Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on ovarian GnRH-R and GnRH mRNA, and the direct effects of GnRH on ovarian function in the bovine Ramakrishnappa, Nagaraja 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-902544.pdf [ 12.66MB ]
Metadata
JSON: 831-1.0091864.json
JSON-LD: 831-1.0091864-ld.json
RDF/XML (Pretty): 831-1.0091864-rdf.xml
RDF/JSON: 831-1.0091864-rdf.json
Turtle: 831-1.0091864-turtle.txt
N-Triples: 831-1.0091864-rdf-ntriples.txt
Original Record: 831-1.0091864-source.json
Full Text
831-1.0091864-fulltext.txt
Citation
831-1.0091864.ris

Full Text

STUDIES ON OVARIAN GnRH-R AND GnRH mRNA, AND THE DIRECT EFFECTS OF GnRH ON OVARIAN FUNCTION IN THE BOVINE b y Nagaraja Ramakrishnappa B . V . Sc . , U n i v o f A g r i c u l t u r a l Sciences, Bangalore , India , 1992 M . V . Sc . , (Surgery & R a d i o l o g y ) , U n i v o f A g r i c u l t u r a l Sciences , Bangalore , India , 1994 A T H E S I S S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y i n T H E F A C U L T Y O F G R A D U A T E S T U D I E S ( A n i m a l Science) W e accept this thesis as confo rming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA A p r i l 2004 © Nagaraja Ramakr ishnappa , 2004 ABSTRACT In the bov ine species, available informat ion f rom a l im i t ed number o f studies has resulted i n contradict ing opinions w i t h respect to the intra-ovarian presence o f G n R H - G n R H receptor system or direct effects o f G n R H o n ovar ian function. Therefore, experiments were carr ied out to examine: i f G n R H - R and G n R H m R N A are expressed i n bov ine ovary; the direct effects o f a G n R H agonist (buserelin) on steroid hormone secretion f rom granulosa ce l ls , luteal cel ls and luteal tissues; the effects o f buserel in o n m R N A expression for steroidogenic enzymes ( S t A R protein, P450scc , 3(3-HSD) and the apoptotic genes ( B c l 2 , B a x ) , and; the effects o f post-breeding G n R H administrat ion o n corpus lu teum ( C L ) function and pregnancy outcome i n H o l s t e i n cows. Resul ts f rom present study revealed G n R H - R m R N A expression i n granulosa cel ls o f sma l l , m e d i u m , and large fo l l ic les as w e l l as i n the C L . The sequence analysis o f R T - P C R -ampl i f i ed products f rom granulosa cells and C L tissues revealed a complete h o m o l o g y to that o f bov ine pi tui tary G n R H receptor c D N A sequence. R T - P C R studies also revealed the poss ible evidence for presence o f G n R H m R N A expression i n granulosa cel ls f rom different s ize fo l l ic les . Buse re l i n e l ic i ted a dose-dependent biphasic response o n E 2 product ion f rom granulosa cel ls . A s imi la r trend i n P 4 secretion from luteal cel ls and luteal tissues was observed f o l l o w i n g buserel in treatment. G n R H antagonist alone (P = 0.07) or i n combina t ion w i t h busere l in resulted i n a significant (P = 0.004) s t imulatory responses o n P 4 output from C L tissues. In terms o f luteal steroidogenic machinery, G n R H - a treatment o f luteal tissues showed a m i l d (nonsignificant) s t imulatory response o n m R N A levels for S t A R protein and ii P450scc m R N A although; tendency for s ignif icance (P = 0.12) c o u l d be seen o n l y i n the case o f 3P-HSD. Buse re l i n treatment d i d not affect m R N A levels o f B a x and B c l 2 i n C L tissues. In response to post-breeding G n R H administrat ion, despite the slight (P > 0.05) e levat ion i n P 4 levels , no improvement i n pregnancy rates was observed. In conc lus ion , the present findings reveal evidence for the presence o f G n R H - r e c e p t o r m R N A expression i n bov ine ovar ian fo l l ic les and C L . Buse r e l i n ( G n R H - a ) caused a dose dependent b iphas ic response o n steroid output f rom bovine granulosa ce l ls , luteal cel ls and luteal tissue. H o w e v e r , the m R N A levels o f S t A R protein, P450scc , and 3P-HSD observed f o l l o w i n g busere l in treatment do not p rov ide the defini t ive evidence for the direct interact ion o f G n R H w i t h its receptor i n the above c e l l types and tissue. Post-breeding G n R H adminis t ra t ion d i d not result i n improved C L function or pregnancy outcome i n d ia ry cattle. iii T A B L E O F C O N T E N T S A B S T R A C T i i T A B L E O F C O N T E N T S i v L I S T O F F I G U R E S i x L I S T O F T A B L E S x i L I S T O F A B B R E V I A T I O N S x i i A C K N O W L E D G M E N T S x i v C H A P T E R 1 1 G E N E R A L I N T R O D U C T I O N A N D R E V I E W L I T E R A T U R E 1.1. G E N E R A L I N T R O D U C T I O N 1 1.2. R E V I E W L I T E R A T U R E 3 P A R T I 1.2.1. G n R H and its types 3 1.2.2. G n R H agonists 4 1.2.3. G n R H receptor and its types 5 1.2.4. M o d e o f G n R H and G n R H - R interactions i n the pi tui tary 6 1.2.5. Ext ra-hypotha lamic G n R H and G n R H - R system i n reproductive tissues 7 1.2.6. M o d e o f G n R H and G n R H - R interaction i n reproductive tissues 9 1.2.7. Di rec t effects o f G n R H and programmed c e l l death i n the ovary 14 1.2.8. G n R H and reproductive tissue tumors 15 P A R T II 1.2.9. Ova r i an fo l l icu la r and C L dynamics i n the bov ine species 20 1.2.10. O v a r i a n steroidogenesis 22 1.2.11. App l i ca t i ons o f G n R H and G n R H analogues i n bov ine reproduct ion 28 1.2.12. Neuroendocr ine response to G n R H analogues i n cattle 28 1.2.13. G o n a d a l response to G n R H analogues i n cattle 31 1.2.14. Effects o f G n R H - a o n preovulatory fo l l i c l e development and C L funct ion 33 1.2.15. Effects o f G n R H analogues o n pregnancy outcome i n cattle 35 1.3. R A T I O N A L E F O R T H E S T U D Y 38 1.4. H Y P O T H E S I S 39 1.5. O B J E C T I V E S 40 R E F E R E N C E S 41 iv CHAPTER 2 62 GnRH-R AND GnRH mRNA EXPRESSION IN THE BOVINE OVARY 2.1. A B S T R A C T 62 2.2. I N T R O D U C T I O N 63 2.3. M A T E R I A L S A N D M E T H O D S 65 2.3 .1 . C o l l e c t i o n o f bovine ovaries and class i f icat ion o f fo l l ic les and C L 65 2.3.2. A s p i r a t i o n o f fol l ic les and granulosa c e l l processing 65 2.3.3. Process ing o f C L tissues 66 2.3.4. C o l l e c t i o n and processing o f bovine pi tui tary and hypothalamus tissues 67 2.3.5. To ta l R N A and m R N A isola t ion from granulosa ce l ls , C L , pi tui tary, and hypothalamus tissues 67 2.3.6. Detec t ion o f G n R H - R m R N A i n granulosa cel ls and C L tissue 69 2.3.6.1. Reverse Transcr ipt ion-Polymerase C h a i n Reac t ion ( R T - P C R ) 69 2.3.6.2. Southern transfer o f P C R products 70 2.3.6.3. Preparat ion o f chemiluminescent probe and hybr id iza t ion 71 2.3.6.4. Sequence analysis o f P C R ampl icons ( G n R H - R ) 73 2.3.6.5. Nes ted P C R ampl i f ica t ion o f G n R H - R sequence and nucleot ide analysis 73 2.3.7. Detec t ion o f G n R H m R N A i n granulosa cel ls 74 2.3.7.1. Se lec t ion o f degenerate G n R H primers 2.3.7.2. Sequence analysis o f P C R ampl icons ( G n R H ) 76 2.4. R E S U L T S 77 2.4 .1 . G n R H - R m R N A Expres s ion i n bovine granulosa cel ls and luteal tissue 77 2.4.2. G n R H m R N A Express ion i n bovine granulosa cel ls 78 2.5. D I S C U S S I O N 78 2.6. C O N C L U S I O N 81 R E F E R E N C E S 87 CHAPTER 3 90 DIRECT EFFECTS OF GnRH-a ON J« Vitro STEROID HORMONE PRODUCTION IN BOVINE GRANULOSA CELLS AND CORPUS LUTEUM 3.1. A B S T R A C T 90 3.2. I N T R O D U C T I O N 92 3.3. M A T E R I A L S A N D M E T H O D S 93 3.3.1. C e l l culture reagents and related materials 93 3.3.2. D i rec t effect o f G n R H - a o n in vitro E 2 and P 4 synthesis o f bov ine granulosa cel ls 94 3.3.2.1. C o l l e c t i o n o f bovine ovaries and laboratory process ing 94 3.3.2.2. Isolat ion o f granulosa cel ls and in vitro culture condi t ions 94 3.3.2.3. E x a m i n a t i o n o f granulosa c e l l v i a b i l i t y and c e l l count ing 95 3.3.2.4. G n R H - a treatment o f granulosa cel ls dur ing in vitro culture 96 3.3.3. D i rec t effect o f G n R H - a o n in vitro P 4 synthesis o f bov ine C L 97 3.3.3.1. Isolat ion o f luteal cel ls and in vitro culture condi t ions 97 3.3.3.2. E x a m i n a t i o n o f luteal c e l l v i ab i l i t y and c e l l count ing 98 3.3.3.3. G n R H - a treatment o f dispersed luteal cel ls 99 3.3.3.4. Preparat ion o f m i n c e d luteal tissue and in vitro culture condi t ions 100 3.3.3.5. Effect o f L H o n in vitro P 4 synthesis i n luteal tissue 100 3.3.3.6. Effect o f G n R H - a o n in vitro P 4 synthesis i n luteal tissue 101 3.3.3.7. Effect o f G n R H - a o n in vitro P 4 synthesis i n luteal tissue, i n presence o f L H or P G F 2 a 101 3.3.4. S teroid hormone assay 102 3.3.5. D a t a analysis 103 3.4. R E S U L T S 103 3.4.1. Effect o f G n R H - a o n in vitro E 2 and P 4 synthesis i n granulosa ce l l s 103 3.4.2. Effect o f G n R H - a on in vitro P 4 synthesis i n bov ine luteal cel ls and luteal tissue 104 3.4.2.1. Effect G n R H - a o n in vitro P 4 synthesis i n luteal cel ls 104 3.4.2.2. L H response o n in vitro P 4 synthesis i n luteal tissue 104 3.4.2.3. Effect o f G n R H - a o n in vitro P 4 synthesis i n luteal tissue 104 3.4.2.4. Effect o f G n R H - a o n in vitro P 4 synthesis i n luteal tissue, i n presence o f L H or P G F 2 a 105 3.5. D I S C U S S I O N 105 3.6. C O N C L U S I O N 111 R E F E R E N C E S 119 C H A P T E R 4 124 E F F E C T S O F GnRH-a O N StAR P R O T E I N , P450scc, 3p-HSD, Bcl2 A N D Bax m R N A E X P R E S S I O N IN B O V I N E C O R P U S L U T E U M . 4 .1 . A B S T R A C T 124 4.2. I N T R O D U C T I O N 125 4.3. M A T E R I A L S A N D M E T H O D S 127 4.3 .1 . Preparat ion o f m i n c e d C L tissue and in vitro culture condi t ions 127 4.3.2. G n R H - a treatment o f luteal tissue 128 4.3.3. T o t a l R N A isola t ion f rom G n R H - a treated luteal tissue 129 4.3.4. Semi-quanti tat ive reverse Transcr ip t ion Polymerase C h a i n Reac t ion 130 4.3.5. D a t a analysis 132 vi 4.4. R E S U L T S 132 4.4 .1 . V a l i d a t i o n o f semi-quantitative R T - P C R 132 4.4.2. Effect o f G n R H - a o n S t A R protein, P450scc , 3 p - H S D , B c l 2 and B a x m R N A levels i n the bov ine C L 133 4.5. D I S C U S S I O N 133 4.6. C O N C L U S I O N 139 R E F E R E N C E S 148 C H A P T E R 5 153 I N F L U E N C E O F P O S T - B R E E D I N G G n R H A D M I N I S T R A T I O N O N C O R P U S L U T E U M F U N C T I O N A N D P R E G N A N C Y IN D A I R Y C A T T L E 5.1. A B S T R A C T 153 5.2. I N T R O D U C T I O N 154 5.3. M A T E R I A L S A N D M E T H O D S 157 5.3.1. A n i m a l s and treatments 157 5.3.2. M i l k and b l o o d sample co l lec t ion for P 4 measurement 158 5.3.3. Rad io immunoassay for P 4 measurement 158 5.3.4. Reproduc t ive status o f the animals based o n P 4 concentrat ion 159 5.3.5. Pregnancy diagnosis 159 5.3.6. D a t a analysis 160 5.4. R E S U L T S 161 5.4.1. Corpus lu teum function and presumptive pregnancy rates 161 5.4.2. O v e r a l l pregnancy rates on day 35 p o s t - A I 162 5.4.3. E m b r y o n i c mor ta l i ty or pregnancy loss 162 5.5. D I S C U S S I O N 163 5.6. C O N C L U S I O N 167 R E F E R E N C E S 174 vii C H A P T E R 6 178 G E N E R A L D I S C U S S I O N A N D C O N C L U S I O N S 6.1. G E N E R A L D I S C U S S I O N 178 6.2. G E N E R A L C O N C L U S I O N 190 R E F E R E N C E S 192 viii LIST OF FIGURES 1.1. Ext ra -hypotha lamic G n R H and its possible target sites i n different tissues. 18 1.2. Hypo the t i ca l m o d e l o f G n R H involvement i n s t imulat ion or suppression o f mul t ip l e s ignal ing pathways i n associations w i t h var ious endocrine factors i n the 19 ovary. 1.3. D iag rammat i c i l lustrat ion o f the two-ce l l - two-hormone theory. 25 1.4. F o l l i c u l a r biosynthesis o f estradiol-17p\ The k e y steps i n v o l v e d i n fo l l i cu la r s teroidogenic pathways and their respective enzymes are il lustrated. 26 1.5. Schemat ic representation o f intracellular events occurs dur ing progesterone biosynthesis i n C L . 27 2 .1 . R T - P C R detection o f G n R H - R m R N A i n bov ine granulosa cel ls and C L tissues. 82 2.2. E th id ium-b romide stained agarose gel showing the expected s ized nested P C R fragments ( G n R H - R ) . 83 2.3. B o v i n e granulosa c e l l and luteal tissue G n R H - R c D N A (partial) sequence and its h o m o l o g y to bov ine pi tui tary G n R H - R c D N A sequence. 84 2.4. Representative autoradiogram (upper panel) and corresponding photograph o f e th id ium bromide stained agarose gel ( lower panel) showing G n R H m R N A transcripts f rom different stage fo l l icu lar granulosa cel ls . 85 3.1. Effect o f G n R H - a o n in vitro synthesis o f estradiol-17p (E2) and progesterone (P4) i n bov ine granulosa cel ls f rom m e d i u m fol l ic les ( M F ) . 112 3-2. Effect o f G n R H - a o n in vitro synthesis o f estradiol-17p (E2) and progesterone (P4) i n bov ine granulosa cel ls f rom large fol l ic les ( L F ) . 113 3-3- Effect o f G n R H - a i n presence or absence G n R H antagonist o n in vitro estradiol-17p (E2) and progesterone (P4) synthesis i n bovine granulosa cel ls f rom large fo l l ic les ( L F ) . 1 1 4 3 •4- Effect o f G n R H - a o n in vitro P 4 synthesis from bov ine luteal cel ls . ^ ^ 3-5- L H dose response o n in vitro progesterone (P4) synthesis i n luteal tissue. 116 3-6- Effect o f G n R H - a o n progesterone (P4) synthesis i n bov ine luteal tissue. ^ IX 3.7. Effect o f G n R H - a i n combinat ions o f L H and P G F 2 o c on progesterone (P4) synthesis i n bov ine luteal tissue. 118 4 .1 . Character iza t ion o f semi-quantitative R T - P C R for G 3 P D H , S t A R protein, and P450scc m R N A transcripts from bovine luteal tissue. 140 4.2. Character iza t ion o f semi-quantitative R T - P C R for G 3 P D H and 3 0 - H S D m R N A transcripts from bov ine luteal tissue. 141 4.3. Character iza t ion o f semi-quantitative R T - P C R for G 3 P D H , B c l 2 , and B a x m R N A transcripts from bov ine luteal tissue. 142 4.4. Effect o f G n R H - a o n S t A R protein m R N A levels i n bov ine luteal tissue. 143 4.5. Effect o f G n R H - a o n P450scc m R N A levels i n luteal tissue. 144 4 - 6 - Effect o f G n R H - a on 3 p - H S D m R N A levels i n luteal tissue. 145 4- 7. Effect o f G n R H - a o n B c l 2 and B a x m R N A levels i n bov ine luteal tissue. 146 5 • 1. Expe r imen ta l p ro tocol for post-breeding G n R H administrat ion. 168 5- 2. Post-breeding mean progesterone (P4) levels i n different treatments groups. 169 5-3. Presumpt ive pregnancy rates i n lactating dai ry cows and heifers subjected to different treatments. 170 5-4. O v e r a l l pregnancy rates i n lactating dai ry cows and da i ry heifers based the scanning results o n day 35 pos t -AI . 171 X L I S T O F T A B L E S 2.1. Ol igonuc le t ide p r imer pair and their respective P C R ampl icons for G n R H - R , G n R H and G 3 P D H m R N A transcripts f rom bovine ovary. 86 4 .1 . Ol igonuc le t ide p r imer pai r and their respective P C R ampl icons for S t A R protein, P450scc , 3 p - H S D , B a x , B c l 2 and G 3 P D H m R N A transcripts f rom bov ine luteal tissue. 147 5.1. Post-breeding experimental treatments and number o f animals per treatment group. 172 5.2. N u m b e r o f animals inc luded i n P 4 analysis, number o f animals that were i n estrus based o n P 4 <1 n g / m L o n the day o f A I , and ovu la t ion rates based o n P 4 >1 n g / m L o n day 7 pos t -AI , i n each treatment group are l isted. 172 5.3. Presumpt ive pregnancy rates ( P R ) and embryonic losses i n cows and heifers subj ected to different treatments. 173 xi L I S T O F A B B R E V I A T I O N S ° c degrees Ce l s ius mic rog ram u l micro l i t re urn micrometer 3 p - H S D 3P-hydroxy steroid dehydrogenase A l A r t i f i c i a l inseminat ion B S A bov ine serum albumen c A M P c y c l i c adenosine monophosphate C E cholesterol esterase C L corpus lu teum D A G 1 ,2 -d i acy lg lyce ro l D F dominant fo l l i c l e D M S O dimethyle sulfoxide D N A deoxyr ibonuc le ic ac id E 2 estradiol-17P F S H fo l l i c l e s t imulat ing hormone g g ram G gravi ty G 3 P D H glycelora ldehyde 3-phosphate dehydrogenase G A P G n R H - a s s o c i a t e d peptide G D P guanosine diphosphate G n R H gonadotropin releasing hormone G n R H - a G n R H - a g o n i s t G n R H - I , II, III gonadotropin releasing hormone type I, II, III G n R H - R gonadotropin releasing hormone receptor G T P guanosine triphosphate h hour(s) h C G human chor ion ic gonadotropin H D L high-densi ty l ipoprote in H D I b p high-densi ty l ipoprote in b i n d i n g protein H P O hypothalamo-pi tui tary-ovar ian axis I M intramuscular I N F - t interferon tau IPs inositol-1,4,5-triphosphate L D ladder (molecular) L D L low-dens i ty l ipoprote in L D L r low-dens i ty l ipoprote in receptor L F large fo l l i c l e L H lu te in iz ing hormone L H R H lu te in iz ing hormone-releasing hormone M F m e d i u m fo l l i c l e m g m i l l i g r a m M g + 2 magnes ium xii M G A melengestrol acetate m L m i l l i l i t r e m m mi l l ime te r m R N A messenger r ibonucle ic ac id n sample size or an imal numbers n g nanogram(s) P 4 progesterone P450scc cytochrome P 4 5 0 side cha in cleavage enzyme P B S phosphate buffered saline P G E 2 prostaglandin E 2 P G F 2 a prostaglandin F 2 a P G H S - 2 prostaglandin G / H synthase PIPz phosphat idyl inos i to l 4,5-bisphosphate P K A protein kinase A P K C protein kinase C P R pregnancy rate(s) - R sample wi thout reverse transcriptase enzyme R T - P C R Reverse Transcr ipt ion-Polymerase C h a i n Reac t ion s second(s) S E M standard error o f the mean S E R smooth endoplasmic re t icu lum S F sma l l fo l l i c l e S L C sma l l luteal cel ls S S C standard S o d i u m Citrate S t A R steroidogenic acute regulatory protein - T sample wi thout template U T R untranslated region. xiii ACKNOWLEDGEMENTS In the game of 'race against the clocks in which one almost inevitably becomes enmeshed with •preparatory steps, in my case my thesis project, it is a true relief to 6e blessed with a true support and encouragement from people who show sympathy and who continue to Believe in what you are doing. The main credit for such support should undoubtedly go to (Prof. (R. (Rajamahendran, my thesis supervisor, whose inspiring interest and ceaseless enthusiasm for the topic explored in this thesis has meant a great deal to my learning experience. I would like to register my sincere thanks to my supervisory committee members, (Prof. (P. C % Leung, (Dept. of Obstetrics and gynaecology, and (Prof. %M. Cheng, faculty of Agricultural Sciences, for their invaluable time spent on in-depth analysis of my research proposal and timely suggestions during the entire course this thesis project. Thanks are also due to (Prof. H. van Vuuren, faculty of Agricultural Sciences, for allowing me in utilizing their molecular biology lab facilities during the early days of my research experiments. I graciously acknowledge the financial assistance from Canadian Commonwealth Scholarship; (Elizabeth (R^Howland(Fellowship, the Guy Fowler Memorial Fund, and NS(E(R£ funding. Thanks are also due to the Government of India for recognizing my candidature to the award of Canadian Commonwealth Scholarship. My deepest appreciation should go to (Dr. 67. Cjiritharan, who has been a good friend. I highly thank^him forhis help with data analysis and exchange of many research ideas. I also would like to thanks my colleagues at the present lab; QDrs. M. Aali, and A- (Balendran, for their help and cooperation during the course my stay in this lab. My thanks are also due to (Dr. Jayagopalareddy, <Dr. g. tNayakj (Dr. <P. Madan, and theirrespective families for allthe help and suggestions during our (family) very early days in Canada. I deeply appreciate the untiring support and assistance from Ms. Sylvia Leung, who has been very kind person and resourceful with lab related matters including timely procurement of research materials. I also would like to thankjest of the faculty staff for their cooperation and assistance during the course of my stay in this faculty. I would like to register my deepest gratitude and sincere thanks to (Prof. <P. % (Basrur, "University (Professor (Emeritus (Vniv of (juelph), for her invaluable guidance, encouragement, and moral support at times when I needed the most. I sincerely thank^(Prof. S.M. Jayadevappa, (Prof. <D. !Nuthan, (Prof. Vj.A-%ing, and Dr. !K. 'Kochhar, for all the support and formative influence on my academic career. My sincere thanks are due to my wife, Sreelata, for relieving me from family duties and taking care of our kids, (Ranesh and Mdhishri, during the years I have been immersed in my graduate program at 1)(BC Finally, I would like to see this thesis as a modest tribute to all the people that have had a formative influence on me over the years: my parents, Mr. G.% (Ramakrishnappa and Mrs. Chennamma (Ramakrishnappa, my Brothers andsisters, grandparents, family friends andwell-wishers. xiv C H A P T E R 1 G E N E R A L I N T R O D U C T I O N A N D L I T E R A T U R E R E V I E W 1.1. I N T R O D U C T I O N Gonadot rop in releasing hormone ( G n R H ) , also k n o w n as lu te in iz ing hormone releasing hormone ( L H R H ) , is a v i t a l requirement for the state o f homeostasis o f reproduct ive processes. G n R H is a neuronal secreting decapeptide, p r i n c i p a l l y p roduced b y neuronal cel ls i n the med ia l basal hypothalamus ( M B H ) , and released i n a pulsat i le manner into the hypophys i a l portal c i rcula t ion. U p o n b ind ing to its receptors o n pi tui tary gonadotropes, G n R H initiates a series o f phys io log i ca l events leading to the synthesis and release o f gonadotropins, lu te in iz ing hormone ( L H ) and fo l l ic le -s t imula t ing hormone ( F S H ) . In a h i g h l y coordinated fashion, both the L H and F S H i n turn cont ro l the processes o f gametogenesis and steroidogenesis ( C o n n and C r o w l e y , 1994; S to j i l kov i c and Catt, 1995). In addi t ion, it is be l i eved that G n R H m a y have a role as a modula tor o f the ac t iv i ty o f diverse systems i n the bra in and many peripheral organs (Hsueh and Jones, 1981; H s u e h et a l . , 1981; E m o n s and Scha l ly , 1994). Several reports suggest that there is also an extra-hypothalamic o r i g i n o f G n R H , as w e l l as the extra-pituitary presence o f G n R H receptors ( G n R H - R ) across different types o f tissues i n the b o d y ( F i g . 1.1). W i t h respect to the reproductive system, several reports reveal evidence for the presence o f G n R H and G n R H - R systems i n different organs such as the ovary , oviduct , endometr ium, placenta, and testes, across different species o f animals , i n c l u d i n g humans 1 ( R e v i e w e d b y Janssens et a l . , 2000). F r o m both in vivo and in vitro m o d e l studies i n rodents, primates and humans, it is becoming increas ingly evident that G n R H or its synthetic analogues, c o u l d exert direct effect (s) through an autocrine or paracrine manner, e l i c i t ing a var ie ty o f responses depending o n the type o f target tissue and phys io log i ca l condi t ions ( R e v i e w e d b y Janssens et a l . , 2000; Steele and L e u n g , 2003). Thus , i n recent years the extra-pi tui tary roles o f G n R H have attracted special interests i n the f ie ld o f reproductive b i o l o g y and c l i n i c a l reproductive medic ine . H o w e v e r , there is an apparent pauci ty o f such in format ion w i t h regard to the bov ine species. Despi te the wea l th o f accumulated informat ion o n mul t i func t iona l roles o f G n R H and its applications i n bov ine reproduct ive management, substantial va r i ab i l i ty exists i n terms o f reproductive responses f o l l o w i n g adminis t ra t ion o f G n R H or its super-agonist analogues. Hypothe t ica l ly , the broader percept ion is that these variat ions c o u l d , i n part, be due to the direct effects o f G n R H o n reproductive tissues (Hsueh and Jones, 1982; Jones and Hsueh , 1982; G i l l i a n et a l . , 1981; D ' O c c h i o and A s p d e n , 1999). Hence , there is apparent need for more research and thorough understanding o f G n R H or its super-agonist- induced b i o l o g i c a l effects o n the reproductive system i n the bov ine species. Further, it w o u l d be h i g h l y in t r iguing i f mechanisms that are reported i n other species, can be shown to exist i n the bov ine species w h i c h is more often subjected to G n R H (or its analogues) treatment i n day-to-day reproductive management practices. Therefore, due to the apparent lack o f informat ion, there is a clear ind ica t ion that more systematic and in-depth studies are required to explore the intra-ovarian presence o f G n R H and G n R H - R system and its poss ible invo lvement i n modula t ion o f ovar ian function and reproduct ive performance i n the bov ine species. 2 1.2. L I T E R A T U R E R E V I E W T h i s section provides background informat ion pertaining to this thesis, and is presented i n two parts. Part I covers the rev iew o n G n R H , G n R H - R , and their different forms, and dis t r ibut ion i n different b o d y tissues w i t h special emphasis o n reproduct ive system. Part II covers an overv iew o f the ovar ian function i n cattle w i t h the m a i n emphasis o n appl icat ions o f G n R H i n bovine reproductive management. T h e rationale for the present study, general hypothesis tested, and the objectives o f the study are presented at the end o f this section. P A R T I 1.2.1. G n R H and its types The hypothalamic G n R H , w h i c h is also referred to as G n R H - I or type one m a m m a l i a n G n R H ( m G n R H ) , was first isolated and sequenced dur ing the early seventies b y D r s . A . Scha l ly , R . G u i l l e m i n , R . Y a l o w and co-workers w h o became the N o b e l Laureates i n M e d i c i n e , i n 1977 ( R e v i e w e d b y R i v i e r , 2001). Presently, about 14 structurally variant forms o f hypotha lamic G n R H are k n o w n to regulate reproduct ion across a w i d e var ie ty o f organisms ranging from yeast to mammals . A t least a dozen o f these different G n R H forms have been fu l ly sequenced and characterized (Sherwood et a l . , 1993; Seal fon et a l . , 1997). A l l these forms are o f c lass ica l 10 amino ac id peptides, ( p G l u - H i s - T r p - S e r - T y r - G l y - L e n - S e r -P r o - G l y - N H 2 ) w i t h a pyro-g lu tamyl -modi f ied amino terminus, an amidated c o r b o x y terminus, and conserved amino acids i n posi t ions 1, 2, 4, 9, and 10 ( P o w e l l et a l . , 1994). T h e most w i d e l y recognized and c o m m o n structural var ia t ion among the different forms o f G n R H resides i n amino acids between 5 and 8 i n the sequence. 3 T h e second type, a midbra in G n R H or G n R H - I I was first ident i f ied i n c h i c k e n bra in ( M i y a m o t o et a l . , 1984). Thus , it is also referred to as ch icken G n R H - I I or c G n R H - I I ( M i l l a r et a l . , 2001) and is structurally conserved i n species ranging f rom teleost f ish to humans (Whi te et a l . , 1998). T h e th i rd type, a telencephalic G n R H , also ca l led type III G n R H or G n R H - I I I , p redominant ly exists i n the terminal part o f the olfactory neuronal c e l l i n the bra in ( M i l l a r et a l . , 2001). It is clear that each form has its unique locations w i t h i n the bra in , w h i c h suggests a difference i n developmental o r ig in and/or adult function (Sherwood et a l . , 1993; 1994; W h i t e et a l . , 1995; L e s c h e i d et a l . , 1997; D u b o i s et a l . , 2002). M o s t important ly , the G n R H - I I peptide is the one that appears to be predominant ly expressed i n other tissues such as the reproduct ive system; thereby, attracting the specia l interest o f today 's reproduct ive b io logis t s . H o w e v e r , the exact function o f these non-hypothalamic G n R H molecules is yet to be defined (Lesche id et a l . , 1997; Gore , 2002; L e u n g et a l . , 2003). 1.2.2. G n R H agonis ts Bes ides the mul t i funct ional properties o f G n R H , knowledge o n peptide sequence and its shorter half- l i fe i n general c i rcu la t ion has led to the d i scovery o f synthetic G n R H , super-agonist analogues w i t h greater stabil i ty against enzymatic degradation, increased receptor aff ini ty and b i o l o g i c a l potency ( review b y Kar t en and R i v i e r , 1986). In i t ia l ly , the o r ig ina l concept o f potent G n R H - a g o n i s t s ( G n R H - a ) was to treat hypogonad i sm resul t ing f rom insufficient endogenous secretion o f G n R H . H o w e v e r , the mul t id imens iona l properties o f G n R H analogues, and their potential appl icat ion i n reproductive p h y s i o l o g y and med ic ine were q u i c k l y rea l ized. T y p i c a l structural features that d is t inguish G n R H - a from the natural sequence o f G n R H are substitution o f g lyc ine at pos i t ion 6 o f the peptide w i t h a D - a m i n o 4 ac id (e.g. D-tryptophan) , and the r emova l o f g lyc ine from the amino terminus. Subst i tut ion w i t h a D - a m i n o ac id at pos i t ion 6 increases the half- l i fe o f G n R H - a i n c i rcu la t ion , and r emova l o f the amino terminal g lyc ine increases affinity for the G n R H - r e c e p t o r (Kar ten and R i v e r , 1986). S o m e o f the G n R H analogues or G n R H - a that are current ly i n use for c l i n i c a l or exper imental purposes include: gonadorel in (native-l ike G n R H ; gonadore l in diacetate tetrahydrate or gonadore l in hydrochlor ide) , buserel in (D-serine at pos i t ion 6 and ethylamide at pos i t ion 10), fert irel in acetate (ethylamide at pos i t ion 10) and des lore l in (D-t ryptophan at pos i t i on 6 and ethylamide at pos i t ion 10). 1.2.3. G n R H r e c e p t o r a n d its types C l o n i n g o f the G n R H - R from several m a m m a l i a n species i n c l u d i n g the mouse (Tsutsumi et a l . , 1992), rat (E idne et a l . , 1992; K a i s e r et a l . , 1992; Reinhar t et a l . , 1992), c o w ( K a k a r et a l . , 1993), human ( K a k a r et a l . , 1992; C h i et a l . , 1993), sheep ( B r o o k s et a l . , 1993; I l l i n g et a l . , 1993) and p i g (Weesner and M a t t e d , 1994) and a non -mammal i an species (catfish: Tensen et a l . , 1997) has revealed that the G n R H - R is a member o f the large super f a m i l y o f seven transmembrane doma in receptors that b i n d to G-proteins. The G n R H - R has seven transmembranal he l i ca l domains , characteristic o f the guanine prote in coup led receptor ( G P C R ) super fami ly . H o w e v e r , a unique feature o f the G n R H - R is the absence o f a corboxy- te rmina l cy toplasmic ta i l , w h i c h is thought to be engaged i n desensi t izat ion and in ternal iza t ion i n other G P C R s . In conjunct ion w i t h the existence o f the other two forms o f G n R H , G n R H - I I and G n R H - I I I , it is also suggested that separate and cognate receptor types w o u l d also be present i n vertebrates (Troskie et a l . , 1998). The recent ly d iscovered T y p e II G n R H - R from the marmoset and human ( M i l l a r et a l . , 2001 ; N e i l l et a l . , 2001) is s h o w n to be 5 h i g h l y selective for G n R H - I I , and is w i d e l y expressed i n reproductive tissues and i n the central nervous system ( M i l l a r , 2002). In addi t ion, G n R H - I I receptor is expressed i n the major i ty o f gonadotropes suggesting it has a role i n the regulat ion o f gonadotropin secretion. Contrast to the T y p e I receptor, the T y p e II receptor get r ap id ly in ternal ized and has a d is t inc t ly different s ignal ing pathway and preferentially stimulates F S H secretion. T h i s has l ed to the suggested hypothesis that G n R H - I I and the T y p e II receptor have a specif ic role i n the regulat ion o f the gonadotrope function ( M i l l a r , 2002). The loca l iza t ion o f the T y p e II receptor to the b ra in reg ion is k n o w n to affect sexual arousal, and suggests a role i n reproduct ive behaviors . S i m i l a r l y , the presence o f the T y p e II receptor i n reproduct ive tissues (e.g. gonads, prostate, endometrium/placenta, and m a m m a r y glands) suggests an existence o f dist inct role(s) for type II G n R H molecules i n these tissues. 1.2.4. Mode of G n R H and G n R H - R interactions in the pituitary U p o n b i n d i n g to its receptors o n gonadotropes, G n R H activates the G q / G l l subfami ly o f G-proteins . T h i s causes an increase i n phospholipase C ( P L C ) act iv i ty that results i n phosphoinosi t ide b reakdown and generation o f inos i to l 1, 4, 5-trisphosphate (IP3) and d i a c y l g l y c e r o l ( D A G ) . IP3 releases Ca2+ from intracel lular stores whereas D A G activates prote in kinase C ( P K C ) . These events lead to the synthesis and release o f gonadotropins, L H and F S H (S to j i lkov ic and Catt 1995). The frequency and ampli tude o f G n R H release from hypotha lamic neuronal cel ls is a c r i t i ca l and ra te - l imi t ing step for the cont ro l and maintenance o f gonadotropin secretion from pi tui tary gonadotropes. The G n R H pulse and ampli tude changes, i n turn, depend on feedback exerted b y sex steroids and gonadal peptides produced throughout the reproductive cyc l e (Shupnik , 1996). B o t h G n R H -6 R synthesis and L H p synthesis is favored at h i g h G n R H pulse frequencies (one pulse every 30 m i n ) , whereas F S H P synthesis is favored at l o w G n R H pulse frequencies (one pulse every 120 m i n ) as observed b y K a i s e r et a l . (1997). Further, it is suggested that the modu la t ion o f the G n R H pulse frequency enables G n R H to regulate mul t ip le p h y s i o l o g i c a l effects that c o u l d result i n the differential act ivat ion o f s ignal transduction pathways, thereby e l i c i t i ng different ce l lu la r processes. T h i s phenomenon was demonstrated b y K a i s e r et a l . (1995) where G n R H - s t i m u l a t e d L H p promoter ac t iv i ty was at the op t imal point o f s t imula t ion i n co inc idence w i t h that o f re la t ively h i g h G n R H - R numbers, w h i l e F S H P promoter ac t iv i ty was o p t i m a l l y st imulated at re la t ively l o w G n R H - R numbers. T h e recent studies b y Haisenleder et a l . (1997) suggest that i n addi t ion to G n R H - R numbers, the modu la t ion o f the frequency o f intracel lular c a l c i u m pulses m a y also p lay a role i n the differential regulat ion o f L H p and F S H p m R N A synthesis. 1.2.5. Extra-hypothalamic G n R H and G n R H - R system in reproductive tissues T h e first and earliest reports reveal ing the evidence for the presence o f ovar ian G n R H - R , or h i g h affinity b i n d i n g sites for G n R H i n rodent species, dates back to the late seventies. T h r o u g h rad io l igand b ind ing assays, l igand specif ic b i n d i n g sites were demonstrated o n granulosa and luteal cells (C l ay ton et a l . , 1979, 1980; H a r w o o d et a l . , 1980; Reeves et a l . , 1980; Jones et a l . , 1980; Pieper et a l . , 1981), oocyte ( D e k e l et a l . , 1988; N y et a l . , 1987), testicular interstit ial tissue (Bourne et a l . , 1980, 1982), and L e y d i g cel ls (Lefebvre et a l . , 1980; Sharpe and Fraser, 1983; C l a y t o n et a l . , 1990). These f indings were further conf i rmed i n subsequent studies b y several other researchers (Latouche et a l . , 1989; W h i t e l a w et a l . , 1995). Expres s ion o f G n R H m R N A has been demonstrated i n human 7 reproduct ive tissues and c e l l l ines ( D o n g et a l . , 1993; D o n g and Roberts et a l . , 1996), rat gonads ( O i k a w a et a l . , 1990; B a h k et a l . , 1995), and endometrial cel ls o f human (Raga et a l . , 1999). In-situ hybr id iza t ion studies revealed the loca l iza t ion o f G n R H m R N A i n granulosa cel ls o f p r imary , secondary, and tertiary fol l ic les i n the ovary (C l ay t o n et a l . , 1992; W h i t e l a w et a l . , 1995). Presence o f m R N A for GnRH-recep to r s has also been ident i f ied i n human granulosa luteal cel ls ( h G L C s ) us ing reverse transcription polymerase cha in react ion ( R T -P C R ) techniques (Minare tz i s et a l . , 1995; O lo f s son et a l . , 1995; K a n g et a l . , 2000; Ramakr i shnappa et a l . , 2003). In testicular tissue, f rom both fetal (Botte et a l . , 1998) and mature rats, and i n adult humans, seminiferous tubular cel ls were found posi t ive for G n R H m R N A , whereas m R N A for G n R H - R was found i n interstitial cel ls , i nc lud ing the L e y d i g cel ls ( B a h k et a l . , 1995; C l a y t o n et a l . , 1990). Recent ly , us ing Nor the rn hybr id iza t ion procedure, three dis t inct ive, different s ized G n R H - R m R N A transcripts have been demonstrated i n rat and mouse testicular germ cel ls ( B u l l et a l , 2000). In addi t ion, type II G n R H - R exon 1-containing transcripts were detected b y i n si tu hybr id iza t ion i n human mature sperm, and i n postmeiot ic ge rm ce l l s , and were considered to be c lose ly related w i t h spermatogenesis, sperm maturat ion, and fer t i l izat ion (van B i l j o n et a l , 2002). Th rough nucleot ide sequence analysis, it was conf i rmed that both rat and human ovar ian and testicular G n R H - R have sequences ident ica l to those found i n the pi tui tary ( K a k a r et a l . , 1992; P e n g et a l . , 1994; M o u m n i et a l . , 1994; O l o f s s o n et a l . , 1995; Ko t t l e r et a l . , 1999; Ramakr i shnappa et. a l . , 2003) . In para l le l , the knowledge o f hypotha lamic G n R H structure and its phys io log i ca l concentrations (Nett et a l . , 1974) or its short half- l i fe i n the general c i rcu la t ion (Eskay et a l . , 1977, H s u e h and Jones, 8 1981), has led to the idea o f exp lo r ing the presence o f G n R H or G n R H l i ke molecules i n gonads. In this regard, several researchers were successful i n demonstrating the existence o f G n R H - l i k e molecules i n Ser tol i cel ls b y compet i t ive b ind ing studies and i m m u n o -his tochemis t ry (Sharpe and Fraser 1983; P a u l l et a l . , 1981; B h a s i n and Swerdloff , 1984). G n R H or G n R H - l i k e molecules have been detected i n human fo l l i cu la r f l u id ( Y i n g et a l . , 1981), bov ine ( A t e n et a l . , 1987a; Ireland et a l , 1988) and human ovary ( A t e n et a l . , 1987b), i n human semina l p lasma ( Izumi et a l . , 1985), i n testicular intersti t ial f l u id o f hCG- t rea ted rats (Sharpe and Fraser, 1980a,b), and i n rat germ cel ls (Pau l l et a l , 1981). It has also been suggested that these molecules are p robably be ing synthesized i n the gonads ( O i k a w a et a l . , 1990; Sharpe and Cooper , 1982a, b) and i n the prostate ( A z a d , et a l . , 1993). W i t h g r o w i n g evidence o f the endogenous presence o f G n R H - G n R H - R systems i n reproduct ive tissues, intensive studies have been focused o n elucidat ing autocrine or paracrine mechanisms that m a y exist w i t h i n reproductive tissues. 1.2.6. Mode of G n R H and G n R H - R interaction in reproductive tissues In the ovary , G n R H has been shown to el ic i t a m i x e d effect o f both inh ib i to ry and s t imulatory responses affecting ovar ian function (review by ; Sharpe, 1982; Janssens et a l . , 2000) . G n R H is be l i eved to exert its direct effects either o n its o w n , or i n conjunct ion w i t h other factors such as P G F 2 a , angiotension II or lu te in iz ing hormone ( F i g . 2). S t imula t ion o f one or more s igna l ing pathways such as phospholipase C ( P L C ) , phosphol ipase A 2 ( P L A 2 ) and phosphol ipase D ( P L D ) , or act ivat ion o f protein kinase C ( P K C ) causes either inh ib i to ry or s t imulatory effects o n ovar ian cel lu lar steroid output. These dual effects have been c lear ly demonstrated w i t h in vivo experiments i n adult male and female hypophysec tomized rats 9 where exogenous G n R H or G n R H - a cou ld either stimulate or inhib i t gonadal functions i n terms o f steroidogenesis (Hsueh and Jones, 1981). In adult male rats, a lower dose G n R H - a adminis t ra t ion for a short-term durat ion was shown to stimulate testosterone secretion (Sharpe et a l . , 1982), whereas the effect was opposite w h e n the agonist was administered at a higher dose or for long-term durations ( A r i m u r a et a l . , 1979, H s u e h and E r i c k s o n , 1979). S i m i l a r l y , other reports have demonstrated that G n R H modulates, bo th basal and gonadotropin, s t imulated steroidogenesis (Olofsson et a l . , 1995) i n the ovary . The inh ib i to ry act ion o f G n R H , or its agonists, o n gonadal steroidogenesis i nvo lves suppression o f gonadotropin receptors or intermediary enzymes i n v o l v e d i n steroidogenic pathway. Repor ts suggest ing G n R H - a induced suppression o f F S H and L H receptors ( T i l l y et a l . , 1992; Piquette et a l . , 1991; Guerrero et a l . , 1993), gonadotropin-induced c A M P levels (Richards , 1994; K n e c h t et a l . , 1985), steroidogenic enzyme act iv i ty such as peripheral-type benzodiazepine receptor, steroidogenic acute regulatory protein, P450scc enzyme, and 30-H S D (Sr idaran et a l . , 1999a; Sridaran et a l . , 1999b) or no effect (Casper et a l . , 1984) o f G n R H o n progesterone (P4) product ion i n human granulosa-lutein cel ls ( h G L C s ) have been documented. In the bov ine species, s imi la r observations revealed inh ib i to ry effects o f G n R H - a , busere l in o n P 4 secretion f rom in vitro cultured luteal cel ls ( M i l v a e et a l . , 1984). In vivo studies b y D ' O c c h i o et a l . , (2000) suggest that the suppressed ovar ian funct ion i n heifers treated long- term w i t h G n R H - a m a y have been due, i n part, to a direct act ion o f des lore l in ( G n R H implant) o n the ovaries. O n the other hand, there are several reports, bo th f rom in vitro or in vivo studies, i n rodent, primate and in vitro human granulosa c e l l culture models , 10 to p rov ide contradic t ing data o n the above ment ioned inh ib i to ry effects o f G n R H - a at the gonadal l eve l . L i u et a l . (1991) reported dose-related s t imulatory effects o f G n R H - a o n aromatase ac t iv i ty and P 4 product ion i n m o n k e y granulosa c e l l cultures. T h e y also demonstrated G n R H antagonist suppression o f G n R H - a s t imulatory effect o n granulosa c e l l steroidogenesis i n culture. S i m i l a r reports demonstrating G n R H - a induced steroidogenesis i n cul tured human granulosa cel ls have been reported (Ranta et a l . , 1982; Par inaud et a l . , 1992; Bussenot et a l . , 1993). Par inaud et a l . (1988) suggest that G n R H - a c o u l d modulate steroidogenesis b y a direct ovar ian action. The agonist, buserel in, increased basal and decreased L H - i n d u c e d P 4 secretion in vitro. Guerrero et a l . (1993) found an increase i n P 4 and decrease i n estradiol- 17P (E2) product ion, w h i c h seemed to be related to a decrease o f L H receptor numbers and aromatase act ivi ty i n G n R H agonist-treated granulosa cel ls . In the male gonads G n R H has been shown to cause a direct s t imulatory effect o n basal steroidogenesis, and an inh ib i to ry effect o n gonadotropin-s t imula ted androgen biosynthesis (Hsueh and Jones, 1982; Hsueh et a l . , 1984). Short-term in vitro treatments o f adult rat L e y d i g cel ls w i t h G n R H resulted i n increased testosterone product ion (Sharpe and Copper , 1982b; M o l c h o et a l . , 1984), w h i l e long-term incubat ion decreased the response to h C G ( B r o w n i n g et a l . , 1983). G n R H - a or G n R H - l i k e material also revealed pos i t ive effects o n the testosterone product ion and sprematogonial mu l t ip l i ca t ion i n frogs ( M i n u c c i et a l . , 1986; Ze ran i et a l . , 1991). In contrast, it has been shown that h igh dose or long-act ing G n R H -a have a direct inh ib i to ry effect o n the testosterone secretion i n hypophysec tomized rat. In immature and hypophysec tomized rats, in vivo administrat ion o f G n R H and G n R H - a had inh ib i to ry effects o n reproductive function (Bambino et a l . , 1980; K e r r et a l . , 1986), and 11 G n R H - a inh ib i ted the basal and L H - s t i m u l a t e d steroidogenesis i n rat fetus, and cul tured testicular cel ls (Dufau and K n o x , 1985; Habert , 1992). T h i s suggests that G n R H - a has a direct effect o n testis wi thout the act ion o f gonadotropin ( A r i m u r a et a l , 1979). Therefore, p h y s i o l o g i c a l functions induced b y G n R H or its agonists m a y be der ived f rom the direct effects o f G n R H and/or indirect effects v i a the variat ions o f gonadotropin and testosterone levels (Botte e t a l . , 1999). H o r m o n a l regulat ion o f G n R H and G n R H - R m R N A appears to be o f c ruc ia l importance for e lucidat ing G n R H - G n R H - R system i n testis. In adult rats, long-act ing G n R H -a . (triptorelin) c o u l d reduce the levels o f both G n R H , and G n R H - R m R N A 24 hrs after inject ion. H o w e v e r , GnRH-an tagon i s t (antarelix) s ignif icant ly increased the levels o f G n R H -R m R N A 8 hrs after injection, but had no effect o n G n R H m R N A express ion i n rat testis (Botte et a l , 1999). The mechan i sm b y w h i c h the GnRH-an tagon i s t elevated the levels o f G n R H - R m R N A remains to be elucidated. O n the other hand, treatment w i t h F S H had no effect o n the G n R H and G n R H - R m R N A expression i n rat testis, and L H can down-regulate G n R H - R , but not G n R H , m R N A levels(Botte et a l , 1999). A d m i n i s t r a t i o n o f testosterone c o u l d increase G n R H - R , but not G n R H m R N A levels, and this s t imulat ion was mediated b y L H secretion (Botte et a l , 1999). Thus , the regulat ion o f G n R H m R N A appeared to be independent o f gonadotropins i n rat testis, and L H is thought to be a k e y regulator o f G n R H -R m R N A expression. In addi t ion, i n hypophysec tomized rat, adminis t ra t ion o f L H d imin i shed the effect o f post -hypophysectomy-induced increase o f G n R H - R (Bourne and M a r s h a l l , 1984). These f indings suggest that endogenous regulat ion i n the testis is different f rom that i n pi tui tary g land where G n R H and steroid regulate G n R H - R expression. 12 Furthermore, it is suggested that G n R H and its analogs m a y modulate spermatozoa-zona pe l l uc ida b i n d i n g i n humans (Mora les and L lanos , 1996). Short t ime (5 min ) exposure o f spermatozoa to a 20 n M G n R H , or its agonist buserel in, caused a s ignif icant increase i n the number o f zona bound sperm count (by 300 to 350 fold) . T h i s effect was comple te ly preventable b y pr ior exposure o f spermatozoa to G n R H antagonist (Mora le s and L l a n o s , 1996). These f indings suggest that the spermatozoa m a y interact w i t h G n R H , or G n R H - l i k e molecules , that they m a y come i n contact w i t h dur ing their journey through the male and female reproductive tracts (Mora les , 1998; B u l l et a l . , 2000). The interaction m a y occur : (a) dur ing spermatogenesis b y loca l , intra-testicular product ion (Hedger et a l ; 1985; H s u e h and Schaeffer, 1985; V e r h o e v e n and Ca i l l eau , 1985); (b) dur ing sperm maturat ion i n the ep id idymis ; (c) dur ing ejaculation, upon m i x i n g w i t h seminal p lasma dur ing transport to the site o f fer t i l iza t ion i n the oviduct . In the oviduct , the spermatozoa m a y interact w i t h G n R H secreted l oca l l y , or transported b y the products o f ovula t ion ( fo l l icu lar f lu id , granulose cells) f rom the ovary ( Y i n g et a l . , 1981; A t e n et a l . , 1987a, b ; Ireland et a l . , 1988; O i k a w a et a l . , 1990). In addi t ion, it is also suggested that G n R H is i n v o l v e d i n the process o f fer t i l izat ion. G n R H - a has been shown to increase the cleavage rate o f bov ine oocytes in vitro (Funston et a l . , 1995), whereas Casan et a l . (2000) demonstrated the presence o f both G n R H m R N A and prote in expression i n the human fa l lopian tube dur ing the luteal, but not fo l l icu lar , phase o f the menstrual cyc le . G n R H - a i n supra-physiological or long-act ing doses appear to exert an inh ib i to ry effect o n each step o f spermatogenesis, and it is thought to be mediated b y suppressing F S H , L H and intratesticular testosterone levels. Interestingly, G n R H - a or G n R H antagonist, treatment enhanced the regeneration o f spermatogenesis f rom damaged testes i n irradiated rats ( M e i s t r i c h and K a n g a s n i e m i , 1997; Shutt lesworth et a l , 2000) , c ryp torch id rats 13 ( K o i c h i et a l . , 2002) , cy to toxic therapy rat (Me i s t r i ch , et a l . , 1999), and juven i l e spermatogonial deplet ion (jsd) mutant m i ce ( M a t s u m i y a et a l , 1999). It is be l i eved that G n R H - a treatment w o u l d stimulate spermatogonial prol i ferat ion resul t ing i n then regeneration o f spermatogenesis. The exact mechan i sm for this is s t i l l uncertain, however , reduced intra-testicular testosterone levels b y G n R H - a m a y p l a y a role since intra-testicular testosterone l eve l was elevated after i r radiat ion or chemica l insult ( M e i s t r i c h and K a n g a s n i e m i , 1997). Testosterone is necessary for spermatogenesis, but suppressive to spermatogonial prol i fera t ion ( K o i c h i et a l . , 2002). M i x e d o p i n i o n exists w i t h regard to the presence o f the G n R H - G n R H - R system and its autocrine or paracrine effect i n the m a m m a r y system. G n R H m R N A has been detected i n the m a m m a r y gland o f pregnant and lactating rats, but not i n that o f v i r g i n rats ( P a l m o n et a l . , 1994; flceda et a l . , 1995). D u e to its conspicuous presence s tr ic t ly dur ing the pe r iod o f pregnancy or lactation, it was suggested that G n R H expression might be regulated b y pro lac t in ( P a l m o n et a l . , 1994). It has been speculated that the presence o f b i o l o g i c a l l y active peptides i n m i l k suggests that the target o f m a m m a r y G n R H m a y be the offspr ing (Gore , 2002) . 