Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of the molecular mechanisms underlying the cadherin-mediated differentiation of human… Kwok, Yin Wan 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2005-0066.pdf [ 8.92MB ]
Metadata
JSON: 831-1.0091814.json
JSON-LD: 831-1.0091814-ld.json
RDF/XML (Pretty): 831-1.0091814-rdf.xml
RDF/JSON: 831-1.0091814-rdf.json
Turtle: 831-1.0091814-turtle.txt
N-Triples: 831-1.0091814-rdf-ntriples.txt
Original Record: 831-1.0091814-source.json
Full Text
831-1.0091814-fulltext.txt
Citation
831-1.0091814.ris

Full Text

CHARACTERIZATION OF THE M O L E C U L A R MECHANISMS UNDERLYING THE CADHERIN-MEDIATED DIFFERENTIATION OF H U M A N TROPHOBLASTIC CELLS by YIN W A N K W O K B.Sc. The University of Hong Kong, 2002 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF T H E REQUIRMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES (Reproductive and Developmental Sciences) THE UNIVERSITY OF BRITISH COLUMBIA DECEMBER 2004 © Yin Wan Kwok, 2004 ABSTRACT The majority of the biological functions of the human placenta are performed by the syncytial trophoblast layer, a multinucleated cell that is formed by the terminal differentiation and fusion of the underlying layer of mitotically active, mononucleate cytotrophoblasts. This key step in the formation and organization of the placenta is mediated by a decrease in E-cadherin (E-cad) and a concomitant increase in the levels of Cadherin-11 (cad-11) expressed on the surface of differentiating trophoblastic cells. Similarly, aberrant expression of these two cadherin subtypes has also been associated with the development of persistent trophoblastic disease in vivo. To identify the mechanisms underlying the switch in cadherin expression in human trophoblasts, we examined the mRNA levels and the protein levels of Snail and Slug, 2 zinc finger transcription repressors that regulate E-cad expression, and Twist, a transcription factor associated with tumor metastasis, in BeWo choriocarcinoma cells undergoing differentiation and fusion in response to the intracellular secondary messenger, cAMP. Quantitative Competitive Polymerase Chain Reaction (QC-PCR) analysis revealed significant declines in E-cadherin mRNA levels in BeWo choriocarcinoma cells after 12h of culture in the presence of cAMP. The levels of this mRNA transcript continued to decline until the termination of these studies at 48h. Western blot analysis and immunostaining also demonstrated a significant decrease in the protein levels of E -cadherin in response to cAMP. A significant and continuous increase in Snail mRNA levels and protein levels were detected in these trophoblastic cells over time in culture with cAMP using QC-PCR and Western Blot. Intense immunostaining for Snail expression was also detected in the nuclei of cultured BeWo cells. However, the levels of ii * the mRNA transcript encoding Slug remained relatively low and constant, at least at the time points examined in these studies. There was also a significant increase in Twist mRNA levels and protein levels as the BeWo cells underwent terminal differentiation and fusion. Collectively, these observations suggest that Snail and Twist regulate the switch in cadherin subtypes expressed, on the surface of human trophoblastic cells, a cellular event underlying the formation of multinucleated syncytium in vivo and in vitro. Future studies will examine the effects of loss-, or gain-of- function of Snail and Twist on the terminal differentiation and fusion of human trophoblastic cells in vitro. iii T A B L E O F C O N T E N T S A B S T R A C T ii T A B L E OF CONTENTS iv LIST OF.FIGURES vi LIST OF ABBREVIATIONS viii A C K N O W L E D G E M E N T S x P A R T I I N T R O D U C T I O N 1.1 Overview 1 1.2 Terminal differentiation of cytotrophoblast and syncytiotrophoblast 3 1.2.1 Syncytial fusion: its turnover and apoptosis 5 1.2.2 Syncytial fusion: A membrane lipid associated event 7 1.2.3 Factors mediating trophoblast syncytialization 8 1.3 Cell-cell interactions 14 1.3.1 The cadherin superfamily 15 1.3.2 Classical cadherin-catenin interactions 18 1.3.3 Signaling through cadherins 21 1.4 Identification of the classical cadherins present in the human placenta 22 and during trophoblast differentiation 1.5 Cadherin-associated transcription factors 24 1.5.1 The Snail family 24 1.5.2 Gene and protein structure of the human Snail (SNAI1) 26 1.5.3 Gene and protein structure of the human Slug (SNAI 2) 27 1.5.4 The roles of human Snail and E-cadherin during tissues 31 development 1.5.5 Twist- A big player in cell differentiation 33 1.5.6 Twist protein in morphogenesis 34 1.5.7 Twist in human 34 1.5.8 H-Twist gene 35 P A R T II. HYPOTHESIS AND O B J E C T I V E 38 iv P A R T III. M A T E R I A L S A N D M E T H O D S 3.1 BeWo choriocarcinoma cell culture 39 3.2 Primer design 39 3.3 Total RNA preparation and first strand cDNA synthesis 40 3.4 Quantitative competitive PCR 49 3.5 Western blot analysis 50 3.6 Immunolocalization of E-cadherin and Snail in BeWo cell cultures 51 3.7 Immunohistochemical analysis of Snail in vivo 52 3.8 Statistical analysis 52 P A R T IV. R E S U L T S 4.1 Time-dependent effects of 8-bromo-cAMP on E-cadherin mRNA and 53 protein levels in human BeWo choriocarcinoma cells 4.2 Time-dependent effects of 8-bromo-cAMP on Snail mRNA and 63 protein levels in human BeWo choriocarcinoma cells 4.3 Time-dependent effects of 8-bromo-cAMP on Slug mRNA level in 74 human BeWo choriocarcinoma cells 4.4 Time-dependent effects of 8-bromo-cAMP on Twist mRNA and 81 protein levels in human BeWo choriocarcinoma cells P A R T V . DISCUSSION 89 P A R T V I . S U M M A R Y 97 P A R T VII . R E F E R E N C E S 98 v L I S T O F F I G U R E S Figure 1 Two simultaneous trophoblast differentiation pathways that occur 2 during the first trimester of gestation Figure 2 Domain organization of representative members of the cadherin 16 superfamily Figure 3 Cadherin/ catenins complex in adherens junction 20 Figure 4 Gene and protein structure of SNA! 1 29 Figure 5 Gene and protein structure of SNAI2 30 Figure 6 Gene and protein structure of Twist 37 Figure 7 Schematic diagram summarizing the QC-PCR strategy employed in 41 the study of E-cadherin Figure 8 Schematic diagram summarizing the QC-PCR strategy employed in 43 the study of Snail Figure 9 Schematic diagram summarizing the QC-PCR strategy employed in 45 the study of Slug Figure 10 Schematic diagram summarizing the QC-PCR strategy employed in 47 the study of Twist Figure 11 Determination of the optimal amount of internal standard E- 55 cadherin cDNAs to be added to the QC-PCR mixtures Figure 12 Time-dependent inhibition of E-cadherin transcript expression in 57 BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 13 Time-dependent inhibition of E-cadherin protein expression in 61 BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 14 Immunolocalization of E-cadherin in BeWo cell cultures. 62 Figure 15 Determination of the optimal amount of internal standard Snail 65 cDNAs to be added to the QC-PCR mixtures Figure 16 Time-dependent induction of Snail transcript expression in BeWo 67 choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 17 Time-dependent induction of Snail protein expression in BeWo 71 choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 18 Immunolocalization of Snail in BeWo cell cultures 72 Figure 19 Immunolocalization of Snail in the villous and syncytial trophoblast 73 layers of the first-trimester placenta Figure 20 Determination of the optimal amount of internal standard Slug 76 cDNAs to be added to the QC-PCR mixtures Figure 21 Time-dependent effects of Slug mRNA transcript expression in 78 BeWo choriocarcinoma cells Figure 22 Time-dependent effects of Slug protein expression in BeWo 80 choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 23 Determination of the optimal amount of internal standard Twist 83 cDNAs to be added to the QC-PCR mixtures vi Figure 24 Time-dependent induction of Twist transcript expression in BeWo 85 choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 25 Time-dependent induction of Twist protein expression in BeWo 88 choriocarcinoma cells by 1.5mM 8-bromo-cAMP Figure 26 Proposed signaling pathway that regulate the subcellular localization 94 of Snail in BeWo cells vii L I S T O F A B B R E V I A T I O N S BeWo human choriocarcinoma cell line C A M cell-adhesion molecules cDNA complementary deoxyribonucleic acid CSF colony-stimulating factor Cyclic-AMP cyclic-adenosine monophosphate DNA deoxyribonucleic acid dNTP deoxynucleoside triphosphate E-cad E-cadherin EGF epidermal growth factor E M T epithelial-mesenchymal transition FBS fetal bovine serum g acceleration of gravity GM-CSF granulocyte-macrophage colony-stimulating factor hCG human chorionic gonodotropin hPL human placental lactogen HERV-W human endogenous retrovirus IL interleukin M A P K mitogen-activated protein kinase Min minutes mRNA messenger ribonucleic acid \x micro PCR polymerase chain reaction viii PS phosphatidylserine TNF tumor necrosis factor T G F transforming growth factor V E G F vascular endothelial growth factor Z O l occludin ix A C K N O W L E D G M E N T S My deepest gratitude and appreciation goes to my supervisors, Dr. Colin D. MacCalman and Dr. Peter C.K. Leung for their supervision and resources throughout my studies. Their advice and guidance have proven valuable and with genuine significance to my research and further career pursuits. I would like to give my sincere thanks to Dr. Catherine Pallen for her valuable suggestions and the critical reading of my thesis. Also I would like to thank my committee members, Drs. Raja Rajamahendran and Peter von Dadelszen. I offer my appreciation to my colleagues Ellen Zhu, Alex Beristain, York Ng, Jiadi Wen for their encouragements and suggestions. This thesis is dedicated to my family who always encourage me to follow my dreams and always be my source of strength and support. Mom, this is especially for you, I owe more than words can describe for your lifelong devotion and guidance. All above all I want to register the thanks and acknowledge of my heart, in the words of Philippians (4:6-7). PART 1. INTRODUCTION 1.1 Overview The placenta is a unique, transient extraembryonic organ that permits the growth and survival of the developing embryo within the female reproductive tract. The establishment and outcome of pregnancy critically depend on intimate physical contact and functional cooperation between the trophoblast and the uterus. The trophoblast is extraembryonic fetal tissue derived from trophectoderm of the blastocyst. Trophectoderm is the earliest outermost epithelial layer and its apical interaction with the uterine luminal epithelium is a key step in implantation (Pijnenborg et al., 1980; Aplin, 1991). Implantation in humans involves the embryo invading the maternal uterine luminal epithelium to become embedded within the underlying endometrial stroma, eventually leading to the formation of a haemochorial placenta (Damsky et al, 1993; Cross et al, 1994). In humans, the principal structures of the haemochorial placenta are formed within the first three weeks of pregnancy. During the course of placental development three main trophoblast populations can be identified: cytotrophoblast stem cells and two differentiated derivative cell types: the syncytiotrophoblast and the extravillous cytotrophoblast. Early syncytiotrophoblast and cytotrophoblast can be recognized during the intrusion phase of implantation (Hertig et al, 1956; Denker, 1993). Subsequently, with progression of placentation, trophoblasts can be found forming a variety of different structures, e.g., placental villi, cell islands and anchoring villi (Enders, 1968). They all arise from villous cytotrophoblast stem cells, which either fuse to produce epithelial syncytiotrophoblast that covers placental villi, or give rise to various extravillous trophoblast populations (Figure 1). 1 c Extravillous trophoblast Syncytiotrophoblast Trophoblast stem cell Cytotrophoblast Decidual cell Floating villus Endometrial glands Blood vessels Decidua • Figure 1. Two simultaneous trophoblast differentiation pathways that occur during the first trimester of gestation. A. Terminal differentiation of cytotrophoblasts to syncytiotrophoblasts that form the outer lining of the placenta. B. Differentiation of trophoblast stem cells to extravillous trophoblasts involving initial differentiation into cytotrophoblasts (Bl), followed by differentiation into extravillous trophoblasts which migrate and invade the underlying decidua (B2). 2 The syncytium is a polarized, secretory epithelium with an important transport function. Its formation and function are essential for the establishment and maintenance of pregnancy. Defects in its formation are suspected to lead to several complications such as preeclampsia (Lee et al, 2001) and intrauterine growth retardation (Ishihara et al, 2002) and to be compromised in Down's syndrome (Massin et al, 2001). For these reasons, it is very important to gain a better understanding of 1) the cellular and molecular mechanisms underlying the differentiation of syncytial trophoblasts and 2) the regulation of this important biological process. To date, syncytial fusion has been studied in the context of a variety of biological processes, including apoptosis, membrane biochemistry, and the biology of vesicular trafficking and cell adhesion. In this introduction, the terminal differentiation of trophoblasts will be described, with particular emphasis on syhcytiotrophoblast formation and function. The cellular mechanisms that are believed to modulate trophoblast differentiation will be discussed. The cell biology of the cadherin gene superfamily which has been previously detected in the human placenta and correlated with the terminal differentiation and fusion of human trophoblastic cells will be reviewed. Finally, the potential roles of several cadherin-associated transcription factors during tissue development will be discussed. 1.2 Terminal differentiation of cytotrophoblast and syncytiotrophoblast The syncytium of the definitive placenta is generated by continuous cell fusion of underlying cytotrophoblasts and then maintained as a steady-state structure at the villous maternal-fetal interface throughout the pregnancy. The term syncytium was introduced about 100 years ago to designate the situation in which a multinucleate condition is 3 established by the fusion of initially separate cells. The basic features of the histology of the mammalian placenta were poorly understood until the important contributions of Delporte in 1912. In his study of the implantation of the human ovum, he first described the differentiation of cytotrophoblastic cells into syncytiotrophoblasts and illustrated a number of transitional stages between the syncytiotrophoblast and the cytotrophoblasts (Delporte, 1912). Alternatively, Bargmann and Knoop (1959) suggested that the syncytium was, in fact, a Plasmodium of which the multinucleated syncytial trophoblast was a result of repeated nuclear division without cytokinesis. The origin of the multinucleate trophoblast was not unraveled until functional evidence was provided by the studies of Richart (1961), examining 3H-thymidine incorporation in the trophoblastic cells of the human placenta. These and subsequent studies demonstrated that the villous cytotrophoblasts are mitotically active and that nuclear division is completely absent in the multinucleated syncytiotrophoblast in vivo. The majority of the biological functions of the human placenta are performed by the syncytial trophoblast layer, which covers the whole placenta. It is responsible for transporting nutrients and gases from the maternal to the fetal circulation. Additionally the multinuclear syncytium represents the major endocrine activity of placenta since it secretes hormones such as human chorionic gonadotrophin (hCG) and human placental lactogen (hPL) that are essential for placental growth and for maternal adaptation to pregnancy (Hoshina et al, 1982; Benirschke and Kaufmann, 2002; Hoshina et al, 1983). This epithelial structure is also the most important maternal-fetal barrier because the terminally differentiated trophoblast is not permissive to infection by a number of viruses 4 in vitro and in vivo including human immunodeficiency virus type I (McGann et al., 1994; MacCalman et al, 1996). Progress in our understanding of human trophoblast differentiation has been limited by the fact that in vivo human experimentation is not ethically feasible and by the morphological differences that exist between the human placenta and that of experimental and domestic animals. Consequently, the trophoblastic cell lines derived from choriocarcinoma cells have provided a powerful alternative for studying trophoblast cell biology and placental development. Choriocarcinoma is a relatively rare malignant tumor of the human placenta that is comprised of mitotically active cytotrophoblasts (Benirschke & Kaufmann, 2002). To date, several choriocarcinoma cell lines have been established that exhibit varying degrees of differentiation in culture; in particular, the BeWo cell line is widely used in studying trophoblast terminal differentiation and thus will be discussed in more detail below. 1.2.1 Syncytial fusion: its turnover and apoptosis The terminally differentiated syncytiotrophoblast has no generative potency and thus is dependent upon continuous fusion of cytotrophoblasts into the existing syncytiotrophoblast (Benirschke & Kaufmann, 2002). Continuous fusion of the villous cytotrophoblast with the syncytiotrophoblast is not only the basis for growth of the syncytiotrophoblast but also a prerequisite to keep the syncytiotrophoblast alive. Several studies have shown that loss of the villous cytotrophoblast or absence of syncytial fusion results in degeneration of the syncytiotrophoblast within a few days, as demonstrated in vitro and in animals systems (Fox, 1970; Panigel and Myers, 1972; Castellucci et al, 5 1990). Others have proposed the concept that the syncytiotrophoblast maintains steady-state equilibrium at the maternal-fetal interface. In this model, the cytotrophoblast fusion provides a steady-state input to the villous syncytiotrophoblast; the output from the system is trophoblast shedding into the maternal circulation (Huppertz et al, 2001; Johansen et al, 1999; Redman and Sargent 2000). Noticeably not all villous trophoblast cells fuse syncytially; rather a pool of proliferating stem cells is preserved until term (Benirschke & Kaufmann, 2002). This suggests that syncytial fusion is tightly regulated and is restricted only to the higher differentiated stages of cytotrophoblasts underlying the syncytiotrophoblast. So what regulates this equilibrium? Apoptosis, a form of cell death which is clearly distinct from necrosis, is characterized in its end stages by nuclear chromatin condensation and cytoplasmic dehydration but with preservation of organelle integrity (Kerr et al, 1995; Erckson, 1997). Several components of the molecular machinery that regulate apoptosis are present in the villous cytotrophoblast. These include FasL and Bcl-2, in addition to the enzymes caspase-3 and transglutaminase II which appear to exist only in their inactive forms in cytotrophoblasts (Sakuragi et al, 1994; Marzioni et al, 1998; Hammer et al, 1998). The idea of apoptosis being involved in villous trophoblast turnover is further confirmed by the observation that phosphatidylserine (PS) moves from the inner plasma leaflet to the cell surface, a process known to be an early step in apoptosis (reviewed by Kagan et al, 2000). The phosphatidylserine flip into the outer plasma leaflet is likely to be initiated by activated ICE-like caspases (Renvoize et al, 1997; Black et al, 2004). Recent morphological studies of villous trophoblasts suggest that syncytiotrophoblast differentiation proceeds through two phases. On entering the syncytium, cells are committed to a long-6 programmed pre-apoptotic phase. Instead of completing the entire apoptosis process, high levels of apoptosis inhibitors block the progression of the apoptosis cascade. At that time, the syncytiotrophoblast has the highest metabolic rate, as well as transport capacity. Thereafter, the apoptosis cascade is re-started and completed and the respective syncytial compartments are shed into the maternal circulation (Huppertz et al, 1998). 