasmic sperm injection (ICSI) revealed a frequency of 2.19% of somatic abnormalities including reciprocal and Robertsonian translocations, and inversions at an incidence of 1.23%, 0.82%, and 0.14%, respectively (Gekas et al., 2001). Translocated chromosomes undergo meiosis poorly because they have to form 22 pachytene quadrivalent structures. They lead to the formation of 50% unbalanced gametes that are lethal to the conceptus, resulting in fertility problems (Rives et al., 2003). All of the abnormalities detected were more frequent than in the general population (reviewed by Simpson and Lamb (2001)). Gekas et al. (2001) also evaluated chromosomal abnormalities among 1012 female partners. They found a similar prevalence of somatic abnormalities (2.07%) as they did for men. An increase of somatic chromosomal abnormalities within female partners of infertile men has also been described by other studies (Schreurs et al., 2000). The studies indicate that chromosomal abnormalities may be passed on to the progeny of couples undergoing ICSI, not only from the father, but also from the mother. However, Gekas et al. (2001) also found that 18.7% of azoospermic men were affected by chromosomal abnormalities compared to 4.55% of men affected by severe oligozoospermia and 2.37% of men affected by moderate or mild oligozoospermia. These results show that men affected by a more severe type of infertility have higher chances of being affected by a somatic chromosomal abnormality. Similar observations were reported by Van Assche et al. (1996), who found chromosomal abnormalities in 13.7% and 4.6% of azoospermic and oligospermic men, respectively. 1.4.3.1.2. Sex chromosome aneuploidies Sex chromosome aneuploidies are present in 3.72% of infertile men, compared to 0.325% in the general population (Gekas et al., 2001). The most common sex chromosome abnormality is 47,XXY (Klinefelter's syndrome) and its mosaic form 46,XY/47,XXY. Klinefelter's syndrome is over represented in the infertile population (Gekas et al., 2001). Men affected by Klinefelter's syndrome may have severe oligospermia or azoospermia. In only rare cases have spermatozoa been found in semen from Klinefelter's patients (Foresta et al., 1998; Guttenbach et al., 1997; Okada et al., 1999). Among azoospermic males, the 47,XXY karyotype and the 47,XXY mosaic account for 12.6% and 10.8% of chromosomal abnormalities, respectively (Van Assche etal., 1996). Fluorescence in situ hybridization (FISH) analysis of sperm from Kleinfelter patients has shown that 47,XXY cells are able to undergo meiosis and produce mature spermatozoa (Foresta et al., 1998; Guttenbach et al., 1997; Okada et al., 1999). This conclusion was based on the observation that the proportion of X- and Y- bearing sperm deviated from the expected 1:1 ratio after 46,XY meiosis. There was an increased frequency of 24,XY sperm without the matching 22,0 complement being present, consistent with a 1:1 ratio in meiotic errors involving 46,XY (Foresta et al., 1998). The studies showed that men with an abnormal constitutional karyotype 23 may still have 76-91% of chromosomally normal sperm, compared to more than 98% in fertile men (Foresta et al., 1998; Guttenbach et al., 1997). Since there is a higher incidence of sex chromosome aneuploidy in sperm cells than is seen in fertile men, it is believed that the aneuploidy may be passed on to children of such infertile men (Foresta et al., 1998; Guttenbach etal., 1997). Another sex chromosomal abnormality seen in infertile men is 47,XYY, present in the infertile male population at an prevalence of 0.32%, compared to 0.09% in the general population (Gekas et al., 2001; Simpson and Lamb, 2001). It is thought that men with chromosomal abnormalities have gonadal mosaicism with a normal cell line (Foresta et al., 1998), and that is primarily this cell line that contributes to the production of sperm, even if the sperm produced are chromosomally abnormal (Moosani et al., 1999). Egozcue et al. (2000) explained that the production of gametes in 47,XXY males is unlikely because of the preferential pairing of homologous chromosomes, that is XX, at meiosis I resulting in an inability for X chromosome inactivation to occur thus leading to meiotic arrest. Similarly in 47,XYY males there is preferential pairing of YY at meiosis, which prevents the normal X-Y pairing and also leads to meiotic arrest (Vogt, 2004), and infertility. 1.4.3.2. Meiotic errors in male infertility Infertility is also observed in men with a normal somatic chromosome complement. A review of the literature has shown that infertile men are at a higher risk of having chromosomally abnormal sperm (Shi and Martin, 2001). A lower sperm concentration has been shown to be associated with a higher incidence of sperm aneuploidy, especially disomy 21 and XY disomy (Shi and Martin, 2001). Bernardini et al. (2000) evaluated aneuploidy in sperm from the ejaculate of oligoasthenoteratozoospermic (OAT) patients, from the epididymis and the testis. They found that OAT patients were at a higher risk of having aneuploid, disomic or nullisomic (11.74%), and diploid sperm (2.8%), compared to controls (1.47% and 0.13%, respectively), with a slight increase of abnormality for the autosomes (1 and 17) and the sex chromosomes (14.54 versus 10.1). Increased rates of aneuploidy in OAT patients were also observed by other studies (Aran et al., 1999). Mateizel et al. (2002) evaluated the incidence of chromosome 18, X and Y aneuploidy in testicular sperm from patients with normal spermatogenesis and from patients with failure of spermatogenesis. They found no difference in the rate of aneuploidy for the autosomes (5.6%) or sex chromosomes (8.2%) between the two groups. The abnormalities were, however, 24 higher in both groups than expected in ejaculated sperm (~2%). They observed that patients with normal spermatogenesis had a higher prevalence of sex chromosome aneuploidy than aneuploidy for chromosomes 18, while in the patients with spermatogenesis failure, this difference did not exist (Mateizel et al., 2002). They did detect a difference in the rate of disomy 18, which was more frequent in the group with spermatogenic failure compared to the group with normal spermatogenesis (1.3% and 0.3%) (Mateizel et al., 2002). Levron et al. (2001). They also identified a high rate of chromosomal abnormalities in sperm from testes, in males with spermatogenesis failure (19.6% versus 8.2% with no failure), compared to sperm from oligospermic males (13%) and to controls (1.6%). The rate of disomy was also higher in each of these patient groups compared to the control, 7.8%, 4.9%, 6.2%, and 1%, respectively, with XY disomy dominating (Levron et al., 2001). The rate of chromosome disomy has been correlated with pregnancy outcome. Recurrent pregnancy loss and implantation failure are more frequent among couples where the male partner has a higher rate of sperm disomy (Rubio et al., 2001). 1.4.4. Intracytoplasmic sperm injection Intracytoplasmic sperm injection (ICSI) has been successfully used to treat male factor infertility since 1992 (Palermo et al., 1992). It consists of a single sperm being injected through the zona pellucida into Mil oocyte ooplasm (Palermo etal., 1992; Ma and Ho Yuen, 2001). ICSI has been proven to be an effective tool for the treatment of male factor infertility, including the treatment of men with poor sperm parameters, those with some sperm present in the ejaculate, and those affected by azoospermia. Until ICSI, men with azoospermia were considered sterile, whereas currently, sperm can be surgically retrieved from either the epididymis or the testes (Schlegel, 2004). Microsurgical epididymal sperm aspiration (MESA) is normally performed to obtain sperm from men affected by OA. This is often caused by CBAVD (Tournaye et al., 1994; Liu et al., 1994) or other type of blockage of the ductal system, either congenital or acquired (Schlegel, 2004). Even if sperm is not present in the epididymis in these patients, testicular sperm extraction (TESE) can be offered instead (Silber et al., 1995). TESE is often performed on patients affected by aberrant spermatogenesis, endocrine defects, Sertoli-cell-only syndrome, maturation arrest, hypogonadism and hypospermatogenesis (Schlegel, 2004; Silber et al., 1995; Silber et al., 1996). In cases of maturation arrest, immature sperm cells, or spermatids, can be used for ICSI (Silber et al., 1996). Sperm is often present in the testes of these patients but not in sufficient quantities to reach the epididymis or to be present in the 25 ejaculate (Silber et al., 1997). These are relatively invasive techniques. Sperm can also be retrieved using a percutaneous needle biopsy from the testes and the epididymis, but not as successfully (Schlegel, 2004). Sperm can also be used fresh or can be frozen for future ICSI procedures (Silber et al., 1995). Acceptable fertilization and pregnancy rates follow ICSI (58%, 46%, Tournaye et al., 1994; Silber et al., 1995, respectively, and 21%, 38% Tournaye et al., 1994; Silber et al., 1995; Ma et al., 2001). 1.4.4.1. Safety of the ICSI procedure As successful as ICSI has been, concerns regarding the safety of ICSI have been raised. ICSI bypasses natural selection and potentially leads to fertilization of an oocyte with a spermatocyte that may not have otherwise been able to achieve fertilization. This is perhaps due to inherent chromosomal or genetic abnormalities (Van Steirteghem et al., 2002). Sperm selected for ICSI based on good morphology and motility may not reflect a normal chromosome complement (Rubio et al., 2001). In addition, imprinting may be incomplete or be aberrant in immature germ cells used for ICSI. The ill effects may not be apparent at birth but manifest as developmental problems later in life (Van Steirteghem et al., 2002). The injection procedure itself may introduce foreign, potentially harmful, compounds into the oocyte. It may damage the cellular structures of the oocyte, especially the mitotic spindle apparatus, and lead to abnormal chromosome segregation (Dumoulin et al., 2001; Hewitson et al., 1999). In view of this, injection is performed away from the polar body where the spindle is expected to be located (Van Der Westerlaken et al., 1999). Even the amount of cytoplasm aspirated from the oocyte during the procedure has been shown to affect the development potential of the embryo. However it was not shown to affect the incidence of aneuploidy in the embryo (Dumoulin et al., 2001). The injection procedure has also been reported to affect the primate oocyte's ability to complete meiosis, resulting in the formation of multiple pronuclei and affecting paternal spindle formation (Hewitson et al., 1996). Questions have been raised as to whether the procedure itself leads to chromosomal abnormalities (Hewitson et al., 1999). But whether the source of the errors is meiotic or mitotic remains controversial. Other factors that place the ICSI population at risk include factors related to the infertility of the parents, more so of the father, the higher maternal age of ICSI couples (33-34 years versus 27-28 years in the general population) and the transmission of abnormalities from parents to offspring (Van Steirteghem et al., 2002). 26 1.5. ICSI pregnancy outcome 1.5.1. Chromosomal abnormalities as a result of ICSI 1.5.1.1. Preimplantation genetic diagnosis A high proportion of human embryos observed in vitro show chromosomal abnormalities. Between 60% and 75% of embryos were found to have an unbalanced chromosomal constitution, including aneuploidy, structural abnormalities and a chaotic chromosomal complement, with mosaicism being the most common observed in between 38% and 58% of embryos analyzed (Trussler et al., 2004; Voullaire et al., 2000; Wells and Delhanty, 2000). Some studies identified mosaicism in all analyzed embryos in at risk patients (Malmgren et al., 2002). It is believed that most of the errors seen are of a mitotic origin since many of the blastomeres examined showed a high level of mosaicism, with different chromosomal abnormalities being present (Trussler et al., 2004). Silber et al. (2003) also identified increased chromosomal mosaicism in embryos from testis extracted sperm (53%) compared to embryos derived from oligospermic men (26.5%). They argued that the higher incidence of mitotic errors may be a result of defects in the sperm centriole, as these lead to defective embryo cleavage because the first embryonic mitotic divisions are controlled by the sperm centrosome, rather than being a result of aneuploidy in sperm from infertile men (Silber et al., 2003). 1.5.1.2. Prenatal diagnosis and at birth Prenatal diagnosis on ICSI fetuses revealed an incidence of chromosomal abnormalities of between 2.7% and 4.2% of pregnancies (Wennerholm et al., 2000a; Bonduelle et al., 2002; Loft et al, 1999; Samli et al., 2003), compared to around 0.8% in the general population (Jacobs et al., 1992; Hook and Cross, 1987) (Table 1.6). Reference N De novo % (n) Inherited Origin Total Sex Autosomal %(n) %(n) Bonduelle et al., 2002 Wennerholm et al., 2000a 1586 149 0.63 (10) 0 0.95(15) 1.34(2) 1.39(22) 1.34(2) 17/22 pat 2/2 pat 2.96 (47) 2.68 (4) Loft etal., 1999 209 0 2.9 (6) 0.5 (1) 1/1 pat 3.35 (7) Samli et al., 2003 142 2.8(4) 2(1.4%) 0 4.2(6) Vernaeve et al., 2003 General population Jacobs etal, 1992 Hook and Cross, 1987 85 56952 61000 0 0.19(108) 2.35 (2) 0.26 (148) 1.18(1) 0.29-0.37 (177-226) 3.53 (3) 0.74-0.82 (total) 27 The abnormalities reported by Wennerholm et al. (2000a), Loft et al. (1999) and Vernaeve et al. (2003) were all autosomal, and mainly de novo, and involved the chromosomes most often seen in human aneuploidy, trisomy: 13, 18 and 21. The increase in de novo chromosomal abnormalities seen by Bonduelle et al. (2002) was only significant for sex chromosome abnormalities, which included 47,XXX, 47,XXY, 47,XYY and mosaic forms involving the X chromosome. Samli et al. (2003) also identified two cases of mosaicism for the sex chromosomes 47,XXY and 45,X. The majority of the abnormalities detected at prenatal diagnosis were inherited from the father (17 of 22, 2 of 2 and lof 1, Bonduelle et al., 2002; Wennerholm et al., 2000a and Loft et al., 1999, respectively). Van Opstal et al. (1997) found 75% (6/8) of abnormalities tested to be of paternal origin, which mostly involved sex chromosomes. The trisomies detected were of maternal origin. It is accepted that the higher incidence of autosomal trisomies is related to maternal age, and is to be expected under the circumstances (Bonduelle et al., 1998; Kolibianakis et al., 2003), since prenatal diagnosis is most often consented to and offered when maternal age is a factor (van der Westerlaken et al., 2001). Of the 3.4% of chromosomal abnormalities detected by Loft et al. (1999), 1.9% were associated with advanced maternal age, observed in 29% of women in the study. Rates of advanced maternal age of up to 49% have been reported among couples undergoing ICSI (SART, 2000). Certain studies have found that the chromosomal abnormalities detected at prenatal diagnoses correlated with sperm parameters, such as sperm concentration (less than one and twenty million spermatozoa per milliliter Samli et al., 2003 and Bonduelle et al., 2002, respectively) and sperm motility (Bonduelle et al., 2002). This suggests that chromosomal abnormalities are passed on from the father's sperm, even if he has a normal karyotype. Direct association of aneuploidy in the sperm with aneuploidy in the fetus has been made. Tang et al. (2004) reported on a 45,X pregnancy from a man with high levels of sex chromosome nullisomy in the sperm (19.6% versus 0.3% in control). A non-disjunction error at MI was the most likely explanation for the aneuploidy in the sperm because a 1:1 proportion of sex chromosome nullisomy and disomy was observed (19.6% and 18.6%). Molecular tests showed that a paternal chromosome X was missing (Tang et al., 2004). Moosani et al. (1999) also reported on the paternal origin of the additional X chromosome in a 47,XXY pregnancy from a man with high levels of XY disomy in his sperm (1.39% vs. 0.16% in control). The patient had a normal karyotype, but it was suggested that gonadal mosaicism could be present. Gonadal 28 mosaicism could lead to abnormal pairing in the aneuploid cell line and result in meiotic arrest or in aneuploid sperm in cells that were able to complete meiosis (Moosani et al., 1999). The rate of chromosomal abnormalities in the ICSI population at birth increases (Table 1.7) from that observed at prenatal diagnosis, with autosomal abnormalities being most common. This data show the importance of early diagnosis. Table 1.7. Chromosomal abnormalities in ICSI babies at birth Reference N De novo % (n) Inherited % (n) Total Sex Autosomal Balanced Unbalanced % (n) Bonduelle et al., 2002 Aboulghar et al., 2001 Lam etal., 2001 338 430 43 0.59(2) 1.48 (5) 1.63 (7) 1.63 (7) 2.33 (1) 1.78(6) 0 0.47 (2) 3.85(13) 3.73 (16) 2.33 (1) 1.5.2. Pregnancy loss The rate of spontaneous abortions (SA) in the ICSI pregnancy has been examined by multiple studies. Varying rates from 14 to 26% have been reported (Vernaeve et al., 2003; Van der Westerlaken et al., 2001; Wennerholm et al., 2000a; Aytoz et al, 1999). Chromosomal abnormalities are present in half of the observed ICSI SAs (Causio et al., 2002), and include mostly trisomies for chromosomes 16, 21, 13, 14,17, 22, triploidy, with the most common abnormality being 45,X (Vernaeve et al., 2003; Causio et al., 2002). Pregnancy loss has been correlated to sperm source by some studies. Wennerholm et al. (2000a) found that pregnancy loss did not correlate with the source of sperm; ejaculate, epididymal or testicular. Aytoz et al. (1998a) found a higher rate of pregnancy loss from severely defective sperm from the ejaculate, but an increase was not observed with epididymal and testicular sperm (Aytoz et al., 1998b). The total prenatal mortality was 1.17% (Wennerholm et al., 2000a) and 1.37% (Loft et al., 1999). Vernaeve et al. (2003) observed a prenatal mortality rate of 6.6% and of 1.5% in the NOA and OA groups, which was not statistically significant. 