Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A Role for CpG methylation mediated epigenetic transcriptional silencing during olfactory neuronal development Gin, Christopher S.W. 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-0462.pdf [ 12.03MB ]
Metadata
JSON: 831-1.0091465.json
JSON-LD: 831-1.0091465-ld.json
RDF/XML (Pretty): 831-1.0091465-rdf.xml
RDF/JSON: 831-1.0091465-rdf.json
Turtle: 831-1.0091465-turtle.txt
N-Triples: 831-1.0091465-rdf-ntriples.txt
Original Record: 831-1.0091465-source.json
Full Text
831-1.0091465-fulltext.txt
Citation
831-1.0091465.ris

Full Text

A R O L E F O R C p G M E T H Y L A T I O N M E D I A T E D E P I G E N E T I C T R A N S C R I P T I O N A L S I L E N C I N G D U R I N G O L F A C T O R Y N E U R O N A L D E V E L O P M E N T By Christopher SW Gin B.Sc., The University of British Columbia, 2004 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF M A S T E R OF S C I E N C E In T H E F A C U L T Y OF G R A D U A T E STUDIES (Department of Psychiatry, Neuroscience Program) We accept this thesis as conforming to the required standard The University of British Columbia July 2004 ©Christopher SW Gin, 2004 THE UNIVERSITY OF BRITISH COLUMBIA FACULTY OF G R A D U A T E STUDIES CT Library Authorization In presenting this thesis in partial fulfillment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Name of Author (please print) _ / J J ? i . „ \ Date (dd/mm/yyyy) Title of Thesis A tole Cf& M/rfJiyl*ht*\ M'Jlcvfci n .... ' . A L L „ L ' / \L.. . L ,A T V . . . . / . - . J Degree: Department of The University Vancouver, BC Canada Year: 4 of British Columbia ' Abstract Epigenetic control of chromatin structure plays a critical role in regulated transcriptional silencing in eukaryotes (L i 2002). It is associated with the inaccessibility of D N A to transcription promoting factors and is critical for gene regulation during development. D N A methylation is a mechanism of epigenetic control and leads to the silencing of genes directly by blocking transcription factors from binding to promoters and indirectly by recruiting chromatin remodelling complexes leading to chromatin condensation and exclusion of transcription factors from their binding sites. We have identified Dnmt3b as a gene that is upregulated following bulbectomy induced neurogenesis in the mouse. D N M T 3 b is a de novo methyltransferase which can methylate previously unmethylated genomic D N A . New patterns o f methylation give rise to new patterns of stable and heritable transcriptional silencing. De novo methylation and the establishment of new methylation patterns may play a role in cell lineage refinement and cellular differentiation, silencing genes that are no longer needed in a cell lineage. Here we have examined i f D N A methylation may be a potential regulator of olfactory receptor neuron development. In silico analysis of O R gene clusters showed that functional O R genes are not associated with C p G motifs of characteristically high or characteristically low methylation density suggesting that dynamic control of CpGs is a potential controller of O R gene expression during O R N development. In vivo analysis showed that both D N M T 3 b and the other known de novo D N A methyltransferase, D N M T 3 a are expressed in the olfactory epithelium from E l 1 to i i adulthood and that they are differentially and sequentially expressed by O R N s at different stages of maturation during development. We have previously generated an in vitro model of O R N development to help us understand O R N developmental events. Analyses of D N M T 3 b expression in the OP27 olfactory receptor cell line show that D N M T 3 b is not recruited to D N A replication forks. D N M T 3 b is thus not l ikely to be involved in maintenance methylation and may therefore be involved in mediating changes in transcriptional competence during O R N differentiation. i i i Table of Contents Abstract ii Table of Contents iv List of Tables vi List of Figures vii List of Abbreviations viii Acknowledgments ix Chapter 1: Introduction 1 D N A Methylation Mediated Gene Silencing 3 The De Novo D N A Methyl transferases 12 D N M T 1 12 D N M T 3 a and D N M T 3 b 14 D N M T 2 and DNMT31 16 Epigenetic Silencing During Development and Cellular Differentiation 17 The Olfactory Epithelium: Anatomy and Adult Neurogenesis 21 Epigenetic Regulation of Olfactory Receptor Gene Expression in Olfactory Receptor Neurons 27 Proposal Summary and A ims 29 Chapter 2: Materials and Methods 31 C p G Island and B l repeat mapping 31 D N M T Primer Design 31 R T - P C R 32 Embedding and sectioning of mice 33 Immunohistochemistry 33 Immunofluoresence 34 Immunocytochemistry 35 Cel l Counts 36 Synchronization of OP27 cells in G 1/S phase 36 Cel l Cycle Analysis by Fluorescence Activated Ce l l Sorting 37 Chapter 3: Results 38 3.1 Association of O R genes with C p G rich genomic elements 38 Introduction 38 C p G islands are not associated with functional O R genes 40 B l repetitive elements are not associated with functional O R genes 44 Summary 47 3.2 Characterization of D N M T isoforms in the developing olfactory epithelium 49 Introduction 49 D N M T 1 , D N M T 2 , D N M T 3 a , and D N M T 3 b are expressed in the olfactory epithelium as early as E l 1 and persist into adulthood 50 Summary 54 3.3 In V i vo Characterization of D N M T 3 b and D N M T 3 a in the Developing Olfactory Epithelium , 55 Introduction 55 iv D N M T 3 b is expressed by presumptive globose basal cells in the adult olfactory epithelium 56 D N M T 3 b is expressed in the S-phase of a sub-population of proliferating progenitors in the O E during embryonic development into adulthood 59 D N M T 3 a is expressed in a subset of immature and mature olfactory receptor neurons 64 D N M T 3 a is expressed in post-mitotic immature olfactory receptor neurons at terminal differentiation into mature olfactory receptor neurons but not immediately after assumption of the neural cell fate 69 Histone deacetylase 2 is expressed in a sub-population of D N M T 3 b positive presumptive G B C s , through the immature O R N layer, and into a subpopulation of D N M T 3 a positive O R N s 73 Expression of D N M T 3 b and D N M T 3 a in other systems show parallels to their expression in the O E 75 Summary 80 3.4 Characterization of D N M T s in the OP27 Cel l L ine, a Conditionally Immortalized Cel l line from the Embryonic Mouse Olfactory Placode 83 Introduction 83 D N M T 1 , D N M T 2 , and D N M T 3 b are expressed in the olfactory receptor neuron cell line OP27 and D N M T 1 , D N M T 2 , D N M T 3 a , and D N M T 3 b are expressed in olfactory receptor neuron cell line OP6 85 D N M T 3 b splice variants D N M T 3 M and D N M T 3 b 4 are expressed in the olfactory receptor neuron cell lines OP27 and OP6 85 D N M T 3 b is not sequestered to replication foci in S-phase OP27 cells 88 Summary 91 Chapter 4: Discussion 92 Conclusions 115 References 117 Appendix A 125 Appendix B 132 v List of Tables Table 1: R T - P C R Primer Pairs and Melt ing Temperatures 32 Table 2: Sources and Dilutions of Primary Antibodies 35 Table 3: Sources and Dilutions of Secondary Antibodies 36 Table 4: C p G Islands are Highly Correlated with the Transcriptional Start of Genes 43 Table 5: B l Repetitive Elements are Weakly Associated with O R genes 46 v i List of Figures Figure 1: Catalytic Methylation of Cytosine 4 Figure 2: D N A Methylation can El ic i t Transcriptional Silencing Directly and Indirectly 6 Figure 3: Domain Structure of D N M T s and Interacting Proteins 13 Figure 4: Cellular Organization of the Adult Olfactory Epithelium 23 Figure 5: Lineage Refinement in the Olfactory Epithelium 26 Figure 6: Genomic Mapping of Functional O R Genes and in silico Identification of C p G Islands 42 Figure 7: Genomic Mapping of Functional O R Genes and in silico Identification of B l Repetitive Elements 45 Figure 8: R T - P C R Detection of D N M T 1, 2, 3a and 3b Expression in the Olfactory Epithelium at Progressive Stages of Murine Development....51 Figure 9: Coding Exon Structure of D N M T 3 b and R T - P C R Detection of D N M T 3 b Splice Isoform Expression in the Olfactory Epithelium at Progressive Stages of Murine Development 53 Figure 10: Co-detection of D N M T 3 b and Cell-Type Specific Antigenic Markers in the Adult Olfactory Epithelium 57 Figure 11: D N M T 3 b Expression in Proliferating Cells in the P5 O E 60 Figure 12: Cellular Expression of D N M T 3 b in the O E at E17, P5, and in Unilateral Bulbectomies 63 Figure 13: Numbers of D N M T 3 b Expressing Cells in the Ap ica l , Middle, and Basal Regions of the E l 7 and P5 O E 65 Figure 14: Co-detection of D N M T 3 a and Cell-Type Specific Antigenic Markers in the Adult and P5 Olfactory Epithelium 66 Figure 15: Cellular Expression of D N M T 3 a in the O E at E l 7 , P5, and in Unilateral Bulbectomies 70 Figure 16: Numbers of D N M T 3 a Expressing Cells in the E17 and P5 O E 71 Figure 17: Expression of Histone Deacetylase 2 with D N M T 3 b , D N M T 3 a , and P C N A in the E l 7 , P5 and Adult O E 74 Figure 18: D N M T 3 b and D N M T 3 a expression in the sub ventricular zone and in the developing olfactory bulb 77 Figure 19: D N M T 3 b and D N M T 3 a Expression in the Developing Vomeronasal Organ, , Retina, Taste Pits, and Thymus 78 Figure 20: Sequential expression of D N M T 3 b , H D A C 2 , and D N M T 3 a during stages of O R N neurogenesis 82 Figure 21: R T - P C R Detection of D N M T 1 , 2, 3a and 3b in Proliferating OP27 and OP6 Cells 86 Figure 22: R T - P C R Assessment of D N M T 3 b Splice Variants in Proliferating OP27 and OP6 Cells 87 Figure 23: Expression of D N M T and P C N A in Proliferating OP27 cells 90 vi i List of Abbreviations 5 - L O X lipooxygenase 5-MeC methylated cytosine A d C 5 - A Z A - 2 ' -deoxycytidine C F U colony forming cells D M E M Dulbecco's Modi f ied Eagles Media Dnmt de novo D N A methyltransferase E embryonic day G A P growth associated protein G B C globose basal cell G F A P glial fibrillary acidic protein F A C S fluorescence activated cell sorting H B C horizontal basal cell INP immediate neuronal precursor I R N immature receptor neuron M l Mash-1 expressing cell M B D methyl binding domain M e C P methyl-CpG M O R N mature olfactory neuron N S T neuron specific B i l l tubulin H A T histone acetyl-transferase H D A C histone deacetylase O B olfactory bulb O E olfactory epithelium O M P olfactory marker protein OP olfactory placode O R N olfactory receptor neuron P postnatal day P B S phosphate buffered saline P F A paraformaldehyde Sus Sustentacular T E R T telomerase reverse transcriptase T C R T-cell receptor T C tissue culture V N O vomeronasal organ V N O E vomeronasal epithelium V N R N vomeronasal receptor neuron vi i i Acknowledgments I would like to thank my friends and family for their support and encouragement. I would especially like to thank my supervisor Dr. Jane Roskams for her guidance and support, and for being a great inspiration and role model both inside and outside the field of science. I would also like to extend my gratitude towards the members of my laboratory: Jessica MacDonald, Edmund A u , Barbara Murdoch, Christine Carson, Nicole Janzen, France Fung, Er in Currie, and Andrea Griffiths for technical support. I would also like to acknowledge Dr. Frank Margolis for the O M P antisera. Lastly I would like to acknowledge the Natural Science and Engineering Research Counci l of Canada for awarding me with a N S E R C P G S A studentship. ix Chapter 1: Introduct ion With few exceptions the genomic content of any individual cell in a multi-cellular organism is indistinguishable. The identity of a cell is ultimately established by the transcription of specific genes and the absence of transcription of all other genes. Although the mechanistic and regulatory aspects of gene activation have been highly studied, gene silencing is not as thoroughly understood. The long-standing basic model of transcriptional activation involves the expression of specific transcription activating factors which recognize and bind to the promoters of specific genes. The bound transcription factors then help initiate gene transcription by recruiting the R N A polymerase transcription complex. B y default the reverse of this model, the absence of the appropriate transcription factors, has long been the accepted explanation to the selective absence of gene transcription. However, the demands of this model, having a repertoire of transcription factors large enough to satisfy every unique gene in the genome, as a means to the transcriptional diversity of eukaryotes is inefficient and excessive. The field of epigenetics has re-emerged as another layer of control behind transcriptional silencing and partially accounts for the smaller than expected repertoire of transcription factors in the genome. Epigenetics refers to changes in gene expression independent of transcription factor expression and without modifications to D N A sequence (Wolffe and Matzke 1999). In practice, the term is often used in reference to changes, and the processes resulting in changes to chromatin structure which impacts the \ transcriptional competence of the local genome, most often through regulating the accessibility of transcription factor binding sites. In the past decade, the link between epigenetics and other areas of research such as oncogenesis, nuclear cloning, X -inactivation, and cellular differentiation has come to light and brought about renewed interest and earnest study. The mechanism of epigenetic gene silencing is now known to involve a multi-step self-reinforcing process involving numerous proteins and numerous mechanisms of action. A key characteristic of epigenetics is thatthe transcriptional competence of a cell , as determined by epigenetic mechanisms, is faithfully inherited by its daughter cells (Robert, Mor in et al. 2003). This method is used by terminally differentiated somatic cells when they proliferate to maintain a population of cells. However, changes to the epigenetic character that occur during a cell 's life can also produce daughter cells with novel identities from that of the founding cell. Various forms of cancer are thought to result from aberrant epigenetic changes to somatic cells affecting the expression of proteins which regulate cell proliferation. One example of this is aberrant methylation and silencing of the integrin alpha4 gene in gastric cancer (Park, Song et al. 2004). Programmed changes to epigenetic character are also important during development when cell fates are refined to faithfully silence genes which are no longer needed in its cell lineage (L i 2002). However, it is not known how specific genes are targeted for epigenetic change during these programs. It is widely believed though, that the opening step leading to epigenetic change involves the establishment of new D N A methylation patterns. 2 D N A Methylat ion Mediated Gene Silencing-Covalent methylation at the 5' carbon of the cytosine residue in a C p G dinucleotide pair is a common modification of eukaryotic genomes (Figure 1). Interestingly, methylated cytosines (5-MeC) are innately unstable in comparison to their unmethylated counterparts and spontaneously undergo hydrolytic deamination to become a thymidine residue (Coulondre, Mi l le r et al. 1978). Since the G -T mismatch created by the deamination is recognized by D N A mismatch repair enzymes and reversed with a 50% chance of maintaining the original code, over time the proportion of C p G dinucleotides in the genome, particularly within intergenic sequences, is expected to decrease. True to form, the mammalian genome is relatively depleted in C p G dinucleotides (L i , Beard et al. 1993). The fact that intronic CpGs do persist in the genome despite their tendency towards methylation and subsequent base conversion is a testament to the functional importance of C p G dinucleotides. Evidence has accumulated suggesting an inverse correlation between the state of C p G methylation and transcriptional activity (Yeiv in and Razin 1993). Art i f ic ial demethylation of reporter genes results in gene activation whereas methylation of gene promoter sequences results in gene silencing (Razin ad Cedar 1991) . The majority of unmethylated C p G dinucleotides are found clustered together in C p G islands, genomic loci where the local density of C p G dinucleotides is elevated over the genomic average. C p G islands are predominantly found upstream of constitutively expressed housekeeping genes within the promoter regions of the genes and often extending into the first coding exon (Gardiner-Garden and Frommer 1987). C p G islands are thus associated with loci of active transcription (Cross and B i rd 1995; Siegfried and Cedar 1997). Furthermore, C p G 3 Figure 1: Catalytic Methylation of Cytosine A D N A methyltransferase (S -DNMT) facilitates the methylation of cytosine by forming a bond with the 6 t h carbon. In this state, the 5 t h carbon of cytosine is able to acquire the methyl group from s-adenosyl methionine. Once the methyl group is acquired, the D N A methyltransferase is released. 4 islands show conservation across vertebrate species, located in the same position relative to the transcription unit of orthologous genes (Eden and Cedar 1994). In comparison, methylation of C p G dinucleotides in the promoter region of genes such as glial fibrillary acidic protein (GFAP) is associated with transcriptional silencing (Condorell i, Del l 'Albani et al. 1997). Aberrancies in C p G methylation are often associated with misregulation of genes and are linked with the development of cancer. In addition, the pattern and placement of D N A methylation has also been shown to be important in gene silencing. The position, length, and density of methylated cytosines are allfactors in determining the efficiency of transcriptional repression (Boyes and B i rd 1992; Kass, Goddard et al. 1993; Hsieh 1994). D N A methylation is now known to cause transcriptional silencing in two different ways, one independent of other cofactors and the other in concert with other proteins (Figure 2). Methyl groups protruding into the major groove of the D N A double helix, where many D N A binding proteins dock, sterically block transcription factors from binding. Using artificially methylated gene constructs it has been demonstrated that several transcriptional regulators such as A P - 2 , c -Myc /Myn , E2F , and N F - k B are sensitive to direct methylation of C p G dinucleotides in their gene response element, the residues that are bound to by the transcription factors (Kovesdi, Reichel et al. 1987; Iguchi-Ariga and Schaffner 1989; Bednarik, Duckett et al. 1991; Eden and Cedar 1994). In addition, studies on the interaction between C R E B and the c A M P response element, the immunologic-inducing>roperties of methylated and non -methylated D N A constructs, and in silico molecular models of D N A show that methylation of C p G dinucleotides 5 A B Me Me Me Me - Me Me Me Me c Me Me Me Me Wk%%- M e M e Me Pv Figure 2: DNA Methylation can Elicit Transcriptional Silencing Directly and Indirectly (A) Recruitment of transcription activating factors and enhancers (purple triangle) to the promoter of a gene induces transcription. (B) Methylation of the CpG dinucleotides (Me) at the binding motif of transcription activating factors and enhancers directly blocks transcription activating factors and enhancers from binding, stopping gene transcription. (C) Protein complexes containing a methyl DNA binding domain protein (M) are recruited to methylated cytosines. HDACs (H) recruited as part of these complexes deacetylate the core histones of the nucleosome resulting in chromatin compaction which renders the transcription factor binding sites inaccessible, stopping gene transcription. 6 reduces the flexibil ity of the local D N A . This hinders the ability of the D N A to make the slight conformational changes necessary to form a tight interaction to the D N A binding site of the transcription factor (Heinemann, Al ings et al. 1992; Marcourt, Cordier et al. 1999; Kr ieg 2000; Derreumaux, Chaoui et al. 2001; Nathan and Crothers 2002). The direct effect of C p G methylation on the promoter or enhancer of a gene is thought to make up only a minor component of C p G methylation mediated gene silencing. The major component is through an indirect mechanism where methylated D N A acts as a molecular flag, recruiting effector proteins to the appropriate genomic loci (Figure 2). The effector proteins then exert their effect on transcription by regulating higher order chromatin structure, changing the packing state so that it is inaccessible to transcription-activating factors. Within the interphase nucleus, the packing state o f the D N A within each chromatid is inconsistent. Some areas are densely packed and other areas are loosely packed. These packing states are dubbed heterochromatin and euchromatin and are directly l inked to the transcriptional activity within that region. In general, compact heterochromatin corresponds to transcriptionally silent genomic areas and makes up approximately 10% of the interphase chromosome, mostly near the centromeres and the ends of the chromosomes. Loosely packed euchromatin is more disposed to transcription, however, only 10% of euchromatin is thought to be actively transcribed or available for transcription (Heitz 1929; Frenster, Al l f rey et al. 1963). This discrepancy is due to the fact that it is the nucleosomal structure of the euchromatic chromatid, not the 7 gross microscopic morphology of D N A which is a more accurate determinant and identifier of a loci 's disposition to transcription (Wolffe 1997). The nucleosome is composed of D N A wound around a core of histone proteins (HI , H2a, H2b, H3 , and H4). Histones were long thought to be inert components of the nucleosome. It is now known that a variety of post-translational covalent modifications to the tail domains of histone proteins which protrude from the core of the protein can affect gene transcription. Modifications which have been demonstrated to have downstream effects on transcription include acetylation, ADP-ribosylat ion, sumomylation, and methylation (Henry, Wyce et al. 2003; Shiio and Eisenman 2003). The culmination of these modifications and their effect on transcription independently, or through downstream interpretation by histone tail binding proteins is known as the histone code. The connection between C p G methylation and the histone code was made by the recent identification of six mammalian C p G binding proteins. These proteins are able to bind to methylated D N A and also complex with histone modifying proteins. The founding member of this group of proteins, M e C P 2 has demonstrated the ability to bind methylated C p G sites in vivo and in vitro (Nan, Campoy et al. 1997). Other proteins from the methyl binding domain family of proteins (MBDs) , M B D 1 , M B D 2 , M B D 3 , and M B D 4 were subsequently identified by sequence identity to the methyl binding domain of M e C P 2 . Biochemical fractionations and immunoprecipitations of the M B D s led to the identification of other proteins which complex with M B D s directly or indirectly and which have characterized catalytic functions affecting gene transcription. M B D 2 for example is known to be a component of the N u R D complex which also includes M i -2 8 and histone deacetylase 1 and 2 ( H D A C 1 , H D A C 2 ) (Bowen, Fujita et al. 2004). M e C P 2 interacts with Sin3a and also H D A C 1 and H D A C 2 (Nan, Cross et al. 1998; Nan, N g et al. 1998). M i -2 and Sin3a are ATP-dependent chromatin remodelling enzymes (Bowen, Fujita et al. 2004). They introduce superhelices into the D N A which can alter the accessibility of the chromatin to transcription factors. H D A C 1 and 2 catalyze the removal of acetyl groups from the tails of histone proteins H3 and H4 (Wolffe 1997). Changes to the acetylation state of specifichistone H3 and H4 tail residues is the histone modification most frequently associated with C p G methylation. Experiments transfecting artificially methylated gene sequences show that methylation induced the formation of inactive chromatin and caused silencing of the gene (Keshet, Lieman-Hurwitz et al. 1986). In addition, the silenced form is present only after the methylated D N A has formed the inactive chromatin (Buschhausen, Witt ig et al. 1987) and this inactive form cannot be reversed by the presence of a strong transcriptional activator. To confirm the connection between C p G methylation and histone acetylation, studies investigating the association of in vitro transfected methylated and unmethylated reporter gene constructs with acetylated nucleosomes were performed (Kass, Landsberger et al. 1997). Chromatin immunoprecipitation of acetylated histones followed by quantitation of the bound reporter gene showed that more gene constructs were immunoprecipitated in the cells containing the unmethylated construct in comparison to the cells which were transfected with the methylated construct. The amount of gene construct precipitated from the methylated construct cell line was increased by treating the cells with 9 trichostatin A , an inhibitor of H D A C 1 and 2. This experiment establishes the direct relationship between D N A methylation and histone acetylation. It is now known that lysine residues 9, 14, 18, and 23 of the tail of H3 are selectively acetylated at specific cellular states (Wang, Fischle et al. 2004). Bound acetyl groups neutralize the innate positive charge of nucleosomes and buffer the affinity between the nucleosome and negatively charged D N A (Ura, Kurumizaka et al. 1997). The absence of the acetyl group, on the other hand, exposes the positively charged lysines which then presumably forms a tight association with the D N A and excludes transcription factors from binding (Ura, Kurumizaka et al. 1997). The processes of histone acetylation and the converse process, histone deacetylation, are mediated by two families of proteins, the histone acetyl-transferases (HATs) and the histone deacetylases (HDACs) (Berger 1999; Schreiber and Bernstein 2002). The balance of H A T and H D A C activity determines the transcriptional permissiveness of the D N A . To illustrate, chemical inhibition of H D A C s using trichostatin A causes reacetylation of histones in the E2F-1 gene promoter resulting in transcriptional reactivation of E2F-1 (Suzuki, Yokozaki et al. 2000). Shifting the balance of a histone's acetylation state to the non-acetylated or acetylated state can be accomplished in vivo byregulating the balance of H A T and H D A C expression levelsor alternatively, by recruiting H A T s and H D A C s t o selected genomic loci. This regulation is brought about when H D A C containing protein complexes are recruited to methylated C p G sites through the action of methyl-CpG binding proteins. Furthermore, acetylated histone tails have also been demonstrated in yeast to serve as binding sites for bromo-domain containing proteins such as Swi/Snf, and 10 R S C which are additional ATP-dependent chromatin remodelling proteins (Hirschhorn, Bortvinet al. 1995). Research in the past 7 years has demonstrated the three way relationship between C p G methylation, histone acetylation, and chromatin structure. Recently it has been shown that M B D s can also interact with some of the proteins which methylate D N A effectively reversing the order of events discussed previously (Hendrich and Tweedie 2003). Although it is well accepted that D N A methylation and histone modifications are a self reinforcing process, the question of what step comes first, methylation, or histone modification is unclear. Targeting of methyl C p G binding proteins to specific targets is not wel l understood. Methy l -CpG binding proteins do demonstrate some ability to compensate for each other as disruption of singular M B D s in mice are frequently non-fatal (Wade 2001). However, there has to be some extent of target-specificity in methyl-C p G binding proteins as single disruptions of methyl-CpG binding proteins do present aberrant phenotypes, due presumably to a requirement for regulated cell and stage specific M B D expression. In humans, disruption of the Mecp2 gene results in a disorder known as Rett syndrome which is diagnosed as a delayed-onset developmental disorder with symptoms such as retarded psychomotor development (Amir, Van den Veyver et al. 1999; Kriaucionis and Bi rd 2003). Some ways by which methyl-CpG binding proteins can potentially be recruited to gene targets include sequence specificity, co-factors, or differences in the native morphology of the D N A . However, these mechanisms are speculatory. In comparison, it is also not known i f or how the proteins which methylate D N A are targeted to specific genes either. However, it is known that the actions of these 11 proteins are non-redundant and occur early in development (Okano, Be l l et al. 1999). For these reasons it is widely thought thatchanges in epigenetic effects are induced byde novo changes to D N A methylation patterns. The De novo DNA Methyltransferases-DNA methylation is catalyzed by a family o f proteins, the de novo D N A methyltransferases (DNMTs) . These proteins share in common a C O O H domain containing several highly conserved motifs which catalyze methyl group transfer from S-adenosyl-L-methionine to cytosine bases in D N A (Figure 1). DNMT1: Cloning of the founding methyltransferase now known as Dnmt l was accomplished in 1988 (Bestor 1988) . Several D N M T 1 m R N A isoforms are generated by alternative translation initiation codons and by alternative splicing (Deng and Szyf 1998; Gaudet, Talbot et al. 1998). One of the alternative splice variants of D N M T 1 , D N M T l o has a truncation of the regulatory N terminus and is synthesized in the oocyte. D N M T l o is translocated into the nucleus at the 8 cell stage and is thought to maintain the methylation at imprinted alleles (Carlson, Page et al. 1992; Deng and Szyf 1998; Howel l , Bestor et al. 2001). The presence of other D N M T 1 m R N A variants suggests functional differences within the D N M T 1 family. However, alternative protein isoforms other than D N M T l o have not been identified. Targeted disruption of Dnmt l results in global hypomethylation and embryonic lethality (L i , Bestor et al. 1992). Interestingly, despite the knock out of Dnmt l , D N M T 1 -/- ES cell lines still exhibited residual methyltransferase activity, being able to methylate retroviral template sequences de novo. 12 A . DNMT1 Methyltransferase PCNA Replication Zn Polybrorao-1 Domain Binding Foci Binding ^ NLS DNMT3 a HDAC2 DNMT3b MeCP2 B . DNMT2 II C . DNMT 3 a III I I II PWWP ATRX D . DNMT3b DNMT3b HDAC DNMT1 PWWP ATRX r "TI" 1 I I DNMT3a HDAC DNMT1 E . DNMT31 Figure 3: Domain Structure of DNMTs and Interacting Proteins (A) DNMT1 contains an extensive N-terminal regulatory domain. Several domains including the PCNA binding site, replication foci, and nuclear localization signal are associated with DNA synthesis. DNMT1 also contains domains which are critical for forming interactions with proteins involved with epigenetic mechanisms such as DNMT3a, DNMT3b, MeCP2, HDAC2, and HDAC1. (B) DNMT2 contains the full complement of motifs constituting the catalytic DNA methyltransferase domain but is N-terminally truncated and does not have any mapped regulatory domains. (C+D) The PWWP domain of DNMT3a and DNMT3b folds into a putative DNA binding domain. The ATRX homology domain is a protein binding domain. DNMT3a is known to interact with DNMT1, DNMT3b and HDAC. DNMT3b is known to interact with DNMT1, DNMT3a, and HDAC. (E) DNMT31 is homologous to DNMT3a and DNMT3b but is missing two critical motifs in the truncated catalytic C-terminus. It also contains the ATRX homology domain and a HDAC binding site. 13 This suggested that other proteins in addition to DNMT1 were capable of catalyzing D N A methylation. Since then, multiple D N M T family members have been identified. However, comparison of targeted gene knockdowns of these new D N M T family members resulted in minimal functional redundancy (Li, Bestor et al. 1992; Lei, Oh et al. 1996; Okano, Bell et al. 1999). Characterization of the D N M T family members demonstrated unique characteristics with regard to expression levels, expression patterns and target template preference. DNMT1 is the most abundant methyltransferase in mammalian cells and is highly expressed in somatic cells (Robertson, Uzvolgyi et al. 1999). Studies investigating the D N A target preference of DNMT1 shows that it is 5-30 fold more active on a hemimethylated D N A template, D N A that is methylated on the CpG dinucleotide on one strand but not on the complementing GpC, in comparison to an unmethylated D N A template (Bestor 1992; Glickman, Flynn et al. 1997; Yoder, Soman et al. 1997; Pradhan, Bacolla et al. 1999). In addition, DNMT1 has been shown to be sequence non-specifiponly requiring a hemimethylated CpG for it to act and is localized to the D N A replication fork in association with proliferating cell nuclear antigen (Figure 3) (Leonhardt, Page et al. 1992; Chuang, Ian et al. 1997). For these reasons, DNMT1 is believed to be a maintenance methyltransferase functioning to faithfully propagate methylation patterns to the newly synthesized D N A strand during S phase of each round of cell proliferation. D N M T 3 a and D N M T 3 b : The second major group of D N A methyltransferases consists of DNMT3a and DNMT3b. In vitro, DNMT3a and DNMT3b do not exhibit a preference towards hem* methylated D N A or unmethylated DNA. In vivo, large scale de 14 novo methylation is known to occur during early embryogenesis. Endogenous genomic repetitive elements were used as a reference to study the template preference of D N M T 3 a and D N M T 3 b . In the genome these repeat elements are unmethylated in the blastocyst stage but become highly methylated byhe E9.5 embryo. Analysis of these repetitive elements in D N M T 3 knock-out mice show that these sites are slightly undermethylated in Dnmt3b -/- embryos and highly undermethylated in [Dnmt3b -/-, T>nmt3a -/-] embryos (Okano, Be l l et al. 1999). In combination, these results have lead to the common belief that D N M T 3 a and D N M T 3 b are the primary catalysts for methylation of previously unmethylated C p G targets, termed de novo methylation (Okano, Be l l et al. 1999). Although it has been demonstrated that despite D N M T Is preference towards hemi-methylated D N A , its activity on unmethylated D N A is stil l greater than that of D N M T 3 a and D N M T 3 b in vitro, de novo methylation by D N M T 1 has not been demonstrated in vivo (Okano, Be l l et al. 1999). D N M T 3 a is expressed weakly in the ectoderm and mesoderm at E7.5 and in somites and the ventral half of the embryo at E8.5-E9.5. Expression of D N M T 3 a is more significant at E10.5 in the hind l imb, tail, and mesenchymal cells. Expression of D N M T 3 a becomes very weak in adult tissue cells (Okano, X i e et al. 1998; Okano, Be l l et al. 1999). In comparison, D N M T 3 b is expressed much earlier during embryogenesis first appearing in the inner cell mass at E4.5, then in the epiblast at E5.5, and then in the ectoderm, neural ectoderm, and chorionic ectoderm at E7.5 and later is expressed predominantly in the forebrain and eyes (Watanabe, Suetake et al. 2002). Expression of D N M T 3 b in the embryo decreases significantly after E10.5 and is predominantly absent 15 in adult tissue (Okano, Be l l et al. 1999). Knockouts of Dnmt3a and Dnmt3b are also both lethal, Dnmt3a -/- mice die 4 weeks postnatally and Dnmt3b -/- mice die at around E l 1.5 with severe growth deficits and stunted neural tube development (Okano, Be l l et al. 1999). Interestingly, in totipotent embryonic stem cell lines R l and T M A - S 5 , D N M I b is expressed at 17x higher levels than D N M T 3 a (Watanabe, Suetake et al. 2002). This suggests that the function of D N M T 3 a and D N M T 3 b may be distinct during early embryogenesis. D N M T 2 and D N M T 3 I : In addition to D N M T 1 , D N M T 3 a and D N M T 3 b , there are two other D N M T family members, D N M T 2 and DNMT31. D N M T 2 contains the 10 sequence motifs that comprise the catalytic domain of D N A methyltransferases (Okano, X i e et al. 1998; Dong, Yoder et al. 2001). However, D N M T 2 is small relative to the other D N M T s due to a truncation of the regulatory N terminus (Yoder and Bestor 1998). D N M T 2 is expressed at low levels in ES cells and various adult tissues and inactivation of Dnmt2 in ES cells does not cause abnormal growth or morphology. In addition, Dnmt2 -/- ES cells were able to methylate endogenous viral sequences as efficiently as wi ld type cells (Okano, X i e et al. 1998). L ike D N M T 3 a and D N M T 3 b , D N M T 2 also possesses a putative P W W P D N A binding site (Figure 3) (Dong, Yoder et al. 2001). Unt i l recently, D N M T 2 was thought to be catalytically inert. However it has now been demonstrated in that D N M T 2 does have a low level of catalytic activity when over-expressed in vitro. Over-expression of either drosophila D N M T 2 or murine D N M T 2 in drosophila cells results in the methylation of a co-transfected plasmid (Tang, Reddy et al. 2003). However the natural activity of D N M T 2 has not been shown in vivo. It is 16 possible that D N M T 2 serves a function other than de novo or maintenance methylation such as D N A repair. Dnmt31 is sequence similar to the other Dnmt3s. However it lacks several critical motifs in the catalytic D N A methyltransferase domain and does not demonstrate methyltransferase activity. DNMT31 is known to interact with the C-terminal regions of D N M T 3 a and D N M T 3 b (Chedin, Lieber et al. 2002) and co-expression of DNMT31 enhances D N M T 3 a activity but not D N M T 3 b (Chedin, Lieber et al. 2002). It is possible that DNMT31 makes up for its lack of a catalytic domain by recruiting the catalytic activity of the other D N M T 3 s (Margot, Ehrenhofer-Murray et al. 2003). DNMT31 is highly expressed in embryonic stem cells, in the chorion at E7.5 and E8.5 and is down regulated in differentiated erythroid bodies. Surprisingly, Dnmt31 -/- embryos stil l develop normally. Recent work has shown that DNMT31 is highly expressed in oocytes and differentiating spermatocytes and has demonstrated a link between DNMT31 and the establishment of maternal imprints and in spermatogenesis (Hata, Okano et al. 2002). The loci of genes such as Igf2r, P e g l , Peg3, and Snrpn which are methylated in the wi ld type oocyte are free of methylation in the oocytes from DNMT31 -/- adult mice. This leads to aberrant overexpression of these genes in fertilized embryos due to biallelic expression of the gene in the offspring. DNMT31 -/- males are infertile due to failure of the spermatocytes to differentiate. Epigenetic Silencing During Development andC ellular Differentiation-Changing the methylation patterns on D N A is a mechanism for establishing long-term, heritable 17 changes to the transcriptional potential of a cell and its future lineage. This is particularly well-suited to events such as cell fate decisions and cellular differentiation where genes which are not needed in a particular cell lineage are permanently silenced. D N M T 3 b and D N M T 3 a are highly expressed during the stages in development when cell fate decisions are being made and waves of D N A methylation are known to be fundamental in gametogenesis and embryogenesis (Okano, Be l l et al. 1999; L i 2002). Genome wide demethylation occurs in gametogenesis followed by subsequent de novo methylation. A t the end of gametogenesis, observable differences in the state of methylation of the maternal and paternal gametes are evident where spermatocyte D N A is hypermethylated in comparison to oocyte D N A (Monk, Boubelik et al. 1987). From an architectural stand point, the increased methylation status of spermatocyte D N A results in a higher degree of chromatin condensation accommodating the packing of the genetic material into the small sperm head. However, the differences in methylation seen between the maternal and paternal gametes are also differentially specific to gene alleles, setting up gene expression potentials unique to each gamete. In the genesis o f a viable embryo, the contribution of both the genetic materials encased by the oocyte and sperm is needed to form a viable diploid genome (Barton, Surani et al. 1984; Surani, Barton et al. 1984). Once the genetic material is combined, the expression of certain genes is limited to the transcription of those alleles which are unmethylated and thus are dependent on the differential methylation between the two gametes. The allele which is methylated in the paternal genomic material is not expressed but the gene is instead expressed through transcription, from the maternal allele. This phenomenais known as parental imprinting, 18 where the specific expression of an allele of a gene is determined by the parent of origin of the allele (Murphy and Jirtle 2003). Bi-maternal and bi-paternal embryos are not viable and abort early in gestation due to the non-complementing gene expression profiles of the gametes (Walsh, Glaser et al. 1994). The methylation state of the diploid genome undergoes major changes in early embryogenesis. Although demethylation of the genetic material contributed by the sperm and egg both occur after fertilization, the rate of demethylation is germline specific. The paternal genome is rapidly demethylated whereas the maternal genome is demethylated slowly during the first cell cleavages (Mayer, Niveleau et al. 2000; Oswald, Engemann et al. 2000). This difference in demethylation rates could be a reflection of targeted demethylation or of two distinct mechanisms of D N A de-methylation. There are also germline specific differences in the methylation of certain genes. The Igf2r gene is methylated de novo at the 8 cell stage on the maternal genome but not on the paternal genome (Monk, Boubelik et al. 1987). The question of how the cell selectively methylates one gene and not the other is not known but is potentially due to the activity of D N M T l o which is the only D N M T localized to the nucleus at this stage of embryogenesis. However, although D N M T l o is found in the nucleus, the activity of D N M T l o has yet to be demonstrated to be germline specific. Alternatively, methylation can spread from C p G dinucleotides which are methylated to surrounding C p G dinucleotides which are not (K im, N i et al. 2002). It is possible that the patterning of a specific gene is determined by preset methylation states in the flanking D N A . 