Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Mutagenesis investigation of the molecular determinants of collagen triple helicase activity in neutrophil… Pelman, Gayle R. 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-0281.pdf [ 7.63MB ]
Metadata
JSON: 831-1.0091466.json
JSON-LD: 831-1.0091466-ld.json
RDF/XML (Pretty): 831-1.0091466-rdf.xml
RDF/JSON: 831-1.0091466-rdf.json
Turtle: 831-1.0091466-turtle.txt
N-Triples: 831-1.0091466-rdf-ntriples.txt
Original Record: 831-1.0091466-source.json
Full Text
831-1.0091466-fulltext.txt
Citation
831-1.0091466.ris

Full Text

MUTAGENESIS INVESTIGATION OF THE MOLECULAR DETERMINANTS OF COLLAGEN TRIPLE HELICASE ACTIVITY IN NEUTROPHIL COLLAGENASE (MMP-8)  by  GAYLE R. PELMAN  B.Sc, The University of British Columbia, 1997  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES  (Department of Biochemistry & Molecular Biology)  We accept this thesis as conforming to the required standard  The University of British Columbia  April 2004  © Gayle R. Pelman, 2004  Library Authorization  In presenting this thesis in partial fulfillment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  2.1/W j ^ o o ^  9/WLE PgLMAN Name of Author (please print)  Title of Thesis: De-t-g^rrvA.'iA/a  Degree:  Date (dd/mm/yyyy)  M^TAgincs.'s / ^ ^ - N g s t f i ^ ^-K o f  C o l M o ^  TViple-  M  Department of BiW^e^.s-fv-y The University of British Columbia ^ Vancouver, BC Canada  o f -tint, M o / e c u / a  Hellene,  Year: Ho)ta^)cL^  /fctivi f y  ZOo*-/Biology ^ /  ABSTRACT  Collagen is a triple helical macromolecule that is one of the most complex proteins of the extracellular matrix and one of the most difficult to cleave and degrade. The physiological turnover of collagen is important for growth and repair, with abnormal breakdown of collagen contributing to numerous pathological conditions including arthritis and tumour metastasis. The mechanism of. collagenase activity has been studied extensively through the use of chimeric proteins and more recently through site-directed mutagenesis of specific residues thought to play key roles. Despite these efforts, the mechanism of collagenase cleavage of collagen remains unresolved. The matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that are thought to cleave all extracellular matrix proteins as well as bioactive molecules. Though the collagen triple helix is resistant to most proteases, a number of M M P s display collagenase activity. Neutrophil collagenase (MMP-8) degrades collagen types I, II and III, the major collagen components of bone, tendon, and cartilage, and is implicated in the pathogenesis of rheumatic disease.  We have chosen to systematically alter a range of residues in the S 3 ' substrate specificity subsite of MMP-8 by site-directed mutagenesis. The aims of this project are to decipher which S 3 ' residues are involved in the catalytic function of the enzyme and to resolve any specific molecular determinants for collagen catalysis. Assays of synthetic peptide substrate and native type I collagen cleavage were used to measure the activity of mutant proteins in comparison to wildtype MMP-8 control. Results indicate a specific role for Tyr  in type I collagen cleavage. While the Tyr Ala mutant was catalytically  competent and retained 88% of wildtype synthetic peptide activity, its specificity for type I collagen dropped to one-third of that of wildtype. Mutations of A s n  188  affected both the  catalytic and collagenolytic activity of MMP-8. Our findings support the importance of the S 3 ' residues in the general catalytic competency of M M P - 8 as well as its specificity for native type I collagen.  TABLE OF CONTENTS  Abstract  •  ii  Table of Contents  iii  List of Tables  iv  List of Figures  v  List of Abbreviations  vi  Acknowledgements Overview and Summary  1  1.1  Introduction to the Matrix Metalloproteinases  1  1.2  Structural Elements of MMP-8  5  1.3  MMP-8 Function  20  1.4  Project Rationale and Hypothesis  28  .1.5  References  30  Manuscript  44  2.1  Introduction  45  2.2  Experimental Procedures  2.3  Results  51  2.4  Discussion  53  2.5  References  58  2.6  List of Abbreviations  65  2.7  Tables and Figures  66  Summary  71  3.1  Discussion and Conclusions  71  3.2  References  73  CHAPTER  CHAPTER  CHAPTER  1:  viii  2:  3:  ••••  47  Appendix A : Summary of Constructs  74  Appendix B : Sample Active Site Titration Curve  76  in  LIST O F T A B L E S  Table 2.1: MMP-8 Mutagenesis Primers  LIST O F F I G U R E S  Fig. 1.1:  Comparison of the amino acid sequence of human MMP-8 with other collagenases  Fig. 1.2:  3  Representation of the secondary structure of the M M P - 8 catalytic domain  7  Fig. 1.3:  Structural similarity of MMP-8 and MMP-1  ,  Fig. 1.4:  The catalytic domain of MMP-8  Fig. 1.5:  Schematic representation of the key MMP-8 active site determinants for substrate recognition  Fig. 1.6:  8 10  12  Potential enzyme-substrate interactions calculated from x-ray diffraction crystallography data of MMP-8 in complex with various inhibitors  14  Fig. 1.7:  Structural variation in the N-terminal of MMP-8  16  Fig. 1.8:  Model of the collagenase cleavage site in type I collagen  22  Fig. 1.9:  Potential molecular interactions supporting triple helicase activity  24  Fig. 2.1:  Sequence and location of active site residues of M M P - 8  67  Fig. 2.2:  Purified recombinant wildtype and mutant MMP-8 proteins  68  Fig. 2.3:  MMP-8 hydrolysis of synthetic peptide substrate  69  Fig. 2.4:  The effect of active site mutants on MMP-8 activity against type I collagen  70  LIST OF ABBREVIATIONS  APMA  4-aminophenylmercuric acetate  ATP  adenosine triphosphate  BB94  batimastat (4-(N-hydroxyamine)-2R-Isobutyl-2S-(2-thiomethyl succinylL-phenylalanine-N-methylamide  Brij  polyoxyethylene monolauryl ether  CAB  collagenase assay buffer  CBD  collagen binding domain  CHO  Chinese hamster ovary  CXCR2  C X C chemokine receptor 2  DMEM  Dulbecco's Modified Eagle Medium  DNA  deoxyribose nucleic acid  Dpa  3-(2,4-dinitrophenyl)-L-2,3-diaminopripionyl  FAB  fluorescence assay buffer  GCP  granulocyte chemotactic protein  hCMV  human cytomegalovirus  IL  interleukin  Mca  (7-methoxycoumarin-4-yl)acetyl  MCP  monocyte chemoattractant protein  MMP  matrix metalloproteinases  mRNA  messenger ribosenucleic acid  MT-MMP  membrane-type M M P  PAGE  polyacrylamide gel electrophoresis  PBS  phosphate-buffered saline  PCR  polymerase chain reaction  PDB  Protein Data Bank  QF24  quenched fluorescent peptide (7-methoxycoumarin-4-yl)acetyl-Pro-LeuGly-Leu-[3-(2,4-dinitrophenyl)-L-2,3-diaminopropionyl]-Ala-Arg-NH  RO200-1770 2-hydroxy-5-[4-(2-hydroxy-ethyl)-piperidin-1 -yl]-5-phenyl-1Hpyrimidine-4,6-dione  2  SDS  sodium dodecyl sulphate  TIMP  tissue inhibitor of metalloproteinases  TNF  tumour necrosis factor  Tris  tris (hydroxymethyl) aminomethane  Tween  polyoxyethylene 20-sorbitan monolaurate  vii  ACKNOWLEDGEMENTS  M y appreciation goes to Chris Overall for the opportunity to learn in a dynamic environment and for his support and supervision during my studies. Thanks also to the other members of my supervisory committee, Clive Roberts and Dana Devine, who were always available for my questions.  Through the years in the Overall Lab I've enjoyed the friendship and support of so many people - to all lab members, past and present, thank you. To Y i l i and Eric, who have been there from start to finish; Angela and Angus M . for help in the early years; Charlotte for the proper start in tissue culture and for being such a good bench neighbour; George for the patiently repeated explanations of kinetics; Oded for making the technology run smoothly and for rendering quality figures; Gus and Rich for training the robots to keep things moving along; Andrea for running around and keeping everything together; Reini for spreading the sunshine; Sally for the book chats; Sean for the company in the satellite colony; Heidi, Todd and Shin for continued encouragement long after you have moved on - I'm grateful for the time we've spent together.  Most of all, thanks to Mom and Dad, for making sure I kept things in perspective.  GP 2004  CHAPTER 1 - OVERVIEW AND SUMMARY  1.1 Introduction  to the Matrix  Metalloproteinases  The painful swelling and stiffness of arthritic joints is a direct consequence of connective tissue destruction during the inflammatory disease process. Central to the degradation of connective tissue in both normal turnover and pathological conditions is the activity of matrix metalloproteinases (MMPs), a family of zinc-dependent endopeptidases (1-3). Substrates of M M P s include collagen, fibronectin, elastin, aggrecan and essentially all other extracellular matrix components of cartilage, tendon and bone (4,5).  1.1.1 The  Collagenases  A subset of the M M P s is the collagenases, categorized by their ability to cleave native triple helical collagen. MMP-1 (also called collagenase-1) was first described over forty years ago when it was discovered that a substance present in the tail of a tadpole could degrade triple helical collagen (6). The discovery of two other collagenases, M M P - 8 and MMP-13 (collagenase-2 and -3), followed (7,8). MMP-18 (collagenase-4) has been detected in Xenopus laevis but no human analogue is known (9). The cell-surface bound MMP-14 (membrane type-1 ( M T l ) - M M P ) and gelatinase A (MMP-2) also have weak collagenolytic activity (10,11).  1.1.2 The Role of MMPs  in  Inflammation  The inflammatory response to injury or infection quickly defends against intrusion in a controlled manner that limits self-damage. In chronic inflammatory diseases such as arthritis, there is an imbalance of the pro- and anti-inflammatory signals which leads to the continuation of the destructive cycle (12,13). Immune cells such as the polymorphonuclear neutrophilic leukocyte (neutrophil) are drawn to chemoattractants or cytokine signals. In the disease state, neutrophils migrate from circulation into joints in response to cytokines, are primed by local factors and activated by cytokines, and secrete  proteases and other tissue damaging products which stimulate further cycles of recruitment (14). One enzyme believed to be on the front lines of the inflammatory reaction is MMP-8, the neutrophil collagenase.  1.1.3 Matrix  Metalloproteinase-8  Neutrophil collagenase (MMP-8) (EC 3.4.24.34) degrades collagen types I, II and III, the major collagen components of bone, tendon, and cartilage, and is a key participant in the pathogenesis of rheumatic disease (15). The collagenases have distinct substrate specificities, with MMP-8 preferentially degrading type I collagen over types II and III, while MMP-1 displays greatest activity against type III collagen, followed by type I collagen and, to a much lesser extent, type II collagen (16-18). MMP-13 preferentially degrades type II collagen and is associated with cartilage degradation (19,20).  1.1.3.1 MMPS  Discovery  and  Characterization  The first descriptions of MMP-8 were of an enzyme from the granules of neutrophils that cleaved native type I collagen at neutral pH (21,22). The enzyme was characterized as a metal-dependent glycoprotein of approximately 70-75 kDa which was expressed as a latent zymogen and activated through removal of a 25 kDa segment (23-26). The presence of multiple metal binding sites was inferred through studies with gold compounds (27,28).  In 1990, the cDNA encoding MMP-8 was isolated from an mRNA library derived from the leukocytes of a patient with chronic granulocytic leukemia (7,29). The derived 467 amino acid translation contained the hallmark zinc binding and activation sequences common to the M M P family and had 57% identity and 72% chemical similarity to M M P 1 (Fig. 1). Six potential sites for AMinked glycosylation were identified, including two sites in the propeptide region. The enzyme has a 20 residue signal peptide sequence and an 80 residue propeptide lost on autolytic activation at the Met -Leu bond. G l y 80  Leu  243  was also identified as an autolytic degradation site (29).  81  242  -  MFRLKTLPLL MLHLKTLPFL MFSLKTLPFL MHSFPPLLLL -MHPGVLAAF  MMP8_M0USE MMP8_RAT MMP8_HUMAN MMP1_HUMAN MMP13_HUMAN  IFLHTQLANA FFFHTQLATA LLLHVQISKA LFWG-WSHS LFLSWTHCRA  <r  KEMQRFFSLA KEMQRFFGLP KEMQRFFGLP KQMQEFFGLK REMQSFFGLE  33  1  FPVP E LPVPP E FPVS FPAT L LPLPSGGDED  HLEEKNIKTA HLEEKNMKTA SKEKNTKTV ETQEQDVDLV DLSEEDLQFA  ENYLRKFYNL ENYLRKFYHL QDYLEKFYQL QKYLEKYYNL ERYLRSYYH-  PSNQFRSSRPSNQFRSARPSNQYQSTRK KNDGRQVEKR PTNLAGILKE  PDSGDFLLTP PDSGDFLLTP PDSGGFMLTP PDVAQFVLTE PDVGEYNVFP  GSPKWTHTNL GSPKWTHTNL GNPKWERT L GNPRWEQTHL RTLKWSKMNL  prodomain  ETGKLDAATM ETGKPDAATI VTGKPNEETL VTGKPDAETL VTGKLDDNTL  93  MMP8_M0USE MMP8_RAT MMP 8_HUMAN MMP1_HUMAN MMP13 HUMAN  NAT-MVAEKL NAT-MIAEKL GTNVIVEKL RNSGPWEKL NAASSMTERL  GIMEMPRCGV EIMEKPRCGV DMMKKPRCGV KVMKQPRCGV DVMKKPRCGV  MMP8_M0USE MMP8_RAT MMP 8_HUMAM MMP1_HUM7AN MMP13 _HUMAN  TYWIINHTPQ TYRIINHTPQ TYRIR'NYTPQ TYRIENYTPD TYRIVNYTPD  LSRAEVKTAI MSKAEVKTEI LSEAEVERAI LPRADVDHAI MTHSEVEKAF  EKAFHVWSVA EKAFKIWSVP KDAFELWSVA EKAFQLWSNV KKAFKVWSDV  SPLTFTEILQ STLTFTETLE SPLIFTRISQ TPLTFTKVSE TPLNFTRLHD  GEADINIAFV GEADINIAFV GEADINIAFY GQADIMISFV GIADIMISFG  SRDHGDNSPF SRDHGDNSPF QRDHGDNSPF RGDHRDNSPF IKEHGDFYPF  MMP8_MOUSE MMP8_RAT MMP8_HUMAN MMP1_HUMAN MMP13 _HUMAN  DGPNGILAHA DGPNGILAHA DGPNGILAHA DGPGGNLAHA DGPSGLLAHA  FQPGQGIGGD FQPGRGIGGD FQPGQGIGGD FQPGPGIGGD FPPGPNYGGD  AHFDSEETWT AHFDSEETWT AHFDAEETWT AHFDEDERWT AHFDDDETWT  QDSKNYNLFL QDSKNYNLFL TSANYNLFL NNFREYNLHR SSSKGYNLFL  VAAHEFGHSL VA? HEFGHSL VA? HEFGHSL VA?HELGHSL VA? HEFGHSL  GLSF. STDPGA GLSK STDPGA GLAFSSDPGA GLSF STDIGA GLDF SKDPGA  MMP8_MOUSE MMP8_RAT MMP8_HUMAN MMP1_HUMAN MMP13 _HUMAN  LMYPNYAYRE LMY PNYAYRE LMYPNYAFRE LMYPSYTFSLMFPIYTYTG  PSTYSLPQDD PSTYSLPQDD TSNYSLPQDD -GDVQLAQDD KSHFMLPDDD  INGIQTIYGP INGIQTIYGP IDGIQAIYGL IDGIQAIYGR VQGIQSLYGP  SDNPIQPTGP SDNPVQPTGP SSNPIQPTGP SQNPVQPIGP GDEDPNPKHP  STPKACDPHL STPTACDPHL STPKPCDPSL QTPKACDSKL KTPDKCDPSL  RFDATTTLRG RFDAATTLRG TFDAITTLRG TFDAITTIRG SLDAITSLRG  MMP8_M0USE MMP8_RAT MMP 8 _HUMAN MMP1_HUMAN MMP13_HUMAN  EIYFFKEKYF EIYFFKDKYF EILFFKDRYF EVMFFKDRFY ETMIFKDRFF  WRRHPQLRTV WRRHPQLRTV WRRHPQLQRV MRTNPFYPEV WRLHPQQVDA  DLNFISLFWP DLNFISLFWP EMNFISLFWP ELNFISVFWP ELFLTKSFWP  GLPNGLQAAY FLPNGLQAAY SLPTGIQAAY QLPNGLEAAY ELPNRIDAAY  EDFDRDLVFL EDFDRDLVFL EDFDRDLIFL EFADRDEVRF EHPSHDLIFI  FKGRQYWALS FKGRQYWALS FKGNQYWALS FKGNKYWAVQ FRGRKFWALN  MMP8_M0USE MMP8_RAT MMP8_HUMAN MMP1_HUMAN MMP13 HUMAN  GYDLQQGYPR AYDLQQGYPR GYDILQGYPK GQNVLHGYPK GYDILEGYPK  DISN-YGFPR SVQAIDAAVS DISN-YGFPR SVQAIDAAVS DISN-YGFPS SVQAIDAAVF DIYSSFGFPR TVKHIDAALS KISE-LGLPK EVKKISAAVH  YN--GKTYFF YN--GKTYFF YR--SKTYFF EENTGKTYFF FEDTGKTLLF  INNQCWRYDN VNNQCWRYDN VNDQFWRYDN VANKYWRYDE SGNQVWRYDD  ERRSMDPGYP QRRSMDPGYP QRQFMEPGYP YKRSMDPGYP TNHIMDKDYP  MMP8_MOUSE MMP8_RAT MMP8_HUMAN MMP1_HUMAN MMP13_HUMAN  KSIPSMFPGV TSIASVFPGI KSISGAFPGI KMIAHDFPGI RLIEEDFPGI  NCRVDAVFLQ NCRIDAVFQQ ESKVDAVFQQ GHKVDAVFMK GDKVDAVYEK  QYFAFNFVSH QYFAFNLVSR RYYAFDLIAQ RQYKFDPKTK IQFEYSIWSN  RVTRVARSNL RVTRVARSNL RVTRVARGNK RILTLQKANS RIVRVMPANS  WLNCS-WLNCP-WLNCRYG WFNCRKN ILWC  -><-  catalytic domain 153  213  273  linker  -X-  hemopexin C 333  390  447  F i g . 1.1.  DSFFLFFSGP DSFFLFFSGP EHFFHVFSGP DGFFYFFHGT NGYIYFFNGP  Comparison of the amino acid sequence of human  MMP-8  with other collagenases.  CLUSTAL W  m u l t i p l e s e q u e n c e a l i g n m e n t o f m o u s e M M P - 8 ( S w i s s - P r o t a c c e s s i o n n u m b e r 0 7 0 1 3 8 ) , rat M M P - 8 ( 0 8 8 7 6 6 ) , M M P - 8 (P22894), h u m a n M M P - 1 (P03956), and human M M P - 1 3 (P45452) (30,31).  (1.74)  human  N u m b e r i n g c o m m e n c e s at t h e  m a t u r e s e c r e t e d z y m o g e n f o r m o f the h u m a n M M P - 8 e n z y m e . C o n s e n s u s r e s i d u e s are u n d e r l i n e d . S h a d e d areas o f interest are the P R C G V P D c y s t e i n e s w i t c h l o c u s in the p r o d o m a i n , the P h e ^ / M e t strictly c o n s e r v e d T y r  1 8 9  8 0  N - t e r m i n i o f the a c t i v a t e d e n z y m e a n d the  i n v o l v e d i n a cis p e p t i d e b o n d w i t h n e i g h b o u r i n g A s n  1 8 8  .  T h e archetypal H E x x H x x G x x H Z n  m o t i f c o m m o n to a l l M M P s is b o x e d . P o t e n t i a l N - l i n k e d g l y c o s y l a t i o n sites are g r e y . propeptide, catalytic d o m a i n , linker and h e m o p e x i n C domain.  2 +  A r r o w s d e f i n e the b o u n d a r i e s o f the  1.1.3.2 The Physiological  Role of  MMP-8  MMP-8 has been associated with numerous pathological processes, as well as normal turnover of the extracellular matrix during growth and healing. Increased expression and activation of MMP-8 is found in periodontal remodeling during orthodontic treatment (32,33) and MMP-8 levels in gingival crevicular fluid correlate with the severity of periodontitis (34,35). MMP-8 levels are elevated in children with pulmonary disease and respiratory failure (36). MMP-8 is pointed to as a participant in the protease cascades associated with invasiveness of ovarian tumors (37). MMP-8 was found to be upregulated by interleukin-1 beta (IL-1P) and associated with increased metastasis in ovarian cancer (38). Overexpression of MMP-8 in some breast cancer cell lines confers a nonmetastatic phenotype (39,40). Studies by quantitative PCR question MMP-8 upregulation by IL-1(3 and its role as a major cartilage matrix degrading protease, finding only minor expression of MMP-8 by articular chondrocytes, while mRNA for MMP-8 was detected in osteoarthritic cartilage (41-43). There is also evidence for M M P - 8 expression in rheumatoid synovial fibroblasts (44). Tumour necrosis factor (TNF)-alpha stimulates expression of MMP-8 (42). MMP-8 is involved in the process of cervical ripening and associated with IL-8 (45,46). MMP-8 has also been associated with the corneal renewal cascade (47).  