Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The genomic organisation and transcriptional regulation of natural killer receptor genes Wilhelm, Brian Thomas 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-854183.pdf [ 11.5MB ]
Metadata
JSON: 831-1.0091138.json
JSON-LD: 831-1.0091138-ld.json
RDF/XML (Pretty): 831-1.0091138-rdf.xml
RDF/JSON: 831-1.0091138-rdf.json
Turtle: 831-1.0091138-turtle.txt
N-Triples: 831-1.0091138-rdf-ntriples.txt
Original Record: 831-1.0091138-source.json
Full Text
831-1.0091138-fulltext.txt
Citation
831-1.0091138.ris

Full Text

THE GENOMIC ORGANISATION AND TRANSCRIPTIONAL REGULATION OF N A T U R A L KILLER R E C E P T O R G E N E S By B R I A N T H O M A S W I L H E L M B. S c . , The University of Water loo, 1996 B. E d . , Q u e e n s University, 1996 A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y IN T H E F A C U L T Y O F G R A D U A T E S S T U D I E S (Department of Medica l Genet ics , Medica l Genet ics programme) W e accept this thesis as conforming to the required standard The University of British Co lumbia April 2003 © Brian Thomas Wi lhe lm In presenting t h i s thesis i n p a r t i a l f u l f i l m e n t of the requirements for an advanced degree at the U n i v e r s i t y of B r i t i s h Columbia, I agree that the Library s h a l l make i t f r e e l y a v a i l a b l e for reference and study. I further agree that permission for extensive copying of t h i s thesis for s c h o l a r l y purposes may be granted by the head of my department or by his or her representatives. It i s understood that copying or p u b l i c a t i o n of t h i s thesis for f i n a n c i a l gain s h a l l not be allowed without my written permission. Department of The U n i v e r s i t y of B r i t i s h Columbia Vancouver, Canada Date fl-{<< 1 2.3 11 Abstract The objective of my thesis was to better characterise the transcriptional regulation of genes within the natural killer gene cluster (NKC). As a first step in analysing why different NKC genes are expressed at different frequencies, we attempted to sequence the promoter region of many Ly49 genes. The resulting sequence comparison showed that the promoter region of all of the genes were too similar to draw any conclusions about what regions might be important, although the inclusion of the expressed human Ly49 gene showed that some of the sequence conservation might be significant. In addition, 5' RACE was performed on 4 genes to map their transcriptional start point (TSP). This work revealed that the promoter region of these genes had highly heterogeneous transcriptional start points. We next utilised mouse genomic sequence available in public databases in order to assemble a sequence contig for the Ly49 gene cluster which could be used to study the gene arrangement and genomic features. This work resulted in a detailed analysis of the Ly49 gene content in B6 mice as well as a hypothetical model for the evolution of the gene cluster. In addition, a large stretch of unique repetitive elements was identified at one end of the cluster which is hypothesised to play a role in the atypical expression pattern of Ly49e. Finally, we examined the transcriptional regulation of the murine CD94 gene in more detail. These experiments showed that this gene has two promoter regions and that lymphoid cell types use them differentially. This work also demonstrated that preferential usage of a particular promoter by a cell type was established during fetal development, but that the use of the distal promoter by freshly isolated NK cells could be drastically reduced by culturing them in media containing IL-2. The conclusion of this research was that the CD94 gene has a complex promoter structure, and that several features are shared with the human CD94 gene. Table of Contents iii THE GENOMIC ORGANISATION AND TRANSCRIPTIONAL REGULATION OF NATURAL KILLER RECEPTOR GENES . Abstract ii Table of Contents iii List of Figures vii List of Tables ix . Acknowledgements x List of Abbreviations xi Chapter 1 Introduction 1 1.1 Background on the immune system and identification of NK cells 2 1.2 Ontogeny of NK cells 5 1.3 NK function and regulation through receptors 8 1.4 Classes and families of NK receptors 14 1.4.1 Lectin-l ike genes 14 1.4.2 Immunoglobulin receptors 24 1.5 MHC class I ligands of NK receptors 31 1.6 The expression patterns of natural killer cell receptors 35 1.6.1 Ly49 transcriptional regulation 37 1.6.2 Transcript ion factors implicated in the regulation of N K receptor genes .. 40 iv 1.6.3 Character ised N K C gene promoter regions 41 1.6.4 Other potential N K receptor gene regulatory mechan isms 43 1.7 A model for receptor acquisi t ion and the role of MHC c lass I environment. . . 44 1.8 Convergent receptor evolut ion and co-evolut ion with MHC c lass I 47 1.9 Thesis objectives and organisat ion 48 Chapter 2 Comparat ive analysis of the promoter regions of Ly49 genes 51 2.1 Introduction 52 2.2 Materials and Methods 53 2.2.1 Sequenc ing of putative promoter regions 53 2.2.2 Rap id amplif ication of c D N A ends ( R A C E ) 55 2.2.3 S e q u e n c e Ana lys is 57 2.3 Resul ts and Discuss ion ; 58 2.3.1 S e q u e n c e analysis of putative regulatory regions of the Ly49 genes 58 2.3.2 Identification of potential transcriptional start si tes for Ly49 genes .... 64 2.3.3 Differential effects of T C F - 1 66 2.3.4 The presence of a T A T A box does not s e e m important for Ly49 express ion 68 Chapter 3 Genomic organisat ion of the C57BL/6 Ly49 c luster 71 3.1 Introduction 72 3.2 Materials and Methods 73 3.2.1 Data retrieval and assembly 73 V 3.2.2 S e q u e n c e Al ignments and phylogenetic analys is 74 3.2.3 Repeat analys is and figure generat ion 75 3.2.4 Dotplot Ana lys is 75 3.3 Resul ts and Discuss ion 76 3.3.1 Genera l arrangement of the Ly49 gene cluster in B 6 mice 76 3.3.2 The C 5 7 B L / 6 Ly49 cluster contains large dupl icated regions 79 3.3.3. Relat ionships of the Ly49 genes 83 3.3.4 Formation of Ly49h 89 3.3.5 A model for evolution of the Ly49 gene family 92 3.3.6 Potential role of repetitive sequences 97 3.3.7 Compar i sons to the KIR region 100 3.3.8 Conc lud ing remarks 102 Chapter 4 Transcript ional control of the immune receptor CD94 105 4.1 Introduction 106 4.2 Materials and Methods 107 4.2.1 Mous e strains 107 4.2.2 5' R A C E for CD94 107 4.2.3 Constructs 107 4.2.4 Transfect ions & cell culture 108 4.2.5 Cultured splenocytes 109 4.2.6 Flow cytometry 109 4.2.7 Northern blot analys is 110 4.2.8 Quantitative Real- t ime P C R 110 4.2.9 D N a s e I H S S scan 111 4.3 Resul ts 112 VI 4.3.1 The murine CD94 gene has a novel upstream exon 112 4.3.2 The L N K cell line transcribes and expresses CD94 and NKG2 genes 112 4.3.3 The murine CD94 gene promoters have differing activity that does not correlate with cell surface express ion of the protein 114 4.3.4.The two CD94 promoters have lymphoid cell-type speci f ic usage that is already establ ished in fetal sp lenocytes fractions 116 4.3.5 Establ ishment of cell l ines or culturing N K cel ls alters promoter usage 119 4.3.6 The D B A 2 / J mouse expresses CD94 m R N A but not the translated protein 120 4.3.7 The genes Klre-1 and CD94 are co-expressed 121 4.3.8 There is ev idence of a D N a s e I hypersensit ive sites around the CD94 locus 123 4.4 D iscuss ion 125 Chapter 5 Summary Bibl iography Web references 131 136 168 V l l List of Figures Figure 1-1 A rms of the immune system 4 Figure 1-2 The missing-sel f hypothesis 11 Figure 1-3 Model for Ly49-mediated inhibitory function 13 Figure 1-4 Schemat ic d iagrams of the mouse and human N K C regions 15 Figure 1-5 T h e human leukocyte receptor complex ( L R C ) 25 Figure 1-6 Structure of M H C c lass I molecule and antigen process ing pathway 33 Figure 2-1 Al ignment of Ly49 promoter regions 60 Figure 2-2 Transcript ional start sites inferred from 5' R A C E c lones 62 Figure 2-3 Compar i son of Ly49 h and b promoter region 65 Figure 3-1 Dotplot compar ison of the entire C 5 7 B L / 6 Ly49 cluster 77 Figure 3-2 Dotplot compar ison of Ly49a, c, m region to the Ly49n, i, g region 80 Figure 3-3 S c a l e d iagram of all full length Ly49 genes 82 Figure 3-4 Phylogenet ic trees of the Ly49 genes 84 Figure 3-5 Dotplot compar ison of Ly49h, k, n region to itself 86 Figure 3-6 Mode l for the evolution of Ly49h, k, n region 90 Figure 3-7 Mode l for the evolution of the Ly49 c luster 98 Figure 4-1 Schemat ic d iagram of murine CD94 locus and promoter constructs 113 Figure 4-2 F A C S and Northern analysis of CD94 express ion in L N K and E L - 4 cell l ines 115 Figure 4-3 Resul ts of transfected promoter constructs 117 Figure 4-4 Quantitative real-time P C R results of differential promoter usage by cell type 118 Figure 4-5 Quantitative real-time P C R results of differential promoter usage in fresh versus cultured cel ls 120 viii Figure 4-6 R T - P C R analysis of CD94 express ion in the D B A 2 / J mouse strain 122 Figure 4-7 Graph of Klre-1 and CD94 express ion level by cell type 124 Figure 4-8 Ana lys is of D N a s e I H S S around the C D 9 4 promoter 126 i x List of Tables Table 1-1 Receptors of the C-type lectin-like superfamily 18 Table 1-2 Receptors of the immunoglobulin superfamily 27 Table 3-1 Percentage identity of Ly49h to other genes 88 Table 3-2 Repetitive elements within Ly49 genes 94 Table 4-1 Primers used 107 X Acknowledgements There are many people I would like to thank for their contribution to my complet ion of this thesis. Firstly, I would like to thank Dixie Mager for accept ing me into her lab. Her constant encouragement and attention to detail have provided me with a model for s u c c e s s in research for which I am extremely grateful. I am also naturally grateful for her s imul taneous acceptance of Josette into her lab, for obvious reasons. I would like to thank all the other members of Dixie's lab who have helped me along the way including Doug and Mike for superb technical ass is tance. I would a lso like to especia l ly thank Kar ina M c Q u e e n , without whose help my project would never have advanced as well as it d id. Her suggest ions and general good humour made the lab that much more enjoyable to work in. My unofficial co-superv isor Fumid Take i a lso deserves specia l thanks, not only for helping to guide my project, but a lso for his eternal quest to find the signi f icance of our work. I would a lso like to thank the var ious and numerous people throughout the Terry Fox Lab who have ass is ted me through out the years, to whom I a m truly indebted. I would like to thank my committee members R o b Kay and Kel ly M c N a g y and Fumio Take i for their helpful d iscuss ion at meet ings. My family and fr iends also deserve thanks for their help and support of my efforts. I would definitely like to thank my wife (and co-worker) Jose t te -Renee Landry for everything that she has brought to my life. I cannot imagine a better outcome of my t ime here than to have found such a person with whom I can share my entire life. Lastly, I would like to thank my parents. It has been their constant love and encouragement that has al lowed me to ach ieve the potential they saw in me. It is with humble recognit ion, and utmost gratitude, that I acknowledge that the greatest part of who I am today is a result of their efforts. List of abbreviations A D C C antibody dependent cel l -mediated cytotoxicity A P C antigen presenting cell AP-1 activator protein 1 B A C bacterial artificial ch romosome B C M Baylor Co l lege of Medic ine B C R B-cell receptor bp base pair B6 C57BL/6 B L A S T basic local al ignment search tool p2m beta-2-microglobulin C D clusters of differentiation c D N A complementary deoxyr ibonucleic acid cen centromere chr ch romosome C L E C C-type lectin cmv cytomegalovirus C R D carbohydrate recognition domain C T L D C-type lectin domain D A P 12 D N A X adaptor protein 12 D A P 10 D N A X adaptor protein 10 D C Dendrit ic cell D M E M du lbecco 's modified eagle 's medium D N A deoxyr ibonucleic acid E M S A electrophoretic mobility shift a s s a y E S T expressed sequence tag F A C S f luorescence activated cell sorting F ITC f luorescin isothiocyanate H C M V human cytomegalovirus H L A human leukocyte antigen H M G high mobility group H S V herpes simplex virus H S S hypersensit ive site H T G S high throughput genomic sequences IFN y Interferon g a m m a ig immunoglobul in i g -SF immunoglobul in superfamily IL interleukin IRF-1 interferon regulatory factpr-1 ITAM immunoreceptor tyros ine-based activation motif ITIM immunoreceptor tyros ine-based inhibitory motif kb k i lobase KIR killer immunoglobulin-l ike receptor Klre-1 killer lectin-like receptor family e - member 1 L G L large granular lymphocytes L INE long interspersed repeats LIR leukocyte Ig-like receptors L R C leukocyte receptor complex L T R long terminal repeat Ly lymphocyte antigen m A b monoclonal antibody Mb megabase M C M V murine cytomegalovirus 2-ME 2p-mercapto-ethanol M G S C mouse genome sequenc ing consort ium M H C major histocompatibil ity complex M I C A / B M H C c lass I chain-related A / B MIR Monocyte /macrophage inhibitory receptors ml millilitre m R N A messenger r ibonucleic acid NCBI national centre for biotechnology information ng nanogram N K cell natural killer cell N K C natural killer gene cluster N K T natural killer T-cel l Xll l P1 P1 bacter iophage vector P C R po lymerase chain reaction pg picogram PIR paired immunoglobulin-l ike receptor R A C E rapid amplif ication of c D N A ends R B C red blood cell R N A r ibonucleic acid RPMI Roswel l park memorial institute R T - P C R reverse t ranscr iptase-polymerase chain reaction S S A H A sequence search and al ignment by hashing algorithm S D S sodium dodecyl sulphate SH2 src homology domain 2 S H P SH2-domain-containing phosphatase S I N E short interspersed repeats S S C sodium citrate sodium chloride T C R T-cel l receptor TCF -1 T-cel l factor one T G F - p Transforming growth factor beta tel telomere T R A I L TNF-re la ted apoptosis- inducing ligand T S P transcriptional start point U T R untranslated region Y A C yeast artificial ch romosome a a lpha B beta e epsi lon \\i psi y g a m m a [ig microgram JLXI microlitre 8 delta L\ zeta Chapter 1 Introduction 1.1 Background on the immune system and identification ofNK cells The mammal ian immune system is composed of a highly sophist icated network of cel ls and signall ing molecules that regulate its activity. Mil l ions of years of select ive pressure appl ied from pathogenic organisms have guided the evolution of this elaborate defence sys tem. The immune system has c lassical ly been divided into two branches, innate immunity and acquired immunity. Innate immunity refers to the bas ic , non-specif ic response to all pathogens while acquired immunity involves the recognition of a specif ic pathogen and expans ion of effector cel ls specif ic for that pathogen as well as the formation of immunological memory. Much of the power of the mammal ian immune system comes from the diversity present in the branch of acquired immunity. The primary effector cel ls involved with the cellular and humoral branches of acquired immunity are T-cel ls and B-cel ls respectively. Both of these cell types are able to randomly rearrange a large number of variable gene segments in order to assemb le proteins expressed at the cell surface that are capable of recognising an incredibly diverse range of l igands. Other cel ls such as macrophages and antigen presenting cel ls ( A P C s ) a lso play vital roles in the regulation of the T and B cel ls through the presentation of peptides to these cel ls. Whi le the complexity of acquired immunity is of great benefit to the host organism, responses from these cel ls typically require severa l days to reach max imum effect. S u c h a time delay between invasion of the host and an overwhelming immune response would likely prove fatal in many c a s e s , were it riot for the innate immune sys tem. Ce l ls such as macrophages and neutrophils, that belong to the innate immune sys tem, are capable of " ingesting" bacteria or extracellular material through a process cal led phagocytosis. The material taken in can then be broken down to smal l molecules by lysosomal enzymes providing a method for destroying bacteria in a non-specif ic manner. The foreign material that has been internalised can then be presented to T-cel ls to stimulate a cel l -mediated immune response. S u c h co-operat ion between innate and acquired immune responses is seen in the behaviour of other immune cell types as well . Much research has been directed at elucidating the mechan isms of regulation of the cel l -mediated and humoral branches of the immune sys tem, in part because of the desire to understand the means behind the generat ion of such a diversity of immune proteins. It was therefore not surprising that another vital component of the innate immune system had been over looked until 1975. A smal l group of peripheral blood lymphocytes, cal led large granular lymphocytes (LGL) based on their morphology, were identified, which lacked express ion of previously def ined markers of T-cel ls ( T C R , T-cel l receptor) and B-cel ls ( B C R , B-cell receptor) that were found to be capable of lysing target cel ls without prior immune stimulation (Kiessl ing et a l . 1975a; Kiess l ing et a l . 1975b). B e c a u s e of this ability, these cel ls were said to have "natural killer" functions. The mechan isms behind the activation of this cytotoxicity were uncovered after careful observat ion of the characterist ics of the cel ls that were lysed by these Natural Kil ler (NK) cel ls (Piontek et a l . 1985). N K cel ls differ significantly from both T and B-cel ls in their mechan isms for recognising noh-self/altered-self cel ls as well as in the consequences of cell activation. Whi le stimulated T-cel ls and B-cel ls both produce cel ls with a memory phenotype that can be reactivated during a second infection by a pathogen (reviewed in Zinkernagel et a l . 1996), N K cel ls have not been demonstrated to have this capacity. Figure 1-1 4 Activation Outcome NKCell Activating receptor engagement + lack of inhibitory signal Target cell lysis No memory cells produced T-cell TCR TCR engagement and co-receptor signalling Target cell lysis Memory cells produced B-Cell B C R engagement and co-receptor signalling Proliferation of differentiated Ab producing effector cells Memory cells produced B C R Figure 1-1 A rms of the immune system. The figure depicts cel ls of the acquired immune sys tem (B and T-cel ls) as well as the innate immune sys tem (NK). The B C R and T C R receptors that are shown are features of the acquired immune system as is the production of cel ls with a memory phenotype. i l lustrates some of the dif ferences between B, T and N K cel ls. 5 1.2 Ontogeny of NK cells Like other lymphoid cel ls, N K cel ls are ultimately derived from hematopoiet ic s tem cel ls present in the adult bone marrow (Wil l iams et a l . 1998). N K cel ls do not require the thymus for normal development as athymic mice have normal functional N K cel ls similar to wild-type mice (Minato et a l . 1979). Al though a secondary lymphoid organ is not required for development, research has found that a proper bone marrow microenvironment is one of the many critical factors required for N K cell development. Mice that had their lymphotoxin-a (LTa) or LTp receptor genes knocked out, and were therefore unable to express these genes in bone marrow as in the wildtype, fail to produce N K cel ls, suggest ing that bone marrow stromal cel ls need signals sent by membrane L T a in order support N K cell development in the bone marrow (l izuka et a l . 1999). Our understanding of the development of murine N K cel ls from their earl iest progenitors is a complex and rapidly changing field. C lass ica l ly , N K cel ls were thought to be derived from a progenitor cell that was shared with T-cel ls , but lacked the capacity to produce B-cel ls, as they share cell cytolytic properties. A more primitive lymphoid s tem cell with the phenotype Lin" I L - 7 R + T h y - 1 " S c a - 1 l 0 c-Kit '°was reported to have a capaci ty to differentiate limited to B, T and N K cel ls (Kondo et a l . 1997) (reviewed in Wi l l iams et a l . 1998). Such a hierarchy would not only provide a model for cell fate dec is ions which would agree with observat ions, but a lso provide an explanation for the ex is tence of cel ls that express markers of both T - c e l l s and N K cel ls referred to as N K T cel ls (reviewed in Bende lac et a l . 1997). More recent work cal ls into question the earlier theories however, by showing that commitment to T-cel l and B-cell l ineages may occur through bipotential s tages of T-cel l /myeloid and B-cel l /myeloid differentiation (Katsura 2 0 0 2 ) . The inherent complexity of the microenvironment and plasticity of the stem cel ls involved will likely continue to cause difficulties in attempts to define a rigid order of differentiation of lymphoid cell types. Other studies have focused on the earliest markers of N K differentiation and the transcription factors that are involved in the cell fate dec is ions. A systemat ic study of N K progenitor cel ls suggest that C D 1 2 2 (the interleukin 2 (IL-2) and the IL-15 receptor common subunit B) is the first definitive N K cell marker expressed by developing N K cel ls in both humans and mice (Rosmarak i et a l . 2001 ; K im et a l . 2002). Indeed a role for IL-15 has been clearly illustrated in the case of human N K cel ls through in vitro culture exper iments (Mrozek et a l . 1996). B e c a u s e IL-15 knockout mice have defects that include a severe reduction in N K cel ls, it a lso suggests that IL-15 is critical for the development of murine N K cel ls (Kennedy et al . 2000). Further ev idence is provided by mice that have had their bone marrow, where stromal cel ls can produce IL-15, disrupted by either radioactive isotopes or p-estradiol. The sp leen becomes the major site for hematopoies is in these c a s e s , however the N K cel ls which develop lack all cytolytic activity unless they are cultured in a low dose of IL-15 (Hackett et a l . 1986). A large number of gene knockout studies have focused on transcription factors involved in lymphoid development. T h e s e exper iments have al lowed more precise roles to be descr ibed for a number of proteins implicated in N K cell development. M ice deficient in Ikaros lack N K cel ls, but a lso lack T, B and dendrit ic cel ls , suggest ing that Ikaros is involved in l ineage commitment s tages at a primitive stage (Georgopoulos et 7 al . 1994). The Id2 and Id3 proteins, which belong to a family of inhibitors of helix-loop-helix (HLH) proteins, have been shown to block the development of lymphoid cel ls other than N K cel ls (Spits et a l . 2000). A mouse deficient in Id2 showed a lack of N K cel ls (Yokota et a l . 1999) and this has subsequent ly been attributed to Id2's ability to bind the H E B E-protein, which suggests that this protein a lso promotes N K cell development by preventing differentiation to other lymphoid cell types in a fashion similar to Id3 (Spits et a l . 2000). Other gene knockout models, such as Jak3 (Park et a l . 1995), or interferon regulatory factor-1 (IRF-1) (Duncan et a l . 1996) or over -expressed t ransgenes, such as F c R y (F lamand et a l . 1996) and C D 3 s (Wang et a l . 1994), have also resulted in a lack of N K cel ls. However in most of these c a s e s , the lack of N K cel ls is only one of the observed phenotypes, suggest ing that none of these factors are exclusively important for N K cell development. In addition to cytokine receptors, other N K cell receptors such as N K G 2 D , N k r p l , and Ly49 (see sect ion 1.4.1) have been observed to be expressed at different s tages of N K cell development (Kim et a l . 2002). Al though the l igands for at least some of these receptors are expressed and are presumably interacting with the N K cel ls during development, there is no ev idence to suggest that the signall ing that occurs is necessary for normal development as it is with T C R signall ing during T-cel l development (reviewed in Germa in 2002). In M H C c lass I knockout mice, N K cel ls have been shown to develop normally, although their Ly49 receptors are expressed at a somewhat higher level than in wild-type mice (Sa lcedo et a l . 1997). 8 A s mentioned earlier, there is a smal l subset of lymphoid cel ls that bear the markers of both N K and T-cel ls in humans and mice. T h e s e natural killer T-cel ls (NKT cells) express a limited repertoire of TCRa/B (or y/5) cha ins as well as the Nkrp-1 genes and produce cytokines in a fashion similar to N K cel ls (Godfrey et a l . 2000). N K T cel ls in mice also express Ly49 genes , although their express ion pattern is significantly different from that of N K cel ls (Takei et al . 2001). A c lear understanding of the development of N K T cel ls is compl icated by the fact that there are several functional subsets of N K T cel ls which vary in their dependence on the thymus for development and their use of the CD1 signall ing (Godfrey et a l . 2000). Except for two exper iments in chapter 4 (which do not dist inguish between N K T cell subsets) , N K T cel ls are not specif ical ly examined in this thesis. 1.3 NK function and regulation through receptors W h e n human N K cel ls are act ivated, they produce large amounts of cytokines including IFN-y as well as IL-4, IL-5, IL-10, and IL-13 (Peritt et a l . 1998). T h e s e cytokines serve to activate other branches of the immune system and support the hypothesis that N K cel ls represent a "front-line" defence against pathogens. In addition to stimulating the immune sys tem, N K cel ls are capable of lysing cel ls through the express ion of the TNF-re la ted apoptosis- inducing ligand (TRAIL) which is significantly up-regulated upon N K cell activation (Kayagaki et a l . 1999). This l igand, when bound to its receptor on a target cel l , induces a signall ing c a s c a d e resulting in the cell undergoing apoptosis (reviewed in Wi ley et a l . 1995; Orlinick and C h a o 1998). 9 In order to avoid auto-aggressive behaviour, natural killer cel ls have evolved two main methods for identifying target cel ls for lysis. The first method is as a complement to the function of activated B-cel ls. N K cel ls express the FcyRIII receptor (CD16) that recognises the F c portion of ant ibodies generated by B-cel ls (Vivier et a l . 1992). W h e n the N K cell encounters a target that has antibodies bound to it, C D 1 6 will recognise the F c portion of the antibody which leads to an activation signal in the N K cel l . This signal will result in the lysis of the target cell through the re lease of lytic granules in the space between the N K cell and the target cell (Griffiths and Argon 1995). T h e s e lytic granules contain perforin molecules that will assemb le into a multimeric complex in the membrane of the target cel l , forming large pores in the cell membrane of the target cell resulting in cell lysis (Podack et a l . 1985). In addition the granules contain g ranzymes, a collection of at least 11 different serine proteases are re leased that are bel ieved to act on p ro -caspases inducing an apoptotic signal in the target cell (Kam et a l . 2000). This mode of killing is known as ant ibody-dependent cel l -mediated cytotoxicity ( A D C C ) as the recognition of the target cell is dependent on the presence of bound ant ibodies produced by B-cel ls. The second method that N K cel ls use to dist inguish target cel ls from normal cel ls involves a more sophist icated mechan ism of receptors and l igands expressed by effector and target cel ls. A lmost all cel ls in the human body express major histocompatibil ity complex c lass I ( M H C c lass I) molecules and this is true in other spec ies as well (Janeway and Travers 1997). T h e s e receptors present cel lular ant igens for recognition by the T C R expressed on T-cel ls . Th is method al lows the immune sys tem to effectively survey the body for cel ls that may be virally infected. In such a c a s e , the viral peptides presented to the T-cel l will lead to its activation and the 10 subsequent lysis of the target cel l . In order to avoid this fate, v i ruses have evolved mechan isms for down-regulat ing the express ion of the M H C c lass I molecules upon infection. The herpes s implex virus (HSV) protein IE12 (Neumann et a l . 1997) arid the human cytomegalovirus ( H C M V ) protein U S 6 (Park et a l . 2002) both interfere with the cellular transporters assoc ia ted with antigen processing (TAP) proteins that are required for M H C c lass I express ion at the cell surface (Janeway and Travers 1997). Other viral strategies for blocking presentation of viral peptides include the endocytos is of M H C c lass I molecules from the cell surface by the HIV Nef protein (Cohen et a l . 1999) and express ion of viral M H C c lass I decoy molecules such as the U L 1 8 and m144 H C M V and Murine cytomegalovirus ( M C M V ) v i ruses respectively (Farrell et a l . 1997; Reyburn et a l . 1997b). Whi le these viral tactics may work to prevent T-cel l mediated cytotoxicity, by down regulating the M H C c lass I express ion they have unintentionally made themselves suscept ib le to N K cell mediated lysis. There are receptors that are expressed on N K cel ls that bind to M H C c lass I molecules and send both inhibitory and activating s ignals to the N K cel ls. There are a lso activating receptors expressed on N K cel ls that bind to other, less wel l -character ised, ubiquitously expressed l igands. W h e n an N K cell encounters a normal cel l , it is bel ieved that both inhibitory and activating s ignals are generated, but that the inhibitory signal is dominant and prevents the activation of the N K cel l . If however, the M H C c lass I express ion on the target cell is down-regulated due to viral infection or neoplast ic transformation, the receptors on N K cel ls no longer have a dominant inhibitory signal to prevent the activation of the N K cel l . This leads to the activation of the N K cell and lysis of the target cel l . This theory is descr ibed as the missing-sel f hypothesis and is depicted in figure 1-2. (Ljunggren and Karre 1990). 11 Figure 1-2 The missing-self hypothesis. The figure il lustrates the fundamental concept of the hypothesis that N K cel ls survey the body for cel ls that lack M H C c lass I express ion. The lack of express ion, which may be a result of viral infection or neoplast ic transformation, prevents inhibitory s ignals from being generated. The target cell is therefore suscept ib le to lysis by the N K cel l , (adapted from www.heal th.auckland.ac.nz/ . . . / lmm07/ lmm07Notes2001 .html) 12 Signal l ing through N K receptors has been examined for a number of gene famil ies, however the best studied family members are the Ly49 receptors (described in more detail in sect ion 1.4.1). Character isat ion of their signall ing mechan isms for both activating and inhibitory receptors serves as a paradigm for all N K C receptors. The majority of Ly49 receptors have a signall ing motif in their cytoplasmic domain referred to as an immunoreceptor tyros ine-based inhibitory motif (ITIM). Upon receptor engagement , the tyrosine residues in the ITIMs become phosphorylated al lowing the recruitment of molecules such as S H 2 domain-containing protein phosphatase ( S H P ) -1 and 2 to the cell membrane (Mason et a l . 1997). The recruitment of such phosphatases is bel ieved to al low the blocking of early signall ing events generated from the co-clustering activating receptors (Anderson et a l . 2001) in addition to disrupting binding of N K cel ls to their targets (Burshtyn et a l . 2000). Figure 1-3 depicts a model of Ly-49 mediated inhibitory signal l ing. There are several Ly49 genes in the various mouse strains including B6 that do not have ITIM motifs in their cytoplasmic domains (Brennan et a l . 1994; Smith et a l . 1994). Instead, these proteins contain a charged amino acid residue within their putative t ransmembrane domain . It has been shown that this charged residue al lows these receptors to assoc ia te with a smal l t ransmembrane signall ing adaptor molecule cal led D A P 1 2 (Smith et a l . 1998; Gosse l in et a l . 1999). D A P 12 is expressed as a dimer where each monomer has an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain (Lanier et a l . 1998). Ana lys is of the activating L y 4 9 / D A P 1 2 complexes has demonstrated that Ly49 receptor engagement leads to phosphorylat ion of the D A P 1 2 ITAMs and recruitment of the Syk /Zap70 tyrosine k inase to the membrane (Lanier et al . 1998). This ultimately results in a signall ing c a s c a d e that, in 13 Co-engagement of receptors Activating receptor Inhibitory Ly49 " WlITAM 1 Activated Tyrosine kinases Tyrosine Phosphorylated Substrates Figure 1-3 Model for Ly49-mediated inhibitory funct ion. Upon activating and inhibitory receptor engagement , the tyrosoine res idues in the ITIMs of the inhibitory receptor become phosphorylated and recruits S H P - 1 / 2 to the membrane . T h e s e then prevent the phosphorylat ion of signall ing molecules downst ream of the activation signal c a s c a d e thereby preventing activation of the N K cel l , (figure adapted from Anderson et al . 2001) 14 the absence of any inhibitory s ignals, ends with activation of the N K cel l . After their initial character isat ion, the evolutionary role of these receptors, which would appear to be antagonist ic to the function of the inhibitory receptors, remained a mystery. Recent ly it has been demonstrated that one of these activating receptors, L y 4 9 H , actually recognises a viral protein from the M C M V and this recognition provides resistance to the virus (Daniels et a l . 2001 ; Dokun et al . 2001 ; Lee et a l . 2001a) . Whether the other activating receptors a lso recognise specif ic pathogens has not been determined although other d isease-re lated loci, such as resistance to mouse pox virus (Rmp-1) have been mapped to the region of the N K C (Delano and Brownstein 1995). 