UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of the transcription factor STE12 by the RNA polymerase II associated CDK SRB10 Nelson, Christopher James 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-902390.pdf [ 9.84MB ]
Metadata
JSON: 831-1.0091832.json
JSON-LD: 831-1.0091832-ld.json
RDF/XML (Pretty): 831-1.0091832-rdf.xml
RDF/JSON: 831-1.0091832-rdf.json
Turtle: 831-1.0091832-turtle.txt
N-Triples: 831-1.0091832-rdf-ntriples.txt
Original Record: 831-1.0091832-source.json
Full Text
831-1.0091832-fulltext.txt
Citation
831-1.0091832.ris

Full Text

REGULATION OF T H E TRANSCRIPTION FACTOR STE12 BY T H E RNA POLYMERASE II ASSOCIATED CDK SRB10  By  Christopher James Nelson B . S c , U B C 1998  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF T H E REQUIREMENTS FOR T H E D E G R E E OF DOCTOR OF PHILOSOPHY  in T H E F A C U L T Y OF G R A D U A T E STUDIES D E P A R T M E N T OF BIOCHEMISTRY A N D M O L E C U L A R B I O L O G Y  We accept this thesis as conforming to the required standard  T H E UNIVERSITY OF BRITISH C O L U M B I A November 2003 © Christopher James Nelson  Abstract  The transcription factor Ste12 is a heavily phosphorylated protein that activates genes required for mating, as well as filamentous growth of the yeast Saccharomyces cerevisiae. Both processes require activation by an upstream MAPK cascade, and this model system is representative of signal responsive transcription in higher organisms.  I have identified a signaling pathway that utilizes the RNA polymerase holoenzyme machinery as a means to simultaneously transmit information to potentially all gene specific transcription factors. In my thesis research I have demonstrated that Srb10, a CDK in the mediator subcomplex of the RNA Pol II holoenzyme, directly phosphorylates Ste12, and targets the protein for ubiquitin dependent proteolysis. Using tryptic phosphopeptide mapping I identified two serine residues on Ste12 that are phosphorylated by Srb10 in vitro and required for phosphorylation by Srb10 in vivo. These phosphorylations, at S261 and S451, have a negative effect on Ste12 activity, and filamentous growth as mutation of these sites to alanine results in elevated Ste12 dependent transcription, and hyperfilamentous growth. The ability of Srb10 to phosphorylate Ste12 is dependent on fermentable carbon, an observation that is consistent with the model that Srb10 activity is sensitive to environmental and nutritional stress. Together these observations support a model whereby Srb10 limits ii  Ste12 activity and filamentous response in rich media.  Starvation  antagonizes Srb10, causing stabilization of Ste12, facilitating induction of filamentous response genes. Because other transcription factors are also regulated by Srb10 phosphorylation, this pathway appears to coordinate expression of diverse gene sets with the growth potential of the cell.  iii  Table of Contents Abstract  ii  Table of Contents  iv  List of Figures  vii  List of Tables  viii  List of Abbreviations Nomenclature  ix ••  xi  Acknowledgements  xii  Thesis For mat  xiii  CHAPTER 1  INTRODUCTION  1  1.1  Yeast differentiation as a model for signal transduction  1.2  Pathogenic fungi  3  1.3  Multiple signals regulate differentiation  4  1.4  .  1  Life cycle of the yeast Saccharomyces cerevisiae 1.4.1 Pheromone response 1.4.2 The pheromone response MAPK cascade 1.4.3 The pheromones and the G protein coupled pheromone receptors 1.4.4 Ste20, Cdc42/Cdc24 1.4.5 The MEKK Stel 1 1.4.6 Ste7 1.4.7 Ste5 1.4.8 Fus3andKssl 1.4.8.1 The imposter model; fact, fiction or wishful thinking 1.4.8.2 Kinase independent function: signal insulators 1.4.9 Farl and pheromone induced cell cycle arrest  5 5 8 11 12 13 14 14 16 16 18 18  1.5 Stel2 and its regulators 1.5.1 Ste 12 Domain Structure 1.5.2 Ste 12 DNA binding properties 1.5.3 DN A binding partners 1.5.4 Stel2 is heavily phosphorylated 1.5.5 The Dig proteins  19 19 23 23 25 26  1.6  27 27 27 28 29 30  Filamentous growth 1.6.1 Requirement of the MAPK cascade 1.6.2 Stel2-Tecl heterodimers activate transcription from FREs 1.6.3 cAMP regulates filamentous growth independently of the STE- MAPK cascade 1.6.3.1 Control of cAMP levels 1.6.3.2 Budding yeast has three PKA genes  iv  1.6.3.3 1.7  Targets of PKA regulatefilamentousgrowth  31  Transcription by the RNA Polymerase II Holoenzyme 1.7.1 Promoter architecture 1.7.2 Chromatin and its modifications 1.7.2.1 The histone proteins, nucleosomes, and higher order chromatin structure 1.7.2.2 Modification-free chromatin remodeling 1.7.2.3 Histone acetylation 1.7.2.4 Other post-translational modifications of histones 1.7.3 The yeast RNA Pol II holoenzyme 1.7.3.1 The core RNA polymerase 1.7.3.2 The RNA polymerase CTD 1.7.4 General transcription factors (GTFs) 1.7.4.1 TBP and associated TAFs 1.7.4.2 TFIIH 1.7.4.3 Other associated complexes 1.7.5 Mediator 1.7.5.1 SrblO/11 activity is sensitive to environmental stress 1.7.5.2 Substrates of SrblO  1.8 1.8.1 1.8.2 1.8.3 1.9  Ubiquitin and the SCF ubiquitin ligase complex The ubiquitination process The F-Box hypothesis SCF substrate recognition is phosphorylation dependent Research objectives  CHAPTER 2  MATERIALS AND METHODS  34 35 36 36 36 37 38 39 39 40 42 42 42 44 44 48 50 50 51 52 53  .  57  58  2.1 Media and yeast manipulation 2.1.1 Growth media 2.1.2 Yeast transformation 2.1.3 Monitoring of filamentous growth  58 58 58 59  2.2  59  Plasmids, oligonucleotides, and yeast strains  2.3 Measurement of transcription 2.3.1 Beta-Galactosidase assays 2.3.2 RNA extraction 2.3.3 Northern hybridization  63 63 63 64  2.4 Protein preparation, isolation, and manipulation 2.4.1 Immunoprecipitations from yeast P labeling of Ste 12 2.4.3 35g ] b ij g f stel2 and pulse chases analysis.:. 2.4.4 Tryptic phosphopeptide mapping 2.4.5 In vitro kinase assays 2.4.6 Immunoblotting 2.4.7 Baculovirus expression 2.4.8 Bacterial expression 2.4.9 Glutathione agarose affinity purification 2.4.10 Chromatin Immunoprecipitation (ChIP)  65 65 66 66 67 67 67 68 69 69 70  2 4 2  32  a  CHAPTER 3  e  n  Q  REGULATION OF STE12 BY DIG1  72 v  3.1 3.2  Foreword Results and Discussion 3.2.1 Digs are inhibitors of Ste 12 3.2.2 The Ste 12 activation domain lies between residues 262 and 356 3.2.3 The Stel2 activation domain is pheromone responsive 3.2.4 Digl interacts with the Stel2 activation domain in vivo and in vitro 3.2.5 Stel2 multimerization requires C terminal residues 3.2.6 Overproduction of the Stel2 C-terminus induces transcription through direct interaction with endogenous Stel2 in vivo  3.3  Conclusions  CHAPTER 4 4.1 4.2  72  SRB10 PHOSPHORYLATES STE12  Foreword  Conclusions  CHAPTER 5 SRB10 PHOSPHORYLATION REGULATES STE12 DEGRADATION 5.1 5.2 5.2.1 5.2.2 5.2.3 5.2.4 5.2.5 5.2.6 5.3  90 93  95 95  Results and Discussion 4.2.1 Hyper-filamentous growth of srblO strains requires STE12 and the STE-MAPK pathway 4.2.2 SrblO phosphorylates Stel2 in vitro 4.2.3 Serine 261 and Serine 451 are directly phosphorylated by SrblO 4.2.4 Stel2 S261/451 phosphorylation require fermentable carbon 4.2.5 Mutation of S261 and S451 to alanine elevates pseudohyphal growth, but does not affect pheromone response 4.2.6 S261A/S451A mutants do not affect DNA binding of Stel2  4.3  73 73 74 78 81 82  96 96 103 106 113 121 127 127  131  Foreword  131  Results and Discussion Phosphorylation of S261 and S451 promote Stel2 degradation Stel2 degradation requires Cdc34 of SCF K463R increases invasive growth Mutation of K463R of STE 12 stabilizes Stel2 K463 is not required for S261/S451 phosphorylation Ste 12 regulated genes are differentially affected by the K463R allele of Stel2  132 132 135 141 144 144 147  Conclusions  150  CHAPTER 6  PERSPECTIVES AND FUTURE DIRECTIONS  154  CHAPTER 7  REFERENCES  158  vi  List of Figures Figure 1.1 The life cycle of Saccharomyces cerevisiae Figure 1.2 The STE-MAPK Cascade Figure 1.3 Domain structure of Ste12 Figure 1.4 The cAMP-PKA pathway regulatesfilamentousgrowth Figure 1.5 A typical eukaryotic promoter Figure 1.6 The SCF ubiquitin ligase complex targets proteins for degradation by the 26S proteosome Figure 3.1 Dig1 and Dig2 cannot repress transcription Figure 3.2 Residues 262-474 contain the Ste12 activation domain which is pheromone responsive Figure 3.3 Ste12 (216-688) is inhibited by Dig1 but not Dig2 Figure 3.4 Ste12 C-terminal fragments co-immunoprecipitate in vitro Figure 3.5 Ste12 multimerization is mediated by C-terminal residues in vitro Figure 3.6 The Ste12 C-terminus mediates multimerization in vivo Figure 4.1 Hyperfilamenation of haploid srb10 strains requires Ste12 and the pheromone response MAPK cascade Figure 4.2 Deletion of srb10 elevates diploid pseudohyphal growth in a STE-MAPK dependent manner Figure 4.3 Ste12 is phosphorylated by Srb10 in vitro Figure 4.4 Srb10 is required for production of Ste12 phosphopeptides 3 and 4 in vivo Figure 4.5 Predicted mobilities of tryptic phosphopeptides contained in Ste12 216-473 Figure 4.6 Ste12 S261 and S451 are SRB10 dependent phosphorylation sites Figure 4.7 Srb10 phosphorylates S261 and S451 in vitro Figure 4.8 Phosphorylation of Ste12 S261/S451 is dependent on fermentable carbon Figure 4.9 S261A and S451A alleles elevate pseudohyphal growth and FRE dependent transcription Figure 4.10 Ste12 S261 and S451 do not regulate pheromone response or PRE dependent transcription Figure 4.11 Srb10 phosphorylation does not regulate Ste12 DNA binding in vivo Figure 5.1 Stability of Ste12 is controlled by Srb10 Figure 5.2 Ste12 expression is low in diploids Figure 5.3 Ste12 degradation requires the SCF ubiquitin ligase complex Figure 5.4 K463R mutation elevates filamentous growth Figure 5.5 Lysine 463 is necessary for Ste12 degradation Figure 5.6 Mutation of lysine 463 to arginine does not affect Srb10 phosphorylation of Ste12 Figure 5.7 K463R does not affect pheromone response, but has differential effects on Ste12 dependent transcription Figure 6.1 The model for Srb10 regulation of transcription factors  6 9 21 32 46 55 76 79 83 85 88 91 97 100 104 107 111 114 116 119 123 125 129 133 136 139 142 145 148 151 155  List of Tables Table 1: Components of Mediator and its Sub-Modules Table 2. Plasmids Table 3. Oligonucleotides Table 4. Yeast Strains Table 5. Predicted tryptic phosphopeptide mobilities of Ste12 (216-473)*  49 60 61 62 110  List of Abbreviations A aa ATP p-Me Bp BSA cAMP cdc CDK CTD CTP dATP DBD dCTP DEPC dGTP DMSO DNA dNTP DTT  absorbance amino acid adenosine triphosphate beta-mercaptoethanol base pair bovine serum albumin cyclic adenosine monophosphate cell division cycle cyclin dependent kinase carboxyl-terminal domain cytosine triphosphate 2'-deoxyadenosine triphosphate DNA binding domain 2'-deoxycytosine triphosphate diethylpyrocarbonate 2'-deoxyguanosine triphosphate dimethylsulfoxide deoxyribonucleic acid 2'-deoxynucleoside triphosphate dithiothreitol  ECL EDTA ERK FRE GAP GDP GTP h HOG IPTG kb kD LTR MAPK MEK MEKK min MOI MOPS MW NP-40 OD  enhanced chemiluminescence (Amersh ethylenediaminetetraacetic acid extra-cellular regulated kinase filamentous response element GTPase activating protein guanosine diphosphate guanosine triphosphate hour high-osmolarity glycerol isopropyl p-D-thiogalacto-pyranoside kilobase kilodalton long terminal repeat mitogen activated protein kinase MAPK/ERK kinase MEK kinase minute multiplicity of infection 4-morpholinpropanesulfonic acid molecular weight Nonidet P-40 optical density  E.  coli  Escherichia  coli  ONPG PAGE PAK PBS PCR PDM PKA PMSF Pol II PRE RIPA RNA  S. S.  SCF SDS sec SLAD SSC Ste TAF TBP TBS TBS-T TCA TE Tris Ts TTP U UAS UV YNB  aureus cerevisiae  ortho-nitrophenylgalactoside polyacrylamide gel electrophoresis p-21 activated kinase phosphate buffered saline polymerase chain reaction phosphate depleted media protein kinase A phenyl methyl sulfonyl fluoride RNA polymerase II pheromone response element radio-label immunoprecipitation assay ribonucleic acid  Staphylococcus Saccharomyces  aureus cerevisiae  Skp1-Cdc34-Fbox sodium dodecylsulfate second synthetic low-ammonium with dextrose standard saline citrate sterile TBP-associated factor TATA-binding protein Tris-buffered saline Tris-buffered saline-Tween20 trichloroacetic acid Tris-EDTA Tris(hydroxymethylamino)methane temperature sensitive thymidine triphosphate units upstream activating sequence ultraviolet yeast nitrogen base  Nomenclature Wild-type alleles in Saccharomyces cerevisiae are represented by italicized capital letters (e.g. STE12), while mutant recessive alleles are denoted in lower case italics (e.g. ste12). (e.g. Ste12).  Gene products are written with the first letter capitalized  Acknowledgements Extending thanks here to those who made my experience at UBC memorable seems like hackneyed gesture, but without each of your influences, I would not be leaving with the perspective I have. Foremost I thank Dr. Ivan Sadowski for providing both opportunity to study with him and the freedom to work somewhat independently. Thanks. Also, I appreciate advice and comments from my committee members Dr. Jim Kronstad and Dr. Natalie Strynadka. Thanks to my mother. You taught me well, and I am grateful for your encouragement and perpetual support. Friends made in the lab and department were critical to maintenance of sanity. Lab members could always be counted on for drama. Thanks, good luck with that. The geriatrics (JRR, JMH, GUS, and Dude) led by example, and their traditions are alive today - thanks for advice at the bench, and on the outside. I nod and gesture to Tom(ace), Cameron, Derek, and Martin. We saw Vancouver from an alternate reality. Big fish - you owe me a B-day present. LHPCC and the 2526 Brew-house literally made the last years here worthwhile. And to all: the unexpected will take you to extremes. For example a scallop hit me when I least expected it. Now I can't get it out of my head... •.  xii  Thesis Format This thesis has been written in chapter format where each of the three research chapters describe experiments that have either been published in peer reviewed journals (Chapters 3 and 4) or form the basis of a manuscript in preparation (Chapter 5). The work in Chapter 3 resulted in a co-first author publication in  Molecular and Cellular Biology, and experiments in Chapter 4 were the basis of a first author paper published in Nature. The data in Chapter 5 will be submitted for publication with the results of experiments currently in progress.  xiii  Introduction  Chapter 1 Introduction 1.1  Yeast differentiation as a model for signal transduction  Eukaryotic cells proliferate in diverse environmental conditions by sensing and adapting to a plethora of stimuli. For non-motile unicellular organisms, like the yeasts, the ability to monitor, and adjust to various conditions is critical for survival. Of particular importance to such organisms is the immediate availability of the essential organic molecules. The study of nutrient-induced adaptive growth in Saccharomyces  cerevisiae has led to the discovery of multiple  signaling cascades which ultimately modulate the gene expression to permit proliferation in an otherwise limited supply of nutrients (155).  The yeasts have established a hierarchy for sources of a given nutrient. For example, glucose is the most abundant sugar found in nature, and is also the preferred carbon and energy source for yeast. Other sugars are not metabolized when glucose is present, and accordingly, the genes required for utilization of alternate carbon sources, such as sucrose or galactose are actively repressed when glucose is detectable (23, 85). Similarly, yeast will not catabolize inferior nitrogen sources such as proline or urea when ammonium ions are present in the growth media (85). Thus sensing mechanisms exist to monitor the presence, and quality of nutrients in the environment.  1  Introduction Several signal transduction pathways are sensitive to nutrient availability, and these information networks function to amplify, and integrate or disseminate signals. To survive with poorer substrates, a cell needs to drastically modify multiple programs. This information is relayed to multiple targets to coordinate a survival response. Signals reach transcription factors in the nucleus to tailor gene expression to the particular needs of the cell, cell wall components are reorganized to facilitate attachment to surfaces, translation rates are slowed, cell cycle delays are exaggerated in accord with slower metabolism, and transposon retrotransposition is induced to create genetic diversity in the clonal populous (140).  Saccharomyces cerevisiae isolated from the wild are primarily diploid (141, 142). After exhausting available carbon and nitrogen sources, a diploid will undergo meiosis and sporulate to generate four haploid spores contained in a fortified protein rich ascus. These spores are extremely rugged and can endure indefinite incubation without nutrients, and germination only occurs when sufficient nutrients are present.  Because meiosis generates two pairs of  haploids of opposite mating type, germination in the wild is frequently followed by mating to restore the diploid state.  If a yeast cell is deprived of only nitrogen a different outcome is observed. With ample carbon and energy, the diploid yeast cell will scout the vicinity for a more suitable substrate, catabolizing intracellular macromolecules to provide  2  Introduction nitrogen in the interim (174). How does a cell ascertain what lies beyond the immediate area without motility? Alteration of budding pattern, cell-cycle delays, and growing in a polarized fashion dramatically reshapes single cells, and resultant colonies. Instead of growing in an ovoid form, with a bipolar budding pattern (as is observed in rich media), nitrogen starved diploids grow in elongated chains.  Mother and daughter cells do not separate and long  projections, comprised of multiple cells, emerge from the initial site of colonization.  Haploid yeast undergo a similar morphological transition in response to depletion of fermentable carbon (44). Termed haploid invasive growth, because of noticeable agar penetration, this phenomenon is closely related to the pseudohyphal response because many of the genes required for one process are also required for the other. Invasively growing haploids also grow in chains, remain attached after completion of mitosis, and form projections to forage. Precisely why the absence of different nutrients elicits the same response in two cell types remains an unanswered question in the field, but both cell types possess the ability to forage for nutrients.  1.2  Pathogenic fungi  The ability to alter morphology in response to external stimuli is not unique to baker's yeast. The opportunistic fungal pathogen Candida albicans also can grow as filamentous forms, and it is these isolates that cause disease in 3  Introduction immunocompromised individuals (123, 127). The pathogenic fungi Cryptococcus  neoformans and  also adopts filamentous forms in response to environmental signals, although this morphology is not required for pathogenesis perse  (127),  filamentous differentiation may be involved in dissemination of infectious particles in the environment (219). Furthermore, the MAPK and cAMP signal transduction pathways which are essential for filamentous growth in Saccharomyces  cerevisiae also control dimorphism in Candida and Cryptococcus (17, 123). 1.3  Multiple signals regulate differentiation  At least 4 separate signaling pathways are involved in controlling  filamentous growth in Saccharomyces  cerevisiae  and the conservation of these  signal transduction modules in pathogenic fungi and man underscores the importance of the information provided by studies in Saccharomyces.  The  RAS-cAMP pathway was the first signaling pathway shown to control  development in yeast (67). Later, the pheromone response MAPK cascade was implicated in the same response (120), and this was the first report of a function for this pathway in diploid yeast. Recent work on the TOR kinases, which sense nutrient quality and disseminate information to transcription and translation factors, suggest they may also regulate the transition to filamentous growth (45). Finally, the Snf1 protein kinase which participates in the glucose sensing pathway, may be involved in regulating haploid invasive growth (44). Both the pheromone response MAPK pathway and glucose sensing pathway contain G protein-coupled receptors, and the TOR and cAMP systems have well known 4  Introduction homologues in man. Thus study of filamentous response in the genetically defined yeast Saccharomyces cerevisiae will further our understanding of how evolutionarily conserved eukaryotic signaling proteins function. This review will focus on the cAMP and MAPK pathways, and their role in the regulation of filamentous responsive transcription. The reader is referred to excellent reviews on TOR and glucose repression (23, 179).  1.4 1.4.1  Life cycle of the veast Saccharomyces cerevisiae Pheromone response  Saccharomyces cerevisiae can grow mitotically as either a haploid or diploid. Haploid cells of opposite mating type recognize mating partners by secreting peptide mating pheromones, which upon binding to cognate receptors, initiate a cascade of signaling events that prepare cells for fusion to generate a diploid cell (Figure 1.1).- A diploid cell will divide mitotically until carbon and nitrogen sources are depleted, when the cell undergoes meiosis to generate four haploid gametes in a process called sporulation. The four spores are contained in a rugged ascus, in which spores remain viable for extended periods of time. When growth conditions improve, haploid spores germinate, and the life cycle continues from the haploid state.  Both haploid and diploid yeast can undergo morphological transitions in response to limiting nutrients (Figure 1.1). Haploid yeast adopt an invasively growing 5  Introduction Figure 1.1 The life cycle of Saccharomyces cerevisiae Budding yeast exists in one of two haploid mating types, designated MATa (a), or MATa(a). Peptide pheromones secreted by mating partners stimulate cells Fmate forming a diploid a/a cell. Upon exhaustion of nitrogen and carbon sources, diploid cells undergo meiosis and sporulate, generating four spores protected in a rugged ascus.  When nutrients are available spores can  germinate, and haploid cells can grow mitotically until a mating partner is found. Starvation for fermentable carbon initiates invasive growth in haploids, while nitrogen limitation stimulates pseudohyphal growth in diploids. The Ste12 transcription factor regulates both processes; genes required for mating are controlled by Ste12 oligomers, while genes necessary filamentous growth are responsive to Ste12-Tec1 heteromeric complexes.  6  Introduction  Invasive Growth  7  Introduction  morphology when starved for fermentable carbon (44), while diploids undergo pseudohyphal growth in response to limiting nitrogen (67). The relatedness of these two transitions is apparent in the similarity of gene products required for both developmental programs, and the term filamentous growth refers to both invasive and pseudohyphal growth.  The mating of haploid cells and the  transition to filamentous growth require components of the pheromone response MAPK pathway, which ultimately activates the Ste12 transcription factor (81). Ste12 oligo- or multimers activate genes required for mating (61), while Ste12Tec1 heterodimers control expression of the filamentous growth program (131). Thus the pheromone response pathway regulates separate classes of genes in response to distinct stimuli in the same cell. Insight into how the pheromone response pathway responds to two separate stimuli, eliciting appropriate outputs will further understanding of how MAPK pathways function. 1.4.2 The pheromone response MAPK cascade. The mitogen activated protein kinase (MAPK) cascade is a highly conserved signaling module minimally comprised of three sequentially activated protein kinases. Utilized by all eukaryotes, it is an effective means of regulating numerous cellular processes in response to a variety of external stimuli (72, 185).  Saccharomyces cerevisiae has six MAPK cascades, four of which share a common protein kinase (72). The pheromone response pathway links a G protein coupled receptor for mating pheromone to multiple intercellular targets including transcription factors, the actin cytoskeleton, and cell cycle regulators. 8  Introduction Figure 1.2 The STE-MAPK Cascade The pheromone response pathway of the budding yeast Saccharomyces  cerevisiae is a prototypical MAPK cascade. Peptide pheromones activate the heterotrimeric G-protein coupled receptor, stimulating the Cdc42 GTPase, and the Ste20 PAK kinase. Subsequent sequential phosphorylations of the MAP kinase components Ste11, Ste7 and Fus3/Kss1 ultimately activate Ste12-Dig complexes, bound to pheromone response elements (PREs), inducing transcription of genes required for mating.  Components of the pheromone  response MAPK pathway below Ste20 (excluding Ste5), are required for both pheromone and filamentous response. Ste12-Tec1 hetero-dimers bind filamentous response elements (FREs) to activate genes necessary for filamentous response. Dig1 and Dig2 are direct negative regulators of STE12, the Kss1 and Fus3 MAPK have overlapping roles in filamentous and pheromone response (see text). As noted, the stimulus which activates the STE-MAPK during filamentation is not known.  9  Introduction  Mating Pheromone  Nutrient Limitation ?  Activation of mating genes  Activation of filamentation genes  10  Introduction Signal transduction proceeds via the Gp subunit of the heterotrimeric receptor, the Cdc42/42 GTPase, and the Ste20 PAK kinase before activating the three kinases of the MAPK cascade. The MEKK Stel 1, the MEK Ste7 and the MAPKs Fus3 and Kss1 are sequentially phosphorylated and the active MAPKs target effectors of pheromone response (Figure 1.2). 1.4.3 The pheromones and the G protein coupled pheromone receptors MATa and MATa haploid cells recognize each other by secreting peptide mating pheromones. MATa cells secrete a-factor, a 12 amino acid product of the MFA1  and M F A 2 genes that is a farnesylated and carboxymethylated peptide  (21, 52). Similarly, Mata cells express MFa2, producing a-factor, a diffusible 13 amino acid peptide (62). Each peptide is recognized by a cognate G-protein linked receptor on the surface of cells of the opposite mating type; MATa cells have an a-factor receptor (Ste2), a cells an a factor receptor (Ste3) (7). Pheromone receptors are classical serpentine or seven transmembrane receptors that are coupled to the heterotrimeric G-proteins via their third intracellular  loop (25).  Binding of peptide  pheromone, results in  hyperphosphorylation of the receptor (171, 231), and induces a conformational change that results in exchange of GDP for GTP on the G a subunit Gpa1, followed by dissociation of the lipid anchored Gpy subunits Ste4/Ste18 (115). The Gp subunit initiates downstream signal, as Gp contacts effectors of pheromone response (59, 91, 218, 234).  