Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Individual bull variations on sperm acrosome reaction, sperm-zona binding, in-vitro embryo production,… Giritharan, Gnanaratnam 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-994287.pdf [ 13.59MB ]
Metadata
JSON: 831-1.0091773.json
JSON-LD: 831-1.0091773-ld.json
RDF/XML (Pretty): 831-1.0091773-rdf.xml
RDF/JSON: 831-1.0091773-rdf.json
Turtle: 831-1.0091773-turtle.txt
N-Triples: 831-1.0091773-rdf-ntriples.txt
Original Record: 831-1.0091773-source.json
Full Text
831-1.0091773-fulltext.txt
Citation
831-1.0091773.ris

Full Text

INDIVIDUAL B U L L VARIATIONS ON SPERM A C R O S O M E REACTION, SPERM-ZONA BINDING, IN-VITRO E M B R Y O PRODUCTION, A N D PREIMPLANTATION E M B R Y O APOPTOSIS A N D GENE EXPRESSION by G N A N A R A T N A M GIRITHARAN B . V . S c , The University of Peradeniya, Peradeniya, Srilanka, 1993 M . S c , The University of British Columbia, 2000 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Animal Science) THE UNIVERSITY OF BRITISH C O L U M B I A December 2004 © Gnanaratnam Giritharan, 2004 ABSTRACT The overall objective of this study was to develop in-vitro tests to predict fertility of bulls in the field. The specific objectives were to investigate 1) the bull effect on sperm acrosome reaction, sperm-zona binding and in vitro embryo production (experiment 1), 2) the effect of sperm pre-incubation time and sperm concentration of bulls on in-vitro fertilization (experiment 2), 3) the bull effect on apoptosis and expression of Bcl-2, Bax, p53, interferon tau and heat shock protein-70 genes in bovine preimplantation embryos produced in-vitro (experiment 3), and 4) the correlation between the above in-vitro tests and the field fertility data. In the first experiment, pre-freeze motility, acrosome reaction at 0 h, increase in acrosome reaction at 4 h and sperm-zona binding were different (p<0.05) among bulls. Significant correlations were observed between individual sperm parameters. None of the in-vitro tests was correlated with non-return rates (field fertility data). In the second experiment, significant bull effects were observed on fertilization, when using short and long sperm pre-incubation time with normal and high sperm:oocyte ratio. When using normal sperm:oocyte ratio (25,000:1), the percent difference in normally fertilized zygotes between short and long sperm pre-incubation times showed high degree of correlation with non-return rates (r = 0.90; p<0.05) of the experimental bulls. In the third experiment, significant bull effects (P<0.01) were observed on cleavage and morula to blastocyst development rates; percentage of apoptotic, live and dead cells; and expression levels of heat shock protein 70 and interferon tau genes in morula to blastocyst stage embryos. The expression levels of Bax, Bcl-2 and p53 genes in morula to blastocyst stage embryos were not different among bulls. The field fertility measured by 60-90 day non-return rate was i i highly correlated with relative abundance of Bcl-2 mRNA transcripts (r = -0.93) and the ratio of Bax to Bcl-2 gene expression (r = 0.84). The findings of this study conclude that variations exist among individual bulls in sperm acrosome reaction, sperm-zona binding and in-vitro embryo production, apoptosis, and interferon tau and heat shock protein 70 gene expression. Combinations of some of these sperm parameters may be potentially useful for the accurate prediction of bull fertility in the field. i i i TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF FIGURES vii LIST OF PLATES : ix LIST OF TABLES , x ABBREVIATIONS xi FOREWORD xiii ACKNOWLEDGEMENTS xiv DEDICATION 1 CHAPTER 1 - GENERAL INTRODUCTION 2 CHAPTER 2 - BACKGROUND 5 2.1. M O R P H O L O G Y OF SPERMATOZOA 5 2.2. CAPACITATION OF SPERMATOZOA 8 2.3. S P E R M - Z O N A BINDING 13 2.4. A C R O S O M E REACTION OF SPERMATOZOA 16 2.5. FERTILIZATION 18 2.5.1. Polyspermy 21 2.6. E A R L Y E M B R Y O N I C DEVELOPMENT 22 2.7. APOPTOSIS IN THE PREDVIPLANTATION E M B R Y O 25 2.8. BAX, BCL-2 AND P53 30 2.9. INTERFERON T A U (IFNx) 35 2.10. H E A T SHOCK PROTEIN-70 36 2.11. METHODS DEVELOPED TO PREDICT B U L L FERTILITY 38 2.11.1. Motility, Morphology and Viability 38 2.11.2. Biochemical Parameters 40 2.11.3. Swim-up Tests and Sperm Binding to Genital Epithelium 41 2.11.4. Sperm Capacitation and Acrosome Reaction 42 2.11.5. Sperm Zona Binding/Accessory Sperm Counts 43 2.11.6. Oocyte Penetration Assays 44 2.11.7. Correlation Between In-vitro and In-vivo Fertility 45 2.12. RATIONALE FOR THE STUDY..„ 46 2.13. HYPOTHESES 47 2.14. OBJECTIVES 47 2.15. REFERENCES 49 iv CHAPTER 3 - BULL EFFECTS ON SPERM ACROSOME REACTION, SPERM-ZONA BINDING AND IN-VITRO EMBRYO PRODUCTION 79 3.1. PREFACE 79 3.2. INTRODUCTION 80 3.3. MATERIALS A N D METHODS 82 3.3.1. In-vitro Fertilization (IVF) and Culture Assay 82 3.3.2. Sperm Acrosome Reaction (AR) Assay 84 3.3.3. Sperm Zona Binding (ZB) Assay 85 3.3.4. Field Fertility Data 86 3.3.5. Statistical Analyses -.86 3.4. RESULTS 86 3.5. DISCUSSION 88 3.6. CONCLUSION 91 3.7. REFERENCES 96 CHAPTER 4 - THE EFFECT OF SPERM PRE-INCUBATION TIME AND SPERM CONCENTRATION OF BULLS ON IN-VITRO FERTILIZATION .... 99 4.1. PREFACE 99 4.2. INTRODUCTION 101 4.3. M A T E R I A L S A N D METHODS 104 4.3.1. Experimental Design 104 4.3.2. In-vitro Fertilization 105 4.3.3. Nuclear Staining 106 4.3.4. Field Fertility Data and Other Sperm Parameters 107 4.3.5. Statistical Analyses 107 4.4. RESULTS • 107 4.4.1. In-vitro Fertilization Rates 107 4.4.2. Correlation Between Sperm Parameters 109 4.5. DISCUSSION 110 4.6. CONCLUSION 115 4.7. REFERENCES 121 CHAPTER 5 - BULL INFLUENCE ON APOPTOSIS, AND EXPRESSION OF Bcl2, Bax, P53, HEAT SHOCK PROTEIN 70 AND INTERFERON TAU GENES IN PREIMPLANTATION EMBRYOS 127 5.1. PREFACE 127 5.2. INTRODUCTION 128 5.3. M A T E R I A L S A N D METHODS 131 5.3.1. Experimental Design 131 5.3.2. In-vitro Embryo Production 132 5.3.3. Differential Embryo Staining..... 133 5.3.4. Semi-quantitative RT-PCR Procedure 134 5.3.4.1. Reverse Transcription 134 5.3.4.2. Gene Specific PCR Amplification 135 5.3.5. Field Fertility Data 137 5.3.6. Statistical Analyses 137 5.4. RESULTS 138 v 5.4.1. Validation of Semi-quantitative RT-PCR 138 5.4.2. Bull Effects on Embryo Apoptosis and Development 138 5.4.3. Bull Effects on Embryonic Gene Expression 139 5.4.4. Bull Effects on Non-return Rates 139 5.4.5. Correlation Between Bull Fertility Parameters , 139 5.5. DISCUSSION 140 5.6. CONCLUSION 145 5.7. REFERENCES 166 CHAPTER 6 - GENERAL DISCUSSION AND CONCLUSIONS 173 6.1. REFERENCES 182 VI LIST OF FIGURES FIGURE 4.1. PERCENTAGE OF ZYGOTES, AND NORMALLY FERTILIZED AND POLYSPERMIC ZYGOTES OBTAINED 14-16 H POST INSEMINATION USING 0 AND 6 H PRE-INCUBATED SPERM 118 FIGURE 4.2. PERCENTAGE OF ZYGOTES, NORMALLY FERTILIZED AND POLYSPERMIC ZYGOTES OBTAINED 14-16 H POST INSEMINATION USING SPERM TO OOCYTE RATIO OF 25000:1 AND 50000:1 119 FIGURE 5.1. CHARACTERIZATION OF SEMI-QUANTITATIVE R T - P C R FOR BCL-2 M R N A TRANSCRIPTS FROM BOVINE IN-VITRO PRODUCED EMBRYOS 148 FIGURE 5.2. CHARACTERIZATION OF SEMI-QUANTITATIVE R T - P C R FOR G 3 P D H M R N A TRANSCRIPTS FROM BOVINE IN-VITRO PRODUCED EMBRYOS 149 FIGURE 5.3. CHARACTERIZATION OF SEMI-QUANTITATIVE R T - P C R FOR HSP70 M R N A TRANSCRIPTS FROM BOVINE IN-VITRO PRODUCED EMBRYOS 150 FIGURE 5.4. CHARACTERIZATION OF SEMI-QUANTITATIVE R T - P C R FOR BAX AND G 3 P D H M R N A TRANSCRIPTS FROM BOVINE IN-VITRO PRODUCED EMBRYOS 151 FIGURE 5.5. CHARACTERIZATION OF SEMI-QUANTITATIVE R T - P C R FOR P53 AND G 3 P D H M R N A TRANSCRIPTS FROM BOVINE IN-VITRO PRODUCED EMBRYOS 152 FIGURE5.6. CHARACTERIZATION OF SEMI-QUANTITATIVE R T - P C R FOR INTERFERON TAU AND G 3 P D H M R N A TRANSCRIPTS FROM BOVINE IN-VITRO PRODUCED EMBRYOS 153 FIGURE 5.7. PERCENTAGE OF CLEAVED EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 154 FIGURE 5.8. PERCENTAGE OF MORULA TO BLASTOCYST STAGE EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS (BI-B 6 ) 168 H POST INSEMINATION 155 FIGURE 5.9. PERCENTAGE OF LIVE BLASTOMERES IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 156 FIGURE 5.10. PERCENTAGE OF APOPTOTIC BLASTOMERES IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 157 FIGURE 5.11. PERCENTAGE OF DEAD BLASTOMERES IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 158 FIGURE 5.12. RELATIVE ABUNDANCE OF BCL-2 M R N A TRANSCRIPTS IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 159 FIGURE 5.13. RELATIVE ABUNDANCE OF BAX M R N A TRANSCRIPTS IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 160 FIGURE 5.14. RELATIVE ABUNDANCE OF P53 M R N A TRANSCRIPTS IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 161 FIGURE 5.15. RELATIVE ABUNDANCE OF INTERFERON TAU M R N A TRANSCRIPTS IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 162 vii FIGURE 5.16. RELATIVE ABUNDANCE OF HSP70 M R N A TRANSCRIPTS IN MORULA TO BLASTOCYST EMBRYOS PRODUCED BY FERTILIZATION OF OOCYTES WITH SPERMATOZOA FROM SIX EXPERIMENTAL BULLS 163 FIGURE 5.17. T H E FIELD FERTILITY OF SIX EXPERIMENTAL BULLS MEASURED BY 60-90 DAY NON-RETURN RATES 164 viii L I S T O F P L A T E S PLATE 3.1. LIGHT MICROSCOPIC IMAGES OF BOVINE 2-CELL A ) , 4-CELL B), 8-CELL C), AND BLASTOCYST D) STAGE EMBRYOS 93 PLATE 3.2. FLUORESCENCE A) , AND LIGHT MICROSCOPIC B), IMAGES OF BOVINE SPERMATOZOA, AND SPERMATOZOA BOUND TO ZONA PELLUCIDA OF MATURE OOCYTES C) STAINED BY FLUORESCEIN ISOTHIOCYANATE COATED PISUM SATIVAM AGGLUTININS AND BIS-BENZAMIDE, RESPECTIVELY 94 PLATE 4.1. FLUORESCENCE MICROSCOPIC IMAGES OF BOVINE UNFERTILIZED OOCYTES, AND ZYGOTES SHOWING NORMAL AND ABNORMAL FERTILIZATION AFTER STAINING WITH BISBENZAMIDE 117 P L A T E 5.1. FLUORESCENCE MICROSCOPIC IMAGES OF BOVINE MORULA A ) & B) TO BLASTOCYST C) & D) STAGE EMBRYOS STAINED BY ANNEXIN V , PROPIDIUM IODIDE AND BIS-BENZAMIDE 147 IX L I S T O F T A B L E S T A B L E 3.1. PERCENTAGE OF MOTILE SPERM BEFORE FREEZING (PRFM), PERCENTAGE OF ACROSOME REACTED SPERM AT 0 H (AR1) AFTER THAWING, INCREASE IN THE PERCENTAGE OF ACROSOME REACTED SPERM AT 4 H INCUBATION IN CAPACITATION MEDIA (INAR), 91 T A B L E 3.2. PAIR-WISE COMPARISON OF SPERM PRE-FREEZE MOTILITY (PRFM), SPERM ACROSOME REACTION AT 0 H (AR1), INCREASE IN SPERM ACROSOME REACTION FROM 0 TO 4 H (INAR), SPERM-ZONA BINDING (ZB), 92 T A B L E 4.1. EFFECT OF SPERM PRE-INCUBATION TIME AND SPERM CONCENTRATION OF BULLS ON THE PERCENTAGE OF FERTILIZED, NORMALLY FERTILIZED AND POLYSPERMIC ZYGOTES OBTAINED 14-16 H POST INSEMINATION 115 T A B L E 4.2. PAIR-WISE COMPARISON OF PERCENTAGE OF ZYGOTES WHEN 6 H PRE-INCUBATED SPERM WAS USED IN SPERM TO OOCYTE RATIO OF 25000:1 (T2C1-ZY), PERCENTAGE OF NORMALLY FERTILIZED ZYGOTES 116 T A B L E 5.1. PRIMERS USED IN THE R T - P C R AMPLIFICATION OF SPECIFIC M R N A TRANSCRIPTS IN MORULA TO BLASTOCYST STAGE EMBRYOS 145 T A B L E 5.2. PAIR-WISE COMPARISON OF CLEAVAGE RATE (CL) , BLASTOCYST PRODUCTION RATE (BL), PERCENTAGE OF LIVE BLASTOMERES (PL), 146 X ABBREVIATIONS A l - A Bcl-2 family member, prolongs cell survival A l - Artificial insemination ATF - Apoptosis inducing factor A N O V A - Analysis of variance Apaf-1 - Apoptosis protease activating factor-1 AR1 - Percentage of acrosome reacted sperm at 0 h incubation Bak - Bcl-2 antagonist Bax - Bcl-2 associated x protein Bcl-2 - B-cell lymphoma 2 Bcl-W - A member of the Bcl-2 family that promotes cell survival B c l - X L - A long isoforms of Bcl -X that inhibits apoptosis B H - Bcl-2 homology domain Bid - BH-3 Interacting Domain Bik - Bcl-2 interacting killer Bim - A member of the Bcl-2 family that promotes apoptosis BIR - A baculovirus IAP repeat BO - Brackett and Oliphant Bok - Bcl-2 related ovarian killer Boo - Inhibits apoptosis B S A - Bovine serum albumin cAMP - Cyclic adenosine monophosphate C A R D - Caspase activation and recruitment domain Caspase - Cysteinyl aspartic acid-protease c-IAP-1 - Cellular inhibitor of apoptosis protein-1 c-IAP-2 - Cellular inhibitor of apoptosis protein-2 D A G - Diacylglycerol DED - Death effector domain DISC - Death inducing signaling complex DNTP - Deoxyribonucleic acid triphosphate DPBS - Dulbecco's phosphate buffered saline DR5 - Death receptor-5 ERK1 - Extracellular signal regulated kinase-1 ERK2 - Extracellular signal regulated kinase-2 F A D D - Fas associated death domain FITC - Fluorescein isothyocyanate G3PDH - Glyceraldehyde 3 phosphate dehydrogenase HSP70 - Heat shock protein 70 IAP - Inhibitor of apoptosis proteins ICAD - Inhibitor of caspase-activated DNAse I C M - Inner cell mass IFNx - Interferon tau InAR - Increase in percentage of acrosome reacted sperm at 4 h incubation IP3 - Inositol triphosphate xi IVF - In-vitro fertilization NAIP - Neuronal apoptosis inhibitory protein p53 - A 53 kDa tumor suppressor gene product that promotes apoptosis PAK2 - P21-activating kinase-2 PARP - Poly (ADP ribose) polymerase PIP2 - Phosphatidylinositol 4,5 biphosphate P K A - Protein kinase-A P K C - Protein kinase-C PrFM - Percentage of pre-freeze motile sperm PSA - Pisum sativum agglutinin RT-PCR - Reverse transcription polymerase chain reaction SCS - Superovulated cow serum STAT - Signal transducer and activator of transcription TRAIL - Tumor necrosis factor (TNF)-related apoptosis-inducing ligand XIAP - X-linked inhibitor of apoptosis protein ZB - Sperm-zona binding rate ZP1 - Zona pellucida glycoprotein-1 ZP2 - Zona pellucida glycoprotein-2 ZP3 - Zona pellucida glycoprotein-3 r xii FOREWORD This thesis is based on the following manuscripts and conference proceedings 1. Giritharan G, Ramakrishnappa N , Balendran A , Cheng K M , Rajamahendran R. 2004. Development of In-Vitro Tests to Predict Fertility of Bulls. Can J Anim Sci. (Accepted; Chapter 3). 2. Giritharan G, Rajamahendran R. 2001. In vitro embryo production using ovaries removed from culled cows. Can J Anim Sci. 81(4), 589-591. 3. Giritharan G, Ramakrishnappa N , Balendran A , Rajamahendran R. 2004. Bull influence on apoptosis in bovine preimplantation embryos. 37 t h Annual Meeting of the Society for the Study of Reproduction, Aug 1-4, Vancouver, British Columbia, abstr. 528. (Chapter 5). 4. Giritharan G, Aali M , Ramakrishnappa N , Balendran A , Rajamahendran R. 2004. Prediction of fertility of bulls in the field using in vitro fertilization and in vitro embryo production tests. Proc 11th Int Cong Biotech Anim Reprod, September 16-18, Rapotin, Czech Republic. (Chapters 3&5). 5. Giritharan G, Cheng K, Rajamahendran R. 2001. Prediction of fertility of young sires using in vitro tests. Biol Reprod. 64(Suppl. 1), 308. (Chapter 3). xiii ACKNOWLEDGEMENTS First, I wish to extend my deepest appreciation and gratitude to Dr. R. Rajamahendran for excellent mentorship as my thesis supervisor and for his kindness, enthusiasm, encouragement, guidance and support at every stage of this thesis. I would like to extend special thanks to my supervisory committee members, Dr. K. M. Cheng for his excellent guidance in in-depth analysis of data and suggestions during the preparation of this thesis, and Drs. Gregory Lee and David Kitts for their valuable time in critical reviewing of my thesis. I also express my gratitude to the late Dr. Shelford for his kindness, encouragement and help. I acknowledge the financial assistance from Elizabeth R Howland Fellowship, Wilson Henderson Fellowship and from my supervisor's NSERC grant. I am also most appreciative of the laboratory facilities and excellent educational opportunity provided by the Faculty of Agricultural Sciences and Department of Obstetrics and Gynecology of UBC. My deepest appreciation should go to Nagaraja Ramakrishnappa, who has been a good friend and more importantly, a good company during the years at UBC. I am highly thankful to him for his technical advices in molecular biology and exchange of many research ideas. My deepest appreciation should also go to Muhammad Aali for his encouragement and company during the years, of stay at UBC. I would also like to thank my former and present colleagues, Ming Yang, Pavneesh Madan, Mohan Mahesh, Hirad Mohamed, Anusha Balendran and Jeff Nimo for all the cooperation and help during the course of my stay in this lab. I am highly thankful to my family friends and well-wishers, especially Marcus and Sony, for their help, encouragement and company during the years of stay at UBC. I gratefully acknowledge the endless support and assistance I received from Sylvia Leung in lab related matters and timely procurement of research material. I would also like to thank the rest of the faculty and staff members for their cooperation, support and assistance during the course of my stay in the Faculty of Agricultural Sciences. I am highly thankful to my parents, sisters, brother, in-laws, other relatives and friends for their love thoughts, encouragement and prayers for the accomplishment of this task. The completion of this dissertation would not have been possible without the love, support and understanding of my wife Thiyahiny. I am grateful to my wife, and our kids Kaviny and Varun for making my life less stressful, relaxing and enjoyable. xiv DEDICATION Dedicated to My Late Father, Mother, Wife and Children In Deep Appreciation of Their Love and Understanding CHAPTER 1 - GENERAL INTRODUCTION Artificial insemination (Al) is one of the most successful reproductive technologies developed to improve reproductive efficiency of farm animals, especially dairy cattle. Accurate evaluation of the fertility of bulls used for A l purposes is of utmost importance since a single ejaculate provides multiple insemination doses and contributes much influence on the reproductive potential of a herd. It is well known that it often takes years and great expense before a young bull is proven for its fertility and genetic merit through progeny testing programs. A major portion of the expenditure goes towards maintenance cost of bulls recruited to the progeny testing program, conducting extensive field insemination trials, non-return rate data collection, and payment of incentives to voluntary farmers. Apart from these, valuable space and materials are necessary for maintaining young bulls and storing frozen semen straws obtained from all the young bulls, which are under the progeny testing program. Therefore, a significant economic advantage for the cattle industry as well as to the A l industry is achievable, i f simple laboratory tests are made available to predict fertility of young bulls recruited for progeny testing programs. Numerous laboratory methods have been developed over the years for the laboratory evaluation of semen quality and fertility. Some of these methods measured general characteristics of sperm such as viability, motility patterns, morphology, metabolism, and membrane and acrosome integrity. Despite the progress made in the laboratory evaluation of bull fertility using currently available methods, most of these methods lack the acceptable precision for accurate prediction of fertility in the field. This could possibly be due to the complex 1 nature of sperm:oocyte interaction and several unknown factors associated with the process of fertilization. The field oriented methods such as recording pregnancy data or measuring 60 day non-return rates are routinely used to evaluate the field fertility of processed semen from bulls. It has been shown that 25-35 % of the low field fertility is due to early embryonic mortality of unknown causes. In addition, it has been suggested that failure of breeding with low fertility bulls is due to fertilization failure, while that of high fertility bulls is due to embryonic death of unknown causes. One of the possible causes for fertilization failure is insemination at an inappropriate time. Although the estrus synchronization and timed insemination technique have been improved very much in the recent past, the ovulation time varies considerably with individual animals. Therefore, the successful completion of fertilization depends on the viability of sperm within the female reproductive tract until they interact with the ovum at an optimum time. Similarly, polyspermy is another contributing factor, which is believed to cause early embryonic mortality ranging from 5-10 %. Sperm concentration, oocyte quality, bull and sperm-oocyte incubation time have been shown to influence the polyspermic fertilization. Apoptosis and mitosis are the major key events regulating early embryonic development. Proteins of Bcl-2 family, which include both pro- and anti-apoptotic proteins, are involved in the regulation of apoptosis. A balanced expression of pro- and anti-apoptotic proteins is necessary for successful development and growth of the embryo. It has been shown that chromosomes in some of the morphologically normal sperm undergo aberration during the spermatogenesis and these sperm could fertilize normally. In addition, the early embryonic mortality is very high during the first two 2 weeks of development when activation of embryonic genome and maternal recognition of pregnancy take place. These finding suggest that a defect in the initiation of the expression of developmentally essential genes or the irregular expression of these genes may predispose early embryonic mortality. The question of what extent the bull is responsible for the early embryonic death due to initiation of the expression of developmentally essential genes or the irregular expression of these genes is yet to be answered. Studies on these bull related parameters might reveal new insights on accurate evaluation of bull fertility in vitro. Therefore, the objectives of the proposed study are to evaluate bull fertility based on a) in vitro sperm function tests such as sperm acrosome reaction, sperm-zona binding and in vitro fertilization; b) in vitro fertilizing ability of spermatozoa after alteration of sperm related conditions; and c) apoptosis and the expression of Bcl2, Bax, p53, interferon tau and heat shock protein-70 in in-vitro produced embryos. 3 CHAPTER 2 - BACKGROUND The sperm is a specialized reproductive cell, which has its own unique characteristics, form and function. The sperm should undergo a reversible maturational process, capacitation, during the passage through the female reproductive tract and the acrosome reaction after binding with the zona pellucida of an oocyte to complete the fertilization process. Defects of sperm either in morphology of its head and tail or in functions such as motility, capacitation, sperm-zona binding and acrosome reaction might severely affect its fertilizing potential. In addition, the newly fertilized zygote undergoes a series of developmental changes including activation of the embryonic genome and expression of developmentally essential genes. Hence, this chapter briefly reviews sperm morphology, sperm capacitation, molecules involved in the sperm zona binding, sperm acrosome reaction, fertilization and- early embryonic development. Expression of some developmentally essential genes during early embryonic development is briefly reviewed. Different laboratory tests developed over the past, based on the above sperm functions and the relationship of these tests with field fertility measured by 60-90 day non-return rate, will also be reviewed. The rationale, hypothesis and objectives of the study are presented at the end of this chapter. 2.1. MORPHOLOGY OF SPERMATOZOA The sperm can be structurally divided into head and tail (Saacke and Almquist, 1964a, 1964b). The bovine sperm is about 68-74 microns long in which the head is about 8-10 microns, the neck 0.3-1.5 microns, the mid-piece 2-4 microns, the principal-piece 45-50 microns and the end-piece 2-4 microns (Sullivan, 1978; Cummins and 4 Woodall, 1985). The head is a flattened oval shaped structure loosely enveloped by a lipid bilayered cell membrane of the entire cell. The widest portion of the head is about 4-5 microns, and at the base, it is about 1.5-1.7 microns. The thickness of the head varies across the length; 0.5 micron at the base, 0.3 micron at the middle and it tapers towards the frontal edge (Sullivan, 1978; Gravance et al., 1996). However, the sperm head dimensions may vary with staining and measuring procedures (Foote, 2003). The head of the sperm contains an acrosome cap and a large nucleus, which occupies most of the available space and is a densely packed crystalline aggregate of deoxyribonucleic acids of the chromosomes and nucleoprotein complexes called chromatin (Wilkins, 1956). The sperm acrosome is a sac-like structure surrounded by the inner and outer acrosomal membranes, which covers 60% of the anterior portion of the nucleus. A homogenous dense ground substance is present in the acrosome of a normal sperm cell. The acrosome folds back at the anterior and the lateral edges to form the apical ridge (Blom and Birch-Andersen, 1961; Sullivan, 1978). A nuclear cap covers the rest of the anterior portion and the posterior portion. The junction of anterior and posterior portions forms the nuclear ring. The mammalian sperm nuclei seem to be composed of parallel stacks of lammellar sheets oriented to the sperm's long axis and the sperm chromatin behaves as a cholesteric liquid in which D N A strands are packaged into parallel planes of linear arrays (Koheler, 1970; Plattner, 1971; Sipski and Wagner, 1977; Koheler et al., 1983; Livolant, 1983). Nodular organization of sperm chromatin has also been shown by recent studies (Allen et al., 1993; Haaf and Ward, 1995; Allen et al., 1996; Fuentes-Mascorro et a l , 2000). The sperm nucleus has a uniform thickness of 0.2-0.3 micron, is covered by a porous double membrane, and tapers towards the 5 frontal edge and is thickened at the base, where the neck is inserted into a concave recess, the implantation fossa. The inner surface of the implantation fossa is lined either partially or completely by a basal plate, which appears to be the continuation of the nuclear membrane and is made up of two membranes. There are two semicircular or triangular basal knobs present on each side of the implantation fossa between the point of attachment of the post nuclear cup and the basal plate (Saacke and Almquist, 1964a; Salisbury and van Dongen, 1964; Blom and Birch-Andersen, 1965; Bahr and Engler, 1970; Sullivan, 1978). The neck connects the head with the mid-piece of the tail. The neck is formed by two implantation plates containing large laminated fibers, which originate by merger of completely independent peripheral coarse fibers. The captulum is a common base formed by merger of two implantation plates and the anterior edge of the captulum fits into the implantation fossa (Blom and Birch-Andersen, 1960). The proximal centriole is situated in the anterior portion of the neck and within the captulum (Blom and Birch-Andersen, 1965). The tail is divided into the mid-piece, principal-piece and end-piece. The diameter of the mid-piece is about 0.64-0.85 micron, the principal-piece is about 0.5 micron and the principal piece tapers distally to 0.25 micron (Saacke and Almquist, 1964b; Salisbury and van Dongen, 1964; Bahr and Engler, 1970; Sullivan, 1978). The contractile elements for the motility of the tail are present in the centrally located longitudinally coursing axial fiber bundle. The axial fiber bundle is composed of an outer peripheral ring of nine coarse fibers, an inner ring of nine doublets of fine fibers and a pair of centrally located fibers. This arrangement of fibers is commonly described as 9+9+2 fiber pattern (Blom and Birch-Andersen, 1960; Saacke and Almquist, 1964b). 6 The mid-piece is surrounded by two layers of a single chain right handed mitochondrial helix extending from the neck to Jensen's ring, which separates mid-piece from principle piece and surrounds the axial fiber of the tail (Blom and Birch-Andersen, 1960; Saacke and Almquist, 1964b; Sullivan, 1978). The principal-piece is surrounded by a thin fibrous sheath of closely spaced circular rings. The peripheral coarse fibers in the outer ring of the axial fiber bundle become smaller as they pass posteriorly and eventually disappear at different levels of the tail (Saacke and Almquist, 1964b; Sullivan, 1978). The end-piece of the tail lacks the fibrous sheath and is only surrounded by cell membrane. Only a 9+2 fiber pattern exists at the anterior portion of the end-piece and the doublet character of the peripheral fibers is lost posteriorly (Wu andNewstead, 1966). 2.2. CAPACITATION OF SPERMATOZOA The mammalian sperm is unable to fertilize an egg immediately after ejaculation and requires a period of incubation either in the female genital tract or in an in-vitro capacitation medium to acquire fertilizing capacity (Yanagimachi, 1994; Breitbart and Naor, 1999; Eisenbach, 1999). Removal of decapacitating factors primarily cholesterol and other components of the seminal plasma from the sperm surface in the female reproductive tract or in the in-vitro capacitation medium triggers many sequential biochemical and physiological changes by which sperm gains the ability to undergo the acrosome reaction and fertilize a mature oocyte. These changes are collectively called as sperm capacitation (Cross, 1996; Cross and Mahasreshti, 1997; Eisenbach, 1999; Abou-Haila and Tulsiani, 2000; Baldi et al., 2002; Visconti et al., 2002; Hunter and 7 Rodriguez-Martinez, 2004). During capacitation, several intracellular changes are known to occur including increases in cholesterol efflux, membrane fluidity, intracellular pH, Ca and cAMP, protein tyrosine phosphorylation and changes in motility pattern (Suarez, 1996; Breitbart and Naor, 1999; Eisenbach, 1999). The lipid redistribution in the plasma membrane or membrane destabilization during the capacitation process results in either exposure or hiding of specific receptors and these changes enhance the binding ability of the sperm to its receptors on the ovum (Eisenbach, 1999). Hence, only completely capacitated sperm can undergo a complete acrosome reaction and the partially capacitated sperm can only undergo a partial acrosome reaction (Jaiswal et al., 1998; 1999). Although the biological phenomenon of sperm capacitation has been known for several years, the molecular basis of this process still remains obscure. However, the capacitation process seems to be tightly controlled by number of both intrinsic and extrinsic regulators. The observation that capacitation can occur in-vitro spontaneously in a defined medium without the addition of biological fluids suggests that this process is intrinsically modulated by the sperm itself, such that these cells are preprogrammed to undergo capacitation when they are incubated in the appropriate medium. The regulation of capacitation lies more in the de-repression of inhibitory modulators of capacitation through the removal of decapacitating factors than in the stimulation of this process (Yanagimachi, 1994; Visconti and Kopf, 1998). There are several media constituents and pathways involved in the enhancement and regulation of the capacitation process. 8 The serum albumin acts as a receiving agent for cholesterol and other sterols in the sperm plasma membrane. The removal of cholesterol as well as other sterols is suggested to be responsible for the membrane fluidity changes associated with the capacitation process (Visconti and Kopf, 1998). Cholesterol removal seems to be the primary action of serum albumin in the sperm capacitation process since the capacitation process can be initiated by replacement of albumin with cholesterol-binding proteins, such as high-density lipoproteins or lipid transfer proteins present in follicular or oviductal fluids in in-vitro sperm capacitation medium (Therien and Manjunath, 1996; de Lamirande et al., 1997). 2_|_ Although, the important roles of Ca in sperm signal transduction and capacitation have been documented in several studies, the role of C a 2 + in the initiation or regulation of capacitation is currently controversial (DasGupta et al., 1993; Yanagimachi, 1994; Visconti et al., 1995b). The initiation and regulation of capacitation by C a 2 + occur via different targets, some of which are involved with cAMP metabolism. Since in sperm Ca2 +/calmodulin can activate both the synthesis of cAMP by adenylyl cyclase (Gross et al., 1987), as well as degradation by cAMP cyclic nucleotide phosphodiesterase (Wasco and Orr, 1984), it is not surprising that C a 2 + has both positive and negative actions on capacitation and related signaling events. In this respect, C a 2 + has a positive effect on mouse sperm by inducing capacitation-associated changes in protein tyrosine phosphorylation (Visconti et al., 1995b). In contrast, C a 2 + has been demonstrated to inhibit protein tyrosine phosphorylation in human sperm during the first 2 h of in vitro capacitation (Carrera et al., 1996; Luconi et al., 1998). A n increase in intracellular sperm C a 2 + during capacitation has been described by some investigators, 9 whereas others have shown that no changes in Ca levels occur during this maturational event (Yanagimachi, 1994). This ambiguity could be due, in part, to the 2_|_ well-demonstrated action of Ca on the acrosome reaction and to the inherent difficulties in differentiating between these events. However, the action of C a 2 + at the level of effector enzymes involved in sperm signal transduction suggests that this divalent cation is likely to play an important role in capacitation. The influence of HCO3" in the capacitation process has been demonstrated in numerous studies (Lee and Storey, 1986; Neill and Olds-Clarke, 1987; Boatman and Robbins, 1991; Shi and Roldan, 1995; Visconti et al., 1995a). Although very little information is available on the mechanisms of HCO3" transport in sperm, the ability of the inhibitors of anion transporters to inhibit the actions of HCO3" on various sperm functions suggests that sperm contain functional anion transporters (Okamura et al., 1988; Visconti et al., 1990, 1999; Spira and Breitbart, 1992). The intracellular pH increase during capacitation may be associated with the transmembrane movement of HCO3" into sperm (Uguz et al., 1994; Zeng et al., 1996). Because the synthesis of cAMP by mammalian sperm adenylyl cyclase is highly stimulated by HCO3", the action of HCO3" could be the regulation of sperm cAMP metabolism (Okamura et al., 1985; Garty and Salomon, 1987; Visconti et al., 1990; Chen et al., 2000). Concurrent increase of intracellular cAMP, H C O 3 " and C a 2 + during sperm capacitation implicates an active role of HCO3" in the initiation or regulation of adenylyl cyclase activity and the cAMP signaling pathway in sperm capacitation. Bovine sperm capacitation in vitro can be accomplished in chemically defined medium containing bovine serum albumin, energy substrates, and heparin or oviductal 10 fluid (Parrish et al., 1988; Miller and Ax, 1990; Miller et al., 1990; Therien et al., 1995). The active capacitating agent in the oviductal fluid is thought to be a heparin-like glycosaminoglycan. Although the mechanism of action of heparin or heparin-like glycosaminoglycans in the process of sperm capacitation is not understood well in the past, it is suggested that the glycosaminoglycans may promote capacitation by binding to and removing sperm plasma membrane adsorbed capacitation inhibiting seminal plasma proteins (Miller et al., 1990; Therien et al., 1995). Interestingly, heparin also increases cAMP synthesis (Parrish et al., 1994), elevates pH, and regulates the capacitation-associated changes in protein tyrosine phosphorylation (Galantino-Homer etal., 1997). Involvement of several protein kinase mediated signal transduction pathways have been suggested in the sperm capacitation process (Baldi et al., 2002). Activation of protein kinase A (PKA) and protein kinase C (PKC) have been shown during the capacitation process in recent studies (Naor and Breitbart, 1997). However, the P K C activity is lower in sperm during capacitation than its activity in the somatic cells (Bonaccorsi et al., 1998). Extracellular signal regulated kinases (ERK1 and ERK2) and Ras proto-oncoprotein mediated signaling pathways are also active during the process of capacitation (Feng et al., 1998; Luconi et al., 1998; Naz 1998). Reactive oxygen species mediated signaling pathways also suggested to be involved in the capacitation process since direct addition of hydrogen peroxide at low doses promotes capacitation and the addition of catalase prevents the effect of hydrogen peroxide (Griveau et al., 1995; Aitken et al., 1998). The production of superoxides during the capacitation 11 process and during activation of adenylate cyclase and protein tyrosine phosphorylation have also been shown in the past (Aitken et al., 1998; Leclerc et al., 1996). 2.3. SPERM-ZONA BINDING It is generally accepted that the interaction between sperm and egg is a carbohydrate-mediated receptor-ligand binding site (Tulsiani et al., 1997; Brewis and Wong, 1999; Wassarman et al., 1999; Topfer-Petersen et al., 2000; Primakoff and Myles, 2002; Wassarman, 1999, 2002; Hoodbhoy and Dean, 2004). The zona pellucida of the oocyte is a cell specific extra-cellular matrix or coat composed of three highly conserved glycoproteins named ZP1, ZP2 and ZP3. The ligand, which binds to sperm receptors, appears to be O-linked carbohydrates of the glycoprotein ZP3 since pre-incubation of sperm with ZP3 in micro molar concentrations strongly inhibits sperm binding to the zona pellucida, whereas pre-incubation of sperm with ZP1 and ZP2 has no effect on sperm binding to the zona pellucida. Chemical or enzymatic removal of all ZP3 oligosaccharides prevents sperm binding to the zona pellucida (Wassarman, 1999). The pre-incubation of sperm with ZP3 oligosaccharides recovered by mild alkaline hydrolysis in reducing conditions or synthesized in the laboratory in micro molar concentrations prevents binding of sperm to the zona pellucida (Litscher et al., 1995; Johnston et al., 1998; Wassarman, 1999). Limited proteolysis (Litscher and Wassarman, 1996), exon swapping (Kinloch et al., 1995) and site directed mutagenesis (Kinloch et al., 1995; Chen et al., 1998) studies have revealed that the oligosaccharides responsible for the sperm binding are located on just two of five serine residues, serine-332 and serine-334, in a region of the polypeptide near the carboxyl terminus encoded by exon-7 12 of the ZP3 gene. Since these two serine residues are highly conserved, evolutionary changes in the amino acid sequence neighboring these two serine residues may impose changes in the structure of O-linked oligosaccharides added to ZP3 which allows species specificity in sperm-zona binding (Wassarman, 1999). Several sperm surface egg binding proteins, which include various enzymes to lectin-like protein molecules, from various species have been proposed to function as receptor molecules on the acrosome intact sperm (Wassarman, 1999; Topfer-Petersen et al., 2000). Several studies strongly suggest that sperm-egg binding leading to the acrosomal exocytosis is a complex event that likely reflects interaction between multiple sperm surface receptors and multivalent ZP3 (Brewis and Wong, 1999; Wassarman et al., 1999; Topfer-Petersen et al., 2000; Hoodbhoy and Dean, 2004). Although several putative zona pellucida receptors on the sperm surface have been reported in the last decade, only a few of them are characterized based on their carbohydrate specificity and structure of the carbohydrate-binding domain (Topfer-Petersen et al., 2000). Some of the examples are rabbit spl7, mouse galactosyltransferase, porcine spermadhesins and proacrosin. The rabbit spl7, which shares a consensus sequences with the class-C type lectins, and porcine proacrosin recognize sulfated carbohydrate in the zona pellucida (Topfer-Petersen et al., 2000). However, porcine spermadhesins recognize galactose-containing structures, such as mannose and mannose-6-phosphate, and represent a new class of lectins (Romero et al., 1997). Porcine sperm receptor protein zonadhesin and mouse sp56 have a molecular structure with an unknown ligand-binding specificity (Bookbinder et a l , 1995; Hardy and Garbers, 1995; Topfer-Petersen et al., 2000). After binding with the zona pellucida, 13 mouse p95 tyrosine kinase receptor, human hu9 zona receptor kinase (ZRK) and human fertility antigen FA-1 are autophosphorylated resulting in the induction of intrinsic signaling pathways in the sperm (Burks et al., 1995; Topfer-Petersen et al., 2000). Incubation of sperm with antibodies directed against ZRK, galactosyltransferase and other sperm surface proteins has been shown to initiate the acrosome reaction (McLesky et al., 1998; Shur, 1998). Targeted mutagenesis studies revealed that some of these proteins are not particularly relevant to gamete recognition since male mice, which are homozygous null for P-galactosyltransferase, are fertile (Lu and Shur, 1997). Sperm receptor proteins, proacrosin and PH-20, are located in the wrong compartment of the sperm to participate in gamete recognition or primary binding. Hence, some of these proteins are suggested to be involved in the transient secondary binding of acrosome-reacted sperm during zona penetration (Shur, 1998; Topfer-Petersen, 1999). While porcine p47, spermadhesins and murine proteinase inhibitor-binding protein are peripherally associated to the sperm surface, ZRK, galactosyltransferase, human FA-1 and porcine zonadhesin have been shown to traverse the sperm plasma membrane (McLesky et a l , 1998; Shur, 1998; Topfer-Petersen, 1999). Hence, both surface-associated and transmembrane proteins have been suggested to form multimeric receptor binding with the zona pellucida. This multimeric receptor binding induces the aggregation of the signaling molecules of the receptor complex ZRK, galactosyl transferase, zonadhesin or other still unknown components and triggers the different signal transduction pathways of acrosome reaction (Florman et al., 1998). 