Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Enzymes involved in the bacterial degradation of benzoate Ge, Yong 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-854477.pdf [ 6MB ]
Metadata
JSON: 831-1.0091143.json
JSON-LD: 831-1.0091143-ld.json
RDF/XML (Pretty): 831-1.0091143-rdf.xml
RDF/JSON: 831-1.0091143-rdf.json
Turtle: 831-1.0091143-turtle.txt
N-Triples: 831-1.0091143-rdf-ntriples.txt
Original Record: 831-1.0091143-source.json
Full Text
831-1.0091143-fulltext.txt
Citation
831-1.0091143.ris

Full Text

ENZYMES INVOLVED IN THE BACTERIAL DEGRADATION OF BENZOATE by Yong Ge M . D., Second Military Medical University, Shanghai, P. R. China, 1986 M . Sc., Second Military Medical University, Shanghai, P. R. China, 1992 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology and Immunology) We accept this thesis as conforming to the required standard UNIVERSITY OF BRITISH COLUMBIA April 2003 © Yong Ge 2003 UBC Rare Books and Special C o l l e c t i o n s - Thesis Authorisation Form Page 1 of 1 In presenting t h i s t h e s i s i n p a r t i a l f u l f i l m e n t of the requirements f o r an advanced degree at the U n i v e r s i t y of B r i t i s h Columbia, I agree that the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r reference and study. I f u r t h e r agree that permission f o r extensive copying of t h i s t h e s i s f o r s c h o l a r l y purposes may be granted by the head of my department or by h i s or her representatives. I t i s understood that copying or p u b l i c a t i o n of t h i s t h e s i s f o r f i n a n c i a l gain s h a l l not be allowed without my w r i t t e n permission. Department The U n i v e r s i t y of B r i t i s h Columbia Vancouver, Canada http://ww. l i b r a r y , ubc. ca/spcoll/thesauth. html 4/17/03 ABSTRACT The objective of this doctoral research project is to investigate the specificity, and the structural determinants thereof in two important classes of enzymes that catalyze successive transformations in the aerobic catabolism of aromatic compounds. The first class is ring-hydroxylating dioxygenases represented by toluate 1,2-dioxygenase of Pseudomonas putida mt-2 (TADOmt2, E.C. 1.14.12.-) and benzoate dioxygenase of Acinetobacter calcoaceticus ADP1 ( B A D O A D P I , E.C. 1.14.12.10). The second class is aryl cis-diol dehydrogenases represented by l,2-cw-dihydroxy-3-methyl-cyclohexa-3,5-diene-carboxylate (w-toluate 1,2-diol) dehydrogenase from P. putida mt-2 (XylLm t2, E.C. 1.3.1.59) and l,2-cz's-dihydroxy-3-phenyl-cyclohexa-3,5-diene (biphenyl 2,3-dihydrodiol) dehydrogenase from Burkholderia sp. strain LB400 (BphBLB4oo, E.C. 1.3.1.56). TADOm t2 and B A D O A D P I are two-component enzymes that share 63% sequence identity, but that catalyze the 1,2-dihydroxylation of different ranges of substituted benzoates. The active site of these enzymes is contained in an oxygenase of OC3P3 configuration. The two components of TADOmt2 and B A D O A D P I were hyperexpressed, anaerobically purified and their substrate specificities were compared. Reconstituted TADOm t2 had a specific activity of 3.8 U/mg using m-toluate, and that of B A D O A D P I using benzoate was 5.0 U/mg. Each component had a full complement of their respective [2Fe-2S] centres. Steady-state kinetics data obtained using an oxygraph assay and by varying substrate and dioxygen concentrations were analyzed using a compulsory order ternary complex mechanism. TADOm t2 had greatest specificity for m-toluate, displaying apparent parameters of = 9 ± 1 uM, &cat = 3.9 ± 0.2 s"1, and Kmo2 = 16 ± 2 uM (100 mM sodium phosphate, pH 7.0, 25 °C). The enzyme utilized benzoates in the following order of specificity: m-toluate > benzoate ~ 3-chlorobenzoate > ^-toluate ~ 4-chlorobenzoate » o-toluate ~ 2-chlorobenzoate. The transformation of each of the first five compounds was well coupled to 02-utilization and yielded the corresponding 1,2-cis i i dihydrodiol. In contrast, the transformation of ort/jo-substituted benzoates was poorly coupled to O2 utilization, with > 10 times more O2 being consumed than benzoate. However, the apparent Km of TADOm t2 for these benzoates was > 100 uM, indicating that they do not effectively inhibit the turnover of good substrates. Reconstituted B A D O A D P I had greatest specificity for benzoate, displaying apparent parameters of KmA = 26+1 uM, kcat = 8.6 ±0.1 s"1, and Kmo2 = 53 ± 2 uM. The enzyme had a significantly narrower apparent specificity than TADCW, utilizing only four of the seven tested benzoates in the following order of apparent specificity: benzoate > m-toluate > 3-chlorobenzoate > o-toluate. To investigate the structural determinants of substrate specificity in these dioxygenases, hybrid oxygenases consisting of the a subunit of one enzyme and the P subunit of the other were constructed and anaerobically purified. The apparent substrate specificity of the OCBPT hybrid oxygenase for these benzoates corresponded to that of B A D O A D P I , the parent from which the a subunit originated. In contrast, the apparent substrate specificity of the OCTPB hybrid oxygenase differed slightly to that of T A D O m t 2 (3-chlorobenzoate > m-toluate > benzoate ~ /?-toluate > 4-chlorobenzoate » o-toluate > 2-chlorobenzoate). Moreover, the OCTPB hybrid catalyzed the 1,6-dihydroxylation of o-toluate, not the 1,2-dihydroxylation catalyzed by the TADOmt2 parent. Finally, the turnover of this ortho substituted benzoate was much better coupled to (Vutilization in the hybrid than in the parent. Overall, these results support the notion that the a subunit harbors the principal determinants of specificity in ring-hydroxylating dioxygenase. However, they also demonstrate that the P subunit contributes significantly to the enzyme's function. XylL m t 2 and BphBLB4oo catalyze the NAD+-dependent dehydrogenation of cis-diols in the aerobic catabolism of toluates and biphenyl, respectively. Each enzyme was heterologously expressed and purified, and their respective specificities for each of 4 aryl i i i cz's-diols were determined. Of the tested compounds, the best substrate of X y l L m t 2 was m-toluate 1,2-diol (apparent Km = 23.5 ± 1.6 uM and kcat = 0.31 ± 0.01 s"1) and that of BphBLB4oo was biphenyl 2,3-dihydrodiol (apparent Km = 11.2 ± 1.2 u M and kcat = 26.7 ± 0.02 s"1), consistent with the pathways in which these enzymes occur. Although the apparent specificity of BphBLB4oo for its preferred substrate was approximately 180 times higher than that of X y l L m t 2 for its preferred substrate, the former had a markedly narrower substrate specificity. Thus, the apparent specificity constant of X y l L m t 2 for 1,2-c/s-dihydroxy-3-methyl-cyclohexa-3,5-diene (toluene 2,3-dihydrodiol), a non-carboxylated aryl cw-diol, was half that for m-toluate 1,2-diol. In contrast, BphB LB400 did not transform either of the tested carboxylated aryl cw-diols. Phylogenetic studies of aryl cz's-diol dehydrogenases reveal that there are at least three evolutionarily distinct types of these enzymes. BphB LB400 and XylLmt2 represent separate classes of the type II (SDR-type) enzymes. iv TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS v LIST OF FIGURES ix LIST OF TABLES xi ABBREVIATIONS xii ACKNOWLEDGEMENTS xiv 1. INTRODUCTION 1 1.1 Aromatic compounds 1 1.2 Bacterial catabolism of aromatic compounds 3 1.3 Aerobic catabolism of aromatic compounds 4 1.4 Ring-hydroxylating dioxygenases 7 1.4.1 The oxygenase component (ISP) 10 1.4.1.1 TheRieske [2Fe-2S] clusters 13 1.4.1.2 The mononuclear Fe(II) centre: a 2-His-l-carboxylate facial triad. ...18 1.4.2 Electron transfer components 21 1.4.3Catalytic mechanism 21 1.4.3.1 Coupling of substrate consumption and dihydroxylation 23 1.4.3.2 Steady-state kinetics 25 1.4.4 Specificity determinants 26 1.4.5 Benzoate dioxygenase 26 1.4.6 Toluate dioxygenase 27 1.5 Aryl c/s-diol dehydrogenases 29 1.5.1 The classification of aryl c/s-diol dehydrogenases 31 1.5.2 The three-dimensional structure of BphB 34 1.5.3 Catalytic mechanism 35 1.6 Aim of this study 36 2. MATERIALS AND METHODS 38 2.1 Reagents 38 2.2 Bacterial strains, media and growth conditions 38 2.3 Molecular biology techniques 41 2.3.1 General 41 2.3.2 Cell transformation 42 2.3.3 Site-directed mutagenesis 42 2.4 General handling of proteins 42 2.5 Protein purification 43 2.5.1 Toluate, benzoate and hybrid dioxygenase ISPs 43 2.5.2 Toluate and benzoate dioxygenase REDs 44 2.5.3 Aryl c/s-diol dehydrogenases 44 2.5.4 Ring-cleavage dioxygenases 46 2.6 Protein analysis 46 2.7 Determination of Iron and Sulfur Content 46 2.8 Steady-state kinetics 46 2.8.1 Ring-hydroxylating dioxygenase activity assay 46 2.8.2 Aryl cz's-diol dehydrogenase activity assay 47 2.8.3 Analysis of steady-state kinetic data 49 2.9 Coupling studies 49 2.10 Preparation of aryl cz's-diols 50 2.11 Electronic absorption spectroscopy 52 2.12 HPLC analyses 52 2.13 Identification of reaction products 53 2.14 Sequence alignment and phylogenetic analyses 53 2.15 Crystallization ofXylL m t 2 54 3. TOLUATE, BENZOATE AND HYBRID DIOXYGENASES 55 3.1 Construction of expression systems 55 3.1.1 Native and hybrid ISPs 55 v i 3.1.2 Reductases 57 3.2 Expression and purification 58 3.2.1 Native and hybrid ISPs 58 3.2.2 Reductases 61 3.3 Characterization of the [2Fe-2S] clusters 64 3.4 In vitro reconstitution of dioxygenase activity 67 3.5 Steady-state kinetic studies 70 3.5.1 Native dioxygenases 70 3.5.2 Exchange of reductase 73 3.5.3 Hybrid dioxygenase 74 3.6 Coupling of O2 consumption to substrate transformation in dioxygenases 75 3.7 Identification of reaction products 77 3.7.1 Toluate dioxygenases ; 77 3.7.2 Benzoate dioxygenase 79 3.7.3 Hybrid dioxygenases 79 3.8 Discussion 80 3.8.1 Dioxygenase expression and purification 80 3.8.2 In vitro reconstitution of dioxygenase activity 81 3.8.3 Reductase interchangeability 81 3.8.4 Specificities 82 3.8.4.1 Toluate dioxygenase 82 3.8.4.2 Benzoate dioxygenase 83 3.8.4.3 Hybrid dioxygenases 84 3.8.5 Uncoupling of O2 consumption to substrate transformation 85 3.8.6 Specificity determination 85 3.8.7 Concluding Remarks 87 4. ARYL cw-DIOL DEHYDROGENASES 89 4.1 Expression and purification 89 4.2 In vitro reconstitution of enzyme activities 89 v i i 4.3 Steady-state kinetic studies 91 4.4 Identification of reaction products 93 4.5 Sequence alignment and phylogenetic analyses 93 4.6 Crystallization of X y l L m t 2 99 4.7 Discussion 101 5. REFERENCES 105 v i i i LIST OF FIGURES Figure 1. Examples of natural and xenobiotic aromatic compounds 2 Figure 2. The aerobic catabolism of aromatic compounds 6 Figure 3. Ring-cleavage pathways 7 Figure 4. Organization of prosthetic groups in ring-hydroxylating dioxygenases 8 Figure 5. Phylogenetic tree of ISPs 9 Figure 6. Structural representations of the ISP component of an aromatic ring-hydroxylating dioxygenase 12 Figure 7. The mononuclear iron and Rieske [2Fe-2S] cluster of the ISP of B P D O B S S O 13 Figure 8. The ligands and redox states of [2Fe-2S] clusters 15 Figure 9. Sequence alignment of a subunits 17 Figure 10. The 2-His-l-carboxylate facial triad 20 Figure 11. Proposed ring-hydroxylating dioxygenase catalytic mechanism 22 Figure 12. Proposed routes of uncoupling in ring-hydroxylating dioxygenases 23 Figure 13. The reaction catalyzed by toluate and benzoate dioxygenases 28 Figure 14. The upper and meta operons of the TOL plasmid pWWO of Pseudomonas putida mt-2 and their regulation 29 Figure 15. Dehydrogenation catalyzed by XylLm t2 and BphBLB4oo 30 Figure 16. Phylogenetic tree of 14 bacterial aryl cis-diol dehydrogenases 32 Figure 17. Sequence alignment of five SDR members 33 Figure 18. Proposed cis-diol dehydrogenation mechanism in BphBLB4oo 36 Figure 19. Biosynthesis of aryl cw-diols 51 Figure 20. ISP expression system 55 Figure 21. Comparison of I S P J A D O expression systems 58 ix Figure 22. Denaturing gel of preparations of purified TADO and BADO components...60 Figure 23. Molecular weight determination of native I S P J A D O from gel filtration 61 Figure 24. Comparison of R E D T A D O expression in different systems 62 Figure 25. Time course of the proteolytic removal of the his-tag from ht-REDTADO 63 Figure 26. Spectrum of reduced and oxidized purified ISPTADO 65 Figure 27. Spectrum of reduced and oxidized R E D T A D O 67 Figure 28. Product inhibition analysis 68 Figure 29. Activity of TADO m t 2 at different pHs 69 Figure 30. Steady-state consumption of O2 by reconstituted TADOm t2 in the presence of m-toluate 71 Figure 31. A detail of the interface between the a and P subunits of the ISP of BPDC-B356 87 Figure 32. Denaturing gel of purified preparations of XylL of P. putida mt-2 91 Figure 33. Steady-state reduction of NAD + by XylLm t2 in the presence of m-toluate 1,2-diol 92 Figure 34. Alignment of type II (SDR-type) cz's-diol dehydrogenases 95 Figure 35. Phylogenetic tree of type II (SDR-type) aryl cz's-diol dehydrogenases 97 Figure 36. Sequence alignments of type I (medium-chain) alcohol dehydrogenases (ADH), type III (iron-containing) glycerol dehydrogenases (GLD), and type I V dehydrogenases 98 Figure 37. Crystal of X y l L ^ 100 Figure 38. X-ray diffraction pattern of a crystal of XylL m t 2 101 LIST OF TABLES Table 1. Strains and plasmids used in this thesis 39 Table 2. Purification of the oxygenase component of toluate dioxygenase 59 Table 3. Purification details of ISPs 60 Table 4. Apparent steady-state kinetic parameters of ISPs for selected substituted benzoates 73 Table 5. Activities of ISPs with different reductases 74 Table 6. Apparent steady-state kinetic parameters of ISPs for selected substituted benzoates in air-saturated buffer 76 Table 7. Coupling of substrate utilization in TADO m t 2, B A D O A D P I and their hybrids.. ..77 Table 8. Identification of cis diols 78 Table 9. Purification of XylLmt2 and BphBLB400 90 Table 10. Apparent steady-state kinetic parameters of XylL m t 2 and BphBLB4oo for cis-diols 93 x i ABBREVIATIONS AND SYMBOLS 2HBADO 2-halobenzoate 1,2-dioxygenase DHB 2,3-dihydroxybiphenyl 3-CBADO 3-chlorobenzoate 3,4-dioxygenase ANDO Anthranilate 1,2-dioxygenase BADO benzoate dioxygenase BEDO benzene dioxygenase Bicine N,N-bis(2-hydroxyethyl)glycine BPDO biphenyl dioxygenase DHBD 2,3-dihydroxybiphenyl 1,2-dioxygenase BphB cz's-biphenyl-2,3-dihydrodiol 2,3-dehydrogenase C230 catechol 2,3-dioxygenase CHES 2-(N-cyclohexylamino)ethane sulfonic acid DTT dithiothreitol EPR electron paramagnetic resonance FAD flavin-adenine dinucleotide FMN flavin mononucleotide ht his-tagged rPTG isopropyl-P-D-thiogalactopyranoside ISP iron-sulphur protein kDa kiloDalton The Michaelis constant NADH reduced nicotinamide-adenine dinucleotide NDO naphthalene dioxygenase PADO phthalate 1,2-dioxygenase PCB polychlorinated biphenyl RBS ribosome-binding site RED reductase SDR short-chain alcohol dehydrogenase/reductase TADO toluate dioxygenase x i i TODO toluene dioxygenase V m a x The limiting maximal velocity of an enzymatic reaction under steady-state conditions x i i i ACKNOWLEDGMENTS I express my sincerest gratitude to Dr. Lindsay D. Eltis, my supervisor. You deserve special thanks for the opportunities and support you gave me. Thank you also for keeping me focused and the patience you showed to me during my graduate studies. Your help has proven invaluable. I am also indebted to Drs. Stephen Y. K. Seah and Frederic H. Vaillancourt for their insight and assistance. Thanks are also due to the other members of the Eltis group: Nathalie Imbeault, Manon Couture, Pascal Fortin, Emma Master, Cheryl Whiting, Claude Levesque, Christian Blouin as well as Elitza Tocheva. Many thanks to the members of my advisory committee, Dr. William Mohn, Dr. Michael Murphy, Dr. John T. Beatty, for inspiring questions and constructive suggestions, for looking after me and reviewing my thesis. The friendships with other people in the department are also appreciated greatly, you guys made working in the lab more fun. Finally, I would like to thank my family, particularly my wife Meiqin Cao. Without her support I would have never been able to complete this work. My daughter Susan and my son Eric are the power to uphold my hope and enthusiasm. To them I dedicate this thesis. XIV 1 INTRODUCTION 1.1 Aromatic compounds Aromatic compounds are organic compounds that have planar monocyclic rings with (4n+2) n electrons, where n > 1 (Hiickel's rule; Solomons 1997). The prototypical aromatic compound is benzene, first isolated from pyrolyzed whale oil in 1825 by Michael Faraday (Faraday 1825). Al l other aromatic compounds may be considered to be derivatives of benzene. The chemical formula of benzene is CeH6. Its sp -hybridized carbons form a planar six-membered ring. The short (1.39 A) carbon-carbon bonds in this ring allow the third p orbital of the carbon atoms to overlap equally all around the ring to form a set of six iz molecular orbitals. This closed bonding shell of delocalised n electrons accounts, in part, for the stability of aromatic compounds. A wide variety of aromatic compounds are found throughout the biosphere (Figure 1). Many, such as the amino acids tryptophan, phenylalanine and tyrosine, are synthesized by living organisms and are essential to life. Indeed, a major source of aromatic compounds is the biopolymer lignin. Lignin accounts for 30% of all plant material (Alder 1977), and can be further transformed to polyaromatic hydrocarbons (PAHs) through biogeochemical forces in the absence of oxygen. Thus, PAHs such as anthracene and phenanthrene are found in coal tar oil. Due to their unique chemical properties, aromatic compounds are important in the agricultural, food, pharmaceutical, textile and chemical industries. Such compounds include those that occur naturally and others that do not. The latter are often referred to as xenobiotics. Many industrially produced aromatic compounds have been released either deliberately or accidentally into the environment. Some of these compounds are now amongst the most persistent and pervasive environmental pollutants, particularly those xenobiotics that did not exist in the biosphere in significant quantities prior to their 1 production by man. PAHs possessing more than 4 condensed rings and aromatic compounds possessing electron-withdrawing substituents, such as nitro- and chloro- are particularly recalcitrant. A good example of the latter is polychlorinated biphenyls (PCBs), which are widely distributed in the natural environment, and even found in the Arctic (Blumer et al, 1975). PCBs are recalcitrant to natural degradation, accumulate in the food chain, and cause health problems to various living organisms including man (Faroon et al., 2001a and b). o cA ^ Figure 1. Examples of natural and xenobiotic aromatic compounds. These compounds have one or more aromatic nuclei. They are stable and recalcitrant due to the large negative resonance energy possessed by the aromatic ring. These compounds include amino acids, antibiotics, vitamins, solvents, synthons, pesticides, and explosives. Some of them are carcinogens. 2 1.2 Bacterial catabolism of aromatic compounds A wide variety of bacteria are able to utilize aromatic compounds as sole sources of carbon and energy (Dagley 1986). Indeed, microorganisms provide the main route by which aromatic compounds are degraded in the biosphere. Understanding the catabolic enzymes that are responsible for this degradation is critical to understanding the molecular basis of a process that is essential to maintaining the global carbon cycle. Understanding bacterial enzymes that transform aromatic compounds is also of practical value, as these enzymes are useful biocatalysts in "green chemistry" applications in the industries mentioned in section 1.1 (Faber 2001). Moreover, the enzymes that have evolved to degrade naturally occurring compounds can often at least partially degrade many xenobiotic compounds. There is therefore considerable interest in exploiting such activities for bioremediation (Timmis et al, 1994, Timmis et al, 1999). Exploiting the tremendous, largely untapped biotechnological potential of bacterial catabolic activities requires a thorough understanding of the enzymes responsible for these activities. Bacteria are known to degrade aromatic compounds anaerobically and aerobically. Two key steps in both catabolic strategies are aromatic ring cleavage and the activation of the aromatic ring that must precede this cleavage. Anaerobic degradation has been investigated in a range of bacteria, such as Rhodopseudomonas palustris, Thauera aromatica, and Azoarcus evansii (Spormann et al, 2000; Gibson et al., 2002). In the characterized pathways, the aromatic ring is activated to yield one of three activated intermediates: benzoyl-CoA, resorcinol, and phloroglucinol. Fission of the activated intermediate is achieved by successive steps of reduction of the aromatic ring to an alicyclic compound followed by hydrolytic ring-cleavage. The ring-cleaved product is then transformed to intermediates of the tricarboxylic acid (TCA) cycle. The aerobic degradation of aromatic compounds, about which comparatively more is known, is outlined in the next section. 3 1.3 Aerobic catabolism of aromatic compounds A wide variety of bacteria are able to degrade aromatic compounds aerobically. The best characterized catabolic pathways are those found in y-Proteobacteria, such as the pseudomonads and sphingomonads, and found in actinomycetes, especially Rhodococcus. In all the characterized cases, the aerobic catabolism is characterized by the extensive use of molecular oxygen (O2; Dagley, 1978a and b). Indeed, enzymes that utilize O2, or oxygenases, are involved in the key steps of ring activation and ring fission. Thus, monooxygenases and dioxygenases activate the aromatic ring via hydroxylation. Monooxygenases incorporate one atom of O2 into the substrate and the second atom of O2 is reduced to H2O. This reduction is accomplished either by the aromatic substrate or by a cosubstrate reductant. In contrast, dioxygenases incorporate both atoms of O2 into the substrate, as described for ring-hydroxylating dioxygenases in section 1.4. Ring-hydroxylation, whether catalyzed by a monooxygenase or dioxygenase, is usually the rate-limiting, specificity-determining step of the catabolic pathway, and ultimately gives rise to one of a limited number of common intermediates: catechol, gentisate or protocatechuate. These activated aromatic intermediates are then cleaved by a ring-cleavage dioxygenase (Harayama et al, 1989; Figure 2). Ring-cleavage dioxygenases open the aromatic intermediates by incorporating both atoms of O2 into the ring-cleaved product. The substrates of these enzymes usually have hydroxyl groups on adjacent carbon atoms of the aromatic ring, as in catechols and protocatechuate, or on para positions, as in gentisate. Cleavage of catechols and protocatechuates can occur either between the two hydroxyl groups, in which case it is referred to ortho or intradiol cleavage, or can occur proximal to one of the hydroxyl groups, in which case it is referred to as meta or extradiol cleavage. The initial aromatic substrate of the catabolic pathway influences the mode of ring-cleavage utilized by that pathway. Thus, unsubstituted and haloaromatic compounds are typically metabolized by 4 ortho-cleavage pathways (Rojo et al., 1987), whereas alkyl-aromatics and polyaromatic compounds are typically metabolized by meta-cleavage pathways (Dagley, 1986). The products of ring fission, cis-cis muconates (Dagley, 1978b) and hydroxymuconic semialdehydes (Bayly et al., 1984) in the case of ortho and meta pathways respectively, are readily converted to TCA cycle intermediates (Figure 3). Figure 2. The aerobic catabolism of aromatic compounds. Representative pathways are shown to converge at a few common intermediates - catechol, gentisate or protocatechuate and their substituted analogs. Pathway substrates are: 1, naphthalene; 2, dibenzofuran; 3, dibenzo-p-dioxin; 4, benzene; 5, phenol; 6, aniline; 7, biphenyl; 8, 5 toluene; 9, salicylate; and 10, benzoate. Ring-hydroxylation and ring-cleavage reactions are indicated with A and B, respectively. (Adapted from Reineke 1998). 6 intradiol cleavage ortho cleavage r ^ C O O H C120 k ^ C O O H " * extradiol cleavage meta cleabage X H O aOH C230 COOH acetyl-CoA succinyl-CoA OH catechol f ^ C O O H 3,4-PCD ^ y O H 4,5-PCD HOOC - V - C O O H " H O O C ' J ^ O H HOOC protocatechuic acid HOOC H O O C ^ O OH HOOC GO OH gentisic acid acetaldehyde pyruvate succinic semialdehyde fumarate Figure 3. Ring-cleavage pathways. The limited number of ring-hydroxylating intermediates undergo ortho or meta cleavage pathways and become metabolites of the tricarboxylic acid cycle. C120: catechol 1,2-dioxygenase, C230: catechol 2,3-dioxygenase, 3,4-PCD: protocatechuate 3,4-dioxygenase, 4,5-PCD: protocatechuate 4,5-dioxygenase, GO: gentisate 1,2-dioxygenase (Adapted from Dagley 1978 and 1986) 1.4 Ring-hydroxylating dioxygenases Ring-hydroxylating dioxygenases catalyze the stereo- and regio-specific dihydroxylation of aromatic rings giving rise to aryl cw-l,2-diols. This reaction utilizes one equivalent of 0 2 and two reducing equivalents, which are incorporated into the reaction product. These dioxygenases consist of two or three different components, and are therefore sometimes called multi-component dioxygenases. The oxygenase component (also known as the hydroxylase component or ISP, for iron-sulphur protein) contains a "Rieske-type" [2Fe-2S] cluster and an active site mononuclear iron. A reductase (RED) and, if present, a ferredoxin, transfer electrons from NAD(P)H to the mononuclear iron of the ISP via the [2Fe-2S] cluster (Figure 4). 7 G r o u p I I Benzoate, toluate dioxygenase r Reductase (RED) Oxygenase (ISP) r -\ r NADH Flavin Fe-S Fe-S In, ? Fe r 0 2 Oxygenase (ISP) J G r o u p I V Figure 4. Organization of prosthetic groups in ring-hydroxylating dioxygenases. The prosthetic groups occur in two or three protein components which are functionally connected to form the so-called multi-component dioxygenase. As the rate-limiting, specificity-determining enzymes of the catabolic pathway (Dagley et al, 1978a; Gibson et al., 1987), ring-hydroxylating dioxygenases are key players in the degradation of aromatic compounds and have attracted considerable attention in engineering pathways for the biodegradation of aromatic pollutants (Timmis et al, 1999). In addition, these dioxygenases are important biocatalysts in a growing number of green chemistry applications due to their enantio-, stereo- and regio-specificity. Thus, the aryl ds-diols typically produced by these enzymes are useful chiral synthons. Moreover, these enzymes catalyze a range of monohydroxylation, desaturation, sulfoxidation, O- and N-dealkylation reactions (Gibson et al, 2000; Hudlicky et al, 1999; Boyd et al, 1998). A thorough understanding of the enzymes responsible for these activities will facilitate the exploitation of their tremendous, but largely untapped biotechnological potential. 8 G r O U p 11 Naphthalene (Class III) Sbfotpbenzoate Benzoate Benzoate. Toluate Trichlorophenoxy acetate ^ isopropyf benzoate Pherianlhrene Naphthalene £ ^ Caiba;'oie O-Oibenzodioxm Biphenyl C°\—-3-Fhenyipropionate Group IV (Class IIB, i Toluene/bipheny Group II (Class IB) 3-Chlorobertfoate Phthaiate i Phthaiate Phenoxybenzoate Group I g ^ r - ® (Class IA) p-Toluene sulfonate Vaniflate Cttrron! Opinion <>•> Siote^myiugy Figure 5. Phylogenetic tree of ISPs. This analysis was based on the a subunits of the ISP and resulted in the identification of 4 Groups of distinct substrate preference (dashed boxes). These Groups correspond to the Class IA, IB, IIB and III enzymes classified on the basis of their electron transfer components (Batie et al, 1991). The dashed circle indicates the toluate and benzoate dioxygenases that are the subject of this thesis. Adapted from Gibson et al, 2000. Ring-hydroxylating dioxygenases are classified based on the amino acid sequence of the a subunit of the ISP (Gibson et al, 2000, Nam et al, 2001). As summarized in Figure 5, this classification system identifies four major groups of dioxygenases, which correspond to some extent to the enzymes' substrate specificities, as well as to the groups of a previous classification system based on the nature of the dioxygenase components (Figure 4, 5: Batie et al, 1991). Group I dioxygenases correspond to the Class IA enzymes of the previous system. These enzymes are characterized by phthaiate dioxygenase (PADO) and include those enzymes whose ISPs consist only of an a 9 subunit. Group II enzymes correspond to Class IB enzymes of the previous system, and include the benzoate dioxygenases (BADO). Other notable Group II enzymes are toluate 1,2-dioxygenase (TADO, E.C. 1.14.12.-) and 2-halobenzoate 1,2-dioxygenase (2-HBADO, E.C. 1.14.12.13; Fetzner et al, 1992). Group III enzymes are represented by naphthalene dioxygenase (NDO), and correspond to Class III enzymes of the previous system. Finally, Group IV enzymes include toluene dioxygenase (TODO) and biphenyl dioxygenase (BPDO) of the former Class IIB enzymes. 