1.2.1 Syncytial fusion: A membrane lipid associated event Phosphatidylserine (PS) externalization appears to be an indispensable event in the terminal differentiation and fusion of the cytotrophoblast. Differentiation and fusion of the villous cytotrophoblast result in redistribution of plasma membrane phospholipids with enrichment of PS on the syncytiotrophoblast surface (Lyden et al, 1993; Katsuragawa et al, 1995; Rote et al, 1995; Adler et al, 1995). The importance of enrichment of PS on the trophoblast cell surface during terminal differentiation is confirmed by the observation that a monoclonal antibody against a PS-dependent antigen completely blocked the intercellular fusion process in trophoblast models (Adler et al, 1995). Normally phospholipids are maintained in an asymmetrical distribution in the plasma membrane of virtually all cells with cholinephospholipids (sphingomyelin and phosphatidylcholine) located in the outer leaflet and aminophospholipids (phosphatidylethanolamine and PS) found in the inner leaflet (Daleke et al., 2000). The asymmetric distribution of phospholipids is actively maintained through the action of an Mg/ATP-dependent aminophospholipid translocase that flips PS from the cell surface to the inner leaflet (Connor et al, 1990). Phospholipid asymmetry is disrupted when PS is preferentially externalized during apoptosis (Fadok et al, 1992; Koopman et al, 1994) 7 or by intercellular fusion, such as when myoblasts form myotubes in muscle development (Sessions et al., 1981; Sessions et al, 1983), when sperm and oocyte membranes fuse during fertilization (Gadella et al, 2000), or when villous cytotrophoblasts form the syncytiotrophoblasts (Rote et al, 1995; Adler et al, 1995). However, the externalization of phosphatidylserine alone is not sufficient to trigger syncytial fusion. Many cells in the body become apoptotic and externalize PS without undergoing cell fusion. Syncytial fusion is an extremely specific phenomenon that only happens to cells of the same lineage. With the exception of sperm/oocyte fusion, physiological heterotypic fusion of cells is not known. Erythrocytes and the surface of the syncytiotrophoblast come into contact, both of which show externalization of PS (Connor et al, 1990), but they never fuse spontaneously. Thus, the initiation of syncytial fusion requires a more tissue-specific recognition mechanism. 1.2.3 Factors mediating trophoblast syncytialization 1.2.3a HERV-W Env Glycoprotein The envelope (env) protein of a human endogenous retrovirus (HERV-W) called syncytin is expressed in human trophoblasts (Harris 1998; Blond et al, 2000; Mi et al, 2000). High expression levels of syncytin in human trophoblasts have suggested a role in trophoblast development for this fusogenic protein. In particular, a rabbit polyclonal antibody raised against a mixture of Env-W peptides is able to partially inhibit heterologous fusion between the choriocarcinoma BeWo cell line and COS reporter cells (Mi et al, 2000). The function of syncytin in trophoblast differentiation is further strengthened by its regulated expression during spontaneous differentiation and fusion of 8 primary cultures of human villous cytotrophoblasts in vitro to form syncytium (Frendo et al., 2003). The expression of HERV-W is upregulated during forskolin-induced differentiation of BeWo cells, which results in syncytium formation (Lin et al., 1999). Moreover, by using specific antisense oligonucleotides, inhibition of Env-protein expression leads to a decrease in trophoblast fusion and differentiation in vitro. 1.2.3b hCGandcAMP Human Chorionic Gonadotropin (hCG) is produced by trophoblasts throughout the course of pregnancy (Cedard et al, 1970; Demers et al, 1973; Genti-Ramondi et al, 1981; North et al, 1990; Shi et al, 1993). hCG produced primarily by syncytiotrophoblast has intracrine, autocrine, paracrine and endocrine actions during gestation. One of its autocrine and paracrine actions is associated with the formation of the syncytiotrophoblasts by promoting the fusion of cytotrophoblasts (Cronier et al, 1994; Cronier et al, 1995; Cronier et al, 1997). In addition, exogenous hCG can also increase the morphological and functional differentiation of cytotrophoblasts in a dose-and time-dependent manner (Cronier et al, 1995). Cyclic AMP analogues or agents which activate adenylate cyclase have profound effect upon gene expression and the morphology and function of trophoblastic cells in vitro. Although many of the effects of cAMP are at the level of gene transcription, posttranslational regulation also plays a significant role. Proteins and/or transcripts whose levels are known to be affected by cAMP in the placenta include the chorionic gonadotrophin subunit (Ringler et al, 1989), placental lactogen (Harmen et al, 1987), steroidogenic enzymes, including cytochrome P450scc, adrenodoxin, aromatase, and 17P-hydroxysteroid dehydrogenase (Picardo-Leonard et al, 1988; Lobo and Bellino, 9 1989; Ringler et al, 1989; Tremblay et al, 1990; Ritvos and Voutilainen, 1992). Other proteins are also reported to be affected by cAMP, including pregnancy-specific pi glycoprotein (Kato and Braunstein, 1989), urokinase (Queenan et al, 1987) and the plasminogen activator inhibitors (Coutifaris et al, 1990). Similar to primary cultures of trophoblasts, BeWo choriocarcinoma cells undergo striking changes in response to forskolin or cAMP analogues (Wice et al, 1990). In the basal state, these cells have morphological features of intermediate trophoblasts. In response to forskolin or 8-bromo-cAMP, they show a marked reduction in DNA synthesis. Within 48 to 96h of treatment, cells begin to fuse to form large syncytia (Coutifaris et al, 1991). There is also an increase in microvilli. These morphological alterations are not seen in JEG-3 choriocarcinoma cells treated with exogenous cAMP, likely because these cells do not differentiate in response to cAMP. The stimulation of syncytium formation in BeWo cells reflects the effects of cAMP on promoting cell differentiation. 1.2.3c V E G F , CSF-1 and GM-CSF Many growth factors have been implicated in the autocrine and paracrine regulation of cytotrophoblast function. However, much of this area of research focuses on cell motility and vascular invasion (Lash et al, 1999; Cartwright et al, 1999) and little is known about the functional role of these cytokines in trophoblast differentiation. Throughout gestation, vascular endothelial growth factor (VEGF) is expressed in term cytotrophoblasts and syncytiotrophoblast (Clark et al, 1998; Shore et al, 1997). Immunostaining has proven that high levels are present during early placentation, between gestational weeks 6 and 16, and this level decreases as pregnancy progresses (Shiraishi et al, 1996). The presence of the VEGF receptor, Flt-1, on both the 10 cytotrophoblast and syncytiotrophoblast has suggested a potential role for V E G F in placental angiogenesis and uterine invasion (Charnock-Jones et al, 1994). In addition to the well-established role for extravillous trophoblast in motility and invasion, V E G F has been demonstrated to enhance differentiation into syncytiotrophoblast of first-trimester cytotrophoblasts in vitro (Crocker et al, 2001). Granulocyte-macrophage colony-stimulating factor (GM-CSF) and macrophage colony-stimulating factor (CSF-1) are lymphohaemopoietic cytokines originally characterized by their effects on the proliferation, differentiation, and function of myeloid haematopoietic cells (Clark and Kamen et al, 1987). These cytokines have also been implicated as pivotal mediators of placental growth and development (Pollard, 1991). In the mouse, uterine concentrations of CSF-1 increase 1000-fold in pregnancy under the control of the sex steroids, estrogen and progesterone (Bartocci et al, 1986), with a concomitant upregulation of CSF-1 receptor (CSF-1R) expression in trophoblasts (Regenstreif et al, 1989). The coordinated expression of CSF-1 and its receptor at the feto-maternal interface is temporally associated with the period of maximal placental growth (Arceci et al, 1989). In addition, the physiological relevance of these cytokines in the normal initiation and maintenance of pregnancy is further highlighted by the observation that homozygous mice genetically deficient in CSF-1 are sub-fertile (Pollard et al, 1991). In humans, serum and amniotic fluid levels of CSF-1 increase throughout gestation and CSF-1 mRNA has been detected in endometrial, decidual, and placental tissues (Ringler et al, 1989, Daiter et al, 1992, Kauma et al, 1991). The main source of pregnancy-associated human CSF-1 appears to be the luminal epithelium of the uterus, but first trimester cytotrophoblasts have also been shown to express CSF-1 (Daiter et al, 11 1992). In addition, placental stromal fibroblasts have been shown to produce GM-CSF and CSF and these cytokines are upregulated by IL-1 and TNFa (Garcia-Lloret et al, 1994), both of which are secreted by trophoblasts. CSF-1 receptor mRNA has been detected in primary cytotrophoblasts and in BeWo choriocarcinoma cells. The expression of the CSF-1 receptor increases as cytotrophoblasts fuse and differentiate to form syncytiotrophoblast (Kauma etal, 1991). The roles of these two cytokines in trophoblast differentiation are further confirmed by the observation that GM-CSF and CSF can promote the formation of multinucleated structures in primary cytotrophoblast cultures (Garcia-Lloret et al, 1994). Furthermore, CSF-1 has been shown to primarily induce hCG secretion, while GM-CSF significantly stimulates the production of hPL (Morrish e al, 1998). 1.2.3d EGF and TGF In many species, EGF induces differentiation, proliferation, synthesis of specific proteins, and metabolic activity in various cell types (Carpenter et al, 1979). The cellular localization of EGF and EGF receptor was immunohistochemically analyzed in human placenta at different gestation stages (Takeshi et al, 1995). In 4-to 5-week old placenta, EGF and EGF receptor are almost exclusively localized to cytotrophoblasts, whereas EGF and EGF receptor are predominantly localized to syncytiotrophoblast in 6- to 12-week placenta. The staining intensity of EGF receptor in the syncytiotrophoblast is highest in the first trimester and declines toward the end of gestation. This suggests that the expression of EGF receptor is most pronounced during early placentation. The simultaneous expression of EGF and EGF receptor in cytotrophoblast and syncytiotrophoblast implies that EGF may act in an autocrine manner (Maruo and 12 Mochizuki, 1987; Laines-Llave et al, 1991; Maruo et al, 1992). The action of EGF on proliferation and differentiation is gestationally dependent. In cultures of very early 4-to 5- week placental explants, EGF treatment has no significant effect on the secretion of hCG and hPL to the serum-free medium throughout the entire culture period. Nevertheless, EGF enhances the proliferative activity of cytotrophoblasts in cultures of very early placental tissues obtained at 4-5 weeks gestation. However, in cultures of early 6- to 11- week placental explants, EGF treatment significantly augmented hCG and hPL secretion compared with EGF-untreated cultures, but did not affect the proliferative activity of cytotrophoblasts (Morrish et al, 1987). Some groups have also demonstrated that EGF changes the morphology of the primary cytotrophoblasts, inducing a marked increase in syncytiotrophoblast formation without proliferation (Morrish et al, 1987). The evidence that EGF is involved in trophoblast differentiation is further strengthened by experimental results from the use of an anti-EGF neutralizing monoclonal antibody that acts as an antagonist of the EGF/EGF-receptor. The neutralizing monoclonal antibody exhibits a significant inhibitory effect on the secretion of both hCG and hPL, demonstrating a clear role of EGF during trophoblast differentiation (Amemiya et al, 1994). Transforming growth factor pi is a multifunctional growth factor present in many cells that can have both positive and negative effects on cell proliferation and differentiation (Sporn et al, 1986; Massague et al, 1987). TGFpi induces differentiation of keratinocytes (Shipley et al, 1986; Mansridge et al, 1988; Coffey et al, 1988); ovarian thecal cells (Skinner et al, 1987) and bronchial epithelium (Masui et al, 1986). It can also inhibit differentiation in other cells, including myoblasts (Florini et al, 1988), 13 adipocytes (Ignotz and Massague, 1985), and early hematopoietic progenitor cells (Ohta et al, 1987). Interestingly, TGFpi can act both as an inducer, and an inhibitor of differentiation in cartilage (Frenz et al, 1990). In human placenta, mRNAs encoding isoforms of TGFp (pi, P2, P3) have been detected in syncytiotrophoblasts (Ando et al, 1998; Caniggia et al, 1999). In addition, both type I and type II TGFp receptors have been identified in trophoblasts (Ando et al, 1998). These findings suggest that TGFP may act as an autocrine/paracrine factor to regulate placental development. Notably, TGFpi appears to play an inhibitory role in syncytiotrophoblast formation (Morrish et al, 1991). TGFpi not only inhibits morphological syncytial formation from cytotrophoblasts but also inhibits the expression levels of both hCG and hPL in vitro. TGFpi is also reported to decrease the estradiol and progesterone production in the JEG-3 choriocarcinoma cell line. 1.3 Cell-cell interactions Freshly isolated mononucleate cytotrophoblasts aggregate and establish extensive interactions with one another through the formation of desmosomes, adherens and gap junctions. The cytotrophoblasts eventually undergo terminal differentiation and spontaneously fuse into multinucleated syncytium. It is well accepted that morphogenesis and cell differentiation depend in part on the regulated expression of cell surface proteins, which, through their connections to the cytoskeleton, result in altered gene expression (Edelman, 1998). In light of that theory, there is likely to be tightly regulated expression in trophoblasts of members of the cadherin gene superfamily of calcium-dependent cell 14 adhesion molecules (CAM), as the cadherins are believed to be fundamental players in this morphologic and functional differentiation. 1.3.1 The cadherin superfamily Cadherins are a large family of glycoproteins that mediate calcium-dependent cell adhesion in a homophilic manner. Members of this gene family are comprised of an extracellular domain responsible for cell-cell interactions, a transmembrane domain, and a cytoplasmic domain that is linked to the cytoskeleton. Cadherins are also characterized by a distinctive sequence motif termed a cadherin repeat which is tandemly repeated in their extracellular domain (reviewed by Yagi & Takeichi, 2000). Structural studies have shown that calcium ions bind to each cadherin repeat to ensure proper folding and protect against protease digestion, thus conferring rigidity upon the extracellular domain (Yoshida & Takeichi, 1982; Koch et al, 1999). The cadherin family of proteins consists of classical and non-classical cadherins (Figure 2). The classical cadherins are the main mediators of calcium-dependent cell-cell adhesion (reviewed by Yagi & Takeichi, 2000). The non-classical cadherins include desmosomal cadherins (Angst et al, 2001), the recently discovered large subfamily of protocadherins which are implicated in neuronal plasticity, and the seven-transmembrane cadherins or Flamingo cadherins (Nollet et al, 2000) which were first identified in Drosophila. Flamingo cadherins are believed to mediate planar cell polarity in Drosophila (Chae et al, 1999). 15 Plasma membrane Classical Cadherins Type I Cadherins N' Type II Cadherins Non-classical Cadherins Intracellular Desmosomal Cadherin Proto-oncogene RET Flamingo Cadherin Cadherin repeat (CR) Cadherin cytoplasmic domain pi20 binding site (3-catenin binding site His-Ala-Val motif Single pass transmembrane domain Multiple pass transmembrane domain Laminin AG domain \ y Flamingo box EFG-like domain Intracellular anchoring domain Catenin-binding sequence Proline-rich linker Repeat unit domain Tyrosine kinase Figure 2. Domain organization of representative members of the cadherin superfamily. Classical cadherins have a well conserved cytoplasmic domain and can be grouped into Type I and Type II cadherins, with Type I cadherins having a His-Ala-Val sequence in the N-terminal region. The desmosomal cadherins contain five extracellular CRs and a cytoplasmic domain that interacts with plakoglobin, desmoplakin and the plakophilins. The proto-oncogene RET has one CR and a tyrosine kinase domain in its cytoplasmic domain. Flamingo cadherins have 8-9 CRs, 2 laminin A G domains, 4 E F G domains, and a unique domain called the Flamingo box. 16 Classical cadherins are a family of single-span transmembrane glycoproteins and are further categorized into 2 types, Type I and Type II. The Type I classical cadherins include three that were originally identified by immunological and cDNA cloning strategies: E-cadherin (E-cad), N-cadherin (N-cad) and P-cadherin (P-cad) (Nose and Takeichi, 1986; Nagafuchi et al, 1987; Hatta et al, 1988; Suzuki et al, 1991). These cadherin subtypes are the best characterized members of this gene superfamily of CAMs and were named on the basis of their tissue distribution during mouse embryonic development; E-cad is primarily expressed in epithelial cells, N-cad in neuronal cells and P-cad in the placenta and deciduas. Type I and Type II cadherins both have five extracellular repeats, and Type I can be distinguished from Type II by the presence of a histidine, alanine, valine (HAV) tripeptide within the most N-terminal extracellular repeat (EC1). Homophilic protein-protein interactions between two cadherin molecules at the cell surface are believed to be mediated by interactions between the H A V domains. Cadherin molecules with a deletion in EC1 fail to mediate cell-cell interactions (Takeichi, 1990; Knudsen et al, 1998)). In addition, recent crystallization of the extracellular domain of the Type I cadherin, Xenopus C-cadherin, further identified other intracellular interfaces participating in cadherin interactions, such as the conserved tryptophan side chain that intercalates into a conserved hydrophobic pocket in the corresponding partner (Boggon et al, 2002). These CAMs are synthesized as precursor molecules containing a signal peptide and an amino terminal domain that is removed post-translationally by the furin/subtilisin family of proprotein convertases (Ozawa and Kemler, 1990; Posthaus et al, 1998). The extracellular domain of the cadherins is also glycosylated on asparagine residues prior to being transported to the cell surface (Shore and Nelson, 1991; Geyer et 17 al, 1999). In addition, the EC5 subdomain of the Type I classical cadherins contain four conserved cysteine residues that are likely involved in the formation of intramolecular disulfide bonds (Ringwald et al, 1987, Takeichi, 1991).The cytoplasmic domains are the most highly conserved regions among members of the Type I classical cadherin gene superfamily (Hatta et al, 1988; Suzuki et al, 1991). Recent studies have implicated these cytoplasmic domains in regulating cadherin function at the cell surface (Ozawa and Kemler, 1998; Yap et al, 1998). The classical cadherin cytoplasmic domains are capable of interacting with a group of cytoplasmic proteins, known as the catenins. 