1.2.7. Direct effects of G n R H and programmed cell death in the ovary A s i n the majori ty o f other c e l l types i n the body, occurrence o f p rogrammed c e l l death or apoptosis i n ovar ian fo l l i c l e and luteal tissues has been considered a p h y s i o l o g i c a l process that se lect ively eliminates unwanted cel ls , whi l s t main ta in ing no rma l phys io log i ca l processes (Sh ikone et a l . , 1996; Y u a n and Giud i ce . , 1997). In a l l the species studied so far, 14 the in i t i a t ion o f apoptosis i n granulosa cel ls is one o f the earliest signs o f fo l l i cu la r demise ( T i l l y and H s u e h , 1993; Juengal et a l . 1993; T i l l y , 1996). The occurrence o f apoptosis i n granulosa cel ls o f atretic fo l l ic les has been documented based o n morpho log i ca l (Pa lumbo and Y e h , 1994; Y a n g and Rajamahendran, 2000a; Saito et a l . , 2000) and b i o c h e m i c a l cr i ter ia (Hughes and Gorospe , 1991; N a h u m et a l . , 1996; M a n i k k a m and Rajamahendran 1997, and Y a n g and Rajamahendran 2000a, b). Ev idence suggests a role for G n R H i n i nduc ing fo l l i cu la r atresia (Piquette et a l . , 1991; B i l l i g et a l . , 1994; W o n g and Richa rds , 1992). D u r i n g fo l l i cu la r phase, atretic fo l l ic les i n rats showed a h i g h m R N A expression for G n R H - r e c e p t o r s ( W h i t e l a w et a l . , 1995). D u r i n g in vitro cultures, G n R H either inhib i ted D N A synthesis (Saragueta et a l . , 1997) or induced apoptosis i n rat granulosa cel ls ( B i l l i g et a l . , 1994). Studies have p rov ided the evidence for G n R H - i n d u c e d remode l ing o f the extra-cel lular mat r ix b y induc ing structural luteolysis i n superovulated rats. T h i s was accompl i shed through s t imula t ion o f matr ix metalloproteinase ( M M P - 2 ) and membrane type 1 - M M P expression i n matured C L , w h i c h degraded collagens type I V , type I and III, respect ively (Goto et a l . , 1999). D u r i n g early pregnancy i n the rat, G n R H - a was shown to suppress serum P 4 levels , w h i c h was associated w i t h an increased degree o f D N A fragmentation i n the C L (Sridaran et a l . , 1998; Dharmarajan et a l , 1994; Rueda et a l . , 1995a,b; R u e d a et a l . , 1997). S i m i l a r effects o f G n R H - a - i n d u c e d increased number o f apoptotic bodies i n human granulosa cel ls (obtained dur ing oocyte retr ieval for in vitro fert i l ization) was demonstrated b y Zhao et a l (2000). 1.2.8. GnRH and reproductive tissue tumors It has been hypothesized that G n R H m a y p l ay an autocrine or paracrine regulatory role i n the growth o f reproductive tissue tumors (ovarian ca rc inoma and endometr ial 15 carcinomas) . Recent studies have shown that G n R H was more abundantly present i n ovar ian and endometr ia l carcinomas than i n normal ovaries and endometr ium (Furu i et a l . , 2002). G n R H peptide expression has been identif ied i n certain tumors i n c l u d i n g ovar ian ( A r e n c i b i a and Scha l l y , 2000; K a n g et a l . , 2000; Irmer et a l . , 1995; O h n o et a l . , 1993), endometr ia l (Irmer et a l . , 1994), prostatic ( L i m o n t a et a l . , 1993; B a h k et a l . , 1998; L a u et a l . , 2001) and breast cancers (Harr is et a l . , 1991; Ko t t l e r et a l . , 1997). Further, an autocrine growth-regulatory system that attenuates cancer development through direct effect i n the ova ry and the endometr ium, both in vivo and in vitro, has been hypothes ized based o n G n R H produc t ion and its receptor expression i n endometrial and ovar ian cancers ( Imai et a l . , 2000; A r e n c i b i a and S c h a l l y 2000; E m o n s and Schu lz , 2000; Grundker et a l . , 2002b) . T h e most recent studies b y Grundker et a l . (2002b) demonstrated that a second G n R H system exists i n primates. Further, the anti-proliferative effects o f G n R H - I I or G n R H - I agonist o n c e l l cyc l e and apoptosis were analyzed i n endometr ial cancer c e l l l ines ( H E C - 1 A and Ishikawa) and ovar ian cancer c e l l l ines ( E F O - 2 1 and N T H : O V C A R - 3 ) , and was s h o w n to be pos i t ive for expression o f G n R H - I I receptor m R N A . The prol i fera t ion o f those G n R H -II receptor pos i t ive c e l l l ines was dose- and t ime-dependently reduced b y authentic G n R H - I I , and these effects were found s ignif icant ly higher than the anti-proliferative effects o f equimolar doses o f G n R H - I agonist, Tr ip tore l in . A l t h o u g h there is s t i l l m u c h research to be done, avai lable evidence suggests that direct anti-proliferative effects o f G n R H analogs h o l d p romise as n o v e l therapeutic remedies for the treatment o f reproductive cancers (Grundker et a l . , 2002a; V o l k e r et a l . , 2002). In summary, there are at least two dis t inct ive types o f G n R H that have been fu l ly characterized i n mammals , and these seem to be structurally conserved 16 for over 500 m i l l i o n years. The w i d e tissue dis t r ibut ion, par t icular ly o f G n R H - I I , suggests that it m a y have a var ie ty o f reproductive and nonreproductive functions that are yet to be ident i f ied ( M i l l a r , 2002; L e u n g et a l . , 2003). T h e existence o f dis t inct ive G n R H forms suggests the presence o f dis t inct ive cognate receptor types i n vertebrates; therefore, it w i l l be a product ive area o f research i n c o m i n g years. L i k e both G n R H - I and G n R H - I I , G n R H - I I I m a y also p l a y a role i n the management o f autocrine and paracrine effects w i t h i n reproduct ive tissues (Grundker et a l . , 2002a). T h e existence o f addi t ional G n R H systems i n bra in , pi tui tary and reproductive organs, as w e l l as different mechanisms o f ac t ion i n these tissues, m a y contribute to the development o f "new generation" G n R H analogues (agonists and antagonists) w i t h h i g h l y selective and contro l led actions o n these different types o f receptors. Nonetheless , it is n o w m u c h easier to delineate different mechanisms o f ac t ion i n these tissues; therefore, target-specific G n R H analogs cou ld be developed i n the near future that a l l o w better control over manipula t ion o f var ious reproductive processes. F o r example , target-specific G n R H analogs that o n l y act either at the pi tui tary l eve l , or at the gonadal l eve l , c o u l d be developed. A l t h o u g h m u c h remains to be elucidated w i t h regard to the s ignif icance o f different G n R H - G n R H - R systems i n reproductive tissues, it is certain that the future looks p r o m i s i n g for the research and development o f innovat ive and n o v e l therapeutic measures u t i l i z i n g the G n R H system. Further, it is possible that addi t ional roles for G n R H i n govern ing one or more phys io log i ca l events i n the b o d y c o u l d be unve i l ed i n the future. 17 Gonads: F o l l i c l e , Oocyte , Corpus luteum, Spermatozoa, Interstitial tissues F I G U R E 1.1. Extra-hypothalamic G n R H and its possible target sites in different tissues. 18 FIGURE 1.2. Hypothetical model o f G n R H involvement in stimulation or suppression o f multiple signaling pathways in association with various endocrine factors in the ovary. Potential interactions o f several o f these pathways culminating in the modulation o f estrogen, progestins, and prostaglandin ( P G E 2 / P G F 2 a ) production are depicted. A C , adenylate cyclase; c A M P , cyclic adenosine monophosphate; P K A , protein kinase A ; P L C , phospholipase C ; P L A 2 , phospholipase A 2 ; P L D , phospholipase D ; IP3, inositol trisphosphate; D A G , diacylglycerol; A A , arachidonic acid; P A , phosphatidic acid; P K A , protein kinase A ; C a 2 + , free calcium; P K C , protein kinase C ; P450scc, cytochrome P450 side-chain cleavage enzyme. [Adapted from: Steele and Leung, 1993; with modifications]. 19 P A R T I I S ince this thesis m a i n l y focuses o n ovar ian expression o f G n R H and G n R H - R , and the direct influence o f G n R H - a o n bov ine ovar ian function, this sect ion provides the o v e r v i e w o n ovar ian function i n cattle. Emphas i s has been p laced o n the current knowledge o f applicat ions o f G n R H i n bov ine reproductive management. 1.2.9. Ovarian follicular and CL dynamics in the bovine species M a m m a l i a n fo l l i cu lo genesis is a h i g h l y complex process and o n l y a ve ry s m a l l por t ion o f the fo l l ic les ( -0 .1%) survive apoptosis dur ing their p r imord i a l fo l l i c l e stages. In cattle, less than 1% o f the 100J000 fol l ic les present at puberty w i l l develop to matur i ty and ovulate. T h e m a i n processes i n v o l v e d i n the growth and maturation o f an ovula tory fo l l i c l e includes recruitment, select ion and dominance o f an ovula tory fo l l i c l e . T h e advanced technologies , such as a non- invas ive ultrasound moni to r ing o f ovar ian structures, are an inva luable too l that have enabled researchers to map the fo l l i cu la r and luteal dynamics prec ise ly dur ing the bov ine estrous cyc le . In a typ ica l estrous c y c l e o f a c o w , ovar ian fo l l i cu la r g rowth occurs i n two or three waves (Rajamahendran et a l . , 1994). T h e first fo l l i cu la r wave begins w i t h the emergence o f a cohort o f fo l l ic les ( 4 - m m diameter) f rom w h i c h a single fo l l i c l e acquires dominance and continues to g row w h i l e the others undergo atresia ( L u c y et a l . , 1992; Sav io et a l . , 1993; Rajamahendran et a l . , 1994; Gin ther et a l . , 1996). The first wave dominant fo l l i c l e ( D F ) remains active un t i l approximate ly D a y 10-11 o f the estrous cyc le . A t this t ime, dominance o f the first wave fo l l i c l e is arrested, since a recruitment o f second wave fo l l ic les begins at D a y 16 o f estrous cyc le . T h e second D F ovulates i n a two-wave cyc le ; alternatively, it m a y undergo atresia i n a three-wave cyc le 20 (Ginther et a l . , 1996). U n d e r normal circumstances, the ovula tory fo l l i c l e arises f rom the f inal wave ; therefore estrus gets delayed since the second D F must regress, and the th i rd D F requires addi t ional t ime to complete development before ovula t ion . C o w s exh ib i t ing three-wave pattern fo l l icu la r g rowth tend to have longer inter-estrous intervals compared w i t h those o f a two-wave pattern (Ginther et a l . , 1989a, b ; T a y l o r and Rajamahendran 1991). The p r ima ry functions o f ovar ian fo l l ic les are: 1) to support and nurture a deve lop ing oocyte that is capable o f be ing fer t i l ized after ovula t ion , 2) to secrete steroid hormones that regulate the m o r p h o l o g y and function o f the reproductive organs, as w e l l as reproductive behavior dur ing estrus, and 3) to p rov ide the precursor cel ls that w i l l luteinize and form the C L after ovu la t ion (Irianni and H o d g e n , 1992). T h e C L is a transitory endocrine gland, or a y e l l o w i s h b o d y developed from a Graaf ian fo l l i c l e after ovu la t ion (Rev i ewed b y N i s w e n d e r et a l . (2000). A s described b y Regn ie r de G r a a f (1641-1673) , Corpora (bodies) lutea (ye l low) were named b y M a r c e l l o M a l p i g h i (1628-1694) . The y e l l o w color is attributed to the h igh levels o f an antioxidant, (3-carotene (Graves -Hoag land et a l . , 1989). In the bovine species, luteal format ion begins w i t h an L H surge resul t ing i n successful ovula t ion and lute inizat ion o f fo l l i cu la r granulosa and thecal ce l l s , w h i c h shifts steroid biosynthesis from estrogens to progestins. T h e fo l l i cu la r ce l l s undergo mor pho log i c a l and b iochemica l changes that are related to lu te in iza t ion (Ni swender and Nett , 1988). A m o n g the changes are: 1) the b reakdown o f the basement membrane w h i c h separates the theca from the granulosa cel ls , and 2) i nvas ion o f b l o o d vessels into the ruptured w a l l o f the antral fo l l icu lar space, resul t ing i n the development o f an extensive vascular network (Niswender et a l . , 1994). B l o o d f l ow increases w i t h the increase 21 i n the C L weight (Damber et a l . , 1987). Thus , the complete development o f a C L takes about three days ( D a y 2 to 5 o f a cycle) . The bov ine C L increases i n size un t i l mid- lu tea l stage, at w h i c h t ime it plateaus before decreasing i n diameter dur ing the late diestrus stage (Mares et a l . , 1962). In a non-pregnant cyc le (at around D a y 16 to 18 after ovula t ion) , or i n failure o f pregnancy, the C L undergoes luteolysis i n response to prostaglandin F2 a (PGF2a) secreted b y uterine endometr ium (Garver ick et a l . , 1992). 1.2.10. Ovarian steroidogenesis Steroids are a group o f compounds that share the cyclopentanoperhydrophenanthrene r ing sys tem o f sterols, and are interconverted b y specific enzymes i n different ce l l s ( R e v i e w b y H a n u k o g l u , 1992). T h e two-ce l l , two-gonadotropin m o d e l ( F i g . 3) has been proposed to exp la in ovar ian steroidogenic function (Arms t rong and Dor r ing ton , 1979). T h e predominant pathways o f steroidogenesis are governed b y the specific enzymes produced b y the thecal and granulosa cel ls ( F i g . 4). The k e y enzymes governing fo l l icu la r steroidogenesis inc lude cy tochrome P 4 5 0 enzymes and hydroxys tero id dehydrogenases. T h e thecal and granulosa cel ls differ i n the synthesis o f cytochrome P 4 5 0 enzymes, depending o n the stage o f fo l l i cu la r development. The cytochrome P 4 5 0 1 7 a is expressed b y thecal cel ls at a l l stages o f fo l l i cu la r development; however , granulosa cel ls do not express cytochrome P 4 5 0 1 7 a (Sasano et a l . , 1989). T h e cytochrome P 4 5 0 a r o m is expressed b y granulosa cel ls (and not b y thecal ce l ls ) , but this expression is l o w i n smal l antral fo l l ic les and increases ma rk ed l y w i t h fo l l i cu la r g rowth (Sasano et a l . , 1989). The cytochrome P450scc is expressed b y thecal cel ls at a l l stages o f fo l l i cu la r development, but cytochrome P450scc is o n l y expressed b y granulosa cel ls f o l l o w i n g lute inizat ion (Sasano et a l . , 1989). The steroid environment o f 22 sma l l antral fo l l ic les is androgenic; however , as the fo l l i c l e develops, the steroid environment w i l l become progress ively estrogenic, and then f o l l o w i n g lute inizat ion, P 4 synthesis increases marked ly . Progesterone is the p r imary steroid product o f the C L , and it is an essential requirement for the process o f embryo implantat ion and maintenance o f pregnancy. Concent ra t ion o f P 4 begins to increase progress ively dur ing D a y 3 to 12 o f the estrous cyc l e , and then stabil izes un t i l D a y 16. Concentrat ions rap id ly decrease f o l l o w i n g regression o f the C L (Hanse l and Echte rnkamp, 1972; Rajamahendran et a l . , 1976; N i s w e n d e r et a l . , 2000). T h e functional l i fespan o f the C L is m a i n l y dependent o n the balance between luteotropic and lu teolyt ic hormone, L H and PGF2oc, respectively."It is a wel l -es tabl ished phenomenon that bo th L H and PGF2cc act i n two different mechanisms to exert their luteotropic and lu teolyt ic effects o n exis t ing C L (Rev iewed b y N i s w e n d e r et a l . , 2000) . U p o n b i n d i n g its receptors o n the luteal c e l l membrane, L H causes the synthesis and release o f P 4 into the general c i rcu la t ion ( F i g . 5). The LH-recep to r complex activates a secondary messenger system, cAJVIP, w h i c h i n turn initiates a cascade o f events through a specif ic s igna l ing pa thway ca l l ed prote in k i n a s e - A pathway ( P K A pathway). P K A system is k n o w n to activate esterase enzymes i n the cy toplasm, subsequently processing the conjugated cholesterol into a free fo rm cholesterol . Choles tero l is m a i n l y der ived f rom low-dens i ty l ipoproteins ( L D L ) or high-densi ty l ipoproteins ( H D L ) found i n the b l o o d (Anderson and Die t schy , 1978; A z h a r and M e a n o n , 1981), acetate or l i p i d droplets i n luteal cel ls ( H i n s h e l w o o d et a l . , 1993; H a n s e l et a l . , 1987). It m a y also exist i n unesterified forms i n sma l l and large luteal cel ls ( H i n s h e l w o o d et a l . , 1993). L ipopro te ins (either L D L or H D L ) b i n d to their luteal p la sma 23 membrane-specif ic receptors to stimulate the release o f cholesterol . T h e free fo rm cholesterol is further transported into the inner mi tochondr ia l membrane b y an acute regulatory prote in ca l l ed steroid acute regulatory protein ( S t A R ) . T h i s protein can induce acute changes i n the rate o f steroidogenesis b y m o b i l i z i n g cholesterol , and subjecting it to the enzymes that are already present. These acute change can happen w i t h i n matter o f minutes. In the mi tochondr ia , a specia l type o f enzyme ca l led cytochrome side cha in cleavage enzyme (P450scc) , that is present w i t h i n the inner mi tochondr ia l membrane, converts the free fo rm cholesterol into pregnenolone through cleavage o f the cholesterol side cha in ( M i l v a e et a l . , 1996). Further, pregnenolone is released into cy top lasm where another k e y enzyme, 3P-hydroxys te ro id dehydrogenase (3P-HSD), exists i n the smooth endoplasmic re t i cu lum, and converts pregnenolone into P 4 . The resultant P 4 is then processed i n the G o l g i apparatus and released into general c i rcu la t ion (Rev i ewed b y N i swende r et a l . , 2000). Lu t eo ly t i c hormone, or its analogues, exerts the cyto toxic effects that eventual ly k i l l luteal ce l l s resul t ing i n both functional and structural regression o f C L tissue. It is u n i v o c a l that P G F 2 c t is a potent luteolyt ic agent that exerts its actions through a specif ic s igna l ing pa thway ca l led prote in kinase C ( P K C pathway). U p o n its act ivat ion, P K C is be l i eved to exert its ac t ion i n one or two ways . F i r s t ly , P K C act ivat ion is be l ieved to suppress the p roduc t ion and ac t iv i ty o f a k e y acute regulatory protein, S taR, w h i c h is responsible for the transport o f free cholesterol from outer mi tochondr ia l membrane into inner mi tochondr ia l membrane. Secondly , a cy to toxic effect alters the ce l l membrane potential and causes increased intracel lular c a l c i u m , something that is detrimental to c e l l su rv ivab i l i ty . 24 T H E C A L C E L L S G R A N U L O S A C E L L S F I G U R E 1.3. Diagrammatic illustration o f the two-cell-two-hormone theory. Luteinizing hormone stimulates thecal cells to produce androgens, and follicle-stimulating hormone stimulates granulosa cells to produce estrogens from androgens. L H , Luteinizing hormone; F S H , Foll ic le stimulating hormone, c A M P , cyclic adenosine monophosphate; P K A , protein kinase A ; R, receptor. 25 Cholesterol P450scc Pregnenolone 3J3HSD P45017a P450 17a. 17-Hydroxy pregnenolone 3pHSD •> DHEA 3PHSD P450l7a Progesterone • 17-Hydroxy progesterone P45017a ->• Androstenedione • 17/3HSD Testosterone P450arow Estradiol-17f3 F I G U R E 1.4. Follicular biosynthesis o f estradiol-17(3. The key steps involved in follicular steroidogenic pathways and their respective enzymes are illustrated. P450scc, cytochrome P450 side chain cleavage enzyme; 3p -HSD, 3(3-hydroxysteroid dehydrogenase; 17P-HSD, 17P-hydroxysteroid dehydrogenase; P 4 5 0 1 7 a i 17a-hydroxylase cytochrome P450; P450arom, cytochrome 450aromatase; D H E A , dihydroepiandrostenedione. 26 General circulation F I G U R E 1.5. Schematic representation o f intracellular events occurs during progesterone (P4) biosynthesis in C L . Three source o f cholesterol can be utilized for substrate: 1) low-Density lipoprotein ( L D L ) , 2) high-density lipoprotein ( H D L ) , or 3) hydrolysis o f cholesterol esters by cholesterol esterase. Free cholesterol is transported to inner mitochondrial membrane by the help of steroid acute regulatory protein (StAR). Cholesterol is converted to pregnenolone by cytochrome P450 side chain cleavage enzyme (P450scc). Then pregnenolone transported out o f mitochondria, and converted to P4 by 3(3-hydroxy steroid dehydrogenase (3P-HSD) in the smooth endoplasmic reticulum (SER) . P4 is believed be diffuse out from the cell into general circulation. L H , luteinizing hormone; P K A , protein kinase A ; c A M P , cyclic adenosine monophosphate; L D L r , low-density lipoprotein receptor; H D L B p , high-density lipoprotein binding protein; C E , cholesterol esterase. Modif ied from Niswender et al., 2000. 27 1.2.11. Applications of G n R H and G n R H analogues in bovine reproduction C o m b i n i n g the mul t i funct ional roles o f G n R H , and the ava i lab i l i ty o f potent, l o n g act ing synthetic G n R H analogues broaden the scope for G n R H applicat ions i n the f i e ld o f reproduct ive b i o l o g y and medic ine . In veterinary practice, the versati le functional properties o f G n R H have been exploi ted to manage a variety o f reproductive disorders w i t h v a r y i n g degree o f success ( R e v i e w e d b y Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n , 1999; Rajamahendran et a l . , 2001). F o r instance, the acute effect o f G n R H caus ing endogenous release o f L H and F S H is an important feature that is be ing employed i n manipu la t ing the ovar ian act ivi ty . G n R H - i n d u c e d L H release is associated w i t h numerous p h y s i o l o g i c a l effects such as an altered C L function, and ovula t ion or lu te in iza t ion o f ovar ian fo l l i c les , i nduc t ion and development o f new fo l l ic les . Further, G n R H or its analogues are rout ine ly emp loyed i n var ious treatment regimens inc lud ing synchroniza t ion o f estrus and ovula t ion , i nduc t ion o f postpartum ovula t ion , and reversible suppression o f ovar ian ac t iv i ty for an extended periods ( D ' O c c h i o and A s p d e n , 1999). The accompl ishment o f the later phenomena has become m u c h easier since the ava i lab i l i ty o f s l ow releasing subcutaneous implants o f G n R H analogues. Furthermore, this feature o f a chronic effect appears to be a p r o m i s i n g too l for the development o f safer methods o f contraception through temporary suppression o f ovar ian function. T h e f o l l o w i n g paragraphs prov ide an ove rv i ew o f the roles for G n R H or its analogues i n the f ie ld o f farm an imal reproduction, w i t h special emphasis o n the bov ine species. 28 1.2.12. Neuroendocrine response to G n R H analogues in cattle T h e acute response to G n R H - a , irrespective o f dosage, was characterized b y increased gonadotropin secretion (Rodger and Stormshak, 1986; Chenaul t et a l . , 1990). C h r o n i c treatment w i t h re la t ively h i g h doses o f G n R H - a resulted i n the reversible suppression o f gonadotropin secretion ( L a h l o u et a l . , 1987). The latter was due to the d o w n -regula t ion o f GnRH-recep to r s o n gonadotrophes ( H a z u m and C o n n , 1988; Grospe and C o n n , 1988). K n o w l e d g e o f direct effects o f G n R H - a o n hypothalamic G n R H secretary pattern i n bov ine species is l imi t ed . H o w e v e r , i n rams, treatment w i t h G n R H - a d i d not inf luence G n R H secretary patterns (Caraty et a l . , 1990). It w o u l d appear, therefore, that G n R H - a treatment does not influence the ac t iv i ty o f hypothalamic G n R H secreting neurons, at least i n rams. T h e major direct effects o f G n R H - a w i t h i n the reproductive axis appear to be ac t ion o n pi tu i tary gonadotropes ( H a z u m and C o n n , 1988; H u c k l e and C o n n 1988; V i z c a r r a et a l . , 1997). B u l l s treated w i t h G n R H - a (nafarelin) for 15 days had reduced pi tui tary G n R H -receptors ( M e l s o n et a l . , 1986). Th i s was consistent w i t h the c lass ica l down-regula t ion o f GnRH-recep to r s induced b y G n R H - a ( H a z u m and C o n n , 1988). H o w e v e r , there are several studies i n the bov ine species to contradict these f indings, where bu l l s and heifers treated w i t h G n R H - a mainta ined basal secretion o f L H . These results differ f rom the signif icant reduct ion i n c i rcu la t ing L H seen i n most species dur ing agonist treatment ( D ' O c c h i o and A s p d e n , 1996). R e d u c e d levels o f pi tui tary L H and L H m R N A was demonstrated i n intact bu l l s ( M e l s o n et a l , 1986) and cows ( V i z c a r r a et a l , 1997) treated w i t h G n R H - a . T h i s was associated w i t h a lack o f pulsat i le secretion o f L H but maintenance o f basal L H , secretion ( D ' O c c h i o and A s p d e n , 1996; A s p d e n et a l . , 1997a, b ; Rajamahendran et a l . , 1998; D a v i s et 29 a l , 2003) . Studies o n L H secretary patterns i n bul l s treated w i t h nafarel in revealed that basal L H secretions i n bu l l s were s l ight ly , but s ignif icant ly , increased dur ing treatment (J imenez-Severiano et a l . , 1998, 2003). S i m i l a r increases i n basal p lasma L H was observed i n heifers treated w i t h a long-act ing G n R H - a , leuprol ide (Evans and R a w l i n g s , 1994), as w e l l as i n cows treated w i t h busere l in ( G o n g et a l . , 1995, 1996; Schmit t et a l . , 1996a; Rajamahendran e t a l . , 1998). G n R H - a - r e s p o n s i v e pi tui tary L H secretion i n cattle was further demonstrated us ing castrated bu l l s , w h i c h natural ly have an increased secretion o f L H . A l t h o u g h p l a sma L H was reduced i n castrated bu l l s treated w i t h agonist, basal secretion was maintained, s imi l a r to the f indings i n intact bu l l s ( A s p d e n et. a l . , 1996). The understanding that has emerged f rom G n R H - a studies i n cattle, therefore, is that pulsati le secretion o f L H is b l o c k e d , w h i c h is consistent w i t h down-regula t ion o f GnRH-recep to r s ( V i z c a r r a et a l . , 1997). H o w e v e r , basal L H secretion is ton ica l ly increased (Evans and R a w l i n g s , 1994, Schmi t t et a l . , 1996b; Rajamahendran et a l . , 1998; J imeneze-Severiano et a l . , 1998 and 2003). The exact mechanism(s) that promotes increased basal secretion o f L H i n cattle treated w i t h G n R H - a is not k n o w n . H o w e v e r , it has been hypothesized that the basal secretion c o u l d be consti tutive and does not require typ ica l second messenger pathways ( H u c k l e and C o n n 1988). Al t e rna t ive ly , G n R H - a m a y stimulate second messenger pathways i n cattle to main ta in increased basal L H secretion; nevertheless this assumption might be considered inconsistent w i t h the down-regula t ion o f GnRH-recep to r s i n cattle dur ing agonist treatment. Endogenous G n R H is not required for cont inued secretion o f L H i n bu l l s treated w i t h G n R H - a , as bu l l s 30 treated w i t h agonist, and s imultaneously ac t ive ly i m m u n i z e d against G n R H , mainta ined basal secretion o f L H ( A s p d e n et a l . , 1997a, b). T h e response o f the pituitary to the natural sequence G n R H secretion was reinstated over several weeks after treatment w i t h G n R H - a i n bu l l s (Bergfe ld et a l . , 1996a) and heifers (Bergfe ld et a l . , 1996b). It was not k n o w n whether the gradual recovery o f pi tu i tary responsiveness to G n R H is related to a gradual replenishment o f GnRH-recep to r s o n gonadotroph cel ls , or to a gradual re-establishment o f second messenger pathways w i t h i n gonadotroph cel ls (Grospe and C o n n , 1988). Consistent w i t h a gradual return to n o r m a l pi tui tary funct ion after G n R H - a treatment, post-pubertal heifers treated w i t h a des lore l in ( G n R H - a ) b io - implan t for 10, 28, or 56 days, ovulated approximate ly 20 days after the end o f treatment ( D ' O c c h i o and K i n d e r , 1995; D ' O c c h i o et a l , 1996). Heifers infused w i t h busere l in for 48 days d isp layed estrus and preovulatory L H surge 8-11 and 22 days after cessat ion o f treatment, respect ively ( G o n g et a l . , 1996). In young bul l s , treatment w i t h leuprol ide from 6 to 20 weeks o f age delayed the occurrence o f a pre-pubertal r ise i n p lasma L H and testosterone b y 4 weeks , from 20 weeks to 24 weeks (Chando l i a et a l . , 1997). 1.2.13. Gonadal response to GnRH analogues in cattle T h e acute increase i n p lasma L H that occurs at in i t ia t ion o f G n R H - a treatment (Chenaul t et a l . , 1990) can induce ovula t ion o f a g rowing preovula tory fo l l i c l e , and can also induce a new fo l l i cu la r wave ( M a c m i l l a n and Thatcher, 1991). Lu te in i za t ion , wi thout ovula t ion , also can be induced b y treatment w i t h G n R H - a ( M a c m i l l a n and Thatcher, 1991; Ret tmer et a l . , 1992). In B r a h m a n heifers, ovula t ion was induced w i t h G n R H - a administered 31 o n D a y 4 and D a y 6 o f the estrous cyc le , but not o n D a y 2 or D a y 8 as r ev i ewed b y D ' O c c h i o and A s p d e n (1999). S i m i l a r f ind ing were reported b y Schmit t et a l . (1996a) and Rajamahendran et a l . (1998), where ovula t ion was consistently induced b y treatment w i t h G n R H - a at about D a y 5 to D a y 6 o f the estrous cyc le . L o n g - t e r m and cont inuous adminis t ra t ion o f G n R H - a starting from D a y 5 o f the estrous cyc le i n cattle has resulted i n suppressed p lasma F S H levels ( G o n g et a l . , 1996), and fo l l i c l e g rowth was restricted to ear ly stages o f development (<4mm) ( G o n g et a l . , 1996; Rajamahendran et a l . , 1998; D ' O c c h i o et a l . , 2000) . In prepubertal heifers, treatment w i t h des lore l in for 28 days was associated w i t h increased p lasma concentrations o f E 2 , s imi la r to that o f increased testosterone secretion i n bu l l s treated w i t h G n R H - a (Bergfe ld et a l . , 1996a). S i m i l a r trends were observed w i t h respect to P 4 secretion b y the C L i n heifers and cows treated w i t h G n R H - a ear ly i n the estrous cyc le (Thatcher et a l . , 1993; D ' O c c h i o et. a l 1996; Schmit t et a l . , 1996a; Rajamahendran et a l . , 1998). Increased gonadal steroidogenesis i n cattle rece iv ing G n R H - a was thought to be due to maintenance o f t on ica l ly increased b a s a l , L H secretion (Evans and R a w l i n g s , 1994; Schmi t t et a l . , 1996a; J imenez-Severiano et a l . , 1998: Rajamahendran et a l . , 1998; Taponen et a l . , 1999). Cont ra ry to this assumption, several other authors have shown that G n R H - a administered at different k n o w n t ime points dur ing the estrous cyc le e l ic i ted different effects o n steroidogenic capabil i t ies o f the fo l l i c l e or ensuing C L . It was suggested that the acute increase i n L H that occurs when G n R H - a treatment is init iated at the m i d luteal phase o f the estrous cyc le ( D a y 12-13) causes lu te inizat ion o f fo l l ic les , account ing for the reduced the secretion o f E 2 (Thatcher et a l . , 1993; Ret tmer et a l . , 1992). F o r instance, heifers treated 32 ch ron i ca l l y w i t h G n R H - a fai led to initiate an endogenous preovulatory L H , and ovu la t ion d i d not occur ( D ' O c c h i o et a l . , 2000 and 2002). 1.2.14. Effects of GnRH-a on preovulatory follicle development and CL function F o l l o w i n g luteolysis , increased L H pulse frequency (moderate rise i n F S H levels) , w i t h concomitant transitory rise i n E 2 levels , favors the f inal t ransformation o f granulosa and thecal ce l l s into luteal ce l l s , acqui r ing enhanced steroidogenic potentials to secrete enough P 4 f rom the ensuing C L . T h e transient increase i n F S H and E 2 levels p r io r to ovu la t ion is be l i eved to p l a y a p ivo t a l role i n fo l l icu la r c e l l prol iferat ion, and acquis i t ion o f de n o v a L H -receptors before differentiating into fu l ly lu te inized c e l l mass. Consequent to the advent o f the concept o f estrus synchroniza t ion i n fa rm animals , v igorous efforts are under w a y to f ind out an efficient hormona l treatment reg imen to induce synchron ized fo l l i cu la r development, ovula t ion and an effective C L format ion i n cattle. Recent reports f rom several laboratories have g iven new hope to effective manipu la t ion o f synchron ized ovu la t ion leading to an enhanced C L function through usage o f G n R H or its synthetic analogues. One such recently developed protocol , referred to as " o v s y n c h " (Purs ley et a l . , 1995), i n v o l v i n g G n R H o n D a y 0, P G F 2 a o n D a y 5-7 and second G n R H o n D a y 7-9, has been s h o w n to be a p romis ing method o f estrus synchroniza t ion and ovula t ion . T h i s me thod is be ing w i d e l y pract iced i n t imed inseminat ion protocols . H o w e v e r , due to l im i t ed knowledge o f the mul t i funct ional roles o f G n R H or its analogues i n the reproduct ive tissues, it is not yet possible to come up w i t h an appropriate treatment reg imen for G n R H or G n R H - a i n the f ie ld o f both human and domestic an imal reproductive medic ine . Expe r imen ta l studies 33 have revealed that w h i l e l o w pulse frequency o f G n R H supports F S H synthesis and release. O n the other hand, it is not as effective i n increasing L H levels. Whereas h i g h G n R H pulse frequency inhibi ts F S H synthesis and release ( V i z c a r r a et a l . , 1999). S i ze o f the largest ovar ian fo l l i c l e was greater i n heifers treated w i t h G n R H - a (Purs ley et a l . , 1997, and Taponen. , 1999 and 2000), w h i c h was associated w i t h increased p lasma concentrations o f E 2 (Bergfe ld et a l . , 1996b; M a c l e l l a n et a l . , 1997: Dufour et a l . , 1999). Converse ly , w h e n a second dose o f G n R H - a was administered 24 h after the prostaglandin inject ion, it seemed to cause an L H surge, w h i c h stopped the E 2 secretion i n preovulatory fo l l i c l e . T h i s seems to occur even though the fo l l i c l e had not reached the f inal matur i ty (Taponen et a l , 1999, 2002, 2003) . A d m i n i s t r a t i o n o f G n R H or G n R H - a i n the early fo l l icu la r phase has resulted i n an inadequate or defective C L ( L u c y and Stevenson, 1992; M u r d o c h and V a n K i r k , 1998; Taponen et a l . , 1999, 2003) . There are more than one theory to exp la in that consequent to G n R H - a administrat ion, L H concentrations reach beyond their threshold levels causing down-regula t ion o f LH-receptors i n preovulatory fo l l i c l e cel ls ; thus, ensuing luteal defect. S i m i l a r postulat ions indicate lack o f F S H p r i m i n g granulosa cel ls w o u l d fa i l to acquire a romat iz ing capabil i t ies; hence decreased E 2 levels cou ld lead to decreased granulosa c e l l prol i ferat ion, and thus, the luteal insuff ic iency (D ie l eman and Blankens te in 1984). In heifers, chronic adminis t ra t ion o f G n R H - a c o m m e n c i n g early i n the estrous cyc le ( D a y 3) resulted i n a larger C L , and secreted more P 4 than i n untreated heifers ( D ' O c c h i o et a l . , 1997). S i m i l a r observations were made w h e n G n R H - a was administered dur ing mid - fo l l i cu l a r phase ( M u r d o c h and V a n K i r k , 1998, M o m c i l o v i c et a l . , 1998; Taponen, 1999), or ear ly estrous 34 cyc le , resul t ing i n an enhanced C L function (Twagi ramungu et a l . , 1995). Treatment w i t h des lore l in is associated w i t h an increased p lasma P 4 levels i n cattle (Schmit t et a l . , 1996a and Rajamahendran et a l . , 1998), w h i c h is be l ieved to be attributed i n part to the increased size and funct ion o f the C L . The C L i n heifers treated w i t h des lore l in had a greater content o f S t A R protein, and the steroidogenic enzyme P450scc , ( reviewed i n D ' O c c h i o and A s p d e n , 1999). Treatment o f heifers w i t h buserel in early i n the estrous cyc le caused an increase i n the relat ive numbers o f large luteal cel ls i n the C L (Twagi ramungu et a l . , 1995, Schmi t t et a l . , 1996a). O n the other hand, heifers treated w i t h G n R H - a from about D a y 4 to D a y 6 o f the estrous c y c l e can ovulate and develop an accessory C L w h i c h m a y be a contr ibutory factor towards increased p lasma P 4 (Schmit t et a l . , 1996a; Rajamahendran and Sianangama, 1992; Rajamahendran et a l . , 1998). F o l l o w i n g inseminat ion, administrat ion o f G n R H - a ear ly i n the estrous cyc le to increase p lasma P 4 w o u l d enhance the l i k e l i h o o d o f concept ion, pregnancy recogni t ion and embryo su rv iva l ( U l l a h et a l . , 1996). 1.2.15. Effects of G n R H analogues on pregnancy outcome in cattle A considerable number o f studies have examined whether G n R H treatments g iven at the t ime o f A I are able to improve pregnancy rates i n cattle. In most o f the experiments G n R H treatment (gonadorelin-native G n R H or buserelin-agonist ic analogue) was g iven at the t ime o f first or second A I . The dosage is general ly around 100 - 125 u.g for native G n R H and 8-10 p,g for buserel in . Genera l ly , these treatment are employed around the t ime o f A I , or dur ing the mid- lu tea l phase to attempt to establish enhanced C L function. T h e major i ty o f exper imental results show a numer ica l ly increased P 4 product ion, and i n some instances, pregnancy rate, after G n R H treatment. Howeve r , the difference is often stat ist ically non-35 significant i n compar i son w i t h untreated animals . O v e r a l l , the studies demonstrate an increase i n pregnancy rates i n cows treated w i t h G n R H at the t ime o f first A l ( M e e et a l . , 1990; U l l a h et a l . , 1996). H o w e v e r , according to Thatcher et a l . (1993), changes i n pregnancy rates, i n response to G n R H administrat ion at the t ime o f first service o f da i ry cows , varies f rom -7 to +17%; therefore, it is diff icul t to accept that G n R H is e l i c i t ing a predictable increase i n fert i l i ty that can be re l i ab ly appl ied f rom herd to herd. Repeat breeding has considerable impact o n the economy o f da i ry farmers. The def in i t ion o f repeat breeding includes pregnancy failures occur r ing after three or more inseminat ions performed at estrus w i t h normal inter-estrous intervals i n the absence o f detectable abnormali t ies (Zemjanis , 1980). H o w e v e r , i n most studies dea l ing w i t h the effect o f G n R H g i v e n at the t ime o f A l i n repeat breeders, they were c lass i f ied as c o w s that return to estrus for a th i rd or further service. T h e native G n R H or G n R H agonists are often the choice o f treatment to tackle this p rob lem, and this treatment is usua l ly emp loyed at the t ime o f A l , or 12-16 hours before A l (Stevenson et a l . , 1990). In conc lus ion , it is suggested that the adminis t ra t ion o f G n R H and its agonistic analogues at the t ime o f A l w o u l d increase pregnancy rates, despite the fact that type o f an imal , management and p h y s i o l o g i c a l status can contribute to the differential fert i l i ty responses to G n R H treatments (Thatcher et a l . , 1993; U l l a h et a l . , 1996; C a m et a l . , 2002). In a nutshel l , bo th acute and chronic phases o f the L H response i n cattle to G n R H - a adminis t ra t ion broaden the scope for f ine-tuning the pract ical applicat ions for G n R H analogues i n bov ine reproduction. The acute increase i n p lasma L H that occurs at the 36 beg inn ing o f agonist treatment has been an invaluable too l i n the treatment o f cys t ic fo l l i c les , development o f estrous synchronizat ion protocols , and new super-ovulat ion programs ( review b y Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n , 1999). Further, the exercise o f adminis ter ing G n R H analogues at various t ime points at A I and embryo transfer to enhance concept ion rates, is an ongo ing effort i n ant icipat ion o f more precise answers. B a s e d on the facts, the absence o f a pre-ovulatory L H surge i n animals treated ch ron i ca l l y w i t h G n R H - a is a p r o m i s i n g feature. It cou ld be appl ied to the development o f long-act ing contraceptive methods us ing G n R H - a b io- implants , w h i c h cou ld be used i n farm an ima l practice or for veter inary use ( D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2002; T r i g g et a l . , 2001 ; M u n s o n et a l . , 2001) . A significant propor t ion (30 - 40%) o f pregnancy failures or infer t i l i ty p rob lems i n cattle, have been attributed to inadequate funct ioning o f the C L (Purse ly et a l . , 1997). Studies f rom several researchers reveal that animals destined to carry a conceptus f o l l o w i n g inseminat ion , produce more P 4 dur ing the second h a l f o f the diestrum per iod . T h e opposite is true for those animals destined for concept ion failure or early pregnancy loss. M o s t o f the concept ion failures or early pregnancy losses are associated w i t h defective C L funct ion or luteal funct ion, w h i c h is due to a lack o f adequate luteotropic support f o l l o w i n g ovula t ion . Several correct ive measures have been developed to combat inadequate C L funct ion i n cattle. F o r example , induc t ion o f increased L H p lasma concentrations either through direct L H adminis t ra t ion or adminis t ra t ion o f h C G , c o u l d exert L H l i ke act ivi ty . Efforts have also been made to compensate for luteal insuff ic iency through exogenous P 4 administrat ion. Consequent ly , they have y ie lded poor results due to u n k n o w n reasons besides prac t ica l 37 diff icul t ies . In spite o f continued efforts f rom several researchers, l i t t le improvement has been achieved towards successful treatment o f luteal insuff ic iency i n bov ine species. Resul ts f rom several studies has revealed that the administrat ion o f G n R H or its agonist analogues, w h i c h posses higher aff ini ty for G n R H receptors compared to the endogenous G n R H , y i e lded a m i x e d response towards luteal enhancement f o l l o w i n g ovula t ion . D u e to the versati le nature o f G n R H function depending o n phys io log ica l status o f an i n d i v i d u a l , it is not yet poss ible to u t i l i ze its p romis ing benef ic ia l effects towards luteal enhancement protocols . Suppor t ive results f rom exis t ing G n R H protocols inc lude adminis t ra t ion o f G n R H at var ious t ime points before and after ovulat ions, and induc t ion o f accessory C L , resul t ing i n increased p lasma P 4 concentration. G n R H agonists administered either i n ear ly diestrum, or i n late dies t rum per iod , resulted i n successful induc t ion o f accessory C L and increased p l a sma P 4 concentration. H o w e v e r , results are often inconsistent, and therefore, the search for suitable t ime-point(s) for G n R H - a administrat ion dur ing estrous cyc le continues. 1.3. R A T I O N A L E F O R T H E S T U D Y G n R H has an undisputable k e y role i n hypothalamus-pi tui tary-gonadal axis . A s w e l l , accumulated informat ion c lear ly suggests an importance for the use o f G n R H i n both management and treatment o f var iety o f reproductive disorders. T h e ava i l ab i l i ty o f potent and long-act ing synthetic G n R H analogues have led to an u n v e i l i n g o f diverse roles for G n R H i n m a m m a l i a n reproduction. In addi t ion, there are evidences to suggest autocrine or paracrine roles o f G n R H i n reproductive tissues. Di rec t effects o f G n R H , or its analogues, have been documented i n different reproductive c e l l types i n several species o f animals (primates, p igs , rodents), i nc lud ing humans. H o w e v e r , several o f those reports, i n one or 38 more o f these species, have y ie lded m i x e d results o n the direct effects o f G n R H o n ovar ian funct ion; therefore, it is a continued topic o f research interest. In l i eu o f these in t r igu ing f indings f rom other species, it w o u l d be h i g h l y interesting to explore i f any such mechanisms exist i n the bov ine species, where these animals are often subjected to G n R H or G n R H - a treatment dur ing their reproductive l ife span. The expected outcome f rom this study w i l l be a strengthening o f our knowledge regarding the direct effects o f G n R H - a o n ovar ian cel lu lar function i n the bov ine species. In addi t ion, any such knowledge gained through these studies w o u l d a id i n the ra t ional iza t ion o f the usage o f G n R H , or it potent synthetic analogues, i n both domest ic an imal and h u m a n reproduct ive management. M o r e important ly, the informat ion gained through these studies w i l l further broaden the basis for addi t ional studies w i t h respect to pro-and anti-fert i l i ty effects, as w e l l as therapeutic roles, for G n R H or its analogues i n the f i e ld o f reproduct ive medic ine . 1.4. H Y P O T H E S I S A s pointed out i n the preceding section, literature rev iew, there is an apparent pauci ty o f in format ion w i t h respect to the presence o f G n R H and G n R H - R molecules i n bov ine reproduct ive tissues, and their possible involvement i n modu la t ion o f reproduct ive function(s). Therefore, this thesis proposes the hypothesis i n a broader perspective that the bov ine ovar ian structures ( fo l l ic le and C L tissue), w o u l d express m R N A transcripts for G n R H - R and G n R H , and that the direct effects o f G n R H are exhib i ted through altered 39 ovar ian funct ion i n the bov ine species. A s w e l l , post-breeding G n R H adminis t ra t ion w o u l d enhance C L function and pregnancy outcome i n this species. 1.5. OBJECTIVES In order to test the above hypothesis, a series o f experiments were performed w i t h the f o l l o w i n g specif ic objectives: (a) T o explore the poss ib i l i ty o f m R N A expression for G n R H - R and G n R H i n bov ine ovar ian structures ( fol l ic les and C L ) [ C H A P T E R 2]. (b) T o examine the direct effects o f G n R H - a o n steroid hormone produc t ion i n granulosa ce l ls , dispersed luteal cel ls , and C L tissues in vitro [ C H A P T E R 3]. (c) T o assess the direct influence o f G n R H - a on molecula r mechanisms o f luteal steroidogenic machinery i n the bov ine C L [ C H A P T E R 4] . (d) T o examine the direct influence o f G n R H - a o n apoptotic process i n bov ine C L [ C H A P T E R 4] and (e) T o determine the influence o f post-breeding G n R H adminis t ra t ion o n in vivo C L funct ion and pregnancy outcome i n dai ry cattle [ C H A P T E R 5]. 40 REFERENCES Anderson JM, Dietschy JM. 1978. Re la t ive importance o f h i g h and low-dens i ty l ipoproteins i n the regulat ion o f cholesterol synthesis i n the adrenal gland, ovary , and testis o f the rat. J B i o l C h e m . 253 : 9024-9032. Arencibia J, Schally A. 2000. L u t e i n i z i n g hormone-releasing hormone as an autocrine g rowth factor i n E S - 2 ovar ian cancer c e l l l ine . Int J O n c o l . 16: 1009-1013. Arimura A, Serafini P, Talbot S, Schally AV. 1979. Reduc t ion o f testicular is lu t e in iz ing hormone/human chor ion ic gonadotropin receptors b y [D-Trp6] - lu t e in i z ing hormone releasing hormone i n hypophysec tomized rats. B i o c h e m B i o p h y s Res C o m m u n . 90: 687-693. Armstrong DT, Dorrington JH. 1979. Est rogen biosynthesis i n the ovaries and testes. In Thomas J . A . and S ingha l R L . (eds.), Regula tory M e c h a n i s m s A f f e c t i n g G o n a d a l H o r m o n e A c t i o n , pp. 217-258, U n i v e r s i t y Pa rk Press, Ba l t imore . Aspden WJ, Rao A, Rose K, Scott PT, Clarke IJ, Trigg TE, Walsh J, D'Occhio MJ. 1997a. Di f fe rent ia l responses i n anterior pi tui tary lu te in iz ian ig hormone ( L H ) content and LHJ3 - and alpha-subunit m R N A , and p lasma concentrations o f L H and testosterone, i n bu l l s treated w i t h the L H - r e l e a s i n g hormone agonist deslorel in . Domes t A n i m E n d o c r i n o l . 14: 429-437. Aspden WJ, van Reenen N, Whyte TR, Maclellan LJ , Scott PT, Trigg TE, Walsh J, D'Occhio MJ. 1997b. Increased testosterone secretion i n bu l l s treated w i t h a lu te in iz ing hormone releasing hormone ( L H R H ) agonist requires endogenous L H but not L H R H . D o m e s t A n i m E n d o c r i n o l . 14: 421-428. Aspden WJ, Rao A, Scott PT, Clarke IJ, Trigg TE, Walsh J, D'Occhio MJ. 1996. D i rec t actions o f the lu te in iz ing hormone-releasing hormone agonist, deslorel in , o n anterior pi tui tary contents o f lu te in iz ing hormone ( L H ) and fo l l ic le -s t imula t ing hormone ( F S H ) , L H and F S H subunit messenger r ibonucle ic ac id , and p lasma concentrations o f L H and F S H i n castrated male cattle. B i o l Reprod . 55: 386-392. Aten FR, Ireland JJ, Weems CW, Behrman HR. 1987a. Presence o f gonadotropin-releasing hormone- l ike proteins i n bov ine and ov ine ovaries. E n d o c r i n o l o g y 120:1727-1733. Aten RF, Polan M L , Bayless R, Barman HR. 1987b. A gonadotropin-releasing hormone ( G n R H ) - l i k e prote in i n human ovaries: s imi la r i ty to the G n R H - l i k e ovar ian protein o f the rat. J C l i n E n d o c r i n o l M e t a b . 64:1288-1293. Azad N, Uddin S, La Paglia N, Kirsteins L, Emanuele NV, Lawrence A M , Kelley M R. 1993. L u t e i n i z i n g hormone-releasing hormone ( L H R H ) i n rat prostate: characterizat ion o f 41 L H R H peptide, messenger r ibonucle ic ac id expression, and molecu la r process ing o f L H R H i n intact and castrated male rats. E n d o c r i n o l o g y 133: 1252-1257. Azhar S, Menon KMJ. 1981. Receptor-mediated gonadotropin act ion i n the ovary . Ra t luteal cel ls preferentially u t i l i ze and are acutely dependent upon the p lasma l ipoprote in-suppl ied sterols i n gonadotropin-st imulated steroid product ion. J B i o l C h e m . 