1.4.1 The oxygenase component (ISP) The ISPs of ring-hydroxylating dioxygenases are oligomers composed of either one or two distinct subunits in an ctn or (aP)n configuration. The a subunit is about 50 kDa, and contains both the catalytic mononuclear Fe(II) centre and the Rieske-type [2Fe-2S] cluster involved in electron transfer (Ensley et al, 1983; Subramanian et al, 1985; Yamaguchi et al, 1982). The P-subunit, if present, has a mass of approximately 20 kDa and contains no cofactor. The crystallographic structures of the ISPs from N D O 9 8 I 6 from Pseudomonas sp. NCTB9816 (Kauppi et al, 1998) and B P D 0 B 3 5 6 from Comamonas testosteroni B-356 (Colbert, 2000) show that their overall architectures are similar. Indeed, this overall architecture is considered to be representative of all ISPs of (aP)3 configuration (i.e., Group II, III and IV enzymes). This overall structure resembles a mushroom in which the three a subunits are arranged head-to-tail to form the cap and the three P subunits comprise the stem (Figure 6). The a subunit consists of two domains: an N-terminal domain of ~150 residues contains the [2Fe-2S] cluster, and a C-terminal domain of ~290 residues contains the mononuclear iron. Within a single a subunit, the two metallocentres are separated by approximately 45 A. However, the a subunits are arranged such that the [2Fe-2S] cluster of one cc-subunit is within 12 A of the mononuclear Fe of the adjacent a-subunit. It is therefore thought that electron transfer occurs from the [2Fe-2S] cluster to the mononuclear Fe between adjacent a subunits. 10 Interestingly, a conserved aspartate residue (Asp205 in NDO, Asp230 in BPDO) bridges histidine ligands of adjacent metallocentres (Figure 7). Substitution of Asp205 in NDO, even with glutamate or asparagine, inactivates the dioxygenase, even though the [2Fe-2S] cluster can still be reduced by NADH, RED, and ferredoxin (Parales et al, 1999). The P subunit of NDO and BPDO consists of a six-stranded mixed parallel P~ sheet (Kauppi et al, 1998; Colbert, 2000). Although this subunit contains no prosthetic groups, residues of the P subunit approach to within 10 A of the active site mononuclear iron and the Rieske centre. The functional significance of the P subunit is unclear. 11 Figure 6. Structural representations of the ISP component of an aromatic ring-hydroxylating dioxygenase. (A) A side view of the mushroom-shaped ISP. Three a subunits comprise the cap and three p subunits form the stem. ( B ) A top view of the 3 a subunits in the "cap" showing their head-to-tail association and the resultant positioning of metallocentres in adjacent subunits. (C) Crystal structure of the ISP component of B P D O B 3 5 6 (Colbert, 2000). The a and p subunits are coloured blue and yellow, respectively. Iron is represented as red balls, and sulphur as yellow balls. ( D ) A single ctp protomer of the B P D O ISP. The p subunit is coloured grey. The backbone of the a subunit is colour-ramped from blue (N-terminal) to red (C-terminal). The distance between the mononuclear iron (red ball) and the iron sulphur cluster (yellow and red, balls) is 45 A. 12 Asp386 Asp230 O His239 Figure 7. The mononuclear iron and Rieske [2Fe-2S] cluster of the ISP of B P D O B 3 5 0 (Colbert, 2000). The dotted line indicates the interface of adjacent subunits. Carbon, oxygen, nitrogen, sulphur, and iron atoms are coloured orange, red, blue, mauve, and green, respectively. The enzyme-bound biphenyl molecule is coloured yellow. The hydrogen bonds of the bridging Asp are shown as yellow dots. The ligands of the metallocentres and the bridging Asp are numbered according to BPDO. In TADOm t2, the ligands of the [2Fe-2S] cluster are Cys92, Cysll2, His94, Hisl l5, the Fe(II) ligands are His221, His226, Asp372, and the clusters are bridged by Asp218. Figure made using PyMol (DeLano 2002). 1.4.1.1 The Rieske [2Fe-2S] cluster Iron-sulphur clusters are found in a wide variety of proteins, and are involved in numerous fundamental biological processes including photosynthesis, nitrogen fixation and oxidative phosphorylation (Beinert et al., 1990). Their primary role in these processes is electron transfer. Although there are different kinds of clusters, including 13 cubane [4Fe-4S] clusters and planar [2Fe-2S] clusters, all contain non-heme iron ligated to inorganic or cysteine sulphur (Beinert et al, 1997). In electron transfer, these clusters function as one-electron carriers, with one of the iron atoms in the cluster alternating between the Fe 3 + and Fe 2 + states. [2Fe-2S] clusters contain two atoms of iron, bridged by two labile sulphide atoms (Figure 8). These clusters are reddish brown in colour, the visible absorption principally resulting from sulphur-to-Fe(III) charge-transfer transitions (Palmer et al., 1967). In the oxidized state, each iron is Fe 3 + and the electronic structure of the cluster is such that the spins on the iron ions are anti-ferromagnetically coupled. As a result, the oxidized protein has a ground state with zero spin, and has no electron paramagnetic resonance (EPR) spectrum. Upon reduction, one of the iron ions becomes high-spin Fe(II), and the net spin of the coupled Fe(III) and Fe(II) ions is S=l/2. The largest class of [2Fe-2S] proteins consists of the plant-type ferredoxins, first identified in spinach chloroplast membranes (Mortenson et al, 1962). In these ferredoxins, the cluster is coordinated to the protein by four cysteine sulphides (Figure 8A). The redox potential of plant ferredoxins typically ranges from -455 to -305 mV (Sykes et al, 1991) and the E P R signal of the reduced cluster has an average g-factor of 1.96. However, a subset of these clusters have potentials around -170 mV. Indeed, some of the latter are found in the reductases component of ring-hydroxylating dioxygenases (e.g., R E D P A D O ; Correll et al, 1993). 14 Cys-Ss Cys-S' Fe3+ Fe3\ S-Cys S-Cys Cys-S. Cys-S' Fe3+ Fe2+ /S-Cys \ S-Cys N Cys-SK S yH=/ Fe3+ Fe3\ _ Cys-S. S Cys-S' N * ; Fe3+ Cys-S Fe2\ N = / B Figure 8. The ligands and redox states of [2Fe-2S] clusters. (A) In plant-type [2Fe-2S] clusters, the endogenous cluster ligands are four cysteines. (B) In Rieske-type [2Fe-2S] clusters, the endogenous cluster ligands are two cysteines and two histidines. A second class of [2Fe-2S] clusters, and the type found in the ISP of ring-hydroxylating dioxygenases, is the Rieske-type cluster. This type of cluster was first discovered in a protein isolated from the cytochrome bc\ complex of mitochondria (Rieske et al, 1964). The hallmark of the Rieske-type clusters is that one of the Fe atoms is ligated by two histidine residues (Figure 8B). The other iron is ligated by two cysteine residues, as observed in plant-type clusters. The visible spectrum of the Rieske cluster is red-shifted with respect to that of the plant-type ferredoxins, and is approximately 33% less intense. Moreover, the EPR gav of the reduced Rieske-type cluster is around 1.91 (Rieske et al., 1964), which is lower than that of the plant-type [2Fe-2S] cluster. There appears to be two classes of Rieske-type clusters based on their midpoint reduction potentials. Thus, the redox potentials of the Rieske clusters in mitochondrial bc\ and photosynthetic b$f complexes are approximately +315 mV (Trumpower, 1981). In contrast, the reduction potentials of the Rieske clusters found in the ISP and ferredoxin 15 components of ring-hydroxylating dioxygenase are approximately -115 and -150 mV, respectively (Butler et al, 1997). A sequence alignment of ISP a subunits (Figure 9) reveals that the cysteinyl and histidinyl ligands of the Rieske [2Fe-2S] cluster are conserved. Structural data demonstrate that the folds of all Rieske cluster proteins are similar, and that the observed difference in the reduction potentials is due the positions and orientations of dipoles in the cluster environment (Couture et al, 2001, Colbert et al, 2000). 16 Xy1X_mt2 W T M T M H L Q Q Q Y [ g | S . . BenAADPl . M P R I P V I N T S H d a R W 3 E . CbdA_2CBS M S T P L I A G T G P S A V R Q L I S N , TflAI-AC1T00 . M N T T M N T P V P S Y V N D V S H R G CmtAb_F1 M N N D K N . . BphA LB40D . U S S A I K E V Q G A P V K W V T N W T P E A BphA "B356 . M S S T M K D T Q E A P V R W S R N W T P DA NahAc 9816 M N Y N N K D E N : I V R C K N T E T "- E F K t H D P V S N F R C R R A T D '"• I F R V H D D E N L L F R V A L V D Q E K G L L O H L V D Q • N G K L DA L V S E s G L S 0 K H G Q D D N i „.„.Q K D G a|... P G K E R Y C A D . P F E K E 9 F C D K K E G D C G F P F E K E O F C D K K E G D C G F P F E K D L Y G E S I N XylX mt2 BonA_ADP1 CbdA 2CBS THAI _AC1100 CmtAb_F1 BphA LB400 BphA B366 Nt*Ac 9816 E . N U I - H V S t S X j L e F t a E I H O E _._IP T G A Q N L V P V P R F D I Y A 6 F C F V S F N A E V E P L f K A E WG P L Q O K I ' ' A T Q K BJL V j i A N W O V Q A P D K A D W G P L Qllav E I D I K 0 L V H A . N W 0 P E A P D K c i aaOEGKlav E E I F H H O I vac F D O E A P P 130 140 150 160 180 S R K V T T K I Q S K A I G A S V F L A K E Y L E D A R P Y M S D A M P Y M D A A WY L V O V f L T At L Q I i L Q F t L V E N S I F A A £ J Q F C S | F A A Q O F C S i A P A0R3F V G l 200 L K L PA^O R A ^ P P D P P Q T ^ O '. i l S ^ E P N E Q [ L K N I N D G F S B A K L E G K S T 0 L G N G . . HI G . . I P P E M D L S OA Q I P T K G N Q F R A AEjSfG . . . H[ G . L P P E M O L T Q i l Q L 8 K F J G N O F R S A EHo . . . Hi G E 5 I F S S L £ 1 3 N A A L P P E GA G L Q MT S K Y£ 220 230 240 E F S A P W0R P I A S JWKIV D H P |w F I N D S S |M G V L W 0 SI 250 I L A . I L L S Y S G V H S A D L V XylX mt2 BenAADPl CbdA 2CBS Tf1A1„AC1100 CmlA0_F1 BphA_lB400 BphA_B356 Nat A; 9616 A E P K . A R . G K G D 0 . P A . P A . G A K 290 R D R L A S E E j A A E Y T E K H R E E L K A R V . Q M N A K A R A Y A R L V E L H A E L A E Q R L f ? E MR A D E E H G V A Q l l S K B | E R E E V A D A I V N Q E V R W K E E J M R Q A E MA D R i A Y K H T G M P V R R M V G Q H M T I A E K A A R R V P Q . . L P I L D M F G Q H M T V F l Q E R L N K E I 0 0 V R A R I Y R S H . L Q C T V FI 280 280 300 I S T L Q I I Q L Q S MEIL S LE5L L I I N13 . . . I MA I T V C S F L P T F N N 1 C S F L P G l N T I N S M L T C S G V F 310 V L Q v vE) T WQ T F Y 1 WH K T WH V WN v i R M L S Hl3 Q A P N Y M H V N G W S R G P R G P I D A ' N E I £|V 1 N E V • :: V , N T . (V p m i- 3E!; F D E B S N E B S D WAbJK Y W A F T L V D A D A P A E 1 K E E W A F V L V D A D A P E D I K E E W T B A I V E K D M P E D L K R O 3350 R . E A S E E V S   S  330 340 A S J Y S S Y H S A R E ! 0 Y R A I A A G A T O | Y V l E "i D A f A Atil^USftljg*!D Hi L G K P T E N O R D Y I F S N Y R L V P WS&3l 3 K T*|M G K E T A N Y j f j S D . L S H Y K A . K S Q P L N A Q M G L G R S Q T G H P D F l RV M R K H K A K S T S L C A K M G L N V P N K N N P A Y S O N G K K Y Q S R O S ^ L L S N L G F G E 0 V Y 6 0 A V VI 390 i V Y G S M A F H N E T OMR A F WT R W 0 N V j » J . Y V Y A C I E A A R G K T A Y V Y A L I E A A R G V V J 3 K S A I G U T S Y R O 410 XylX m(2 Ban* ADP1 CbdA^2CBS TllA1_AC11O0 CmtAD F1 BphA_tB400 BphA B356 NafriAc_9816 G M V H H Q W R M ' S G M Y H H E S R M P S K RE$Q D R L 1 A A If K E F A S E A •% F K V F N A S D T T S S V Q v i p T 1 A L W A T L K P WD T L K P WAClF E H A S Figure 9. Sequence alignment of a subunits. The sequences are those of the a subunits of the following enzymes: XylX_mt2, TADO from P. putida mt-2 (Harayama et la., 1991); B e n A A D P l , BADO from A. calcoaceticus ADP1 (Neidle et al, 1991); CbdA_2CBS, HABADO from P. cepacia 2CBS (Haak et al, 1995); TftAlACllOO, trichlorophenoxyacetic acid dioxygenase from Burkholderia cepacia AC1100 (Danganan et al, 1994); CmtAb_Fl, cumate dioxygenase (Eaton et al, 1996); BphA_LB400, BPDO from Burkholderia sp. LB400 (Erickson et al, 1992); BphA_B356, BPDOB356 (Sylvestre et al, 1996b); NahAc_9816, NDO from Pseudomonas sp NCIB9816 (Simon et al, 1993). The residues of XylX_mt2 and NahAc_9816 are numbered above and below the alignment, respectively. Iron-sulphur cluster ligands and mononuclear iron ligands are shaded black. Gray shaded residues are those that are identical in XylX_mt2 and B e n A A D P l . The bridging Asp is labelled with an asterisk. The alignment was created using CLUSTAL X (Thompson et al, 1997) and visualized using ALSCRJPT 1.8 (Barton, 1993). 17 1.4.1.2 The mononuclear Fe(II) centre: a 2-His-l carboxylate facial triad The reaction between ground state O2 and carbon in organic compounds is spin-forbidden: the former is paramagnetic, with two unpaired electron spins, whereas the latter exists in a singlet state. One strategy that biological systems have recruited to overcome this problem is to use transition metals. The reaction between O2 and transition metals is possible due to the latter's incompletely filled d orbitals. Diamagnetic metal-oxygen complexes that form can subsequently react with organic substrates (Halliwell et al, 1984). Examples of transition metals that are used by biological systems for this purpose are iron, copper, manganese, and cobalt. A common coordination geometry utilized by iron-containing 02-activating enzymes is the 2-His-l-carboxylate facial triad (Hegg et al, 1997). This motif has been found in a range of enzymes that catalyze very different reactions: ring-hydroxylating dioxygenases catalyze arene cw-dihydroxylation (Kauppi et al, 1998; Colbert, 2000); tyrosine hydroxylase catalyzes hydroxylation (Goodwill et al, 1997); soybean lipoxygenase catalyzes the dioxygenation of poly-unsaturated fatty acid (Minor et al, 1996); iron superoxide dismutase catalyzes the disproportionation of superoxide (Lah et al, 1995); and the extradiol dioxygenases (section 1.3) catalyze the oxidative cleavage of catechols (Han et al, 1995). The motif has also been found in enzymes that catalyze the oxidative ring closure in the biosynthesis of penicillin (isopenicillin N synthase, Kreisberg-Zakarin et al, 1999), desaturation in the biosynthesis of clavaminic acid (clavaminic acid synthase, Doan et al, 2000) and demethylation in repair of damaged DNA (Duncan et al, 2002). Crystal structures of these enzymes show that in each case, the coordination sphere of the active site iron includes 2 histidine residues and a carboxylate of either aspartate or glutamate (Figure 10). This leaves up to three free coordination sites that can be used to orchestrate the desired chemical reaction. Thus, the identity of the other iron ligands includes other residue side chains and solvent species 18 depending on the type of enzyme and the reaction catalyzed. Moreover, these other ligands may be displaced during the catalytic cycle. For example, in the extradiol dioxygenase 2,3-dihydroxylbiphenyl 1,2-dioxygenase (DHBD), the active site iron is coordinated by two histidines and a glutamate. In the resting state enzyme, the coordination sphere of the iron includes two solvent species (Figure 10, Han et al, 1995). The substrate, 2,3-dihydroxylbiphenyl (DHB), binds to the iron in a bidentate manner, displacing the two solvent species (Sato et al, 2002; Vaillancourt et al, 2002). This leaves a sixth coordination site to bind O2. The 2-His-l-carboxylate facial triad is somewhat analogous to a heme in that it is used by a variety of oxygenases. However, heme enzymes have less flexibility because their iron porphyrin cofactor is ligated to an amino acid residue on the polypeptide chain. This leaves only one coordination site available for 02-activation. Because heme iron uses its only available coordination site to bind and activate O2, the substrate has to be bound at a separate binding site on the protein. 19 His, Asp 3 6 2 His. His 213 G | U 3 7 6 "' His,,,^""'"' '331 _ .nOH, TyrH G l u / A s p H i s His, '270 Asp 2 1£ F e < " , , , , , , , , 0 H 2 His, ' H 2 0 o V Gin H 2N 330 Asp, 56 IPNS . F e ^ NDO H i s Fe „ „ i i « Asp 3 *H 20 Glu 260 '"">..„ His, Fe l l „ . » 'OH, His, OH (2) DHBD «^ z X "<Wco2 His e His, Fe« „»nHis 7 4 ^ H i S 1 6 0 FeSOD His c Fe-o ,,,.n» 1 1 1OH 2 His, V Asn H 2N 694 SLO-1 Figure 10. The 2-His-l-carboxylate facial triad. The common structure of mononuclear iron is depicted in the centre of the figure. The iron is ligated by two histidines and a carboxylate from either Asp or Glu. X, Y, and Z represent possible ligands. Usually it has five or six coordination sites of which at least three are for internal coordination. The other coordination sites combine O2 and/or the other substrate. The crystallographically determined structures of the 2-His-l-carboxylate coordinated iron centres of 6 enzyms are depicted at the periphery. Clockwise from the top, these are: naphthalene dioxygenase (NDO), 2,3-dihydroxylbiphenyl 1,2-dioxygenase (DHBD), tyrosine hydroxylase (TyrH), soybean lipoxygenase (SLO-1), iron superoxide dismutase (FeSOD), and isopenicillin N synthase (IPNS). 20 1.4.2 Electron transfer components In ring-hydroxylating dioxygenases, the requisite electrons are transferred from reduced pyridine nucleotides (NAD(P)H) to the ISP via flavin and [2Fe-2S] redox centres (Figure 4). As noted above, these centres are arranged in one or two soluble proteins. Group I and Group II ring-hydroxylating enzymes, such as PADO, BADO and TADO, utilize a single component, RED, which contains a plant-type [2Fe-2S] cluster in its N-terminal domain and a ferredoxin-NADH reductases in its C-terminal domain (Harayama et al, 1991; Nordlund et al, 1990). In contrast, the electron transport chain of Group III enzymes consists of two components: an NADH-dependent RED that contains a flavin (FAD) and a plant-type [2Fe-2S] cluster, and a ferredoxin that contains a Rieske-type [2Fe-2S] cluster. The electron transport chain of Group IV enzymes also consists of two components, a RED and a ferredoxin. However in this case, the RED contains only a flavin (FAD). In each of the systems, the flavin of the RED accepts two electrons from NADH in one step, and then transfers them to the iron-sulphur cluster one at a time. The two single electron transfer steps ensure that the non-heme mononuclear iron undergoes a series of oxidation changes to activate dioxygen. The additional ferredoxin component of the Group III and IV enzymes presumably affords greater flexibility to change the ratio of flavin and iron-sulphur cluster for optimal electron transportation efficiency (Figure 4). 1.4.3 Catalytic mechanism Single turnover experiments in NDO (Wolfe et al, 2001) and BADO (Wolfe et al, 2002) indicate that both the mononuclear Fe and the [2Fe-2S] cluster start the catalytic cycle in the reduced state (Figure 11). The aromatic substrate binds adjacent to the Fe(II) centre (Carredano et al, 2000; Colbert, 2000), which then binds 0 2 . Spectroscopic studies of PADO indicate that the coordination number of the Fe(II) 21 decreases from six to five upon substrate binding, presumably preparing the latter to bind 0 2 (Gassner et al, 1993; Tierney et al, 1999; Coulter et al, 1999). However, structural data indicate that the mononuclear Fe is 5-coordinate in resting state NDO and BPDO (Kauppi et al, 1998; Colbert, 2000). Moreover, the single turnover studies indicate that the [2Fe-2S] cluster must be reduced for the mononuclear Fe to bind 0 2 (Wolfe et al, 2001; Wolfe et al, 2002). Following substrate hydroxylation, the Fe centre and [2Fe-2S] cluster are oxidized. Reduction of the former appears to be required for product release. The chemical logic of this mechanism and many of its steps are unknown. For example, it is unclear whether reduction of the [2Fe-2S] cluster precedes substrate binding, and how the oxidation state of the [2Fe-2S] cluster gates 0 2 binding by the mononuclear Fe. Moreover, the nature of oxygen activation is unknown: both Fe(III)-peroxo and Fe(V)-oxo species have been postulated (Wolfe et al, 2003). Finally, the roles of active site residues are unknown. Figure 11. Proposed ring-hydroxylating dioxygenase catalytic mechanism (Wolfe et al, 2001 and 2002). The nature and number of activated oxygen intermediate(s) are unknown. Three possibilities are shown. 22 1.4.3.1 Coupling of substrate consumption and dihydroxylation In general, the reactions catalyzed by oxygenases are tightly coupled. That is, every reducing equivalent consumed by the enzyme is used in the transformation of the organic substrate. Uncoupling occurs when the activated oxygen is unable to react with substrate due to steric and/or electronic incompatibility between the reactants within the enzyme active site. Uncoupling leads to the wasteful expenditure of NADH-derived reducing equivalents and the production of peroxide radicals (Figure 12) Figure 12. Proposed routes of uncoupling in ring-hydroxylating dioxygenases. The nature and number of activated oxygen intermediate(s) are unknown. The formation of O2", H2O2 and H 2 O consume 1, 2 and 4 reducing equivalents, respectively. Oxygenases have sophisticated mechanisms to ensure that no unnecessary activated oxygen species are produced (i.e., that activated oxygen species are only 23 generated when they can immediately react with an appropriate substrate). Methane monooxygenase has a regulatory component that forms a specific complex with the reduced hydroxylase. This complex works as a gate to regulate O2 accessibility to the enzyme to ensure a coupled reaction (Liu et al, 1995; Wallar et al, 1996). Cytochromes P-450 achieve the same goal by controlling electron transfer. After substrate binding, the heme's redox potential increases to facilitate the acceptance of the first electron. Then a putidaredoxin-hydroxylase complex forms to ensure a rapid second electron transfer and substrate turnover after O2 binding (Lipscomb et al., 1976). Ring-hydroxylating dioxygenases utilize substrate binding and Rieske cluster reduction as the C^-binding and the oxygen-activating switch to effectively regulate the coupling of NADH consumption to aromatic substrate hydroxylation. Uncoupling can nevertheless occur when a poor substrate, or substrate analogue binds to the active site well enough to mimic the electronic and steric changes induced by a good substrate, but cannot react with the activated oxygen species. In this case, the resultant activated oxygen species slowly decays to hydrogen peroxide or water (Figure 12). For example, benzene causes uncoupling in NDO (Lee, 1999a) and certain PCB congeners cause uncoupling in BPDO (Imbeault et al. 2000). In both cases, uncoupling leads to H2O2 production. Such uncoupling is better understood in cytochrome P-450cam, in which camphene, an analogue of camphor, uncouples oxygen activation and substrate oxidation. In this case, uncoupling seems to be due to the lack of a key hydrogen bond between the enzyme and the camphene. As a result, the latter is highly mobile in the active site despite the similar overall shape and size of camphene and camphor. This mobility appears to allow the entry of solvent into the active site, which acts as a source of protons that could facilitate O2 dissociation as hydrogen peroxide and/or O2 cleavage and reduction to water (Raag et al, 1991). Mutations of active site residues can also lead 24 to uncoupling in oxygenases, through distortion of the 02-binding site and/or increasing accessibility of the active site to solvent. 1.4.3.2 Steady-state kinetics According to the established catalytic cycle of NDO and BADO (see Figure 11), binding of the aromatic substrate precedes that of O2, and both substrates must be bound in order for dihydroxylation to occur. Thus, with respect to these two substrates, the enzyme utilizes a compulsory order ternary complex mechanism. E + A + 0 2 ^ ^ EA + 0 2 ^ ^ E A 0 2 > E + P Equation 1 The steady-state rate equation derived from this mechanism is given in Equation 2 (Cleland, 1963). ME][A][Q2] r . „ V = Equation 2 KDAKM(H + £ m A [ 0 2 ] + KM0JA] + [A][0 2] In this equation, ^mA represents the KM for the aromatic substrate; ^ m 0 2 ' t n e f ° r O2; and K ^ A , the dissociation constant for the aromatic substrate. These parameters, along with kcat, are effective parameters as they are dependent on the concentration of electron transfer components in the assay. When the concentration of either the aromatic substrate or 0 2 is held constant, Equation 2 simplifies to an equation of the same form as the familiar Michaelis-Menten equation. 25 1.4.4 Specificity determinants Due to their importance and potential applications, considerable effort has been focused on identifying the specificity determinants of ring-hydroxylating dioxygenases. Structural studies of NDO (Carredano et al, 2000) and BPDO (Colbert, 2000) indicate that the substrate-binding pocket is contained entirely within the C-terminal region of the ISP a subunit. To functionally evaluate specificity determinants, hybrid ISPs consisting of the a subunit of one enzyme and the p subunit of a related enzyme have been studied. Such experiments on NDO, BPDO, and related enzymes indicate that the a subunit is responsible for substrate preference (Kimura et al, 1997; Parales et al, 1998a and b; Beil et al, 1998; Barriault et al, 2001). Directed mutagenesis and gene shuffling approaches have further indicated that the a subunit harbors the principal determinants of substrate preference (Mondello et al, 1997; Kumamaru et al, 1998; Parales et al, 2000a and b; Barriault et al, 2002; Suenaga et al, 2002). In each of these studies, enzyme function was evaluated solely in terms of substrate preference, in part due to the limited solubility of the substrates. Moreover, this preference was evaluated using whole cell biotransformations. Interestingly, some studies using purified hybrid ISPs indicate that the p subunit can influence the substrate preference (Hurtubise et al, 1998; Maeda et al, 2001). This is consistent with the fact that residues of the P subunit contribute to the second shell of the substrate-binding pocket of NDO and BPDO (Carredano et al, 2000; Colbert, 2000). Similar studies performed with purified dioxygenases that utilize soluble substrates would enable a much more careful evaluation of the structural determinants of substrate specificity. 1.4.5 Benzoate dioxygenase B A D O A D P I of Acinetobacter calcoaceticus ADP1 is a Group II enzyme that catalyzes the dihydroxylation of benzoate to cz's-l,6-dihydroxy-2,4-cyclohexadiene-l-26 carboxylic acid (Figure 13; Reiner 1971a and b). The a and (3 subunits of the B A D O A D P I oxygenase are encoded by benAB. RED, which contains FAD and a plant-type [2Fe-2S] cluster, is encoded by benC. In A. calcoaceticus ADP1, the ben genes are chromosomal. The substrate specificity of B A D O A D P I has not been reported. However, the enzyme appears to have a relatively narrow substrate range, transforming meta and para substituted benzoates poorly (Murray et al., 1972; Reineke et al, 1978a, Yamaguchi et al, 1980). 1.4.6 Toluate dioxygenase TADO of Pseudomonas putida mt-2 (TADOMT2, Figure 13) is involved in the degradation of xylenes and substituted toluenes (Feist et al, 1969; Nakazawa et al, 1973; Williams et al, 1974). Besides hydroxylating m-toluate (3-methyl benzoate), this enzyme also catalyses the dihydroxylation of a range of meta and para substituted benzoates (Zeyer et al, 1985). The a and P subunits of the TADOM T2 ISP are encoded by xylX and xylY, respectively. The RED is encoded by xylZ. The ISP of TADOM T2 shares 63% sequence identity with the ISP of B A D O A D P I -27 Figure 13. The reaction catalyzed by toluate (R=CH3, R'=H) and benzoate (R=R'=H) dioxygenases. TADO and BADO are encoded by xylXYZ and benABC, respectively. The xyl genes are carried on the TOL plasmid pWWO and are arranged in two structural operons (Williams et al, 191 A, Worsey et al, 1975). The upper operon encodes enzymes that transform substituted toluenes to benzoates. The meta operon encodes enzymes, including TADOM T2, that transform meta and para substituted benzoates to intermediates of the TCA cycle (Figure 14). The upper operon is under the control of the Pu promoter that is positively regulated by the XylR transcriptional activator in the presence of substituted toluenes. The meta operon, including xylXYZ, is under the control of the Pm promotor that is positively regulated by the XylS in the presence of substituted benzoates (Figure 14, Mermod et al, 1987). TADOM T2 has been used to engineer improved pollutant-degrading capabilities in a microorganism (Rojo et al, 1987). 28 C H . COOH Q - O -1 I f f Pu) xylCMABN PnT> xylXYZ LTEGFJQKIH xylS <^  Ps P r ^ xylR upper operon meta operon Figure 14. The upper and meta operons of the TOL plasmid pWWO of Pseudomonas putida mt-2 and their regulation. The xyl genes are responsible for the catabolism of toluene and xylenes. Genes of upper operon, xylCMABN, are under the control of the Pu promoter, and encode enzymes that transform toluenes to benzoates. Genes of the lower operon, xylXYZLTEGFJQKIH, are under the control of the Pm promoter, and encode enzymes that transform benzoates to TCA cycle intermediates. The xylR and xylS genes encode positive transcriptional regulators of the upper and meta operons, respectively. The effectors of XylS and XylR are depicted. Adapted from Reineke, 1998; Mermod et al., 1987;Harayamaefa/., 1990. 