Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The genomic organisation and transcriptional regulation of natural killer receptor genes Wilhelm, Brian Thomas 2003

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
831-ubc_2003-854183.pdf [ 11.5MB ]
Metadata
JSON: 831-1.0091138.json
JSON-LD: 831-1.0091138-ld.json
RDF/XML (Pretty): 831-1.0091138-rdf.xml
RDF/JSON: 831-1.0091138-rdf.json
Turtle: 831-1.0091138-turtle.txt
N-Triples: 831-1.0091138-rdf-ntriples.txt
Original Record: 831-1.0091138-source.json
Full Text
831-1.0091138-fulltext.txt
Citation
831-1.0091138.ris

Full Text

THE GENOMIC ORGANISATION AND TRANSCRIPTIONAL REGULATION OF NATURAL KILLER R E C E P T O R G E N E S  By  BRIAN T H O M A S WILHELM  B. S c . , T h e University of W a t e r l o o , 1996 B. E d . , Q u e e n s University, 1996  A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L M E N T O F T H E R E Q U I R E M E N T S FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY IN THE FACULTY OF GRADUATES STUDIES (Department of M e d i c a l G e n e t i c s , M e d i c a l G e n e t i c s p r o g r a m m e )  W e a c c e p t this thesis a s conforming to the required standard  T h e University of British C o l u m b i a April 2 0 0 3 © Brian T h o m a s W i l h e l m  In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t of the requirements f o r an advanced degree at the U n i v e r s i t y of B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and study. I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g of t h i s t h e s i s f o r s c h o l a r l y purposes may be g r a n t e d by the head of my department or by h i s or her r e p r e s e n t a t i v e s . I t i s u n d e r s t o o d t h a t c o p y i n g or p u b l i c a t i o n of t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l not be a l l o w e d without my w r i t t e n p e r m i s s i o n .  Department of The U n i v e r s i t y of B r i t i s h Columbia Vancouver, Canada  Date fl-{<< 1  2.3  11  Abstract  The objective of my thesis was to better characterise the transcriptional regulation of genes within the natural killer gene cluster (NKC). As a first step in analysing why different NKC genes are expressed at different frequencies, we attempted to sequence the promoter region of many Ly49 genes. The resulting sequence comparison showed that the promoter region of all of the genes were too similar to draw any conclusions about what regions might be important, although the inclusion of the expressed human  Ly49  gene showed that some of the sequence  conservation might be significant. In addition, 5' RACE was performed on 4 genes to map their transcriptional start point (TSP). This work revealed that the promoter region of these genes had highly heterogeneous transcriptional start points. We next utilised mouse genomic sequence available in public databases in order to assemble a sequence contig for the Ly49 gene cluster which could be used to study the gene arrangement and genomic features. This work resulted in a detailed analysis of the Ly49  gene content in B6 mice as well as a hypothetical model for the evolution of the  gene cluster. In addition, a large stretch of unique repetitive elements was identified at one end of the cluster which is hypothesised to play a role in the atypical expression pattern of Ly49e. Finally, we examined the transcriptional regulation of the murine CD94  gene in more detail. These experiments showed that this gene has two promoter  regions and that lymphoid cell types use them differentially. This work also demonstrated that preferential usage of a particular promoter by a cell type was established during fetal development, but that the use of the distal promoter by freshly isolated NK cells could be drastically reduced by culturing them in media containing IL2.  The conclusion of this research was that the CD94 gene has a complex promoter  structure, and that several features are shared with the human CD94 gene.  iii  Table of Contents  THE GENOMIC ORGANISATION AND TRANSCRIPTIONAL REGULATION OF NATURAL KILLER RECEPTOR GENES . Abstract  ii  Table of Contents  iii  List of Figures  vii  List of Tables  ix  . Acknowledgements  List of Abbreviations  x  xi  Chapter 1 Introduction  1  1.1 Background on the immune system and identification of NK cells  2  1.2 Ontogeny of NK cells  5  1.3 NK function and regulation through receptors  8  1.4 Classes and families of NK receptors  14  1.4.1 Lectin-like g e n e s  14  1.4.2 Immunoglobulin receptors  24  1.5 MHC class I ligands of NK receptors  31  1.6 The expression patterns of natural killer cell receptors  35  1.6.1 Ly49 transcriptional regulation  37  1.6.2 Transcription factors implicated in the regulation of N K receptor g e n e s .. 4 0  iv 1.6.3 C h a r a c t e r i s e d N K C g e n e promoter regions  41  1.6.4 O t h e r potential N K receptor g e n e regulatory m e c h a n i s m s  43  1.7 A m o d e l f o r receptor a c q u i s i t i o n and the role of M H C c l a s s I e n v i r o n m e n t . . . 44 1.8 C o n v e r g e n t receptor e v o l u t i o n and c o - e v o l u t i o n w i t h M H C c l a s s I  47  1.9 T h e s i s objectives and o r g a n i s a t i o n  48  C h a p t e r 2 C o m p a r a t i v e a n a l y s i s of the promoter r e g i o n s of Ly49 g e n e s  51  2.1 Introduction  52  2.2 Materials a n d M e t h o d s  53  2.2.1 S e q u e n c i n g of putative promoter regions  53  2.2.2 R a p i d amplification of c D N A e n d s ( R A C E )  55  2.2.3 S e q u e n c e A n a l y s i s  57  2.3 R e s u l t s a n d D i s c u s s i o n  ;  58  2.3.1 S e q u e n c e a n a l y s i s of putative regulatory regions of the Ly49 g e n e s 5 8 2.3.2 Identification of potential transcriptional start sites for Ly49 g e n e s .... 6 4 2.3.3 Differential effects of T C F - 1  66  2.3.4 T h e p r e s e n c e of a T A T A box d o e s not s e e m important for Ly49 expression  C h a p t e r 3 G e n o m i c o r g a n i s a t i o n of the C 5 7 B L / 6 Ly49 c l u s t e r  68  71  3.1 Introduction  72  3.2 Materials a n d M e t h o d s  73  3.2.1 Data retrieval a n d a s s e m b l y  73  V  3.2.2 S e q u e n c e Alignments a n d phylogenetic a n a l y s i s  74  3.2.3 R e p e a t a n a l y s i s a n d figure generation  75  3.2.4 Dotplot A n a l y s i s  75  3.3 R e s u l t s a n d D i s c u s s i o n  76  3.3.1 G e n e r a l arrangement of the Ly49 g e n e cluster in B 6 m i c e  76  3.3.2 T h e C 5 7 B L / 6 Ly49 cluster contains large duplicated regions  79  3.3.3. R e l a t i o n s h i p s of the Ly49 g e n e s  83  3.3.4 Formation of Ly49h  89  3.3.5 A model for evolution of the Ly49 g e n e family  92  3.3.6 Potential role of repetitive s e q u e n c e s  97  3.3.7 C o m p a r i s o n s to the K I R region  100  3.3.8 C o n c l u d i n g r e m a r k s  102  Chapter 4 Transcriptional control of the immune receptor CD94  105  4.1 Introduction  106  4.2 Materials a n d M e t h o d s  107  4.2.1 M o u s e strains  107  4.2.2 5' R A C E for CD94  107  4.2.3 C o n s t r u c t s  107  4.2.4 T r a n s f e c t i o n s & cell culture  108  4.2.5 Cultured s p l e n o c y t e s  109  4.2.6 F l o w cytometry  109  4.2.7 Northern blot a n a l y s i s  110  4.2.8 Quantitative Real-time P C R  110  4.2.9 D N a s e I H S S s c a n  111  4.3 Results  112  VI  4.3.1 T h e murine CD94 g e n e h a s a novel upstream e x o n  112  4.3.2 T h e L N K cell line transcribes a n d e x p r e s s e s CD94 a n d NKG2 g e n e s 112 4.3.3 T h e murine CD94 g e n e promoters h a v e differing activity that d o e s not correlate with cell surface e x p r e s s i o n of the protein  114  4 . 3 . 4 . T h e two CD94 promoters h a v e lymphoid cell-type specific u s a g e that is already established in fetal s p l e n o c y t e s fractions  116  4.3.5 Establishment of cell lines or culturing N K cells alters promoter u s a g e 119 4.3.6 T h e D B A 2 / J m o u s e e x p r e s s e s CD94 m R N A but not the translated protein 4.3.7 T h e g e n e s Klre-1 a n d CD94 are c o - e x p r e s s e d  120 121  4.3.8 T h e r e is e v i d e n c e of a D N a s e I hypersensitive sites around the CD94 locus  123  4.4 D i s c u s s i o n  125  Chapter 5 S u m m a r y  131  Bibliography  136  W e b references  168  Vll  List of Figures Figure 1-1 A r m s of the i m m u n e s y s t e m  4  Figure 1-2 T h e missing-self hypothesis  11  Figure 1-3 M o d e l for L y 4 9 - m e d i a t e d inhibitory function  13  Figure 1-4 S c h e m a t i c d i a g r a m s of the m o u s e a n d h u m a n N K C regions  15  Figure 1-5 T h e h u m a n leukocyte receptor c o m p l e x ( L R C )  25  Figure 1-6 Structure of M H C c l a s s I m o l e c u l e a n d antigen p r o c e s s i n g pathway  33  Figure 2-1 Alignment of Ly49 promoter regions  60  Figure 2-2 Transcriptional start sites inferred from 5' R A C E c l o n e s  62  Figure 2-3 C o m p a r i s o n of Ly49 h a n d b promoter region  65  Figure 3-1 Dotplot c o m p a r i s o n of the entire C 5 7 B L / 6 Ly49 cluster  77  Figure 3-2 Dotplot c o m p a r i s o n of Ly49a, c, m region to the Ly49n, i, g region  80  Figure 3-3 S c a l e d i a g r a m of all full length Ly49 g e n e s  82  Figure 3-4 P h y l o g e n e t i c trees of the Ly49 g e n e s  84  Figure 3-5 Dotplot c o m p a r i s o n of Ly49h, k, n region to itself  86  Figure 3-6 M o d e l for the evolution of Ly49h, k, n region  90  Figure 3-7 M o d e l for the evolution of the Ly49 cluster  98  Figure 4-1 S c h e m a t i c d i a g r a m of murine CD94 locus a n d promoter constructs  113  Figure 4-2 F A C S a n d Northern analysis of CD94 e x p r e s s i o n in L N K a n d E L - 4 cell lines 115 Figure 4 - 3 R e s u l t s of transfected promoter constructs  117  Figure 4 - 4 Quantitative real-time P C R results of differential promoter u s a g e by cell type 118 Figure 4 - 5 Quantitative real-time P C R results of differential promoter u s a g e in fresh v e r s u s cultured cells  120  viii Figure 4 - 6 R T - P C R analysis of CD94 e x p r e s s i o n in the D B A 2 / J m o u s e strain  122  Figure 4 - 7 G r a p h of Klre-1 a n d CD94 e x p r e s s i o n level by cell type  124  Figure 4 - 8 A n a l y s i s of D N a s e I H S S around the C D 9 4 promoter  126  ix  List of Tables Table 1-1 Receptors of the C-type lectin-like superfamily  18  Table 1-2 Receptors of the immunoglobulin superfamily  27  Table 3-1 Percentage identity of Ly49h to other genes  88  Table 3-2 Repetitive elements within Ly49 genes  94  Table 4-1 Primers used  107  X  Acknowledgements T h e r e are m a n y p e o p l e I would like to thank for their contribution to my completion of this thesis. Firstly, I would like to thank Dixie M a g e r for a c c e p t i n g m e into her lab. H e r constant e n c o u r a g e m e n t a n d attention to detail h a v e provided m e with a model for s u c c e s s in r e s e a r c h for which I a m extremely grateful. I a m a l s o naturally grateful for her s i m u l t a n e o u s a c c e p t a n c e of Josette into her lab, for o b v i o u s r e a s o n s . I would like to thank all the other m e m b e r s of Dixie's lab w h o have h e l p e d m e along the w a y including D o u g a n d M i k e for s u p e r b technical a s s i s t a n c e . I would a l s o like to e s p e c i a l l y thank K a r i n a M c Q u e e n , without w h o s e help my project would never h a v e a d v a n c e d a s well a s it did. H e r s u g g e s t i o n s and g e n e r a l g o o d h u m o u r m a d e the lab that m u c h more enjoyable to work in. M y unofficial c o - s u p e r v i s o r F u m i d T a k e i a l s o d e s e r v e s s p e c i a l t h a n k s , not only for helping to guide my project, but a l s o for his eternal quest to find the significance of our work. I would a l s o like to thank the various a n d n u m e r o u s people throughout the Terry F o x L a b w h o have a s s i s t e d m e through out the y e a r s , to w h o m I a m truly indebted. I would like to thank my committee m e m b e r s R o b K a y a n d Kelly M c N a g y a n d F u m i o T a k e i for their helpful d i s c u s s i o n at meetings. M y family a n d friends a l s o d e s e r v e thanks for their help a n d support of my efforts. I would definitely like to thank my wife (and co-worker) J o s e t t e - R e n e e L a n d r y for everything that s h e h a s brought to my life. I cannot imagine a better o u t c o m e of my time here than to have found s u c h a p e r s o n with w h o m I c a n s h a r e my entire life. Lastly, I would like to thank my parents. It h a s b e e n their constant love a n d e n c o u r a g e m e n t that h a s allowed m e to a c h i e v e the potential they s a w in m e . It is with humble recognition, a n d utmost gratitude, that I a c k n o w l e d g e that the greatest part of w h o I a m today is a result of their efforts.  List of abbreviations ADCC  antibody d e p e n d e n t cell-mediated cytotoxicity  APC  antigen presenting cell  AP-1  activator protein 1  BAC  bacterial artificial c h r o m o s o m e  BCM  Baylor C o l l e g e of M e d i c i n e  BCR  B-cell receptor  bp  b a s e pair  B6  C57BL/6  BLAST  b a s i c local alignment s e a r c h tool  p2m  beta-2-microglobulin  CD  clusters of differentiation  cDNA  c o m p l e m e n t a r y d e o x y r i b o n u c l e i c acid  cen  centromere  chr  chromosome  CLEC  C-type lectin  cmv  cytomegalovirus  CRD  carbohydrate recognition d o m a i n  CTLD  C-type lectin d o m a i n  D A P 12  D N A X adaptor protein 12  D A P 10  D N A X adaptor protein 10  DC  Dendritic cell  DMEM  d u l b e c c o ' s modified e a g l e ' s m e d i u m  DNA  deoxyribonucleic acid  EMSA  electrophoretic mobility shift a s s a y  EST  e x p r e s s e d s e q u e n c e tag  FACS  f l u o r e s c e n c e activated cell sorting  FITC  fluorescin isothiocyanate  HCMV  h u m a n cytomegalovirus  HLA  h u m a n leukocyte antigen  HMG  high mobility group  HSV  h e r p e s simplex virus  HSS  hypersensitive site  HTGS  high throughput g e n o m i c s e q u e n c e s  IFN y  Interferon g a m m a  ig  immunoglobulin  ig-SF  immunoglobulin superfamily  IL  interleukin  IRF-1  interferon regulatory factpr-1  ITAM  i m m u n o r e c e p t o r t y r o s i n e - b a s e d activation motif  ITIM  i m m u n o r e c e p t o r t y r o s i n e - b a s e d inhibitory motif  kb  kilobase  KIR  killer immunoglobulin-like receptor  Klre-1  killer lectin-like receptor family e - m e m b e r 1  LGL  large granular lymphocytes  LINE  long interspersed repeats  LIR  leukocyte Ig-like receptors  LRC  leukocyte receptor c o m p l e x  LTR  long terminal repeat  Ly  lymphocyte antigen  mAb  m o n o c l o n a l antibody  Mb  megabase  MCMV  murine cytomegalovirus  2-ME  2p-mercapto-ethanol  MGSC  m o u s e g e n o m e s e q u e n c i n g consortium  MHC  major histocompatibility c o m p l e x  MICA/B  M H C c l a s s I chain-related A / B  MIR  M o n o c y t e / m a c r o p h a g e inhibitory receptors  ml  millilitre  mRNA  m e s s e n g e r ribonucleic acid  NCBI  national centre for biotechnology information  ng  nanogram  N K cell  natural killer cell  NKC  natural killer g e n e cluster  NKT  natural killer T-cell  Xlll  P1  P1 bacteriophage vector  PCR  p o l y m e r a s e chain reaction  pg  picogram  PIR  paired immunoglobulin-like receptor  RACE  rapid amplification of c D N A e n d s  RBC  red blood cell  RNA  ribonucleic acid  RPMI  R o s w e l l park memorial institute  RT-PCR  reverse t r a n s c r i p t a s e - p o l y m e r a s e chain reaction  SSAHA  s e q u e n c e s e a r c h and alignment by h a s h i n g algorithm  SDS  s o d i u m d o d e c y l sulphate  SH2  src h o m o l o g y d o m a i n 2  SHP  SH2-domain-containing p h o s p h a t a s e  SINE  short interspersed repeats  SSC  s o d i u m citrate s o d i u m chloride  TCR  T-cell receptor  TCF-1  T-cell factor o n e  TGF-p  Transforming growth factor beta  tel  telomere  TRAIL  T N F - r e l a t e d apoptosis-inducing ligand  TSP  transcriptional start point  UTR  untranslated region  YAC  y e a s t artificial c h r o m o s o m e  a  alpha  B  beta  e  epsilon  \\i  psi  y  gamma  [ig  microgram  JLXI  microlitre  8  delta  L\  zeta  Chapter 1 Introduction  1.1 Background on the immune system and identification ofNK cells T h e m a m m a l i a n immune s y s t e m is c o m p o s e d of a highly sophisticated network of cells a n d signalling m o l e c u l e s that regulate its activity. Millions of y e a r s of selective p r e s s u r e applied from pathogenic o r g a n i s m s have guided the evolution of this elaborate d e f e n c e s y s t e m . The i m m u n e s y s t e m h a s c l a s s i c a l l y b e e n divided into two b r a n c h e s , innate immunity a n d acquired immunity.  Innate immunity refers to the b a s i c , n o n -  specific r e s p o n s e to all p a t h o g e n s while acquired immunity involves the recognition of a specific pathogen a n d e x p a n s i o n of effector cells specific for that pathogen a s well a s the formation of immunological m e m o r y .  M u c h of the power of the m a m m a l i a n i m m u n e s y s t e m c o m e s from the diversity present in the branch of acquired immunity. T h e primary effector cells involved with the cellular a n d humoral b r a n c h e s of acquired immunity are T - c e l l s a n d B-cells respectively. Both of t h e s e cell types are able to randomly rearrange a large n u m b e r of variable g e n e s e g m e n t s in order to a s s e m b l e proteins e x p r e s s e d at the cell surface that are c a p a b l e of recognising a n incredibly diverse range of ligands. Other cells s u c h a s m a c r o p h a g e s a n d antigen presenting cells ( A P C s ) a l s o play vital roles in the regulation of the T a n d B cells through the presentation of peptides to t h e s e cells.  W h i l e the complexity of acquired immunity is of great benefit to the host o r g a n i s m , r e s p o n s e s from t h e s e cells typically require s e v e r a l d a y s to r e a c h m a x i m u m effect. S u c h a time d e l a y between invasion of the host a n d a n overwhelming i m m u n e r e s p o n s e would likely prove fatal in m a n y c a s e s , w e r e it riot for the innate i m m u n e s y s t e m . C e l l s s u c h a s m a c r o p h a g e s and neutrophils, that belong to the innate i m m u n e s y s t e m , are c a p a b l e of "ingesting" bacteria or extracellular material through a p r o c e s s  called p h a g o c y t o s i s . T h e material taken in c a n then be broken d o w n to small m o l e c u l e s by l y s o s o m a l e n z y m e s providing a method for destroying bacteria in a non-specific manner. T h e foreign material that h a s b e e n internalised c a n then be presented to Tcells to stimulate a cell-mediated i m m u n e r e s p o n s e . S u c h co-operation between innate a n d acquired i m m u n e r e s p o n s e s is s e e n in the behaviour of other i m m u n e cell types a s well. M u c h r e s e a r c h h a s b e e n directed at elucidating the m e c h a n i s m s of regulation of the cell-mediated a n d humoral b r a n c h e s of the i m m u n e s y s t e m , in part b e c a u s e of the d e s i r e to understand the m e a n s behind the generation of s u c h a diversity of i m m u n e proteins. It w a s therefore not surprising that another vital c o m p o n e n t of the innate i m m u n e s y s t e m had b e e n overlooked until 1975. A small group of peripheral blood l y m p h o c y t e s , called large granular lymphocytes ( L G L ) b a s e d o n their morphology, w e r e identified, w h i c h l a c k e d e x p r e s s i o n of previously defined m a r k e r s of T-cells ( T C R , T-cell receptor) a n d B-cells ( B C R , B-cell receptor) that w e r e found to be c a p a b l e of lysing target cells without prior i m m u n e stimulation (Kiessling et a l . 1 9 7 5 a ; K i e s s l i n g et a l . 1975b). B e c a u s e of this ability, t h e s e cells w e r e said to have "natural killer" functions. T h e m e c h a n i s m s behind the activation of this cytotoxicity w e r e u n c o v e r e d after careful observation of the characteristics of the cells that w e r e lysed by t h e s e Natural Killer ( N K ) cells (Piontek et a l . 1985).  N K cells differ significantly from both T a n d B-cells in their m e c h a n i s m s for recognising noh-self/altered-self cells a s well a s in the c o n s e q u e n c e s of cell activation. W h i l e stimulated T-cells a n d B-cells both produce cells with a m e m o r y phenotype that c a n be reactivated during a s e c o n d infection by a pathogen (reviewed in Z i n k e r n a g e l et al. 1996), N K cells h a v e not b e e n demonstrated to h a v e this capacity. Figure 1-1  4  Activation  Outcome  NKCell Activating receptor engagement + lack of inhibitory signal  Target cell lysis No memory cells produced  T-cell TCR engagement and co-receptor signalling  Target cell lysis Memory cells produced  TCR  B-Cell B C R engagement and co-receptor signalling  Proliferation of differentiated Ab producing effector cells Memory cells produced  BCR  Figure 1-1 A r m s of the immune s y s t e m . T h e figure depicts cells of the acquired i m m u n e s y s t e m (B a n d T-cells) a s well a s the innate i m m u n e s y s t e m ( N K ) . T h e B C R and T C R receptors that are s h o w n are features of the acquired i m m u n e s y s t e m a s is the production of cells with a m e m o r y phenotype.  5  illustrates s o m e of the differences between B, T a n d N K cells.  1.2 Ontogeny of NK cells Like other lymphoid cells, N K cells are ultimately derived from hematopoietic s t e m cells present in the adult b o n e marrow (Williams et a l . 1998). N K cells d o not require the thymus for normal d e v e l o p m e n t a s athymic mice h a v e normal functional N K cells similar to wild-type mice (Minato et a l . 1979). A l t h o u g h a s e c o n d a r y lymphoid organ is not required for d e v e l o p m e n t , r e s e a r c h h a s found that a proper b o n e marrow microenvironment is o n e of the m a n y critical factors required for N K cell d e v e l o p m e n t . M i c e that had their lymphotoxin-a ( L T a ) or L T p receptor g e n e s k n o c k e d out, a n d w e r e therefore unable to e x p r e s s t h e s e g e n e s in b o n e marrow a s in the wildtype, fail to produce N K cells, s u g g e s t i n g that b o n e marrow stromal cells n e e d signals sent by m e m b r a n e L T a in order support N K cell d e v e l o p m e n t in the b o n e marrow (lizuka et a l . 1999).  O u r understanding of the d e v e l o p m e n t of murine N K cells from their earliest progenitors is a c o m p l e x a n d rapidly c h a n g i n g field. C l a s s i c a l l y , N K cells w e r e thought to be derived from a progenitor cell that w a s s h a r e d with T - c e l l s , but l a c k e d the capacity to p r o d u c e B-cells, a s they s h a r e cell cytolytic properties. A more primitive lymphoid s t e m cell with the phenotype Lin" I L - 7 R T h y - 1 " S c a - 1 +  l 0  c-Kit'°was reported to h a v e a  capacity to differentiate limited to B, T a n d N K cells ( K o n d o et a l . 1997) (reviewed in W i l l i a m s et a l . 1998). S u c h a hierarchy would not only provide a m o d e l for cell fate d e c i s i o n s which would a g r e e with o b s e r v a t i o n s , but a l s o provide a n explanation for the e x i s t e n c e of cells that e x p r e s s markers of both T - c e l l s a n d N K cells referred to a s N K T cells (reviewed in B e n d e l a c et a l . 1997). M o r e recent work calls into question the earlier  theories however, by s h o w i n g that commitment to T-cell a n d B-cell l i n e a g e s m a y o c c u r through bipotential s t a g e s of T-cell/myeloid a n d B-cell/myeloid differentiation (Katsura 2 0 0 2 ) . T h e inherent complexity of the microenvironment a n d plasticity of the s t e m cells involved will likely continue to c a u s e difficulties in attempts to define a rigid order of differentiation of lymphoid cell types.  O t h e r studies have f o c u s e d o n the earliest markers of N K differentiation a n d the transcription factors that are involved in the cell fate d e c i s i o n s . A systematic study of N K progenitor cells s u g g e s t that C D 1 2 2 (the interleukin 2 (IL-2) a n d the IL-15 receptor c o m m o n subunit B) is the first definitive N K cell marker e x p r e s s e d by d e v e l o p i n g N K cells in both h u m a n s a n d mice ( R o s m a r a k i et a l . 2 0 0 1 ; K i m et a l . 2002). Indeed a role for IL-15 has b e e n clearly illustrated in the c a s e of h u m a n N K cells through in vitro culture experiments (Mrozek et a l . 1996). B e c a u s e IL-15 knockout m i c e h a v e defects that include a s e v e r e reduction in N K cells, it a l s o s u g g e s t s that IL-15 is critical for the d e v e l o p m e n t of murine N K cells ( K e n n e d y et al. 2000). Further e v i d e n c e is provided by m i c e that h a v e had their b o n e marrow, w h e r e stromal cells c a n produce IL-15, disrupted by either radioactive isotopes or p-estradiol. T h e s p l e e n b e c o m e s the major site for h e m a t o p o i e s i s in t h e s e c a s e s , h o w e v e r the N K cells w h i c h d e v e l o p lack all cytolytic activity u n l e s s they are cultured in a low d o s e of IL-15 (Hackett et a l . 1986).  A large n u m b e r of g e n e knockout studies h a v e f o c u s e d o n transcription factors involved in lymphoid d e v e l o p m e n t . T h e s e experiments h a v e allowed more p r e c i s e roles to be d e s c r i b e d for a n u m b e r of proteins implicated in N K cell d e v e l o p m e n t . M i c e deficient in Ikaros lack N K cells, but a l s o lack T, B a n d dendritic c e l l s , s u g g e s t i n g that Ikaros is involved in lineage commitment s t a g e s at a primitive stage ( G e o r g o p o u l o s et  7  al. 1994). T h e Id2 a n d Id3 proteins, which belong to a family of inhibitors of helix-loophelix ( H L H ) proteins, h a v e been s h o w n to block the d e v e l o p m e n t of lymphoid cells other than N K cells (Spits et a l . 2000). A m o u s e deficient in Id2 s h o w e d a lack of N K cells (Yokota et a l . 1999) a n d this h a s s u b s e q u e n t l y b e e n attributed to Id2's ability to bind the H E B E-protein, w h i c h s u g g e s t s that this protein a l s o promotes N K cell d e v e l o p m e n t by preventing differentiation to other lymphoid cell types in a fashion similar to Id3 (Spits et al. 2000). Other g e n e knockout m o d e l s , s u c h a s J a k 3 (Park et a l . 1995), or interferon regulatory factor-1 (IRF-1) ( D u n c a n et a l . 1996) or o v e r - e x p r e s s e d t r a n s g e n e s , s u c h a s F c R y ( F l a m a n d et a l . 1996) a n d C D 3 s ( W a n g et a l . 1994), h a v e a l s o resulted in a lack of N K cells. H o w e v e r in most of t h e s e c a s e s , the lack of N K cells is only o n e of the o b s e r v e d p h e n o t y p e s , suggesting that none of t h e s e factors are exclusively important for N K cell development.  In addition to cytokine receptors, other N K cell receptors s u c h a s N K G 2 D , N k r p l , a n d L y 4 9 (see section 1.4.1) have b e e n o b s e r v e d to be e x p r e s s e d at different s t a g e s of N K cell d e v e l o p m e n t (Kim et a l . 2002). Although the ligands for at least s o m e of t h e s e receptors are e x p r e s s e d a n d are p r e s u m a b l y interacting with the N K cells during d e v e l o p m e n t , there is no e v i d e n c e to s u g g e s t that the signalling that o c c u r s is n e c e s s a r y for normal d e v e l o p m e n t a s it is with T C R signalling during T-cell d e v e l o p m e n t (reviewed in G e r m a i n 2002). In M H C c l a s s I knockout m i c e , N K cells h a v e b e e n s h o w n to d e v e l o p normally, although their L y 4 9 receptors are e x p r e s s e d at a s o m e w h a t higher level than in wild-type mice ( S a l c e d o et a l . 1997).  8 A s mentioned earlier, there is a s m a l l s u b s e t of lymphoid cells that b e a r the m a r k e r s of both N K a n d T - c e l l s in h u m a n s a n d m i c e . T h e s e natural killer T - c e l l s ( N K T cells) e x p r e s s a limited repertoire of T C R a / B (or y/5) c h a i n s a s well a s the Nkrp-1 g e n e s a n d p r o d u c e cytokines in a f a s h i o n similar to N K cells (Godfrey et a l . 2000). N K T cells in m i c e a l s o e x p r e s s Ly49 g e n e s , although their e x p r e s s i o n pattern is significantly different from that of N K cells (Takei et al. 2 0 0 1 ) . A c l e a r understanding of the d e v e l o p m e n t of N K T cells is c o m p l i c a t e d by the fact that there are s e v e r a l functional s u b s e t s of N K T cells w h i c h vary in their d e p e n d e n c e o n the t h y m u s for d e v e l o p m e n t a n d their u s e of the C D 1 signalling (Godfrey et a l . 2 0 0 0 ) . E x c e p t for two e x p e r i m e n t s in chapter 4 (which d o not distinguish b e t w e e n N K T cell s u b s e t s ) , N K T cells are not specifically e x a m i n e d in this thesis.  1.3 NK function and regulation through receptors W h e n h u m a n N K cells are activated, they p r o d u c e large a m o u n t s of cytokines including IFN-y a s well a s IL-4, IL-5, IL-10, a n d IL-13 (Peritt et a l . 1998). T h e s e cytokines s e r v e to activate other b r a n c h e s of the i m m u n e s y s t e m a n d support the h y p o t h e s i s that N K cells represent a "front-line" d e f e n c e against p a t h o g e n s . In addition to stimulating the i m m u n e s y s t e m , N K cells are c a p a b l e of lysing cells through the e x p r e s s i o n of the T N F - r e l a t e d a p o p t o s i s - i n d u c i n g ligand ( T R A I L ) w h i c h is significantly up-regulated u p o n N K cell activation ( K a y a g a k i et a l . 1999). T h i s ligand, w h e n b o u n d to its receptor o n a target cell, i n d u c e s a signalling c a s c a d e resulting in the cell u n d e r g o i n g a p o p t o s i s (reviewed in W i l e y et a l . 1 9 9 5 ; Orlinick a n d C h a o 1998).  9  In order to avoid a u t o - a g g r e s s i v e behaviour, natural killer cells h a v e evolved two main m e t h o d s for identifying target cells for lysis. T h e first method is a s a c o m p l e m e n t to the function of activated B-cells. N K cells e x p r e s s the FcyRIII receptor ( C D 1 6 ) that r e c o g n i s e s the F c portion of antibodies generated by B-cells (Vivier et a l . 1992). W h e n the N K cell encounters a target that h a s antibodies bound to it, C D 1 6 will r e c o g n i s e the F c portion of the antibody w h i c h l e a d s to a n activation signal in the N K cell. T h i s signal will result in the lysis of the target cell through the r e l e a s e of lytic g r a n u l e s in the s p a c e b e t w e e n the N K cell a n d the target cell (Griffiths a n d A r g o n 1995). T h e s e lytic granules contain perforin m o l e c u l e s that will a s s e m b l e into a multimeric c o m p l e x in the m e m b r a n e of the target cell, forming large pores in the cell m e m b r a n e of the target cell resulting in cell lysis ( P o d a c k et a l . 1985). In addition the granules contain g r a n z y m e s , a collection of at least 11 different serine p r o t e a s e s are r e l e a s e d that are believed to act on p r o - c a s p a s e s inducing a n apoptotic signal in the target cell ( K a m et a l . 2000). T h i s m o d e of killing is known a s antibody-dependent cell-mediated cytotoxicity ( A D C C ) a s the recognition of the target cell is d e p e n d e n t on the p r e s e n c e of bound antibodies p r o d u c e d by B-cells.  T h e s e c o n d method that N K cells u s e to distinguish target cells from normal cells involves a more sophisticated m e c h a n i s m of receptors a n d ligands e x p r e s s e d by effector a n d target cells. A l m o s t all cells in the h u m a n body e x p r e s s major histocompatibility c o m p l e x c l a s s I ( M H C c l a s s I) m o l e c u l e s a n d this is true in other s p e c i e s a s well ( J a n e w a y a n d T r a v e r s 1997). T h e s e receptors present cellular antigens for recognition by the T C R e x p r e s s e d on T - c e l l s . T h i s method allows the i m m u n e s y s t e m to effectively s u r v e y the body for cells that m a y be virally infected. In s u c h a c a s e , the viral peptides presented to the T-cell will lead to its activation a n d the  10 s u b s e q u e n t lysis of the target cell. In order to avoid this fate, v i r u s e s h a v e e v o l v e d m e c h a n i s m s for down-regulating the e x p r e s s i o n of the M H C c l a s s I m o l e c u l e s upon infection. T h e h e r p e s simplex virus ( H S V ) protein IE12 ( N e u m a n n et a l . 1997) arid the h u m a n cytomegalovirus ( H C M V ) protein U S 6 (Park et a l . 2002) both interfere with the cellular transporters a s s o c i a t e d with antigen p r o c e s s i n g ( T A P ) proteins that are required for M H C c l a s s I e x p r e s s i o n at the cell surface ( J a n e w a y a n d T r a v e r s 1997). Other viral strategies for blocking presentation of viral peptides include the e n d o c y t o s i s of M H C c l a s s I m o l e c u l e s from the cell surface by the HIV Nef protein ( C o h e n et a l . 1999) a n d e x p r e s s i o n of viral M H C c l a s s I d e c o y m o l e c u l e s s u c h a s the U L 1 8 a n d m 1 4 4 H C M V a n d Murine cytomegalovirus ( M C M V ) v i r u s e s respectively (Farrell et a l . 1997; R e y b u r n et a l . 1997b). W h i l e t h e s e viral tactics m a y work to prevent T-cell mediated cytotoxicity, by d o w n regulating the M H C c l a s s I e x p r e s s i o n they have unintentionally m a d e t h e m s e l v e s s u s c e p t i b l e to N K cell mediated lysis.  T h e r e are receptors that are e x p r e s s e d on N K cells that bind to M H C c l a s s I m o l e c u l e s a n d s e n d both inhibitory a n d activating signals to the N K cells. T h e r e are a l s o activating receptors e x p r e s s e d on N K cells that bind to other, l e s s wellc h a r a c t e r i s e d , ubiquitously e x p r e s s e d ligands. W h e n a n N K cell encounters a normal cell, it is believed that both inhibitory a n d activating signals are g e n e r a t e d , but that the inhibitory signal is dominant a n d prevents the activation of the N K cell. If however, the M H C c l a s s I e x p r e s s i o n on the target cell is down-regulated d u e to viral infection or neoplastic transformation, the receptors on N K cells no longer h a v e a dominant inhibitory signal to prevent the activation of the N K cell. T h i s l e a d s to the activation of the N K cell a n d lysis of the target cell. T h i s theory is d e s c r i b e d a s the missing-self hypothesis a n d is depicted in figure 1-2. (Ljunggren a n d K a r r e 1990).  11  Figure 1-2 The missing-self hypothesis. T h e figure illustrates the fundamental c o n c e p t of the h y p o t h e s i s that N K cells survey the b o d y for c e l l s that lack M H C c l a s s I e x p r e s s i o n . T h e lack of e x p r e s s i o n , which m a y be a result of viral infection o r neoplastic transformation, prevents inhibitory signals from being g e n e r a t e d . T h e target cell is therefore s u s c e p t i b l e to lysis by the N K cell, (adapted from www.health.auckland.ac.nz/.../ l m m 0 7 / l m m 0 7 N o t e s 2 0 0 1 .html)  12  Signalling through N K receptors h a s b e e n e x a m i n e d for a n u m b e r of g e n e families, h o w e v e r the best studied family m e m b e r s are the L y 4 9 receptors (described in more detail in section 1.4.1). Characterisation of their signalling m e c h a n i s m s for both activating a n d inhibitory receptors s e r v e s a s a p a r a d i g m for all N K C receptors. T h e majority of L y 4 9 receptors have a signalling motif in their c y t o p l a s m i c d o m a i n referred to a s a n i m m u n o r e c e p t o r t y r o s i n e - b a s e d inhibitory motif (ITIM). U p o n receptor e n g a g e m e n t , the tyrosine residues in the ITIMs b e c o m e phosphorylated allowing the recruitment of m o l e c u l e s s u c h a s S H 2 domain-containing protein p h o s p h a t a s e ( S H P ) -1 a n d 2 to the cell m e m b r a n e ( M a s o n et a l . 1997). T h e recruitment of s u c h p h o s p h a t a s e s is believed to allow the blocking of early signalling e v e n t s generated from the c o clustering activating receptors ( A n d e r s o n et a l . 2 0 0 1 ) in addition to disrupting binding of N K cells to their targets (Burshtyn et a l . 2000). Figure 1-3 depicts a model of L y - 4 9 mediated inhibitory signalling.  T h e r e are s e v e r a l Ly49 g e n e s in the various m o u s e strains including B 6 that d o not have ITIM motifs in their c y t o p l a s m i c d o m a i n s (Brennan et a l . 1994; Smith et a l . 1994). Instead, t h e s e proteins contain a c h a r g e d a m i n o acid residue within their putative t r a n s m e m b r a n e d o m a i n . It h a s b e e n s h o w n that this c h a r g e d residue allows t h e s e receptors to a s s o c i a t e with a small t r a n s m e m b r a n e signalling adaptor m o l e c u l e called D A P 1 2 (Smith et a l . 1998; G o s s e l i n et a l . 1999). D A P 12 is e x p r e s s e d a s a dimer w h e r e e a c h m o n o m e r has an immunoreceptor t y r o s i n e - b a s e d activation motif (ITAM) in its c y t o p l a s m i c d o m a i n (Lanier et a l . 