Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Interventions for primary prevention of post-bronchiolitis allergic sensitization in guinea pigs Tayyari, Farnoosh 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-0606.pdf [ 3.87MB ]
Metadata
JSON: 831-1.0091133.json
JSON-LD: 831-1.0091133-ld.json
RDF/XML (Pretty): 831-1.0091133-rdf.xml
RDF/JSON: 831-1.0091133-rdf.json
Turtle: 831-1.0091133-turtle.txt
N-Triples: 831-1.0091133-rdf-ntriples.txt
Original Record: 831-1.0091133-source.json
Full Text
831-1.0091133-fulltext.txt
Citation
831-1.0091133.ris

Full Text

INTERVENTIONS FOR P R I M A R Y PREVENTION OF POST-BRONCHIOLITIS A L L E R G I C S E N S I T I Z A T I O N IN G U I N E A PIGS by FARNOOSH T A Y Y A R I M.D., Mashhad University of Medical Sciences, Mashhad, Iran, 1997 A THESIS SUBMITTED IN P A R T I A L F U L F I L M E N T OF THE REQUIREMENTS FOR THE D E G R E E OF M A S T E R OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES (DEPARTMENT OF E X P E R I M E N T A L MEDICINE) We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A September 2003  © Farnoosh Tayyari, 2003  c  U B C Rare Books and Special Collections - Thesis Authorisation Form  Page 1 of 1  In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f the requirements f o r an advanced degree a t the U n i v e r s i t y o f B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and study. I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g o f t h i s t h e s i s f o r s c h o l a r l y purposes may be g r a n t e d by the head of my department o r by h i s o r her r e p r e s e n t a t i v e s . I t i s u n d e r s t o o d t h a t c o p y i n g or p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l not be a l l o w e d without my w r i t t e n p e r m i s s i o n .  Department The U n i v e r s i t y o f B r i t i s h Columbia Vancouver, Canada  http://www.library.ubc.ca/spcoll/thesauth.html  9/23/2003  ABSTRACT Asthma is a serious health problem that affects over 2.4 million Canadians. Asthma and allergy are closely linked and 80% of asthmatic children are allergic to at least one inhaled antigen. Among several conditions of diverse etiology that are included in asthma, we studied postbronchiolitis asthma and allergy in children, in which an episode of acute bronchiolitis precedes the onset of asthma. By focusing on the Thl/Th2 paradigm concept, in which shifting the Thl/Th2 balance towards Th2 is characteristic of allergic responses, we proposed two types of interventions for preventing the post-bronchiolitis allergic sensitization and asthma in a guinea pig model of respiratory syncytial virus (RSV) infection and ovalbumin (OA) sensitization. These interventions, which included inoculation of animals with relatively "low doses" of R S V or administration of CpG-ODN (synthetic oligodeoxynucleotides rich in cytosine and guanine) before experimental R S V infection plus O A exposures, were applied to shift the Thl/Th2 towards T h l responses. We compared 4 groups of animals (n=10-12/group), including controls and animals that had the intervention. We compared airway inflammatory cells (eosinophils and T cells) by point counting of the Hansel stained and anti-CD3 immunostained formalin-fixed paraffin embedded lung sections. Using ELISA, we also measured the titers of serum O A specific IgGi antibodies, which increase during allergic sensitization and reflect Th2 responses. We also compared lung IFNy/IL-5 gene expression ratios as indices of Thl/Th2 balance, by semi-quantitative RT-PCR method. The results showed that low dose R S V had no effect on any of the indices of allergy and asthma examined. However, CpG-ODN intervention decreased the percentage of inflammatory cells and the titers of IgGi antibodies, and increased the lung IFNy/IL-5 gene expression ratios. We also tested the effect of CpG-ODN on uninfected O A sensitized guinea pigs and the results showed that CpG-ODN did not affect O A sensitization. In conclusion, the "low dose" R S V intervention had no effect on post-bronchiolitis allergic sensitization of guinea pigs but the CpG-ODN administration provided partial protection against combination of R S V infection and O A sensitization.  ii  T A B L E OF CONTENTS Page Abstract  ii  Table of Contents  iii  List of Tables  vi  List of Figures  vii  Acknowledgements  viii  C H A P T E R 1 Asthma 1.1 1.2  1.3  1.4  1.5 CHAPTER 2 2.1 2.2 2.3 2.4 2.5  2.6 2.7 2.8  1 General Introduction Definition 1.2.1 Reversible Airflow Obstruction 1.2.2 Non-specific Bronchial Hyperreactivity 1.2.3 Airway Inflammation 1.2.4 Airway Remodeling Etiology of Asthma 1.3.1 Atopy and Asthma 1.3.2 Bronchiolitis 1.3.2.1 Clinical Features 1.3.2.2 Diagnosis 1.3.2.3 Treatment 1.3.2.4 Prophylaxis 1.3.2.5 Immunization Imbalance between Thl and Th2 Cells and the Origin of Asthma 1.4.1 T h l Priming with Different Doses of antigen 1.4.2 Thl Priming with CpG-ODNs Summary  1 1 1 2 2 2 2 3 3 3 4 4 5 5 5 7 7 7  Respiratory Syncytial Virus  8  Historical Background Classification of RSV R S V structure RSV Replicative cycle Host Response to R S V Infection 2.5.1 Innate Immunity to R S V 2.5.2 Humoral Immunity to R S V 2.5.3 Cellular Response to R S V RSV Pathology RSV and Asthma Summary iii  8 8 8 9 9 10 10 11 11 11 12  CHAPTER 3 3.1 3.2 3.3 3.4 3.5 CHAPTER 4 4.1 4.2 4.3 4.4  4.5 CHAPTER 5 5.1  5.2  CHAPTER 6 6.1 6.2 6.3 6.4 6.5 6.6 6.7 6.8 6.9  Animal Model for Post-bronchiolitis Asthma  14  Animal Models for RSV Bronchiolitis Guinea Pig as a Model for Asthma Other Advantages of Using Guinea pigs Limitations of Using Guinea pigs in Molecular Biology Summary  14 15 16 16 16  Working Hypothesis, Specific Aims and Strategy  17  Goal Working Hypothesis Specific Aims Strategy 4.4.1 Low Dose R S V 4.4.2 CpG-ODN Dose and Route of Administration 4.4.3 OA-specific IgG, Titers 4.4.4 Allergic Airway Inflammation 4.4.5 Lung IFNy/IL-5 Ratios Summary  17 17 17 18 18 18 18 18 19 19  Preliminary Studies  21  CpG-ODN Dosing Study Of Guinea Pigs To Determine How Dose And Route O f Administration Affects Pulmonary Thl/Th2 Balance 21 5.1.1 Experimental Design 21 5.1.2 Specimens 21 5.1.3 Data Analysis 22 5.1.4 Results 22 5.1.5 Summary 23 Cytokine Gene Expression Measurement 23 5.2.1 Primer Design for PCR 23 5.2.2 PCR Optimization 23 5.2.3 PCR Sensitivity Measurement 24 5.2.4 Sequencing the PCR products 24 5.2.5 Summary 24 Materials and Methods  35  Experimental Design Animals Virus Preparation Virus Inoculation CpG-ODN Administration OA-sensitization and Challenge Serum Collection Lung Tissue Processing Measurement of OA-specific IgGi Titers  35 35 35 36 36 36 37 37 37  iv  6.10  6.11  6.12 CHAPTER 7 7.1 7.2 7.3 CHAPTER 8 8.1 8.2 8.3 8.4 8.5 CHAPTER 9 9.1 9.2 9.3 9.4  Lung Histology 6.10.1 Eosinophil and Lymphocyte Staining 6.10.2 Image Capture and Cell Counting Cytokine Messenger R N A Expression 6.11.1 R N A Extraction 6.11.2 Reverse Transcription 6.11.3 Polymerase Chain Reaction 6.11.4 Gel Electrophoresis, Digital Image Capture and Densitometry 6.11.5 Normalization and Determining Copy Equivalents Statistical Analysis  40 40 40  Results  44  OA-specific Antibody Titers Airway Inflammation Semi-quantitative RT-PCR  44 44 45  The Effect of CpG-ODN on OA-sensitized Animals  58  Experimental Design Specimens Data Analysis Results Conclusion  58 58 58 59 59  Discussion  63  The Low Dose R S V Intervention 63 The CpG-ODN Intervention 65 Effects of CpG-ODN Pre-treatment Regimen on OA-sensitized Guinea Pigs 69 Summary and Conclusion 71  Bibliography Appendix  38 38 38 39 39 39 39  72 Equations  78  i  List of Tables  No.  Title  Page  4.1  Results of Low Dose R S V Infection on IFNy/IL-5 Ratio and RSV-Specific IgGi ... .20  5.1  Primer Sequences for RT-PCR  29  5.2  Sequences of our PCR Products Reported by NAPS  34  6.1  Temperatures, Time, and Cycles during PCR  43  7.1 7.2 7.3 7.4  Circulating Titers of OA-specific IgGi Antibodies in Sera of Guinea Pigs Results of Lung Histology for Airway T Cells Results of Lung Histology for Airway Eosinophils Results of Lung Cytokine Gene Experiment  46 55 56 57  8.1 8.2 8.3  Circulating Titers of OA-specific IgGi Antibodies in Sera of Guinea Pigs Results of lung Histology for Airway Eosinophils Lung Cytokine Gene Results  60 61 62  vi  List of Figures No.  Title  5.1  The ratio of natural logarithm of lung IFNy to natural logarithm lung G A P D H in different groups of our preliminary experiment The ratio of natural logarithm of lung IFNy to natural logarithm lung G A P D H in different groups of our preliminary experiment The ratio of natural logarithm of lung IFNy to natural logarithm lung G A P D H in different groups of our preliminary experiment Cycles of amplification for pActin Cycles of amplification for IFNy Cycles of amplification for IL-5 Sensitivity of PCR methods  5.2 5.3 5.4 5.5 5.6 5.7 6.1 6.1  7.1 7.2 7.3 7.4 7.5 7.6 7.7 7.8  Page  Schematic diagram showing time course of treatments Guinea pig whole lung and sagital sections of the lung lobes one hour after intranasal administration of 300 | l L of India ink  Photomicrograph of unsensitized, uninfected guinea pig (Group 1) airway (stained by anti-CD3 antibody) Photomicrograph of RSV-infected, OA-sensitized guinea pig (Group 2) airway (stained by anti-CD3 antibody) Photomicrograph of low dose RSV inoculated, RSV-infected, OA-sensitized guinea pig (Group 3) airway (stained by anti-CD3 antibody) Photomicrograph of CpG-ODN pre-treated, RSV-infected, OA-sensitized guinea pig (Group 4) membranous airway (stained by anti-CD3 antibody) Photomicrograph of unsensitized, uninfected OA-sensitized guinea pig (Group 1) airway (Hansel's staining) Photomicrograph of RSV-infected, OA-sensitized guinea pig (Group 2) airway (Hansel's staining) Photomicrograph of low dose R S V inoculated, RSV-infected, OA-sensitized guinea pig (Group 3) airway (Hansel's staining) Photomicrograph of CpG-ODN pre-treated, RSV-infected, OA-sensitized guinea pig (Group 4) membranous airway (Hansel's staining)  vn  26 27 28 30 31 32 33 41 42  47 48 49 50 51 52 53 54  Acknowledgments  I would like to thank my supervisor Dr. R.G. Hegele for his continuous support and encouragement; my supervisory committee Drs. R.R. Schellenberg and D.R. Dorscheid for their constructive comments; Mr. M . Sekhon for his collaboration in OA-sensitization and R N A extraction; Mr. T. Sutton for his assistance in OA-sensitization; Drs. M . K . Ashfaq, P.K. Kaan, L. Ding, L. Buzatu, and Ms. D. Zhou, Mr. S Tsang, Mr. S. Greene for their helpful comments and suggestions in techniques used in this thesis; staff of St. Paul's Hospital Histology Laboratory for processing histological sections; Ms. L. Carter and C. Collier and K. Groden from the Animal Care Facility; Dr. H.E. Manson for her statistical advice; Coley Pharmaceutical Group Inc. for providing CpG-ODN (Chapters 5, 6, and 7); and to my husband, Fateh for his faith and support and my precious daughter, Hiva for her patience. This project was funded by the Canadian Institutes of Health Research (CIHR).  Vlll  C H A P T E R 1: A S T H M A 1.1. G E N E R A L I N T R O D U C T I O N  Asthma is a serious health problem in Canada and affects both children and adults. According to the 1998-99 National Population Health Survey (NPHS), over 2.4 million Canadians (10.7% of children and 7.5% of adults) suffer from this chronic condition [1]. The mortality and morbidity associated with asthma affects the life of asthmatic patients and their families as well as the community and is estimated to cost the Canadian health care system $0.8 to $1 billion annually [2].  1.2. DEFINITION i_  Instead of being a single entity, asthma includes several conditions of diverse etiology and pathogenesis that share similar clinical features [3]. Due to this diversity, asthma is difficult to define and instead it is characterized by its hallmarks of reversible airflow obstruction, nonspecific bronchial hyperreactivity, chronic airway inflammation and airway remodeling [4,5]. Each of the hallmarks is described below. 1.2.1. Reversible Airflow Obstruction  Decreased airflow rates during expiration that are often associated with an elevated functional residual capacity are characteristic for airflow obstruction [6]. Using lung spirometry, airflow obstruction is diagnosed by measuring the forced expiratory volume in 1 second (FEVi) and the forced vital capacity (FVC) [6]. The decreased ratio of F E V i to F V C (<75%) is indicative of airflow obstruction [7]. However, in contrast to chronic obstructive pulmonary diseases (COPD), airflow obstruction in asthma is episodic and has a pharmacological and spontaneous reversibility [6]. The reversibility of the obstruction in patients with obstructive lung disease could be measured by changes in F E V i before and after administration of an inhaled bronchodilator. In adults, an increase of at least 12% and 200 mL in F E V i or 15% and 200 m L in F V C defines reversibility [7]. In children, reversibility has been defined by 10% increase in F E V i [8]. In situations for which spirometry is not diagnostic, bronchial provocation testing will be needed to confirm non-specific bronchial hyperreactivity in the airways of asthmatics [6].  1  1.2.2 Non-Specific Bronchial Hyperreactivity Bronchial hyperreactivity refers to the airways of asthmatic patients having a lower threshold (increased sensitivity) and greater narrowing (increased maximal response) in response to exposure to nonspecific bronchoconstrictors such as cold air, exercise, and a number of inhaled substances (e.g., methacoline) [9]. Increasing amounts of a bronchoconstrictive agent can be given to induce the response in patients. A test is considered positive when a >20% drop in F E V i is observed after inhaling a nebulized solution of methacoline at a dose of 16mg/mL or less [7].  1.2.3. Airway Inflammation The inflammatory process in airways of asthmatics has been recognized for more than 100 years. The chronic airway inflammation in asthma affects the proximal and distal conducting airways but relatively spares the parenchyma [11]. The airway inflammation is characterized by infiltration of inflammatory cells [11]. The inflammatory cells are infiltrated in all compartments of the airway and include T lymphocytes, mast cells, basophils, macrophages, and eosinophils and in some forms of asthma, neutrophils [11].  1.2.4. Airway Remodeling Airway inflammation plays a central role in asthma, but it does not explain the chronicity and progression of this disease [10]. For example, the use of corticosteroids in the therapy of asthma controls symptoms but does not cure the disease [11]. However, other structural changes in all compartments of the airway that result in airway wall thickening, have attracted the notice of researchers interested in asthma. These changes are called "airway remodeling" and are characterized by epithelial goblet cell hyperplasia and metaplasia, increased accumulation of extracellular matrix in subepithelial connective tissue and adventitia of the airway wall, smooth muscle hypertrophy and hyperplasia, increased vascularity, and proliferation of nerves [12].  1.3. ETIOLOGY OF ASTHMA The etiology of asthma involves the  interaction  between  genetic  factors  and  environmental exposures. However, being a "complex genetic disorder", classical Mendelian patterns of inheritance do not apply to asthma [13]. Environmental exposures are also believed to play important roles in the development of asthma [14].  It is thought that genetic factors (e.g. atopy) predispose individuals to environmental allergic reactions. The environmental factors that lead to allergic responses include animal dander, dust mite, cockroach allergens and workplace contaminants. In addition there are other factors that increase the possibility of developing asthma in people exposed to allergens and examples of these contributing factors are viral respiratory infections, air pollution, and exposure to cigarette smoke during pregnancy and childhood. [1] In contrast to factors mentioned above, breast-feeding and avoiding the exposure of infants and young children to allergens and cigarette smoke may decrease the risk of asthma [1].  1.3.1. Atopy and Asthma The term "atopy" refers to a state of IgE-mediated allergic response to environmental allergens [15]. Despite there being no standardized definition of atopy, it can be assessed in several ways, including measurement of total serum IgE and allergen-specific IgE, positive skintest reaction to intradermally-injected allergens, or association with other conditions such as infantile eczema, allergic rhinitis and food allergies [15]. Asthma and atopy are closely linked, and if the age of patients is considered, > 80% of asthmatic children are allergic to one or more inhaled allergens [16].  1.3.2. Bronchiolitis Association of bronchiolitis in infancy with recurrent wheezing and asthma during childhood has been reported frequently [18-21] and will be described in the next chapter. Acute bronchiolitis is a common, predominantly viral illness that affects lower respiratory tract of children less than 24 months old. The disease occurs sporadically and has peak incidence during the winter and early spring. Respiratory syncytial virus (RSV) accounts for the majority of cases and almost all of the remainder are produced by parainfluenza 3 virus, Mycoplasma, some adenoviruses, and occasionally other viruses [17].  