A transgenic Mmp8''' mouse model has been established to study the effects of loss of MMP-8 (48). Although their development and growth appear phenotypically normal, male MmpS' ' mice showed increased susceptibility to skin tumours. A similar propensity 1  was seen in female MmpS' ' mice treated with tamoxifen, an estrogen receptor antagonist, 1  and those whose ovaries were removed. Transplantation of wildtype bone marrow to Mmp8 ''"mice restored a natural degree of protection against tumours. The inflammatory response of MmpS' ' mice was initially sparser than that of wildtype counterparts, but the 1  response was maintained for an abnormally extended time period. It has been suggested that chronic inflammation can lead to genomic instability thereby promoting tumour development (49).  MMP-8 likely acts as a mediator of the inflammatory response. M M P - 8 has some proteolytic activity against the chemokines monocyte chemoattractant protein (MCP) -1 and granulocyte chemotactic protein (GCP) - 2 and is proposed to have a role in regulating recruitment of immune cells to sites of inflammation (50,51). The murine chemokine L I X is cleaved and activated by MMP-8, accounting for the delayed infiltration of neutrophils in Mmp8~'~ mice (48).  MMP-8 is synthesized and stored in granules during neutrophil maturation in the bone marrow (22,52). With a finite amount of stored MMP-8 per neutrophil, more cells need to be recruited to sustain release of the enzyme during the inflammatory response. This is in contrast to the constitutive synthesis and release of MMP-1 from fibroblasts (7). Although the cellular sources of the human collagenases vary, their structural elements remain very similar (53).  1.2 Structural Elements  of  MMPS  MMP-8 consists of an N-terminal propeptide domain, a central catalytic domain, a linker region, and a C-terminal hemopexin C domain. Expression and purification of recombinant truncated forms of MMP-8 containing only the catalytic domain provided a pure source of enzyme for use in X-ray structure determination (54). The crystal structure of the catalytic domain with various N-terminal initiating residues has been solved in combination with synthetic peptides mimicking bound substrate transition states (PDB Accession Codes 1A85, 1A86, 1BZS, 1173, 1176, 1JAN, 1JAO, 1JAP, 1JAQ, 1JH1, 1JJ9, 1KBC, 1MMB, 1MNC) (55).  1.2.1 The Prodomain  Maintains  Enzyme  Latency  M M P s are expressed as inactive zymogens, and their post-translational processing to functional form provides another means of regulating their activity. Enzyme latency is maintained by coordination of the Cys residue from the P R C G V P D (in all human collagenases) motif of the prodomain to the catalytic zinc (Fig. 1). M M P activation  occurs by a "cysteine switch" mechanism in which a water molecule displaces the Cys from the active site Zn (56,57). Autolytic cleavages or processing by other proteases result in an active enzyme with a variety of N-terminal residues. MMP-3 and -10 (stromelysin-1 and -2) have been shown to cleave MMP-8 at the Gly -Phe bond 78  79  (58,59). Chymotrypsin and cathepsin G cleave leaving a Met N-terminus, while 80  kallikrein cleaves between Leu -Thr (60). Trypsin activates in a two-step process with 81  82  cleavages at Arg -Phe and Arg -Cys 48  49  70  71  (60). MMP-12 (elastase) cleaves the prodomain  at A s n - V a l but does not activate the enzyme (60). Aminophenylmercuric acetate 53  54  (APMA) facilitates intramolecular activation and promotes cleavage at A s n - V a l and 53  54  Asp -Met followed by a final cleavage resulting in an activated enzyme with a Met or 64  Leu  65  80  N-terminus. Inhibition by tissue inhibitor of metalloproteinases (TIMP)-l, which  is also expressed by neutrophils (61), blocks activation by A P M A but does not stop preliminary cleavage of the A s n - V a l bond (62,63). 53  1.2.2  The Catalytic  54  Domain  Two research groups simultaneously resolved the crystal structure of the catalytic domain of MMP-8 in complex with inhibitory molecules (64-66). The overall structure of the catalytic domain is spherical, with a larger top N-module and smaller bottom C-module separated by the active site cleft. The N-module consists of five (3-strands (si - sV) and 2 a-helices (hA, hB) (Fig. 2). The only anti-parallel f3-strand, sIV, outlines the upper edge of the active site, while hB is the active site helix bearing the residues of the HExxH consensus motif.  The upper portion of the N-module contains a structural zinc ion (Zn ) as well as two 998  calcium ions (Ca , Ca ). The loop connecting sill and sIV forms an S-shape around 996  Zn  9 9 8  997  and C a , then protrudes into the substrate-binding cleft as part of the S2' pocket 997  (Fig. 3A). C a  996  is located in a Gly-rich loop before sV. Z n  a tetrahedral fashion by H i s , A s p , H i s 147  octahedrally coordinated; C a  996  149  162  9 9 8  is strongly coordinated in  and H i s . The calcium ions are both 175  is positioned by A s p , G l y , G l y , A s p 137  169  171  173  and two  6  F M L T P G N P K W E R T N L T Y R I R N Y T P Q L S E A E V E R A 79~~  85  90  N I A F Y Q R D H G D N S P 139  145  150  95  100  105  205  210  U5  120  125  I F T R I S Q G E A D I 130  135  F D G P N G I L A H A F Q P G Q G I G G D A H F D A E E T W T N T S A N Y N L F L V A A H E 155  160  165  F G H S L G L A H S S D P G A L M Y P N Y A F R E T S N Y S 199  110  I K D A F E L W S V A S P L  215  220  225  170  175  180  185  190  195  L P Q D D I D G I Q A I Y G 230  235  240  Fig. 1.2. Representation of the secondary structure of the M M P - 8 catalytic domain. The MMP-8 catalytic domain (residues 79 - 242) consists of five beta sheets (si - sV) and three alpha helices (hA - hC) with numerous beta turns ((3). Amino acids coordinating with catalytic Z n (*), structural Z n (•) and C a ions 996 and 997 (o) are identified. Adapted from a PROMOTIF schematic (67). 9 9 9  9 9 8  2+  7  Fig. 1.3. Structural similarity of MMP-8 and MMP-1. A. Ribbon representation of the catalytic domain of MMP-8 (PDB accession code 1JAN). Five beta sheets (si sV) and three alpha helices (hA - hB) are labelled. B. Ribbon representation of the full-length structure of MMP-1 (1FBL). The catalytic domain is very similar to that of MMP-8 with an additional calcium ion. The catalytic domain is followed by the flexible linker and the hemopexin C domain which has a four-bladed (I - IV) propeller-like structure surrounding a central calcium ion. The full length structure of MMP-8 has not yet been solved by x-ray diffraction crystallography but is postulated by sequence homology to tightly resemble that of M M P - 1 .  8  solvent molecules, while C a  997  coordinates to A s p , G l y , A s n , He , A s p , and 154  155  157  159  177  Glu . 180  The catalytic Z n  9 9 9  is located at the bottom of the active site and is coordinated by H i s  and H i s , which are separated by one helical turn in hB (Fig. 4). Nearby G l u 201  198  197  binds a  solvent molecule that is also involved in coordination with the catalytic zinc in the free enzyme. At the end of hB (Gly ), the chain turns to the C-portion of the catalytic 204  domain and forms the lower wall of the active site cleft. The third His ligand to Z n His  is  9 9 9  , which completes the trigonal pyramidal arrangement as part of the characteristic  HExxHxxGxxH motif. This residue is followed by Ser , which is hydrogen (H)-bonded 208  to the M e t  215  component of the Met-turn. The Met-turn is a sharp (l,4)-(3-turn, which  stabilizes a right-handed loop composed of A l a , L e u , M e t 213  214  215  and T y r . The M e t 216  215  sulphur atom is 0.5 nm from the catalytic zinc and the two lone pair orbitals do not point in its direction. However, the E-methyl of M e t 197  with His  215  faces the edge of H i s  207  and is in plane  201  and His  Although M e t  215  , allowing for possible H-interactions through the aromatic rings.  is a strictly conserved hallmark of the metzincin superfamily of  enzymes, the function of the Met-turn as a hydrophobic floor to the zinc binding site may not be critical to enzyme activity. Site-directed mutagenesis of this Met to Leu and Ser has recently been reported to have no effect on enzyme activity (68). Pro  217  following the Met-turn produces a kink in the chain, which follows the surface of  the enzyme before looping into the final helix, hC, of the catalytic domain. This turn creates a protected S i ' pocket, shielded from bulk water (66). This deep subsite allows for binding of substrate with a large P i ' side chain, a residue important for cleavage specificity.  Other residues important to the structure of the catalytic domain include the aspartic acids of hC. A s p , located after the first turn of hC, forms two H-bonds with N atoms of the 233  Met-turn residues L e u  214  and Met . A s p 215  232  creates a salt bridge with the N-terminal  ammonium of the Phe form of the catalytic domain. The N-terminus of the catalytic 79  domain is secured to the hydrophobic core by Trp (binding Leu , He , Pro , G l y , 88  93  138  166  172  Fig. 1.4. The catalytic domain of M M P - 8 . Ribbon diagram of the structure of the MMP-8 catalytic domain (PDB accession code 1 JAP). The catalytic zinc ion is coordinated to H i s , H i s and H i s , and interacts with a solvent molecule polarized by the active site G l u . Highlighted residues A s n and T y r of the S ' substrate specificity subsite are joined in an unusual cis peptide bond configuration. 197  201  198  207  188  189  3  Leu ) before ascending to si (65). Crystallographic studies of the Met form of the 203  8U  catalytic domain indicate that the first six residues are unordered (to Pro ) and a concave 86  space exists at the bottom of the enzyme between Pro and Ser 86  1.2.2.1 Enzyme-Substrate  Interactions in the Active  209  (64).  Site  Peptide substrates bind through the active site anti-parallel to the sIV edge strand forming the upper face. Substrates bind in an extended conformation to take advantage of multiple binding sites (Fig. 5). Non-primed residues (N-terminal of the scissile bond) are 201  positioned at the bottom of the cleft over the imidazole plane of His  . P2 forms two H -  9 0 9  bonds with Ser  and the scissile peptide is also believed to H-bond with the edge strand.  The hydrophobic S 3 subsite is well-suited for a P 3 proline side chain, and the S2 subsite is shallow as well. Subsite S] is longer and points away from the active site cleft. Hydrophobic residues are preferred in P , P i ' and P ' positions and the best-suited Pi and 2  2  P 3 ' residues are Gly and Ala. 1.2.2.2 The Catalytic  Hydrolysis  Reaction  The scissile peptide bond is oriented so that the carbonyl is polarized by the catalytic Zn. 198  A water molecule squeezed between this carbonyl and Glu the catalytic activity of MMP-8. Transfer of a proton to G l u  plays an important role in 198  readies the water for  nucleophilic attack on the carbonyl of the scissile bond. The transitional state of the reaction is supported by the catalytic Zn and stabilizing interactions with neighbouring residues such as the His triad (69). Hydrolysis of the Pi - P i ' peptide bond returns the enzyme to the free state. It has been demonstrated that mutation of the catalytic Glu to Ala or Gin abolishes enzyme activity (70,71). 1.2.2.3 Structural Insights from Crystallography  with Inhibitors  The first crystal structures of MMP-8 catalytic domain were published in 1994 (64-66). Along with purely structural aspects, the crystallization of various inhibitor molecules in  Fig. 1.5. Schematic representation of the key MMP-8 active site determinants for substrate recognition. Conserved active site residues help shape the S2 to S2' specificity subsites. Hydrolysis ( X ) of the scissile bond between substrate residues Pi and P i ' is mediated by catalytic G l u polarization of a solvent molecule and stabilized in part by catalytic Z n . Adapted from Brandstetter et al (72). 198  999  12  complex with the enzyme provided insight into the enzyme-substrate binding interactions occurring in the active site. OA  One of the first structures of the MMP-8 catalytic domain (with Met N-terminus) was determined in complex with the inhibitor Pro-Leu-Gly-hydroxamine (PLGNHOH) (Fig. 6A)(64). The inhibitor lies antiparallel to sIV forming the top of the active site cleft and ' binds to the unprimed side of the active site. P L G N H O H , with a typical peptide backbone and standard amino acid sidechains, mimics a "good substrate" for MMP-8 since Pro and Leu have been determined to be desirable candidates for the P 3 and P? positions of an MMP-8 substrate (73). The likely contributions of Ser , Phe 151  His  164  and  to the formation of the S 3 substrate specificity site were noted by the authors.  162  The first structure solved for the Phe form of MMP-8 showed the implications of one 79  extra residue to the structure of the N-terminal of molecule (Fig. 6B) (65). While the Met variant appears structurally disordered to Pro , the Phe form, longer by just one 80  86  residue, is able to form a salt bridge to the A s p against He  240  and A s n  85  79  carboxylate of hC (Fig. 7). L e u  232  while Phe is stabilized by G l y 79  236  and A l a  239  packs  81  . This anchoring of  the N-tail results in a 3.5-fold increase in collagenase activity. This "superactive" form also benefits from 2 H-bonds between A s p in turn H-bonds the catalytic H i s . A s p 197  enclosed by G l y , A l a , He , L e u 236  238  240  205  233  232  and the Met-turn L e u  Thr  215  and Met , and is also involved in locking two 215  water molecules into the area contained by Leu 233  and M e t , which  is located beside a hydrophobic groove  205  Both water molecules bond A s p  214  120  , Trp  215  , Met  z  233  236  , A s p " and Gly J  .  and Met and are thereby connected to the active site. 80  stabilizes the tight turn towards Asn through its placement in the hydrophobic  pocket created by Pro , G i n , G l y 86  70  of Phe  165  204  and A l a . The consistent active site geometries 206  RO  and Met forms (both solved in combination with the non-primed side inhibitor  PLGNHOH) provide an indication for N-terminal involvement in enzyme efficiency. 70  The docked Phe  terminus may add extra stabilization to the catalytic energy network to 80  help boost enzyme activity or perhaps the "loose" N-terminal of the Met form impedes substrate binding. Biomolecular interaction analysis found that TIMP-2 is a better inhibitor of the Met form of MMP-8 than the Phe form (74). It was proposed 80  79  A  1  6  1  N218,e •k  E198  f  H201  D  ,H162  H207JU  A.  F-f H197  E198  H201>  V*v  *  ZN999 /*  *  V194  p**  1 1 5 9 Y 2 1 6  Y189|  V  | i 59%  'V194 P217  14  Y219  Fig. 1.6. Potential enzyme-substrate interactions calculated from x-ray diffraction crystallography data of MMP-8 in complex with various inhibitors. A. Complex of Pro-Leu-Gly-hydroxamine inhibitor with the catalytic domain of MMP-8 (Met form)(PDB accession code 1JAP). B. Complex of Pro-Leu-Glyhydroxamine inhibitor with the catalytic domain of MMP-8 (Phe form)(UAN). C. Methylamino-Phe-Leu-hydroxamate in complex with the catalytic domain of MMP-8 (1MNC). D. Batimastat inhibitor in complex with the catalytic domain of MMP-8 (1MMB). E. Complex of Pro-Leu-alpha-phosphono-Trp with the catalytic domain of MMP-8 (Met Form) (1173). F. Complex of l,2,3,4-tetrahydroisochinolin-3carboxylic acid with the catalytic domain of MMP-8 (Met Form) (1176). G. Complex of 2-hydroxy-5-[4-(2-hydroxy-ethyl)-piperidin-1 -yl]-5-phenyl-1Hpyrimidine-4,6-dione with the catalytic domain of MMP-8 (1JJ9). Modified from LIGPLOT schematic diagrams (75). 80  79  80  80  Fig. 1.7. Structural variation in the N-terminal of MMP-8. Ribbon diagrams of MMP-8 catalytic domain bound to P L G N H O H inhibitor. Arrows indicate the N termini of the structures. A. The Met variant (PDB accession code 1 JAP) is disordered to Pro . B. The N-terminal of the Phe variant (1JAN) is anchored to helix C at the bottom of the catalytic domain. 80  86  79  16  that the tethering of the N-terminal hinders access to the catalytic Zn by the inhibitory Cys residue of the TIMP.  The first structure of MMP-8 in complex with an inhibitor C-terminal to the substrate scissile bond was also solved in 1994 (Fig. 6C) (66). The hydroxamate-based inhibitor (methylamino-phenylalanyl-leucyl-hydroxamic acid) binds to the primed specificity subsites of the active site. Although this structure only resolved one of the two C a  2+  ions  integral to the catalytic domain, it was important to the visualization of the S i ' subsite, which is noticeably larger in MMP-8 than in MMP-1. The S i ' subsite is considered a key determinant of substrate specificity in the MMPs (69,76). The L e u more open space in the pocket compared to Arg  193  of M M P - 8 leaves  of M M P - 1 . Other differences between  MMP-8 and MMP-1 were noted. MMP-8 appears disordered between A r g  222  and Ser . 225  This segment contains two extra residues when compared with the sequence of MMP-1 (Fig. 1). It was also observed that the P2 phenyl group of the inhibitor displays a different orientation than when bound to MMP-1 (77).  The binding conformations of substrates provide insight for drug design. Zinc binding is an important feature for any potential M M P inhibitor. Hydroxamate groups bind Zn in a fashion that mimics the trigonal bipyramidal arrangement found in the native enzyme. One commercially developed inhibitor, batimastat (BB-94), was studied in complex with MMP-8 (Fig. 6D) (78). This inhibitor binds across the active site cleft with moieties occupying the Si - S 3 ' subsites. While previous studies have conjectured that P 3 ' residues are mainly solvent exposed, weak contacts with L e u , T y r 160  189  and T y r  219  are  proposed for the P 3 ' C-terminal of the inhibitor.  