1.5 Aryl c/s-diol dehydrogenases The dihydroxylation of many monocyclic aromatic compounds gives rise to cis-1,2-diol cyclohexadienes. These cw-diols are transformed to catechols in an NAD + -dependent fashion by aryl cz's-diol dehydrogenases (Figure 15). In some catabolic pathways, the initial dihydroxylation reaction yields an unstable cz's-diol which is non-enzymatically transformed to a catechol. For example, the dihydroxylation of 2-chlorobenzoate by 2-HABADO yields a cw-diol that is non-enzymatically transformed to catechol via loss of chlorine and carbon dioxide (Fetzner et al, 1992). In such pathways, no aryl c/s-diol dehydrogenase is required. The aryl cz's-diol dehydrogenases involved in the catabolism of toluates and biphenyl are cz's-l,2-dihydroxy-3-methylcyclohexa-3,5-dienecarboxylate dehydrogenase 29 (XylL, E.C. 1.3.1.59) and cz's-2,3-dihydro-2,3-dihydroxybiphenyl dehydrogenase (BphB, E.C. 1.3.1.56), respectively. XylL of the TOL meta pathway of P. putida mt-2 (XylLm t2, Harayama et al, 1984) catalyzes the dehydrogenation and concomitant decarboxylation of benzoate cz's-diols to form the corresponding catechol (Figure 15). XylLmt2 has been reported to catalyze the demethylation of toluene 2,3-dihydrodiol in the presence of adenosylcobalamin (3-methyl-4,5-cyclohexadiene-cz.s-1,2-diol; Lee, et al, 1999b). cw-diol catechol Figure 15. Dehydrogenation catalyzed by XylLm t2 and BphBLB4oo- The depicted cz's-diols are generated by ring-hydroxylating dioxygenases (see Figure 2). cz'5-2,3-Dihydro-2,3-dihydroxybiphenyl dehydrogenase (E.C. 1.3.1.56), the counterpart of XylLm t2 in the biphenyl degradation pathway, catalyzes the dehydrogenation of biphenyl and chlorinated biphenyl cz's-diols to the corresponding 2,3-dihydroxybiphenyl. The crystal structure of BphB from Burkholderia sp. LB400 (BphBLB4oo) has been determined to 2.0 A (Hulsmeyer et al, 1998). This enzyme is a tetramer of 28 kDa that shares 23% sequence identity with XylLm t2. Whole cell studies showed that BphBLB4oo transforms a broad range of chlorinated biphenyl czs-diols (Abramowicz, 1990). 30 One widely accepted characteristic of aryl cw-diol dehydrogenases is that they have broad substrate specificities and thus apparently do not limit the carbon source utilized by a particular pathway. For example, a chlorobenzene dihydrodiol dehydrogenase (TcbB) from Pseudomonas sp. strain P51 expressed in E. coli transforms the c/s-diols of 1,2-dichlorobenzene, biphenyl, and toluene to the corresponding catechols (Werlen et al, 1996). Moreover, in the transformation of chlorinated biphenyls by different bph pathways, no significant quantities of cz's-diols were observed to accumulate (Furukawa et al, 1979; Seeger et al, 1995, 1999). Interestingly, a plasmid that contains the genes encoding 7 different ring-hydroxylating dioxygenases contains only two genes that encode aryl cz's-diol dehydrogenases (Romine et al, 1999). This suggests that these 2 dehydrogenases transform the reaction products of the seven dioxygenases, although it is possible that additional dehydrogenases are chromosomally encoded. Finally, BedDML2 transforms glycerol and.l,2-propanediol in addition to benzene cz's-diol (Fong et al, 1996). Despite statements concerning the relaxed substrate specificity of aryl cz's-diol dehydrogenases, the only study that actually reports the substrate specificities of these enzymes is that of Barriault et al. (1999). These researchers demonstrated that BphBB356 of C. testosteroni B-356 and NahBo7 of P. putida G7, which share 35.5% sequence identity, both have higher specificity constants for biphenyl 2,3-diol than for naphthalene 1,2-diol. Other than these data, there are essentially no reports on the substrate specificity of aryl cz's-diol dehydrogenases. 1.5.1 The classification of aryl cw-diol dehydrogenases Most of the bacterial aryl cz's-diol dehydrogenases characterized to date, including XylLmt2 and BphBLB4oo5 belong to the short-chain dehydrogenase/reductase (SDR) superfamily. The family consists of more than 2000 identified enzymes which utilize NAD(P)+ as a cofactor and act on a variety of substrates, including steroids, alcohols, sugars and aromatic compounds. SDR enzymes are the second of three evolutionarily 31 distinct types of polyol dehydrogenases, the type I and III enzymes being "medium-chain" and "iron-containing" alcohol dehydrogenases, respectively (Ruzheinikov et al, 2001). These enzymes are ubiquitously distributed in humans, animals, plant, and microorganisms (Jornvall et al., 1995, 1999; Kallberg et al., 2002). Members of the SDR superfamily typically have 250 amino acid residues, and are thus shorter than medium-chain dehydrogenases, which usually have more than 350 amino acid residues. The SDR family is highly divergent with only 15-30% sequence identity in most cases. Bacterial aryl cw-diol dehydrogenases appear to belong to a single subgroup of the SDR superfamily. A phylogenetic study using 14 sequences indicates that the bacterial enzymes cluster according to their substrate within this subgroup (Figure 16, Sylvestre et al., 1996a; Barriault et al, 1999). BenD XylL PahB-C1S PahB-0USB2 BphB-KFm BphB-LB400 , | I- Bph8-KF71S BphB-B3S6 BphB-KKSIO! BphB-PB BpdD-MS TcbB TorfD BpbB-RHAI € Figure 16. Phylogenetic tree of 14 bacterial aryl cis-diol dehydrogenases. BenD, from Alcaligenes calcoaceticus; XylL, P. putida mt-2; PahB-C18, Pseudomonas sp. strain CI8; PahB-OUS82, P. putida OUS82; BphB-KF707, P. pseudoalcaligenes KF707; BphB-LB400, Burkholderia sp. LB400; BphB-KF715, P. putida KF715; BphB-B356, C. testosteroni B-356; BphB-KKS102, Pseudomonas sp. strain KKS102; BphB-P6, R. globerulus P6; BpdD-M5, Rhodococcus sp. strain M5; TcbB, Pseudomonas sp. strain P51; TodD, P. putida F l ; BphB-RHAl, Rhodococcus sp. strain RHA1 (Sylvestre et al, 1996a). 32 Despite the low primary sequence identity within the SDR family, an N-terminal nucleotide-binding motif and a catalytic triad S-X] i_ i 2 -YXXXK motif are characteristic of all family members (Jornvall et al, 1995; Vedadi, et al, 2000) (Figure 17). The nucleotide binding N-terminal motif comprises the putative glycine-rich fingerprint GXXXGXG, which interacts with the pyrophosphate of the bound dinucleotide (Wierenga et al, 1983). A negatively charged aspartic acid downstream of the nucleotide binding motif hydrogen bonds to the 2'-hydroxyl of the adenine ribose of NAD + . This aspartate accounts for the preference of these dehydrogenases for NAD + , as the negatively charged side chain repels the phosphate group of NADP+(Fan et al, 1991). XylL m!2 M N K R f Q G K V A V " : 0 « " Q • I Q R V A E HlM A M a M G R L L L V f l R C I . . . [=§L I H E & A D E L Bpli3 LB400 M K L K Q E A V L •BHGOISH I . S i A L V Oii lF V d . ? f « j A K V A V L I S K E I . . . A l i H L A B H E T D H TnOasIT M E E S K V S M M N C N N E G R W S l K G T T A L V T Q G S K 0 I M Y A l V E E L A G L G A R V Y T C S R N E K E L D E C L E I W R E K DM1 Ral M K K Y L L P V L V L C L G Y Y Y S T N E E F R P E M L Q G K K V I V T HA S K Q I MR E M A Y H L S K M G A H V V L T A R S E E G L Q K V V S R C L E L dh«1 Hum M A R T V V L I T EjC S S Q I H L H L A V R L A S D P S Q S F K V Y A T L R D L K T Q G R L W E A A 60 70 60 80 100 110 120 XylL m!2 V G V A E Q Q T L T AKjL E Q F A E C Q R V M A A A L E Q Q Q . . R L pl l W l H t l V p l . . G i l l W A K P F f jH Y Q E R E I E A E V R R S L F P ' . W C BphB„LB400 G . . D N O B G I V GEIV R S L E D Q K Q A A S R C V A Q U E ] . . K I 0 T tSBP B1A Ell WD Y S U A L V D L P t l E S L D A A F D E V F H I N V K G v HA Tr1_Das1r G . . L N V E G S V C D L L S R T E R D K L M Q T V A H V F D G . K L N I L V N N A G V V I H K E A K D F T E K D Y N I I M G T N F E A A Y H L Dh11Ral G - A A S A H Y I A G T M E D M A F A E R F V V E A G K L L G . . G L D M L I L N H I T Q T T M S L F H D D I H S V R R S M E V N F L S Y V V L dhesllHum R A L A C P P G S L E T L Q L D V R D S K S V A A A R E R V T E G R V D V L V C N A G L G L L G P L E A L G E D A V A S V L D V N V V G T V R M 130 140 * 150 160 170 160 190 XylL m!2 C H H A HA P M I E Q G S PlA I V N V S H V EST R G I H R . . V PQQCX333 G V N A H|T A C Q D a Q T A E H . . G I 0QE1A T A P G E T E A R H GpjF R BphB_LE4O0 V K H C t S P A L V A S R . 6JN V I F T I HNUS F Y P N G G G P L QT U t l j H A I V GU|v R E B C D Q L A P Y V UKSilG V G S E t J l NSDLR = S Tr1 Dasf S O I A Y P L L K A S Q N G N V I F L S 3 A G F S A L P S V S L Q s T s Q G A l N Q M T K S L A C E W A K D . . Nl R V N S V A P G V I L T P L V E T A DM 1_Rat S T A A L P M L K O S N . G S I A l I S HM A G K M T Q P L I A S Q s A S H F A L D G F F S T I R K E H L M T K V N V S I T L C V L G F I D T E T A L K E dhos1_Hum L Q A F L P D M K R R G S G R V L V T G B « G G L MG L P F N D V Q C A SDF A L E G L C E S L A Y L L L P . . F G V H L S L I E C G P V H T A F U E K V 200 210 220 230 240 XylL m!2 N S A E P f JE Q E K V WY Q Q I V Q O S L D S S L M K C l Y G S I D H Q V E A I L | L E ! S D AM Bpdff LB400 S L G M G Q . . K A I 8 T V P L A Q M L K S V L F G Q U P E . V E H Y T G A Y V H I F E I T R O . . . . D O TrlOaslr I K K N P H Q K E E I D N F I V K T P M Q R A G K P Q E V S A L I A F L C F P A A DM 1 Rat T S G I I L S Q A A P K Q E C A L E I K G T V L R K D E V Y Y D K S S W T P L L L G N P . . . . GR dhasr Hum L G S P E E V L D R T D I H T F H R F Y Q Y L A H S K Q V F R E A A Q N P E E V A E V F L T A L R A P K P T L R Y F T T E R F L P L L R M R L D D P S G S 250 260 XylL ml2 S Y I 001 TD|P V AEJEJD . HEJC Q S C S V M F S V S G BphB LB400 A P A O E j A L BIN Y D E K l . G K l V R Q F F S G A G G N D L L E Q L N I HP Tr1_Dastr S Y I T G • I I WA D G G . . F T A N G G F DM 1_Ra1 R l M E F L S L R S Y N R D . L F V S N dh8Sl_Hum N Y V T A M H R E V F G D V P A K A E A G A E A G G G A G P G A E O E A G R S A V G D P E L G D P P A A P Q . . . Figure 17. Sequence alignment of five SDR members. XylL_mt2, toluate cis-dihydrodiol dehydrogenase from Pseudomonas putida mt-2. BphB_LB400, biphenyl cis-dihydrodiol dehydrogenase from Burkholderia sp. LB400. Trl_Dastr, tropine dehydrogenase from Datura stramonium (jimsonweed gi : 1717752). Dhl lRat , corticosteroid 11-P-dehydrogenase from Rattus norvegicus (Norway rat, gi :203350). DheslHum, estradiol 17P-dehydrogenase type 1 from human (gi :65913) Identical residues in XylL and BphB are coloured gray. Nucleotide binding residues and the catalytic residues, Ser, Tyr and Lys, are coloured black. This alignment was obtained by CLUSTAL X and visualized by ALSCRIPT 1.8. Several aryl c/s-diol dehydrogenases do not seem to belong to the SDR superfamily. Thus, cz's-l,2-dihydroxycyclohexa-3,5-diene (benzene 1,2-dihydrodiol) 3 3 dehydrogenase from Pseudomonas putida ML2 (BedDMu) was classified as both a medium-chain and type III alcohol dehydrogenase based on the similarity of its sequence to that of glycerol dehydrogenase (GlyDH), even though no iron-binding motif could be identified and the Tyr and Lys residues characteristic of SDR enzymes were noted (Fong et al, 1996). Moreover, a group of three enzymes including l-carboxy-3-chloro-3,4-cz,s-dihydroxycyclohexa-l,5-diene dehydrogenase (CbaCctest) from Comamonas testosteroni (Nakatsu et al, 1997), and two l,6-dicarboxy-3,4-c/s-dihydroxycyclohexa-l,5-diene (phthalate 4,5-dihydrodiol) dehydrogenases (Pht4 and OphB; Nomura et al, 1992, Chang et al, 1998) have been classified as SDR enzymes even though they share very little sequence identity with the latter (Chang et al, 1998). Given the apparent confusion in the classification of aryl cz's-diol dehydrogenases, a re-examination of the phylogenetic relationships of these enzymes is warranted. 1.5.2 The Three-dimensional Structure of BphBLB4oo BphBLB400 is a tetramer of identical subunits. It is typical of the SDR superfamily in that it is a single domain enzyme consisting of a seven-stranded parallel p-sheet and eight a helices (Htilsmeyer et al, 1998). The core P-sheet is sandwiched by two arrays of three oc-helices: one array on each side of the sheet. The other two oc-helices, together with a nearby mobile loop, are believed to form the substrate binding site. The Rossmann-fold element for coenzyme-binding is found in the N-terminus of the enzyme, whereas the substrate-binding pocket and the catalytic triad of Serl42, Tyrl55 and Lys 159 are located in the C-terminus (Figure 17). A superposition of the active sites of available SDR structures yields an average RMS deviation of only 0.48 A for the triad residues (Persson et al, 1991; Jornvall et al, 1995). Docking experiments involving computer imaging indicate that the substrate of BphBLB400> cw-(2R,3S)-dihydroxy-l-phenyl-cyclonexa-4,6-diene (biphenyl 2,3-dihydro-34 diol), binds in a deep hydrophobic cleft, 12 A below the surface of the enzyme, such that the polar ring of the substrate lies between the nicotinamide moiety of the N A D + and the side chain of Trp90. Indeed, these three rings adopt a nearly staggered arrangement. In the docked complex, the closest contact between BphBLB4oo and biphenyl 2,3-dihydrodiol occurs between the CE2 of Trp90 and C6 of diol. The hydride-accepting carbon of NAD + is 3.3 A from hydride donor, C3 of biphenyl 2,3-dihydrodiol. One of the major specificity determinants of BphBLB4oo is thought to be Asnl43, which hydrogen bonds to the substrate 02 hydroxyl (3.2 A). Asnl43 is conserved in other aryl c/s-diol dehydrogenases that use biphenyl-, phenyl-, and toluene derivates as substrates, but not in those using benzoate and naphthalene czs-diol as substrate. 1.5.3 Catalytic mechanism The proposed catalytic mechanism utilized by BphBLB4oo consists of essentially two steps (Figure 18; Hiilsmeyer et al, 1998): abstraction of a hydride from C3 of biphenyl 2,3-dihydrodiol and rearomatization of the diol to a catechol. The first step is initiated by the deprotonation of the 3-hydroxyl group of the biphenyl 2,3-dihydrodiol. The catalytic base in this deprotonation is probably Tyrl55 of the catalytic triad, which is probably deprotonated at pH 9.5, the optimal pH of aryl cw-diol dehydrogenase (Rogers et al, 1977; Sylvestre et al, 1996a). Deprotonation of the C3 hydroxyl facilitates abstraction of the hydride at C3, which is accepted by NAD + . The resulting species undergoes a non-enzymatic tautomerization to rearomatize the ring to yield a catechol. Conserved Serl42 is predicted to form a second hydrogen bond to the 3-hydroxyl group, stabilizing the complex. The conserved Lysl59 probably does not participate directly in the catalytic cycle. Lysl59 forms a bifurcated hydrogen bond to the 2'- and 3'-hydroxyl groups of the nicotinamide ribose. Lysl59 could facilitate the 35 BPDO H O-Tyr,, •OH s^,^ —o H "°-Tyri55 N NAD I Ph OH keto-enol tautomerism OH V NAD I -NAD(H) Ph H r ^ ^ - O H H-0 -Tyr 1 5 5 Figure 18. Proposed cz's-diol dehydrogenation mechanism in BphBLB4oo (Hulsmeyer et al, 1998) deprotonation of Tyrl55 and promote its catalytic role by polarizing it, lowering the pKa of its phenolic hydroxyl group through an electrostatic interaction because N-Lysl59 and 0-Tyrl55 are too far away (4.3 A) to form hydrogen bonds (Hulsmeyer et al, 1998). Trp90 may constrain the substrate to adopt a planar conformation, thereby promoting catalysis. 1.6 Aim of this study The overall objective of this doctoral research project was to investigate the specificity, and the structural determinants, of two classes of important enzymes involved in the aerobic catabolism of aromatic compounds: ring-hydroxylating dioxygenases and aryl cz's-diol dehydrogenases. TADOm t2 and B A D O A D P I , which preferentially transform m-toluate and benzoate, respectively, were studied as representatives of ring-36 hydroxylating dioxygenases. All the components of each enzyme were expressed using the native transcriptional regulatory machinery of the structural genes, and were purified anaerobically in highly active form. An oxygraph assay was used to investigate the specificity of TADOM T2, B A D O A D P I and the steady-state utilization of O2 in the presence of different substrates. Hybrid ISPs consisting of the a subunit of one enzyme and the P subunit of the other were expressed and purified, and their respective specificities for a range of substituted benzoates were compared to those of the parent enzymes. The coupling of substrate utilization in the hybrid enzymes was also investigated. Subsequently, the transformation products of these benzoates were identified. The contributions of the different subunits to the activities of these enzymes are discussed. XylLM T2 and BphBLB4oo, which preferentially transform m-toluate 1,2-diol and biphenyl 2,3-dihydrodiol, respectively, were studied as representatives of aryl cz's-diol dehydrogenases. Each enzyme was heterologously expressed and purified to apparent homogeneity. A spectrophotometric assay was used to investigate the specificity of XylL M T 2 and BphBLB4oo for each of 4 c/s-diols: benzoate 1,2-diol, m-toluate 1,2-diol, toluene 2,3-dihydrodiol and biphenyl 2,3-dihydrodiol. A comprehensive phylogenetic analysis of the aryl cis-diol dehydrogenases was conducted. The determined specificities are discussed with respect to the metabolic role of each enzyme, the crystallographic structure of BphBLB400, and the phylogenetic relationship of aryl cw-diol dehydrogenases. Finally, XylL M T 2 was crystallized and preliminary X-ray diffraction data were analyzed. 37 2. MATERIALS AND METHODS 2.1 Reagents The following reagents were from Sigma-Aldrich (purity in parentheses): benzoate (99.5%), o-toluate (99.5%), m-toluate (99%), p-toluate (98%), 2-C1 benzoate (98%), 3-C1 benzoate (99%), 4-C1 benzoate (97%), catechol, 3-methyl catechol, 4-methyl catechol, bicine, NAD + , biphenyl, toluene, and catalase. DHB and 3-C1 catechol were gifts from Prof. Victor Snieckus. Restriction enzymes, T4 ligase and chromatography resins were from Amersham Biosciences. Pful DNA polymerase was from Stratagene. Nickel-NTA Superflow resin was purchased from Qiagen. Other resins were purchased from Amersham Biosciences. Oligonucleotides were purchased from Invitrogen Life Technologies. Crystallization screen kits Crystal Screen and Crystal Screen 2 were from Hampton Research (Laguna Niguel, CA, 92677-3913 USA). Crystallization screen kits Wizard I and Wizard II were from Emerald BioStructure (Bainbridge Island, WA 98110 USA). Al l other chemicals were of analytical grade. Buffers were prepared using water purified on a Barnstead NANOpure UV apparatus to a resistance of greater than 17 MQcnf 1. 2.2 Bacterial strains, media and growth conditions Strains and plasmids used are listed in Table 1. Escherichia coli and P. putida strains were grown at 37°C and 30°C, respectively. Strains used in the propagation of DNA and in the expression of non metal-containing enzymes were grown in Luria-Bertani broth (Bertani 1951). Strains used in the expression of metal-containing enzymes were grown in Terrific Broth (Ausubel et al, 2000) supplemented at 10 mL/1 with a HC1-solubilized mineral solution (Markus et al., 1986; Vaillancourt et al., 1998). For protein expression, one liter of media in a 2-liter flask was inoculated with 10 mL of an overnight culture. Media were supplemented with ampicillin 100 |ag/mL, piperacillin 25 |J.g/mL, 38 rifampicin 20 (ig/mL, streptomycin 50 ug/mL, kanamycin 25 ng/mL, anaVor 10 ug/mL tetracycline, as appropriate. Each of the four ISPs (OCTPT, CCBPB, OCBPT, and CCTPB) were expressed in strain P. putida CL01 containing pVLTXYZl , pVLTABl , pVLTAYl and pJBXBl, respectively. When the culture reached an OD6oo of 0.6, isopropyl-l-thio-P-D-galactopyranoside Table 1. Strains and plasmids used in this thesis Strain or plasmid Relevant genotype/properties Reference E. coli DH5a supEAA A/acU169((p80/acZAM15) hsdRM recAl endAX gyrA96 thi-l reiki Hanahan 1983 E. co/z GJ1158 T7 RNAP under the control of proU Bhandari 1997 E. coli S17-l/lpzV X pir lysogen, Smr de Lorenzo 1993 a E. coli BL21(DE3)pLysS T7 RNAP produced from A,-lysogen DE3 under the control of Puvs, containing pLysS Stratagene E. coli JM101 supE thi A(lac-proAB) F' traD36 ProAB lacPZAM15 Yanisch-Perron 1985 E. coli C41(DE3) A mutant of E. coli BL21(DE3) for protein expression. Miroux 1996 P. putida KT2442 prototrophic, hsdR, R i f Herrero 1990 P. putida CL01 P. putida KT2442 carrying xylS, Rif, Pip r This study Plasmids pPL392 pBR322, carrying the xyl meta operon, Ap r Harayama 1984 pIB1354 pUC19, carrying ben ABC, Ap r Neidle 1987 pJB655 Pm promoter, Ap r Blatny 1997 pT7-7 T7 promoter, ColEl origin, Ap r Tabor 1985 pT7-6a T7 promoter, ColEl origin, carrying bphAEFGLB400, Ap r Hofer 1993 pT7-7a-cam T7 promoter, ColEl origin, carrying bphAEFGCzm.\, Ap r Master 2001 pVLT31 broad-host-range expression vector, Ptac promoter, RSFIOIO-Zaci9, Tcr de Lorenzo 1993 a 39 Table 1. Strains and plasmids used in this thesis (Continue) pCNB5 pLEHP20 pLEBD4 pBKT7-l pEMBL18 pEMRBS pEMXBl pEMAl pEMABl pEMAYl pEMXYZl pBKT7-S pCNB5-S pFVZ8 pFVZl l pJBXBl pVLTABl pVLTAYl pVLTXYZl pVLTCl pVLTZl pT7XYLL pUT mini Tn5 delivery system, Ap r, Km r Phc promoter, his-tag expression vector, Ap r broad-host-range expression vector. lacPlPtrp-lac, carrying bphBC, Tc r T7 promoter, Ap r P\ac promoter, Ap r pEMBL18 carrying Pm promoter, Ap r Piac promoter, pEMBL18 carrying xylXbenB, Ap r Pm promoter, E. coli. RBS carrying first part of ben A, Ap r Pm promoter, E. coli. RBS carrying benAB, A./ Pm promoter, E. coli. RBS carrying benAxylY, Ap r pEMBL18 carrying xylXYZ, Ap r T7 promoter, pBKT7-l carrying xylS, Ap r pCNB5 carrying xylS, Ap r, Km r pLEHP20 carrying xylZ with his-tag, Ap r pT7-7 carrying xylZ with his-tag, Ap r Pm promoter, Ap r carrying xylX and benB Piac promoter, Tcr carrying benAB Piac promoter, Tc r carrying ben A and xylY pVLT31 carrying xylXYZ, Tcr Ptac, pVLT31 carrying benC with his-tag, Tc r pVLT31 carrying xylZ with his-tag, Tc r T7 promoter, ColEl origin, carrying xylL, A / de Lorenzo 1993b Etlis 1994 de Lorenzo 1993a Kessler 1994 Dente 1987 Vaillancourt & Eltis' unpublished This study This study This study This study This study This study This study This study This study This study This study This study This study This work This study This study 40 Ap r, ampicillin resistance; Km r, Kanamycin resistance; Pipr, piperacillin resistance; Rif, rifampin resistance; Smr, streptomycin resistance; Tcr, tetracycline resistance (IPTG) and /w-toluate were added to final respective concentrations of 0.1 mM and 1 mM. This amount of m-toluate was added a second time three hours after the initial induction. R E D T A D O and R E D B A D O were expressed under similar conditions using P. putida KT2442 containing pVLTZl and pVLTCl, respectively. When the culture reached an OD6oo of 0.6, IPTG was added to final concentration of 0.5 mM. The cultures were incubated for an additional 20 h before harvesting. Cell pellets were frozen at -80°C until further use. X y l L m t 2 was expressed in strain E. coli GJ1158 containing pT7XYLL. XylL m t 2 expression was induced when the culture reached an O D 6 0 0 of 0.6 by adding NaCl to a final concentration of 0.3 M . BphBLB400 was expressed in P. putida KT2442 containing pLEBD4 (De Lorenzo et al., 1993a). BphBLB4oo expression was induced when the culture reached an O D 6 0 0 of 0.6 by adding IPTG to a final concentration of 0.5 mM. The culture was incubated for an additional 20 h before harvesting. To synthesize cz's-diols, E. coli strains containing the appropriate ring-hydroxylating dioxygenase were grown at 37°C in 1 L Luria-Bertani broth. When the culture reached an OD6oo of 0.6, IPTG was added to a concentration of 0.5 mM to induce dioxygenase expression, and the cultures were incubated for a further 3 hours. The cells were harvested by centrifugation and used immediately. 2.3 Molecular biology techniques 2.3.1 General DNA was purified, digested and ligated using standard protocols (Sambrook et al., 1989). Conjugal mating was performed using established protocols (Simon et al., 1983). PCR amplification was performed using a Thermolyne Model DB66P25 41 thermocycler (Barnstead, San Diego, CA). The nucleotide sequences of cloned PCR products were verified using an ABI model 373 Stretch DNA sequencer at the Nucleic Acid Analysis Units of the University of British Columbia and Universite Laval. Sequencing reactions were performed according to the ABI dye-deoxy terminator protocol. 2.3.2 Cell transformation Competent cells were prepared using modified GYT media (10% glycerol, 0.125%o yeast extract and 0.25% tryptone; Tung et al, 1995). Cells were transformed with plasmids via electroporation using a Gene Pulser Transfection Apparatus and Pulse Controller (Bio-Rad, Hercules, CA) according to the instructions of the manufacturer. 2.3.3 Site-directed mutagenesis Oligonucleotide-directed mutagenesis was performed using a strategy based on the elimination of a restriction site (Deng et al, 1992) or using overlap extension PCR (Sarkar 1990). In both cases, derivatives of pEMBL18 served as the template DNA. The sequences of site-directed mutants were confirmed as described above. 2.4 General handling of proteins Protein samples were kept on ice unless otherwise specified. Anaerobic protein samples were handled in a glovebox maintained at less than 2 ppm O2 or in stoppered glass vials flushed with argon. Buffers for anaerobic procedures were filtered, bubbled vigorously with argon for 20 minutes, then equilibrated in the glovebox for 24 h prior to use. Protein-containing samples were concentrated by ultrafiltration using an Amicon stirred cell equipped with a YM10 filter (Millipore, Nepean, Ontario). Small samples of protein were exchanged into appropriate buffers by passage over a 1 x 8 cm column of Bio-gel P-6 DG (Bio-Rad) equilibrated with the said buffer. 42 2.5 Protein purification Cell pellets were resuspended in buffer containing 0.01 mg/niL DNase (Boehringer Mannheim) and disrupted by a single passage through a French Press (Aminco) at an operating pressure of 18,000 p.s.i. The cell debris was removed by ultracentrifugation at 170,000 x g for 75 min. The clear supernatant fluid was filtered through a 0.45 um filter. High resolution chromatographic techniques were performed using an AKTA Explorer (Amersham Biosciences). 2.5.1 Toluate, benzoate and hybrid dioxygenase ISPs Dioxygenase components were purified anaerobically. Accordingly, the supernatants were transferred to a glovebox after filtering, and all subsequent procedures were performed anaerobically as described previously (Vaillancourt et al., 1998). In purifying ISPs, buffer A was 25 mM HEPES, pH 7.3 and contained 10% glycerol, 0.25 mM Fe(NH4)2(S04)2, and 2 mM DTT to maximize the specific activity of the preparation. Column eluates were monitored at 280, 323 and 455 nm. The supernatant, prepared from 24 g of cells resuspended in 30 mL of 25 mM HEPES, pH 7.3, 10% glycerol, was divided into two portions, each of which was loaded onto a 2 x 9 cm column of Source Q anion-exchange resin equilibrated with buffer A and operated at a flow rate of 20 mL/min. The ISP was eluted using a linear gradient of 0.2 to 0.4 M NaCl in 20 column volumes of buffer A. Brown colored ISP-containing fractions, which eluted at approximately 0.3 M NaCl, were pooled and concentrated to 2.0 mL. The sample was loaded onto a Superdex 200HR 26/60 column equilibrated with buffer A containing 0.15 M NaCl and operated at a flow rate of 2 mL/min. ISP-containing fractions were pooled and concentrated. This sample was combined with two volumes of buffer A containing 2 M ammonium sulfate, filtered, and loaded onto a Phenyl-Sepharose column (1x9 cm) equilibrated with buffer A containing 1.26 M ammonium sulfate. ISP 43 was eluted using a linear gradient of 1.26 to 0 M ammonium sulfate in 10 column volumes. Oxygenase-containing fractions, which eluted at 0.6 M ammonium sulfate, were pooled, concentrated and exchanged into buffer A using ultrafiltration. Preparations of purified protein were flash frozen in liquid nitrogen as beads and stored at -80°C until further use. Protein stored in this manner exhibited no loss of activity over six months. 2.5.2 Toluate and benzoate dioxygenase REDs R E D T A D O and R E D B A D O were purified anaerobically (see beginning of section 2.5.1) as His-tagged (ht-) proteins in a single step using immobilized metal affinity chromatography (IMAC). Columns of Nickel-NTA resin were prepared using glass wool-plugged Pasteur pipettes. The volume of resin utilized was calculated to minimize the non-specific binding of other proteins. The resin was equilibrated with 20 mM MOPS, pH 8.0, 300 mM NaCl. The supernatant, prepared from 20 g of cell resuspended in 30 mL of 20 mM MOPS, pH 8.0, 300 mM NaCl was loaded onto the column. The column was washed with the same buffer containing 20 mM imidazole to remove non-specifically bound proteins. The reductase was eluted with buffer containing 150 mM imidazole. H t - R E D was concentrated and exchanged into his-tag cleavage buffer (50 mM Tris, pH 8.0 containing 100 mM NaCl and 1 mM CaCh) using ultrafiltration. In some samples, the his-tag was proteolytically removed using Factor Xa (Heamatologic Technologies Inc. Essex Junction, Vermont) at a 50:1 ratio (weight:weight) for 24 hours. 