1.3.2.1 Clinical Features A history of exposure to older children or adults with minor respiratory diseases within the week before the onset of bronchiolitis is usual. First the infant develops upper respiratory infection symptoms with or without loss of appetite and fever and after several days, paroxysmal wheezy cough and dyspnea occurs. Respiratory distress results in tachypnea and cyanotic 3  appearance as well as diminished food intake, which in turn causes dehydration, irritability, and lethargy. Increased respiratory effort leads to nasal flaring and intercostal and subcostal retractions. The liver and spleen may be palpable due to their depression by overinflated lungs. If the bronchiolitis is not severe enough to cause a complete airway obstruction, widespread fine crackles and wheezes are heard. Conjunctivitis or otitis may accompany the illness. The course of bronchiolitis in previously healthy infants is typically 3 to 10 days. Overall, 1-2% of children diagnosed with bronchiolitis require hospitalization, and of these hospitalized patients, 3% to 7% develop respiratory failure, and 1% die. Complications such as atelectasis, apnea, and respiratory failure are more common in children who have significant cardiopulmonary disease or immunodeficiency [17,22].  1.3.2.2 Diagnosis Virus may be demonstrated in nasopharyngeal secretions by culture, antigen detection (e.g., by immunofluorescence assay (IFA) or enzyme immunoassay (EIA)) or by amplification of virus-specific nucleic acid by use of polymerase chain reaction (PCR) [23]. Chest x-ray findings are nonspecific and may reveal diffuse hyperinflation of the lungs or scattered areas of consolidation, which represent alveolar inflammation or atelectasis [22].  1.3.2.3 Treatment The treatment for bronchiolitis is mainly supportive and includes administration of oral fluids, antipyretics, and oxygen. Bronchodilators sometimes are beneficial and this is usually shown by a trial administration. Indications for hospitalization in otherwise healthy children are tachypnea, marked retractions, listlessness, and poor oral intake. In addition, children with immunodeficiency or underlying cardiopulmonary disease should be admitted to the hospital. In case of apnea, rising  P C02 a  value, listlessness and chest retractions intubation and mechanical  ventilation are required. Ventilated patients receive corticosteroids, theophylline, and furosemide [17,22]. Ribavirin, a broad-spectrum antiviral agent is administered for early treatment of R S V bronchiolitis in high-risk infants (e.g., infants with congenital heart disease, bronchopulmonary dysplasia, lung and chest wall anomalies, and immunodeficiency) and also less than 6-week-old infants or those who are severely affected  (P 02 a  <65 mm Hg, rising  P C02). a  Improved  oxygenation, improved clinical scores, and lower levels of mediators of inflammation have been observed after administration of ribavirin [24]. 4  However, use of ribavirin does not reduce mortality or duration of hospitalization in infants with R S V bronchiolitis [19]. Furthermore, the use of ribavirin is restricted because of its expense and potential teratogenic effects on hospital staff. [19].  1.3.2.4 Prophylaxis Passive immunization with the immunoglobulin containing high titers of anti-RSV antibody or monoclonal antibody against F protein of R S V (palivizumab) has been reported to result in less severe illness and lower risk of hospitalization for R S V infection [24]. Given practical considerations of cost and logistic of administration, prophylaxis for R S V is only recommended in high-risk infants who have an underlying condition such as bronchopulmonary dysplasia or a history of premature birth [22].  1.3.2.5 Immunization  ;  The unfortunate experience during the original trials of a formalin-inactivated vaccine, in which after subsequent R S V infection 80% of vaccine recipients compared with 5% of controls were hospitalized and two vaccine recipients died [25], has delayed the vaccine development. Furthermore, particular problems such as existence of several antigenic strains for R S V , immaturity of immune system during early life, presence of maternal antibodies during the first months of infancy, and limitations of available animal models, the development of a vaccine has been delayed [23]. Despite these problems, research on live attenuated vaccines, genetically engineered viral vaccines, live viral vectors, and subunit vaccines is proceeding [23].  1.4. I M B A L A N C E B E T W E E N TH1 A N D TH2 C E L L S A N D T H E ORIGIN O F A S T H M A  C D 4 T lymphocytes, also known as T helper (Th) cells can be classified into subsets, +  based on biosecretory profiles of cytokines [26]. O f these subsets, T h l and Th2 cells have opposing roles and regulate immune responses to intracellular and extracellular pathogens, respectively [27]. Murine Thl cells are involved in cellular immunity by producing interferon-y (IFNy), interleukin-2 (IL-2), and tumor necrosis factor-p (TNFp), thereby promoting the development of CD8 cytotoxic T lymphocytes and macrophages, while Th2 cells by producing +  IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13 are involved in humoral immunity, which is associated with allergy and parasitic infestations [27,28]. Although production of some cytokines such as IL-2, IL-6, IL-10, and IL-13 in humans is not limited to a single subset of C D 4 T cells, the +  5  overall Thl/Th2 pattern is similar to the mouse [27]. A variety of factors determine the commitment to a T h l or Th2 response including the local cytokine milieu, the dose of antigen, the antigen-presenting cell (APC), and the delivery of the costimulatory signals from the A P C to T cells [28]. Briefly, T cells are regulated by antigen-specific signals and costimulatory signals mediated by CD28 on T cells and B7-1 (CD80) and B7-2 (CD86) on APCs add an additional level of regulation on T cells [29]. Several in vitro and in vivo studies have reported that B7/CD28 signals induce the Th2 responses [29]. A period of antigenic stimulation is required to make isolation of C D 4 T cells capable of a Thl or Th2 response [30]. This stimulation, which +  can also occur during active or resolved infections, categorizes the T-cells into primed memory T cells [30]. IL-12 produced by APCs has a key role in commitment of naive C D 4  +  T cell  precursors to T h l cells [28]. IL-12 by activating signal transducer and activator of transcription 4 (Stat4) results in T h l responses [28]. T h l cells in turn produce IFNy, which upregulates the IL12 receptor and inhibits the growth of Th2 cells [28]. On the other hand Stat6 mediates development of Th2 responses by IL-4 [28]. IL-4 also downregulates IL-12 receptors making the commitment into Th2 cells easy [28]. Taken together, an increase in the differentiation and function of one of these C D 4  +  subsets decreases the differentiation and function of the opposing one, indicating existence of a Thl/Th2 balance in the body that can be skewed in different conditions. It is thought that a T h l and Th2 balance shifted toward the Th2 response, contributes to the etiology of atopic diseases such as asthma [30]. It is believed that during normal pregnancy the immune response shifts towards Th2 response, to protect rejection of the fetus by immunologically different maternal tissues [31]. In newborns the Thl/Th2 balance is still skewed toward Th2 cells and some investigators have suggested that exposure to stimuli which shift the Thl/Th2 balance toward Thl during early infancy can reduce the risk of allergy and asthma in childhood [30]. Although several interventions have been proposed for priming T h l host response, the efficacy of these interventions in preventing the onset of asthma and allergy in children is controversial [32,33]. Despite this controversy, two types of suggested interventions that we have applied in our experiments are described below:  1.4.1 T h l Priming with Different Doses of Antigens Studies on the effect of tuberculosis [34] and Leishmaniasis [35] on the T cell cytokine profile show that Thl/Th2 responses are determined by the infectious dose during first exposure. In particular, regardless of whether the pathogen is bacterial or parasitic, exposures to 6  comparatively low doses of initial pathogen stimulate a long-lasting, protective T h l response, while initial high infectious doses stimulate a harmful mixed Thl+Th2 response. These findings support the possibility of developing interventions that can preferentially stimulate a Thl response.  1.4.2 T h l priming with C p G oligodeoxynucleotides (ODNS) CpG-ODNs are synthetic oligodeoxynucleotide agents characterized by unmethylated cytosine-guanine (CG) dinucleotides in particular motifs [36]. These CpG motifs have potent immunostimulatory effects and are found abundantly in bacterial D N A [36]. Unmethylated CpG motifs do not exist in vertebrate D N A and the vertebrate immune system recognizes the CpG motifs by Toll-like receptor 9 (TLR9) [37]. CpG motifs can activate a number of transcription factors such as nuclear factor  KB (NF-KB)  and activator protein-1 (AP-1) [37]. This activation  induces macrophages and dendritic cells to secrete cytokines such as IL-12 and IL-18 and natural killer cells to secrete IFNy [38]. In murine models of asthma, application of CpG-ODN has resulted in suppression of allergen-induced asthma associated with a shift of Thl/Th2 balance toward T h l responses [39-41].  1.5 S U M M A R Y In summary asthma and allergy are closely linked, with >80% of asthmatic children being allergic to one or more inhaled allergens. There is epidemiological and experimental evidence that viral respiratory tract infections such as RSV acute bronchiolitis may contribute to allergic sensitization. It is believed that asthma and allergy originate from shift of Thl/Th2 balance toward Th2 responses. Accordingly, several interventions have been proposed to shift the Thl/Th2 balance away from Th2 responses, thereby protecting against allergy and asthma. Two of these interventions that are related to this thesis are described in this chapter including priming Thl responses with low doses of antigens and priming T h l responses with CpG-ODNs.  7  C H A P T E R 2: R E S P I R A T O R Y S Y N C Y T I A L VIRUS  2.1. H I S T O R I C A L B A C K G R O U N D Respiratory syncytial virus (RSV) was first isolated in 1956 from chimpanzees that had common cold symptoms and the new virus was called the "Chimpanzee coryza agent" [42]. The following year, the same virus was isolated from infants with respiratory disease [43] and the name "respiratory syncytial virus" was given to the virus because of its ability to fuse infected cells into syncytia in some tissue culture cell lines. Today R S V is regarded as "the most important viral agent of serious respiratory tract disease in the pediatric population worldwide" [44]. Up to 90% of bronchiolitis cases and about 50% of pneumonia during infancy occurs as a result of R S V infection [45]. Almost all children are infected with RSV during the first two years of life; 2.5% are hospitalized, and 0.1% die [45]. More than 45 years of research has brought neither a good treatment nor any vaccine [46].  2.2. C L A S S I F I C A T I O N O F R S V R S V is categorized in the genus Pneumovirus within the family Paramyxoviridae. Viruses in the Paramyxoviridae family have a single-stranded, negative-polarity R N A genome. The genome is located in a helical nucleocapsid that is RNAse-resistant and also contains the viral polymerase. The genome is transcribed in a stop-restart mode, in which the polymerase produces subgenomic messenger RNAs (mRNAs). The viral replicative cycle takes place in the cytoplasm of the host. The virus is enveloped by the plasma membrane of the infected cell and enters the host cell by fusion to the surface [44].  2.3 R S V S T R U C T U R E The RSV virion is about 150-300 nm in diameter and consists of a nucleocapsid within a lipid envelope [44]. The genome is a single-stranded, non-segmented R N A with approximately 15,200 nucleotides that encode 11 proteins, three of which (G, F, and SH) are transmembrane surface glycoproteins [46]. The diameter of these surface glycoproteins is 11-20 nm and they are spaced at intervals of 6-10 nm in the envelope. [44]. The G (Glycoprotein) protein is involved in the viral attachment to the host cell surface and the F (Fusion) protein is required for fusion of the viral envelope or infected cell membranes with the uninfected cell membranes [46]. The two 8  major antigenic groups of R S V (A and B) are mainly classified according to their G protein variations, but the F protein is highly conserved between the strains [24]. The function of S H (small hydrophobic) protein is not known and its presence is not essential for maintaining viral viability [46]. The nucleocapsid consists of N (nucleocapsid), P (phosphoprotein) M2-1 proteins and L proteins [46]. L protein is the R N A polymerase and the other nucleocapsid proteins are also involved in transcriptional activity [46]. The M2-2 protein, which is low in infected cells but increases during infection, is involved in regulation of transcription [44]. However, the M2-2 protein is not essential for growth and replication of the virus. The M (matrix) protein organizes assembly of envelope proteins and nucleocapsid proteins and is vital for viral viability [44]. R S V has also nonstructural proteins (NS1 and NS2), which enhance virus growth but they are not essential proteins for viability [44]. Nonstructural proteins may be antagonists for interferon-a and p [44,46].  2.4 RSV REPLICATIVE C Y C L E The RSV can survive on inanimate objects for hours and transmission can occur through self-inoculation of secretions from hands [47]. In addition, large-particle aerosols are able to transmit the virus to the nasal mucosa or conjunctivae [47]. Cell surface attachment is the first step in the viral infection process, which occurs via the G protein. The cellular receptor(s) for G protein has not been identified. Once attached, the fusion of viral envelope to the host cell membrane occurs and then the nucleocapsid is released into the cytoplasm. In the cytoplasm, mRNA transcription and genomic R N A replication take place. Viral proteins and genome are then assembled and the mature virions either leave the cell by budding or produce RSV cell-to-cell fusion and syncytia formation [46].  2.5 HOST RESPONSE TO RSV INFECTION It is not well understood why RSV infection is more severe in some infants. One reason could be the genetic variations and indeed recently an association has been found for the R S V bronchiolitis and an IL-8 genetic polymorphism [48]. The host immune response has a key role in producing the lower respiratory tract disease caused by R S V infection [49]. The importance of the host response to R S V infection was discovered after the disastrous formalin-killed R S V vaccine trial, in which subsequent natural infection caused more severe disease [25].  9  2.5.1 Innate Immunity to RSV Epithelial cells and alveolar macrophages mediate the innate immune response to RSV. For example, epithelial cells produce opsonins and collectins. Surfactant A , one of the collectins produced by epithelial cells, enhances the opsonisation of R S V by monocytes and macrophages and thereby is involved in RSV clearance [50]. R S V infection also induces epithelial cells to secrete cytokines such as IL-1 a [51], Tumor necrosis factor-alpha (TNF-a) [51], IL-8 [52], and RANTES (regulation upon activation normal T cell-expressed and secreted) [53]. IL-1 a upregulates the expression of intracellular adhesion molecule (ICAM)-l [51] in RSV-infected cells, and thereby may be involved in neutrophil and eosinophil trafficking in the airways after R S V infection. T N F - a is a potent chemotactic factor and a neutrophil activator and IL-8 is the most important factor for neutrophil chemotaxis [54]. In addition, R A N T E S is an effective chemoattractant  for T cells and  eosinophils [54]. Taken together, these mediators are chemotactic for neoutrophils, T helper cells and eosinophils and may take part in the pathogenesis of RSV-induced wheezing. Alveolar macrophages also release inflammatory cytokines such as TNF-a, IL-8, and IL6 (a lymphocyte activator) when infected with R S V [55]. It has been reported that the innate immune response to the viral F protein is mediated by Toll-like receptor (TLR) 4 and CD 14 receptor on monocytes [56].  2.5.2 Humoral Immunity to RSV A l l full-term newborns have maternal RSV-neutralizing antibodies in their sera [57,58]. Although mainly transferred transplacentally, antibodies can be delivered to the newborn by breast-feeding. [59]. The titer of maternal antibodies declines during the first few months after birth and if neutralizing antibodies are detectable after 7 months of age, they are produced by infection [57]. Observations that prophylaxis with RSV-specific IgG reduces hospitalization from subsequent R S V infection [60] and breastfeeding reduces the likelihood of severe bronchiolitis [61] provide evidence that antibodies have neutralizing effects against RSV. In contrast, more severe disease and wheezing after R S V infection are associated with higher levels ofRSV-specific IgE [62].  