14 2.4. ACROSOME REACTION OF SPERMATOZOA The acrosome reaction is an exocytotic event in which the sperm acrosome undergoes a terminal structural modification leading to fusion, vesiculation and loss of both the outer acrosomal membrane and overlying plasma membrane. The acrosome reaction is a result of signal transduction pathways initiated by carbohydrate mediated sperm binding to the zona pellucida of an egg or suitable ligand (Yanagimachi, 1994; Abou-Haila and Tulsiani, 2000; Baldi et al., 2002; Breitbart, 2002). This exocytotic event results in the release of the trypsin-like acrosin and a variety of enzymes such as acid glycohydrolases, proteinases, phosphatases, esterases and aryl sulfatases, and the exposure of new membrane domains, both of these events are essential for the fertilization process (Allen and Green, 1997; Tulsiani et al., 1998). The sperm creates a groove approximately the width and height of the head to penetrate the zona pellucida with the help of the acrosomal matrix enzymes and the physical pressure of hyperactivated motility obtained by the capacitation process (Allen and Green, 1997). A number of media constituents, such as progesterone, follicular fluid and cumulus cell secretions containing prostaglandins, sterol sulfate, glycosaminoglycans, and neoglycoproteins, have been shown to induce the acrosome reaction in-vitro (Abou-Haila and Tulsiani, 2000). The zona pellucida glycoprotein ZP3 is the natural agonist which triggers signal transduction pathways resulting in the fenestration and fusion of the sperm plasma membrane and the outer acrosome membrane at multiple sites of the anterior region of the sperm head, sequentially releasing the acrosomal contents at the site of sperm-zona binding and the exposure of the inner acrosomal membrane (Tulsiani et al., 1998). However, there are several reports demonstrating heparin and 15 heparin-like glycosaminoglycans of the follicular fluid, cumulus cell secretions and female reproductive tract secretions as important factors, which stimulate the acrosome reaction in the sperm (Lee et al., 1985; Miller and Ax 1990; Tulsiani et al., 1998) The binding of G protein coupled receptor of sperm to ZP3 activates adenylate cyclase and the phospholipase C resulting in an intracellular increase in cAMP and hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2), respectively. The intracellular increase in cAMP concentration triggers phosphorylation of P K A and the hydrolysis of PIP2 resulting the release of diacylglycerol (DAG) and inositol triphosphate (IP3), which leads to P K C translocation and activation. The activation of P K A and release of IP3 stimulate release of C a 2 + from the interior of the acrosome to the cytosol of the sperm by a voltage-dependent and IP3-gated C a 2 + channel in the outer acrosomal membrane, respectively. This initial increase in the Ca2+concentration may help further activation of phospholipase C and break down of PIP2. The ZP3 also binds to a tyrosine kinase coupled receptor in the sperm plasma membrane and activates the isoforms of phospholipase C and further break down of PIP2 results in release of higher concentrations of D A G and IP3. The breakdown of PIP2 may remove the inhibition of actin-severing proteins to enhance the fusibility of the membranes. The increase D A G concentrations activate specific PKC isoforms to activate a sperm plasma membrane voltage-dependent C a 2 + channel and resulting in a second surge of intracellular C a 2 + concentration (Spungin and Breitbart, 1996). In addition, the depletion of acrosomal C a 2 + by activation of P K A and IP3-dependent C a 2 + channels of the outer acrosomal membrane also activates a capacitative C a 2 + entry mechanism in the plasma membrane (Breitbart, 2002). The binding G protein or tyrosine kinase coupled receptor of the 16 sperm can also activate a N a / H exchanger in the plasma membrane, resulting in an increase in intracellular pH (Baldi et al., 2002). The increase in intracellular C a 2 + activates membrane bound phopholipase-A2 and phospholipase-C which act on membrane phospholipids and release fusogenic lysophospholipids. PKC-mediated protein phosphorylation with the increase in intracellular pH and C a 2 + activates actin-severing protein, which results in the dispersion of F-actin. The increase in intracellular pH and C a 2 + also promotes the conversion of acrosomal proacrosin into enzymatically active acrosin. The fusogenic lysophospholipids and F-actin dispersion result in the fusion of the plasma and outer acrosomal membranes, leading to vesiculation and acrosomal exocytosis (Breitbart and Naor, 1999; Abou-Haila and Tulsiani, 2000; Baldi et al., 2002; Breitbart, 2002). 2.5. FERTILIZATION Mammalian fertilization is defined as, a complex process, in which the sperm and egg unite thereby restoring the somatic chromosome number and development of a new individual exhibiting the characteristics of the species (Yanagimachi, 1994; Wassarman, 1999). Egg and sperm undergo a series of maturational changes before they fuse successfully and form a viable zygote (Wassarman and Albertini, 1994; Visconti and Kopf, 1998). During maturation, the sperm undergoes capacitation to gain fertilizing capacity and the oocyte undergoes nuclear and cytoplasmic maturation in which the cortical granules move towards the periphery of the oocyte. In the fertilization process, binding of sperm and the zona pellucida of the mature oocyte initiates the sperm acrosome reaction and release of acrosomal contents. With the help 17 of acrosomal contents, the acrosome reacted spermatozoa penetrate through the zona pellucida and bind with the vitelline membrane of the oocyte. Since previous sections of this chapter reviewed the sperm-zona binding and the sperm acrosome reaction, this section wil l review the events of fertilization following penetration of the sperm through the zona pellucida. The oolemma forms microvilli on the surface surrounding the oocyte except the region overlying the mitotic spindle (Longo and Chen, 1984). The observation, that the acrosome reacted sperm binds and fuses only on the region containing microvilli and rarely fuses with the region lacking microvilli, indicates that the oocyte microvilli and equatorial segment of the sperm are rich in molecules involved in sperm egg fusion (Yanagimachi, 1994). Based on antibody and gene targeting studies, several molecules such as a member of the ubiquitous tetraspanin family of proteins CD9, glycosylphosphatidylinositol (GPI)-anchored proteins, epididymal protein DE/cysteine-rich secretory protein-1, fertilin-a, fertilin-P and cyritestin have been suggested to be involved in sperm egg fusion and binding (Cho et al., 1998; Miller et al., 2000; Nishimura et al., 2001; Alfieri et al., 2003; Kaji and Kudo, 2004). The interaction between the sperm and egg initiates a series of biochemical events in the egg called egg activation. The early events of egg activation include an initial transient rise in intracellular C a 2 + concentration followed by several hours of C a 2 + oscillations resulting in the induction of cortical granule exocytosis and resumption of meiosis (Ben-Yosef and Shalgi, 1998). The initial transient rise in intracellular C a 2 + concentration is thought to be due to the release of Ca from intracellular stores like the endoplasmic reticulum by increasing concentrations of IP3 after hydrolysis of PIP2 (Swarm and Parrington, 18 1999). The hydrolysis of PIP2 also releases D A G , which activates the P K C (Ben-Yosef and Shalgi, 2001). The exocytosis of cortical granules into the peri-vitelline space leads to alterations in the structure of the zona pellucida glycoproteins, thus establishing a block to polyspermy (Ducibella et al., 1993). Following the early events of egg activation the late events including extrusion of the second polar body, decondensation of the sperm D N A , maternal R N A recruitment, formation of male and female pronuclei, initiation of D N A synthesis, syngamy and cleavage occur (Xu et al., 1994; Schultz and Kopf, 1995). Although it has been suggested that the sperm activates the egg by its binding to a receptor on the egg plasma membrane, evolving recent evidence has strongly suggested that the egg is activated by a sperm protein directly introduced into the egg ooplasm (Parrington et al., 1996; Ben-Yosef and Shalgi, 2001; Runft et al., 2002; Kaji and Kudo, 2004). The mammalian egg can be activated with increases in intracellular C a 2 + concentration by activators such as C a 2 + ionophores, ethanol or by introduction of IP3 into the ooplasm (Jones and Nixson, 2000). However, these activators give only a single increase in intracellular C a 2 + and do not give the transient C a 2 + oscillations, which are induced by sperm fusion. It is not yet clear how the sperm activates increases in intracellular C a 2 + concentration, transient C a 2 + oscillations, cortical reaction and resumption of meiosis. Although other second messengers, P K C and protein tyrosine kinase, were suggested as possible inducers for early events of egg activation, their role in the egg activation is yet to be proved (Sun et al., 1997; Raz et al., 1998; Eliyahu et al., 2002; Kaji and Kudo, 2004). 19 2.5.1. Polyspermy In the fertilization process, the sperm fusion with vitelline membrane of the oocyte initiates the release of cortical granules into the peri-vitelline space, which causes chemical changes in the zona pellucida to prevent the entry of other sperm, the zona block (Cherr and Ducibella, 1990; Wassarman, 1999). Defects in the process of zona block resulting in the penetration of more than one sperm and can lead to polyspermy (Hyttel et al., 1988; Cherr and Ducibella, 1990; Yanagimachi, 1994; Ducibella, 1996). Compared to in-vivo embryos, in-vitro produced embryos show a high incidence of polyspermy (Xu and Greeve, 1988). In the in-vitro fertilized embryos, polyspermic penetration is associated with the observation of undispersed cortical granule contents in the invaginations of oolemma resulting in an incomplete block to polyspermy (Hyttel et al., 1988). It has been suggested that polyspermy appears to be a result of a delay in the migration the cortical granules during maturation of oocytes in-vitro (Hyttel et al., 1986, 1989). Polyspermy has been shown as a most prevalent abnormal fertilization procedure resulting in the formation of polyploidic zygotes (Xu and Greve, 1988; Saeki et al., 1991). The frequency of polyspermic fertilization ranges from 6-37% in in-vitro produced embryos and 5-10% in in-vivo produced embryos (Iwasaki et al., 1989; King, 1991; Lechniak, 1996). It has been shown that polyspermic zygotes rarely develop beyond the morula and blastocyst stages or develop as androgenotes (Iwasaki et al., 1989; Pinto-Correia et al., 1992; Long et al., 1993). Improper maturation of oocytes (Niwa et al., 1991; Chian et al., 1992; Long et al., 1994; Agca et al., 2000), concentration of sperm (Long et al., 1994), source of sperm (Kreysing et a l , 1997), fertilization medium (Tajik et al., 1993; Pavlok, 2000) and 20 sperm oocyte co-incubation time (Long et al., 1994) have been shown to influence fertilization and polyspermy. 2.6. EARLY EMBRYONIC DEVELOPMENT The oviduct provides an optimum environment for sperm-egg transport, fusion at the ampulla region in the fertilization process and early embrynic development. Paracrine and/or autocrine systems involving various growth factors and glycoproteins secreted by oviductal epithelial cells mediate embryo growth promoting action of the oviductal microenvironment (Martus et al., 1997; Pushpakumara et al., 2002). Granulosa cell co-culture or synthetic oviductal fluid provides a similar environment for embryo development in-vitro. The developing bovine embryo enters the uterus 72-84 h after fertilization and starts attaching to the uterine wall from day 22 of gestation after hatching on day 9 of gestation. During migration from the oviduct to the uterus and before attachment with the uterine wall, the developing embryo undergoes a series of biochemical and morphological changes. The zygote starts with the mitotic divisions and the duration of first, second, third and fourth cell cycles of in-vitro produced embryos have been estimated as 32-34, 9-14, 10-14, and 48-54 h, respectively (Grisart et al., 1994; Holm et al. 1998). However, in-vivo studies showed that the duration of cell cycles 1-4 are about 32, 13, 14 and 24 h, respectively. This indicates there is a relatively long fourth cell cycle and a delay in the development of the in-vitro embryos after the 8-16 cell stage (Holm et al. 2002). The two major events in early embryonic development are compaction and cavitation, which follow the fifth cell cycle. As embryonic cell cleavage proceeds past the early 8 cell stage, the developmental potency 21 of the dividing cells is gradually restricted with a combination of several events that include the relative in/out positions of the cells within the embryonic structure and the gradual polarization of the outer cell layer resulting in the segregation into two mutually exclusive cell lineages at the time of compaction (Johnson and Ziomek, 1981). Compaction occurs around the 32-cell stage in both in-vivo and in-vitro derived embryos and appears to be a pre-requisite for the formation of the trophectoderm (Van Soom et al., 1997). A cluster of small and apolar cells devoid of microvilli located on the inside of the compacted embryo and the appearance of these cells differs considerably with the development of apical and baso-lateral domains in the outer cells. The differentiation of outer cells into the trophectoderm of the embryo is associated with the peripheral re-organization, profound changes in the cytoskeleton of the outer cells and the establishment of apical junctional complexes between them (Wiley et al., 1990). Formation of a tight permeability seal around the embryo, coupled with the vectorial transporting activity of the trophectoderm, results in the accumulation of fluid between cells and the progressive expansion of a central cavity known as the blastocoele which displaces the clump of apolar inner cells towards an eccentric position (Biggers et al., 1988). Thus, outer and inner cells acquire distinct morphological and functional characteristics, and are exposed to different microenvironments, the external uterine milieu and the blastocoele fluid, respectively. In response to these combined events, inside cells evolve into the inner cell mass (ICM), which contains the founder cells of the fetus. Experimental evidence showing that the descendants of the first-dividing blastomere of the two-cell stage embryo locate preferentially in the I C M (Graham and Deussen, 1978; Kelly et al., 1978) further 22 suggests that the rapid accentuation of ICM-trophectoderm cell divergence during blastocyst expansion depends on the preliminary unequal distribution of cell determinants before the time of compaction (Edwards and Beard, 1997). Progressive segregation of key cytoplasmic constituents, such as transcription factors, during successive rounds of cleavage between fertilization and compaction has been postulated as a mechanism for the generation of embryonic cells with unique complements of developmental information, and thereby with different I C M trophectoderm commitments (Antczak and Van Blerkom, 1997). As development proceeds throughout the blastocyst stage and the early phase of implantation, the I C M cells sub-divide into all three germ layers (Gardner, 1983). The interval between insemination and the formation of a tight compact morula and early blastocyst in-vitro is 110-140 h and 135-155 h post insemination, respectively (Holm et al. 1998). It is well known that the stage of development in which embryonic genome activation occurs is species specific. The bovine embryonic genome activation generally occurs during the fourth cell cycle and this is paralleled by marked ultrastructural changes in the blastomere nucleoli (Laurincik et al., 2000). Although activation of major portions of the bovine embryonic genome takes place during the fourth cell cycle, the embryonic genome is not completely inactive in the preceding cycles and some embryonic transcriptions are detected as early as the first cell cycle (Hay-Schmidt et al., 2001). During the proliferation of blastomeres by mitosis and the development of the embryo, the unwanted cells, which includes chromosomally aberrated blastomeres, are eliminated by a programmed cell death process. 23 2.7. APOPTOSIS IN THE PREIMPLANTATION EMBRYO Development of multicellular organisms is controlled not only by cell proliferation and differentiation, but also by the elimination of unwanted cells with minimal disturbance to the organism. The elimination of unwanted cells is carried out by a programmed cell death or cell suicidal procedure called apoptosis. Apoptosis is an energy requiring genetically regulated multistep physiological procedure maintaining balanced tissue homeostasis during cell proliferation (Antonsson, 2001). Apoptosis is a tightly regulated process that initiates cleavage of many proteins to mediate final cell death alteration in specific cells and leads them to cell suicidal program (Bloom and Muscarella, 1998). Apoptosis is characterized morphologically by cell shrinkage, membrane blebbing, chromatin aggregation, nuclear and cytoplasmic condensation, internucleosomal D N A fragmentation, and partition of cytoplasm and nucleus into membrane-bound vesicles called apoptotic bodies which are subsequently phagocytosed by resident macrophages or adjacent cells (Kerr et al., 1972). Chromatin condensation during the apoptosis process is associated with a specific type of D N A fragmentation in which D N A is first cleaved into large 300- and 50-kb (Ploski and Apian, 2001) fragments and then subsequently cleaved between nucleosomes to generate fragments of D N A that are multiples of 185 bp resulting in a specific D N A ladder pattern on agarose gel electrophoresis (Wyllie, 1980). The stimulus for apoptosis can be intracellular such as D N A damage, excess production of reactive oxygen species, or extracellular such as heat stress or ionizing radiation. The mitochondrial pathway and the death receptor pathway have been identified as two major pathways for programmed cell death (Ingo et al., 2000). Both pathways are regulated by cysteine-dependent 24 aspartate-specific proteases called caspases, which require a cysteine in their active site for activity and proteolytically cleave target proteins at an aspartate residue within a 4-amino acid cleavage site (Vanags et al., 1996). Fourteen caspases have been identified and are classified into three functional groups. Group 1 caspases, which include caspase-1, -4, -5, -11, -12, -13, and -14, are involved in the processing of proinflammatory cytokines and do not appear to play a role in apoptosis. Group 2 caspases, which include caspase-2, -8, -9, and -10, are regulatory caspases and play a role in initiating the apoptotic pathway. Group 3 caspases, which include caspase-3, -6, and -7, are called effector caspases and play a key role in enzymatically cleaving a variety of cellular proteins that lead to an orderly demise of the cell (Mirkes, 2002). The Bcl-2 family of proteins are involved in the regulation of the mitochondrial apoptotic pathway. To date, at least 17 members of the Bcl-2 family have been identified and classified into three functional groups. Group 1 members, which include Bcl-2, B c l - X L , A l , Boo, Bcl-w and Mcl-1, have anti-apoptotic activity and contain four conserved Bcl -2 homology (BH1-4) domains that localize the protein to the outer membrane of the mitochondria and the membranes of the endoplasmic reticulum. Group 2 members, which include Bax, Bak and Bok, have pro-apoptotic activity and their structure is similar to group 1 members, but the BH4 domain is absent in this group. Group 3 members, which include Bim, Bik, Bid, Bad, Bmf, Hrk, Noxa and P U M A , have pro-apoptotic activity, and contain a diverse collection of proteins that share only the BH3 domain with group 1 and 2 (Antonsson, 2001; Mirkes, 2002). Another family of anti-apoptotic proteins known as inhibitors of apoptosis (IAPs) have been identified recently based on their highly conserved approximately 70 amino acid baculoviral IAP repeat 25 (BIR) domain that functions to suppress apoptosis triggered by various apoptotic stimuli known to activate both mitochondrial and receptor-mediated apoptotic pathways (Deveraux and Reed, 1999). Eight members of IAP family; XIAP, NAIP, C-IAP-1, C-IAP-2, p-IAP, Survivin, LEVIN, and B R U C E or A P O L L O N , have been identified and some of these act on various caspases to inactivate the apoptotic pathways (Bennett et al., 1998; Deveraux et al., 1997, 1998; Roy et al., 1997; Kasof and Gomes, 2001). In the death receptor-mediated apoptotic pathway, the ligand binding of the death receptors, which include Fas/CD95, TNFR1, DR3/APO-3, DR4 and DR5, activate the receptor by inducing receptor clustering (Mirkes, 2002). The activated receptor recruits a cytosolic adapter protein known as Fas associated death domain (FADD). F A D D recruits and binds procaspase-8 via common death effector domains (DED) and forms a complex called death-inducing signaling complex (DISC). Within the DISC, the procaspase-8 is autocatalytically processed resulting in the active caspase-8 containing large and small subunits. The activated caspase-8 enzymatically cleaves and activates the downstream effector caspases such as caspase-3 (Chen and Wang, 2002; Mirkes, 2002). In the mitochondrial apoptotic pathway, instead of caspase-8/-10, procaspase-9 is activated through unclear upstream pathways. A variety of apoptotic signals act on the mitochondria to release cytochrome-c into the cytoplasm where cytochrome c activates a protein called apoptosis protease activating factor-1 (Apaf-1) to form an oligomeric complex known as an apoptosome. Subsequently, procaspase-9 is recruited to the apoptosome through protein-protein interactions mediated by caspase recruitment domains (CARD) in Apaf-1 and caspase-9 (Tsujimoto and Shimizu, 2000; Mirkes, 2002). Although the activation of procaspase-9 is not completely understood, 26 autocatalytic processing of the proenzyme within the apoptosome yields the activated, caspase-9, which activates downstream effector caspases, such as procaspase-3. Both the death receptor and the mitochondrial apoptotic pathways involve caspase cascades that activate one or more effector caspases. The activated effector caspases act on various cellular proteins containing a caspase cleavage motif to either activate, e.g., P21- Activating Kinase 2 (PAK2) or inactivate, e.g., Poly (ADP-ribose) Polymerase (PARP), inhibitors of caspase activated DNAse (ICAD). Inactivation of PARP and ICAD, and cleavage of lamin -A, actin, Gas-2, gelsolin and fodrin by effector caspases results in D N A fragmentation, and cell shrinkage and membrane blebbing, respectively (Kothakota et al., 1997). Effector caspase mediated cleavage of lamins, which are intermediate filament scaffold proteins of the nuclear envelope, also appears to be involved in nuclear fragmentation because over expression of lamins with mutated caspase cleavage sites delays the onset of chromatin condensation (Rao et al., 1996). Although the relationship between the cleavage of some of the specific substrates and subsequent functional and morphological events of apoptosis has been established, the relationship between cleavage of most effector caspase target proteins, and the functional and morphological events of apoptosis is yet to be established. p53, a tumor suppresser protein, has been shown to regulate both the death receptor and the mitochondrial pathways and apoptosis by transcription dependent and independent ways. p53 regulates apoptosis following a variety of stimuli such as D N A damage, cytotoxic drugs, free radicals, irradiation, growth factor withdrawal, hypoxia, metabolic change, virus infection, cytokines, or deregulated expression of cell cycle genes (Canman and Kastan, 1998). p53 initiates the mitochondrial apoptotic pathway by 27 up-regulation of pro-apoptotic genes such as Bax and down-regulation of anti-apoptotic genes such as bcl-2 by transcriptional activation or repression, resulting in alteration of the relative quantities of Bax to Bcl-2 and shifting the balance towards apoptosis (Miyashita et al., 1994). Activation of p53 induces the death receptor mediated apoptotic pathway by translocation of an intracellular pool of Fas located in the Golgi complex to the cell surface, which induces F A D D recruitment to Fas, and caspase activation. Recent studies revealed that various stages of p53 dependent and independent apoptotic pathways are negatively regulated by heat shock protein-70 (Beere et al., 2000; Gabai et al., 2000). A n irregular expression pattern of pro and anti apoptotic proteins regulating both the death receptor and the mitochondrial pathways causes cell death and embryo mortality during early stages of development since apoptosis and mitosis are essential developmentally regulated functions for development and differentiation of the early embryo (Hardy, 1997; Matwee et al., 2000; Kolle et al., 2002). Compared to in-vivo produced embryos, in-vitro produced embryos show higher numbers of apoptotic cells (Jurisicova et al., 1998) and this might be one of the reasons for the lower survival rates of in-vitro produced embryos (Xu et al., 1992; Keskintepe and Brackett, 1996). External stress factors change the expression patterns of pro and anti apoptotic proteins to predispose blastomeres to signal induced apoptosis (Jurisicova et al., 1998). Apoptosis has been observed in 8-16 cell, morula and blastocyst stage embryos, but has not been observed in zygotes (with 2 pronuclei), 2-cell, or 3 to 7-cell stage embryos (Matwee et al., 2000). Furthermore, the percentage of apoptotic nuclei observed decreases at the morula stage before increasing again at the blastocyst stage (Byrne et al., 1999). 28 Although expression of several IAPs, which protect cells from apoptosis, have been shown, their roles in development and the embryo response to apoptotic stimuli are unknown. 2.8. Bax, Bcl-2 and p53 Bcl-2 associated protein (Bax) is one of the major pro-apoptotic proteins first isolated with the key regulatory anti-apoptotic protein B-cell lymphoma-2 (Bcl-2) by co-immunoprecipitation (Oltvai et al., 1993). In normal cells, Bax is primarily localized in the cytosol as a monomer and apoptotic stimulation specifically translocates Bax to the mitochondria (Hsu et al. 1997; Hsu and Youle 1998; Gross et al. 1998; Zhang et al. 1998b; Antonsson et al. 2000). Activation and translocation of Bax have been accompanied by conformational changes in its quaternary structure in which the C-terminal a-helix is removed from the BH3 cleft making the BH3 domain accessible to interactions leading to complex formation (Suzuki et al. 2000). After activation, Bax is found inserted into the outer mitochondrial membrane as large oligomers (Antonsson et al. 2001). ). It has been shown that Bax forms large clusters containing oligomers of thousands of Bax molecules in the outer mitochondrial membrane in cells undergoing apoptosis (Nechushtan et al. 2001). Bax levels have been reported to change during apoptosis in several cell types (Krajewski et al. 1995; Ekegren et al. 1999). p53 has been shown to mediate transcriptional activation of the Bax promoter resulting in up-regulation of Bax protein expression (Miyashita and Reed 1995). Bax appears to induce apoptosis with the release of cytochrome c and other proteins, including AIF, adenylate kinase and endonuclease G from the mitochondrial intermembrane space by forming 29 specific channels or pores in the outer membrane and/or by opening the permeability transition pore resulting in mitochondrial matrix swelling and outer membrane rupture (Daugas et al. 2000; Verhagen et al. 2000; L i et al. 2001). Bcl-2, the founder of the Bcl-2 protein family was first identified as a gene translocated in B-cell lymphoma, thus linking its activity to tumor growth (Tsujimoto et al. 1985). Anti-apoptotic proteins like Bcl-2 are localized in several intracellular membranes, including the mitochondria, endoplasmic reticulum, and nuclear envelope (Krajewski et al. 1993). Anti-apoptotic members such as Bcl-2 tend to form heterodimers with BH3 domains of the pro-apoptotic members, blocking their function, such that cell fate may be determined by the ratio of pro- to anti-apoptotic members (Oltvai et al., 1993). Since Bcl-2 inhibits Bax activation and oligomerization by either direct or indirect interactions, the molecular mechanism for Bcl-2 prevention of Bax activation remains unclear and appears to be dependent on cell type or the apoptotic stimulation (Mahajan et al., 1998; Antonsson et al., 2001; Mikhailova et al. 2001). Pro-apoptotic and cell cycle inhibitory functions of Bcl-2 have also been reported (O'Reilly et al., 1996; Vairo et al., 1996; Cheng et al., 1997; Shinoura et al. 1999). Bcl-2 can also modulate the cell cycle in a way that is different from the inhibitory effect on apoptosis (Linette et al. 1996). Bcl-2 promotes exit into quiescence and retards re-entry into the cell cycle (Mazel et al., 1996; Adams and Cory, 1998). It has been shown that over expression of the Bcl-2 protein increases the half-life of the Bax protein (Miyashita et al., 1995) indicating that the Bcl-2 gene functions like a pro-apoptotic gene in some circumstances. It has been reported that caspase-3 cleaves Bcl-2 at Asp34 and transforms the Bcl-2 protein into an inducer of cell death (Cheng et al., 1997). The anti-30 apoptotic function of the Bcl-2 can be lost by multi-site phosphorylation (Haldar et al. 1995). The regulation of the function of Bcl-2 mainly involves interactions with other proteins of the Bcl-2 protein family, but phosphorylation may also be a crucial event in the regulation of its function (Haldar et al. 1995; Yamamoto et al. 1999). Jnk was repeatedly indicated as a potential Bcl-2 kinase, which phosphorylates Bcl-2 at four serine/threonine sites (Maundrell et al. 1997; Blagosklonny, 2001). However, it has been suggested that several kinases may be involved in the phosphorylation of Bcl-2 (Blagosklonny, 2001). Although Bcl-2 at a low level of expression was anti-apoptotic, Bcl-2 at a high level of expression was pro-apoptotic to Fas-mediated apoptosis (Shinoura et al., 1999). Expression of Bcl-2 and Bax was demonstrated in the bovine (Kolle et al., 2002; Matwee et al., 2000; Yang and Rajamahendran, 2002), human (Liu et al., 2000; Spanos et al., 2002; Jurisicova et al., 2003), and mouse (Exley et al., 1999) pre-implantation embryos. Changes in expression of Bcl-2 and other members of Bcl-2 family are associated with fragmentation of embryos at the pronucleate and blastocyst stages (Jurisicova et al., 1998; Exley et al., 1999). Bcl-2 family members are involved in the regulation of apoptosis during mouse preimplantation development. The anti-apoptotic members including Bcl-2, Bcl-W, and Bc l -XL are expressed at high mRNA levels at the pronucleate and blastocyst stages and lowest at the 2-8 cell stages, suggesting that the message is both inherited from the oocyte and transcribed from the embryonic genome (Jurisicova et al., 1998; Warner et a l , 1998; Exley et al., 1999). Of these, Bcl -X L is expressed at the highest copy number, with Bcl-2 lowest (Jurisicova et al., 1998). Bax is constitutively expressed, increasing from low copy number to higher levels after 31 embryonic genome activation, with pro-apoptotic members Bak and Bad also expressed (Jurisicova et al., 1998). Jurisicova et al. (2003) studied seven Bcl-2 genes in normal and fragmenting embryos, and found that levels of the pro-apoptotic genes of the Bcl-2 family were up regulated in fragmented embryos. p53 is a 53 kDa sequence-specific protein transcription factor that is widely recognized to function during the cell cycle as an inducer of cell cycle arrest and as a mediator of apoptosis (Yonish-Rouach et al., 1991; Levine, 1997; Sionov & Haupt, 1999). The elimination of excess, damaged or infected cells by p53 mediated apoptosis is essential for the proper regulation of cell proliferation and for. the control of propagation of damaged D N A in multicellular organisms (Huang and Strasser, 2000). p53 exerts its tumor suppressor effect through regulation of cell proliferation by regulating cell cycle checkpoints and mediating growth arrest, and also by mediating apoptosis by both transactivation of genes involved in different cellular functions and activation of transcription-independent mechanisms of apoptosis (Lane, 1992; Haupt et al., 1995; Agarwal et al., 1998). The external and internal stress signals, such as D N A damage, free radicals, irradiation, virus infection and nucleotide depletion, activate p53 and promote its nuclear accumulation in an active deregulated expression of cell cycle genes resulting in either viable cell growth arrest or apoptosis (reviewed by Bennett, 1999). Under normal conditions, p53 has a short half-life regulated by p53 inhibitors (Giaccia and Kastan, 1998). p53 activation involves stabilization of the protein, and enhancement of its D N A binding and transcriptional activity. These changes in p53 are mediated by extensive post-translational modifications of p53 and protein-protein interactions with cooperating factors. The activation of p53 leads to either cell growth 32 arrest or apoptosis depending on the summation of incoming signals and the cellular context (Jin and Levine, 2001). A multitude of mechanisms, which include stimulation of a wide network of signals that act through two major apoptotic pathways by induction of specific apoptotic target genes and promotion of apoptosis by a transcription-independent mechanism under certain conditions, are employed by p53 to ensure efficient induction of apoptosis in a stage, tissue and stress signal specific manner (Giaccia and Kastan, 1998; Lohrum and Vousden, 1999). p53 can activate the extrinsic apoptotic pathway through the induction of genes encoding three transmembrane proteins Fas, DR5 and PERP (Muller et al., 1998). p53 may also rapidly sensitize cells to Fas-induced apoptosis by increasing Fas receptors at the cell surface by promoting Fas receptor trafficking from the Golgi before the transcription-dependent apoptotic effect (Bennett et al., 1998). p53 also induces DR5/KILLER, the death-domain-containing receptor for the TNF-related apoptosis-inducing ligand (TRAIL), in response to D N A damage (Wu et al., 1997). p53 regulates the key Bcl-2 family pro-apoptotic proteins of the intrinsic apoptotic pathway such as Bax, Noxa, P U M A and Bid (Cory and Adams, 2002; Kuwana et al., 2002; Thornborrow et al., 2002). It appears that in response to D N A damage p53 activates the intrinsic mitochondrial apoptotic pathway by inducing the expression of at least three Bcl-2 pro-apoptotic family members, shifting the balance towards pro-apoptotic effects (Adams and Cory, 2002). p53 also induces Apaf-1 expression through a response element within the Apaf-1 promoter (Rozenfeld- Granot et al., 2002). The p53 also induces apoptosis by direct action in the mitochondria through signal-induced localization resulting in cytochrome c release and procaspase-3 activation to induce apoptosis (Marchenko et al., 2000). p53 also forms 33 complexes with the protective B c l - X L and Bcl-2 proteins and promotes permeabilization of the outer mitochondrial membrane (Mihara et al., 2003). p53 regulates transcription of pro-apoptotic Bid which is distinguished by its unique ability to connect activation of the extrinsic death receptor pathway to activation of Bax and Bak associated with the intrinsic pathway (Sax et a l , 2002). Hence, p53 appears to promote the convergence of the intrinsic and extrinsic pathways of apoptosis through Bid regulation. 2.9. INTERFERON TAU (IFNx) Bovine trophoblast IFNx is a 195 amino acid pre-protein. It is coded by a 595 bp open reading frame, containing a 23 amino acid signal sequence that is cleaved to yield the mature protein. It has molecular masses of 22,000 to 24,000 kDa, each with multiple isoforms, and is glycosylated with N-linked oligosaccharides (Demmers et al., 2001). IFNx is a well characterized embryonic signal for the maternal recognition of pregnancy. It exerts its function through a reduction in the expression of estrogen and oxytocin receptors in the endometrium, which in turn reduces or prevents the oxytocin mediated pulsatile secretion of prostaglandin F 2 a and luteolysis (Godkin et al., 1997; Wolf et al., 2003). In addition to maintenance of the corpus luteum of pregnancy, IFNx induces expression of a number of genes such as STAT (signal transducer and activator of transcription) 1 and 2 (Stewart et a l , 2001), |32 microglobulin (Vallet et al., 1991), IFN-regulatory factor 1 (Spencer et al., 1998), ubiquitin conservative protein (Johnson et al., 1999), M x protein (Ott et al., 1998), granulocyte chemotactic protein 2 (Teixeira et al., 1997) and 2'5'-oligoadenylate synthase (Johnson et al., 2001). Further, IFNx 34 stimulates the expression of granulocyte-macrophage colony-stimulating factor, a cytokine with putative positive effects on the conceptus, in stroma cells of the endometrium (Emond et a l , 2000). Other effects of IFNT in endometrial cells include a reduction of oxytocin-induced cyclooxygenase-2 and prostaglandin F-synthetase expression (Xiao et al. 1999). Thus, IFNT supports the maintenance of pregnancy via multiple mechanisms. Inadequate reaction of the endometrium to IFNT or insufficient secretion of IFNT by the conceptus is assumed to be the major reason for early embryonic loss and pregnancy failure. Therefore, the level of IFNT secretion has been discussed as a parameter for the assessment of embryo quality (Hernandez-Ledezma et al. 1993). IFNT is expressed transiently during embryo development with the peak production on day 16 in sheep (Godkin et al., 1982) and day 17 in cattle (Bartol et al., 1985). It is detectable until day 20 in sheep and day 25 in cattle when the embryo starts the implantation process. The rapid onset and cessation of IFNT expression is regulated by number of transcription factors such as Ets-2 (Ezashi et al., 1998) and granulocyte-macrophage colony-stimulating factor acting via the proto-oncogene c-jun and an AP-1 site (Imakawa et al., 1993; Yamaguchi et al., 1999). In addition, negative regulatory domains have been shown in the bovine IFNT promoter that may be involved in the precisely timed cessation of gene expression (Guesdon et al., 1996; Yamaguchi et al., 1999). 