UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of allelic loss on chromosomes 8q and 13q in oral premalignancies and tumors Xie, Liying 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-0454.pdf [ 5.12MB ]
Metadata
JSON: 831-1.0091005.json
JSON-LD: 831-1.0091005-ld.json
RDF/XML (Pretty): 831-1.0091005-rdf.xml
RDF/JSON: 831-1.0091005-rdf.json
Turtle: 831-1.0091005-turtle.txt
N-Triples: 831-1.0091005-rdf-ntriples.txt
Original Record: 831-1.0091005-source.json
Full Text
831-1.0091005-fulltext.txt
Citation
831-1.0091005.ris

Full Text

Identification of Allelic Loss on Chromosomes 8q and 13q in Oral Premalignancies and Tumors by Liying Xie B.Sc., Xiamen University, 1986 M.Sc, Shanghai Second Medical University, 1992 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Oral Biological and Medical Science) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA July 2003 © Liying Xie, 2003 In p resen t ing th is thesis in part ial fu l f i lment o f t h e r e q u i r e m e n t s f o r an advanced d e g r e e at t h e Universi ty o f Brit ish C o l u m b i a , I agree that t h e Library shall m a k e it f ree ly available f o r re ference and s tudy. I f u r the r agree that pe rm iss ion f o r ex tens ive c o p y i n g o f this thesis f o r scholar ly pu rposes may b e g ran ted b y t h e head o f m y d e p a r t m e n t o r b y his o r her representat ives. It is u n d e r s t o o d that c o p y i n g o r pub l i ca t i on o f this thesis fo r f inancial gain shall n o t be a l l o w e d w i t h o u t m y w r i t t e n pe rmiss ion . D e p a r t m e n t The Univers i ty o f British C o l u m b i a Vancouver , Canada Date DE-6 (2/88) ABSTRACT Oral squamous cell carcinoma (SCC) is believed to progress through sequential stages of premalignancies to invasive cancer. Once cancer is formed, the prognosis is poor and the 5-year survival rate is less than 50%. It is important to develop new strategies to improve diagnosis in early stages and to obtain information on the molecular mechanisms underlying carcinogenesis. It is now widely accepted that cancer development is underlined with the accumulation of changes to the critical control genes. Analysis of lesions at different stages of carcinogenesis may help to define the genetic changes associated with these stages during the development and progression of oral SCC. Microsatellite analysis of loss of heterozygosity (LOH) has been shown to be a powerful molecular approach to detect loss of tumor suppressor genes (TSGs) in many organs and systems, including oral cancer and premalignant lesions. The first objective of this thesis was to fine map one region of deletion at 13ql4.11 that was previously identified by RAPD (random amplified polymorphic DNA), in search of novel regions (minimal region of alteration, MRA) containing tumor genes. Two other MRAs have been identified by other people in the research group at 8q22 (D8S545 and D8S1830). The second objective was to investigate the temporal changes of the 3 new hotspots (one to be identified at 13ql4.11 by this study and 2 at 8q22, D8S545 and D8S1830) during oral carcinogenesis, and compare this data with known regions of losses at chromosomes 3p, 9p, and 17p. The latter represent frequent early changes in this disease. DNA microdissected from 58 dysplasias and 40 SCCs were studied by microsatellite analysis for LOH. ii For fine mapping at 13ql4.11, 3 primers were used: D13S1297 within 13ql4.11, D13S263 (1.6 Mbp centromeric to D13S1297) and D13S1227 (0.3 Mbp telomeric to D13S1297). Sixteen tumors showed LOH at D13S1297. A centromeric boundary at D13S263 was observed in 6 of the 16 tumors and a telomeric boundary at D13S1227 in 4 of the 16 tumors. Similar results were found in dysplasias. Thirteen dysplasias showed LOH at D13S1297. A centromeric boundary at D13S263 was observed in 7 of the 13 dysplasias and a telomeric boundary at D13S1227 in 6 of the 13 dysplasias. The results suggest presence of a 1.9 Mb MRA spanning between D13S263 and D13S1227. For temporal changes, LOH at D13S1297 (13ql4.11) was present in 23% low-grade dysplasia, increasing in frequency with progression to high-grade dysplasia (58%) then plateauing in tumors (57%). Such high frequency of LOH at D13S1297 during oral carcinogenesis again supports the presence of tumor gene(s) at the newly identified MRA at D13S1297. Using the above results, another graduate student in the research group has gone further with the experiment and demonstrated that AKAP220, a gene located within the 1.9 Mb MRA, was overexpressed in oral SCCs. Our research group is the first to associate AKAP220 with tumorigenesis. High frequency of LOH was also noted in the other two new hotspots at 8q22 during the multistage oral carcinogenesis. LOH at D8S1830 was noted in 22 of the 38 (58%) informative low-grade dysplasias, 4 of 12 (33%) high-grade dysplasias, and 13 of 31 (42%) SCCs. LOH at D8S545 was noted to increase with progression of the lesions: in 4 of the 22 (18%) informative low-grade dysplasias, 3 of 12 (25%) high-grade dysplasias, and 11 of 26 (42%) SCCs. ) In summary, this thesis has identified a new hotspot at 13ql4.11 (D13S1297) and LOH analysis of different stages of oral lesions supported the presence of the new hotspot. A novel gene, AKAP220 has been identified within this region subsequent to this thesis (and based on its results). In addition, high frequency of LOH was also noted for the other two new hotspots at 8q22 and further studies are needed to identify the tumor genes within the regions. iv TABLE OF CONTENTS TABLE OF CONTENTS V LIST OF TABLES. ..VIII LIST OF FIGURES IX LIST OF ABBREVIATIONS X DEDICATION XII ACKNOWLEDGEMENTS XIII I. INTRODUCTION.... 1 1.1. O V E R V I E W 1 1.2. IMPORTANCE OF STUDYING ORAL PREMALIGNANT LESIONS 3 1.3. ETIOLOGIES FOR ORAL CANCER 4 1.4. O R A L MUCOSA 6 1.5. O R A L PREMALIGNANT LESIONS A N D THE HISTOLOGICAL PROGRESSION M O D E L 7 1.6. T U M O R GENES A N D CANCER DEVELOPMENT 10 1.7. Loss OF HETEROZYGOSITY (LOH) A N D MICROSATELLITE ANALYSIS 13 1.7.1. LOH in oral and head & neck premalignant lesions 16 1.7.2. A molecular progression model for oral SCC 18 1.7.3. LOH analysis and prediction of cancer risk for oral premalignant. 19 1.8. R A N D O M AMPLIFIED POLYMORPHIC DNA PCR (RAPD-PCR) A N D GENOME SCANNING FOR N O V E L REGIONS OF GENETIC INSTABILITY IN HNSCC 21 1.9. GENETIC ALTERATIONS ON CHROMOSOME 8Q 22 1.9.1. Genetic changes of 8q (8q22) in a variety of cancer 22 1.9.2. Genetic changes of 8q (8q22) in head and neck cancer 26 1.9.3. Genetic changes of 8q (8q22) inpremalignancies 29 1.9.4. Main genes on chromosome 8q 29 c-myc gene 3 0 T-STARgene 3 0 1.10. GENETIC ALTERATIONS ON CHROMOSOME 13Q 31 1.10.1. Genetic alterations of 13q (13ql4) in a variety of cancers 31 1.10.2. Genetic alterations of 13q (13ql4) in head and neck cancer 40 1.10.3. Genetic changes of 13ql4 in premalignancies 44 1.10.4. Main genes at chromosome 13q 45 RBI gene 45 BRCA2 gene 4 6 ING1 gene 47 Leul and Leu2 gene 47 AP-2rep gene 48 II. STATEMENT OF THE PROBLEMS 49 v II. 1. W H E R E ARE THE ADDITIONAL TUMOR GENES AT 1 3Q 14.11 L O C A T E D ? 49 II.2. A T WHAT STAGES OF ORAL CANCER DEVELOPMENT DO ALTERATIONS AT 13Q14.11 A N D 8Q22 OCCUR? 50 I I I . O B J E C T I V E S 53 I V . H Y P O T H E S I S 54 V . M A T E R I A L S A N D M E T H O D S 55 V . 1. S A M P L E SOURCES 55 V . 2 . S A M P L E SETS 55 V . 3 . CRITERIA FOR SAMPLE SELECTION 56 V.S.I. Histological diagnosis 56 V.3.2. Sample size 56 V.3.3. History of cancer 56 V.4 . C L I N I C A L INFORMATION 57 V . 5 . SLIDE PREPARATION 57 V . 6 . MICRODISSECTION 58 V . 7 . S A M P L E DIGESTION A N D D N A EXTRACTION 58 V . 8 . D N A QUANTITATION 59 V . 9 . PRIMERS 59 V.9.1. Primers for fine mapping 59 V. 9.2. Primers for LOH analysis of different stages of oral lesions 61 V. 10. PRIMER EXTENSION PREAMPLIFICATION ( P E P ) 61 V . l l . E N D - L A B E L I N G 62 V. 12. P C R AMPLIFICATION A N D L O H ANALYSIS ..' 62 V. 13. SCORING OF A L L E L I C LOSS 63 V I . R E S U L T S 65 VI. l . R E S U L T S O N 13Q14.11 65 VI. 1.1. Minimal region of alteration at D13S1297 65 VI. 1.2. Frequency of LOH at D13S1297 in oral premalignant and malignant lesions 70 VI.l.3. Comparison ofLOHatD13S1297 (13ql4.11) with LOHatD13S170 (13q31) in oral premalignancies and tumors 71 VI.2. RESULTS ON 8Q22 73 VI.l.2. Frequency ofLOHatD8S545 and D8S1830 in oral premalignant and malignant lesions 74 VI.3. COMPARISON OF L O H AT 13Q14.1 1 (D13S1297) A N D AT 8Q22 (D8S545 A N D D8S1830) WITH L O H AT 3P14, 9P21 A N D 17P1 1-13 IN ORAL PREMALIGNANCIES A N D TUMORS75 V I I . D I S C U S S I O N 79 VII . l . 13Q14.11 (D13S1297) 79 VII. 1.1. Temporal changes at D13S1297 80 VII. 1.2. LOH at D13S1297 occurred independently of LOH atD13S170 81 VIII. 3. D13S1297, a new hot spot at 13q 14.11 81 VII. 1.4. D13S1297 andAKAP220 gene 82 VII.2. 8Q22 (D8S545 A N D D8S1830) 86 VII.3. S U M M A R Y A N D FUTURE WORK 88 vi VIII. R E F E R E N C E S 90 vii LIST OF TABLES Table 1. L O H frequencies (%) in oral premalignant lesions 17 Table 2. L O H frequencies (%) in head and neck premalignant lesions 18 Table 3. Genetic changes in different cancer on chromosome 8q (8q22) 23 Table 4. Genetic alterations in head and neck cancer on chromosome 8q (8q22) 27 Table 5. Genetic alterations in different cancer on chromosome 13q (13ql4) 32 Table 6. Deletion of 13q (13q) in head and neck cancer 41 Table 7. Types of premalignancies and SCC used in this study 55 Table 8. Primers used on chromosome 8q22 60 Table 9. Primers used on chromosome 13ql4.11 61 Table 10. Microsatellite mapping of chromosome arm 13ql4.11 in SCC cases 67 Table 11. Microsatellite mapping of chromosome arm 13ql4.11 in dysplasia cases 70 Table 12. L O H at D13S1297 in a spectrum of primary oral premalignant and malignant lesions 71 Table 13. Comparison of L O H MD13S1297 (UqU.U) with L O H atD13S170 (13q31) .73 Table 14. L O H at D13S1297 and D13S170: frequencies at which these alterations occur together or independent of each other 73 Table 15. L O H at D8S545 and D8S1830 in a spectrum of primary oral premalignant and malignant lesions 75 Table 16. Comparison of L O H at 13ql4.11 (D13S1297) and 8q22 (D8S545 and D8S1830) with L O H at 3pl4, 9p21 and 17pll-13 77 LIST OF FIGURES Figure 1. Histological progression model of oral premalignant and malignant lesions 10 Figure 2. Genetic pathway of carcinogenesis 13 Figure 3. Molecular model proposed for tumorigenesis in head and neck SCC 19 Figure 4. Examples of allelic loss and retention in the MRA 68 Figure 5. Comparison of AI of 13ql4.11 and 8q22 with other chromosome arms 78 Figure 6. Physical map between D13S220 and D13S170 on 13q 84 Figure 7. A schematic diagram summarizing the role of AKAP220 in cell cycle regulation.86 ix LIST OF ABBREVIATIONS AI allelic imbalance AKAP220 A-kinase anchoring protein 220 APC adenomatous polyposis coli ATM ataxia telangiectasia mutated BRCA1 breast cancer 2 CIS carcinoma in situ CCND1 cyclin DI C G H comparative genomic hybridization D N A deoxyribonucleic acid erbB-1 epidermal growth factor receptor FISH fluorescence in situ hybridization H & E hematoxylin and eosin HNSCC head and neck squamous cell carcinoma HPV human papillomavirus Leul leukemia-associated gene 1 L O H loss of heterozygosity LSC laser scanning cytometry Mbp megabase pair MEN1 multiple endocrine neoplasia type 1 mFISH multicolor fluorescence in situ hybridization MI microsatellite instability MRA minimal region of alteration NBCCS nevoid basal cell carcinoma syndrome NF1 neurofibromatosis type I o scc oral squamous cell carcinoma PCR polymerase chain reaction RANKL receptor activator of NK-kappa-B ligand RAPD random amplified polymorphic DNA RB retinoblastoma RFLP restriction frequents length polymorphism PP1 protein phophatase SBA southern blot analyses SCCHN squamous cell carcinoma of head and neck SMAL scanning microdissected archival lesions STAR signal transduction and activation of RNA TSG tumor suppressor gene UCSC University of California Santa Cruz WHO World Health Organization DEDICATION To My Parents ACKNOWLEDGEMENTS I am extremely grateful to my supervisors Dr. Lewei Zhang and Dr. Miriam Rosin for their support and direction through the project. It would have been very difficult for me to complete this challenging work without their valuable instruction and constant encouragement. I also appreciate the participation of Dr. Lari Hakkinen as a member of my supervisory committee. I would also like to take this opportunity to thank all the members of Dr. Rosin and Dr. Zhang's laboratory over the past three years. Finally, I'd like to thank my family. This thesis could not have been completed without their support and understanding. xiii I. Introduction 1.1. Overview Head and neck squamous cell carcinoma (HNSCC) is believed to progress from sequential stages of premalignant lesions from hyperplasia to dysplasia (mild, moderate and severe) to carcinoma in situ (CIS) and finally to invasive SCC. It is the sixth most common cancer worldwide and the incidence of head and neck cancer is increasing in developing countries (Macfarlane et al., 1994; Parkin et al., 1993). It is a disease associated with major morbidity and mortality. The overall 5-year survival rate for patients with HNSCC is among the lowest of the major cancers and remains at about 50%. It has not improved dramatically during the last 3 decades (Raybaud-Diogene et al, 1996; Partridge et al., 1998; Tabor et ai, 2001; Crowe et al, 2002). The understanding of the early stages of oral carcinogenesis is one key to improve the dismal prognosis. However, few of the genetic alterations underlying the early stages of the process have been identified, mainly due to the difficulty of molecular analysis of minute-sized early stage lesions. Accumulation of genetic alterations to critical control genes, e.g., tumor suppressor gene (TSG) and oncogenes, are believed to underline the development of neoplasms. Few oncogenes have been identified in head and neck cancers. However, abnormalities in the expression of several genes, such as oncogenes c-mys, erbB-1, ras, and cyclin DI have been reported, mainly in immunohistochemical studies (Zhang and Rosin, 2001). On the other hand, reports of mutation of TSGs in head and neck SCCs are numerous, indicating important 1 roles of these genes in the development of head and neck SCC. Some of the TSGs involved in head and neck cancers include p53, Rb (retinoblastoma), andpl6INK4A (Gleich et al 1996; Liggett et al, 1996; Pavelic and Gluckman, 1997; Papadimitrakopoulou et al, 1997b; Partridge et al, 1998 and 1999a; Gallo et al 1999; Jares et al, 1999; Reed et al 1996; Sartor et al, 1999). Microsatellite analysis of loss of chromosome regions (loss of heterozygosity, LOH) that map close to or within putative or known TSGs has been the most frequently used approach to assess loss of putative or known TSGs. Information obtained from LOH studies has dual merit. The finding of frequently lost regions during cancer development can lead to discovery of new TSGs. Such was the case for several important TSGs: Rb, MEN1, APC, NFI, NFII, and BRCA2 (Ah-See et al, 1994; Fearon E. 1997). LOH analysis can also be used to obtain critical information on the role of the presumptive TSGs in cancer development, even prior to the identification of the actual TSG (Field et al, 1995; Califano et al, 1996; Zhang et al, 1997; Partridge et al, 1999b). There have been continuing identifications of new TSGs through this approach. However, the technique of LOH has its limitations. It is not a high-throughput technique for genomic wide scan of new genes and the analysis is only aimed at known hot spots. On the other hand, the random amplified polymorphic DNA (RAPD) fingerprinting assay is a high-resolution technique that could scan the whole genome randomly by simultaneously monitoring multiple loci. Once a chromosomal region using RAPD has been identified as a target of deletion, the region of loss could then be narrowed by LOH analysis. 