2.5.3 Aryl m-diol dehydrogenases Dehydrogenases were purified aerobically. Buffer B was 25 mM HEPES, pH 7.3 containing 10% glycerol. Chromatographic procedures were performed using an AKTA Explorer (Amersham Biosciences) and column eluates were monitored at 280 nm. 44 To purify XylL M T 2, cell pellets from 4 L of culture (~19 g) were resuspended in 30 mL buffer A containing 0.01 mg/mL DNase (Roche) and disrupted by a single passage through a French Press (Aminco) operated at 18,000 p.s.i., 4°C The cell debris was removed by ultracentrifugation at 170,000 x g for 75 min. The clear supernatant fluid was filtered through a 0.45-um filter. The supernatant was divided into two portions, each of which was loaded onto a 2 x 9 cm column of Source Q anion-exchange resin equilibrated with buffer B and operated at a flow rate of 20 mL/min. XylL M T 2 was eluted using a linear gradient 0 to 0.4 M of NaCl in 20 column volumes of buffer B. Dehydrogenase-containing fractions were identified using the colorimetric assay described below. These fractions, which eluted at approximately 0.2 M NaCl, were pooled and concentrated to 2.0 mL. The sample was loaded onto a Superdex 200HR 26/60 column equilibrated with buffer B containing 0.15 M NaCl and operated at a flow rate of 2 mL/min. XylLMT2-containing fractions were pooled and concentrated. This sample was combined with 0.5 volumes of buffer B containing 2 M ammonium sulfate, filtered, and loaded onto a Phenyl-Sepharose column (1x9 cm) equilibrated with buffer B containing 0.67 M ammonium sulfate. XylLM T2 was eluted using a linear gradient of 0.67 to 0 M ammonium sulfate in 10 column volumes. Dehydrogenase-containing fractions, which eluted at 0.2 M ammonium sulfate, were pooled, concentrated and exchanged into buffer A using ultrafiltration. BphBLB4oo was purified using a similar protocol that differed in the following respects. BphBLB4oo eluted from the anion-exchange resin at 0.15 M NaCl. This sample and the phenyl-Sepharose column were equilibrated with buffer B containing 1 M ammonium sulfate. BphBLB400 was loaded onto the column, and eluted using a linear gradient of 1 to 0 M ammonium sulfate in 15 column volumes. Dehydrogenase-containing fractions eluted at 0.3 M ammonium sulfate. 45 2.5.4 Ring-cleavage dioxygenases Catechol 2,3-dioxygenase (C230) and 2,3-dihydroxybiphenyl dioxygenase (DHBD) were purified according to established procedures (Seah et al, 1998; Vaillancourt et al, 1998). 2.6 Protein analysis SDS-PAGE was performed on a Bio-Rad MiniPROTEAN II apparatus and stained with Coomassie Blue according to established procedures (Ausubel et al, 2000). Protein concentrations were determined by the Bradford method (Bradford, 1976) using bovine serum albumin as standard. The concentration of ISPTADO was determined using an extinction coefficient of 83.4 raM"1cm'1 at 323 nm, calculated as described in the Results. 2.7 Determination of Iron and Sulphur Content Iron and sulphur concentrations were determined colourimetrically using Ferene S (Haigler et al, 1990) and N,N-dimethyl-/?-phenylene-diamine (Chen et al, 1977), respectively. Sulphur assays were performed using gas-tight cuvettes. Al l assays were performed in duplicate. The correlation coefficients of the standard curves were at least 0.98. 2.8 Steady-state kinetics 2.8.1 Ring-hydroxylating dioxygenase activity assay The dioxygenase-catalyzed reactions were monitored polarographically following the consumption of O2 using a Clarke-type oxygen electrode (Yellow Springs Instruments Model 5301 (Yellow Springs, OH)) and a thermojacketted Cameron Instrument Co. Model RC1 respiration chamber (Port Aransas, TX) essentially as 46 described previously (Vaillancourt et al., 1998). The oxygen electrode was calibrated using either catechol (0 to 30 uM) and excess C230 or 2,3-dihydroxybiphenyl (0 to 100 (J.M) and excess DHBD. The full scale was established using buffer equilibrated with 5%, 20%, 50% or 100% O2 (see below) according to the experiment. The instrument was zeroed by adding excess sodium hydrosulfite to the assay mixture. The electrode signal was amplified using a Cameron Instrument model OM200 O2 meter and recorded on a microcomputer. Initial velocities were determined from progress curves by analyzing the data using Microsoft Excel (Redmond, WA). Reaction buffers containing different concentrations of dissolved O2 were prepared by vigorously bubbling them with humidified mixtures of O2 and N 2 gases for at least 15 min prior to the experiment as described previously (Vaillancourt et al., 1998). The reaction chamber was flushed continuously with the humidified gas mixture, the equilibrated buffer was transferred to the reaction chamber using a gas-tight syringe, and the stopper was inserted into the reaction chamber. The standard activity assay was performed in a total volume of 1.4 mL of air-saturated 100 mM phosphate buffer, pH 7.0, 25 ± 1°C containing 430 uM NADH and 100 uM of either w-toluate (for TADOM T2) or benzoate (for B A D O A D P I ) - RED was added to a final concentration of 2.0 J J M and the background was recorded. The reaction was initiated by injecting the appropriate ISP to a final concentration of 0.37 uM into the reaction chamber. One unit of enzymatic activity was defined as the quantity of enzyme required to consume 1 umol of 02/min. 2.8.2 Aryl cw-diol dehydrogenase activity assay Dehydrogenase-catalyzed reactions were routinely monitored spectrophotometrically following the formation of NADH at 340 nm using a Varian Cary IE spectrophotometer equipped with a thermojacketed cuvette holder. The 47 spectrophotometer was interfaced to a microcomputer and controlled by Cary WinUV software version 2.00. Mixtures lacking enzyme were used as controls. Data were recorded every 0.1 s. Initial velocities were determined from progress curves by analyzing the data using Cary WinUV Kinetics. The standard activity assay was performed in a total volume of 1 mL of 50 mM Bicine, pH 9.0, 25 + 1°C containing 5 mM of NAD + . For XylL M T 2, the reaction mixture contained 1 mM w-toluate 1,2-diol. For BphBLB4oo, the reaction mixture contained 280 uM biphenyl 2,3-dihydrodiol. The reaction was initiated by adding the aryl cis-diol dehydrogenase to the reaction mixture. One unit of enzymatic activity (U) was defined as the quantity of enzyme required to reduce 1 umol of N A D + per minute. Dehydrogenase activities were also followed by eye during enzyme purification using a coupled assay performed in a 1.5 mL Eppendorf tube. For XylL M T 2, the tube contained 0.1 mL 0.1 M phosphate buffer, pH 7.0, 25 mM w-toluate. To this was added 10 ul of a suspension of P. putida CL01 containing pVLTXYZl . This strain expresses toluate dioxygenase (TADOM T2) and transforms toluate to w-toluate 1,2-diol. To this mixture was added 10 ul of the fraction to be tested for X y l L ^ followed by 1.8 |ag of C230. For BphBLB4oo, the tube contained 0.1 mL 0.1 M phosphate buffer, pH 7.0, 25 mM biphenyl 2,3-dihydrodiol. The assay was initiated by adding 10 ul of the fraction to be tested for BphBLB400 followed by 1 u.g of DHBD. In both cases, the formation of a yellow-coloured ring cleavage product indicated the presence of the cis-diol dehydrogenase. The pH optimum of the enzymes was investigated using the standard activity assay and the following buffers over the indicated ranges of pH: potassium phosphate (pH 6.0 - 8.0), CHES (pH 8.5 - 11), and Bicine buffer (pH 7.5-9.5). Steady-state kinetic parameters were determined using the standard assay conditions described above. In 48 determining the KM values of the dehydrogenases for aryl c/s-diols, the concentration of the cw-diol was varied from 2 to 400 uM. In determining the KM values for NAD + , the concentration of this substrate was varied from 1.25 to 35 mM. 2.8.3 Analysis of steady-state kinetic data Steady-state kinetic data obtained from the ring-hydroxylating dioxygenases were analyzed using equations described in 1.4.3.2. The equations were fitted to the data using the least squares and dynamic weighting options of LEONORA (Cornish-Bowden, 1995). The parameters determined in this study are apparent as they depend on the concentration of RED. For dehydrogenase or for dioxygenase when the concentration of either the aromatic substrate or O2 is held constant, steady-state kinetic data were analyzed using the Michaelis-Menten equation (Equation 3). V m a x [A] v — Equation 3 KMA+[A] The equation was fitted to the data using the least squares and dynamic weighting options of LEONORA (Cornish-Bowden 1995). The parameters determined in this study are apparent as the concentration of N A D + was not high enough to saturate either dehydrogenase. 2.9 Coupling studies Coupling experiments of native and hybrid ISPs were carried out using the same conditions as in the standard activity assay (section 2.8.1) except that the RED, ISP and substrate concentrations were 4 uM, 1.8 (iM, and 215 uM, respectively. Reactions were initiated by adding ISP and quenched by diluting 200 ul of the reaction mixture with 400 49 ul of methanol 3 min after the initiation of the reaction or when O2 consumption stopped. Oxygen consumption was monitored using the O2 electrode. The consumption of aromatic substrate was determined by HPLC measurements. The amount of remaining substrate was determined from the area of the absorbance peak at 280 nm at the respective retention time. Standard curves were obtained from treating the pure substituted benzoate solution in the same way as reaction mixtures at different known concentrations. The amount of hydrogen peroxide was determined by measuring the amount of O2 released upon the addition of 800 U catalase to the reaction mixture at the time corresponding to the methanol quench. Data were corrected for background O2 consumption and H2O2 formation. 2.10 Preparation of aryl c/s-diols Biphenyl 2,3-dihydrodiol was synthesized (Figure 19) from biphenyl using E. coli BL21(DE3)pLysS harboring plasmid pT7-6a expressing the biphenyl dioxygenase (BPDO) of Burkholderia sp. strain LB400 (Hofer et al, 1993). Toluene 2,3-dihydrodiol was synthesized from toluene using E. coli C41(DE3) harboring plasmid pT7-7a-cam expressing the BPDO of Pseudomonas strain Cam-1 (Master et al, 2001). Benzoate 1,2-diol and /n-toluate 1,2-diol were synthesized from benzoate and m-toluate, respectively, using E. coli JM101 harboring plasmid pIB1354 expressing BADO (Neidle et al, 1987). Cells were grown as described above, harvested, and immediately resuspended in 0.5 L minimal medium in a 2 L Erlenmeyer flask containing 0.2 % glucose and either 2 g biphenyl, 60 mg benzoate, 60 mg w-toluate or toluene, as appropriate. Toluene was supplied to the culture by placing 2 mL of toluene in a 15 mL conical tube (Sarstedt, Newton, NC) suspended above the medium using a neoprene stopper. The open end of 50 the conical tube above the stopper was plugged with cotton. Four holes in the tube below the stopper allowed the toluene to diffuse into the headspace above the culture flask. E. CO//JM101 E. co//JM101 E. coli BL21(DE3) E. co//C41(DE3) pIB1354 pIB1354 pT7-6a pT7-7a-cam BenABC BenABC BphAl -4 L B 4 0 o B p h A l - 4 c a m COOH I^OH COOH X^OH • CH3 y r*OH U 1-OH 1^ "H J ^ H L\ C8H Strain Plasmid Enzyme Figure 19. Biosynthesis of aryl c/s-diols. Benzoate 1,2-diol and w-toluate 1,2-diol were prepared using an established procedure (Jenkins et al., 1995). Accordingly, cell suspensions were incubated at 37°C overnight with agitation. Cells were removed by filtration and centrifugation. The culture supernatant was acidified to pH 4 using dilute hydrochloric acid and extracted four times using 250 mL ethyl acetate. The four ethyl acetate fractions were combined and dried over anhydrous sodium sulfate. Ethyl acetate was removed using a rotary evaporator, the residue was dissolved in warm hexane, and stored at -20°C overnight. 51 The crystallized cz's-diol was dried under a stream of nitrogen and kept at -20°C until use. Biphenyl 2,3-diol and toluene 2,3-diol were prepared by essentially the same procedures except that the culture supernatant was not acidified prior to extraction. Approximately 60 mg of biphenyl 2,3-dihydrodiol was obtained from 1 g biphenyl. The yield of each of the other cw-diols was approximately 50 mg. The purity of each cis-diol was greater than 90% as determined by HPLC. Using the conditions described in section 2.12, retention times (JR) of the respective diols were: 3.232 min for biphenyl 2,3-dihydrodiol, 2.152 min for benzoate 1,2-diol, 2.168 min for m-toluate 1,2-diol, and 2.815 min for toluene 2,3-diol. Their concentrations for use in kinetic assays were determined using the following extinction coefficients: e303 = 13,600 NT'cm"1 for biphenyl 2,3-dihydrodiol (Gibson et al, 1973), S262 = 3,350 M^cm"1 for benzoate 1,2-diol (Reiner et al, 1971b), E 2 6 i = 2,770 M ' W 1 for w-toluate 1,2-diol (Hudlicky et al, 1999), and e 2 6 5 -5,220 M ' W 1 for toluene 2,3-diol (Gibson et al, 1970). 2.11 Electronic absorption spectroscopy Absorption spectra were recorded using a Varian Cary IE spectrophotometer equipped with a thermojacketed cuvette holder maintained at 25°C. The spectrophotometer was interfaced to a microcomputer and controlled by Cary WinUV software version 2.00. Samples contained 1.2 uM protein in 25 mM HEPES buffer, pH 7.3. Spectra of anaerobic samples were recorded using a 3 mL gas-tight cuvette (Hellma, Concord, Ontario). Oxidized samples were prepared in a glovebox by adding several grains of K3Fe(CN)6 to the protein sample, and passing the latter through a small desalting column (0.7 * 6 cm Bio-Gel P6 DG) equilibrated with the buffer of choice (see Figure 26, 27). Al l measurements were performed in duplicate. 2.12 HPLC analyses 52 HPLC measurements were performed using a Waters Millennium^ system including a Waters 2996 Photodiode Array Detector, an Alliance Waters 2695 Separations Module equipped with a CI8 reverse-phase, ODS hypersil column (4 x 125 mm). Al l components were interfaced with a Milliennium Client/Server (Waters Corporation. Milford, MA 01757). Samples of 10 ul were injected and the column was operated at a flow rate of 1 mL/min. To resolve benzoates, the column was eluted with a 4:1 mixture of H 2 0 and acetonitrile (v/v). To resolve cz's-diols, a 9:1 mixture (v/v) was used. 2.13 Identification of reaction products The products of dioxygenase-catalyzed reactions were identified in reactions performed and quenched as described for the coupling assay except that the reaction mixture also contained 1.2 uM of XylL and 128 uM of N A D + to transform c/j-diols to the corresponding catechol. Substituted catechols were identified in reaction mixtures by comparing the retention times and absorption spectra of HPLC peaks with those of commercially available catechols. In some instances, product identification was confirmed by further treating reaction mixtures with C230 and comparing the HPLC retention times and absorption spectra of the cleavage products with those of known compounds. 2.14 Sequence alignment and phylogenetic analyses Aryl cis-diol dehydrogenase amino acid sequences were retrieved from the databases using BLAST (cut off at 15% similarity) at the NCBI server and one of three query sequences: X y l L m t 2 , CbaCctest, and BedD\iL2- Sequences were retained if the encoding gene occurred in an appropriate catabolic gene cluster (i.e., adjacent to genes encoding a ring-hydroxylating or ring-cleavage dioxygenase). In those cases in which more than one sequence shared greater than 99.6% identity, only one sequence was 53 retained for further analysis. In the analyses of SDR family sequences, the sequences of three distantly related enzymes were included: P-ketoacyl reductase from E. coli, estradiol 17 P-dehydrogenase 3 from Homo sapiens, and mouse adipocyte P27-like protein from Caenorhabditis elegans. The sequences were aligned using CLUSTAL X (Thompson et al, 1997). The alignment was built using the slow/accurate option, the Gonnet Series protein weight matrix, a 30% delay for divergent sequences, and the default values for gap opening and extension penalties, residue-specific penalties and hydrophilic penalties. The phylogenetic analysis was performed using the neighbor-joining routine of CLUSTAL X (Thompson et al, 1997). The phylogenetic tree was visualized using TreeView (Page 1996). 2.15 Crystallization of XylLm t2 Crystallization screens were carried out using the hanging-drop method. The drop volume was 4 ul. Each drop was suspended from a cover glass over a reservoir in a crystal screen plate. The reservoirs contained 800 ul of one of 192 mother solutions. Each drop contained 1:1:2 mixture (v/v/v) of the following: 22 mg/mL X y l L m t 2 in 25 mM HEPES, pH 7.3, 10% glycerol; 50-400 mM NAD + in 25 mM HEPES, pH 7.3, 10% glycerol; and mother solution. Screening plates were incubated at 19°C. Crystal formation was monitored daily using a microscope. 54 3. TOLUATE, BENZOATE AND HYBRID DIOXYGENASES 3.1 Construction of expression systems 3.1.1 Native and hybrid ISPs A host cell for native and hybrid ISP expression was constructed by inserting an inducible copy of xylS into the chromosome of P. putida KT2442. Briefly, the xylS gene was excised from pBKT7-S (de Lorenzo et al, 1993a) as a -1.5 kB Noil fragment and was ligated into the Noil site of pCNB5 (de Lorenzo et al., 1993b). The resulting construct, pCNB5-S, places xylS under control of the Ptrc promoter on a mini-Tn5 transposon. The constructed mini-Tn5 was inserted into the chromosome of P. putida KT2442 by biparental mating using E. coli S17-1 A/?z> containing pCNB5-S as the donor, thereby generating P. putida CL01 (Figure 20). CHj Pu^  xylCMABN Pny> xylXYZ LTEGFJQK1H xylS ^ Ps Pr^  xylR upper operon IPTG 1 © z ^ ' ^ "^mfita operon * * s N N ' \ N • V < \ ' X + 1 - - U " " > . ™ ~ \ - - " ^ ^ Toluate Figure 20. ISP expression system. The genes encoding TADOM T2, xylXYZ, together with the Pm promoter which lies upstream of xylX, were subcloned from pPL392 (Harayama et al, 1984) into pEMBL18 55 (Dente et al., 1987) and pVLT31 (de Lorenzo et al., 1993a) as a Sacl-BamHl fragment, generating constructs pEMXYZl and pVLTXYZl , respectively. Expression vectors for B A D O A D P I and hybrid ISPs were designed based on the systems that yielded the best expression of the TADOm t2 components (section 3.2.1). To express OIBPB, a vector was constructed by initially introducing an Ncol site at the start codon of benA in pIB1354. The initial portion of benA was then cloned as a 640 bp Ncol-Hincll fragment into pEMRBS, yielding pEMAl . The intact benA together with benB was reconstructed by inserting a 1.7 kb Hincll fragment from pIB1354 into pEMAl , yielding pEMABl . Finally, a 2.4 kb Sacl-Hindlll fragment containing the benAB genes together with the Pm promotor and a suitable RBS was excised from pEMABl and cloned into pVLT31, yielding pVLTABl . To express CITPB, a Bsml site was introduced 2 bp downstream of xylX in pEMXYZl by directed mutagenesis using primer BsmlXY (CTTCGTAGGAAGCATTCATTTACACGCCC, introduced Bsml site underlined). A 1 kb Bsml-Hincll fragment carrying benB was then excised from pIB1354 and used to replace the corresponding fragment in pEMXYZl , yielding pEMXBl . This strategy positioned benB immediately downstream of xylX, analogous to the position of xylY in the TOL operon, without changing the sequences of XylX or BenB. Finally, a 2.5 kb Xbal-Kpnl fragment from pEMXBl containing the Pm promotor, xylX, benB and part of benC were subcloned into pJB655 to form pJBXBl. To express OCBPT, xylY was amplified by PCR using primers Ay-1, (GGGAATTCGAATGCTACTATCTCCTACGAA; introduced Bsml site underlined) and Ay-2 (CCCCGAAGCTT AAGTCAGTGGC AACC; introduced Hindlll site underlined). The resulting 500 bp fragment was digested with Bsml and Hindlll, and cloned into pEMABl , yielding pEMAYl . Finally, a 2.3 kb Sacl-Hindlll fragment 56 containing the benA and xylY genes together with the Pm promo tor was excised from pEMAYl and cloned into pVLT31, yielding p V L T A Y l . This strategy resulted in the addition of two amino acids at the N-terminus of XylY, asparagine and alanine, which are the second and third amino acids of BenB, respectively. This was done to preserve the same four base pair overlap between benA and xylY that exists between benA and benB (Harayama et al., 1991). Inspection of the sequence alignment, and the structure of BPDO (Colbert 2000) indicate that the addition of these two amino acids to the N terminus of XylY should not change the properties of XylY. 3.1.2 Reductases An Nhel site was introduced at the beginning of xylZ by directed mutagenesis using a synthetic oligonucleotide with the sequence 5'-GGCAACCTTGTGGCTAGCGGCGGCACCTCA-3' (Nhel site underlined). The xylZ gene was then cloned into pLEHP20 (Eltis et al., 1994) as an Nhel-Pstl fragment following a sequence encoding a six-histidine tag, generating pFVZ8 which contains a gene encoding an N-terminal his-tagged R E D T A D O (ht-REDTADo)- The gene encoding ht-R E D T A D O was cloned into pT7-7 and pVLT31 as an Xbal-Pstl fragment, generating pFVZl l and pVLTZl , respectively. R E D B A D O was expressed as a his-tagged protein using a system analogous to that for REDTADO- Accordingly, benC was amplified by PCR using primers BCfor (CGCCCTGCAGTCACGACGTTG; Pstl site underlined) and BCrev (GCCCGCTAGCTTATATTTGAATAGG; Nhel site underlined) from pIB1354. The resulting 1.2 kb fragment was digested with Nhel and Pstl, and ligated into appropriately digested pLEHP20. The gene encoding the his-tagged benC was then cloned into pVLT31 as an Xbal-Pstl fragment, yielding pVLTCl. 57 3.2 Expression and purification 3.2.1 Native and hybrid ISPs Among the E. coli- and Pseudomonas-based systems tested for the expression of ISPTADO, P. putida CL01 containing pVLTXYZl yielded the highest levels of soluble protein (Figure 21). In contrast, E. coli DH5a containing pEMXYZl yielded approximately one third the amount of ISPTADO, much of which was insoluble. Optimal expression of ISPTADO in P. putida was achieved by growing the cells to an OD600 of 0.6, adding 0.1 mM IPTG and 1 mM m-toluate, then adding a further 1 mM m-toluate three hours later. In cells harvested 24 hours after the initial induction, ISPTADO constituted approximately 20% of the total cellular protein. Therefore, ISPBADO and hybrid enzymes were all expressed and purified from a system based on P. putida CL01 and pVLT31. Figure 21. Comparison of ISPTADO expression systems. Lane M , molecular weight standards. Odd numbered lanes were loaded with whole cell extracts. Even numbered lanes were loaded with the soluble fraction of these extracts, generated via sonication and centrifugation. Lanes 1, 2: pEMXYZl in E. coli DH5a. Lanes 3, 4: pEMXYZl in P. putida KT2442. Lanes 5, 6: pEMXYZl in P. putida CL01. Lanes 7, 8: pVLTXYZl in P. putida KT2442. Lanes 9, 10: pVLTXYZl in E. coli DH5a. Lanes 11, 12: pVLTXYZl in P. putida CL01. In all cases, protein expression was induced with two additions of 1 mM m-toluate except in the case of P. putida CL01, for which 0.1 mM IPTG was also used (see section 2.2 for additional details). 58 The four ISPs (CCTPT, OBPB, OCBPT, a n ( ^ a iPB) were expressed in P. putida CL01 containing pVLTXYZl , pVLTABl , pVLTAYl and pJBXBl, respectively. Each ISP was expressed at relatively high levels in P. putida CL01 using the protocol described for ISPTADO: each constituted more than 20% of the total cellular protein (results not shown). Each ISP was anaerobically purified from cells harvested from 4 L of culture using anion-exchange, gel filtration, and hydrophobic interaction chromatographies. Purification details of CCTPT are presented in Table 2. The overall yields and qualities of the native and hybrid ISPs were comparable (Table 3). Thus, approximately 32 to 100 mg of each ISP was purified from 24 g of cells (wet weight). The final preparation of each ISP was judged to be greater than 90% pure based on a Coomassie Blue-stained denaturing gels (Figure 22). Table 2. Purification of the oxygenase component of toluate dioxygenase. Purification step Total protein Total activity Specific activity Yield mg U U/mg % Crude extract 1840 883 0.48 100 SourceQ 175 385 2.2 44 Superdex 200HR 104 260 2.5 29 Phenyl-Sepharose 39 148 3.8 17 Activity units (U) are defined in Materials and Methods. 59 Table 3. Purification details of ISPs ISP Protein Yield Specific activity0 Fe content S content A280/A323 mg U/mg Fe/013 S/a3 Oxidized Reduced OITPT 39 3.8 16 5.8 4.5 6.7 a B p B 75 5.0 11 6.0 6.1 12.7 a T p B 100 2.3 15 5.9 4.5 6.7 a B p T 32 3.1 12 5.9 6.1 12.7 "Activity units (U) are defined in Materials and Methods. Specific activities were obtained using m-toluate for oixPx and a TpB, and benzoate for OBPB and aBPx. Elution of axpT, a B p B and hybrid ISPs from the gel filtration column was consistent with each ISP having a molecular mass of approximately 215 kDa and, therefore, an a 3p 3 constitution (Figure 23). Purified proteins flash frozen in liquid nitrogen and stored as beads at -80°C exhibited no significant loss of activity over six months. Figure 22. Denaturing gel of preparations of purified TADO and BADO components. The lanes were loaded with (M) molecular weight standards and 5 jj.g of each of the indicated protein preparations. The a and P subunits of the ISPs are indicated. 60 1000 1 -I , , , 1 1 160 180 200 220 240 260 Elution volume (ml) Figure 23. Molecular weight determination of native ISPTADO from gel filtration. A standard curve (solid line) was constructed by plotting the relative molecular weights of markers (Bio-Rad) against their elution volumes (solid circles). The markers (Mr in parenthesis) were: myosin (200,000), p-galactosidase (116,250), serum albumin (66,200), ovalbumin (45,000), carbonic anhydrase (31,000). The migration of I S P T A D O (OCTPT) relative to the standards is indicated by an open circle. 3.2.2 Reductases Among the systems tested, P. putida KT2442 containing pVLTZl produced the largest quantity of ht-REDTADo (Figure 24). Cells grown to an OD6oo of 0.6 and incubated for a further 20 hours in the presence of 0.5 mM IPTG expressed ht-REDiADo to 20% of the total cellular protein, essentially all of which was soluble. High levels ht-R E D T A D O were also produced in both E. coli BL21(DE3):pLysS and E. coli GJ1158 containing p F V Z l l . However, under all expression protocols tested, most of the fusion protein was present in inclusion bodies in these strains. 61 M l 2 3 4 5 6 7 8 9 Figure 24. Comparison of R E D T A D O expression in different systems. Lane M : molecular weight standards. Lanes 1, 4, and 7 were loaded with whole cell extracts. Lanes 2, 5, and 8 were loaded with soluble cell extracts. Lanes 3, 6, and 9 were loaded with the insoluble fraction of cell extracts. Lanes 1-3 were loaded with samples derived from E. coli BL21(DE3):pLysS containing p F V Z l l . Lanes 4-6 were loaded with samples derived from E. coli. GJ1158 containing pFVZl 1. Lanes 7-9 were loaded with samples derived from P. putida KT2442 containing pVLTZl. Recombinant protein expression in E. coli. GJ1158 was induced using 0.3 M of NaCl. In the other two strains, expression was induced using 0.5 mM IPTG. See section 2.2 for additional details. During aerobic purification, brown-coloured solutions of ht-REDxADO turned yellow, consistent with loss of the [2Fe-2S] cluster and oxidation of the FAD. During subsequent concentration of the ht-REDxAoo-containing solution, the yellow colour passed through the ultrafiltration membrane, indicating that the FAD had dissociated from the reductase. To minimize the loss of cofactors during the IMAC-based purification of ht-REDxADO, manipulations were therefore performed anaerobically as described in Material and Methods. A total of 60 mg of fusion protein was obtained from 4 L of culture. This was judged to be greater than 99% pure by SDS-PAGE (Figure 22). Ht-REDxADO was not stable in the presence of imidazole, even under anaerobic conditions, thus it was important to rapidly remove the imidazole after IMAC. In some samples, the his-tag was proteolytically removed from ht-REDxADO using Factor Xa. 62 This was accomplished using a Factor X a : R E D ratio of 1:50 (weight:weight) and an incubation time of 24 hours (Figure 25). RED was further purified by gel filtration using a Superdex 200HR 26/60 column. The specific activity of ht-REDiADO in the TADO oxygraph assay was essentially identical to that of a preparation of non-histagged R E D J A D O - Therefore, h t - R E D T A D O was used in subsequent TADO assays. Purified ht-R E D T A D O flash frozen in liquid nitrogen and stored as beads at -80°C exhibited no detectable loss of activity over six months. M C 1 2 3 4 5 6 7 8 200.0-116.2. 