19 Upon fertilization, the male pronucleus is demethylated independently of replication suggesting that some form of active demethylation is occurring. B y the formation of the zygote, both the maternal and paternal chromosomes undergo passive demethylation through cellular division, erasing the paternal imprints on the original gametes (Howlett and Reik 1991; Rougier, Bourc'his et al. 1998; Mayer, Niveleau et al. 2000; Oswald, Engemann et al. 2000). New embryonic methylation patterns are then gradually re-established. A s mentioned previously, targeted knock out of Dnmt l results in death at embryonic day 5, knock out of Dnmt3b result in death at E l 1.5, and knock out of Dnmt3a results in death at 4 weeks post natal suggesting that D N M T 3 a acts at stages of development later than D N M T 3 b . Developmental lethality is appropriate because of the drastic changes in genomic D N A methylation and cellular proliferation during embryogenesis. De novo D N A methylation contributes to cell fate decisions, the end result being cells with tissue specific transcriptional competencies. It is wel l demonstrated that tissue-specific expression of genes is in many cases regulated by D N A methylation. For example, the differential methylation of the C p G dinucleotides in the promoter region of the rat placental lactooxygenin I gene restricts the expression of this gene to the placenta (Cho, Kimura et al. 2001). Differential D N A methylation and the corresponding differential expression of tissue specific genes have been compared in end point somatic cells. Examples of specific changes to the epigenetic influence on specific genes during cellular differentiation are not as wel l characterized. Some examples which have been described include the regulation of the human telomerase reverse transcriptase gene (TERT) in the 20 human teratocarinoma and acute myeloid leukemia cell lines when grown in differentiating conditions over a 12 day span (L iu, Saldanha et al. 2004). Before the cell lines are differentiated, T E R T is expressed. After differentiation, T E R T is silenced. During the 12 day time line of differentiation, T E R T expression is progressively silenced coincident with the accumulation of methylated cytosines within the promoter of the T E R T gene. Another example of specific gene silencing during differentiation is with regard to the lipooxygenase gene (5 -LOX ) during differentiation of the neural precursor cell line N T 2 . When growing under differentiating conditions, the expression of the 5-L O X gene progressively decreases. When this cell line is treated with D N A methyltransferases inhibitor 5-aza-2'-deoxycytidine (AdC), the expression of 5 - L O X is upregulated (Uhl , K lan et al. 2002; Zhang, Chen et al. 2004). Changes resulting in the demethylation and subsequent transcriptional activation of specific genes also occur during cellular differentiation. In astrocytes, the demethylation of the Gfap gene promoter and subsequent expression of G F A P is required for glial differentiation (Condorelli, Del l 'Albani et al. 1997). Lastly, during haematopoiesis, specific demethylation of the C p G dinucleotides located in the core of transcription factor binding sites regulating expression of chicken lysozyme are critical for differentiation of primary myeloid cells from transgenic bone marrow (Tagoh, Meln ik et al. 2004). The Ol factory Ep i the l ium: Anatomy and Adu l t Neurogenesis-The olfactory mucosa consists of the olfactory neuroepithelium and the lamina propria (Figure 4). From the apical layer of the O E to the lamina propria at the base of the O E , the olfactory epithelium is composed of sustentacular cells (Sus), mature olfactory receptor neurons 21 (ORN) , immature receptor neurons (IRN), globose basal cells ( G B C and horizontal basal cells (HBC) (Figure 4). In addition, Bowman's Glands are also present in the olfactory epithelium extending from the lamina propria to the surface of the olfactory epithelium. The cell bodies of sustentacular cells are located in a single layer at the apex of the olfactory epithelium. Sustentacular cells are non-neuronal and have large cell bodies capped by microvi l l i at the surface of the O E . Sus cells express cytokeratin 8 and 18 which are typically found in regular epithelial cells, and several enzymes expressed by liver cells including cytochrome p450 which are involved with detoxification (Chen, Getchell et al. 1992). In addition, Sus cells possess an extensive endoplasmic reticulum. For these reasons it is believed that Sus cells are involved in regulating the ionic composition of the epithelial mucus membrane and in detoxifying the mucus membrane of olfactory stimuli (Getchell, Margolis et al. 1984). Sus cells are also known to phagocytose dead neurons during times of accelerated neuronal death. ORNs are bipolar in shape and are functionally responsive to odorant stimuli. From the apical end of the cell extends a dendrite which terminates in a knob at the surface of the epithelium. Roughly a dozen ci l ia branch from the dendritic knob and spread along the surface of the epithelium. From the basal end of the olfactory receptor neuron extends an unmyelinated axon that exits the epithelium through the lamina propria. Axons from multiple olfactory receptor neurons fasciculate and become myelinated by olfactory ensheathing cells after exiting from the neuroepithelium. These 22 HB CFU M1 INP ORN MORN Su Figure 4: Cellular Organization of the Adult Olfactory Epithelium The olfactory epithelium can be divided into three layers, basal, middle, and apical. The basal layer contains horizontal basal cells (HB) which lie directly superior to the basal lamina. Directly above the horizontal basal cells lie the globose basal cells which can be further subdivided into neuronal colony-forming cells (CFU), Mash-1 expressing cells (Ml), and immediate neuronal precursors (INP). The middle layer contains the neuronal population where immature receptor neurons (ORN) resides lower in the layer and the mature olfactory receptor neurons (MORN) are higher and superior to the immature ORNs. Sustentacular cells (Su) are located in the apical-most layer of the OE (Calof, Mumm et al. 1998). 2 3 olfactory nerves extend through the cribiform plate to theipsilateral olfactory bulb to form synapses with intermediary neurons. Mature olfactory receptor neurons can be identified by their expression of odorant receptors and components of the signal transduction cascade and olfactory marker protein (OMP) . IRNs are found in the layers underneath the O R N s I RNs have not developed a presynaptic terminal nor do they possess a fully developed dendrite. It is believed that IRNs typically take a week to mature to an O R N (Schwob, Szumowski et al. 1992). Immature receptor neurons can be identified by their expression of growth-associate protein 43 (GAP43) which is expressed in axon and dendrite growth cones and neuron specific B i l l tubilin (NST). Globose basal cells are round in shape and found below the I R N layer. They are the immediate precursor to olfactory receptor neurons (Calof and Chikaraishi 1989) and express a variety of G B C proteins and M A S H - 1 . G B C s exhibit a high proliferative rate demonstrated by their high rate of thymidine analog uptake and are believed to be a transit amplifying pluripotent progenitor cell (Huard and Schwob 1995). In addition to neurons, globose basal cells have also demonstrated the ability to differentiate into a O R N s and Sus cells. G B C s which are first isolated by immunoselection and fluorescence activated cell sorting and subsequently transplanted into a permissive olfactory epithelium were found to give rise to IRNs, O R N s , and Sus cells (Chen, Fang et al. 2004). Horizontal basal cells in the adult olfactory epithelium have a flattened morphology and lie directly on top of the basement membrane (Andres 1966; Graziadei and Graziadei 1979; Graziadei and Graziadei 1979). They express cytokeratin 5 and 14 and have a carbohydrate moiety recognized by bandiraiea (griffonia) lectin 1 (Holbrook, 24 Szumowski et al. 1995). They are considered by some to be the stem cells of the olfactory epithelium because they can divide asymmetrically giving rise to another H B C and a globose basal cell (Calof and Chikaraishi 1989; Carter, MacDonald et al. 2004). The adult olfactory epithelium has the innate ability to generate new O R N s to replenish O R N s throughout vertebrate life. The neurogenic ability of the O E was first observed as a phenomena following damage to the olfactory epithelium (Smith 1951). After damage is wrought on the O E surgically or by chemical lavage, the O E repopulated itself with the correct cells within a few weeks. The lineage of O R N s was resolved in later studies using lineage tracers (Smith 1951). Radiolabeled thymidine, when injected into an animal, is incorporated into the genetic material of dividing nuclei. B y sampling the O E at progressive time points after administration of thymidine, it was shown that basal cells were the first to incorporate the label. Subsequent time points showed that the nuclei containing the thymidine were now higher in the olfactory epithelium corresponding to the I R N and O R N cell layers (Graziadei and Metcal f 1971; Graziadei 1973; Moul ton 1974; Graziadei, Levine et al. 1978). These experiments showed that O R N s arise from dividing basal cells which then differentiate progressively into IRNs and then O R N s (Figure 5). The ability of the olfactory epithelium to replace neurons makes it a convenient system to study the molecular mechanisms regulating gene transcription in neurogenesis. In the generation of O R N s lineage decisions in the basal layer are made as basal cells commit to a neuronal fate. Parallel with an O R N ' s progressive differentiation, transitioning from 25 nasal cavity sustentacular cell mature olfactory receptor neuron 4 maturing olfactory receptor neuron globose basal cell horizontal basal cell lamina propria Figure 5: Lineage Refinement in the Olfactory Epithelium Olfactory receptor neurons are generated from the basal cell population. Horizontal basal cells give rise to globose basal cells. Globose basal cells can give rise to sustentacular cells or immature receptor neurons. Immature receptor neurons differentiate into mature olfactory receptor neurons. The OP27 cell line was characterized as being a transit amplifying neuronal precursor. The OP6 cell line was characterized as being an immature receptor neuron. 26 pmripotent progenitor to a mature O R N , permanent changes to a cell 's transcriptional profile occur. A s discussed before, de novo methylation of D N A is a wel l suited mechanism to mediate these transcriptional changes. In our lab, the O E has been identified as a system which may continue to express D N M T 3 b and D N M T 3 a in the adult. This suggests that the de novo D N A methyltransferases maybe linked to the neurogenic events in the O E . Recently, epigenetic mechanisms have been implicated in regulating the expression of olfactory receptor genes in ORNs. Potential for Epigenetic Regulation of Olfactory Receptor Gene Expression in Olfactory Receptor Neurons-The mammalian olfactory system is capable of detecting an innumerable number of odorants. Odorant molecules are volatile, hydrophobic, organic ligands and each odorant has a unique chemical structure (Buck and A x e l 1991; Buck 2000; Firestein 2001). Detection of an odorant is initiated by the binding of the odorant molecule to its olfactory sensory receptor mate, expressed on the ciliated dendrites of olfactory receptor neurons (Buck and A x e l 1991; Buck 2000; Firestein 2001). Binding of the ligand to its G-protein like receptor initiates an action potential that is transmitted down the neuronal axon through to downstream synaptic targets. Cloned odorant receptors demonstrate the ability to bind a narrow range of structurally similar odorants, and discrimination between odors is encoded by the combined stimulation of a group of odorant receptors (Vassar, Ngai et al. 1993; Malnic, Hirono et al. 1999; Kaj iya, Inaki et al. 2001). In order to detect and discriminate between the vast array of odorants in the environment, a vast variety of receptors are also needed. 27 In the murine genome, the diversity of odorant receptors is encoded by over 1000 individual genes, the coding region of which is typically a single non-interrupted exon (Young, Friedman et al. 2002; Young and Trask 2002; Zhang and Firestein 2002). These genes are organized in the genome in widely distributed gene clusters which probably reflect their evolutionary origin; gene duplication and subsequent divergence (Buck and Axe l 1991; Young and Trask 2002; Zhang and Firestein 2002). According to one classification, ORs with >40% amino acid identity are called families, ORs with more than 60% identity are called sub-families (Buck and Axe l 1991). Analysis of one such cluster on chromosome 17pl3.3 identified seventeen olfactory receptor genes and six pseudogenes within 412 kb of sequence. Most of the exons are separated from each other by 10 to 20 kb with the occasional separation of 30 or 40 kb. Each olfactory receptor neuron exclusively expresses only one olfactory receptor gene from its genomic repertoire. This exclusion includes both the receptor genes at other loci and also the allele of the expressed receptor gene, a process known as mutually exclusive expression (Serizawa, Ishii et al. 2000). In addition, olfactory sensory neurons are not randomly dispersed throughout the surface of the olfactory epithelium but are restricted to specific zones based on which specific olfactory receptor gene is expressed (Strotmann, Wanner et al. 1994; Strotmann, Wanner et al. 1994). In combination, the challenges of olfactory receptor gene transcription are obvious. One hypothesis for olfactory receptor gene regulation was prompted by the identification of a T-cel l receptor alpha gene segment in proximity to an O R cluster (Lane, Roach et al. 2002). This suggested recombination of olfactory receptor genes into transcriptionally active loci in a 28 manner similar to T-cel l receptor recombination. However, it has been shown in recent experiments that mice cloned by nuclear transfer from terminally differentiated olfactory receptor neurons possess a repertoire and organization of olfactory receptor genes indistinguishable from wi ld type mice (Eggan, Baldwin et al. 2004; L i , Ishii et al. 2004). Thus transcriptional control of O R gene expression does not arise from genetic recombination but from a reversible process. Genomic analysis of the upstream regions of O R gene clusters has also failed to find significant regulatory homology, despite similar regulatory agendas. However, the regulatory impacts of sequence non-specific C p G dinucleotides, has not been exhaustively explored as a mechanism behind O R gene regulation. Proposal Summary and Aims-Previously we identified Dnmt3b as a gene that is upregulated in the O E following bulbectomy induced neurogenesis in the mouse. D N M T 3 b is a de novo D N A methyltransferase which catalytically establishes new methylation marks. New patterns of methylation i l l icit new profiles of transcriptional competency and are heritable. Thus, de novo methyltransferases may play a role in events such as cell lineage refinement and differentiation. D N A methylation mediated epigenetic control of transcription during O R N neurogenesis is not well understood. To address this issue, I w i l l use a combination of bioinformatics and molecular approaches to test the following hypotheses: 1. Promoter regions of similarly expressed olfactory receptors have a common C p G organization. 29 2. D N M T 3 a and D N M T 3 b are expressed at distinct and different stages of O R N development. 3. Developmental O R N patterns of D N M T 3 a and D N M T 3 b are recapitulated in in vitro models of O R N development, the OP6 and OP27 cell lines. 30 Chapter 2: Materials and Methods CpG Island and Bl repeat mapping-Genomic sequences were retrieved using the N C B I Map Viewer interface (http://www.ncbi.nlm.nih.gov/mapview/). C p G islands were identified by inputting F A S T A formatted sequence into the C p G Island finding tool at the European Bioinformatics Institute (http://www.ebi.ac.uk/emboss/cpgplot/) using the following parameters: program-cpgplot, window-100, step-1, obs/exp-0.6, minPC-50, length-500, reverse-no, complement-no. B l repetitive repeats were identified using the same tool with the same parameters with the exception of the length parameter. B l sequences are identified as C p G islands of less than 500 nucleotides. Primer Design-Since several isoforms of (mRNA) Dnmt3b exist special measures were used to design primers to (mRNA) Dnmt3b. c D N A sequences for (mRNA) Dnmt3b were retrieved from N C B I Genbank. These sequences include: NM_010068.1, AF068626.2, AF068627.2, AF06828.2, AF151969.1, AF151970.1, AF151971.1, AF151972.1, AF151973.1, AF151974.1, AF151975.1, and AF151976.1. A multiple sequence alignment using ClustalW (www.ebi.ac.uk/clustalw/) was performed using default settings to identify the loci of variable splice (see Appendix B) . The primer design program Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) was then used to design primers targeting motifs in common to all the c D N A s . Primer3 was then instructed to design primers that would amplify the regions of alternate splicing within the coding region. 31 RT-PCR-Reve rse transcriptase P C R was performed (using a P E Appl ied Biosystems Geneamp 9700) to check for the expression of D N M T isoforms in the olfactory epithelium. O E tissue was microdissected from CD- I mice of various developmental time points and homogenized in lysis buffer with a Kontes Pellet Pestle Motor or a Fischer Sciences Powergen 125 for 30s. R N A was extracted from the homogenates using a Qiagen RNeasy kit. First strand c D N A s were generated with a Superscript II kit (Invitrogen) using 0.5 ug of total R N A . l u l of the first strand reaction was combined with 5 ul P C R buffer, 40 ul d H 2 0 , l u l 10 m M dNTPS, 3ul 50 m M M g C l 2 , 2.5 units Taq D N A polymerase (Invitrogen) and 2.5 ul 25 m M primers. Primers were selected using the Primer3 program, a summary of primers and sequences is found in Table 1. The P C R cycling protocol was as follows; 94C for 5' (first cycle), followed by 94C for 30s, 58C for 35s, 72C for 30s (30 cycles), 72C for 4 min (last cycle). R T - P C R products were electrophoresed on a 1.5% TBE/agarose gel and the picture was captured using a B ioRad Geldoc 1000. Table 1: R T - P C R Pr imer Pai rs and Mel t ing Temperatures mRNA Target Forward Primer Reverse Primer Melting Temp B-actin AGCCATGTACGTAGCCATCCAG GGAGTACTTCTAGGACTCGCTCG 43 Dnmtl ATCCATTTGGCTGGTGTCTC TCATCGATGCTCACCTTCTG 47 Dnmt2 CCTCTCTGTGCAGATGCTGA CACATGCACGTTGAGGCTAT 47 Dnmt3a GGGCTTGACATCAGGGTCTA TTCTGGTGGGGTCTCAGTTC 49 Dnmt3b TGGGTACAGTGGTTTGGTTGA GCCCTTGTTGTTGGTGACTT 47 Dnmt3b exon 7 GCGTCAGTACCCCATCAGTT GCGTCAGTACCCCATCAGTT 39 Dnmt 3b exon 17 ACTTGGTGATTGGTGGAAGC GTGTAGTGAGCAGGGAAGCC 45 32 Embedding and sectioning of mice-CD-I mice younger than postnatal day 6 were decapitated and immersion fixed by submerging them in 4% freshly made P F A for 2 hours, then in 10% sucrose for 1 day, then in 30% sucrose for another day. C D - I mice older than postnatal day 5 were perfused with P B S and then 4% P F A . Fixed C D - I embryos were then embedded directly into Tissue-Tek O C T (Sakura) and frozen on l iquid nitrogen. Fixed postnatal mice were suctioned to remove internal air bubbles by subjecting them to slight negative pressure while immersed in Tissue-Tek O C T for 5 minutes and then embedded directly into O C T and frozen on l iquid nitrogen. Frozen blocks were then sectioned at 7um on a Mic rom H M 500 O M cryostat and stored at -20. For staging of the embryos, mid-day on the day of the appearance of the vaginal plug was considered as E0.5. Immunohistochemistry-Sections were warmed for 10 min on a Labline slide warmer set at temperature 4. The sections were fixed in 4% P F A for 10 min and then washed 2 X in P B S in the microwave. The sections were then subjected to antigen retrieval by microwaving the sections on the high setting while submerged in 0.01 M citric acid p H 6. The sections were then washed 2 X 5 min in P B S and permeablized in 0.1X Tri ton-X 100 for 30 min. The cells were then washed 2 X 5 min in P B S and then blocked in 4% normal horse serum for 20 min then incubated in a D N M T primary antibody for 1 hr at R T or overnight at 4°C. The sections were then washed 2 X 5 min in P B S and then incubated in a biotinylated anti-mouse secondary diluted 1/200 for 30 min. The sections were then washed 2 X 5 min in P B S , incubated for 10 min in 0.5% H2O2, then washed again for 5 min in P B S . The sections were incubated in A B C kit (Vector) for 30 min and then 33 washed 2X 10 min P B S . The sections were then developed using the V IP kit (Vector), dehydrated in 50, 75, and 100% ethanol (5 min each wash), and coverslipped with Permount (Fisher). Immunofluoresence- Sections were warmed for 10 min on a Labline slide warmer set at temperature 4. The sections were fixed in 4% P F A for 10 min and then washed 2 X in the microwave. The sections were then subjected to antigen retrieval by microwaving the sections on the high setting while submerged in 0.01 M citric acid p H 6. The sections were then washed 2 X 5 min in P B S and permeablized in 0.1X Triton-X 100 for 30 min. The sections were then washed 2 X 5 min in P B S and then blocked in 4% normal horse serum for 20 min then incubated in a D N M T primary antibody for 1 hr at R T or overnight at 4°C. The sections were then washed 2 X 5 min in P B S and then incubated in a biotinylated anti-mouse secondary diluted 1/200 for 30 min. The sections were then washed 2 X 5 min in P B S , then incubated for 10 min in 0.5% H2O2, then washed again for 5 min in P B S . The sections were incubated in A B C kit (Vector) for 30 min and then washed 2 X 10 min P B S . The sections were incubated for 5 min in Amplex (Molecular Probes), washed in Amplex buffer for 5 min, then in P B S for 5 min. The sections were then re-blocked in 4% normal donkey serum for 20 ' and then incubated in a second primary overnight at 4°C. The cells were then washed 2 X 5 min in P B S and incubated for 1 hr with a fluorescent-conjugated secondary. The sections were washed 2 X in P B S and then incubated with D A P I for 5 minutes then washed 2 X 5 min in P B S and coverslipped in Vectashield (Vector). 34 Immunocytochemistry- Cells were rinsed twice in P B S and fixed for 10 min in ice cold methanol. The cells were then washed 2 X 5 min in P B S and stored in PBS/0 .05% Sodium Azide. The cells were permeablized in 0.1X Tween 20 for 30 min. The cells were then washed 2 X 5 min in P B S and the blocked in 4% normal donkey serum for 20 min then incubated in a D N M T primary antibody overnight at 4°C. The cells were then washed 2 X 5 min in P B S and then incubated in a fluorescent-conjugated secondary antibody diluted for 90 min. The cells were then washed 2 X min in P B S in 4% normal donkey serum for 20 ' and then incubated in a second primary overnight at 4°C. The cells were then washed 2 X 5 min in P B S and incubated for 1 hr with a fluorescent-conjugated secondary for 90 min. The cells were incubated with D A P I for 5 minutes, then washed 2 X 5 min in P B S and coverslipped in Vectashield (Vector). Table 2: Sources and Dilutions of Primary Antibodies. Primary Antibodies Species Source Dilution of Immunostaining Dilution used for immunocytochemistry DNMT3b Mouse monoclonal Imgenex 1:150 1:150 DNMT3a Mouse monoclonal Imgenex 1:100 -4'-6'-diamidino-2-phenylindole (DAPI) Roche 1:10 000 1:10 000 HDAC2 Rabbit polyclonal Santa Cruz 1:200 -Unique B-Tubulin (NST) Mouse monoclonal Bio-Can Scientific 1:5000 1:5000 PCNA Mouse monoclonal Sigma 1:5 000 1:5 000 OMP Goat polyclonal Frank Margolis U of Maryland 1:10 000 1:5 000 Cytokeratin 5/6 Mouse monoglonal Boehringer Mannheim 1:100 -NF Rabbit polyclonal Chemicon 1:500 -GAP 43 Mouse monoclonal Chemicon 1:200 -NCAM Rabbit polyclonal Chemicon 1:500 - • 35 Table 3: Sources and Dilutions of Secondary Antibodies Primary Antibodies Species Source Dilution of Immunostaining Anti-mouse Alexa 488 Donkey IgG Molecular Probes 1 100 Anti-rabbit Alexa 594 Donkey IgG Molecular Probes 1 100 Anti-goat Alexa 594 Donkey IgG Molecular Probes 1 100 Anti-mouse Alex 594 Donkey IgG Molecular Probes 1 100 Anti-mouse biotinylated Horse IgG Vector 1 200 Amplex red reagent - Molecular Probes 1 400 Cell Counts-A total of 3 animals per time point, E l 7 and P5, were used for cell counts. From each animal, 3 coronal sections were analyzed, the caudal-most containing the first few layers of the olfactory bult( cauda) , another 140 um rostral to thecaudal(mid) , and another 140 um more rostral to the mid (rostral). In each section, 3 areas of the olfactory epithelium were targeted for cell counts; the top of the olfactory arch, along the septum just before the olfactory/respiratory epithelium boundary, and the medio-lateral olfactory turbinate. A 200 um stretch of olfactory epithelium, measured parallel to the basement membrane, in each spot was then analyzed for the number of cells expressing certain antigens. Synchronization of OP27 cells in Gl/S phase- OP27 E A G cells were grown in D M E M / 1 0 % F B S until they reached a density of 80% confluency. The cells were then switched to serum free D M E M and grown at 33°C for 48 hours. After 48 hours, the cells were trypsinized and passaged into new TC flasks in D M E M / 1 0 % F B S and allowed to settle for 2 hours. After two hours, the media was supplemented with Aphidicol in to a final concentration of 0.25 ug/ml and grown for 12 hours at 33°C. 36 Cell Cycle Analysis by Fluorescence Activated Cell Sorting- Between 300,000-500,000 OP27 cells were trypsinized and resuspended in P B S / 2 % F B S . The cells are then centrifuged at 1650 R P M for 5 minutes and the pellet is washed by resuspension in 3ml of P B S . The cells are centrifuged once more at 1650 R P M for 5 minutes and the pellet is resuspended in 297ul of P B S . 3ul of lOmg/ml RNase is added and the sample is incubated for 40 minutes in a 37C water bath. 1.5ul of lOmg/ml propidium iodide is added and incubated for 10 minutes. The sample is then filtered through a sterile filter and analyzed using a FACscal ibur using CellQuest acquisition software. The acquired data files are then analyzed using the cell cycle analyses platform in FlowJo 3.1. The best fit cell cycle composition was achieved using the 2-populations algorithm using a set G2 peak at 1.83XG1. 37 Chapter 3: Results 3.1 Association of OR genes with CpG Rich Genomic Elements. Introduction-OR genes sharing >60% sequence homology are defined as belonging to the same O R gene subfamily (Glusman, Yanai et al. 2001). Subfamilies of O R genes arise from gene duplication and subsequent divergence, are organized proximally to each other on the genome in gene clusters, and typically have similar zonally restricted expression patterns within the olfactory epithelium. It is reasonable to expect that genes that arise from duplication and which have similar expression paradigms willalso share common or similar transcription control elements. Transgenic experiments have shown that the ~3kb surrounding an O R gene is ordinarily sufficient for achieving normal wi ld type expression patterns (Qasba and Reed 1998). However, efforts to identify conserved cis-acting sequence motifs within the regions surrounding O R genes belonging to a subfamily have failed to identify such elements (Lane, Cutforth et al. 2001; Lane, Roach et al. 2002). It is l ikely that the regulatory elements controlling O R gene expression are small and/or scattered and require more sensitive techniques to identify them. D N A methylation initiated gene silencing is a potential regulator of gene transcription. Currently, the only known sequence related target requirements for its action are individual C p G dinucleotides. The small size of this target excluded it from the resolution of previous efforts to identify conserved sequence motifs. However, the size makes serial analysis of the positions and methylation status of the many individual 38 CpG dinucleotides upstream of OR genes a formidable task. Alternatively, several conserved genomic elements as discerned by higher than normal CpG representation have been shown to have characteristically stable high or low methylation densities in vivo and have methylation dependent effects on the transcription of proximal genes. CpG islands are rich in CpG dinucleotides, are methylation poor, and are found upstream of constitutively active genes. B l elements are also rich in CpG dinucleotides butunlike CpG islands, they are heavily methylated and negatively effect gene transcription. Unlike individual CpG dinucleotides, the identification of these motifs ad elements for the assessment of their potential effect on OR gene transcription is a manageable endeavour. By reverse logic, i f the CpG sites that are not classified as such motifs are by default considered to be viable targets for dynamic control of methylation, then i f an association of these conserved motifs with functional OR genes existed, this would make a case against dynamic CpG methylation as a means of regulating OR gene transcription. This leads to the hypothesis that i f OR gene clusters are regulated by differential CpG methylation, the OR genes within the cluster are not associated with CpG islands or B l elements. 39 Results C p G islands are not associated with functional OR genes-To determine i f O R genes are associated with C p G rich sequence motifs linked to low methylation density and constitutive gene transcription, the C p G islands proximal to several O R gene clusters were identified. C p G islands were originally described as regions 200 bp or longer with a C+G content of 50% or higher and an observed CpG/expected C p G content of over 60% (Gardiner-Garden and Frommer 1987). Arbitrary in definition, this description was defined before large amounts of genomic sequence data were widely available and has since been refined to exclude C p G rich motifs which are not C p G islands, mainly B1 repeat elements, and to improve the correlation of computationally identified C p G islands with regions controlling the transcription of genes for use as a gene finding tool. To determine i f O R genes are associated with C p G rich sequence motifs linked to low methylation and constitutive expression, the functional O R genes within 6 O R gene clusters, groups of O R genes with less than a megabase separating adjacent O R gene coding regions (Godfrey, Maln ic et al. 2004), found on 5 chromosomes were mapped to their genomic loci according to Genbank records, and plotted alongside C p G islands identified using the E B I C p G island finder (Figure 6 A - F ) (Rice, Longden et al. 2000). The two O R gene clusters plotted on chromosome 1 are small and only occupy loci of approximately 200 kb. The cluster on Chr9 is very large, oc cupying 2.5 M b and the cluster on Chr 16 occupies approximately 800 kb. The O R gene cluster on chromosome 17 occupies approximately 1.3 M b and the cluster on chromosome 19 occupies 2 40 megabases. In the analysed regions containing the O R gene clusters on chromosomes 1, 9 and 16, no C p G islands internal to the O R gene cluster were identified (Figure 6 A - D ) . However, regions surrounding these O R gene clusters contained several C p G islands and C p G islands tightly flank the O R gene clusters in the cases o f the Chr 1 cluster at 94.5 M B , Chr 9, 16, and 19. The identified C p G islands also demonstrate a high correlation to the transcriptional start site of annotated and putative genes as identified by Genbank records. Frequentlythe C p G islands overlap the first exon or are within 1 kb of the first coding exon. A summary is found in Table 4. In contrast to the O R clusters on chromosomes 1, 9, and 16, the O R gene clusters examined on chromosome 17 and 19 (Figure 6 E-F) contain one or more internal C p G islands. The single C p G island identified within the O R gene cluster on Chr 17 does not correspond to an actively transcribed gene, however, it does overlap with the coding exon of an O R pseudogene, a gene bearing homology to an O R gene but which is l ikely non-functional because of a truncation of the coding region or a reading frame shift in the coding region. O f the five C p G islands identified within the cluster on chromosome 19, three are associated with the upstream regulatory region of non-OR genes (Figure 6 F). The C p G island located at 13 373 098 is lOkb away from the G m l 2 7 6 gene, which is similar to a gene needed for testes development, and the C p G islands found at 13 667 568 and 13 671 136 are associated with the translation start site of the putative gene, 4933402K05Rik, a gene found internal to the O R gene cluster. The other 3 remaining C p G islands internal to the Chr 19 O R gene clusterare not associated with any known or putative gene. 41 C l ( 6 ) B CpG I s l a n d s o—0 C * l <7> 1 — L O R S e - e o - e -CpG I s l a n d s C9 ( 8 6 ) O R S mo o a~B~Mtt-e~a—— s e a ——»-OOOD<—•—asoe-37 38 39 40 41 D CpG I s l a n d s — 0 0 0 0 o -0 C16 < 2 3 ORS (JBBSMtt> CpG I s l a n d s ORs C17 - <**)-F CpG I s l a n d s C19 0 E s dm QEPoqp o o I — 3 0 coo 0 0 ( 4 2 ) Figure 6: Genomic Mapping of Functional OR Genes and in silico Identification of CpG Islands. (A-F) The loci of the functional OR genes (an OR gene with a contiguous coding exon) belonging to 6 OR gene clusters (a series of OR genes with < 1 Mb in between adjacent OR genes) found on chromosomes 1, 9, 16, 17, and 19 are plotted on the bottom axis (ORs) in megabase distances relative to the centromeric region (located towards the left hand side) and represented by an open circle (O). Darker circles result from overlapping individual open circles. The number of functional OR genes within each cluster are denoted within the brackets above the plot of the OR genes. The loci of CpG islands, here defined as genomic loci with 1) an observed CpG content/expected CpG content > 0.60 2) a C+G percent > 0.5 and 3) an overall length of >500, are plotted on the axis (CpG Islands) immediately superior to the axis representing the loci of the OR genes and are represented by an open diamond (0). Darker diamonds result from overlapping individual open diamonds. (F) The position of the 4933402K05Rik gene is denoted with a shaded box. 42 Chromosome Region Analysed (Mb away from centromere) # of Identified C p G Islands # of C p G Islands with an Associated Gene. 1 93-95, 176-178 15 12 9 37-42 6 4 16 57-61 7 6 17 36-39 3 3 19 11-15 8 7 Table 4: CpG Islands are Highly Correlated with the Transcriptional Start of Genes. The loci of CpG islands, defined as genomic loci with 1) an observed CpG content/expected CpG content > 0.60 2) a C+G percent > 0.5 and 3) an overall length of >500, identified in stretches of genomic sequences of chromosomes 1,9, 16, 17, and 19 were analyzed to identify potential overlap or association with the regulatory and coding regions of known or computationally predicted genes. A CpG island is defined as having an associated gene if it is overlapping with, or within 1 kb of a gene's initial coding exon. 43 B l elements are not associated with functional O R genes-To determine i f O R genes are associated with C p G rich sequence motifs linked to high methylation density and silent transcription, the B1 repetitive elements proximal to the O R gene clusters previously analyzed for C p G island content were also identified. B l elements in and around 6 O R gene clusters found on chromosomes 1,9, 16, 17 and 19 were identified using the E B I C p G island finder. In general, the B l elements are widely dispersed on the examined stretches of chromosome and are present both internally and externally to O R gene clusters (Figure 7 A -F ) . N o pattern or trend in B l distribution is easily apparent, although in general, it appears that the density of the B l repetitive elements within the loci of the O R gene cluster is lower than the density in the surrounding D N A . The B l distribution around the O R gene clusters on chromosome 1 is an exception to this observation, where the B l elements are clearly distributed around the O R gene clusters (Figure 7 A ) . However, the small size of these gene clusters makes it hard to derive conclusions from this. The other exception to the B l density observation is the arrangement of B l elements around and within the gene cluster on Chr 19 where in comparison to the other investigated O R gene clusters with internal B l repeats, the cluster at Chr 19 contains a density of B l elements that is the same i f not higher than the surrounding regions. This atypical B l arrangement may be due to the proximity of the O R gene cluster to the centromere, approximately 11.5 M b . The other mapped O R gene clusters on chromosomes 9, 16, 17 and 19 allcontain internal B l elements (Figure 7 B-F). A t a more refined scale, the correlation of internal B l elements with the coding regions of functional O R genes was examined by identifying O R genes with a B l element less than 10 kb away from the start of the coding region. The results are 44 A Alu Elements ci <6> > — L ORs WO-B Alu Elements «~ UJ- 0 R s Q o o o Alu Elements C9 37 38 39 40 41 D Alu Elements e — o 0 CKO 0 OO 0 ®-0 OO-© ©—© O — 0 — C16 ( 2 3 ! E Alu Elements C17 0 H S H w i n itHHpaooe—«cro<B-(44) F C19 ( 4 2 ) Figure 7: Genomic Mapping of Functional OR Genes and in silico Identification of B l Repetitive Elements. (A-F) The loci of the functional OR genes (an OR gene with a contiguous coding exon) belonging to 6 OR gene clusters (a series of OR genes with < 1 Mb in between adjacent OR genes) found on chromosomes 1, 9, 16, 17, and 19 are plotted on the bottom axis (ORs) in megabase distances relative to the centromeric region and represented by an open circle (O). Darker circles result from overlapping individual open circles. The number of functional OR genes within each cluster are denoted within the brackets above the plot of the OR genes. The loci of Bl repeat elements, here defined as genomic loci with 1) an observed CpG content/expected CpG content > 0.60 2) a C+G percent > 0.5 and 3) an overall length of <500, are denoted by an open diamond (0) on the axis (Bl Elements) immediately superior to the axis representing the loci of the OR genes. Darker diamonds result from overlapping individual open diamonds. 