256: 6548-6555. Bahk JY, Hyun JS, Chung SH, Lee H, Kim MO, Lee BH, Choi WS. 1995. Stage specif ic ident i f ica t ion o f the expression o f G n R H m R N A and loca l iza t ion o f the G n R H - r e c e p t o r i n mature rat and adult human testis. J U r o l . 154:1958-1961. Bahk J, Hyun JS, Lee H, Kim M , Cho G, Lee B, Choi W. 1998. E x p r e s s i o n o f gonadotropin-releasing hormone ( G n R H ) and G n R H receptor m R N A i n prostate cancer cel ls and effect o f G n R H o n the prol i ferat ion o f prostate cancer cel ls . U r o l Res . 26: 259-264. Bambino TH, Schreiber JR, Hsueh AJW. 1980. Gonadotropin-re leas ing hormone and its agonist inh ib i t testicular lu te in iz ing hormone receptor and steroidogenesis i n immature and adult hypophysec tomized rats. E n d o c r i n o l o g y 107: 908-917. Bergfeld EG, D'Occhio MJ, Kinder JE. 1996a. Con t inued desensit izat ion o f the pi tui tary g land i n y o u n g bu l l s after treatment w i t h the lu te in iz ing hormone-releasing hormone agonist des lore l in . B i o l . Reprod . 54: 769-775. Bergfeld E G , D'Occhio MJ, Kinder JE. 1996b. P i tu i tary function, ovar ian fo l l i cu la r g rowth , and p lasma concentrations o f 17 6-estradiol and progesterone i n prepubertal heifers dur ing and after treatment w i t h the lu te in iz ing hormone-releasing hormone agonist des lore l in . B i o l Reprod . 54, 776-782. Bhasin S, Swerdloff RS. 1984. Test icular G n R H - l i k e factors: characterizat ion o f b io log i c act ivi ty . B i o c h e m . B i o p h y s Res C o m m u n . 122: 1071-1075. Billig H, Furuta I, Hsueh AJ. 1994. Gonadotropin-re leas ing hormone d i rec t ly induces apoptotic c e l l death i n the rat ovary: b iochemica l i n situ detection o f deoxyr ibonuc le ic ac id fragmentation i n granulosa cel ls . E n d o c r i n o l o g y 134: 245-252. Botte M C , Chamagne A M , Carre MC, Counis R, Kottler ML. 1998. Fe ta l expression o f G n R H and G n R H receptor genes i n rat testis and ovary. J E n d o c r i n o l . 159: 179-189. Botte M C , Lerrant Y, Lozach A, Berault A, Counis R, Kottler ML. 1999. L H d o w n -regulates gonadotropin-releasing hormone ( G n R H ) receptor, but not G n R H , m R N A levels i n the rat testis. J E n d o c r i n o l . 162: 409-415. Bourne GA, Dockrill MR, Regiani S, Marshall JC, Payne AH. 1982. Induct ion o f testicular gonadotropin-releasing hormone ( G n R H ) receptors b y G n R H : effects o f pi tui tary hormones and relat ionship to inh ib i t ion o f testosterone product ion. E n d o c r i n o l o g y 110: 727-33. 42 Bourne GA, Regiani S, Payne AH, Marshall JC. 1980. Test icular gonadotropin-releasing hormone receptor-characterization and loca l iza t ion o n interstit ial tissue. J C l i n E n d o c r i n o l . M e t a b 51:407-409. Bourne, G A, Marshall, J C. 1984. An t e r i o r pi tui tary ho rmona l regula t ion o f testicular gonadotropin-releasing hormone receptors. E n d o c r i n o l o g y 115, 723-727. Brooks J, Taylor PL, Saunders PT, Eidne KA, Struthers WJ, McNeilly AS. 1993. C l o n i n g and sequencing o f the sheep pitui tary gonadotropin-releasing hormone receptor and changes i n expression o f its m R N A dur ing the estrous cyc le . M o l C e l l E n d o c r i n o l . 94:23-27. Browning JY, D'Agat, R, Steinberger A, Grotjan Jr. HE, Steinberger E. 1983. B i p h a s i c effect o f gonadotropin-releasing hormone and its agonist analog ( H O E 7 6 6 ) o n in vitro testosterone product ion b y pur i f ied rat L e y d i g cel ls . E n d o c r i n o l o g y 113: 985-991 . Bull P, Morales P, Huyser C, Socias T, Castellon EA. 2000. Exp re s s ion o f G n R H receptor i n mouse and rat testicular germ cel ls . M o l H u m Reprod . 6: 582-586 Bussenot I, Azoulay-Barjonet C, Parinaud J. 1993. M o d u l a t i o n o f the steroidogenesis o f cul tured human granulosa- lu te in cel ls b y gonadotropin-releasing hormone analogs. J C l i n E n d o c r i n o l M e t a b . 76: 1376-1379 . Cam MA, Kuran M , Yildiz S, Selcuk E. 2002. Feta l g rowth and reproductive performance i n ewes administered G n R H agonist o n day 12 post-mating. A n i m R e p r o d S c i . 72(1-2):73-82. Caraty A, Locatelli A, Delaleu B, Spitz IM, Schatz B, Bouchard P. 1990. Gonado t rop in releasing hormone ( G n R H ) agonists and G n R H antagonists do not alter endogenous G n R H secretion i n short-term castrated rams E n d o c r i n o l o g y 127: 2523-2529. Casan E M , Rag, F, Bonilia-musoles F, Polan ML. 2000. H u m a n ov iduc ta l gonadotropin releasing hormone: Poss ib le impl ica t ions i n fert i l izat ion, early embryon ic development , and implanta t ion. J C l i n E n d o c r i n o l Me tab . 85: 1377-1381. Casper RF, Erickson GF, Yen SS. 1984. Studies o f the effect o f G n R H and its agonist on human luteal steroidogenesis in vitro. Fe r t i l Ster i l . 42 : 39-43. Chandolia RK, Evans ACO, Rawlings NC. 1997. Effect o f inh ib i t ion o f increased gonadotrophin secretion before 20 weeks o f age i n b u l l calves o n testicular development . J R e p r o d F e r t i l . 109:65-71. Chenault JR, Kratzer RA, Rzepkowski RA, Goodwin MC. 1990. L H and F S H response o f H o l s t e i n heifers to fert irel in acetate, gonandorel in and busere l in The r iogeno logy 43 : 81 (Abstract) 43 Chi L , Zhou W, Prikhozhan A, Flanagan C, Davidson JS, Golembo M , Illing N, Millar RP, Sealfon SC. 1993. C l o n i n g and characterization o f the human G n R H receptor. M o l C e l l E n d o c r i n o l . 91 : 1-6. Clayton RN, Katikineni M, Chan V, dufau ML, Catt KJ. 1990. D i rec t i nh ib i t i on o f testicular funct ion b y gonadotropin-releasing hormone: media t ion b y specif ic gonadotropin-releasing hormone receptors i n interstit ial ce l l . P roc N a t l A c a d S c i U S A . 77: 4459-4463. Clayton RN, Shakespear RA, Duncan JA, Marshall JC, Munson PJ, Rodbard D. 1979. Radio iod ina ted nondegradable gonadotropin-releasing hormone analogs: new probes for the invest igat ion o f pi tui tary gonadotropin-releasing hormone receptors. E n d o c r i n o l o g y 105:1369-76. Clayton RN, Eccleston L, Gossard F, Morel G. 1992. Ra t granulosa cel ls express the gonadotropin-releasing hormone gene: evidence from i n si tu hybr id iza t ion . J M o l e E n d o c r i n o l . 9: 189-195. Conn PM, Crowley WF.Jr. 1994. Gonadotropin-releasing hormone and its analogs. A n n u R e v M e d . 45 : 391-405. D'Occhio MJ, Aspden WJ. 1996. Characterist ic o f lu te in iz ing hormone ( L H ) and testosterone secretion, pi tui tary responses to L H - r e l e a s i n g hormone ( L H R H ) and reproduct ive funct ion i n young bul l s rece iv ing the L H R H agonist des lore l in : effect o f castration o n L H responses to L H R H . B i o l R e p r o d 54:45-52. D'Occhio MJ, Kinder JE. 1995. Fa i lu re o f the L H - r e l e a s i n g hormone agonist, des lore l in , to prevent development o f a persistent fo l l i c l e i n heifers synchronized w i t h norgestomet. The r iogeno logy 44: 849-502. D'Occhio MJ, Aspden WJ, Whyte TR. 1996. Cont ro l l ed , reversible suppression o f estrous c y c l e i n bee f heifers and cows us ing agonists o f lu te in iz ing hormone-releasing hormone. J A n i m S c i . 74:218-225. D'Occhio MJ, Aspden WJ. 1999. Endocr ine and reproductive responses o f male and female cattle to agonists o f gonadotropin-releasing hormone. J R e p r o d Fert. (supple 54): 101-114. D'Occhio MJ, Fordyce G, Whyte TR, Aspden WJ, Trigg TE. 2000. Reproduc t ive responses o f cattle to G n R H agonists. A n i m R e p r o d S c i . 6 0 - 6 1 : 4 3 3 - 4 4 2 . D'Occhio MJ, Fordyce G, Whyte TR, Jubb TF, Fitzpatrick LA, Cooper NJ, Aspden WJ, Bolam MJ, Trigg TE. 2002. U s e o f G n R H agonist implants for long-term suppression o f fer t i l i ty i n extensively managed heifers and cows . A n i m R e p r o d S c i . 74:151-62. D'Occhio MJ, Sudha G, Jillella D, Whyte T, Maclellan LJ , Walsh J, Trigg T E , Miller D. 1997. U s e o f a G n R H agonist to prevent the endogenous L H surge and inject ion o f 44 exogenous L H to induce ovula t ion i n heifers superstimulated w i t h F S H : A new m o d e l for superovulat ion. Ther iogeno logy 47: 601-613. Damber JE, Cajander S, Gavels M , Selstam G. 1987. B l o o d f l ow changes and vascular appearance i n preovula tory fo l l ic les and corpora lutea i n immature pregnant mare ' s serum gonadotropins-treated rats. B i o l Reprod . 37:651-658. Davis T L , Mussard ML, Jimenez-Severiano H, Enright WJ, Kinder JE. 2003. C h r o n i c treatment w i t h an agonist o f gonadotropin-releasing hormone enhances luteal funct ion i n cattle. B i o l Rep rod . 69:398-403. Dekel N, Lewysohn O, Ayalon D, Hazum E. 1988. Receptors for gonadotropin releasing hormone are present in rat oocytes. Endocrinology 123:1205-7. Dharmarajan A M , Goodman SB, Tilly KI, and Tilly JL. 1994. A p o p t o s i s dur ing funct ional corpus lu teum regression: evidence o f a role for chor ion ic gonadotropin i n p romot ing luteal c e l l su rv iva l . Endoc r J . 2:295-303. Dieleman SJ, Blankenstein DM. 1984. Changes i n estrogen synthesiz ing ab i l i ty o f bov ine fo l l i c les relat ive to the peak o f L H . J R e p r o d Fer t i l . 72:487-494. Dong KW, Duval P, Zeng Z, Gordon K, Williams RF, Hodgen GD, Jones G, Kerdelhue B, Robersts JL. 1996. M u l t i p l e transcription start sites for the G n R H gene i n rhesus and cynomogus monkeys : a no-human primate m o d e l for s tudying G n R H gene regulat ion. M o l C e l l E n d o c r i n o l . l 17:121-130. Dong KW, Yu K L , Roberts JL. 1993. Identif ication o f a major up-stream transcript ion start site for the human progonadotropin-releasing hormone gene used i n reproduct ive tissues and c e l l l ines . M o l E n d o c r i n o l . 7: 1654-1666. Dubois EA, Zandbergen MA, Peute J, Goos HJ. 2002. Evo lu t iona ry development o f three gonadotropin-releasing hormone ( G n R H ) systems i n vertebrates. B r a i n Res B u l l . 57: 413-418. Dufau M L , Knox GF, 1985. Feta l L e y d i g c e l l culture-an in vitro system for the study o f t rophic hormone and G n R H receptors and actions. J Steroid B i o c h e m . 23 : 743-755. Dufour JJ, Mermillod P, Mariana JC, Romain RF. 1999. The effect o f a G n R H agonist o n fo l l i cu la r dynamics and response to F S H st imulat ion i n prepubertal calves. R e p r o d N u t r D e v . 39:133-44. Eidne KA, Sellar RE, Couper G, Anderson L , Taylor PL. 1992. M o l e c u l a r c l o n i n g and characterisation o f the rat pi tui tary gonadotropin-releasing hormone ( G n R H ) receptor. M o l C e l l E n d o c r i n o l . 90: 5-9. 45 Emons G, Schally AV. 1994. The use o f lu te in iz ing hormone releasing hormone agonists antagonists i n gynaecolog ica l cancers. H u m Reprod . 9:1364-79. Emons G, Schulz K. 2000. P r i m a r y salvage therapy w i t h L H - R H analogues i n ovar ian cancer. Recent Resul ts Cancer Res . 153: 83-94. Eskay RL, Mical RS, Porter JC. 1977. Rela t ionship between lu te in iz ing hormone releasing hormone concentrat ion i n hypophys ia l portal b l o o d and lu te in iz ing hormone release i n intact, castrated, and elect rochemical ly-s t imulated rats. E n d o c r i n o l o g y 100: 263-270. Evans ACO, Rawlings NC. 1994. Effects o f a long-act ing gonadotropin - r e l eas ing hormone agonist ( leuprol ide)on ovar ian fo l l icu la r development i n prepubertal heifer calves . C a n J A n i m S c i . 74:649-656. Funston RN, Seidel GE Jr. 1995. Gonadotropin-releasing hormone increases cleavage rates o f bov ine oocytes fer t i l ized in vitro. B i o l Reprod . 53: 541-545. Furui T, Imai A, Tamaya T. 2002. Intratumoral l eve l o f gonadotropin-releasing hormone i n ovar ian and endometr ial cancers. O n c o l R e p . 9: 349-352. Garverick HA, Zollers Jr. WG, Smith MF. 1992. M e c h a n i s m s associated w i t h corpus lu teum l i fespan i n animals hav ing no rma l or subnormal luteal function. A n i m R e p r o d S c i . 28 :111 - 124 . Gillian M , Peters, AR, Lamming GE. 1981. Induct ion o f pulsat i le L H release and ovu la t ion i n postpartum acyc l i c bee f cows b y repeated sma l l dose o f G n R H . J R e p r o d Fe r t i l . 63 : 559-565. Ginther OJ, Kastelic JP, Knopf L. 1989a. C o m p o s i t i o n and characteristics o f fo l l i cu la r w a v e dur ing the bov ine estrous cyc le . A n i m R e p r o d S c i . 20:187-200. Ginther OJ, Knopf L, Kastelic JP. 1989b. Tempora l associations among ovar ian events i n cattle dur ing oestrous cycles w i t h two and three fo l l icu la r waves. J R e p r o d Fe r t i l . 87: 223-230 . Ginther OJ, Wiltbank MC, Fricke PM, Gibbons JR, Kot K. 1996. Se lec t ion o f the dominant fo l l i c l e i n cattle. B i o l Reprod . 55:1187-1194. Gong JG, Bramley TA, Gutierrez CG, Peters AR, Web R. 1995. Effects o f chronic treatment w i t h a gonadotrophin-releasing hormone agonist o n peripheral concentrations o f F S H and L H , and ovar ian function i n heifers. J R e p r o d Fe r t i l . 105:263-270. Gong JG, Campbell BK, Bramley TA, Gutierrez CG, Peters AR, Web R. 1996. Suppress ion i n the secretion o f fo l l i c l e s t imulat ing hormone and lu te in iz ing hormone, and ovar ian fo l l i c l e development i n heifers cont inuously infused w i t h y a gonadotropin-releasing hormone agonist. B o i l Reprod . 55:68-74. 46 Gore AC. 2002. G n R H cel ls out side the nervous system. In: Gore , A . C . (Eds.) , G n R H : the master molecu le o f reproduct ion. K l u w e r A c a d e m i c Publ ishers , Bos ton . Goto T, Endo T, Henmi H, Kitajima Y, Kiaya T, Nishikawa A, Manase K, Sato H, Kudo R. 1999. Gonadotropin-releasing hormone agonist has the ab i l i ty to induce increase matrix- metalloproteinase ( M M P ) - 2 membrane type 1 - M M P expression i n corpora lutea, structural lu teolysis i n rats. J E n d o c r i n o l . 161: 393-402. Graves-Hoagland RL, Hoagland TA, Woody CO. 1989. Re la t ionsh ip o f p lasma P-carotene and v i t a m i n A to luteal function i n postpartum cattle. J D a i r y S c i . 72:1854-1858. Grospe WC, Conn PM. 1988. Restorat ion o f the L H secretary response i n desensit ized gonadotropes . M o l C e l l E n d o c r i n o l 59:101-110. Grundker C, Grunthert AR, Westphalen S, Emons G. 2002a. B i o l o g y o f the gonadotropin releasing hormone ( G n R H ) system i n gyneco log ica l cancers. E u r J E n d o c r i n o l . 146:1-14. Grundker C, Gunthert A.R, Millar RP, Emons G. 2002b. Expres s ion o f gonadotrotropin releasing hormone II ( G n R H - I I ) receptor i n human endometrial ovar ian cancer cel ls and effects o f G n R H - I I o n tumor c e l l prol iferat ion. J C l i n E n d o c r i n o l Me tab . 87:1427-1430. Guerrero HE, Stein P, Asch RH, de Fried EP, Tesone M. 1993. Effect o f a gonadotropin-re leasing hormone agonist o n lu te in iz ing hormone receptors and steroidogenesis i n ovar ian cel ls . F e r t i l S ter i l . 59, 803-808. Habert R. 1992. Effect o f decapitation and chronic in-vivo treatment w i t h a gonadotrophin-releasing hormone agonist o n testicular steroidogenesis i n the rat fetus. J E n d o c r i n o l . 133, 245-251 . Haisenleder, DJ, Yasin M , Marshall JC. 1997. Gonadot rop in subunit and gonadotropin-releasing hormone receptor gene expression are regulated b y alterations i n the frequency o f c a l c i u m pulsat i le signals. E n d o c r i n o l o g y 138: 5227-5230. Hansel W, Alila HW, Dowd JP, Yang X. 1987. C o n t r o l o f steroidogenesis i n sma l l and large bov ine luteal cel ls . A u s t J B i o l S c i . 40:331-347. Hansel W, Echternkamp SE. 1972. C o n t r o l o f ovar ian function i n domest ic animals . A m Zoo log i s t . 12:225-243. Hanukoglu I. 1992. Steroidogenic enzymes: structure, function, and role i n regulat ion o f steroid hormone biosynthesis . J Steroid B i o c h e m M o l B i o l . 43:779-804. Harris NC, Daltow C, Eiden KA, Dong KW, Millar RP. 1991. G n R H gene expression i n M D A - M B - 2 3 1 Z R - 7 5 - 1 breast ca rc inoma c e l l l ines. Cancer Research. 51 : 2577-2581 . Harwood JP, Clayton RN, Catt KJ. 1980. Ova r i an gonadotropin-releasing hormone receptors. I. Properties and inh ib i t ion o f luteal c e l l function. E n d o c r i n o l o g y 107: 407-413. 47 Hazum E, Conn PM. 1988. M o l e c u l a r mechan i sm o f gonadotropin-releasing hormone ( G n R H ) act ion. I. The G n R H receptor. Endoc r R e v . 9:379-386. Hedger MP, Robertson DM, Browne CA, de Kretser DM. 1985. T h e i so la t ion and measurement o f lu te in iz ing hormone-releasing hormone ( L H R H ) f rom the rat testis. M o l C e l l E n d o c r i n o l . 42:163-74. Hinshelwood M M , Demeter-Arlotto M, Means GD, Simpson ER. 1993. M o l e c u l a r b i o l o g y o f genes encoding steroidogenic enzymes i n the ovary, In: A d a s h i E Y , L e u n g P C K (eds.); T h e O v a r y . P l e n u m Press, N e w Y o r k , p i 6 5 - 1 8 3 . Hsueh AJW, Schreiber JR, Erickson GF. 1981. Inhibi tory effect o f gonadotropin-releasing hormone u p o n cul tured testicular cel ls . M o l C e l l E n d o c r i n o l . 21:43-49. Hsueh AJ, Adashi EY, Jones PB, Welsh TH Jr. 1984. H o r m o n a l regulat ion o f the differentiation o f cul tured ovar ian granulosa cel ls . E n d o c r R e v . 1: 76-127. Hsueh AJ, Erickson, GF. 1979. Extra-pi tui tary inh ib i t ion o f testicular funct ion b y lu te in is ing hormone releasing hormone. Nature 281 : 66-67. Hsueh AJ, Jones PB. 1981. E x t r a pi tui tary actions o f gonadotropin-releasing hormone. E n d o c r R e v . 2: 437-461. Hsueh AJ, Jones PB, 1982. Regu la t ion o f ovar ian granulosa luteal c e l l functions b y gonadotropin releasing hormone and its antagonist. A d v E x p M e d B i o l . 147, 223-262. Hsueh AJ, Schaeffer JM. 1985. Gonadotropin-releasing hormone as a paracrine hormone and neurotransmitter i n extra-pituitary sites. J Steroid B i o c h e m . 23:757-764. Huckle WR, Conn PM. 1988. M o l e c u l a r mechanisms o f gonadotropin releasing hormone act ion II. T h e receptor system. Endocr ine R e v . 9:387-395. Hughes FM. Jr, Gorospe WC. 1991. B i o c h e m i c a l ident i f icat ion o f apoptosis (programmed c e l l death) i n granulosa cel ls : evidence for a potential mechan i sm under ly ing fo l l i cu la r atresia. E n d o c r i n o l o g y 129:2415-22 Ikeda M , Taga M , Sakakibara H, Minaguchi H, Vonderhaar BK. 1995. De tec t ion o f messenger R N A for gonadotropin-releasing hormone ( G n R H ) but not for G n R H receptors i n mouse m a m m a r y glands. B i o c h e m B i o p h y s Res C o m m u n . 207: 800-806. Illing N , Jacobs GF, Becker II, Flanaga, CA, Davidson JS, Eales A, Zhou W, Sealfon SC. Millar RP. 1993. Compara t ive sequence analysis and functional characterizat ion o f the c loned sheep gonadotropin-releasing hormone receptor reveal differences i n p r ima ry structure and l igand specif ic i ty among m a m m a l i a n receptors. B i o c h e m B i o p h y s Res C o m m u n . 196: 745-751. 48 Imai A, Takagi A, Tamaya T. 2000. G n R H analog repairs reduced endometr ia l c e l l apoptosis i n endometriosis in vitro. A m J Obstet G y n e c o l . 182: 1142-1146. Irianni F, Hodgen GD. 1992. M e c h a n i s m o f ovu la t ion .Endocr ino l M e t a b C l i n N o r t h A m . 21:19-38. Ireland JJ, Aten FRO, Barman HR. 1988. G n R H - l i k e proteins i n cows : concentrations dur ing corpora lutea development and selective loca l iza t ion i n granulosal cel ls . B i o l Rep rod . 38:544-550. Irmer G, Burger C, Muller R, Ortman O, Peter U, Emons G. 1995. E x p r e s s i o n o f the m R N A s for lu te in iz ing hormone-releasing hormone and its receptor i n human ovar ian epi thel ia l ca rc inoma. Cancer Research. 55: 817-822. Irmer G, Burger C, Ortmann O, Schulz K, Emons G. 1994. Exp re s s ion o f lu te in iz ing hormone releasing hormone and its m R N A i n human endometrial cancer c e l l l ines. J C l i n E n d o c r i n o l Me tab . 79: 916-919. Izumi S, Makino T, Iizuka R. 1985. Immunoreact ive lu te in iz ing hormone-releas ing hormone i n the seminal p lasma and human semen parameters. Fe r t i l S ter i l . 43 : 617-620. Janssens RMJ, Brus L , Cahill DJ, Huirne JA, Schoemaker J, Lambalk CB. 2000. D i rec t ovar ian effects and safety aspects o f G n R H agonists and antagonists. H u m R e p r o d Update . 6: 505-518. Jimenez-Severiano H, Mussard M, Ehnis I, Koch J, Zabekka E, Lindsey B, Enrigtht W, D'Occhio M , Kinder J. 1998. Secret ion o f L H i n b u l l calves treated w i t h analogs o f G n R H . J R e p r o d F e r t i l . Supp l . 54. Jimenez-Severiano H, D'Occhio MJ, Lunstra DD, Mussard M L , Koch JW, Ehnis LR, Enright WJ, Kinder JE. 2003. Effect o f chronic treatment w i t h the gonadotrophin-releasing hormone agonist azagly-nafarel in o n basal concentrations o f L H i n prepubertal bu l l s . Reproduc t ion . 125:225-32. Jones PB, Hsueh AJ. 1982. Regu la t ion o f ovar ian 3 beta-hydroxysteroid dehydrogenase ac t iv i ty b y gonadotropin-releasing hormone and fo l l ic le-s t imula t ing hormone i n cul tured rat granulosa ce l l s . E n d o c r i n o l o g y 110:1663-71. Jones PB, Conn PM, Marian J, Hsueh AJ. 1980. B i n d i n g o f gonadotropin releasing hormone agonist to rat ovar ian granulosa cel ls . L i f e S c i . 27:2125-32 Juengal JL. Garverick HA, Johnson AL, Youngquist RS, Smith MF. 1993. A p o p t o s i s dur ing luteal regression i n cattle. E n d o c r i n o l o g y 132: 249-254. Kaiser UB, Conn PM, Chin WW, 1997. Studies o f gonadotropin-releasing hormone act ion us ing gonadotropin-releasing hormone receptor expressing pi tui tary c e l l l ines. E n d o c r R e v . 18: 46-70. 49 Kaiser UB, Sabbagh E, Katzenellenbogen RA, Conn PM, Chin WW. 1995. A mechan i sm for the differential regulat ion o f gonadotropin subunit gene expression b y gonadotropin-releasing hormone. P roc N a t l A c a d S c i U S A . 92: 12280-12284. Kaiser UB, Zhao D, Cardona GR, Chin WW. 1992. Isolat ion and characterizat ion o f c D N A s encod ing the rat pi tui tary gonadotropin-releasing hormone receptor. B i o c h e m B i o p h y s R e s C o m m u n . 189:1645-52. Kakar SS, Musgrove L C , Devor DC Sellers JC, Neill J D . 1992. C l o n i n g , sequencing, and expression o f human gonadotropin releasing hormone ( G n R H ) receptor. B i o c h e m . B i o p h y s R e s C o m m u n . 189:289-295. Kakar SS, Rahe CH. Neill JD. 1993. M o l e c u l a r c lon ing , sequencing, and character iz ing the bov ine receptor for gonadotropin releasing hormone ( G n R H ) . Domes t A n i m E n d o c r i n o l 10: 335-342. Kang S, Cheng K, Nathwani P, Choi K, Leung P. 2000. Au toc r ine role o f gonadotropin-releasing hormone and its receptor i n ovar ian cancer c e l l growth. E n d o c r i n o l o g y 13: 297-304. Karten MJ, River JE. 1996. Gonadotropin-releasing hormone analog design. Structure -funct ion studies towards the development o f agonists and antagonists: rationale and perspective. E n d o c r R e v . 7:44-66. Kerr JB, Sharpe RW. 1986. Effects and interactions o f L H and L H R H agonists o n testicular m o r p h o l o g y and function i n hypophysec tomized rats. J R e p r o d Fe r t i l . 76: 175-192. Knecht M, Ranta I, Feng P, Shonohara O, Catt KJ. 1985. Gonadotropin-re leas ing hormone as a modula tor o f ovar ian function. J Steroid B i o c h e m . 23:771-778. Koichi U, Mitsumasa T, Masahiko H, Yoshinobu K, Takehiko O. 2002. R e c o v e r y o f spermatogenesis b y h i g h dose gonadotropin-releasing hormone analogue treatment i n rat c ryp torch id testis after orchiopexy. J U r o l . 168:1279-1283. Kottler M L , Starzec A, Carre M , Lagarde J, Martin A, Counis R. 1997. T h e genes for gonadotropin-releasing hormone and its receptor are expressed i n human breast w i t h f ibrocyst ic disease and cancer. Int J Cancer . 71 : 595-599. Kottler M L , Bergametti F, Carre MC, Morice S, Decoret E, Lagarde JP, Starzec A, Counis R. 1999. Tissue-specif ic pattern o f variant transcripts o f the h u m a n gonadotropin-releasing hormone receptor gene. E u r J E n d o c r i n o l . 140: 561-569. Lahlou N, Roger M , Chaussain J-L, Feinstein M-C, Sultan C, Toublanc JE, Schally AV, Scholler R. 1987. Gonado t rop in and alpha-subunit secretion dur ing long- term pi tui tary suppression b y D-Rrp6 - lu t e in i s i ng hormone-releasing hormone microcapsules as treatment o f precocious puberty. J C l i n E n d o c r i n o l Me tab . 65: 946-953 50 Latouche J, Crumeyrolle-Arias M , Jordan D, Kopp N, Augendre-Ferrante B, Cedard L , Haour F. 1989. G n R H receptors i n human granulosa cel ls : anatomical loca l i za t ion and characterizat ion b y auto radiographic study. E n d o c r i n o l o g y 125: 1739 -1741 . Latouche TA. Menzies GS, Baird DT. 1985. Specif ic b i n d i n g o f gonadotrophin-releasing hormone and an agonist to human corpus luteum homogenates: characterization, properties, and luteal phase levels . J C l i n E n d o c r i n o l Me tab . 61:834-841. Lau HL, Zhu X M , Leung PC, Chan LW, Chen GF, Chan PS, Yu K L , Chan FL. 2001. Detec t ion o f m R N A expression o f gonadotropin-releasing hormone and its receptor i n n o r m a l neoplast ic rat prostates. Int J O n c o l . 19: 1193-201. Lefebvre FA, Reeves JJ, Seguin C, Massicotte J, Labrie F. 1980. Spec i f ic b i n d i n g o f a potent L H R H agonist i n rat testis. M o l C e l l E n d o c r i n o l . 20: 127-134. Lescheid DW, Terasawa E, Abler LA, Urbanski HF, Warby C M , Miller RP, Sherwood NM. 1997. A second form o f gonadotropin-releasing hormone ( G n R H ) w i t h characteristics o f c h i c k e n G n R H - I I is present i n the primate bra in . E n d o c r i n o l o g y 138: 5618-5629. Leung PC, Cheng CK, Zhu X M . 2003. Mu l t i - f ac to r i a l role o f G n R H - I and G n R H - I I i n the h u m a n ovary . M o l C e l l E n d o c r i n o l . 202: 145-153. Limonta P, Dondi D, Moretti R, Fermo D, Garattini E , Motta M. 1993. E x p r e s s i o n o f l u t e in iz ing hormone-releasing hormone m R N A i n the human prostatic cancer c e l l l ine L N C a P . J C l i n E n d o c r i n o l Me tab . 76: 797-800. Liu YX, Hu ZY, Feng Q, Zou RJ. 1991. Pa radox ica l effect o f a G n R H agonist on steroidogenesis i n cul tured m o n k e y granulosa cel ls . S c i C h i n a 34: 1452-60 . Abstract . Lucy MC, Savio JD, Badinga L , De La Sota RL, Thatcher WW. 1992. Factors that affect ovar ian fo l l i cu la r dynamics i n cattle. J A n i m S c i . 70: 3615-26. Maclellan L J , Bergfeld EG, Earl CR, Fitzpatrick LA, Aspden WJ, Kinder JE, Walsh J, Trigg TE, D'Occhio MJ. 1997. Influence o f the lu te in iz ing hormone-releasing hormone agonist, des lore l in , o n patterns o f estradiol-17B and lu te in iz ing hormone secretion, ovar ian fo l l i cu la r responses to super s t imulat ion w i t h fo l l ic le-s t imula t ing hormone, and recovery and in vitro development o f oocytes i n heifer calves. B i o l Reprod . 56: 878-84. Macmillan K L , Thatcher WW. 1991. Effects o f an agonist o f gonadotropin-releasing hormone o n ovar ian fo l l ic les i n cattle. B i o l Reprod . 45 : 883-9. Manikkam M , Rajamahendran R. 1997. Progesterone-induced atresia o f the proestrous dominant fo l l i c l e i n the bov ine ovary: changes i n diameter, i n su l in - l ike g rowth factor system, aromatase act ivi ty , steroid hormones, and apoptotic index. B i o l Reprod . 57: 580-587. 51 Mares SE, Zimbleman RG, Casida L E . 1962. V a r i a t i o n i n progesterone content o f the bov ine corpus lu teum o f the estrual cyc le . J A n i m S c i . 21:266-271. Matsumiya K, Meistrich ML, Shetty G, Dohmae K, Tohda A, Okuyama A, Nishimune Y. 1999. S t imula t ion o f spermatogonial differentiation i n juven i l e spermatogonial deple t ion (jsd) mutant m i c e b y gonadotropin-releasing hormone antagonist treatment. E n d o c r i n o l o g y 140: 4912-4915. Meistrich M L , Kangasniemi M. 1997. H o r m o n e treatment after i r radia t ion stimulates recovery o f rat spermatogenesis f rom su rv iv ing spermatogonia. J A n d r o l . 18: 80-87. Meistrich M L , Wilson G, Huhtaniemi 1.1999. H o r m o n a l treatment after cy to tox ic therapy stimulates recovery o f spermatogenesis. Cancer Res . 59: 3557-3560. Melson BE, Brown JL, Schoenemann HM, Tarnavsky Gk, Reeves JJ. 1986. E l e v a t i o n o f serum testosterone dur ing chronic L H R H agonist treatment i n the b u l l . J A n i m S c i . 62 : 199-207. Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B, Ott T, Millar M, Lincoln G, Sellar R, Faurholm B, Scobie G, Kuestner R, Terasawa E, Katz A. 2001. A n o v e l m a m m a l i a n receptor for the evolu t ionar i ly conserved type II G n R H . P r o c N a t l A c a d S c i U S A . 9 8 : 9 6 3 6 - 9 6 4 1 . Millar RP. 2002. G n R H II and type II G n R H receptors. Trends E n d o c r i n o l M e t a b . 14: 35-43 . Milvae RA, Hinekley ST, Carlson JC. 1996. Luteotropic and lu teolyt ic mechanisms i n bov ine corpus luteum. Ther iogeno logy 45:1327-1349. Milvae RA, Murphy BD, Hansel W. 1984. P ro longa t ion o f the bov ine estrous c y c l e w i t h a gonadotropin-releasing hormone analogue. B i o l Reprod . 31:664-670. Minaretzis D, Jakubowski M, Mortola JF, Pavlou SN. 1995. Gonadotropin-re leas ing hormone receptor gene expression i n human ovary and granulosa-lutein cel ls . J C l i n E n d o c r i n o l . Me tab . 80: 430-434. Minucci S, Di Matteo L, Pierantoni R, Varriale B, Rastogi RK, Chieffi G. 1986. In vivo and in vitro s t imulatory effect o f G n R H analog ( H O E 766) on spermatogonial mu l t i p l i ca t i on i n the frog, R a n a esculenta. E n d o c r i n o l o g y 119: 731-736. Miyamoto K, Hasegawa Y, Nomura M, Igarashi M, Kanagawa K, Matsuo H. 1984. Ident i f icat ion o f a second gonadotropin releasing hormone i n c h i c k e n hypothalamus: evidence that gonadotropin secretion is p robably contro l led b y two dist inct gonadotropin-releasing hormones i n av ian species. P roc N a t l A c a d S c i U S A . 81 : 3874-3878. Molcho J, Zakut H, Naor Z. 1984. S t imula t ion o f prostaglandin E and testosterone produc t ion i n rat interstit ial cel ls b y a gonadotropin-releasing hormone agonist. E n d o c r i n o l o g y 114: 2382-2387. 52 Momcilovic D, Archbald LF, Walters A, Tran T, Kelbert D, Risco CA and WW Thatcher. 1998. Reproduc t ive Performance o f Lac ta t ing D a i r y C o w s Treated w i t h Gonado t rop in - Re leas ing H o r m o n e ( G n R H ) and / or Pros taglandin F - 2 a lpha for S y n c h r o n i z i n g o f Estrus and Ovula t ion . Ther iogenology 50: 1131-1139. Morales M , Llanos M. 1996. Interaction o f human spermatozoa w i t h the zona pe l luc ida o f oocyte: Deve lopmen t o f the acrosome reaction. Front B i o . 1:146-160. Morales P. 1998. Gonadotropin-re leas ing hormone increases ab i l i ty o f the spermatozoa to b i n d to the human zona pe l luc ida . B i o Reprod . 59:426-430. Moumni M , Kottler M L , Counis R. 1994. Nuc leo t ide sequence analysis o f m R N A predicts that rat pi tui tary and gonadal gonadotropin-releasing hormone receptor proteins have ident ica l p r ima ry structure. B i o c h e m B i o p h y s Res C o m m u n . 200:1359-1366. Munson L , Bauman CS, Asa CS, Jochle W, Trigg TE. 2001. E f f i c a c y o f the G n R H analogue des lore l in for suppression o f oestrous cycles i n cats. J R e p r o d Fe r t i l . 57: 269-273 . (Supple) . Murdoch WJ, Van Kirk EA. 1998. Lu tea l dysfunct ion i n ewes induced to ovulate ear ly i n the fo l l i cu la r phase. E n d o c r i n o l o g y 139:3480-4. Nahum R, Beyth Y, Chun SY, Hsueh AJ, Tsafriri A. 1996. E a r l y onset o f deoxyr ibonuc le ic ac id fragmentation dur ing atresia o f preovula tory ovar ian fo l l ic les i n rats. B i o l Rep rod . 55:1075-1080. Natraj U, Richards JS. 1993. H o r m o n a l regulat ion, loca l iza t ion , and functional ac t iv i ty o f the progesterone receptor i n granulosa cel ls o f rat preovulatory fo l l ic les . E n d o c r i n o l o g y 133:761-769. Neill JD, Duck LW, Sellers JC, Musgrove L C . 2001. A gonadotropin-releasing hormone ( G n R H ) receptor specif ic for G n R H II i n primates. B i o c h e m B i o p h y s Res C o m m u n . 282:1012-1018. Nett T M , Akbar A M , Niswender GD. 1974. Serum levels o f lu te in iz ing hormone and gonadotropin-releasing hormone i n c y c l i n g , castrated and anestrous ewes. E n d o c r i n o l o g y 94: 713-718. Niswender GD, Juengel JL, McGuire WJ, Belfiore CJ, Wiltbank MC. 1994. Lu t ea l funct ion o f the estrous cyc le and early pregnancy. B i o l Reprod . 50:239-247. Niswender GD, Juengel JL, Silva PJ, Rollyson MK, Mclntush EW. 2000. M e c h a n i s m s con t ro l l ing the funct ion and l i fe span o f the corpus luteum. P h y s i o l . R e v i e w s . 80:1-29. 53 Niswender GD, Nett T M . 1988. The corpus lu teum and its control . In: E . K n o b i l and J . N e i l l (Ed. ) The P h y s i o l o g y o f reproduction, pp 489-525. R a v e n Press, N e w Y o r k . Ny T, Liu YX, Ohlsson M , Jones PB, Hsueh AJW. 1987. Regu la t ion o f tissue - t y p e p lasminogen activator ac t iv i ty and messenger R N A levels b y gonadotropin-releasing hormone gene i n cul tured rat granulosa cel ls and cumulus-oocyte complexes . J B i o l chem. 262: 11790-11793. Ohno T, Imai A, Furui T, Takahash K, Tamaya T. 1993. Presence o f gonadotropin-releasing hormone its messenger r ibonucle ic ac id i n human ovar ian epi thel ia l ca rc inoma. A m J Obstet G y n e c o l . 169: 605-610. Oikawa M , Dargan C, Ny T, Hsueh AJ, 1990. Express ion o f gonadotropin-releasing hormone and pro thymosin-a lpha messenger r ibonucle ic ac id i n the ovary . E n d o c r i n o l o g y 127: 2350-2356. Olofsson JI, Conti CC, Leung PCK. 1995. H o m o l o g o u s and heterologous regula t ion o f gonadotropin-releasing hormone receptor gene expression i n preovulatory rat granulosa cel ls . E n d o c r i n o l o g y 136: 974-980. Palmon A, Ben Aroya N, Tel-Or S, Burstein Y, Fridkin M, Koch Y. 1994. T h e gene for the neuropeptide gonadotropin-releasing hormone is expressed i n the m a m m a r y g land o f lactat ing rats. P r o c N a t l A c a d S c i U S A . 91 : 4994-4996. Palumbo A, Yeh J. 1994. In si tu loca l iza t ion o f apoptosis i n the rat ovary dur ing fo l l i cu la r atresia. B i o l Rep rod . 51:888-95. Parinaud J, Vieitez G, Beaur A, Pontonnier G, Boureau E. 1988. Effect o f lu te in iz ing hormone-releas ing hormone agonist (buserelin) on steroidogenesis o f cul tured human prevoula tory granlosa cel ls . Fe r t i l S ter i l . 50:597-602. Parinaud J, Oustry P, Bussenot I, Tourre A, Perineau M, Monrozies X, Reme JM, Pontonnier G. 1992. Pa radox ica l ovar ian s t imulat ion i n course o f treatment b y L H - R H analogs. E u r J Obstet G y n e c o l R e p r o d B i o l . 46:117-122. Paull WK, Turkelson C M , Thomas CR, Arimura A. 1981. Immunohis tochemica l demonstrat ion o f a testicular substance related to lu te in iz ing hormone-releasing hormone. Science . 213:1263-1264. Peng C, Fan NC, Ligier M , Vaananen J. 1994. Expres s ion and regula t ion o f G n R H and G n R H receptor m R N A i n H u m a n Granu losa Lu tea l C e l l s . E n d o c r i n o l o g y 135:1740-1746. Pieper DR, Richards JS. Marshall JC. 1981. Ova r i an gonadotropin-releasing hormone ( G n R H ) receptors: characterization, dis tr ibut ion, and induc t ion b y G n R H . E n d o c r i n o l o g y 108:1148-1155. 54 Piquette GN, LaPolt PS, Oikawa M, Hsueh AJW. 1991. Regu la t ion o f lu te in iz ing hormone receptor messenger r ibonucle ic ac id levels b y gonadotropins, g rowth factors, gonadotropin-releasing hormone i n cultured rat granulosa cel ls . E n d o c r i n o l o g y 128: 2449-2456. Powell JF, Zohar Y, Elizur A, Park M , Fischer WH, Craig AG, Rivier JE, Lovejoy DA, Sherwood NM. 1994. Three forms o f gonadotropin-releasing hormone characterized f rom brains o f one species. P roc N a t l A c a d S c i U S A . 91:12081-12085. Pursley JR, Kosorok MR, Wiltbank MC. 1997. Reproduct ive management o f lactat ing da i ry c o w s us ing synchroniza t ion o f ovula t ion . J D a i r y S c i . 80: 301-6. Pursley JR, Mee MO, Wiltbank MC. 1995. Synchroniza t ion o f ovu la t ion i n da i ry cows us ing P G F 2 a and G n R H . Ther iogenology 44:915-923. Raga F, Casan E M , Wen Y, Huang H, Polan ML. 1999. Independent regulat ion o f matr ix metalloproteinase-9, tissue inhibi tor o f metalloproteinase-1 ( T E M P - 1 ) , T I M P - 3 i n human endometr ia l s t romal cel ls b y G n R H : impl ica t ions i n ear ly human implanta t ion J C l i n E n d o c r i n o l M e t a b . 84: 636-642. Rajamahendran R, Sianangama PC. 1992. Effect o f human chor ion ic gonadotrophin o n dominant fo l l ic les i n cows : format ion o f accessory corpora lutea, progesterone product ion and pregnancy rates. J R e p r o d Fe r t i l . 95: 577-84. Rajamahendran R, Ambrose JD, Burton B. 1994. C l i n i c a l and research appl ica t ion o f real- t ime ul trasonography i n bovine reproduction. C a n V e t J . 35:563-572. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ, Thatcher WW. 1998. Effec ts , o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants o n p lasma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . The r iogeno logy 50:1141-55. Rajamahendran R, Lague PC, Baker RD. 1976. P l a s m a progesterone levels i n c y c l i n g and gonadotrophin-prostaglandin-treated heifers. C a n J A n i m S c i . 56:37-42. Rajamahendran R, Ambrose DJ, Small JA, Dinn N. 2001. Synchron iza t ion o f estrus and ovu la t ion i n cattle. A r c h . A n i m a l . B reed ing 44: special issue 58-67. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ. Thatcher WW. 1998. Effects o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants o n p l a sma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . The r iogeno logy 50:1141-1155. Ramakrishnappa N, Giritharan G, Aali M, Madan P, Rajamahendran R. 2003. G n R H receptor messenger G n R H receptor messenger r ibonucle ic ac id expression i n bov ine ovary. C a n J A n i m sc i . 83:825-828. 55 Ranta T, Knecht M , Kody M, Catt KJ. 1982. G n R H receptors i n cul tured rat granulosa ce l l s : media t ion o f the inh ib i to ry and st imulatory actions o f G n R H . M o l C e l l E n d o c r i n o l . 27: 233-40. Reeves JJ, Seguin C, Lefebvre FA, Kelly PA, Labrie F. 1980. S i m i l a r lu te in iz ing hormone-releas ing hormone b i n d i n g sites i n rat anterior pi tui tary and ovary . P roc . N a t l . A c a d . S c i . U S A . 77: 5567-5571. Reinhart J, Mertz L M , Catt KJ. 1992. M o l e c u l a r c l o n i n g and expression o f c D N A encod ing the mur ine gonadotropin-releasing hormone receptor. J B i o l C h e m . 67: 21281-1284. Rettmer I, Stevenson JS, Corah LR. 1992. Endocr ine responses and ovar ian changes i n inseminated da i ry heifers after an inject ion o f a G n R H agonist 11 to 13 days after insemina t ion . J A n i m S c i . 70:508-515. Richards JS. 1994. H o r m o n a l control o f gene expression i n the ovary. E n d o c r R e v . 15: 725-751 . Rivier J. 2001. G n R H Agon i s t s : the future .In: Lunenfe ld , B . (Eds . ) , G n R H analogues: the state o f the art 2001 . Parthenon, Lancaster, pp 1-14. Rodger LD, Stormshak F. 1986. Gonadotropin-releasing hormone- induced alteration o f bov ine corpus lu teum function. B i o l Rep rod , 35:149-56. Rueda BR, Tilly KI, Hansen TR, Hoyer PB, Tilly JL.1995a. Exp re s s ion o f super ox ide dismutase, catalase and glutathione peroxidase i n the bov ine corpus lu teum: evidence support ing a role for ox ida t ive stress i n luteolysis . E n d o c r i n o l o g y 3:227-232. Rueda BR, Wegner JA, Marion SL, Wahlen DD, Hoyer PB. 1995b. Internucleosomal D N A fragmentation i n ovine luteal tissue associated w i t h luteolysis : In Vivo and In Vitro analyses. B i o l Rep rod . 52:305-312. Rueda BR, Tilly KI, Botros IW, Jolly PD, Hansen YR, Hoyer PB, Tilly JL. 1997. Increased B a x and in te r leuk in- lb -conver t ing enzyme messenger r ibonuc le ic ac id levels co inc ide w i t h apoptosis i n the bovine corpus lu teum dur ing structural regression. B i o l Rep rod . 56:186-193. Saito H, Wang X, Saito T, Kaneko T, Hiroi M. 2000. Effects o f gonadotropin-releasing hormone agonist o n the incidence o f apoptosis i n porcine and human granulosa cel ls . G y n e c o l Obstet Invest. 49 : 52-6. Saragueta PE, Lanuza GM, and Raranao JL. 1997. Inhibi tory effect o f gonadotrophin-releasing hormone ( G n R H ) o n rat granulosa cel ls deoxyr ibonuc le ic ac id synthesis. M o l R e p r d D e v . 47:170-174. 56 Sasano H, Mason JI, Sasano N. 1989. h ru i iunohis tochemical analysis o f cy tochrome P -450 17a-hydroxylase i n p i g adrenal cortex, testis and ovary. M o l C e l l E n d o . 62: 197-202. Savio JD, Thatcher WW, Morns GR, Entwistle K, Drost M, Mattiacci MR. 1993. Effects o f induc t ion o f l o w p lasma progesterone concentrations w i t h a progesterone-releasing device o n fo l l i cu la r turnover and fert i l i ty i n cattle. J Rep rod Fe r t i l . 98:77-84. Schmitt EJ, Barros C M , Fields PA, Fields MJ, Diaz T, Kluge JM, Thatcher WW. 1996a. A cel lu lar and endocrine characterization o f the or ig ina l and induced corpus lu teum after adminis t ra t ion o f a gonadotropin-releasing hormone agonist or human chor ion ic gonadotropin o n day f ive o f the estrous cyc le . J A n i m S c i . 74:1915-1929. Schmitt EJ, Diaz T, Barros C M , de la Sota RL, Drost M, Fredriksson EW, Staples CR, Thorner R, Thatcher WW. 1996b. Different ia l response o f the luteal phase and fert i l i ty i n cattle f o l l o w i n g ovu la t ion o f the first-wave fo l l i c l e w i t h human chor ion ic gonadotropin or an agonist o f gonadotropin-releasing hormone. J A n i m Sci .74 :1074-1083. Sealfon SC, Weinstein H, Millar RP. 1997. M o l e c u l a r mechanisms o f l igand interaction w i t h the gonadotropin-releasing hormone receptor. E n d o c r R e v . 18:180-205. Sharpe 1982. C e l l u l a r aspects o f the inh ib i tory actions o f L H - R H o n the ovary and testis. J R e p r o d F e r t i l . 64: 517-527. Sharpe RM, Cooper I. 1982a. S t imula tory effect o f L H R H and its agonists o n L e y d i g c e l l steroidogenesis in vitro. M o l C e l l E n d o c r i n o l . 26:141-150. Sharpe RM, Cooper I. 1982b. V a r i a t i o n i n the steroidogenic responsiveness o f isolated rat L e y d i g cel ls . J R e p r o d Fer t i le . 65:475- 481 . Sharpe RM, Doogan DG, Cooper 1,1982. S t imula t ion o f L e y d i g c e l l testosterone secretion in vitro and in vivo i n hypophysec tomized rats b y an agonist o f lu te in iz ing hormone releasing hormone. B i o c h e m B i o p h y s Res C o m m u n . 106:1210-1217. Sharpe RM, Fraser HM. 1980a. H C G st imulat ion o f testicular L H R H - l i k e act ivi ty . Nature 287:642-643. Sharpe RM, Fraser HM. 1980b. L e y d i g ce l l receptors for lu te in iz ing hormone-releasing hormone and its agonists and their modula t ion b y administrat ion or depr ivat ion o f the releasing hormone. B i o c h e m B i o p h y s Res C o m m u n . 95: 256-262. Sharpe RM, Fraser HM. 1983. T h e role o f L H i n regulat ion o f L e y d i g c e l l responsiveness to an L H R H agonist. M o l C e l l E n d o c r i n o l . 33: 131-146. Sherwood NM, Lovejoy DA, Coe IR. 1993. O r i g i n o f m a m m a l i a n gonadotropin-releasing hormones. E n d o c r R e v . 14: 241 -254 . 57 Shikone T, Yamoto M , Kokawa K, Nishimori K, Nakano R. 1996. Apop tos i s o f human corpora lutea dur ing c y c l i c luteal regression and early pregnancy. J C l i n E n d o c r i n o l M e t a b 8 1 : 2 3 7 6 - 2 3 8 0 . Shupnik MA, 1996. Gonado t rop in gene modula t ion b y steroids and gonadotropin-releasing hormone. B i o l Rep rod . 54: 279-286. Shuttlesworth GA, de Rooij DG, Huhtaniemi I, Reissmann T, Russell LD, Shetty G, Wilson G, Meistrich ML. 2000. Enhancement o f A spermatogonial prol i fera t ion and differentiat ion i n irradiated rats b y gonadotropin-releasing hormone antagonist administrat ion. E n d o c r i n o l o g y 141: 37-49. Sridaran R, Hisheh S, Dharmarajan A M . 1998. Induct ion o f apoptosis b y a gonadotropin-releasing hormone agonist dur ing early pregnancy i n the rat. A p o p t o s i s 3: 51-57. Sridaran R, Lee MA, Haynes L, Srivastava RK, Ghose M , Sridaran G, Smith CJ, 1999a. G n R H act ion o n luteal steroidogenesis dur ing pregnancy. Steroids. 64: 618-623. Sridaran R, Philip GH, Li H, Culty M , Liu Z, Stocco DM, Papadopoulos V. 1999b. G n R H agonist treatment decreases progesterone synthesis, luteal per ipheral benzodiazepine receptor m R N A , l igand b ind ing , steroidogenic acute regulatory prote in expression dur ing pregnancy. J M o l E n d o c r i n o l . 22 : 45-54. Steele GL, Leung PCK. 1993. S igna l transduction mechanisms i n ovar ian cel ls . In: A d a s h i , E . Y . and L e u n g , P . C . K . (Eds.) , The Ovary . R a v e n Press, N e w Y o r k , pp.113-127. Stevenson JS, Call EP, Scoby RK, Phatak AP. 1990. D o u b l e insemina t ion and gonadotropin-releasing hormone treatment o f repeat-breeding da i ry cattle.J D a i r y S c i . 73:1766-72. Stojilkovic SS. Catt KJ. 1995. Express ion and s ignal t ransduction pathways o f gonadotropin-releasing hormone receptors. R e c . P rog . H o r m . Res . 50:161-205. Taponen J, Hjerppe P, Kopra E, Rodriguez-Martinez H, Katila T, Kindahl H. 2003. Premature prostaglandin F2a lpha secretion causes luteal regression i n G n R H - i n d u c e d short estrous cyc les i n c y c l i c da i ry heifers. Ther iogenology 60:379-93. Taponen J, Katila T, Rodriguez-Martinez H. 1999. Induct ion o f ovu la t ion w i t h gonadotropin-releasing hormone dur ing proestrus i n cattle: influence o n subsequent fo l l i cu la r g rowth and luteal function. A n i m R e p r o d S c i . 55 :91-105 . Taponen J, Kulcsar M, Katila T, Katai L , Huszenicza G, Rodriguez-Martinez H. 2002. Short estrous cycles and estrous signs after premature ovulat ions induced w i t h c loprostenol and gonadotropin-releasing hormone i n c y c l i c da i ry cows. Ther iogeno logy 58 :1291-302 . 58 Taponen J, Rodriguez-Martinez H, Katila T. 2000. A d m i n i s t r a t i o n o f gonadotropin-releasing hormone dur ing metoestrus i n cattle: influence o n luteal funct ion and cyc le length. A n i m R e p r o d S c i . 64 :161-9 . Taylor C, Rajamahendran R. 1991. F o l l i c u l a r dynamics , corpus lu teum growth and regression i n lactating da i ry cattle. C a n J A n i m S c i . 71:61-68. Tensen C, Okuzawa K, Blomenrohr M, Rebers F, Leurs R, Bogerd J, Schultz R, Goos H. 1997. D i s t inc t efficacies o f two endogenous l igands o n a single cognate gonadol iberm receptor. E u r J B i o c h e m . 243:134-140. Thatcher WW, Drost M , Savio JD, Macmillan K L , Entwistle KW, Schmitt RL, de La Sota RL, Morris GR. 1993. N e w c l i n i c a l uses o f G n R H and its analogues i n cattle. A n i m R e p r o d S c i . 33:27-49. Tilly JL. 1996. T h e molecula r basis o f ovar ian c e l l death dur ing germ c e l l attrition, fo l l i cu la r atresia, and luteolysis . Frontiers i n B iosc ience . 1:1-11. Tilly JL, Hsueh AJ. 1993. M i c r o s c a l e autoradiographic method for the quali tat ive and quantitative analysis o f apoptotic D N A fragmentation. J C e l l P h y s i o l . 154:519-526. Tilly JL, Lapolt PS, Hsueh AJW. 1992. H o r m o n a l regulat ion o f fo l l i c l e - s t i m u l a t i n g hormone receptor messenger r ibonucle ic ac id levels i n cul tured rat granulosa cel ls . E n d o c r i n o l o g y 130: 1296-1302. Trigg TE, Wright PJ, Armour AF, Williamson PE, Junaidi A, Martin GB, Doyle AG, Walsh J. 2001. U s e o f a G n R H analogue implant to produce reversible long- term suppression o f reproductive function i n male and female domest ic dogs. J R e p r o d Fe r t i l . 57: 255-261 . (Supple) . Troskie B, Illing N , Rumbak E, Sun Y M , Hapgood J, Sealfon S, Conklin D, Millar R. 1998. Identif icat ion o f three putative G n R H receptor subtypes i n vertebrates. G e n . C o m p . E n d o c r i n o l . 112:296-302. Tsutsumi M , Zhou W, Millar RP, Mellon PL, Roberts JL, Flanagan CA, Dong K, Gillo B, Sealfon SC. 1992. C l o n i n g and functional expression o f a mouse gonadotropin-releasing hormone receptor. M o l E n d o c r i n o l . 6:1163-9. Twagiramungu H, Guilbault LA, Dufour JJ. 1995. Synchron iza t ion o f ovar ian fo l l i cu la r waves w i t h a gonadotropin-releasing hormone agonist to increase the p rec i s ion o f estrus i n ' cattle: a r ev iew. J A n i m S c i . 73:3141-3151. Ullah G, Fuquay JW, Keawkhong T, Clark BL, Pogue DE, Murphey EJ. 1996. Effect o f gonadotropin-releasing hormone at estrus o n subsequent luteal funct ion and fert i l i ty i n lactating Hols te ins dur ing heat stress. J D a i r y S c i . 79:1950-1953. 59 van Biljon W, Wykes S, Scherer S, Krawetz SA, Hapgood J. 2002. T y p e II gonadotropin-releasing hormone receptor transcripts i n human sperm. B i o l Rep rod . 67:1741-1749. Verhoeven G, Cailleau J. 1985. A factor i n spent med ia from Ser to l i -ce l l -enr iched cultures that stimulates steroidogenesis i n L e y d i g cel ls . M o l C e l l E n d o c r i n o l . 40:57-68. Vizcarra JA, Wettemann RP, Braden TD, Turzillo AM, Nett T M . 1997. Effect o f gonadotropin-releasing hormone ( G n R H ) pulse frequency o n serum and pi tui tary concentrations o f lu te in iz ing hormone and fo l l ic le-s t imula t ing hormone, G n R H receptors, and messenger ribonucleic ac id for gonadotropin subunits i n cows . E n d o c r i n o l o g y 138: 594-601 . Vizcarra JA, Wettemann RP, Morgan GL. 1999. Influence o f dose, frequency, and durat ion o f infused gonadotropin-releasing hormone o n secretion o f lu te in iz ing hormone and fo l l i c le - s t imula t ing hormone i n nutr i t ional ly anestrous beef cows . Domes t A n i m E n d o c r i n o l . 16:171-81. Volker P, Grundker C, Schmidt O, Schulz KD, Emons G. 2002. E x p r e s s i o n o f receptors for l u t e in i z ing hormone-releasing hormone i n human ovar ian endometr ia l cancers: frequency, autoregulation, and correlat ion w i t h direct antiproliferative ac t iv i ty o f lu te in iz ing hormone releasing hormone analogues. A m J Obstet G y n e c o l . 186:171-179. Weesner GD, Matteri RL. 1994. R a p i d communica t ion : nucleot ide sequence o f lu te in iz ing hormone-releas ing hormone ( L H R H ) receptor c D N A i n the p i g pituitary. J A n i m S c i . 