97.4 > 66.2 — _ + His-tagged R E D — ' R E D 31.0 * '*»• . . — — 21.5 14.4 Figure 25. Time course of the proteolytic removal of the his-tag from ht-REDrADO- The lanes of the denaturing gel were loaded with 5 ug each of the following samples: lane M , molecular weight standards; lane C, ht-REDjADo control; lanes 1-4, Xa:RED 1:100 (w/w) after 4, 8, 12, and 24 hours of incubation, respectively; lane 5-8, Xa:RED 1:50 (w/w) after 4, 8, 12, 24 hours of incubation, respectively. R E D B A D O was expressed as a his-tagged protein in P. putida KT2442 at a level similar to that of ht-REDiADO and was purified anaerobically in a single step using IMAC as described for ht-REDjADO- The yield and purity of h t - R E D B A D O were essentially identical to those of ht-REDjADO (Figure 22). 63 3.3 Characterization of the [2Fe-2S] clusters Purified ISPTADO contained 16 + 3 mole iron and 5.8 ± 0.4 mole sulphur, respectively, per mole of OC3P3 hexamer. Passage of the ISPTADO preparation over a small desalting column equilibrated with buffer A containing no added iron did not affect these values. The iron and sulphur contents of other purified ISPs were also determined in anaerobically desalted samples of protein. The values indicate that each ISP contained a full complement of [2Fe-2S] and mononuclear iron prosthetic groups (Table 3). While all ISPs seemed to contain adventitiously bound iron, ISPs containing the a subunit of TADO mt2 (OCTPT and OCTPB) contained more. Preparations of REDs contained about 2 ± 0.1 mole iron and 2 ± 0.2 mole sulphur, respectively, per mole of reductase. As purified, CCTPT (ISPTADO) absorbed maximally at 280, 323 and 455 nm, typical of reduced Rieske-type [2Fe-2S] clusters (Figure 26). The R-value (ratio of A280/A323) was 6.7 and was unaffected by the anaerobic addition of sodium hydrosulfite, indicating that the* Rieske-type [2Fe-2S] cluster of ISPTADO remained fully reduced during purification. ISPTADO could be oxidized by treating it with a slight excess of potassium ferricyanide or by exposing the sample to air for 20 minutes. The R-value of oxidized ISPTADO was 4.5 (Figure 26). These spectra are similar to those of the oxygenases of other ring-hydroxylating dioxygenases (Fetzner et al, 1992, Imbeault et al., 2000). 64 0 -J 1 1 1 1 1 300 350 400 450 500 550 600 Wavelength (nm) Figure 26. Spectrum of reduced ( ) and oxidized ( ) purified ISPTADO (OCTPT)- The sample cuvette contained 1.2 uM protein in 25 mM HEPES buffer, pH 7.3, 25°C. The spectra of other ISPs were similar to that of ISPTADO-The UV/vis spectra of O:BPB, <XTPB and OCBPT were similar to that of OCTPT, absorbing maximally at 280, 323 and 455 nm. The spectra indicate that as purified, the Rieske-type [2Fe-2S] cluster of each ISP was fully reduced. As for CCTPT, the [2Fe-2S] cluster could be oxidized in samples of each ISP by either exposure to air for 20 minutes or treatment with a slight excess of K3Fe(CN)6 (Figure 26). The R-value (A280/A323) of each oxidized ISP is lower than that of the corresponding reduced form (Table 3), principally because the absorption bands of the oxidized cluster are more intense than those of the reduced cluster. Interestingly, the R-value of purified OCTPT was significantly lower than that of CIBPB (Table 3). Similarly, preparations of purified CCTPT had a more intense brown color than preparations of a BPs of similar concentration. Indeed, the extinction coefficients of reduced OLTPT and OCBPB at 323 nm were 83.42 and 40.55 cm" 'mM" 1, respectively (25 mM HEPES buffer, pH 7.3, 10 % glycerol, 25 °C) based on the sulphur content of the ISP. These values are comparable with those reported for oxidized 65 2HBAD0 (34 crn'mM"1; Fetzner et al, 1992) and BADOci from Pseudomonas arvilla C-l (58.6 cm^mM"'; Yamaguchi et al, 1980) based on their protein concentrations. However, the absorption of the oxidized ISPs is generally 50% higher than that of the reduced protein, indicating that the current preparations of OCTPT and OCBPB probably contain a higher proportion of their [2Fe-2S] cluster than reported ones. Finally, the R-value of each hybrid ISP corresponded to that of the parent from which the oc-subunit originated. This is consistent with structural data showing that the [2Fe-2S] cluster in ring-hydroxylating dioxygenases is contained entirely with the a subunit (Kauppi et al, 1998; Colbert, 2000). The stabilities of [2Fe-2S] clusters in the native and hybrid ISPs were compared by following the absorption at 455 nm ( A 4 5 5 ) of oxidized samples incubated at room temperature. After 48 hours, the A 4 5 5 of aerobic, oxidized samples of CITPT, WTPB, O:BPB and a s p T decreased by 6%, 12%, 26%, and 58%, respectively. These data indicate that exchanging the P subunit decreased the stability of the ISP with respect to the parent enzyme from which the a subunit originated. Assuming an exponential decay, this instability was judged to not be a factor over the time course of the kinetic experiments (typically 2 min). There were no significant changes in the A 4 5 5 of oxidized samples incubated anaerobically during the same period of time. The absorption spectra of R E D T A D O and R E D B A D O were typical of Group II reductases (Figure 27; Eby et al, 2001; Fetzner et al, 1992). As isolated, the R E D J A D O and R E D B A D O absorbed maximally at 270, 340 and 455 nm in anaerobic buffer and had essentially identical R-values (A27o/A455) of 5.9. Addition of NADH to 2 uM did not alter the absorption spectrum of the [2Fe-2S] cluster. Exposure of samples of REDs to air resulted in a decrease of the R-value to a maximum of 3.1, observed at 20 minutes. Oxidized samples of RED could be reduced with a small molar excess of NADH (Figure 66 27) as indicated by the spectrum. This indicates that loss of the [2Fe-2S] cluster from the oxidized R E D T A D O was not immediate. 250 300 350 400 450 500 Wavelength (nm) Figure 27. Spectrum of reduced ( ) and oxidized ( ) REDTADO-The sample cuvette contained 1 uM protein in 50 mM Tris, 100 mM NaCl, 1 mM C a C l 2 , pH 8.0, 25°C. The sample of oxidized protein was generated by exposing the sample of reduced protein to air for 20 minutes. Addition of 1.2 uM NADH resulted in essentially complete reduction of the oxidized protein. 3.4 In vitro reconstitution of dioxygenase activity TADO m t2 was reconstituted in vitro as described in 2.8.1 and its activity was monitored using an oxygraph assay (Figure 28). At concentrations of ISPTADO ranging from 0.1 to 0.6 uM, the oxygenase could not be saturated by R E D T A D O , even in the presence of a fifty-fold excess of the latter. Moreover, increasing R E D T A D O increased the background O 2 consumption observed in the absence of oxygenase. Therefore, in the standard assay, the respective concentrations of R E D T A D O and ISPTADO were fixed at 2.0 and 0.37 uM (i.e., a molar ratio of approximately 5.4:1). At this concentration of R E D T A D O , the activity of TADO m t2 was proportional to the concentration of ISPTADO over an order of magnitude. Analysis of oxygraph traces indicated that the observed decline in 67 the rate of O2 consumption during TADOmt2-catalyzed transformation of m-toluate could be accounted for by m-toluate depletion alone (Figure 28). That is, these rates could be calculated from the Michaelis-Menten equation using parameters calculated from initial velocities determined at different concentrations of m-toluate. In this analysis, O2 concentrations remained saturating. Importantly, this indicates that no significant product inhibition or enzyme inactivation occurred in these assays. 8 2 0-1 , , . . . ! 0 20 40 60 80 100 120 -20 J ' Time (s) Figure 28. Analysis of oxygraph traces of TADOm t2 activity. The assay was performed using final concentrations of 0.5 uM OCTPT, 2.0 uM ht-REDTADO, 0.5 mM NADH and 0.45 mM m-toluate in air-saturated 0.1 M potassium phosphate buffer, pH 7.0, 25°C. (A) The polarographic trace. The RED and ISP were added at points "R" and "O", 68 respectively. At point "P", 100 uM product had accumulated. The slope of the trace between R and O represents the background O2 consumption. (B) The derivative of the trace in A. The lower dashed line represents the background O2 consumption. The upper dashed line was calculated using the Michaelis-Menten equation and values for Km and Fmax derived from initial velocities determined under the stated assay conditions. Using 0.1 M ionic strength phosphate buffers, 25°C, TADOM T2 activity was highest at pH 7.0 (Figure 29). The addition of iron, FAD and/or reducing agents did not affect the activity of TADOM T2. Under the standard assay conditions, the specific activity of T A D C w was 3.8 U/mg. pH values Figure 29. Activity of TADOM T2 at different pHs. The activities of BADO and the hybrid dioxygenases were reconstituted in vitro using the same conditions as for TADCW. The specific activity of each reconstituted dioxygenase was determined using the derivative of benzoate for which it showed the highest apparent specificity (i.e., w-toluate for aj^j and OCTPB, and benzoate for OCBPB and CCBPT; see below) and using the RED of the dioxygenase from which the a subunit originated (i.e., ht-REDT ADO for CCTPT and OTPB, and ht-REDBADO for a B p B and CCBPT)-Under these conditions, the specific activities of the dioxygenases reconstituted using OCBPB, CCTPB, OCBPT were 5.0, 2.3 and 3.1 U/mg, respectively. 69 3.5 Steady-state kinetic studies 3.5.1 Native dioxygenases Steady-state kinetics studies were performed using a variety of substituted benzoates to determine the apparent specificities of native and hybrid dioxygenases. To investigate the specificity of TADOm t2, the initial rate of O2 utilization by the enzyme was determined as a function of substituted benzoate and O2 concentrations. For the substituted benzoates that were efficiently transformed by TADOmt2, the steady-state rate equation describing a compulsory order, ternary complex mechanism (Equation 1) fit the initial rate data (representative data in air-saturated buffer are shown in Figure 30), consistent with the proposed mechanism of ring-hydroxylating dioxygenases (Wolfe et al., 2001). However, the data could not be used to exclude other steady-state mechanisms. 70 140 Concentration of m -toluate (LIM) Figure 30. Steady-state consumption of O2 by reconstituted TADOm t2 in the presence of ra-toluate. The experiments were performed using air-saturated buffer (100 mM phosphate buffer, pH 7.0, 25°C). Additional experimental details are provided in the Materials and Methods (section 2.8.1). The line represents the best fit of the Michaelis-Menten equation to the data. The fitted parameters were K " ^ — 5.3 ± 0.3 uM, and V = 55 ± 1 uM/min. Of the benzoates tested, TADOm t2's preferred substrate was w-toluate, which it utilized with an apparent specificity three fold higher than benzoate and five times higher than /?-toluate (Table 4). Ort/zo-substituted benzoates were even poorer substrates for TADOm t2, and the enzyme was more specific for methylated benzoates than the corresponding chlorinated analogues. Interestingly, the enzyme's affinity for the various substrates (reflected in calculated values of K^A) varied to a much greater extent than the turnover numbers. The ability of TADOmt2 to utilize O2 also varied markedly with the aromatic substrate (Table 4). Thus, the dioxygenase was equally reactive with O2 in the presence of meta-substituted, para-substituted and unsubstituted benzoates, as determined by 71 kcJKmo2 and, in the presence of these substrates, was essentially saturated with O2 in air-saturated buffer (Kmo2 - 1 5 uM). In contrast, the specificity of TADOM T2 for O2 was approximately five fold lower in the presence of ort/20-substituted benzoates. Because few studies have investigated the specificity of ring-hydroxylating dioxygenases as a function of O2 concentration, the steady-state parameters of TADOM T2 for substituted benzoates in air-saturated buffers are presented in Table 4 to facilitate comparison with other enzymes. B A D O A D P I had a narrower specificity than TADOM T2, transforming only four of seven selected benzoates (Table 4). The best substrate for :BADOADPi was benzoate (KMA = 26 ± 1 uM, /Vcat = 8.6 ±0.1 s"1, ATmo2 = 53 ± 2 uM), and the enzyme utilized substituted benzoates in the following order of apparent specificity: benzoate > m-toluate > 3-chlorobenzoate > o-toluate. In contrast, TADOM T2 utilized substituted benzoates in the following order of apparent specificity: m-toluate > benzoate ~ 3-chlorobenzoate > p-toluate ~ 4-chlorobenzoate » o-toluate ~ 2-chlorobenzoate. Thus, B A D O A D P I and TADOM T2 differed significantly in their abilities to utilize para-substituted benzoates. The nature of the substituted benzoate influenced the ability of B A D O A D P I to utilize O2 (Table 4) as observed for TADOM T2- However, in the case of B A D O A D P I , the Kmo2 correlates with the specificity of the enzyme for the substituted benzoate. Thus, the Kmo2 of B A D O A D P I was lowest in the presence of benzoate, the enzyme's preferred substrate, was 2 fold higher in the presence of m-toluate and 3-C1 benzoate, and was highest in the presence of o-toluate, the worst substrate tested. 72 Table 4. Apparent steady-state kinetic parameters of ISPs for selected substituted benzoates Substrate ^dA -KmA Km02 c^at /Kmo2 uM uM uM s"1 x 1 0 4 M V x I O 4 M V Benzoate 130(23) 19(4) 13(2) 2.8(0.1) 15(3) 22 (2) o-toluate 4100(2800) 250 (65) 46 (10) 2.3 (0.13)A 0.9 (0.2)A 4.9 (0.9) A T P T w-toluate 21(3) 9.1 (1.3) 16(2) 3.9 (0.2) 43(4) 25 (2) />-toluate 203 (46) 28 (6) 8.4(1.5) 2.5 (0.1) 9(2) 30(4) 2-C1 benzoate 3300(1100) 144 (90) 92 (22) 1.9 (0.1)A 1.3 (0.8)A 2.1 (0.4) 3-C1 benzoate 33 (6) 26 (3) 19(6) 3.1(0.1) 15(1) 21(1) 4-C1 benzoate 310(67) 41 (9) 12(2) 3.0 (0.1) 8(1) 25 (3) Benzoate 96 (5) 26(1) 53 (2) 8.6 (0.1) 33 (3) 16(1) a e P B o-toluate 6500(1400) 1401 (48) 247 (20) 4.2 (0.2)A 0.3 (0.1)A 1.7(0.9) m-toluate 138 (18) 89 (6) 129(11) 7.0(0.5) 8(2) 5.4 (0.4) 3-CI benzoate 192 (58) 113 (8) 128(11) 3.0 (0.1) 3(1) 2.3 (0.5) Experiments were performed using 0.1 M sodium phosphate, pH 7.0 at 25°C containing 430 uM NADH. Standard errors are given in parentheses. Ht-REDs were paired with the a subunit of the ISP. The data sets used to calculate the parameters for different substrates contain 80-110 points. BADO displayed no detectable activity in the presence of /7-toluate, 2-C1 benzoate or 4-C1 benzoate. "Values were based on 0 2 consumption to be consistent with the other values in the table. Values calculated based on cis-dihydrodiol production are at least one order of magnitude lower. 3.5.2 Exchange of reductase The apparent steady-state kinetic parameters of all native ISPs were relatively unaffected when the dioxygenase was reconstituted with each of the two ht-REDs. Thus, the specific activities of OCTPT and OCBPB were both slightly higher in the presence of ht-R E D T A D O (Table 5), and small differences in the apparent kcat and Km were observed. As noted above in studies with TADOM T2, the level of RED affected both the Km and the kCit. 73 However, the apparent specificity of each ISP for m-toluate and benzoate was unaffected by the identity of RED (Table 5). Subsequent experiments with hybrid ISPs were performed using the RED of the dioxygenase from which the a subunit originated. This choice was guided in part by the observation that the a subunit of TODO could be reduced in the absence of the P subunit using NADH and catalytic amounts of this enzyme's RED and ferredoxin (Jiang et al., 1999). Table 5. Activities of ISPs with different reductases. ISP R E D substrate Specific activity U/mg uM &cat s"1 c^at /KrnK x 1 0 4 M V OCTPT T A D O M T 2 benzoate 3.0 (0.2) 15(1) 2.4 (0.1) 16(1) m-toluate 3.2 (0.1) 5.3 (0.3) 2.92 (0.04) 46 (3) B A D O A D P I benzoate 1.7(0.1) 10(2) 1.8(0.1) 17(2) m-toluate 2.8 (0.2) 5.6(1.6) 2.7 (0.2) 48 (4) OCBPB T A D O M T 2 benzoate 14.5 (0.8) 61(6) 12.8 (0.6) 21(1) m-toluate 10.2 (0.9) 69 (5) 7.1 (0.5) 9(1) B A D O A D P I benzoate 8.2 (0.4) 38(1) 8.6 (0.3) 23 (1) m-toluate 7.6 (0.3) 49 (3) 5.3 (0.2) 11(2) Experiments were performed using 100 mM sodium phosphate, pH 7.0, 25°C containing 430 uM NADH. Standard errors are provided in parentheses. 3.5.3 Hybrid dioxygenase The apparent substrate specificities of OTPB and a Bpj for substituted benzoates were determined in air-saturated buffer (Table 6). The apparent substrate specificity of OCBPT corresponded to that of B A D O A D P I , the parent from which the a subunit originated. In contrast, CCTPB differed slightly from TADOM T2 in that it had greatest apparent specificity for 3-chlorobenzoate (3-chlorobenzoate > m-toluate > benzoate ~ p-toluate > 74 4-chlorobenzoate » o-toluate > 2-chlorobenzoate). In general, the KmA of each hybrid ISP for a given benzoate was 2-10 fold higher than that of the corresponding parent ISP. 3.6 Coupling of O 2 consumption to substrate transformation in dioxygenases To investigate whether substrate utilization is coupled in TADCW, the stoichiometry of aromatic substrate and O2 consumption in the dioxygenase-catalyzed reaction was investigated. In these experiments, the amount of aromatic substrate consumed in the reaction was determined by HPLC. In the presence of saturating quantities of good substrates (i.e., benzoate, meta and para substituted benzoates), the amount of substrate consumed corresponded to the amount of O2 consumed (Table 7). In contrast, in the presence of the ortAo-substituted benzoates substrate utilization was significantly uncoupled: at least ten times more O2 was consumed than benzoate. Moreover, H2O2 accounted for between 20 and 30% of the total O2 consumed (Table 7). In B A D O A D P I , substrate and O2 consumption were well coupled for all benzoates used in this study (Table 7). The turnover of various benzoates was as well coupled to 02-utilization in the OIBPT hybrid as in B A D O A D P I - Unexpectedly, the turnover of ortho substituted benzoates was much better coupled to 02-utilization in the OITPB hybrid than in TADO m t 2 . 75 Table 6. Apparent steady-state kinetic parameters of ISPs for selected substituted benzoates in air-saturated buffer Substrate KmA Acat uM s"1 x I O 4 M V Benzoate 15(1) 2.4 (0.1) 16(1) o-toluate 590 (60) 1.6 (0.1)A 0.3 (0.02)A CCTPT w-toluate 5.3 (0.3) 2.9 (0.04) 46 (3) //-toluate 43 (3) 2.25 (0.06) 5(1) 2-C1 benzoate 1200(240) 1.4 (0.1)A 0.1 (0.01)A 3-C1 benzoate 22 (2) 1.03(0.01) 4.6 (0.5) 4-C1 benzoate 83 (7) 0.86 (0.03) 1(0.1) Benzoate 81(7) 1.3 (0.12) 1.6(0.1) o-toluate 410 (124) 0.3 (0.02) 0.09 (0.01) m-toluate 38(4) 1.4 (0.06) 3.6 (0.2) CCTPB />toluate 73(1) 1.2 (0.16) 1.7(0.2) 2-C1 benzoate 1204(218) 0.3 (0.02) 0.02 (0.005) 3-C1 benzoate 20 (3) 1.3 (0.05) 7(1) 4-C1 benzoate 458 (96) 1.47 (0.09) 0.3 (0.06) Benzoate 38(1) 8.6 (0.3) 23 (1) a B p B o-toluate 2890 (240) 2.1 (0.2)A 0.07 (0.01)A /w-toluate 49(3) 5.3 (0.2) 11(2) 3-C1 benzoate 94 (8) 2.2 (0.1) 2.3 (0.3) Benzoate 110(20) 4.0 (0.2) 3.6 (0.3) a B p T o-toluate 5130 (390) 2.7 (0.2) 0.05 (0.01) m-toluate 178 (2) 2.4 (0.3) 1.3 (0.1) 3-CI benzoate 281 (38) 3.1 (0.1) 1.1(0.1) Experiments were performed using 0.1 M air-saturated sodium phosphate, pH 7.0 at 25°C containing 430 uM NADH. Standard errors are given in parentheses. Ht-REDs were paired with the a subunit of the ISP. In these assays, OCBPB and OCBPT displayed no detectable activity in the presence of either p-toluate, 2-C1 benzoate or 4-C1 benzoate. "Values were based on O2 consumption to be consistent with the other values in the table. Values calculated based on cw-dihydrodiol production are at least one order of magnitude lower. 76 Table 7. Coupling of substrate utilization in T A D O m t 2 , B A D O A D P I and their hybrids Enzyme Substrate substrate: O2 H202:02 Benzoate 0.96 (0.10) 0.03 (0.006) o-toluate 0.10(0.10) .0.27 (0.02) CCTPT m-toluate 0.92 (0.13) 0.01 (0.003) p-toluate 0.90 (0.10) 0.03 (0.005) 2-C1 benzoate 0.10(0.09) 0.2 (0.05) 3-C1 benzoate 0.94 (0.10) 0.002 (0.0005) 4-C1 benzoate 0.93 (0.10) 0.03 (0.01) Benzoate 0.98 (0.10) 0.02 (0.003) o-toluate 0.92(0.10) 0.04 (0.002) CtTpB m-toluate 0.98 (0.13) 0.007 (0.001) jp-toluate 0.94 (0.10) 0.01 (0.003) 2-C1 benzoate 0.90 (0.09) 0.05 (0.01) 3-CI benzoate 0.96 (0.10) 0.03 (0.0006) 4-C1 benzoate 0.97 (0.10) 0.04 (0.007) Benzoate 1.02 (0.08) 0.01 (0.002) OCBPB o-toluate 1.01 (0.10) 0.04 (0.01) m-toluate 1.04 (0.12) 0.02 (0.002) 3-CI benzoate 1.04 (0.10) 0.002 (0.0008) Benzoate 1.02 (0.10) 0.03 (0.003) CCBPT o-toluate 1.01 (0.10) 0.02 (0.02) m-toluate 1.04 (0.13) 0.01 (0.002) 3-CI benzoate 1.01 (0.10) 0.02 (0.0003) Experiments were performed using air-saturated 100 mM sodium phosphate, pH 7.0 at 25°C containing 430 uM NADH, 4 uM RED, 1.8 uM ISP and 215 pM of different substrates. Standard errors are given in parentheses. The reductase in the assay was paired to the a subunit of the ISP. 3.7 Identification of reaction products 3.7.1 Toluate dioxygenases In TADOmt2, a single reaction product was detected for each of the well coupled substrates, (i.e., benzoate, meta- and para-substituted benzoates; Table 8). XylL-treated 77 transformation products co-eluted with the respective substituted catechol standards in HPLC analyses, indicating that the TADOM T2 transformation products were exclusively 1,2-dihydrodiols. No dehalogenation or demethylation products were detected. In each case, the amount of catechol detected corresponded to the amount of benzoate transformed within experimental error. Table 8. Identification of cis diols ISP benzoate tR of cw-diol min m^ax Of C/S-diol nm catechol3 cis-dio\h OCTPTC benzoate 2.152 261.5 catechol 1,2-dihydroxy-o-toluate 2.152 261.5 catechol 1,2-dihydroxy-/w-toluate 2.168 262.7 3 -methylcatechol l,2-dihydroxy-3-methyl-/>-toluated 2.086 265.0 4-methylcatechol 1,2-dihydroxy-4-methyl-CCTPB o-toluate 2.036 262.7 3 -methylcatechol l,6-dihydroxy-2-methyl-identified on the basis of HPLC data and/or spectrum of meta cleavage product. hcis-Diols are listed as derivatives of cyclohexa-2,4-diene-carboxylate. cEach ISP produced the same m-diols as OCTPT unless otherwise indicated. dNot detectably transformed by OCBPB or OCBPT- fa: retention time. A single reaction product was also detected in the case of o-toluate. This product co-eluted with the cz's-dihydrodiol produced from benzoate (2.152 min) and had the same absorption spectrum as the latter (kmax = 261.5 nm). In contrast, the cw-dihydrodiols produced from m- and p-toluates had different elution times (2.168 min, 2.086 min) and spectra (262.7 nm, 265.0 nm). Moreover, the TADOM T2 transformation product of o-toluate was quantitatively transformed by XylL to a compound that co-eluted with catechol, and could be further transformed by catechol 2,3-dioxygenase to yield a spectrum identical to that of 2-hydroxymuconic semialdehyde ( A . M A X = 376 nm). The amount of catechol detected corresponded to approximately 1% of the O2 consumed. The 78 detected cz's-dihydrodiol did not arise from contaminating benzoate, as HPLC analysis indicated that a 1 mM solution of o-toluate contained less than 10 nM benzoate. In the case of 2-chlorobenzoate, no transformation product was detected, even when an initial concentration of 1 mM 2-chlorobenzoate was used. 3.7.2 Benzoate dioxygenase A single reaction product was detected for each of the four benzoates turned over by B A D O A D P I , as observed for the TADOmt2-catalyzed transformations. The XylL-treated transformation products of benzoate and meta substituted benzoates co-eluted with catechol and 3-methylcatechol, respectively, in HPLC analyses, and the amount of catechol detected corresponded to the amount of benzoate transformed within experimental error. In the case of o-toluate, the cis-diol coeluted with the cis-diol produced from benzoate and had the same absorption as the latter (Table 8), again as observed for TADOmt2. These results indicate that both TADOm t2 and B A D O A D P I exclusively catalyzed the 1,2-dihydroxylation of the tested benzoates. 3.7.3 Hybrid dioxygenase In general, the hybrid ISPs transformed benzoates to the same products as the parental enzymes. The only exception to this was CCTPB, which transformed o-toluate to a product whose retention time on the HPLC column and absorption spectrum did not correspond those of any of the other cw-diols observed in this study, including that produced from o-toluate by TADOm t2 and B A D O A D P I (Table 8). Transformation of this unknown cz's-diol by XylL and C230 yielded a yellow product whose spectrum was identical to that of the meta-cleavage product of 3-methyl catechol. TADOm t2 transforms /w-toluate to l,2-dihydroxy-3-methyl-cyclohexa-3,5-diene-carboxylate, which is also transformed to 3-methylcatechol. However, the cis-diol produced by the ctxPB-catalyzed 79 transformation of o-toluate was clearly different. It was therefore concluded that the latter was 1,6-dihydroxy-2-methyl-cyclohexa-2,4-diene-carboxylate. 3.8 Discussion 3.8.1 Dioxygenase expression and purification The production of TADOmt2, B A D O A D P I and their hybrid components in suitably engineered pseudomonad strains was higher than that observed for other dioxygenases. Thus, the yield of approximately 10-25 mg of purified ISPs per liter of culture of P. putida CL01 represents a much higher yield of oxygenase than obtained from native strains grown on appropriate carbon sources or from recombinant strains of E. coli. For example, Fetzner et al. (Fetzner et al, 1992) obtained less than 0.5 mg of 2-HBADO per litre of culture of P. cepacia 2CBS. Although the oxygenase components of some ring-hydroxylating enzymes, including ANDO (Eby et al, 2001), have been overproduced in E. coli, the production of other oxygenases appears to be limited by the formation of inclusion bodies (Maeda et al, 2001, Suen et al, 1994), as was observed when xylXY was expressed in E. coli (see Figure 21). This may reflect the inability of E. coli strains to effectively incorporate the [2Fe-2S] cluster into the dioxygenase components as they are translated. Indeed, the expression of BPDO in E. coli was recently improved by co-expressing the isc (iron-sulphur cluster) gene cluster responsible for the insertion of [2Fe-2S] clusters (Imbeault, Eltis and Powlowski, in preparation). Anaerobic purification is critical to obtaining highly active preparations of ISPs and REDs, as was necessary in purifying BPDO (Imbeault et al, 2000). It is difficult to compare the specific activity of reconstituted dioxygenases to other Group II dioxygenases due to differences in assay procedures and the intrinsic enzyme activities. However, elemental analyses indicate that preparations of ISPs and REDs contained full complements of prosthetic groups. Moreover, the addition of exogenous iron or FAD did 80 not increase the preparation's specific activity, in contrast to what has been reported for some aerobically purified enzyme preparations (Eby et al, 2001, Fetzner et al., 1992, Lee, 1999a). The high iron content of ISPs may be due to non-specific binding of iron to the oxygenase, as has been observed in DHBD (Han et al, 1995) and BPDO (Imbeault et al, 2000). Finally, preparations of ISPTADO have a significantly lower R-value than that of preparations of BADO and 2-HBADO (Fetzner et al, 1992, Yamaguchi et al, 1980), suggesting that the anaerobic preparation of the former yielded an ISP preparation that contains a higher proportion of [2Fe-2S] clusters. 3.8.2 In vitro reconstitution of dioxygenase activity The inability to saturate ISPTADO with R E D T A D O , even at a 50-fold molar excess of the latter, is consistent with observations for other dioxygenases, including phthalate dioxygenase and BPDO (Batie et al, 1987, Imbeault et al, 2000). In BADO and ANDO, the Kms of the oxygenases for their reductases were 26 and 1 uM, respectively (Eby et al, 2001, Yamaguchi et al, 1980). It is impractical to perform steady-state kinetics at high concentrations of reductase due to the amount of protein required and the background consumption of O2. However, at the limiting concentrations of R E D T A D O used, TADOM T2 activity is linearly dependent on ISP concentration and the apparent kinetic parameters obtained provide a useful means of evaluating the catalytic properties of the enzyme. 