45 Chromosome Region Analysed (Mb away from centromere) #B1 Repetitive Elements Internal to the O R Gene Cluster # o f B l Repetitive Elements within 10 kb of a Functional O R Gene % o f Functional O R Genes with an B l Repetive Element within 10 kb # o f B l Repetitive Element(s) within 3kb of a Functional O R Genes % o f Functional O R Genes with an B l Repetive Element within 3 kb 1 93-95, 176-178 0 0 0 0 0 7 37-42 12 3 3.5 1 1.2 16 57-61 6 0 0 0 0 17 36-39 6 2 4.5 1 2.3 19 11-15 22 7 16.7 1 2.4 Table 5: B l Repetitive Elements are Weakly Associated with OR genes. In the regions examined on chromosomes 1,7, 16, 17 and 19, the positions of B l repeat elements, here defined as genomic loci with 1) an observed CpG content/expected CpG content > 0.60 2) a C+G percent > 0.5 and 3) an overall length of <500, internal to an OR gene cluster were analyzed for their proximity to the regulatory regions and coding exons of functional OR genes (an OR gene with a contiguous coding exon). ABI element is defined as being associated with a functional OR gene if it is within lOkb or 3kb of the first coding exon of the OR gene depending on the stringency of the association. 46 summarized in Table 5. Wi th the exception of chromosome 19 the proportion of O R genes with an associated B l element is small. In addition, there is no correlation between B l repeat elements and genes within a subfamily of O R genes. If the definition of an associated B l element to a gene is refined further to being within 3 kb of the start site, a more stringent definition based on transgenic experiments determining the critical amount of upstream sequence for correct O R gene expression (Bulger, Bender et al. 2000; Lane, Cutforth et al. 2001; Lane, Cutforth et al. 2002), the correlation between B l element and O R gene is even lower. In general, B1 elements internal to an O R gene cluster demonstrate only a weak correlation with the coding regions of the constituent O R genes. Even with the generous lOkb definition of associated O R genes and B l elements, between 0% and 17% of all O R genes within the analyzed chromosomes have an associated B l element. Summary-In order to better understand the potential regulators of O R gene expression, sequence motifs with characteristic methylation densities and their proximity to functional O R genes were identified. The C p G rich motifs, C p G islands and B l repetitive elements, within and surrounding known O R gene clusters of various sizes on chromosomes 1,9, 16, 17, and 19 were identified using in silico tools and plotted alongside the positions of O R genes. A correlation between the position of C p G islands with several known and putative genes was identified. However, C p G islands are generally excluded from O R gene clusters and are not associated with functional O R genes. B l repetitive elements are more commonly found in the analyzed regions than 47 C p G islands. In comparison to C p G islands, several B l elements are found internal to O R gene clusters. However, these events generally occur at a lower density within O R gene clusters than in the regions surrounding the gene clusters. L ike C p G islands, there is a very poor correlation between B l repetitive elements and functional O R genes. Associated C p G islands and B1 repetitive elements are not a common feature of the O R genes within the clusters analyzed. In summary, identification of C p G islands and B1 repeat elements in the 6 O R gene clusters show that: 1. C p G islands are not common features to the promoter regions of functional O R genes. 2. C p G islands are generally excluded from O R gene clusters and in some instances, flank O R gene clusters. 3. B l repeat elements are not common features to the promoter regions of functional O R genes. 48 3.2 Characterization of D N M T Isoforms in the Developing Olfactory Epithelium. Introduction-Previous data failed to identify a correlation between functional O R genes and C p G motifs of characteristic methylation density. This leaves open the possibility that dynamic methylation could contribute at least in part to the silencing of some O R genes. The components of the D N A methylation machinery that may contribute to O R gene silencing have not been identified. We have identified Dnmt3b as a gene that is highly transcribed in the olfactory epithelium of the mouse six to 10 days after bulbectomy using an in vivo subtraction/suppression reverse transcriptase polymerase chain reaction assay for changes in gene expression. This suggests that D N M T 3 b may be important in methylation dependent gene regulation occurring during O R N genesis. D N M T 3 b is only one member of a family of D N A methyltransferase genes and is also expressed as a variety of isoforms resulting from alternative splicing events. To further investigate i f other de novo D N A methyltransferases are involved in O R N development, reverse-transcription P C R was used to assess whether the other major D N M T s , D N M T 1 , D N M T 2 , and DNMT3aare expressed in the O E during normal mouse development. In addition, R T - P C R was also used to identify which splice isoforms of D N M T 3 b m R N A are transcribed. 49 Results mRNA for DNMT1, DNMT2, DNMT3a, and DNMT3b are expressed in the olfactory epithelium as early as E l l and persist into adulthood-To identify the expression of D N M T isoformsin the O E during development, reverse-transcription P C R was performed on m R N A from the O E of E l 1, E l 8, P5 and adult mice using m R N A splice variant-insensitive primers. Primers targeting the c D N A of maintenance methyltransferase D N M T 1 amplified a single P C R product at all four time points as did primers targeting the c D N A of D N M T 2 (Figure 8). This suggests that D N M T 1 and D N M T 2 are expressed in at least some cell populations within the O E from embryonic development into adulthood. Primers targeting the de novo methyltransferases were also used to detect the c D N A of D N M T 3 b and D N M T 3 a . Since D N M T 3 b m R N A can be alternatively spliced resulting in more than one m R N A isoform, ClustalW was first used to compare the 9 Genbank (mRNA) Dnmt3b entries to identify the locations of the alternatively spliced exons (see Appendix B) (Higgins 1994). A single primer set was designed to target a region common to all of the D N M T 3 b m R N A variants. This primer set amplified a single P C R product at all four time points, E l 1 to adult (Figure 8). Primers targeting c D N A for D N M T 3 a also amplified a single P C R product at all four time points although detection in the adult is comparatively weak (Figure 8). This suggests that D N M T 3 a and D N M T 3 b are expressed as early as E l 1 in the O E persisting into adulthood. B-actin was used as an internal positive control for successful reverse transcription of poly A m R N A . 50 Figure 8: R T - P C R Detection of D N M T 1 , 2,3a and 3b Expression in the Olfactory Epithelium at Progressive Stages of Murine Development. cDNA templates for PCR were generated by oligo-dT-primed reverse-transcription of R N A harvested from the olfactory epithelium at E l 1, E l7 , P5, and adult (6 weeks). PCR primers complementing the cDNA of maintenance methyltransferase DNMT1 and accessory methyltransferase DNMT2 amplified PCR products of approximately 600 nt from cDNA generated from E l 1 ->adult OE R N A extracts. RT-PCR primers targeting de novo methyltransferases DNMT3a and DNMT3b mRNA also amplified PCR products of approximately 600 nt from cDNA generated from E l 1 ->adult OE R N A extracts. B-actin was used as an internal positive control for successful reverse transcription. 51 m R N A for DNMT3b splice variants, D N M T 3 b l and DNMT3b4 are expressed in the O E from E l l into adulthood-Several protein isoformsof D N M T 3 b have been described in the mouse and have corresponding homologs in humans (Robertson, Uzvolgy i et al. 1999; Y i n , Chen et al. 1999). A sequence alignment of thetwelve available m R N A records in Genbank show that the D N M T 3 b protein isoforms are generally the result of two variable regions corresponding to the presence or absence of coding exons 7 and 17 (Appendix B) (Figure 9 A , arrows and dashed lines). The four protein isoforms of D N M T 3 b translated from the m R N A isoforms are full length D N M T 3 M , D N M T 3 b 2 which contains exon 17 but not exon 7, DNMT3b3 which contains neither exon 7 nor 17, and D N M T 3 b 4 which contains exon 7 but not 17. Furthermore, each protein is encoded by two separate m R N A s which are identical except for an additional alternative exon splicing event in the 5' untranslated region. However, the function of the non-coding splice variation is unknown. The remaining D N M T 3 b m R N A records differ in a small number of single nucleotide polymorphisms and how completely the 5 ' U T R was sequenced. To identify which D N M T 3 b protein variants are expressed in the O E , reverse-transcription P C R was performed on c D N A generated from the O E of E l 1, E l 8, P5 and adult mice using flanking primers that complemented the exons surrounding the alternatively spliced exons, to amplify the sequence between those exons (Figure 9 A ) . In the presence of the variable exon, an amplicon of approximately 600 bp would be amplified. In the absence of the exon, a smaller amplicon w i l l be amplified. Amplif icat ion of a single 600 nucleotide product at potential splice site 1 (Figure 9 B) 52 A A l t . Spl 1 T 10 12 14 16 Exon 8 1 2 3 4 5 6 7 8 9 11 13 15 A l t . Spl 2 V 17 Chromosome 2 A l t . Spliced Exons II I III I 111 I l l l l I I 19.23 Kb — B -v0 4? 4? 4° # A l t . Spl 1 — e x o n 7 exon 17 no exon 17 Figure 9: Coding Exon Structure of DNMT3b and RT-PCR Detection of DNMT3b Splice Isoform Expression in the Olfactory Epithelium at Progressive Stages of Murine Development. (A) The Dnmt3b gene is located on chromosome 2 and is encoded for by 18 exons. Exons 7 and 17 can be alternatively spliced giving rise to 4 unique DNMT3b protein variants. The positions of the alternative splicing events are labelled as Alt. Spl 1, and Alt. Spl 2 and the alternative exon structure of (mRNA) Dnmt3b is marked by dashed lines. (B) cDNA templates for PCR were generated by oligo-dT-primed reverse-transcription of RNA harvested from the olfactory epithelium at El 1, E17, P5, and adult (6 weeks). RT-PCR primers complementing and amplifying the sequence between exons 6 and 8 (Alt. Spl 1) amplify a single -600 nt product from El 1 ->adult OE RNA extracts, corresponding to a DNMT3b cDNA template containing exon 7. RT-PCR primers complementing and amplifying the sequence between exons 16 and 18 (Alt. Spl 2) yield two amplicons of-600 nt and -400 nt from El l^adult OE RNA extracts, corresponding to two populations of DNMT3b cDNA templates, one containing exon 17 and one without exon 17. B-actin was used as an internal positive control for successful reverse transcription. 53 indicates that all D N M T 3 b m R N A s and proteins expressed in the O E contain exon 7. In contrast, the amplification of two products at potential splice site 2, corresponding to products of 600 and 400 nucleotides, indicate that two populations of D N M T 3 b exist in the O E , one containing exon 17 and the other in which exon 17 is absent. Taken together, the R T - P C R data shows that the m R N A s encoding the D N M T 3 b isoforms D N M T 3 M and D N M T 3 b 4 are expressed in the O E from E l l into adulthood suggesting that these two protein variants are translated in the O E . In addition, the relative intensities of the amplicons resultant from amplification of the site containing exon 17 are approximately consistent between each of the time points suggesting that the proportions of D N M T 3 b l and D N M T 3 b 4 m R N A are consistent at all times. B-actin was used as a positive control for successful reverse transcription po lyA m R N A Summary-The developmental characterization of D N M T 1, D N M T 2 , and the other de novo methyltransferase, D N M T 3 a using R T - P C R shows that like D N M T 3 b , these genes are also transcribed as early as E l 1 and persist into adulthood. Although there are at least 4 protein coding splice variants of D N M T 3 b , only 2 of these variants, D N M T 3 M and D N M T 3 b 4 are expressed in the O E . The splice variants are not developmentally regulated as each isoform is transcribed from as early as E l 1 into adulthood in the same approximate proportions. 54 3.3 In vivo Characterization of D N M T 3 b and D N M T 3 a in the Developing Olfactory Epithelium. Introduction-DNMT3b and D N M T 3 a are commonly regarded as the members of the D N M T family responsible for de novo methylation, the novel methylation of previously unmethylated C p G dinucleotides. This is in contrast to maintenance methylation which concerns the faithful duplication and passage of existing methylation patterns to daughter cells during the S-phase of mitosis which is catalyzed by D N M T 1 (Okano, Be l l et al. 1999). Changes in a cell 's transcriptional profile occur when pluripotent cells undergo lineage commitment or when cells undergo differentiation. If these changes are dependent upon alterations in the transcriptional competence of the D N A , D N M T 3 b and D N M T 3 a are the likely candidates responsible for catalyzing new heritable D N A methylation marks, eliciting subsequent repression of proximal genes. Both lineage commitment and cellular differentiation occur within the olfactory epithelium. To investigate the role of D N M T 3 b and D N M T 3 a in these events in the context of the O E , immunohistochemistry was used to examine when and where D N M T 3 b and D N M T 3 a are expressed in the O E . Correlating the in vivo expression profile with known cell types and developmental events in O R N development w i l l provide insight into the windows of action of D N M T 3 b and D N M T 3 a . 55 Results D N M T 3 b is expressed by presumptive globose basal cells in the adult olfactory epithelium-Immunohistochemistry was used to determine which cell populations within the adult O E expressed D N M T 3 b . Analysis was performed on tissue sections containing adult O E because at this age the O E has achieved a mature pseudo-layered organization, facilitating the assessment of cell type and cell maturity. Using amplified colorimetric immunohistochemistry, D N M T 3 b was found to be expressed in a single cell layer of basally located cell nuclei in the adultOE one cell layer above the basal lamina (Figure 10 A ) . In addition, the expression of D N M T 3 b was not uniform across the adult O E but occurred in localized patches of expression (Figure 10 B) . Because of their basal position within the O E , the potentialidentities of these cells are l ikely to be globose basal cells, and/or immature neuroblasts. Sustentacular cell nuclei are found exclusively in the apical layer of O E and are thus excluded as a candidate cell type expressing D N M T 3 b . Further refinement of the identity of the D N M T 3 b expressing cells was achieved by co-detection of D N M T 3 b with cell specific antigens (Figure 10 C-G) . Several antigenic markers are used to identify neurons in the O E according to how mature the neurons are. Two antigenic markers commonly used to identify mature olfactory receptor neurons are neural cell adhesion molecule ( N C A M ) , a pan-neuronal marker most highly expressed on the surface and processes of mature neurons, and olfactory marker protein (OMP) , expressed in the cell body and axon when olfactory receptor neurons have established their synaptic contact in the olfactory bulb. Co -56 D N M T 3 b C NCAM NC 3 » s %m E ^ ^ G I Figure 10: Co-detection of DNMT3b and Cell-Type Specific Antigenic Markers in the Adult Olfactory Epithelium. (A) DIC image of VIP developed DNMT3b. DNMT3b (purple). (B) DNMT3b (white) is not expressed continuously in the OE but in localized patches. NC=nasal cavity. T=turbinate. Dashed line=basal lamina. (C G) DNMT3b (red). (C) Cells expressing DNMT3b do not express NCAM (green). OE=olfactory epithlium. NC=nasal cavity. (C), nor do they express (D) OMP (green), and (E) NST (green). (F) GAP43 (green) expressing cells do not express DNMT3b. (G) Cytokeratin 5/6 (green) expressing HBCs are located basally to DNMT3b expressing cells. (H-K) Secondary only negative controls. (A,C-F) Scale bar = 50 um. (B) Scale bar = 200 um. 57 detection of D N M T 3 b with N C A M demonstrated that the cells expressing D N M T 3 b do not co-express N C A M (Figure 10 C) . Co-detection of D N M T 3 b and O M P likewise failed to show an overlap of D N M T 3 b and O M P signals (Figure 10 D). This clearly indicates that the cells expressing D N M T 3 b are not mature neurons. Instead, the N C A M and O M P signals are distinctly apical to the D N M T 3 b positive cells in the O E . Growth associated protein (GAP43) and neuron specific B i l l tubulin (NST) are highly expressed in early immature neurons. G A P 4 3 is expressed in the cell bodies and in growth cones of dendrites and axons in IRNs and is down regulated in mature receptor neurons. Co-detection of D N M T 3 b with GAP43 failed to demonstrate an overlap between the cell populations expressing each antigen (Figure 10 F). N S T is expressed immediately after a progenitor's commitment to a neural fate just before G A P 4 3 is expressed. The nature of the N S T signal also changes with a cells maturity, being expressed highly in, and clearly surrounding the cell body of neurons immediately after lineage commitment and gradually being restricted to the neurites and only faintly expressed on the cell surface as the neuron matures. Co-detection o f D N M T 3 b with N S T likewise showed that D N M T 3 b and N S T are expressed in different cell populations. (Figure 10 E). The absence of overlap between the D N M T 3 b signal with N S T and G A P 4 3 shows that D N M T 3 b is not expressed in immature neurons. Instead, D N M T 3 b is distinctly expressed by cells located underneath the N S T and G A P 4 3 positive cells. Taken together, it is clear that D N M T 3 b is expressed in one or both of the basally located uncommitted progenitor cell types. 58 Cytokeratin 5/6 is a cell surface marker expressed by horizontal basal cells. In the adult O E , cytokeratin is detected in a uniform single layer in the basal layer of the O E . Co-detection of D N M T 3 b with cytokeratin 5/6 showed that these two antigens are expressed by two exclusive cell populations with the D N M T 3 b positive cells residing immediately superior to cells expressing cytokeratin 5/6 (Figure 10 B) . It is apparent that in the adult, horizontal basal cells do not express D N M T 3 b . B y process of elimination, the immunohistochemical data when taken together shows thatthe cells expressing D N M T 3 b reside in between the horizontal basal cell layer and the immature neuron layer suggesting that the cell type expressing D N M T 3 b is restricted to globose basal cells. Unfortunately, confirmation of the G B C identity with available G B C markers was not possible because conditions for D N M T 3 b detection were not compatible with the conditions for G B C detection. D N M T 3 b is expressed in the S-phase of a sub-population of proliferating progenitors in the P5 OE-The globose basal cell layer is consistent and uniform in the adult O E . The patchy distribution of D N M T 3 b in the adult O E suggests that only a subpopulation of G B C s express D N M T 3 b . Globose basal cells are also the most actively proliferating cells in the olfactory epithelium (Schwartz Levey, Chikaraishi et al. 1991). To assess whether D N M T 3 b expression is correlated with a proliferating population of the presumptive G B C s , co-detection of D N M T 3 b was performed with proliferating cell nuclear antigen ( P C N A ) which is expressed and active during the S-phase of mitosis (Figure 11 A ) . A t P5 the O E is still undergoing extensive neurogenesis and a large 59 A 3 b / P C N A • • • B PCNA A p # f • ' ORN k Q D N M T 3 b ¥ D / C K 5 / 6 E ^ / 6 / P C N A Y F Figure 11: DNMT3b Expression in Proliferating Cells in the P5 OE. (A) PCNA (green) is highly co-expressed with DNMT3b (red) in most basal cells, overlap (orange). Some PCNA expressing cells have clear foci of PCNA expression corresponding to concentrations at replication forks (thin white arrow) Dashed line=basal lamina. (A-C) Occasional cells express PCNA singly (white arrowhead) or DNMT3b singly (thick white arrow). (B) PCNA(white). Ap=Apical layer of OE. ORN=ORN layer of OE. GBC=GBC layer of OE. (C) DNMT3b (white). Dashed line=basal lamina. (D) DNMT3b expressing cells (red) do not co-express CK 5/6 (green). (E) In the P5 OE, PCNA expressing cells (green) co-exist with CK 5/6 (red) expressing cells in the same layer. Some PCNA positive cells co-express CK 5/6 (white arrowhead). (F) Secondary only negative control. (A-F) Scale bar = 50 um. 60 number of P C N A positive cells are found in the basal layers and some scattered P C N A positive cells are found near the apical portion of the O E (Carter, MacDonald et al. 2004). Foci of P C N A expression in individual cell nuclei (Figure 11 A thin white arrow) bear resemblance to aggregations of P C N A at replication forks of cells in late S-phase. In the basal layers of the O E at P5, there is a high correlation between D N M T 3 b and P C N A expression. This nuclear co-localization suggests that D N M T 3 b is expressed during the S-phase of cellular proliferation. There are rare examples of cells which are positive for D N M T 3 b and negative for P C N A (Figure 11 A thick white arrow, Figure 11 C) , and cells which are positive for P C N A but negative for D N M T 3 b (Figure 11 A white arrowhead). Since at P5 , globose basal cells and horizontal basal cells are intermixed in the basal layer (Figure 11 D) and clear layerization of G B C s and H B C s does not occur ti l l later in development, the P C N A posi t ive/DNMT3b negative cells may be proliferating H B C s (Figure H E , white arrowhead). To see i f singular D N M T 3 b signals also corresponded to horizontal basal cells in the P5 O E , C K 5/6 was co-detected with D N M T 3 b . From the absence of signal overlap in the co-labelled samples, it is clear that D N M T 3 b is not co-expressed with cytokeratin 5/6 positive H B C s . This leaves open the possibility that the cells expressing D N M T 3 b without P C N A are either newly generated neurons or a sub population of non-proliferating G B C s . To further investigate the relationship between D N M T 3 b and proliferating presumptive G B C s during development, co-detection of D N M T 3 b with P C N A and N S T was performed in the E l 7, P5, and adult O E . A t E l 7, two main populations of dividing 61 cells are present, marked by the expression of the S-phase specific marker, proliferating cell nuclear antigen ( P C N A ) (Figure 12 A ) . The two populations are generally restricted to 1-2 cell layers in the apical portion of the O E and 1-2 cell layts in the basal portion of the O E . The P C N A positive cells in the basal layers are highly associated with D N M T 3 b expression. There are a few examples of D N M T 3 b / P C N A co-expressing cells in the apical layer; however the majority of the cells in the apical population express P C N A exclusively (Figure 12 A , white arrowhead). There are also a small number of cells expressing both D N M T 3 b and P C N A in the middle immature O R N layer (Figure 12 A , thin white arrow). Expression of one of these antigens in this middle population does not occur without expression of the other. In comparison to the E l 7 O E , in the P5 O E the apical population of P C N A positive S-phase cells is decreased (Figure 12 A+B, white arrowheads). The basal population of D N M T 3 b / P C N A positive cells still appears unchanged from the E l 7 O E . Co-detection of D N M T 3 b and N S T in the E l 7 and P5 O E also show that the rare D N M T 3 b positive cells in the middle O R N layer are distinctly N S T negative and are thus not of the neuronal lineage (Figure 12 E+F, thin white arrows). A t face value, D N M T 3 b positive cells do not co-express N S T in any of the populations of D N M T 3 b positive cells, apical, basal, or migratory, and are thus not of the neuronal lineage, as was seen previously in the adult O E (Figure 12 E). However, upon closer examination, at E l 7 and P5 a small number of cells expressing D N M T 3 b in the basal layer also do express N S T (Figure 12 E+F white arrowheads). In general, the cells co-expressing D N M T 3 b and N S T expressed both of them weakly in comparison to cells expressing either D N M T 3 b or N S T singly. In the adult O E , the apical population of proliferating cells are completely depleted and the numbers of P C N A positive or 62 DNMT3b/ DNMT3b/ PCNA NST E17 A "t * T E P5 B" / X m 6d P B L e s i o n C \ \ \ v^s % \ \ H i D 6d P B v 1 \v k * V \ t C o n t r o l •Vv i i - T V . * i Figure 12: Cellular Expression of DNMT3b in the OE at E17, P5, and in Unilateral Bulbectomies. (A-D) DNMT3b (red), PCNA (green), co-localization (orange). (A) DNMT3b and PCNA expression at E17. Apical population of proliferating cells (white arrow). Cell migrating through the middle layer (thin white arrow). PCNA +ve/ DNMT3b -ve cell (white arrowhead). (B) DNMT3b and PCNA expression at P5. Apical population of proliferating cells (white arrow). Cell migrating through the middle layer (thin white arrow). (C,D,G,H) Double headed white arrows denote the thickness of the OE to show the contrast the effect to the OE after a bulbectomy to the control unlesioned side. (C) Unlesioned side of a unilaterally bulbectomized adult mouse 6 days post bulbectomy. (D) Lesioned side of a unilaterally bulbectomized adult mouse 6 days post bulbectomy. (E-H) DNMT3b (red) NST, (green). (E) DNMT3b and NST expression at El7. DNMT3b/NST positive cell (white arrow). DNMT3b +ve/ NST -ve cell (thin white arrow). (F) DNMT3b and NST expression at P5. DNMT3b/NST positive cell (white arrow). DNMT3b +ve/ NST -ve cell (thin white arrow). (G) Unlesioned side of a unilaterally bulbectomized adult mouse 6 days post bulbectomy. (H) Lesioned side of a unilaterally bulbectomized adult mouse 6 days post bulbectomy. (I) Secondary only negative control. (A-H) Scale bar = 100 um. 6 3 D N M T 3 b positive cells in the basal layers is also vastly decreased as was described before (Figure 12 C) . In the O E 6 days after bulbectomy, there is an obvious thinning of the olfactory epithelium (Figure 12 C+D, double headed white arrows) concomitant with an increase in the number of P C N A / D N M T 3 b positive cells, occurring in a single cell layer in the basal layer but no new proliferation in the apical region of the O E (Figure 12 D). After bulbectomy, there is also an increase in the number of N S T positive cells in the O E following bulbectomy (Figure 12 G+H). The cell populations in the OE expressing DNMT3b shifts between E17 and P5-As mentioned previously D N M T 3 b expressing cells can be found in the apical, middle, and basal layers of the O E depending on the age of the mouse. Counts of the D N M T 3 b positive cells in each of these layers at E17 and P5 were performed to see i f the numbers of D N M T 3 b positive cells in each population changed in accordance to the development of the O E . A t E l 7, D N M T 3 b expressing cells can be found in each of the three compartments of the O E . B y P5, there are more D N M T 3 b expressing cells in the basal layer, a slight decrease of D N M T 3 b expressing cells in middle pseudolayer, and a significant drop in the number of D N M T 3 b expressing cells in the apical layer (Figure 13). This change in the number of D N M T 3 b positive cells is concomitant with the changes in P C N A positive expressing cells over the same time point (Figure 12 A - B ) and with an increase in the number of N S T expressing IRNs (Figure 12 C-D) . DNMT3a is expressed in a subset of immature and mature olfactory receptor neurons-Immunohistochemical analysis in the adult O E was performed to determine the 64 mm Cells Epressing DNMT3b in the Basal Layer in the E17 and P5 OE c Cells expressing DNMT3b in the Middle Layer of I the E17 and P5 OE o Cells Expressing DNMT3b in the Apical Layer of the E17 and P5 OE 4.0 -3.0 -2.0 -1.0 -E17 [PS Caudal E17 P5 Md E17 P5 Rostral • Turbinate 1.3 0.0 1.0 00 1.7 0.0 • Septum 0.7 00 0 0 0.0 0.3 0.0 • Arch 1.7 0 0 2 3 0.0 1.3 0.0 Figure 13: Numbers of DNMT3b Expressing Cells in the Apical, Middle, and Basal Regions of the E17 and P5 OE. Rostral, Mid, and Caudal designations refer to the position of the coronal section where the caudal section is one that contains the outermost layers of the bulb. The mid section is sampled precisely 140 um rostral to the caudal section, and the rostral section is sampled precisely 140 um rostral to the mid section. Consistent locations in the OE were used for counts corresponding to the septum (red shading), arch (blue shading) and medial-lateral turbinate (yellow shading). Refer to inset. The OE is further divided into 3 pseudolayers, the most basal (Basal), the most apical (Apical), and everything else in-between (Middle) for cell counts. 65 H GAP43 f _ i J * . Figure 14: Co-detection of DNMT3a and Cell-Type Specific Antigenic Markers in the Adult and P5 Olfactory Epithelium. (A-I. K-N) Adult OE. (A) DIC picture of DNMT3a in the adult OE detected with VIP. DNMT3a (purple) (C,D, G-N) DNMT3a (red). (B) DNMT3a (white) is generally expressed in a continuous layer in the adult OE. White dashed line=basal lamina. (C) Some NCAM (green) expressing cells co-express DNMT3a. (D) A subset of cells expressing OMP (green) co-express DNMT3a, co-localization (orange). Some DNMT3a expressing cells do not co-express OMP (white arrow). (E+F) DNMT3a and OMP signal intensities are inversely correlated. A cell expressing DNMT3a highly expresses OMP weakly (white arrowhead). A cell expressing DNMT3a lowly expresses OMP highly (thin white arrow). (G) Many cells expressing NST (green) and (H) GAP43 (green) co-express DNMT3a (I) Cytokeratin 5/6 (green) expressing HBCs do not co-express DNMT3a. (J) In the P5 OE, DNMT3a expressing cells do not co-express PCNA. (K-N) Secondary only negative controls. (A,C-J) Scale bar = 50 um. (B) Scale bar = 200 um. 66 identities of the cells expressing D N M T 3 a . D N M T 3 a was found expressed in 3-5 cell layers above the basal layers of the O E (Figure 14 A ) . In comparison to the patchy expression of D N M T 3 b in the basal layers, D N M T 3 a was more uniformly distributed across the O E (Figure 14 B) . Co-analysis of D N M T 3 a expression with other cell specific markers in the O E demonstrated that D N M T 3 a expressing cells lie superior to, and are not co-expressed in cells staining positive for cytokeratin 5/6 (Figure 14 I). The D N M T 3 a expressing cells are thus not horizontal basal cells. When D N M T 3 a is co-detected with N C A M and O M P , markers of mature olfactory receptor neurons, it is clear that a subpopulation of mature olfactory receptor neurons express D N M T 3 a . Co detection of D N M T 3 a with N C A M shows that D N M T 3 a pos i t i ve /NCAM positive cells exist in a more basally located population of N C A M positive cells. Many N C A M posi t ive/DNMT3a negative cells are found superior to N C A M / D N M T 3 a positive cell population. In addition, D N M T 3 a is not expressed in a solid layer in the basal O E but is also interspersed with N C A M posi t ive/DNMT3a negative cells (Figure 14 C) . Most of the cells expressing D N M T 3 a also express N C A M , but there are a few instances where the N C A M signal is weak or nonexistent which is due presumably to decreased N C A M expression in early stage maturing neurons. Thus the early indication is that D N M T 3 a is expressed by neurons. D N M T 3 a is also expressed by a basal subpopulation of O M P positive cells (Figure 14 D). Most D N M T 3 a positive cells are also O M P positive, however there are a few instances where the D N M T 3 a is expressed in cells which do not express O M P (Figure 14 D, white arrowheads). In addition, there is also what appears to be an inverse relationship between the intensity of 67 the D N M T 3 a and O M P signals where cells expressing high amounts of D N M T 3 a generally express lesser amounts of O M P as assessed by immunofluorescent signal intensity (Figure 14 E+F, thin white arrows), and cells expressing low amounts of D N M T 3 a generally express higher amounts of O M P (Figure 14 E+F, thin white arrows). D N M T 3 a expression is also highly associated with markers of early immature neurons, N S T and G A P 4 3 . As described before, the cells which have recently committed to the neuronal lineage express N S T highly in the cell bodies and cell surface. Almost all of the cells expressing N S T in this pattern also express D N M T 3 a (Figure 14 G). In addition, all cells expressing G A P 4 3 in the cell body also express D N M T 3 a (Figure 14 H). Since there are no instances where N S T or GAP43 positive cells do not co-express D N M T 3 a , this suggests tat all early immature neurons express D N M T 3 a . The level of expression of N S T and G A P 4 3 by each cell within the immature O R N population, as visualized by the intensity of the signal, appears to encompass a range where some cells express N S T or G A P 4 3 in higher amounts than others. In general, the more weakly N S T and GAP43 expressing cells are superior to the more highly expressing cells. The various levels of expression may correspond with levels of maturity, where cells just entering an immature phase or exiting the immature phase express less N S T or G A P 4 3 . There are some cells which express D N M T 3 a which do not express N S T and some cells which do not express GAP43 (Figure 14 G+H, white arrows). These cells are typically superior to the cells that do express N S T and G A P 4 3 and are l ikely to be ORNs . 68 P C N A was used previously to identify the presumptive proliferating basal progenitor cells in the O E . Dogma states that a characteristic of neurons are that they are post mitotic. To further examine the characteristics of cells expressing D N M T 3 a , co-detection of D N M T 3 a and P C N A was performed in the P5 O E (Figure 14 J). This analysis showed that the cells expressing these antigens are separate demonstrating that the cells expressing D N M T 3 a are non-mitotic and therefore exclusively neuronal by state and position. D N M T 3 a is expressed in post-mitotic immature receptor neurons at terminal differentiation into mature olfactory receptor neurons but not immediately after assumption of the neural cell fate-Like D N M T 3 b , D N M T 3 a expression during early development of the O E is slightly different in comparison to the adult state. In comparison to the expression pattern seen in the adult O E , where all cells expressing N S T also expressed D N M T 3 a , the correlation between expression of N S T with D N M T 3 a is less stringent at E l 7 and P5 (Figure 15 A+B) . A t E17 and particularly at P5, it is still apparent that N S T is co-expressed with D N M T 3 a in some cells, however there is also a population of cells underneath the D N M T 3 a positive cells which express N S T but not D N M T 3 a (Figure 15 B, white arrow). Upon closer examination, the highest cell body N S T expression is in the basal population of the I R N cell layers, including the D N M T 3 a negative and D N M T 3 a positive cells. The level of N S T in the cell body and the level of D N M T 3 a in the nucleus are inversely correlated. In the more apical layers, N S T expression is decreased coincident with a higher D N M T 3 a signal. In general, D N M T 3 a is expressed at lower levels in more basally located cells and in a continuum of increasing 69 DNMT3a/ DNMT3a/ NST OMP P5 6dPB Lesion 6dPB Control A * J- ~ ~ E B k > • A.*. F G -•• Sikt D H . f I J DNMT 3 a Figure 15: Cellular Expression of DNMT3a in the OE at E17, P5, and in Unilateral Bulbectomies. (A-D) DNMT3a (red), NST (green). (A) Expression of DNMT3a and NST at E17. (B) Expression of DNMT3a and NST at P5. NST positive/ DNMT3a negative cells (white arrowhead). (C,D,G,H) Double sided white arrows denote the thickness of the OE to show the contrast the effect to the OE after a bulbectomy to the control unlesioned side. (C) Unlesioned side of a unilaterally bulbectomized mouse 6 days post bulbectomy. (D) Lesioned side of a unilaterally bulbectomized mouse 6 days post bulbectomy (E-H) DNMT3a (red) OMP, (green). (E) Expression of DNMT3a and OMP at El7. White dashed line=basal lamina. (F) Expression of DNMT3a and OMP at P5. DNMT3a positive/ OMP negative cells (white arrowhead). (G) Unlesioned side of a unilaterally bulbectomized mouse 6 days post bulbectomy. (H) Lesioned side of a unilaterally bulbectomized mouse 6 days post bulbectomy. (I) Secondary only negative control. (J) DNMT3a in P5 OE. Yellow arrow denotes a gradient of increasing DNMT3a signal intensity from low intensity in the basal OE to high intensity in the apical OE. (A-I) Scale bar = 100 um. (J) Scale bar = 100 um. 70 Figure 16: Numbers of DNMT3a Expressing Cells in the E17 and P5 OE. Rostral, Mid, and Caudal designations refer to the position of the coronal section where the caudal section is one that contains the outermost layers of the bulb. The mid section is sampled precisely 140 um rostral to the caudal section, and the rostral section is sampled precisely 140 um rostral to the mid section. Consistent locations in the OE were used for counts corresponding to the septum (red shading), arch (blue shading) and medial-lateral turbinate (yellow shading). Refer to inset. 71 expression in the more apically located cells (Figure 15 J). In the apical O R N layers, D N M T 3 a is clearly expressed in some cells that do not express N S T . These cells are probably N S T negative mature neurons. Between the E l 7 , P5 and adult O E there are also differences in the number of D N M T 3 a expressing cells in the O E . Ce l l counts of the number of D N M T 3 a expressing cells in the O E indicate that more D N M T 3 a positive cells are present at P5 than at E l 7 . The higher number of D N M T 3 a expressing cells suggest that a larger population of IRNS are ready to, or undergoing terminal differentiation at P5 than at E17 (Figure 16). In the embryonic and P5 O E , there are also many more D N M T 3 a posit ive/OMP negative cells in comparison to the adult O E where most D N M T 3 a positive cells also expressed some O M P (Figure 14 D, Figure 15 E + F). From these early developmental time points, it is clear that D N M T 3 a is expressed before O M P and O M P is expressed at the tail end of D N M T 3 a expression. A return to the developmental pattern of D N M T 3 a expression in the adult O E can be elicited by bulbectomy induced neurogenesis. In comparison to the control unlesioned side, the ipsilateral O E 6 days post bulbectomy demonstrates an increase in the number of D N M T 3 a positive cells and a decreased number of O M P positive cells (Figure 15 C , D , G,H). Interestingly, not many cells co-express both of the antigens in comparison to the unlesioned side where most of the D N M T 3 a positive cells also express O M P . 