11  Introduction The carboxyl-terminal domain of the Ste2 pheromone receptor is the site of several phosphorylations (29) and ubiquitination (82), and these sequential modifications signal the protein for endocytosis and transport to the lysosome. Ste2 internalization is independent on G protein activation, but is accelerated upon ligand binding, and represents one of several mechanisms by which cells recover from extended pheromone exposure (92, 231).  Ste3, the a-factor  receptor, is also subject to constitutive ligand independent endocytosis that leads to destruction in the vacuole, but ligand presentation leads to Ste3 recycling (28).  1.4.4  Ste20, Cdc42/Cdc24  Ste20 is the founding member of the PAK (p21 activated kinase) family of protein kinases (167). Ste20 has a conserved C- terminal domain required for interaction with the Gf3 subunit Ste4 (117). Prior to pheromone exposure, Ste20 is found at the plasma membrane at sites of new growth and this localization is dependent on interaction with the conserved CRIB domain of the Rho-like GTPase Cdc42 (115, 143). Interaction of the released Gp subunit Ste4 with Ste20 is thought to recruit the Cdc42 bound pool of Ste20 into a complex with the scaffold protein Ste5, and the MEKK Ste11 as each of these signaling molecules is localized to the tip of the mating projection after pheromone stimulation (53).  Cdc24 is the guanine-nucleotide exchange factor for Cdc42. Shuttling of Cdc24 between the nucleus and cytoplasm is dependent on the Far1 protein (209), and the Msn5 nuclear transporter (12). In the absence of pheromone 12  <  Introduction stimulation, Cdc24-Far1 is localized to the nucleus. Pheromone treatment increases the rate of Far1 nuclear export, and Cdc24 is redistributed to the cytoplasm where it can activate Cdc42 (12, 150, 189). Ste4-Ste18-Far1-Cdc24Cdc42 are all localized to the tip of the mating projection in pheromone treated cells, suggesting this complex serves as a landmark for polarized growth. Consistent with this model, several factors involved in actin nucleation, including Bni1, Gic1 and Gic2, are also targets of Cdc42 (53).  1.4.5 The MEKK Ste11 Full activation of Ste11 requires relief of an amino terminal inhibitory domain (20, 198) and interaction with the Ste5 scaffold (see below).  In  unstimulated cells, the N-terminal inhibitory domain antagonizes the C-terminal kinase domain, and separate mechanisms can relieve this inhibition. The first mechanism involves Ste20, which directly phosphorylates S302, S306 and T307 of Stel 1 within the N terminus. These phosphorylation sites are conserved in MEKKs from other organisms suggesting this may represent a conserved mechanism for PAK regulation of MAPK signaling (50).  A second regulator of Ste11 is Ste50, a small SAM domain protein required for optimal Ste11 activity in pheromone response (225) and other pathways that utilize Ste11, including the high osmolarity-glycerol (HOG) (152, 164), and the invasive growth pathways (224). SAM domains are found in other signaling proteins including the tumor suppressor p53 (203), and structural 13  Introduction studies implicate this protein-protein interaction domain in dimerization (168). Because interaction of Ste50 with Ste11 is mediated by respective S A M domains, Ste50 may positively influence Ste11 activity by disrupting intermolecular Ste11 interaction.  1.4.6  Ste7  The only known substrate for Ste11 is the MEK Ste7(148, 235). Phosphorylation of conserved active site residues S359 and T363 is absolutely required for signal transmission, as mutation of these residues results in catalytically inactive Ste7, sterility of haploid yeast, and failure to undergo filamentous response (233).  Interaction of Ste7 with the Ste5 scaffold is  mediated by the C-terminal kinase domain (34, 90), while a MAPK docking site in the N-terminus binds either the Fus3 or Kss1 MAPK (4), which are activated by direct Ste7 phosphorylation of activation loop threonine and tyrosine residues (48). The MAPK docking site identified in Ste7 has since been identified in other signaling proteins known to associate with MAPKs (188).  1.4.7  Ste5  The Ste5 scaffold protein has been the subject of intense study in recent years. As its name implies, Ste5 is required for mating, but unlike the Ste11 and Ste7 kinases of the pheromone response pathway, Ste5 is not involved in the HOG, invasive growth, or newly described sterile vegetative growth pathway  14  Introduction (SVG) (54).  Ste5 tethers the three core kinases of the pheromone response  pathway into a large complex. Each kinase has a separate docking site (34, 137), and sedimentation studies suggest that all three kinases are simultaneously present in a large 350-500 kDa complex that harbors maximal Fus3 kinase activity (33). Sequestering the kinases of the pheromone response pathway may increase signaling efficiency by placing enzymes and substrates in close proximity, while insulating them from activation by other signals; effectively preventing cross-talk between pathways that utilize the same kinases (161).  Ste5 also regulates activation of the pheromone response pathway by controlling the distribution of the kinase components within the cell. In untreated cells, Ste5 shuttles between the cytoplasm and the nucleus (134).  Upon  pheromone stimulation, Ste5 nuclear export by Msn5 is increased, and only Ste5 molecules that have passed through the nucleus are capable of associating with Gp\ indicating that a nuclear modification licenses Ste5 molecules for a single mating event (134). Once recruited to the cell cortex, Ste5 interacts with Gp, Ste20, Cdc42 and Ste50 at the tip of the mating projection.  Here several  components of the pheromone response pathway, including the MAPK Fus3, can be localized in pheromone treated cells, and this spatial regulation is likely key to polarized growth and chemotaxis (53, 54). Exactly how the signal is transmitted to nuclear substrates is not well resolved, but the presence of active MAPKs within the nucleus minutes after stimulation indicated that their nuclear import is rapid (173, 183), and that separate pools of signaling molecules likely target  15  Introduction substrates in the cytoplasm and nucleus. Consistent with this hypothesis, a recent report suggests activated MAPKs alone, rather than cytoplasmically formed Ste5-MAPK complexes re-enter the nucleus (212).  1.4.8  Fus3andKss1  Fus3 and Kss1 are related MAPKs that were identified as regulators of mating. Fus3 was identified as a positive effector of the mating response (56), while Kss1 was cloned in a genetic screen for suppressors of pheromone induced growth arrest (42). Fus3 is pheromone inducible and only expressed in haploid cells, while Kss1 is actively transcribed in both haploid and diploid cells (16, 34, 132). Both MAPKs can stably associate with the Ste5 scaffold (34), and be activated by Ste7, but the relative proportion of each scaffold - M A P K complex  in vivo  is not known. Fus3 has numerous substrates located in both the nucleus and cytoplasm  including Ste5 (110), Ste11 (235), Ste7 (4, 20, 198), the Sst2 phosphatase (64), the a-factor receptor Ste3 (58), the CKI Far1 (57, 211), the transcription factor Ste12 (15, 57), as well as the Ste12 inhibitors Dig1 and Dig2 (38, 202). The ability of Kss1 to phosphorylate these substrates is less well studied (38), but there are clear differences in substrate specificity between the two kinases (15).  1.4.8.1  The imposter model; fact, fiction or wishful thinking.  16  Introduction Fus3 and Kss1 are protypical serine/threonine protein kinases that require activating-MEK phosphorylations for catalytic activity. Utilization of unactivatable alleles of these kinases has provided insight into their in vivo of either f u s 3 or k s s 1 does not lead to sterility, but k s s 1 fus3  function. Deletion double mutants  cannot mate or express pheromone inducible genes suggesting that the two MAPKs are functionally redundant for pheromone response. Surprisingly cells expressing the fus3(K42R)  allele are also sterile (133). Because the kinase  .inactive K42R allele of F U S 3  can interact with the MAPK module, but not  transmit a signal it was suggested that Fus3 was the major kinase responsible for mating.  Only when Fus3 was physically absent from the cell could Kss1  substitute as the pheromone response MAPK by acting as an i m p o s t e r (133). Recent studies have further refined the model for Fus3 and Kss1 function. Because the genome wide expression profiles of cells harboring the  fus3(K42R)  allele appear identical to wild-type cells, the imposter model cannot hold true for activation of Ste12 regulated pheromone responsive genes (15): each MAPK is equally competent for activating Ste12, and each MAPK is rapidly activated by phosphorylation in response to pheromone (15,183). It appears that since Fus3, but not Kss1,  can phosphorylate and activate Far1, substrate specificity may be  the only difference in activity of the two MAPKs (15, 16). It is possible that the imposter model may hold true in the cytoplasm, but since the dynamics of nuclear cytoplasmic shuttling of activated MAPKs is still unclear, nuclear substrates of the MAPKs may have a less stringent preference for MAPK activity.  17  1.4.8.2 fus3kss1  Introduction Kinase independent function: signal insulators.  strains are sterile (55, 128) and cannot induce P R E regulated  transcription (15, 173), but exhibit elevated transcription from FREs (6). Thus MAPKs cause inhibition Ste12-Tec1 complexes, and are required for pheromone induction of PREs.  Surprisingly, kinase activity is not required for MAPK  mediated inhibition. Unphosphorylatable alleles of Kss1 mimic inactive kinase, and constitutively inhibit Ste12 at FREs (5), and in wild type cells Kss1, in concert with Dig1, inhibits Ste12-Tec1 complexes (6). Ste7 phosphorylation on the Kss1 activation loop induces a conformational change that may cause dissociation of the ternary MAPK-Dig1 complex, and unmask the transactivation potential of Ste12-Tec1 (5). Conversely, activation of P R E regulated transcription requires MAPK activity, as introduction of kinase inactive alleles retards pheromone response. One explanation for this observation is that the Dig1/2 proteins have a higher affinity for Ste12-Ste12 complexes than Ste12-Tec1 (6).  Together these  observations demonstrate that the MAPKs of the pheromone response pathway participate in the inhibition and activation of transcription.  In their  unphosphorylated and inactive state they inhibit Ste12, and upon Ste7 dependent activation they are converted from inhibitors to activators of Ste12 containing complexes. 1.4.9  Fart and pheromone induced cell cycle arrest. FAR1  was isolated as a mutant that was resistant to pheromone induced  cell cycle arrest. Before a pair of haploid yeast fuse to form a diploid, they ensure 18  Introduction that their cell cycles are synchronized by expressing the CDK inhibitor (CKI) Far1. FAR  1 expression is pheromone inducible, and it must be phosphorylated  by the Fus3 MAPK to have full activity. Far1 is constitutively degraded by S C F activity, and it is now known that Fus3 phosphorylation stabilizes Far1 (77). Far1 causes a transient cell cycle arrest at G1/S by interacting with and inhibiting Cdc28/Cln complexes. This mechanism ensures that each mating partner only contributes one copy of the genome to the newly generated diploid cell. Far1 also regulates mating by sequestering signaling molecules. By shuttling between the nucleus and cytoplasm, Far1 controls the localization of associated Cdc24 (48).  1.5 1.5.1  Ste12 and its regulators. Ste12 Domain Structure  Ste12 is a 688 amino acid site specific transcription factor required for transcription of approximately 200 genes induced by mating pheromone (15, 173). The DNA binding domain (DBD), has homology to a homeodomain (229), and is contained within the N terminal 215 amino acids, with residues 40-195 comprising the minimal DBD. Deletion of this region abolishes DNA binding of Ste12 in vivo  and recombinant Ste12 (1-215) is capable of binding to pheromone  response elements in EMSA experiments (229). Replacing the Ste12 DBD with that of Gal4 renders the GAL genes pheromone inducible (194), demonstrating that residues C-terminal of the DBD activate transcription in response to pheromone. The central activation domain is high in serine, threonine and proline 19  Introduction residues and is the site of at least 6 phosphorylations in vivo  (see below), while  residues 474-688 are involved in auto-regulation as well as interaction with Mcm1 (101).  20  Introduction Figure 1.3 Domain structure of Ste12 Ste12 is a 688 amino acid protein. Contained in the N terminus is the homeodomain-like DNA binding domain. The central third of Ste12 contains the transcriptional activation domain and is the site of 6 phosphorylations, two of which were previously mapped to S226 and S261. T525 and an unknown phosphorylation site reside in the C terminus of the protein (88), which is required for interaction with the Mcm1 transcription factor. As shown, Ste12 interacts with multiple regulatory factors, including the MAPKs Fus3 and Kss1, and the negative regulators Dig1, and Dig2.  21  Introduction  22  Introduction  1.5.2  Ste12 DNA binding properties  Pheromone inducible promoters harbor a conserved 7 bp sequence called a pheromone response element (PRE) whose consensus is 5' TGAAACA 3' (111). The P R E is both necessary and sufficient for pheromone responsive induction of downstream genes, as a heterologous reporter can be made pheromone inducible by inserting copies of this sequence into a basal promoter (74). Conversely, mutation of this sequence abolishes basal transcription and pheromone inducibility of Ste12 regulated genes. PREs tend to be grouped in clusters, and recombinant Ste12 DBD (1-215) has greater affinity for paired PREs in vitro  (229). Orientation of PREs does not appear to affect pheromone  inducibility of a synthetic reporter, and examples of both head-to-head and headto-tail orientations are found in vivo  1.5.3  (229).  DNA binding partners  Ste12 positively regulates the expression of several classes of genes, and heteromeric complexes between Ste12 and other DNA binding partners provides signaling specificity. Pheromone inducible genes can be grouped into three subclasses based on the cell types in which they are expressed. Genes expressed in both mating types are regulated by Ste12 oligomeric complexes which bind to clusters of PREs (49). Receptors and mating factors are cell type specific and are regulated by unique Ste12 containing complexes. The apheromone receptor STE2, the alpha factor precursor MFA1, and the alpha 23  Introduction factor protease B A R 1  are examples of a - s p e c i f i c genes as their expression is  limited to a-cells, while conversely, the a-factor receptor (STE3), encoding gene MF(ct)1  are a-specific  the alpha factor  genes. Haploid specific genes utilized for  haploid mating type are generally not expressed in a diploid cell. Examples of such genes are the MAPK F U S 3 and the G-protein p and y subunits encoded by  the  STE4  and S T E W  genes. The remainder of the pheromone response  pathway is expressed in diploid cells and regulates filamentous/pseudohyphal growth.  Pheromone responsive expression of a-specific genes is regulated by Ste12-Mcm1 heteromeric complexes that bind cooperatively to adjacent P R E and P-box elements (144, 187), while a trimeric complex of Ste12-Mcm1-Mata2 proteins activate alpha specific genes in response to pheromone by recognizing a different sequence element (187, 230). Surprisingly Ste12 does not actually contact DNA directly in this complex as PREs are not required for formation, and activity of this complex. Finally, expression of a small subset of Ste12-dependent genes involved in karyogamy requires the transcription factor Kar4. Because Kar4 expression is itself Ste12 dependent, it is not clear if a Ste12-Kar4 heteromer exists (113).  Ste12 also participates in the regulation of genes required for filamentous growth of diploid and haploid yeast. These genes are regulated by Ste12-Tec1 complexes that bind to filamentous response elements (FREs) within the  24  Introduction promoters of several genes in vivo  (131). FREs are loosely defined as a PRE in  close proximity to a T e d binding site 5' CATTCT 3' (TCS, or Tea-Atts consensus sequence), and because the spacing requirements between these elements is variable, it is impossible to gauge the total number of F R E s in the  Saccharomyces cerevisiae genome. More importantly, the observation that T e d may be able to regulate transcription independently of Ste12 suggests that the FRE may not be the only means by which the STE-MAPK cascade can influence filamentous responsive transcription (105). Regardless of sequence elements involved, a recent study identified 57 genes co-regulated by Ste12 and T e d under conditions of butanol treatment (232). 1.5.4  Ste12 is heavily phosphorylated  Tryptic phosphopeptide analysis indicates that Ste12 is multiply phosphorylated.  When transiently overexpressed, 8 phosphopeptides are  detectable, and pheromone treatment results in the appearance of two MAPK dependent phosphorylations (89). The central activation domain of the Ste12 protein, defined as amino acid residues 216-473, contains 6 of 8 basal phosphorylations, two of which have been identified as Serine 226 (S226) and 261 (S261) (88). Phosphorylation of S226 is dependent on Cdc28 activity, and appears to stimulate Ste12 proteolysis, while the kinase for, and function of, S261 was previously unknown. A third Ste12 phosphorylation was mapped to threonine 525 (T525), and the phenotype of a T525A substitution is subtle. Strains harboring this allele exhibit marginally elevated mating efficiency (88).  25  Introduction Multiple studies of Ste12 phosphorylation indicate that Fus3 and Kss1 can phosphorylate Ste12 (15, 38, 57, 89, 194), but the consequences of these modifications are not well studied because the sites of phosphorylation are not known. Furthermore, the possibility of other kinases modulating the activity of Ste12 is an essentially unexplored facet of pheromone and filamentous response.  1.5.5  The Dig proteins  The Dig/Rst proteins were identified in separate two hybrid screens, using Kss1 (38) and Cln1 (202) as baits. Dig1/Rst1 and Dig2/Rst2 (hereto referred to as Dig1 and Dig2) share 45% similarity, and both interact with the MAPKs Fus3 and Kss1. The Digs also interact directly with Ste12 and inhibit activation in the absence of pheromone signal (154,163, 202). Deletion of either dig has modest effects, but removal of both dig genes causes hyperfilamentous growth (38, 202), and unrestrained expression of the majority of Ste12 responsive genes (15,173). Upon pheromone stimulation, Dig mediated inhibition of Ste12 is relieved, and pheromone responsive genes are induced (173). This derepression requires catalytically active Fus3 or Kss1, suggesting that phosphorylation of Dig1, Dig2 and/or Ste12 is a prerequisite for transcriptional induction (173).  MAPK  dependent phosphorylations on Ste12 are detectable after pheromone exposure (89), but the identity of the phosphorylations have not been determined. Likewise Fus3 and Kss1 immune complexes are capable of phosphorylating Dig1 and Dig2 in vitro  but these phosphorylation sites have not been mapped (38, 202). 26  Introduction  1.6  Filamentous growth  In response to the stress of nutrient deprivation Saccharomyces cerevisiae adopts a filamentous morphology to direct growth towards a gradient of nutrient. As described above, carbon and nitrogen sources are the stimulus for this behavior in haploid and diploid cells, respectively (44, 67). In accord with the importance of nutrient sensing and adaptive growth, multiple signaling pathways have been shown to affect this simple developmental transition (155).  1.6.1  Requirement of the MAPK cascade  The mating pheromone response pathway (described above) is the founding member of the MAPK cascade family. Components of this pathway are also essential for pseudohyphal growth of diploids and invasive growth of haploids.  Kinases downstream of Ste20 and the transcription factor Ste12  participate in activation of filamentous response genes while receptors and G proteins are dispensable for pseudohyphal growth (120).  1.6.2  Ste12-Tec1 heterodimers activate transcription from FREs  The Ste12 transcription factor forms heteromeric complexes with other DNA binding proteins to control expression of several different classes of genes.  PGU1, FL011, Ty1, KSS1 and YLR042C are representatives of a larger class of genes whose expression is dependent on STE12, and is induced by nutrient 27  Introduction limitation (132) or the constitutively active STE11-4 allele (173). The majority of these promoters harbor a conserved element which mediates MAPK responsive transcription. Termed the FRE (filamentous response element), this sequence is comprised of a single PRE (TGAAACA) in close proximity to a T e d binding site (CATTCT), and Ste12-Tec1 heterodimers recognize this element in vivo  and i n  vrtro (131). Promoters bound by Ste12-Tec1 can be divided into two groups based on the transience of transcription factor occupancy. Ste12 is bound to 38 promoters in the absence of stimulus and upon treatment of liquid cultures with butanol, which causes an effect that mimics filamentous growth, both Ste12 and T e d associate with 57 promoters involved in cell cycle regulation, polarized growth, and signal transduction (232). This response is specific to filamentous response, as treatment of the same cells with mating pheromone results in accumulation of Ste12 at a different set of promoters, namely genes involved in mating (170).  1.6.3 cAMP regulates filamentous growth independently of the STEMAPK cascade Filamentous growth is modulated by multiple signals in budding yeast, and the two best characterized effector pathways are the STE-MAPK, discussed above, and the protein kinase A (PKA) pathway, which is intimately coupled to intracellular levels of the second messenger, cAMP (155). Because the F L 0 1 1 gene is required for both haploid invasive growth, and diploid pseudohyphal development, it has become the hallmark reporter for filamentous responsive transcription (63, 124). The promoter of F L 0 1 1 is large. Spanning nearly 4000 28  Introduction bp, it contains, in various multiplicities, binding sites for positive and negative regulators of filamentous responsive transcription including Ste12, T e d ,  F I 0 8 ,  SfM, Phd1, Ash1 and likely other uncharacterized factors (182). Removal of transcription factor binding sites (182), or analysis of ste12,  t e d , flo8  strains  (102, 124, 158) demonstrated the signals from both the STE-MAPK and cAMP pathway could independently activate F L 0 1 1 transcription. In this regard the promoter harbors several "switches" which can independently recruit the RNA polymerase II holoenzyme to activate transcription, making this regulon a particularly good example of how promoters in higher eukaryotes function as platforms responsive to multiple signals.  1.6.3.1  Control of cAMP levels  Intracellular cAMP levels are a function of two antagonizing activities. Adenylate cyclase, encoded by the CYR1 gene, converts ATP to cAMP, while the phosphodiesterases Pde1 and Pde2 reduce intracellular cAMP levels (46). At least three pathways activate Cyr1. Extracellular fermentable carbon is detected by the G protein coupled receptor Gpr1, and together with the Gcx subunit Gpa1 stimulates adenylate cyclase activity (46).  Intracellular^,  hexokinase activity also stimulates Cyr1. Although the details of this mechanism remain unclear, it appears that monitoring glucose-6-phosphate levels ensures that uptake and metabolism of available energy sources is adequate (9, 181). The Ras small GTPases, whose activity has long been known to coordinate cell growth with nutrient availability, also positively affect cAMP through Cyr1.  29  Introduction Neither R A S 1 nor R A S 2 is essential, but r a s 1 r a s 2 mutants are inviable. Since this lethality is rescued when C Y R 1 is overproduced (96, 201, 208), and hyperactive Ras alleles elevate cAMP levels (96), it is clear that PKA activity is tightly coupled to Ras. PKA  activity is not sustained indefinitely after addition of fermentable  carbon, and a negative feedback loop returns cAMP levels to near basal levels (22, 36, 151).  This is likely accomplished through  activation  of  phosphodiesterase activity. Although activation of Pde1-2 by cAMP has not been formally demonstrated, Pde1 does contain a P K A consensus phosphorylation site, phosphorylation of Pde1 increases its activity in crude extracts, and p d e l strains have elevated levels of cAMP (130).  1.6.3.2  Budding yeast has three PKA genes  There are three catalytic subunits of PKA in budding yeast, and each is inhibited by the Bcy1 regulatory subunit. Upon binding cAMP, Bcy1 dissociates from either Tpk1,  Tpk2 or Tpk3, liberating active kinase (206, 207). Unlike their  requirement for vegetative growth, where any of the three Tpks can support growth (207), the role of PKA in filamentous growth is complicated. Tpk2 promotes filamentation, while Tpk3 inhibits it (157, 176). The role of Tpk1 is less clear as one group has reported no effect of t p k l deletions (176), while another observes a phenotype similar to tpk3  alleles, implicating Tpk1 as an inhibitor of  filamentous development (157).  30  Introduction  1.6.3.3  Targets of PKA  regulate filamentous growth  A handful of transcription factors interact with and are regulated by the Tpks, but to date the list of genes regulated by them is short. Sfl1 is a DNA binding protein that recruits the Ssn6-Tup1 repressor to the F L 0 1 1 promoter (37, 176).  Tpk2, but not Tpk1 or Tpk3, interacts with SfM in a two hybrid system,  suggesting that Tpk2 could activate some genes by alleviating their repression (176). The best characterized transcription factor that is activated by PKA and cAMP is Flo8. The F L 0 8 gene in strains of the W303 and S288C lineages, contains a non-functional allele with a single point mutation that creates a premature stop codon, which partially explains the hypofilamentous morphology of these strains (121). Known to bind to several filamentation genes, and act independently of the pheromone response MAPK signal (157, 182), this transactivator is also essential for Tpk2 regulation of F L 0 1 1 transcription (102). Flo8 has several putative PKA a b o n a fide  dependent phosphorylation sites, but whether it is  substrate for any of the Tpks remains to be tested. The stress  induced transcription factors Msn2 and Msn4 (13, 193) as well as the Rim15 kinase (169), a regulator of meiotic gene expression, are also recently identified targets of PKA, but genetic studies indicate that they do not play a role in filamentous response (157).  