1.5.3. Congenital and developmental abnormalities Congenital abnormalities are subdivided by some studies into two groups, major and minor. Major abnormalities are defined as those that are of medical importance, affecting a child's development or health, and cosmetic importance (Katalinic et al., 2004; Sutcliffe et al., 2003). Minor abnormalities are defined as those that pose no social or significant health burden to the child (Sutcliffe et al., 2003). 29 The estimated rate of major malformations in the general population is 2 to 3% (Van Steirteghem et al., 2002). Numerous studies have reported on the incidence of congenital abnormalities in the ICSI population with varying results observed, but most of them found only a slight increase. Katalinic et al. (2004) observed major malformations in 8.75% of the ICSI babies compared to 6.09% in controls. After an adjustment for maternal age, malformations in the parents and the history of a previous child affected by abnormalities, the relative risk dropped. However, the ICSI population was still at an increased risk for congenital abnormalities in singletons (Katalinic et al., 2004). Congenital abnormalities are more often observed as a result of multiple births (Wennerholm et al., 2000b). In total, major birth defects were observed in 2.2% live-born ICSI children and the incidence of minor birth defects was 1.2% (Loft et al. 1999). Abnormalities were observed more often with association with fetal death. No single abnormality dominated and only two were seen twice: hydrocephalus and unilateral hydronephrosis (major abnormality). Congenital hip luxation (minor abnormality) was observed in five children (total 730) (Loft et al., 1999). An increase was not reported by Sutcliffe et al. (2003) in a cohort of 264 children born through ICSI in which they observed an incidence of congenital abnormalities of 5.6% and of 5.7% in the control population. The incidence of congenital abnormalities did not differ by sperm source, NOA versus OA (5.6% and 6.9%, respectively) (Vernaeve et al., 2003). The reporting of congenital abnormalities in the ICSI pregnancy varies among studies. Some have proposed that comparisons of such studies are invalid because of the different methodologies used (Van Steirteghem et al., 2002), thus potentially creating bias. However, the one abnormality that is specific to the ICSI children is hypospadias, found at a higher incidence by numerous studies (Wennerholm et al., 2000b; Katalinic et al, 2004; Ericson and Kallen, 2001; Sutcliffe et al., 2003). This may be related to paternal subfertility (Wennerholm et al., 2000b). Development of ICSI babies has also been studied. There have been reports of a higher incidence of imprinting syndromes, such as Angelman syndrome and Beckwith- Wiedemann syndrome, among children born through assisted reproductive technologies, including ICSI (Cox et al., 2002; Maher et al, 2003; DeBaun et al., 2003; Gicquel et al., 2003). These syndromes are overrepresented in the ICSI population, but still remain at a very low incidence. It is speculated that they occur either as a result of culture or the use of immature germ cells for the ICSI procedure (Gicquel et al, 2003; Cox et al., 2002). 30 Mental development scores were evaluated in the UK and Australia of children born through ICSI. At the age of 13 and 17 months they did not differ from the control population. This observation was independent of sperm quality (Sutcliffe et al., 2003). Medical follow up studies of three hundred singletons conceived through ICSI at five years of age did not reveal an increase in developmental or general health problems (Bonduelle et al., 2004). Cognitive development was also normal (Ponjaert-Kristoffersen, et al., 2004) compared to a control population. The most recent study, after a five year follow up, did conclude that ICSI babies were at greater risk of being affected by congenital abnormalities (2.77 times as likely as the general population). Mostly urogenital abnormalities in the boys were present, with hypospadias being most common (Bonduelle et al., 2005). ICSI children also experienced more illness, needed more surgery, therapy and spent more time in the hospital (Bonduelle et al., 2005). 1.5.4. Multiple births Multiple pregnancies often occur in an ICSI pregnancy and are associated with pregnancy complications. The increase in multiple gestations is mostly associated with the practice of replacing two to three embryos into the uterus to achieve better pregnancy rates. The incidence of multiple gestation rates in the ICSI pregnancy is a little over 20%, compared to an incidence of 1% in the general population (Katalinic et al., 2004). Wennerholm et al. (2000a) reported a multiple gestation rate of 21.3% in 982 pregnancies, mostly twins. A similar frequency was reported by Loft et al. (1999) and Katalinic et al. (2004). The sperm source does not seem to affect the rate of multiple births (NOA and OA, 21% and 27%, respectively) (Vernaeve et al., 2003). Aytoz et al. (1998a) reported a higher incidence of multiple births (31.4%) that was higher in pregnancies from cryopreserved embryos than from fresh embryo transfers (Aytoz et al., 1999). Multiple gestations have a higher risk (30%) for very low birth weight and infant mortality (Magee, 2004) and there is also a higher risk for congenital abnormalities and preterm birth (Wennerholm et al., 2000a; 2000b). The complications worsen for high order multiples (Blickstein, 2004). 1.5.5. Preterm birth Preterm delivery, defined as delivery before the 37th week of gestation, is also higher in an ICSI pregnancy than expected, especially in multiple gestations. 31 Wonnerholm et al. (2000a) observed a preterm rate of 19% (188/982). Of these 18% (34/188) occurred before the thirty second week, in 8.4% of singletons and in 42.3% of twins. Preterm rates for twins have been reported of up to 56.7% (Aytoz et al., 1998b). Loft et al. (1999) have reported similar numbers of preterm rates in singletons and twins of 6.1% and 35%, respectively. In addition, 2% of singletons and 10.3% twins were delivered before the 32nd week (Loft et al., 1999). Triplets were delivered between the 32nd and the 37th week of gestation (Loft et al., 1999). These numbers were similar to the general population, with an expected prematurity rate of 5.2% in singletons (Aytoz et al., 1999), 40% for twins and 100% for triplets (Loft et al., 1999). Vernaeve et al. (2003) reported a much higher rate of preterm births of 38% and 26% in the NOA and OA groups, which were not significantly different except for twins which were born prematurely at a rate of 86% and 54% in the two groups, respectively. The mean gestational age was 39.8 weeks for singletons and 36.8 weeks for twins (Loft et al., 1999). Sutcliffe et al. (2003) reported a significant difference in mean gestational age in the ICSI population compared to the control, 38.77 weeks and 39.44, respectively. Vernaeve et al. (2003) found the gestational age of singletons from the NOA group to be significantly lower than in the OA group, 38.3 versus 39.3 weeks. However, the gestational ages between twins and triplets did not differ (Vernaeve et al., 2003). 1.5.6. Low birth weight Low birth weight (LBW), defined at birth weight below 2500g, and very low birth weight (VLBW), the birth weight below 1500g, is observed more often in ICSI pregnancies and is often associated with multiple gestation. Wonnerholm et al. (2000a) observed LBW and VLBW in 18.9% and 3.9% of ICSI pregnancies, respectively. This was seen in 9% of singletons and 48% of twins. A similar incidence was observed by Aytoz et al. (1998a), compared to 4.8% in singletons in the general population. Loft et al. (1999) reported 18.2% and 2.88% of children were affected by low and very low birth weight, respectively. In addition 38% of twins and 100% of triplets were of low birth weight compared to 6.7% of singletons. Interestingly, higher birth weight were seen for singletons resulting from cryopreserved embryos than from fresh embryos (Wennerholm et al., 2000a), but not by Aytoz et al. (1999). In general, it has been accepted that ICSI babies are at a higher risk of being of low birth weight compared to the general population (Sutcliffe et al., 2003). This does not correlate with 32 sperm source (NOA and OA, at 34% and 31%, respectively; Vernaeve et al., 2003) and is most likely the result of multiple birth rates often seen in the ICSI pregnancy. 1.6. Chapter Summary Fetal development is a complex sequence of events, with the placenta playing the central o role in pregnancy maintenance and fetal nutrition (Rossant and Cross, 2001). Fetal outcome is initially affected by chromosome abnormalities, not only in the embryonic tissues but also confined to extraembryonic tissues, such as the placenta. Adverse outcomes include fetal demise (Johnson et al., 1990; Wolstenholme et al., 1994), congenital abnormalities (Leschot et al., 1996; Farra et al., 2000) and intrauterine growth restriction (IUGR) (Artan et al., 1995; Matstuzaki et al., 2004). Confined placental mosaicism (CPM) occurs when a trisomic cell line is present in the placenta, but absent from fetal tissues (Kalousek et al., 1992). Persistence of CPM to term and its presence in a large proportion of trophoblast cells are mostly associated with a negative pregnancy outcome, usually the result of a meiotic error (Robinson et al., 1997; Kalousek et al., 1991). Mitotic post-zygotic errors may also give rise to CPM. Even though they are more common, they are less likely to affect the outcome of a pregnancy (Wolstenholme, 1996). While there are numerous reasons for infertility, infertile men may be affected due to cystic fibrosis mutation (Costes et al., 1995), Y chromosome mutations (Vogt et al., 1996) and chromosomal abnormalities, either somatic (Gekas et al., 2001) or in the sperm (Shi and Martin, 2001). Couples affected by infertility are at a higher risk of being affected by meiotic errors, because of the increased sperm aneuploidy in infertile men and women partners being more likely to be affected by advanced maternal age (Van Steirteghem et al., 2001). Both these factors may lead to the formation of a trisomic zygote. In addition, couples undergoing fertility treatments such as, intracytoplasmic sperm injection (ICSI) may be at a higher risk for mitotic chromosomal abnormalities in the embryo due to the technique itself (Dumoulin et al., 2001; Hewitson et al., 1999). Perhaps, such events result in is an increase in chromosomal abnormalities in embryos (Trussler et al., 2004; Silber et al., 2003), at prenatal diagnosis (Wennerholm et al., 2000a; Loft et al., 1999), and in children born through ICSI (Bonduelle et al., 2002; Lam et al., 2001). However, extraembryonic tissues have not yet been examined. The consequences of chromosomal abnormalities in extraembryonic tissues are not known in the ICSI pregnancy. The ICSI pregnancy is more likely to be affected by negative pregnancy outcomes, similar to those observed as a consequence of CPM. 33 CHAPTER II. CGH ANALYSIS OF CPM IN POST-DELIVERY PLACENTAS OBTAINED FROM ICSI. 2.1. Introduction Intracytoplasmic sperm injection (ICSI) has been successfully used for the treatment of male factor infertility through the last decade (Palermo et al., 1992, Ma and Yuen, 2001). A single sperm is retrieved from men with poor sperm parameters or spermatogenesis failure and directly injected into an oocyte to achieve fertilization, bypassing the oocyte's natural selection barriers (Simpson and Lamb, 2001). Because of the nature of the ICSI technique (Ma et al., 2001), concerns regarding its safety have been raised. Although the association of ICSI with a higher incidence of congenital abnormalities has been controversial, studies are beginning to show that ICSI babies may be at a higher risk for being affected by urogenital abnormalities, especially hypospadias (Bonduelle et al., 2005; Sutcliffe et al., 2003). ICSI babies have also been shown to be at risk of being affected by prematurity and low birth weight (Wonnerholm et al. 2000a; Loft et al. 1999). These conditions are often associated with multiple gestations, but also found more often than expected in singleton ICSI babies (Schieve et al., 2002). In addition, prenatal and post-natal cytogenetic analysis of ICSI babies has shown this population to be at a higher risk for de-novo chromosomal abnormalities (Bonduelle et al., 2002; Wennerholm et al., 2000a; Loft et al., 1999; Samli et al., 2003; Vernaeve et al., 2003; Aboulghar et al., 2001). At the present time, only non-mosaic chromosomal abnormalities have been found. Mosaicism may be confined to select tissues, such as the placenta. There is no data available pertaining to this. Confined placental mosaicism (CPM) is a chromosomal discrepancy between the fetal cells and placental cells (Kalousek and Vekemans, 1996). The chromosomal abnormality can be confined to the trophoblast, stroma or both cell types, while the fetal cells remain normal (Kalousek and Vekemans, 1996). CPM has been associated with pregnancy complications including congenital abnormalities (Farra et al., 2000; Leschot et al., 1996) and intrauterine growth restriction (IUGR) (Kalousek et al., 1991; Leschot et al., 1996). CPM has been found to be about ten times as prevalent in pregnancies affected by IUGR than in uncomplicated pregnancies (Table 1.5). The presence of CPM is most often associated with a negative pregnancy outcome when it is of meiotic origin affecting a large proportion of cells (Wolshenholme, 1996) and when present in the placenta examined after delivery (Kalousek et al., 1991; Schuring-Blom et al., 1993). 