2.10. HEAT SHOCK PROTEIN-70 Stress or heat shock proteins (HSPs) were first discovered as a set of highly conserved proteins whose expression was induced by different kinds of stressors 35 (Ritossa, 1962). Mammalian HSPs have been classified into four major families according to their molecular size: HSP90, HSP70, HSP60 and the small HSPs. HSPs act as molecular chaperones which regulate some of the important house keeping functions such as import of proteins into cellular compartments; folding of proteins in the cytosol, endoplasmic reticulum and mitochondria; degradation of unstable proteins; dissolution of protein complexes; prevention of protein aggregation; control of regulatory proteins; and refolding of misfolded proteins (Bakau and Horwich, 1998). The specificity of chaperone activity is determined by the structure of the chaperone, and the size and localization of the protein to be chaperoned HSP70 functions as ATP-dependent molecular chaperones under normal conditions by assisting the folding of newly synthesized polypeptides, the assembly of multi-protein complexes and the transport of proteins across cellular membranes (Murakami et al., 1988; Beckmann et al., 1990; Shi and Thomas, 1992). When HSP70 is expressed under various stress conditions their synthesis enhances the ability of stressed cells to cope with increased concentrations of unfolded or denatured proteins (Nollen et al., 1999). HSP70 has been shown to inhibit apoptosis and thereby increase the survival of cells exposed to a wide range of lethal stimuli and overexpression of HSP70 protects cells from stress-induced apoptosis, both upstream and downstream of the caspase cascade activation (Mosser et al., 1997). HSP70 helps ensure the survival of cells by directly interacting with various components of tightly regulated programmed cell death machinery (Buzzard et al., 1998; Parcellier el al., 2003). HSP70 also seems to protect cells from energy deprivation associated with cell death (Wong et a l , 1998). HSP70 has been shown to inhibit apoptosis downstream of the release of cytochrome c 36 and upstream of the activation of caspase-3 (Li et al., 2000). The direct interaction of HSP70 with APAF-1 to prevent the recruitment of procaspase-9 to the apoptosome has also been reported (Beere et al., 2000; Saleh et al., 2000). HSP70 may prevent cell apoptosis by interacting with proteins mediating caspase independent cell death pathways (Creagh et al., 2000). HSP70 directly interacts with apoptosis inducing factor (AIF) and neutralizes the apoptogenic effects of AIF such as AIF-induced chromatin condensation. (Ravagnan et al., 2001). HSP70 does not preclude the activation of caspase-3 but prevents downstream morphological changes that are characteristic of dying cells in TNF-induced apoptosis (Jaattela et al., 1998). HSP70 has also been shown to associate with the pro-apoptotic proteins p53 and c-myc (Beere et al., 2000; Gabai et al., 2000). Expression of HSP70 in the developing embryo, which undergoes various stress conditions, is important for the survival of the embryo and HSP70 has been shown to play a key role in protection of developing preimplantation embryos from various stress factors. The expression of HSP70 is developmentally regulated (Edwards et al., 1997; Paula-Lopes and Hansen, 2002). Heat stress induced expression of HSP70 was reported in very early 2 cell stage embryos (Chandolia et al., 1999) 2.11. METHODS DEVELOPED TO PREDICT BULL FERTILITY 2.11.1. Motility, Morphology and Viability Among the parameters necessary for a basic analysis of semen, sperm concentration, motility, viability and morphology estimates would be considered the most important. Semen quality traits that are viability-related or of a morphological nature (Saacke, 1982) could be assessed by microscopic examination of either unstained 37 semen samples or stained semen samples by simple staining procedures. The relationship of sperm morphology to field fertility has been shown recently (Sailer et al., 1996; Aziz et al., 1998; Ostermeier et al., 2001). Acceptable standards for a "probable fertile" specimens of bull semen are the presence of over 500 x 106 spermatozoa per ml and more than 50% of motile sperm making forward progression (Hafez, 1987). Several studies have compared the basic traits of semen quality with fertility estimates and correlations have ranged from zero to very high (Saacke, 1982). At present, advanced technologies such as computer-assisted semen analysis systems have become commercially available. Such systems allow an analysis of sperm translational movement, thus providing an alternative to subjective sperm motion analysis (Macnutt, 1990). Budworth et al. (1988) used this technique to examine the relationship between sperm motility and fertility, and found a correlation between the two, and suggested that computerized motility analysis may be useful in the prediction of fertility of bull spermatozoa. However, Bailey et al. (1994) found no correlation between any of the seven computer determined motility parameters and in-vivo fertility of cryopreserved bovine spermatozoa. Other than motility, parameters like the live:dead ratio, acrosomal status and morphological abnormalities are considered important for predicting the fertilizing ability of bovine spermatozoa. Assessment of sperm viability has conventionally depended on supravital staining techniques. These are based on the principle that live cells possess intact plasma-acrosomal membranes and thus do not readily allow the passage of the macromolecular stain. Eosin-nigrosin, trypan blue or Congo red have 38 been conventionally used for assessing membrane integrity of bull spermatozoa. Since early reports of the use of nucleic acid specific stains (bisbenzamide) for the sorting of live cells according to their D N A content (Arndt-Jovin and Jovin, 1977; Visser, 1980), commercially available stains such as Hoechst 33258 and Hoechst 33345 (Sigma, St. Louis, M O , USA) have been found useful for assessing membrane integrity of spermatozoa in a wide variety of species including the human (Cross et al., 1989). In spite of their importance, these tests fail to predict fertility of bulls in the field. The maximum permissible limits for the abnormal spermatozoa in bull semen were set over 70 years ago. Williams and Savage (1925) found that i f abnormal spermatozoa exceeded 18%, fertility declined. Even though a wide variety of morphological abnormalities of spermatozoa have been reported, there is no clear experimental evidence of a relationship between specific morphological characteristics and fertility; however a high frequency of abnormal spermatozoa has been associated with reduced fertility (Sullivan, 1978). The maximum permissible limit for head abnormalities is set at 5%, and 20 % for total abnormalities (all categories). Any sample exceeding this limit is considered unfit for A l . Based on the above findings, it has been suggested that tests based on sperm qualitative parameters (concentration, morphology and viability) might be useful for the first step elimination of bad semen producers and development of tests based on sperm function might be necessary for selection of highly fertile semen producers. 2.11.2. Biochemical Parameters Measurements of metabolic activity of spermatozoa have also been considered as possible predictors of fertility. The use of metabolic tests such as oxygen uptake 39 (Bishop and Salisbury, 1955), pyruvate oxidation (Melrose and Terner, 1953), fructolysis index (Secrist and Schultze, 1952), methylene blue reduction (Branton et al., 1951), and resazurin reduction (Erb and Ehlers, 1950) have been suggested, but were not found useful for routine evaluation of semen. Pace and Graham (1970) attempted to use enzyme-loss as fertility-index. They measured the release of glutamic-oxaloacetic-transaminase (GOT) from spermatozoa and found significant correlations between such measurements and fertility. A kit for rapidly and conveniently assessing sperm viability by measuring ATP loss is now commercially available (Sperm Viability Test, FireZyme Diagnostic Technologies Limited, Halifax, NS, Canada). This test uses an enzyme, Luciferase (derived from Fire-Fly), which oxidizes luciferin (substrate) in proportion to the concentration of ATP present, resulting in.the emission of light. Since ATP disappears within seconds following cell death, only the viable spermatozoa wil l contain ATP to contribute to the light producing reaction. The light produced is measured in a bioluminometer. Major A l companies are currently using the kit priced at around $3,500.00 on a trail basis. Published information on the usefulness of this test for making fertility estimates is still not available. Although this method gives considerable accuracy in predicting fertility, the cost of this kit renders it less useful for routine semen analysis. 2.11.3. Swim-up Tests and Sperm Binding to Genital Epithelium Spermatozoa have an innate ability to traverse fluids of a certain viscosity, which led to the so-called "swim-up tests" where spermatozoa are assessed for their capacity to pass through fluid barriers as happens in-vivo (Rodriguez - Martinez et al., 1997). Studies with frozen-thawed bull semen, using "swim-up tests" across a column 40 of culture medium have indicated the number of viable spermatozoa with linear motility and this test reflected the innate fertilizing ability of a semen sample (Zhang et al., 1998a). Binding of spermatozoa to oviductal epithelial cells prolongs their life in vitro, presumably because the binding occurs only with non-capacitated spermatozoa (Lefebvre and Suarez, 1996). Sperm co-culture with oviductal explants is being used to determine the capacity of a semen sample to colonize the reservoir with a marginal relation to fertility. 2.11.4. Sperm Capacitation and Acrosome Reaction Once the acrosome reaction has occurred, spermatozoa tend to die rapidly. In order to prolong the life span of spermatozoa, which may be essential for successful fertilization, acrosomal integrity should be maintained. Saacke (1970) found a significant correlation between post thaw motile life and maintenance of the acrosome in bull spermatozoa. Saacke and White (1972) found a positive correlation between the percentage of intact acrosomes and non-returns of first insemination, whereas only a weak correlation was obtained when motility estimates were compared with non-returns. Following this report, many workers have examined the relationship between fertility and either acrosomal integrity or the ability of spermatozoa to undergo the acrosome reaction under in-vitro conditions (Ambrose et al., 1995; Whitfield and Parkinson, 1995; Januskauskas et al., 2000). There is strong evidence to show that the ability of spermatozoa to acrosome react under the influence of heparin or other agents like calcium ionophore A23187 or lysophosphatidylcholine has a definite relationship to fertility (Ax et al., 1985; Parrish et al., 1985; Ax and Lenz, 1986; Graham and Foote 1987a; 1987b; Whitfield and Parkinson, 1992). A relationship between the binding 41 affinity of heparin to spermatozoa and fertility has also been demonstrated (Marks and Ax, 1985; Lalich et al., 1989; Bellin et al., 1993). A test based on calcium ionophore-induced acrosome reaction in human spermatozoa has been found useful in identifying semen samples of sub-fertile/infertile men, indicating acrosomal dysfunction as a likely cause of fertilization failure. Cummins et al. (1991) have shown this test to have a predictive value for fertility. Results of these studies strongly suggest that the ability of spermatozoa to undergo the acrosome reaction in-vitro may be useful in predicting the fertility of bulls. Rajamahendran et al. (1994) demonstrated the use of anti-human sperm monoclonal antibody HS-11 as a marker to assess bovine sperm capacitation and acrosome reaction in-vitro. Ambrose et al. (1995) using the HS-11 antibody further concluded that a) between bull differences exist in HS-11 binding to spermatozoa and cleavage rate of embryos in vitro, and b) HS-11 binding to spermatozoa is correlated with fertility, as determined by the cleavage rate of bovine oocytes matured and fertilized in vitro. 2.11.5. Sperm Zona Binding/Accessory Sperm Counts The effective binding of spermatozoa to the zona pellucida is a critical step in the process of fertilization that has sperm capacitation as a pre-requisite and relates to the acrosome reaction induced by the zona pellucida (Topper et al., 1999) being the rationale for in vitro sperm-zona binding tests. Using zona-binding tests significant correlations have been obtained with fertility in bulls (Zhang et al., 1998a). Spermatozoa that did not penetrate the zona pellucida entirely during fertilization (due to effective block to polyspermy by the oocyte) are trapped in the zona pellucida of the oocytes or early embryos and named "accessory spermatozoa". These spermatozoa have 42 demonstrated all the attributes needed to penetrate the zona pellucida and therefore been considered as potentially fertile (Saacke et al., 1998). The number of accessory spermatozoa bound to zona pellucida in-vivo significantly correlated with in-vivo fertilization rates of bulls (Nadir et al., 1993; Saacke et al., 2000), and therefore was used to measure the fertilizing capacity of a given semen sample. Although the sperm-zona binding assay showed a significant correlation with field fertility of bulls, the repeatability of this test was very low. This could be attributed to the testing procedure since frozen immature oocytes are used for this test procedure and the sperm receptor proteins on the zona pellucida undergo structural alterations by freezing procedure. Therefore, modification of the test procedure by using fresh matured oocytes might give higher repeatability in zona binding assays. 2.11.6. Oocyte Penetration Assays Oocyte penetration assays (Bousquet et al., 1983; Boatman et al., 1988; Wheeler and Seidal, 1987; Graham and Foote, 1987a; 1987b; Fazeli et al., 1993; Fazeli et al., 1995) have been developed and examined as predictors of fertility. Normally, sperm of a species can penetrate ova only of the same species due to the species-specific barrier provided by the zona pellucida. However, the pioneering work of Yanagimachi (1972) demonstrated that capacitated and acrosome reacted spermatozoa of most species could penetrate hamster eggs whose zona has been removed in-vitro. For some unexplained reason, zona free hamster oocytes seem most receptive to spermatozoa from heterologous species. Zona free hamster eggs have been used to assess the fertilizing capacity of human spermatozoa, and have also been shown to allow penetration by the capacitated spermatozoa of various species including cattle (Bousquet and Brackett, 43 1982; Brackett et al., 1982a), horse (Brackett et al., 1982b), pig (Imai et al., 1980), sheep (Flechon and Pavlok, 1986), goat (Bou and Hanada, 1985) and buffalo (Takahashi et al., 1989). Attempts to determine the fertilizing capacity of cattle, using this system, and to rank breeding bulls in order of their fertility status were not successful since the results did not fit with the rank of bulls based on their non-return rates (Kruip et al., 1992). 2.11.7. Correlation Between In-vitro and In-vivo Fertility Brackett et al. (1982a) was the first to report the birth of the first live calf produced by an in-vitro fertilization (IVF) techniques. Since then, the potential applications of bovine IVF have generated tremendous interest in this technology. As a result, though with limited success, bovine IVF has now become a feasible technology for the production of embryos for both research and commercial applications (Gordon and Lu, 1990; Trounson, 1992). Attempts have been made to correlate the results of bovine IVF with in-vivo fertility based on 60-90 day non-return-rates, but conflicting results have been obtained (Oghoda et al., 1988; Hillery et al., 1990; Marquant-Le Guienne et al., 1990). The non-return rate for a given bull is defined as that percentage of females not returning to estrus within a given period (usually 60-90 day) after being bred with semen from that bull. Thus, the higher the non-return rate, the better the fertility of the bull under question. Shamsuddin and Larsson (1993) found that 56-60 day non-return rates were significantly correlated with the first cleavage in-vitro, but further embryonic development in-vitro was not correlated with non-return rate. 44 2.12. RATIONALE FOR THE STUDY Reproductive efficiency has important economical values in a dairy farm operation. The fertility of bulls used for A l has an important role in determining the reproductive efficiency. Huge expenditures are incurred by A l organizations in terms of time, labour and management costs to prove young bulls for their fertility and genetic merit. This indicates that significant advantages to the cattle industry as well as to the A l industry could be achievable, i f simple laboratory tests were made available to predict fertility of young bulls recruited for progeny testing program. Although several laboratory semen evaluation methods have been developed over the past, most of them lack repeatability or precise prediction of bull fertility in the field. The success of the reproductive process is measured by the birth of viable calf. In this process sperm and egg fuse and the zygote develops in a highly controlled ordered stepwise process beginning with sperm capacitation, sperm-zona binding, sperm acrosome reaction, penetration, fusion, activation of embryonic genome and development of an embryo. Hence, the irregular occurrence of any of these processes is detrimental and reflected by low fertility. Since several new molecular techniques have been developed in the past to evaluate cell functions at gene expression levels, the embryo developmental capacity can be evaluated more accurately at molecular level than just evaluating morphology and sperm functions. Hence, it was decided to evaluate the fertility of bulls by determining sperm functions before fertilization (sperm-zona binding and acrosome reaction), at fertilization (sperm pre-incubation time and concentration on normal and polyspermic fertilization), and after fertilization (embryo development, apoptosis and gene expression). 45 2.13. HYPOTHESES Although there have been several studies conducted to evaluate fertility of bulls accurately, few single sperm parameters have been found to significantly correlated with field fertility. The more the sperm parameters are tested, the more accurate will the prediction of bull fertility be. In this respect, the following hypotheses are proposed for this study. 1. Bovine in-vitro sperm acrosome reaction, sperm-zona binding and fertilization are partially male factor dependant and therefore will have a direct influence on fertility of bulls. 2. Viability of bovine spermatozoa within the female reproductive tract is partially male factor dependant and has a direct influence on fertility of bulls. 3. Apoptosis and gene expression of bovine pre-implantation embryos are partially male factor dependant and have a direct influence on fertility of bulls. 2.14. OBJECTIVES The overall objective of the proposed study is to evaluate the fertility of bull using in vitro sperm function tests. Based on this general objective, the following specific objectives are proposed for this study. 1. To investigate the bull effect on sperm acrosome reaction, sperm-zona binding and in-vitro embryo production (experiment 1) 2. To study the effect of sperm pre-incubation time and sperm concentration of bulls on in-vitro fertilization (experiment 2). 46 3. To study the bull effect on apoptosis and expression of Bcl-2, Bax, p53, interferon tau and heat shock protein-70 genes in bovine in-vitro produced embryos (experiment 3). 4. To study the correlation between the above in-vitro tests and field fertility data. 47 2.15. REFERENCES Abou-Haila A , Tulsiani DRP. 2000. Mammalian sperm acrosome: formation, contents, and function. Arch Biochem Biophy 379, 173-182. Adams JM, Cory S. 1998. The Bcl-2 protein family: arbiters of cell survival. Science 281, 1322-1326. Adams JM, Cory S. 2002. Apoptosomes: engines for caspase activation. Curr Opin Cell Biol 14, 715-720. Agarwal M L , Taylor WR, Chernov M V , Chernova OB, Stark GR. 1998. The p53 network. J Biol Chem 273, 1-4. Agca Y , Liu J, Rutledge JJ, Critser ES, Critser JK. 2000. Effect of osmotic stress on the developmental competence of germinal vesicle and metaphase ii stage bovine cumulus oocyte complexes and its relevance to cryopreservation. Mol Reprod Dev 55, 212-219. Aitken RJ, Harkiss D, Knox W, Paterson M , Irvine DS. 1998. A novel signal transduction cascade in capacitating human spermatozoa characterized by redox-regulated, cAMP-mediated induction of tyrosine phosphorylation. J. Cell. Sci. I l l , 645-656. Alfieri JA, Martin A D , Takeda J, Kondoh G, Myles DG, Primakoff P. 2003. Infertility in female mice with an oocyte-specific knockout of GPI-anchored proteins. J Cell Sci 116,2149-2155. Allan K W . 1991. Embryo mediated pregnancy failure in cattle. Can Vet J 32, 99-103. Allen C A , Green DP. 1997. The mammalian acrosome reaction: gateway to sperm fusion with the oocyte? Bioessays 19, 241-247. Allen M J , Lee C, Lee JDIV, Pogany GC, Balooch M , Siekhaus WJ, Balhorn R. 1993. Atomic force microscopy of mammalian sperm chromatin. Chromos 102, 623-630. Allen M J , Bradbury E M , Balhorn R. 1996. The chromatin structure of well-spread demembranated human sperm nuclei revealed by atomic force microscopy. Scann Microsc 10, 989-996. Ambrose JD, Rajamahendran R, Sivakumaran K , Lee C Y G . 1995. Binding of the anti-human sperm monoclonal antibody HS-11 to bull spermatozoa is correlated with fertility in vitro. Theriogenology 43, 419-426. 48 Antczak M , Van Blerkom J. 1997. Oocyte influences on early development: the regulatory proteins leptin and Stat-3 are polarized in mouse and human oocytes and differentially distributed within the cells of the pre-implantation embryo. Mo l Hum Reprod3, 1067-1086. Antonsson B. 2001. Bax and other pro-apoptotic Bcl-2 family "killer-proteins" and their victim, the mitochondrion. Cell Tiss Res 306, 347-361. Antonsson B, Montessuit S, Lauper S, Eskes R, Martinou JC. 2000. Bax oligomerization is required for channel-forming activity in liposomes and to trigger cytochrome c release from mitochondria. Biochem J 345, 271-278. Antonsson B , Montessuit S, Sanchez B, Martinou J-C. 2001. Bax is present as a high molecular weight oligomer/complex in the mitochondrial membrane of apoptotic cells. J Biol Chem276, 11615-11623. Arndt-Jovin DJ, Jovin T M . 1977. Analysis and sorting of living cells according to deoxyribonucleic acid content. J Histochem Cytochem 25, 585-589. Ax R L , Dickson K , Lenz RW. 1985. Induction of acrosome reactions by chondroitin sulfates in vitro corresponds to non-return rates of dairy bulls. J Dairy Sci 68, 387-390. Ax RL , Lenz RW. 1986. Laboratory procedures to assess fertility of bulls. Proc 11 t h Tech Conf Artif Insem Reprod. Natl Assn Anim Breeders pp 80-83. Aziz N , Fear S, Taylor C, Kingsland CR, Lewis-Jones DI. 1998. Human sperm head morphometric distribution and its influence on human fertility. Fertil Steril 70, 883-891. Bahr JF, Engler WF. 1970. Consideration of volume, mass, D N A and arrangement of mitochondria in the midpiece of bull spermatozoa. Expl Cell Res 60, 338-340 Bailey JL, Robertson L , Buhr M M . 1994. Relationships among in vivo fertility, computer analyzed motility and in vitro C a 2 + flux in bovine spermatozoa. Can J Anim Sci 74, 53-58. Bakau B , Horwich A L. 1998. The Hsp70 and Hsp60 chaperone machines? Cell 92, 351-366. Baldi E, Luconi M , Bonaccorsi L , Forti G. 2002. Signal transduction pathways in human spermatozoa. J Reprod Immunol 53, 121-131. 49 Bartol FF, Roberts R M , Bazer FW, Lewis GS, Godkin ID, Thatcher WW. 1985. Characterization of proteins produced in vitro by peri-attachment bovine conceptuses. Biol Reprod 32, 681-693. Beckmann RP, Mizzen L A , Welch WJ. 1990. Interaction of Hsp70 with newly synthesized proteins: implications for protein folding and assembly. Science 248, 850-854. Beere H M , Wolf B B , Cain K , Mosser DD, Mahboubi A , Kuwana T, Tailor P, Morimoto RI, Cohen G M , Green D. 2000. Heat shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol 2, 469-475. Bellin M E , Hawkins HE, Somoza JN, Ax RL. Sperm from high fertility bulls contain high affinity heparin binding proteins. Biol Reprod 1993;48(Suppl l):108a. Ben-Yosef D, Shalgi R. 1998. Early ionic events in activation of the mammalian egg. Rev Reprod 3, 96-103. Ben-Yosef D, Shalgi R. 2001. Oocyte activation: lessons from human infertility. Trends i n M o l Med 7, 163-169. Bennett MR. 1999. Mechanisms of p53 induced apoptosis. Biochemical Pharmacology 58, 1089-1095. Bennett M , Macdonald K , Chan SW, Luzio JP, Simari R, Weissberg P. 1998. Cell surface trafficking of Fas: a rapid mechanism of p53-mediated apoptosis. Science 282, 290-293. Biggers ID, Bell JE, Benos DJ. 1988. Mammalian blastocyst: transport functions in a developing epithelium. Am J Physiol 255, C419-C432. Bishop M W H , Salsibury GW. 1955. Effect of sperm concentration on the oxygen uptake of bull semen. A m J Physiol 180, 107-112. Blagosklonny M V . 2001. Unwinding the loop of Bcl-2 phosphorylation. Leukemia 15, 869. Blom E, Birch-Andersen A. 1960. The ultrastructure of the bull sperm. I. The middle piece. Nord Vet Med 12, 261-279. Blom E, Birch-Andersen A . 1961. An apical body in the Glea Capitis of the normal bull sperm. Nature (London) 190, 1127-1128. 50 Blom E, Birch-Andersen A. 1965. The ultrastructure of the bull sperm. II. The sperm head. Nord Vet Med 17, 193-212. Bloom SE, Muscarella DE. 1998. Stress responses in the avian early embryo: regulation by pro- and anti-apoptotic cell death genes. Poult Avian Biol Rev 9, 43-45. Boatman DE, Andrews JC, Bavister BD. 1988. A quantitative assay for capacitation: Evaluation of multiple sperm penetration through the zona pellucida of salt-stored hamster eggs. Gamete Res 19, 19-29. Boatman DE, Robbins RS. 1991. Bicarbonate: carbon-dioxide regulation of sperm capacitation, hyperactivated motility, and acrosome reactions. Biol Reprod 44, 806-813. Bochenek M , Smorag Z, Pilch J. 2001. Sperm chromatin structure assay of bulls qualified for artificial insemination. Theriogenology 56, 557-567. Bonaccorsi L , Krausz C, Pecchioli P, Forti G, Baldi E. 1998. Progesterone-stimulated intracellular calcium increase in human spermatozoa is calcium-independent. Mol . Hum. Reprod. 4, 259-268. Bookbinder L H , Cheng A , Bleil JD. 1995. Tissue and species-specific expression of sp56, a mouse sperm fertilization protein. Science 269, 86-89. Bou S, Hanada A. 1985. Penetration of zona-free hamster eggs in-vitro by ejaculated goat spermatozoa after treatment with ionophore A-23187. Japanese J Anim Reprod 31, 115-121. Bousquet D, Brackett B G . 1982. Penetration of zona-free hamster ova as a test to assess fertilizing ability of bull sperm after frozen storage. Theriogenology 17, 199-212. Bousquet D, Brackett B G , Dressel M A , Allen CH. 1983. Efforts to correlate laboratory with field observations on bull sperm fertility. Theriogenology 20, 601-611. Brackett B G , Bouquet D, Boice M L , Donawich WJ, Evans JF, Dressel M A . 1982a. Normal development following in vitro fertilization of bovine follicular oocytes. Biol Reprod 28,717-725. Brackett B G , Cofone M A , Boice M L , Bousquet D. 1982b. Use of zona-free hamster ova to assess sperm fertilizing ability of bull and stallion. Gamete Res 5, 217-227. Branton C, James CB, Patrick TE, Newsom M H . 1951. The relationship between certain semen quality tests and fertility and the interrelationship of these tests. J Dairy Sci 34,310-316. 51 Breitbart H . 2002. Role and regulation of intracellular calcium in acrosomal exocytosis. J Reprod Immunol 53, 151-159. Breitbart H , Naor Z. 1999. Protein kinases in mammalian sperm capacitation and the acrosome reaction. Rev Reprod 4, 151-159. Brewis IA, Wong CH. 1999. Gamete recognition: sperm proteins that interact with the egg zona pellucida. Rev Reprod 4, 135-142. Buckbinder L , Talbott R, Velascomiguel S, Takenaka I, Faha B, Seizinger B , Kley N . 1995. Induction of the growth inhibitor IGF-binding protein-3 by p53. Nature 377, 646-649. Budworth PR, Amann RP, Hammerstedt R H . 1988. Relationship between computerized measurement of frozen thawed spermatozoa and fertility. J Androl 9, 41-54. Buhr M M , Zhao Y . 1995. Cryopreservation damages specific enzymes in bull sperm. Dairy Research Report. University of Guelph, Ontario Ministry of Agriculture, Food and Rural Affairs, Agriculture and Agri-Food Canada pp 40-41. Burks DJ, Carballada R, Moore H D M , Saling P M . 1995. A tyrosine kinase from human sperm interacts with the zona pellucida at fertilization. Science 269 83-86. Buzzard K A , Giaccia AJ , Killender M , Anderson RL. 1998. Heat shock protein 72 modulates pathways of stress induced apoptosis. J Biol Chem 273, 17147-17153. Byrne AT, Southgate J, Brison DR, Leese HJ. 1999. Analysis of apoptosis in the preimplantation bovine embryo using TUNEL. J Reprod Fertil 117, 97-105. Canman CE, Kastan M B . 1998. Small contribution of G l checkpoint control manipulation to modulation of p53-mediated apoptosis. Oncogene 16, 957-966. Carrera A , Moos J, Ning XP, Gerton GL, Tesarik J, Kopf GS, Moss SB. 1996. Regulation of protein tyrosine phosphorylation in human sperm by a calcium/calmodulin-dependent mechanism: identification of A kinase anchor proteins as major substrates for tyrosine phosphorylation. Dev Biol 180, 284-296. Chandolia R K , Peltier MR, Tian W, Hansen PJ. 1999. Transcriptional control of development, protein synthesis, and heat-induced heat shock protein 70 synthesis in 2-cell bovine embryos. Biol Reprod 61, 1644-1648. 52 Chen J, Flannery JG, LaVail M M , Steinberg RH, Xu J, Simon MI. 1996. bcl-2 overexpression reduces apoptotic photoreceptor cell death in three different retinal degenerations. Proc Natl Acad Sci U S A 93, 7042-7047. Chen J, Litscher ES, Wassarman P M . 1998. Inactivation of the mouse sperm receptor, mZP3, by site-directed mutagenesis of individual serine residues located at the combining-site for sperm. Proc Natl Acad Sci U S A 95, 6193-6197. Chen M , Wang J. 2002. Initiator caspases in apoptosis signaling pathways. Apoptosis 7, 313-319. Chen Y , Cann MJ , Litvin TN, Iourgenko V , Sinclair M L , Levin LR, Buck J. 2000. Soluble adenylyl cyclase as an evolutionarily conserved bicarbonate sensor. Science 289, 625-628. Cheng EH-Y, Kirsch DG, Clem RJ, Ravi R, Kastan M B , Bedi A , Ueno K , Hardwick JM. 1997. Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 278, 1966-1968. Cherr G N , Ducibella T. 1990. Activation of mammalian egg: cortical granule distribution, exocytosis, and block to polyspermy. In Bovister BD, Cummins J, Roldan ERS. (eds.), Fertilization in Mammals. Serono Symposia USA, Norwell, M A . pp. 309-330. Chian RC, Nakahara H , Niwa K , Funahashi H . 1992. Fertilization and early cleavage in vitro of aging bovine oocytes after maturation in culture. Theriogenology 37, 665-672. Cho C, Bunch DO, Faure JE,.Goulding EH, Eddy E M , Primakoff P, Myles DG. 1998. Fertilization defects in sperm from mice lacking fertilin beta. Science 281, 1857-1859. Cory S, Adams JM. 2002. The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2, 647-656. Creagh E M , Carmody RJ, Cotter TG. 2000. Heat shock protein 70 inhibits caspase-dependent and -independent apoptosis in Jurkat T cells. Exp Cell Res 257, 58-66. Crister JK, Noiles EE. 1993. Bioassays of sperm function. Semin Reprod Endocrinol 11, 1-16. Cross N L . 1996. Human seminal plasma prevents sperm from becoming acrosomally responsive to the agonist, progesterone: cholesterol is the major inhibitor. Biol Reprod 54, 138-145. 53 Cross N L , Mahasreshti P. 1997. Prostasome fraction of human seminal plasma prevents sperm from becoming acrosomally responsive to the agonist progesterone. Arch Androl 39, 39-44. Cross N L , Meizel S. 1989. Methods for evaluating the acrosomal status of mammalian spermatozoa. Biol Reprod 41, 635-641. Cummins JM, Pember S M , Jequier A M , Yovich JL, Hartmann PE. 1991. A test of the human sperm acrosome reaction following ionophore challenge: Relationship to fertility and other seminal parameters. J Androl 12, 98-103. Cummins JM, Woodall PF. 1985. On mammalian sperm dimensions. J Reprod Fertil 75, 153-175. Dalton JC, Nadir S, Bame JH, Noftsinger M , Nebel RL, Saacke RG. 2001. Effect of time of insemination on number of accessory sperm, fertilization rate, and embryo quality in nonlactating dairy cattle. J Dairy Sci 84, 2413-2418. DasGupta S, Mills C L , Fraser LR. 1993. Ca(2+)-related changes in the capacitation state of human spermatozoa assessed by a chlortetracycline fluorescence assay. J Reprod Fertil 99, 135-143. Daugas E, Susin SA, Zamzami N , Ferri K F , Irinopoulou T, Larochette N , Prevost M C , Leber B , Andrews D, Penninger J, Kroemer G. 2000. Mitochondrio-nuclear translocation of AIF in apoptosis and necrosis. FASEB J 14, 729-739. de Lamirande E, Leclerc P, Gagnon C. 1997. Capacitation as a regulatory event that primes spermatozoa for the acrosome reaction and fertilization. Mol Hum Reprod 3, 175-194. Demmers K J , Derecka K , Flint A . 2001. Trophoblast interferon and pregnancy. Reproduction 121,41-49 Deveraux QL, Takahashi R, Salvesen GS, Reed JC. 1997. X-linked IAP is a direct inhibitor of cell death proteases. Nature 388, 300-303. Deveraux QL, Roy N , Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula S M , Alnemri ES, Salvesen GS, Reed JC. 1998. IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. E M B O J 17, 2215r2223. Deveraux QL, Reed JC. 1999. IAP family proteins-suppressors of apoptosis. Genes Dev 13,239-252. 54 Dransfield M B G , Nebel RL , Pearson RE, Warnick L D . 1998. Timing of insemination for dairy cows identified in estrus by a radiotelemetric estrus detection system. J Dairy Sci 81, 1874-1882. Ducibella T. 1996. The cortical reaction and development of activation competence in mammalian oocytes. Hum Reprod Update 2, 29-42. Ducibella T, Kurasawa S, Duffy P, Kopf GS. 1993. Regulation of the polyspermy block in the mouse egg: maturation-dependent differences in cortical granule exocytosis and zona pellucida modifications induced by inositol 1,4,5-trisphosphate and an activator of protein kinase-C. Biol Reprod 48, 1251-1257. Edwards R G , Beard HK. 1997. Oocyte polarity and cell determination in early mammalian embryos. Mol Hum Reprod 3, 863-905. Eisenbach M . 1999. Mammalian sperm chemotaxis and its association with capacitation. Developmental Genetics 25, 87-94. Ekegren T, Grundstrom E, Lindholm D, Aquilonius SM. 1999. Upregulation of Bax protein and increased D N A degradation in A L S spinal cord motor neurons. Acta Neurol Scand 100,317-321. Eliyahu E, Talmor-Cohen A , Shalgi R. 2002. Signaling through protein kinases during egg activation. J Reprod Immunol 53, 161-169. Elliot FI. 1978. Significance of sperm quality. In Salisbury GW, Van Demark N L , Lodge JR (eds): "Physiology of Reproduction and artificial insemination of cattle" 2 n d ed., San Francisco: W H Freeman & Co. pp. 428-441. Emond V , Asselin E, Fortier M A , Murphy BD, Lambert RD. 2000. Interferon-tau stimulates granulocyte-macrophage colony-stimulating factor gene expression in bovine lymphocytes and endometrial stromal cells. Biol Reprod 62, 1728-1737. Erb.RE, Ehlers M H . 1950. Resazurin reduction time as an indicator of bovine sperm fertilizing capacity. J Dairy Sci 33, 853-864. Exley GE, Tang C, McElhinny AS, Warner C M . 1999. Expression of caspase and B C L 2 apoptotic family members in mouse preimplantation embryos. Biol Reprod 61, 231-239. Eyestone W H , First N L . 1989. Variation in bovine embryo development in vitro due to bulls. Theriogenology 31, 191. 55 Ezashi T, Ealy A D , Ostrowski M C , Roberts R M . 1998. Control of interferon-t gene expression by Ets-2. Proc Natl Acad Sci U S A 95, 7882-7887. Fazeli AR, Holt C, Steenweg W, Bevers M M , Holt W V , Colenbrander B. 1995. Development of a sperm hemizona binding assay for boar semen. Theriogenology 44, 17-27. Fazeli AR, Steenweg W, Bevers M M , deLoos F A M , van der Broek J, Colebrander B . 1993. Development of a spermatozoa zona binding assay for bull semen. Vet Rec 132, 14-16. Feng H , Sandlow JI, Sandra A. 1998. The c-kit receptor and its possible signaling transduction pathway in mouse spermatozoa. Mol . Reprod. Dev. 49, 317-326. Feng Y , Gordon JW. 1996. Birth of normal mice after removal of the supernumerary male pronucleus from polyspermic zygotes. Hum Reprod 11, 341-344. Flechon JE, Pavlok A . 1986. Ultra structural study of the interactions and fusion of ram spermatozoa with zone-free hamster oocytes. Reprod Nutri, Dev 26, 999-1008. Florman H M , Arnoult C, Kasam IG, Chongqing L , O'Toole C M B . 1998. A perspective on the control of mammalian fertilization by egg-activated ion channels in sperm: a tale of two channels. Biol Reprod 59, 12-16. Foote R H . 2003. Effect of processing and measuring procedures on estimated sizes of bull sperm heads. Theriogenology 59, 1675-1773. Fuentes-Mascorro G, Serrano H , Rosado A . 2000. Sperm chromatin. Arch Androl 45, 215-225. Gabai V L , Yaglom JA, Volloch V , Meriin A B , Force T, Koutroumanis M , Massie B , Mosser DD, Shermanet M Y . 2000. Hsp72 mediated suppression of c-Jun N-terminal Kinase is implicated in development of tolerance to caspase-independent cell death. M o l Cell Biol 20, 6826-6836 Galantino-Homer H , Visconti PE, Kopf GS. 1997. Regulation of protein tyrosine phosphorylation during bovine sperm capacitation by a cyclic adenosine 3',5'-monophosphate-dependent pathway. Biol Reprod 56, 707-719. Gardner R L . 1983. Origin and differentiation of extra-embryonic tissues in the mouse. Int Rev Pathol 24, 63-133. 56 Garty N B , Salomon Y . 1987. Stimulation of partially purified adenylate cyclase from bull sperm by bicarbonate. FEBS Lett 218, 148-152. Giaccia A J , Kastan M B . 1998. The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev 12, 2973-2983. Godkin ID, Bazer FW, Moffat J, Sessions F, Roberts R M . 1982. Purification and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts at day 13-21. J Reprod Fertil 65, 141-150. Godkin JD, Smith SE, Johnson RD, Dore JJE. 1997. The role of trophoblast interferons in the maintenance of early pregnancy in ruminants. A m J Reprod Immunol 37, 137-143. Gordon I, Lu K H . 