2 In this thesis, one region of deletion, between D13S263 and D13S1227 at 13ql4.11 as identified by RAPD, was fine mapped by LOH in search for novel regions (minimal region of alteration, MRA) containing TSGs. Two other MRAs have been identified by other people in the research group at 8q22 (D8S545 and D8S1830). This thesis investigated the loss of these new regions in different degree of oral dysplasias and oral cancer, and compared their loss with known regions of losses at chromosomes 3p, 9p, and 17p. The following literature review provides introduction of oral lesion, its histological alteration, and cancer development. A summary of genetic alterations on chromosome arms 8q and 13q are given followed by in different cancer as well as HNSCC. 1.2. Importance of studying oral premalignant lesions Oral cancer is the sixth commonest cancer throughout the world, particularly in some developing countries, such as India, Sri Lanka, Vietnam, Philippines, and parts of Brazil, where up to 40% of all cancers are oral cancer (Parkin et al, 1988; Magrath & Litvakk, 1993). In recent decades, oral cancer incidence and mortality rates have been increasing in the Unite States, Japan, Germany, and China (Ishwad et al, 1996). In the United States, approximately 42,000 new cases of head and neck cancer occur annually and result in 12,000 deaths (Tanaka, 1995). On average, 4600 new cases occur annually in Canada (BCCA, 1996). Once invasive cancer is formed, the prognosis is poor, with 5- year survival rates of about 40-50% in the Western world and even lower in India (20-43%)(Rao & Krishnamurthy, 3 1998; Greenlee et al, 2001). Early diagnosis and treatment still offers the best chance of cure for cancers. This has resulted in a recent emphasis on the study of early phases of carcinogenesis (premalignant lesions), and an increased awareness of the importance of screening and management of the carcinogenesis process at early stages. According to the World Health Organization (1978), premalignant lesions are defined as morphologically altered areas of a tissue in which cancer is more likely to occur than in its apparently normal counterpart. In the oral cavity, most premalignancy occurs in the form of a white patch, leukoplakia, which is defined as "a predominantly white lesion of the oral mucosa that cannot be characterized as any other definable lesion" (Banoczy & Sugar 1972; WHO, 1978; Pindborg et ah, 1997). As implied in the definition of the premalignancy, these lesions have increased likelihood of cancer risk; however, only a small percentage of premalignant lesions progress into cancer. 1.3. Etiologies for oral cancer It is generally accepted that oral SCC has a multifaceted etiology and that it involves a combination of environmental and genetic risk factors. A number of epidemiological factors have been identified which recognizes individuals that have a high risk of developing squamous cell carcinoma of head and neck. Most of these malignancies are caused by tobacco and alcohol use. In some developing countries, tobacco and betel quid chewing, usually mixed with other toxins such as slaked lime, are the common causative agents for most of the oral cancers. Tobacco, either smoked or chewed, causes more than 75% of all oral cancer in the 4 world. Tobacco contains numerous carcinogens, such as aromatic hydrocarbons and nitrosamines. Chemical analysis reveals that smoke from a single cigarette is composed of over 4,000 different constituents, including some that are pharmacologically active, toxic, mutagenic, or carcinogenic. Most studies suggest that alcohol acts as a co-carcinogen or a promoter rather than by directly inducing DNA damage. Many of the numerous alterations to the body that result from chronic alcohol usage would be consistent with such a role. Whatever the mechanism involved, there is no doubt that the combined usage of tobacco products and alcohol markedly increases the risk of cancer development (Spitz, 1994; Andre et al, 1995; Ng et al, 1993). This increase may be by as much as 50% to 100% over the rates observed in non-drinking smokers or non-smoking drinkers (Newcomb & Carbone, 1992). The causes of oral SCC have not been fully elucidated, although the roles of tobacco and alcohol as etiologies of oral SCC have been firmly established. Microorganisms, particularly oncogenic viruses such as human papillomavirus (HPV), have been suspected of playing a role in oral cancer development. A recent study with a large number of fresh head and neck SCC from an esteemed research laboratory (Sidransky's group) in Johns Hopkins hospital investigated HPV infection in oropharyngeal and oral SCC. While a low rate (12%) of HPV was found in oral SCC, a high rate (90%) was found for oropharyngeal SCC (Gillison et al, 2000). 5 For any given level of exposure to carcinogens, only a proportion of exposed individuals will develop cancer. This suggests that some individuals are resistant to the exposure. The area of genetic susceptibility to cancer is a newly developing field. However, it is likely individual susceptibility to carcinogen exposure plays a major role in cancer development including oral cancers. 1.4. Oral mucosa Oral mucosa that lines the oral cavity consists of overlying epithelium and underlying connective tissue (Bhaskar, 1986). There is a physical barrier, which is called the basement membrane that separates the overlying epithelium from underlying connective tissue. The epithelial tissues are stratified squamous epithelium composed mainly of basal and prickle cells. When a basal cell divides, it may give rise to new basal cells or differentiate to form the larger polyhedral shaped prickle cells. As the prickle cells mature, they push towards the surface where they shrink in size, become long and flat, and are eventually desquamated. Like many other parts of the body with mucosa lining such as esophagus and cervix, the majority of the oral cavity lining is not keratinized. However, some oral epithelium regions susceptible to mechanical forces such as gingiva and hard plate are covered with keratin and are referred to as masticatory mucosa (Wertz et al, 1993). This mucosa serves as a very effective mechanical and permeability barrier. The dorsum of the tongue is composed of a specialized epithelium, that is a mixture of both non4ieratinized and keratinized tissues which 6 are attached tightly to the underlying tongue muscle (Wertz et al, 1993). The non-keratinized oral regions such as buccal and the floor of the mouth are more flexible, thus accommodating the actions of chewing and speaking (Wertz et al, 1993). Over 90% of oral malignancies develop from this stratified squamous epithelial tissue, hence giving rise to the name, Squamous Cell Carcinoma (SCC). The connective tissue or stroma contains blood and lymphatic vessel, small nerves, fibroblasts, collagen, and elastic fibers. The basement membrane separates the overlying epithelium from the underlying connective tissue. The connective tissue supports the epithelium and binds it to neighboring structures. 1.5. Oral premalignant lesions and the histological progression model According to the World Health Organization (WHO, 1978), a premalignant lesion is "a morphologically altered tissue in which cancer is more likely to occur than in its apparently normal counterpart". Clinically, most oral premalignant lesions present as leukoplakia and occasionally as erythroplakia. As the majority of oral premalignant lesions present clinically as leukoplakia, the terms leukoplakia and oral premalignant lesion have been used frequently interchangeably. Leukoplakia is defined clinically as a white patch or plaque of the mucosa, which is not removed by rubbing and not classifiable as any other oral disease, and has increased cancer risk 7 (WHO, 1978). Microscopically, leukoplakia demonstrates hyperkeratosis (thickening of keratin layer) and/or acanthosis (thickening of the prickle cells) with or without epithelial dysplasia. Leukoplakia from the floor of mouth, ventrolateral surface of the tongue and soft palate complex hold an increased risk for dysplasia and squamous cell carcinoma, and these sites are called high-risk regions. Erythroplakia is a lesion of the oral mucosa that presents as bright red, velvety plaques, which cannot be characterized clinically or pathologically as being due to any other condition. This type of lesions is generally considered to be of higher risk for malignant transformation than leukoplakia as a large percentage of these lesions are histological high-grade dysplasia and in fact some of them represent squamous cell carcinoma (Summerlin, 1996). The majority of oral premalignant lesions do not progress into cancer (Banoczy and Surgar, 1972; WHO, 1978; Silverman et al, 1984; Lumerman et al, 1995; Papadimitrakopoulou and Hong, 1997a). To assess the risk of malignant transformation of leukoplakia or erythroplakia, the current gold standard is to take a biopsy of the clinical lesion and evaluate the presence and degree of dysplasia histological (Shin et al., 1993; Riddell, 1996). The term dysplasia refers to the classical cytological and histological changes in intraepithelial lesions that are historically associated with an increased risk for cancer. The World Health Organization (1978) has established the criteria for histological diagnosis of oral dysplasia. They are: 1) loss of basal cell polarity, 2) more than 1 layer of basaloid cells, 3) increased nuclear to cytoplasmic ratio, 4) drop-shaped rate ridges, 5) irregular stratification, 6) 8 increased and abnormal mitoses, 7) mitotic figures in the superficial half of the epithelium, 8) cellular pleomorphism (variation in shape and size), 9) nuclear hyperchromatism (dark staining nuclei), 10) enlarged nucleoli, 11) reduction of cellular cohesion, 12) keratinization of single cells or cell groups in the spinouts cell layer. There are several kinds of dysplasia: mild, moderate, severe, and carcinoma in situ (CIS) depending upon how much of the epithelial layers is dysplasia. The earliest lesions are called mild dysplasia in which the dysplastic cells are confined to the basal and parabasal layers. In the moderate dysplasia, dysplastic changes involve the lower half-thickness of the epithelium. With severe dysplasia, dysplastic changes are pronounced and involve most of the epithelial thickness. When the dysplastic cells occupy the entire thickness of epithelium (bottom to top changes), but the basement membrane is still intact, the lesion is diagnosed as carcinoma in situ. A l l these lesions are preinvasive. When the dysplastic cells break through the basement membrane and grow into the underlying stroma, the lesions are called invasive squamous cell carcinoma (SCC). Using these criteria, a histological progress model has been established for oral cavity (Fig. 1). Premalignant lesions are classified histological into categories with progressively increased risk of becoming invasive SCC: epithelial hyperplasia (without dysplasia), mild, moderate and severe dysplasia, and carcinoma in situ (CIS). 