1.3.2 Classical cadherin-catenin interactions At the adherens junctions, the intracellular domain of the classical cadherins interacts with various catenin proteins to form the cytoplasmic cell-adhesion complex (CCC) (Figure 3). P-catenin and y-catenin, also known as plakoglobin, bind in a mutually exclusive way to the same conserved site comprising a core region of 30 amino acids at the carboxyl terminal of classical cadherins (Stappert et al, Jou et al, 1995). P-catenin and y-catenin are both members of the Armadillo family of proteins and share about 65% identity (Fouquet et al, 1992). Apparently these two proteins play very different roles in cellular signaling pathways (Zhurinsky et al, 2000), however they can substitute for one another as structural components of the adherens junction (Butz et al, 1992; Knuden et al, 1992). The N-terminal portion of both P-and y- catenins interacts with a-catenin, which links the cadherin to the cytoskeleton. a-catenin is crucial in maintaining the integrity of adherens junctions since knocking-down or mutation of a-catenin disrupts adherens junctions (Aberle et al, 1994; Jou et al, 1995; Pokutta & Weis, 2000; 18 Nagafuchi &Tsukita, 1994). Further studies showed that both the N-terminus and C-terminus of a-catenin are needed to connect the cadherin complex to the cytoskeleton (Nagafuchi et al., 1994). Several actin-binding proteins such as a-actinin, vinculin and Z O l are responsible for linking a-catenin to the actin cytoskeleton, although in some cases a-catenin can interact with the actin cytoskeleton directly (Knudsen et al, 1995; Watabe-Uchida etal, 1998). In addition to P-catenin and plakoglobin, another catenin called pi20 catenin binds to the cytoplasmic domain of Type I and Type II classical cadherins. pl20 catenin is a member of a subgroup of Armadillo family members that have been shown to be localized in various cellular junctions (Anastasiadis & Reynolds, 2000). pi 20 catenin was initially identified as Src substrate and subsequently shown to interact with the highly conserved juxtamembrane domain of cadherins (Reynolds et al, 1994). The role played by pi20 in adherens junctions is still elusive, probably because there are numerous pi20 catenin splice variants and a number of closely related family members that hinder detailed investigation of each kind. In addition to their roles in regulating cadherin-mediated adhesion and linkage to the cytoskeleton, the catenins have been shown to be integral parts of signal transduction pathways. 19 Figure 3. Cadherin-cadherin and cadherin-catenin complexes at the adherens junction. Trans-interactions between two cadherins molecules are mediated by homophilic protein-protein interactions. These, and cadherin-catenin interactions, form molecular complexes that are linked to the actin cytoskeleton and regulate intracellular signaling pathways. 20 1.3.3 Signaling through cadherins Wnt At the adherens junctions, P-catenin is well known as a participant in mediating cadherin-based, cell-cell adhesion. On the other hand, P-catenin is also an integral part of the Wnt signaling pathway involved in both development and tumorigenesis. Wnt is an extracellular matrix-associated growth factor that interacts with its receptor, a member of the frizzled family, to initiate a signal transduction pathway that ultimately promotes cell growth by inducing cyclin D l and myc (Conacci-Sorrell et al, 2002). In the absence of Wnt signaling, a pool of non-adhesion-associated, soluble P-catenin binds to the adenomatous polyposis coli (APC)-axin tumor suppressor complex, where it is phosphorylated by glycogen synthase kinase 3P and targeted for degradation by ubiquitin. In contrast, in response to Wnt signaling, P-catenin degradation is inhibited, allowing it to accumulate and move to the nucleus where it forms a complex with the TCF/LEF transcription factors to drive transcription of Wnt responsive genes. There is strong evidence that the expression of E-cadherin can modulate the activity of P-catenin-associated Wnt signaling. This idea comes from transfection studies where overexpression of E-cadherin can retain P-catenin/TCF signaling (Gottardi et al, 2001). M A P K Regulated E-cadherin expression is believed be compromised in abnormal cell growth and differentiation. Increasing evidence has shown that disruption of E-cadheirn expression and function not only has an effect on the cell-cell adhesion system, but also on intracellular signal transduction. The kinase cascade regulating the activity of p42/p44 21 mitogen-activated protein kinases (MAPK) is one of the best characterized intracellular signaling pathways, and it integrates signals coming from a wide array of cell membrane receptors (Seger et al, 1995). The M A P K pathway has been found to play a critical role in the control of cell survival, proliferation, and differentiation when activated by both growth factor receptor and surface adhesion molecules such as integrins, in a variety of cellular settings (Howe et al, 1998; Zhu et al, 1999). A recent report by Gutkind et al. (2000) has demonstrated that E-cadherin is capable of activating M A P K in epithelial cells. Furthermore, E-cadherin is able to transactivate EGFR in a ligand-independent manner, although the mechanism is still unknown. The use of tyrphostin A G 1478, which specifically inhibits EGFR kinase by competing for ATP, decreases M A P K activation induced by the formation of adherens junctions after calcium restoration. The current idea is that E-cadherin and EGFR cooperate to activate signaling pathways downstream of adherens junctions, thus leading to the phosphorylation of She and an increase in the enzymatic activity of M A P K (Gutkind et al, 2000) 1.4 Identification of the classical cadherins present in the human placenta and during trophoblast differentiation Cadherin superfamily members not only maintain the structural integrity of cells and tissues but also control a wide array of cellular behaviors (Larue et al, 1996; Huber et al, 1996). They are key regulators of cell and tissue polarization (Larue et al, 1994; Riethmacher et al, 1995), and they also regulate cell movement such as cell sorting, cell migration and cell rearrangements (Nose et al, 1988; Steinberg & Takeichi, 1994; Takeichi, 1998). The importance of cadherins is evidenced by the embryonic lethality or 22 abnormal tissue maturation in mice null for specific cadherins (Hynes, 1996). In view of the central role that the classical cadherins play in the formation and organization of tissues during embryonic development and in maintaining tissue integrity, it is not surprising that members of this gene superfamily mediate human placentation. The expression of E-cadherin during morphologic differentiation of trophoblastic cells has been well studied (Coutifaris et al, 1991). Unlike the cytotrophoblasts isolated from human chorionic villi that aggregate and fuse spontaneously to form syncytium in vitro, JEG-3 and BeWo choriocarcinoma cells are not fusion competent under standard culture conditions. During the aggregation of primary cytotrophoblasts, E-cadherin is localized on the cell surface at points of cell-cell contact and cannot be detected following cellular fusion. E-cadherin protein levels in normal cytotrophoblasts increase during the initial 24h of culture, but decrease by 82% between 24h and 96h of culture, coincident with a marked decrease in the number of cellular aggregates and a parallel increase in the formation of multinucleated syncytia. The disappearance of E-cadherin from the cell surface was also observed in BeWo choriocarcinoma cells undergoing terminal differentiation and fusion in response to the intracellular second messenger, cAMP (Coutifaris et al, 1991). In contrast to E-cadherin, the expression of Cadherin-11 increases during the formation of multinucleated syncytium in primary cultures of villous trophoblasts. Antisense oligonucleotides specific for Cadherin-11 are able to inhibit the terminal differentiation and fusion of primary villous cytotrophoblasts (MacCalman, 1997). The fusogenic ability of Cadherin-11 was further confirmed by the exogenous expression of Cadherin-11 in mononucleate JEG-3 cells, which are not fusion competent. The 23 exogenous expression of Cadherin-11 is capable of promoting the morphological and functional differentiation of these trophoblastic cells with a concomitant decrease of E -cad and increase of hCG(3 mRNA levels (Getsios et al, 2003). Collectively, these results indicate that E-cadherin and Cadherin-11 are differentially expressed during trophoblast differentiation in vitro and are key players mediating the differentiation process. 1.5 Cadherin-associated transcription factors Cloning and characterization of the human E-cadherin promoter has revealed that two E-boxes present in a proximal fragment of the promoter are important for the repression of this gene (Giroldi et al, 1997). The two E-boxes characterized so far in the human and mouse E-cadherin promoters have an identical core, consisting of the sequence 5'CACCTG. This sequence exactly matches the DNA-binding site of Snail (Mauhin et al, 1993; Battle et al, 2000). Snail is an important regulator of E-cadherin gene expression in several developmental processes in different species, from flies to humans (reviewed by Hamavathy et al, 2000). Drosophila Snail mutant embryos die at gastrulation and show a gastrulation-defective phenotype that has been associated with impaired downregulation of E-cadherin (Oda et al, 1998). In light of the regulation of Snail on E-cadherin gene expression, Snail and its family members are believed to be fundamental players in E-cadherin-mediated trophoblast differentiation and fusion. In the next section, the cell biology of the Snail family will be discussed. 1.5.1 The Snail family Snail was first identified in Drosophila melanogaster (Grau et al, 1984; Nusslein-Volhard et al, 1984), and has been implicated in several important embryonic 24 developmental processes, including mesoderm formation (Leptin, 1991; Alberga et al, 1991) neural crest formation (Nieto et al, 1994), and left-right asymmetry (Issac et al, 1997). Embryos which are homozygous for loss-of-function of Snail exhibit defects in the invagination of the presumptive mesoderm and retraction of the germ band (Grau et al, 1984; Nusslein-Volhard et al, 1984). The elucidation of the significant role of Snail in Drosophila embryogenesis prompted a search for similar genes in other organisms. Since then, homologs of Snail have been identified in diverse groups of animals including nematodes (Metzstein & Horwitz, 1999), protochordates (Corbo et al, 1997), amphibians, fish (Smith et al, 2000), and mammals (Twigg & Wilkie, 1999). Snail family members encode zinc-finger type transcription factors (Mauhin et al, 1993). They all share a similar organization, being composed of a highly conserved carboxyl-terminal region that contains from four to six zinc fingers of which probably a minimum of four fingers are required for function. The amino-terminal region of Snail family proteins is more divergent among all members of the family. Zinc fingers are one of the most abundant structural motifs. Different classes of zinc fingers include CCHH, CCHC, C C C H , C C C C , where C and H are the cysteine and histidine residues that constitute the zinc-binding structure. The fingers of the Snail family are all the C C H H type and function as sequence-specific DNA-binding motifs. The fingers are structurally composed of two P-strands followed by an a-helix, the amino-terminal part of which binds to the major groove of the DNA. Both random selection and transfection assays with different promoters have shown that the consensus binding site for S«aj7-related genes contains a core of six bases, C A G G T G (Battle et al, 2000). This motif is identical to the E-box, which is also the consensus binding site of 25 basic helix-loop-helix (bHLH) transcription factors, suggesting that Snail proteins might compete with these for the same binding sequences (Kataoka et al, 2000,). On binding to the E box, Snail family members have been demonstrated to act as transcriptional repressors. The repressor activity depends not only on the finger region, but also on at least two different motifs that are found in the amino-terminal region. One of these is the SNAG domain. This domain was originally identified in the Gfi-1 oncoprotein (Grimes et al, 1996), which is also a zinc-finger protein, and was believed to function as a repressor domain. The SNAG domain is conserved in all vertebrate Snail genes, and is important for repression in mammalian cells (Nakayama et al, 1998). However, SNAG is not the only the motif responsible for repression. In Drosophila, there is another motif called the CtBP binding site, which interacts with a co-repressor, CtBP (carboxy-terminal binding protein) and thus as a repressor domain for Snail (Nibu, 1998). 1.5.2 Gene and protein structure of the human Snail gene (SNAI1) Paznekas et al (1999) mapped the human Snail gene to chromosome 20 using somatic cell and radiation hybrid mapping panels. It is composed of three exons with 2 intervening introns (Figure 4). The human Snail gene is 60.6 % identical to the coding region of human Slug. The structure of human Snail is similar to that of the mouse Snail gene with 85% nucleotide identity. The human and mouse Snail 5'UTR share 55.7% identity, while the 3'UTRs share 63% identity. The Snail protein is composed of 264 amino acids with a predicted molecular mass of 29.1 kDa. It is composed of 264 amino acids. Its C-terminal portion has three classic zinc fingers and a fourth atypical zinc 26 finger. The N-terminal portion differs much more among the various family members and contains a SNAG domain (Pazekas et al, 1999). The human Snail protein is expressed in many tissues. By Northern blot analysis, the human Snail transcript is 2.0kb in size with no observed alternative spliceoforms. It is highly expressed in adult heart and lung, and in placenta. It is expressed at lower levels in adult brain, liver and skeletal muscle (Pazekas et al, 1999). 1.5.3 Gene and protein structure of the human Slug (SNAI2) In addition to Snail genes, all vertebrates contain a related Slug gene. The Slug proteins from different vertebrates constitute a distinct subgroup and they are particularly highly conserved among themselves. The human Slug gene has been mapped to chromosome 8 (Cohen et al, 1998). Similar to human Snail, it contains three exons and 2 introns (Figure 5). The Slug transcript is 2.2kb and is highly expressed in placenta and adult heart but is barely detectable in adult brain and lung. The protein is composed of 268 amino acids, with an expected molecular mass of 29.989 kDa. The human Slug protein is 95, 93 and 88% homologous to mouse, chicken and Xenopus Slug, respectively. The zinc finger regions are 100% identical between human and mouse Slug, indicating that Slug is very resistant to evolutionary changes (Cohen et al, 1998). The expression and function of both Snail and Slug in vertebrates are still not well understood. Slug seems to be the dominantly expressed protein of the pair in chick embryos and is responsible for neural crest migration and mesoderm delamination (Nieto et al, 1994). This idea comes from the observation that antisense oligonucleotides to Slug inhibited both neural crest migration and mesoderm delamination in early chick 27 development (Nieto et al, 1999). Similar results were obtained from Xenopus when antisense oligonucleotides to Slug were injected into Xenopus embryos, as this disrupted neural crest migration and formation of specific crest derivatives (Carl et al, 1999). However, Snail in the chick embryo was found to be involved in left-right asymmetry (Issac et al, 1997), in contrast to its action in Xenopus, where Slug and Snail act redundantly to control neural crest cell migration (Carl et al, 1999). Human Slug has been demonstrated to be an anti-apoptotic factor mediating the oncogenic effect of the E2A-HLF fusion protein in leukemia (Inukai et al, 1999). Interestingly, Slug mRNA is present in most adult tissues including spleen and thymus, but not in peripheral blood leukocytes. It has been suggested that Slug is present at earlier developmental stages of lymphocytes, when its anti-apoptotic function is required for positive selection (Hemavathy et al, 2000). 28 A. 82 bp 528 bp 185 bp 5' 60 bp k 682 bp 3520 bp 3* 801 bp 795bp B. Figure 4. Gene and protein structure of the Snail family member SNAI1. A. The gene encoding SNAII comprises three exons and two introns. The green boxes represent the exons and the solid lines denote the untranslated area and intronic regions. B. The SNAI I protein has 264 amino acids with 4 zinc fingers and a SNAG domain. Snail family members all share a similar organization, being composed of a highly conserved carboxyl-terminal region that contains from four to six zinc fingers of which probably a minimum of four fingers are required for function. The amino-terminal part of the Snail family proteins is more divergent among all members of the family. 29 79bp 546 bp 182 bp 5' 745 bp , 907 bp 3' 807bp B . Figure 5. Gene and protein structure of the Snail family member SNAI 2. A. The SNAI 2 gene encoding Slug comprises three exons and two introns. The green boxes represent the exons and the solid lines denote the untranslated area and intronic regions. B . The SNAI 2 protein has 268 amino acids with 5 zinc fingers and a SNAG domain. 30 1.5.4 The roles of hSnail and E-cadherin during tissue development The importance of hSnail in triggering epithelial-mesenchymal transition (EMT) has been well established (Cano, 2000). E M T is the mechanism by which epithelial cells that are generated in a particular region can dissociate from the epithelium and migrate to reach different locations (Hay et al, 1995; Boyer et al, 2000). As such, E M T is fundamental to both normal development and the progression of malignant epithelial tumors. The involvement of Snail in E M T has been demonstrated by the observation that Snail can convert normal epithelial cells into mesenchymal cells through the direct repression of E-cadherin expression (Carver et al, 2001). The inverse correlation of E-cadherin and Snail expression has been seen not only during E M T but in an EMT-like process, cancer progression (Battle et al, 2000). Epithelial-mesenchymal transition is one of the components of the progression of carcinomas, particularly those having an invasive phenotype. Both E M T and progression of cancer occur concomitantly with the cellular acquisition of migratory properties following downregulation of expression of E-cadherin. The strong inverse correlation between Snail and E-cadherin expression has been seen in different carcinoma cell lines, including breast (Hajra et al, 2002), gastric (Rosivatz et al, 2002,), and hepatocellular carcinoma (Sugimachi et al, 2003). Ectopic expression of Snail is able to downregulate E-cadherin in human hepatocellular carcinoma (HHC), while expression of Slug, the other Snail family member, is not related to E-cadherin expression in HHC. Recently, Hajra et al. (2000) reported that Slug is capable of repressing E-cadherin in breast cancer cell lines. They also demonstrated repression of E-cadherin by Slug and Snail in vivo (Hajra et al, 2002). Although Snail 31 and Slug are from the same family, their functions differ among various species and cells type. As Snail is involved in the loss of E-cadherin expression during development and cancer progression, several groups have provided different mechanisms by which Snail or Slug mediate the transcriptional repression of E-cadherin. Phosphorylation and subcellular location both regulate the activity of Snail. The nuclear export sequence (NES) located within the N-terminal of Snail is proven to participate in the transport of Snail out of the nucleus. The activity of the NES is regulated by phosphorylation, although the kinase and the transporter that are respectively responsible for the phosphorylation and export are unknown. When Snail is phosphorylated, it is transported out of the nucleus even though the DNA binding ability is retained, and is thus not able to access its target promoters. Therefore, Dominguez et al. (2003) suggest that Snail promotes its effects only when it is upregulated and the entire population cannot be totally phosphorylated and exported. Hence some Snail is retained in the nucleus and subsequently binds to its target genes. Epigenetic gene regulation has emerged as a main mechanism to control gene expression. This involves chromatin remodeling and histone modifications that change the conformation of the DNA. Epigenetic processes that involve hyperacetylation of histone are a common way to control gene expression, especially developmentally regulated gene expression, for example of the globin gene. Hyperacetylation of histone H3 and H4 are generally associated with transcriptionally active chromatin, while the chromatin of inactive regions is enriched with deacetylated histones H3 and H4. The acetylation status of histones at specific DNA regulatory sequences depends on the 32 recruitment of histone acetyltransferases or histone deacetylase (HDAC). These do not only function alone, but also recruit different co-activators or co-repressors. In Peinado et al. (2004), Snail interacts directly with the endogenous E-cadherin promoter, as demonstrated by chromatin immunoprecipitation (ChIP) assays. In addition, Snail recruits histone deacetylase (HDAC). Moreover, association of Snail with the co-repressor mSin3A is required for down-regulation of E-cadherin gene expression. These interactions are dependent on the SNAG domain in the N-terminal region of Snail. 