1998). A n a l y s i s of the activating L y 4 9 / D A P 1 2 c o m p l e x e s h a s demonstrated that L y 4 9 receptor e n g a g e m e n t l e a d s to phosphorylation of the D A P 1 2 I T A M s a n d recruitment of the S y k / Z a p 7 0 tyrosine k i n a s e to the m e m b r a n e (Lanier et al. 1998). T h i s ultimately results in a signalling c a s c a d e that, in  13  Co-engagement of receptors  Activating receptor  Inhibitory Ly49 "  WlITAM  1 Activated Tyrosine kinases  Tyrosine Phosphorylated Substrates  Figure 1-3 M o d e l f o r Ly49-mediated inhibitory f u n c t i o n . U p o n activating a n d inhibitory receptor e n g a g e m e n t , the tyrosoine r e s i d u e s in the ITIMs of the inhibitory receptor b e c o m e phosphorylated and recruits S H P - 1 / 2 to the m e m b r a n e . T h e s e then prevent the phosphorylation of signalling m o l e c u l e s d o w n s t r e a m of the activation signal c a s c a d e thereby preventing activation of the N K cell, (figure a d a p t e d from A n d e r s o n et al. 2 0 0 1 )  14 the a b s e n c e of any inhibitory signals, e n d s with activation of the N K cell. After their initial characterisation, the evolutionary role of t h e s e receptors, w h i c h would a p p e a r to be antagonistic to the function of the inhibitory receptors, r e m a i n e d a mystery. R e c e n t l y it h a s b e e n d e m o n s t r a t e d that o n e of t h e s e activating receptors, L y 4 9 H , actually r e c o g n i s e s a viral protein from the M C M V a n d this recognition provides resistance to the virus (Daniels et a l . 2 0 0 1 ; D o k u n et al. 2 0 0 1 ; L e e et a l . 2 0 0 1 a ) . W h e t h e r the other activating receptors a l s o r e c o g n i s e specific p a t h o g e n s h a s not b e e n determined although other d i s e a s e - r e l a t e d loci, s u c h a s resistance to m o u s e pox virus ( R m p - 1 ) h a v e b e e n m a p p e d to the region of the N K C (Delano a n d Brownstein 1995).  1.4 Classes and families ofNK receptors A great d e a l of r e s e a r c h effort h a s b e e n e x p e n d e d s i n c e the d i s c o v e r y of N K cells to identify receptors w h i c h are e x p r e s s e d o n N K cells a n d to determine how they regulate N K cell activity. T h e result of this effort h a s b e e n a large a n d continually e x p a n d i n g n u m b e r of receptors w h e r e m a n y of the multigene families h a v e both inhibitory a n d activating v e r s i o n s of the receptors. All of the receptors c a n be divided broadly into the 2 superfamilies d e s c r i b e d below in section 1.4.1 a n d 1.4.2.  1.4.1 Lectin-like genes T h e first group are receptors that contain a c-type lectin-like d o m a i n in their extracellular d o m a i n . M e m b e r s of this superfamily are typically e x p r e s s e d a s dimeric type-2 t r a n s m e m b r a n e proteins with a carbohydrate recognition d o m a i n at their c a r b o x y terminus (Takei et a l . 1997; Lanier 1998). Although m e m b e r s of this family h a v e  15  Human NKC OS  tt  •x z  «  Bf  1  yi  -o  ON  DFECA  2Mb  Mouse NKC  QEXFD —  KHNIGLJMCA •  8.5 Mb  Figure 1-4 S c h e m a t i c diagrams of the m o u s e and human N K C regions, t h e centromeric a n d telomeric regions of the c h r o m o s o m e s are indicated, a s are s o m e , but not all, of the g e n e s identified in the g e n o m i c D N A in the region of the cluster. T h e s i z e of the g e n e clusters are indicated by the d i a g r a m s a n d g e n e s are not drawn to s c a l e . Information regarding g e n e arrangement a n d cluster s i z e w a s obtained from s o u r c e s a s d e s c r i b e d in chapter 3, (Hofer et a l . , 2001) a n d the H u m a n / M o u s e g e n o m e browser at U C S C (http://genome.ucsc.edu/)  16 similarity to other c-type (calcium-dependent) lectins, experimental e v i d e n c e from X - r a y crystallography h a s revealed that m a n y of t h e s e proteins lack a critical loop in their protein folds which is required for c a l c i u m binding (Boyington et a l . 1999; T o r m o et a l . 1999; W o l a n et a l . 2001). It is therefore likely that t h e s e receptors do not bind their ligands in a c a l c i u m - d e p e n d e n t m a n n e r and that, despite s e q u e n c e similarity to other C T L D proteins, the N K receptors likely r e c o g n i s e proteins rather than s u g a r s (Sawicki et a l . 2001). Early work on N K cell receptor biology had s h o w n that g e n e s e n c o d i n g a n u m b e r of lectin receptors e x p r e s s e d preferentially o n N K cells w e r e found in a cluster o n h u m a n c h r o m o s o m e 12 ( R e n e d o et a l . 1997) and o n a syntenic region of m o u s e c h r o m o s o m e 6 ( Y o k o y a m a and S e a m a n 1993; B r o w n et a l . 1997b). T h i s region w a s termed the Natural Killer g e n e cluster ( N K C ) a s a result of t h e s e findings. T h e N K C o c c u p i e s a region of approximately 2 M b p in h u m a n s and approximately 8.5 M b p in C 5 7 B L / 6 (B6) m i c e . Figure 1-4 s h o w s a s c h e m a t i c d i a g r a m of the h u m a n and m o u s e N K C regions.  A s u m m a r y of s o m e of the lectin-like receptors is s h o w n in table 1-1  w h e r e ligand, location, g e n e c o p y number, cell-type e x p r e s s i o n pattern and type of signalling are indicated w h e r e known. S c h e m a t i c d i a g r a m s of the receptors are s h o w n depicting signalling c o m p o n e n t s of the m o l e c u l e s a s well a s adaptor proteins. S e v e r a l of the better-characterised g e n e families are d i s c u s s e d in more detail below.  NKRP-1 T h e N K R P - 1 proteins are e x p r e s s e d on the surface of murine N K ( R y a n et a l . 1992) (in C 5 7 B L / 6 a s determined by NK1.1 staining) cells a n d a s u b s e t of T-cells (Ballas and R a s m u s s e n 1990; S y k e s 1990), while the single h u m a n g e n e is e x p r e s s e d o n only a s u b s e t of both N K and T-cells (Lanier et a l . 1994). In the m o u s e , both activating a n d inhibitory forms of t h e s e g e n e s are found (Plougastel et a l . 2001),  17 w h e r e a s in h u m a n s there is only a n inhibitory version of this g e n e (Lanier et a l . 1994). B e c a u s e of the e x p r e s s i o n pattern of t h e s e g e n e s in m i c e , they h a v e b e e n u s e d a s a marker of N K cells a s well a s for a small n u m b e r of cells known a s N K T cells, that e x p r e s s not only N K R P - 1 but a l s o a functional T C R (Biron a n d B r o s s a y 2 0 0 1 ; M a c D o n a l d 2002).  Although the natural ligand of Nkrp-1 in both m o u s e a n d h u m a n is u n k n o w n , studies have s h o w n that the activating forms of the murine receptor likely a s s o c i a t e with the FcsRIy activating adaptor chain through interactions with a c h a r g e d r e s i d u e s in the t r a n s m e m b r a n e d o m a i n s ( A r a s e et a l . 1997). T h e h u m a n N K R P - 1 protein is a b l e to interfere with activation signals a n d therefore is p r e s u m e d to act a s a n inhibitory receptor (Lanier et a l . 1994). H o w e v e r , b e c a u s e the h u m a n version of the g e n e h a s neither a n i m m u n o r e c e p t o r t y r o s i n e - b a s e d inhibitory motif (ITIM) nor a c h a r g e d a m i n o acid residue in its t r a n s m e m b r a n e d o m a i n , it is not clear how the inhibitory signal is generated.  The Ly49 gene family O n e of the first families of lectin N K receptors identified are e n c o d e d by the Ly49 g e n e s . Initially d e s c r i b e d a s a novel murine T-cell surface antigen ( C h a n a n d T a k e i 1989), the first L y 4 9 m o l e c u l e (Ly49a) w a s s u b s e q u e n t l y found to be e x p r e s s e d o h a s u b s e t of murine N K cells (Karlhofer et a l . 1992). C o n t i n u e d r e s e a r c h h a s led to the identification a n d cloning of other m e m b e r s of this multigene family (Brown et a l . 1 9 9 7 a ; M c Q u e e n et a l . 1998; W i l h e l m et a l . 2002), w h i c h allowed the d e v e l o p m e n t of h y p o t h e s e s regarding the function of t h e s e receptors.  Further experimental e v i d e n c e  u z z o.  J3  CN  u  3  fc  Z  T3  a "C < z  E  CO  it!  00  1  3  u z z  8  s  1  /  J3  o  a.  o  z z so  o  a.  SO  •a"  CO.  O  3  z  £' 2 m  z Cu  CN  3  91 CQ os  3  3 3  2  x  o  3  DC  Q  3  o o  o  00  •3  ca o o  3  00  3  SO  60  3 8  z  Ok  1 3°  Q. O  O  T A B L E 1-1 R E C E P T O R S OF T H E C - T Y P E LECTIN-LIKE  SUPERFAMILY  19 clearly illustrated that in m i c e , L y 4 9 receptors a r e involved in the recognition of distinct M H C c l a s s I m o l e c u l e s o n the surface of potential target cells a n d that this recognition controls N K cell activation (Karlhofer et a l . 1992; C o l o n n a a n d S a m a r i d i s 1995).  Early experiments illustrated that the ligands for at least s o m e of the L y 4 9 receptors w e r e indeed M H C c l a s s I m o l e c u l e s (Karlhofer et a l . 1992), although the receptors vary significantly in their ability to r e c o g n i s e different M H C c l a s s I haplotypes. T h i s finding a n d its implications a r e d i s c u s s e d further in section 1.5 w h i c h d e a l s with the M H C ligands for N K receptors.  Although the Ly49 family plays a significant role in murine N K cell biology, the s a m e is not true for h u m a n s . O n e of the most interesting findings in the initial characterisation of the g e n e s present in the N K C b e t w e e n s p e c i e s w a s that there w a s a significant e x p a n s i o n of the Ly49 g e n e s in m i c e , but not in h u m a n s . W h i l e there a r e o v e r 16 known Ly49 g e n e s in B 6 m i c e , there is only o n e Ly49 g e n e in h u m a n s that is a likely a p s e u d o g e n e a s a result of a splice site mutation in its fifth e x o n . T h i s rules out a similar function for Ly49 g e n e s in h u m a n s (Westgaard et a l . 1998). A s d i s c u s s e d later, the functional role of Ly49 receptors in h u m a n s is filled the by K I R receptors. T h e p r e s e n c e of a single c o p y Ly49 g e n e with multiple K I R g e n e s is not limited to h u m a n s but is a l s o true for c o w s ( M c Q u e e n et a l . , 2 0 0 2 ) while c a t s , d o g s a n d pigs a l s o h a v e single c o p y Ly49 g e n e s , although their K I R g e n e c o p y n u m b e r s a r e unknown (unpublished observations).  A n o t h e r interesting observation that h a s c o m e out of r e s e a r c h into Ly49 g e n e s , is that the g e n e n u m b e r a n d organisation vary significantly b e t w e e n s e v e r a l different  20 laboratory strains of mice (Takei et a l . 1997). A recent s e r i e s of studies of the Ly49 g e n e cluster of the 129/J m o u s e strain illustrated that, although the 1 2 9 / J a n d B 6 m o u s e strains both have similar n u m b e r s of g e n e s , their g e n o m i c organisation is quite distinct (Makrigiannis et a l . 2 0 0 1 ; Makrigiannis et a l . 2002). A s a result of multiple recombination a n d g e n e c o n v e r s i o n events, a s will be d i s c u s s e d in chapter 3, it is extremely difficult to identify g e n e s which are truly allelic b e t w e e n m o u s e strains. A n e x a m p l e of this complexity is given by examining the single Ly49i g e n e in 1 2 9 / J that has 9 4 % a m i n o acid identity to Ly49j a n d c a n d 9 5 % identity to Ly49i in B 6 (Makrigiannis et al. 2001). B e c a u s e the three B 6 g e n e s are all a result of recent g e n e duplication events, it is not clear that a m e a s u r e of s e q u e n c e identity, by itself, is sufficient to identify Ly49 alleles.  The CD94INKG2 family T h e CD94 g e n e w a s first identified in h u m a n s a s a protein w h o s e e x p r e s s i o n w a s restricted to h u m a n N K cells and a minor T lymphocyte s u b s e t a n d which w a s thought to operate a s a receptor for histocompatibility leukocyte antigen ( H L A ) B (Moretta et a l . 1994). S u b s e q u e n t work established that C D 9 4 f o r m e d a functional heterodimer with s e v e r a l of the neighbouring NKG2 g e n e s , a n d in fact w a s a receptor of the n o n - c l a s s i c a l H L A - E m o l e c u l e in h u m a n s (Braud et a l . 1998) (and the n o n - c l a s s i c a l Q a - 1 in m i c e ; V a n c e et a l . 1998), not H L A - B . b  H o m o l o g s of this g e n e family are  present in both h u m a n s a n d m i c e , located within the centromeric region of the N K C . T h e r e are 5 a n d 4 NKG2 g e n e s next to the CD94 g e n e in h u m a n s a n d B 6 mice respectively, with alternatively spliced forms of s e v e r a l g e n e s having b e e n given additional g e n e n a m e s .  T h e CD94 g e n e e n c o d e s a protein that forms a heterodimer with NKG2 m e m b e r s . T h e C D 9 4 protein itself h a s a very short c y t o p l a s m i c d o m a i n that l a c k s a n y signalling motifs ( C h a n g et a l . 1995; V a n c e et a l . 1997). H o w e v e r , b e c a u s e the NKG2 g e n e s d o not s e e m c a p a b l e of forming h o m o d i m e r s , CD94 e x p r e s s i o n is a requirement for the e x p r e s s i o n of heterodimers at the cell surface ( V a n c e et a l . 2002).  In both the h u m a n a n d m o u s e , the NKG2C a n d E g e n e s function a s activating receptors (Lazetic et a l . 1996; H o u c h i n s et a l . 1997; V a n c e et a l . 1999). Similar to other activating N K receptors, the h u m a n N K G 2 C / E proteins lack a n ITIM motif a n d instead h a v e a c h a r g e d residue in their putative t r a n s m e m b r a n e d o m a i n s . T h i s allows them to a s s o c i a t e with the D A P 1 2 molecule which signals in the s a m e m a n n e r a s previously d e s c r i b e d for the activating L y 4 9 m o l e c u l e s . In the c a s e of the murine NKG2 g e n e s , the activating N K G 2 C receptor l a c k s a n ITIM motif but a l s o d o e s not have a c h a r g e d residue for the recruitment of D A P 1 2 ( V a n c e et a l . 1999). It h a s b e e n postulated that the murine C D 9 4 , w h i c h h a s a c h a r g e d residue in its t r a n s m e m b r a n e d o m a i n ( V a n c e et al. 1997) m a y instead recruit D A P 1 2 in activating heterodimer c o m p l e x e s .  A s mentioned earlier, the ligand in both h u m a n s a n d mice for C D 9 4 / N K G 2 inhibitory receptors are n o n - c l a s s i c a l M H C c l a s s I m o l e c u l e s H L A - E a n d Q a - 1  b  respectively. T h e s e receptors are both non-polymorphic a n d widely e x p r e s s e d a n d both present peptides derived from the l e a d e r s e q u e n c e of c l a s s i c a l M H C c l a s s I m o l e c u l e s (Borrego et a l . 1998; K u r e p a et a l . 1998). T h e u s e of t h e s e a s ligands represents another level of sophistication in the behaviour of N K cell surveillance. B e c a u s e c l a s s i c a l M H C c l a s s I derived l e a d e r peptides are n e e d e d for the e x p r e s s i o n of H L A - E a n d Q a - 1 ( B a i et a l . 1998; L e e et a l . 1998b), it provides N K cells with a b  22  method for indirectly surveying e x p r e s s i o n levels of c l a s s i c a l M H C C l a s s I g e n e s . If v i r u s e s down-regulate e x p r e s s i o n of c l a s s i c a l M H C c l a s s I receptors a n d e x p r e s s d e c o y receptors, the lack of leader s e q u e n c e s will result in a d e c r e a s e in C D 9 4 / N K G 2 inhibitory signalling a n d lead to N K cell activation. T h e r e m a y be m a n y other m e t h o d s in which the i m m u n e s y s t e m attempts to circumvent pathogenic d e f e n c e s through interaction with host N K receptors. A recent reported s h o w e d that the signal peptide derived from the heat s h o c k protein (hsp) 60 protein c a n bind to H L A - E a n d interfere with C D 9 4 / N K G 2 A binding ( M i c h a e l s s o n et a l . 2002). B e c a u s e this protein is s t r e s s i n d u c e d , it could signal to N K cells w h e n cells that h a v e normal M H C c l a s s I e x p r e s s i o n have become compromised.  T h e e x p r e s s i o n of CD94/NKG2  heterodimers is not limited to N K cells. T h e y  also e x p r e s s e d o n C D 8 T-cells ( C a r e n a et a l . 1997) a s well a s o n murine N K T cells +  (Takei et a l . 2001). Interestingly, studies have s h o w n that the e x p r e s s i o n of inhibitory receptors o n T-cells c a n inhibit T C R signalling during infections ( M o s e r et a l . 2002). W h e n mice s u s c e p t i b l e to the highly o n c o g e n i c p o l y o m a virus are infected, mature antiviral C D 8 T-cells b e c o m e highly e x p a n d e d , but exhibit a gradual reduction in cytotoxic +  behaviour. T h i s correlates with the up-regulation of C D 9 4 / N K G 2 A heterodimers in t h e s e T - c e l l s . T h e in vivo functions of cells other than N K c a n therefore be influenced by the e x p r e s s i o n of N K receptors, e v e n if the activating signalling p a t h w a y s blocked differ, although this effect is not universal (Miller et a l . 2002).  NKG2D A l t h o u g h NKG2D is located between CD94 a n d the other NKG2 g e n e s in both h u m a n a n d m o u s e , it differs significantly in its structure, e x p r e s s i o n a n d function. T h e  23 NKG2D g e n e s in h u m a n s a n d mice h a v e 13 a n d 10 e x o n s respectively a s c o m p a r e d to the 7 present in other NKG2 g e n e s ( V a n c e et a l . 1997; G l i e n k e et a l . 1998). T h e protein c o d e d by the g e n e is a l s o highly divergent from other m e m b e r s of the NKG2s having only 2 1 % a m i n o acid identity with the c l o s e s t s e q u e n c e in the c a s e of the h u m a n g e n e ( H o u c h i n s et a l . 1991).  R e c e n t l y work h a s identified the ligands for both the h u m a n a n d the m o u s e NKG2D a n d has greatly improved our understanding of the role of this receptor. NKG2D is e x p r e s s e d a s an alternatively s p l i c e d h o m o d i m e r w h e r e the o p e n reading f r a m e s are identical e x c e p t for a b s e n c e of the last 13 a m i n o acid r e s i d u e s at the a m i n o terminus in the short form of the protein ( N K G 2 D - S ) ( D i e f e n b a c h et a l . 2002). W h e r e a s the long form ( N K G 2 D - L ) a s s o c i a t e s exclusively with D A P 1 0 , N K G 2 D - S a s s o c i a t e s with both D A P 10 a n d D A P 1 2 . B e c a u s e the cytoplasmic d o m a i n of NKG2D lacks signalling motifs, t h e s e are instead sent through the I T A M a n d activating s e q u e n c e in D A P 1 2 a n d D A P 1 0 respectively, w h i c h results in the recruitment of PI-3 k i n a s e a n d s u b s e q u e n t activation signalling ( C h a n g et a l . 1999). T h e murine N K G 2 D is e x p r e s s e d o n nearly all N K cells a n d its ligands are H 6 0 , R A E - 1 a n d M u l t l ( C e r w e n k a et a l . 2 0 0 0 ; D i e f e n b a c h et a l . 2000). In the c a s e of the h u m a n g e n e , the ligands h a v e b e e n found to be the stress-inducible M H C c l a s s I chain-related (MIC) A a n d B ( B a u e r et a l . 1999; Steinle et al. 2001). Both of t h e s e M H C c l a s s l-like m o l e c u l e s are under the control of heat s h o c k promoter e l e m e n t s that c a n be induced by either cellular stress or viral infection. Target cells that e x p r e s s the M I C A / B ligands have b e e n found to b e highly s u s c e p t i b l e to lysis by N K G 2 D - m e d i a t e d killing. W h i l e the m o u s e ligands are not known to b e i n d u c e d by cellular s t r e s s , it is p o s s i b l e that s o m e other pathogenic condition might induce their e x p r e s s i o n . T h e h u m a n a n d m o u s e N K G 2 D receptors a l s o bind to another c l a s s of  proteins called U L - 1 6 binding proteins ( U L B P 1 - 2 ) ( C o s m a n et a l . 2 0 0 1 ; C a r a y a n n o p o u l o s et a l . 2002). A s indicated by their n a m e s , t h e s e proteins bind the H C M V a n d M C M V e n c o d e d U L - 1 6 proteins respectively. T h e function of the U L B P proteins is unknown but they are thought to act a s m a r k e r s of transformed or virally infected cells.  1.4.2 Immunoglobulin receptors T h e s e c o n d major c l a s s of N K receptors belong to the immunoglobulin superfamily (IgSF). Similar to the lectin-like receptors, e x a m p l e s of receptors in this c l a s s c a n be found in both mice a n d h u m a n s , although, in a situation a n a l o g o u s to the Ly49 g e n e s in m i c e , there has b e e n a e x p a n s i o n of m e m b e r s of this superfamily in primates a s well a s in the c o w (Martin et a l . 2 0 0 0 ; T r o w s d a l e et a l . 2 0 0 1 ; M c Q u e e n et al. 2002).  IgSF receptors all s h a r e a similar structure of b e t w e e n 1 a n d 7 repeated  immunoglobulin (Ig) d o m a i n s with ITIM signalling motifs in their c y t o p l a s m i c d o m a i n reviewed in (Trowsdale et a l . 2 0 0 1 ; B o r r e g o et a l . 2 0 0 2 ; V i l c h e s a n d P a r h a m 2002). A l s o similar to the L y 4 9 m o l e c u l e s , s o m e IgSF receptors lack a n y signalling motifs in their c y t o p l a s m i c d o m a i n s but have c h a r g e d amino acid residues in their t r a n s m e m b r a n e region. T h e s e receptors a s s o c i a t e with the h u m a n D A P 1 2 m o l e c u l e a n d act a s activating receptors in a m a n n e r similar to that d e s c r i b e d previously for the lectin-like receptors (Moretta et a l . 1995; B i a s s o n i et a l . 1996).  M a n y IgSF g e n e s are found in a tight cluster o n h u m a n c h r o m o s o m e 19q13.4 in a region termed the leukocyte receptor c o m p l e x ( L R C ) ( W a g t m a n n et a l . 1997; W e n d e et a l . 1999) a n d a s c h e m a t i c representation of the cluster is s h o w n in figure 1-5.  L R C - related g e n e s  #  $  #  LRC  / / / /  /  /#  %-» iimiiiiHm -twtfftf» 4-11III11 II mm imiiiiii \ 11  Figure 1-5 The h u m a n leukocyte receptor c o m p l e x ( L R C ) . T h e s i z e for the L R C is approximately 9 0 0 kb a n d is not drawn to s c a l e . T h i s figure w a s a d a p t e d from T r o w s d a l e et al. 2 0 0 1 .  Although murine N K cells s e e m to predominantly u s e the lectin-like receptors, there are s e v e r a l IgSF g e n e s o n m o u s e c h r o m o s o m e 7 w h i c h is the syntenic region of h u m a n c h r o m o s o m e 19q13.4 ( Y a m a s h i t a et a l . 1998a). Interestingly, the murine paired immunoglobulin-like receptor (PIR) multigene family found here is not e x p r e s s e d in T or N K cells but is restricted to myeloid a n d B-cells ( H a y a m i et a l . 1997; K u b a g a w a et a l . 1997). T a b l e 1-2 s u m m a r i e s the features of several murine a n d h u m a n g e n e s in this family.  The Killer Cell Immunoglobulin-like receptor (KIR) genes  O n e of the main groups of N K receptors in h u m a n s includes m e m b e r s of the killer cell immunoglobulin-like receptor (KIR) multigene family. T h e K I R g e n e s are primarily classified by the n u m b e r immunoglobulin d o m a i n s that are in the extra-cellular portion of the protein that varies from 1 to 3 (Hsu et a l . 2 0 0 2 ; V i l c h e s a n d P a r h a m 2002). T h e K I R receptors have b e e n found to be the functional equivalent of the Ly49 g e n e s in m i c e , recognising various M H C c l a s s I alleles that result in inhibitory signals being generating in the N K cell (reviewed in V i l c h e s a n d P a r h a m 2002). W h i l e the majority of K I R receptors r e c o g n i s e H L A - C m o l e c u l e s , the 2 D L 4 , 3 D L 1 a n d 3 D L 2 r e c e t o r s r e c o g n i s e H L A - G , H L A - B a n d H L A - A respectively (Vilches a n d P a r h a m K  2002). T h e r e are o v e r 13 K I R g e n e s that have b e e n identified to date, with o v e r 80 alleles a m o n g s t all of the g e n e s (Trowsdale et a l . 2001). A s s u c h , the K I R g e n e s represent a highly polymorphic g e n e family that vary not only in s e q u e n c e between individuals, but a l s o in total g e n e content. T h e s e findings support a p r o p o s e d model of g e n e organisation w h e r e certain K I R g e n e s are invariant, termed a n c h o r loci, while others vary in their p r e s e n c e between individuals (Uhrberg et a l . 1997). A s d i s c u s s e d  27  Q Pi  3  S  NO  E E  s  ULTUFI  1  cn  3  3J  CN  a*  uuof  ON  Q  ©  Q  CT  Os  CN  2  ^3  ON  3  u  u  ON  II  uulr  .3 s s s s  3  .o  3  o  60  o  60  g s  o 3  3  o •5 o o  3  3  c  sis 3*  O 3  o  u  60  ft W  3 ° 2  o  bo  s .£P  T A B L E 1-2 R E C E P T O R S OF THE I M M U N O G L O B U L I N  8 3 ffi  <L> »>  3 ° 2  8 3 8 §  W "60  60  c: o 3 3  S  o  o  1 o  3  cn  3  8  o  ft  <L> «>  o  ft o U  ft  W  SUPERFAMILY  •s CO 60  28 below, the organisation of haplotypes in h u m a n s a p p e a r s to be more c o m p l e x than originally b e l i e v e d .  Initial characterisation of the KIR g e n e s in the h u m a n population s u g g e s t e d that there w e r e two main haplotype g r o u p s , A a n d B, w h e r e haplotype B had s e v e r a l more activating receptors than A (Uhrberg et al. 1997; W i l s o n et a l . 2000). T h e s e studies w e r e e n h a n c e d by the s u b s e q u e n t a n a l y s i s of the K I R content in large pedigree families. A more accurate model now s u g g e s t s that there are in fact 6 main haplotypes derived from regions representing 3 partial haplotypes. Of t h e s e 6 haplotypes, o n e is the previously d e s c r i b e d A type (which is present in approximately 5 0 % of the C a u c a s i a n population) a n d the others are variants of the B haplotype (Hsu et a l . 2002). T h e majority of the variability s e e n in the g e n e content is in the telomeric half of the cluster, w h i c h c a n be divided into 2 of the 3 partial haplotypes d e s c r i b e d .  Interestingly,  the variability s e e n in the C a u c a s i a n population is not unique, a s studies of various ethnic populations from geographically isolated or distinct populations including north Indian H i n d u s , J a p a n e s e , P a l e s t i n i a n s , and T h a i s h a v e s h o w n similar variation in K I R haplotypes ( N o r m a n et a l . 2 0 0 1 ; R a j a l i n g a m et a l . 2 0 0 2 ; Y a w a t a et a l . 2002). S t u d i e s of the K I R g e n e s in other primates have s h o w n that although the g e n e type a n d g e n e r a l arrangement is c o n s e r v e d , the g e n e s t h e m s e l v e s are structurally distinct between s p e c i e s . O u r laboratory h a s recently s h o w n that multi-copy K I R s a l s o exist in c o w s ( M c Q u e e n et a l . 2002), while L y 4 9 receptors a p p e a r to be single c o p y g e n e s e x c e p t in rodents. It is interesting to note however, that in s e v e r a l primate s p e c i e s , the single Ly49 c o p y a p p e a r s to be coding competent ( M a g e r et a l . 2 0 0 1 ) , though whether or not it h a s any biological role h a s not b e e n tested.  29 S e v e r a l activating K I R g e n e s have b e e n identified w h i c h lack a long c y t o p l a s m i c d o m a i n a n d h a v e a c h a r g e d residue in their t r a n s m e m b r a n e d o m a i n (Moretta et a l . 1995; B i a s s o n i et a l . 1996). T h e ligands for s e v e r a l of t h e s e g e n e s h a v e b e e n identified a s being H L A - C , h o w e v e r the 2 D S 4 a n d 2 D S 5 g e n e s have no identified ligands. It is u n c l e a r what t h e s e activating K I R s are recognising a n d therefore w h e t h e r they might function in a similar m a n n e r to activating L y 4 9 s in recognising peptides from pathogens. E v e n if the activating receptors d o interact with M H C c l a s s I m o l e c u l e s , they m a y h a v e the capacity to r e c o g n i s e other non-cellular ligands in a f a s h i o n similar to N K G 2 D ( R a d a e v et a l . 2002).  The immunoglobulin-like transcript (ILT) genes T h e L R C region a l s o contains s e v e r a l other g e n e s distantly related to the K I R . T h e s e g e n e s are called immunoglobulin-like transcripts (ILT) (also known a s leukocyte Ig-like receptors (LIR) or M o n o c y t e / m a c r o p h a g e inhibitory receptors MIR) a n d are found in two c l o s e l y s p a c e d clusters which a p p e a r to have formed through a s e r i e s of duplication events, a n a l o g o u s to t h o s e d e s c r i b e d for the Ly49 g e n e s in chapter 4 (Volz et a l . 2 0 0 1 ; Y o u n g et a l . 2001). T h e ILT g e n e s e n c o d e proteins that contain between 2 a n d 4 Ig-like d o m a i n s in their extracellular d o m a i n a n d both inhibitory a n d putative activating forms of ILT g e n e s have b e e n c l o n e d (Volz et a l . 2001). Despite their proximity to the K I R g e n e s , the e x p r e s s i o n pattern of the ILT g e n e s is significantly different with most the g e n e s being e x p r e s s e d on mature B-cells a n d m o n o c y t e s . H o w e v e r s e v e r a l g e n e s , including ILT2, 3 a n d 6, are e x p r e s s e d in cytotoxic T a n d N K cells ( S a m a r i d i s a n d C o l o n n a 1997; W a g t m a n n et a l . 1997; T o r k a r et al. 1998)  O f the 13 identified ILT g e n e s , over 50 alleles h a v e s o far b e e n identified, but most of t h e s e alleles have b e e n identified from c D N A s that are believed to be from p s e u d o g e n e s (Volz et a l . 2001). Unlike the K I R g e n e s , the intron a n d intergenic s i z e s are not similar between ILT g e n e s a n d only o n e of the g e n e s , ILT6, a p p e a r s to be polymorphic in its p r e s e n c e or a b s e n c e from haplotypes (Torkar et a l . 2000). T h e s e features, a s well a s the g e n o m i c organisation of the ILTs, s u g g e s t that they are older than the K I R g e n e s a n d may, therefore, represent orthologs of the m o u s e P I R g e n e s d i s c u s s e d below (Trowsdale et a l . 2001). In support of the theory that ILT g e n e s are widely distributed a m o n g s p e c i e s , zoo-blot a n a l y s i s of various a n i m a l s s u g g e s t s that ILT-like g e n e s existed in the last c o m m o n a n c e s t o r between birds a n d h u m a n s approximately 3 0 0 million y e a r s a g o (Volz et a l . 2001).  O f all of the ILT g e n e s , only two have b e e n found to r e c o g n i s e H L A m o l e c u l e s . ILT2 a n d ILT4, both inhibitory receptors, r e c o g n i s e H L A - G a n d H L A - F ( B o r g e s et a l . 1997; C o s m a n et a l . 1997; L e p i n et a l . 2000) respectively with ILT2 a l s o exhibiting broad H L A c l a s s I specificity (Vitale et a l . 1999). T h e lack of defined biological ligands represents a n o b v i o u s difficulty in determining a functional role for the ILT receptors. It m a y be that the ILT locus simply provided the starting material from which the K I R g e n e s w e r e formed a n d that its functional significance h a s s i n c e d i m i n i s h e d . T h e high p e r c e n t a g e of p s e u d o g e n e s in the family, along with the e x i s t e n c e of at least o n e m e m b e r of the family, ILT6, which lacks a t r a n s m e m b r a n e d o m a i n a n d is s e c r e t e d a s a result (and would therefore lack any cellular function) (Volz et a l . 2001), is consistent with this theory.  31  The paired immunoglobulin-like receptors (PIR) genes T h e 8 murine P I R g e n e s are found near the centromere o h c h r o m o s o m e 7 in a region that is syntenic to h u m a n c h r o m o s o m e 19q13.4 (the L R C ) ( Y a m a s h i t a et al. 1998a). T h e P I R g e n e s were originally isolated in a s e a r c h for h o m o l o g s to the h u m a n F c receptor family m e m b e r s and consequently belong to the s a m e Ig superfamily ( H a y a m i et al. 1997; K u b a g a w a et al. 1997). O f the 8 P I R g e n e s , 7 are activating forms ( P I R A 1 - 7 ) while only o n e , PIR-B, is an inhibitory form (Takai and O n o 2001). T h e P I R g e n e s h a v e b e e n found to be e x p r e s s e d in B-cells a n d cells of the myeloid lineage, and the e x p r e s s i o n of t h e s e g e n e s is regulated s u c h that both activating and inhibitory forms of the receptors are e x p r e s s e d in the s a m e cell ( K u b a g a w a et al. 1997).  T h e PIR-B m o l e c u l e h a s 4 ITIM motifs in its cytoplasmic d o m a i n w h i c h , w h e n phosphorylated, c a n recruit S H P - 1 and block d o w n s t r e a m activation signals in a similar m a n n e r to other inhibitory receptors ( M a e d a et al. 1998). T h e activating forms of the P I R h a v e a c h a r g e d residue in their t r a n s m e m b r a n e d o m a i n which allows a s s o c i a t i o n with F c R signalling c o m p o n e n t s allowing activation signals to be generated ( Y a m a s h i t a et al. 1998b). Like the ILTs, with which they s h a r e « 6 7 % identity in their extracellular region (Volz et al. 2001), P I R s h a v e no identified biological ligands. G i v e n the e v i d e n c e that the PIR-B m o l e c u l e is constitutively phosphorylated w h e n e x p r e s s e d (implying constitutive ligation with its ligand) (Ho et al. 1999) and the fact that P I R e x p r e s s i o n is down-regulated in B2m-deficient mice (but not T A P 1 or M H C c l a s s II deficient mice), it h a s b e e n s u g g e s t e d that the P I R ligands m a y be n o n c l a s s i c a l M H C c l a s s I m o l e c u l e s (Takai and O n o 2001).  32  1.5 MHC class I ligands ofNK receptors T h e earliest experiments that identified a link b e t w e e n M H C c l a s s I e x p r e s s i o n a n d sensitivity of cells to lysis by N K cells established the framework for understanding the role of N K cells in the immune s y s t e m (Ljunggren a n d K a r r e 1 9 8 5 ; Piontek et a l . 1985). W h a t w a s not appreciated at the time w a s the inherent complexity of the recognition s y s t e m s which N K cells h a v e b e e n found to u s e .  T h e major histocompatibility c o m p l e x g e n e s (termed H u m a n L e u k o c y t e Antigen ( H L A ) in h u m a n s a n d H-2 in mice) are found in a large cluster, along with n u m e r o u s other M H C - r e l a t e d g e n e s a n d those required for antigen p r o c e s s i n g , on c h r o m o s o m e 6 in h u m a n a n d c h r o m o s o m e 17 in the m o u s e ( J a n e w a y a n d T r a v e r s 1997). T h e M H C receptors c a n be divided into two c l a s s e s of g e n e s , those e n c o d i n g M H C c l a s s I m o l e c u l e s which present e n d o g e n o u s l y derived peptides to C D 8  +  cells a n d those  e n c o d i n g M H C c l a s s II m o l e c u l e s which present e x o g e n o u s l y derived peptides o n the surface of antigen presenting cells. T h e M H C c l a s s I g e n e s c a n be further divided into t h o s e e n c o d i n g c l a s s i c a l or n o n c l a s s i c a l m o l e c u l e s , w h e r e n o n c l a s s i c a l g e n e s lack the high level of p o l y m o r p h i s m s e e n with the c l a s s i c a l a n d h a v e a more restricted e x p r e s s i o n pattern than c l a s s i c a l ( J a n e w a y a n d T r a v e r s 1997).  T h e structure of M H C I m o l e c u l e s a n d the p r o c e s s of antigen display by M H C c l a s s I m o l e c u l e s for effector cell recognition are extensively reviewed e l s e w h e r e (Trowsdale 1 9 9 3 ; Natarajan et a l . 1999; T h o r s b y 1999) a n d will not be d i s c u s s e d in detail here. Figure 1-6 s h o w s a diagrammatic representation of an M H C c l a s s I m o l e c u l e c o m p l e x e d with the p 2 m molecule. T h i s figure a l s o presents a c o m p a r i s o n of  indirect recognition  1  i  direct recognition  1  Figure 1-6 Structure of M H C I molecule and antigen p r o c e s s i n g pathway A ) Diagramatic representation of a n M H C c l a s s I m o l e c u l e c o m p l e x e d with a p 2 m m o l e c u l e . A l s o s h o w n is the peptide binding grove b e t w e e n the a1 a n d a 2 d o m a i n s w h e r e peptides are displayed to effector cells. B) C o m p a r i s o n of antigen presentation pathways by c l a s s i c a l a n d n o n c l a s s i c a l M H C c l a s s I m o l e c u l e s in h u m a n s a n d mice a n d their respective receptors, (part B a d a p t e d from R a u l e t et a l , 2 0 0 1 )  34 antigen p r o c e s s i n g pathways for h u m a n a n d m o u s e c l a s s i c a l a n d n o n c l a s s i c a l M H C c l a s s I m o l e c u l e s . W h e n M H C c l a s s I ligands w e r e first identified a s ligands for N K receptors which control N K cell activation, n u m e r o u s questions a r o s e , given what w a s already known about M H C function. O n e of the primary o n g o i n g q u e s t i o n s is which receptors r e c o g n i s e which polymorphic M H C c l a s s I m o l e c u l e s . S e v e r a l studies h a v e a d d r e s s e d this question a n d , in the c a s e of both h u m a n s a n d m i c e , it s e e m s there is a wide range in receptor specificity.  M H C c l a s s I recognition by L y 4 9 receptors h a s b e e n a n a l y s e d by s e v e r a l groups ( M a s o n et a l . 1 9 9 5 ; B r e n n a n et a l . 1996; G e o r g e et a l . 1999; H a n k e et a l . 1999). S o m e receptors s u c h a s L y 4 9 A a n d C a p p e a r to r e c o g n i s e a wide range of M H C c l a s s I haplotypes, other receptors s u c h a s L y 4 9 D a n d F a p p e a r to be far more restricted. S e v e r a l other L y 4 9 s s u c h a s L y 4 9 B , Q , E , X , d o not r e c o g n i s e a n y M H C c l a s s I m o l e c u l e s yet tested. T h e situation is complicated by the recent finding that s o m e L y 4 9 m o l e c u l e s , both activating a n d inhibitory, r e c o g n i s e virally e n c o d e d ligands (Daniels et al. 2 0 0 1 ; D o k u n et a l . 2 0 0 1 ; L e e et a l . 2001 a ; A r a s e et a l . 2002). T h e lack of binding to M H C c l a s s I ligands d o e s not, therefore, imply that the receptor l a c k s a function. A similar range in receptor binding h a s b e e n o b s e r v e d for the polymorphic K I R receptors in h u m a n s ( C i c c o n e et a l . 1992; W a g t m a n n et a l . 1995; Winter et a l . 1998). Although there is e v i d e n c e that the recognition of M H C c l a s s I m o l e c u l e s by L y 4 9 A a n d C ( C o r r e a a n d Raulet 1995; Orihuela et a l . 