The first example of an MMP-8 inhibitor occupying the Si subsite was published in 2000. (Fig. 6E) (79). Previous studies with non-primed side inhibitor P L G N H O H lacked information about Pi sidechain-enzyme contacts since Gly occupied this key active site position. In comparison, Pro-Leu-alpha-phosphono-tryptophan (PLTP) contains a Trp at the P[ position. Interactions between the Pi residue and H i s  162  and H e  159  of the enzyme  were determined. The same article reported the findings of enzyme interactions with the  primed-side inhibitor l,2,3,4-tetrahydroisochinolin-3-carboxylic acid (TIC) (Fig. 6F). Binding to this inhibitor induced a significant conformational change in the active site stage. Binding of the biphenyl group of the inhibitor caused a downward shift in P r o that widened the Si subsite entrance. The A l a  161  to Phe  217  217  carbonyl oxygen distance was  increased to 0.88 nm in comparison to 0.80 nm for other complexes. A l a  161  is repeatedly  proposed to be involved in substrate binding interactions (Fig. 6).  New structural determinants for substrate recognition by MMP-8 were reported in 2001. The crystal structure of MMP-8 in complex with the barbiturate inhibitor 2-hydroxy-5-[4(2-hydroxy-ethyl)-piperidin-l-yl]-5-phenyl-lH-pyrimidine-4,6-dione (RO200-1770) detailed a new spatial arrangement of Zn and its binding ligands in comparison with other inhibitors (Fig. 6G) (72). While the centre barbiturate ring mimics BB-94 interactions with the enzyme, the P i ' phenyl and P2' piperidyl rings give new insight into the binding at the S i ' and S2' subsites. The phenyl ring appears to have an ideal stacking arrangement with the parallel H i s . Of critical importance to our research is the 197  188  recognition of a previously unreported cis peptide bond between Asn  189  and Tyr  on a  loop that has been implicated in collagenase activity. 1.2.2.4 The Asn -Tyr 188  189  cis Peptide Bond of MMPS  Peptide bonds link amino acids between a carboxylate carbon and the amine nitrogen of the next residue. Peptide bonds have a partial double bond character that restricts rotation and leads to one of two energetically preferred conformations: Trans, with the amide hydrogen on the opposite side of the bond from the carbonyl oxygen, or cis, with the hydrogen and oxygen on the same side of the bond. Cis peptide bonds are usually less energetically favourable than those in the trans conformation due to closer contacts between neighbouring alpha carbons and other side chain atoms. The exception is the peptide bond found before a Pro residue. The bend of the backbone chain caused by the cyclic sidechain of Pro makes the trans conformation of higher energy and only slightly more favourable than cis. Analysis of a representative sampling of protein structures from the Protein Data Bank found that approximately 5% of Xaa-Pro bonds (where Xaa  is any amino acid) exist in cis form compared with 0.03% of Xaa-non Pro bonds (80). It has been speculated that cis bonds may act as an energy reservoir and play a role in the function of an enzyme (81).  The cis bond between A s n  188  and T y r  189  is found on a solvent exposed loop at the start of  the helix forming the base of the active site (Fig. 4). The sidechains of the residues are both oriented towards the interior of the pocket in contrast to the alternating trans directions usually seen for two neighbouring sidechains on a peptide backbone. Of the three-dimensional structures solved for MMPs, the 188-189 cis bond is only found in MMP-1 and MMP-8 (72,82)! MMP-13, as well as MMP-2 and MMP-14, which show 189  weak collagenase activity, have not been reported to contain the cis bond (83-85). Tyr is strictly conserved through the M M P collagenases (MMP-1, -8,-13 and -18) and is also present in the collagen-degrading gelatinases (MMP-2 and -9). It is not found in the membrane-type MMPs. In MMP-8, there is a stabilizing H-bond between the carbonyl of Thr  181  and the amide of T y r  189  (72). Also of note is that of all human MMPs, only M M P -  1 (Glu ) and MMP-8 (Asn ) lack a Gly at position 188. Even M M P - 2 and MMP-9, 188  188  with large collagen binding domain (CBD) insertions directly before this critical residue, have a conserved G l y  188  (86). Gly is the only structural fit for a trans bond turning the  loop between s5 and helix B (72). The connection of a non-Gly residue 188 to a cis 188189 bond suggests this bond may make a significant contribution to the function of the enzyme. Since the 188 residue is variable between the two cis-bond containing MMPs, it is probable that the backbone conformation plays a role in the activity. 1.2.3 The Linker and Hemopexin C Domain  The structure of the MMP-8 linker and hemopexin C domains have not yet been determined by crystallography. It is presumed from sequence homology to other MMPs that the structure will be similar to those reported for MMP-1 (Fig. 3B) and M M P - 2 (85,87). The flexible linker acts as a hinge between the catalytic domain and hemopexin C domain. Linker length varies between MMPs, with collagenases having a relatively short 17-residue linker compared with the extended linkers of M M P - 9 and the M T -  MMPs (86). The pattern of Pro residues in the linker have led to the suggestion that the linker mimics the conformation of a collagen chain and may be involved in binding and destabilizing the triple helix of collagen substrate (88).  The hemopexin C domain is the C-terminal domain of all soluble vertebrate M M P s with the exception of the truncated MMP-7. The structure of the hemopexin C domain resembles a four-bladed propeller consisting of four segments of four antiparallel beta strands arranged around a central axis (89). The terminal cysteine residue forms a disulphide bridge with a cysteine near the top edge of the first blade (90). In the membrane-type (MT) - MMPs, which are tethered to the cell membrane, the hemopexin C domain is followed by a transmembrane domain and cytoplasmic segment. The hemopexin C domains of many MMPs bind collagen and are an important determinant of collagenase function (91-94). There must be at least partial unwinding of the collagen triple helix for exposure of the scissile bonds, and this conformational change is believed to be mediated by the hemopexin C domain.  1.3 MMPS  1.3.1  Function  Collagen  Of the physiological substrates of MMP-8, our interest focuses on type I collagen, a principal building block of bone and skin. Type I collagen is a fibril-forming collagen comprised of two ccl(I) chains and one cc2(I) chain. Procollagen precursor chains are synthesized and then undergo selective hydroxylation and glycosylation in the endoplasmic reticulum. The pro-chains self-assemble into triple helices with interchain hydrogen bonds aiding stabilization. The sequence of each polypeptide chain is a repetitive G l y - X - Y pattern, with approximately 20% of the X and Y residues being the imino acids proline and hydroxyproline (95). Chains align in a staggered conformation and the recurrent Gly residues, with minimal side chains, are essential to the tight packing of the triple helix. Once secreted, the procollagen N - and C-terminal propeptides are cleaved by proteinases and the resulting collagen monomers spontaneously assemble into  fibrils. Fibrils are strengthened by the formation of cross-links between lysine and hydroxylysine residues of neighbouring molecules (96,97).  1.3.2  Collagenolysis  MMP-8 cleaves native type I collagen at a single specific location in the triple helix. The hydrolysis of the a l and a2 chains occurs between G l y " - l i e " and G l y " - L e u " bonds, D  0  respectively, approximately A of the distance from the N-terminal of the helix (Fig. 8) 3  (98). Other proteases including the cysteine protease cathepsin K and serine proteases such as fiddler crab collagenase, insect collagenase and shrimp chymotrypsin are capable of cleaving triple helical collagen (99-102).  The binding and cleavage of collagen by MMP-8 has been visually captured by atomic force microscopy. This approach allows the investigation of individual molecules in comparison to the results of bulk assays measured by gel electrophoresis or fluorimetry. Over 50% of the enzyme-substrate complexes showed interaction at the A- A collagenase 3  l  cleavage site, although the orientation was unknown (103). Pre-digestion of the substrate before microscopy produced A and A fragments, and on-surface digestion recorded gaps 3  l  appearing at the expected specific cleavage site. Further developments in molecular visualization may prove enlightening to the investigation of the MMP-collagen interaction.  A model for the optimal collagen cleavage site by human collagenases has been developed (98). Features of the ideal cleavage site include: A tight triple helical region, with at least 33% imino acid content, preceding the scissile bond; a looser, low imino acid content region following the scissile bond; a low charge density; a hydrophobic sequence with a maximum of two charged residues in the four repeats before and after the cleavage site; and a non imino residue in the P2 position. Features of the collagen triple helix, as well as multiple interactions with the collagenase, likely contribute to successful cleavage of the triple helix.  21  H  o  H  j  Collagenase  Fig. 1.8. Model of the collagenase cleavage site in type I collagen. The collagenase catalyses hydrolysis of the two ccl(I) chains and one oc2(I) chain of the triple helix at a specific location preceded by a tight triple-helical collagen region and followed by a region of loose helix. Cleavage of a 1(1) occurs between G l y and H e and cleavage of oc2(I) occurs between G l y and L e u . Redrawn from (104). 775  775  776  776  22  The diameter of the triple helical collagen molecule is approximately 1.5 nm and the opening of the MMP-8 active site cleft is a much narrower 0.5 nm. There must be some change in the triple helical nature of collagen to allow cleavage of individual a-chains at the active site. The precise mechanism of collagen catalysis is unknown. The factors contributing to the ability of MMPs to hydrolyse collagen have been comprehensively reviewed both from the perspective of the enzyme (105) and that of the substrate (104). Three key stages of the process have been identified: Collagen binding, unwinding of the triple helix (triple helicase activity), and hydrolysis of the individual strands of the triple helix.  Exosites are regions of an enzyme, outside of the primary specificity subsites, which provide additional binding contacts with a substrate (105). The hemopexin C domain of MMP-8 is known to bind collagen (93) and is likely to have a role in the triple helicase activity of the enzyme, helping to unwind the triple helix to allow cleavage of the occhains.  The triple helicase activity of MMP-8 could involve any of a series of possible forces (105). Clamping of collagen by the hemopexin C domain to the catalytic domain may cause a lateral compression that splays the a-chains apart (Fig. 9A). The linker may intercalate between strands of the triple helix, forcing them apart (Fig. 9B). The simultaneous binding of collagen to the catalytic domain as well as to exosites on the hemopexin C domain might force a bending of the helix that separates the strands (Fig. 9C). The lateral tension caused by movement to satisfy multiple binding interactions could pull strands apart (Fig. 9D), or axial rotation by the hemopexin C domain could cause local unwinding of the triple helix (Fig. 9E). Another possibility is that axial compression of the collagen results in a bulge of loosened helix (Fig. 9F). Each of these options involves multiple points of interaction between the collagenase and the collagen triple helix. The exact locations of contact have yet to be elucidated.  23  Fig. 1.9. Potential molecular interactions supporting triple helicase activity. Reprinted from (105). A. Lateral compression or clamping; B. a-chain intercalation; C. bending; D. lateral tension; E. axial rotation; F. axial compression bulge.  1.3.3 Mapping  MMPS  Function  to Structural  Elements  Various studies with recombinant domains, chimeric proteins, and site-directed mutants have attempted to map the regions and residues of importance to the activity of collagenases. Researchers have examined the effect of changes in the extended binding site of the catalytic domain, as well as potential exosites of the linker and hemopexin C domain which may contribute to substrate binding and triple helicase activity.  1.3.3.1 Studies  with Mutant  Enzymes  It has been demonstrated that the catalytic domain of collagenase alone, while able to degrade casein, gelatin and peptide substrates with similar activity to full-length enzyme, is unable to cleave native collagen (93,106). Construction of a hybrid enzyme consisting of the MMP-1 catalytic domain linked to the hemopexin domain of the noncollagenolytic MMP-3 (stromelysin-1) did not rescue the collagenase activity of the catalytic domain; neither did the addition of the hemopexin domain of MMP-1 to the catalytic domain of MMP-3 confer collagenolytic activity upon that enzyme (92). Chimeric proteins linking the catalytic domain of MMP-1 with the linker and hemopexin C domain of MMP-10 (stromelysin-2) also did not display collagenolytic activity (107). The catalytic domains of collagenases M M P - 1 , MMP-8 and MMP-13 are all unable to mediate cleavage of triple helical collagen alone (93,94,108,109). This has been challenged by recent studies with triple helical peptide models that have demonstrated binding and cleavage by truncated collagenases lacking the hemopexin C domain, and cleavage of type I collagen has also been recorded at 37 °C (110,111). Synthetic heterotrimeric collagen peptides have been developed as triple helical models for collagen catabolism (110,112). Studies have suggested a fundamental difference in the cleavage of triple helical peptide strands by gelatinases and collagenases. While gelatinases release intermediate single-stranded cleavage products, collagenases trap the heterotrimer until all three strands have been cleaved, releasing only the final product of cleavage (113). Both MMP-8 and a truncated form of the enzyme consisting of only the catalytic domain have been shown to cleave triple helical peptides at the expected single  cleavage site (114). Likewise, full-length and catalytic domain MMP-1 cleave synthetic triple helical collagens (110). Since neither catalytic domain alone is able to hydrolyse native type I collagen, it has been proposed that the hemopexin domain is required for native collagen catalysis but not for recognition and cleavage of a triple helix.  The hemopexin C domain has long been recognized as pivotal to the mechanism of collagenase. Clark and Cawston first reported that the autolytic collagenase fragments of the hemopexin C domain alone bind collagen (108). Collagen binding of the hemopexin C domain of both collagenase (92-94) and non-collagenase M M P s such as stromelysin-1 (91) and, more recently, MMP-14 (115) has been demonstrated.  The linker connecting the hemopexin C domain with the catalytic domain has also been implicated in collagenase activity. Replacement of critical Pro residues in the MMP-8 linker with Ala resulted in a mutant with only 1.5% the collagenolytic activity of the wildtype enzyme (116). Another chimeric enzyme substituting a 16 amino acid sequence of MMP-3 into the linker region of MMP-8 eliminated collagenase activity (117). Residue G l y  272  of the MMP-1 linker has also been shown to be critical for collagenolytic  activity (118). It is postulated that the linker, with structural similarities to collagen, intercalates with the collagen triple helix in a displacement arrangement to generate a free strand able to dock in the active site (88,107,116-119). Tarn et al reported that recombinant MMP-14 (MT1-MMP) hemopexin C domain required the contiguous presence of the linker to block collagenase activity of MMP-14 in competition, whereas the C domain alone, although capable of binding native collagen, was ineffective (115).  Site-directed mutants A s p G l u and A s p G l y of the final helix C of the catalytic 232  232  domain retained 55-57% of wildtype MMP-8 activity, whereas A s p G l u showed 35% 233  activity, and A s p G l y activity was abolished (117). The authors speculated that A s p 233  233  was involved in coordinating a critical metal ion although it was later determined by crystallographic data that Asp with L e u  214  and M e t  215  does not bind a metal but rather forms hydrogen bonds  of the Met-turn (65).  26  A loss of function mutant was constructed by replacing the equivalent of residues 192240(MMP-8) in MMP-1 with the same region from MMP-3 (120). This large segment of the enzyme contains residues involved in forming the  S1-S3  and  Si'-S3'  binding sites and  the collagenase activity of the mutant was reduced to 2.2% of that of wildtype M M P - 1 . The reverse approach was applied to create a series of chimeras replacing M M P - 3 with increasing MMP-1 sequence C-terminally through the catalytic domain (121). A nine amino acid sequence preceding the HExxH Zn binding motif was identified as critical to collagenolytic activity. Substitution of this sequence in MMP-1 with the corresponding residues from MMP-3 led to 11.6% of the collagenolytic activity of wildtype MMP-1 and mutation of the single residue MMP-l(Tyr Thr) demonstrated 23.4% activity compared 191  to wildtype. This tyrosine corresponds to the S3' T y r  189  of MMP-8. T y r  189  is strictly  conserved through the M M P collagenases (MMP-1, -8, -13 and -18) and is also present in the collagen-degrading gelatinases (MMP-2 and -9). It is not found in the membranetype MMPs (86,122). Aside from the possible structural or functional necessity of this conserved residue, it has been determined by analysis of structural data determined by xray diffraction crystallography that T y r  189  is involved in a cis peptide bond with  188  neighbouring Asn 7.3.3.2 Studies  (72). with Mutant  Substrates  Insight into the functional determinants of MMP-8 activity has also been gained from investigations using mutant substrates. Differences in substrate sequence specificities of MMP-8 and MMP-1 have been determined using a variety of synthetic peptides (73). Substitutions and truncations of a model ccl(I) chain octapeptide revealed that P i , P i ' and P2' residues have the greatest contribution to enzyme activity and specificity, while truncations removing the P 3 or P2 residues of the substrate lead to less than 5% activity. Substrates lacking a P 4 ' residue retained only 54% activity and elimination of a P 3 ' residue dropped activity to less than 5%. These results show the significance of the extended binding subsites and point to an important contribution of the S 3 ' subsite to catalytic activity. Substitutions of P 3 ' Gly with a larger Arg or Met residue decreased activity by 67% whereas substitution with Ala or Ser produced a 20-30% increase in  enzyme activity in MMP-8 and up to a 100% increase in M M P - 1 . One key difference seen in P i ' preference between the two collagenases is that while MMP-8 activity is enhanced nearly four fold by the presence of aromatic residues, MMP-1 is intolerant for aromatic residues at P i ' .  