1.4 Classes and families ofNK receptors A great deal of research effort has been expended s ince the d iscovery of N K cel ls to identify receptors which are expressed on N K cel ls and to determine how they regulate N K cell activity. The result of this effort has been a large and continually expanding number of receptors where many of the mult igene famil ies have both inhibitory and activating vers ions of the receptors. Al l of the receptors can be divided broadly into the 2 superfamil ies descr ibed below in sect ion 1.4.1 and 1.4.2. 1.4.1 Lectin-l ike genes The first group are receptors that contain a c-type lectin-like domain in their extracellular domain . Members of this superfamily are typically expressed as dimeric type-2 t ransmembrane proteins with a carbohydrate recognition domain at their carboxy terminus (Takei et a l . 1997; Lanier 1998). Al though members of this family have 15 Human NKC OS tt •x z « Bf 1 y i O N -o D F E C A 2Mb Mouse NKC Q E X F D K H N I G L J M C A — • 8.5 Mb Figure 1-4 Schemat ic diagrams of the mouse and human N K C regions, t h e centromeric and telomeric regions of the ch romosomes are indicated, as are some, but not all, of the genes identified in the genomic D N A in the region of the cluster. The s ize of the gene clusters are indicated by the d iagrams and genes are not drawn to sca le . Information regarding gene arrangement and cluster s ize was obtained from sources as descr ibed in chapter 3, (Hofer et a l . , 2001) and the Human /Mouse genome browser at U C S C (http:/ /genome.ucsc.edu/) 16 similarity to other c-type (calcium-dependent) lectins, experimental ev idence from X-ray crystal lography has revealed that many of these proteins lack a critical loop in their protein folds which is required for calc ium binding (Boyington et a l . 1999; Tormo et a l . 1999; Wo lan et a l . 2001). It is therefore likely that these receptors do not bind their l igands in a ca lc ium-dependent manner and that, despite sequence similarity to other C T L D proteins, the N K receptors likely recognise proteins rather than sugars (Sawicki et a l . 2001). Ear ly work on N K cell receptor biology had shown that genes encoding a number of lectin receptors expressed preferentially on N K cel ls were found in a cluster on human chromosome 12 (Renedo et a l . 1997) and on a syntenic region of mouse ch romosome 6 (Yokoyama and S e a m a n 1993; Brown et a l . 1997b). This region was termed the Natural Kil ler gene cluster ( N K C ) as a result of these f indings. The N K C occup ies a region of approximately 2 Mbp in humans and approximately 8.5 Mbp in C 5 7 B L / 6 (B6) mice. Figure 1-4 shows a schemat ic d iagram of the human and mouse N K C regions. A summary of some of the lectin-like receptors is shown in table 1-1 where l igand, location, gene copy number, cell-type express ion pattern and type of signall ing are indicated where known. Schemat ic d iagrams of the receptors are shown depict ing signall ing components of the molecules as well as adaptor proteins. Severa l of the better-characterised gene famil ies are d iscussed in more detail below. NKRP -1 The N K R P - 1 proteins are expressed on the surface of murine N K (Ryan et a l . 1992) (in C 5 7 B L / 6 as determined by NK1.1 staining) cel ls and a subset of T-cel ls (Bal las and R a s m u s s e n 1990; S y k e s 1990), while the single human gene is expressed on only a subset of both N K and T-cel ls (Lanier et a l . 1994). In the mouse , both activating and inhibitory forms of these genes are found (Plougastel et a l . 2001), 17 whereas in humans there is only an inhibitory version of this gene (Lanier et a l . 1994). B e c a u s e of the express ion pattern of these genes in mice, they have been used as a marker of N K cel ls as well as for a smal l number of cel ls known as N K T cel ls, that express not only N K R P - 1 but a lso a functional T C R (Biron and B rossay 2001 ; MacDona ld 2002). Al though the natural l igand of Nkrp-1 in both mouse and human is unknown, studies have shown that the activating forms of the murine receptor likely assoc ia te with the FcsRIy activating adaptor chain through interactions with a charged residues in the t ransmembrane domains (Arase et a l . 1997). The human N K R P - 1 protein is able to interfere with activation s ignals and therefore is presumed to act as an inhibitory receptor (Lanier et a l . 1994). However, because the human version of the gene has neither an immunoreceptor tyros ine-based inhibitory motif (ITIM) nor a charged amino acid residue in its t ransmembrane domain , it is not c lear how the inhibitory signal is generated. The Ly49 gene family O n e of the first famil ies of lectin N K receptors identified are encoded by the Ly49 genes . Initially descr ibed as a novel murine T-cel l surface antigen (Chan and Takei 1989), the first Ly49 molecule (Ly49a) was subsequent ly found to be expressed oh a subset of murine N K cel ls (Karlhofer et a l . 1992). Cont inued research has led to the identification and cloning of other members of this mult igene family (Brown et a l . 1997a; M c Q u e e n et a l . 1998; Wi lhe lm et a l . 2002), which al lowed the development of hypotheses regarding the function of these receptors. Further exper imental ev idence 2 x 00 3 o 3 o •3 ca o o 3 DC 3 o Q. O O 8 o 3 60 Q 3 3 00 Ok 1 3° 91 CQ os 3 u z J3 u z o. CN fc E 3 Z < z T3 a "C CO i t ! 1 00 8 s1 u z / J3 o 3 z a . o z so o z a . CO. O z •a" £ ' 2 m 3 SO z Cu CN z 3 SO T A B L E 1-1 R E C E P T O R S OF THE C-TYPE LECTIN-LIKE S U P E R F A M I L Y 19 clearly illustrated that in mice, Ly49 receptors are involved in the recognit ion of distinct M H C c lass I molecules on the surface of potential target cel ls and that this recognition controls N K cell activation (Karlhofer et a l . 1992; Co lonna and Samar id is 1995). Ear ly exper iments illustrated that the l igands for at least some of the Ly49 receptors were indeed M H C c lass I molecules (Karlhofer et a l . 1992), although the receptors vary significantly in their ability to recognise different M H C c lass I haplotypes. Th is finding and its implications are d iscussed further in sect ion 1.5 which deals with the M H C l igands for N K receptors. Al though the Ly49 family plays a significant role in murine N K cell biology, the s a m e is not true for humans. One of the most interesting f indings in the initial characterisat ion of the genes present in the N K C between spec ies was that there was a significant expans ion of the Ly49 genes in mice, but not in humans. Whi le there are over 16 known Ly49 genes in B6 mice, there is only one Ly49 gene in humans that is a likely a pseudogene as a result of a spl ice site mutation in its fifth exon. This rules out a similar function for Ly49 genes in humans (Westgaard et a l . 1998). A s d iscussed later, the functional role of Ly49 receptors in humans is filled the by KIR receptors. The presence of a single copy Ly49 gene with multiple KIR genes is not limited to humans but is a lso true for cows (McQueen et a l . , 2002) while cats, dogs and pigs a lso have single copy Ly49 genes , although their KIR gene copy numbers are unknown (unpubl ished observat ions). Another interesting observat ion that has come out of research into Ly49 genes , is that the gene number and organisat ion vary significantly between severa l different 20 laboratory strains of mice (Takei et a l . 1997). A recent ser ies of studies of the Ly49 gene cluster of the 129/J mouse strain illustrated that, although the 129/J and B6 mouse strains both have similar numbers of genes , their genomic organisat ion is quite distinct (Makrigiannis et a l . 2001; Makr igiannis et a l . 2002). A s a result of multiple recombination and gene conversion events, as will be d i scussed in chapter 3, it is extremely difficult to identify genes which are truly allelic between mouse strains. A n example of this complexity is given by examining the single Ly49i gene in 129/J that has 9 4 % amino acid identity to Ly49j and c and 9 5 % identity to Ly49i in B6 (Makrigiannis et a l . 2001). B e c a u s e the three B6 genes are all a result of recent gene duplication events, it is not c lear that a measure of sequence identity, by itself, is sufficient to identify Ly49 al le les. The CD94INKG2 family The CD94 gene was first identified in humans as a protein whose express ion was restricted to human N K cel ls and a minor T lymphocyte subset and which was thought to operate as a receptor for histocompatibil ity leukocyte antigen (HLA) B (Moretta et a l . 1994). Subsequent work establ ished that C D 9 4 formed a functional heterodimer with several of the neighbouring NKG2 genes , and in fact was a receptor of the non-c lass ica l H L A - E molecule in humans (Braud et a l . 1998) (and the non-c lass ica l Q a - 1 b in mice; V a n c e et a l . 1998), not H L A - B . Homologs of this gene family are present in both humans and mice, located within the centromeric region of the N K C . There are 5 and 4 NKG2 genes next to the CD94 gene in humans and B6 mice respectively, with alternatively spl iced forms of several genes having been given addit ional gene names. The CD94 gene encodes a protein that forms a heterodimer with NKG2 members . The C D 9 4 protein itself has a very short cytoplasmic domain that lacks any signall ing motifs (Chang et a l . 1995; V a n c e et a l . 1997). However, because the NKG2 genes do not s e e m capable of forming homodimers, CD94 express ion is a requirement for the express ion of heterodimers at the cell surface (Vance et a l . 2002). In both the human and mouse, the NKG2C and E genes function as activating receptors (Lazetic et a l . 1996; Houchins et a l . 1997; V a n c e et a l . 1999). Simi lar to other activating N K receptors, the human N K G 2 C / E proteins lack an ITIM motif and instead have a charged residue in their putative t ransmembrane domains . Th is al lows them to assoc ia te with the D A P 1 2 molecule which s ignals in the s a m e manner as previously descr ibed for the activating Ly49 molecules. In the case of the murine NKG2 genes , the activating N K G 2 C receptor lacks an ITIM motif but a lso does not have a charged residue for the recruitment of D A P 1 2 (Vance et a l . 1999). It has been postulated that the murine C D 9 4 , which has a charged residue in its t ransmembrane domain (Vance et a l . 1997) may instead recruit D A P 1 2 in activating heterodimer complexes . A s mentioned earlier, the l igand in both humans and mice for C D 9 4 / N K G 2 inhibitory receptors are non-c lassical M H C c lass I molecules H L A - E and Q a - 1 b respectively. T h e s e receptors are both non-polymorphic and widely expressed and both present peptides derived from the leader sequence of c lass ica l M H C c lass I molecules (Borrego et a l . 1998; Kurepa et a l . 1998). The use of these as l igands represents another level of sophist ication in the behaviour of N K cell survei l lance. B e c a u s e c lass ica l M H C c lass I derived leader peptides are needed for the express ion of H L A - E and Q a - 1 b ( B a i et a l . 1998; Lee et a l . 1998b), it provides N K cel ls with a 2 2 method for indirectly surveying express ion levels of c lass ica l M H C C l a s s I genes . If v i ruses down-regulate express ion of c lass ica l M H C c lass I receptors and express decoy receptors, the lack of leader sequences will result in a dec rease in C D 9 4 / N K G 2 inhibitory signall ing and lead to N K cell activation. There may be many other methods in which the immune system attempts to circumvent pathogenic de fences through interaction with host N K receptors. A recent reported showed that the signal peptide derived from the heat shock protein (hsp) 60 protein can bind to H L A - E and interfere with C D 9 4 / N K G 2 A binding (Michaelsson et a l . 2002). B e c a u s e this protein is s t ress-induced, it could signal to N K cells when cel ls that have normal M H C c lass I express ion have become compromised. The express ion of CD94/NKG2 heterodimers is not limited to N K cel ls. They also expressed on C D 8 + T-cel ls (Carena et a l . 1997) as well as on murine N K T cel ls (Takei et a l . 2001). Interestingly, studies have shown that the express ion of inhibitory receptors on T-cel ls can inhibit T C R signall ing during infections (Moser et a l . 2002). W h e n mice suscept ib le to the highly oncogenic polyoma virus are infected, mature anti-viral C D 8 + T-cel ls become highly expanded , but exhibit a gradual reduction in cytotoxic behaviour. This correlates with the up-regulation of C D 9 4 / N K G 2 A heterodimers in these T-cel ls . The in vivo functions of cel ls other than N K can therefore be inf luenced by the express ion of N K receptors, even if the activating signall ing pathways blocked differ, although this effect is not universal (Miller et a l . 2002). NKG2D Although NKG2D is located between CD94 and the other NKG2 genes in both human and mouse , it differs significantly in its structure, express ion and function. The 23 NKG2D genes in humans and mice have 13 and 10 exons respectively as compared to the 7 present in other NKG2 genes (Vance et a l . 1997; G l ienke et a l . 1998). The protein coded by the gene is a lso highly divergent from other members of the NKG2s having only 2 1 % amino acid identity with the c losest sequence in the case of the human gene (Houchins et a l . 1991). Recent ly work has identified the l igands for both the human and the mouse NKG2D and has greatly improved our understanding of the role of this receptor. NKG2D is expressed as an alternatively spl iced homodimer where the open reading f rames are identical except for absence of the last 13 amino acid res idues at the amino terminus in the short form of the protein ( N K G 2 D - S ) (Diefenbach et a l . 2002). W h e r e a s the long form ( N K G 2 D - L ) assoc ia tes exclusively with D A P 1 0 , N K G 2 D - S assoc ia tes with both D A P 10 and D A P 1 2 . B e c a u s e the cytoplasmic domain of NKG2D lacks signall ing motifs, these are instead sent through the ITAM and activating sequence in D A P 1 2 and D A P 1 0 respectively, which results in the recruitment of PI-3 k inase and subsequent activation signall ing (Chang et a l . 1999). The murine N K G 2 D is expressed on nearly all N K cel ls and its l igands are H60, R A E - 1 and Mul t l (Cerwenka et a l . 2000; Diefenbach et a l . 2000). In the case of the human gene, the l igands have been found to be the stress- inducible M H C c lass I chain-related (MIC) A and B (Bauer et a l . 1999; Steinle et al . 2001). Both of these M H C c lass l-like molecules are under the control of heat shock promoter e lements that can be induced by either cellular stress or viral infection. Target cel ls that express the M I C A / B l igands have been found to be highly suscept ib le to lysis by NKG2D-med ia ted killing. Whi le the mouse l igands are not known to be induced by cellular st ress, it is possib le that some other pathogenic condit ion might induce their express ion. The human and mouse N K G 2 D receptors a lso bind to another c lass of proteins cal led UL-16 binding proteins (ULBP1-2 ) (Cosman et a l . 2001 ; Carayannopou los et a l . 2002). A s indicated by their names , these proteins bind the H C M V and M C M V encoded UL-16 proteins respectively. The function of the U L B P proteins is unknown but they are thought to act as markers of transformed or virally infected cel ls. 1.4.2 Immunoglobulin receptors The second major c lass of N K receptors belong to the immunoglobul in superfamily (IgSF). Simi lar to the lectin-like receptors, examples of receptors in this c lass can be found in both mice and humans, al though, in a situation ana logous to the Ly49 genes in mice, there has been a expans ion of members of this superfamily in primates as well as in the cow (Martin et a l . 2000; Trowsda le et a l . 2001 ; M c Q u e e n et a l . 2002). IgSF receptors all share a similar structure of between 1 and 7 repeated immunoglobul in (Ig) domains with ITIM signall ing motifs in their cytoplasmic domain reviewed in (Trowsdale et a l . 2001 ; Borrego et a l . 2002; V i l ches and Parham 2002). A l so similar to the Ly49 molecules, some IgSF receptors lack any signall ing motifs in their cytoplasmic domains but have charged amino acid residues in their t ransmembrane region. These receptors assoc ia te with the human D A P 1 2 molecule and act as activating receptors in a manner similar to that descr ibed previously for the lectin-like receptors (Moretta et a l . 1995; B iasson i et a l . 1996). Many IgSF genes are found in a tight cluster on human chromosome 19q13.4 in a region termed the leukocyte receptor complex ( L R C ) (Wagtmann et a l . 1997; W e n d e et a l . 1999) and a schemat ic representation of the cluster is shown in figure 1-5. L R C - related genes L R C # $ # / / / / / / # %-» iimiiiiHm -twtfftf» 4-11III11 II mm imiiiiii \ 11 Figure 1-5 The human leukocyte receptor complex (LRC). The s ize for the L R C is approximately 900 kb and is not drawn to scale. Th is figure w a s adapted from Trowsdale et al . 2001 . Although murine N K cel ls s e e m to predominantly use the lectin-like receptors, there are severa l IgSF genes on mouse chromosome 7 which is the syntenic region of human chromosome 19q13.4 (Yamashi ta et a l . 1998a). Interestingly, the murine paired immunoglobulin-l ike receptor (PIR) multigene family found here is not expressed in T or N K cel ls but is restricted to myeloid and B-cel ls (Hayami et a l . 1997; Kubagawa et a l . 1997). Tab le 1-2 summar ies the features of several murine and human genes in this family. The Ki l ler Cel l Immunoglobulin-l ike receptor (KIR) genes O n e of the main groups of N K receptors in humans includes members of the killer cell immunoglobulin-l ike receptor (KIR) mult igene family. The KIR genes are primarily c lassi f ied by the number immunoglobul in domains that are in the extra-cellular portion of the protein that var ies from 1 to 3 (Hsu et a l . 2002; V i l ches and Parham 2002). The KIR receptors have been found to be the functional equivalent of the Ly49 genes in mice, recognising various M H C c lass I al le les that result in inhibitory signals being generat ing in the N K cell (reviewed in V i lches and Pa rham 2002). Whi le the majority of KIR receptors recognise H L A - C molecules, the 2 D L 4 , 3DL1 and 3 D L 2 rece K t o rs recognise H L A - G , H L A - B and H L A - A respectively (Vi lches and Parham 2002). There are over 13 KIR genes that have been identified to date, with over 80 al leles amongst all of the genes (Trowsdale et a l . 2001). A s such , the KIR genes represent a highly polymorphic gene family that vary not only in sequence between individuals, but a lso in total gene content. T h e s e f indings support a proposed model of gene organisat ion where certain KIR genes are invariant, termed anchor loci, while others vary in their p resence between individuals (Uhrberg et a l . 1997). A s d iscussed 27 Q Pi 3 ULTUFI E E S1 cn 3 u u o f Q Q CN 2 ON u u l r II s s s s CN s a* ON Os u .3 3 .o 60 3 o 3 o •5 o o 3 o ft o u 3 o ft W 3 60 g s 3* 60 bo NO 3J © CT ON 3 u ^3 o c o s i s O 3 o <L> 3 <L> 8 60 «> cn »> 3 c: 3 8 3 8 3 ° 3 ° § 3 2 ffi 2 W S " 6 0 8 o s 1 .£P o ft o U 3 o ft W o •s CO 60 T A B L E 1-2 R E C E P T O R S OF THE IMMUNOGLOBULIN S U P E R F A M I L Y 28 below, the organisat ion of haplotypes in humans appears to be more complex than originally bel ieved. Initial characterisat ion of the KIR genes in the human population suggested that there were two main haplotype groups, A and B, where haplotype B had several more activating receptors than A (Uhrberg et al . 1997; Wi lson et a l . 2000). These studies were enhanced by the subsequent analys is of the KIR content in large pedigree famil ies. A more accurate model now suggests that there are in fact 6 main haplotypes derived from regions representing 3 partial haplotypes. Of these 6 haplotypes, one is the previously descr ibed A type (which is present in approximately 5 0 % of the C a u c a s i a n population) and the others are variants of the B haplotype (Hsu et a l . 2002). The majority of the variability seen in the gene content is in the telomeric half of the cluster, which can be divided into 2 of the 3 partial haplotypes descr ibed. Interestingly, the variability seen in the Caucas ian population is not unique, as studies of various ethnic populat ions from geographical ly isolated or distinct populat ions including north Indian Hindus, J a p a n e s e , Palest in ians, and Tha is have shown similar variation in KIR haplotypes (Norman et a l . 2001 ; Raja l ingam et a l . 2002; Yawa ta et a l . 2002). Studies of the KIR genes in other primates have shown that although the gene type and general arrangement is conserved, the genes themselves are structurally distinct between spec ies . Our laboratory has recently shown that mult i-copy K IRs also exist in cows (McQueen et a l . 2002), while Ly49 receptors appear to be single copy genes except in rodents. It is interesting to note however, that in severa l primate spec ies , the single Ly49 copy appears to be coding competent (Mager et a l . 2001), though whether or not it has any biological role has not been tested. 29 Severa l activating KIR genes have been identified which lack a long cytoplasmic domain and have a charged residue in their t ransmembrane domain (Moretta et a l . 1995; B iasson i et a l . 1996). The l igands for several of these genes have been identified as being H L A - C , however the 2 D S 4 and 2 D S 5 genes have no identified l igands. It is unclear what these activating K IRs are recognising and therefore whether they might function in a similar manner to activating Ly49s in recognising peptides from pathogens. Even if the activating receptors do interact with M H C c lass I molecules, they may have the capaci ty to recognise other non-cel lular l igands in a fashion similar to N K G 2 D (Radaev et a l . 2002). The immunoglobul in- l ike transcript (ILT) genes The L R C region a lso contains several other genes distantly related to the KIR. T h e s e genes are cal led immunoglobulin-l ike transcripts (ILT) (also known as leukocyte Ig-like receptors (LIR) or Monocyte /macrophage inhibitory receptors MIR) and are found in two c losely spaced clusters which appear to have formed through a ser ies of duplication events, ana logous to those descr ibed for the Ly49 genes in chapter 4 (Volz et a l . 2001 ; Young et a l . 2001). The ILT genes encode proteins that contain between 2 and 4 Ig-like domains in their extracellular domain and both inhibitory and putative activating forms of ILT genes have been c loned (Volz et a l . 2001). Despite their proximity to the KIR genes , the express ion pattern of the ILT genes is significantly different with most the genes being expressed on mature B-cel ls and monocytes. However several genes , including ILT2, 3 and 6, are expressed in cytotoxic T and N K cel ls (Samarid is and Co lonna 1997; Wagtmann et a l . 1997; Torkar et al . 1998) Of the 13 identified ILT genes , over 50 al leles have so far been identified, but most of these al leles have been identified from c D N A s that are bel ieved to be from pseudogenes (Volz et a l . 2001). Unlike the KIR genes , the intron and intergenic s izes are not similar between ILT genes and only one of the genes , ILT6, appears to be polymorphic in its p resence or absence from haplotypes (Torkar et a l . 2000). T h e s e features, as well as the genomic organisat ion of the ILTs, suggest that they are older than the KIR genes and may, therefore, represent orthologs of the mouse PIR genes d i scussed below (Trowsdale et a l . 2001). In support of the theory that ILT genes are widely distributed among spec ies , zoo-blot analys is of var ious animals suggests that ILT-like genes existed in the last common ancestor between birds and humans approximately 300 million years ago (Volz et a l . 2001). Of all of the ILT genes , only two have been found to recognise H L A molecules. ILT2 and ILT4, both inhibitory receptors, recognise H L A - G and H L A - F (Borges et a l . 1997; C o s m a n et a l . 1997; Lepin et a l . 2000) respectively with ILT2 a lso exhibiting broad H L A c lass I specificity (Vitale et a l . 1999). The lack of def ined biological l igands represents an obvious difficulty in determining a functional role for the ILT receptors. It may be that the ILT locus simply provided the starting material from which the KIR genes were formed and that its functional signif icance has s ince diminished. The high percentage of pseudogenes in the family, a long with the ex is tence of at least one member of the family, ILT6, which lacks a t ransmembrane domain and is secreted as a result (and would therefore lack any cellular function) (Volz et a l . 2001), is consistent with this theory. 31 The paired immunoglobul in- l ike receptors (PIR) genes The 8 murine PIR genes are found near the centromere oh ch romosome 7 in a region that is syntenic to human chromosome 19q13.4 (the L R C ) (Yamashi ta et a l . 1998a). The PIR genes were originally isolated in a search for homologs to the human F c receptor family members and consequent ly belong to the same Ig superfamily (Hayami et a l . 1997; Kubagawa et al . 1997). Of the 8 PIR genes , 7 are activating forms (PIRA1-7) while only one, PIR-B, is an inhibitory form (Takai and O n o 2001). The PIR genes have been found to be expressed in B-cells and cel ls of the myeloid l ineage, and the express ion of these genes is regulated such that both activating and inhibitory forms of the receptors are expressed in the same cell (Kubagawa et a l . 1997). The PIR-B molecule has 4 ITIM motifs in its cytoplasmic domain which, when phosphorylated, can recruit S H P - 1 and block downstream activation s ignals in a similar manner to other inhibitory receptors (Maeda et a l . 1998). The activating forms of the PIR have a charged residue in their t ransmembrane domain which al lows associat ion with F c R signall ing components allowing activation s ignals to be generated (Yamashi ta et a l . 1998b). Like the ILTs, with which they share « 6 7 % identity in their extracellular region (Volz et a l . 2001), P IRs have no identified biological l igands. G iven the ev idence that the PIR-B molecule is constitutively phosphorylated when expressed (implying constitutive ligation with its ligand) (Ho et a l . 1999) and the fact that P IR express ion is down-regulated in B2m-deficient mice (but not T A P 1 or M H C c lass II deficient mice), it has been suggested that the PIR l igands may be nonclass ica l M H C c lass I molecules (Takai and O n o 2001). 32 1.5 MHC class I ligands ofNK receptors The earliest exper iments that identified a link between M H C c lass I express ion and sensitivity of cel ls to lysis by N K cel ls establ ished the framework for understanding the role of N K cel ls in the immune system (Ljunggren and Karre 1985; Piontek et a l . 1985). What was not appreciated at the time was the inherent complexity of the recognition sys tems which N K cells have been found to use . The major histocompatibil ity complex genes (termed Human Leukocyte Ant igen (HLA) in humans and H-2 in mice) are found in a large cluster, a long with numerous other MHC-re la ted genes and those required for antigen process ing, on ch romosome 6 in human and chromosome 17 in the mouse (Janeway and Travers 1997). The M H C receptors can be divided into two c lasses of genes , those encoding M H C c lass I molecu les which present endogenous ly derived peptides to C D 8 + cel ls and those encoding M H C c lass II molecules which present exogenous ly derived peptides on the surface of antigen presenting cel ls. The M H C c lass I genes can be further divided into those encoding c lass ica l or nonclass ica l molecules, where nonc lass ica l genes lack the high level of polymorphism seen with the c lass ica l and have a more restricted express ion pattern than c lass ica l (Janeway and Travers 1997). The structure of M H C I molecules and the process of antigen display by M H C c lass I molecules for effector cell recognition are extensively reviewed e lsewhere (Trowsdale 1993; Natarajan et a l . 1999; Thorsby 1999) and will not be d iscussed in detail here. Figure 1-6 shows a diagrammatic representation of an M H C c lass I molecule complexed with the p2m molecule. This figure a lso presents a compar ison of indirect recognition direct recognition 1 i 1 Figure 1-6 Structure of MHC I molecule and antigen process ing pathway A) Diagramatic representation of an M H C c lass I molecule complexed with a p2m molecule. A l s o shown is the peptide binding grove between the a1 and a 2 domains where peptides are displayed to effector cel ls. B) Compar i son of ant igen presentat ion pathways by c lass ica l and nonc lass ica l M H C c lass I molecules in humans and mice and their respect ive receptors, (part B adapted from Raulet et a l , 2001) 34 antigen processing pathways for human and mouse c lass ica l and nonclass ica l M H C c lass I molecules. W h e n M H C c lass I l igands were first identified as l igands for N K receptors which control N K cell activation, numerous quest ions arose, given what was already known about M H C function. O n e of the primary ongoing quest ions is which receptors recognise which polymorphic M H C c lass I molecules. Severa l studies have addressed this question and , in the case of both humans and mice, it s e e m s there is a wide range in receptor specificity. M H C c lass I recognition by Ly49 receptors has been ana lysed by severa l groups (Mason et a l . 1995; Brennan et a l . 1996; George et a l . 1999; Hanke et a l . 1999). S o m e receptors such as Ly49A and C appear to recognise a wide range of M H C c lass I haplotypes, other receptors such as Ly49D and F appear to be far more restricted. Severa l other Ly49s such as Ly49B , Q , E, X , do not recognise any M H C c lass I molecules yet tested. The situation is compl icated by the recent finding that some Ly49 molecu les, both activating and inhibitory, recognise virally encoded l igands (Daniels et a l . 2001 ; Dokun et a l . 2001 ; Lee et a l . 2001 a; A r a s e et a l . 2002). The lack of binding to M H C c lass I l igands does not, therefore, imply that the receptor lacks a function. A similar range in receptor binding has been observed for the polymorphic KIR receptors in humans (C iccone et a l . 1992; Wag tmann et a l . 1995; Winter et a l . 1998). Al though there is ev idence that the recognition of M H C c lass I molecules by Ly49A and C (Correa and Raulet 1995; Or ihuela et a l . 1996; F ranksson et a l . 1999) C D 9 4 / N K G 2 A in mice (Kraft et a l . 2000) and K IRs in humans (Peruzzi et a l . 1996; Rajagopalan and Long 1997; reviewed in Reyburn et a l . 1997a) is dependent upon the p resence of bound peptide, it is unclear if the recognition of the M H C c lass I is in all c a s e s peptide specif ic. 35 A s illustrated in figure 1.6, the nonclass ica l M H C c lass I molecu les H L A - E and Q a - 1 b present a peptide derived from the leader sequence of c lass ica l M H C c lass I molecules. 1.6 The expression patterns of Natural killer cell receptors The express ion pattern of murine N K receptors has been well studied whereas similar information is not yet avai lable for human receptors due in part to experimental constraints. In the course of murine hematopoiet ic development when immature definitive N K cel ls first appear, virtually all of these cel ls have been found to express C D 9 4 / N K G 2 heterodimers (Sa lcedo et a l . 2000), as well as Nkrp1-C that is recognised by the NK1.1 antibody (Kim et a l . 2002). Ly49 express ion, except for Ly49e (Van Beneden et a l . 2001 ; V a n Beneden et a l . 2002), does not begin until shortly after birth, when these receptors are first detectable by F A C S analys is (Dorfman and Raulet 1998). Interestingly while Ly49 f requencies have reached adult levels by approximately 40 days after birth (S ivakumare t a l . 1997; Dorfman and Raulet 1998), C D 9 4 / N K G 2 f requencies actually dec rease significantly to the level observed in adult mice (Kubota et a l . 1999; V a n c e et a l . 2002). The mechan isms for this change in express ion patterns is not clear, although the gradual expression of Ly49 receptors that can recognise speci f ic M H C c lass I al leles as opposed to C D 9 4 / N K G 2 heterodimers which indirectly survey all c lass ica l M H C c lass I express ion would presumably have an evolutionary benefit. The express ion of C D 9 4 / N K G 2 receptors is bel ieved to be a necessary component of a self-tolerance mechan ism for N K cel ls during fetal development (S ivakumar et a l . 1999; Toomey et a l . 1999). The hypothetical outcome of the circulation of N K cel ls that do not express inhibitory receptors would be widespread 36 lysis of normal cel ls. A recently publ ished report of a strain of inbred mice (DBA2/J ) which lacks express ion of a full length CD94 transcript (and therefore all functional C D 9 4 / N K G 2 heterodimers) revealed that even in the absence of C D 9 4 / N K G 2 heterodimers on fetal N K cel ls, self-tolerance is maintained (Vance et a l . 2002). This suggests that there are either more inhibitory receptors expressed on fetal N K cel ls than are currently known, or that N K cel ls can be educated during development to tolerate a lack of inhibitory signal l ing. Ev idence supporting the later hypothesis has been shown in the c a s e of mice and humans who lack M H C c lass I express ion due to express ion defects in either T A P proteins or the p 2 m molecule. In these c a s e s , the respect ive animals develop normally, although with a widely variable level of immunodef ic iency (Raulet 1994; Arkwright et a l . 2002). The N K cel ls of the mice express Ly49 receptors at f requencies similar to those in the wild-type and display self- tolerance to self cel ls (Liao et a l . 1991; Sa lcedo et a l . 