10  2.5.3 Cellular Immunity to R S V Some observations suggest that cell-mediated immune responses start within 10 days of RSV infection [63,64]. Individuals who have cellular immunodeficiency have longer courses of RSV-induced disease, indicating a critical role for cell-mediated responses [65,66]. Both protective and disease-enhancing roles have been observed for C D 8 and C D 4 T lymphocytes in +  +  RSV-infected mice, including reduction in viral shedding but with increased pulmonary damage [67]. As mentioned in Chapter 1.4, C D 4 T cells are classified into two functionally distinct +  Thl and Th2 subsets. Viruses are intracellular pathogens and T h l responses are involved in cellmediated responses against intracellular pathogens, therefore in general it is believed that a normal host response to viruses is mediated by T h l cells. Live RSV infection in mice stimulated a T h l response, whereas immunization with formalin-inactivated virus resulted in a Th2 (allergyassociated) response [68]. It is suggested that formalin-inactivated vaccine stimulated a Th2-type response and thereby resulted in the more severe disease following subsequent R S V infection in humans [69]. Studies on presence and relevance of Thl versus Th2 responses to R S V infection of humans have reported contradictory results [70,71,72].  2.6 R S V P A T H O L O G Y Since lung specimens are not obtained very often from very young children, there is little known about R S V pathology in mild human cases. However, in severe cases of R S V bronchiolitis some histological changes have been observed in bronchioles including destruction of epithelial cells, peribronchiolar inflammation, edema of submucosal and adventitial tissues, and profuse mucus production. Bronchiolar obstruction leads to either collapse of the airways or air trapping. In the pneumonia cases, alveoli are involved and alveolar walls are infiltrated with mononuclear cells [44].  2.7. R S V A N D A S T H M A There is considerable evidence that R S V bronchiolitis might play a key role in development of recurrent wheezing and asthma [18-21]. Although the pathogenesis of postbronchiolitis asthma is not well understood, several hypotheses are proposed to explain the mechanism behind this development including:  11  1. A 'hit and run driver' mechanism for the virus, in which despite viral clearance from the lungs, a chronic sequela remains. Evidence for this mechanism is provided by a rat model of parainfluenza type I (Sendai) virus lung infection, in which bronchial hyperresponsiveness and mast cell hyperplasia last for at least three months, without evidence of concomitant viral persistence [73]. 2. Enhancement of allergen sensitization by the viral infections. Increased airway responsiveness and lung inflammation after allergen sensitization in RSV-infected mice [74] and also increased levels OA-specific IgGi antibody in RSV-infected, OA-sensitized guinea pigs [75] provide supporting evidence for this mechanism. 3. Persistence of viral infection. This potential mechanism is supported by a study on guinea pigs that reported association of chronic intrapulmonary R S V persistence with bronchial hyperresponsiveness and airway inflammation [76]. In contrast to those who consider a causal link between viral infection and asthma, some investigators regard a protective role for viruses against development of allergy and asthma [77,78,79]. Proponents of this concept point to the Thl-type response after a viral exposure in early life [77]. Their hypothesis is further supported by studies that show a lower possibility of asthma development at 6 to 13 years of age in children who receive more exposures to viruses during infancy, in daycare settings or from their older siblings [80]. Indeed, the rise in asthma and allergy in western countries could be explained by the "hygiene hypothesis". According to this theory, higher levels of hygienic conditions and thereby less pathogen exposure in infants is associated with an increased risk of asthma development in children. This hypothesis can be explained by considering a T h l response after viral infections that brings protection to asthma and allergy [81]. However, as mentioned in Section 2.5.3, it is controversial whether R S V stimulates a predominant Thl or Th2 response in humans, such that the applicability of hygiene hypothesis in the context of acute bronchiolitis and asthma remains unclear.  2.8 S U M M A R Y  R S V is the most common cause of acute bronchiolitis in infants. There is considerable evidence suggesting causal link between respiratory viral infections, especially R S V infections, and allergy and asthma, but the mechanism behind this link is poorly understood. On the other hand, some investigators consider a protective role for respiratory viral infections against allergy and asthma, but whether the host response to R S V bronchiolitis is predominantly T h l or Th2 12  mediated is controversial. In our opinion, some of this controversy could be explained by considering the doses of infectious virus to which the infant was first exposed. This postulation provided a basis for one of the interventions we applied for primary prevention of postbronchiolitis allergic sensitization in this thesis.  13  CHAPTER 3: ANIMAL MODEL FOR POST-BRONCHIOLITIS ASTHMA  3.1. A N I M A L MODELS FOR RSV BRONCHIOLITIS The tragic trial of formalin-inactivated (FI) RSV vaccine, in which vaccinees developed more severe disease after subsequent natural RSV infection, was a stimulus for finding a relevant small animal model for R S V infection [82]. So far many different animal models have been proposed and in this chapter some advantages and limitations of these models are reviewed. Not only is the genetic relatedness of chimpanzees to humans more than any other laboratory animal, chimpanzees also become i l l after being infected with human R S V [42]. However, chimpanzees are not readily available and their purchase and maintenance is expensive. In addition terminal experiments on chimpanzees are not allowed [82]. Monkeys are genetically closer to human than many other species and terminal experiments on them are not forbidden. Moreover, some strains of monkeys show signs of rhinorrhea after human RSV infection. However, expense, lack of inbreeding, and inadequately available species-specific immunologic reagents are limitations for using these animals in R S V research [82]. The calf is another example of a large animal model for R S V infection and calves can become infected with bovine RSV, a pathogen that is related to the human virus. The disease caused by bovine RSV in calves is similar to the one caused by human RSV in humans in many ways. For example, it is limited to respiratory tract, results in an epidemic disease with a peak during winter months, induces an incomplete immunity, and high levels of maternal antibody attenuate the disease. Moreover, the severity of disease is highest among neonates. However, expense, lack of inbred animals, and inadequately available species-specific reagents are limitations for using calves as an animal model. In addition, human and bovine RSVs are different in terms of amino acid homology, propagation in vitro and titering, which adds to the disadvantages for modeling human R S V infection [82]. Research on small animal models has the benefits of easy handling and low cost of purchase and maintenance. Several small animals have been used as models for R S V infection including cotton rats, mice, guinea pigs, ferrets, and hamsters. The mouse and the cotton rat have the problem of not developing acute lower respiratory tract disease or an impressive bronchiolar inflammation [83,84]. For example, more than 10 plaque-forming units (pfu) of RSV is required for producing bronchial inflammation in mice 14  [83], while intranasal inoculation of only 500 pfu is sufficient to develop infection in 100% of human volunteers [85]. In contrast to humans who are susceptible to R S V bronchiolitis during their infancy, cotton rats of all ages [84] and mice only after maturity [83] develop pulmonary infection. The advantage of using cotton rats over mice is their 100-fold greater permissiveness to RSV with 10-fold higher titers of serum antibody [83,86]. Moreover, like humans, the cotton rat develops vaccine-enhanced disease [82]. However, lack of species-specific reagents and the absence of congenic, transgenic and knock out strains are limitations of using cotton rats over mice [82]. Virus permissiveness in guinea pigs is more than cotton rats and mice (10 -10 pfu in 3  4  guinea-pigs compared to >10 pfu in mice) with evidence of virus replicating in the lungs [87]. 7  Moreover, not only have RSV genome and/or protein have been detected in the guinea pig lung for at least 100 days [76,88,89] after experimental inoculation but also the replicating virus was isolated from guinea pig lungs 60 days after inoculation [90], providing evidence for persistence of intact, infectious virus in vivo. Limitations for using this model are shortage of inbred strains as well as lack of species-specific reagents [82,91]. Although both guinea pigs [92] and ferrets [82] possess the advantage of developing pulmonary infection only before maturity and thereby modeling the more susceptibility of infants than adults to R S V lung infection, the knowledge on ferret models is not as vast as guinea pigs, hence using ferrets do not offer any advantage over guinea pigs. In Syrian hamsters R S V replicates in both nose and lungs, but the permissiveness is similar to mouse [82]. Overall, the knowledge about R S V infection in hamsters is not enough to encourage using them over other proposed models.  3.2. G U I N E A P I G A S A M O D E L F O R A S T H M A  The Cam-Hartley guinea pig has been used as a model of allergic sensitization and challenge to aerosolized O A [93]. The allergic response in this animal model has been associated with non-specific bronchial hyperresponsiveness to acetylcholine challenge, airway eosinophil infiltrates and OA-specific IgGi production (the main class of antibody involved in allergic responses of guinea pigs [94]) [75]. In addition, inoculation of juvenile Cam-Hartley guinea pigs with human R S V results in long-term persistence of the virus, airway hyperresponsiveness to acetylcholine challenge, airway eosinophil infiltrates and RSV-specific IgGi production [76,90]. RSV infection in guinea pigs has also been shown to enhance OA-specific IgGi production [75], 15  similar to the results reported in mice, in which R S V infection intensified antigen-specific IgE production [95,96]. Moreover, R S V infection results in bronchial hyperresponsiveness, allergic airway inflammation and skewing of the lung Thl/Th2 cytokine ratios toward Th2 responses in strain 2 and strain 13 guinea pigs, which are inbred for delayed hypersensitivity and allergic reactions, respectively [97].  3.3. O T H E R A D V A N T A G E S O F U S I N G G U I N E A PIGS Lung tissue in guinea pigs is abundant in comparison to other small animal species and allows the investigator to use the lungs of the same animal for different purposes such as molecular biology, histology and tissue culture work [91,97]. Having three major lobes on the right side and two major lobes on the left side, the gross anatomy of guinea pig lung is roughly similar to the human lung [91]. Moreover, the well-defined terminal bronchioles with subtending alveolar ducts in guinea pigs provide another advantage for them to model human lung diseases [91].  3.4 L I M I T A T I O N S O F USING G U I N E A P I G IN M O L E C U L A R B I O L O G Y Tissue handling for mRNA measurement purposes in guinea pigs requires extensive precautions because these animals have very high levels of endogenous ribonuclease. In addition, guinea pig gene and protein sequences are less characterized than those of mouse and rat. However, the number of these sequences is growing rapidly for guinea pigs and there is also evidence of cross-reaction of some human reagents with guinea pig specimens [91].  3.5 S U M M A R Y In summary, no perfect animal model is available for R S V infection. Being used as models for both bronchiolitis and allergic sensitization, guinea pigs offer benefits of relatively higher RSV permissiveness for developing experimental acute bronchiolitis. In addition, guinea pigs produce IgGi antibodies in response to R S V and O A and this capability is relevant to modeling post-bronchiolitis wheezing and asthma in this species. More general issues such as easy handling, relatively low purchase and maintenance cost, similarity of guinea pig lung to human lung, and availability of abundant lung tissue from a single animal are added benefits of using guinea pigs to model human R S V lung infection. 16  C H A P T E R 4: W O R K I N G HYPOTHESIS, SPECIFIC AIMS A N D STRATEGY  The working hypothesis of this thesis was based primarily on the general hypothesis that interventions designed to optimize Thl/Th2 balance away from Th2 (allergic) responses will inhibit RSV-enhanced allergic sensitization to aeroallergen.  4.1 G O A L The goal was to determine whether "low dose" R S V infection (a RSV-specific intervention)  or CpG-ODN  administration  (a  general intervention)  would inhibit  the  development of RSV-enhanced allergic sensitization of guinea pigs to aerosolized O A , and inhibit allergic airway inflammation and production of OA-specific IgGi antibodies.  4.2 W O R K I N G H Y P O T H E S I S Maintaining Thl/Th2 balance away from Th2 responses by low dose R S V infection or CpG-ODN administration of guinea pigs, prior to exposure to OA-containing aerosols, will decrease the high dose RSV-enhanced OA-specific IgGl antibody production and decrease allergic airway inflammation.  4.3 S P E C I F I C A I M S 1. To determine the effects of low dose R S V infection or CpG-ODN administration on production of RSV-enhanced OA-specific IgGi antibodies after subsequent exposure to high dose RSV plus OA-containing aerosols; 2. To determine the effects of low dose R S V infection or CpG-ODN administration on subsequent high dose RSV plus OA-induced allergic airway inflammation; 3. To determine the effects of low dose R S V infection or CpG-ODN administration on lung IFNy/IL-5 ratios from subsequent high dose RSV plus OA-exposures.  17  4.4 S T R A T E G Y 4.4.1 Low Dose R S V The amount of low dose R S V for use as an intervention has been determined in a previous work in our lab [98]. Briefly, 18 juvenile Cam Hartley guinea pigs were divided into three groups (n=6/group) as follows: "High dose" R S V infection (1.3 x 10 pfu) 4  "Low dose" R S V infection (1.3 x 10 pfu) 2  "Sham inoculated", uninfected controls Lung homogenates from three animals of each group were prepared for R S V genome detection by RT-PCR, and cytokine measurement by semi-quantitative RT-PCR during acute bronchiolitis (one week post-inoculation). After three weeks of inoculation sera from remaining animals underwent ELISA for RSV-specific IgGi measurement. Table 4.1 summarizes the results of this experiment, in which animals that received "low dose" R S V had evidence of intrapulmonary virus, without skewing of lung Thl/Th2 toward Th2, and without production of detectable levels of RSV-specific IgGi. High dose R S V infection also resulted in evidence of intrapulmonary virus, but showed skewing of Thl/Th2 balance toward Th2, and production of detectable RSV-specific IgGi. The result of this study indicated that ~10 pfu of R S V is 2  acceptable for use as a "low dose" viral exposure.  4.4.2 C p G - O D N Dose and Route of Administration The optimal dose and route of CpG-ODN administration was not known in guinea pigs. A preliminary experiment reported in the next chapter was designed to examine the effects of different CpG-ODN dosing regimen on lung Thl/Th2 balance in guinea pigs.  4.4.3 OA-Specific IgGi Titers OA-specific IgGi was measured according to the ELISA method described by Dakhama et al. [75].  4.4.4 Allergic Airway Inflammation Infiltrates in small airways of asthmatics are rich in eosinophils and T cells [11,99]. The percentage of eosinophils and T cells in small airways of guinea pigs were measured as indices  18  of airway inflammation by using Image Pro PLUS image analysis system (Media Cybernetic, inc; Silver Spring, M D , USA).  4.4.5 Lung IFNy/IL-5 Ratios Lung specimens were homogenized and the ratios of IFN y/IL-5 messenger R N A were measured with a semi-quantitative RT-PCR method developed in this thesis.  4.5 S U M M A R Y A Cam Hartley guinea pig model was used to test the working hypothesis that manifestations of high dose RSV-enhanced O A sensitization such as OA-specific IgGi antibody production and airway inflammation would be decreased by maintaining Thl/Th2 balance away from Th2 responses. "Low dose" R S V inoculation and CpG-ODN administration were the interventions that we used for producing a Thl/Th2 balance away from the Th2 responses. A quantitative histology method and ELISA were used for assessment of the airway inflammation and OA-specific IgGi antibody measurement, respectively. Levels of gene expression of selected Thl and Th2 cytokines were measured in lung homogenates using a semi-quantitative RT-PCR method.  