1990. Production of embryos in vitro and its impact on livestock production. Theriogenology 33, 77-88. Gordon JW, Grunfeld L , Garrisi GJ. 1989. Successful microsurgical removal of a pronucleus from tripronuclear human zygotes. Fertil Steril 52, 367. Graham CF, Deussen ZA. 1978. Features of cell lineage in preimplantation mouse embryo development. J Embryol Exp Morphol 48, 53-72. Graham JK, Foote R H . 1987a. Dilauroylphosphatidylcholine liposome effects on the acrosome reaction and in vitro penetration of zona-free hamster eggs by bull spermatozoa: I. A fertility assay for fresh semen. Gamete Res 16, 133-145. Graham JK, Foote R H . 1978b. Dilauroylphosphatidylcholine liposome effects on the acrosome reaction and in vitro penetration of zona-free hamster eggs by bull spermatozoa: II. A fertility assay for frozen-thawed semen. Gamete Res 16, 147-158. Gravance CG, Vishwanath R, Pitt C, Casey PJ. 1996. Computer automated morphometric analysis of bull sperm heads. Theriogenology 46, 1205-1215. Grisart B , Massip A , Dessy F. 1994. Cinematographic analysis of bovine embryo development in serum-free oviduct-conditioned medium. J Reprod Fertil 101, 257-264. Griveau JF, Dumont E, Renard P, Le Lannou D. 1995. An in-vitro promoting role for hydrogen peroxide in human sperm capacitation. Int. J. Androl. 17, 300-307. Gross A , Jockel J, Wei M C , Korsmeyer SJ. 1998. Enforced dimerization of B A X results in its translocation, mitochondrial dysfunction and-apoptosis. E M B O J 17, 3878-3885. 57 Gross M K , Toscano DG, Toscano W A Jr. 1987. Calmodulin-mediated adenylate cyclase from mammalian sperm. J Biol Chem 262, 8672-8676. Guesdon F, Stewart HJ, Flint APF. 1996. Negative regulatory domains in a trophoblast interferon promoter. J Mo l Endocrinol 16, 99-106. Haaf T, Ward DC. 1995. Higher order nuclear structure in mammalian sperm revealed by in situ hybridization and extended chromatin fibers. Exp Cell Res 219, 604-611. Hafez ESE. 1987. Semen evaluation in Hafez ESE (ed): "Reproduction in Farm Animals". Philadelphia: Lea and Febiger, pp. 455-480. Haldar S, Jena N , Croce C M . 1995. Inactivation of Bcl-2 by phosphorylation. Proc Natl Acad Sci U S A 92, 4507-4511. Hammerstedt RH, Graham JK, Nolan J. 1990. Cryopreservation of mammalian sperm: what we ask them to survive. J Androl 11, 73-88. Hardy D M , Garbers DL . 1995. A sperm membrane protein that binds in a species-specific manner to the egg extracellular matrix is homologous to von Willebrand factor. J Biol Chem 270, 26025-26028. Hardy K . 1997. Cell death in the mammalian blastocyst. Mol Hum Reprod 3, 919-925. Haupt Y , Rowan S, Shaulian E, Vousden K H , Oren M . 1995. Induction of apoptosis in HeLa cells by trans-activation-deficient p53. Genes Dev 9, 2170-2183. Hay-Schmidt A , Viuff D, Greve T, Hyttel P. 2001. Transcriptional activity in in-vivo developed early cleavage stage bovine embryos. Theriogenology 56, 167-176. Hernandez-Ledezma JJ, Mathialagan N , Villanueva C, Sikes JD, Roberts R M . 1993. Expression of bovine trophoblast interferons by in vitro-derived blastocysts is correlated with their morphological quality and stage of development. Mo l Reprod Dev 36, 1-6. Hillery FL , Parrish JJ, First N L . 1990. Bull specific effect on fertilization and embryo development in vitro. Theriogenology 33, 249. Holm P, Booth PJ, Callesen H . 2002. Kinetics of early in vitro development of bovine in vivo- and in vitro-derived zygotes produced and/or cultured in chemically defined or serum-containing media. Reproduction 123, 553-565. Holm P, Shukri N N , Vajta G, Booth P, Bendixen C, Callesen H . 1998. Developmental kinetics of the first cell cycles of bovine in vitro produced embryos in relation to their in vitro viability and sex. Theriogenology 50, 1285-1299. 58 Hoodbhoy T, Dean J. 2004. Insights into the molecular basis of sperm-egg recognition in mammals. Reproduction 127, 417-422. Hopee PC, Illmensee K . 1977. Microsurgically produced homozygous-diploid uniparental mice. Proc Natl Acad Sci USA 74, 5657-5661. Hsu Y T , Youle RJ. 1998. Bax in murine thymus is a soluble monomeric protein that displays differential detergent-induced conformations. J Biol Chem 273, 10777-10783. Hsu Y T , Wolter K G , Youle RJ. 1997. Cytosol-to-membrane redistribution of Bax and Bcl-X(L) during apoptosis. Proc Natl Acad Sci U S A 94, 3668-3672. Huang DC, Strasser A . 2000. BH3-Only proteins-essential initiators of apoptotic cell death. Cell 103, 839-842. Hunter RHF, Rodriguez-Martinez H . 2004. Capacitation of mammalian spermatozoa in vivo, with a specific focus on events in the fallopian tubes. Mol Reprod Dev 67, 243-250. Hyttel P, Callesen H , Greve T. 1989. A comparative ultrastructural study of in vivo versus in vitro fertilization of bovine oocytes. Anat Embryol 179, 435-442. Hyttel P, X u K P , Greve T. 1988. Ultrastructural abnormalities of in vitro fertilization of in vitro matured bovine oocytes. Anat Embryol 178, 47-52. Hyttel P, X u KP, Smith S, Greve T. 1986. Ultrastructure of in vitro oocyte maturation in cattle. J Reprod Fertil 78, 615-625. Imai H , Niwa K , Iritani A . 1980. Ultrastructural observations of boar spermatozoa penetrating zona-free hamster eggs. Biol Reprod 23, 481-486. Imakawa K , Helmer SD, Nephew KP, Meka CSR, Christenson R K . 1993. A novel role for G M - C S F : enhancement of pregnancy specific interferon production, ovine trophoblast protein-1. Endocrinology 132, 1869-1871. Ingo S, Sabine K , Peter K H . 2000. Regulation of death receptor-mediated apoptosis pathways. Int J Biochem Cell Biol. 32, 1123-1136. Iwasaki S, Shioya Y , Masuda H , Hanada A, Nakahara T. 1989. Incidence of chromosomal anomalies in early bovine embryos derived from in vitro fertilization. Gamete Res 22, 83-91. 59 Jaattela M , Wissing D, Kokholm K , Kallunki T, Egeblad M . 1998. Hsp70 exerts its anti-apoptotic function downstream of caspase-3-like proteases. E M B O J 17, 6124-6134. Jaiswal BS, Cohen-Dayag A, Tur-Kaspa I, Eisenbach M . 1998. Sperm capacitation is, after all, a prerequisite for both partial and complete acrosome reaction. FEBS Lett 427, 309-313. Jaiswal BS, Eisenbach M , Tur-Kaspa I. 1999. Detection of partial and complete acrosome reaction in human sperm: which inducers and probes to use? M ol Hum Reprod 5, 214-219. Januskauskas A , Johannisson A, Soderquist L, Rodriguez-Martinez H . 2000. Assessment of sperm characteristics post-thaw and response to calcium ionophore in relation to fertility in Swedish dairy A l bulls. Theriogenology 53, 859-875. Jin S, Levine AJ . 2001. The p53 functional circuit. J Cell Sci 114, 4139-4120. Johnson GA, Spencer TE, Hansen TR, Austin KJ , Burghardt RC, Bazer FW. 1999. Expression of the interferon tau inducible ubiquitin cross-reactive protein in the ovine uterus. Biol Reprod 61, 312-318. Johnson G A , Stewart M D , Gray CA, Choi Y , Burghardt RC, Yu-Lee L Y , Bazer FW, Spencer TE. 2001. Effects of the estrous cycle, pregnancy, and interferon tau on 2',5'-oligoadenylate synthetase expression in the ovine uterus. Biol Reprod 64, 1392-1399. Johnson M H , Ziomek C A . 1981. The foundation of two distinct cell lineages within the mouse morula. Cell 24, 71-80. Johnston DS, Wright WW, Shaper JH, Hokke C H , Van den Eijnden D H , Joziasse D H . 1998. Murine sperm-zona binding, a fucosyl residue is required for a high affinity sperm-binding ligand. J Biol Chem 273, 1888-1895. Jones K T , Nixson V L . 2000. Sperm-induced C a 2 + oscillations in mouse oocytes and eggs can be mimicked by photolysis of caged inositol 1,4,5-trisphosphate: evidence of inositol 1,4,5-trisphosphate during mammalian fertilization. Dev Biol 225, 1-12. Jurisicova A , Antenos M , Varmuza S, Tilly JL, Casper RF. 2003. Expression of apoptosis-related genes during human preimplantation embryo development: Potential roles for the Harakiri gene product and caspase-3 in blastomere fragmentation. M o l Hum Reprod 9, 133-141. 60 Jurisicova A , Latham K E , Casper RF, Varmuza SL. 1998. Expression and regulation of genes associated with cell death during murine preimplantation embryo development. Mol Reprod Develop 51, 243-253. Kaji K , Kudo A. 2004. The mechanism of sperm-oocyte fusion in mammals. Reproduction 127, 423-429. Kasof G M , Gomes BC. 2001. Livin, a novel inhibitor of apoptosis protein family member. J Biol Chem 276, 3238-3246. Kelly SJ, Mulnard JG, Graham CF. 1978. Cell division and cell allocation in early mouse development. J Embryol Exp Morphol 48, 37-51. Kerr JFR, Wyllie A H , Currie AR. 1972. Apoptosis: a basic phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26, 239-257. Keskintepe L , Brackett B G . 1996. In vitro developmental competence of in vitro-matured bovine oocytes fertilized and cultured in completely defined media. Biol Reprod 55, 333-339. King W A . 1991. Embryo-mediated pregnancy failure in cattle. Can Vet J 32, 99-103. Kinloch R M , Sakai Y , Wassarman P M . 1995. Mapping the mouse ZP3 combining site for sperm by exon swapping and site directed mutagenesis. Proc Natl Acad Sci U S A 92, 263-267. Kjaestad TG, Stubbings RB. 1992. Sire and insemination dose does effect in vitro fertilization of bovine oocytes. Theriogenology 37, 240. Koheler JK. 1970. A freeze-etching study of rabbit spermatozoa with particular reference to head structure. J Ultrastruct Res 33, 598-614. Koheler JK, Wurschmidt U , Larsen MP. 1983. Nuclear and chromatin structure in rat spermatozoa. Gamete Res 8, 357-370. Kolle S, Stojkovic M , Boie G, Wolf E, Sinowatz F. 2002. Growth hormone inhibits apoptosis in in-vitro produced bovine embryos. Mol Reprod Dev 61, 180-186. Korsmeyer SJ, Shutter JR, Veis DJ, Merry DE, Oltvai Z N . 1993. Bcl-2/Bax a rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 4, 327-332. Kothakota S, Azuma T, Reinhard C, Klippel A , Tanf J, Chu K , McGarry TJ, Kirschner M W , Koths K , Kwiatkowski DJ, Williams LT. 1997. Caspase-3-generated fragment of gelsolin: effector of morphological change in apoptosis. Science 278, 294-298. 61 Krajewski S, Mai JK, Krajewska M , Sikorska M , Mossakowski MJ , Reed JC. 1995. Upregulation of bax protein levels in neurons following cerebral ischemia. J Neurosci 15, 6364-6376. Krajewski S, Tanaka S, Takayama S, Schibler MJ , Fenton W, Reed JC. 1993. Investigation of the subcellular distribution of the bcl-2 oncoprotein: residence in the nuclear envelope, endoplasmic reticulum, and outer mitochondrial membranes. Cancer Res 53, 4701-4714. Kreysing U , Nagai T, Niemann H. 1997. Male-dependent variability of fertilization and embryo development in two bovine in vitro fertilization systems and the effects of casein phospholipids (CPPs). Reprod Fertil Dev 9, 465-474. Kruip T A M , Wurth Y A , Boni R, Roelofsen M W M , Pieterse M C . 1992. Embryo production in vitro: The promising future for cattle breeding. Mededelingen van de Faculteit Landbouwwetenschappen Universiteit Gent. 57(4 PART A-B) , 1807-1810. Kuwana T, Mackey MR, Perkins G, Ellisman M H , Latterich M , Schneiter R, Green DR, Newmeyer DD. 2002. Bid, Bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell 111, 331-342. Lalich R A , Vedantham S, McCormick N , Wagner C, Prins GS. 1989. Relationship between heparin binding characteristics and ability of human spermatozoa to penetrate hamster ova. J Reprod Fertil 86, 297-302. Lane DP. 1992. p53, guardian of the genome. Nature 358, 15-16. Laurincik J, Thomsen PD, Hay-Schmidt A , Avery B, Greve T, Ochs RL , Hyttel P. 2000. Nucleolar proteins and nuclear ultrastructure in preimplantation bovine embryos produced in vitro. Biol Reprod 62, 1024-1032. Lechniak D. 1996. The incidence of polyploidy and mixoploidy in early bovine embryos derived from in vitro fertilization. Genet Select evol 28, 321-328. Leclerc P, de Lamirande E, Gagnon C. 1996. Cyclic adenosine 3'5'monophosphate-dependent regulation of protein tyrosine phosphorylation in relation to human sperm capacitation and motility. Biol Reprod 55, 684-692. Lee C N , Handrow RR, Lenz RW, Ax RL. 1985. Interactions of seminal plasma and glycosaminoglycans on acrosome reaction in bovine spermatozoa in vitro. Gamete Res 12, 345-355. 62 Lee M A , Storey BT. 1986. Bicarbonate is essential for fertilization of mouse eggs: mouse sperm require it to undergo the acrosome reaction. Biol. Reprod. 34, 349-356. Lefebvre R. Suarez SS. 1996. Effect of capacitation on bull sperm binding to homologous oviductal epithelium. Biol Reprod 54, 575-582. Levine AJ . 1997. p53, the cellular gatekeeper for growth and division. Cell 88, 323. L i C Y , Lee JS, Ko Y G , Kim J, and Seo JS. 2000. Hsp70 inhibits apoptosis downstream of cytochrome c release and upstream of caspase-3 activation. J Biol Chem 275, 25665-25671. L i L Y , Luo X , Wang X . 2001. Endonuclease G is an apoptotic DNase when released from mitochondria. Nature 412, 95-99. Linette GP, L i Y , Roth K , Korsmeyer SJ. 1996. Cross talk between cell death and cell cycle progression: Bcl-2 regulates NFAT-mediated activation. Proc Natl Acad Sci U S A 93, 9545. Litscher ES, Wassarman P M . 1996. Characterization of a mouse ZP3-derived glycopeptide, gp55, that exhibits sperm receptor and acrosome reaction-inducing activity in vitro. Biochemistry 35, 3980-3985. Litscher ES, Juntunen K , Seppo A , Penttila L , Niemela R, Renkonen O, Wassarman P M . 1995. Oligosaccharide constructs with defined structures that inhibit binding of mouse sperm to unfertilized eggs in vitro. Biochemistry 34, 4662-4669. Liu HC, He Z Y , Mele CA, Veeck L L , Davis O, Rosenwaks Z. 2000. Expression of apoptosis-related genes in human oocytes and embryos. J Assist Reprod Genet 17, 521-533. Livolant F. 1983. Cholesteric organization of D N A in the stallion sperm head. Tiss Cell 16, 535-555. Lohrum M A , Vousden K H . 1999. Regulation and activation of p53 and its family members. Cell Death Differ 6, 1162-1168. Long CR, Chase C N , Balise JJ, Duby RT, Robl JM. 1993. Effect of sperm removal time, sperm concentration and motility enhancers on fertilization parameters and development of bovine embryos in vitro. Theriogenology 39, 261. 63 Long CR, Damiani C, Pinto-Correia C, MacLean RA, Duby RT, Robl JM. 1994. Morphology and subsequent development in culture of bovine oocytes matured in vitro under various conditions of fertilization. J Reprod Fertil 102, 361-369. Longo FJ, Chen D Y . 1984. Development of surface polarity in mouse eggs. Scanning Electron Microscopy 2, 703-716. Lu Q, Shur BD. 1997. Sperm from pi,4-galactosyltransferase-null mice are refractory to ZP3-induced acrosome reactions and penetrate the zona pellucida poorly. Development 124, 4121-4131. Luconi M , Barni T, Vannelli GB, Krausz C, Marra F, Benedetti PA, Evangelista V , Francavilla S, Properzi G, Forti G, Baldi E. 1998. Extracellular-signal regulated kinases modulate capacitation of human spermatozoa. Biol. Reprod. 58, 1476-1489. Luconi M , Krausz C, Forti G, Baldi E. 1996. Extracellular calcium negatively modulates tyrosine phosphorylation and tyrosine kinase activity during capacitation of human spermatozoa. Biol Reprod 55, 207-216. Macnutt TL. 1990. The influence of oviduct and follicular fluid on bovine spermatozoa during in vitro capacitation. Perm State Univ., USA., PhD thesis. Mahajan NP, Linder K , Berry G, Gordon GW, Heim R, Herman B. 1998. Bcl-2 and Bax interactions in mitochondria probed with green fluorescent protein and fluorescence resonance energy transfer. Nat Biotechnol 16, 547-552. Malter HE, Cohen J. 1989. Embryonic development after microsurgical repair of polyspermic human zygotes. Fertility and Sterility 52, 373-379. Marchenko ND, Zaika A , Mol l U M . 2000. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J Biol Chem 275, 16202-16212. Marks JL, Ax RL. 1985. Relationship of non-return rates of dairy bulls to binding affinity of heparin to spermatozoa. J Dairy Sci 68, 2078-2082. Marquant-Le Guienne B, Humblot P, Thibier M , Thibault C. 1990. Evaluation of bull semen fertility by homologous in vitro fertilization tests. Reprod Nutr Dev 30, 259-266. Martus NS, Verhage HG, Mavrogianis PA, Thibodeaux JK. 1997. Enhanced in-vitro development of bovine embryos in the presence of a bovine oviductal specific glycoprotein. Theriogenology 47, 334. 64 Matwee Christie, Betts Dean H , King W Allan. 2000. Apoptosis in the early bovine embryo. Zygote 8, 57-68. Maundrell K , Antonsson B, Magnenat E, Camps M , Muda M , Chabert C, Gillieron C, Boschert U , Vial-Knecht E, Martinou JC, Arkinstall S. 1997. Bcl-2 undergoes phosphorylation by c-Jun N-terminal kinase/stress-activated protein kinases in the presence of the constitutively active GTP-binding protein Racl . J Biol Chem 272, 25238. Mazel S, Burtrum D, Petrie HT. 1996. Regulation of cell division cycle progression by bcl-2 expression: a potential mechanism for inhibition of programmed cell death. J Exp Med 183,2219-2226. McGrath J, Solter D. 1983. Nuclear transplantation in the mouse embryo by microsurgery and cell fusion. Science 220, 1300. McLesky SB, Dowds C, Carbadalla R, White RR, Saling P M . 1998. Molecules involved in mammalian sperm-egg interaction. Int Rev Cytol 177, 57-113. Melrose DR, Terner C. 1953. The metabolism of pyruvate in bull spermatozoa. Biochem J 53, 296-305. Mihara M , Erster S, Zaika A , Petrenko O, Chittenden T, Pancoska P, Mol l U M . 2003. p53 Has a Direct Apoptogenic Role at the Mitochondria. Mol Cell 11, 577-590. Mikhailova V , Mikhailova M , Pulkrabek DJ, Dong Z, Venkatachalam M A , Saikumar P. 2001. Bcl-2 prevents bax oligomerization in the mitochondrial outer membrane. J Biol Chem 276, 18361-18374. Miller BJ , Georges-Labouesse E, Primakoff P, Myles DG. 2000. Normal fertilization occurs with eggs lacking the integrin alpha6betal and is CD9-dependent. Journal of Cellular Biology 149, 1289-1296. Miller DJ, Ax R L . 1990. Carbohydrates and fertilization in animals. Mo l Reprod Dev 26, 184-198. Miller DJ, Winer M A , Ax RL. 1990. Heparin-binding proteins from seminal plasma bind to bovine spermatozoa and modulate capacitation by heparin. Biol Reprod 42, 899-915. Mirkes PE. 2002. To die or not to die, the role of apoptosis in normal and abnormal mammalian development. Teratology 65, 228-239. 65 Miyashita T, Kitada S, Krajewski S, Home WA, Delia D, Reed JC. 1995. Overexpression of the Bcl-2 protein increases the half-life of p21 Bax. J Biol Chem 270, 26049-26052. Miyashita T, Krajewski S, Krajewska M , Wang HG, Lin H K , Liebermann D A , Hoffman B , Reed JC. 1994. Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 9, 1799-1805. Miyashita T, Reed JC. 1995. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293-299. Modlinski JA. 1975. Haploid mouse embryos obtained by microsurgical removal of one pronucleus. J embryol Exp Morphol 33, 897-905. Mosser DD, Caron A W , Bourget L , Denis-Larose C, Massie B. 1997. Role of human heat shock protein hsp70 in protection against stress-induced apoptosis. M o l Cell Biol 17, 5317-5327. Muller M , Wilder S, Bannasch D, Israeli D, Lehlbach K , Li-Weber M , Friedman SL, Galle PR, Stremmel W, Oren M et al. 1998. p53 activates the CD95 (APO-l/Fas) gene in response to D N A damage by anticancer drugs. J Exp Med 188, 2033-2045. Murakami H , Pain D, Blobel G. 1988. 70-kD heat shock related protein is one of at least two distinct cytosolic factors stimulating protein import into mitochondria. J Cell Biol 107, 2051-2057. Nadir S, Saacke RG, Bame J, Mullins J, Degelos S. 1993. Effect of freezing semen and dosage of sperm on number of accessory sperm, fertility, and embryo quality in artificially inseminated cattle. J Anim Sci 71,199-204. Naor Z, Breitbart H . 1997. Protein kinase C and mammalian spermatozoa acrosome reaction. Trends Endocrinol. Metab. 8, 337-342. Naz R H . 1998. c-Abl proto-oncoprotein is expressed and tyrosine phosphorylated in human sperm cells. Mol . Reprod. Dev. 51, 210-217. Nechushtan A , Smith C L , Lamensdorf I, Yoon SH, Youle RJ. 2001. Bax and Bak coalesce into novel mitochondria-associated clusters during apoptosis. J Cell Biol 153, 1265-1276. 66 Neill JM, Olds-Clarke P. 1987. A computer-assisted assay for mouse sperm hyperactivation demonstrates that bicarbonate but not bovine serum albumin is required. Gamete Res 18, 121-140. Nishimura H , Cho C, Branciforte DR, Myles DG, Primakoff P. 2001. Analysis of loss of adhesive function in sperm lacking cyritestin or fertilin beta. Development Biology 233, 204-213. Niwa K , Park CK, Okuda K . 1991. Penetration in vitro of bovine oocytes during maturation by frozen-thawed spermatozoa. J Reprod Fertil 91, 329-336. Nollen E A , Brunsting JF, Roelofsen H, Weber L A , Kampinga H H . 1999. In vivo chaperone activity of heat shock protein 70 and thermo tolerance. Mo l Cell Biol 11, 2069-2079. Ohgoda O, Niwa K, Yuhara M , Takahashi S, Kanoya K. 1988. Variation in penetration rates in vitro of bovine follicular oocytes do not reflect conception rates after artificial insemination using frozen semen from different bulls. Theriogenology 29, 1375-1381. Okamura N , Tajima Y , Soejima A , Masuda H , Sugita Y . 1985. Sodium bicarbonate in seminal plasma stimulates the motility of mammalian spermatozoa through direct activation of adenylate cyclase. J Biol Chem 260, 9699-9705. Okamura N , Tajima Y , Sugita Y . 1988. Decrease in bicarbonate transport activities during epididymal maturation of porcine sperm. Biochem Biophys Res Commun 157, 1280-1287. Oltvai Z N , Milliman CL, Korsmeyer SJ. 1993. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609-619. O'Reilly L A , Huang DCS, Strasser A . 1996. The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. E M B O J 15, 6979-6990. Ostermeier GC, Sargeant GA, Yandell BS, Evenson DP, Parrish JJ. 2001. Relationship of bull fertility to sperm nuclear shape. J Androl 22, 595-603. Ott TL , Y i n J, Wiley A A , Kim HT, Gerami-Naini B, Spencer TE, Bartol FF, Burghardt RC, Bazer FW. 1998. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol Reprod 59, 784-794. 67 Pace M M , Graham EF. 1970. The release of glutamic oxaloacetic transaminase from bovine spermatozoa as a test method of assessing semen quality and fertility. Biol Reprod 3, 140-147. Parcellier A , Gurbuxani S, Schmitt E, Solary E, Garrido C. 2003. Heat shock proteins, cellular chaperones that modulate mitochondrial cell death pathways. Biochemical and Biophy Res Commun 304, 505-512. Parks JE, Graham JK, 1992. Effects of cryopreservation procedures on sperm membranes. Theriogenology 38, 209-222. Parrington J, Lai FA, Swann K. 1996. A novel protein for Ca2+ signaling at fertilization. Curr Top Dev Biol 39, 215-243. Parrish JJ, Susko-Parrish JL, First NL. 1985. Effect of heparin and chondroitin sulfate on the acrosome reaction and fertility of bovine sperm in vitro. Theriogenology 24, 537-549. Parrish JJ, Susko-Parrish J, Winer M A , First N L . 1988. Capacitation of bovine sperm by heparin. Biol Reprod 38, 1171-1180. Parrish JJ, Susko-Parrish JL, Uguz C, First N L . 1994. Differences in the role of cyclic adenosine 3',5'-monophosphate during capacitation of bovine sperm by heparin or oviduct fluid. Biol Reprod 51, 1099-1108. Paula-Lopes FF, Hansen PJ. 2002. Heat shock-Induced apoptosis in preimplantation bovine embryos is a developmentally regulated phenomenon. Biol Reprod 66, 1169-1177. Pavlok A . 2000. D-Penicillinamine and granulose cells can effectively extend the fertile life span of bovine frozen-thawed spermatozoa in vitro: effect on fertilization and polyspermy. Theriogenology 53, 1135-1146. Pinto-Correia C, Long C, Duby RT, Robl JM. 1992. Development of polyspermic cow zygotes after multiple sperm aster formation. Mol Biol Cell 3, 16. Plattner H . 1971. Bull spermatozoa: an investigation by freeze-etching using widely different cryofixation procedures. J Submicrosc Cytol 3, 19-32. Ploski JE, Apian PD. 2001. Characterization of D N A fragmentation events caused by genotoxic and non-genotoxic agents. Mutat Res 473, 169-180. 68 Primakoff P, Myles DG. 2002. Penetration, adhesion, and fusion in mammalian sperm-egg interaction. Science 296, 2183-2185. Pushpakumara PGA, Robinson RS, Demmers KJ , Mann GE, Sinclair K D , Webb R, Wathes DC. 2002. Expression of insulin like growth factor (IGF) system in the bovine oviduct at oestrus and during early pregnancy. Reproduction 123, 859-868. Rajah R, Valentinis B , Cohen P. 1997. Insulin like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-bl on programmed cell death through a p53- and IGF-independent mechanism. J Biol Chem 272, 12181-12188. Rajamahendran R, Ambrose JD, Lee C Y G . 1994. Anti-human sperm monoclonal antibody HS-11: A potential marker to detect bovine sperm capacitation and acrosome reaction in vitro. J Reprod Fertil 101, 539-545. Rao L , Perez D, White E. 1996. Lamin proteolysis facilitates nuclear events during apoptosis. J Cell Biol 135, 1441-1455. Ravagnan L, Gurbuxani S, Susin SA, Maisse C, Daugas E, Zamzami N , Mak T, Jaattela M , Penninger JM, Garrido C, Kroemer G. 2001. Heat shock protein 70 antagonizes apoptosis inducing factor. Nat Cell Biol 3, 839-843. Rawlins RG, Binor Z, Radwanska E. 1988. Microsurgical enucleation of tripronuclear human zygotes. Fertil Steril 50, 266-272. Raz T, Eliyahu E, Yesodi V , Shalgi R. 1998. Profile of P K C isozymes and their possible role in mammalian egg activation. FEBS Lett 431, 415-418. Ritossa F. 1962. A new puffing pattern induced by temperature and DNP in Drosophila. Experimentia 18, 571-573. Rodriguez-Martinez H , Larsson B. 1998. Assessment of sperm fertilizing ability in farm animals. Acta Agric Scand Sect A Anim Sci suppl29, 12-18. Romero A , Romao M J , Varela PF, Kolln I, Diaz JM, Carvalho JM, Sanz L , Topfer-Petersen E, Calvete JJ. 1997. The crystal structure of two spermadhesins reveal the C U B domain fold. Nature Struct Biol 4, 783-787. Roy N , Deveraux QL, Takahashi R, Salvesen GS, Reed JC. 1997. The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. E M B O J 16, 6914-6925. 69 Rozenfeld-Granot G, Krishnamurthy J, Kannan K, Toren A , Amariglio N , Givol D, Rechavi G. 2002. A positive feedback mechanism in the transcriptional activation of Apaf-1 by p53 and the coactivator Zac-1. Oncogene 21, 1469-1476. Runft L L , Jaffe L A , Mehlmann L M . 2002. Egg Activation at Fertilization: Where It A l l Begins. Develop Biol 245, 237-254. Saacke RG, White JM. 1970. Acrosomal alteration of freeze thawed bovine sperm. J Anim Sci 31, 229-230. Saacke RG. 1971. Morphology of the sperm and its relationship to fertility. Proc 3 r d Tech Conf Artif Insem Reprod. Natl Assn Anim Breeders pp 17-30. Saacke RG. 1982. Components of semen quality. J Anim Sci 55(suppl 2), 1-13. Saacke RG, Almquist JO. 1964a. Ultrastructure of bovine spermatozoa: I. The head of normal ejaculated sperm. A m J Anat 115, 143-162. Saacke RG, Almquist JO. 1964b. Ultrastructure of bovine spermatozoa: II. The neck and tail of normal ejaculated sperm. Am J Anat 115, 163-184. Saacke RG, White JM. 1972. Semen quality tests and their relationship to fertility. Proc 4 t h Tech Conf Artif Insem Reprod. Natl Assn Anim Breeders pp 22-27. Saacke RG, Dejarnette JM, Bame JH, Karabinus DS, Whitman SS. 1998. Can spermatozoa with abnormal heads gain access to the ovum in artificially inseminated super- and single-ovulating cattle? Theriogenology 50, 117-128. Saacke RG, Dalton JC, Nadir S, Nebel RL, Bame JH. 2000. Relationship of seminal traits and insemination time to fertilization rate and embryo quality. Anim Reprod Sci 60-61,663-677. Saeki K , Kato H , Hosoi Y , Miyake M , Utsumi K, Iritani A . 1991. Early morphological events of in vitro fertilized bovine oocytes with frozen-thawed spermatozoa. Theriogenology 35, 1051-1058. Sailer BS, Jost L K , Evenson DP. 1996. Bull sperm head morphometry related to abnormal chromatin structure and fertility. Cytometry 24, 167-173. Saleh A , Srinivasula S M , Balkir L , Robbins PD, Alnemri ES. 2000. Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat Cell Biol 2, 476-483. Salisbury GW, van Dongen CG. 1964. A comparison of several methods of estimating nuclear size of bovine spermatozoa. J Anim Sci 23, 1098-1101. 70 Sax JK, Fei P, Murphy M E , Bernhard E, Korsmeyer SJ, El-Deiry WS. 2002. BID regulation by p53 contributes to chemosensitivity. Nat Cell Biol 4, 842-849. Schultz M R , Kopf GS. 1995. Molecular basis of mammalian egg activation. Curr Top Dev Biol 30,21-62. Secrist RS, Schultze A B . 1952. The fructolysis of bovine semen and its relationship to fertilizing ability. J Anim Sci 11, 801. Shamsuddin M , Larsson B. 1993. In vitro development of bovine embryos after fertilization using semen from different donors. Reprod Dom Anim 28, 77-84. Shi QX, Roldan ER. 1995. Bicarbonate/C02 is not required for zona pellucida- or progesterone-induced acrosomal exocytosis of mouse spermatozoa but is essential for capacitation. Biol Reprod 52, 540-546. Shi Y , Thomas JO. 1992. The transport of proteins into the nucleus requires the 70-kilo Dalton heat shock protein or its cytosolic cognate. Mol Cell Biol 12, 2186-2192. Shinoura N , Yoshida Y , Nishimura M , Muramatsu Y , Asai A , Kirino T, Hamada H . 1999. Expression level of Bcl-2 determines anti- or proapoptotic function. Cancer Res 59,4119-4128. Shur DB. 1998. Is sperm galactosyltransferase a signaling subunit of a multimeric gamete receptor? Biochem Biophys Res Commun 250, 537-543. Sionov R V , Haupt Y . 1999. The cellular response to p53: the decision between life and death. Oncogene 18, 6145. Sipski M L , Wagner TE. 1977. The total structure and organization of chromosomal fibers in eutherian sperm nuclei. Biol Reprod 16, 428-440. Spanos S, Rice S, Karagiannis P, Taylor D, Becker DL , Winston R M , Hardy K . 2002. Caspase activity and expression of cell death genes during development of human preimplantation embryos. Reproduction 124, 353-363. Spencer TE, Ott TL, Bazer FW. 1998. Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregnancy and ovine interferon tau. Biol Reprod 58, 1154-1162. Spira B , Breitbart H . 1992. The role of anion channels in the mechanism of acrosome reaction in bull spermatozoa. Biochim Biophys Acta 1109, 65-73. 71 Spungin B , Breitbart H . 1996. Calcium mobilization and influx during sperm exocytosis. J Cell Sci 109, 1947-1955 Stewart D M , Johnson GA, Vyhlidal CA, Burghardt RC, Safe SH, Yu-Lee L Y , Bazer FW, Spencer TE, 2001. Interferon tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 142, 98-107. Suarez S. 1996. Hyperactivated motility in sperm. J Androl 17, 331-335. Sullivan JJ. 1978. Morphology and motility of spermatozoa. In Salisbury GW, Van Demark N L , Lodge JR (eds): "Physiology of Reproduction and Artificial Insemination of Cattle" 2 n d ed., San Francisco: W H Freeman & Co., pp 286-328. Sun QY, Wang WH, Hosoe M , Taniguchi T, et al. 1997. Activation of protein kinase C induces cortical granule exocytosis in a Ca2+-independent manner, but not the resumption of cell cycle in porcine eggs. Dev Growth Differ 39, 523-529. Suzuki M , Youle RJ, Tjandra N . 2000. Structure of Bax: coregulation of dimer formation and intracellular localization. Cell 103, 645-654. Swann K , Parrington J. 1999. Mechanism of Ca2+ release at fertilization in mammals. J ExpZool 285,267-275. Tajik P, Niwa K , Murase T. 1993. Effects of different protein supplements in fertilization medium on in vitro penetration of cumulus-intact and cumulus-free bovine oocytes matured in culture. Theriogenology 40, 949-958. Takahashi Y , Nihayah M , Hishinuma M , Jainudeen M R, Mazni O A , Mori Y , Kanagawa H . 1989. Preliminary study of buffalo sperm penetration into zona-free hamster eggs after treatment with calcium ionophore A - 23187. Japanese J Vet Res 37(3-4), 161-166. Teixeira M G , Austin K J , Perry DJ, Dooley V D , Johnson GA, Francis BR, Hansen TR. 1997. Bovine granulocyte chemotactic protein-2 is secreted by the endometrium in response to interferon-tau (IFN-tau). Endocrine 6, 31-37. Therien I, Bleau G, Manjunath P. 1995. Phosphatidylcholine-binding proteins of bovine seminal plasma modulate capacitation of spermatozoa by heparin. Biol Reprod 52, 1372-1379. 72 Therien I, Manjunath P. 1996. Phospholipid-binding proteins of bovine seminal vesicles modulate HDL-and heparin-induced capacitation of spermatozoa. Biol Reprod 54(suppl 1), 62. Thomas C A , Garner DL. 1994. Post-thaw bovine spermatozoal quality estimated from fresh samples. J Androl 15, 489-500. Thornborrow EC, Patel S, Mastropietro A E , Schwartzfarb E M , Manfredi JJ. 2002. A conserved intronic response element mediates direct p53-dependent transcriptional activation of both the human and murine bax genes. Oncogene 21, 990-999. Topfer-Petersen E. 1999. Molecules on the Sperm's Route to Fertilization. J Experimental Zool 285, 259-266. Topfer-Petersen E, Petrounkina A M , Ekhlasi-Hundrieser M . 2000. Oocyte-sperm interactions. Anim Reprod Sci 60-61, 653-662. Topper EK, Killian GJ, Way A, Engel B, Woelders H. 1999. Influence of capacitation and fluids from the male and female genital tract on the zona binding ability of bull spermatozoa. J Reprod Fertil 115, 175-183. Trounson A . 1992. The production of ruminant embryos in vitro. Anim Reprod Sci 28, 125-137. Tsujimoto Y , Cossman J, Jaffe E, Croce C M . 1985. Involvement of the bcl-2 gene in human follicular lymphoma. Science 228, 1440-1443. Tsujimoto Y , Shimizu S. 2000. Bcl-2 family life-or-death switch. FEBS lett 466, 6-10. Tulsiani DRP, Abou-Haila A , Loeser CR, Pereira B M J . 1998. The biological and functional significance of the sperm acrosome and acrosomal enzymes in mammalian fertilization. Exp Cell Res 240, 151-164. Tulsiani DRP, Yoshida-Komiya H , Araki Y . 1997. Mammalian fertilization: a carbohydrate-mediated event. Biol Reprod 57, 487-494. Uguz C, Vredenburgh WL, Parrish JJ. 1994. Heparin-induced capacitation but not intracellular alkalinization of bovine sperm is inhibited by Rp-adenosine-3'5'-cyclic monophosphorothioate. Biol Reprod 51, 1031-1039. Vairo G, Innes K M , Adams JM. 1996. Bcl-2 has a cell cycle inhibitory function separable from its enhancement of cell survival. Oncogene 13,1511-1519. 73 Vallet JL, Barker PJ, Lamming GE, Skinner N , Huskisson NS, 1991. A low molecular weight endometrial secretory protein which is increased by ovine trophoblast protein-1 is a beta 2-microglobulin-like protein. J Endocrinol 130, R1-R4. van Soom A , Ysebaert MT, de Kruif A . 1997. Relationship between timing of development, morula morphology, and cell allocation to inner cell mass and trophectoderm in in-vitro-produced bovine embryos. Mol Reprod Dev 47, 47-56. Vanags D M , Porn-Ares MI, Coppola S, Burgess D H , Orrenius S. 1996. Protease involvement in fodrin cleavage and phosphatidylserine exposure in apoptosis. J Biol Chem 271, 31075-31085. Verhagen A M , Ekert PG, Pakusch M , Silke J, Connolly L M , Reid GE, Moritz R L , Simpson RJ, Vaux DL. 2000. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43-53. Victor Ivakhnenko, Jeanine Cieslak, Yury Verlinsky. 2000. A microsurgical technique for enucleation of multipronuclear human zygotes. Human Reprod 15, 911-916. Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P, Kopf GS. 1995a. Capacitation of mouse spermatozoa. I. Correlation between the capacitation state and protein tyrosine phosphorylation. Development 121, 1129-1137. Visconti PE, Kopf GS. 1998. Regulation of protein phosphorylation during sperm capacitation. Biol Reprod 59, 1-6. Visconti PE, Moore GD, Bailey JL, Laclerc P, Connors SA, Pan D, Olds-Clarke P, Kopf G-S. 1995b. Capacitation in mouse spermatozoa II. Protein tyrosine phosphorylation and capacitation are regulated by a cAMP-dependent pathway. Development 121, 1139-1150. Visconti PE, Muschietti JP, Flawia M M , Tezon JG. 1990. Bicarbonate dependence of cAMP accumulation induced by phorbol esters in hamster spermatozoa. Biochim Biophys Acta 1054, 231-236. Visconti PE, Stewart-Savage J, Blasco A , Battaglia L, Miranda P, Kopf GS, Tezon JG. 1999. Roles of bicarbonate, cAMP, and protein tyrosine phosphorylation on capacitation and the spontaneous acrosome reaction of hamster sperm. Biol Reprod 61, 76-84. 74 Visconti PE, Westbrook V A , Chertihin O, Demarco I, Sleight S, Diekman A B . 2002. Novel signaling pathways involved in sperm acquisition of fertilizing capacity. J Reprod Immunol 53, 133-150. Visser JWM. 1980. Vital staining of haemopoietic cells with the fluorescent bis-benzimidazole derivatives Hoechst 33342 and 33258. In Laerum OD, Lindmo T, Thorud E (eds):'Flow Cytometry IV" Proc 4 t h Intl Symp Flow Cytometry, Newyork: Irvington-on-Hudson, pp 86-90. Walker W L , Nebel RL , McGilliard M L . 1996. Time of ovulation relative to mounting activity in dairy cattle. J Dairy Sci 79, 1555-1561. Warner C M , Cao W, Exley GE, McElhinny AS, Alikani M , Cohen J, Scott RT, Brenner CA. 1998. Genetic regulation of egg and embryo survival. Hum Reprod 13, 178-190. Wasco W M , Orr G A . 1984. Function of calmodulin in mammalian sperm: presence of a calmodulin-dependent cyclic nucleotide phosphodiesterase associated with demembranated rat caudal epididymal sperm. Biochem Biophys Res Commun 118, 636-642. Wassarman P M . 1999. Mammalian fertilization: Molecular aspects of gamete adhesion, exocytosis, and fusion. Cell 96, 175-183. Wassarman P M . 2002. Sperm receptors and fertilization in mammals. Mt. Sinai J Med 69, 148-155. Wassarman P M , Albertini David F. 1994. The mammalian ovum. Knobil, E.; Neill, J. D.: Eds. The physiology of reproduction, Second edition, Vols. 1 and 2, 79-122. Wassarman P M , Chen J, Cohen N , Litscher E, Liu C, Qi H , Williams Z. 1999. Structure and function of the mammalian egg zona pellucida. J Experimental Zool 285, 251-258. Wheeler M B , Seidel GE Jr. 1987. Zona pellucida penetration assay for capacitation of bovine spermatozoa. Gamete Res 18, 237-250. Wiley L M , Kidder G M , Watson AJ . 1990. Cell polarity and development of the first epithelium. Bioessays 12, 67-73. Wilkins M H F . 1956. Physical studies of the molecular structure of deoxyribose nucleic acid and nucleoprotein. Cold Spring Harbor Symp Quant Biol 21, 75-90. Williams WW, Savage A . 1925. Observations of the seminal micropathology of bulls. Cornell Vet 15, 353-375. 75 Whitfield C H , Parkinson TJ. 1992. Relationship between fertility of bovine semen and in vitro induction of acrosome reactions by heparin. Theriogenology 38, 11-20. Whitfield C H , Parkinson TJ. 1995. Assessment of the fertilizing potential of frozen bovine spermatozoa by in vitro induction of acrosome reactions with calcium ionophore (A23187). Theriogenology 44, 413-422. Wolf E, Arnold GJ, Bauersachs S, Beier H M , Blum H , Einspanier R, Frohlich T, Herrler A , Hiendleder S, Kolle S, Prelle K, Reichenbach H-D, Stojkovic M , Wenigerkind H , Sinowatz F. 2003. Embryo-maternal communication in bovine -strategies for deciphering a complex cross-talk. Reprod Dom Anim 38, 276-289. Wong HR, Menendez IY, Ryan M A , Denenberg A G , Wispe JR. 1998. Increased expression of heat shock protein-70 protects A549 cells against hyperoxia. A m J Physiol 275.L836-841. Wu GS, Burns TF, McDonald ER, 3rd, Jiang W, Meng R, Krantz ID, Kao G, Gan DD, Zhou JY, Muschel R et al. 1997. KILLER/DR5 is a D N A damage-inducible p53-regulated death receptor gene. Nat Genet 17, 141-143. Wu SH, Newstead JD. 1966. Electron microscope study of bovine epididymal spermatozoa. J Anim Sci 25, 1186-1196. Wyllie A H . 1980. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 284, 555-556. Xiao CW, Murphy BD, Sirois J, Goff A K . 1999. Down regulation of oxytocin-induced cyclooxygenase-2 and prostaglandin F synthase expression by interferon-tau in bovine endometrial cells. Biol Reprod 60, 656-663 X u K P , Greve T. 1988. A detailed analysis of early events during in vitro fertilization of bovine follicular oocytes. J Reprod Fertil 82, 127-134. X u K P , Yadav BR, Rorie RW, Plante L , Betteridge KJ , King WA. 1992. Development and viability of bovine embryos derived from oocytes matured and fertilized in-vitro and co-cultured with bovine oviductal epithelial cells. J Reprod Fertil 94, 33-43. X u Z, Kopf GS, Schultz R M . 