31  Introduction Figure 1.4 The cAMP-PKA pathway regulates filamentous growth Expression of filamentous response genes, like F L 0 1 1 are positively regulated by intracellular levels of cAMP. The glucose sensor Gpr1 and the Gpa1 Gprotein sense glucose levels outside the cell and stimulate the activity of adenylate cyclase (AC), which converts ATP to cAMP. Hexokinase also activates AC when glucose-6-phosphate is detected within the cell. Three PKA catalytic subunits TPK1-3 are each negatively regulated by Bcy1, and this inhibition is relieved when cAMP-Bcyl complex is formed. Tpk2 positively regulates filamentous response genes, while Tpk1 and Tpk3 exert a negative effect. A negative feedback loop, utilizing Tpk1/3 and the phosphodiesterases Pde1/2 return cAMP levels to basal levels. Figure adapted from D'Souza and Heitman, 2001.  32  Introduction  glucose  Carbon utilization  I FL011  filamentous growth  33  Introduction  1.7  Transcription bv the RNA Polymerase II Holoenzyme  The first eukaryotic RNA polymerase enzymes were purified based on their ability to transcribe a ribonucleotide copy of calf thymus DNA template (178). However, because this first form of the enzyme was incomplete, it did not respond to activators in vivo.  A collection of associated general transcription  factors were later identified biochemically as activities that restore sequence selective transcription to RNA polymerases in vitro  (75, 177). Further  components of the giant holoenzyme complex are still being identified, and despite over 40 years of work, the study of how eukaryotic protein coding genes are transcribed is still a highly active field of biochemistry, with many pressing questions remaining unanswered.  1994 brought a paradigm shift to the field as the step-wise assembly model of transcriptional initiation was challenged. Isolation of a large 2 megadalton complex, containing the core polymerase and most GTFs spawned the "holoenzyme" model of transcriptional activation (106, 107). Simply put, Young and co-workers showed that the entire machinery for catalyzing synthesis of a messenger RNA could exist as a preformed complex; a corollary is that activators could activate transcription by contacting any component of this giant apparatus.  34  Introduction 1.7.1  Promoter architecture  The basic eukaryotic promoter can be defined as the core promoter, containing a transcriptional initiation site and a TATA box, plus sequence elements that are bound by activators and repressors of transcription. The TATA binding protein (TBP) binds to the TATA box which is located approximately 40120 Bp upstream of the transcriptional start site in yeast (25-30 Bp in higher eukaryotes) (199). Some sites of initiation include an element called the initiator, (Inr) which overlaps the transcriptional start site, and binds regulatory factors (192). Other regulatory elements are comprised of upstream activating sequences (UASs), enhancers, upstream repression sequences (URSs), and silencers. UASs and enhancers are both bound by activator proteins. Typically, UASs function locally, usually within 1-2 kb of the start site (199), while enhancers are capable of exerting an effect on transcription from as far away as 85 kb (11). URSs and silencers impose a negative influence on transcription. Factors that occlude activators, prevent holoenzyme recruitment or procession, and modify Ideal chromatin structure are found to associate with these elements (136). URSs tend to control dynamic regulons, like the GAL and SUC genes of budding yeast (23), while silencers typically exert a sustained effect (153). Silencers can repress transcription in a position and distance independent manner, and are thought to work by recruiting activities that catalyze formation of repressive chromatin. The silent mating type locus, and some telomeric loci are examples of silenced DNA in Saccharomyces cerevisiae (65). 35  Introduction 1.7.2 Chromatin and its modifications 1.7.2.1 The histone proteins, nucleosomes, and higher order chromatin structure Consistent with their fundamental importance, the histones are among the most conserved proteins in eukaryotes. A comprehensive review of histone biology is beyond the scope of this thesis, but excellent reviews and current perspectives in the field can be found elsewhere (108, 236).  Briefly, a  nucleosome is made up of two H2A/H2B, and two H3/H4 heterodimers. Interaction with DNA is mediated by contacts between the charged phosphodiester backbone and histones, although interaction  between  deoxyribose epitopes and histones are also observed (125). Adjacent histones interact via contacts between histone amino termini which protrude from the nucleosome core, and these tails are the sites of numerous, functionally important post-translation modifications (see below). Finally histone H1, the linker histone, secures the nucleosome structure together (108,125,126).  1.7.2.2  Modification-free chromatin remodeling  Accessibility of promoters is compromised by compaction of DNA into chromatin, and several protein machines control formation and unfolding of higher order chromatin (19).  In yeast several ATP dependent chromatin  remodeling activities have been described including SWI/SNF, RSC, ISW1, and ISW2 (215). These multiprotein complexes contain from two (ISW2) to 17 (RSC) components, and target various genes in vivo  (116). The best studied complex is 36  Introduction SWI/SNF; the components of which were identified as factors affecting mating type switching (SW/j(197) and SUC2 expression (SNF)(147)  . SWI2/SNF2 are  encoded by the same gene, which possesses ATPase activity. Because deletion of s w i 2  causes increased transcription of some genes and decreased  transcription of others (200), it is thought that SWI/SNF may simply increase plasticity of chromatin structure, and not always be associated with derepression. RSC is similar to SWI/SNF but is essential for growth, and obviously regulates a distinct subset of genes (138). The ISW1 and ISW2 complexes are less well characterized, and recently the ISW1 ATPase was shown to be required for activity of two separable activities termed ISW1a and ISW1b (213). Because these complexes have overlapping and distinct targets, and exhibit distinguishable phenotypes, it appears that the family of chromatin remodeling activities is diverse, and suggests that the eukaryotic cell may employ multiple closely related machines to modulate the architecture of distinct gene promoters (213).  1.7.2.3  Histone acetylation  Attachment of acetyl groups to lysine e amino groups of histone tails is catalyzed by histone acetyl transferases (HATs), and their removal is dependent on histone deacetylases (HDACs) (112, 118). There is excellent correlation between histone acetylation, chromatin relaxation, and transcriptional activity, and recent experiments have provided examples of HAT activity preparing templates for GTFs, and mediator (10, 41, 114). Reciprocally, numerous 37  Introduction repressors work by recruiting HDAC activity (8, 76, 217). Histone modifications affect transcription by separate mechanisms. In theory, acetylation of histone tails neutralizes a positive charge and should reduce nucleosome-DNA affinity, loosening ordered structures at promoters and facilitating access to other regulatory factors (71). However acetylation can also directly modulate interaction with specific transcription factors (221). HAT activity is found in several multi-protein complexes whose components were previously identified as regulators of transcription (116). The yeast HAT Gcn5, a homologue of the Tetrahymena p55 protein, is present in at least two biochemically distinct complexes. One of these is S A G A (Spt-AdaGcn5-Acetylase), which shares components with the GTF TFIID (70). SAGA interacts directly with a growing family of activation domains, including those of yeast Gal4 (10, 114) and Swi5 (41), and this interaction with DNA bound regulatory proteins can facilitate increased acetylation of promoter bound nucleosomes. The literature describing details of histone acetylation is vast, and several comprehensive reviews of HAT and HDAC complexes in Saccharomyces  cerevisiae are available (71,112, 126, 221). 1.7.2.4  Other post-translational modifications of histones.  In addition to acetylation, histones are substrates for multiple posttranslational modifications including phosphorylation, methylation, sumosylation and ubiquitination (47, 196). To add complexity, multiple sites have been identified for most covalent additions. Such combinatorial controls should not be  38  Introduction surprising considering the role of histones in template assembly, mitosis, transcription, and replication.  1.7.3 The yeast RNA Pol II holoenzyme 1.7.3.1  The core RNA polymerase  The core RNA polymerase is comprised of 12 essential subunits (Rpb112) in yeast and man. These subunits are evolutionarily conserved as most of the corresponding human genes can substitute for their yeast counterparts (222). When assayed in vitro  this core polymerase is capable of synthesizing an RNA  transcript from a DNA template, but is incapable of promoter recognition. The structure of RNA polymerase II has been solved, shedding light on the contributions of each subunit (43, 68). The two largest subunits, Rpb1 and Rpb2, form a cleft containing a magnesium ion and the active site. Rpb1/Rpb2 together with Rpb6 appear to form a sliding DNA clamp, while Rpb5/Rpb1/Rpb9 help to position down-stream DNA. Rpb3/Rpb10/Rpb11/Rpb12 form a subcomplex, as does Rpb4 and Rpb7. The latter is implicated in transcription initiation and stress response (32, 51, 223).  Interestingly, this dimer is  dissociable, and is present in sub-stoichiometric amounts when cells are grown in rich media, but under poor growth conditions, like stationary phase, there is balanced stoichiometry between Rpb4/Rpb7 and the rest of the core enzyme (32). A similar phenomena is observed in human cells, where there is tissue specific expression of Rpb4/Rpb7 (97).  39  Introduction 1.7.3.2  The RNA polymerase CTD  Rpb1, the largest subunit of the RNA polymerase II holoenzyme, contains an evolutionarily conserved carboxyl terminal domain (CTD) that consists of repeats of the heptapeptide Y S P T S P S . All species have this essential repeat, with yeast Rpb1 having 26 or 27 repeats, while humans have 52 (116). Truncation of the CTD in yeast results in a cold sensitive phenotype that was the basis of a genetic screen that identified the SRB proteins of the mediator subcomplex of the holoenzyme (204)(see below). The CTD serves as a docking site for accessory complexes, with phosphorylation controlling which factors interact with the holoenzyme (165). The hypo-phosphorylated CTD, termed IIA, is representative of polymerase molecules prior to transcription initiation, while heavily phosphorylated polymerases, termed MO are associated with elongating holoenzymes (172). CTD phosphorylation promotes exchange of cofactors, because association with mRNA capping activity (139, 186), and elongation factors (24) is dependent on phosphorylation . Reciprocally, the mediator complex, which regulates initiation, only interacts with unphosphorylated CTD containing holoenzymes (100). Taken together, these observations suggest that CTD phosphorylation is required for polymerase to advance from initiation to elongation. Three cyclin dependent kinases can phosphorylate the CTD, and each is found in initiation complexes. Cdk7/cyclinT are components of the TFIIH GTF, and are encoded by the KIN28/CCL1 genes in yeast (165). Catalytically inactive alleles of Kin28 exhibit defects in CTD phosphorylation in vivo  (135) and in  vitro  40  Introduction (205). Kin28 activity is essential (190), and temperature sensitive alleles display a complete loss of transcription of protein coding genes at the non-permissive temperature (86). The mediator complex also contains a CDK/cyclin pair, encoded by the  SRB10/SRB11 genes, which are the yeast versions of Cdk8/cyclinC. Although SrblO activity is dispensable for growth (107), s r b W strains do exhibit growth defects, and genome wide expression analysis implicates this CDK in negative regulation of a distinct subclass of genes involved in various stress responses (see  below). The yeast genes BUR1 and BUR2  less S U C 2  were identified as repressors of a UAS-  promoter (166). Burl and Bur2 form a CDK/cyclin pair that is  activated by Cak1 (145, 227, 228). Burl co-precipitates with Rpb1, and this complex can phosphorylate the CTD (145).  There is a genetic interaction  between BUR1/2 and the CTD, elongation factors, and the Fcp1 CTD phosphatase enforcing the claim that Burl is a b o n a fide  regulator of the CTD  (165). These observations and sequence alignments indicate that Burl may be the yeast homologue of P-TEFb (122). Only one phosphatase has been shown to have activity towards the CTD. Fcp1 from yeast and humans is stimulated by, and interacts with the GTF TFIIF (2). Addition of TFIIB inhibits this stimulation, suggesting that these three factors mediate polymerase recycling (31). Fcp1 is essential, and temperature sensitive f c p l mutants display broad transcriptional defects (2, 103).  41  Introduction 1.7.4  General transcription factors (GTFs)  The TFII subcomplexes were characterized as factors that are required for specific promoter binding of RNA polymerase II in vivo  (75). Despite the broad  application of the term "GTF" to factors A, B, D, E, F, and H, each complex has not been formally demonstrated to be required for transcription of all genes, and other factors may be as important for the process of transcription. 1.7.4.1  TBP and associated TAFs  The TATA binding protein (TBP), and TBP associated factors are known as TFIID. TBP recognizes the minor groove of DNA at the TATA box and this complex adopts a saddle-like structure that induces a sharp bend in DNA. This bend is accompanied by an unwinding of a short stretch of DNA that is likely critical for transcriptional initiation (27, 98, 99). The TAFs copurify with TBP, but are not involved in transcription at all promoters (18).  For example, TAFs are dispensable at TATA containing  promoters, but required for basal transcription from TATA-less promoters. Consistent with the differential role of the TAFs, they can both antagonize and stimulate TBP at different loci (116).  1.7.4.2 TFIIH TFIIH is the most complex of the GTFs, with three catalytic activities; a DNA-dependent ATPase, an ATP dependent helicase and a CTD kinase (35). Components of TFIIH can be separated into subcomplexes based on the presence or absence of the cyclin dependent kinase activity provided by the 42  Introduction Kin28/Ccl1 CDK/cyclin pair. TFIIH lacking this activity is referred to as the core. In addition to regulating transcription initiation, core TFIIH is also found in the nucleotide excision repair complex, which explains its requirement for transcription coupled DNA repair (1). The helicase activity of TFIIH is encoded by Rad3 and Rad25 in yeast, which correspond to the XPD/ERCC2 and X P B / E R C C 3 human genes (116). Like associated TFIIE, TFIIH has roles in template opening as its requirement in  vitro  is bypassed by premelting of DNA. Mutations in ERCC2 and ERCC3 are  linked to genetic disease in humans including xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy. Since XPB is primarily involved in transcription, while XPD participates mainly in nucleotide excision repair the cause of these diseases lie in both transcriptional and DNA repair defects (116). Kin28/Ccl1 are homologues of human CDK7/cyclinH, and this kinase activity primarily controls the phosphorylation state of the CTD (165). As described above, phosphorylation of the serines of this heptapeptide converts the RpblllA to RpblllO, initiating polymerase release and elongation, while stimulating the exchange of CTD associated accessory factors.  Cdk7 is essential for  transcription of protein coding genes, and viability, in all eukaryotes. Interestingly human Cdk7 regulates cell cycle progression as it has assumed CAK (CDK activating kinase) activity performed by yeast Cak1/Ccv1 (94). Additional substrates for Cdk7 have been described, including the yeast transcription factor Gal4 (83), but the in vivo  relevance of these modifications remains unresolved.  43  Introduction 1.7.4.3  Other associated complexes  The recycling of RNA polymerase II molecules is dependent on CTD phosphorylation, as progression from initiation to elongation to termination is controlled by CTD kinase and phosphatase activity (165). A corollary of this model is that there should be heterogeneity in RNA polymerase II holoenzymes in vivo.  Indeed several substoichiometric complexes are described as  polymerase associated. Factors involved in initiation, such as TBP and mediator, bind specifically to unphosphorylated CTDs, while activities mediating elongation mRNA capping, splicing, cleavage, and 3' end processing all require phosphorylated CTDs for holoenzyme interaction (165). As multiple sites of phosphorylation are inherently present in the CTD, and several kinases are capable of modifying the CTD, elucidating whether these complexes sequentially or simultaneously interact with the CTD will be complicated.  1.7.5 Mediator Mediator was first identified by separate groups in 1988 in yeast and mammalian cells (66, 100, 210). The recruitment model of how transcription factors function had been proposed, and in attempts to identify targets of transcriptional activators, Gill and Triezenberg separately performed titration experiments in which overproduction of one activator could decrease potency of another. Expecting that a component of assembling RNA polymerase or general transcription factor (GTF) was being sequestered, both groups attempted, and failed to identify the limiting factor by addition of known GTFs and polymerase  44  Introduction extract, and this factor was termed mediator, as it was thought to function between transactivator and the RNA polymerase II machine.  45  Introduction Figure 1.5 A typical eukaryotic promoter Transcription of eukaryotic protein coding genes is performed by the RNA polymerase II, which can be isolated as a large holoenzyme containing most of the TFII general transcription factors. The largest subunit of RNA polymerase II harbors a repetitive heptapeptide sequence termed the C-terminal domain (CTD) which is a docking site for numerous accessory complexes. CTD associated factors involved in initiation  of transcription  (Mediator)  interact with  unphosphorylated CTD, while elongation, splicing, termination and other complexes affiliated with post initiation events bind to the phosphorylated CTD (P). Transcriptional activators function by interacting with upstream activating sequences (UASs) and recruiting the holoenzyme, components of the initiation complex, chromatin remodeling machines (Swi/Snf), or histone acetyltransferases (HATs). Repressors bind upstream repression sequences (URSs) and recruit histone deacetylases, or antagonize positive effectors by other mechanisms. See text for details.  46  Introduction  Accessory Complexes  47  Introduction  Mediator is a 20-30 polypeptide complex (depending on purification scheme) that is essential for the transcription of most protein coding genes in yeast (100) (Table 1). Multiple screens in yeast identified several genes that were later found to encode mediator subunits. As their names suggest, several components were identified in more than one screen. Because these factors have both positive and negative effects on transcription, mediator is necessary * for both repression and activation of diverse sets of genes (146). Mediator has now been biochemically defined, and the structure of both yeast and human complexes solved. Fractionation of mediator has revealed several smaller subcomplexes,  whose  composition  has been  confirmed  by co-  immunoprecipitation (95). 1.7.5.1  Srb10/11 activity is sensitive to environmental stress.  Implication of SrblO in stress response was based on the observation that introduction of kinase inactive alleles resulted in derepression of a distinct subset of genes involved in stress response (86). Furthermore, the SrblO kinase is depleted as cells reach the diauxic shift (86), the partner cyclin Srb11 is sensitive to a multitude of stresses (40), and deletions of either srblO  or srbl  1, as well as  other components of the mediator complex, result in a morphological traits characteristic with starvation response (86). Finally, components of the mediator complex, including Srb10/11 were genetically implicated in nutrient sensing and stress response, suggesting that mediator is likely a downstream target of 48  Introduction environmental sensing machinery (26).  Table 1: Components of Mediator and its Sub-Modules. Gene  Mass (kD)  Essential?  Other name(s)  SRB4 SRB2 SRB4 SRB5 SRB6 MED6 MED8 MED11 ROX3  23 78 34 14 32 25 15 25  no yes no yes yes yes yes yes  HRS2  Med9/10 MED1 MED4 MED7 MED9 MEDIO SRB7  64 32 32 17 18 16  no yes yes no yes yes  SRB 8-11 SRB8 SRB9 SRB10 SRB11 NUT1  167 160 63 38 128  no no no no no  Rgr1 RGR1 SIN4 GAL11 PDG1 MED2  123 111 120 47 48  yes no no no no  NUT3,  SSN7  CSE2 NUT2  GIG1, NUT8, GIG2, GIG3,  NUT6, SCA1, NUT7, NUT9,  BEL2, RAR3, HRS1,  GAL22, SDS4, MED3  49  Introduction  1.7.5.2 The  Substrates of SrblO  association of SrblO with the CTD (119), and the observations that  s r b W mutation suppresses phenotypes associated with CTD truncations (204) indicated that the CTD may be a physiological substrate for this kinase. SrblO can  phosphorylate the CTD in vitro,  and holoenzymes prepared from srbW  yeast  lack CTD kinase activity (119). These observations are at odds with the fact that yeast lacking srblO  vivo.  are viable, and are not deficient in CTD phosphorylation in  Since the transcriptional defects of srblO  strains are specific (78), these  data suggest that SrblO may target other substrates in  vivo.  Prior to my work, yeast SrblO had been shown to directly regulate three site-specific transcription factors. SrblO phosphorylation of Gal4 is required for efficient G A L gene induction (83, 180), whereas phosphorylation of Msn2 and Gcn4 promotes transactivator nuclear export and degradation, respectively (30). The  abolishment of SrblO activity in response to stress would stimulate Gcn4  and  Msn2 activity, while moderating Gal4 dependent transcription in accord with  cell physiology. Based on their physical interaction with SrblO, the transcription factors Sip4 and Sfl1 may also be regulated in this fashion (195, 216), however direct phosphorylation of these factors by SrblO has not been demonstrated.  1.8  Ubiquitin and the SCF ubiauitin lipase complex  50  Introduction The  steady state level of a given protein is governed by its rate of  synthesis and destruction, and the abundance of many regulatory proteins is stringently controlled by ubiquitin-mediated proteolysis. Ubiquitin, a 76 amino acid protein is covalently attached to lysines of substrate proteins by specialized multiprotein complexes termed ubiquitin ligases (80). The yeast S a c c h a r o m y c e s  cerevisiae has two major ubiquitin ligase activities. The A P C complex is the activity that targets destruction of mitotic cyclins and other key proteins to initiate anaphase (162).  The Skp1-Cdc53-F-Box (SCF) ubiquitin ligase complex is  responsible for attaching ubiquitin to numerous signaling molecules in yeast including the transcription factors Met4 and Gcn4, the cell cycle regulators S i d , Far1,  and Swe1 as well as several components of the pheromone response  pathway (220).  1.8.1 The ubiquitination process The  components of S C F catalyze a sequence of transthioesterification  reactions. Ubiquitin is activated by the ubiquitin activating enzyme or E1 Cdc53, and  is transferred to the E2 ubiquitin conjugating enzyme Cdc34. The third  enzyme in the ubiquitin transfer reaction is the E3 ubiquitin protein ligase, and is defined as a factor that can interact with both the E2 and a substrate; hence E3s are targeting subunits. Ubiquitin is attached directly to proteins when an e- amino group of a lysine residue of the substrate protein nucleophilically attacks the thioester intermediate of the E2. Reiteration of this process, using an internal lysine acceptor site in the ubiquitin peptide results in multiubiquitin chain 51  Introduction formation. Poly-ubiquitinated proteins are then degraded by the 26S proteosome (80). A newly identified E4 activity, encoded by the UFD2  gene of budding yeast,  regulates chain polymerization, as different linkages of ubiquitin may serve as unique recognition modules (104).  1.8.2 The F-Box hypothesis The SCF  E1 and E2 enzymes are used ubiquitously throughout the cell, and  activity is targeted to substrates by an E3 protein. E3 proteins interact with  Cdc53 and Cdc34 via Skp1, and different S C F complexes are annotated as SCF  cdc4  Q r  scF  S k p 2  , with the E3 enzyme denoted in superscript. Alignment of the  first three Skp1 interacting proteins cyclin F, Skp2, and Cdc4 uncovered a conserved motif named the F-box after cyclin F (3). The F box has a relatively weak hydrophobic consensus sequence that stretches over 40 amino acids, and sequence inspection reveals 17 putative F-box proteins in  Saccharomyces  cerevisiae, although it should be noted that not all F-box proteins are necessarily targeting subunits of Cdc34 (220). SCF  dependent degradation of Cln2 and S i d require separate F-box  proteins, and this observation was the basis of the F-Box hypothesis which has two main tenets (3):  1. Skp1 with  links  the F-box  Cdc34/Cdc53 motif  to F-box and  proteins  by interacting  directly  Cdc53.  52  Introduction  2. The F-box machinery protein The  protein by interacting  interaction  recruits directly  substrates with  to the them  through  ubiquitination other  protein-  domains.  F-box hypothesis is reinforced by biochemical data demonstrating  that Cdc53 simultaneously binds both Skp1 and Cdc34; the former via a short region of the N terminus, and the later through a conserved cullin homology domain (159). Furthermore, as predicted by the hypothesis, Cdc53 and Cdc34 are essential for all S C F activities in yeast, while perturbing E3 activity only affects degradation of specific substrates (160, 191). Finally, only S C F  C d c 4  ubiquitin ligase activity has been successfully  reconstituted from recombinant proteins (191), suggesting that additional factors or modifications may be critical for some SCF  activities in  vivo.  1.8.3 SCF substrate recognition is phosphorylation dependent. Without exception, recognition of substrates by S C F is dependent on substrate phosphorylation, but unlike other phosphorylation dependent proteinprotein interaction motifs, like SH2 and 14-3-3 domains, the mechanism by which F-box proteins recognize phospho-proteins is not understood (220). Up to 5 separate phosphorylations contribute to degradation of Sic1(214), and Gcn4 (30), while a single phosphorylation of Far1 is sufficient to recruit S C F (77). Furthermore, comparison of phosphorylation sites of several Cdc4 substrates reveals no apparent consensus sequence.  