9 Figure 1. Histological progression model of oral premalignant and malignant lesions CIS sec 1.6. Tumor genes and cancer development Normal cellular growth is a delicate balance between cellular proliferation and cell death. This homeostasis is controlled by genes (Gollin, 2001). Cancer is a disruption in this homeostasis, resulting in an imbalance favoring cellular proliferation over cell death. These genetic alterations include activation of proto-oncogenes and inactivation of tumor suppressor genes (TSGs). Tumors develop as a result of deregulation of multiple cancer-related genes. Alteration of three to six genes is thought to be necessary for tumor development. Oncogenes are derived by the mutation of normal cellular genes termed proto-oncogenes. These genes are dominant-acting cellular genes normally involved in the processes of cellular growth and proliferation. A 10 number of mechanisms have been described in activating these proto-oncogenes including point mutations, gene amplification and chromosome translocation. When one copy of an oncogene is mutated or otherwise deregulated, it functions in a manner similar to a "stuck accelerator pedal", resulting in uncontrolled cellular proliferation. Approximately 50 different oncogenes have been identified. Most of them code for proteins that function as growth factors, growth factor receptors, cytoplasmic second messengers, and regulation of gene transcription. As mentioned before, although abnormalities in the expression of oncogenes have been reported in the head and neck cancers, such as those of ras, myc, erbB-l (epidermal growth factor receptor), erbB-2, bcl-1, CCND1 and int-2/cyclin-Dl (Kiaris et al, 1995; Lese et al, 1995; Saranath etal, 1993; Warnakulasuriya etal, 1992, Schwab 1999), few oncogenes have been identified in head and neck cancers. In contrast to oncogenes, tumor suppressor genes are recessive-acting "gatekeepers" of cellular proliferation; they may inhibit cell growth or promote cell death. Such genes are thought to encode proteins that negatively regulate cell growth and thus suppress tumorigenesis. In these terms tumor suppressor genes are critical targets affected by allelic loss. When both alleles of a tumor suppressor gene are mutated, lost, or otherwise inactivated in a somatic cell, it is as if the cell has "lost its brakes". Examples of such tumor suppressor genes altered in HNSCC are TP53, RBI, and CDKN2A (Kinzler & Vogelstein, 1997; Ransom etal., 1996; Sidransky, 1995). An addition family of genes critical to carcinogenesis is the DNA repair genes or "caretakers" of the genome. These genes, including ATM, MSH2, and MLH1, maintain the 11 "integrity" of the genome, playing key roles in DNA repair processes. Although one DNA repair defect, microsatellite instability, has been reported in SCCHN (Mao et al, 1994; Ishwad et al, 1995), the role of the various genome integrity genes in HNSCC has not yet been explored fully. The contemporary view of cancer is that a malignancy arises from the transformation of genetic material in a normal cell, followed by successive mutations, ultimately leading to the uncontrolled proliferation of progenitor cells (Bishop, 1991; Vogelstein, 1992). Ilyas et al (1996) summarized that for a normal cell to become malignant; it must acquire the stepwise accumulation of genetic changes and a minimum number of necessary mutations that help it to overcome growth controls. These mutations and the order of development of the mutation profile comprise the "genetic pathway" of carcinogenesis (Figure 2)(Ilyas & Tomlinson 1996). Among the events implicated in this process are point mutations, gene amplifications, or rearrangements leading to activation of protooncogenes, in addition to deletions, mitotic recombinations of nondisjunction events which cause functional loss of tumor suppressor genes (Lasko & Cavenee, 1989). Frequent loss of heterozygosity (LOH) involving a discrete chromosomal region is generally considered an indication of the presence of a tumor suppressor gene (TSG), whose loss/inactivation contributes to the development or progression of that tumor type (Weinberg, 1991). Detailed LOH analysis of polymorphic loci distributed along a chromosome can reveal a common minimal region of deletion where a putative TSG may reside. 12 Figure 2. Genetic pathway of carcinogenesis * (colored oval): mutation profile (the group of mutations which are essential for tumor development) ** (continuous circle): selected (a cell will undergo colonial expansion and outgrowth) *** (dashed circle): not selected (become apoptosis) 1.7. Loss of heterozygosity (LOH) and microsatellite analysis Characterization of the genetic events that occur during tumorigenesis has been facilitated through recent advances in the field of molecular genetics. Unveiling the human genome has revealed distinct areas that feature simple tandem bp repeats. These sequences, called microsatellite, are ubiquitous, and they can serve as markers to define the allelic status of a tumor at a variety of chromosomal positions. 13 The concept of LOH is consistent with Knudson's two-hit hypothesis. During the course of studying retinoblastoma, Knudson discovered that in order for tumorigenesis to occur, both alleles of some genes (later discovered to be tumor suppressor genes) had to be abrogated either by deletion or other means. In other words, they are recessive in nature (Knudson, 1971). Loss of heterozygosity is a concept used to describe the loss of one of the two alleles of a TSG, which has been reported to be associated with the development of cancer. The technique used to measure this is called the LOH assay. LOH is defined as a loss of genomic material (from a few thousand nucleotides to a whole chromosome) in one of a pair of chromosomes. The LOH assay is designed to assess polymorphic chromosomal regions that map close to or within putative or known recessive cancer-related genes. LOH analysis has been employed as a means of identifying critical loci containing TSGs and has subsequently led to the discovery of several important genes of this class, including the retinoblastoma (Rb) gene and the genes responsible for multiple endocrine neoplasia type 1 (MEN1), the nevoid basal cell carcinoma syndrome (NBCCS), adenomatous polyposis coli (APC), and neurofibromatosis type I and II (NF1 and NFII, respectively) (Ah-See et al, 1994 and Fearon, 1997). Two methods have been available for the study of LOH or allelic loss: the more classical approach of restriction frequents length polymorphism (RFLP) analysis, and the newer method of microsatellite analysis. This thesis employed microsatellite analysis for at least two reasons. First, microsatellite repeat markers are highly polymorphic and well' distributed 14 throughout the human genome. They show levels of heterozygosity between 30-80%, significantly above the level observed with the RFLP analysis based on base substitutions at endonuclease recognition sites. Second, this PCR-based approach is much more sensitive than the RFLP analysis and requires only small quantities of D N A (5 nanograms or less per reaction). For these reasons, the microsatellite analysis procedure has become the major tool for the majority of current L O H studies of oral premalignant lesions, which tend to be small as compared to oral SCCs. Microsatellites contain runs of short and tandemly iterated sequences of di, tri, or tetranucleotides, such as GTGTGT. . . or G T A G T A G T A . . . or G T A C G T A C G T A . . . . These short repetitive D N A sequences are called microsatellites. The number of such tandem repeats is found to be highly variable in the population, with a high probability of inheriting alleles with different lengths from both parents (i.e., heterozygous for the region). In addition, they are well inter-spersed throughout the human genome (e.g., estimated every 30-60 kb for C A repeats) and are highly conserved through successive generations (Ah-See et al, 1994). Testing of highly polymorphic microsatellite markers from a specific chromosomal region allows rapid assessment of allelic loss by comparing the alleles in tumor D N A to normal DNA. Therefore microsatellites are good way to research the TSGs either close to or within these chromosome spots. Loss of heterozygosity suggests that a putative tumor suppressor gene nearby may be also lost. 15 1.7.1. LOH in oral and head & neck premalignant lesions Since tumorigenesis is a sequential accumulation of genetic alterations, analysis of early and late stage lesions may define the genetic changes associated with the development and progression of HNSCC. However the study of oral premalignant lesions has been a difficult task compared to that of oral SCCs. The main difficulties lie in the fact that: 1) premalignant lesions are small and therefore it is extremely hard to obtain sufficient amount of DNA for molecular analysis, 2) big hospitals or research centers typically have better access to cancers rather than premalignant lesions, and 3) it is much harder to microdissect premalignant lesions compared to carcinomas. The limited number of studies on premalignant lesions either used only a small number of cases or primers, or did not correlate LOH with degree of dysplasia and mostly from high-grade dysplasias. Nonetheless, results from these studies clearly show that LOH is a frequent event in premalignant lesions (Tables 1 and 2; El-Naggar et al, 1995; Califano et al, 1996; Mao et al, 1996; Emilion et al, 1996; Roz et al, 1996). For example, a similar frequency of LOH at 9p was reported in preinvasive lesions (71%) as in SCC (72%) (Van der Riet et al, 1994). This suggests that loss of 9p is an early event in the progression of oral cancer (Papadimitrakopoulou et al, 1997; Van der Riet et al, 1994). Similarly LOH at 3p have been found to occur very early during oral carcinogenesis and in a significant number of oral mild dysplasia or even hyperplasias (Zhang et al, 1997). On the other hand, data from this lab showed that LOH at 17p was not found in reactive hyperplastic lesions and mild dysplasia of 16 oral mucosa, indicating loss at 17p occurs later than LOH at 3p and 9p (Zhang et al, 1997). El-Naggar and his colleges (1998) recently found LOH at 8p in 27% of the dysplastic lesions and in 67% of the invasive oral and laryngeal SCCs. The highest frequency of allele losses in dysplasia and cancer were detected in the same loci: 8p21 and 8p22. In addition, allelic losses in both dysplastic and corresponding invasive specimens were noted at the same loci, suggesting their emergence from a common preneoplastic clone. The studies suggested that inactivation of TSGs within these loci may constitute an early event in the evolution of oral and laryngeal SCCs. Table 1. L O H frequencies (%) in oral premalignant lesions Chromosome arm Frequencies of L O H References 3p 19% (6/32) 33 % (7/21) 40 % (12/30) 44% (8/18) 36 % (27/75) Maoera/, 1996 Roz etal, 1996 Emilion et al, 1996 Mao etal, 1998 Rosin et al, 2000 4q 14% (10/69) Rosin et al, 2000 8p 38 % (12/32) 26 % (19/72) Maoef a/., 1996 Rosin et al, 2000 9p 71 % (12/17) 57 % (43/75) Van der Riet etal, 1994 Rosin et al, 2000 l lq 20% (15/75) Rosin et al, 2000 13q 12 % (9/74) Rosin et al, 2000 17p 19% (3/16) 27 % (22/82) Emilion etal, 1996 Rosin et al, 2000 17 Table 2. L O H frequencies (%) in head and neck premalignant lesions Chromosome arm Frequencies of L O H References 3p 5 % (1/19) 52% (15/29) El-Naggar, 1995 Califano etal, 1996 8p 13 % (3/24) 27 % (8/30) Califano etal., 1996 El-Naggar, 1998 9p 33 % (6/18) 58% (17/30) 81% (17/21) El-Naggar, 1995 Califano etal, 1996 Mao etal, 1998 l lq 7% (1/15) 29% (9/31) El-Naggar, 1995 Califano etal, 1996 13q 32 % (9/28) Califano et al., 1996 17p 7 % (1/14) 33 % (10/30) 42 % (8/19) El-Naggar, 1995 Califano etal, 1996 Mao etal, 1998 J. 7.2. A molecular progression model for oral SCC In the late 1980's, Fearon and Volgelstein were among the first people to describe a molecular model for histo-pathological progression of human colon cancer. They suggested that 1) tumors progress via the activation of oncogenes and the inactivation of TSGs, each generating a growth advantage for a clonal population of cells; 2) specific genetic events often occur in a distinct order of progression; but 3) the order of pfogression is not necessarily the same for each individual tumor, and therefore it is the accumulation of genetic events that determines tumor progression. Although a considerable amount of cytogenetic and molecular genetic data on HNSCC have been accumulated during the last years, the picture as to how the genetic alterations 18 interfere with the different steps of tumor progression is still incomplete. Based on the detection of loss of heterozygosity in 87 head and neck tumors including benign and pre-invasive lesions, Califano et al were the first to develop a molecular progression model for HNSCC (Figure 3) (Califano et ah, 1996). According to this model, LOH in the chromosomal region 9p is already observed in benign and precursor lesions; deletions in chromosomal regions 3p and 17p are observed in dysplasia; deletions in 1 lq, 13q and 14q regions are associated with carcinoma in situ, and deletions involving chromosomal regions 6p, 8p, and 4q are associated with invasive lesions. These investigators point out that it is the accumulation and not necessarily the order of the genetic events that determines tumor progression. A similar model proposed by Rosin and Zhang further supports Califano's progression model (Rosin et al, 2000). Figure 3. Molecular model proposed for tumorigenesis in head and neck SCC Normal mucosa 9p loss I 3p, 17p loss Benign or precursor lesions n—> pl6, 1 lq, 13q, 14q loss p53 mut 6p, 8p, 4q loss Dysplasia Carcinoma Invasive in Situ carcinoma |f M - I ' - - . ^JA 1.7.3. LOH analysis and prediction of cancer risk for oral premalignant 19 In the landmark study by Mao and his colleagues (Mao et al, 1996a) investigated oral leukoplakia and cancer progression for association between LOH at 2 chromosome arms 3p and 9p. The results showed that the presence of LOH at 9p21 &/or 3pl4 in oral leukoplakia was associated with a greater probability of progression of these lesions into SCC 7of 19 (37%) cases with such LOH progressed to SCC in their study, as compared to only 1 of 18 (6%) cases without LOH. To further characterize the pattern of genetic change in premalignant lesions and identify chromosomal differences between premalignancies, another recent study from our lab examined a set of 116 biopsies from patients with hyperplasia or mild/moderate dysplasia for LOH at 7 chromosome arms (3pl4.2, 4q26, 8p23.3, 9p21, llq22.3, 13ql2.3-14.3 and 17pl 1.2) (Rosin et ah, 2000). The results suggested loss at any of the other five chromosomes (4q, 8p, 1 lq, 13q and 17p) in addition to LOH at 3p and /or 9p seems to provide a better predictive value. Based on these results, 3 risk groups were deduced: a low-risk LOH pattern (retention of 3p and 9p), an intermediate-risk pattern (LOH at 3p and /or 9p) and a high-risk pattern (LOH at 3p and/or 9p plus loss 4q, 8p, 1 lq, 13q or 17p). This is an important study, since it provided a useful approach for differentiating high-risk lesions from morphologically similar low-grade premalignancies. 