3.8.3 Reductase interchangeability The relative interchangeability of R E D T A D O and R E D B A D O in the two dioxygenases is not surprising given their sequence identity. Single turnover studies have established that the reductase component is required for product release from the ISP, but not for substrate hydroxylation (Wolfe et al, 2001, 2002). Indeed some ring-hydroxylating enzymes of different specificity appear to share the same reductase in vivo. 81 Thus in Ralstonia sp. strain U2, the respective ISPs of salicylate 5-hydroxylase, which transforms salicylate to gentisate, and NDO share the same ferredoxin and reductase component (Zhou et al., 2002). Similarly, plasmid pNLl of S. aromaticivorans F199 carries genes encoding 7 different ISPs but only two copies of reductase-encoding genes (Romine et al., 1999), although it is possible that other reductases are encoded elsewhere in the genome. 3.8.4 Specificities 3.8.4.1 Toluate dioxygenase The lack of specificity data for TADOm t2 or B A D O A D P I precludes direct comparison of the current results with other studies. However, the maximal activity of TADOmt2 for substituted benzoates {meta > unsubstituted > para > ortho; from apparent &cat, Table 6) differs from the relative rates reported for BADO (unsubstituted > meta > ortho > para (Yamaguchi et al., 1980)). Interestingly, the maximal activity of TADOmt2 for substituted benzoates corresponds to the relative rates of transformation of these compounds by E. coli cells containing TADO (Zeyer et al., 1985), but not by m-toluate-grown cells of P. putida mt-2 (unsubstituted > meta > para > ortho (Murray et al., 1972, Reineke et al., 1978a and b, Zeyer et al., 1985)). It is possible that these differences reflect differences in substrate uptake by the cells, as previously noted (Reineke et al., 1978a). However, it seems more likely that the differences reflect the presence of a second benzoate-transforming enzyme in m-toluate-grown cells of P. putida mt-2 (Jeffrey et al., 1992, Nakazawa et al., 1973, Williams et al., 1974). The specificity of TADO m t 2 contrasts markedly to those of 2-HBADO and ANDO, which show strong preferences for ortho substituted benzoates (Eby et al., 2001, Fetzner et al., 1992). Moreover, TADOm t2 differs from 2-HBADO in that the former has no apparent ability to dehalogenate ortho-chlorinated benzoates. Highly active preparations of TADOmt2, together with the 82 availability of closely related enzymes with markedly different substrate specificities, should facilitate the elucidation of the structural determinants of reactivity, including specificity, in this important group of enzymes. The specificity of TADCW for methyl benzoates differs significantly from the effector preference of XylS, which is strongly activated by both meta- and ortho-substituted benzoates {meta ~ ortho > unsubstituted » para (Ramos et al., 1986)). This may reflect a vestigial activity of XylS that predates its recruitment to regulate the TOL meta operon, particularly as high concentrations of o-mefhylated and o-chlorinated benzoates uncouple TADCW- Interestingly, XylS appears to also activate the transcription of the chromosomally located BADO genes of P. putida mt-2 (Jeffrey et al., 1992). It is thus possible that the specificity of XylS reflects a dual regulatory role. In this respect, it would be interesting to determine the substrate specificity of the chromosomally encoded BADO and the effector specificity of BenR, the primary transcriptional regulator of the chromosomal genes (Cowles et al., 2000). 3.8.4.2 Benzoate dioxygenase TADOm t2 and B A D O A D P I are Group II aromatic ring-hydroxylating dioxygenases whose ISP and RED components share 62% and 53% sequence identity, respectively (Harayama et al., 1991). Their relatively high degree of similarity and the solubility of their respective substrates make these enzymes useful models for studies of specificity determinants in ring-hydroxylating dioxygenases. As BADOs from different bacterial isolates have been characterized to different extents in the literature, and no specificity data exist for any of these, it was first necessary to determine the reactivity of B A D O A D P I with substituted benzoates. The activity of purified, reconstituted B A D O A D P I reported herein is consistent with that of BADOci, whose substrate preference was investigated using 1 mM of 83 different benzoates (benzoate > /w-toluate > 3-chlorobenzoate > o-toluate; Yamaguchi et al., 1980). Thus, BADOs from both strains have a preference for methyl versus chloro substituents, and for substituents in the following positions: meta > ortho > para. B A D O B H , present in 3-chlorobenzoate-grown Pseudomonas sp. B-13, has this same preference for substituent position (Reineke et al, 1978a and b). However, the B-13 enzyme prefers chloro substituents over methyl substituents. The substrate preference of 2-halobenzoate 1,2-dioxygenase of Pseudomonas cepacia 2CBS (2HBADO), which shares 56% sequence identity with B A D O A D P I , is different again, preferentially utilizing chloro versus methyl substituents, and benzoates substituted in the following positions: ortho > meta > para (Fetzner et al., 1992). Significant for this thesis, the apparent substrate specificity of B A D O A D P I was narrower than that of TADOmt2 and differed in its preference of ortho versus para substituted benzoates. 3.8.4.3 Hybrid dioxygenases The apparent specificity of each of the hybrid enzymes, OCTPB and OCBPT, corresponded most closely to that of the parent from which the a subunit originated. This indicates that this subunit harbors the major determinants of specificity in these Group II dioxygenases. This finding is consistent with the results of subunit-swapping experiments in Group III and IV enzymes, including NDO (Parales et al, 1998a and b) and BPDO (Kimura et al, 1997; Barriault et al, 2001). Directed mutagenesis and gene shuffling experiments in these systems have further localized the major determinants of substrate preference in the Group III and IV enzymes to the C-terminal domain of the a subunit (Mondello et al, 1997; Kumamaru et al, 1998; Parales et al, 2000a and b; Barriault et al, 2002; Suenaga et al, 2002). This thesis extends this finding as it investigates substrate specificity in purified enzymes. 84 3.8.5 Uncoupling of 0 2 consumption to substrate transformation This thesis demonstrates that the transformation of orf/zo-substituted benzoates by TADOm t2 is severely uncoupled from O2 utilization. The degree of uncoupling indicates that the steady state rate constants determined on the basis of O2 consumption overestimate the true values by at least one order of magnitude. Uncoupling has been observed in other ring-hydroxylating dioxygenases, including NDO (Lee, 1999a) and BPDO (Imbeault et al., 2000), and may reflect the inability of ort/zo-substituted benzoates to displace solvent molecules from the active site of TADOm t2. In principle, ort/20-substituted benzoates could competitively inhibit the transformation of meta- and para-substituted benzoates. However, the relatively high Km of ISPTADO for ortho-substituted benzoates indicates that high concentrations would be required, consistent with the previous finding that o-toluate does not significantly inhibit TADOm t2 activity (Wubbolts et al., 1990). The similar elution times and spectra of the c/s-dihydrodiols obtained from o-toluate and benzoate, respectively, as well as the transformation of the former to catechol by XylL m t 2, suggest that TADOm t2 catalyzes the concomitant dihydroxylation and demethylation of o-toluate. Interestingly, XylLmt2 has been reported to catalyze the demethylation of toluene cw-dihydrodiol. However, this reaction required adenosylcobalamin (Lee, et al, 1999b). Further characterization of these demethylation reactions is warranted. 3.8.6 Specificity determination The current study clearly indicates that the p subunit contributes to reactivity of the dioxygenase. Thus, although CCTPB transformed the same broad range of substituted benzoates as TADOm t2, the apparent specificity of the hybrid was slightly different. Moreover, C<TPB transformed o-toluate with a different regioselectivity and improved coupling than CCTPT- The contribution of the P subunit to dioxygenase activity has been 85 suggested in at least two studies of hybrid BPDOs. For example, replacement of the P subunit of TODO with that of a BPDO yielded an enzyme with improved trichloroethylene-transforming activity (Furukawa et al, 1994; Maeda et al, 2001). Similarly, the ability of purified hybrid BPDOs to transform polychlorinated biphenyls was determined to some extent by the P subunit (Hurtubise et al, 1998; Chebrou et al, 1999). Interestingly, the current studies are consistent with an insertional mutagenesis study of TADOma that demonstrated that disruption of the P subunit affects the enzyme's substrate preference (Harayama et al, 1986). The observation that the P subunit contributes to the reactivity of ring-hydroxylating dioxygenases is consistent with crystallographic structures of NDO (Carredano et al, 2000) and BPDO (Colbert, 2000). These structures demonstrate that while the mononuclear Fe(II) site and the substrate-binding pocket of the ISP are contained entirely within the C-terminal domain of the a subunit of these enzymes, the p subunit probably contributes to the structural integrity and function of the active site. Thus, in BPDO, the interface between the a and P subunits is extensive, constituting a buried surface of 3360 A 2 per ap dimer. Much of this interface involves a central sheet of the P subunit and an extended helix of the a subunit. This extended helix contains Asp386, one of the Fe(II) ligands (Figure 31). Similar packing interactions in NDO lock the structurally analogous helix of this dioxygenase in position. Moreover, the structure of the BPDO:product complex suggests that the extended helix shifts by up to 1.4 A during the catalytic cycle of the enzyme (Colbert & Bolin, personal communication). Thus, the structural data indicate that the close contacts between the a and P subunits in the vicinity of the active site could influence substrate specificity, the coupling of substrate utilization during the dynamic catalytic process, as well as the stability of the ISP. 86 p subunit (Met87-Argl09) Figure 31. A detail of the interface between the a and p subunits of the ISP of BPDOB356. The figure depicts a 3 A hydrogen bond between Asp385 of the a subunit and AsplOl of the p subunit. Asp385 is adjacent to Asp386, one of the Fe(II) ligands. These two aspartates are conserved in ring-hydroxylating dioxygenases (Figure 9), and correspond to Asp371 and Asp372 in TADOM T2- Oxygen, nitrogen, and iron atoms are coloured red, blue, and green, respectively. The biphenyl molecule is coloured yellow. Hydrogen bonds are shown as yellow dots. Figure made using Swiss-PdbViewer v 3.7ba (Guex, 1997) and POV-Ray v 3.5 (Williamstown, Australia). 3.8.7 Concluding Remarks This thesis confirms the value of using highly active, purified enzyme preparations in investigating the structural determinants of substrate specificity. More specifically, the results demonstrate that it is important to not overlook the role of the P subunit in generating ring-hydroxylating dioxygenases with useful activities, both to fine-tune these activities and to optimize the stability of variant enzymes (Parales et al, 2000a and b; Barriault et al, 2002; Suenaga et al, 2002). Indeed, it is possible that subunit exchange occurred during the natural evolution of ring-hydroxylating dioxygenases to produce enzymes with novel, useful activities. Current efforts are focused on 87 understanding the structural basis of the specificities of different BADOs for chlorinated versus alkylated benzoates. 88 4. ARYL c/s-DIOL DEHYDROGENASES 4.1 Expression and purification The xylL gene was amplified from pPL392 by PCR using the primers XylLfor (GCATCCCGGGTTCTCTTCTTAACC, introduced Xmal site underlined) and XylLrev (CGAGGTGGCATATGAACAAACG, introduced Ndel site underlined). The amplified fragment was digested with Ndel and Xmal, and cloned into pT7-7 using the Ndel and Xmal sites of the latter. The resulting plasmid, pT7XYLL, was transformed into E. coli GJ1158 (Bhandari et al, 1997). XylL m t 2 was purified to a final specific activity of 0.6 U/mg with a yield of 11.4 mg/L of cell culture. The yield and specific activity of BphBLB400 were 35 mg/L and 54.4 U/mg, respectively. Details of the purification of each enzyme are summarized in Table 9. SDS-PAGE analysis showed that the purity of XylL m t 2 was >95% and that its molecular weight was 29 kDa (Figure 32). Preparations of BphBLB4oo were of similar quality (results not shown). Gel filtration indicated that the native molecular weights of these dehydrogenases were similar (-120 kDa). This indicates that XylL m t 2 is a tetramer of identical subunits, as has been determined for BphBLB400 by crystallography (Ffiilsmeyer et al, 1998). 4.2 In vitro reconstitution of enzyme activities Under the standard assay conditions, the activity of Xy lL m t 2 was highest at pH 10. This is comparable to the pH optima of NahBN P from P. putida NP and BphBB356, which have been reported to be 9 (Patel et al, 1974; Vedadi et al, 2000). Subsequent studies were performed at pH 9.0. Using saturating concentrations of m-toluate 1,2-diol (270 uM), the Km of XylLm t2 for N A D + was 19.8 ± 3.1 mM. Using saturating concentrations of biphenyl 2,3-diol (138 89 uM), the Km of BphBLB4oo for N A D + was 2.1 ± 0.4 mM. These values were too high to routinely utilize saturating concentrations of N A D + in the dehydrogenase assays. Consequently, 5 mM N A D + was used in the standard assay, and the determined steady-state kinetic parameters for the c/s-diols should be considered as apparent. Table 9 Purification of XylLm t2 and BphBLB4oo X y l L m t 2 BphBLB400 Purification step Total activity Specific activity Yield Total activity Specific activity Yield U U/mg % U U/mg % Crude extract 90 0.10 100 44800 22 100 SourceQ 40 0.22 44 11200 43 25 Superdex 200HR 32 0.29 35 8960 46 20 Phenyl-Sepharose 28 0.62 30 7616 54 17 One unit of enzymatic activity (U) is defined as the quantity of enzyme required to reduce 1 umol of N A D + per minute in the standard assay. 90 1 2 3 4 5 200 - • 116.2 -+ 97.4 Figure 32. Denaturing gel of purified preparations of XylL of P. putida mt-2. The lanes were loaded with 5-10 ug each of: (1) molecular weight standards; (2) whole cell crude extract; (3) after Source Q column; (4) after Superdex column; (5) after Phenyl Sepharose column. The arrow on the right indicates purified XylL m t 2. 4.3 Steady-state kinetic studies The steady-state dehydrogenation of czs-diols by X y l i t e and BphBLB400 obeyed Michaelis-Menten kinetics (Figure 33). Of the tested compounds, the best substrate for XylL m t 2 was w-toluate 1,2-diol, which it utilized with an apparent specificity approximately twice that of benzoate 1,2-diol (Table 10). Interestingly, XylLmt2 utilized toluene 2,3-diol, which lacks a carboxylate, with an apparent specificity that was comparable to that of benzoate 1,2-diol. However, XylLm^ did not detectably transform biphenyl 2,3-diol. 91 25 [m-toluate 1,2-diol] (LIM) Figure 33. Steady-state reduction of N A D + by XylLmg in the presence of m-toluate 1,2-diol. The experiment was performed using 50 mM bicine, pH 9.0 (I = 0.1), 25 ± 1°C containing 5 mM of NAD + . The line represents a best fit of the Michaelis-Menten equation to the data. The fitted parameters are Km = 23.5 ±1.6 uM and V = 0.79 ± 0.02 uM/min. Unsurprisingly, the best substrate for BphBLB4oo was biphenyl 2,3-dihydrodiol. However, the apparent specificity constant of BphBLB4oo for biphenyl 2,3-dihydrodiol was approximately 180 times higher than that of XylLm t2 for its preferred substrate. Moreover, the substrate specificity of BphBLB4oo was much narrower than that of XylLmt2-Thus, the apparent specificity constant of BphBLB4oo for biphenyl 2,3-dihydrodiol was 40 fold greater than for toluene 2,3-dihydrodiol, and the enzyme did not detectably transform either carboxylated cz's-diol. 92 Table 10. Apparent steady-state kinetic parameters of XylLm t2 and BphBLB4oo for cis-diols. X y l L m t 2 BphBLB400 substrate -Km c^at kcat /Km c^at kcs\/Km (MM) (x 1 0 6 M V ) (MM) (x l o V r V 1 ) biphenyl 2,3-dihydrodiol NA NA NA 11.2(1.2) 26.7 (0.02) 2.4 (0.1) toluene 2,3-dihydrodiol 33 (7) 0.17(0.01) 0.005 (0.001) 7.1 (1.4) 0.45 (0.002) 0.06 (0.01) /w-toluate 1,2-diol 24 (2) 0.31 (0.01) 0.013 (0.001) NA NA NA benzoate 1,2- diol 44 (3) 0.28 (0.003) 0.006 (0.001) NA NA NA Reactions carried out in 50 mM bicine, pH 9.0, 25 ± 1°C containing 5 mM of NAD . The Km of X y l L m t 2 for N A D + in the presence of m-toluate 1,2-diol was 20 ± 3 mM. The Km of BphBLB4oo for NAD + in the presence of biphenyl 2,3-dihydrodiol was 2.1 ± 0.4 mM. NA - no detectable activity. 4.4 Identification of reaction products In every case in which the cis-diol was transformed by either X y l L m t 2 or BphBLB400, HPLC analyses indicated that the reaction product was the corresponding catechol (results not shown). In particular, XylLm t2 did not catalyze the demethylation of either m-toluate 1,2-diol or toluene 2,3-dihydrodiol under the conditions tested. 4.5 Sequence alignment and phylogenetic analyses A total of 70 sequences of putative aryl cz's-diol dehydrogenases were retrieved from the NCBI-accessible databases. Of these, 41 were retained for alignment, and subsequent phylogenetic analysis. Analysis of the sequences indicates that these sequences represent 3 evolutionarily distinct types of proteins. Thirty-seven of these enzymes, including all of those identified as XylL, BphB and NahB in the databases, 93 belong to the SDR superfamily. An alignment of these enzymes is presented in Figure 34. A phylogenetic analysis of these sequences indicates that these SDR-type aryl cis-diol dehydrogenases cluster according to their putative substrate preference (Figure 35). Moreover, the topology of the tree bears some similarity to that of the ring-hydroxylating dioxygenases (Nam et al., 2001). Thus, one of the major clades of the tree comprises the benzoate cis-diol dehydrogenases (BenD) and XylL-like enzymes. These enzymes are thought to transform the cz's-diols produced by the Group II dioxygenases. The second major clade of the tree actually contains two subclades. One of these comprises BphB and closely related dehydrogenases that transform toluene (TodD), alkylbenzene and chlorobenzene cz's-diols. The other subclade comprises the NahB-like enzymes. These two groups transform the cz's-diols produced by the Group IV and III dioxygenases, respectively. The similar clustering of the ring-hydroxylating dioxygenases on the one hand, and the SDR-type cz's-diol dehydrogenases on the other indicates that the genes encoding these enzymes likely evolved together for a significant portion of their respective histories. 94 . . M N K R F . . M.N K R F . . M N K R F , . M N U R F . . M N.D R F . M Y P G R F 5 L V T P . H R F . M S T Q R F . M S T Q R F M.N S T Q R F M T D A N G R F M S D L M G-W L . M Q L . M Q L . M K L , M K L . M K L . M R F . M K L . M R L . M K L , U R L M G F L M G F L M G N . . M G N . . M S N . . M S T •'  . M N i: . . M T .A R L 10 Q G K V A V Q G K V A V Q D K T A V Q G K V A I R D K V A L D G R V V T D G K V V A A G K V M V A G K V M V E H K V V . I A D K I A V H N E S I F D G Y S A.V T N E V A L N N E V A L K G E A V L K G E A V L T G E V V L T G E V I L T G E V A L E G E V A L K G E V A L Q D E V V L . . . M l D G K V A L D G K V A L . Q Q V V S . O Q V V S V T V S V T V T V T V. T V T V T I T V T V T V T . a a v v s i . Q Q V I A I . Q Q V I A I E G Q V A L L E G K I A L \ D G V I V N r M G Q W A V I A A Q A A]Q A A Q A A Q A A Q A A Q A A Q A.A-Q A A Q A A Q A A Q G G S A G S G G S G O S G A S G A 'S G A S G A A G A S G G A G G A G C A G Q S G G S G G S A G S A G S A G S A G S A G S A G S A G S :G A T A S R T F A A G 0 R R V A E R M A A E G G R L L L V D-R S E . L 1 H E L A D E L V G V . A E V L T L T A D L E Q F R R V A E R M A A E G G R L L L V D R S E . L 1 H E L A D E L V G V . A E V L T L T A D L E Q F R R V A E R M A A E G G R L L L V D R S E . L 1 H E L A D E L V . G V . A E V L T L T. A D L E Q F R G V C WR L K A E G A Q V V A V D-R S E . I V H E L A G E G M L T L T A D L E O H L G V A R R L L E E G A R V V A V D-R S E . L V E L A G D A C L C L T A D L E R Y L V V A S R A A E G G S V I L V D-R S E . L V H E V A K E L R E K G F a A H S V T A D L E T F L T V A T R L A A E G A S L 1 L D R A E . 1 V H E V A K G L R E N G T D A H S 1 T 'A D L E Q F R G A L R A A A E G A R V L L V D R A O . F V A E V A A E A K S A D T A G F V A D L E T Y R A V A.V R A A A E G G K V L . F V D-R A D . F V S E V A A E A D G A 0 T A G F V A D L E T Y R a V A L R A Q,E G G C L 1 L A D R S O . L 1 Q A V L A E K A L G A L A 1 A V E T D L E T Y F A T A Q R L G R E G A T V V V A D R A- E Q A T L D A V A R L 'A E.S V 0 A H P A 1 H D L E O Q L A L V E R F 1 E E G A Q V A T L" E L S A A K V A S L R a R F G E H L A V E G N V T C Y K A V G R F L T E G A N V . V A F D K S G E K L S A L K T H :G D A V E T. V T G D V R S 1 H A V D R F A E G A R V A V L D K S A A R L Q E L K A A G A K V L G 1 E G D V R V L R A V 0 R F A E G A R V A V L D K S A A R L Q E L a A A G A K V L G 1 E G D V R V L R A L V D R F A E . A K V A V L D K S A E R L A E L E T D L G D N V L G 1 V G D V R S L R A L V 0 R F V A E G A K. V A V L D K S A E R L A E L E T D H G 0 N V L G 1 V G D V R S L R A L V D R F V A E R A K V A V L D K S A E R L A Q L E T D H G D N V L G V T G D V R S L R A L V 0 R F V A E G A K V A V L D'K S A E R L O Q L E S D H G E E V V C 1 V G D V R S L fl A L V 0 R F V A E G A R V A V L D K S : A E R L R E L E V A H G G N A V G V V G D V R S L R A V 0 R Y A E G A R V A V L D K S A A G L E A L R K L H G 0 A V G V E G 0 V R S L R A V D R Y V A E G A R V A V L D K S A A G L E E 1 R K R H G D A V V G 1 E G D V R S L R A V 0 R F V C E G A R V A V L D R S V A G L E E L R A A H G D A V V A V E G • V R Y L R A L V E R F L G E G A R V G V L E K S A E K A E K L A N D F G E D V L V V E G 0 V R K Y R A V V E L Y V Q E G A K V G V L E 1 S P E K V K D L R N A L P A D S V V V T. E G D A T S M R A V V E L Y V Q E G A K V G V L E 1 S P E K V K D L R N A L P A D S V V V T : E : G D A T S M L E L V R S F K S A G Y Y V S A L V R N E E Q E A L L C K E F K D A L E 1 V V G D V R D H L E L V R S F K L A G Y C V S A L V R N E E Q E A L'L C N E F K D A L E 1 V V G D V R D H L E L V R S F K S A G Y Y V S A L V R N E E Q K A K L C N E F K D A L E 1 V V G D V R A H L A L V R 5 F K S A G Y C V S A L v a N E E Q K A S L C N E F K N A L E 1 V V G D V R D H L A L V R S F K S A G Y C V S A L v a N E E Q K A S L C N E F K D A L E 1 V V G D V R D H L E L V R S F K A A G Y C V S A L V R N E E Q E A G L R S E F K D A E 1 V A G D V R D H L E L V R S F K A A G Y C V S A L V R N E E Q E A G L R S E F K D A E 1 V A G D V C D H A A V A H Y L E E G A K V G V L V ,R D A D Q A D M V R M R G K G V V V ,E' G D V R N R A A E T L A A R G A K V 1 G T A T S E N G A a A 1 S D Y L G A N G K G L M L N V T D P K E C L S L A K A G A Q V 1 A F A R N E A N L L S L V K E T T S L R Y T 1 1 P V G D K A Y S F E L A K R G L N V V L 1 S R T L. E K L E A 1 A T E 1 E R T r G R S V K 1 1 Q A D F T K D XylL mt2 XylL S-47 XylL"Pa«r630 BnnG P i l l XylL PAD1 BopC.19070 BenD RHA1 CbeD~NKS BenD2TH2 BenD Accal XylL F199 HcaB K12 BphB_TA4Z1 BphB TK102 BphB_KKS102 BphB_KF707 BphB LB4O0 BpnB~OU83 EbdB~01G3 BphB~B356 TodD F1 TecB_PS12 BphB P6 BphB~RHA1 NarB~12038 RnoB~CIR2 NahB~C18 NnhBlG7 MahBZ 5IIIAS NahBl 5IIIAS NahB SNIO PnhBlCteslH N*gB_U2 BphB F198 .ACP-Rod K12 MDU6*P27 Cat H S D 1 7 B 3 " H B 70 BC 90 100 110 120 130 A E C Q R V M A A A L E R F G R L D 1 L N N;V G G T. 1 WA K P F, E H Y 0 E R E 1 E A E V R R s L F P . . T L W C c H A A L A P M 1 E . Q G S G A 1 V A E C Q R V M A.A A L E R F G H L D 1 L \ N N V G G T 1 WA K P F E H Q E R E l E A E V R R s L F P . . T L w c c H A.A:L A P M E . Q:G S G A 1 V A D C Q R V M A A A L E R F G R L D 1 L N N V : G G T 1 WA,K P F E H Y Q.E H E 1 E A E V R R s L F P . . T L w c c H A A : V p P U L E . Q G S G A 1 V -T 0 C A R M A S A V E T F G R L D 1 L V N N V G G T I W A K P F E H E V E Q 1 E A E V R R s L F P . . T L w c c H A A-L p Y M L E . R G S G A 1 V A E C Q R V L E R T L E R F G R L D 1 L V N N V G G T L WA K P Y Q H A E D E 1 E A E L R R s L L P . . T L w c c R A A L p A M L G . Q G S G A 1 V A G A O S A D E A R Q 0 H G R 1 D V L V N N V G G T 1 WA K'P Y E H Y T P E • 1 Q A E V Q R s L F P . . T L WT C R A V L p Y L 1 E . Q R S G T 1 V A D A E A A D E A R a Q H G R L D V L N N'V G G T 1 WA K P Y E H Y T A E O 1 0 A E Q R s L F P . . T L WT C R A.V.L p L 1 A . a . a S G T 1 V E G A A A A M A F A A R T F G G 1 D 1 L V N G V G G A 1 R M R P Y A E F E P A • 1 D A E R R s L M P . . T L Y A C H A V L p L L E . R G R G T 1 V E G A A S A M D F A A R K F G G 1 D 1 L V N G V G G A 1 R M R.P F A E F E P A • 1 D A E R R s L M P . . T L Y A C H A ; V L p Y L L K . HG G G T 1 V A G A E L V V S H A 1 A E G R 1 D V L N N V<G G A 1 WM K P F Q E F S E E Eil 1 Q E V H R s L F P . . A L W C C R A V L p E M L K . H Q Q G T 1 V T G A A A L Y N:A V S a K F G R 1 D V A V H N V G G T I WA K P V WE Y T T E E 1 V A E N'R s L WP . . T L W C C H A;V'L p H M R A A G R G A 1 V N A D Y Q R A V D O 1 L T R S G K L D C F 1 G N.A G 1 WD H N A S L V N T P A E T L E T G F H E L F N V N V L G Y L L G A K A .C .A p A L 1 A . S E G S M 1 F E D N K R A C E R A 1 E K F G K L D T F V G N.A G L WD F N R T L T D T P S E L L E A G F D E L F G V N V K G Y V L G A K A A 1 p A L Q A . S G G S 1 V L A D H Q K A A R E C V A A F G K 1 DC L P N A ;G 1 WD Y S M P L V D 1 P D D K 1 D A A F D E V F H N V K G Y L L A V K A C L p A L V a . S R G S V V F A D H Q K A A R E C V A A F G K 1 D C L 1 P N A G 1 WD Y S M P L V D P D D R 1 D A A F D E V F H N V K G Y L L A V K A C L p A L V Q . S R G S V V F E D 0 K • A A S R C V A R F G K 1 • T L P N A G 1 WD .Y S T A L V D L P E E S L D A A F 0 E V F H N V K G Y H A V K A.. L p A L V A . S R G N V 1 F E D Q K Q A A S R C V A R F G'K 1 D T L P N A G 1 WD Y S T -A.L V D L P E E S I D A A F D E V F H N V K G Y H A V K A C L p A L V A . S R Q N V 1 F E D O K Q A A S R C V A K F G K 1 D T L 1 P N A G 1 WD Y S T A L 1 D L P E E S L D A A F D E V F H N V K G Y H A V K A C L p A L V A . S R G N V 1 F E D O K R A A S C C 1 A K F G K 1 D T L P N A G 1 WD Y N T Q L V D L P E D S 1 D T A F D E L F 0 N V K G Y H A V K A C L p A L V A . S R G S V 1 C O D O K R A A E R C L A A F G K 1 D T L P N.A G 1. WD Y S T A L A D L P E D K 1 D A A F D D 1 F H V N V K G Y H A V K A C L p A L V S . S R G S V V F D S H R E A V A R C V E A F GlK L D C L V G N A G V WD Y L T Q L V D 1 P D D L 1 S E A F E E M F E V N V K G Y L A A K A A L p A L Y Q : S K G S A 1 F. D s H R E A V A R C V E T F G,K L D C L 1 G N A G V WD Y Q T Q L A D P D N G 1 S E A F D E M F A V K G Y L A A K A A.L p A L' Y K . S K G S A 1 F D s H K E T V A K C V E T F G K L D C Y G N A G V WD Y S T A L V E 1 P E D R L D E A F D E MY S U V K G Y L L. G V K A A L G A L Y A . S R G S V 1 F D D N A R V V Q E T V R Q F G R L D T F V A N A A 1 WD F S T 'K .M V D 1 P V D R L D A L F • ,E M F H N V K G Y L H G A R A A V E E L A A . T 'G G S 1 1 Y A • N E R A V A D V V D A F G P L T T L V C V V G V F D Y F T ' E I P Q L P K D R 1 S E A F D Q L F G V N V K S N L L S V K A A L 0 Q L 1 E . N E G D 1 1 L A D N E R A V A D V V D A F G P L T T L V C V ' V G V F O V F T E 1 P Q L P K D R 1 S E A F D a L F G V N V K S N L L S V K A A L D 0 L E . N E G D I . 