1997). Interestingly, al though N K cel ls from T a p T p 2 m T mice do not lyse lymphoblasts generated from p2m7" mice, cytolytic activity of the N K cel ls against self cel ls , but not blasts from B 6 mice express ing M H C c lass I, can be restored by ex-vivo culturing in the presence of IL-2 (Sa lcedo et a l . 1998). O n the bas is of the avai lable ev idence, it is c lear that CD94/NKG2 express ion is not required for self- tolerance in developing mice; however, the lack of express ion of these receptors might lead to an increased susceptibil i ty to pathogens during gestation if the host N K cel ls are hyporesponsive. There is at least one notable except ion to the general Ly49 receptor express ion pattern, and that is Ly49e (Van Beneden et al . 2001). A s will be d i scussed in Chapter 3, this gene is located at the far centromeric region of the Ly49 c luster and is, a long with Ly49q, separated from the rest of the Ly49 genes by a large stretch of highly repetitive 37 D N A . Both F A C S analys is and R T - P C R have shown that Ly49e is expressed on fetal N K cel ls (Van Beneden et a l . 2001). Whether the express ion of Ly49e on fetal N K cel ls is ev idence to support the notion that other receptors may maintain self-tolerance in the absence of C D 9 4 / N K G 2 is not c lear as Ly49E has no identified l igand. No information has been publ ished on the express ion pattern of Ly49q that is in c lose proximity to Ly49e or for Ly49b that is approximately 800 kb telomeric of the cluster. Both of these genes are highly divergent from all the other Ly49 genes and , therefore, it would not be surprising to find that their express ion patterns, and indeed their biological roles, differ from that of the other Ly49 genes . 1.6.1 Ly49 transcript ional regulation Of the murine N K receptors, the best character ised are the members of the Ly49 gene family. The analys is of bulk populations of N K cel ls has revealed that each Ly49 gene examined is expressed at a consistent and characterist ic f requency in a proportion of N K cel ls that ranges from 5 % to approximately 6 0 % (reviewed in S ivakumar et a l . 1998; Kubota et a l . 1999). A study of Ly49 gene express ion in individual N K cel ls examined by R T - P C R has shown that there is significant heterogeneity from cell to cell in which Ly49 genes are transcribed (Kubota et a l . 1999). Th is analys is a lso illustrated that the f requency of receptor co-express ion can be calculated from the product of the f requencies of the individual receptors (Kubota et a l . 1999). Th is result supports the hypothesis that the express ion of each receptor is regulated independently of any other. A subsequent report provided ev idence based on F A C S analys is that this theory might not be true for the co-express ion of activating receptors, as Ly49D and H were shown to be co-expressed at a significantly higher level than would be predicted by the product of their individual express ion probabilit ies (Smith et a l . 2000). Furthermore, the single cell analys is did not detect cel ls which lacked all known receptors. Th is finding suggests a model for the random and continued activation of Ly49 genes until a receptor for self-M H C is expressed . The merits of such a model are d iscussed later. The express ion of individual murine Ly49 genes has also been found to be mono-al lel ic; however, there is no bias against the express ion of different Ly49 genes from both ch romosomes (Held and Raulet 1997a; Held and K u n z 1998). Al though the express ion of a single Ly49 gene simultaneously from both al leles is quite rare, it has been experimental ly observed (Held and Raulet 1997a), suggest ing that this express ion pattern is not regulated with the same rigidity as the allelic exc lus ion exhibited by the T C R genes . No definitive mechan ism for mono-al lel ic Ly49 express ion has yet been proposed; however, general s chemes that rely on a rate limiting trans-acting factor required for initiation of gene express ion have been suggested to explain the observed patterns (Held and Kunz 1998). There is ev idence from T C F - 1 7 " mice, d i scussed later, to suggest that such a mechan ism may be used for some , but not al l , of the Ly49. genes . Ana lys is of t ransgenic mice expressing the Ly49a gene in all cel ls indicates that there is a feedback mechan ism to block express ion of the endogenous Ly49a al leles (Held and Raulet 1997b). Whi le this does indicate that signall ing events though a speci f ic receptor can alter the cell surface express ion of other receptors, this p rocess was found to be post-transcriptional and does not contradict the model of initiation of Ly49 express ion being regulated by the rate-limiting assembly of transcript initiation complexes . Finally, a similar pattern of mono-al lel ic express ion has been observed for the murine NKG2A gene (Vance et al . 2002), demonstrat ing that this mechan ism of gene activation may apply broadly to all N K C genes. 39 In an attempt to analyse the mechan isms behind the acquisit ion of Ly49 express ion by Ly49" precursor cel ls, several groups performed ex vivo differentiation exper iments to determine if there is an order in which Ly49s begin to be exp ressed . Using a culturing systerrfof bone marrow stromal cel ls to induce Ly49 express ion in clonal bone marrow progenitor cel ls, Raulet 's group found that an order of gene activation could be deduced as Ly49a, Ly49/7NK1.1, fol lowed by Ly49g/i and c (Roth et a l . 2000). This order was determined by F A C S purifying N K cel ls that expressed a given receptor and observing what other receptors could subsequent ly be expressed on the purified cel ls after additional culturing. The conclusion of this experiment was that there is a window of opportunity where gene express ion can be induced, and once the window is c losed , the resulting transcriptional state is maintained. The second group used N K progenitor cel ls plated at limiting dilution in wells with O P 9 stromal cel ls to grow up bulk cultures of cel ls that were then checked for Ly49 express ion at var ious time points (Wil l iams et al . 2000). Contrary to the first group's f indings, N K cel ls grown in these condit ions appeared to acquire Ly49g express ion first fol lowed by Ly49i and c s imultaneously fol lowed last by Ly49a and of. The reason for the dif ferences between the two group's f indings is not entirely clear, although some unknown consequences of dif ferences in the experimental procedures might explain the d iscrepancy. In addit ion, the results are not necessar i ly contradictory as in later case , the actual order of express ion was assayed as opposed to first study that looked at the timing of commitment to express individual genes . There is, however, addit ional in vivo ev idence to support the theory of cumulat ive receptor acquisit ion of the first group. 40 Earl ier studies involving adoptive transfers of N K cel ls ( N K 1 . 1 \ C D 3 " , Ly49") into recipient mice showed that receptor express ion is stable after transfer to the recipient mouse. In addit ion, while donor N K cells which were Ly49A" could not give rise to L y 4 9 A + N K cel ls in the recipient, they could give rise to L y 4 9 G + and C + donor derived N K cel ls (Dorfman and Raulet 1998). This result supports the earlier conc lus ion that the ability to induce Ly49a express ion ends when NK1.1 express ion is acquired and that receptor express ion is sequential and cumulat ive. 1.6.2 Transcript ion factors implicated in the regulation of NK receptor genes Very little is known about the transacting factors that are involved in the transcriptional regulation of the any of the murine N K cell receptors. In the case of a few genes , fortuitous d iscover ies have provided some insight. Severa l of these examples are d iscussed below. A function for Activator Protein-1 (AP-1) in the transcriptional regulation of the human Ig-SF gene encoding the activating receptor 2 B 4 has recently been demonstrated (Chuang et a l . 2001). Predicted AP-1 binding sites are located in the putative promoter region of the 2 B 4 gene and luciferase constructs using these stretches of D N A showed high activity when transfected into the human N K cell line, Y T . Th is activity was significantly reduced when the predicted A P - 1 binding site was mutated. E M S A analys is indicated that AP-1 appeared to be binding to the predicted sites in the promoter region, where this binding could be effectively competed by consensus AP-1 ol igonucleot ides. 2 B 4 remains one of the only Ig-SF genes whose transcriptional control has been linked to a transacting factor. 41 To date, one of the few well-characterised transcription factors involved in expression of the Ly49 genes is T-cell factor 1 (TCF-1). This transcription factor belongs to a family of proteins referred to as high mobility group (HMG) proteins which have been shown to bend strands of DNA in vivo (Thomas and Travers 2001). As they lack any trahsactivational domain, their role has been speculated to be primarily architectural, bending DNA around a promoter region to allow other trans-acting factors to bind and induce transcription. An analysis of a mouse strain that is deficient in TCF-1 expression showed that the expression of Ly49A was reduced in a dose-dependent manner suggesting it is present in limiting quantity (Held et al. 1999). However, except for a decrease in Ly49D and a slight increase in Ly49G expression, no other Ly49 genes showed a change in expression. In this same study, luciferase constructs using the sequence of the previously reported promoter region of Ly49a also showed a TCF-1 dependent activity and this activity was observed only in cell lines where both TCF-1 and Ly49a were endogenously expressed. Interestingly, the very few NK cells that did express Ly49a in TCF-1 T mice did so at normal levels, suggesting that TCF-1 may only be involved in the initiation of Ly49 expression rather than maintaining transcriptional activity. The alterations in the Ly49 expression patterns in the TCF-17" mice were subsequently shown to be unrelated to any possible changes in MHC class I expression (Kunz and Held, 2001). A more complete discussion of the role of this factor can be found in chapter 2 where an explanation for the variations in the Ly49 expression patterns in TCF-1T mice is proposed. The only other trans-acting factor that has been implicated in the expression of Ly49 genes is called ATF-2. This protein was identified in an analysis of Ly49a expression in the EL-4 cell line (Kubo et al. 1999). Promoter constructs that contained 42 the A T F - 2 binding site had high promoter activity in E L - 4 but not other cel ls. In addit ion, electrophoretic mobility shift a s s a y s ( E M S A ) a lso showed that purified A T F - 2 protein could bind to the proposed sites in the Ly49a promoter region. B e c a u s e the E L - 4 cell line expresses Ly49a, but not any other Ly49 genes , the role of transcriptional regulation of A T F - 2 could not be extended to other Ly49 genes . 1.6.3 Character ised N K C gene promoter regions The promoter regions of several Ly49 genes have been character ised in detail. The promoter region of Ly49a was first def ined by using primer extension and S1 nuc lease mapping to identify the transcriptional start point (Kubo et a l . 1993). A search of the sequence upstream also revealed numerous computational ly predicted transcription factor binding sites, including two for the T C F - 1 transcription factor. More recent studies involving the c losely related Ly49c, and j genes failed to reveal any significant di f ferences in the sequence in the putative promoter region of these genes even though Ly49c is expressed at a much higher f requency than Ly49j. (McQueen et al . 2001). Promoter constructs made using varying lengths of sequence from upstream of the first exon of Ly49a, c and j or sequence exhibited varying activities that dec reased with the construct length. S e q u e n c e s from the 3' end of the first intron of these genes were also tested for promoter activity, in part because Ly49a and j contained a canonica l T A T A box sequence in this region and a lso because the human NKG2A gene had been reported to encode transcripts originating in the vicinity of a T A T A box in a similar position within the gene (Plougastel and Trowsda le 1998). Only the intron sequence of Ly49j d isplayed any promoter activity, perhaps in part due to the presence of a canonica l C A A T sequence at the predicted distance upstream of the T A T A sequence (McQueen et a l . 2001). 43 The Ly49i promoter region in the 129/J mouse strain has also been examined to some extent. Th is work showed that a stretch of D N A upstream of the presumed transcriptional start point exhibited promoter activity in transient transfection a s s a y s and that in E M S A exper iments, some unidentified proteins from E L - 4 lysates bound to the canonica l T A T A box found in the region of the promoter (Gosse l in et a l . 2000). Despi te verifying assumpt ions made regarding the signi f icance of some cis-act ing sequence e lements, these f indings were unable to define a role for any novel transacting factor in the express ion of Ly49i. However, the s a m e group was able to provide ev idence that suggests that transcriptional regulation of Ly49 genes (and likely other N K receptors) is more complex than initially thought. A novel promoter region was identifed upstream of several Ly49 genes which is active in bone marrow and fetal thymus (Saleh et a l . 2002). A s shown in chapter 3, this promoter region is located upstream of all Ly49 genes except b and q. Transient transfection a s s a y s of the activity of this promoter using sequence upstream of the B6 Ly49j gene did not yield high activity compared to Ly49i and g. This fact is interesting in light of the low frequency of express ion observed for Ly49j (approximately 5 % of N K cel ls; Kubota et a l . 1999) and the t issue specif icity of promoter (including bone marrow, where Ly49 express ion may be initiated). 1.6.4 Other potential NK receptor gene regulatory mechan isms. A s d iscussed previously, there appears to be a switch in receptor usage by murine N K cel ls where ubiquitous CD94/NKG2 express ion is supplanted by heterogenous Ly49 express ion. It is tempting to speculate that the chromosomal position might play a role in regulating this aspect of receptor express ion in a manner 44 similar to that seen in the B-globin gene cluster (reviewed in Li et a l . 1999). This possibil ity is proposed for Ly49e in chapter 3, by virtue of its location relative to the other Ly49 genes . Currently, there is no experimental ev idence that there is some global alteration in the chromatin structure in the N K C that inf luences the order in which receptors are expressed . It is of interest that, in the case of fetal human N K cel ls, it appears that the KIR genes are expressed along with CD94/NKG2 genes (Raulet et a l . 2001). Whether this is because the KIR genes are in a different chromosomal location, and therefore not subject to the effects of a hypothetical locus control region ( L C R ) that might control the order of gene express ion in the N K C , is unknown. More global methods of regulating gene express ion have been examined in the c a s e of the KIR genes . Interestingly, in human N K cell l ines where individual KIR genes are not expressed , there is a excel lent correlation with a state of hypermethylation of the KIR promoter regions (Santourl idis et a l . 2002). The reverse has also been found to be true in examining the promoter regions of KIR genes that are exp ressed . In agreement with this observat ion, KIR express ion can be induced in lymphoid, but not non- lymphoid, KIR negative cell l ines when treated with methyltransferase inhibitor 5-aza-2 ' -deoxycyt id ine. Al though this clarifies one aspect of control over KIR express ion, the question of whether demethylat ion is a developmental requirement for the induction of KIR gene express ion or whether KIR genes which are not expressed simply become methylated has not been answered yet. Th is method of regulation may not apply to the Ly49 genes as analys is of the genomic sequence shows no predicted C p G is lands 45 within the cluster, although some small clusters of C p G dinucleot ides can be found in the promoter regions. 1.7 A model for receptor acquisition and the role of MHC I environment A s d iscussed earlier there appears to be a stochast ic mechan ism that initiates Ly49 gene express ion. A model , descr ibed as the "at least one" model , was proposed to explain the observed receptor express ion pattern (Raulet et a l . 1997). The e s s e n c e of this theory is that all N K cel ls must express at least one receptor capab le of recognising s e l f - M H C molecules to maintain self- tolerance. G e n e express ion could, therefore, be randomly initiated and continue until a self-tolerant receptor repertoire has been acquired. Th is theory is supported by the analysis of panels of human N K c lones from two subjects (Valiante et a l . 1997). In this study, all c lones expressed at least one receptor that would recognise donor M H C c lass I molecules. Whi le a similar study in mice also general ly supported the theory, some cel ls did not appear to express self-M H C receptors (Kubota et a l . 1999), although additional B6 Ly49 genes have s ince been c loned which were not tested. Such cel ls may express other unknown receptors for se l f -MHC, or may be hyporesponsive due to down-regulat ion of receptors involved in N K cell activation. It has been proposed that N K cel ls may in fact start off in a hyporesponsive state and then only develop normal cytolytic activity after engagement of inhibitory receptors with se l f -MHC molecules. This hypothesis would explain the maintenance of N K self-tolerance in M H C c lass I deficient mice and humans and the ability to restore the cytolytic activity after high dose IL-2 activation in the case of the murine N K cel ls (Sa lcedo et a l . 1998). A s a consequence , the M H C c lass I environment in which N K cel ls develop should be an important inf luence on the development of N K receptor repertoires. Stud ies of mice strains express ing Ly49a t ransgenes so that the receptor is expressed on a wide variety of cell types have revealed this hypothesis to be true. In transplantation exper iments, the presence of the H-2 d l igand was shown to lead to the down-regulat ion of Ly49A express ion upon transfer from a H-2 b donor to a H - 2 b / d recipient (Khoo et a l . 1998). This down-regulation was not f ixed, as a secondary transfer to a H-2 b recipient caused an increase in the f requency of Ly49A express ion while transfer to an H-2 d recipient caused and even greater dec rease in express ion. A second Ly49A transgenic mouse showed a similar dec rease in the f requency of L y 4 9 G express ion, which also recognizes H-2 d (Held and Raulet 1997b). In addit ion, while there was no alteration in the amount of Ly49a m R N A per cel l , as measured by the R N a s e protection assay , the frequency of L y 4 9 A + cel ls in non-transgenic mice which expressed the H-2 d molecule was lower. Th is would suggest that in normal mice, the receptor modulat ion observed in post-transcriptional. In the c a s e of Ly49A transgenic mice, the level of endogenous Ly49a express ion was significantly reduced which was interpreted as indicated a reduced frequency of endogenous Ly49a express ion. The role of M H C c lass I environment has also been demonstrated through examinat ion of bone marrow or fetal liver chimeric mice. Both hematopoiet ic and non-hematopoiet ic cel ls lacking M H C c lass I express ion were able to induce a tolerance to subsequent M H C c lass I negative bone marrow grafts (Hoglund et a l . 1991), with the non-hematopoiet ic M H C c lass I negative ch imeras inducing substantial ly higher to lerance (Wu and Raulet 1997). A s noted above, this tolerance was shown to be 47 reversible, indicating that N K cel ls are not fixed in a hyporesponsive state. In summary, these exper iments have shown that the level of Ly49 receptor express ion at the cell sur face is modulated by the M H C c lass I environment, with the presence of the cognate l igand of a receptor leading to the down-regulation of that receptor. A s mentioned earlier, this modulation process appears to be post-transcriptional (Held and Raulet 1997b) in nature and a similar down-regulation can be seen in B-cel ls express ing a t ransgenic Ly49a receptor gene (Raulet et a l . 2001), showing that this effect is not specif ical ly related to N K cell function or development. 1.8 Convergent receptor evolution and co-evolution with MHC class I O n e of the most interesting f indings in N K cell biology to date is the fact that the receptors used in humans and mice to recognise se l f -MHC molecules belong to structurally different famil ies. Despite obvious structural di f ferences, there are many similarities between the human and mouse receptors. For both the KIR and Ly49s, there is ev idence to suggest that the genes have evolved, in some c a s e s rapidly, though a ser ies of duplication events (Martin et a l . 2000; V o l z et a l . 2001 ; and chapter 3) that have produced a large cluster of genes . Both of these clusters contain inhibitory and activating forms of the receptors, which in both c a s e s in both famil ies, use similar signall ing mechan isms. The express ion of Ly49 and KIR receptors a lso appears to be stochast ic and clonal in both humans and mice (Valiante et a l . 1997; Kubota et a l . 1999). It is interesting that both spec ies a lso have a conserved mechan ism for non-specif ical ly monitoring c lass ica l M H C c lass I express ion. Al l of these similarities suggest that there has been strong select ive pressure in both organ isms to develop and maintain such a sys tem. The source of the pressure likely c o m e s in part from the l igand for these receptors, the M H C c lass I molecules. 48 A s further outlined in chapter 3, the M H C c lass I genes are an example of a group of rapidly evolving genes under select ive pressure to maintain diversity to al low the immune system to recognise pathogens (reviewed in Y e a g e r and Hughes 1999). If any receptor requires the recognition of an M H C c lass I l igand, it would be expected that the receptor would have to match the evolutionary pace of the M H C to maintain function. G o o d ev idence has been provided to show that this is indeed the case for the KIR receptors in humans (reviewed in V i lches and Parham 2002). Whi le in-bred mouse strains, where N K receptor gene repertoires have been studied, likely do not properly reflect the select ive pressures on wild mice, they do nonetheless suggest that murine N K receptors are a lso evolving at a rapid pace. Further detai led analys is of the N K cell receptor repertoire of other spec ies will perhaps al low broader conc lus ions to be made about why the c-type lectin-like receptors appear to be expanded in only rodents while KIR receptors appear to be expanded more broadly across spec ies . t 1.9 Thesis objectives and organisation My overall thesis objective was to identify the mechan isms of transcriptional regulation of genes in the natural killer gene cluster (NKC) . Specif ical ly, my goals were to sequence and compare the promoter regions of a large number of related N K C genes and look for explanat ions for the different express ion f requencies observed. My goal was then to focus on a single gene in the N K C and to examine in more detail how it is regulated. The sudden availability of genomic sequence for the murine Ly49 cluster added an additional goal , that of characterising the genomic organisat ion of the Ly49 cluster in the C 5 7 B L / 6 mouse strain. The organisat ion of my thesis is outl ined below. 49 Chapter 2: Comparative analysis of the promoter regions of Ly49 genes The goal of this work was to sequence the promoter region of a large number of Ly49 genes to character ise the al igned sequence in terms of regions of highly conserved sequence that might have functional s igni f icance. In addit ion, the transcriptional start points of several genes were determined by 5' R A C E . T h e s e exper iments provided a basis for interpreting other publ ished experimental work on the transcriptional regulation of Ly49 genes . This chapter has been publ ished: Brian T. Wi lhe lm, Kar ina L. M c Q u e e n , J . Douglas F reeman , Fumio Take i and Dixie L. Mager (2001) Comparat ive analys is of the promoter regions and transcriptional start sites of mouse Ly49 genes . Immunogenetics 53(3): 215-224 Chapter 3: Genomic organisation of the C57BL/6 Ly49 cluster The focus of this study was to ana lyse the genomic organisat ion of the Ly49 cluster at the nucleotide level from the sequence provided by the public mouse genome sequenc ing consort ium. Th is work permitted the formulation of a gene evolution theory for the expans ion of the Ly49 cluster to be formulated and analys is of genomic features a lso al lowed for an explanation of a d iscrepancy in the previously descr ibed developmental express ion pattern of the Ly49 genes . Th is chapter has been publ ished: Brian T. Wi lhe lm, L iane Gagnier , Dixie L. Mager (2002) S e q u e n c e analys is of the Ly49 cluster in C 5 7 B L / 6 mice: A rapidly evolving mult igene family in the immune sys tem. G e n o m i c s 80(6): 646-661 50 Chapter 4: Transcript ional control of the immune receptor CD94 The aim of this work was to character ise the transcriptional regulation of a single N K receptor, C D 9 4 . Study of this receptor using F A C s sorting and real-time quantitative P C R has illustrated a complex mechan ism of cell-type specif ic regulation. Th is chapter has been submitted for publication: Brian T. Wi lhe lm, Jose t te -Renee Landry, Fumio Take i and Dixie L. Mager (submitted) Transcript ional control of the murine C D 9 4 gene: differential usage of dual promoters by lymphoid cell types. Th is chapter a lso contains data and d iscuss ion publ ished in a paper entitled Identification of a new murine lectin-like gene in c lose proximity to C D 9 4 by Brian T. Wi lhe lm and Dixie L. Mager (2003) Immunogenetics, (in press). Chapter 5: Summary This final chapter summar ises the contribution of my work to the field of N K cell biology and also outl ines areas in which further work could aid in answer ing quest ions that remain unclear. 51 Chapter 2 Comparative analysis of the promoter regions of Ly49 genes A paper by Brian T. Wi lhe lm, Kar ina L. M c Q u e e n , J . Douglas F reeman , Fumio Take i and Dixie L. Mager entitled "Comparat ive analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes" has been publ ished in Immunogenetics 53(3): 215-24 (2001). Kar ina M c Q u e e n sequenced the promoter region of Ly49c and j. Douglas F reeman sequenced the promoter region of Ly49g and b. Th is work is descr ibed in sect ion 2.2.1 52 2.1 Introduction At the beginning of my thesis work, only one Ly49 gene had had its promoter region identified and the sequence character ised (Kubo et a l . 1993). This study did not show experimental ev idence for the identification of the transcriptional start site. Prev ious work had showed that there were at least 14 Ly49 genes in B6 mice that were expressed at varying f requencies (Smith et a l . 1994; Brown et a l . 1997b; M c Q u e e n et al . 1998; S ivakumar et a l . 1998). G iven the lack of information regarding the promoter region sequence for these genes and the availability of wel l -mapped genomic c lones of the region, it was dec ided that the sequenc ing of the promoter regions should be the first experimental approach taken. The subsequent similarity of promoter region sequence in the 9 genes ana lysed led to the second aim of this work that was to identify the transcriptional start points for several genes . 53 2.2 Materials and Methods 2.2.1 Sequencing of putative promoter regions Nucleot ide sequence from the putative promoter regions was obtained through a combinat ion of several techniques. Subc lones were initially obtained and sequenced from regions of previously descr ibed (McQueen et a l . 1998) P1 bacter iophage genomic c lones (Resource Centre, Max-Planck- lnst i tute for Molecular Genet ic , Berl in, Germany) which hybridised to 32P- labe led ol igonucleot ides des igned from sequence in exon 1 of the previously publ ished c D N A s of Ly49 /', of and h. In addit ion, some sequences were obtained with vectorette P C R performed as descr ibed previously (Riley et a l . 1990) using these exon 1 primers as well as an exon 2 consensus primer. Briefly, D N A to be used as template for a P C R reaction was digested with a restriction enzyme and special ly des igned linkers with compatible overhanging ends were ligated to the digested template. P C R was then performed with a gene specif ic primer and a primer specif ic for the linker. A region of non-complementar i ty within the linker al lows gene specif ic amplif ication. To increase the likelihood of obtaining large fragments, different enzymes were used for the restriction digest rather than Dde I used in the original publication. In the present study, initial P C R fragments for Ly49h and /' was obtained using linker primers with Pst I overhangs and gene specif ic primers in e x o n l . Fragments for Ly49d, g and b were from linkers with Nsi I overhangs and gene specif ic primers in exon2. The template D N A used included the previously ment ioned P1 genomic c lones as well as the Y A C s 52A6 , 242D11 and 9 5 E 6 from two Whi tehead Institute/MIT libraries (Research Genet ics , Huntsvil le, A L ) which were shown to contain genes of interest. P C R fragments were first identified using gene specif ic 54 ol igonucleot ide probes and then sequenced using vector primers and var ious deletion c lones of the fragments. Pr imers used for Vectorette P C R were: 224 primer (linker primer) 5' T C G C T A A G A G C A T G C T T G C C A A T G C T A A G C 3' Ly49B primer 5 ' A T G A A A T C T C A G A G T T G T G T A A G T G 3' L y 4 9 G primer 5' T G G G C C T T T G A G G C T C C T C A G T 3' Ly49D primer 5' A A G T G T C T T C T T G T T C A G T C A T C T C 3' Ly49H primer 5' T A G A A A G A A T G G A T G C C T C A 3' Ly49l primer 5' G A T G C T G G T G G A G G G A A A A 3' S e q u e n c e obtained from five of the Ly49 genes al lowed the design of consensus primers for the upstream region, permitting amplif ication of an approximately 260 bp fragment from all genomic D N A templates known to contain genes . Simi lar sequence was a lso amplif ied from other P1 genomic c lones not previously descr ibed as containing Ly49 genes indicating the existence of other novel genes or gene fragments. Var ious P1 D N A samples were used to obtain the sequence within this region and then to use this information to design new gene specif ic primers to extend the sequence further upstream. The consensus primers (one 5' and two 3') used were: 5' Pr imer 5' C T T A G C T S C A A Y T A G Y A T A A T T C 3' 3' Pr imer A 5' C T T T C A A T T T T G A A A C T C R T A G G R 3' 3' Pr imer B 5' T T Y W T Y T T G G A G M C W C T Y A G G G G 3' Thermocycl ing was performed for 2 min at 94°C, fol lowed by 35 cyc les of 30s @ 94°C, 30s @ 63°C, 1 min at 68°C fol lowed by 7 min at 68°C. The products of these P C R reactions were ligated into p G E M - T vector (Promega Mad ison , WI) and sequenced using the ABI Pr ism Big Dye Terminator cycle sequenc ing kit ( P E 55 Biosys tems, Foster City, Calif.) in an ABI automated D N A sequence machine (model 310). Finally, in the case of Ly49e, / and h, genomic fragments were subc loned from P1 c lones and further sequenced . 2.2.2 Rapid amplif ication of cDNA ends (RACE) 5' R A C E was performed to identify the transcriptional start site of Ly49a, c, d and g. To locate the transcriptional start site for Ly49a and c in the Ba lb /c strain, c D N A was amplif ied from a Mara thon-Ready c D N A kit of Ba lb /c lymphocytes (Clontech, Pa lo Alto, Calif.) using the same sets of nested B6 gene specif ic primers mentioned below. B e c a u s e the commerc ia l c D N A was of Ba lb /c origin, and because of the genetic variation observed between different mouse strains at this locus (Makrigiannis and Anderson 2000), it was necessary to obtain R N A from B6 mice to verify our results for Ly49a and c and also to ana lyse Ly49d and g. For Ly49a, c, d and g in the B6 strain, c D N A was created from either total adult cel lular splenic R N A or from total cellular R N A from interleukin-2-activated N K cel ls (75% N K 1 . 1 + ) . The R N A was then reverse transcribed using either random primers as previously descr ibed (Medstrand et a l . 