20 1.8. Random amplified polymorphic DNA PCR (RAPD-PCR) and genome scanning for novel regions of genetic instability in HNSCC Although locus by locus alleleotyping of microdissected material using the LOH technique has been instrumental in deducing the pattern of loss of chromosomal intervals during cancer progression, LOH assay is not a high-throughput technique for genomic wide scan of new cancer genes and the analysis is only aimed at known hot spots. Higher resolution genome scanning could be achieved using the same materials by simultaneously and randomly monitoring multiple loci. The random amplified polymorphic DNA (RAPD) fingerprinting assay is a high-resolution technique that could scan the whole genome randomly by simultaneously monitoring multiple loci. RAPD method is a DNA fingerprinting technique based on polymerase chain reaction (PCR) amplification of random fragments of genomic DNA with single short primers of arbitrary nucleotide sequence (Williams et al, 1990). The advantages of RAPD analysis lie in the technique being locus non-specific and easy identification of the regions of amplification, deletion or rearrangement without prior screening of multiple regions of the genome. Furthermore, RAPD screening can be performed on a small amount of DNA, and it is relatively easier to clone the altered fragments for further analysis. Different from the LOH analysis which can only detects in specific microsatellite loci, the RAPD method can simply and rapidly detect genetic alterations in the entire genome without knowledge of specific DNA sequence information (Welsh et al, 1995). This RAPD method is a powerful tool for population and pedigree analysis, phylogenetic studies, and bacterial strain identification (Hering and 21 Nirenberg, 1995). Recently, the RAPD method was applied as a means for identifying the genomic alterations in human tumors (Sood and Buller, 1996;Ong et al., 1998; Afroze et ai, 1998; Maedaefa/., 1999). Once a chromosomal region using RAPD has been identified as a target of deletion, the region of loss could then be narrowed by LOH analysis. This thesis has delineated the region of 13ql4.11 and found a 1.9 Mb minimal region of alteration (MRA) at D13S1297. Two other MRAs at 8q22 (D8S545 and D8S1830) have also been found by people in our research group. 1.9. Genetic alterations on chromosome 8q 1.9.1. Genetic changes of 8q (8q22) in a variety of cancer There is increasing interest in the role of gene alteration on the long arm of chromosome 8 in breast cancer, prostate cancer, gastric cancer, and other cancers. Most genetic alterations on 8q are gains, which suggest oncogenes (Table 3). 22 Table 3. Genetic changes in different cancer on chromosome 8q (8q22) Tumor types Location Types of alterations Method* Frequencies (%)• References Adenocarcinoma 8q23-.24.1 Gain C G H 79% Van Dekken et al, 1999 8q23 Gain C G H 80% Walch et al, 2000 Breast cancer 8q24.1 Gain PCR quantitative analysis 28% & 52% Yokota et al., 1999 8q Gain C G H 36% Kainu et al, 2000 8q21 Gain SBA 9% (3/32) Balleine et al, 2000 8q Gain C G H 39% (17/44) Seute et al, 2001 Esophageal SCC 8q Gain C G H 80% (8/10) Mayamae/a/., 2000 8q Gain C G H 60% (15/25) Wei et al, 2002 Gallbladder carcinomas 8q Loss L O H 60% Nakayama et al, 2001 Gastric cancer 8q Gain C G H 51% & 64% W u e / f l l , 2001 Hepatocellular carcinoma 8q21-24 Gain C G H 31% Sakakura et al, 1999 8q24 Gain C G H 66% Kusano et al, 1999 8q23-24 Gain C G H 83% Balsara et al, 2001 8q24.1-24.3 Gain C G H 52% Niketeghad et al, 2001 Lung cancer 8q Loss L O H 36% Stanton et al, 2000 8q Gain mFISH 100% (2/2) Gunawan et al, 2001 8q Gain C G H 31% Wong et al, 2003 Mesotheliomas 8q22-23 Gain C G H 18% Krismann et al, 2002 Ovary cancer 8q Gain C G H 20%-64% Staebler et al, 2002 8q Loss L O H 50% Shridhar et al, 2002 Pleomorphic adenoma 8q Loss L O H 47% Gillenwater et al, 1997 Posterior melanomas 8q Loss L O H 60% Parrella et al, 1999 2 3 8ql2-13 Loss L O H 48% Perinchery et al., 1999 8q Gain C G H 36% Alers et al., 2000 Prostate 8q Gain C G H 37% Alers al., 2001 8q ' Gain C G H 48% El Gedaily et al., 2001 8q Loss L O H 26% Karan et al., 2001 8q24 Gain C G H 6% Wolter et al., 2002 Stomach carcinoma 8q Loss L O H 80% Kim et al, 2001 * C G H , comparative genomic hybridization; L O H , loss of heterozygosity; mFISH, multicolor fluorescence in situ hybridization; SBA, southern blot analyses. In prostate cancer, Perinchery et al. (1999) analyzed three 8q loci in 60 tumors using microsatellite analysis. LOH at 8ql2-13 was noted in 48% of the prostate tumors. Karan et al. (2001) found 26% prostate tumors with allelic loss on 8q. However, Alers et al. (2000) found that the alterations on chromosome arm 8q in the prostate cancer were often gained (36%) instead of losses by using comparative genomic hybridization to screen the tumor genome alterations in 56 different patients. Furthermore, Alers et al. (2001) also observed gain of 8q (37%) in the large size tumors. El Gedaily et al. (2001) supported the finding and reported gain of 8q in 48% of the 27 advanced prostate cancers by using the same method. Wolter et al. (2002) indicated that 8q24 (6%) was amplification in the primary prostate adenocarcinomas. In breast cancer, Yokota and co-workers (1999) examined 142 sporadic breast cancers for abnormalities in a 16 cM region on 8q24.1 using 14 polymorphic microsatellite markers on 8q. Multiplication on 8q24.1 was observed more frequently in invasive solid-tubular or scirrhous tumors (52%) than in less aggressive histologic types (28%). Kainu et al. (2000) used comparative genomic hybridization to study 61 breast tumors from 37 breast cancer 24 families with no identified BRCA1 and BRCA2 mutation. Gain on 8q was observed in 36% of these tumors. Balleine et al. (2000) identified increased copy number at 8q21 in 9% of breast carcinoma using Southern blot analyses. Seute et al. (2001) found that the most frequent chromosomal aberrations in breast cancer were gains on 8q. In lung cancer, Stanton et al. (2000) used L O H analysis and found 36% small cell lung carcinomas with allelic loss on 8q. Gunawan et al. (2001) utilized conventional banding analysis and multicolor flurescence in situ hybridization (mFISH) and found a net gain (100%) of sequences on 8q in two cases. Wong et al. (2003) found 31% of lung carcinoma was overrepresented by CGH. In hepatocellular cancer, Sakakura et al. (1999) studied 35 hepatocellular carcinomas associated with hepatitis C virus using comparative genomic hybridation. Gain was noted at 8q21-24 in 31% of the tumors. Kusano et al. (1999) found the most common site of increase in D N A copy number was 8q (66% of the tumors) with minimal overlapping region at 8q24. Balsara et al. (2001) identified that the most prominent change in the primary hepatocellular carcinomas (83%) was gain on 8q23-24. Niketeghad et al. (2001) detected the gain on 8q24.1-24.3 in 52% of the hepatocellular carcinomas. In esophageal cancer, Gillenwater et al. (1997) noted the frequency of L O H was on 8q (47%) from 1 patient with carcinoma ex pleomorphic adenoma and 17 patients with pleomorphic adenoma. Van Dekken et al. (1999) used comparative genomic hybridation for genetic analysis of 28 adenocarcinomas of the gastroesophageal junction. Frequent gain was 25 observed at 8q23-24.1 for 79% of the tumors. Walch et al. (2000) used 30 esophageal adenocarcinoma resection specimens and identified gain at 8q23 in 80% of the cancers. Mayama et al. (2000) performed a comparative genomic hybridization analysis using 10 esophageal SCC and found frequent gain of 8q (80%). Nakayama et al. (2001) found a high frequency of allelic loss on 8q in gallbladder tumors (60%). Wu et al. (2001) observed that advanced gastric cancer demonstrated a higher prevanlence of gain of 8q (51%) than early gastric cancer (10%). Gain on 8q (64%) was higher in intestinal gastric cancer than in diffuse gastric cancer (20%). Kim et al. (2001) used 49 genome-wide microsatellite markers in an allelotype study of 30 cases of stomach resections that harbored both adenomas and carcinomas. Frequent loss of heterozygosity on 8q was demonstrated in 80% of carcinomas. Wei et al. (2002) detected that the most common gains were 8q (60%) on primary tumors of esophageal squamous cell carcinomas using comparative genomic hybridization. In ovarian tumors, Staebler et al. (2002) used comparative genomic hybridation and found gains on 8q in 64% of invasive serous carcinomas, 20% of micropapillary serous carcinomas, and 22% of atypical proliferative serious tumors. Shridhar et al. (2002) found 8q loss in 50% of the early- (6/12) and late-stage (4/8) tumors, respectively. In skin cancer, Parrella et al. (1999) screened every autosomal arm and the X chromosome of 50 primary posterior melanomas. Allelic imbalance of 8q was observed in 60% of melanomas tumors. 1.9.2. Genetic changes of 8q (8q22) in head and neck cancer 26 Gains and deletions of the long arm of chromosome 8 (8q) are also a common finding in head and neck squamous cell carcinoma. The summary of these changes is in Table 4. Table 4. Genetic alterations in head and neck cancer on chromosome 8q (8q22) Tumor types Location Types of alteration Method Frequencies (%) References HNSCC 8q Loss L O H 38% (10/26) Nawroz et al., 1994 HNSCC 8q21-24 Gain C G H 57% (17/30) Bockmuhl et al., 1996 HNSCC 8q21-24 Gain C G H 56% (28/50) Bockmuhl et al., 1998 OSCC 8q Gain C G H 50% (7/14) Weber et al, 1998 Oropharynx & hypopharynx 8q Gain C G H 50% (5/10) Welkoborsky et al., 2000 OSCC 8q Gain C G H 45% (5/11) Okafuji et al, 2000 HNSCC 8q Gain C G H 42% Bergamo et al., 2000 Nasopharyngeal carcinoma 8q Loss L O H 22% (6/27) Lo et al., 2000 HNSCC 8q Gain C G H 72% (13/18) Hashimoto et al., 2000 HNSCC 8q 8ql0-13 Gain Loss FISH 92% (11/12) 8% (1/12) Jin et al., 2001 HNSCC 8q24.1 Gain C G H 48% (36/75) • Huang et al., 2002 HNSCC 8q24.1 Gain FISH 8.8% Freier et al, 2003 Nawroz et al. (1994) tested every autosomal arm of 29 primary head and neck tumors for allelic loss. Loss of 8q was found in 38% of cases. Bockmuhl et al. (1996) used comparative genomic hybridization to screen 30 primary head and neck SCC. Overexpression 27 at 8q21 was found 57% of the tumors. Two year later, Bockmuhl et al (1998) obtained comprehensive information about the genetic changes in 50 HNSCC using same method. They observed DNA overrepresentation at 8q21-24 in more than 50% of the cases. Weber et al. (1998) identified gain on 8q in 50% of the oral SCC. Welkoborsky et al. (2000) investigated 10 patients with nonmetastasizing squamous cell carcinomas of the oropharynx and hypopharynx by quantitative DNA measurements and comparative genomic hybridization. The specimens displayed overexpression on 8q for 50% of the tumors. Okafuji et al. (2000) have examined genetic alterations in 11 surgically removed oral squamous cell carcinomas (OSCCs) using CGH and laser scanning cytometry (LSC). Gains in DNA sequence copy number on 8q was detected in 45% of the tumors. Bergamo et al. (2000) used comparative genomic hybridization to identify chromosomal imbalances in 19 samples of HNSCC. It was detected overexpression (42%) of the tumors on 8q. Lo et al. (2000) found LOH on 8q in 22% of nasopharyngeal carcinomas. Hashimoto et al. (2000) used 18 consecutive cases of HNSCCs to analyze DNA sequence copy number aberrations. Gain of 8q (72%) was detected in as many as 13 of the 18 carcinomas. Jin et al. (2001) investigated 12 HNSCC with FISH. Overexpression of 8q (92%) was detected in 11 of the 12 cases and only one tumor showed loss (8%) at 8ql0-13. Huang et al. (2002) applied CGH and observed that the most frequent DNA copy number gain was on chromosome arms 8q24.1 (48%) in HNSCC. Freier et al. (2003) used fluorescence in situ hybridization to detect amplification of oncogenes and found it was 8.8% for myc, which is located on 8q24.1. 28 1.9.3. Genetic changes of 8q (8q22) in premalignancies Since a well-known oncogene, myc, is located on 8q 24.1, most of previous tumor studies on 8q were focused at region around 8q24. So far, few papers have studied 8q alteration in premalignant lesions. Sarbia et al. (2001) analyzed Barrett esophagus that is a premalignant lesions that represents the initial step in a metaplasia-dysplasia-carcinoma sequence. Amplification of c-myc was found in none of 29 specialized epithelial specimens, none of 23 low-grade dysplasia specimens, and 6 of 24 (25%) high-grade dysplasia specimens. Their data indicate that amplification of c-myc is a late event in the metaplasia-dysplasia-carcinoma sequence in Barrett esophagus. Recently few papers have investigated 8q22 alteration in different premalignancies and cell lines. Cheng et al. (1998) examined premalignant lesions of prostate and found allelic imbalance at 8q22.2 (15%). Wong et al. (2003) revealed consistent 100%> (6/6) overexpression of 8q with a smallest overlapping region identified on 8q21.1-q22 in nasopharygeal carcinoma cell lines using CGH. 1.9.4. Main genes on chromosome 8q Several cytogenetic and molecular studies have investigated the occurrence of genetic alterations in HNSCC and other cancers, demonstrating that oncogene activation and tumor suppressor gene inactivation are in the development of the disease on 8q. 29 C-MYC GENE The c-myc gene is located on 8q24.1. The members of the myc gene family (c-myc, N-myc, L-myc) encode for a 62-kDa protein with transactivational activity. The myc proteins (p62myc) are able to dimerize with a second protein, max. Using immunohistochemistry, Field et al. (1989) observed c-myc amplification in 48% of tumor analyzed. Although no association has been found between the c-myc amplification and sex, gender, tumor size, clinical stage or differentiation, these investigators observed that patients with tumors with high levels of c-myc showed shortened overall survival. In addition, Porter et al. (1994) demonstrated c-myc amplification in 22 % of tumors from the nasopharynx and observed that the prognosis for patients with tumors with c-myc amplification was worse compared with patients with tumors without c-myc amplification. It is postulated that overexpression of myc leads to increased amounts of myc-mas heterodimers and reduced max-mad heterodimer formation, changing the regulation of many genes and contributing to malignant transformation (Bouchard et al, 1998). T-STAR GENE T-STAR is a novel member of STAR (signal transduction and activation of RNA) family, and is predicted to encode a spermatogenesis related RNA4>inding protein. This gene is mapped on 8q24 and located within the markers D8S2049 and D8S1753 (Sugimoto et al, 2000). Its complete coding region spans nine exons. In addition to its known expression in testis, moderate level of transcripts for T-STAR gene was detected in brain, heart and is highly abundant in skeletal muscle. Mutational analysis for the T-STAR gene in child absence 30 epilepsy families did not show any sequence variation in the coding region, and this suggests that the T-STAR gene is not involved in the pathogenesis of persisting child absence epilepsy. However, genomic organization of T-STAR gene characterized in the present report might help in understanding the biological functions of T-STAR as well as its suspected involvement in other tumorigenesis (Sugimoto et al, 2001). 