34 CPM has been extensively studied in post-delivery placentas by cytogenetic analysis that requires tissue culture (Artan et al., 1995; Cowles et al., 1996; Kalousek and Dill, 1983; Stipolijev et al. 2001). However, a molecular technique, comparative genomic hybridization (CGH), has been recently applied to the study of CPM in term placental tissue (Barrett et al., 2001; Lestou et al., 2000; Amiel et al., 2002). CGH offers the advantage of eliminating tissue culture artifacts and culture failure (Lomax et al., 1998), factors that have previously hindered the study of CPM (Griffin et al., 1997). CGH is a molecular technique that allows the simultaneous analysis of the entire genome (Kallioniemi et al., 1992). However, it does not detect polyploidy levels or detect low levels of mosaicism reliably (Barrett et al., 2001). CGH can only detect unbalanced chromosomal rearrangements (Lomax et al., 1998). Therefore, fluorescence in situ hybridization (FISH) and flow cytometry are needed to confirm abnormalities detected by CGH and to determine the ploidy of a sample, respectively. CGH involves the co-hybridization of differentially labeled test (green) and reference (red) DNA to normal metaphase chromosome spreads (Kallioniemi et al., 1992). Differences in chromosome copy numbers between test and reference DNA are detected by CGH software by generation of average fluorescence ratio profiles. Any observed shifts to the left or right signify loss and gain of a chromosome homologue, respectively. The frequency of CPM in pregnancies derived through ICSI may be higher than by natural conception because of an increased chance of generating a chromosomally abnormal zygote as a result of ICSI. The increased risk may be associated with the higher incidence of chromosomal aneuploidy in the sperm from men undergoing ICSI treatment (Shi and Martin, 2001). There is the added risk of creating aneuploidy in the embryo by mechanical disruption of the spindles (Dumoulin et al., 2001; Hewitson et al.,1999). Couples undergoing ICSI are also at a higher risk of being affected by advanced maternal age (Van Steirteghem et al., 2002), associated with an increased incidence of non-disjunction and therefore with the production of chromosomally abnormal oocytes (Simoni and Sirchia, 1994; Ma et al., 2001). CPM may result if the aneuploid zygote undergoes trisomy rescue (Robinson et al., 1997). In addition, a high proportion of embryos show chromosomal mosaicism (Trussler et al., 2004; Voullaire et al., 2000; Wells and Delhanty, 2000). As already mentioned, babies conceived through ICSI are at higher risk of being affected by low birth weight (Schieve et al., 2002), a factor correlated with the incidence of CPM (Wolstenholme, 1996; Kalousek et al., 1991; Leschot et al., 1996). The possible existence of CPM in ICSI pregnancies may be associated with the prevalence of low birth weight in newborns. 35 In this study we set out to investigate the incidence of CPM in post-delivery placentas derived from ICSI. Our hypothesis is that CPM will be present at a higher frequency in placentas derived through ICSI compared to spontaneous pregnancies. Also, CPM will be more prevalent in pregnancies complicated by IUGR, observed at term, and congenital malformations than in ICSI pregnancies with a normal outcome. Fifty one post-delivery placentas were studied by CGH at three placental sites. Both the trophoblast and stroma were analyzed, and flow cytometry was carried out on stromal cells to determine the ploidy level. The prevalence of CPM in spontaneous pregnancies was obtained from published studies. 2.2. Materials and Methods 2.2.1. Clinical Information University of British Columbia Ethics Committee approval was obtained before initiating the study. Post-delivery placentas from ICSI pregnancies were obtained with informed consent from patients who have undergone the ICSI procedure at the University of British Columbia in vitro fertilization (IVF) Program from 1997 to 2004. Staff delivering the babies provided information on pregnancy outcome, including congenital malformations, gestational age, birth weight, and maternal age at delivery. Placentas and cord blood samples from ICSI pregnancies were collected postnatally from consecutive pregnancies where the parents had consented. Cord blood was cultured for chromosome analysis using standard culture techniques, Twenty five G-banded metaphases were analyzed by a technologist in Dr. Ma's lab to determine the fetal chromosomal constitution. The post-delivery placentas were divided into two groups, A and B. Group A included placentas from pregnancies with a normal outcome. Group B included placentas from pregnancies affected by a negative pregnancy outcome either the occurrence of IUGR, defined as birth weight below the 10th percentile (adjusted for gestational age and gender based on Hoffman et al., 1974, for singletons, Min et al., 2000 and 2004 for twins and triplets, respectively) or diagnosed at ultrasound examination, or the presence of congenital malformations. Cases with fetal chromosomal abnormalities were excluded from the study, because, by definition, abnormalities in CPM are confined to placental cell lineages. 2.2.2. Tissue preparation for CGH Placentas were stored at 4°C and analyzed within 24 to 48 hours of delivery. Placentas were measured, weighed and examined for gross morphological abnormalities. The placentas were then 'mapped' according to the methods described by Henderson et al (1996), where the 36 sampled sites were marked on a drawing representing the placenta. Under an inverted light microscope, placentas were sampled for amnion and chorionic villi at ten sites, three of which were analyzed for the present study. The chorionic villi were cleaned of decidua to avoid maternal contamination. The tissues were either frozen at -20°C or processed further. A pea size amount of chorionic villi were washed of blood with minimum essential medium supplemented with 4% penicillin streptomycin. Villi were enzymatically digested into cytotrophoblast and chorionic stroma using collagenase 1A (lmg/ml) (Sigma, Oakville, Canada) (Henderson et al., 1996). Trophoblast, chorionic stroma and amnion were digested (3ml lysis buffer, 300ul 10% sodium dodecyl sulphate (SDS), 150ul lmg/ml proteinase K (Sigma, Oakville, Canada)) in a 54°C water bath (VWR). DNA was extracted using standard salt extraction protocols and resuspended in low tris-ethylenediamine tetra-acetic acid (EDTA) (TE) buffer of pH 8.0. Deoxyribonucleic acid (DNA) concentration was estimated using a spectrophotometer (Eppendorf). 2.2.2.1. CGH analysis With each CGH batch a control sample with a known abnormality was included to assess the quality of the CGH batch. The CGH protocol was modified from Lestou et al. (1999). Test DNA (2ug) was labeled with fluorescein-12-dUTP (FITC) (Boehringer Mannheim, Laval, Quebec) by using nick translation enzyme mix (Boehringer Mannheim, Laval, Quebec), with the addition of DNA polymerase I (New England Biolabs, Beverly, MA) to achieve DNA fragments between 3000 and 500 base pairs in size. Reference DNA was extracted from confirmed diploid female placental tissue, and labeled with tetramethyhhodamine-5-dUTP (TRITC) (Boehringer Mannheim, Laval, Quebec). DNA fragment size was assessed by running a 2ul sample aliquot and a Hind III Lambda (Sigma, St. Louis, MO) marker on a 1.2% agarose gel containing ethidium bromide and visualizing the fragments on a UV transilluminator (UVP, BioDock-It system). Labeled test and reference DNA (lug each) were precipitated in ethanol with 20u,g of human Cot-1 DNA (Sigma, St. Louis, MO) in presence of LiCl. The probe pellets were reconstituted in 14(4.1 of hybridization buffer (50% formamide/10% dextran sulfate/2 x saline sodium citrate (SSC)), denatured at 78°C for 5 min and pre-annealed. Target slide metaphases were prepared from normal male chromosomes of 450-500 band resolution and a high mitotic index, with taking care to produce good spreads. Slides were pretreated with RNAse (Sigma, St. Louis, MO) (0.125mg/ml in SSC; 1 hour at 37°C), fixed in 10% buffered formalin (10 minutes), denatured in 70% fromamide/2xSSC for 5 minutes at 78°C and dehydrated in ethanol series 37 (70%, 85%, 100%, two minutes each). The probe mixture was applied to the slide, sealed with rubber cement and co-hybridized for 3 days at 37°C in a humid chamber. Post-hybridization wash was done in 50% formamide/2xSSC for 10 minutes at 48°C, followed by a 2xSSC wash for 5 minutes at 48°C and a PBS wash at room temperature. The slides were counterstained in 4',6-Diamidino-2-phenylindole (DAPI) (0.2ug/ml) (Sigma, St. Louis, MO) and mounted with Vectashieid (Vector Laboratories, Burlingame, CA). 2.2.3. Tissue preparation for FISH FISH was used to confirm abnormalities observed by CGH and by flow cytometry. Tissue for FISH was obtained from the stored villi sample. Trophoblast cells were obtained from chorionic villi in the same way as for CGH (above). The trophoblast cells were incubated in pre-warmed 1% sodium citrate at 37°C for 20 minutes, followed by fixation in 3:1 methanol acetic acid fix. The cells were then dropped onto slides and pretreated with 0.03% trypsin (Difco, Oakville, Ontario) in PBS for 10 seconds, and fixed in 10% buffered formalin for 10 minutes (Henderson et al., 1996). Chorionic stroma was obtained from chorionic villi in the same way as for CGH (above). To obtain a single cell suspension, the stroma cells were washed in 0.9% NaCl, pH 1.5, and treated with 0.5% pepsin (Sigma, St. Louis, MO) for 10 to 15 minutes in a 37°C water bath. The cell suspension was washed in phosphate buffered saline (PBS) and dropped onto silanized slides, then fixed in 10% buffered formalin for 2 hours and 15 minutes (Henderson et al., 1996). FISH was carried out on harvested lymphocytes. Methanol acetic acid fixed cells were dropped onto slides, allowed to air dry and run through an ethanol series (70%, 85%, 100%, two minutes each). The slides were incubated in 2XSSC for 15 minutes at 37°C. Before FISH, slides were run through an ethanol series (70%, 85%, 100%, two minutes each). 2.2.3.1. FISH FISH probes used over the course of the experiment are listed in Table 2.1, all are from Vysis (Downers Grove, Illinois). A control slide was also prepared for each probe from normal placental tissue or lymphocyte culture. FISH was performed as recommended for the commercially available probes (Vysis, Downers Grove, Illinois). Slides were denatured in 70% formamide/2XSSC (pH 7.0) for 5 minutes at 78°C and dehydrated in an ice cold ethanol series (70%, 85%, 100%, two minutes each). The probe mixture (3.5ui centromere enumeration probe 38 (CEP) hybridization buffer (Vysis, Downers Grove, Illinois), 0.5ul probe, lu.1 water) was denatured for 5 minutes at 73 °C, and applied to the slide, sealed with rubber cement under a 1 lX22mm cover slip and hybridized overnight in a humid chamber at 37°C. Post hybridization wash was done in 0.4XSSC/0.3% nonidet P-40 (NP-40) (Sigma, St. Louis, MO) for 2 minutes at 73°C followed by 30 seconds in 2XSSC/0.1%NP-40. The slides were allowed to air dry, were counterstained in DAPI (0.2ug/ml) (Sigma, St. Louis, MO) and mounted with Vectashield (Vector Laboratories, Burlingame, CA). Five hundred nuclei were scored for detection of mosaicism and two hundred nuclei were scored for ploidy determination. To determine the statistical significance between the control and test FISH analysis, the Z-test statistic was applied, two-tailed at 95% confidence, or the Chi square test was applied, as indicated in each table. Table 2.1. FISH probes used in the study. Probe Sequence type Locus CEP 2 (D2Z1) SpectrumOrange Alpha Satellite DNA 2pl 1.1-ql 1.1 LSI Elastin Gene SpectrumOrange/ Locus specific 7ql 1.23/7q31 D7S486, D7S522 Spectrum Green CEP 16 (D16Z3) SpectrumOrange Satellite II DNA 16ql 1.2 CEP 18 (D18Z1) SpectrumAqua Alpha Satellite DNA 18pl 1.1-ql 1.1 CEPX(DXZl)SpectrumGreen/ Alpha Satellite DNA X p l l . l - q l l . l / Y p l l . l - q l l . l Y (DYZ3) Alpha Satellite DNA SpectrumOrange LSI STS SpectrumOrange/CEPX SpectrumGreen Locus specific Xp22.3/Xpll.l-qll.l CEP chromosome enumeration probe, LSI locus specific identification 2.2.4. Digital Image Analysis CGH analysis was performed using a Zeiss Axioplan epifluorescent microscope equipped with appropriate filters and a charge-coupled device (CCD) camera, connected to Cytovision image analysis software (Applied Imaging International, Santa Clara, CA). Between 6 and 12 metaphases were captured for each analysis, under DAPI, FITC and TexasRed filters. The captured metaphases were karyotyped using the inverted DAPI image and a fluorescent ratio profile was generated. A sample was considered abnormal if shifts in the average ratio profile were observed to be different from the normal 1:1 profile: shifts to the left or right indicating a loss or gain of a chromosome, respectively. Analysis of FISH results was conducted using the same equipment. 2.2.4.1. Interpretation of CGH profiles 39 CGH hybridization was considered good if metaphases under the microscope showed bright green and red signals and if the known abnormality included in each run could be identified correctly. Chromosome regions rich in heterochromatin, such as centromeric regions of chromosomes 1,9,16, the q arm of the Y chromosome and the satellite regions of the acrocentric chromosomes were excluded from analysis because these produce variable CGH profiles and are suppressed by the Cot-1 DNA (Lestou et al., 1999). Labeling artifacts can cause false positive CGH ratio shifts for GC-rich regions, including lp32-ter, and chromosomes 16,19 and 22. This is minimized through the use of direct labeling (Isola et al., 1994) as in this experiment. To minimize the follow up of such false positive results, FISH was only performed when profile shifts for these regions occurred independently for each region, otherwise shifts for these chromosomes were considered as CGH specific. 2.2.5. SRY PCR The q arm of the Y chromosome contains heterochromatin. For this reason, the CGH profiles may be variable for the Y chromosome and may be difficult to interpret. The presence or absence of the Y chromosome is not always clear. In such cases SRY PCR was carried out to confirm the presence or absence of the Y chromosome. Sex determination was performed using primers specific to the SRY region of the Y chromosome (forward: 5' GGC AACGTCCAGG AT AGAGTGA3', reverse: 5'CGGCAGCATCTTCGCCTTCCGA3') in a 25ul reaction (0.24uM forward and reverse primer, IX Taq polymerase buffer, 0.25mM each dNTP, 5mM MgCL., 0.125U Taq polymerase, 200ng DNA). The product was amplified using an Eppendorf Mastercyler with the following PCR program: initial denaturation at 94°C for 4 minutes, 94°C for 1 minute, 60°C for 2 minutes, 72°C 3 minutes, repeated for 30 cycles, and a final extension at 72°C for 5 minutes and a soak at 4°C. The PCR products and a low kb ladder were run on a 2% agarose gel stained with ethiduim bromide, with the expected product size of 258 base pairs. A female and a male control, and a blank were included with each PCR set up. 2.2.6. Flow cytometry One of the drawbacks of CGH analysis is the inability to identify polyploidy. Accordingly, the samples were analyzed by flow cytometry to determine the ploidy level. Flow cytometry was carried out on thawed chorionic stroma cells. A single cell suspension of stroma cells was prepared the same way as for FISH, and fixed in 70% cold ethanol overnight at -20°C. 40 To obtain a homogenous suspension of single cells, each sample was passed through a 40pm cell sieve (Becton Dickinson, Franklin Lakes, NJ). Five hundred milliliter aliquots of each sample were prepared at a concentration of 1 million cells per millileter, counted using a haemocytometer. The cells were stained with propidium iodide (Sigma, St. Louis, MO) (40ug/ml), treated with RNase (Sigma, St. Louis, MO) (20ug/ml) (Cancer Research UK, http://science.cancerresearch.uk.org) before analysis by FACScan (Becton Dickinson, Franklin Lakes, NJ) flow cytometer at the UBC BioMedical facility. Twenty thousand cells were analyzed for signal intensity. The instrument was calibrated before each run using a diploid control sample. The data were analyzed using computer software: FlowJo (FlowJo, Ashland, OR). Diploidy was confirmed if the diploid peak did not shift by more than 10% compared to the control and if the number of cells in the G2 peak was lower or equal to 15% (Rua et al., 1995). Flow cytometry was not performed on samples for which ploidy was known through FISH analysis. 