1.5.5 Twist-A big player in cell differentiation The basic helix-loop-helix transcription factor Twist was originally identified in Drosophila, in which mutated Twist results in a Twisted phenotype in embryos (Thisse et al, 1988). Thereafter several groups demonstrated that the expression pattern of Twist is related to the formation and specification of the mesoderm in Drosophila (Leptin, 1991). Recently, Twist was demonstrated to play a major role in inducing cell movement and tissue reorganization during invasion and metastasis (Yang et al, 2004), in particular in the metastasis of breast cancer. In addition to cancer differentiation, Twist is able to regulate osteoblast differentiation. As Twist has a regulatory role both in cancer differentiation and normal differentiation, we speculate that Twist may be regulated during trophoblast differentiation. In the next section, the role of Twist during morphogenesis and embryogenesis will be reviewed. 33 1.5.6 Twist protein in morphogenesis During gastrulation, the mesoderm and the anterior endoderm are formed by the invagination of the ventral furrow. Several zygotic genes, under control of different maternal morphogens, set up the primordial of the germ layers. The nuclear gradient of the maternal gene product dorsal directs the ventral expression of two zygotic transcription factors, Twist and Snail (Belay et al, 1987; Thisse et al, 1988, 1991; Ip et al, 1992). Both Twist and Snail are required for the formation of the ventral furrow and later, of the mesodermal germ (Simpson, 1983; Grau et al, 1984). They are thought to activate the genes responsible for ventral furrow formation and for mesodermal differentiation (Leptin, 1991). Following gastrulation, a segmentally repeated pattern of Twist expression forms along the anterior-posterior axis of the embryo, subdividing each mesodermal segment into a low and high Twist domain (Azpiazu et al, 1996; Riechmann et al, 1997). Cells located in the high Twist domain develop into somatic muscle and heart, whereas cells located in the low Twist domain differentiate into visceral muscle, fat body and gonadal mesoderm. High Twist levels direct cells to differentiate into body muscle, and low levels permit the execution of other tissue fates (Baylies and Bate, 1996). 1.5.7 Twist in human In humans, mutations in the Twist gene have been identified in Saethre-Chotzen syndrome, a bone disease characterized by premature fusion of the cranial sutures and limb abnormalities of variable severity (El Ghouzzi et al, 1997). Insertions, deletions, nonsense and missense mutations have been identified in H-Twist, and these gene 34 alterations result .in protein degradation and subcellular mislocalization of the Twist protein (El Ghouzzi et al., 2000). Twist has been demonstrated to alter osteoblastic differentiation patterns in bone development. Twist overexpressing cells are more progenitor-like, whereas cells treated with Twist antisense oligonucleotides and thus having reduced Twist expression represent a more differentiated osteoblast phenotype (Lee et al., 1999). In addition, it has been shown that Twist plays a crucial role in cranial osteogenesis, and Twist haploinsufficiency enhances apoptosis in osteoblasts leading to premature fusion of calvarial bones (Yousfi et al., 2002). It has been proposed that many craniosynostosis syndromes result from local perturbation of apoptotic programs that are essential for proper timing of suture fusion. (Bourez et al., 1997) Recently, the role of Twist in apoptosis has been further elucidated. Twist may function as a potential oncogene interfering with p53-related pathways, leading to the prevention of myc-induced apoptosis in mouse embryonic fibroblasts (Maestro et al., 1999). Twist is also involved in the suppression of differentiation and protection of apoptosis through inhibition of p21 via both p53-dependent and -independent pathways. Twist exerts its anti-apoptotic function by specifically suppressing NF-kB-dependent cytokine expression (Sosic et al., 2003). 1.5.8 H-Twist gene The human Twist gene is located at 7p21 (Bourgeois et al, 1996). The gene encoding H-Twist comprises two exons separated by an intron (Figure 6). The human H-twist cDNA isolated from a placental cDNA library encodes a protein of 202 amino acids with a basic helix-loop-helix domain (Bourgeois et al, 1996). It is 96.6% identical to the 35 M-Twist protein of Mus musculus. Overall sequence conservation is obvious among the 40 amino acids lying in the amino-end, and in the carboxy terminal moiety of these proteins, including the basic helix-loop-helix (bHLH) structure. Twist is a bHLH transcription factor. The two amphipathic helices are separated by a loop with varying length, which is important in maintaining the tertiary structure of the H L H moiety. B H L H proteins bind as dimers to the consensus hexanucleotide sequence E-box, 5'CANNTG-3'. The basic domain mediates the interaction with DNA (Yin et al., 1997; Cripps & Olson, 1998). Class B bHLH proteins to which H-Twist belongs are known to form stable heterodimers with members of class A bHLH transcription factors, including gene products of E2A (El2 and E47) (Staudinger et al., 1993). In humans, E12 appears as a putative partner in vivo that regulates H-twist transcriptional activity and determines the tissue-specificity of Twist (El Ghouzzi et al., 2000). 36 exon 1 intron 1 untranslated exon 2 5' B. helix 1 helix 2 N -Figure 7. Gene and protein structure of the human Twist. A. The gene encoding H-Twist comprises two exons separated by a unique intron. B . The H-Twist protein has 202 amino acids with a basic helix-loop-helix domain. 37 P A R T II. H Y P O T H E S I S A N D O B J E C T I V E A tight regulation of cadherin expression is fundamental for the differentiation of cytotrophoblasts. As demonstrated from previous studies, the cadherin subtype switch from E-cadherin to Cadherin-11 is associated with cytotrophoblast differentiation. Many transcriptional regulators and signaling molecules have been identified as playing key roles in various developmental processes. Among the transcription regulators, the Snail family and the bHLH Twist transcription factor both have significant roles in embryogenesis and tissue differentiation. In particular, a number of reports indicated that Snail or Slug is a potential regulator of E-cadherin expression. In addition, Twist is implicated in cadherin switching during tumor metastasis. Since cytotrophoblast differentiation is at least in part mediated by cadherin subtype switching, the present study aimed to elucidate the molecular mechanism(s) underlying the differential expression of cadherin molecules by examining the expression profiles of Snail, Slug and Twist during cAMP -induced differentiation of BeWo choriocarcinoma cells. 38 P A R T III. M A T E R I A L A N D M E T H O D S 3.1 Cel l preparation and culture A human BeWo choriocarcinoma cell line was obtained from American Type Culture Collection (ATCC, Rockville, MD). Cells were maintained as a monolayer in culture flasks and induced to differentiate in vitro as described previously (MacCalman et al., 1996). Briefly, culture medium F12 (Sigma, St Louis, MO) was supplemented with 10% fetal bovine serum (Life Technologies, Inc. Burlington, ON, Canada) and penicillin and streptomycin (lOOIU/ml and lOOug/ml, respectively. Cultures of the BeWo choriocarcinoma cell line were treated with or without 8-bromo-cAMP (1.5 mM; Sigma-Aldrich, Canada) for 0, 12, 24, or 48 h before being harvested for total R N A extraction, protein extraction or immunostaining. For RNA extraction and Western blot analysis, BeWo cells were cultured in 35 mm 2 culture dishes at densities of 4X10 5 cells per dish. For immunocytochemistry, the cells were seeded on glass coverslips that had been placed in 6 well-plates at densities of 1X105 cells per dish. Cells were grown in a humidified incubator with 5% carbon dioxide at 37°C. 3.2 Primer design Nucleotide sequences specific for E-cadherin, Snail, Slug, Twist were identified in the human mRNA sequences deposited in GenBank (National Center for Biotechnology Information, Bethesda, MD). Forward and reverse primers corresponding to these D N A sequences and the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were used to quantify and assess the integrity of the total RNA samples, and were synthesized at the Nucleic Acid Protein Synthesis Unit, University of 39 British Columbia. To construct internal standard cDNA fragments, floating primers with a sequence complementary to a short nucleotide sequence present in the expected PCR products were generated by attaching the complementary sequences of these binding sites to the 3' end of the original reverse primers specific for E-cadherin, Snail, Slug and Twist (Figures. 7-10). 3.3 Total R N A preparation and R T - P C R Total RNA was prepared from the BeWo cultures using a RNeasy Mini Kit (Qiagen, Inc., Chatsworth, CA) using a protocol recommended by the manufacturer. The concentrations of total RNA obtained from the cell extracts were quantified by optical densitometry (260/280nm) using a Du-64 UV-spectrophotometer. An aliquot (l^ig) of the total RNA extracts was reverse transcribed into cDNA using a First Strand cDNA Synthesis Kit according to the manufacturer's protocol (Amersham Pharmacia Biotech., Oakville, Canada). PCR was performed using template cDNA generated from total RNA extracts from BeWo cultures and the primer sets specific for E-cadherin, Snail, Slug or Twist. The PCR conditions were as follows: 1 min at 94°C, lmin at 58.5°C, 58.5°C, 59.5°C or 58°C for E-cadherin, Snail, Slug or Twist, respectively, and 1.5 min at 72°C, followed by a final extension at 72°C for 15 min. Thirty PCR cycles were carried out for E-cadherin, Snail, Slug or Twist. The resultant PCR products for E-cadherin, Snail, Slug and Twist were resolved by gel electrophoresis and visualized by ethidium bromide staining. Aliquots of the E-cadherin, Snail, and Slug and Twist PCR products were subcloned into the PCR II vector (Invitrogen, Carlsbad, CA) and selected clones were subjected to DNA 40 F I G U R E 7. Schematic diagram of oligonucleotide primers for human E-cadherin amplification mRNA Primers 5'-3' Size (bp) Human E-cad Forward Primer Reverse Primer Mutant Forward Primer 1. TGGATGTGCTGGATGTGAAT 560bp 2. ACCCACCTCTAAGGCCATCT 3. TGGATGTGCTGGATGTGAATGCTACAGACA3' 305bp 560 bp target cDNA Forward Primer TGGATGTGCTGGATGTGAAT fi ACCCACCTCTAAGGCCATCT Reverse Primer TGGATGTGCTGGATGTGAAT GCTACAGACAi ACCCACCTCTAAGGCCATCT Mutant Forward Primer TGGATGTGCTGGATGTGAAT GCTACAGACA ACCCACCTCTAAGGCCATCT Reverse Primer fl 305bp competitor cDNA 41 Figure 7. Schematic diagram summarizing the QC-PCR strategy employed in the study of E-cadherin. A competitive E-cadherin cDNA (305 bp) was generated through the addition of a stretch nucleotides, corresponding to a specific sequence within the target cDNA(560bp),to the initial forward primer. 42 FIGURE 8. Schematic diagram of oligonucleotide primers for human Snail mRNA amplification mRNA Primers 5'-3' Size (bp) Human Snail Forward Primer Reverse Primer Mutant Forward Primer 1. GGTTCTTCTGCGCTACTGCT 552 2. CCAGGCTGAGGTATTCCTTG 552 3. GGTTCTTCTGCGCTACTGCT CCAATGCTCA 351 552bp target cDNA fi Forward Primer GGTTCTTCTGCGCTACTGCT CCAGGCTGAGGTATTCCTTG Reverse Primer GGTTCTTCTGCGCTACTGCT i CCAATGCTCA CCAGGCTGAGGTATTCCTTG Mutant Forward Primer GGTTCTTCTGCGCTACTGCT CCAATGCTCA fl CCAGGCTGAGGTATTCCTTG Reverse Primer 351 bp competitor cDNA 43 Figure 8. Schematic diagram summarizing the Q C - P C R strategy employed in the study of Snail. A competitive Snail cDNA (351 bp) was generated through the addition of a stretch nucleotides, corresponding to a specific sequence within the target cDNA (550 bp), to the initial forward primer. 44 F I G U R E 9. Schematic diagram of oligonucleotide primers for human Slug m R N A amplification mRNA Primers 5'-3' Size (bp) Human Slug Forward Primer Reverse Primer Mutant Reverse Primer 1. ATGGCCTCTCTCCTCTTTCC 582 2. AGCAGCCAGATTCCTCATGT 582 3. AGCAGCCAGATTCCTCATGT GCATCTTCAG 338 582bp target cDNA Forward Primer ATGGCCTCTCTCCTCTTTCC AGCAGCCAGATTCCTCATGT Reverse Primer ATGGCCTCTCTCCTCTTTCC GCATCTTCAG i AGCAGCCAGATTCCTCATGT Mutant Forward ATGGCCTCTCTCCTCTTTCC AGCAGCCAGATTCCTCATGT GCATCTTCAG Mutant Reverse Primer fl 338bp competitor cDNA 45 Figure 9. Schematic diagram summarizing the Q C - P C R strategy employed in the study of Slug. A competitive Slug cDNA (338 bp) was generated through the addition of a stretch nucleotides, corresponding to a specific sequence within the target cDNA (582bp), to the initial reverse primer 46 F I G U R E 10. Schematic diagram of oligonucleotide primers for human Twist mRNA amplification mRNA Primers 5'-3' Size (bp) Human Twist Forward Primer Reverse Primer Mutant Forward Primer 1. AGTCCGCAGTCTTACGAGGA 576 2. GCAGAGGATGTGAGGATGGT 576 3. AGTCCGCAGTCTTACGAGGA CAAGTGGCA 361 576bp target cDNA Forward Primer AGTCCGCAGTCTTACGAGGA GCAGAGGATGTGAGGATGGT Reverse Primer AGTCCGCAGTCTTACGAGGA CAAGTGGCA GCAGAGGATGTGAGGATGGT Mutant Forward Primer AGTCCGCAGTCTTACGAGGA CAAGTGGCA fl 361bp competitor cDNA GCAGAGGATGTGAGGATGGT Reverse Primer 47 Figure 10. Schematic diagram summarizing the Q C - P C R strategy employed in the study of Twist. A competitive Twist cDNA (361 bp) was generated through the addition of a stretch nucleotides, corresponding to a specific sequence within the target cDNA (576 bp), to the initial forward primer. 48 sequencing to confirm the specificity of the primers. These clones were also used to generate internal standard E-cadherin, Snail, Slug or Twist cDNA fragments by standard molecular biology techniques. 3.4 Quantitative competitive PCR (QC-PCR) The QC-PCR strategy employed in these studies is based upon the competitive coamplification of a known amount of a internal standard specific for E-cadherin, Snail, Slug or Twist that was added to aliquots of the first strand cDNA prepared from the BeWo cell RNA. To determine the optimal amounts of the internal standards to be used in the QC-PCR analyses, PCR mixtures containing 1 pi of serial diluted competitive PCR products and lpl of first strand cDNA. PCR was then performed using these cDNA mixtures and the distinct E-cadherin, Snail, Slug or Twist primer sets under the optimized conditions described above. An aliquot (lOul) of the resultant E-cadherin, Snail, Slug or Twist PCR products containing the resultant target and internal standard PCR products were resolved by electrophoresis in a 1% agarose gel and visualized by ethidium bromide staining. The intensity of the ethidium bromide staining of the PCR products was analyzed using a U V densitometry imaging system (Biometra, Whiteman Co., Gottingen, Germany). Volume counts (square millimeters) of the scanned PCR products were then determined using Scion Image computer software (Scion Image Co., Frederick, MD). The absorbance values obtained for each of the native and the corresponding competitive cDNAs generated by PCR were plotted against the amount of internal standard initially added to the reaction mixtures. The point of interception on these line graphs was taken as the 49 optimal amount of internal standard to be used in the QC-PCR analysis. Based upon these observations, E-cadherin, Snail, Slug or Twist internal standard cDNAs were added to aliquots of the first strand cDNA to be used in the QC-PCR analysis at concentrations of 7.8xl0~3, 0.125, 3.765xl0;6 and 1.95xl0"3 pg/ul, respectively. Subsequent QC-PCR reactions were performed using an aliquot (lul) of the first strand cDNA synthesized from the BeWo cell RNA and containing the optimized amount of the corresponding internal standard cDNA, with the E-cadherin, Snail, Slug or Twist primer sets under the PCR conditions described above. The ratios of the intensity of ethidium bromide staining of the resultant target/internal standard PCR products were determined as described above. 3.5 Western blot analysis Cultured BeWo cells were washed three times in PBS and incubated at 4°C for 30 min on a rocking platform in 1 OOul of cell lysis buffer (Biosource International, Carmarillo, CA) containing lOmM Tris, pH 7.4; lOOmM NaCl; ImM EDTA; ImM E G T A ; ImM NaF; 1% Triton X-100; 10% Glycerol; 0.1% SDS; 0.5% deoxycholate supplemented with ImM PMSF and protease inhibitor cocktail. The cell lysates were centrifuged at 10,000 x g for 20 min at 4°C, and the supernatants were used for Western blot analysis. The concentration of protein in the cell lysates was determined using the B C A kit (Pierce Chemicals, Rockford, IL). Proteins (40ug) were separated on 10% SDS polyacrylamide gels and transferred to nitrocellulose membrane (Hybond-P, Amersham Pharmacia Biotech., Oakville, Canada). Subsequently, membranes were blocked with 5% nonfat dry milk for lh at room temperature. The nitrocellulose blots were probed with 50 antibodies directed against human Snail (Abgent, San Diego, CA), Slug (Abgent, San Diego, CA), Twist (Santa Cruz, Biotechnology, Inc.) or E-cadherin (Transduction Laboratory, Lexington, KY) overnight at 4 °C. After washing three times with Tris buffered saline (TBS) containing 0.1% Tween-20, membranes were incubated with 1:2000 secondary antibodies in 5% nonfat dry milk for lh. The enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech., Oakville, Canada) was used to detect antibody bound to antigen. The blots were then scanned using a L K B laser densitometer. 3.6 Immunolocalization of E-cadherin and Snail in BeWo cell cultures. Cultures of BeWo cells grown on glass coverslips for 72h were fixed in 4% paraformaldehyde for 30 min at room temperature. The fixed cells were immunostained using a mouse monoclonal antibody directed against E-cadherin (Transduction Laboratory, Lexington, KY)) and a rabbit polyclonal antibody directed against Snail (Abgent, San Diego, CA). Sequential incubations were performed. These included incubations with 10% normal horse serum for monoclonal antibody and normal goat serum for -polyclonal antibody at 37°C for 30 min, primary antibody at 37°C for lh, secondary biotinylated antibody at 37°C for 30 min, streptavidin-biotinylated horseradish peroxidase complex reagent at 37°C for 30 min, and three 5 min washes in PBS. The cells were then exposed to chromagen reaction solution (0.0035%) diaminobenzidine and 0.03%) hydrogen peroxide) for 5 min, washed in tap water for 5 min, counterstained in haematoxylin, dehydrated, cleared, and mounted. 51 3.7 Immunohistochemical analysis of Snail in vivo Immunohistochemistry was performed using sections prepared from permanent paraffin blocks containing first trimester chorionic villi (n=3). The tissue sections were immunostained using polyclonal antibodies directed against human Snail (Abgent, San Diego, CA) on three independent occasions. Nonspecific isotype-matched antibodies were used as negative controls. Sequential incubations were performed and included 5% normal goat serum for 30 min, primary antibody for 2 hr at room temperature, three 5 min washes in PBS, secondary antibody conjugated with HRP-labeled polymer (EnVision™; DakoCytomation) for 30 min, and three 5 min washes in PBS. The sections were then developed in NovaRED substrate (Vector Labs, SK-4800) for 8 min, washed in tap water for 5 min, counterstained in hematoxylin, dehydrated, cleared, and mounted. 