19  Table.4.1. Results of low dose R S V infection on IFNy/IL-5 ratio and RSV-specific IgGi [98] RSV RT-PCR (+)  IFNy/IL-5 (Dav 7)  RSV-sDecific IgGi  (Da 7)  (mean ± SD)  titer (Dav 21)  (n=3/group)  (n=3/group)  (n=3/group)  Uninfected controls  0/3  1.20 ±0.12  <1:5;<1:5; 1:5  Low dose R S V  3/3  1.14 ± 0.14  <1:5;<1:5; 1:5  3/3  0.65 ± 0 . 1 1 *  1:500; 1:500;  Group  Y  (1.3 x l O pfu) 2  High dose R S V  1:250**  (1.3xl0 pfu) 4  *  p< 0.04 compared to uninfected controls and low dose RSV groups  ** p< 0.001 compared to uninfected controls and low dose RSV groups  20  C H A P T E R 5: P R E L I M I N A R Y  STUDIES  In order to test the working hypothesis mentioned in Chapter 4, we first did some preliminary studies to determine the optimal dose and route of CpG-ODN administration to guinea pigs and establish a semi-quantitative RT-PCR method for selected T h l and Th2 cytokines.  5.1 C p G - O D N D O S I N G S T U D Y O F G U I N E A PIGS T O D E T E R M I N E H O W D O S E A N D R O U T E O F A D M I N I S T R A T I O N A F F E C T S P U L M O N A R Y TH1/TH2 B A L A N C E  1  This preliminary experiment was done to determine the optimal dose and route of CpGO D N (CpG-ODN 2007; Coley Pharmaceutical Group, Inc., Wellesley, M A ) administration in guinea  pigs.  The  CpG-ODN  contained  22  nucleotides  with  three  CpG  motifs  (TCGTCGTTGTCGTTTTGTCGTT). The doses and routes of CpG-ODN administration as well as the duration of immunotherapy were recommended by Dr. Heather Davis, Science Officer for Infectious Disease, Coley Pharmaceutical Group, Inc.  5.1.1 Experimental Design Five groups of female juvenile (n=4/group), 1-month old Cam Hartley guinea pigs were studied as follows: Group 1: No CpG-ODN Group 2: 30 p:g CpG-ODN (biweekly x 4 weeks), subcutaneous Group 3: 100 (ig CpG-ODN (biweekly x 4 weeks), subcutaneous Group 4: 30 |ig CpG-ODN (biweekly x 4 weeks), intranasal Group 5: 100 p.g CpG-ODN (biweekly x 4 weeks), intranasal  5.1.2 Specimens Animals were killed 1-week after last CpG-ODN dose by intraperitoneal injection of an overdose of barbiturate (Euthanyl Forte, 1:1 diluted in saline; M T C Pharmaceuticals, Cambridge, ON). Lungs were harvested and flash frozen and kept in -70°C for subsequent mechanical Work described in section 5.1 has been published: Tayyari F, Ashfaq MK, Manson HE, Hegele RG. Comparison of dose and route of administration of CpG oligonucleotides (CpG ODN) on pulmonary Thl/Th2 cytokine balance in guinea pigs. Am J Respir Crit Care Med 2003,167: A724 (Abstract). 1  21  homogenization by Tissue-Tearor® (BIOSPEC Products, Inc; Racine, Wl) and extraction of total R N A by use of RNeasy Midi-Kits (Qiagen, Corp; Hilden, Germany). During R N A extraction oncolumn DNase digestion (Qiagen, Corp) was applied to remove any contaminating D N A . Levels of guinea pig IFNy (Thl cytokine), IL-5 (Th2 cytokine) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, housekeeping gene) were measured using semi-quantitative RT-PCR method, which is further described in the next section.  5.1.3 Data Analysis  After normalization of IFNy and IL-5 optical density (OD) to corresponding G A P D H OD, the ratio of IFNy/IL-5 was calculated for each animal. The normalized cytokine values and ratios underwent logarithmic transformation, which better approximated a normal distribution for the data. One-way analysis of variance (ANOVA) was used to compare mean levels of IFNy/GAPDH, IL-5/GAPDH, and IFNy/IL-5 among the 5 groups of animals (SPSS v . l l , Statistical Product and Services Solutions; Chicago IL) and a post hoc two-tailed t-test was used to examine the differences between pairs of groups. P value < 0.05 was set as level of statistical significance.  5.1.4 Results  A l l animals tolerated CpG-ODN administration very well and no animal death or side effect was observed from the CpG-ODN treatment. Since the value of lung IFNy in one animal from Group 1 was equal to zero and could not be logarithmically transformed, the animal was excluded from data analysis. As illustrated in Figure 5.1, animals in Group 1 (no CpG-ODN treatment) had significantly lower IFNy gene expression than animals given CpG-ODN (p < 0.05). Figure 5.2 shows that there was a trend toward higher IL-5 gene expression in the guinea pig lung after CpG-ODN treatment except for Group 5 (high dose, intranasal route). Group 5 had significantly lower levels of IL-5 gene expression than other CpG-ODN-treated groups. Figure 5.3 illustrates the IFNy/IL-5 ratios in groups of animals. A l l CpG-ODN groups showed significant Thl shift in pulmonary Thl/Th2 balance in comparison to untreated controls. The extent of Thl shift was influenced by dose and route of administration of CpG-ODN, in that Group 5 (high dose, intranasal route) had significantly greater T h l shift in Thl/Th2 balance than Group 2 (low dose, subcutaneous route).  22  5.1.5 Summary  As the goal of CpG-ODN treatment of guinea pigs is to maximize increase in Th 1 and minimize any possible increase in Th2 in the lungs, in this thesis, we used the protocol of 100 |ig CpG-ODN, delivered intranasal, biweekly over 4 weeks as the intervention.  5.2 C Y T O K I N E G E N E E X P R E S S I O N M E A S U R E M E N T  This preliminary study was done for establishing a sensitive method for measurement of cytokine gene expression in guinea pig lung specimens. The methods used for R N A extraction and reverse transcription are described in the next chapter. In this section, we describe how the primers were designed, how the sensitivity of our method was measured, and how we provided evidence that our PCR products were true amplicons of the relevant cytokines.  5.2.1. Primer Designing for P C R  Using http://www.ncbi.nlm.nih.gov web site guinea pig sequences for IL-5 and Pactin and IFNy messenger R N A (or complementary D N A ) were obtained and aligned with human genomic D N A for determining different exons. In the case of IFNy the sequence was also aligned with mouse and rat genomic D N A . Primers for guinea pig Pactin, IL-5, and IFNy were designed  using  Primer3  software  available  at  http://www-genome.wi.rnit.edu/cgi-  bin/prirner/prirner3 ww.cgi. The primers were selected from different exons. Table 5.1 shows the sequence of selected primers. At the time of our preliminary experiments the sequences for guinea pig G A P D H or Pactin were not available and therefore we were using mouse and rat primer sequences for G A P D H . However, before starting our major experiment the guinea pig Pactin sequence became available and we switched to it as our housekeeping gene.  5.2.2 Polymerase Chain Reaction (PCR) Optimization  Details of our PCR method are provided in Chapter 6. The concentration of primers and Mg  2 +  were determined according to finding a single band without smears on PCR product gel  images. The cycles of amplification were optimized such that the numbers of amplicons were in the exponential phase (Figures 5.4 to 5.6).  23  5.2.3 P C R Sensitivity Measurement  After gel electrophoresis (described in Chapter 6), the PCR products were purified from the gel using QIAquick Gel Extraction Kit (Qiagen, Corp). According to the manufacturer's instruction, the band was cut from the gel with a clean scalpel and put in a tube. After weighing, Buffer QG was added to the tube (3 p:L of the Buffer for each jig of gel). The gel was dissolved by a 10 min-incubation at 50°C and isopropanol (1 U.L for each pig of gel) was added to the mixture. The mixture underwent centrifugation on QIAquick column for 1 min and the column underwent washing with 0.5 mL of Buffer QG and centrifugation for 1 min. The next step was washing with 0.75 mL of Buffer PE and centrifugation for another 1 min. After an extra 1 min centrifugation the column was placed in a new tube and eluted in 50 | i L of Buffer E B (10 m M Tris.Cl, pH 8.5). The optical density (OD) of the elution was measured and then the concentration of D N A was calculated by Equation 2 (Appendix). The copy equivalents were measured by means of Equation 3 (Appendix) and known amounts of copy equivalents underwent PCR and gel electrophoresis for sensitivity determination. Distilled water was used instead of copy equivalents as negative control. The sensitivity of the method was measured according to detectable bands such that detecting 10 copy equivalents would provide an acceptable sensitivity. Since 1-10 copy equivalents of our cytokines or housekeeping gene were detectable (Fig. 5.7), we considered the methods sensitive enough for our major experiments.  5.2.4 Sequencing the P C R Products  PCR products were extracted from gels (as described in Section 5.2.3) and the purified products were sent to NAPS Unit D N A Sequencing (NAPS; University of British Columbia, Vancouver, Canada). The results of sequencing are shown in table 5.2. " B L A S T 2 sequences" program located in the http://www.ncbi.nlm.nih.gov/blast/bl2eq/bl2.html website was used to test the alignment of the reported sequences with the relevant guinea pig nucleotide sequences. The result of this alignment showed that our PCR products were 99-100% matched with the relevant cytokines.  5.2.5 Summary  In summary, we designed primers for measuring selected Thl and Th2 cytokines and pactin by semi-quantitative PCR methods. Our methods were sensitive enough to detect 1-10  24  copy equivalents of selected T h l and Th2 cytokines and (3actin and PCR product sequencing confirmed our amplicons being true copies of relevant cytokines.  25  2  T  1.  1  Fig.5.1  2  3  GROUP  4  5  Natural logarithm of IFNy/IL-5 ratios in different groups of our preliminary experiment.  Groupl: No CpG-ODN, Group 2: 30 pig CpG-ODN (biweekly x 4 weeks), subcutaneous, Group 3: 100 pg CpG-ODN (biweekly x 4 weeks), subcutaneous, Group 4: 30 pig CpG-ODN (biweekly x 4 weeks), intranasal, Group 5: 100 pig CpG-ODN (biweekly x 4 weeks), intranasal. Note the significantly increased level of IFNy/GAPDH in CpG-ODN treated groups. The p values were as follows:  G r o u p 1 v e r s u s G r o u p 2:  versus G r o u p  4:p<  p<  0.04;  G r o u p 1 versus G r o u p 3:  0.02; G r o u p 1 v e r s u s G r o u p 5:  0.05. (Group 1: n=3; Groups 2-5: n=4)  26  p<  0.03; G r o u p 1  p < 0.03; all other group comparisons: p >  2.0  1.5  H  CL <  O  .5.  LO i  _J  z  o.o-  _J  -.5-  -1.0.  1  2  3  4  5  GROUP  Fig.5.2 Natural logarithm of lung IL-5/GAPDH ratios in different groups of our preliminary experiment. Group 1: No CpG-ODN, Group 2: 30 fig CpG-ODN (biweekly x 4 weeks), subcutaneous, Group 3: 100 |lg CpG-ODN (biweekly x 4 weeks), subcutaneous, Group 4: 30 u.g CpG-ODN (biweekly x 4 weeks), intranasal, Group 5: 100 |Xg CpG-ODN (biweekly x 4 weeks), intranasal. Note the trend toward higher IL-5 gene expression in the CpG-ODN pre-treated animals except for the Group 5. Group 5 had significantly lower levels of IL-5 gene expression than other CpG-ODN pre-treated groups. The p values were as follows: Group 2 versus Group 5: p < 0.001; Group 3 versus Group 5: p < 0.001; Group 4 versus Group 5: p < 0.02; A l l  other group comparisons: p > 0.05. (Group 1: n=3; Groups 2-5: n=4)  27  1  Z  Ll_  -3-  1  2  3  4  5  GROUP  Fig.5.3 Natural logarithm of lung IFNy/IL-5 ratios in different groups of our preliminary experiment. Group 1: No CpG-ODN, Group 2: 30 |ig CpG-ODN (biweekly x 4 weeks), subcutaneous, Group 3: 100 |ig CpG-ODN (biweekly x 4weeks), subcutaneous, Group 4: 30 jig CpG-ODN (biweekly x 4 weeks), intranasal, Group 5: 100 |ig CpG-ODN (biweekly x 4 weeks), intranasal. Note the significantly higher IFNy/IL-5 ratio in the CpG-ODN pre-treated animals. Moreover, the ratio of IFNy/IL-5 in Group 5 was significantly higher than Group 2. The p values are as follows: Group 1 versus Group 2: p < 0.03; Group 1 versus Group 3: p < 0.02; Group 1 versus Group 4: p< 0.02; Group 1 versus Group 5: p< 0.01; Group 2 versus Group 5: p<  0.002; A l l other group comparisons: p > 0.05. (Group 1: n=3; Groups 2-5: n=4)  28  Table 5.1 Primer sequences for RT-PCR  Target Gene  Primer Sequences  Product Size (base pair)  pactin  Antisense 5' G G G G T G T T G A A A G T C T C G A A 3'  157  Sense 5' A C T G G G A C G A C A T G G A G A A G 3' IFNy  Antisense 5' A G G A G A C G A T T T G G C T C T G A 3'  298  Sense 5 ' G A A G T T C T T T G G A C C T G A T C G 3' IL-5  Antisense 5' C C A G A G C T T C C C C T T G T G T A 3' Sense 5' T G T C T G T G T C T G T G C C A T C C 3'  29  215  • sm  600 bp-  1  2  3  4  5  6  7  40  35  30  25  20  Cycles: 45  Lxmjwrmr  157 bp-  pactin Fig.5.4 Cycles of amplification for Pactin. The cDNA used in PCR reaction was 1:10 diluted. 30 cycles of amplification was chosen to obtain the amplicons in exponential phase. Lane 1 is an empty lane. PCR products loaded in lanes 2-7 were produced from the same amount of reagents and cDNA. Negative controls (distilled water instead of cDNA) were loaded in different gels (not shown), (sm = size markers)  30  sm  1  2  4  3  5  600 bp-  Cycles: 45  40  35  30  25  298 bp-  IFN7  Fig.5.5 Cycles of amplification for IFNy. 40 cycles of amplification was chosen for obtaining the amplicons in exponential phase. PCR products loaded in lanes 1-5 were produced from the same amount of reagents and cDNA. Negative controls (distilled water instead of cDNA) were loaded in different gels (not shown), (sm = size marker)  31  IL-5 Fig.5.6 Cycles of amplification for IL-5. 40 cycles of amplification was chosen for obtaining the amplicons in exponential phase. The lane between sm (size marker) and 45 cycles is empty. Negative controls (distilled water instead of cDNA) were loaded in different gels (not shown).  32  IO  5  1()  4  IO  IO  3  IO  2  i  uf  10  s  io  io  4  mHtlP vMiKi^  io  3  lo  2  10°  1  0  pActin  1  io°  o  'iwwy  1FN7  IO  7  10  6  IO  5  IO IO IO 4  3  2  ]()'  10°  0  IL-5 Fig 5.7 Sensitivity of PCR methods (copy equivalents used are shown above the bands). One to ten copy equivalents provided detectable bands after PCR and gel electrophoresis.  33  Table 5.2 Sequences of our PCR Products Reported by NAPS. Cytokine or Housekeeping gene IL-5  IFNy  pactin  Primer used  Sequence reported by N A P S  Sense  GCAGCAGAGTGCACTCTGAGGGCGCTGGNAANAGAGACCCTGACTCTGCTTT CTACTCATCGAACTCTGCTTAAAGGNAATGAGACTCTGAGGGATTTCTGTTCC TGCACATAAGAATCACCANCTATGCATTGAAGACANTCTTCCAAGGANTTGA CACANTGACNCAATCNNGCTACNNNAGGGGAAGCTCNGNANNNNN*  Antisense  GNTGTTCNTNGTGTNTNAATTCCTTGGAAGATTTCTTCNATGCATANGTTGGT CGATTTTTATGTGCTCGGAACAGANATCCTCAGAGTCTCATTGCCTTTGAGTC AGTAGTTCGATGAGTAGAAAGCATNAGTCATGGGATCTCTCTTACCAGNGCC CTCANAGTGGNACTCTGCTTGGNGATGGCACAGACACANACAANNNNNC*  Sense  ATATCAGAGCTACTGATTTCATCTTCTTTAGCCCAACTCTCTGAAACAATGAA GTATACAAGTTCCATCTTGGCTCTTCAGTTCTGTATCATTTTGAGTTTTTCTAG CTACTACTGCCAGTCAAGATTTACAAATGAAATACGCATTCTAAAGAACTACT TTAATGCAGATAACTCAGATGTAGGAGACAATGGGACGCTCTTTGTAGGCAT TTTGAAGAATTGCCAAGAGGAGAGTGAAAGAAAAATATTTCAGAGCCAAATC GTCTCCTACNCNNNNGNN*  Antisense  AANTTCTTCCTCTCCTCNTGNCAATTCTTCAAAATGCCTACAAAGAGCGTCCC ATTGTCTCCTACATCTGAGTTATCTGCATTAAAGTAGTTCTTTAGAATGCGTA TTTCATTTGTAAATCTTGACTGGCAGTAGTAGCTAGAAAAACTCAAAATGAT ACAGAACTGAAGAGCCAAGATGGAACTTGTATACTTCATTGTTTCAGAGAGT TGGGCTAAAGAAGATGAAATCAGTAGCTCTTGTATTAAGTCGATCAGGTCCA AAGAACTTCAANACATCTGAGTTATCTGCNTTAAAGTAGTTCTTTAGAATGCG TATTTCATTTGTAN *  Sense  ATGGACCACACCTTTTANATGAATTGCGTGTGGCCCCTGAGGAGCACCCTGTG CTGCTGACGGAGGCTCCCCTGAACCCCAAGGCCAACCGTGAGAAGATGACCC AGATCATGTTCGAGACTTTCAACACCCNAAN*  Antisense  CAGACTGGGTCATCTTCTCACGGTTGGCCTTGGGGTTCAGGGGAGCCTCCGTC AGCAGCACAGGGTGCTCCTCAGGGGCCACACGCAATTCATTGTAAAAGGTGT GGTGCCAGATCTTCTCCATGTCGTCCCAGTANNNNNNNNNNN*  *The letter " N " shows the unreadable nucleotides. These reported sequences were aligned with relevant cytokine and housekeeping gene complementary D N A sequences for guinea pigs and the results were 9 9 1 0 0 % match (not shown).  34  CHAPTER 6: MATERIALS AND METHODS In this chapter the experimental design and the material and methods used in our major experiment will be described.  6.1  EXPERIMENTAL DESIGN  Four groups (n=12/group) of female juvenile, 1-month old Cam Hartley guinea pigs were studied as following: Group 1: Uninfected, unsensitized controls Group 2: High dose RSV infected + O A Group 3: Low dose RSV inoculated + (High dose RSV infected + OA) Group 4: CpG-ODN pre-treated + (High dose R S V infected + OA) The terms "infected" and "inoculated" do not indicate different methods of R S V inoculation. A schematic diagram showing time course of treatments is illustrated in Figure 6.1. 6.2 A N I M A L S  Juvenile 1-month old, female Cam Hartley guinea pigs (body weight: 250-300g) were purchased from Charles River Laboratories (Montreal, QC) and housed under conditions of alternating 12-hour light-dark cycles, in plastic cages with hypoallergenic bedding, and with free access to food and water. Animals were acclimatized for five days before experimentation.  6.3 V I R U S P R E P A R A T I O N  The Long strain of subgroup A human R S V (American Type Culture Collection; Manassas V A ) was propagated on HEp-2 cell monolayers at 37°C in a humidified incubator containing 5% CO2. Cell culture medium consisted of RPMI 1640 (Gibco, Grand Island, N Y ) , supplemented with 5% fetal bovine serum (FBS) (Gibco), 1% L-glutamine (Gibco), and 1% Antibiotic-Antimyotic (Gibco). Working stocks of R S V for guinea pig inoculation were prepared by addition of autoclaved 3 mm diameter glass beads to infected HEp-2 cell monolayers and agitating with a vortex for 10 s. After agitation aliquots were prepared and kept in -70°C. One week before inoculation, an aliquot of frozen working stock was thawed and underwent plaque assay. On the designated day of inoculation another aliquot was thawed, centrifuged at 200 X g 35  for 5 min. The resulting supernatant was transferred to a sterile tube for inoculation into guinea pigs. Plaque assays were repeated on the day of inoculation to confirm the viral dose delivered to animals.  