1996; F r a n k s s o n et a l . 1999) C D 9 4 / N K G 2 A in mice (Kraft et a l . 2 0 0 0 ) a n d K I R s in h u m a n s ( P e r u z z i et a l . 1996; R a j a g o p a l a n a n d L o n g 1997; reviewed in R e y b u r n et a l . 1997a) is d e p e n d e n t upon the p r e s e n c e of bound peptide, it is unclear if the recognition of the M H C c l a s s I is in all c a s e s peptide specific.  35 A s illustrated in figure 1.6, the n o n c l a s s i c a l M H C c l a s s I m o l e c u l e s H L A - E a n d Q a - 1  b  present a peptide derived from the l e a d e r s e q u e n c e of c l a s s i c a l M H C c l a s s I m o l e c u l e s .  1.6 The expression patterns of Natural killer cell receptors T h e e x p r e s s i o n pattern of murine N K receptors h a s b e e n well studied w h e r e a s similar information is not yet available for h u m a n receptors d u e in part to experimental constraints. In the c o u r s e of murine hematopoietic d e v e l o p m e n t w h e n immature definitive N K cells first a p p e a r , virtually all of t h e s e cells have b e e n found to e x p r e s s C D 9 4 / N K G 2 heterodimers ( S a l c e d o et a l . 2000), a s well a s N k r p 1 - C that is r e c o g n i s e d by the NK1.1 antibody (Kim et a l . 2002). Ly49 e x p r e s s i o n , e x c e p t for Ly49e ( V a n B e n e d e n et a l . 2 0 0 1 ; V a n B e n e d e n et a l . 2002), d o e s not begin until shortly after birth, w h e n t h e s e receptors a r e first detectable by F A C S a n a l y s i s (Dorfman a n d Raulet 1998). Interestingly while Ly49 f r e q u e n c i e s have r e a c h e d adult levels by approximately 4 0 d a y s after birth ( S i v a k u m a r e t a l . 1997; Dorfman a n d Raulet 1998), C D 9 4 / N K G 2 f r e q u e n c i e s actually d e c r e a s e significantly to the level o b s e r v e d in adult mice (Kubota et a l . 1999; V a n c e et a l . 2002). T h e m e c h a n i s m s for this c h a n g e in e x p r e s s i o n patterns is not clear, although the gradual e x p r e s s i o n of L y 4 9 receptors that c a n r e c o g n i s e specific M H C c l a s s I alleles a s o p p o s e d to C D 9 4 / N K G 2 heterodimers which indirectly s u r v e y all c l a s s i c a l M H C c l a s s I e x p r e s s i o n would p r e s u m a b l y h a v e a n evolutionary benefit.  T h e e x p r e s s i o n of C D 9 4 / N K G 2 receptors is believed to be a n e c e s s a r y c o m p o n e n t of a self-tolerance m e c h a n i s m for N K cells during fetal d e v e l o p m e n t ( S i v a k u m a r et a l . 1999; T o o m e y et a l . 1999). T h e hypothetical o u t c o m e of the circulation of N K cells that d o not e x p r e s s inhibitory receptors would be w i d e s p r e a d  36 lysis of normal cells. A recently published report of a strain of inbred mice ( D B A 2 / J ) which lacks e x p r e s s i o n of a full length CD94 transcript (and therefore all functional C D 9 4 / N K G 2 heterodimers) revealed that e v e n in the a b s e n c e of C D 9 4 / N K G 2 heterodimers o n fetal N K cells, self-tolerance is maintained ( V a n c e et a l . 2002). T h i s s u g g e s t s that there are either more inhibitory receptors e x p r e s s e d on fetal N K cells than are currently k n o w n , or that N K cells c a n be e d u c a t e d during d e v e l o p m e n t to tolerate a lack of inhibitory signalling. E v i d e n c e supporting the later hypothesis h a s b e e n s h o w n in the c a s e of m i c e a n d h u m a n s w h o lack M H C c l a s s I e x p r e s s i o n d u e to e x p r e s s i o n defects in either T A P proteins or the p m m o l e c u l e . In t h e s e c a s e s , the respective 2  a n i m a l s d e v e l o p normally, although with a widely variable level of immunodeficiency (Raulet 1994; Arkwright et a l . 2002). T h e N K cells of the mice e x p r e s s L y 4 9 receptors at f r e q u e n c i e s similar to those in the wild-type a n d display self-tolerance to self cells (Liao et a l . 1 9 9 1 ; S a l c e d o et a l . 1997).  Interestingly, although N K cells from  T a p T p 2 m T mice do not lyse lymphoblasts generated from p2m7" mice, cytolytic activity of the N K cells against self cells, but not blasts from B 6 mice e x p r e s s i n g M H C c l a s s I, c a n be restored by ex-vivo culturing in the p r e s e n c e of IL-2 ( S a l c e d o et a l . 1998). O n the b a s i s of the available e v i d e n c e , it is c l e a r that CD94/NKG2  e x p r e s s i o n is not  required for self-tolerance in d e v e l o p i n g mice; however, the lack of e x p r e s s i o n of t h e s e receptors might lead to an i n c r e a s e d susceptibility to p a t h o g e n s during gestation if the host N K cells are h y p o r e s p o n s i v e .  T h e r e is at least o n e notable exception to the g e n e r a l L y 4 9 receptor e x p r e s s i o n pattern, a n d that is Ly49e ( V a n B e n e d e n et al. 2001). A s will be d i s c u s s e d in C h a p t e r 3, this g e n e is located at the far centromeric region of the Ly49 cluster a n d is, along with Ly49q, s e p a r a t e d from the rest of the Ly49 g e n e s by a large stretch of highly repetitive  37 DNA.  Both F A C S a n a l y s i s a n d R T - P C R h a v e s h o w n that Ly49e is e x p r e s s e d o n fetal  N K cells ( V a n B e n e d e n et a l . 2001). W h e t h e r the e x p r e s s i o n of Ly49e o n fetal N K cells is e v i d e n c e to support the notion that other receptors m a y maintain self-tolerance in the a b s e n c e of C D 9 4 / N K G 2 is not c l e a r a s L y 4 9 E h a s no identified ligand. N o information has b e e n published on the e x p r e s s i o n pattern of Ly49q that is in c l o s e proximity to Ly49e or for Ly49b that is approximately 8 0 0 kb telomeric of the cluster. Both of t h e s e g e n e s are highly divergent from all the other Ly49 g e n e s a n d , therefore, it would not be surprising to find that their e x p r e s s i o n patterns, a n d indeed their biological roles, differ from that of the other Ly49 g e n e s .  1.6.1 Ly49 transcriptional regulation Of the murine N K receptors, the best c h a r a c t e r i s e d are the m e m b e r s of the Ly49 g e n e family. T h e a n a l y s i s of bulk populations of N K cells h a s revealed that e a c h Ly49 g e n e e x a m i n e d is e x p r e s s e d at a consistent a n d characteristic f r e q u e n c y in a proportion of N K cells that r a n g e s from 5 % to approximately 6 0 % (reviewed in S i v a k u m a r et a l . 1998; K u b o t a et a l . 1999). A study of Ly49 g e n e e x p r e s s i o n in individual N K cells e x a m i n e d by R T - P C R h a s s h o w n that there is significant heterogeneity from cell to cell in w h i c h Ly49 g e n e s are transcribed (Kubota et a l . 1999). T h i s a n a l y s i s a l s o illustrated that the f r e q u e n c y of receptor c o - e x p r e s s i o n c a n be calculated from the product of the f r e q u e n c i e s of the individual receptors (Kubota et a l . 1999). T h i s result supports the hypothesis that the e x p r e s s i o n of e a c h receptor is regulated independently of a n y other. A s u b s e q u e n t report provided e v i d e n c e b a s e d o n F A C S a n a l y s i s that this theory might not be true for the c o - e x p r e s s i o n of activating receptors, a s L y 4 9 D a n d H w e r e s h o w n to be c o - e x p r e s s e d at a significantly higher level than would be predicted by the product of their individual e x p r e s s i o n probabilities (Smith et a l . 2000). Furthermore, the single cell  a n a l y s i s did not detect cells which l a c k e d all known receptors. T h i s finding s u g g e s t s a model for the r a n d o m and continued activation of Ly49 g e n e s until a receptor for selfM H C is e x p r e s s e d . T h e merits of s u c h a model are d i s c u s s e d later.  T h e e x p r e s s i o n of individual murine Ly49 g e n e s h a s a l s o b e e n found to be mono-allelic; however, there is no bias against the e x p r e s s i o n of different Ly49 g e n e s from both c h r o m o s o m e s (Held and Raulet 1 9 9 7 a ; Held and K u n z 1998). Although the e x p r e s s i o n of a single Ly49 g e n e simultaneously from both alleles is quite rare, it h a s b e e n experimentally o b s e r v e d (Held and Raulet 1997a), s u g g e s t i n g that this e x p r e s s i o n pattern is not regulated with the s a m e rigidity a s the allelic e x c l u s i o n exhibited by the T C R genes.  N o definitive m e c h a n i s m for mono-allelic Ly49 e x p r e s s i o n h a s yet b e e n  p r o p o s e d ; however, general s c h e m e s that rely on a rate limiting trans-acting factor required for initiation of g e n e e x p r e s s i o n have b e e n s u g g e s t e d to explain the o b s e r v e d patterns (Held and K u n z 1998). T h e r e is e v i d e n c e from T C F - 1 7 " m i c e , d i s c u s s e d later, to s u g g e s t that s u c h a m e c h a n i s m m a y be u s e d for s o m e , but not all, of the Ly49. g e n e s . A n a l y s i s of transgenic mice e x p r e s s i n g the Ly49a g e n e in all cells indicates that there is a f e e d b a c k m e c h a n i s m to block e x p r e s s i o n of the e n d o g e n o u s Ly49a alleles (Held a n d Raulet 1997b). W h i l e this d o e s indicate that signalling events though a specific receptor c a n alter the cell surface e x p r e s s i o n of other receptors, this p r o c e s s w a s found to be post-transcriptional and d o e s not contradict the model of initiation of L y 4 9 e x p r e s s i o n being regulated by the rate-limiting a s s e m b l y of transcript initiation c o m p l e x e s . Finally, a similar pattern of mono-allelic e x p r e s s i o n h a s b e e n o b s e r v e d for the murine NKG2A g e n e ( V a n c e et a l . 2002), demonstrating that this m e c h a n i s m of g e n e activation m a y apply broadly to all N K C g e n e s .  39 In a n attempt to a n a l y s e the m e c h a n i s m s behind the acquisition of Ly49 e x p r e s s i o n by Ly49" precursor cells, s e v e r a l g r o u p s performed ex vivo differentiation e x p e r i m e n t s to determine if there is a n order in w h i c h Ly49s begin to be e x p r e s s e d . U s i n g a culturing systerrfof b o n e marrow stromal cells to i n d u c e Ly49 e x p r e s s i o n in clonal b o n e marrow progenitor cells, R a u l e t ' s group found that a n order of g e n e activation could be d e d u c e d a s Ly49a, Ly49/7NK1.1, followed by Ly49g/i a n d c (Roth et al. 2000). T h i s order w a s determined by F A C S purifying N K cells that e x p r e s s e d a given receptor a n d observing what other receptors could s u b s e q u e n t l y be e x p r e s s e d on the purified cells after additional culturing. T h e c o n c l u s i o n of this experiment w a s that there is a w i n d o w of opportunity where g e n e e x p r e s s i o n c a n be i n d u c e d , a n d o n c e the w i n d o w is c l o s e d , the resulting transcriptional state is maintained.  T h e s e c o n d group u s e d N K progenitor cells plated at limiting dilution in wells with O P 9 stromal cells to grow up bulk cultures of cells that w e r e then c h e c k e d for Ly49 e x p r e s s i o n at various time points (Williams et al. 2000). Contrary to the first group's findings, N K cells grown in t h e s e conditions a p p e a r e d to acquire Ly49g e x p r e s s i o n first followed by Ly49i a n d c simultaneously followed last by Ly49a a n d of. T h e r e a s o n for the differences b e t w e e n the two group's findings is not entirely clear, although s o m e unknown c o n s e q u e n c e s of differences in the experimental p r o c e d u r e s might explain the d i s c r e p a n c y . In addition, the results are not n e c e s s a r i l y contradictory a s in later c a s e , the actual order of e x p r e s s i o n w a s a s s a y e d a s o p p o s e d to first study that looked at the timing of commitment to e x p r e s s individual g e n e s . T h e r e is, however, additional in vivo e v i d e n c e to support the theory of cumulative receptor acquisition of the first group.  40 Earlier studies involving adoptive transfers of N K cells ( N K 1 . 1 \ C D 3 " , Ly49") into recipient mice s h o w e d that receptor e x p r e s s i o n is stable after transfer to the recipient m o u s e . In addition, while donor N K cells w h i c h w e r e L y 4 9 A " could not give rise to L y 4 9 A N K cells in the recipient, they could give rise to L y 4 9 G a n d C d o n o r derived +  +  +  N K cells (Dorfman a n d Raulet 1998). T h i s result supports the earlier c o n c l u s i o n that the ability to induce Ly49a e x p r e s s i o n e n d s w h e n N K 1 . 1 e x p r e s s i o n is acquired a n d that receptor e x p r e s s i o n is sequential a n d cumulative.  1.6.2 Transcription factors implicated in the regulation of N K receptor genes V e r y little is known about the transacting factors that are involved in the transcriptional regulation of the a n y of the murine N K cell receptors. In the c a s e of a few g e n e s , fortuitous d i s c o v e r i e s have provided s o m e insight. S e v e r a l of t h e s e e x a m p l e s are d i s c u s s e d below.  A function for Activator Protein-1 ( A P - 1 ) in the transcriptional regulation of the h u m a n Ig-SF g e n e e n c o d i n g the activating receptor 2 B 4 h a s recently b e e n d e m o n s t r a t e d ( C h u a n g et a l . 2001). Predicted A P - 1 binding sites are located in the putative promoter region of the 2 B 4 g e n e a n d luciferase constructs using t h e s e stretches of D N A s h o w e d high activity w h e n transfected into the h u m a n N K cell line, Y T . T h i s activity w a s significantly r e d u c e d w h e n the predicted A P - 1 binding site w a s mutated. E M S A a n a l y s i s indicated that A P - 1 a p p e a r e d to be binding to the predicted sites in the promoter region, w h e r e this binding could be effectively c o m p e t e d by c o n s e n s u s A P - 1 oligonucleotides. 2 B 4 remains o n e of the only I g - S F g e n e s w h o s e transcriptional control h a s b e e n linked to a transacting factor.  41  To date, one of the few well-characterised transcription factors involved in expression of the Ly49 genes is T-cell factor 1 (TCF-1). This transcription factor belongs to a family of proteins referred to as high mobility group (HMG) proteins which have been shown to bend strands of DNA in vivo (Thomas and Travers 2001). As they lack any trahsactivational domain, their role has been speculated to be primarily architectural, bending DNA around a promoter region to allow other trans-acting factors to bind and induce transcription. An analysis of a mouse strain that is deficient in TCF-1 expression showed that the expression of Ly49A was reduced in a dose-dependent manner suggesting it is present in limiting quantity (Held et al. 1999). However, except for a decrease in Ly49D and a slight increase in Ly49G expression, no other Ly49 genes showed a change in expression. In this same study, luciferase constructs using the sequence of the previously reported promoter region of Ly49a also showed a TCF-1 dependent activity and this activity was observed only in cell lines where both TCF-1 and Ly49a were endogenously expressed. Interestingly, the very few NK cells that did express  Ly49a  in TCF-1 T mice did so at normal levels, suggesting that TCF-1 may only  be involved in the initiation of Ly49 expression rather than maintaining transcriptional activity. The alterations in the Ly49 expression patterns in the TCF-17" mice were subsequently shown to be unrelated to any possible changes in MHC class I expression (Kunz and Held, 2001). A more complete discussion of the role of this factor can be found in chapter 2 where an explanation for the variations in the Ly49 expression patterns in TCF-1T mice is proposed.  The only other trans-acting factor that has been implicated in the expression of Ly49  genes is called ATF-2. This protein was identified in an analysis of Ly49a  expression in the EL-4 cell line (Kubo et al. 1999). Promoter constructs that contained  42  the A T F - 2 binding site h a d high promoter activity in E L - 4 but not other cells. In addition, electrophoretic mobility shift a s s a y s ( E M S A ) a l s o s h o w e d that purified A T F - 2 protein could bind to the p r o p o s e d sites in the Ly49a promoter region. B e c a u s e the E L - 4 cell line e x p r e s s e s Ly49a, but not a n y other Ly49 g e n e s , the role of transcriptional regulation of A T F - 2 could not be extended to other L y 4 9 g e n e s .  1.6.3 Characterised N K C gene promoter regions T h e promoter regions of several Ly49 g e n e s have b e e n c h a r a c t e r i s e d in detail. T h e promoter region of Ly49a w a s first defined by using primer extension a n d S1 n u c l e a s e m a p p i n g to identify the transcriptional start point ( K u b o et a l . 1993). A s e a r c h of the s e q u e n c e u p s t r e a m a l s o revealed n u m e r o u s computationally predicted transcription factor binding sites, including two for the T C F - 1 transcription factor. M o r e recent studies involving the c l o s e l y related Ly49c, a n d j g e n e s failed to reveal a n y significant differences in the s e q u e n c e in the putative promoter region of t h e s e g e n e s e v e n though Ly49c is e x p r e s s e d at a m u c h higher f r e q u e n c y than Ly49j. ( M c Q u e e n et al. 2001). P r o m o t e r constructs m a d e using varying lengths of s e q u e n c e from u p s t r e a m of the first e x o n of Ly49a, c a n d j or s e q u e n c e exhibited varying activities that d e c r e a s e d with the construct length. S e q u e n c e s from the 3' e n d of the first intron of t h e s e g e n e s w e r e a l s o tested for promoter activity, in part b e c a u s e Ly49a a n d j contained a c a n o n i c a l T A T A box s e q u e n c e in this region a n d a l s o b e c a u s e the h u m a n NKG2A g e n e had b e e n reported to e n c o d e transcripts originating in the vicinity of a T A T A box in a similar position within the g e n e (Plougastel a n d T r o w s d a l e 1998). O n l y the intron s e q u e n c e of Ly49j d i s p l a y e d a n y promoter activity, p e r h a p s in part d u e to the p r e s e n c e of a c a n o n i c a l C A A T s e q u e n c e at the predicted d i s t a n c e u p s t r e a m of the T A T A s e q u e n c e ( M c Q u e e n et a l . 2001).  43 T h e Ly49i promoter region in the 1 2 9 / J m o u s e strain h a s a l s o b e e n e x a m i n e d to s o m e extent. T h i s work s h o w e d that a stretch of D N A u p s t r e a m of the p r e s u m e d transcriptional start point exhibited promoter activity in transient transfection a s s a y s a n d that in E M S A experiments, s o m e unidentified proteins from E L - 4 lysates bound to the c a n o n i c a l T A T A box found in the region of the promoter ( G o s s e l i n et a l . 2000). D e s p i t e verifying a s s u m p t i o n s m a d e regarding the significance of s o m e cis-acting s e q u e n c e e l e m e n t s , t h e s e findings w e r e unable to define a role for a n y novel transacting factor in the e x p r e s s i o n of Ly49i.  H o w e v e r , the s a m e group w a s able to provide e v i d e n c e that s u g g e s t s that transcriptional regulation of Ly49 g e n e s (and likely other N K receptors) is more c o m p l e x than initially thought. A novel promoter region w a s identifed u p s t r e a m of several Ly49 g e n e s w h i c h is active in bone marrow a n d fetal t h y m u s ( S a l e h et a l . 2002). A s s h o w n in chapter 3, this promoter region is located upstream of all Ly49 g e n e s except b a n d q. Transient transfection a s s a y s of the activity of this promoter using s e q u e n c e u p s t r e a m of the B 6 Ly49j g e n e did not yield high activity c o m p a r e d to Ly49i a n d g. T h i s fact is interesting in light of the low frequency of e x p r e s s i o n o b s e r v e d for Ly49j (approximately 5 % of N K cells; K u b o t a et a l . 1999) a n d the tissue specificity of promoter (including b o n e marrow, w h e r e Ly49 e x p r e s s i o n m a y be initiated).  1.6.4 Other potential N K receptor gene regulatory m e c h a n i s m s . A s d i s c u s s e d previously, there a p p e a r s to be a switch in receptor u s a g e by murine N K cells w h e r e ubiquitous CD94/NKG2 e x p r e s s i o n is supplanted by h e t e r o g e n o u s Ly49 e x p r e s s i o n . It is tempting to s p e c u l a t e that the c h r o m o s o m a l position might play a role in regulating this a s p e c t of receptor e x p r e s s i o n in a m a n n e r  44  similar to that s e e n in the B-globin g e n e cluster (reviewed in Li et a l . 1999). T h i s possibility is p r o p o s e d for Ly49e in chapter 3, by virtue of its location relative to the other Ly49 g e n e s . Currently, there is no experimental e v i d e n c e that there is s o m e global alteration in the chromatin structure in the N K C that influences the order in w h i c h receptors are e x p r e s s e d .  It is of interest that, in the c a s e of fetal h u m a n N K cel l s, it a p p e a r s that the K I R g e n e s are e x p r e s s e d along with CD94/NKG2 g e n e s (Raulet et a l . 2001). W h e t h e r this is b e c a u s e the K I R g e n e s are in a different c h r o m o s o m a l location, a n d therefore not subject to the effects of a hypothetical l o c u s control region ( L C R ) that might control the order of g e n e e x p r e s s i o n in the N K C , is u n k n o w n .  M o r e global m e t h o d s of regulating g e n e e x p r e s s i o n h a v e b e e n e x a m i n e d in the c a s e of the K I R g e n e s . Interestingly, in h u m a n N K cell lines w h e r e individual K I R g e n e s are not e x p r e s s e d , there is a excellent correlation with a state of hypermethylation of the KIR promoter regions (Santourlidis et a l . 2002). T h e reverse h a s a l s o b e e n found to be true in e x a m i n i n g the promoter regions of K I R g e n e s that are e x p r e s s e d . In a g r e e m e n t with this observation, K I R e x p r e s s i o n c a n be induced in lymphoid, but not n o n - l y m p h o i d , K I R negative cell lines w h e n treated with methyltransferase inhibitor 5a z a - 2 ' - d e o x y c y t i d i n e . Although this clarifies o n e a s p e c t of control o v e r K I R e x p r e s s i o n , the question of whether demethylation is a d e v e l o p m e n t a l requirement for the induction of K I R g e n e e x p r e s s i o n or whether K I R g e n e s which are not e x p r e s s e d simply b e c o m e methylated has not b e e n a n s w e r e d yet. T h i s method of regulation m a y not apply to the Ly49 g e n e s a s a n a l y s i s of the g e n o m i c s e q u e n c e s h o w s no predicted C p G islands  45 within the cluster, although s o m e small clusters of C p G dinucleotides c a n be found in the promoter regions.  1.7 A model for receptor acquisition and the role of MHC I environment A s d i s c u s s e d earlier there a p p e a r s to be a stochastic m e c h a n i s m that initiates Ly49 g e n e e x p r e s s i o n . A m o d e l , d e s c r i b e d a s the "at least o n e " m o d e l , w a s p r o p o s e d to explain the o b s e r v e d receptor e x p r e s s i o n pattern (Raulet et a l . 1997). T h e e s s e n c e of this theory is that all N K cells must e x p r e s s at least o n e receptor c a p a b l e of recognising s e l f - M H C m o l e c u l e s to maintain self-tolerance. G e n e e x p r e s s i o n c o u l d , therefore, be randomly initiated a n d continue until a self-tolerant receptor repertoire h a s b e e n a c q u i r e d . T h i s theory is supported by the a n a l y s i s of p a n e l s of h u m a n N K c l o n e s from two subjects (Valiante et a l . 1997). In this study, all c l o n e s e x p r e s s e d at least o n e receptor that would r e c o g n i s e donor M H C c l a s s I m o l e c u l e s . W h i l e a similar study in mice a l s o generally supported the theory, s o m e cells did not a p p e a r to e x p r e s s selfM H C receptors (Kubota et a l . 1999), although additional B 6 Ly49 g e n e s have s i n c e b e e n c l o n e d which w e r e not tested. S u c h cells m a y e x p r e s s other unknown receptors for s e l f - M H C , or m a y be h y p o r e s p o n s i v e d u e to down-regulation of receptors involved in N K cell activation. It h a s b e e n p r o p o s e d that N K cells m a y in fact start off in a h y p o r e s p o n s i v e state a n d then only d e v e l o p normal cytolytic activity after e n g a g e m e n t of inhibitory receptors with s e l f - M H C m o l e c u l e s . T h i s hypothesis would explain the m a i n t e n a n c e of N K self-tolerance in M H C c l a s s I deficient m i c e a n d h u m a n s a n d the ability to restore the cytolytic activity after high d o s e IL-2 activation in the c a s e of the murine N K cells ( S a l c e d o et a l . 1998).  A s a c o n s e q u e n c e , the M H C c l a s s I environment in which N K cells d e v e l o p should be a n important influence o n the d e v e l o p m e n t of N K receptor repertoires. S t u d i e s of mice strains e x p r e s s i n g Ly49a t r a n s g e n e s s o that the receptor is e x p r e s s e d o n a wide variety of cell types have revealed this hypothesis to be true. In transplantation experiments, the p r e s e n c e of the H - 2 ligand w a s s h o w n to lead to the d  down-regulation of L y 4 9 A e x p r e s s i o n upon transfer from a H - 2 d o n o r to a H - 2 b  b / d  recipient ( K h o o et a l . 1998). T h i s down-regulation w a s not fixed, a s a s e c o n d a r y transfer to a H - 2 recipient c a u s e d a n i n c r e a s e in the f r e q u e n c y of L y 4 9 A e x p r e s s i o n b  while transfer to a n H - 2 recipient c a u s e d a n d e v e n greater d e c r e a s e in e x p r e s s i o n . d  A s e c o n d L y 4 9 A transgenic m o u s e s h o w e d a similar d e c r e a s e in the f r e q u e n c y of L y 4 9 G e x p r e s s i o n , w h i c h a l s o r e c o g n i z e s H - 2 (Held a n d Raulet 1997b). In addition, d  while there w a s no alteration in the amount of Ly49a m R N A p e r cell, a s m e a s u r e d by the R N a s e protection a s s a y , the frequency of L y 4 9 A cells in non-transgenic mice +  which e x p r e s s e d the H - 2 m o l e c u l e w a s lower. T h i s would s u g g e s t that in normal m i c e , d  the receptor modulation o b s e r v e d in post-transcriptional. In the c a s e of L y 4 9 A transgenic mice, the level of e n d o g e n o u s Ly49a e x p r e s s i o n w a s significantly r e d u c e d which w a s interpreted a s indicated a reduced frequency of e n d o g e n o u s Ly49a expression.  T h e role of M H C c l a s s I environment h a s a l s o b e e n demonstrated through examination of b o n e marrow or fetal liver chimeric mice. Both hematopoietic a n d n o n hematopoietic cells lacking M H C c l a s s I e x p r e s s i o n w e r e a b l e to induce a tolerance to s u b s e q u e n t M H C c l a s s I negative b o n e marrow grafts (Hoglund et a l . 1991), with the non-hematopoietic M H C c l a s s I negative c h i m e r a s inducing substantially higher tolerance ( W u a n d Raulet 1997). A s noted a b o v e , this tolerance w a s s h o w n to be  47  reversible, indicating that N K cells are not fixed in a h y p o r e s p o n s i v e state. In s u m m a r y , t h e s e experiments have s h o w n that the level of L y 4 9 receptor e x p r e s s i o n at the cell s u r f a c e is modulated by the M H C c l a s s I environment, with the p r e s e n c e of the c o g n a t e ligand of a receptor leading to the down-regulation of that receptor. A s mentioned earlier, this modulation p r o c e s s a p p e a r s to be post-transcriptional (Held a n d Raulet 1997b) in nature a n d a similar down-regulation c a n be s e e n in B-cells e x p r e s s i n g a transgenic Ly49a receptor g e n e (Raulet et a l . 2001), s h o w i n g that this effect is not specifically related to N K cell function or development.  1.8 Convergent receptor evolution and co-evolution with MHC class I O n e of the most interesting findings in N K cell biology to date is the fact that the receptors u s e d in h u m a n s a n d mice to r e c o g n i s e s e l f - M H C m o l e c u l e s belong to structurally different families. Despite o b v i o u s structural differences, there are m a n y similarities b e t w e e n the h u m a n a n d m o u s e receptors. F o r both the K I R a n d Ly49s, there is e v i d e n c e to s u g g e s t that the g e n e s have e v o l v e d , in s o m e c a s e s rapidly, though a s e r i e s of duplication events (Martin et a l . 2 0 0 0 ; V o l z et a l . 2 0 0 1 ; a n d chapter 3) that have p r o d u c e d a large cluster of g e n e s . Both of t h e s e clusters contain inhibitory a n d activating forms of the receptors, which in both c a s e s in both families, u s e similar signalling m e c h a n i s m s . T h e e x p r e s s i o n of Ly49 a n d K I R receptors also a p p e a r s to be stochastic and clonal in both h u m a n s a n d m i c e (Valiante et a l . 1997; K u b o t a et a l . 1999). It is interesting that both s p e c i e s a l s o have a c o n s e r v e d m e c h a n i s m for non-specifically monitoring c l a s s i c a l M H C c l a s s I e x p r e s s i o n . All of t h e s e similarities s u g g e s t that there has b e e n strong selective p r e s s u r e in both o r g a n i s m s to d e v e l o p a n d maintain s u c h a s y s t e m . T h e s o u r c e of the p r e s s u r e likely c o m e s in part from the ligand for t h e s e receptors, the M H C c l a s s I m o l e c u l e s .  48  A s further outlined in chapter 3, the M H C c l a s s I g e n e s are a n e x a m p l e of a group of rapidly evolving g e n e s under selective p r e s s u r e to maintain diversity to allow the i m m u n e s y s t e m to r e c o g n i s e p a t h o g e n s (reviewed in Y e a g e r a n d H u g h e s 1999). If any receptor requires the recognition of a n M H C c l a s s I ligand, it would be e x p e c t e d that the receptor would have to match the evolutionary p a c e of the M H C to maintain function. G o o d e v i d e n c e has b e e n provided to s h o w that this is indeed the c a s e for the K I R receptors in h u m a n s (reviewed in V i l c h e s a n d P a r h a m 2002). W h i l e in-bred m o u s e strains, w h e r e N K receptor g e n e repertoires have b e e n studied, likely d o not properly reflect the selective p r e s s u r e s o n wild m i c e , they d o n o n e t h e l e s s s u g g e s t that murine N K receptors are a l s o evolving at a rapid p a c e . Further detailed a n a l y s i s of the N K cell receptor repertoire of other s p e c i e s will p e r h a p s allow broader c o n c l u s i o n s to be m a d e about w h y the c-type lectin-like receptors a p p e a r to be e x p a n d e d in only rodents while K I R receptors a p p e a r to be e x p a n d e d more broadly a c r o s s s p e c i e s . t  1.9 Thesis objectives and organisation M y overall thesis objective w a s to identify the m e c h a n i s m s of transcriptional regulation of g e n e s in the natural killer g e n e cluster ( N K C ) . Specifically, my g o a l s w e r e to s e q u e n c e a n d c o m p a r e the promoter regions of a large n u m b e r of related N K C g e n e s a n d look for explanations for the different e x p r e s s i o n f r e q u e n c i e s o b s e r v e d . M y goal w a s then to f o c u s on a single g e n e in the N K C a n d to e x a m i n e in more detail how it is regulated. T h e s u d d e n availability of g e n o m i c s e q u e n c e for the murine Ly49 cluster a d d e d a n additional g o a l , that of characterising the g e n o m i c organisation of the Ly49 cluster in the C 5 7 B L / 6 m o u s e strain. T h e organisation of my thesis is outlined below.  49  Chapter 2: Comparative analysis of the promoter regions of Ly49 genes  T h e goal of this work w a s to s e q u e n c e the promoter region of a large n u m b e r of Ly49 g e n e s to characterise the aligned s e q u e n c e in terms of regions of highly c o n s e r v e d s e q u e n c e that might h a v e functional significance. In addition, the transcriptional start points of s e v e r a l g e n e s w e r e determined by 5' R A C E . T h e s e experiments provided a b a s i s for interpreting other published experimental work o n the transcriptional regulation of Ly49 g e n e s . T h i s chapter h a s b e e n p u b l i s h e d : Brian T. W i l h e l m , K a r i n a L. M c Q u e e n , J . D o u g l a s F r e e m a n , F u m i o T a k e i a n d Dixie L. M a g e r (2001) C o m p a r a t i v e a n a l y s i s of the promoter regions a n d transcriptional start sites of m o u s e Ly49 g e n e s . Immunogenetics 53(3): 2 1 5 - 2 2 4  Chapter  3: Genomic  organisation of the  C57BL/6 Ly49 cluster  T h e f o c u s of this study w a s to a n a l y s e the g e n o m i c organisation of the Ly49 cluster at the nucleotide level from the s e q u e n c e provided by the public m o u s e g e n o m e s e q u e n c i n g consortium. T h i s work permitted the formulation of a g e n e evolution theory for the e x p a n s i o n of the Ly49 cluster to be formulated a n d a n a l y s i s of g e n o m i c features a l s o allowed for a n explanation of a d i s c r e p a n c y in the previously d e s c r i b e d d e v e l o p m e n t a l e x p r e s s i o n pattern of the Ly49 g e n e s . T h i s chapter h a s b e e n p u b l i s h e d : Brian T. W i l h e l m , L i a n e G a g n i e r , Dixie L. M a g e r (2002) S e q u e n c e a n a l y s i s of the Ly49 cluster in C 5 7 B L / 6 m i c e : A rapidly evolving multigene family in the i m m u n e s y s t e m . G e n o m i c s 80(6): 646-661  50 Chapter 4: Transcriptional control of the immune receptor CD94  T h e aim of this work w a s to characterise the transcriptional regulation of a single N K receptor, C D 9 4 . Study of this receptor using F A C s sorting a n d real-time quantitative P C R h a s illustrated a c o m p l e x m e c h a n i s m of cell-type specific regulation. T h i s chapter h a s b e e n submitted for publication: Brian T. W i l h e l m , J o s e t t e - R e n e e Landry, F u m i o T a k e i a n d Dixie L. M a g e r (submitted) Transcriptional control of the murine C D 9 4 g e n e : differential u s a g e of dual promoters by lymphoid cell types. T h i s chapter a l s o contains data a n d d i s c u s s i o n published in a p a p e r entitled Identification of a new murine lectin-like g e n e in c l o s e proximity to C D 9 4 by Brian T. W i l h e l m a n d Dixie L. M a g e r (2003) Immunogenetics, (in press).  Chapter 5: S u m m a r y T h i s final chapter s u m m a r i s e s the contribution of my work to the field of N K cell biology a n d a l s o outlines a r e a s in which further work could aid in a n s w e r i n g questions that remain unclear.  51  Chapter 2 Comparative analysis of the promoter regions of Ly49 genes  A p a p e r by Brian T. W i l h e l m , Karina L. M c Q u e e n , J . D o u g l a s F r e e m a n , F u m i o T a k e i a n d Dixie L. M a g e r entitled " C o m p a r a t i v e analysis of the promoter regions and transcriptional start sites of m o u s e Ly49 g e n e s " has b e e n published in Immunogenetics 53(3): 2 1 5 - 2 4 (2001).  K a r i n a M c Q u e e n s e q u e n c e d the promoter region of Ly49c and j.  Douglas  F r e e m a n s e q u e n c e d the promoter region of Ly49g a n d b. T h i s work is d e s c r i b e d in section 2.2.1  52  2.1 Introduction  At the beginning of my thesis work, only o n e Ly49 g e n e h a d h a d its promoter region identified a n d the s e q u e n c e characterised (Kubo et a l . 1993). T h i s study did not s h o w experimental e v i d e n c e for the identification of the transcriptional start site. P r e v i o u s work h a d s h o w e d that there w e r e at least 14 Ly49 g e n e s in B 6 m i c e that w e r e e x p r e s s e d at varying f r e q u e n c i e s (Smith et a l . 1994; B r o w n et a l . 1997b; M c Q u e e n et al. 1998; S i v a k u m a r et a l . 1998). G i v e n the lack of information regarding the promoter region s e q u e n c e for t h e s e g e n e s a n d the availability of w e l l - m a p p e d g e n o m i c c l o n e s of the region, it w a s d e c i d e d that the s e q u e n c i n g of the promoter regions s h o u l d be the first experimental a p p r o a c h t a k e n . T h e s u b s e q u e n t similarity of promoter region s e q u e n c e in the 9 g e n e s a n a l y s e d led to the s e c o n d a i m of this work that w a s to identify the transcriptional start points for s e v e r a l g e n e s .  53  2.2 Materials and Methods 2.2.1 Sequencing of putative promoter regions Nucleotide s e q u e n c e from the putative promoter regions w a s obtained through a combination of s e v e r a l t e c h n i q u e s . S u b c l o n e s w e r e initially obtained a n d s e q u e n c e d from regions of previously d e s c r i b e d ( M c Q u e e n et a l . 1998) P1 bacteriophage g e n o m i c c l o n e s ( R e s o u r c e C e n t r e , Max-Planck-lnstitute for M o l e c u l a r G e n e t i c , Berlin, G e r m a n y ) w h i c h hybridised to 3 2 P - l a b e l e d oligonucleotides d e s i g n e d from s e q u e n c e in e x o n 1 of the previously published c D N A s of Ly49 /', of a n d h. In addition, s o m e s e q u e n c e s w e r e obtained with vectorette P C R performed a s d e s c r i b e d previously (Riley et a l . 1990) using t h e s e e x o n 1 primers a s well a s a n e x o n 2 c o n s e n s u s primer.  