2.3. Results In total, 51placentas were collected post-delivery. The study population is presented in Table 2.2, which consisted of 25 singletons, 10 sets of twins and 2 sets of triplets. The average maternal age at delivery, average gestational age and the average birth weight are also listed. Table 2.2. Clinical information for the study population Study population Infants 00 % maternal age (years) mean ± SD gestational age (weeks) mean ± SD birth weight (g) mean ± SD singletons 25 49.0 34.4±4.4 39.01±1.48** 3250.24±709.78** twins 20 39.2 33.7±3.95 35.9±1.79** 2360.6±466.27** triplets 6 11.8 38±1.41 32±1.41** 1715±239.27** Population 51 100 34.41±4.21* 37.79±2.49 2740.86±796.56 •significantly different from general population (27±4.7) (t-test, p<0.5, Katalinic et al., 2004) **not significantly different from general population (t-test, p>0.5, Katalinic et al., 2004) Of the 51 placentas, 41 were associated with a normal pregnancy outcome and formed group A (Table 2.3). Ten were associated with a negative pregnancy outcome and formed group B (Table 2.4). Of the 10 placentas in group B, two were associated with a congenital abnormality in the baby, spina bifida and congenital bilateral hip dysplasia. Nine were affected by IUGR, including the baby affected by congenital bilateral hip dysplasia. Among the IUGR cases, six were diagnosed at birth. Three were diagnosed prenatally at ultrasound examination. 41 The average maternal age and the average gestational age did not differ significantly between the two groups. Table 2.3. Clinical information of Group A. Pregnancy n outcome gestation maternal age (years) mean ± SD gestational age (weeks) mean ± SD sirth weight (g) mean ± SD Normal 41 (18) Singletons (17) Twins (6) Triplets 34.33±4.28 37.5±2.55 2814.17±849.71 Table 2.4. Clinical information of Group B. Pregnancy outcome n Time of diagnosis Gestation maternal age (years) mean ± SD gestational age (weeks) mean ± SD birth weight (g) mean ± SD Congenital abnormalities spina bifida congenital hip dysplasia IUGR total 2 (2) at birth 9 (6) at birth (3) prenatal 10* (2) singleton (5) singleton (1) twin (1) singleton (2) twin 32.00±1.41 33.89±4.59 33.60± 4.43** 40.00±0 37.56±2.83 37.80± 2.78** 2665.00± 487.90 2230.56± 404.89 2308.50± 454.40*** *infant affected by congenital hip dysplasia is also affected by IUGR ** not significantly different from group A (t-test, p>0.5) ***significantly different from group A (t-test, p<0.5) 2.3.1. CGH results A karyotype was successfully obtained from a cord blood sample in 41 of the 51 cases. In each instance the chromosomal constitution was normal. A single normal karyotype was obtained at amniocentesis. In the remaining nine cases, the genetic constitution of the baby was determined by CGH analysis of the amnion, which showed a normal balanced constitution in all cases (Table 2.5). CGH analysis of trophoblast and chorionic stroma at three sites of 51 placentas demonstrated a normal balanced result in 50 placentas (Fig. 2.1, Table 2.5). An abnormality was observed in one placenta (case 02-8). A gain of part of the long arm of chromosome 7 (7q31>qter) and a loss of part of the short arm of chromosome X (Xp21>pter) were confined to the trophoblast at two sites (sites 1 and 3) (Fig. 2.2). FISH confirmed the abnormality at both sites (Table 2.6). Analysis of trophoblast showed a gain of 7q31>qter in 10.8% of cells at site 1 and 34.4% of cells at site 3 (vs. 0.78% in the control, P < 0.001). A loss of Xp21>pter was detected in 30.5% of cells at site 1 and 79% of cells at site 3 (vs. 4.35% in the control, P < 0.001) 42 (Fig. 2.3). The abnormality was identified in a child affected by a congenital malformation, spina bifida (group B). Table 2.5. A summary of CGH results. Fetal genetic constitution site 1 Trophoblast site 2 site 3 site 1 Stroma site 2 site 3 Group A (20) 46, XX* bal,XX bal,XX bal,XX bal,XX bal,XX bal,XX (15)46, XY bal,XY bal,XY bal,XY bal,XY bal,XY bal,XY (5) bal, XX bal,XX bal,XX bal,XX bal,XX bal,XX bal,XX (1) bal, XY bal,XY bal,XY bal,XY bal,XY bal,XY bal,XY Group B (5) 46, XX bal,XX bal,XX bal,XX bal,XX bal,XX bal,XX (2) 46, XY bal,XY bal,XY bal,XY bal,XY bal,XY bal,XY (1) bal,XX bal,XX bal,XX bal,XX bal,XX bal,XX bal,XX (l)bal,XY bal,XY bal,XY bal,XY bal,XY bal,XY bal,XY (1) bal,XX** gain7q31-ter, gain7q31-ter, bal,XX bal,XX bal,XX lossXp21-ter bal,XX lossXp21-ter *one normal cytogenetic result from amniocentesis, **abnormality associated with spina bifida Table 2.6. Confirmation of gain7q31-ter and lossXp21-ter by FISH analysis in trophoblast cells. FISH results Placenta site CGH result gain 7q31>qter n loss Xp21>pter n P Site 1 gain 7q31>qter 10.8% 507 30.5% 556 <0.001 loss Xp21>pter Site 3 gain 7q31>qter 34.4% 540 79% 517 <0.001 loss Xp21>pter Control 0.78% 513 4.35% 506 for test vs. control samples, Z-test In addition, the CGH profiles shifted from the 1:1 ratio in three cases, one in trophoblast and two in chorionic stroma, indicating a possible gain of chromosome 2, 16 and 18. FISH was performed with the appropriate probes to confirm the abnormalities, however the suspected abnormalities were not confirmed (Table 2.7). Table 2.7. Confirmation of CGH results by FISH for trisomy 2,16 and 18. case Abnormality n Disomy (%) Trisomy (%) 02-3 T l Trisomy 2 510 95.7 0.196 NS control 517 96.1 0.193 03-44 S3 Trisomy 16 541 92.6 0.74 NS control 537 92.9 0.37 02-9 S6 Trisomy 18 520 96.5 0.38 NS control 520 96.5 0.19 'for test vs. control samples, chi square test, NS not significant 43 19 M=14 20 11=14 21 ll=14 22 ll=13 Y ll=7 X ll=6 F i g . 2.1. C G H profi les for (a) normal female and (b) no rma l male . Test D N A is compared to normal female reference D N A . A 1:1 profi le for the X chromosome for (a) a female test samples is seen and a loss o f the X chromosome and a gain o f the Y chromosome for the (b) male sample, indicated by the shift to the left and to the right for the respective chromosomes . Other chromosomes show a 1:1 ratio prof i le , indicat ive o f a no rma l ch romosomal const i tut ion. 44 Site 1 Fig. 2.2. C G H profiles at placental sites one and three, showing (a) gain 7q31>qter and loss Xp21>pter, shown as shift to the right and left, respectively, confined to the trophoblast. (b) Chorionic stroma and (c) amnion at same sites show normal chromosomal constitutions. Fig. 2.3. FISH analysis of (1) control and (2) test trophoblast cells. Hybridization with probes specific for (a) 7ql 1.3 (orange) and 7q31 (green), and for (b) Xp22.3 (orange) and X p l 1.1 -ql 1.1 (green). The control shows two signals for each of the probes used as expected. Abnormality in the trophoblast was indicated by three green signals for 7q31 and one orange signal for Xp22.3. 45 Ambiguous CGH profiles for the Y chromosome were sometimes observed. The CGH was either repeated or PCR specific for the SRY region of the Y chromosome was performed. SRY PCR was performed in eight cases. It was negative in all eight cases (Fig. 2.4). 2.3.2. Ploidy determination Because one of the drawbacks of CGH is its inability to determine the ploidy level of a sample, additional tests had to be performed to determine ploidy. The ploidy level was known for four cases on which FISH analysis had been performed (cases 02-3, 02-8, 02-9 and 03-44). All four were diploid. Flow cytometry was carried out on samples on which FISH had not been previously performed. Flow cytometry on 42 stroma samples demonstrated diploidy, while two samples showed tetraploidy, defined by an increase of cells in the G2 peak from the expected 15% (Fig. 2.5). In three cases, FISH was performed on samples where flow cytometry had failed twice. FISH probes specific for chromosomes 18, X and Y were used to differentiate between aneuploidy and polyploidy. In the three cases a diploid constitution was shown. The tetraploidy detected by flow cytometry in the stroma at one site of two placentas was confirmed by FISH (Fig. 2.6), with probes for chromosomes 18, X and Y. Tetraploidy was present in 28.8% of stroma cells in one case and in 37.9% of stroma cells in the second case, compared to 0% in the control (Table 2.8). The presence of tetraploidy was further assessed in the stroma in the remaining two sites of each placenta and in the trophoblast at all three sites of the two placentas. FISH probes for chromosomes X and Y were used because tetraploidy in the first sites analyzed established that higher levels of ploidy, and not aneuploidy, were present in the two placentas. FISH analysis of stroma at the two additional sites, also showed an increased level of tetraploidy in the samples analyzed (Table 2.9). However, one of the placentas (03-43) showed lower levels of tetraploidy in the additional two sites, 5.9% and 9.2% (0% in control) compared with 28.8% tetraploidy observed in the first site analyzed. The second placenta (03-45) showed a similar level of tetraploidy in the two additional sites, 30.0% and 37.2% (0% in control) as the 37.9% found in the first site analyzed. The analysis of trophoblast cells at three sites of the two placentas, also demonstrated the presence of tetraploid cells (Fig. 2.7, Table 2.10). Tetraploidy was present in 2.2%, 4.0% and in 4.71% of trophoblast cells in case 03-43, and in 49.6%, 88.9% and in 89.6% of trophoblast cells in case 03-45, compared to 1.39% in the control. To eliminate the possibility of general mosaicism, FISH was also performed on the lymphocytes of the two babies with tetraploid mosaicism in the placenta. Tetraploidy was not present in either baby (Table 2.11). 46 1 2 3 4 5 6 7 8 9 10 11 12 < - 258 bp Fig. 2.4. SRY analysis. Lane 1 is the low molecular weight ladder, lanes 2-9 are the test samples, 10 is the female control, lane 11 is the male control and lane 12 is a blank control. Lane 11 shows the expected product of 258 base pairs (bp). Based on the absence of the 258 base pah-product in the test samples, the absence of the SRY region can be concluded. a f Lao, b[ 100 -3 200 * * A 100 -0-46 IA 200 4(H) 600 H00 1000 2110 4 0 0 I HOD I IKK i Fig. 2.5. Flow cytometry results for detected tetraploidy. First peak represents the cells that are in the Gl phase, the second peak represents the cells that are in the G2 phase, (a) Diploid control showing less than 15% of cells in the G2 peak, (b) 03-43 S4 and (c) 03-45 S2 are tetraploid because more than the expected 15% of cells are in the G2 peak, 28.4% and 32.5%, respectively. Sample (b) did not provide a good flow cytometry result as both peaks are shifted to the left. Ploidy analysis was repeated by FISH, which confirmed tetraploidy in the sample. 47 Table 2.8. FISH confirmation of tetraploidy detected by flow cytometry in stroma cells. case n Diploid (%) Tetraploid (%) P* control 214 93.5 0 03-43S4 250 67.6 28.8 <0.001 03-45S2 274 54.4 37.9 O.001 "for test vs. control samples, chi square test Table 2.9. FISH analysis for tetraploidy of additional stroma sites. case n Diploid (%) Tetraploid (%) p* control 506 99.4 0 03-43S1 512 93.5 5.9 O.001 S8 510 90.0 9.2 O.001 03-45S4 520 69.0 30.0 O.001 S7 514 62.3 37.2 <0.001 "for test vs. control samples, chi square test Table 2.10. FISH analysis for tetraploidy in trophoblast cells. case n Diploid (%) Tetraploid (%) p* control 502 97.6 1.39 03-43T1 522 96.0 4.0 O.01 T4 551 97.1 2.2 NS T8 551 95.1 4.71 O.01 03-45T2 601 8.6 88.9 <0.001 T4 540 48.7 49.6 <0.001 T7 528 5.7 89.6 O.001 'for test vs. control samples, chi square test Table 2.11. FISH analysis for tetraploidy in lymphocytes. case n Diploid (%) Tetraploid (%) p* control 508 99.4 0.2 03-43 511 99.2 0 NS control 507 98.0 0.2 03-45 507 99.0 0 NS for test vs. control samples, chi square test, NS not significant A summary of ploidy results is shown in Table 2.12. Both tetraploid cases were not associated with a negative pregnancy outcome (group A). The incidence of tetraploidy was 5% in group A and 4% in the ICSI study population. Tetraploidy was not observed in pregnancies associated with a negative pregnancy outcome (group B). Table 2.12. Summary of ploidy results by flow and FISH for groups A and B. Population n Technique Ploidy tetraploid % (n) Group A 41 (36) flow (39) diploid 5(2) (5) FISH (2) diploid/tetraploid Group B 10 (8) flow (10) diploid 0 (2) FISH total 51 4(2) 48 Fig. 2.6. Confirmation of tetraploidy in stroma cells by FISH. FISH was carried out with probes for chromosome 18 (aqua), X (green) and Y (orange), (a) Diploid control showing two signals for chromosome 18 and two signals for chromosome X. Tetraploidy in (b) 03-43 S4 and (c) 03-45 S2 is confirmed as both show four signals for chromosome 18, and four signals for the sex chromosomes: (b) two signals for chromosome X and two signals for chromosome Y, (c) four signals for chromosome X (see Table 2.8 for FISH scores). Tetraploidy was also found in stroma cells at two other placental sites, (see Table 2.9 for FISH scores) Fig. 2.7. Evaluation of tetraploidy in trophoblast cells by FISH. To examine trophoblast cells for tetraploidy FISH was carried out with probes for chromosome X (green) and Y (orange), (a) Diploid control shows two signals for chromosome X. Tetraploidy in (b) 03-43 S4 and (c) 03- 45 S2 is demonstrated as both show four signals for the sex chromosomes: (b) two signals for chromosome X and two signals for chromosome Y, (c) four signals for chromosome X. Tetraploidy was also found in trophoblast cells at two other placental sites, (see Table 2.10 for FISH scores) 49 2.3.3. C P M in post-delivery placentas derived through I C S I In total, three cases of CPM were identified in the study population, consisting of two cases of tetraploidy in group A and of a gain of 7q31-ter and loss of Xp21-ter in group B (Table 2.13). The incidence of CPM in group A was 5% and 10% in group B, with the incidence of CPM in the study group of 6%. CPM was not identified in pregnancies affected by IUGR. Table 2.13. Summary of incidence of CPM in post-delivery ICSI placentas Population N Number of Abnormality Incidence of abnormalities CPM (%) Group A 41 2 mosaic tetraploidy 5* Group B 10 1 10* Congenital abnormalities mosaic gain7q31-ter,lossXp21-ter IUGR none total 51 3 6 •incidence of abnormalities not significantly different between group A and B (Chi square, p>0.5) 2.4. Discussion The study population was made up of singletons, twins and triplets (Table 2.2). Even though multiple births have been previously excluded from analysis of CPM, they were included in the current study because they represent the true ICSI population, which is often made up of multiple births (Loft et al., 1999; Katalinic et al., 2004). In order to include multiple gestations in the current study, the birth weight was adjusted for gestational age and gender separately for singletons, twins and triplets using published charts listing the expected birth weight by gestational age and gender for each group. Therefore, even though children from multiple gestations are expected to be of lower birth weight due to multiplicity, by using the charts described we were able to determine those births that were below the expected birth weight for multiple gestations and to allow inclusion in our study. We defined IUGR as birth weight below the 10th percentile for gestational age. The average maternal age was higher in the study population (34.4 years) than expected in the population which normally averages 27 years of age (Katalinic et al., 2004). Higher maternal age is often observed in couples undergoing ICSI treatment and is thought to be one factor contributing to chromosomal aberrations found in the ICSI population (Bonduelle et al., 1998). The congenital abnormalities that were observed in the study population have been described previously in ICSI babies in other studies (Katalinic et al., 2004), but are not specific to the ICSI population (Wennerholm et al, 2000b; Katalinic et al., 2004). Of the fifty one placentas analyzed, ten originated from pregnancies associated with a negative outcome, two with a congenital abnormality; congenital bilateral hip displasia and 50 neural tube defect, and nine with IUGR, one of which was also affected by congenital bilateral hip displasia. The two groups differed only by mean birth weight. CPM is best studied by the analysis of trophoblast and chorionic stroma (Kalousek and Vekemans, 1996), as these represent both of the placenta tissue lineages present at the blastocyst stage (Crane and Cheung, 1988). In addition, by examining fetal tissue, such as cord blood or amnion, all three tissue lineages of the blastocyst can be evaluated (Crane and Cheung, 1988). The analysis of the three tissue lineages allowed us to examine chromosomal mosaicism that was present either at the zygotic stage, due to meiotic errors, or the result of mitotic errors in any one of the lineages and then maintained until term. It is believed that it is the persistence of CPM until term that is associated with a negative pregnancy outcome (Henderson et al., 1996). Also, mosaicism in the placenta may show spatial variability and therefore more than one site should be analyzed to sufficiently study CPM (Henderson et al., 1996). These issues were addressed in the present study, where the three tissue lineages were examined at three placental sites. The background rate of CPM in the general population and its incidence in the general population affected by IUGR have been well established in the literature (Table 1.5). The mean incidence of CPM reported in the eleven published studies has been used as a comparison for this study. 