It is thus possible that  phosphorylation of substrates may simply induce a conformational change that exposes an epitope recognized by a cognate F-box protein. A good candidate 53  Introduction motif is the short acidic PEST sequence. Found in most SCF substrates, this feature is simply named after the enrichment of proline, glutamine, serine and threonine residues. Removal of the PEST signature from Cln2 and Cln3 increases their stability (73), and transfer of this peptide from Cln3 can destabilize a heterologous protein (226).  54  Introduction Figure 1.6 The SCF ubiquitin ligase complex targets proteins for degradation by the 26S proteosome. Phosphorylation dependent ubiquitination of numerous proteins is mediated by SCF ubiquitin ligase complexes. S C F complexes are comprised of a ubiquitin activating E1 enzyme (Cdc53), ubiquitin conjugating E2 enzyme (Cdc34), an adapter protein (Skp1), and substrate targeting E3 (F-box protein). E3's recruit ubiquitination  activity to substrates by simultaneously interacting with  phosphorylated substrates and an E2. Poly-ubiquitinated substrates are recognized by the 26S proteosome and degraded. See text for details.  55  Introduction  56  Introduction 1.9  Research objectives  Surprisingly little is known about the details of Ste12 regulation. First, the mechanism by which pheromone stimulation increases Ste12's ability to activate transcription is unclear. It is accepted that activation involves antagonizing two negative regulators, Dig1 and Dig2 and this requires the catalytic activity of upstream MAPKs. Secondly, Ste12 is heavily phosphorylated at multiple sites, but the function of these modifications has not been addressed. Finally the ability of Ste12 to activate separate classes of genes in response to distinct signals is perplexing considering the same upstream components appear to mediate two (pheromone and filamentation) transcriptional programs in the same cell.  My objectives were to investigate each of these problems with a primary emphasis on the bi-functionality of Ste12 and the STE-MAPK cascade in pheromone and filamentous response. One chapter of this thesis is devoted to investigating how Dig1 inhibits Ste12, and here I also define two functional domains of Ste12. Early in my work I identified Srb10 as a kinase that regulates Ste12 function in filamentous response, and the subsequent focus of my thesis work became to understand the mechanism of this regulation.  57  Materials & Methods  Chapter 2 Materials and Methods 2.1 2.1.1  Media and yeast manipulation Growth media  Standard growth media was used for all yeast and E.coli  manipulation.  Synthetic low-ammonium dextrose (SLAD) was made as follows. Approximately 26 grams of agar were washed in 1.5 L of d H 0 with vigorous mixing and 2  allowed to settle.  This was repeated 3 times or until the agar and water  appeared colorless, when water was gently decanted. Approximately 6.66 grams of Yeast Nitrogen Base without amino acids (Difco) were combined with 20 grams of glucose, 50 uJ of 1 M Ultrapure Ammonium Sulfate, and 1 L of d H 0 , 2  added to washed agar and autoclaved. Leucine or uracil was added either directly to plates or to bulk media to meet auxotrophic requirements with no observable effect on pseudohyphal development. PDM media was made as described (89). 2.1.2 One  Yeast transformation loopful of the desired yeast strain was resuspended in 400 u,l of TLP  (10 mM TRIS-HCI, 1 mM EDTA, 100 mM LiOAc, 44% P E G 4000).  Forty  microliters of DMSO, 5 u.l of single stranded salmon sperm DNA, and 0.3-1.0 u.g of plasmid were added and the mixture vortexed, and incubated at RT for 2-12 h. The  mixture was then heat shocked at 42°C for 10 min and plated on the  appropriate selective media. srblO with plS023 (cut Kpn1),  strains were generated by transforming yeast  which is a two-step URA3 disruption plasmid. Similarly 58  Materials & Methods  STE12 alleles were introduced into ste12  yeast by transformation with the  integrating plasmids listed in Table 2. Integration was targeted to the A D E 8 locus by cutting with Nru1,  or the ste12::KAN locus by cutting with Afll .  were confirmed by sequencing of PCR  2.1.3  Mutations  products flanking the site of integration.  Monitoring of filamentous growth  Assays for haploid invasive growth and diploid pseudohyphal growth were performed essentially as described (175). Cells were grown for the indicated time, and photographed after plate washing (invasive growth), or directly on SLAD plates (pseudohyphal growth). 2.2  Plasmids. oligonucleotides, and yeast strains.  Plasmids used in Chapter 3 have been previously described (154). All other plasmids, oligonucleotides and yeast strains are described below in Tables 2, 3, and  4.  59  Materials & Methods Table 2. Plasmids  Plasmid Name DIS147 DIS253  Details Bacmid encoding 6his-STE12 Bacmid encoding  Reference This study 6his- This study  D-IS255  Bacmid  6his- This study  PBMH276 pCN18 pCN19 pCN20 pCN23  FRE-lacZ reporter Gal inducible STE12 (T405A) Gal inducible STE12 (S445A) Gal inducible STE12 (S451A) ade8:: STE12 (S451A) integrating vector  pCN30 pCN31 pCN32 pCN38 pCN39 pCN41  CEN, CEN,  pCN42 pCN48 pGAL4/STE12 plS023 PIS172 plS198 pJL/E-ura pJL1 pJTS2 pJTS5  STE12(S261A) STE12(S451A)  STE12 STE12  encoding  (S451A) (S261A/S451A) inducible STE12 (S261A/S451A) inducible STE12 (K272R) inducible STE12 (K463R)  This This This This This (K272R) integrating This  Gal Gal Gal ade8:: S T E 1 2 vector ade8:: S T E 1 2 (K463R) integrating vector Gal inducible STE12-flag produces GAL4(1-147)-STE12(216688) from ADH1 promoter in yeast Two-step srblO disruption plasmid ade8:: STE12 integrating vector ade8:: STE12 (S261A) integrating vector Gal inducible STE12 (S261A) Gal inducible STE12  CEN, CEN,  (131) This study This study This study This study  STE12 STE12  (S261A)  study study study study study study  This study This study (88) This study This study This study (88) (89) (88) (88)  60  Materials & Methods Table 3. Oligonucleotides Oligo Name AB68 AB69 AB84 AB85 CN110 CN111 CN144  Sequence 5' -> 3' GAACGGTGTTTTCTCCAATCAA TTCATGG CTCGCAAAATCCAACGTTTTCT TGTTCA TATCGGCGCAAGGTGTTT CAGATGAGC IACAGGIGCI I I I IAACIGIGC ATGAGCCAAG GTATGTAGAAATATAGATTCCA TTTTGAGGATTC GACATTTGATAAGGTGTATACG GAATCATAG CGATTTTGCTGGATTGAGCTGA ATG  CN145  GCGAACGAAGAACTCCTTGGC CA  CN162  GATTTTATTCCTCAGAGATTGAT TATAGAACC  CN163  GGTTCTATAATCAATCTCTGAG GAATAAAATC  CN164  GATACTACCCAAGAATGCCGTA TAATC  CN165  GATTATACGGCATTCTTGGGTA GTATC  CN75  ATACTTCATGTAGCTGGCCGGG TCGCTAGG  CN76  CTGGAAGTTGTTACCATATAAT TAGTG  CN77  TCCGTTTGGGTAAGCTTGCTGG AAGTT  CN79  CCTAGCGACCCGGCCAGCTAC ATGAAGTAT  CN80  CACTAATTATATGGTAACAACTT CCAG  CN81  AACTTCCAGCAAGCTTACCCAA ACGGA  Target His4 ORF  Use ChIP PCR  His4 ORF  ChIP PCR  TEC1 FRE  ChIP PCR  TEC1 FRE  ChIP PCR  Ty1 FRE  ChIP PCR  Ty1 FRE  ChIP PCR  CLN1 promoter CLN1 promoter Mutation K272-to R Mutation K272-to R Mutation K463-to R Mutation K463-to R Mutation T405 to A Mutation S445 to A Mutation S451 to A Mutation T405 to A Mutation S445 to A Mutation S451 to A  ChIP PCR ChIP PCR of SDM of SDM of SDM of SDM of SDM of SDM of SDM of SDM of SDM of SDM  61  Materials & Methods Table 4. Yeast Strains Yeast Strain HLY333 L5366 MLY183 a/a  MLY216a MLY216a/a MT1147 MT1154 W303-1A YA01 YA06 YCN3 YCN38 YCN40 YCN44 YCN48 YCN52 YCN53 YCN55 YCN56 YCN57 YCN6 YCN60 YCN61 YCN7 YCN80 YCN81 YCN82 YCN83  Genotype 21278b, MATa, ura3-52 21278b, MATa/@, ura3-52 2 1278b, Mat a/@, ted ::Kan/tec1 ::Kan  Reference/Source (120) G. Fink ura3-52/ura3-52, (156)  21278b, Mat a, ura3-52, leu2::hisG, ste12::Kan 21278b, MATa/@, leu2::hisG/leu2::hisG, ura3-52/ura352, ste12::Kan/ste12::Kan MATa ade2 his3 Ieu2 trp1 ura3 can1, rst2::HIS3 MATa ade2 his3 Ieu2 trp1 ura3 canl, rst1 ::TRP1 MATa, ade2, his3, Ieu2, trp1, ura3, canl W303, MATa ste12A Ieu2 ura3 ade2 trp1 his3A::FUS1-HIS3 mfa2A::FUS1-lacz W303, Mat a ste12A,ade2, trp1,can1, Ieu2, his3, ura3 W303, MATa, ade2, his3, Ieu2, trp1, ura3, canl, srblO 21278b, Mat a, ura3, ste11::Kan, leu2::hisG,srb10 21278b, MATa, ste12::LEU2, leu2::hisG, ura3-52, srblO 21278b, Mat a, ura3-52, srblO 21278b, MAT a, ura3-52,leu2, WT STE12::ste12 2 1278b, MAT a, ura3-52,leu2 STE12(S261 A/S451 A)::ste12 2 1278b, MATa/@ ura3-52/ura3-52, ade8::STE12/ade8::STE12 2 1278b, MATa/@ ura3-52/ura3-52, ade8: :STE12(S451 A)/ade8: :STE 12(S451 A) 2 1278b, MATa/@ ura3-52/ura3-52, ade8::STE12(S261A)/ade8::STE12(S261A) 2 1278b, MATa/® ura3-52/ura3-52, ade8::STE12(S261 A/451 A)/ade8::STE12(S261 A/451 A) W303, MATa, ade2, his3, Ieu2, trp1, ura3, canl, ste12::LEU2, srblO 21278b, MATa/@, ura-/ura-, srb10-/srb10W303, MATa, ade2, his3, Ieu2, trp1, ura3, canl, srblO, mfa2::Fus1-lacZ:URA3 W303, MATa, ade2, his3, Ieu2, trp1, ura3, canl, ste12, rst1, rst2::HIS3 21278b, MATa/®, stel 2::LEU2/ste12::LEU2, leu2::hisG/ leu2::hisG, ura3-52/ura3-52, srb10/srb10 21278b, Sigma 1278,Mat a/@, ura3/ura3, ste11::Kan / ste11::Kan, leu2::hisG / leu2::hisG, srb10/srb10 21278b, MATa, ura3-52,leu2, STE12(K272R)::ste12 21278b, MATa, ura3-52,leu2, STE12(K463R)::ste12  (156) (156) (154) (154) H.Ronne (154) (154) This study This study This study This study This study This study This study This study This study This study This study This study This study (154) This study This study This study This study 62  Materials & Methods 2.3 2.3.1  Measurement of transcription Beta-Galactosidase assays  Measurement of beta-galactosidase activity was performed as described (154). 2.3.2 RNA extraction All solutions for RNA work were DEPC treated before use by adding D E P C to 0.1%, followed by vigorous mixing, overnight incubation, and autoclaving. Yeast were grown to an OD oo of 0.6 - 1.0 and 10-15 ml of culture 6  was harvested by centrifugation. Cell pellets were washed in 1ml DEPC treated AE buffer (50 mM NaOAc pH 5.3, 10 mM EDTA) and transferred to a 1.5 ml microcentrifuge tube. Cells were briefly pelleted and resuspended in 400 u,l of fresh A E buffer. Forty microliters of 10% SDS were added and the suspension vortexed prior to the addition of an equal volume of AE buffered phenol. The emulsion was vortexed for 20 sec and placed at 65°C for 4 min. The tubes were then moved directly to an ethanol/dry ice bath without vortexing and samples were chilled until phenol crystals appeared. Samples were then centrifuged at 13K RPM in a microfuge at RT for 2 min. The aqueous phase was then removed and extracted with an equal volume of AE buffered Phenol [(25):Chloroform (24): Isoamylalcohol (1)].  Following vortexing and centrifugation the aqueous phase  was precipitated by addition of 3M NaOAC to 10%, and 2.5 volumes of cold 95% EtOH. RNA was then precipitated for 20 min at -20°C, pelleted by centrifugation for 5 min at 13K RPM at RT. The RNA pellet was washed with cold 80% EtOH, 63  Materials & Methods and dried briefly in a speedvac prior to resuspension in 20-100 \i\ of DEPC treated water. 2.3.3  Northern hybridization  Between 10-20 \ig of total RNA were combined with an equal volume of RNA loading buffer (50% glycerol, 1 mM EDTA. 0.4% bromophenol blue), heated at 65°C for 15 min, and cooled on ice for 2 min. One microliter of 1 mg/ml ethidium bromide was added to each sample prior to separation in 1X MOPS buffer (40 mM MOPS pH 7.0, 10 mM NaOAc, 1 mM EDTA) on a 1% agarose gel containing 6.5% formaldehyde with constant voltage of 70 V for 2 h. Gels were photographed and washed with DEPC treated d H 0 for 10 min on a rotating 2  platform. This wash was repeated twice, and followed by a 45-min wash in 20X S S C (3 M NaCI, 0.3 M sodium citrate pH 7.0).  RNA was then transferred  overnight by capillary action to a nylon membrane (Pharmacia). After transfer, the membrane was photographed to confirm transfer quality, and washed briefly in DEPC d H 0 . RNA was then cross-linked to the membrane by placing the 2  nylon face down on fresh Saran wrap atop a UV-gel box for 4 min. Cross-linked membranes were then placed in pre-hybridization solution (6X S S C , 50% N  deionized formamide. 0.5% S D S , 2.5X P V P Ficoll [5 g Ficoll, 5 g polyvinylpyrrolidone per 500 ml DEPC treated water], 50 mM Na Phosphate pH 6.5, 100 nl/ml sheared salmon sperm DNA) for 4-24h, and probed with gene specific probes using standard methods.  64  2.4 2.4.1  Materials & Methods Protein preparation, isolation, and manipulation Immunoprecipitations from yeast  Yeast cultures were grown to an OD oo of 0.6-1.0 and collected by 6  centrifugation. Cells were washed once in YLB [50 mM Tris-HCI pH 8.0, 5 mM MgCI , 150 mM NaCI, 5 mM NaF, 2 mM ZnCI , and 1X Protease Inhibitor 2  2  Cocktail (PIC, Sigma)], and transferred to a 2 ml screw-cap tube. Pellets were resuspended in 400 uJ of YLB  containing protease inhibitors. An equal volume of  glass beads (400-600 micron) was added and lysis accomplished by vortexing or treatment in a bead beater. Lysis was monitored by microscopy, and when >80% were lysed, 400 u.l of 2X RIPA [20 mM Tris-HCI pH8.0, 200 mM NaCI, 2 mM  EDTA, 2% NP-40, 1% sodium deoxycholate, 0.2% SDS] containing protease  inhibitors was added, followed by 30 sec of vortexing. Insoluble material was removed by centrifugation at 12 000 X g at 4°C, and lysates pre-cleared for 30 min with 50 jxl of 10% formalin fixed S. aureus  (Zymed) at 4°C with gentle mixing.  Following brief centrifugation in a microfuge, supernatants were transferred to a fresh tube containing the desired antibody. Following a 60 min incubation on ice, 50 \i\ of 10% S. aureus  were added and samples were moved to a nutator at 4°C  for 1-12h. Immune complexes were then sequentially washed with 1vml of cold WASH1 [10 mM Tris-HCI pH 8.0, 1 M NaCI, 0.1% NP-40], WASH2 [10 mM TrisHCI  pH 8.0, 0.1 M NaCI, 0.1% NP-40, 0.1% SDS],  8.0,  0.1% NP-40], and 1X RIPA.  WASH3 [10 mM Tris-HCI pH  Immune complexes were dissociated by  addition of 2xSDS sample buffer and incubation at 100°C for 10 min. Samples were then subjected to SDS-PAGE and subjected to autoradiography. 65  Materials & Methods  2.4.2  labeling of Ste12  Cultures of yeast (50 ml) harboring the appropriate expression plasmid were grown to an  OD600  of 0.6 -1.0 in ura- glycerol media. Cells were washed  three times in 20 ml of ura- glycerol PDM, and starved in 50 ml of PDM for 1 h. Galactose was added to a final concentration of 2%, and cultures grown at 30°C for 30-45 min in an orbital shaker prior to transfer to a 2 ml screw-cap tube in a 200-400 u.l volume of the same media. From 0.5 to 5 mCi of P orthophosphate 3 2  were added and cells labeled for 45 min at RT on a nutator. Ste12 protein was immunoprecipitated as described, and resolved by SDS-PAGE. Wet gels were wrapped in Saran wrap and exposed to film. Phosphorylated Ste12 was excised from the gel and subjected to tryptic phosphopeptide analysis.  2.4.3  3S  S labeling of Ste12 and pulse chases analysis  Yeast harboring a plasmid born galactose inducible STE12 alleles were grown to an  OD600  of 0.6-1.0 in ura- glycerol (25 ml). Cells were washed twice  with 10 ml of ura-met- raffinose and resuspended in 25 ml of the same. Cells were starved for 15 min in an orbital shaker, harvested, and resuspended in 400 ixl of ura-met-galactose in a 2 ml screw-cap tube.  One hundred and fifty r  microliters of S methionine were added and cells were labeled for 1 h at RT on 3 5  a nutator. Labeling was stopped by washing once with 1 ml of YEPD+25 mM methionine. Pellets were resuspended in 550 u,l of the same, and 100 u,l aliquots 66  Materials & Methods removed at desired times. Aliquots were rapidly pelleted and media removed. Four hundred microliters of YLB containing protease inhibitors was added together with an equal volume of glass beads (400-600 micron). The mixture was briefly vortexed to disperse the yeast cell pellet, and flash frozen in liquid nitrogen. After 20 sec, samples were placed at -70°C until immunoprecipitations were performed.  2.4.4 Tryptic phosphopeptide mapping Analysis of protein phosphorylation by tryptic phosphopeptide analysis was performed exactly as described (89). 2.4.5 In vitro kinase assays Kinase reactions with recombinant Srb10/Srb11 complexes were performed as described (84). p42 MAPK (NEB) was substituted for Srb10/11 complexes and assayed under identical conditions. Approximately 50-100 ng of baculoviral produced 6his-Ste12 were used as substrate.  2.4.6 Immunoblotting Anti-flag M2 (Sigma) and polyclonal anti-Ste12 antisera (89) were used at 1:10 000 dilutions. Blots were probed overnight in TBS-T [0.1 M Tris-HCI pH 8.0, 0.9% NaCI, 0.1% Tween20] containing 2% skim milk powder at 4°C.  67  Materials & Methods 2.4,7 Baculovirus expression  Transfection of Sf9 cells was performed essentially as described in the GIBCO BRL Bac-to-Bac Expression System Manual. In short, 9 x 10 Sf9 cells 5  were seeded on a 35 mm plate and allowed to attach for 1h. Five micoliters of bacmid DNA encoding recombinant viral genomes (bacmids), were then added to 6 u.l of CELLFECTIN in a total volume of 0.2 ml of TC-100 serum free insect cell media. Plates were washed once with TC-100 serum free media and 0.8ml of the same was added to each CELLFECTIN/DNA sample which was then overlayed onto the cells. Cells were incubated at 27°C for 5 h when the transfection mix was removed and replaced with 2 ml of TC-100 complete media. Cells were left for 72 h when signs of infection were clearly visible. Supernatants, containing viral particles were saved and viral titers amplified twice as follows. One hundred microliters of virus containing media was introduced to 2x10 cells to ensure a low MOI. Viral infection was allowed to proceed for 5 days 6  when supernatants were again saved. After the second amplification cells were analyzed for recombinant protein production and viral titers determined using Clontech's Rapid Titer Kit. Cells were harvested, resuspended in SDS-sample buffer and visualized by SDS-PAGE or Western blotted. Large scale protein production of WT and mutant alleles of STE12 was performed as previously (84), and purification to homogeneity was as described (87).  68  Materials & Methods 2.4.8  Bacterial expression  BL21Codon Plus (RIL or RP) were transformed with the desired expression plasmid. Cells were grown with ample aeration to an OD oo or 0.3-0.5 6  and protein expression was induced by addition of IPTG to 1mM. Cultures were grown for a further 2 h at 37°C, and cells harvested, washed with cold PBS and frozen at -70°C. Lysates were prepared by thawing cell pellets on ice, and resuspending in XA-90 lysis buffer [10 mM Tris-HCI pH 8.0, 0.5 M NaCI, 10% glycerol, 10 mM p-mercaptoethanol, 0.1% Tween20}. For each 250 ml of culture, 4 ml of buffer were used. Cells were lysed by sonication, and extracts cleared by centrifugation at 12K RPM for 20 min. Supernatants were aliquoted and frozen at -70°C until required. 2.4.9 E. coli  Glutathione agarose affinity purification extracts were prepared as described (154), and incubated with  glutathione agarose, and extract from infected Sf9 cells.  The volume of beads  used was approximated based on the binding capacity of the resin and the predicted amount of GST protein produced as determined by Coomassie blue staining of total extracts. Binding was performed at 4°C on a nutator for 30-60 min. Beads were washed thrice in GST binding buffer, and bound GST fusion protein and interacting proteins mixed with 2X SDS sample buffer, and subjected to SDS-PAGE and immunoblotting.  69  Materials & Methods 2.4.10 Chromatin Immunoprecipitation (ChIP) For each immunoprecipitation, a 50 ml culture of cells was grown tomidlog phase in the indicated media. Cross-linking was achieved by addition of 1.4 ml of formaldehyde to give a final concentration of 1%. Cells were cross-linked for 20 min at room temperature, followed by overnight incubation at 4°C with constant mixing. Excess formaldehyde was quenched by addition of 2.5 M glycine to a final concentration of 125 mM for 5 min at RT. Cells were then harvested and washed four times in cold TBS. Cell pellets were transferred to 15 ml falcon tubes and resuspended in 400 u.l ChIP lysis buffer [50 mM HEPESKOH pH 7.5, 140 mM NaCI, 1 mM EDTA, 1% Triton X-100, 0.1% Nadeoxycholate, 1X protease inhibitor cocktail (Sigma)] and sonicated on ice to generate average chromatin fragments of 500 bp. Ste12-DNA complexes were incubated overnight with 30 \i\ of magnetic Protein G beads (Dynal) pre-coupled to anti-Ste12 anti-serum (4 \x\ of anti-serum per 30 uJ beads). Beads were washed twice with 1 ml ChIP lysis buffer, twice with ChIP lysis buffer containing 360 mM NaCI, twice with wash buffer [10 mM Tris-HCI pH 8.0, 250 mM LiCI, 0.5% NP-40, 0.5% Na-deoxycholate, 1 mM EDTA), and once with TE [50 mM Tris-HCI pH 8.0, 10 mM EDTA]. Each wash lasted for 5 min on a nutator at 4°C, and beads were separated in a magnetic device (Dynal) between each wash. Washed beads were resuspended in Elution buffer (TE containing 1% SDS) and heated to 65°C for 15 min with periodic vortexing, followed by overnight incubation at 65°C to reverse cross-links. The next day, 140 u-l TE, 2 \i\ of 10 mg/ml glycogen and 7.5 \i\ of 20 mg/ml proteinase K (Invitrogen) were added and 70  Materials & Methods samples incubated at 37°C for 2 h. Precipitated DNA was extracted twice with phenol, and once with phenol/chloroform/isoamyl alcohol before purification on Qiagen mini-columns. Recovered DNA was subject to standard P C R in 15 uJ volumes with Platinum Taq DNA polymerase and 0.1 uJ of 3000Ci/mmol a - P 32  dCTP per reaction. Cycles began with an initial denaturing at 95°C for 4 min, followed by 21 cycles of 95°C for 30 sec , 50°C for 30 sec, 72°C for 30 sec. PCR products were resolved on acrylamide gels, dried and exposed to phosphorimager screens (Molecular Dynamics).  71  Dig1 regulation ofSte12  Chapter 3 Regulation of Ste12 by Dig1 3.1  Foreword  Pheromone responsive transcription is positively regulated by Ste12, and heterologous over-expression of Ste12 can induce a FUS1-\acZ reporter gene. When I initiated the experiments described in this chapter, ste12 mutants that induced FUS1  transcription in wild-type, but not ste12  deletion strains had  been identified (154). Because these Ste12 fragments lacked residues necessary for DNA binding, it was proposed that their over-expression was inducing transcription of Ste12 regulated genes by titrating a negative regulator from endogenous WT Ste12. This interpretation was supported by in vitro  data  demonstrating that Dig1, the sought after direct inhibitor, interacted directly with these Ste12 fragments. The relationship between Ste12 and Dig1 was thus reminiscent of that between Gal4 and Gal80, in that in both cases, the negative regulator (Dig1 or Gal80) interacted directly with residues identified as the major activation domain. These data suggest Dig1 inhibits Ste12 by competing with holoenzyme targets for access to Ste12 residues.  This model of Ste12 regulation held true until it was observed that overexpression of the aforementioned deletion fragments also induced  F U S 1  expression in a d i g l strain. Thus co-expression of Ste12 fragments could not be inducing endogenous Ste12 by titrating Dig1.  72  Dig1 regulation ofSte12 The experiments described in this chapter were designed to identify the mechanism of Ste12 induction, and in particular to explore the regulation of Ste12by Dig1.  3.2  Results and Discussion 3.2.1  Digs are inhibitors of Ste12  Dig1 and Dig2 negatively regulate pheromone response by preventing Ste12 from activating transcription. Direct interaction between the Digs and Ste12 has been demonstrated (154), but the mechanism of how they modulate Ste12 activity remains unclear. Recruitment of factors to promoters could prevent transcription of adjacent genes by at least two distinct mechanisms. Factors could directly repress transcription by affecting the architecture of chromatin. Such proteins harbor an intrinsic activity that either enzymatically modifies components (i.e. HDAC) of chromatin, or recruits such entities. Tup1, is an example of such a repressor,  defined as a factor that can exert a negative affect  on transcription of a heterologous gene if artificially recruited to its promoter. In other words, artificial recruitment of such factors will cause repression of transcription at any locus.  The second mechanism by which a negative regulator could limit transcription is by antagonizing the activity of a positive effector of transcription. A classic example of this type of regulator is the Gal80 protein, which binds to  73  Dig1 regulation of Ste12 and  sterically masks the Gal4 activation domain. By definition Gal80 is an  inhibitor,  and can only negatively regulate transcription that is dependent on a  specific activator, in this case Gal4.  To  determine if the Digs are inhibitors  or repressors  I tested their ability to  repress transcription of a constitutive reporter gene when artificially recruited to its promoter. WT yeast harboring the constitutive CYC1-6lex-lacZ (LexA ) or ops  the CYC1-lacZ (control) reporter gene were transformed with either LexA, or LexA fused to the entire open reading frame of Dig1 (Lex-Dig1) or Dig2 (LexADig2).  None of the constructs had an effect on transcription of the control  reporter lacking LexA operators (Figure 3.1, open bars). Consistent with the notion that the Digs are direct inhibitors  of Ste12, expression of either LexA-Dig  fusion had no significant effect on the constitutive reporter harboring 6 LexA operators. Thus unlike LexA-Tup1 or LexA-Rpd3, which constitutively repress transcription of this reporter (93), the Dig proteins specifically regulate Ste12 function. These results are supported by subsequent genome wide microarray studies which demonstrate that the vast majority of genes derepressed in dig1dig2  strains require STE12  3.2.2 356  for their expression (173).  The Ste12 activation domain lies between residues 262 and  In the absence of pheromone there is minimal transcription from PREs, and  despite nearly 20 years of study, the mechanism by which Ste12 is  74  Dig1 regulation ofSte12 converted to a potent transcriptional activator is unclear.  Signaling events  upstream of the MAP kinases Fus3 and Kss1 are relatively well defined, but remarkably little is known about subsequent steps in Ste12 activation. A better understanding of pheromone responsive transcription requires identification of the minimal pheromone response domain on Ste12. A previous study identified Ste12 residues 301-335 as the pheromone  induction  domain.  