72:1911-1911. White RB, Eisen JA, Kasten TL, Fernald RD. 1998. Second gene for gonadotropin-releasing hormone i n humans. P roc N a t l A c a d S c i U S A . 95: 305-309. White SA, Kasten T L , Bond, CT, Adelman JP, Fernal, RD. 1995. Three gonadotropin releasing hormone genes i n one organism suggest nove l roles for an ancient peptide. P r o c N a t l A c a d S c i U S A . 92:8363-8367. Whitelaw PF, Eidne KA, Sellar R, Smyth CD, Hillier SG. 1995. Gonadotropin-re leas ing hormone receptor ribonucleic ac id expression i n rat ovary. E n d o c r i n o l o g y 136: 172-179. Wong WY, Richards JS. 1992. Induct ion o f prostaglandin H synthase i n rat provula tory fo l l ic les b y gonadotropin-releasing hormone. E n d o c r i n o l g y . l 3 0 : 3 5 1 2 - 3 5 2 1 . Yang MY, Rajamahendran R. 2000a. Involvement o f apoptosis i n the atresia o f nonovula tory dominant fo l l i c l e dur ing the bovine estrous cyc le . B i o l R e p r o d . 63:1313-21. Yang MY, Rajamahendran R. 2000b. M o r p h o l o g i c a l and b i o c h e m i c a l ident i f ica t ion o f apoptosis i n smal l , m e d i u m , and large bov ine fol l ic les and the effects o f fo l l i c le -s t imula t ing hormone and in su l in - l i ke growth factor-I on spontaneous apoptosis i n cul tured bov ine granulosa cel ls . B i o l . Rep rod . 62:1209-1217. 60 Ying SY, Ling N, Bohlen P, Guillemin R. 1981. Gonadocr in ins : peptides i n ovar ian fo l l i cu la r f l u i d s t imulat ing the secretion o f pi tui tary gonadotropins. E n d o c r i n o l o g y 108: 1206-1215. Yuan W, Giudice L C . 1997. P rogrammed c e l l death i n human ovary is a funct ion o f fo l l i c l e corpus lu teum status. J C l i n E n d o c r i n o l Me tab . 82: 3148-3155. Zemjanis R. 1980. "Repeat-breeding" or conceptionfai lure i n cattle. In M o r r o w , D . A . (ed.). Cur ren tTherapy i n Ther iogeno logy W,B .Saunde r s C o . Ph i lade lph ia , P A . Zerani M , Gobetti A , Mosconi G, Novara C, Botte V. 1991. M a m m a l i a n G n R H and poss ible paracrine regulat ion o f the gonad i n the green frog, R a n a esculenta. B o l l Z o o l . 58: 77-79. Zhao S, Saito H, Wang X, Saito T, KanekoT, Hiroi M . 2000. Effects o f gonadotropin-releasing hormone agonist o n the incidence o f apoptosis i n porc ine human granulosa cel ls . G y n e c o l Obstet Invest. 49 : 52-56. 61 C H A P T E R 2 G n R H - R A N D G n R H mRNA E X P R E S S I O N IN T H E B O V I N E O V A R Y 2.1. A B S T R A C T T h i s study was undertaken to investigate the m R N A expression for G n R H receptor and its l igand , G n R H , i n the bov ine ovary. Granu losa cel ls from sma l l (<4 m M ) , m e d i u m (5-8 m M ) and large fo l l ic les (>8 m M ) and tissues f rom different staged C L [Stage I ( D a y 1-4), Stage II ( D a y 5-10), Stage III ( D a y 11-17), and Stage TV ( D a y 18-21, days after ovulat ion)] , were harvested from bov ine ovaries col lected at a l oca l abattoir. The m R N A isolated from ' representative samples was subjected to R T - P C R us ing gene sequence specif ic pr imers . The expected s ized P C R ampl icons were detected through southern hybr id i za t ion procedure, and the sequence identi ty ( G n R H - R ) was conf i rmed through nucleot ide sequence analysis . The results were s h o w n to be posi t ive for the presence o f G n R H - R m R N A expression i n both fo l l ic les and C L . Mode ra t e ly higher levels o f G n R H - R transcripts were evident i n granulosa cel ls from sma l l fo l l ic les , whereas s l igh t ly lower , but un i form, expression levels were evident i n bo th m e d i u m and large fo l l ic les . A m o n g different staged C L , G n R H - R transcripts were c lea r ly detectable i n stage III luteal tissues, where as the expression levels were s l igh t ly l ower i n stage II, and bare ly or not detectable i n stage I and I V luteal tissues. W i t h respect to G n R H m R N A expression i n bov ine fo l l ic les , p re l iminary f indings f rom R T - P C R studies revealed the evidence for the possible presence o f G n R H m R N A expression i n granulosa cel ls from different staged fol l ic les . 62 2.2. INTRODUCTION G n R H is a neuronal secretary decapeptide that p lays a central role i n reproduct ive processes through s ignal ing , synthesis and release o f gonadotropins, L H and F S H , f rom the anterior pituitary. A l t h o u g h it is an indisputable fact that hypothalamus and pi tui tary are respect ively the p r inc ipa l source o f G n R H and its target sites, recent reports con f i rm the extra-hypothalamic o r ig in o f more than one type o f G n R H peptide, as w e l l as the presence o f its cogni t ive receptor types i n extra-pituitary tissues i n the body . Reproduc t ive tissues such as ovaries, placenta, endometr ium, oviducts , and testes have been shown to be pos i t ive for the G n R H and G n R H - R m R N A , or functional forms o f respective prote in molecules , across different laboratory species (rats, p igs , and monkeys) and i n humans. Numerous studies have also demonstrated the direct effects o f G n R H at the ovar ian ce l lu lar l eve l (sect ion 1.2.5 and 1.2.6; C H A P T E R 1). T h e earliest report o f evidence for the presence o f ovar ian G n R H receptors was the demonstrat ion o f h igh affinity b i n d i n g sites for G n R H i n rodent species ( C l a y t o n et a l . , 1979; Jones et a l . , 1980; Pieper et a l . , 1981; D e k e l et a l . , 1988). Despi te in i t i a l conf l i c t ing reports, subsequent studies i n humans have successful ly demonstrated G n R H receptor expression i n the ovary. Presence o f h i g h aff ini ty G n R H receptors o n granulosa cel ls (Latouche et a l . , 1989), ands l o w affinity b i n d i n g sites i n corpus lu teum ( C L ) (Latouche et a l . , 1985), has been conf i rmed through b i n d i n g or auto-radiographic studies. Further, the ava i lab i l i ty o f powerfu l tools i n the field o f molecu la r b i o l o g y has enabled researchers to gain deeper insight w i t h respect to G n R H or G n R H receptor gene expression, and its regulat ion. T h e nucleot ide sequence o f human G n R H receptors c D N A was deduced us ing the R T - P C R technique ( K a k a r et a l . , 1992). Later, s imi l a r studies conf i rmed the nucleot ide sequence o f G n R H and its receptor i n human granulosa cel ls (Peng et a l . , 1994; 63 M i n a r e t z i s et a l . , 1995). Studies o n the regulat ion o f the ovar ian G n R H receptor m R N A showed that G n R H up-regulates, and h C G down-regulates the G n R H receptor gene express ion (Peng et a l . , 1994). Further, several observations from both in vivo, and in vitro m o d e l studies i n rodents, primates and humans, p rov ided evidence that G n R H can affect the fate and funct ion o f ovar ian cel ls through its direct act ion o n them ( reviewed b y Janssens et a l . , 2000; L e u n g et a l . , 2003). Interestingly, there is an apparent pauci ty o f informat ion w i t h regards to the poss ible existence o f G n R H - R and G n R H system, and its direct involvement i n modu la t ion o f ovar ian funct ion l o c a l l y i n bov ine species. Based o n o n l y a l imi t ed number o f studies, the conc lus ion was d rawn that the bov ine species lacks the ovar ian expression o f G n R H receptor m R N A , or its funct ional prote in ( B r o w n and Reeves, 1983; Net t et a l . , 1987; K a k a r et a l . , 1993). H o w e v e r , there is at least one study that has revealed the presence o f G n R H receptor m R N A i n bov ine cumulus-oocyte complex cel ls b y us ing R T - P C R technique (Funston and Se ide l , 1995). Therefore, there is a clear indica t ion that more studies are needed i n order to explore the presence o f G n R H - R and G n R H system i n bovine ovar ian structures, fo l l i c l e and C L . Hence , the current study was undertaken w i t h the objective o f exp lo r ing for the presence o f m R N A expression for G n R H receptor and its l igand, G n R H , i n bov ine ovar ian structures, fo l l i c l e and C L . 64 2.3. MATERIALS AND METHODS 2.3.1. Collection of bovine ovaries and classification of follicles and C L B o v i n e ovaries were col lected at a loca l abattoir w i t h i n 15 to 20 m i n after exsanguinations. Pa i red ovaries from each an imal were separately packed i n w h i r l pack plast ic bags conta in ing i ce -co ld D M E M / F T 2 culture m e d i u m . Ovar ies were transported to the laboratory o n ice w i t h i n 3 to 4-h after co l lec t ion . Immediate ly upon ar r iva l at the laboratory, each pa i r o f ovaries was examined carefully, and the exis t ing fo l l ic les were c lass i f ied into different categories according to p rev ious ly established cri ter ia ( K r u i p and D i e l e m a n , 1982; Y a n g and Rajamahendran, 2000). Based on fo l l i c l e diameter and morpho log i ca l appearance, fo l l i c les were c lass i f ied as sma l l (<4 m m ) , m e d i u m (5-8 m m ) and large fo l l ic les (>8 m m diameter). T h e stage o f exis t ing C L was determined and categorized into one o f four stages based o n their gross appearance, size o f the c rown , and shape (Ireland et a l . , 1980). T h e four stages were , Stage I (Day , 1-4); Stage II (Day , 5-10); Stage III (Day , 11-17) and Stage I V (Day , 18-21), after ovula t ion . Batches o f 6 to 8 pairs o f ovaries were obtained dur ing each v is i t to the abattoir, and at least 5 different pools o f granulosa cel ls from each stage o f fo l l i c les , and at least 6 different tissue samples from each stage o f C L were examined i n this study. 2.3.2. Aspiration of follicles and granulosa cell processing F o l l i c u l a r f l u id conta ining granulosa cel ls was aspirated from different s ized fo l l ic les u s ing a 1 0 - m L plast ic syringe w i t h 18 gauge needle. F o l l i c u l a r f l u id f rom each category o f fo l l i c les was poo led and kept separately i n heparin-dusted 15 m L F a l c o n tubes. F o r sma l l fo l l i c les , about 1 m L o f sterile phosphate buffered saline ( P B S ) so lu t ion was used i n order to 65 facilitate retr ieval o f granulosa cel ls into the syringe. M e d i u m and large fo l l ic les were aspirated wi thout us ing P B S . D u r i n g aspiration o f each fo l l i c l e , fo l l i cu la r f l u id was repeatedly aspirated and expel led into the fo l l i c l e several t imes to m a x i m i z e the recovery o f granulosa cel ls . Tubes containing fo l l icu la r f l u id were he ld o n ice dur ing the pe r iod o f aspiration. F o l l i c u l a r aspirates were centrifuged at 400 x G for 10 m i n at 4 ° C and the supernatants were discarded. Depend ing o n the size o f the remain ing granulosa c e l l pellet , 1 to 2 m L o f T r i Reagent so lu t ion ( S i g m a - A l d r i c h Canada L t d . O a k v i l l e , O N ) was added di rec t ly to the F a l c o n tubes. Contents were thoroughly m i x e d b y repeated pipet t ing un t i l the complete d isso lu t ion o f c e l l pellet into to a un i fo rm homogenate. A t this stage, i n d i v i d u a l samples were either processed immediate ly , or stored at - 7 5 ° C un t i l the next day, for cont inued w i t h total R N A isola t ion. 2.3.3. Processing of C L tissues U p o n ident i fy ing the stage o f each C L , about 200 m g o f luteal tissue was harvested from the central port ions o f each C L mass, and immedia te ly transferred into a 50 m L F a l c o n tubes conta in ing 2 to 3 m L o f T r i Reagent solut ion. Care was taken to a v o i d us ing C L w i t h larger cavi t ies , or from pregnant animals dur ing the co l lec t ion process. T h e luteal tissues were then homogen ized us ing a l o w speed motor-operated tissue homogen iza t ion meta l l i c probe. The resultant homogenate mixtures were either used immedia te ly for total R N A iso la t ion , or stored at -75 ° C for subsequent use. 66 2.3.4. Collection and processing of bovine pituitary and hypothalamus tissues A bov ine (cow) head w i t h an intact s k u l l was col lected at the l o c a l abattoir and transported to the laboratory on ice. The sku l l bone was cut us ing a hand-held electric saw, and the intact bra in , a long w i t h pi tui tary gland, was careful ly l if ted f rom the s k u l l cavi ty , and thoroughly washed w i t h i ce -co ld phys io log i ca l saline solut ion. The pi tui tary g land was careful ly separated f rom its capsule and surrounding vascular structures, and immedia te ly frozen o n d r y ice . Cerebra l hemispheres were cut apart through the mid-sagi ta l sect ion us ing a scalpel and bra in tissue explants from the hypothalamus area were harvested and immedia te ly frozen o n dry ice . B o t h the pi tui tary and hypothalamus samples were either stored at - 7 5 ° C , or immedia te ly processed for total R N A and m R N A iso la t ion , i n a s imi l a r fashion to those o f C L tissues. 2.3.5. Total R N A and mRNA isolation from granulosa cells, C L , pituitary, and hypothalamus tissues T o t a l R N A was isolated f o l l o w i n g a single-step R N A iso la t ion method ( C h o m c z y n s k i and Sacch i , 1987) us ing a total R N A isola t ion solut ion, T r i Reagent. B r i e f l y , 1 m L o f homogenate mix ture prepared f rom granulosa cel ls , or respective tissue samples ( C L , pi tui tary and hypothalamus) were transferred to sterile 1.5 m L micro-centr i fuge tubes, and samples were a l l owed to sit for 5 m i n at r o o m temperature to facilitate complete d isso lu t ion o f nuclear proteins and c e l l w a l l components. T w o hundred u.1 o f ch lo ro fo rm per each 1 m L o f i n i t i a l v o l u m e o f T r i Reagent so lu t ion was added to each tube, and samples were agitated v i g o r o u s l y for 30 s. A g a i n , the samples were a l l owed to stand at r o o m temperature for 10 to 15 m i n , and then centrifuged at 12000 x G for 15 m i n at 4 ° C . The top layer o f a clear 67 so lu t ion conta in ing total R N A molecules was careful ly transferred into a new set o f sterile micro-centr i fuge tubes. F o r each tube, 0.5 m L o f isopropanol (per each 1 m L in i t i a l v o l u m e o f T r i Reagent solution) was added and samples were a l l owed to stand for 15 m i n at r o o m temperature. Samples were again centrifuged at 12000 x G for 10 m i n at 4 ° C , and the supernatant so lu t ion was careful ly discarded . The resultant R N A pellet was washed two t imes w i t h 75 % ethanol and f ina l ly the R N A pellet was d i sso lved i n sterile, D E P C treated water. T h e quanti ty and qual i ty o f the total R N A was assessed b y both spectrophotometry, and b y observ ing clear bands for 28S and 18S ribosomal R N A species o n e th id ium bromide stained, 0 .8% agarose gels. To ta l R N A was either used immedia te ly for m R N A iso la t ion or stored at - 7 5 ° C for subsequent use. U s i n g total R N A from the representative samples o f fo l l i c les , C L , and pi tui tary tissues, P o l y ( A + ) R N A was isolated us ing a c o m m e r c i a l l y avai lable m R N A Isolat ion K i t (Roche M o l e c u l a r B i o c h e m i c a l s , L a v a l , Q C ) . B r i e f l y , a k n o w n amount o f total R N A from respective samples was hybr id i zed w i t h a biot in- labeled o l igo (dT)20 probe. T h i s mixture was added to separate micro-centr ifuge tubes conta ining streptoavidin magnet ic particles that were prepared ^earlier. Tubes were incubated for 5 m i n at 3 7 ° C . T h e resultant P o l y ( A + ) R N A - S t r e p t o a v i d i n magnet ic part icle h y b r i d mixture was separated from the rest o f the R N A species b y subjecting to a M a g n e t i c Part ic le Separator (Cat. N o . 1641794, R o c h e M o l e c u l a r B i o c h e m i c a l s , L a v a l , Q C ) . Further, the magnetic pa r t i c le -Po ly ( A + ) R N A mix ture was washed twice w i t h wash ing buffer. F i n a l l y the bound P o l y ( A + ) R N A was eluted into the RNase-free water, b y incubat ing 2 m i n at 6 5 ° C , fo l lowed b y separation o f magnetic particles from the f l u id por t ion , w h i c h contains P o l y ( A + ) R N A molecules . The qua l i ty and quantity o f 68 P o l y (A + ) R N A was determined spectrophotometrically. P o l y ( A + ) R N A samples were either used immedia te ly for R T - P C R or stored i n aliquots at - 7 5 ° C . A l l buffers used i n this p ro toco l were suppl ied as part o f the ki t . 2.3.6. Detection of G n R H - R mRNA expression in granulosa cells and C L tissue 2.3.6.1. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Unles s otherwise specif ied, the R T - P C R protocols used i n this study were accompl i shed b y u t i l i z i n g a c o m m e r c i a l l y avai lable R T - P C R - 2 0 K i t ( S i g m a - A l d r i c h Canada L t d . O a k v i l l e , O N ) . In i t ia l ly , the amount o f template m R N A , magnes ium concentrat ion, compa t ib i l i t y o f p r imer pairs, and P C R cyc le number were tested to determine op t ima l condi t ions for R T - P C R (data not shown). A b o u t 200 to 500 n g (depending o n the source, e.g. 200 n g f rom pi tui tary and 500 ng from granulosa cel ls and C L tissues) o f P o l y ( A + ) R N A from each sample was reverse transcribed ( R T ) for 1 hour at 4 2 ° C , as per k i t guidel ines. T h e gene sequence specif ic 3 ' end antisense pr imers for both G n R H - R and a housekeeping gene, G 3 P D H , were u t i l i zed for the R T step. The internal control , G 3 P D H , was co-ampl i f i ed w i t h the G n R H receptor sequence i n order to ascertain the qual i ty o f the template R N A , and to insure the success o f R T - P C R reactions. Components inc luded i n R T react ion were: 50 m M T r i s - H C I ( p H 8.3), 40 m M K C I , 8 m M M g C l 2 , 1 m M D T T , 0.5 m M each d N T P , 20 U Enhanced A M V reverse transcriptase, 20 U R N a s e inhibi tor , and m R N A from fo l l i cu la r granulosa ce l l s or luteal tissues. A 5 u,l o f the R T sample representing about 50 n g (pituitary) or 125 n g (granulosa cel ls or luteal tissue) o f P o l y ( A + ) R N A , was used to co -ampl i fy both G n R H - R and G 3 P D H sequences i n the 50 u.L react ion vo lume . P C R m i x was compr i sed o f 1 x P C R buffer (10 m M T r i s - H C I / p H 8.3, 50 m M K C I , 1.5 m M M g C l 2 , 0.001 % gelat in, 2 % 69 D M S O v / v ) , 200 u M each d N T P , 400 n M o f each gene specif ic pr imers ( forward and reverse), 2.5 U o f A c c u T a q L A D N A polymerase, and the required amount o f water to make up the f ina l v o l u m e o f 50 p L reaction m i x . The pr imer pairs der ived from respective c D N A sequences, bov ine pi tui tary G n R H - R (Access#: U 0 0 9 3 4 ) and bov ine G 3 P D H (Access #: A J 0 0 0 0 3 9 ) were used to ampl i fy an approximate size o f a 920 bp and a 320 bp P C R fragments for G n R H - R and G 3 P D H , respect ively (Table 1.1). In order to main ta in the exponent ia l P C R condi t ions for both G n R H - R and G 3 P D H , different sets o f P C R cycles were performed for fo l l ic les (33 & 20), C L (35 & 21), and pi tui tary (26 & 20) samples (data not shown) . Pr imers for G 3 P D H were dropped i n to P C R reactions at a specif ied cyc l e number dur ing P C R ampl i f ica t ion ( W o n g et a l . , 1994). C o n t r o l reactions inc luded P o l y ( A + ) R N A from bov ine pituitary, wi thout m R N A template, and wi thout reverse transcriptase enzyme, to ensure the successful ampl i f ica t ion o f the expected P C R ampl i con , lack o f cross contaminat ion, and the absence o f genomic D N A ampl i f ica t ion , respect ively. Af t e r an in i t i a l denaturation step o f 3 m i n at 9 5 ° C , the P C R was carr ied out for the appropriate number o f cyc les of: a denaturing step o f 1 m i n at 9 4 ° C , an anneal ing step o f 1 m i n at 5 8 ° C , and an extension step o f 1 m i n at 7 2 ° C , f o l l owed b y a f inal extension step o f 10 m i n at 7 2 ° C . 2.3.6.2. Southern transfer of PCR products A l i q u o t s (pituitary 10 p L , granulosa cel ls 15 p i and luteal tissues 20 p i ) o f P C R products were electrophoresed on a 1.5 % agarose ge l and transferred onto the n y l o n membranes. B r i e f l y , the agarose gel-resolved P C R ampl icons were subjected to the a lka l ine denaturation for 20 m i n i n 0.4 M sod ium hydroxide solut ion, and the denatured D N A strands were transferred onto pos i t ive ly charged n y l o n membranes (Hybond-NT, A m e r s h a m B i o t e c h 70 U K L t d . Buck inghams i r e , England) b y f o l l o w i n g the cap i l l a ry transfer method i n 0.5 M sod ium hydrox ide solut ion. F o l l o w i n g overnight transfer, the transfer set up was dismant led, the membranes were ident if ied, and the i nd iv idua l lanes were marked . In order to remove agarose residues, the membranes were washed i n 2 x S S C solu t ion for 2 m i n at r o o m temperature, air-dried, and the membranes were either used immedia te ly for hyb r id i za t ion or stored at - 2 0 ° C . 2.3.6.3. Preparation of chemiluminescentprobe and hybridization R T - P C R ampl i f i ed gene specific sequences o f both G n R H - R (750 bp) and G 3 P D H (320 bp) served as the source o f material for preparation o f chemiluminescent D N A probes ( E C L T M , D i r ec t N u c l e i c A c i d L a b e l i n g Detec t ion System, A m e r s h a m B i o t e c h U K L t d . B u c k i n g h a m s i r e , Eng land) . B r i e f l y , D N A fragments o f an approximate size, 750 bp G n R H - R and a 320 bp G 3 P D H , were generated through R T - P C R b y us ing m R N A isolated f rom bov ine pi tui tary and luteal tissues, respectively. The D N A fragments were reso lved o n 1 % agarose ge l , and extracted us ing ge l extraction k i t ( Q I A q u i c k G e l Ex t rac t ion K i t , Qu iagen Inc. Mis s i s sauga , O N ) . The sequence identi ty o f the respective P C R ampl icons was conf i rmed through nucleot ide sequence analysis. The required amount o f gel pur i f ied D N A (10 n g / m L ) was denatured for five m i n i n a b o i l i n g water bath and immedia te ly p laced o n ice for 5 m i n . Tube contents were centrifuged br ie f ly and an equal amount o f l abe l ing reagent was added and thoroughly m i x e d b y repeated pipett ing. Subsequently, an equal amount o f glutaraldehyde so lu t ion was added, m i x e d and once again centrifuged b r i e f ly to concentrate tube contents at the bot tom. L a b e l i n g was cont inued b y incubat ing the tubes at 3 7 ° C for 20 71 m i n , and then the probe was used immediate ly , or stored i n 50 % g lyce ro l at - 2 0 ° C for subsequent use. H y b r i d i z a t i o n o f resultant D N A blots and s ignal detection was carr ied out b y us ing an E C L D i r ec t N u c l e i c A c i d L a b e l i n g k i t ( E C L T M , Di rec t N u c l e i c A c i d L a b e l i n g Detec t ion Sys tem, A m e r s h a m B i o t e c h U K L t d . Buck inghams i re , Eng land) as per manufacture's instructions. B r i e f l y , the hybr id iza t ion buffer was prepared freshly b y m i x i n g b l o c k i n g agent (suppl ied w i t h the ki t ) and analyt ical grade N a C I to the concentrat ion o f 5 % and 0.5 M , respect ively. Buf fe r contents were m i x e d thoroughly b y st i rr ing for 1 hour at r o o m temperature, f o l l owed b y m i x i n g at 4 2 ° C for 30 m i n . Membranes were p re -hybr id ized for 1 hour at 4 2 ° C , then a labeled probe was added at the concentrat ion o f 10 n g / m L o f hybr id i za t ion buffer. A further hybr id iza t ion process was carr ied out over night at 4 2 ° C w i t h gentle shaking. B l o t s were washed (2 x 20 m i n cycle) i n p r imary w a s h buffer (0.5 x S S C , p H 7.0, 0.4 % S D S , 6 M urea) at 4 2 ° C , f o l l owed b y a secondary was h two times w i t h 2 x S S C at r o o m temperature. E a c h secondary wash lasted for 5 m i n w i t h gentle agitation. F o l l o w i n g wash ing , the detection solu t ion was added to the membranes for one m i n , and the excess detection reagent was q u i c k l y blot ted d ry from the membranes. Signals were recorded through autoradiography b y us ing E C L f i lms ( A m e r s h a m B i o t e c h U K L t d . Buck inghams i r e , England) . T h e probe-target specif ic i ty and the absence o f cross react ion between G 3 P D H and G n R H - R probes were examined b y h y b r i d i z i n g the uncut membranes either w i t h o n l y G 3 P D H probe, or G n R H - R probe alone i n separate hybr id iza t ion steps (data not shown) . 72 2.3.6.4. Sequence analysis of PCR amplicons (GnRH-R) T h e P C R ampl i f i ed G n R H - R fragments ( -920 bp) generated dur ing the first round R T - P C R (from bov ine granulosa ce l ls , C L and pi tui tary tissues) step were subjected to a nested P C R ampl i f ica t ion . The identi ty o f the nested P C R ampl i f ied , D N A products were conf i rmed through nucleot ide sequence analysis (F ig . 2.3). 2.3.6.5. Nested PCR amplification of GnRH-R sequence and nucleotide analysis T h e internal pr imers , f lanking a 750 bp s ized P C R fragment w i t h i n the sequence length o f a 920 bp first round R T - P C R , G n R H - R D N A fragment used are i l lustrated i n F i g . 2 . 2 A and B . The internal p r imer pai r (Table. 1.1) used i n nested P C R was p rev ious ly tested and publ i shed (Funston and Se ide l , 1995). A b o u t 2 p i o f first round R T - P C R D N A sample, representing each sma l l fo l l i c l e and C L tissue, was used to ampl i fy the second round G n R H -R D N A sequences (750 bp) i n 50 p L reaction volumes . P C R m i x was compr i sed o f 1 x P C R buffer (10 m M T r i s - H C I / p H 8.3, 50 m M K C 1 , 1.5 m M M g C l 2 , 0.001 % gelat in, 2 % D M S O v /v ) , 200 u M each d N T P , 400 n M o f each gene specific pr imers ( forward and reverse), 2.5 U o f A c c u T a q L A D N A polymerase and the required amount o f water to make up the f inal v o l u m e o f 50 p L react ion m i x . C o n t r o l reactions i nc lud ing first round R T - P C R D N A representing bov ine pituitary, wi thout reverse transcriptase enzyme i n R T samples from s m a l l fo l l i c l e granulosa cel ls and C L tissue, and wi thout D N A template were inc luded to ensure successful ampl i f ica t ion o f the expected P C R ampl icons , the absence o f genomic D N A ampl i f ica t ion , and lack o f cross contaminat ion, respectively. T h e P C R condi t ions were: i n i t i a l denaturation for 3 m i n at 9 5 ° C , and 45 sec at 9 4 ° C , 1 m i n at 5 8 ° C , and 1 m i n at 7 2 ° C 73 f o l l o w e d b y f inal po lymer i za t ion for 10 m i n at 7 2 ° C . A total o f 30 cyc les were a l l owe d dur ing the nested P C R step. T h e nested P C R ampl icons were resolved o n 1% agarose gel , and respective bands ( F i g . 2.2) were careful ly excised f rom the gel and pur i f ied us ing a c o m m e r c i a l l y avai lable gel extract ion k i t ( Q I A q u i c k G e l Ex t rac t ion K i t , Quiagen Inc. Miss i s sauga , O N ) . Further, the pur i f ied , nested P C R D N A samples representing smal l fo l l ic les , C L and pi tui tary, were subjected to nucleot ide sequence analysis (Nuc le i c A c i d Pro te in Services , B i o t e c h n o l o g y Labora tory , T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a ) . The identi ty o f the products was conf i rmed through nucleot ide sequence query us ing N C B I standard nucleot ide-nucleot ide B L A S T [blastn]. A t least 3 samples each o f nested P C R products representing different poo ls o f granulosa ce l ls , and different C L tissue, were analyzed. 2.3.7. D e t e c t i o n o f G n R H m R N A i n g r a n u l o s a cells D u e to the lack o f informat ion o n bov ine G n R H cod ing sequence, three different sets o f pr imers degenerate pr imers , pr imers designed based on ov ine G n R H sequence (partial), and a p r imer set der ived from human hypothalamus G n R H - I were u t i l i z ed i n this part o f the experiment. R T - P C R was performed us ing m R N A isolated from bov ine granulosa cel ls o f different s ize ovar ian fo l l ic les . 2.3.7.1. Selection of degenerate GnRH primers Degenerate pr imers are ol igonuleot ides primers that have a number o f options at several posi t ions i n the sequence, so as to a l l ow annealing to, and ampl i f i ca t ion of, a var iety 74 o f related sequences. Degenerate pr imers are used i n P C R ampl i f ica t ion to isolate distantly related sequences encoding the conserved amino ac id sequence (Rose et a l . , 2003) . D u r i n g this study, a set o f degenerate pr imers (Table 1.1) was der ived based o n the most conserved regions or mot i fs o f amino acids i n hypothalamus G n R H sequence among bov ine , sheep and human. The onl ine ve rs ion o f the degenerate p r imer designing software ( C O D E H O P V e r s i o n 12/17/99.1: F r e d H u t c h i n s o n Cancer Research Center, Seattle, W A , U S A ) was u t i l i z ed to generate G n R H degenerate pr imers for this study. Degenerate pr imers generated b y this software consist o f a a l l possible nucleotide sequences encoding 3 to 4 h i g h l y conserved amino acids w i t h i n a 3' degenerate core, and a longer 5' non-degenerate c lamp reg ion that contains the most probable nucleotide predicted for each f lank ing codon (Rose et a l . , 2003) . A second and th i rd pair o f pr imer sets were der ived based o n ov ine and human hypothalamus G n R H ( G n R H - I ) c D N A sequences and were u t i l i zed dur ing the R T - P C R procedure. R T - P C R , Southern transfer-hybridization, and s ignal detection methods were s imi l a r to those expla ined under the R T - P C R procedure for G n R H - R m R N A ident i f ica t ion i n bov ine granulosa cel ls and C L tissues, except for the f o l l o w i n g modif ica t ions . A b o u t two p g o f total R N A representing the hypothalamus and granulosa cel ls f rom different s ize fo l l ic les was reverse transcribed ( R T ) us ing 3 ' end specific antisense p r imer i n 20 u l react ion ( R T -P C R - 2 0 , S i g m a - A l d r i c h Canada L t d . O a k v i l l e , O N ) . The R T - P C R reaction components were the same as out l ined for the ampl i f ica t ion o f the G n R H receptor sequence, except for the template R N A and different pr imer pairs used dur ing different R T - P C R s . B o t h the sense and antisense o l igonucle t ide pr imers (degenerate, or ovine and human G n R H gene sequence specif ic pr imers (Table 1.1) were used to ampl i fy an expected s ized (sheep-152 bp and 75 human-380 bp) P C R fragment. P C R condit ions were, in i t i a l denaturation for 3 m i n at 9 5 ° C f o l l o w e d w i t h 45 s at 94° C , 1 m i n at 5 5 ° C , [degenerate pr imes, 2 m i n at 6 5 ° C ; ov ine pr imers , 1 m i n at 6 5 ° C ] and 1 m i n at 7 2 ° C for 40 cycles , and f inal po lymer i za t ion for 10 m i n at 7 2 ° C . Whereve r applicable, para l le l reactions compr i s ing a pos i t ive control (human granulosa lu te in c e l l c D N A ) , wi thout R N A template, and wi thout reverse transcriptase enzyme, were inc luded to ensure successful ampl i f ica t ion o f the expected P C R ampl i con , lack o f cross contaminat ion, and the absence o f genomic D N A ampl i f ica t ion , respect ively. H u m a n granulosa lu te in c e l l c D N A and the pr imers used i n this part o f the R T - P C R experiment, were obtained as a gift f rom D r . P . C . K . L e u n g ' s L a b , Facu l ty o f M e d i c i n e , T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a . 2.3.7.2. Sequence analysis of PCR amplicons (GnRH) R T - P C R fragments o f G n R H , representing both bov ine granulosa ce l ls , hypothalamus tissue and human granulosa lutein cel ls , was resolved o n e th id ium bromide stained 2 % agarose ge l and respective bands ( F i g . 2.4) were careful ly excised f rom the gel , and pur i f ied b y us ing a c o m m e r c i a l l y available gel extraction k i t ( Q I A q u i c k G e l Ex t rac t ion K i t , Qu iagen Inc. Mis s i s sauga , O N ) . Further, the pur i f ied P C R D N A samples were subjected to nucleot ide sequence analysis ( N u c l e i c A c i d Pro te in Services, B io t echno logy Laboratory , T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a ) . T h e 3 ' end (reverse) pr imer from human hypothalamus G n R H - I , w h i c h was used i n R T - P C R step, was used as sequencing pr imer . 76 2.4. R E S U L T S 2.4.1. G n R H - R m R N A Expression in bovine granulosa cells and luteal tissue Resul ts f rom the present study revealed G n R H - R m R N A expression i n granulosa cel ls f rom sma l l , m e d i u m , and large fo l l ic les , as w e l l as i n the C L . A representative autoradiogram showing G n R H - R m R N A expressions i n different s ize fo l l i c les ( F i g . 2. I B ) , and f rom different stage C L ( F i g . 2 .1C) , are presented. A m o n g different stage C L , the G n R H - R transcripts were c lear ly detectable i n stage III ( D a y 11 - 17), whereas l o w express ion i n stage II ( D a y 5 - 1 0 ) , and ve ry weak expression or no s ignal was evident f rom stages I ( D a y 1 - 4) and I V ( D a y 1 8 - 2 1 ) luteal tissue (F ig . 2 . 1 C ) . A s shown i n the F i g . 2 . 1 B and C , the expected s ized ( -920 bp) P C R fragments o f G n R H - R were successful ly ampl i f i ed us ing gene specif ic pr imers designed, based o n the bov ine pi tui tary G n R H - R c D N A sequence. Further, nucleot ide sequence analysis o f nested P C R , D N A fragments ( F i g . 2.2) generated f rom both granulosa cel ls and C L tissue m R N A revealed a complete h o m o l o g y to that o f bov ine pi tui tary G n R H - R sequence (F ig . 2.3). D u e to a weak fluorescence s ignal o n e th id ium bromide-stained agarose gels, Southern b lot hybr id i za t ion step was undertaken i n order to enhance the s ignal intensity and detection l imi t s . T h i s step was an added advantage for ident i f icat ion o f P C R ampl i f i ed products us ing a gene sequence specific probe. The expected s ized P C R fragments were detectable as clear, discrete and single bands on resultant autoradiograms. Non- spec i f i c b i n d i n g o f the chemilumeniscent probe, or cross-reaction between G n R H - R and G 3 P D H probes, was not detectable dur ing southern blot procedure ( F i g . 2 . I B and C ) . The poss ib i l i ty o f genomic D N A ampl i f ica t ion or cross-contamination was ru led out as no P C R products 77 were detectable f rom negative control samples without R T enzyme and wi thout template dur ing R T and P C R ampl i f ica t ion steps, respectively. 2.4.2. G n R H mRNA Expression in bovine granulosa cells R T - P C R technique i n an attempt to identify G n R H m R N A expression i n bov ine granulosa ce l ls , us ing degenerate pr imers or a pr imer set der ived based o n the ov ine G n R H c D N A sequence (partial), was not successful. H o w e v e r , the p re l imina ry evidence f rom R T -P C R us ing the pr imers der ived f rom human hypothalamus G n R H - I revealed poss ible evidence for G n R H m R N A expression i n bov ine granulosa cel ls obtained from sma l l , m e d i u m , and large fo l l ic les (F ig . 2.4). The expected s ized P C R a m p l i c o n was evident o n the e th id ium b romide stained agarose gels. H o w e v e r , further conf i rmatory steps through Southern b lot procedure or sequence analysis were not successful due to lack o f s ignal dur ing either step. 2.5. DISUCSSION Intra-ovarian expression o f G n R H receptor-l igand system and its direct invo lvement i n alteration o f ovar ian ce l lu lar functions, is a wel l -documented fact i n several species o f animals and humans but not i n the bov ine species. T o our knowledge , current results are the first to successful ly demonstrate the presence o f G n R H receptor m R N A expression i n both fo l l i c les and C L tissues i n the bovine species. H o w e v e r , present studies cannot rule out granulosa c e l l contaminat ion w i t h cumulus oocyte complexes where the latter c e l l types have been s h o w n pos i t ive for the presence o f G n R H - R m R N A expression (Funston and Se ide l , 1995). In addi t ion, al though our present f indings are a step forward i n the right d i rec t ion, 78 demonstrat ion o f the functional form o f G n R H - R protein molecules is an imperat ive step before attributing any possible direct effects o f G n R H or its agonists at ovar ian ce l lu la r l eve l i n bov ine . Fa i lu re o f previous attempts to demonstrate G n R H receptor prote in ( B r o w n and Reeves , 1983; Net t et a l . , 1987), or G n R H receptor m R N A , i n the bov ine ovary ( K a k a r et a l . , 1993) m a y be attributable to the investigative methods used. T h e y m a y not be sensit ive enough, or because o f the type o f experimental materials used were inadequate. In the former study ( B r o w n and Reeves , 1983), the who le ovar ian homogenates used for s ingle point saturation analysis i n associat ion w i t h l o w abundance receptor concentrations, c o u l d have undermined the detection l imi t s . In the study o f K a k a r et a l . (1993), the procedure o f us ing w h o l e ovar ian tissue as a starting mater ial might not have been adequate for detecting the G n R H - R message i f it is present o n l y i n a few c e l l types o f the ovary. W i t h respect to bov ine ovar ian expression o f G n R H m R N A , al though the current f indings are ve ry pre l iminary , R T - P C R results show possible evidence for presence o f G n R H m R N A i n bov ine ovar ian granulosa cel ls . P C R products resolved o n agarose ge l (e th id ium bromide stained) revealed clear bands o f expected s ized P C R ampl icons that run at a s imi l a r l eve l w i t h the pos i t ive control samples (human granulosa lu te in cel ls) . Despi te the l imi ta t ions o f the materials, and the experimental approach used i n this part o f the study, failure o f southern hybr id i za t ion procedure and nucleotide sequencing steps m a y be attributable to one or more factors. These include the amount o f target D N A avai lable o n the blot , the percentage o f probe target compl imentary sequence, the s tabi l i ty o f the probe sequence to wi ths tand pos t -hybr id iza t ion wash ing steps, and f ina l ly , the nature o f the s ignal itself. In the present experiment, the l o w amount o f target D N A , and the part ial compl imen ta ry probe 79 sequence o f re la t ive ly shorter length i n the who le p l a smid used, and the chemi luminescent s igna l ing method c o u l d have undermined the detection abi l i ty . In the case o f the sequencing step, the direct P C R product used as template DAN, and the same 3 ' end pr imer w h i c h was used both dur ing R T - P C R and dur ing sequencing step, w o u l d have been the major contr ibut ing factor for the absence o f the s ignal output dur ing sequencing step. Further steps, such as c l o n i n g o f R T - P C R fragments into a suitable vector, propagat ion i n a p l a smid , and sequence analysis us ing universa l sequencing pr imers such as M l 3 c o u l d have been a more product ive approach i n ident i fy ing G n R H sequence. T h e p re l imina ry evidence f rom present study m a y be supported b y the related informat ion f rom earlier f indings where the presence o f G n R H - l i k e prote in molecules i n bovine ovaries has been suggested (S to j i l kov ic and Catt, 1995; Ireland et a l . , 1988), and demonstrated i n human and rat ovaries ( A t e n et a l . , 1987). Therefore, w e bel ieve that the R T - P C R technique, us ing human primers has revealed evidence for G n R H m R N A expression i n bovine granulosa cel ls o f different s ized fo l l ic les . Severa l studies f rom other species not o n l y reveal the presence o f G n R H - R - G n R H system i n intra-ovarian structures ( fol l ic les and C L tissue), but there are evidences suggesting intra-ovarian funct ional roles for G n R H . G n R H - a has been shown to induce a dose-dependent s t imulatory effect o n aromatase act iv i ty and P 4 product ion i n m o n k e y granulosa cel ls , in vitro ( reviewed b y Janssens et a l . , 2000). O n the other hand, inh ib i to ry actions o f G n R H or its agonists on gonadal steroidogenesis i n v o l v i n g suppression o f gonadotropin receptors, or intermediary enzymes i n steroidogenic pathway such as S t A R , P450scc enzyme, and 3-pHSD, were also reported i n rodent species (Sridaran et a l . , 1999). In the bov ine species, G n R H - a has been shown to cause an inh ib i to ry effect o n P 4 secretion f rom in vitro 80 cul tured luteal cel ls ( M i l v a e et a l . , 1984). It is also noteworthy to that bov ine oocytes exposed to the G n R H agonist, buserel in, had increased cleavage potential after in vitro fer t i l iza t ion (Funston and Se ide l , 1995). The reason for these v a r y i n g effects o f G n R H o n reproduct ive tissues across different species is not k n o w n . Therefore, i n order to gain a deeper perspective subsequent studies ( C H A P T E R 3) have focused o n invest igat ing the direct effects o f G n R H o n the bov ine ovary. 2.5. C O N C L U S I O N In conc lus ion , the present f indings reveal defini t ive evidence for the presence o f G n R H - R m R N A expression i n bovine ovar ian structures (the fo l l i c l e , and the C L ) . It is wor th no t ing that our p re l imina ry studies also p rov ided evidence for G n R H m R N A expression i n bov ine granulosa cel ls . 81 5' U T R F I G U R E 2.1. R T - P C R detection o f G n R H - R m R N A in bovine granulosa cells and C L tissue. A . The locations of the primers selected from bovine G n R H - R c D N A sequence are indicated (not to scale). B . Representative auto radiogram showing G n R H - R (upper panel) m R N A transcripts in different staged follicular granulosa cells and pituitary tissue; (P) bovine pituitary, (S) small follicles, (M) medium follicles, (L) large follicles, (-R) sample without reverse transcriptase enzyme, (-T) sample without m R N A template. Lower panel represents the internal control, G 3 P D H . C . Representative auto radiogram showing G n R H - R (upper panel) m R N A transcript in different staged C L and in pituitary tissue; (P) bovine pituitary, ( C l ) stage I C L , (C2) stage II corpus luteum, (C3) stage III C L , and (C4) stage I V C L , (-R) sample without reverse transcriptase enzyme, (-T) sample without m R N A template. Lower panel represents the internal control, G 3 P D H . 82 5' U T R F2 Nested P C R , 750 bp M 1 R2 M S F C L 3 Pt - R s - R c - T 1000 bp 750 bp-* 500 bp F I G U R E 2.2. E th id ium-bromide stained agarose gel showing the expected s ized nested P C R fragments ( G n R H - R ) . A . Locations o f first round P C R ( F l , R l ) . B . Locations o f the internal primers (F2, R2) . (M) 250 bp ladder; (SF), small follicle; (S) small follicle; (CL3) stage III C L ; (Pt) pituitary; (-Rs) without reverse transcriptase from small follicle; (-Rc) sample from small follicles without reverse; (-Rc) sample from C L 3 without reverse transcriptase; (-T) negative control without template. 83 Ovary-P i t u i t a r y - 38 6 Ovary-P i t u i t a r y - 4 4 6 Ovary-P i t u i t a r y - 5 0 6 Ovary-P i t u i t a r y - 5 66 Ovary-P i t u i t a r y - 6 2 6 Ovary-P i t u i t a r y - 6 8 6 Ovary-P i t u i t a r y - 7 4 6 Ovary-P i tuxtary-806 Ovary-P i t u i t a r y - 8 6 6 Ovary-P i t u i t a r y - 9 2 6 Ovary-P i t u i t a r y - 9 8 6 Ovary-P i t u i tary-1046 a taaotg t t caa tgg ta tgc tggagagc tcc t t tg taaagtcc toagota to tgaagc t t I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ataaotg t tcaatggta tgo tggagagc tcc t t tgcaaagtcc tcagc ta to tgaagot t 445 t t c tcca tg tacgcccoogoct tca tgatggtggtgatoagcc t tgaccgotcgc tggcg I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t to tocatgtaogccccogoct tcatgatggtggtgatcagcctcgaoogctcgctggcg 505 atcaccaagcctctagoagtgaaaagcaacagcaagcttggacagttoatgattggottg I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I atcaccaagcctc tagcagtgaaaagcaacagcaagct tggacagt tcatgat tggct tg 565 gcc tggc t t c t cag tagoato t t tgc tggaccacagota taoatc t t tgggatga toca t I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I gcc tggotoo tcag tagca tc t t tgc tggacoacagc ta taca tc t t tgggatga tcca t 625 t tagcagatgac tc tggacagac tgaaggt t t c t c t cag tg tg taacacac tgcag t t t t I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t tagcagatgaototggacagaotgaaggt t tc tc toagtgtg taacacactgoagt t t t 685 o c a o a g t g g t g g o a t c a a g c c t t t t a t a a c t t t t t c a c c t t c a g c t g c c t c t t o a t c a t c I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I c c a c a g t g g t g g c a t o a a g c o t t t t a t a a c t t t t t o a o o t t c a g o t g c c t c t t o a t o a t c 745 c c t c t t c t c a t c a t g g t g a t c t g c a a t g c a a a a a t c a t c t t t a c c c t a a c a a g g g t c c t t I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I c c t c t t c t c a t c a t g g t g a t o t g c a a t g c a a a a a t c a t c t t t a c c c t a a o a a g g g t c c t t 805 catcaggatccccacaaactacaactgaatcagtccaagaacaatataccacgagctcgg I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I catcaggatccccacaaactacaactgaatcagtccaagaacaatataccacgagctcgg 865 c tgaggaccctaaagatgacggt tgcat t tgocaot tcat t taotgtc tgotggacgcoo I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I c tgaggaccc taaagatgacggt tgoat t tgocac t tca t t tac tg tc tgc tggacgooc 925 tao ta tg tco t tggaat t tgg ta t tgg t t tga tcc tgaca tgg taaacagggtg toagat I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t a c t a t g t c c t t g g a a t t t g g t a t t g g t t t g a t c c t g a c a t g g t a a a c a g g g t g t c a g a t 985 c c a g t a a a t c a c t t c t t c t t t c t o t t t g c t t t t t t a a a t c c a t g c t t t g a t c c a c t t a t a I I I I I I I I I I I I I I I I I I I 1 1 I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I c o a g t a a a t o a o t t c t t c t t t c t c t t t g c t t t t t t a a a t o o a t g c t t t g a t o c a c t t a t a 1045 t a t g g a t a t t t c t c t c t a t a a t t g t t a g a c t g c a t a g a a a g I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t a t g g a t a t t t c t c t c t a t a a t t g t t a g a c t g c a t a g a a a g 1086 F I G U R E 2.3. Bovine granulosa cell and luteal tissue G n R H - R c D N A (partial) sequence and its homology to bovine pituitary G n R H - R c D N A sequence. About 750 bp sized nested P C R products from granulosa and luteal tissues were gel extracted and subjected for nucleotide sequence analysis. Sequence results were subjected to sequence query using N C B I standard nucleotide-nucleotide B L A S T [blastn]. 84 5 ' U T R S P G n R H G A P mm 888888 3 ' U T R R T - P C R , 380 b p R 500 bp G n R H 3 8 0 b p 250 bp F I G U R E 2.4. Representative autoradiogram (upper panel) and corresponding photograph o f ethidium bromide stained agarose gel (lower panel) showing G n R H m R N A transcripts in different staged follicular granulosa cells. ( L D ) 250 bp ladder; (G) human granulosa lutein cells; (S) small follicle; ( M ) medium follicle; (L) large follicles; (H) bovine hypothalamus. A . Location o f the forward and reverse primers on human G n R H - I c D N A are indicated (not to scale). SP, signal peptide sequence; G A P , GnRH-associated peptide; 375' U T R , 3' and 5' untranslated region. 85 T a b l e 2 .1 . Ol igonuc le t ide pr imer pairs and their respective P C R ampl icons for G n R H - R , G n R H and G 3 P D H m R N A transcripts form bov ine ovary. N a m e P r i m e r Sequence F r a g m e n t F o r w a r d 5 ' -3 ' L e n g t h (bp) R e v e r s e 5 ' -3 ' G 3 P D H [318 bp] 5 ' - T G T T C C A G T A T A G A T T C C A C C - 3 ' 5 ' - A G G A G G C A T T G C T G A C A A T C - 3 ' 318 G n R H - R [918 bp] 5 ' - G A G T A G C A G T T A C T T T C T T C C - 3 ' 5 ' - A G G A A G A A G C G T A A C A T T A C C - 3 ' 918 G n R H - R [748 bp] 5 ' - A C T C T G A T T G T T A T G C C A C T G - 3 ' 5 ' - C C T T T C T T T G A C T T T C T A T G C - 3 ' 748 G n R H [degenerate] 5'- C G G C T T G C G G C C N G G N G G N A A - 3 ' 5 ' - T C G C G G G C T G G T C N A C Y T C Y T T N R C - 3 ' G n R H [ovine] 5 ' - G A A T T C G C C C T G G A G G A A A G A G A A A T - 3 ' 1 5 2 5 ' - G A A T T C A C T T T C C A G A G C T G C C T T C A - 3 ' 5 ' - A T T C T A C T G A C T T G G T G C G T G - 3 ' U n R H - l Lnumanj 5 _ G G A A T A T G T G C A A C T T G G T G T - 3 ' 380 8 6 REFERENCES Aten FRO, Ireland JJ, Weems CW, Behrman HR. 1987. Presence o f gonadotropin-releasing hormone- l ike proteins i n bovine and ovine ovaries. E n d o c r i n o l o g y 120:1727-33. Brown JL, Reeves JJ. 1983. Absence o f specif ic lu te in iz ing hormone releasing hormone receptors i n ovine , bov ine and porcine ovaries. B o i l Reprod . 29:1179-1182. Chomczynski P, Sacchi N. 1987. Single-step method o f R N A iso la t ion b y ac id guan id in ium thiocyanate-phenol-chloroform extraction. A n a l B i o c h e m . 162:156-159. Clayton RN, Shakespear RA, Duncan JA, Marshall JC, Munson PJ, Rodbard D. 1979. Radio iod ina ted nondegradable gonadotropin-releasing hormone analogs: n e w probes for the invest igat ion o f pi tui tary gonadotropin-releasing hormone receptors. E n d o c r i n o l o g y 105:1369-76. Dekel N, Lewysohn O, Ayalon D, Hazum E. 1988. Receptors for gonadotropin releasing hormone are present i n rat oocytes. E n d o c r i n o l o g y 123:1205-7. Funston RN, Seidel GE. Jr. 1995. Gonadotropin-releasing hormone increases cleavage rates o f bov ine oocytes fer t i l ized in vitro. B i o l Reprod . 53:541-545. Ireland JJ, Aten FRO, Barman HR. 1988. G n R H - l i k e proteins i n cows : concentrations dur ing corpora lutea development and selective loca l iza t ion i n granulosal cel ls . B i o l Rep rod . 38:544-550. Ireland JJ, Murphee RL, Coulson PB. 1980. A c c u r a c y o f pred ic t ing stages o f bov ine estrous cyc le b y gross appearance o f the corpus luteum. J D a i r y S c i . 63:155-160. Janssens RMJ, Brus L, Cahill DJ, Huirne JA, Schoemaker J, Lambalk CB. 2000. D i rec t ovar ian effects and safety aspects o f G n R H agonists and antagonists. H u m R e p r o d Update . 