6.4 V I R U S I N O C U L A T I O N Animals were inoculated with virus preparations under light anesthesia induced by 3-5% halothane inhalation. Figure 6.2 shows the lung of a guinea pig 1 hour after inoculation with 150 | l L of 1:10 diluted India ink in each nostril. The same volume and way of administration was used for the virus preparations. Low dose exposures consisted of 1 X 10 pfu of RSV, based on 2  results of the preliminary experiment mentioned in Chapter 4.4. High dose viral exposures consisted of 4.5 x 10 pfu, an amount that reproducibly produces features of acute bronchiolitis 4  in guinea pigs. Controls received normal saline instead of low dose RSV.  6.5 C p G - O D N A D M I N I S T R A T I O N The dose and route of CpG-ODN administration used was according to the regimen of the preliminary study described in Chapter 5. After anesthesia with 3-5% halothane, animals received 300 u L (containing 100 fig) of CpG-ODN intranasally such that 150 u,L was inoculated to each nostril. The procedure was repeated biweekly for 4 weeks.  6.6 O A S E N S I T I Z A T I O N A N D C H A L L E N G E Guinea pigs were placed in polycarbonate chambers and sensitized with exposure to an aerosol of 1% O A (Sigma; St. Louis, MO) in sterile normal saline for 9 min. The aerosol was delivered by an ultrasonic nebulizer (DeVilbiss, Somerset, PA). Animals underwent sensitization 2h after inoculation with the high dose RSV. OA challenge started 7 d after the first exposure and consisted of 9 min exposure to 0.5% O A aerosols in saline and was repeated three times per week over 2 weeks. Twenty to thirty min before each challenge, animals received 40 mg.kg of body weight  _1  diphenhydramine hydrochloride (Sigma) i.p. to prevent anaphylactic death.  36  6.7 S E R U M C O L L E C T I O N At the designated time point guinea pigs were killed by intraperitoneal injection of an overdose of barbiturate (MTC Pharmaceuticals). Heart blood was sampled and kept in serum separation tubes (SST) (Becton Dickinson, Franklin Lakes, NJ) and after 30-60 min sitting on bench at room temperature underwent centrifugation at 1000 X g for 15 min. The protocol for serum separation was obtained from Quantikine HS handbook (R&D SYSTEMS, Minneapolis, MN). Aliquots of serum were kept in -70°C.  6.8 L U N G TISSUE P R O C E S S I N G Lungs were harvested after blood sampling. One randomly selected lobe was kept in R N Mater (Qiagen, Corp) for cytokine RT-PCR experiments and another lobe was inflated with OCT compound (Sakura Finetek, Torrance, CA), sliced and kept in formalin and embedded in paraffin. We used OCT for easier slicing of lung samples. OCT is a cryoprotective and normally is used for tissues that are going to be frozen.  6.9 M E A S U R M E N T O F O A - S P E C I F I C IgG, T I T E R S OA-specific IgGi was measured using ELISA method described by Dakhama et al. [75]. Each well of polypropylene 96-well microtitre plates (Corning; Corning, N Y ) was coated with 100 (iL of 10 jig mL" O A in carbonate/bicarbonate buffer (Sigma) and washed five times with 1  Tween-containing phosphate-buffered saline (PBS-T; lOmM PBS, pH=7.4; with 0.05% Tween20). Wells were blocked with 5% bovine serum (BSA; Sigma) in PBS-T, incubated for one hour at room temperature and washed five times with PBS-T. Guinea pig sera were 10-fold and then 2 fold serially diluted in PBS-T+1% B S A . From the serially diluted sera 100 (iL were added to each well and incubated for 2 h at room temperature. Samples were washed five times with PBST before adding 200 u L of diluted (in PBS-T+1% BSA) HRP-conjugated Goat anti-Guinea Pig IgGi-heavy chain specific (Bethyl, Montgomery, TX). Plates were incubated for 2h and washed with PBS-T before adding 100 p:L of O-phenylenediamine dihydrochloride (OPD) peroxidase substrate (Sigma) to each well. Half an hour after adding substrate the optical density (OD) was determined at a wavelength of 450 nm in an ELISA microtitre plate reader (Titertek, Multiskan Plus M K 2 ; Huntsville, A L ) . Titers were reported as the greatest serum dilution to produce an OD at least 0.1 OD units higher than control (sera obtained from unsensitized, uninfected, naive 37  animals) values. This cut off level was selected based on a lower limit of 1.5-2 times background values [75].  6.10 L U N G H I S T O L O G Y  Inflammation in membranous, muscular airways was evaluated by comparing the percentage of eosinophils and lymphocytes in animal groups [99].  6.10.1 Eosinophil and Lymphocyte Staining  Eosinophils and lymphocytes were stained on formalin-fixed paraffin-embedded lung sections mounted on glass slides by Hansel's method and CD3+ immunostaining, respectively. For Hansel's staining slides were flooded with Eosin solution for 60 s and buffer was added to slides for 5 min. After washing with distilled water, slides were counterstained in diluted Methylene blue and quickly washed in distilled water, dehydrated, cleared and mounted. For CD3+ immunostaining, after deparaffinization, slides underwent cell conditioning with E D T A based-buffer, conditioner #1 (CC1). The next step was adding 1:50 dilutions of anti-CD3 antibody ( D A K O 0452, Dakopatts; Glostrop, Denmark) and then blocking the antibody and counterstaining. After this one drop of hematoxylin was added and coverslip was applied and sample was incubated for 2 min. Following a post counterstain step one drop of bluing reagent was added and after applying a coverslip the sample was incubated for another 2 minutes.  6.10.2 Image Capture and Cell Counting  Slides were coded such that the microscopist did not know from which study group a given slide was obtained. Images from 5-10 randomly selected membranous bronchioles were captured using a digital camera (Nikon, Japan). The Image Pro PLUS image analysis system (Media Cybernetic, Inc.; Silver Spring M D , USA) was used to place a grid over the microscopic field and count the positively stained points in all compartments of the airways. The ratio of these positively stained points to non-stained ones in the airway walls were reported as percentages.  38  6.11 C Y T O K I N E M E S S E N G E R R N A E X P R E S S I O N 6.11.1 R N A Extraction From the lung samples kept in KNAlater (Qiagen, Corp) in -20°C, R N A was extracted using RNeasy Midi Kit (Qiagen, Corp) and according to manufacturer's instructions, as follows: 100-150g of KNAlater stabilized lung tissue was placed in a 50 mL tube containing 4 mL of lysate buffer and after homogenization with Tissue-Tearor® underwent centrifugation for 10 min at 3000 X g. The supernatant was carefully transferred to a 15 mL tube by pipette and 4 mL 70% ethanol was added. After shaking the tube vigorously, the sample was transferred to RNeasy Midi column. The sample underwent spinning for 5 min at 3000 X g and the flow-through was discarded. RNase Free DNase Set (Qiagen, Corp) was applied at this stage and the column was washed one more time with RW1 solution and two times with RPE buffers both included in the kit. The R N A was then eluted in 150 |J,L of RNase-free water.  6.11.2 Reverse Transcription The optical density of R N A at 260 nm was measured by  spectrophotometer  (Bodenseewerk Perkin-Elmer & Co.; Ueberlingen, Germany) and the R N A was quantified using Equation 1 (Appendix). Equal starting amounts of R N A (0.5 |!g) underwent reverse transcription using random hexamers and Moloney Murine Leukemia Virus Reverse Transcriptase ( M - M L V RT; Gibco) according to the manufacturer's instruction as following: 250 ng of random hexamers and 10 m M of dNTP mix were added to 0.5 p:g of R N A and distilled water was added to obtain a 12 \iL solution. The mixture was heated to 65°C for 5 min and quickly chilled on ice. After a brief centrifugation  4 u L of 5X First-Strand Buffer and 2 uX of 0.1 M D D T (both  prepared by the kit) and 1 | i L of Ribonuclease Inhibitor (Invitrogen, Corp; Grand Island, N Y ) , was added to the mixture. The contents were mixed gently and incubated at 25°C for 10 min and then 37°C for 2 min. The next step was adding 1 uX of M - M L V RT and gentle mixing by pipetting and then incubating at 37°C for 50 min. Finally, by heating the mixture at 70°C for 15 min the RT was inactivated. The obtained complementary D N A (cDNA) was then used as a template for amplification by PCR.  6.11.3: Polymerase Chain Reaction Since the target messenger R N A (mRNA) was expressed at low levels, a PCR-based method of nucleic acid amplification was used. Two | i L of complementary D N A (cDNA) (non39  diluted for IFNy or IL-5, or l:10-diluted in sterile distilled H 0 for Pactin PCR) from the reverse 2  transcription reaction was used in a 25 (iL P C R reaction mixture that consisted of I X P C R buffer, 2.5 m M M g , 200 | i M of each dNTP, 0.5 | i M each primer, 2.5 units per reaction HotStar 2 +  Taq D N A Polymerase (Qiagen, Corp). Table 6.1 shows the denaturing, annealing, and extension temperature, time and cycles for amplifying pactin, IL-5, and IFNy cDNA on a Robocycler 96 (Stratagene; La Jolla, CA).  6.11.4: Gel Electrophoresis, Digital Image Capture and Densitometry PCR products underwent electrophoresis on ethidium bromide-stained 2% agarose gels and were visualized under ultraviolet light. The intensity of bands was measured by densitometry using an Eagle Eye digital image capture and analysis system (Stratagene).  6.11.5: Normalization and Determining Copy Equivalents The density of the bands obtained from different gels had to be normalized with a standard. To prepare this standard, diluted purified P C R products underwent P C R in 50 | i L volumes, the maximum volume that our Robocycler 96 manufacturer recommended for each tube. Several 50 (iL P C R products were mixed to provide a sufficient starting amount of standard. Five p:L of this standard was run each time with samples to make normalization possible. Densities of the bands were normalized and the copy equivalents were obtained using standard curves drawn from known copy equivalents.  6.12: S T A T I S T I C A L A N A L Y S I S SPSS version 11.0 statistical software was applied for our statistical analysis. One-way A N O V A was used to compare the airway T cell and eosinophil percentages as well as mean reciprocal OA-specific IgGi antibody titers and lung cytokine ratios among the experimental groups. In order to obtain a better approximation of a normal distribution, the mean reciprocal OA-specific IgGi antibody titers underwent logarithmic transformation. Any statistically significant result by A N O V A were further examined by post hoc t-tests where a p value < 0.05 was considered to be statistically significant.  40  Group 1:  •  *  T T *  0  000  000  TTT  TTT  TTT  T  T T t  t  •  Group 2:  • Group 3:  ••A  AAA  •  TTT  TTT  T  AAA  AAA  Group 4: T  Day:  o  T  12  24  30  •  37 39 41 44 46 48 51  Fig 6.1 Schematic diagram showing time course of treatments. Group 1: uninfected, unsensitized; Group 2: high dose R S V infected OA-sensitized; Group 3: low dose R S V inoculated + high dose R S V infected OA-sensitized; Group 4: CpG-ODN pre-treated + high dose RSV infected OA-sensitized. • ! intranasal saline inoculation; 0 i saline inhalation; M: high dose R S V infection + O A sensitization; A: OA-challenge; • : low dose R S V inoculation; -4: intranasal CpG-ODN administration; • :  euthanization.  41  Fig. 6.2 Guinea pig whole lung (top) and sagittal sections of the lung lobes (bottom) one hour after intranasal administration of 300 |J,L of India ink. Note the distribution of the ink, indicative of successful delivery of inoculum to different regions of the lungs.  42  Table 6.1 Temperatures, Time, and Cycles during PCR Target Gene  Activation  Denaturing, Annealing, Extension  (1 cycle)  (1 cycle) pactin  15 min, 95°C,  Final Extension  1 min 94°C, 1 min 59°C, 1 min 72°C,  10 min, 72°C,  (30 cycle) IFNy  15 min, 95°C,  1 min 94°C, 1 min 58°C, 1 min 72°C  10 min, 72°C,  (40 cycle) IL-5  15 min, 95°C,  1 min 94°C, 1 min 60°C, 1 min 72°C (40 cycle)  43  10 min, 72°C,  C H A P T E R 7: R E S U L T S As mentioned in Chapter 6 in our major experiments our animals were grouped as follows: Group 1: Uninfected, unsensitized controls Group 2: High dose RSV infected + O A Group 3: Low dose RSV inoculated + (High dose R S V infected + OA) Group 4: CpG-ODN pre-treated + (High dose R S V infected + OA) During our major experiment two animals died in Group 3 during the second R S V inoculation procedure and one animal from group 2 underwent euthanasia two days after the second O A exposure because of decreased activity and poor feeding. Procedures were well tolerated by all other animals.  7.1 O A - S P E C I F I C A N T I B O D Y T I T E R S Table 7.1 shows the data obtained from serologic analysis. OA-specific IgGi antibodies were detected in the sera of all animals who received repeated exposures of OA. Titers of OAspecific IgGi were significantly lower in Group 4 than Group 2 (p<0.02) and Group 3 (p<0.03). Groups 2 and Group 3 showed no significant difference in circulating of OA-specific IgGi antibody titers. No OA-specific IgGi was detected in Group 1.  7.2 A I R W A Y I N F L A M M A T I O N Photomicrographs of airways stained for T cells and eosinophils are shown in Figures 7.1- 7.8. Tables 7.2 and 7.3 summarize the results of T cell and eosinophil percentages, respectively. Data shown in these tables are the ratios of positively stained to non-stained points by the grid applied with Image Pro P L U S software and are reported as percentages. Statistical analysis showed Group 1 had significantly lower airway T cell counts than other groups (pO.OOl) and Group 4 had significantly lower airway T cell counts than Group 2 or Group 3 (/?<0.001) There was no significant difference in airway T-cell counts between Groups 2 and 3 (p=0.76). Furthermore, Group 1 had significantly lower airway eosinophil counts than other groups (p<0.001) and Group 4 had significantly lower airway eosinophil counts than Group 2 and 3 (p<0.04 and /?<0.001, respectively). There was no significant difference in airway eosinophil percentages between Groups 2 and 3. In summary, all the animals that received R S V 44  and O A had significant increases in T cell and eosinophil counts in their airway walls in comparison to uninfected unsensitized controls. Amounts of airway T cells in the Group 4 (the CpG-ODN pretreated group) were significantly lower than Groups 2 or 3. There were no significant differences in terms of T cell or eosinophil quantification between Group 2 and 3.  7.3 S E M I - Q U A N T I T A T I V E R T - P C R Table 7.4 shows the mean and standard error for IFNy/IL-5, IFNy/pactin, and IL-5/pactin ratios. A N O V A revealed significant differences among groups for IFNy/IL-5, IFNy/pactin, and IL-5/pactin ratios (p<0.03, p<0.003, and /?<0:02, respectively). The p values for post hoc t-tests of differences between pairs of groups are shown in Table 7.4. Data summarized in this Table show that, animals in Group 1 had very low baseline levels of IFNy and IL-5 expression, with a Thl dominant IFNy/IL-5 ratio. Groups 2 and 3 showed similar results. The combination of high dose R S V + O A shifted the lung Thl/Th2 ratio toward Th2 and pre-treatment with low dose RSV did not affect patterns of cytokine gene expression resulting from combination of high dose RSV + O A alone. Group 4 (CpG-ODN pre-treated group) showed increased expression of IFNy and IL-5 in response to high dose RSV + O A combination compared to Group 1, but IFNy/IL-5 ratio was preserved in T h l direction.  45  Table 7.1 Circulating Titers of OA-specific IgGi Antibodies in Sera of Guinea Pigs GROUP  Log O A - I g G l f  1 (Uninfected, unsensitized)  None detected  2 (RSV + O A only)  5.5 ± 0 . 1  3 (Low dose R S V + (RSV + OA))  6.0 ± 0 . 1 *  4 (CpG-ODN + (RSV + OA))  5.3 ± 0 . 1 * *  f Data shown are mean ± SE *Not significantly different from Group 2 (p=0A 1). ** Significantly lower than Group 2 (p<0.002) and Group 3 (pO.OOl).  46  Fig. 7.1 Photomicrograph of unsensitized, uninfected guinea pig (Group 1) bronchiole. Note the relatively low amount of T cells (brown stain) in the airway wall. Anti-CD3 immunostaining. Scale bar = 50 |im.  47  Fig. 7.2 Photomicrograph of RSV-infected, OA-sensitized guinea pig (Group 2) bronchiole. Note the extensive T cell infiltrates (brown stain). Anti-CD3 immunostaining. Scale bar = 50 |im.  48  Fig. 7.3 Photomicrograph of low dose R S V inoculated, RSV-infected, OA-sensitized guinea pig (Group 3) bronchiole. Note the extensive T cell infiltrates (brown stain). immunostaining. Scale bar = 50 u.m.  49  Anti-CD3  Fig. 7.4 Photomicrograph of CpG-ODN pre-treated, RSV-infected, OA-sensitized guinea pig (Group 4) bronchiole. Note the T cell infiltrates, (brown stain). Anti-CD3 immunostaining. Scale bar = 50 |im.  50  Fig. 7.5 Photomicrograph of unsensitized, uninfected guinea pig (Group 1) bronchiole. Note the relatively low amount of eosinophils (red stain). Hansel's staining. Scale bar = 50 jim.  51  Fig. 7.6 Photomicrograph of RSV-infected, OA-sensitized guinea pig (Group 2) bronchiole. Note the extensive eosinophil infiltrates (red stain). Hansel's staining. Scale bar = 50 p:m.  52  Fig. 7.7 Photomicrograph of low dose R S V inoculated, RSV-infected, OA-sensitized guinea pig (Group 3) bronchiole. Note the extensive eosinophil infiltrates (red stain). Hansel's staining. Scale bar = 50 |im.  53  Fig. 7.8 Photomicrograph of CpG-ODN pre-treated, RSV-infected, OA-sensitized guinea pig (Group 4) bronchiole. Note the eosinophil infiltrates (red stain). Hansel's staining. Scale bar = 50 urn.  54  Table 7.2 Results of Lung Histology for Airway T Cells GROUP 1 (Uninfected, unsensitized)  T cell percentage f 2.5 ± 0 . 