Briefly, D N A to be u s e d a s template for a P C R reaction w a s digested with a restriction e n z y m e a n d specially d e s i g n e d linkers with compatible overhanging e n d s w e r e ligated to the digested template. P C R w a s then performed with a g e n e specific primer a n d a primer specific for the linker. A region of non-complementarity within the linker allows g e n e specific amplification. T o i n c r e a s e the likelihood of obtaining large fragments, different e n z y m e s w e r e u s e d for the restriction digest rather than Dde I u s e d in the original publication. In the present study, initial P C R fragments for Ly49h a n d /' w a s obtained using linker primers with Pst I o v e r h a n g s a n d g e n e specific primers in e x o n l . F r a g m e n t s for Ly49d, g a n d b w e r e from linkers with Nsi I o v e r h a n g s a n d g e n e specific primers in e x o n 2 . T h e template D N A u s e d included the previously mentioned P1 g e n o m i c c l o n e s a s well a s the Y A C s 5 2 A 6 , 242D11 a n d 9 5 E 6 from two W h i t e h e a d Institute/MIT libraries ( R e s e a r c h G e n e t i c s , Huntsville, A L ) w h i c h w e r e s h o w n to contain g e n e s of interest. P C R fragments w e r e first identified using g e n e specific  54 oligonucleotide probes a n d then s e q u e n c e d using vector primers a n d various deletion c l o n e s of the fragments. P r i m e r s u s e d for Vectorette P C R w e r e : 2 2 4 primer (linker primer) 5' T C G C T A A G A G C A T G C T T G C C A A T G C T A A G C 3' L y 4 9 B primer 5 ' A T G A A A T C T C A G A G T T G T G T A A G T G 3' L y 4 9 G primer 5' T G G G C C T T T G A G G C T C C T C A G T 3' L y 4 9 D primer 5' A A G T G T C T T C T T G T T C A G T C A T C T C 3' L y 4 9 H primer 5' T A G A A A G A A T G G A T G C C T C A 3' L y 4 9 l primer 5' G A T G C T G G T G G A G G G A A A A 3'  S e q u e n c e obtained from five of the Ly49 g e n e s allowed the d e s i g n of c o n s e n s u s primers for the u p s t r e a m region, permitting amplification of a n approximately 2 6 0 bp fragment from all g e n o m i c D N A templates known to contain g e n e s . S i m i l a r s e q u e n c e w a s a l s o amplified from other P1 g e n o m i c c l o n e s not previously d e s c r i b e d a s containing Ly49 g e n e s indicating the e x i s t e n c e of other novel g e n e s or g e n e fragments. V a r i o u s P1 D N A s a m p l e s w e r e u s e d to obtain the s e q u e n c e within this region a n d then to u s e this information to d e s i g n n e w g e n e specific primers to extend the s e q u e n c e further u p s t r e a m . T h e c o n s e n s u s primers (one 5' a n d two 3') u s e d w e r e : 5' P r i m e r 5' C T T A G C T S C A A Y T A G Y A T A A T T C 3' 3' P r i m e r A 5' C T T T C A A T T T T G A A A C T C R T A G G R 3' 3' P r i m e r B 5' T T Y W T Y T T G G A G M C W C T Y A G G G G 3' T h e r m o c y c l i n g w a s performed for 2 min at 9 4 ° C , followed by 3 5 c y c l e s of 3 0 s @ 9 4 ° C , 3 0 s @ 6 3 ° C , 1 min at 68°C followed by 7 min at 6 8 ° C . T h e products of t h e s e P C R reactions w e r e ligated into p G E M - T vector ( P r o m e g a M a d i s o n , WI) a n d s e q u e n c e d using the ABI P r i s m Big D y e Terminator c y c l e s e q u e n c i n g kit ( P E  55 B i o s y s t e m s , F o s t e r City, Calif.) in a n A B I automated D N A s e q u e n c e m a c h i n e (model 310). Finally, in the c a s e of Ly49e, / a n d h, g e n o m i c fragments w e r e s u b c l o n e d from P1 c l o n e s a n d further s e q u e n c e d .  2.2.2 R a p i d amplification of c D N A e n d s ( R A C E ) 5' R A C E w a s performed to identify the transcriptional start site of Ly49a, c, d a n d g. T o locate the transcriptional start site for Ly49a a n d c in the B a l b / c strain, c D N A w a s amplified from a M a r a t h o n - R e a d y c D N A kit of B a l b / c lymphocytes ( C l o n t e c h , P a l o Alto, Calif.) using the s a m e sets of nested B 6 g e n e specific primers mentioned below. B e c a u s e the c o m m e r c i a l c D N A w a s of B a l b / c origin, a n d b e c a u s e of the genetic variation o b s e r v e d between different m o u s e strains at this l o c u s (Makrigiannis a n d A n d e r s o n 2000), it w a s n e c e s s a r y to obtain R N A from B 6 m i c e to verify our results for Ly49a a n d c a n d a l s o to a n a l y s e Ly49d a n d g.  F o r Ly49a, c, d a n d g in the B 6 strain, c D N A w a s created from either total adult cellular splenic R N A or from total cellular R N A from interleukin-2-activated N K cells ( 7 5 % N K 1 . 1 ) . T h e R N A w a s then reverse transcribed using either r a n d o m primers a s +  previously d e s c r i b e d (Medstrand et a l . 1992) or a primer specific for Ly49a, d a n d g using a method a l s o previously d e s c r i b e d ( Z h a n g a n d F r o h m a n 1997). T h e c D N A obtained w a s poly-A tailed by incubating the s a m p l e s with terminal transferase ( G i b c o / B R L , Burlington, O N ) at 37°C for 1 hr in the p r e s e n c e of 1 0 m M d A T P ( G i b c o / B R L , Burlington, O N ) . P C R w a s performed o n the c D N A s a m p l e s using a n oligo-dT primer sites  ("Q " 0  and  ("Q ") t  "Qi").  (Zhang a n d F r o h m a n 1997) which contained two n e s t e d primer T h e " E l o n g a s e " e n z y m e mix ( G i b c o / B R L , Burlington, O N ) , which  h a s proofreading functions but which a l s o A-tails its products, w a s u s e d for the P C R  56  amplification. T h e resulting fragments of nested P C R reactions w e r e then c l o n e d into the p G E M - T vector a n d s e q u e n c e d using plasmid primers. T h e s e q u e n c e s of the g e n e specific primers u s e d w e r e : L y 4 9 A D G R e v e r s e transcription primer 5' A C T C C A Y G K T T T T C T G T C C A T G 3' 5' R A C E O u t s i d e L y 4 9 A 5' G C T A T C A C A A T G A A C T T C C A G T G G 3' 5' R A C E N e s t e d L y 4 9 A 5' G C C C T T T A G T C T C C T C A G G T C T C 3' 5' R A C E O u t s i d e L y 4 9 D 5' C C T G G T T T T A T C A C A C A G T A T G T T T T G 5' R A C E N e s t e d L y 4 9 D 5 ' A A G T G T C T T C T T G T T C A G T C A T C T C  3'  3'  5' R A C E O u t s i d e L y 4 9 G 5' A G A T C A T T G C C T G G C C T A C A C T C 3' 5' R A C E N e s t e d L y 4 9 G 5' T G G G C C T T T G A G G C T C C T C A G T 3' 5' R A C E O u t s i d e L y 4 9 C 5' A C T G C C A A C A C T G C A A C T G T T A C A 3' 5' R A C E N e s t e d L y 4 9 C 5' C A C A A T G A G T T G C C A G G G T G C T G 3' 5' R A C E O u t s i d e R N A H e l i c a s e A 5' C C C A T T G G T G C T G G T A A C C C T 3' 5' R A C E N e s t e d R N A H e l i c a s e A 5' G T A T G G G T G G G G G T G G T A C A A 3'  First round thermocycling for the B 6 c D N A w a s 10 c y c l e s of (20s @ 9 4 ° C , 2 0 s @ 4 0 ° C , 9 0 s at 68°C) with only the Q primer present followed a hold of 3 min at 6 8 ° C . t  T h e g e n e specific primers along with Q w e r e a d d e d a n d a further 3 5 c y c l e s of (20s @ 0  9 4 ° C , 2 0 s @ 53°C, 9 0 s at 68°C) w e r e performed with a final hold of 7 min at 68°C. N e s t e d P C R for the B 6 s a m p l e s w a s 3 5 c y c l e s of (20s @ 9 4 ° C , 2 0 s @ 5 3 ° C , 9 0 s at 68°C) followed by 7 min at 68 °C. T h e r m o c y c l i n g for the B a l b / c reactions w a s performed for 2 min at 94°C followed by 3 5 c y c l e s of (20s @ 9 4 ° C , 2 0 s @ 53°C, 9 0 s at 68°C) followed by 7 min at 68 °C.  57 5' R A C E P C R products w e r e s e p a r a t e d out on a g a r o s e g e l s a n d b a n d s w e r e e x c i s e d , purified a n d ligated into the p G E M - T vector a n d s e q u e n c e d using vector primers. T w e l v e B 6 c l o n e s from e a c h of the 4 independent R T a n d 5' R A C E reactions w e r e s e q u e n c e d for e a c h g e n e (a total of 4 8 c l o n e s for e a c h g e n e ) while a total of 4 0 c l o n e s from 3 independent experiments for B a l b / c a s s e q u e n c e d . F o r the R N A h e l i c a s e control experiments 2 4 c l o n e s w e r e amplified a n d s e q u e n c e d using the r a n d o m primed N K and spleen R N A .  2.2.3 S e q u e n c e A n a l y s i s S e q u e n c e s w e r e first aligned using the G C G program " P i l e u p " with a g a p weight penalty of 3 a n d a g a p extension penalty of 1. T h e resulting alignment w a s then imported into the program G e n e D o c (available free at the w e b s i t e h t t p : / / w w w . p s c . e d u / b i o m e d / g e n e d o c / ) which allows optimization of the alignment by h a n d . S i n g l e b a s e pair c h a n g e s in the alignment w e r e m a d e only if the initial position had b e e n arbitrary a s s i g n e d a n d c h a n g e would result in a significant i n c r e a s e in alignment local homology. T h e individual s e q u e n c e s w e r e a l s o a n a l y s e d using the R e p e a t m a s k e r program (available at http://www.genome.washington.edu/UWGC/analysistools/repeatmask.htm) which identifies various families of repeats present in a nucleotide s e q u e n c e .  2.3 Results and Discussion 2.3.1 S e q u e n c e analysis of putative regulatory regions of the Ly49 genes O u r initial a p p r o a c h to investigate Ly49 g e n e regulation w a s to s e q u e n c e a n d c o m p a r e the putative regulatory regions of n u m e r o u s Ly49 g e n e s to attempt to locate regions of highly c o n s e r v e d s e q u e n c e . T h r o u g h a combination of t e c h n i q u e s ( s e e Materials a n d M e t h o d s ) w e obtained s e q u e n c e upstream of e x o n 1 from the Ly49b, d, e, g, h, a n d / ' g e n e s in C 5 7 B L / 6 mice a n d c o m p a r e d it to the previously published Ly49a g e n o m i c s e q u e n c e , a s well a s s e q u e n c e obtained in o u r laboratory for Ly49c a n d j ( M c Q u e e n et a l . 2001). Figure 3-1 s h o w s the s e q u e n c e alignment of t h e s e nine Ly49 g e n e s from C 5 7 B I / 6 mice along with the h u m a n Ly49l g e n e with the alignment ending 8 bp after the previously published exon1/intron1 b o u n d a r i e s (nt position 878). P r e v i o u s l y published regulatory features including T A T A b o x e s (nt position 5 8 9 & 708) ( K u b o et a l . 1 9 9 3 ; G o s s e l i n et a l . 2 0 0 0 ) H M G b o x e s (nt position 6 4 3 & 6 8 8 ) (Held et a l . 1999) a n d the previously published transcriptional start site for Ly49a (nt position 722) ( K u b o et a l . 1993) a r e indicated. T h e r e a r e s e v e r a l features of the alignment w h i c h a r e of interest, the first being the high level of conservation s e e n in the 5' region of the majority of g e n e s in the alignment. T h i s to be e x p e c t e d of a family of g e n e s w h i c h h a s e x p a n d e d recently in evolution; however, the p r e s e n c e of s u c h large s e c t i o n s of c o n s e r v e d s e q u e n c e in the promoter region of g e n e s w h i c h a r e known to be e x p r e s s e d at different f r e q u e n c i e s s u g g e s t s that other, more distant regions a l s o influence e x p r e s s i o n patterns.  A n o t h e r notable feature is the p r e s e n c e of repetitive e l e m e n t s in the promoter region of two of the g e n e s . T h e 5' regions of both Ly49h a n d Ly49b contain a similar repetitive s e q u e n c e belonging to the L1 family a s illustrated in figure 2-2, while other  S I N E e l e m e n t s are present within its first intron of Ly49b. T h e m o u s e Ly49 g e n e cluster h a s p r e s u m a b l y e v o l v e d through a s e r i e s of g e n e duplications, c o n v e r s i o n e v e n t s , other r e a r r a n g e m e n t s a n d s e q u e n c e d i v e r g e n c e . F o r e x a m p l e , Ly49h is « 9 5 % identical to Ly49i in e x o n s 4-7 but is m u c h less related in the 5' part of the g e n e . T h i s s u g g e s t s that Ly49h w a s formed via a g e n e c o n v e r s i o n or other rearrangement. Ly49b a n d h s h a r e only 6 9 . 7 % nucleotide identity between their c o d i n g regions, but 7 8 % identity b e t w e e n their putative promoter regions a n d 8 5 % identity between the regions of LINE-1 s e q u e n c e . T h e 3' e n d of the LINE-1 element varies b e t w e e n the two g e n e s d u e primarily to a deletion in the Ly49h s e q u e n c e , a n d the 5' extent of the e l e m e n t s h a s not yet b e e n d e t e r m i n e d . W e c a n therefore not be certain if the LINE-1 e l e m e n t s represent the s a m e integration event or two s e p a r a t e events. N o n e t h e l e s s , the likelihood of two independent LINE-1 insertions occurring at the s a m e position in two related g e n e s is very low. It is p o s s i b l e that the LINE-1 element integrated into o n e of the g e n e s a n d then w a s "transferred" to the other g e n e via g e n e c o n v e r s i o n . H o w e v e r , until large s c a l e g e n o m i c s e q u e n c e is available for this region, it will be difficult to trace the actual evolutionary relationships of t h e s e g e n e s .  In order to optimise the alignment, s e v e r a l large (>30 bp) g a p s w e r e inserted into the s e q u e n c e s of Ly49d (nt position 21-56), Ly49a a n d g (nt position 3 2 9 - 3 6 8 ) . G a p s w e r e inserted in all of the s e q u e n c e s from nt position 4 8 7 - 5 0 4 to adjust for a short stretch of s e q u e n c e which is present only in Ly49g. O n e other large g a p (nt position 3 0 9 - 449) w a s inserted into the Ly49h s e q u e n c e in order to align the LINE-1 s e q u e n c e with that of Ly49b. T h e resulting alignment s u g g e s t s that the region u p s t r e a m of the beginning of the g a p in the Ly49h (nt position 1-308), although highly similar in the g e n e s studied, is not crucial for g e n e regulation, a s Ly49h is appropriately e x p r e s s e d  60  Fig 2-1 Alignment of g e n o m i c s e q u e n c e of 9 Ly49 genes from C 5 7 B L / 6 mice The sequence of Ly49a, b, c, d, e, g ,h , i , and ) are shown along with the sequence of the human Ly49l gene. The 3' end of the alignment is 8 bp past the exon1/intron1 boundary (indicated by a grey triangle) previously published for Ly49a and confirmed for Ly49c, j and g in our laboratory. The black shading indicates 60% or greater identity at that position and the light grey represents 4 0 % identity. Repetitive sequence from Ly49b and h is shown as by an arrowed range. Underlined and labelled regions of sequence indicate locations of other putative regulatory regions. A n arrow at nt position 747 indicates the previously published transcriptional start site for Ly49a. Previously published sequences used include Ly49a (Kubo et al. 1993), Ly49c & j (McQueen et al. 2001) and the human Ly49l gene (Barten and Trowsdale 1999)  61. without this s e q u e n c e . N e a r the 5'end of the alignment (approximately nt position 6 5 145), there is a l s o a C A rich repeat which is present, in varying lengths, in all of the Ly49 g e n e s e x c e p t b a n d h which have LINE-1 s e q u e n c e in this region.  A s mentioned a b o v e , it w a s recently reported that the activating receptors Ly49d a n d h a r e c o - e x p r e s s e d at higher levels than would b e e x p e c t e d from their individual e x p r e s s i o n f r e q u e n c i e s (Smith et a l . 2000). O n e p o s s i b l e explanation for this observation is that there m a y b e trans-acting factors specific for activating receptors w h i c h a r e e x p r e s s e d only in s u b s e t s of N K cells or that bind to s e q u e n c e s present only in the promoters of activating receptors. Although the s e q u e n c e s of all of the g e n e s a r e similar, Ly49d a n d h d o s h a r e a short stretch of identical s e q u e n c e (nt positions 8 0 0 822) w h i c h is not present in the other m o u s e g e n e s a s well a s a region of similar s e q u e n c e (nt positions 8 3 9 - 8 5 9 ) s h a r e d only with Ly49b. It is p o s s i b l e that t h e s e or other regions h a v e functional significance. Alternatively, the high c o - e x p r e s s i o n levels of Ly49d a n d h m a y b e a result of s o m e post-translational control m e c h a n i s m o r environmental influence. G i v e n the fact that interactions of L y 4 9 m o l e c u l e s with M H C C l a s s I m o l e c u l e s affect receptor levels ( F a h l e n et a l . 1997; H e l d a n d R a u l e t 1997b; Roth et a l . 2 0 0 0 , chapter 1), a n d given the high d e g r e e of similarity of all of the g e n e s within the promoter region (delimited by the insertion point of the LINE-1 s e q u e n c e ) , o n e of the later explanations s e e m s more likely.  T h e h u m a n Ly49l g e n e is a l s o included in the alignment in figure 2-1 a n d it s h o w s a high level of conservation with the m o u s e g e n e s through nt position 6 3 7 - 7 6 0 . A l t h o u g h the h u m a n g e n e is thought to b e non-functional d u e to incorrect splicing, it is  62  Lv49b Promoter LINE  85%  Ly49h  = lOObp  LINE  Sine  Sine  78% Promoter r  Figure 2-2 Repetitive elements flanking the putative regulatory regions of two Ly49 genes. S e v e r a l repetitive s e q u e n c e s near promoter region of Ly49b a n d h are s h o w n to s c a l e . T h e full length of the L I N E e l e m e n t s in either g e n e is u n k n o w n b e y o n d the « 5 0 0 bp s e q u e n c e d a n d the location of the putative promoter region is b a s e d o n h o m o l o g y to the other g e n e s , a s 5' R A C E w a s not performed o n t h e s e two g e n e s . T h e calculated percentage identity b e t w e e n the two g e n e s for the L I N E s e q u e n c e a n d promoter region is s h o w n .  63 still transcribed in NK cells but not in T or B cells, a s s h o w n by northern blot (Westgaard et a l . 1998). T h i s s u g g e s t s that, despite a potentially low e x p r e s s i o n level, the g e n e ' s regulatory m e c h a n i s m is still intact. If s o , the region of conservation m a y represent the core promoter region, at least for s o m e of the m o u s e g e n e s . A n a n a l y s i s of putative transcription factor binding sites within the region of highest conservation between h u m a n a n d m o u s e g e n e s (nt position 637-760) did not reveal a n y o b v i o u s c a n d i d a t e s . T h e analysis w a s d o n e using the M a t l n s p e c t o r program (http://transfac.gbf.de/c/s.dll/matSearch/matsearch.pl) and although n u m e r o u s high quality m a t c h e s w e r e returned, the majority of t h e s e m a t c h e s had short or d e g e n e r a t e recognition s e q u e n c e s s o their significance is unclear. O n e of the longer, high quality, m a t c h e s w a s a predicted binding site for the transcription factor NF-AT at nt positions 6 7 4 - 6 8 2 (general c o n s e n s u s site WGGAAANHN with core s e q u e n c e in bold). NF-AT b e l o n g s to a family of transcription factors which are e n c o d e d by 4 g e n e s , 3 of which are alternatively spliced to yield a variety of functional protein isoforms ( R a o et a l . 1997). M e m b e r s of this family are e x p r e s s e d in a variety of haematopoietic cell types including NK cells a n d have b e e n implicated in regulating the e x p r e s s i o n of a large n u m b e r of g e n e s ( R a o et a l . 1997). NF-AT proteins c a n be activated through a variety of signalling pathways including through C D 1 6 , a s w a s recently d e m o n s t r a t e d in the c a s e of NK cells (Aramburu et al. 1995). W e c o n d u c t e d a preliminary examination of the potential role of NF-AT in the e x p r e s s i o n of Ly49 g e n e s using c o m p o u n d s to either stimulate or block the activity of NF-AT. T h e s e experiments in E L 4 cells a s well a s primary NK cells w e r e not c o n c l u s i v e , and further a n a l y s i s will be required to test the p o s s i b l e role of NF-AT in Ly49 g e n e regulation.  64 2.3.2 Identification of potential transcriptional start sites for Ly49 genes O n l y o n e previous study h a s reported the transcriptional start site for a n Ly49 g e n e , that of Ly49a ( K u b o et a l . 1993). W e therefore performed 5' R A C E experiments to identify the start sites for Ly49d, g a n d c a n d to confirm the location for Ly49a. Figure 2-3a a n d b s h o w that there is a great d e a l of heterogeneity in the location of the transcriptional start points for these g e n e s . It is unlikely that this heterogeneity results from using d e g r a d e d R N A , a s the c D N A s u s e d for a n a l y s i s c a m e from s e v e r a l independent s o u r c e s . A s well, the fact that clustering of start sites in different e x o n s w a s o b s e r v e d using independent R N A s a m p l e s strongly a r g u e s against this, a s this would not be predicted a s a result of R N A degradation. A s a control for the u s e of 5' R A C E to accurately localize the transcriptional initiation site of a g e n e , w e u s e d the s a m e R N A s o u r c e s with primers d e s i g n e d for the g e n e R N A h e l i c a s e A w h i c h w a s recently s h o w n to have a single transcriptional start point by primer extension ( L e e et a l . 1998a). T h e R N A h e l i c a s e 5' R A C E primers w e r e d e s i g n e d to amplify a longer fragment c o m p a r e d to the Ly49 R A C E experiments (600 v s . 4 0 0 bp) which constitutes a more stringent test of the technique. Figure 3-2c s h o w s that the vast majority of R N A h e l i c a s e A 5' R A C E products start at the exact nucleotide position previously reported to be the transcriptional start point by primer e x t e n s i o n , s u g g e s t i n g that this a p p r o a c h provides valid data for the Ly49 g e n e s .  For every g e n e a n a l y s e d , the s e q u e n c e d c l o n e s s h o w e d a great d e a l of variation in length a n d did not reveal a single potential transcriptional start site. Rather, the 5' e n d s of the R A C E products varied o v e r a range of 60 to 70 bp w h i c h differed s o m e w h a t in location between g e n e s . W h e r e a s the majority of Ly49a transcripts a p p e a r to  65 A "  • 600 * * * TATAAATCATTCACATTTGTTTTG-TCCATCCAATACTATATGTTGTT  Ly49C  *  650  * TCAGATTGCAAT  Ly49D  TATCATATATAGTCATTTCTTTTGCAGCATCTGGCAAAATATTTTGCTTCTTTCCCTTGCCTTCAGACTCAGCTTTCA-A  Ly49A-B6  TATCAGTTATGGACATTTGTTTTGCAGCATCTGGCACAATACGTTACTTCTCTCETTTGTIICTGAGGGTCAGGTTTCATT  Ly49A-Balb  TATCAGTTATGGACATTTGTTTTGCAGCATCTGGCACAATACGTTACTTCTCTdCTTTGTHCTGAGGGTCAGGTTTCATT  Ly49G  TATCAGTTATGGACATTTGTTTTGCAGCATCTGGCACAATATGTTTCTTCTCTCSllGlIlCTGAGGGTCAGGTTTCATT HMGBox-1  Ly49C  680 * * * * 730 * AAGCAATTTCCTCTTTTTGCTTTGGTGACGAGGAGGGGCAGAAAATCATGAGGTTGAGTATCACCCGGTGGAAATTTAGT  Ly49D  AAGCAATTTCCTCTTTTTGATTTGGTCAAGAGGAGGGGCAGAAAACCATGAGATTGAGTGTTGCTCAGAGGAAATTTAGT  •  44_  AAGCAGTTTCCTCTTTTTG^TTTGAT1GACGAGGAGGAGCA^AAAA^CA^^AGGTTGAGTATCTCTCAG(SfeGAAATTTAGT  Ly49A-Balb  AAGCAGTTTCCTCTTTTTGgWTGAiPACGAGGAGGAGCATAAAATCATGAGGTTGAGTATCTCTCAGTGGAAATTTAGT  Ly49G  AAGCAGTTTCCTCTTTTTC^TTTGAlbAAGAGGAGGAGCATAAAATCATGAGGTTGAGTATCACTCAGTGGAAATTTAGT HMO Box-2 ^  Ly49C  * 760 * * * 810 * TCCGACTTTCAATTTTGAAACTCGTAGGAGATCTAAACCAGAAAA-CGCCAACGTTTCAGACAAATTTTCCCTCCACCAG 4 ^^-5^ ^ ^ 3-^ ^ ^-2 T_2 4. 4-4 4 4_2  Ly49D  TCTGCCTTTCTTCTTGGAGCCTCTAAGGGGATACACACCAGAAAAG-GCCCACATTACCCCAACAGGGACATCCATTCCT  3  2-^ 2444g T.3  Ly49A-B6 Ly49A-Balb Ly49G  4  X.3  2  B  4 44  4  2  TCTACCGTTTATTTTGGAGACACTTAGGGGATATCAACCAGAAAAA-GCCAACTTTTTCCTCCACCAGAACCACTTCTTG  2-4+  4.2  4.10  4.2  4.  4  2  4  4  TCTACCGTTTATTTTGGAGACACTTAGGGGATATCAACCAGAAAAA-GCCAACTTTTTCCTCCACCAGAACCACTTCTTG *4-3 4_6 2 44 44 ^-4 TCTACTGTTTATTTTGGAGACACTTAGGGGATATCAACCAGAAAAA-GCCAACTTTTTCTCCACAGGAATCACTTCTCAG  4  4  L y 4 9G  40 BO AAATTTGGTCAGTCCATGTCAGGGTGTTTATAGCATTAAGTGAGTTAGTCAGACCCCACCCTTTCCCAGACCTCTGTATC  Ly4SG  12 0 ATCATATCTAGTTATCTTCCTATAGGTGAACATTTTAACATTTTTCGTAdAAACCACTCAAGGCACCATTTTAACTGAGA  Intron 1  Exon 2  >4. 4  44  2  L y 4 9G  u  4  2  Ly4 9A- B6  2  C  4_  2  RNA  ,.  .  Helicase A  * 200 * 240 ACATACTTCATACATCATTCCCAAGATGAGTGAGCAGGAGGTCACTTACTCAACTGTGAGATTTCATGAGTCTTCAAGGT  *  4  ^  0  *  8  0  TGGCCTACGCGCCAGGCCAGTCGCCGACTCCGCCCCCTGGGTCCTGCAGTCGGA&CATTTCGCCGCTGCTTCCATGCGG  +  *  +  120  1ft  1 5  44  *  160  GTGAGGTGTGTTCTTTCGCCGTTCTCGTGGAAGGTTGGCGCTGCGAACTCGCCTAAGAAGGCTGTGCTCTCGGGCACGGA  4  4  Figure 2-3 5' R A C E analysis for four Ly49 genes Part A s h o w s a s u b s e c t i o n of e x o n 1 a n d u p s t r e a m s e q u e n c e for several Ly49 g e n e s . T h e termination points of 5' R A C E products are s h o w n with arrows a n d sites with multiple start points s h o w n a s n u m b e r e d arrows. P r e v i o u s l y identified regulatory e l e m e n t s are s h o w n in titled b o x e s a n d the previously published transcriptional start site for Ly49a is circled. P r o p o s e d T A T A b o x e s are s h o w n in bold for Ly49c a n d a a n d g. Part B s h o w s the g e n o m i c s e q u e n c e of the intron 1/exon 2 boundary of Ly49g with termination points of 5' R A C E products indicated. T h e numbering of part A of the figure is the s a m e a s that of figure 2-1 a n d the translation start c o d o n for Ly49g in part B is underlined. B e c a u s e no differences w e r e o b s e r v e d between strains, the start sites from Ly49c in both strains w e r e p o o l e d , with e q u a l n u m b e r s of c l o n e s being present in the final s a m p l e while the Ly49a results w e r e left s e p a r a t e to d e m o n s t r a t e the similar distribution patterns. Part C s h o w s the g e n o m i c s e q u e n c e for the m o u s e R N A H e l i c a s e A g e n e with the previously published transcriptional start point circled.  66 originate in a region from nt positions 6 9 5 - 7 7 0 in figure 2-3, Ly49d transcripts a p p e a r more tightly clustered from nt positions 7 4 5 to 7 6 5 . T h e e x p e r i m e n t s for Ly49g p r o d u c e d a n u n e x p e c t e d result in that the transcriptional start sites a p p e a r in a tight cluster within e x o n 2 of the g e n e , immediately u p s t r e a m of the initiation c o d o n with o v e r 9 0 % of the 5' R A C E c l o n e s terminating in this cluster or just u p s t r e a m in intron 1. Indeed, it a p p e a r s that t h e s e transcripts result from initiation signals g e n e r a t e d within the first intron. A l t h o u g h longer transcripts w h i c h originally defined the e x o n 1 s e q u e n c e h a v e b e e n previously published (Smith et a l . 1994) a n d are a l s o detected in the current work, the 5' R A C E technique allows an a s s e s s m e n t of the frequency of transcripts w h i c h m a y not be evident w h e n simply attempting to identify the longest transcripts. W e h a v e recently s h o w n that the first intron of Ly49j in B 6 mice contains e l e m e n t s c a p a b l e of acting a s a promoter in transient transfection reporter a s s a y s ( M c Q u e e n et a l . 2 0 0 1 ) a n d a transcript with a 5'-end within intron 1 h a s b e e n found in the 129/J m o u s e strain (Ly49v c D N A , G e n b a n k a c c e s s i o n A F 2 8 8 3 8 1 ) . H e r e w e s h o w e v i d e n c e s u g g e s t i n g that the first intron of Ly49g  m  acts a s a major promoter of this  g e n e in vivo.  2.3.3 Differential effects of TCF-1 Within the Ly49a g e n o m i c s e q u e n c e , there are two c o n s e n s u s binding sites for the transcription factor T C F - 1 ( C T T T G W W ) (boxed s e q u e n c e at nt positions 6 4 2 a n d 6 8 8 in figure 2-3) w h i c h are immediately u p s t r e a m of a previously predicted T A T A box for Ly49a (shown in bold at nt position 708) ( K u b o et a l . 1993). A s d i s c u s s e d in chapter 1, Held a n d co-workers u s e d T C F - 1 knockout mice to e x a m i n e the potential role of this transcription factor in Ly49 receptor e x p r e s s i o n (Held et a l . 1999). T h e y noted that  67 T C F - 1 deficient mice essentially lack L y 4 9 A N K cells, although the residual L y 4 9 A N K +  +  cells e x p r e s s the protein at normal levels. Interestingly, while the percentage of L y 4 9 D e x p r e s s i n g N K cells w a s also d e c r e a s e d in TCF-17" m i c e , the p e r c e n t a g e s for L y 4 9 C , G a n d I were u n c h a n g e d or slightly higher. T h i s would imply that the role of T C F - 1 is limited to the acquisition of L y 4 9 A and D e x p r e s s i o n but not the m a i n t e n a n c e of e x p r e s s i o n of a n y g e n e s . T h e y further d e m o n s t r a t e d , using E L - 4 cells transfected with luciferase reporter constructs with combinations of normal and mutated binding sites, that while both binding sites i n c r e a s e d luciferase e x p r e s s i o n , the 5' most binding site had the most significant effect on e x p r e s s i o n . A s mentioned in section 1.6.2 in the introduction, the c h a n g e s s e e n in L y 4 9 e x p r e s s i o n d o e s in TCF-17" mice d o e s not s e e m to be affected by the level of host M H C c l a s s I e x p r e s s i o n ( K u n z and H e l d , 2001).  O u r s e q u e n c e analysis h a s revealed that this first H M G box is not present in Ly49c or /' (figure 2-1) which could explain why e x p r e s s i o n of t h e s e two g e n e s is not affected by the a b s e n c e of T C F - 1 . H o w e v e r , Ly49g contains this site but is also unaffected in T C F - 1 7" mice. O u r 5' R A C E experiments a l s o provide a p o s s i b l e explanation for this observation. S i n c e Ly49g a p p e a r s to be promoted primarily from within the first intron, the p r e s e n c e or a b s e n c e of the H M G b o x e s m a y not be critical for its e x p r e s s i o n . W e h a v e also detected several Ly49a transcripts that start further upstream than the s e c o n d H M G box studied by Held and co-workers. W h i l e the data from the T C F - 1 7" mice indicate that it h a s a role in the acquisition of g e n e e x p r e s s i o n , whether this effect is direct or indirect is not clear. It is p o s s i b l e that T C F - 1 m a y be acting further upstream in the promoter region or e l s e it is influencing the e x p r e s s i o n of another trans-acting factor which in turn acts only on specific Ly49 g e n e s . It is  68 interesting a n d p e r h a p s significant that the region of m o u s e - h u m a n conservation begins at the 5 ' H M G box.  2.3.4 The presence of a T A T A box d o e s not s e e m important for Ly49 e x p r e s s i o n K u b o a n d co-workers ( K u b o et a l . 1993) h a v e p r o p o s e d a potential T A T A box for Ly49a which is highlighted in figures 2-1 a n d 2 - 3 a . A n o t h e r control e l e m e n t identified in the Ly49a promoter is a 13bp s e q u e n c e termed E L 1 3 , w h i c h h a s partial h o m o l o g y to the C R E c o n s e n s u s - b i n d i n g site for A T F - 2 ( K u b o et a l . 1999). It w a s d e m o n s t r a t e d that this portion of regulatory s e q u e n c e upstream of the p r o p o s e d T A T A box a p p e a r s to have cell-specific promoter function in E L 4 cells. O u r 5' R A C E a n a l y s i s of Ly49a d o e s not a g r e e with the previously reported single transcriptional start site for this g e n e ( K u b o et a l . 1993). W e h a v e found n u m e r o u s transcriptional start points w h i c h are u p s t r e a m of both the E L - 1 3 element a n d the p r o p o s e d T A T A box. T h e s e data d o not n e c e s s a r i l y e x c l u d e a role for the E L - 1 3 binding protein in regulating the e x p r e s s i o n of Ly49a. It is p o s s i b l e that there m a y be genetic differences in E L 4 cells w h i c h m a k e the E L - 1 3 s e q u e n c e important in the regulation of Ly49a e x p r e s s i o n in this cell line. In s u c h a c a s e , the p r o p o s e d T A T A box m a y in fact be functional. H o w e v e r there d o e s not a p p e a r to be strong e v i d e n c e that this is the c a s e for transcripts detected from s p l e n o c y t e s o r N K cells from B a l b / c or C 5 7 B I / 6 mice. A further point making it unlikely that the p r o p o s e d T A T A box is functional in vivo is that this Ly49a s e q u e n c e element, a n d the c l o s e flanking s e q u e n c e , is identical to the Ly49g s e q u e n c e w h i c h d o e s not a p p e a r to function a s a transcriptional initiator. A s e c o n d T A T A box, approximately 120 bp u p s t r e a m of the p r o p o s e d box for Ly49a, h a s b e e n s h o w n to exist in L y 4 9 / '  129  ( G o s s e l i n et a l . 2 0 0 0 ) a n d in Ly49i, c,j a n d e in B 6 mice (figure 2-1). In a recent study, it w a s d e m o n s t r a t e d that a n oligonucleotide probe containing the L y 4 9 / '  129  T A T A box  69 a n d c l o s e flanking s e q u e n c e could form specific c o m p l e x e s with the lysate from E L 4 cells a s well a s with 1 2 9 / J murine N K cell lysate in E M S A a n a l y s i s ( G o s s e l i n et a l . 2000). B e c a u s e this binding w a s a l s o demonstrated using the questionable T A T A box previously p r o p o s e d for Ly49a, the significance of this binding is not c l e a r a n d it has not b e e n demonstrated that this box is n e c e s s a r y for promoter activity of the region. Furthermore, w e did not detect a n y transcripts for Ly49c which initiated closely d o w n s t r e a m of this T A T A box a s would be e x p e c t e d if it w e r e functioning a s a promoter. N u m e r o u s reports have s h o w n that g e n e s s u c h a s Ly49c a n d Ly49i which h a v e c a n o n i c a l T A T A b o x e s are a s highly e x p r e s s e d a s g e n e s s u c h a s Ly49d a n d g w h i c h d o not h a v e r e c o g n i z e d T A T A b o x e s ( S i v a k u m a r et a l . 1998; Smith et a l . 2000). T h e fact that w e have s h o w n that the p r e s e n c e or a b s e n c e of a T A T A box d o e s not a p p e a r to affect the location of transcription initiation raises the question of whether a T A T A box is actually n e c e s s a r y for Ly49 e x p r e s s i o n . T h e r e are at least two possibilities for explaining transcriptional control of the Ly49 g e n e s which are consistent with our 5' R A C E o b s e r v a t i o n s . T h e first is that transcripts are generated s o m e w h a t indiscriminately from A T - r i c h regions in the promoter s e q u e n c e . It h a s b e e n previously d o c u m e n t e d that m a n y A T - r i c h s e q u e n c e s six b a s e s long or more c a n function a s T A T A b o x e s ( S m a l e 1997), and the p r e s e n c e of several s u c h regions in the promoter might a c c o u n t for the heterogeneity w e o b s e r v e d . Alternatively, the Ly49 g e n e s m a y represent T A T A - l e s s g e n e s which have their transcription controlled by a n initiator element. T h e transcripts generated from T A T A - l e s s promoters c a n be from a single start point or from n u m e r o u s sites o v e r a range of s e v e r a l h u n d r e d s of b a s e s ( S m a l e 1997). T h e c o n s e n s u s s e q u e n c e which h a s b e e n d e s c r i b e d for the initiator element is 5' Y Y C A N T Y Y 3', w h e r e the C A N T core is critical for function. T h e flanking pyrimidine b a s e s must a l s o be present in order to allow initiator activity, h o w e v e r not all of them  n e e d to be present in order to initiate transcription ( S m a l e 1997). Additionally, the majority of T A T A - l e s s promoters a l s o contain multiple S P 1 binding sites, the a b s e n c e of w h i c h c a n contribute to h e t e r o g e n e o u s start sites ( S m a l e 1997). Although the majority of T A T A - l e s s g e n e s are generally thought to be constitutively active " h o u s e - k e e p i n g " g e n e s , s o m e are c a p a b l e of being e x p r e s s e d in a developmentally specific a n d tissue specific m a n n e r ( A z i z k h a n et a l . 1993). Indeed, m a n y of the c o m p l e m e n t g e n e s are tightly regulated despite having T A T A - l e s s promoters ( V o l a n a k i s 1995). T h e h u m a n NKG2A (Plougastel a n d T r o w s d a l e 1998) a n d 2 B 4 ( C h u a n g et a l . 2 0 0 1 ) g e n e s both h a v e tissue-restricted e x p r e s s i o n without T A T A s e q u e n c e s in their most 5' promoter region a n d h a v e a l s o b e e n s h o w n to have h e t e r o g e n e o u s transcriptional start sites. In e x a m i n i n g the g e n o m i c s e q u e n c e of the Ly49 g e n e s , w e c a n find s e v e r a l regions which match a portion of the initiator element c o n s e n s u s ; however, there are no s e q u e n c e s which a p p e a r to be m a t c h e s for an S P 1 binding site. W h i l e it is not p o s s i b l e at this point to d o more than s p e c u l a t e on the nature of the interaction of the b a s a l transcriptional m a c h i n e r y with t h e s e g e n e s , that data obtained s o far s u g g e s t that it is c o m p l e x a n d m a y h a v e g e n e - s p e c i f i c a s p e c t s to it.  In c o n c l u s i o n , w e have s e q u e n c e d the putative regulatory region of 9 Ly49 g e n e s a n d s h o w n that the s e q u e n c e s are highly c o n s e r v e d a n d a l s o s h a r e regions of conservation with the h u m a n Ly49l g e n e . T h r o u g h 5' R A C E a n a l y s i s , w e have s h o w n that there are multiple transcriptional start sites w h i c h are clustered in different locations in the g e n e s e x a m i n e d . In addition, w e h a v e s h o w n that the start sites for the majority of transcripts for Ly49g originate in the first intron a s well a s e x o n 2 of the g e n e . O u r findings s u g g e s t that the regulation of g e n e s in the Ly49 cluster is very c o m p l e x , a n d likely e m p l o y s multiple levels of regulation.  71  Chapter 3 Genomic organization of the C57BL/6 Ly49 cluster  A p a p e r by Brian T. W i l h e l m , L i a n e G a g n i e r , Dixie L. M a g e r entitled " S e q u e n c e a n a l y s i s of the Ly49 cluster in C 5 7 B L / 6 m i c e : A rapidly evolving multigene family in the i m m u n e s y s t e m " h a s b e e n published in G e n o m i c s Dec;80(6): 646-61 (2002).  