1992) or a primer speci f ic for Ly49a, d and g using a method also previously descr ibed (Zhang and Frohman 1997). The c D N A obtained was poly-A tailed by incubating the samp les with terminal t ransferase ( G i b c o / B R L , Burl ington, O N ) at 37°C for 1 hr in the presence of 10mM d A T P ( G i b c o / B R L , Burl ington, ON) . P C R was performed on the c D N A samp les using an ol igo-dT primer ("Qt") (Zhang and Frohman 1997) which contained two nested primer sites ("Q 0 " and "Qi"). The "E longase" enzyme mix ( G i b c o / B R L , Burl ington, O N ) , which has proofreading functions but which also A-tai ls its products, was used for the P C R 56 amplif ication. The resulting fragments of nested P C R reactions were then c loned into the p G E M - T vector and sequenced using plasmid primers. The sequences of the gene specif ic primers used were: L y 4 9 A D G Reverse transcription primer 5' A C T C C A Y G K T T T T C T G T C C A T G 3' 5' R A C E Outs ide Ly49A 5' G C T A T C A C A A T G A A C T T C C A G T G G 3' 5' R A C E Nested Ly49A 5' G C C C T T T A G T C T C C T C A G G T C T C 3' 5' R A C E Outs ide Ly49D 5' C C T G G T T T T A T C A C A C A G T A T G T T T T G 3' 5' R A C E Nested Ly49D 5 ' A A G T G T C T T C T T G T T C A G T C A T C T C 3' 5' R A C E Outside L y 4 9 G 5' A G A T C A T T G C C T G G C C T A C A C T C 3' 5' R A C E Nested L y 4 9 G 5' T G G G C C T T T G A G G C T C C T C A G T 3' 5' R A C E Outside L y 4 9 C 5' A C T G C C A A C A C T G C A A C T G T T A C A 3' 5' R A C E Nested L y 4 9 C 5' C A C A A T G A G T T G C C A G G G T G C T G 3' 5' R A C E Outs ide R N A Hel icase A 5' C C C A T T G G T G C T G G T A A C C C T 3' 5' R A C E Nested R N A Hel icase A 5' G T A T G G G T G G G G G T G G T A C A A 3' First round thermocycl ing for the B6 c D N A was 10 cyc les of (20s @ 94°C, 20s @ 40°C, 90s at 68°C) with only the Q t primer present fol lowed a hold of 3 min at 68°C. The gene specif ic primers along with Q 0 were added and a further 35 cyc les of (20s @ 94°C, 20s @ 53°C, 90s at 68°C) were performed with a final hold of 7 min at 68°C. Nested P C R for the B6 samp les was 35 cyc les of (20s @ 94°C, 20s @ 53°C, 90s at 68°C) fol lowed by 7 min at 68 °C. Thermocycl ing for the Balb /c reactions was performed for 2 min at 94°C fol lowed by 35 cyc les of (20s @ 94°C, 20s @ 53°C, 90s at 68°C) fol lowed by 7 min at 68 °C. 57 5' R A C E P C R products were separated out on agarose gels and bands were exc ised , purified and ligated into the p G E M - T vector and sequenced using vector primers. Twelve B6 c lones from each of the 4 independent R T and 5' R A C E reactions were sequenced for each gene (a total of 48 c lones for each gene) while a total of 40 c lones from 3 independent experiments for Balb/c as sequenced . For the R N A hel icase control exper iments 24 c lones were amplif ied and sequenced using the random primed N K and sp leen R N A . 2.2.3 Sequence Ana lys is S e q u e n c e s were first al igned using the G C G program "Pi leup" with a gap weight penalty of 3 and a gap extension penalty of 1. The resulting al ignment was then imported into the program G e n e D o c (available free at the websi te ht tp: / /www.psc.edu/b iomed/genedoc/) which al lows optimization of the al ignment by hand. Single base pair changes in the al ignment were made only if the initial position had been arbitrary ass igned and change would result in a significant increase in al ignment local homology. The individual sequences were a lso ana lysed using the Repea tmasker program (available at h t tp : / /www.genome.washington.edu/UWGC/analys is tools / repeatmask.htm) which identifies var ious famil ies of repeats present in a nucleotide sequence . 2.3 Results and Discussion 2.3.1 Sequence analysis of putative regulatory regions of the Ly49 genes Our initial approach to investigate Ly49 gene regulation was to sequence and compare the putative regulatory regions of numerous Ly49 genes to attempt to locate regions of highly conserved sequence . Through a combinat ion of techniques (see Materials and Methods) we obtained sequence upstream of exon 1 from the Ly49b, d, e, g, h, and / 'genes in C 5 7 B L / 6 mice and compared it to the previously publ ished Ly49a genomic sequence , as well as sequence obtained in our laboratory for Ly49c and j (McQueen et a l . 2001). Figure 3-1 shows the sequence al ignment of these nine Ly49 genes from C57BI /6 mice along with the human Ly49l gene with the al ignment ending 8 bp after the previously publ ished exon1/intron1 boundar ies (nt position 878). Previously publ ished regulatory features including T A T A boxes (nt position 589 & 708) (Kubo et a l . 1993; Gosse l in et a l . 2000) H M G boxes (nt position 643 & 688) (Held et a l . 1999) and the previously publ ished transcriptional start site for Ly49a (nt position 722) (Kubo et a l . 1993) are indicated. There are several features of the al ignment which are of interest, the first being the high level of conservat ion seen in the 5' region of the majority of genes in the al ignment. This to be expected of a family of genes which has expanded recently in evolution; however, the presence of such large sect ions of conserved sequence in the promoter region of genes which are known to be expressed at different f requencies suggests that other, more distant regions also influence express ion patterns. Another notable feature is the presence of repetitive e lements in the promoter region of two of the genes . The 5' regions of both Ly49h and Ly49b contain a similar repetitive sequence belonging to the L1 family as illustrated in figure 2-2, while other S I N E elements are present within its first intron of Ly49b. The mouse Ly49 gene cluster has presumably evolved through a ser ies of gene dupl icat ions, convers ion events, other rearrangements and sequence divergence. For example , Ly49h is « 9 5 % identical to Ly49i in exons 4-7 but is much less related in the 5' part of the gene. This suggests that Ly49h was formed via a gene conversion or other rearrangement. Ly49b and h share only 69 .7% nucleotide identity between their coding regions, but 7 8 % identity between their putative promoter regions and 8 5 % identity between the regions of LINE-1 sequence . The 3' end of the LINE-1 element varies between the two genes due primarily to a deletion in the Ly49h sequence , and the 5' extent of the e lements has not yet been determined. W e can therefore not be certain if the LINE-1 e lements represent the same integration event or two separate events. Nonethe less , the l ikelihood of two independent LINE-1 insertions occurring at the s a m e position in two related genes is very low. It is possib le that the LINE-1 element integrated into one of the genes and then was "transferred" to the other gene via gene convers ion. However , until large sca le genomic sequence is avai lable for this region, it will be difficult to trace the actual evolutionary relat ionships of these genes. In order to opt imise the al ignment, several large (>30 bp) gaps were inserted into the sequences of Ly49d (nt position 21-56), Ly49a and g (nt position 329-368). G a p s were inserted in all of the sequences from nt position 487-504 to adjust for a short stretch of sequence which is present only in Ly49g. O n e other large gap (nt position 309- 449) was inserted into the Ly49h sequence in order to align the LINE-1 sequence with that of Ly49b. The resulting al ignment suggests that the region upstream of the beginning of the gap in the Ly49h (nt position 1-308), although highly similar in the genes studied, is not crucial for gene regulation, as Ly49h is appropriately expressed 60 Fig 2-1 Al ignment of genomic sequence of 9 Ly49 genes from C57BL/6 mice The sequence of Ly49a, b, c, d, e, g ,h , i , and ) are shown along with the sequence of the human Ly49l gene. The 3' end of the alignment is 8 bp past the exon1/intron1 boundary (indicated by a grey triangle) previously published for Ly49a and confirmed for Ly49c, j and g in our laboratory. The black shading indicates 60% or greater identity at that position and the light grey represents 40% identity. Repetitive sequence from Ly49b and h is shown as by an arrowed range. Underlined and labelled regions of sequence indicate locations of other putative regulatory regions. An arrow at nt position 747 indicates the previously published transcriptional start site for Ly49a. Previously published sequences used include Ly49a (Kubo et al. 1993), Ly49c & j (McQueen et al. 2001) and the human Ly49l gene (Barten and Trowsdale 1999) 61. without this sequence . Near the 5'end of the al ignment (approximately nt position 65 -145), there is a lso a C A rich repeat which is present, in varying lengths, in all of the Ly49 genes except b and h which have LINE-1 sequence in this region. A s mentioned above, it was recently reported that the activating receptors Ly49d and h are co-expressed at higher levels than would be expected from their individual express ion f requencies (Smith et a l . 2000). O n e possib le explanat ion for this observat ion is that there may be trans-acting factors speci f ic for activating receptors which are expressed only in subsets of N K cel ls or that bind to sequences present only in the promoters of activating receptors. Al though the sequences of all of the genes are similar, Ly49d and h do share a short stretch of identical sequence (nt posit ions 800-822) which is not present in the other mouse genes as well as a region of similar sequence (nt posit ions 839-859) shared only with Ly49b. It is possib le that these or other regions have functional s ignif icance. Alternatively, the high co-express ion levels of Ly49d and h may be a result of some post-translational control mechan ism or environmental inf luence. G iven the fact that interactions of Ly49 molecules with M H C C l a s s I molecu les affect receptor levels (Fahlen et a l . 1997; Held and Raulet 1997b; Roth et a l . 2000, chapter 1), and given the high degree of similarity of all of the genes within the promoter region (delimited by the insertion point of the LINE-1 sequence) , one of the later explanat ions s e e m s more likely. The human Ly49l gene is a lso included in the al ignment in figure 2-1 and it shows a high level of conservat ion with the mouse genes through nt position 637-760. Al though the human gene is thought to be non-functional due to incorrect spl ic ing, it is 62 Lv49b Ly49h = lOObp L I N E 8 5 % L I N E Promoter 7 8 % Sine Sine Promoter r Figure 2-2 Repetitive elements flanking the putative regulatory regions of two Ly49 genes. Severa l repetitive sequences near promoter region of Ly49b and h are shown to sca le . The full length of the L INE elements in either gene is unknown beyond the « 500 bp sequenced and the location of the putative promoter region is based on homology to the other genes , as 5' R A C E was not performed on these two genes . The calculated percentage identity between the two genes for the L INE sequence and promoter region is shown. 63 still t ranscribed in NK cel ls but not in T or B cel ls , as shown by northern blot (Westgaard et a l . 1998). This suggests that, despite a potentially low express ion level, the gene 's regulatory mechan ism is still intact. If so , the region of conservat ion may represent the core promoter region, at least for some of the mouse genes . A n analys is of putative transcription factor binding sites within the region of highest conservat ion between human and mouse genes (nt position 637-760) did not reveal any obv ious candidates. The analysis was done using the Mat lnspector program (http:/ / transfac.gbf.de/c/s.dl l /matSearch/matsearch.pl) and although numerous high quality matches were returned, the majority of these matches had short or degenerate recognition sequences so their s igni f icance is unclear. O n e of the longer, high quality, matches was a predicted binding site for the transcription factor NF-AT at nt posit ions 674-682 (general consensus site WGGAAANHN with core sequence in bold). NF-AT belongs to a family of transcription factors which are encoded by 4 genes , 3 of which are alternatively spl iced to yield a variety of functional protein isoforms (Rao et a l . 1997). Members of this family are expressed in a variety of haematopoiet ic cell types including NK cel ls and have been implicated in regulating the express ion of a large number of genes (Rao et a l . 1997). NF-AT proteins can be activated through a variety of signall ing pathways including through C D 1 6 , as was recently demonstrated in the c a s e of NK cel ls (Aramburu et al . 1995). W e conducted a preliminary examinat ion of the potential role of NF-AT in the express ion of Ly49 genes using compounds to either stimulate or block the activity of NF-AT. T h e s e exper iments in E L 4 cel ls as well as primary NK cel ls were not conclus ive, and further analys is will be required to test the possib le role of NF-AT in Ly49 gene regulation. 64 2.3.2 Identification of potential transcriptional start s i tes for Ly49 genes Only one previous study has reported the transcriptional start site for an Ly49 gene, that of Ly49a (Kubo et al . 1993). W e therefore performed 5' R A C E exper iments to identify the start si tes for Ly49d, g and c and to confirm the location for Ly49a. Figure 2-3a and b show that there is a great deal of heterogeneity in the location of the transcriptional start points for these genes. It is unlikely that this heterogeneity results from using degraded R N A , as the c D N A s used for analys is c a m e from severa l independent sources . A s wel l , the fact that clustering of start si tes in different exons was observed using independent R N A samples strongly argues against this, as this would not be predicted as a result of R N A degradat ion. A s a control for the use of 5' R A C E to accurately local ize the transcriptional initiation site of a gene, we used the s a m e R N A sources with primers des igned for the gene R N A hel icase A which was recently shown to have a single transcriptional start point by primer extension (Lee et a l . 1998a). The R N A hel icase 5' R A C E primers were des igned to amplify a longer fragment compared to the Ly49 R A C E exper iments (600 vs . 400 bp) which constitutes a more stringent test of the technique. Figure 3-2c shows that the vast majority of R N A hel icase A 5' R A C E products start at the exact nucleotide position previously reported to be the transcriptional start point by primer extension, suggest ing that this approach provides valid data for the Ly49 genes . For every gene ana lysed, the sequenced c lones showed a great deal of variation in length and did not reveal a single potential transcriptional start site. Rather, the 5' ends of the R A C E products varied over a range of 60 to 70 bp which differed somewhat in location between genes . W h e r e a s the majority of Ly49a transcripts appear to 65 A " • 6 0 0 * * * * 6 5 0 * L y 4 9 C T A T A A A T C A T T C A C A T T T G T T T T G - T C C A T C C A A T A C T A T A T G T T G T T T C A G A T T G C A A T L y 4 9 D T A T C A T A T A T A G T C A T T T C T T T T G C A G C A T C T G G C A A A A T A T T T T G C T T C T T T C C C T T G C C T T C A G A C T C A G C T T T C A - A L y 4 9 A - B 6 TATCAGTTATGGACATTTGTTTTGCAGCATCTGGCACAATACGTTACTTCTCTCETTTGTIICTGAGGGTCAGGTTTCATT L y 4 9 A - B a l b T A T C A G T T A T G G A C A T T T G T T T T G C A G C A T C T G G C A C A A T A C G T T A C T T C T C T d C T T T G T H C T G A G G G T C A G G T T T C A T T L y 4 9 G T A T C A G T T A T G G A C A T T T G T T T T G C A G C A T C T G G C A C A A T A T G T T T C T T C T C T C S l l G l I l C T G A G G G T C A G G T T T C A T T HMGBox-1 6 8 0 * * * * 7 3 0 * L y 4 9 C A A G C A A T T T C C T C T T T T T G C T T T G G T G A C G A G G A G G G G C A G A A A A T C A T G A G G T T G A G T A T C A C C C G G T G G A A A T T T A G T • 44_2 4_2 4 L y 4 9 D A A G C A A T T T C C T C T T T T T G A T T T G G T C A A G A G G A G G G G C A G A A A A C C A T G A G A T T G A G T G T T G C T C A G A G G A A A T T T A G T L y 4 9 A - B 6 A A G C A G T T T C C T C T T T T T G ^ T T T G A T 1 G A C G A G G A G G A G C A ^ A A A A ^ C A ^ ^ A G G T T G A G T A T C T C T C A G ( S f e G A A A T T T A G T L y 4 9 A - B a l b A A G C A G T T T C C T C T T T T T G g W T G A i P A C G A G G A G G A G C A T A A A A T C A T G A G G T T G A G T A T C T C T C A G T G G A A A T T T A G T L y 4 9 G A A G C A G T T T C C T C T T T T T C ^ T T T G A l b A A G A G G A G G A G C A T A A A A T C A T G A G G T T G A G T A T C A C T C A G T G G A A A T T T A G T HMO Box-2 ^ * 7 6 0 * * * 8 1 0 * L y 4 9 C T C C G A C T T T C A A T T T T G A A A C T C G T A G G A G A T C T A A A C C A G A A A A - C G C C A A C G T T T C A G A C A A A T T T T C C C T C C A C C A G 4 2 ^ ^ - 5 ^ ^ ^ 3-^ ^ -^2 T_2 4.3 4-4 4 4_2 L y 4 9 D T C T G C C T T T C T T C T T G G A G C C T C T A A G G G G A T A C A C A C C A G A A A A G - G C C C A C A T T A C C C C A A C A G G G A C A T C C A T T C C T 2-^  2444g T.3 4 2 X.3 4244 4 L y 4 9 A - B 6 T C T A C C G T T T A T T T T G G A G A C A C T T A G G G G A T A T C A A C C A G A A A A A - G C C A A C T T T T T C C T C C A C C A G A A C C A C T T C T T G 2-4+ 4.2 4.10 4.2 4.2 4 4 4 L y 4 9 A - B a l b T C T A C C G T T T A T T T T G G A G A C A C T T A G G G G A T A T C A A C C A G A A A A A - G C C A A C T T T T T C C T C C A C C A G A A C C A C T T C T T G *4-3 4_6 244 44 ^-4 L y 4 9 G T C T A C T G T T T A T T T T G G A G A C A C T T A G G G G A T A T C A A C C A G A A A A A - G C C A A C T T T T T C T C C A C A G G A A T C A C T T C T C A G 4 4 B 40 BO L y 4 9G A A A T T T G G T C A G T C C A T G T C A G G G T G T T T A T A G C A T T A A G T G A G T T A G T C A G A C C C C A C C C T T T C C C A G A C C T C T G T A T C 12 0 Intron 1 L y 4 S G A T C A T A T C T A G T T A T C T T C C T A T A G G T G A A C A T T T T A A C A T T T T T C G T A d A A A C C A C T C A A G G C A C C A T T T T A A C T G A G A >4.2 4 Exon 2 4 4 * 2 0 0 * 2 4 0 L y 4 9G A C A T A C T T C A T A C A T C A T T C C C A A G A T G A G T G A G C A G G A G G T C A C T T A C T C A A C T G T G A G A T T T C A T G A G T C T T C A A G G T C RNA * 4 0 ^ * 8 0 u , . . T G G C C T A C G C G C C A G G C C A G T C G C C G A C T C C G C C C C C T G G G T C C T G C A G T C G G A & C A T T T C G C C G C T G C T T C C A T G C G G Helicase A + + 15 ft 44 * 1 2 0 * 1 6 0 G T G A G G T G T G T T C T T T C G C C G T T C T C G T G G A A G G T T G G C G C T G C G A A C T C G C C T A A G A A G G C T G T G C T C T C G G G C A C G G A 4 4 Figure 2-3 5' R A C E analysis for four Ly49 genes Part A shows a subsect ion of exon 1 and upstream sequence for several Ly49 genes . The termination points of 5' R A C E products are shown with arrows and sites with multiple start points shown as numbered arrows. Previously identified regulatory e lements are shown in titled boxes and the previously publ ished transcriptional start site for Ly49a is c irc led. P roposed T A T A boxes are shown in bold for Ly49c and a and g. Part B shows the genomic sequence of the intron 1/exon 2 boundary of Ly49g with termination points of 5' R A C E products indicated. The numbering of part A of the figure is the s a m e as that of figure 2-1 and the translation start codon for Ly49g in part B is underl ined. B e c a u s e no differences were observed between strains, the start sites from Ly49c in both strains were pooled, with equal numbers of c lones being present in the final sample while the Ly49a results were left separate to demonstrate the similar distribution patterns. Part C shows the genomic sequence for the mouse R N A Hel icase A gene with the previously publ ished transcriptional start point c i rc led. 66 originate in a region from nt posit ions 695-770 in figure 2-3, Ly49d transcripts appear more tightly clustered from nt posit ions 745 to 765. The exper iments for Ly49g produced an unexpected result in that the transcriptional start sites appear in a tight cluster within exon 2 of the gene, immediately upstream of the initiation codon with over 9 0 % of the 5' R A C E c lones terminating in this cluster or just upstream in intron 1. Indeed, it appears that these transcripts result from initiation s ignals generated within the first intron. Al though longer transcripts which originally def ined the exon 1 sequence have been previously publ ished (Smith et a l . 1994) and are a lso detected in the current work, the 5' R A C E technique al lows an assessmen t of the f requency of transcripts which may not be evident when simply attempting to identify the longest transcripts. W e have recently shown that the first intron of Ly49j in B 6 mice contains e lements capable of acting as a promoter in transient transfection reporter a s s a y s (McQueen et a l . 2001) and a transcript with a 5'-end within intron 1 has been found in the 129/J mouse strain (Ly49v c D N A , Genbank access ion AF288381 ) . Here we show ev idence suggest ing that the first intron of Ly49gm acts as a major promoter of this gene in vivo. 2.3.3 Differential effects of TCF-1 Within the Ly49a genomic sequence , there are two consensus binding sites for the transcription factor T C F - 1 ( C T T T G W W ) (boxed sequence at nt posit ions 642 and 688 in figure 2-3) which are immediately upstream of a previously predicted T A T A box for Ly49a (shown in bold at nt position 708) (Kubo et a l . 1993). A s d i scussed in chapter 1, Held and co-workers used T C F - 1 knockout mice to examine the potential role of this transcription factor in Ly49 receptor express ion (Held et a l . 1999). They noted that 67 T C F - 1 deficient mice essential ly lack L y 4 9 A + N K cel ls, although the residual L y 4 9 A + N K cel ls express the protein at normal levels. Interestingly, while the percentage of Ly49D express ing N K cel ls was also decreased in TCF-17" mice, the percentages for L y 4 9 C , G and I were unchanged or slightly higher. This would imply that the role of T C F - 1 is limited to the acquisit ion of Ly49A and D express ion but not the maintenance of express ion of any genes . They further demonstrated, using E L - 4 cel ls transfected with luciferase reporter constructs with combinat ions of normal and mutated binding sites, that while both binding sites increased luciferase express ion, the 5' most binding site had the most significant effect on express ion. A s mentioned in sect ion 1.6.2 in the introduction, the changes seen in Ly49 express ion does in TCF-17" mice does not s e e m to be affected by the level of host M H C c lass I express ion (Kunz and Held , 2001). Our sequence analysis has revealed that this first H M G box is not present in Ly49c or /' (figure 2-1) which could explain why express ion of these two genes is not affected by the absence of T C F - 1 . However, Ly49g contains this site but is a lso unaffected in T C F - 1 7" mice. Our 5' R A C E exper iments a lso provide a possib le explanat ion for this observat ion. S ince Ly49g appears to be promoted primarily from within the first intron, the presence or absence of the H M G boxes may not be critical for its express ion. W e have also detected several Ly49a transcripts that start further upstream than the second H M G box studied by Held and co-workers. Whi le the data from the T C F - 1 7" mice indicate that it has a role in the acquisit ion of gene express ion, whether this effect is direct or indirect is not clear. It is possib le that T C F - 1 may be acting further upstream in the promoter region or e lse it is influencing the express ion of another trans-acting factor which in turn acts only on specif ic Ly49 genes . It is 68 interesting and perhaps significant that the region of mouse-human conservat ion begins at the 5 ' H M G box. 2.3.4 The presence of a TATA box does not seem important for Ly49 expression Kubo and co-workers (Kubo et a l . 1993) have proposed a potential T A T A box for Ly49a which is highlighted in f igures 2-1 and 2-3a. Another control e lement identified in the Ly49a promoter is a 13bp sequence termed E L 1 3 , which has partial homology to the C R E consensus-b ind ing site for A T F - 2 (Kubo et a l . 1999). It was demonstrated that this portion of regulatory sequence upstream of the proposed T A T A box appears to have cel l -specif ic promoter function in E L 4 cel ls. Our 5' R A C E analys is of Ly49a does not agree with the previously reported single transcriptional start site for this gene (Kubo et a l . 1993). W e have found numerous transcriptional start points which are upstream of both the E L - 1 3 element and the proposed T A T A box. T h e s e data do not necessar i ly exc lude a role for the E L - 1 3 binding protein in regulating the express ion of Ly49a. It is possib le that there may be genetic dif ferences in E L 4 cel ls which make the E L - 1 3 sequence important in the regulation of Ly49a express ion in this cell l ine. In such a c a s e , the proposed T A T A box may in fact be functional. However there does not appear to be strong ev idence that this is the case for transcripts detected from splenocytes or N K cel ls from Balb /c or C57BI /6 mice. A further point making it unlikely that the proposed T A T A box is functional in vivo is that this Ly49a sequence element, and the c lose f lanking sequence , is identical to the Ly49g sequence which does not appear to function as a transcriptional initiator. A second T A T A box, approximately 120 bp upstream of the proposed box for Ly49a, has been shown to exist in Ly49 / ' 1 2 9 (Gosse l in et a l . 2000) and in Ly49i, c,j and e in B6 mice (figure 2-1). In a recent study, it was demonstrated that an ol igonucleotide probe containing the Ly49 / ' 1 2 9 T A T A box 69 and c lose f lanking sequence could form specif ic complexes with the lysate from E L 4 cel ls as well as with 129/J murine N K cell lysate in E M S A analys is (Gosse l in et a l . 2000). B e c a u s e this binding was a lso demonstrated using the quest ionable T A T A box previously proposed for Ly49a, the signi f icance of this binding is not c lear and it has not been demonstrated that this box is necessary for promoter activity of the region. Furthermore, we did not detect any transcripts for Ly49c which initiated closely downst ream of this T A T A box as would be expected if it were functioning as a promoter. Numerous reports have shown that genes such as Ly49c and Ly49i which have canonica l T A T A boxes are as highly expressed as genes such as Ly49d and g which do not have recognized T A T A boxes (Sivakumar et a l . 1998; Smith et a l . 2000). The fact that we have shown that the presence or absence of a T A T A box does not appear to affect the location of transcription initiation raises the quest ion of whether a T A T A box is actually necessary for Ly49 express ion. There are at least two possibil i t ies for explaining transcriptional control of the Ly49 genes which are consistent with our 5' R A C E observat ions. The first is that transcripts are generated somewhat indiscriminately from AT-r ich regions in the promoter sequence . It has been previously documented that many AT-r ich sequences six bases long or more can function as T A T A boxes (Smale 1997), and the presence of several such regions in the promoter might account for the heterogeneity we observed. Alternatively, the Ly49 genes may represent T A T A - l e s s genes which have their transcription controlled by an initiator element. The transcripts generated from T A T A - l e s s promoters can be from a single start point or from numerous sites over a range of several hundreds of bases (Smale 1997). The consensus sequence which has been descr ibed for the initiator element is 5' Y Y C A N T Y Y 3', where the C A N T core is critical for function. The flanking pyrimidine bases must a lso be present in order to al low initiator activity, however not all of them need to be present in order to initiate transcription (Smale 1997). Addit ionally, the majority of T A T A - l e s s promoters a lso contain multiple S P 1 binding si tes, the absence of which can contribute to heterogeneous start sites (Smale 1997). Al though the majority of T A T A - l e s s genes are general ly thought to be constitutively active "house-keeping" genes , some are capable of being expressed in a developmental ly specif ic and t issue specif ic manner (Azizkhan et a l . 1993). Indeed, many of the complement genes are tightly regulated despite having T A T A - l e s s promoters (Volanakis 1995). The human NKG2A (Plougastel and Trowsdale 1998) and 2 B 4 (Chuang et a l . 2001) genes both have t issue-restr icted express ion without T A T A sequences in their most 5' promoter region and have a lso been shown to have heterogeneous transcriptional start si tes. In examining the genomic sequence of the Ly49 genes , we can find several regions which match a portion of the initiator element consensus ; however, there are no sequences which appear to be matches for an S P 1 binding site. Whi le it is not possib le at this point to do more than speculate on the nature of the interaction of the basal transcriptional machinery with these genes , that data obtained so far suggest that it is complex and may have gene-speci f ic aspects to it. In conc lus ion, we have sequenced the putative regulatory region of 9 Ly49 genes and shown that the sequences are highly conserved and a lso share regions of conservat ion with the human Ly49l gene. Through 5' R A C E analys is , we have shown that there are multiple transcriptional start sites which are clustered in different locations in the genes examined. In addit ion, we have shown that the start sites for the majority of transcripts for Ly49g originate in the first intron as well as exon 2 of the gene. Our f indings suggest that the regulation of genes in the Ly49 cluster is very complex, and likely employs multiple levels of regulation. 71 Chapter 3 Genomic organization of the C57BL/6 Ly49 cluster A paper by Brian T. Wi lhe lm, L iane Gagnier , Dixie L. Mager entitled "Sequence analys is of the Ly49 cluster in C 5 7 B L / 6 mice: A rapidly evolving mult igene family in the immune sys tem" has been publ ished in Genom ics Dec;80(6): 646-61 (2002). L iane Gagn ie r ass is ted in obtaining genomic sequence to c lose gaps in the Ly49 contigs and Dixie Mager created figure 3-7 and table 3-2. This work is descr ibed in sect ion 3.2.1, 3.2.2, and 3.2.3 72 3.1 INTRODUCTION The goal of this work was to utilize the newly avai lable mouse genomic sequence to study the Ly49 gene cluster of the C 5 7 B L / 6 mouse strain at the nucleotide level. S ince the first identification of Ly49 genes (Chan and Take i 1989), an ever increasing number of genes in this family have been identified. The ex is tence of such a large number of genes , not all of which are recognized by ant ibodies, made analyz ing express ion patterns of all genes virtually impossib le. Work by severa l labs, including our own, helped contribute to an accurate map of most of the known genes in the cluster (Brown et a l . 1997a; M c Q u e e n et a l . 1998; Depat ie et a l . 2000). Without reliable sequence for the region it was not possib le to unambiguously ass ign gene identities to several Ly49 promoter regions which we c loned and which appeared to be identical. In late 2001 , through a combinat ion of B A C and shotgun sequenc ing efforts which were part of the public effort to sequence the mouse genome (Waterston et a l . 2002), it was possib le to assemb le a ser ies of sequence contigs which covered virtually the entire Ly49 cluster. Us ing this sequence , a variety of studies were performed including dotplot analys is , large-scale sequence al ignments and phylogenetic analys is . Th is enabled us to formulate a model for the evolution of the entire Ly49 gene cluster as well as models for more recent gene duplication events within the cluster. 73 3.2 Materials and Methods 3.2.1 Data retrieval and assembly The Genbank entry for Ly49a (NM_016659) was used to screen the high throughput database ( H T G S ) at NBCI (http://www.ncbi.nlm.nih.gov). S e q u e n c e matches corresponding to three B A C s at varying stages of complet ion were identified as entries A C 0 9 0 5 6 3 , A C 0 9 0 1 2 7 , A C 8 7 3 3 6 (NCBI 2002). T h e s e sequence entries were retrieved and assemb led to a form a cont iguous sequence using tools at B C M search launcher (http:/ /searchlauncher.bcm.tmc.edu/) and the Blast2 program at NCBI (http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) to reverse and assemb le the nine sequence fragments in A C 0 9 0 5 6 3 . Other assembled genomic sequence fragments from the latest whole genome shotgun assembly ( M G S C version 3) were obtained from the Ensemb l genome server service (http:/ /www.ensembl.org/Mus musculus/) (Ensembl 2002) using the S S A H A program and from NCBI using B L A S T . The Ly49b-containing contigs from the initial version 3 sequence assembly were identified as cont ig_199739, cont ig_139082 and cont ig_105974. The sequence contig which contained the gene fragments lettered a , p, and y (which a lso over lapped A C 0 8 7 3 3 6 ) was retrieved from NCBI mouse genome database as sequence Mm6_WIFeb01_117 . The current M G S C assembly is based on a Feb 2002 data f reeze that contains approximately 7x genome coverage corresponding to 9 6 % of mouse euchromatic D N A . Two smal l gaps remain within assembled sequence for the cluster (excluding the W G S sequence at the telomeric end of the cluster) used for this analys is , one between Ly49g and j and one between Ly49e and q. However because of the extensive mapping performed by our lab as well as others, in addition to the public B A C sequence information, it is c lear that the gaps remaining must be quite smal l (<1 kb). The range 74 of sequence containing portions of the gene fragments p and y which does not overlap A C 0 8 7 3 3 6 contains 4 gaps of unknown s ize and 1 gap of known s ize (509 bp). Al l of the gaps from this area cluster into two regions between fragment p and y and between exon 4 and 5 for Fragment y. 3.2.2 Sequence Al ignments and phylogenetic analysis The C lus ta lX program was used to perform the initial al ignments of the Ly49 gene sequences . The gene sequences for Ly49c, e, f, g, h, /', j, k, /, m, and n were first al igned and then the sequences for Ly49a, d and the novel gene x were al igned to the other sequences using the profile al ignment mode in C lus ta lX . The sequences were subsequent ly exported into the program G e n e d o c (http:/ /www.psc.edu/biomed/genedoc/) for manipulation prior to being re-exported for phylogenetic analys is. The penalty parameters for G a p Open ing and G a p Extension were 10 and 1 respectively. The M E G A 2 software package avai lable freely at the websi te http://www.meqasoftware.net was used to perform phylogenetic analys is of the Ly49 gene segments . The al igned gene sequences were imported in the program and the neighbour-joining method was used to create the phylogenetic tree with the Jukes -Cantor model of nucleotide substitution. To calculate the percent identities between var ious regions of the Ly49 genes , portions of the gene sequence were exported to S e q w e b (http://www.accelrys.com) where the G A P program was used to provide an optimal global al ignment for sequence pairs. The gap creation and extension penalt ies were 30 and 3 respectively, end gaps were not penal ized, as were gaps larger than 15 bp. Vers ion 2.03 of Seqweb was used to perform the analys is . 