3.7 Statistical analysis The absorbance values of the ethidium bromide stained PCR products were subjected to statistical analysis using GraphPad Prism 4 software (San Diego, CA). Statistical differences between the absorbance values were assessed by the analysis of variance (ANOVA). Differences were considered significant when p<0.05. Significant differences between the means were determined using Dunnett's test. The results are presented as the mean relative absorbance (±SEM) obtained from >3 different experiments. 52 P A R T IV. R E S U L T S 4.1 Time-dependent effects of 8-bromo-cAMP on E-cadherin m R N A and protein levels in human BeWo choriocarcinoma cells The Quantitative Competitive Polymerase Chain Reaction (QC-PCR) strategy used in the following studies involves the competitive co-amplification of a known amount of internal standard cDNA specific for the target of interest. To determine the optimal amount of internal standard E-cadherin cDNA to be used in the QC-PCR analysis, serial dilutions of this internal standard cDNA were coamplified in the presence of a fixed amount of target cDNA. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cells with known decreasing amounts of competitive E-cadherin cDNA. As expected, progressively decreasing the amount of the latter competitive cDNA resulted in concomitant increases in the PCR amplification of the BeWo cell target cDNA (Figure. 11). The point of interception of the lines depicting amplified product of internal standard cDNA or target cDNA indicated the optimal amount of internal standard cDNA that should be added to the subsequent QC-PCR reactions. Hence, 7.8x10~3pg/ul of E-cadherin cDNA was added to each QC-PCR reaction (Figure. 11). The time-dependent effect of a fixed concentration of cAMP on E-cadherin transcript expression was investigated. A concentration of 1.5mM cAMP was chosen for this experiment based on its reported ability to induce BeWo cell differentiation (MacCalman et al, 1996). The E-cadherin mRNA transcript was detected in all of the total RNA extracts prepared from the BeWo cell cultures. E-cadherin transcript level was not affected during culture of the cells for 48h in the absence of 8-bromo-cAMP (Figure. 53 12A and C). However, QC-PCR revealed a 50% decrease in E-cadherin mRNA levels in BeWo choriocarcinoma cells after 12h of culture in the presence of this cAMP concentration (Figure. 12B and C). The levels of this mRNA transcript continued to decrease over time with a 9-fold decrease observed at the termination of these studies at 48h (Figure. 12BandC). 54 Marker 160000 140000 i 120000 100000 i 80000 60000 i 40000 20000 i 0 560bp 305bp internal standard cDNA target cDNA 62.5 31.25 0.4875 KHpg/ul Figure 11. Determination of the optimal amount of internal standard E-cadherin cDNA to be added to the Q C - P C R reaction mixtures. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cell cultures and decreasing amounts of competitive E-cadherin cDNA. A representative ethidium bromide-stained gel containing the resultant PCR products is presented (upper panel). The sizes of the resultant target (560bp) and internal standard (305bp) PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrographs. The gels were analyzed by UV densitometry and the volume counts obtained for both PCR products were plotted in the line graph (lower panel). The point of interception of the two lines indicates the optimal amount (7.8xl0"3pg/ul) of competitive cDNA to be added to each QC-PCR reaction mixture. 55 Figure 12. Time-dependent inhibition of E-cadherin mRNA transcript expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 12, 24, or 48 h. B . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 12, 24, or 48 h. The sizes of the resultant target (560bp) and internal standard (305bp) PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrographs. C . The absorbance ratios of the target QC-PCR product versus that of the internal standard were calculated from three independent studies and were represented in the bar graphs (mean ± SEM, n=3; *p< 0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 56 560bp 305bp M 0 12 24 48 560bp 305bp 57 E-cadherin protein expression was examined in BeWo cells treated with 1.5mM cAMP as above. Western blot analysis of protein extracts prepared from the cells was carried out using a mouse monoclonal antibody directed against E-cadherin. This revealed the presence of a single E-cadherin (120 kDa) protein species in all of the cellular extracts (Figure. 13A and B). No significant change in E-cadherin protein expression was detected in cells cultured for up to 72h in the absence of cAMP (Figure. 13A and C). E-cadherin protein levels decreased over time in culture in the presence of cAMP, with a significant 20% reduction observed at 48h (Figure. 13B and C). There was a pronounced decrease of E-cadherin protein levels at 72h of culture as the cells continued to fuse and become multinucleated (Figure. 13B and C). At this time-point, the protein levels of E-cadherin were halved when compared to that of Oh control. The cAMP-induced inhibition of E-cadherin expression was thus observed at both the transcript and protein levels, although protein expression declined more slowly and to a lesser extent than did transcript level. This may reflect differences in the half-life/turnover of E-cadherin protein and mRNA. The effect of cAMP on E-cadherin expression was also investigated by immunohistochemical staining of BeWo cell cultures. Intense immunostaining for E -cadherin expression was detected in mononucleate BeWo cells cultured in the absence of cAMP (Figure. 14A). In particular, E-cadherin was localized to areas of cell-cell contact in these trophoblastic cells (Figure. 14A, arrows). After 72h culture in the presence of cAMP, E-cadherin immunostaining was not detectable on the surface of the multinucleated syncytium (Figure. 14B, area in dotted square) and was only detected in areas of unfused BeWo cell-cell contacts (Figure. 14B, arrows). Although E-cadherin 58 immunostaining was still detectable after 72h culture, the overall colour intensity of the E-cadherin staining was significantly reduced compared to that of control cells that were cultured for 72h without 1.5mM 8-bromo-cAMP. Cells immunostained with a nonspecific isotype-matched polyclonal antibody provided a negative control (Figure. 14C). 59 Figure 13. Time-dependent inhibition of E-cadherin protein expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Protein lysates were prepared from BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 24, 48, and 72h. Each lysate (10 \xg protein) was probed for E-cadherin using anti-E-cadherin monoclonal antibody. B . As in A, except protein lysates were prepared from BeWo cells cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 24, 48, and 72 h. C . The autoradiograms were then scanned using a laser densitometer. The results derived from this analysis, as well as from two other studies for both control and 8-bromo-cAMP treatment were represented (mean ±SEM; n=3) in the bar graphs (*p<0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 60 A 61 Figure 14. Immunolocalization of E-cadherin in BeWo cell cultures. A. BeWo cells were stained for E-cadherin after 72h culture in the absence of 8-bromo-cAMP. Arrows represent areas of cell-cell contact. B. BeWo cells were stained for E-cadherin after 72h culture in the presence of 1.5mM 8-bromo-cAMP. The dotted square represents multinucleated syncytium and the arrows depict staining of unfused BeWo cells. Immunostaining utilized a monoclonal anti-E-cadherin antibody. C . Negative control in which the primary antiserum was replaced with a non-specific isotype-matched monoclonal antibody. 62 4.2 Time-dependent effects of 8-bromo-cAMP on Snail m R N A and protein levels in human BeWo choriocarcinoma cells Cloning and characterization of the human E-cadherin promoter has revealed that two E-boxes present in a proximal fragment of the promoter match the DNA-binding site of Snail (Mauhin et al, 1993; Battle et al, 2000). Snail is known to regulate the expression of E-cadherin in several developmental processes in different species, from fly to human. Drosophila Snail mutant embryos die at the gastrulation stages and show a gastrulation-defective phenotype that has been associated with impaired downregulation of E-cadherin (Oda et al, 1998). In light of these observations, Snail and related proteins could be the fundamental regulators of the E-cadherin-mediated trophoblast differentiation and fusion process. Therefore the expression profiles of Snail and of its other family member Slug were investigated during cAMP-induced differentiation and fusion of human trophoblastic cells. As described for E-cadherin-specific QC-PCR (Results section 4.1), the optimum amount of internal standard Snail cDNA to be used in the QC-PCR analysis was determined. Serial dilutions of the internal standard cDNA for Snail were coamplified in the presence of a fixed amount of target cDNA. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cells with known decreasing amounts of competitive Snail cDNA (Figure. 15). The point of interception of the lines depicting amplified product of internal standard cDNA or target cDNA indicated the optimal amount of internal standard cDNA that should be added to the subsequent QC-PCR reactions. Hence, 0.125 pg/ul of Snail cDNA was added to each QC-PCR reaction (Figure. 15). 63 The time-dependent effect of a fixed concentration of cAMP on Snail transcript expression was investigated. The Snail mRNA transcript was present in all of the total RNA extracts prepared from the BeWo cell cultures. QC-PCR detected a minor increase in Snail mRNA level in cells culture over time in the absence of 8-bromo-cAMP (Figure. 16A and C), indicating that Snail was slightly upregulated during normal cell growth. QC-PCR detected a significant and continuous increase in Snail mRNA level in these trophoblastic cells with increasing time in culture in the presence of 1.5mM cAMP (Figure. 16B and C). There was about a 6-fold increase of this mRNA transcript at 24h of culture in the presence of 8-bromo-cAMP when compared to the Oh control (Figure. 16C). The levels of Snail mRNA transcript continued to increase with time in culture and an approximate 9-fold increase in transcript level (compared to Oh of culture) was apparent after 48h of culture in the presence of 1.5mM 8-bromo cAMP (Figure. 16C). 64 Figure 15. Determination of the optimal amount of internal standard Snail cDNAs to be added to the Q C - P C R reaction mixtures. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cell cultures and decreasing amounts of competitive Snail cDNA. A representative ethidium bromide-stained gel containing the resultant PCR products is presented (upper panel). The sizes of the resultant target (552bp) and internal standard (351bp) PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrographs. The gels were analyzed by U V densitometry and the volume counts obtained for both PCR products were plotted in the line graph (lower panel). The point of interception of the two lines indicates the optimal amount (0.125 pg/ul) of competitive cDNA to be added to each QC-PCR reaction mixture. 65 Figure 16. Time-dependent induction of Snail m R N A transcript expression in BeWo choriocarcinoma cells by 8-bromo-cAMP. A . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 12, 24, or 48 h. B . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 12, 24, or 48 h. The sizes of the resultant target (552bp) and internal standard (351bp) PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrographs. C . The absorbance ratios of the resultant target QC-PCR product versus that of the internal standard were calculated from three independent studies and were represented in the bar graphs (mean ± SEM, n=3; *p< 0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 66 552bp 351bp 552bp 351bp 3.5 2 1.5 -1 * X i i 12 24 48 Time in culture (h) I control • treated with 8-bromo-cAMP 67 Snail protein expression was examined in BeWo cells treated with 1.5mM cAMP as above. Western blot analysis of protein extracts prepared from the cells was carried out using a rabbit polyclonal antibody directed against human Snail. This revealed the presence of a major Snail (29 kDa) protein species after 24h and 48h of culture (Figure. 17B). There was no detectable Snail protein expression in the Oh and 12h control cultures (Figure. 17A) or in Oh and 12h 8-bromo-cAMP-treated cells (Figure. 17B). In accord with the increase in Snail mRNA level that was detected in cells cultured for 24h and 48h in the absence of cAMP (Figure. 17A and C), the protein expression of Snail was also slightly increased upon 24h and 48h of culture without 8-bromo-cAMP (Figure. 17A). When cultured in the presence of cAMP, Snail protein expression was not observed until 24h (Figure. 17B). In agreement with the QC-PCR data, the late expression levels of the Snail protein were significantly increased, with an 8-fold increase observed at 48h culture in response to 8-bromo-cAMP treatment (Figure. 17C). The effect of cAMP on Snail expression was also investigated by immunohistochemical staining of BeWo cell cultures. Snail immunostaining was barely detectable in BeWo cells cultured in the absence of 1.5mM 8-bromo-cAMP (Figure. 18A). Intense Snail immunostaining was detected in BeWo cells after treatment with 1.5mM 8-bromo-cAMP. In particular, Snail was localized to the nucleus in these trophoblastic cells after 72h culture in the presence of cAMP (Figure. 18B, arrows). Cells immunostained with a nonspecific isotype-matched polyclonal antibody provided a negative control (Figure. 18C). The immunolocalization of Snail was also examined in the villous and syncytial trophoblast layers of the first-trimester placenta. Snail expression was mainly 68 immunolocalized to syncytial trophoblasts of first-trimester chorionic villi (Figure. 19A). In particular, the expression of Snail appeared to be localized primarily to the nucleus of the syncytial trophoblasts (Figure. 19A, arrows). Snail was not found in the mesenchymal core or blood vessels of these chorionic villi. Sections immunostained with a nonspecific isotype-matched polyclonal antibody were used as a negative control (Figure. 19B). 69 Figure 17. Time-dependent induction of Snail protein expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Protein lysates were prepared from BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 24, 48, and 72h. Each lysate (40 \xg protein) was probed for Snail using anti-Snail polyclonal antibody. B . As in A, except protein lysates were prepared from BeWo cells cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 24, 48, and 72 h. C . The autoradiograms were then scanned using a laser densitometer. The results derived from this analysis, as well as from two other studies of control and 8-bromo-cAMP treatment were represented (mean ±SEM; n=3) in the bar graphs (*p<0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 70 0 24 48 72 4 29kDa 24 48 72 29kDa 2.5' S-c 2 ' <U 3 •s b * 2 1.5 •- .-a. — 1 5 H 4) * 0.5 0 24 48 Time in culture (h) I 72 I control • treated with 8-bromo-cAMP 71 • gg- w- m c Figure 18. Immunolocalization of Snail in BeWo cell cultures. A. BeWo cells were stained for Snail after 72h culture in the absence of 8-bromo-cAMP. B. BeWo cells were stained for Snail after 72h culture in the presence of 1.5mM 8-bromo-cAMP. Immunostaining utilized a polyclonal anti-Snail antibody. Arrows indicate nuclear staining. C . Negative control in which the primary antiserum was replaced with a non-specific isotype-matched monoclonal antibody. 72 Figure 19. Immunolocalization of Snail in the villous and syncytial trophoblast layers of the first-trimester placenta. A. Paraffin sections of first-trimester (gestational ages 8-12 week, n=3) chorionic villi were immunostained with polyclonal antibodies directed against Snail. Arrows represent syncytial trophoblasts (ST) and cytotrophoblasts (CT). B. Sections immunostained with a non-specific isotype-matched polyclonal antibody were used as negative control. Arrows represent syncytial trophoblasts (ST) and cytotrophoblasts (CT). Immunohistochemical analysis of these placental tissues was performed on three independent occasions. 73 4.3 Time-dependent effects of 8-bromo-cAMP on Slug mRNA and protein levels The cAMP-regulated expression profile of Slug, a Snail family member, was also investigated in BeWo cells. As described above for E-cadherin QC-PCR (Results section 4.1) and Snail QC-PCR (Results section 4.2), the optimum amount of internal standard Slug cDNA to be used in QC-PCR analysis was determined. Serial dilutions of the internal standard cDNA for Slug were coamplified in the presence of a fixed amount of target cDNA. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cells with known decreasing amounts of competitive Slug cDNA. However, progressively decreasing the amount of the latter competitive cDNA did not result in concomitant increases in the PCR amplification of the BeWo cell target cDNA (Figure. 20). This indicated that the Slug mRNA transcript was expressed at a very low level (10"6pg/ul), and that even decreasing the amount of the competitive cDNA to low levels was unable to promote increased Slug cDNA amplification. Though there was no clear equivalence between the target QC-PCR product and that of the internal standard, 3.765xl0"6pg/pl of Slug cDNA was chosen as the amount of internal standard cDNA to use in subsequent QC-PCR experiments. As expected the levels of the mRNA transcript encoding Slug remained relatively low in the absence of 8-bromo-cAMP (Figure. 21A and C). Similarly, the mRNA levels of Slug remained fairly constant and low even in the presence of 1.5mM 8-bromo-cAMP, at least at the time points examined in these studies (Figure. 21B and C). Slug protein expression was examined in BeWo cells treated with 1.5mM cAMP as above. Western blot analysis of protein extracts prepared from the cells was carried out using a rabbit polyclonal antibody directed against Slug. This revealed the presence of an 74 immunoreactive band of 29 kDa in all of the cellular extracts (Figure. 22A and B). In accord with the QC-PCR analysis, the protein levels of Slug remained fairly constant and low in both control and in the presence of 8-bromo-cAMP (Figure. 22C). 75 J 30000 § 25000 1 20000 o Z 15000 I 10000 o > 5000 o . 582bp - 338bp internal standard cDNA target cDNA 241 120 60.2 30.1 15 7.53 3.77 1. 0.94 0.47 10"6pg/ul Figure 20. Determination of the optimal amount of internal standard Slug cDNAs to be added to the Q C - P C R reaction mixtures. QC-PCR was performed under optimized conditions using an aliquot (lpl) of first strand cDNA synthesized from RNA of BeWo cell cultures and decreasing amounts of competitive Slug cDNA. A representative ethidium bromide-stained gel containing the resultant PCR products is presented (upper panel). The sizes of the resultant target (582bp) and internal standard (338bp) PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrographs. The gels were analyzed by UV densitometry and the volume counts obtained for both PCR products were plotted in the line graph (lower panel). The point of interception of the two lines indicates the optimal amount 3.765x10_6pg/pl of competitive cDNA to be added to each QC-PCR reaction mixture. 76 Figure 21. Time-dependent effect of Slug m R N A transcript expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 12, 24, or 48 h. B . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 12, 24, or 48 h. The sizes of the resultant target (582bp) and internal standard (338bp) PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrographs. C . The absorbance ratios of the resultant target QC-PCR product versus that of the internal standard were calculated from three independent studies and were represented in the bar graphs (mean ± SEM, n=3). 