1.10. Genetic alterations on chromosome 13q 1.10.1. Genetic alterations of 13q (13ql4) in a variety of cancers Genetic alterations on chromosome 13q have frequently been observed in a variety of cancers. The majority of these genetic changes have been found at 13ql2-14. The data from 1999 to the present are summarized in Table 5. 31 Table 5. Genetic alterations in different cancer on chromosome 13q (13ql4) Tumor types Location Types of alterations Method* Frequencies (%) References Bladder cancer 13ql 1-12.1 13ql4.3 Loss L O H 21 % 32% Wada et al, 2000 Breast cancer 13q21-22 Loss C G H 56% Kainu et al, 2000 13ql2-14 Loss L O H 38% (15/40) Imyanitov et al, 2000 13ql4 Loss L O H 47% (59/125) Bieche and Lidereau, 2000 13ql4.1 Loss L O H 31% (13/42) Kollias et al., 2000 13q Loss C G H 57% (25/44) Seutee/ al, 2001 13ql4 Loss L O H 48%(16/33)-55% (18/33) Kurose et al, 2001 13ql2.3 Loss L O H 37 % Farabegoli et al, 2002 13ql2.3 Loss L O H 7% (1/15) Selim et al, 2002 13ql3 Loss L O H 74% Johnson et al., 2002 Cervical carcinoma 13ql4.1-14.3 Loss L O H 4%(2/50)-21 % (4/19) Krul etal, 1999 Esophageal SCC 13q Loss C G H 100 % (17/17) Pack etal, 1999 13ql2-13 Loss L O H 3 9 - 4 4 % Harada et al, 1999 13q Loss L O H 93% Hu etal, 1999 13q Loss C G H 70 % (7/10) Mayama et al, 2000 13ql2.11 13ql2.3-13.1 Loss L O H 76 - 89 % 70 - 83% L i et al, 2001 13qll 13ql2.3-14.2 13q32-34 Loss L O H 60% (6/10) 50% (2/4) 50% (3/6) Roth et al, 2001 13ql3-34 Loss L O H 59% Chen et al, 2001 Gallbladder carcinoma 13q Loss L O H 40 % , Chang et al, 1999 3 2 Gastric tumor 13q21-31 Loss L O H 57% Yustein et al., 1999 T3q Gain C G H 46% Van Dekken et al., 1999 13q Loss L O H 50% Han et al, 2000 13q Gain C G H 24% Wu et al, 2001 Hepatocellular carcinoma 13q31.1 13ql4.3 Loss L O H 24% 23 % Lin era/., 1999 13ql3-14 Loss C G H 37% Kusano et al, 1999 13q Loss C G H 20% Sakakura et al, 1999 13ql2.1-32 Loss L O H 32% Shueefa/, 1999 13q Loss L O H 67 % (child) 22 % (adult) Kim et al, 2000 13q Loss C G H 19% Niketeghad et al, 2001 Leukemia 13ql4.3 13ql2-13 Loss FISH 33 % (6/18) -55 % (10/18) 16% (3/18) Lens et al, 2000 13ql4 Loss L O H 4% (6/138) Cave et al, 2000 13ql4 Loss L O H 10% (5/49) Chung et al, 2000 Lung cancer 13qll 13ql2-14 13q34 Loss L O H 67% 62 % & 93 % 62% Girard et al, 2000 13q Loss L O H 91 % Stanton et al, 2000 13q Gain mFISH 50 % (1/2) Gunnawan et al, 2001 13q21-31 Loss C G H 70% Goeze et al, 2002 13q Loss C G H 28% Wong et al, 2003 Lymphoma 13ql4.3 Loss FISH 16 % (7/43)-33 % (14/43) Wadae/a/., 1999 13ql4 Loss L O H 64 % - 75 % Siu et al, 2000 13ql4 Loss L O H 50 % (4/8) Wada et al, 2000 Malignant mesothelioma 13ql3.3 13ql4.3 Loss L O H 71 % (10/14) 67% (14/21) Rienzo et al, 2000 Myeloma 13ql4 Loss FISH 54% (176/325) Fonseca et al, 2001 Ovarian tumor 13ql4.1 Loss L O H 3 1 % (16/52) Graser al, 2001 13ql2-14 Loss L O H 46%(8/15)-67%(6/9) Shridhar et al, 2002 33 Pituitary tumor 13ql4 Loss C G H 42% (5/12) Harada et al, 1999 13q Loss L O H 54% Simpson et al., 2000 13ql4 Loss L O H 53 % (31/59) Uedae/a/ , 1999 13ql4.3 13qll Loss L O H 15% (5/33) . 11% (3/28) Hyytinen et al., 1999 13ql4.3 Loss L O H 85 % (33/39) Latil etal, 1999 13q Loss L O H 27% Afonso et al., 1999 13ql4.3 Loss L O H 37% Yin etal., 1999 13q Loss C G H 55% Alers et al., 2000 13q Loss C G H 31 % & 6 9 % Alers et al, 2001 Prostate cancer 13q Loss C G H 50% El Gedaily et al., 2001 13ql3 13ql4 Loss L O H 47% 39% Fiedler et al., 2001 13ql4 Loss L O H 10% (13/134) Chen et al, 2001 13ql4 13q21 13q33 Loss L O H 62% (21/34) 57 % (20/35) 34% (11/320 Dong et al, 2001 13q Loss L O H 62% (13/21) Schmidt et al, 2001 13q21 Loss C G H 24% Wolter et al, 2002 Rhabdomyosarcoma 13q21 Gain C G H & FISH 33% Bridge et al, 2000 13ql4 Gain C G H & FISH 22% Bridge et al, 2002 Somatotrophinomas 13q Loss L O H 29% Simpson et al, 1999 Urothelial cancer 13ql4.3 Loss L O H 31 % (4/13) Sengelov et al, 2000 Uveal melanoma 13ql4 Loss L O H 21 % Scholes et al, 2001 * C G H , comparative genomic hybridization; L O H , loss of heterozygosity; mFISH, multicolor fluorescence in situ hybridization; FISH, fluorescence in situ hybridization. In prostate cancer, Ueda et al. (1999) analyzed 14 cases of cancer and detected LOH at 13ql4 in seven (50%) primary tumors. Of the 59 primary tumors, 53% (31/59) cases showed LOH involving at least one locus on chromosome arm 13q. Hyytinen et al. (1999) found 58% 34 (23/40) showed LOH for at least one marker of the primary tumors. Furthermore, Latil et al. (1999) found 85% (33/39) of these tumors had evidence of allelic loss involving a region of 13ql4 containing RBI. Afonso et al. (1999) performed LOH analysis on normal and tumor pairs from 36 prostate cancer patients. The overall rate of LOH on chromosome 13 was 27%. Yin et al. (1999) found that the most frequent (37%) LOH among the informative cases with allele losses was detected on chromosome 13ql4.3. Alers et al. (2000) detected that chromosome arm 13q (55%) has the most frequently loss using comparative genomic hybridization. In further studies, Alers et al. (2001) found frequently 13q (31%) loss in the small tumors and 13q (69%) loss in the intermediate cancers using the same method. El Gedaily et al. (2001) also found the most prevalent changes was loss of 13q (50%) using CGH. Chen et al. (2001) detected deletions at 13ql4 in 10% (13/134) of tumor specimens. Dong et al. (2001) found the frequencies of LOH at 13ql4, 13q21, and 13q33 were 62%, 57%, and 34%, respectively. Schmidt et al. (2001) preformed LOH analyses with six microsatellite markers at 13q. The most frequently deleted region was at D13S149 where 57% (8/14) of informative patients had AI or LOH. Wolter et al. (2002) indicated that the most frequent alteration was 13q21 (24%) using CGH analysis. In breast cancer, Kainu et al. (2000) studied 61 breast tumors from 37 breast cancer families with no identified BRCAI or BRCA2 mutations using CGH. They found 13q21-22 losses in non-BRCAI/BRCA2 tumors were the most often seen (56%). Imyanitov et al. (2000) observed in 38% for 13ql2-14 in informative tumors. Bieche and Lidereau (2000) studied 129 tumors for RBI expression and also had tested for LOH on chromosome arm 13ql4 by using polymorphic microsatellite DNA markers. LOH was found in 47% of the informative tumor 35 DNAs. Kollias et al. (2000) used microsatellite markers to test for loss of heterozygosity (LOH) in left and right tumors for 31 women with premenopausal bilateral breast cancer. Data showed 31% allelic loss in the 13ql4.\(BRCA2) region. Seute et al. (2001) used CGH analysis and found the most frequent losses on chromosome arm 13q. Kurose et al. (2001) identified the frequent LOH loss in both neoplastic epithelial and/or stromal compartments, from 55% to 48% respectively at 13ql4. Farabegoli et al. (2002) analyzed 28 pure breast ductal carcinima in situ samples for LOH. They observed the highest frequency of loss (37%) at 13ql2.3 region. Selim et al. (2002) also found loss (7%) at 13ql2.3 in apocrine metaplasia of the breast. In Johnson et al. 's (2002) study, the frequency of LOH detected for 13.3 regions was 74% in young breast cancer. In lung cancer, Girard et al. (2000) detected the chromosome arms with the most frequent LOH at 13ql2-14 (93%) & at 13q34 (62%) in small cell lung cancer and at 13ql 1 (67%) & at 13ql2-14 (62%) in non-small cell lung cancer. Stanton et al. (2000) performed a comprehensive allelotype analysis of all 39 nonacrocentric autosomal arms. Alterations in 158 polymorphic microsatellite alleles were examined in 24 pairs of human small cell lung carcinomas and normal control DNA samples. A total of 2,107 informative reactions were analyzed. This analysis revealed 91% loss within chromosome arms 13q. Furthermore, Gunawan et al. (2001) utilized conventional banding analysis and multicolor flurescence in situ hybridization (mFISH) and found a net gain of sequences on 13q in case 2. Goeze et al. (2002) detected the deletion with the highest frequency was the underrepesentation at 13q21-31 in 70% of cases using CGH. Wong et al. (2003) found loss (28%) at 13q in primary lung adenocarcinomas using CGH. 36 In esophageal cancer, Pack et al. (1999) found the frequency of chromosomal loss associated this type of tumor was 100% 13q by CGH. Harada et al. (1999) identified frequent loss at D13S260 (44%), D13S171 (39%), and D13S267 (44%) of 13ql2-13. LOH at D13S171 showed a significant correlation with lymph node metastasis. Hu et al. (1999) screened 23 with and 23 without a family history of upper gastrointestinal cancer of esophageal squamous cell carcinoma patients. One marker (D13S894 on 13q) showed greater LOH in patients (93%) with a positive family history. Li et al. (2001) analyzed 42 microsatellite markers spanning chromosome band 13ql 1-13 in 56 esophageal SCC patients. Two deleted regions were identified. The first region (I) was at segment 13ql2.11 and was defined by markers D13S787, D13S1243, D13S283, and D13S221 (LOH frequencies of 79%, 77%, 76%, and 89%, respectively). The second deletion region (II) was at 13ql2.3-13.1 and including markers D13S267, D13S220, and D13S219 (LOH frequencies of 83%, 71%, and 70%, respectively. Roth et al. (2001) also found LOH in three regions: 13ql 1 (60%), 13ql2.3-14.2 (50%), and 13q32-34 (50%) in invasive tumors. Chen et al. (2001) examined 59% of esophageal squamous cell carcinoma showed allelic loss at chromosome 13q33-34. In lymphoma, Wada et al. (1999) found that 13q deletion was frequently detected in the aggressive non-Hodgkin's lymphoma compared with that in indolent non-Hodgkin's lymphoma. In 2000, they also found a significant number of B-cell non-Hodgkin's lymphoma with loss of genetic material on chromosome arm 13q at RBI locus. Another Siu's group (2000) observed LOH at chromosome 13q was found in 64% of nasal NK cell lymphomas and 75% of nonnasal NK cell lymphomas. 37 In hepatocellular cancer, Sheu et al. (1999) found LOH was shown 32% at 13ql2.1-32 in Taiwan. Sakakura et al. (1999) studied 35 hepatocellular carcinomas associated with hepatitis C virus using CGH. Chromosomal loss was noted on 13q (20%). Further, Kim et al, (2000) found that LOH frequency on 13q was relatively higher in childhood than in adult hepatocellular carcinoma (67% vs. 22%, p=0.058). Niketeghad et al. (2001) found that loss in 13q (19%) using comparative genomic hybridizatio (CGH). In bladder cancer, Wada et al. (2000) detected a statistically significant correlation was found between the number of loci with LOH at 13ql4.3 and tumor stage and grade, respectively. In cervical cancer, Krul and co-workers (1999) observed that the difference in the rate of incident of LOH at chromosome 13ql4.1-14.3 between specimens from Surinam and the Netherlands were statistically significant. In leukemia, Lens et al. (2000) have investigated the incidence of 13q deletion in 18 B cell prolymphocytic leukemia cases by fluorescence in situ hybridization (FISH), using molecular probes for the RBI and D13S25 loci. Monoallelic loss of RBI, D13S25 and BRCA2 was present in 55%, 33% and 16% of the cases, respectively. All the cases with D13S25 and BRCA2 deletion showed RBI loss. Chung et al. (2000) analyzed 49 patients with adult lymphoblastic leukemia and showed 10% deletion at 13ql4. Cave et al. (2001) detected that allelic loss was demonstrated in six cases (4%) out of 138 children with acute lymphoblastic 38 leukemia. In gastric cancer, Yustein et al. (1999) found high degrees of allelic loss on 13q (57%) in xenografted gastric cancer. Van Dekken et al. (1999) identified frequent gain on 13q (46%). Han et al. (2000) study showed a high rate of LOH in chromosome 13q (50%) in gastric neuroendocrine tumor. However, Wu et al. (2001) found gain on 13q (24%) using comparative genomic hybridization in gastric cancer. In malignant mesothelioma, Rienzo et al. (2000) found the highest frequencies of LOH were observed at 13ql3.3 (71%) and 13ql4.3 (67%) (Rienzo etal, 2000). In urothelial cancer, Loss on chromosome 13q showed 31% and never occurred alone but was associated with chromosomal lesions in preferentially 8p or lOp in Sengelov et al. 's study (2000). In sporadic epithelial ovarian tumors, Gras et al, (2001) identified 31% LOH on chromosome 13ql2-14. Shridhar et al. (2002) analyzed 15 early- and 18 late-stage ovarian tumor samples. Two markers on 13ql4.1 showed 62% & 67% in the early stage tumors and 46% & 50% in late-stage tumors. In other cancer, Simpson et al. (1999) found that a marker 3 cm telomeric to RBI showed the frequency of deletion in somatotrophinomas (29%). Bridge et al. (2000) found gain of chromosome 13q21 (33%) in 10 rhabdomyosarcoma patients using comparative 39 genomic hybridization (CGH) and fluorescence in situ hybridization (FISH). Furthermore, Bridge et al (2002) investigated 45 rhabdomyosarcoma specimens using same methods. The prominent imbalance was also found that gain of13ql4 (22%). Fonseca et al. (2001) found 13ql4 deletions in 176 (54%) out of 325 valuables myeloma patients. In gallbladder cancer, Chang et al. (.1999) found LOH on chromosome 13q was frequent only in advanced stage (III and IV) carcinomas. In pituitary tumor, Harada et al. (1999) utilized CGH to study 12 tumor samples and detected loss of 13q (5 cases) (42%), with a minimal common overlapping region at 13ql4. In support of the LOH of 13q finding in invasive tumors, Simpson et al. (2000) did another large genetic study of human pituitary tumor DNA that showed a significantly higher frequency of LOH was evident in the invasive nonfunctional tumors (54%). 