1994. Involvement of inositol 1,4,5-triphosphate-mediated Ca2+ release in early and late events of mouse egg activation. Development 120, 1851-1859. 76 Yamaguchi H , Ikeda Y , Moreno JJ, Katsumura M , Miyazawa T, Takahashi E, Imakawa K , Sakai S, Christenson RK. 1999. Identification of a functional transcriptional factor AP-1 site in the sheep interferon x gene that mediates a response to P M A in JEG3 cells. Biochem J 340, 767-773 Yamamoto K , Ichijo H , Korsmeyer SJ. 1999. Bcl-2 is phosphorylated and inactivated by an ASKl / Jun N-terminal protein kinase pathway normally activated at G2/M. Mo l Cell Biol 19, 8469. Yanagimachi R. 1972. Penetration of guinea pig sperm into hamster eggs in vitro. J Reprod Fertil 28, 477-480. Yanagimachi R. 1994. Mammalian fertilization. In: Knobil E, Neill J, editors. The Physiology of reproduction. New York: Raven Press, p i 89-317. Yang M Y , Rajamahendran R. 2002. Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci 70, 159-169. Yonish-Rouach E, Resnitzky D, Lotem J, Sachs L, Kimchi A , Oren M . 1991. Wild-type p53 induces apoptosis of myeloid leukemic cells that is inhibited by interleukin-6. Nature 352, 345-347. Zeng Y , Oberdorf JA, Florman H M . 1996. pH regulation in mouse sperm: identification of Na(+)-, Cl( )-, and HC03( )-dependent and arylaminobenzoate-dependent regulatory mechanisms and characterization of their roles in sperm capacitation. Dev Biol 173, 510-520. Zhang BR, Larsson B, Lundeheim N , Rodriguez-Martinez H . 1998a. Sperm characteristics and zona pellucida binding in relation to field fertility of frozen-thawed semen from dairy A l bulls. Int J Androl 21, 207-216. Zhang H , Heim J, Meyhack B. 1998b. Redistribution of Bax from cytosol to membranes is induced by apoptotic stimuli and is an early step in the apoptotic pathway. Biochem Biophys Res Commun 251, 454-459. 77 CHAPTER 3 - BULL EFFECTS ON SPERM ACROSOME REACTION, SPERM-ZONA BINDING AND IN-VITRO EMBRYO PRODUCTION* 3.1. PREFACE Bull effect on sperm acrosome reaction, sperm-zona binding and in-vitro embryo production, and the correlation of this effect to field fertility measured by 60-90 day non-return rate were investigated in this study. Frozen semen from three separate ejaculates of eight genetically unrelated young bulls was used. Upon thawing, ejaculates from each bull were pooled, motile sperm separated by swim-up and a) subjected to an immunofluorescent assay at 0 and 4 h of incubation in capacitation media, to assess the acrosome status; b) used in an in-vitro fertilization assay system, to assess cleavage and blastocyst production rates; and c) a sperm-zona binding assay was carried out to determine the number of sperm bound to the zona pellucida of mature oocytes. Percentage of pre-freeze motile sperm (PrFM) and non-return rate data were obtained from an artificial insemination center. PrFM, percentage of acrosome reacted sperm at 0 h (AR1), increase in percentage of acrosome reacted sperm after 4 h (InAR), and sperm-zona binding rates (ZB) differed (p<0.05) among sperm samples obtained from different young bulls. Significant correlations (p<0.05) were observed between PrFM and AR1 (r = -0.31), InAR (r = 0.36), and ZB (r = 0.32). AR1 was negatively correlated to ZB (r = -0.27) and cleavage rate (r = -0.20), while InAR was positively correlated with ZB (r = * This chapter was accepted for publication in Canadian Journal of Animal Science - Giritharan, G., Ramakrishnappa, N., Balendran, A., Cheng, K.M. and Rajamahendran, R. Development of In-Vitro Tests to Predict Fertility of Bulls. Can J Anim Sci. (November 2004). 78 0.31) and cleavage rate (r=0.26). None of the in-vitro tests was correlated with non-return rate. Our findings indicate that along with pre-freeze motility, a combination of in-vitro tests including the percentage of spontaneously acrosome reacted sperm at thawing, might be useful in predicting bull field fertility. Such a combination of assays, however, yet to be determined. 3.2. INTRODUCTION Artificial insemination (Al) is one of the most successful reproductive technologies developed to improve reproductive efficiency of farm animals, especially dairy cattle. Accurate evaluation of the fertility of bulls used for A l purposes is of utmost importance since a single ejaculate provides hundreds of insemination doses and may have considerable influence on the reproductive potential of a herd (Rodriguez-Martinez and Larsson, 1998). Therefore, the basic purpose of semen evaluation procedures is to ensure that only good quality and highly fertile semen is used for A l purposes. Recording pregnancy data or measuring 60 day non-return rates provides the field fertility of processed semen from bulls (Zhang et al., 1999). A relatively high number of variables affect the success of these methods. From the paternal side, ejaculate, semen handling, storage, season and technician, and from the maternal side, estrus detection, farm management, parity and season influence the outcome of A l (reviewed by Foote, 2003). To increase the precision of this method one has to increase the number of animals inseminated, which is both costly and time consuming (reviewed by Foote 2003). Numerous methods have been developed for the laboratory evaluation of semen quality and fertility (Branton et al., 1951; Saacke, 1982; Budworth et al., 79 1988; Critser and Noiles, 1993; Bailey et al., 1994; Collin et al., 2000). Some of these methods measure general characteristics of spermatozoa (i.e., viability, motility patterns, morphology, sperm metabolism, membrane and acrosome integrity) and among these, semen fertility appears to be more closely related to membrane integrity than to the other general characteristics (reviewed by Larsson and Rodriguez-Martinez, 2000). Considering that fertilization is a complex process, semen samples can be subjected to various in-vitro tests that are related to the process of fertilization. Among these, selecting sperm by swim-up protocols, the ability of the sperm to bind genital epithelia, the ability to undergo sperm capacitation and acrosome reaction in-vitro, the ability to bind to the zona pellucida, accessory sperm counts on the zona pellucida, and in-vitro fertilization are potential predictors of fertility of bulls in the field (reviewed by Larsson and Rodriguez-Martinez, 2000). These tests are very important for young bulls recruited to a "progeny testing" program. It is well known that it often takes years before a young bull is proven for his genetic merit through progeny testing programs (Leitch, 1989; Norman et al., 2001, 2003). In the process, huge expenditures are incurred by the A l organizations in terms of time, labour and management costs. A major portion of the expenditure goes towards maintenance cost of bulls recruited to progeny testing programs, conducting extensive field insemination trials, non-return rate data collection, and payment of incentives to voluntary farmers (Leitch, 1989). Apart from these expenses, valuable space and materials are tied up to maintain young bulls and to store frozen semen straws obtained from young bulls that subsequently score poorly in progeny tests or show low field fertility and are consequently removed 80 from the young sire testing program. It is therefore of significant advantage to the cattle industry as well as to the A l industry i f simple laboratory tests become available to predict fertility of young bulls recruited for progeny testing programs. Thus, this study was designed to determine, whether the in-vitro sperm acrosome reaction, in-vitro fertilization and sperm-zona binding assay could be used as simple laboratory tests to predict fertility of young bulls recruited to a commercial progeny-testing program in Canada. 3.3. MATERIALS AND METHODS Eight genetically unrelated young bulls (YSpYSg) were randomly selected for this study based on their pedigree information over the last 4-5 generations. The age of the bulls, during collection, ranged from 13-17 months. Frozen semen from three separate ejaculates per bull collected at the beginning, middle and at the end of the test collection period was obtained from the British Columbia Artificial Insemination Center (Westgen). Sperm pre-freeze motility and 60-90 day non-return rate data for each bull recorded by the Westgen staff was also obtained. Ejaculates from each bull collected at the three different collection periods were thawed and pooled before being subjected to in-vitro tests described below to minimize variability among ejaculates. In all, nine replicate tests per bull were carried out. 3.3.1. In-vitro Fertilization (IVF) and Culture Assay Bovine ovaries were collected at a local slaughterhouse and transported to the laboratory in normal saline (0.9% NaCl; Sigma-Aldrich Canada Ltd, Oakville, ON) supplemented with penicillin-G (100 IU/mL; Sigma-Aldrich Canada Ltd) and 81 streptomycin sulphate (0.2 pg/mL; Sigma-Aldrich Canada Ltd) at 30-32 °C in a thermos flask. Cumulus oocyte complexes from small follicles (< 7 mm) were aspirated using an 18-G needle and 10 mL syringe into a mixture of Dulbecco's phosphate buffered saline (DPBS; GIBCO B R L , Canadian Life Technologies, Burlington, ON), 0.3% bovine serum albumin (BSA; Sigma-Aldrich Canada Ltd) and 50 pg/mL gentamicin (Sigma-Aldrich Canada Ltd). Oocytes with an evenly granulated cytoplasm and surrounded by more than three layers of cumulus cells were selected for maturation. These oocytes were cultured in maturation medium for 24 h at 38.5 °C in humidified air containing 5% CO2. The maturation medium consisted of tissue culture medium 199 (TCM199; Sigma-Aldrich Canada Ltd), 0.01 mg/mL follicle stimulating hormone (Folltropin; Vetrepharm Canada Inc., Belleville, ON), 5% superovulated cow serum (SCS; Boediono et al., 1994) and 50 pg/mL gentamicin. Straws containing frozen semen from a test bull, collected at three different times, were thawed at 37 °C, pooled and washed twice by centrifugation at 500 g for 5 min in Brackett and Oliphant medium (BO medium; Brackett and Oliphant 1975). The viable spermatozoa were swim-up separated, diluted to 5 x 106 sperm/mL in BO medium, and supplemented with 2.5 m M caffeine sodium benzoate (Sigma-Aldrich Canada Ltd) and 20 pg/mL heparin (Sigma-Aldrich Canada Ltd; Giritharan and Rajamahendran, 2001). Sperm droplets (100 uL) were prepared under mineral oil and pre-incubated at 38.5 °C in humidified air containing 5% CO2 for 1 h. Twenty matured oocytes were placed in each of these semen droplets and incubated at 38.5 °C in humidified air containing 5% CO2 for 16-18 h (Giritharan and Rajamahendran, 2001). The presumptive zygotes were then cultured in media prepared by mixing TCM-199, 5% SCS, 5 pg/mL insulin (Sigma-Aldrich 82 Canada Ltd) and 50 ixg/mL gentamicin (Boediono et al., 1994) in four-well culture dishes at 38.5 °C in humidified air containing 5% CO2. The culture media was changed every 72 h. Cleavage and blastocyst formation were assessed 72 h after insemination and 9 d of embryo culture, respectively (Plate 3.1.). 3.3.2. Sperm Acrosome Reaction (AR) Assay Acrosome status of sperm from a test bull was assessed immediately after thawing (0 h) and after 4 h of incubation of the sperm sample (prepared for IVF assay) in capacitation medium, using an indirect immunofluorescent assay with fluorescein isothiocyanate (FITC) labeled Pisum sativum agglutinin (PSA; Sigma-Aldrich Canada Ltd; Cross and Meizel, 1989; Cross and Watson, 1994). Three separate smears per bull were prepared from the test sample (concentration 5 x 106 sperm per niL) after incubation at 0 and 4 h in capacitation medium. Five micro liter of semen preparation was placed on the wells of teflon coated multi-well slides, spread well to make thin smears and air-dried. The slides were then fixed in methanol for 10 min. Each smear was washed three times with BO medium containing 0.6% B S A and 50 uL of FITC labeled PSA (10 jag/mL) was placed on each smear. The slides were incubated in a dark humidifying chamber. After 45 min of incubation in the dark chamber, excess FITC labeled PSA solution was removed by pipetting and the smears were washed three times with BO medium containing 0.6% BSA. A drop of 80% glycerol diluted in DPBS was placed on the smear and covered with an appropriate cover slip. Slides were examined under a fluorescence microscope at xlOO to x400 magnification using a B-2A filter (excitation filter of 450 - 490 nm and barrier filter of 520 nm) and the status of sperm acrosomes was assessed. The acrosomal region of acrosome-intact spermatozoa would 83 normally show a bright green fluorescent staining with FITC labeled PSA, whereas acrosome reacted spermatozoa would show no staining or a band of green fluorescence (Plate 3.2.; Cross and Meizel, 1989; Cross and Watson, 1994). Acrosome status was assessed on randomly selected fields until 100 spermatozoa were counted from each well of the slides. In each field, the number of total spermatozoa was counted under dark field illumination, immediately followed by the counting of FITC-labeled sperm under fluorescent light in a dark field to obtain the percent acrosome intact sperm. 3.3.3. Sperm Zona Binding (ZB) Assay Thirty good quality mature oocytes were denuded with 0.1% hyaluronidase (Sigma-Aldrich Canada Ltd) by vortexing for 3 min. Denuded mature oocytes were placed (10 oocytes/bull) into 50 uL semen droplets (sperm concentration - 1 x 106 per ml) prepared for IVF assay, covered with mineral oil and incubated at 38.5 °C in humidified air containing 5% CO2 for 4 h. After incubation, sperm oocyte complexes were removed and washed 10 times in DPBS containing 0.5% B S A to remove loosely attached sperm. Sperm oocyte complexes were then fixed in 2.5 % Glutaraldehyde (Sigma-Aldrich Canada Ltd) for 10 min and washed three times in DPBS containing 0.5 % BSA. Sperm oocyte complexes were thereafter incubated in 50 pL drops of HOECHST 33342 (bis-benzamide) stain solution (0.1 mg/mL; Sigma-Aldrich Canada Ltd) in a dark chamber for 10 min. Sperm-oocyte complexes were then transferred to a glass slide and were slightly compressed under a cover slip supported on the corners by Vaseline. Prepared slides were then stored in a dark humidified chamber until counting the sperm attached to zona pellucida. Sperm attached to zonae were counted under a 84 fluorescence microscope using U V - 2 A filter combination (excitation filter of 330 - 380 nm and barrier filter of 420 nm) at x 100 to x 400 magnification (Plate 3.2.). 3.3.4. Field Fertility Data The field fertility data of all experimental bulls were obtained from Westgen to estimate the correlation between the field fertility and in-vitro tests performed. Field fertility data for each bull were based on 60-90 day non-return rate after the first insemination with semen of that particular bull. The number of inseminations ranged from 335 to 637. 3.3.5. Statistical Analyses Data analysis was done by analysis of variance (ANOVA) after arcsine transformation of data using JMP statistical software (SAS Institute Inc., Sas Campus Drive, Cary, North Carolina 27513, USA). Mean separation procedure was performed using Fisher's LSD multiple comparison test when A N O V A showed significant F-Values. Non-return rate data were analyzed by Chi-square test using JMP statistical software. For all experiments, results are reported as the mean values for each set of data ± standard error of the means and the level of statistical significance was defined at a p value of less than 0.05. The Pearson pair-wise correlation was used to establish correlations between in-vitro tests and field fertility. 3.4. RESULTS Results of this study are shown in Table 3.1. and 3.2. Pre-freeze motility of the sperm samples from different young bulls was significant (p<0.05) different. Sperm 85 from bull Y S i (74.2±2.0 %) and Y S 8 (69.8±0.8 %) showed highest and lowest pre-freeze motility, respectively. Mean percent spontaneous acrosome reacted sperm at 0 h ranged from 28.9±2.1 to 44.5±1.7%. Sperm samples from bulls YS4 and Y S i showed highest and lowest acrosome reacted sperm, respectively. Sperm samples showed significant (p<0.05) differences in percent spontaneous acrosome reacted sperm at 0 h incubation due to bull. Sperm samples also showed significant (p<0.05) difference in the increase in acrosome reacted sperm at 4 h incubation due to bull. Sperm sample from bull Y S i showed highest percentage increase in acrosome reacted sperm at 4 h. The mean number of sperm from the test bulls bound to the zona pellucida ranged from 84.7±4.8 to 145.9±8.4. Sperm samples significantly (p<0.05) differed due to bull in their binding ability to the zona pellucida of in-vitro matured oocytes. Sperm from bulls YS2 and YS7 had highest binding, whereas sperm samples from bull YSg showed lowest binding. However, there was no significant difference in the percentage of cleaved embryos or blastocysts produced by fertilization of oocytes with sperm from different young bulls. In addition, chi-square analysis revealed that there was no significant difference among bulls in non-return rates. Pre-freeze motility was positively correlated (p<0.05) with an increase in percentage of acrosome reacted sperm at 4 h (r = 0.36) and the number of sperm that bound to zonae (r = 0.32), and negatively correlated with percentage of acrosome reacted sperm at 0 h (r = -0.31). The percentage of acrosome reacted sperm at 0 h was negatively correlated with the number of sperm that bound to zonae (r = -0.27) and cleavage rate (r = -0.20). The increase in percentage of acrosome reacted sperm at 4 h 86 was positively correlated with the number of sperm that bound to zonae (r=0.31) and cleavage rate (r=0.26). None of the in-vitro tests was correlated with 60-90 day non-return rate. 3.5. DISCUSSION Since sperm motility is necessary for successful fertilization, motility parameters are routinely used as a first step selection procedure to select semen samples for A l . However, the correlation of this parameter with fertility is questionable. Some studies have shown a positive correlation with field fertility (Januskauskas et. al., 2001), whereas others failed to show any correlation (Bailey et al., 1994; Zhang et al., 1999). In our study, although the percentage of motile sperm pre-freeze was not correlated with non-return rate, it was correlated positively with increase in the percentage of acrosome reacted sperm at 4 h post-thaw and the rate of sperm-zona binding. Conversely, the percentage of motile sperm before freezing was negatively correlated with the percentage of acrosome reacted sperm at 0 h post-thaw. This observation is in agreement with observations in a number of studies where sperm motility has been linked with in-vitro tests such as sperm morphology, sperm concentration, acrosome integrity, and sperm migration capacity (Correa et. a l , 1997). Several early reports have suggested that the ability of spermatozoa to undergo the acrosome reaction in-vitro may be useful in predicting the fertility of bulls (Ambrose et al., 1995; Whitfield and Parkinson, 1995; Januskauskas et al., 2000). On average, 30-40% sperm were spontaneously acrosome reacted at 0 h in our study, showing that membrane damage due to freezing procedures is very high in these semen 87 samples. Significant differences due to bull in percentage of acrosome reacted sperm at 0 h indicates that either membrane integrity of sperm varies among bulls or the incidence of membrane damage due to cryopreservation varies among bulls. When correlating the percentage of acrosome reacted sperm at 0 h to pre-freeze motility, sperm-zona binding and the increase in the percentage of acrosome reacted sperm at 4 h, negative correlations were observed. This shows that sperm having superior membrane integrity and motility are less susceptible to membrane cryo-damage. This finding is in agreement with studies reported earlier (Hammerstedt et al., 1990; Parks and Graham, 1992; Ambrose et al., 1995; Watson, 2000). In our study, the pre-freeze sperm motility was very high in the sample from bull Y S i and it also showed the lowest rate of spontaneous acrosome reactions at 0 h, highest net increase in the rate of acrosome reactions at 4 h, as well as highest sperm-zona binding rate. Moreover, cleavage and blastocyst development rates and the 60-90 day non-return rate also tended to be higher in this bull. This finding suggests that sperm with high pre-freeze motility can withstand cryopreservation, thus resulting higher in-vitro and in-vivo fertility. The binding of sperm to the zona pellucida is an important step in the process of fertilization and appears correlated with in-vivo fertility in bulls (Zhang et al., 1998). However, in the present study, even though sperm from different bulls differed in binding to the zona pellucida, there was no correlation with 60-90 day non-return rate. Interestingly, poor correlations were also obtained between zona-binding test and in-vitro fertility as measured by cleavage and blastocyst production rates. However, significant correlations were obtained between the percentage of motile sperm pre-88 freeze and sperm-zona binding as well as the rates of acrosome reacted sperm at 0 and 4 h pre-incubation. Attempts have been made to correlate the results of in-vitro fertilization rates with in-vivo fertility based on 60-90 day non-return rates, but conflicting results have been reported (Ohgoda et al., 1988; Hillery et al., 1990; Shamsuddin and Larson, 1993). In the present study, there was no difference in cleavage rate or blastocyst development rate among embryos produced by in-vitro fertilization using sperm from the different bulls. Also, there was no correlation either between cleavage rate and non-return rate or between blastocyst development rate and non-return rate. This might indicate that the large number of sperm in the fertilization droplet masks the effect of bull on embryo development in vitro, because a very low number of sperm reaches the site of fertilization in in-vivo. Eyestone and First (1989), and Kjaestad and Stubbings (1992) reported similar findings after using larger, as well as smaller, numbers of sperm for in-vitro fertilization. Although there was no effect of bull on cleavage rate or blastocyst development rate among embryos produced by experimental bulls, cleavage rate was correlated with the increase in acrosome reacted sperm at 4 h incubation. The increase in acrosome reacted sperm at 4 h of incubation was also correlated to the sperm-zona binding rate. Neither the non-return rate nor the cleavage and blastocyst development rates were affected by bull. Although several studies have tried to establish an in-vitro test to measure field fertility, few have showed high correlation with field fertility measured by non-return rate (Ambrose et. al., 1995; Zhang et. al., 1998). In our study, none of the in-vitro tests was correlated with non-return rate and this is in agreement with most of the other 89 studies (Linford et. al., 1976; Bailey et. al., 1994). Although the non-return rate gives the actual field fertility of a bull, several environmental and maternal factors influence the accuracy of this measurement. Using non-return rates corrected for ejaculate, season, inseminator and parity to minimize the influence of these factors Zhang et. al. (1999) showed highest correlation with in-vitro tests. The chance of obtaining a higher correlation between an in-vitro test and field fertility increases when there is a high variation in non-return rate between bulls (Linford et. al., 1976; Zhang et. al., 1999). This might be one of the reasons for the very poor correlation in our study, because the non-return rate of test bulls ranged only from 64.9 to 71.9 percent. 3.6. CONCLUSION In conclusion, assays of sperm function such as acrosome reaction, zona binding ability and in-vitro fertilization showed between bull variations and inter function correlations. Hence, these sperm parameters may be potentially useful with routine semen analysis tests in predicting of field fertility. However, it remains to be established that these tests can be used to predict in-vivo fertility accurately. This justifies further research into the exact relationship between these parameters and field fertility. Calculation of a fertility index from the outcome of the combination of these tests might result in much accurate prediction of field fertility. Acknowledgement We gratefully acknowledge British Columbia Investment Agriculture Foundation, Canada and British Columbia Artificial Insemination Center (WESTGEN), Canada for their financial assistance and support for this project. 90 Table 3.1. Percentage of motile sperm before freezing (PrFM), percentage of acrosome reacted sperm at 0 h (AR1) after thawing, increase in the percentage of acrosome reacted sperm at 4 h incubation in capacitation media (InAR), average number of sperm bound to zona pellucida of mature oocytes after 4 h co-incubation in in-vitro fertilization medium (ZB), percentage of inseminated oocytes that cleaved (CL), percentage of inseminated eggs that developed to the blastocyst stage after 9 d culture (BL) and 60-90 day non-return rates (NRR). Frozen semen from three separate ejaculates were thawed and pooled for each of eight unrelated young bulls (YSi-YSg) were pooled then used. Bull PrFM(%)$ Acrosome Reaction (%)$ ZB $ (Mean±SE) z CL(%) $ BL(%) NRR(%) ID (Mean±SE)w AR1 (Mean±SE) x InAR (Mean±SE) y * YS, 74.2±2.0a 28.9±2.1d 23.4±3.6a 123.4±8.46c 67.2 19.4 71.3 YS 2 70.0±2.2Z?c 33.9±2.5c 22.9±3Aab 145.9±8.4a 59.4 16.1 70.5 YS 3 71.7±l.lafcc 36.1+3.6&C 16.8±3.06c 103.5±9.3«fe 59.4 14.4 68.4 YS 4 ll.l±\.labc 44.5+1. la 18.1±l.lafec U0A±9.5bcd 57.2 18.9 71.8 YS 5 ll.0±l.0abc 37.8±3.06c 20.1±4.0a6 105.1±8.6afe 56.1 15.0 71.2 YS 6 13.0±l.2ab 37.7±2.36c 19.9+3.6ab 89.6±6.5cfe 60.6 20.6 64.9 YS 7 73.3±l.lafc 40.4±3.4a6 14.9±2.4c \30A±l.Sab 61.1 17.8 67.5 YS 8 69.2±0.8c 39.9±3.2aZ> ll.9±3.5abc 84.7+4.8e 61.1 22.2 71.9 a,b,c,d,e - Means with different letters within a column differ (P<0.05). w,x,y,z - Arithmetic mean and standard error of mean for percentage of motile sperm before freezing, percentage of acrosome reacted sperm 0 h after thawing, percentage of acrosome reacted sperm 4 h after incubation in capacitation medium, and number of sperm bound per matured oocyte, respectively. s - Data within these columns are based nine replicates (n = 9) * - The non-return rates are based on the number of inseminations ranged from 335 to 637. 91 Table 3.2. Pair-wise comparison of sperm pre-freeze motility (PrFM), sperm acrosome reaction at 0 h (AR1), increase in sperm acrosome reaction from 0 to 4 h (InAR), sperm-zona binding (ZB), embryo cleavage (CL). blastocyst production (BL) and 60-90 day non-return (NRR) rates. PrFM AR1 InAR ZB CL BL AR1 -0.31* InAR 0.36* -0.47* ZB 0.32* -0.27* 0.31* CL 0.12 -0.20* 0.26* 0.15 BL 0.03 0.10 0.01 0.19 0.41* NRR -0.46 -0.02 0.29 0.14 -0.04 0.01 * comparisons showing significant correlation at P<0.05. 92 Plate 3.1. Light microscopic images of bovine 2-cell A), 4-cell B), 8-cell C), and blastocyst D) stage embryos. The photographs were taken at x400 magnification. 93 Plate 3.2. Fluorescence A), and light microscopic B), images of bovine spermatozoa, and spermatozoa bound to zona pellucida of mature oocytes C) stained by fluorescein isothiocyanate coated pisum sativam agglutinins and bis-benzamide, respectively. The photographs were taken at 400x magnification using B-2A (excitation filter of 450 -490 nm and barrier filter of 520 nm) and UV-2A (excitation filter of 330 - 380 nm and barrier filter of 420 nm) filter combination and dark field illumination B). The sperm acrosome shows green fluorescence and bis-benzamide stained sperm heads shows blue fluorescence. The arrow indicates partial and complete acrosome reaction. 94 3.7. REFERENCES Ambrose JD, Rajamahendran R, Sivakumaran K , Lee C Y G . 1995. Binding of the anti-human sperm monoclonal antibody HS-11 to bull spermatozoa is correlated with fertility in vitro. Theriogenology 33, 419-426. Bailey JL, Robertson L , Buhr M M . 1994. Relationships among in vivo fertility, computer analyzed motility and m vitro Ca flux in bovine spermatozoa. Can J Anim Sci 74, 53-58. Boediono A , Takagi M , Saha S, Suzuki T. 1994. Influence of Day 0 and Day 7 superovulated cow serum during development of bovine oocytes in vitro. Reprod Fertil Dev 6, 261-264. Brackett B G , Oliphant G. 1975. Capacitation of rabbit spermatozoa in vitro. Biol Reprod 12, 260-274. Branton C, James CB, Patrick TE, Newsom M H . 1951. The relationship between certain semen quality tests and fertility and the interrelationship of these tests. J Dairy Sci 34,310-316. Budworth PR, Amann RP, Hammerstedt RH. 1988. Relationship between computerized measurement of frozen thawed spermatozoa and fertility. J Androl 9, 41-54. Collin S, Sirard M A , Dufour M , Bailey JL. 2000. Sperm calcium levels and chlortetracycline fluorescence patterns are related to the in vivo fertility of cryopreserved bovine semen. J Androl 21, 938-943. Correa JR, Pace M M , Zavos P M . 1997. Relationship among frozen-thawed sperm characteristics assessed via the routine semen analysis, sperm functional tests and fertility of bulls in an artificial insemination program. Theriogenology 48, 721-731. Crister JK, Noiles EE. 1993. Bioassays o f sperm function. Semin Reprod Endocrinol 11,1-16. Cross N L , Meizel S. 1989. Methods for evaluating the acrosomal status of mammalian spermatozoa. Biol Reprod 41, 635-641. Cross N L , Watson SK. 1994. Assessing acrosomal status of bovine sperm using fluoresceinated lectins. Theriogenology. 42, 89-98. 95 Eyestone W H , First N L . 1989. Variation in bovine embryo development in vitro due to bulls. Theriogenology 31, 191 (Abstr.). Foote R H . 2003. Fertility estimation: a review of past experience and future prospects. Anim Reprod Sci 75, 119-139. Giritharan G, Rajamahendran R. 2001. In vitro embryo production using ovaries removed from culled cows. Can J Anim Sci 81, 589-591. Hammerstedt RH, Graham JK, Nolan J. 1990. Cryopreservation of mammalian sperm: what we ask them to survive. J Androl 11, 73-88. Hillery FL , Parrish JJ, First NL. 1990. Bull specific effect on fertilization and embryo development in vitro. Theriogenology 33, 249 (Abstr.). Januskauskas A , Johannisson A , Rodriguez-Martinez H . 2001. Assessment of sperm quality through fluorometry and sperm chromatin structure assay in relation to field fertility of frozen thawed semen from Swedish A l bulls. Theriogenology 55, 947-961. Januskauskas A , Johannisson A , Soderquist L , Rodriguez-Martinez H . 2000. Assessment of sperm characteristics post-thaw and response to calcium ionophore in relation to fertility in Swedish dairy A l bulls. Theriogenology. 53, 859-875. Kjaestad TG, Stubbings RB. 1992. Sire and insemination dose does effect in vitro fertilization of bovine oocytes. Theriogenology 37, 240 (Abstr.). Larsson B , Rodriguez-Martinez H . 2000. Can we use in vitro fertilization tests to predict semen fertility ? Anim Reprod Sci (60-61), 327-336. Leitch HW. 1989. Centering on breed improvement: genetic improvement-at what cost? The A.I. commitment to breed improvement. Holstein J 52, 86. Lindford E, Glover FA, Bishop C, Steward DL. 1976. The relationship between semen evaluation methods and fertility in the bulls. J Reprod Fertil 47, 283-291. Norman HD, Powell R L , Wright JR, Sattler CG. 2001. Overview of progeny-test programs of artificial-insemination organizations in the United States. J Dairy Sci 84, 1899-1912. Norman HD, Powell RL , Wright JR, Sattler CG. 2003. Timeliness of progeny testing through artificial insemination and percentage of bulls returned to service. J Dairy Sci 86, 1513-1525. 96 Ohgoda O, Niwa K , Yuhara M , Takahashi S, Kanoya K. 1988. Variation in penetration rates in vitro of bovine follicular oocytes do not reflect conception rates after artificial insemination using frozen semen from different bulls. Theriogenology 29, 1375-1382. Parks JE, Graham JK. 1992. Effects of cryopreservation procedures on sperm membranes. Theriogenology 38, 209-222. Rodriguez-Martinez H , Larsson B. 1998. Assessment of sperm fertilizing ability in farm animals. Acta Agric Scand Sect A Anim Sci 129(Suppl.), 12-18. Saacke RG. 1982. Components of semen quality. J Anim Sci 55(Suppl. 2), 1-13. Saacke RG, White JM. 1972. Semen quality tests and their relationship to fertility. Proc 4 t h Tech Conf Artif Insem Reprod Natl Assn Anim Breeders 22-27. Shamsuddin M , Larsson B . 1993. In vitro development of bovine embryos after fertilization using semen from different donors. Reprod Dom Anim 28, 77-84. Watson PF. 2000. The causes of reduced fertility with cryopreserved semen. Animal Reprod Sci 60,481-492. Whitfield C H , Parkinson TJ. 1995. Assessment of the fertilizing potential of frozen bovine spermatozoa by in vitro induction of acrosome reactions with calcium ionophore (A23187). Theriogenology. 44, 413-422. Zhang BR, Larsson B, Lundeheim N , Rodriguez-Martinez H . 1998. Sperm characteristics and zona pellucida binding in relation to field fertility of frozen-thawed semen from dairy A l bulls. Int J Androl 21, 207-216. Zhang BR, Larsson B, Lundeheim N , Haard M G H , Rodriguez-Martinez H . 1999. Prediction of bull fertility by combined in vitro assessments of frozen-thawed semen from young dairy bulls entering an A l program. Int J Androl 22, 253-260. 97 CHAPTER 4 - THE EFFECT OF SPERM PRE-INCUBATION TIME AND SPERM CONCENTRATION OF BULLS ON IN-VITRO FERTILIZATION 4.1. PREFACE In this study, the bull effect on in-vitro fertilization (including normal and polyspermy) was evaluated using normal (25,000:1) and high (50,000:1) sperm:oocyte ratio with short (0 h) and long (6 h) sperm pre-incubation in capacitation medium. The degree of correlation of this effect with the non-return rates, sperm pre-freeze motility and other in-vitro sperm parameters obtained in the first experiment (Chapter 3) was also investigated. In addition to this, data were pooled to determine the effect of sperm concentration and pre-incubation time on in-vitro fertilization. Frozen semen from two separate ejaculates of six unrelated bulls was used. Ejaculates from each bull were alternately used for in-vitro fertilization in six replicates (3 from one set of ejaculates and other 3 from second set of ejaculates) to minimize variability among ejaculates. Oocytes obtained from slaughterhouse ovaries were matured and co-incubated with sperm from experimental bulls using a normal (25,000:1) and high (50,000:1) sperm:oocyte ratio and short (0 h) and long (6 h) sperm pre-incubation in capacitation medium at 38.5 °C in a humidified atmosphere of 5% CO2 in air. After 14-16 h exposure to sperm, presumptive zygotes were stained with bisbenzamide and the percentage of fertilized oocytes containing 2 pronuclei and more than 2 pronuclei was determined. The non-return rates and sperm pre-freeze motility data of the experimental 98 bulls were obtained from the records of the artificial insemination center. The sperm acrosome reaction, sperm-zona binding and in-vitro embryo development data were obtained from the first experiment (Chapter 3). Percentage of zygotes (including both normal and polyspermic) and normally fertilized zygotes containing 2 pronuclei was different among bulls with short sperm pre-incubation in normal (p<0.01) and high (p<0.06) sperm:oocyte ratios. Percentage of zygotes was different among bulls with long sperm pre-incubation in high sperm:oocyte ratio (p<0.05), but not in the normal sperm:oocyte ratio. However, percentage of normally fertilized zygotes was different among bulls with long sperm pre-incubation in normal sperm:oocyte ratio (p<0.05), but not in the high sperm:oocyte ratio. However, the percentage of polyspermic zygotes was different among bulls with long sperm pre-incubation in the high sperm:oocyte ratio (p<0.05). The percentage of difference in normally fertilized zygotes between short and long sperm pre-incubation in the normal sperm:oocyte ratio showed a high degree of correlation with non-return rates (r = 0.90; p<0.05) of the experimental bulls. A high degree of correlation was also observed between sperm pre-freeze motility, and percentage of zygotes (r = 0.88; p<0.05) and normally fertilized zygotes (r = 0.85; p<0.05) with the long sperm pre-incubation in the normal sperm:oocyte ratio. Increase in acrosome reaction at 4 h was highly correlated with percentage of polyspermic zygotes when using long sperm pre-incubation in normal sperrmoocyte ratio (r = 0.93; p<0.05). The cleavage rate was correlated with the percentage of zygotes when using long sperm pre-incubation in the normal sperm:oocyte ratio. The percentage of difference in normally fertilized zygotes between short and long sperm pre-incubation in the high sperm:oocyte ratio had a correlation with blastocyst production rate of the 99 experimental bulls (r = 85; p<0.05). Increase in sperm concentration and pre-incubation time resulted significant (p<0.01) increases and decreases in percentage of zygotes and normally fertilized zygotes, respectively. The present study concludes that the sperm of bulls showing high non-return rates exhibits a significant reduction in in-vitro fertilizing ability within 6 h of pre-incubation in capacitation medium. 