77 582bp 338bp 582bp 338bp 78 Figure 22. Time-dependent effect of Slug protein expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Protein lysates were prepared from BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 24, 48, and 72h. Each lysate (40ug protein) was probed for Slug using anti-Slug polyclonal antibody. B . As in A, except protein lysates were prepared from BeWo cell cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 24, 48, and 72h. C . The autoradiograms were then scanned using a laser densitometer. The results derived from this analysis, as well as from two other studies of control and 8-bromo-cAMP treatment were represented (mean±SEM; n=3) in the bar graphs (*p<0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 79 80 4.4 Time-dependent effects of 8-bromo-cAMP on Twist mRNA and protein levels In both tumor metastasis and trophoblast differentiation, there is a disappearance of E-cadherin at the cell-cell junction. This allows the former cells to dissociate from one another and become invasive, and for the later cells to fuse. Recently, the transcription factor Twist, which has long been implicated in embryonic morphogenesis, was found to be a master regulator in tumor metastasis. Ectopic expression of Twist results in loss of E -cadherin-mediated cell-cell adhesion and induction of cell motility (Yang et al., 2004). It is speculated that Twist may be regulated during cadherin-mediated differentiation of the human trophoblastic cells. Therefore the expression profile of Twist was investigated during cAMP-induced differentiation and fusion of BeWo cells. As described above for E-cadherin QC-PCR (Results section 4.1) and Snail QC-PCR (Results section 4.2), the optimum amount of internal standard Twist cDNA to be used in QC-PCR analysis was determined. Serial dilutions of the internal standard cDNA for Twist were coamplified in the presence of a fixed amount of target cDNA. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cell cultures with known decreasing amounts of competitive Twist cDNA. As expected, progressively decreasing the amount of the latter competitive cDNA resulted in concomitant increases in the PCR amplification of the BeWo cell target cDNA (Figure. 23). The point of interception of the lines depicting amplified product of internal standard cDNA or target cDNA indicated the optimal amount of internal standard cDNA that should be added to the subsequent QC-PCR reactions. Hence, 1.95xl0~3pg/ul of Twist cDNA was added to the subsequent QC-PCR reactions (Figure. 23). 81 The time-dependent effect of a fixed concentration of cAMP on Twist transcript expression was investigated. QC-PCR revealed about a 2-fold increase in Twist mRNA levels in BeWo cell after 24h of culture in the presence of 1.5mM 8-bromo-cAMP (Figure. 24B and C). The levels of this mRNA continued to increase over time as the BeWo cells underwent terminal differentiation and fusion, until the termination of these studies at 48h (Figure. 24B and C). On the other hand, the mRNA level of Twist was slightly upregulated in the absence of 8-bromo-cAMP as BeWo cells continued to grow in culture (Figure. 24A). 82 Marker Figure 23. Determination of the optimal amount of internal standard Twist cDNAs to be added to the Q C - P C R reaction mixtures. QC-PCR was performed under optimized conditions using an aliquot (lul) of first strand cDNA synthesized from RNA of BeWo cell cultures and decreasing amounts of competitive Twist cDNA. A representative ethidium bromide-stained gel containing the resultant PCR products is presented (upper panel). The sizes of the resultant target (576bp) and internal standard PCR (361bp) products relative to 100-bp ladder (lane M) are marked to the right of the photomicrographs. The gels were analyzed by U V densitometry and the volume counts obtained for both PCR products were plotted in the line graph (lower panel). The point of interception of the two lines indicates the optimal amount of (1.95xl0~3pg/u.l) competitive cDNA to be added to each QC-PCR reaction mixture. 83 Figure 24. Time-dependent induction of Twist m R N A transcript expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA prepared from BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 12, 24, or 48 h. B . Representative photomicrograph of an ethidium bromide-stained gel containing QC-PCR products generated using template cDNA synthesized from RNA of BeWo cells cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 12, 24, or 48 h. The sizes of the resultant target (576bp) and internal standard (3 61 bp) PCR products relative to a 100-bp ladder (lane M) were marked to the right of the photomicrographs. C . The absorbance ratios of the resultant target QC-PCR product versus that of the internal standard were calculated from three independent studies and were represented in the bar graphs (mean ± SEM, n=3; *p< 0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 84 85 Twist protein expression was examined in BeWo cells treated with 1.5mM cAMP as above. Western blot analysis of protein extracts prepared from the cells was carried out using a rabbit polyclonal antibody directed against Twist. This revealed the presence of an immunoreactive band of 32 kDa (the expected size of Twist) in all of the cellular extracts (Figure. 25A and B). Western blot analysis revealed that 1.5mM 8-bromo-cAMP induced a 3-fold increase in the protein expression of Twist at 72h (Figure. 25C). In accord with the QC-PCR analysis, an increase in Twist protein expression was detected in the absence of 8-bromo-cAMP as the cells continued to grow but to a much lesser extent than that observed in the presence of 1.5mM 8-bromo-cAMP (Figure. 25C). 86 Figure 25. Time-dependent induction of Twist protein expression in BeWo choriocarcinoma cells by 1.5mM 8-bromo-cAMP. A . Protein lysates were prepared from BeWo cells cultured in the absence of 8-bromo-cAMP for 0, 24, 48, and 72h. Each lysate (40pg protein) was probed for Twist using anti-Twist polyclonal antibody. B . As in A, except protein lysates were prepared from BeWo cell cultured in the presence of 1.5mM 8-bromo-cAMP for 0, 24, 48, and 72h. C . The autoradiograms were then scanned using a laser densitometer. The results derived from this analysis, as well as from two other studies of control and 8-bromo-cAMP treatment were represented (mean±SEM; n=3) in the bar graphs (*p<0.05 vs. Oh control). Asterisks depict significant differences with the Oh control. 87 03 Relative protein expression (arbitrary units) oo oo o I, Q-O I o I I I P A R T V . DISCUSSION Syncytial fusion is a very rare event in cell biology and obligatory to embryonic development. In humans, there are 4 typical cell-cell fusion events that have been well studied: the fertilization of the egg by sperm (Wilson and Snell, 1998), the formation of myotubes from mononucleate myoblasts during striated muscle development (Nadal-Grinard, 1978), the differentiation of osteoclasts (Roodman, 1996;) and the formation of the syncytial trophoblast layer during human placentation (Kilman et al, 1986). All of these syncytia are highly specialized endpoints of particular differentiation pathways. Membrane fusion processes play an important role in the vesicular transport system that mediates the synthesis and trafficking of proteins (Rothman, 1996; Rothman and Wieland, 1996) and one of the prerequisites of these fusion events is to establish extensive adhesive interactions. Obviously, cell-cell fusion not only changes the cell morphology but also the physiology of these cells. For example, from an endocrine point of view, syncytical fusion of cytotrophoblasts is not just a morphological event but is associated with increased hormone secretion (Hoshina et al, 1982; Cronier et al, 1994). 5.1 Cadherin subtype switching during trophoblast terminal differentiation It is well accepted that morphogenesis and cell differentiation depend, in part, on the regulated expression of adhesion molecules. Some of these adhesion molecules have been well characterized including E-cadherin (Coutifaris et al, 1991) and Cadherin-11 (MacCalman, 1997). Previous studies have demonstrated that the expression levels of E -cadherin, in conjunction with those of its associated cytoplasmic proteins, a-, p \ y-catenin, and pl20 C T N , are down-regulated during the terminal differentiation of 89 trophoblasts in vitro and in vivo (Getsios et al., 2003). In contrast, an increase in Cadherin-11 expression is capable of promoting the formation of multinucleated syncytia in mononucleate trophoblastic cell cultures. 5.2 E-cadherin expressions during cAMP-induced differentiation of BeWo cells The results of the present study that were obtained using QC-PCR revealed a significant decline in E-cadherin mRNA levels in BeWo choriocarcinoma cells after 12h of culture in the presence of 1.5mM 8-bromo-cAMP. The levels of this mRNA transcript continued to decline until the termination of these studies at 48h. Consistent with the transcript reduction, there was a decrease in E-cadherin protein expression as the BeWo cells continued to undergo differentiation and fusion in response to 8-bromo-cAMP treatment. No significant changes in E-cadherin transcript and protein levels were detected in cells cultured for up to 72h in the absence of cAMP. Although there is strong evidence that the process of trophoblast terminal differentiation involves the down-regulation of E-cadherin, the mechanisms underlying this E-cadherin repression are still poorly understood. The regulation of E-cadherin expression occurs mainly at transcriptional levels. Recent cloning and characterization of the human E-cadherin promoter has revealed that two E-boxes present in a proximal fragment of the promoter are important for the repression of this gene (Giroldi et al., 1997). The two E-boxes characterized so far in the human and mouse E-cadherin promoters have an identical core, consisting of the sequence 5'CACCTG. This sequence exactly matches the DNA-binding site of Snail (Mauhin et al., 1993; Battle et al, 2000). 90 5.3 Potential role of the Snail/Slug family during cAMP-induced differentiation of BeWo cells The Snail/Slug family was first identified in Drosophila, where it downregulates the transcription of E-cadherin to control gastrulation. Recently, direct evidence showed that the Snail transcription factor and its family protein Slug repress E-cadherin in human epithelial tumor cell lines, including hepatocellular carcinoma (Sugumachi et al, 2003) and breast carcinoma (Hajra et al, 2002). Indeed, loss of E-cadherin expression has been shown to be responsible for the loss of intercellular adhesion occurring during invasion and metastasis (Battle et al, 2000). The results of the present study demonstrated that Snail mRNA level and protein expression were low in the BeWo choriocarcinoma cells cultured in the absence of 8-bromo-cAMP, and that Snail mRNA level and protein expression were significantly increased after adding 8-bromo-cAMP to the culture medium. Both the mRNA and protein levels continued to increase as the cells were induced to differentiate. The induction of Snail protein was observed to be slower than that of Snail transcript, however, the late expression levels of the Snail protein at 72h matched the maximal decline of E-cadherin protein levels. The coordinated expression of Snail and E-cadherin may thus be inter-related. As 8-bromo-cAMP was able to induce fusion and differentiation of the BeWo cells in conjunction with the down-regulation of E-cadherin, the results of our study suggest that the disappearance of E-cadherin from the cAMP-induced trophoblastic cell fusion was through up-regulation of Snail gene and protein expression. To our knowledge, this is the first time that this inverse relationship between Snail and E-cadherin mRNA and protein levels has been demonstrated during cAMP-91 induced trophoblast cell fusion. This observation indicates that Snail is a likely negative regulator of E-cadherin expression during trophoblast cell differentiation. Moreover, immunostaining studies revealed that Snail was localized in the nucleus after the cells were induced to fuse and differentiate. According to Dominguez et al. (2003) the activity of Snail is regulated by the phosphorylation and subcellular location. Under normal conditions Snail is phosphorylated and stays in the cytoplasm and is not able to access its target promoters. Therefore, Snail promotes its effects only when it is upregulated to levels where it cannot be totally phosphorylated and hence some Snail is retained in the nucleus and subsequently binds to the target gene. Our results demonstrate intense immunostaining of Snail in the nucleus of the cAMP-treated cells, thus it is highly likely that this Snail protein is in its functional state and able to bind to its target sequences, including those of the E-cadherin gene. Recently, Zhou et al. (2004) found that Snail contains two glycogen synthase kinase 30 (GSK3p) phosphorylation motifs. Immunocomplex kinase assays showed that GSK3P physically interacts with Snail and specifically phosphorylates it at two consensus motifs. This finding further confirms the role of phosphorylation in the regulation of Snail activity. Under normal conditions, GSK3P phosphorylates Snail in the nucleus and this directs Snail to the cytoplasm. Inhibition of the kinase activity of GSK3P by phosphorylation stabilizes Snail, and unphosphorylated Snail is retained in the nucleus. This results in the upregulation of Snail protein in the nucleus. What are the upstream pathways that regulate the activity of GSK3P, and in turn control the phosphorylation of Snail, thus regulating its subcellular localization? According to Li et al. (2000), elevation of intracellular cAMP levels in rat cerebellar granule neurons leads 92 to phosphorylation and inhibition of GSK3p\ The increased phosphorylation of GSK3P by protein kinase A (PKA) occurs at serine 9 and purified PKA is able to phosphorylate recombinant GSK3P in vitro. These findings agree with our working model that cAMP, which we used to induce BeWo cell differentiation, activates PKA and PKA in turn phosphorylates GSK3P to effect the upregulation of Snail protein in the nucleus (Figure 26). In contrast to Snail, the mRNA level and protein expression of Slug, the other member of the Snail protein family, remained relatively low and constant when BeWo cells were cultured in the absence or presence of 8-bromo-cAMP. Although Snail and Slug are members of the same protein superfamily and share a high degree of homology, there are functional differences between them. For example, Slug has been implicated in triggering E M T in the chick by repressing E-cadherin expression (Nieto et al., 1994), however, a role for Slug of repressor for E-cadherin expression has not been supported in other models. The functional differences between Snail and Slug in respect to E-cadherin regulation likely reflect their specific contributions in different cell types and different species. 5.4 Potential role of Twist in repressing E-cadherin expression In both tumor metastasis and trophoblast differentiation, there is a disappearance of E-cadherin from the cell-cell junctions. This allows the former cells to dissociate from one another and become invasive, and the latter cells to fuse. Recently, the transcription factor Twist, which has long been implicated in embryonic morphogenesis, was found to 93 Figure 26. Proposed signaling pathways that regulate the subcellular localization of Snail in BeWo cells. Under normal conditions, Snail is phosphorylated by GSK3P and transported to the cytoplasm. However, an increase in intracellular cAMP activates PKA which phosphorylates and inhibits GSK3P kinase activity, and this in turn stabilizes Snail to retain Snail in the nucleus. 94 be a key regulator in tumor metastasis (Yang et al, 2004). Ectopic expression of Twist results in loss of E-cadherin-mediated cell-cell adhesion and induction of cell motility. In human breast cancers, a high level of Twist expression correlates with invasive lobular carcinoma, a highly invasive tumor type associated with loss of E-cadherin expression (Thiery and Morgan, 2004). Our present studies demonstrate that the mRNA and protein levels of Twist were both significantly upregulated when BeWo cells were induced to fuse and differentiate in response to 8-bromo-cAMP treatment. Unlike the expression pattern of Snail in which the Snail protein was only detected in cAMP-treated cells, Twist protein was found in cells cultured in either the absence or presence of cAMP. As Twist was also slightly upregulated during normal cell culture indicating that the upregulation of Twist was not only a result of cAMP treatment. However, cAMP treatment did reinforce the induction of Twist protein during BeWo cells undergoing fusion and differentiation. As this is the first investigation of the expression profile of Twist during trophoblast cell fusion and differentiation, additional studies are required to understand the underlying mechanism(s) involved in Twist upregulation. It is also of interest to identify the transcriptional targets of Twist. A well-known target gene of Twist is E-cadherin. Interestingly, cAMP-induced increase in Twist protein expression matched the maximal decline of E-cadherin protein levels. This observation is consistent with the hypothesis that Twist is one of the modulators of the expression of E-cadherin during trophoblast fusion and differentiation. 95 5.5 Future studies Our findings suggest that Snail and Twist play critical roles in the fusion and differentiation of trophoblastic cells. These observations not only characterize molecular mechanism(s) underlying the reduced E-cadherin expression observed during trophoblast fusion and differentiation, but also provide a basis for further studies to examine the aberrant development of the placenta during pregnancy. As Snail and Twist are found to participate in trophoblast fusion and differentiation, other molecular components of their associated signaling pathways are good candidates to be examined for their possible involvement in trophoblast terminal differentiation. Since the majority of the biological functions of the human placenta are performed by the syncytial trophoblast layer, impaired trophoblastic cell fusion has been correlated with several complications of pregnancy, for example, preeclampsia and Down's syndrome. Therefore, it is of interest to examine whether aberrant expression of these two transcription factors, Snail and Twist, contributes to the development of persistent trophoblastic disease in vivo. In the future, a siRNA approach will be utilized to examine the effects of abrogated Snail and/or Twist expression on the morphological expression of E-cadherin and on the trophoblast differentiation process. As the mechanisms that regulate Snail remain elusive, future studies must aim to elucidate the signaling pathways underlying the expression and activity of Snail during cAMP-induced differentiation of BeWo choriocarcinoma cells by examining the expression profile of G S K 3 P and other possible signaling pathways, for example, Wnt signaling. 96 P A R T VI . S U M M A R Y These studies are the first to demonstrate an increase in the expression of Snail and Twist during the fusion and differentiation of human trophoblast cells. The altered expression patterns of these two transcription factors correlate with the reduced E-cadherin expression during cAMP-induced fusion and differentiation of human choriocarcinoma BeWo cells. As 8-bromo-cAMP is able to induce fusion and differentiation of the BeWo cells mediated by down-regulation of E-cadherin, the results of our study suggest that the disappearance of E-cadherin from the cAMP-induced trophoblastic cells during fusion is mediated by up-regulation of Snail and Twist. To our knowledge, this is the first time that this inverse relationship between Snail, Twist and E -cadherin mRNA and protein levels has been demonstrated during cAMP-induced trophoblast cell fusion. Collectively, these studies not only further our understanding of the cellular mechanisms that mediate the formation and organization of the human placenta but also provide useful insight into the potential roles of these embryonic transcription factors in the trophoblast differentiation process. 