72 Histone deacetylase 2 is expressed in a sub-population of DNMT3b positive presumptive GBCs, through the immature ORN layer, and into a subpopulation of DNMT3a positive ORNs-HDAC2 is a component common to many of the various protein complexes recruited to methylated D N A . It is a wel l characterized functional intermediate in the progression from methylated D N A to compact, transcriptionally silent chromatin. In the E17, P5, and adult O E , H D A C 2 is differentially expressed in the nuclei of basally located, D N M T 3 b positive, presumptive globose basal cells. Some of these basally located D N M T 3 b positive cells do not express H D A C 2 (Figure 17 A - C , thin white arrow) and some do express H D A C 2 (Figure 17 A - C , white arrowhead). The expression of H D A C 2 continues from the G B C layer through the immature O R N layer and into the cells expressing D N M T 3 a , interpreted previously as IRNs which may be transitioning from an immature receptor neuron to a mature O R N (Figure 17 D-F). O f the H D A C 2 positive cells in the O R N layer, the more basally located H D A C 2 positive cells do not express D N M T 3 a (Figure 17 D-E , white arrowhead) and only the more basal subpopulation of the D N M T 3 a positive neurons co-express H D A C 2 (Figure 17 D-F). The more apically located D N M T 3 a positive neurons do not express H D A C 2 (Figure 17 D-F, thin white arrows). Interestingly, only a sub population of P C N A positive cells express H D A C 2 (Figure 17 G+H white arrowhead). There are some distinctly H D A C 2 posit ive/NST negative cells in the apical layer and P C N A / H D A C 2 positive cells the middle layer (Figure 17 G+H). In parallel to the co-expression of D N M T 3 a and H D A C 2 , H D A C 2 expression continues from the population of immature O R N s into the population of mature O R N s shown by the overlap between the basal 73 Figure 17: Expression of Histone Deacetylase 2 with DNMT3b, DNMT3a, and PCNA in the E17, P5 and Adult OE. (A-C)HDAC2 (green). DNMT3b (red). Overlap (orange). DNMT3b/HDAC2 positive cell (white arrowhead). DNMT3b positive/HDAC2 negative cell (thin white arrow). In the El7 (A), P5 (B), and Adult OE (C) DNMT3b is expressed in a sub-population of basally located DNMT3b positive cells and in all DNMT3b positive cells not located basally. (D-F) HDAC2 (green). DNMT3a (red). Overlap (orange). (D-E) DNMT3a negative/HDAC2 positive cell (white arrowhead). (D-F) DNMT3a positive/HDAC2 negative cell (thin white arrow). In the El7 (D), P5 (E), and Adult OE (F) HDAC2 is expressed by the more basal subpopulation of DNMT3a positive cells. (G-H) HDAC2 (green). PCNA (red). Overlap (orange). In the E17 (G) and P5 OE (H) HDAC2 is expressed in a subpopulation of both apically located (thin white arrow) and basally located (white arrowhead) proliferating cells. Thick white arrow = PCNA +ve, DNMT3b -ve cell. (I) In the P5 OE HDAC2 is expressed in the more basal subpopulation of OMP positive cells. HDAC2 (green). OMP (red). OMP positive/ HDAC2 negative cell (white arrowhead). (J) Secondary only negative control. (A-I) Scale bars = 100 um 74 subpopulation of O M P positive cells and H D A C 2 in the P5 O E (Figure 17 I). The apically located O M P positive O R N s , corresponding to older mature O R N s do not express H D A C 2 (Figure 171, white arrow). As previously described, in the E l 7 and P5 O E there are two populations of proliferating cells. One population is found in the apical region of the O E , the other is found in the basal region of the O E . D N M T 3 b is differentially expressed in these populations of cells, showing a high amount of co-expression with P C N A in the basal layers and a lower amount of co-expression with P C N A in the apical layers (Figure 12). Subpopulations of both the basally dividing and apically dividing cell populations co-express H D A C 2 (Figure 17 G+H). Interestingly, all of the D N M T 3 b expressing cells in the apical population also express H D A C 2 (Figure 17 B) but most of the P C N A positive cells in the apical layer do not co-express H D A C 2 (Figure 17 G+H). In addition, the D N M T 3 b positive cells found in between the two layers and which are thought to be migrating also express H D A C 2 . Expression of DNMT3b and DNMT3a in other systems show parallels to their expression in the OE-Immunohistochemistry was performed in other developing tissues including other neuronal sensory tissues to see i f the patterns of D N M T 3 b and D N M T 3 a expression in the O E shared parallels to otherdevelopin g systems. In sagital cortical sections, N S T is highly expressed in the cortex (Figure 18 A ) . In contrast, D N M T 3 b is expressed by a small subpopulation of N S T positive cells in cells in the cortex appearing to be migrating radially outwards from the regions surrounding the lateral ventricle (Figure 18 A + C) . In comparison to the basal population in the O E , the P C N A positive 75 cells are not co-expressed with P C N A . P C N A is expressed highly by cells in the subventricular zones, through the R M S , and into the olfactory bulb (Figure 18 B) . The adult olfactory bulb (OB) contains a highly organized network of neurons and supporting cells. A t P5 the olfactory bulb is still undergoing development and cells in the O B are maturing. D N M T 3 b is expressed in a small sub-population o f peri glomerular cells in the region where glomeruli form (Figure 18 C) . The cells in this region l ikely correspond to periglomerular cells or astrocytes. In the adult O B , mature periglomerular cells are highly organized and encircle glomeruli. There are also a few cells in the inner regions of the bulb which express D N M T 3 b (Figure 18 C) . Interestingly, D N M T 3 b is also detected in the forming glomeruli where there are no cell bodies nor nuclei present. It is not clear i f this signal is real or i f it is non-specific. There are a few D N M T 3 b expressing periglomerular cells which also co-express N S T in the periglomerular cell region (Figure 18 thin white arrow). D N M T 3 a is widely expressed in several regions of the O B . L ike D N M T 3 b , it is expressed in the periglomerular cell region near the forming glomeruli but in much higher numbers that D N M T 3 b . In addition, like D N M T 3 b , D N M T 3 a expressing cells in this region do not form tight boundaries around the glomeruli as is seen in the adult bulb (Figure 18 A ) . D N M T 3 a is also expressed in the granule cell layer and in the putative mitral/tufted cell layer. Most of the cells in the granule and mitral cell layers express P C N A exclusively. There is a subpopulation of the P C N A expressing cells in these regions which co-express P C N A and small population of the cells which express D N M T 3 a exclusively. In contrast, in the periglomerular region, most cells express 76 Figure 18: DNMT3b and DNMT3a expression in the sub ventricular zone and in the developing olfactory bulb. (A-C) El 7 sagital section of lateral ventricle. OB=olfactory bulb. SVZ=sub-ventricular zone. LV=lateral ventricle. RMS=rostral migratory stream. OE=olfactory epithelium. (A) DNMT3b (red), NST (green). (B) PCNA. (C) DNMT3b. (D-F) P5 olfactory bulb. (D) DNMT3a (red) PCNA (green). Gl=glomerular layer. M=mitral/tufted cell layer. G=granule cell region. White inset box=2X magnification of gray inset box. Thin white arrow=DNMT3a/PCNA +ve cell. Thick white arrow=DNMT3b +v3, PCNA -ve cell. (E) DNMT3a (red) NST (green). White inset box=2X magnification of gray inset box. Thin white arrow=DNMT3a/NST +ve cell. (F) DNMT3b (red), NST (green). White inset box = 2X magnification of gray inset box. Thin white arrow = DNMT3b/NST positive cell. Thick white arrow = DNMT3b positive cell. (D-F) Scale bar = 150 um 77 Figure 19: D N M T 3 b and D N M T 3 a Expression in the Developing Vomeronasal Organ, , Retina, Taste Pits, and Thymus. (A-D) P5 vomeronasal organ. (A) DNMT3b (red), PCNA (green). RE=respiratory epithelium. VC=vomeronasal cavity. vORN=vomeronasal receptor neuron layer. (B) DNMT3a (red), PCNA (green). (C) DNMT3b (red) OMP (green). (D) DNMT3b (red) CK5/6 (green). (E-F) El6 retina. (E) DNMT3b (red), NST (green). (F) DNMT3b (red), HDAC2 (green). (G-H) P5 retina. (G) DNMT3a (red), NST (green). (H) DNMTa (red), HDAC2 (green). (I) E17 tongue. Inset=2x magnification of gray box. 0=oral cavity. T=tongue. DNMT3b (red), PCNA (green). White arrowhead=DNMT3b/PCNA+ve cell. (P) E17 thymus. White inset box=2X magnification of gray inset. DNMT3b (red), PCNA (green). (A-D) Scale bar = 200 um (E-H) Scale bar=150 um (I+J) Scale bar=200 um. 78 D N M T 3 a exclusively with a sub-population of cells which co-express D N M T 3 a and P C N A , and an even smaller number of cells which express P C N A exclusively. In the periglomerular region, a subpopulation of the D N M T 3 a expressing cells also express N S T (Figure 18 B) . Both of the de novo D N A methyltransferases are expressed in the P5 vomeronasal organ (VNO) , a pheremonal sensory system closely related to the olfactory system. The epithelium of the vomeronasal organ ( V N O E ) is organized similarly to the O E with immature cells located near the basal lamina and increasing in maturity as the position of the cell rises to the apical regions. The expression of D N M T 3 b and D N M T 3 a in the V N O E closely reflected the pattern seen in the olfactory epithelium. In the P5 V N O E , D N M T 3 b is expressed in a population of cells near the basal lamina and is highly co-expressed with P C N A but not co-expressed in mature vomeronasal receptor neurons ( V N R N S ) (Figure 19 A + C) . D N M T 3 a is expressed in cells in the vomeronasal receptor neuron region, where O M P positive vomeronasal olfactory receptors are also located (Figure 19 B + C). The region of the V N O which expressed P C N A and cytokeratin but not D N M T 3 b nor D N M T 3 a is part of the respiratory epithelium. Similar to the O E , these adjacent respiratory regions do not give rise to V N R N s . The temporal sequence of D N M T 3 b and D N M T 3 a expression in the O E appears to be duplicated in the retina. A t E l 7 , D N M T 3 b is expressed (Figure 19 E + F) but D N M T 3 a is not. In contrast, at P5, D N M T 3 b is no longer expressed but D N M T 3 a is 79 now expressed (Figure 19 G + H). D N M T 3 b is also detected in putative developing taste buds at E17 (Figure 19 I). A t E l 7 , taste buds are undergoing differentiation (Wong, Oakley et al. 1994). In these cells at this time, D N M T 3 b is co-expressed with P C N A and is more highly expressed in the base of the taste bud pit than in the cells expressing P C N A located more apically up the walls of the pit (Figure 19 I). Interestingly, D N M T 3 b is also expressed in a non-neuronal, non-sensory system, the thymus. The thymus at P5 contains T-cells which are undergoing immunoselection. A large number of cells in the thymus express D N M T 3 b . There is a small subpopulation of cells in the thymus which co-express D N M T 3 b and P C N A (Figure 19 J). Summary-These data support the hypothesis that D N M T 3 b and D N M T 3 a are expressed at sequential stages of differentiation in the O R N lineage. D N M T 3 b is expressed by proliferating presumptive G B C s at the transition to immature receptor neurons. D N M T 3 a is expressed by IRNS at the transition to mature olfactory receptor neurons. The number of D N M T 3 b and D N M T 3 a expressing cells varies directly with the rate of neurogenesis in the O E . The numbers of D N M T 3 b and D N M T 3 a expressing cells increases between E17 and P5, when the introduction of odorants from the environment stimulate increased O R N neurogenesis, and is decreased in the adult. The developmental patterns of D N M T 3 b and D N M T 3 a expression can be partially recapitulated by bulbectomy induced neurogenesis. These temporal and cell specific expression patterns of D N M T 3 b and D N M T 3 a suggest that D N M T 3 b is involved in cell lineage decisions and D N M T 3 a is involved jn terminal differentiation. The histone deacetylase H D A C 2 , a 80 mediator of methylation induced transcriptional silencing is expressed appropriately to mediate the actions of DNMT3b and DNMT3a. The sequence of DNMT3b, DNMT3a, and HDAC2 expression in conjunction with markers of cell identity is summarized in Figure 21. 81 H B O G B C - H R N - O R N HDAC2 [DNMT3bJ DNMT3a NST Figure 20: Sequential expression of DNMT3b, HDAC2, and DNMT3a during stages of ORN neurogenesis. D N M T 3 b is expressed in proliferating progenitor cells ( G B C ) through to their transition to the N S T expressing neural cell fate ( IRN). D N M T 3 a is expressed in immature receptor neurons through their transition to O M P expressing mature olfactory receptor neurons ( O R N ) . H D A C 2 is expressed in proliferating progenitor cells through to early mature olfactory receptor neurons. 82 3.4 Characterization of D N M T s in the OP27 Cell Line, a Conditionally Immortalized Cell line from the Embryonic Mouse Olfactory Placode. Introduction-Several cell lines possessing characteristics of olfactory receptor neurons exist (MacDonald, Mackay-Sim et al. 1996; Murrel l and Hunter 1999; Barber, Jaworsky et al. 2000). Two of these, OP6 and OP27 were clonally generated from the E10.5 olfactory placode and conditionally immortalized (Illing, Boolay et al. 2002). These cells have a generally triangular morphology and proliferate at the permissive temperature of 33°C. Over the course of 4-8 days at the non-permissive temperature of 39°C, when the immortalizing U19 tsA58 SV40 Large T antigen is inactive, some of the OP6 and OP27 cells differentiate into bipolar shaped cells similar to cells seen in primary neuron cultures. In collaboration with the Ill ing lab we have previously characterized the transcriptional and protein expression profiles of these cell lines at the permissive temperature and after differentiation. A t the permissive temperature, both cell lines express the transcriptional profile of O R N s in an intermediate transit amplifying stage. Under differentiating conditions, shifts in the transcriptional profile, and in the post-translational modifications of certain gene products occur, similar to what happens in maturing O R N S in vivo. Once terminally differentiated, both cell lines express markers of mature O R N s including odorant receptors and O M P . Although the transcriptional and protein expression profiles of OP6 and OP27 cells largely overlap, their profiles are somewhat staggered suggesting that the two cell lines are slightly different in their 83 developmental stage at the time of immortalization. For example, OP27 cells express Pax-6, an embryonic O R N progenitor transcription factor, in comparison to the OP6 cells which never expresses Pax-6. Addit ionally, in comparison to OP6 cells the level of N S T expression in OP27 cells growing in the permissive temperature is higher and G A P 4 3 expression in OP27 cells increases under differentiating conditions whereas it decreases in OP6 cells. Lastly, differentiated OP6 cells express markers o f mature O R N s such as odorant receptors, O M P , and O C N C 1 earlier and in higher amounts than differentiated OP27 cells. Taken together, this previous analysis places the OP27 cell line at an earlier stage of differentiation than OP6 cells. Using the OP6 and OP27 cell lines as in vitro modefc for developing olfactory receptor neurons w i l l help us understand the molecular events which occur during O R N differentiation. The expression of D N M T 3 b in proliferating presumptive G B C s in vivo implicate it as a candidate methyltransferase involved in cell fate decisions. A s previously described, the OP27 cell line expresses a transcriptional profile which places it slightly earlier in the O R N developmental time line and is thus more appropriate for analyzing early events in O R N development. To determine whether the OP27 and OP6 cell lines are appropriate for studying the functions of D N M T 3 b and D N M T 3 a , the OP cell lines were characterized for D N M T expression by R T - P C R . In addition, to help understand the role of D N M T 3 b in proliferating presumptive progenitor cells of the O E , the nuclear co-localization of D N M T 3 b and P C N A in OP27 cells was analyzed. 84 Results mRNA for DNMT1, DNMT2, and DNMT3b are expressed in the olfactory receptor neuron cell line OP27 and mRNA for DNMT1, DNMT2, DNMT3a, and DNMT3b are expressed in olfactory receptor neuron cell line OP6- Reverse-transcription PCR was used to detect for the presence of mRNA transcripts encoding the various D N M T isoforms in proliferating OP6 and OP27 cells. Splice variant insensitive primers designed to target cDNA for DNMT1, DNMT2, and DNMT3b yielded single PCR amplicons of-600 bp from cDNA generated from proliferating OP27 and OP6 cells indicating that these genes are transcribed in the cell lines (Figure 21). Interestingly, primers complementing DNMT3a cDNAdid not amplify a product in OP27 cells, but yielded a faint product in OP6 cells. This suggests that DNMT3a is differentially expressed in OP27 and OP6 cells. mRNA for DNMT3b splice variants DNMT3bl and DNMT3b4 are expressed in the olfactory receptor neuron cell lines OP27 and OP6-Reverse-transcription PCR was performed on cDNA generated from the OP27 and OP6 cell lines using primers that complemented the exons surrounding the alternatively spliced exons, to amplify the sequence between those exons (Figure 22). Amplification of a single 600 nucleotide product at potential splice site 1 indicates that the DNMT3b proteins expressed by both OP27 and OP6 contain exon 7. In contrast, the amplification of two products at potential splice site 2, corresponding to products of 600 and 400 nucleotides, indicate that two populations of DNMT3b exist in the OP27 and OP6 cell lines, one 85 DN3YIT1 DNMT2 DNMT3a DNMT3b B - a c t i n Figure 21: RT-PCR Detection of DNMT1, 2,3a and 3b in Proliferating OP27 and OP6 Cells. RT-PCR primers complementing the cDNA of maintenance methyltransferase DNMT1, accessory methyltransferase DNMT2 and de novo methyltransferases DNMT3b mRNA amplify PCR products of approximately 600 nt from cDNA generated from OP27 RNA extracts. These primers when used with template cDNA generated from OP6 R N A extracts amplify products for DNMT1, DNMT2, DNMT3a, and DNMT3b. B-actin was used as an internal positive control for successful reverse transcription. 8 6 A l t . Spl 1 A l t . Spl 2 B - a c t i n Figure 22: RT-PCR Assessment of DNMT3b Splice Variants in Proliferating OP27 and OP6 Cells. RT-PCR primers amplifying the sequence between exons 6 and 8 amplify a single ~600 nt product from cDNA templates generated from OP27 and OP6 cell RNA extracts (Alt. Spl 1). RT-PCR primers targeting the sequence between exons 16 and 18 amplify two gene products, one which is -600 nt long and another -400 nt long (Alt. Spl 2) from both OP27 and OP6 cells. B-actin was used as an internal positive control for successful reverse transcription. 87 containing exon 17 and the other in which exon 17 is absent. As described before, these D N M T 3 b splice isoforms correspond to D N M T 3 M and DNMT3b4 . B-actin was used as an internal positive control for successful reverse transcription. DNMT3b is not sequestered to replication foci in S-phase OP27 cells-Immunocytochemistry was used to look at the nuclear distribution of D N M T 3 b in OP27 cells during S-phase. To enrich for the number of cells in each stage of the cell cycle OP27 cells were synchronized at the G l - S boundary by culturing them in low serum conditions followed by growth in media supplemented with aphidicolin, a chemical inhibitor of D N A synthesis. These synchronizing conditions resulted in an increase in the proportion of cells in the G l - S phase boundary, from 4 1 % before synchronization to 73% after synchronizing conditions as determined by F A C s analysis (Figure 23 D). Under synchronizing conditions, P C N A is expressed and localized to the nuclei of OP27 cells (Figure 23 A ) . The nuclear localization pattern of P C N A in these cells in G l phase is diffuse and non-focal and the P C N A signal is distinct from the D N A as inferred by the lack of signal overlap between D N M T 3 b and the D N A intercalating dye, D AP I . When the cells are released from the synchronizing conditions, S-phase is entered and cells in S-phase can be distinguished by an increase in nuclear size and a change in the nuclear localization of P C N A , becoming more focal and granular in appearance as the cell progresses through S-phase (Figure 23 B+C). Two hours after release, most cells are in the beginning of S-phase and the distribution of P C N A within the nuclei looks slightly granular and begins to co-localize with D A P I (Figure 23 B) . This is in distinct contrast to the diffuse P C N A signal in the nuclei of G l phase cells. The aggregations of P C N A 88 l ikely represent the beginnings of P C N A clustering to replication forks (Nomura 1994). A t 4 hours post release from synchronization, large foci of P C N A are organized in the cell nucleus, typical of late stage S-phase distribution of P C N A to replication foci (Figure 23 C) . A t 4 hours there is a distinct overlap of P C N A and D A P I signal at the putative replication foci and also exclusive D A P I signals without P C N A . In vivo, D N M T 3 b is expressed within P C N A positive cells in the basal layer of the O E . This is also true of the P C N A positive OP27 cells. L ike P C N A , the expression of D N M T 3 b is also quite diffuse in G I phase OP27 cells (Figure 23 A ) . Co-detection of D N M T 3 b and P C N A in G I phase shows what appears to be diffuse co-localization as inferred by the overlap in signal. It is also apparent that D N M T 3 b and P C N A are excluded from D N A in G I phase due to the lack of overlap between the P C N A or D N M T 3 b signals with D A P I . D N M T 3 b was co-detected with P C N A in S-phase OP27 cells. In both early and late S-phase, there is minimal overlap between the D N M T 3 b and P C N A signals (Figure 23 B+C). This is particularly apparent in the late S-phase nuclei where the large P C N A foci are generally devoid of overlap with the D N M T 3 b signal. The exception to this is some signal overlap in the central part of the nuclei but this is l ikely to be false co-localizations due to the depth of the cell. This is substantiated by the fact that the overlapped signals do not correspond to distinct foci of D N M T 3 b and P C N A signal but correspond to overlaps of fuzzy signals. The lack of signal overlap indicates that D N M T 3 b and P C N A are not co-localized in the nuclei suggesting that D N M T 3 b is not recruited to replication foci during OP27 proliferation. 89 A G I 3 Early-Late Figure 23: Expression of DNMT and PCNA in Proliferating OP27 cells. (A) OP27 cells in late GI phase. (B) OP27 cells in early S phase. (C) OP27 cells in late S-phase. (D) Typical FACs profile of culture in G lphase. (D) Typical FACs profile of culture enriched for early S-phase cells. (E) Typical FACs profile of culture enriched for late S-phase cells. 9 0 D N M T 3 b does not form the distinct foci that is typical of P C N A in late S phase (Nomura 1994). It appears that minimal foci of D N M T 3 b are present in early and late S-phase. However, these foci do not form to the organized extent that is achieved by P C N A as the minimal foci of D N M T 3 b are intermixed with non-discrete fuzzy D N M T 3 b signals. Some overlap of the D N M T 3 b signal with D A P I does appear to occur during S-phase that is of a distinctly different pattern than that seen in G I where the signals are clearly non-overlapping. However it is not clear whether this overlap is a true reflection of recruitment of D N M T 3 b to the D N A and it is not conclusive whether D N M T 3 b is recruited to the D N A during S-phase. Summary- Characterization by R T - P C R indicates that D N M T 1 , D N M T 2 , and the de novo methyltransferase D N M T 3 b are expressed in the OP6 and OP27 cell line models for O R N development. The two splice variants of D N M T 3 b m R N A that are expressed in the olfactory epithelium encoding D N M T 3 M and D N M T 3 b 2 , are the same variants expressed in both the OP6 and OP27 cell line. D N M T 3 a is differentially expressed in the OP cell lines, being expressed in the more mature OP6 cell line but not in the OP27 cell line. Thus D N M T 3 b and D N M T 3 a are expressed in the cell lines appropriately to the stages of O R N development they were previously characterized, and at stages consistent with the in vivo expression. Immunocytochemistry show that at G I , D N M T 3 b along with P C N A is localized diffusely in the nucleus. When these cells enter S-phase, P C N A is recruited to D N A gradually aggregating to distinct foci but D N M T 3 b does not colocalize to those same foci, demonstrating that D N M T 3 b is not recruited to replication forks at the same time as P C N A . 91 Chapter 4 : Discussion Most in-silico tools for bioinformatics are constantly undergoing rounds of improvement. The software used for predicting C p G islands is no exception as the sensitivity and selectivity of C p G island detection are refined as features of C p G islands are better elucidated. Presently, C p G island finding tools are evaluated by how well the predicted C p G islands correspond with the loci of known genes since one of the general features of C p G islands is their close association with the promoters and initial coding exons of genes. In this study the user-defined parameters input into the C p G island predicting tool yielded results where 82% of the total predicted C p G islands overlapped with the initial coding exon of a known or putative gene (Table 4). In the sequences surrounding and containing the O R gene clusters used in the analysis, none of the predicted C p G islands were located within 3 kilobases of a functional odorant receptor gene suggesting that C p G islands aren't involved with regulating O R gene expression. In general, the C p G islands are excluded from O R gene clusters (Figure 6). The C p G island identified on the analyzed region of Chr 17 found internal to the O R gene cluster is unique because it is located within 3 kb of an O R pseudogene. It is possible that C p G islands might contribute to the silencing and subsequent inactivating divergence of proximally inserted duplicated O R genes. However, C p G islands are not common features to O R pseudogenes, and i f this were the case for this pseudogene it would probably be an exception to, rather than the rule. The C p G islands predicted internally to the O R gene cluster on Chr 19 are also interesting because 3 of them are associated with putative genes. Two of the C p G islands are associated with the first coding exon of the 4933402K05Rik gene which is not only located internally to the O R gene cluster but also 92 interrupts the OR202 sub-family. This is interesting because it is thought that the presence of non-OR genes located within O R gene clusters is a rare occurrence. The O R gene cluster analyzed on chromosome 19 also has a higher than average number of internal C p G islands in comparison to the other analyzed O R gene clusters. This may be a consequence of this O R gene cluster being located close to the centromere of chromosome 19 because pericentromeric regions are typically heavily methylated and compact. The purpose of these C p G islands may be to offset the chromatin condensation at the loci of the O R genes preventing them from being silenced. A B l repetitive element is a short, highly repeated, interspersed repeat element similar to human A l u elements. It is the predominant C p G rich motif, present in over a mi l l ion copies interspersed widely throughout the genome. They contain an R N A polymerase III promoter and are transposed around the genome through an m R N A intermediate and are responsible for a variety of diseases when transposed into the coding or regulatory regions of genes. The frequency of retrotransposition is kept in check because B l repetitive elements are hypermethylated effectively silencing the transcription of the m R N A intermediate (Englander, Wolffe et al. 1993). The B l repeat elements identified in this study show a poor proximal correlation with the promoter regions of functional O R genes and are not a common feature of O R genes within a subfamily (Figure 7, Table 5). L ike the C p G islands internal to the Chr 19 O R gene cluster, there is also a predominance of B l sequences in this pericentromeric region. This raises the possibility that this region of D N A containing the O R gene cluster has a 93 heterologous packing structure, with areas of heavy methylated condensed chromatin interspersed with sparsely methylated uncondensed chromatin. The purpose of this analysis was to see i f OR genes were associated with motifs which have stable methylation states and if these motifs were conserved between OR genes of a subfamily. The absence of a correlation between CpG islands, which are stably methylation poor and associated with genes which are constitutively transcribed, and OR genes suggests that 1) OR genes are not protected from methylation and thus not constitutively transcribed and 2) regulation by CpG islands is not a common paradigm to similarly expressed OR genes. Conversely, the absence of a strong correlation between B l repeat elements, which are stably methylation rich and associated with silent loci, and OR genes suggests that 1) OR genes are not associated with constitutively heavily methylated D N A and are not constitutively silent and 2) regulation by B l repeat elements is not a common paradigm to similarly expressed OR genes. This leaves open the possibility that individual OR genes are dynamically or variably regulated by selective or targeted CpG methylation. One way in which individual OR genes within a sub-cluster may be targeted similarly despite a lack of consensus motifs is by the targeting of semi-sequence dependent structural elements upstream of the gene by D N A methyltransferases. Alternatively, it is widely believed that the clustered organization of OR genes is important in their transcriptional control. OR genes within a gene cluster are either commonly expressed or commonly silenced according to the distinct regions of the OE. 94 It would be efficient i f clusters were activated or silenced as a whole. C p G methylation can spread laterally to silence surrounding regions once it has been established at a single locus, providing a mechanism by which multiple O R genes may be silenced as a unit without a requirement for a sequence or structural element common to each individual O R gene for targeted methylation. C p G islands inherently resist methylation and may act as buffers stopping the spread of methylation outside the gene cluster. Wi th regard to the organization of the C p G islands around the O R gene clusters analyzed in this study, C p G islands acting as buffers to spreading methylation seems to be a distinct possibility in some of the cases. The O R gene cluster at 94.5 megabases on chromosome 1, and the O R gene clusters analyzed on chromosomes 9 and 16 are all tightly flanked by C p G islands. C p G islands found internally to an O R gene cluster, such as in the O R gene cluster on chromosome 19, may represent internal boundaries of methylation. However, as mentioned before, 2 of the C p G islands within this gene cluster interrupt the O R gene sub-family 202 (Figure 6 F). This arrangement does not fit with the belief that O R sub-family members are similarly regulated since this C p G island would interrupt the common transcriptional control of the sub-family. In addition, as discussed previously the early indication from experiments inserting O R genes from foreign clusters into new clusters is that the information dictating wi ld type O R gene expression is present within the 3 kb of genomic sequence upstream of the O R gene. Unt i l more comprehensive studies are performed to see whether every O R gene has an entire complement of regulatory information in the proximal upstream region, it w i l l remain unclear i f regulation of clusters as a single unit is a mechanism to O R gene regulation. Nonetheless, it is still l ikely that epigenetic mechanisms such as D N A methylation do 95 play a role in O R gene silencing as recent publications have shown that mice cloned from post mitotic olfactory neurons express a wi ld type complement of O R genes suggesting a reversible regulatory mechanism (Eggan, Baldwin et al. 2004). One of the interesting characteristics of D N A methylation is that it is heritable and is a l ikely mechanism in events where long-term or irreversible changes in transcription occur such as in cell lineage decisions and cellular differentiation, all of which occur in the olfactory epithelium. Alternatively, D N A methylation could be involved in the allelic exclusion of O R genes similar to what occurs in T-cel l receptor selection in the immune system. Expression of m R N A encoding the 4 major D N M T isoforms was identified in the olfactory epithelium as early as E l 1 and into adulthood by R T - P C R analysis (Figure 8). D N M T 1 is a maintenance methyltransferase and its function is to faithfully pass on methylation patterns to daughter cells during cell proliferation. Indirectly, the expression of D N M T 1 suggests that cell proliferation is occurring in the O E throughout life. This is known to be true because basal cells in the O E proliferate to replenish the neuronal population in the O E . The expression of the de novo methyltransferases D N M T 3 a and D N M T 3 b from as early as E l 1 and into adulthood is more interesting because expression of these two proteins is not highly nor widely expressed in mammals after early development (Okano, Be l l et al. 1999). The known catalytic activity of these proteins, establishing new methylation marks suggests that methylation re patterning is occurring in the O E . This fits with the dogma that lineage decisions and fate refinement, events which require long term changes in transcriptional profile, are occurring in the O E . However the role of D N M T 3 b and D N M T 3 a in these specific events has yet to be 96 confirmed. In addition, the expression of both of the de novo methyltransferases is intriguing because the catalytic specificity of D N M T 3 a and D N M T 3 b is known to be only minimally redundant suggesting that separate and unique de novo methylation events are occurring in O E . The number of potential players in de novo methylation events in the O E is brought up to three by the identification that two alternatively spliced m R N A variants encoding D N M T 3 b , D N M T 3 M and D N M T 3 b 4 , are transcribed in the O E (Figure 9). The existence of several variants of D N M T 3 b holds intriguing potential for specific targeting preferences or unique functional activity (Okano, Be l l et al. 1999). However, the functional differences between the splice variants are not well understood in any developmental system. Investigations into the expression patterns of alternative D N M T 3 b m R N A have shown that the D N M T 3 b m R N A expressed in embryonic stem cells always contain exon 7, as does the O E , whereas somatic cell lines express the transcript lacking exon 7 (Weisenberger, Vel icescu et al. 2004). This exon may be an important delineator for D N M T 3 b function in embryonic stem cells compared to somatic cells. D N M T 3 b is known to have more than one function and previous research has shown that D N M T 3 b can interact with D N M T L Transcripts lacking exon 7, corresponding to the somatic cell specific splice variants, can augment maintenance methylation (Nguyen, Gonzales et al. 2001). In experiments with human cancer cell lines depletion of D N M T 3 b using splice variant insensitive antisense oligonucleotides slowed proliferation by 2.7 ± 0.5 X and increased cell death. W i l d type proliferation was restored by exogenous expression of D N M T 3 b 2 and D N M T 3 b 3 , the splice variants 97 which do not encode exon 7 (Beaulieu, Mor in et al. 2002). Unfortunately, the effect of exogenous expression of D N M T 3 M and D N M T 3 b 4 , wteh do encode exon 7 was not shown and it is not known i f exon 7 is needed for D N M T 1 interaction despite the binding site for D N M T 1 being close to exon 7. Interestingly, the two variants of D N M T 3 b containing exon 7, D N M T 3 M and D N M T 3 b 4 , are the specific variants expressed in the olfactory epithelium, a site of adult stem cell activity, and are expressed as early as E l 1 persisting into adulthood. This suggests that the function of D N M T 3 b in the O E is of a parallel paradigm to the embryonic function of D N M I b and not the somatic proliferation-augmenting function and that this embryonic form persists into the adult O E . In the O E , the major variant of D N M T 3 b appears to be D N M T 3 b 4 (Figure 9). It has been thought that D N M T 3 b variants that do not encode exon 17, including D N M T 3 b 4 are functionally inactive or have reduced activity because exon 17 contains motifs which are critical for methyltransferase activity (Saito, Kanai et al. 2002). However, the facts that these splice variants are highly conserved between mouse and human suggests that they do have a necessary function. Recent experiments studying binding of D N M T 3 b variants to 5-aza-2'-deoxycitidine treated D N A suggests that these variants, which include D N M T 3 b 4 identified here in the murine O E , are at least capable of binding to D N A . 