2 *  2 (RSV + O A only)  8.6 ± 0 . 6  3 (Low dose R S V + (RSV + OA))  8.3 ± 0 . 8  4 (CpG-ODN + (RSV + OA))  4.8 ±0.4**  t Data shown are mean ± SE of the percentage of T cells (the ratio of positively stained points to non-stained ones) in the airway wall. * Significantly lower than Groups 2-4 (pO.OOl) ** Significantly lower than Group 2 or 3 (pO.OOl)  55  Table 7.3 Results of Lung Histology for Airway Eosinophils Eosinophil percentagef  GROUP 1 (Uninfected, unsensitized)  3.6 ± 0 . 3 *  2 (RSV + O A only)  9.1 ± 0 . 6  3 (Low dose R S V + (RSV + OA))  10.4 ± 0 . 6 7.5 ± 0 . 5 * *  4 (CpG-ODN + (RSV + OA))  t Data shown are mean ± SE of the percentage of eosinophils (the ratio of positively stained points to non-stained ones) in airway wall. * Significantly lower than Groups 2-4 (/><0.001) ** Significantly lower than Group 2 (p=0.037) or 3 O<0.001)  56  Table 7.4 Results of Lung Cytokine Gene Expression GROUP  IFNy/IL-5 f  IFNy/pactin f  IL-5/pactin f  1 (Uninfected, unsensitized)  9.8 ± 3 . 5  0.9 ± 0.4  0.9 ± 0.5  2 (RSV + O A only)  1.4 ± 1 . 0 *  1.7 ± 0 . 9  3.2 ± 1 . 2 TTT  3 (Low dose R S V + (RSV + OA))  1.0 ±0.6**  4.6 ± 2 . 7  5.2 ± L O T  4 (CpG-ODN + (RSV + OA))  8.8 ± 3 . 2  23.9 ± 8 . 5 * * *  3.2 ± 0.9 TT  | Data shown are mean ± SE * Significantly different from Group 1 (p<0.04) and Group 4 (p<0.05). ** Significantly different from Group 1 (p<0.03) and Group 4 G?<0.04). *** Significantly different from Group 1 (p<0.02), Group 2 (p<0.03), and Group 3 (p<0.05). T Significantly different from Group 1 (p<0.02) TT Significantly different than Group 1 (p<0.03) TTT In comparison to Group 1, trend toward higher IL-5 observed (p<0.06).  57  C H A P T E R 8: T H E E F F E C T O F C p G - O D N O N OA-SENSITIZED ANIMALS  The results of our major experiment suggest that CpG-ODN pre-treatment confers some benefit to the effects of combination of RSV infection plus repeated O A exposures. In murine models of allergen sensitization, some investigators have shown the effectiveness  of  administration of CpG-ODN alone (without antigen) on subsequent antigen exposures [40,41], while others have reported that CpG-ODNs are only effective when they are administered with the antigen [39,100]. The effects of CpG-ODN pre-treatment (using the regimen described in Chapter 5) on uninfected, OA-sensitized guinea pigs were not known. In order to explore this issue in guinea pigs, we performed the following experiment:  8.1 E X P E R I M E N T A L D E S I G N Three groups (n=4/group) of female juvenile, 1-month old Cam Hartley guinea pigs were studied as follows: Group 1: Sham controls that received saline Group 2: O A sensitized and challenged Group 3: CpG-ODN pretreated and O A sensitized and challenged  8.2 S P E C I M E N S Animals were killed 3 days after last O A or saline exposure by overdose of intraperitoneal sodium pentobarbital. Specimens for lung cytokines, serology, and histology were prepared as previously described in Chapter 6. IFNy, IL-5, and pactin gene expression were measured using the same semi-quantitative RT-PCR method we used before. Levels of O A specific IgGi antibody were determined using our indirect ELISA method and the percentages of airway eosinophils were also measured as before.  8.3 D A T A A N A L Y S I S After normalization of IFNy, and IL-5 OD to corresponding pactin OD, the ratio of IFNy/IL-5 was calculated for each animal. Copy equivalents of cytokines and pactin were 58  determined using normalized values and ratios and standard curves. Possible differences in mean levels of IFNy/pactin, IL-5/pactin, and IFNy/IL-5, OA-specific IgGi antibody titer, and percentages of airway eosinophils among the 3 groups of animals were examined by one-way A N O V A (SPSS Statistical Software, v. 11) and post hoc Student's t-tests were used to examine the differences between pairs of experimental groups. P value < 0.05 was set as level of statistical significance.  8.4 R E S U L T S OA-specific IgGi titers were undetectable in Group 1 and were significantly lower than the other two groups of animals (/?<0.001) (table 8.1). The mean percentage of eosinophils was significantly lower in Group 1 than the other groups (pO.OOl) (table 8.2). As shown in Table 8.1 and 8.2, there were no significant differences between Groups 2 and 3 in terms of OA-specific IgGi antibody titer or eosinophil percentage. Levels of cytokine gene expressions were not significantly different among any of the three groups (table 8.3).  8.5 C O N C L U S I O N O A repeated exposures increased the titer of OA-specific IgGi antibody and airway eosinophil percentage. CpG-ODN pre-treatment did not make any difference in these values after subsequent O A exposures. Lung cytokine gene expression also remained the same in all three groups.  59  Table 8.1 Circulating Titers of OA-specific IgG] Antibodies in Sera of Guinea Pigs Log OA-specific IgGi titers (mean + SE)  Group  None detected  1. Sham controls 2. O A sensitized and challenged  5.7 ±0.1  3. CpG-ODN + O A sensitized and challenged  5.9 + 0.1  60  Table 8.2 Results of lung Histology for Airway Eosinophils Mean ± SE  Group  1. Sham controls  1.8 ± 0 . 3 *  2. O A sensitized and challenged  4.9 ± 0.4  3. CpG-ODN + O A sensitized and challenged  5.2 ± 0 . 8  * Significantly different from Groups 2 or 3  (p<0.001)  61  Table 8.3 Lung Cytokine Gene Expression Results Group  IFNy/pactin IL-5/pactin (mean + SE)* (mean + SE)*  IFNy/IL-5 (mean + SE)*  1. Sham controls  0.3 ±0.3  1.1 ± 1.0  2+1  2. OA sensitized and challenged  0.3 ±0.2  0.2 + 0.2  10 + 8  3. CpG-ODN + OA sensitized and challenged  0.1 ±0.1  0.1 ±0.1  9±9  * p values NS  62  C H A P T E R 9: D I S C U S S I O N  The interaction between R S V infection and O A allergic sensitization has been studied in guinea pigs by Dakhama et al. [75], who showed that R S V infection at the time of first O A exposure was associated with increased circulating titers of OA-specific IgGi antibodies. The purpose of our study was to determine whether interventions such as low dose R S V inoculation or CpG-ODN administration inhibits the development of subsequent RSV-enhanced allergic sensitization of guinea pigs to aerosolized O A in terms of development of allergic airway inflammation and production of OA-specific IgGi antibodies. In this chapter we will discuss the results of our study for each intervention separately.  9.1 T H E L O W D O S E R S V I N T E R V E N T I O N  The idea that low dose of R S V can result in protection against RSV-enhanced allergic sensitization to O A was inspired by advances in tuberculosis [34] and Leishmaniasis [35] research, which showed that host Thl/Th2 balance is influenced by the first infectious dose to which the host is exposed and this first exposure to infection determines the response to subsequent exposures. In these studies exposures to comparatively low doses of mycobacterium or parasite showed similar responses, in which there was stimulation of a long lasting, protective Thl response, whereas high infectious doses of these pathogens stimulated a mixed Thl+Th2 response. These results suggest the indicating possibility to design a generalized, effective intervention strategy for avoiding initial Th2 responses to pathogens. On the other hand, in spite of the association between acute bronchiolitis and recurrent wheezing asthma and allergy in children [18-21], some investigators have postulated a protective role for early life viral infections in the development of allergy and asthma [77-79]. Part of the rationale in viruses being protective is based on the understanding that a T h l response typically develops during viral infections, which can provide a milieu against allergy and asthma [79]. Overall, there is a considerable controversy with regard to the potential role of viral respiratory tract infections, including acute RSV bronchiolitis, in triggering allergic sensitization and airway inflammation in asthma. We postulated that the controversy in the role of R S V in the onset of asthma and allergy could be explained by differences in the first amount of infectious virus to which children are exposed. We proposed low dose viral exposures could have a protective role in post-bronchiolitis allergic sensitization. 63  Using a guinea pig model, we examined the effects of low dose R S V exposures on subsequent RSV-enhanced OA-sensitization. Allergic inflammation of the airways and production of allergen-specific IgGi  antibodies were studied as determinants  of post-  bronchiolitis allergic sensitization. In a study by Hamid et al. [99] the investigators reported that airways from patients with asthma demonstrated significant increases in the numbers of T cells and eosinophils compared with airways from nonasthmatic subjects. Accordingly, among all types of potential inflammatory cells to study, we focused on eosinophils and T cells. We also studied only the membranous airways because in the same study by Hamid et al. [99], they showed that there was a similar but more severe inflammatory process present in the peripheral compared with the central airways of patients with asthma. Moreover, R S V typically affects peripheral airways [44]. A 4-week interval between low dose R S V intervention and R S V infection + first O A exposure was chosen to let the guinea pigs recover from the first inoculation procedure [90]. In agreement with the study by Dakhama et al. [75] our results showed that high dose R S V infection plus O A repeated exposures in the high dose R S V infected + O A group (Group 2), led to production of OA-specific IgGi antibody, a Th2-mediated response [101]. The animals in Group 2 also had significantly higher amount of airway eosinophils than uninfectedunsensitized controls. Increased numbers of eosinophils in guinea pig airways after R S V infection [97], O A sensitization [93], and combination of R S V infection and O A sensitization [75] have been reported before. In addition, animals in Group 2 had significantly increased numbers of T-cells in their airways, which has been reported in other strains of guinea pigs after experimental R S V infection [97]. Animals in the low dose RSV inoculated + (RSV+OA) group (Group 3) did not have any significant difference with Group 2 in terms of mean circulating titers of OA-specific IgGi antibodies or airway inflammatory cells, indicating that the intervention of low dose R S V exposure did not protect guinea pigs against subsequent RSV-enhanced O A sensitization. To characterize this further, we measured the lung cytokines by semi-quantitative RTPCR and the results showed that in Group 2 the IFNy/IL-5 ratio was significantly lower than sham controls (Group 1), along with trends in increased IL-5 gene expression (p = 0.06). Group 3 showed significantly higher IL-5 expression and lower IFNy/IL-5 ratio than Group 1 and the expression of IFNy was not significantly different among Groups 1, 2, and 3. Furthermore, Group 2 and Group 3 showed no difference in levels of IL-5 expression and IFNy/IL-5 ratio. Taken together, these results indicate that Group 2 and Group 3 are similar in terms of shift of 64  the lung Thl/Th2 balance towards Th2, such that low dose R S V does not affect patterns of cytokine gene expression resulting from a combination of high dose R S V and repeated O A exposures. Our finding that R S V infection was not associated with increased IFNy expression indicates that R S V appears to be an exception to the general rule that virus infections stimulate Thl responses, which is consistent with the idea of some investigators [102] but in contrast to that of the others [103,104]. Moreover, in a recent study by Bramley et al. [97], R S V infection in strain 2 and strain 13 guinea pigs increased the lung IL-5 expression but did not have any effect on lung IFNy expression, consistent with our results in Cam Hartley guinea pigs. Finally, a combination of R S V infection and repeated O A exposures might have been responsible in the inability of R S V to enhance the IFNy expression. Increased IL-5 expression in Group 3 and a trend toward higher IL-5 gene expression Group 2 could be because of the effect of R S V [97], or O A (as an allergen generates Th2 responses and results in pulmonary inflammation [105]), or the combination of both. In summary OA-specific IgGi antibody production and airway inflammation by eosinophils and T cells in association with a Th2 prominent cytokine milieu, were produced by the combination of R S V infection and repeated O A exposures in guinea pigs. We demonstrate here that low dose R S V inoculation 4 weeks before high dose R S V infection plus repeated O A exposures does not affect patterns of cytokine gene expressions, OA-specific IgGi titers, or airway eosinophil and T cell percentage.  9.2 T H E C p G - O D N I N T E R V E N T I O N The rationale for applying the CpG-ODN intervention for primary prevention of virusenhanced allergic sensitization is based on several lines of evidence. Epidemiological studies suggest that mycobacterial infections are protective against later development of allergic conditions in later childhood [106]. The decline in incidence of childhood bacterial and mycobacterial infections in western countries is in parallel with the increasing incidence of asthma [81], suggesting that these infections possibly protect children from allergy and asthma by inducing T h l responses. Recent advances in animal experiments using bacterial components, including CpG-ODNs, suggest that developing novel vaccines for protecting humans from allergic disorders is possible [107]. CpG-ODN can act as a "danger signal" and activate innate immune defenses [108]. The first evidence that CpG-ODN administration confers resistance to infection was reported by Krieg et al. [109]. These investigators showed that single dose pre65  treatment with CpG-ODN provides resistance to L. monocytogenes and the resistance developed within 48 h and persisted for at least 2 weeks. Elkins et al. [110] also reported that prior administration of CpG-ODN protected mice against Francisella tularensis. CpG-ODN also conferred protection against malaria [111] and Leishmania major [112]. There are also reports showing protective effects of CpG-ODN against some viral infections including herpes simplex virus type l ( H S V - l ) [113], HSV-2 [114]. Gramzinski et al. [ I l l ] reported that stimulation of the innate immune system by CpG immunostimulatory motifs can confer protection against malaria but that the protection is short lived (less than 7 days). Hence, they proposed repeated dosing for CpG-ODN could offer a long lasting protection. Klinman et al. [115] examined this and reported repeated administration of CpG-ODN 2 to 4 times/month before infection conferred a long time protection (at least 4 months) to L. monocytogenes and F. tularensis. For different studies CpG-ODN has been delivered via systemic and mucosal routes [116]. In order to determine how route and dose of administration affects pulmonary Thl/Th2 balance in guinea pigs we performed a preliminary study (Chapter 5). Our dosing regimens for CpG-ODN administration were 30 |ig and 100 |ig, which are reasonably near to the doses applied for mice [36,41,115]. The dosing was repeated biweekly over 4 weeks to provide a longterm protection [115]. Subcutaneous and intranasal routes of administration were considered to compare a systemic route with a mucosal one. Guinea pigs tolerated the  CpG-ODN  administration very well and no sign of illness, poor feeding or weight loss was observed during the whole procedure. This is consistent with CpG-ODN being well tolerated, with toxicity observed in special conditions such as administration of repeated large doses, or the combination of CpG-ODN with lipopolysaccharide (LPS) [117]. Toxicity has resulted in wasting syndrome and death of mice [117]. In addition sepsis syndrome and pulmonary inflammation has been reported after exposure to large doses of D N A containing CpG motifs [109]. Animals who did not receive any CpG-ODN (Group 1) had significantly lower IFNy gene expression than animals given CpG-ODN (Groups 2-5). There was a trend toward higher IL-5 gene expression in the guinea pig lungs after CpG-ODN treatment except for 100 fig intranasal group (Group 5), which had significantly lower levels of IL-5 gene expression than other CpGODN-treated groups (Groups 2-4), suggesting routes and doses of CpG-ODN administration are important in shifting the immune response toward T h l , Th2 or mixed