1 L A T N E K L 1 K Q T 1 D R F G.H L D C F 1 A N A G 1 WD Y M L S I E E P WE K 1 S S S F D E 1 F D N V K S Y F S G I S A A L P E L K K . T N G S V V M A T N E K L 1 K Q T 1 D R F G H L D C F A N A G 1 WD Y M L N 1 E E P WE K.I S S S F D E 1. F D N V K S Y F S G I S A A L P E L K K . T N G S V V M A P N E K L 1 K:Q T T D R F G H L D C F 1 A N A G V WD Y M L G 1 E E P WE K\ S S S F D E F N N V K S Y F S G I S A A L P E L K K . T N G S V V M P T N E K L 1 K • P P D R F G H L D C L A N A G 1 WD Y M L G 1 E E P WE K l S S S F D E 1. F N N V K S Y F S G I R A A L Q E L K K . T S G S V V M A T N E K L 1 K a T T D R F G H L D C F A N A G 1 WD Y M L G 1 E E P WE K 1 S S S F D E 1 F N N V K 5 Y F S G I R A A L 0 E L K K . T S G S V V M A T N E K L V N K A 1 A R F G H L D C F G N A G 1 WD Y M L G V D E P WE K L S G S F E E 1 F D N V K SlY F S G I S A A L P E L K K . T N G S ' V V V A T N E K L V N K A V A R F G H L D C F G N A G 1 WD Y M L G V D E P W E K.L S G S F E ,E 1 F D N V K S Y F S G I S A A L P E L K K . T 'N Q S V V V S D N Q N A V A A T V A T F G'K. L D V F V G N V . Q I WO Y M T P L A D M b P D K L S E T L D E r F G V N V K G Y F F G A R A A 1 P E L R K . T K G S 1 1 F A S I E S V L E K 1 R A E F G E V D 1 L V N N :A G 1 T R 0 N L L M R M K D E E WN D E T N L S S V F R L S K A V M R A M M K K R H G R 1 1 T S A N E E V L F K L 1 V P H F P. 1 H G L V N N A G 1. A T. N H A 1 G Q 1 T Q Q S D R T F A V N V R G P L 1 A a L -V A R N F V D R Q 1 K G S 1 V D I Y E H I K E K L A G L E l G 1 L V N N V G M L P N L L P S H F L N . A P D E 1 a s L 1. H c N 1 T S^V V K M T a L i L K H M E S . R a K G L 1 L .140 N V P " N V N V N V N V N V N V N V ' A T R . ' A T.R . ' A T R . A T R . ' A T R . ' A T R .: ' A T:R . J A T R . I S N A T R . A T R . I T R . U W V ^ S F F k G F Y V G F Y k G F Y V G F Y k G F Y V G F Y I G F V k G F Y V G F Y V G F Y V G F Y V A F Y I A F Y 3 S H A 3 S H A 3 S H A > S H A 3 S H A 1 S V A S S Y A i S F Y / V G T 3 A A I 3 I A L G V G V G V G V G V G t G I G I G V P G G G S G G G P N G G P N G G P N G G P N G G P N G G P N G G P N G G P G G G P G G G P A G G P G G G P G G G P G G G V G G G V G G G V G G G V G A G V G A G A G G G A G G G T G G G M G N G R P L D F P WP ISO H R.V P H R.V P N R V P N R V P N R V P N R V P N R:V P R R V P R R V P H R.I N R V P i G . P i f G . P L G . P L G . P L G . P L G . P L G . P L G . V L G . V L G . A L G . P L G . P L G . P L G . S C G . S C 6". S C G . S C G.. S C G . S C G -. S C G . T P G:Q A N N H T V L Y S M G A A G A A G A A G A A G A A A A A A A S S A A S A A S A C A A A T A S V A S T A T T G A T A A T A A T A A T A T T A T T A G T A G - G A T A S V S S s s A S A S A S A S A S A S A S A S IA A A C A S S A S G G V G G V G G V G G V G O V G G V G G V G G V G G V G G V G G V H A A H A G H A V H A V a A I H A I H A.V A V A V H A.V H A : V H A i H A,V F A V F A V A V |H A V A V |H A.V A V H A V H A V H A ' V A,G L A A L A F V N A L T N A L T N A L T N A L T N A L T N A I T N A L T N A M T N.A I T N A L T A A L T T G L I V G L V V G M V V G M V V G L V V G L V. V G L V V G L V. V G L V I G L I i: Q L V V G M V V G L I R G L V R G L V. L G M V L G M V L G M V L G M M L G M M L G M V L G M V L G L I I G F S D M V T C A F S A C L A C L A C L A C L A C L A A L A S L H A.L Q S L A S L A A L R Q L K Q L R E L. R E L R E L R E L R E L R E L R O M K O L K Q L K Q L K E L A E L A N S K A L K A L K A L K A.L K A L K A L K A L R O L K S L R C I K A L 170 . A F E T A A F E T A A F E T A A F E T A A F E T A A L E A A A L E A A A M E Y G A M E Y A A F E H A S L E L E A Y E L A A Y E L A A F E L A A Y E L A A . F E L A A F E L A A F . E L A A F E L A A F E L A A H E WG A H E WG A Y E L G A F E L G A Y E L A R T S WR A Y E L A A Y E L A A Y E L A A Y E L A A Y E L A A Y E L A A Y E L A A W E L T A R E V A A N E L G O E E Y K E R G I E R G I: E R G T G R G I D Q G i P Y G I Q Y G I E H N I D C G I P K . V P R . V P H , V P H . V-P Y . V P Y , V P Y . V. P Y . V P H . V. P R . I P R . I P H . I P K . I P K . V: R S . T P E . V P E . I P E . V P H . I P H . I P H . I P H . I P D . V S R.G I S Q N I A K E V : 1B0 R V N A T R V N A T R V N A T R V M A T R V N A V R V V A T R V V A T R V V . A A R V V A T R V N A V R V N C V R V N G V R V N A V R V N G V R V N 6 . V R V N G V R V N G V R V N G V R V N G . V R V N G V R V N G I R V . N G I R V N G I R V N G V R V N G V R Q R R C R V . N A V R V N A V R V N A V R V N A V R V N A V R V N G V R V N G V R V N G V T V N V V R V N S V I I Q V L A P G: A P G A- P G A P G: A .p. G A P G: A P G A P G A.P G A T G A P G: G P C A P G A P G A P. G G'P G: G S .G G P G G V G A P. G A P G A P-G A P G A P G. A P G T R R S P-G S P : G S P G A P G A P G A P G A P-G A P G A-P G N P . T P Y G T E G T E G T E G T E G T D G T D G T E G T E G T • G T K G V N G M A G M D G M S G M S G M N G L G A M P G T I H Y H G T V G T V G T V G T V G T V G T V G T V G T R 190 A R H G G F . A P P R ' R I F A P P R R I F A P P R R V P . A P P R R I " A P V R R V A . A P A R R V P . A P P R R V; P . A P P R R V P . A P P R'K I " V T . R V T P . . S D L R G . . T D L ' R G . . T D L R G . . T D L R G . . S D M R G . . S D L R G . . S D L R G . . T D L R G . . T D L R G . G S D L R G . G S D I R G . G S D L R G . . T D L R G . . T E L R G . . R T A R . . . T S L C G . . T S L C G . . T S L C G . . T S L C G . . T S L C G . . T S L A G . . T S L A G . .' T P L G G . A V S T A M T K Y L N T N V R N S A E P S E Q E K V WY R N S A E P S E Q E K V W Y R N s A E P s E a E K V WY R N s A E Q s E a E K R W Y R N A A A a s E E E R R WY R G P A A Q s E a E K G WY R G P G A E T D Q E K A WY R N A A G D s E Q E K L WM R N T A G D s E a E K V WM R N A a P L s K S E Q V WM R N T A P H s D A D R K G F P a A L G a s E T S I M Q S P D A L G L s N T A I G 0 A P A S L G M A N a A I S . S P A s L G M A N a A I S . s P S S L G M G S K A 1 S T P S S L G M G S K A 1 S . T P S S L G M G G K A 1 S T P C S L G M S E Q S 1 s . s P S S L G L S E Q S 1 s . s L K s L D L 0 D K S 1 S . T L K T L G L Q D a T 1 A . T L K A L D L A E V S L S ; K P G S L G M G E T T 1 T S A I P A L A N E G a S L K D V -H P G P G Q R G P K P Q G R S A S A G F D K M H M K 0 M P A S A G F D K M H M K D M P A S A G F D K M H M K 0 M P A S A G F D K T H M E N M • P A s A G F 0 K T H M E N M P A s A G F D K T K M K 0 M P A s A G F 0 K T K M K 0 M T K A G G T A D V H M E 0 M F E T D M T R A L S V V M T D M G R D N WS D T K T A D E F V K E S L N Y 210 220 230 240 250 260 XylL_ml2 Q Q I V D Q S - L D S S L M.K R Y G S I D E Q V E A I L F L A S . D A A S Y I T G I T L P V A G G . D L G C Q S C S V M F S V S G XylL_S-47 Q Q I V D Q S L D 5 S L M K R Y G S I D E Q V E A I L F L A S . D A A S Y I T G I T L P V A G G . D L G XylLPB*630 Q Q I V D Q T L D S S L M K R Y G N I D E Q A G A I L F L A S . 0 0 A A Y I T S V T L P V A G G . D L G . BenD P111 Q Q I V D Q T L D S S L M H R Y G S I D E Q V G A I L F L A S . D E A S Y I T Q V T L P V G G G D L G xyiL PADI R Q I V E Q T L D S S L M K R Y G S I D E Q V A A I L F L A : S , : D E A S Y I T G V T L P V A G G . D L G BopC tfl070 Q Q I V O Q T V D S S L L K R Y G T L D E Q A A A I T F L A S . E E A S Y I T G T V L P V A G G . D I G BenD_RHA1 Q Q I V O Q T V D S S L L K R Y G T L D E Q A A A I V F L A S . O E A T Y l T G T V L P V A G G . D L G CboD_NK8 N E A V K Q V T E S T Y L K R Y G T L D E Q I A P I L F L A S . D E A S Y I T G A V L P V A G ' S . D N G . BonD_TH2 . S . E A V K Q V . T E S T F L K R Y G S I D E Q A A . P ' I L F L A S , O E A G Y I T G T V L P V A G G . D N G Bon D Accal Q Q V V D Q T I D R S F L G R Y G S I D E Q V N.A I T F L A S i . D E S S Y I T . G S V L P V G G G . D Q G H c a B m - M~$T \ ??T Z\- *l t\- $ £ S E A . 5 Y ! I S .9 T L Y U A G G • 9 1 G BphB~TA421 BphBlrK102 V P L G D M L A S V L P V G R M P V A A E Y T G A Y. V F F A T R G D T F P T T G A L L N H D G G M G V R G ' F F D A A ' G R Q . R P A A E T A A F i T K E K T BphB_KKSlDZ V P L G E M L . T S V L P V G R M P V R A E Y T G A ' Y V F F A T R G D T F P T T G A L L N H 0 -Q 'Q M G V R G ' F F E A T G G K D L P Q K L R L S ' . BphB_KF7D7 V P L A D M L K S V L PI G R M P E V E E Y T G A Y V F F A T R G D A A P A S G A L V N Y D G,G L G V R G F F S G A G G N D L L E Q L N l H P gP£B LB400 V P L A D M L K S V L PI G R M P E V E E Y T ' G A Y V F F A T R . G D A A P A T G A L L N Y . D G G L G V R G F F S G A G G N D L L E Q L N I H P . BphB_OU83 V P L A D M L K S V L PI G R M P E A E E Y T G A Y V F F A T R G D A A P A T G A L L NY. D G G L G V R G F F S G A G G N D L L E R L N l N S EbdB_0IG3 BphB B35S TodD~Fl TecB_PS12 BphB PG BphB'RHAl Na-B "12038 RnoETCIR2 NshB C18 NohB~G7 NahB2 511 IAS NaiiBI 511 IAS NohB_AN10 PaflB_CIOStH NagB U2 . _ . . _ _ BphB"F100 E G L D A M I A G M T P L A R I .A E P 0 0 H T G L Y A L L A S R R D S A Y M T G A V L L S D G G I G I G K R P E G ACP-Red K12 • - ~ , . » . r . ^ . „ „ . u „ ,* „ „ „ MouaaP27 Cel HSD17B3"Hs  0 1  Q'S-.L       1    V E A.I  F L A      Y 1  G 1  L P V A  Q 1  D Q S  S s L M K R Y G S 1 0  Q  E  1   L A S    S Y 1  G 1-  L P V A  Q 1  T '   s L M K R Y G N 1  A 1  F L A S     Y 1  G V T L P V A  Q 1  -T  D S s L M H R Y G S 1  E Q V A. I  F L A 5      1 T G : . V     1   Q.T L D S s L M K R Y G S 1   Q V A A l   L ;S    S Y 1  G V T L     Q 1  D -T V D S s L    G T L   Q A A A 1  F L A S    s Y 1   T V L      1  D Q T V   s L   L D  Q A A A 1  F L A S D    Y 1  G  V L        K Q V T  S T Y    G T L   Q 1 : '   F L A     s Y 1  G  V L P V  S. E A  K Q V T    F L     S 1  E Q  A.PH  F L A  0   G Y 1      0    D Q T 1     L G R Y G S 1    .  1  F L A  D E S S Y 1  G S V  P V G G E V M E Q-T L R D T P L G R F G E P E E L A A A 1 C F L A A D E A s Y 1 T G Q T L Y V A L T P E K 1 A A 1 L P L Q F F P Q P A D F T G P Y V M L T S R R N N R A L S G V M N A 0 F P 1 G E V M K Q R S A L H F E P A P E D Y V A A Y V L L A A K  Q S R T V T G S V F D V s V P L G D M L A S V L P V G R M P V A A E Y ,T G A Y V F F A T R G D T F P T T G A L L N H D V P L  E L T S V L P V   P V R A E Y T G A Y V F F A T    T F P T T A L L   0 V P L A D M L K  V L P  R M P E V E E Y T G A Y V F F A T R G D A A P A S A L V  Y D V  L A D M L  V L P    P E V E E Y T G A Y V F F A T    A A P A T G A L L N Y. D V P L A D M L  V L P G R M P E A E E Y T G A Y V F F A T R G D A A P A T G A L L N Y. D V  L A E L L Q D V L P  M P D A E E Y T G A Y V F F A T R C D S V P A T G T L L N Y D V P L A D M L K S V L P G R M P,A L E E Y T G A'Y V F F A T R G D S L P A :T G A L L N Y. D F^  P L D D M L K S V L P T G R A A T A E E Y A G A Y V F F A T R G D T V P L T G S V L N F D M P L A D M L G P V L P T G R VAT A E E Y.A G A Y V F F A T R A • T P L T G S V L N 1 D V P L G D M L K D 1 L P T G O M A S A E E S T G A Y V F F A T R S E T V P L T G S V L N Y D V S L G D L V K Q C T V L Q.E L P E A A D . Y T G H Y . V L L A S K A N S R T A T G A 1 N C D P D E G L 1 E G 1 N P L G V V A Q P E D H S W S Y A L L A S R E R T S A V T G T 1 N S D A R H R G S N R G H Q S A G R R R 0 P E 0 H S W S Y A L L A S R E R T S A V T G T 1 N S D P G D D M 1 K G L T P L G F A A K P . E 0 V V A P Y L L L A S R K Q G K F 1 T G T V 1 S 1 D P G 1 D D M 1 K G L T P L G F A A K P E D V V A P Y L L L A S R K Q G K F 1 T G T V 1 S 1 D P S 1 D D M 1 K G L T P L G F A A K P E D V V A P Y L L L A S R K Q G K F 1 T G T V 1 S 1 0 P G 1 E 0 M 1 K G L T P L G F A A K A E D V V A P Y L L L A S R D Q G K F 1 T G T V N 1 0 P G E 0 M 1 K G L T P L G F A A K A E D V V A P Y L L L A S R D Q G K F 1 T G T V N 1 0 P G D D M 1 K G L T P L G F A A R P E D V V A P Y L L L A S R E Q G K F 1 T G T V G 1 D P G D D M 1 K.G L T P L G F A A R P E D V V A P Y L L L A S R E O G K F 1 T G T V G 1 D E G L D A M 1 A G M T P L A R 1 :A E P D D H T G L Y A L L A S R R D S A Y M T G A V L L S D D D 0 R  G 1 L A Q V  A G R L G G A Q E 1 A N A.V  F    D E A A Y 1 T G E T L H V N P D K K K K M L D R M P K R F A E V D E V V N A V L F L L S 0 N A S M T T G S T L P V D V T 1 G G E T C G C L A H E 1 U A G F L S L 1 P A W A F Y S G A F O R L L L T H Y V A Y L K 95 Figure 34. Alignment of type II (SDR-type) cis-diol dehydrogenases. Nucleotide binding residues and catalytic residues (Ser, Tyr and Lys) are coloured black. Thirty-six N-terminal amino acids were truncated from HSD17B3_Hs for a clear presentation. The sequences are as follows (database accession numbers as obtained from NCBI are provided in parentheses): XylL_F199, XylL from Novosphingobium aromaticivorans F199 (NP_049181.1); XylL_Paw630, XylL from P. putida Paw630 (AAD31450.2); XylL_mt2, XylL from P. putida mt-2 (CAC86808.1); XylL_S-47, XylL from Pseudomonas sp. S-47 involved in 4Cl-benzoate degradation (AAK08202.1); XylL_PA01, XylL from Pseudomonas aeruginosa PA01 (NP_251205.1); B e n D P l l l , BenD from P. putida P i l l (AAK52290.1); BopL_19070, aryl cis-diol dehydrogenase from Rhodococcus sp. 19070 (AAK58906.1); B e n D R H A l , BenD from Rhodococcus sp. RHA1 (BAB70701.1); BenDADPl , BenD from Acinetobacter calcoaceticus ADP1 (P07772); CbeD_NK8, aryl cw-diol dehydrogenase from Burkholderia sp. NK8 (BAB21466.1); BenD_TH2, BenD from Burkholderia sp. TH2 (BAC16784.1); MouseP27_Cel, protein like mouse adipocyte P27 protein from Caenorhabditis elegans (NP_506182.1); ACP-Red_K12, Chain A of P-Ketoacyl [Acyl Carrier Protein] Reductase from E. Coli K12 (AAC74177.1); HSD17B3_Hs, estradiol 17 p-dehydrogenase 3 from Homo sapiens (NP_000188.1); HcaB_K12, 2,3-dihydroxy-2,3-dihydro-phenylpropionate dehydrogenase from E. coli K12 (P77646); B p h B R H A l , BphB from Rhodococcus sp. RHA1 (BAA06873.1); BphB_TK102, BphB from C. testosteroni TK102 (BAC01055.1); BphB_KKS102, BphB from Pseudomonas sp. strain KKS102 (JC2441); BphB_B356, BphB from C. testosteroni B356 (Q46381); BphB_OU83, BphB from P. putida OU83 (P72220); BphB_KF707, BphB from Pseudomonas pseudoalcaligenes KF707 (P08694); BphB_LB400, BphB from Burkholderia sp. LB400 (CAA46909); BphB_P6, BphB from Rhodococcus globerulus P6 (P47230); BphB_TA421, BphB from Rhodococcus erythropolis TA421 (BAA25607.1); BphB_F199, N. aromaticivorans F199 (NP_049192.1); NahB2_5IIIAS, NahB from P. putida 5IIIASal (AAG53393.1); NahB_C18, NahB from P. putida CI8 (Q52459); NahB_G7, NahB from P. putida Gl (AAD39137); NahBl_5IIIAS, NahB from P. putida 5IIIASal (AAG53392.1); NahB_AN10, NahB from Pseudomonas stutzeri AN10 (AAD02138.1); PahB_CtestH, C. testosteroni H (AAF72978.1); NagB_U2, NahB homolog from Ralstonia sp. U2 (AAD12612.1); NarB_12038, NahB from Rhodococcus sp. NCTMB12038 (AAD30203.1); RnoB_CIR2, aryl cis-diol dehydrogenase from Rhodococcus sp. CIR2 (BAA76340.1); EbdB_01G3, cz'5-2,3-dihydroxy-2,3-dihydroalkylbenzene dehydrogenase from P. putida 01G3 (CAB99200.1); T o d D F l , P. putida F l (P13859); TecB_PS12, cis-chlorobenzene dihydrodiol dehydrogenase from Burkholderia sp. PS12 (AAC46395.1). 96 0.1 Figure 35. Phylogenetic tree of type II (SDR-type) aryl cis-diol dehydrogenases. Enzymes are named as described in the legend of Figure 34. Of the remaining 4 sequences of the 41 that were retained, BedDML2 showed less than 15% sequence identity to any of the other aryl cw-diol dehydrogenases. BedDML2 shares 60% sequence identity with GlyDH from Bacillus stearothermophilus, a type III polyol dehydrogenase whose crystal structure was recently determined (Ruzheinikov et al., 2001). Significantly, the residues of the 2-His-l-carboxylate facial triad that binds Zn 2 + in GlyDH are conserved in BedDML2: Aspl71, His254 and His271 (BedDML2 numbering; Figure 36B). Moreover, the Ser-Tyr-Lys catalytic triad that is 97 E S li^Hnisil i t lgrib: l ^ l i ? f l EMS Vri\ sigslisttjtsi %ts;»s8nsfsi»si?^s»8Tifsntsis^?s;niE:tss!itn»&s$7;2 GylDH_Bs1oa D T K I I A N A P P R L L A S G I A 0 A L A T W V E A R S V I K S Q G K T M A G S I P T I A A E A I A E K C E Q T L F K Y G K L A Y E S V K A K V V T P A i a . siTniriinsLrigpFft^ ikrisiii?! SKrii§3?xiisria^xjiitfi«Hii::K OphB DB01 PhW PTH CbaC_Ctest OptiB Pr.ta OphB 0BO1 PhW PTH CbaC_C1est OphB D3C1 PhW PTH CbaCCtes l OphB 0801 I L K S S D T G T D V T L PhMjPTH M L R S S E E Q R D I T L G V N V E D T Q W R E N P S S CbaC CleM L L E G G K P E . L I G M R A T A V A C A G R S S G R . Figure 36. Sequence alignments of (A) type I (medium-chain) alcohol dehydrogenases (ADH), (B) type III (iron-containing) glycerol dehydrogenases (GLD), and (C) type IV dehydrogenases. (A) ADHHuman, human ADH (dbj BAC06856.1); ADHPapha, ADH from Papio hamadryas (sp P14139); AdhE_Horse, horse liver ADH (sp P00327). Zinc ligands (from the crystallographic structure of horse liver ADH) are coloured black. (B) GldA_C18, GLD from Salmonella typhi CT18 (ref NP_457944.1); BedD_ML2, benzene c/s-dihydrodiol dehydrogenase from P. putida ML2 (sp P50173); GylDH_Bstea, GLD from Bacillus stearothermophilus (gb AAA22477.1). Iron ligands (from the crystallographic structure of GylDH_Bstea) are coloured as black. (C) OphB_DB01, phthalate 4,5-dihydrodiol dehydrogenases from Burkholderia cepacia DB01 (gb AAD03557); Pht4_PTH, phthalate 4,5-dihydrodiol dehydrogenases from Pseudomonas putida plasmid PTH (sp Q05184); CbaC_Ctest, l-carboxy-3-chloro-3,4-cw-dihydroxycyclohexa-l,5-diene dehydrogenase from Comamonas testosteroni (sp Q44258). Potential metal ligands are coloured with different shades. A possible NAD + -binding motif is marked with box. 98 characteristic of SDR enzymes (Jornvall et al, 1995) is absent in BedDML2- No other aryl cis-diol dehydrogenases were retrieved from the databases using the BedDML2 sequence. Finally, CbaCctest, OphB and Pht4, three aryl cis-diol dehydrogenases that were identified as a subgroup of SDR enzymes (Chang et al, 1998) shared less than 15% sequence identity to each of the three types of polyol dehydrogenases. Indeed, these enzymes shared no significant sequence identity with any other protein in the databases. More specifically, the conserved residues of these three aryl cis-diol dehydrogenases (Figure 36C) included neither the Cys and His residues that ligate Zn 2 + in the type I (medium-chain) dehydrogenases (Figure 36A), nor the Ser-Tyr-Lys catalytic triad of the type II (SDR) enzymes, nor the 2-His-l-carboxylate facial triad of the type III ("iron-containing") dehydrogenases (Ruzheinikov et al, 2001). The conserved residues of the three enzymes do include those that could ligate divalent metal ions. However, the order and spacing of these residues in the linear amino acid sequence are not those of the endogenous metal ligands of either the type I or III dehydrogenases. 4.6 Crystallization of XylLm t2 Crystals of XylL m t 2 were obtained only in the presence of NAD + , perhaps because the latter reduces local mobility of protein when bound to the enzyme. Initial trials with commercially available screening kits revealed that small needle-like crystals of XylL m t 2 could be obtained at pH 6.5-8.5 using either ammonium sulfate (1.26 - 2.0 M) or lithium sulfate (1.2 - 2.0 M) in the presence of NAD + (3.5 -100 mM) and a small amount of other salts including NaCl and C0CI2. After further screening of these conditions at different pH values, precipitant concentrations and additive concentrations, the following conditions were found to most reproducibly yield the largest, diffraction-quality crystals: 1.8 M L12SO4, 6% PEG 400, pH 7.5, 25 mM N A D + (Figure 37). Under these conditions, 99 crystals appeared after 7 days, and continued to grow until day 14. Crystals diffracted to 2.2 A (Figure 38). Figure 37. Crystal of X y l i t e The crystal was grown for 10 days under the following conditions: 0.1 M HEPES pH 7.5, 1.8 mM U 2 S O 4 , 25 mM NAD+, 6% PEG 400, 19°C. 100 Figure 38. X-ray diffraction pattern of a crystal of XylLmt2- White circle represents 2.0 A resolution shell. Data were collected using a MAR345 detector (marUSA Inc. Evanston, IL) and an exposure time of 5 min per frame. Raw data were successfully indexed and processed to 2.7 A resolution. The crystal was mounted and the data were collected by Elitza Tocheva (Department of Microbiology & Immunology, UBC). 4.7 Discussion The current sequence analyses indicate that bacterial aryl cz's-diol dehydrogenases constitute at least three evolutionarily distinct types of enzymes. However, only two of these correspond to known types of polyol dehydrogenases. Thus, most aryl c/s-diol dehydrogenases characterized to date belong to the SDR superfamily, and as such are type II polyol dehydrogenases. The sequence similarity of BedDML2 and characterized GlyDHs clearly identifies the former as a type III polyol dehydrogenase. This family of enzymes utilizes either Zn or Fe as a cofactor (Ruzheinikov et al., 2001). Although the current sequence analysis indicates that appropriate ligands are conserved in BedML2, 101 the divalent metal ion dependence of this enzyme has not been reported. Finally, the CbaC-type enzymes do not correspond to any of the three types of polyol dehydrogenases (see Figure 36 for sequence comparison). As these enzymes may represent a fourth type of polyol dehydrogenases, we tentatively designate them as type IV. The phylogeny of the aryl cis-diol dehydrogenases largely reflects that of the ring-hydroxylating dioxygenases with which they are physiologically associated. Thus, the clades and subclades of the type II aryl cw-diol dehydrogenases (Figure 35) correspond approximately to those of Group II, III and IV dioxygenases (Figure 5). Moreover, the type IV aryl cw-diol dehydrogenases are exclusively associated with Group I dioxygenases. These data suggest that the corresponding dioxygenase- and dehydrogenase-encoding genes co-evolved during a significant portion of their recent history. At the same time, it is well known that lateral gene transfer can occur during the evolution of bacterial catabolic pathways. This is apparently what occurred in the case of the fred-encoding benzene catabolic pathway: bedD^u, which encodes a type III polyol dehydrogenase, lies immediately upstream of the genes encoding benzene dioxygenase (BEDO), a Group IV dioxygenase, and is flanked by direct repeats (Fong et al, 1996). The preparations of XylLm t2 and BphBLB4oo obtained in the current study were highly active. Thus, the specific activity of BphBLB4oo was three times higher than that of BphBB356 from C. testosteroni B356 (Vedadi et al., 2000), five times higher than TodDpi (Rogers et al., 1977), and six times higher than that of NahBNp (Patel et al., 1974). This comparison is limited by the fact that the activities of the different enzymes were determined using different assay conditions, including different buffers and concentrations of substrate. The Km values of XylLm t2 and BphBLB4oo for N A D + were higher than those reported for other SDR-type aryl cis-diol dehydrogenases. Thus, the Km values of NahBN P and BphBB356 for N A D + were 0.8 mM (Patel et al, 191 A) and 0.24 mM (Vedadi et al., 2000), respectively. 102 The respective specificities of XylL m t 2 and BphBLB4oo reflect their physiological roles: in both cases, the preferred substrate (m-toluate 1,2-diol and biphenyl 2,3-dihydrodiol, respectively) was the diol of the preferred substrate of the pathway in which the enzyme occurs. Nevertheless, the relative specificities of these two enzymes are strikingly different. Thus, the apparent specificity constant of BphBLB400 for its natural substrate was approximately 180-fold higher than that of X y l L m t 2 for its preferred substrate. Much of this difference is reflected in the turnover numbers (&cat). In this respect, it should be noted that under the assay conditions, XylL m t 2 was only 20% saturated with N A D + whereas BphBLB4oo was approximately 70% saturated. Thus, the true &cat values of these enzymes in the presence of their respective preferred substrates is expected to differ by 25-fold. Although the activity of XylL m t 2 was lower than that of BphBLB400, the former enzyme transformed a broader range of aryl c/s-diols. Most strikingly, the apparent specificity constant of XylL m t 2 for toluene 2,3-dihydrodiol, a non-carboxylated aryl cis-diol, was only half that of the preferred substrate of the enzyme, and only one tenth that of BphBLB4oo for toluene 2,3-dihydrodiol (Table 10). In contrast, BphBLB4oo did not detectably transform either of the two carboxylated cw-diols that were tested. It is possible that the biochemical activity of XylL is somewhat unique as this enzyme is part of a catabolic pathway that degrades a range of substituted benzoates. The catalytic properties of X y l i t e may be connected to the enzyme's ability to demethylate toluene 2,3-dihydrodiol in the presence of adenosylcobalamin (Lee et al., 1999b). However, it ' does not appear that the lower activity and broader specificity of XylL m t 2 versus BphBLB4oo represent the properties of the two major classes of SDR-type aryl cw-diol dehydrogenases. Thus, the apparent specificity constant of BphBB356 for biphenyl 2,3-diol, which is similar to that of BphBLB4oo reported here, was significantly higher than that of NahBo7 for naphthalene 1,2-diol (Barriault et al, 1999). It has been suggested 103 that the different activities of BphB and NahB may reflect a differing susceptibility of the 2,3-dihydroxybiphenyl and 1,2-dihydroxynaphthalene to non-enzymatic oxidation to quinones (Werlen et al, 1996; Patel et al, 1974). This thesis, together with the report of Barriault et al (1999), demonstrate that aryl cis-diol dehydrogenases vary considerably in the relaxed nature of their substrate specificities. The crystallographic structure of XylLm t2, and its comparison with that of BphBLB4oo, may help elucidate the molecular basis of the different properties of these enzymes. 104 5. REFERENCES Abramowicz, D. A. 1990. Aerobic and anaerobic biodegradation of PCBs: a review. Grit. Rev. Biotechnol. 10:241-251 Alder, E. 1977. Lignin chemistry-Past, present and future. Wood Sci. Technol. 11:169-218 Ausubel, F. M. , R. Brent, R. E. Kinston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 2000. Current Protocols in Molecular Biology, J. Wiley & Sons Inc., New York Barriault, D., C. Simard, H. Chatel, and M . Sylvestre. 2001. Characterization of hybrid biphenyl dioxygenases obtained by recombining Burkholderia sp. strain LB400 bphA with the homologous gene of Comamonas testosteroni B-356. Can. J. Microbiol. 47:1025-32 Barriault, D., M . Vedadi, J. Powlowski, and M . Sylvestre. 1999. c/s-2,3-dihydro-2,3-dihydroxybiphenyl dehydrogenase and cw-l,2-dihydro-l,2-dihydroxynaphthalene dehydrogenase catalyze dehydrogenation of the same range of substrates. Biochem. Biophys. Res. Commun. 260:181-187 Barriault, D., M-M. Plante, and M . Sylvestre. 2002. Family shuffling of a targeted bphA region to engineer biphenyl dioxygenase. J. Bacteriol. 184:3794-3800 Barton, G. J. 1993. ALSCRTPT: a tool to format multiple sequence alignments. Protein Eng. 6:37-40 Batie, C. J., D. P. Ballou, and C. C. Correll. 1991. Phthalate dioxygenase reductase and related flavin-iron-sulfur containing electron transferases. Chem. Biochem. Flavoenzymes 3:543-556 Batie, J. C , E. LaHaie, and P. D. Ballou. 1987. Purification and characterization of phthalate oxygenase and phthalate oxygenase reductase from Pseudomonas cepacia. J. Biol. Chem. 262:1510-1518 Bayly, R.C, and M . G. Barbour. 1984. The degradation of aromatic compounds the meta and gentisate pathways: biochemistry and regulation, p. 253-294. In D.T. Gibson (ed.), Microbial Degradation of Organic Compounds. Dekker, New York Beil, S., R. J. Mason, N.T. Timmis, and D. H. Pieper. 1998. Identification of chlorobenzene dioxygenase sequence elements involved in dechlorination of 1,2,4,5-tetrachlorobenzene. J. Bacteriol. 180:5520-5528 Beinert, H. 1990. Recent developments in the field of iron-sulfur proteins. FASEB J. 4: 2483-2491 Beinert, H., R. H. Holm, and E. Munck. 1997. Iron-sulfur clusters: Nature's modular, multipurpose structures. Science 277:653-659 105 Bertani, G. 1951. Studies on lysogenesis, the mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300 Bhandari, P., and J. Gowrishankar. 1997. An Escherichia coli host strain useful for efficient overproduction of cloned gene products with NaCl as the inducer. J. Bacteriol. 179:4403-4406 Blatny, J. M. , T. Brautaset, H. C. Winther-Larsen, P. Karunakaran, and S. Valla. 1997. Improved broad-host-range RK2 vectors useful for high and low regulated gene expression levels in gram-negative bacteria. Plasmid 38:35-51 Blumer, M. , and W. W. Youngblood, W. W. 1975. Polycyclic aromatic hydrocarbons in soils and recent sediments. Science 188:53-55 Boyd, D. R., and G. N . Sheldrake. 1998. The dioxygenase-catalysed formation of vicinal cis-diols. Nat. Prod. Rep. 15:309-3224 Bradford, M . M . 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254 Butler, C. S., and J. R. Mason. 1997. Structure-function analysis of the bacterial aromatic ring-hydroxylating dioxygenases. Adv. Microb. Physiol. 38:47-84 Carredano, E., A Karlsson, B. Kauppi, D. Choudhury, R. E. Parales, J. V. Parales, K. Lee, D. T. Gibson, H. Eklund, and S. Ramaswamy. 2000. Substrate binding site of naphthalene 1,2-dioxygenase: functional implications of indole binding. J. Mol. Biol. 296:701-712 Chang, H. K., and G. J. Zylstra. 1998. Novel organization of the genes for phthalate degradation from Burkholderia cepacia DBOl . J. Bacteriol. 180:6529-6537 Chebrou, H., Y. Hurtubise, D. Barriault, and M . Sylvestre. 1999. Heterologous expression and characterization of the purified oxygenase and of chimeras derived from it. J. Bacteriol. 181:4805-4811 Chen, J. S., and L. E. Mortenson 1977. Inhibition of methylene blue formation during determination of the acid-labile sulfide of iron-sulfur protein samples containing dithionite. Anal. Biochem. 79:157-165 Cleland, W.W. 1963. The kinetics of enzyme-catalyzed reactions with two or more substrates or products. Biochim. Biophys. Acta 67:104-137. Colbert, C. L., 2000. Initiating the biodegradation of PCBs: Structural analysis of the biphenyl dioxygenase system. Ph.D. thesis. Purdue University, West Lafayette. Cornish-Bowden, A. 1995. Analysis of Enzyme Kinetic Data, Oxford University Press, New York 106 Correll, C. C , M . L. Ludwig, C. M . Bruns, and P. A. Karplus. 1993. Structural prototypes for an extended family of flavoprotein reductases: comparison of phthalate dioxygenase reductase with ferredoxin reductase and ferredoxin. Protein Sci. 2:2112-2133 Coulter, E. D., N . Moon, C. J. Batie, W. R. Dunham, and D. P. Ballou. 1999. Electron paramagnetic resonance measurements of the ferrous mononuclear site of phthalate dioxygenase substituted with alternate divalent metal ions: direct evidence for ligation of two histidines in the copper(U)-reconstituted protein. Biochemistry 38:11062-11072 Couture, M . M. , C. L. Colbert, E. Babini, F. I. Rosell, A. G. Mauk, J. T. Bolin, and L. D. Eltis. 