L i a n e G a g n i e r a s s i s t e d in obtaining g e n o m i c s e q u e n c e to c l o s e g a p s in the Ly49 contigs and Dixie M a g e r created figure 3-7 and table 3-2. T h i s work is d e s c r i b e d in section 3.2.1, 3.2.2, a n d 3.2.3  72  3.1 INTRODUCTION T h e goal of this work w a s to utilize the newly available m o u s e g e n o m i c s e q u e n c e to study the Ly49 g e n e cluster of the C 5 7 B L / 6 m o u s e strain at the nucleotide level. S i n c e the first identification of Ly49 g e n e s ( C h a n a n d T a k e i 1989), a n e v e r increasing n u m b e r of g e n e s in this family have b e e n identified. T h e e x i s t e n c e of s u c h a large n u m b e r of g e n e s , not all of w h i c h are r e c o g n i z e d by antibodies, m a d e a n a l y z i n g e x p r e s s i o n patterns of all g e n e s virtually i m p o s s i b l e . W o r k by s e v e r a l l a b s , including our o w n , helped contribute to a n a c c u r a t e m a p of most of the known g e n e s in the cluster (Brown et a l . 1 9 9 7 a ; M c Q u e e n et a l . 1998; Depatie et a l . 2000). Without reliable s e q u e n c e for the region it w a s not p o s s i b l e to u n a m b i g u o u s l y a s s i g n g e n e identities to s e v e r a l Ly49 promoter regions which w e c l o n e d a n d w h i c h a p p e a r e d to be identical. In late 2 0 0 1 , through a combination of B A C a n d shotgun s e q u e n c i n g efforts w h i c h w e r e part of the public effort to s e q u e n c e the m o u s e g e n o m e (Waterston et a l . 2002), it w a s p o s s i b l e to a s s e m b l e a series of s e q u e n c e contigs w h i c h c o v e r e d virtually the entire Ly49 cluster. U s i n g this s e q u e n c e , a variety of studies w e r e performed including dotplot a n a l y s i s , l a r g e - s c a l e s e q u e n c e alignments a n d phylogenetic a n a l y s i s . T h i s e n a b l e d us to formulate a model for the evolution of the entire Ly49 g e n e cluster a s well a s m o d e l s for more recent g e n e duplication events within the cluster.  73  3.2 Materials and Methods 3.2.1 Data retrieval and a s s e m b l y T h e G e n b a n k entry for Ly49a ( N M _ 0 1 6 6 5 9 ) w a s u s e d to s c r e e n the high throughput d a t a b a s e ( H T G S ) at N B C I (http://www.ncbi.nlm.nih.gov).  Sequence  m a t c h e s c o r r e s p o n d i n g to three B A C s at varying s t a g e s of completion w e r e identified a s entries A C 0 9 0 5 6 3 , A C 0 9 0 1 2 7 , A C 8 7 3 3 6 ( N C B I 2002). T h e s e s e q u e n c e entries w e r e retrieved a n d a s s e m b l e d to a form a contiguous s e q u e n c e using tools at B C M s e a r c h l a u n c h e r (http://searchlauncher.bcm.tmc.edu/) a n d the Blast2 program at N C B I (http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) to reverse a n d a s s e m b l e the nine s e q u e n c e fragments in A C 0 9 0 5 6 3 . Other a s s e m b l e d g e n o m i c s e q u e n c e fragments from the latest whole g e n o m e shotgun a s s e m b l y ( M G S C v e r s i o n 3) w e r e obtained from the E n s e m b l g e n o m e server service (http://www.ensembl.org/Mus  musculus/)  ( E n s e m b l 2 0 0 2 ) using the S S A H A program a n d from N C B I using B L A S T . T h e Ly49bcontaining contigs from the initial version 3 s e q u e n c e a s s e m b l y w e r e identified a s c o n t i g _ 1 9 9 7 3 9 , c o n t i g _ 1 3 9 0 8 2 a n d c o n t i g _ 1 0 5 9 7 4 . T h e s e q u e n c e contig which contained the g e n e fragments lettered a , p, a n d y (which a l s o o v e r l a p p e d A C 0 8 7 3 3 6 ) w a s retrieved from N C B I m o u s e g e n o m e d a t a b a s e a s s e q u e n c e M m 6 _ W I F e b 0 1 _ 1 1 7 .  T h e current M G S C a s s e m b l y is b a s e d o n a F e b 2 0 0 2 d a t a f r e e z e that contains approximately 7x g e n o m e c o v e r a g e c o r r e s p o n d i n g to 9 6 % of m o u s e euchromatic D N A . T w o small g a p s remain within a s s e m b l e d s e q u e n c e for the cluster (excluding the W G S s e q u e n c e at the telomeric e n d of the cluster) u s e d for this a n a l y s i s , o n e between Ly49g a n d j a n d o n e between Ly49e a n d q. H o w e v e r b e c a u s e of the e x t e n s i v e m a p p i n g performed by our lab a s well a s others, in addition to the public B A C s e q u e n c e information, it is clear that the g a p s remaining must be quite small (<1 kb).  T h e range  74 of s e q u e n c e containing portions of the g e n e fragments p a n d y w h i c h d o e s not overlap A C 0 8 7 3 3 6 contains 4 g a p s of unknown s i z e a n d 1 g a p of known s i z e (509 bp). All of the g a p s from this a r e a cluster into two regions between fragment p a n d y a n d between e x o n 4 a n d 5 for F r a g m e n t y.  3.2.2 S e q u e n c e Alignments and phylogenetic a n a l y s i s T h e C l u s t a l X program w a s u s e d to perform the initial alignments of the Ly49 g e n e s e q u e n c e s . T h e g e n e s e q u e n c e s for Ly49c, e, f, g, h, /', j, k, /, m, and n w e r e first aligned a n d then the s e q u e n c e s for Ly49a, d a n d the novel g e n e x w e r e aligned to the other s e q u e n c e s using the profile alignment m o d e in C l u s t a l X . T h e s e q u e n c e s w e r e s u b s e q u e n t l y exported into the program G e n e d o c (http://www.psc.edu/biomed/genedoc/) for manipulation prior to being re-exported for phylogenetic a n a l y s i s . T h e penalty parameters for G a p O p e n i n g a n d G a p E x t e n s i o n w e r e 10 a n d 1 respectively. T h e M E G A 2 software p a c k a g e available freely at the website http://www.meqasoftware.net w a s u s e d to perform phylogenetic a n a l y s i s of the Ly49 g e n e s e g m e n t s . T h e aligned g e n e s e q u e n c e s w e r e imported in the program a n d the neighbour-joining method w a s u s e d to create the phylogenetic tree with the J u k e s C a n t o r m o d e l of nucleotide substitution. T o calculate the percent identities between various regions of the Ly49 g e n e s , portions of the g e n e s e q u e n c e w e r e exported to S e q w e b (http://www.accelrys.com) w h e r e the G A P program w a s u s e d to provide a n optimal global alignment for s e q u e n c e pairs. T h e g a p creation a n d extension penalties w e r e 30 a n d 3 respectively, e n d g a p s w e r e not p e n a l i z e d , a s w e r e g a p s larger than 15 bp. V e r s i o n 2.03 of S e q w e b w a s u s e d to perform the a n a l y s i s .  75 3.2.3 Repeat analysis and figure generation T h e individual g e n e s e q u e n c e s w e r e a l s o a n a l y s e d using the R e p e a t m a s k e r program (available at http://www.genome.washington.edu/UWGC/analysistools/repeatmask.htm) which identifies various families of repeats present in a nucleotide s e q u e n c e . T h i s d a t a , a s well a s the e x o n locations, w e r e u s e d a s m a s k files for the program p i p m a k e r (http://bio.cse.psu.edu/pipmaker/) which g e n e r a t e d a P D F figure of the location a n d orientation of all of the repeat s e q u e n c e s within the g e n e s a s well a s m a p p i n g the e x o n s in the d i a g r a m .  3.2.4 Dotplot A n a l y s i s All dotplots of the regions in cluster w e r e g e n e r a t e d using the Dotter program (available at http://www.cqr.ki.se/cqr/qroups/sonnhammer/Dotter.html).  Output  files w e r e s a v e d a s postscript files and imported into A d o b e P h o t o s h o p 5.0 for the addition of the labels a n d s y m b o l s u s e d .  76  3.3 RESULTS AND DISCUSSION 3.3.1 General arrangement of the Ly49 gene cluster in B 6 mice Figure 3-1 s h o w s a dotplot diagram of the entire cluster c o m p a r e d against itself along with the s e q u e n c e contigs and a s s e m b l i e s u s e d in this a n a l y s i s . T h e cluster is at least 6 2 0 kb in s i z e , excluding the region of at least 8 0 0 kb between Ly49b and the rest of the g e n e s (Depatie et al. 2000), which is c o m p a r a b l e to what h a s b e e n reported for the 129/J m o u s e strain (Makrigiannis et al. 2002). T h e telomeric end of the cluster is not yet precisely defined d u e to a g a p of known size (52 kb) at the e n d of the available s e q u e n c e a s well a s 4 g a p s of unknown s i z e within the s e q u e n c e before the known g a p . P r e v i o u s work had s h o w n that there were at least 14 Ly49 g e n e s within B 6 (Ly49a-n) (Brown et al. 1 9 9 7 a ; M c Q u e e n et al. 1998). Not all of the g e n e s are functional, a s it h a s b e e n s h o w n that Ly49k, n and m are likely p s e u d o g e n e s in this strain ( M c Q u e e n et al. 1999; K a n e et al. 2001). In addition, the Ly49l g e n e , which h a s b e e n identified a s a functional g e n e in the C B A and B a l b / c strain (Makrigiannis et al. 2 0 0 0 ; K a n e et al. 2001), a p p e a r s to have b e e n mostly deleted in B 6 . W e previously reported B 6 e x o n 2 a n d 7 s e q u e n c e s believed to be from Ly49l but were unable to detect e x o n 4 ( M c Q u e e n et al. 1998). It is now apparent that the previously reported e x o n 2 s e q u e n c e ( M c Q u e e n et al. 1998) w a s actually from Ly49m, s o e x o n 7 is the only Ly49l e x o n that could be found in the B 6 g e n o m i c s e q u e n c e .  O u r a n a l y s i s of the g e n o m i c s e q u e n c e in the B 6 strain revealed a total of 15 complete g e n e s a n d 3 g e n e fragments that are clustered together a n d which m a y represent two complete but rearranged g e n e s . T h i s n u m b e r is similar to the total n u m b e r of putative Ly49 g e n e s (19) identified in the 129/J cluster (Makrigiannis et al. 2002). All complete g e n e s in the B 6 strain are oriented in the s a m e transcriptional  77 o o o  / j/.  o o  / .• -... s.'v- ' .  y\ o o  §1  I  . "s-  • • '•y..yy.  A .  1  it-...' -' ••" ' :-  y. A  . .v.  .  -  . •  v'>-" ;; v ;  :  :  o o  - • •:  A y A y  o o  •**!*'  '/•.' •yy/  "y".  .;.:'/..;./ . . . . .  y .. .... .v.. • '  v-  •  x • -• ' v  !  o o  .  ,' '. '•>•.*  Pi  y\ . :t  ••  - .  / ' y •• T". , ": -  •'•  /  //:•  :  3  l  /  •/ .' / '•.  'Aw  \y y  •/  * . .'•  ....  '  y. -  . ••  /  /'  <yy  H3  '--  /  •  I'  10 WGS  WGS  AC090563 (RP23-45IF7) AC090127(RP23-128D23) Centromere  ^  ' • v..  ' . ' . , * .  IS  B  ..y \.  •  AC087336 (RP23-44607) Telomere  Figure 3-1 Dotplot of the entire Ly49 cluster against itself. T h e dotplot of the cluster w a s g e n e r a t e d a s d e s c r i b e d in the m e t h o d s s e c t i o n . Lettered b o x e s c o r r e s p o n d to the Ly49 g e n e s a n d the transcriptional orientation of the g e n e s is indicated by arrows. T h e s c a l e of the d i a g r a m is indicated in 10kb intervals o n the side of the d i a g r a m . T h e 3' e n d of Ly49q h a s not b e e n determined a n d this is s h o w n by a n o p e n b o x c o n n e c t e d to the known g e n e s e q u e n c e . T h e lines under the g e n e s indicate the regions w h i c h w e r e obtained from various s o u r c e s . G e n b a n k a c c e s s i o n n u m b e r s for the three B A C s u s e d are indicated. A portion of the contiguous s e q u e n c e a s s e m b l y from M G S C V 3 w a s u s e d to c l o s e the g a p between A C 0 9 0 1 2 7 a n d A C 0 8 7 3 3 6 a n d to extend the cluster s e q u e n c e o n the telomeric e n d . G a p s in the s e q u e n c e a r e indicated by vertical lines with lower c a s e "g"s beneath the s c a l e d i a g r a m of the cluster. G a p s in the region of the g e n e fragments a r e not s h o w n . T h e orientation of the s e q u e n c e contig o n the m o u s e c h r o m o s o m e is indicated by the centromere & telomere labels o n the bottom left a n d right s i d e s  78 direction a n d are closely s p a c e d . W e h a v e precisely located a n d ordered the previously identified Ly49 g e n e s (a through n, excluding b) a n d in addition, h a v e positioned two recently d e s c r i b e d g e n e s , Ly49q a n d Ly49x. Ly49q, w a s d e p o s i t e d into G e n b a n k a s a full length c D N A isolated from N K cells with no other information, while Ly49x w a s identified a s a p o s s i b l e h o m o l o g of the Ly49v g e n e in the 1 2 9 / J m o u s e strain, putatively e n c o d i n g a n activating receptor (Makrigiannis et a l . 2002). W e h a v e detected the 3' e n d of transcripts by R T - P C R for Ly49x that a p p e a r s to contain a reading frame shift w h i c h would result in a premature stop c o d o n in e x o n 5 (data not shown). C o m p a r i s o n s with the other Ly49 c D N A s a l s o indicate that a premature stop c o d o n exists in e x o n 5 without the o b s e r v e d reading frame shift, a n d therefore Ly49x is almost certainly a p s e u d o g e n e in B 6 m i c e .  T h e three g e n e fragments identified, termed a , (3 a n d y are at the telomeric region of the Ly49 cluster, but centromeric to the g a p between Ly49b a n d the other g e n e s . U s i n g the Ly49a c D N A a n d the B L A S T 2 program (Altschul et a l . 1997), a total of nine e x o n s h a v e b e e n identified. Extending from the 5' end of Ly49a, t h e s e e x o n s include hits for e x o n s 5, 4 , & 2 (fragment a ) followed by e x o n 6 a n d 7 (fragment p), a n d followed by e x o n 7, 6, 5 & 4 (fragment y). B e c a u s e of the rearranged s e q u e n c e in this part of the cluster the status of t h e s e g e n e s is not entirely clear. T h e fragment p s e q u e n c e s m a y h a v e originated a s part of a g e n e containing the fragment a s e q u e n c e s , creating a c o m p l e t e g e n e e x c e p t for e x o n 3. Similarly, the fragment y s e q u e n c e s m a y represent the end portion of a c o m p l e t e g e n e w h e r e the rest of the g e n e is in the 52 kb g a p in the a s s e m b l e d s e q u e n c e .  79 O n e unique feature of the Ly49 region is the ~ 5 5 k b of s e q u e n c e w h i c h is o v e r 6 5 % repetitive (primarily L T R retrotransposons) a n d which s e p a r a t e s Ly49q a n d e from the remaining g e n e s a s d i s c u s s e d in chapter 1. Ly49e has b e e n s h o w n to be the only Ly49 g e n e e x p r e s s e d in fetal N K cells while the other g e n e s tested are transcribed only in adults ( T o o m e y et a l . 1998; V a n B e n e d e n et a l . 2001). It is tempting to s p e c u l a t e that the repeat region between Ly49x a n d e m a y act a s a type of boundary e l e m e n t that allows g e n e s outside the proximal cluster to be regulated in a different f a s h i o n than the other Ly49 g e n e s . T h e e x p r e s s i o n pattern of the recently d e s c r i b e d Ly49q g e n e , located next to Ly49e, is unknown but will be interesting to investigate a s a test for this hypothesis. In addition to Ly49e and q, Ly49b exists outside the main cluster at a m u c h greater d i s t a n c e from the other g e n e s . It is a l s o intriguing that Ly49b, q a n d e, three g e n e s apart from the main cluster, s h a r e the most similarity with their alleles in 1 2 9 / J . All three are >99.5% identical between the two strains w h e r e a s other p r e s u m e d alleles are 9 8 % identical on a v e r a g e (Makrigiannis a n d A n d e r s o n 2000). In fact, alleles cannot be definitely identified for s e v e r a l of the g e n e s . A s previously p r o p o s e d (Makrigiannis et al. 2002), this m a y s u g g e s t that recombinations o c c u r r e d to h o m o g e n i z e the outlying g e n e s between a n c e s t o r s of the two strains or that functional constraints prevent the a c c u m u l a t i o n of s e q u e n c e c h a n g e s . A n o t h e r possibility is that t h e s e g e n e s are l e s s likely to undergo rearrangements, c o n v e r s i o n s or other c h a n g e s d u e to their location outside the main cluster. It will be n e c e s s a r y to e x a m i n e t h e s e g e n e s in other strains to gain insight into this question.  3.3.2 The C57BI/6 Ly49 cluster contains large duplicated regions A s would be e x p e c t e d for a cluster of related g e n e s , figure 3-1 s h o w s that n u m e r o u s h o m o l o g o u s regions of varying s i z e s are evident throughout the region. T h e  80  Figure 3-2 Dotplot of the duplicated region c o n t a i n i n g Ly49a, c and m. S e q u e n c e containing the Ly49a, c a n d m g e n e s w a s u s e d in a dotplot against the region containing Ly49n, i a n d g. Lettered b o x e s c o r r e s p o n d to the Ly49 g e n e s a n d the transcriptional orientation of the g e n e s is indicated by arrows. T h e s c a l e of the d i a g r a m is indicated in 5 k b intervals o n the s i d e of the d i a g r a m .  81 large s e g m e n t of approximately 55 kb toward the centromeric end h a s no homology to other parts of the cluster a n d , a s d i s c u s s e d a b o v e , s e r v e s to s e p a r a t e Ly49q a n d e from the remaining g e n e s . E x c e p t for this region, the uniform s p a c i n g s between the diagonal lines of similarity s u g g e s t s that the g e n e s duplicated in blocks containing o n e or more g e n e s with little or no unique D N A between the duplicated units. Interestingly, although the telomeric end of the cluster contains s e v e r a l g e n e fragments, this region h a s very little similarity to the rest of the cluster. B e c a u s e the g e n e fragments are quite divergent relative to the other Ly49 g e n e s (« 7 5 % identity overall), w e c o m p a r e d t h e m to the region containing Ly49b, which is a l s o divergent relative to the other Ly49 g e n e s , a n d to the g e n o m i c s e q u e n c e of the h u m a n Ly49. Neither of t h e s e regions s h o w e d a n y higher similarity to the g e n e fragments than did the other Ly49 g e n e s .  W e u s e d s e v e r a l features of the dotplot to help d e d u c e the nature of the duplication events that have o c c u r r e d . T h e most o b v i o u s continuous long block of similarity exists b e t w e e n the region s p a n n i n g Ly49m, c a n d a a n d the region including Ly49n, i a n d g. Figure 3-2 s h o w s a n e x p a n d e d c o m p a r i s o n of t h e s e two regions. T h e a r e a of highest h o m o l o g y begins at the 5' e n d of the Ly49n g e n e a n d extends to 8 kb b e y o n d the 5' end of Ly49g a n d s p a n s a distance of approximately 90 kb. T h e g a p s e e n in the c o m p a r i s o n of the 3' end of the Ly49g g e n e with respect to Ly49a c o r r e s p o n d s to a s e g m e n t of repetitive D N A which is present Ly49a but not g. A s illustrated below, Ly49a a n d g s h a r e a highly similar overall structure, with the exception of a large deletion of s e q u e n c e in the 6th intron of Ly49g. c D N A c o m p a r i s o n s h a v e a l s o s h o w n that Ly49c a n d / are very c l o s e l y related (96% identical in the coding region). T h u s , it a p p e a r s that a s e q u e n c e block duplicated to form the Ly49n - g a n d Ly49m - a  l.yllA  I  I  :::;;::: le.  i ; <; I  -la  LyWi I'  »•  I I  I  •• • • t-1  5  4  I  i  J  I  2  i  |  1  .  I  1  m  i  3  I  II  i  •  K  •  j  i  »  i  i  ;  S  4  II ;i I c  •  I  1 : 1  6  ';  1  L  4  I  2  I  II  i  I  4  I  I  I  •  i  5  II  I  5  2  I  I  ,|  j . I .1  I  I <  Figure 3-3 Scale diagram of all full-length Ly49 g e n e s in B6 m i c e . P i p m a k e r output files w e r e u s e d to g e n e r a t e a c o m p o s i t e d i a g r a m of all Ly49 g e n e s , s h o w i n g e x o n s a n d all repetitive s e q u e n c e s present within the g e n e s . T w o g a p s in the a s s e m b l y of Ly49b g e n e are indicated by vertical lines through the g e n e . T h e dark n u m b e r e d b o x e s c o r r e s p o n d to e x o n s , with the recently characterized fetal promoter e l e m e n t s m a r k e d a s e x o n -1a w h e r e present. T h e majority of repetitive s e q u e n c e s within the g e n e s b e l o n g to the L I N E c l a s s (light gray arrow boxes). L T R e l e m e n t s are s h o w n a s black arrow b o x e s a n d s i m p l e s e q u e n c e repeats a s white b o x e s .  83 regions. T h i s duplication most likely o c c u r r e d more recently than s o m e of the other block duplication events b e c a u s e the region of similarity is largely u n b r o k e n . A potentially older duplication event involving t h e s e g e n e s is s h o w n a s a l e s s well c o n s e r v e d line of similarity between this s a m e region a n d the block containing the x, f a n d d g e n e s . M o r e recent duplication events are evident in the region containing Ly49i, n, h a n d k a n d the relationships of t h e s e g e n e s will be d i s c u s s e d further below.  3.3.3 R e l a t i o n s h i p s of the Ly49 genes Figure 3-3, which w e g e n e r a t e d using the P i p m a k e r program (see section 3.2.3), s h o w s a s c a l e d i a g r a m of 15 Ly49 g e n e s , excluding the largely deleted Ly49l, but including the e x o n s a n d repetitive s e q u e n c e s present within a n d flanking the g e n e s . Differences in g e n e s i z e s d u e to intronic repetitive s e q u e n c e s are apparent, a s are s h a r e d a n d unique repeats. T h e structure of the Ly49 g e n e s is very similar with the majority of g e n e s having 7 e x o n s , the last 6 of w h i c h are c o d i n g . A careful investigation of s e v e r a l previously submitted Ly49 c D N A s e q u e n c e s in G e n b a n k a n d the surrounding g e n o m i c s e q u e n c e h a s revealed that all Ly49 g e n e s e x c e p t Ly49q have a 78 bp intron s e q u e n c e in the middle of the last e x o n of the transcript. In s e v e r a l g e n e s including Ly49a a n d d, splice site mutations are present which prevent the removal of this intron s e q u e n c e (data not shown). H o w e v e r other g e n e s that h a v e correct splice d o n o r a n d a c c e p t o r sites apparently a l s o fail to splice out this intron s e q u e n c e in s o m e instances ( S t o n e m a n et a l . 1996). In light of the inconsistent removal of this last intron, the s c h e m a t i c representations of the Ly49 g e n e s in figure 3-3 depict the last e x o n of all g e n e s except Ly49b a s having no intron spliced out. Ly49b has c a n o n i c a l splice a c c e p t o r a n d d o n o r sites a n d all full length c D N A s d e p o s i t e d in G e n b a n k s h o w that the 78 bp intron is r e m o v e d .  84  Figure 3-4 Phylogenetic trees of B6 Ly49 genes. Part A s h o w s the phylogenetic tree b a s e d o n the aligned g e n o m i c s e q u e n c e s of 14 full length (exons 1-7, with the exception of Ly49q(1-6)) g e n e s , created using the neighbour joining method. T h e letters c o r r e s p o n d to the s a m e Ly49 g e n e . Parts B a n d C s h o w similarly constructed trees using approximately 1.4 kb portions of aligned s e q u e n c e from intron 1 a n d intron 6 respectively. A d i v e r g e n c e s c a l e is s h o w n below e a c h of the trees.  85 R e c e n t l y , transcripts originating from a n u p s t r e a m alternative promoter with a different first e x o n have b e e n detected for Ly49a, e and g a n d for s o m e g e n e s in the 129/J strain ( S a l e h et al. 2002). T h e region c o r r e s p o n d i n g to this alternative first e x o n is c o n s e r v e d in all the g e n e s e x c e p t Ly49b a n d q and is s h o w n a s e x o n 1a in the d i a g r a m . If e x o n 1a is taken a s the start of the g e n e , then g e n o m i c s i z e s of the Ly49 g e n e s range from 18 to 34 kb. A full length c D N A of Ly49q h a s b e e n reported but e x o n 7 w a s not within the s e q u e n c e d contig, suggesting Ly49q h a s a final intron larger than 12 kb. In a g r e e m e n t with this, a s e a r c h of the latest a s s e m b l y of the public m o u s e g e n o m e (http://www.ensembl.org/Mus_musculus/) indicates that the last e x o n of q is approximately 3 2 . 5 kb distant from the rest of the g e n e . W e h a v e u s e d the p r e s e n c e of s h a r e d repetitive s e q u e n c e s to help determine the history of t h e s e g e n e s a n d s o m e of the repeats that are particularly informative are listed in table 3-2. T h i s table a l s o includes the status of t h e s e specific repeats in the Ly49b g e n e , the s e q u e n c e of w h i c h is mostly c o m p l e t e (see section 3.2.3). T h e relative a g e s of the repeats, a s estimated by their d i v e r g e n c e from the repeat family c o n s e n s u s (Jurka 2 0 0 0 ) , a n d their p r e s e n c e or a b s e n c e in the different g e n e s have b e e n u s e d to help construct a model for the formation of the Ly49 cluster presented below.  W e created the phylogenetic tree s h o w n in figure 3-4a by using a multiple alignment of the g e n o m i c s e q u e n c e s s p a n n i n g e x o n s 1 to 7 of 15 Ly49 g e n e s . A s h a s b e e n evident from previous c D N A c o m p a r i s o n s (Smith et a l . 1994; M c Q u e e n et a l . 1998; Makrigiannis a n d A n d e r s o n 2000), the tree provides further support for a c o m m o n origin of groups of Ly49 g e n e s . T w o primary groups are clearly distinguishable - o n e consisting of Ly49a, d, g, m a n d x a n d the other containing the remaining g e n e s e x c e p t for Ly49q. T w o more c l o s e l y related s u b g r o u p s of Ly49c/i/j a n d Ly49h/k/n are readily  86  Figure 3-5 Dotplot of the duplicated region c o n t a i n i n g Ly49h, If a n d n. S e q u e n c e containing the Ly49h, k a n d n g e n e s w a s u s e d in a dotplot a g a i n s t itself. Lettered b o x e s c o r r e s p o n d to the Ly49 g e n e s a n d the transcriptional orientation of the g e n e s is indicated by arrows. T h e s c a l e of the diagram is indicated in 5 k b intervals o n the side of the d i a g r a m .  87 apparent, indicating relatively recent duplications or g e n e c o n v e r s i o n s involving t h e s e sets of g e n e s . Additional levels of evolutionary complexity involving t h e s e g e n e s is revealed by c o m p a r i n g phylogenetic trees constructed from different intronic s e g m e n t s . Figure 3-4b a n d 3-4c respectively s h o w trees of intron 1 a n d a similarly-sized region of intron 6. T h e similarity relationships of t h e s e s e g m e n t s are substantially different a m o n g the g e n e s . F o r e x a m p l e , a s d i s c u s s e d further below, intron 1 of the Ly49h, n, k group clusters with Ly49d, m a n d x. In addition, intron 1 of Ly49g a n d a is c l o s e r to the Ly49cli group but intron 6 clusters definitively with Ly49d, m a n d x. S u c h differences indicate that multiple recombinations or c o n v e r s i o n s h a v e o c c u r r e d during the formation of this cluster.  Ly49 m o l e c u l e s are type II t r a n s m e m b r a n e proteins w h e r e e x o n 2 e n c o d e s the intracellular d o m a i n , e x o n 3 the t r a n s m e m b r a n e region a n d e x o n s 4-7 the extracellular portion, including the C-type lectin-like d o m a i n (Takei et a l . 1997). A s mentioned a b o v e , the g e n e s c a n be functionally divided into those e n c o d i n g inhibitory or activating receptors with the inhibitory form being the likely ancestral type. T h i s division is b a s e d o n a m i n o acid differences in e x o n s 2 a n d 3. In e x o n 2, inhibitory receptor g e n e s h a v e a n ITIM ( i m m u n o r e c e p t o r t y r o s i n e - b a s e d inhibitory motif) ( R y a n a n d S e a m a n 1997) w h e r e a s activating Ly49 receptor g e n e s lack s u c h a n ITIM. T h e t r a n s m e m b r a n e d o m a i n s (exon 3) in activating receptors are distinguished by the p r e s e n c e of a c h a r g e d arginine residue w h i c h is required for m e m b r a n e a s s o c i a t i o n with the D A P 1 2 signalling m o l e c u l e (Smith et a l . 1998). In C 5 7 B I / 6 , Ly49d a n d h are known activating receptors ( M a s o n et a l . 1996; G o s s e l i n et a l . 1999) a n d Ly49k, n, m ( M c Q u e e n et a l . 1998) a n d x h a v e the s e q u e n c e characteristics of activating receptor g e n e s . All others e n c o d e known or putative inhibitory receptors. A s is evident from figure 3 - 4 a , activating a n d  Table 3-1 Percentage Identity of Ly49h to other genes  Region Region Region Region  1 2 3 4  Ly49k 96.6 94.6 91.1 96.4  Jl  Region 1  Ly49n 96.8 95.9 86.6 94.4  Ly49i 74.0 88.5 97.8 96.8  Ly49d 82.7 80.5 71.6 63.1  IL  Region 2 Region 3  Region 4  Ly49m 82.9 80.9 71.5 65.4  inhibitory receptors fall into both primary groups b a s e d o n overall s e q u e n c e similarity. W h i l e it is p o s s i b l e that the progenitor activating forms a r o s e more than o n c e , w e c o n s i d e r this s c e n a r i o unlikely a n d our model presented below a c c o u n t s for the current g e n e content through the creation of a single activating receptor progenitor g e n e .  3.3.4 Formation of Ly49h W e e x a m i n e d Ly49h in more detail to illustrate the c o m p l e x history of the Ly49 g e n e s . T h i s g e n e is of particular interest s i n c e it e n c o d e s a n activating receptor that confers resistance to M C M V (Brown et a l . 2 0 0 1 ; L e e et a l . 2 0 0 1 a ; A r a s e et a l . 2 0 0 2 ) a n d a p p e a r s to be present in only a few inbred strains related to B 6 (Lee et a l . 2001b) s i n c e most inbred strains are C m v . A s illustrated in figures 3-1 a n d 3-4, this g e n e is s  c l o s e l y related to Ly49k a n d n, both of which w e r e reported to be p s e u d o g e n e s b a s e d o n c D N A a n a l y s i s ( M c Q u e e n et a l . 1999). T h e g e n o m i c s e q u e n c e of t h e s e g e n e s confirms that they are defective. Ly49k h a s a termination c o d o n at the e n d of e x o n 4 a n d a partial deletion of e x o n 5 while Ly49n h a s a splice a c c e p t o r site mutation at the beginning of e x o n 4 that c a u s e s aberrant splicing 7 bp d o w n s t r e a m .  All of the g e n e s s h a r e a high level of identify with e a c h other, suggesting that the duplications/rearrangements which created t h e s e g e n e s o c c u r r e d relatively recently. T h e duplicated s e g m e n t s containing the k, h a n d n g e n e s are 3 2 - 3 4 kb in length a n d are j u x t a p o s e d e n d to end with the left end located approximately 7.5 kb u p s t r e a m of the e x o n 1a s e q u e n c e of Ly49d (see figure 3-3). T h i s is illustrated by a dotplot c o m p a r i s o n of the region s h o w n in figure 3-5. A lower level of s e q u e n c e identity is evident c o m p a r i n g the 5' end of the Ly49i g e n e to the Ly49h, k a n d n. A s s h o w n in figure 3-4b for intron 1, c o m p a r i s o n s of the Ly49 g e n e s s p a n n i n g the first three e x o n s  90  Figure 3-6 Model for evolution of the Ly49h, k and n g e n e s . G e n e s are represented by large black or white b o x e s with the direction of transcription of g e n e s from right to left. Activating receptors are s h a d e d black and inhibitory receptors are white. L I N E s e q u e n c e s present in the intergenic s e q u e n c e are s h o w n a s s m a l l e r b o x e s s h a d e d in various patterns. U n i q u e repeats within the cluster are lettered A - E a n d the s e r i e s of e v e n t s d i s c u s s e d in the text are n u m b e r e d 1-5. T h e straight arrows denote duplication events while the c u r v e d arrow indicates an insertion event. Part A is not s h o w n to scale.  91 reveal that this part of Ly49h, k a n d n is more similar to the Ly49x, m a n d d group, suggesting a g e n e rearrangement event prior to the duplication that created h, k a n d n. T h e similarity b e t w e e n the hlkln group a n d , in particular, m a n d d is a l s o o b v i o u s w h e n c o m p a r i n g the repetitive s e q u e n c e s between e x o n 1 a n d 1 a . T h e s e five g e n e s s h a r e repeats which the other g e n e s lack (table 3 - 1 ; figure 3-3). C l o s e r examination of s e q u e n c e relationships s u g g e s t s that other events contributed to the creation of Ly49h, a n d this is illustrated T a b l e 3-2. T h e first part of the h g e n e extending to just after e x o n 3 is more c l o s e l y related to Ly49d and m than to Ly49i. After that point, k, n a n d h are most c l o s e l y related to e a c h other until approximately 150 bp 3' of e x o n 4 . In the next interval, which is all within intron 4 , Ly49h is clearly most similar to Ly49i or c. After intron 4 , Ly49h is equally related to k, n, i a n d c. T h i s s u g g e s t s that at least o n e , a n d possibly m o r e , g e n e c o n v e r s i o n s or recombinations w e r e involved in s h a p i n g the Ly49h gene.  Figure 3-6 illustrates a more detailed model for the duplication events that likely o c c u r r e d to generate Ly49h, k a n d n. B a s e d o n s h a r e d repeats in the intergenic s p a c e (lined b o x e s ) , it a p p e a r s that a n ancestral event duplicated Ly49i, including the 3' intergenic region, which led to the g e n e arrangement s h o w n o n top line of figure 3-6 ( d i s c u s s e d further below). T h e progenitor for the h, k a n d n g e n e s is then p r o p o s e d to h a v e b e e n created by a fusion of the Ly49/'-like g e n e with a n activating receptor g e n e in a recombination event, n u m b e r e d 1 in figure 3-6. T h e intergenic s e q u e n c e s to the right of Ly49d a n d left of Ly49i s h a r e overall similarity, but there are s e v e r a l unique repetitive s e q u e n c e insertions s h o w n in the figure a s lettered b o x e s A - D . B y noting the p r e s e n c e or a b s e n c e of t h e s e repeats, w e define the duplication unit (underlined a s event 2) a s  92 starting at the e n d of e x o n 7 of the hybrid g e n e created in event n u m b e r 1 to the e n d of Ly49i. A n o t h e r L I N E s e q u e n c e (box E ) inserted (event 3) upstream of the "leftmost" hybrid g e n e shortly after this unit first duplicated (based o n d i v e r g e n c e v a l u e s of repeat s e q u e n c e s ) . T h i s now enlarged unit duplicated a s e c o n d time (event 4) to generate the current g e n e arrangement. A s u b s e q u e n t g e n e c o n v e r s i o n event (event 5), a s d i s c u s s e d earlier, is p r o p o s e d to have occurred between Ly49i and h.  It h a s b e e n recently s h o w n that Ly49h in B 6 mice binds a n M H C - l i k e protein, m 1 5 7 , e n c o d e d by M C M V and confers host viral resistance by activating killing of infected cells ( A r a s e et a l . 2002). N o inhibitory receptors in B 6 m i c e apparently bind m 1 5 7 . Interestingly, in the M C M V - s e n s i t i v e strain 1 2 9 / J , Ly49/' binds m 1 5 7 a n d 129  inhibits killing of infected cells, suggesting that m 1 5 7 evolved to help the virus e v a d e N K killing by mimicking normal M H C c l a s s I. S u c h findings lend weight to the idea that inhibitory receptors are n e c e s s a r y to prevent autoimmunity but activating receptors evolve to fight p a t h o g e n s ( K h a k o o et a l . 2 0 0 0 ; A r a s e et a l . 2002). In the specific c a s e of Ly49h, o u r a n a l y s e s s h o w that its creation involved fusion of a Ly49d/m-\ike activating region (exons 1-3) to the extracellular portion of a n Ly49/'-like g e n e followed by further g e n e c o n v e r s i o n events. T h e genetic o u t c o m e that, by c h a n c e , conferred protection against M C M V would likely have b e e n under strong positive selection to b e c o m e fixed if e x p o s u r e to the virus w a s e n d e m i c during the evolutionary history of C57BL/6.  3.3.5 A model for evolution of the Ly49 gene family O u r a n a l y s i s , c o u p l e d with the recently published order of Ly49 g e n e s in the 129/J strain (Makrigiannis et a l . 2002), c a n be u s e d to p r o p o s e a p o s s i b l e s c h e m e for  93 creation of the Ly49 g e n e cluster present in B 6 m i c e (figure 3-7). T h i s model is consistent with the overall similarity relationships between g e n e s , the dotplot c o m p a r i s o n s a n d the p r e s e n c e of repetitive s e q u e n c e s but other s c e n a r i o s are a l s o p o s s i b l e . T h e model d o e s not deal with events leading to the creation of the g e n e fragments at the telomeric end of the cluster, nor c a n it a d d r e s s all the differences b e t w e e n the inbred strains of mice. Furthermore, it is almost certain that multiple g e n e c o n v e r s i o n e v e n t s h a v e o c c u r r e d which c o m p l i c a t e s s u c h a n a l y s i s . With t h e s e provisos, w e will d i s c u s s our p r o p o s e d model by referring to e a c h n u m b e r e d line in figure 3-7. (0) T h e purple g e n e represents the ancestral g e n e after the split from the more divergent a n d physically distant Ly49b. R e p e a t 2 integrated here s i n c e it is present in all g e n e s e x c e p t Ly49b. (1) A duplication event split the g e n e s into "red" a n d "blue" progenitors. R e p e a t 24 must have integrated into the red progenitor at this point. (2) Ly49q w a s most likely formed by o n e of the first duplications of the red progenitor s i n c e it is quite divergent from the others but s h a r e s repeat 24 with other red-type g e n e s (Table 3-2). R e p e a t s 12, 2 5 a n d 2 6 , in c o m m o n to Ly49a, d, g, m a n d x, likely inserted in the blue progenitor here. (3) A duplication of the block of two g e n e s a s s h o w n is a likely next step. R e p e a t 14 must h a v e inserted here or slightly later. (4) W e then p r o p o s e that the leftmost "blue" g e n e duplicated to form two g e n e s that will eventually r e c o m b i n e to form Ly49x (see lines 7-8). In this m o d e l , the black g e n e marked "act." in figure 3-7 is the progenitor of all the activating receptors (shown later a s white/black). W e p r o p o s e that the c h a n g e s to e x o n 2 a n d 3 n e c e s s a r y for activating function a n d the insertion of repeats 1 a n d 7 o c c u r r e d in this g e n e prior to the next block duplication. (5) T h e first duplication of a block of three g e n e s took place a n d a g e n e c o n v e r s i o n event m a y have o c c u r r e d at this point or later to m a k e the s e q u e n c e of Ly49e more similar to the other "red" g e n e s . T h i s stage is the most probable insertion  94 Table 3-2 Repetitive elements within Ly49 genes  a  b  c  Type of repetitive sequence as given by Repeatmasker. Not all repeats are listed. Percent divergence of repeat from the consensus sequence. Higher values indicate an older age. lntron location of the repeat. Repeats 1-3 are 5' of exon 1 and repeat 26 is 3' of exon 7.  