5-aza-2'-deoxycitidine is a cytidine analog which incorporates into D N A . When methyltransferases bind to these cytidines they are irreversibly bound. D N M T 3 b 4 is also sequestered in cells treated with 5-aza-2'-deoxycytidine, albeit less efficiently than D N M T 3 b splice variants containing exon 17. Whether this effect reflects 98 a reduced catalytic activity or is simply an artifact of D N M T 3 b binding to D N A without exacting a function, is not known. The higher expression of D N M T 3 b 4 may reflect an increased role in de novo methylating events in the O E or a compensatory up-regulation for decreased catalytic activity. The m R N A for D N M T 2 was also detected in O E R N A extracts (Figure 8). A s previously described, it is not clear i f D N M T 2 is functionally active because it lacks much of the regulatory domain. In recent studies, some evidence has arisen that D N M T 2 does bind D N A . Because of the lack of a clear role for D N M T 2 we did not pursue which cell populations in the O E express this methyltransferase. The de novo methyltransferases D N M T 3 a and D N M T 3 b are expressed in distinct and separate cell populations in the O E and their predominance within the O E is directly related to periods of peak neurogenesis (Figure 12, Figure 13, Figure 15, Figure 16). The distinct cell populations which they are expressed in correspond to different stages of pluripotency and neuron maturity suggestive of different roles in O R N neurogenesis. The antibody used to detect D N M T 3 b in vivo is insensitive to the various D N M T 3 b splice variants so the distribution of D N M T 3 M and D N M T 3 b 4 in the O E is not known. From the immunohistochemical data we therefore cannot tell whether the different splice variants of D N M T 3 b are equally distributed amongst the D N M T 3 b positive cells in the O E or i f they are restricted to specific subpopulations of G B C s . The patchy expression of D N M T 3 b in the adult O E is interesting because G B C s normally 99 make up a continuous layer in the adult O E between the H B C and neuronal layers (Calof, M u m m et al. 1998). This suggests that only a subpopulation of cells in the G B C layer express D N M T 3 b . Co-detection of D N M T 3 b with P C N A , and the increase in the number of cells expressing D N M T 3 b and P C N A after induced neurogenesis strongly suggest that D N M T 3 b expressing presumptive G B C s are involved in the neurogenic response. This high rate of co-expression of P C N A in cells expressing D N M T 3 b also indicates that G B C s only express D N M T 3 b when they are proliferating, or more precisely, when they are in S-phase. A t E l 7, two populations of dividing cells, apical and basal, are found in the O E , identified by the expression of P C N A (Figure 12). In early development ( E l 2) olfactory receptor neurons are derived from progenitor cells that divide initially on the apical side of the O E and which over time progressively lose their apical contacts and migrate to the basal side where they establish another population of proliferating progenitors (Smart 1971) (Caggiano, Kauer et al. 1994). However, theseapical and basal restricted progenitor populations are not equivalent. The apical population expresses Mash-1, an early neural progenitor marker required for establishing neurons. The basal population of progenitor cells is derived from the apical population and is more mature. They do not express Mash-1 but do express genes expressed just prior to neuronal differentiation such as Ngn-1 (Cau, Casarosa et al. 2002). In M A S H - 1 knock out mice, the basal population of proliferating progenitors is not produced. Between E l l and P10 the populations of proliferating cells shifts so that most of the apical population is depleted, leaving only the basal population. In the adult olfactory epithelium the apical population no longer exists 100 and all dividing progenitor cells are found in the basal layer. However, the identity of the basal population has also changed in this period of time and now expresses Mash-1. The apical and basal populations of P C N A positive cells detected in this study at E l 7 are l ikely to represent the two aforementioned progenitor populations. Unfortunately, using Mash-1 to confirm these two populations was not possible because the conditions used for Mash-1 immunohistochemistry did not work with the conditions used for P C N A or D N M T 3 b . There are a few instances of P C N A positive cells in between the two apical and basal population of dividing progenitors. A s mentioned before, there is a gradual shift in the distribution of proliferating progenitor cells to the basal layer. A t P5, there is a noticeable reduction in the number of apically located progenitor cells due presumably to either terminal differentiation or to migration to the basal region of the olfactory epithelium and in the adult O E , the population of apical progenitors is completely depleted and the basal population of dividing progenitors is refined to localized puncti of dividing progenitors (Figure 12). It is wel l known that when neurogenesis in the O E is artificially induced by methods such as chemical lavage, methyl bromide lesion, or ipsilateral bulbectomy, the number of actively proliferating presumptive globose basal cells increases. After bulbectomy, there is a similar increase in the number of basal cells expressing P C N A and D N M T 3 b together (Figure 12). D N M T 3 b is highly co-expressed with the presumptive P C N A positive S-phase dividing progenitors in the O E , at E l 7 (Figure 12). A t this stage D N A is being replicated and it is possible that D N M T 3 b may contribute to the maintenance methylation as 101 D N M T 3 b does interact with components of the D N A synthesis replication fork. However, D N M T 3 b is unequally divided between the two populations of dividing progenitors (Figure 12, Figure 13). The majority of cells expressing D N M T 3 b are in the basal P C N A positive layers and only a few D N M T 3 b positive cells are in the apical population. Almost all of the basal P C N A positive cells are D N M T 3 b positive. In comparison, only a small fraction of P C N A positive cells in the apical population co-express D N M T 3 b . There are almost no instances where D N M T 3 b is expressed without P C N A . The unequal distribution of D N M T 3 b in the proliferating progenitor cell populations suggests a functional distinction between the apical and basal proliferating progenitor population. A t the very least, the expression of P C N A without D N M T 3 b in the apical layer suggests that D N M T 3 b does not coincide with proliferation in the apical progenitor sub population. And i f D N M T 3 b does have a role in maintenance methylation in proliferating cells, there is something inherently different between the D N A synthesis occurring in the apical population than the basal population. However, the R T - P C R results indicate that the forms of D N M T 3 b expressed in the O E correspond to the embryonic version of D N M T 3 b and not to the D N M T 3 b variants which are expressed in terminally differentiated somatic cells and which have demonstrated maintenance methylation augmenting activity (Figure 9). Alternatively, it is possible that D N M T 3 b has another role in addition to or other than D N A synthesis in the basal cell population. The distribution of D N M T 3 b in the P C N A positive cells of the O E correlates to progenitor cells of sequential maturity. Mash-1 is a marker for pluripotent neural progenitors. The O E in early embryonic development is unique because the basal cell layer corresponds to a maturity intermediate to Mash-1 neural progenitors and N S T 102 positive immature neurons. It is interesting that the loss of the Mash-1 identity, as determined by the location of the cells within the O E , and the assumption of the preneural cell fate is coincident with the expression of D N M T 3 b . Interestingly, D N M T 3 b is also expressed in cells migrating to the basal population suggesting that D N M T 3 b expression is coincident with cells losing the M A S H - 1 progenitor identity and migration to the more mature basal population of progenitors. In general, the basal progenitor cells represent a more mature progenitor population and express D N M T 3 b . This expression pattern further refines the placement of D N M T 3 b at a stage of cell development where progenitors begin to take on the neural cell identity. From the immunohistochemical analysis of D N M T 3 a in E17, P5 and adult O E it is clear that D N M T 3 a is expressed by immature receptor neurons at a transitional stage to O M P expressing mature O R N s (Figure 14, Figure 15). This is evident by the patterns of overlapping signals of D N M T 3 a with N S T , G A P 4 3 and O M P . In comparison to the adult O E , in the E17 and P5 O E there is an additional layer of N S T posi t ive/DNMT3a negative cells in the more basal population of IRNs (Figure 15). This separation of layers probably arose due to the increased rate of neurogenesis in the E l 7 and P5 O E in comparison to the adult O E . From this layerization, it is clear that N S T is expressed before D N M T 3 a , and D N M T 3 a is expression is refined to the more mature, apically located population of IRNs. From this it can be inferred that D N M T 3 a is not required for the assumption of the neural cell fate but is expressed at some time after. The time point of D N M T 3 a expression is highly correlated with the assumption of the mature neuronal identity as seen by the high degree of overlap between the basal subpopulation of O M P 103 positive mature O R N s and D N M T 3 a . Taken together, it appears that D N M T 3 a is expressed when neurons are undergoing terminal differentiation from an immature O R N to an O R N . However, immunohistochemical data from the adult O E suggests that D N M T 3 a is not expressed in response to the signal for terminal differentiation but is expressed prior to being induced to terminally differentiate. In the adult O E , the majority of the I R N population expresses D N M T 3 a as discerned by the overlap between the D N M T 3 a signal and the N S T or G A P 4 3 signals. This proportion of I R N expressing D N M T 3 a is l ikely too high to represent terminally differentiating IRNs. In addition, taking into consideration the low level patchy expression of D N M T 3 b and P C N A expressing cells in the adult O E , it is unlikely that enough cells are being produced in the basal cell layer to replenish the I R N population i f D N M T 3 a expression was directly correlated to the rate of terminally differentiating IRN. The l ikely scenario occurring in the O E is that D N M T 3 a is not a specific marker for active terminal differentiation but is expressed and sequestered in the nucleus in preparation for terminal differentiation. These D N M T 3 a expressing IRNs are l ikely to be quiescent immature neurons in a holding pattern ready to receive a signal for terminal differentiation. Once the cell receives the signal, D N M T 3 a is down regulated rapidly with the onset of O M P expression, as is seen with the inverse relationship between the D N M T 3 a and O M P signal intensity. In this model for terminal differentiation, the O E sustains a population of immature O R N s which can rapidly respond to a pro-differentiation signal. Alternatively, it is possible that D N M T 3 a is not a pro-differentiation factor but is instead an anti-differentiation factor. In several systems, it has been shown that 104 demethylation of genomic D N A is required for cellular differentiation. For example, the terminal differentiation of glial cells requires the demethylation and subsequent expression of the G F A P gene. Using immunohistochemistry alone, it is clear that D N M T 3 a is expressed and localized to the nucleus at the transitional stage between immature and mature O R N but it is unclear whether D N M T 3 a activity suppresses the transcription of genes required for terminal differentiation keeping the I R N in a holding pattern, or i f it suppresses genes that need to be silenced for terminal differentiation after a pro-differentiation signal is received by the cell. If it is the former, then targeted demethylation should occur during terminal differentiation after release from the effect o f D N M T 3 a . The mechanism of D N A demethylation is still unknown but it is thought to occur through two processes. Passive demethylation occurs when D N A replication occurs during cellular proliferation in the absence of maintenance methylation yielding a hemimethylated daughter strand. A subsequent round of proliferation wi l l yield a daughter strand which is completely unmethylated. The alternative process is active demethylation. However, the enzyme responsible for active catalytic demethylation is presently unknown. If release from D N M T 3 a and demethylation is a feature of terminal O R N differentiation, it is l ikely that demethylation occurs through an active mechanism since neurons are post mitotic. This is substantiated by the absence of signal overlap when P C N A and D N M T 3 a are co-detected. The number of D N M T 3 a expressing cells does reflect the amount of neurogenesis occurring in the O E (Figure 13). More D N M T 3 a expressing cells are found in the P5 O E in comparison to the E l 7 O E . This is l ikely due to the fact that the rate of neurogenesis 105 in the P5 O E is higher than at E17 because the mice post birth are exposed to environmental odorants since neurogenesis in development is partially dependent on stimuli. The difference in the number of cells expressing D N M T 3 a at P5 and in the adult is not due to differences in the amount of odorant stimuli. In the adult, neurogenesis is primarily driven by signals for replacing mature O R N s which have apoptosed. The rate of O R N replenishment in the adult O E is lower in comparison to the developmentally driven neurogenesis in the P5 O E . Characterization of the cell types expressing the de novo D N M T s shows stages of development where new D N A methylation marks are set, checkpoints in development. Although methylation can silence transcription independently, the main process by which methylation leads to transcriptional silencing is by eliciting chromatin compaction. This is mediated by multi-protein complexes which recognize and are recruited to methylated D N A . One of the best characterized functional components of these complexes is H D A C 2 which when recruited to D N A , w i l l deacetylate proximal histones leading to the remodelling and inactivation of the local chromatin. In the O E , H D A C 2 is expressed at an appropriate time during O R N development to act on the de novo methylation marks established by D N M T 3 b and D N M T 3 a (Figure 17). In the O E at the time points analyzed, H D A C 2 is expressed in only a sub-population of the D N M T 3 b expressing presumptive G B C s . The existence of a large number of D N M T 3 b positive, H D A C negative cells suggests that H D A C 2 is just beginning to be expressed in D N M T 3 b positive cells, after a slight delay from the onset of D N M T 3 b expression. H D A C 2 expression continues through the immature O R N layer, and into a sub population of 106 D N M T 3 a positive immature O R N layer. Expression of H D A C 2 in cells negative for the de novo D N M T s , particularly apparent at P5, suggest that H D A C 2 activity continues past the stages where new methylation patterns are set by D N M T 3 b . It is possible that H D A C 2 is expressed longer because its action is required for unprocessed methylated substrates generated through both maintenance methylation, since basally located IRNs arise from basal cells which have recently divided, in addition to the de novo sites of methylation set by D N M T 3 b . It is reasonable then, that less time would be required for H D A C 2 to act on the de novo methylation marks set by D N M T 3 a since these marks are set in the absence of proliferation. This is substantiated by there being no H D A C 2 positive, D N M T 3 a negative cells superior to the D N M T 3 a positive cell population. Interestingly, in the most apical population of D N M T 3 a positive cells, corresponding to the most mature IRNS and early O R N S , H D A C 2 expression is down regulated even before D N M T 3 a . If D N M T 3 a is still in action in these cells not expressing H D A C 2 , it is possible that a protein other than H D A C 2 is mediating the effect of the new methylation marks on gene transcription or they have a different turnover rate. Alternatively, these D N M T 3 a positive cells may be in the process of down-regulating D N M T 3 a expression. In the adult O E , H D A C 2 is expressed in a generally consistent layer across the length of the O E whereas P C N A is detected only in patches in the adult( Figure 17). The expression of H D A C 2 is probably too widespread for silencing of genomic targets generated through maintenance methylation to be a significant function of H D A C 2 . It is possible that H D A C 2 , as was hypothesized for D N M T 3 a , is expressed in immature O R N s in preparation for a rapid response to pro-differentiation signals and is not 107 necessarily active during all the stages of O R N development in which it is expressed. Taken together, the pattern of H D A C 2 expression suggests that H D A C 2 is expressed in immature O R N s but is down regulated after terminal differentiation into mature O R N s . Once the immature O R N s have terminally differentiated, H D A C 2 is no longer expressed because mature ORNs no longer undergo changes in transcriptional competence. H D A C 2 is only expressed in subpopulations of both the apically and basally located, P C N A positive proliferating cells (Figure 17). The P C N A / H D A C 2 positive cells in the apical population l ikely correspond to D N M T 3 b positive cells as inferred by the high correlation between D N M T 3 b and H D A C 2 expression in this population. In the apical layer, H D A C 2 is only expressed in cells expressing D N M T 3 b . The expression of P C N A in cells in the absence of H D A C 2 is interesting in itself since H D A C 2 and P C N A share a common protein interacter, D N M T l . P C N A interacts with D N M T 1 and is recruited to replication forks during proliferation. H D A C 2 can also bind to D N M T l and would reasonably be expected to also be expressed in cells undergoing proliferation i f this were active in this lineage. However, although H D A C 2 is expressed faintly in a large number of the basally located proliferating population, only a small population of apically dividing cells express H D A C 2 . This suggests that H D A C 2 may not be required for proliferation in the apical layer. The lack of H D A C 2 in these proliferating cells may be compensated for by other proteins. For example, D N M T l can also interact with other mediators for silencing such as H D A C 1 , in addition to H D A C 2 . The high correlation between H D A C 2 and D N M T 3 b , especially in the apical populations, suggests that H D A C 2 activity is important in cells where D N M T 3 b is active. In addition, the 108 correlation between H D A C 2 and D N M T 3 b and D N M T 3 a is maintained in the developing retina (Figure 19). Interestingly, in comparison to the expression of D N M T 3 a in the O E , D N M T 3 a cells in the P5 bulb are co-expressed in some P C N A positive cells (Figure 18). This suggests that D N M T 3 a may have a role in the bulb analogous to D N M T 3 b in the O E which may include cell fate determination. However, although there is generation of new neurons in the O B , these neurons arise from the rostral migratory stream and there are fewer multipotent progenitor cells located within the O B than there are in the O E . In the P5 O B , the P C N A positive cells have arisen from the cells incoming from the rostral migratory stream from the sub-ventricular zone. D N M T 3 a is expressed by cells in the granule cell region and demonstrates a non-organized distribution within this region. This is appropriate for cells differentiating into mature neurons as D N M T 3 a expressing cells are not organized into layers that are typical of mature granule cells. In the granule cell region, cells expressing D N M T 3 a and D N M T 3 b are also l ikely to be participating in the differentiation of periglomerular neurons as the D N M T 3 a and D N M T 3 b positive cells are located in positions where maturing periglomerular cells are found. In additional contrast to the O E , P C N A and D N M T 3 b are not co-expressed in the cortex of the E17 mouse. P C N A positive cells are restricted to the sub ventricular zone and rostral migratory stream. D N M T 3 b expressing cells are more dispersed in the O E and appear to be radiating from the lateral ventricle (Figure 18). It is possible that these cells are migrating along radial glia to their final destinations in the cortex while expressing D N M T 3 b during its maturation. 109 The vomeronasal organ is involved in the detection of pheremones. L ike O R N s , vomeronasal receptor neurons (VNRNs) are also turned over and have the capacity to renew the V N R N s from a population of basal cells. Analogous to the expression patterns of the de novo methyltransferases in the O E , D N M T 3 b is co-expressed in the basal population of cells in the V N O and l ikely give rise to D N M T 3 a positive cells in the V N R N layer (Figure 19). The expression of D N M T 3 b and D N M T 3 a in the development of sensory neuronal systems appears to be a common theme. The temporal pattern of D N M T 3 b and D N M T 3 a expression in relation to N S T in the retina supports the theory that D N M T 3 a is expressed at later developmental stages than D N M T 3 b , as is seen in the O E and in embryonic development (Figure 19). P C N A and D N M T 3 b are co-expressed in taste buds during their window of differentiation, at E l 7, and are found at the base of the pits where taste progenitors are found (Figure 19). Interestingly, D N M T 3 b is highly expressed in the thymus which is neither sensory nor neuronal (Figure 19). The thymus is important in the development of the immune system. T-cells are generated in the bone marrow and migrate to the thymus where they multiply and mature into immuno-competent cells. A major event in the maturation is the expression of a T-cel l receptor (TCR). Expression of the T C R involves rearrangement of the T cell receptor alpha chain and allelic exclusion so that the T-cell w i l l only recognize one antigen. The concept of allelic exclusion is a theme in common to O R gene expression in the development of ORNs . The parallel between D N M T 3 b expression in these two systems which both incorporate allelic 110 exclusion as a developmental event suggest that D N M T 3 b may also play a role in allelic exclusion, known to be regulated by methylation in the thymus. M B D 2 also persists in both systems postnatally (MacDonald, personal communication). The controlled environments of cell line systems such as the OP6 and OP27 cell lines can greatly facilitate the study of O R N development. However, these conditionally immortalized systems are not perfect as they are induced to proliferate under control of the SV40 large T antigen and some of their cell cycle regulatorcharacteristics m ay not necessarily reflect the true in vivo scenario. Characterization of the de novo methyl transferases by R T - P C R demonstrate a similar pattern of D N M T 3 a and D N M T 3 b expression to what is seen in vivo (Figure 21). Interestingly, D N M T 3 b is expressed in both the OP27 and OPf ie l l lines . D N M T 3 b expression in the OP27 cell line is expected because as discussed earlier, OP27 cells demonstrate some characteristics of proliferating progenitors. On the other hand, the expression of D N M T 3 b in the OP6 cell line is slightly unexpected because this cell line is supposedly of a more mature stage of development, having already assumed the identity of an immature receptor neuron and which as inferred by the in vivo expression pattern of D N M T 3 b , does not express D N M T 3 b . The detection of D N M T 3 b transcripts in this cell line suggests that a sub population of OP6 cells are also less advanced in their development. This is supported by the R T - P C R analysis done previously which detected brain factor 1 (BF-1), a transcription factor expressed in proliferating neuroprogenitors, in both the OP27 and OP6 cell lines (Dou, L i et al. 1999; ti l ing, Boolay et al. 2002). Alternatively, D N M T 3 b may be an artifact of expression coincident with the expression of P C N A due to the 111 immortalization of the cell line since D N M T 3 b is known to interact with D N M T l . A k i n to the in vivo scenario, the D N M T 3 b transcripts expressed by both the OP27 and OP6 cell lines, D N M T 3 M and D N M T 3 b 4 , correspond to the transcripts expressed in the O E (Figure 22). The differential expression of D N M T 3 a in the OP6 and OP27 cell line strengthens previous assessments that the OP6 cell line is at a more mature stage in O R N development than OP27 cells (Illing, Boolay et al. 2002). The expression of D N M T 3 a in vivo correlates with terminal differentiation from IRNs to O R N s . The weak expression of D N M T 3 a in the proliferating OP6 cell culture may be due to small populations of OP6 cells undergoing spontaneous differentiation. Lastly, as mentioned before, it is not clear what functional purpose D N M T 2 serves since its catalytic activity has only been detected in vitro (Tang, Reddy et al. 2003). However, the detection of D N M T 2 in the OP6 and OP27 cell lines suggest that in vivo, cells of the O R N lineage also express this methyltransferase isoform (Figure 21). A limiting factor to using the OP6 and OP27 cell lines as models for O R N development is that the cell cultures are heterogeneous and at any given time, cells in the culture can exist in a small range of stages in O R N development. The range in maturities of an unsynchronized population makes it more difficult to accurately stage the cell line at a specific point of in vivo development. Although the OP27 cell line was originally characterized as being in general, a transit-amplifying cell , several characteristics of this cell line suggest that at least a sub population of the cells in culture of this cell line may 112 be at a slightly earlier stage of maturity-that of a globose basal cell (Illing, Boolay et al. 2002). The expression of Pax-6 as detected by previous immunocytochemical analysis is one such characteristic. Thus the OP27 cell line is an appropriate model for analyzing D N M T 3 b function in O R N development as it is staged closest to the in vivo stage when D N M T 3 b is expressed. Interestingly, immunocytochemical detection of D N M T 3 b shows that almost all of the cells in the OP27 cell culture express D N M T 3 b . This is somewhat surprising since in vivo, D N M T 3 b is expressed in cells coincident with neurogenesis and this cell culture is in a supposedly immortalized but non-differentiating stage. A limited number of D N M T 3 b positive cells would have been expected due to spontaneous differentiation. It is possible that in the proliferative condition, D N M T 3 b is being expressed in OP27 cells in preparation for differentiation, but is not active. Alternatively, as discussed before, D N M T 3 b has been shown to interact with the maintenance methylation machinery and in some cases is important in for the proliferation cells in vitro. Expression of D N M T 3 b as assessed by R T - P C R in the more differentiated OP6 cells supports the latter theory as this cell line is supposedly already neuronally committed. Co-localization of D N M T 3 b with P C N A in S-phase shows that D N M T 3 b is not recruited to replication foci with P C N A and is thus, l ikely not involved with maintenance methylation during cell proliferation. Some overlap between D N M T 3 b and P C N A does occur during G I but this is l ikely due to coincidental localizations and does not have functional significance (Figure 23 A ) . A t G I , P C N A is functionally inactive and there is unlikely to be a functional purpose for an interaction between D N M T 3 b and P C N A at this point. A lack of P C N A and D N M T 3 b 113 activity in G l is supported by the apparent absence of co-localization of P C N A and D N M T 3 b with D A P I . During S phase the P C N A signal is co-localized with D A P I (Figure 23 B + C). However, there is no significant signal co-localization between D N M T 3 b and D A P I . It is possible that D N M T 3 b is recruited to D N A only under differentiating conditions. Alternatively, it is possible that the resolution is not high enough to detect the overlap. 114 Conclusions Recent literature has demonstrated that the processes controlling O R gene expression are reversible (Eggan, Baldwin et al. 2004). Using in silico tools for genome analysis, O R genes are shown to be potential targets for dynamic methylation-induced silencing because they are not associated with C p G rich motifs of characteristically low methylation, C p G islands, nor are they associated with C p G rich motifs of characteristically high methylation, B l repetitive elements. The presence of C p G islands flanking some of the analyzed O R gene clusters, on the other hand, present putative buffers for methylation spreading, a potential mechanism for silencing O R gene clusters as a whole. Previously we have found that D N M T 3 b m R N A is upregulated in the O E fol lowing bulbectomy induced neurogenesis in the mouse. Using R T - P C R , m R N A encoding D N M T l , D N M T 2 , and the other de novo D N A methyltransferase, D N M T 3 a are identified in the O E . Further investigation into which D N M T 3 b splice variants are expressed in the O E showed that D N M T 3 M and D N M T 3 b 4 , splice variants which are exclusively expressed in the early developing embryo and in embryonic stem cells, are expressed in the olfactory epithelium. Immunohistochemical analysis of D N M T 3 b and D N M T 3 a expression in the O E show that D N M T 3 b is expressed in dividing progenitors and the number of presumptive G B C s expressing D N M T 3 b increases during times of increased neurogenesis. In comparison to D N M T 3 b , D N M T 3 a is expressed later in the O R N lineage in I R N undergoing terminal differentiation into ORNs. H D A C 2 was 115 identified as a potential effector for the methylation patterns established by both D N M T 3 b and D N M T 3 a in developing neurons in the O E . Two cell lines, OP27 and OP6 were previously described to have been conditionally immortalized from O R N progenitors at staggered stages of maturity. The expression patterns of D N M T 3 b and D N M T 3 a in these cell lines parallel their previously described stages in development where D N M T 3 b is expressed in OP27 cells, placed at the transition from transit amplifier to immediate neuronal precursor, and D N M T 3 a is expressed in OP6 cells which are placed at the I R N stage. Immunocytochemical analysis of D N M T 3 b in OP27 cells show that D N M T 3 b is not recruited to replication foci and thus is supports a potential role other than maintenance methylation in the development of O R N S , namely, of participating in differentiation checkpoints in neuronal development. 116 References Amir , R. E., I. B. Van den Veyver, et al. (1999). "Rett syndrome is caused by mutations in X- l inked M E C P 2 , encoding methyl-CpG-binding protein 2." Nat Genet 23(2): 185-8. Andres, K. H. (1966). "[The fine structure of the olfactory region of macrosmatic animals]." Z Zellforsch Mikrosk Anat 69: 140-54. Barber, R. D., D. E. Jaworsky, et al. (2000). "Isolation and in vitro differentiation of conditionally immortalized murine olfactory receptor neurons." J Neurosci 20(10): 3695-704. Barton, S. C., M . A . Surani, et al. (1984). "Role of paternal and maternal genomes in mouse development." Nature 311(5984): 374-6. Beaulieu, N. , S. Mor in , et al. (2002). " A n essential role for D N A methyltransferase D N M T 3 B in cancer cell survival." J B io l Chem 277(31): 28176-81. Bednarik, D. P., C. Duckett, et al. (1991). " D N A C p G methylation inhibits binding of NF-kappa B proteins to the HIV-1 long terminal repeat cognate D N A motifs." New B io l 3(10): 969-76. Berger, S. L. (1999). "Gene activation by histone and factor acetyl transferases." Curr Qpin Cel l B io l 11(3): 336-41. Bestor, T. H. (1988). "Cloning of a mammalian D N A methyltransferase." Gene 74(1): 9-12. Bestor, T. H. (1992). "Activation of mammalian D N A methyltransferase by cleavage of a Zn binding regulatory domain." Embo J 11(7): 2611-7. Bowen, N . J . , N . Fujita, et al. (2004). " M i - 2 / N u R D : multiple complexes for many purposes." Biochim Biophys Acta 1677(1-3): 52-7. Boyes, J . and A . B i rd (1992). "Repression of genes by D N A methylation depends on C p G density and promoter strength: evidence for involvement of a methyl-CpG binding protein." Embo J 11(1): 327-33. Buck, L. and R. Axe l (1991). " A novel multigene family may encode odorant receptors: a molecular basis for odor recognition." Ce l l 65(1): 175-87. Buck, L. B. (2000). "The molecular architecture of odor and pheromone sensing in mammals." Ce l l 100(6): 611-8. Bulger, M . , M . A . Bender, et al. (2000). "Comparative structural and functional analysis of the olfactory receptor genes flanking the human and mouse beta-globin gene clusters." Proc Natl Acad Sci U S A 97(26): 14560-5. Buschhausen, G . , B. Witt ig, et al. (1987). "Chromatin structure is required to block transcription of the methylated herpes simplex virus thymidine kinase gene." Proc Natl Acad Sci U S A 84(5): 1177-81. Caggiano, M . , J . S. Kauer, et al. (1994). "Globose basal cells are neuronal progenitors in the olfactory epithelium: a lineage analysis using a replication-incompetent retrovirus." Neuron 13(2): 339-52. Calof, A . L. and D. M . Chikaraishi (1989). "Analysis of neurogenesis in a mammalian neuroepithelium: proliferation and differentiation of an olfactory neuron precursor in vitro." Neuron 3(1): 115-27. 117 Calof, A . L., J . S. Mumm, et al. (1998). "The neuronal stem cell of the olfactory epithelium." J Neurobiol 36(2): 190-205. Carlson, L. L., A . W. Page, et al. (1992). "Properties and localization of D N A methyltransferase in preimplantation mouse embryos: implications for genomic imprinting." Genes Dev 6(12B): 2536-41. Carter, L. A . , J . L. MacDonald, et al. (2004). "Olfactory horizontal basal cells demonstrate a conserved multipotent progenitor phenotype." J Neurosci 24(25): 5670-83. Cau, E., S. Casarosa, et al. (2002). "Mash l and N g n l control distinct steps of determination and differentiation in the olfactory sensory neuron lineage." Development 129(8): 1871-80. Chedin, F., M . R. Lieber, et al. (2002). "The D N A methyltransferase-like protein D N M T 3 L stimulates de novo methylation by Dnmt3a." Proc Natl Acad Sci U S A 99(26): 16916-21. Chen, X . , H. Fang, et al. (2004). "Multipotency of purified, transplanted globose basal cells in olfactory epithelium." J Comp Neurol 469(4): 457-74. Chen, Y . , M . L. Getchell, et al. (1992). "Immunolocalization of two cytochrome P450 isozymes in rat nasal chemosensory tissue."Neuroreport 3(9): 749-52. Cho, J . H., H . Kimura, et al. (2001). " D N A methylation regulates placental lactogen I gene expression." Endocrinology 142(8): 3389-96. Chuang, L. S., H. I. Ian, et al. (1997). "Human DNA-(cytosine-5) methyltransferase-P C N A complex as a target for p 2 1 W A F l . " Science 277(5334): 1996-2000. Condorell i , D. F., P. Del l 'Albani , et al. (1997). " A neural-specific hypomethylated domain in the 5' flanking region of the glial fibril lary acidic protein gene." Dev Neurosci 19(5): 446-56. Coulondre, C , J . H . Mi l ler , et al. (1978). "Molecular basis of base substitution hotspots in Escherichia col i . " Nature 274(5673): 775-80. Cross, S. H. and A . P. B i rd (1995). " C p G islands and genes." Curr Opin Genet Dev 5(3): 309-14. Deng, J . and M . Szyf (1998). "Mult iple isoforms of D N A methyltransferase are encoded by the vertebrate cytosine D N A methyltransferase gene." J B io l Chem 273(36): 22869-72. Derreumaux, S., M . Chaoui, et al. (2001). "Impact of C p G methylation on structure, dynamics and solvation of c A M P D N A responsive element." Nucleic Acids Res 29(11): 2314-26. Dong, A . , J . A . Yoder, et al. (2001). "Structure of human D N M T 2 , an enigmatic D N A methyltransferase homolog that displays denaturant-resistant binding to D N A . " Nucleic Acids Res 29(2): 439-48. Dou, C . L., S. L i , et al. (1999). "Dual role of brain factor-1 in regulating growth and patterning of the cerebral hemispheres." Cereb Cortex 9(6): 543-50. Eden, S. and H. Cedar (1994). "Role of D N A methylation in the regulation of transcription." Curr Opin Genet Dev 4(2): 255-9. Eggan, K., K. Baldwin, et al. (2004). "M ice cloned from olfactory sensory neurons." Nature 428(6978): 44-9. 118 Englander, E. W. , A . P. Wolffe, et al. (1993). "Nucleosome interactions with a human A l u element. Transcriptional repression and effects of template methylation." J B io l Chem 268(26): 19565-73. Firestein, S. (2001). "How the olfactory system makes sense of scents." Nature 413(6852): 211-8. Frenster, J . H. , V . G. Al l f rey, et al. (1963). "Repressed and Active Chromatin Isolated from Interphase Lymphocytes." Proc Natl Acad Sci U S A 50: 1026-32. Gardiner-Garden, M . and M . Frommer (1987). " C p G islands in vertebrate genomes." J M o l B io l 196(2): 261-82. Gaudet, F., D. Talbot, et al. (1998). " A short D N A methyltransferase isoform restores methylation in vivo." J B io l Chem 273(49): 32725-9. Getchell, T. V . , F. L. Margolis, et al. (1984). "Perireceptor and receptor events in vertebrate olfaction." Prog Neurobiol 23(4): 317-45. Gl ickman, J . F., J . Flynn, et al. (1997). "Purification and characterization of recombinant baculovirus-expressed mouse D N A methyltransferase." Biochem Biophys Res Commun 230(2): 280-4. Glusman, G . , I. Yanai, et al. (2001). "The complete human olfactory subgenome." Genome Res 11(5): 685-702. Godfrey, P. A . , B. Malnic, et al. (2004). "The mouse olfactory receptor gene family." Proc Natl Acad Sci U S A 101(7): 2156-61. Graziadei, G . A . and P. P. Graziadei (1979). "Neurogenesis and neuron regeneration in the olfactory system of mammals. II. Degeneration and reconstitution of the olfactory sensory neurons after axotomy." J Neurocytol 8(2): 197-213. Graziadei, P. P. (1973). "Ce l l dynamics in the olfactory mucosa." Tissue Ce l l 5(1): 113-31. Graziadei, P. P. and G . A . Graziadei (1979). "Neurogenesis and neuron regeneration in the olfactory system of mammals. I. Morphological aspects of differentiation and structural organization of the olfactory sensory neurons." J Neurocytol 8(1): 1-18. Graziadei, P. P., R. R. Levine, et al. (1978). "Regeneration of olfactory axons and synapse formation in the forebrain after bulbectomy in neonatal mice." Proc Natl Acad Sci U S A 75(10): 5230-4. Graziadei, P. P. and J. F. Metcalf (1971). "Autoradiographic and ultrastructural observations on the frog's olfactory mucosa." Z Zellforsch Mikrosk Anat 116(3): 305-18. Hata, K., M . Okano, et al. (2002). "Dnmt3L cooperates with the Dnmt3 family of de novo D N A methyltransferases to establish maternal imprints in mice." Development 129(8): 1983-93. Heinemann, U. , C. Al ings, et al. (1992). "Double helix conformation, groove dimensions and ligand binding potential of a G / C stretch in B - D N A . " Embo J 11(5): 1931-9. Heitz, E. (1929). "Heterochromatin, Chromocentren, Chromomeren (Corlaufige Mitteilung)." Ber. Dtsch. Bot. Ges. 47: 274-284. Hendrich, B. and S. Tweedie (2003). "The methyl-CpG binding domain and the evolving role of D N A methylation in animals." Trends Genet 19(5): 269-77. Henry, K. W. , A . Wyce, et al. (2003). "Transcriptional activation via sequential histone , H 2 B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8." Genes Dev 17(21): 2648-63. 119 Higgins, D. G . (1994). " C L U S T A L V : multiple alignment of D N A and protein sequences." Methods M o l B io l 25: 307-18. Hirschhorn, J . N . , A . L. Bortvin, et al. (1995). " A new class of histone H 2 A mutations in Saccharomyces cerevisiae causes specific transcriptional defects in vivo." M o l Cel l B i o l 15(4): 1999-2009. Holbrook, E. H., K. E. Szumowski, et al. (1995). " A n immunochemical, ultrastructural, and developmental characterization of the horizontal basal cells of rat olfactory epithelium." J Comp Neurol 363(1): 129-46. Howel l , C. Y . , T. H. Bestor, et al. (2001). "Genomic imprinting disrupted by a maternal effect mutation in the Dnmt l gene." CeH 104(6): 829-38. Howlett, S. K. and W. Reik (1991). "Methylation levels of maternal and paternal genomes during preimplantation development." Development 113(1): 119-27. Hsieh, C. L. (1994). "Dependence of transcriptional repression on C p G methylation density." M o l Ce l l B i o l 14(8): 5487-94. Huard, J . M . and J. E. Schwob (1995). "Ce l l cycle of globose basal cells in rat olfactory epithelium." Dev Dyn 203(1): 17-26. Iguchi-Ariga, S. M . and W . Schaffner (1989). " C p G methylation of the cAMP-responsive enhancer/promoter sequence T G A C G T C A abolishes specific factor binding as wel l as transcriptional activation." Genes Dev 3(5): 612-9. Ill ing, N . , S. Boolay, et al. (2002). "Conditionally immortalized clonal cell lines from the mouse olfactory placode differentiate into olfactory receptor neurons." M o l Ce l l Neurosci 20(2): 225-43. Kaj iya, K., K . Inaki, et al. (2001). "Molecular bases of odor discrimination: Reconstitution of olfactory receptors that recognize overlapping sets of odorants." J Neurosci 21(16): 6018-25. Kass, S. U. , J . P. Goddard, et al. (1993). "Inactive chromatin spreads from a focus of methylation." M o l Ce l l B io l 13(12): 7372-9. Kass, S. U. , N . Landsberger, et al. (1997). " D N A methylation directs a time-dependent repression of transcription initiation." Curr B io l 7(3): 157-65. Keshet, I., J . Lieman-Hurwitz, et al. (1986). " D N A methylation affects the formation of active chromatin." CeU 44(4): 535-43. K i m , G . D., J . N i , et al. (2002). "Co-operation and communication between the human maintenance and de novo D N A (cytosine-5) methyltransferases." Embo J 21(15): 4183-95. Kovesdi, I., R. Reichel, et al. (1987). "Role of an adenovirus E2 promoter binding factor in ElA-mediated coordinate gene control." Proc Nat l Acad Sci U S A 84(8): 2180-4. Kriaucionis, S. and A . B i rd (2003). " D N A methylation and Rett syndrome."Hum M o l Genet 12 Spec No 2: R221-7. Kr ieg, A . M . (2000). " C p G oligonucleotides as immune adjuvants." Ernst Schering Res Found Workshop(30): 105-18. Lane, R. P., T. Cutforth, et al. (2002). "Sequence analysis of mouse vomeronasal receptor gene clusters reveals common promoter motifs and a history of recent expansion." Proc Natl Acad Sci U S A 99(1): 291-6. Lane, R. P., T. Cutforth, et al. (2001). "Genomic analysis of orthologous mouse and human olfactory receptor loci ." Proc Natl Acad Sci U S A 98(13): 7390-5. 