6: 505-518. Jones PB, Conn PM, Marian J, Hsueh AJ. 1980. B i n d i n g o f gonadotropin releasing hormone agonist to rat ovar ian granulosa cel ls . L i f e S c i . 27:2125-32 Kakar SS, Musgrove L C , Devor DC, Sellers JC, Neill JD. 1992. C l o n i n g , sequencing, and express ion o f human gonadotropin releasing hormone ( G n R H ) receptor. B i o c h e m B i o p h y s R e s C o m m u n . 189:289-295. Kakar SS, Rahe CH, Neill JD. 1993. M o l e c u l a r c lon ing , sequencing, and character iz ing the bov ine receptor for gonadotropin releasing hormone ( G n R H ) . Domes t A n i m E n d o c r i n o l . 10: 335-342. Kruip TA, Dieleman SJ. 1982. M a c r o s c o p i c c lass i f icat ion o f bov ine fo l l i c les and its va l ida t ion b y mic romorpho log i ca l and steroid b iochemica l procedures. R e p r o d N u t r D e v . 22:465-73. 87 Latouche J, Crumeyrolle-Arias M , Jordan D, Kopp N, Augendre-Ferrante B, Cedard L. Haour F. 1989. G n R H receptors i n human granulosa cel ls : anatomical loca l i za t ion and characterizat ion b y auto radiographic study. E n d o c r i n o l o g y 125: 1739 -1741 . Latouche TA, Menzies GS, Baird DT. 1985. Speci f ic b i n d i n g o f gonadotrophin-releasing hormone and an agonist to human corpus lu teum homogenates: characterization, properties, and luteal phase levels . J C l i n E n d o c r i n o l Me tab . 61:834-841. Leung PC, Cheng CK, Zhu X M . 2003. Mul t i - f ac to r i a l role o f G n R H - I and G n R H - I I i n the h u m a n ovary . M o l C e l l E n d o c r i n o l . 202: 145-153. Milvae RA, Murphy BD, Hansel W. 1984. P ro longa t ion o f the bov ine estrous c y c l e w i t h a gonadotropin-releasing hormone analogue. B i o l Reprod . 31:664-670. Minaretzis D, Jakubowski M , Mortola JF, Pavlou SN. 1995. Gonadotropin-re leas ing hormone receptor gene expression i n human ovary and granulosa-lutein cel ls . J C l i n E n d o c r i n o l M e t a b . 80: 430-434. Nett T M , Cermak D, Braden T, Manns J, Niswender G. 1987. P i tu i tary receptors fro G n R H and estradiol, and pitui tary content o f gonadotropins i n beef cows . I. Changes dur ing the estrous cyc le . Domes t A n i m E n d o c r i n o l . 4:123-132. Peng C, Fan NC, Ligier M , Vaananen J. 1994. Expres s ion and regula t ion o f G n R H and G n R H receptor m R N A i n H u m a n Granulosa Lu tea l C e l l s . E n d o c r i n o l o g y 135:1740-1746. Pieper DR, Richards JS, Marshall JC. 1981. Ova r i an gonadotropin-releasing hormone ( G n R H ) receptors: characterization, dis tr ibut ion, and induc t ion b y G n R H . E n d o c r i n o l o g y 108:1148-1155. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ, Thatcher WW. 1998. Effects o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants on p lasma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . Ther iogeno logy 50:1141-1155. Rajamahendran R, Ambrose DJ, Small JA, Dinn N. 2001. Synchron iza t ion o f estrus and ovu la t ion i n cattle. A r c h A n i m a l Breed ing . 44: special issue 58-67. Rose T M , Henikoff JG, Henikoff S. 2003. C O D E H O P (COnsensus-DEgenera te H y b r i d Ol igonuc leo t ide Pr imer ) P C R pr imer design. N u c l e i c A c i d s Res . 31:3763-6. Sridaran R, Lee MA, Haynes L , Srivastava RK, Ghose M , Sridaran G, Smith CJ, 1999. G n R H act ion o n luteal steroidogenesis dur ing pregnancy. Steroids 64: 618-623. Stojilkovic SS, Catt KJ. 1995. Expres s ion and signal transduction pathways o f gonadotropin-releasing hormone receptors. R e c P r o g H o r m Res . 50:161-205. Wong WDH, Anderson WD, Cheng T, Riabowol KT. 1994. M o n i t o r i n g m R N A E x p r e s s i o n b y Polymerase C h a i n Reac t ion : The 'P r imer -Dropp ing ' M e t h o d . A n a l B i o c h e m . 223:251-258. 88 Y a n g M Y , R a j a m a h e n d r a n R . 2000. M o r p h o l o g i c a l and b i o c h e m i c a l ident i f ica t ion o f apoptosis i n smal l , m e d i u m , and large bovine fo l l ic les and the effects o f fo l l i c le -s t imula t ing hormone and insu l in - l ike growth factor-I o n spontaneous apoptosis i n cul tured bov ine granulosa ce l l s . B i o l Rep rod . 62:1209-1217. 89 C H A P T E R 3 D I R E C T E F F E C T S O F GnRH-a O N In Vitro STEROID H O R M O N E P R O D U C T I O N IN B O V I N E G R A N U L O S A C E L L S A N D C O R P U S L U T E U M 3.1. A B S T R A C T T h e present study investigated the direct effects o f the G n R H - a (buserelin) o n in vitro steroid hormone secretion f rom granulosa cel ls , dispersed luteal cel ls and C L tissue from the bov ine species. Granu losa cel ls harvested f rom m e d i u m and large fo l l ic les were cul tured i n a serum-supplemented g rowth m e d i u m for 48 h . Thereafter, c e l l cultures were swi tched to serum-free culture condi t ions , and subjected to increased dose levels o f busere l in (0, 10, 50, 200, 500 or 1000 n g / m L ) for the next 24 h . Dispersed luteal cel ls were prepared f rom stage III C L ( D a y 11 - 17) and incubated i n serum-supplemented g rowth m e d i u m for 24 h . Thereafter, luteal c e l l cultures were swi tched to serum free-culture condi t ions , and treated w i t h increased doses o f buserel in (0, 10, 50, 200, 500 or 1000 n g / m L ) for the next 24 h . M i n c e d luteal tissue samples (100 mg) , prepared from stage III C L , were subjected to busere l in treatment. Treatments (ng /mL) were compr ised o f m e d i u m alone ( C O N ) , L H 100 ng , busere l in ( B U S ) 200 ng , B U S 1000 ng , L H 100 ng + B U S 200 ng , L H 100 n g + B U S 1000 ng , antide ( A N T ) 500 ng , A N T 500 ng + B U S 200 ng , PGF 2 oc 500 ng, or P G F 2 o c 500 ng + B U S 1000 ng . Granu losa and luteal c e l l cultures were incubated at 3 7 ° C and m i n c e d tissues were incubated at 3 8 ° C i n a humid i f i ed atmosphere o f 95 % air, and 5 % C 0 2 . Spent culture m e d i u m was col lected at the end o f each treatment per iod and assessed for steroid hormone concentrations b y f o l l o w i n g a radio immunoassay procedure. A dose-dependent, b iphas ic response o f busere l in was evident o n E 2 accumulat ion dur ing in vitro treatment o f 90 granulose cel ls . Buse re l in , at a dose o f 200 - 500 n g / m L , exerted a s t imulatory response (P < 0.05) o n E 2 secretion from granulosa cel ls . A further higher dose o f buserel in , 1000 n g / m L , caused a m i l d inh ib i l to ry effect o n E 2 output. C o m b i n e d treatment o f antide and busere l in resulted i n the reversal o f buserel in caused st imulatory response o n E 2 output i n granulosa cel ls . P4 concentrations revealed a s imi la r trend, except that the busere l in response o n P 4 output was not s igni f icant ly different from that o f P4 levels i n untreated cont ro l samples. Dispersed luteal cel ls treated w i t h buserel in exhibi ted a dose-dependent, b iphas ic response i n terms o f P4 product ion. M a x i m a l s t imulatory response was evident at the dose range o f 50 - 500 n g / m L o f buserel in (P = 0.1). A higher dose o f buserel in , 1000 n g / m L , showed a m i l d inh ib i to ry effect o n P4 levels; al though the difference was not s igni f icant ly different from that o f P4 levels i n untreated control samples. Buse r e l i n treatment o f bov ine luteal tissue (minced C L tissue) in vitro exhibi ted a s imi la r response i n terms o f P4 output. T h e dose-dependent s t imulatory response o f buserel in 200 n g / m L (P = 0.19) and 1000 n g / m L (P — 0.14) tended to be different from that o f P4 levels i n untreated control samples. Treatment w i t h antide alone ( P = 0.07), or a combina t ion o f buserel in ( P = 0.004), showed a m a x i m a l s t imulatory response i n terms o f P4 output. L H treatement, at the dose o f 100 - 500 n g / m L caused a s t imulatory response o n P4 output i n luteal tissue (P = 0.05). , B u s e r e l i n i n combina t ion w i t h L H or PGF20C treatment had no influence o n P4 output i n luteal tissue. In summary , the G n R H - a (buserelin) exerted a dose dependent-biphasic treatment effect o n steroid hormone output from granulosa cel ls , dispersed luteal cel ls , and luteal tissue dur ing in vitro culture. 91 3.2. INTRODUCTION Gonado t rop in releasing hormone ( G n R H ) is a hypothalamic neuronal secretory decapeptide that p lays a p ivo ta l role i n reproduction. O n the pi tui tqry gonadotrope cel ls , G n R H binds to a s ingle class o f G protein coupled receptors ( G P C R ) , and initiates a cascade o f b i o c h e m i c a l and molecu la r events that leads to synthesis and the release o f gonadotropins, l u t e in i z ing hormone ( L H ) , and fo l l ic le -s t imula t ing hormone ( F S H ) , into general c i rcu la t ion . B o t h the L H and F S H , i n turn control the processes o f gamate produc t ion and ovar ian steroidogenesis ( C o n n and C r o w l e y , 1994; S to j i l kov ic and Catt, 1995). In addi t ion, it has been suggested that G n R H m a y have a role as a modulator o f the ac t iv i ty o f the diverse systems i n the bra in , and m a n y peripheral organs (Jones et a l . , 1980; H s u e h and Jones, 1981; E m o n s and Scha l ly , 1994). A l t h o u g h it is an indisputable fact that the hypothalamus and pi tui tary are the p r inc ipa l source and target site for G n R H , respect ively, several reports have suggested an extra-hypothalamic source o f G n R H , as w e l l as an extra-pituitary presence o f G n R H receptors ( G n R H - R ) across different types o f tissues i n the body. W i t h respect to the reproduct ive system, it is becoming increas ingly evident that there is a functional G n R H -G n R H - R system that exist i n different laboratory species (rats, p igs , and monkeys ) and i n humans. ( C H A P T E R 1; 1.2.5 and 1.2.6). Further, there are several reports suggesting that the direct effects o f G n R H , i n an autocrine or paracrine manner, e l ic i t a var ie ty o f responses depending o n the type o f target tissue and phys io log i ca l condi t ions . Therefore, the experiments present i n this chapter were undertaken to further ve r i fy our previous f indings o f the presence o f G n R H receptor m R N A expression i n bov ine granulosa cel ls and i n C L tissue ( C H A P T E R 2). W e tested the hypothesis that the direct effects o f G n R H - a at ovar ian ce l lu lar levels are exhib i ted through the altered in vitro steroid hormone produc t ion i n fo l l i cu la r and 92 luteal cel ls , or C L tissue dur ing in vitro culture. Exper iments were performed i n different steps w i t h the f o l l o w i n g specific objectives; (i) to examine the direct effect o f buserel in o n in vitro p roduc t ion o f estradiol-17p (E2) and progesterone (P4) i n bov ine granulosa ce l l s , and (i i) to examine the direct effect o f buserel in o n in vitro P 4 p roduct ion i n bov ine luteal cel ls , and m i n c e d C L tissue, i n the presence or absence o f lu te in iz ing hormone ( L H ) and luteolyt ic hormone [prostaglandin F 2 alpha (PGF2oc)] and the G n R H antagonist, antide ( A N T ) . 3.3. MATERIALS AND METHODS 3.3.1. Cell culture reagents and related materials D u l b e c c o ' s M o d i f i e d Eagles m e d i u m ( D - M E M ) , and H a m ' s F -12 (1:1) conta in ing 15 m M H E P E S buffer (15 m M ) , L-g lu tamine , and pyr idox ine H C 1 were purchased f rom G I B C O (Bur l ing ton , Ontar io , Canada). F a l c o n P r i m a r i a ™ m u l t i - w e l l (6 and 24-we l l ) tissue culture plates were purchased f rom B e c t o n D i c k i n s o n and C o m p a n y , C A . P e r c o l l ™ , density-gradient m e d i u m was purchased f rom Pharmac ia B io t ech , M o r g a n , Canada. B o v i n e L H was obtained as a gift f rom N H P P ( U S D A - L H - B 5 ; B e l t s v i l l e , M D , U S A ) . P G F 2 a ( L u t a l y s e ® ; Pha rmac ia & U p j o h n , Orangev i l l e , O N , Canada) . R I A kits were purchased f rom Diagnos t i c Products Corpora t ion ( C o a t - A - C o u n t , Diagnos t ic Products Corp . , L o s Ange le s , C A , U S A ) . Un le s s specif ied, a l l other c e l l culture reagents and materials u t i l i zed dur ing these studies were purchased f rom S i g m a - A l d r i c h Canada L t d . ( O a k v i l l e , O N , Canada). 93 3.3.2. Direct effect of GnRH-a on in vitro E2 and P4 synthesis of bovine granulosa cells T h i s part o f the study was performed to determine the direct effect o f G n R H - a (buserelin) on in vitro cultured bov ine granulosa cel ls , i n terms o f their steroidogenic potentials. 3.3.2.1. Collection of bovine ovaries and laboratory processing B o v i n e ovaries were obtained from a l oca l slaughterhouse w i t h i n 20 to 30 m i n after exsanguinations. Ovar ies were he ld i n the thermos flask conta ining w a r m ( 3 0 ° C to 3 5 ° C ) n o r m a l saline supplemented w i t h s t reptomycin (100,000 p g / L ) and p e n i c i l l i n (100,000 IJJ /L) . Sa l ine was replaced 2 to 3 t imes dur ing wa i t ing per iod at the slaughterhouse, and ovaries were transported to the laboratory w i t h i n 3 to 4 hrs after co l lec t ion . In the laboratory, ovaries were washed i n saline, and he ld i n w a r m saline solut ion, w h i l e aspirating fo l l ic les from i n d i v i d u a l ovaries for granulosa ce l l co l lec t ion . . 3.3.2.2. Isolation of granulosa cells and in vitro culture conditions F o l l i c l e s were classif ied into three different categories based o n their diameter and morpho log i ca l appearance ( K r u i p and D i e l e m a n , 1982; Y a n g and Rajamahendran, 1998); m e d i u m (5-8 m m ) and large fo l l ic les (>8 m m diameter). Care was taken to a v o i d aspirat ion o f atretic and hemorrhagic fo l l ic les . F o l l i c u l a r f l u id was aspirated us ing a 10 C C plast ic sy r inge 'w i th an 18 guage needle. F o l l i c u l a r f lu id from each category o f fo l l i c les was poo led separately i n heparin-dusted 15 m L F a l c o n tubes. W h i l e aspirating fo l l i c les , fo l l i cu la r f lu id was gent ly aspirated and expel led into fo l l i c l e several t imes i n order to m a x i m i z e granulosa c e l l recovery. D u r i n g the per iod o f aspiration (20 -30 min ) , tubes conta in ing fo l l i cu la r f l u id 94 were h e l d at 3 7 ° C i n a water bath. F o l l i c u l a r aspirates were centrifuged at 300 x G for 10 m i n , and the supernatant was discarded. In order to el iminate the red b l o o d cel ls ( R B C ) , the ce l lu la r pellets were re-suspended i n c a l c i u m and magnesium-free H a n k ' s B a l a n c e d Salt So lu t i on ( H B S S ) . T h e y were then gently over- layered o n a continuous pe rco l l gradient (40%) m e d i u m , and centrifuged at 600 x G for 20 m i n at r o o m temperature. T h e interphase, ce l lu lar layer was careful ly aspirated us ing a 1 m L pipette, and transferred to sterile 1 5 - m L F a l c o n tubes. C e l l s were m i x e d i n 5 to 6 m L o f H B S S , and centrifuged i n order to remove the contaminated P e r c o l l solut ion. C e l l pellets were re-suspended i n a p r imary g rowth m e d i u m , plated i n 35 m m 6 w e l l c e l l culture plates, and incubated for 48 h . T h e p r ima ry g rowth m e d i u m consis ted o f 1:1 (v/v) D M E M / F - 1 2 w i t h L-g lu tamine , py r idox ine H C L , s o d i u m bicarbonate, and H E P E S . G r o w t h m e d i u m was supplemented w i t h 1 0 % heat-inactivated fetal bov ine serum ( F B S ) , human transferrin (5 u.g/mL), sod ium selenite (4 n g / m L ) and an antibacterial and ant imycot ic mixture (pen ic i l l in 100 I U / m L ; s t reptomycin 100 ixg /mL and amphoterocin B 2.5 n g / m L ) . 3.3.2.3. Examination of granulosa cell viability and cell counting Afte r 48 h o f incubat ion i n the p r imary growth m e d i u m , cel ls were washed 2 to 3 t imes to free the dead or unattached cel ls , and c e l l debris, us ing w a r m H B S S . The attached c e l l layer was over layered w i t h 0.7 m L o f non-enzymat ic c e l l d issocia t ion solut ion. Cul tures were incubated for 10 to 15 m i n , or un t i l the cel ls were comple te ly detached from the plate surface. S o m e cultures required more than 15 m i n incubat ion, depending the c e l l densi ty and degree o f attachment. Detached cel ls were di luted w i t h 4 to 5 m L o f H B S S , poo led i n 15 m L F a l c o n tubes, and centrifuged at 300 x G for 8 m i n . Based o n the size o f the c e l l pellet , cel ls 95 were re-suspended i n 0.5 to 2 m l o f culture m e d i u m , and c e l l v i a b i l i t y was examined b y the t rypan b lue (0.2%) exc lus ion method (S immons et a l . , 1976). A l i q u o t o f ce l l s w i t h required d i l u t i on was m i x e d w i t h t rypan blue , and incubated 2 to 3 m i n at r o o m temperature. To ta l c e l l count and percentage c e l l v i a b i l i t y were determined b y f o l l o w i n g Hemocy tomete r c e l l count ing method. The c e l l v i a b i l i t y o f >85% was observed dur ing different trials o f experiments. 3.3.2.4. GnRH-a treatment of granulosa cells during in vitro culture Serum-free, experimental c e l l cultures were prepared i n 24 w e l l tissue culture plates (Fa l con P r i m a r i a ™ ) , and granulosa cel ls were seeded at the densi ty o f 5 x 10 5 c e l l s / m L / w e l l . E a c h treatment w e l l contained a f inal v o l u m e o f 1 m L o f culture m e d i u m , i n c l u d i n g exper imental treatments. The c e l l culture m e d i u m inc luded supplements (v /v) : androstenedione (10" 7 M ) , human transferrin (5 p g / m L ) , sod ium selenite (4 n g / m L ) and gentamic in (50 p g / m L ) . The buserel in treatment compr i s ing o f different doses (0, 10, 50, 200 , 500 or 1000 n g / m L ) was appl ied to duplicate or triplicate we l l s , depending o n total c e l l y i e l d . A d d i t i o n a l c e l l cultures were also treated w i t h buserel in i n the presence o f an antide, a G n R H antagonist (500 n g / m L ) , w h e n sufficient cel ls were avai lable . Cul tures were incubated at 3 7 ° C i n a humid i f i ed atmosphere o f 5% CO2, and 9 5 % air, for 24 h . Af te r 24 h incubat ion, 700 p i o f spent m e d i u m was harvested from each treatment w e l l , and immedia te ly stored at -2 0 ° C . Care was taken not to disturb the ce l lu lar layer w h i l e co l l ec t ing the spent m e d i u m from culture we l l s . E a c h experiment compr i s ing o f duplicate or tr iplicate w e l l s for each l eve l o f treatments, was performed us ing a different p o o l o f granulosa cel ls prepared from the groups o f ovaries co l lec ted at different days. Exper iments were repeated at least 5 t imes. 96 3.3.3. Direct effect of GnRH-a on in vitro P4 synthesis of bovine C L In this part o f the study, the direct effects o f buserel in o n in vitro P 4 product ion i n dispersed luteal ce l l s , and m i n c e d luteal tissue was examined. Exper iments were conducted i n two different steps. In the first step, a dispersed luteal c e l l culture system was u t i l i z ed to determine the dose effect o f buserel in on in vitro P 4 output. In the second step, m i n c e d luteal tissues were u t i l i z ed to examine the possible direct effects o f busere l in o n P 4 secretion i n the presence or absence o f L H , and P G F 2 a . 3.3.3.1. Isolation of luteal cells and in vitro culture conditions B o v i n e C L (Stage III; Ireland et a l . , 1980) were obtained at a l oca l abattoir and transported i n i c e - c o l d D M E M - F 1 2 m e d i u m supplemented w i t h antibacterial ( pen i c i l l i n 100,000 I U / L , s t reptomycin 100,000 u.g/L) and ant imycot ic (amphoterocin B 2.5 n g / m L ) agents. In the laboratory, C L were washed i n c o l d saline, subjected to a qu ick d ip i n 7 0 % ethanol, and immedia te ly washed w i t h c o l d saline. Dispersed luteal cel ls f rom i n d i v i d u a l C L were prepared b y f o l l o w i n g the procedures out l ined reports i n the literature ( S i m m o n s et a l . , 1976; O k u d a et a l . , 1992; Pet roff et a l . , 2001 ; K a m a d a and Dcumo, 1997), w i t h necessary modif ica t ions . B r i e f l y , each C L was separated from its capsule, and about 1.5-2 g o f tissue was asept ical ly dissected into a 50 m L F a l c o n centrifuge tube conta in ing 15-20 m L o f ice c o l d D M E M - F 1 2 culture m e d i u m . Tissues were m i n c e d into smaller pieces us ing a sterile scalpel , and was washed 2 t imes w i t h ice c o l d D M E M - F 1 2 culture m e d i u m . Further, the tissue samples were incubated ( 3 7 ° C for 30 min) i n D M E M - F 1 2 , w i t h gentle agitat ion i n order to free the red b l o o d cel ls and cel lu lar debris. The m e d i u m was careful ly decanted and 97 incubat ion was cont inued w i t h D M E M - F 1 2 , containing 0 .5% B S A , and collagenase (400 I U / m L ) . Af t e r 4 5 - 60 m i n o f incubat ion, dissociated cel ls were removed, fresh m e d i a conta in ing collagenase was added, and incubat ion was cont inued for further 45 - 60 m i n . Tissue c lumps were dispersed b y repeated up and d o w n pipet t ing us ing a glass Pasteur pipette. T h e resultant c e l l suspension was filtered through a mul t i - layered cheesecloth to remove the remain ing tissue c lumps . Further, the cel ls were washed i n 10 m L o f fresh m e d i u m b y centrifugation at 300 G , for 5 m i n i n 3 cycles . The supernatant was discarded, and the cel ls were resuspended i n 2-3 m L o f fresh m e d i u m , and subjected to P e r c o l l discontinuous gradient centrifugation to remove remain ing c e l l debris, R B C , and excessive l i p i d content. The discont inuous P e r c o l l gradients composed o f 3 m L each o f 50, 25, and 12 .5% P e r c o l l c o l u m n were layered i n the same tubes ( K a m a d a and Dcumo, 1997). A b o u t 3 m L o f enriched c e l l suspension was careful ly layered o n the top P e r c o l l c o l u m n , and centrifuged at 400 G for 20 m i n at 4 ° C . Af t e r centrifugation, the pur i f ied luteal cel ls i n the 2 5 % P e r c o l l layer were careful ly aspirated, and washed 2 t imes w i t h fresh culture m e d i u m . Immediate ly , the cel ls were sparsely plated i n a 6 - w e l l culture plates and incubated i n p r imary growth m e d i u m conta in ing heat inact ivated 1 0 % F B S , for the first 24 h . 3.3.3.2. Examination of luteal cell viability and cell counting Af te r 24 h o f culture i n the p r imary growth m e d i u m , cel ls were washed w i t h w a r m H B S S , 2 to 3 t imes, to free the dead or unattached cel ls and c e l l debris. The attached c e l l layer was over layered w i t h 0.7 m L o f a non-enzymat ic ce l l -d issoc ia t ion solu t ion , and incubated for 10 to 15 m i n (or un t i l the cel ls were comple te ly detached from the plate surface). S o m e cultures required more than 15 m i n incubat ion, depending o n the c e l l densi ty 98 and degree o f attachment. Cul tures were di lu ted w i t h 4 to 5 m L o f H B S S , p o o l e d into sterile 15 m L F a l c o n tubes, and centrifuged at 300 x G for 8 m i n . Depend ing the size o f c e l l pellet , ce l l s were re-suspended i n 0.5 to 2 m L o f culture m e d i u m , and c e l l v i ab i l i ty , were examined b y the t rypan blue (0.2%) exc lus ion method. B r i e f l y , an al iquot o f ce l ls , w i t h required d i lu t ions , were m i x e d w i t h trypan blue, and incubated 2 to 3 m i n at r o o m temperature. To ta l c e l l count, and percentage c e l l v i ab i l i ty , were determined b y f o l l o w i n g the Hemocy tomete r c e l l count method. C e l l v i a b i l i t y was observed i n the range o f 80 to 9 0 % dur ing different days o f luteal c e l l preparation for the experimental treatments. 3.3.3.3. GnRH-a treatment of dispersed luteal cells Dispe r sed luteal c e l l cultures prepared as per the procedure out l ined i n the above paragraphs. Lu tea l cel ls were plated at the density o f 5 x 10 5 c e l l s / m L / w e l l , i n 24 w e l l tissue culture plates. E a c h treatment w e l l contained a f inal v o l u m e o f 1 m L o f culture m e d i u m , i n c l u d i n g exper imental treatments, and culture m e d i u m supplements (v/v) : 25 -hydroxycho les t ro l (20 ixg/mL) , human transferrin (5 n g / m L ) , se len ium (4 n g / m L ) and gentamic in (50 u g / m L ) . Different doses o f buserel in (0, 10, 50, 200, 500 or 1000 n g / m L ) , was appl ied i n duplicate or triplicate culture we l l s . Treatment cultures were incubated at 3 7 ° C i n a humid i f i ed atmosphere, saturated w i t h 95 % air and 5 % C 0 2 for the next 24 h . Af t e r 24 h , the incubat ion was terminated, and a sample (0.5 m L ) o f spent culture m e d i u m was harvested from each treatment w e l l , and stored at - 2 0 ° C for P 4 measurement. M o r e than a dozen C L were u t i l i z ed i n this study, and o n each day o f experiment, 1 to 3 C L were processed, depending o n the number o f C L obtained dur ing each v is i t to the slaughterhouse. 99 3.3.3.4. Preparation of minced luteal tissue and in vitro culture conditions B o v i n e ovaries were obtained at a loca l abattoir, and transported i n i c e - c o l d D M E M -F 1 2 , supplemented w i t h antibacterial (pen ic i l l i n 100,000 JJJ /L, s t reptomycin 100,000 p g / L ) , and ant imycot ic (amphoterocin B 2.5 n g / m L ) agents. In the laboratory, C L were washed i n c o l d saline, subjected to a qu ick dip i n 7 0 % ethanol, and immedia te ly washed w i t h a sterile c o l d saline. T issue samples were harvested from 2-3 C L , pooled together and m i n c e d into smal ler pieces i n a large petri d i sh containing ice c o l d H B S S . M i n c e d C L tissue was washed 2-3 t imes w i t h 10 m L o f ice c o l d H B S S . D u r i n g wash ing steps, the petri d i sh contents were subjected to gentle s w i r l i n g , and H B S S solut ion, i nc lud ing f loat ing tissue debris, was aspirated us ing Pasture pipette. The excess amount o f l i q u i d from m i n c e d tissue was r emoved b y b r i e f ly p l a c i n g the tissue o n mul t i - layered sterile K i m wipes . Immediately, about 100 m g o f tissue was weighed , and r andomly distributed into i nd iv idua l we l l s (24 -we l l tissue culture plates, F a l c o n P r i m a r i a T M ) conta ining 1 m L o f c o l d H B S S solut ion. The tissue samples i n i n d i v i d u a l culture we l l s were g iven an addi t ional was h b y gentle agitation, and r emova l o f H B S S . Care was taken to avo id the remova l o f tissue w h i l e aspirating H B S S dur ing wash ing steps. Immediate ly , the tissue samples i n each w e l l were suppl ied w i t h the w a r m D M E M - F 1 2 m e d i u m , w h i c h was supplemented w i t h 25-hydroxycholes t ro l (20 u.g/mL), human transferrin (5 n g / m L ) , se lenium (4 n g / m L ) and gentamicin (50 p g / m L ) . T h e f inal v o l u m e o f culture m e d i u m , i n c l u d i n g respective treatments i n each treatment w e l l was adjusted to 1 m L . 3.3.3.5. Effect of LH on in vitro P 4 synthesis in luteal tissue The m i n c e d luteal tissue cultures were prepared as out l ined i n the previous paragraph. T h e different doses o f L H (0, 50, 100, or 500 ng/ m L ) were appl ied i n tr iplicate culture we l l s , 100 and the treatment cultures were incubated at 3 8 ° C i n a humid i f i ed atmosphere, saturated w i t h 95 % air, and 5 % C 0 2 for the next 6 h . A t the end o f 6 h , treatment cultures were terminated, and a sample (0.5 m L ) o f spent culture m e d i u m was col lec ted f rom each w e l l and stored at - 2 0 ° C for P 4 measurement. A t least 4 i nd iv idua l C L col lec ted o n different days were u t i l i z e d i n this part o f the experiment. 3.3.3.6. Effect of GnRH-a on in vitro P4 synthesis in luteal tissue T h e different treatments were compr ised o f m e d i u m alone ( C O N ) , L H - 1 0 0 ng , busere l in ( B U S ) 200 ng , B U S 1000 ng, L H 100 n g + B U S 200 ng , L H 100 ng + B U S 1000 ng , A n t i d e ( A N T ) 500 ng , and A N T 500 ng + B U S 200 ng . E a c h treatment culture w e l l contained a f inal v o l u m e o f 1 m L o f culture m e d i u m , i nc lud ing exper imental treatments, and culture m e d i u m supplements (v/v) : 25-hydroxycholes t ro l (20 u,g/mL), human transferrin (5 n g / m L ) , se lenium (4 n g / m L ) and gentamicin (50 u.g/mL). Treatment cultures were incubated for 6 h at 3 8 ° C , w i t h humid i f i ed atmosphere saturated w i t h 95 % air and 5 % C 0 2 . Cul tures were terminated at the end o f the s ix th hour o f incubat ion, and spent m e d i u m was harvested and stored at - 2 0 ° C for P 4 measurement. A t least f ive trials that were conducted o n separate occasions were inc luded i n this study. 3.3.3.7. Effect of GnRH-a on in vitro P4 synthesis in luteal tissue, in presence of LH, or PGF2a T h i s part o f the study was a replicate o f the above experiment (3.3.3.6), w i t h different treatment combinat ions us ing different batches o f C L . T h i s study was undertaken to examine the direct effect G n R H - a o n in vitro P 4 product ion i n bov ine luteal tissue, i n the presence o f L H , or d P G F 2 a . T h e different treatments (ng /mL) were compr i sed o f cont ro l (med ium 101 only) , L H 100 ng , busere l in ( B U S ) 200 ng, B U S 1000 ng, L H 100 n g + B U S 200 ng , L H 100 n g + B U S 1000 ng , P G F 2 c t 500 ng , and PGF2cc 500 ng + B U S 1000 ng . Treatment cultures were incubated for 6 h at 3 8 ° C , i n a humid i f i ed atmosphere, saturated w i t h 95 % air and 5 % C 0 2 . Cul tures were terminated at the end o f s ix th hour incubat ion and spent m e d i u m was harvested and stored at - 2 0 ° C for P 4 measurement. In this part o f the study, at least 4 trials were conducted us ing C L that were harvested o n different days. 3.3.4. Steroid hormone assay Steroid hormones ( E 2 and P 4 concentrations i n spent culture med ium) were measured b y us ing a c o m m e r c i a l l y avai lable, s o l i d phase radio immunoassay ( R I A ) ki ts . These ki ts were p r ev ious ly val idated for the measurement o f both E 2 , and P 4 , concentrations i n spent c e l l culture m e d i u m i n our laboratory ( M a n i k k a m and Rajamahendran, 1997). B r i e f l y , dur ing in i t i a l steps, R I A were performed o n serial d i lu ted spent culture m e d i u m samples (data not shown) . D u r i n g subsequent steps, the spent culture m e d i u m samples were d i lu ted i n a phosphate buffered saline (1:100), and the respective concentrations o f E 2 and P 4 were measured dur ing separate R I A steps. S a m p l i n g o f the spent culture m e d i u m (diluted), the k i t standards ( E 2 and P 4 calibrators) and incubat ion o f react ion components were s imi l a r to that o f k i t guidel ines. U p o n addi t ion o f buffered I - labeled P 4 or E 2 (1.0 m l ) , the tube contents were m i x e d b y gentle agitation, and then incubated at r o o m temperature for 3 h . A t the end o f 3 h incubat ion , the tubes were decanted, and the remain ing radio-act iv i ty was counted for 1 m i n us ing a g a m m a counter (Packard A u t o gamma 500, Packard Instruments, D o w n e r s G r o v e , I L , U S A ) . The assay sensit ivi ty, intra- and inter- assay coefficient o f var ia t ion for E 2 were 5 p g / m L , 7 .6% and 12 .3% (n = 3), respectively. Whereas for P 4 , the assay sensi t ivi ty, 102 intra- and inter-assay coefficient o f var ia t ion were 0.01 n g / m L , 6 .3% and 10 .2% (n = 6), respect ively. 3.3.5. Data analysis R I A data for steroid hormones ( E 2 and P 4 measurements), were converted to a percentage o f contro l , and presented as the mean ± S E M . T h i s step was necessary due to the var ia t ion observed i n the steroid output among different day ' s cultures, and different poo ls o f granulosa ce l ls , luteal ce l l s , and different batches o f m i n c e d C L tissue cultures. E a c h culture w e l l , i n duplicate or tr iplicate treatment, was considered as an independent exper imental unit . T h e data were analyzed us ing one-way analysis o f variance ( A N O V A ) , f o l l o w e d b y pair-w i s e compar i son us ing a S tuden t -Newman-Keuls test. Resul ts were considered s ignif icant at P < 0.05 and w i t h an approaching signif icance at P > 0.05 to P < 0.15. The respective P values are indicated wherever applicable. A l l data were analyzed us ing N C S S Stat is t ical Software - t ra i l ve r s ion ( K a y s v i l l e , Utah) . 3.4. R E S U L T S 3.4.1. Effect of GnRH-a on in vitro E2 and P4 synthesis in granulosa cells B u s e r e l i n e l ic i ted a dose-dependent, b iphasic response o n in vitro E 2 secretion, i n granulosa cel ls harvested from both m e d i u m , and large, fo l l ic les ( F i g . 3.1 and 3.2). The m a x i m u m , significant s t imulatory response o f buserel in o n E 2 release was observed at the doses o f 200 n g / m L (P = 0.002), and 500 n g / m L (P = 0.07), i n granulose cel ls f rom m e d i u m fo l l i c les and 200 n g / m L i n large fo l l icu la r granulosa cel ls (P < 0.05). In terms o f P 4 output, there was an apparent tendency towards m i l d s t imulatory response, al though the results were 103 not s igni f icant ly different f rom that o f untreated control samples. H i g h e r dose levels o f buserel in , 1000 n g / m L appeared to be s l igh t ly inh ib i to ry o n both E 2 and P 4 output, irrespective o f the fo l l i c l e size ( F i g . 3.1 and 3.2). In the cultures co-treated w i t h both busere l in and its antagonist (antide, ANT), the antagonistic effect o f the latter was tended to be c lear ly evident i n terms o f the reversal o f buserel in effect o n granulosa c e l l steroid output (Fig . 3.3). 3.4.2. Effect of GnRH-a on in vitro P4 synthesis in luteal cells and tissue 3.4.2.1. Effect GnRH-a on in vitro P4 synthesis in luteal cells G n R H - a exhibi ted a dose-dependent, biphasic response o n P 4 product ion from bov ine luteal ce l l s treated dur ing in vitro culture (F ig . 3.4). The m a x i m u m st imulatory response was found at the dose range o f 50 n g - 200 n g / m L o f buserel in (P = 0.1), whereas higher dose o f busere l in (1000 n g / m L ) showed a m i l d inh ib i tory effect on P 4 levels . 3.4.2.2. LH response on in vitro P4 synthesis in luteal tissue M i n c e d luteal tissues were cul tured in vitro, and treated w i t h different doses o f bov ine LH. T h e L H (100 - 500 n g / m L ) response o n in vitro P 4 release i n luteal tissue was s igni f icant ly higher (P < 0.05), compared to that o f P 4 levels from untreated cont ro l samples (Fig . 3.5). 3.4.2.3. Effect of GnRH-a on in vitro P4 synthesis in luteal tissue In luteal tissue, buserel in treatment caused a dose-dependent, s t imulatory response o n P4 output ( F i g . 3.6) s imi la r to that o f from dispersed luteal cel ls ( F i g . 3.4). Buse r e l i n caused 104 s t imulatory response o n P4 output at 200 n g / m L (P = 0.19), and 1000 n g / m L (P = 0.14), tended to be different f rom that o f untreated control samples. Treatment o f bov ine luteal tissue w i t h antide alone (P = 0.07), or i n combina t ion w i t h buserel in (P = 0.004), showed the m a x i m a l s t imulatory response i n terms o f P4 output (F ig . 3. 6). 3.4.2.4. Effect of GnRH-a on in vitro P4 synthesis in luteal tissue, in presence of LH, or PGF2a Treatment o f m i n c e d luteal tissue w i t h buserel in (200 or 1000 n g / m L ) resulted i n a non-s ingnif icant rise i n P4 levels . Whereas, busere l in treatment combinat ions either w i t h L H , or PGF2oc alone d i d not affect the P4 output i n luteal tissue ( F i g . 3. 7). L H (100 n g / m L ) response o n P4 ouput was s igni f icant ly different (P = 0.05) f rom that o f P4 levels i n untreated samples. 3.5. D I S C U S S I O N T h e series o f experiments presented i n this chapter investigated the direct influence o f G n R H - a o n steroid hormone secretion i n bovine granulosa cel ls , dispersed luteal cel ls and i n m i n c e d luteal tissue dur ing in vitro culture. It was evident that G n R H - a exerts a dose-dependent, b iphas ic effect o n E2 output f rom in vitro cultured granulosa cel ls . A t lower dose levels (10 to 200 n g / m L ) , G n R H - a caused an increased (E2) output, whereas at a h igher dose l eve l (1000 n g / m L ) , the accumulated E2 levels were s l igh t ly l ower i n compar i son w i t h that o f E2 levels f rom untreated control cultures. A l t h o u g h the effect o f busere l in o f P4 output was s imi l a r to that o f E2 output, none o f the buserel in doses (10 to 1000 n g / m L ) caused a s ingnif icant rise i n P4 output i n granulosa cel ls . T h i s is conf i rmatory evidence that under the present culture condi t ions granulosa cel ls were fu l ly estrogenic and d i d not undergo 105 lu te in iza t ion process. The present observations are i n agreement w i t h s imi l a r reports that have demonstrated that G n R H - a w o u l d induce steroidogenesis i n human granulosa cel ls in vitro (Ranta et a l . , 1982; Par inaud et a l , 1992; O l s s o n et a l . , 1990; Bussenot et a l . , 1993). Par inaud et a l . (1988) suggested that G n R H - a c o u l d modulate steroidogenesis b y a direct ovar ian act ion. Guerrero et a l . (1993) found an increase i n P 4 , and decrease i n E 2 product ion , w h i c h seemed to be related to a decrease o f L H receptor numbers and aromatase ac t iv i ty i n G n R H agonist-treated cel ls . The present study does not provide def ini t ive evidence for the presence o f functional G n R H receptors that c o u l d mediate a G n R H - a response affecting steroidogenic potentials o f bov ine granulosa cel ls treated in vitro. Nonetheless , based o n the response e l ic i ted b y G n R H antagonist, reversal o f G n R H - a effect o n E 2 output does suggest the poss ib le existence o f G n R H l igand specific target sites o n granulosa cel ls . In efforts to examine the direct effects o f G n R H - a o n in vitro P 4 product ion i n bov ine C L , bo th dispersed luteal c e l l cultures, and luteal tissue (organ) culture systems, were u t i l i zed . B o t h dispersed c e l l culture systems and organ/tissue culture systems possess their o w n merits and demerits. Dispersed c e l l culture condi t ions a l l o w examinat ion o f the specif ic type, or a specif ic o f c e l l popula t ion i n question, whereas an organ or tissue culture system a l lows examina t ion o f the organ, w h i c h represents, more or less, the intact system i n the body . F r o m the literature, it is evident that the m i n c e d luteal tissues, or organ culture system, w o u l d preserve the cel lu lar interaction, and retain h i s to logica l and b i o c h e m i c a l differentiation o f the C L tissue (Harr i son et a l . , 1987; D e l V e c c h i o et a l . , 1995a,b). Therefore, w e u t i l i zed both dispersed luteal c e l l culture, and tissue/organ culture systems, to examine the possible direct influence o f G n R H - a o n C L function i n bov ine species. D u r i n g 106 the in i t i a l steps, the functional v i a b i l i t y o f m i n c e d luteal tissue and the culture condi t ions were ascertained b y examin ing the L H responsive P 4 secretion ( F i g . 3.5); There was a dose-dependent L H st imulatory response on P 4 secretion. Therefore the present culture condi t ions were considered appropriate for the purpose o f examin ing G n R H - a effect o n C L P 4 output dur ing in vitro culture. G n R H - a exhib i ted a dose-dependent, s t imulatory response o n P 4 output f rom both dispersed luteal cel ls and luteal tissue. H o w e v e r , the higher dose levels o f busere l in (1000 n g / m L ) showed a m i l d inh ib i to ry effect o n P 4 levels i n luteal ce l ls . It is not clear whether the suppressed P 4 l eve l at higher dosage levels is i n fact due to inh ib i to ry roles o f G n R H - a , or autoregulatory mechanisms such as receptor desensit ization, or down-regula t ion o f its o w n receptors, as reported i n other studies (Olofsson et a l . , 1995; V o l k e r et a l . , 2002) . Treatment o f luteal tissues w i t h antide alone, or i n combina t ion o f buserel in, e l ic i ted a m a x i m a l s t imulatory response i n terms o f P 4 output. U n l i k e other reports, as w e l l as i n the present study (antide alone or the combined effect o f buserel in and antide o n granulosa c e l l steroid output; 3.3.6), a m a x i m a l s t imulatory response was e l ic i td i n terms o f P 4 output i n C L tissue, w h e n treated as antide alone, or i n combina t ion w i t h buserel in . T h e reason for this a typical response is not k n o w n . H o w e v e r , evidence suggests that the G n R H antagonist (antide) c o u l d e l ic i t a agonist- l ike ac t iv i ty i n certain type o f ovar ian cancer cel ls (Grundker and E m o n s , 2003) . In addi t ion, there m a y be other u n k n o w n factors w i t h i n C L tissue, i n conjunct ion w i t h antide that might have been responsible for this a typical response. It is also interesting to note that granulosa cel ls f rom w o m e n that were treated w i t h G n R H antagonist (cetrorelix) responded earlier to the in vitro hormone s t imulat ion, i n terms o f P 4 accumula t ion , than 107 w o m e n treated w i t h the G n R H agonist (buserelin) as reported b y L i n et a l . (1999). T h e i r results indicate that luteal function is less impai red i n G n R H antagonist treatment, than i n G n R H agonist, treatment. Further, evidence f rom porcine granulosa c e l l cultures suggests that G n R H antagonist, combined w i t h fo l l icu la r f lu id , c o u l d enhance L H - s t i m u l a t e d P 4 secretion ( L e d w i t z - R i g b y , 1989). In addit ion, the biphasic effects o f G n R H antagonist o n rat granulosa c e l l in vitro steroidogenesis that varies w i t h exposure t ime, showed the in i t i a l response be ing st imulatory, and the latter inhibi tory . The i r studies show that 20 a l p h a - O H P secretion i n the same cultures was potentiated b y the combined presence o f F S H , and G n R H -a (Sheela R a n i et a l . , 1983). These authors suggest that these types o f responses c o u l d have been due, to some extent, the maturational stage o f the granulosa cel ls . F r o m this evidence, it is tempt ing to suggest that G n R H antagonist m a y mediate their effects independent o f G n R H target sites and they m a y also interact w i t h some u n k n o w n factors i n ovar ian c e l l types. T h i s br ings attention to several o f previous reports, w h i c h suggest the presence o f G n R H - l i k e molecu les i n gonadal structures ( Y i n g et a l . , 1981; A t e n et a l . , 1987a, b ; Ireland et a l . , 1988; I z u m i et a l . , 1985). H o w e v e r , there is no concrete evidence that suggests any funct ional role for such molecules i n the ovary or any other reproductive tissues. Resul ts f rom the present study differ f rom those o f M i l v a e et a l . (1984), w h o reported a dose-dependent suppression o f P 4 secretion f rom in vitro cultured, bov ine luteal ce l l s . In that study, the authors suggest that it is ve ry u n l i k e l y that G n R H mediated its effects through the mechan i sm o f l igand-specif ic receptor interaction o n bov ine luteal ce l ls . The reason for entirely different types o f responses observed between these studies, c o u l d have been due to the variat ions i n experimental condit ions. A s it seems to be there are o n l y two such studies 108 that were carr ied out i n bov ine species, w i t h two different observations, it is di f f icul t to draw a def ini t ive conc lus ion w i t h respect to the direct effects o f G n R H or its analogues o n bov ine ovar ian function. H o w e v e r , it is noteworthy that i n the bovine species, in vivo adminis t ra t ion o f G n R H - a dur ing la te-mid luteal phase has resulted i n increased P 4 output (Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2000; Rajamahendran et a l . , 1998, 2001) . In the ovary , G n R H has been shown to el ic i t a mixedtype o f response that m a y affect ovar ian funct ion ( review by; Sharpe, 1982; Janssens et a l . , 2000; L e u n g et a l . , 2003) . Severa l reports, from different experimental models , have suggested the funct ional modula tor roles for G n R H , or its analogues, at the gonadal l eve l . Guerrero et a l . (1993) obsereved an increase i n P 4 and decrease i n E 2 product ion, w h i c h seemed to be related to a decrease i n L H receptor numbers and aromatase act iv i ty i n G n R H agonist-treated cel ls . It is also reported that the G n R H agonist, buserel in, causes a biphasic effect, such as increased basal P 4 secretion, or decreased L H - i n d u c e d P 4 secretion, in vitro. G n R H is be l i eved to exert its direct effects o n its o w n , or i n conjunct ion w i t h other factors such as P G F 2 a , a n g i o t e n s i n II or lu te in iz ing hormone ( R e v i e w e d b y Steele and L e u n g , 1993). H o w e v e r , i n this study buserel in treatment i n combinat ions o f L H or P G F 2 a , had no influence o n P 4 output from luteal tissue. S t imula t ion o f one or more s ignal ing pathway, such as phosphol ipase C ( P L C ) , phosphol ipase A 2 ( P L A 2 ) and phospholipase D ( P L D ) , and/or act ivat ion o f prote in kinase C ( P K C ) have been hypothes ized to cause either inhib i tory , or s t imulatory effects o n ovar ian ce l lu la r s teroid output. These dual effects have been demonstrated dur ing in vivo experiments i n adult ma le and female hypophysec tomized rats, where exogenous G n R H or G n R H - a c o u l d 109 both stimulate or inhib i t gonadal functions i n terms o f steroidogenesis (Hsueh and Jones, 1981, 1982). In adult male rats, a lower dose o f G n R H - a administrat ion for a short duration, was s h o w n to stimulate testosterone secretion (Sharpe et a l . , 1982). H o w e v e r , the effect was opposite w h e n the agonist was administered at a higher dose, or for a longer durations ( A r i m u r a et a l . , 1979, H s u e h and E r i c k s o n , 1979). Other reports have demonstrated that G n R H modulates both basal and gonadotropin-st imulated steroidogenesis (Olofsson et a l . , 1995) i n the ovary . T h e inh ib i to ry act ion o f G n R H , or its agonists, o n gonadal steroidogenesis invo lves suppression o f the gonadotropin receptors, or intermediary enzymes, i n v o l v e d i n the steroidogenic pathway. Reports suggesting G n R H - a - i n d u c e d suppression o f F S H and L H receptors ( T i l l y et a l . , 1992; Piquette et a l . , 1991; Guerrero et a l . , 1993), gonadotropin- induced c A M P levels (Richards , 1994; K n e c h t et a l . , 1985) or steroidogenic enzyme ac t iv i ty such as S t A R protein, P450scc enzyme, and 3P-HSD (Sridaran et a l . , 1999a; Sr idaran et a l . , 1999b), or no effect (Casper et a l . , 1984) o f G n R H o n P 4 produc t ion i n human granulosa-lutein cel ls ( h G L C s ) , have been documented. Researchers have also reported that G n R H and its potent agonists c o u l d stimulate meios i s in vitro, i n fo l l ic le -enc losed oocytes, i n a dose-dependent manner (Hi l lens jo and L e M a i r e , 1980). S i m i l a r l y , i n the bov ine species, oocytes that were pre-exposed to the G n R H - a (buserelin) had increased cleavage potentials dur ing in vitro fer t i l izat ion (Funston and Se ide l , 1995). The reasons for these complex , and var ied responses o f reproductive tissues across different species (to the G n R H , or its analogues) are not understood. Therefore, i n attempts to ver i fy our present observations, further studies were focused o n examin ing the G n R H - a inf luence o n molecu la r mechanisms o f steroidogenic machinery i n the bov ine C L ( C H A P T E R 4). 110 3.6. C O N C L U S I O N S B a s e d o n the results presented i n this chapter, G n R H - a caused a dose-dependent s t imulatory response o n steroid hormone output from bovine granulosa ce l ls , dispersed luteal ce l l s , and from luteal tissue treated in vitro. Howeve r , these f indings do not p rov ide the def ini t ive evidence for a direct interaction o f G n R H - a w i t h its receptor o n the above c e l l types. Nevertheless , the evidence gained through these studies, not o n l y fo rm the basis for further studies, but also refines the research strategies i n ga in ing further knowledge w i t h regard to the direct effects o f G n R H i n m a m m a l i a n reproductive tissues. i l l F I G U R E 3.1. Effect o f G n R H - a on in vitro synthesis of estradiol-17p (E2) and progesterone (P4) in bovine granulosa cells from medium follicles. Cells were cultured in primary growth medium for 48 h and then treated with different doses o f G n R H - a (0 ng to 1000 ng/mL) for the next 24 h in serum-free cultures supplemented with 10"7 M androstenedione as the precursor for E2 synthesis. E2 and P4 values were expressed as a percentage o f control. Each data point represents the mean ± S E M from at least 5 individual trials. * different (P < 0.05) from untreated control samples. \ 112 FIGURE 3.2. Effect of G n R H - a on in vitro synthesis o f estradiol-170 (E2) and progesterone (P4) in bovine granulosa cells from large follicles. Ceils were cultured in primary growth medium for '48 h and then treated with different doses o f G n R H - a (0 ng to 1000 ng/mL) for the next 24 h in serum- free cultures supplemented with 10' 7 M androstenedione as the precursor for E2 synthesis. E2 and P4 values were expressed as a percentage o f control. Each data point represents the mean ± S E M from at least 5 individual trials. * different ( P < 0.05) from untreated control samples. 113 140 T F I G U R E 3.3. Effect o f Gt iRH-a in presence or absence G n R H antagonist on in vitro estradiol-17(3 (E2) and progesterone (P4) synthesis in bovine granulosa cells from large follicles. Cells were cultured in primary growth medium for 48 h and then treated with o f G n R H - a in presence o f absence G n R H antagonist, antide ( A N T ) for the next 24 h. Serum-free cultures supplemented with 10"7 M androstenedione as a precursor for E2 synthesis. Treatments were consisted o f medium alone ( C O N ) , Buserelin ( B U S ) 200 ng, B U S 200 ng + A N T 500 ng and A N T 500 ng/mL. Each data point represents the mean ± S E M from two different trials. N o statistical analysis was performed due to less er number o f trials. 