1.10.2. Genetic alterations of 13q (13ql4) in head and neck cancer The frequency of genetic alterations of 13q loci in head and neck squamous cell carcinoma varies widely among the different studies of allelic loss in these tumors. All genetic changes of these studies are deletions (Table 6). Most of genetic changes are found at 13ql2-14. Several tumor suppressor genes have been suggested to be located at this region, including BRCA2 and RBI. Few studies found loss at 13q32-34, a third hot spot of deletion in head and neck tumors (Lydiatt et al, 1994; Maestro et al., 1996; Tsang et al., 1999). These regions are near the locus for the ING1 gene. 40 Table 6. Deletion of 13q (13q) in head and neck cancer Cancer Regions Method Frequencies of L O H (%) References HNSCC 13ql2.11 13ql2.12 L O H 46 % (6/13) 56% (10/18) Nawroz et al, 1994 HNSCC 13ql2 L O H 51% Ah-Seee/a/., 1994 HNSCC 13q32 L O H 33% (12/29) Lydiatt et al, 1994 HNSCC 13ql4.3 L O H 94% (29/31) Yoo etal, 1994 HNSCC 13qll-q34 L O H 46 % (22/48) -67 % (32/48) Maestro etal, 1996 HNSCC 13ql4 L O H 22 % (2/9) Ransom et al, 1996 HNSCC 13ql4 C G H 67 % (20/30) Bockmuhl et al, 1996 HNSCC 13ql2-ql3 L O H 27 % (6/22) Kirkpatrick et al, 1997 Oral SCC 13ql4.3-q21.1 13ql4.3 13ql4.3-q21.2 13ql4.2-q21.2 13ql4.3 L O H 36% (11/31) 33 % (9/27) 32 % (8/25) 37 % (10/27) 32% (12/28) Ogawara et al, 1998 HNSCC 13ql4 C G H 70 % (35/50) Bockmuhl et al, 1998 HNSCC 13ql4.1-14.3 L O H ' 66% (21/32) Nawroz-Danish et al, 1998 Nasopharyngeal Cancer 13ql2 13ql4 L O H 80 % (39/49) 71 % (34/48) Mutirangura et al, 1999 Oral SCC 13ql2.3 13ql4.2 13ql4.3 13q21.2 13q31-32 L O H 8% 35% 23% 38% 19% Partridge et al, 1999 Nasopharyngeal Carcinoma 13ql4.3 13q32-q34 L O H 54% 39% Tsang et al, 1999 Oral SCC 13q L O H 69% Gupta etal, 1999 HNSCC 13q34 L O H 48 % (20/44) Sanchez-Cespedes et al, 2000 Nasopharyngeal Carcinoma 13ql2-ql4 13q31-q32 L O H 52% 48 % Lo et al, 2000 41 Oral& oropharyngeal Carcinoma 13ql4.1-ql4.2 L O H 47% Grati et al, 2000 HNSCC 13q33-q34 L O H 68 % (23/34) Gunduz et al, 2000 Oral SCC 13q31 13ql4.3 L O H 38% (5/13) 29 % (2/7) Zhang et al, 2001 HNSCC 13ql4 13q22 L O H 46% (12/36) 36 % (8/22) Fiedler et al, 2002 HNSCC 13q C G H 24% (18/75) Huang et al, 2002 Nawroz et al. (1994) screened 29 head and neck squamous cell carcinomas for LOH. Loss of 13q was found in 56% of cases with highest percentage of loss near the RB locus (13ql4). As-See et al. (1994) analyzed 28-paired normal and tumor DNA samples to identify such regions involved in the development of squamous carcinoma of head and neck. In informative cases they observed a high incidence of loss of heterozygosity at 13ql2 (51%). To further define an area of minimal loss, Yoo et al. (1994) tested 60 primary HNSCC in 59 patients for LOH by using 10 polymorphic microsatellite markers spanning the long arm of chromosome 13. Twenty-nine of 31 (94%) lost a portion of 13q that included D13S133, which lies just telemetric to the RB gene at 13ql4.3. Lydiatt et al. (1994) examined 42 prospectively collected, paired samples of HNSCC. Significant loss of heterozygosity was observed on 13q (33%). However, Ransom et al. (1996) investigated 78 SCCHN patients for LOH. The LOH rate for RB was 22%. Maestro et al. (1996) analyzed 48 primary HNSCC for LOH using 11 different polymorphic loci extending from the 13ql 1 to 13q34 bands. Thirty-two of the 48 cases analyzed (67%) showed LOH for at least one of the polymorphisms tested. Twenty-two cases (46%) carried a wide deletion involving almost the entire long arm of chromosome 13. Bockmuhl et al. (1996) performed 30 primary HNSCC using CGH. Deletion was frequently 42 observed on 13q (67%). To identify the role of BRCA2 (13ql2-ql3) in the development of the Laryngeal cancers, Kirkpatrick et al. (1997) found that only 27% of these cancers demonstrated LOH of the Z?i?C42-containing region. Ogawara et al. (1998) analyzed tumors from 34 unrealted patients with oral SCC by LOH with 18 microsatellite markers on 13q. The high frequency of LOH was observed at 13ql4.1-q21.2 from 32% to 37%. Bockmuhl et al. (1998) performed 50 primary HNSCC by CGH. CGH analysis indicated loses at locus of the RB in 70% of the cases. Nawroz-Danish et al. (1998) investigated 32 primary HNSCC by microsatellite analysis with the use of 10 new markers spanning the minimal region of 13q. Twenty-one (66%) of 32 tumors displayed loss of heterozygosity and the minimal region of loss was confirmed to be 13ql4.1-ql4.3. Mutirangura et al. (1999) analyzed 50 informative cases of naspharyngeal cancer using 16 microsatellite markers. Allelic losses at one or more loci on chromosome 13q were observed in 44 (88%) cancer cases. The regions of 13ql2 and 13ql4 showed LOH 80% and 71%, respectively. Partridge et al. (1999) carried out microsatellite analysis with 52 polymorphic markers at 13 key regions implicated in the pathogenesis of head and neck cancers. Forty-eight primary oral SCC were tested and showed LOH from 8% to 38% in thel3ql2.3-q32 region. Tsang et al. (1999) examined 31 primary nasopharyngeal carcinoma tumors by LOH analysis with a panel of 13 microsatellite polymorphic markers distributed along the long arm of chromosome 13. The highest frequency of LOH was found at loci D13S133 (54%) on 13ql4.3 and D13S796 (39%) on 13q32-34. Gupta et al. (1999) detected several distinct minimal regions of deletion on 13q in supraglottic and oral squamous cell carcinomas. 69% of the 145 tumors examined demonstrated allelic loss at one or more loci on 13q. Sanchez-Cespedes et al. (2000) analyzed 44 primary tumors for LOH at 13q, using four widely spaced microsatellite markers (13ql4, 13ql4.3-q22, 13q22, and 43 13q34). Twenty (48%) of the tumor samples showed LOH in all of the informative markers tested, including D13S1315 at 13q34. Lo et al. (2000) performed high-resolution allelotyping on 27 microdissected primary nasopharyngeal carcinoma tumors using 382 microsatellite markers. They detected high frequencies of allelic imbalance on 13q (56%). Grati et al. (2000) analyzed 25 oral and oropharyngeal epithelial carcinomas for LOH and microsatellite instability by using 55 ologonucleotide repeat markers located in 45 chromosomal regions. An allelic loss of 13ql4.1-ql4.2 was 47%. Gunduz et al. (2000) also demonstrated that of 34 informative cases of HNSCC showed 68% LOH at chromosome 13q33-q34. Zhang et al. (2001) analyzed 66 mild and moderate dysplasias for LOH. In 20 cases that progressed to the SCC, they showed 38% at 13q31 and 29% at 13ql4.3. Fiedler et al. (2002) tested 38 head and neck tumor samples and found that the frequencies of LOH from 13ql4 to 13q34 were 12%-4%. Huang et al. (2002) found DNA copy number decrease occurred most frequently at 13q (24%). 1.10.3. Genetic changes of 13ql4 in premalignancies Deletion of portions of chromosome arm 13ql4 was frequently detected in a wide variety of human cancers. It can also occur in premalignant lesions. Partridge et al. (1998) screened 31 potentially malignant oral lesions presenting as leukoplakia and erythroplakia, with histological evidence of dysplasia, for genetic abnormalities at loci which frequently show allelic imbalance when oral squamous cell carcinomas (SCC). The highest frequency (32%) of allelic imbalance was detected for 13ql4.2 with the Rb gene. Roth et al. (2001) investigated 44 low- and high-grade dysplastic lesions in esophageal patients. There was no LOH at 13ql2.3-13ql4.2 in low-grade dysplasia. However, LOH was detected in high-grade dysplasia (25%). It suggested that LOH at these loci might occur later in the neoplastic process. Tabor et al. (2003) found that all ten samples (100%) with moderate and severe dysplasia and 14 of 21 (67%) with mild dysplasia contained LOH at 13ql4.3. 1.10.4. Main genes at chromosome 13q Deletion mapping studies of 13q in many types of cancer, including those of the head and neck, have suggested 3 regions of the chromosome arm that potentially contain tumor suppressor genes. In head and neck squamous cell carcinoma, discrete regions of deletion have been defined in 13ql4, 13ql2, and 13q34. RBI GENE The well-characterized tumor suppressor gene RBI (retinoblastoma) is located in one of the minimally deleted regions of chromosome 13 (13ql4). However, examination of RBI and its gene product in these tumors revealed no mutation and strongly argues against a significant role of this gene in the development of tumors in SCCHN (Maestro et al., 1996). In addition, Yoo et al. used a number of microsatellite markers and found a common region of deletion between D13S118 and D13S133. This region includes the retinoblastoma gene. However, immunohistochemical staining of the tumor revealed absence of the retinoblastoma protein in only 19% of tumors that showed LOH for Rb. They concluded that the Rb gene was probably not involved in the pathogenesis of SCCHN (Yoo et al., 1994). At the Rb locus, Ransom et 45 al. observed LOH in 2 of 9 (22%) of informative cases again supportive of the concept that Rb is not particularly important in SCCHN (Ransom et al., 1996). BRCA2 GENE The BRCA2, another candidate tumor suppressor gene, is located on chromosome 13ql2-13 and consist of 26 coding exons distributed over approximately 70-kb of genomic DNA (Wooster et al, 1994). It encodes a transcript of 1 l-12kb. The protein product has 3418 amino acids. Like BRCA1, BRCA2 is a large gene in terms of the number of exons and size of the encoded protein, and it has a large exon 11 that contains approximately half of the entire coding region (Tavtigian et al, 1996). Kirkpatrick et al. analyzed 16 that head and neck SCC were found to present LOH including the BRCA2 locus (Kirkpatrick et al, 1997). All 16 tumors were examined for mutations in the coding exons of BRCA2 by single stranded conformational polymorphism (SSCP) and restriction analysis, but no mutations were found. In another study, Nawroz-Danish et al. analyzed exon 11 of BRCA2 at the transcriptional and translational level for truncation mutation in 37 HNSCC with LOH of 13ql2, but found no abnormalities (Nawroz-Danish HM et al, 1998). Partridge et al reported that the low frequency of allelic imbalance (AI) at BRCA2 suggested these sequences are unlikely to be involved in the pathogenesis of oral cancer (Partridge et al., 1999). The findings of Hamel et al. suggested that neither somatic BRCA2 mutations in tumors, nor frequent germline BRCA2 mutations are associated with head and neck cancer development. The results imply that it is unlikely that BRCA2 is the putative 13q tumor suppressor gene associated with SCCHN development (Hamel et al, 1999). 46 ING1 GENE The human ING1 gene was mapped to the subtelomeric region of the long arm of chromosome 13 (13q34) (Zeremski et al, 1997). The candidate tumor suppressor gemlNGl encodes pSS™01, a nuclear protein that physically interacts with TP53. It has been shown that p33mG1 acts in the same biochemical pathway as TP53, leading to cell growth inhibition. Interestingly, a rearrangement of the ING1 gene was found in a neuroblastoma cell line, supporting its involvement in tumor development (Garkavtsev et al, 1996). In addition to 13ql2-13 and 13ql4, a third hot spot of deletion in head and neck tumors has been reported at 13q32-ter, near the locus for the ING1 gene (Maestro et al, 1996). Sanchez-Cespedes et al analyzed 44 primary tumors for LOH at 13q using four widely spaced microsatellite markers, including 13q34. They suggested that ING1 is not a tumor suppressor gene target in head and neck cancer (Sanchez-Cespedes et al, 2000). However, Gunduz et al. reported that 68% of tumors showed loss of heterozygosity at chromosome 13q33-34, where the IGN1 gene is located (Gunduz et al, 2000). Chen et al. examined esophageal squamous cell carcinoma for genetic alterations of ING1 and 59% of the tumors showed allelic loss at chromosome 13q33-34 (Chen et al, 2001). Fiedler et al. also found a high number of losses for the markers located in the region 13q22-34, indicating the importance of INGI and/or other putative suppressor gene (Fiedler et al, 2002). LEVI AND LEU2 GENE Two adjacent genes, termed Leul and Leu2 (leukemia-associated genel and 2), were 47 mapped to the minimally deleted region on chromosome 13ql4. Liu et al screened a panal of 206 primary chronic lymphocytic leukemia cases for deletion of these genes. However, in all cases of 13ql4 loss examined, the first exons of both genes, which are only 300 bp apart, were deleted. They conclud that the Leul and Leu2 genes are strong candates as tumor suppressor gene(s) involved in B- chronic lymphocytic leukemia leukemogenesis (Liu et al, 1997). Gupta et al. examined 25 HNSCC that exhibited allelic loss within this region and for which they had sufficient DNA as well as 17 head and neck SCC cell lines for homozygous deletion of Leul gene multiplex PCR. One oral cavity tumor, exhibited homozygous deletion of Leul, with amplification of the tumor DNA yielding only 5% of the expected Leul signal (Gupta et al, 1999). AP-2REP GENE Recently, a JFTV/EG^Z-related zinc finger repressor gene, AP-2rep (KLF12), was cloned and mapped to the 13q21 region of deletion. Ap-2rep protein has been reported to down-regulate the expression of the AP-2 transcription factor in prostate cancer cell lines (Imhof et al, 1999; Roth et al, 2000). These data suggest that AP-2rep could function as a tumor suppressor gene in prostate cancer (Chen et al, 2001). 