Removal of this  peptide from Ste12 rendered the activator unresponsive to mating pheromone, and addition of this short sequence to the Gal4 DBD conferred pheromone responsiveness to a G A L 7"-lacZ reporter (163). Furthermore, Dig1 and Dig2 were shown to interact with this region of Ste12, suggesting the basis of pheromone induction involved dissociation or antagonism of the Dig proteins (163). Several experiments are in conflict with this report. For example a previous student demonstrated that the Dig proteins interact with separate regions of Ste12 both in vivo,  and in vitro  (154). Because the association of both  Digs with the Ste12 301-305 was only demonstrated by two-hybrid interaction, and because the yeast strain used contained endogenous Ste12, Dig1, and Dig2, this observation could be the result of an indirect interaction, potentially bridged by any of the above proteins. To test this hypothesis I assayed the ability of various Ste12 fragments to activate transcription when artificially recruited to a heterologous reporter gene in the yeast strain YCN7 (ste12,  digl,  dig2),  which is  devoid of Ste12, Dig1 and Dig2. Ste12 fragments were fused to the bacterial  75  Dig1 regulation ofSte12 Figure 3.1 Dig1 and Dig2 cannot repress transcription. Transformants of yeast strain Y A 0 6 bearing the pLGA312s(LexAo -lacZ) PS  reporter gene (closed bars), or operator-less control reporter (open bars), and plasmids expressing either LexA (vector) or LexA fused to Dig1 (LexA-Dig1) or Dig2 (LexA-Dig2) were grown to mid-log phase in selective media, and pgalactosidase activity measured.  76  Dig1 regulation ofSte12  • ^  CYC1-lacZ LexA -CYC1-lacZ ops  1250  LexA  LexA-Dig1  LexA-Dig2  77  Dig1 regulation ofSte12 LexA protein and transcription from a LexA -lacZ reporter gene was measured. ops  Fusing Ste12 (216-688), (216-500) or (216-474) to LexA created a strong transcriptional activator even in uninduced cells. This supports the notion that inhibition of Ste12 requires the Digs (Figure 3.2). N-terminal truncations to amino acid 262 did not adversely affect transcriptional potency, but truncation at amino acid 356 prevented activation by LexA-Ste12 (Figure 3.2, 356-688).  These  results indicate that the minimal activation domain of Ste12 resides between amino acids 262 and 356, a region overlapping with, but much larger than the previous described pheromone induction domain.  3.2.3  The Ste12 activation domain is pheromone responsive.  Despite ample conjecture, the mechanism for activation of Ste12 remains unresolved. Several experiments demonstrate that inhibition by Dig1 and Dig2 must be overcome to fully activate Ste12, but it is not clear if Fus3 or Kss1 modify Ste12, the Digs, or both. The Digs and Ste12 are substrates for the MAPKs Fus3 and Kss1 in vitro,  suggesting that phosphorylation of the Digs  and/or Ste12 results in activation of pheromone responsive transcription (15, 38, 57, 202). This model has never been formally tested but is widely accepted. To determine if a signal is communicated directly to Ste12 I assayed LexA-Ste12 fusions in the yeast strain YCN7, which lacks both Dig1 and Dig2.  Cells were  grown to mid-log phase and LexA -lacZ activity was assayed before and after ops  treatment with alpha factor (Figure 3.2). Without regulation by Dig1 and Dig2,  78  Dig1 regulation ofSte12 Figure 3.2 Residues 262-474 contain the Ste12 activation domain which is pheromone responsive. The  yeast strain YCN7 (ste12  digl  dig2)  bearing the multicopy reporter pSH18-  34 (LexAops-LACZ) was transformed with pMHLex expressing LexA (vector) or the LexA-Ste12p expression plasmids plS182 (216-688), plS184 (216-500), plS183 (216-474), plS187 (262-688), plS188 (356-688), plS189 (403-688), and plS194 (450-688). Cells were harvested at mid-log phase and transcriptional activation by LexA fusions was assayed prior to (open bars) and after (closed bars) addition of alpha factor to a final concentration of (2 H.g/ml). Results are an average of three independent determinations, with standard deviation shown.  79  Digl regulation ofSte12  1250 -i  80  Dig1 regulation ofSte12 LexA-Ste12 (216-688) is a strong activator, even in the absence of pheromone (open bars, compare with Figure 3.3).  However, treatment with mating  pheromone increased activation by this construct approximately two-fold. The activation domain of Ste12 must reside very close to, or contain, residues targeted in response to pheromone, as each construct that activates transcription (LexA fused to (216-688), (216-500) and (216-474)) was comparably induced by treatment with pheromone. Indeed further deletions could not separate residues required for basal and induced transcription  (T. Malcolm, personal  communication). These results support previous reports which indicate that the major mechanism for pheromone induction involves neutralization of Dig mediated inhibition, but clearly the Ste12 activation domain itself responds to pheromone signaling, suggesting that multiple factors are targeted to induce transcription of Ste12 regulated genes in response to pheromone. Future work to elucidate the means by which Ste12 is induced, including the dependence of this phenomena on upstream components of the pheromone response pathway is required. It is possible that Fus3 or Kss1 phosphorylate Ste12 to increase transcriptional potency, and implementation of kinase-inactive alleles of these MAPKs will be required to distinguish between this possibility and the reported direct inhibition of Ste12 by unphosphorylated Fus3 and Kss1 (39).  3.2.4 Dig1 interacts with the Ste12 activation domain in vivo and in vitro  81  Dig1 regulation ofSte12  In vitro  studies performed in our lab demonstrated that Dig1 and Dig2  interact with separate regions of Ste12, with the implication that they regulate Ste12 by independent mechanisms.  GST-Dig1 interacts with the central  activation domain of Ste12 (residues 216-547), while GST-Dig2 interacts with the N-terminal DNA binding domain (residues 21-195) (154). This is in contrast to a previous report, which suggests that both Dig1 and Dig2 interact with the same central region of Ste12 responsible for transcriptional activation (163). To address this discrepancy I tested activation by LexA-Ste12 derivatives in d i g l and  d i g 2 strains. Consistent with previous reports, I found that LexA-Ste12 (1-  688),  and LexA-Ste12 (216-688) were weak transcriptional activators in the  absence of pheromone (Figure 3.3).  Deletion of d i g l but not d i g 2 elevated  transcription by LexA-Ste12 (216-688) but not LexA-Ste12 (1-688), indicating that only Digl is capable of inhibiting the Ste12 C-terminus. LexA-Ste12 (1-688) must be regulated by both Digl and Dig2 as disruption of either d i g l or  dig2  could not derepress this hybrid in the absence of pheromone. Together with the observation that Dig2, but not Digl, can inhibit activation by Ste12 (1-215)-VP16 (154), these data support the view that Digl and Dig2 inhibit Ste12 via interaction with separate regions of Ste12.  3.2.5  Ste12 multimerization requires C terminal residues  Previous studies examined the effects of overproduction of Ste12 Cterminal fragments with the rationale that they would activate endogenous Ste12 by competing for inhibitor proteins. Since this effect is not mediated by 82  Dig1 regulation of Stel2 Figure 3.3 Ste12 (216-688) is inhibited by Dig1 but not Dig2. Yeast strains Y A 0 6 (WT), MT1154 (digl) pSH  or MT1147 (dig2)  harboring the  18-34 LexAops-\acZ reporter were transformed with plasmids expressing  either LexA, LexA-Ste12(1-688) or LexA-Ste12(216-688). Cells were grown to mid-log phase and p-galactosidase activity measured. Results are the average of three separate determinations, with standard deviation shown.  83  Dig1 regulation ofSte12  100 •  WT  Mdigi  fsT 75 H  0d/flf2  I  CO  i I 3.  50 i  O CO  "5s CQ.  o iFma LexA  rfe  LexASte12p 1-688  LexASte12p 216-688  84  Dig1 regulation ofSte12 Figure 3.4 Ste12 C-terminal fragments co-immunoprecipitate in vitro. Sf9 extracts prepared from cells infected with 6his-Ste12 recombinant baculovirus (input, lane 5) were incubated with extracts from E. coli  expressing  6his-Gal4 DBD (6H-G4, Iane4), or 6H-G4 fused to Ste12 residues 216-688 (lanel), 216-473 (lane 2), or 474-688 (Iane3). Gal4 fusions were recovered by immunoprecipitation with Gal4 DBD monoclonal antibody, and the interacting Ste12 protein was detected by immunoblotting with Ste12(1-215) antibodies (top). Input 6H-GH fusion protein was demonstrated by blotting with Gal4 DBD antibody (bottom).  85  Digl regulation  A  s  K  to  to C M  <?  C O  3  5  * r. 1  2  3  s  ofSte12  ^  to £ 4  5  6H-G4-(216-€«a)*-j 6H-G4-(216-473) 6H-G4-(474-688)-^  u-GAL.4 DBD  6H-G4*-  86  Digl regulation of Ste12 sequestering of Digl, I tested if direct interaction between full-length endogenous Ste12 and overproduced C-terminal fragments could be responsible for the observed FUS1 induction. The ability of Ste12 fragments to interact with WT Ste12 was tested directly by co-immunoprecipitation of recombinant proteins. Ste12 residues (216-688), (216-473) and (474-688) were fused to the Gal4 DNA binding domain and expressed in E. coli.  Crude extracts containing these hybrid  proteins were incubated with extracts from Sf9 cells infected with 6his-Ste12 generating baculovirus (Figure 3.4, (top) Input).  Immunoblotting of Gal4  immunoprecipitates with antibodies to the Ste12 DBD (1-215) allowed detection of co-precipitating full length Ste12. Full length Ste12 was not detectable in Gal4 DBD  immunoprecipitates but was recovered when Ste12 (216-688), (216-473)  and  (474-688) were expressed as fusions to the Gal4 DBD. This indicates that  multiple sequences flanking Ste12 amino acid 473 can facilitate Ste12-Ste12 interaction in WT  vitro.  Ste12 was also recovered by protein affinity chromatography when  Ste12 residues (216-594) were fused to GST. In attempts to further define regions capable of promoting Ste12 multimerization, I tested the ability of smaller GST-Ste12 fragments to recover full length Ste12 from S f 9  cell extracts.  Although GST alone was not capable of co-precipitating Ste12, GST fused to Ste12 amino acids 216-594, 216-500, 262-688, 356-688 or 450-688 could recover full length Ste12 (Figure 3.5). These results strongly suggest that the Cterminus of Ste12 harbors multiple peptide sequences involved in direct Ste12Ste12 interaction. Because the C-terminus has been previously implicated in 87  Dig1 regulation ofSte12 Figure 3.5 Ste 12 multimerization is mediated by C-terminal residues in vitro. Sf9 extracts prepared from cells infected with 6his-Ste12 recombinant baculovirus (input, lane 1) were incubated with recombinant GST (lane 2), or GST fused to Ste12 residues 216-594 (lane 3), 216-500 (lane 4), 262-688 (lane 5), 356-688 (lane 6), or 450-688 (Iane7). Ste12 complexes were recovered with glutathione agarose, resolved by SDS-PAGE and full length Ste12 detected by immunoblotting with Ste12 (1-215) polyclonal antibodies.  88  Dig1  regulation  ofSte12  GST-Ste12p CO CO  CD  O O  IA  m «o <o «o  O  CM  CM  CM  2  3  4  5  Jf  00 00  00 00  I s?i s i i  t: Jr Mi^p  t  «  6  n  7  89  Digl regulation of Ste12 auto-regulation, these results raise the possibility that activity of Ste12 may be controlled by formation of dimer-, oligo- or, multimeric complexes. 3.2.6 Overproduction of the Ste12 C-terminus induces transcription through direct interaction with endogenous Ste12 in vivo.  Heterologous expression of the Gal4 C-terminus can activate the G A L genes by competing for Gal4's direct inhibitor Gal80. Similarly, over-expression of Ste12 (216-688), a derivative which lacks the DNA binding domain, activates pheromone inducible F U S 1 gene. Since induction of pheromone responsive transcription requires endogenous Ste12, but not Digl, I tested if this effect might be  mediated by direct interaction between Ste12 (216-688) with WT Ste12. To  test this model in vivo  I assayed the ability of Ste12 C-terminal fragments to  interact with LexA-Ste12 fusions in a modified two-hybrid system. LexA-Ste12 (356-688) and LexA-Ste12 (450-688) are incapable of activating transcription because they lack the central transcriptional activation domain (Figure 3.2), and were selected as bait molecules. Co-expression of Ste12 (216-688), which contains regions necessary for both activation (Figure 3.2) and multimerization in  vitro  (Figures 3.4 and 3.5), caused activation of reporter gene expression in cells  containing both LexA-Ste12 C-terminal fusions but not with LexA produced on it's own (Figure 3.5 LexA-Ste12 Prey 216-688). As predicted by the "piggybacking" model, co-expression of Ste12 (356-688), which lacks an activating region but is capable of interacting with Ste12 in vitro  (Figure 3.2) could not activate either  90  Digl regulation ofSte12 Figure 3.6 The Ste12 C-terminus mediates multimerization in vivo. The  yeast strain YCN7 (ste12  digl  dig2)  bearing the multicopy reporter pSH18-  34 (LexAoPs-LACZ) and the pMHLex (LexA vector) or the LexA-Ste12 bait plasmids plS188 (356-688), or plS194 (450-688) were co transformed with vectors expressing the indicated Ste12 fragments from a galactose inducible promoter. Cells were grown to mid log phase, induced with galactose for 2 h and p-galactosidase activity measured. The results represent three independent determinations with standard deviation shown.  91  Dig1 regulation ofSte12  B LOJiA-StelZp wclor 2HM53B  35&-6B8  3ftW88 <tSO-GBft  vector 216-5CHK  386-608  o so imo iso zoo f3-GaU. Activity {LexA ops-lacZ)  92  Dig1 regulation ofSte12 LexA-Ste12 bait (Figure 3.5, Ste12 Prey 356-688). Overproduction of Ste12 (215-500), which contains Ste12's activating region induced reporter expression weakly suggesting that this construct may not interact as efficiently with Ste12 in  vivo  as is does in vitro.  In support of this notion, this construct activates well  when recruited to DNA by the LexA DBD (Figure 3.2), but cannot induce F U S 1 expression when exogenously expressed on its own (154).  3.3  Conclusions  Data presented in this chapter provide insight into the nature of Ste12 activation, and the relationship between Dig1 and Ste12. The observation that overexpression of Ste12 fragments could induce F U S 1 transcription in WT but not ste12  cells resembled pioneering experiments which led to the identification  of Gal80 as a direct inhibitor of Gal4 (129). It was thus thought that Ste12 Cterminal fragments must bind to a negative regulator, and cause induction of endogenous Ste12 by sequestering an inhibitor. Instead Ste12 induction under the above circumstances is a result of accumulation of Ste12 molecules, and does not appear to involve competition for Dig1 or Dig2. The Ste12 activation domain was identified by assaying activation potential of Ste12 fragments in the absence of known inhibitor proteins. Since the minimal activation domain retains some pheromone inducibility in a d i g strain, full induction of transcription by Ste12 involves a second mechanism in addition to dissociation of Dig1 and Dig2. It remains possible that another protein dissociates from Ste12 upon pheromone  93  Dig1 regulation of Ste12 treatment. Likely candidates are the MAPKs Fus3 and Kss1, which are known to interact with and directly inhibit Ste12. However, since the ability of Kss1 to inhibit Ste12 is dependent on Dig1 (6), this model is less favored than the possibility of direct modification of Ste12 by the MAPKs. Because MAPK mediated repression of Ste12 does not require kinase activity, implementation of kinase deficient alleles of both MAPKs should distinguish between these two models.  94  Srb10 phosphorylates Ste12  Chapter 4 Srb10 phosphorylates Ste12 4.1  Foreword  Cyclin dependent protein kinases (CDKs) gained notoriety for their control of cell cycle progression, but not all CDK/cyclin complexes have roles in the progression of cell division. The CDK8/cyclinC complex is conserved amongst eukaryotes. The yeast genes SRB10 (CDK8) and SRB11 (cyclin C) were identified as suppressors of RNA Polymerase II C-terminal domain truncations (204). Subsequently found to be components of the mediator complex of the RNA polymerase II holoenzyme machinery (79), this CDK/cyclin pair has a negative influence on transcription and interacts directly with the carboxylterminal domain (CTD) of RNA Polymerase II. The observation that Srb10/11 could phosphorylate the CTD heptapeptide repeat provided the first model for how this CDK could regulate gene expression (119). abolishing Srb10 activity in vivo  However in rich media,  results in derepression of 173 genes (3% of the  genome), many of which are involved in various stress responses (86). CTD modification does not account for this observation, which suggests that this kinase must mediate transcription via targets less ubiquitous than the CTD. Experiments described in this chapter demonstrate that Srb10 directly phosphorylates the transcriptional activator Ste12. I identify two serine residues on Ste12 that are phosphorylated by Srb10 in vitro phosphorylation by Srb10 in vivo.  and required for  Mutation of these sites to alanine results in  elevated FRE dependent transcription, and hyperfilamentpus growth. The ability 95  SrblO phosphorylates Ste12 of SrblO to phosphorylate Ste12 is dependent on fermentable carbon, an observation that is consistent with the model of SrblO activity being sensitive to environmental and nutritional stress.  4.2 4.2.1  Results and Discussion  Hyper-filamentous growth of srblO strains requires STE12 and the STE-MAPK pathway The observation that deletion of srbW  causes constitutive haploid invasive  growth in various lab strains has been documented by others (86). Since Ste12, and the pheromone response MAPK cascade, positively regulate transcription from filamentous response elements (120) (FREs), I created srbW  ste12  double  mutants to address if Ste12 was required for the hyperfilamentous phenotype of  srblO  mutants.  Haploid invasive growth is scored by a plate-washing assay  (175). Cells are streaked or patched on rich media, and allowed to grow for 3 days, when plates are washed under a gentle stream of water; attachment of cells after washing defines the invasive phenotype.  In some genetic  backgrounds filamentous growth also manifests itself as grainy, rippled colonies (Figure 4.1). Deletion of s r b W caused hyper-invasive growth in both W303, and 21278b genetic backgrounds (Figure 4.1, srblO). conjunction with srblO (Figure 4.1,  srblO  srb10ste12)  Disruption of ste12  in  reduced both abnormal morphology and cell attachment indicating that expression of some genes derepressed in  backgrounds requires  STE12.  96  Srb10 phosphorylates Ste12 Figure 4.1 Hyperfilamenation of haploid srb10 strains requires Ste12 and the pheromone response MAPK cascade A)  Filamentous colony morphology of 21278 strains. Haploid strains  HLY333(WT), YCN44 (srbW),  YCM0(srb10,ste12),  and YCN38(srM0,  ste11)  were allowed to form colonies at 30°C for 5 days when representative colonies were photographed. B) W303-1A (WT), YCN3 (srbW),  or YCN6  {srb10ste12)  yeast were assayed for invasive growth after growth on YEPD for three days. Plates were photographed before and after gentle washing under a stream of water.  97  SrblO phosphorylates  WT  srbW  srb 10,ste11  s r b l 0 , ste  12  WT  srbW  srb10,ste12  WASH  Ste12  SrblO phosphorylates Ste12 One and  possible interpretation of this data is that SrblO simply inhibits Ste12,  deletion of the CDK alleviates this regulation, resulting in constitutive  transcription from FREs. Under this scenario, Ste12 activity would be uncoupled from upstream signals conveyed through the pheromone response MAPK pathway. Alternatively, since SrblO is a component of the RNA Polymerase II holoenzyme machinery, regulation of Ste12 could be dependent on interaction with the activator during initiation of transcription. In this model Ste12 would have to activate transcription in order to be regulated by SrblO. The MEKK STE11  is required for both pheromone and filamentous response and deletion of  ste7" 7 eliminates basal transcription of Ste12 regulated genes (60, 175). Thus, to clarify how SrblO regulates Ste12, I examined the effect of deleting s t e 1 1  in  conjunction with s r b l O .  srbW  Haploid 21278b strains lacking ste11 and  displayed severely reduced filamentous colony morphology (Figure 4.2,  srb10ste11),  and isogenic diploids displayed a parallel decrease in pseudohyphal  growth when compared to srblO of ste  11  STE11  counterparts (Figure 4.2B). Disruption  also returned FRE-dependent transcription to levels below that of WT,  confirming that an intact STE-MAPK cascade is essential for elevated filamentous responsive transcription of srblO  yeast (Figure 4.2A). Since  impairment of the STE-MAPK signal prevents haploid and diploid srblO  yeast  from developing filaments, and activating transcription of an FRE dependent reporter gene, I conclude that SrblO must exert its effect on Ste12 only after Ste12 activates transcription.  Ideally one would like to directly test this  hypothesis by examining the phosphorylation state of Ste12 derivatives 99  Srb10 phosphorylates Ste12 Figure 4.2 Deletion of srbW elevates diploid pseudohyphal growth in a STE-MAPK dependent manner A)  The  yeast  MLY183a/ct(tec 1/tec and  YCN81 (srbl0/srb10,  strains  L5366  1), YCN60(srb 10/srb ste11/ste11)  (WT),  10),  MLY216a/ct  YCN80(srb 10/srb  10,ste  (ste12/ste12),  12/ste  12),  bearing an FRE-lacZ reporter were grown  to mid-log phase in selective media and assayed for p-galactosidase activity. Results are an average of three determinations with standard deviation shown. B)  The indicated strains described in A) were streaked on SLAD media and  photographed after 3 days growth at 30°  100  Srb10  phosphorylates  Ste12  101  Srb10 phosphorylates Ste12 incapable of binding DNA as this approach convincingly showed that Gal4 is phosphorylated as a consequence of activation (184).  This experiment is  technically impossible to perform on Ste12 because alleles lacking the DNA binding domain can associate with promoters via interaction with other transcription factors like Mcm1, which is encoded by an essential gene. The requirement of a functional STE-MAPK pathway for filamentous response has led to the suggestion that this signaling pathway must receive, decipher and transmit separate signals for pheromone and filamentous response within the same cell (Figure 1.2). Since signal integrity is maintained (pheromone does not stimulate invasive growth, and nutrient deprivation does not induce mating), it appears that this MAPK cascade transmits separate signals. However despite great efforts, no stimulus or receptor has been identified that regulates this MAPK cascade in response to nutrient deprivation.  The data I present here offer a simpler explanation for the requirement of the STE-MAPK in yeast filamentous response. The critical observation that seems to have been overlooked is that Ste12 activity, and expression is dependent on upstream components. Because hyperactivity of Ste12 in an  srb10  strain is still dependent on STE11, a simpler interpretation of published  data is that the only requirement of the STE-MAPK in filamentous growth is to provide Ste12 activity at low basal levels. Results in Chapter 4 and 5 suggest that an independent Srb10 dependent pathway modifies the potency of basally active Ste12, and this pathway regulates filamentous response.  102  SrblO phosphorylates Ste12  4.2.2  SrblO phosphorylates Ste12 in vitro  Because hyperfilamentous growth of s r b W strains requires Ste12 activity, I wondered if SrblO directly regulated Ste12 by phosphorylation. Srb10/Srb11 complexes purified in a baculoviral expression system are capable of phosphorylating Gal4 and the RNA polymerase CTD in vitro  (84). I tested the  ability of this purified complex to directly phosphorylate full-length recombinant Ste12. Srb10/11 could phosphorylate recombinant Ste12, but not GST-Dig1 or GST-Dig2 in vitro  (Figure 4.3). Phosphorylation was dependent on SrblO kinase  activity as Ste12 was only weakly phosphorylated when incubated with a kinaseinactive allele of Srb10D290A (Figure 4.3, lane 2). Tryptic phosphopeptide analysis of Ste12 recovered from in vitro  kinase reactions produced two  phosphopeptides (Figure 4.3A, spots 3 and 4), indicating that SrblO could directly modify at least two residues on Ste12. Human p 4 2 phosphorylate Ste12 in vitro  (Figure 4.3A, p42  ERK2  ERK2  can also  ) , however based on tryptic  phosphopeptide analysis, this kinase phosphorylates different residues on Ste12, indicating that Srb10/11 complexes retain some substrate specificity in (Figure 3.4B, p42  To  ERK  vitro  ).  determine if SrblO phosphorylated Ste12 in vivo,  yeast expressing  Ste12 from a galactose inducible promoter were labeled with P orthophosphate, 3 2  and Ste12 recovered by immunoprecipitation. diploids, is a heavily phosphorylated protein in vivo,  Ste12, expressed in haploids or as tryptic phosphopeptide 103  Srb10 phosphorylates Ste12 Figure 4.3 Ste12 is phosphorylated by Srb10 in vitro. A) In vitro  kinase assays were performed with purified recombinant WT Srb10/11  (lanes 1,3 and 4) or kinase mutant D290A Srb10/11 (lane 2) and recombinant WT  Ste12 (lanes 1 and 2), GST-Dig1 (Iane3) or GST-Dig2 (lane 4). The  presence of GST - D i g l and GST-Dig2 is demonstrated by anti-GST Western blotting (lanes 5 and 6, W.b.) B) Left, peptides in vitro p42  (labeled 3 and 4). Right,  Srb10/11 complexes phosphorylate two  In vitro  phosphorylation of Ste12 with  ERK2 produces phosphopeptide 1, which migrates as a doublet in the  chromatographic dimension, probably due to cysteine/methionine oxidation-state isomers. The author acknowledges K. Lund for performing kinase assays in panel A).  104  SrblO  phosphorylates  Ste12  Kinase ?! ?!  cm  W.b.  55 55 o  q  i-  ^  SrblO W D W W 5  Q kDa  Ste12 « f —  116  SrblO (  6 6  1  2 3 4  5  6  SrblO  105  Srb10 phosphorylates Ste12 analysis of in vivo  labeled Ste12 produced at least 8 phosphopeptides, with a  migration pattern resembling a previous report (89) (Figure 4.4, WT).  The  phosphorylation pattern of Ste12 recovered from s r b W cells lacked two phosphopeptide spots, previously numbered 3 and 4 (89)(Figure 4.4, Since phosphopeptides 3 and 4 produced from in vitro  srb10).  phosphorylation with  Srb10/11 complexes co-migrate with phosphopeptides 3 and 4 from in  vivo  labeled Ste12 (Figure 4.6), I concluded that Srb10 directly phosphorylates two Ste12 residues.  4.2.3  Serine 261 and Serine 451 are directly phosphorylated by Srb10  After establishing that Srb10 directly phosphorylated Ste12, I wanted to identify the sites of phosphorylation. CDK consensus sites are weakly defined by a serine or threonine followed by a proline (S/T-P). Ste12 has 66 serines and threonines with 10 CDK consensus sites.  