Studies with mutant type I collagens have also shown the importance of interactions in the extended substrate binding site to MMP-1 and MMP-8 activity. Substitution in al(I) of Pro for H e Gin  774  776  and A l a  eliminated collagenase susceptibility and double mutations of Pro for  7 7 7  also conferred collagenase resistance to the mutant collagen (123,124).  1.4 Project Rationale  and  Hypothesis  As evident from the structural studies of MMPs, their highly conserved domain structure and active site Zn binding configuration lead to very similar modes of active site disruption by inhibitory molecules. With overlapping expression, regulators and substrates, target specificity and selectivity are critical to the success of any therapeutic aimed at blocking the function of a particular M M P . Battling erratic M M P behaviour poses many challenges to drug design. The more that is known about the conformation of specific residues and their interactions with adjacent atoms, especially those extending beyond the core Si-Si' of the active site, the more rational can be the approach to inhibitor design. Using site-directed mutagenesis to systematically alter residues in S 3 ' we aim to investigate this region which has been implicated both structurally and functionally as a modulator of MMP-8 activity.  Although the sequence and domain structure of the M M P s are remarkably conserved, their widespread range of substrate preferences indicates that small variations in sequence and topography must be major contributors to enzyme specificity. The construction of chimera can alter interior as well as inter-domain interactions, meaning loss of function mutants created by domain swapping or other chimeric constructions do not necessarily reflect a specific loss of function attributable to the altered residues (105). More focused mutagenesis at single points are less likely to cause disruption to overall structure. Site-  directed mutagenesis can provide a detailed analysis of single residue contributions to enzyme activity. One caveat, however, is that the function of single residues can be masked by redundancy and the strength of other contributions (105).  We have chosen to systematically alter a range of residues in the S 3 ' subsite of MMP-8 by site-directed mutagenesis. The aims of this project are to decipher which S 3 ' residues are involved in the catalytic function of the enzyme and to resolve any specific molecular determinants for collagen catalysis. The A s n  188  residue was chosen for mutagenesis  based on a mutation of the analogous residue in rat MMP-8, which disrupted collagenase activity of the enzyme (125). From analysis of three-dimensional structural models of MMP-8 we hypothesized that neighbouring T y r substrates. The conserved nature of T y r  189  189  and A s n  190  might also interact with  noted from comparison of collagenase protein  sequences also indicated this residue might have a specific contribution of a structural or functional nature. Further support of our hypothesis that S 3 ' residues are involved in collagenolysis was presented while this study was underway with the recognition of the 188  189  unusual cis bond between Asn -Tyr"" (72). 100  The following manuscript (Chapter 2), prepared for submission to the Journal of Biological Chemistry, details the methods and results of my experimental work and presents a discussion of the significance of the findings.  29  1.5  References  1.  Birkedal-Hansen, H . Proteolytic Remodeling of Extracellular Matrix. Curr Opin Cell Biol 7, 728-35 (1995).  2.  Vu, T. H . and Werb, Z. Matrix Metalloproteinases: Effectors of Development and Normal Physiology. Genes Dev 14, 2123-33 (2000).  3.  Egeblad, M . and Werb, Z. New Functions for the Matrix Metalloproteinases in Cancer Progression. Nat Rev Cancer 2, 161-74 (2002).  4.  Nagase, H. and Woessner, J. F. Matrix Metalloproteinases. J Biol Chem 274, 21491-21494 (1999).  5.  Bode, W. and Maskos, K . Structural Basis of the Matrix Metalloproteinases and Their Physiological Inhibitors, the Tissue Inhibitors of Metalloproteinases. Biol Chem 384, 863-72 (2003).  6.  Gross, J. and Lapiere, C. M . Collagenolytic Activity in Amphibian Tissues; A Tissue Culture Assay. Proc Natl Acad Sci US A 48, 1014-22 (1962).  7.  Hasty, K . A., Pourmotabbed, T. F., Goldberg, G. I., Thompson, J. P., Spinella, D. G., Stevens, R. M . and Mainardi, C. L . Human Neutrophil Collagenase. A Distinct Gene Product with Homology to Other Matrix Metalloproteinases. J Biol Chem 265, 11421-4(1990).  8.  Freije, J. M . , Diez-Itza, I., Balbin, M . , Sanchez, L . M . , Blasco, R., Tolivia, J. and Lopez-Otin, C. Molecular Cloning and Expression of Collagenase-3, a Novel Human Matrix Metalloproteinase Produced by Breast Carcinomas. J Biol Chem 269, 16766-73 (1994).  9.  Stolow, M . A., Bauzon, D. D., L i , J., Sedgwick, T., Liang, V . C , Sang, Q. A . and Shi, Y . B . Identification and Characterization of a Novel Collagenase in Xenopus Laevis: Possible Roles During Frog Development. Mol Biol Cell 7, 1471-83 (1996).  10.  d'Ortho, M . P., Will, H., Atkinson, S., Butler, G., Messent, A., Gavrilovic, J., Smith, B., Timpl, R., Zardi, L. and Murphy, G. Membrane-Type Matrix Metalloproteinases 1 and 2 Exhibit Broad-Spectrum Proteolytic Capacities  30  Comparable to Many Matrix Metalloproteinases. Eur J Biochem 250, 751-7 (1997). 11.  Overall, C. M . Matrix Metalloproteinase Substrate Binding Domains, Modules and Exosites. Overview and Experimental Strategies. Methods Mol Biol 151, 79120 (2001).  12.  Nathan, C. Points of Control in Inflammation. Nature 420, 846-52 (2002).  13.  Mohammed, F. F., Smookler, D. S. and Khokha, R. Metalloproteinases, Inflammation, and Rheumatoid Arthritis. Ann Rheum Dis 62 Suppl 2, ii43-7 (2003).  14.  Edwards, S. W. and Hallett, M . B. Seeing the Wood for the Trees: The Forgotten Role of Neutrophils in Rheumatoid Arthritis. Immunol Today 18, 320-4 (1997).  15.  Sorsa, T., Konttinen, Y. T., Lindy, O., Ritchlin, C , Saari, H., Suomalainen, K., Eklund, K . K . and Santavirta, S. Collagenase in Synovitis of Rheumatoid Arthritis. Semin Arthritis Rheum 22, 44-53 (1992).  16.  Hasty, K . A., Jeffrey, J. J., Hibbs, M . S. and Welgus, H . G . The Collagen Substrate Specificity of Human Neutrophil Collagenase. J Biol Chem 262, 1004852 (1987).  17.  Mallya, S. K., Mookhtiar, K . A., Gao, Y., Brew, K., Dioszegi, M . , BirkedalHansen, H . and Van Wart, H. E. Characterization of 58-Kilodalton Human Neutrophil Collagenase: Comparison with Human Fibroblast Collagenase. Biochemistry 29, 10628-34 (1990).  18.  Van Wart, H. E. Human Neutrophil Collagenase. Matrix Suppl 1, 31-6 (1992).  19.  Knauper, V., Lopez-Otin, C , Smith, B., Knight, G. and Murphy, G. Biochemical Characterization of Human Collagenase-3. J Biol Chem 271, 1544-50 (1996).  20.  Billinghurst, R. C , Dahlberg, L., Ionescu, M . , Reiner, A., Bourne, R., Rorabeck, C , Mitchell, P., Hambor, J., Diekmann, O., Tschesche, H., Chen, J., Van Wart, H . and Poole, A. R. Enhanced Cleavage of Type Ii Collagen by Collagenases in Osteoarthritic Articular Cartilage. J Clin Invest 99, 1534-45 (1997).  21.  Lazarus, G. S., Brown, R. S., Daniels, J. R. and Fullmer, H . M . Science 159, 1483-1485 (1968).  22.  Murphy, G., Reynolds, J. J., Bretz, U . and Baggiolini, M . Collagenase Is a Component of the Specific Granules of Human Neutrophil Leucocytes. Biochem J 162, 195-7 (1977).  23.  Uitto, V . J., Turto, H., Huttunen, A., Lindy, S. and Uitto, J. Biochim Biophys Acta 613, 168-177 (1980).  24.  Macartney, H. W. and Tschesche, H. Eur J Biochem 130, 71-78 (1983).  25.  Hasty, K . A., Hibbs, M . S., Kang, A. H . and Mainardi, C. L . Heterogeneity among Human Collagenases Demonstrated by Monoclonal Antibody That Selectively Recognizes and Inhibits Human Neutrophil Collagenase. J Exp Med 159, 1455-63 (1984).  26.  Mookhtiar, K . A., Wang, F. and Van Wart, H. E . Functional Constituents of the Active Site of Human Neutrophil Collagenase. Arch Biochem Biophys 246, 645-9 (1986).  27.  Mallya, S. K . and Van Wart, H . E. Inhibition of Human Neutrophil Collagenase by Gold(I) Salts Used in Chrysotherapy. Biochem Biophys Res Commun 144, 101-8 (1987).  28.  Mallya, S. K . and Van Wart, H. E. Mechanism of Inhibition of Human Neutrophil Collagenase by Gold(I) Chrysotherapeutic Compounds. Interaction at a Heavy Metal Binding Site. J Biol Chem 264, 1594-601 (1989).  29.  Devarajan, P., Mookhtiar, K., Van Wart, H. and Berliner, N . Structure and Expression of the Cdna Encoding Human Neutrophil Collagenase. Blood 77, 2731-8 (1991).  30.  Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. Gapped Blast and Psi-Blast: A New Generation of Protein Database Search Programs. Nucleic Acids Res 17, 3389-402 (1997).  31.  Boeckmann, B., Bairoch, A., Apweiler, R., Blatter, M . - C , Estreicher, A . , Gasteiger, E., Martin, M . J., Michoud, K., O'Donovan, C , Phan, I., Pilbout, S. and Schneider, M . The Swiss-Prot Protein Knowledgebase and Its Supplement Trembl in 2003. Nucleic Acids Res 31, 365-370 (2003).  32.  Apajalahti, S., Sorsa, T., Railavo, S. and Ingman, T. The in Vivo Levels of Matrix Metalloproteinase-1 and -8 in Gingival Crevicular Fluid During Initial Orthodontic Tooth Movement. J Dent Res 82, 1018-22 (2003).  33.  Takahashi, I., Nishimura, M . , Onodera, K., Bae, J. W., Mitani, H., Okazaki, M . and Sasano, Y . Expression of Mmp-8 and Mmp-13 Genes in the Periodontal Ligament During Tooth Movement in Rats. J Dent Res 82, 646-51 (2003).  34.  Sorsa, T., Saari, H., Konttinen, Y . T., Suomalainen, K., Lindy, S. and Uitto, V . J. Non-Proteolytic Activation of Latent Human Neutrophil Collagenase and Its Role in Matrix Destruction in Periodontal Diseases. Int J Tissue React 11, 153-9 (1989).  35.  Mantyla, P., Stenman, M . , Kinane, D. F., Tikanoja, S., Luoto, H., Salo, T. and Sorsa, T. Gingival Crevicular Fluid Collagenase-2 (Mmp-8) Test Stick for ChairSide Monitoring of Periodontitis. J Periodontal Res 38, 436-9 (2003).  36.  Winkler, M . K., Foldes, J. K., Bunn, R. C. and Fowlkes, J. L . Implications for Matrix Metalloproteinases as Modulators of Pediatric Lung Disease. Am J Physiol Lung Cell Mol Physiol 284, L557-65 (2003).  37.  Stenman, M . , Paju, A., Hanemaaijer, R., Tervahartiala, T., Leminen, A., Stenman, U . H , Konttinen, Y . T. and Sorsa, T. Collagenases (Mmp-1, -8 and -13) and Trypsinogen-2 in Fluid from Benign and Malignant Ovarian Cysts. Tumour Biol 24,9-12(2003).  38.  Stadlmann, S., Pollheimer, J., Moser, P. L., Raggi, A., Amberger, A., Margreiter, R., Offner, F. A., Mikuz, G., Dirnhofer, S. and Moch, H . Cytokine-Regulated Expression of Collagenase-2 (Mmp-8) Is Involved in the Progression of Ovarian Cancer. Eur J Cancer 39, 2499-505 (2003).  39.  Agarwal, D., Goodison, S., Nicholson, B., Tarin, D. and Urquidi, V . Expression of Matrix Metalloproteinase 8 (Mmp-8) and Tyrosinase-Related Protein-1 (Tyrp1) Correlates with the Absence of Metastasis in an Isogenic Human Breast Cancer Model. Differentiation 71, 114-25 (2003).  40.  Montel, V., Kleeman, J., Agarwal, D., Spinella, D., Kawai, K . and Tarin, D. Altered Metastatic Behavior of Human Breast Cancer Cells after Experimental  Manipulation of Matrix Metalloproteinase 8 Gene Expression. Cancer Res 64, 1687-94 (2004). 41.  Cole, A . A., Chubinskaya, S., Schumacher, B., Huch, K., Szabo, G., Yao, J., Mikecz, K., Hasty, K . A . and Kuettner, K . E. Chondrocyte Matrix Metalloproteinase-8. Human Articular Chondrocytes Express Neutrophil Collagenase. J Biol Chem 271, 11023-6 (1996).  42.  Shlopov, B . V., Lie, W. R., Mainardi, C. L., Cole, A . A., Chubinskaya, S. and Hasty, K . A . Osteoarthritic Lesions: Involvement of Three Different Collagenases. Arthritis Rheum 40, 2065-74 (1997).  43.  Stremme, S., Duerr, S., Bau, B., Schmid, E. and Aigner, T. Mmp-8 Is Only a Minor Gene Product of Human Adult Articular Chondrocytes of the Knee. Clin Exp Rheumatol 21, 205-9 (2003).  44.  Hanemaaijer, R., Sorsa, T., Konttinen, Y . T., Ding, Y . , Sutinen, M . , Visser, H., van Hinsbergh, V . W., Helaakoski, T., Kainulainen, T., Ronka, H., Tschesche, H . and Salo, T. Matrix Metalloproteinase-8 Is Expressed in Rheumatoid Synovial Fibroblasts and Endothelial Cells. Regulation by Tumor Necrosis Factor-Alpha and Doxycycline. J Biol Chem 272, 31504-9 (1997).  45.  Osmers, R. G., Adelmann-Grill, B. C , Rath, W., Stuhlsatz, H . W., Tschesche, H . and Kuhn, W. Biochemical Events in Cervical Ripening Dilatation During Pregnancy and Parturition. J Obstet Gynaecol 21, 185-94 (1995).  46.  Sennstrom, M . B., Brauner, A., Bystrom, B., Malmstrom, A . and Ekman, G. Matrix Metalloproteinase-8 Correlates with the Cervical Ripening Process in Humans. Acta Obstet Gynecol Scand 82, 904-11 (2003).  47.  Holopainen, J. M . , Moilanen, J. A., Sorsa, T., Kivela-Rajamaki, M . , Tervahartiala, T., Vesaluoma, M . H . and Tervo, T. M . Activation of Matrix Metalloproteinase-8 by Membrane Type 1-Mmp and Their Expression in Human Tears after Photorefractive Keratectomy. Invest Ophthalmol Vis Sci 44, 2550-6 (2003).  48.  Balbin, M . , Fueyo, A., Tester, A. M . , Pendas, A. M . , Pitiot, A. S., Astudillo, A . , Overall, C. M . , Shapiro, S. D. and Lopez-Otin, C. Loss of Collagenase-2 Confers Increased Skin Tumor Susceptibility to Male Mice. Nat Genet 35, 252-7 (2003).  49.  Coussens, L. M . and Werb, Z. Inflammation and Cancer. Nature 420, 860-7 (2002) .  50.  McQuibban, G. A., Gong, J. H., Wong, J. P., Wallace, J. L., Clark-Lewis, I. and Overall, C. M . Matrix Metalloproteinase Processing of Monocyte Chemoattractant Proteins Generates Cc Chemokine Receptor Antagonists with Anti-Inflammatory Properties in Vivo. Blood 100, 1160-7 (2002).  51.  Van Den Steen, P. E., Wuyts, A., Husson, S. J., Proost, P., Van Damme, J. and Opdenakker, G. Gelatinase B/Mmp-9 and Neutrophil Collagenase/Mmp-8 Process the Chemokines Human Gcp-2/Cxcl6, Ena-78/Cxcl5 and Mouse Gcp2/Lix and Modulate Their Physiological Activities. Eur J Biochem 270, 3739-49 (2003) .  52.  Bainton, D. F., Ullyot, J. L . and Farquhar, M . G. The Development of Neutrophilic Polymorphonuclear Leukocytes in Human Bone Marrow. J Exp Med 134, 907-34 (1971).  53.  Maskos, K . and Bode, W. Structural Basis of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases. Mol Biotechnol 25, 241-66 (2003).  54.  Ho, T. F., Qoronfleh, M . W., Wahl, R. C , Pulvino, T. A., Vavra, K . J., Falvo, J., Banks, T. M . , Brake, P. G. and Ciccarelli, R. B. Gene Expression, Purification and Characterization of Recombinant Human Neutrophil Collagenase. Gene 146, 297-301 (1994).  55.  Berman, H . M . , Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N . , Weissig, H., Shindyalov, I. N . and Bourne, P. E. The Protein Data Bank. Nucleic Acids Res 28, 235-42 (2000).  56.  Springman, E. B., Angleton, E. L., Birkedal-Hansen, H. and Van Wart, H. E. Multiple Modes of Activation of Latent Human Fibroblast Collagenase: Evidence for the Role of a Cys73 Active-Site Zinc Complex in Latency and a "Cysteine Switch" Mechanism for Activation. Proc Natl Acad Sci U S A 87, 364-8 (1990).  57.  Van Wart, H . E. and Birkedal-Hansen, H . The Cysteine Switch: A Principle of Regulation of Metalloproteinase Activity with Potential Applicability to the Entire Matrix Metalloproteinase Gene Family. Proc Natl Acad Sci U S A 87, 5578-82 (1990).  58.  Knauper, V., Wilhelm, S. M . , Seperack, P. K., DeClerck, Y . A., Langley, K . E., Osthues, A . and Tschesche, H . Direct Activation of Human Neutrophil Procollagenase by Recombinant Stromelysin. Biochem J 295 ( Pt 2), 581-6 (1993).  59.  Knauper, V., Murphy, G. and Tschesche, H . Activation of Human Neutrophil Procollagenase by Stromelysin 2. Eur J Biochem 235, 187-91 (1996).  60.  Knauper, V., Kramer, S., Reinke, H . and Tschesche, H . Characterization and Activation of Procollagenase from Human Polymorphonuclear Leucocytes. N Terminal Sequence Determination of the Proenzyme and Various Proteolytically Activated Forms. Eur J Biochem 189, 295-300 (1990).  61.  Price, B., Dennison, C , Tschesche, H . and Elliott, E. Neutrophil Tissue Inhibitor of Matrix Metalloproteinases-1 Occurs in Novel Vesicles That Do Not Fuse with the Phagosome. J Biol Chem 275, 28308-15 (2000).  62.  Blaser, J., Knauper, V., Osthues, A., Reinke, H . and Tschesche, H . Mercurial Activation of Human Polymorphonuclear Leucocyte Procollagenase. Eur J Biochem 202, 1223-30 (1991).  63.  Kleine, T., Bartsch, S., Blaser, J., Schnierer, S., Triebel, S., Valentin, M . , Gote, T. and Tschesche, H . Preparation of Active Recombinant Timp-1 from Escherichia Coli Inclusion Bodies and Complex Formation with the Recombinant Catalytic Domain of Pmnl-Collagenase. Biochemistry 32, 14125-31 (1993).  64.  Bode, W., Reinemer, P., Huber, R., Kleine, T., Schnierer, S. and Tschesche, H . The X-Ray Crystal Structure of the Catalytic Domain of Human Neutrophil Collagenase Inhibited by a Substrate Analogue Reveals the Essentials for Catalysis and Specificity. Embo J13, 1263-9 (1994).  65.  