114 250 a- 200 4 o u -g S 150 PH 100 4 50 4 Treatments n g / m L CON [BUS-0 ng] El BUS-10 ng BUS-200ng 0BUS-5OOng IBUS-50ng IBUS-lOOOng FIGURE 3.4. Effect o f G n R H - a on in vitro P4 synthesis from bovine luteal cells. Dispersed luteal cells were cultured in primary growth medium for 24 h and then treated with different doses o f buserelin ( B U S ) for the next 24 h in serum free culture conditions. Treatments were comprised o f medium alone ( C O N ) , B U S (0, 10, 50, 200, 500, 1000 ng/mL). Data represents the mean ± S E M from more than a dozen o f individual C L that were processed (1-3 C L / trial) on different occasions. * different (P = 0.1) from control samples. 115 LH ng/mL HLH-Ong ^LH-50ng HLH-100 ng E3LH-500ng F I G U R E 3 . 5 . L H dose-response on in vitro progesterone (P4) synthesis in luteal tissue. Minced luteal tissue samples were cultured in vitro and treated with different doses o f L H (0, 50, 100, and 500 ng/ m L ) for 6 h. Data represents the mean ± S E M of 4 individual C L (stage I I I ) . * different {P < 0.05) from untreated control samples (LH-0 ng/mL). 116 160 140 120 100 80 60 40 20 0 fe • CON BLH100 ng C3 BUS200 ng E3BUS1000ng H ANT500 ng • ANT500 ng+BUS200 ng Treatments ng/mL F I G U R E 3 . 6 . Effect o f G n R H - a on progesterone (P4) synthesis in bovine luteal tissue. Minced luteal tissue samples were cultured in vitro and treated with different doses o f buserelin ( B U S ) for 6 h. Treatments consisted o f only medium (CON) , L H 1 0 0 ng, B U S 200 ng, B U S 1000 ng, Antide ( A N T ) 500 ng, A N T + B U S 200 ng, Data represents the mean ± S E M of 5 trials. * different (P < 0. 05) from control samples. 117 F I G U R E 3.7. Effect o f G n R H - a in combinations o f L H and P G F 2 o c on progesterone (P4) synthesis in bovine luteal tissue. Minced luteal tissue was cultured in vitro and treated with buserelin ( B U S ) in combinations o f L H or P G F 2 a for 6 h. Treatments consisted o f medium alone ( C O N ) , L H 1 0 0 ng, B U S 2 0 0 ng, BUS1000 ng, BUS200 ng + LH100 , BUS1000 ng + L H 1 0 0 ng, PGF 2 c t 500 ng, BUS1000 ng + P G F 2 a 5 0 0 ng. Data represents the mean + S E M of 4 trials. 118 REFERENCES Arimura A, Serafini P, Talbot S, Schally AV. 1979. Reduc t ion o f testicular lu te in iz ing hormone/human chor ion ic gonadotropin receptors b y [D-Trp6] - lu te in iz ing hormone releasing hormone i n hypophysec tomized rats. B i o c h e m B i o p h y s Res C o m m u n . 90: 687-693. Aten FR, Ireland JJ, Weems CW, Behrman HR. 1987a. Presence o f gonadotropin-releasing hormone- l ike proteins i n bov ine and ovine ovaries. E n d o c r i n o l o g y 120:1727-1733. Aten RF, Polan M L , Bayless R , Barman HR. 1987b. A gonadotropin-releasing hormone ( G n R H ) - l i k e prote in i n human ovaries: s imi la r i ty to the G n R H - l i k e ovar ian prote in o f the rat. J C l i n E n d o c r i n o l Me tab . 64:1288-1293. Bussenot I, Azoulay-Barjonet C, Parinaud J. 1993. M o d u l a t i o n o f the steroidogenesis o f cul tured h u m a n granulosa- lu te in cel ls b y gonadotropin-releasing hormone analogs. J C l i n E n d o c r i n o l M e t a b . 76: 1376-1379 . Casper RF, Erickson GF, Yen SS. 1984. Studies o f the effect o f G n R H and its agonist o n h u m a n luteal steroidogenesis in vitro. Fe r t i l Ster i l . 42 : 39-43. Conn PM, Crowley WF. Jr. 1994. Gonadotropin-releasing hormone and its analogs. A n n u R e v M e d . 45 : 391-405. Del Vecchio RP, Thibodeaux JK, Hansel W. 1995a. Contact-associated interactions between large and sma l l bovine luteal cel ls dur ing the estrous cyc le . D o m e s A n i m E n d o c r i n o l . 12:25-33. Del Vecchio RP, Thibodeaux JK, Saatman R, Hansel W. 1995b. Interactions between large and s m a l l luteal cel ls col lected dur ing the m i d - or late-luteal stages o f the oestrous cyc le . R e p r o d F e r t i l D e v e l o p . 7:35-40. D'Occhio MJ, Aspden WJ. 1999. Endocr ine and reproductive responses o f male and female cattle to agonists o f gonadotropin-releasing hormone. J R e p r o d Fert. (supple 54): 101-114. D'Occhio MJ, Fordyce G, Whyte TR, Aspden WJ, Trigg TE. 2000. Reproduc t ive responses o f cattle to G n R H agonists. A n i m R e p r o d S c i . 6 0 - 6 1 : 4 3 3 - 4 4 2 . Emons G, Schally AV. 1994. The use o f lu te in iz ing hormone releasing hormone agonists and antagonists i n gynaecolog ica l cancers. H u m Reprod . 9:1364-79. Funston RN, Seidel GE. Jr. 1995. Gonadotropin-releasing hormone increases cleavage rates o f bov ine oocytes fer t i l ized in vitro. B i o l Reprod . 53:541-545. Grundker C, Emons G. 2003. R o l e o f gonadotropin-releasing hormone ( G n R H ) i n ovar ian cancer. R e p r o d B i o l E n d o c r i n o l . 7:65. 119 Guerrero HE, Stein P, Asch RH, de Fried EP, Tesone M . 1993. Effect o f a gonadotropin-releasing hormone agonist o n lu te in iz ing hormone receptors and steroidogenesis i n ovar ian cel ls . F e r t i l S te r i l . 59, 803-808. Harrison L M , Kenny N, Niswender GD. 1987. Progesterone product ion , L H receptors, and o x y t o c i n secretion b y ov ine luteal c e l l types o n days 6, 10 and 15 o f the oestrous cyc l e and day 25 o f pregnancy. J R e p r o d Fer t i l . 79:539-548. Hillensjo T, LeMaire, WJ. 1980. Gonadot rop in releasing hormone agonists stimulate me io t i c maturat ion o f fo l l ic le -enclosed rat oocytes in vitro. Nature 287: 145-146 . Hsueh AJ, Jones PB. 1982. Regu la t ion o f ovar ian granulosa and luteal c e l l functions b y gonadotropin releasing hormone and its antagonist. A d v E x p M e d B i o l . 147:223-62. Hsueh AJ, Erickson, GF. 1979. Extra-pi tui tary inh ib i t ion o f testicular funct ion b y lu te in i s ing hormone releasing hormone. Nature 281 : 66-67. Hsueh AJ, Jones, PB. 1981. E x t r a pi tui tary actions o f gonadotropin-releasing hormone. E n d o c r R e v . 2: 437-461 . Hsueh AJW, Schreiber JR, Erickson GF. 1981. Inhibi tory effect o f gonadotropin-releasing hormone u p o n cul tured testicular cel ls . M o l C e l l E n d o c r i n o l . 21:43-49. Ireland JJ, Murphee RL, Coulson PB. 1980. A c c u r a c y o f predic t ing stages o f bov ine estrous c y c l e b y gross appearance o f the corpus luteum. J D a i r y S c i . 63:155-160. Ireland JJ, Aten FRO, Barman, HR. 1988. G n R H - l i k e proteins i n cows : concentrations dur ing corpora lutea development and selective loca l iza t ion i n granulosal cel ls . B i o l Rep rod . 38: 544-550. Izumi S, Makino T, Iizuka R. 1985. Immunoreact ive lu te in iz ing hormone-releas ing hormone i n the seminal p l a sma and human semen parameters. Fe r t i l S ter i l . 43 : 617-620. Janssens RMJ, Brus L , Cahill DJ, Huirne JA, Schoemaker J, Lambalk CB. 2000. D i rec t ovar ian effects and safety aspects o f G n R H agonists and antagonists. H u m R e p r o d Update . 6: 505-518. Jones PB, Conn PM, Marian J, Hsueh AJ. 1980. B i n d i n g o f gonadotropin releasing hormone agonist to rat ovar ian granulosa cel ls . L i f e S c i . 27:2125-32. Kamada H, Ikumo H. 1997. Effect o f se lenium o n cul tured bov ine luteal cel ls . A n i m R e p r o d S c i . 46:203-11. Knecht M , Ranta I, Feng P, Shonohara O, Catt KJ. 1985. Gonadotropin-re leas ing hormone as a modula tor o f ovar ian function. J Steroid B i o c h e m . 23:771-778. 120 Kruip TA, Dieleman SJ. 1982. M a c r o s c o p i c c lass i f icat ion o f bov ine fo l l i c les and its va l ida t ion b y mic romorpho log i ca l and steroid b iochemica l procedures. R e p r o d N u t r D e v . 22:465-73. Ledwitz-Rigby, F. 1989. A comparison of the actions of stimulatory follicular fluid and gonadotropin-releasing hormone analogs on progesterone secretion by porcine granulosa cells. Biol. Reprod. 41: 604-609. Leung PC, Cheng CK, Zhu X M . 2003. Mul t i - f ac to r i a l role o f G n R H - I and G n R H - I I i n the h u m a n ovary . M o l C e l l E n d o c r i n o l . 202: 145-153. Lin Y, Kahn JA, Hillensjo T. 1999. Is there a difference i n the funct ion o f granulosa-luteal cel ls i n patients undergoing in-vitro fer t i l izat ion either w i t h gonadotrophin-releasing hormone agonist or gonadotrophin-releasing hormone antagonist? H u m Reprod . 14:885-8. Manikkam M , Rajamahendran R. 1997. Progesterone-induced atresia o f the proestrous dominant fo l l i c l e i n the bov ine ovary: changes i n diameter, i n su l in - l ike g rowth factor system, aromatase act ivi ty , steroid hormones, and apoptotic index. B i o l Reprod . 57: 580-587. Milvae RA, Murphy BD, Hansel W. 1984. P ro longa t ion o f the bov ine estrous c y c l e w i t h a gonadotropin-releasing hormone analogue. B i o l Reprod . 31:664-670. Okuda K, Miyamoto A, Sauerwein H, Schweigert FJ, Schams D. 1992. E v i d e n c e for o x y t o c i n receptors i n cul tured bovine luteal cel ls . B i o l Rep rod . 46:1001-1006. Olofsson JI, Conti CC, Leung PCK. 1995. H o m o l o g o u s and heterologous regula t ion o f gonadotropin-releasing hormone receptor gene expression i n preovula tory rat granulosa cel ls . E n d o c r i n o l o g y 136: 974-980. Olsson JH, Akesson I, Hillensjo T. 1990. Effects o f a gonadotropin-releasing hormone agonist o n progesterone formation i n cultured human granulosa cel ls . A c t a E n d o c r i n o l (Copenh) . 122:427-31. Abstract . Parinaud J, Oustry P, Bussenot I, Tourre A, Perineau M, Monrozies X, Reme JM, Pontonnier G. 1992. Pa radox ica l ovar ian s t imulat ion i n course o f treatment b y L H - R H analogs. E u r J Obstet G y n e c o l R e p r o d B i o l . 46:117-122. Parinaud J, Vieitez G, Beaur A, Pontonnier G, Boureau E. 1988. Effect o f lu te in iz ing hormone-releas ing hormone agonist (buserelin) o n steroidogenesis o f cul tured human prevoula tory granlosa cel ls . Fe r t i l Ster i l . 50:597-602. Petroff MG, Petroff BK, Pate JL. 2001. M e c h a n i s m s o f cy tokine- induced death o f cul tured bov ine luteal cel ls . Reproduc t ion 121:753-760. Piquette GN, LaPolt PS, Oikawa M , Hsueh AJW. 1991. Regu la t ion o f lu te in iz ing hormone receptor messenger r ibonucle ic ac id levels b y gonadotropins, g rowth factors, 121 gonadotropin-releasing hormone i n cultured rat granulosa cel ls . E n d o c r i n o l o g y 128: 2449-2456. Rajamahendran R, Ambrose DJ, Small JA, Dinn N. 2001. Synchron iza t ion o f estrus and ovu la t ion i n cattle. A r c h A n i m a l Breed ing . 44: special issue 58-67. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ, Thatcher WW. 1998. Effects o f busere l in inject ion and des lore l in ( G n R H - a g o n i s t ) implants o n p lasma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . The r iogeno logy 50:1141-1155. Ranta T, Knecht M , Kody M , Catt KJ. 1982. G n R H receptors i n cul tured rat granulosa cel ls : media t ion o f the inh ib i to ry and st imulatory actions o f G n R H . M o l C e l l E n d o c r i n o l . 27:233-40. Richards JS. 1994. H o r m o n a l control o f gene expression i n the ovary. E n d o c r R e v . 15: 725-751 . Sharpe 1982. C e l l u l a r aspects o f the inh ib i to ry actions o f L H - R H o n the ovary and testis. J R e p r o d F e r t i l . 64: 517-527. Sheela Rani CS, Ekholm C, Billig H, Magnusson C, Hillensjo T. 1983. B i p h a s i c effect o f gonadotropin releasing hormone o n progest in secretion b y rat granulosa cel ls . B i o l Rep rod . 28:591-7. Simmons KR, Caffrey JL, Phillips JL, Abel JH. Jr, Niswender GD. 1976. A s imple method for prepar ing suspensions o f luteal cel ls . P roc . Soc . E x p . B i o l . M e d i c . l 5 2 : 3 6 6 - 3 7 1 . Sridaran R, Lee MA, Haynes L, Srivastava RK, Ghose M , Sridaran G, Smith CJ, 1999a. G n R H act ion o n luteal steroidogenesis dur ing pregnancy. Steroids. 64: 618-623. Sridaran R, Philip GH, Li H, Culty M, Liu Z, Stocco DM, Papadopoulos V. 1999b. G n R H agonist treatment decreases progesterone synthesis, luteal per ipheral benzediazepine receptor m R N A , l igand b ind ing , steroidogenic acute regulatory prote in expression dur ing pregnancy. J M o l E n d o c r i n o l . 22: 45-54. Steele GL, Leung PCK. 1993. S igna l transduction mechanisms i n ovar ian cel ls . Pages 113-127 in E . Y . A d a s h i and P . C . K . L e u n g , eds. T h e Ovary . R a v e n Press, N e w Y o r k . Stojilkovic SS, Catt KJ. 1995. Express ion and s ignal t ransduction pathways o f gonadotropin-releasing hormone receptors. R e c P r o g H o r m Res . 50:161-205. Thatcher WW, Drost M , Savio JD, Macmillan K L , Entwistle KW, Schmitt RL, de La Sota R L , Morris GR. 1993. N e w c l i n i c a l uses o f G n R H and its analogues i n cattle. A n i m R e p r o d S c i . 33:27-49. 122 Tilly JL, Lapolt PS, Hsueh AJW. 1992. H o r m o n a l regulat ion o f fo l l i c l e - s t i m u l a t i n g hormone receptor messenger r ibonucle ic ac id levels i n cul tured rat granulosa cel ls . E n d o c r i n o l o g y 130: 1296-1302. Volker P, Grundker C, Schmidt O, Schulz KD, Emons G. 2002. E x p r e s s i o n o f receptors for lu te in iz ing hormone-releasing hormone i n human ovar ian endometr ia l cancers: frequency, autoregulation, and correlat ion w i t h direct antiproliferative ac t iv i ty o f lu te in iz ing hormone releasing hormone analogues. A m J Obstet G y n e c o l . 186:171-179. Yang MY, Rajamahendran R. 1998. Effects o f gonadotropins and in su l i n - l i ke growth factor-I and - I I o n in vitro steroid product ion b y bov ine granulosa cel ls . C a n J A n i m S c i . 78:587-597. Ying SY, Ling N , Bohlen P, Guillemin R. 1981. Gonadocr in ins : peptides i n ovar ian fo l l i cu la r f l u i d s t imulat ing the secretion o f pi tui tary gonadotropins. E n d o c r i n o l o g y 108: 1206-1215. 123 C H A P T E R 4 E F F E C T S O F GnRH-a O N StAR P R O T E I N , P450scc, 30-HSD, BcI2 A N D Bax m R N A E X P R E S S I O N IN B O V I N E C O R P U S L U T E U M 4.1. A B S T R A C T T h i s study investigated the direct effects o f the G n R H - a (buserelin) o n m R N A express ion levels for the steroidogenic molecu la r machinery; S t A R protein, P450scc , 3(3-H S D , and assessed the influence o f buserel in o n m R N A levels for the pro- and anti-apoptotic molecules B a x and B c l 2 i n bov ine corpus luteum ( C L ) . B o v i n e C L (stage III or matured C L ) were obtained f rom a l oca l abattoir and transported to the laboratory i n i c e - c o l d D M E M - F 1 2 culture m e d i u m . M i n c e d luteal tissue samples (100 mg) were prepared (pooled tissue f rom 2 or 3 C L ) and subjected to buserel in treatment in vitro. Treatments were compr i sed o f untreated cont ro l (med ium on ly) , L H - 1 0 0 ng , buserel in ( B U S ) 200 ng , B U S 1000 ng , G n R H antagonist (antide; A N T ) 500 ng , and A N T 500 ng + B U S 200 ng . Treatment cultures were incubated for 6 h at 3 8 ° C , i n a humid i f i ed atmosphere o f w i t h 95 % air, and 5 % C 0 2 . A t the end o f the treatment per iod , incubat ion was terminated and the culture m e d i u m was decanted f rom the treatment we l l s . The remain ing luteal tissue i n culture we l l s was subjected to snap freezing i n l i q u i d ni trogen, and then stored at - 7 5 ° C for total R N A iso la t ion at a later t ime. T h e m R N A levels were assessed b y the semi-quantitative R T - P C R method. Resul ts revealed that despite the tendency for a s t imulatory response, the effect o f buserel in o n m R N A levels for S t A R prote in and P450scc were not different f rom that o f cont ro l samples. H o w e v e r , G n R H - a caused a s t imulatory response o n 3P -HSD m R N A levels that tended to be different (P = 0.12) f rom untreated control samples. Buse re l i n treatment had no influence o n the 124 m R N A levels for pro-and anti-apoptotic molecules ( B a x and B c l 2 ) i n luteal tissue. In conc lus ion , G n R H - a treatment exhibi ted an apparent tendency towards a s t imulatory response o n steroidogenic machinery molecules i n bovine C L . The present study revealed no evidence o f any adverse effects o f G n R H - a treatment i n terms o f i nduc ing apoptotic or lu te lyt ic process i n bov ine luteal tissue. 4 .2 . I N T R O D U C T I O N The hypotha lamic gonadotropin releasing hormone ( G n R H ) is released into the portal c i rcu la t ion , and binds to its receptors o n pituitary gonadotropes and causes synthesis and release o f F S H and L H into systemic c i rcula t ion . B o t h the F S H and L H , i n turn, act o n the gonads govern ing the process o f gametogenesis and steroidogenesis ( C o n n and C r o w l e y , 1994; S to j i l kov i c and Catt , 1995). In addit ion, it has been suggested that G n R H m a y have a role as a modula tor o f the ac t iv i ty i n diverse systems i n the bra in , and m a n y per ipheral organs (Jones et a l . , 1980; H s u e h and Jones, 1981; E m o n s and Scha l ly , 1994). Severa l reports have suggested an extra-hypothalamic o r ig in o f G n R H , as w e l l as the extra-pituitary presence o f G n R H receptors ( G n R H - R ) i n different types o f tissues i n the body . W i t h respect to the reproduct ive system, it is becoming increas ingly evident that there is a functional G n R H - G n R H - R system that exists i n different laboratory species (rats, p igs , and monkeys ) and i n humans ( C H A P T E R 1; 1.2.5 and 1.2.6). Further, there are numerous reports that suggest there are direct effects o f G n R H that m a y act i n an autocrine or paracrine manner, e l i c i t i ng a var ie ty o f responses i n reproductive tissues. Several studies have demonstrated that G n R H modulates, bo th basal and gonadotropin, st imulated steroidogenesis i n the ova ry (Olo f s son et a l . , 1995). It has been shown that G n R H - a administrat ion causes suppression o f 125 F S H and L H receptors ( T i l l y et a l . , 1992; Piquette et a l . , 1991; Guerrero et a l , 1993) or gonadotropin- induced c A M P levels i n rats (Richards, 1994; K n e c h t et a l . , 1985). Fur ther ,m vivo adminis t ra t ion o f G n R H - a (buserelin) i n rats has resulted i n suppression o f steroidogenic enzyme act ivi ty , such as steroidogenic acute regulatory protein ( S t A R ) , cy tochrome P 4 5 0 side cha in cleavage enzyme (P450scc) , and 3p -hyd roxy steroid dehydrogenase ( 3 P - H S D ) , i n the C L o f rats (Sr idaran et a l . , 1999a; Sr idaran et a l . , 1999b). Cont ra r i ly , no effect o f G n R H was found o n P 4 product ion i n human granulosa-lutein cel ls (Casper et a l . , 1984). C o l l e c t i v e l y , it is evident that G n R H , or its analogues, e l ic i t w i d e l y v a r y i n g responses, depending o n the type o f tissue or phys io log ica l status o f the body . It is a w i d e l y accepted fact that apoptosis, or p rogrammed c e l l death, is o f central importance for development and morpho log ica l homeostasis i n the b o d y (Steller, 1995). Hence , apoptosis has been considered as one o f the k e y mechanisms that occur dur ing the process o f luteal demise i n different species, i nc lud ing the bov ine species (Juengal et a l . , 1993; C h u n et a l . , 1994; Q u i r k et a l . , 1995; R u e d a et a l . , 1995 and 1997). In the ovary , there are several specif ic regulators o f apoptosis, i nc lud ing hormones, g rowth factors and cytokines ( C h u n and Hsueh , 1998). L a c k o f exposure, or overexposure, to some o f the hormones m a y induce apoptosis b y causing changes i n the intracel lular environment . F o r example , gonadotropins are k n o w n as fo l l i c l e su rv iva l factors. G n R H , o n the other hand, is suggested to p l a y a phys io log i ca l role associated w i t h fo l l icu la r atresia and C L demise i n the vertebrate ovary , poss ib ly v i a s t imulat ion o f apoptosis ( B i l l i g et a l . , 1994; K o g o et a l . , 1995; Sr idaran et a l . , 1998; Z h a o et a l . , 2000). Further, reports have indicated that G n R H - I and G n R H - I I can d i rec t ly induce apoptosis i n the ovar ian c e l l types i n both m a m m a l i a n , and non-126 m a m m a l i a n , vertebrates (Imai et a l . , Y a n o et a l . , 1997; A n d r e u - V i e y r a and H a b i b i , 2000) . H o w e v e r , no such informat ion has been reported i n the bov ine species. In the w a k e o f this interesting evidence f rom other species, it is o f great interest to examine i f s imi la r mechanisms take part i n the bov ine ovary cel lu lar l eve l , where G n R H , or its agonists, are emp loyed o n a routine basis i n reproductive management practices. Therefore, the experiments presented i n this chapter were carr ied out to further examine the results f rom our previous study where the tendency for a G n R H - a s t imulatory response o n in vitro s teroid output was observed i n bovine C L . In addi t ion, w e examined the poss ible direct influence o f G n R H - a o n the apoptotic process i n bov ine C L . T h e specif ic objectives o f these studies were as fo l lows : (i) T o determine the G n R H - a induced alterations i n m R N A expression levels for k e y regulatory molecules i n steroidogenic machinery : S t A R protein, 3P -HSD, and P450scc enzyme, ( i i ) T o examine the direct influence o f G n R H - a o n m R N A expression levels for pro (Bax) and anti ( B c l 2 ) apoptotic molecules i n the bov ine C L . 4.3. M A T E R I A L S A N D M E T H O D S 4.3.1. Preparation of minced C L tissue and in vitro culture conditions B o v i n e ovaries were obtained at a l oca l abattoir, and transported i n i c e - c o l d D M E M -F 1 2 supplemented w i t h antibacterial (pen ic i l l in 100,000 I U / L , s t reptomycin 100,000 u,g/L) and ant imycot ic (amphoterocin B 2.5 n g / m L ) agents. In the laboratory, ovaries were washed w i t h c o l d saline, subjected to a qu ick dip i n 7 0 % ethanol, and then immedia te ly washed once again w i t h c o l d saline i n order to remove the ethanol residue. T h e i n d i v i d u a l C L were inspected careful ly, and Stage III C L (mature C L ) were selected as per the procedure 127 out l ined b y Ireland et a l . (1980). Tissue samples were harvested from 2 or 3 C L , poo led together, and m i n c e d into smaller pieces i n a large petri d i sh conta in ing ice c o l d H B S S . M i n c e d tissue was washed 2 to 3 times i n c o l d H B S S . D u r i n g each wash ing cyc l e , the excessive H B S S and f loat ing tissue fragments were aspirated us ing a Pasture pipette. Further, any r ema in ing l i q u i d content from m i n c e d tissue was removed b y br ie f ly p l ac ing the tissue o n m u l t i layered sterile K i m wipes . Immediately, about 100 m g o f tissue was we ighed and r andomly distr ibuted into i n d i v i d u a l we l l s (24 -we l l tissue culture plates, F a l c o n P r i m a r i a T M ) conta in ing 1 m L o f c o l d H B S S solut ion. The tissue samples i n i nd iv idua l culture w e l l s were g iven an addi t ional wa sh i n c o l d H B S S w i t h gentle agitation, and excess H B S S was removed. Care was taken to avo id the remova l o f tissue w h i l e aspirating H B S S dur ing each wash ing step. Immediate ly , the tissue sample i n each w e l l was suppl ied w i t h w a r m D M E M -F 1 2 culture m e d i u m . D M E M - F 1 2 m e d i u m was supplemented w i t h 25-hydroxycholes t ra l (20 p g / m L ) , human transferrin (5 n g / m L ) , se lenium (4 n g / m L ) and gentamicin (50 p g / m L ) . E a c h treatment w e l l contained a f inal v o l u m e o f 1 m L D M E M - F 1 2 i n c l u d i n g the treatments (v/v) . D u r i n g the in i t i a l steps, the v i a b i l i t y o f the m i n c e d luteal tissue culture condi t ions was ascertained b y examin ing the L H dose response o n P 4 accumulat ions i n spent culture m e d i u m samples ( C H A P T E R 3; 3.3.3.5. and 3.4.2.2). 4 .3 .2 . G n R H - a t r e a tmen t o f l u t ea l t issue T h e different treatments were compr ised o f untreated control ( m e d i u m on ly , C O N ) , L H - 1 0 0 ng , busere l in ( B U S ) 200 ng , B U S 1000 ng, A n t i d e ( A N T ) 500 ng , and A N T 500 ng + B U S 200 ng . Treatment cultures were incubated for 6 h at 3 8 ° C , i n a h u m i d i f i e d atmosphere o f 95 % air, and 5 % C 0 2 . A t the end o f treatment (6 h), incubations were 128 terminated, and the spent culture m e d i u m was decanted from culture w e l l s . T h e remain ing tissue samples i n culture we l l s were immedia te ly subjected to "snap" freezing i n l i q u i d ni t rogen, and stored at - 7 5 ° C for total R N A isola t ion at a later t ime. A t least f ive trials that were conducted o n separate occasions were inc luded i n this study. E a c h treatment levels were compr i sed o f tr iplicate samples. 4.3.3. Total R N A isolation from GnRH-a treated luteal tissue F r o m post-treatment luteal tissues, total R N A was isolated b y f o l l o w i n g a single step R N A i so la t ion method ( C h o m c z y n s k i and Sacch i , 1987), us ing a c o m m e r c i a l l y avai lable total R N A iso la t ion solut ion, T r i Reagent. B r i e f l y , about 100-150 m g o f luteal tissue was poo led from replicate treatment we l l s . U s i n g mortar and pestle, the tissue sample was pu lve r i zed i n l i q u i d nitrogen, and immedia te ly transferred into sterile 1.5 m L m i c r o -centrifuge tubes conta in ing 1 m L o f T r i Reagent solut ion. The tube contents were m i x e d thoroughly, and a l l owe d to stand for 5 m i n at r o o m temperature i n order to facilitate complete d i sso lu t ion o f nuclear proteins, and cytoskeletal components. F o r each m L ( in i t ia l vo lume) o f T r i Reagent solut ion, 200 p i o f ch loroform was added to each tube, and samples were agitated v i g o r o u s l y for 30 s. Samples were a l l owed to stand at r o o m temperature for 10 to 15 m i n , and then centrifuged at 12000 x G for 15 m i n at 4 ° C . The top layer w i t h clear and transparent so lu t ion conta ining total R N A molecules was careful ly transferred into a new set o f sterile micro-centr ifuge tubes. E a c h tube was suppl ied w i t h a 0.5 m L o f i sopropanol , m i x e d , and samples were a l l owed to stand for 15 m i n at r o o m temperature. T h e samples were centrifuged at 12000 x G for 10 m i n at 4 ° C , and supernatant was discarded careful ly. T h e resultant pellet conta ing total R N A at the bot tom o f the tube was washed twice i n i ce -co ld 129 7 5 % ethanol b y centr ifuging at 12000 x G for 5 m i n . The resultant total R N A pellets were a i r -dr ied for 10-15 m i n , and f ina l ly d isso lved i n sterile D E P C - t r e a t e d water. T h e quanti ty and qual i ty o f total R N A were assessed b y both spectrophotometry, and b y observ ing clear bands for 28S , and 18S, r ibosomal R N A species o n e th id ium bromide stained agarose ge l (0.8%). To ta l R N A was either used immedia te ly for c D N A preparation, or stored at - 7 5 ° C for subsequent use. 4.3.4. Semi-quantitative Reverse Transcription-Polymerase Chain Reaction Reverse Transcr ip t ion-Polymerase C h a i n Reac t ion ( R T - P C R ) used i n this study was accompl i shed b y u t i l i z i n g the c o m m e r c i a l l y avai lable first strand c D N A Synthesis ki ts (The C e l l s - t o - c D N A II K i t , A m b i o n , Inc. The R N A C o m p a n y , A u s t i n , Texas , U S A ) , and P C R ki ts (JumpStart R E D T a q R e a d y m i x ki t , S i g m a - A l d r i c h Canada L t d . O a k v i l l e , O N , Canada) . R T - P C R reactions were carried out as per the k i t manufacturer's p ro toco l , w i t h necessary modif ica t ions . D u r i n g in i t i a l attempts, the amount o f template R N A , magnes ium concentrat ion, and compat ib i l i ty o f pr imer pairs was tested to determine op t ima l condi t ions for R T - P C R (data not shown). U s i n g K i t suppl ied random decamer pr imers , 2 u.g o f the total R N A sample was reverse-transcribed i n 20 u l react ion volumes . T h e f o l l o w i n g components were inc luded i n the R T reaction: 1 0 X R T buffer p H 7.4 (2 u l ) , d N T P (0.5 m M each) 1 u l , M - M L V reverse transcriptase l u i (10 U ) , R N a s e inhib i tor 1 u l (10 U ) , R a n d o m decamers 5 u M , and total R N A 2 u,g. The f inal v o l u m e was adjusted to 20 u l us ing nuclease-free water. T h e R T step was performed at 4 2 ° C for 60 m i n , and then incubated at 95 ° C for 10 m i n to inactivate the reverse transcriptase enzyme. R T samples were stored at - 2 0 ° C for future use i n P C R ampl i f ica t ion . 130 D u r i n g P C R ampl i f ica t ion , 2 p.1 o f R T sample (first strand c D N A ) were used to co-ampl i fy the housekeeping gene, G 3 P D H (as an internal standard), i n the f o l l o w i n g combinat ions o f different gene transcripts: G 3 P D H , S t A R and P45oscc ; G 3 P D H and 30-H S D ; G 3 P D H , J3cl2 and B a x . The P C R m i x (JumpStart R E D T a q R e a d y M i x ) was compr i sed o f 20 m M T r i s - H C I , p H 8.3, 100 m M K C I , 4 n M M g C l 2 , 0 .002% gelatin, 0.4 m M each d N T P ( d A T P , d C T P , d G T P , d T T P ) , inert dye, stabilizers, 0.06 U / u l T a q D N A Polymerase , JumpStart T a q antibody, 400 n M o f each p r imer (forward and reverse), and the required amount o f nuclease-free water to make up the f inal v o l u m e o f 25 u X react ion m i x . The p r imer sequence and their respective expected s ized P C R ampl icons are presented i n Tab le 4 .1 . T h e P C R condi t ions were as fo l lows : in i t i a l denaturation for 3 m i n at 9 4 ° C , ( G 3 P D H , S t A R , P450scc , 3 p - H S D , B c l 2 , and B a x ) , f o l l owed b y subsequent cycles w i t h denaturation at 9 3 ° C for 40 sec, anneal ing at 5 8 ° C for 50 sec ( G 3 P D H , S t A R , P450scc , 3P -HSD) , at 6 2 ° C for 50 sec ( B c l 2 , B a x , G 3 P D H ) and extension for 1 m i n at 7 2 ° C , and an addi t ional extension for 10 m i n at 7 2 ° C . The annealing temperature for G 3 P D H was found to be i n the range o f 5 5 ° C to 6 5 ° C (data not shown). F o r each gene o f interest, P C R ampl i f i ca t ion was cal ibrated to determine the op t ima l number o f cycles that w o u l d a l l o w detection o f the appropriate m R N A transcripts, w h i l e s t i l l keeping the ampl i f ica t ion o f these genes i n the l o g phase. The different gene transcript, P C R combinat ions i nc lud ing S t A R , P450scc , G 3 P D H ; 3 p - H S D , G 3 P D H ; and B c l 2 , B a x , G 3 P D H were a l l owed a total o f 23 , 22, and 27 cycles , respect ively. A n al iquot (equal vo lume) f rom each react ion mixture ( P C R ) was electrophoresed o n a 2 % agarose gel conta in ing e th id ium bromide , and photographed under ul t raviolet 131 i l l umina t i on . The opt ica l density o f i nd iv idua l bands (inverse image) was ana lyzed b y us ing S c i o n Image computer ized densitometry software ( S c i o n Image, h t tp : / /www.sc ioncorp .com) . 4 .3.5. Data analysis E a c h experiment was repeated at least five t imes. The data represent the mean ± S E M , and is presented as relative fo ld change to the control values. Dens i tomet ry values were no rma l i zed against corresponding, internal control G 3 P D H values, ana lyzed b y one-w a y A N O V A , and f o l l o w e d w i t h a pai r -wise compar i son us ing a T u k e y - K a r m e r test. A n y difference i n treatment effects are indicated w i t h respective P values. A l l data were analyzed us ing N C S S Statist ical Software-trail vers ion ( K a y s v i l l e , Utah) . 4.4. R E S U L T S 4.4.1. Validation of semi-quantitative R T - P C R Semi-quanti tat ive R T - P C R method was used to determine the m R N A levels for S t A R protein, P450scc , 3 p - H S D , B c l 2 and B a x i n luteal tissue. A l inear relat ionship ( log phase), P C R ampl i f i ca t ion for different gene transcripts and the internal contro l , G 3 P D H was found between 19 to 32 cycles ( F i g . 4 .1 , 4.2, 4.3 for S t A R and P450scc , 3 p - H S D , B c l 2 and B a x , respect ively) . T h e expected s ized P C R ampl icons for different gene transcripts S t A R , P450scc , 3 p - H S D , B c l 2 , B a x , and G 3 P D H were 590 bp, 362 bp, 360 bp, 154 bp, 362 bp, and 850 bp , respect ively. T h i s method o f semi-quantitative m R N A measurement us ing G 3 P D H as an internal control has been p rev ious ly described ( M a m l u k et a l . , 1998; 1999). The poss ib i l i t y o f P C R cross-contamination, or genomic D N A ampl i f ica t ion , was ru led out 132 because no P C R products were observed i n negative controls (without template and wi thout reverse transcriptase enzyme dur ing R T step). 4.4.2. Effects of GnRH-a on StAR protein, P450scc, 3p-HSD, Bcl2 and Bax m R N A levels in the bovine C L T h e semi-quantitative R T - P C R results o f luteal tissue m R N A levels for S t A R protein, P450scc , 3 p - H S D , and B a x and B c l 2 are shown i n figures 4.4, 4 .5, 4.6, and 4.7 respect ively. Despi te the tendency for a m i l d s t imulatory response, G n R H - a (buserelin) treatment d i d not affect m R N A levels for S t A R protein and P450scc , whereas buserel in effect o n m R N A levels for 3P -HSD tended to be different (P = 0.12) from that o f untreated cont ro l samples ( F i g . 4.6). Treatment o f luteal tissue w i t h G n R H - a (Busere l in , 200 ng , 1000 ng), i n combina t ion o f antide, or antide alone (500 n g / m L ) , d i d not affect the m R N A levels for pro- and anti-apoptotic gene transcripts, B a x and B c l 2 ( F i g . 4.7), respect ively 4.5. DISCUSSION The present studies investigated the direct effects o f G n R H - a o n molecu la r steroidogenic machinery , as w e l l as G n R H - a influence o n m R N A express ion for pro- and anti-apoptotic molecules i n bov ine C L . D u r i n g in vitro culture, G n R H - a treatment o f C L tissues caused a m i l d s t imulatory response o n m R N A levels o f S t A R , P450scc and 3 p - H S D al though an approaching signif icance levels c o u l d be seen o n l y i n case o f 3P -HSD. O n the other hand, G n R H - a treatment o f bov ine luteal tissues dur ing in vitro culture d i d not affect the m R N A levels for either anti- or pro-apoptotic molecules , B c l 2 and B a x , respect ively. O v e r a l l , G n R H - a caused an apparent m i l d st imulatory response o n m R N A transcripts for the 133 above-specif ied k e y regulatory molecules o f C L steroidogenic machinery . T h i s was a t yp ica l o f the response observed i n terms o f P 4 output f rom luteal cel ls and C L tissues, f o l l o w i n g G n R H - a treatment in vitro ( C H A P T E R 3). The present f indings are i n agreement w i t h earlier reports where the C L i n heifers adminis tered des lore l in ( G n R H - a ) had a greater content o f S t A R protein, and the steroidogenic enzyme, P450scc (Pitcher et a l . , 1997 ci ted b y D ' O c c h i o and A s p d e n , 1999). T h e same group o f researchers also reported a significant increase i n testosterone levels and m R N A expression leve l for S t A R , P450scc , 3(3-HSD, and P45017<x, i n testicular tissues o f bu l l s that were administered des lore l in ( A s p d e n et a l . , 1998). F r o m recent studies, it is evident that the G n R H - a ( leuprolide acetate) i n combina t ion o f e C G adminis t ra t ion i n m i c e caused a s ignif icant increase i n not o n l y S t A R m R N A , but also S t A R protein and P 4 l eve l i n ovar ian fo l l ic les (Irusta et a l . , 2003). O v e r a l l , the present f indings are i n agreement w i t h s imi l a r observations where increased p lasma P 4 levels were a characteristic feature i n many o f the studies w i t h G n R H administrat ion dur ing the luteal phase i n cattle (Thatcher et a l 1993, D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2000; Rajamahendran et a l . , 1998, 2001) . Further, these studies conf i rm the important fact that G n R H - a adminis t ra t ion dur ing luteal phase does not adversely affect the C L function i n bov ine species, as it has been reported as an opposite phenomenon i n the majori ty o f the studies i n other species o f animals i n c l u d i n g humans ( R e v i e w e d b y Janssens et a l . , 2000). The present f indings differ f rom the s imi l a r studies where the G n R H - a , buserel in (Sridaran et a l . , 1999a; Sr idaran et a l . , 1999b) or leuprol ide acetate ( A n d r e u et a l , 1998), treatment caused a significant suppressive effect o f S t A R , 3 p - H S D and P450scc i n rat ovaries. 134 T h e steroidogenic machinery molecules , S t A R protein, cy tochrome P450scc , and 30-H S D , are k e y and rate l i m i t i n g factors that govern P 4 synthesis i n the C L . In luteal cel ls , S t A R prote in facilitates the transfer o f free-form cholesterol into the inner mi tochondr i a l membrane. T h i s prote in can induce acute changes i n the rate o f steroidogenesis b y m o b i l i z i n g cholesterol , and subjecting it to the enzymes that are already present. These acute changes can happen w i t h i n a matter o f minutes. In the mi tochondr ia , the specia l type o f enzyme (P450scc) that is present w i t h i n the inner mi tochondr ia l membrane converts the free-fo rm cholesterol into pregnenolone through cleavage o f cholesterol side cha in ( M i l v a e et a l . , 1996). Further, pregnenolone is released into the cy top lasm where another k e y enzyme, 3 0 -H S D , that exists i n smooth endoplasmic re t icu lum, converts pregnenolone into P 4 . The resultant P 4 is then processed i n the G o l g i apparatus, and released into general c i rcu la t ion ( R e v i e w e d b y N i s w e n d e r et a l . , 2000). In the present studies, the exact mechanisms that affected a m i l d s t imulatory response o n m R N A expression levels S t A R , P450scc and 30 -HSD are not k n o w n . In addi t ion, these f indings do not conf i rm whether the G n R H - a effect was, indeed, due to its direct interact ion w i t h the G n R H specif ic receptor o n luteal c e l l types i n bov ine C L . M o r e studies are needed to further explore such a poss ib i l i ty , and conf i rmat ion o f any functional forms o f G n R H receptor molecules and their mode o f interaction w i t h its l igand is needed. H o w e v e r , it has been suggested that G n R H c o u l d mediate its direct effects i n conjunct ion w i t h other ho rmona l agents such as P G F 2 a , or L H , that are w e l l k n o w n to regulate ovar ian funct ion ( R e v i e w e d b y Steele and L e u n g , 1993). S t imula t ion o f one or more s igna l ing pathways such as phosphol ipase C ( P L C ) , phospholipase A 2 ( P L A 2 ) and phosphol ipase D ( P L D ) , and 135 act ivat ion o f prote in kinase C ( P K C ) has been hypothesized as causing either inh ib i tory , or s t imulatory effects o n ovar ian cel lu lar steroid output. These dua l effects have been c lea r ly demonstrated dur ing in vivo experiments i n adult male and female hypophysec tomized rats, where exogenous G n R H or G n R H - a c o u l d either stimulate or inhib i t gonadal functions i n terms o f steroidogenesis (Hsueh and Jones, 1981, 1982). G n R H has been s h o w n to el ic i t m i x e d responses affecting ovar ian function ( reviewed b y Sharpe, 1982; Janssens et a l . , 2000; L e u n g et a l . , 2003). The inhib i tory act ion o f G n R H , or its agonists, o n gonadal steroidogenesis invo lves suppression o f the gonadotropin receptors, or intermediary enzymes, i n v o l v e d i n the steroidogenic pathway. G n R H - a induced suppression o f F S H and L H receptors ( T i l l y et a l . , 1992; Piquette et a l . , 1991; Guerrero et a l . , 1993), and G n R H - a caused suppression o f gonadotropin-induced c A M P levels , has been reported (Richards , 1994; K n e c h t e t a l . , 1985). F r o m the present studies, in vitro treatment o f luteal tissue w i t h G n R H - a d i d not affect the m R N A levels for pro- and anti-apoptotic molecules , B a x and B c l 2 . These f indings differ f rom several other studies o f different species where G n R H - a was s h o w n to induce apoptotic process i n ovar ian c e l l types. D u r i n g in vitro culture, G n R H inh ib i ted D N A synthesis (Saragueta et a l . , 1997), or induced apoptosis i n rat granulosa cel ls ( B i l l i g et a l . , 1994). Studies have shown evidence for G n R H - i n d u c e d remode l ing o f the extra-cellular mat r ix . Where G n R H induced structural luteolysis i n superovulated rats through s t imula t ion o f mat r ix metalloproteinase ( M M P - 2 ) , and membrane type 1 - M M P expression ( in a developed C L ) , w h i c h degraded collagens type I V , type III, and type I, respect ively (Goto et a l . , 1999). D u r i n g ear ly pregnancy i n the rat, G n R H - a has been s h o w n to suppress serum P 4 136 levels , w h i c h is associated w i t h an increased degree o f D N A fragmentation i n the C L (Sr idaran et a l . , 1998). S i m i l a r effects o f G n R H - a - i n d u c i n g increased number o f apoptotic bodies i n human granulosa cel ls (obtained dur ing oocyte retr ieval for in vitro fert i l ization) was demonstrated b y Z h a o et a l . (2000). In the ovary, there are several specific regulators o f apoptosis, i n c l u d i n g hormones, g rowth factors and cytokines ( C h u n et a l . , 1994; C h u n and Hsueh , 1998; Y a n g and Rajamahendran, 2000). Transforming growth factor P ( T G F p ) (Mar t imbeau and T i l l y 1997), as w e l l as some l o c a l l y produced cytokines , are be l ieved p lay a role i n regulat ing apoptosis i n the ova ry (Richards , 1994). F o r example, i n cultured rat fo l l ic les , I L - i p suppressed fo l l i c l e apoptosis i n a dose dependent manner ( C h u n et a l . , 1995). In contrast, I L - 6 was s h o w n to induce apoptosis i n cul tured rat granulose cel ls (Grospe and Spangelo, 1993). A l t h o u g h the exact mechan i sm o f apoptotic c e l l death is not clear, some o f the processes i n v o l v e d appear to be h i g h l y conserved. Different s ignal ing pathways, that are c e l l specif ic , u l t imate ly converge to activate a c o m m o n or s imi la r apoptotic death program ( H s u and Hsueh , 1998). T w o important famil ies o f regulators o f the apoptotic process are the molecules o f B c l - 2 famil ies and caspases (Hengartner, 2000). The B c l - 2 f a m i l y o f genes includes both apoptosis p romot ing (e.g. B a x , B o k , and B a d ) , and apoptosis inh ib i t ing (e.g. B c l - 2 and B c l -X L , M c l - 1 ) members (Antonsson and M a r t i n o u , 2000). The B c l - 2 f a m i l y members are located i n the outer membranes o f the mi tochondr ia , and can b i n d to each other i n different pa i r -wise condi t ions . In most cases, the ratio o f pro-apoptotic to anti-apoptotic B c l - 2 homologues w i t h i n a c e l l determines whether the c e l l undergoes apoptosis or not (Ga jewsk i 137 and T h o m p s o n , 1996; An tons son et a l . , 1997). The m a i n function o f the B c l - 2 f a m i l y seems to be regulat ing the release o f pro-apoptotic factors, par t icular ly cy tochrome C , f rom the mi tochondr i a into the cy toso l (Antonsson and M a r t i n o u , 2000) . M a n y members o f the B c l - 2 f a m i l y have been isolated i n the ovary, i nc lud ing B a d , M c l - 1 , B c l - X L and B o k ( H s u and H s u e h , 2000) . Caspases are cy tosol ic proteases, and are synthesized as inact ive precursors that are c leaved b y other caspases, or autocatalyt ical ly i n order to become activated. A n important funct ion o f caspases is to activate caspase-activated D N a s e ( C A D ) , the endonuclease responsible for inter-nucleosomal D N A fragmentation, one o f the most frequently used ha l lmarks o f apoptosis ( Y u a n g , 1997; Nagata , 1997). C A D and its inh ib i to ry subunit, inh ib i to r o f caspase-activated D N a s e ( I C A D ) , are constantly expressed i n the cel ls . Caspase-mediated cleavage o f the inh ib i tory subunit results i n release and act ivat ion o f the endonuclease ( Y u a n g , 1997; Nagata , 1997). T h e present study reveals no evidence o f any adverse effects o f G n R H - a i n terms o f i nduc ing p rogrammed c e l l death i n bov ine luteal tissue, as reported i n other species. Bes ides species difference, the reason for this differential response o f G n R H - a o n luteal tissue or c e l l types is not k n o w n . H o w e v e r , f indings from these studies do not reveal any conc lus ive evidence w i t h respect to the lack o f a G n R H - a effect causing p rogrammed c e l l death, contrary to the f indings from other species. M o r e studies i n v o l v i n g , i nd iv idua l c e l l types, rather than w h o l e organ/tissue culture systems and different dose levels o f G n R H - a , m a y p rov ide more concrete and rel iable evidence. It is also important to undertake comprehensive investigations u t i l i z i n g different approaches such as assessing the h a l l mark o f apoptosis, 138 in ter-nucleosomal D N A fragmentation, or examin ing the ear ly responder o f apoptotic process, F A S and F A S l igand system. 4.6. C O N C L U S I O N F r o m the present studies, results revealed a m i l d s t imulatory response o f G n R H - a , busere l in o n m R N A expression levels for S t A R , P450scc , and 3(3-HSD, w h i c h , are k e y regulatory molecules o f steroidogenic machinery mechan i sm i n bov ine C L . H o w e v e r , statistical s ignif icance c o u l d not be achieved. Secondly , un l ike results f rom other species, G n R H - a treatment d i d not cause any adverse effect o n C L funct ion b y i n d u c i n g or augment ing the apoptotic process and luteolysis . 139 L D 19 22 25 28 31 34 37 40 Cycle Number F I G U R E 4 .1 . Character izat ion o f semiquantitative R T - P C R for G 3 P D H , S t A R protein, and P450scc m R N A transcripts f rom bovine luteal tissue. To ta l R N A was extracted f rom exper imental samples, reverse transcribed, and ampl i f ied us ing a thermal cyc le r as described under Mater ia l s and Methods . P C R products were electrophorosed o n 2 % agarose gel , stained w i t h e th id ium bromide and photographed. Inverse images (upper panel) were ana lyzed by densitometry and the l inear relationship between P C R products and ampl i f i ca t ion cycles is shown i n the lower panel . L D , molecular weight base pair (ladder). 140 L D 19 22 25 28 31 34 37 40 VP SG3PDH H S D c o Q 1 0 0 0 0 7 8 0 0 0 4 6 0 0 0 -£ 4 0 0 0 O 2 0 0 0 -0 G 3 P D H 3 b H S D 19 2 2 2 5 2 8 3 2 3 5 C y l c e N u m b e r 3 7 4 0 F I G U R E 4.2. Characterization of semiquantitative RT-PCR for G 3 P D H and 3P-HSD mRNA transcripts from bovine luteal tissue. Total RNA was extracted from experimental samples, reverse transcribed, and amplified using a thermal cycler as described in Materials and Methods. PCR products were electrophorosed on 2% agarose gel, stained with ethidium bromide and photographed. Inverse images (upper panel) were analyzed by densitometry and the linear relationship between PCR products and amplification cycles is shown in the lower panel. LD, molecular weight base pair (ladder). 141 LD 19 22 25 28 31 34 37 40 I I I I 1 1 1 19 22 25 28 32 35 37 40 Cycle Number F I G U R E 4.3. Characterization o f semiquantitative R T - P C R for G3PDH, Bcl2, and Bax m R N A transcripts from bovine luteal tissue. Total R N A was extracted from experimental luteal tissue, reverse transcribed, and amplified using a thermal cycler as described in Materials and Methods. P C R products were electrophorosed on 2% agarose gel, stained with ethidium bromide and photographed. Inverse images (upper panel) were analyzed by densitometry and the linear relationship between P C R products and amplification cycles is shown in the lower panel. L D , molecular weight base pair (ladder). 142 LD CON LH100 BUS200 BUS1000 ANT500 ANTBUS200 -R -T 9MtF ^NMP ^fffff S t A R • C O N SLH100 ng HBTJS200 ng 0 BUS 1000 ng CD ANT500 ng 0 ANT500 ng+BUS200 ng Treatments ng/mL F I G U R E 4.4. Effect o f G n R H - a on S t A R protein m R N A levels in bovine luteal tissues. Minced luteal tissue samples were cultured in vitro and treated with different doses o f buserelin medium only ( C O N ) , L H 100 ng, buserelin ( B U S ) 200 ng, and B U S 1000 ng, Antide ( A N T ) 500 ng, A N T 500 ng + B U S 200 ng. B U S dose response on S t A R protein m R N A levels (fold change from C O N ) is shown in the histogram. L D , molecular weight base pair (ladder); -R, minus RTase; -T, minus template. 143 F I G U R E 4.5. Effect o f G n R H - a on P450scc m R N A levels in luteal tissues. Minced luteal tissue samples were cultured in vitro and treated with different doses o f buserelin. Untreated control ( C O N ) , L H 100 ng, buserelin (BUS) 200 ng, B U S 1000 ng, Antide ( A N T ) 500 ng, A N T 500 ng + B U S 200 ng. B U S dose response on P450scc m R N A levels (fold change from C O N ) is shown in the histogram. L D , molecular weight base pair (ladder); - R minus RTase; -T, minus template. 144 CON LH100 BUS200 BUS1000 ANT500 ANTBUS200 -R -T G3PDH + 3RHSD 1.5 4 1 "t 0 1= : . . . . L + " # s f t _ " I ' I ' I T- • CON gLHlOO ng 3 BUS200 ng BBUS1000 ng • ANT500 ng 0 ANT500 ng+BUS200 ng 3 — i 1 | 1 ^ 1 I It. E = = = l ff [ 1 E==3 . 4"™ fc: i i: ± : \ \ \ \ \ \ \ \ \ \ \ •>\\\\\\\\\\' - - 'i'i'i W 1 | | L i | | 1 | Treatements ng/mL F I G U R E 4.6. Effect o f G n R H - a on 30 -HSD m R N A levels in luteal tissue. Minced luteal tissue samples were cultured in vitro and treated with different doses o f buserelin. Untreated control ( C O N ) , L H 1 0 0 ng, buserelin (BUS) 200 ng, B U D S 1000 ng, Antide ( A N T ) 500 ng, A N T 500 ng + B U S 200 ng. B U S dose response on 3(3-HSD m R N A levels (fold change from C O N ) is shown in the histogram. * different (P = 0.12) from that o f control samples.LD, molecular weight base pair (ladder); -R, minus RTase; -T, minus template. 1 4 5 LD CON LH100 BUS200 BUS1000 ANT500 ANTBUS200 -R -T *m nm m * * * G 3 P D H B a x Bcl2 c o > CD E3 B a x E l B c I 2 T r e a t m e n t s n g / m L F I G U R E 4.7. Effect o f G n R H - a on Bcl2 and Bax m R N A levels in bovine luteal tissue. Minced luteal tissue samples were cultured in vitro and treated with different doses of buserelin ( B U S ) . Medium only ( C O N ) , L H 100 ng, B U S 200 ng, B U S 1000 ng, Antide ( A N T ) 500 ng, A N T 500 ng + B U S 200 ng. B U S dose response on Bc l2 and Bax m R N A levels (fold change from C O N ) is shown in the histogram. L D , molecular weight base pair (ladder); -R, minus RTase; -T, minus template. 