2.4.1. CGH for the study of CPM CGH has been successfully used to study CPM (Amiel et al., 2002; Lestou et al., 1999; Lestou et al., 2000). It is culture independent, thus eliminating culture failure and clonal expansion, and unlike FISH allows for the simultaneous analysis of multiple chromosomes (Lomax et al., 1998). However, CGH can only detect unbalanced rearrangements, where gains and losses are involved. CGH is not efficient at detecting chromosomal mosaicism, often seen with CPM (Barrett et al., 2001). It has been estimated that more than 30% of cells have to be chromosomally abnormal in order to detect the abnormality by CGH analysis (Kallioniemi et al., 1994). This limitation does not affect the usefulness of CGH for CPM detection. We have shown in this experiment that CGH analysis detected an abnormality affecting only 10.8% of cells, as confirmed by FISH (Table 2.6). It is possible, that over the years, technical advances have made CGH analysis more sensitive than previously to allow the detection of lower levels of mosaicism. This is the first experiment that has coupled CGH and flow cytometry for the study of CPM in post-delivery placentas. Previous studies have only specified the importance of performing flow cytometry when evaluating CPM in spontaneous abortions (Barrett et al., 2001) 51 but have not performed flow cytometry on tissue from term placentas (Lestou et al., 2000; Amiel et al., 2002). Other studies have excluded the possibility of the presence of a polyploid cell line in a term placenta based on the clinical phenotype of the live born baby (Barrett et al, 2001). We did not find phenotypic, or chromosomal, abnormalities in the babies associated with tetraploidy mosaicism in the placentas. This leads us to conclude that the incidence of tetraploidy, or polyploidy in general, in placentas is underestimated by studies that evaluate CPM by CGH. Consequently our study demonstrates the importance of determining ploidy levels in placental tissues at term, not only in placentas derived through ICSI but in all studies evaluating CPM by CGH. 2.4.2. CPM detected by CGH An abnormality was identified in one of the fifty one placentas analyzed by CGH. We found a gain of 7q31>qter (partial trisomy) and loss of Xp21>pter (partial monosomy) by CGH in the trophoblast layer of a placenta from an ICSI derived pregnancy complicated by spina bifida in the child (group B). We did not detect any abnormalities by CGH in group A or placentas derived from pregnancies affected by IUGR. Although CPM usually involves trisomy, cases with partial gains and losses have been reported (Amiel et al., 2002, Stipolijev et al., 2001). Monosomy X has been previously reported to be associated with spina bifida (Coerdt et al., 1997). However, genes on Xq may be involved (Hoi et al., 2000). It is unclear whether the chromosomal abnormality in the placenta is related to the congenital abnormality in the child. Neural tube defects, such as spina bifida, occur more frequently in the IVF population (Lancaster, 1987; Ericson and Kallen, 2001) and may be associated with ovulation induction (Lancaster, 1987). Although neural tube defects are not associated with ICSI, it is possible that the abnormality observed could be related to ovulation induction, and not necessarily be due to placental mosaicism. The localization of the abnormality to the trophoblast seen in our case has been previously reported in spontaneous pregnancies (Artan et al., 1995). The CGH profile for the amnion showed a balanced genetic profile from which we can infer a normal chromosomal constitution (or a balanced translocation) in the child. DNA extracted from third trimester amnion represents primarily the epithelial layer of the amnion (Fig. 1) (Casey and MacDonald, 1996), which originates from the epiblast, tissue that also gives rise to the embryo (Bianchi et al., 1993). Thus molecular analysis of the amnion allows us to infer the genetic constitution of the baby. However, in the case of gain of 7q3 l>qter and loss of Xp21>pter it is difficult to 52 determine whether the abnormality in the placenta represents an unbalanced translocation or an independent loss and gain of two different chromosome arms, most likely originating from a meiotic and mitotic event, respectively. A FISH probe could be designed to enable to differentiate between a balanced translocation from a balanced chromosomal constitution when performed on interphase nuclei, for example from amnion. The set of probes currently used in the study allowed only differentiation between a balanced and an unbalanced chromosomal constitution. The CPM we observed, localized to trophoblast cells, is referred to as type I and is thought to occur via a mitotic mechanism, when few trophoblast cells are affected by the abnormality (Wolshenholme, 1996; Kalousek and Vekemans, 1996). In such cases it is normally not associated with an adverse pregnancy outcome (Kalousek and Vekemans, 1996) and therefore is likely to be unrelated to the congenital malformation observed in the child. That the abnormality is localized to only a proportion of cells, between 10.8% and 79% of cells (Table 2.6), suggests that the event leading to the abnormality could have been mitotic in origin occurring late in gestation (Kalousek et al., 1991; Robinson et al., 1997). A study we have conducted on skewed X-chromosome inactivation (XCI) in female infants derived from ICSI (unpublished data), also provides indirect evidence that this error may have occurred during a mitotic division; analysis of the case revealed random XCI whereas cases with meiotic CPM most often show skewed XCI (Robinson et al., 1997). The occurrence of a mitotic mechanism may also be suggested by the FISH results, which have shown twice as many signals for loss of Xp21>pter as for gain of 7q3 l>qter (Table 2.6). This suggests an independent loss and gain of the chromosome arms that most likely occurred through a mitotic error. The true origin of the abnormality can only be determined by molecular analysis of parental, fetal and placental DNA (Lestou and Kalousek, 1998; Sirchia et al., 1998). This was not possible in our case as the parents refused to donate additional samples. We did however, attempt to extract DNA from maternal decidua but the DNA was too degraded to perform additional molecular tests. The incidence of CPM in the general population in association with congenital abnormalities is hard to estimate because the study of CPM in such cases is often not undertaken (Stipoljev et al., 2001; Kennerknecht et al., 1993) as chromosomal abnormalities are expected to occur more often than expected in association with congenital abnormalities. The few studies presented of CPM with association with congenital abnormalities (Table 1.4) do not present a fair comparison. 53 2.4.3. CPM detected by flow cytometry Flow cytometry was carried out on stromal cells from one placental site because trophoblast cells, specifically the syncytiotrophoblast, are multinucleated (Tarrade et al., 2001) and would be expected to show polyploidy. Theoretically only cytotrophoblast cells, which are not multinucleated, should be recovered after collagenase IA digestion (Henderson et al., 1996), but it is possible that syncytiotrophoblast still remain in the sample. The ploidy was determined by FISH for seven placentas. The analysis of forty four placentas by flow cytometry showed tetraploidy in two samples analyzed from group A, which was confirmed by FISH (Table 2.8). Tetraploidy was also found in the stroma cells at the additional two sites in each placenta (Table 2.9). Even though one of the placentas (03-43) showed higher levels of tetraploidy in the stromal cells (5.9% and 9.2%) compared to the control (0%), it is not clear whether these are significant because a portion of cells is expected to be in the G2 phase (Rua et al., 1995). At this phase cells have replicated their DNA but not yet divided and are thus tetraploid. However, the control stromal cells have shown only a diploid constitution in two separate FISH experiments (Table 2.8 and 2.9). The second placenta (03-45) was affected by higher levels of tetraploidy in the stromal cells in all three sites analyzed ranging from 30% to 37 % (Table 2.8 and 2.9). Even though we expected a proportion of trophoblast cells to be polyploid, as mentioned above, we performed flow cytometry on trophoblast cells from the placentas where tetraploidy was identified in stromal cells. Tetraploidy was identified in trophoblast cells at three placental sites analyzed in both placentas (Table 2.10), with lower levels of tetraploidy being present in one of the placentas (03-43) ranging from 2.2% to 4.7%. The other placenta (03-45) showed higher levels of tetraploid cells, which ranged from 49% to 89% of cells affected. Tetraploid cells were also detected in 1.39% of control trophoblast cells, as opposed to none being present in the stromal cells. The presence of tetraploidy in trophoblast cells suggests that some syncytiotrophoblast cells may remain after collagenage 1A digestion or that a small proportion of cytotrophoblast cells are tetraploid. It is also possible that two closely associated diploid cells were scored as one tetraploid cell. To eliminate the possibility of general mosaicism, the presence of tetraploidy was examined in the lymphocytes of the child. Tetraploidy was not present in the lymphocyte cultures examined by FISH (Table 2.11). However, a single tetraploid cell was observed in the controls and again most likely represents two closely associated diploid cells scored as one tetraploid cell. The two cases of tetraploidy represent an incidence of 5% (2/41) in pregnancies from group A and of 4% (2/51) in the total study population (Table 2.12), both of which are significantly different from incidence of tetraploidy in the general population 54 (group A versus background rate (1/468), Table 1.5, Chi square test, p<0.001; total study population versus general population rate (4/714), Table 1.5, Chi square test, p<0.01). Polyploidy is a relatively common finding. Analysis of unused embryos from IVF and ICSI showed polyploidy in 20.4% embryos (of 216 analyzed), where mosaic polyploids that involving a diploid cell line are the most common (Bielanska et al., 2002; Clouston et al., 2002). An interesting finding was the increase in incidence of polyploidy with a more advanced stage of embryonic development, where polyploidy was identified in 3.8% of 2 to 8 cell embryos, in 6.3% of morula and in 67.9% of blastocysts (Bielanska et al., 2002). The higher incidence of polyploidy at the blastocysts stage is thought to reflect the differentiation of cytotrophoblast into the multinucleated syncytiotrophoblast (Bielanska et al., 2002; Tarrade et al., 2001). Polyploidy also increased in embryos of low quality (Bielanska et al., 2002) and in cultured embryos compared to those directly processed, 22.9% versus 6.1%, respectively (Bielanska et al., 2003). Again it is thought that embryo culture to day 5 coincides with the blastocyst stage and so polyploidy may signify the beginning of trophoblast differentiation (Bielanska et al, 2003). Tetraploidy is the most common type of polyploidy observed in embryos (Clouston et al., 2002; Evsikov and Verlinsky, 1998), with 29% to 48% of embryos being a mosaic tetraploid/ diploid (Clouston et al, 2002; Munne et al., 1994). Tetraploidy has also been observed during prenatal diagnosis (Kalousek et al., 1991; Kennerknecht et al., 1993). Tetraploid cells are often observed in chorionic villi cultures, affecting both the trophoblast and the stroma (Noomen et al., 2001). Low levels of tetraploidy mosaicism in trophoblast cells and mosaicism between 4% and 58% in stroma cells were not associated with any pregnancy complications due to the presence of tetraploidy in 100 pregnancies examined at CVS (Noomen et al., 2001). Two tetraploid mosaics (1.4%) have been identified at amniocentesis of ICSI babies (Samli et al., 2003). However, tetraploidy in live born children is rare with only few cases having been reported (Nakamura et al., 2003). A recent paper reported on a tetraploid birth, which ended in perinatal death. In addition the baby was affected by numerous severe abnormalities and IUGR (Nakamura et al., 2003). Tetraploidy represents between 3.2% and 6% of CPM abnormalities detected in spontaneous abortions (Barrett et al., 2001; Griffin et al., 1997; Kalousek et al., 1992) and between 1 and 10 % of CPM at CVS and at term (Artan et al., 1995; Cowles et al., 1996; Wilkins-Haug etal., 1995). Tetraploidy is most often associated with a negative pregnancy outcome when high levels of tetraploid cells are present in placental tissue. For example Kennerknecht et al. (1993) observed intrauterine death when 78% of trophoblast cells were tetraploid, while perinatal death 55 was observed by Leschot et al. (1996) when tetraploidy affected 100% of trophoblast cells. Micrognathia was also found in the baby. However, lower levels of tetraploidy in trophoblast cells of 33% have also been reported to be associated with IUGR (Kalousek et al., 1991). When tetraploidy persists to term, it is most often associated with IUGR (Artan et al., 1995; Cowles et al., 1996; Wilking-Haug et al., 1995). Tetraploid cells are selectively distributed to the trophoectoderm of the blastocyst (Everett and West, 1996). In addition, they may also be distributed to the inner cell mass, but only to the primitive endoderm (James et al., 1995), the cell line that will give rise to the stroma (James et al., 1995; Crane and Cheung, 1988). Tetraploid cells are selectively excluded from embryonic tissues (Everett and West, 1996). However, if tetraploid cells are present they are thought to be at a selective disadvantage and may be lost from both embryonic and extra-embryonic tissues before implantation takes place (Everett and West, 1998). Tetraploidy may arise through mitotic errors, such as cytokinesis failure at the first zygotic division (Causio et al., 2002), nuclear fusion of two blastocysts (Murine et al., 1994) or through meiotic errors which involve the incorporation of a polar body and fertilization either by two sperms (Baumer et al., 2003) or by a diploid sperm. The two cases of tetraploidy we identified are most likely to be of mitotic origin as the level of mosaicism was generally low. The two cases of tetraploidy mosaicism we have identified in this study were not associated with a negative pregnancy outcome. Based on what has been reported in the literature, we would have expected the case affected by higher levels of tetraploidy in both the stroma and trophoblast cells to be affected by IUGR because high levels of mosaicism especially in the trophoblast are more likely to be associated with a negative pregnancy outcome (Robinson et al., 1997). This was not seen in our case. Based on this observation, the low level of mosaicism in the other case is most likely associated with the normal pregnancy outcome for that case. The significance of tetraploidy in the two cases remains unknown, but may be representative of the high levels of tetraploidy that have been observed in ICSI derived embryos (Clouston et al., 2002; Munne et al., 1994). Tetraploidy present early in development may persist to term and may or may not be associated with a negative pregnancy outcome. With the identification of CPM it has to be kept in mind that the analysis of cord blood or amnion cannot guarantee that a chromosomally abnormal cell line is not present in the baby since a chromosomal abnormality may be limited to only a few tissues and other tissues not analyzed may still be affected (Bruyere et al., 1999). 