75 3.2.3 Repeat analysis and figure generation The individual gene sequences were also ana lysed using the Repea tmasker program (available at h t tp : / /www.genome.washington.edu/UWGC/analys is tools / repeatmask.htm) which identifies var ious famil ies of repeats present in a nucleotide sequence . Th is data, as well as the exon locations, were used as mask files for the program pipmaker (http://bio.cse.psu.edu/pipmaker/) which generated a P D F figure of the location and orientation of all of the repeat sequences within the genes as well as mapping the exons in the d iagram. 3.2.4 Dotplot Ana lys is All dotplots of the regions in cluster were generated using the Dotter program (available at http://www.cqr.ki.se/cqr/qroups/sonnhammer/Dotter.html). Output fi les were saved as postscript fi les and imported into A d o b e Photoshop 5.0 for the addition of the labels and symbols used. 76 3.3 RESULTS AND DISCUSSION 3.3.1 General arrangement of the Ly49 gene cluster in B6 mice Figure 3-1 shows a dotplot d iagram of the entire cluster compared against itself a long with the sequence contigs and assembl ies used in this analys is . The cluster is at least 620 kb in s ize , excluding the region of at least 800 kb between Ly49b and the rest of the genes (Depatie et a l . 2000), which is comparable to what has been reported for the 129/J mouse strain (Makrigiannis et a l . 2002). The telomeric end of the cluster is not yet precisely def ined due to a gap of known s ize (52 kb) at the end of the avai lable sequence as well as 4 gaps of unknown s ize within the sequence before the known gap. Prev ious work had shown that there were at least 14 Ly49 genes within B6 (Ly49a-n) (Brown et a l . 1997a; M c Q u e e n et a l . 1998). Not all of the genes are functional, as it has been shown that Ly49k, n and m are likely pseudogenes in this strain (McQueen et a l . 1999; Kane et a l . 2001). In addit ion, the Ly49l gene, which has been identified as a functional gene in the C B A and Balb /c strain (Makrigiannis et a l . 2000; K a n e et a l . 2001), appears to have been mostly deleted in B6 . W e previously reported B6 exon 2 and 7 sequences bel ieved to be from Ly49l but were unable to detect exon 4 (McQueen et a l . 1998). It is now apparent that the previously reported exon 2 sequence (McQueen et a l . 1998) was actually from Ly49m, so exon 7 is the only Ly49l exon that could be found in the B6 genomic sequence . Our analys is of the genomic sequence in the B6 strain revealed a total of 15 complete genes and 3 gene fragments that are clustered together and which may represent two complete but rearranged genes . Th is number is similar to the total number of putative Ly49 genes (19) identified in the 129/J cluster (Makrigiannis et a l . 2002). Al l complete genes in the B6 strain are oriented in the same transcriptional 77 o o o o o o o o o o o o o / j/. / .• -... s.'v- ' . y\ . "s-A . • • '•y..yy. it-...' -' ••":-' y . A . .v. . - . • v':>-;" ;;:v •: • - • ..y \. A y A y '/•.' •**!*' ^ •yy/ "y". ,' '. '•>•.* y \:t. .;.:'/..;./ . . . . . . - . ' • v.. •• y .. .... .v.. • ' v- • x • -v' • ' y •• , T". / ! / •'• ' . ' . , * . / ": - • / * . .'• //:• 'Aw • / . ' / '•. . •• . . . . / \ y : y ' / y. -' <yy ' - - / • § 1 I1 B Pi 3l I' I S H3 10 AC090563 (RP23-45IF7) Centromere WGS WGS AC090127(RP23-128D23) AC087336 (RP23-44607) Telomere Figure 3-1 Dotplot of the entire Ly49 c luster against itself. The dotplot of the cluster was generated as descr ibed in the methods sect ion. Lettered boxes correspond to the Ly49 genes and the transcriptional orientation of the genes is indicated by arrows. The sca le of the d iagram is indicated in 10kb intervals on the side of the d iagram. The 3' end of Ly49q has not been determined and this is shown by an open box connected to the known gene sequence . The lines under the genes indicate the regions which were obtained from var ious sources. Genbank access ion numbers for the three B A C s used are indicated. A portion of the cont iguous sequence assembly from M G S C V 3 was used to c lose the gap between A C 0 9 0 1 2 7 and A C 0 8 7 3 3 6 and to extend the cluster sequence on the telomeric end. G a p s in the sequence are indicated by vertical l ines with lower c a s e "g"s beneath the sca le d iagram of the cluster. G a p s in the region of the gene fragments are not shown. The orientation of the sequence contig on the mouse ch romosome is indicated by the centromere & telomere labels on the bottom left and right s ides 78 direction and are c losely spaced . W e have precisely located and ordered the previously identified Ly49 genes (a through n, excluding b) and in addit ion, have posit ioned two recently descr ibed genes , Ly49q and Ly49x. Ly49q, was deposi ted into Genbank as a full length c D N A isolated from N K cel ls with no other information, while Ly49x was identified as a possib le homolog of the Ly49v gene in the 129/J mouse strain, putatively encoding an activating receptor (Makrigiannis et a l . 2002). W e have detected the 3' end of transcripts by R T - P C R for Ly49x that appears to contain a reading frame shift which would result in a premature stop codon in exon 5 (data not shown). Compar i sons with the other Ly49 c D N A s also indicate that a premature stop codon exists in exon 5 without the observed reading frame shift, and therefore Ly49x is almost certainly a pseudogene in B6 mice. The three gene fragments identified, termed a , (3 and y are at the telomeric region of the Ly49 cluster, but centromeric to the gap between Ly49b and the other genes . Us ing the Ly49a c D N A and the B L A S T 2 program (Altschul et a l . 1997), a total of nine exons have been identified. Extending from the 5' end of Ly49a, these exons include hits for exons 5, 4, & 2 (fragment a) fol lowed by exon 6 and 7 (fragment p), and fol lowed by exon 7, 6, 5 & 4 (fragment y). B e c a u s e of the rearranged sequence in this part of the cluster the status of these genes is not entirely clear. The fragment p sequences may have originated as part of a gene containing the fragment a sequences , creating a complete gene except for exon 3. Similarly, the fragment y sequences may represent the end portion of a complete gene where the rest of the gene is in the 52 kb gap in the assemb led sequence . 79 O n e unique feature of the Ly49 region is the ~55kb of sequence which is over 6 5 % repetitive (primarily L T R retrotransposons) and which separates Ly49q and e from the remaining genes as d iscussed in chapter 1. Ly49e has been shown to be the only Ly49 gene expressed in fetal N K cel ls while the other genes tested are transcribed only in adults (Toomey et a l . 1998; V a n Beneden et a l . 2001). It is tempting to speculate that the repeat region between Ly49x and e may act as a type of boundary element that al lows genes outside the proximal cluster to be regulated in a different fashion than the other Ly49 genes . The express ion pattern of the recently descr ibed Ly49q gene, located next to Ly49e, is unknown but will be interesting to investigate as a test for this hypothesis. In addition to Ly49e and q, Ly49b exists outside the main cluster at a much greater d istance from the other genes . It is a lso intriguing that Ly49b, q and e, three genes apart from the main cluster, share the most similarity with their al leles in 129/J . Al l three are >99.5% identical between the two strains whereas other presumed al leles are 9 8 % identical on average (Makrigiannis and Anderson 2000). In fact, al le les cannot be definitely identified for several of the genes . A s previously proposed (Makrigiannis et a l . 2002), this may suggest that recombinat ions occurred to homogen ize the outlying genes between ancestors of the two strains or that functional constraints prevent the accumulat ion of sequence changes . Another possibil ity is that these genes are less likely to undergo rearrangements, convers ions or other changes due to their location outside the main cluster. It will be necessary to examine these genes in other strains to gain insight into this quest ion. 3.3.2 The C57BI/6 Ly49 cluster contains large dupl icated regions A s would be expected for a cluster of related genes , figure 3-1 shows that numerous homologous regions of varying s izes are evident throughout the region. The 80 Figure 3-2 Dotplot of the duplicated region containing Ly49a, c and m. S e q u e n c e containing the Ly49a, c and m genes was used in a dotplot against the region containing Ly49n, i and g. Lettered boxes correspond to the Ly49 genes and the transcriptional orientation of the genes is indicated by arrows. The sca le of the d iagram is indicated in 5 k b intervals on the s ide of the d iagram. 81 large segment of approximately 55 kb toward the centromeric end has no homology to other parts of the cluster and , as d iscussed above, serves to separate Ly49q and e from the remaining genes . Except for this region, the uniform spac ings between the diagonal l ines of similarity suggests that the genes dupl icated in blocks containing one or more genes with little or no unique D N A between the dupl icated units. Interestingly, although the telomeric end of the cluster contains several gene fragments, this region has very little similarity to the rest of the cluster. B e c a u s e the gene fragments are quite divergent relative to the other Ly49 genes (« 7 5 % identity overall), we compared them to the region containing Ly49b, which is a lso divergent relative to the other Ly49 genes , and to the genomic sequence of the human Ly49. Neither of these regions showed any higher similarity to the gene fragments than did the other Ly49 genes . W e used several features of the dotplot to help deduce the nature of the duplication events that have occurred. The most obvious cont inuous long block of similarity exists between the region spanning Ly49m, c and a and the region including Ly49n, i and g. Figure 3-2 shows an expanded compar ison of these two regions. The area of highest homology begins at the 5' end of the Ly49n gene and extends to 8 kb beyond the 5' end of Ly49g and spans a distance of approximately 90 kb. The gap seen in the compar ison of the 3' end of the Ly49g gene with respect to Ly49a corresponds to a segment of repetitive D N A which is present Ly49a but not g. A s illustrated below, Ly49a and g share a highly similar overall structure, with the except ion of a large deletion of sequence in the 6th intron of Ly49g. c D N A compar isons have a lso shown that Ly49c and / are very c losely related (96% identical in the coding region). Thus , it appears that a sequence block dupl icated to form the Ly49n - g and Ly49m - a l.yllA I :::;;::: le. I i ; <; I LyWi -la I' 5 4 J 2 1 1 » • I I I I I | . I I 5 4 I 2 1 •  • • t-1 I I I I 1 : 1 • I L i i i i i m • 4 3 I I I I • K 6 i j i » i i I ; S 4 5 2 I I I I , | j . I .1 ; i I c I ' ; • II I I < Figure 3-3 Scale diagram of all full-length Ly49 genes in B6 mice. P ipmaker output fi les were used to generate a composi te d iagram of all Ly49 genes , showing exons and all repetitive sequences present within the genes. Two gaps in the assembly of Ly49b gene are indicated by vertical l ines through the gene. The dark numbered boxes correspond to exons , with the recently character ized fetal promoter e lements marked as exon -1a where present. The majority of repetitive sequences within the genes belong to the L INE c lass (light gray arrow boxes). L T R e lements are shown as black arrow boxes and s imple sequence repeats as white boxes . 83 regions. Th is duplication most likely occurred more recently than some of the other block duplication events because the region of similarity is largely unbroken. A potentially older duplication event involving these genes is shown as a less well conserved line of similarity between this same region and the block containing the x, f and d genes . More recent duplication events are evident in the region containing Ly49i, n, h and k and the relationships of these genes will be d iscussed further below. 3.3.3 Relat ionships of the Ly49 genes Figure 3-3, which we generated using the P ipmaker program (see sect ion 3.2.3), shows a sca le d iagram of 15 Ly49 genes , excluding the largely deleted Ly49l, but including the exons and repetitive sequences present within and flanking the genes. Dif ferences in gene s izes due to intronic repetitive sequences are apparent, as are shared and unique repeats. The structure of the Ly49 genes is very similar with the majority of genes having 7 exons, the last 6 of which are coding. A careful investigation of several previously submitted Ly49 c D N A sequences in Genbank and the surrounding genomic sequence has revealed that all Ly49 genes except Ly49q have a 78 bp intron sequence in the middle of the last exon of the transcript. In severa l genes including Ly49a and d, spl ice site mutations are present which prevent the removal of this intron sequence (data not shown). However other genes that have correct spl ice donor and acceptor si tes apparently a lso fail to spl ice out this intron sequence in some instances (Stoneman et a l . 1996). In light of the inconsistent removal of this last intron, the schemat ic representat ions of the Ly49 genes in figure 3-3 depict the last exon of all genes except Ly49b as having no intron spl iced out. Ly49b has canonica l spl ice acceptor and donor sites and all full length c D N A s deposi ted in G e n b a n k show that the 78 bp intron is removed. 84 Figure 3-4 Phylogenetic trees of B6 Ly49 genes. Part A shows the phylogenetic tree based on the al igned genomic sequences of 14 full length (exons 1-7, with the except ion of Ly49q(1-6)) genes , created using the neighbour joining method. The letters correspond to the s a m e Ly49 gene. Parts B and C show similarly constructed trees using approximately 1.4 kb portions of al igned sequence from intron 1 and intron 6 respectively. A divergence sca le is shown below each of the trees. 85 Recent ly , transcripts originating from an upstream alternative promoter with a different first exon have been detected for Ly49a, e and g and for some genes in the 129/J strain (Saleh et al . 2002). The region corresponding to this alternative first exon is conserved in all the genes except Ly49b and q and is shown as exon 1a in the d iagram. If exon 1a is taken as the start of the gene, then genomic s izes of the Ly49 genes range from 18 to 34 kb. A full length c D N A of Ly49q has been reported but exon 7 was not within the sequenced contig, suggest ing Ly49q has a final intron larger than 12 kb. In agreement with this, a search of the latest assemb ly of the public mouse genome (http: / /www.ensembl.org/Mus_musculus/) indicates that the last exon of q is approximately 32.5 kb distant from the rest of the gene. W e have used the presence of shared repetitive sequences to help determine the history of these genes and some of the repeats that are particularly informative are listed in table 3-2. Th is table a lso includes the status of these specif ic repeats in the Ly49b gene, the sequence of which is mostly complete (see sect ion 3.2.3). The relative ages of the repeats, as est imated by their d ivergence from the repeat family consensus (Jurka 2000), and their p resence or absence in the different genes have been used to help construct a model for the formation of the Ly49 cluster presented below. W e created the phylogenetic tree shown in figure 3-4a by using a multiple al ignment of the genomic sequences spanning exons 1 to 7 of 15 Ly49 genes . A s has been evident from previous c D N A compar isons (Smith et a l . 1994; M c Q u e e n et a l . 1998; Makr igiannis and Anderson 2000), the tree provides further support for a common origin of groups of Ly49 genes . Two primary groups are clearly dist inguishable - one consist ing of Ly49a, d, g, m and x and the other containing the remaining genes except for Ly49q. Two more c losely related subgroups of Ly49c/i/j and Ly49h/k/n are readily 86 Figure 3-5 Dotplot of the duplicated region containing Ly49h, If and n. S e q u e n c e containing the Ly49h, k and n genes was used in a dotplot against itself. Lettered boxes correspond to the Ly49 genes and the transcriptional orientation of the genes is indicated by arrows. The sca le of the diagram is indicated in 5 k b intervals on the side of the d iagram. 87 apparent, indicating relatively recent dupl icat ions or gene convers ions involving these sets of genes . Addit ional levels of evolutionary complexity involving these genes is revealed by compar ing phylogenetic trees constructed from different intronic segments . Figure 3-4b and 3-4c respectively show trees of intron 1 and a similar ly-sized region of intron 6. The similarity relationships of these segments are substantial ly different among the genes . For example, as d iscussed further below, intron 1 of the Ly49h, n, k group clusters with Ly49d, m and x. In addit ion, intron 1 of Ly49g and a is c loser to the Ly49cli group but intron 6 clusters definitively with Ly49d, m and x. S u c h dif ferences indicate that multiple recombinat ions or convers ions have occurred during the formation of this cluster. Ly49 molecules are type II t ransmembrane proteins where exon 2 encodes the intracellular domain , exon 3 the t ransmembrane region and exons 4-7 the extracellular portion, including the C-type lectin-like domain (Takei et a l . 1997). A s mentioned above, the genes can be functionally divided into those encoding inhibitory or activating receptors with the inhibitory form being the likely ancestral type. Th is division is based on amino acid dif ferences in exons 2 and 3. In exon 2, inhibitory receptor genes have an ITIM ( immunoreceptor tyros ine-based inhibitory motif) (Ryan and S e a m a n 1997) whereas activating Ly49 receptor genes lack such an ITIM. The t ransmembrane domains (exon 3) in activating receptors are dist inguished by the presence of a charged arginine residue which is required for membrane associat ion with the D A P 1 2 signall ing molecule (Smith et a l . 1998). In C57BI /6, Ly49d and h are known activating receptors (Mason et a l . 1996; Gosse l in et a l . 1999) and Ly49k, n, m (McQueen et a l . 1998) and x have the sequence characterist ics of activating receptor genes . Al l others encode known or putative inhibitory receptors. A s is evident from figure 3-4a, activating and Table 3-1 Percentage Identity of Ly49h to other genes Ly49k Ly49n Ly49i Ly49d Ly49m Region 1 96.6 96.8 74.0 82.7 82.9 Reg ion 2 94.6 95.9 88.5 80.5 80.9 Reg ion 3 91.1 86.6 97.8 71.6 71.5 Reg ion 4 96.4 94.4 96.8 63.1 65.4 Jl IL Region 1 Region 2 Region 3 Region 4 inhibitory receptors fall into both primary groups based on overal l sequence similarity. Whi le it is possib le that the progenitor activating forms arose more than once , we cons ider this scenar io unlikely and our model presented below accounts for the current gene content through the creation of a single activating receptor progenitor gene. 3.3.4 Formation of Ly49h W e examined Ly49h in more detail to illustrate the complex history of the Ly49 genes . Th is gene is of particular interest s ince it encodes an activating receptor that confers resistance to M C M V (Brown et a l . 2001 ; Lee et a l . 2001a ; A r a s e et a l . 2002) and appears to be present in only a few inbred strains related to B6 (Lee et a l . 2001b) s ince most inbred strains are C m v s . A s illustrated in f igures 3-1 and 3-4, this gene is c losely related to Ly49k and n, both of which were reported to be pseudogenes based on c D N A analysis (McQueen et a l . 1999). The genomic sequence of these genes conf irms that they are defective. Ly49k has a termination codon at the end of exon 4 and a partial deletion of exon 5 while Ly49n has a spl ice acceptor site mutation at the beginning of exon 4 that causes aberrant splicing 7 bp downst ream. Al l of the genes share a high level of identify with each other, suggest ing that the dupl icat ions/rearrangements which created these genes occurred relatively recently. The dupl icated segments containing the k, h and n genes are 32-34 kb in length and are juxtaposed end to end with the left end located approximately 7.5 kb upstream of the exon 1a sequence of Ly49d (see figure 3-3). This is illustrated by a dotplot compar ison of the region shown in figure 3-5. A lower level of sequence identity is evident compar ing the 5' end of the Ly49i gene to the Ly49h, k and n. A s shown in figure 3-4b for intron 1, compar isons of the Ly49 genes spanning the first three exons 90 Figure 3-6 Model for evolution of the Ly49h, k and n genes. G e n e s are represented by large black or white boxes with the direction of transcription of g e n e s from right to left. Activating receptors are shaded black and inhibitory receptors are white. L INE sequences present in the intergenic sequence are shown as smal ler boxes shaded in var ious patterns. Unique repeats within the cluster are lettered A - E and the ser ies of events d i scussed in the text are numbered 1-5. The straight arrows denote duplication events while the curved arrow indicates an insertion event. Part A is not shown to sca le . 91 reveal that this part of Ly49h, k and n is more similar to the Ly49x, m and d group, suggest ing a gene rearrangement event prior to the duplication that created h, k and n. The similarity between the hlkln group and, in particular, m and d is a lso obvious when compar ing the repetitive sequences between exon 1 and 1a. T h e s e five genes share repeats which the other genes lack (table 3-1; figure 3-3). C lose r examinat ion of sequence relationships suggests that other events contributed to the creation of Ly49h, and this is illustrated Tab le 3-2. The first part of the h gene extending to just after exon 3 is more c losely related to Ly49d and m than to Ly49i. After that point, k, n and h are most c losely related to each other until approximately 150 bp 3' of exon 4. In the next interval, which is all within intron 4, Ly49h is clearly most similar to Ly49i or c. After intron 4, Ly49h is equal ly related to k, n, i and c. This suggests that at least one, and possibly more, gene convers ions or recombinat ions were involved in shaping the Ly49h gene. Figure 3-6 illustrates a more detai led model for the duplication events that likely occurred to generate Ly49h, k and n. B a s e d on shared repeats in the intergenic space (lined boxes), it appears that an ancestral event dupl icated Ly49i, including the 3' intergenic region, which led to the gene arrangement shown on top line of figure 3-6 (d iscussed further below). The progenitor for the h, k and n genes is then proposed to have been created by a fusion of the Ly49/'-like gene with an activating receptor gene in a recombinat ion event, numbered 1 in figure 3-6. The intergenic sequences to the right of Ly49d and left of Ly49i share overall similarity, but there are severa l unique repetitive sequence insertions shown in the figure as lettered boxes A - D . By noting the presence or absence of these repeats, we define the duplication unit (underlined as event 2) as 92 starting at the end of exon 7 of the hybrid gene created in event number 1 to the end of Ly49i. Another L INE sequence (box E) inserted (event 3) upstream of the "leftmost" hybrid gene shortly after this unit first dupl icated (based on d ivergence va lues of repeat sequences) . Th is now enlarged unit dupl icated a second time (event 4) to generate the current gene arrangement. A subsequent gene convers ion event (event 5), as d iscussed earlier, is proposed to have occurred between Ly49i and h. It has been recently shown that Ly49h in B6 mice binds an MHC- l i ke protein, m157, encoded by M C M V and confers host viral resistance by activating killing of infected cel ls (Arase et a l . 2002). No inhibitory receptors in B6 mice apparently bind m157. Interestingly, in the MCMV-sens i t i ve strain 129/J , Ly49/'129 binds m157 and inhibits killing of infected cel ls, suggest ing that m157 evolved to help the virus evade N K killing by mimicking normal M H C c lass I. S u c h f indings lend weight to the idea that inhibitory receptors are necessary to prevent autoimmunity but activating receptors evolve to fight pathogens (Khakoo et a l . 2000; A r a s e et a l . 2002). In the speci f ic case of Ly49h, our ana lyses show that its creation involved fusion of a Ly49d/m-\ike activating region (exons 1-3) to the extracellular portion of an Ly49/'-like gene fol lowed by further gene convers ion events. The genetic outcome that, by chance , conferred protection against M C M V would likely have been under strong positive select ion to become fixed if exposure to the virus was endemic during the evolutionary history of C 5 7 B L / 6 . 3.3.5 A model for evolution of the Ly49 gene family Our analys is , coupled with the recently publ ished order of Ly49 genes in the 129/J strain (Makrigiannis et a l . 2002), can be used to propose a possib le scheme for 93 creation of the Ly49 gene cluster present in B6 mice (figure 3-7). This model is consistent with the overall similarity relat ionships between genes , the dotplot compar isons and the presence of repetitive sequences but other scenar ios are a lso possib le. The model does not deal with events leading to the creation of the gene fragments at the telomeric end of the cluster, nor can it address all the dif ferences between the inbred strains of mice. Furthermore, it is almost certain that multiple gene convers ion events have occurred which compl icates such analys is . With these provisos, we will d i scuss our proposed model by referring to each numbered line in figure 3-7. (0) The purple gene represents the ancestral gene after the split from the more divergent and physical ly distant Ly49b. Repeat 2 integrated here s ince it is present in all genes except Ly49b. (1) A duplication event split the genes into "red" and "blue" progenitors. Repeat 24 must have integrated into the red progenitor at this point. (2) Ly49q was most likely formed by one of the first dupl icat ions of the red progenitor s ince it is quite divergent from the others but shares repeat 24 with other red-type genes (Table 3-2). Repeats 12, 25 and 26, in common to Ly49a, d, g, m and x, likely inserted in the blue progenitor here. (3) A duplication of the block of two genes as shown is a likely next step. Repeat 14 must have inserted here or slightly later. (4) W e then propose that the leftmost "blue" gene dupl icated to form two genes that will eventual ly recombine to form Ly49x (see lines 7-8). In this model , the black gene marked "act." in figure 3-7 is the progenitor of all the activating receptors (shown later as white/black). W e propose that the changes to exon 2 and 3 necessary for activating function and the insertion of repeats 1 and 7 occurred in this gene prior to the next block dupl icat ion. (5) The first duplication of a block of three genes took place and a gene convers ion event may have occurred at this point or later to make the sequence of Ly49e more similar to the other "red" genes . This stage is the most probable insertion 94 Table 3-2 Repetit ive elements within Ly49 genes a Type of repetitive sequence as given by Repeatmasker. Not all repeats are listed. bPercent divergence of repeat from the consensus sequence. Higher values indicate an older age. clntron location of the repeat. Repeats 1-3 are 5' of exon 1 and repeat 26 is 3' of exon 7. 95 t ime interval for repeats 8 and 9, shared by a and g; and repeats 18 and 20, found in c, h, i,j, k and n. (6) B a s e d on the 129/J gene order, we propose that the ancestor of Ly49t, which is present in 129/J but absent in B6 was deleted. Th is line a lso shows the block of three genes duplicating to form the eventual "ri'-i-g and m-c-a units which are evident from the dotplot compar isons. Repeat 10, which is shared by h, k and n, could have inserted here or later in the scheme. (7) B a s e d on information from 129/J mice, a duplication involving the Ly49q-e block may have taken p lace to form the q2 and e/c2 genes present in 129/J but not B6 . (8) T h e s e latter two genes were likely deleted when two genes present in 129/J recombined to create Ly49x. Th is possibil ity was recently suggested (Makrigiannis et a l . 2002) and is supported by a compar ison of the L y 4 9 v 1 2 9 c D N A and the genomic region containing Ly49x. Whi le the 3' region of the Ly49x gene, proposed to have been derived from L y 4 9 v 1 2 9 , has exon 5, 6, & 7 matches with high (>95%) identity to L y 4 9 v 1 2 9 , this similarity dec reases (s 85%) for exon 1,2,3, & 4 , proposed to have been derived from Ly49l/r:29. Aga in , a lack of 129/J genomic sequence prevents identification of the precise recombinat ion point. Line 8 of the figure a lso shows duplication of the two gene block containing the Ly49d and /' progenitors as d iscussed above. In addit ion, we postulate that the Ly49g progenitor dupl icated with the resulting right-hand gene, then recombining with the rightmost "black/white" gene to create the Ly49m/I progenitor in line 9. This recombinat ion event is proposed because Ly49m is most c losely related to Ly49g in the 3' portion of the gene (figure 3-4c and data not shown). Line 8 a lso shows a possib le gene convers ion event resulting in donation of sequences from the 5' portion of the Ly49m progenitor to Ly49d. Th is event is proposed because Ly49d and m share repeats 4 and 5 in their 5' regions, which are not found in any of the other genes . The 96 similarity of the 5' parts of these two genes is also shown in figure 3-4b. (9) A s shown in figure 3-6, we propose that a recombination event occurred to form a "fusion" gene -the progenitor of k, h and n. Furthermore, due to the high similarity of Ly49c, i and j, we suggest that a relatively recent convers ion event occurred to homogen ize the sequences of these two genes . (10-11) The h/k/n progenitor dupl icated and repeat 3 integrated into one copy (this is repeat E in figure 3-6). The two-gene block boxed on line 9 likely dupl icated to form Ly49l and j and Ly49m and c. Repeat 11 is specif ic to Ly49j and so must have integrated after this duplication event. W e propose that a deletion occurred that removed most of Ly49l as well as the intervening sequence between Ly49l and j. W e previously reported that Ly49j similarity with Ly49i and c at the 3' end of the genes ceased within the 3' U T R (McQueen et a l . 2001), a point that can now be defined as the deletion junction. Exon 7 and part of the last intron are all that remain of Ly49l, with this last exon located 2.6 kb 3' of Ly49j. Another gene convers ion event is proposed to explain the fact that Ly49h is most similar to /, c and j in a portion of its sequence . Repeats 22 and 23 , which are Ly49d-speci f ic , repeats 6 and 21 (Ly49x-specif ic) and repeat 13 (Ly49c/-specific) are shown at likely points of integration based on their relative d ivergences from consensus (age). The only repeat which does not fit this model is repeat 16 which is present in Ly49a, d and x, but not in g and m as might be expected. It is possib le that this repeat was deleted in the latter two genes or that a gene convers ion or rearrangement obscured its origin. The reconstruction of ancient duplication events illustrated in figure 3-7 is not only of academic interest, but a lso provides insight into the mechan isms of rapid gene expans ion . W e have used information from the distribution of repeats within the Ly49 gene cluster, a phylogenetic tree based on a 40 kb multiple sequence al ignment file of 97 all of the Ly49 genes (excluding Ly49b and /) as well as information from the dotplots of the cluster to develop a model for the generat ion of the present day cluster of genes . Th is model expla ins some of the Ly49 gene dif ferences between 129/J and B6 but a complete sequence of the region in 129/J or other strains will be necessary to fully understand the evolutionary relationships and history of these genes in the mouse. Whi le it is possib le and even likely that some aspects of the model are incorrect, it serves to illustrate the genetic fluidity of this region. It has been formed by single and block dupl icat ions of genes , as well as delet ions, convers ions and other rearrangements resulting in a highly variable and complex locus in the mouse . 3.3.6 Potential role of repetitive sequences In addition to constructing our model for the expans ion of the Ly49 genes , we have ana lyzed the ends of several of the duplication regions to look for repetitive sequences or other unusual features. Al though we could not identify any remarkable sequence features that may cause this region to be particularly prone to recombinat ion, we have found that for the duplication region involving Ly49a and c, there are L INE sequences in the general region of the boundar ies, suggest ing that they may have facilitated the expans ion of the cluster. However, in the c a s e of the recent dupl icat ions of Ly49h, k and n, no ev idence could be found for a specif ic role of repetitive sequences mediating recombinat ion events. Such ana lyses are compl icated by the fact that ancestra l repeat sequences may have been deleted over time and also that gene convers ion events may obscure regions involved in the dupl icat ion. Furthermore, s ince the cluster is composed of end-to-end dupl icat ions, it is difficult to define success ive duplication endpoints. W e did observe that the right end point of the duplication creating Ly49j can be local ized to a simple sequence ( T A G A ) n repeat approximately 98 Figure 3-7 Model for evolution of the Ly49 gene c luster in C57BL/6 mice. G e n e s are represented by smal l boxes and are not to sca le . The direction of transcription of all genes is right to left. Sol id arrows show duplication events with the thick arrows denoting block (boxed) duplications involving more than one gene. Except for the first duplication and the one involving Ly49k, h and n, the color/pattern of one of the dupl icated genes remains the s a m e as the parent whi le the other has been g iven a different pattern of the s a m e color family. Dashed arrows show recombinat ions leading to gene deletions. C u r v e d lines indicate possible gene convers ions. The "129" above the deleted or c rossed-out genes shows genes present in the 129/J strain but not in C 5 7 B L / 6 . Numbers above the genes show probable insertion points of the repetitive sequences listed in Tab le 3-2. 