48 II. Statement of the problems ILL Where are the additional tumor genes at 13ql4.11 located? Oral SCC is believed to develop through histopathological stages of increasing severity from hyperplasia to mild, moderate and severe dysplasia to carcinoma in situ (CIS), and finally invasive squamous cell carcinoma (SCC). Once invasion occurs and oral SCC is formed, the prognosis is poor and about half of the patients die within 5 years of diagnosis despite recent advancement in treatment. Since the prognosis for cure decreases dramatically after invasion, one key to improve the dismal prognosis of oral cancer is early diagnosis. Accumulation of genetic alterations to critical control genes such as loss of tumor suppressor gene (TSG) is believed to underline the development of neoplasms. Frequent loss of chromosome 13q has been reported in many tumors including oral SCC. Although some tumor genes have been identified in the 13q regions, additional tumor genes, particularly tumor suppressor genes, are presumed to be located at these regions. The identification and location of potential tumor genes is important for the understanding and early diagnosis of oral carcinogenesis. The random amplified polymorphic DNA (RAPD) fingerprinting assay is a high-resolution technique that could scan the whole genome randomly for genetic alterations by simultaneously monitoring multiple loci. One region of deletion, 13ql4.11, has been identified by RAPD method by our research group. This thesis had performed preliminary fine mapping 49 of the region to search for location (minimal regions of alteration, MRA) of novel regions of alterations at 13ql4.11 as part of the collaboration effort to identifying tumor genes in the region. The preliminary fine mapping results using microsatellite analysis from this study were used by other people in the group to further investigate the tumor genes by employing other techniques including BAC arrays and expression assays. Many previous studies in locating tumor genes have used tumor samples only and a major problem for such study design is that cancers are full of'nonspecific' genetic alterations resulting from their intrinsic genetic instability. To avoid the problem, this thesis used a spectrum of tissue samples including SCC and dysplasia to establish the MRA. The rationale for using preinvasive lesions is that alterations occurring in these early lesions are more likely to be a driving force for carcinogenesis rather than due to the random genetic instability seen in tumors. Consequently, studies of preinvasive lesions are more likely to reveal the small region of loss that contains critical tumor genes. II.2. At what stages of oral cancer development do alterations at 13ql4.11 and 8q22 occur? In addition to 13ql4.11, people in our research group had identified two novel hot spots of losses at 8q22 centered at D8S545 and D8S1830. Microsatellite analysis of LOH at 13ql4.11 and 8q22 were to be performed for different stages of oral lesions. Information obtained from LOH studies has dual merit. The finding of frequently lost 50 regions during cancer development can lead to discovery of new TSGs. In addition, LOH findings can provide critical information on the role of the presumptive tumor genes even before the cloning of the tumor gene. For example, studies have shown that there are three discrete regions of loss at 3p, suggesting that each of these three regions contains at least one tumor suppressor gene (Partridge et al, 1996). While we have yet to identify the genes involved at 3p, studies on the timing of such loss during histological progression have already lead to the conclusion that loss on at least one of the regions, 3pl4, is an early critical event for cancer development and is associated with increased cancer risk for oral premalignant lesions (Rosin et al, 2000, 2002). While the preliminary mapping studies in this thesis may yield information on location of putative tumor suppressor genes at 13ql4.11, and also studies from other people in the lab had shown two hot spots for 8q22 (D8S545 and D8S1830), it may be some time before such genes at 13ql4.11 and 8q22 can be identified. Acquisitions of information on at what stage of oral cancer development the new candidate gene is altered will not only provide information on the possible roles of the gene, but may also facilitate the process of identification of the gene. The major objectives of this thesis were to study the potential role of 13ql4.11 and 8q22 in early oral carcinogenesis by investigating at what stages of oral carcinogenesis the alterations occur using microsatellite analysis of LOH of a spectrum of oral premalignant lesions (different degrees of dysplasia) and oral SCCs, and compared the LOH results of the two regions with known regions of losses (LOH at 3p, 9p and 17p). If the results indicate high frequency of losses of these two regions during early carcinogenesis, it would support the 51 presence of tumor genes in these two regions. III. Objectives 1. To use microsatellite analysis to preliminarily examine (fine-mapping) DNA extracted from mild dysplasia, moderate dysplasia, severe dysplasia, carcinoma in situ (CIS) and SCC for novel alterations in the 13ql4.11 region. 2. To determine at what stage of oral cancer development the alterations at 13ql4.11 and 8q22 (D8S545 and D8S1830) occur by performing microsatellite analysis on a spectrum of different stages of oral premalignant lesions (mild dysplasia, moderate dysplasia, severe dysplasia, CIS) as well as invasive SCC. 3. To compare data obtained above with LOH at 3p, 9p and 17p using the same sample set. 53 IV. Hypothesis 1. Microsatellite analysis of oral premalignant and malignant samples will reveal novel allelic loci in the region of 13ql4.11, which contain one or several putative tumor genes. 2. LOH at 8q22 and 13ql4.11 occurs in a significant proportion of premalignant lesions. If the data support these hypotheses, it would suggest that minimal regions of alterations (MRA) exist at 8q22 and 13ql4.11 that harbors one or more putative tumor suppressor genes, and will also identify the stage that these regions are lost during early oral carcinogenesis. 54 V. Materials and Methods V . l . Sample sources Archival paraffin blocks were supplied by the Provincial Oral Biopsy Service located at Department of Pathology and Laboratory Medicine, Vancouver Hospital & Health Sciences Center. The use of these samples was approved by the University Ethics Committee. V.2. Sample sets A total 98 specimens were used for this study: 58 are preinvasive lesions (mild, moderate, and severe dysplasia/CZS) and 40 are invasive SCC (Table 7). Table 7. Types of premalignancies and SCC used in this study Lesion types Number of cases Mild Dysplasia 28 Moderate Dysplasia 14 Severe Dysplasia/CIS 16 SCC 40 Total 98 Severe dysplasia and CIS were grouped together because histologically they are very 55 similar and it is sometimes difficult to distinguish one from the other. Furthermore, both premalignant conditions behave similarly in terms of clinical outcome and should merit the same treatment (Mashberg & Samit; 1989 and 1995; Waldron & Shafer, 1975). V.3. Criteria for sample selection V.3.1. Histological diagnosis The histopathological diagnoses for these lesions were performed independently by Dr L. Zhang and Dr. R. Priddy, oral pathologists at the University of British Columbia, using criteria established by the World Health Organization (WHO, 1978). Only those cases in which an agreement was reached on diagnoses between the two pathologists were used. V.3.2. Sample size The samples were large enough to yield sufficient DNA from both the epithelium and from the connective tissue for multiple RAPD and LOH analyses. V.3.3. History of cancer All the premalignant lesions used in the study were confirmed to not have a previous history of cancer. All the SCC samples used in the study were primary cancer. This 56 information was obtained from hospital records and by using a computer linkage with British Columbia Cancer Registry, where all the cancer in the province must be registered. V.4. Clinical information The following clinical data were obtained for the cases studied by examining pathology reports and hospital charts: smoking habit, age and gender of the patients and anatomical location of the lesions. Some of this information was not recorded for some cases (see Result section). V.5. Slide preparation When a case fit the selection criteria, i.e., confirmation of histological diagnosis by 2 pathologists, sufficient sample size, and no prior history of HNSCC, the tissue block for the case was selected from the archive for cutting. One 5 microns thick section was cut and stained with H&E (hematoxylin and eosin) and coverslipped for reference. Further sections for microdissection were then cut at a 10 to 12 microns thickness and put on glass slides with approximately 15 slides per sample. These sections were also stained with H&E but left uncoverslipped. The H&E procedure for the slides is described below: Slides were baked at 37°C overnight in an oven, then at 60-65°C for 1 hour and left at room temperature to cool. Samples were deparaffinized by two changes of xylene for 15 minutes each, which were cleared in graded ethanol (100%, 95% and 70%), and then by rinsing 57 in tap water. Slides were then placed in Gill's Hematoxylin for 5 minutes followed by rinsing in tap water and were then blued with 1.5% (w/v) sodium bicarbonate for 1 minute. After rinsing in water, slides were lightly counterstained with eosin for 10 seconds, dehydrated in graded ethanol, and then cleared in xylene for coverslipping. Thick sections to be dissected were stained by the above procedure without the dehydration step, and air-dried. V.6. Microdissection Microdissection of the specimens was either performed or supervised by Dr. L. Zhang, an oral pathologist. Areas of dysplasia were identified using H&E stained sections cut from formalin-fixed paraffin-embedded tissues. Epithelial cells in these areas were then meticulously dissected from adjacent non-epithelium tissue under an inverted microscope using a 23-G needle. The non-epithelial underlying stroma dissected out from the same tissue block was used as controls. All samples were coded in such a way that the analysis of LOH would be performed without the knowledge of the sample diagnosis. V.7. Sample digestion and DNA extraction The microdissected tissue was placed in a 1.5 ml eppendorf tube and digested in 300 ul of 50 mM Tris-HCL (pH 8.0) containing 1% sodium dodecyl sulfate (SDS) proteinase K (0.5 mg/ml) at 48° C for 72 or more hours. During incubation, samples were spiked with 10 or 20 ul of fresh proteinase K (20 mg/ml) twice daily. The DNA was then extracted 2 times with PC-9, a phenol-chloroform mixture and precipitated with 70% ethanol in the presence of glycogen, 58 and washed with 70% ethanol. The samples were then re-suspended in LOTE, a low ionic strength Tris buffer, and submitted for DNA quantitation (Rosin et al 1997; Zhang et al, 1997). V.8. DNA quantitation Fluorescence analysis with a Picogreen kit (Molecular Probes) was used to quantitate DNA. This method used 2 standard curves. The low concentration standard curve was used for samples with 1 to 20 ng/ul, while the high concentration standard curve was used for concentrations between 10 and 400 ng/ul. Absorbance was read with a SLM 4800C spectrofluorometer (SLM Instruments Inc. Urbana, IL). The sample DNA concentration was then determined from one of the standard curves depending on its concentration, hence absorbance. A series of dilutions were done subsequently to adjust the concentration of DNA to 5 ng/ul with LOTE buffer (Rosin et al 1997; Zhang et al 1997). V.9. Primers V.9.1. Primers for fine mapping Microsatellite markers in the region close to the two regions of deletion, one at 8q22 and another at 13ql4 as identified by RAPD, were determined using map information provided by the Ensembl system (http://www.ensembl.org) and UCSC (http://www.genome.cse.ucsc.edu/index.html). Markers with high degree of heterozygosity were chosen. The sequence and details of each new region primer pair of 8q and 13q are listed in Table 8 & Table 9. 59 Table 8. Primers used on chromosome 8q22 Oligo name Sequence 5'-> 3' Size (BP) Annealing temp. (°C) Location D8S545F D8S545R A C A G A A A C A G T C C C T G T C T C A A A T A G G A A C A A T C A G G A T G C A A A T 187 60 8q22.3 D8S1830F D8S1830R T G C A C C T T G T G G A T G G A C C T C A A A T C A G A T T A G A G A G C C 149-187 55 8q22 D8S1738F D8S1738R CTG T C A GTG CTT G A G C A G A CTT GTC A G T TTC C T A TGC G T A GTA A 189 60 8q22 D8S506F D8S506R TTT C T A TTA C C A CCT T C A TTG C ATT TTG TTA GTT TGT TTT CTT GAT G 121-132 58 8q22 D8S559F D8S559R A A T T G A A G T G A G G T A G G A G G T T G A G C T A T T G C T C T T A C A G G A G G G 218 60 8q22 D8S1814F D8S1814R TGC A C T CCT A T G A G G C A A G G C T C A A C C A G A A A A T A C TTA G A 212-230 60 8q22 D8S1844F D8S1844R TGG CTC A A A GTA C A C GTC A GCT GCT G A G TGC A T G A A 190-200 60 8q22 60 Table 9. Primers used on chromosome 13ql4.11 Oligo name Sequence 5'-> 3' Size (BP) Annealing temp. (°C) Location D13S1297F D13S1297R T G T C C C G C T A C T G C C C A C C A T G C A A T G C C A G G 163 55 13ql4.11 D13S263F D13S263R CCCAGTCTTGGGTATGTTTTTA CCTGGCCTGTTAGTTTTTATTGTTA 149 60 13ql4.11 D13S1227F D13S1227R A A G C C A T C A C T G T G T T C C C T G C T T G G G T G G A A T G C 124 55 13ql4.11 D13S765F D13S765R T G T A A C T T A C T T C A A A T G G C T C A T T G A A A C T T A C A G A C A G C T T G C 193 60 13ql4.11 D13S1270F D13S1270R A C A T G A G C A C T G G T G A C T G G G C C T C A A A T G T T T T A A G C A 168-184 60 13ql4.11 D13S168F D13S168R G C C T A G C C C A G T G G T G TGCTTGTGCCTATGTTCTTG 173-197 60 13ql4.11 D13S164F D13S164R G C T G T G A T T G C A C C A C C A T T A C A G G C G T G A C A C A C C 208-219 60 13ql4.11 V.9.2. Primers for LOH analysis of different stages of oral lesions Previous studies showed high frequency of LOH at chromosomes 3p, 9p, 13q and 17p in different stages of oral lesions. This study used same sample set to compare the novel regions genetic alteration with these chromosome arms. The microsatellite markers used for LOH analysis came from Research Genetics (Huntsville AL) and mapped to the following regions: (1) 3pl4.2, D3S1234, D3S1228, and D3S1300; (2) 9p21,1 FN A, D9S171, and D9S1748; (3) 13q31, D13S170; (4) 17pll-pl3, CHRNB1, tp53, andD17S786. V.10. Primer extension preamplification (PEP) 61 If the concentration of DNA was low (<1000 ng total DNA), a procedure called primer-extension preamplification (PEP) was done to increase the mount of DNA. This step involved amplification of multiple sites of the genome using random primers and low stringency conditions. It was carried out in a 60 ul reaction volume containing 20 ng of the DNA sample, 900 mM of Tris-HCL of pH 8.3, 2 mM of dNTP where N is A, C, G and T, 400 u.M of random 15-mers (Operon Techologies), and 1 u.1 of Taq DNA polymerase (GibcoBRL, 5 U/uA). Two drops of mineral oil were added prior to the reaction. PEP using the automated thermal cycle (Omigene HBTR3CM, Hybaid Ltd) involved 1 cycle of pre-heat at 95 °C for 2 min, followed by 50 cycles of: 1) denaturation at 92 °C for 1 min, 2) annealing at 37 °C for 2 min, and 3), ramping from 37 °C to 55 °C at 10 