Previous analysis of Ste12  phosphorylation localized 6 phosphorylations to the central third (216-473) of the protein, and identified serine 261 as the phosphorylation site producing phosphopeptide 3 (88). Analysis of the in vivo  phosphorylation state of a Ste12  (S261A) confirmed this observation, as phosphopeptide 3 is absent from tryptic maps of this protein (Figure 4.6, S261A). Furthermore, recombinant Ste12 (S261A), mutant protein, produced in baculovirus, is not phosphorylated by Srb10/11 complexes in vitro  (Figure 4.7). These data indicate that Ste12 (S261)  is phosphorylated by Srb10. 106  SrblO phosphorylates Ste12 Figure 4.4 SrblO is required for production of Ste12 phosphopeptides 3 and 4 in vivo Wild type (WT) or srblO  yeast strains expressing the STE12 from a galactose  inducible promoter were labeled with [ P]-orthophosphate and Ste12 protein was 32  recovered by immunoprecipitation and subjected to tryptic phosphopeptide analysis as described in Materials and Methods.  107  SrbW  phosphorylates  Ste12  2  1  1  o  4 6 W  WT  srblo  108  SrMO phosphorylates Ste12  Deletion analysis indicated that the phosphorylation responsible for production of phosphopeptide 4 must reside between amino acids 216 and 473 (88), a region of Ste12 that is highly acidic and contains 14 phosphorylatable tryptic peptides (88) (Table 3.1).  Tryptic phosphopeptide mapping resolves  peptides based on their charge to mass ratio (1 dimension) and hydrophobicity st  (2 dimension). The distance traveled in the first dimension is thus a function of nd  the amino acids contained in that peptide, and the pH at which electrophoresis is carried out. Similarly, averaging the empirically determined Rf values of the constituent amino acids can approximate peptide migration in the second dimension.  To compile a list of putative phosphorylation sites that could  generate phosphopeptide 4,1 calculated the electrophoretic and chromatographic mobilities of all phosphorylatable tryptic peptides between amino acids 216 and 473  (Table 5).  It is important to note that calculated mobilities are usually  accurate at predicting the relative  migration  of peptides within a given sample. In  other words, one cannot define the precise distance a phosphopeptide will travel, but can usually predict where a phosphopeptide will resolve compared to another. When plotted in 2 dimensions, two candidate peptides were predicted to migrate with the properties of phosphopeptide 4 (Table 5 and Figure 4.5); below and to the left of phosphopeptide 3.  109  SrblO phosphorylates Ste12  Table 5. Predicted tryptic phosphopeptide mobilities of Ste12 (216-473)*. Position of cleavag e 222 229 236 272  A B C D  295  E  299 301 349  F G H  360  I  Resulting Tryptic Peptide  Phosphorylatable?  Peptide Length (AAs)  Peptide Mass (Da)  Peptide charge' ' (pH 1.9)  2RPSSTTK SDNSPPK LESENFK DNELVTVTNQ PLLGVGLMD DDAPESPSQI NDFIPQK LIIEPNTLELN GLTEETPHDL PK NTAK GR DEEDFPLDYF PVSVEYPTEE NAFDPFPPQA FTPAAPSMPI SYDNVNER DSMPVNSLLN  Y Y Y Y  7 7 7 36  775.419 743.345 865.418 3908.899  Y  23  Y N Y  Rf  +2 +1 +1 +1  Charge/Mas s (charge/Day x10" 2.58 1.35 1.16 0.26  0.341 0.309 0.411 0.429  2585.359  +2  0.77  0.469  4 2 48  432.233 231.133 5493.450  +1 np +1  2.31 np 0.18  0.278 np 0.469  Y  11  1244.618  +1  0.80  0.422  Y  19  2092.063  +1  0.48  0.479  Y Y N Y  7 9 2 12  932.429 932.429 275.148 1323.638  +2 +1 np +1  2.14 1.07 np 0.76  0.366 0.342 np 0.436  Y  21  2473.016  +2  0.81  0.355  Y Y  9 24  985.458 2859.307  +2 +2  2.03 0.70  0.287 0.424  N  10  1077.426  np  np  np  1  3  D  379  J  386 395 397 409  K L M N  430  0  439 463  P Q  473  R  r\  YPYQLSVAPT FPVPPSSSR QHFMTNR DFYSSNNNK EK LVSPSDPTSY MK YDEPVMDFD ESRPNENCT NAK SHNSGQQTK QHQLYSNNF QQSYPNGMV PGYYPK MPYNPMGGD P  calculations performed as described (14). _=contributes positive charge at pH1.9. *= R/KP sequences are not cut by trypsin, thus contribute an additional positive charge. S/T=phosphorylatable residue np= not phosphorylatable *= assuming a single phosphorylation t =  110  Srb10 phosphorylates Ste12 Figure 4.5 Predicted mobilities of tryptic phosphopeptides contained in Ste12 216-473. The relative migration of the tryptic peptides was predicted according to Boyle  et  al (reference 14;Table 5). Letters indicate the peptides listed in Table 5.  111  SrbW  phosphorylates  Ste12  r 0.6  Electrophoresis  Charge/Mass Ratio (charge/m.w.)x10 3  112  Srb10 phosphorylates Ste12 These peptides would have to be phosphorylated at T405, S445 or S451. To test this prediction, site directed mutagenesis was used to create T405A, S445A, and S451A alleles of STE12. These alleles were introduced into ste12  yeast,  and over-expressed protein immunoprecipitated and subjected to tryptic phosphopeptide mapping. Mutation of either threonine 405 or serine 445 to alanine had no effect on the number or pattern of Ste12 phosphopeptides detected (Figure 4.6). In contrast, mutation of serine 451 to alanine produced a tryptic phosphopeptide map lacking spot 4 (Figure 4.6), suggesting that this serine was the second site directly phosphorylated by Srb10. Consistent with this prediction Ste12 (S451A) produced in baculovirus is only weakly phosphorylated by Srb10/11 complexes in vitro  (Figure 4.7), and phosphopeptide  analysis confirms that only phosphopeptide 3 is modified when this protein is used as substrate (Figure 4.7B, S451A)  These data demonstrate that Srb10 phosphorylates S261 and S451 of Ste12 both in vitro 4.2.4  and in  vivo.  Ste12 S261/451 phosphorylation require fermentable carbon The activity of the Srb10/11 complex is sensitive to nutrient availability  (see  Introduction). Under conditions of nitrogen starvation, the stimulus that  triggers pseudohyphal development, Srb10 protein and kinase activity are dramatically reduced as measured by kinase assays with immunoprecipitated Srb10 (69, 149). Consistent with this observation, Srb10 dependent  113  SrblO phosphorylates Ste12 Figure 4.6 Ste12 S261 and S451 are SRB10 dependent phosphorylation sites. Yeast strains expressing the indicated STE12 alleles were labeled with [ P]32  orthophosphate and Ste12 protein was recovered by immunoprecipitation and subjected to tryptic phosphopeptide analysis. Tryptic phosphopeptides derived from SrblO kinase assays (in vitro)  and in vivo  phosphorylated Ste12 (Panel 1)  were mixed prior to 2D resolution (Panel 6) to demonstrate that SrblO phosphorylates the same peptides in vivo  and in  vitro.  114  SrblO  STE12(WT)  STE12(T405A)  1 6  V  phosphorylates  Ste12  STE12 (S445A)  2  *  *5  3  *m  v 2  t  *  c  3  4  #  5 1 #  2  6  3 6  STE12 (S261A)  4  STE12 (S451A)  3  in vivo + in vitro  115  SrblO phosphorylates Ste12 Figure 4.7 SrblO phosphorylates S261 and S451 in vitro. A) In vitro  kinase reactions were performed with purified recombinant WT  Srb10/11 and recombinant Ste12 (WT), Ste12 S261A, or Ste12 S451A substrate. Lower: Equivalent amounts of substrate protein were present as demonstrated by anti-Ste12 immunoblotting. B) Phosphopeptide analysis of in vitro phosphorylated Ste 12 S451A from A).  116  Srb10  phosphorylates  Ste12  S451A, In Vitro  117  Srb10 phosphorylates Ste12  phosphorylations are absent from Ste12 recovered from cells shifted to nitrogen depleted media (149). The C-type cyclin, Srb11, is degraded when cells are denied fermentable carbon (40). Since depletion of fermentable carbon is the stimulus that triggers haploid invasive growth I reasoned that Srb10 regulation of Ste12 might be controlled by carbon source.  To determine if the Srb10 dependent  phosphorylations on Ste12 are sensitive to carbon source I examined the phosphorylation state of Ste12 in fermentable (raffinose) and non-fermentable (glycerol) carbon sources. Because over-expression of Ste12 causes cell cycle arrest, I metabolically labeled WT yeast bearing high copy plasmids expressing Gal4 (1-147)-Ste12 (216-688), which cannot induce cell cycle arrest when overexpressed, but harbors 6 of 8 natural phosphorylation sites. Gal4-Ste12 recovered from raffinose  grown  cultures contained  all 6 expected  phosphopeptides, plus an additional peptide presumed to be from an unmapped phosphorylation site in the Gal4 DBD (Figure 4.8, Raffinose). In contrast Gal4Ste12 recovered from glycerol grown cultures lacked phosphopeptide 3, and 6, while phosphopeptide 4 was dramatically under-phosphorylated (Figure 4.8B). Quality nitrogen (69), and carbon sources (Figure 4.8) are required for Srb10 activity towards Ste12, strongly indicating that Srb10 regulates Ste12 activity in response to nutrient availability.  118  SrblO phosphorylates Ste12 Figure 4.8 Phosphorylation of Ste12 S261/S451 is dependent on fermentable carbon. The yeast strain Y A 0 6 was transformed with plasmids expressing Gal4(1-147)Ste12(216-688) from the A D H 1 promoter were grown to mid-log phase in the absence of fermentable carbon. Cells were split and raffinose added to one culture for 2 h prior to labeling with P orthophosphate. Gal4-Ste12 protein was 3 2  immunoprecipitated from cultures and resolved by SDS-PAGE (A). Labeled Gal4-Ste12 isolated from glycerol and raffinose was also subjected to tryptic phosphopeptide mapping.  119  Srb10  >—I  Li. U. <  G4STE12  phosphorylates  GLYCEROL  Ste12  RAFFINOSE  • 41 :  1  2  3  'W''  4  120  SrblO phosphorylates 4.2.5  Ste12  Mutation of S261 and S451 to alanine elevates pseudohyphal growth, but does not affect pheromone response. Yeast lacking srblO  are hyperfilamentous with elevated levels of F R E  dependent transcription (Figure 4.1-4.3, and (78)), indicating that SrblO antagonizes Ste12. However, srblO  strains mate with normal efficiency, and do  not exhibit elevated transcription from PREs (78). particular facet of Ste12 activity.  SrblO thus regulates a  To further explore this observation, I  characterized the behavior of phosphorylation site mutants of Ste12 with the rationale that mutation of the SrblO dependent phosphorylation sites should have a similar phenotype to deleting SrblO. To measure the effect that S261  and S451  phosphorylation have on FRE transcription and filamentous response, various  STE12 alleles were integrated in single copy, to the chromosome of haploid ste12  yeast.  Integration of WT STE12,  under the control of its native promoter,  to the a d e 8 locus restored pheromone response and invasive growth (Figure 4.10) to the parent ste12 of STE12  strain. Complementation with S261A or S451A alleles  alone, or in combination, had no effect on basal or induced pheromone  response as measured by halo assay or F U S 1 - l a c Z reporter gene expression (Figure 4.10).  Thus it appears that SrblO phosphorylation does not affect  pheromone response. Surprisingly, S261A, S451A or S261A/S451A alleles behaved as WT when assayed for invasive growth in either W303 or Sigma 1278b genetic backgrounds (not shown). Repeated attempts in which media, incubation time, and washing method were independently varied could not identify conditions that would demonstrate a reproducible  difference in invasive 121  SrbW phosphorylates  Ste12  growth of haploids between any of the described STE12 alleles. In a single cell invasive growth assay, subtle increases in filamentous morphology were observed with the S T E 1 2 ( S 2 6 1 A / S 4 5 1 A ) allele (P. Cullen, personal communication), and occasionally modest differences in cell morphology could be observed after plate washing.  To assay for pseudohyphal development, homozygous diploid strains were derived from parental haploids.  When streaked on synthetic-low-  ammonium-dextrose (SLAD) supplemented with uracil and adenine for auxotrophic requirements, STE12 dependent pseudohyphal development was readily detected as colonies with long, multicelled projections emerging from the body of the colony (Figure 4.9, STE12). This phenotype was exaggerated if  STE12(S261A) (Figure 4.9, S261A) or STE12(S451A) (Figure 4.9, S451A) were integrated. To measure filamentous responsive transcription, diploids bearing integrated STE12 alleles were transformed with an FRE-lacZ reporter, and pgalactosidase activity measured on cultures shifted to liquid SLAD media for 4 hours. As observed in haploids, FRE transcription is dependent on STE12 (Figure 4.9, compare ste12  and STE12). Mutation of either S261A or S451A  increased FRE transcription by 3-4 times that of wild-type STE12, enforcing the hypothesis that Srb10 phosphorylation inhibits Ste12's ability to activate transcription from FREs.  Mutating both phosphorylation sites elevated  transcription only marginally compared to single S-A mutants, suggesting that both phosphorylations are necessary to inhibit Ste12 activity.  122  SrblO phosphorylates  Ste12  Figure 4.9 S261A and S451A alleles elevate pseudohyphal growth and FRE dependent transcription. A) Homozygous diploid yeast bearing the indicated alleles of S T E 12 were streaked on synthetic-low-ammonium-dextrose (SLAD) media and photographed after 3 days growth. B) Strain described in A) bearing FREAacZ reporter were grown to mid-log phase, shifted to SLAD media for 4 hours and p-galactosidase activity measured. Results are the average of three independent measurements, with standard deviation shown.  123  SrblO  phosphorylates  Ste12  B  ste 72  I  i  O 4 <  i WT  3CQ  3  IE 2 mm  S261A  TO 1 WT  S451A »  S451A ^w^ ' 1  fill  124  SrbW phosphorylates Ste12 Figure 4.10 Ste 12 S261 and S451 do not regulate pheromone response or PRE dependent transcription. A) The yeast strains MLY216a (ste72), YA01 (WT) or YCN61  (srblO)  were  transformed with plasmids bearing the indicated STE12 alleles and activity of integrated F U S 1 - l a c Z reporter measured before (open bars) or after (closed bars) treatment with 2  \ig/m\  alpha factor B) Pheromone response halo-assays  were performed on the strains described in A) by spotting 20 |xg of synthetic afactor on sterile discs on a lawn of cells.  125  SrbW phosphorylates Ste12  4.2.6  S261A/S451A mutants do not affect DNA binding of Ste12.  Mutation of serines 261 and 451 to alanines does not effect basal or pheromone inducible transcription from PREs, but FRE dependent transcription and pseudohyphal response are elevated. Since separate complexes bind to, and regulate transcription from, these sequences, one possible mechanism by which Srb10 could differentially regulate Ste12 activity would be to control Ste12 interaction with these elements. I used chromatin immunoprecipitation (ChIP) to measure Ste12 occupancy of known binding sites within promoters of both pheromone inducible and filamentous response genes (Figure 4.11). Ste12 was readily detectable at the promoters of FUS1 and TEC1 genes, but not at CLN1 or  HIS4.  Strains harboring STE12 alleles with S261A or S451A or both did not  have altered affinity for FREs (TEC1,Ty1 promoters). This effect was mirrored in diploid strains, and demonstrates that phosphorylation of Ste12 on S261 and S451 does not regulate the ability of Ste12 to interact with filamentous response elements, and thus Srb10 does not inhibit filamentous response by modulating Ste12's interaction with FREs.  4.3  Conclusions  The results presented in this chapter identify a novel signaling pathway that utilizes the RNA polymerase holoenzyme machinery as a means to simultaneously transmit information to potentially all gene specific transcription  127  SrblO  phosphorylates  Ste12  factors. I have demonstrated that SrblO, a CDK in the mediator sub-complex of the RNA Pol II holoenzyme, directly phosphorylates Ste12.  Using tryptic  phosphopeptide mapping I identified two serine residues on Ste12 that are phosphorylated by SrblO in vitro  vivo.  and required for phosphorylation by SrblO in  These phosphorylations, at S261 and S451, have a negative effect on  Ste12 activity, and filamentous growth as mutation of these sites to alanine results in elevated Ste12 dependent transcription, and hyperfilamentous growth. The ability of SrblO to phosphorylate Ste12 is dependent on fermentable carbon, an observation that is consistent with SrblO activity being sensitive to environmental and nutritional stress. Together, these observations support a model of SrblO limiting Ste12 activity, and filamentous response in rich media. Starvation antagonizes SrblO and stabilizes Ste12 (149), facilitating induction of filamentous response genes. Because other transcription factors are also regulated by SrblO phosphorylation (30, 84), this pathway appears to coordinate expression of diverse gene sets with the growth potential of the cell.  128  Srb10 phosphorylates Ste12 Figure 4.11 Srb10 phosphorylation does not regulate Ste12 DNA binding in vivo. The homozygous diploid yeast strains MLY216a/a(ste7'2;, YCN52(WT), YCN57(STE72(S261A/S451A)), and YCN60(srM0) were grown to mid-log phase in YEPD, wash three times in SLAD media, resuspended in the same and allowed to grow for a further 4 h. Cells were subjected to formaldehyde crosslinking and chromatin immunoprecipitation as described in Materials and Methods. Total genomic DNA (odd numbered lanes) or immunopurified DNA fragments (even numbered lanes) were used a templates in multiplex P C R reactions containing oligonucleotide primers for the Tyl(FRE), the T e d (FRE), the CLN1 promoter, and the HIS4  open reading frame.  129  Srb10  phosphorylates  -  Tecl(FRE)  Ste12  bps  2 5 0 * > * * »  ste12  WT  m»»*  S261A/  S451A  m** e  .  i f t  s r b 1  °  130  SrbW controls Ste12 Stability  Chapter 5  Srb10 phosphorylation regulates Ste12  degradation 5.1  Foreword  Phosphorylation can regulate the activity of enzymes by multiple mechanisms.  Transcription factors positively control gene expression by  simultaneously associating with components of the RNA polymerase holoenzyme, and DNA sequence elements within promoters.  Activity of  transcription factors can be further controlled by interaction with regulatory proteins. Ste12 activates transcription from filamentous response genes, and this aspect of Ste12 function requires association with T e d and FREs. Digl and Dig2 inhibit Ste12, and the role of the MAPKs Fus3 and Kss1 in filamentous response is complicated by the fact that Kss1 exerts both positive and negative roles in filamentous response. Thus there are several candidate facets of Ste12 function that could be affected by phosphorylation of S261 and S451. The experiments in this chapter address how Srb10 phosphorylation of Ste12 inhibit filamentous response, while having seemingly no effect on pheromone response. Instead of controlling interaction of Ste12 with DNA or a known regulatory protein, I demonstrate that S261 and S451 phosphorylation control the stability of Ste12. I then present evidence that activity of the SCF ubiquitin ligase complex is required for Ste12 degradation, and although I have not shown Ste12 ubiquitination directly, I do identify a putative ubiquitination site, as a lysine residue which is essential for Ste12 degradation. 131  SrbW controls Ste12 Stability 5.2 5.2.1  Results and Discussion Phosphorylation of S261 and S451 promote Ste12 degradation  Phosphorylation can target proteins for degradation. To determine if Srb10 phosphorylation of Ste12 modulates Ste12 protein stability I measured the half-life of Ste12 alleles by  3 5  S pulse chase labeling. Ste12 expression was  placed under control of the GAL1 promoter and a burst of labeled Ste12 protein was produced by addition of galactose for one hour, in the presence of  3 5  S  methionine. Cultures were harvested and shifted to fresh, glucose containing media supplemented with 25 mM methionine (t=0), and aliquots removed at the indicated times. Following immunoprecipitation, Ste12 was visualized by SDSPAGE and autofluorography.  Ste12 expressed in WT cells had a half-life of  approximately 30-40 min (Figure 5.1, Ste12). Mutation of serine 261 and 451 to alanine increased Ste12 half-life to beyond 90 min (Figure 5.1, S261A/S451A), indicating that Srb10 phosphorylation of these residues likely inhibits Ste12 by promoting degradation of the transcription factor. Consistent with this model, the half-life of WT Ste12 protein was extended beyond 60 min when expressed in an  srb10  strain (Figure 5.1, srbW).  These observations strongly suggest that Srb10  antagonizes Ste12 activity by controlling its abundance.  132  SrMO  controls  Ste12  Stability  Figure 5.1 Stability of Ste12 is controlled by Srb10. A)  Pulse-chase analysis of Ste12. ste12  vector control (ste12)  or ste12srb10  (srb10) yeast carrying a  or GAL-expression plasmids producing wild-type STE12  or  STE12 (S261A/S451A) were labeled with [ S]-methionine in the presence of 35  galactose for 1 h. Samples were chased into Y E P D medium plus 25 mM methionine, and Ste12 recovered by immunoprecipitation at the indicated times. The experiment was repeated with similar results. B) Quantification of pulse chase data.  133  SrbW  Ste12  Stability  chase(min)  n  v  controls  0  10  20  40  60 90  ' i H r f  ^ ^  W  W  f  c  - t  S261A/S451A S r b 1  °  125  WTSte12, WT S261A/S451A, WT WTSte12, srblO  Time(min)  134  SrMO  controls  Ste12  Stability  These results can account for the increase in FRE dependent transcription and consequent increased filamentous response associated with the STE12 (S261A/S451A) allele, and srblO strains. However they do not explain why mutation of these sites has no effect on pheromone response or PRE driven gene expression. A previous report compared STE12 expression in haploid and diploid yeast, and found that STE12 mRNA is 5 to 10 fold lower in diploids relative to haploids.  I observe a similar reduction of Ste12 protein in wild-type  yeast (Figure 5.2, compare lanes 2 and 3). Together these observations indicate that filamentous growth of a diploid cell, which has significantly less Ste12, is much more sensitive to Ste12 dosage. This can explain the observation that diploid, but not haploid cells exhibit noticeable phenotype when expressing  STE12 (S261A/S451A). In contrast, srblO yeast are hyperfilamentous in both cell types (Figures 4.1 and 4.2), implying that other targets that control filamentous response are likely negatively regulated by SrblO. 5.2.2  Ste 12 degradation requires Cdc34 of SCF  Transcription of amino acid biosynthetic genes is positively regulated by Gcn4, a transcription factor of the basic leucine-zipper (bZIP) family.  Under  conditions of nutrient availability Gcn4 is turned over rapidly, in a ubiquitin dependent  manner.  The S C F ubiquitin  ligase complex recognizes  phosphorylated Gcn4, and targets it for degradation by the 26S proteosome (109). Recently, SrblO was identified  135  SrblO  controls  Ste12  Stability  Figure 5.2 Ste12 expression is low in diploids Extracts were prepared from MLY216a(MATa ste12,  lane 1), HLY333(MATa,  lane 2) or L5366(MATa/a, lane 3). Total protein (200 ug) was resolved by  SDS-  PAGE, and proteins detected by immunoblotting with antibodies to Ste12 (top), or actin (bottom).  136  Srb10  STE12 MAT  +  a  a  controls  Ste12  Stability  +  a/a "f  a-Ste12 a-Actin  137  SrbW as  controls  Ste12  Stability  one of two CDKs that could phosphorylate Gcn4 and promote its S C F  dependent degradation when nutrients are readily available (30). As  Ste12 degradation  is also regulated  by Srb10 dependent  phosphorylations in rich media, the S C F ubiquitin ligase complex could be the machinery which catalyses Ste12 degradation. To explore if S C F prepares Ste12 for degradation, I measured the half-life of Ste12 in temperature sensitive mutants of S C F components. To simplify pulse-chase analysis I developed a non-radioactive approach to measuring Ste12 abundance. expressed from the G A L 1  Ste12 was still  promoter but Ste12 protein was detected by  immunoblotting whole cell lysates instead of immunoprecipitation from labeled extracts.  3 5  S  After one hour of induction with galactose, glucose and  cyclohexamide were added to stop transcription and translation of Ste12 respectively. Also a single flag epitope was added to the C-terminus of Ste12 to improve signal to noise ratios of immunoblots. WT Ste12-flag had a half-life of approximately 30 min (Figure 5.3), a value comparable to that determined from 35  S  labeled pulse chases (Figure 5.1). Components of SCF  are essential, so to  address the importance of this complex in Ste12 degradation, cells bearing a  cdc34  temperature sensitive allele were transformed with a vector expressing  galactose inducible Ste12-flag, and cultures were pulsed-chased at the nonpermissive temperature of 37°C. WT Ste12-flag maintained a half-life of 30 min in wild-type yeast at this temperature.  However S C F activity appears to be  necessary for proteolysis of Ste12, as the stability of Ste12-flag was extended in  138  SrblO  controls  Ste12  Stability  Figure 5.3 Ste 12 degradation requires the SCF ubiquitin ligase complex. Pulse-chase analysis of Ste12. A) Wild-type yeast (WT) or a strain bearing a temperature sensitive allele of the S C F component Cdc34 (cdc34)  were  transformed with a GAL-expression plasmids producing wild-type Ste12-flag and were grown to mid-log phase in ura- raffinose media at 25°C. Cells were shifted to 37°C for 2 h, when galactose was added to a final concentration of 2%. After 1 h (pulse), glucose (to 2%) and cyclohexamide (to 10 ng/ml) were added (chase, t=0).  Samples were removed at the indicated times, resuspended in  SDS-loading buffer and boiled. Following SDS-PAGE, Ste12 proteins were detected by immunoblotting with anti-Flag antibodies. The experiment was repeated with similar results. B) Quantification of pulse-chase data.  139  SrblO  controls  Ste12  Stability  140  Srb10 the temperature sensitive cdc34  strain (Figure 5.3, cdc34).  controls  Ste12  Stability  It is important to note  that this observation is not evidence that Ste12 is ubiquitinated, as shifting cells to the non-permissive temperature in a cdc34  mutant inhibits ubiquitin  incorporation throughout the cell. It is entirely possible that the effect is indirect, and  that ubiquitination of an unknown factor is required for proper degradation of  Ste12.  From these results I conclude that Ste12 degradation is positively  affected by the SCF  ubiquitin ligase complex. Attempts at resolving the relevant  substrates and the cognate E3 activity are currently underway. 5.2.3 K463R increases invasive growth Srb10 phosphorylates serine 261 and 451 on Ste12 (Chapter 4). Alignment of the amino acid sequences flanking these sites reveals moderate sequence similarity (Figure 5.4A). Of note were lysines at positions 272 and 463. I reasoned that if phosphorylation promoted degradation, these residues could be potential sites of ubiquitination, or other covalent modifications. If this hypothesis is correct, mutation of target lysines to arginine should stabilize Ste12 and confer a hyperfilamentous phenotype.  