2001. Characterization of BphF, a Rieske-type ferredoxin with a low reduction potential. Biochemistry 40:84-92. Cowles, C. E., N . N . Nichols, and C. S. Harwood. 2000. BenR, a XylS homologue, regulates three different pathways of aromatic acid degradation in Pseudomonas putida. J. Bacteriol. 182:6339-6346 Dagley, S. 1978a. Determinants of biodegradability. Q Rev. Biophys. 11:577-602 Dagley, S. 1978b. Pathways for the utilization of organic growth substrates, p. 305-388. In L.N. Ornston and J. R. Sokatch (ed.), The Bacteria Volume 10. Academic Press, New York. Dagley, S. 1986. Biochemistry of aromatic hydrocarbon degradation in pseudomonads p527-555 In J. R. Sokatch(ed), The bacteria Vol. 10. The biology of Pseudomonas. Academic Press Inc. Orlando. Fla Danganan, C. E., R. W. Ye, D. L. Daubaras, L. Xun, and A. M . Chakrabarty. 1994. Nucleotide sequence and functional analysis of the genes encoding 2,4,5-trichlorophenoxyacetic acid oxygenase in Pseudomonas cepacia AC 1100. Appl. Environ. Microbiol. 60:4100-4106. DeLano, W. L. 2002. The PyMOL molecular graphics system. Delano Scientific, San Carlos. CA de Lorenzo, V., L. D. Eltis, B. Kessler, and K. N. Timmis. 1993a. Analysis of Pseudomonas gene products using lacf/Ptrp-lac plasmids and transposons that confer conditional phenotypes. Gene 123:17-24 de Lorenzo, V., S. Fernandez, M . Herrero, U. Jakubzik, and K. N . Timmis. 1993b. Engineering of alkyl- and haloaromatic-responsive gene expression with mini-transposons containing regulated promoters of biodegradative pathways of Pseudomonas. Gene 130:41-46 Deng, W. P., and J. A. Nickoloff. 1992. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem. 200:81-88 107 Dente, L., and R. Cortese. 1987. pEMBL: a new family of single-stranded plasmids for sequencing DNA. Methods. Enzymol. 155:111-119 Doan, L. X , A. Hassan, S. J. Lipscomb, A. Dhanda, Z. Zhang, and C. J. Schofield. 2000. Mutagenesis studies on the iron binding ligands of clavaminic acid synthase. Biochem. Biophys. Res. Commun. 279:240-244. Duncan, T., S. C. Trewick, P. Koivisto, P. A. Bates, T. Lindahl, and B. Sedgwick. 2002. Reversal of DNA alkylation damage by two human dioxygenases. Proc. Natl. Acad. Sci. U. S. A. 99:16660-16665. Eaton, R.W. 1996. p-Cumate catabolic pathway in Pseudomonas putida Fl: cloning and characterization of DNA carrying the cmt operon. J. Bacteriol. 178: 1351-1362 Eby, D. M. , Z. M . Beharry, E. D. Coulter, D. M . Kurtz, Jr., and E. L. Neidle. 2001. Characterization and evolution of anthranilate 1,2-dioxygenase from Acinetobacter sp. Strain ADP1. J. Bacteriol. 183:109-118 Eltis, L. D., S. Iwagami, and M . Smith. 1994. Hyperexpression of a synthetic gene encoding a high potential iron sulfur protein. Protein Engineering 7:1145-1150 Ensley, B. D., and D. T. Gibson. 1983. Naphthalene dioxygenase: purification and properties of a terminal oxygenase component. J. Bacteriol. 155:505-511 Erickson B. D., and F. J. Mondello. 1992. Nucleotide sequencing and transcriptional mapping of the genes encoding biphenyl dioxygenase, a multicomponent polychlorinated-biphenyl-degrading enzyme in Pseudomonas strain LB400. J. Bacteriol. 174 :2903-2912 Faber, 2001. Biotransformations in Organic Chemistry, Springer-Verlag, Berlin. Fan, F, J. A. Lorenzen, and B. V. Plapp. 1991. An aspartate residue in yeast alcohol dehydrogenase I determines the specificity for coenzyme. Biochemistry 30:6397-6401 Faraday, M . 1825. On new compounds of carbon and hydrogen, and on certain other products obtained during the decomposition of oil by heat. Phil. Trans. 440 Faroon, O. M , S. Keith, D. Jones, and C. de Rosa. 2001a. Effects of polychlorinated biphenyls on development and reproduction. Toxicol. Ind. Health 17:63-93. Faroon, O. M , S. Keith, D. Jones, and C. de Rosa. 2001b. Carcinogenic effects of polychlorinated biphenyls. Toxicol. Ind. Health 17:41-62. Feist, C. F., and F. D. Hegeman. 1969. Phenol and benzoate metabolism by Pseudomonas putida: regulation of tangential pathways. J. Bacteriol. 100:869-877 108 Fetzner, S., R. Muller and F. Lingens. 1992. Purification and some properties of 2-halobenzoate 1,2-dioxygenase, a two-component enzyme system from Pseudomonas cepacia 2CBS. J. Bacteriol. 174:279-290 Fong, K. P., C. B. Goh, and H. M . Tan. 1996. Characterization and expression of the plasmid-borne bedD gene from Pseudomonas putida ML2, which codes for a NAD+-dependent c/s-benzene dihydrodiol dehydrogenase. J. Bacteriol. 178:5592-5601 Furukawa, K, N . Tomizuka, and A. Kamibayashi. 1979. Effect of chlorine substitution on the bacterial metabolism of various polychlorinated biphenyls. Appl. Environ. Microbiol. 38:301-310 Furukawa, K., J. Hirose, S. Hayashida, and K. Nakamura. 1994. Efficient degradation of trichloroethylene by a hybrid aromatic ring dioxygenase. J. Bacteriol. 176:2121-2123 Gassner, G.T., D.P. Ballou, D.P., G.A. Landrum, G.A. and J. W. Whittaker J.W. 1993. Magnetic circular dichroism studies on the mononuclear ferrous active site of phthalate dioxygenase from Pseudomonas cepacia show a change of ligation state on substrate binding. Biochemistry 32: 4820-4825 Gibson, D. T. 1987. Microbial metabolism of aromatic hydrocarbons and the carbon cycle, pp. 33-58. In S. R. Hagedorn, R. S. Hanson, D. A. Kunz (ed.), Microbial Metabolism and the Carbon Cycle. Harwood Academic Press, Chur, Switzerland Gibson, D. T., and R. E. Parales. 2000. Aromatic hydrocarbon dioxygenases in environmental biotechnology. Curr. Opin. Biotechnol. 11:236-243 Gibson, D. T., M . Hensley, H. Yoshioka, and T. J. Mabry. 1970. Formation of (+)-czs,-2,3-dihydroxy-l-methylcyclohexa-4,6-diene from toluene by Pseudomonas putida. Biochemistry 9:1626-1630 Gibson, D. T., R. L. Roberts, M . C. Wells, and V. M . Kobal. 1973. Oxidation of biphenyl by a Beijerinckia species. Biochem. Biophys. Res. Commun. 50:211-219 Gibson, J, and C. S. Harwood. 2002. Metabolic diversity in aromatic compound utilization by anaerobic microbes. Annu. Rev. Microbiol. 56:345-369 Goodwill, K. E., C. Sabatier, C , Marks. R., Raag, P. F. Fitzpatrick, and R. C. Stevens. 1997. Crystal structure of tyrosine hydroxylase at 2.3 A and its implications for inherited neurodegenerative diseases. Nat. Struct. Biol. 4:578-585 Guex, N. , and M . C. Peitsch. 1997. Swiss-MODEL and Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723 Haak, B., S. Fetzner, and F. Lingens. 1995. Cloning, nucleotide sequence, and expression of the plasmid-encoded genes for the two-component 2-halobenzoate 1,2-dioxygenase from Pseudomonas cepacia 2CBS. J. Bacteriol. 177:667-675. 109 Haigler, B. E., and D. T. Gibson. 1990. Purification and properties of NADH-ferredoxinNAp reductase, a component of naphthalene dioxygenase from Pseudomonas sp. strain NCIB 9816. J. Bacteriol. 172:457-464 Halliwell, B., and J. M . C. Gutteridge. 1984. Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem. J. 219:1-14 Han, S., L. D. Eltis, K. N . Timmis, S. W. Muchmore, and J. T. Bolin. 1995. Crystal structure of the biphenyl-cleaving extradiol dioxygenase from a PCB-degrading pseudomonad. Science 270:976-980 Hanahan, D. 1983. Studies on transformation of. Escherichia coli with plasmids. J. Mol. Biol. 166:557-580 Harayama, S., P. R. Lehrbach, and K. N . Timmis. 1984. Transposon mutagenesis analysis of meta-cleavage pathway operon genes of the TOL plasmid of Pseudomonas putida mt-2. J. Bacteriol. 160:251-255 Harayama, S., and M . Rekik. 1989. Bacterial aromatic ring-cleavage enzymes are classified into two different gene families. J. Biol. Chem. 264:15328-15333 Harayama, S., and M . Rekik. 1990. The meta cleavage operon of TOL degradative plasmid pWWO comprises 13 genes. Mol. Gen. Genet. 221:113-120 Harayama, S., M . Rekik, A. Bairoch, E. L. Neidle, and L. N . Ornston. 1991. Potential DNA slippage structures acquired during evolutionary divergence of Acinetobacter calcoaceticus chromosomal benABC and Pseudomonas putida TOL pWWO plasmid xylXYZ, genes encoding benzoate dioxygenases. J. Bacteriol. 173:7540-7548 Harayama, S., M . Rekik, and K. N. Timmis. 1986. Genetic analysis of a relaxed substrate specificity aromatic ring dioxygenase, toluate 1,2-dioxygenase, encoded by TOL plasmid pWWO of Pseudomonas putida. Mol. Gen. Genet. 202:226-234 Hegg, E. L., and L. Que Jr. 1997. The 2-His-l-carboxylate facial triad: An emerging structural motif in mononuclear non-heme iron(U) enzymes. Eur. J. Biochem. 250:625-629 Herrero, M. , V, V. de Lorenzo, and K. N. Timmis. 1990. Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J. Bacteriol. 172:6557-6567 Hofer, B., L. D. Eltis, D. N . Dowling, and K. N . Timmis. 1993. Genetic analysis of a Pseudomonas locus encoding a pathway for biphenyl/polychlorinated biphenyl degradation. Gene 130:47-55 Hudlicky, T., D. Gonzalez, and D.T. Gibson. 1999. Enzymatic hydroxylation of aromatics in enantioselective synthesis: expanding asymmetric methodology. Aldrichimica Acta 32:35-62. 110 Hulsmeyer, M , H. J. Hecht HJ, K. Niefind K, B. Hofer B, L. D. Eltis LD, K. N. Timmis KN, and D. Schomburg. D. 1998. Crystal structure of czs-biphenyl-2,3-dihydrodiol-2,3-dehydrogenase from a PCB degrader at 2.0 A resolution. Protein Sci. 7:1286-1293 Hurtubise, Y., D. Barriault, and M . Syllvestre. 1998. Involvement of the terminal oxygenase beta subunit in the biphenyl dioxygenase reactivity pattern toward chlorobiphenyls. J. Bacteriol. 180:5828-5835 Imbeault, N . Y. , J. B. Powlowski, C. L. Colbert, J. T. Bolin, and L. D. Eltis. 2000. Steady-state kinetic characterization and crystallization of a polychlorinated biphenyl-transforming dioxygenase. J. Biol. Chem. 275:12430-12437. Jeffrey, W. H., S. M . Cuskey, P. J. Chapman, S. Resnick, and R. H. Olsen. 1992. Characterization of Pseudomonas putida mutants unable to catabolize benzoate: cloning and characterization of Pseudomonas genes involved in benzoate catabolism and isolation of a chromosomal DNA fragment able to substitute for xylS in activation of the TOL lower-pathway promoter. J. Bacteriol. 174:4986-4996 Jenkins, G. N. , D. W. Ribbons, D. A. Widdowson, A. M . Z. Slawin, and D. J. Williams. 1995. Synthetic application of biotransformations: absolute stereochemistry and diels-alder reactions of the (lS,2R)-l,2-dihydroxycyclohexa-3,5-diene-l-carboxylic acid from Pseudomonas putida. J. Chem. Soc. Perkin Trans 1.1995:47-2655 Jiang, H, R. E. Parales, N. A. Lynch, and D.T. Gibson. 1996. Site-directed mutagenesis of conserved amino acids in the alpha subunit of toluene dioxygenase: potential mononuclear non-heme iron coordination sites. J. Bacteriol. 178: 3133-3139 Jiang, H., R. E. Parales, and D. T. Gibson. 1999. The alpha subunit of toluene dioxygenase from Pseudomonas putida F l can accept electrons from reduced FerredoxinTOL but is catalytically inactive in the absence of the beta subunit. Appl. Environ. Microbiol. 65:315-318 Jornvall, H, B. Persson, M . Krook, S. Atrian, R. Gonzalez-Duarte, J. Jeffery, and D. Ghosh. 1995. Short-chain dehydrogenases/reductases (SDR). Biochemistry 34:6003-6013 Jornvall, H., J. O. Hoog, and B. Persson. 1999. SDR and MDR: completed genome sequences show these protein families to be large, of old origin, and of complex nature. FEBS Lett. 445:261-264 Kallberg, Y., U. Oppermann, H. Jornvall, and B. Persson. 2002. Short-chain dehydrogenase/reductase (SDR) relationships: a large family with eight clusters common to human, animal, and plant genomes. Protein Sci. 11:636-641. Kauppi, B., K. Lee, E. Carredano, R. E. Parales, D. T. Gibson, H. Eklund, and S. Ramaswamy. 1998. Structure of an aromatic-ring-hydroxylating dioxygenase-naphthalene 1,2-dioxygenase. Structure 6:571-586 i l l Kessler, B., K. N. Timmis, and V. de Lorenzo. 1994. The organization of the Pm promoter of the TOL plasmid reflects the structure of its cognate activator protein XylS. Mol. Gen. Genet. 244:596-605 Kimura, N. , A. Hishi, A. M . Goto, M. , and K. Furukawa K. 1997. Functional analyses of a variety of chimeric dioxygenases constructed from two biphenyl dioxygenases that are similar structurally but different functionally. J. Bacteriol. 179: 3936-3943 Kreisberg-Zakarin, R, I. Borovok, M . Yanko, Y. Aharonowitz, and G. Cohen. 1999 Recent advances in the structure and function of isopenicillin N synthase. Antonie Van Leeuwenhoek. 75:33-39. i Kumamaru, T., H. Suenaga, M . Mitsuoka, T. Watanabe, and K. Furukawa. 1998. Enhanced degradation of polychlorinated biphenyls by directed evolution of biphenyl dioxygenase. Nat. Biotechnol. 16:663-666 Lah, M . S., M . M . Dixon, K. A. Pattridge, W. C. Stallings, J. A. Fee, and M . L. Ludwig. 1995. Structure-function in Escherichia coli iron superoxide dismutase: comparisons with the manganese enzyme from Thermus thermophilus. Biochemistry 34:1646-1660 Lee K. 1999a. Benzene-induced uncoupling of naphthalene dioxygenase activity and enzyme inactivation by production of hydrogen peroxide. J. Bacteriol. 181:2719-2725. Lee, J.-Y., H.-S. Park, and H. S. Kim. 1999b. Adenosylcobalamin-mediated methyl transfer by toluate cz's-dihydrodiol dehydrogenase of the TOL plasmid pWWO. J. Bacteriol. 181:2953-2957 Lipscomb, J. D., S. G. Sligar, M . J. Namtvedt, and I. C. Gunsalus. 1976. Autooxidation and hydroxylation reactions of oxygenated cytochrome P-450canv J- Biol. Chem. 251:1116-1124 Liu, Y, J. C. Nesheim, S. K. Lee, and J. D. Lipscomb. 1995. Gating effects of component B on oxygen activation by the methane monooxygenase hydroxylase component. J. Biol. Chem. 270:24662-24665 Maeda, T., Y. Takahashi, H. Suenage, A. Suyama, M . Goto, and K. Furukawa. 2001. Functional Analyses of Bph-Tod hybrid dioxygenase, which exhibits high degradation activity toward trichloroethylene. J. Biol. Chem. 276:29833-29838 Markus, A., D. Krekel, and F. Lingens. 1986. Purification and some properties of component A of the 4-chlorophenyacetate 3,4-dioxygenase from Pseudomonas species strain CBS. J. Biol. Chem. 261:12883-12888 Master, E. R, and W. W. Mohn. 2001. Induction of bphA, encoding biphenyl dioxygenase, in two polychlorinated biphenyl-degrading bacteria, psychrotolerant Pseudomonas strain Cam-1 and mesophilic Burkholderia strain LB400. Appl. Environ. Microbiol. 67:2669-2676 112 Mermod, N., J. L. Ramos, A. Bairoch, and K. N . Timmis. 1987. The xylS gene positive regulator of TOL plasmid pWWO: identification, sequence analysis and overproduction leading to constitutive expression of meta cleavage operon. Mol. Gen. Genet. 207:349-354. Minor, W., J, Steczko, B. stec, Z. Otwinowski, J. T. bolin, R. Walter, and B. Axelrod. 1996. Crystal structure of xoybena lipoxygenase L - l at 1.4 A resolution. Biochemistry 35:10687-10701 Miroux, B., and J. E. Walker. 1996. Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 260:289-298 Mondello, F. J., M . P. Turcich, J. H. Lobos, and B. D. Erickson. 1997. Identification and modification of biphenyl dioxygenase sequences that determine the specificity of polychlorinated biphenyl degradation. Appl. Environ. Microbiol. 63:3096-3103. Mortenson, L. E., R. C. Valentine, and J. E. Carnahan. 1962. An electron transport factor from Clostridium pasteurianum. Biochem. Biophys. Res. Commun. 7:488 Murray, K., C. J. Duggleby, J. M . Sala-Trepat, and P. A. Williams. 1972. The metabolism of benzoate and methybenzoates via the meto-cleavage pathway by Pseudomonas arvilla mt-2. Eur. J. Biochem. 28:301-310 Nakatsu, C. H., M . Providenti, and R. C. Wyndham. 1997. The cz's-diol dehydrogenase cbaC gene of Tn5271 is required for growth on 3-chlorobenzoate but not 3,4-dichlorobenzoate. Gene 196:209-218 Nakazawa, T., and T. Yokota. 1973. Benzoate metabolism in Pseudomonasputida(arvilla) mt-2: demonstration of two benzoate pathways. J. Bacteriol. 115:262-267 Nam J. W., H. Nojiri, T. Yoshida, H. Habe, H. Yamane, and T. Omori. 2001. New classification system for oxygenase components involved in ring-hydroxylating oxygenations. 2001, Biosci. Biotechnol. Biochem. 65, 254-63 Neidle, E. L., C. Hartnett, L. N . Ornston, A. Bairoch, M . Rekik, and S. Harayama. 1991. Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases. J. Bacteriol. 173:5385-5395. Neidle, E. L., M . K. Shapiro, and L.N. Ornston. 1987. Cloning and expression in Escherichia coli of Acinetobacter calcoaceticus genes for benzoate degradation. J. Bacteriol. 169 :5496-5503 Nomura, Y., M . Nakagawa, N. Ogawa, S. Harashima, and Y. Oshima, 1992. Genes in PHT plasmid encoding the initial degradation pathway of phthalate in Pseudomonas putida. J. Ferment. Bioeng. 74:333-344 113 Nordlund, I., J. Powlowski, and V. Shingler. 1990. Complete nucleotide sequence and polypeptide analysis of multicomponent phenol hydroxylase from Pseudomonas sp. strain CF600. J. Bacteriol. 172: 6826-6833 Page, R. D. M . 1996. TreeView: An application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12:357-358 Palmer, G., G. Palmer, H. Brintzinger, and R. W. Estabrook.1967. Spectroscopic studies on spinach ferredoxin and adrenodoxin. Biochemistry 6:1658-1664. Parales, R. E., J. V. Parales, and D. T. Gibson. 1999. Aspartate 205 in the catalytic domain of naphthalene dioxgyenase in essential for activity. J. Bacteriol. 181:1831-1837 Parales, R. E., K. Lee, S. M . Resnick, H. Jiang, D. J. Lessner, and D. T. Gibson. 2000a. Substrate specificity of naphthalene dioxygenase: effect of specific amino acids and the active site of the enzyme. J. Bacteriol. 182:1641-1649 Parales, R. E., M . D. Emig, N. A. Lynch, and D. T. Gibson. 1998a. Substrate specificities of hybrid naphthalene and 2,4-dinitrotoluene dioxygenase enzyme systems. J. Bacterial. 180:2337-2344 Parales, R. E., S. M . Resnick, C-L Yu, D. R. Boyd, N . D. Sharma, and D. T. Gibson. 2000b. Regioselectivity and enantioselectivity of naphthalene dioxygenase during arene cz's-dihydroxylation: Control by phenylalanine 352 in the a subunit. J. Bacteriol. 182:5495-5504 Parales, V. J., R. E. Parales, M . S. Resnick, and D. T. Gibson. 1998b. Enzyme specificity of 2-nitrotoluene 2,3-dioxygenase from Pseudomonas sp. strain JS42 is determined by the C-terminal region of the alpha subunit of the oxygenase component. J. Bacteriol. 180:1194-1199. Patel, T. R., and D. T. Gibson. 1974. Purification and properties of (+)-c/s-naphthalene dihydrodiol dehydrogenase of Pseudomonas putida. J. Bacteriol. 119:879-888 Persson, B., M . Krook, and H. Joornvall. 1991. Characteristics of short-chain alcohol dehydrogenases and related enzymes. Eur. J. Biochem. 200:537-543 Raag, R., and T. L. Poulos. 1991. Crystal structures of cytochrome P-450CAM complexed with camphane thiocamphor and adamantane: Factors controlling P-450 substrate hydroxylation. Biochemistry 30:2674-2684 Ramos, J. L., A. Stolz, W. Reineke, and K. N. Timmis. 1986. Altered effector specificities in regulators of gene expression: TOL plasmid xylS mutants and their use to engineer expansion of the range of aromatics degraded by bacteria. Proc. Natl. Acad. Sci. U. S. A. 83:8467-8471. Reineke, W. 1998. Development of hybrid strains for the mineralization of chloroaromatics by patchwork assembly. Annu. Rev. Microbiol. 52:287-331 114 Reineke, W., and H. J. Knackmuss. 1978a. Chemical structure and biodegradability of halogenated aromatic compounds. Substituent effects on 1,2-dioxygenation of benzoic acid. Biochim. Biophys. Acta 542:412-423 Reineke, W., W. Otting, and H. J. Knackmuss. 1978b. c/s-dihydrodiols microbially produced from halo- and methylbenzoic acids. Tetrahedron 34:1707-1714 Reiner, A. M . 1971a. Metabolism of benzoic acid by bacteria: 3,5-cyclohexadiene-l,2-diol-l-carboxylic acid is an intermediate in the formation of catechol. J. Bacteriol. 108: 89-94 Reiner A. M. , and G. D. Hegeman. 1971b. Metabolism of benzoic acid by bacteria. Accumulation of (-)-3,5-cyclohexadiene-l,2-diol-l-carboxylic acid by mutant strain of Alcaligenes eutrophus. Biochemistry 10:2530-2536 Rieske, J. S., R. E. Hansen, R.E., and W. S. Zaugg. 1964. Studies on the electron transfer syustem, LVm. Properties of a new oxidation-reduction component of the respiratory chain as studied by electron paramagnetic resonance spectroscopy. J. Biol. Chem. 239: 3017-3021 Rogers, J. E., and D. T. Gibson. 1977. Purification and properties of cw-toluene dihydrodiol dehydrogenase from Pseudomonas putida. J. Bacteriol. 130:1117-1124 Rojo, F., D. H. Pieper, K. H. Engesser, H. J. Knackmuss, and K. N . Timmis. 1987. Assemblage of ortho cleavage route for simultaneous degradation of chloro- and methylaromatics. Science 238:1395-1398 Romine, M . F., L. C. Stillwell, K.-K. Wong, S. J. Thurston, E. C. Sisk, C. Sensen, T. Gaasterland, J. K. Fredrickson, and J. D. Saffer. 1999. Complete sequence of a 184-kilobase catabolic plasmid from Sphingomonas aromaticivorans F199. J. Bacteriol. 181:1585-1602 Ruzheinikov, S. N. , J. Burke, S. Sedelnikova, P. J. Baker, R. Taylor, P. A. Bullough, N. M. Muir, M . G. Gore, and D. W. Rice. 2001. Glycerol dehydrogenase, structure, specificity, and mechanism of a family m polyol dehydrogenase. Structure 9:789-802 Sambrook, J., E. F. Fristch, and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY Sarkar, G., and S. S. Sommer. 1990. The "megaprimer" method of site-directed mutagenesis. Biotechniques. 8:404-407 Sato, N. , Y. Uragami, T. Nishizaki, Y. Takahashi, G. Sazaki, K. Sugimoto, T. Nonaka, E. Masai, M . Fukuda, and T. Senda. 2002. Crystal structures of the reaction intermediate and its homologue of an extradiol-cleaving catecholic dioxygenase. J. Mol. Biol. 321:621-636. 115 Seah, S. Y.-K., G. Terracina, J. T. Bolin, P. Riebel, V. Snieckus, and L. D. Eltis. 1998. Purification and preliminary characterization of a serine hydrolase involved in the microbial degradation of polychlorinated biphenyls. J. Biol. Chem. 273:22943-22949 Seeger, M , K. N . Timmis, and B. Hofer. 1995. Conversion of chlorobiphenyls into phenylhexadienoates and benzoates by the enzymes of the upper pathway for polychlorobiphenyl degradation encoded by the bph locus of Pseudomonas sp. strain LB400. Appl. Environ. Microbiol. 61:2654-2658 Seeger, M , M . Zielinski, K. N . Timmis, and B. Hofer. 1999. Regiospecificity of dioxygenation of di- to pentachlorobiphenyls and their degradation to chlorobenzoates by the bph-encoded catabolic pathway of Burkholderia sp. strain LB400. Appl. Environ. Microbiol. 65:3614-3621 Simon, M . J., T. D. Osslund, R. Saunders, B. D. Ensley, S. Suggs, A. Harcourt, W. C. Suen, D. L. Cruden, D. T. Gibson, and G. J. Zylstra. 1993. Sequences of genes encoding naphthalene dioxygenase in Pseudomonas putida strains G7 and NCEB 9816-4. Gene 127:31-37 Simon, R., U. Priefer, and A. Piihler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio. Technol. 1:784-791 Solomons, G. T. W. 1997. Fundamentals of organic chemistry. Fifth Edition. John Wiley & Sons, Inc. USA Spormann, A. M. , and F. Widdel. 2000. Metabolism of alkylbenzenes, alkanes, and other hydrocarbons in anaerobic bacteria. Biodegradation 11:85-105. Subramanian, V., T-N. Liu, W-K. Yeh, C. M . Serdar, L.P. Wackett, and D. T. Gibson. 1985. Purification and properties of ferredoxinTOL. A component of toluene dioxygenase from Pseudomonas putida F l . J. Biol. Chem. 260:2355-2363 Suen, W. C , and D. T. Gibson. 1994. Recombinant Escherichia coli strains synthesize active forms of naphthalene dioxygenase and its individual alpha and beta subunits. Gene 143:67-71 Suenaga, H., T. Watanabe, M . Sato, Ngadiman, and K. Furukawa. 2002. Alteration of regiospecificity in biphenyl dioxygenase by active-site engineering. J. Bacteriol. 184:3682-3688. Sykes, A.G. 1991 Properties and electron transfer reactivity of [2Fe-2S] ferredoxins, p. 291-321. In H. Sigel and A. Sigel (ed.), Metal Ions in Biological Systems Volume 27: Electron Transfer Reactions in Metalloproteins. Marcel Dekker, Inc., New York. Sylvestre, M. , Y. Hurtubise, D. Barriault, J. Bergeron, and D. Ahmad. 1996a. Characterization of active recombinant 2,3-dihydro-2,3-dihydroxybiphenyl dehydrogenase 116 from Comamonas testosteroni B-356 and sequence of the encoding gene (bphB). Appl. Environ. Microbiol. 62:2710-2715 Sylvestre, M. , M . Sirois, Y. Hurtubise, J. Bergeron, D. Ahmad, F. Shareck, D. Barriault, I. Guillemette, and J. M . Juteau. 1996b. Sequencing of Comamonas testosteroni strain B-356-biphenyl/chlorobiphenyl dioxygenase genes: evolutionary relationships among Gram-negative bacterial biphenyl dioxygenases. Gene 174:195-202. Tabor, S., and C. C. Richardson. 1985. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Natl. Acad. Sci. U. S. A. 82:1074-1078 Thompson J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-82. Tierney, D. L., T. G. T. Gassner, C. Luchinat, I. Bertini, D. P. Ballou, and J. E. Penner-Hahn. 1999. NMR characterization of substrate binding in the phthalate dioxygenase system. Biochemistry 38:11051-11061 Timmis, K. N. , and D. H. Pieper. 1999. Bacteria designed for bioremediation. Trends Biotechnol. 17:201-204. Timmis, K.N., T. J. Steffan, and R. Unterman. 1994. Designing microorganisms for the treatment of toxic wastes. Annu. Rev. Microbiol. 48:525-557 Trumpower, B. L. 1981. Function of the iron-sulfur protein of the cytochrome b-cl segment in electron-transfer and energy-conserving reactions of the mitochondrial respiratory chain. Biochim. Biophys. Acta 639:129-155 Tung, W. L., and K. C. Chow. 1995. A modified medium for efficient electrotransformation of is. coli. TIG 11:128 Vaillancourt, F. H., C. J. Barbosa, T. G. Spiro, J. T. Bolin, M . W. Blades, R. F. Turner, and L. D. Eltis. 2002. Definitive evidence for monoanionic binding of 2,3-dihydroxybiphenyl to 2,3-dihydroxybiphenyl 1,2-dioxygenase from UV resonance Raman spectroscopy, UV/Vis absorption spectroscopy, and crystallography. J. Am. Chem. Soc. 124:2485-2496. Vaillancourt, F. H., S. Han, P. D. Fortin, J. T. Bolin, and L. D. Eltis. 1998. Molecular basis for the stabilization and inhibition of 2,3-dihydroxybiphenyl 1,2-dioxygenase by /-butanol. J. Biol. Chem. 273:34887-34895 Vedadi, M , D. Barriault, M , Sylvestre, and J. Powlowski. 2000. Active site residues of cis-2,3-dihydro-2,3-dihydroxybiphenyl dehydrogenase from Comamonas testosteroni strain B-356. Biochemistry 39:5028-5034 Wallar, B. J, and J. D. Lipscomb. 1996. Dioxygen activation by enzymes containing binuclear non-heme iron clusters. Chem. Rev. 96:2625-2658 117 Werlen, C, H. P. Kohler, and J. R. van der Meer. 1996. The broad substrate chlorobenzene dioxygenase and czs-chlorobenzene dihydrodiol dehydrogenase of Pseudomonas sp. strain P51 are linked evolutionarily to the enzymes for benzene and toluene degradation. J. Biol. Chem. 271:4009-4016. Wierenga, R. K., and W. G. Hoi. 1983. Predicted nucleotide-binding properties of p21 protein and its cancer-associated variant. Nature 302:842-844. Williams, P. A., and K. Murray. 1974. Metabolism of benzoate and the methylbenzoates by Pseudomonas putida (arvilla) mt-2: evidence for the existence of a TOL plasmid. J. Bacteriol. 120,416-423. Wolfe, M . D., and J. D. Lipscomb. 2003. Hydrogen peroxide coupled cis-diol formation catalyzed by naphthalene 1,2-dioxygenase. J. Biol. Chem. 278:829-835 Wolfe, M . D., D. J. Altier, A. Stubna, C. V. Popescu, E. Miinck, and J. D. Lipscomb. 2002. Benzoate 1,2-dioxygenase from Pseudomonas putida: single turnover kinetics and regulation of a two-component Rieske dioxygenase. Biochemistry 41:9611-9626. Wolfe, M . D., J. V. Parales, D. T. Gibson, and J. D. Lipscomb. 2001. Single turnover chemistry and regulation of O2 Activation by the oxygenase component of naphthalene 1,2-dioxygenase. J. Biol. Chem. 276:1945-1953 Worsey, M . J., and P. A. Williams 1975. Metabolism of toluene and xylenes by Pseudomonas (putida (arvilla) mt-2: evidence for a new function of the TOL plasmid. J. Bacteriol. 124:7-13 Wubbolts M . G., and K. N . Timmis. 1990. Biotransformation of substituted benzoates to the corresponding cw-diols by an engineered strain of Pseudomonas oleovorans producing the TOL plasmid-specified enzyme toluate-1,2-dioxygenase. Appl. Environ. Microbiol. 56:569-571 Yamaguchi, M. , and H. Fujisawa. 1980. Purification and characterization of an oxygenase component in benzoate 1,2-dioxygenase system from Pseudomonas arvilla C - l . J. Biol. Chem. 255:5058-5063 Yamaguchi, M. , and H. Fujisawa. 1982. Subunit structure of oxygenase component in benzoate-1,2-dioxygenase system from Pseudomonas arvilla C - l . J. Biol. Chem. 257:12497-12502 Yanisch-Peron, C , J. Vieira, and J. Messing. 1985. Improved M13 cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119 Zeyer, J., P. R. Lehrbach, and K. N. Timmis. 1985. Use of cloned genes of Pseudonomas TOL plasmid to effect biotransformation of benzoates to cz's-dihydrodiols and catechols by Escherichia coli cells. Appl. Environ. Microbiol. 50:1409-1413 118 Zhou, N . Y., J. Al-Dulayymi, M . S. Baird, and P. A. Williams. 2002. Salicylate 5-hydroxylase from Ralstonia sp. strain U2: a monooxygenase with close relationships to and shared electron transport proteins with naphthalene dioxygenase. J. Bacteriol. 184:1547-1555 119 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091143/manifest

Comment

Related Items