120 Lane, R. P., J . C. Roach, et al. (2002). "Genomic analysis of the olfactory receptor region of the mouse and human T-cell receptor alpha/delta loci ." Genome Res 12(1): 81-7. Le i , H. , S. P. Oh, et al. (1996). "De novo D N A cytosine methyltransferase activities in mouse embryonic stem cells." Development 122(10): 3195-205. Leonhardt, H., A . W. Page, et al. (1992). " A targeting sequence directs D N A methyltransferase to sites of D N A replication in mammalian nuclei." Ce l l 71(5): 865-73. L i , E. (2002). "Chromatin modification and epigenetic reprogramming in mammalian development." Nat Rev Genet 3(9): 662-73. L i , E., C . Beard, et al. (1993). " D N A methylation, genomic imprinting, and mammalian development." Co ld Spring Harb Symp Quant B io l 58: 297-305. L i , E., T. H. Bestor, et al. (1992). "Targeted mutation of the D N A methyltransferase gene results in embryonic lethality." Ce l l 69(6): 915-26. L i , J . , T. Ishii, et al. (2004). "Odorant receptor gene choice is reset by nuclear transfer from mouse olfactory sensory neurons." Nature 428(6981): 393-9. L i u , L., S. N . Saldanha, et al. (2004). "Epigenetic regulation of human telomerase reverse transcriptase promoter activity during cellular differentiation." Genes Chromosomes Cancer 41(1): 26-37. MacDonald, K. P., A . Mackay-Sim, et al. (1996). "Olfactory neuronal cell lines generated by retroviral insertion of the n-myc oncogene display different developmental phenotypes." J Neurosci Res 45(3): 237-47. Maln ic , B., J . Hirono, et al. (1999). "Combinatorial receptor codes for odors." Ce l l 96(5): 713-23. Marcourt, L., C. Cordier, et al. (1999). "Impact of C5-cytosine methylation on the solution structure of d ( G A A A A C G T T T T C ) 2 . A n N M R and molecular modelling investigation." Eur J Biochem 265(3): 1032-42. Margot, J . B., A . E. Ehrenhofer-Murray, et al. (2003). "Interactions within the mammalian D N A methyltransferase family." B M C M o l B io l 4(1): 7. Mayer, W. , A . Niveleau, et al. (2000). "Demethylation of the zygotic paternal genome." Nature 403(6769): 501-2. Monk, M . , M . Boubelik, et al. (1987). "Temporal and regional changes in D N A methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development." Development 99(3): 371-82. Moulton, D. G . (1974). "Dynamics of cell populations in the olfactory epithelium." Ann N Y Acad Sci 237(0): 52-61. Murphy, S. K. and R. L. Jirtle (2003). "Imprinting evolution and the price of silence." Bioessavs 25(6): 577-88. Murrel l , J . R. and D. D. Hunter (1999). " A n olfactory sensory neuron line, odora, properly targets olfactory proteins and responds to odorants." J Neurosci 19(19): 8260-70. Nan, X . , F. J . Campoy, et al. (1997). " M e C P 2 is a transcriptional repressor with abundant binding sites in genomic chromatin." Ce l l 88(4): 471-81. Nan, X . , S. Cross, et al. (1998). "Gene silencing by methyl-CpG-binding proteins." Novartis Found Symp 214: 6-16; discussion 16-21, 46-50. 121 Nan, X . , H . H . N g , et al. (1998). "Transcriptional repression by the methyl-CpG-binding protein M e C P 2 involves a histone deacetylase complex." Nature 393(6683): 386-9. Nathan, D. and D. M . Crothers (2002). "Bending and flexibility of methylated and unmethylated EcoRI D N A . " J M o l B io l 316(1): 7-17. Nguyen, C. T., F. A . Gonzales, et al. (2001). "Altered chromatin structure associated with methylation-induced gene silencing in cancer cells: correlation of accessibility, methylation, M e C P 2 binding and acetylation." Nucleic Acids Res 29(22): 4598-606. Nomura, A . (1994). "Nuclear distribution of proliferating cell nuclear antigen ( P C N A ) in fertilized eggs of the starfish Asterina pectinifera." J Ce l l Sci 107 ( Pt 12): 3291-300. Okano, M . , D. W. Be l l , et al. (1999). " D N A methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development." Cel l 99(3): 247-57. Okano, M . , D. W . Be l l , et al. (1999). " D N A methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development." Ce l l 99(3): 247-57. Okano, M . , S. X ie , et al. (1998). "Cloning and characterization of a family of novel mammalian D N A (cytosine-5) methyltransferases." Nat Genet 19(3): 219-20. Okano, M . , S. X ie , et al. (1998). "Dnmt2 is not required for de novo and maintenance methylation of viral D N A in embryonic stem cells." Nucleic Acids Res 26(11): 2536-40. Oswald, J., S. Engemann, et al. (2000). "Active demethylation of the paternal genome in the mouse zygote." Curr B io l 10(8): 475-8. Park, J., S. H . Song, et al. (2004). "Aberrant methylation of integrin alpha4 gene in human gastric cancer cells." Oncogene 23(19): 3474-80. Pradhan, S., A . Bacol la, et al. (1999). "Recombinant human D N A (cytosine-5) methyltransferase. I. Expression, purification, and comparison of de novo and maintenance methylation." J B i o l Chem 274(46): 33002-10. Qasba, P. and R. R. Reed (1998). "Tissue and zonal-specific expression of an olfactory receptor transgene." J Neurosci 18(1): 227-36. Razin, A . and H . Cedar (1991). " D N A methylation and gene expression." Microbio l Rev 55(3): 451-8. Rice, P., I. Longden, et al. (2000). " E M B O S S : the European Molecular Biology Open Software Suite." Trends Genet 16(6): 276-7. Robert, M . F., S. Mor in , et al. (2003). " D N M T 1 is required to maintain C p G methylation and aberrant gene silencing in human cancer cells." Nat Genet 33(1): 61-5. Robertson, K. D., E. Uzvolgy i , et al. (1999). "The human D N A methyltransferases (DNMTs) 1, 3a and 3b: coordinate m R N A expression in normal tissues and overexpression in tumors." Nucleic Acids Res 27(11): 2291-8. Rougier, N . , D. Bourc'his, et al. (1998). "Chromosome methylation patterns during mammalian preimplantation development." Genes Dev 12(14): 2108-13. Saito, Y . , Y . Kanai, et al. (2002). "Overexpression of a splice variant of D N A methyltransferase 3b, D N M T 3 b 4 , associated,with D N A hypomethylation on 122 pericentromeric satellite regions during human hepatocarcinogenesis." Proc Natl Acad Sci U S A 99(15,: 10060-5. Schreiber, S. L. and B. E. Bernstein (2002). "Signaling network model of chromatin." Ce l l 111(6): V71-8. Schwartz Levey, M . , D. M . Chikaraishi, et al. (1991). "Characterization of potential precursor populations in the mouse olfactory epithelium using immunocytochemistry and autoradiography." J Neurosci 11(11): 3556-64. Schwob, J . E., K. E. Szumowski, et al. (1992). "Olfactory sensory neurons are trophically dependent on the olfactory bulb for their prolonged survival." J Neurosci 12(10): 3896-919. Serizawa, S., T. Ishii, et al. (2000). "Mutually exclusive expression of odorant receptor transgenes." Nat Neurosci 3(7): 687-93. Shiio, Y . and R. N . Eisenman (2003). "From The Cover: Histone sumoylation is associated with transcriptional repression." Proc Natl Acad Sci U S A 100(23): 13225-30. Siegfried, Z. and H. Cedar (1997). " D N A methylation: a molecular lock." Curr B io l 7(5): R305-7. Smart, I. H. (1971). "Location and orientation of mitotic figures in the developing mouse olfactory epithelium." J Anat 109(2): 243-51. Smith, C. G. (1951). "Regeneration of sensory olfactory epithelium and nerves in adult frogs." Anat Rec 109(4): 661-71. Strotmann, J . , I. Wanner, et al. (1994). "Rostro-caudal patterning of receptor-expressing olfactory neurones in the rat nasal cavity." Ce l l Tissue Res 278(1): 11-20. Strotmann, J . , I. Wanner, et al. (1994). "Olfactory neurones expressing distinct odorant receptor subtypes are spatially segregated in the nasal neuroepithelium." Ce l l Tissue Res 276(3): 429-38. Surani, M . A . , S. C . Barton, et al. (1984). "Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis." Nature 308(5959): 548-50. Suzuki, T., H . Yokozak i , et al. (2000). "Effect of trichostatin A on cell growth and expression of cell cycle- and apoptosis-related molecules in human gastric and oral carcinoma cell lines." Int J Cancer 88(6): 992-7. Tagoh, H. , S. Melnik, et al. (2004). "Dynamic reorganization of chromatin structure and selective D N A demethylation prior to stable enhancer complex formation during differentiation of primary hematopoietic cells in vitro." Blood 103(8): 2950-5. Tang, L. Y . , M . N . Reddy, et al. (2003). "The eukaryotic D N M T 2 genes encode a new class of cytosine-5 D N A methyltransferases."J B io l Chem 278(36): 33613-6. Uh l , J . , N . K lan , et al. (2002). "The 5-lipoxygenase promoter is regulated by D N A methylation." J B io l Chem 277(6): 4374-9. Ura, K., H . Kurumizaka, et al. (1997). "Histone acetylation: influence on transcription, nucleosome mobility and positioning, and linker histone-dependent transcriptional repression." Embo J 16(8): 2096-107. Vassar, R., J . Ngai , et al. (1993). "Spatial segregation of odorant receptor expression in the mammalian olfactory epithelium." Ce l l 74(2): 309-18. Wade, P. A . (2001). "Methyl CpG-binding proteins and transcriptional repression." Bjoessays 23(12): 1131-7. 123 Walsh, C , A . Glaser, et al. (1994). "The non-viability of uniparental mouse conceptuses correlates with the loss of the products of imprinted genes." Mech Dev 46(1): 55-62. Wang, Y . , W . Fischle, et al. (2004). "Beyond the double helix: writing and reading the histone code." Novartis Found Symp 259: 3-17; discussion 17-21, 163-9. Watanabe, D., I. Suetake, et al. (2002). "Stage- and cell-specific expression of Dnmt3a and Dnmt3b during embryogenesis." Mech Dev 118(1-2): 187-90. Weisenberger, D. J . , M . Velicescu, et al. (2004). "Role of the D N A methyltransferase variant D N M T 3 b 3 in D N A methylation." M o l Cancer Res 2(1): 62-72. Wolf fe, A . P. (1997). "Histones, nucleosomes and the roles of chromatin structure in transcriptional control." Biochem Soc Trans 25(2): 354-8. Wolf fe, A . P. and M . A . Matzke (1999). "Epigenetics: regulation through repression." Science 286(5439): 481-6. Wong, L., B. Oakley, et al. (1994). "Keratin 19-like immunoreactivity in receptor cells of mammalian taste buds." Chem Senses 19(3): 251-64. Ye iv in , A . and A . Razin (1993). "Gene methylation patterns and expression." Exs 64: 523-68. Y i n , B., Y . Chen, et al. (1999). "[Cloning of full-length Dnmt3b c D N A and its alternative splicing isoforms in mouse embryo]." Zhongguo Y i Xue K e Xue Yuan Xue Bao 21(6): 431-8. Yoder, J . A . and T. H. Bestor (1998). " A candidate mammalian D N A methyltransferase related to pmt lp of fission yeast." Hum M o l Genet 7(2): 279-84. Yoder, J . A . , N . S. Soman, et al. (1997). " D N A (cytosine-5)-methyltransferases in mouse cells and tissues. Studies with a mechanism-based probe." J M o l B io l 270(3): 385-95. Young, J . M . , C. Friedman, et al. (2002). "Different evolutionary processes shaped the mouse and human olfactory receptor gene families." Hum M o l Genet 11(5): 535-46. Young, J . M . and B. J . Trask (2002). "The sense of smell: genomics of vertebrate odorant receptors." Hum M o l Genet 1K10V. 1153-60. Zhang, X . and S. Firestein (2002). "The olfactory receptor gene superfamily of the mouse." Nat Neurosci 5(2): 124-33. Zhang, Z. , C. Q. Chen, et al. (2004). " D N A methylation as an epigenetic regulator of neural 5-lipoxygenase expression: evidence in human N T 2 and N T 2 - N cells." J Neurochem 88(6): 1424-30. 124 Appendix A C p G I s l a n d a n d B l r e p e a t e l e m e n t i d e n t i f i c a t i o n o n C h r o m o s o m e 1 s u m m a r y o f r e s u l t s . R e g i o n o f c h r o m o s o m e a n a l y z e d . 9 3 0 0 0 0 0 0 - 9 5 0 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d F u n c t i o n a l OR a n d L o c i a s s o c i a t e d L o c i . G e n e L o c i . ( r e l a t i v e t o w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t ( r e l a t i v e t o s t a r t o f i n p u t I s l a n d s e q u e n c e ) s t a r t o f i n p u t s e q u e n c e ) s e q u e n c e ) 1 4 2 4 4 9 1 5 3 4 9 5 L e n g t h 6 0 0 L e n g t h 2 0 8 L e n g t h 2 4 0 0 0 ( 1 6 6 0 9 0 . . 1 6 6 6 8 9 ) 2 5 1 0 0 1 0 F 1 5 R i ( 9 5 7 4 6 . 9 5 9 5 3 ) ( 3 9 2 8 3 9 . . 3 9 3 0 7 8 ) 1 4 3 5 6 3 1 5 5 4 4 6 k 2 4 L e n g t h 7 0 6 L e n g t h 2 4 1 L e n g t h 2 2 5 1 4 5 6 2 8 ( 3 1 4 1 0 7 . . 3 1 4 8 1 2 ) ( 1 6 5 7 6 4 . 1 6 6 0 0 4 ( 3 9 3 9 3 8 . . 3 9 4 1 6 2 ) 9 0 7 1 0 0 0 7 A 1 4 R i ) 1 5 1 9 7 9 L e n g t h 8 2 9 k ( 3 r d e x o n ) 1 ( 3 7 4 8 1 5 . . 3 7 5 6 4 3 ) L e n g t h 2 2 1 P e r 2 L e n g t h 2 0 6 ( 4 5 6 4 0 0 . . 4 5 6 6 2 0 ) L e n g t h 7 5 0 ( 2 1 1 7 9 3 . 2 1 1 9 9 8 ( 4 1 1 7 3 3 . . 4 1 2 4 8 2 ) ) L O C 3 8 1 2 8 2 L e n g t h 2 1 7 L e n g t h 5 4 3 L e n g t h 2 0 9 ( 6 7 3 1 8 7 . . 6 7 3 4 0 3 ) ( 4 5 6 6 6 2 . . 4 5 7 2 0 4 ) ( 2 1 4 0 8 4 . 2 1 4 2 9 2 A s b l ) L e n g t h 1 0 5 9 L e n g t h 2 5 3 ( 7 1 7 0 1 2 . . 7 1 8 0 7 0 ) L e n g t h 2 0 1 ( 7 1 8 2 7 5 . . 7 1 8 5 2 7 ) T w i s t 2 ( 2 2 4 4 5 6 . 2 2 4 6 5 6 L e n g t h 1 5 3 9 ) L e n g t h 2 8 7 ( 1 2 5 2 8 5 7 . . 1 2 5 4 3 9 5 ( 8 4 4 7 6 7 . . 8 4 5 0 5 3 ) ) 4 9 3 2 4 0 8 F 1 9 L e n g t h 3 5 2 ( 2 6 0 7 8 2 . 2 6 1 1 3 3 L e n g t h 2 2 7 L e n g t h 5 6 1 ) ( 1 1 3 5 4 4 0 . . 1 1 3 5 6 6 6 ( 1 4 1 8 2 2 0 . . 1 4 1 8 7 8 0 N d u f a l O ) ) L e n g t h 3 9 1 ( 2 6 1 1 6 1 . 2 6 1 5 5 1 L e n g t h 2 0 4 L e n g t h 5 1 1 1 1 1 0 0 0 2 M 0 9 R i ) ( 1 2 3 3 7 5 0 . . 1 2 3 3 9 5 3 ( 1 5 8 8 2 9 4 . . 1 5 8 8 8 0 4 k ) ) L e n g t h 4 4 2 ( 2 8 2 1 0 8 . 2 8 2 5 4 9 L e n g t h 2 2 4 L e n g t h 8 6 6 G p c l ) ( 1 3 3 7 8 1 8 . . 1 3 3 8 0 4 1 ( 1 7 7 8 1 0 2 . . 1 7 7 8 9 6 7 ) ) i n t e r n a l t o L e n g t h 3 6 0 L e n g t h 3 7 6 L e n g t h 2 0 4 4 9 3 0 4 8 3 1 1 0 ( 3 2 8 3 0 5 . 3 2 8 6 6 4 ( 1 7 9 5 0 4 3 . . 1 7 9 5 4 1 8 ( 1 8 6 3 8 6 9 . . 1 8 6 4 0 7 2 ) ) ) i n t e r n a l t o 4 9 3 0 4 8 3 1 1 0 L e n g t h 3 7 2 L e n g t h 6 7 9 L e n g t h 6 3 4 ( 3 2 8 8 5 0 . 3 2 9 2 2 1 ( 1 8 4 0 5 7 5 . . 1 8 4 1 2 5 3 ( 1 8 6 4 0 8 0 \ . . 1 8 6 4 7 1 3 4 9 3 0 4 8 3 1 1 0 ) ) ; L e n g t h 2 9 5 L e n g t h 3 7 8 L e n g t h 6 6 4 ( 3 3 0 0 2 4 . 3 3 0 3 1 8 ( 1 9 4 1 8 8 4 . . 1 9 4 2 2 6 1 ( 1 9 3 8 2 9 3 ) . . 1 9 3 8 9 5 6 ) ) L e n g t h 2 3 6 ( 3 8 7 1 9 8 ) . 3 8 7 4 3 3 R e g i o n o f c h r o m o s o m e a n a l y z e d . 1 7 6 0 0 0 0 0 0 - 1 7 8 0 0 0 0 0 0 P r e s u m p t i v e l y F u n c t i o n a l OR G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) . C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e a s s o c i a t e d w i t h C p G I s l a n d B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) 8 1 7 0 6 5 9 6 0 8 9 1 9 9 1 9 2 4 1 0 4 6 8 3 2 1 0 6 6 6 9 0 1 0 . 7 8 9 8 5 1 1 3 3 5 0 9 L e n g t h 2 4 1 ( 2 5 5 3 . . 2 7 9 3 ) L e n g t h 7 9 9 ( 2 3 4 0 5 5 . . 2 3 4 8 5 3 ) L O C 3 8 1 3 2 7 P i g m L e n g t h 5 8 8 ( 5 6 9 7 . . 6 2 8 4 ) L e n g t h 4 3 6 ( 1 7 0 0 2 8 . . 1 7 0 4 6 3 ) L e n g t h 4 3 8 ( 1 8 3 4 9 4 . . 1 8 3 9 3 1 L e n g t h 3 3 4 ( 3 5 8 9 9 8 . . 3 5 9 3 3 1 ) L e n g t h 2 1 8 ( 3 9 2 0 8 5 . . 3 9 2 3 0 2 ) L e n g t h 2 2 4 ( 4 0 0 9 4 5 . . 4 0 1 1 6 8 ) 125 ) L e n g t h ( 1 8 3 9 4 1 ) 4 7 2 . 1 8 4 4 1 2 L e n g t h 2 0 3 ( 4 2 1 8 1 0 . . 4 2 2 0 1 2 ) L e n g t h 4 3 3 ( 4 2 2 6 7 6 . . 4 2 3 1 0 8 ) L e n g t h ( 1 9 8 6 2 3 2 2 8 . 1 9 8 8 5 0 L e n g t h 3 7 1 ( 4 9 2 2 9 1 . . 4 9 2 6 6 1 ) ; L e n g t h ( 1 9 8 8 5 7 3 8 5 . 1 9 9 2 4 1 L e n g t h 3 2 1 ( 1 2 3 0 2 8 6 . . 1 2 3 0 6 0 6 ) ) L e n g t h ( 2 3 4 8 8 3 3 5 1 . 2 3 5 2 3 3 L e n g t h 2 0 6 ( 1 2 3 0 8 5 1 . . 1 2 3 1 0 5 6 ) ) L e n g t h ( 3 4 0 4 2 8 ) 3 0 4 . 3 4 0 7 3 1 L e n g t h 2 8 8 ( 1 6 1 2 9 1 3 . . 1 6 1 3 2 0 0 ) L e n g t h ( 3 5 8 5 4 9 ) 2 6 9 . 3 5 8 8 1 7 C p G I s l a n d a n d B l r e p e a t e l e m e n t i d e n t i f i c a t i o n o n C h r o m o s o m e 9 s u m m a r y o f r e s u l t s . R e g i o n o f c h r o m o s o m e a n a l y z e d . 3 7 0 0 0 0 0 0 - 3 8 0 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d F u n c t i o n a l OR a n d L o c i . a s s o c i a t e d L o c i . G e n e L o c i . ( r e l a t i v e t o s t a r t w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t ( r e l a t i v e t o o f i n p u t s e q u e n c e ) I s l a n d s e q u e n c e ) s t a r t o f i n p u t s e q u e n c e ) L e n g t h 54 8 L e n g t h 4 3 2 L e n g t h 4 3 2 ( 7 5 4 3 1 . . 7 5 9 7 8 ) E i 2 4 ( 4 6 1 2 3 . . 4 6 5 5 4 ) ( 5 4 1 0 6 8 . . 5 4 1 4 9 9 L e n g t h 5 4 8 L e n g t h 2 4 7 i ( 5 7 0 3 7 9 . . 5 7 0 9 2 6 ) L O C 3 8 4 92 9 ( 4 6 7 4 7 . . 4 6 9 9 3 ) L e n g t h 2 4 7 ( 5 4 1 6 9 2 . . 5 4 1 9 3 8 L e n g t h 2 7 6 ) ( 1 7 4 6 5 7 . . 1 7 4 9 3 2 ) L e n g t h 2 5 6 L e n g t h 3 6 3 ( 9 2 1 7 6 2 . . 9 2 2 0 1 7 ( 1 9 2 5 1 8 . . 1 9 2 8 8 0 ) ) L e n g t h 3 1 7 L e n g t h 3 1 5 ( 2 5 1 6 4 5 . . 2 5 1 9 6 1 ) ( 9 2 2 5 3 6 . . 9 2 2 8 5 0 L e n g t h 2 1 8 ) ( 4 9 9 4 7 9 . . 4 9 9 6 9 6 ) L e n g t h 4 3 0 ( 9 2 3 1 8 9 . . 9 2 3 6 1 8 ) L e n g t h 2 4 1 ( 9 2 3 7 0 8 . . 9 2 3 9 4 8 ) R e g i o n o f c h r o m o s o m e a n a l y z e d . 3 8 0 0 0 0 0 0 - 3 9 0 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d F u n c t i o n a l OR a n d L o c i . a s s o c i a t e d L o c i . G e n e L o c i . ( r e l a t i v e t o w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) ( r e l a t i v e t o s t a r t o f i n p u t I s l a n d s t a r t o f i n p u t s e q u e n c e ) s e q u e n c e ) 5 2 5 1 9 9 9 9 8 9 5 7 L e n g t h 5 3 7 L e n g t h 2 5 2 L e n g t h 2 7 2 5 5 1 7 2 7 1 0 3 3 5 5 1 ( 2 3 9 2 3 3 . . 2 3 9 7 6 9 ) n o ( 1 0 7 7 7 1 . . 1 0 8 0 2 2 ) ( 3 2 4 9 1 4 . 3 2 5 1 8 5 ) 5 8 3 0 4 8 1 0 4 8 6 4 7 a s s o c i a t e d 6 3 4 0 5 2 1 0 8 8 9 2 0 L e n g t h 7 6 7 g e n e L e n g t h 2 3 7 L e n g t h 2 3 9 6 9 7 8 7 6 1 1 0 9 7 2 1 ( 2 6 8 2 1 1 . . 2 6 8 9 7 7 ) ( 1 0 8 8 7 4 . . 1 0 9 1 1 0 ) ( 3 3 1 6 4 3 . 3 3 1 8 8 1 ) 7 7 2 6 2 6 1 1 2 9 2 1 7 8 0 5 9 4 0 1 1 4 7 6 8 0 n o L e n g t h 2 5 0 L e n g t h 2 2 1 8 6 4 9 7 0 1 1 5 8 0 1 5 a s s o c i a t e d ( 1 1 4 5 1 4 . . 1 1 4 7 6 3 ) ( 3 9 2 2 6 3 . 3 9 2 4 8 3 ) 8 8 8 8 2 0 1 2 2 9 0 0 6 g e n e 8 9 5 9 3 0 1 2 4 4 1 7 5 L e n g t h 4 1 5 L e n g t h 3 6 7 9 2 3 2 6 9 1 2 5 2 8 8 1 ( 1 2 4 6 7 4 . . 1 2 5 0 8 8 ) ( 4 3 5 9 8 7 . 4 3 6 3 5 3 ) 9 6 0 0 0 3 1 2 6 8 1 6 3 9 6 9 9 3 1 . 1 2 7 8 8 0 3 L e n g t h 2 8 8 L e n g t h 2 9 0 126 9 8 9 1 8 7 1 2 9 6 1 6 6 ( 1 6 1 6 4 5 . 1 6 1 9 3 2 ) ( 9 3 5 9 6 5 . . 9 3 6 2 5 4 ) L e n g t h 2 8 1 L e n g t h 3 8 1 ( 1 9 7 9 7 2 . 1 9 8 2 5 2 ) ( 9 5 1 3 7 3 . . 9 5 1 7 5 3 ) L e n g t h 2 6 0 L e n g t h 2 0 3 ( 2 0 6 6 5 0 . 2 0 6 9 0 9 ) ( 1 0 9 7 2 1 7 . . 1 0 9 7 4 1 9 L e n g t h 2 4 2 ) ( 3 2 3 9 5 2 . 3 2 4 1 9 3 ) R e g i o n o f c h r o m o s o m e a n a l y z e d . 3 9 3 0 0 0 0 0 - 4 0 2 0 0 0 0 0 P r e s u m p t i v e l y F u n c t i o n a l OR G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e a s s o c i a t e d w i t h C p G I s l a n d B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i , ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) 3 8 6 6 4 1 3 0 0 6 L e n g t h 2 0 2 1 9 0 2 9 4 5 8 5 1 0 ( 6 2 0 0 5 2 . . 6 2 0 2 5 3 ) 6 1 6 6 2 . 4 6 4 9 4 2 8 6 8 5 0 4 7 7 3 3 8 L e n g t h 2 0 4 1 2 6 9 7 3 5 0 1 4 5 0 ( 8 7 8 0 3 3 . . 8 7 8 2 3 6 ) 1 3 7 8 4 1 5 4 2 5 6 0 1 5 2 8 8 7 5 5 6 8 7 3 1 7 7 8 1 2 5 6 0 6 2 7 1 9 8 6 7 9 6 2 7 0 1 2 2 3 6 0 7 3 6 4 1 9 5 7 2 5 5 6 4 0 6 6 7 0 5 7 2 9 5 8 9 2 6 9 9 2 8 7 3 0 8 0 8 1 7 3 9 6 4 8 3 3 7 8 8 1 7 6 6 2 2 4 3 7 5 0 7 2 R e g i o n o f c h r o m o s o m e a n a l y z e d . 4 0 3 0 0 0 0 0 - 4 1 9 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . F u n c t i o n a l OR a n d L o c i . a s s o c i a t e d ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e L o c i . ( r e l a t i v e t o w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t I s l a n d s t a r t o f i n p u t s e q u e n c e ) s e q u e n c e ) 5 3 0 6 1 4 3 1 0 7 2 L e n g t h 5 1 5 L e n g t h 2 0 4 L e n g t h 2 7 9 6 1 4 0 8 4 6 4 9 1 3 ( 1 0 1 1 6 6 2 . . 1 0 1 2 1 7 6 Z f p 2 0 2 ( 1 9 5 4 . . 2 1 5 7 ) ( 1 0 1 1 3 8 2 . . 1 0 1 1 6 6 0 ) 7 5 9 3 5 5 0 1 4 4 1 ) 1 0 2 4 1 5 7 0 7 2 7 L e n g t h 2 8 1 L e n g t h 3 8 9 1 6 0 3 7 1 6 L e n g t h 8 7 9 A 9 3 0 0 0 8 A 2 2 R i k ( 2 2 3 6 4 1 . . 2 2 3 9 2 1 ) ( 1 0 1 7 7 7 3 . . 1 0 1 8 1 6 1 ) 1 4 1 5 5 6 1 1 2 9 1 ( 1 2 7 5 1 4 8 . . 1 2 7 6 0 2 6 9 6 1 7 4 4 3 ) L e n g t h 2 2 7 L e n g t h 3 4 9 1 6 3 9 5 6 5 6 7 9 1 ( 4 7 7 8 0 2 . . 4 7 8 0 2 8 ) ( 1 0 7 8 5 2 2 . . 1 0 7 8 8 7 0 ) 0 6 6 2 5 1 6 1 7 9 0 2 8 9 8 3 9 1 L e n g t h 2 5 0 L e n g t h 2 0 5 4 9 1 6 1 1 7 ( 4 8 5 4 1 8 . . 4 8 5 6 6 7 ) ( 1 3 0 7 5 1 6 . . 1 3 0 7 7 2 0 ) 2 0 5 1 9 9 2 4 6 4 4 7 9 5 1 6 3 5 L e n g t h 2 1 0 L e n g t h 2 3 0 2 1 4 7 5 1 0 1 2 6 3 n ( 4 8 9 2 1 0 . . 4 8 9 4 1 9 ) ( 1 3 1 1 9 5 1 . . 1 3 1 2 1 8 0 ) 5 2 3 8 3 5 1 L e n g t h 2 4 7 L e n g t h 3 3 7 9 ( 4 9 0 2 9 5 . . 4 9 0 5 4 1 ) ( 1 3 5 1 0 1 5 . . 1 3 5 1 3 5 1 ) 2 6 0 7 2 2 L e n g t h 2 2 0 2 7 7 6 6 ( 8 7 4 3 0 9 . . 8 7 4 5 2 8 ) u 3 6 3 4 9 u 3 8 7 0 1 1 X 4 1 1 2 7 6 C p G I s l a n d a n d B l r e p e a t e l e m e n t i d e n t i f i c a t i o n o n C h r o m o s o m e 1 6 s u m m a r y o f r e s u l t s . R e g i o n o f c h r o m o s o m e a n a l y z e d . 5 7 0 0 0 0 0 0 - 5 8 0 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d F u n c t i o n a l OR a n d L o c i . a s s o c i a t e d L o c i . G e n e L o c i . ( r e l a t i v e t o w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t ( r e l a t i v e t o s t a r t o f i n p u t I s l a n d s e q u e n c e ) s t a r t o f i n p u t s e q u e n c e ) 127 s e q u e n c e ) L e n g t h 5 3 8 L e n g t h 2 4 6 L e n g t h 2 8 0 ( 1 5 8 9 3 0 . 1 5 9 4 6 7 ) T f g ( 2 0 8 2 0 0 . 2 0 8 4 4 5 ) ( 9 2 4 5 4 4 \ . 9 2 4 8 2 3 L e n g t h 7 1 0 L e n g t h 3 9 1 / ( 5 7 3 2 8 3 . 5 7 3 9 9 2 ) D 1 6 I u m 2 2 e ( 3 9 6 4 4 2 . 3 9 6 8 3 2 ) L e n g t h 2 5 6 ( 9 2 4 9 5 4 . 9 2 5 2 0 9 L e n g t h 2 2 2 ) ( 5 0 2 3 0 7 . 5 0 2 5 2 8 ) L e n g t h 3 9 3 L e n g t h 3 0 0 ( 9 9 4 9 4 5 . 9 9 5 3 3 7 ( 6 1 8 4 8 7 . 6 1 8 7 8 6 ) ) L e n g t h 4 6 9 L e n g t h 4 4 1 ( 6 8 2 1 6 4 . 6 8 2 6 3 2 ) ( 8 3 6 0 1 2 . 8 3 6 4 5 2 L e n g t h 2 1 8 } ( 7 2 5 2 0 1 . 7 2 5 4 1 8 ) L e n g t h 2 2 8 ( 9 2 4 2 5 6 . 9 2 4 4 8 3 L e n g t h 4 4 1 ) ( 8 3 6 0 1 2 . 8 3 6 4 5 2 ) L e n g t h 2 8 0 L e n g t h 2 2 8 ( 9 2 4 5 4 4 . 9 2 4 8 2 3 ( 9 2 4 2 5 6 . 9 2 4 4 8 3 ) ) L e n g t h 2 5 6 ( 9 2 4 9 5 4 ) . 9 2 5 2 0 9 L e n g t h 3 9 3 ( 9 9 4 9 4 5 ) . 9 9 5 3 3 7 R e g i o n o f c h r o m o s o m e a n a l y z e d . 5 8 0 0 0 0 0 0 - 5 9 0 0 0 0 0 0 P r e s u m p t i v e l y F u n c t i o n a l OR G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e a s s o c i a t e d w i t h C p G I s l a n d B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) L e n g t h 5 2 5 ( 5 2 7 4 5 . . 5 3 2 6 9 ) L e n g t h 6 1 3 ( 9 2 2 9 3 6 . . 9 2 3 5 4 8 ) 2 6 1 0 5 2 8 E 2 3 R i k E s d n L e n g t h 4 4 3 ( 1 4 2 7 0 2 . . 1 4 3 1 4 4 ) L e n g t h 2 8 4 ( 6 5 1 2 4 3 . . 6 5 1 5 2 6 ) L e n g t h 3 1 2 ( 7 4 1 9 2 7 . . 7 4 2 2 3 8 ) L e n g t h 3 6 8 ( 8 4 1 3 1 9 . . 8 4 1 6 8 6 ) L e n g t h 2 5 0 ( 8 5 4 1 0 5 . . 8 5 4 3 5 4 ) L e n g t h 2 0 8 ( 8 5 4 9 4 1 . . 8 5 5 1 4 8 ) L e n g t h 2 1 0 ( 9 2 3 7 1 0 . . 9 2 3 9 1 9 ) L e n g t h 2 6 3 ( 9 3 7 2 8 2 . . 9 3 7 5 4 4 ) R e g i o n o f c h r o m o s o m e a n a l y z e d . 5 9 0 0 0 0 0 0 - 6 0 0 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d F u n c t i o n a l OR a n d L o c i . a s s o c i a t e d L o c i . G e n e L o c i . ( r e l a t i v e t o w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t ( r e l a t i v e t o s t a r t o f i n p u t I s l a n d s e q u e n c e ) s t a r t o f i n p u t s e q u e n c e ) s e q u e n c e ) 2 7 4 8 7 3 5 8 7 5 9 5 L e n g t h 6 9 9 L e n g t h 2 3 8 L e n g t h 3 4 8 3 0 8 8 6 6 6 6 6 2 3 3 ( 3 7 8 7 9 . . 3 8 5 7 7 ) S i a t l O ( 1 6 5 1 1 9 . . 1 6 5 3 5 6 ) ( 3 2 2 0 6 3 . . 3 2 2 4 1 0 3 3 5 7 9 8 6 9 8 4 1 8 ) 3 7 3 1 5 2 7 1 6 8 1 6 L e n g t h 5 3 8 C p o L e n g t h 2 2 1 3 8 5 3 6 8 7 3 2 7 6 9 ( 1 8 5 1 1 0 . . 1 8 5 6 4 7 ) ( 1 6 8 9 1 1 . . 1 6 9 1 3 1 ) L e n g t h 2 6 2 4 0 2 4 0 8 7 9 7 5 8 0 ( 6 3 7 8 4 1 . . 6 3 8 1 0 2 4 2 8 8 3 5 8 1 2 4 1 3 L e n g t h 2 0 9 ) 4 3 8 7 6 5 8 3 1 9 9 6 ( 1 6 9 9 5 9 . . 1 7 0 1 6 7 ) 5 1 2 8 1 2 8 7 3 3 0 5 L e n g t h 2 0 2 5 3 5 2 5 4 8 8 7 3 3 3 L e n g t h 2 4 7 ( 6 4 6 8 0 8 . . 6 4 7 0 0 9 5 4 0 2 2 3 8 8 7 3 3 6 ( 1 8 9 8 1 5 . . 1 9 0 0 6 1 ) ) 5 4 9 1 4 5 L e n g t h 3 1 5 ( 2 4 2 6 4 2 . . 2 4 2 9 5 6 ) L e n g t h ( 6 4 7 0 1 8 . 2 6 2 . 6 4 7 2 7 9 128 L e n g t h 2 2 8 ( 2 4 2 9 6 3 . . 2 4 3 1 9 0 ) ) L e n g t h 2 98 ( 7 6 8 2 9 9 . . 7 6 8 5 9 6 ) L e n g t h 2 2 0 ( 7 7 8 6 2 7 . . 7 7 8 8 4 6 ) R e g i o n o f c h r o m o s o m e a n a l y z e d . 6 0 0 0 0 0 0 0 - 6 1 0 0 0 0 0 0 P r e s u m p t i v e l y F u n c t i o n a l O R G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e a s s o c i a t e d w i t h C p G I s l a n d B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) L e n g t h 6 5 7 ( 1 5 3 0 4 8 . . 1 5 3 7 0 4 ) i n t e r n a l t o E p h a 6 L e n g t h 2 1 2 ( 7 5 6 0 5 . . 7 5 8 1 6 ) L e n g t h 4 98 ( 1 0 4 6 2 8 . . 1 0 5 1 2 5 ) L e n g t h 2 8 1 ( 2 2 9 1 0 3 . . 2 2 9 3 8 3 ) L e n g t h 3 6 2 ( 4 2 4 9 7 1 . . 4 2 5 3 3 2 ) L e n g t h 2 0 9 ( 5 4 7 0 1 4 . . 5 4 7 2 2 2 ) L e n g t h 2 0 3 ( 8 5 4 3 3 4 . . 8 5 4 5 3 6 ) L e n g t h 4 8 9 ( 9 5 1 2 7 9 . . 9 5 1 7 6 7 ) C p G I s l a n d a n d B l r e p e a t e l e m e n t i d e n t i f i c a t i o n o n C h r o m o s o m e 1 7 s u m m a r y o f r e s u l t s . R e g i o n o f c h r o m o s o m e a n a l y z e d . 3 6 0 0 0 0 0 0 - 3 7 0 0 0 0 0 0 P r e s u m p t i v e l y C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d F u n c t i o n a l O R a n d L o c i . a s s o c i a t e d L o c i . G e n e L o c i . ( r e l a t i v e t o w i t h C p G ( r e l a t i v e t o s t a r t o f i n p u t ( r e l a t i v e t o s t a r t o f i n p u t I s l a n d s e q u e n c e ) s t a r t o f i n p u t s e q u e n c e ) s e q u e n c e ) 8 6 1 8 8 3 9 6 3 5 0 2 L e n g t h 6 3 1 L e n g t h 2 0 2 L e n g t h 4 2 4 9 0 2 3 2 7 9 7 8 1 8 7 ( 6 9 8 6 6 6 . . 6 9 9 2 9 6 ) L O C 2 4 0 0 9 4 ( 3 1 3 0 2 7 . . 3 1 3 2 2 8 ) ( 7 5 4 3 6 4 . . 7 5 4 7 8 7 9 2 2 4 8 3 9 8 4 4 9 6 ) L e n g t h 6 4 3 L e n g t h 2 0 2 ( 9 4 9 1 2 3 . . 9 4 9 7 6 5 ) O R ( 3 6 1 8 5 5 . . 3 6 2 0 5 6 ) L e n g t h 4 0 2 p s e u d o g e n e ( 7 9 7 5 7 1 . . 7 9 7 9 7 2 L e n g t h 2 6 5 ) ( 5 6 5 8 6 2 . . 5 6 6 1 2 6 ) L e n g t h 2 1 8 L e n g t h 2 6 5 ( 7 9 7 9 8 1 . . 7 9 8 1 9 8 ( 5 8 8 9 8 0 . . 5 8 9 2 4 4 ) ) L e n g t h 5 9 3 L e n g t h 3 0 7 ( 6 9 4 5 0 7 . . 6 9 5 0 9 9 ) ( 8 0 1 0 3 6 . \ . 8 0 1 3 4 2 L e n g t h 3 1 0 I ( 7 1 0 0 9 4 . . 7 1 0 4 0 3 ) L e n g t h 2 0 1 ( 8 0 1 6 4 1 . . 8 0 1 8 4 1 L e n g t h 2 7 7 ) ( 7 4 0 2 5 3 . . 7 4 0 5 2 9 ) L e n g t h 2 6 7 ( 8 0 2 0 6 4 . ) . 8 0 2 3 3 0 L e n g t h 2 6 7 ( 9 6 3 9 5 4 . ) . 9 6 4 2 2 0 R e g i o n o f c h r o m o s o m e a n a l y z e d . 3 7 0 0 0 0 0 0 - 3 8 0 0 0 0 0 0 | P r e s u m p t i v e l y | C p G I s l a n d L e n g t h I G e n e a s s o c i a t e d | B l R e p e t i t i v e E l e m e n t | 129 F u n c t i o n a l OR G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) w i t h C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) 3 0 6 9 3 3 6 9 3 8 L e n g t h 2 4 2 1 5 7 0 5 3 5 2 0 8 7 ( 7 2 0 8 0 0 . . 7 2 1 0 4 1 ) 2 9 4 0 3 3 8 6 4 6 9 3 1 5 7 6 4 6 8 1 7 0 L e n g t h 2 2 2 3 7 4 0 5 4 9 3 4 9 8 ( 7 2 1 8 8 4 . . 7 2 2 1 0 5 ) 5 4 3 6 9 4 9 3 4 9 8 6 7 8 0 5 5 3 9 2 1 7 L e n g t h 2 5 1 9 0 6 4 0 5 6 3 0 3 8 ( 7 2 7 5 0 7 . . 7 2 7 7 5 7 ) 1 1 5 3 5 4 5 7 2 7 3 9 1 2 9 9 1 2 6 0 2 2 7 8 L e n g t h 2 3 7 1 3 5 6 9 8 6 1 7 8 7 2 ( 8 1 4 4 9 8 . . 8 1 4 7 3 4 ) 1 4 7 7 2 3 6 7 0 3 5 9 1 5 8 6 9 2 8 2 1 4 8 8 1 6 0 9 7 9 8 3 4 0 6 2 2 0 5 3 9 0 8 4 8 9 2 1 2 1 1 3 4 4 8 9 7 1 3 8 2 4 1 0 4 5 9 1 5 4 7 9 2 5 8 4 7 3 9 4 1 9 7 5 3 2 5 7 9 8 9 7 5 1 3 6 R e g i o n o f c h r o m o s o m e a n a l y z e d . 3 8 0 0 0 0 0 0 - 3 9 0 0 0 0 0 0 P r e s u m p t i v e l y F u n c t i o n a l OR G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e a s s o c i a t e d w i t h C p G I s l a n d B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) 7 1 4 1 2 8 0 2 2 1 1 0 2 0 5 0 L e n g t h 2 3 4 ( 3 4 6 7 2 . . 3 4 9 0 5 ) L e n g t h 3 4 5 ( 1 2 8 7 8 0 . . 1 2 9 1 2 4 ) L e n g t h 2 5 1 ( 3 1 0 7 8 7 . . 3 1 1 0 3 7 ) L e n g t h 2 4 3 ( 3 1 4 9 1 1 . . 3 1 5 1 5 3 ) L e n g t h 2 0 0 ( 3 2 0 9 4 1 . . 3 2 1 1 4 0 ) L e n g t h 2 3 4 ( 6 8 0 3 7 7 . . 6 8 0 6 1 0 ) C p G I s l a n d a n d B l r e p e a t e l e m e n t i d e n t i f i c a t i o n o n C h r o m o s o m e 1 9 s u m m a r y o f r e s u l t s . R e g i o n o f c h r o m o s o m e a n a l y z e d . 1 1 0 0 0 0 0 0 - 1 3 0 0 0 0 0 0 C o d i n g E x o n C p G I s l a n d L e n g t h G e n e B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . S t a r t L o c i o f a n d L o c i . a s s o c i a t e d ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) P r e s u m p t i v e l y ( r e l a t i v e t o w i t h C p G F u n c t i o n a l O R s t a r t o f i n p u t I s l a n d G e n e ( r e l a t i v e s e q u e n c e ) t o s t a r t o f i n p u t s e q u e n c e ) 6 5 9 7 6 2 L e n g t h 5 0 7 L e n g t h 2 4 3 L e n g t h 2 8 5 7 0 8 3 3 0 ( 6 5 0 2 7 6 . . 6 5 0 7 8 2 ) s y n t a x i n 3 ( 2 5 7 2 0 4 . 2 5 7 4 4 6 ) ( 1 1 9 3 3 4 6 . . 1 1 9 3 6 3 0 7 2 7 7 0 8 ) 8 6 7 4 9 3 L e n g t h 7 7 8 L e n g t h 2 3 2 8 9 0 4 9 4 ( 7 4 3 7 5 9 . . 7 4 4 5 3 6 ) a v 3 1 2 0 8 6 ( 2 5 8 1 6 5 . 2 5 8 3 9 6 ) L e n g t h 2 5 0 9 1 9 5 4 0 ( 1 2 7 4 4 3 4 . . 1 2 7 4 6 8 3 9 3 0 3 8 7 L e n g t h 9 4 4 L e n g t h 2 0 9 ) 9 4 0 2 8 5 ( 7 9 7 1 0 9 . . 7 9 8 0 5 2 ) 1 1 1 0 0 1 8 F 0 6 R i ( 6 0 2 0 2 5 . 6 0 2 2 3 3 ) 9 5 1 4 0 6 k L e n g t h 2 3 7 1 0 3 3 9 1 L e n g t h 8 5 6 L e n g t h 2 3 7 ( 1 3 2 6 4 6 5 . . 1 3 2 6 7 0 1 6 ( 1 3 7 3 0 9 8 . . 1 3 7 3 9 5 3 ( 6 1 5 2 8 9 . 6 1 5 5 2 5 ) ) 1 0 6 8 4 1 ) l O k b a w a y 4 f r o m a g e n e . L e n g t h 2 1 0 L e n g t h 3 1 0 1 0 9 5 9 2 L e n g t h 6 1 4 ( 6 5 0 9 0 7 . 6 5 1 1 1 6 ) ( 1 3 7 3 9 6 2 . . 1 3 7 4 2 7 1 5 ( 1 6 6 7 5 6 8 . . 1 6 6 8 1 8 1 4 9 3 3 4 0 2 K 0 5 R 1 ) 1 1 1 0 7 3 ) k L e n g t h 3 8 9 8 ( 7 0 0 3 8 9 . 7 0 0 7 7 7 ) L e n g t h 3 0 3 1 1 2 5 8 7 L e n g t h 5 8 0 ( 1 4 6 8 1 3 3 . . 1 4 6 8 4 3 5 1 ( 1 6 7 1 1 3 6 . . 1 6 7 1 7 1 5 4 9 3 3 4 0 2 K 0 5 R i L e n g t h 3 1 7 ) 1 2 2 1 1 2 ) k ( 7 1 0 0 1 9 . 7 1 0 3 3 5 ) 3 L e n g t h 2 3 1 1 2 4 9 1 6 L e n g t h 2 5 5 ( 1 6 6 6 8 3 4 . . 1 6 6 7 0 6 4 9 ( 8 4 2 1 2 1 . 8 4 2 3 7 5 ) ) 1 5 4 6 3 0 130 2 1 5 5 2 2 0 C L e n g t h 2 4 4 ( 9 7 8 0 5 6 . . 9 7 8 2 9 9 ) L e n g t h 4 7 9 ( 1 6 6 7 0 7 0 . . 1 6 6 7 5 4 8 1 7 3 7 5 4 4 1 7 5 9 6 5 0 1 7 6 5 4 1 6 1 7 7 6 6 1 L e n g t h 2 2 8 ( 1 0 4 2 6 8 0 . . 1 0 4 2 9 0 7 ) ) L e n g t h 2 1 0 ( 1 6 7 2 3 7 2 . . 1 6 7 2 5 8 1 L e n g t h 2 4 1 ( 1 0 4 3 0 0 7 . . 1 0 4 3 2 4 7 ) ) L e n g t h 3 6 8 ( 1 7 7 1 6 2 9 . . 1 7 7 1 9 9 6 6 1 7 9 5 1 3 0 1 8 1 0 5 0 L e n g t h 2 4 0 ( 1 1 8 8 8 7 1 . . 1 1 8 9 1 1 0 ) ; L e n g t h 2 6 9 ( 1 8 6 9 0 9 0 . . 1 8 6 9 3 5 8 7 1 8 2 9 3 5 8 1 8 7 4 7 3 n L e n g t h 2 7 1 ( 1 1 8 9 1 2 4 . . 1 1 8 9 3 9 4 ) t L e n g t h 2 3 0 ( 1 9 3 9 0 4 1 . . 1 9 3 9 2 7 0 u 1 9 5 5 8 5 1 1 9 8 7 1 0 7 ) L e n g t h 4 3 1 ( 1 9 9 6 6 3 3 . . 1 9 9 7 0 6 3 ) R e g i o n o f c h r o m o s o m e a n a l y z e d . 1 3 0 0 0 0 0 0 - 1 5 0 0 0 0 0 0 P r e s u m p t i v e l y F u n c t i o n a l O R G e n e L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) C p G I s l a n d L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) G e n e a s s o c i a t e d w i t h C p G I s l a n d B l R e p e t i t i v e E l e m e n t L e n g t h a n d L o c i . ( r e l a t i v e t o s t a r t o f i n p u t s e q u e n c e ) 4 2 7 8 2 8 8 0 0 9 1 7 8 0 8 6 2 2 3 7 1 9 2 4 6 5 8 3 4 7 6 7 1 0 4 9 8 1 0 5 5 2 0 9 8 9 5 4 0 2 2 4 5 5 2 4 9 4 5 6 6 5 4 5 5 8 6 5 2 4 6 1 0 1 0 4 6 5 9 1 4 6 L e n g t h 5 2 6 ( 8 8 4 0 3 4 . . 8 8 4 5 5 9 ) L e n g t h 1 0 3 0 ( 1 3 7 2 4 2 5 . . 1 3 7 3 4 5 4 ) N o a s s o c i a t e d g e n e - i n 2 ° a e x o n o f T l e 4 L e n g t h 2 5 8 ( 4 0 4 6 2 . . 4 0 7 1 9 ) L e n g t h 2 2 2 ( 1 6 0 7 1 0 . . 1 6 0 9 3 1 ) L e n g t h 2 0 6 ( 3 1 9 3 5 4 . . 3 1 9 5 5 9 ) L e n g t h 3 1 1 ( 7 0 1 0 7 9 . . 7 0 1 3 8 9 ) L e n g t h 2 4 5 ( 7 0 4 7 1 9 . . 7 0 4 9 6 3 ) L e n g t h 2 9 5 ( 1 0 4 2 0 4 0 . . 1 0 4 2 3 3 4 ) L e n g t h 8 3 3 ( 1 3 7 1 2 0 4 . . 1 3 7 2 0 3 6 ) 131 Appendix B Clustal alignment of D N M T 3 b splice m R N A isoforms. Sequences a l i g n e d : Sequence Sequence Sequence Sequence Sequence Sequence Sequence Sequence Sequence Sequence Sequence Sequence gi I 6753 gi I 8347 gi|8347 gi|8347 gi|8347 g i I 8347 gi I 8347 gil8347 gil8347 gi|644 gi|644 gi!644 661IrefINM_010068 136|gb|AF151976.1 134|gb|AF151975.1 130|gb|AF151974.1 127|gb|AF151973.1 125|gb|AF151972.1 122IgblAF151971.1 119lgb|AF151970.1 117|gb|AF151969.1 9473lgblAF068628 9471|gb|AF068627 9469lgb|AF068626 .11 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 2IAF068 2IAF068 2IAF068 Alignment s c o r e s : Group 1: Sequences: 2 Score 78136 Group 2: Sequences: 3 Score 73465 Group 3: Sequences: 4 Score 74102 Group 4 : Sequences: 5 Score 75515 Group 5: Sequences: 6 Score 74566 Group 6: Sequences: 2 Score 78668 Group 7: Sequences: 3 Score 73997 Group 8: Sequences: 4 Score 74980 Group 9: Sequences: 5 Score 75894 Group 10 Sequences: 6 Score:75352 Group 11 Sequences: 12 Score :74729 Alignment Score 1927070 Alignment: gi|6449471 gi|6449469 gil6753661 g i I 6449473 gi|8347119 gi|8347122 gi|8347130 gi|8347127 gil8347136 gil8347134 gi|8347117 gi!8347125 |gb|AF068627.2 |gb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 |gb|AF151970.1 |gb|AF151971.1 lgblAF151974.1 lgblAF151973.1 |gb|AF151976.1 |gb|AF151975.1 lgblAF151969.1 |gb|AF151972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 3946 bp 3974 bp 4034 bp 4163 bp 4223 bp 4149 bp 4089 bp 4278 bp 4338 bp 3946 bp 4135 bp 4195 bp AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 50 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 50 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 50 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 50 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 5 0 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 5 0 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 5 0 AGACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGT 5 0 g i l 6 4 4 9471|gb|AF068627.2|AF068 g i l 6 4 4 94 69|gblAF068626.2|AF068 gil6753661IrefINM_010068.11 gi|644 9473|gblAF068 628.2IAF068 gil8347119lgb|AF151970.1|AF151 gi|8347122|gb|AF151971.1IAF151 gi|8347130lgb|AF151974.1|AF151 gil8347127|gblAF151973.1IAF151 gil8347136IgblAF151976.1|AF151 g i l 8347134 IgblAF151975.11AF151 gi|8347117|gblAF151969.1IAF151 gil8347125lgb|AF151972.1|AF151 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 CTCGCAGCCGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAG 100 gi|64 49471IgblAF068627.2|AF068 giI64494 69lgb|AF0 68 626.2|AF0 68 gil 6 7 5 3 661IrefINM_010068.11 gi|6449473lgb|AF068 628.2|AF068 gi|8347119|gb|AF151970.1|AF151 gi|8347122|gb|AF151971.1|AF151 gil8347130lgb|AF151974.1|AF151 g i l 8347127 Igbl AF151973.11AF151 gi|8347136lgb|AF151976.1|AF151 gi I 8347134 IgbIAF151975.11AF151 g i l 8347117 IgblAF151969.11AF151 gil8347125lgblAF151972.1|AF151 GAATTCCGG 9 GAATTCCGG 9 GAATTCCGG 9 GAATTCCGG 9 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 CCCGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGG 150 gi I 6449471IgblAF068627.21AF068 gi|644 94 69lgb|AF068 62 6.2|AF068 gil6753661IrefINM_010068.11 g i l 6 4 4 9473|gblAF068628.2IAF0 68 g i l 8347119|gb|AF151970.1IAF151 gi|8347122|gb|AF151971.1|AF151 gil8347130|gbJAFl51974.1 IAF151 gil8347127|gb|AF151973.1|AF151 gil8347136lgblAF151976.1|AF151 gi I 8347134IgblAF151975.11AF151 gi|8347117|gb|AF151969.1|AF151 —GCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 57 —GCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 57 —GCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 57 —GCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 57 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 200 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 200 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 200 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 2 00 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 200 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 2 00 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 200 132 gi|8347125lgblAF151972.1IAF151 CAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCC 200 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 |gb|AF068627.2 |gb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 |gb|AF151970.1 lgblAF151971.1 |gb|AF151974.1 |gb|AF151973.1 |gblAF151976.1 |gblAF151975.1 |gb|AF151969.1 |gblAF151972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 lgblAF068627. lgblAF068626. IrefINM_0100( lgb|AF068628. lgblAF151970. lgb|AF151971. |gb|AF151974. |gb|AF151973. |gb|AF151976, lgblAF151975. |gblAF151969. lgb|AF151972. 2IAF0 68 2IAF0 68 8.11 2IAF068 1IAF151 1IAF151 1IAF151 1IAF151 1IAF151. 1IAF151 1IAF151 1IAF151 IgblAFO IgblAFO I refINM IgblAFO' IgblAFl IgblAFl IgblAFl I gb IAF1 I gb IAF1 I gbIAF1 IgblAFl I gb IAF1 68627.2 68626.2 010068 68628.2 51970.1 51971.1 51974.1 51973.1 51976.1 51975.1 51969.1 51972.1 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 lgb|AF068627.2 |gb|AF068626.2 Iref|NM_010068 |gb|AF068628.2 |gb|AF151970.1 |gb|AF151971.1 |gb|AF151974.1 lgb|AF151973.1 lgblAF151976.1 |gb|AF151975.1 lgblAF151969.1 lgb|AF151972.1 I gbIAFO I gbIAFO I ref INM I gb | AFO" IgblAFl I gb|AF1 I gb IAF1 I gb IAF1 I gb IAF1 I gb IAF1 I gb IAF1 I gb IAF1 68627.2 68626.2 010068 68628.2 51970.1 51971.1 51974.1 51973.1 51976.1 51975.1 51969.1 51972.1 IAF068 IAF068 • II I AFO 68 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 I AFO68 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IgblAFO68627. |gb|AF068626. IrefINM_0100( lgblAF068628. |gb|AF151970. |gb|AF151971. lgblAF151974. |gb|AF151973. lgblAF151976. lgblAF151975. |gb|AF151969. |gb|AF151972. 