99 1.7 kb 5' of the Ly49j exon 1 a and just 3' of Ly49m. W e a lso noticed that the gene convers ion event involving Ly49h and Ly49ilc begins at the point where the al ignment of the highly similar Ly49i, c and j genes is interrupted by a 600 bp stretch of L INE sequence unique to Ly49j (repeat 11 in figure 3-6b and Tab le 3-1. A s mentioned above, for an interval beyond this point, Ly49h is most similar to Ly49i/c/j. It s e e m s highly co-incidental that the convers ion should have been initiated at this point by chance but it is not c lear what the mechanist ic signi f icance of the Ly49j L INE sequence might b e . ' With respect to s imple sequence repeats or microsatel l i tes, there are a large number within the Ly49 genes , and this is characterist ic of mouse genomic D N A which has higher densit ies of these repeats compared to humans (Kruglyak et a l . 1998; G l u s m a n et a l . 2001 ; Waterson et a l . 2002). It has been suggested that stretches of pyrimidine-purine dimers act as signals for gene convers ion regulation in several loci (Mart insohn et a l . 1999). W e could not pinpoint such repeats to precise gene convers ion boundar ies, but, as mentioned above, one endpoint of the Ly49j "insertion" s e e m s to be located in a ( T A G A ) n repeat. In addit ion, we noted several examples of microsatell i tes being immediately juxtaposed to other retroelements, in keeping with reports that such sequences may promote recombination or maintain an "open" form of chromatin (Liao and We iner 1995). W e a lso compared the lengths of paralogous microsatell i tes present in the different genes because it has been shown that allele lengths of repeats at equil ibrium follow a ba lanced, bel l -shaped distribution (Xu et a l . 2000). A relatively old ( T A A ) n repeat present in all genes except Ly49q and b and found upstream of exon 1 is highly degenerate and has a rather tight length distribution of 63-97 bp. In contrast, younger repeats found in only subsets of genes are more 100 variable in length (data not shown). A n extreme example is the ( C A / T G / T A ) n repeat found in the recently dupl icated Ly49h, k and n genes where repeat s izes range from 14 to 152. Whi le such a wide variation in length within highly related genes could be due to replication s l ippage, it is perhaps more likely that gene convers ion and/or c rossover are responsible for this magnitude of variation (Richard and P a q u e s 2000). If this is the c a s e , then the variable microsatell i tes within the cluster suggest that the potential for ongoing rearrangements involving these genes remains high. 3.3.7 Compar isons to the KIR region It is interesting to compare genomic characterist ics of the mouse Ly49 cluster to that of the human KIR region s ince both gene famil ies, while structurally unrelated, serve ana logous functions in N K cel ls. Prev ious studies of the smal ler KIR locus have shown that the genes are very c losely s p a c e d , less than 3 kb apart in most c a s e s , and are all oriented in the same transcriptional direction. Furthermore, dot matrix analys is shows that the KIR genes form a nearly cont inuous stretch of related sequence over a region spanning 150 kb (Wilson et a l . 2000). Ana lys is of the ages of repetitive sequences within the K IRs suggests that the genes amplif ied in primates during the last 40 million years (Martin et a l . 2000). Most Ly49 genes are a lso c losely spaced . If the recently descr ibed exon 1a is taken as the start of the gene, most intergenic d is tances within the core group of genes range from 7 to 9 kb. Ly49g is somewhat more separated, being 21 kb from Ly49i and 28 kb from the exon 7 remnant of Ly49l. Furthermore, like the KIR region, the Ly49 cluster is composed of a largely cont inuous stretch of blocks of related sequence , a result of success ive dupl icat ions. It has been shown that there are two distinct KIR haplotypes in humans, where a subset of genes are absent from the second haplotype. The existence of haplotypes that share certain genes at specif ic locations within the cluster has suggested the possibil ity that these genes represent "framework genes" (Wilson et a l . 2000). Addit ionally, although the haplotypes are smal ler, the ex is tence of f ramework genes has been extended to the KIR genes within the pygmy ch impanzee (Rajal ingam et a l . 2001), suggest ing that this gene arrangement has been present and maintained for a considerable period of t ime. The recent compar ison of Ly49 gene content between the 129 and B6 inbred strains suggests that, like the KIR cluster, there is plasticity in the gene cluster (Makrigiannis et a l . 2002). Despite this similarity, there is currently insufficient ev idence to suggest that such framework genes exist within the Ly49 family. Whi le there are Ly49 transcripts such as Ly49e (Makrigiannis et a l . 2001) and b (Genbank access ion # A F 2 5 3 0 5 9 , A F 2 5 3 0 5 8 , AF253057 ) which are nearly identical between inbred stains, as we have illustrated, these genes lie outside the main Ly49 cluster. Such outlying genes may simply have been left out of the recombination events that occurred in the generat ion of cluster diversity and therefore would not be ana logous to the framework pattern observed for the KIR genes . Unfortunately, assigning time intervals to the Ly49 duplication events using approximate ages of the inserted retroelements is problematic because there remains considerable controversy over the neutral mutation rate in rodents. S o m e studies have conc luded that the mutation rate in rodents is significantly higher than in primates with publ ished rates ranging as high as 8 x 10" 9/bp/yr for rodents (Li 1991). In contrast, a recent analys is found basical ly the same rate of 2.2 x 10" 9/bp/yr when compar ing all mammals (Kumar and Subramanian 2002). Another recent study of retroelements derived a figure of - 8 % divergence to represent 25 million years of evolution in the 102 rodent l ineage (Lander et a l . 2001). If we take this latter va lue, the first dupl icat ions shown in figure 3-7 must have occurred 60-70 million years ago, assuming the d ivergence va lues of the repeats from their consensus "parent" e lements are reasonably accurate (Smit 1999; Jurka 2000). Th is time interval is, as expected, after most est imates for the divergence between rodents and primates. If the highest est imate for mutation rate is used , then the initial dupl ications may have occurred as recently as 30 million years ago. In either event, these est imates are consistent with the theory that the amplif ication of Ly49 genes was restricted to rodents. Severa l Ly49 c D N A s have been isolated from the rat (Dissen et a l . 1996), but insufficient rat genomic information is currently avai lable for comparat ive studies. However, al though Ly49 appears to be a single copy gene in primates (Mager et a l . 2001), cow (McQueen et a l . 2002), and some other mammals including dog , cat and pig (unpubl ished observat ions from our laboratory), it is possib le that it could have expanded independently to multiple copies in selected spec ies . Indeed, this likely occurred with the KIR locus. Multiple KIR genes have been recently been reported in the cow which, assuming the est imates for age of the KIR expans ions in primates are accurate, implies that the KIR genes amplif ied independently in cows (McQueen et a l . 2002). The ultimate fate and number of such genes is likely a lso dependent on the fate and structure of their M H C l igands and on the pathogens encountered during evolution of the spec ies . 3.3.8 Conc lud ing remarks The origins of multigene famil ies, particularly those involved in host defense such as the T C R and M H C I loci where diversity is essent ia l , have been studied extensively. 103 While some comparisons can be drawn between these systems and the Ly49 gene cluster, the latter appears to be unique in several ways. Unlike the MHC loci, Ly49 has not expanded to a multi-gene family in a large number of species. The fact that functional homologs exist in other species argues for the importance of the function, but not the specific protein family involved, provided the family exhibits sufficient diversity. In addition, unlike the MHC or TCR regions, the Ly49 genes appear to have undergone a functional split some time ago where now several of the genes encode activating receptors. The evolution of activating receptors which are presumed to have diverged from their inhibitory counterparts is not unique to the Ly49 receptors but also exists within the KIRs and other NK cell receptors (Taylor et al. 2000; Ryan et al. 2001). Again, there seems to be a value to organisms that develop activating receptors against pathogens regardless of the family to which they belong and this case has clearly been demonstrated for Ly49h (Brown et al. 2001; Lee et al. 2001a; Arase et al. 2002). Of all the full-length Ly49 genes present in B6 mice, it is intriguing that the pseudogenes, namely Ly49k, m, n, and x, encode potential activating receptors. The remaining genes all encode apparently functional receptors. Thus, it appears that selection has prevented the persistence of harmful mutations in inhibitory receptors while allowing mutations to accumulate in activating receptors. Indeed, if activating receptors function only against specific pathogens, it might be expected that the genomic content of these genes would be more variable than their inhibitory relatives. In this regard, it would be extremely interesting to examine the Ly49 gene content in wild mice since such populations have likely been exposed to pathogens not seen by the common inbred strains. 104 The complex evolutionary tapestry of the Ly49 cluster is impossible to unravel completely from the perspective of one mouse strain. Therefore, further studies will need to be conducted in other strains or populations in order to clarify evolutionary events and other issues that could not be addressed in this study. Besides being useful to help elucidate NK cell biology, studies of rapidly evolving multi-gene families such as Ly49 will also aid in answering questions of a more general nature regarding how genetic diversity is generated. 105 Chapter 4 Transcriptional control of the immune receptor CD94 A paper based on this work by Brian Wi lhe lm, Jose t te -Renee Landry, Fumio Take i and Dixie L. Mager entitled "Transcriptional control of the murine C D 9 4 gene: differential usage of dual promoters by lymphoid cell types" has been submitted for publication to the Journal of Immunology. A second paper dervied from this study by Br ian Wi lhe lm and Dixie L. Mager entitled "Identification of a new murine lectin-like gene in c lose proximity to CD94" is in press for Immunogenet ics (2003). Jose t te -Renee Landry preformed northern blots and analys is of several quantitative real-time P C R reactions. Th is work is summar ized in sect ion 4.2.7 and 4.2.8 106 4.1 Introduction Ana lys is of the transcriptional control of the CD94 gene is of interest for several reasons. A s mentioned earlier, there is a developmental switch in receptor usage in mice from C D 9 4 / N K G 2 heterodimers to Ly49 homodimers (Sa lcedo et a l . 2000). In addit ion, because the murine CD94/NKG2 genes have functional homologs in humans, an additional source of data exists to compare genomic sequence features as well as functional data. Finally, the detai led investigation of one N K C gene may yield experimental results that are broadly appl icable to all N K C genes . Earl ier work on the identification of transcriptional start points for Ly49 genes was extended to examine members of the murine CD94/NKG2 family that are centromeric to the Ly49 genes within the N K C . The subsequent characterisat ion of the promoter regions of CD94 i l lustrates the complex nature of transcriptional control of genes within the N K C . 107 4.2 Materials and methods 4.2.1 Mouse strains Fetal C 5 7 B L / 6 J pups and 1-2 month old C 5 7 B L / 6 J mice and D B A 2 / J mice (The J a c k s o n Laboratory, Bar Harbour, Ml) were used for all exper iments. 4.2.2 5' RACE for CD94 5' R A C E was performed to isolate the complete c D N A from the CD94 gene and as performed as previously descr ibed (Wilhelm et a l . 2001 , chapter 2). 4.2.3 Constructs Reporter constructs were generated using the tailed primers listed in table 4-1 by amplif ication using B6 genomic D N A as a template and the P F U enzyme. The P C R products were purified using the Q iagen P C R - p r o d u c t purification kit, d igested with the appropriate tail restriction enzyme (Kpn I or Bgl II) and then ligated into Kpn l/Bgl II d igested empty P G L 3 B firefly luciferase vector. In order to control a high background activity of P G L 3 B in lymphoid cel ls observed in our lab, addit ional polyA sites were inserted upstream of the multiple cloning site of the empty vector. Al l constructs were similarly modif ied to eliminate experimental dif ferences caused by sequence dif ferences between vector backbones. Co lon ies transformed from ligations were grown up and sequenced from either orientation before large cultures were prepared for transfections. Tab le 4-I. Primers used Primer S e q u e n c e (5' to 3') C D 9 4 5 ' R A C E C T G G A T T G G G G C T G A A G A A G G C T G G C D 9 4 5 ' R A C E nested G C G A A G C A C A G A A A T C T C T G C C D 9 4 R T exon 1 b sense T C C T T G G A A C A T C A C T T C T C A T G G C C D 9 4 R T exon 2 a - s e n s e T G A A T T T A T C A G C A A A A C T C C C A A A G C D 9 4 R T exon 1a sense C A G G G T C G G C A C T C A G A A G G A A C 108 C D 9 4 R T exon 1 b a - s e n s e T G G T G C A G A G A T G T G T T T G T G C T T G A D P H R T sense A A C G A C C C C T T C A T T G A C G A D P H R T a - s e n s e C T C C A C G A C A T A C T C A G C A C C D 9 4 construct exon 1a 5' Long G G G G T A C C G T G A T T T C A C C T T T G A G T C C T C D 9 4 construct exon 1a 5' Short G G G G T A C C A T T A C C T C C T G G A C T T C A T A G C D 9 4 construct exon 1a 3' B a s e G A A G A T C T C C T C A G T T A G A G T A T A C G G A T C D 9 4 construct exon 1 b 5' Long C G G G T A C C T G C T C A A C A C C C T A T G T T C T G C D 9 4 construct exon 1 b 5' Short C G G G T A C C T A T T A A G C G A T C A G A T A A T A T G T G C D 9 4 construct exon 1 b 3' B a s e G A A G A T C T G G C A C A C A T A C C T G C C A G G A Human C D 9 4 construct 5' C G G G T A C C G G T A G A G T C A G A A G A A C A G Human C D 9 4 construct 3' G A A G A T C T G A G A A A T T A T G T T C C A A G A G C G C D 9 4 exon 3 A A T T C T A C A G T G G T G G T T G G A G A A G C D 9 4 e x o n 1 a A A C A T C A A C A T C C C A C A C T T G T A T G A C C D 9 4 exon 4 A C A A G T G G G T T G G G C A T C A G T G C D 9 4 exon 6 A A A C G C T T T T G C T T G G A C T G T A C D 9 4 R T exon 5 sense G G G A G G A T G G C A C A G T T C C C T C C D 9 4 R T exon 6 a - s e n s e T T T C A C A G G A T T C A G C A G A A A C G C 4.2.4 Transfections & Cell Culture The E L - 4 cell line was cultured in D M E M supplemented with 5 % F B S , 100 U/ml penicil l in, and 100 U/ml streptomycin. T h e L N K cell line was obtained from Dr. K. Nakanish i through the lab of Dr. S . Anderson and was cultured in R P M I 1640 containing 5 0 ^ M 2 - M E , nonessent ia l amino ac ids , 5 % F B S , 100 U/ml penicil l in, 100 U/ml streptomycin, sod ium pyruvate, L-glutamine, H E P E S , and IL-2 (8000 lU/ml). A n IL-2 independent version of the C T L L - 2 cell l ines was obtained from Dr. T. G o n d a and was grown in R P M I 1640 containing 50|aM 2 - M E , nonessent ia l amino ac ids , 5 % F B S , 100 U/ml penicil l in, 100 U/ml streptomycin, sodium pyruvate, L-glutamine. NIH 3T3 cel ls were grown in D M E M supplemented with 10% F B S , 100 U/ml penicil l in, and 100 U/ml streptomycin. The L N K and C T L L - 2 cell l ines were transfected using the D E A E -Dextran transfection kit and protocol suppl ied (Amersham B iosc iences) while the E L - 4 and NIH 3T3 cel ls were transfected using l ipofectamine as previously descr ibed (McQueen et a l . 2001) or according to the manufacturer 's protocol, respectively. To 109 control for transfection efficiency, dual transfections with the P R L - T K Renilla luciferase vector were done at least twice, in dupl icate, for each cell line tested and all firefly luciferase va lues were normal ized to the Renilla activity prior to analys is . Luci ferase measurements were performed as per the suppl ier 's instructions (Promega, Wiscons in) using a luminometer. 4.2.5 Cultured splenocytes Sp leens were homogenized and R B C were removed from single suspens ions by 20-second lysis with ice-cold distilled water. Remain ing cel ls were washed twice with P B S and incubated for 1 hour in a media filled packed nylon wool co lumn. Ce l l s were slowly eluted from the co lumn, washed and cultured in R P M I 1640 containing 10% F B S , 100 U/ml penicil l in, 100 U/ml streptomycin, sod ium pyruvate, L-glutamine and IL-2 (8000 lU/ml). After 3 days the media was changed and all non-adherent cel ls were removed by wash ing twice with P B S . Ce l ls were cultured for another 3-6 days before R N A extraction. 4.2.6 Flow cytometry Splenocy tes and fetal (day 18-20) liver samp les were prepared as single-cel l suspens ions , stained with labelled antibodies and analyzed by flow cytometry. Ce l l suspens ions were pre-treated with a culture supernatant containing ant i -FcRyl l l / I IR, 2 .4G2 to prevent F c R binding by labelled antibodies. mAbs directed against the following cell sur face markers were used : NK1 .1 (PK136) , CD94(18d3) , NKG2(20d5) , C D 4 9 b ( D X 5 ) , CD3s(145-2c11) . F low cytometry and sorting was performed on a F A C S v a n t a g e S E (BD B iosc iences , Mountain V iew, C A . ) using Ce l lQues t software. 110 4.2.7 Northern blot analysis RNA was isolated from EL4 and LNK cells using Trizol as described by the supplier (Gibco BRL). Following the elimination of remaining genomic DNA with DNase I (Gibco BRL), 10 ug of RNA from EL4 or LNK cells were electrophoresed on a 1.2% agarose, 5% (VA/) formaldehyde, 1X MOPS buffer gel and transferred to a Zetaprobe membrane (Biorad). The Northern blot was hybridized in ExpressHyb (Clontech) at 68°C with a CD94 cDNA fragment corresponding to the nearly full-length transcript. The membrane was washed twice for 20 min in 2X SSC, 0.05% SDS at room temperature followed by 2 washes of 20 min in 0.1 X SSC, 0.1% SDS at 50°C. To confirm the amounts of mRNA loaded in each lane, the blots were rehybridised with a human 1.9 kb actin cDNA fragment. 4.2.8 Quantitative Real-time P C R RNA to be used for Real-time PCR was isolated using the Trizol reagent and protocol (Gibco/BRL) and treated with DNase I (Gibco/BRL) to remove any possible DNA contamination before reverse transcription. The RNA concentration was estimated using a spectrophotometer prior to reverse transcription. RNA was reverse transcribed as previously described (Wilhelm et al. 2001), using random hexamers. The RNA from FACS sorted NK, T and NKT cells was diluted based on the absolute cell numbers collected (5x104 - 7.5x105) so that the RNA concentrations were identical before reverse transcription. Quantitative Real-time PCR was performed using 1(al of the prepared cDNA along with 22jJ of water, 1 |al of each of the two primers (30 pmol/^ l) and 25^ 1 of the 2X Sybr green PCR master mix (PE Applied Biosystems) and the following amplification I l l condit ions: 30s at 95°G, 30s at 65°C and 30s at 72°C for 40 cyc les on a Biorad iCycler. Pr imers were des igned according to P E Appl ied B iosys tems ' recommendat ions and dif ferences in primer amplif ication eff iciency were calculated as recommended. For each experiment, dissociat ion curve analysis was performed to verify the presence of only a single P C R product. The relative quantification of the transcripts was derived using the comparat ive threshold cycle method ( P E Appl ied B iosys tems User Bulletin #2, ABI P R I S M 7700 S e q u e n c e Detection system) suppl ied by the manufacturer. Al l quantitative real-time P C R experiments were performed at least twice in dupl icate. 4.2.9 DNase I H S S scan The D N a s e I hypersensit ive site assay was performed as previously descr ibed (Porter et a l . 1999). Briefly, D N A was col lected from L N K and E L - 4 cell l ines, where cell pellets were lysed using a Dounce homogenizer in R S B - N P 4 0 (10mM Tris-HCI pH7.5 , 10mM NaCI , 3 m M M g C I 2 , 0 .5% NP-40) . Nuclei were col lected and further homogen ized. The nuclei were then treated with varying concentrat ions of D N a s e I before inactivation and proteinase K digestion overnight. D N A was then separated by eletrophoresis, Southern blotted and probed. A D N A fragment from the proximal promoter region of the Lck gene previously shown to indicate hypersensit ive sites in the E L - 4 cell line (Wildin et a l . 1995) was used as a positive control for the technique. The probe used was the 1.2 kb proximal promoter construct insert and the 1.3 kb distal promoter construct insert was a lso used to verify the location of the hypersensit ive site. Hybridization condit ions were performed as per the Exp ressHyb (Clontech) protocol. 112 4.3 Results 4.3.1 The murine CD94 gene has a novel upstream exon 5' RACE was used to identify the transcriptional start point for the CD94 gene. Clones isolated and sequenced from a RACE kit from Clontech using Balb/c splenocyte RNA contained sequence that extended beyond the previously presumed 5' end of the gene (Lohwasser et al. 1998). The novel sequence originated from a previously identified exon in the 5' UTR of CD94. The 275 bp upstream exon, termed 1a, is approximately 3.3 kbp upstream of the previously identified first exon, referred to hereafter as exon 1 b. The novel exon is predicted to form part of the 5' UTR of the transcript, although it does contain 5 upstream translational start codons. Because only one of these is in the correct reading frame and none of the ATGs are in a favourable context to initiate translation, it seems unlikely that the novel upstream exon alters the sequence of the protein although it is not possible to rule out effects of the novel 5' UTR on translation of the protein. No canonical promoter sequences such as TATA or CAAT boxes could be identified upstream of the novel exon. Although rat ESTs could be found which contained sequence highly similar to the novel upstream CD94 exon, no homologous region could be found upstream of the human CD94 for a distance of 10kb using BLAST software. Figure 4-1 shows a scale drawing of the revised genomic structure of the murine CD94 gene including the locations of the fragments used below to test for promoter activity. 4.3.2 The LNK cell line transcribes and expresses CD94 and NKG2 genes In order to test the promoter activity of regions surrounding the CD94 gene, an attempt was made to identify a cell line that expresses its endogenous gene as a 113 1a 1b 23 4 5 6 | (3329 bp) | | | j j | Long Long Short — Short i 1=1 kb Figure 4-1 Schematic diagram of CD94 gene. The large numbered boxes represent the exons of the CD94 gene, with the novel 5' exon shown as 1a. The distance between the two alternative first exons is shown and the regions of sequence used for both the long and short promoter constructs are shown to scale below. 114 permissive environment for promoter characterization. Various NK, T and NKT cell lines including EL-4, KY-1 and CTLL-2 were characterized which were all negative for cell surface expression of CD94/NKG2. However one NK cell line, LNK, which had previously been described (Tsutsui et al. 1996) was positive for CD94/NKG2 expression at the cell surface by FACS (figure 4-2A). The lack of CD94 mRNA in EL-4 cells compared to LNK was also confirmed by northern blot using p-actin as a control (figure 4-2B). This cell line as well as other lymphoid and non-lymphoid cell lines were used to assay for promoter activity. 4.3.3 The murine CD94 gene promoters have differing activity that does not corelate with cell surface expression of the protein Reporter constructs were generated as described in the materials and methods and transfected into several cell lines. The activity of the constructs was made relative to an empty PGL3B vector (basic) with the SV40 promoted PGL3P (promoter) as a positive control. The results of the luciferase transfection assays are shown in figure 4-3. While none of the CD94 constructs tested had activity in the NIH 3T3 cell line, the constructs from the downstream promoter (exon 1b) had high activity in all lymphoid cell lines tested. The upstream promoter (exon 1a) had only limited activity in the lines tested which suggested it might act as a weak promoter in vivo. This hypothesis was shown to be incorrect in subsequent real-time PCR analysis discussed below. The promoter activity in the exon 1 b fragments appears to be conserved between human and mouse genes. The human CD94 construct which contains the 800 bp upstream of the human CD94 translational codon exhibited high activity in all lymphoid cell lines tested. We have previously characterized the similarity between the 115 Figure 4-2 CD94 is expressed by the cell line LNK but not EL-4. A) FACS profiles of the EL-4 and LNK cell lines stained with anti-CD94 and anti-NKG2 antibodies B) Northern blot of RNA collected from the EL-4 and LNK cell lines. In the top panel a fragment of the actin cDNA was used as a probe. In the bottom panel, a portion of the CD94 cDNA was used as a probe. 116 human and mouse genes in this region (Lohwasser et al. 2000), but it is not clear which, if any, of the regions conserved between species are involved in transcriptional regulation. Interestingly, the promoter activity of the CD94 gene fragments did not correlate with cell surface expression of the endogenous gene. Both CTLL-2 and EL-4 cell lines that are negative for CD94 expression by F A C S , exhibited high luciferase activity. Through northern blots (figure 4-2B) and quantitative real-time P C R (data not shown) we have shown that the lack of CD94 expression in EL-4 cells is the result of a transcriptional defect rather than a problem with cell surface presentation. The high promoter activity observed combined with the lack of endogenous gene expression implicates alterations in chromatin structure or methlyation patterns in the transcriptional regulation of CD94. 4.3.4 The two CD94 promoters have lymphoid cell-type specific usage that is already established in fetal splenocytes fractions In an effort to characterize the usage patterns of the two CD94 promoters, freshly isolated C57BL/6 splenocytes were sorted by F A C S into NK, NKT and T-cell fractions from which RNA was collected. Real-time quantitative P C R was performed using primers that would distinguish between CD94 transcripts that originated from the upstream promoter (detected by P C R using primers in exon 1a and exon 1b) and those originating from both promoters (detected by P C R using primers in exon 1 b and exon 2). The later was used to represent total functional CD94 transcripts, as the translational start codon is in exon 1b. As illustrated in figure 4-4, the usage of the upstream CD94 promoter varied by lymphoid cell type with adult NK cells using it 117 Promoter Basic Exon 1A Exon 1A Exon 1B E x o n I B Human (PGL3P) (PGL3B) 1300bp 600bp 1200bp 500bp CD94 800bp Figure 4-3 Results of reporter construct transfections. The cell lines used are indicated in the figure on the right hand side. The vertical axis indicates the fold induction of luciferase over the basic construct that lacks promoter activity. The constructs transfected and their sizes are indicated under the horizontal axis. In order to maintain clarity of the graph, the value of the positive control (PGL3P) construct in LNK cells is indicated in brackets. 118 Figure 4-4 Quantitative real-time P C R results of differential promoter usage by cel l type. The cell types tested are indicated along the horizontal axis while the vertical axis shows the percentage of the total transcripts that contain exon 1a. Fetal and adult cell types are indicated by shading patterns in the legend on the bottom left. 119 almost exclusively. Conversely, T-cells that expressed CD94 did so primarily from the exon 1 b promoter. NKT cells, which express markers characteristic of both NK and T cells, had expression from both promoters. Further, the trends in promoter usage seen in the adult cell types were present in the same late-stage fetal cell types, albeit to a lesser extent. Based on this observation, it appears the cell-type specific promoter usage begins at an early stage of development, with adult patterns being reached shortly after birth. 4.3.5 Establ ishment of cel l l ines or culturing NK cel ls alters promoter usage Discrepancies between the promoter usage observed by real-time PCR and 5' RACE clones obtained from cultured NK cells lead us to investigate the promoter usage by the LNK cell line as well as cultured NK cells. NK cells were isolated from bulk splenocytes using a nylon wool column and cultured for 7 days with IL-2 before RNA collection. Real-time quantitative PCR was performed on samples of cultured NK cells as well as RNA collected from the LNK cell line to compare, the promoter usage of these cultured cells. Figure 4-5 shows that relative to freshly isolated NK cells, both cultured cells as well as the NK cell line LNK have significantly decreased exon 1a promoter usage. The decrease in exon 1a promoter usage in cultured NK cells was coordinate with a general down regulation of CD94 expression after culturing (data not shown). An alteration in promoter usage for other cultured lymphoid cell types was not determined. 4.3.6 The DBA2/J mouse expresses an incomplete CD94 m R N A A recent report was published describing a mouse sub-strain (DBA2/J) that lacked detectable expression of CD94 at the cell surface by FACS and transcriptionally 120 120 Figure 4-5 Quantitative real-time P C R results of promoter usage in fresh versus cultured cel ls. The figure indicates the percentage of CD94 transcripts that contain exon 1a in freshly isolated NK cells, NK cells cultured for 7 days as described in materials and methods or the LNK cell line. by northern blot (Vance et al. 2002). We examined this strain as a potentially useful model to explain CD94 transcriptional regulation. Surprisingly, quantitative real-time PCR products from either of the sets of exon 1a/b and exon 2 primers could be generated in the same ratio in the DBA2/J substrain as in a CD94-expressing strain (C57BL/6) relative to an internal control (GADPH) (data not shown). To further clarify the situation, new primers were designed to test for the presence of the last 2 exons (5 and 6) of the CD94 transcript. Real-time PCR indicated that the product from these primers could not be amplified from the DBA/2J strain whereas a product was easily detected from B6 mice. The results of a series of RT-PCR amplifications from FACS sorted NK cells from DBA2/J and B6 mice are shown in figure 4-6. While products from exons 1a to 3 could be generated from both strains, products amplified from exons 4 to 6 or exons 2 to 6 could only be generated using B6 cDNA. These results suggest that there is some defect in the 3' end of the CD94 gene in DBA2/J that does not prevent transcription but does prevent translation and cell surface presentation of the protein. Why the CD94 transcripts were not detected in the previously published report is not clear; however, at least one of the probes used in the northern blot that was negative was from the 3' end of the CD94 transcript. One possible explanation for our reults is that the 3' end of CD94 gene, containing at least exon 6 but perhaps also exon 5, is deleted in DBA2/J. As it seems clear that this is not a transcriptional defect, we have not investigated further into the exact nature of the defect in the DBA2/J mouse strain. 4.3.7 The genes Klre-1 and CD94 are co-expressed The whole genome shotgun sequence (WGS) has been assembled and gene identification software has been used to characterise the gene content of the C57BL/6 mouse genome. A gene predicted to exist in close proximity to the murine CD94 gene 122 Exons A m p l i f i e d 1 a - 3 4 - 6 2 - 6 § § 3 M CD CQ to CQ CD CQ m Q CQ Q CQ Q i 1 i 1 i 5 0 0 b p -Figure 4-6 RT-PCR analysis of CD94 transcription in the DBA2/J mouse strain. R T - P C R was performed on F A C S sorted NK cells in the B6 (CD3"NK1.1 +) and DBA2/J (CD3"DX5 +) strain using primers which would amplify various regions of the CD94 transcript. The exons amplified in each reaction and the mouse strain used are indicated at the top. 123 based on sequence analysis and EST evidence was submitted to Genbank (XM_145036.1). The closest matches to this predicted gene product were the CD94-proteins from Rhesus monkey and mouse. The expression of this gene which we termed killer lectin-like receptor family e - member one (Klre-1) was investigated because of its similarity and proximity to the CD94 gene. The expression level of Klre-1 relative to CD94 was measured by quantitative real-time PCR was performed as described in section 4.2.8 and the results are shown in figure 4-7. Klre-1 and CD94 expression values were made relative to GADPH levels in each sample and CD94 expression in NK cells was arbitrarily assigned a value of 100 percent. Interestingly, the general pattern of Klre-1 expression is similar to CD94, with Klre-1 being expressed at a higher level except in the case of T-cells. We have also found that in the EL-4 cell line, where CD94 expression is absent, there is also no expression of Klre-1. With the exception of T-cells, there appears to be a strong correlation between the expression of these two genes, which is not unexpected given their proximity. It is not clear why there is a lack of correlation between CD94 and Klre-1 expression in T-cells. It is possible that because almost all CD94 transcripts are originating at the exon 1b promoter in T-cells (figure 4-4) which is further away from the Klre-1 locus, the lack of transcriptional activity at the upstream promoter affects Klre-1 expression. 