4.2. INTRODUCTION Every year the dairy industry loses a greater amount of revenue primarily due to reproductive inefficiency either by fertilization failure due to misdiagnosis of estrus, inappropriate timing of A l , or early embryonic mortality of unknown causes (Senger, 1994). It has also been suggested that failure of breeding with low fertility bulls is due to fertilization failure and that of high fertility bulls is due to embryonic death of unknown causes (Saacke et al., 2000). Bulls differ in the ability of their sperm to survive in the female reproductive tract during the interval between insemination and ovulation and very big differences in fertility are observed when cows are inseminated early in the estrus than when they are inseminated at a later stage of estrus (Shannon, 1978; Maatje et al., 1997). Both of these differences are found when frozen and fresh semen from bulls with low fertility are compared to those with high fertility (Shannon 1978). Hence, the fertility of bulls in the field is mainly dependent on the viability of sperm in the female reproductive tract and the evaluation of the fertile lifespan of sperm might be helpful in accurate laboratory prediction of field fertility of bulls. Mammalian fertilization is a complex process, in which the sperm and egg unite, thereby, restoring the somatic chromosome number and developing a new individual 100 exhibiting the characteristics of the species (reviewed by Yanagimachi, 1994; Wassarman, 1999). Egg and sperm undergo a series of maturational changes before they fuse successfully and form a viable zygote during the fertilization process (Wassarman and Albertini, 1994; Visconti and Kopf, 1998). During maturation; sperm undergoes capacitation to gain fertilizing capacity, and the oocyte undergoes nuclear and cytoplasmic maturation in which the cortical granules move towards periphery of the oocyte. Hence, success of the fertilization process depends on the correct timing of insemination to allow sufficient time for the sperm and egg to undergo maturational changes before fertilization. Generally, there are two technical difficulties associated with studies designed to evaluate the optimal time of artificial insemination. These are inadequate numbers of cows for valid statistical comparisons (Trimberger and Davis, 1943; Trimberger 1948; Maatje et al., 1997) and knowledge of the onset of estrus due to the low frequency and efficiency of the methods used for estrus detection (Foote, 1978; Nebel et al., 1994). The fertile lifespan of sperm and egg, the transport time of viable sperm from the site of artificial insemination to fertilization, and the ovulation time in association with artificial insemination are the critical biological events that influence the timing of artificial insemination and fertilization. Studies by Rajamahendran et al. (1989) and Walker et al. (1996) showed that the interval from the onset of estrus to ovulation was 28-36 h. The transport of viable sperm to the oviduct requires a minimum of 6 h to obtain a sperm population capable of fertilization; sperm numbers in the oviduct progressively increase over 8 to 18 h (Thibault, 1973; Wilmut and Hunter, 1984; Hawk, 1987). The chance of pregnancy was highest when artificial insemination was performed 11.8 h after the onset of estrus signs (Maatje et al., 1997). Therefore, 101 successful fertilization appears to depend on the functional lifespan of the sperm during transport in the female reproductive tract. The fertility due to number of functional viable sperm at the site of fertilization varies with bull and sperm concentration used for insemination (den Daas et al., 1998). Non-return rates are low when too many as well as too few sperm are used for artificial insemination (Foote, 1970; Saacke, 1982) Hence, studies based on sperm parameters such as sperm concentration and in-vitro fertilizing capacity after pre-incubation for 6 h may reveal the fertilizing potential of sperm from different bulls in-vivo. In the fertilization process, the binding of sperm to the zona pellucida of the mature oocyte initiates the sperm acrosome reaction and the release of acrosomal contents. With the help of acrosomal contents, the capacitated sperm penetrate through the zona pellucida and bind with the vitelline membrane of the oocyte. This initiates the release of cortical granules into peri-vitelline space, which causes chemical changes in the zona pellucida, the zona block, to prevent the entry of other sperm (Cherr and Ducibella, 1990; Wassarman, 1999). Defects in the process of the zona block resulting in the penetration of more than one sperm can lead to polyspermy (Hyttel et al., 1986; Cherr and Ducibella, 1990; Ducibella, 1996). Polyspermy is the most prevalent abnormal fertilization procedure in which more than one sperm enters into a mature female egg and forms polyploidic zygotes (Xu and Greve, 1988; Saeki et al., 1991). The polyspermic zygotes rarely develop beyond morula and blastocyst stages or develop as androgenotes (Iwasaki et al., 1989; Pinto-Correia et al., 1992; Long et al., 1993). Improper maturation of oocytes (Niwa et al., 1991; Chian et al., 1992; Long et al., 1994; Agca et al., 2000), concentration of sperm (Long et al., 1994), source of sperm 102 (Kreysing et al., 1997), in-vitro fertilization medium (Tajik et al., 1993; Pavlok, 2000) and sperm oocyte co-incubation time (Long et al., 1994) have been shown to influence fertilization and polyspermy. Some of the above factors, which are determined by time of insemination and the quality of semen sample, influence the in-vivo fertilizing capacity of sperm (Dransfield et al., 1998). In this study, it is hypothesized that the fertile lifespan of bovine sperm within the female reproductive tract is male factor dependant and has a direct influence on bull fertility. The objective of this study is to determine the effect of bull on in-vitro fertilization with sperm pre-incubation time and concentration, the relationship of these sperm fertilization parameters to in-vivo fertility and other laboratory parameters of sperm, and the effect of sperm pre-incubation and concentration on in-vitro fertilization. 4.3. MATERIALS AND METHODS 4.3.1. Experimental Design Six genetically unrelated young bulls (Si-Se) were randomly selected for this study based on their pedigree information over the last 4-5 generations. Frozen semen from two separate ejaculates per young bull collected at two different collection periods was obtained from a local A l center. Sperm from one set of ejaculates were used at a time with 0 and 6 h pre-incubation time before being subjected to in-vitro fertilization in a sperrmoocyte ratio of 25,000 to 1 and 50,000 to 1 as described below. Both ejaculates were used alternately for in-vitro fertilization to minimize variability between ejaculates in six replicates (3 from one set of ejaculates and other 3 from the second set of ejaculates) using 240 oocytes per bull. 103 4.3.2. In-vitro Fertilization Bovine ovaries were collected at a local slaughterhouse and transported to the laboratory in normal saline (0.9% NaCl; Sigma-Aldrich Canada Ltd, Oakville, ON) supplemented with penicillin-G (100 IU/mL; Sigma-Aldrich Canada Ltd) and streptomycin sulphate (0.2 ug/mL; Sigma-Aldrich Canada Ltd) at 30-32 °C in a thermos flask. Cumulus oocyte complexes from small 2-8 mm follicles were collected into an aspiration medium using an 18-G needle and a 10-mL syringe. The medium contained Dulbecco's phosphate buffered saline (DPBS; GIBCO B R L , Canadian Life Technologies, Burlington, ON), 0.3% bovine serum albumin (BSA; Sigma-Aldrich Canada Ltd) and 50 pg/mL gentamicin (Sigma-Aldrich Canada Ltd). Oocytes with an evenly granulated cytoplasm and surrounded by more than three layers of cumulus cells were selected for maturation. These oocytes were cultured in maturation medium for 24 h at 38.5 °C in a humidified atmosphere of 5% CO2 in air. The maturation medium consisted of tissue culture medium 199 (TCM199; Sigma-Aldrich Canada Ltd), 0.01 mg/mL follicle stimulating hormone, 5% superovulated cow serum (SCS; Boediono et al., 1994) and 50 ug/mL gentamicin. Frozen semen from different experimental bulls was thawed at 37 °C, washed twice by centrifugation at 500g for 5 min, diluted to 5 x 106 sperm/mL and 10 x 106 sperm/mL in Brackett and Oliphant medium (Brackett and Oliphant, 1975), and supplemented with 2.5 m M caffeine sodium benzoate (Sigma-Aldrich Canada Ltd), 0.3% B S A and 20 pg/mL heparin (Sigma-Aldrich Canada Ltd). Sperm droplets (50 uL) were prepared under mineral oil and pre-incubated at 38.5 °C in a humidified atmosphere of 5% CO2 in air for 0 and 6 h. Ten matured oocytes were placed in each of these semen droplets and incubated at 38.5 °C in a humidified 104 atmosphere of 5% CO2 in air. After 14-16 h exposure to sperm, the cumulus cells attached to presumptive zygotes were removed by vortexing for 2-3 min and the denuded presumptive zygotes were washed three times in DPBS supplemented with 0.3 % B S A and stained by nuclear staining procedure described below 4.3.3. Nuclear Staining The denuded presumptive zygotes were washed three times in DPBS solution containing 0.25% pronase (Sigma-Aldrich Canada Ltd) to remove accessory sperm and then fixed in a 2.5% glutaraldehyde solution (Sigma-Aldrich Canada Ltd) for 10 min. The presumptive zygotes were then washed three times in DPBS solution supplemented with 0.3% B S A to remove the glutaraldehyde and incubated in 50 pL drops of 10 pg/mL bisbenzamide stain (Sigma-Aldrich Canada Ltd) at 38.5 °C in a dark humidified atmosphere of 5% CO2 in air. After 10 min incubation, presumptive zygotes were washed three times in DPBS solution supplemented with 0.3% B S A before being transferred to a clean glass slide, and slightly compressed under cover slip supported on the corners by a mixture vaseline and mineral oil (Sigma-Aldrich Canada Ltd). The slides were stored in dark humidified chamber until counting the number of pronuclei under the fluorescent microscope using U V - 2 A filter combination (excitation filter of 330 - 380 nm and barrier filter of 420 nm) at 100 to 400 times magnification. The oocytes containing either a bright blue germinal vesicle, or one polar body and metaphase spindle were considered as unfertilized (Plate 4.1.). The oocytes containing 2 bright blue polar bodies in the peri-vitelline space and 2 or more than 2 bright blue pronuclei were considered fertilized and thus called zygotes (Plate 4.1.). The zygotes 105 containing 2 polar bodies and 2 pronuclei were considered normally fertilized and those containing 2 polar bodies and more than 2 pronuclei were considered polyspermic. 4.3.4. Field Fertility Data and Other Sperm Parameters The field fertility and pre-freeze motility data of all the experimental bulls in question were obtained from the records of the A l center in order to estimate the degree of correlation between the field fertility and in-vitro fertilization parameters. The field fertility data for each bull were based on 60-90 day non-return rate to first insemination with semen of that particular bull. The number of inseminations ranged from 335 to 637. The sperm acrosome reaction, sperm-zona binding and the in-vitro embryo production data used in this study were obtained from the previous experiment (Chapter 3). 4.3.5. Statistical Analyses Analysis of variance was used to compare the sperm concentration and pre-incubation time related effects of bull on in-vitro fertilization. An arcsine transformation was conducted on all percentage data before analysis and a Fisher's Least Significant Difference test was used to locate differences among experimental bulls of all treatment groups. Pearson's correlation coefficient was used to determine the degree of correlation between in-vivo fertilization and in-vitro fertilization parameters. 4.4. RESULTS 4.4.1. In-vitro Fertilization Rates The in-vitro fertilization results of this study are summarized in table 4.1. Percentage of zygotes was different among bulls in the treatment groups where 0 h pre-106 incubated sperm was used in a sperm:o6cyte ratio of 25,000:1 (p<0.01) and 50,000:1 (p<0.05). Percentage of normally fertilized zygotes containing 2 pronuclei was also different among bulls in the treatment groups where 0 h pre-incubated sperm were used in a sperm:oocyte ratio of 25,000:1 (p<0.01) and 50,000:1 (p=0.062). Percentage of zygotes was different among bulls in the treatment groups where 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 50,000:1 (p<0.05). Percentage of normally fertilized zygotes was different among bulls in the treatment groups where 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 25,000:1 (p<0.05). However, percentage of zygotes in the treatment groups where 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 25000:1 and percentage of normally fertilized zygotes in the treatment groups where 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 50,000:1 were not different among bulls. Whereas, percentage of polyspermic zygotes was different among bulls in the treatment groups where 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 50,000:1 (p<0.05). Percentage of polyspermic zygotes in the treatment groups where 0 h and 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 25,000:1 was not different among bulls. The effect of sperm concentration and sperm pre-incubation time on percentage of zygotes, and normally fertilized and polyspermic zygotes was determined by pooled data and showed in Fig. 4.1. and 4.2. When the sperm:oocyte ratio is increased from 25,000:1 to 50,000:1 the percentage of zygotes as well as normally fertilized zygotes increased in all experimental bulls (56.4±2.1, 68.5+2.0; 51.8+1.9, 61.9+1.7, respectively; p<0.01). When sperm pre-incubation time increased from 0 to 6 h the 107 percentage of zygotes and normally fertilized zygotes was reduced in all experimental bulls (68.3±2.1, 56.5±2.1; 61.8±1.9, 51.9±1.8, respectively; p<0.01). 4.4.2. Correlation Between Sperm Parameters The sperm parameters showing significant correlations are shown in Table 4.2. The percent differences in normally fertilized zygotes between treatment groups where 0 h and 6 h pre-incubated sperm were used in a sperm:oocyte ratio of 25,000:1 showed a high degree of correlation with non-return rates (r = 0.90; p<0.05) of the experimental bulls. High degrees of correlation were also observed between sperm pre-freeze motility, and percentage of zygotes (r = 0.88; p<0.05) and normally fertilized (r = 0.85; p<0.05) zygotes in the treatment group where 6 h pre-incubated sperm were used in a sperm:oocyte ratio of 25,000:1. Increase in acrosome reaction in 4 h pre-incubated sperm was highly correlated with percentage of polyspermic zygotes in the treatment group in which 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 25,000:1 (r = 0.93; p<0.05). The cleavage rate showed a high degree of correlation with percentage of zygotes in the treatment group in which 6 h pre-incubated sperm was used in a sperm:oocyte ratio of 25000:1 (r = 0.90; p<0.05). The percent differences in normally fertilized zygotes between treatment groups where 0 h and 6 h pre-incubated sperm were used in a sperm:oocyte ratio of 50,000:1 showed a high degree of correlation with blastocyst production rate of the experimental bulls (r = 0.85; p<0.05). The sperm-zona binding was not correlated with any of the sperm in-vitro fertilization parameters. 108 4.5. DISCUSSION In the present study, a very efficient and less time consuming nuclear staining technique was used to determine the effect of bull on in-vitro fertilization using short (0 h) and long (6 h) sperm pre-incubation time and normal (25,000:1) and high (50,000:1) sperm:oocyte ratios. The degrees of correlation between these effects on in-vitro fertilization, and in-vivo fertility of bulls measured by 60-90 day non-return rates and other sperm parameters measured in the laboratory were also assessed. In addition, using pooled data of all the bulls, the effect of sperm pre-incubation and sperm concentration on in-vitro fertilization was determined. This is the first study, which showed very high positive correlation between non-return rate and percent difference in normally fertilized zygotes with the increase in sperm pre-incubation time from 0 to 6 h using normal sperm:oocyte ratio. This indicates that when non-return rates go up the fertile life span of sperm in in-vitro capacitation medium goes down with the increase in sperm pre-incubation time. Male dependent variability in in-vitro as well as in-vivo fertilization rates has been observed despite intensive testing and selection of bulls for high fertilization rates (Hillery et al., 1990; Zhang et al. 1995; Kurtu et al., 1996; Larocca et al., 1996; Kreysing et al., 1997). Similarly, a marked variability among individual bulls and different ejaculates from the same bull in their suitability for in-vitro embryo production has been reported (Brackett et al l982; Ohgoda et al., 1988; Kurtu et al. 1996). In the present study, when using normal and high sperm:oocyte ratio, sperm from different experimental bulls showed significant differences in fertilizing capacity with short (0 h) pre-incubation. This supports the findings in the recent studies where sperm 109 concentrations ranging from 0.065 to 0.5 x 106 sperm/ml were used, and significant differences in fertilization rates of the sperm from bulls having non-return rates range from 57 to 78.5 was shown (Ward et al., 2002; 2003). A high degree of correlation between non-return rates and in-vitro fertilization rates at a concentration of 0.5 x 106 sperm/ml was also demonstrated. However, in the present study bull effect on the fertilization at short sperm pre-incubation was not correlated with non-return rates with normal and high sperm:oocyte ratio. This can be attributed to the high concentration (5 x 106 sperm/ml) used in the in-vitro fertilization procedure of present study. In the current study, when using normal sperm:oocyte ratio the polyspermic fertilization was not significantly different among sperm from different experimental bulls in both short and long (6 h) pre-incubation groups. This indicates that polyspermic fertilization is not affected by sperm pre-incubation time at normal sperm:oocyte ratio and this is in agreement with the research findings by Saeki et al. (1995). The exposure of oocytes to high numbers of capacitated sperm has been shown to increase the incidence of polyspermy (Hunter 1991; Kim et al., 1997). In the present study, in high sperm:oocyte ratio, different experimental bulls showed significant differences in their fertilizing capacity in the short and long pre-incubation groups. However, normal fertilization was not significantly different among bulls in the long pre-incubation group. When using the high sperm:oocyte ratio with short sperm pre-incubation, bulls marginally affected the polyspermic fertilization. However, bulls significantly affected polyspermic fertilization with long sperm pre-incubation and high sperm-oocyte ratio. Based on in-vivo and in-vitro studies it has been documented that a high number of sperm in the inseminate increases availability of viable and fertile 110 sperm for fertilization, and thereby increases fertilization rates (Koops et al., 1995; Shannon and Vishwanath, 1995; Heeres et al., 1996; Kommisrud et al., 1996; Fearon and Wegener, 2000; Ward et al., 2003). This is the case in the present study in which the increase from normal to high sperm:oocyte ratio significantly increased the percentage of zygotes and normally fertilized zygotes in both short and long sperm pre-incubation groups. The increase in sperm pre-incubation time from 0 to 6 h significantly reduced the percentage of fertilized as well as normally fertilized zygotes in both low and high sperm:oocyte ratios. This indicates that either in-vitro fertilizing capacity or viability of the sperm is significantly affected by longer pre-incubation in sperm capacitation medium. This supports the findings of the recent studies in which the fertile lifespan of sperm was assessed in-vitro with various media supplements after 8 h pre-incubation (Fukui et al., 1990; Gliedt et al., 1996; Pavlok 2000; Lechniak et al., 2003). The bovine serum albumin and heparin supplements in the sperm pre-incubation and the in-vitro fertilization media significantly reduced the percentage of penetrated oocytes, after 8 h pre-incubation only 3.5 % of the oocytes showed penetration. However, in the present experiment, the sperm pre-incubation and in-vitro fertilization in the same medium also showed a reduction in fertilization rate after a longer sperm pre-incubation, but with 56.5% zygotes showing two or more than two pronuclei. This indicates that the reduction in the in-vitro fertilizing capacity with sperm pre-incubation varies with experimental conditions in the different laboratories and is very high after 6 h pre-incubation in capacitation medium. I l l < In the current study, the bulls showing higher non-return rates showed significant reductions in in-vitro fertilizing capacity with increased sperm pre-incubation time with the normal sperm:oocyte ratio. A very high positive correlation was observed between non-return rate and percentage difference in normally fertilized zygotes with the increase in sperm pre-incubation time from 0 to 6 h using normal sperrmoocyte ratio. This indicates that sperm from these bulls lose their fertilizing capacity rapidly and i f they are present in large numbers, it will result in abnormal fertilization with more than two pronuclei. This is documented in the present study in which sperm from bulls showing higher non-return rates tended to show higher percentages of polyspermic fertilization in normal as well as high sperm:oocytes ratio. In the in-vitro fertilization system, an increase in the time of sperm:oocyte co-culture increases the incidence of oocyte penetration and polyspermy (Chian et al., 1992; Sumantri et al., 1997; Kreysing et al., 1997). Hence, exposure of oocytes to high numbers of fertile sperm for a long period increases the chances of polyspermic fertilization. The polyspermic embryos undergo degeneration within two weeks after fertilization. In the present study, very high positive correlation was observed between non-return rate and percentage difference in normally fertilized zygotes with the increase in sperm pre-incubation time from 0 to 6 h using normal sperm:oocyte ratio. This might be an indication that only very good quality sperm fertilize the oocytes and most of the defective sperm lose their viability after 6 h in-vitro pre-incubation. This notion supports the previous finding that the optimum time for artificial insemination is 4-14 h after the onset of estrus. Because i f the animal is inseminated 4-14 h after onset of 112 estrus, only the good quality sperm, which show long fertile lifespan, fertilize the oocytes and most of the defective sperm are neither fertile nor viable at the time of ovulation (Dransfield et al., 1998; Nebel et al., 2000). In addition, the fertilized zygote is surrounded by a very small number of viable as well as highly fertile sperm i f the animal is inseminated early in estrus. This concept is also supported by previous findings in which animals inseminated 24 h after the onset of estrus, although showing high fertilization rates and high numbers of accessory sperms, yielded poor quality blastocysts compared to 0 and 12 h insemination groups (Foote, 1978; Dalton et al., 2001). This is attributed to the availability of high numbers of viable and fertile sperm at the time of fertilization in the animals inseminated 24 h after the onset of estrus. Motility is a very important characteristic of sperm to help reaching the oocyte after transport through the female reproductive tract and the cumulus investment of the oocyte to bind and penetrate through the zona in a successful fertilization process. Hence, sperm motility is routinely used as evaluation criteria for the selection of bulls with varying degrees of correlation to field fertility (Bailey et al., 1994; Correa et al., 1997). In the current study, although the pre-freeze motility is not correlated with field fertility, it is correlated with percentage of zygotes and normally fertilized zygotes in the treatment group where longer pre-incubated sperm were used in normal sperm:oocyte ratio. A high degree of correlation was observed between percentage of polyspermic zygotes produced by using longer sperm pre-incubation with normal sperm:oocyte ratio, and increase in acrosome reaction in 4 h pre-incubated sperm. This supports the previous findings in which the exposure of oocytes to a high number of capacitated sperm has been shown to increase the incidence of polyspermy (Hunter 113 1991; K i m et al., 1997). The cleavage rate of the experimental bulls showed a high degree of correlation with the percentage of zygotes produced by using longer sperm pre-incubation with normal sperm:oocyte ratio. The percentage of difference in normally fertilized zygotes between treatment groups where short and long pre-incubated sperm were used in a high sperm:oocyte ratio showed a high degree of correlation with the blastocyst production rates of the experimental bulls. This supports the research findings of Zhang et al. (1999) and Ward et al. (2003) in which the cleavage and blastocyst production rates are correlated with field fertility measured by 60-90 day non-return rates. This correlation changes with number of sperm used for in-vitro fertilization. 4.6. CONCLUSION In the present study, bull influence on fertile lifespan of sperm was assessed by in-vitro fertilization technique using 0 and 6 h pre-incubated sperm in sperm:oocyte ratios of 25,000:1 and 50,000:1. Based on this study, it is concluded that the fertile lifespan of sperm from bulls showing higher field fertility measured by 60-90 day non-return rates reduces with in-vitro pre-incubation in capacitation medium. This measure may be potentially used for the prediction of bull fertility in the field. The increase in pre-incubation time reduces in-vitro fertilizing capacity of sperm, whereas increase in the concentration increases the in-vitro fertilizing capacity of sperm. 114 Table 4.1. Effect of sperm pre-incubation time and sperm concentration of bulls on the percentage of fertilized, normally fertilized and polyspermic zygotes obtained 14-16 h post insemination. The semen from six experimental bulls (Si-Se) was used with oocytes collected from slaughterhouse ovaries to produce presumptive zygotes. The presumptive zygotes were stained by bisbenzamide and evaluated under the fluorescent microscope. The zygotes showing two polar bodies and two pronuclei were considered as normally fertilized. The zygotes showing two polar bodies and more than two pronuclei were considered as polyspermic. The fertilized zygotes included both normally fertilized and polyspermic zygotes. Sperm pre- Bull Numbers incubation time s, s2 s3 s4 s5 s6 Percentage of zygotes (M±SEM)Z Oh ab 71.7±4.8 c 45.0+4.3 a 83.316.2 be 65.015.0 c 51.714.8 c 50.014.5 (sperm to oocyte ratio of 25000:1) 6h 50.0±3.7 51.716.0 63.319.9 58.319.8 51.7+3.1 50.015.8 Percentage of normally fertilized zygotes Oh a 66.7±4.9 b 45.014.3 a 71.717.0 ab 60.013.7 b 43.313.3 b 46.714.2 (M±SEM)Z (sperm to oocyte ratio of 25000:1) 6h ab 48.3±4.0 b 45.014.3 a 58.317.9 a 58.319.8 b 46.7+3.3 ab 46.716.2 Percentage of polyspermic zygotes (M±SEM)Z (sperm to oocyte ratio of 25000:1) Oh 5.0±2.2 0 11.716.0 5.012.2 8.313.1 3.313.3 6h 1.7+1.7 6.714.9 5.013.4 0 5.013.4 3.3+2.1 Percentage of zygotes (M±SEM)Z Oh abc 78.314.0 c 56.715.6 a 90.013.7 ab 78.314.8 abc 73.3+8.0 be 71.716.0 (sperm to oocyte ratio of 50000:1) 6h c 51.714.8 c 53.3+4.2 a 75.018.5 abc 63.314.9 ab 71.713.1 be 58.316.5 Percentage of normally fertilized zygotes Oh a 71.713.1 b 51.7+4.8 a 78.316.5 ab 70.015.2 ab 65.018.5 ab 66.713.3 (M±SEM)Z (sperm to oocyte ratio of 50000:1) 6h 51.714.8 51.714.8 63.316.1 60.015.2 61.7+4.8 51.7+4.8 Percentage of polyspermic zygotes (M±SEM)Z Oh 6.712.1 5.012.2 11.716.5 8.315.4 8.314.8 5.013.4 (sperm to oocyte ratio of 50000:1) 6h c 0 c 1.711.7 a 11.713.1 be 3.312.1 ab 10.014.5 abc 6.713.3 a,b,c — Means with different superscripts within rows differ (PO.05). (For percentage of normally fertilized zygotes using 50,000:1 sperm-oocyte ratio and 0 h pre-incubation time group p=0.062). z - Arithmetic mean and standard error of the percentage of zygotes, and normally fertilized and polyspermic zygotes obtained by fertilization of oocytes with sperm from different experimental bulls. 115 Table 4.2. Pair-wise comparison of percentage of zygotes when 6 h pre-incubated sperm was used in sperm to oocyte ratio of 25,000:1 (T2Cl-Zy), percentage of normally fertilized zygotes when 6 h pre-incubated sperm was used in sperm to oocyte ratio of 25,000:1 (T2C1-2PN), percentage of polyspermic zygotes when 6 h pre-incubated sperm was used in sperm to oocyte ratio of 25,000:1 (T2C1->2PN), percentage of difference in normally fertilized zygote between 0 and 6 h pre-incubated sperm used in sperm to oocyte ratio of 25,000:1 (ClDif-2PN), percentage of difference in normally fertilized zygotes between 0 and 6 h pre-incubated sperm used in sperm to oocyte ratio of 50,000:1 (C2Dif-2PN), sperm pre-freeze motility (PrFM), increase in acrosome reaction from 0 to 4 h pre-incubation of sperm (InAR), cleavage rate(CL), blastocyst production rate (BL) and 60-90 day non-return rates (NRR). T2C1-Zy T2C1-2PN T2C1->2PN ClDif-2PN C2Dif-2PN PrFM InAR C L BL T2C1-2PN 0.97* T2C1->2PN -0.36 -0.57 ClDif-2PN . -0.12 -0.15 0.20 C2Dif-2PN 0.50 0.59 -0.57 0.24 PrFM 0.88* 0.85* -0.46 -0.27 0.65 InAR -0.07 -0.29 0.93* 0.30 -0.26 -0.18 CL 0.90* ' 0.77 0.08 -0.12 0.28 0.76 0.36 BL 0.61 0.63 -0.38 -0.14 0.85* 0.72 -0.06 0.53 NRR -0.16 -0.23 0.36 0.90* -0.12 0.36 0.36 -0.11 -0.48 * Comparisons showing significant correlations at PO.05. 116 A ) B) Plate 4.1. Fluorescence microscopic images of bovine unfertilized oocytes, and zygotes showing normal and abnormal fertilization after staining with bisbenzamide. The photographs were taken at 400x magnification using UV-2A filter combination (excitation filter of 330 - 380 nm and barrier filter of 420 nm). The oocytes containing either bright blue germinal vesicle (A) or one polar body and metaphase spindle (B) were considered as unfertilized. The zygotes containing 2 polar bodies and 2 pronuclei were considered as normally fertilized (C) and the zygotes containing 2 polar bodies and more than 2 pronuclei were considered as polyspermic (D). 117 • O h • 6 h Zygotes Normally Fertilized Polyspermic Zygotes Zygotes Figure 4.1. Percentage of zygotes, and normally fertilized and polyspermic zygotes obtained 14-16 h post insemination using 0 and 6 h pre-incubated sperm. a,b - Bars with different superscripts within each group of bars differ significantly (P<0.01). 118 80 70 -60 -Co 50 -4) <M a 40 -J -a p 30 _ J 20 -i -CU U H 10 -0 -• 25,000 Spermrl Oocyte P50 , 000 Spermrl Oocyte Zygotes Normally Fertilized Zygotes Polyspermic Zygotes Figure 4.2. Percentage of zygotes, normally fertilized and polyspermic zygotes obtained 14-16 h post insemination using sperm:oocyte ratio of 25,000:1 and 50,000:1. a,b - Bars with different superscripts within each group of bars differ significantly (PO.01). 119 4.7. REFERENCES Agca Y , Liu J, Rutledge JJ, Critser ES, Critser JK. 2000. Effect of osmotic stress on the developmental competence of germinal vesicle and metaphase II stage bovine cumulus oocyte complexes and its relevance to cryopreservation. Mol Reprod Dev 55, 212-219. Bailey JL, Robertson L , Buhr M M . 1994. Relationships among in vivo fertility, computer analyzed motility and in vitro C a 2 + flux in bovine spermatozoa. Can. J. Anim. Sci. 74, 53-58. Boediono A , Takagi M , Saha S, Suzuki T. 1994. Influence of Day 0 and Day 7 superovulated cow serum during development of bovine oocytes in vitro. Reprod Fertil Dev 6, 261-264. Brackett B G , Cofone M A , Boice M L , Bousquet D. 1982. Use of zona-free hamster ova to assess sperm fertilizing ability of bull and stallion. Gamete Res 5, 217-227. Brackett B G , Oliphant G. 1975. Capacitation of rabbit spermatozoa in vitro. Biol Reprod 12, 260-274. Cherr G N , Ducibella T, 1990. Activation of the mammalian egg; cortical granule distribution, exocytosis, and the block to polyspermy. In: Bavister, B.D., Cummins, J., Roldan, E.R.S. Eds., Fertilization in Mammals. Serono Symp. Norwell, M A , pp. 309-330. Chian RC, Nakahara H , Niwa K , Funahashi H . 1992. Fertilization and early cleavage in vitro of aging bovine oocytes after maturation in culture. Theriogenology 37, 665-672. Correa JR, Pace M M , Zavos P M . 1997. Relationship among frozen-thawed sperm characteristics assessed via the routine semen analysis, sperm functional tests and fertility of bulls in an artificial insemination program. Theriogenology. 48:721-731. Dalton JC, Nadir S, Bame JH, Noftsinger M , Nebel RL , Saacke RG. 2001. Effect of time of insemination on number of accessory sperm, fertilization rate, and embryo quality in nonlactating dairy cattle. J Dairy Sci 84, 2413-2418. den Daas JHG, DeJong G, Lansbergen L , Van Wagtendonk-De Leeuw A M . 1998. The relationship between the number of spermatozoa inseminated and the reproductive efficiency of individual bulls. J Dairy Sci 81, 1714-1723. 120 Dransfield M B G , Nebel RL , Pearson RE, Warnick L D . 1998. Timing of insemination for dairy cows identified in estrus by a radiotelemetric estrus detection system. J Dairy Sci. 81, 1874-1882. Ducibella T. 1996. The cortical reaction and development of activation competence in mammalian oocytes. Human Reprod Update 2, 29-42 Fearon JM, Wegener PT. 2000. Relationship between fertility in cattle and the number of inseminated spermatozoa. J Reprod Fertil 119, 293-308. Foote R H . 1970. Influence of extender, extension rate, and glycerolating technique on fertility of frozen bull semen. J Dairy Sci 53, 1478-1482. Foote R H . 1978. Time of artificial insemination and fertility in dairy cattle. J Dairy Sci 62,355-358. • Fukui Y , Sonoyama T, Mochizuki H , Ono H . 1990. Effects of heparin dosage and sperm capacitation time on in vitro fertilization and cleavage of bovine oocytes matured in vitro. Theriogenology 34, 579-591. Gliedt DW, Rosenkrans CF jr, Rorie RW, Rakes JM. 1996. Effects of oocyte maturation length, sperm capacitation time, and heparin on bovine embryo development. J Dairy Sci 79, 532-535. Gordon I, Lu K H . 1990. Production of embryos in vitro and its impact on livestock production. Theriogenology 33, 77-88. Hawk HW. 1987. Transport and fate of spermatozoa after insemination of cattle. J. Dairy Sci. 70, 1487-1503. Heeres A A , Merton JS, Hazeleger W, van Wagtendonk-de Leeuw A M , Kemp B. 1996. Optimization of sperm./oocyte ratio during in vitro fertilization of bovine cumulus-oocytes-complexes. Theriogenology 45, 266. Hillery FL , Parrish JJ, First N L . 1990. Bull specific effect on fertilization and embryo development in vitro. Theriogenology 33, 249. Hunter RHF. 1991. Oviduct function in pigs with particular reference to the pathological condition of polyspermy. Mol Reprod Dev 29, 385-391. Iwasaki S, Shioya Y , Masuda H , Hanada A, Nakahara T. 1989. Incidence of chromosomal anomalies in early bovine embryos derived from in vitro fertilization. Gamete Research 22, 83-91. 121 K i m N H , Do JT, Song H , Koo DB, Kim JH, Lee HT, Chung KS. 1997. Involvement of adrenergic system on the cortical granule exocytosis and polyspermic penetration during in vitro fertilization of porcine oocytes. Theriogenology 48, 1351-1360. Kjaestad TG, Stubbings RB. 1992. Sire and insemination dose does effect in vitro fertilization of bovine oocytes. Theriogenology. 37, 240. Kommisrud E, Steine T, Graffer T. 1996. Comparison of fertility rates following insemination with different numbers of spermatozoa per insemination dose of frozen bovine semen. Reprod Dom Anim 31, 359-362. Koops WJ, Grossman M , den Daas JHG. 1995. A model for reproductive efficiency of dairy bulls. J Dairy Sci 78, 921-928. Kreysing U , Nagai T, Niemann H. 1997. Male-dependent variability of fertilization and embryo development in two bovine in vitro fertilization systems and the effects of casein phospholipids (CPPs). Reprod Fertil Dev 9, 465-474. Kurtu JM, Ambrose JD, Rajamahendran R. 1996. Cleavage rate of bovine oocytes in-vitro is affected by bulls but not sperm concentrations. Theriogenology 45, 257. Larocca C, Romad JE, Calvo J, Lago I, Fila D, Roses G, Viqueira M , Kmaid S, Imai K . 1996. Relation between bulls and semen preparation on in vitro production of bovine embryos. Theriogenology 45, 267. Lechniak D, Strabell T, Bousquet D, King A W . 2003. Sperm pre-incubation prior to insemination affects the sex ratio of bovine embryos produced in vitro. Reprod Dom Anim 38, 224-227 Long CR, Chase C N , Balise JJ, Duby RT, Robl JM. 1993. Effect of sperm removal time, sperm concentration and motility enhancers on fertilization parameters and development of bovine embryos in vitro. Theriogenology39, 261. Long CR, Damiani C, Pinto-Correia C, MacLean R A , Duby RT, Robl JM. 1994. Morphology and subsequent development in culture of bovine oocytes matured in vitro under various conditions of fertilization. J Reprod Fertil 102, 361-369. Maatje K , Loeffler SH, Engel B. 1997. Optimal time of insemination in cows that show visual signs of estrus by estimating onset of estrus with pedometers. J Dairy Sci 80, 1098-1105. 122 Marquant-Le Guienne B, Humblot P, Thibier M , Thibault C. 1990. Evaluation of bull semen fertility by homologous in vitro fertilization tests. Reprod Nutr Dev 30, 259-266. Nadir S, Saacke RG, Bame J, Mullins J, Degelos S. 1993. Effect of freezing semen and dosage of sperm on number of accessory sperm, fertility, and embryo quality in artificially inseminated cattle. J Anim Sci 71, 199-204. Nebel RL , Dransfield M G , Jobst SM, Bame JH. 2000. Automated electronic systems for the detection of oestrus and timing of A l in cattle. Anim Reprod Sci 60-61, 713-723. Nebel R L , Walker WL, McGilliard M L , Allen C H , Heckman GS. 1994. Timing of insemination of dairy cows: fixed time once daily versus morning and afternoon. J Dairy Sci 77,3185-3191. Niwa K , Park CK, Okuda K . 1991. Penetration in vitro of bovine oocytes during maturation by frozen-thawed spermatozoa. J Reprod Fertil 91, 329-336. Ohgoda O, Niwa K , Yuhara M , Takahashi S, Kanoya K. 1988. Variation in penetration rates in vitro of bovine follicular oocytes do not reflect conception rates after artificial insemination using frozen semen from different bulls. Theriogenology 29, 1375-1381. Pavlok A . 2000. D-Penicillinamine and granulose cells can effectively extend the fertile life span of bovine frozen-thawed spermatozoa in vitro: effect on fertilization and polyspermy. Theriogenology 53, 1135-1146. Petersen ET, Petrounkina A M , Hundrieser M E . 2000. Oocyte-sperm interactions. Anim Reprod Sci 60-61, 653-662. Pinto-Correia C, Long C, Duby RT, Robl JM. 1992. Development of polyspermic cow zygotes after multiple sperm aster formation. Mol Biol Cell 3, 16. Rajamahendran R, Robinson J, Desbottes S, Walton JS. 1989. Temporal relationships among estrus, body temperature, milk yield, progesterone and luteinizing hormone levels, and ovulation in dairy cows. Theriogenology 31, 1173-1182. Saacke RG. 1982. Components of semen quality. J Anim Sci 55(Suppl. 2), 1-13. Saacke RG, Dalton JC, Nadir S, Nebel RL , Bame JH. 2000. Relationship of seminal traits and insemination time to fertilization rate and embryo quality. Anim Reprod Sci 60-61, 663-677. 123 Saeki K , Hoshi Y , Nagai M . 1995. Effects of heparin, sperm concentration and bull variation on in vitro fertilization of bovine oocytes in a protein-free medium. Theriogenology 43, 751-759. Saeki K , Kato H , Hosoi Y , Miyake M , Utsumi K , Iritani A . 1991. Early morphological events of in vitro fertilized bovine oocytes with frozen-thawed spermatozoa. Theriogenology 35, 1051-1058. Senger PL. 1994. The estrous detection problem: new concepts, technologies, and possibilities. J. Dairy Sci. 77, 2745-2753. Shamsuddin M , Larsson B. 1993. In vitro development of bovine embryos after fertilization using semen from different donors. Reprod Dom Anim 28, 77-84. Shannon P. 1978. Factors affecting semen preservation and conception rates in cattle. Journal of Reproduction and Fertility. 54, 519-527. Shannon P, Vishwanath R. 1995. The effect of optimal and suboptimal concentrations of sperm on the fertility of fresh and frozen bovine semen and a theoretical model to explain the fertility differences. Anim Reprod Sci 39, 1-10. Sumantri C, Boediono A , Ooe M , Murakami M , Saha T, Suzuki. 1997. The effect of sperm-oocyte incubation time on in vitro embryo development using sperm from a tetraparenteral chimeric bull. Anim Reprod Sci 48, 187-195. Tajik P, Niwa K , Murase T. 1993. Effects of different protein supplements in fertilization medium on in vitro penetration of cumulus-intact and cumulus-free bovine oocytes matured in culture. Theriogenology 40, 949-958. Thibault C. 1973. Sperm transport and storage in vertebrates. J Reprod Fertil 18(Suppl.), 39-53. Trimberger GW. 1948. Breeding efficiency in dairy cattle from artificial insemination at various intervals before and after ovulation. Nebraska Agric Exp Stn Res Bull 153, 1-26. Trimberger GW, Davis HP. 1943. Conception rate in dairy cattle from artificial insemination at various stages of estrus. Nebraska Agric Exp Stn Res Bull 129, 1-14. Trounson A . 1992. The production of ruminant embryos in vitro. Anim Reprod Sci 28, 125-137. 124 Visconti Pablo E, Kopf Gregory S. 1998. Regulation of protein phosphorylation during sperm capacitation. Biol Reprod 59, 1-6. Walker W L , Nebel RL , McGilliard M L . 