146 T a b l e 4 .1 . Ol igonuc le t ide pr imer pai r and their respective P C R ampl icons for S t A R protein, P450scc , 3 P - H S D , B a x , B c l 2 and G 3 P D H m R N A transcripts f rom bov ine luteal tissue. G e n e sequence P r i m e r sequence F r a g m e n t l eng th (bp) F o r w a r d 5 ' - 3 ' R e v e r s e 5 ' - 3 ' G 3 P D H 5 ' - T G T T C C A G T A T A G A T T C C A C C - 3 ' 850 5 - T C C A C C A C C C T G T T G C T G T A - 3 ' S t A R 5 ' - C A T G G T G C T C C G C C C C T T G G C T - 3 ' 590 5 ' - C A T T G C C C A C A G A C C T C T T G A - 3 ' P450scc 5 ' - A A C G T C C C T C C A G A A C T G T A C C - 3 ' 362 5 ' - C T T G C T T A T T G C T C C C T C T G C C - 3 ' 3P -HSD 5 ' - T G T T G G T G G A G G A G A A G G - 3 ' 360 5 ' - G G C C G T C T T G G A T G A T C T - 3 ' B a x 5 ' - C C T T T T G C T T C A G G G T T T C A T C C A G - 3 ' 362 5 ' - C G A A G G A A G T C C A A T G T C C A G C - 3 ' B c l 2 5 ' - T T C G C C G A G A T G T C C A G T C A G C - 3 ' 154 5 ' - T T G A C G C T C T C C A C A C A C A T G A C - 3 ' 147 REFERENCES Andreu C, Parborell F, VanzuIIi S, Chemes H, Tesone M . 1998. Regu la t ion o f fo l l i cu la r lu te in iza t ion b y a gonadotropin-releasing hormone agonist: relat ionship between steroidogenesis and apoptosis. M o l R e p r o d D e v . 51 : 287-94. Andreu-Vieyra CV, Habibi HR. 2000. Factors con t ro l l ing ovar ian apoptosis. C a n J Phys io . Pharma. 78: 1003-1012. Antonsson B, Conti F, Ciavatta A. 1997. Inhib i t ion o f B a x channel - forming ac t iv i ty b y B c l - 2 . Sc ience 277: 370-372. Antonsson B, Martinou JC. 2000. The B c l - 2 protein fami ly . Exper imen ta l C e l l Research 256: 50-57. Aspden WJ, Rodgers RJ, Stocco DM, Scott PT, Wreford NG, Trigg TE, Walsh J, D'Occhio MJ. 1998. Changes i n testicular steroidogenic acute regulatory ( S t A R ) protein, s teroidogenic enzymes and testicular morpho logy associated w i t h increased testosterone secretion i n bu l l s r ece iv ing the lu te in iz ing hormone releasing hormone agonist des lore l in . D o m e s t A n i m E n d o c r i n o l . 15: 227-38. Billig H, Furuta I, Hsueh AJW. 1994. Gonadotropin-releasing hormone d i rec t ly induces apoptotic c e l l death i n the rat ovary: B i o c h e m i c a l and in situ detection o f deoxyr ibonuc le ic ac id fragmentation i n granulosa cel ls . E n d o c r i n o l o g y 134: 245-252. Casper RF, Erickson GF, Yen SS. 1984. Studies o f the effect o f G n R H and its agonist o n human luteal steroidogenesis in vitro. Fe r t i l Ster i l . 42: 39-43. Chomczynski P, Sacchi N. 1987. Single-step method o f R N A iso la t ion b y ac id guan id in ium thiocyanate-phenol-chloroform extraction. A n a l . B i o c h e m . 162:156-159. Chun SY, Eisenhaur K M , Minami S, Hsueh AJW. 1995. I n t e r l euk in - ip suppresses apoptosis i n rat ovar ian fo l l ic les b y increasing ni t r ic ox ide product ion . E n d o c r i n o l o g y 136: 3120-3127. Chun SY, Hsueh A J W . 1998. Paracrine mechanisms o f ovar ian fo l l i c l e apoptosis. J Repro I m m u n o l . 39 : 63-75. Chun SY, Billig H , Furuta I, Tsafriri A, Hsueh AJW. 1994. Gonado t rop in suppression o f apoptosis i n cul tured preovulatory fo l l ic les : mediatory role o f endogenous in su l in - l i ke g rowth factor-1. E n d o c r i n o l o g y 135: 1845-1853. Conn PM, Crowley WF. Jr. 1994. Gonadotropin-releasing hormone and its analogs. A n n u R e v M e d . 45 : 391-405. D'Occhio MJ, Aspden WJ. 1999. Endocr ine and reproductive responses o f male and female cattle to agonists o f gonadotropin-releasing hormone. J R e p r o d Fert. (supple 54): 101-114. 148 D'Occhio M J , Fordyce G , Whyte TR, Aspden W J , Trigg T E . 2000. Reproduc t ive responses o f cattle to G n R H agonists. A n i m R e p r o d S c i . 6 0 - 6 1 : 4 3 3 - 4 4 2 . Emons G , Schally A V . 1994. The use o f lu te in iz ing hormone releasing hormone agonists and antagonists i n gynaecologica l cancers. H u m Reprod . 9:1364-79. Gajewski T F , Thompson C B . 1996. Apop tos i s meets s ignal transduction: e l imina t ion o f a B A D influence. C e l l 87: 589-592. Goto T, Endo T, Henmi H , Kitajima Y , Kiaya T, Nishikawa A , Manase K , Sato H , Kudo R. 1999. Gonadotropin-re leas ing hormone agonist has the ab i l i ty to induce increase mat r ix metalloproteinase ( M M P ) - 2 membrane type 1 - M M P expression i n corpora lutea, structural luteolysis i n rats. J E n d o c r i n o l . 161. 393-402. Grospe W C , Conn P M . 1988. Restorat ion o f the L H secretary response i n desensit ized gonadotropes . M o l C e l l E n d o c r i n o l 59:101-110. Guerrero H E , Stein P, Asch R H , de Fried E P , Tesone M . 1993. Effect o f a gonadotropin-releasing hormone agonist o n lu te in iz ing hormone receptors and steroidogenesis i n ovar ian cel ls . F e r t i l S ter i l . 59, 803-808. Hengartner M O . 2000 . The b iochemis t ry o f apoptosis. Nature 407: 770-776. Hsu SY, Hsueh A J W . 1998. Intracellular mechanisms o f ovar ian c e l l apoptosis. M o l e c u l a r and C e l l u l a r E n d o c r i n o l o g y 145:21-25. Hsu SY, Hsueh A J W . 2000. Tissue-specif ic B c l - 2 protein partners i n apoptosis: an ovar ian parad igm. P h y s i o l o g i c a l R e v i e w s 80: 593-614. Hsueh A J , Jones, PB. 1981. E x t r a pi tui tary actions o f gonadotropin-releasing hormone. E n d o c r R e v . 2: 437-461. Hsueh A J , Jones PB. 1982. Regula t ion o f ovar ian granulosa and luteal c e l l functions b y gonadotropin releasing hormone and its antagonist. A d v E x p M e d B i o l . 147:223-62. Imai A , Ohno T. 1994. Express ion o f G n R H receptor i n human epi thel ia l ovar ian carc inoma. A n n J C l i n B i o c h e m . 31 : 550-555. Ireland J J , Murphee R L , Coulson PB. 1980. A c c u r a c y o f predic t ing stages o f bov ine estrous cyc le b y gross appearance o f the corpus luteum. J D a i r y S c i . 63:155-160. Irusta G , Parborell F, Peluffo M , Manna PR, Gonzalez-Calvar SI, Calandra R, Stocco D M , Tesone M . 2003 . Steroidogenic acute regulatory prote in i n ovar ian fo l l i c les o f gonadotropin-st imulated rats is regulated b y a gonadotropin-releasing hormone agonist. B i o l R e p r o d . 68: 1577-83. Janssens R M J , Brus L , Cahill D J , Huirne JA , Schoemaker J , Lambalk C B . 2000. D i rec t ovar ian effects and safety aspects o f G n R H agonists and antagonists. H u m R e p r o d Update . 6: 505-518. 149 Jones PB, Conn PM, Marian J , Hsueh AJ. 1980. B i n d i n g o f gonadotropin releasing hormone agonist to rat ovar ian granulosa cel ls . L i f e S c i . 27:2125-32. Juengal JL, Garverick HA, Johnson AL, Youngquist RS, Smith MF. 1993. A p o p t o s i s dur ing luteal regression i n cattle. E n d o c r i n o l o g y 132: 249-254. Knecht M , Ranta I, Feng P, Shonohara O, Catt KJ. 1985. Gonadotropin-re leas ing hormone as a modula tor o f ovar ian function. J Steroid B i o c h e m . 23:771-778. Kogo H, Kudo A, Park MK, Kawashima S. 1995. In situ detection o f G n R H receptor m R N A expression i n rat ovar ian fo l l ic les . J Exp Z o o l o g . 272: 62-68. Leung PC, Cheng CK, Zhu X M . 2003. Mul t i - f ac to r i a l role o f G n R H - I and G n R H - I I i n the h u m a n ovary . M o l C e l l E n d o c r i n o l . 202: 145-153. Mamluk R, Chen D, Greber Y, Davis JS, Meidan R. 1998. Character iza t ion o f messenger r ibonuc le ic ac id expression for prostaglandin F 2 alpha and lu te in iz ing hormone receptors i n var ious bov ine luteal c e l l types. B i o l Reprod . 58: 849-56. Mamluk R, Greber Y, Meidan R. 1999. H o r m o n a l regulat ion o f messenger r ibonuc le ic ac id expression for steroidogenic factor-1, steroidogenic acute regulatory prote in , and cytochrome P 4 5 0 s ide-chain cleavage i n bov ine luteal cel ls . B i o l Rep rod . 60: 628-34. Martimbeau S, Tilly J L . 1997. P h y s i o l o g i c a l c e l l death i n endocrine dependent tissues: an ovar ian perspective. C l i n E n d o c r i n o l . 46: 241-254. Milvae RA, Murphy BD, Hansel W. 1984. P ro longa t ion o f the bov ine estrous c y c l e w i t h a gonadotropin-releasing hormone analogue. B i o l Reprod . 31:664-670. Milvae RA, Hinekley ST, Carlson JC. 1996. Luteotropic and luteolyt ic mechanisms i n bov ine corpus luteum. Ther iogeno logy 45:1327-1349. Nagata S. 1997. Apop tos i s b y death factor. C e l l 88: 355-365. Olofsson Jl , Conti CC, Leung PCK. 1995. H o m o l o g o u s and heterologous regula t ion o f gonadotropin-releasing hormone receptor gene expression i n preovula tory rat granulosa cel ls . E n d o c r i n o l o g y 136: 974-980. Piquette GN, L a P o l t PS, Oikawa M , Hsueh AJW. 1991. Regu la t ion o f lu te in iz ing hormone receptor messenger r ibonucle ic ac id levels b y gonadotropins, g rowth factors, gonadotropin-releasing hormone i n cul tured rat granulosa cel ls . E n d o c r i n o l o g y 128: 2449-2456. Quirk SM, C o w a n RG, Joshi SG, Henrikson KP. 1995. Fas antigen-mediated apoptosis i n h u m a n granulosa luteal cel ls . B i o Reprod . 52: 279-287. Rajamahendran R, Ambrose DJ, Small JA, Dinn N. 2001. Synchron iza t ion o f estrus and ovu la t ion i n cattle. A r c h A n i m a l Breed ing . 44: special issue 58-67. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ, Thatcher WW. 1998. Effects o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants o n p l a sma 150 progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . Ther iogeno logy 50:1141-1155. Richards JS. 1994. H o r m o n a l control o f gene expression i n the ovary. E n d o c r R e v . 15: 725-751 . Rueda B R , Tilly K I , botros IW, Tilly J L . 1997. Increased bax and i n t e r l e u k i n - l p -conver t ing enzyme m R N A levels co inc ide w i t h apoptosis i n the bov ine corpus lu teum dur ing structural regression. B i o l Reprod . 56:186-193. Rueda B R , Wegner J A , Marion SL , wahlen DD. 1995. Internucleosomal D N A fragmentation i n ov ine luteal tissue associated w i t h luteolysis: in vivo and in vitro analyses. B i o l R e p r o d . 52: 305-12. Saragueta P E , Lanuza G M , and Raranao J L . 1997. Inhibi tory effect o f gonadotrophin-releasing hormone ( G n R H ) o n rat granulosa cel ls deoxyr ibonuc le ic ac id synthesis. M o l R e p r d D e v . 47:170-174. Sharpe 1982. C e l l u l a r aspects o f the inh ib i to ry actions o f L H - R H o n the ovary and testis. J R e p r o d F e r t i l . 64: 517-527. Sridaran R, Hisheh S, Dharmarajan A M . 1998. Induct ion o f apoptosis b y a gonadotropin-releasing hormone agonist dur ing ear ly pregnancy i n the rat. Apop tos i s 3:51-57. Sridaran R, L e e M A , Haynes L , Srivastava R K , Ghose M , Sridaran G , Smith C J , 1999a. G n R H act ion o n luteal steroidogenesis dur ing pregnancy. Steroids. 64: 618-623. Sridaran R, Philip G H , L i H , Culty M , L i u Z , Stocco D M , Papadopoulos V . 1999b. G n R H agonist treatment decreases progesterone synthesis, luteal per ipheral benzodiazepine receptor m R N A , l igand b ind ing , steroidogenic acute regulatory prote in express ion dur ing pregnancy. J M o l E n d o c r i n o l . 22 : 45-54. Steele G L , Leung P C K . 1993. S igna l transduction mechanisms i n ovar ian cel ls . Pages 113-127 in E . Y . A d a s h i and P . C . K . Leung , Eds . The Ovary . R a v e n Press, N e w Y o r k . Steller H . 1995. M e c h a n i s m s and genes o f ce l lu lar suicide. Science 267: 1456-62. Stojilkovic S S , Catt K J . 1995. Expres s ion and s ignal transduction pathways o f gonadotropin-releasing hormone receptors. R e c P r o g H o r m Res . 50:161-205. Thatcher W W , Drost M , Savio JD, Macmillan K L , Entwistle K W , Schmitt R L , de L a Sota R L , Morris GR. 1993. N e w c l i n i c a l uses o f G n R H and its analogues i n cattle. A n i m R e p r o d S c i . 33:27-49. Tilly J L , Lapolt P S , Hsueh A J W . 1992. H o r m o n a l regulat ion o f fo l l i c l e - s t i mu la t i ng hormone receptor messenger r ibonucle ic ac id levels i n cul tured rat granulosa cel ls . E n d o c r i n o l o g y 130: 1296-1302. Yang M Y , Rajamahendran R. 2000. M o r p h o l o g i c a l and b i o c h e m i c a l ident i f ica t ion o f apoptosis i n smal l , m e d i u m , and large bovine fo l l ic les and the effects o f fo l l i c le -s t imula t ing 151 hormone and in su l in - l i ke growth factor-I on spontaneous apoptosis i n cul tured bov ine granulosa cel ls . B i o l Rep rod . 62:1209-1217. Y u a n g J. 1997. Transduc ing signals o f l i fe and death. Current O p i n i o n s i n C e l l B i o l o g y 9:247-251. Z h a o S, Sa i t o H , W a n g X , Sa i to T , K a n e k o T , H i r o i M . 2000. Effects o f gonadotropin-releasing hormone agonist o n the incidence o f apoptosis i n porcine human granulosa cel ls . G y n e c o l Obstet Invest. 49 : 52-56. 152 C H A P T E R 5 I N F L U E N C E O F P O S T - B R E E D I N G G n R H A D M I N I S T R A T I O N O N C O R P U S L U T E U M F U N C T I O N A N D P R E G N A N C Y IN D A I R Y C A T T L E 5.5. A B S T R A C T T h e objectives o f the present study were to examine the influence o f post-breeding G n R H adminis t ra t ion o n in vivo C L function i n terms o f progesterone (P4) secretion, and pregnancy outcome, i n dai ry cattle. One hundred and four H o l s t e i n cattle (cows = 74; heifers = 30) were inc luded i n this study. Lac ta t ing cows (completed at least 90 days postpartum period) , and heifers, that were observed i n standing natural estrus were inseminated and subjected to one o f the three treatments randomly. Treatments were compr i sed o f control (untreated, cows n=25; heifers n= 10), G n R H 100 p g (cows n=25; heifers n= 10), or h C G 2500 JJJ (cows n=24; heifers n= 10). A l l treatments were administered(intramuscular) o n day 7 post-breeding. Start ing f rom the day o f breeding ( D a y 0), m i l k (cows) and b l o o d (heifers) samples were col lec ted at w e e k l y intervals un t i l the 5th week post-breeding for P 4 measurements. Pregnancy diagnosis was determined b y ultrasound scanning o n D a y 35 after breeding. P 4 concentrat ion from m i l k and p lasma samples was determined b y f o l l o w i n g a R I A procedure. B a s e d o n P 4 concentrations and pregnancy outcome, no significant differences were observed between sham treated control and G n R H , or G n R H and h C G , treatment groups. H o w e v e r , h C G treatment group had s igni f icant ly (P < 0.05) h igher levels o f P 4 (f rom D a y 14 un t i l 35 post-breeding), but pregnancy rates were not different from 153 cont ro l or G n R H groups. In summary, post-breeding G n R H administrat ion, d i d not result i n i m p r o v e d pregnancy rates i n dai ry cattle. 5.2. I N T R O D U C T I O N Gonado t rop in releasing hormone ( G n R H ) is a v i t a l requirement for the maintenance o f reproductive homeostasis. The versatile functional properties o f G n R H have been extens ive ly studied, and are a continued topic o f interest i n reproduct ive p h y s i o l o g y and medic ine . F o r instance, the acute effects o f G n R H causing endogenous release o f fo l l i c l e s t imula t ing hormone ( F S H ) , and lu te in iz ing hormone ( L H ) is an invaluable feature that aids i n manipu la t ing ovar ian act ivi ty i n a predictable manner ( C o n n and C r o w l e y , 1994; S t o j i l k o v i c and Catt , 1995). G n R H - i n d u c e d gonadotropin release exert numerous p h y s i o l o g i c a l effects such as wave emergence and development o f n e w fo l l i c les , ovu la t ion or lu te in iza t ion o f ovar ian fo l l ic les , and an altered corpus lu teum ( C L ) function. N u m e r o u s studies have examined whether G n R H treatments g iven at the t ime o f ar t i f ic ia l inseminat ion ( A I ) are able to improve pregnancy rates i n cattle (Rev i ewed b y Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n , 1999; Rajamahendran et a l . , 2002). In most experiments, G n R H treatments were administered around the t ime o f A I (Schmit t et a l . , 1996a) or dur ing the m i d -luteal phase ( reviewed b y Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n et a l . , 1999; Rajamahendran et a l . , 2002) i n attempts to establish enhanced C L function. The major i ty o f exper imental results show a numer i ca l ly increased P 4 concentration, and i n some instances, increased pregnancy rate after G n R H treatment. H o w e v e r , the difference is often stat ist ically non-signif icant i n compar i son w i t h untreated control animals. A d m i n i s t r a t i o n o f G n R H agonist analogues ( G n R H - a ) dur ing mid - fo l l i cu l a r phase ( M u r d o c h and V a n K i r k , 1998, 154 M o m c i l o v i c et a l . , 1998), or early estrus ( M a c m i l l a n and Thatcher et a l . , 1991) per iod , has been reported to result i n an enhanced C L function f o l l o w i n g ovu la t ion i n some studies. O n the other hand, no change has been not iced i n other studies and studies have reported that G n R H , or G n R H - a , administered i n the early fo l l icu la r phase has resulted i n an inadequate or defective C L f o l l o w i n g ovu la t ion ( L u c y and Stevenson, 1992; M u r d o c h and V a n K i r k , 1998; Taponen et a l . , 1999, 2000). Theore t ica l ly , it is be l ieved that consequent to G n R H - a administrat ion, L H concentration reaches beyond its threshold leve l caus ing a d o w n -regula t ion o f LH-recep tors i n preovulatory fo l l i c l e cel ls ; and thus, ensuing luteal defect. S i m i l a r postulations suggest the lack o f F S H p r i m i n g granulosa cel ls w o u l d fa i l to acquire a romat iz ing capabil i t ies; thereby, the decreased estradiol- 17p (E2) levels c o u l d lead to decreased granulosa c e l l prol iferat ion, and consequently the luteal insuff ic iency. In contrary to these experiments, i n rodent species, experiments have p roved that ovar ian super-s t imula t ion dur ing fo l l i cu la r phase has resulted i n suppression o f E 2 augmented pi tui tary L H response, prevent ing ovula t ion . Further, it has been shown that the L H surge inhibi ts E 2 secretion b y the preovulatory fo l l i c l e (D ie l eman and Blankens te in 1984). A significant propor t ion o f pregnancy failures (30 - 40%) and infer t i l i ty problems i n cattle have been attributed to inadequate functioning o f the C L ( R e v i e w e d b y Rajamahendran et a l . , 2002) . M o s t o f the concept ion failures, or early pregnancy losses, are associated w i t h the defective C L , due to lack o f adequate luteotropic support f o l l o w i n g ovula t ion . Several correct ive measures have been developed to combat inadequate C L funct ion i n cattle. E i the r direct L H administrat ion, or administrat ion o f human chor ionic gonadotropin ( h C G ) that exerts an L H - l i k e luteotropic effect leading to enhanced C L funct ion ( R e v i e w e d b y 155 N i s w e n d e r et a l . , 2000) . H o w e v e r , repeated use o f h C G i n cattle can induce ant ibody format ion; thus, it cannot be used as the best alternative treatment reg imen o n a routine basis, i n contrast to G n R H - b a s e d protocols (Rev i ewed b y Rajamahendran et a l . , 2002) . In addi t ion, efforts have been made to compensate for luteal insuff ic iency through exogenous P 4 adminis t ra t ion, but it has often y ie lded poor results (Rhodes et a l . , 1999). In spite o f cont inued efforts f rom several researchers, li t t le improvement has been achieved towards the successful treatment o f luteal insuff ic iency i n bovine species. Therefore, based o n the support ive evidence f rom present G n R H protocols , administrat ion o f G n R H at var ious t ime points before and after ovula t ion and induct ion o f an accessory C L leading to increased p l a sma P 4 concentrations is s t i l l be ing considered as a p r o m i s i n g method to achieve enhanced pregnancy outcome i n cattle. In this direct ion, i nc lud ing the present laboratory, there have been numerous studies that have reported a va ry ing degree o f success i n pregnancy rates ( P R ) f o l l o w i n g different t ime-point G n R H adminis t ra t ion dur ing the estrous cyc le i n cattle. Therefore, it is a clear ind ica t ion that more studies are needed to ga in further knowledge wr th respect to the G n R H response o n in vivo C L function, and, i n , turn, the eventual P R i n cattle. Further, most o f the studies c i ted above were conducted i n combina t ion w i t h estrous synchroniza t ion protocols. O n l y l imi t ed informat ion is avai lable o n post-breeding G n R H administrat ion i n animals that were bred at the t ime o f natural estrus w i t h spontaneous ovulat ions. Therefore, the present study was undertaken to assess C L function, and pregnancy outcome f o l l o w i n g post-breeding G n R H administrat ion i n dai ry cattle that were inseminated at natural estrus. In order to establish the effects o f post-breeding G n R H treatment o n in vivo C L function, h C G treatment was inc luded as pos i t ive a cont ro l group dur ing the present experiment. Bes ides the numerous reports from the literature, previous 156 studies f rom this laboratory have suggested that h C G treatment at 7 days after inseminat ion c o u l d be used to induce an accessory C L , raise p lasma P 4 and reduce the inc idence o f early embryon ic mor ta l i ty i n cattle ( reviewed b y Rajamahendran et a l . , 2002) . 5.3. MATERIALS AND METHODS 5.3.1. Animals and treatments T h i s study was conducted at the U n i v e r s i t y o f B r i t i s h C o l u m b i a D a i r y E d u c a t i o n and Research Center, A g a s s i z , B r i t i s h C o l u m b i a , Canada, dur ing the months o f January to M a y 2003. H a n d l i n g and management o f animals were i n accordance w i t h the guidel ines o f the Canad ian C o u n c i l o n A n i m a l Care (1993). A n i m a l s were housed i n a free-stall system that a l l owed a considerable amount o f interact ion among herd mates. A total o f one hundred and four H o l s t e i n dai ry cattle (lactating cows , n = 74; heifers, n = 30) were inc luded i n this study (Table 5.1). Lac ta t ing c o w s were i n the stage o f first to s ix th lactation, and completed at least a 90-days post-partum per iod . A n i m a l s w i t h a his tory o f injury or reproductive problems, were exc luded f rom the experiment. B o t h cows and heifers were ar t i f ic ia l ly inseminated at the t ime o f natural estrus, and then r andomly al located to one o f the three treatment groups: cont ro l (no treatment; cows , n = 25 ; heifer, n = 10), G n R H 100 u,g (cows, n = 25; heifers, n = 10), and h C G (cows, n = 24; heifers, n = 10). G n R H ( F a c t r e l ® ) and h C G (Chorulon) were purchased from the For t D o d g e Laboratories , For t D o d g e , I A and Intervet, Canada, respect ively. A l l treatments were administered (intra-muscular route, I M ) o n the 7th D a y post-breeding ( F i g . 5.1). 157 5.3.2. Milk and blood sample collection for P4 measurement W h o l e m i l k samples (cows) and b l o o d samples (heifers) were col lec ted o n D a y 0 (day o f breeding), and D a y s 7, 14, 21 , 28, and 35, post-breeding, for P 4 determination. B l o o d samples (10 m L ] were col lected f rom each an imal (heifers) v i a the coccygea l vessels i n hepar in ized vacutainer tubes (Bec ton D i c k i n s o n , Ru th f i e ld N e w Jersey, U S A ) . Samples were centrifuged (1000 x G , 30 min ) w i t h i n 1 h o f co l lec t ion , and the p lasma separated. B o t h m i l k and p l a sma samples were stored at - 2 0 ° C un t i l assayed for P 4 . 5 .3.3. Radioimmunoassy for P4 measurement Concentra t ion o f P 4 i n m i l k and p lasma samples was measured us ing a c o m m e r c i a l l y avai lable , s o l i d phase, radioimmunoassay ( R I A ) ki ts ( C o a t - A - C o u n t , Diagnos t i c Products C o r p . , L o s Ange l e s , C A ) . These ki ts were p rev ious ly val idated for the measurement P 4 concentrat ion i n m i l k and p lasma samples (Tay lo r and Rajamahendran, 1991; S ianangama and Rajamahendran, 1992) i n this laboratory. B r i e f l y , at the t ime o f assay preparation, an al iquot o f 100 p i o f the P 4 standards was transferred into duplicate set o f tubes (antibody-coated) that were labeled as A A , B B , C C , D D , E D , F F , and G G , corresponding to the P 4 concentrations o f 0.0, 0.1, 0.5, 2.0", 10.0, 20.0, and 40.0 n g / m L . S i m i l a r l y , the required number o f addi t ional tubes (antibody-coated) was suppl ied w i t h an al iquot o f 100 u l o f exper imental samples ( m i l k and plasma), and each tube was assigned an unique ident i f icat ion number to match their respective samples ( m i l k or plasma). Then , a l l tubes were arranged i n serial order (Tube A to Tube N i n numbers), and each tube was suppl ied w i t h P4-buffered I 1 2 5 - l a b e l e d P 4 (1.0 ml ) . The tube contents were m i x e d b y gentle agitation, and incubated at r o o m temperature for 3 h to achieve the equ i l ib r ium o f antibody-antigen reaction. A t the end 158 o f the 3 h incubat ion, the l i q u i d por t ion o f the assay mixture was decanted f rom the tubes and any remain ing l i q u i d residue was removed b y ho ld ing the tubes i n an inverted pos i t ion o n a b lo t t ing surface (paper) for an addi t ional 10 m i n . The s o l i d por t ion o f assay mix ture ( in tubes) that contained radioact iv i ty was counted for 1 m i n us ing a g a m m a counter (Packard A u t o g a m m a 500, Packa rd Instruments, D o w n e r s G r o v e , I L , U S A ) . T h e assay sensi t ivi ty, that is the intra- and inter- assay coefficienst o f variations for P 4 , were 8.6% and 10.8%, respect ively. 5.3.4. Reproductive status of the animals based on P4 concentration N u m b e r o f animals inc luded i n P 4 analysis, number o f animals that were i n estrus based P 4 <1 n g / m L o n the day o f A l and ovula t ion rates based o n P 4 >1 n g / m L o n D a y 7 post-breeding, i n each treatment group are presented i n Table 5.2. Ind iv idua l animals were considered as pregnant p rov id ing P 4 levels were <1 n g / m L o n D a y 0 and mainta ined >1 n g / m L o n D a y 7 through 21 pos t -AI . The presumptive P R was calculated based o n the percentage o f animals that became pregnant i n relat ion to the total number that were i n estrus o n D a y 0 (day o f breeding), and had a successful ovula t ion (based o n P 4 levels < 1 n g / m L o n D a y 0, and >1 n g / m L o n D a y 7 post-breeding). 5.3.5. Pregnancy diagnosis O n D a y 35 after breeding, pregnancy diagnosis was carr ied out us ing a per-rectal ul t rasound-scanning device , as described b y Rajamahendran and T a y l o r (1990). A real- t ime ul t rasound-scanning device ( A l o k a 500 V , A l o k a C o . L t d . , T o k y o , Japan), equipped w i t h a 7.5 M H z trans-rectal transducer was used. D u r i n g scanning, the uterine horns and b o d y o f the 159 uterus were scanned i n several planes i n order to examine uterine contents, and to ident ify embryon ic vesicles and the embryo proper, i f pregnant. The overa l l P R i n each treatment group was calculated based on the total number o f animals that were al located per treatment group (control n = 35; G n R H n = 35; h C G n = 34), o n the day o f breeding ( F i g 5.4). 5.3.6. Data ana lys i s P R was defined as the percentage o f animals that became pregnant i n re la t ion to the total number treated. The post-breeding G n R H effect o n the in vivo C L funct ion was determined based o n the comparat ive P 4 levels f rom that o f the contro l , and h C G treatment groups. T h e G n R H treatment effect o n presumptive P R was assessed based o n P 4 levels at different t ime points dur ing the p o s t - G n R H treatment per iod ( D a y 2 1 , 28 , and 35). F i n a l l y , the G n R H treatment effect o n overa l l P R was calculated based o n ul trasound scanning data from D a y 35, pos t -AI . The percentage o f estimated embryonic mor ta l i ty was calculated based o n animals w i t h P 4 levels < 1 n g / m L o n D a y 0, and > 1 n g / m L at D a y s 7, 14, 21 and any drop i n P 4 levels < l n g / m L o n 28, and 35, pos t -AI . R I A data for P 4 concentrations was ana lyzed us ing one-way analysis o f variance ( A N O V A ) , f o l l owed b y pa i r -wise compar i son us ing a F i she r ' s L S D method. In vivo C L function (presumptive P R based o n P 4 concentrations), and overa l l P R data f rom ultrasound scanning results, were ana lyzed us ing Ch i -Squa re method. The leve l o f s ignif icance was set at a = 0.05. 160 5.4. R E S U L S T S 5.4.1. C L function and presumptive pregnancy rates based on P4 concentration O v u l a t i o n occurred i n 69 out o f the 74 (93.24%) animals that were i n estrus o n the day o f breeding (based o n P 4 < 1 n g / m L ; Table 5.2). The mean ± S E M o f combined (cows and heifers) P 4 profi les dur ing post-breeding per iod ( D a y 7 through 35) indicated no difference (P > 0.05) i n C L function between sham control , and G n R H treatment groups (data not shown) . H o w e v e r , when P 4 data was analyzed for o n l y those animals that were i n estrus (P4 <1 n g / m L ) o n day o f A I and had a successful ovu la t ion (based o n P 4 levels >1 n g / m L o n D a y 7 post-breeding), the tendency for a non-signif icant (P > 0.05) increase i n P 4 levels was evident i n the G n R H treatment group (F ig . 5 . 2 A ) . T h e h C G treatment group mainta ined a s ignif icant ly higher levels P 4 concentrations w h e n analyzed either as combined data both cows and heifers ( F i g . 5 . 2 A ) , or based o n the type or par i ty o f the animals , heifers ( F i g . 5 .2B) and cows (F ig . 5 .2C) . F o r the purpose presumptive P R calculat ion, o n l y those animals that were i n estrus o n the day o f breeding (P4 <1 n g / m L ) , and had a successful ovu la t ion (P4 >1 n g / m L o n D a y 7 post-breeding), were inc luded (Table 5.3). Presumpt ive P R was calculated based o n P 4 levels >1 n g / m L o n D a y 21 , 28, and 35 post-breeding. The combined ( F i g . 5 . 3 A ) , percentage o f presumptive P R i n different treatment groups was as fo l lows : D a y 21 (control 6 8 % , G n R H 8 0 % , h C G 91.67%), D a y 28 (control 52%, G n R H 6 5 % , h C G 66.67%), and D a y 35 (control 2 5 % , G n R H 6 0 % , h C G 62.5%). The percentage o f presumptive P R i n heifers and c o w s are presented i n F i g . 5 .3B and F i g . 5 .3C, respectively. W h e n P 4 levels were considered, 161 i rrespective o f treatment groups, the cumulat ive presumptive P R (overal l P R ) were 79 .71%, 60 .87%, and 57 .59% o n D a y 21 , 28, and 35 post-breeding, respect ively ( F i g . 5 . 3 A ) 5.4.2. Overall pregnancy rates on Day 35 post-AI B a s e d o n ul trasound scanning data ( D a y 35 post-breeding), the c o m b i n e d (cows and heifers) P R was calculated based o n the number o f animals pregnant i n re la t ion to the total numbers o f animals that were i n i t i a l l y al located to each treatment group o n the day o f breeding (control , n = 35; G n R H , n = 35; h C G , n = 24). The combined P R s i n the different treatment groups were 42 .86%, 42 .86% and 4 0 . 0 0 % for contro l , G n R H , and h C G groups, respect ively ( F i g . 5.4) In terms o f pregnancy outcome, no difference was observed among cont ro l , G n R H , and h C G (P > 0.05) treatment groups. W h e n P R was ana lyzed based o n par i ty or type o f the animals (cows and heifers), P R i n heifer groups was s igni f icant ly higher (P < 0.05) f rom that o f P R i n cows (F ig . 5.4). 5.4.3. Embryonic death or pregnancy loss The percentage o f estimated embryonic mortal i ty , o n D a y 28 and 35 after breeding, was calculated based on the animals w i t h P 4 levels < 1 n g / m l o n D a y 0, and > 1 n g / m l at D a y s 7, 14, 2 1 , and any drop i n P 4 levels to <1 n g / m L o n 28 or 35 p o s t - A I . In other words animals that were i n estrus o n D a y 0, had successful ovula t ion , mainta ined P 4 levels > 1 n g / m L un t i l at least D a y 21 post-breeding (presumptively pregnant), and had P 4 levels droped to <1 n g / m L o n D a y 28 or 35 post-breeding was considered as pregnancy loss. T h e b reakdown o f presumptive P R and pregnancy losses, based o n an ima l type (cows and heifers) are presented i n Table 5.3. The estimated pregnancy loss or ear ly embryon ic 162 morta l i ty that occurred between D a y 21 and 35 post-breeding i n different treatment groups were 16%, 2 0 % , and 29 .17% for control , G n R H and h C G , respectively. A m o n g the three, the h C G treatment group had more number o f animals that lost pregnancy between D a y 21 and 35 post-breeding. W h e n overa l l data was considered (irrespective o f the treatment groups), the presumptive pregnancy loss that occurred between D a y s 21 and 35 post-breeding was 21 .74%. 5.5. D I S C U S S I O N T h e present f indings are i n agreement w i t h several related studies reported i n the literature. G n R H , administered at var ious t ime-points dur ing the post-breeding pe r iod i n cattle, had a m i x e d response i n terms o f P 4 output, and P R . F o r example , no effect o n P 4 concentrations was observed w h e n c y c l i n g cows were injected w i t h G n R H - a o n D a y 7 after estrus (Twag i r amungu et. a l . , 1995). S i m i l a r l y , G n R H (100 p,g, natural G n R H ) o n D a y 2 or 8 o f the estrous cyc le d i d not affect any increase i n p lasma P 4 levels ( M a r t i n et a l . , 1990). G n R H , or G n R H - a , administered i n the early fo l l icu la r phase, has resulted i n an inadequate or defective C L f o l l o w i n g ovula t ion ( L u c y and Stevenson, 1992; Taponen et a l . , 1999, 2000). Treatment w i t h G n R H o n D a y 2 or 10 caused a reduct ion i n serum P 4 levels o n D a y s 12, 14 and 16 o f the cyc le i n cattle (Rodger and Stormshak, 1986). Whereas mid - fo l l i cu l a r ( M u r d o c h and V a n K i r k , 1998: M o m c i l o v i c et a l . , 1998; Taponen et a l . , 2003) , or early estrus (Twag i r amungu et a l . , 1994) G n R H - a administrat ion has been s h o w n to result i n an enhanced C L function f o l l o w i n g ovula t ion . It was evident that busere l in administered (heifers) ear ly i n the estrous cyc le , caused an increase i n the relat ive numbers o f large luteal cel ls i n the C L (Twag i ramungu et a l . , 1995; Schmit t et a l . , 1996b). G n R H - a adminis t ra t ion at 163 about D a y 4 to D a y 6, f o l l o w i n g breeding, cou ld ovulate first wave fo l l i c l e and develop an accessory corpus lu teum as a contr ibutory factor towards increased serum P 4 levels ( D ' O c c h i o et a l . , 1999; A m b r o s e et a l . , 1999, 2000; Rajamahendran et a l . , 2001) . Pregnancy rates f o l l o w i n g post-breeding G n R H adminis t ra t ion have been reported w i t h var iable results. The present study does not indicate any increase o f P R due to G n R H adminis t ra t ion o n D a y 7 after breeding. Whereas from other studies ( M a c m i l l a n et a l . , 1986), it is evident that there was an increase i n P R f o l l o w i n g m i d - c y c l e G n R H adminis t ra t ion i n heifers. U l t r a sound examinations, dur ing the luteal phase o f the estrous cyc le ( H a r v e y et a l . , 1994), revealed that treatment w i t h G n R H induced an accessory C L i n approximate ly h a l f o f the treated animals that subsequently had increased concept ion rates. H o w e v e r , the same authors also suggested that a sudden increase i n the serum concentrations o f L H f o l l o w e d b y a concomitant increase i n P 4 concentration, after m id -cyc l e G n R H administrat ion. Further, this effect caused an extended estrous cyc le length among cows returning to estrus and that d i d not become pregnant. In the present study, G n R H treatment d i d result i n significant differences i n P 4 concentrations, or P R rates, compared to that o f the cont ro l or h C G treatment groups. A l t h o u g h the hCG- t rea ted animals maintained s igni f icant ly h igher P 4 levels (P < 0.05) i n this study, there was no significant difference observed i n terms o f P R f rom that o f either the contro l , or G n R H group. It is suggested that the higher P 4 levels i n the h C G -treatment animals c o u l d have been attributed to the accessory C L format ion as w e l l as the direct effect o f h C G o n spontaneous C L . S i m i l a r observations have been reported f rom 164 previous studies where h C G was administered dur ing mid- lu tea l stage i n ant ic ipat ion o f i m p r o v e d pregnancy rate, but it was often associated w i t h inconsistent increase i n peripheral concentrations o f P 4 (Rajamahendran and Sianangama, 1992; Rajamahendran and Sianagama, 1992; Schmit t et a l . , 1996b). Some authors ( E d m o n s o n et a l . , 1989) attributed these var iable results to the condi t ion (parity) o f animals u t i l i zed for such experiments. It is reported that first par i ty cows usua l ly have higher concept ion rates than older cows ( L e a n et a l . , 1989; F o l m a n et a l . , 1990; E i c k e r et a l . , 1996). The present findings are i n agreement w i t h the above stated observations. The overa l l P R i n the heifer group was s igni f icant ly higher than the cows (P < 0.05). Th i s m a y be attributable to the adverse effects o f h i g h m i l k y ie lds ; and thus stress o n early pregnancy as observed i n mult iparous animals (Lean et a l . , 1989). H o w e v e r , contrary to this, L u c y et a l . (1992) suggested that mul t iparous cows m a y have advanced ovula t ion and enhanced P R , due to one or more reasons under the free stall heard management system. O lde r cows (multiparous) consume more dry matter dur ing postpartum per iod than younger cows (heifers and pr imiparous) ( L u c y et a l . , 1992; Grant and A l b r i g h t , 1995), w h i c h m a y be attributable to larger sizes and soc ia l dominance , w h i c h mul t iparous cows usua l ly possess over pr imiparous cows w h e n housed i n a free-stall type o f fac i l i ty (Grant and A l b r i g h t , 1995). In this study, the estimated pregnancy loss or early embryonic mor ta l i ty that occurred between D a y s 21 and 35 post-breeding, i n different treatment groups was , 16%, 2 0 % , and 2 9 . 1 7 % for contro l , G n R H and h C G groups, respectively. A m o n g the three treatment groups, the h C G group had higher number o f animals that apparently lost their pregnancy between D a y s 21 and 35 post-breeding. The reason for this higher pregnancy loss i n the h C G group is 165 not clear. H o w e v e r , this m a y be also attributable to an extended estrous cyc le length due to h C G treatment (Sianangama and Rajamahendran, 1992). T h i s might have contr ibuted to more animals returning to estrus between D a y s 28 and 35, w h e n compared to cont ro l or G n R H - t r e a t e d groups. H o w e v e r , the percentage range o f pregnancy loss observed i n this study is i n agreement w i t h the findings o f Vasconce los (1999), w h o reported a 2 4 % embryon ic loss between 25 D a y s p o s t - A I and c a l v i n g t ime i n G n R H - b a s e d synchroniza t ion protocols (Ovsynch) . S i m i l a r l y , M o r e i r a et a l . (2000) have reported an estimated 3 5 % loss o f embryos between D a y 20 and 27, and an 8% loss between D a y 27 and 45 , pos t -AI . L o s s o f C L funct ion around the t ime o f implanta t ion ( D a y 14 to 16) c o u l d prevent implanta t ion and c o u l d lead to a loss o f pregnancy. Further, it has been reported that 4 0 % o f the total embryon ic mor ta l i ty occurred between D a y s 8 and 17 o f pregnancy, w h i c h m a y be attributed to the inab i l i t y o f certain conceptuses to secrete interferon-tau ( IFN- t ) , w h i c h inhibi ts the uterine P G F 2 a secretion dur ing early pregnancy (Thatcher et a l . , 2001) . Inc lud ing this study, the reported va r i ab i l i ty i n pregnancy rates i n response to G n R H adminis t ra t ion at different t ime-points after breeding i n dai ry animals , m a y be, i n part, due to the type o f the herd, geographical loca t ion ( inc lud ing weather patterns), and overa l l management practice. H o w e v e r , it is an un ivoca l assumption that administrat ion o f G n R H and its agonist ic analogues at the t ime o f A I or dur ing post-breeding per iod w o u l d increase pregnancy rates i n cattle (Thatcher et a l . , 1993; U l l a h et a l . , 1996; Rajamahendran et a l . , 1998; D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2000; C a m et a l . , 2002). Therefore, i n order to fu l ly u t i l i ze the benefits o f G n R H i n bovine reproductive practice, further studies are needed to unravel any inherent, as w e l l as external, factors that m y be contr ibut ing to the present va r i ab i l i t y i n terms o f pregnancy outcome i n cattle. 166 5.6. CONCLUSION In conc lus ion , administrat ion o f G n H or h C G o n D a y 7 post-breeding i n the present s tudy d i d not increase the overa l l pregnancy rates i n dai ry cattle. F o r more than one decade, the present laboratory i n association w i t h other research collaborators has carr ied out extensive w o r k o n post-breeding hormona l treatments to improve embryo su rv iva l w i t h v a r y i n g degrees o f success. H o w e v e r , based o n first hand research experience, the previous f indings f rom present laboratory suggest that it is possible to induce the ovu la t ion o f a first-wave dominant fo l l i c l e us ing G n R H preparations, or h C G at var ious t ime-points post-breeding, thus i m p r o v i n g the poss ib i l i ty o f pregnancy outcome i n da i ry cattle. 167 C o n t r o l B r e e d i n g G n R H Scanning for P D h C G 1 I = 4 = D a y 0 7 14 21 28 35 T 1 1 t T T Time points of milk and blood sample collection for P4 determination. F I G U R E 5.1. Experimental protocol for post-breeding G n R H administration. One hundred and four Holstein dairy cattle (lactating cows, n = 74; heifers, n = 30) were included in this study. Lactating cows were in the stage o f 1- 6th lactation, and completed at least a 90-day post partum period. Both the cows and heifers were bred at the time o f natural estrus (Day 0) and randomly assigned to one o f the three treatment groups, untreated (Control), G n R H (100 jxg, IM, ) , and h C G (2500 I U , I M ) group. A l l treatments were administered on Day 7, post-breeding. M i l k (cows) and blood (heifers) samples were collected on Day 0, and on Day 7, 14, 21, 28 and 35 post-breeding, for P4 determination. Ultrasound scanning for pregnancy diagnosis (PD) was carried out on Day 35 post-breeding. 168 - a CON • GnRH - EDhCG Post-breeding (Days) FIGURE 5.2. Post-breeding mean progesterone (P4) levels in different treatments groups. A. Combined (heifers and cows N=81: CON=29, GnRH=27, hCG=25). B. Heifers (CON=9, GnRH=10, hCG=10). C . Cows (CON=20, GnRH=17, hCG=15). Animals were bred on the day o f natural estrus (Day 0) and randomly assigned to one of the three treatment groups, untreated or control ( C O N ) , G n R H (100 ug, IM,) , and h C G (2500 I U , I M ) group. A l l treatments were administered on Day 7 (Day 7), post-breeding. Whole milk and blood samples were collected on Day 0, and on Day 7, 14, 21, 28, and 35 post-breeding, for P4 determination. * different from other treatments (P < 0.05), within the same time point. 169 .>, 100 1 80 H in 2 60 On, •g 40 c M u OH 20 Day 21 Day 28 Day 35 X B 60 ID 100 80 60 40 20 Day 21 Day 28 Day 35 $ 100 3 80 s 6 0 a 40 i 20 0 OH a Day 21 3 Day 28 Day 35 F I G U R E 5.3. Presumptive pregnancy rates in lactating dairy cows and heifers subjected to different treatments: untreated control (CON), GnRH (100 ng, IM), and hCG (2500 IU, IM) on Day 7 post-AI. Milk (cows) and serum (heifers) P4 profdes measured at different time points during post-AI period, was used as an indicator of presumptive pregnancy rates and expressed in percentage. (A) Combined (heifers and cows), (B) Heifers, and (C) Cows. Animals considered pregnant based on P4 < 1 ng/mL on Day 0, and P4 > 1 ng/mL on Days 7, 14, 21, 28 and 35 post-AI. 170 • C O N H G n R H D h C G 80 Heifers Day 35 Post-breeding Combined F I G U R E 5.4. Overall pregnancy rates in lactating dairy cows and dairy heifers based on the scanning results on Day 35 post-AI. A l l animals were inseminated at the time o f natural estrus and randomly allocated to one o f the three treatments: control ( C O N = 35; G n R H 100 ug, n = 35; h C G 2500 I U , n = 34). Treatments were administered on Day 7 post-AI. On Day 35 post-AI, al l animals were scanned for pregnancy diagnosis. * different (P < 0.05) from P R in cows or combined (cows and heifers). 171 Table 5.1. Post-breeding experimental treatments and number o f animals per treatment group. A l l animals that were i n natural estrus were inseminated ( D a y 0) and r andomly al located into one o f the three treatment groups(control , G n R H or h C G ) . Treatments N o . o f C o w s N o . o f Hei fers C o n t r o l 25 10 G n R H 25 10 h C G 24 10 Table 5.2. N u m b e r o f animals inc luded i n P 4 analysis, number o f animals that were i n estrus based o n P 4 <1 n g / m L o n the D a y o f A l , and ovu la t ion rates based o n P 4 >1 n g / m L o n D a y 7 p o s t - A I , i n each treatment group are l isted. Animal T r e a t m e n t s Animals included Animals Animals Type in P4 analysis in Estrus Ovulated C o n t r o l 20 19 18 (94.74%) £ ° ^ 2 G n R H 1 7 1 4 1 1 ( 7 8 - 5 7 % ) h C G 15 14 14 (100%) C o n t r o l 9 8 7 (87.5%) G n R H 1 0 9 9 (100%) h C G 10 10 10 (100%) 172 Table 5.3. Presumptive pregnancy rates (PR) and embryonic losses in cows and heifers subjected to different treatments: untreated control, G n R H (100 ug, IM) , and h C G (2500 K J , I M ) on Day 7 post-A I . M i l k (cows) and plasma (heifers) P4 profiles measured at different time points during post-AI, was used as an indicator o f percentage presumptive pregnancy rates (based on P 4 < 1 ng/ml on Day 0, and P 4 > 1 ng/ml on Day 7, 14, 21, 28 and 35 post-AI), and percentage estimated embryonic loss (the difference o f % P R on Day 21 and Day 35 post-AI). Pregnancy status Treatments Heifers (%) Cows (%) Est imated P R o n D a y 21 pos t -AI C o n t r o l 71.43 66.67 G n R H 88.89 72.73 h C G 90.00 92.86 Es t imated P R o n D a y 35 p o s t - A I C o n t r o l 28.57 38.89 G n R H 44.44 45.45 h C G 50.00 57.14 Es t imated embryonic loss (%) on D a y 35 p o s t - A I C o n t r o l G n R H h C G 42.86 44.45 40.00 27.78 27.27 35.71 173 REFERENCES Ambrose JD, Kastelic JP, Rajamahendran R, Small J, Urton G. 2000. P regnancy rates i n da i ry cows after G n R H treatment at 7, 14, or 7 and 14 days after t imed inseminat ion . C a n J A n i m S c i . 80:755. Ambrose JD, Kastelic JP, Kappe Y, Small J, Mohammed H, Rajamahendran R. 1999. O v u l a t i o n responses, progesterone concentrations, and pregnancy rates i n da i ry cows after G n R H treatment at 7, 14 or 7 and 14 days after t imed inseminat ion. J A n i m S c i . 77 (Supp l 1): 227. Cam MA, Kuran M, Yildiz S, Selcuk E. 2002. Feta l growth and reproduct ive performance i n ewes administered G n R H agonist on day 12 post-mating. A n i m R e p r o d S c i . 72(1-2): 73-82. Conn PM, Crowley WF.Jr. 1994. Gonadotropin-releasing hormone and its analogs. A n n u R e v M e d . 45:391-405. Dieleman SJ, Blankenstein DM. 1984. Changes i n estrogen synthesiz ing ab i l i ty o f bov ine fo l l i c les relat ive to the peak o f L H . J R e p r o d Fe r t i l . 72:487-494. D'Occhio MJ, Aspden WJ. 1999. Endocr ine and reproductive responses o f male and female cattle to agonists o f gonadotropin-releasing hormone. J R e p r o d Fert. (Supple 54): 101-114. D'Occhio MJ, Fordyce G, Whyte TR, Aspden WJ, Trigg TE. 2000. Reproduc t ive responses o f cattle to G n R H agonists. A n i m R e p r o d S c i . 60-61: 433-442. Edmonson AJ, Lean IJ, Weaver LD, Farver T, Webster G. 1989. A b o d y cond i t ion scor ing chart o f H o l s t e i n dai ry cows . J D a i r y S c i . 72:68-78. Eicker SW, Grohn YT, Hertl JA. 1996. The associat ion between cumula t ive m i l k y i e l d , days open, and days to first breeding i n New Y o r k H o l s t e i n cows . J D a i r y S c i . 79:235-241. Folman Y, Kaim M , Herz Z, Rosenberg M . 1990. C o m p a r i s o n o f methods for the synchroniza t ion o f estrous cycles i n dai ry cows . 2. Effects o f progesterone and par i ty o n concept ion. J D a i r y S c i . 73:2817-2825. Grant RJ, Albright JL. 1995. Feed ing behavior and management factors dur ing the transi t ion pe r iod i n da i ry cattle. J A n i m S c i . 73:2791-2803. Harvey MJA, Renton JP, Salaheddine M, Robertson L. 1994. O v a r i a n and c l i n i c a l response o f cattle to buserel in . V e t R e c . 134:169-171. Lean JJ, Galland JC, Scot t JL. 1989. Rela t ionships between ferti l i ty, peak m i l k y ie lds and lactat ional persistency i n dai ry cows . Ther iogenology 31:1093-1103. 174 Lucy M C , Savio JD, Badinga L , De L a Sota R L , Thatcher W W . 1992. Factors that affect ovar ian fo l l i cu la r dynamics i n cattle. J A n i m S c i 70: 3615-26. Macmillan K L , Taufa V K , Day A M . 1986. Effects o f an agonist o f gonadotrophin releasing hormone (Buserel in) i n cattle. III. Pregnancy rates after a post - inseminat ion inject ion dur ing metoestrus or dioestrus. A n i m R e p r o d S c i . 11: 1-10. Macmillan K L , Thatcher W W . 1991. Effects o f an agonist o f gonadotropin-releasing hormone o n ovar ian fo l l ic les i n cattle. B i o l . Reprod . 45:883-889. Martin T L , Swanson L V , Appell L H , Rowe K E , Stormshak F. 1990. Response o f the bov ine corpus lu teum to increased secretion o f lu te in iz ing hormone induced b y exogenous gonadotropin releasing hormone. Domes t A n i m E n d o c r i n o l . 7:27-34. Momcilovic D, Archbald L F , Walters A , Tran T, Kelbert D, Risco C A and W W Thatcher. 1998. Reproduc t ive Performance o f Lac ta t ing D a i r y C o w s Treated w i t h Gonado t rop in - Re leas ing H o r m o n e ( G n R H ) and / or Pros taglandin F - 2 a lpha for S y n c h r o n i z i n g o f Estrus and Ovula t ion . Ther iogenology 50: 1131-1139. Moreira F, Risco C, Pires M F A , Ambrose JD, Drost M , DeLorenzo M , Thatcher W W . 