95 time interval for repeats 8 a n d 9, s h a r e d by a a n d g; a n d repeats 18 a n d 2 0 , found in c, h, i,j, k a n d n. (6) B a s e d on the 129/J g e n e order, w e p r o p o s e that the a n c e s t o r of Ly49t, w h i c h is present in 1 2 9 / J but a b s e n t in B 6 w a s d e l e t e d . T h i s line a l s o s h o w s the block of three g e n e s duplicating to form the eventual "ri'-i-g a n d m-c-a units w h i c h are evident from the dotplot c o m p a r i s o n s . R e p e a t 10, w h i c h is s h a r e d by h, k a n d n, could h a v e inserted here or later in the s c h e m e . (7) B a s e d o n information from 1 2 9 / J m i c e , a duplication involving the Ly49q-e block m a y h a v e taken p l a c e to form the q2 a n d e/c2 g e n e s present in 129/J but not B 6 . (8) T h e s e latter two g e n e s w e r e likely deleted w h e n two g e n e s present in 1 2 9 / J r e c o m b i n e d to create Ly49x. T h i s possibility w a s recently s u g g e s t e d (Makrigiannis et a l . 2002) a n d is supported by a c o m p a r i s o n of the L y 4 9 v  1 2 9  c D N A a n d the g e n o m i c region containing Ly49x. W h i l e the 3' region of the Ly49x g e n e , p r o p o s e d to have b e e n derived from L y 4 9 v high (>95%) identity to L y 4 9 v  1 2 9  1 2 9  , h a s e x o n 5, 6, & 7 m a t c h e s with  , this similarity d e c r e a s e s (s 8 5 % ) for e x o n 1,2,3, & 4 ,  p r o p o s e d to h a v e b e e n derived from Ly49l/r . :29  A g a i n , a lack of 1 2 9 / J g e n o m i c  s e q u e n c e prevents identification of the precise recombination point.  Line 8 of the figure a l s o s h o w s duplication of the two g e n e block containing the Ly49d a n d /' progenitors a s d i s c u s s e d a b o v e . In addition, w e postulate that the Ly49g progenitor duplicated with the resulting right-hand g e n e , then recombining with the rightmost "black/white" g e n e to create the Ly49m/I progenitor in line 9. T h i s recombination event is p r o p o s e d b e c a u s e Ly49m is most c l o s e l y related to Ly49g in the 3' portion of the g e n e (figure 3-4c a n d data not shown). Line 8 a l s o s h o w s a p o s s i b l e g e n e c o n v e r s i o n event resulting in donation of s e q u e n c e s from the 5' portion of the Ly49m progenitor to Ly49d. T h i s event is p r o p o s e d b e c a u s e Ly49d a n d m s h a r e repeats 4 a n d 5 in their 5' regions, which are not found in any of the other g e n e s . T h e  96 similarity of the 5' parts of t h e s e two g e n e s is also s h o w n in figure 3-4b. (9) A s s h o w n in figure 3-6, w e p r o p o s e that a recombination event o c c u r r e d to form a "fusion" g e n e the progenitor of k, h a n d n. Furthermore, d u e to the high similarity of Ly49c, i and j, w e s u g g e s t that a relatively recent c o n v e r s i o n event o c c u r r e d to h o m o g e n i z e the s e q u e n c e s of t h e s e two g e n e s . (10-11) T h e h/k/n progenitor duplicated a n d repeat 3 integrated into o n e c o p y (this is repeat E in figure 3-6). T h e two-gene block boxed o n line 9 likely duplicated to form Ly49l and j a n d Ly49m a n d c. R e p e a t 11 is specific to Ly49j a n d s o must h a v e integrated after this duplication event. W e p r o p o s e that a deletion o c c u r r e d that r e m o v e d most of Ly49l a s well a s the intervening s e q u e n c e between Ly49l a n d j. W e previously reported that Ly49j similarity with Ly49i a n d c at the 3' e n d of the g e n e s c e a s e d within the 3' U T R ( M c Q u e e n et a l . 2001), a point that c a n now be defined a s the deletion junction. E x o n 7 a n d part of the last intron are all that remain of Ly49l, with this last e x o n located 2.6 kb 3' of Ly49j. A n o t h e r g e n e c o n v e r s i o n event is p r o p o s e d to explain the fact that Ly49h is most similar to /, c a n d j in a portion of its s e q u e n c e . R e p e a t s 2 2 a n d 2 3 , w h i c h are L y 4 9 d - s p e c i f i c , repeats 6 a n d 21 (Ly49x-specific) a n d repeat 13 (Ly49c/-specific) are s h o w n at likely points of integration b a s e d on their relative d i v e r g e n c e s from c o n s e n s u s (age). T h e only repeat w h i c h d o e s not fit this model is repeat 16 which is present in Ly49a, d a n d x, but not in g a n d m a s might be e x p e c t e d . It is p o s s i b l e that this repeat w a s deleted in the latter two g e n e s or that a g e n e c o n v e r s i o n or rearrangement o b s c u r e d its origin.  T h e reconstruction of ancient duplication events illustrated in figure 3-7 is not only of a c a d e m i c interest, but a l s o provides insight into the m e c h a n i s m s of rapid g e n e e x p a n s i o n . W e h a v e u s e d information from the distribution of repeats within the Ly49 g e n e cluster, a phylogenetic tree b a s e d on a 4 0 kb multiple s e q u e n c e alignment file of  97 all of the Ly49 g e n e s (excluding Ly49b a n d /) a s well a s information from the dotplots of the cluster to d e v e l o p a model for the generation of the present d a y cluster of g e n e s . T h i s model e x p l a i n s s o m e of the Ly49 g e n e differences b e t w e e n 1 2 9 / J a n d B 6 but a c o m p l e t e s e q u e n c e of the region in 1 2 9 / J o r other strains will b e n e c e s s a r y to fully understand the evolutionary relationships a n d history of t h e s e g e n e s in the m o u s e . W h i l e it is p o s s i b l e a n d e v e n likely that s o m e a s p e c t s of the m o d e l a r e incorrect, it s e r v e s to illustrate the genetic fluidity of this region. It h a s b e e n formed by single a n d block duplications of g e n e s , a s well a s deletions, c o n v e r s i o n s a n d other r e a r r a n g e m e n t s resulting in a highly variable a n d c o m p l e x l o c u s in the m o u s e .  3.3.6 Potential role of repetitive sequences In addition to constructing o u r model for the e x p a n s i o n of the Ly49 g e n e s , w e h a v e a n a l y z e d the e n d s of s e v e r a l of the duplication regions to look for repetitive s e q u e n c e s o r other unusual features. Although w e could not identify a n y remarkable s e q u e n c e features that m a y c a u s e this region to be particularly prone to recombination, w e h a v e found that for the duplication region involving Ly49a a n d c, there a r e L I N E s e q u e n c e s in the g e n e r a l region of the b o u n d a r i e s , s u g g e s t i n g that they m a y h a v e facilitated the e x p a n s i o n of the cluster. H o w e v e r , in the c a s e of the recent duplications of Ly49h, k a n d n, n o e v i d e n c e could b e found for a specific role of repetitive s e q u e n c e s mediating recombination events. S u c h a n a l y s e s a r e c o m p l i c a t e d by the fact that a n c e s t r a l repeat s e q u e n c e s m a y h a v e b e e n deleted o v e r time a n d a l s o that g e n e c o n v e r s i o n events m a y o b s c u r e regions involved in the duplication. Furthermore, s i n c e the cluster is c o m p o s e d of end-to-end duplications, it is difficult to define s u c c e s s i v e duplication endpoints. W e did o b s e r v e that the right e n d point of the duplication creating Ly49j can b e localized to a simple s e q u e n c e ( T A G A ) repeat approximately n  98  Figure 3-7 Model for evolution of the Ly49 gene c l u s t e r in C57BL/6 mice. G e n e s are represented by s m a l l b o x e s a n d are not to s c a l e . T h e direction of transcription of all g e n e s is right to left. S o l i d arrows s h o w duplication e v e n t s with the thick a r r o w s denoting block (boxed) duplications involving more than o n e g e n e . E x c e p t for the first duplication a n d the o n e involving Ly49k, h a n d n, the color/pattern of o n e of the duplicated g e n e s r e m a i n s the s a m e a s the parent while the other h a s b e e n g i v e n a different pattern of the s a m e color family. D a s h e d a r r o w s s h o w recombinations leading to g e n e deletions. C u r v e d lines indicate possible g e n e c o n v e r s i o n s . T h e " 1 2 9 " a b o v e the deleted or c r o s s e d - o u t g e n e s s h o w s g e n e s present in the 1 2 9 / J strain but not in C 5 7 B L / 6 . N u m b e r s a b o v e the g e n e s s h o w probable insertion points of the repetitive s e q u e n c e s listed in T a b l e 3-2.  99 1.7 kb 5' of the Ly49j e x o n 1 a a n d just 3' of Ly49m. W e a l s o noticed that the g e n e c o n v e r s i o n event involving Ly49h a n d Ly49ilc begins at the point w h e r e the alignment of the highly similar Ly49i, c a n d j g e n e s is interrupted by a 6 0 0 bp stretch of L I N E s e q u e n c e unique to Ly49j (repeat 11 in figure 3-6b a n d T a b l e 3 - 1 . A s mentioned a b o v e , for a n interval b e y o n d this point, Ly49h is most similar to Ly49i/c/j. It s e e m s highly co-incidental that the c o n v e r s i o n should h a v e b e e n initiated at this point by c h a n c e but it is not clear what the mechanistic significance of the Ly49j L I N E s e q u e n c e might b e . '  With respect to simple s e q u e n c e repeats or microsatellites, there are a large n u m b e r within the Ly49 g e n e s , a n d this is characteristic of m o u s e g e n o m i c D N A which h a s higher densities of t h e s e repeats c o m p a r e d to h u m a n s (Kruglyak et a l . 1998; G l u s m a n et a l . 2 0 0 1 ; W a t e r s o n et a l . 2002). It h a s b e e n s u g g e s t e d that stretches of pyrimidine-purine d i m e r s act a s signals for g e n e c o n v e r s i o n regulation in s e v e r a l loci (Martinsohn et a l . 1999). W e could not pinpoint s u c h repeats to p r e c i s e g e n e c o n v e r s i o n b o u n d a r i e s , but, a s mentioned a b o v e , o n e endpoint of the Ly49j "insertion" s e e m s to be located in a ( T A G A ) repeat. In addition, w e noted s e v e r a l e x a m p l e s of n  microsatellites being immediately j u x t a p o s e d to other retroelements, in keeping with reports that s u c h s e q u e n c e s m a y promote recombination or maintain a n " o p e n " form of chromatin (Liao a n d W e i n e r 1995). W e a l s o c o m p a r e d the lengths of p a r a l o g o u s microsatellites present in the different g e n e s b e c a u s e it h a s b e e n s h o w n that allele lengths of repeats at equilibrium follow a b a l a n c e d , b e l l - s h a p e d distribution (Xu et a l . 2000). A relatively old ( T A A ) repeat present in all g e n e s e x c e p t Ly49q a n d b a n d n  found u p s t r e a m of e x o n 1 is highly d e g e n e r a t e a n d h a s a rather tight length distribution of 63-97 bp. In contrast, y o u n g e r repeats found in only s u b s e t s of g e n e s are more  100 variable in length (data not shown). A n extreme e x a m p l e is the ( C A / T G / T A )  n  repeat  found in the recently duplicated Ly49h, k a n d n g e n e s w h e r e repeat s i z e s range from 14 to 152. W h i l e s u c h a wide variation in length within highly related g e n e s could be d u e to replication s l i p p a g e , it is p e r h a p s more likely that g e n e c o n v e r s i o n and/or c r o s s o v e r are responsible for this magnitude of variation (Richard a n d P a q u e s 2000). If this is the c a s e , then the variable microsatellites within the cluster s u g g e s t that the potential for ongoing rearrangements involving t h e s e g e n e s remains high.  3.3.7 C o m p a r i s o n s to the KIR region It is interesting to c o m p a r e g e n o m i c characteristics of the m o u s e Ly49 cluster to that of the h u m a n K I R region s i n c e both g e n e families, while structurally unrelated, serve a n a l o g o u s functions in N K cells. P r e v i o u s studies of the s m a l l e r K I R locus h a v e s h o w n that the g e n e s are very c l o s e l y s p a c e d , l e s s than 3 kb apart in most c a s e s , a n d are all oriented in the s a m e transcriptional direction. Furthermore, dot matrix a n a l y s i s s h o w s that the K I R g e n e s form a nearly continuous stretch of related s e q u e n c e o v e r a region s p a n n i n g 150 kb (Wilson et a l . 2000). A n a l y s i s of the a g e s of repetitive s e q u e n c e s within the K I R s s u g g e s t s that the g e n e s amplified in primates during the last 4 0 million y e a r s (Martin et a l . 2000). M o s t Ly49 g e n e s are a l s o c l o s e l y s p a c e d . If the recently d e s c r i b e d e x o n 1a is taken a s the start of the g e n e , most intergenic d i s t a n c e s within the core group of g e n e s range from 7 to 9 kb. Ly49g is s o m e w h a t more s e p a r a t e d , being 21 kb from Ly49i a n d 2 8 kb from the e x o n 7 remnant of Ly49l. Furthermore, like the K I R region, the Ly49 cluster is c o m p o s e d of a largely continuous stretch of blocks of related s e q u e n c e , a result of s u c c e s s i v e duplications.  It h a s b e e n s h o w n that there are two distinct K I R haplotypes in h u m a n s , w h e r e a  s u b s e t of g e n e s are a b s e n t from the s e c o n d haplotype. T h e e x i s t e n c e of haplotypes that s h a r e certain g e n e s at specific locations within the cluster h a s s u g g e s t e d the possibility that t h e s e g e n e s represent "framework g e n e s " (Wilson et a l . 2000). Additionally, although the haplotypes are smaller, the e x i s t e n c e of framework g e n e s has b e e n e x t e n d e d to the K I R g e n e s within the pygmy c h i m p a n z e e ( R a j a l i n g a m et a l . 2001), s u g g e s t i n g that this g e n e arrangement h a s b e e n present a n d maintained for a c o n s i d e r a b l e period of time. T h e recent c o m p a r i s o n of Ly49 g e n e content b e t w e e n the 129 a n d B 6 inbred strains s u g g e s t s that, like the K I R cluster, there is plasticity in the g e n e cluster (Makrigiannis et a l . 2002). Despite this similarity, there is currently insufficient e v i d e n c e to s u g g e s t that s u c h framework g e n e s exist within the Ly49 family. W h i l e there are Ly49 transcripts s u c h a s Ly49e (Makrigiannis et a l . 2001) a n d b ( G e n b a n k a c c e s s i o n # A F 2 5 3 0 5 9 , A F 2 5 3 0 5 8 , A F 2 5 3 0 5 7 ) which are nearly identical between inbred stains, a s w e h a v e illustrated, t h e s e g e n e s lie outside the main Ly49 cluster. S u c h outlying g e n e s m a y simply have b e e n left out of the recombination events that o c c u r r e d in the generation of cluster diversity a n d therefore w o u l d not be a n a l o g o u s to the framework pattern o b s e r v e d for the K I R g e n e s .  Unfortunately, a s s i g n i n g time intervals to the Ly49 duplication e v e n t s using approximate a g e s of the inserted retroelements is problematic b e c a u s e there remains c o n s i d e r a b l e controversy o v e r the neutral mutation rate in rodents. S o m e studies h a v e c o n c l u d e d that the mutation rate in rodents is significantly higher than in primates with published rates ranging a s high a s 8 x 10" /bp/yr for rodents (Li 1991). In contrast, a 9  recent a n a l y s i s found basically the s a m e rate of 2.2 x 10" /bp/yr w h e n c o m p a r i n g all 9  m a m m a l s ( K u m a r a n d S u b r a m a n i a n 2002). A n o t h e r recent study of retroelements derived a figure of - 8 % d i v e r g e n c e to represent 2 5 million y e a r s of evolution in the  102 rodent lineage ( L a n d e r et a l . 2001). If w e take this latter v a l u e , the first duplications s h o w n in figure 3-7 must have o c c u r r e d 6 0 - 7 0 million y e a r s a g o , a s s u m i n g the d i v e r g e n c e v a l u e s of the repeats from their c o n s e n s u s "parent" e l e m e n t s are r e a s o n a b l y a c c u r a t e (Smit 1999; J u r k a 2000). T h i s time interval is, a s e x p e c t e d , after most estimates for the d i v e r g e n c e between rodents a n d primates. If the highest estimate for mutation rate is u s e d , then the initial duplications m a y h a v e o c c u r r e d a s recently a s 30 million y e a r s a g o .  In either event, t h e s e estimates are consistent with the theory that the amplification of Ly49 g e n e s w a s restricted to rodents.  S e v e r a l Ly49 c D N A s h a v e b e e n  isolated from the rat ( D i s s e n et a l . 1996), but insufficient rat g e n o m i c information is currently available for comparative studies. H o w e v e r , although Ly49 a p p e a r s to be a single c o p y g e n e in primates ( M a g e r et a l . 2001), c o w ( M c Q u e e n et a l . 2002), a n d s o m e other m a m m a l s including d o g , cat a n d pig (unpublished observations from our laboratory), it is p o s s i b l e that it could h a v e e x p a n d e d independently to multiple c o p i e s in s e l e c t e d s p e c i e s . Indeed, this likely o c c u r r e d with the K I R locus. Multiple K I R g e n e s h a v e b e e n recently b e e n reported in the c o w w h i c h , a s s u m i n g the estimates for a g e of the K I R e x p a n s i o n s in primates are a c c u r a t e , implies that the K I R g e n e s amplified independently in c o w s ( M c Q u e e n et a l . 2002). T h e ultimate fate a n d n u m b e r of s u c h g e n e s is likely a l s o d e p e n d e n t on the fate a n d structure of their M H C ligands a n d o n the p a t h o g e n s e n c o u n t e r e d during evolution of the s p e c i e s .  3.3.8 C o n c l u d i n g remarks T h e origins of multigene families, particularly t h o s e involved in host d e f e n s e s u c h a s the T C R a n d M H C I loci w h e r e diversity is e s s e n t i a l , h a v e b e e n studied extensively.  103  While some comparisons can be drawn between these systems and the Ly49 gene cluster, the latter appears to be unique in several ways. Unlike the MHC loci,  Ly49  has  not expanded to a multi-gene family in a large number of species. The fact that functional homologs exist in other species argues for the importance of the function, but not the specific protein family involved, provided the family exhibits sufficient diversity. In addition, unlike the MHC or TCR regions, the Ly49 genes appear to have undergone a functional split some time ago where now several of the genes encode activating receptors. The evolution of activating receptors which are presumed to have diverged from their inhibitory counterparts is not unique to the Ly49 receptors but also exists within the KIRs and other NK cell receptors (Taylor et al.  2000;  Ryan et al.  2001).  Again, there seems to be a value to organisms that develop activating receptors against pathogens regardless of the family to which they belong and this case has clearly been demonstrated for  Ly49h  (Brown et al. 2001; Lee et al.  2001a;  Arase et al.  2002).  Of all the full-length Ly49 genes present in B6 mice, it is intriguing that the pseudogenes, namely Ly49k,  m, n, and x, encode potential  activating receptors. The  remaining genes all encode apparently functional receptors. Thus, it appears that selection has prevented the persistence of harmful mutations in inhibitory receptors while allowing mutations to accumulate in activating receptors. Indeed, if activating receptors function only against specific pathogens, it might be expected that the genomic content of these genes would be more variable than their inhibitory relatives. In this regard, it would be extremely interesting to examine the Ly49 gene content in wild mice since such populations have likely been exposed to pathogens not seen by the common inbred strains.  104 The complex evolutionary tapestry of the Ly49 cluster is impossible to unravel completely from the perspective of one mouse strain. Therefore, further studies will need to be conducted in other strains or populations in order to clarify evolutionary events and other issues that could not be addressed in this study. Besides being useful to help elucidate NK cell biology, studies of rapidly evolving multi-gene families such as Ly49 will also aid in answering questions of a more general nature regarding how genetic diversity is generated.  105  Chapter 4 Transcriptional control of the immune receptor CD94  A p a p e r b a s e d o n this work by Brian W i l h e l m , J o s e t t e - R e n e e Landry, F u m i o T a k e i a n d Dixie L. M a g e r entitled "Transcriptional control of the murine C D 9 4 g e n e : differential u s a g e of dual promoters by lymphoid cell types" h a s b e e n submitted for publication to the Journal of Immunology.  A s e c o n d p a p e r dervied from this study by  Brian W i l h e l m and Dixie L. M a g e r entitled "Identification of a n e w murine lectin-like g e n e in c l o s e proximity to CD94" is in p r e s s for Immunogenetics (2003).  J o s e t t e - R e n e e L a n d r y preformed northern blots a n d a n a l y s i s of s e v e r a l quantitative real-time P C R reactions. T h i s work is s u m m a r i z e d in section 4.2.7 and 4.2.8  106  4.1 Introduction A n a l y s i s of the transcriptional control of the CD94 g e n e is of interest for several r e a s o n s . A s mentioned earlier, there is a d e v e l o p m e n t a l switch in receptor u s a g e in mice from C D 9 4 / N K G 2 heterodimers to L y 4 9 h o m o d i m e r s ( S a l c e d o et a l . 2000). In addition, b e c a u s e the murine CD94/NKG2 g e n e s have functional h o m o l o g s in h u m a n s , a n additional s o u r c e of data exists to c o m p a r e g e n o m i c s e q u e n c e features a s well a s functional data. Finally, the detailed investigation of o n e N K C g e n e m a y yield experimental results that are broadly applicable to all N K C g e n e s . Earlier work o n the identification of transcriptional start points for Ly49 g e n e s w a s e x t e n d e d to e x a m i n e m e m b e r s of the murine CD94/NKG2 family that are centromeric to the Ly49 g e n e s within the N K C . T h e s u b s e q u e n t characterisation of the promoter regions of CD94 illustrates the c o m p l e x nature of transcriptional control of g e n e s within the N K C .  107  4.2 Materials and methods 4.2.1 Mouse strains Fetal C 5 7 B L / 6 J p u p s a n d 1-2 month old C 5 7 B L / 6 J m i c e a n d D B A 2 / J mice (The J a c k s o n Laboratory, B a r Harbour, M l ) w e r e u s e d for all e x p e r i m e n t s .  4.2.2 5' RACE for CD94 5' R A C E w a s performed to isolate the c o m p l e t e c D N A from the CD94 g e n e a n d a s performed a s previously d e s c r i b e d (Wilhelm et a l . 2 0 0 1 , chapter 2).  4.2.3 Constructs R e p o r t e r constructs w e r e g e n e r a t e d using the tailed primers listed in table 4-1 by amplification using B 6 g e n o m i c D N A a s a template a n d the P F U e n z y m e . T h e P C R products w e r e purified using the Q i a g e n P C R - p r o d u c t purification kit, digested with the appropriate tail restriction e n z y m e (Kpn I or Bgl II) a n d then ligated into K p n l/Bgl II digested empty P G L 3 B firefly luciferase vector. In order to control a high b a c k g r o u n d activity of P G L 3 B in lymphoid cells o b s e r v e d in our lab, additional p o l y A sites w e r e inserted u p s t r e a m of the multiple cloning site of the empty vector. All constructs w e r e similarly modified to eliminate experimental differences c a u s e d by s e q u e n c e differences b e t w e e n vector b a c k b o n e s . C o l o n i e s transformed from ligations w e r e grown up a n d s e q u e n c e d from either orientation before large cultures w e r e prepared for transfections.  T a b l e 4-I. Primers used Primer CD94 5'RACE C D 9 4 5 ' R A C E nested C D 9 4 R T exon 1 b sense C D 9 4 R T exon 2 a - s e n s e C D 9 4 R T e x o n 1a s e n s e  S e q u e n c e (5' to 3') CTGGATTGGGGCTGAAGAAGGCTGG GCGAAGCACAGAAATCTCTGC TCCTTGGAACATCACTTCTCATGGC TGAATTTATCAGCAAAACTCCCAAAG CAGGGTCG GCACTCAGAAG G AAC  108  C D 9 4 R T exon 1 b a - s e n s e G A D P H RT sense G A D P H RT a-sense C D 9 4 construct e x o n C D 9 4 construct e x o n C D 9 4 construct e x o n C D 9 4 construct e x o n  1a 5' L o n g 1a 5' Short 1 a 3' B a s e 1 b 5' L o n g  C D 9 4 construct e x o n 1 b 5' Short C D 9 4 construct e x o n 1 b 3' B a s e H u m a n C D 9 4 construct 5' H u m a n C D 9 4 construct 3' C D 9 4 exon 3 CD94exon1a C D 9 4 exon 4 C D 9 4 exon 6 C D 9 4 R T exon 5 sense C D 9 4 R T exon 6 a - s e n s e  TGGTGCAGAGATGTGTTTGTGCTT AACGACCCCTTCATTGAC CTCCACGACATACTCAGCAC G G G GTACCGTG ATTTCACCTTTG AGTCCT GGGGTACCATTACCTCCTGGACTTCATAG GAAGATCTCCTCAGTTAGAGTATACGGAT CGGGTACCTGCTCAACACCCTATGTTCTG CGGGTACCTATTAAGCGATCAGATAATATGTG GAAGATCTGGCACACATACCTGCCAGGA CGGGTACCGGTAGAGTCAGAAGAACAG GAAGATCTGAGAAATTATGTTCCAAGAGCG AATTCTACAGTG GTG GTTGGAG AAG AACATCAACATCCCACACTTGTATGAC ACAAGTG GGTTGG G CATCAGTG AAACGCTTTTGCTTGGACTGTA GGGAGGATGGCACAGTTCCCTC TTTCA C A G GATTCAG CAG A A A C G C  4.2.4 Transfections & Cell Culture T h e E L - 4 cell line w a s cultured in D M E M s u p p l e m e n t e d with 5 % F B S , 100 U/ml penicillin, and 100 U/ml streptomycin. T h e L N K cell line w a s obtained from Dr. K. N a k a n i s h i through the lab of Dr. S . A n d e r s o n and w a s cultured in R P M I 1640 containing 5 0 ^ M 2 - M E , nonessential amino a c i d s , 5 % F B S , 100 U/ml penicillin, 100 U/ml streptomycin, s o d i u m pyruvate, L-glutamine, H E P E S , and IL-2 (8000 lU/ml). A n IL-2 independent version of the C T L L - 2 cell lines w a s obtained from Dr. T. G o n d a a n d w a s grown in R P M I 1640 containing 50|aM 2 - M E , nonessential a m i n o a c i d s , 5 % F B S , 100 U/ml penicillin, 100 U/ml streptomycin, s o d i u m pyruvate, L-glutamine. NIH 3 T 3 cells w e r e grown in D M E M s u p p l e m e n t e d with 1 0 % F B S , 100 U/ml penicillin, and 100 U/ml streptomycin. T h e L N K a n d C T L L - 2 cell lines were transfected using the D E A E Dextran transfection kit and protocol supplied ( A m e r s h a m B i o s c i e n c e s ) while the E L - 4 and NIH 3 T 3 cells were transfected using lipofectamine a s previously d e s c r i b e d ( M c Q u e e n et al. 2001) or a c c o r d i n g to the manufacturer's protocol, respectively. T o  109 control for transfection efficiency, dual transfections with the P R L - T K Renilla luciferase vector w e r e d o n e at least twice, in duplicate, for e a c h cell line tested a n d all firefly luciferase v a l u e s w e r e normalized to the Renilla activity prior to a n a l y s i s . L u c i f e r a s e m e a s u r e m e n t s w e r e performed a s per the supplier's instructions ( P r o m e g a , W i s c o n s i n ) using a luminometer.  4.2.5 Cultured splenocytes S p l e e n s w e r e h o m o g e n i z e d a n d R B C w e r e r e m o v e d from single s u s p e n s i o n s by 2 0 - s e c o n d lysis with ice-cold distilled water. R e m a i n i n g cells w e r e w a s h e d twice with P B S a n d incubated for 1 hour in a m e d i a filled p a c k e d nylon w o o l c o l u m n . C e l l s w e r e slowly eluted from the c o l u m n , w a s h e d a n d cultured in R P M I 1640 containing 1 0 % F B S , 100 U/ml penicillin, 100 U/ml streptomycin, s o d i u m pyruvate, L-glutamine a n d IL-2 (8000 lU/ml). After 3 d a y s the m e d i a w a s c h a n g e d a n d all non-adherent cells w e r e r e m o v e d by w a s h i n g twice with P B S . C e l l s w e r e cultured for another 3-6 d a y s before R N A extraction.  4.2.6 Flow cytometry S p l e n o c y t e s a n d fetal (day 18-20) liver s a m p l e s w e r e prepared a s single-cell s u s p e n s i o n s , stained with labelled antibodies a n d a n a l y z e d by flow cytometry.  Cell  s u s p e n s i o n s w e r e pre-treated with a culture supernatant containing a n t i - F c R y l l l / I I R , 2 . 4 G 2 to prevent F c R binding by labelled antibodies. m A b s directed against the following cell s u r f a c e markers w e r e u s e d : N K 1 . 1 ( P K 1 3 6 ) , C D 9 4 ( 1 8 d 3 ) , N K G 2 ( 2 0 d 5 ) , C D 4 9 b ( D X 5 ) , C D 3 s ( 1 4 5 - 2 c 1 1 ) . F l o w cytometry a n d sorting w a s performed o n a F A C S v a n t a g e S E ( B D B i o s c i e n c e s , Mountain V i e w , C A . ) using C e l l Q u e s t software.  110 4.2.7 Northern blot analysis  RNA was isolated from EL4 and LNK cells using Trizol as described by the supplier (Gibco BRL). Following the elimination of remaining genomic DNA with DNase I (Gibco BRL), 10 ug of RNA from EL4 or LNK cells were electrophoresed on a 1.2% agarose, 5% (VA/) formaldehyde, 1X MOPS buffer gel and transferred to a Zetaprobe membrane (Biorad). The Northern blot was hybridized in ExpressHyb (Clontech) at 68°C with a CD94 cDNA fragment corresponding to the nearly full-length transcript. The membrane was washed twice for 20 min in 2X SSC, 0.05% SDS at room temperature followed by 2 washes of 20 min in 0.1 X SSC, 0.1% SDS at 50°C. To confirm the amounts of mRNA loaded in each lane, the blots were rehybridised with a human 1.9 kb actin cDNA fragment.  4.2.8 Quantitative Real-time P C R  RNA to be used for Real-time PCR was isolated using the Trizol reagent and protocol (Gibco/BRL) and treated with DNase I (Gibco/BRL) to remove any possible DNA contamination before reverse transcription. The RNA concentration was estimated using a spectrophotometer prior to reverse transcription. RNA was reverse transcribed as previously described (Wilhelm et al. 2001), using random hexamers. The RNA from FACS sorted NK, T and NKT cells was diluted based on the absolute cell numbers collected (5x10 - 7.5x10) so that the RNA concentrations were identical before 4  5  reverse transcription.  Quantitative Real-time PCR was performed using 1(al of the prepared cDNA along with 22jJ of water, 1 |al of each of the two primers (30 pmol/^l) and 25^1 of the 2X Sybr green PCR master mix (PE Applied Biosystems) and the following amplification  Ill conditions: 3 0 s at 95°G, 3 0 s at 65°C a n d 3 0 s at 72°C for 4 0 c y c l e s o n a Biorad iCycler. P r i m e r s w e r e d e s i g n e d a c c o r d i n g to P E A p p l i e d B i o s y s t e m s ' r e c o m m e n d a t i o n s a n d differences in primer amplification efficiency w e r e calculated a s r e c o m m e n d e d . F o r e a c h experiment, dissociation curve a n a l y s i s w a s performed to verify the p r e s e n c e of only a single P C R product. T h e relative quantification of the transcripts w a s derived using the comparative threshold c y c l e method ( P E A p p l i e d B i o s y s t e m s U s e r Bulletin #2, A B I P R I S M 7 7 0 0 S e q u e n c e Detection system) supplied by the manufacturer.  All  quantitative real-time P C R experiments w e r e performed at least twice in duplicate.  4.2.9 DNase I H S S s c a n T h e D N a s e I hypersensitive site a s s a y w a s performed a s previously d e s c r i b e d (Porter et a l . 1999). Briefly, D N A w a s collected from L N K a n d E L - 4 cell lines, w h e r e cell pellets w e r e lysed using a D o u n c e h o m o g e n i z e r in R S B - N P 4 0 ( 1 0 m M Tris-HCI p H 7 . 5 , 1 0 m M N a C I , 3 m M M g C I , 0 . 5 % N P - 4 0 ) . Nuclei w e r e collected a n d further 2  h o m o g e n i z e d . T h e nuclei w e r e then treated with varying concentrations of D N a s e I before inactivation a n d proteinase K digestion overnight.  D N A w a s then s e p a r a t e d by  eletrophoresis, S o u t h e r n blotted a n d probed. A D N A fragment from the proximal promoter region of the Lck g e n e previously s h o w n to indicate hypersensitive sites in the E L - 4 cell line (Wildin et a l . 1995) w a s u s e d a s a positive control for the technique. T h e probe u s e d w a s the 1.2 kb proximal promoter construct insert a n d the 1.3 kb distal promoter construct insert w a s a l s o u s e d to verify the location of the hypersensitive site. Hybridization conditions w e r e performed a s per the E x p r e s s H y b (Clontech) protocol.  112  4.3 Results 4.3.1 The murine CD94 gene has a novel upstream exon  5' RACE was used to identify the transcriptional start point for the  CD94  gene.  Clones isolated and sequenced from a RACE kit from Clontech using Balb/c splenocyte RNA contained sequence that extended beyond the previously presumed 5' end of the gene (Lohwasser et al. 1998). The novel sequence originated from a previously identified exon in the 5' UTR of CD94. The 275 bp upstream exon, termed 1a, is approximately 3.3 kbp upstream of the previously identified first exon, referred to hereafter as exon 1 b. The novel exon is predicted to form part of the 5' UTR of the transcript, although it does contain 5 upstream translational start codons. Because only one of these is in the correct reading frame and none of the ATGs are in a favourable context to initiate translation, it seems unlikely that the novel upstream exon alters the sequence of the protein although it is not possible to rule out effects of the novel 5' UTR on translation of the protein. No canonical promoter sequences such as TATA or CAAT boxes could be identified upstream of the novel exon. Although rat ESTs could be found which contained sequence highly similar to the novel upstream CD94 exon, no homologous region could be found upstream of the human CD94 for a distance of 10kb using BLAST software. Figure 4-1 shows a scale drawing of the revised genomic structure of the murine CD94 gene including the locations of the fragments used below to test for promoter activity.  4.3.2 The LNK cell line transcribes and expresses CD94 and NKG2 genes  In order to test the promoter activity of regions surrounding the CD94 gene, an attempt was made to identify a cell line that expresses its endogenous gene as a  113  1a |  i  1b (3329 bp)  |  Long  Long  Short  — Short  23  4  5  | |  j  j  6 |  1=1 kb  Figure 4-1 Schematic diagram of CD94 gene. The large numbered boxes represent the exons of the CD94 gene, with the novel 5' exon shown as 1a.  The distance between the two alternative first exons is shown and the regions of sequence used for both the long and short promoter constructs are shown to scale below.  114  permissive environment for promoter characterization. Various NK, T and NKT cell lines including EL-4, KY-1 and CTLL-2 were characterized which were all negative for cell surface expression of CD94/NKG2. However one NK cell line, LNK, which had previously been described (Tsutsui et al. 1996) was positive for  CD94/NKG2  expression  at the cell surface by FACS (figure 4-2A). The lack of CD94 mRNA in EL-4 cells compared to LNK was also confirmed by northern blot using p-actin as a control (figure 4-2B). This cell line as well as other lymphoid and non-lymphoid cell lines were used to assay for promoter activity.  4.3.3 The murine CD94 gene promoters have differing activity that does not corelate with cell surface expression of the protein  Reporter constructs were generated as described in the materials and methods and transfected into several cell lines. The activity of the constructs was made relative to an empty PGL3B vector (basic) with the SV40 promoted PGL3P (promoter) as a positive control. The results of the luciferase transfection assays are shown in figure 43. While none of the  CD94  constructs tested had activity in the NIH 3T3 cell line, the  constructs from the downstream promoter (exon 1b) had high activity in all lymphoid cell lines tested. The upstream promoter (exon 1a) had only limited activity in the lines tested which suggested it might act as a weak promoter in vivo. This hypothesis was shown to be incorrect in subsequent real-time PCR analysis discussed below.  The promoter activity in the exon 1 b fragments appears to be conserved between human and mouse genes. The human CD94 construct which contains the 800 bp upstream of the human CD94 translational codon exhibited high activity in all lymphoid cell lines tested. We have previously characterized the similarity between the  115  A) FACS profiles of the EL-4 and LNK cell lines stained with anti-CD94 and anti-NKG2 antibodies B) Northern blot of RNA collected from the EL-4 and LNK cell lines. In the top panel a fragment of the actin cDNA was used as a probe. In the bottom panel, a portion of the CD94 cDNA was used as a probe. Figure 4-2 CD94 is expressed by the cell line LNK but not EL-4.  116 human and mouse genes in this region (Lohwasser et al. 2000), but it is not clear which, if any, of the regions conserved between species are involved in transcriptional regulation.  Interestingly, the promoter activity of the CD94 gene fragments did not correlate with cell surface expression of the endogenous gene. Both CTLL-2 and EL-4 cell lines that are negative for CD94 expression by F A C S , exhibited high luciferase activity. Through northern blots (figure 4-2B) and quantitative real-time P C R (data not shown) we have shown that the lack of CD94 expression in EL-4 cells is the result of a transcriptional defect rather than a problem with cell surface presentation. The high promoter activity observed combined with the lack of endogenous gene expression implicates alterations in chromatin structure or methlyation patterns in the transcriptional regulation of CD94.  