97 P A R T VII . R E F E R E N C E S • Adler RR, Ng A K , Rote NS (1995) Monoclonal antiphosphatidylserine antibody inhibits intercellular fusion of the choriocarcinoma line, JAR. Biology of Reproduction 53:905-910. • Alberga A, Boulay J, Kempe E, Dennefield C, Haenlin M (1991) The snail gene required for mesoderm formation in Drosophila is expressed dynamically in derivatives of all three germ layers. Development 111 :983-992. • Amemiya K, Kurachi H, Adachi H, Morishige K l , Adachi K (1994) Involvement of epidermal growth factor/ EGF receptor autocrine and paracrine mechanism in human trophoblast cells: functional differentiaion in vitro. Journal of Endocrinology 143:291-301. • Anastasiadis PZ, Reynolds A B (2000) The pi20 catenin family: complex roles in adhesion, signaling and cancer. J Cell Sci 113(pt 8): 1319-34. • Ando N, Hirahara F, Fukushima J, Kawamoto S, Okuda K, Funabashi T, Gorai I, Minaguchi H (1998) Differential gene expression of TGFp receptors during the first trimester of pregnancy at the human maternal-fetal interface. Am J Reprod Immuno 40:48-56. • Angst Bl , Marcozzi C, Magee AI (2001) The cadherin superfamily:diversity in form and function. J Cell Sci 114:629-41. • Aplin JD (1991) Implantation, trophoblast differentiation and haemochorial placentation: Mechanistic evidence in vivo and in vitro. J Cell Sci 99:681-692. • Arceci RJ, Shanahan F, Stanley ER, Pollard JW (1989) temporal expression and location of CSF-1 and its receptor in the female reproductive tract are consistent with CSF-1 regulated placental development. Proc Natl Acad Sci USA 86:8818-8822. • Athanassakis I, Bleackley RC, Paetkau V, Guilbert L, Barr PJ, Wegmann T G (1987) The immunostimulatory effect of T cell and T cell lymphokines on murine fetally derived placental cells. J Immunol 138:37-44. • Azpiazu N, Lawrence O, Vincent JP, Frasch M (1996) Segmentation and specification of the Drosophila mesoderm. Genes Dev 10: 3183-3194. 98 Bargmann W and Knoop A (1959) Electronic microscopic studies on the placental villi in man. (Remarks on the syncytium problem). Z Zellforsch mikrosk Anat 50:472-493. Bartocci A , Pollard JW, Stanley ER (1986) Regulation of colony-stimulating factor 1 during pregnancy. J Exp Med 164:956-961. Battle E (2000) The transcription factor Snail is a repressor of E-cadherin gene expression in epitheilial tumor cells. Nature Cell Biol 2:84-89. Baylies M K & Bate M (1996) Twist, a myogenic switch in Drosophila. Science 272: 1481-1484. Benirschke K and Kaufmann P (2002) Pathology of the human placenta (4th edition) New York: Springer. Black S, Kadyrov M , Kaufmann P, Ugele B, Emans N, Huppertz B (2004) Syntical fusion of human trophoblast depends on caspase 8. Cell death and differentiation 11: 90-98. Blond JL, Lavillette D, Cheyney V, Bouton O, Oriol G, Chapel-Fernandes S, Mandrand B, Mallet F and Cosset FL (2000) An envelope glycoprotein of te human endogenous retrovirus HER-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. J Virol 74: 3321-3329. Boggon TJ, Murray J, Chappuis-Flament S, Wong E, Gumbiner B M , Shapiro L (2002) C-cadherin ectodomain structure and implications for cell adhesion mechanism. Sicence 296:1308-13 Boulay JL, Dennefeld C, Alberga A (1987) The Drosophila developmental gene snail encodes a protein with nuclei acid binding fingers. Nature 330:395-8. Bourez RL, Mathijssen M , Vaandrager JM, Vermeiji-Keers C (1997) Apoptotic cell death during normal embryogenesis of the coronal suture: early detection of apotosis in mice using annexin V. J Craniofac Surg 8:441-5. Bourgeois P, Stoetzel C, Bolcato-Bellemin A L , Mttei M G , Perrin-Schmitt F (1996) The human H-twist gene is located at 7p21 and encodes a B - H L H protein that is 96 % similar to its murine M-twist counterpart. Mamm Genome 7: 915-7. 99 Boyer M , Valles A M , Edme N (2000) Induction and Regulation of Epithelial-Mesenchymal transitions. Biochem Pharma 60: 1091-1099. Butz S, Stappert J, Weissig H, Kemler R (1992) Plakoglobin and beta-catenin: distinct but closely related. Science 257:1142-44. Cano A (2000) The transcription factor snail control Epithelial-mesenchymal transitions by repression E-cadherin expression. Nature Cell Biol 2:76-83. Carl TF, Dufton S, Hanken J, Klymkowsky M W (1999) Inhibition of neural crest migration in Xenopus using antisense slug RNA. Dev Biol 213:101-115. Carpenter G, Cohen S (1979) Epidermal growth factor. Annu Rev Biochem 48:193. Cartwright JE, Holden DP, Whitley GSJ (1999) Heptocyte growth factor regulates human trophoblast motility and invasion: A role for nitric oxide. Br J Pharmacol 128: 181-189. Carver EA, Jiang R, Lan Y , Oram KF, Gridley T (2001) The mouse Snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol 21:8184-8188. Castellucci M , Kaufmann P, bischof P (1990) Extracellular matrix influences hormone and protein production by human chorionic villi. Cell Tissue Res 262:135-142. Cedard L, Alsat E, Urtasun M L , Varangot J (1970) Studies on the mode of action of luteinizing hormone and chorionic gonadotropin on estrogenic biosynthesis and glycogenolysis by human placenta perfused in vitro. Steriods 16: 361-375. Chae J, Kim MJ, Goo JH, Collier S, Gubb D (1999) The Drosophila tissue polarity gene starry night encodes a member of the protocadherin family. Development 126:5421-29. Charnock-Jones DS, Sharkey A M , Boocock C A (1994) Vascular endothelial growth factor receptor localization and activation in human trophoblast and choriocarcinoma cells. Biol Reprod 51:524-530. Cheng Y H , Aronow BJ, Hossain S, Trapnell B, Kong S, Handwerger S (2004) Critical role for transcription factor AP-2 in human trophoblast differentiation. Physio Genomics 100 Clark E, Smith SK, Licence D, Evans Al , Charnock-Jones DS (1998) Comparison of expression patterns for placenta growth factor, vascular endothelial growth factor (VEGF), VEFG-B and V E G F - C in the human placenta throughout gestation. J Endo 159:459-67. Clark SC, Kamen R (1987) The human hematopoietic colony-stimulating factors. Science 236: 1229-37. Review Coffey RJ, Sipes NJ, Bascom CC, Graves-Deal R, Pennington CY, Weissman BE, Moses H L (1988) Growth modulation of mouse keratinocytes by transforming growth factors. Cancer Res 48: 1596-1602. Cohen M E , Yin MF, Paznekas WA, Schertzer M , Wood S, Jabs EW (1998) Human SLUG gene organization, expression, an chromosome map location on 8q. Genomics 51: 468-471. Conacci-Sorrell M , Zhurinsky J, Ben-Ze'ev A (2002) The cadherin-catenin adhesion system in signaling and cancer. J Clin Invest 109:987-91. Connor J, Schroit AJ (1990) Aminophospholipid translocation in erythrocytes: evidence for the involvement of a specific transporter and an endofacial protein. Biochemistry 29:37-43. Corbo JC, Erives A, Di Gregorio A, Chang A, Levine M (1997) Dorsoventral patterning of the vertebrate neural tube is conserved in protochordate. Development 124:2335-2344. Coutifaris C, Babalola GO, Feinberg RF, Kao L C , Kliman HJ & Strauss JF III (1990) Purified human cytotrophoblast: surrogates for the blastocyt in vitro models of implantation? In Advances in Assisted Reproductive Techonology pp. 687-695. New York: Plenum Press. Coutifaris C, Kao L C , Sehdev H M , Chin U, Babalola GO, Blaschuk OW, Strauss JF III (1991) E-cadherin expression during the terminal differentiation of human trophoblasts. Development 113:767-777. Cripps R M , Olson EN (1998) Twist is required for muscle template splitting during adult Drosophila myogenesis. Dev Biol 203:106-115. 101 Crocker IP, Strachan BK, Lash GE, Cooper S, Warren A Y , Baker PN (2001) Vascular endothelial growth factor but not placental growth factor promotes trophoblast syncytialization in vitro. J Soc Gynecol Investig. 8(6):341-6. Cronier L , Bastide B, Herve JC, Deleze J, Malassine A (1994) Gap junctional communication during human trophoblast differentiation: influence of human chorionic gonadotropin. Endocrinology 135:402-408. Cronier L, Bois P, Herve JC, Malassine A (1995) Effect of human chorionic gonadotropin on chloride current in human syncytiotrophoblasts in culture. Placenta 16: 599-609. Cronier L, Herve JC, Deleze J, Malassine A (1997) Regulation of gap junctional communitcation during human trophoblast differentiation. Microsc Res Tech 38:21-28. Cross JC, Z.Werb, S.J.Fisher (1994) Implantation and the placenta: key pieces of the development puzzle. Science 266:508-151. Daiter E, Pampfer S, Yeung Y G , Barad D, Stanley ER, Pollard JW (1992) Expressionof CSF-1 in the human uterus and placenta. J Clin Endocrinol Metab 74:850-858. Daleke Dl, Lyles JV (2000) Identification and purification of aminophospholipid flippases. Biochimica et Biophysica Acta 1468:103-27. Damsky C, A.Sutherland, S.Fisher (1993) Extracellular matrix 5:Adhersive interactions in early mammalian embryogenesis, implantation and placentation. F A S E B J 7:1320-1329. Delporte F (1912) Contribution a 1 etude de la nidation d'oeul humanin et de la physiologie du trophoblaste. Brussels: Lamertin. Demers L M , Gabbe SG, Villee CA, Greep RO (1973) Human chorionic gonadotropin mediated glycogenolysis in human placenta villi. Biochem Bio-phys Acta 313: 202-210. Denker HW (1993) Implantation: A cell biological paradox. J ExpZool 266:541-558. Dominguez D, Montserrat-Sentis B, Virgos-Soler A, Guaita S, Grueso J, Porta M , Puig I, Baulida J, Franci C, Garcia de Herreros A. (2003) Phosphorylation 102 regulates the subcellular location and activity of the snail transcriptional repressor. Mol Cell Biol. Jul; 23(14):5078-89. Edelman G M (1988) Morphoregulatory molecules Biochem 27:3533-3543 El Ghouzzi V, Le Merrer M , Perrin-Schmitt F, Lajeunie E, Benit P, Reniter D, Bourgeois P, Bolcato-Bellemin A L , Munnich A, Bonaventure J (1997) Mutations of the TWIST gene in the Saethre-Chotzen syndrome. Nature Genetics 15:42-46. El Ghouzzi V, Legeai-Mallet L, Aresta S, Benoist C, Munnich A, Gunzburg J, Bonaventure J (2000) Saethre-Chotzen mutations cause Twist protein degradation or impaired nuclear location. Human Mol Genetics 9: 813-819. Enders A C (1968) Fine structure of anchoring villi of the human placenta. Am J Anat 122:419-452. Erickson GF (1997) Defining apoptosis: players and systems. J Soc Gynecol Investig 4:219-228. Fadok V A , Voelker DR, Campbell PA, Cohen JJ, Bratton DL, Henson PM (1992) Exposure of phosphatidyserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. Journal of Immunology 148:2207-2216. Florini JR, Ewton DZ (1988) Actions of transforming growth factor (3 on muscle cells. J Cell Physiol 135:301-308. Fouquet B, Zimbelmann R, Hranke WW (1992) Identification of plakoglobin in oocytes and early embryos of Xenopus laevis: maternal expression of a gene encoding a junctional plaque protein. Differentiation 51:157-194. Fox H (1970) Effect of hypoxia on trophoblast in organ culture. Am J Obstet Gynecol 107:1058-1064. Frendo JL, Olivier D, Cheynet V, Blond JL, Bouton O, Vidaud M , Rabreau M , Evain-Brion d, Mallet F (2003) Direct involvement of HERV-W Env Glycoprotein in human trophoblast cell fusion and differentiation. Mol Cell Biol 23: 3566-3574. Frenz DA, Van de Water TR (1990) TGFpl modulation of chondrogenic differentiation by cultured periotic mesenchymal cells. Ann N Y Sci 593:341-342. 103 Gadella B M , Harrison RAP (2000) The capacitating agent bicarbonate induces protein kinase A- dependent changes in phospholipid transbilayer behavior in the sperm plasma membrane. Development 127:2407-20. Garcia-Lloret MJ, Morrish DW, Wegmann T G , Turner R, Guilbert LJ (1994) Demonstration of functional cytokine-placental interactions: CSF-1 and GM-CSF stimulate human cytotrophoblast differentiaion and peptide hormone secetion. Exp Cell Res 214:46-54. Genti-Ramondi S, Patrito L C , Nootny E, Flury A (1981) Effect in vitro of high dose of hCG on progesterone synthesis from pregnenolone in human placenta. Cell Mol Biol 27: 573-577. Getsios S, Chen GTC, MacCalman CD (2001) a-, p-, y-catenin and p l20 C T N expression during the terminal differentiation and fusion of human mononucleate cytotrophoblast in vitro and in vivo. Mol Reprod Dev 59:168-177. Getsios S, Chen GTC, MacCalman CD (2000) Regulation of p-catenin mRNA and protein levels in human villous cytotrophoblasts undergoing aggregation and fusion in vitro: correlation with E-cadherin expression. J Reprod Fert 119:59-68. Getsios S, MacCalman CD (2003) Cadherin-11 modulates the terminal differentiation and fusion of human trophoblastic cells in vitro. Dev Biol 257:41-54. Geyer H, Geyer R, Odenthal-Schnittler M , Schnittler HJ (1999) Characterization of human vascular endothelial cadherin glycans. Glycobiology 9(9) 915-25. Giroldi L A (1997) Role of E boxes in the repression of E-cadherin expression. Biochem. Biophys Res Commun 241:453-458. Gottardi JC, Wong E, Gumbiner B M (2001) E-cadherin suppresses cellular transformation by inhibiting beta-catenin signaling in an adhesion-independent manner. J Cell Biol 153:1049-60. Grau T, Carteret C, Simpson P (1984) Mutations and chromosomal rearragements affecting the expression Snail, a gene involved in embryonic patterning in Drosophila malanogaster. Genetics 108:347-360. 104 Grau Y , Carteret C, Simpson P (1984) Mutations and chromosomal rearrangements affecting the expression of Snail, a gene involved in embryonic patterning in Drosophila melanogaster. Genetics 108:347-360. Grimes HL, Chan TO, Zweidler-McKay PA, Tong B, Tsichlis PN (1996) The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits GI arrest induced by interleukin-2 withdrawal. Mol Cell Biol 16:6263-6272. Gutkind (2000) Regulation of mitogenOactivated protein kinase signaling networkds by G-protein-coupled-receptors. Science's STKE 40:RE1. Ignotz RA, Massague J (1985) Type P transforming growth factor controls the adipogenic differentiation of 3T3 fibroblasts. Proc Natl Acad Sci USA 82:8260-8210. Hajra K M , Chen DY, Fearon ER (2002) The SLUG zinc -finger protein repress E-cadherin in breast cancer. Cancer Res 62:1613-1618. Hammer A, Blascitz A, Daxbock C, Walcher W, Dohr G (1998) Fas and Fas-ligand are expressed in the utero-placental units of first trimester pregnancy. Am J Reprod Immunl. Harmen I, Costello A, Sane A, Handwerger S (1987) Cyclic adenosine-3',-5'monophosphate stimulates the acute release of placental lactogen from human trophoblast cells. Endocrinology 121:59-63. Harris J. (1998) Placental endogenous retrovirus (ERV): structural, functional, and evolutionary significance. Bioessays 20: 307-316. Hatta K, Nose A, Nagafuchi A, Takeichi (1988) Cloning and expression of cDNA encoding a neural calcium-dependent cell adhesion molecules: its identity in the cadherin gene family. 106 (3):573-81. Hay ED (1995) An overview of epithelio-mesenchymal transformation. Acta Anat 154: 8-20. Hemavathy K, Guru SC, Harris J, Chen JD, Ip Y T (2000) Human slug is a repressor that localized to site of active transcription. Mol Cell Biol 20:5087-5095. 105 Hemavathy K, Ashraf SI, Ip Y T (2004) Snail/slug family of repressors: slowly going into the fast lane of development and cancer. Gene 17;257(1):1-12. Hertig AT, J. Rock, J. Adams (1956) A description of 34 human ova within the first 17 days of development. Am J Anat 98:325-494. Hoshina M , Boothby M & Boime I (1982) Cytological localization of chorionic gonadotropin alpha and placental lactogen mRNAs during development of the human placenta. J Cell Biol 93, 190-198. Hoshina M , Boothby R, Hussam R. Pattillo, H.M. Camel, L. Boime (1983) Linkage of human chorionc gonadotrophin and placental lactogen biosynthesis to torphoblast differentiation and tumorigenesis. Placenta 6: 163-172. Howe A, Aplin A E , Alahari SK, Juliano RL (1998) Integrin signaling and cell growth control. Curr Opin Cell Biol 10:220-231. Huber O, Biskamp C, Kemler R (1996) Cadherins and catenins in development. Curr Opin Cell Biol 8:685-691. Huppertz B, Frank HG, Reister F, Kingdom J, Korr & Kaufinann P (1998) Villous cytotrophoblast regulation of the syncytial apoptotic cascade in the human placenta. Histichem Cell Biol 110:495-508. Huppertz B, Tews DS &Kaufmann P (2001) Apoptosis and syncytial fusion in human placental trophoblast and skeletal muscle. Int Rev Cytol 205: 531-539. Hynes RO (1996) Targeted mutations in cell adhersion genes: what have we learned from them. Dev Biol 180:402-412. Inukai T, Inoue A, Kurosawa H, Goi K, Shinjyo T, Ozawa K, Mao M , Inaba T, Look A T (1999) Slug, a ces-I related zinc finger trancription factor gene wth antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Mol Cell 4:343-352. Isaac A, Sargent M G , Cooke J (1997) Control of vertebrate left-right asymmetry by a Snail-related zinc finger gene. Science 175:1301-1304. Ishihara N, Matsuo H, Murakoshi H, Laoag-Fernandez JB, Samoto T, Maruo T (2002) Increased apoptosis in the syncytiotrophoblast in human term placentas complicated by either preeclampsia or intrauterine growth retardation. Am J Obstet Gynecol. 186(1): 158-66. 106 Johansen M , Redman CW, Wilkins T & Sargent IL (1999) Trophoblast deportation in human pregnancy-its relevance for pre-eclampsia. Placenta 20:531-539. Johnson KR, Lewis JE, Li D, wahl J, Soler AP (1993) P- and E-cadherin are in separate complexes in cells expressing both cadherins. Exp Cell Res 207:252-260. Jou TS, Stewart BD, Stappert J, Nelson WJ, Marrs JA (1995) Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc. Natl. Acad. Sci. USA 92:5067-5071. Kagan V E , Fabisiak JP, Shvedova A A , Tyurina Y Y , Tyurin V A , Schor NF, Kawai K (2000) Oxidative signaling pathway for externalization of plasma membrane phosphatidylserine during apoptosis. FEBS Lett. 14;477(l-2):l-7. Kataoka H (2000) A novel SnazV-related transcription factor Smuc regulates basic helix-loop-helix transcription factor activities via specific E-boxes. Nucleic Acids Res 28:626-633. Kato Y &Braunstein GD (1989) Discordany secretion of placental protein hormones in differentiating trophoblasts in vitro. Journal of clinical Endocrinology and Metabolism 70: 1187-1192. Katsuragawa H, Rote NS, Inoue T, Narukawa S, Kanzaki H, Mori T (1995) Mnoclonal antiphosphatidylserine antibody reactivity against human first-trimester placental trophoblasts. American Journal of Obstetrics and Gynecology 172:1592-7. Kauma SW, Aukerman SL, Eierman D, Turner T (1991) CSF-1 and c-frns expression in human endometrial tissues and placental during the menstrual cycle and early pregnancy. J Clin Endocrinol Metab. 73:746-751. Kerr JF, Gobe GC, Winterford C M Harmon BV (1995) Anatomical methods in cell death. Methods Cell Biol 46:1-27. Keryer G, Alsat E, Tasken K, Evain-Brion D (1998) Cyclic AMP -dependent protein kinases and human trophoblast cell differentiation in vitro. J Cell Sci 111:995-1004. 107 Knudsen K A , Frankowski C, Johnson KR, Wheelock MJ (1998) A role for cadherins in cellular signaling and differentiation. J Cell Biochem Suppl. 30-31:168-176. Knuden K A , Wheelock MJ (1992) Plakoglobin, or an 83-kD homologue distinct from beta-catenin, interacts with E-cadherin and N-cadherin. J Cell Biol. 118:671-679. Koch AW, Bozic D, Pertz O, Engel J (1999) Homophilic adhesion by cadherins. Curr. Opin. Struc. Biol. 9:275-81. Konfler M , Saleh L, Bauer S, Vasicek R, Griesinger G, Strohmer H (2000) Promoter elements and transcription factors involved in differentiation-dependent human chorionic gonadotrophin-alpha messenger ribonucleic acid expression of term villous trophoblast. Endocrinology 141:3737-3748. Konfler M , Vasicek R, & Schreiber M (2001) Key regulatory transcription factors involved in placental trophoblast development. Placenta 22(supplA) 83-92. Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen R M , Pals ST, van Oers M H (1994) Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergong apoptosis. Blood 84: 1415-20. Ladines-Llave CA, Maruo T, Manalo As, Mochizuki M (1991) Cytologic localization of epidermal growth factor and its receptor in developing human placenta varies over the course of pregnancy. Am J Obstet. Gynecol. 