56 2.4.4. Association of IUGR with CPM in ICSI pregnancy The association of CPM with IUGR is well documented in the literature. A summary of eleven studies (Table 1.5) shows the incidence of CPM in pregnancies affected by IUGR to be 14.3%; almost ten times the background rate. The incidence of CPM in ICSI derived pregnancies has not yet been established. Our study has also failed to show an association of CPM with IUGR in the nine IUGR cases included in our experiment. This is most likely due to the small sample size of pregnancies affected by IUGR in the current experiment. The mean gestational age and the mean birth weight of the study population were not significantly different from the expected mean values for the general population (Table 2.2). In addition, the majority of pregnancies affected by low birth weight were multiple gestations, which were also affected by premature birth (Table 2.2). Therefore the infants were of appropriate size for their early gestational age as babies born prematurely are expected to be smaller. Our results with regard to CPM in the ICSI pregnancy affected by IUGR are inconclusive. This topic requires further assessment in the future. Perhaps future experiments should assess CPM in infants affected by a more severe form of IUGR, below the 5th percentile, as the infants in this study were affected by the less severe form of IUGR, below the 10th percentile, and they were all just below the 10th percentile. In addition, a population made up of singletons should be studied as they are less likely to be affected by premature birth and therefore more likely to be affected by IUGR at birth, if born with a low birth weight. 2.4.5. Association of maternal age with CPM in ICSI derived pregnancies The three pregnancies affected by CPM were associated with advanced maternal age, with the mean maternal age of 37.3 years. The two tetraploidy cases observed in this experiment were both associated with an advanced maternal age of 40 years. However, such an association was not observed by other studies (Samli et al., 2003; Munne et al., 1998). It is possible that aged oocytes may be at a higher risk of being diploid, and through ICSI have been fertilized by a diploid sperm. The maternal age for CPM involving the partial gain of 7q and loss of Xp was 32. 2.4.6. Summary In the current study, fifty one post-delivery placentas derived from ICSI were analyzed by CGH for the presence of CPM. Placentas obtained for the study were subdivided according to pregnancy outcome into one of two groups; group A for pregnancies with a normal outcome 57 or group B for pregnancies with a negative pregnancy outcome, either congenital abnormalities or IUGR. Trophoblast and stroma were analyzed by CGH for the presence of a chromosomal abnormality at three placental sites. In addition, stroma samples were examined by flow cytometry for ploidy determination. Abnormalities identified either by CGH or flow cytometry were evaluated by FISH for confirmation. We identified a chromosomal abnormality in three placentas. A gain of 7q31>qter and a loss of Xp21>pter was identified by CGH confined to trophoblast cells at two placental sites and confirmed by FISH. The abnormality was associated with a congenital abnormality, spina bifida. Two cases of tetraploidy were identified by flow cytometry and also confirmed by FISH, where tetraploidy was identified in both the trophoblast and stroma cells. The tetraploidy cases were associated with a normal pregnancy outcome. The detected abnormalities were most likely of a mitotic origin and advanced maternal age affected both tetraploidy cases. The incidence of CPM was 5% (2/41) in group A and 10% (1/10) in group B, and did not differ significantly between the two groups. We did not however, identify CPM in pregnancies affected by IUGR, most likely due to the small sample size of IUGR pregnancies analyzed (only 9). Both the background rate of CPM in the ICSI population in our study (5%) and the total incidence of CPM in all of the pregnancies studied (6%) did not differ significantly from the incidence found in the general population (1.5% and 5.9%, respectively) (Table 2.14). However, the incidence of tetraploidy in the ICSI population was higher than in the general population. Table 2.14. The incidence of CPM in ICSI population compared to the general population. Background rate IUGR Congenital abnormalities Pregnancies analyzed . ICSI population 2/41 (5%)** 0/9 1/2 (50%) 3/51 (6%)** (current study) General Population* 7/469(1.5%) 35/245 (14.3%) ? 42/714 (5.9%) Data from Table V **Not significantly different by Fisher's exact test, p>0.1 compared to general population. 58 CHAPTER III. SUMMARY AND CONCLUSION 3.1. Summary Even though intracytoplasmic sperm injection (ICSI) has been successfully used to treat male factor infertility (Palermo et al., 1992; Ma and Yuen, 2001), safety concerns have been raised. A higher prevalence of chromosomal abnormalities has been reported among babies born through ICSI (Bonduelle et al., 2002; Wennerholm et al., 2000a; Loft et al., 1999). These children are also at a higher risk of prematurity and low birth weight (Wonnerholm et al. 2000a; Loft et al. 1999), and possibly congenital abnormalities (Bonduelle et al., 2005; Sutcliffe et al., 2003). To date only chromosomal abnormalities of the embryonic tissues have been evaluated and it is not known whether extraembryonic tissues are also affected, influencing the outcome of the ICSI pregnancy. Confined placental mosaicism (CPM) is a dichotomy between fetal and placental tissues (Kalousek et al., 1991) and has been well established in the literature as a factor affecting pregnancy outcome, specifically IUGR (Kalousek et al., 1991; Leschot et al., 1996). CPM is most often associated with a poor pregnancy outcome when it affects a large proportion of cells in the post-delivery placenta (Wolshenholme, 1996; Schuring-Blom et al., 1993). The incidence of CPM in pregnancies derived through ICSI may be higher than it is in the natural population, as ICSI is associated both with increased meiotic (Shi and Martin, 2001; Van Steirteghem et al., 2002) and mitotic errors (Dumoulin et al., 2001; Hewitson et al., 1999). Both types of these errors can give rise to CPM. In addition, babies born through ICSI are more likely to be affected by low birth weight (Schieve et al., 2002), a factor correlated with the incidence of CPM (Wolstenholme, 1996; Kalousek et al., 1991; Leschot et al., 1996). The possible existence of CPM in ICSI pregnancies may be associated with the prevalence of low birth weight in newborns. In the current study we hypothesized that CPM would be present at a higher frequency in placentas derived through ICSI compared to spontaneous pregnancies. Also, the CPM identified would be more prevalent in pregnancies complicated by IUGR and congenital malformations, compared to pregnancies with a normal outcome. We examined fifty one post-delivery placentas from ICSI pregnancies and analyzed both placental tissues, trophoblast and chorionic stroma, at three placental sites for the presence of CPM using the molecular techniques CGH. Ploidy was determined by flow cytometry and FISH analysis was used to confirm abnormalites detected. Placentas from pregnancies with a normal pregnancy outcome (n=41) and a negative pregnancy outcome (n=10) (congenital abnormalities or IUGR) were collected and subdivided into two 59 groups with the two different pregnancy outcomes. Cord blood was collected for cytogenetic analysis. All children included in this study had a balanced chromosomal constitution. CGH "analysis of trophoblast and stoma at three sites showed a balanced chromosomal constitution in fifty of the fifty one placentas analyzed. An abnormality was detected in group B (10%), in a placenta from a child affected by spina bifida. CGH analysis showed a gain of 7q3 l>qter and a loss of Xp21>pter in the trophoblast at two sites, but not in the chorionic stroma. Flow cytometry analysis of stroma cells showed tetraploidy in two placentas from group A (5%). All three abnormalities were confirmed by FISH analysis. The three abnormalities most likely were of a mitotic origin. CPM was not detected in pregnancies affected by IUGR. The incidence of CPM in the total post-ICSI population was 6% (3/51). 3.2. Conclusion The association of ICSI with a higher risk for meiotic and mitotic errors did not result in a higher prevalence of CPM in the ICSI pregnancy. The incidence of CPM was not higher than reported in the general population and therefore the post-ICSI population does not appear to be at an increased risk for being affected by CPM. Studies evaluating CPM in the general population have demonstrated CPM to be associated with a higher risk for a negative pregnancy outcome. However, we did not detect a higher incidence of CPM in the ICSI study group affected by a negative pregnancy outcome compared to the pregnancies with a normal outcome. A larger sample size is needed to determine whether IUGR in ICSI pregnancies is associated with CPM. We did identify a higher prevalence of tetraploidy in placentas derived through ICSI, compared to the expected frequency in the general population. Tetraploidy was associated with advanced maternal age in our study and it would be interesting to further explore the possible correlation. The current study shows the importance of ploidy determination when studying CPM. 60 B I B L I O G R A P H Y Aboulghar H, Aboulghar M, Mansour R, Serour G, Amin Y and Al-Inany H (2001) A prospective controlled study of karyotyping for 430 consecutive babies conceived through intracytoplasmic sperm injection. Fertil Steril 76: 249-253. Alberts B, Bray D, Lewis J, Raff M, Roberts K and Watson JD (1983) Molecular biology of the cell. New York: Garland Publishing Inc., pp 769-811. Alsat E, Guibourdenche J, Couturier A and Evain-Brion D (1998) Physiological role of human placental growth hormone. Mol Cell Endocrinol 140: 121-127. Amiel A, Bouaron N, Kidron D, Sharony R, Gaber E and Fejgin MD (2002) CGH in the detection of confined placental mosaicism (CPM) in placentas of abnormal pregnancies. Prenat Diagn 22: 752-758. Antonarakis SE, Avramopoulos D, Blouin JL, Talbot CC Jr and Schinzel AA (1993) Mitotic errors in somatic cells cause trisomy 21 in about 4.5% of cases and are not associated with advanced maternal age. Nat Genet 3: 146-150. Aran B, Blanco J, Vidal F, Vendrell JM, Egozcue S, Barri PN, Egozcue J and Veiga A (1999) Screening for abnormalities of chromosomes X, Y, and 18 and for diploidy in spermatozoa from infertile men participating in an in vitro fertilization intracytoplasmic sperm injection program. Fertil Steril 72: 699-701. Artan A, Basaran N, Hassa H, Ozapl S, Sener T, Sayli BS, Cerigiz C, Ozdemir M, Durak T, Dolen I, Ozgunen T and Tuna M (1995) Confined placental mosaicism in term placentae: analysis of 125 cases. Prenat Diagn 15:1135-1142. Aytoz A, De Catte L, Camus M, Bonduelle M, Van Assche E, Liebaers I, Van Steirteghem A and Devroey P (1998a) Obstetric outcome after prenatal diagnosis in pregnancies after intracytoplasmic sperm injection. Hum Reprod 13: 2958-2961. Aytoz A, Camus M, Tournaye H, Bonduelle M, Van Steirteghem A and Devroey P (1998b) Outcome of pregnancies after intracytoplasmic sperm injection and the effect of sperm origin and quality on this outcome. Fertil Steril 70: 500-505. Aytoz A, Van den Abbeel E, Bonduelle M, Camus M, Joris H, Van Steirteghem A and Devroey P (1999) Obstetric outcome of pregnancies after the transfer of cryopreserved and fresh embryos obtained by conventional in-vitro fertilization and intracytoplasmic sperm injection. Hum Reprod 14: 2619-2624. Barrett IJ, Lomax BL, Loukianova T, Tang SS, Lestou VS and Kaloused DK (2001) Comparative genomic hybridization. A new tool for reproductive pathology. Arch Pathol Lab Med 125: 81-84. Battaglia FC and Meschia G (1988) Fetal nutrition. Ann Rev Nutr 8: 43-61. 61 Baumer A, Dres D, Basaran S, Isci H, Dehgan T and Schinzel A (2003) Parental origin of the two additional haploid sets of chromosomes in an embryo with tetraploidy. Cytogenet Genome Res 101: 5-7. Bell GI, Kayano T, Buse JB, Burant CF, Tadeka J, Lin D, Fukumoto H, Seino S (1990) Molecular biology of mammalian glucose transporters. Diabetes Care 13: 198-208. Bellve AR (1998) Introduction: the male germ cell; origin, migration, proliferation and differentiation. Semin Cell Dev Biol 9: 379-391. Benn P (1998) Trisomy 16 and trisomy 16 mosaicism: a review. Am J Med Genet 79: 121-133. Bernardini L, Gianaroli L, Fortini D, Conte N, Magli C, Cavani S, Gaggero G, Tindiglia C, Ragni N and Venturini PL (2000) Frequency of hyper-, hypohaploidy and diploidy in ejaculate, epididymal and testicular germ cells of infertile patients. Hum Reprod 15: 2165-2172. Bhasin S and DeKrester DM (1994) Pathophysiology and natural history of male infertility. J Clin Endocrinol Metab 79: 1525-1529. Bianchi DW, Wilkins-Haug LE, Enders AC and Hay ED (1993) Origin of extraembryonic mesoderm in experimental animals: relevance to chorionic mosaicism in humans. Am J Med Genet 46: 542-550. Bielanska M, Tan SL and Ao A (2002) Chromosomal mosaicism throughout human preimplantation development in vitro: incidence, type, and relevance to embryo outcome. Hum Reprod 17: 413-419. Bielanska M, Tan SL and Ao A (2003) Chromosomal information derived from single blastomeres isolated from cleavage-stage embryos and cultured in vitro. Fertil Steril 79: 1304-1311. Blau H, Freud E, Mussaffi H, Werner M, Konen O and Rathaus V (2002) Urogenital abnormalities in male children with cystic fibrosis. Arch Dis Child 87: 135-138. Blickstein I (2004) How and why are triplets disadvantaged compared to twins? Best Pract Res Clin Obstet Gynaecol 18: 631-644. Bonduelle M, Aytoz A, Van Assche E and Devroey P (1998) Incidence of chromosomal aberrations in children born after assisted reproduction through intracytoplasmic sperm injection. Hum Reprod 13: 781-782. Bonduelle M, Camus M, De Vos A, Staessen C, Tournaye H, Van Assche E, Verheyen G, Devroey P, Liebaers I and Van Steirteghem A (1999) Seven years of intracytoplasmic sperm injection and follow-up of 1987 subsequent children. Hum Reprod Suppl 1: 243-264. Bonduelle M, Van Assche E, Joris H, Keymolen K, Devroey P, Van Steirteghem A and Liebaers I (2002) Prenatal testing in ICSI pregnancies: incidence of chromosomal anomalies in 1586 karyotypes and relation to sperm parameters. Hum Reprod 17: 2600-2614. 62 Bonduelle M, Bergh C, Niklasson A, Palermo GD, Wennerholm UB (2004) Medical follow-up study of 5-year-old ICSI children. Reprod Biomed Online 9: 91-101. Bonduelle M , Wennerholm UB, Loft A, Tarlatzis BC, Peters C, Henriet S, Mau C, Victorin-Cederquist A, Van Steirteghem A, Balaska A, Emberson JR and Sutcliffe AG (2005) A multi-centre cohort study of the physical health of 5-year-old children conceived after intracytoplasmic sperm injection, in vitro fertilization and natural conception. Hum Reprod 20:413-419. Brandell RA, Mielnik A, Liotta D, Ye Z, Veek LL, Palermo GD and Schlegel PN (1998) AZFb deletions predict the absence of spermatozoa with testicular sperm extraction: preliminary repot of a prognostic genetic test. Hum Reprod 13: 2812-2815. Brown GM, Furlong RA and Sargent CA (1998) Characterization of the coding sequence and fine mapping of the human DFFRY gene and comparative Dffry gene. Hum Mol Genet 7: 97-107. Bruyere H, Barrett IJ, Kalousek DK and Robinson WP (1999) Tissue specific involvement in fetal trisomy 16. Am J Hum Genet 65: A173. Carlson BM (2004) Human embryology and developmental biology. Philadelphia: Mosby, pp 3-41. Casey ML and MacDonald PC (1996) Interstitial collagen synthesis and processing in human amnion: a property of the mesenchymal cells. Biol Reprod 55: 1253-1260. Causio F, Fischetto R, Sarcina E, Geusa S and Tartagni M (2002) Chromosome analysis of spontaneous abortions after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI). Eur J Obstet Gynecol Reprod Biol 105: 44-48. Cedard L (1997) The endocrine function of the placenta: interactions between trophic peptides and hormones. In: Battaglia FC ed. Placental Function and Fetal Nutrition. Nestle Nutrition Workshop Series, Vol. 39. Philadelphia: Vevey/Lippincott-Raven Publishers, pp 59-73. Cetin I, Marconi AM, Corbetta C, Baggiani AM, Battaglia FC and Pardi G (1993) Fetal-maternal amino acid relationships in normal and intrauterine growth retarded (IUGR) pregnancies. Trophoblast Res volume 7: 11-23. Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, Nunes V, Ferec C and Estivill X (1995) Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med 332: 1475-1480. Chu CS, Trapnell BC, Curristin S, Cutting GR and Crystal RG (1993) Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet 3: 151-156. Clouston HJ, Herbert M, Fenwick J, Murdoch AP and Wolstenholme J (2002) Cytogenetic analysis of human blastocysts. Prenat Diagn 22: 1143-1152. 63 Coerdt W, Miller K, Holzgreve W, Rauskolb R, Schwinger E and Rehder H (1997) Neural tube defects in chromosomally normal and abnormal human embryos. Ultrasound Obstet Gynecol 10, 410-415. Costes B, Girodon E, Ghanem N, Flori E, Jardin A, Soufir JC and Goossens M (1995) Frequent occurrence of the CFTR introm 8 (TG)n 5T allele in men with congenital bilateral absence of the vas deferens. Eur J Hum Genet 3: 285-293. Cowles TA, Zneimer SM and Elder FFB (1996) A prospective cytogenetic study in third trimester placentas of fetuses with unexplained intrauterine growth restriction. J Matern Fetal Invest 6: 207-209. Cox GF, Burger J, Lip V, Mau UA, Sperling K, Wu BL and Horsthemke B (2002) Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am J Hum Genet 7: 162-164. Crane JP and Cheung SW (1988) An embryonic model to explain cytogenetic inconsistencies observed in chorionic villus versus fetal tissue. Prenat Diagn 8: 119-129. Cross JC and Rossant J (2001) Development of the embryo. In: Harding R and Bocking AD eds. Fetal Growth and development. Cambridge: Cambridge University Press, pp 1-16. Cupisti S, Conn CM, Fragouli E, Whalley K, Mills JA, Faed MJ and Delhanty JD (2003) Sequential FISH analysis of oocytes and polar bodies reveals aneuploidy mechanisms. Prenat Diagn 23: 663-668. DeBaun MR, Niemitz EL and Feinberg AP (2003) Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and HI9. Am J Hum Genet 72: 156-160. Dicke JM and Henderson Gl (1988) Placental amino acid uptake in normal and complicated pregnancies. Am J Med Sci: 295: 223-227. Dumoulin JCM, Coonen E, Bras M, Bergers-Janssen JM, Ignul-Vanvuchelen RCM, Wissen LCP, Geraedts JPM and Evers JLH (2001) Embryo development and chromosomal anomalies after ICSI: the effect of the injection procedure. Hum Reprod 16: 306-312. Dym M (1994) Spermatogonial stem cells of the testis. Proc Natl Acad Sci USA 91: 11287-11289. Egozcue S, Blance J, Vendrell JM, Garcia F, Veiga A, Aran C, Barri PN, Vidal F and Egozcue J (2000) Human male infertility: chromosome anomalies, meiotic disorders, abnormal spermatozoa and recurrent abortion. Hum Reprod Update 6: 93-105. Ericson A and Kallen B (2001) Congenital malformations in infants born after IVF: a population-based study. Hum Reprod 16: 503-509. 64 Everett CA and West JD (1996) The influence of ploidy on the distribution of cells in chimaeric mouse blastocysts. Zygote 4: 59-66. Everett CA and West JD (1998) Evidence for selection against tetraploid cells in tetraploid<— >diploid mouse chimaeras before the late blastocyst stage. Genet Res 72: 225-228. Evsikov S and Verlinsky Y (1998) Mosaicism in the inner cell mass of human blastocysts. Hum Reprod 13:3151-3155. Farra C, Giudicelli B, Pellissier MC, Philip N and Piquet C (2000) Fetoplacental chromosomal discrepancy. Prenat Diagn 20: 190-193. Fisher SJ, Cui TC, Shang L, Hartman L, Grahl K, Guo-Yang Z, Tarpey J and Damsky CH (1989) Adhesive and degradative properties of human placental cytotrophoblast cells in vitro. J Cell Biol 109: 891-902. Foresta C, Galeazzi C, Bettella A, Bella M and Scandellari C (1998) High incidence of sperm sex chromosomes aneuploidies in two patients with Klinefelter's syndrome. J Clin Endocrinol Metab 83: 203-205. Gazvani R and Lewis-Jones DI (2004) Cystic fibrosis mutation screening before assisted reproduction. Int J Androl 27: 1-4. Gekas J, Thepot F, Turleau C, Siffroi JP, Dadoune JP, Briault S, Rio M, Bourouillou G, Carre-Pigeon F, Wasels R and Benzacken B (2001) Chromosomal factors of infertility in candidate couples for ICSI: an equal risk of constitutional aberrations in women and men. Hum Reprod 16: 82-90. Gibbons B, Cheng HH, Yoong AKH and Brown S (1997) Confined placental mosaicism for trisomy 2 with intrauterine growth retardation and severe oligohydroaminos in the absence of uniparental disomy in the fetus. Prenat Diagn 17: 689-690. Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A and Le Bouc Y (2003) In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCNIOT gene. Am J Hum Genet 72: 1338-1341. Griffin DK, Millie EA, Redline RW, Hassold TJ and Zaragoza MV (1997) Cytogenetic analysis of spontaneous abortions: comparison of techniques and assessment of the incidence of confined placental mosaicism. Am J Med Genet 72: 297-301. Guttenbach M, Michelmann HW, Hinney B, Engel W and Schmid M (1997) Segregation of sex chromosomes into sperm nuclei in a man with 47,XXY Klinefelter's karyotype: a FISH analysis. Hum Genet 99: 474-477. Henderson KG, Shaw TE, Barrett IJ, Telenius AH, Wilson RD and Kalousek DK (1996) Distribution of mosaicism in human placentae. Hum Genet 97: 650-654. Hansen WF, Bernard LE, Langlois S, Rao KW, Chescheir NC, Aylsworth AS, Smith DI, Robinson WP, Barrett IJ and Kalousek DK (1997) Maternal uniparental disomy of chromosome 65 2 and confined placental mosaicism for trisomy 2 in a fetus with intrauterine growth restriction, hypospadias, and oligohydroaminos. PrenatDiagn 17: 443-450. Hassold T and Hunt P (2001) To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet 2: 280-291. Hassold TJ, Sherman SL, Pettay D, Page DC and Jacobs PA (1991) XY chromosome nondisjunction in man is associated with diminished recombination in the pseudoautosomal region. Am J Hum Genet 49: 253-260. Hassold T, Merrill M, Adkins K, Freeman S and Sherman S (1995) Recombination and maternal age-dependent nondisjunction: molecular studies of trisomy 16. Am J Hum Genet 57: 867-874. Hawley RS, Frazier JA and Rasooly R (1994) Separation anxiety: the etiology of non-disjunction in flies and people. Hum Mol Genet 3: 1521-1528. Hewitson LC, Simerly CR, Tengowski MW, Sutovsky P, Navara CS, Haavisto AJ and Schatten G (1996) Microtubule and chromatin configurations during rhesus intracytoplasmic sperm injection: successes and failures. Biol Reprod 55: 271-280. Hewitson L, Dominko T, Takahashi D, Martinovich C, Ramalho-Santos J, Sutovsky P, Fanton J, Jacob D, Monteith D, Neuringer M, Battaglia D, Simerly C and Schatten G (1999) Unique checkpoints during the first cell cycle of fertilization after intracytoplasmic sperm injection in rhesus monkeys. Nat Med 5:431-433. Hoffman HJ, Stark CR, Lundin FE Jr and Ashbrook JD (1974) Analysis of birth weight, gestational age, and fetal viability, U. S. births, 1968. Obstet Gynecol Surv 29: 651-681. Hogge WA, Schonberg SA and Golbus MS (1986) Chorionic villus sampling: Experience of the first 1000 cases. Am J Obstet Gynecol 154: 1249-1252. Hoi FA, Schepens MT, van Beersum SE, Redolfi E, Affer M, Vezzoni P, Hamel BC, Karnes PS, Mariman EC and Zucchi I (2000) Identification and characterization of an Xq26-q27 duplication in a family with spina bifida and panhypopituitarism suggests the involvement of two distinct genes. Genomics 69, 174-181. Hook EB and Cross PK (1987) Rates of mutant and inherited structural cytogenetic abnormalities detected at amniocentesis: results on about 63,000 fetuses. Ann Hum Genet 51: 27-55. Islami D, Bischof P and Chardonnens D (2003) Possible internactions between laptin, gonadotrophin-releasing hormone (GnRH-I and II) and human chorionic gonadotrophin (hCG). Eur J Obstet Gynecol Reprod Biol 110: 169-175. Isola J, Devries S, Chu L, Ghazvini S, and Waldman F (1994) Analysis of changes in DNA sequence copy number by comparative genomic hybridization in archival paraffin-embedded tumor samples. Am J Path 145: 1301-1308. 66 Jacobs PA, Hassold TJ, Whittington E, Butler G, Collyer S, Keston M and Lee M (1988) Klinefelter's syndrome: an analysis of the origin of the additional sex chromosome using molecular probes. Ann Hum Genet 52: 93-109. Jacobs PA, Browne C, Gregson N, Joyce C and White H (1992) Estimates of the frequency of chromosome abnormalities detectable in unselected newborns using moderate levels of banding. JMed Genet 29:103-108. James RM, Klerkx AH, Keighren M, Flockhart JH and West JD (1995) Restricted distribution of tetraploid cells in mouse tetraploid<=>diploid chimaeras. Dev Biol 167: 213-226. Jarzabek K, Zbucka M, Pepinski W, Szamatowicz J, Domitrz J, Janica J, Wolczynski S and Szamatowicz M (2004) Cystic fibrosis as a cause of infertility. Reprod Biol 4: 119-129. Jequier AM, Ansell ID and Bullimore NJ (1985) Congenital absence of the vasa deferentia presenting with infertility. J Androl 6: 15-19. Jeyendran RS (2000) Interpretation of semen analysis results: a practical guide. Cambridge, UK: Cambridge University Press. Johnson A, Wapner RJ, Davis GH and Jackson LG (1990) Mosaicism in chorionic villus sampling: an association with poor perinatal outcome. Obstet Gynecol 75: 573-577. Kallioniemi A, Kallioniemi O, Sudar D, Rutovitz D, Gray JW, Waldman F and Pinkel D (1992) Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science 258,818-821 Kallioniemi OP, Kallioniemi A, Piper J, Isola J, Waldman F, Gray JW, and Pinkel D (1994) Optimizing comparative genomic hybridization for analysis of DNA sequence copy number changes in solid tumors. Genes Chromosom Cancer 10: 231-243. Kalousek DK and Dill FJ (1983) Chromosomal mosaicism confined to the placenta in human conceptions. Science 221: 665-667. Kalousek DK and Vekemans M (1996) Confined placental mosaicism. J Med Genet 33: 529-533. Kalousek DK, Howard-Peebles PN, Olson SB, Barrett IJ, Dorfmann A, Black SH, Schulman JD and Wilson RC (1991) Confirmation of CVS mosaicism in term placentae and high frequency of IUGR association with CPM. Prenat Diagn 11: 743-750. Kalousek DK, Barrett IJ and Gartner AB (1992) Spontaneous abortion and confined chromosomal mosaicism. Hum Genet 88: 642-646. Kalousek DK, Langlois S, Robinson WP, Telenius A, Bernard L, Barrett IJ, Howard-Peebles PN and Wilson RD (1996) Trisomy 7 CVS mosaicism: pregnancy outcome, placentas and DNA analysis in 14 cases. Am J Med Genet 65: 348-352. 67 Katalinic A, Rosch C and Ludwig M (2004) Pregnancy course and outcome after intracytoplasmic sperm injection: a controlled, prospective cohort study. Fertil Steril 81: 1604-1616. Kayisli UA, Selam B, Guzeloglu-Kayisli O, Demir R and Arici A (2003) Human chorionic gonadotropin contributes to maternal immunotolerance and endometrial apoptosis by regulating Fas-Fas ligand system. J Immunol 171: 2305-2313. Kennerknecht I, Kramer S, Brab D, Terinde R and Vogel W (1993)A prospective cytogenetic study of third-trimester placentae in small-for-date but otherwise normal newborns. Prenat Diagn 13:257-269. Khong TY (2004) Placental vascular development and neonatal outcome. Semin Neonatol 9: 255-263. Kliman HJ, Nestler JE, Sermasi E, Sanger JM and Strauss III, JF (1986) Purification, characterization and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118: 1567-1582. Knowles MR, Stutts MJ, Spock A, Fischer N, Gatzy JT and Boucher RC (1983) Abnormal ion permeation through cystic fibrosis respiratory epithelium. Science 9:1067-1070. Kolibianakis E, Osmanagaoglu K, De Catte L, Camus M, Bonduelle M, Liebaers I, Van Steirteghem A and Devroey P (2003) prenatal genetic testing by amniocentesis appears to result in a lower risk of fetal loss than chorionic villus sampling in singleton pregnancies achieved by intracytoplasmic sperm injection. Fertil Steril 79: 374-378. Kotzot D (2002) Review and meta-analysis of systematic searches for uniparental disomy (UPD) other than UPD 15. Am J Med Genet 111: 366-375. Kotzot D, Lurie IW, Mehes K, Werder E and Schnizel A (2000) No evidence of uniparental disomy 2, 6, 14, 16, 20 and 22 as a major cause of intrauterine growth retardation. Clin Genet 58: 177-180. Krausz C, Rajpert-De Meyts E, Frydelund-Larsen L, Quintana-Murci L, McElreavey K and Skakkebaek NE (2001) Double-blind Y chromosome microdeletion analysis in men with known sperm parameters and reproductive hormone profiles: microdeletions are specific for spermatogenic failure. J Clin Endocrinol Metab 86: 2638-42. Krishnomoorthy A, Gowen LC, Boll KE, Knuppel RA and Sciorra L (1995) Chromosome and interphase analysis of placental mosaicism in intrauterine growth retardation. J Perinatol 15: 47-50. Kuchinka BD, Barrett IJ, Moya G, Sanchez JM, Langlois S, Yong SL, Dalousek DK and Robinson WP (2001) Two cases of confined placental mosaicism for chromosome 4, including one with maternal uniparental disomy. Prenat Diagn 21: 36-39. Lacroix MC, Guibourdenche J, Frendo JL, Muller F and Evain-Brion D (2002) Human placental growth hormone - a review. Placenta 23, Suppl A: S87-S94. 68 Lam R, Ma S, Robinson WP, Chan T and Yuen BH (2001) Cytogenetic investigation of fetuses and infants conceived through intracytoplasmic sperm injection. Fertil Steril. 76: 1272-1275. Lamb NE, Freeman SB, Savage-Austin A, Pettay D, Taft L, Hersey J, Gu Y, Shen J, Saker D, May KM, Avramopoulos D, Petersen MB, Hallberg A, Mikkelsen M, Hassold TJ abd Sherman SL (1996) Susceptible chiasmate configurations of chromosome 21 predispose to non-disjunction in both maternal meiosis I and meiosis II. Nat Genet 14: 400-405. Lancaster PA (1987) Congenital malformations after in-vitro fertilisation. Lancet. 2: 1392-1393. Leschot NJ, Schuring-Blom GH, Van Prooijen-Knegt AC, Verjaal M, Hansson K, Wolf H, Kanhai HH, Van Vugt JM and Christiaens GC (1996) The outcome of pregnancies with confined placental chromosome mosaicism in cytotrophoblast cells. Prenat Diagn 16: 705-712. Lestou VS and Kalousek DK (1998) Confined placental mosaicism and intrauterine fetal growth. Arch Dis Child Fetal Neonatal Ed 79, F223-F226. Lestou VS, Lomax BL, Barrett IJ and Kalousek DK (1999) Screening of human placentas for chromosomal mosaicism using comparative genomic hybridization. Teratology 59: 325-330. Lestou VS, Desilets V, Lomax BL, Wilson RD, Langlois S and Kalousek DK (2000) Comparative genomic hybridization: A new approach to screening for intrauterine complete or mosaic aneuploidy. Am J Med Genet 92: 281-284. Levron J, Aviram-Goldring A, Madgar I, Raviv G, Barkai G and Dor J (2001) Sperm chromosome abnormalities in men with severe male factor infertility who are undergoing in vitro fertilization with intracytoplasmic sperm injection. Fertil Steril 76: 479-484. Linnemann K, Malek A, Schneider H and Fusch C (2001) Physiological and pathological regulation of feto/placneto/maternal leptin expression. Biochem Soc Trans 29: 86-90. Liu J, Lissens W, Silber SJ, Devroey P, Liebaers I and Van Steirteghem A (1994) Birth after preimplantation diagnosis of the cystic fibrosis delta F508 mutation by polymerase chain reaction in human embryos resulting from intracytoplasmic sperm injection with epididymal sperm. JAMA 272: 1858-1860. Loft A, Petersen K, Erb K, Mikkelsen AL, Grinsted J, Hald F, Hindkjaer J, Nielsen KM, Lundstrom P, Gabrielsen A, Lenz S, Hornnes P, Ziebe S, Ejdrup HB, Lindhard A, Zhou Y and Andersen AN (1999) A Danish national cohort of 730 infants born after intracytoplasmic sperm injection. Hum Reprod 14: 2143-2148. Lomax BL, Lestou VS, Barrett IJ and Kalousek DK (1998) Confined placental mosaicism for chromosome 7 detected by comparative genomic hybridization. Prenat Diagn 18, 752-754. Ma S and Yuen BH (2001) Intracytoplasmic sperm injection could minimize the incidence of prematurely condensed human sperm chromosomes. Fertil Steril 75: 1095-1101. 