4.3.4 The two CD94 promoters have lymphoid cell-type specific usage that is already established in fetal splenocytes fractions In an effort to characterize the usage patterns of the two CD94 promoters, freshly isolated C57BL/6 splenocytes were sorted by F A C S into NK, NKT and T-cell fractions from which R N A was collected. Real-time quantitative P C R was performed using primers that would distinguish between CD94 transcripts that originated from the upstream promoter (detected by P C R using primers in exon 1a and exon 1b) and those originating from both promoters (detected by P C R using primers in exon 1 b and exon 2). The later was used to represent total functional CD94 transcripts, as the translational start codon is in exon 1b. A s illustrated in figure 4-4, the usage of the upstream CD94 promoter varied by lymphoid cell type with adult NK cells using it  117  Promoter (PGL3P)  Basic (PGL3B)  Exon 1A 1300bp  Exon 1A Exon 1B 600bp 1200bp  ExonIB 500bp  Human CD94 800bp  Figure 4-3 Results of reporter construct transfections. The cell lines used are indicated in the figure on the right hand side. The vertical axis indicates the fold induction of luciferase over the basic construct that lacks promoter activity. The constructs transfected and their sizes are indicated under the horizontal axis. In order to maintain clarity of the graph, the value of the positive control (PGL3P) construct in LNK cells is indicated in brackets.  118  Figure 4-4 Quantitative real-time P C R results of differential promoter usage by cell type. The cell types tested are indicated along the horizontal axis while the  vertical axis shows the percentage of the total transcripts that contain exon 1a. Fetal and adult cell types are indicated by shading patterns in the legend on the bottom left.  119  almost exclusively. Conversely, T-cells that expressed CD94 did so primarily from the exon 1 b promoter. NKT cells, which express markers characteristic of both NK and T cells, had expression from both promoters. Further, the trends in promoter usage seen in the adult cell types were present in the same late-stage fetal cell types, albeit to a lesser extent. Based on this observation, it appears the cell-type specific promoter usage begins at an early stage of development, with adult patterns being reached shortly after birth.  4.3.5 Establishment of cell lines or culturing N K cells alters promoter usage  Discrepancies between the promoter usage observed by real-time PCR and 5' RACE clones obtained from cultured NK cells lead us to investigate the promoter usage by the LNK cell line as well as cultured NK cells. NK cells were isolated from bulk splenocytes using a nylon wool column and cultured for 7 days with IL-2 before RNA collection. Real-time quantitative PCR was performed on samples of cultured NK cells as well as RNA collected from the LNK cell line to compare, the promoter usage of these cultured cells. Figure 4-5 shows that relative to freshly isolated NK cells, both cultured cells as well as the NK cell line LNK have significantly decreased exon 1a promoter usage. The decrease in exon 1a promoter usage in cultured NK cells was coordinate with a general down regulation of CD94 expression after culturing (data not shown). An alteration in promoter usage for other cultured lymphoid cell types was not determined.  4.3.6 The DBA2/J m o u s e  e x p r e s s e s an incomplete CD94 m R N A  A recent report was published describing a mouse sub-strain (DBA2/J) that lacked detectable expression of CD94 at the cell surface by FACS and transcriptionally  120  120  Figure 4-5 Quantitative real-time P C R results of promoter usage in fresh v e r s u s cultured cells. The figure indicates the percentage of CD94  transcripts that contain exon 1a in freshly isolated NK cells, NK cells cultured for 7 days as described in materials and methods or the LNK cell line.  by northern blot (Vance et al. 2002). We examined this strain as a potentially useful model to explain CD94 transcriptional regulation. Surprisingly, quantitative real-time PCR products from either of the sets of exon 1a/b and exon 2 primers could be generated in the same ratio in the DBA2/J substrain as in a CD94-expressing strain (C57BL/6) relative to an internal control (GADPH) (data not shown). To further clarify the situation, new primers were designed to test for the presence of the last 2 exons (5 and 6) of the  CD94 transcript.  Real-time PCR indicated that the product from these  primers could not be amplified from the DBA/2J strain whereas a product was easily detected from B6 mice. The results of a series of RT-PCR amplifications from FACS sorted NK cells from DBA2/J and B6 mice are shown in figure 4-6. While products from exons 1a to 3 could be generated from both strains, products amplified from exons 4 to 6 or exons 2 to 6 could only be generated using B6 cDNA. These results suggest that there is some defect in the 3' end of the  CD94 gene in DBA2/J that  does not prevent  transcription but does prevent translation and cell surface presentation of the protein. Why the  CD94 transcripts  were not detected in the previously published report is not  clear; however, at least one of the probes used in the northern blot that was negative was from the 3' end of the  CD94 transcript.  One possible explanation for our reults is  that the 3' end of CD94 gene, containing at least exon 6 but perhaps also exon 5, is deleted in DBA2/J. As it seems clear that this is not a transcriptional defect, we have not investigated further into the exact nature of the defect in the DBA2/J mouse strain.  4.3.7 The genes Klre-1 and CD94 are c o - e x p r e s s e d  The whole genome shotgun sequence (WGS) has been assembled and gene identification software has been used to characterise the gene content of the C57BL/6 mouse genome. A gene predicted to exist in close proximity to the murine CD94 gene  122  Exons  Amplified  M  1a-3  CD  i  m  4-6  § CQ Q  to 1 i  CQ  2-6  §  CQ Q  1  CD CQ  3 CQ Q  i  500 bp -  Figure 4-6 RT-PCR analysis of CD94 transcription in the DBA2/J mouse strain. R T - P C R was performed on F A C S sorted NK cells in the B6 (CD3"NK1.1 ) and DBA2/J (CD3"DX5 ) strain using primers which would amplify various regions of the CD94 transcript. The exons amplified in each reaction and the mouse strain used are indicated at the top. +  +  123  based on sequence analysis and EST evidence was submitted to Genbank (XM_145036.1). The closest matches to this predicted gene product were the  CD94-  proteins from Rhesus monkey and mouse. The expression of this gene which we termed killer lectin-like receptor family e - member one (Klre-1) was investigated because of its similarity and proximity to the CD94 gene. The expression level of Klre-1 relative to CD94 was measured by quantitative real-time PCR was performed as described in section 4.2.8 and the results are shown in figure 4-7.  Klre-1  and  expression values were made relative to GADPH levels in each sample and  CD94  CD94  expression in NK cells was arbitrarily assigned a value of 100 percent. Interestingly, the general pattern of Klre-1 expression is similar to CD94, with  Klre-1  being expressed at a  higher level except in the case of T-cells. We have also found that in the EL-4 cell line, where CD94 expression is absent, there is also no expression of Klre-1. With the exception of T-cells, there appears to be a strong correlation between the expression of these two genes, which is not unexpected given their proximity. It is not clear why there is a lack of correlation between CD94 and Klre-1 expression in T-cells. It is possible that because almost all CD94 transcripts are originating at the exon 1b promoter in Tcells (figure 4-4) which is further away from the Klre-1 locus, the lack of transcriptional activity at the upstream promoter affects Klre-1 expression.  4.3.8 There is e v i d e n c e for a D N a s e I hypersensitive site a r o u n d the C D 9 4 l o c u s  Because expressed genes are frequently associated with open chromatin (Horn & Peterson, 2002) we next looked for evidence of DNase I hypersensitive sites (HSS) around the CD94 locus. Figure 4-8 shows evidence that such a HSS is present at the CD94  locus in LNK cells. We first verified that our procedure could detect previously  described DNase I HSS by reproducing a previously published example. We were  124  1000  NK  T  NKT  EI-4  LNK  Cell type  Figure 4-7 G r a p h of Klre-1 and CD94 e x p r e s s i o n level by cell type. RNA from FACS sorted C57BL/6 splenocytes was collected using CD3 and NK1.1 staining patterns. The hatched boxes represent the expression level of CD94 while the solid bars represent the Klre-1 expression level. The real time  experiments were performed twice in duplicate and the expression of both genes was then normalized to GADPH. Expression of CD94 and Klre-1 in the EL-4 cell line was undetectable.  125  clearly able to detect the previously described HSS at the distal promoter of the Lck gene in EL-4 cells (Wildin et al. 1995) (data not shown). Initial hybridizations were performed with the 1.2kb frament from the exon 1 b promoter region which did not preceisly locate the site. Further hybridizations indicated that the site of the sensitive location is in close proximity to the exon 1a promoter element. The presence of this site appears to correlate with CD94 expression, as it is detectable in the CD94 expressing cell line LNK, but not EL-4 which does not express  CD94.  4.4 Discussion  Previous work on NK receptor genes has suggested that their transcriptional control is complex. Even in cases where trans-acting factors involved in NKC gene regulation have been identified (Held et al. 1999; Kubo et al. 1999), the effects seen have not been identical for all members of a given gene family. Our current work with the murine CD94 promoter provides further evidence that genes within the natural killer gene cluster (NKC) have a complex pattern of transcriptional control.  The identification of a novel upstream CD94 promoter and the fact that the two promoters are used differentially by various lymphoid cells offers a theoretical explanation for the expression of NK receptors on other cell types. It has been observed that small subsets of T-cells express receptors usually found on NK cells in both humans (Carena et al. 1997) and mice (Takei et al. 2001) and that this expression has functional consequences. For instance, the expression of CD94INKG2 proteins has been shown to influence the CD8 T-cell activity in viral infections (Moser et al. +  2002), although this effect appears to be virus-specific (McMahon et al. 2002; Miller et al. 2002). It has also been shown that several cytokines including IL-12  126  - 3.0 kb-  -1.0kb-  B  1  2  3 4  5  6  7  la  lb  23  4  5  6  It I H I I I 2  1  • = 1 kb  Figure 4-8 D N a s e I hypersensitive site a n a l y s e s of the E L - 4 and L N K cell lines. Part A shows southern blots prepared from DNase I treated EL-4 and L N K genomic DNA, digested with Bgl II. The expected size of the Bgl II fragment detected by the probe used is 9.3 kb. An arrow on the right hand side indicates the hypersensitive fragment generated in L N K DNA. Part B shows a schematic diagram of the murine Klre-1 and CD94 locus with the 9.3 kb Bgl II fragment indicated by the line under the exons of the genes. The location hypersensitive sites in part A are shown within the locus by vertical arrows with the corresponding arrows. A scale for part B of the diagram is shown in the bottom left.  127  (Derre et al. 2002), TGF-p (Bertone et al. 1999), IL-15 (Mingari et al. 1998) and IL-10 (Romero et al. 2001) are capable of inducing expression of CD94/NKG2 in human Tcells. In one of these reports, the signal for induction of CD94 gene expression was independent of the activity of IL-15 (Derre et al. 2002), similar to a recent report where a majority of pathogen-specific CD8 T cells upregulated expression of +  CD94INKG2A  independent of the activity of IL-15 (McMahon et al. 2002). In the past, IL-15 has been demonstrated to be necessary to induce expression of CD94/NKG2 on developing human (Mingari et al. 1997) and murine (Williams et al. 1999) NK cells. It is, therefore, possible that the downstream promoter may represent a cryptic promoter that only has high activity in T-cells and is regulated differentially through cytokine signalling in the microenvironment. As the full signalling pathways for many cytokines have not been defined, it is not possible to confirm the theoretical prediction of the presence of transcription factor binding sites or response elements in the promoter regions of these genes.  Such a simplistic scenario for regulation does not, however, sufficiently explain our results from transfection that the downstream (exon 1b) promoter constructs displayed high activity in all cell lines despite the lack of expression of the endogenous CD94  gene in most cases. A complete explanation of the function of each promoter  would, therefore, need to address issues of chromatin structure or histone modifications in each region. Although murine NK cells appear to go through a switch in receptor system usage during development (Salcedo et al. 2000; Takei et al. 2001, chapter 1), there is currently no evidence that chromatin modifications or alterations in methylation influence murine NKC expression. In contrast, the expression of killer inhibitory receptor (KIR) genes, which are the functional homologs of the Ly49 genes in humans,  128  has recently been shown to be dependent on alterations of the methylation status of the promoter region of the genes (Santourlidis et al. 2002). Our experiments were able to detect the presence of a DNase I hypersensitive sites upstream of the proximal CD94 promoter region, which would suggest that some alteration in chromatin structure must allow expression of the endogenous CD94 gene only in the case of the LNK cell line.  It is also of interest that constructs using sequence from the previously defined promoter region upstream of the translational start codon of the human CD94 gene also showed high promoter activity in all murine lymphoid cell lines tested. We have previously shown that this region has a fairly high level of identity between the two species (Lohwasser et al. 2000), and so the shared promoter activity is perhaps not surprising. Unpublished results showing the presence of a novel promoter upstream of the human CD94 gene that is also used differentially between lymphoid cell types (J. Coligan, personal communication) suggests that the intricate dual promoter system of the CD94 gene is conserved between species.  Despite an apparent conservation of function, there does not appear to be sequence conservation between the upstream promoter regions of the two species. As described in the Results section, we have been unable to find any region upstream of the human CD94 gene that exhibited homology to the novel upstream exon or the novel promoter region in the murine gene. The nature of the upstream promoter region of the murine CD94 gene is further complicated by the fact that the novel gene, Klre-1, is located in close (2.3 kb) proximity to upstream promoter of CD94. We found the expression of Klre-1 and CD94 to be coordinate (figure 4-7); however, this would not necessarily mean than they are transcriptionally regulated in the same manner (the  129 NKG2D  gene which is on the other side of CD94 has a significantly different expression  pattern; Bauer et al. 1999; Diefenbach et al. 2000).  The possibility of developmental^ coordinated expression is made more likely by our detection of a DNase I hypersensitive sites (HSS) in the vicinity of the exon 1a and 1 b promoter region (figure 4-8). The fragment generated by restriction digest in the DNase I HSS analysis encompassed not only the 5' end of the CD94 gene (from exon 4), but also the last exon of the Klre-1 gene. It is, therefore, possible that the detected DNase I HSSs 5' of the CD94 gene may regulate the expression of CD94 as well as Klre-1.  Our finding does not, however, rule out the possibility that there are other HSSs  further away from the CD94 promoter region which control the developmental expression pattern of CD94 and Klre-1. In the context of this genomic organization, it would suggest that if the CD94 upstream promoter activity is in fact conserved between species, it may be functionally defined by a short stretch of sequence which may not be detectable in strict homology-based searches.  Our finding that promoter usage in fetal NK, T and NKT cells shows a bias which increases in cells from fetal to mature mice indicates that promoter usage changes during development. The comparison of CD94 promoter usage in cultured (IL-2 activated) NK cells versus fresh NK cells also shows that even in adult cells, the promoter usage pattern is not fixed. As the decrease Jn exon 1a promoter usage takes place at the same time as an overall down-regulation of CD94 expression, it suggests that culturing NK cells with IL-2 (or NK cell activation in vivo) leads to the shutdown of the upstream promoter resulting in a reduction in CD94/NKG2 expression. Functionally,  130  the down-regulation of receptors which inhibit cytotoxicity would make sense if the immune system were trying to activate NK cells against pathogens.  Our experiments show that the murine CD94 gene clearly has a complex promoter structure that appears to regulate cell-type specific activity. Previously published reports of immune system genes with multiple promoters illustrate that the complex structure of the murine CD94 promoter is not unique (Allen et al. 1992; Wildin et al. 1995; Gessner et al. 1996). Indeed, the usage of dual promoters has been described for several of the Ly49 genes in a situation which might be analogous to CD94.  The distal promoter was reported to have activity in fetal cells and in bone  marrow cells, possibly linking its usage to the initiation of Ly49 expression in NK cells (Saleh et al. 2002). Unfortunately, the recently described DBA2/J mouse strain (Vance et al. 2002), as explained in the results and figure 4-6, could not be used to gain further insight into the examination of defects in transcriptional regulation of CD94. It will however be interesting to address the transcriptional regulation of the murine NKG2 genes to see if their promoter structures are similarly complex or whether, through the limiting expression of CD94, they let their dimerization partner call the shots.  131  Chapter 5 Summary As discussed in the introduction to my thesis, my objective was to clarify the transcriptional regulation of genes within the N K C . Given the broad nature of the objective and the apparent complexity in the expression of these genes, I believe I have succeeded in my goal and made several useful contributions. I believe that the work on the promoter regions of the Ly49 genes will prove very useful for other researchers in the field. Not only were we able to provide a sequence comparison of the promoter regions of 9 Ly49 genes but also our subsequent analysis of the transcriptional start points provided experimental data to explain the effects observed in the TCF-17" mouse strain. Prior to our work, there was only one paper that mentioned that Ly49a had a single transcriptional start point and that the expression of only Ly49a and of was affected in the TCF-1 deficient mice. The heterogeneity of transcriptional start points seen in our work illustrated that previously proposed TATA boxes did not appear to be used and that the expression of Ly49g was likely not affected in the TCF-17" mice due to its use of an alternative promoter in the first intron of the gene.  Our analysis of the nucleotide sequence of the Ly49 gene cluster also represented a useful contribution to the field. Initial work in the NK field focused on identifying receptors that recognised M H C class I molecules. In the more than 10 years since their initial discovery, a list of nearly 40 NK receptors in humans and mice has been compiled. Specifically in the case of the Ly49 genes, gene-specific monoclonal antibodies have been lacking for many of the receptors that had been initially identified. In functional assays where antibodies are marking cell subsets or blocking receptors, a proviso to the results has always been that there might be additional receptors that have not been identified which might influence the results. W e have now precisely  132  defined the Ly49 receptor repertoire in the C57BL/6 strain. While antibodies may still be lacking for some gene products, our analysis has at least removed any uncertainty regarding the number of functional receptors that B6 NK cells can express. We were also able to identify a large stretch of unique repetitive DNA within the Ly49 cluster that separates Ly49e and q from the other Ly49 genes. As discussed in chapter 3, this novel finding may represent a boundary element to allow Ly49e (and perhaps o/) to be regulated differently than the other Ly49 genes during development. The high level of sequence similarity observed elsewhere in the intergenic space of the Ly49 cluster suggests that the regulatory mechanisms of Ly49 expression are not based on sequence variation at the location of each gene. This is not to say that single nucleotide differences do not play a role, but rather that it is precisely these small differences that influence expression by default, as there are few observed large differences.  The analysis of the promoter region of CD94 has illustrated the complex nature of promoters of genes in the NKC. The finding that NK and T-cells use different promoters for CD94 could also form the rationale behind further studies to elucidate the transcriptional control of NKC genes. Examination of the role of cytokines in the induction of CD94 expression form one promoter or another and the identification of cell-type specific trans-acting factors which bind to the 2 promoters would both be useful questions to study. In addition, the nature of the developmental switch between the Ly49 and CD94/NKG2 receptors remains largely uncharacterised. These studies would likely require additional background information, perhaps derived from DNA microarray analysis, in order to narrow down proteins that might be of interest to examine. Numerous other questions such as the extent to which the mechanism of  133 stochastic gene expression is shared between receptor systems in different species, whether the same trans-acting factors are involved in the expression of both the Ly49 receptors and KIR and how signalling events in developing NK cells influences the sequential activation of genes also remain to be answered.  The work presented in this thesis, in combination with other published work, allows for some general conclusions to be draw about the nature of transcriptional regualtion that exists within the N K C cluster. On the basis of the available evidence, one possible model would involve a change in higher order chromatin structure which would allow a locus to become competent to be transcribed. Subsequent to this event, transacting factors, the exact number and type of which appears to vary from gene to gene, can bind the promoter regions and initiate transcription. The factors appear to be, at least in some cases, in limiting supply, which might also explain the predominantly mono-allelic expression seen by genes in the N K C .  The final aspect of the model of  transcriptional regulation is the repression of genes that are not expressed by developing NK cells within a defined window of opportunity.  Data indicating the existance of a fetal promoter for the Ly49 genes that is only active in bone marrow, where NK cells begin to develop provides circumstantial evidence to support this model. The fact that the activity observed in transient transfection assays, using DNA fragments containing this promoter sequence from individual genes, seems to corelate with the frequency of expression of the individual Ly49 genes, suggests that transcriptional activity at this location might be critical for induction of Ly49 expression. A s the promoter is not active in adult cells, its principal  134  role may be to enable particular Ly49 genes to become competent to be expressed by NK adult cells.  Other evidence in support of the proposed model has shown that the transcription of certain Ly49 genes is dependent on the presence of particular transacting factors. The best example of this comes from analysis of the Ly49a gene. The expression of this gene has been shown in, TCF-1 deficient mice, to be wholy dependent on the presence of this transcription factor. Indeed, TCF-1 appears to be in limiting quantity based on the dose dependent loss of Ly49A expression seen in the heterozygous and homozygous mutants. While other genes such as Ly49g are also affected by the absence of TCF-1, the fact that their expression is not completely abolished in the TCF-1 deficient mice suggests that the Ly49 genes have highly individualized promoters in terms of the cirtical transcription factors involved in their expression. No mechanisms have yet been proposed to explain the repression of Ly49 genes that are not expressed in individual NK cells. It is possible that suppressor elements exist which act to silence loci that do not express particular Ly49 genes during development.  It is not yet clear to what extent the experimental observations for the Ly49 genes can be generalized to other genes in the NKC. The murine  NKG2A  gene has  recently been shown to have monoalleic expression in a fashion similar to the Ly49 genes, and the results in chapter 4 indicate that changes in chromatin structure (leading to the creation of a DNase I hypersensitive site) are a prequisite for the expression of the CD94 gene supporting the idea that genes (such as the Ly49 multigene family) must be first made transcriptionally competent before transcription can occur. This suggests  135  that the same general model of transcriptional control might be applicable to all NKC genes, although more detailed experiments will be needed to investigate this possibility.  136  Bibliography  Allen, J.M., K.A. Forbush, and R.M. Perlmutter. 1992. Functional dissection of the Ick proximal promoter.  Mol Cell Biol 12: 2758-68.  Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res  25: 3389-402.  Anderson, S.K., J.R. Ortaldo, and D.W. McVicar. 2001. The ever-expanding Ly49 gene family: repertoire and signaling. Immunol Rev  181: 79-89.  Aramburu, J., L. Azzoni, A. Rao, and B. Perussia. 1995. Activation and expression of the nuclear factors of activated T cells, NFATp and NFATc, in human natural killer cells: regulation upon CD16 ligand binding. J Exp Med 182: 801-10. Arase, H., E.S. Mocarski, A.E. Campbell, A.B. Hill, and L.L. Lanier. 2002. Direct Recognition of Cytomegalovirus by Activating and Inhibitory NK Cell Receptors. Science 296:  1323-1326.  Arase, N., H. Arase, S.Y. Park, H. Ohno, C. Ra, and T. Saito. 1997. Association with FcRgamma is essential for activation signal through NKR-P1 (CD161) in natural killer (NK) cells and NK1.1+ T cells. J Exp Med 186: 1957-63. Arkwright, P.D., M. Abinun, and A.J. Cant. 2002. Autoimmunity in human primary immunodeficiency diseases. Blood 99: 2694-702. Azizkhan, J.C., D.E. Jensen, A.J. Pierce, and M. Wade. 1993. Transcription from TATAless promoters: dihydrofolate reductase as a model. Crit Rev  Eukaryot Gene  Expr 3: 229-54.  Bai, A., J. Broen, and J. Forman. 1998. The pathway for processing leader-derived peptides that regulate the maturation and expression of Qa-1b. Immunity 9: 41321.  Ballas, Z.K. and W. Rasmussen. 1990. NK1.1+ thymocytes. Adult murine CD4-, CD8thymocytes contain an NK1.1+, CD3+, CD5hi, CD44hi, TCR-V beta 8+ subset. J Immunol 145: 1039-45.  Bauer, S., V. Groh, J. Wu, A. Steinle, J.H. Phillips, L.L. Lanier, and T. Spies. 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress- inducible MICA. Science  285: 727-9.  Bendelac, A., M.N. Rivera, S.H. Park, and J.H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu Rev Immunol 15: 535-62. Bertbne, S., F. Schiavetti, R. Bellomo, C. Vitale, M. Ponte, L. Moretta, and M.C. Mingari. 1999. Transforming growth factor-beta-induced expression of CD94/NKG2A inhibitory receptors in human T lymphocytes. Eur J Immunol 29: 23-9. Biassoni, R., C. Cantoni, M. Falco, S. Verdiani, C. Bottino, M. Vitale, R. Conte, A. Poggi, A. Moretta, and L. Moretta. 1996. The human leukocyte antigen (HLA)-Cspecific "activatory" or "inhibitory" natural killer cell receptors display highly homologous extracellular domains but differ in their transmembrane and intracytoplasmic portions. J Exp Med 183: 645-50. Biron, CA. and L. Brossay. 2001. NK cells and NKT cells in innate defense against viral infections. Curr Opin Immunol 13: 458-64. Borges, L., M.L. Hsu, N. Fanger, M. Kubin, and D. Cosman. 1997. A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J Immunol 159: 5192-6. Borrego, F., J. Kabat, D.K. Kim, L. Lieto, K. Maasho, J. Pena, R. Solana, and J.E. Coligan. 2002. Structure and function of major histocompatibility complex (MHC) class I specific receptors expressed on human natural killer (NK) cells. Mol Immunol 38: 637-60.  Borrego, F., M. Ulbrecht, E.H. Weiss, J.E. Coligan, and A.G. Brooks. 1998. Recognition of human histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signal sequence-derived peptides by CD94/NKG2 confers protection from natural killer cell-mediated lysis. J Exp Med 187: 813-8. Boyington, J.C., A.N. Riaz, A. Patamawenu, J.E. Coligan, A.G. Brooks, and P.D. Sun. 1999. Structure of CD94 reveals a novel C-type lectin fold: implications for the NK cell-associated CD94/NKG2 receptors. Immunity 10: 75-82. Braud, V.M., D.S. Allan, CA. O'Callaghan, K. Soderstrom, A. D'Andrea, G.S. Ogg, S. Lazetic, NT. Young, J.I. Bell, J.H. Phillips, L.L. Lanier, and A.J. McMichael. 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795-9.  Brennan, J., D. Mager, W. Jefferies, and F. Takei. 1994. Expression of different members of the Ly-49 gene family defines distinct natural killer cell subsets and cell adhesion properties. J Exp Med 180: 2287-95. Brennan, J., G. Mahon, D.L. Mager, W.A. Jefferies, and F. Takei. 1996. Recognition of class I major histocompatibility complex molecules by Ly-49: specificities and domain interactions. J Exp Med 183: 1553-9. Brown, M.G., A.O. Dokun, J.W. Heusel, H.R. Smith, D.L. Beckman, E.A. Blattenberger, C.E. Dubbelde, L.R. Stone, A.A. Scalzo, and W.M. Yokoyama. 2001. Vital involvement of a natural killer cell activation receptor in resistance to viral infection. Science  292: 934-7.  Brown, M.G., S. Fulmek, K. Matsumoto, R. Cho, P.A. Lyons, E.R. Levy, A.A. Scalzo, and W.M. Yokoyama. 1997a. A 2-Mb YAC contig and physical map of the natural killer gene complex on mouse chromosome 6. Genomics  42:  16-25.  Brown, M.G., A.A. Scalzo, K. Matsumoto, and W.M. Yokoyama. 1997b. The natural killer gene complex: a genetic basis for understanding natural killer cell function and innate immunity. Immunol Rev 155: 53-65. Burshtyn, D.N., J. Shin, C. Stebbins, and E.O. Long. 2000. Adhesion to target cells is disrupted by the killer cell inhibitory receptor. CurrBiol  10: 777-80.  Carayannopoulos, L.N., O.V. Naidenko, D.H. Fremont, and W.M. Yokoyama. 2002. Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J Immunol 169: 4079-83. Carena, I., A. Shamshiev, A. Donda, M. Colonna, and G.D. Libera. 1997. Major histocompatibility complex class I molecules modulate activation threshold and early signaling of T cell antigen receptor-gamma/delta stimulated by nonpeptidic ligands. J Exp Med 186: 1769-74. Cerwenka, A., A.B. Bakker, T. McClanahan, J. Wagner, J. Wu, J.H. Phillips, and L.L. Lanier. 2000. Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity 12: 721-7. Chan, P.Y. and F. Takei. 1989. Molecular cloning and characterization of a novel murine T cell surface antigen, YE1/48. J Immunol 142: 1727-36. Chang, C, J. Dietrich, A.G. Harpur, J.A. Lindquist, A. Haude, Y.W. Loke, A. King, M. Colonna, J. Trowsdale, and M.J. Wilson. 1999. Cutting edge: KAP10, a novel transmembrane adapter protein genetically linked to DAP12 but with unique signaling properties. J Immunol 163: 4651-4. Chang, C, A. Rodriguez, M. Carretero, M. Lopez-Botet, J.H. Phillips, and L.L. Lanier. 1995. Molecular characterization of human CD94: a type II membrane glycoprotein related to the C-type lectin superfamily. EurJ  Immunol 25: 2433-7.  Chuang, S.S., H.T. Pham, P.R. Kumaresan, and P.A. Mathew. 2001. A prominent role for activator protein-1 in the transcription of the human 2B4 (CD244) gene in NK cells. J Immunol 166: 6188-95. Ciccone, E., D. Pende, O. Viale, A. Than, C. Di Donato, A.M. Orengo, R. Biassoni, S. Verdiani, A. Amoroso, A. Moretta, and et al. 1992. Involvement of HLA class I alleles in natural killer (NK) cell-specific functions: expression of HLA-Cw3 confers selective protection from lysis by alloreactive NK clones displaying a defined specificity (specificity 2). J Exp Med 176: 963-71. Cohen, G.B., R.T. Gandhi, D.M. Davis, O. Mandelboim, B.K. Chen, J.L. Strominger, and D. Baltimore. 1999. The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. Immunity 10: 661-71. Colonna, M. and J. Samaridis. 1995. Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells. Science 268: 405-8.  Correa, I. and D.H. Raulet. 1995. Binding of diverse peptides to MHC class I molecules inhibits target cell lysis by activated natural killer cells. Immunity!: 61-71. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, and M.L. Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity 7: 273-82. Cosman, D., J. Mullberg, CL. Sutherland, W. Chin, R. Armitage, W. Fanslow, M. Kubin, and N.J. Chalupny. 2001. ULBPs, novel MHC class l-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity 14: 123-33.  Daniels, K.A., G. Devora, W.C. Lai, CL. O'Donnell, M. Bennett, and R.M. Welsh. 2001. Murine cytomegalovirus is regulated by a discrete subset of natural killer cells reactive with monoclonal antibody to Ly49H. J Exp Med 194: 29-44. Delano, M.L. and D.G. Brownstein. 1995. Innate resistance to lethal mousepox is genetically linked to the NK gene complex on chromosome 6 and correlates with early restriction of virus replication by cells with an NK phenotype.  J Virol 69:  5875-7. Depatie, C, S.H. Lee, A. Stafford, P. Avner, A. Belouchi, P. Gros, and S.M. Vidal. 2000. Sequence-ready BAC contig, physical, and transcriptional map of a 2-Mb region overlapping the mouse chromosome 6 host-resistance locus Cmv1.  Genomics  66: 161-74. Derre, L., M. Corvaisier, M.C Pandolfino, E. Diez, F. Jotereau, and N. Gervois. 2002. Expression of CD94/NKG2-A on human T lymphocytes is induced by IL-12: implications for adoptive immunotherapy. J Immunol168: 4864-70. Diefenbach, A., A.M. Jamieson, S.D. Liu, N. Shastri, and D.H. Raulet. 2000. Ligands for the murine NKG2D receptor: expression by tumor cells and activation of NK cells and macrophages.  Nat Immunol 1: 119-26.  Diefenbach A., Tomasello E., Lucas M., Jamieson A. M., Hsia J. K., Vivier E., and Raulet D. H. 2002. Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D. Nat Immunol 3: 1142-9. Dissen, E., J.C Ryan, W.E. Seaman, and S. Fossum. 1996. An autosomal dominant 0  locus, Nka, mapping to the Ly-49 region of a rat natural killer (NK) gene complex, controls NK cell lysis of allogeneic lymphocytes. J Exp Med 183: 2197-207.  Dokun, A.O., S. Kim, H.R. Smith, H.S. Kang, D.T. Chu, and W.M. Yokoyama. 2001. Specific and nonspecific NK cell activation during virus infection.  Nat Immunol 2:  951-6. Dorfman, J.R. and D.H. Raulet. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. J Exp Med 187: 609-18. Duncan, G.S., H.W. Mittrucker, D. Kagi, T. Matsuyama, and T.W. Mak. 1996. The transcription factor interferon regulatory factor-1 is essential for natural killer cell function in vivo. J Exp Med 184: 2043-8. Ensembl. 2002. Mouse genome assembly version 3. In. Ensembl. Fahlen, L, N.K. Khoo, M.R. Daws, and CL. Sentman. 1997. Location-specific regulation of transgenic Ly49A receptors by major histocompatibility complex class I molecules. Eur J Immunol 27: 2057-65. Farrell, H.E., H. Vally, D.M. Lynch, P. Fleming, G.R. Shellam, A.A. Scalzo, and N.J. Davis-Poynter. 1997. Inhibition of natural killer cells by a cytomegalovirus MHC class I homologue in vivo. Nature 386: 510-4. Flamand, V., E.W. Shores, T. Tran, K. Huang, E. Lee, A. Grinberg, J.P. Kinet, and P.E. Love. 1996. Delayed maturation of CD4- CD8- Fc gamma RII/III+ T and natural killer cell precursors in Fc epsilon RI gamma transgenic mice. J Exp Med 184: 1725-35. Franksson, L., J. Sundback, A. Achour, J. Bernlind, R. Glas, and K. Karre. 1999. Peptide dependency and selectivity of the NK cell inhibitory receptor Ly-49C. Eur J Immunol 29: 2748-58.  George, T.C, L.H. Mason, J.R. Ortaldo, V. Kumar, and M. Bennett. 1999. Positive recognition of MHC class I molecules by the Ly49D receptor of murine NK cells. J Immunol 162:  2035-43.  Georgopoulos, K., M. Bigby, J.H. Wang, A. Molnar, P. Wu, S. Winandy, and A. Sharpe. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79:  143-56.  Germain, R.N. 2002. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol!:  309-22.  Gessner, J.E., T. Grussenmeyer, M. Dumbsky, and R.E. Schmidt. 1996. Separate promoters from proximal and medial control regions contribute to the natural killer cell-specific transcription of the human FcgammaRIII-A (CD16-A) receptor gene. J Biol Chem 271: 30755-64. Glienke, J., Y. Sobanov, C. Brostjan, C. Steffens, C. Nguyen, H. Lehrach, E. Hofer, and F. Francis. 1998. The genomic organization of NKG2C, E, F, and D receptor genes in the human natural killer gene complex. Immunogenetics 48: 163-73. Glusman, G., L. Rowen, I. Lee, C. Boysen, J.C. Roach, A.F. Smit, K. Wang, B.F. Koop, and L. Hood. 2001. Comparative genomics of the human and mouse T cell receptor loci. Immunity 15: 337-49. Godfrey D. I., Hammond K. J., Poulton L. D., Smyth M. J., and Baxter A. G. (2000). NKT cells: facts, functions and fallacies. Immunol Today 21: 573-83. Gosselin, P., A.P. Makrigiannis, R. Nalewaik, and S.K. Anderson. 2000. Characterization of the Ly49l promoter.  Immunogenetics 51:  326-31.  