Reinemer, P., Grams, F., Huber, R., Kleine, T., Schnierer, S., Piper, M . , Tschesche, H. and Bode, W. Structural Implications for the Role of the N Terminus in the 'Superactivation' of Collagenases. A Crystallographic Study. FEBS Lett 338, 227-33 (1994).  66.  Stams, T., Spurlino, J. C , Smith, D. L., Wahl, R. C , Ho, T. F., Qoronfleh, M . W., Banks, T. M . and Rubin, B. Structure of Human Neutrophil Collagenase Reveals Large SI' Specificity Pocket. Nat Struct Biol 1, 119-23 (1994).  67.  Hutchinson, E. G. and Thornton, J. M . Promotif—a Program to Identify and Analyze Structural Motifs in Proteins. Protein Sci 5, 212-20 (1996).  68.  Butler, G. S., Tarn, E. M . and Overall, C. M . The Canonical Methionine 392 of Matrix Metalloproteinase 2 (Gelatinase a) Is Not Required for Catalytic Efficiency or Structural Integrity: Probing the Role of the Methionine-Turn in the Metzincin Metalloproteinase Superfamily. J Biol Chem 279, 15615-15620 (2004).  69.  Gomis-Ruth, F. X . Structural Aspects of the Metzincin Clan of Metalloendopeptidases. Mol Biotechnol 24, 157-202 (2003).  70.  Crabbe, T., Zucker, S., Cockett, M . I., Willenbrock, F., Tickle, S., O'Connell, J. P., Scothern, J. M . , Murphy, G. and Docherty, A . J. Mutation of the Active Site Glutamic Acid of Human Gelatinase A: Effects on Latency, Catalysis, and the Binding of Tissue Inhibitor of Metalloproteinases-1. Biochemistry 33, 6684-90 (1994).  71.  Windsor, L . J., Bodden, M . K., Birkedal-Hansen, B., Engler, J. A . and BirkedalHansen, H . Mutational Analysis of Residues in and around the Active Site of Human Fibroblast-Type Collagenase. J Biol Chem 269, 26201-7 (1994).  72.  Brandstetter, H , Grams, F., Glitz, D., Lang, A., Huber, R., Bode, W., Krell, H . W. and Engh, R. A . The 1.8-a Crystal Structure of a Matrix Metalloproteinase 8Barbiturate Inhibitor Complex Reveals a Previously Unobserved Mechanism for Collagenase Substrate Recognition. J Biol Chem 276, 17405-12 (2001).  73.  Netzel-Arnett, S., Fields, G. B., Birkedal-Hansen, H , Van Wart, H . E. and Fields, G. Sequence Specificities of Human Fibroblast and Neutrophil Collagenases. J Biol Chem 266, 6747-55 (1991).  74.  Farr, M . , Pieper, M . , Calvete, J. and Tschesche, H . The N-Terminus of Collagenase Mmp-8 Determines Superactivity and Inhibition: A Relation of Structure and Function Analyzed by Biomolecular Interaction Analysis. Biochemistry 38, 7332-8 (1999).  75.  Wallace, A . C , Laskowski, R. A . and Thornton, J. M . Ligplot: A Program to Generate Schematic Diagrams of Protein-Ligand Interactions. Protein Eng 8, 12734 (1995).  37  76.  Welch, A . R., Holman, C. M . , Huber, M . , Brenner, M . C , Browner, M . F. and Van Wart, H. E. Understanding the PI' Specificity of the Matrix Metalloproteinases: Effect of SI' Pocket Mutations in Matrilysin and Stromelysin1. Biochemistry 35, 10103-9 (1996).  77.  Spurlino, J. C , Smallwood, A. M . , Carlton, D. D., Banks, T. M . , Vavra, K . J., Johnson, J. S., Cook, E. R., Falvo, J., Wahl, R. C , Pulvino, T. A . and et al. 1.56 a Structure of Mature Truncated Human Fibroblast Collagenase. Proteins 19, 98109 (1994).  78.  Grams, F., Crimmin, M . , Hinnes, L., Huxley, P., Pieper, M . , Tschesche, H. and Bode, W. Structure Determination and Analysis of Human Neutrophil Collagenase Complexed with a Hydroxamate Inhibitor. Biochemistry 34, 1401220 (1995).  79.  Gavuzzo, E., Pochetti, G., Mazza, F., Gallina, C , Gorini, B., D'Alessio, S., Pieper, M . , Tschesche, H . and Tucker, P. A . Two Crystal Structures of Human Neutrophil Collagenase, One Complexed with a Primed- and the Other with an Unprimed-Side Inhibitor: Implications for Drug Design. J Med Chem 43, 3377-85 (2000).  80.  Jabs, A., Weiss, M . S. and Hilgenfeld, R. Non-Proline Cis Peptide Bonds in Proteins. J Mol Biol 286, 291-304 (1999). .  81.  Weiss, M . S., Jabs, A . and Hilgenfeld, R. Peptide Bonds Revisited. Nat Struct Biol 5, 676 (1998).  82.  Woessner, J. F. and Nagase, H. Matrix Metalloproteinases and Timps (Oxford University Press, New York, 2000).  83.  Fernandez-Catalan, C , Bode, W., Huber, R., Turk, D., Calvete, J. J., Lichte, A . , Tschesche, H. and Maskos, K . Crystal Structure of the Complex Formed by the Membrane Type 1-Matrix Metalloproteinase with the Tissue Inhibitor of Metalloproteinases-2, the Soluble Progelatinase a Receptor. Embo J17, 5238-48 (1998).  84.  Lovejoy, B., Welch, A . R., Carr, S., Luong, C , Broka, C , Hendricks, R. T., Campbell, J. A., Walker, K. A., Martin, R., Van Wart, H . and Browner, M . F.  38  Crystal Structures of Mmp-1 and -13 Reveal the Structural Basis for Selectivity of Collagenase Inhibitors. Nat Struct Biol 6, 217-21 (1999). 85.  Morgunova, E., Tuuttila, A., Bergmann, U., Isupov, M . , Lindqvist, Y., Schneider, G. and Tryggvason, K . Structure of Human Pro-Matrix Metalloproteinase-2: Activation Mechanism Revealed. Science 284, 1667-70 (1999).  86.  Massova, I., Kotra, L . P., Fridman, R. and Mobashery, S. Matrix Metalloproteinases: Structures, Evolution, and Diversification. Faseb J 12, 107595 (1998).  87.  L i , J., Brick, P., O'Hare, M . C , Skarzynski, T., Lloyd, L . F., Curry, V . A., Clark, I. M . , Bigg, H . F., Hazleman, B. L., Cawston, T. E. and et al. Structure of FullLength Porcine Synovial Collagenase Reveals a C-Terminal Domain Containing a Calcium-Linked, Four-Bladed Beta-Propeller. Structure 3, 541-9 (1995).  88.  De Souza, S. J., Pereira, H . M . , Jacchieri, S. and Brentani, R. R. Collagen/Collagenase Interaction: Does the Enzyme Mimic the Conformation of Its Own Substrate? Faseb J 10, 927-30 (1996).  89.  Bode, W. A Helping Hand for Collagenases: The Haemopexin-Like Domain. Structure 3, 527-30 (1995).  90.  Murphy, G. and Knauper, V . Relating Matrix Metalloproteinase Structure to Function: Why the "Hemopexin" Domain? Matrix Biol 15, 511-8 (1997).  91.  Allan, J. A., Hembry, R. M . , Angal, S., Reynolds, J. J. and Murphy, G. Binding of Latent and High M r Active Forms of Stromelysin to Collagen Is Mediated by the C-Terminal Domain. J Cell Sci 99 ( Pt 4), 789-95 (1991).  92.  Murphy, G., Allan, J. A., Willenbrock, F., Cockett, M . I., O'Connell, J. P. and Docherty, A . J. The Role of the C-Terminal Domain in Collagenase and Stromelysin Specificity. / Biol Chem 267, 9612-8 (1992).  93.  Knauper, V., Osthues, A., DeClerck, Y . A., Langley, K . E., Blaser, J. and Tschesche, H . Fragmentation of Human Polymorphonuclear-Leucocyte Collagenase. Biochem /291 ( Pt 3), 847-54 (1993).  94.  Knauper, V., Cowell, S., Smith, B., Lopez-Otin, C , O'Shea, M . , Morris, H , Zardi, L . and Murphy, G. The Role of the C-Terminal Domain of Human Collagenase-3 (Mmp-13) in the Activation of Procollagenase-3, Substrate  Specificity, and Tissue Inhibitor of Metalloproteinase Interaction. J Biol Chem 272,7608-16(1997). 95.  Ramachandran, G. N . and Kartha, G. Structure of Collagen. Nature 176, 593-5 (1955).  96.  Kadler, K . Extracellular Matrix 1: Fibril-Forming Collagens (Academic Press, 1994).  97.  Kadler, K . E., Holmes, D. F., Trotter, J. A . and Chapman, J. A . Collagen Fibril Formation. Biochem 7316 ( Pt 1), 1-11 (1996).  98.  Fields, G. B. A Model for Interstitial Collagen Catabolism by Mammalian Collagenases. / Theor Biol 153, 585-602 (1991).  99.  Bromme, D., Okamoto, K , Wang, B . B. and Biroc, S. Human Cathepsin 02, a Matrix Protein-Degrading Cysteine Protease Expressed in Osteoclasts. Functional Expression of Human Cathepsin 0 2 in Spodoptera Frugiperda and Characterization of the Enzyme. J Biol Chem 271, 2126-32 (1996).  100.  Grant, G. A., Henderson, K. O., Eisen, A . Z. and Bradshaw, R. A . Amino Acid Sequence of a Collagenolytic Protease from the Hepatopancreas of the Fiddler Crab, Uca Pugilator. Biochemistry 19, 4653-9 (1980).  101.  Lecroisey, A., Gilles, A. M . , De Wolf, A . and Keil, B. Complete Amino Acid Sequence of the Collagenase from the Insect Hypoderma Lineatum. J Biol Chem 262, 7546-51 (1987).  102.  Sellos, D. and Van Wormhoudt, A . Molecular Cloning of a Cdna That Encodes a Serine Protease with Chymotryptic and Collagenolytic Activities in the Hepatopancreas of the Shrimp Penaeus Vanameii (Crustacea, Decapoda). FEBS Lett 309,219-24(1992).  103.  Sun, H . B., Smith, G. N . , Jr., Hasty, K . A . and Yokota, H . Atomic Force Microscopy-Based Detection of Binding and Cleavage Site of Matrix Metalloproteinase on Individual Type Ii Collagen Helices. Anal Biochem 283, 153-8 (2000).  104.  Lauer-Fields, J. L., Juska, D. and Fields, G. B. Matrix Metalloproteinases and Collagen Catabolism. Biopolymers 66, 19-32 (2002).  40  105.  Overall, C. M . Molecular Determinants of Metalloproteinase Substrate Specificity: Matrix Metalloproteinase Substrate Binding Domains, Modules, and Exosites. Mol Biotechnol 22, 51-86 (2002).  106.  Schnierer, S., Kleine, T., Gote, T., Hillemann, A., Knauper, V . and Tschesche, H . The Recombinant Catalytic Domain of Human Neutrophil Collagenase Lacks Type I Collagen Substrate Specificity. Biochem Biophys Res Commun 191, 31926 (1993).  107.  Sanchez-Lopez, R., Alexander, C. M . , Behrendtsen, O., Breathnach, R. and Werb, Z. Role of Zinc-Binding- and Hemopexin Domain-Encoded Sequences in the Substrate Specificity of Collagenase and Stromelysin-2 as Revealed by Chimeric Proteins. J Biol Chem 268, 7238-47 (1993).  108.  Clark, I. M . and Cawston, T. E. Fragments of Human Fibroblast Collagenase. Purification and Characterization. Biochem J 263, 201-6 (1989).  109.  Bigg, H . F., Clark, I. M . and Cawston, T. E. Fragments of Human Fibroblast Collagenase: Interaction with Metalloproteinase Inhibitors and Substrates. Biochim Biophys Acta 1208, 157-65 (1994).  110.  Lauer-Fields, J. L., Tuzinski, K . A., Shimokawa, K., Nagase, H . and Fields, G. B. Hydrolysis of Triple-Helical Collagen Peptide Models by Matrix Metalloproteinases. / Biol Chem 21S, 13282-90 (2000).  111.  Gioia, M . , Fasciglione, G. F., Marini, S., D'Alessio, S., De Sanctis, G., Diekmann, O., Pieper, M . , Politi, V., Tschesche, H . and Coletta, M . Modulation of the Catalytic Activity of Neutrophil Collagenase Mmp-8 on Bovine Collagen I. Role of the Activation Cleavage and of the Hemopexin-Like Domain. / Biol Chem 277, 23123-30 (2002).  112.  Ottl, J. and Moroder, L . Disulfide-Bridged Heterotrimeric Collagen Peptides Containing the Collagenase Cleavage Site of Collagen Type I. Synthesis and Conformational Properties. J Am Chem Soc 121, 653-661 (1999).  113.  Ottl, J., Gabriel, D., Murphy, G., Knauper, V., Tominaga, Y . , Nagase, H., Kroger, M . , Tschesche, H., Bode, W. and Moroder, L . Recognition and Catabolism of Synthetic Heterotrimeric Collagen Peptides by Matrix Metalloproteinases. Chem Biol 7, 119-32 (2000).  114.  Ottl, J., Battistuta, R., Pieper, M . , Tschesche, H., Bode, W., Kuhn, K . and Moroder, L. Design and Synthesis of Heterotrimeric Collagen Peptides with a Built-in Cystine-Knot. Models for Collagen Catabolism by MatrixMetalloproteases. FEBS Lett 398, 31-6 (1996).  115.  Tarn, E. M . , Wu, Y. I., Butler, G. S., Stack, M . S. and Overall, C. M . Collagen Binding Properties of the Membrane Type-1 Matrix Metalloproteinase ( M t l Mmp) Hemopexin C Domain. The Ectodomain of the 44-Kda Autocatalytic Product of M t l - M m p Inhibits Cell Invasion by Disrupting Native Type I Collagen Cleavage. J Biol Chem 277, 39005-14 (2002).  116.  Knauper, V., Docherty, A . J., Smith, B., Tschesche, H . and Murphy, G. Analysis of the Contribution of the Hinge Region of Human Neutrophil Collagenase (Hnc, Mmp-8) to Stability and Collagenolytic Activity by Alanine Scanning Mutagenesis. FEBS Lett 405, 60-4 (1997).  117.  Hirose, T., Patterson, C , Pourmotabbed, T., Mainardi, C. L . and Hasty, K . A . Structure-Function Relationship of Human Neutrophil Collagenase: Identification of Regions Responsible for Substrate Specificity and General Proteinase Activity. Proc Natl Acad Sci USA90, 2569-73 (1993).  118.  Tsukada, H. and Pourmotabbed, T. Unexpected Crucial Role of Residue 272 in Substrate Specificity of Fibroblast Collagenase. / Biol Chem 277, 27378-84 (2002).  119.  de Souza, S. J. and Brentani, R. Collagen Binding Site in Collagenase Can Be Determined Using the Concept of Sense-Antisense Peptide Interactions. J Biol Chem 267, 13763-7 (1992).  120.  Knauper, V., Patterson, M . L., Gomis-Ruth, F. X . , Smith, B., Lyons, A . , Docherty, A. J. and Murphy, G. The Role of Exon 5 in Fibroblast Collagenase (Mmp-1) Substrate Specificity and Inhibitor Selectivity. Eur J Biochem 268, 1888-96 (2001).  121.  Chung, L., Shimokawa, K., Dinakarpandian, D., Grams, F., Fields, G. B. and Nagase, H. Identification of the (183)Rwtnnfrey(191) Region as a Critical Segment of Matrix Metalloproteinase 1 for the Expression of Collagenolytic Activity. J Biol Chem 275, 29610-7 (2000).  122.  Sang, Q. A . and Douglas, D. A . Computational Sequence Analysis of Matrix Metalloproteinases. J Protein Chem 15, 137-60 (1996).  123.  Hasty, K . A., Wu, H., Byrne, M . , Goldring, M . B., Seyer, J. M . , Jaenisch, R., Krane, S. M . and Mainardi, C. L . Susceptibility of Type I Collagen Containing Mutated Alpha 1(1) Chains to Cleavage by Human Neutrophil Collagenase. Matrix 13, 181-6(1993).  124.  Wu, H., Byrne, M . H., Stacey, A., Goldring, M . B., Birkhead, J. R., Jaenisch, R. and Krane, S. M . Generation of Collagenase-Resistant Collagen by Site-Directed Mutagenesis of Murine Pro Alpha 1(1) Collagen Gene. Proc Natl Acad Sci USA 87, 5888-92 (1990).  125.  Overall, C. M . , Lowne, D., Wells, G., Burel, S., McCulloch, C. A . G. and Clements, J. M . Cloning, Cho Cell Expression, and Activation of Rat Collagenase-2 (Mmp-8). J Dent Res 78, 458 (1999).  43  CHAPTER 2 - MANUSCRIPT  Residues of the S ' Substrate Specificity Subsite of 3  Matrix Metalloproteinase-8 (MMP-8) are Determinants of Collagen Triple Helicase Activity Gayle R. Pelman*, Charlotte J. Morrison^ and Christopher M . Overall* H§ <  Departments of *Biochemistry & Molecular Biology and  fOred  Biological & Medical  Sciences, University of British Columbia, Vancouver, Canada, V6T 1Z3  § To whom correspondence should be addressed: University of British Columbia, 2199 Wesbrook Mall, J.B. Macdonald Bldg., Vancouver, British Columbia V6T 1Z3, Canada email: chris.overall@ubc.ca phone: 1-604-822-3561 fax: 1-604-822-3562 web:  http://www.clip.ubc.ca  Running Title: Collagen Triple Helicase Activity of M M P - 8  2.1 Introduction Collagen is a triple helical macromolecule that is one of the most complex proteins of the extracellular matrix and one of the most difficult to cleave.and degrade. The physiological turnover of collagen is important for growth and repair with abnormal breakdown of collagen contributing to numerous pathologies including arthritis and tumour metastasis (1-4). The matrix metalloproteinases (MMPs) are a family of zincdependent endopeptidases that are thought to cleave all extracellular matrix proteins (5) as well as bioactive molecules (6-8). Though the collagen triple helix is resistant to most proteases, a number of MMPs, M M P - 1 , -8, and -13, display collagenase activity. The cell-surface bound MMP-14 (membrane-type ( M T ) l - M M P ) and gelatinase A (MMP-2) also have weak collagenolytic activity (9). The collagenases have distinct substrate specificities, with MMP-8 preferentially degrading type I collagen over types II and III, while MMP-1 displays greatest activity against type III collagen, followed by type I collagen and, to a much lesser extent, type II collagen (10,11). MMP-13 preferentially degrades type II collagen and is associated with cartilage degradation (12,13).  MMP-8, also known as neutrophil collagenase, is released from the specific granules of polymorphonuclear neutrophilic leukocytes at sites of inflammation (14,15). Neutrophils are involved in the early immune response and aid the wound healing process by debriding the compromised area of local contamination (16). In chronic inflammatory conditions, the continuous recruitment of neutrophils and their subsequent secretion of proteases, including MMP-8, and other tissue damaging products which stimulate further cycles of recruitment, can lead to tissue damage (17).  The mechanism of triple helicase cleavage remains undetermined. The diameter of the collagen triple helix is 1.5 nm in comparison to the approximately 0.5 nm M M P - 8 active site. Since the triple helical structure must be opened before cleavage can occur, collagen must first be locally unwound by a process termed triple helicase activity. No ATP or other energy input is required for collagen hydrolysis. This process is difficult, as  reflected by kinetic analyses which have demonstrated that MMP-1 catalyses a very inefficient turnover of only 25 moles of collagen per mole of enzyme per hour (18).  Collagen triple helicase activity has been studied extensively through the use of chimeric proteins and more recently through site-directed mutagenesis of specific residues. The hemopexin C domain has long been recognized as pivotal to the mechanism of collagenase. Clark and Cawston first reported that the autolytic collagenase fragments of the hemopexin C domain alone bind collagen (19). The binding of the hemopexin C domain of both collagenolytic (20-22) and non-collagenolytic M M P s such as stromelysin-1 (23) and, more recently, MMP-14 (24) has been demonstrated.  However, attempts to impart collagenolytic activity on non-collagenolytic M M P s (MMP3, MMP-10) by creation of chimeric enzymes using the collagenase hemopexin C domain have been unsuccessful (25-27). Potential problems introduced by the construction of chimeric enzymes include domain clashes or orientation effects which may result in the misalignment of the hemopexin C domain with the active site. Any of these disruptions may be responsible for the lack of collagenolytic activity in chimeras (28). Further studies by Nagase in which MMP-1 was progressively grafted on M M P - 3 only recaptured significant collagenase activity when the entire C-terminal hemopexin C domain and linker and catalytic subdomain up to and beyond the S 3 ' region of the active site were replaced with that of collagenase M M P - 1 . The resulting collagenase activity is not surprising since the collagen interacting surface of such a chimera is MMP-1-like on a MMP-3 hydrophobic core (29).  