69 Ma S, Robinson W, Lam R and Yuen BH (2001) Maternal origin of monosomy 21 derived from intracytoplasmic sperm injection. Hum Reprod 16,1100-1103 Magee BD (2004) Role of multiple births in very low birth weight and infant mortality. J Reprod Med 49: 812-816. Maher ER, Brueton LA, Bowdin SC, Luharia A, Cooper W, Cole TR, Macdonald F, Sampson JR, Barratt CL, Reik W and Hawkins MM (2003) Beckwith-Wiedemann syndrome and assisted reproduction technology (ART). J Med Genet 40: 62-64. Maimgren H, Sahlen S, Inzunza J, Aho M, Rosenlund B, Fridstrom M, Hovatta O, Ahrlund-Richter L, Nordenskjold M and Blennow E (2002) Single cell CGH analysis reveals a high degree of mosaicism in human embryos from patients with balanced structural chromosome aberrations. Mol Hum Reprod 8: 502-510. Mastuzaki H, Miura K, Yoshiura K, Yoshimura S, Niikawa N and Ishimaru T (2004) Detection of cell free placental DNA in maternal plasma: direct evidence from three cases of confined placental mosaicis. J Med Genet 41: 289-292. Mateizel I, Verheyen G, Van Assche E, Tournaye H, Liebaers I and Van Steirteghem A (2002) FISH analysis of chromosome X, Y and 18 abnormalities in testicular sperm from azoospermic patients. Hum Reprod 17: 2249-5227. McCallum TJ, Milunsky JM, Cunningham DL, Harris DH, Maher TA and Oates RD (2000) Fertility in men with cystic fibrosis: an update on current surgical practices and outcomes. Chest 118: 1059-1062. Min SJ, Luke B, Gillespie B, Min L, Newman RB, Mauldin JG, Witter FR, Salman FA and O'sullivan MJ (2000) Birth weight references for twins. Am J Obstet Gynecol 182: 1250-1257. Min SJ, Luke B, Min L, Misiunas R, Nugent C, Van de Ven C, Martin D, Gonzalez-Quintero VH, Eardley S, Witter FR, Mauldin JG and Newman RB (2004) Birth weight references for triplets. Am J Obstet Gynecol 191: 809-814. Moosani N, Chernos J, Lowry RB, Martin RH and Rademaker A (1999) A 47,XXY fetus resulting from ICSI in a man with an elevated frequency of 24,XY spermatozoa. Hum Reprod 14: 1137. Mulhall JP, Reijo R, Alagappan R, Brown L, Page D, Carson R and Oates RD (1997) Azoospermic men with deletion of the DAZ gene cluster are capable of completing spermatogenesis: fertilization, normal embryonic development and pregnancy occur when retrieved testicular spermatozoa are used for intracytoplasmic sperm injection. Hum Reprod 12: 503-508. Munne S, Weier HU, Grifo J and Cohen J (1994) Chromosome mosaicism in human embryos. Biol Reprod 51: 373-379. Munne S, Marquez C, Reing A, Garrisi J and Alikani M (1998) Chromosome abnormalities in embryos obtained after conventional in vitro fertilization and intracytoplasmic sperm injection. 70 Fertil Steril 69: 904-908. Myatt L, Brewer AS, Langdon G and Brockman DE (1993) Novel endothelial-derived factors in the human fetal-placental circulation. Trophoblast Res7:117-131. Nakamura Y, Takaira M, Etsuko S, Kawano K, Miyoshi O and Niikawa N (2003) A tetraploid liveborn neonate: cytogenetics and autopsy findings. Arch Pathol Lab Med 127: 1612-1614. Nicolaidis P and Petersen MB (1998) Origin and mechanisms of non-disjunction in human autosomal trisomies. Hum Reprod 13: 313-319. Noomen P, van den Berg C, de Ruyter JL, Van Opstal D and Los FJ (2001) Prevalence of tetraploid metaphases in semidirect and cultured chorionic villi. Fetal Diagn Ther 16: 129-132. Norwitz ER, Schust DJ and Fisher SJ (2001) Implantation and the survival of early pregnancy. N EngJ Med 345: 1400-1408. Okada H, Fujioka H, Tatsumi N, Kanzaki M, Okuda Y, Fujisawa M, Hazama M, Matsumoto O, Gohji K, Arakawa S and Kamidono S (1999) Klinefelter's syndrome in the male infertility clinic. Hum Reprod 14: 946-952. Owens JA, Kind KL and Robinson JS (1997) Oxygenation in utero: placental determinants and fetal requirements. In: Battaglia FC ed. Placental Function and Fetal Nutrition. Nestle Nutrition Workshop Series, Vol. 39. Philadelphia: Vevey/Lippincott-Raven Publishers, pp 123-138. Page DC, Silber S and Brown LG (1999) Men with infertility caused by AZFc deletion can produce sons by intracytoplasmic sperm injection, but are likely to transmit the deletion and infertility. Hum Reprod 14: 1722-1726. Palermo G, Joris H, Devroey P and Van Steirteghem AC (1992) Pregnancies after intracytoplasmic injection of single spermatozoon into an oocyte. Lancet 340: 17-18. Patrizio P, Asch RH, Handelin B and Silber SJ (1993) Aetiology of congenital absence of vas deferens: genetic study of three generations. Hum Reprod 8: 215-220. Ponjaert-Kristoffersen I, Tjus T, Nekkebroeck J, Squires J, Verte D, Heimann M, Bonduelle M, Palermo G and Wennerholm UB (2004) Psychological follow-up study of 5-year-old ICSI children. Hum Reprod 19: 2791-2797. Quinton PM (1983) Chloride impermeability in cystic fibrosis. Nature 3:421-422. Qumsiyeh, MB (1998) Chromosome abnormalities in the placenta and spontaneous abortions. J Mat Fet Med 7: 210-212. Rives N, Jarnot M, Mousset-Simeon N, Joly G and Mace B (2003) Fluorescence in situ hybridization (FISH) analysis of chromosome segregation and interchromosomal effect in spermatozoa of a reciprocal translocation t(9;10) (ql l;pl 1.1) carrier. J Hum Genet 48: 535-540. 71 Roberts E, Dunlop J, Davis GS, Churchill D and Davison EV (2003) A further case of confined placental mosaicism for trisomy 2 associated with adverse pregnancy outcome. Prenat Diagn 23: 564-565. Robinson WP, Barrett IJ, Bernard L, Telenius A, Bernasconi F, Wilson RD, Best RG, Howard-Peebles PN, Langlois S and Kalousek DK (1997) Meiotic origin of trisomy in confined placental mosaicism correlated with presence of fetal uniparental mosaicism, high levels of trisomy in trophoblast, and increased risk of fetal intrauterine growth restriction. Am J Hum Genet 60: 917-927. Roland B, Lynch L, Berkowitz G and Zinberg R (1994) CPM in CVS and pregnancy outcome. Prenat Diagn 14: 589-593. Rossant J and Cross JC (2001) Placental development: lessons from mouse mutants. Nat Genet Rev 2: 538-548. Rua S, Comino A, Fruttero A and Abrate M (1995)DNA flow cytometric analysis of abortions. A simple method for detection of triploidy and tetraploidy in the trophoblastic cells. Pathologica 87:107-111. Rubio C, Gil-Salom M, Simon C, Vidal F, Rodrigo L, Minguez Y, Remohi J and Pellicer A (2001) Incidence of sperm chromosomal abnormalities in a risk population: relationship with sperm quality and ICSI outcome. Hum Reprod 16: 2084-2092. Rurak DW (2001). Development and function of the placenta. In: Harding R and Bocking AD eds. Fetal Growth and development. Cambridge: Cambridge University Press, 17-43. Samli H, Solak M, Imirzalioglu N, Beyatli Y, Simsek S and Kahraman S (2003) Fetal chromosomal analysis of pregnancies following intracytoplasmic sperm injection with amniotic tissue culture. Prenat Diagn 23: 847-850. SART REGISTRY (2000) Assisted reproductive technology in the United States: 1997 results generated from the American Society for Reproductive Medicine/Society for Assisted Reproductive Technology Registry. Fertil Steril 74: 641-653. Schieve LA, Meikle SF, Ferre C, Peterson HB, Jeng G and Wilcox LS (2002) Low and very low birth weight in infants conceived with use of assisted reproductive technology. N Eng J Med 346, 731-737. Schlegel PN (2004) Causes of azoospermia and their management. Reprod Fertil Dev 16: 561-572. Schreurs A, Legius E, Meuleman C, Fryns JP and D'Hooghe TM (2000) Increased frequency of chromosomal abnormalities in female partners of couples undergoing in vitro fertilization or intracytoplasmic sperm injection. Fertil Steril 74: 94-96. Schubert R, Raff R and Schwanitz G (1996) Molecular-cytogenetic investigations of ten term placentae in cases of parentally diagnosed mosaicism. Prenat Diagn 16: 907-913. 72 Schuring-Blom GH, Keijzer M, Jakobs ME, Van den Brande DM, Visser HM, Wiegant J, Hoovers JM and Leschot NJ (1993) Molecular cytogenetic analysis of term placentae suspected of mosaicism using fluorescence in situ hybridization. Prenat Diagn 13: 671-679. Schwinger E, Seidl E, Klink F and Rehder H (1989) Chromosome mosaicism of the placenta - a cause of developmental failure of the fetus? Prenat Diagn 9: 639-647. Sertic J, Cvitkovic P, Myers A, Saiki RK and Stavljenic Rukavina A (2001) Genetic markers of male infertility: Y chromosome microdeletions and cystic fibrosis transmembrane conductance gene mutations. Croat Med J 42: 416-420. Shaffer LG, Langlois S, McMaskill C, Main DM, Robinson WP, Barrett IJ and Kalousek DK (1996) Analysis of nine pregnancies with confined placentas mosaicism for trisomy 2. Prenat Diagn 16: 899-905. Shi Q and Martin RH (2001) Aneuploidy in human spermatozoa: FISH analysis in men with constitutional chromosomal abnormalities, and in infertile men. Reproduction 121: 655-666. Simpson JL and Lamb DJ (2001) Genetic effects of intracytoplasmic sperm injection. Semin Reprod Med 19: 239-249. Silber SJ, Nagy Z, Liu J, Tournaye H, Lissens W, Ferec C, Liebaers I, Devroey P and Van Steirteghem AC (1995) The use of epididymal and testicular spermatozoa for intracytoplasmic sperm injection: the genetic implications for male infertility. Hum Reprod 10: 2031-2043. Silber SJ, van Steirteghem A, Nagy Z, Liu J, Tournaye H and Devroey P (1996) Normal pregnancies resulting from testicular sperm extraction and intracytoplasmic sperm injection for azoospermia due to maturation arrest. Fertil Steril 66: 110-117. Silber SJ, Nagy Z, Devroey P, Tournaye H and Van Steirteghem AC (1997) Distribution of spermatogenesis in the testicles of azoospermic men: the presence or absence of spermatids in the testes of men with germinal failure. Hum Reprod 12: 2422-2428. Silber SJ, Alagappan R, Brown LG and Page DC (1998) Y chromosome deletions in azoospermic and severely oligozoospermic men undergoing intracytoplasmic sperm injection after testicular sperm extraction. Hum Reprod 13: 3332-3337. Silber S, Escudero T, Lenahan K, Abdelhadi I, Kilani A and Munne S (2003) Chromosomal abnormalities in embryos derived from testicular sperm extraction. Fertil Steril 79: 30-38. Simoni G and Sirchia SM (1994) Confined placental mosaicism. Prenat Diagn 14: 1185-1189. Sirchia SM, Garagiloa I, Colucci G, Guerneri S, Lalatta F, Grimoldi MG and Simoni G (1998) Trisomic zygote rescue revealed by DNA polymorphism analysis in confined placental mosaicism. Prenat Diagn 18, 201-206. Stipoljev F, Latin V, Kos M, Kiskovic B and Kurjak A (2001) Correlation of confined placental mosaicism with fetal intrauterine growth retardation. A case control study of placentas at delivery. Fetal Diagn Ther 16: 4-9. 73 Sutcliffe AG, Saunders K, McLachlan R, Taylor B, Edwards P, Grudzinskas G, Leiberman B and Thorton S (2003) A retrospective case-control study of developmental and other outcomes in a cohort of Australian children conceived by intracytoplasmic sperm injection compared with a similar group in the United Kingdom. Fertil Steril 79: 512-516. Tang SS, Gao H, Robinson WP, Ho Yuen B and Ma S (2004) An association between sex chromosomal aneuploidy in sperm and an abortus with 45,X of paternal origin: possible transmission of chromosomal abnormalities through ICSI. Hum Reprod 19:147-151. Tarrade A, Kuen RL, Malassine A, Tricottet V, Blain P, Vidaud M and Evain-Brion D (2001) Characterization of human villous and extravillous trophoblasts isolated from first trimester placenta. Lab Invest 81: 1199-1211. Thomas NS, Collins AR, Hassold TJ and Jacobs PA (2000) A reinvestigation of non-disjunction resulting in 47, XXY males of paternal origin. Eur J Hum Genet 8: 805-808. Tournaye H, Devroey P, Liu J, Nagy Z, Lissens W and Van Steirteghem A (1994) Microsurgical epididymal sperm aspiration and intracytoplasmic sperm injection: a new effective approach to infertility as a result of congenital bilateral absence of the vas deferens. Fertil Steril 61: 1045-1051. Trussler JL, Pickering S J and Ogilvie CM (2004)Investigation of chromosomal imbalance in human embryos using comparative genomic hybridization. Reprod Biomed Online 8: 701-711. Van Assche E, Bonduelle M, Tournaye H, Joris H, Verheyen G, Devroey P, Van Steirteghem A and Liebaers I (1996) Cytogenetics of infertile men. Hum Reprod Suppl 4:1-24. Van der Ven K, Messer L, van der Ven H, Jeyendran RS and Ober C (1996) Cystic fibrosis mutation screening in healthy men with reduced sperm quality. Hum Reprod 11:513-517. Van Der Westerlaken LA, Helmerhorst FM, Hermans J and Naaktgeboren N (1999) Intracytoplasmic sperm injection: position of the polar body affects pregnancy rate. Hum Reprod 14: 2565-2569. Van der Westerlaken L, Verburg H, Naaktgeboren N, Breuning M and Helmerhorst F (2001) Invasive prenatal diagnosis after intracytoplasmic sperm injection. Fertil Steril 75: 1240-1241. Van Opstal D, Los FJ, Ramlakhan S, Van Hemel JO, Van Den Ouweland AMW, Brandengurg H, Pieters MHCE, Verhoeff A, Vermeer MCS, Dhont M and In't Veld PA (1997) Determination of the parent of origin in nine cases of prenatally detected chromosome aberrations found after intracytoplasmic sperm injection. Hum Reprod 12: 682-686. Van Ospal D, Van Den Berg C, Deelen WH, Brandenburg H, Cohen-Overbeek TE, Halley DJJ, Van Den Ouweland AMW, In 'T Veld PA and Los FJ (1998) Prospective prenatal investigations on potential uniparental disomy in cases of confined placental trisomy. Prenat Diagn 18: 35-44. Van Steirteghem A, Bonduelle M, Devroey P and Liebaers I (2002) Follow-up of children born after ICSI. Hum Reprod Update 8:111-116. 74 Vernaeve V, Bonduelle M, Tournaye H, Camus M, Van Steirteghem A an Devroey P (2003) Pregnancy outcome and neonatal data of children born after ICSI using testicular sperm in obstructive and non-obstructive azoospermia. Hum Reprod 18: 2093-2097. Verp MS and Unger NL (1990) Chorionic chromosome abnormalities and intrauterine growth retardation. J Perinatol 10: 52-54. Vogt PH (2004) Molecular genetic of human male infertility: from genes to new therapeutic perspectives. Curr Pharm Des 10: 471-500. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farah S, Ramos C, Hartmann M, Hartschuh W, Meschede D, Behre HM, Castel A, Nieschlag E, Weidner W, Grone HJ, Jung A, Engel W and Haidl G (1996) Human Y chromosome azoospermia factor (AZF) mapped to different subregions in Yql 1. Hum Mol Genet 5: 933-943. Von Wolfe M, Ursel S, Hahn U, Steldinger R and Strowitzki T (2003) Glucose transporter proteins (GLUT) in human endometrium: expression, regulation and function throughout the menstrual cycle and in early pregnancy. J Clin Endocrinol Metab 88: 3885-3892. Voullaire L, Slater H, Williamson R and Wilton L (2000) Chromosome analysis of blastomeres from human embryos by using comparative genomic hybridization. Hum Genet 106: 210-207. Wells D and Delhanty JD (2000) Comprehensive chromosomal analysis of human preimplantation embryos using whole genome amplification and single cell comparative genomic hybridization. Mol Hum Reprod 6: 1055-1062. Wennerholm UB, Bergh C, Hamberger L, Westlander G, Wikland M and Wood M (2000a) Obstetric outcome of pregnancies following ICSI, classified according to sperm origin and quality. Hum Reprod 15: 1189-1194. Wennerholm UB, Bergh C, Hamberger L, Lundin K, Nilsson L, Wikland M and Kallen B (2000b) Incidence of congenital malformations in children born after ICSI. Hum Reprod 15: 944-948. Wilkins-Haug L, Roberts DJ and Morton CC (1995) Confined placental mosaicism and intrauterine growth retardation: A case-control analysis of placentas at delivery. Am J Obstet Gynecol 172: 44-50. Winkel CA, Snyder JM, MacDonald PC (1980) Regulation of cholesterol and progesterone synthesis in human placental cells in culture by serum lipoprotein receptor function. Endocrinology 106: 1054-1050. Wolstenholme J, Rooney DE and Davison EV (1994) Confined placental mosaicism, IUGR, and adverse pregnancy outcome: a controlled retrospective UK collaborative survey. Prenat Diagn 14:345-361. 75 Wolstenholme J (1996) Confined placental mosaicism for trisomies 2, 3, 7, 9,16, and 22: their incidence, likely origins, and mechanisms for cell lineage compartmentalization. Prenat Diagn 16: 511-524. Wolstenholme J, White I, Sturgiss S, Carter J, Plant N and Goodship JA (2001) Maternal uniparental heterodisomy for chromosome 2: detection through 'atypical' maternal AFP/hCG levels, with an update on previous cases. Prenat Diagn 21:813-817. WHO (World Health Organization) (1992) Laboratory manual for the examination of human semen and sperm-cervical mucus interactions, 3 ed. Cambridge: Cambridge University Press. 76 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091980/manifest

Comment

Related Items