1996. Time of ovulation relative to mounting activity in dairy cattle. J Dairy Sci. 79, 1555-1561. Ward F, Enright B, Rizos D, Boland MP, Lonergan P. 2002. Optimization of in vitro bovine embryo production: effect of duration of maturation, length of gamete co-incubation, sperm concentration and sire. Theriogenology 57, 2105-2117. Ward F, Rizos D, Boland MP, Lonergan P. 2003. Effect of reducing sperm concentration during IVF on the ability to distinguish between bulls of high and low field fertility: work in progress. Theriogenology 59, 1575-1584. Wassarman P M , Albertini DF. 1994. The mammalian ovum. Knobil, E.; Neill, J. D.: Eds. The physiology of reproduction, Second edition, Vols. 1 and 2. pp. 79-122. Wassarman P M . 1999. Mammalian fertilization: Molecular aspects of gamete adhesion, exocytosis, and fusion. Cell 96, 175-183. Wilmut I, Hunter RHF. 1984. Sperm transport into the oviducts of heifers mated early in oestrus. Reprod. Nutr. Dev. 24, 461-468. X u K P , Greve T. 1988. A detailed analysis of early events during in vitro fertilization of bovine follicular oocytes. J Reprod Fertil 82, 127-134. Yanagimachi R. 1994. Mammalian fertilization. In: Knobil, E., Neill, J.D. Eds., The Physiology of Reproduction. Raven Press, N Y , pp. 189-317. Zhang BR, Larsson B, Lundeheim N , Haard M G H , Rodriguez-Martinez H . 1999. Prediction of bull fertility by combined in vitro assessments of frozen-thawed semen from young dairy bulls entering an A l program. Int. J. Androl. 22, 253-260. Zhang BR, Larsson B, Rodriguez-Martinez H . 1995. Influence of batches of bovine oocytes on the outcoume of an intact zona pellucida binding assay and in vitro fertilitzaion. Int J Androl 18, 213-220. 125 CHAPTER 5 - BULL INFLUENCE ON APOPTOSIS, AND EXPRESSION OF Bcl2, Bax, P53, HEAT SHOCK PROTEIN 70 AND INTERFERON TAU GENES IN PREIMPLANTATION EMBRYOS 5.1. PREFACE The bull effects on development, apoptosis, and expression of Bax, Bcl-2, p53, heat shock protein 70 (HSP70) and interferon tau (IFNx) genes in in-vitro produced embryos were investigated in this study. The degree of correlation of this effect with the 60-90 day non-return rates was also investigated. Frozen semen from three separate ejaculates of six genetically unrelated bulls (Bi-Be) was used. Ejaculates from each bull were pooled to minimize variability among ejaculates. Oocytes obtained from slaughterhouse ovaries were matured and incubated with sperm from experimental bulls in a standard in-vitro fertilization and embryo culture procedure to obtain morula to blastocyst stage embryos. Cleavage and morula to blastocyst development rates were determined at 72 h and 168 h post insemination, respectively. The number of live, apoptotic, and dead cells of morula to blastocyst stage embryos was counted after staining with annexin V , propidium iodide, and bisbenzamide. Bax, Bcl-2, p53, HSP70 and IFNx gene expression levels in morula to blastocyst stage embryos were determined by reverse transcription polymerase chain reaction. The non-return rate data for all experimental bulls were obtained from a local artificial insemination center. Cleavage and morula to blastocyst development rates were different (P<0.01) among bulls. Percent apoptotic, live and dead cells in morula to blastocyst stage embryos were 126 different (P<0.01) among bulls. The expression levels of HSP70 and IFNx genes in morula to blastocyst stage embryos were different (P<0.01) among bulls. The expression levels of Bax, Bcl-2 and p53 genes in morula to blastocyst stage embryos were not different among bulls. Percentage of live cells was positively correlated with cleavage rate (r = 0.61), morula to blastocyst development rate (r = 0.73), and expression levels of interferon tau (r = 0.58) and heat shock protein 70 (r = 0.57) genes. Percentage of apoptotic cells was negatively correlated (p<0.05) with cleavage rate (r = -0.57), morula to blastocyst development rate (r = -0.67), and IFNx (r = -0.56) and HSP70 (r = -0.51) gene expression levels. The field fertility measured by 60-90 day non-return rate is highly correlated (p<0.05) with relative abundance of Bcl-2 mRNA transcripts (r = -0.93) and the ratio of Bax to Bcl-2 gene expression (r = 0.84;). None of the other in-vitro embryo parameters was correlated with 60-90 day non-return rate. 5.2. INTRODUCTION There are approximately 30% and 40% embryonic losses observed in cattle by day 7 and by day 8-17 after fertilization, respectively. This indicates that early embryonic mortality is the main cause of reproductive wastage (Humblot 2001; Thatcher et al., 1994, 2001; Bilodeau-Goeseels and Kastelic, 2003). The main reasons for embryonic losses could be due to intrinsic defects within embryo (Gustafsson and Larsson 1983), suboptimal oviductal and uterine environment (Lafrance et al., 1989; Gray et al., 2001) or insufficient interaction of the embryo with the oviduct and the endometrium (Goff, 2002; Hansen, 2002). There is very little information available on intrinsic defects within the embryo. Apoptosis is an energy-requiring, genetically 127 regulated multi-step process that initiates the cleavage of many proteins. The cleavage of these proteins mediates final cell death alteration in some specific cells in a cell suicidal program (Bloom and Muscarella, 1998). Apoptosis and mitosis are the key events regulating early embryonic differentiation and development (Hardy, 1997; Kolle et a l , 2002). Hence, some of the intrinsic defects in the embryo may be reflected by an increase in number of blastomeres undergoing apoptosis. The stimulus for apoptosis can be intracellular such as D N A damage, excess production of reactive oxygen species, or extra cellular such as heat stress. The D N A damage in the embryo can be reflected by an increase in the expression of p53, a 53 kDa tumor suppressor protein, which acts as a transcription factor for several pro-apoptotic genes (Betts and King, 2001). The mitochondrial pathway and the death receptor pathway have been identified as two major pathways for programmed cell death (Ingo et al., 2000). Members of Bcl-2 protein family are involved in the regulation of the mitochondrial pathway. These proteins are subdivided into two major groups: pro- and anti-apoptotic proteins (Antonsson, 2001). Expression of pro- and anti-apoptotic proteins was demonstrated in bovine pre-implantation embryos (Kolle et al., 2002; Matwee et al., 2000; Yang and Rajamahendran, 2002). A balanced expression of pro- and anti-apoptotic proteins is necessary for successful development and growth of the embryo (Warner et al., 1998; Kolle et al., 2002). External stress factors originating from oviductal and uterine environment change the expression pattern of pro- and anti-apoptotic proteins to predispose blastomeres to signal induced apoptosis (Jurisicova et al., 1998). One of the main factors in this category is heat stress. The survival of the embryo depends on the degree to which it can either adjust its own physiology to withstand external stress 128 factors or act on the mother to restore its favorable microenvironment (Hansen, 2002). The embryo can adjust its own physiology by producing increased amounts of heat shock protein 70 (HSP70), a 70 kDa protein. Expression of this protein in bovine pre-implantation embryos subjected to various stress factors has been shown in the past (Edwards and Hansen, 1997; Edwards et al., 1997; Al-Katanani and Hansen, 2002). The embryo produces various signals to manipulate its oviductal and uterine microenvironment. The high failure rate in maintaining the pregnancy is assumed to be due to insufficient communication between embryo and mother. One of the main signals produced by the embryo is the expression of IFNT , which acts on the endometrium to prevent the production of PGF2 alpha and thereby maintain the corpus luteum of pregnancy (Wolf et al., 2003). The quality of the embryo is determined at the time of oocyte maturation, in vitro fertilization, initial embryonic cell divisions and embryonic genome activation, and by sufficient expression of developmentally essential genes at correct time points (Hansen, 2002). Therefore, the successful execution of embryo developmental program is partially determined at the time of fertilization by genetic and non-genetic inheritance that an embryo receives from the oocyte or sperm. It has been shown that chromosomes in some of the morphologically normal spermatozoa undergo aberration during spermatogenesis and these spermatozoa could fertilize normally (Bochenek et al., 2001). Sperm chromatin damage due to stress varies with bull and significantly reduces the fertility due to embryonic mortality at the time of embryonic genome activation and the expression of developmentally essential genes (Evenson, 1999). Paternal influence on first cleavage division of the embryo and its relationship to embryo development was also reported recently (Warner et al., 1998; 129 Comizzoli et al., 2000;Ward et al., 2001). Hence studies based on these parameters in the embryo can reveal the fertility of the male. Accurate prediction of bull fertility in the field by laboratory evaluation of semen samples is a long time goal for the A l industry. Although bulls are selected for high production traits and various sperm parameters, their fertilizing ability shows considerable variation in the field. Since embryonic mortality is very high during the first week of development when activation of the embryonic genome takes place, it was hypothesized that the bull has influence on embryo apoptosis and expression of developmentally essential genes, and this influence can be reflected by field fertility. The objective of this experiment was to investigate the effect of the bull on viability of in vitro produced embryos by measuring cleavage and blastocyst development rates, and percentage of live, apoptotic and dead cells, and expression levels of Bcl-2, Bax, p53, HSP70 and IFNx genes in morula to blastocyst stage embryos and to determine the degree of correlation of this bull effect with 60-90 day non-return rates. 5.3. MATERIALS AND METHODS 5.3.1. Experimental Design Frozen semen from three separate ejaculates collected from six genetically unrelated bulls (of which three exhibited high field fertility and the other three low field fertility) were selected based on their pedigree information over the 4-5 generations. Ejaculates from each bull collected at three different collection periods were pooled before being subjected to in-vitro fertilization to minimize variability among ejaculates. 130 Oocytes collected from slaughterhouse ovaries were randomly assigned for in-vitro fertilization with spermatozoa from each bull to produce embryos for staining (n = 10) and semi-quantitative reverse transcription polymerase chain reaction (RT-PCR; n = 15). The in-vitro fertilization was repeated four times per bull and 480 oocytes were allocated per bull. Both staining and semi-quantitative RT-PCR were also repeated four times with a total of 100 morula to blastocyst embryos per bull. 5.3.2. In-vitro Embryo Production Bovine ovaries were collected at a local slaughterhouse and transported to the laboratory in normal saline (0.9% NaCl; Sigma-Aldrich Canada Ltd, Oakville, ON) supplemented with penicillin-G (100 IU/mL; Sigma-Aldrich Canada Ltd) and streptomycin sulphate (0.2 pg/mL; Sigma-Aldrich Canada Ltd) at 30-32 °C in a thermos flask. Cumulus oocyte complexes from small 2-8 mm follicles were collected into an aspiration medium using an 18-G needle and a 10-mL syringe. The medium contained Dulbecco's phosphate buffered saline (DPBS; GIBCO B R L , Canadian Life Technologies, Burlington, ON), 0.3% bovine serum albumin (BSA; Sigma-Aldrich Canada Ltd) and 50 pg/mL gentamicin (Sigma-Aldrich Canada Ltd). Oocytes with an evenly granulated cytoplasm and surrounded by more than three layers of cumulus cells were selected for maturation. These oocytes were cultured in maturation medium for 24 h at 38.5 °C in a humidified atmosphere of 5% CO2 in air. The maturation medium consisted of tissue culture medium 199 (TCM199; Sigma-Aldrich Canada Ltd), 0.01 mg/mL follicle stimulating hormone, 5% superovulated cow serum (SCS; Boediono et al., 1994) and 50 pg/mL gentamicin. Three straws containing frozen semen from a test bull, collected at three different times, were thawed at 37 °C, pooled and washed twice 131 by centrifugation at 500g for 5 min in Brackett and Oliphant medium (BO medium; Brackett and Oliphant, 1975). The viable spermatozoa were swim-up separated, diluted to 5 x 106 sperm/mL in BO medium, and containing 2.5 m M caffeine sodium benzoate (Sigma-Aldrich Canada Ltd) and 20 pg/mL heparin (Sigma-Aldrich Canada Ltd). Six sperm droplets (100 pL each) were prepared under mineral oil and pre-incubated at 38.5 °C in a humidified atmosphere of 5% CO2 in air for 1 h. Twenty matured oocytes were placed in each of these sperm droplets and incubated at 38.5 °C in a humidified atmosphere of 5% CO2 in air for 16-18 h. The presumptive zygotes were then cultured in media prepared by mixing TCM-199, 5% SCS, 5 pg/mL insulin (Sigma-Aldrich Canada Ltd) and 50 pg/mL gentamicin (Boediono et al., 1994), in four-well culture dishes at 38.5 °C in a humidified atmosphere of 5% C 0 2 in air. The culture media was changed every 72 h. The uncleaved presumptive zygotes were removed and the cleavage rate was assessed at 72 h post insemination. During in vitro culture, morula to early blastocyst stage embryos (n = 25) were randomly collected at 168 h post insemination. Their cumulus cells were removed by gentle pipetting in 0.3% hyaluronidase solution before ten were stained, and fifteen were subjected to the RT-PCR procedure. 5.3.3. Differential Embryo Staining Annexin V-FITC Apoptosis Detection kit (Sigma-Aldrich Canada Ltd) was used with bisbenzamide (Sigma-Aldrich Canada Ltd) to differentially stain embryos to detect live, apoptotic and dead blastomeres. The kit manufacturer's protocol was followed with slight modification to fit the experimental conditions. Briefly, the embryos (n = 10) were washed twice in DPBS supplemented with 0.3% BSA, incubated in 0.25% 132 Pronase (Sigma-Aldrich Canada Ltd) solution for 1 min and observed under a dissecting microscope. When the zona pellucida appeared thin and flexible the embryos were transferred to DPBS containing 0.3% B S A and the zona pellucida was removed by gentle pipetting. The embryos were then washed twice in DPBS containing 0.3% B S A and transferred to a mixture containing 20 pg/mL bisbenzamide, 10 pg/mL propidium iodide, 2 pg/mL FITC conjugated annexin V and the binding buffer provided with the kit for 30 min. The stained embryos were washed in DPBS containing 0.3% BSA, transferred onto a clean glass slide and carefully pressed under a cover slip mounted on a wax and mineral oil mixture at the four corners. The slides were kept in a dark humidified chamber until counting. The embryos were observed under fluorescence microscope and the numbers of live, apoptotic and dead cells were counted at x 100 to x400 magnification using U V - 2 A (excitation filter of 330 - 380 nm and barrier filter of 420 nm), B-2A (excitation filter of 450 - 490 nm and barrier filter of 520 nm) and G-2A (excitation filter of 510 - 560 nm and barrier filter of 590 nm) filter combinations. The live, apoptotic and dead cells appeared bright blue, green and red color, respectively (Plates 5.1.). The staining procedure was repeated four times per bull with different sets of morula to blastocyst embryos. During preliminary work, serial concentrations of the above stains were tested with a series of different incubation times to find an optimum stain concentration and incubation time for true positive staining without background or false positive staining. 5.3.4. Semi-quantitative RT-PCR Procedure 5.3.4.1. Reverse Transcription Reverse transcription used in this study was accomplished by utilizing the commercially available first strand cDNA synthesis kits (Cells to cDNA II kit, Ambion 133 Inc. The R N A Company, Austin, Texas, USA). The reverse transcription reactions were performed by following the kit manufacturer's protocol with slight modification to match the experimental conditions. During initial attempts, different numbers of embryos and various concentrations of oligo-dT and random decamers were tested to determine optimum conditions for reverse transcription, which produce a sufficient amount of first strand cDNA for PCR amplification of the genes of interest. The embryos (n = 15) were washed three times in nuclease free phosphate buffered saline provided with the kit, pooled and lysed in 15 pL of cell lysis buffer by incubation at 75 °C for 10 min. The genomic D N A was removed by addition of DNase I (0.04 U/pL) and incubation at 37 °C. The DNase I in the solution was inactivated by incubation at 75 °C for 6 min. The reverse transcription reaction was performed by using 15 pL of cell lysate, 5 p M of random decamers, 2.5 p M of oligo dT primers, deoxyribonucleoside triphosphate mixture (0.5 m M each), 4 pL of 10XRT buffer pH 7.4, RNase inhibitor (0.5 U/pL), M - M L V reverse transcriptase (0.5 U/pL) and nuclease free water in a 40 pL reaction mixture and by incubation of the reaction mixture at 42 °C for 1 h. The reverse transcriptase was inactivated by incubating the reaction mixture at 94 °C for 10 min and the product was stored at -20 °C for future use in PCR amplification. For each bull the reverse transcription was repeated four times with different sets of in-vitro produced morula to blastocyst stage embryos. 5.3.4.2. Gene Specific PCR Amplification The polymerase chain reaction (PCR) was performed using Jumpstart REDTaq ReadyMix PCR reaction mix (Jumpstart; Sigma-Aldrich Canada Ltd) and gene specific primers for Bcl-2, Bax, HSP70, p53, IFNx and the house keeping gene G3PDH. The 134 gene specific primers Bax, HSP70, p53 and IFNt were designed by using Primer3 software (Whitehead Institute for Biomedical Research; http://frodo.wi.mit.edu/primer3/primer3_code.html: Rozen and Skaletsky, 2000.) and the messenger R N A sequence obtained from the National Center for Biotechnology Information (NCBI) web site (http://www.ncbi.nlm.nih.gov/). The gene specific primer sequences for Bcl-2 and G3PDH were obtained from previously published data (Reyes and Cockerell, 1998). The primer sequence, fragment size, annealing temperature, number of PCR cycles and gene reference identification number are provided in Table 5.1. The PCR reaction was performed by following manufacturer's protocol with a slight modification to fit the experimental conditions. Briefly, gene specific primers, MgCb, nuclease free water and 2 pL of cDNA template were added to 12.5 pL of Jumpstart to make 25 pL reaction mixture. The reaction mixture was composed of 10 m M Tris-HCl, 50 m M KC1, 2.5 m M M g C l 2 , 0.001% gelatin, 0.2 m M of each dNTP (dATP, dCTP, dGTP, dTTP), inert dye, stabilizers, 0.03 U/pL Taq D N A polymerase, Jumpstart Taq antibody, 0.8 - 1.6 p M gene specific primers, cDNA template and nuclease free water. For the amplification of the HSP70 gene sequence instead of using 2.5 m M MgCb, 4 m M MgCl2 was used in the reaction mixture. The typical reaction cycles consisted of an initial denaturation step at 94 °C for 2 min followed by 34 - 38 cycles of denaturation at 94 °C for 30 sec, annealing at 56 - 62 °C for 30 sec and elongation at 72 °C for 45 sec with a final elongation step at 72 °C for 5 min. The PCR products were analyzed by gel electrophoresis using ethidium bromide (0.4 pg/mL) stained 2-3% agarose gels. The gels were photographed under ultraviolet illumination and the optical density of individual bands was analyzed using Scion Image Beta 4.02 135 for Windows computerized image analyzing software (Scion Corporation, Frederick, Maryland, USA; http://www.scioncorp.com/). The PCR procedure was repeated four times with different sets of cDNA synthesized by reverse transcription. The PCR products were nucleotide sequenced and the sequence identity was confirmed by standard nucleotide-nucleotide blasting at the NCBI web site. 5.3.5. Field Fertility Data Based on 513,469 Holstein first inseminations, the Holstein breed average field fertility was determined as 67% and this was considered as fertility solution equal to 0. Fertility of different bulls is expressed in relation to this fertility solution value, and the bulls showing 60-90 day non-return rates above this value were considered as high fertility and the bulls showing non-return rates below this value were considered as low fertility. Based on this scaling and the number of inseminations which ranged from 335 to 467, three of the experimental bulls showed fertility values above 67%, high fertility and the other three showed fertility values below 67%, low fertility. 5.3.6. Statistical Analyses Data analysis was done by one-way analysis of variance (ANOVA) after arcsine transformation of percentage data. Mean separation procedure was performed when analysis of variance showed significant F-Values using Fisher's Least Significant Difference. Non-return rate data were analyzed by Chi-square test. The results were reported as the mean values for each set of data ± standard error of the means and the level of statistical significance was defined at a probability level of less than 0.05. Pearson's pair-wise correlation coefficient was used to determine the degree of 136 correlation between in-vitro, in-vivo fertilization, and apoptosis and gene expression in morula to blastocyst stage embryos. 5.4. RESULTS 5.4.1. Validation of Semi-quantitative RT-PCR The semi-quantitative RT-PCR method was used to determine the relative abundance of mRNA transcripts for Bcl-2, Bax, p53, HSP70 and IFNx in bovine preimplantation embryos produced in-vitro. A linear relationship (log phase) was found between 34 and 38 cycles for PCR amplification of different gene transcripts and the internal control G3PDH, (Fig. 5.1., 5.2., 5.3., 5.4., 5.5. and 5.6.). The .expected PCR amplicon size for Bcl-2, Bax, P53, HSP70, IFNx and G3PDH gene transcripts were 156 bp, 223 bp, 363 bp, 376 bp, 386 bp and 318 bp, respectively. This method of semi-quantitative RT-PCR measurement of mRNA transcripts using G3DPH as an internal control was previously described in the literature (Mamluk et al., 1998; 1999). The possibility of PCR cross contamination and genomic D N A amplification was ruled out because no PCR products were observed in negative controls (without template and without reverse transcriptase)! 5.4.2. Bull Effects on Embryo Apoptosis and Development The in-vitro embryo development results measured by cleavage and morula to blastocyst development rates are shown in Fig. 5.7.and 5.8., respectively. The results of embryo viability measured by percentage of live, apoptotic and dead blastomeres in morula to blastocyst stage embryos produced by fertilization of oocytes with spermatozoa from various experimental bulls are shown in Fig. 5.9., 5.10. and 5.11., respectively. In order to investigate the in-vitro fertility of experimental bulls the 137 cleavage rate and morula to blastocyst development rates were measured and the data revealed that the cleavage and morula to blastocyst development rate were different (PO.01) among bulls. Percent apoptotic, live and dead cells in morula to blastocyst stage embryos were also different (PO.01) among bulls. 5.4.3. Bull Effects on Embryonic Gene Expression The semi-quantitative RT-PCR results for relative abundance of mRNA transcripts for Bcl-2, Bax, p53, HSP70 and IFNT are shown in Fig. 5.12., 5.13., 5.14., 5.15 and 5.16. Although the number of live, apoptotic and dead blastomeres were significantly different, the relative abundance of transcripts for pro-apoptotic genes Bax and p53, and the anti-apoptotic gene Bcl-2 were not significantly different in morula to blastocyst stage embryos produced by fertilization of oocytes with spermatozoa from various experimental bulls. However, the HSP70 and IFNT gene transcripts were significantly different in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from various experimental bulls. 5.4.4. Bull Effects on Non-return Rates The field fertility measured by 60-90 day non-return rates to first service is shown in Fig. 5.17. The Chi square test revealed that the non-return rates were significantly different among bulls (p<0.01). 5.4.5. Correlation Between Bull Fertility Parameters The significant correlations between different in-vitro sperm fertility parameters and the field fertility measured by 60-90 day non-return rates are summarized in Table 5.2. The cleavage rate was positively correlated with percentage of live blastomeres (r = 0.61; p<0.05) and IFNT gene expression levels (r = 0.42; p<0.05), and negatively 138 correlated with percentage of apoptotic blastomeres (r = -0.57; p<0.05). The morula to blastocyst development rate was also positively correlated with percentage of live blastomeres (r = 0.73; p<0.05) and IFNx gene expression levels (r = 0.42; p<0.05), and negatively correlated with percentage of apoptotic blastomeres (r = -0.67; p<0.05). Cleavage or morula to blastocyst development rates were not correlated with Bcl-2, Bax, p53 and HSP70 gene expression levels. The percentage of live blastomeres was positively correlated with IFNx (r = 0.58; p<0.05) and HSP70 (r = 0.57; p<0.05) gene expression levels. Percentage of apoptotic blastomeres was negatively correlated with IFNx (r = -0.56; p<0.05) and HSP70 (r = -0.51; p<0.05) gene expression levels. Percentage of live and apoptotic blastomeres in morula to blastocyst stage embryos was not correlated with Bcl-2, Bax and p53 gene expression levels. The percentage of dead blastomeres was positively correlated with bcl-2 gene expression (r = 0.87; p<0.05) and not correlated with expression levels of other genes. The field fertility measured by 60-90 day non-return rate is correlated with relative abundance of Bcl-2 mRNA transcripts (r = -0.93; p<0.05) and the ratio of Bax to Bcl-2 gene expression (r = 0.84; p<0.05). None of the other in-vitro embryo parameters was correlated with 60-90 day non-return rates. 5.5. DISCUSSION The present study investigated bull effects on embryo viability at various levels such as in-vitro embryo development, apoptosis and gene expression. This study is the first one showing the bull influence on percentage of apoptotic, live and dead 139 blastomeres, and expression of interferon tau and HSP70 genes in in-vitro produced morula to blastocyst stage embryos. In the present study the bull dependent variation in the percentage of live, apoptotic and dead blastomeres in in-vitro produced embryos indicated that the in-vitro fertility of bulls is determined by viability of embryos based on the percentage of live, apoptotic and dead blastomeres. This is supported by correlation data in which the in-vitro fertility of bulls assessed by cleavage and blastocyst production rates is positively correlated with percentage of live blastomeres and negatively correlated with percentage of apoptotic blastomeres. A l l the experimental embryo samples showed apoptosis and some of them showed an excessive percentage of apoptotic blastomeres. This finding supports the notion that occurrence of apoptosis is most common in the developing embryo, which undergoes rapid cell division resulting in a chance for a high degree of chromosomal abnormalities and that apoptosis is a process by which faulty as well as unwanted cells are removed from the system (Mirkes, 2002). Although apoptosis is the most commonly occurring process to remove faulty and unwanted cells during cell proliferation, excessive cell apoptosis is detrimental and leads to eventual death of the whole organism (Antonsson, 2001). The embryos, which showed a high percentage of apoptotic blastomeres in the current experiment, were either highly susceptible to stress factor induced apoptosis or had imbalances in the tightly regulated cascade of apoptosis resulting in excessive cell apoptosis and death as indicated by Zakeri and Lockshin (2002). The viability of embryos showing high percentages of apoptotic blastomeres is low as there is a negative correlation observed in the present study with percentage of live blastomeres, and in-vitro embryo development assessed 140 by cleavage and blastocyst production rates. This supports the finding by Yang and Rajamahendran (2002) in which they showed that embryos, which show high levels of apoptosis measured by TUNEL, and the expression levels of Bcl2 and Bax proteins, have high levels of fragmentation. When cells are exposed to apoptotic stimulation, pro-apoptotic proteins are activated through post-translational modifications or changes occur in their conformation and mitochondria to release cytochrome c by increasing membrane permeability. In the cytosol, cytochrome c forms a complex with apoptosis protease activating factor 1 which activates the caspase cascade ultimately leading to cell death (Antonsson, 2001; Mirkes, 2002). The death receptor pathway is stimulated by the binding of tumor necrosis factor a, FAS ligand and other death initiating factors to their receptors, and direct activation of downstream caspases, which lead to cell death (Mirkes, 2002). The balance between pro- and anti-apoptotic protein expression regulates the fate of the cell since pro-apoptotic activity of Bax can be inhibited by over expression of Bcl-2 (Korsmeyer et al., 1993). Irregular expression pattern of these proteins causes cell death and embryo mortality during early stages of development (Hardy, 1997). In the present experiment, expression levels of HSP70 mRNA transcripts were influenced by the bull and negatively correlated with the percentage of apoptotic cells in the experimental embryo samples. HSP70 has been shown to modulate the apoptosis process at different levels of the downstream caspase cascade (Parcellier el al., 2003). Hence, HSP70 may have played a major role in the difference in the percentage of apoptotic blastomeres in the experimental embryo samples. In the present study, expression of IFNx genes varied with embryos produced from fertilization of oocytes with spermatozoa from various experimental bulls. This 141 indicates that the expression of IFNx can be influenced by heritable and non-heritable factors, which affect the expression of some of the transcription factors. Because, the rapid onset and cessation of IFNx expression is regulated by number of transcription factors such as Ets-2 (Ezashi et al., 1998) and granulocyte-macrophage colony-stimulating factor acting via the proto-oncogene c-jun and an AP-1 site (Imakawa et al., 1993; Yamaguchi et al., 1999). Also, negative regulatory domains have been shown in the bovine IFNx promoter that may be involved in the precisely timed cessation of gene expression (Guesdon et al., 1996; Yamaguchi et al., 1999). This also supports the recent finding in which bull dependent variability in IFNx production in in-vitro produced embryos has been reported (Kubisch et al., 2001). IFNx expression was highly correlated with in-vitro embryo development measured by cleavage and blastocyst production rates indicating that the viability of embryos is represented by IFNx expression. The observation, that the viability of the embryos is represented by IFNx expression in the present study, supports the previous finding by Hernandez-Ledezma et al. (1993). Inadequate reaction of the endometrium to IFNx or insufficient secretion of IFNx by the embryo is assumed to be the major reason for early embryonic losses and pregnancy failure. Therefore, the level of IFNx secretion has been discussed as a parameter for the assessment of embryo quality (Hernandez-Ledezma et al. 1993). Hence, in the current study the expression of IFNx gene should have been correlated with in-vivo fertility measured by 60-90 day non-return rates, but it was not correlated because of unknown reasons. This may be attributed to various paternal, maternal and management factors which influence the success of A l and in-vivo embryo development. 142 In the present study, it was shown that there is a bull influence on the expression levels of HSP70 mRNA transcripts in in-vitro produced embryos. The bull influence is also correlated with the developmental competence of in-vitro produced embryos assessed by cleavage and morula to blastocyst production rates. This indicates that the viability of in-vitro produced embryos has been also determined by expression of HSP70 and bull related variability in the viability of in-vitro produced embryos is associated with expression of HSP70 gene. HSP70 ensures the survival of cells by acting as cellular chaperones to correct the folding and prevent the aggregation of stress-accumulated misfolded proteins by directly interacting with various components of tightly regulated programmed cell death machinery, and playing a role in proteosome mediated degradation of selected proteins under stress conditions (Parcellier el al., 2003). Our findings support the notion that the HSP70 plays a key role in the protection of developing preimplantation embryos from various stress factors and the expression of this protein is developmentally regulated (Edwards et al., 1997; Paula-Lopes and Hansen, 2002). Several researchers have compared in-vitro fertility of bulls with in-vivo fertility to establish suitable method to predict fertility in the laboratory with conflicting results. Some of the investigators established significant correlation between in-vivo and in-vitro fertility (Hillery et al. 1990; Kjaestadt et al. 1992; Eid et al. 1994; Zhang et al. 1995; Bredbacka et al. 1997; Lansbergen et al. 1997) whereas, others has shown no correlation or poor correlation (Ohgoda et al. 1988; Palma et al. 1996; Schneider et al. 1996). In the current study, the field fertility measured by 60-90 day non-return rate was not correlated with in-vitro fertility measured either by cleavage and embryo production 143 rates. Also, this is in agreement with the findings of the first study of this thesis (Chapter III). However, the non-return rates are negatively correlated with Bcl-2 expression and positively correlated with the ratio of Bax to Bcl-2 expression and not correlated with expression levels of p53, HSP70 and IFNx genes. Also, the Bcl-2 expression is correlated with the percentage of dead blastemeres. This indicates that the cells, which are not undergoing apoptosis, may start producing higher amounts of Bcl-2 as a compensatory preventive measure for the survival of embryos. Since a pro-apoptotic function of Bcl-2 has been demonstrated (Chen et al., 1996; Shinoura et al., 1999), the higher expression of Bcl-2 in the embryos produced by low fertility bulls is an indication that they are undergoing apoptosis. Also, when Bcl-2 is expressed at higher levels caspase 3 acts on Bcl-2 and cleaves it to a pro-apoptotic protein (Cheng et al., 1997). This is a good indication that the bulls showing low fertility in the field may produce very susceptible embryos in which the blastomeres undergo irregular apoptosis by unknown pathways. 5.6. CONCLUSION In the present study, bull influence on embryo viability was assessed by in-vitro embryo development, embryo apoptosis, and the expression levels of Bcl-2, Bax, p53, HSP70 and IFNx genes. Based on this study, it is concluded that the bull affects the preimplantation embryo development, apoptosis, and expression levels of HSP70 and IFNx genes. Measurement of either the Bcl-2 gene or a ratio of Bax to Bcl-2 gene expression levels in morula to blastocyst stage embryos produced in-vito may be useful in predicting bull field fertility. 144 Table 5.1. Primers used in the RT-PCR amplification of specific mRNA transcripts in morula to blastocyst stage embryos. Gene Primer Sequence (5'-3') Anneal. T ° C PCR cycles Fragment Length Accession Number G3PDH 5' TGTTCCAGTATGATTCCACCC 3' AGGAGGCATTGCTGACAATC 58 34-36 318 bp U85042 Bax 5' TGCTTCAGGGTTTCATCCAG 3' AACATTTCAGCCGCCACTC 58 34 223 bp U92569 Bcl-2 5' TTCGCCGAGATGTCCAGTCAGC 3' GTTGACGCTCTCCACACACA 62 37 156 bp U92434 p53 5' GCACCACCATCCACTACAA 3' GCTCCAAGGCATCATTCAG 56 36 363 bp X81704 HSP70 5' CACTTCGTGGAGGAGTTCA 3' GGTTGATGCTCTTGTTGAGG 58 38 376 bp AY149619 IFNx 5' GACTCTCTCCTCATCCCTGTCT 3' GGCTCTCATCATCTCCACTCT 57 35 386 bp AF196325 145 Table 5.2. Pair-wise comparison of cleavage rate (CL), blastocyst production rate (BL), percentage of live blastomeres (PL), percentage of apoptotic blastomeres (PA), percentage of dead blastomeres (PD), expression of Bcl-2 gene (Bcl-2), ratio of expression of Bax and Bcl-2 genes (Bax/Bcl-2), expression of interferon tau gene (IFNx), expression of heat shock protein 70 gene (HSP70), 60-90 day non-return rates (NRR). The percentage of live, apoptotic and dead blastomeres, and all the gene expression levels are measured in morula to blastocyst stage embryos. C L BL PL PA PD Bcl-2 if 3,^ p53 IFNx HSP70 Bcl-2 r BL 0.89* PL 0.61* 0.73* PA -0.57* -0.67* -0.91* PD -0.25 -0.31 -0.46* 0.04 Bcl-2 -0.28 -0.15 -0.08 0.04 0.87* Bax/Bcl-2 0.33 0.29 0.26 -0.31 0.05 -0.58* p53 -0.13 -0.14 0.06 0.001 -0.15 -0.04 0.08 IFNx 0.42* 0.42* 0.58* -0.56* -0.19 -0.19 0.20 0.17 HSP70 0.36 0.29 0.57* -0.51* -0.26 -0.22 0.11 0.44* 0.58* NRR 0.45 0.26 0.28 -0.06 -0.65 -0.93* 0.84* -0.03 0.42 * Comparisons showing significant correlations at p<0.05. 146 A ) B) Plate 5.1. Fluorescence microscopic images of bovine morula A) & B) to blastocyst C) & D) stage embryos stained by annexin V, propidium iodide and bis-benzamide. The photographs were taken at 400x magnification using UV-2A (excitation filter of 330 -380 nm and barrier filter of 420 nm), B-2A (excitation filter of 450 - 490 nm and barrier filter of 520 nm) and G-2A (excitation filter of 510 - 560 nm and barrier filter of 590 nm) filter combination. The live, apoptotic, and dead cells show blue, green, and red or red & green fluorescence, respectively. 147 A) 30 32 34 36 38 40 42 B) Number of PCR cycles Figure 5.1. Characterization of semi-quantitative RT-PCR for Bcl-2 mRNA transcripts from bovine in-vitro produced embryos. The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed A. The optical density of the bands on the inverse image was measured. The linear relationship between PCR products and the number of amplification cycles is shown in B. 148 A) 28 30 32 34 36 38 40 400 bp 300 bp « -G3PDHat318bp B) •a c « O C tu G3PDH 30 32 34 36 38 Number of PCR cycles 40 Figure 5.2. Characterization of semi-quantitative RT-PCR for G3PDH mRNA transcripts from bovine in-vitro produced embryos. The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed A . The optical density of the bands on the inverse image was measured. The linear relationship between PCR products and the number of amplification cycles is shown in B. 149 A ) 32 34 36 38 40 42 44 B) • ' i i 1 1 — — i 32 34 36 38 40 42 44 Number of PCR cycles Figure 5.3. Characterization of semi-quantitative RT-PCR for HSP70 mRNA transcripts from bovine in-vitro produced embryos. The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed A. The optical density of the bands on the inverse image was measured. The linear relationship between PCR products and the number of amplification cycles is shown in B. 150 A) 28 30 32 34 36 38 40 300 bp 200 bp gmmm _ r " V i *'""™* ™ " M " " ^ » W> -G3PDHat318bp -Bax at 223 bp B) Bax -m- G3PDH 8000 30 32 34 36 38 Number of PCR cycles 40 Figure 5.4. Characterization of semi-quantitative RT-PCR for Bax and G3PDH mRNA transcripts from bovine in-vitro produced embryos. The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed A. The optical density of the bands on the inverse image was measured. The linear relationship between PCR products and the number of amplification cycles is shown in B. 151 A ) 30 32 34 36 38 40 42 400 bp -> 300 bp > IPMMV -.•j ^MWK^ ^mnn^ **** 4 H i Ste mm ^^ ^^^ R^m^P' H^UP^  ««-P53 at 363 bp ««-G3PDHat318bp B) P53 - » - G 3 P D H 10000 9000 . •a 8000 . e a 7000 -CQ <M o 6000 . 5000 . B Q> 4000 -•«-> a 3000 . 2000 . 