In addition to the catalytic domain, other elements in the full length molecule are important for collagenase activity. Both the linker and hemopexin C domain are proposed to provide exosites for binding of native type I collagen (28). The linker region connecting the M M P catalytic and hemopexin C domain has been shown to contribute by domain swap and chimeric protein studies. Chimeric proteins linking the catalytic domain of MMP-1 with the linker and hemopexin C domain of stromelysins MMP-3 or 10 did not display collagenolytic activity (20,26). It is postulated that the linker, with  structural similarities to collagen, intercalates with the collagen triple helix in a displacement arrangement to generate a free strand able to dock in the active site (25,26,30-33). Tarn et al reported that recombinant MMP-14 (MT1-MMP) hemopexin C ' domain required the contiguous presence of the linker to block collagenase activity of MMP-14 in competition whereas the C domain alone, although capable of binding native collagen, was ineffective (24).  Unlike most M M P s with deep and variable S i ' pockets, collagenases have a relatively shallow S T which accommodates P i ' Leu and He of the scissile 775-776 bond of type I collagen (34,35). There is a considerable difference between the S T binding pocket of MMP-8 and that of M M P - 1 , which is significantly occluded by an Arg residue, so the S i ' pocket does not appear critical for triple helicase activity per se but rather for peptide bond specificity within collagen and between collagen types (36). One key difference seen in P i ' preference between MMP-1 and -8 is that while MMP-8 activity is enhanced nearly four fold by the presence of aromatic residues, MMP-1 is intolerant for aromatic residues at P i ' (37). New structural determinants for substrate recognition by MMP-8 were recognized when the crystal structure of MMP-8 in complex with the barbiturate inhibitor RO200-1770 detailed a new spatial arrangement of Zn and its binding ligands in comparison with other inhibitors (38). This previously unreported cis peptide bond between A s n  188  and T y r  189  on a loop of the S 3 ' substrate specificity subsite has been  implicated in collagenase activity (29,38). Interestingly, our previous studies of rat 188  MMP-8 had determined that mutagenesis of the rat analogue of human Asn  in S 3 '  disrupted the catalytic ability of the enzyme (39). From this observation we have undertaken a site-directed mutagenesis approach to the analysis of the S 3 ' subsite. Here we present the results of a series of site-directed mutants expressed to systematically explore the molecular determinants of collagenase substrate specificity. 2.2 Experimental  Procedures  Sequence and Three-dimensional Modeling Analyses  47  The S 3 ' specificity subsite region of human MMP-8 (EC 3.4.24.34) was examined by three-dimensional modeling of structural data coordinates (PDB IDs 1 J A N , 1 JAP, 1MNC, 1KBC, 1A85, 1A86) using Rasmol v2.6 (R. Sayle) and Swiss-PdbViewer v3.7 (GlaxoSmithKline). Residues of interest for mutagenesis were selected from structure models and analysis of collagenase protein sequences (Fig. 1). Target nucleotide bases for mutagenesis were identified by sequence analysis of human neutrophil collagenase cDNA (Nucleotide Accession Code J05556) using Lasergene EditSeq software (DNAStar Inc.).  Site-directed Mutagenesis  Six site-directed mutations of the S 3 ' substrate specificity subsite of M M P - 8 (Asn Gly, Asn Lys, Asn Leu, T y r A l a , Tyr Phe, Asn Leu) were generated using the 188  188  189  189  190  QuikChange™ site-directed mutagenesis strategy (Stratagene, USA). A n inactive mutant enzyme was also produced by site-directed mutagenesis of the catalytic residue G l u A l a . Complementary oligonucleotides (Table I and Appendix A) (Nucleic Acid 198  Protein Services (NAPS) Unit, U B C , Canada and J. Hewitt, U B C , Canada) were used to introduce point mutations in a double-stranded template of full-length MMP-8 in the p G W I H G plasmid under regulation of a h C M V promoter (British Biotech. Ltd, Oxford, U K ) (40). PCR cycling parameters were 30 s at 95 °C followed by 14-16 cycles of 30 s at 95 °C, 60 s at 65 °C, and 18 min at 68 °C. D N A sequence verification was completed by automated sequencing using BigDye™ v3.1 Terminator Chemistry (Applied Biosystems, NAPS Unit) and sequence alignment with Sequencher (Gene Codes Corp.). Large-scale plasmid preparations were generated using the QIAfilter plasmid maxi kit (Qiagen).  Mammalian Cell Transfection  Chinese Hamster Ovary (CHO-K1) cells (American Type Culture Collection) were maintained in Dulbecco's Modified Eagle Medium (DMEM) (Gibco) supplemented with 10% Cosmic calf serum (HyClone Laboratories, Inc.) and non-essential amino acids  (Gibco). Cells were transfected and stable clones selected as previously described (41). Briefly, CHO-K1 cells were transfected with Not I-linearized p G W l H G - M M P - 8 or mutant plasmids by electroporation and stable transfectants were selected in 25 u.g/ml mycophenolic acid (Invitrogen). Clones were screened and stable MMP-8 expressers were identified by western blotting with T93-5660 or T25-88 anti-MMP-8 antibody (generously provided by Dr. H. Tschesche, Biel, DE) and cleavage of quenched fluorescent peptide (7-methoxycoumarin-4-yl)acetyl-Pro-Leu-Gly-Leu-[3-(2,4dinitrophenyl)-L-2,3-diaminopropionyl]-Ala-Arg-NH2 (Mca-Pro-Leu-Gly-Leu-Dpa-AlaArg-NH2) (QF24) (supplied by Dr. C. G. Knight, Cambridge, U K ) .  Recombinant Protein Expression and Purification  Transfected cells were expanded to confluence in roller bottles (850 cm , Becton Dickinson). Cultures were washed with phosphate-buffered saline (PBS) (138 m M NaCl, 2.7 m M KC1, 20 m M N a H P 0 , 1.5 m M K H P 0 , pH 7.4) and incubated with 100 ml 2  4  2  4  serum-free CHO-S-SFM II medium (Gibco). Medium was collected every 1-2 days for up to 8 days. Conditioned medium was chromatographed over gelatin Sepharose 4B resin (Pharmacia Biotech) (V 10 ml) connected in tandem with a Red Sepharose CL-6B t  column (Pharmacia Biotech) (V 25 ml). Peak protein fractions (as measured by t  A 8o) 2  eluted from Red Sepharose with 50 m M Tris/1 M NaCl were pooled and the salt concentration adjusted to 500 m M NaCl. The pooled fraction was loaded on a Chelating Sepharose Fast Flow resin (Pharmacia Biotech) (V 10 ml) charged with Z n S 0 and the t  4  unbound fraction was loaded on Lectin-Agarose Sepharose 4B (Sigma-Aldrich). Fractions containing MMP-8 were eluted with 50 m M Tris/100 m M oc-Dmethylmannopyranoside (Sigma). Purified enzymes were exchanged into collagenase assay buffer (CAB; 50 m M Tris, 200 m M NaCl, 5 m M CaCl , 0.05% Brij 35, pH 7.4) 2  through PD-10 Sephadex G-25 columns (Amersham Pharmacia Biotech). Murine TIMP1 was expressed in CHO cells and purified as previously described (42).  49  Enzyme Activation  MMP-8 mutant and wildtype proteins (0.35 pmol/ui) were activated with 1 m M 4aminophenylmercuric acetate (APMA) for 2 h, 37 °C. Processing to the fully activated form (59 kDa) was confirmed by electrophoresis on 10% SDS-PAGE followed by silver staining. The concentrations of activated mutants were determined by active site titration against a standard preparation of TIMP-1 (Appendix B) (43).  Synthetic Peptide Cleavage  Rates of wildtype and mutant cleavage of quenched fluorescent peptide QF24 (1 uJVI) were measured at 37 °C by continuous assay in fluorescence assay buffer (FAB; 100 m M Tris-HCl, 10 m M CaCl , 100 mM NaCl, 0.05% Brij 35, pH 7.5) in 96-well fluorimetry 2  plates in a FLUOstar Optima plate reader ( B M G Labtechnologies) using a 320 nm excitation and 405 nm emission filter pair. Fluorescence was calibrated using a Mca-NF^ standard (10 pmol) (Bachem). V  m a x  was calculated in the linear portion (500-1000 s) of  the initial rate of substrate cleavage.  Collagenase Assays  Biotin-labeled porcine type I collagen (24) (100 fmol) was incubated with 0 - 250 fmol MMP-8 or mutant enzymes in C A B for 18 h, 28 °C. Reactions were terminated by being brought to 0.125 M Tris-HCI, 2 M urea, 2% SDS, pH 6.8 in SDS-PAGE sample buffer. Proteins were separated by 7.5% SDS-PAGE and analyzed by in-gel detection (700 nm channel) using the Odyssey Infrared Imaging System (LI-COR Biosciences) as follows: Gels were incubated in 2-propanol (50% in H 0 ) , then ultrapure H2O, before incubation 2  with Streptavidin Alexa Fluor 680 conjugate (2 pg/ml, diluted in PBS-0.1% Tween, Molecular Probes), 2 h and then washed with PBS. Specific activities of wildtype and MMP-8 mutants were determined by densitometric analysis of collagen cleavage products detected by the biotin-specific probe. One Unit of collagenase activity is defined as the amount of enzyme required to degrade 2 fmol of collagen by 50% in 1 h.  2.3  Results  Site-directed mutagenesis of S3' residues 1  The S 3 ' residues Asn  1 SO  SS  , Tyr  1  and Asn  QO  targeted by site-directed mutagenesis are  located along the amino side of alpha helix B that forms the base of the active site cleft (Fig. 1A). The cis orientation of the peptide bond connecting residues 188 and 189 is an unusual characteristic and results in the parallel, nearly planar, configuration of the 1RR  sidechains of Asn  1QQ  and Tyr  , which are both directed into the cleft. Helix B also  positions the critical residues H i s  197  and H i s  201  of the histidine triad that coordinates the  catalytic zinc, as well as the essential catalytic residue G l u . The collagenolytic MMPs 198  share a high sequence homology with the residues forming the active site cleft (Fig. IB). With the exception of MMP-14, human collagenases-1, -2 and -3 (MMPs-1, -8 and -13), 189  as well as the gelatinase MMP-2, all possess a Tyr at the position analogous to Tyr MMP-8. A s n  188  of  preceding the Tyr was altered by site-directed mutagenesis to Gly, Lys  and Leu, with the Gly substitution predicted to destabilize the cis orientation of the 189  peptide converting it to the trans form. The strictly conserved Tyr Asn  190  were also altered by site-directed mutagenesis to A l a , Phe 189  and neighbouring 189  and L e u . Mouse 190  and rat MMP-8 sequences also bear a high level of conservation in the S 3 ' region. A mutation of rat MMP-8 analogous to A s n  188  of the human enzyme resulted in an enzyme 1  with decreased catalytic activity (39). The catalytic Glu  no  of the HexxHxxGxxH motif  was mutated to Ala to generate a predicted catalytically incompetent mutant. Recombinant Protein Expression Wildtype MMP-8 and the seven enzyme variants generated by site-directed mutagenesis were expressed in CHO cells. Purified proteins were collected in the proenzyme form and displayed an apparent molecular mass of 79 kDa as analysed by silver staining or western blotting with anti-MMP-8 antibody (Fig. 2A). At high concentrations wildtype enzyme underwent autolytic activation resulting in the removal of the propeptide and a shift in apparent molecular weight to 59 kDa. Mutants Asn Leu and T y r A l a were 190  189  unstable and recalcitrant to purification. Autolytic activation occurred for all mutants 51  upon incubation with A P M A with complete removal of the propeptide by 120 min (Fig. 2B). The mutant G l u A l a was not activated by A P M A , indicating catalytic 198  incompetency of the enzyme.  Synthetic Peptide Cleavage  The concentrations of APMA-activated purified mutants were determined by active site titration with TIMP-1 (Appendix B). The activity of equimolar samples of mutant enzymes against QF24 fluorescent peptide substrate was measured by continuous fluorescence spectroscopy (Fig. 3A). The relative efficiency of MMP-8 mutants for 189  QF24 hydrolysis was determined in comparison to wildtype enzyme (Fig. 3B). Tyr  Phe  displayed 88% (n=20) of wildtype activity indicating the importance of the hydroxyl 188  group in forming a hydrogen bond. Replacement of Asn  had a more varied effect on  enzyme activity; A s n G l y and Asn Lys showed a 30% (n=27) and 22% (n=13) 188  188  decrease in enzyme activity, respectively, while the Asn Leu mutation reduced activity 188  to only 26% (n=7) of that of the wildtype enzyme. Catalytic activity of G l u A l a was 198  completely abolished, as reported for other MMPs, but not previously for MMP-8, for this essential residue (44,45). Effects of S3' Mutations of MMP-8 on Type I Collagen Cleavage  The impact of mutagenesis of specific S 3 ' residues on degradation of type I collagen was determined by cleavage assays using biotinylated type I collagen (Fig. 4A). The relative specific activity of mutants for type I collagen substrate was calculated and compared with wildtype MMP-8 (Fig. 4B). In contrast to activities against the QF24 substrate, the most significant loss of specificity for type I collagen was incurred by the mutation of Tyr  189  to Phe. While this mutant was catalytically competent and retained 88% of  wildtype QF24 activity, its specificity for type I collagen dropped to one-third of that of wildtype. These results indicate a specific role for this residue in type I collagen cleavage. Mutagenesis of A s n  188  had a varying impact on collagenolytic activity  depending on the residue introduced. The 25% decrease in collagen cleavage by  Asn  188  Gly was similar to the decline seen in QF24 substrate activity and can be attributed  to a general reduction in catalytic efficiency of the enzyme. No change in preference for 188  type I collagen substrate was demonstrated by mutation of Asn  to Lys even though  mutant competency against QF24 was reduced by 22%. This suggests the amino group may be important for collagen recognition, although introduction of a larger side chain I 88  may interfere with catalysis of simple peptide substrates. The Asn  Leu mutant shows a  56% reduction in specific activity against type I collagen, albeit not as pronounced as its 188  decrease in activity against QF24. This points to a critical role for Asn  in both the  catalytic and collagenolytic activity of MMP-8, likely through the contribution of hydrogen bonding to the stability of the enzyme or the enzyme-substrate interaction. 2.4  Discussion  As a product of the polymorphonuclear neutrophil, MMP-8 is thought to have a role in the early stages of the inflammatory reaction. The classification of MMP-8 as one of the few enzymes able to hydrolyse the native fibrillar collagen triple helix, and in particular the only M M P that preferentially cleaves native type I collagen over types II and III, suggests that this specific ability has evolved to suit the requirements of the connective tissue infiltrating neutrophil. Indeed the Mmp8~'' mouse shows the surprising phenotype of decreased infiltration of cells in the early phases of inflammation but with a delayed reduction in infiltrate cell numbers in the later phases (46). Absence of the C X C R 2 chemokine L I X processing and activation by MMP-8 with consequent loss of a feedforward chemotactic response to L I X was identified as the underlying cause of the initial lag phase, but the reason for infiltrate retention remains obscure. Potentially a delay in collagen remodelling in the wound resolution phase leads to prolonged generation of chemotactic signals for neutrophils. The triple helicase mechanism and precise method of collagen binding and cleavage by collagenases is unresolved. Several studies have mapped possible determinants of enzyme activity through the analysis of domain swap and point mutations but the mechanism remains elusive (20,25,26,29,31,32).  Tyr  189  is strictly conserved through the M M P collagenases (MMP-1, -8, -13 and -18) and  is also present in the collagen-degrading gelatinases (MMP-2 and -9), but is not found in the membrane-type MMPs. Here we have determined the relative impact of specific mutations in the S 3 ' region of the active site. The Tyr Phe mutation demonstrated a 189  specific function for this residue in type I collagen hydrolysis by reducing collagen 189  degradation by 67%. It is likely that Tyr  forms hydrogen bonds with the collagen  substrate that are critical for either triple helicase or collagenolytic activity. The unstable mutant T y r A l a , as evidenced by its recalcitrance to purification, demonstrated 189  collagenase activity in conditioned media from CHO-K1 cells, although no estimate of catalytic efficiency could be obtained (data not shown). The influence of the S 3 ' subsite on collagenase cleavage propensity has previously been documented using simple peptide substrates and mutagenesis of M M P - 1 . In previous work, the catalytic activity of M M P 8 against a synthetic peptide modeling the al(I) chain was reduced by greater than 95% upon removal of a P 3 ' binding residue. Substitutions of P 3 ' Gly with a larger Arg or Met residue decreased activity by 67% whereas substitution with Ala or Ser produced a 2030% increase in enzyme activity (47). Peptide library scanning also showed MMP-1 preference for Ala, Gly or Ser at P 3 ' (48). Although the conserved Tyr has long been recognized, no mutation of this residue had been reported until our study was in progress. In MMP-1 mutation of the conserved S 3 ' T y r  191  to Thr resulted in more than a 75%  decrease in collagenolytic activity (29). 188  The recent recognition of a cis peptide bond between Asn  189  and Tyr  of MMP-8  strengthens the proposal that these residues are an important factor in the collagenolytic process (38). Cis peptide bonds are usually less energetically favourable than those in the trans, conformation due to closer contacts between neighbouring alpha carbons and other side chain atoms. This led to the speculation that cis bonds may act as an energy reservoir and play a role in the function of an enzyme (49). In collagen cleavage, where no ATP is utilized, such an energy source is an attractive idea to account for the energy dependence of the collagenolytic process (28).  