2IAF068 2|AFO68 8.1| 2 IAFO68 1IAF151 1IAF151 1 IAF151 1IAF151 1IAF151 1IAF151 1IAF151 1IAF151 64 4 9471IgblAFO68627.21AF068 64 4 94 69IgblAFO68626.2|AF068 67536611refINM_010068.1 I 644 9473|gblAF0 68 628.2IAF068 8347119|gb|AF151970.1|AF151 834 7122|gb|AF151971.1IAF151 8347130lgblAF151974.1IAF151 8347127|gb|AF151973.1IAF151 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 107 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 107 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 107 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 107 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCG 250 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 157 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 157 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 157 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 157 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 300 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 300 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGG 2 91 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGG 2 91 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGG 2 91 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGG 2 91 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 300 GCGCGATCGCGGCGCCGCGCTACAGCCAGCCTCACGACAGGCCCGCTGAG 300 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 207 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 207 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 207 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 207 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 350 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 350 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 350 GCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGG 350 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 257 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 257 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 257 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 257 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 4 00 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 4 00 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 400 ATCTCCCCTCCCCCATCCATAGTGCCTTGGGACCAAATCCAGGGCCTTCT 400 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 307 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 307 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 307 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 307 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 4 50 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 450 AAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 335 AAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 335 AAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 335 AAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 335 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 4 50 TTCAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGT 4 50 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 357 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 357 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 357 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 357 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 500 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 500 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 385 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 385 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 385 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 385 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 500 GCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCA 500 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 407 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 4 07 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 407 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 407 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 550 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 550 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 435 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 435 133 834713 6lgb|AF15197 6.1IAF151 8347134IgblAF151975.1 IAF151 8347117IgblAF151969.11AF151 8347125 IgbIAF151972.1IAF151 644 9471lgblAF068627.2IAF0 68 644 94 69|gb|AF06862 6.2IAF0 68 6753 661Iref|NM_010068.11 64 4 9473lgblAF068628.2IAF068 8347119 Igbl AF151970.1 IAF151 8347122IgblAF151971.1IAF151 8347130|gb|AF151974.1|AF151 8347127IgblAF151973.1|AF151 8347136|gb|AF151976.1IAF151 8347134|gb|AF151975.1 IAF151 8347117IgblAF151969.11AF151 8347125lgblAF151972.1IAF151 644 9471|gb|AF068627.2IAF068 64 4 94 69lgblAF06862 6.2IAF0 68 6753 661IrefINM_010068.1 I 64 4 9473lgb|AF068628.2|AF0 68 8347119|gb|AF151970.1IAF151 834 7122IgblAF151971.1IAF151 8347130lgblAF151974.1|AF151 8347127IgblAF151973.1 IAF151 8347136 IgbIAF151976.1IAF151 8347134|gb|AF151975.1IAF151 8347117IgblAF151969.1|AF151 8347125IgblAF151972.1|AF151 644 9471lgblAF0 68 627.2IAF068 6449469 Igb|AFO68626.2IAF068 6753661Iref INM_010068.1| 644 9473lgb|AF068628.2IAF068 8347119lgb|AF151970.1IAF151 8347122lgblAF151971.1|AF151 8347130 I gb IAF151974.11AF151 8347127|gbIAF151973.1IAF151 834 7136lgb|AF15197 6.1IAF151 8347134|gb|AF151975.1IAF151 8347117IgblAF151969.1IAF151 8347125IgblAF151972.1 IAF151 644 94711gbIAFO68627.2 IAFO68 644 94 69|gb|AF068 62 6.2IAF068 6753661IrefINM_010068.1I 644 9473lgblAF068 628.2IAF068 8347119 IgbIAF151970.1IAF151 83471221gblAF151971.1IAF151 83471301gb|AF151974.1|AF151 8347127IgblAF151973.1 IAF151 8347136lgblAF151976.1IAF151 8347134|gb|AF151975.1IAF151 8347117 IgblAF151969.1 | AF151 8347125IgblAF151972.1 IAF151 64494711gbIAFO68627.2 IAFO68 6449469|gb|AFO68626.2IAF068 67536611refINM_010068.11 6449473IgblAFO68628.2IAF068 8347119 IgbIAF151970.1IAF151 8347122|gb|AF151971.1IAF151 8347130lgblAF151974.1IAF151 8347127IgblAF151973.1|AF151 8347136 IgbIAF151976.1IAF151 8347134lgblAF151975.1IAF151 8347117IgblAF151969.11AF151 8347125|gb|AF151972.1IAF151 6449471lgblAF068627.2IAFO68 64 4 94 69 IgbIAF068626.2 IAFO68 6753661Iref|NM_010068.1I 64 4 9473IgblAF068628.2 IAFO68 8347119|gblAF151970.1IAF151 8347122IgblAF151971.11AF151 8347130IgblAF151974.11AF151 8347127|gb|AF151973.1|AF151 8347136|gb|AF151976.1IAF151 8347134|gb|AF151975.11AF151 8347117IgblAF151969.11AF151 8347125lgblAF151972.1|AF151 64 4 9471|gb|AF068 627.2IAFO68 64 4 94 69 IgbIAF068626.2 IAFO68 6753661IrefINM_010068.11 64 4 9473IgblAF068628.2 IAFO68 8347119|gb|AF151970.1|AF151 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 435 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 435 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 550 GTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCT 550 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 4 57 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 4 57 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 4 57 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 457 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 600 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 600 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 485 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 485 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 485 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 485 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 600 GCACAGAGCCAGTCTGCACACCAGAGACCAGAGGCCGCAGGTCAAGCTCC 600 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 507 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 507 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 507 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 507 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 650 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 650 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 535 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 535 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 535 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 535 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 650 CGGCTGTCTAAGAGGGAGGTCTCCAGCCTTCTGAATTACACGCAGGACAT 650 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 557 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 557 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 557 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 557 GACAGGAGATGGAGACAGAGAIGATGAAGTAGATGATGGGAATGGCTCTG 700 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 700 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 585 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 585 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 585 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 585 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 700 GACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTG 700 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 607 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 607 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 607 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 607 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 750 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 750 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 635 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 635 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 635 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 635 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 750 ATATTCTAATGCCAAAGCTCACCCGTGAGACCAAGGACACCAGGACGCGC 750 ************************************************** TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 657 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 657 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 657 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 657 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 800 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 800 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 685 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 685 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 685 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 685 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 800 TCTGAAAGCCCGGCTGTCCGAACCCGACATAGCAATGGGACCTCCAGCTT 800 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 707 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 707 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 707 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 707 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 850 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 850 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 735 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 735 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 735 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 735 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 850 GGAGAGGCAAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCC 850 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 757 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 757 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 757 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 757 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 900 134 g i 8347122 gb|AF151971 1 AF151 g i 8347130 gb|AF151974 1 AF151 g i 8347127 gblAF151973 1 AF151 g i 8347136 gblAF151976 1 AF151 g i 8347134 gb|AF151975 1 AF151 g i 8347117 gblAF151969 1 AF151 g i 8347125 gblAF151972. 1 AF151 g i 6449471 gb|AF068627 2 AF068 g i 6449469 gb|AF068626 2 AF068 g i 6753661 reflNM 010068 1 1 g i 6449473 gb|AF068628 2 AFO 68 g i 8347119 gblAF151970 1 AF151 g i 8347122 gb|AF151971 1 AF151 g i 8347130 gblAF151974 1 AF151 g i 8347127 gb|AF151973 1 AF151 g i 8347136 gblAF151976 1 AF151 g i 8347134 gblAF151975 1 AF151 g i 8347117 gblAF151969 1 AF151 g i 8347125 gblAF151972 1 AF151 g i 6449471 gblAF068627 2 AF068 g i 6449469 gb|AF068626 2 AFO 6 8 g i 6753661 reflNM 010068 11 g i 6449473 gblAF068628 2 AF068 g i 8347119 gblAF151970 1 AF151 g i 8347122 gblAF151971 1 AF151 g i 8347130 gb|AF151974 1 AF151 g i 8347127 gb|AF151973 1 AF151 g i 8347136 gb|AF151976 1 AF151 g i 8347134 gb|AF151975 1 AF151 g i 8347117 gb|AF151969 1 AF151 g i 8347125 gb|AF151972 1 AF151 g i 6449471 gb|AF068627 2 AFO 68 g i 6449469 gb|AF068626 2 AFO 68 g i 6753661 reflNM 010068 1 1 g i 6449473 gb|AF068628 2 AFO 68 g i 8347119 gblAF151970 1 AF151 g i 8347122 gblAF151971 1 AF151 g i 8347130 gblAF151974 1 AF151 g i 8347127 gblAF151973 1 AF151 g i 8347136 gblAF151976 1 AF151 g i 8347134 gb|AF151975 1 AF151 g i 8347117 gblAF151969 1 AF151 g i 8347125 gb|AF151972 1 AF151 g i 6449471 gb|AF068627 2 AF068 g i 6449469 gb|AF068626 2 AFO 6 8 g i 6753661 reflNM 010068 11 g i 6449473 gblAF068628 2 AF068 g i 8347119 gb|AF151970 1 AF151 g i 8347122 gblAF151971 1 AF151 g i 8347130 gblAF151974 1 AF151 g i 8347127 gb|AF151973 1 AF151 g i 8347136 gb|AF151976 1 AF151 g i 8347134 gb|AF151975 1 AF151 g i 8347117 gb|AF151969 1 AF151 g i 8347125 gblAF151972 1 AF151 g i 6449471 gblAF0 68 627 2 AFO 68 g i 6449469 gblAF068626 2 AFO 68 g i 6753661 reflNM 010068 1 1 g i 6449473 gblAF068628 2 AF068 g i 8347119 gblAF151970 1 AF151 g i 8347122 gblAF151971 1 AF151 g i 8347130 gblAF151974 1 AF151 g i 8347127 gb|AF151973 1 AF151 g i 8347136 gblAF151976 1 AF151 g i 8347134 gb|AF151975 1 AF151 g i 8347117 gb|AF151969 1 AF151 g i 8347125 gblAF151972 1 AF151 g i 6449471 gb|AF068627 2 AFO 6 8 gi . 6449469 gb|AF068626 2 AF068 g i 6753661 reflNM 010068 11 g i 6449473 gb|AF068628 2 AF068 g i 8347119 gb|AF151970 1 AF151 g i 8347122 gb|AF151971 1 AF151 g i 8347130 gb|AF151974 1 AF151 g i 8347127 gb|AF151973 1 AF151 g i 8347136 gb|AF151976 1 AF151 g i 8347134 gb|AF151975 1 AF151 g i 8347117 gblAF151969 1 AF151 g i 8347125 gb|AF151972 1 AF151 g i 6449471 gb|AF068627 2 AFO 68 g i 6449469 gb|AF0 68 62 6 2 AFO 68 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 900 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 7 85 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 7 85 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 7 85 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 785 ACCATGTGCAGGAGTACCCIGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 900 ACCATGTGCAGGAGTACCCTGTGGAGTTTCCGGCTACCAGGTCTCGGAGA 900 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 807 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 807 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 807 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 807 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 950 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 950 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 835 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 835 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 835 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 835 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 950 CGTCGAGCATCGTCTTCAGCAAGCACGCCATGGTCATCCCCTGCCAGCGT 950 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 857 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 857 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 857 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 857 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 1000 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 1000 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 885 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 885 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 885 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 885 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 1000 CGACTTCATGGAAGAAGTGACACCTAAGAGCGTCAGTACCCCATCAGTTG 1000 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 907 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 907 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 907 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 907 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 1050 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 1050 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 935 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 935 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 935 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 935 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 1050 ACTTGAGCCAGGATGGAGATCAGGAGGGTATGGATACCACACAGGTGGAT 1050 GCAGAGAGCAGAGATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 957 GCAGAGAGCAGAGATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 957 GCAGAGAGCAGAGATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 957 GCAGAGAGCAGAGATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 957 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 1100 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 1100 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 985 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 985 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 985 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 985 GCAGAGAGCATATATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 1100 GCAGAGAGCATAT ATGGAGACAGCACAGAGTATCAGGATGATAAAGAGTT 1100 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1007 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1007 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1007 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1007 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1150 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1150 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1035 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1035 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1035 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1035 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1150 TGGAATAGGTGACCTCGTGTGGGGAAAGATCAAGGGCTTCTCCTGGTGGC 1150 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1057 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1057 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1057 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1057 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1200 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1200 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1085 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1085 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1085 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1085 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1200 CTGCCATGGTGGTGTCCTGGAAAGCCACCTCCAAGCGACAGGCCATGCCC 1200 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1107 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1107 135 67536611refINM_010068.1| 6449473IgblAFO68628.2|AFO68 8347119 1gblAF151970.11AF151 834 7122IgblAFl51971.1|AF151 834 7130IgblAFl51974.1IAF151 834 7127IgblAFl51973.1 IAF151 8347136lgblAF15197 6.1IAF151 8347134 lgblAF151975.1IAF151 8347117|gb|AF151969.1|AF151 8347125|gblAF151972.1|AF151 6449471|gb|AF068627.2IAFO68 64 494 69lgblAF068626.2IAFO68 6753 6611refINM_010068.II 64 4 9473lgb|AF068628.2|AF068 8347119lgblAF151970.1IAF151 834 7122IgblAFl51971.1IAF151 8347130IgblAFl51974.1IAF151 8347127IgblAFl51973.1 IAF151 834 7136lgblAF15197 6.1|AF151 8347134 IgblAF151975.1IAF151 8347117|gblAF151969.11AF151 8347125IgbIAF151972.11AF151 644 9471lgblAF068 627.2IAF0 68 64494691gbIAFO68626.2 IAFO68 6753 6611refINM_010068.1 I 64494731gbIAFO68628.2 IAFO68 8347119Igb|AF151970.1IAF151 8347122IgblAFl51971.1IAF151 8347130IgbIAF151974.1IAF151 834 7127IgblAFl51973.11AF151 8347136IgblAFl51976.1IAF151 8347134IgbIAF151975.1|AF151 8347117|gb|AF151969.1IAF151 8347125IgbIAF151972.1|AF151 644 9471|gb|AF068 627.2IAF068 644 94 69 IgblAFO68626.2 IAF068 6753661IrefINM_010068.1I 644 9473lgblAF068 628.2IAF068 8347119lgblAF151970.1IAF151 8347122IgbIAF151971.1|AF151 8347130IgbIAF151974.1|AF151 8347127IgbIAF151973.1 IAF151 8347136IgblAFl51976.1IAF151 8347134IgblAFl51975.1|AF151 8347117 IgblAFl51969.1 IAF151 8347125lgblAF151972.1IAF151 644 9471|gblAFO68627.2IAF068 644 94 69 IgbIAF068626.2IAF068 6753661IrefINM_010068.11 644 9473|gblAFO68628.2|AF068 8347119Igb|AF151970.1IAF151 8347122IgbIAF151971.11AF151 8347130IgbIAF151974.1|AF151 8347127IgbIAF151973.11AF151 8347136IgbIAF151976.1|AF151 8347134IgbIAF151975.11AF151 8347117 IgblAFl51969.11AF151 8347125 IgblAFl 51972.1 IAF151 64 4 9471|gb|AF068627.2IAFO68 64 4 94 69lgb|AF068626.2IAF068 67536611refINM_010068.II 644 9473lgb|AF068628.2IAFO68 8347119Igb IAF151970.1IAF151 8347122Igb|AF151971.1IAF151 8347130Igb IAF151974.1IAF151 8347127|gb|AF151973.1IAF151 8347136lgblAF15197 6.1IAF151 8347134lgblAF151975.1IAF151 8347117IgbIAF151969.1|AF151 8347125Igb|AF151972.11AF151 64 4 9471lgblAF068627.2IAFO68 64 4 94 69lgb|AF068626.2IAFO68 6753661IrefINM_010068.1I 64 4 9473lgb|AF068628.2IAFO68 8347119|gb|AF151970.1|AF151 8347122|gb|AF151971.1IAF151 8347130Igb IAF151974.11AF151 8347127IgbIAF151973.11AF151 8347136lgblAF15197 6.1IAF151 8347134|gb|AF151975.1IAF151 8347117IgbIAF151969.1|AF151 8347125IgbIAF151972.1|AF151 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1107 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1107 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1250 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1250 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1135 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1135 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1135 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1135 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1250 GGAATGCGCTGGGTACAGTGGTTTGGTGATGGCAAGTTTTCTGAGATCTC 1250 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1157 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1157 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1157 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1157 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1300 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1300 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1185 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1185 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1185 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1185 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1300 TGCTGACAAACTGGTGGCTCTGGGGCTGTTCAGCCAGCACTTTAATCTGG 1300 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1207 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1207 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1207 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1207 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1350 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1350 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1235 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1235 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1235 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1235 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1350 CTACCTTCAATAAGCTGGTTTCTTATAGGAAGGCCATGTACCACACTCTG 1350 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1257 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1257 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1257 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1257 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1400 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1400 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1285 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1285 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1285 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1285 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 14 00 GAGAAAGCCAGGGTTCGAGCTGGCAAGACCTTCTCCAGCAGTCCTGGAGA 1400 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1307 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1307 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1307 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1307 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1450 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1450 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1335 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1335 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1335 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1335 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 1450 GTCACTGGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCT 14 50 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAG— 1355 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAGTG 1357 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAG— 1355 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAG— 1355 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAG— 1498 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAG— 14 98 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACC 1381 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAGTG 1385 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACC 1381 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAGTG 1385 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAGTG 1500 TCAAGCCTACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAGTG 1500 GTTAATAAGTCGAAGGTGCGTCGTTCAGACAGTAGGAACTTAGAACCCAG 14 07 GTTAATAAGTCGAAGGTGCGTCGTTCAGACAGTAGGAACTTAGAACCCAG 1435 GTTAATAAGTCGAAGGTGCGTCGTTCAGACAGTAGGAACTTAGAACCCAG 1435 GTTAATAAGTCGAAGGTGCGTCGTTCAGACAGTAGGAACTTAGAACCCAG 1550 GTTAATAAGTCGAAGGTGCGTCGTTCAGACAGTAGGAACTTAGAACCCAG 1550 136 I 6449471IgblAFO68627.2|AFO68 AGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1397 I 644 94 691gbIAFO6862 6.2 IAFO68 GAGACGCGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 14 57 I 6753661IrefINMO10068.1 I AGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1397 I 644 9473|gb|AFO68628.2|AFO68 AGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1397 I 8347119|gb|AF151970.1|AF151 AGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 154 0 8347122lgblAF151971 .1 IAF151 AGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 154 0 8347130lgb|AF151974.1|AF151 CGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1425 8347127 Igbl AF151973.1 | AF151 GAGACGCGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 14 85 8347136 IgbIAF151976.1IAF151 CGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1425 I 8347134 |gb|AF151975.1 IAF151 GAGACGCGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 14 85 18347117 1 gb I AF151969.1 | AF151 GAGACGCGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1600 8347125 IgbIAF151972.1 IAF151 GAGACGCGAGAACAAAAGTCGAAGACGCACAACCAATGACTCTGCTGCTT 1600 I 6449471 I 6449469 I 6753661 I 6449473 I 8347119 I 8347122 I 8347130 I 8347127 8347136 8347134 8347117 8347125 Igbl AFO IgblAFO68 IrefINMO lgb|AF068 |gb|AF151 |gb|AF151 |gb|AF151 !gblAF151 lgblAF151 |gblAF151 |gb|AF151 lgb|AF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 IAF068 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1447 IAF068 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1507 .11 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1447 IAF068 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1447 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1590 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1590 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1475 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1535 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1475 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1535 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1650 IAF151 CTGAGTCCCCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAG 1650 I 6449471 I 6449469 I 6753661 I 6449473 I 8347119 I 8347122 I 8347130 I 8347127 I 8347136 8347134 8347117 I 8347125 |gb|AF068627.2 |gb|AF068626.2 Iref|NM_010068 lgblAF068628.2 lgb|AF151970.1 |gb|AF151971.1 |gb|AF151974.1 lgblAF151973.1 lgblAF151976.1 |gb|AF151975.1 |gb|AF151969.1 lgb|AF151972.1 I AFO 68 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 14 97 IAF068 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1557 .11 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1497 I AFO 68 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 14 97 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1640 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1640 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1525 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1585 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1525 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1585 IAF151 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1700 IAF1S1 GACCGAGGGGAGGATGAGGAGAGCCGAGAACGGATGGCTTCTGAAGTCAC 1700 I 644 9471IgblAF068627.2 IAFO68 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1547 I 644 94 69 IgbIAF068626.2 IAFO68 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1607 I 6753661 IrefINM_010068.1| CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1547 I 6449473 IgbIAF068628.2IAF068 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1547 I 8347119IgblAF151970.1 IAF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1690 I 8347122 Igbl AF151971 .1 | AF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1690 I 8347130 Igb | AF151974 .1 IAF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1575 I 8347127IgbIAF151973.1IAF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1635 183471361gbIAF1519 7 6.1 IAF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1575 I 834 7134 IgblAF151975. 1 IAF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1635 I 834 7117 |gb| AF151969.1 | AF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1750 I 8347125 IgblAF151972.1IAF151 CAACAACAAGGGCAATCTGGAAGACCGCTGTTTGTCCTGTGGAAAGAAGA 1750 I 6449471 I 6449469 I 6753661 I 6449473 I 8347119 I 8347122 I 8347130 18347127 I 8347136 I 8347134 8347117 8347125 I gblAFO I gblAFO I r e fINM IgblAFO" IgblAFl IgblAFl IgblAFl I gbIAF1 I gb|AF1 IgblAFl I gb IAF1 I gbIAF1 68627.2 68626.2 010068 68 628.2 51970.1 51971.1 51974.1 51973.1 51976.1 51975.1 51969.1 51972.1 IAF068 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1597 IAF068 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1657 .11 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1597 IAF068 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1597 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1740 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1740 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1625 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1685 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1625 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1685 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1800 IAF151 ACCCTGTGTCCTTCCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGC 1800 I 644 9471 Igb I AF068627 .2 I AFO 68 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1647 I 644 94 69lgb|AF06862 6.2IAFO68 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1707 I 6753 661 IrefINM010068.1 I CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1647 I 6449473 IgblAFO68628.2|AF068 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1647 |8347119lgb|AF151970.1IAF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1790 I 8347122 Igbl AF151971.11 AF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 17 90 I 834 7130IgblAF151974.1|AF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1675 I 834 7127 |gb| AF151973.1 I AF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1735 I 8347136Igb|AF151976.1IAF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1675 I 8347134 IgblAF151975.1 IAF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1735 I 8347117 IgblAF151969.1|AF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1850 I 8347125 IgblAF151972.1 |AF151 CGGGATCGCTTCCTAGAGCTCTTCTACATGTATGATGAGGACGGCTATCA 1850 I 644 9471|gb|AF068627.2IAFO68 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1697 I 644 94 69lgblAF06862 6.2IAFO68 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 17 57 I 6753661 I r e f | NM_0100 68.11 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1697 I 64494731gb|AFO68628.2 IAFO68 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1697 83471191gb IAF15197 0.1 IAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1840 I 8347122 Igb I AF151971.1 IAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 184 0 8347130 Igb | AF151974 .1 IAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1725 83471271 gb I AF151973.IIAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1785 I 8347136 lgb|AF15197 6.1 IAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1725 18347134|gb|AF151975.1IAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1785 137 1347117IgblAF151969.11AF151 l347125igblAF151972.1|AF151 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 lgblAF068 lgb|AF06 IrefINM_0 I gb| AFO 68 |gb|AF151 |gb|AF151 |gblAF151 lgb|AF151 |gb|AF151 lgblAF151 |gblAF151 lgblAF151 627.2 626.2 10068 628 .2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 lgblAF06 lgb|AF068 IrefINM_0 I gbl AFO 68 IgblAFl 51 |gb|AF151 |gblAF151 IgblAFl51 |gblAF151 |gblAF151 lgblAF151 lgb|AF151 627.2 62 6.2 10068 628.2 970.1 971 974 973 .1 .1 .1 976.1 975.1 969.1 972.1 |gblAF06 |gb|AF06 IrefINM_0 |gb|AF068 |gb|AF151 lgb|AF151 |gb|AF151 I g b l A F l S l |gb|AF151 lgblAF151 |gb|AF151 lgblAF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 I AFO68 I AFO68 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 |gb|AF06 lgb|AF068 Iref|NM_0 |gb|AF068 |gb|AF151 |gb|AF151 IgblAFl51 lgb|AF151 |gb|AF151 lgblAF151 |gb|AF151 |gb|AF151 627.2 62 6.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 lgblAF06 |gb|AF068 IrefINM_0 lgb|AF068 lgb|AF151 IgblAFl 51 |gb|AF151 |gb|AF151 |gblAF151 |gb|AF151 lgblAF151 lgblAF151 627.2 62 6.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 I AFO68 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 lgb|AF068 |gb|AF068 Iref|NM_0 I gbIAFO |gb|AF151 |gb|AF151 lgblAF151 |gb|AF151 |gblAF151 |gb|AF151 lgblAF151 lgb|AF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 64 4 9471|gb|AF068627.2 IAFO68 64 4 94 69 IgbIAF068626.2 IAF068 6753 6611refINM_010068.11 64 49473IgblAF068628.2|AF068 8347119lgblAF151970.1|AF151 8347122|gb|AF151971.1|AF151 8347130IgblAF151974.1 IAF151 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1900 GTCCTACTGCACCGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTA 1900 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1747 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1807 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1747 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1747 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 18 90 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 18 90 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1775 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1835 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1775 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1835 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1950 ACACAAGCTGCTGCAGATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTG 1950 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1797 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1857 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1797 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 17 97 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 194 0 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1940 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1825 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1885 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1825 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 1885 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 2000 GGCGCAGGCACAGCTGAGGATGCCAAGCTGCAGGAACCCTGGAGCTGCTA 2000 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1847 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1907 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1847 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1847 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1990 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1990 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1875 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1935 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 1875 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGArT 1935 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 2050 TATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATT 2050 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 18 97 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1957 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1897 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1897 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 204 0 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 204 0 GGAACATGCGCCIGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1925 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1985 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1925 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 1985 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 2100 GGAACATGCGCCTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAA 2100 ************************************************** TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 1947 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2007 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 1947 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 1947 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2090 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2090 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 1975 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2035 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 1975 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2035 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2150 TTTGAGCCACCCAAGTTGTACCCAGCAATTCCTGCAGCCAAAAGGAGGCC 2150 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 1997 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2057 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 1997 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 1997 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2140 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 214 0 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2025 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2085 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2025 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2085 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2200 CATTAGAGTCCTGTCTCTGTTTGATGGAATTGCAACGGGGTACTTGGTGC 2200 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2047 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2107 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2047 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2047 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2190 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2190 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2075 138 8347127IgbIAF151973.11AF151 8347136|gb|AF15197 6.1IAF151 8347134IgbIAF151975.11AF151 8347117lgblAF151969.1IAF151 8347125IgbIAF151972.1|AF151 64 4 9471|gb|AF068 627.2IAF068 64 4 94 69 1gbIAFO6862 6.2 IAFO68 6753661IrefINM_010068.1| 644 94 73 IgbIAF068628.2IAF068 8347119lgblAF151970.1|AF151 8347122IgbIAF151971.1IAF151 8347130 IgblAFl51974 .1IAF151 8347127IgbIAF151973.1|AF151 8347136IgbIAF151976.1IAF151 8347134|gb|AF151975.1|AF151 8347117|gb|AF151969.1IAF151 8347125IgbIAF151972.1IAF151 644 9471lgb|AF068627.2IAF068 64494691gbIAFO6862 6.2 IAFO68 6753661IrefINM_010068.1I 64 4 9473lgblAF068 628.2|AF068 8347119lgblAF151970.1IAF151 834 7122IgbIAF151971.1IAF151 834 7130IgblAFl51974.1IAF151 8347127IgbIAF151973.1 IAF151 8347136IgbIAF151976.1IAF151 834 7134IgblAFl51975.1IAF151 8347117 Igb I AF151969.1 IAF151 8347125IgbIAF151972.1IAF151 644 9471|gb|AF068627.2IAFO68 64 4 94 69lgb|AF06862 6.2IAF068 6753661IrefINM_010068.11 64 4 9473lgblAF068628.2IAFO68 8347119IgbIAF151970.1|AF151 8347122IgbIAF151971.1|AF151 834 7130|gblAF151974.1|AF151 834 7127|gb|AF151973.1IAF151 834 7136lgb|AF15197 6.1|AF151 8347134|gb|AF151975.1IAF151 834 7117|gblAF151969.1IAF151 8347125IgblAFl51972.11AF151 644 9471|gb|AFO68627.21AF068 6449469 IgblAFO68626.2|AFO68 67536611refINM_010068.II 6449473 IgblAFO68628.2|AFO68 8347119|gblAF151970.1|AF151 8347122 Igb IAF151971.11AF151 8347130lgblAF151974.1IAF151 8347127lgb|AF151973.1IAF151 8347136IgbIAF151976.11AF151 8347134Igb|AF151975.11AF151 8347117IgbIAF151969.1IAF151 8347125IgbIAF151972.11AF151 644 9471IgbIAF068627.21AF068 644 94 69lgb|AF068 62 6.2|AF068 67536611refINM_010068.11 6449473IgbIAF068628.2IAF068 8347119IgbIAF151970.1IAF151 8347122IgbIAF151971.1IAF151 8347130IgblAFl51974.1IAF151 8347127 Igb I AF151973.1 I AF151 8347136 Igb IAF15197 6.1 IAF151 8347134 Igb lAFl51975.1 IAF151 8347117IgbIAF151969.1IAF151 8347125IgbIAF151972.1IAF151 64 4 9471lgblAF068627.2IAF068 64 494 69lgb|AF06862 6.2IAF068 6753 6611ref|NM_010068.11 6449473 IgbIAF068628.2IAF068 8347119lgb|AF151970.1|AF151 8347122IgbIAF151971.1|AF151 8347130Igb|AF151974.1|AF151 8347127IgbIAF151973.11AF151 834713 6lgb|AF15197 6.1|AF151 8347134IgblAFl51975.11AF151 8347117Igb|AF151969.1|AF151 8347125IgbIAF151972.1IAF151 6449471|gblAFO68627.2|AFO68 644 94 69lgb|AF068626.2IAFO68 67536611refINM_010068.II 6449473 IgblAFO68628.2 IAFO68 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2135 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2 075 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2135 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2250 TCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGT 2250 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2097 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2157 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2097 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 20 97 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 224 0 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 224 0 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2125 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2185 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2125 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2185 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2300 GCAGAGTCCATCGCTGTGGGAACTGTTAAGCATGAAGGCCAGATCAAATA 2300 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2147 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2207 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2147 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2147 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 22 90 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2290 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2175 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2235 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2175 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2235 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2350 TGTCAATGACGTCCGGAAAATCACCAAGAAAAATATTGAAGAGTGGGGCC 2350 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2197 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2257 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2197 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2197 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2340 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2340 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2225 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2285 CGTrCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2225 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2285 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2400 CGTTCGACTTGGTGATTGGTGGAAGCCCATGCAATGATCTCTCTAACGTC 2400 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2247 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2307 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2247 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2247 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2390 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2390 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2275 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2335 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2275 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 2335 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCITCGA 24 50 AATCCTGCCCGCAAAGGTTTATATGAGGGCACAGGAAGGCTCTTCTTCGA 24 50 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 22 97 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2357 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 22 97 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 22 97 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 24 40 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 24 40 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2325 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2385 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2325 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2385 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2500 GTTTTACCACTTGCTGAATTATACCCGCCCCAAGGAGGGCGACAACCGTC 2500 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 234 7 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 24 07 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 2347 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 234 7 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 24 90 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 24 90 CATTCTTCTGGATGTTCGAGAATGT1GTGGCCATGAAAGTGAATGACAAG 2375 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 24 35 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 2375 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 24 35 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 2550 CATTCTTCTGGATGTTCGAGAATGTTGTGGCCATGAAAGTGAATGACAAG 2550 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2397 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2457 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2397 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2397 139 8347119lgblAF151970.1IAF151 8347122|gb|AF151971.1|AF151 8347130lgblAF151974.1IAF151 8347127IgbIAF151973.1 IAF151 834713 6lgb|AF15197 6.1|AF151 8347134IgblAF151975.1|AF151 8347117|gblAF151969.1IAF151 834 7125lgb|AF151972.1IAF151 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 lgblAF068 |gb|AF068 IrefINMO I gblAFO IgblAFl51 lgb|AF151 IgblAFl51 |gb|AF151 IgblAFl51 lgblAF151 |gb|AF151 lgb|AF151 627.2 626.2 10068 628. 