4.3.8 There is evidence for a DNase I hypersensit ive site around the CD94 locus Because expressed genes are frequently associated with open chromatin (Horn & Peterson, 2002) we next looked for evidence of DNase I hypersensitive sites (HSS) around the CD94 locus. Figure 4-8 shows evidence that such a HSS is present at the CD94 locus in LNK cells. We first verified that our procedure could detect previously described DNase I HSS by reproducing a previously published example. We were 124 1000 NK T NKT EI-4 LNK Cell type Figure 4-7 Graph of Klre-1 and CD94 express ion level by cel l type. RNA from FACS sorted C57BL/6 splenocytes was collected using CD3 and NK1.1 staining patterns. The hatched boxes represent the expression level of CD94 while the solid bars represent the Klre-1 expression level. The real time experiments were performed twice in duplicate and the expression of both genes was then normalized to GADPH. Expression of CD94 and Klre-1 in the EL-4 cell line was undetectable. 125 clearly able to detect the previously described HSS at the distal promoter of the Lck gene in EL-4 cells (Wildin et al. 1995) (data not shown). Initial hybridizations were performed with the 1.2kb frament from the exon 1 b promoter region which did not preceisly locate the site. Further hybridizations indicated that the site of the sensitive location is in close proximity to the exon 1a promoter element. The presence of this site appears to correlate with CD94 expression, as it is detectable in the CD94 expressing cell line LNK, but not EL-4 which does not express CD94. 4.4 Discussion Previous work on NK receptor genes has suggested that their transcriptional control is complex. Even in cases where trans-acting factors involved in NKC gene regulation have been identified (Held et al. 1999; Kubo et al. 1999), the effects seen have not been identical for all members of a given gene family. Our current work with the murine CD94 promoter provides further evidence that genes within the natural killer gene cluster (NKC) have a complex pattern of transcriptional control. The identification of a novel upstream CD94 promoter and the fact that the two promoters are used differentially by various lymphoid cells offers a theoretical explanation for the expression of NK receptors on other cell types. It has been observed that small subsets of T-cells express receptors usually found on NK cells in both humans (Carena et al. 1997) and mice (Takei et al. 2001) and that this expression has functional consequences. For instance, the expression of CD94INKG2 proteins has been shown to influence the CD8+ T-cell activity in viral infections (Moser et al. 2002), although this effect appears to be virus-specific (McMahon et al. 2002; Miller et al. 2002). It has also been shown that several cytokines including IL-12 126 - 3.0 kb--1 .0kb-B 1 2 3 4 5 6 7 la lb 2 3 4 5 6 It I H I I I 2 1 • = 1 kb Figure 4-8 DNase I hypersensit ive site analyses of the EL-4 and LNK cel l l ines. Part A shows southern blots prepared from DNase I treated EL-4 and LNK genomic DNA, digested with Bgl II. The expected size of the Bgl II fragment detected by the probe used is 9.3 kb. An arrow on the right hand side indicates the hypersensitive fragment generated in LNK DNA. Part B shows a schematic diagram of the murine Klre-1 and CD94 locus with the 9.3 kb Bgl II fragment indicated by the line under the exons of the genes. The location hypersensitive sites in part A are shown within the locus by vertical arrows with the corresponding arrows. A scale for part B of the diagram is shown in the bottom left. 127 (Derre et al. 2002), TGF-p (Bertone et al. 1999), IL-15 (Mingari et al. 1998) and IL-10 (Romero et al. 2001) are capable of inducing expression of CD94/NKG2 in human T-cells. In one of these reports, the signal for induction of CD94 gene expression was independent of the activity of IL-15 (Derre et al. 2002), similar to a recent report where a majority of pathogen-specific CD8+ T cells upregulated expression of CD94INKG2A independent of the activity of IL-15 (McMahon et al. 2002). In the past, IL-15 has been demonstrated to be necessary to induce expression of CD94/NKG2 on developing human (Mingari et al. 1997) and murine (Williams et al. 1999) NK cells. It is, therefore, possible that the downstream promoter may represent a cryptic promoter that only has high activity in T-cells and is regulated differentially through cytokine signalling in the microenvironment. As the full signalling pathways for many cytokines have not been defined, it is not possible to confirm the theoretical prediction of the presence of transcription factor binding sites or response elements in the promoter regions of these genes. Such a simplistic scenario for regulation does not, however, sufficiently explain our results from transfection that the downstream (exon 1b) promoter constructs displayed high activity in all cell lines despite the lack of expression of the endogenous CD94 gene in most cases. A complete explanation of the function of each promoter would, therefore, need to address issues of chromatin structure or histone modifications in each region. Although murine NK cells appear to go through a switch in receptor system usage during development (Salcedo et al. 2000; Takei et al. 2001, chapter 1), there is currently no evidence that chromatin modifications or alterations in methylation influence murine NKC expression. In contrast, the expression of killer inhibitory receptor (KIR) genes, which are the functional homologs of the Ly49 genes in humans, 128 has recently been shown to be dependent on alterations of the methylation status of the promoter region of the genes (Santourlidis et al. 2002). Our experiments were able to detect the presence of a DNase I hypersensitive sites upstream of the proximal CD94 promoter region, which would suggest that some alteration in chromatin structure must allow expression of the endogenous CD94 gene only in the case of the LNK cell line. It is also of interest that constructs using sequence from the previously defined promoter region upstream of the translational start codon of the human CD94 gene also showed high promoter activity in all murine lymphoid cell lines tested. We have previously shown that this region has a fairly high level of identity between the two species (Lohwasser et al. 2000), and so the shared promoter activity is perhaps not surprising. Unpublished results showing the presence of a novel promoter upstream of the human CD94 gene that is also used differentially between lymphoid cell types (J. Coligan, personal communication) suggests that the intricate dual promoter system of the CD94 gene is conserved between species. Despite an apparent conservation of function, there does not appear to be sequence conservation between the upstream promoter regions of the two species. As described in the Results section, we have been unable to find any region upstream of the human CD94 gene that exhibited homology to the novel upstream exon or the novel promoter region in the murine gene. The nature of the upstream promoter region of the murine CD94 gene is further complicated by the fact that the novel gene, Klre-1, is located in close (2.3 kb) proximity to upstream promoter of CD94. We found the expression of Klre-1 and CD94 to be coordinate (figure 4-7); however, this would not necessarily mean than they are transcriptionally regulated in the same manner (the 129 NKG2D gene which is on the other side of CD94 has a significantly different expression pattern; Bauer et al. 1999; Diefenbach et al. 2000). The possibility of developmental^  coordinated expression is made more likely by our detection of a DNase I hypersensitive sites (HSS) in the vicinity of the exon 1a and 1 b promoter region (figure 4-8). The fragment generated by restriction digest in the DNase I HSS analysis encompassed not only the 5' end of the CD94 gene (from exon 4), but also the last exon of the Klre-1 gene. It is, therefore, possible that the detected DNase I HSSs 5' of the CD94 gene may regulate the expression of CD94 as well as Klre-1. Our finding does not, however, rule out the possibility that there are other HSSs further away from the CD94 promoter region which control the developmental expression pattern of CD94 and Klre-1. In the context of this genomic organization, it would suggest that if the CD94 upstream promoter activity is in fact conserved between species, it may be functionally defined by a short stretch of sequence which may not be detectable in strict homology-based searches. Our finding that promoter usage in fetal NK, T and NKT cells shows a bias which increases in cells from fetal to mature mice indicates that promoter usage changes during development. The comparison of CD94 promoter usage in cultured (IL-2 activated) NK cells versus fresh NK cells also shows that even in adult cells, the promoter usage pattern is not fixed. As the decrease Jn exon 1a promoter usage takes place at the same time as an overall down-regulation of CD94 expression, it suggests that culturing NK cells with IL-2 (or NK cell activation in vivo) leads to the shutdown of the upstream promoter resulting in a reduction in CD94/NKG2 expression. Functionally, 130 the down-regulation of receptors which inhibit cytotoxicity would make sense if the immune system were trying to activate NK cells against pathogens. Our experiments show that the murine CD94 gene clearly has a complex promoter structure that appears to regulate cell-type specific activity. Previously published reports of immune system genes with multiple promoters illustrate that the complex structure of the murine CD94 promoter is not unique (Allen et al. 1992; Wildin et al. 1995; Gessner et al. 1996). Indeed, the usage of dual promoters has been described for several of the Ly49 genes in a situation which might be analogous to CD94. The distal promoter was reported to have activity in fetal cells and in bone marrow cells, possibly linking its usage to the initiation of Ly49 expression in NK cells (Saleh et al. 2002). Unfortunately, the recently described DBA2/J mouse strain (Vance et al. 2002), as explained in the results and figure 4-6, could not be used to gain further insight into the examination of defects in transcriptional regulation of CD94. It will however be interesting to address the transcriptional regulation of the murine NKG2 genes to see if their promoter structures are similarly complex or whether, through the limiting expression of CD94, they let their dimerization partner call the shots. 131 Chapter 5 Summary As discussed in the introduction to my thesis, my objective was to clarify the transcriptional regulation of genes within the NKC. Given the broad nature of the objective and the apparent complexity in the expression of these genes, I believe I have succeeded in my goal and made several useful contributions. I believe that the work on the promoter regions of the Ly49 genes will prove very useful for other researchers in the field. Not only were we able to provide a sequence comparison of the promoter regions of 9 Ly49 genes but also our subsequent analysis of the transcriptional start points provided experimental data to explain the effects observed in the TCF-17" mouse strain. Prior to our work, there was only one paper that mentioned that Ly49a had a single transcriptional start point and that the expression of only Ly49a and of was affected in the TCF-1 deficient mice. The heterogeneity of transcriptional start points seen in our work illustrated that previously proposed TATA boxes did not appear to be used and that the expression of Ly49g was likely not affected in the TCF-17" mice due to its use of an alternative promoter in the first intron of the gene. Our analysis of the nucleotide sequence of the Ly49 gene cluster also represented a useful contribution to the field. Initial work in the NK field focused on identifying receptors that recognised MHC class I molecules. In the more than 10 years since their initial discovery, a list of nearly 40 NK receptors in humans and mice has been compiled. Specifically in the case of the Ly49 genes, gene-specific monoclonal antibodies have been lacking for many of the receptors that had been initially identified. In functional assays where antibodies are marking cell subsets or blocking receptors, a proviso to the results has always been that there might be additional receptors that have not been identified which might influence the results. We have now precisely 132 defined the Ly49 receptor repertoire in the C57BL/6 strain. While antibodies may still be lacking for some gene products, our analysis has at least removed any uncertainty regarding the number of functional receptors that B6 NK cells can express. We were also able to identify a large stretch of unique repetitive DNA within the Ly49 cluster that separates Ly49e and q from the other Ly49 genes. As discussed in chapter 3, this novel finding may represent a boundary element to allow Ly49e (and perhaps o/) to be regulated differently than the other Ly49 genes during development. The high level of sequence similarity observed elsewhere in the intergenic space of the Ly49 cluster suggests that the regulatory mechanisms of Ly49 expression are not based on sequence variation at the location of each gene. This is not to say that single nucleotide differences do not play a role, but rather that it is precisely these small differences that influence expression by default, as there are few observed large differences. The analysis of the promoter region of CD94 has illustrated the complex nature of promoters of genes in the NKC. The finding that NK and T-cells use different promoters for CD94 could also form the rationale behind further studies to elucidate the transcriptional control of NKC genes. Examination of the role of cytokines in the induction of CD94 expression form one promoter or another and the identification of cell-type specific trans-acting factors which bind to the 2 promoters would both be useful questions to study. In addition, the nature of the developmental switch between the Ly49 and CD94/NKG2 receptors remains largely uncharacterised. These studies would likely require additional background information, perhaps derived from DNA microarray analysis, in order to narrow down proteins that might be of interest to examine. Numerous other questions such as the extent to which the mechanism of 133 stochastic gene expression is shared between receptor systems in different species, whether the same trans-acting factors are involved in the expression of both the Ly49 receptors and KIR and how signalling events in developing NK cells influences the sequential activation of genes also remain to be answered. The work presented in this thesis, in combination with other published work, allows for some general conclusions to be draw about the nature of transcriptional regualtion that exists within the NKC cluster. On the basis of the available evidence, one possible model would involve a change in higher order chromatin structure which would allow a locus to become competent to be transcribed. Subsequent to this event, transacting factors, the exact number and type of which appears to vary from gene to gene, can bind the promoter regions and initiate transcription. The factors appear to be, at least in some cases, in limiting supply, which might also explain the predominantly mono-allelic expression seen by genes in the NKC. The final aspect of the model of transcriptional regulation is the repression of genes that are not expressed by developing NK cells within a defined window of opportunity. Data indicating the existance of a fetal promoter for the Ly49 genes that is only active in bone marrow, where NK cells begin to develop provides circumstantial evidence to support this model. The fact that the activity observed in transient transfection assays, using DNA fragments containing this promoter sequence from individual genes, seems to corelate with the frequency of expression of the individual Ly49 genes, suggests that transcriptional activity at this location might be critical for induction of Ly49 expression. As the promoter is not active in adult cells, its principal 134 role may be to enable particular Ly49 genes to become competent to be expressed by NK adult cells. Other evidence in support of the proposed model has shown that the transcription of certain Ly49 genes is dependent on the presence of particular transacting factors. The best example of this comes from analysis of the Ly49a gene. The expression of this gene has been shown in, TCF-1 deficient mice, to be wholy dependent on the presence of this transcription factor. Indeed, TCF-1 appears to be in limiting quantity based on the dose dependent loss of Ly49A expression seen in the heterozygous and homozygous mutants. While other genes such as Ly49g are also affected by the absence of TCF-1, the fact that their expression is not completely abolished in the TCF-1 deficient mice suggests that the Ly49 genes have highly individualized promoters in terms of the cirtical transcription factors involved in their expression. No mechanisms have yet been proposed to explain the repression of Ly49 genes that are not expressed in individual NK cells. It is possible that suppressor elements exist which act to silence loci that do not express particular Ly49 genes during development. It is not yet clear to what extent the experimental observations for the Ly49 genes can be generalized to other genes in the NKC. The murine NKG2A gene has recently been shown to have monoalleic expression in a fashion similar to the Ly49 genes, and the results in chapter 4 indicate that changes in chromatin structure (leading to the creation of a DNase I hypersensitive site) are a prequisite for the expression of the CD94 gene supporting the idea that genes (such as the Ly49 multigene family) must be first made transcriptionally competent before transcription can occur. This suggests 135 that the same general model of transcriptional control might be applicable to all NKC genes, although more detailed experiments will be needed to investigate this possibility. 136 Bibliography Allen, J.M., K.A. Forbush, and R.M. Perlmutter. 1992. Functional dissection of the Ick proximal promoter. Mol Cell Biol 12: 2758-68. Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-402. Anderson, S.K., J.R. Ortaldo, and D.W. McVicar. 2001. The ever-expanding Ly49 gene family: repertoire and signaling. Immunol Rev 181: 79-89. Aramburu, J., L. Azzoni, A. Rao, and B. Perussia. 1995. Activation and expression of the nuclear factors of activated T cells, NFATp and NFATc, in human natural killer cells: regulation upon CD16 ligand binding. J Exp Med 182: 801-10. Arase, H., E.S. Mocarski, A.E. Campbell, A.B. Hill, and L.L. Lanier. 2002. Direct Recognition of Cytomegalovirus by Activating and Inhibitory NK Cell Receptors. Science 296: 1323-1326. Arase, N., H. Arase, S.Y. Park, H. Ohno, C. Ra, and T. Saito. 1997. Association with FcRgamma is essential for activation signal through NKR-P1 (CD161) in natural killer (NK) cells and NK1.1+ T cells. J Exp Med 186: 1957-63. Arkwright, P.D., M. Abinun, and A.J. Cant. 2002. Autoimmunity in human primary immunodeficiency diseases. Blood 99: 2694-702. Azizkhan, J.C., D.E. Jensen, A.J. Pierce, and M. Wade. 1993. Transcription from TATA-less promoters: dihydrofolate reductase as a model. Crit Rev Eukaryot Gene Expr 3: 229-54. Bai, A., J. Broen, and J. Forman. 1998. The pathway for processing leader-derived peptides that regulate the maturation and expression of Qa-1b. Immunity 9: 413-21. Ballas, Z.K. and W. Rasmussen. 1990. NK1.1+ thymocytes. Adult murine CD4-, CD8-thymocytes contain an NK1.1+, CD3+, CD5hi, CD44hi, TCR-V beta 8+ subset. J Immunol 145: 1039-45. Bauer, S., V. Groh, J. Wu, A. Steinle, J.H. Phillips, L.L. Lanier, and T. Spies. 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress- inducible MICA. Science 285: 727-9. Bendelac, A., M.N. Rivera, S.H. Park, and J.H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu Rev Immunol 15: 535-62. Bertbne, S., F. Schiavetti, R. Bellomo, C. Vitale, M. Ponte, L. Moretta, and M.C. Mingari. 1999. Transforming growth factor-beta-induced expression of CD94/NKG2A inhibitory receptors in human T lymphocytes. Eur J Immunol 29: 23-9. Biassoni, R., C. Cantoni, M. Falco, S. Verdiani, C. Bottino, M. Vitale, R. Conte, A. Poggi, A. Moretta, and L. Moretta. 1996. The human leukocyte antigen (HLA)-C-specific "activatory" or "inhibitory" natural killer cell receptors display highly homologous extracellular domains but differ in their transmembrane and intracytoplasmic portions. J Exp Med 183: 645-50. Biron, CA. and L. Brossay. 2001. NK cells and NKT cells in innate defense against viral infections. Curr Opin Immunol 13: 458-64. Borges, L., M.L. Hsu, N. Fanger, M. Kubin, and D. Cosman. 1997. A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J Immunol 159: 5192-6. Borrego, F., J. Kabat, D.K. Kim, L. Lieto, K. Maasho, J. Pena, R. Solana, and J.E. Coligan. 2002. Structure and function of major histocompatibility complex (MHC) class I specific receptors expressed on human natural killer (NK) cells. Mol Immunol 38: 637-60. Borrego, F., M. Ulbrecht, E.H. Weiss, J.E. Coligan, and A.G. Brooks. 1998. Recognition of human histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signal sequence-derived peptides by CD94/NKG2 confers protection from natural killer cell-mediated lysis. J Exp Med 187: 813-8. Boyington, J.C., A.N. Riaz, A. Patamawenu, J.E. Coligan, A.G. Brooks, and P.D. Sun. 1999. Structure of CD94 reveals a novel C-type lectin fold: implications for the NK cell-associated CD94/NKG2 receptors. Immunity 10: 75-82. Braud, V.M., D.S. Allan, CA. O'Callaghan, K. Soderstrom, A. D'Andrea, G.S. Ogg, S. Lazetic, NT. Young, J.I. Bell, J.H. Phillips, L.L. Lanier, and A.J. McMichael. 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795-9. Brennan, J., D. Mager, W. Jefferies, and F. Takei. 1994. Expression of different members of the Ly-49 gene family defines distinct natural killer cell subsets and cell adhesion properties. J Exp Med 180: 2287-95. Brennan, J., G. Mahon, D.L. Mager, W.A. Jefferies, and F. Takei. 1996. Recognition of class I major histocompatibility complex molecules by Ly-49: specificities and domain interactions. J Exp Med 183: 1553-9. Brown, M.G., A.O. Dokun, J.W. Heusel, H.R. Smith, D.L. Beckman, E.A. Blattenberger, C.E. Dubbelde, L.R. Stone, A.A. Scalzo, and W.M. Yokoyama. 2001. Vital involvement of a natural killer cell activation receptor in resistance to viral infection. Science 292: 934-7. Brown, M.G., S. Fulmek, K. Matsumoto, R. Cho, P.A. Lyons, E.R. Levy, A.A. Scalzo, and W.M. Yokoyama. 1997a. A 2-Mb YAC contig and physical map of the natural killer gene complex on mouse chromosome 6. Genomics 42: 16-25. Brown, M.G., A.A. Scalzo, K. Matsumoto, and W.M. Yokoyama. 1997b. The natural killer gene complex: a genetic basis for understanding natural killer cell function and innate immunity. Immunol Rev 155: 53-65. Burshtyn, D.N., J. Shin, C. Stebbins, and E.O. Long. 2000. Adhesion to target cells is disrupted by the killer cell inhibitory receptor. CurrBiol 10: 777-80. Carayannopoulos, L.N., O.V. Naidenko, D.H. Fremont, and W.M. Yokoyama. 2002. Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J Immunol 169: 4079-83. Carena, I., A. Shamshiev, A. Donda, M. Colonna, and G.D. Libera. 1997. Major histocompatibility complex class I molecules modulate activation threshold and early signaling of T cell antigen receptor-gamma/delta stimulated by nonpeptidic ligands. J Exp Med 186: 1769-74. Cerwenka, A., A.B. Bakker, T. McClanahan, J. Wagner, J. Wu, J.H. Phillips, and L.L. Lanier. 2000. Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity 12: 721-7. Chan, P.Y. and F. Takei. 1989. Molecular cloning and characterization of a novel murine T cell surface antigen, YE1/48. J Immunol 142: 1727-36. Chang, C, J. Dietrich, A.G. Harpur, J.A. Lindquist, A. Haude, Y.W. Loke, A. King, M. Colonna, J. Trowsdale, and M.J. Wilson. 1999. Cutting edge: KAP10, a novel transmembrane adapter protein genetically linked to DAP12 but with unique signaling properties. J Immunol 163: 4651-4. Chang, C, A. Rodriguez, M. Carretero, M. Lopez-Botet, J.H. Phillips, and L.L. Lanier. 1995. Molecular characterization of human CD94: a type II membrane glycoprotein related to the C-type lectin superfamily. EurJ Immunol 25: 2433-7. Chuang, S.S., H.T. Pham, P.R. Kumaresan, and P.A. Mathew. 2001. A prominent role for activator protein-1 in the transcription of the human 2B4 (CD244) gene in NK cells. J Immunol 166: 6188-95. Ciccone, E., D. Pende, O. Viale, A. Than, C. Di Donato, A.M. Orengo, R. Biassoni, S. Verdiani, A. Amoroso, A. Moretta, and et al. 1992. Involvement of HLA class I alleles in natural killer (NK) cell-specific functions: expression of HLA-Cw3 confers selective protection from lysis by alloreactive NK clones displaying a defined specificity (specificity 2). J Exp Med 176: 963-71. Cohen, G.B., R.T. Gandhi, D.M. Davis, O. Mandelboim, B.K. Chen, J.L. Strominger, and D. Baltimore. 1999. The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. Immunity 10: 661-71. Colonna, M. and J. Samaridis. 1995. Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells. Science 268: 405-8. Correa, I. and D.H. Raulet. 1995. Binding of diverse peptides to MHC class I molecules inhibits target cell lysis by activated natural killer cells. Immunity!: 61-71. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, and M.L. Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity 7: 273-82. Cosman, D., J. Mullberg, CL. Sutherland, W. Chin, R. Armitage, W. Fanslow, M. Kubin, and N.J. Chalupny. 2001. ULBPs, novel MHC class l-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity 14: 123-33. Daniels, K.A., G. Devora, W.C. Lai, CL. O'Donnell, M. Bennett, and R.M. Welsh. 2001. Murine cytomegalovirus is regulated by a discrete subset of natural killer cells reactive with monoclonal antibody to Ly49H. J Exp Med 194: 29-44. Delano, M.L. and D.G. Brownstein. 1995. Innate resistance to lethal mousepox is genetically linked to the NK gene complex on chromosome 6 and correlates with early restriction of virus replication by cells with an NK phenotype. J Virol 69: 5875-7. Depatie, C, S.H. Lee, A. Stafford, P. Avner, A. Belouchi, P. Gros, and S.M. Vidal. 2000. Sequence-ready BAC contig, physical, and transcriptional map of a 2-Mb region overlapping the mouse chromosome 6 host-resistance locus Cmv1. Genomics 66: 161-74. Derre, L., M. Corvaisier, M.C Pandolfino, E. Diez, F. Jotereau, and N. Gervois. 2002. Expression of CD94/NKG2-A on human T lymphocytes is induced by IL-12: implications for adoptive immunotherapy. J Immunol168: 4864-70. Diefenbach, A., A.M. Jamieson, S.D. Liu, N. Shastri, and D.H. Raulet. 2000. Ligands for the murine NKG2D receptor: expression by tumor cells and activation of NK cells and macrophages. Nat Immunol 1: 119-26. Diefenbach A., Tomasello E., Lucas M., Jamieson A. M., Hsia J. K., Vivier E., and Raulet D. H. 2002. Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D. Nat Immunol 3: 1142-9. Dissen, E., J.C Ryan, W.E. Seaman, and S. Fossum. 1996. An autosomal dominant 0 locus, Nka, mapping to the Ly-49 region of a rat natural killer (NK) gene complex, controls NK cell lysis of allogeneic lymphocytes. J Exp Med 183: 2197-207. Dokun, A.O., S. Kim, H.R. Smith, H.S. Kang, D.T. Chu, and W.M. Yokoyama. 2001. Specific and nonspecific NK cell activation during virus infection. Nat Immunol 2: 951-6. Dorfman, J.R. and D.H. Raulet. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. J Exp Med 187: 609-18. Duncan, G.S., H.W. Mittrucker, D. Kagi, T. Matsuyama, and T.W. Mak. 1996. The transcription factor interferon regulatory factor-1 is essential for natural killer cell function in vivo. J Exp Med 184: 2043-8. Ensembl. 2002. Mouse genome assembly version 3. In. Ensembl. Fahlen, L, N.K. Khoo, M.R. Daws, and CL. Sentman. 1997. Location-specific regulation of transgenic Ly49A receptors by major histocompatibility complex class I molecules. Eur J Immunol 27: 2057-65. Farrell, H.E., H. Vally, D.M. Lynch, P. Fleming, G.R. Shellam, A.A. Scalzo, and N.J. Davis-Poynter. 1997. Inhibition of natural killer cells by a cytomegalovirus MHC class I homologue in vivo. Nature 386: 510-4. Flamand, V., E.W. Shores, T. Tran, K. Huang, E. Lee, A. Grinberg, J.P. Kinet, and P.E. Love. 1996. Delayed maturation of CD4- CD8- Fc gamma RII/III+ T and natural killer cell precursors in Fc epsilon RI gamma transgenic mice. J Exp Med 184: 1725-35. Franksson, L., J. Sundback, A. Achour, J. Bernlind, R. Glas, and K. Karre. 1999. Peptide dependency and selectivity of the NK cell inhibitory receptor Ly-49C. Eur J Immunol 29: 2748-58. George, T.C, L.H. Mason, J.R. Ortaldo, V. Kumar, and M. Bennett. 1999. Positive recognition of MHC class I molecules by the Ly49D receptor of murine NK cells. J Immunol 162: 2035-43. Georgopoulos, K., M. Bigby, J.H. Wang, A. Molnar, P. Wu, S. Winandy, and A. Sharpe. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79: 143-56. Germain, R.N. 2002. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol!: 309-22. Gessner, J.E., T. Grussenmeyer, M. Dumbsky, and R.E. Schmidt. 1996. Separate promoters from proximal and medial control regions contribute to the natural killer cell-specific transcription of the human FcgammaRIII-A (CD16-A) receptor gene. J Biol Chem 271: 30755-64. Glienke, J., Y. Sobanov, C. Brostjan, C. Steffens, C. Nguyen, H. Lehrach, E. Hofer, and F. Francis. 1998. The genomic organization of NKG2C, E, F, and D receptor genes in the human natural killer gene complex. Immunogenetics 48: 163-73. Glusman, G., L. Rowen, I. Lee, C. Boysen, J.C. Roach, A.F. Smit, K. Wang, B.F. Koop, and L. Hood. 2001. Comparative genomics of the human and mouse T cell receptor loci. Immunity 15: 337-49. Godfrey D. I., Hammond K. J., Poulton L. D., Smyth M. J., and Baxter A. G. (2000). NKT cells: facts, functions and fallacies. Immunol Today 21: 573-83. Gosselin, P., A.P. Makrigiannis, R. Nalewaik, and S.K. Anderson. 2000. Characterization of the Ly49l promoter. Immunogenetics 51: 326-31. Gosselin, P., L.H. Mason, J. Willette-Brown, J.R. Ortaldo, D.W. McVicar, and S.K. Anderson. 1999. Induction of DAP12 phosphorylation, calcium mobilization, and cytokine secretion by Ly49H. J Leukoc Biol 66: 165-71. Griffiths, G.M. and Y. Argon. 1995. Structure and biogenesis of lytic granules. Curr Top Microbiol Immunol 198: 39-58. Hackett, J., Jr., M. Tutt, M. Lipscomb, M. Bennett, G. Koo, and V. Kumar. 1986. Origin and differentiation of natural killer cells. II. Functional and morphologic studies of purified NK-1.1+ cells. J Immunol 136: 3124-31. Hanke, T., H. Takizawa, C.W. McMahon, D.H. Busch, E.G. Pamer, J.D. Miller, J.D. Altman, Y. Liu, D. Cado, F.A. Lemonnier, P.J. Bjorkman, and D.H. Raulet. 1999. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11: 67-77. Hayami, K., D. Fukuta, Y. Nishikawa, Y. Yamashita, M. Inui, Y. Ohyama, M. Hikida, H. Ohmori, and T. Takai. 1997. Molecular cloning of a novel murine cell-surface glycoprotein homologous to killer cell inhibitory receptors. J Biol Chem 272: 7320-7. Held, W., J.R. Dorfman, M.F. Wu, and D.H. Raulet. 1996. Major histocompatibility complex class l-dependent skewing of the natural killer cell Ly49 receptor repertoire. Eur J Immunol 26: 2286-92. Held, W. and B. Kunz. 1998. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur J Immunol 28: 2407-16. Held, W., B. Kunz, B. Lowin-Kropf, M. van de Wetering, and H. Clevers. 1999. Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans-acting factor TCF-1. Immunity 11: 433-42. Held, W. and D.H. Raulet. 1997a. Expression of the Ly49A gene in murine natural killer cell clones is predominantly but not exclusively mono-allelic. Eur J Immunol 27: 2876-84. -. 1997b. Ly49A transgenic mice provide evidence for a major histocompatibility complex-dependent education process in natural killer cell development. J Exp Med 185: 2079-88. Ho, L.H., T. Uehara, C.C. Chen, H. Kubagawa, and M.D. Cooper. 1999. Constitutive tyrosine phosphorylation of the inhibitory paired Ig-like receptor PIR-B. Proc Natl Acad Sci U S A 96: 15086-90. Hoglund, P., C. Ohlen, E. Carbone, L. Franksson, H.G. Ljunggren, A. Latour, B. Koller, and K. Karre. 1991. Recognition of beta 2-microglobulin-negative (beta 2m-) T-cell blasts by natural killer cells from normal but not from beta 2m- mice: nonresponsiveness controlled by beta 2m- bone marrow in chimeric mice. Proc Natl Acad Sci U S A 88: 10332-6. Houchins, J.P., L.L. Lanier, E.C. Niemi, J.H. Phillips, and J.C. Ryan. 1997. Natural killer cell cytolytic activity is inhibited by NKG2-A and activated by NKG2-C. J Immunol 158:3603-9. Houchins, J.P., T. Yabe, C. McSherry, and F.H. Bach. 1991. DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med 173: 1017-20. Horn P. J., and Peterson C. L. (2002). Molecular biology. Chromatin higher order folding-wrapping up transcription. Science 297: 1824-7. Hsu, K.C., X.R. Liu, A. Selvakumar, E. Mickelson, R.J. O'Reilly, and B. Dupont. 2002. Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic diversity with a minimum of six basic framework haplotypes, each with multiple subsets. J Immunol 169: 5118-29. lizuka, K., D.D. Chaplin, Y. Wang, Q. Wu, L.E. Pegg, W.M. Yokoyama, and Y.X. Fu. 1999. Requirement for membrane lymphotoxin in natural killer cell development. Proc Natl Acad Sci USA96: 6336-40. Janeway, C. and P. Travers (1997). Immunobiology : the immune system in health and disease. London ; San Francisco, New York, Current Biology ; Garland Pub. Jurka, J. 2000. Repbase update: a database and an electronic journal of repetitive elements. Trends Genet 16: 418-20. Kam, CM., D. Hudig, and J.C Powers. 