54  I  88  The cis bond between Asn  I8Q  and Tyr  is located on a solvent exposed loop at the start  of the helix forming the base of the active site (38). The sidechains of the residues are both oriented towards the interior of the pocket in contrast to the alternating trans directions usually seen for two neighbouring sidechains on a peptide backbone (Figure 1A). Of the three-dimensional structures solved, the 188-189 cis bond is only found in MMP-1 and MMP-8 (38). MMP-13, as well as MMP-2 and MMP-14, which only show weak collagenase activity, have not been reported to contain the cis bond (35,50,51). Also of note is that of all human MMPs, only MMP-1 (Glu ) and MMP-8 (Asn ) lack 188  188  a Gly at position 188 (52). M M P - 2 and MMP-9, with large collagen binding domain (CBD) insertions directly before this critical residue, have a conserved G l y  188  . Gly is the  only structural fit for a trans bond turning the loop between strand V of the catalytic domain and the active site helix. The connection of a non-Gly residue 188 to a cis 188189 bond suggests this bond, which may be cis due to the distortion of the backbone caused by the non-Gly residue, may make a significant contribution to the function of the enzyme. Since the 188 residue is variable between the two cw-bond containing MMPs, it is probable that the backbone conformation also plays a role in the activity. 188  The mutation Asn  Leu reported here shows a reduction in the complementarity of the  188 residue with both peptide and native collagen substrates as evidenced by reduced cleavage of these two substrates. Although insufficient material has yet been expressed for crystallographic studies, it is predicted that this mutation disrupts the cis 188-189 bond and causes some strain or unfavourable interaction in the enzyme structure. However, since A s n G l y shows only little reduction in activity in comparison with 188  wildtype MMP-8 and Asn Lys, this indicates that the cis bond may not be critical for 188  collagen cleavage. Indeed, the decrease in catalytic activity for the A s n G l y mutant is 188  nearly the same for type I collagen and QF24 substrate, suggesting a general effect on catalysis rather than a collagen-specific role, either in binding or triple helicase activity, for this residue. The precise mechanism of collagen catalysis is unknown. The factors contributing to the ability of MMPs to hydrolyse collagen have been comprehensively reviewed both from  the perspective of the enzyme (28) and that of the substrate (2). Three key stages of the process have been identified: Collagen binding, unwinding of the triple helix (triple helicase activity), and hydrolysis of the individual strands of the triple helix. Binding of native collagen by collagenase is believed to involve contacts between the substrate and the active site cleft and also to substrate binding exosites on regions of the enzyme outside of the active site. The additional contribution of exosite-substrate interactions supports collagenolytic activity by lowering K , thus improving the k / K ratio. There m  c a t  m  are known differences between the molecular determinants required for catalysis of native triple helical collagen and those required for single peptide strands. The hemopexin C domain of collagenases binds native collagen through exosites (2022,24,53). Other MMPs that possess some collagenolytic activity, MMP-14 and MMP-2, demonstrate contradictory results with respect to collagen binding by the hemopexin C domain. While the hemopexin C domain of MMP-14 binds collagen as seen in the collagenases (24), the collagen binding exosites of M M P - 2 appear to be situated in the C B D and the hemopexin C domain does not bind collagen (54,55). Collagenase catalytic domains alone do not cleave triple helical collagen, although activity versus simpler peptide'substrates is retained (19-22,56). These ideas have been challenged by recent studies with triple helical peptide models that have demonstrated binding and cleavage by truncated collagenases lacking the hemopexin C domain, and cleavage of type I collagen has also been recorded at 37 °C (57,58). However, synthetic peptide model substrates may be difficult to mimic the structural stability of full length native type I collagen. It is likely that the temperature dependence has an important regulatory effect on M M P - 8 . MMP-1 supports a very low turnover rate of 25 moles collagen per mole enzyme per hour while a temperature shift of only 3 °C may lead to a four-fold increase in the rate of cleavage (18,59). At sites of inflammation, local temperatures can rise by 3-4 °C, which therefore may significantly increase native collagen degradation. Limiting optimum enzyme activity to sites of active inflammation may be a key control mechanism of an immune system trying to maintain balance between defensive and destructive potential.  Various possibilities for the contribution of the hemopexin C domain and linker to the, triple helicase process have been suggested (28). Binding contacts may induce  compression or bending of the helix, forcing looseness in another area near the cleavage site, or may serve to splay apart individual a-chains. Rotation of the helix or intercalation of the linker within the triple helix may also separate strands and allow catalysis of the substrate. A model for the favourable collagen cleavage site recognized by collagenases proposed a looser, low imino acid-content helical region following the scissile bond (60). Features of the collagen triple helix, as well as multiple interactions with the collagenase, likely contribute to successful triple helicase activity.  A three point binding model has been proposed to produce the energy required for triple helicase activity. Binding to any two of the three sites - hemopexin C domain, linker or S 3 ' region - may be permitted, but the third site may be structurally oriented away from the collagen. Fulfilling the binding propensity of the third site simultaneously may only occur by structural changes in the collagen - changes that open up the helix to allow occupancy of the active site cleft by the a-chain for scission. Our findings support the importance of the S 3 ' residues in the general catalytic competency of M M P - 8 as well as its specificity for native type I collagen. While resolving the molecular determinants of the collagenase-collagen interaction cast important clues to the collagenolytic mechanism, a clear answer to the elusive mechanism is likely only to be resolved by determination of the three-dimensional structure of the collagen triple helix bound to fulllength enzyme.  2.5 References 1.  Vu, T. H . and Werb, Z. Matrix Metalloproteinases: Effectors of Development and Normal Physiology. Genes Dev 14, 2123-33 (2000).  2.  Lauer-Fields, J. L., Juska, D. and Fields, G. B. Matrix Metalloproteinases and Collagen Catabolism. Biopolymers 66, 19-32 (2002).  3.  Murphy, G., Knauper, V., Atkinson, S., Butler, G., English, W., Hutton, M . , Stracke, J. and Clark, I. Matrix Metalloproteinases in Arthritic Disease. Arthritis Res 4 Suppl 3, S39-49 (2002).  4.  Mohammed, F. F., Smookler, D. S. and Khokha, R. Metalloproteinases, Inflammation, and Rheumatoid Arthritis. Ann Rheum Dis 62 Suppl 2, H43-7 (2003).  5.  Bode, W. and Maskos, K . Structural Basis of the Matrix Metalloproteinases and Their Physiological Inhibitors, the Tissue Inhibitors of Metalloproteinases. Biol Chem 384, 863-72 (2003).  6.  McCauley, L. K. Transgenic Mouse Models of Metabolic Bone Disease. Curr Opin Rheumatol  7.  13, 316-25 (2001).  Egeblad, M . and Werb, Z. New Functions for the Matrix Metalloproteinases in Cancer Progression. Nat Rev Cancer 2, 161-74 (2002).  8.  Lopez-Otin, C. and Overall, C. M . Protease Degradomics: A New Challenge for Proteomics. Nat Rev Mol Cell Biol 3, 509-19 (2002).  9.  Overall, C. M . Matrix Metalloproteinase Substrate Binding Domains, Modules and Exosites. Overview and Experimental Strategies. Methods Mol Biol 151, 79120 (2001).  10.  Hasty, K . A., Jeffrey, J. J., Hibbs, M . S. and Welgus, H . G. The Collagen Substrate Specificity of Human Neutrophil Collagenase. J Biol Chem 262, 1004852 (1987).  11.  Mallya, S. K , Mookhtiar, K . A., Gao, Y., Brew, K., Dioszegi, M . , BirkedalHansen, H . and Van Wart, H. E. Characterization of 58-Kilodalton Human Neutrophil Collagenase: Comparison with Human Fibroblast Collagenase. Biochemistry 29, 10628-34 (1990).  58  12.  Knauper, V., Lopez-Otin, C , Smith, B., Knight, G. and Murphy, G. Biochemical Characterization of Human Collagenase-3. J Biol Chem 271, 1544-50 (1996).  13.  Billinghurst, R. C , Dahlberg, L., Ionescu, M . , Reiner, A., Bourne, R., Rorabeck, C , Mitchell, P., Hambor, J., Diekmann, O., Tschesche, H., Chen, J., Van Wart, H . and Poole, A . R. Enhanced Cleavage of Type Ii Collagen by Collagenases in Osteoarthritic Articular Cartilage. J Clin Invest 99, 1534-45 (1997).  14.  Murphy, G., Reynolds, J. J., Bretz, U . and Baggiolini, M . Collagenase Is a Component of the Specific Granules of Human Neutrophil Leucocytes. Biochem J 162, 195-7 (1977).  15.  Hasty, K . A., Hibbs, M . S., Kang, A . H . and Mainardi, C. L . Secreted Forms of Human Neutrophil Collagenase. J Biol Chem 261, 5645-50 (1986).  16.  Sylvia, C. J. The Role of Neutrophil Apoptosis in Influencing Tissue Repair. J Wound Care 12, 13-6 (2003).  17.  Edwards, S. W. and Hallett, M . B. Seeing the Wood for the Trees: The Forgotten Role of Neutrophils in Rheumatoid Arthritis. Immunol Today 18, 320-4 (1997).  18.  Welgus, H . G., Jeffrey, J. J., Stricklin, G. P., Roswit, W. T. and Eisen, A . Z. Characteristics of the Action of Human Skin Fibroblast Collagenase on Fibrillar Collagen. J Biol Chem 255, 6806-13 (1980).  19.  Clark, I. M . and Cawston, T. E. Fragments of Human Fibroblast Collagenase. Purification and Characterization. Biochem J 263, 201-6 (1989).  20.  Murphy, G., Allan, J. A., Willenbrock, R , Cockett, M . I., O'Connell, J. P. and Docherty, A . J. The Role of the C-Terminal Domain in Collagenase and Stromelysin Specificity. J Biol Chem 267, 9612-8 (1992).  21.  Knauper, V., Osthues, A., DeClerck, Y . A., Langley, K . E., Blaser, J. and Tschesche, H . Fragmentation of Human Polymorphonuclear-Leucocyte Collagenase. Biochem J 291 ( Pt 3), 847-54 (1993).  22.  Knauper, V., Cowell, S., Smith, B., Lopez-Otin, C , O'Shea, M . , Morris, H , Zardi, L . and Murphy, G. The Role of the C-Terminal Domain of Human Collagenase-3 (Mmp-13) in the Activation of Procollagenase-3, Substrate Specificity, and Tissue Inhibitor of Metalloproteinase Interaction. J Biol Chem 272, 7608-16(1997). 59  23.  Allan, J. A., Hembry, R. M . , Angal, S., Reynolds, J. J. and Murphy, G. Binding of Latent and High M r Active Forms of Stromelysin to Collagen Is Mediated by the C-Terminal Domain. J Cell Sci 99 ( Pt 4), 789-95 (1991).  24.  Tarn, E. M . , Wu, Y. I., Butler, G. S., Stack, M . S. and Overall, C. M . Collagen Binding Properties of the Membrane Type-1 Matrix Metalloproteinase ( M t l Mmp) Hemopexin C Domain. The Ectodomain of the 44-Kda Autocatalytic Product of M t l - M m p Inhibits Cell Invasion by Disrupting Native Type I Collagen Cleavage. / Biol Chem 277, 39005-14 (2002).  25.  Hirose, T., Patterson, C , Pourmotabbed, T., Mainardi, C. L . and Hasty, K . A . Structure-Function Relationship of Human Neutrophil Collagenase: Identification of Regions Responsible for Substrate Specificity and General Proteinase Activity. Proc Natl Acad Sci USA90, 2569-73 (1993).  26.  Sanchez-Lopez, R., Alexander, C. M . , Behrendtsen, O., Breathnach, R. and Werb, Z. Role of Zinc-Binding- and Hemopexin Domain-Encoded Sequences in the Substrate Specificity of Collagenase and Stromelysin-2 as Revealed by Chimeric Proteins. J Biol Chem 268, 7238-47 (1993).  27.  Knauper, V., Patterson, M . L., Gomis-Ruth, F. X., Smith, B., Lyons, A . , Docherty, A . J. and Murphy, G. The Role of Exon 5 in Fibroblast Collagenase (Mmp-1) Substrate Specificity and Inhibitor Selectivity. Eur J Biochem 268, 1888-96 (2001).  28.  Overall, C. M . Molecular Determinants of Metalloproteinase Substrate Specificity: Matrix Metalloproteinase Substrate Binding Domains, Modules, and Exosites. Mol Biotechnol 22, 51-86 (2002).  29.  Chung, L., Shimokawa, K., Dinakarpandian, D., Grams, F., Fields, G. B . and Nagase, H . Identification of the (183)Rwtnnfrey(191) Region as a Critical Segment of Matrix Metalloproteinase 1 for the Expression of Collagenolytic Activity. JBiol Chem 275, 29610-7 (2000).  30.  de Souza, S. J. and Brentani, R. Collagen Binding Site in Collagenase Can Be Determined Using the Concept of Sense-Antisense Peptide Interactions. J Biol Chem 267, 13763-7 (1992).  60  31.  De Souza, S. J., Pereira, H. M . , Jacchieri, S. and Brentani, R. R. Collagen/Collagenase Interaction: Does the Enzyme Mimic the Conformation of Its Own Substrate? Faseb J 10, 927-30 (1996).  32.  Knauper, V., Docherty, A. J., Smith, B., Tschesche, H . and Murphy, G . Analysis of the Contribution of the Hinge Region of Human Neutrophil Collagenase (Hnc, Mmp-8) to Stability and Collagenolytic Activity by Alanine Scanning Mutagenesis. FEBS Lett 405, 60-4 (1997).  33.  Tsukada, H . and Pourmotabbed, T. Unexpected Crucial Role of Residue 272 in Substrate Specificity of Fibroblast Collagenase. J Biol Chem 277, 27378-84 (2002).  34.  Bode, W., Fernandez-Catalan, C , Tschesche, H., Grams, F., Nagase, H . and Maskos, K . Structural Properties of Matrix Metalloproteinases. Cell Mol Life Sci 55, 639-52 (1999).  35.  Lovejoy, B., Welch, A . R., Carr, S., Luong, C , Broka, C , Hendricks, R. T., Campbell, J. A., Walker, K . A., Martin, R., Van Wart, H . and Browner, M . F. Crystal Structures of Mmp-1 and -13 Reveal the Structural Basis for Selectivity of Collagenase Inhibitors. Nat Struct Biol 6, 217-21 (1999).  36.  Stams, T., Spurlino, J. C , Smith, D. L., Wahl, R. C , Ho, T. F., Qoronfleh, M . W., Banks, T. M . and Rubin, B. Structure of Human Neutrophil Collagenase Reveals Large SI' Specificity Pocket. Nat Struct Biol 1, 119-23 (1994).  37.  Netzel-Arnett, S. J., Fields, G. B., Nagase, H , Suzuki, K., Moore, W. G., Birkedal-Hansen, H . and Van Wart, H. E. Comparative Sequence Specificities of Human Fibroblast and Neutrophil Matrix Metalloproteinases. Matrix Suppl 1, 745 (1992).  38.  Brandstetter, H., Grams, F., Glitz, D., Lang, A., Huber, R., Bode, W., Krell, H . W. and Engh, R. A . The 1.8-a Crystal Structure of a Matrix Metalloproteinase 8Barbiturate Inhibitor Complex Reveals a Previously Unobserved Mechanism for Collagenase Substrate Recognition. J Biol Chem 276, 17405-12 (2001).  39.  Overall, C. M . , Lowne, D., Wells, G., Burel, S., McCulloch, C. A . G. and Clements, J. M . Cloning, Cho Cell Expression, and Activation of Rat Collagenase-2 (Mmp-8). J Dent Res 78, 458 (1999).  40.  Green, D. R., Banuls, M . P., Gearing, A . J. H., Needham, L . A., White, M . R. H . and Clements, J. M . Generation of Human Umbilical Vein Endothelial Cell Lines Which Maintain Their Differentiated Phenotype. Endothelium 2, 191-201 (1994).  41.  Morrison, C. J., Butler, G . S., Bigg, H. F., Roberts, C. R., Soloway, P. D. and Overall, C. M . Cellular Activation of Mmp-2 (Gelatinase a) by Mt2-Mmp Occurs Via a Timp-2-Independent Pathway. J Biol Chem 276, 47402-10 (2001).  42.  Bigg, H. F., Morrison, C. J., Butler, G. S., Bogoyevitch, M . A., Wang, Z., Soloway, P. D. and Overall, C. M . Tissue Inhibitor of Metalloproteinases-4 Inhibits but Does Not Support the Activation of Gelatinase a Via Efficient Inhibition of Membrane Type 1-Matrix Metalloproteinase. Cancer Res 61, 3610-8 (2001).  43.  Willenbrock, F., Crabbe, T., Slocombe, P. M . , Sutton, C. W., Docherty, A. J., Cockett, M . I., O'Shea, M . , Brocklehurst, K., Phillips, I. R. and Murphy, G. The Activity of the Tissue Inhibitors of Metalloproteinases Is Regulated by CTerminal Domain Interactions: A Kinetic Analysis of the Inhibition of Gelatinase A. Biochemistry 32, 4330-7 (1993).  44.  Crabbe, T., Zucker, S., Cockett, M . I., Willenbrock, F., Tickle, S., O'Connell, J. P., Scothern, J. M . , Murphy, G. and Docherty, A . J. Mutation of the Active Site Glutamic Acid of Human Gelatinase A: Effects on Latency, Catalysis, and the Binding of Tissue Inhibitor of Metalloproteinases-1. Biochemistry 33, 6684-90 (1994).  45.  Windsor, L . J., Bodden, M . K , Birkedal-Hansen, B., Engler, J. A . and BirkedalHansen, H . Mutational Analysis of Residues in and around the Active Site of Human Fibroblast-Type Collagenase. J Biol Chem 269, 26201-7 (1994).  46.  Balbin, M . , Fueyo, A., Tester, A . M . , Pendas, A . M . , Pitiot, A . S., Astudillo, A . , Overall, C. M . , Shapiro, S. D. and Lopez-Otin, C. Loss of Collagenase-2 Confers Increased Skin Tumor Susceptibility to Male Mice. Nat Genet 35, 252-7 (2003).  47.  Netzel-Arnett, S., Fields, G. B., Birkedal-Hansen, H., Van Wart, H . E. and Fields, G. Sequence Specificities of Human Fibroblast and Neutrophil Collagenases. J Biol Chem 266, 6747-55 (1991).  62  48.  Turk, B . E., Huang, L . L., Piro, E. T. and Cantley, L . C. Determination of Protease Cleavage Site Motifs Using Mixture-Based Oriented Peptide Libraries. Nat Biotechnol 19, 661-7 (2001).  49.  Weiss, M . S., Jabs, A . and Hilgenfeld, R. Peptide Bonds Revisited. Nat Struct Biol 5, 676 (1998).  50.  Fernandez-Catalan, C , Bode, W., Huber, R., Turk, D., Calvete, J. J., Lichte, A . , Tschesche, H . and Maskos, K . Crystal Structure of the Complex Formed by the Membrane Type 1-Matrix Metalloproteinase with the Tissue Inhibitor of Metalloproteinases-2, the Soluble Progelatinase a Receptor. Embo J 17, 5238-48 (1998).  51.  Morgunova, E., Tuuttila, A., Bergmann, U., Isupov, M . , Lindqvist, Y . , Schneider, G. and Tryggvason, K . Structure of Human Pro-Matrix Metalloproteinase-2: Activation Mechanism Revealed. Science 284, 1667-70 (1999).  52.  Massova, I., Kotra, L . P., Fridman, R. and Mobashery, S. Matrix Metalloproteinases: Structures, Evolution, and Diversification. Faseb J 12, 107595 (1998).  53.  Bigg, H . F., Clark, I. M . and Cawston, T. E. Fragments of Human Fibroblast Collagenase: Interaction with Metalloproteinase Inhibitors and Substrates. Biochim Biophys Acta 1208, 157-65 (1994).  