165:1377-82. Larue L, Antos C, Butz S, Huber O, Delmas V, Dominis M , Kemler R (1996) A role for cadherins in tissue formation. Development 122:3185-3194. Larue L, Ohsugi M , Hirchenhain J, Kemler R (1994) E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc. Natl. Acad. Sci. USA 91:8263-67. Lash GE, Cartwright JE, Whitley GS, Trew AJ, Baker PN (1999) The effects of angiogenic growth factors on extravillous trophoblast invasion and motility. Placenta 20:661-667. 108 Lee MS, Lowe GN, Strong DD, Wergedal JE, Glackin C A (1999) Twist, a basic helix-loop-helix transcription factor can regulate the human osteogenic lineage. J Cell Biochem 75:566-577. Lee X, Keith Jr JC, Stumm N, Moutastsos I, McCoy JM, Crum CP, Genest D, Chin D, Ehrenfeis C, pijnenborg R, Van Assche FA, Mi S (2001) Downregulation of placental Syncytin expression and abnormal protein localization in Pre-eclampsia. Placenta 22: 808-812. Leptin M (1991) Twist and Snail as positive and negative regulators during Drosophila mesoderm development. Genes Dev. 5:1568-1576. Leptin M (1991) Twist and Snail as positive and negative regulators during Drosophila mesoderm development. Genes Dev 5:1568-1576. Li M , Wang X, Meintzer M K , Laessig T, Birnbaum MJ, Heidenreich K A (2000) Cyclic AMP promotes neuronal survival by phosphorylation of glycogen synthase kinase 3beta. Mol Cell Biol. 20(24): 9356-63. Lin L, Xu B &Rote NS (1999) Expression of endogenous retrovirus ERV-3 induces differentiation n BeWo, a choriocarcinoma model of human placental trophoblast. Placenta 20:09-119. Lobo JO & Bellino FL (1989) Oestrogen synthetase (Aromatase) and hormone secretion in primary cultures of human placenta trophoblast cells. Effects of cyclic AMP addition at the start of culture in attached and unattached cell populations. Placenta 10:377-385. Lohmann SM, Walter U (1984) Regulation of the cellular and subcellular and disribution of nucleotide-dependent protein kinases. Adv Cyclic Nuc Prot Phosph Res 18:63-102. Luo S, Yu H, Wu D, Peng C (2002) TGFpl inhibits steriodogenesis in human trophoblast cells. Mol Human Reprod 8:318-325. Lyden TW, Ng A K , Rote NS (1993) Modulation of phosphatidylserine epitope expression on BeWo cells during forskolin treatment. Placenta 14: 177-186. MacCalman CD (1997) Modulation of trophoblast differentiation using antisense oligonucleotides specific for cadherin-11. J Assist Reprod Genet (suppl) 14:61 S. 109 MaCcalman CD, Furth EE, Omigbodun A, Kozarsky KF, Coutifaris C, Strauss III JF (1996) Tranduction of human trophoblast cells by recombinant adenoviruses is differentiation dependent. Biol of Reprod 54:682-691. Maestro R, Dei Tos AP, Hamamori Y, Krasnokutsky S, Sartorelli V , Kedes L , Doglioni C, Beach DH, Harmon GJ (1999) Twist is a potential oncogene that inhibits apoptosis. Genes & Dev. 13:2207-2217. Magoffin DA, Gancedo M , Erickson GF (1989) Transforming growth factor P promotes differentiation of ovarian thecal -intertitial cells but inhibits androgen production. Endocrinology 125:1951-1958. Mansbridge JN, Hanawalt PC (1988) Role of transforming growth factor p in the maturation of human epidermal keratinocytes. J Invest Dematol 90:336-341. Marzioni D, Muhlhauser J, Vrescimanno C, Banita M , Pierleoni C & Castellucci M (1998) Bcl-2 expression in the human placenta and its correlation with fibrin deposits. Human Reprod 13:171-1722. Maruo T, Matsuo H, Murata K and Mochizuki M (1992) Gestational age-dependent duel action of epidermal growth factor on human placenta early in gestation. J Clin Endo. Metab 75:1362-1367. Maruo T and Mochizuki M (1987) Immunohistichemical localization of epidermal growth factor receptor and myc oncogene product in human placenta: implication for trophoblast proliferation and differentiation. Am J Obstet Gynecol. 156:721-727. Massague J, Cheifetz S, Endo T Nadal-Ginard B (1986) Type p transforminggrowth factor is an inhibitor of myogenic differentiation. Proc Natl Acad Sci USA 83:8206-8210. Massague J 1987 The TGFP family of growth and differentiation factors. Cell 49:437-438. Massin N, Frendo JL, Guibourdenche J, Luton d, Giovangrandi Y , Muller F, Vidaud M , Evain-Brion D (2001) Defect of syncytiotrophoblast formation and human chorionic gonodotropin expression in Down's Syndrome. Placenta 22 supp A,S93-97. 110 Masui T, Wakefield L M , Lechner JF, LaVeck M A , Sporn MB, Harris C C (1986) Type p transforming growth factor is the primary differentiation-inducing serum factor for normal human bronchial epithelial cells. Proc Natl Acad Sci USA 83:2438-2442. Mauhin V , Lutz Y , Dennefeld A, Alberga A (1993) Definition of the DNA_binding site repertoire for the Drosophila transcription factor Snail. Nuclei Acids Res 21:3951-3957. McGann K A , Collman R, Kolson DL, Gonzalez-Scarano F, Coukos G, Coutifaris C, Strauss III JF, Nathanson N (1994) Human immunodeficiency virus type I causes productive infection of macrophage in primary placental cell cultures. J Infect Dis 169:746-753. McKnight S (1991) Cyclic AMP second messenger systems. Curr Opin. Cell Biol. 3,213-217. Metzstein M M & Horwitz HR (1999) The C. elegant cell death specification gene ces-1 encodes a Snail family zinc finger protein. Mol Cell 4:309-319. Mi S, Lee X, Li X, Veldman G M , Finnerty H, Racie 1, LaVallie E, Tang X Y , Edouard P,Howes S, Keith JC and McCoy JM (2000) Syncytin is a captive retrovial envelope protein involved in human placental morphogenesis. Nature 403: 785-789. Moore JJ, Baker JV, Whitsett JA (1983) cAMO-dependent protein kinase and cAMP, cGMP and calcium stimulated phosphorylation in human placenta: comparison of cytosol and membrane fractions. Trophoblast Res 1:185-196. Morrish DW, Bhardwaj D, Dabbagh L K , Maruyk H, Siy O (1987) Epidermal Growth Factor induces differentiation and secretion of human chorionic gonadotropin and placental lactogen in normal human placenta. J Clin Endo. Metab 65: 1282-1290. Morrish DW, Bhardwaj D, Paras M T (1991) Transforming growth factor pi inhibits placental differentiation and human chorionic gonadotropin and human placental lactogen secretion. Endocrinology 129: 22-26. Morrish DW, Dakour J, Li H (1998) Functional regulation of human trophoblast differentiation. J Reprod Immuno 39:179-195. I l l Nagafuchi A, Shirayoshi Y , Okazaki K, Yasuda K, Takeichi M (1987) Transformation of cell adhesion properties by exogenously introduced E-cadherin cDNA. Nature 329:341-343. Nakayama H, Scott IC, Cross JC (1998) The transition of endoreduplication in trophoblast giant cells in regulated by the mSna zinc finger transcription factor. Dev Biol 199:150-163. Nibu Y (1998) dCtBP mediates transcriptional repression by Knips, Kruppel and Snail in the Drosophila embryo. EMBO J 17:7009-7020. Nieto M A , Sargent M , Wilkinsin DG, Cooke J (1994) Control of cell behaviour during vertebrate development by Slug a zinc finger gene. Science 264:835-839. Nollet F, Kools P, van Roy F (2000) Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol 299:551-572. North RA, Whitehead R, Larkins RG (1990) Stimulation by human chorionic gonadotropin of prostaglandin synthesis by early human placenta tissue. J Clin Endocrinol Metab 73:60-70. Nose A, nagafuchi A, Takeichi M . (1988) Expressed recombinant cadherins mediate cell sorting in model systems. Cell 54:993-1001. Nose and Takeichi (1986) A novel cadherin cell adhesion molecules: its expression patterns associated with implantation and organogenesis of mouse embryo. J Cell Biol. 103:2649-58 Nusslein-Volhard C, Weichaus E, Kluding H (1984) Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. I. Zygotic loci on the second chromosome. Wilheim Roux's Arch Dev Biol 193:267-282. Oda H, Tsukita S, Takeichi M (1998) Dynamic behavior of the cadherin-based cell-cell adhesion system during Drosophila gastrulation. Dev Biol 203:435-450 Ohta M , Greenberger JS, Anklesaria P, Bassol A, Massague J (1987) Two forms of transforming growth factor P distinguished by multipotential haematopoietic progenitor cells. Nature 329:539-541. Ozawa and Kemler (1990) Correct proteolytic cleavage is required for the cell adhesive function of uromorulin. J Cell Biol. 111(4) 1645-50. 112 Ozawa M , Kemler R ( 1998) Altered cell adhesion activity by pervanadate due to the dissociation of alpha-catenin from the E-cadherin-catenin complex. J Biol Chem 273(11): 6166-70. Panigel m, Myers RE (1972) Histological and ultrastructural changes in rhesus monkey placenta following interruption of fetal placenta circulation by fetectomy or interplacental umbilical vessel ligation. Acta Anat 81:481-506. Paznekas WA, Okajima K, Schertzer M , Wood S, Jabs EW (1999) Genomic organization, expression and chromosome location of the Human SNAIL gene (SNAI1) and a related processed Pseudogene (SNAIIP). Genomics 62:42-49. Pece A, Gutkind JS (2000) Signaling from E-cadherins to the M A P K pathway by the recruitment and activation of Epidermal growth factor receptors upon cell-cell contact formation. J Biol Chem 275:41227-41233. Peinado H, Ballestar E, Esteller M , Cano A. (2004) Snail mediates E-cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1VHDAC2 complex. Mol Cell Biol. Jan; 24(1):306-19. Peng L & Payne A H (2000) AP-2 gamma and the homeodomain protein distal-less 3 are required for placental-specific expression of the murine 3 beta-hydrozysteriod dehydrogenase VI gene, Hsd3b6. J Biol Chem 277:7945-7954. Picardo-Leonard J, Voutilainen R, Kao L C , Chung B, Strauss JF III & Miller W L (1988) Human adrenodoxin: cloning of three cDNAs and cycloheximide enhancement in JEG-3 cells. Journal of Biological Chemistry 263:3240-3244. Pijnenborg R, G. Dixon, W.B. Robertsonl. Brosens (1980) Trophoblastic invasion of human deciduas from 8 to 18 weeks of pregnancy. Placenta 1:3-19. Pollard JW (1991) Lymphohematopoietic cytokines in the female reproductive tract. Curr Opin Immuno 3: 772-7. Pollard JW, Hunt JS, Wiktor-Jedrzejczak W, Stanley ER (1991) A pregnancy defect on the osteopetrotic (op/op) mouse demonstrate the requirement for CSF-1 in female fertility. Dev Biol 148:273-283. Posthaus H, Dubois C M , Laprise M H , Grondin F, Suter M M , Muller E (1998) Proprotein cleavage of E-cadherin by furin in baculovirus overexpression system: 113 potential role of other convertase in mammalian cells. FEBS Lett. 438(3):306-310. Queenan JT, Kao L C , Arboleda C E , Ulloa-Aguirre A, Golos T G , Cines DB & Strauss JF III (1987) Regulation of urokinase -type plasminogen activator production by cultured human cytotrophoblasts. Journal of Biological Chemistry 262: 10903-10906. Redman CW & sergeant IL (2000) Placental debris, oxidative stress and pre-eclampsia. Placenta 21:597-602. Regenstreif LJ, Rossant J (1989) Expression of the c-frns proto-oncogene and of the cytokine, CSF-1, during mouse embryogenesis. Dev Biol 144:284-294. Renvoize C, Roger R, Moulian N, Bertoglio J, Breard J (1997) Bcl-2 expression in tarfet cells leads to functional inhibition of caspase-3 protease family in human N K and lymphokine-activated killer cell granule-mediated apoptosis. J Immunol 159: 126-134. Reynolds A N , Daniel J, McCrea PD, Wheelock MJ, Wu J, Zhang Z (1994) Identification of a new catenin: the tyrosine kinase substrate pi20 cas associates with E-cadherin complexes. Mol Cell Biol 14:8333-42. Ri chart R (1961) Studies of placental morphogenesis. 1 Radioautographic studies of human placenta utilizing nitrated thymidine. Proc Soc exp Biol Med 106:829-831. Richardson BD, Cheng Y H , Langland RA, Handwerger S (2001) Differential expression of AP-2 gamma and AP-2 alpha during human trophoblast differentiation. Life Sci 69:2157-2165. Richardson BD, Landland RA, Bachurski CJ, Richards RG, Kessler CA, Cheng Y H , Handwerger S (2000) Activator protein -2 regulated human placental lactogen gene expression. Mol Cell Endo 160:183-192. Riechmann V, Irion U, Wilson R, Grosskortenhaus R, Leptin M (1997) Control of cell fates and segmentation in the Drosophila mesoderm. Development 124:2915-2922. 114 Riethmacher D, Brinkmann V, Birchmeier C. (1995) A targetd mutation in the moue E-cadherin gene results in defective preimplantation development. Proc Natl.Acad. Sci USA 92:855-59. Ringler GE, Coutifaris C, Strauss JF 3rd, Allen Jl, Geier M (1989) Accumulation of CSF-1 in amniotic fluid during human pregnancy. Am J Obstet Gynecol 160:655-656. Ringler GE, Kao L C , Miller WL, Strauss JF III (1989) Effects of 8-bromo-cAMP on expression of endocrine functions by cultured human trophoblast ells. Regulation of specific mRNAs. Mol Cell Endo 61:13-21. Ringwald M , Schuh R, Vestweber D, Eistetter H, Lottseich F, Engel J, Dolz R, Jahnig F, Epplen J, Mayer S (1987) The structure of cell adhesion molecule uvomorulin. Insight into the molecular mechanism of calcium dependent cell adhesion. EMBO J 6(12) 3647-53. Ritvos O & Voutilainen R (1992) Regulation o aromatase cytochrom P-450 and 17p-hydroxysteriod dehydrogenase messenger ribonucleic acids levels in choriocarcinoma cells. Endocrinology 130: 61-67. Rosivatz E, Becker I, Specht K, Fricke E, Luber , Busch R, Hofler H, Becker KF (2002) Differential expression of the epithelial-mesenchymal transition regulators snail,SIP 1, and twist in gastric cancer. Am J Pathol 161:1881-91. Rote NS, Chang J, Katsuragawa H, Ng A K , Lyden TW, Mori T (1995) Expression of phosphatidyserine-dependent antigens on the surface of differentiating BeWo human choriocarcinoma cells. Americal Jouranl of Reproductive Immunology 33:114-121. Rubin CS (1994) A kinase anchor proteins and the intracellular targeting of signals carried by cyclic AMP. Biochim Biophys Acta 1224:467-479. Sakuragi N, Matsuo H, Coukos G, Furth EE, Bronner MP, VanArsdale C M , Krajewsky S, Reed JC & Strauss III JF (1994) Differentiation-dependet expression of the BCL-2 proto-oncogene in the human trophoblast lineage. J sco Gynecol Invest 1:164-172. 115 Sessions A, Horowitz AF (1983) Differentiation related differences in the plasma membrane phospholipid asymmetry of myogenic and fibrogenic cells. Biochimica et Biophysica Acta 728:103-11. Sessions A, Horowitz A F (1981) Myoblast aminophospholipid asymmetry differs from that of fibroblast. FEBS Letters 134:75-78. Seger R, Krebs E G (1995) The M A P K signaling cascade. FASEB J 9:726-735. Shi QJ, Lei Z M , Rao Chv, Lin J (1993) Novel role of human chorionic gonadotropin in differentiation of human cytotrophoblasts. Endocrinology 132:1387-1395. Shipley GD, Pittelkow MR, Wille JJ, Scott RE, Moses H L (1986) Reversible inhibition of normal human prokeratinocyte proliferation by type p transforming growth factor-growth inhibitor in serum free medium. Cancer Res 46:2068-2071. Shiraishi S, Nakagawa K, Kinukawa N, Nakano H, Sueishi K (1996) Immunohistochemical localization of vascular endothelial growth factor in the human placenta. Placenta 17:111-121. Shore E M , Nelson WJ (1991) Biosynthesis of the cell adhesion molecules uromorulin (E-cadherin) in Madin -Darby canine kidney epithelial cells. J Biol Chem 266(29) 19672-80. Shore V H , Wang T H , Wang CL, Torry RJ, Caudle MR, Torry DS (1997) Vascular endothelial growth factor, placenta growth factor and their receptors in isolated human trophoblast. Placenta 18:657-65. Simpson P (1983) Maternal-zygotic gene interactions during formation of the dorsoventral pattern in Drosophila embryo. Genetics 105:751-761. Skinner M K , Keski-Oja, Osteen K G , Moses H L (1987) Ovanian thecal cells produce transforming growth factor p which can regulate granulosa cell growth. Endocrinology 121:786-792. Smith A, Metcalfe JA, Elgar G (2000) Identification and analysis of two snail genes in the pufferfish and mapping of human SNA to 20q. Gene 247:119-128. Sosic D, Richardson JA, Yu K, Ornitz D M , Olson E N (2003) Twist regulates cytokine gene expression through a negative feedback loop that represses NF-kB activity. Cell 112:169-180. 116 Sporn MB, Roberts AB, Wakefield L M , Assioan R K (1986) Transforming growth factor p: biological function and chemical structure. Science 233:532-534. Stappert J, Lemler R (1994) A short core region of E-cadherin is essential for catenin binding and is highly phosphorylated. Cell Adhes Commum 2:319-27. Staudinger J, Perry M , Elledge SJ, Olson EN (1993) Interactions among vertebrate helix-loop-helix proteins in yeast using the two-hybrid system. J Biol Chem 268: 460-4611. Steinberg MS, Takeichi (1994) Experimental specification of cell soring, tissue spreading, and specific spatial patterning by quantitative difference in cadherin expression. Proc. Natl. Acad. Sci. USA 91:206-209. Sugumachi K, Tanaka S, Kameyama T, Taguchi K, Aishima S, Shimada M , Tsuneyoshi M (2003) Transcriptional repressor Snail and progression of human hepatocellular carcinoma. Clin Cancer Res 9:2657-2664. Suzuki S, Sano K, Tanihara H (1991) Diversity of the cadherin family: evidence for eight new cadherins in nervous tissue. Cell Regul. 2(4) 261-70. Takeichi M (1988) The cadherins: cell-cell adhersion molecules controlling animal morphogenesis. Development 102:639-655. Takeichi M (1990) Caherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biocehm 59:237-252. Tasken K, Solberg R, Foss KB, Skalhegg BS, Hansson V and Jahnsen T (1995) cAMP -dependent protein kinase (vertebrates). In the protein kinase: Protein-serine kinases, pp 58-63. Academic Press. London. Taylor SS, Buechler JA, Yonemoto W (1990) cAMP-dependent protein kinase: Framework for a diverse family of regulatory enzymes. Ann Rev Biochem 59:971-1005. Thiery JP and Morgan M (2004) Breast cancer progression with a Twist. Nature Medicine 10:777-778. Thisse B, Stoetzel C, Gorostiza-Thisse C, Perrin-Schmitt F (1988) Seuence of The twist gene and nuclear localization of its protein in endomesodermal cells of early Drosophila embryos. E M B O J 7:2175-2183. 117 Thisse C, Perrin-Schmitt F, Stoetzel C Thisse (1991) Sequence-specific transactivation of the Drosophila twist gene by the dorsal gene product. Cell 65:1191-1201. Tremblay Y , Rinler GE, Morel Y , Mohandas TK, Labrie F, Strauss JF III & Miller W L (1989) Regulation of the gene for estrogenic 17-ketosteriod reductase lying on chromosome 17 cen -> q25. Journal of Biological Chemistry 264:20458-20462. Twigg SRF & Wilkie A O M (1999) Characterization of the human Snail (SNAI) gene and exclusion as a major disease gene in craniosynostosis. Hum. Genet 105:320-326. Watabe-Uchida M , Uchida N, Imamura Y, Nagafuchi A, Fujimoto K (1998) Alpha-catenin-vinculin interaction functions to organize the apical junctional complex in epithelial cells. J Cell Biol 142:847-57. Wice B, Menton D, Geuze H & Scwartz A L (1990) Modulators of cyclic AMP metablism induce syncytiotrophoblast formation in vitro. Experimental an Cellular Research 186:306-316. Yagi T, Takeichi M (2000) Cadherin superfamily genes: functions, genomic organization and neurologic diversity. Gene Dev 14:1169-1180. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA (2004) Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117:927-939. Yap As, Niessen C M , Gumbiner B M (1998) The juxtamembrane region of the cadherin cytoplasmic tail supports lateral clustering. Adhesive strengthening and interaction with pl20ctn. J Cell Biol. 141(3) 779-89. Yin Z, Xu X L , Frasch M (1997) Regulation of the twist target gene tinman by modular cis-regulatory elements during early mesoderm development. Development 124:4971-4982. Yoshida & Takeichi (1984) Teratocarcinoma cell adhesion: identification of a cell-surface protein involved in calcium-dependent cell aggregation. Cell 28:217-224. 118 Yousfi M , Lasmoles F, El Ghouzzi V, Marie PJ (2002) Twist haploinsufficiency in Saethre-Chotzen syndrome induces calcarial osteoblast apoptosis due to increase TNFalpha expression and caspase-2 activation. Human Mol Genet 11:359-369. Zhu AJ, Haase I, Watt F M (1999) Signaling via betal integrins and mitogen-activated protein kinase determines human epidermal stem cell fate in vitro. Proc. Natl. Acad. Sci. USA 96:6728-6733. Zhou BP, Deng J, Xia W, Xu J, Li Y M , Gunduz M , Hung M C (2004) Dula regulation of Snail by GSK-3 p-mediated phosphorylation in control of epithelial-mesenchymal transition. Nature Cell Biology 6: 931-939. Zhurinsky J, Shtutman M , Ben-Ze'ev A (2000) Plakoglobin and beta-catenin: protein interactions, regulation and biological roles. J Cell Sci 113 (pt. 18):3127-3129. 119 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091814/manifest

Comment

Related Items