970. 971. 974. 973. 976. 975. 969. 972. 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 |gb|AF068627.2 lgblAF068626.2 IrefINM_010068 lgblAF068628.2 lgb|AF151970.1 lgblAF151971.1 lgblAF151974.1 lgblAF151973.1 lgblAF151976.1 lgb|AF151975.1 |gb|AF151969.1 lgb|AF151972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 I gb|AFO68 I gblAFO68 Iref|NM_0 I gbl AFO 68 lgblAF151 lgblAF151 lgblAF151 lgb|AF151 lgblAF151 lgblAF151 |gb|AF151 lgb|AF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975. 1 969.1 972.1 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 I gb|AFO I gblAFO I ref INM IgblAFO" Ig b l A F l I g b l A F l I g b l A F l I gb IAF1 I gb IAF1 I gb IAF1 I gb|AF1 Igb l A F l 68627.2 8626.2 010068 68628.2 51970.1 51971.1 51974 .1 51973.1 51976.1 51975.1 51969.1 51972.1 IAF068 I AFO 68 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF068 I AFO68 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 lgblAF068 |gb|AF068 Iref|NM_0 lgblAF068 |gb|AF151 lgblAF151 lgblAF151 |gb|AF151 IgblAF151 lgblAF151 |gb|AF151 lgblAF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 I gbl AFO 68 lgb|AF068 Iref|NM_0 I gblAFO68 |gb|AF151 |gb|AF151 |gb|AF151 lgb|AF151 |gb|AF151 |gb|AF151 lgblAF151 |gb|AF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 IAF068 IAF068 .11 IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF068 IAF068 • II IAF068 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 IAF151 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 254 0 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 254 0 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2425 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 24 85 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2425 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 24 85 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2600 AAAGACATCTCAAGATTCCTGGCATGTAACCCAGTGATGATCGATGCCAT 2600 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2447 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2507 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 24 4 7 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 24 47 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2590 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2590 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2475 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2535 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2475 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2535 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2 650 CAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACCTACCCG 2 650 GAATGAACAGGCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAG 24 97 GAATGAACAGGCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAG 2557 GAATGAACAGG 2458 GAATGAACAGG 2458 GAATGAACAGGCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAG 2 640 GAATGAACAGG 2601 GAATGAACAGGCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAG 2525 GAATGAACAGGCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAG 2585 GAATGAACAGG 2486 GAATGAACAGG 2546 GAATGAACAGGCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAG 2700 GAATGAACAGG 2 661 GACTGCCTGGAGTTCAGTAGGACAGCAAAGTTAAAGAAAGTGCAGACAAT 2547 GACTGCCTGGAGTTCAGTAGGACAGCAAAGTTAAAGAAAGTGCAGACAAT 2 607 GACTGCCTGGAGTTCAGTAGGACAGCAAAGTTAAAGAAAGTGCAGACAAT 2690 GACTGCCTGGAGTTCAGTAGGACAGCAAAGTTAAAGAAAGTGCAGACAAT 2575 GACTGCCTGGAGTTCAGTAGGACAGCAAAGTTAAAGAAAGTGCAGACAAT 2635 GACTGCCTGGAGTTCAGTAGGACAGCAAAGTTAAAGAAAGTGCAGACAAT 2750 AACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTG 2597 AACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTG 2 657 AACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTG 2740 AACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTG 2 625 AACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTG 2 685 AACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTG 2 800 TAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGCTCGAAAGG 2647 TAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGCTCGAAAGG 2707 TAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGCTCGAAAGG 27 90 TAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGCTCGAAAGG 2 675 TAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGCTCGAAAGG 2735 TAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGCTCGAAAGG 2850 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2 697 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2757 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2508 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2508 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 284 0 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2651 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2725 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2785 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2536 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2596 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2900 ATCTTCGGCTTCCCTGCTCACTACACGGACGTGTCCAACATGGGCCGCGG 2711 g i l 6 4 4 9471IgblAF068627.2|AF06 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2747 140 6449469 IgblAFO68626.2 IAFO68 67536611ref|NM_0100 68.II 6449473IgbIAF068628.2 IAFO68 8347119lgb|AF151970.1|AF151 834 7122IgblAFl51971.1IAF151 8347130lgb|AF151974.1IAF151 834 7127 1gbIAF151973.1IAF151 8347136IgblAFl51976.1IAF151 8347134IgblAFl51975.1IAF151 8347117|gb|AF151969.ilAF151 8347125IgbIAF151972.11AF151 644 94711gblAFO68627.2 IAF068 6449469 IgblAFO68626.2|AF068 67536611refINM_010068.II 644 9473lgb|AF068628.2IAF068 8347119IgbIAF151970.1IAF151 8347122Igb|AF151971.1 IAF151 8347130IgbIAF151974.1IAF151 834 7127IgblAFl51973.11AF151 8347136IgblAFl51976.1IAF151 834 7134IgblAFl51975.1IAF151 8347117IgblAFl51969.1IAF151 8347125Igb|AF151972.1|AF151 644 9471|gblAFO68627.2IAF068 644 94 69|gb|AFO68626.21AF068 6753661IrefINM_010068.11 644 9473 IgblAFO68628.2|AF068 8347119 Igb I AF151970.1 IAF1S1 8347122 Igb IAF151971.1 IAF151 8347130IgbIAF151974.1IAF151 834 7127Igb|AF151973.1|AF151 8347136IgbIAF151976.1IAF151 834 7134Igb|AF151975.11AF151 834 7117lgblAF151969.1IAF151 8347125Igb|AF151972.1|AF151 6449471IgbIAF068627.2|AFO68 6449469 IgblAFO68626.2|AFO68 6753661IrefINM_010068.1I 644 9473 IgblAFO68628.2|AF068 8347119IgblAFl51970.1IAF151 8347122 IgblAF151971.1IAF151 8347130Igb|AF151974.1IAF151 8347127IgbIAF151973.1 IAF151 8347136IgbIAF151976.1IAF151 8347134IgbIAF151975.1 IAF151 8347117IgbIAF151969.1IAF151 8347125|gb|AF151972.1IAF151 64 4 9471|gblAF068627.2IAFO68 6449469IgbIAF068626.2 IAFO68 67536611 ref I NM_010068 .11 644 9473 IgblAFO68628.2 IAF068 8347119IgblAFl51970.1IAF151 8347122IgblAFl51971.1|AF151 8347130lgblAF151974.1IAF151 8347127IgbIAF151973.1|AF151 8347136lgblAF151976.1IAF151 8347134|gb|AF151975.1IAF151 8347117|gblAF151969.1IAF151 8347125IgbIAF151972.1|AF151 64 4 94 71|gb|AF068627.2IAFO68 64 4 94 69lgb|AF06862 6.2IAFO68 6753 6611refINM_0100 68.11 6449473IgbIAF068628.2 IAFO68 8347119lgb|AF151970.1|AF151 8347122IgblAFl51971.1|AF151 8347130lgblAF151974.1IAF151 8347127Igb|AF151973.1|AF151 8347136Igb|AF151976.1IAF151 8347134IgblAFl51975.11AF151 8347117Igb|AF151969.11AF151 8347125IgbIAF151972.1 IAF151 6449471|gblAFO68627.2|AF068 6449469 IgblAFO68626.2 IAF068 67536611refINM_010068.11 6449473 IgblAFO68628.2 IAF068 8347119lgb|AF151970.1|AF151 8347122IgblAF151971.1IAF151 8347130IgbIAF151974.1|AF151 8347127IgblAFl51973.11AF151 8347136IgbIAF151976.11AF151 8347134IgblAFl51975.1IAF151 8347117IgblAFl51969.11AF151 8347125IgblAF151972.1|AF151 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2 8 07 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2558 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2558 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2890 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 27 01 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2775 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2835 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 258 6 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2646 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2950 CGCCCGTCAGAAGCTGCTGGGCAGGTCCTGGAGTGTACCGGTCATCAGAC 2761 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2797 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2857 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2608 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2608 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2940 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2751 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2825 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2885 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2 636 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2 696 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 3000 ACCTGTTTGCCCCCTTGAAGGACTACTTTGCCTGTGAATAGTTCTACCCA 2811 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2847 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2907 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2 658 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2 658 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2 990 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2801 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2 875 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2935 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 2686 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 274 6 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 3050 GGACTGGGGAGCTCTCGGTCAGAGCCAGTGCCCAGAGTCACCCCTCCCTG 28 61 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2897 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2 957 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2708 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2708 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 3040 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2851 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2 925 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCICACAT 2 985 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2736 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2796 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 3100 AAGGCACCTCACCTGTCCCCTTTTTAGCTCACCTGTGTGGGGCCTCACAT 2911 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 2947 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 3007 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 2758 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 2758 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 3090 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 2901 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 2975 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 3035 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 278 6 CACTGTACCICAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 284 6 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 3150 CACTGTACCTCAGCTTTCTCCTGCTCAGTGGGAGCAGAGCCTCCTGGCCC 2 961 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 2997 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 3057 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 2 808 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 2 808 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 314 0 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 2951 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 3025 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 3085 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 2836 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCIGGCT 2896 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 3200 TTGCAGGGGAGCCCCGGTGCTCCCTCCGTGTGCACAGCTCAGACCTGGCT 3011 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3047 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3107 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 2858 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 2858 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3190 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3001 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3075 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3135 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 2886 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 294 6 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3250 GCTTAGAGTAGCCCGGCATGGTGCTCATGTTCTCTTACCCTGAAACTTTA 3061 141 I 6449471 I 6449469 I 6753661 I 6449473 I 8347119 I 8347122 8347130 I 8347127 I 8347136 I 8347134 8347117 8347125 |gblAF068627.2 lgb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 |gb|AF151970.1 |gblAF151971.1 |gb|AF151974.1 |gb|AF151973.1 |gb|AF151976.1 |gb|AF151975.1 |gb|AF151969.1 |gb|AF151972.1 IAF068 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3097 IAF068 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3157 .11 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 2908 IAF068 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 2908 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3240 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCT1TCTTTTACCCTCCTGAGTTTAT 3051 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3125 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3185 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 2936 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 2996 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3300 IAF151 AAACTTGAAGTAGGTAGTAAGATGGCTTTCTTTTACCCTCCTGAGTTTAT 3111 I 6449471 I 6449469 I 6753661 I 6449473 8347119 18347122 18347130 18347127 I 8347136 I 8347134 18347117 I 8347125 |gb|AF068627.2 I gblAFO68626.2 Iref|NM_010068 |gb|AF068628.2 lgblAF151970.1 lgblAF151971.1 lgb|AF151974.1 |gb|AF151973.1 |gb|AF151976.1 lgblAF151975.1 |gb|AF151969.1 |gblAF151972.1 IAF068 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3147 IAF068 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3207 .11 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 2958 IAF068 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 2958 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3290 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3101 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3175 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3235 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 2 986 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3046 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3350 IAF151 CACTCAGAAGTGATGGCTAAGATACCAAAAAAACAAACAAAAACAGAAAC 3161 I 6449471 I 6449469 I 6753661 I 6449473 8347119 8347122 8347130 I 8347127 18347136 18347134 18347117 18347125 |gb|AF068 lgb|AF068 Iref|NM_0 I gb|AFO68 |gb|AF151 lgblAF151 |gb|AF151 |gb|AF151 |gb|AF151 |gblAF151 |gb|AF151 |gb|AF151 627.2 626.2 10068 628.2 970.1 971.1 974.1 973.1 976.1 975.1 969.1 972.1 IAF068 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3197 IAF068 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3257 .11 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3008 IAF068 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3008 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3340 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3151 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3225 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3285 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3036 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 30 96 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3400 IAF151 AAAAAACAAAAAAAAACCTCAACAGCTCTCTTAGTACTCAGGTTCATGCT 3211 I 644 9471 Igbl AF068627. 2 I AF068 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3247 I 644 94 69lgb|AF068626.2IAFO68 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3307 I 6753661 | r e f |NM_010068 .1 I GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3058 I 644 9473lgblAF068628.2IAF068 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3058 183471191 gb | AF151970 .1 | AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3390 183471221gbIAF151971.1 IAF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3201 18347130 1gblAF151974.1|AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3275 I 8347127 |gb| AF151973.1 | AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 3335 I 8347136 |gb| AF15197 6.1 | AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 308 6 I 8347134 Igbl AF151975.1 I AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 314 6 8347117IgbIAF151969.1|AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 34 50 I 8347125 I gb I AF151972 .1 I AF151 GCAAAATCACTTGAGATTTTGTTTTTAAGTAACCCGTGCTCCACATTTGC 32 61 A************************************************* I 6449471|gb|AF068627.2IAF068 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3297 I 6449469 IgbIAF068626.2 IAFO68 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3357 I 6753661 Iref | NM_010068.1 I TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3108 I 6449473 IgbIAF068628.2IAF068 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3108 183471191 gb IAF151970.II AF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 344 0 183471221 gb IAF151971.II AF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3251 I 8347130 Igbl AF151974.1 I AF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3325 183471271 gb IAF151973.il AF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3385 I 8347136IgblAF151976.1|AF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3136 I 8347134lgblAF151975.1IAF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3196 8347117 1 gb IAF151969 .1 IAF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3500 183471251gbIAF151972.1 IAF151 TGGAGGATGCTATTGTGAATGTGGGCTCAGATGAGCAAGGTCAAGGGGCC 3311 I 6449471 I 6449469 I 6753661 I 6449473 I 8347119 I 8347122 I 8347130 I 8347127 I 8347136 I 8347134 I 8347117 8347125 lgb|AF068627.2 I gb| AFO 68 62 6.2 Iref|NM_010068 lgb|AF068628.2 lgblAF151970.1 lgblAF151971.1 lgblAF151974.1 lgb|AF151973.1 |gb|AF151976.1 |gb|AF151975.1 lgblAF151969.1 lgblAF151972.1 IAF068 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3347 IAF068 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3407 .11 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3158 IAF068 AAAAAAAAxTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3158 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3490 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3301 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3375 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3435 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3186 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3246 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3550 IAF151 AAAAAAAATTCCCCCTCTCCCCCCAGGAGTATTTGAAGATGATGTTTATG 3361 I 6449471 I 6449469 I 6753661 I 6449473 18347119 I 8347122 8347130 18347127 18347136 lgb|AF068627.2 lgb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 |gb|AF151970.1 |gb|AF151971.1 |gb|AF151974.1 |gblAF151973.1 lgb|AF151976.1 IAF068 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3397 IAF068 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3457 .11 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3208 IAF068 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3208 IAF151 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3540 IAF151 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3351 IAF151 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3425 IAF151 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3485 IAF151 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3236 142 834 7134IgblAF151975.1|AF151 8347117IgblAFl51969.1IAF151 8347125Igb|AF151972.1IAF151 64 4 9471|gb|AF068627.2|AF068 64 4 94 69lgb|AF068626.2IAF068 67536611ref|NM_0100 68.11 644 9473 IgblAFO68628.2|AFO68 8347119IgbIAF151970.1IAF151 8347122IgblAF151971.1|AF151 8347130|gblAF151974.1|AF151 8347127IgblAF151973.1|AF151 8347136IgbIAF151976.1IAF151 8347134IgblAF151975.11AF151 8347117IgblAF151969.11AF151 8347125|gb|AF151972.1IAF151 64 4 94 71|gblAF068627.2IAFO68 64 4 94 69lgb|AF068626.2IAFO68 6753 661IrefINM_010068.1I 6449473IgbIAF068628.2|AFO68 8347119IgbIAF151970.1IAF151 8347122|gb|AF151971.1IAF151 8347130IgblAFl51974.1IAF151 8347127IgbIAF151973.1IAF151 8347136|gb|AF151976.1|AF151 8347134IgblAF151975.1IAF151 8347117IgblAF151969.1|AF151 8347125IgblAF151972.1|AF151 644 9471|gblAFO68627.2|AF068 6449469|gb|AFO68626.2|AFO68 6753661Iref|NM_010068.1I 6449473IgbIAF068628.2 IAFO68 8347119lgb|AF151970.1IAF151 8347122IgblAF151971.11AF151 8347130|gb|AF151974.1|AF151 8347127 Igbl AF151973.11AF151 8347136 IgblAFl 51976.1 IAF151 8347134IgblAFl51975.1IAF151 834 7117IgblAFl51969.1IAF151 8347125IgblAFl51972.1IAF151 64 4 9471|gb|AF068627.2IAFO68 6449469 IgblAFO68626.2|AF068 6753661 Iref|NM_010068.II 644 9473|gb|AF068628.2IAF068 8347119lgb|AF151970.1|AF151 8347122IgblAF151971.1|AF151 8347130IgblAF151974.11AF151 8347127|gb|AF151973.1|AF151 8347136lgblAF15197 6.1IAF151 8347134IgblAF151975.11AF151 8347117IgblAF151969.11AF151 8347125lgblAF151972.1IAF151 64 49471|gb|AF068627.2IAFO68 64 494 69lgblAF068626.2IAF068 6753661|refINM_010068.1| 6449473|gblAF068628.2IAFO68 8347119Igb|AF151970.1IAF151 8347122lgb|AF151971.1|AF151 8347130IgbIAF151974.1IAF151 8347127|gb|AF151973.1IAF151 8347136IgbIAF151976.1IAF151 8347134Igb|AF151975.1|AF151 8347117|gb|AF151969.1IAF151 8347125lgb|AF151972.1IAF151 644 9471|gb|AF068627.2|AFO68 6449469IgbIAF068626.2|AFO68 6753661IrefINM_010068.1I 6449473IgbIAF068628.2|AFO68 8347119|gb|AF151970.1IAF151 8347122IgblAF151971.1IAF151 8347130lgb|AF151974.1IAF151 8347127IgblAF151973.11AF151 8347136|gb|AF15197 6.1|AF151 8347134IgblAFl51975.1 IAF151 8347117|gb|AF151969.1IAF151 8347125IgblAF151972.1|AF151 644 9471 IgblAFO68627.2 IAF068 64494691gbIAFO68626.2 IAFO68 6753661Iref|NM_010068.1 I 6449473IgbIAF068628.2|AFO68 8347119|gblAF151970.1IAF151 8347122IgblAF151971.11AF151 GTTIAAGTCTTCCTGGCACCITCCCCTTGCTTTGGTACAAGGGCTGAAGT 32 96 GTTTAAGTCTTCCTGGCACCTTCCCCTTGCTTTGGTACAAGGGCTGAAGT 3600 GTTTAAGTCTTCCTGGCACCITCCCCTTGCTTTGGTACAAGGGCTGAAGT 3411 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3447 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3507 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3258 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3258 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3590 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 34 01 CCTGTTGGICTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 34 75 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3535 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 328 6 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 334 6 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 3650 CCTGTTGGTCTTGTAGCATTTCCCAGGATGATGATGTCAGCAGGGATGAC 34 61 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 34 97 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3557 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3308 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3308 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3 640 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 34 51 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3525 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3585 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3336 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3396 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3700 ATCACCACCTTTAGGGCTTTTCCCTGGCAGGGGCCCATGTGGCTAGTCCT 3511 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 354 7 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3607 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3358 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3358 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3690 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3501 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3575 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3 635 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 338 6 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 34 4 6 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGTGGAGTG 3750 CACGAAGACTGGAGTAGAATGTTTGGAGCTCAGGAAGGGTGGGIGGAGTG 3561 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3597 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3 657 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3408 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3408 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 374 0 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3551 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3625 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3685 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3436 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 34 96 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3800 GCCCTCTTCCAGGTGTGAGGGATACGAAGGAGGAAGCTTAGGGAAATCCA 3611 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3647 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3707 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3458 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3458 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 37 90 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3601 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3 675 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3735 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 348 6 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 354 6 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3850 TTCCCCACTCCCTCTTGCCAAATGAGGGGCCCAGTCCCCAACAGCTCAGG 3661 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3697 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3757 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3508 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3508 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 384 0 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3651 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3725 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3785 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3536 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3596 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3900 TCCCCAGAACCCCCTAGTTCCTCATGAGAAGCTAGGACCAGAAGCACATC 3711 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3747 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3807 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3558 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3558 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3890 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3701 143 8347130lgb|AF151974.1 8347127|gblAF151973.1 8347136lgb|AF151976.1 8347134|gb|AF151975.1 8347117|gb|AF151969.1 8347125|gb|AF151972.1 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 |gblAF068627.2 |gb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 |gb|AF151970.1 lgb|AF151971.1 |gb|AF151974.1 lgb|AF151973.1 |gblAF151976.1 lgblAF151975.1 lgb|AF151969.1 lgb|AF151972.1 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 |gb|AF068627.2 |gb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 lgblAF151970.1 lgb|AF151971.1 |gb|AF151974.1 lgb|AF151973.1 |gb|AF151976.1 |gb|AF151975.1 |gb|AF151969.1 |gb|AF151972.1 I gbIAFO I gb|AFO I refINM I gb | AFO' I gbIAF1 I gbIAF1 Igb l A F l I g b l A F l IgblAFl I gbIAF1 IgblAFl IgblAFl 68627.2 8626.2 010068 68628.2 51970.1 51971.1 51974.1 51973.1 51976.1 51975.1 51969.1 51972.1 lgb|AF068627.2 lgblAF068626.2 Iref|NM_010068 lgblAF068628.2 |gb|AF151970.1 |gb|AF151971.1 lgb|AF151974.1 |gb|AF151973.1 lgb|AF151976.1 lgblAF151975.1 lgb|AF151969.1 |gb|AF151972.1 6449471 6449469 6753661 6449473 8347119 8347122 8347130 8347127 8347136 8347134 8347117 8347125 lgb|AF068627.2 |gb|AF068626.2 Iref|NM_010068 lgb|AF068628.2 lgb|AF151970.1 lgblAF151971.1 |gb|AF151974.1 lgb|AF151973.1 |gb|AF151976.1 lgblAF151975.1 |gb|AF151969.1 |gb|AF151972.1 g i 6449471|gb|AF068627 2 AF068 g i 6449469lgblAF068626 2 AF068 g i 67536611 re f |NM 010068 11 g i 6449473lgblAF068628 2 AF068 g i 8347119lgb|AF151970 1 AF151 g i 8347122lgblAF151971 1 AF151 g i 8347130|gb|AF151974 1 AF151 g i 8347127|gblAF151973 1 AF151 g i 8347136 |gb|AF151976' 1 AF151 g i 8347134lgblAF151975 1 AF151 g i 8347117|gb|AF151969 1 AF151 g i 8347125lgb|AF151972 1 AF151 g i 6449471lgblAF068627 2 AF068 g i 6449469lgblAF068626 2 AFO 6 8 g i 6753661Iref|NM_010068 11 AF151 AF151 AF151 AF151 AF151 AF151 AFO 68 AFO 68 II AF068 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AFO 6 8 AFO 6 8 II AF068 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AFO 68 AF068 II AFO 68 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AF068 AF068 II AF068 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AFO 68 AF068 II AF068 AF151 AF151 AF151 AF151 AF151 AF151 AF151 AF151 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 377 5 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3835 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 358 6 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 364 6 GITCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 3950 GTTCCCCTTATCTGAGCAGTGTTTGGGGAACTACAGTGAAAACCTTCTGG 37 61 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 37 97 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3857 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3608 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3608 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 394 0 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3751 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3825 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3885 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3636 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 369 6 AGATGTTAAAAGCTTTTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 4 000 AGATGTTAAAAGCTTxTTACCCCACGATAGATTGTGTTTTTAAGGGGTGC 3811 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 384 7 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3907 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3658 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3658 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3990 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3801 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3875 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 3935 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 368 6 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 374 6 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 4 050 TTTTTTTAGGGGCATCACTGGAGATAAGAAAGCTGCATTTCAGAAATGCC 38 61 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 38 97 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3 957 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3708 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3708 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 404 0 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3851 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3925 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3985 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3736 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3796 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 4100 ATCGTAATGGTTTTTAAACACCTTTTACCTAATTACAGGTGCTATTTTAT 3911 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 394 7 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 4 007 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 3758 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 3758 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTITCATGT 4 0 90 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 3901 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 3975 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 4 035 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 378 6 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 384 6 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 4150 AGAAGCAGACAACACTTCTTTTTATGACTCTCAGACTTCTATTTTCATGT 3961 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 3997 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 4057 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 3808 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 38 08 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 414 0 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 3951 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 4 025 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 4 085 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 383 6 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 3896 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 4200 TACCATTTTTTTTGTAACTCGCAAGGTGTGGGCTTTTGTAACTTCACAGG 4 011 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4 047 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4107 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 3858 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 3858 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4190 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4001 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4075 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4135 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 38 86 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 394 6 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4250 TGTGGGGAGAGACTGCCTTGTTTCAACAGTTTGTCTCCACTGGTTTCTAA 4 061 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4 097 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4157 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 3908 144 gi164494731gbIAFO68628.2 IAFO68 gi|8347119|gblAF151970.1IAF151 gil8347122lgblAF151971.1IAF151 gil8347130IgbIAF151974.11AF151 gil8347127lgblAF151973.1IAF151 gi|8347136lgblAF15197 6.1IAF151 gil8347134IgblAF151975.1IAF151 g i I 8347117 Igbl AF151969.1 IAF151 gil8347125IgblAF151972.1|AF151 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 3908 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4240 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4 051 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4125 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4185 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 3 936 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGT1IACCTTTCTGGTTGAT 3996 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGITTACCTTTCTGGTTGAT 4300 TTTTTAGGTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGAT 4111 gi l 6 4 4 9471IgblAF068627.2|AF068 g i l 6 4 494 69|gb|AF068626.2IAF068 gil67536611ref|NM_010068.11 gi|6449473|gb|AF068628.2|AF068 g i l 8347119 Igb | AF151970. l . | AF151 gil8347122IgbIAF151971.11AF151 gi|8347130lgblAF151974.1IAF151 gil8347127|gblAF151973.1|AF151 gil8347136lgblAF15197 6.1|AF151 giI 8347134IgblAF151975.11AF151 gil8347117|gblAF151969.1|AF151 gil8347125IgbIAF151972.1|AF151 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4135 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4195 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 3946 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 3946 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4278 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4 08 9 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4163 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4223 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 3974 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4034 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 4338 TAAAGTTGTATTTCTCTAAAAAAAAAAAAAAAAAAAAA 414 9 145 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0091465/manifest

Comment

Related Items