Gosselin, P., L.H. Mason, J. Willette-Brown, J.R. Ortaldo, D.W. McVicar, and S.K. Anderson. 1999. Induction of DAP12 phosphorylation, calcium mobilization, and cytokine secretion by Ly49H. J Leukoc Biol 66: 165-71. Griffiths, G.M. and Y. Argon. 1995. Structure and biogenesis of lytic granules. Curr Top Microbiol Immunol 198:  39-58.  Hackett, J., Jr., M. Tutt, M. Lipscomb, M. Bennett, G. Koo, and V. Kumar. 1986. Origin and differentiation of natural killer cells. II. Functional and morphologic studies of purified NK-1.1+ cells. J Immunol 136: 3124-31. Hanke, T., H. Takizawa, C.W. McMahon, D.H. Busch, E.G. Pamer, J.D. Miller, J.D. Altman, Y. Liu, D. Cado, F.A. Lemonnier, P.J. Bjorkman, and D.H. Raulet. 1999. Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11: 67-77. Hayami, K., D. Fukuta, Y. Nishikawa, Y. Yamashita, M. Inui, Y. Ohyama, M. Hikida, H. Ohmori, and T. Takai. 1997. Molecular cloning of a novel murine cell-surface glycoprotein homologous to killer cell inhibitory receptors. J Biol Chem  272:  7320-7. Held, W., J.R. Dorfman, M.F. Wu, and D.H. Raulet. 1996. Major histocompatibility complex class l-dependent skewing of the natural killer cell Ly49 receptor repertoire. Eur J Immunol 26: 2286-92. Held, W. and B. Kunz. 1998. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur J Immunol 28: 2407-16. Held, W., B. Kunz, B. Lowin-Kropf, M. van de Wetering, and H. Clevers. 1999. Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans-acting factor TCF-1. Immunity 11: 433-42. Held, W. and D.H. Raulet. 1997a. Expression of the Ly49A gene in murine natural killer cell clones is predominantly but not exclusively mono-allelic. 2876-84.  Eur J Immunol 27:  -. 1997b. Ly49A transgenic mice provide evidence for a major histocompatibility complex-dependent education process in natural killer cell development. J Exp Med 185: 2079-88. Ho, L.H., T. Uehara, C.C. Chen, H. Kubagawa, and M.D. Cooper. 1999. Constitutive tyrosine phosphorylation of the inhibitory paired Ig-like receptor PIR-B. Proc Natl Acad Sci U S A 96:  15086-90.  Hoglund, P., C. Ohlen, E. Carbone, L. Franksson, H.G. Ljunggren, A. Latour, B. Koller, and K. Karre. 1991. Recognition of beta 2-microglobulin-negative (beta 2m-) Tcell blasts by natural killer cells from normal but not from beta 2m- mice: nonresponsiveness controlled by beta 2m- bone marrow in chimeric mice. Proc Natl Acad Sci U S A 88: 10332-6.  Houchins, J.P., L.L. Lanier, E.C. Niemi, J.H. Phillips, and J.C. Ryan. 1997. Natural killer cell cytolytic activity is inhibited by NKG2-A and activated by NKG2-C. J Immunol 158:3603-9.  Houchins, J.P., T. Yabe, C. McSherry, and F.H. Bach. 1991. DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med 173: 1017-20. Horn P. J., and Peterson C. L. (2002). Molecular biology. Chromatin higher order folding-wrapping up transcription.  Science 297:  1824-7.  Hsu, K.C., X.R. Liu, A. Selvakumar, E. Mickelson, R.J. O'Reilly, and B. Dupont. 2002. Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic diversity with a minimum of six basic framework haplotypes, each with multiple subsets. J Immunol 169: 5118-29.  lizuka, K., D.D. Chaplin, Y. Wang, Q. Wu, L.E. Pegg, W.M. Yokoyama, and Y.X. Fu. 1999. Requirement for membrane lymphotoxin in natural killer cell development. Proc Natl Acad Sci USA96:  6336-40.  Janeway, C. and P. Travers (1997). Immunobiology : the immune system in health and disease. London ; San Francisco, New York, Current Biology ; Garland Pub. Jurka, J. 2000. Repbase update: a database and an electronic journal of repetitive elements. Trends Genet  16:  418-20.  Kam, CM., D. Hudig, and J.C Powers. 2000. Granzymes (lymphocyte serine proteases): characterization with natural and synthetic substrates and inhibitors. Biochim Biophys Acta 1477:  307-23.  Kane, K.P., E.T. Silver, and B. Hazes. 2001. Specificity and function of activating Ly-49 receptors. Immunol Rev  181:  104-14.  Karlhofer, F.M., R. Hunziker, A. Reichlin, D.H. Margulies, and W.M. Yokoyama. 1994. Host MHC class I molecules modulate in vivo expression of a NK cell receptor. J Immunol 153:  2407-16.  Karlhofer, F.M., R.K. Ribaudo, and W.M. Yokoyama. 1992. MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature 358: 66-70. Katsura, Y. 2002. Redefinition of lymphoid progenitors. Nat Rev Immunol 2: 127-32. Kayagaki, N., N. Yamaguchi, M. Nakayama, K. Takeda, H. Akiba, H. Tsutsui, H. Okamura, K. Nakanishi, K. Okumura, and H. Yagita. 1999. Expression and function of TNF-related apoptosis-inducing ligand on murine activated NK cells. J Immunol 163:  1906-13.  Kennedy, M.K., M. Glaccum, S.N. Brown, E.A. Butz, J.L. Viney, M. Embers, N. Matsuki, K. Charrier, L. Sedger, C.R. Willis, K. Brasel, P.J. Morrissey, K. Stocking, J.C. Schuh, S. Joyce, and J.J. Peschon. 2000. Reversible defects in natural killer and  memory CD8 T cell lineages in interleukin 15-deficient mice. J Exp Med 191: 771-80. Khakoo, S.I., R. Rajalingam, BP. Shum, K. Weidenbach, L. Flodin, D.G. Muir, F. Canavez, S.L. Cooper, N.M. Valiante, L.L. Lanier, and P. Parham. 2000. Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans.  Immunity 12: 687-98.  Khoo, N.K., L. Fahlen, and CL. Sentman. 1998. Modulation of Ly49A receptors on mature cells to changes in major histocompatibility complex class I molecules. Immunology 95:  126-31.  Kiessling, R., E. Klein, H. Pross, and H. Wigzell. 1975a. "Natural" killer cells in the mouse. II. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Characteristics of the killer cell. Eur J Immunol 5: 117-21. Kiessling, R., E: Klein, and H. Wigzell. 1975b. "Natural" killer cells in the mouse. I. Cytotoxic cells with specificity for mouse Moloney leukemia cells. Specificity and distribution according to genotype. Eur J Immunol 5: 112-7. Kim, S., K. lizuka, H.S. Kang, A. Dokun, A.R. French, S. Greco, and W.M. Yokoyama. 2002. In vivo developmental stages in murine natural killer cell maturation. Nat Immunol 3:  523-8.  Kondo, M., I.L. Weissman, and K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Ce//91: 661-72. Kraft, J.R., R.E. Vance, J. Pohl, A.M. Martin, D.H. Raulet, and P.E. Jensen. 2000. Analysis of Qa-1 (b) peptide binding specificity and the capacity of CD94/NKG2A to discriminate between Qa-1-peptide complexes. J Exp Med 192: 613-24.  Kruglyak, S., R.T. Durrett, M.D. Schug, and C.F. Aquadro. 1998. Equilibrium distributions of microsatellite repeat length resulting from a balance between slippage events and point mutations.  Proc Natl Acad Sci U SA 95:  10774-8.  Kubagawa, H., P.D. Burrows, and M.D. Cooper. 1997. A novel pair of immunoglobulinlike receptors expressed by B cells and myeloid cells. Proc  Natl Acad Sci USA  94: 5261-6. Kubo, S., Y. Itoh, N. Ishikawa, R. Nagasawa, T. Mitarai, and N. Maruyama. 1993. The gene encoding mouse lymphocyte antigen Ly-49: structural analysis and the 5'flanking sequence. Gene  136: 329-31.  Kubo, S., R. Nagasawa, H. Nishimura, K. Shigemoto, and N. Maruyama. 1999. ATF-2binding regulatory element is responsible for the Ly49A expression in murine T lymphoid line, EL-4. Biochim Biophys Acta  1444:  191-200.  Kubota, A., S. Kubota, S. Lohwasser, D.L. Mager, and F. Takei. 1999. Diversity of NK cell receptor repertoire in adult and neonatal mice.  J Immunol163:  212-6.  Kumar, S. and S. Subramanian. 2002. Mutation rates in mammalian genomes. Proc Natl Acad Sci U S A 99: 803-8.  Kunz, B., W. Held. 2001. Positive and negative roles of the trans-acting T cell factor-1 for the acquisition of distinct Ly-49 MHC class I receptors by NK cells. J Immunol.  2001 166: 6181-7.  Kurepa, Z. CA. Hasemann, and J. Forman. 1998. Qa-1b binds conserved class I f  leader peptides derived from several mammalian species. J Exp Med 188: 973-8. Lander, E.S. et al. 2001. Initial sequencing and analysis of the human genome. 409: 860-921. Lanier, L.L. 1998. NK cell receptors. Annu  Rev Immunol^:  359-93.  Nature  Lanier, L.L, C. Chang, and J.H. Phillips. 1994. Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes.  J Immunol 153: 2417-28;  Lanier, L.L., B.C. Corliss, J. Wu, C. Leong, and J.H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391: 703-7. Lazetic, S., C. Chang, J.P. Houchins, L.L. Lanier, and J.H. Phillips. 1996. Human natural killer cell receptors involved in MHC class I recognition are disulfidelinked heterodimers of CD94 and NKG2 subunits. J Immunol 157: 4741-5. Lee, C.G., T. Eki, K. Okumura, V. da Costa Soares, and J. Hurwitz. 1998a. Molecular analysis of the cDNA and genomic DNA encoding mouse RNA helicase A. Genomics 47: 365-71.  Lee, N., D.R. Goodlett, A. Ishitani, H. Marquardt, and D.E. Geraghty. 1998b. HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. J Immunol 160: 4951-60. Lee, S.H., S. Girard, D. Macina, M. Busa, A. Zafer, A. Belouchi, P. Gros, and S.M. Vidal. 2001a. Susceptibility to mouse cytomegalovirus is associated with deletion of an activating natural killer cell receptor of the C-type lectin superfamily. Nat Genet 28: 42-5.  Lee, S.H., J. Gitas, A. Zafer, P. Lepage, T.J. Hudson, A. Belouchi, and S.M. Vidal. 2001b. Haplotype mapping indicates two independent origins for the Cmvls susceptibility allele to cytomegalovirus infection and refines its localization within the Ly49 cluster. Immunogenetics 53: 501-5. Lepin, E.J., J.M. Bastin, D.S. Allan, G. Roncador, V.M. Braud, D.Y. Mason, P.A. van der Merwe, A.J. McMichael, J.I. Bell, S.H. Powis, and CA. O'Callaghan. 2000.  Functional characterization of HLA-F and binding of HLA-F tetramers to ILT2 and ILT4 receptors. Eur J Immunol 30: 3552-61. Li, Q., S. Harju, and K.R. Peterson. 1999. Locus control regions: coming of age at a decade plus. Trends  Genet 15:  403-8.  Li, W.H., and Graur, D. 1991. Fundamentals of Molecular Evolution. 1: 443. Liao, D. and A.M. Weiner. 1995. Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT)n.(GA)n microsatellite embedded within the U2 repeat unit. Genomics  30:  583-93.  Liao, N.S., M. Bix, M. Zijlstra, R. Jaenisch, and D. Raulet. 1991. MHC class I deficiency: susceptibility to natural killer (NK) cells and impaired NK activity. Science  253:  199-202. Ljunggren, H.G. and K. Karre. 1985. Host resistance directed selectively against H-2deficient lymphoma variants. Analysis of the mechanism. J Exp Med 162: 174559. Ljunggren, H.G. and K. Karre. 1990. In search of the 'missing self: MHC molecules and NK cell recognition. Immunol Today  11: 237-44.  Lohwasser, S., B. Wilhelm, D.L. Mager, and F. Takei. 2000. The genomic organization of the mouse CD94 C-type lectin gene. Eur J Immunogenet 27: 149-51. MacDonald, H.R. 2002. Development and selection of NKT cells. Curr Opin  Immunol  14: 250-4. Maeda, A., M. Kurosaki, M. Ono, T. Takai, and T. Kurosaki. 1998. Requirement of SH2containing protein tyrosine phosphatases SHP-1 and SHP-2 for paired immunoglobulin-like receptor B (PIR-B)-mediated inhibitory signal. J Exp Med 187: 1355-60.  151  Mager, D.L., K.L. McQueen, V. Wee, and J.D. Freeman. 2001. Evolution of natural killer cell receptors: coexistence of functional Ly49 and KIR genes in baboons.  Curr  Biol 11: 626-30.  Makrigiannis, A.P. and S.K. Anderson. 2000. Ly49 gene expression in different inbred mouse strains. Immunol Res 21: 39-47. Makrigiannis, A.P., J. Etzler, R. Winkler-Pickett, A. Mason, J.R. Ortaldo, and S.K. Anderson. 2000. Identification of the Ly49L protein: evidence for activating counterparts to inhibitory Ly49 proteins. J Leukoc Biol 68: 765-71. Makrigiannis, A.P., A.T. Pau, A. Saleh, R. Winkler-Pickett, J.R. Ortaldo, and S.K. Anderson. 2001. Class I MHC-binding characteristics of the 129/J Ly49 repertoire. J Immunol 166: 5034-43. Makrigiannis, A.P., A.T. Pau, P.L. Schwartzberg, D.W. McVicar, T.W. Beck, and S.K. Anderson. 2002. A BAC Contig Map of the Ly49 Gene Cluster in 129 Mice Reveals Extensive Differences in Gene Content Relative to C57BL/6 Mice. Genomics 7 9 :  437-44.  Martin, A.M., E.M. Freitas, CS. Witt, and FT. Christiansen. 2000. The genomic organization and evolution of the natural killer immunoglobulin-like receptor (KIR) gene cluster. Immunogenetics 51: 268-80. Martinsohn, J.T., AB. Sousa, L.A. Guethlein, and J.C. Howard. 1999. The gene conversion hypothesis of MHC evolution: a review. Immunogenetics 50: 168-200. Mason, L.H., S.K. Anderson, W.M. Yokoyama, H.R. Smith, R. Winkler-Pickett, and J.R. Ortaldo. 1996. The Ly-49D receptor activates murine natural killer cells. J Exp Med 184: 2119-28. Mason, L.H., P. Gosselin, S.K. Anderson, W.E. Fogler, J.R. Ortaldo, and D.W. McVicar. 1997. Differential tyrosine phosphorylation of inhibitory versus activating Ly-49  receptor proteins and their recruitment of SHP-1 phosphatase. J Immunol 159: 4187-96. Mason, L.H., J.R. Ortaldo, H.A. Young, V. Kumar, M. Bennett, and S.K. Anderson. 1995. Cloning and functional characteristics of murine large granular lymphocyte1: a member of the Ly-49 gene family (Ly-49G2). J Exp Med 182: 293-303. McMahon, C.W., A.J. Zajac, A.M. Jamieson, L. Corral, G.E. Hammer, R. Ahmed, and D.H. Raulet. 2002. Viral and bacterial infections induce expression of multiple NK cell receptors in responding CD8(+) T cells. J Immunol  169: 1444-52.  McQueen, K.L., J.D. Freeman, F. Takei, and D.L. Mager. 1998. Localization of five new Ly49 genes, including three closely related to Ly49c. Immunogenetics  48:  174-  83. McQueen, K.L., S. Lohwasser, F. Takei, and D.L. Mager. 1999. Expression analysis of new Ly49 genes: most transcripts of Ly49j lack the transmembrane domain. Immunogenetics 49: 685-91.  McQueen, K.L., B.T. Wilhelm, K.D. Harden, and D.L. Mager. 2002. Evolution of NK receptors: a single Ly49 and multiple KIR genes in the cow.  Eur J Immunol 32:  810-7. McQueen, K.L., B.T. Wilhelm, F. Takei, and D.L. Mager. 2001. Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes. Immunogenetics  52:  23. Medstrand, P., M. Lindeskog, and J. Blomberg. 1992. Expression of human endogenous retroviral sequences in peripheral blood mononuclear cells of healthy individuals. J Gen  Virol 73:  2463-6.  212-  Michaelsson, J., C. Teixeira de Matos, A. Achour, L.L. Lanier, K. Karre, and K. Soderstrom. 2002. A signal peptide derived from hsp60 binds HLA-E and interferes with CD94/NKG2A recognition. J Exp Med 196: 1403-14. Miller, J.D., M. Peters, A.E. Oran, G.W. Beresford, L. Harrington, J.M. Boss, and J.D. Altman. 2002. CD94/NKG2 expression does not inhibit cytotoxic function of lymphocytic choriomeningitis virus-specific CD8+ T cells. J Immunol 169: 693701. Minato, N., B.R. Bloom, C. Jones, J. Holland, and L.M. Reid. 1979. Mechanism of rejection of virus persistently infected tumor cells by athymic nude mice. J Exp Med 149: 1117-33. Mingari, M.C., M. Ponte, S. Bertone, F. Schiavetti, C. Vitale, R. Bellomo, A. Moretta, and L. Moretta. 1998. HLA class l-specific inhibitory receptors in human T lymphocytes: interleukin 15-induced expression of CD94/NKG2A in superantigen- or alloantigen-activated CD8+ T cells. Proc Natl Acad  Sci USA  95: 1172-7. Mingari, M.C., C. Vitale, C. Cantoni, R. Bellomo, M. Ponte, F. Schiavetti, S. Bertone, A. Moretta, and L. Moretta. 1997. lnterleukin-15-induced maturation of human natural killer cells from early thymic precursors: selective expression of CD94/NKG2-A as the only HLA class l-specific inhibitory receptor. Eur J Immunol 27: 1374-80. Moretta, A., S. Sivori, M. Vitale, D. Pende, L. Mprelli, R. Augugliaro, C. Bottino, and L. Moretta. 1995. Existence of both inhibitory (p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J Exp Med 182: 875-84. Moretta, A., M. Vitale, S. Sivori, C. Bottino, L. Morelli, R. Augugliaro, M. Barbaresi, D. Pende, E. Ciccone, M. Lopez-Botet, and et al. 1994. Human natural killer cell  receptors for HLA-class I molecules. Evidence that the Kp43 (CD94) molecule functions as receptor for HLA-B alleles. J Exp Med 180: 545-55. Moser, J.M., J. Gibbs, P.E. Jensen, and A.E. Lukacher. 2002. CD94-NKG2A receptors regulate antiviral CD8(+) T cell responses. Nat Immunol 3: 189-95. Mrozek, E., P. Anderson, and M.A. Caligiuri. 1996. Role of interleukin-15 in the development of human CD56+ natural killer cells from CD34+ hematopoietic progenitor cells. Blood 87: 2632-40. Natarajan, K., H. Li, R.A. Mariuzza, and D.H. Margulies. 1999. MHC class I molecules, structure and function. Rev Immunogenet 1: 32-46. NCBI. 2002. HTGS database. In. NCBI. Neumann, L., W. Kraas, S. Uebel, G. Jung, and R. Tampe. 1997. The active domain of the herpes simplex virus protein ICP47: a potent inhibitor of the transporter associated with antigen processing.  J Mol Biol 272: 484-92.  Norman, P.J., H.A. Stephens, D.H. Verity, D. Chandanayingyong, and R.W. Vaughan. 2001. Distribution of natural killer cell immunoglobulin-like receptor sequences in three ethnic groups. Immunogenetics 52: 195-205. Orihuela, M., D.H. Margulies, and W.M. Yokoyama. 1996. The natural killer cell receptor Ly-49A recognizes a peptide-induced conformational determinant on its major histocompatibility complex class I ligand. Proc Natl Acad Sci U S A 93: 11792-7. Orlinick, J.R. and M.V. Chao. 1998. TNF-related ligands and their receptors.  Cell Signal  10: 543-51. Park, B., H. Oh, S. Lee, Y. Song, J. Shin, Y.C. Sung, S.Y. Hwang, and K. Ahn. 2002. The MHC class I homolog of human cytomegalovirus is resistant to downregulation mediated by the unique short region protein (US)2, US3, US6, and US11 gene products. J Immunol 168: 3464-9.  Park, S.Y., K. Saijo, T. Takahashi, M. Osawa, H. Arase, N. Hirayama, K. Miyake, H. Nakauchi, T. Shirasawa, and T. Saito. 1995. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3: 771-82. Peritt, D., S. Robertson, G. Gri, L. Showe, M. Aste-Amezaga, and G. Trinchieri. 1998. Differentiation of human NK cells into NK1 and NK2 subsets. J Immunol 161: 5821-4. Peruzzi, M., K.C. Parker, E.O. Long, and M.S. Malnati. 1996. Peptide sequence requirements for the recognition of HLA-B*2705 by specific natural killer cells. J Immunol 57: 3350-6.  Piontek, G.E., K. Taniguchi, H.G. Ljunggren, A. Gronberg, R. Kiessling, G. Klein, and K. Karre. 1985. YAC-1 MHC class I variants reveal an association between decreased NK sensitivity and increased H-2 expression after interferon treatment or in vivo passage. J Immunol 135: 4281-8. Plougastel, B., K. Matsumoto, C. Dubbelde, and W.M. Yokoyama. 2001. Analysis of a 1-Mb BAC contig overlapping the mouse Nkrpl cluster of genes: cloning of three new Nkrpl members, Nkrpl d, Nkrpl e, and Nkrplf. Immunogenetics 53: 592-8. Plougastel, B. and J. Trowsdale. 1998. Sequence analysis of a 62-kb region overlapping the human KLRC cluster of genes. Genomics 49: 193-9. Podack, E.R., J.D. Young, and Z.A. Cohn. 1985. Isolation and biochemical and functional characterization of perforin 1 from cytolytic T-cell granules. Proc Natl Acad Sci U S A 82:  8629-33.  Porter, S.D., J. Hu, and C.B. Gilks. 1999. Distal upstream tyrosinase S/MAR-containing sequence has regulatory properties specific to subsets of melanocytes. Dev Genet 25: 40-8.  Radaev, S., M. Kattah, Z. Zou, M. Colonna, and P.D. Sun. 2002. Making sense of the diverse ligand recognition by NKG2D. J Immunol 169: 6279-85. Rajagopalan, S. and E.O. Long. 1997. The direct binding of a p58 killer cell inhibitory receptor to human histocompatibility leukocyte antigen (HLA)-Cw4 exhibits peptide selectivity. J Exp Med 185: 1523-8. Rajalingam, R., M. Hong, E.J. Adams, BP. Shum, L.A. Guethlein, and P. Parham. 2001. Short KIR haplotypes in pygmy chimpanzee (Bonobo) resemble the conserved framework of diverse human KIR haplotypes. J Exp Med 193: 135-46. Rajalingam, R., P. Krausa, H.G. Shilling, J.B. Stein, A. Balamurugan, M.D. McGinnis, N.W. Cheng, N.K. Mehra, and P. Parham. 2002. Distinctive KIR and HLA diversity in a panel of north Indian Hindus. Immunogenetics 53: 1009-19. Rao, A., C. Luo, and P.G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15: 707'-47. Raulet, D.H. 1994. MHC class l-deficient mice. Adv Immunol 55: 381-421. Raulet, D.H., W. Held, I. Correa, J.R. Dorfman, M.F. Wu, and L. Corral. 1997. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class l-specific Ly49 receptors. Immunol Rev 155: 41-52. Raulet, D.H., R.E. Vance, and C.W. McMahon. 2001. Regulation of the natural killer cell receptor repertoire. Annu Rev Immunol 19: 291-330. Renedo, M., I. Arce, A. Rodriguez, M. Carretero, L.L. Lanier, M. Lopez-Botet, and E. Fernandez-Ruiz. 1997. The human natural killer gene complex is located on chromosome 12p12- p13. Immunogenetics 46: 307-11. Reyburn, H., O. Mandelboim, M. Vales-Gomez, E.G. Sheu, L. Pazmany, D.M. Davis, and J.L. Strominger. 1997a. Human NK cells: their ligands, receptors and functions. Immunol Rev  155:  119-25.  Reyburn, H.T., O. Mandelboim, M. Vales-Gomez, D.M. Davis, L. Pazmany, and J.L. Strominger. 1997b. The class I MHC homologue of human cytomegalovirus inhibits attack by natural killer cells. Nature 386: 514-7. Richard, G.F. and F. Paques. 2000. Mini- and microsatellite expansions: the recombination connection. EMBO Rep 1: 122-6. Riley, J., R. Butler, D. Ogilvie, R. Finniear, D. Jenner, S. Powell, R. Anand, J.C. Smith, and A.F. Markham. 1990. A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res 18:2887-90. Romero, P., C. Ortega, A. Palma, I.J. Molina, J. Pena, and M. Santamaria. 2001. Expression of CD94 and NKG2 molecules on human CD4(+) T cells in response to CD3-mediated stimulation. J Leukoc Biol 70: 219-24. Rosmaraki, E.E., I. Douagi, C. Roth, F. Colucci, A. Cumano, and J.P. Di Santo. 2001. Identification of committed NK cell progenitors in adult murine bone marrow. Eur J Immunol 31: 1900-9.  Roth, C, J.R. Carlyle, H. Takizawa, and D.H. Raulet. 2000. Clonal acquisition of inhibitory Ly49 receptors on developing NK cells is successively restricted and regulated by stromal class I MHC. Immunity 13: 143-53. Ryan, J.C, C. Naper, S. Hayashi, and M.R. Daws. 2001. Physiologic functions of activating natural killer (NK) complex-encoded receptors on NK cells. Immunol Rev 181: 126-37. Ryan, J.C. and W.E. Seaman. 1997. Divergent functions of lectin-like receptors on NK cells. Immunol Rev 155: 79-89.  Ryan, J.C, J. Turck, E.C Niemi, W.M. Yokoyama, and W.E. Seaman. 1992. Molecular cloning of the NK1.1 antigen, a member of the NKR-P1 family of natural killer cell activation molecules. J Immunol 149: 1631-5. Salcedo, M., M. Andersson, S. Lemieux, L. Van Kaer, B.J. Chambers, and H.G. Ljunggren. 1998. Fine tuning of natural killer cell specificity and maintenance of self tolerance in MHC class l-deficient mice. Eur J Immunol 28: 1315-21. Salcedo, M., F. Colucci, P.J. Dyson, L.A. Cotterill, F.A. Lemonnier, P. Kourilsky, J.P. Di Santo, H.G. Ljunggren, and J.P. Abastado. 2000. Role of Qa-1(b)-binding receptors in the specificity of developing NK cells. Eur J Immunol 30: 1094-101. Salcedo, M., A.D. Diehl, M.Y. Olsson-Alheim, J. Sundback, L. Van Kaer, K. Karre, and H.G. Ljunggren. 1997. Altered expression of Ly49 inhibitory receptors on natural killer cells from MHC class l-deficient mice. J Immunol 158: 3174-80. Saleh, A., A.P. Makrigiannis, D.L. Hodge, and S.K. Anderson. 2002. Identification of a novel Iy49 promoter that is active in bone marrow and fetal thymus. J Immunol 168: 5163-9. Samaridis, J. and M. Colonna. 1997. Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways. Eur J Immunol 27: 660-5. Santourlidis, S., H.I. Trompeter, S. Weinhold, B. Eisermann, K.L. Meyer, P. Wernet, and M. Uhrberg. 2002. Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK cells. J Immunol 169:4253-61.  Sawicki, M.W., N. Dimasi, K. Natarajan, J. Wang, D.H. Margulies, and R.A. Mariuzza. 2001. Structural basis of MHC class I recognition by natural killer cell receptors. Immunol  Rev 181: 52-65.  Sivakumar, P.V., M. Bennett, and V. Kumar. 1997. Fetal and neonatal NK1.1+ Ly-49cells can distinguish between major histocompatibility complex class l(hi) and class l(lo) target cells: evidence for a Ly-49-independent negative signaling receptor. Eur J Immunol 27: 3100-4. Sivakumar, P.V., A. Gunturi, M. Salcedo, J.D. Schatzle, W.C. Lai, Z. Kurepa, L. Pitcher, M.S. Seaman, F.A. Lemonnier, M. Bennett, J. Forman, and V. Kumar. 1999. Cutting edge: expression of functional CD94/NKG2A inhibitory receptors on fetal NK1.1+Ly-49- cells: a possible mechanism of tolerance during NK cell development. J Immunol^!: 6976-80. Sivakumar, P.V., N.S. Williams, I.J. Puzanov, J.D. Schatzle, M. Bennett, and V. Kumar. 1998. Development of self-recognition systems in natural killer cells. Adv Exp Med Biol 452:  1-12.  Smale, ST. 1997. Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim  Biophys Acta 1351:  73-88.  Smit, A.F. 1999. Interspersed repeats and other mementos of transposable elements in mammalian genomes. Curr Opin  Genet Dev 9:  657-63.  Smith, H.R., H.H. Chuang, L.L. Wang, M. Salcedo, J.W. Heusel, and W.M. Yokoyama. 2000. Nonstochastic coexpression of activation receptors on murine natural killer cells. J Exp Med 191: 1341-54. Smith, H.R., F.M. Karlhofer, and W.M. Yokoyama. 1994. Ly-49 multigene family expressed by IL-2-activated NK cells. J Immunol 153: 1068-79. Smith, K.M., J. Wu, A.B. Bakker, J.H. Phillips, and L.L. Lanier. 1998. Ly-49D and Ly49H associate with mouse DAP12 and form activating receptors. J Immunol 161: 7-10.  Spits, H., F. Couwenberg, A.Q. Bakker, K. Weijer, and C.H. Uittenbogaart. 2000. Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (preDC)2 but not into pre-DC1. Evidence for a lymphoid origin of pre-DC2. J Exp Med 192: 1775-84. Steinle, A., P. Li, D.L. Morris, V. Groh, L.L. Lanier, R.K. Strong, and T. Spies. 2001. Interactions of human NKG2D with its ligands MICA, MICB, and homologs of the mouse RAE-1 protein family.  Immunogenetics 53:  279-87.  Stoneman, E.R., M. Bennett, J. An, K.A. Chesnut, E.K. Wakeland, and J.B. Scheerer. 1996. Cloning and characterization of 5E6 (Ly-49C), a receptor molecule expressed on a subset of murine natural killer cells. J Exp Med 183: 2705. Sykes, M. 1990. Unusual T cell populations in adult murine bone marrow. Prevalence of CD3+CD4-CD8- and alpha beta TCR+NK1.1+ cells. J Immunol 145: 3209-15. Takai, T. and M. Ono. 2001. Activating and inhibitory nature of the murine paired immunoglobulin- like receptor family.  Immunol Rev 181:  215-22.  Takei, F., J. Brennan, and D.L. Mager. 1997. The Ly-49 family: genes, proteins and recognition of class I MHC.  Immunol Rev 155:  67-77.  Takei, F., K.L. McQueen, M. Maeda, B.T. Wilhelm, S. Lohwasser, R.H. Lian, and D.L. Mager. 2001. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol Rev 181: 90-103. Taylor, L.S., S.P. Paul, and D.W. McVicar. 2000. Paired inhibitory and activating receptor signals. Rev  Immunogenet 2: 204-19.  Thomas, J.O. and A.A. Travers. 2001. HMG1 and 2, and related 'architectural' DNAbinding proteins. Trends Biochem Sci 26: 167-74. Thorsby, E. 1999. MHC structure and function.  Transplant Proc 31: 713-6.  Toomey, J.A., M. Salcedo, L.A. Cotterill, M.M. Millrain, Z. Chrzanowska-Lightowlers, J. Lawry, K. Fraser, F. Gays, J.H. Robinson, S. Shrestha, P.J. Dyson, and C.G. Brooks. 1999. Stochastic acquisition of Qa1 receptors during the development of fetal NK cells in vitro accounts in part but not in whole for the ability of these cells to distinguish between class l-sufficient and class l-deficient targets.  J Immunol  163: 3176-84. Toomey, J.A., S. Shrestha, S.A. de la Rue, F. Gays, J.H. Robinson, Z.M. ChrzanowskaLightowlers, and C.G. Brooks. 1998. MHC class I expression protects target cells from lysis by Ly49- deficient fetal NK cells. Eur J Immunol 28: 47-56. Torkar, M., A. Haude, S. Milne, S. Beck, J. Trowsdale, and M.J. Wilson. 2000. Arrangement of the ILT gene cluster: a common null allele of the ILT6 gene results from a 6.7-kbp deletion. Eur J Immunol 30: 3655-62. Torkar, M., Z. Norgate, M. Colonna, J. Trowsdale, and M.J. Wilson. 1998. Isotypic variation of novel imrriunoglobulin-like transcript/killer cell inhibitory receptor loci in the leukocyte receptor complex. Eur J Immunol 28: 3959-67. Tormo, J., K. Natarajan, D.H. Margulies, and R.A. Mariuzza. 1999. Crystal structure of a lectin-like natural killer cell receptor bound to its MHC class I ligand. Nature 402: 623-31. Trowsdale, J. 1993. Genomic structure and function in the MHC. Trends Genet 9: 11722. Trowsdale, J., R. Barten, A. Haude, CA. Stewart, S. Beck, and M.J. Wilson. 2001. The genomic context of natural killer receptor extended gene families. Immunol Rev 181: 20-38.  Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, and K. Kaneda. 1996. IFN-gamma-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J Immunol AST: 3967-73. Uhrberg, M., N.M. Valiante, BP. Shum, H.G. Shilling, K. Lienert-Weidenbach, B. Corliss, D. Tyan, L.L. Lanier, and P. Parham. 1997. Human diversity in killer cell inhibitory receptor genes. Immunity 7: 753-63. Valiante, N.M., M. Uhrberg, H.G. Shilling, K. Lienert-Weidenbach, K.L. Arnett, A. D'Andrea, J.H. Phillips, L.L. Lanier, and P. Parham. 1997. Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7: 739-51. Van Beneden, K., A. De Creus, F. Stevenaert, V. Debacker, J. Plum, and G. Leclercq. 2002. Expression of Inhibitory Receptors Ly49E and CD94/NKG2 on Fetal Thymic and Adult Epidermal TCR Vgamma3 Lymphocytes. J Immunol 168: 3295-302. Van Beneden, K., F. Stevenaert, A. De Creus, V. Debacker, J. De Boever, J. Plum, and G. Leclercq. 2001. Expression of Ly49E and CD94/NKG2 on fetal and adult NK cells. J Immunol 166: 4302-11. Vance, R.E., A.M. Jamieson, D. Cado, and D.H. Raulet. 2002. Implications of CD94 deficiency and monoallelic NKG2A expression for natural killer cell development and repertoire formation. Proc Natl Acad  Sci U S A 99:  868-73.  Vance, R.E., A.M. Jamieson, and D.H. Raulet. 1999. Recognition of the class lb molecule Qa-1(b) by putative activating receptors CD94/NKG2C and CD94/NKG2E on mouse natural killer cells. J Exp Med 190: 1801-12. Vance, R.E., J.R. Kraft, J.D. Altman, P.E. Jensen, and D.H. Raulet. 1998. Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major  histocompatibility complex (MHC) class I molecule Qa-1(b). J Exp Med 188: 1841-8. Vance, R.E., D.M. Tanamachi, T. Hanke, and D.H. Raulet. 1997. Cloning of a mouse homolog of CD94 extends the family of C-type lectins on murine natural killer cells. Eur J Immunol 27: 3236-41. Vilches, C. and P. Parham. 2002. KIR: Diverse, Rapidly Evolving Receptors of Innate and Adaptive Immunity. Annu Rev  Immunol 20: 217-51.  Vitale, M., R. Castriconi, S. Parolini, D. Pende, M.L. Hsu, L. Moretta, D. Cosman, and A. Moretta. 1999. The leukocyte Ig-like receptor (LIR)-1 for the cytomegalovirus UL18 protein displays a broad specificity for different HLA class I alleles: analysis of LIR-1 + NK cell clones. Int Immunol 11: 29-35. Vivier, E., M. Ackerly, N. Rochet, and P. Anderson. 1992. Structure and function of the CD16:zeta:gamma complex expressed on human natural-killer cells. IntJ  Cancer  Suppl 7: 11-4.  Volanakis, J.E. 1995. Transcriptional regulation of complement genes. Annu Rev Immunol13:  277-305.  Volz, A., H. Wende, K. Laun, and A. Ziegler. 2001. Genesis of the ILT/LIR/MIR clusters within the human leukocyte receptor complex. Immunol Rev 181: 39-51. Wagtmann, N., S. Rajagopalan, C.C. Winter, M. Peruzzi, and E.O. Long. 1995. Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by direct binding and by functional transfer. Immunity 3: 801-9. Wagtmann, N., S. Rojo, E. Eichler, H. Mohrenweiser, and E.O. Long. 1997. A new human gene complex encoding the killer cell inhibitory receptors and related monocyte/macrophage receptors. CurrBiol7: 615-8.  Wang, B., C. Biron, J. She, K. Higgins, M.J. Sunshine, E. Lacy, N. Lonberg, and C. Terhorst. 1994. A block in both early T lymphocyte and natural killer cell development in transgenic mice with high-copy numbers of the human CD3E gene. Proc Natl Acad  Sci U S A 91: 9402-6.  Waterston, R.H. et al. 2002. Initial sequencing and comparative analysis of the mouse genome. Nature  420: 520-62.  Wende, H., M. Colonna, A. Ziegler, and A. Volz. 1999. Organization of the leukocyte receptor cluster (LRC) on human chromosome 19q13.4. Mamm  Genome 10:  154-60. Westgaard, I.H., S.F. Berg, S. Orstavik, S. Fossum, and E. Dissen. 1998. Identification of a human member of the Ly-49 multigene family.  Eur J Immunol 28:  1839-46.  Wildin, R.S., H.U. Wang, K.A. Forbush, and R.M. Perlmutter. 1995. Functional dissection of the murine Ick distal promoter.  J Immunol 155:  1286-95.  Wiley, S.R., K. Schooley, P.J. Smolak, W.S. Din, CP. Huang, J.K. Nicholl, G.R. Sutherland, T.D. Smith, C. Rauch, CA. Smith, and et al. 1995. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 3: 673-82.  Wilhelm, B.T., L. Gagnier, and D.L. Mager. 2002. Sequence analysis of the Iy49 cluster in C57BL/6 mice: a rapidly evolving multigene family in the immune system. Genomics 80: 646-61.  Wilhelm, B.T. and D.L. Mager. 2003. Identification of a new murine lectin-like gene in close proximity to CD94. Immunogenetics In  press.  Wilhelm, B.T., K.L. McQueen, J.D. Freeman, F. Takei, and D.L. Mager. 2001. Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53: 215-24.  Williams, N.S., J. Klem, I.J. Puzanov, P.V. Sivakumar, M. Bennett, and V. Kumar. 1999. Differentiation of NK1.1+, Ly49+ NK cells from flt3+ multipotent marrow progenitor cells. J Immunol 163: 2648-56. Williams, N.S., J. Klem, I.J. Puzanov, P.V. Sivakumar, J.D. Schatzle, M. Bennett, and V. Kumar. 1998. Natural killer cell differentiation: insights from knockout and transgenic mouse models and in vitro systems. Immunol Rev 165: 47-61. Williams, N.S., A. Kubota, M. Bennett, V. Kumar, and F. Takei. 2000. Clonal analysis of NK cell development from bone marrow progenitors in vitro: orderly acquisition of receptor gene expression. Eur J Immunol 30: 2074-82. Wilson, M.J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, and J. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/ILT gene families. Proc  Natl Acad Sci U S A 97:  4778-83.  Winter, C.C., J.E. Gumperz, P. Parham, E.O. Long, and N. Wagtmann. 1998. Direct binding and functional transfer of NK cell inhibitory receptors reveal novel patterns of HLA-C allotype recognition. J Immunol 161: 571-7. Wolan, D.W., L. Teyton, M.G. Rudolph, B. Villmow, S. Bauer, D.H. Busch, and I.A. Wilson. 2001. Crystal structure of the murine NK cell-activating receptor NKG2D at 1.95 A. Nat Immunol 2: 248-54. Wong, S., J.D. Freeman, C. Kelleher, D. Mager, and F. Takei. 1991. Ly-49 multigene family. New members of a superfamily of type II membrane proteins with lectinlike domains. J Immunol 147: 1417-23. Wu, J., Y. Song, A.B. Bakker, S. Bauer, T. Spies, L.L. Lanier, and J.H. Phillips. 1999. An activating immunoreceptor complex formed by NKG2D and DAP10. 285: 730-2.  Science  Wu, M.F. and D.H. Raulet. 1997. Class l-deficient hemopoietic cells and nonhemopoietic cells dominantly induce unresponsiveness of natural killer cells to class l-deficient bone marrow cell grafts. J Immunol 158: 1628-33. Xu, X., M. Peng, and Z. Fang. 2000. The direction of microsatellite mutations is dependent upon allele length. Nat Genet 24: 396-9. Yamashita, Y., D. Fukuta, A. Tsuji, A. Nagabukuro, Y. Matsuda, Y. Nishikawa, Y. Ohyama, H. Ohmori, M. Ono, and T. Takai. 1998a. Genomic structures and chromosomal location of p91, a novel murine regulatory receptor family. J Biochem (Tokyo) 123:  358-68.  Yamashita, Y., M. Ono, and T. Takai. 1998b. Inhibitory and stimulatory functions of paired Ig-like receptor (PIR) family in RBL-2H3 cells. J Immunol 161: 4042-7. Yawata, M., N. Yawata, K.L. McQueen, N.W. Cheng, L.A. Guethlein, R. Rajalingam, H.G. Shilling, and P. Parham. 2002. Predominance of group A KIR haplotypes in Japanese associated with diverse NK cell repertoires of KIR expression. Immunogenetics 54:  543-50.  Yeager, M. and A.L. Hughes. 1999. Evolution of the mammalian MHC: natural selection, recombination, and convergent evolution. Immunol Rev  167:  45-58.  Yokota, Y., A. Mansouri, S. Mori, S. Sugawara, S. Adachi, S. Nishikawa, and P. Gruss. 1999. Development of peripheral lymphoid organs and natural killer cells depends on the helix-loop-helix inhibitor Id2. Nature 397: 702-6. Yokoyama, W.M. and W.E. Seaman. 1993. The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex. Annu Rev Immunol 11: 613-35.  Young, NT., F. Canavez, M. Uhrberg, BP. Shum, and P. Parham. 2001. Conserved organization of the ILT/LIR gene family within the polymorphic human leukocyte receptor complex. Immunogenetics 53: 270-8. Zhang, Y. and M.A. Frohman. 1997. Using rapid amplification of cDNAends (RACE) to obtain full-length cDNAs. Methods  Mol Biol 69:  61-87.  Zinkernagel, R.M., MP. Bachmann, TM. Kundig, S. Oehen, H. Pirchet, and H. Hengartner. 1996. On immunological memory. Annu  Rev Immunol 14:  333-67.  168  Web site references  http://searchlauncher.bcm.tmc.edu/; site from which sequence manipulations can be performed. http://www.ncbi.nlm.nih.gov; site where data can be human and mouse sequence data (in draft and finished form) can be searched for and downloaded from. http://www.ncbi.nlm.nih.gov/blast/bl2seg/bl2.html: site where local alignments of two sequences can be performed. http://www.ensembl.org/Mus musculus; site where daft genomic data can be searched and downloaded. http://www.psc.edu/biomed/genedoc; site where the Genedoc program can be downloaded. http://www.megasoftware.net; site where Mega software package can be downloaded. http://bio.cse.psu.edu/pipmaker/; site where percentage identity plots and figures between two sequences can be generated. http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotter.html; site where the Dotter program can be downloaded. http://www.health.auckland.ac.nz/.../ lmm07/lmm07Notes2001 .html; Missing-self hypothesis image. http://www.genome.washington.edu/UWGC/analysistools/repeatmask.htm; program which identifies repetitive sequences. http://transfac.gbf.de/c/s.dll/matSearch/matsearch.pl; program to search for transcription factor binding sites. http://genome.ucsc.edu/; human genome browser site for summarized genomic sequence and features.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091138/manifest

Comment

Related Items