54.  Steffensen, B., Wallon, U . M . and Overall, C. M . Extracellular Matrix Binding Properties of Recombinant Fibronectin Type Ii-Like Modules of Human 72-Kda Gelatinase/Type Iv Collagenase. High Affinity Binding to Native Type I Collagen but Not Native Type Iv Collagen. J Biol Chem 270, 11555-66 (1995).  55.  Wallon, U . M . and Overall, C. M . The Hemopexin-Like Domain (C Domain) of Human Gelatinase a (Matrix Metalloproteinase-2) Requires Ca2+ for Fibronectin and Heparin Binding. Binding Properties of Recombinant Gelatinase a C Domain to Extracellular Matrix and Basement Membrane Components. J Biol Chem 272, 7473-81 (1997).  56.  Schnierer, S., Kleine, T., Gote, T., Hillemann, A., Knauper, V . and Tschesche, H . The Recombinant Catalytic Domain of Human Neutrophil Collagenase Lacks  Type I Collagen Substrate Specificity. Biochem Biophys Res Commun 191, 31926 (1993). 57.  Lauer-Fields, J. L., Tuzinski, K. A., Shimokawa, K., Nagase, H . and Fields, G. B. Hydrolysis of Triple-Helical Collagen Peptide Models by Matrix Metalloproteinases. / Biol Chem 275, 13282-90 (2000).  58.  Gioia, M . , Fasciglione, G. F., Marini, S., D'Alessio, S., De Sanctis, G., Diekmann, O., Pieper, M . , Politi, V., Tschesche, H . and Coletta, M . Modulation of the Catalytic Activity of Neutrophil Collagenase Mmp-8 on Bovine Collagen I. Role of the Activation Cleavage and of the Hemopexin-Like Domain. J Biol Chem 211, 23123-30 (2002).  59.  Harris, E. D., Jr. and Krane, S. M . Collagenases (Second of Three Parts). N Engl J Med 291,605-9(1974).  60.  Fields, G. B. A Model for Interstitial Collagen Catabolism by Mammalian Collagenases. J Theor Biol 153, 585-602 (1991).  61.  Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. Gapped Blast and Psi-Blast: A New Generation of Protein Database Search Programs. Nucleic Acids Res 17, 3389-402 (1997).  62.  Boeckmann, B., Bairoch, A., Apweiler, R., Blatter, M . - C , Estreicher, A., Gasteiger, E., Martin, M . J., Michoud, K , O'Donovan, C , Phan, I., Pilbout, S. and Schneider, M . The Swiss-Prot Protein Knowledgebase and Its Supplement Trembl in 2003. Nucleic Acids Res 31, 365-370 (2003).  64  2.6 List of  Abbreviations  APMA  4-aminophenylmercuric acetate  ATP  adenosine triphosphate  Brij  polyoxyethylene moholauryl ether  CAB  collagenase assay buffer  CBD  collagen binding domain  CHO  Chinese hamster ovary  CXCR2  C X C chemokine receptor 2  DMEM  Dulbecco's Modified Eagle Medium  Dpa  3-(2,4-dinitrophenyl)-L-2,3-diaminopripionyl  FAB  fluorescence assay buffer  hCMV  human cytomegalovirus  Mca  (7-methoxycoumarin-4-yl)acetyl  MMP  matrix metalloproteinase  MT-MMP  membrane-type M M P  PAGE  polyacrylamide gel electrophoresis  PBS  phosphate-buffered saline  PCR  polymerase chain reaction  PDB  Protein Data Bank  QF24  quenched fluorescent peptide (7-methoxycoumarin-4-yl)acetyl-Pro-LeuGly-Leu-[3-(2,4-dinitrophenyl)-L-2,3-diaminopropionyl]-Ala-Arg-NH2  RO200-1770 2-hydroxy-5-[4-(2-hydroxy-ethyl)-piperidin-l-yl]-5-phenyl-lHpyrimidine-4,6-dione SDS  sodium dodecyl sulphate  TIMP  tissue inhibitor of metalloproteinases  Tris  tris (hydroxymethyl) aminomethane  Tween  polyoxyethylene 20-sorbitan monolaurate  Table 2.1. MMP-8 mutagenesis primers. The segment of the protein and coding sequence for MMP-8 is shown with amino acid targets of site-directed mutagenesis denoted by asterisk (*). Complementary oligonucleotide pairs for each site-directed mutant are listed with the coding primer aligned to the coding sequence. Modified nucleotides are underlined and altered codons are shown in bold. The resulting mutant residue is identified above the mutant codon in italics.  cr CD"  c/>  Oligonucleotide  Mutant  Q. 181  Wildtype Sequence  * T  5 ' - A C A  W  T  N  T  S  *  A  *  N  Y  * N  L  F  L  V  A  A  H  204 E  F  G  T G G A C C A A C A C C T C C G C A A A T T A C A A C T T G T T T C T T G T T G C T G C T C A T G A A T T T  H  S  L  G G C C A T T C T T T G  G  GGG-3'  Tl CO"  c  CO  N188G  G A C A A C T T G T T T C T T G T T G C  3 ' 3 '  G G A C C A A C A C C T C C G C A  5'  G C A A C A A G  A A A  GGT  C A A G T T G T A A C C T G C G G A G G T G T T G G T C C  5'  K N188K  5' G G A C C A A C A C C T C C G C A AAG T A C A A C T T G T T T C T T G T T G C 3' 5'  G C A A C A A G  A A A  C A A G T T G T A C T T T G C G G A G G T G T T G G T C C  3'  L  N188L  5' G G A C C A A C A C C T C C G C A CTT T A C A A C T T G T T T C T T G T T G C 3' 5'  G C A A C A A G A A A  C A A G T T G T A A A G  T G C G G A G G T G T T G G T C C  3 '  A  Y189A  '  5  c  5'  c  A  A  C A  C  C T  C  C G  C  A A  A  G C A G C A A C A A G A A A  T  A  A  C T  T  G T  T  T C  T  T G  T  T G  C  T G  C  3  '  C A A G T T G G C A T T T G C G G A G G T G T T G G  3'  F  Y189F  5  '  5'  c  c  A  A  C A  C  C T  C  C G  G C A A C A A G A A A  C  A A  A  T T  5  C A  A  C A A G T T G A A  C T  T  G T  T  T C  T  T G  T  T G  C  3  '  A T T T G C G G A G G T G T T G G  3'  L  |\jigOL  5' C C A A C A C C T C C G C A A A T T A C CTC T T G T T T C T T G T T G C T G C 3' 5'  G C A G C A A C A A G  A A A  C A A G A G G T A A T T T G C G G A G G T G T T G G  3 '  A  E198A  5  '  5'  ON ON  C  T  T G  T  T G  C C A A A G  C  T G  C  T C  A  T G C  A ' " T  I  rG  G  C C  A  T T  C  T T  T  G G  3  '  A A T G G C C A A A T G C A T G A G C A G C A A C A A G  3'  B MMP-1  1 8 3 RWTNNFREYN  MMP-2  183 T.WTL—fcYS  LHRVAAHELGHSLGLSH 209 L F L V A A H E F G H A M G L E H 384  MMP-8  1 8 1 TWTNTSANYN 187 TWTSSSKGYN  LFLVAAHEFGHSLGLAH L F L V A AHEFGHSLGLDH  207  MMP-13 MMP-14  229  mMMP-8  200 PWTVRNEDLNGNDIFLVAVHELGHALGLEH 1 8 1 TWTQDSKNYN L F L V A AHEFGHSLGLSH  rMMP-8  1 8 2 TWTQDSKNYN  LFLV7AA H E F G H S L G L S H  208  213 207  Fig. 2.1. Sequence and location of active site residues of MMP-8. A. Discovery ViewerLight (Accelrys) rendering of the structure of the MMP-8 active site (PDB accession code 1 JAN). The catalytic zinc ion is coordinated to His , His and His , and interacts with a solvent molecule polarized by the active site Glu . Highlighted residues Asn , Tyr and Asn of the S ' substrate specificity subsite were modified by sitedirected mutagenesis as was Glu . B. Partial CLUSTAL W (1.74) multiple sequence alignment of human collagenolytic MMPs: MMP-1 (Swiss-Prot accession number P03956), MMP-2 (P08253), MMP-8 (P22894), MMP-13 (P45452), and MMP-14 (P50281), with mouse MMP-8 (mMMP-8)(O70138) and rat MMP-8 (rMMP8)(088766)(61,62). Numbering commences at the mature secreted zymogen form of the enzyme. For MMP-2 the site of insertion of the 179-residue domain comprised of three fibronectin type II modules is highlighted as CBD (collagen binding domain). In MMP-8 catalytic G l u in the archetypal HEXXHXXGXXH motif is shown in bold in the box. The locations of human MMP-8 residues investigated by site-directed mutagenesis are denoted in bold. 197  201  188  207  189  198  190  3  198  198  67  M (x1Cr ) WT  WB  r  3  N188G N188K  N188L  Y189F  E198A  N188L  162100695238-  B M (x10 ) r  3  60  WT N188G 120 60 120  N188K 60 120  N188L 60 120  Y189F 60 120  E198A 60 120 (min)  16210069-  •pro  52-  • active  38-  Fig. 2.2. Purified recombinant wildtype and mutant MMP-8 proteins. A. 10% SDSPAGE gels of the recombinant and mutant MMP-8 proteins stained with silver. The autolytic 59 kDa active MMP-8 protein band is visible in the wildtype (WT) lane. WB lane, western blot of N188L protein using anti-MMP-8 antibody T25-88. B. Autolytic enzyme activation upon incubation with APMA (1 mM) for 60 or 120 min, 37 °C. The inactive catalytic mutant El98A is not processed to the active form and was included as a control.  68  A  0  1000  2000  3000  4000  5000  Time (s)  B 1.2  WT  N188G  N188K  N188L  Y189F  E198A  Fig. 2.3. MMP-8 hydrolysis of synthetic peptide substrate. A . Progress curves of QF24 (1 uM) substrate cleavage by MMP-8 and mutants, 37 °C. The negative control was the inactive mutant G l u A l a from a separate plate. Dashed lines denote the boundaries of the linear portion in which the initial rate of substrate cleavage was used to calculate the V . B. Specific activity of M M P - 8 mutants assayed against quenched fluorescent peptide substrate (QF24) expressed relative to wildtype (WT) M M P - 8 . Enzyme concentration was determined by active site titration against TIMP-1. 198  m a x  69  A 0  a 2  .5  1 2.5  5  N188G 10 20 30 40  50 100250  ~*.  0  .08  . 1 5 .3  WT .6 1.2 2 . 4 4 . 8  alA->(-'.  alA-*  — _  a2A~M  a2A-*- -  0 ':  —  _  _  f  N188K  1  9 19 38 75  4  5  6  7  8  9  Y189F 10 12 14 16 18  0  4  5  6  7  8  9  10 12 14 16  18  al .  i  u l A - ^ ^ ^ K L  -  alA-£ J  ,... _ N188L  0  4  7  8  9  10 12 14  16 18 20 10  a2A~*^H  Fig. 2.4. The effect of active site mutants on MMP-8 activity against type I collagen. A. Representative SDS-PAGE gels of collagenase assays. Biotin-labeled type I collagen (100 fmol) was incubated with varying amounts, as indicated (fmol), of wildtype (WT) and mutant MMP-8 proteins for 18 h at 28 °C. Intact collagen a-chains ( a l , a2) and cleavage products ( a l A , a2A) were separated by SDS-PAGE (7.5%) and analysed with streptavidin-coupled Alexa Fluor 680 detection of the biotinylated collagen. B. Specific activity of MMP-8 mutants assayed against type I collagen substrate expressed relative to wildtype MMP-8. Enzyme concentration was determined by active site titration against TIMP-1. 1 unit (U) of activity is defined as the amount of wildtype MMP-8 required to degrade to 50% completion 2 fmol of type I collagen per h, 28 °C. Specific activity is 70 expressed in U-(pmol enzyme" ). 1  CHAPTER 3 -  SUMMARY  3.1 Discussion  and  Conclusions  We have built on the knowledge gathered from many different methods of investigation into the function of MMP-8. Patterns in the sequence homology of M M P s with similar activities and specificities point to conserved residues with potential importance to enzyme structure or function. Structures derived from x-ray crystallography data allow us to visualize the positioning of specific amino acids in the active site cleft and its supporting areas and make informed choices in the selection of candidates for mutation. Previous studies of substrate specificity have proven the importance of enzyme-substrate interactions beyond the P i - P i ' scissile residues, as well as the difference between the general catalytic capabilities of MMP-8 against simple substrates and the capacity of the enzyme for collagen catalysis. Indication of the S 3 ' subsite as a region of importance came from a previously found mutation (rat MMP-8 Asn Lys), with more confirmation 209  as our studies were underway from chimeric protein data and other mutations in the region.  Our results illustrate the complexity of collagenase activity, with multiple determinants contributing to the recognition and cleavage of collagen by MMP-8. Some residues, such as G l u  198  and A s n , are important to the general catalytic competency of the enzyme, 188  while mutation of T y r  189  demonstrates a specific function for this residue in type I  collagen hydrolysis.  Future studies with the mutants I have developed (Appendix A) will aim to further elucidate the role of S 3 ' residues in the collagenase activity of M M P - 8 . The series of site-directed mutants on the catalytically incompetent G l u A l a background will be used I98  in an effort to distinguish the contribution of each residue to substrate recognition and binding. By eliminating the catalytic activity of the mutants, the substrate binding 1  properties of the double mutants in comparison to Glu  QQ  Ala can be investigated without  the interference of substrate catalysis. These results can be compared to findings for  specific mutants in this work. It will be interesting to determine whether Tyr Phe, 189  which was shown to specifically alter collagenolysis, has disrupted collagen binding ability or if the decrease in mutant activity might be attributed to involvement in the triple helicase activity of the enzyme.  With the advent of proteomics, degradomics and other innovative approaches to discovering the in vivo substrates of proteases, there will surely be new insights into the physiological and pathological role of MMP-8 (1). Building on this information and the knowledge garnered from structural and mechanistic studies of the enzyme will advance the development of therapeutics for diseases such as arthritis.  3.2  References  1.  Lopez-Otin, C. and Overall, C. M . Protease Degradomics: A New Challenge for Proteomics. Nat Rev Mol Cell Biol 3, 509-19 (2002).  73  APPENDIX A  Summary of all constructs developed by site-directed mutagenesis or by subcloning with restriction digest. 1. Full length MMP-8 mutants (encoding both catalytic and hemopexin C domains): Enzyme MMP-8 (Wildtype)  Partial protein sequence (residues 181-207) TWTNTSANYNLFLVAAHEFGHSLGLAH  Mutant Construct MMP-8 (A187L) MMP-8 (N188G) MMP-8 (N188K) MMP-8 (N188L) MMP-8 (Y189A) MMP-8 (Y189F) MMP-8 (N190L) MMP-8 (F192H/L193R) MMP-8 (El98A) MMP-8 (E198D) MMP-8 (A187L/E198A) MMP-8 (N188G/E198A) MMP-8 (N188K/E198A) MMP-8 (N188L/E198A) MMP-8 (Y189A/E198A) MMP-8 (Y189F/E198A) MMP-8 (N190L/E198A) MMP-8 (F192H/L193R/E198A)  TWTNTSLNYNLFLVAAHEFGHSLGLAH TWTNTSAGYNLFLVAAHEFGHSLGLAH TWTNTSAKYNLFLVAAHEFGHSLGLAH TWTNTSALYNLFLVAAHEFGHSLGLAH TWTNTSANANLFLVAAHEFGHSLGLAH TWTNTSANFNLFLVAAHEFGHSLGLAH TWTNTSANYLLFLVAAHEFGHSLGLAH TWTNT SANYNLHRVAAHE FGH S LGLAH TWTNT SANYNL F LVAAHAFGH S LGLAH TWTNT SANYNL F LVAAHDFGH S LGLAH TWTNTSLNYNLFLVAAHAFGHSLGLAH TWTNTSAGYNLFLVAAHAFGHSLGLAH TWTNTSAKYNLFLVAAHAFGHSLGLAH TWTNT SALYNLF LVAAHAFGH S LGLAH TWTNT SANANL F LVAAHAFGH S LGLAH TWTNT SANFNL F LVAAHAFGH S LGLAH TWTNT SANYLL F LVAAHAFGH S LGLAH TWTNT SANYNLHRVAAHAFGH SLGLAH  Underlined residues indicate replacements made by site-directed mutagenesis. A l l double/triple mutants were developed by introducing secondary mutations onto the E l 9 8 A background. Additional sense and antisense oligonucleotides for site-directed mutagenesis of mutants not described in the body of the thesis (*) are listed in the table below. Mutant  Oligonucleotides  MMP-8 (A187L)  5'  C A T GGA C C A A C A C C T C C C T A A A T T A C A A C T T G T T T C T T G T T G C  5'  GCA ACA AGA AAC AAG T T G T A A T T T AGG GAG GTG T T G GTC CAT G  5' 5' 5' 5'  CCG CAA A T T ACA ACT TGC ATC GTG T T G CTG CTC A T G  MMP-8 (F192H/L193R) MMP-8 (E198D)  CAT GAG CAG CAA CAC GAT GCA AGT T G T AAT T T G CGG G T T C T T G C T G C T C A T GAC T T T GGC C A T T C T T T G G C C A A A G A A T GGC C A A A C T C A T GAG C A G C A A C A A G  3' 3''  3' 3'  3' 3'  74  2. Domain truncation mutants produced by site-directed mutagenesis: M M P - 8  (G242U)  Truncated protein consisting o f only the catalytic d o m a i n developed b y site-directed  introduction  of a stop c o d o n to replace G 2 4 2 M M P - 8  (G242U/E198A)  Truncated protein consisting o f only the catalytic d o m a i n developed b y site-directed  introduction  of a stop c o d o n to replace G 2 4 2 o n a n inactive mutant E l 9 8 A  background  Oligonucleotides  Mutant M M P - 8  5' 5'  (G242U)  TTC  AGG  CCA  TCT  ATT  GAC  TTT  CAA  GCA  ACC  C 3'  GGG T T G  CTT  GAA  AGT  CAA  TAG  ATG  GCC  TGA  ATG  C 3 '  GCA  3. Domain truncation mutants produced by PCR subcloning: Truncated protein consisting o f only the linker  M M P - 8 - L C D  and hemopexin C domain Truncated protein consisting o f only the  M M P - 8 - C D  hemopexin C domain  Mutant  Primers  M M P - 8 - L C D  '  5  GAGC (G*CTAGC) C T T T C A A G C A A C C C T A T C C A A C C  3'  5' primer encoding Nhel restriction site (recognition sequence bounded by parentheses, restriction cleavage site denoted by *) 5'  CCAG(CTGCA*G)TCAGCCATATCTACAGTTAAGCC  3'  3' primer encoding Pstl restriction site M M P - 8 - C D  5  '  GAGC (G*CTAGC) CCCTGTGACCCCAGTTTGACA  3 '  5' primer encoding Nhel restriction site 5'  CCAG(CTGCA*G)TCAGCCATATCTACAGTTAAGCC  3'  3' primer encoding Pstl restriction site  M M P - 8 - L C D parameters:  and M M P - 8 - C D  mutants were constructed b y P C R amplification  72 °C) o f L C D and C D domains f r o m full-length M M P - 8 plasmid.  (cycling  6 0 s at 9 5 ° C f o l l o w e d b y 3 0 c y c l e s o f 3 0 s at 9 5 ° C , 3 0 s at 5 5 ° C a n d 3 0 s at coding sequences i n p G W I H G  P C R products w e r e blunt-end ligated into P C R - S c r i p t ™ C a m vectors asper k i t  instructions (Stratagene) f o l l o w e d b y  NhellPstl  digestion and ligation into  p G Y M X  plasmid (1).  1.  Steffensen, B . , W a l l o n , U .M . a n d O v e r a l l , C .M . E x t r a c e l l u l a r M a t r i x  Binding  Properties o f Recombinant Fibronectin T y p e II-Like M o d u l e s o f H u m a n Gelatinase/Type I V Collagenase. H i g h Affinity B i n d i n g to Native T y p e C o l l a g e n but N o t N a t i v e T y p e I V C o l l a g e n .  J Biol Chem 270,  72-Kda I  11555-66  (1995).  APPENDIX B  Sample active site titration curve and calculations. .1  0.4  g  0.35 4  n  0  1  2  3  4  5  6  7  TIMP-1 (nM)  To determine the amount of activated enzyme by active site titration, the V of QF24 cleavage (as measured from the initial rate of fluorescence product formation after addition of enzyme, excitation 320 nm / emission 405 nm) was graphed vs. TIMP-1 concentration. Since TIMP-1 binds MMP-8 in a 1:1 stoichiometric ratio, the x-intercept of the linear regression line to the linear range of the plot is the molar equivalent of active enzyme present (1). The regression line is extrapolated beyond the range of measured data points since higher concentrations of inhibitor lead to a plateau of data points which do not fall in the linear range. m a x  1.  Willenbrock, F., Crabbe, T., Slocombe, P. M . , Sutton, C. W., Docherty, A . J., Cockett, M . I., O'Shea, M . , Brocklehurst, K., Phillips, I. R., and Murphy, G. The Activity of the Tissue Inhibitors of Metalloproteinases Is Regulated by C-Terminal Domain Interactions: A Kinetic Analysis of the Inhibition of Gelatinase A . Biochemistry 32, 4330-7 (1993).  76  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091466/manifest

Comment

Related Items