Thl/Th2 responses. In agreement with our results in Group 5, in murine models of asthma, CpG-ODN administration increased lung lavage fluid levels of IL-12 and IFNy and prevented the allergen-induced increase 66  in IL-4 levels, therefore up-regulated T h l and down-regulated Th2 responses [39]. In addition, consistent with our results in Groups 2, 3 and 4, McCluskie et al. [118] reported the increase in both T h l and Th2 responses after oral administration of CpG-ODN to B A L B / c mice. These investigators found that oral administration of CpG-ODN along with hepatitis B surface antigen (HBs Ag) or tetanus toxoid (TT) increased IgG2a antibodies (Thl responses) as well as IgGi and IgA antibodies (Th2 responses). A l l CpG-ODN pre-treated groups showed significant T h l shift in pulmonary Thl/Th2 balance in comparison to untreated controls. The extent of Thl shift was influenced by dose and route of administration of CpG-ODN; in that 100 jig intranasal group (Group 5) had significantly more T h l shift in Thl/Th2 balance than the 30 p:g subcutaneous group (Group 2). As the goal of CpG-ODN treatment of guinea pigs was to maximize increase in T h l and minimize any possible increase in Th2 in the lungs, for each animal we used 100 p.g CpG-ODN, delivered intranasally, biweekly over 4 weeks. To examine the effect of CpG-ODN pre-treatment on subsequent R S V infection plus repeated O A exposures, we used a guinea pig model of R S V and O A sensitization. The results showed that in the CpG-ODN pre-treated + ( High dose R S V infected + OA) group (Group 4) the level of IFNy and IL-5 gene expressions were significantly higher than those of the sham control group (Group 1), but the IFNy/IL-5 ratios were shifted in the Thl direction. Since CpGO D N is supposed to induce the T h l response [36] the increase in the IFNy gene expression level was expected. The higher level of IL-5 gene expression could be the result of R S V infection, O A exposures or both. As mentioned earlier, in the high dose R S V infected + O A group (Group 2), the combination of high dose R S V infection and repeated O A exposures shifted the Thl/Th2 balance towards Th2, with the IFNy gene expression remaining unchanged but there was a trend toward higher IL-5 gene expression (jp=0.06). When we compared the Group 4 with Group 2 IFNy/IL-5 ratio and the IFNy gene expression were significantly higher in the CpG-ODN pre-treated animals. The levels of IL-5 gene expression in Groups 2 and 4 were higher than Group 1, but Groups 2 and 4 did not have any significant difference in IL-5 gene expression level. Hence, CpG-ODN induced the T h l response but could not suppress the Th2 response resulting from the combination of R S V infection plus O A exposures. We next evaluated the effect of CpG-ODN on the development of airway inflammation in our model. In the CpG-ODN pre-treated animals levels of eosinophils and T cells were 67  significantly higher than sham controls and lower than the ones in Group 2, suggesting CpGODN pre-treatment confers a partial protection against the allergic inflammation of airways resulting from combination of RSV infection and O A exposures. Increases in airway T cells and eosinophils have been shown in RSV infected guinea pigs [97]. Moreover, O A as an allergen can result in T cell and eosinophil infiltration to the lungs [31]. Hence, increased airway inflammation by T cells and eosinophils after combination of R S V infection and O A exposure was not surprising. It is possible that cytokines induced by CpG-ODN can disrupt viral replication and activate natural killer cells thereby lyse infected cells and limit the viral replication and disease [113]. This effect of CpG-ODN could be a reason that our CpG-ODN pre-treated group had a lower T cell inflammation than Group 2. The effect of CpG-ODN on allergen sensitization will be discussed in Chapter 9.3. The shift of pulmonary Thl/Th2 balance toward Th2 after R S V infection plus O A exposures, suggests that many of infiltrating T cells in the airways of the animals were from the Th2 subset. The type of Th cells could be determined by in situ hybridization technique [105], in which target mRNA sequences are localized to individual cells in lung specimens. We next examined serum titers of OA-specific IgGi antibody, a marker for allergic sensitization. As expected, we could not detect serum OA-specific IgGi antibody in the sham controls. The titer of serum OA-specific IgGi antibody was significantly higher in Group 2 than the CpG-ODN pre-treated one. In murine models, it is well established that some cytokines can regulate the expression of immunoglobulin isotypes [119]. Initial activation of naive B-cells by antigens and T cells results in immunoglobulin class switching [31]. The Th cell cytokines determine the direction of this class switching. The Th2 cytokines such as IL-4 and also IL-13 are responsible for switching to IgGi in mice, while IFNy secreted by T h l cells inhibits this [119]. In our animals we did not measure the level of IL-4 and IL-13 gene expression because the nucleotide sequences of these cytokines for guinea pigs were not available. The level of IL-5 gene expression (a Th2 cytokine) in the CpG-ODN-pre-treated animals did not have any difference with the R S V infected and O A exposed animals thereby, could not explain the lower titer of OA-specific IgGi antibody in Group 4. However, the higher level of IFNy gene expression in the CpG-ODN pretreated animals could be a reason for lower IgGi antibody titers in Group 4, suggesting that in IgGi antibody production, the Thl/Th2 balance is more important than the level of each Th class cytokine by itself.  68  In summary, we have demonstrated that CpG-ODN administration 4 weeks before high dose R S V infection plus repeated O A exposures confers partial protection against allergic sensitization and can affect patterns of cytokine gene expressions, OA-specific IgGi titers, and number of airway eosinophils and T cells.  9.3 E F F E C T S O F C p G - O D N P R E - T R E A T M E N T R E G I M E N O N O A - S E N S I T I Z E D G U I N E A PIGS To determine whether our CpG-ODN pre-treatment regimen had any effect on O A sensitization (without R S V infection) we performed another study, which is explained in more detailed in Chapter 8. Briefly, CpG-ODN pre-treated OA-sensitized animals were compared with OA-sensitized ones that did not receive CpG-ODN as well as sham controls. We measured the OA-specific IgGi antibody titer as well as airway eosinophils. As we expected OA-sensitization resulted in antibody production and higher airway eosinophil counts in all OA-sensitized animals. However, there was no significant difference between the CpG-ODN pre-treated and non-CpG-ODN pre-treated OA-sensitized groups in terms of antibody titers or airway eosinophil counts. The phosphorothioate backbone of CpG-ODN 2007 (the CpG-ODN that we used) [120], provides more resistance to nucleases than phosphodiester CpG-ODNs [117] thereby, rapid degradation of CpG-ODN in our experiment is less likely. Animal studies have shown that i.p. or in. administration of CpG-ODN alone (given without antigen) led to suppression allergen induced asthma in mice [40,41]. However, the protocols used for CpG-ODN administration were different than ours such that other investigators administered the CpG-ODN before antigen challenges to presensitized animals. In contrast to these investigators, Kline et al. [39] reported that administration of CpG-ODN alone did not result in any significant protection against development of allergy and asthma. They administered CpG-ODN along with the allergen at the time of sensitization and observed the protective effects of CpG-ODN against asthma. Shirota et al. [100] also observed the inhibitory effects of CpG-ODN on airway hyperresponsiveness and eosinophilia of presensitized animals only when it was given in combination with allergen, suggesting allergen-specific immune responses were responsible for the inhibition. This interpretation was supported by results of another study, in which CpG-ODN combined with O A protected against the development of airway eosinophilia of mice, but that protection against O A sensitization did not protect the animals against schistosome sensitization [39]. Moreover, Tighe et al. [121] showed that conjugation of CpG-ODN to antigen intensifies the immunostimulatory 69  effects of CpG-ODN. In CpG-ODN conjugates, antigen is co-incorporated with the CpG-ODN during uptake by APCs, which results in high IL-12 expression and development of T h l cells [122]. Taken together, several reasons could be proposed for our finding that CpG-ODN had no significant inhibitory effect on production of OA-specific IgGi antibody titers or airway eosinophilia in guinea pigs. First, we gave CpG-ODN to unsensitized naive animals and we stopped the administration one week before sensitization, therefore the timing of CpG-ODN administration was different from that of other studies. Secondly, CpG-ODN was administered alone and consistent with some of/the aforementioned studies, CpG-ODN alone cannot offer a protective effect against antigens. It is possible that in the context of allergic sensitization, CpGO D N acts as an immune enhancer only when it is combined with an allergen or at least it is given after the allergen sensitization. In this context, CpG-ODN has been used as an adjuvant for the R S V F protein adsorbed to aluminum hydroxide (F/AIOH), as a subunit candidate vaccine against RSV [123]. Compared with administration of F/AIOH alone, coadministration of CpGO D N with F/AIOH resulted in significantly higher T h l responses as well as significantly lower Th2 responses. By contrast in this thesis, the CpG-ODN was administered alone before O A sensitization to determine if we could protect our animals in an antigen-independent way, thereby modeling the "real world" situation, in which there is an abundance of potential allergens (e.g., house dust mite, ragweed, animal dander, etc.) that might be deleterious to the patient. Moreover, our goal was to bring a protection against post-bronchiolitis allergy and asthma and as mentioned earlier, in naive animals CpG-ODN alone has conferred protection against bacterial and viral infections. In our experiment on effects of CpG-ODN on OA-sensitization alone (Chapter 8), we also measured T h l and Th2 cytokine gene expressions. The results showed that there was no difference among the CpG-ODN pre-treated OA-sensitized group, animals that only received OA-sensitization, and sham controls. The result that CpG-ODN pre-treatment did not increase the IFNy gene expression was consistent with the concomitant findings that CpG-ODN did not significantly affect airway eosinophilia or OA-specific IgGi antibody titers. However, the finding of no significant differences in IL-5 gene expression between the OA-sensitized animals and sham controls was unexpected. To our knowledge, there is no other study on lung cytokines of OA-sensitized guinea pigs that we could compare with the present study. It is possible that the baseline levels of IL-5 gene expression in our guinea pigs were too high to let the O A sensitization make a recognizable enhancement in its level. Furthermore, since we have used 70  total lung homogenates for our RT-PCR method, the amount of paranchymal IL-5 gene expression might have overwhelmed any significantly different airway IL-5 gene expression. It is also possible that in guinea pigs the effect of eotaxin on airway eosinophilia is greater than that of IL-5 [97]. Furthermore, the level of bioactive IL-5 protein in the guinea pig lung might be different from the level of its mRNA. Finally, the small sample size (n=4/group) and fairly large variances within the experimental groups might have increased the possibility of making type II error (i.e., accepting the null hypothesis when it is false) [124].  9.4 SUMMARY AND CONCLUSION In summary, low dose R S V inoculation before RSV-enhanced OA-sensitization did not confer protection against manifestations of allergy and asthma in a guinea pig model. B y contrast, CpG-ODN administration before RSV-enhanced OA-sensitization provided partial protection against production of OA-specific IgGi antibodies, and airway inflammation by T cells and eosinophils. CpG-ODN also induced a predominantly Thl pattern of immune activation in the guinea pigs. Investigating the effects of CpG-ODN on uninfected OA-sensitized animals revealed that our method of pre-treatment with CpG-ODN did not have any significant effect on ameliorating subsequent allergen-sensitization, suggesting CpG-ODN protected the animals against R S V only or the combination of both R S V infection and O A exposures. Alteration of protocols for CpG-ODN administration, such as combining antigen with CpG-ODN, may provide better protection against RSV-enhanced OA-sensitization. This work can be extended to other viruses and ultimately new approaches can be developed for the primary prevention of post-bronchiolitis asthma and allergy in children.  71  BIBLIOGRAPHY 1. 2. 3. 4. 5. 6.  http://www.hc-sc.gcxa/pphb-dgspsp/ccdpc-cpcmc/crd-mrc/asthma e.html http://www.healthpromoresearch.com/CHERA poster.pdf Anonymous. The future of asthma. Lancet 1997;350:1113. American Thoracic Society. Standards for the diagnosis and care of patients with chronic (COPD) and asthma. A m Rev Respir Dis 1987;136:225-44. Roberts CR. Is asthma a fibrotic disease? Chest 1995; 107:111S-117S. Slovis BS, Brigham K.L. Diagnostic techniques and their indications. In: Carpenter CJ, Griggs RC, Loscalzo J, eds. Cecil Essentials of Medicine. 5 edition. Philadelphia, PA: W . B . Saunders company, 2001:181-84. Chesnutt MS, Pendergast TJ. Lung. In: Tierney L M Jr, McPhee SJ, Papadakis M A , eds. Current Medical Diagnosis & Treatment. New York, N Y : McGraw-Hill, 2002:296-362 Behrman RE, Kliegman R M , Jenson H B . Asthma. In: Nelson Textbook of Pediatrics, 16 edition. Philadelphia, PA: W.B Saunders Company, 2000. Lemanske RF Jr, Busse WW. Asthma. J Allergy Clin Immunology 2003;1111 :S502-S519. Osier W. Bronchial asthma. The Principals and the Practice of Medicine. 1 edition. New York, N Y : D. Appleton and Company, 1892. Hegele R G . The pathology of asthma: brief review. Immunopharmacol 2000;48:257-62. Davies D E , Wicks J, Powell R M , Puddicombe S M , Holgate ST. Airway remodeling in asthma: new insights. J Allergy Clin Immunol 2003; 111:215-25. Sandford A , Weir T, Pare P. The genetics of asthma. A m J Respir Crit Care Med 1996; 153:174965. Maddox L, Schwartz D A . The pathophysiology of asthma. Ann Rev Med 2002;53:477-98. Wiesch D G , Samet J M . Epidemiology and natural history of asthma. In: Middleton E, Ellis E F , Yunginger JW, Reed C E , Adkinson NF, Busse W W , eds. Middleton: Allergy: Principles and Practice. 5 edition. St. Louis, M O : Mosby-Yearbook, Inc., 1998:799-815. Gold DR, Burg H A , Carey V , Milton D K , Platts-Mills T, Weiss ST. Predictors of repeated wheeze in the first year of life. The relative roles of cockroach, birth weight, acute lower respiratory illness, and maternal smoking. A m J Respir Crit Care Med 1999;160:227-36. Orenstein D M . Bronchiolitis. In: Behrman R E , Kliegman R M , Jenson H B , eds. Nelson Textbook of Pediatrics. 16 edition. Philadelphia, PA: W.B Saunders Company, 2000: 1284-87. Pullan CR, Hey E N . Wheezing asthma and pulmonary dysfunction 10 years after infection with respiratory syncytial virus. B.M.J. 1982; 284: 1665-9. Carlsen K H , Larsen S, Bjerve 6, Leegard J. Acute bronchiolitis: predisposing factors and characterization of infants at risk. Pediatric pulmonol 1987;3:153-60. Noble V , Murray M , Webb MSC, Alexander J, Schwarbrick A S , Milner A D . Respiratory status and allergy nine to ten years after bronchiolitis. Arch. Dis. Child 1997;76:315-9. Sigurs N , Bjamason R, Sigurbergson F, Kjellman B . Respiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. A m J Respir Crit Care Med 2000;161:1501-7. Hanson C, Shearer WT. Bronchiolitis. In: McMillan JA, DeAngelis CD, Feigin RD, Warshaw JB, eds. Oski's Pediatrics: Principles and Practice 2nd edition. Philadelphia, PA: Lippincott Williams & Wilkins, 1999. Collins C L , Pollard A J . Respiratory syncytial virus infections in children and adults. J Infect 2002;45:10-7. Hall C B . Respiratory syncytial virus and parainfluenza virus. N Eng J Med 2001 ;344(25): 191728. Kim HW, Canchola JG, Brandt C D , Chanock R M , Jansen K , Parrott R H . Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. A m J Epidem 1969;89:422-34. Mosmann TR, Cherwinski H , Bond M W , Giedlin M A , Coffman R L . Two types of murine T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol 1986;136:2348-57. th  7. 8. 9. 10. 11. 12. 13. 14. 15.  th  st  th  16.  17.  th  18. 19. 20. 21.  22.  23. 24. 25.  26.  72  27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44.  