Indeed mutation of lysine 463 to arginine  resulted in hyperinvasive haploid yeast (Figure 5.4, K463R). This phenotype was easily scored in haploid yeast: a phenotype much stronger than that of the Ste12  141  SrbW  controls  Ste12  Stability  Figure 5.4 K463R mutation elevates filamentous growth. A)  Ste12 sequences flanking the S261 and S451 were aligned using the blossum  62 algorithm. Identical residues are shaded. Of note are the lysine residues at position 272 and 463 (arrow). B) HLY352 (WT), YCN52(S261A/S451A), YCN83(K273R), and YCN84(K463R) were grown to saturation and 25 ^l spotted on a YEPD plate and grown at 30°C for 3 days. Plates were photographed before and after washing with a stream of water.  142  SrbW  controls  Ste12  Stability  SrbW  controls  Ste12  Stability  S261A/S451A mutant. This phenotype indicates that K463 may regulate Ste12 in the same pathway as S261 and S451, and likely functions downstream of phosphorylation. 5.2.4  Mutation of K463R of STE12 stabilizes Ste12  Mutation of STE12 K463R increases filamentous response, a phenotype resembling that of srbW  strains and Ste12S261A/S451A mutants. To determine  if this lysine residue is also involved in controlling Ste12 protein stability I measured the half-life of this mutant by pulse-chase Western blotting as described in Chapter 4. Like removal of Srb10 dependent phosphorylations, and the Srb10 kinase, mutation of K463R increases the half-life of Ste12 from 30 min to greater than 2 h (Figure 5.6). This result implies that modification of this lysine could target Ste12 for proteolysis. 5.2.5  K463 is not required for S261/S451 phosphorylation  Because the phenotype of STE72(K463R) is more severe than STE12 (S261A/S451A) it appears the role of lysine 463 likely lies downstream of phosphorylation. However it remains possible that this residue is simply required for Srb10 phosphorylation of Ste12. To rule out this possibility, I analyzed the phosphorylation state of both the K463R allele by in vivo  tryptic phosphopeptide  mapping. Ste12K463R was labeled as efficiently as WT Ste12 (not shown). Consistent with the prediction that lysine modification likely lies downstream of  144  SrMO  controls  Ste12  Stability  Figure 5.5 Lysine 463 is necessary for Ste12 degradation. Pulse-chase analysis of STE12 (K463R) allele. ste12 yeast bearing GALexpression plasmids producing wild-type STE12 (WT) or K463R STE12 (K463R) were grown to mid-log phase in ura" raffinose media. Galactose was added for 1 h (pulse), followed by addition of glucose (to 2%) and cyclohexamide (to 10ug/ml) (chase). Samples were removed at the indicated times, resuspended in SDS-loading buffer and boiled. Following SDS-PAGE, Ste12 proteins were detected by immunoblotting with anti-Flag antibodies.  145  Srb10  controls  Ste12  Stability  chase(h) gly  0 0.5 1 ^|P|r  ^^^^P  2 WT K463R  146  Srb10  controls  Ste12  Stability  Srb10 dependent phosphorylation, mutation of lysine to arginine did not prevent phosphorylation of Ste12 on any sites (Figure 5.7, K463R). In fact this mutation appears to increase the relative abundance of all three phosphorylations which promote Ste12 degradation, namely S226 (represented by phosphopeptide 6 (88)) and S261/S451 (phosphopeptides 3 and 4, Chapter 4). Thus mutation of K463R permits accumulation of these phosphorylated species, which are normally targeted for proteolysis, supporting the notion that K463R is required for phosphorylation dependent Ste12 turnover. 5.2.6 Ste12 regulated genes are differentially affected by the K463R allele of Ste12. Presumably the mechanism by which STE12(K463R) i n c r e a s e s filamentous growth involves increased expression of factors that promote invasive growth. To determine if STE12(K463R) increases haploid invasive growth by increasing expression of FRE dependent genes I measured the expression levels of Ste12 regulated genes in yeast containing integrated alleles of STE12.  Like srb10, and STE12(S261A/S451A)  (Figure 4.10), the K463R  allele does not affect either pheromone response in a halo assay (not shown), or FUS1 expression (Figure 5.5). The CWP1 gene encodes a cell wall protein that contains an FRE at position -630 to -612 of its promoter, and genome-wide localization analysis confirms that Ste12 is present at this promoter. Expression of CWP1 is also elevated 2.2-fold in s r b W strains (86). Surprisingly, deletion of  ste12 appears to increase expression of CWP1 (Figure 5.5, ste12), and this effect is mirrored as CWP1 expression decreases after 30 min of pheromone 147  SrblO  controls  Ste12  Stability  Figure 5.6 Mutation of lysine 463 to arginine does not affect SrblO phosphorylation of Ste12 Wild type yeast strains (W303-1A) expressing the either wild-type STE12 or  STE12(K463R) from a galactose inducible promoter were labeled with [ P]32  orthophosphate and Ste12 protein was recovered by immunoprecipitation and subjected to tryptic phosphopeptide analysis as described in Materials and Methods.  148  SrblO  WTSTE12  controls  Ste12  Stability  STE12(K463R)  149  SrblO  controls  Ste12  Stability  treatment (173). In strains expressing STE12(K463R), CWP1 levels are elevated when compared to WT (Figure 5.7). FL011, a second FRE regulated gene, is correlated with filamentous response in both haploids and diploid cells. Surprisingly, FL011 expression is reduced in strains expressing  STE12(K272R),  and is unaffected by STE12(K463R). These observations demonstrate that K463 does affect Ste12's ability to activate transcription of some filamentous response genes, but the different effects at two FRE regulated promoters indicates that increasing the stability of Ste12 may have different effects at different promoters. Underscoring the strength of the phenotype of the STE12(K463) allele is the fact that this mutation, but not the mutation of STE12(S261A/S451A), effects Ste12 regulated transcription  in a haploid cell (Figure 5.7). An effect  of  S7E72(S261A/S451A) is only detectable in diploids (Figure 4.9). 5.3  Conclusions  The results of the final chapter of this thesis describe the mechanism by which SrblO controls Ste12 activity, and the findings have implications for the described bi-functionality of the pheromone response pathway.  Because  mutations that abrogate signaling through the MAPK cascade abolish both pheromone and filamentous response, this pathway is thought to transmit two separate signals. In conflict with this interpretation is the fact that, apart from mating pheromone, no stimulus has been identified that can activate the STEMAPK cascade. The identification of SrblO as a regulator of Ste12 activity, and particularly Ste12 activity in filamentous growth, warrants re-examination of  150  SrbW  controls  Ste12  Stability  Figure 5.7 K463R does not affect pheromone response, but has differential effects on Ste12 dependent transcription The  yeast strain MLY216a (sfe72), YCN48(WT), YCN52 (S261A/S451 A),  YCN82(K272R), and YCN83(K463R) were grown to mid-log phase and total RNA  harvested before (uninduced) or after (pheromone treated) addition of  synthetic a-factor to a final concentration of 2 |xg/ml. RNA  was resolved on a 1%  agarose-formaldehyde gel, transferred to nylon membranes (Promega) and subject to Northern hybridization with the indicated probes.  151  SrbW  uninduced  gfc  controls  Ste12  Stability  30 min alpha factor  m  CWP1  FL011  FUS1  ACTIN  152  SrMO  controls  Ste12  Stability  previous data. An overlooked aspect of the pheromone response, is the fact that components of the STE-MAPK cascade are essential for their own expression. In naive cells, transcription of the STE12  gene itself is detectable at a basal level,  but this requires an intact STE-MAPK cascade. Thus it is entirely possible that the sole requirement for this signaling module in filamentous response is to produce a basal level of Ste12.  Srb10 phosphorylation of Gal4 at S699 is  dependent on both fermentable carbon, and Gal4's ability to bind DNA, suggesting that the phosphorylation event likely takes place during initiation of transcription. If Ste12 is regulated by Srb10 in the same way, an attractive model for Ste12 regulation in filamentous growth would solely involve protein stability. Induction of FREs is limited in rich media because Srb10 is active, and promotes Ste12 degradation. Nutrient deprivation depletes Srb10 kinase activity from the cell, which results in accumulation of Ste12, and induction of filamentous response genes. Direct testing of this model is complicated by the fact that alleles of Ste12 that do not associate with DNA are not available as even complete disruption of the DNA binding domain does not prevent Ste12 from associating with promoters. Such alleles can interact with Mem  1,  a1, and  possibly the transcription factor Kar4, and thus retain the ability to interact with the transcription machinery.  153  Future  Directions  Chapter 6 Perspectives and Future Directions  The study of Ste12 phosphorylation in this thesis has identified a new signal transduction pathway that utilizes Srb10/Cdk8, a component of the RNA polymerase II holoenzyme machinery, to disseminate signals indicative of cell health to sequence specific transcription factors (Figure 6.1). This pathway controls Ste12 turnover in rich media, and allows its accumulation under starvation conditions.  Ste12 proteolysis is dependent on the S C F ubiquitin ligase complex E2 Cdc34, but it is not clear if Ste12 is directly ubiquitinated. Experiments designed to address this point are underway, as are attempts to identify other factors controlling Ste12 degradation; namely an E3 activity, and protease. Identification of an E3 will permit direct testing of the F-box hypothesis; if Ste12 is ubiquitinated, the E3 enzyme should only recognize phosphorylated Ste12. Since the temperature sensitive allele of cdc34  causes cell cycle arrest in G1, it  will also be important to determine if Ste12 degradation is cell cycle regulated.  Experiments described in Chapter 3 also suggest that Ste12 may be directly modified in response to pheromone. speculation  in the  literature,  This has been the subject of  but two weak  pheromone  dependent  phosphorylations on Ste12 remain unmapped (89). Data presented in this thesis may explain the difficulty in detecting these modifications. Pheromone stimulation 154  Future  Directions  Figure 6.1 The model for SrblO regulation of transcription factors. As  a component of the mediator complex of RNA polymerase II holoenzyme,  Srb10/Cdk8 is strategically placed to transmit signals to a variety of promoter associated transcription factors. Srb10/Cdk8 therefore can regulate expression of RNA Polymerase II transcribed genes by modulating the activity of sequence specific DNA binding proteins.  Because SrblO activity is regulated by the  availability of nutrients (Figure 4.8), and other environmental stresses (40), it appears this CDK is responsible for limiting gene expression to a level appropriate for the immediate growth conditions.  155  Future  Directions  Future  Directions  increases Ste12 interaction with the holoenzyme, which I demonstrate can result in Ste12 degradation. Thus the more Ste12 activates transcription, the faster it is degraded. As shown in Figure 5.6, hyperphosphorylated, unstable forms of Ste12 are stabilized by mutation of lysine 463 to arginine. Hence this allele may prove to be valuable for mapping pheromone dependent phosphorylations of Ste12.  Finally SrblO's human homologue, Cdk8, is essentially unstudied. Thus it will be exciting to identify substrates for this kinase; if its function is conserved from yeast to man, Cdk8 should prove to be important in regulating expression of diverse gene sets in response to stresses.  157  References  Chapter 7 References 1. 2.  3.  4.  5.  6.  7.  8. 9.  10. 11. 12.  13.  Araujo, S. J., and R. D. Wood. 1999. Protein complexes in nucleotide excision repair. Mutat Res 435:23-33. Archambault, J., R. S. Chambers, M . S. Kobor, Y. Ho, M . Cartier, D. Bolotin, B. Andrews, C. M . Kane, and J. Greenblatt. 1997. A n essential component of a C-terminal domain phosphatase that interacts with transcription factor IIF in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 94:14300-5. Bai, C , P. Sen, K. Hofmann, L. Ma, M . Goebl, J. W. Harper, and S. J . Elledge. 1996. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86:263-74. Bard well, L., J . G . Cook, E . C. Chang, B. R. Cairns, and J . Thorner. 1996. Signaling in the yeast pheromone response pathway: specific and high- affinity interaction of the mitogen-activated protein (MAP) kinases Kssl and Fus3 with the upstream M A P kinase kinase Ste7. Mol Cell Biol 16:3637-50. Bard well, L., J . G. Cook, D. Voora, D. M . Baggott, A. R. Martinez, and J. Thorner. 1998. Repression of yeast Ste 12 transcription factor by direct binding of unphosphorylated Kssl M A P K and its regulation by the Ste7 M E K . Genes Dev 12:2887-98. Bardwell, L., J. G. Cook, J. X. Zhu-Shimoni, D. Voora, and J . Thorner. 1998. Differential regulation of transcription: repression by unactivated mitogenactivated protein kinase Kssl requires the D i g l and Dig2 proteins. Proc Natl Acad Sci U S A 95:15400-5. Bender, A., and G. F. Sprague, Jr. 1986. Yeast peptide pheromones, a-factor and alpha-factor, activate a common response mechanism in their target cells. Cell 47:929-37. Bernstein, B. E., J . K. Tong, and S. L . Schreiber. 2000. Genomewide studies of histone deacetylase function in yeast. Proc Natl Acad Sci U S A 97:13708-13. Beullens, M . , K. Mbonyi, L . Geerts, D. Gladines, K. Detremerie, A. W. Jans, and J . M . Thevelein. 1988. Studies on the mechanism of the glucose-induced c A M P signal in glycolysis and glucose repression mutants of the yeast Saccharomyces cerevisiae. Eur J Biochem 172:227-31. Bhaumik, S. R., and M . R. Green. 2001. S A G A is an essential in vivo target of the yeast acidic activator Gal4p. Genes Dev 15:1935-45. Blackwood, E. M . , and J. T. Kadonaga. 1998. Going the distance: a current view of enhancer action. Science 281:61-3. Blondel, M . , P. M . Alepuz, L . S. Huang, S. Shaham, G. Ammerer, and M . Peter. 1999. Nuclear export of Farlp in response to pheromones requires the export receptor Msn5p/Ste21p. Genes Dev 13:2284-300. Boy-Marcotte, E., M . Perrot, F. Bussereau, H . Boucherie, and M . Jacquet. 1998. Msn2p and Msn4p control a large number of genes induced at the diauxic transition which are repressed by cyclic A M P in Saccharomyces cerevisiae. J Bacteriol 180:1044-52.  158  References 14.  15.  16. 17. 18. 19. 20.  21.  22.  23. 24.  25.  26.  27.  28. 29. 30.  Boyle, W. J., P. van der Geer, and T. Hunter. 1991. Phosphopeptide mapping and phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates. Methods Enzymol 201:110-49. Breitkreutz, A., L . Boucher, and M . Tyers. 2001. M A P K specificity in the yeast pheromone response independent of transcriptional activation. Curr Biol 11:1266-71. Breitkreutz, A., and M . Tyers. 2002. M A P K signaling specificity: it takes two to tango. Trends Cell Biol 12:254-7. Brown, A. J., and N. A. Gow. 1999. Regulatory networks controlling Candida albicans morphogenesis. Trends Microbiol 7:333-8. Bukusoglu, G., and D. D. Jenness. 1996. Agonist-specific conformational changes in the yeast alpha-factor pheromone receptor. M o l Cell Biol 16:4818-23. Cairns, B. R. 1998. Chromatin remodeling machines: similar motors, ulterior motives. Trends Biochem Sci 23:20-5. Cairns, B. R., S. W. Ramer, and R. D. Kornberg. 1992. Order of action of components in the yeast pheromone response pathway revealed with a dominant allele of the STE11 kinase and the multiple phosphorylation of the STE7 kinase. Genes & Development 6:1305-18. Caldwell, G. A., F. Naider, and J. M . Becker. 1995. Fungal lipopeptide mating pheromones: a model system for the study of protein prenylation. Microbiol Rev 59:406-22. Cameron, S., L . Levin, M . Zoller, and M . Wigler. 1988. cAMP-independent control of sporulation, glycogen metabolism, and heat shock resistance in S. cerevisiae. Cell 53:555-66. Carlson, M . 1999. Glucose repression in yeast. Curr Opin Microbiol 2:202-7. Carty, S. M . , A. C. Goldstrohm, C. Sune, M . A. Garcia-Blanco, and A. L . Greenleaf. 2000. Protein-interaction modules that organize nuclear function: F F domains of CA150 bind the phosphoCTD of R N A polymerase II. Proc Natl Acad Sci U S A97:9015-20. Celic, A., N. P. Martin, C. D. Son, J. M . Becker, F. Naider, and M . E . Dumont. 2003. Sequences in the intracellular loops of the yeast pheromone receptor Ste2p required for G protein activation. Biochemistry 42:3004-17. Chang, Y. W., S. C. Howard, Y. V. Budovskaya, J . Rine, and P. K. Herman. 2001. The rye mutants identify a role for Ssn/Srb proteins of the R N A polymerase II holoenzyme during stationary phase entry in Saccharomyces cerevisiae. Genetics 157:17-26. Chasman, D. I., K. M . Flaherty, P. A. Sharp, and R. D. Kornberg. 1993. Crystal structure of yeast TATA-binding protein and model for interaction with D N A . Proc Natl Acad Sci U S A 90:8174-8. Chen, L., and N. G. Davis. 2000. Recycling of the yeast a-factor receptor. J Cell Biol 151:731-8. Chen, Q., and J. B. Konopka. 1996. Regulation of the G-protein-coupled alphafactor pheromone receptor by phosphorylation. Mol Cell Biol 16:247-57. Chi, Y., M . J. Huddleston, X. Zhang, R. A. Young, R. S. Annan, S. A. Carr, and R. J. Deshaies. 2001. Negative regulation of Gcn4 and Msn2 transcription factors by SrblO cyclin-dependent kinase. Genes Dev 15:1078-92.  159  References 31.  32.  33.  34.  35. 36.  37.  38.  39.  40.  41.  42.  43.  44.  Cho, H., T. K. Kim, H . Mancebo, W. S. Lane, O. Flores, and D. Reinberg. 1999. A protein phosphatase functions to recycle R N A polymerase II. Genes Dev 13:1540-52. Choder, M . , and R. A. Young. 1993. A portion of R N A polymerase II molecules has a component essential for stress responses and stress survival. M o l Cell Biol 13:6984-91. Choi, K. Y., J. E . Krahz, S. K. Mahanty, K. S. Park, and E . A. Elion. 1999. Characterization of Fus3 localization: active Fus3 localizes in complexes of varying size and specific activity. Mol Biol Cell 10:1553-68. Choi, K. Y., B. Satterberg, D. M . Lyons, and E . A. Elion. 1994. Ste5 tethers multiple protein kinases in the M A P kinase cascade required for mating in S. cerevisiae. Cell 78:499-512. Coin, F., and J. M . Egly. 1998. Ten years of TFIIH. Cold Spring Harb Symp Quant Biol 63:105-10. Colombo, S., P. Ma, L. Cauwenberg, J. Winderickx, M . Crauwels, A. Teunissen, D. Nauwelaers, J. H . de Winde, M . F. Gorwa, D. Colavizza, and J . M . Thevelein. 1998. Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced c A M P signalling in the yeast Saccharomyces cerevisiae. Embo J 17:3326-41. Conlan, R. S., and D. Tzamarias. 2001. Sfll functions via the co-repressor Ssn6-Tupl and the cAMP-dependent protein kinase Tpk2. J M o l Biol 309:100715. Cook, J. G., L . Bardwell, S. J. Kron, and J. Thorner. 1996. Two novel targets of the M A P kinase Kssl are negative regulators of invasive growth in the yeast Saccharomyces cerevisiae. Genes & Development 10:2831-48. Cook, J. G., L . Bardwell, and J . Thorner. 1997. Inhibitory and activating functions for M A P K Kssl in the S. cerevisiae filamentous-growth signalling pathway. Nature 390:85-8. Cooper, K. F., M . J. Mallory, J. B. Smith, and R. Strich. 1997. Stress and developmental regulation of the yeast C-type cyclin Ume3p (Srbl Ip/Ssn8p). Embo J 16:4665-75. Cosma, M . P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97:299-311. Courchesne, W. E., R. Kunisawa, and J. Thorner. 1989. A putative protein kinase overcomes pheromone-induced arrest of cell cycling in S. cerevisiae. Cell 58:1107-19. Cramer, P., D. A. Bushnell, J. Fu, A. L . Gnatt, B. Maier-Davis, N. E . Thompson, R. R. Burgess, A. M . Edwards, P. R. David, and R. D. Kornberg. 2000. Architecture of R N A polymerase II and implications for the transcription mechanism. Science 288:640-9. Cullen, P. J., and G. F. Sprague, Jr. 2000. Glucose depletion causes haploid invasive growth in yeast [In Process Citation]. Proc Natl Acad Sci U S A 97:13619-24.  160  References 45.  46. 47. 48.  49. 50.  51.  52.  53. 54. 55.  56.  57.  58.  59.  60.  61. 62.  Cutler, N. S., X. Pan, J . Heitman, and M . E . Cardenas. 2001. The TOR signal transduction cascade controls cellular differentiation in response to nutrients. M o l Biol Cell 12:4103-13. D'Souza, C. A . , and J. Heitman. 2001. Conserved c A M P signaling cascades regulate fungal development and virulence. FEMS Microbiol Rev 25:349-64. Davie, J. R., and V. A . Spencer. 1999. Control of histone modifications. J Cell Biochem Suppl 32-33:141-8. Dohlman, H . G., and J. W . Thorner. 2001. Regulation of G protein-initiated signal transduction in yeast: paradigms and principles. Annu Rev Biochem 70:703-54. Dolan, J. W., and S. Fields. 1991. Cell-type-specific transcription in yeast. Biochim Biophys Acta 1088:155-69. Drogen, F., S. M . O'Rourke, V. M . Stucke, M . Jaquenoud, A . M . Neiman, and M . Peter. 2000. Phosphorylation of the M E K K Stel lp by the PAK-like kinase Ste20p is required for M A P kinase signaling in vivo. Curr Biol 10:630-9. Edwards, A . M . , C. M . Kane, R. A . Young, and R. D. Romberg. 1991. Two dissociable subunits of yeast R N A polymerase II stimulate the initiation of transcription at a promoter in vitro. J Biol Chem 266:71-5. Edwards, P. A . , and J. Ericsson. 1999. Sterols and isoprenoids: signaling molecules derived from the cholesterol biosynthetic pathway. Annu Rev Biochem 68:157-85. Elion, E . A . 2000. Pheromone response, mating and cell biology. Curr Opin Microbiol 3:573-81. Elion, E . A . 2001. The Ste5p scaffold. J Cell Sci 114:3967-78. Elion, E . A . , J. A . Brill, and G. R. Fink. 1991. FUS3 represses CLN1 and C L N 2 and in concert with KSS1 promotes signal transduction. Proceedings of the National Academy of Sciences of the United States of America 88:9392-6. Elion, E . A . , P. L . Grisafi, and G. R. Fink. 1990. FUS3 encodes a cdc2+/CDC28-related kinase required for the transition from mitosis into conjugation. Cell 60:649-64. Elion, E . A . , B. Satterberg, and J. E . Kranz. 1993. FUS3 phosphorylates multiple components of the mating signal transduction cascade: evidence for STE12 and FAR1. Molecular Biology of the Cell 4:495-510. Feng, Y., and N. G. Davis. 2000. Feedback phosphorylation of the yeast a-factor receptor requires activation of the downstream signaling pathway from G protein through mitogen-activated protein kinase. Mol Cell Biol 20:563-74. Feng, Y., L. Y. Song, E . Kincaid, S. K. Mahanty, and E . A . Elion. 1998. Functional binding between Gbeta and the L I M domain of Ste5 is required to activate the M E K K Stel 1. Curr Biol 8:267-78. Fields, S., D. T. Chaleff, and G. F. Sprague, Jr. 1988. Yeast STE7, STE11, and STE12 genes are required for expression of cell-type-specific genes. Molecular & Cellular Biology 8:551-6. Fields, S., and I. Herskowitz. 1985. The yeast STE12 product is required for expression of two sets of cell-type specific genes. Cell 42:923-30. Fuller, R. S., R. E . Sterne, and J. Thorner. 1988. Enzymes required for yeast prohormone processing. Annu Rev Physiol 50:345-62.  161  References 63. 64.  65. 66. 67.  68.  69. 70.  71. 72.  73.  74.  75. 76.  77.  78.  79.  Gancedo, J . M . 2001. Control of pseudohyphae formation in Saccharomyces cerevisiae. FEMS Microbiol Rev 25:107-23. Garrison, T. R., Y. Zhang, M . Pausch, D. Apanovitch, R. Aebersold, and H . G. Dohlman. 1999. Feedback phosphorylation of an RGS protein by M A P kinase in yeast. J Biol Chem 274:36387-91. Gasser, S. M . , and M . M . Cockell. 2001. The molecular biology of the SIR proteins. Gene 279:1-16. Gill, G., and M . Ptashne. 1988. Negative effect of the transcriptional activator G A L A Nature 334:721-4. Gimeno, C. J., P. O. Ljungdahl, C. A. Styles, and G. R. Fink. 1992. Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and R A S . Cell 68:1077-90. Gnatt, A. L., P. Cramer, J. Fu, D. A. Bushnell, and R. D. Kornberg. 2001. Structural basis of transcription: an R N A polymerase II elongation complex at 3.3 A resolution. Science 292:1876-82. Goto, S. a. S. In preparation. Grant, P. A., D. Schieltz, M . G. Pray-Grant, D. J . Steger, J . C. Reese, J. R. Yates, 3rd, and J . L . Workman. 1998. A subset of TAF(II)s are integral components of the S A G A complex required for nucleosome acetylation and transcriptional stimulation. Cell 94:45-53. Grunstein, M . 1997. Histone acetylation in chromatin structure and transcription. Nature 389:349-52. Gustin, M . C , J. Albertyn, M . Alexander, and K. Davenport. 1998. M A P kinase pathways in the yeast Saccharomyces cerevisiae. Microbiol Mol Biol Rev 62:1264-300. Hadwiger, J . A., C. Wittenberg, H . E . Richardson, M . de Barros Lopes, and S. I. Reed. 1989. A family of cyclin homologs that control the G l phase in yeast. Proc Natl Acad Sci U S A 86:6255-9. Hagen, D. C , G. McCaffrey, and G. F. Sprague, Jr. 1991. Pheromone response elements are necessary and sufficient for basal and pheromone-induced transcription of the FUS1 gene of Saccharomyces cerevisiae. Molecular & Cellular Biology 11:2952-61. Hampsey, M . 1998. Molecular genetics of the R N A polymerase II general transcriptional machinery. Microbiol Mol Biol Rev 62:465-503. Hassig, C. A., T. C. Fleischer, A. N. Billin, S. L . Schreiber, and D. E . Ayer. 1997. Histone deacetylase activity is required for full transcriptional repression by mSin3A. Cell 89:341-7. Henchoz, S., Y. Chi, B. Catarin, I. Herskowitz, R. J . Deshaies, and M . Peter. 1997. Phosphorylation- and ubiquitin-dependent degradation of the cyclindependent kinase inhibitor Farlp in budding yeast. Genes Dev 11:3046-60. Hengartner, C. J., V. E . Myer, S. M . Liao, C. J. Wilson, S. S. Koh, and R. A. Young. 1998. Temporal regulation of R N A polymerase II by SrblO and Kin28 cyclin- dependent kinases. M o l Cell 2:43-53. Hengartner, C. J., C. M . Thompson, J. Zhang, D. M . Chao, S. M . Liao, A. J . Koleske, S. Okamura, and R. A. Young. 1995. Association of an activator with an R N A polymerase II holoenzyme. Genes Dev 9:897-910.  162  References 80. 81. 82. 83. 84.  85. 86.  87.  88. 89.  90.  91.  92. 93.  94. 95.  96.  97.  Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu Rev Biochem 67:425-79. Herskowitz, 1. 1995. M A P kinase pathways in yeast: for mating and more. Cell 80:187-97. Hicke, L., and H. Riezman. 1996. Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis. Cell 84:277-87. Hirst, M . 1999. Phosphorylation of Gal4. Ph.D. U B C , Vancouver. Hirst, M . , M . S. Kobor, N. Kuriakose, J. Greenblatt, and I. Sadowski. 1999. G A L 4 is regulated by the R N A polymerase II holoenzyme-associated cyclindependent protein kinase SRB10/CDK8. M o l Cell 3:673-8. Hofman-Bang, J. 1999. Nitrogen catabolite repression in Saccharomyces cerevisiae. M o l Biotechnol 12:35-73. Holstege, F. C , E . G. Jennings, J . J . Wyrick, T. I. Lee, C. J. Hengartner, M . R. Green, T. R. Golub, E . S. Lander, and R. A. Young. 1998. Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95:717-28. Holzinger, A., K. S. Phillips, and T. E . Weaver. 1996. Single-step purification/solubilization of recombinant proteins: application to surfactant protein B. Biotechniques 20:804-6, 808. Hung, W. 1997. Phosphorylation of Stel2. Ph.D Thesis. U B C , Vancouver. Hung, W., K. A. Olson, A. Breitkreutz, and I. Sadowski. 1997. Characterization of the basal and pheromone-stimulated phosphorylation states of Stel2p. Eur J Biochem 245:241-51. Inouye, C , N. Dhillon, T. Durfee, P. C. Zambryski, and J . Thorner. 1997. Mutational analysis of STE5 in the yeast Saccharomyces cerevisiae: application of a differential interaction trap assay for examining protein-protein interactions. Genetics 147:479-92. Inouye, C , N. Dhillon, and J. Thorner. 1997. Ste5 RING-H2 domain: role in Ste4-promoted oligomerization for yeast pheromone signaling. Science 278:1036. Jenness, D. D., and P. Spatrick. 1986. Down regulation of the alpha-factor pheromone receptor in S. cerevisiae. Cell 46:345-53. Kadosh, D., and K. Struhl. 1997. Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell 89:365-71. Kaldis, P., A. Sutton, and M . J. Solomon. 1996. The Cdk-activating kinase (CAK) from budding yeast. Cell 86:553-64. Rang, J . S., S. H . Kim, M . S. Hwang, S. J. Han, Y. C. Lee, and Y. J. Kim. 2001. The structural and functional organization of the yeast mediator complex. J Biol Chem 276:42003-10. Kataoka, T., S. Powers, C. McGill, O. Fasano, J . Strathern, J . Broach, and M . Wigler. 1984. Genetic analysis of yeast RAS1 and RAS2 genes. Cell 37:43745. Khazak, V . , J. Estojak, H . Cho, J . Majors, G. Sonoda, J. R. Testa, and E. A. Golemis. 1998. Analysis of the interaction of the novel R N A polymerase II (pol II) subunit hsRPB4 with its partner hsRPB7 and with pol II. M o l Cell Biol 18:1935-45.  163  References 98. 99. 100.  101.  102. 103.  104.  105.  106. 107. 108. 109. 110.  111. 112. 113.  114.  Kim, J. L., D. B. Nikolov, and S. K. Burley. 1993. Co-crystal structure of TBP recognizing the minor groove of a T A T A element. Nature 365:520-7. Kim, Y., J. H . Geiger, S. Hahn, and P. B. Sigler. 1993. Crystal structure of a yeast TBP/TATA-box complex. Nature 365:512-20. Kim, Y. J., S. Bjorklund, Y. Li, M . H . Sayre, and R. D. Kornberg. 1994. A multiprotein mediator of transcriptional activation and its interaction with the Cterminal repeat domain of R N A polymerase II. Cell 77:599-608. Kirkman-Correia, C , I. L . Stroke, and S. Fields. 1993. Functional domains of the yeast STE 12 protein, a pheromone-responsive transcriptional activator. Molecular & Cellular Biology 13:3765-72. Kobayashi, O., H . Yoshimoto, and H . Sone. 1999. Analysis of the genes activated by the F L 0 8 gene in Saccharomyces cerevisiae. Curr Genet 36:256-61. Kobor, M . S., J. Archambault, W. Lester, F. C. Holstege, O. Gileadi, D. B. Jansma, E . G. Jennings, F. Kouyoumdjian, A. R. Davidson, R. A. Young, and J. Greenblatt. 1999. A n unusual eukaryotic protein phosphatase required for transcription by R N A polymerase II and CTD dephosphorylation in S. cerevisiae. M o l Cell 4:55-62. Koegl, M., T. Hoppe, S. Schlenker, H. D. Ulrich, T. U. Mayer, and S. Jentsch. 1999. A novel ubiquitination factor, E4, is involved in multiubiquitin chain assembly. Cell 96:635-44. Kohler, T., S. Wesche, N. Taheri, G. H. Braus, and H . U. Mosch. 2002. Dual role of the Saccharomyces cerevisiae TEA/ATTS family transcription factor Teclp in regulation of gene expression and cellular development. Eukaryot Cell 1:673-86. Koleske, A. J., and R. A. Young. 1995. The R N A polymerase II holoenzyme and its implications for gene regulation. Trends Biochem Sci 20:113-6. Koleske, A. J., and R. A. Young. 1994. An R N A polymerase II holoenzyme responsive to activators. Nature 368:466-9. Kornberg, R. D., and Y. Lorch. 1999. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 98:285-94. Kornitzer, D., B. Raboy, R. G. Kulka, and G. R. Fink. 1994. Regulated degradation of the transcription factor Gcn4. Embo J 13:6021-30. Kranz, J. E., B. Satterberg, and E . A. Elion. 1994. The M A P kinase Fus3 associates with and phosphorylates the upstream signaling component Ste5. Genes Dev 8:313-27. Kronstad, J. W., J. A. Holly, and V. L . MacKay. 1987. A yeast operator overlaps an upstream activation site. Cell 50:369-77. Kurdistani, S. K., and M . Grunstein. 2003. Histone acetylation and deacetylation in yeast. Nat Rev M o l Cell Biol 4:276-84. Kurihara, L . J., B. G. Stewart, A. E . Gammie, and M . D. Rose. 1996. Kar4p, a karyogamy-specific component of the yeast pheromone response pathway. Molecular & Cellular Biology 16:3990-4002. Larschan, E., and F. Winston. 2001. The S. cerevisiae S A G A complex functions in vivo as a coactivator for transcriptional activation by Gal4. Genes Dev 15:1946-56.  164  References 115. 116. 117.  118.  119.  120.  121.  122.  123.  124.  125.  126. 127.  128.  129. 130.  Leberer, E., D. Y. Thomas, and M . Whiteway. 1997. Pheromone signalling and polarized morphogenesis in yeast. Curr Opin Genet Dev 7:59-66. Lee, T. I., and R. A . Young. 2000. Transcription of eukaryotic protein-coding genes. Annu Rev Genet 34:77-137. Leeuw, T., C. Wu, J. D. Schrag, M . Whiteway, D, Y. Thomas, and E . Leberer. 1998. Interaction of a G-protein beta-subunit with a conserved sequence in Ste20/PAK family protein kinases. Nature 391:191-5. Lehrmann, H., L. L . Pritchard, and A . Harel-Bellan. 2002. Histone acetyltransferases and deacetylases in the control of cell proliferation and differentiation. Adv Cancer Res 86:41-65. Liao, S. M . , J. Zhang, D. A . Jeffery, A . J . Koleske, C. M . Thompson, D. M . Chao, M . Viljoen, H . J. van Vuuren, and R. A . Young. 1995. A kinase-cyclin pair in the R N A polymerase II holoenzyme. Nature 374:193-6. Liu, H., C. A . Styles, and G . R. Fink. 1993. Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 262:17414. Liu, H., C. A . Styles, and G . R. Fink. 1996. Saccharomyces cerevisiae S288C has a mutation in F L 0 8 , a gene required for filamentous growth. Genetics 144:967-78. Liu, J., and E . T. Kipreos. 2000. Evolution of cyclin-dependent kinases (CDKs) and CDK-activating kinases (CAKs): differential conservation of C A K s in yeast and metazoa. Mol Biol Evol 17:1061-74. Lo, H . J . , J . R. Kohler, B. DiDomenico, D. Loebenberg, A . Cacciapuoti, and G . R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell 90:93949. Lo, W. S., and A . M . Dranginis. 1998. The cell surface flocculin Flol 1 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae. M o l Biol Cell 9:161-71. Luger, K., A . W. Mader, R. K. Richmond, D. F. Sargent, and T. J. Richmond. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389:251-60. Luger, K., and T. J. Richmond. 1998. The histone tails of the nucleosome. Curr Opin Genet Dev 8:140-6. Lurie, H . I., and H . J. Shadomy. 1971. Morphological variations of a hyphaforming strain of Cryptococcus neoformans (Coward strain) in tissues of mice. Sabouraudia 9:10-4. Ma, D., J. G . Cook, and J. Thorner. 1995. Phosphorylation and localization of K s s l , a M A P kinase of the Saccharomyces cerevisiae pheromone response pathway. M o l Biol Cell 6:889-909. Ma, J., and M . Ptashne. 1987. The carboxy-terminal 30 amino acids of G A L 4 are recognized by GAL80. Cell 50:137-42. Ma, P., S. Wera, P. Van Dijck, and J. M . Thevelein. 1999. The PDE1 -encoded low-affinity phosphodiesterase in the yeast Saccharomyces cerevisiae has a specific function in controlling agonist-induced c A M P signaling. Mol Biol Cell 10:91-104.  165  References 131. 132.  133.  134.  135.  136. 137.  138. 139.  140.  141. 142.  143.  144.  145.  146.  Madhani, H. D., and G. R. Fink. 1997. Combinatorial control required for the specificity of yeast M A P K signaling. Science 275:1314-7. Madhani, H . D., T. Galitski, E . S. Lander, and G. R. Fink. 1999. Effectors of a developmental mitogen-activated protein kinase cascade revealed by expression signatures of signaling mutants. Proc Natl Acad Sci U S A 96:12530-5. Madhani, H . D., C. A . Styles, and G. R. Fink. 1997. M A P kinases with distinct inhibitory functions impart signaling specificity during yeast differentiation. Cell 91:673-84. Mahanty, S. K., Y. Wang, F. W. Farley, and E . A . Elion. 1999. Nuclear shuttling of yeast scaffold Ste5 is required for its recruitment to the plasma membrane and activation of the mating M A P K cascade. Cell 98:501-12. Makela, T. P., J . D. Parvin, J. Kim, L. J. Huber, P. A . Sharp, and R. A . Weinberg. 1995. A kinase-deficient transcription factor TFIIH is functional in basal and activated transcription. Proc Natl Acad Sci U S A 92:5174-8. Maldonado, E., M . Hampsey, and D. Reinberg. 1999. Repression: targeting the heart of the matter. Cell 99:455-8. Marcus, S., A . Polverino, M . Barr, and M . Wigler. 1994. Complexes between STE5 and components of the pheromone-responsive mitogen-activated protein kinase module. Proc Natl Acad Sci U S A 91:7762-6. Martens, J. A . , and F. Winston. 2003. Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Curr Opin Genet Dev 13:136-42. McCracken, S., N. Fong, E . Rosonina, K. Yankulov, G. Brothers, D. Siderovski, A . Hessel, S. Foster, S. Shuman, and D. L . Bentley. 1997. 5'Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of R N A polymerase II. Genes Dev 11:3306-18. Morillon, A . , M . Springer, and P. Lesage. 2000. Activation of the Kssl invasive-filamentous growth pathway induces T y l transcription and retrotransposition in Saccharomyces cerevisiae. M o l Cell Biol 20:5766-76. Mortimer, R. K. 2000. Evolution and variation of the yeast (Saccharomyces) genome. Genome Res 10:403-9. Mortimer, R. K., P. Romano, G. Suzzi, and M . Polsinelli. 1994. Genome renewal: a new phenomenon revealed from a genetic study of 43 strains of Saccharomyces cerevisiae derived from natural fermentation of grape musts. Yeast 10:1543-52. Moskow, J. J., A . S. Gladfelter, R. E . Lamson, P. M . Pryciak, and D. J. Lew. 2000. Role of Cdc42p in pheromone-stimulated signal transduction in Saccharomyces cerevisiae. Mol Cell Biol 20:7559-71. Mueller, C. G., and A . Nordheim. 1991. A protein domain conserved between yeast M C M 1 and human SRF directs ternary complex formation. E M B O Journal 10:4219-29. Murray, S., R. Udupa, S. Yao, G. Hartzog, and G. Prelich. 2001. Phosphorylation of the R N A polymerase II carboxy-terminal domain by the Burl cyclin-dependent kinase. M o l Cell Biol 21:4089-96. Myers, L . C , and R. D. Kornberg. 2000. Mediator of transcriptional regulation. Annu Rev Biochem 69:729-49.  166  References 147.  148.  149.  150. 151.  152.  153. 154.  155.  156.  157.  158.  159.  160.  161. 162.  Neigeborn, L., and M . Carlson. 1984. Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108:845-58. Neiman, A. M . , and I. Herskowitz. 1994. Reconstitution of a yeast protein kinase cascade in vitro: activation of the yeast M E K homologue STE7 by STE11. Proc Natl Acad Sci U S A 91:3398-402. Nelson, C , S. Goto, K. Lund, W. Hung, and I. Sadowski. 2003. Srbl0/Cdk8 regulates yeast filamentous growth by phosphorylating the transcription factor Stel2. Nature 421:187-90. Nern, A., and R. A. Arkowitz. 2000. Nucleocytoplasmic shuttling of the Cdc42p exchange factor Cdc24p. J Cell Biol 148:1115-22. Nikawa, J., P. Sass, and M . Wigler. 1987. Cloning and characterization of the low-affinity cyclic A M P phosphodiesterase gene of Saccharomyces cerevisiae. M o l Cell Biol 7:3629-36. O'Rourke, S. M., and I. Herskowitz. 1998. The Hogl M A P K prevents cross talk between the HOG and pheromone response M A P K pathways in Saccharomyces cerevisiae. Genes Dev 12:2874-86. Ogbourne, S., and T. M . Antalis. 1998. Transcriptional control and the role of silencers in transcriptional regulation in eukaryotes. Biochem J 331 (Pt 1):1-14. Olson, K. A., C. Nelson, G. Tai, W. Hung, C. Yong, C. Astell, and I. Sadowski. 2000. Two regulators of Stel2p inhibit pheromone-responsive transcription by separate mechanisms. M o l Cell Biol 20:4199-209. Palecek, S. P., A. S. Parikh, and S. J . Kron. 2002. Sensing, signalling and integrating physical processes during Saccharomyces cerevisiae invasive and filamentous growth. Microbiology 148:893-907. Pan, X., T. Harashima, and J. Heitman. 2000. Signal transduction cascades regulating pseudohyphal differentiation of Saccharomyces cerevisiae. Curr Opin Microbiol 3:567-72. Pan, X., and J. Heitman. 1999. Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae. M o l Cell Biol 19:4874-87. Pan, X., and J. Heitman. 2000. Sok2 regulates yeast pseudohyphal differentiation via a transcription factor cascade that regulates cell-cell adhesion. Mol Cell Biol 20:8364-72. Patton, E . E., A. R. Willems, D. Sa, L . Kuras, D. Thomas, K. L . Craig, and M . Tyers. 1998. Cdc53 is a scaffold protein for multiple Cdc34/Skpl/F-box proteincomplexes that regulate cell division and methionine biosynthesis in yeast. Genes Dev 12:692-705. Patton, E . E., A. R. Willems, and M . Tyers. 1998. Combinatorial control in ubiquitin-dependent proteolysis: don't Skp the F-box hypothesis. Trends Genet 14:236-43. Pawson, T., and J. D. Scott. 1997. Signaling through scaffold, anchoring, and adaptor proteins. Science 278:2075-80. Peters, J . M . 1998. SCF and A P C : the Yin and Yang of cell cycle regulated proteolysis. Curr Opin Cell Biol 10:759-68.  167  References 163.  164.  165. 166.  167.  168.  169.  170.  171.  172. 173.  174.  175.  176.  177.  Pi, H., C. T. Chien, and S. Fields. 1997. Transcriptional activation upon pheromone stimulation mediated by a small domain of Saccharomyces cerevisiae Stel2p. M o l Cell Biol 17:6410-8. Posas, F., E . A. Witten, and H. Saito. 1998. Requirement of STE50 for osmostress-induced activation of the STE11 mitogen-activated protein kinase kinase kinase in the high-osmolarity glycerol response pathway. M o l Cell Biol 18:5788-96. Prelich, G. 2002. R N A polymerase II carboxy-terminal domain kinases: emerging clues to their function. Eukaryot Cell 1:153-62. Prelich, G., and F. Winston. 1993. Mutations that suppress the deletion of an upstream activating sequence in yeast: involvement of a protein kinase and histone H3 in repressing transcription in vivo. Genetics 135:665-76. Ramer, S. W., and R. W. Davis. 1993. A dominant truncation allele identifies a gene, STE20, that encodes a putative protein kinase necessary for mating in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 90:452-6. Ramezani-Rad, M . 2003. The role of adaptor protein Ste50-dependent regulation of the M A P K K K Stel 1 in multiple signalling pathways of yeast. Curr Genet 43:161-70. Reinders, A., N. Burckert, T. Boiler, A. Wiemken, and C. De Virgilio. 1998. Saccharomyces cerevisiae cAMP-dependent protein kinase controls entry into stationary phase through the Riml5p protein kinase. Genes Dev 12:2943-55. Ren, B., F. Robert, J . J . Wyrick, O. Aparicio, E. G. Jennings, I. Simon, J . Zeitlinger, J. Schreiber, N. Hannett, E. Kanin, T. L . Volkert, C. J . Wilson, S. P. Bell, and R. A. Young. 2000. Genome-wide location and function of D N A binding proteins. Science 290:2306-9. Reneke, J. E., K. J. Blumer, W. E . Courchesne, and J. Thorner. 1988. The carboxy-terminal segment of the yeast alpha-factor receptor is a regulatory domain. Cell 55:221-34. Riedl, T., and J. M . Egly. 2000. Phosphorylation in transcription: the C T D and more. Gene Expr 9:3-13. Roberts, C. J., B. Nelson, M . J . Marton, R. Stoughton, M . R. Meyer, H . A. Bennett, Y. D. He, H. Dai, W. L . Walker, T. R. Hughes, M . Tyers, C. Boone, and S. H . Friend. 2000. Signaling and circuitry of multiple M A P K pathways revealed by a matrix of global gene expression profiles. Science 287:873-80. Roberts, P., S. Moshitch-Moshkovitz, E . Kvam, E . O'Toole, M . Winey, and D. S. Goldfarb. 2003. Piecemeal Microautophagy of Nucleus in Saccharomyces cerevisiae. Mol Biol Cell 14:129-41. Roberts, R. L., and G. R. Fink. 1994. Elements of a single M A P kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes & Development 8:2974-85. Robertson, L . S., and G. R. Fink. 1998. The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc Natl Acad Sci U S A 95:137837. Roeder, R. G. 1996. The role of general initiation factors in transcription by R N A polymerase II. Trends Biochem Sci 21:327-35.  168  References 178. 179. 180. 181.  182.  183.  184.  185. 186.  187.  188.  189.  190.  191.  192. 193.  Roeder, R. G., and W. J. Rutter. 1969. Multiple forms of DNA-dependent R N A polymerase in eukaryotic organisms. Nature 224:234-7. Rohde, J., J. Heitman, and M . E . Cardenas. 2001. The TOR kinases link nutrient sensing to cell growth. J Biol Chem 276:9583-6. Rohde, J. R., J. Trinh, and I. Sadowski. 2000. Multiple signals regulate G A L transcription in yeast. Mol Cell Biol 20:3880-6. Rolland, F., J. H. De Winde, K. Lemaire, E . Boles, J. M . Thevelein, and J . Winderickx. 2000. Glucose-induced c A M P signalling in yeast requires both a Gprotein coupled receptor system for extracellular glucose detection and a separable hexose kinase-dependent sensing process. Mol Microbiol 38:348-58. Rupp, S., E. Summers, H. J. Lo, H. Madhani, and G. Fink. 1999. M A P kinase and c A M P filamentation signaling pathways converge on the unusually large promoter of the yeast F L O l 1 gene. Embo J 18:1257-69. Sabbagh, W., Jr., L . J. Flatauer, A. J. Bardwell, and L. Bardwell. 2001. Specificity of M A P kinase signaling in yeast differentiation involves transient versus sustained M A P K activation. Mol Cell 8:683-91. Sadowski, I., D. Niedbala, K. Wood, and M . Ptashne. 1991. G A L 4 is phosphorylated as a consequence of transcriptional activation. Proc Natl Acad Sci U S A88:10510-4. Schaeffer, H. J., and M . J. Weber. 1999. Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19:2435-44. Schroeder, S. C , B. Schwer, S. Shuman, and D. Bentley. 2000. Dynamic association of capping enzymes with transcribing R N A polymerase II. Genes Dev 14:2435-40. Sengupta, P., and B. H. Cochran. 1990. The PRE and PQ box are functionally distinct yeast pheromone response elements. Molecular & Cellular Biology 10:6809-12. Sharrocks, A. D., S. H. Yang, and A. Galanis. 2000. Docking domains and substrate-specificity determination for M A P kinases. Trends Biochem Sci 25:44853. Shimada, Y., M . P. Gulli, and M . Peter. 2000. Nuclear sequestration of the exchange factor Cdc24 by Farl regulates cell polarity during yeast mating. Nat Cell Biol 2:117-24. Simon, M . N., C. De Virgilio, B. Souza, J. R. Pringle, A. Abo, and S. I. Reed. 1995. Role for the Rho-family GTPase Cdc42 in yeast mating-pheromone signal pathway. Nature 376:702-5. Skowyra, D., K. L . Craig, M . Tyers, S. J. Elledge, and J. W. Harper. 1997. Fbox proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91:209-19. Smale, S. T., and D. Baltimore. 1989. The "initiator" as a transcription control element. Cell 57:103-13. Smith, A., M . P. Ward, and S. Garrett. 1998. Yeast P K A represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. Embo J 17:3556-64.  169  References 194.  195. 196. 197. 198.  199. 200.  201.  202.  203. 204.  205.  206.  207.  208.  209.  Song, D., J . W. Dolan, Y. L . Yuan, and S. Fields. 1991. Pheromone-dependent phosphorylation of the yeast STE12 protein correlates with transcriptional activation. Genes & Development 5:741-50. Song, W., and M . Carlson. 1998. Srb/mediator proteins interact functionally and physically with transcriptional repressor S f l l . Embo J 17:5757-65. Spencer, V. A . , and J. R. Davie. 1999. Role of covalent modifications of histones in regulating gene expression. Gene 240:1-12. Stern, M . , R. Jensen, and I. Herskowitz. 1984. Five SWI genes are required for expression of the HO gene in yeast. J M o l Biol 178:853-68. Stevenson, B. J., N. Rhodes, B. Errede, and G . F. Sprague, Jr. 1992. Constitutive mutants of the protein kinase STE11 activate the yeast pheromone response pathway in the absence of the G protein. Genes & Development 6:1293304. Struhl, K. 1995. Yeast transcriptional regulatory mechanisms. Annu Rev Genet 29:651-74. Sudarsanam, P., V. R. Iyer, P. O. Brown, and F. Winston. 2000. Wholegenome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 97:3364-9. Tatchell, K., D. T. Chaleff, D. DeFeo-Jones, and E. M . Scolnick. 1984. Requirement of either of a pair of ras-related genes of Saccharomyces cerevisiae for spore viability. Nature 309:523-7. Tedford, K., S. Kim, D. Sa, K. Stevens, and M . Tyers. 1997. Regulation of the mating pheromone and invasive growth responses in yeast by two M A P kinase substrates. Curr Biol 7:228-38. Thanos, C. D., and J. U. Bowie. 1999. p53 Family members p63 and p73 are S A M domain-containing proteins. Protein Sci 8:1708-10. Thompson, C. M . , A . J. Koleske, D. M . Chao, and R. A . Young. 1993. A multisubunit complex associated with the R N A polymerase II C T D and T A T A binding protein in yeast. Cell 73:1361-75. Tirode, F., D. Busso, F. Coin, and J. M . Egly. 1999. Reconstitution of the transcription factor TFIIH: assignment of functions for the three enzymatic subunits, X P B , X P D , and cdk7. Mol Cell 3:87-95. Toda, T., S. Cameron, P. Sass, M . Zoller, J. D. Scott, B. McMullen, M . Hurwitz, E . G . Krebs, and M . Wigler. 1987. Cloning and characterization of B C Y 1 , a locus encoding a regulatory subunit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae. M o l Cell Biol 7:1371-7. Toda, T., S. Cameron, P. Sass, M . Zoller, and M . Wigler. 1987. Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase. Cell 50:277-87. Toda, T., I. Uno, T. Ishikawa, S. Powers, T. Kataoka, D. Broek, S. Cameron, J. Broach, K. Matsumoto, and M . Wigler. 1985. In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 40:27-36. Toenjes, K. A . , M . M . Sawyer, and D. I. Johnson. 1999. The guaninenucleotide-exchange factor Cdc24p is targeted to the nucleus and polarized growth sites. Curr Biol 9:1183-6.  170  References 210.  211.  212. 213.  214.  215. 216.  217.  218.  219.  220.  221. 222. 223.  224.  225.  Triezenberg, S. J., R. C. Kingsbury, and S. L . McKnight. 1988. Functional dissection of V P 16, the trans-activator of herpes simplex virus immediate early gene expression. Genes Dev 2:718-29. Tyers, M . , and B. Futcher. 1993. Farl and Fus3 link the mating pheromone signal transduction pathway to three Gl-phase Cdc28 kinase complexes. M o l Cell Biol 13:5659-69. van Drogen, F., V. M . Stucke, G. Jorritsma, and M . Peter. 2001. M A P kinase dynamics in response to pheromones in budding yeast. Nat Cell Biol 3:1051-9. Vary, J. C , Jr., V. K. Gangaraju, J. Qin, C. C. Landel, C. Kooperberg, B. Bartholomew, and T. Tsukiyama. 2003. Yeast Iswlp forms two separable complexes in vivo. Mol Cell Biol 23:80-91. Verma, R., R. S. Annan, M . J. Huddleston, S. A. Carr, G. Reynard, and R. J. Deshaies. 1997. Phosphorylation of Siclp by G l Cdk required for its degradation and entry into S phase. Science 278:455-60. Vignali, M . , A. H . Hassan, K. E . Neely, and J. L . Workman. 2000. ATPdependent chromatin-remodeling complexes. Mol Cell Biol 20:1899-910. Vincent, O., S. Kuchin, S. P. Hong, R. Townley, V. K. Vyas, and M . Carlson. 2001. Interaction of the SrblO kinase with Sip4, a transcriptional activator of gluconeogenic genes in Saccharomyces cerevisiae. Mol Cell Biol 21:5790-6. Watson, A. D., D. G. Edmondson, J. R. Bone, Y. Mukai, Y. Yu, W. Du, D. J. Stillman, and S. Y. Roth. 2000. Ssn6-Tupl interacts with class I histone deacetylases required for repression. Genes Dev 14:2737-44. Whiteway, M . S., C. Wu, T. Leeuw, K. Clark, A. Fourest-Lieuvin, D. Y. Thomas, and E. Leberer. 1995. Association of the yeast pheromone response G protein beta gamma subunits with the M A P kinase scaffold Ste5p. Science 269:1572-5. Wickes, B. L., M . E. Mayorga, U. Edman, and J. C. Edman. 1996. Dimorphism and haploid fruiting in Cryptococcus neoformans: association with the alpha-mating type. Proc Natl Acad Sci U S A 93:7327-31. Willems, A. R., T. Goh, L. Taylor, I. Chernushevich, A. Shevchenko, and M . Tyers. 1999. SCF ubiquitin protein ligases and phosphorylation-dependent proteolysis. Philos Trans R Soc Lond B Biol Sci 354:1533-50. Workman, J. L., and R. E . Kingston. 1998. Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem 67:545-79. Woychik, N. A. 1998. Fractions to functions: R N A polymerase II thirty years later. Cold Spring Harb Symp Quant Biol 63:311-7. Woychik, N. A., and R. A. Young. 1989. R N A polymerase II subunit RPB4 is essential for high- and low-temperature yeast cell growth. Mol Cell Biol 9:28549. Wu, C , E . Leberer, D. Y. Thomas, and M . Whiteway. 1999. Functional characterization of the interaction of Ste50p with Stel lp M A P K K K in Saccharomyces cerevisiae. Mol Biol Cell 10:2425-40. Xu, G., G. Jansen, D. Y. Thomas, C. P. Hollenberg, and M . Ramezani Rad. 1996. Ste50p sustains mating pheromone-induced signal transduction in the yeast Saccharomyces cerevisiae. Mol Microbiol 20:773-83.  171  References 226.  227.  228.  Yaglom, J., M . H . Linskens, S. Sadis, D. M . Rubin, B. Futcher, and D. Finley. 1995. p34Cdc28-mediated control of Cln3 cyclin degradation. M o l Cell Biol 15:731-41. Yao, S., A. Neiman, and G. Prelich. 2000. BUR1 and BUR2 encode a divergent cyclin-dependent kinase-cyclin complex important for transcription in vivo. M o l Cell Biol 20:7080-7. Yao, S., and G. Prelich. 2002. Activation of the Burl -Bur2 cyclin-dependent kinase complex by C a k l . M o l Cell Biol 22:6750-8. Yuan, Y. L., and S. Fields. 1991. Properties of the DNA-binding domain of the Saccharomyces cerevisiae STE12 protein. Molecular & Cellular Biology 11:5910-8. Yuan, Y. O., I. L . Stroke, and S. Fields. 1993. Coupling of cell identity to signal response in yeast: interaction between the alpha 1 and STE12 proteins. Genes & Development 7:1584-97. Zanolari, B., S. Raths, B. Singer-Kruger, and H . Riezman. 1992. Yeast pheromone receptor endocytosis and hyperphosphorylation are independent of G protein-mediated signal transduction. Cell 71:755-63. Zeitlinger, J., I. Simon, C. T. Harbison, N. M . Hannett, T. L . Volkert, G. R. Fink, and R. A. Young. 2003. Program-specific distribution of a transcription factor dependent on partner transcription factor and M A P K signaling. Cell 113:395-404. Zheng, C. F., and K. L . Guan. 1994. Activation of M E K family kinases requires phosphorylation of two conserved Ser/Thr residues. Embo J 13:1123-31. Zheng, Y., R. Cerione, and A. Bender. 1994. Control of the yeast bud-site assembly GTPase Cdc42. Catalysis of guanine nucleotide exchange by Cdc24 and stimulation of GTPase activity by Bem3. J Biol Chem 269:2369-72. Zhou, Z., A. Gartner, R. Cade, G. Ammerer, and B. Errede. 1993. Pheromone-induced signal transduction in Saccharomyces cerevisiae requires the sequential function of three protein kinases. M o l Cell Biol 13:2069-80. Zlatanova, J., S. H . Leuba, and K. van Holde. 1999. Chromatin structure revisited. Crit Rev Eukaryot Gene Expr 9:245-55. r  229.  230.  231.  232.  233. 234.  235.  236.  172  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091832/manifest

Comment

Related Items