1000 0 " 30 32 — i — 34 40 42 36 38 Number of PCR cycles Figure 5.5. Characterization of semi-quantitative RT-PCR for P53 and G3PDH mRNA transcripts from bovine in-vitro produced embryos. The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed A . The optical density of the bands on the inverse image was measured. The linear relationship between PCR products and the number of amplification cycles is shown in B. 152 A) 28 30 32 34 36 38 40 400 bp > 300 bp > B) 12000 _ 10000 n a £ 8000 o 6000 «9 a | 4000 2000 J •HP -IFNT at 386 bp -G3PDHat318bp IFN - « - G3PDH 30 32 34 36 38 Number of PCR cycles 40 Figure5.6. Characterization of semi-quantitative RT-PCR for interferon tau and G3PDH mRNA transcripts from bovine in-vitro produced embryos. The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed A . The optical density of the bands on the inverse image was measured. The linear relationship between PCR products and the number of amplification cycles is shown in B. 153 100 Bull ID Figure 5.7. Percentage of cleaved embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B]-B 6) 72 h post insemination. The in-vitro fertilization procedure was repeated four times for each bull with a total of 480 oocytes. a,b,c - Bars with different superscripts differ significantly (PO.01). 154 Bull ID Figure 5.8. Percentage of morula to blastocyst stage embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B1-B6) 168 h post insemination. The in-vitro fertilization and embryo production procedure was repeated four times for each bull with a total of 480 oocytes. a,b,c - Bars with different superscripts differ significantly (P<0.01). 155 Figure 5.9. Percentage of live blastomeres in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (Bi-Be). The embryos were stained by bis-benzamide, annexin V, and propidium iodide and the live (blue), apoptotic (green) and dead (red) blastomeres were counted under a fluorescence microscope. The staining procedure was repeated four times with different sets of embryos and a total of 40 embryos were used for each bull. a,b,c - Bars with different superscripts differ significantly (P<0.01). 156 Figure 5.10. Percentage of apoptotic blastomeres in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (Bi-B 6 ) . The embryos were stained by bis-benzamide, annexin V , and propidium iodide and the live (blue), apoptotic (green) and dead (red) blastomeres were counted under a fluorescence microscope. The staining procedure was repeated four times with different sets of embryos and a total of 40 embryos were used for each bull. a,b,c - Bars with different superscripts differ significantly (P<0.01). 157 Bull ID Figure 5.11. Percentage of dead blastomeres in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (Bi-Bg). The embryos were stained by bis-benzamide, annexin V , and propidium iodide and the live (blue), apoptotic (green) and dead (red) blastomeres were counted under a fluorescence microscope. The staining procedure was repeated four times with different sets of embryos and a total of 40 embryos were used for each bull. a,b,c - Bars with different superscripts differ significantly (P<0.01). 158 A) Bi B 2 B 3 B 4 B 5 B 6 Bi B 2 B 3 B 4 B 5 B 6 Bull ID Figure 5.12. Relative abundance of Bcl-2 mRNA transcripts in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B1-B6). The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed. The optical density of the bands on the inverse image was measured. The RT-PCR was repeated four times with separate sets of embryos, the representative gel photograph and the average ratio of Bcl-2 to G3PDH band density (mean +SEM) are shown in A) and B), respectively. 159 A) Bi B 2 B 3 B 4 B 5 B 6 Bull ID Figure 5.13. Relative abundance of Bax mRNA transcripts in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B1-B6). The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed. The optical density of the bands on the inverse image was measured. The RT-PCR was repeated four times with separate sets of embryos, the representative gel photograph and the average ratio of Bax to G3PDH band density (mean ±SEM) are shown in A) and B), respectively. 160 A) Bi B 2 B 3 B 4 B 5 B 6 «*-363 bp -4-318 bp Bull ID Figure 5.14. Relative abundance of p53 mRNA transcripts in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B] -B6) . The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed. The optical density of the bands on the inverse image was measured. The RT-PCR was repeated four times with separate sets of embryos, the representative gel photograph and the average ratio of p53 to G3PDH band density (mean ±SEM) are shown in A) and B), respectively. 161 A) Bi B 2 B 3 B 4 B 5 B 6 <4-386 bp bp Bull ID Figure 5.15. Relative abundance of interferon tau mRNA transcripts in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B]-B 6). The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed. The optical density of the bands on the inverse image was measured. The RT-PCR was repeated four times with separate sets of embryos, the representative gel photograph and the average ratio of IFNx to G3PDH band density (mean ±SEM) are shown in A) and B), respectively. a,b,c - Bars with different superscripts differ significantly (PO.05). 162 A) Bull ID Figure 5.16. Relative abundance of HSP70 mRNA transcripts in morula to blastocyst embryos produced by fertilization of oocytes with spermatozoa from six experimental bulls (B1-B6). The total R N A in the experimental embryo samples was reverse transcribed and amplified using a thermal-cycler as described in the Materials and Methods. The PCR products were resolved on ethidium bromide stained 2% agarose gel and photographed. The optical density of the bands on the inverse image was measured. The RT-PCR was repeated four times with separate sets of embryos, the representative gel photograph and the average ratio of HSP70 to G3PDH band density (mean ±SEM) are shown in A) and B), respectively. a,b,c - Bars with different superscripts differ significantly (P<0.05) 163 Figure 5.17. The field fertility of six experimental bulls measured by 60-90 day return rates, a, b - Bars with different superscripts differ significantly (P<0.01). 5.7. REFERENCES Al-Katanani Y M , Hansen PJ. 2002. Induced thermotolerance in bovine two-cell embryos and the role of heat shock protein 70 in embryonic development. Mol Reprod Dev 62(2), 174-180. Antonsson B. 2001. Bax and other pro-apoptotic Bcl-2 family "killer-proteins" and their victim, the mitochondrion. Cell Tissue Res 306, 347-361. Bartol FF, Roberts R M , Bazer FW, Lewis GS, Godkin ID, Thatcher WW. 1985. Characterization of proteins produced in vitro by peri-attachment bovine conceptuses Biol Reprod 32, 681-693. Betts D H , King WA. 2001. Genetic regulation of embryo death and senescence. Theriogenology 55, 171-191. Bilodeau-Goeseels S, Kastelic JP. 2003. Factors affecting embryo survival and strategies to reduce embryonic mortality in cattle. Can. J. Anim. Sci. 83, 659-671. Bloom SE, Muscarella DE. 1998. Stress responses in the avian early embryo: regulation by pro- and anti-apoptotic cell death genes. Poult Avian Biol Rev 9, 43-45. Bochenek M , Smorag Z, Pilch J. 2001. Sperm chromatin structure assay of bulls qualified for artificial insemination. Theriogenology 56, 557-567. Boediono, A. , Takagi, M . , Saha, S. and Suzuki, T. 1994. Influence of Day 0 and Day 7 superovulated cow serum during development of bovine oocytes in vitro. Reprod. Fertil Dev 6, 261-264. Brackett B G , Oliphant G. 1975. Capacitation of rabbit spermatozoa in vitro. Biol Reprod 12, 260-274. Bredbacka K , Andersson M , Bredbacka P. 1997. The use of in vitro fertilization and sperm assay to evaluate field fertility of bulls. Theriogenology 47, 253. Chen J, Flannery JG, LaVail M M , Steinberg R H , X u J, Simon MI. 1996. bcl-2 overexpression reduces apoptotic photoreceptor cell death in three different retinal degenerations. Proc Natl Acad Sci U S A 93, 7042-7047. Cheng EH-Y, Kirsch DG, Clem RJ, Ravi R, Kastan M B , Bedi A , Ueno K , Hardwick JM. 1997. Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 278, 1966-1968. 165 Comizzoli P, Marquant-Le Guienne B, Heyman Y , Renard JP. 2000. Onset of the first S-phase is determined by a paternal effect during the Gl-phase in bovine zygotes. Biol Reprod 62, 1677-1684. Conner E A , Teramoto T, Wirth PJ, Kiss A , Garfield S, Thorgeirsson SS. 1999. HGF-mediated apoptosis via p53/bax-independent pathway activating JNK1. Carcinogenesis 20, 583-590. Dannet-Desnoyers G, Wetzels C, Thatcher WW. 1994. Natural and recombinant bovine interferon tau regulate basal and oxytocin induced secretion of prostaglandin F2a and E2 by epithelial cells and stromal cells in the endometrium Reprod Fertil Dev 6, 193-202. Demmers K J , Derecka K , Flint A . 2001. Trophoblast interferon and pregnancy. Reproduction 121, 41-49 Edwards JL, Ealy A D , Monterroso V H , Hansen PJ. 1997. Ontogeny of temperature regulated heat shock protein 70 synthesis in preimplantation bovine embryos. Mo l Reprod Dev 48, 25-33. Edwards JL, Hansen PJ. 1997. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Mol Reprod Dev 46:138-145. Eid L N , Lorton SP, Parrish JJ. 1994. Paternal influence on S-phase in the first cell cycle of the bovine embryo. Biol Reprod 51, 1232-1237. Emond V , Asselin E, Fortier M A , Murphy BD, Lambert RD. 2000. Interferon-tau stimulates granulocyte-macrophage colony-stimulating factor gene expression in bovine lymphocytes and endometrial stromal cells. Biol Reprod 62, 1728-1737. Evenson DP. 1999. Loss of livestock breeding efficiency due to uncompensable sperm nuclear defects. Reprod Fertil Dev 11,1-15. Ezashi T, Ealy A D , Ostrowski M C , Roberts R M . 1998. Control of interferon-t gene expression by Ets-2 Proc Natl Acad Sci U S A 95, 7882-7887. Godkin JD, Bazer FW, Moffat J, Sessions F, Roberts R M . 1982. Purification and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts at day 13-21. J Reprod Fertil 65, 141-150. 166 Godkin JD, Smith SE, Johnson RD, Dore JJE. 1997. The role of trophoblast interferons in the maintenance of early pregnancy in ruminants. American J Reprod Immunol 37, 137-143. Goff A K . 2002. Embryonic signals and survival. Reprod Dom Anim 37, 133-139. Gray C A , Taylor K M , Ramsey WS, Hi l l JR, Bazer FW, Bartol FF, Spencer TE, 2001: Endometrial glands are required for preimplantation conceptus elongation and survival. Biol Reprod 64, 1608-1613. Guesdon F, Stewart HJ, Flint APF. 1996. Negative regulatory domains in a trophoblast interferon promoter. J Mol Endocrin 16, 99-106. Gustafsson H , Larsson K , 1983: Reciprocal embryo transfer between repeat-breeder and virgin heifers - an experimental model. Acta Vet Scand 24, 59-64. Hansen PJ. 2002. Embryonic mortality in cattle from the embryo's perspective. J Anim Sci 80 (E. suppl. 2), E33-E44. Hardy K . 1997. Cell death in the mammalian blastocyst. Mol Human Reprod. 3, 919-925. Haupt S, Berger M , Goldberg Z, Haupt Y . 2003. Apoptosis - the p53 network. J Cell Sci 116, 4077-4085. Hernandez-Ledezma JJ, Mathialagan N , Villanueva C, Sikes JD, Roberts R M . 1993. Expression of bovine trophoblast interferons by in vitro-derived blastocysts is correlated with their morphological quality and stage of development. Mol Reprod Dev 36, 1-6. Hillery FL , Parrish JJ, First N L . 1990. Bull specific effect on fertilization and embryo development in vitro. Theriogenology 33, 249. Humblot P. 2001. Use of pregnancy specific proteins and progesterone assays to monitor pregnancy and determine the timing, frequencies and sources of embryonic mortality in ruminants. Theriogenology 56, 1417-1433. Imakawa K , Helmer SD, Nephew KP, Meka CSR, Christenson R K . 1993. A novel role for G M - C S F : enhancement of pregnancy specific interferon production, ovine trophoblast protein-1. Endocrinology 132, 1869-1871. Ingo S, Sabine K , Peter K H . 2000. Regulation of death receptor-mediated apoptosis pathways. Int J Biochem Cell Biol 32, 1123-1136. 167 Johnson GA, Spencer TE, Hansen TR, Austin K J , Burghardt RC, Bazer FW. 1999. Expression of the interferon tau inducible ubiquitin cross-reactive protein in the ovine uterus. Biol Reprod 61, 312-318. Johnson G A , Stewart M D , Gray CA, Choi Y , Burghardt RC, Yu-Lee L Y , Bazer FW, Spencer TE. 2001. Effects of the estrous cycle, pregnancy, and interferon tau on 2',5'-oligoadenylate synthetase expression in the ovine uterus. Biol Reprod 64, 1392-1399. Jurisicova A , Latham K E , Casper RF, Varmuza SL. 1998. Expression and regulation of genes associated with cell death during murine preimplantation embryo development. Mol Reprod Dev. 51, 243-253. Kjaestad TG, Stubbings RB. 1992. Sire and insemination dose does effect in vitro fertilization of bovine oocytes. Theriogenology 37, 240. Kolle S, Stojkovic M , Boie G, Wolf E, Sinowatz F. 2002. Growth hormone inhibits apoptosis in in-vitro produced bovine embryos. Mol Reprod Dev 61, 180-186. Korsmeyer SJ, Shutter JR, Veis DJ, Merry DE, Oltvai Z N . 1993. Bcl-2/Bax a rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 4, 327-332. Kubisch H M , Larson M A , Ealy A D , Murphy C N , Roberts R M . 2001. Genetic and environmental determinants of interferon-x secretion by in vivo and in vitro derived bovine blastocysts. Anim Reprod Sci 66, 1-13. Lafrance M , Goff A K , Guay P, Harvey D. 1989. Failure to maintain luteal function: a possible cause of early embryonic mortality in the cow. Can J Vet Res 53, 279-284. Lansbergen L M T E , Hanenberg EHAT, van Wagtendonk-de Leeuw A M . 1997. Predictive value of in vitro embryo production characteristics for in vivo fertility of bulls. Theriogenology 47, 259. Lewis J, Oyler GA, Ueno K , Yih-Ru Fannjiang Y , Chau B N , Vornov J, Korsmeyer SJ, Zou S, Hardwick JM. 1999. Inhibition of virus-induced neuronal apoptosis by Bax. Nature Medicine 5, 832-835. Linette GP, L i Y , Roth K , Korsmeyer SJ. 1996. Cross talk between cell death and cell cycle progression: Bcl-2 regulates NFAT-mediated activation. Proc Natl Acad Sci U S A 93, 9545. 168 Mamluk R, Chen D, Greber Y , Davis JS, Meidan R. 1998. Characterization of messenger ribonucleic acid expression for prostaglandin F2 alpha and luteinizing hormone receptors in various bovine luteal cell types. Biol Reprod 58, 849-856. Mamluk R, Graber Y , Meidan R. 1999. Hormonal regulation of messenger ribonucleic acid expression for steroidogenic factor-1, steroidogenic acute regulatory protein, and cytochrome P450 side chain cleavage in bovine luteal cells. Biol Reprod 60, 628-634. Matwee Christie, Betts Dean H , King W Allan. 2000. Apoptosis in the early bovine embryo. Zygote 8, 57-68. Mirkes PE. 2002. To die or not to die, the role of apoptosis in normal and abnormal mammalian development. Teratology 65, 228-239. Ohgoda O, Niwa K , Yuhara M , Takahashi S, Kanoya K . 1988. Variations in penetration rates in-vitro of bovine follicular oocytes do not reflect conception rates after artificial insemination using frozen semen from different bulls. Theriogenology 29(6), 1375-1382. Ott TL, Y i n J, Wiley A A , Kim HT, Gerami-Naini B, Spencer TE, Bartol FF, Burghardt RC, Bazer FW. 1998. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol Reprod 59, 784-794. Palma, G, Braun J, Stolla R, Brem G. 1996. The ability to produce embryos in vitro using semen from bulls with a low non-return rate. Theriogenology 45(1), 308. Parcellier A , Gurbuxani S, Schmitt E, Solary E, Garrido C. 2003. Heat shock proteins, cellular chaperones that modulate mitochondrial cell death pathways. Biochemical and Biophy Res Commun 304, 505-512. Paula-Lopes FF, Hansen PJ. 2002. Heat shock-Induced apoptosis in preimplantation bovine embryos is a developmentally regulated phenomenon. Biol Reprod 66, 1169-1177. Reyes R A , Cockerell GL. 1998. Increased ratio of bcl2/bax expression is associated with bovine leukemia virus-induced leukemogenesis in cattle. Virology 242, 184-192. Rozen S, Skaletsky HJ. 2000. Primer3 on the W W W for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365-386 169 Schneider CS, Ellington JE, Wright RW Jr. 1996. Effects of bulls with different field fertility on in vitro embryo cleavage and development using sperm co-culture systems. Theriogenology 45(1), 262. Shinoura N , Yoshida Y , Nishimura M , Muramatsu Y , Asai A , Kirino T, Hamada H . 1999. Expression level of Bcl-2 determines anti- or proapoptotic function. Cancer Res 59,4119-4128. Spencer TE, Ott TL, Bazer FW. 1998. Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregnancy and ovine interferon tau. Biol Reprod 58, 1154-1162. Stewart D M , Johnson GA, Vyhlidal CA, Burghardt RC, Safe SH, Yu-Lee L Y , Bazer FW, Spencer TE, 2001. Interferon tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 142, 98-107. Strasser-Wozak E M C , Hartmann B L , Geley S, Sgonc R, Bock G, Oliveira Dos Santos A J , Hattmannstorfer R, Wolf H , Pavelka M , Kofler R. 1998. Irradiation induces G2/M cell cycle arrest and apoptosis in p53-deficient lymphoblastic leukemia cells without affecting Bcl-2 and Bax expression. Cell Death Differen 5, 687-693. Teixeira M G , Austin K J , Perry DJ, Dooley V D , Johnson GA, Francis BR, Hansen TR. 1997. Bovine granulocyte chemotactic protein-2 is secreted by the endometrium in response to interferon-tau (IFN-tau). Endocrine 6, 31-37. Thatcher WW, Staples CR, Danet-Desnoyers G, Oldick B , Schmitt EP. 1994. Embryo health and mortality in sheep and cattle. J Anim Sci 72(suppl. 3), 16-30. Thatcher WW, Guzeloglu A , Mattos R, Binelli M , Hansen TR, Pru JK. 2001. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 56, 1435-1450. Vallet JL, Barker PJ, Lamming GE, Skinner N , Huskisson NS. 1991. A low molecular weight endometrial secretory protein which is increased by ovine trophoblast protein-1 is a beta 2-microglobulin-like protein. J Endocrinol 130, R1-R4. Ward F, Rizos D, Corridan D, Quinn K , Boland M , Lonergan P. 2001. Paternal influence on the time of first embryonic cleavage post insemination and the implications 170 for subsequent bovine embryo development in vitro and fertility in vivo. Mol Reprod Dev 60, 47-55. Warner C M , Exley GE, McElhinny AS, Tang C. 1998. Genetic regulation of preimplantation mouse embryo survival. J Experim Zool 282, 272-279. Wolf E, Arnold GJ, Bauersachs S, Beier H M , Blum H, Einspanier R, Frohlich T, Herrler A , Hiendleder S, Kolle S, Prelle K, Reichenbach H-D, Stojkovic M , Wenigerkind H , Sinowatz F. 2003. Embryo-maternal communication in bovine -strategies for deciphering a complex cross-talk. Reprod Dom Anim 38, 276-289. Xiao CW, Murphy BD, Sirois J, Goff A K . 1999. Down regulation of oxytocin-induced cyclooxygenase-2 and prostaglandin F synthase expression by interferon-tau in bovine endometrial cells. Biol Reprod 60, 656-663. Yamaguchi H , Ikeda Y , Moreno IJ, Katsumura M , Miyazawa T, Takahashi E, Imakawa K , Sakai S, Christenson RK. 1999. Identification of a functional transcriptional factor AP-1 site in the sheep interferon x gene that mediates a response to P M A in JEG3 cells. Biochem J 340, 767-773 Yang M Y , Rajamahendran R. 2002. Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci 70, 159-169. Zakeri Z, Lockshin R. 2002. Cell death during development. J Immunol Methods 265, 3-20. Zhang BR, Larsson B , Rodriguez-Martinez H . 1995. Influence of batches of bovine oocytes on the outcoume of an intact zona pellucida binding assay and in vitro fertilitzaion. Int J Androl 18, 213-220. 171 CHAPTER 6 - GENERAL DISCUSSION AND CONCLUSIONS Artificial insemination is the most extensively used technology in the dairy industry to improve reproductive and production efficiency (reviewed by Foote 2003). Huge expenditures are incurred by A l organizations in terms of time, labour and management costs to prove bulls for their fertility and genetic merit (reviewed by Rodriguez-Martinez and Larsson, 1998; Giritharan et al., 2004). This indicates that there will be significant advantages to the cattle industry as well as to the A l industry, i f simple laboratory tests are made available to predict fertility of young bulls recruited for progeny testing programs. Although several laboratory tests for semen evaluation have been developed in the past, most of them lack repeatability or precise prediction of bull fertility in the field (reviewed by Larsson and Rodriguez-Martinez, 2000; Foote, 2003; Rodriguez-Martinez, 2003). The aim of this thesis was to further address the problem of prediction of bull fertility in the field by analyzing sperm related functions such as pre-freeze motility, acrosome reaction, sperm-zona binding, fertilization, embryo gene expression, apoptosis and development in-vitro. The possible implications of these in-vitro sperm functions on the prediction of in-vivo fertility were also examined. In the first experiment (Chapter 3), the bull effects on sperm acrosome reaction, sperm-zona binding and in-vitro embryo production, and the correlation of these parameters to pre-freeze motility and field fertility measured by 60-90 day non-return rate were investigated. Bull effects were observed in pre-freeze motility, acrosome reaction at 0 h, increase in acrosome reaction at 4 h and sperm-zona binding. The pre-freeze motility was correlated negatively with acrosome reaction at 0 h, and positively with the increase in acrosome reaction at 4 h, and sperm-zona binding. Although 172 acrosome reaction at 0 h was negatively correlated to sperm-zona binding and cleavage rate, the increase in acrosome reaction at 4 h was positively correlated with sperm-zona binding and cleavage rate. None of these tests was correlated with non-return rates (field fertility). The results of this experiment showed bull variations in sperm pre-freeze motility, acrosome reaction 0 h after thawing, spontaneous acrosome reaction after 4 h incubation in sperm capacitation medium and sperm-zona binding. When checking the correlations, although there was no relationship between in-vitro sperm functions and 60-90 day non-return rates, individual sperm functions showed relationships among them. This indicates that the accuracy of the non-return rate measurement may be questionable. Because, some of the routinely measured sperm functions, such as sperm pre-freeze motility, showed either positive correlation (Januskauskas et al., 2001) or no correlation with field fertility measured by 60-90 day non-return rate (Bailey et al., 1994; Zhang et al., 1999). In addition, most of the sperm functions examined in this study were correlated with pre-freeze motility. Many factors determine the accuracy of the non-return rate, and non-return rates corrected for these factors such as ejaculate, season, inseminator and parity are considered very accurate and have shown high correlation with in-vitro tests (Zhang et al., 1999). On the other hand, since several factors determine in-vivo fertility, thousands of inseminations should be performed to get the accurate estimate of in-vivo fertility of a bull (reviewed by Foote, 2003; Rodriguez-Martinez, 2003). However, less than one thousand inseminations were performed to get the field fertility of the experimental bulls used in the present study. Getting field fertility data from a larger sample may give a definitive answer for the relationship of these sperm functions to field fertility (reviewed by Foote, 173 2003; Rodriguez-Martinez, 2003). The results of this experiment indicated that bulls did not affect the in-vitro embryo development measured by cleavage and blastocyst production rates. Whereas, the result of the third experiment (chapter 5), in which the bulls were selected with a wide range of in-vivo fertility, revealed that bull affects embryo development as measured by cleavage and morula to blastocyst production rates. This finding indicates that the bull effect on in-vitro embryo development can be clearly shown by selecting the bulls with a wide range of in-vivo fertility, as previous findings showed high degrees of correlation between in-vitro tests and the field fertility using bulls with wide range of non-return rates (Linford et. al., 1976; Zhang et. al., 1999). The other interesting finding in the first experiment was that a very high percentage of sperm, on average 30-40%, showed acrosomal membrane damage due to the freezing procedure and low fertility bulls showed higher acrosomal membrane damage. This indicates that some of the fertility problems associated with bulls may be overcome by either improving cryopreservation procedure with the same insemination dose or increase the dose with the same cryopreservation procedure. This observation supports the findings of Saacke et al. (2000) who also showed that some of the compensable fertility deficiencies could be corrected by increasing the concentration of sperm in the insemination dose. In addition, results of the second experiment, in which increased sperm concentration yielded high fertility, support this concept. This was the first study in which the zona pellucida of the 18-24 h matured oocyte was used for sperm-zona binding assay with the assumption that the zona from mature oocytes would reflect a very accurate relationship with in-vitro as well as in-174 vivo fertility. However, the results revealed that, although bulls affected the sperm-zona binding, the sperm-zona binding showed a poor relationships with in-vitro as well as with in-vivo fertility due to unknown reasons. This poor relationship may be attributable to either the use of bulls with a narrow range of non-return rates (64.9 to 71.9 %) or the high concentrations of sperm used in this experiment. Using bulls with a wide range of non-return rates and a lower insemination dose may yield a definitive relationship between sperm-zona binding and field fertility. In the second experiment (Chapter 4), a very efficient and less time consuming nuclear staining technique was used to determine the effect of bull on in-vitro fertilization (including both normal and polyspermic) using short and long time pre-incubated sperm in normal and high sperm concentrations. The implications of this bull effect on the prediction of in-vivo fertility, and the relationships to sperm acrosome reaction, sperm-zona binding and in-vitro fertilization were also examined. In addition, the effect of sperm pre-incubation time and concentration on in-vitro fertilization was investigated. Using both normal (25,000:1) or higher (50,000:1) sperm:oocyte ratios with shorter (0 h) sperm pre-incubation time in the in-vitro fertilization process, the bull affected the percentage of zygotes (including both normal and polyspermic) and normally fertilized zygotes formed. When using the higher sperm :oocyte ratio with longer (6 h) sperm pre-incubation, the bull affected the percentage of zygotes formed, but not the percentage of normally fertilized zygotes. However, when using a normal sperm:oocyte ratio with longer sperm pre-incubation time, the bull affected only the percentage of normally fertilized zygotes, but not the percentage of zygotes. In addition, using a higher sperm:oocyte ratio with a longer sperm pre-incubation time, the bull 175 affected the percentage of polyspermic zygotes. When data from all the bulls were pooled, the sperm concentration and pre-incubation time affected the percentage of zygotes and normally fertilized zygotes formed. When using a normal sperm:oocyte ratio, the difference in the percentage of normally fertilized zygotes between shorter and longer sperm pre-incubation times showed high degree of correlation with non-return rates of the experimental bulls. A high degree of correlation was also observed between sperm pre-freeze motility, percentage of zygotes, and normally fertilized zygotes with normal sperm:oocyte ratio and longer sperm pre-incubation time. Increase in acrosome reaction at 4 h was highly correlated with the percentage of polyspermic zygotes, with a normal sperm:oocyte ratio, and a long sperm pre-incubation time. The cleavage rate showed a high degree of correlation with percentage of zygotes with normal sperm:oocyte ratio and long sperm pre-incubation time. When using the high spernr.oocyte ratio, the difference in the percentage of normally fertilized zygotes between short and long sperm pre-incubation times showed high degree of correlation with blastocyst production rate of the experimental bulls. The findings of this experiment indicated that bulls showing higher non-return rates exhibited a significant reduction in their in-vitro fertilizing ability within 6 h of pre-incubation in capacitation medium. Although, the bulls showing higher non-return rates produced higher percentages of zygotes in both short and long pre-incubation times with the normal sperm:oocyte ratio, surprisingly, their in-vitro fertility was significantly reduced from short to longer pre-incubation time than bulls showing lower non-return rates. Hence, evaluation of the reduction in in-vitro fertility in combination with other routinely used semen evaluation methods may be useful in predicting bull 176 field fertility. Another interesting finding in this experiment is that increasing the sperm:oocyte ratio from 25,000:1 to 50,000:1 using sperm concentrations of 5 million/mL and 10 million/mL resulted in an increase in the percentage of zygotes and normally fertilized zygotes. In contrast to the findings of this experiment, previous studies using sperm:oocyte ratio of 5,000:1 to 50,000:1 in a sperm concentrations of 0.5 to 4 million/mL reported that increasing sperm:oocyte ratio above 5,000:1 either did not affect or reduced the fertilization rate (Kurtu et al., 1996; Camargo et al., 2000; Tanghe et al., 2000). The third experiment (Chapter 5) investigated bull effects on embryo viability at various levels such as in-vitro embryo development, apoptosis, and gene expression. Significant bull effects were observed on in-vitro embryo development as measured by cleavage and morula to blastocyst development rates, embryo apoptosis as measured by percentage of apoptotic, live and dead blastomeres in morula to blastocyst stage embryos, and the expression levels of HSP70 and IFNx genes in morula to blastocyst stage embryos. However, bulls did not affect the expression levels of Bax, Bcl-2 and p53 genes in morula to blastocyst stage embryos produced in-vitro. Percentage of live cells was positively correlated with cleavage rate, morula to blastocyst development rate, and IFNx and HSP70 gene expression levels in morula to blastocyst stage embryos produced in-vitro. Percentage of apoptotic cells was negatively correlated with cleavage rate, morula to blastocyst development rate, and IFNx and HSP70 gene expression levels in morula to blastocyst stage embryos. The field fertility measured by 60-90 day non-return rate was correlated negatively with relative abundance of Bcl-2 mRNA 177 transcripts and positively with the ratio of Bax to Bcl-2 gene expression. None of the other in-vitro embryo parameters tested was correlated with 60-90 day non-return rate. During the past decade, several studies have reported the regulation of embryo development by apoptosis and gene expression (Yang and Rajamahendran, 2002; Knijn et al., 2003; Lonergan et al., 2003; Rizos et al., 2003). However, very few studies have investigated the bull effects on these developmentally essential cell processes. The present study is the first, which investigated bull effects on these processes in bovine embryos. The findings of this experiment showed that the bull influences development, apoptosis, and expression of IFNx and HSP70 genes in in-vitro produced morula to blastocyst stage embryos. Another interesting finding in this experiment was that bulls affected embryo apoptosis and development in-vitro. Since apoptosis, IFNx and HSP70 regulate cell proliferation, maternal recognition of pregnancy and protection, respectively, to ensure survival of embryo (Edwards et al., 1997; Godkin et al., 1997; Hardy 1997; Paula-Lopes and Hansen, 2002; Wolf et al., 2003), it was hypothesized that the in-vivo fertility of the bulls is better reflected by expression of IFNx and HSP70 genes, and apoptosis in the pre-implantation embryos. However, the results revealed that although in-vitro fertility was related to expression of IFNx and HSP70 genes, and apoptosis in morula to blastocyst stage embryos, in-vivo fertility did not show a relationship with expression of these genes and apoptosis. This was due to an opposite trend in the expression of these genes, and apoptosis in the morula to blastocyst embryos produced from the sperm of one bull in each of the low fertility and high fertility groups. This could be due to the small sample number used in this study in which, by chance, one bull in the low fertility group and one bull in the high fertility 178 group might have been allocated very poor and good quality oocytes in all four replications, respectively. In addition, it has been shown that there is a high variation in the quality of ovaries and oocytes in the day-to-day collection from slaughterhouse. Using either oocytes collected repeatedly by ultrasound guided ovum pick up from same animals for in-vitro fertilization with sperm from all experimental bulls or a higher sample number might reveal a definite answer for the relationship of vivo fertility with the expression of these genes. Irregular or imbalanced expression patterns of Bax, Bcl-2 and p53 genes induce apoptotic cell death and embryo mortality during early stages of development (Korsmeyer et al., 1993; Hardy, 1997; Haupt et al., 2003). Hence, it was hypothesized that the fertility of bulls could be reflected by the expression of Bcl-2, Bax and p53 genes in the morula to blastocyst stage embryos. However, the results showed that although there is no relationship between expression levels of these genes and percentage of apoptotic cells, surprisingly, there is a negative relationship between expression of Bcl-2 gene and in-vivo fertility. Since Bcl-2 is an anti-apoptotic protein and expressed to ensure the survival or viability of cells, the negative relationship of in-vivo fertility with the expression level of Bcl-2 gene in the embryo might be due to compensatory expression of Bcl-2 in the remaining live cells of the embryos, which were produced using sperm from low fertility bulls and undergoing apoptosis. This study demonstrated that there is a paternal influence on apoptosis and expression levels of IFNx and HSP70 genes in bovine preimplantation embryos. This is a strong indication that the paternal influence is also on the expression of other essential genes involved in the pre-implantation embryo development. Based on these finding, 179 future studies could be designed to evaluate expression levels of multiple genes using gene microarray technique. The outcome of these future studies might be usefull for the evaluation of bull field fertility. This study concluded that the new functional assays such as sperm acrosome reaction, sperm zona-binding and in vitro fertilization tests might be useful with routine semen analysis tests in the prediction of bull fertility in the field. The fertile lifespan of sperm from bulls showing higher field fertility measured by 60-90 day non-return rates reduces with in-vitro pre-incubation in capacitation medium and this measure may be also useful for the prediction of bull fertility in the field. The bull affects preimplantation embryo development, apoptosis, and expression levels of HSP70 and IFNx genes. Measurement of either the Bcl-2 gene or a ratio of Bax to Bcl-2 gene expression levels in morula to blastocyst stage embryos produced in-vitro may be useful in predicting bull field fertility. Getting a fertility index from the outcome of a combination of these tests might help in the accurate prediction of field fertility. Such a combination of assays, however, remains yet to be determined. 180 6.1. REFERENCES Bailey JL, Robertson L, Buhr M M . 1994. Relationships among in vivo fertility, computer analyzed motility and in vitro Ca flux in bovine spermatozoa. Can J Anim Sci 74, 53-58. Edwards JL, Ealy A D , Monterroso V H , Hansen PJ. 1997. Ontogeny of temperature regulated heat shock protein 70 synthesis in preimplantation bovine embryos. Mo l Reprod Dev 48, 25-33. Foote R H . 2003. Fertility estimation: a review of past experience and future prospects. Anim Reprod Sci 75, 119-139. Giritharan G, Aali M , Ramakrishnappa N , Balendran A , Rajamahendran R. 2004. Prediction of fertility of bulls in the field using in vitro fertilization and in vitro embryo production tests. Proc 11th Int Cong Biotech Anim Reprod, September 16-18, Rapotin, Czech Republic. Godkin JD, Smith SE, Johnson RD, Dore JJE. 1997. The role of trophoblast interferons in the maintenance of early pregnancy in ruminants. American J Reprod Immunol 37, 137-143. Hardy k. 1997. Cell death in the mammalian blastocyst. Mol Human Reprod. 3, 919-925. Haupt S, Berger M , Goldberg Z, Haupt Y . 2003. Apoptosis - the p53 network. J cell Sci 116,4077-4085. Januskauskas A , Johannisson A Rodriguez-Martinez H. 2001. Assessment of sperm quality through fluorometry and sperm chromatin structure assay in relation to field fertility of frozen thawed semen from Swedish A l bulls. Theriogenology. 55, 947-961. Knijn H M , Gjorret JO, Vos P L A M , Hendriksen PJM, van der Weijden B C , Maddox-Hyttel P, Dieleman SJ. 2003. Consequences of in vivo development and subsequent culture on apoptosis, cell number, and blastocyst formation in bovine embryos. Biol Reprod 69, 1371-1378. Korsmeyer SJ, Shutter JR, Veis DJ, Merry DE, Oltvai Z N . 1993. Bcl-2/Bax a rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 4, 327-332. Kurtu JM, Ambrose JD, Rajamahendran R. 1996. Cleavage rate of bovine oocytes in-vitro is affected by bulls but not sperm concentrations. Theriogenology 45, 257. 181 Larsson B , Rodriguez-Martinez H. 2000. Can we use in vitro fertilization tests to predict semen fertility ? Anim Reprod Sci (60-61), 327-336. Lindford E, Glover FA, Bishop C, Steward DL. 1976. The relationship between semen evaluation methods and fertility in the bulls. J Reprod Fertil 47, 283-291. Lonergan P, Rizos D, Gutie'rrez-Ada'n A , Moreira P M , Pintado B, de la Fuente J, Boland MP. 2003. Temporal divergence in the pattern of messenger R N A expression in bovine embryos cultured from the zygote to blastocyst stage in vitro or in vivo. Biol Reprod 69, 1424-1431. Paula-Lopes FF, Hansen PJ. 2002. Heat shock-Induced apoptosis in preimplantation bovine embryos is a developmentally regulated phenomenon. Biol Reprod 66, 1169-1177. Rizos D, Gutie'rrez-Ada'n A , Pe'rez-Garnelo P, de la Fuente J, Boland MP, Lonergan P. 2003. Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger R N A expression. Biol Reprod 68, 236-243. Rodriguez-Martinez H . 2003. Laboratory semen assessment and prediction of fertility: still Utopia? Reprod Dom Anim 38, 312-318. Rodriguez-Martinez H , Larsson B. 1998. Assessment of sperm fertilizing ability in farm animals. Acta Agric Scand Sect A Anim Sci suppl 29,12-18. Saacke R G , Dalton JC, Nadir S, Nebel RL , Bame JH. 2000. Relationship of seminal traits and insemination time to fertilization rate and embryo quality. Anim Reprod Sci 60-61,663-677. Wolf E, Arnold GJ, Bauersachs S, Beier H M , Blum H, Einspanier R, Frohlich T, Herrler A , Hiendleder S, Kolle S, Prelle K, Reichenbach H-D, Stojkovic M , Wenigerkind H , Sinowatz F. 2003. Embryo-maternal communication in bovine -strategies for deciphering a complex cross-talk. Reprod Dom Anim 38, 276-289. Yang M Y , Rajamahendran R. 2002. Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci 70, 159-169. 182 Zhang BR, Larsson B, Lundeheim N , Haard M G H , Rodriguez-Martinez H . 1999. Prediction of bull fertility by combined in vitro assessments of frozen-thawed semen from young dairy bulls entering an A l program. Int J Androl 22, 253-260. 183 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091773/manifest

Comment

Related Items