Mosmann TR, Sad S. The expanding universe of T-cell subsets: Thl, Th2 and more. Immunol Today 1996; 17(3): 138-46. O'Garra A. T cell differentiation: commitment factors for T helper cells. Curr Biol 2000;10:R492-94. Liang L, Sha WC. The right place at the right time: novel B7 family members regulate effector T cell responses. Curr Opin Immunol 2002;14:384-90. Constant SL, Bottomly K. Induction of Thl and Th2 CD4+ T cell responses: the alternative approaches. Ann Rev Immunol 1997;15:297-322. Lordan JL, Hellewell PG. Cytokines, chemokines, and adhesion proteins. In: Holgate AT, Church MK, Lichtenstein L M , eds. Allergy, 2nd edition. London. UK: Mosby, 2001:283-302. von Hertzen LC, Haahtela T. Pro: Could the risk of asthma and atopy be reduced by a vaccine that induces a strong T-helper type response? Am J Respir Cell Mol Biol 2000;22:139-42. Castro M , Chaplin DD, Walter MJ, Holtzman MJ. Con: Could asthma be worsened by stimulating the T-helper type 1 immune response? Am J Respir Cell Mol BIOL 2000;22:143-6. Power CA, Wei G, Bretscher PA. Mycobacterial dose defines the Thl/Th2 nature of the immune response independently of whether immunization is administered by intravenous, subcutaneous or intradermal route. Infect Immun 1998;66:5743-50. Menon JN, Bretscher PA. Parasite dose determines the Thl/Th2 nature of the response to Leishmania major independently of infection route and strain of host or parasite. Eur J Immunol 1998;28:4020-8. Kline JN, Krieg A M . CpG oligodeoxynucleotides. Prog Respir Res 2001 ;31:229-32. Kandimalla ER, Zhu F -G, Bhagat L, Yu D, Agrawal S. Toll-like receptor 9: modulation of recognition and cytokine induction by novel synthetic CpG DNAs. Biochem Soc Trans 2003,31:654-8. Krieg A M . CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709-60. Kline JN, Waldschmidt TJ, Businga T , Lemish JE, Weinstock JV, Thorne PS, Krieg A M : Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol 1998,160:2555-9. Broide D, Schwarze J, Tighe H, Gifford T, Nguyen MD, Malek S, Van Uden J, Martin-Orozco E, Gelfand EW, Raz E. Immunostimulatory DNA sequences inhibit IL-5, eosinophilic inflammation, and airway hyperresponsiveness in mice. J Immunol 1998;61:7054-62. Sur S, Wild JS, Choudhury BK, Sur N, Alam R, Klinman DM: Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J Immunol 1999;162:6284-93 Morris JA, Blount RE Jr, Savage RE. Recovery of cytopathogenic agent from chimpanzees with coryza. Proc Soc Exp Med 1956; 92:544-9. Chanock RM, Roizman B, Myers R. Recovery from infants with respiratory illness of a virus related to chimpanzee coryzal agent (CCA). I. Isolation properties and characterization. Am J Hyg 1957;66:281-90. Collins PL, Chanock RM, Murphy BR. Respiratory syncytial virus. In: Knipe DM, Howley PM, Griffin DE, Martin MA, Lamb RA, Roizman B, Straus SE, eds. Field's Virology 4 edition. Philadelphia, PA: Lippincott Williams & Wilkins, 2001:1443-85. Domachowske JB, Rosenberg HF. Respiratory syncytial virus infection: immune response, immunopathogenesis, and treatment. Clin Microbiol Rev 1999;12:298-309. Hacking D, Hull J. Respiratory syncytial virus-viral biology and the host response. J Infect 2002;45:18-24. Musher D M . How contagious are common respiratory tract infections? N Eng J Med 2003;348:1256-66. Hull J, Thomson A, Kwiatkowski D. Association of syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax 2000;55:1023-7. Hussel T, Baldwin CJ, O'Garra A, Openshaw PJ. CD8+ T cells control Th2-driven pathology during pulmonary respiratory syncytial virus infection. Eur J Immunol 1997;27:3341-9. lh  45. 46. 47. 48. 49.  73  50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70.  Barr FE, Pedigo H, Johnson TR, Shepherd VL. Surfactant protein A enhances uptake of respiratory syncytial virus by monocytes and U937 macrophages. Am J Respir Cell Mol Biol 2000;23:586-92. Patel JA, Kunimoto M , Sim TC et al. Interleukin-la mediates the enhanced expression of intracellular adhesion molecule-1 in pulmonary epithelial cells infected with respiratory syncytial virus. Am J Respir Cell Mol Biol 1995;13:602-9. Noah TL, Henderson FW, Wortman IA, Devlin RB, Handy J,Koren HS, Becker S. Nasal cytokine production in viral acute upper respiratory infection of childhood. J Infect Dis 1995;171:584-92. Becker S, Reed W, Henderson FW, Noah TL. RSV infection of human airway epithelial cells causes production of the b-chemokine RANTES. Am J Physiol 1997;272:L512-20. Borish LC, Steinke JW. Cytokines and Chemokines. J Allergy Clin Immunol 2003;111 :S460-75. Becker S, Quay J, Soukup J. Cytokine (tumor necrosis factor, IL-6, and IL-8) production by respiratory syncytial virus-infected human alveolar macrophages. J Immunol 1991;147:4307-12. Kurt-Jones EA, Popova L, Kwinn L et al. Pattern recognition receptors TLR4 and CD 14 mediate response to respiratory syncytial virus. Nat Immunol 2000;1:398-401. Beem M , Egerer R, Anderson J. Respiratory syncytial virus neutralizing antibodies in persons residing in Chicago, Illinois. Pediatrics 1964;34:761-70. Parrot RH, Kim HW, Arrobio JO. Epidemiology of respiratory syncytial virus infection in Washington, D.C. II. Infection and disease with respect to age, immunologic status, race and age. Am. J. Epidemiol 1973;98:289-300 Mcintosh K, Masters HB, Orr I, Chao RK, Barkin RM. The immunologic response to infection with respiratory syncytial virus in infants. J Infect Dis 1978; 138:24-32. The IMpact-RSV Study Group. Palivizumab, a humanized respiratory syncytial virus monoclonal antibody, reduces hospitalization from respiratory syncytial virus infection in high-risk infants. Pediatrics 1998;102:531-37. Holberg CJ, Wright AL, Martinez FD, Ray CG, Taussig L M , Lebowitz MD. Risk factors for respiratory syncytial virus-associated lower respiratory illnesses in the first year of life. Am J Epidemiol 1991;133:1135-51. Welliver RC, Sun M , Rinaldo D, Ogra PL. Predictive value of respiratory syncytial virus-specific IgE responses for recurrent wheezing following bronchiolitis. J Pediatr 1986;109:776-80. Chiba Y , Higashidato Y , Suga K. Development of cell-mediated cytotoxic immunity to respiratory syncytial virus in human infants following naturally acquired infection. J Med Virol 1989;28:133-9. Isaacs D, Bangham CR, McMichael AJ. Cell-mediated cytotoxic response to respiratory syncytial virus in infants with bronchiolitis. Lancet 1987;2:769-71. Englund JA, Sullivan CJ, Jordan C, Dehner LP, Vercellotti GM, Balfour HH Jr. Respiratory syncytial virus infection in immunocompromised adults. Ann Intern Med 1988;109:203-8. Hall CB, Powell KR, MacDonald NE, Gala CL, Menegus ME, Suffm SC, et al. Respiratory syncytial viral infection in children with compromised immune function. N Engl J Med 1986;315:77-81. Alwan WH, Record FM, Openshaw PJ. CD4+ T cells clear virus but augment disease in mice infected with respiratory syncytial virus. Comparison with the effects of CD8+ T cells. Clin Exp Immunol 1992;88:527-36. Graham BS, Henderson GS, Tang YW, Lu X, Neuzil K M , Colley DG. Priming immunization determines T helper cytokine mRNA expression patterns in lungs of mice challenged with respiratory syncytial virus. J Immunol 1993;151:2032-40. Graham BS. Pathogenesis of respiratory syncytial virus vaccine-augmented pathology. Am J Respir Crit Care Med 1995;152:S63-6. Roman M , Calhoun WJ, Hinton KL, Avendano LF, Simon V, Escobar A M , Gaggero A, Diaz PV. Respiratory syncytial virus infection in infants is associated with predominant Th-2-like response. Am J Respir Crit Care Med 1997; 156:190-5.  74  71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93.  van Schaik SM, Tristram DA, Nagpal IS, Hintz K M , Welliver RC II, Welliver RC. Increased production of IFN-gamma and cysteinyl leukotrienes in virus-induced wheezing. J Allergy Clin Immunol 1999;103:630-6. Kim CK, Kim SW, Park CS, Kim BI, Kang H, Koh Y Y . Bronchoalveolar lavage cytokine profiles in acute asthma and acute bronchiolitis. J Allergy Clin Immonol 2003; 112:64-71. Sorkness R, Lemanske RF Jr, Castleman WL. Persistent airway hyperresponsiveness after neonatal viral bronchiolitis in rats. J Appl Physiol 1991; 70:375-83. Schwartze J, Hamelmann E, Bradley KL, Takeda K, Gelfand EW. Respiratory syncytial virus infection results in airway hyperresponsiveness and enhanced airway sensitization to allergen. J Clin Invest 1997; 100:226-33. Dakhama A, Bramley A M , Chan NG, McKay KO, Schellenberg RR, Hegele RG. Effects of respiratory syncytial virus on subsequent allergic sensitization to ovalbumin in guinea-pigs. Eur Respir J 1999;13:976-82. Bramley A M , Vitalis TZ, Wiggs BR, Hegele RG. Effects of respiratory syncytial virus persistence on airway responsiveness and inflammation in guinea pigs. Eur Respir J 1999;14:1061-67. Martinez FD. Role of viral infections in the inception of asthma and allergies during childhood: could they be protective? Thorax 1994;49:1189-91. Landau LI. Bronchiolitis and asthma: are they related/ Thorax 1994;49:293-6. Shaheen SO. Changing patterns of childhood infection and the rise in allergic disease. Clin Exp Allergy 1995;25:1034-7. Ball TM, Castro-Rodriguez JA, Griffith KA, Holberg CJ, Martinez FD, Wright AL. Siblings, daycare, attendance, and the risk of asthma and wheezing during childhood. N Eng J Med 2000;343:538-43. Osur SL. Viral respiratory infections in association with asthma and sinusitis: a review. Ann Allergy Asthma Immunol 2002;89:553-60. Byrd LG, Prince GA. Animal models of respiratory syncytial virus infection. Clin Infect Dis 1997;25:1363-8. Graham BC, Perkins MD, Wright PF, Karzon DT. Primary respiratory virus infection in mice. J Med Virol 1988;26:153-62. Prince GA, Jenson AB, Horswood RL, Camargo E, Chanock R M . The pathogenesis of respiratory syncytial virus infection in cotton rats. Am J Pathol 1978;93:771-91. Mills J, van Kirk JE, Wright PF, Chanock RM. Experimental respiratory syncytial virus infection in adults. J Immunol 1971;107:123-30. Prince GA, Horswood RL, Berndt JA, Suffin SC, Chanock RM. Respiratory syncytial virus infection in inbred mice. Infect Immun 1979;26:764-6. Hegele RG, Robinson PJ, Gonzalez S, Hogg JC. Production of acute bronchiolitis in guinea-pigs by human respiratory syncytial virus. Eur Respir J 1993;6:1324-31. Hegele RG, Hayashi S, Bramley A M , Hogg JC. Persistence of respiratory syncytial virus genome and protein after acute bronchiolitis in guinea pigs. Chest 1994;105:1848-54. Riedel F, Obersieck B, Streckert H-J, Philippou S, Krusat T, Marek W. Persistence of airway hyperresponsiveness and viral antigen following respiratory syncytial virus bronchiolitis in young guinea-pigs. Eur Respir J 1997;10:639-45. Dakhama A, Vitalis TZ, Hegele RG. Persistence of respiratory syncytial virus (RSV) infection and development of RSV-specific IgGi response in guinea-pig model of acute bronchiolitis. Eur Respir J 1997;10:20-6. Wright JL, Churg A. A model of tobacco smoke-induced airflow obstruction in guinea pig. Chest 2002;121:188S-191S. Hegele RG, Robinson PJ, Hogg JC. Age susceptibility of guinea pigs to acute bronchiolitis induced by human respiratory syncytial virus. Am Rev Respir Dis 1992;145:A434 (Abstract). Ishida K, Kelly LJ, Thomson RJ, Beattle LL, Schellenberg RR. Repeated antigen challenge induces airway hyperresponsiveness with tissue eosinophilia in guinea pigs. J Appl Physiol 1989;67:1133-9. 75  94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113.  Al-laith M , Weyer A, Havet N , Dumarey C, Vargaftig BB, Bachelet M . Immunoglobulin-Gdependent stimulation of guinea pig lung mast cell and macrophages. Allergy 1993;48:608-14. Leibovitz E, Freihorst J, Piedra PA, Ogra PL. Modulation of systemic and mucosal immune responses to inhaled ragweed antigen in experimentally induced infection with respiratory syncytial virus: implication in viral allergy. Int Arch Allergy Appl Immunol 1988;86:112-6. Freihorst J, Piedra PA, Okamoto Y, Ogra PL. Effect of respiratory syncytial virus to infection on the uptake of and immune response to other inhaled antigens. Proc Soc Exp Bio Med 1988;188:191-7. Bramley A M , Khan M A , Manson HE, Hegele RG. Development of respiratory syncytial 'bronchiolitis' in guinea pigs does not reflect an allergic predisposition in the host. Chest 2003;124:671-81. Hegele RG, Bramley A M , Ashfaq MK, Manson HE. Effects of RSV dose on Thl/Th2 responses in guinea pigs: an opportunity for intervention. RSV 2003 symposium, Stone Mountain, GA, Nov 8-11, 2003 (Abstract, accepted). Hamid Q, Song Y, Kotsimbos TC, Minshall E, Bai TR, Hegele RG, Hogg JC. Inflammation of small airways in asthma. J Allergy Clin Immunol 1997;100:44-51. Shirota H, Sano K, Kikuchi T, Tamura G, and Shirato K. Regulation of T-helper type 2 cell and airway eosinophilia by transmucosal coadministration of antigen and oligodeoxynucleotides containing CpG motifs. Am J Respir Cell Mol Biol 2000;22:176-82. Bochner BS, Hamid Q, Advances in mechanisms of allergy. J Allergy Clin Immunol 2003;lll:S819-23. Wang SZ, Forsyth KD. Asthma and respiratory syncytial virus infection in infancy: is there a link? Clin Exp Allergy 1998;28:927-35. De Weerd W, Twilhaar WN, Kimpen JLL. T cell subset analysis in peripheral blood of children with RSV bronchiolitis. Scand J Infect Dis 1998;30:77-80. Hussell T, Openshaw PJM. Intracellular IFN-y expression in natural killer cells precedes lung CD8+ T cell recruitment during respiratory syncytial virus infection. J Gen Virol 1998;79:2593601. Robinson DS, Hamid Q, Ying S, Tsicopoulos A, Barkans J, Bentley A M , Corrigan C, Durham SR, Kay AB. Predominant Th2-like bronchoalveolar T-lymphocyte population in atopic asthma. N Eng J Med 1992;326:298-304. Shirakawa T, Enomoto T, Shimazu S, Hopkin JM. The inverse association between tuberculin responses and atopic disorder. Science 1997;257:77-9. Erb KJ, Wohlleben G. Novel vaccines protecting against the development of allergic disorders: a double-edged sword? Curr Opin Immunol 2002; 14:633^13 Krieg A M . An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J Lab Clin Med 1996;128:128-33. Krieg A M , Love-Homan L, Yi AK, Harty JT. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J Immunol 1998;161:2428-34. Elkins KL, Rhinehart-Jones TR, Stibitz S, Conover JS, Klinman DM. Bacterial DNA containing CpG motifs stimulates lymphocyte-dependent protection of mice against lethal infection with intracellular bacteria. J Immunol 1999;162:2291-98. Gramzinski RA, Doolan DL, Sedegah M , Davis HL, Krieg A M , Hoffman SL. Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice. Infect Immun 2001;69:1643-9 Zimmermann S, Egeter O, Hausmann S, Lipford GB. Rocken M , Wagner H, Heeg K. CpG oligodeoxynucleotides trigger protective and curative Thl responses in lethal murine Leishmaniasis. J Immunol 1998;160:3627-30. Mutwiri G, Pontarollo R, Babiuk S, Griebel P, van Drunen Little-van den Hurk S, Mena A, Tsang C, Alcon V, Nichani A, Ioannou X, Gomis S, Townsend H, Hecker R, Potter A, Babiuk LA. Biological activity of immunostimulatory CpG DNA motifs in domestic animals. Vet Immunol Immunopathol 2003;91:89-103.  76  114. 115. 116. 117. 118. 119. 120. 121.  122. 123. 124. 125.  Harandi A M , Eriksson K, Holmgren J. A protective role of locally administered immunostimulatory CpG oligodeoxynucleotide in a mouse model of genital herpes infection. J Virol 2003;77:953-62. Klinman DM, Conover J, Coban C. Repeated administration of synthetic oligodeoxynucleotides expressing CpG motifs provides long-term protection against bacterial infection. Infect Immun 1999;67:5658-63. Horner AH, Van Uden JH, Zubeldia JM, Broide D, Raz E. DNA-based immunotherapeutics for treatment of allergic disease. Immunol Rev 2001;179:102-18. Weiner GJ. The immunobiology and clinical potential of immunostimulatory CpG oligodeoxynucleotides. J Leukoc Biol 2000;68:455-63. McCluskie MJ, Weeratna RD, Krieg A M , Davis HL. CpG DNA is an effective oral adjuvant to protein antigens in mice. Vaccine 2001;19:950-7. Estes DM, Brown WC. Type 1 and type 2 responses in regulation of lg isotope expression in cattle. Vet Immunol Immunopathol 2002;90:1-10. Rankin R, Pontarollo R, Ioannou X , Krieg A M , Hecker R, Babiuk LA, Van Drunen Little-van Den Hurk S. CpG motif identification for veterinary and laboratory species demonstrates that sequence recognition is highly conserved. Antisense Nucleic Acid Drug Dev 2001 ;11:333-40. Tighe H, Takabayashi K, Schwartz D, Van Nest G, Tuck S, Eiden JJ, Kagey-Sobotka A, Creticos PS, Lichtenstein L M , Spiegelberg HL, Raz E. Conjugation of immunostimulatory DNA to the short ragweed allergen Amb a 1 enhances its immunogenicity and reduces its allergenicity. J Allergy Clin Immunol 2000; 106:124-34. Shirota H, Sano K, Hirasawa N, Terui T, Ohuchi K, Hattori T, Shirato K, Tamura G. Novel roles of CpG oligodeoxynucleotides as a leader for the sampling and presentation of CpG-tagged antigen by dendritic cells. J Immunol 2001;167:66-74. Hancock GE, Heers K M , Smith JD, Scheuer CA, Ibraghimov AR, Pryharski KS. CpG containing oligodeoxynuleotides are potent adjuvant for parenteral vaccination with the fusion (F) protein of respiratory syncytial virus (RSV). Vaccine 2001;19:4874-82. Mendenhall W. Introduction to Probability and Statistics, 5 ed. North Scituate, MA: Duxbury Press, 1979. Barker K. DNA RNA and protein. In: At the Bench. A Laboratory Navigator. Woodbury, NY: Cold Spring Harbor Laboratory Press, 1998. th  77  Appendix Equation 1 [125]: R N A Concentration (jug I mL) = (OD 260) x Dilution Factor x  40jUg DNAJmL  1 OD unit 260  Equation 2 [125]: D N A Concentration (jug I mL) = (OD 260) x Dilution Factor x  DNA/raZ, 1 OD unit 260  Equation 3 (Quanti Tect S Y B R Green P C R Handbook, Qiagen, Corp): (•X gl,*. D N A £ _ _  p  r  o  d  u  c  (  ^  ^  b  a  s  e  p a j r s x 6 6 0 ]  78  ) x 6 . 0 2 3 x l 0 - = Y molecules/^  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091133/manifest

Comment

Related Items