2000. Granzymes (lymphocyte serine proteases): characterization with natural and synthetic substrates and inhibitors. Biochim Biophys Acta 1477: 307-23. Kane, K.P., E.T. Silver, and B. Hazes. 2001. Specificity and function of activating Ly-49 receptors. Immunol Rev 181: 104-14. Karlhofer, F.M., R. Hunziker, A. Reichlin, D.H. Margulies, and W.M. Yokoyama. 1994. Host MHC class I molecules modulate in vivo expression of a NK cell receptor. J Immunol 153: 2407-16. Karlhofer, F.M., R.K. Ribaudo, and W.M. Yokoyama. 1992. MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature 358: 66-70. Katsura, Y. 2002. Redefinition of lymphoid progenitors. Nat Rev Immunol 2: 127-32. Kayagaki, N., N. Yamaguchi, M. Nakayama, K. Takeda, H. Akiba, H. Tsutsui, H. Okamura, K. Nakanishi, K. Okumura, and H. Yagita. 1999. Expression and function of TNF-related apoptosis-inducing ligand on murine activated NK cells. J Immunol 163: 1906-13. Kennedy, M.K., M. Glaccum, S.N. Brown, E.A. Butz, J.L. Viney, M. Embers, N. Matsuki, K. Charrier, L. Sedger, C.R. Willis, K. Brasel, P.J. Morrissey, K. Stocking, J.C. Schuh, S. Joyce, and J.J. Peschon. 2000. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J Exp Med 191: 771-80. Khakoo, S.I., R. Rajalingam, BP. Shum, K. Weidenbach, L. Flodin, D.G. Muir, F. Canavez, S.L. Cooper, N.M. Valiante, L.L. Lanier, and P. Parham. 2000. Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans. Immunity 12: 687-98. Khoo, N.K., L. Fahlen, and CL. Sentman. 1998. Modulation of Ly49A receptors on mature cells to changes in major histocompatibility complex class I molecules. Immunology 95: 126-31. Kiessling, R., E. Klein, H. Pross, and H. Wigzell. 1975a. "Natural" killer cells in the mouse. II. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Characteristics of the killer cell. Eur J Immunol 5: 117-21. Kiessling, R., E: Klein, and H. Wigzell. 1975b. "Natural" killer cells in the mouse. I. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Specificity and distribution according to genotype. Eur J Immunol 5: 112-7. Kim, S., K. lizuka, H.S. Kang, A. Dokun, A.R. French, S. Greco, and W.M. Yokoyama. 2002. In vivo developmental stages in murine natural killer cell maturation. Nat Immunol 3: 523-8. Kondo, M., I.L. Weissman, and K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Ce//91: 661-72. Kraft, J.R., R.E. Vance, J. Pohl, A.M. Martin, D.H. Raulet, and P.E. Jensen. 2000. Analysis of Qa-1 (b) peptide binding specificity and the capacity of CD94/NKG2A to discriminate between Qa-1-peptide complexes. J Exp Med 192: 613-24. Kruglyak, S., R.T. Durrett, M.D. Schug, and C.F. Aquadro. 1998. Equilibrium distributions of microsatellite repeat length resulting from a balance between slippage events and point mutations. Proc Natl Acad Sci U SA 95: 10774-8. Kubagawa, H., P.D. Burrows, and M.D. Cooper. 1997. A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells. Proc Natl Acad Sci USA 94: 5261-6. Kubo, S., Y. Itoh, N. Ishikawa, R. Nagasawa, T. Mitarai, and N. Maruyama. 1993. The gene encoding mouse lymphocyte antigen Ly-49: structural analysis and the 5'-flanking sequence. Gene 136: 329-31. Kubo, S., R. Nagasawa, H. Nishimura, K. Shigemoto, and N. Maruyama. 1999. ATF-2-binding regulatory element is responsible for the Ly49A expression in murine T lymphoid line, EL-4. Biochim Biophys Acta 1444: 191-200. Kubota, A., S. Kubota, S. Lohwasser, D.L. Mager, and F. Takei. 1999. Diversity of NK cell receptor repertoire in adult and neonatal mice. J Immunol163: 212-6. Kumar, S. and S. Subramanian. 2002. Mutation rates in mammalian genomes. Proc Natl Acad Sci U S A 99: 803-8. Kunz, B., W. Held. 2001. Positive and negative roles of the trans-acting T cell factor-1 for the acquisition of distinct Ly-49 MHC class I receptors by NK cells. J Immunol. 2001 166: 6181-7. Kurepa, Z.f CA. Hasemann, and J. Forman. 1998. Qa-1b binds conserved class I leader peptides derived from several mammalian species. J Exp Med 188: 973-8. Lander, E.S. et al. 2001. Initial sequencing and analysis of the human genome. Nature 409: 860-921. Lanier, L.L. 1998. NK cell receptors. Annu Rev Immunol^: 359-93. Lanier, L.L, C. Chang, and J.H. Phillips. 1994. Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol 153: 2417-28; Lanier, L.L., B.C. Corliss, J. Wu, C. Leong, and J.H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391: 703-7. Lazetic, S., C. Chang, J.P. Houchins, L.L. Lanier, and J.H. Phillips. 1996. Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. J Immunol 157: 4741-5. Lee, C.G., T. Eki, K. Okumura, V. da Costa Soares, and J. Hurwitz. 1998a. Molecular analysis of the cDNA and genomic DNA encoding mouse RNA helicase A. Genomics 47: 365-71. Lee, N., D.R. Goodlett, A. Ishitani, H. Marquardt, and D.E. Geraghty. 1998b. HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. J Immunol 160: 4951-60. Lee, S.H., S. Girard, D. Macina, M. Busa, A. Zafer, A. Belouchi, P. Gros, and S.M. Vidal. 2001a. Susceptibility to mouse cytomegalovirus is associated with deletion of an activating natural killer cell receptor of the C-type lectin superfamily. Nat Genet 28: 42-5. Lee, S.H., J. Gitas, A. Zafer, P. Lepage, T.J. Hudson, A. Belouchi, and S.M. Vidal. 2001b. Haplotype mapping indicates two independent origins for the Cmvls susceptibility allele to cytomegalovirus infection and refines its localization within the Ly49 cluster. Immunogenetics 53: 501-5. Lepin, E.J., J.M. Bastin, D.S. Allan, G. Roncador, V.M. Braud, D.Y. Mason, P.A. van der Merwe, A.J. McMichael, J.I. Bell, S.H. Powis, and CA. O'Callaghan. 2000. Functional characterization of HLA-F and binding of HLA-F tetramers to ILT2 and ILT4 receptors. Eur J Immunol 30: 3552-61. Li, Q., S. Harju, and K.R. Peterson. 1999. Locus control regions: coming of age at a decade plus. Trends Genet 15: 403-8. Li, W.H., and Graur, D. 1991. Fundamentals of Molecular Evolution. 1: 443. Liao, D. and A.M. Weiner. 1995. Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT)n.(GA)n microsatellite embedded within the U2 repeat unit. Genomics 30: 583-93. Liao, N.S., M. Bix, M. Zijlstra, R. Jaenisch, and D. Raulet. 1991. MHC class I deficiency: susceptibility to natural killer (NK) cells and impaired NK activity. Science 253: 199-202. Ljunggren, H.G. and K. Karre. 1985. Host resistance directed selectively against H-2-deficient lymphoma variants. Analysis of the mechanism. J Exp Med 162: 1745-59. Ljunggren, H.G. and K. Karre. 1990. In search of the 'missing self: MHC molecules and NK cell recognition. Immunol Today 11: 237-44. Lohwasser, S., B. Wilhelm, D.L. Mager, and F. Takei. 2000. The genomic organization of the mouse CD94 C-type lectin gene. Eur J Immunogenet 27: 149-51. MacDonald, H.R. 2002. Development and selection of NKT cells. Curr Opin Immunol 14: 250-4. Maeda, A., M. Kurosaki, M. Ono, T. Takai, and T. Kurosaki. 1998. Requirement of SH2-containing protein tyrosine phosphatases SHP-1 and SHP-2 for paired immunoglobulin-like receptor B (PIR-B)-mediated inhibitory signal. J Exp Med 187: 1355-60. 151 Mager, D.L., K.L. McQueen, V. Wee, and J.D. Freeman. 2001. Evolution of natural killer cell receptors: coexistence of functional Ly49 and KIR genes in baboons. Curr Biol 11: 626-30. Makrigiannis, A.P. and S.K. Anderson. 2000. Ly49 gene expression in different inbred mouse strains. Immunol Res 21: 39-47. Makrigiannis, A.P., J. Etzler, R. Winkler-Pickett, A. Mason, J.R. Ortaldo, and S.K. Anderson. 2000. Identification of the Ly49L protein: evidence for activating counterparts to inhibitory Ly49 proteins. J Leukoc Biol 68: 765-71. Makrigiannis, A.P., A.T. Pau, A. Saleh, R. Winkler-Pickett, J.R. Ortaldo, and S.K. Anderson. 2001. Class I MHC-binding characteristics of the 129/J Ly49 repertoire. J Immunol 166: 5034-43. Makrigiannis, A.P., A.T. Pau, P.L. Schwartzberg, D.W. McVicar, T.W. Beck, and S.K. Anderson. 2002. A BAC Contig Map of the Ly49 Gene Cluster in 129 Mice Reveals Extensive Differences in Gene Content Relative to C57BL/6 Mice. Genomics 79 : 437-44. Martin, A.M., E.M. Freitas, CS. Witt, and FT. Christiansen. 2000. The genomic organization and evolution of the natural killer immunoglobulin-like receptor (KIR) gene cluster. Immunogenetics 51: 268-80. Martinsohn, J.T., AB. Sousa, L.A. Guethlein, and J.C. Howard. 1999. The gene conversion hypothesis of MHC evolution: a review. Immunogenetics 50: 168-200. Mason, L.H., S.K. Anderson, W.M. Yokoyama, H.R. Smith, R. Winkler-Pickett, and J.R. Ortaldo. 1996. The Ly-49D receptor activates murine natural killer cells. J Exp Med 184: 2119-28. Mason, L.H., P. Gosselin, S.K. Anderson, W.E. Fogler, J.R. Ortaldo, and D.W. McVicar. 1997. Differential tyrosine phosphorylation of inhibitory versus activating Ly-49 receptor proteins and their recruitment of SHP-1 phosphatase. J Immunol 159: 4187-96. Mason, L.H., J.R. Ortaldo, H.A. Young, V. Kumar, M. Bennett, and S.K. Anderson. 1995. Cloning and functional characteristics of murine large granular lymphocyte-1: a member of the Ly-49 gene family (Ly-49G2). J Exp Med 182: 293-303. McMahon, C.W., A.J. Zajac, A.M. Jamieson, L. Corral, G.E. Hammer, R. Ahmed, and D.H. Raulet. 2002. Viral and bacterial infections induce expression of multiple NK cell receptors in responding CD8(+) T cells. J Immunol 169: 1444-52. McQueen, K.L., J.D. Freeman, F. Takei, and D.L. Mager. 1998. Localization of five new Ly49 genes, including three closely related to Ly49c. Immunogenetics 48: 174-83. McQueen, K.L., S. Lohwasser, F. Takei, and D.L. Mager. 1999. Expression analysis of new Ly49 genes: most transcripts of Ly49j lack the transmembrane domain. Immunogenetics 49: 685-91. McQueen, K.L., B.T. Wilhelm, K.D. Harden, and D.L. Mager. 2002. Evolution of NK receptors: a single Ly49 and multiple KIR genes in the cow. Eur J Immunol 32: 810-7. McQueen, K.L., B.T. Wilhelm, F. Takei, and D.L. Mager. 2001. Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes. Immunogenetics 52: 212-23. Medstrand, P., M. Lindeskog, and J. Blomberg. 1992. Expression of human endogenous retroviral sequences in peripheral blood mononuclear cells of healthy individuals. J Gen Virol 73: 2463-6. Michaelsson, J., C. Teixeira de Matos, A. Achour, L.L. Lanier, K. Karre, and K. Soderstrom. 2002. A signal peptide derived from hsp60 binds HLA-E and interferes with CD94/NKG2A recognition. J Exp Med 196: 1403-14. Miller, J.D., M. Peters, A.E. Oran, G.W. Beresford, L. Harrington, J.M. Boss, and J.D. Altman. 2002. CD94/NKG2 expression does not inhibit cytotoxic function of lymphocytic choriomeningitis virus-specific CD8+ T cells. J Immunol 169: 693-701. Minato, N., B.R. Bloom, C. Jones, J. Holland, and L.M. Reid. 1979. Mechanism of rejection of virus persistently infected tumor cells by athymic nude mice. J Exp Med 149: 1117-33. Mingari, M.C., M. Ponte, S. Bertone, F. Schiavetti, C. Vitale, R. Bellomo, A. Moretta, and L. Moretta. 1998. HLA class l-specific inhibitory receptors in human T lymphocytes: interleukin 15-induced expression of CD94/NKG2A in superantigen- or alloantigen-activated CD8+ T cells. Proc Natl Acad Sci USA 95: 1172-7. Mingari, M.C., C. Vitale, C. Cantoni, R. Bellomo, M. Ponte, F. Schiavetti, S. Bertone, A. Moretta, and L. Moretta. 1997. lnterleukin-15-induced maturation of human natural killer cells from early thymic precursors: selective expression of CD94/NKG2-A as the only HLA class l-specific inhibitory receptor. Eur J Immunol 27: 1374-80. Moretta, A., S. Sivori, M. Vitale, D. Pende, L. Mprelli, R. Augugliaro, C. Bottino, and L. Moretta. 1995. Existence of both inhibitory (p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J Exp Med 182: 875-84. Moretta, A., M. Vitale, S. Sivori, C. Bottino, L. Morelli, R. Augugliaro, M. Barbaresi, D. Pende, E. Ciccone, M. Lopez-Botet, and et al. 1994. Human natural killer cell receptors for HLA-class I molecules. Evidence that the Kp43 (CD94) molecule functions as receptor for HLA-B alleles. J Exp Med 180: 545-55. Moser, J.M., J. Gibbs, P.E. Jensen, and A.E. Lukacher. 2002. CD94-NKG2A receptors regulate antiviral CD8(+) T cell responses. Nat Immunol 3: 189-95. Mrozek, E., P. Anderson, and M.A. Caligiuri. 1996. Role of interleukin-15 in the development of human CD56+ natural killer cells from CD34+ hematopoietic progenitor cells. Blood 87: 2632-40. Natarajan, K., H. Li, R.A. Mariuzza, and D.H. Margulies. 1999. MHC class I molecules, structure and function. Rev Immunogenet 1: 32-46. NCBI. 2002. HTGS database. In. NCBI. Neumann, L., W. Kraas, S. Uebel, G. Jung, and R. Tampe. 1997. The active domain of the herpes simplex virus protein ICP47: a potent inhibitor of the transporter associated with antigen processing. J Mol Biol 272: 484-92. Norman, P.J., H.A. Stephens, D.H. Verity, D. Chandanayingyong, and R.W. Vaughan. 2001. Distribution of natural killer cell immunoglobulin-like receptor sequences in three ethnic groups. Immunogenetics 52: 195-205. Orihuela, M., D.H. Margulies, and W.M. Yokoyama. 1996. The natural killer cell receptor Ly-49A recognizes a peptide-induced conformational determinant on its major histocompatibility complex class I ligand. Proc Natl Acad Sci U S A 93: 11792-7. Orlinick, J.R. and M.V. Chao. 1998. TNF-related ligands and their receptors. Cell Signal 10: 543-51. Park, B., H. Oh, S. Lee, Y. Song, J. Shin, Y.C. Sung, S.Y. Hwang, and K. Ahn. 2002. The MHC class I homolog of human cytomegalovirus is resistant to down-regulation mediated by the unique short region protein (US)2, US3, US6, and US11 gene products. J Immunol 168: 3464-9. Park, S.Y., K. Saijo, T. Takahashi, M. Osawa, H. Arase, N. Hirayama, K. Miyake, H. Nakauchi, T. Shirasawa, and T. Saito. 1995. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3: 771-82. Peritt, D., S. Robertson, G. Gri, L. Showe, M. Aste-Amezaga, and G. Trinchieri. 1998. Differentiation of human NK cells into NK1 and NK2 subsets. J Immunol 161: 5821-4. Peruzzi, M., K.C. Parker, E.O. Long, and M.S. Malnati. 1996. Peptide sequence requirements for the recognition of HLA-B*2705 by specific natural killer cells. J Immunol 57: 3350-6. Piontek, G.E., K. Taniguchi, H.G. Ljunggren, A. Gronberg, R. Kiessling, G. Klein, and K. Karre. 1985. YAC-1 MHC class I variants reveal an association between decreased NK sensitivity and increased H-2 expression after interferon treatment or in vivo passage. J Immunol 135: 4281-8. Plougastel, B., K. Matsumoto, C. Dubbelde, and W.M. Yokoyama. 2001. Analysis of a 1-Mb BAC contig overlapping the mouse Nkrpl cluster of genes: cloning of three new Nkrpl members, Nkrpl d, Nkrpl e, and Nkrplf. Immunogenetics 53: 592-8. Plougastel, B. and J. Trowsdale. 1998. Sequence analysis of a 62-kb region overlapping the human KLRC cluster of genes. Genomics 49: 193-9. Podack, E.R., J.D. Young, and Z.A. Cohn. 1985. Isolation and biochemical and functional characterization of perforin 1 from cytolytic T-cell granules. Proc Natl Acad Sci U S A 82: 8629-33. Porter, S.D., J. Hu, and C.B. Gilks. 1999. Distal upstream tyrosinase S/MAR-containing sequence has regulatory properties specific to subsets of melanocytes. Dev Genet 25: 40-8. Radaev, S., M. Kattah, Z. Zou, M. Colonna, and P.D. Sun. 2002. Making sense of the diverse ligand recognition by NKG2D. J Immunol 169: 6279-85. Rajagopalan, S. and E.O. Long. 1997. The direct binding of a p58 killer cell inhibitory receptor to human histocompatibility leukocyte antigen (HLA)-Cw4 exhibits peptide selectivity. J Exp Med 185: 1523-8. Rajalingam, R., M. Hong, E.J. Adams, BP. Shum, L.A. Guethlein, and P. Parham. 2001. Short KIR haplotypes in pygmy chimpanzee (Bonobo) resemble the conserved framework of diverse human KIR haplotypes. J Exp Med 193: 135-46. Rajalingam, R., P. Krausa, H.G. Shilling, J.B. Stein, A. Balamurugan, M.D. McGinnis, N.W. Cheng, N.K. Mehra, and P. Parham. 2002. Distinctive KIR and HLA diversity in a panel of north Indian Hindus. Immunogenetics 53: 1009-19. Rao, A., C. Luo, and P.G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15: 707'-47. Raulet, D.H. 1994. MHC class l-deficient mice. Adv Immunol 55: 381-421. Raulet, D.H., W. Held, I. Correa, J.R. Dorfman, M.F. Wu, and L. Corral. 1997. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class l-specific Ly49 receptors. Immunol Rev 155: 41-52. Raulet, D.H., R.E. Vance, and C.W. McMahon. 2001. Regulation of the natural killer cell receptor repertoire. Annu Rev Immunol 19: 291-330. Renedo, M., I. Arce, A. Rodriguez, M. Carretero, L.L. Lanier, M. Lopez-Botet, and E. Fernandez-Ruiz. 1997. The human natural killer gene complex is located on chromosome 12p12- p13. Immunogenetics 46: 307-11. Reyburn, H., O. Mandelboim, M. Vales-Gomez, E.G. Sheu, L. Pazmany, D.M. Davis, and J.L. Strominger. 1997a. Human NK cells: their ligands, receptors and functions. Immunol Rev 155: 119-25. Reyburn, H.T., O. Mandelboim, M. Vales-Gomez, D.M. Davis, L. Pazmany, and J.L. Strominger. 1997b. The class I MHC homologue of human cytomegalovirus inhibits attack by natural killer cells. Nature 386: 514-7. Richard, G.F. and F. Paques. 2000. Mini- and microsatellite expansions: the recombination connection. EMBO Rep 1: 122-6. Riley, J., R. Butler, D. Ogilvie, R. Finniear, D. Jenner, S. Powell, R. Anand, J.C. Smith, and A.F. Markham. 1990. A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res 18:2887-90. Romero, P., C. Ortega, A. Palma, I.J. Molina, J. Pena, and M. Santamaria. 2001. Expression of CD94 and NKG2 molecules on human CD4(+) T cells in response to CD3-mediated stimulation. J Leukoc Biol 70: 219-24. Rosmaraki, E.E., I. Douagi, C. Roth, F. Colucci, A. Cumano, and J.P. Di Santo. 2001. Identification of committed NK cell progenitors in adult murine bone marrow. Eur J Immunol 31: 1900-9. Roth, C, J.R. Carlyle, H. Takizawa, and D.H. Raulet. 2000. Clonal acquisition of inhibitory Ly49 receptors on developing NK cells is successively restricted and regulated by stromal class I MHC. Immunity 13: 143-53. Ryan, J.C, C. Naper, S. Hayashi, and M.R. Daws. 2001. Physiologic functions of activating natural killer (NK) complex-encoded receptors on NK cells. Immunol Rev 181: 126-37. Ryan, J.C. and W.E. Seaman. 1997. Divergent functions of lectin-like receptors on NK cells. Immunol Rev 155: 79-89. Ryan, J.C, J. Turck, E.C Niemi, W.M. Yokoyama, and W.E. Seaman. 1992. Molecular cloning of the NK1.1 antigen, a member of the NKR-P1 family of natural killer cell activation molecules. J Immunol 149: 1631-5. Salcedo, M., M. Andersson, S. Lemieux, L. Van Kaer, B.J. Chambers, and H.G. Ljunggren. 1998. Fine tuning of natural killer cell specificity and maintenance of self tolerance in MHC class l-deficient mice. Eur J Immunol 28: 1315-21. Salcedo, M., F. Colucci, P.J. Dyson, L.A. Cotterill, F.A. Lemonnier, P. Kourilsky, J.P. Di Santo, H.G. Ljunggren, and J.P. Abastado. 2000. Role of Qa-1(b)-binding receptors in the specificity of developing NK cells. Eur J Immunol 30: 1094-101. Salcedo, M., A.D. Diehl, M.Y. Olsson-Alheim, J. Sundback, L. Van Kaer, K. Karre, and H.G. Ljunggren. 1997. Altered expression of Ly49 inhibitory receptors on natural killer cells from MHC class l-deficient mice. J Immunol 158: 3174-80. Saleh, A., A.P. Makrigiannis, D.L. Hodge, and S.K. Anderson. 2002. Identification of a novel Iy49 promoter that is active in bone marrow and fetal thymus. J Immunol 168: 5163-9. Samaridis, J. and M. Colonna. 1997. Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways. Eur J Immunol 27: 660-5. Santourlidis, S., H.I. Trompeter, S. Weinhold, B. Eisermann, K.L. Meyer, P. Wernet, and M. Uhrberg. 2002. Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK cells. J Immunol 169:4253-61. Sawicki, M.W., N. Dimasi, K. Natarajan, J. Wang, D.H. Margulies, and R.A. Mariuzza. 2001. Structural basis of MHC class I recognition by natural killer cell receptors. Immunol Rev 181: 52-65. Sivakumar, P.V., M. Bennett, and V. Kumar. 1997. Fetal and neonatal NK1.1+ Ly-49-cells can distinguish between major histocompatibility complex class l(hi) and class l(lo) target cells: evidence for a Ly-49-independent negative signaling receptor. Eur J Immunol 27: 3100-4. Sivakumar, P.V., A. Gunturi, M. Salcedo, J.D. Schatzle, W.C. Lai, Z. Kurepa, L. Pitcher, M.S. Seaman, F.A. Lemonnier, M. Bennett, J. Forman, and V. Kumar. 1999. Cutting edge: expression of functional CD94/NKG2A inhibitory receptors on fetal NK1.1+Ly-49- cells: a possible mechanism of tolerance during NK cell development. J Immunol^!: 6976-80. Sivakumar, P.V., N.S. Williams, I.J. Puzanov, J.D. Schatzle, M. Bennett, and V. Kumar. 1998. Development of self-recognition systems in natural killer cells. Adv Exp Med Biol 452: 1-12. Smale, ST. 1997. Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim Biophys Acta 1351: 73-88. Smit, A.F. 1999. Interspersed repeats and other mementos of transposable elements in mammalian genomes. Curr Opin Genet Dev 9: 657-63. Smith, H.R., H.H. Chuang, L.L. Wang, M. Salcedo, J.W. Heusel, and W.M. Yokoyama. 2000. Nonstochastic coexpression of activation receptors on murine natural killer cells. J Exp Med 191: 1341-54. Smith, H.R., F.M. Karlhofer, and W.M. Yokoyama. 1994. Ly-49 multigene family expressed by IL-2-activated NK cells. J Immunol 153: 1068-79. Smith, K.M., J. Wu, A.B. Bakker, J.H. Phillips, and L.L. Lanier. 1998. Ly-49D and Ly-49H associate with mouse DAP12 and form activating receptors. J Immunol 161: 7-10. Spits, H., F. Couwenberg, A.Q. Bakker, K. Weijer, and C.H. Uittenbogaart. 2000. Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (pre-DC)2 but not into pre-DC1. Evidence for a lymphoid origin of pre-DC2. J Exp Med 192: 1775-84. Steinle, A., P. Li, D.L. Morris, V. Groh, L.L. Lanier, R.K. Strong, and T. Spies. 2001. Interactions of human NKG2D with its ligands MICA, MICB, and homologs of the mouse RAE-1 protein family. Immunogenetics 53: 279-87. Stoneman, E.R., M. Bennett, J. An, K.A. Chesnut, E.K. Wakeland, and J.B. Scheerer. 1996. Cloning and characterization of 5E6 (Ly-49C), a receptor molecule expressed on a subset of murine natural killer cells. J Exp Med 183: 2705. Sykes, M. 1990. Unusual T cell populations in adult murine bone marrow. Prevalence of CD3+CD4-CD8- and alpha beta TCR+NK1.1+ cells. J Immunol 145: 3209-15. Takai, T. and M. Ono. 2001. Activating and inhibitory nature of the murine paired immunoglobulin- like receptor family. Immunol Rev 181: 215-22. Takei, F., J. Brennan, and D.L. Mager. 1997. The Ly-49 family: genes, proteins and recognition of class I MHC. Immunol Rev 155: 67-77. Takei, F., K.L. McQueen, M. Maeda, B.T. Wilhelm, S. Lohwasser, R.H. Lian, and D.L. Mager. 2001. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol Rev 181: 90-103. Taylor, L.S., S.P. Paul, and D.W. McVicar. 2000. Paired inhibitory and activating receptor signals. Rev Immunogenet 2: 204-19. Thomas, J.O. and A.A. Travers. 2001. HMG1 and 2, and related 'architectural' DNA-binding proteins. Trends Biochem Sci 26: 167-74. Thorsby, E. 1999. MHC structure and function. Transplant Proc 31: 713-6. Toomey, J.A., M. Salcedo, L.A. Cotterill, M.M. Millrain, Z. Chrzanowska-Lightowlers, J. Lawry, K. Fraser, F. Gays, J.H. Robinson, S. Shrestha, P.J. Dyson, and C.G. Brooks. 1999. Stochastic acquisition of Qa1 receptors during the development of fetal NK cells in vitro accounts in part but not in whole for the ability of these cells to distinguish between class l-sufficient and class l-deficient targets. J Immunol 163: 3176-84. Toomey, J.A., S. Shrestha, S.A. de la Rue, F. Gays, J.H. Robinson, Z.M. Chrzanowska-Lightowlers, and C.G. Brooks. 1998. MHC class I expression protects target cells from lysis by Ly49- deficient fetal NK cells. Eur J Immunol 28: 47-56. Torkar, M., A. Haude, S. Milne, S. Beck, J. Trowsdale, and M.J. Wilson. 2000. Arrangement of the ILT gene cluster: a common null allele of the ILT6 gene results from a 6.7-kbp deletion. Eur J Immunol 30: 3655-62. Torkar, M., Z. Norgate, M. Colonna, J. Trowsdale, and M.J. Wilson. 1998. Isotypic variation of novel imrriunoglobulin-like transcript/killer cell inhibitory receptor loci in the leukocyte receptor complex. Eur J Immunol 28: 3959-67. Tormo, J., K. Natarajan, D.H. Margulies, and R.A. Mariuzza. 1999. Crystal structure of a lectin-like natural killer cell receptor bound to its MHC class I ligand. Nature 402: 623-31. Trowsdale, J. 1993. Genomic structure and function in the MHC. Trends Genet 9: 117-22. Trowsdale, J., R. Barten, A. Haude, CA. Stewart, S. Beck, and M.J. Wilson. 2001. The genomic context of natural killer receptor extended gene families. Immunol Rev 181: 20-38. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, and K. Kaneda. 1996. IFN-gamma-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J Immunol AST: 3967-73. Uhrberg, M., N.M. Valiante, BP. Shum, H.G. Shilling, K. Lienert-Weidenbach, B. Corliss, D. Tyan, L.L. Lanier, and P. Parham. 1997. Human diversity in killer cell inhibitory receptor genes. Immunity 7: 753-63. Valiante, N.M., M. Uhrberg, H.G. Shilling, K. Lienert-Weidenbach, K.L. Arnett, A. D'Andrea, J.H. Phillips, L.L. Lanier, and P. Parham. 1997. Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7: 739-51. Van Beneden, K., A. De Creus, F. Stevenaert, V. Debacker, J. Plum, and G. Leclercq. 2002. Expression of Inhibitory Receptors Ly49E and CD94/NKG2 on Fetal Thymic and Adult Epidermal TCR Vgamma3 Lymphocytes. J Immunol 168: 3295-302. Van Beneden, K., F. Stevenaert, A. De Creus, V. Debacker, J. De Boever, J. Plum, and G. Leclercq. 2001. Expression of Ly49E and CD94/NKG2 on fetal and adult NK cells. J Immunol 166: 4302-11. Vance, R.E., A.M. Jamieson, D. Cado, and D.H. Raulet. 2002. Implications of CD94 deficiency and monoallelic NKG2A expression for natural killer cell development and repertoire formation. Proc Natl Acad Sci U S A 99: 868-73. Vance, R.E., A.M. Jamieson, and D.H. Raulet. 1999. Recognition of the class lb molecule Qa-1(b) by putative activating receptors CD94/NKG2C and CD94/NKG2E on mouse natural killer cells. J Exp Med 190: 1801-12. Vance, R.E., J.R. Kraft, J.D. Altman, P.E. Jensen, and D.H. Raulet. 1998. Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-1(b). J Exp Med 188: 1841-8. Vance, R.E., D.M. Tanamachi, T. Hanke, and D.H. Raulet. 1997. Cloning of a mouse homolog of CD94 extends the family of C-type lectins on murine natural killer cells. Eur J Immunol 27: 3236-41. Vilches, C. and P. Parham. 2002. KIR: Diverse, Rapidly Evolving Receptors of Innate and Adaptive Immunity. Annu Rev Immunol 20: 217-51. Vitale, M., R. Castriconi, S. Parolini, D. Pende, M.L. Hsu, L. Moretta, D. Cosman, and A. Moretta. 1999. The leukocyte Ig-like receptor (LIR)-1 for the cytomegalovirus UL18 protein displays a broad specificity for different HLA class I alleles: analysis of LIR-1 + NK cell clones. Int Immunol 11: 29-35. Vivier, E., M. Ackerly, N. Rochet, and P. Anderson. 1992. Structure and function of the CD16:zeta:gamma complex expressed on human natural-killer cells. IntJ Cancer Suppl 7: 11-4. Volanakis, J.E. 1995. Transcriptional regulation of complement genes. Annu Rev Immunol13: 277-305. Volz, A., H. Wende, K. Laun, and A. Ziegler. 2001. Genesis of the ILT/LIR/MIR clusters within the human leukocyte receptor complex. Immunol Rev 181: 39-51. Wagtmann, N., S. Rajagopalan, C.C. Winter, M. Peruzzi, and E.O. Long. 1995. Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by direct binding and by functional transfer. Immunity 3: 801-9. Wagtmann, N., S. Rojo, E. Eichler, H. Mohrenweiser, and E.O. Long. 1997. A new human gene complex encoding the killer cell inhibitory receptors and related monocyte/macrophage receptors. CurrBiol7: 615-8. Wang, B., C. Biron, J. She, K. Higgins, M.J. Sunshine, E. Lacy, N. Lonberg, and C. Terhorst. 1994. A block in both early T lymphocyte and natural killer cell development in transgenic mice with high-copy numbers of the human CD3E gene. Proc Natl Acad Sci U S A 91: 9402-6. Waterston, R.H. et al. 2002. Initial sequencing and comparative analysis of the mouse genome. Nature 420: 520-62. Wende, H., M. Colonna, A. Ziegler, and A. Volz. 1999. Organization of the leukocyte receptor cluster (LRC) on human chromosome 19q13.4. Mamm Genome 10: 154-60. Westgaard, I.H., S.F. Berg, S. Orstavik, S. Fossum, and E. Dissen. 1998. Identification of a human member of the Ly-49 multigene family. Eur J Immunol 28: 1839-46. Wildin, R.S., H.U. Wang, K.A. Forbush, and R.M. Perlmutter. 1995. Functional dissection of the murine Ick distal promoter. J Immunol 155: 1286-95. Wiley, S.R., K. Schooley, P.J. Smolak, W.S. Din, CP. Huang, J.K. Nicholl, G.R. Sutherland, T.D. Smith, C. Rauch, CA. Smith, and et al. 1995. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 3: 673-82. Wilhelm, B.T., L. Gagnier, and D.L. Mager. 2002. Sequence analysis of the Iy49 cluster in C57BL/6 mice: a rapidly evolving multigene family in the immune system. Genomics 80: 646-61. Wilhelm, B.T. and D.L. Mager. 2003. Identification of a new murine lectin-like gene in close proximity to CD94. Immunogenetics In press. Wilhelm, B.T., K.L. McQueen, J.D. Freeman, F. Takei, and D.L. Mager. 2001. Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53: 215-24. Williams, N.S., J. Klem, I.J. Puzanov, P.V. Sivakumar, M. Bennett, and V. Kumar. 1999. Differentiation of NK1.1+, Ly49+ NK cells from flt3+ multipotent marrow progenitor cells. J Immunol 163: 2648-56. Williams, N.S., J. Klem, I.J. Puzanov, P.V. Sivakumar, J.D. Schatzle, M. Bennett, and V. Kumar. 1998. Natural killer cell differentiation: insights from knockout and transgenic mouse models and in vitro systems. Immunol Rev 165: 47-61. Williams, N.S., A. Kubota, M. Bennett, V. Kumar, and F. Takei. 2000. Clonal analysis of NK cell development from bone marrow progenitors in vitro: orderly acquisition of receptor gene expression. Eur J Immunol 30: 2074-82. Wilson, M.J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, and J. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/ILT gene families. Proc Natl Acad Sci U S A 97: 4778-83. Winter, C.C., J.E. Gumperz, P. Parham, E.O. Long, and N. Wagtmann. 1998. Direct binding and functional transfer of NK cell inhibitory receptors reveal novel patterns of HLA-C allotype recognition. J Immunol 161: 571-7. Wolan, D.W., L. Teyton, M.G. Rudolph, B. Villmow, S. Bauer, D.H. Busch, and I.A. Wilson. 2001. Crystal structure of the murine NK cell-activating receptor NKG2D at 1.95 A. Nat Immunol 2: 248-54. Wong, S., J.D. Freeman, C. Kelleher, D. Mager, and F. Takei. 1991. Ly-49 multigene family. New members of a superfamily of type II membrane proteins with lectin-like domains. J Immunol 147: 1417-23. Wu, J., Y. Song, A.B. Bakker, S. Bauer, T. Spies, L.L. Lanier, and J.H. Phillips. 1999. An activating immunoreceptor complex formed by NKG2D and DAP10. Science 285: 730-2. Wu, M.F. and D.H. Raulet. 1997. Class l-deficient hemopoietic cells and nonhemopoietic cells dominantly induce unresponsiveness of natural killer cells to class l-deficient bone marrow cell grafts. J Immunol 158: 1628-33. Xu, X., M. Peng, and Z. Fang. 2000. The direction of microsatellite mutations is dependent upon allele length. Nat Genet 24: 396-9. Yamashita, Y., D. Fukuta, A. Tsuji, A. Nagabukuro, Y. Matsuda, Y. Nishikawa, Y. Ohyama, H. Ohmori, M. Ono, and T. Takai. 1998a. Genomic structures and chromosomal location of p91, a novel murine regulatory receptor family. J Biochem (Tokyo) 123: 358-68. Yamashita, Y., M. Ono, and T. Takai. 1998b. Inhibitory and stimulatory functions of paired Ig-like receptor (PIR) family in RBL-2H3 cells. J Immunol 161: 4042-7. Yawata, M., N. Yawata, K.L. McQueen, N.W. Cheng, L.A. Guethlein, R. Rajalingam, H.G. Shilling, and P. Parham. 2002. Predominance of group A KIR haplotypes in Japanese associated with diverse NK cell repertoires of KIR expression. Immunogenetics 54: 543-50. Yeager, M. and A.L. Hughes. 1999. Evolution of the mammalian MHC: natural selection, recombination, and convergent evolution. Immunol Rev 167: 45-58. Yokota, Y., A. Mansouri, S. Mori, S. Sugawara, S. Adachi, S. Nishikawa, and P. Gruss. 1999. Development of peripheral lymphoid organs and natural killer cells depends on the helix-loop-helix inhibitor Id2. Nature 397: 702-6. Yokoyama, W.M. and W.E. Seaman. 1993. The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex. Annu Rev Immunol 11: 613-35. Young, NT., F. Canavez, M. Uhrberg, BP. Shum, and P. Parham. 2001. Conserved organization of the ILT/LIR gene family within the polymorphic human leukocyte receptor complex. Immunogenetics 53: 270-8. Zhang, Y. and M.A. Frohman. 1997. Using rapid amplification of cDNAends (RACE) to obtain full-length cDNAs. Methods Mol Biol 69: 61-87. Zinkernagel, R.M., MP. Bachmann, TM. Kundig, S. Oehen, H. Pirchet, and H. Hengartner. 1996. On immunological memory. Annu Rev Immunol 14: 333-67. 168 Web site references http://searchlauncher.bcm.tmc.edu/; site from which sequence manipulations can be performed. http://www.ncbi.nlm.nih.gov; site where data can be human and mouse sequence data (in draft and finished form) can be searched for and downloaded from. http://www.ncbi.nlm.nih.gov/blast/bl2seg/bl2.html: site where local alignments of two sequences can be performed. http://www.ensembl.org/Mus musculus; site where daft genomic data can be searched and downloaded. http://www.psc.edu/biomed/genedoc; site where the Genedoc program can be downloaded. http://www.megasoftware.net; site where Mega software package can be downloaded. http://bio.cse.psu.edu/pipmaker/; site where percentage identity plots and figures between two sequences can be generated. http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotter.html; site where the Dotter program can be downloaded. http://www.health.auckland.ac.nz/.../ lmm07/lmm07Notes2001 .html; Missing-self hypothesis image. http://www.genome.washington.edu/UWGC/analysistools/repeatmask.htm; program which identifies repetitive sequences. http://transfac.gbf.de/c/s.dll/matSearch/matsearch.pl; program to search for transcription factor binding sites. http://genome.ucsc.edu/; human genome browser site for summarized genomic sequence and features. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091138/manifest

Comment

Related Items