2000 . Effect o f b o d y condi t ion on reproductive eff ic iency o f lactating da i ry c o w s r ece iv ing t imed inseminat ion . Ther iogenology 53:1305-1319. Murdoch W J , Van K i r k E A . 1998. Lu tea l dysfunct ion i n ewes induced to ovulate ear ly i n the fo l l i cu la r phase. E n d o c r i n o l o g y 139:3480-4. Niswender G D , Juengel J L , Silva PJ , Rollyson M K , Mclntush E W . 2000. M e c h a n i s m s con t ro l l ing the funct ion and l ife span o f the corpus luteum. P h y s i o l . R e v i e w s . 80:1-29. Rajamahendran R, Ambrose DJ , Small J A , Dinn N . 2001 . Synchron iza t ion o f estrus and ovu la t ion i n cattle. A r c h A n i m a l Breed ing . 44: special issue 58-67. Rajamahendran R, Ambrose JD, Ramakrishnappa N . 2002 . H o r m o n a l treatments f o l l o w i n g breeding to increase pregnancy rates i n cattle. Presented at 9th International Congress o n B i o t e c h n o l o g y i n A n i m a l Reproduc t ion : Management o f F a r m A n i m a l Reproduc t ion - Fe r t i l i ty Improvement and A d v a n c e d Technologies . H e l d dur ing 2 - 4 December 2002, at the Madras Ve te r ina ry Co l l ege , Chenna i , India. Rajamahendran R, Ambrose JD, Schmitt E J , Thatcher M J , Thatcher W W . 1998. Effects o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants o n p l a sma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . Ther iogeno logy 50:1141-1155. Rajamahendran R, Manikkam M . 1994. Effects o f exogenous steroid hormones o n the dominant fo l l i c l e mainta ined b y a norgestomet implant i n heifers. C a n J A n i m S c i . 74:457-464. 175 Rajamahendran R, Taylor C. 1990. Character izat ion o f ovar ian ac t iv i ty i n postpartum da i ry cows us ing ul trasound imag ing and progesterone profi les . A n i m R e p r o d S c i . 22 :171-180. Rodger L D , Stormshak F. 1986. Gonadotropin-releasing hormone- induced alteration o f bov ine corpus lu teum function. B i o l Reprod . 35:149-56. Rhodes F M , McDougall S, Verkerk G A , Morgan SR. 1999. Progesterone (P4) supplementat ion f o l l o w i n g inseminat ion does not increase concept ion rates i n da i ry cows . J o A n i m S c i . (Supple 1) 77: Abs t r . 6: Page 90. Schmitt EJP , Diaz T, Barros C M , de la Sota R L , Drost M , Fredriksson E W , Staples C R , Thorner R and Thatcher W W . 1996b. Different ia l response o f the luteal phase and fert i l i ty i n cattle f o l l o w i n g ovula t ion o f the first-wave fo l l i c l e w i t h human chor ion ic gonadotropin or an agonist o f gonadotropin-releasing hormone. J A n i m S c i . 74:1074-1083. Schmitt E J , Diaz T, Drost M , Thatcher W W . 1996a. U s e o f a gonadotropin-releasing hormone agonist or human chor ionic gonadotropin for t imed inseminat ion i n cattle. J A n i m S c i . 74 :1084-91 . Sianangama P C , Rajamahendran, R. 1992. Effect o f human chor ion ic gonadotropin adminis tered at specif ic times f o l l o w i n g breeding o n m i l k progesterone and pregnancy i n cows . Ther iogeno logy 38: 85-96. Stojilkovic SS, Catt K J . 1995. Expres s ion and signal t ransduction pathways o f gonadotropin-releasing hormone receptors. R e c P r o g H o r m Res . 50:161-205. Taponen J , Katila T, Rodriguez-Martinez H . 1999. Induct ion o f ovu la t ion w i t h gonadotropin-releasing hormone dur ing proestrus i n cattle: influence o n subsequent fo l l i cu la r g rowth and luteal function. A n i m R e p r o d S c i . 55 :91-105 . Taponen J , Rodriguez-Martinez H , Katila T. 2000. A d m i n i s t r a t i o n o f gonadotropin-releasing hormone dur ing metoestrus i n cattle: influence o n luteal funct ion and cyc le length. A n i m R e p r o d S c i . 64 :161-9 . Taylor C, Rajamahendran R. 1991. F o l l i c u l a r dynamics , corpus lu teum growth and regression i n lactating da i ry cattle. C a n J A n i m S c i . 71:61-68. Taylor C, Rajamahendran R. 1994. Effect o f mid- lu tea l progesterone levels o n the first wave dominate fo l l i c l e i n cattle. C a n J A n i m S c i . 74:281-285. Twagiramungu H , Guilbault L A , Dufour J J . 1995. Synchron iza t ion o f ovar ian fo l l i cu la r waves w i t h a gonadotropin-releasing hormone agonist to increase the p rec i s ion o f estrus i n cattle: a rev iew. J A n i m S c i . 73:3141-3151. Twagiramungu H , Guilbault L A , Proulx J G , Dufour J J . 1994. Influence o f corpus lu teum and induced ovu la t ion o n ovar ian fo l l icu la r dynamics i n postpartum c y c l i c cows treated w i t h busere l in and cloprostenol . J A n i m S c i . 72:1796-805. 176 Thatcher WW, Drost M , Savio JD, Macmillan K L , Entwistle KW, Schmitt RL, de La Sota, R L, Morris GR. 1993. N e w c l i n i c a l uses o f G n R H and its analogues i n cattle. A n i m R e p r o d S c i . 33:27-49. Thatcher WW, Guzeloglu A , Mattos R, Binelli M , Hansen TR, Pru JK. 2001. U te r ine -conceptus interactions and reproductive failure i n cattle. Ther iogeno logy 56:1435-1450. Thatcher WW, Macmillan K L , Hansen PJ, Drost M. 1989. Concepts for regulations o f corpus lu teum funct ion b y the conceptus and ovar ian fo l l ic les to improve fert i l i ty. Ther iogeno logy 31:149-164. Vasconcelos J L M , Silcox RW, Rosa GJM, Pursley JR, Wiltbank MC. 1999. Synchron iza t ion rate, size o f the ovula tory fo l l i c l e , and pregnancy rate after synchroniza t ion o f ovu la t ion beg inn ing o n different days o f the estrous cyc le i n lactat ing da i ry cows . Ther iogeno logy 52:1067-1078. 177 C H A P T E R 6 G E N E R A L D I S C U S S I O N A N D C O N C L U S I O N S 6.1. G E N E R A L D I S C U S S I O N In recent years, numerous reports have gathered evidence o n an extra-hypothalamic o r i g i n o f G n R H , as w e l l as the presence o f an extra-pituitary G n R H - R i n different types o f tissues i n the body. W i t h respect to the reproductive system, several reports reveal evidence for the presence o f G n R H and G n R H - R systems i n the ovary, oviduct , endometr ium, placenta, and testes, i n different species o f animals , i nc lud ing humans ( R e v i e w e d b y Janssens et a l . , 2000; Ramakr i shnappa et a l . , 2004). F r o m both in vivo and in vitro m o d e l studies i n rodents, primates, and i n humans, it is becoming increas ingly evident that G n R H , or its synthetic analogues, c o u l d exert direct effects through an autocrine or paracrine manner, i n target tissue ( R e v i e w e d b y Janssens et a l . , 2000; Ramakr i shnappa et a l . , 2004) . Surpr i s ing ly , i n the bov ine species, there were no such informat ion avai lable, nor was there any evidence o f systematic efforts that have been made to examine such poss ibi l i t ies . In l i eu o f these in t r igu ing f indings f rom other species, w e were prompted to explore i f any such mechanisms exist i n bov ine species. Therefore, the series o f experiments out l ined i n this thesis were designed to examine i f G n R H - R and G n R H m R N A are expressed i n the bov ine ovary , as w e l l as to examine the direct effect o f G n R H - a o n ovar ian steroidogenic machinery , apoptotic process i n C L , and post-breeding G n R H administrat ion o n in vivo C L funct ion and pregnancy outcome i n dai ry cattle. 178 In Chapter 1, us ing R T - P C R methods, w e examined the presence o f G n R H - R m R N A expression i n granulosa cel ls f rom different stage fo l l ic les and C L , as w e l l as G n R H m R N A expression i n granulosa cel ls . T o our knowledge , the present results are the first to successful ly demonstrate the presence o f G n R H - R m R N A expression i n fo l l i c les ( smal l , m e d i u m and large), and C L tissues (stage III) i n bovine species. A l t h o u g h these f indings are, a step forward demonstrat ion o f the functional fo rm G n R H - R protein molecules is an imperat ive step needed before attributing any poss ible direct effects o f G n R H , or its agonists, at ovar ian ce l lu lar l eve l i n the bov ine species. P r e l im ina ry evidence from R T - P C R results suggest for the presence o f G n R H m R N A expression i n bov ine granulosa cel ls o f different s ize fo l l ic les . D u e to the l imitat ions o f the materials, and the experimental approach used i n this part o f the study, our further confirmatory attempts such as southern b lot hybr id iza t ion , and nucleot ide sequencing steps, were not successful. T h i s m a y be attributed to one or more factors such as the l o w amount o f target D N A o n blots, the part ial compl imen ta ry probe sequence that was o f re la t ive ly shorter length i n the w h o l e p l a s m i d used, and the chemi luminescent s igna l ing method c o u l d have undermined the detection abi l i ty . In the case o f the sequencing step, the direct P C R product used as template D N A , and the same 3 ' end p r imer that was used both dur ing R T - P C R , and dur ing the sequencing step, c o u l d have been the poss ib le contr ibut ing factors for the absence o f the s ignal output dur ing the sequencing step. Further steps, such as c lon ing o f R T - P C R fragments, and sequence analysis us ing universa l sequencing pr imers , m a y a id i n ident i fy ing the G n R H sequence. T h e p re l imina ry evidence from the present study supported b y previous reports that suggested the presence o f G n R H - l i k e prote in molecules i n bov ine ovaries (S to j i lkov ic and Catt , 1995; Ireland et a l . , 1988). In addi t ion, s imi la r evidence has been demonstrated i n human and rat ovaries ( A t e n et 179 a l . , 1987a). Therefore, w e do bel ieve that the R T - P C R technique, u s ing human pr imers , reveals evidence for G n R H m R N A expression i n bovine granulosa cel ls . In Chapter 3, a series o f trials were performed to investigate the direct effects o f G n R H - a (buserelin) o n steroid hormone secretion from bov ine granulosa ce l ls , dispersed luteal ce l l s , and from m i n c e d luteal tissue dur ing in vitro culture. B a s e d o n the results, it was evident that G n R H - a exerted a dose-dependent, b iphasic effect o n E 2 output from in vitro cul tured granulosa cel ls . At lower dose levels (200 - 500 n g / m L ) , G n R H - a caused an increased steroid output, whereas at higher dose levels (1000 n g / m L ) , the accumulated steroid levels were s l igh t ly lower or not different from E 2 levels i n untreated controls . A l t h o u g h P 4 concentrations revealed a s imi la r trend, the buserel in response o n P 4 output was not different from that o f i n untreated control samples. The present observations are i n agreement w i t h reports that have demonstrated G n R H - a - i n d u c e d steroidogenesis from in vitro cul tured human granulosa cel ls (Ranta et a l , 1982; Par inaud et a l . , 1992; O l s s o n et a l . , 1990; Bussenot et a l . , 1993). P rev ious ly , it was suggested that G n R H - a c o u l d modulate steroidogenesis b y a direct ovar ian act ion (Parinaud et a l . , 1988). Guerrero et a l . (1993) found an increase i n P 4 and a decrease i n E 2 product ion, w h i c h seemed to be related to a decrease o f L H receptor numbers and aromatase ac t iv i ty i n GnRH-a- t rea ted cel ls . T h e present study, do not p rov ide def ini t ive evidence for the presence o f functional G n R H receptors that c o u l d mediate a G n R H - a response, affecting steroidogenic potentials o f bov ine granulosa ce l l s in vitro. Nonetheless , based o n the response e l ic i ted b y a G n R H antagonist, reversal o f the G n R H - a effect o n E 2 output does suggest the possible existence o f G n R H l igand specif ic target sites o n granulosa cel ls . Demonst ra t ion o f the functional fo rm o f G n R H - R prote in 180 molecu les is an imperat ive step before attributing any possible direct effects o f G n R H , or its agonists, at the ovar ian cel lu lar l eve l i n the bovine species. In efforts to examine the direct effects o f G n R H - a o n in vitro P 4 product ion i n bov ine C L , bo th dispersed luteal c e l l cultures, and luteal tissue or organ culture systems, were u t i l i zed . G n R H - a exhibi ted a dose-dependent, b iphasic response i n terms o f P 4 synthesis f rom in vitro-treated dispersed luteal cel ls , and from luteal tissues. H o w e v e r , i n luteal ce l l s , the higher dose levels o f buserel in (1000 n g / m L ) showed a s l igh t ly inh ib i to ry effect o n P 4 levels . It is not clear whether the suppressed P 4 levels at higher dosage levels is i n fact due to inh ib i to ry roles o f G n R H - a , or auto-regulatory mechanisms such as receptor desensi t izat ion, or d o w n regulat ion o f its o w n receptors, as reported i n other studies (Olofsson et a l . , 1995; V o l k e r et a l . , 2002) . T h e present f indings differ from that o f M i l v a e et a l . (1984), w h o reported a dose-dependent suppression o f P 4 secretion from in vitro cultured bov ine luteal ce l ls . In that report, authors suggest that it is ve ry u n l i k e l y that G n R H mediates its effects through the mechan i sm o f l igand specific-receptor interaction o n bov ine luteal cel ls . H o w e v e r , the reason for the different types o f response observed between these two studies c o u l d have been due to the variations i n experimental condi t ions. A s there seems to be o n l y two such studies that were carried out i n the bovine species, it is d i f f icul t to draw a def ini t ive conc lus ion as to whether G n R H , or its analogues, c o u l d exert direct effects at ovar ian ce l lu la r levels i n the bov ine species. H o w e v e r , it is note-worthy that i n the bov ine species, in vivo adminis t ra t ion o f G n R H - a dur ing la te-mid luteal phase has resulted enhanced P 4 output (Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2000; Rajamahendran et a l . , 1998, 2001) . 181 In the present study G n R H - a treatment i n combina t ion w i t h L H or PGF2 a > had no influence o n P 4 output f rom luteal tissues. H o w e v e r , un l ike w i t h other reports [as w e l l as i n the present study (antide and G n R H - a effect o n granulosa c e l l steroid output)], antide treatment e l ic i ted a m a x i m a l s t imulatory response o n P 4 output i n C L tissue, w h e n treated as antide alone, or i n combina t ion w i t h G n R H - a . H o w e v e r , this effect was not reflected i n terms o f a concomitant increase i n m R N A levels o f k e y enzymes ( S t A R protein, P450scc , and 30-HSD) that are i n v o l v e d i n the steroidogenic pathway. T h e reason for this a typical response is not k n o w n . Perhaps, this cou ld be due to some other u n k n o w n factors w i t h i n C L tissue, that in conjunct ion w i t h antide that m a y have been responsible for this a typica l response. It is also reported that granulosa cel ls f rom w o m e n that were administered w i t h G n R H antagonist (cetrorelix) responded earlier to the in vitro hormone s t imulat ion, i n terms o f P 4 accumula t ion , than w o m e n treated w i t h the buserel in ( L i n et a l . (1999). T h e i r results indicate that luteal funct ion is less impai red i n G n R H antagonist treatment, than i n G n R H agonist treatment. Further, evidence from porcine granulosa c e l l cultures suggests that a G n R H antagonist, combined w i t h fo l l icu la r f lu id , c o u l d enhance L H - s t i m u l a t e d P 4 secretion ( L e d w i t z - R i g b y , 1989). In addit ion, the biphasic effects o f G n R H antagonist o n in vitro steroidogenesis (rat granulosa cells) that var ied w i t h exposure t ime showed the in i t i a l response be ing st imulatory, and the later inh ib i tory (Sheela R a n i et a l . , 1983). T h e y also showed that 20 alpha-OHP secretions i n the same cultures were potentiated b y the combined presence o f FSH, and G n R H - a . These authors suggested that these types o f responses c o u l d have been due to the maturat ional stage o f the granulosa cel ls . F r o m this evidence, it is tempt ing to suggest that the G n R H antagonist m a y not o n l y mediate their effects independent 182 of G n R H target sites, but they m a y also interact w i t h some other u n k n o w n factors i n ovar ian c e l l types. T h i s br ings attention to several previous reports that suggest the presence o f G n R H - l i k e molecules i n gonadal structures ( Y i n g et a l . , 1981; A t e n et a l . , 1987a, b ; Ireland et a l . , 1988; I z u m i et a l . , 1985), w h i c h m a y have a regulatory role o n ovar ian ce l lu la r function, l oca l l y . H o w e v e r , to date there is no concrete evidence for a funct ional ro le for such molecu les i n the ovary or any other reproductive tissue. In Chapter 4, w e examined the direct effect o f G n R H - a o n molecu la r steroidogenic machinery , as w e l l as G n R H - a influence o n m R N A expression for pro- and anti-apoptotic molecules i n bov ine C L . D u r i n g in vitro culture, G n R H - a treatment o f C L tissue caused a m i l d s t imulatory response o n m R N A levels o f S t A R , P450scc and 3 P - H S D ; al though an approaching s ignif icance (P = 0.12) c o u l d be achieved o n l y i n the case o f 3 P - H S D . T h i s was typ ica l o f the response observed i n terms o f P 4 output f rom luteal cel ls and tissues, f o l l o w i n g G n R H - a treatment in vitro ( C H A P T E R 3). The present f indings are i n agreement w i t h earlier reports where the C L i n heifers that were administered w i t h long-act ing G n R H - a (deslorel in) , had a greater content o f S t A R protein, and the steroidogenic enzyme, P450scc (Pi tcher et a l . , 1997 ci ted b y D ' O c c h i o and A s p d e n , 1999). T h e same group o f researchers also reported a s ignif icant increase i n testosterone levels , and m R N A expression leve l for S t A R , P450scc , 3 P - H S D , and P 4 5 0 n a j i n testicular tissues o f bul l s that were administered des lore l in ( A s p d e n et a l . , 1998). G n R H - a ( leuprolide acetate), i n combina t ion w i t h e C G adminis t ra t ion, has been reported to cause a significant increase i n S t A R m R N A and also S t A R prote in and P 4 levels , i n ovar ian fo l l ic les o f mice (frusta et a l . , 2003). O v e r a l l , the present f indings are i n consistent w i t h observations where increased p lasma P 4 levels were a characteristic feature 183 i n m a n y o f the studies w i t h G n R H administrat ion dur ing the luteal the phase i n cattle (Thatcher et a l . , 1993; D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2000; Rajamahendran et a l . , 1998, 2001) . Further, these studies indicate that G n R H - a administrat ion dur ing the luteal phase does not adversely affect the C L function i n the bov ine species, contrary to reports i n the major i ty o f the studies i n other species (Rev i ewed b y Janssens et a l . , 2000) . T h e present f indings differ f rom s imi la r studies where buserel in (Sridaran et a l . , 1999a,b), or leuprol ide acetate ( A n d r e u et a l , 1998), treatment caused a significant suppressive effect o n S t A R , 3p-H S D and P450scc i n rat ovaries. In the present study, the exact mechanisms for a m i l d s t imulatory response i n m R N A expression levels for S t A R , P450scc and 3 0 - H S D are not k n o w n . In addi t ion, these observations do not conf i rm whether the effect o f G n R H - a treatment was due to its direct interaction w i t h the G n R H specific receptor o n luteal c e l l types i n bov ine C L . M o r e studies are needed to explore such a poss ib i l i ty , and conf i rmat ion o f any funct ional forms o f G n R H receptor molecules , and their mode o f interaction w i t h its l igand system. It has been suggested that G n R H c o u l d mediate its direct effects i n conjunct ion w i t h other hormona l agents such as PGF2 a , or L H , that are w e l l k n o w n to regulate ovar ian funct ion ( R e v i e w e d b y Steele and L e u n g , 1993). S t imula t ion o f one or more s igna l ing pathways, such as phospholipase C ( P L C ) , phosphol ipase A 2 ( P L A 2 ) , and phosphol ipase D ( P L D ) , and act ivat ion o f prote in kinase C ( P K C ) has been hypothes ized to cause either inh ib i tory , or st imulatory, effects o n ovar ian ce l lu lar steroid output. These dual effects have been c lear ly demonstrated w i t h in vivo experiments i n adult male , and female, hypophysec tomized rats, where exogenous G n R H or G n R H - a c o u l d either st imulate or inh ib i t gonadal functions i n terms o f steroidogenesis (Hsueh and Jones, 1981a, b ; H s u e h and Jones, 1982). G n R H has been shown to el ic i t m i x e d responses per ta ining to ovar ian funct ion 184 ( rev iewed b y Sharpe, 1982; Janssens et a l . , 2000; L e u n g et a l . , 2003) . T h e inh ib i to ry act ion o f G n R H , or its agonists, o n gonadal steroidogenesis invo lves suppression o f the gonadotropin receptors, or intermediary enzymes, i n v o l v e d i n the steroidogenic pathway. G n R H - a induced suppression o f F S H and L H receptors ( T i l l y et a l . , 1992; Piquette et a l . , 1991; Guerrero et a l . , 1993), and G n R H - a caused suppression o f gonadotropin- induced c A M P levels , has been reported (Richards, 1994; K n e c h t et a l . , 1985). In the present study, in vitro treatment o f luteal tissues w i t h G n R H - a d i d not affect the m R N A levels for pro-and anti-apoptotic molecules ( B a x and B c l 2 ) . T h i s is consistent w i t h the other f indings f rom present study where G n R H - a exerted a pos i t ive influence o n in vitro steroid output, a m i l d increase i n m R N A levels for steroidogenic enzymes. H o w e v e r , these f indings differ from several other studies i n different species where G n R H - a was s h o w n to induce apoptotic process i n ovar ian ce l l types. D u r i n g in vitro cultures, G n R H inh ib i ted DNA synthesis (Saragueta et a l . , 1997), and induced apoptosis i n rat granulosa cel ls ( B i l l i g et a l . , 1994). G n R H has been shown to induce structural luteolysis i n superovulated rats through s t imula t ion o f matr ix metalloproteinase ( M M P - 2 ) , and membrane type 1 - M M P expression ( in a developed CL), w h i c h degraded collagens type I V , type III, and I respect ively (Goto et a l . , 1999). D u r i n g ear ly pregnancy i n the rat, G n R H - a has been s h o w n to suppress serum P 4 levels , w h i c h was associated w i t h an increased degree o f D N A fragmentation i n the C L (Sridaran et a l . , 1998). A s imi la r effect o f G n R H - a induc ing an increased number o f apoptotic bodies i n human granulosa cel ls (obtained dur ing oocyte retr ieval for in vitro fert i l ization) has been reported b y Zhao et a l . (2000). 185 T h e present study reveals no evidence o f any adverse effects o f G n R H - a i n terms o f i nduc ing p rogrammed c e l l death (apoptosis) i n bov ine luteal tissues, as has been reported i n other species. Bes ides species differences, the reason for this differential response o f G n R H - a o n luteal tissue or c e l l types is not k n o w n . O n the other hand, f indings f rom the present study do not suggest any conc lus ive evidence w i t h respect to the lack o f a G n R H - a effect caus ing p rogrammed c e l l death, contrary to the f indings f rom other species. M o r e studies i n v o l v i n g , i n d i v i d u a l c e l l types rather than who le organ/tissue culture systems, and different dose levels o f G n R H - a , m a y prov ide more concrete and rel iable evidence. It is also important to undertake comprehensive investigations through different approaches such as assessing inter-nuc leosomal D N A fragmentation and examin ing the ear ly responder o f apoptotic process such as F A S and F A S l igand, or P 5 3 system. In chapter 5, w e investigated the influence o f post-breeding G n R H adminis t ra t ion on in vivo C L funct ion i n terms o f P 4 secretion, and pregnancy outcome, i n da i ry cattle. Resul ts from this study indicate no significant differences between sham-treated control and G n R H , or G n R H and h C G , treatment groups. H o w e v e r , i n compar i son w i t h cont ro l animals , cows i n the G n R H treatment group mainta ined s l igh t ly higher levels (non-significant) o f P 4 from D a y 7 to 35 post-breeding, however , no difference was observed i n pregnancy rates. W h i l e the h C G treatment group had s ignif icant ly (P < 0.05) higher levels o f P 4 from D a y 14 un t i l 35 post-breeding, the pregnancy rate was not different from both the control and G n R H groups. The present f indings are i n agreement w i t h several related studies reported i n the literature. G n R H administered at var ious t ime points dur ing the post-breeding pe r iod i n cattle had a m i x e d response i n terms o f P 4 output and P R . F o r example , no increase i n P 4 concentrations 186 was observed w h e n c y c l i n g cows were injected w i t h G n R H - a o n D a y 7 after estrus (Twag i r amungu et. a l . , 1995). S i m i l a r l y , G n R H (100 |xg) o n D a y 2 and 8 o f the estrous cyc le d i d not affect p la sma P 4 levels ( M a r t i n et a l . , 1990). G n R H , or G n R H - a , administered i n ear ly the fo l l i cu la r phase has resulted i n an inadequate or defective C L f o l l o w i n g ovu la t ion ( L u c y and Stevenson, 1992; Taponen et a l . , 1999, 2003). Treatment w i t h G n R H o n either D a y 2, or D a y 10, caused a reduct ion i n serum P 4 levels than o n D a y s 12, 14 and 16 o f the c y c l e i n cattle (Rodger and Stormshak 1986). Whereas, mid - fo l l i cu l a r ( M u r d o c h and V a n K i r k , 1998, M o m c i l o v i c et a l . , 1998; Taponen et a l . , 1999), or ear ly estrus (Twag i r amungu et a l . , 1994), G n R H - a adminis t ra t ion has been shown to result i n an enhanced C L funct ion f o l l o w i n g ovula t ion . Heifers treated w i t h buserel in ear ly i n the estrous c y c l e were s h o w n to have an increase i n the relative numbers o f large luteal ce l l s i n their C L (Twag i r amungu et a l . , 1995; Schmi t t et a l . , 1996b). G n R H - a administrat ion at about D a y 4, to D a y 6, f o l l o w i n g breeding c o u l d induce ovula t ion o f first wave dominant fo l l i c l e and development o f an accessory C L as a contr ibutory factor towards increased serum P 4 levels ( D ' O c c h i o and A s p d e n et a l . , 1999; A m b r o s e et a l . , 1999, 2000; Rajamahendran et a l . , 2001) . Pregnancy rates f o l l o w i n g post-breeding G n R H adminis t ra t ion have been reported w i t h var iable results. The present study does not indicate any increase o f P R f rom G n R H adminis tered o n D a y 7 after breeding. H o w e v e r , there was an increase i n P R f o l l o w i n g m i d -cyc le G n R H administrat ion i n heifers i n other studies ( M a c m i l l a n et a l . , 1986; Thatcher et a l . , 1993) . U l t r a sound examinat ions dur ing the luteal phase o f the estrous cyc le ( H a r v e y et a l . , 1994) revealed that treatment w i t h G n R H induced an accessory C L i n approximate ly h a l f o f the treated animals that subsequently had an increase i n P R . In addi t ion, these authors 187 suggest that there is a sudden increase i n the serum concentrations o f L H f o l l o w e d b y a concomitant increase i n P 4 concentration after m i d - c y c l e G n R H administrat ion. Further, this effect can cause an extended estrous cyc le among nonpregnant cows . H o w e v e r , the present study d i d not show any difference i n P 4 concentrations or P R rates f o l l o w i n g G n R H compared to that o f the control or h C G treatment groups. In this study, al though the h C G treated animals tended to main ta in s ign i f ican t ly higher P 4 levels (P < 0.05) there was no significant difference observed i n terms o f P R from that o f either the control or G n R H group. It is suggested that the higher P 4 levels i n the h C G treatment animals c o u l d have been attributed to the accessory C L , and the direct effects o f h C G o n exis t ing C L at the t ime o f administrat ion. S i m i l a r observations have been reported from previous studies where h C G was administered dur ing the mid- lu tea l stage i n ant ic ipat ion o f i m p r o v e d pregnancy rate, but it was often associated w i t h inconsistent per ipheral concentrations o f P 4 (de L o s Santos-Valadez et. a l . , 1982; Rajamahendran and Sianangama, 1992; Schmi t t et a l . , 1996b). Some authors ( E d m o n s o n et a l . , 1989) attributed var iable results to the type o f animals u t i l i zed for such experiments. It has been reported that first par i ty cows usua l ly have higher concept ion rates than older c o w s (Lean et a l . , 1989; F o l m a n et a l . , 1990; E i c k e r et a l . , 1996). In the present study, overa l l P R i n the heifer group was s igni f icant ly higher than i n cows (P < 0.05). T h i s m a y be attributable to the adverse effects o f h i g h m i l k y ie lds ; and thus stress o n early pregnancy, as reported b y L e a n et a l . (1989). 188 In this study, the estimated pregnancy loss, or ear ly embryonic morta l i ty , that occurred between D a y 21 and 35 post-breeding i n the different treatment groups was 16%, 2 0 % , and 2 9 . 1 7 % for contro l , G n R H and h C G , respectively. A m o n g the three treatment groups, the h C G group had more animals that apparently lost pregnancy between D a y s 21 and 35 post-breeding. The reason for this higher pregnancy loss i n the h C G group is not clear. H o w e v e r , this m a y be attributable to an extended estrous cyc le length due to an h C G caused de lay i n luteolyis (Sianangama and Rajamahendran, 1992). T h i s might have contr ibuted to the fact that more animals returned to heat between D a y s 28 and 35, compared to the cont ro l or G n R H treated groups. Howeve r , the percentage range o f pregnancy loss observed i n this study is i n agreement w i t h the f indings o f Vasconce los (1999), w h o reported a 2 4 % embryon ic loss between 25 D a y s pos t -AI , and c a l v i n g t ime, i n G n R H based synchroniza t ion protocols (Ovsynch) . S i m i l a r l y , M o r e i r a et a l . (2000) recent ly reported an estimated 3 5 % loss o f embryos between D a y 20 and 27, and an 8% loss between D a y 27 and 45 pos t -AI . L o s s o f C L maintenance around the t ime o f implanta t ion ( D a y 14 to 16) c o u l d prevent implanta t ion, and c o u l d lead to loss o f the pregnancy. Further, Thatcher et a l . (2001) reported that 4 0 % o f the total embryonic mor ta l i ty occurred between D a y s 8 and 17 o f pregnancy, w h i c h m a y be attributed to the inab i l i ty o f certain conceptuses to secrete interferon-tau (LFN-t) that inhibi ts the uterine PGF2 t t dur ing early pregnancy (Thatcher et a l . , 2001) . In summary, i nc lud ing this study, changes i n pregnancy rates, i n response to G n R H adminis t ra t ion at different t ime points after breeding i n da i ry animals m a y be i n part due to the type o f the herd, geographical locat ion, i nc lud ing weather patterns, and overa l l management practice. H o w e v e r , it was an un ivoca l assumption that adminis t ra t ion o f G n R H and its agonist ic analogues at the t ime o f A l , or dur ing post-breeding per iod , w o u l d increase 189 pregnancy rates i n cattle (Thatcher et a l . , 1993; U l l a h et a l . , 1996; Rajamahendran et a l . , 1998; D ' O c c h i o and A s p d e n , 1999; D ' O c c h i o et a l . , 2000; C a m et a l . , 2002) . Therefore, i n order to u t i l i ze the benef ic ia l effects o f G n R H to its fullest extent, further studies are needed to unravel any inherent, as w e l l as external, factors that m a y be contr ibut ing to the present var iab i l i ty , i n terms o f pregnancy outcome i n cattle. 6.2. G E N E R A L C O N C L U S I O N S T o the best o f our knowledge , some o f the findings that emerged from these studies are the first to be reported i n the literature. In particular, this study p rov ided the clear evidence for the presence o f G n R H - R m R N A expression i n both fo l l ic les , and C L i n the bov ine species. In these studies G n R H - a (buserelin) shown to cause a dose-dependent, b iphas ic effect on steroid hormone output from in vitro cul tured granulosa ce l ls , luteal cel ls and i n C L tissues. In luteal tissues, treatment w i t h a G n R H antagonist (antide) alone or i n combina t ion w i t h buserel in showed a h i g h l y significant s t imulatory response o n P 4 output. T h e reason for this a typical response is u n k n o w n , and further research us ing different G n R H antagonistic preparations is warranted. In terms o f luteal steroidogenic machinery , G n R H - a treatment o f luteal tissues showed a m i l d (nonsignificant) s t imulatory response o n m R N A levels for S t A R prote in and P450scc m R N A although; tendency for s ignif icance (P = 0.12) c o u l d be seen o n l y i n the case o f 3(3-HSD. Consistent w i t h above f indings, the present study revealed no evidence for any adverse effects o f G n R H - a treatment, i n terms o f i nduc ing apoptotic process, and luteolysis , un l ike that reported i n other species. In response to post-breeding G n R H administrat ion, al though animals i n the G n R H treatment group mainta ined 190 s l igh t ly (non-significant) higher P 4 levels f rom D a y 7 to 35 post-breeding, no difference was observed i n pregnancy rates w h e n compared to the control and h C G treatment groups. C o l l e c t i v e l y , based o n the present observations o f G n R H - R m R N A expression, and G n R H - a effect o n steroid hormone output, and G n R H - a effect o n molecu la r steroidogenic machinery , w e be l ieve that G n R H - a cou ld cause a dose-dependent b iphas ic response o n steroid hormone output from bov ine granulosa cel ls , dispersed luteal ce l l s and C L tissue. H o w e v e r , these f indings do not provide defini t ive evidences to whether these results are, i n fact due to the direct interaction o f G n R H - a w i t h its receptors o n the above c e l l types. G n R H antagonist caused a typica l s t imulatory response o n P 4 output from C L tissues; is an interesting feature i n this study. Consistent w i t h above findings, and un l ike i n other species, G n R H - a treatment d i d not cause any adverse effects o n C L funct ion b y i n d u c i n g or augment ing the apoptotic process, or luteolysis . In the present study, a l though G n R H adminis t ra t ion o n D a y 7 post-breeding caused a slight e levat ion i n per ipheral P 4 levels pregnancy, outcome was not different f rom untreated control animals . T h i s s i m p l y impl i e s that the benef ic ia l effects o f exogenous G n R H o n the bovine reproductive system are w i d e l y var iable; and therefore, it is important to continue further research i n order to unravel the inherent benef ic ia l effects o f G n R H , and its super-agonistic analogues, o n bov ine reproduct ive function. 191 R E F E R E N C E S Ambrose JD, Kastelic JP, Rajamahendran R, Small J , Urton G . 2000. P regnancy rates i n da i ry cows after G n R H treatment at 7, 14, or 7 and 14 days after t imed inseminat ion . C a n J A n i m S c i . 80:755. Ambrose JD, Kastelic JP, Kappe Y , Small J , Mohammed H , Rajamahendran. R. 1999. O v u l a t i o n responses, progesterone concentrations, and pregnancy rates i n da i ry cows after G n R H treatment at 7, 14 or 7 and 14 days after t imed inseminat ion. J A n i m S c i . 77 (Supple 1): 227. Andreu C, Parborell F, Vanzulli S, Chemes H , Tesone M . 1998. Regu la t ion o f fo l l i cu la r lu te in iza t ion b y a gonadotropin-releasing hormone agonist: relat ionship between steroidogenesis and apoptosis. M o l R e p r o d D e v . 51 : 287-94. Aspden W J , Rodgers R J , Stocco D M , Scott PT, Wreford N G , Trigg T E , Walsh J , D'Occhio M J . 1998. Changes i n testicular steroidogenic acute regulatory ( S T A R ) protein, s teroidogenic enzymes and testicular morpho logy associated w i t h increased testosterone secretion i n bu l l s r ece iv ing the lu te in iz ing hormone releasing hormone agonist des lore l in . D o m e s t A n i m E n d o c r i n o l . 15:227-238. Aten FR, Ireland J J , Weems C W , Behrman H R . 1987a. Presence o f gonadotropin-releasing hormone- l ike proteins i n bovine and ovine ovaries. E n d o c r i n o l o g y 120:1727-1733. Aten R F , Polan M L , Bayless R, Barman HR. 1987b. A gonadotropin-releasing hormone ( G n R H ) - l i k e prote in i n human ovaries: s imi la r i ty to the G n R H - l i k e ovar ian prote in o f the rat. J C l i n E n d o c r i n o l Me tab . 64:1288-1293. Bill ig H , Furuta I, Hsueh A J . 1994. Gonadotropin-releasing hormone d i rec t ly induces apoptotic c e l l death i n the rat ovary: b iochemica l i n situ detection o f deoxyr ibonuc le ic ac id fragmentation i n granulosa cel ls . E n d o c r i n o l o g y 134: 245-252. Bussenot I, Azoulay-Barjonet C, Parinaud J . 1993. M o d u l a t i o n o f the steroidogenesis o f cul tured human granulosa- lu te in cells b y gonadotropin-releasing hormone analogs. J C l i n E n d o c r i n o l M e t a b . 76: 1376-1379 . Cam M A , Kuran M , Yi ld iz S, Selcuk E . 2002. Fe ta l g rowth and reproductive performance i n ewes administered G n R H agonist o n day 12 post-mating. A n i m R e p r o d S c i . 72(1-2): 73-82. D'Occhio M J , Aspden W J . 1999. Endocr ine and reproductive responses o f male and female cattle to agonists o f gonadotropin-releasing hormone. J R e p r o d Fert. (Supple 54): 101-114. D'Occhio M J , Fordyce G , Whyte TR, Aspden W J , Trigg T E . 2000. Reproduc t ive responses o f cattle to G n R H agonists. A n i m R e p r o d S c i . 6 0 - 6 1 : 4 3 3 - 4 4 2 . 192 Goto T, Endo T, Henmi H , Kitajima Y , Kiaya T, Nishikawa A , Manase K , Sato H , Kudo R. 1999. Gonadotropin-re leas ing hormone agonist has the ab i l i ty to induce increase mat r ix metalloproteinase ( M M P ) - 2 membrane type 1 - M M P expression i n corpora lutea, structural lu teolysis i n rats. J E n d o c r i n o l . 161: 393-402. Guerrero H E , Stein P, Asch R H , de Fried EP , Tesone M . 1993. Effect o f a gonadotropin-releasing hormone agonist o n lu te in iz ing hormone receptors and steroidogenesis i n ovar ian cel ls . F e r t i l S ter i l . 59: 803-808. Harvey M J A , Renton JP, Salaheddine M , Robertson L . 1994. O v a r i a n and c l i n i c a l response o f cattle to buserel in . V e t R e c . 134:169-171. Hsueh A J , Jones PB. 1982. Regu la t ion o f ovar ian granulosa and luteal c e l l functions b y gonadotropin releasing hormone and its antagonist. A d v E x p M e d B i o l . 147:223-62. Hsueh A J W , Schreiber JR, Erickson GF . 1981a. Inhibi tory effect o f gonadotropin-releasing hormone upon cultured testicular cel ls . M o l C e l l E n d o c r i n o l . 21:43-49. Hsueh A J , Jones, PB. 1981b. E x t r a pi tui tary actions o f gonadotropin-releasing hormone. Endoc r ine R e v . 2: 437-461 . Ireland J J , Aten F R O , Barman, HR. 1988. G n R H - l i k e proteins i n cows : concentrations dur ing corpora lutea development and selective loca l iza t ion i n granulosal ce l ls . B i o l Rep rod . 38:544-550. Irusta G , Parborell F, Peluffo M , Manna PR, Gonzalez-Calvar SI, Calandra R, Stocco D M , Tesone M . 2003. Steroidogenic acute regulatory prote in i n ovar ian fo l l i c les o f gonadotropin-st imulated rats is regulated b y a gonadotropin-releasing hormone agonist. B i o l R e p r o d . 68: 1577-83. Izumi S, Makino T, Iizuka R. 1985. Immunoreact ive lu te in iz ing hormone-releasing hormone i n the seminal p lasma and human semen parameters. Fe r t i l S te r i l . 43 : 617-620. Janssens R M J , Brus L , Cahill DJ , Huirne J A , Schoemaker J , Lambalk C B . 2000. D i rec t ovar ian effects and safety aspects o f G n R H agonists and antagonists. H u m R e p r o d Update . 6: 505-518. Knecht M , Ranta I, Feng P, Shonohara O, Catt K J . 1985. Gonadotropin-re leas ing hormone as a modula tor o f ovar ian function. J Steroid B i o c h e m . 23:771-778. Ledwitz-Rigby, F. 1989. A compar ison o f the actions o f s t imulatory fo l l i cu la r f l u id and gonadotropin-releasing hormone analogs o n progesterone secretion b y porc ine granulosa cel ls . B i o l . R e p r o d . 4 1 : 6 0 4 - 6 0 9 . 193 Leung P C , Cheng C K , Zhu X M . 2003. Mul t i - f ac to r i a l ro le o f G n R H - I and G n R H - I I i n the h u m a n ovary . M o l C e l l E n d o c r i n o l . 202: 145-153. L i u Y X , H u Z Y , Feng Q, Zou R J . 1991. Pa radox ica l effect o f a G n R H agonist o n steroidogenesis i n cul tured m o n k e y granulosa cel ls . S c i C h i n a 34: 1452-60 . Abs t r . Lucy M C , Savio JD, Badinga L , De L a Sota R L , Thatcher W W . 1992. Factors that affect ovar ian fo l l i cu la r dynamics i n cattle. J A n i m S c i 70: 3615-26. Macmillan K L , Taufa V K , Day A M . 1986. Effects o f an agonist o f gonadotrophin releasing hormone (Buserel in) i n cattle. III. Pregnancy rates after a post - inseminat ion inject ion dur ing metoestrus or dioestrus. A n i m . Reprod . S c i . 11: 1-10. Martin T L , Swanson L V , Appell L H , Rowe K E , Stormshak F. 1990. Response o f the bov ine corpus lu teum to increased secretion o f lu te in iz ing hormone induced b y exogenous gonadotropin releasing hormone. Domes t A n i m E n d o c r i n o l . 7:27-34. Milvae R A , Murphy B D , Hansel W. 1984. P ro longa t ion o f the bov ine estrous cyc le w i t h a gonadotropin-releasing hormone analogue. B i o l Reprod . 31:664-670. Momcilovic D, Archbald L F , Walters A , Tran T, Kelbert D, Risco C A and W W Thatcher. 1998. Reproduc t ive Performance o f Lac ta t ing D a i r y C o w s Treated w i t h Gonado t rop in - Re leas ing H o r m o n e ( G n R H ) and / or Pros taglandin F - 2 a lpha for S y n c h r o n i z i n g o f Estrus and Ovula t ion . Ther iogenology 50: 1131-1139. Murdoch W J , Van K i r k E A . 1998. Lu tea l dysfunct ion i n ewes induced to ovulate early i n the fo l l i cu la r phase. E n d o c r i n o l o g y 139:3480-4. Olofsson J l , Conti C C , Leung P C K . 1995. H o m o l o g o u s and heterologous regulat ion o f gonadotropin-releasing hormone receptor gene expression i n preovulatory rat granulosa cel ls . E n d o c r i n o l o g y 136: 974-980. Olsson J H , Akesson I, Hillensjo T. 1990. Effects o f a gonadotropin-releasing hormone agonist o n progesterone formation i n cul tured human granulosa cel ls . A c t a E n d o c r i n o l (Copenh) . 122:427-31. Abstract . Parinaud J , Vieitez G , Beaur A , Pontonnier G , Boureau E . 1988. Effect o f lu te in iz ing hormone-releas ing hormone agonist (buserelin) o n steroidogenesis o f cul tured human prevoula tory granlosa cel ls . Fe r t i l Ster i l . 50:597-602. Parinaud J , Oustry P, Bussenot I, Tourre A , Perineau M , Monrozies X , Reme J M , Pontonnier G . 1992. Pa radox ica l ovar ian s t imulat ion i n course o f treatment b y L H - R H analogs. E u r J Obstet G y n e c o l R e p r o d B i o l . 46:117-122. Piquette G N , LaPolt PS, Oikawa M , Hsueh A J W . 1991. Regu la t ion o f lu te in iz ing hormone receptor messenger r ibonucle ic ac id levels b y gonadotropins, g rowth factors, 194 gonadotropin-releasing hormone i n cul tured rat granulosa cel ls . E n d o c r i n o l o g y 128: 2449-2456. Rajamahendran R, Sianangama PC. 1992. Effect o f human chor ion ic gonadotrophin o n dominant fo l l ic les i n cows : formation o f accessory corpora lutea, progesterone produc t ion and pregnancy rates. J R e p r o d Fe r t i l . 95: 577-84. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ, Thatcher WW. 1998. Effects o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants on p l a sma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . The r iogeno logy 50:1141-55. Rajamahendran R, Ambrose DJ, Small JA, Dinn N. 2001. Synchron iza t ion o f estrus and ovu la t ion i n cattle. A r c h . A n i m a l . B r e e d i n g 44: special issue 58-67. Rajamahendran R, Ambrose JD, Schmitt EJ, Thatcher MJ. Thatcher WW. 1998. Effects o f busere l in inject ion and des lore l in (GnRH-agon i s t ) implants o n p l a sma progesterone, L H , accessory C L formation, fo l l i c l e and corpus lu teum dynamics i n H o l s t e i n cows . The r iogeno logy 50:1141-1155. Ramakrishnappa N, Rajamahendran R, Yung-Ming Lin, Leung PCK. 2004. G n R H i n N o n - H y p o t h a l a m i c Reproduc t ive Tissues. A n i m . Reprod . S c i . (a r ev iew article has been submitted for publ ica t ion) . Ranta T, Knecht M , Kody M, Catt KJ. 1982. G n R H receptors i n cul tured rat granulosa ce l l s : med ia t ion o f the inh ib i to ry and st imulatory actions o f G n R H . M o l C e l l E n d o c r i n o l . 27: 233-40. Richards JS. 1994. H o r m o n a l control o f gene expression i n the ovary. Endocr ine R e v . 15: 725-751. Rodger LD, Stormshak F. 1986. Gonadotropin-releasing hormone- induced alteration o f bov ine corpus lu teum function. B i o l Reprod . 35:149-56. Saragueta PE, Lanuza GM, and Raranao JL. 1997. Inhibi tory effect o f gonadotrophin-releasing hormone ( G n R H ) on rat granulosa cel ls deoxyr ibonuc le ic ac id synthesis. M o l R e p r d D e v . 47:170-174. Schmitt EJ, Diaz T, Barros CM, de la Sota RL, Drost M , Fredriksson EW, Staples CR, Thorner R, Thatcher WW. 1996b. Dif ferent ia l response o f the luteal phase and fert i l i ty i n cattle f o l l o w i n g ovu la t ion o f the first-wave fo l l i c l e w i t h human chor ion ic gonadotropin or an agonist o f gonadotropin-releasing hormone. J A n i m Sc i .74 : 1074-1083. Sharpe 1982. C e l l u l a r aspects o f the inh ib i tory actions o f L H - R H o n the ova ry and testis. J R e p r o d Fe r t i l . 6 4 : 5 1 7 - 5 2 7 . 195 Sheela Rani CS, Ekholm C , Bill ig H , Magnusson C , Hillensjo T. 1983. B i p h a s i c effect o f gonadotropin releasing hormone on progestin secretion b y rat granulosa cel ls . B i o l Rep rod . 28:591-7. Sridaran R, Hisheh S, Dharmarajan A M . 1998. Induct ion o f apoptosis b y a gonadotropin-releasing hormone agonist dur ing ear ly pregnancy i n the rat. Apop tos i s . 3: 51-57. Sridaran R, Lee M A , Haynes L , Srivastava R K , Ghose M , Sridaran G , Smith C J , 1999a. G n R H act ion o n luteal steroidogenesis dur ing pregnancy. Steroids. 64: 618-623. Sridaran R, Philip G H , L i H , Culty M , L i u Z , Stocco D M , Papadopoulos V . 1999b. G n R H agonist treatment decreases progesterone synthesis, luteal per ipheral benzodiazepine receptor m R N A , l igand b ind ing , steroidogenic acute regulatory prote in express ion dur ing pregnancy. J M o l E n d o c r i n o l . 22: 45-54. Steele G L , Leung P C K . 1993. S igna l transduction mechanisms i n ovar ian cel ls . In: A d a s h i , E . Y . and L e u n g , P . C . K . (Eds.) , The Ovary . R a v e n Press, N e w Y o r k . pp. 113-127. Stojilkovic SS. Catt K J . 1995. Express ion and s ignal t ransduction pathways o f gonadotropin-releasing hormone receptors. R e c . P rog . H o r m . Res . 50:161-205. Taponen J , Hjerppe P, Kopra E , Rodriguez-Martinez H , Katila T, Kindahl H . 2003. Premature prostaglandin F2a lpha secretion causes luteal regression i n G n R H - i n d u c e d short estrous cycles i n c y c l i c da i ry heifers. Ther iogenology 60:379-93. Taponen J , Katila T, Rodriguez-Martinez H . 1999. Induct ion o f ovu la t ion w i t h gonadotropin-releasing hormone dur ing proestrus i n cattle: influence o n subsequent fo l l i cu la r g rowth and luteal function. A n i m R e p r o d S c i . 55 :91-105 . Thatcher W W , Drost M , Savio J D , Macmillan K L , Entwistle K W , Schmitt R L , de L a Sota R L , Morris G R . 1993. N e w c l i n i c a l uses o f G n R H and its analogues i n cattle. A n i m R e p r o d S c i . 33:27-49. Thatcher W W , Guzeloglu A , Mattos R, Binelli M , Hansen TR, Pru J K . 2001. Ute r ine-conceptus interactions and reproductive failure i n cattle. Ther iogeno logy 56:1435-1450. Til ly J L , Lapolt PS, Hsueh A J W . 1992. H o r m o n a l regulat ion o f fo l l i c l e - s t i m u l a t i n g hormone receptor messenger r ibonucle ic ac id levels i n cul tured rat granulosa cel ls . E n d o c r i n o l o g y 130: 1296-1302. Twagiramungu H , Guilbault L A , Dufour J J . 1995. Synchron iza t ion o f ovar ian fo l l i cu la r waves w i t h a gonadotropin-releasing hormone agonist to increase the p rec i s ion o f estrus i n cattle: a rev iew. J A n i m S c i . 73:3141-3151. Twagiramungu H , Guilbault L A , Proulx J G , Dufour J J . 1994. Influence o f corpus lu teum and induced ovu la t ion o n ovar ian fo l l icu la r dynamics i n postpartum c y c l i c cows treated w i t h busere l in and cloprostenol . J A n i m S c i . 72:1796-805. 196 Ullah G , Fuquay J W , Keawkhong T , Clark B L , Pogue D E , Murphey E J . 1996. Effect o f gonadotropin-releasing hormone at estrus o n subsequent luteal funct ion and fert i l i ty i n lactating Hols te ins dur ing heat stress. J D a i r y S c i . 79:1950-1953. Vasconcelos J L M , Silcox R W , Rosa G J M , Pursley JR, Wiltbank M C . 1999. Synchron iza t ion rate, s ize o f the ovula tory fo l l i c l e , and pregnancy rate after synchroniza t ion o f ovu la t ion beg inn ing on different days o f the estrous cyc le i n lactat ing da i ry cows . The r iogeno logy 52:1067-1078. Volker P, Grundker C, Schmidt O, Schulz K D , Emons G . 2002. E x p r e s s i o n o f receptors for l u t e in i z ing hormone-releasing hormone i n human ovar ian endometr ia l cancers: frequency, autoregulation, and correlat ion w i t h direct antiproliferative ac t iv i ty o f l u t e in i z ing hormone releasing hormone analogues. A m J Obstet G y n e c o l . 186:171-179. Ying SY, Ling N , Bohlen P, Guillemin R. 1981. Gonadocr in ins : peptides i n ovar ian fo l l i cu la r f l u id s t imulat ing the secretion o f pi tui tary gonadotropins. E n d o c r i n o l o g y 108: 1206-1215. Zhao S, Saito H , Wang X , Saito T , KanekoT, Hiroi M . 2000. Effects o f gonadotropin-releasing hormone agonist o n the incidence o f apoptosis i n porc ine human granulosa cel ls . G y n e c o l Obstet Invest. 49: 52-56. 197 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091864/manifest

Comment

Related Items