sec/degree, polymerization at 55 °C for 4min. V . l l . E n d - l a b e l i n g One more step prior to PCR was end labeling of one member of the primer pair. The 50ul reaction contained 38u.l of PCR standard water, 5u.l of 10 x buffer for T4 polynucleotide kinase (New England BioLabs), lul 10 x BSA, luJ one of the primer pair, 3[xl T4 polynucleotide kinase, and 2 u.1 [y-32P] ATP (20 uCi, Amersham). The PCR reaction included 1 cycle at 37° C for 60 min run on the thermal cycles (Rosin et al 1997; Zhang et al 1997). V.12. PCR a m p l i f i c a t i o n a n d LOH a n a l y s i s PCR amplification using the thermal cycle was carried out in a 5 ul reaction volume containing 5 ng of genomic DNA, 1 ng of labeled primer, 10 ng of each unlabeled primer, 1.5 mM each of dATP, dGTP, dCTP, and dTTP, 0.5 units of Taq DNA polymerase (Life 62 Technologies), PCR buffer [16.6 mM ammonium sulfate, 67 mM Tris (pH8.8), 6.7 mM magnesium chloride, 10 mM 2-mercaptoethanol, 6.7 mM EDTA, and 0.9% dimethyl sulfoxide], and 2 drops of mineral oil. Amplification involved 1 cycle of pre-heat at 95°C for 2 minutes; and 40 cycles of 1) denaturation at 95°C for 30 seconds, 2) annealing at 50-60°C (depending on the primer used) for 60 seconds, and 3) polymerization at 70°C for 60 seconds; and 1 cycle of final polymerization at 70°C for 5 minutes. The PCR products were then diluted 1:2 in loading buffer, separated on 7% urea-formamide-polyacrylamide gels, and visualized by autoradiography. The films were then coded and scored for LOH without knowing the diagnosis (Rosin et al 1997; Zhang et al 1997). V.13. Scoring of allelic loss The assessment of loss of heterozygosity (LOH) relies on the identification of changes in,the allele intensity ratio between tumor alleles and normal control alleles due to the loss of one allele. For informative cases (meaning both alleles were of different length and thus could be distinguished from one another on the gel), allelic loss was scored if the signal intensity of the band was at least 50% less than its normal control counterpart from the connective tissue DNA (Rosin et al 1997; Zhang et al 1997). Theoretically, if a region is lost, it will not be amplified and therefore will not appear on the film. However, since there are always some normal cells included in the cells microdissected from the lesions, and genetic variation exists within the lesion, researchers have adopted a 50% cutoff (Emilion et al 1996) (i.e. a reduction in the intensity of one of the alleles by 50% in the lesion DNA compared to normal DNA). This cutoff is arbitrary but nevertheless has been the common standard in LOH studies. 63 64 VI. Results VI.l. Results on 13ql4.11 VI. 1.1. Minimal region of alteration at D13S1297 In Tumor Samples: To establish the minimal region of alteration (MRA) at 13q. D13S164, D13S168, D13S1227, D13S765, D13S263, D13S1270 and D13S1297 were first tested. 40 oral squamous cell carcinomas (SCCs) cases were fine mapped around the region atD13S1297. Two primers were used that mapped to either side of D13S1297: D13S263 (a neighboring microsatellite marker 1.6 Mbp centromeric to D13S1297) and D13S1227 (a neighboring microsatellite marker 0.3 Mbp telomeric to D13S1297). Thirty of these 40 SCC were informative for the 3 markers. Of these 30 tumors, 24 showed losses for one or all of the three primers (D13S263, D13S1297 and D13S1227). The results of the 24 tumors were listed in Table 10. Four tumors were non-informative at D13S1297 (112T, 202T, 122T, and 342T). Only 4 of the 20 (20%) tumors that were informative for D13S1297 showed retention at D13S1297 (2T, 123T, 114T and 385T). Sixteen informative tumors showed loss at D13S1297. The 16 65 tumors with LOH at D13S1297 demonstrated that the loss has extended to include the centromeric region (D13S263) in 9 cases (115T, 116T, 118T, 414T, 620T, 543T, 125T, 161T, and 451T), and extended to include the telomeric region (D13S1227) in 5 cases (115T, 116T, 118T, 414T, and 620T). However, a centromeric boundary at D13S263 was observed in 6 of the 16 (38%) tumors (386T, 539T, 542T, 469T, 569T, and 577T) and a telomeric boundary at D13S1227 was observed in 4 of the 16 (25%) tumors (386T, 469T, 539T and 542T) (Figure 4) 66 Table 10. Microsatellite mapping of chromosome arm 13ql4.11 in SCC cases Case number Primers D13S263 D13S1297 D13S1227 112T L NI L 202 T L NI NI 122 T R NI L 342 T R NI R 2T L R ND 123 T L R L 114T R R L 385 T R R R 115 T L L L 116T L L L 118T L L L 414T L L L 620 T L L L 543 T L L ND* 125 T L L NI 161 T L L NI 451 T L L NI 43 T NI L NI 386 T R L R 539 T R L R 542 T R L R 469 T R L R 569 T R L ND 577 T R L ND *ND: Not done due to running out of DNA. 67 Figure 4. Examples of allelic loss and retention in the MRA D13S263 D13S1297 D13S1227 542T 539T In Dysplasia Samples: Studies have shown that minimal region of loss, with progression of carcinogenesis, could expand to include larger areas of loss or even the whole chromosome. It is expected that a high proportion of tumors would show larger areas of chromosome loss in regions that previously show M R A . Early lesions (dysplasias) should have less chromosome instability and hence show the M R A better. For this reason, 58 dysplasia cases were fine mapped around the region of D13S1297 similar to the tumor cases. Forty-six of the 58 dysplasias were informative for the 3 markers. Of these 46 dysplasias, 19 showed losses for one or all of the three primers (D13S263, D13S1297 and 68 D13S1227). The results of the 19 dysplasias were listed in Table 11. One dysplasia was non-informative at D13S1297 (373D). Only 5 of the 18 (28%) dysplasias that were informative for D13S1297 showed retention at D13S1297 (586D, 325D, 735 D, 737 D, and 752 D). Thirteen of the 18 (72%) dysplasias showed loss at D13S1297. The 13 dysplasias with LOH at D13S1297 demonstrated that the loss had extended to include the centromeric region (D13S263) in 4 lesions (747D, 380D, 204D, and 75 ID), and extended to include the telomeric region (D13S1227) in 4 cases (747D, 649D, 755D, and 585D). A larger proportion of the dysplasias with LOH at D13S1297 showed boundaries: a centromeric boundary at D13S263 was observed in 7 of the 13 (54%) dysplasias (585D, 292D, 332D, 535D, 567D, 612D, and 209D) and a telomeric boundary at D13S1227 was observed in 6 of the 13 (46%) dysplasias (292D, 332D, 535D, 567D, 612D, and 209D). 69 Table 11. Microsatellite mapping of chromosome arm 13ql4.11 in dysplasia cases Case number Primers D13S263 D13S1297 Z)/557227 373 D R NI L 586 D L R R 325 D L R R 735 D R R R 737 D NI R NI 752 D R R L 747 D L L L 380 D L L ND* 204 D L L ND 751 D L L NI 649 D NI L L 755 D ND L L 585 D R L L 292 D R L R 332 D R L R 535 D R L R 567 D R L R 612 D R L R 209 D R L R *ND: Not done due to running out of DNA. VI. 1.2. Frequency of LOH at D13S1297 in oral premalignant and malignant lesions To determine at what stage of oral cancer development the alterations at D13S1297 70 occur, a whole spectrum of oral lesions was analyzed for LOH atD13S1297, including 42 low-grade dysplasias (mild or moderate), 16 high-grade dysplasias (severe dysplasia or CIS), and 40 SCC. LOH at AI D13S1297 was noted in 7 of the 30 (23%) informative low-grade dysplasias, 7 of 12 (58%) high-grade dysplasias, and 17 of 30 (57%) SCCs (Table 12). Table 12. L O H at D13S1297 in a spectrum of primary oral premalignant and malignant lesions Diagnoses Number of cases Informativity3 L O H b Low-grade dysplasia 42 30/42 (71%) 7/30 (23%) High-grade dysplasia 16 12/16 (75%) 7/12 (58%) SCC 40 30/40 (75%) 17/30 (57%) "Informativity: Number of cases informative for this locus (showing 2 bands)/total case number. b Number of cases showing LOH/total number of informative cases. VI.1.3. Comparison of LOH at D13S1297 (13ql4.11) with LOHatD13S170 (13q31) in oral premalignancies and tumors To determine whether D13S1297 (13ql4.11) is distinct from known regions of tumor suppressor gene losses on 13q, the primer D13S170 was investigated using the same sample set as described in the above section. D13S170 was originally believed to be located at 13ql2.3-13 and found frequently lost in oral SCC (Califano et al., 1996; Ogawara et al., 1998; Mutirangura et ai, 1999; Sanchez-Cespedes et al., 2000; Lo et ai, 2000; Fiedler et al., 2002), and also observed in the oral premalignant lesions (Rosin et ai, 2000; 2002). However, the location of 71 the marker has changed recently to 13q31, 40 Mbp telomeric to D13S1297, according to Human Genome project draft shown in the University of California Santa Cruz database (www.genome.cse.ucsc.edu) and the Ensembl Genome Browser (www.ensembl.org). As shown in Table 13, LOH at D13S170 (13q31) was present in 5 of the 29 (17%) informative low-grade dysplasias. With progressing dysplasia and formation of invasive SCC, there was a steady increase in the frequency of LOH at D13S170 from 31% (4/13 informative cases) of high-grade dysplasias to 43% (15/35 informative cases) of SCC. The increase from low-grade dysplasia to high-grade dysplasia, however, was not significant for D13S170 (P = 0.4233) by student t test. Nor was the increase from high-grade dysplasia to SCC (P = 0.5218), although LOH frequency for SCC was significantly higher than that of the low-grade dysplasia (15/35 vs. 5/29, P = 0.0334). In contrast, LOH at D13S1297 (13ql4.11) was shown in 23% of the low-grade dysplasia. Compared to D13S170, there was a sharper rise of LOH frequency from low-grade dysplasia to high-grade dysplasia, and the rise was approaching significant (23% vs. 58%, P = 0.0666). The frequency of LOH plateaued at the stage of high-grade dysplasia (58% versus 57% in SCC,P= 1). 72 Table 13. Comparison of L O H at D13S1297 (13ql4.11) with L O H atD13S170 (13q31) Primer Low-grade dysplasia High-grade dysplasia P value (low- vs. high-grade dysplasia) SCC P value (SCC vs. high-grade dysplasia) D13S170 5/29(17%)* 4/13 (31%) 0.4233 15/35 (43%) 0.5218 D13S1297 7/30 (23%) 7/12 (58%) 0.0666 17/30 (57%) 1 * Number of cases showing LOH/total number of informative cases. Table 14 examined how frequent LOH at D13S1297 and D13S170 occur together or independently of each other in the same samples. The majority of samples (91% low-grade dysplasia and 90% high-grade dysplasia and 61% SCC) showed different LOH pattern for the two primers in the same samples. Table 14. L O H at D13S1297 and D13S170: frequencies at which these alterations occur together or independent of each other # of cases LOH at LOH at L O H at both Total # cases with informative at D13S1297 D13S170 D13S1297 & different pattern both loci only only D13S170 (%)" Low-grade dysplasia 11 7 ' 5 1 10/11(91%) High-grade dysplasia 10 7 4 1 9/10(90%) SCC 18 16 9 7 11/18(61%) Value given as number of samples showing AI for one primer but retention for the other (% of cases in parentheses). VI.2. Results on 8q22 73 VI.1.2. Frequency of LOH at D8S545 and D8S1830 in oral premalignant and malignant lesions To determine at what stage of oral cancer development the alterations at D8S545 and D8S1830 occur, a whole spectrum of oral lesions was analyzed for LOH at D8S545 and D8S1830, including 40 low-grade dysplasias (mild or moderate), 14 high-grade dysplasias (severe dysplasia or CIS), and 38 SCC (Table 15). LOH frequency at AI D8S545 was noted to increase with progression of the lesions: in 4 of the 22 (18%) informative low-grade dysplasias, 3 of 12 (25%) high-grade dysplasias, and 11 of 26 (42%) SCCs (Table 15). However, no statistical difference in the frequency of LOH was present among the three histological groups (low-grade dysplasia, high-grade dysplasias and SCC): low-grade dysplasia versus high-grade dysplasia (18%> vs. 25%, P = 0.6769); high-grade dysplasia versus SCC (25% vs. 42%, P = 0.4722); or low-grade dysplasia versus SCC (18% vs. 42%, P = 0.1179), even though the frequency of LOH in SCC is more than twice that of the low-grade dysplasia. LOH at AI D8S1830 was noted in 22 of the 38 (58%) informative low-grade dysplasias, 4 of 12 (33%) high-grade dysplasias, and 13 of 31 (42%) SCCs (Table 15). There was no difference in the frequency of LOH among the three histological groups (low-grade dysplasia, high-grade dysplasias and SCC): low-grade dysplasia versus high-grade dysplasia (58% vs. 33%, P = 0.1902); high-grade dysplasia versus SCC (33% vs. 42%, P = 0.7346); or low-grade 74 dysplasia versus SCC (58% vs. 42%, P = 0.2301). Table 15. L O H at D8S545 and D8S1830 in a spectrum of primary oral premalignant and malignant lesions Primer Low-grade dysplasia High-grade dysplasia SCC LOH % No. ofNI* LOH % No. ofNI L O H % No. ofNI D8S545 4/22(18%) 11 3/12 (25%) 2 11/26 (42%) 12 D8S1830 22/38 (58%) 2 4/12 (33%) 1 13/31 (42%) 6 * NI: non-informative cases. VI.3. Comparison of L O H at 13ql4.11 (D13S1297) and at 8q22 (D8S545 and D8S1830) with L O H at 3pl4, 9p21 and 17pll-13 in oral premalignancies and tumors In this study, several regions that have been found to be frequently lost early during oral carcinogenesis were also assayed for LOH: 3pl4 (D3S1234, D3S1228, andD3S1300), 9p21 (IFNA, D9S171, and D9S'1748) and 17pl 1-13 (CHRNB1, tp53, andD17S786). LOH frequencies at 13ql4.11 (D13S1297) and at 8q22 (D8S545 and D8S1830) were compared to those at3pl4, 9p21 and 17pll-13. LOH frequencies at 3pl4 and 9p21 were high in low-grade dysplasia (46% and 55% respectively), consistent with previous findings that alterations at 3p and 9p are the early events; Peak LOH frequencies for 3pl4 and 9p21 seemed to be at high-grade dysplasia (64% 75 and 81% respectively), and plateaued in invasive SCC (60% and 69%). On the other hand, LOH frequency at 17pl 1-13 was low in low-grade dysplasias (16%), and rose with progression of the lesions (29% of high-grade dysplasias) and peaked with the formation of the invasive SCC (64%). LOH at 13ql4.11 (D13S1297), similar to LOH at 3pl4 and 9p21, also rose from low-grade dysplasia to high-grade dysplasia, and peaked at the high-grade dysplasia. However, LOH at 13ql4.11 (D13S1297) was not seen in low-grade dysplasia as frequently as 3pl4 and 9p21: the frequency of LOH at 13ql4.11 (D13S1297) (23%) was lower in low-grade dysplasia compared to those of 3pl4 (46% vs. 23%, P = 0.0730, approaching significant) and 9p21 (55% vs. 23%, P = 0.0136). The pattern of LOH at D8S545 paralleled that of 17p 11 -13 closely: both are low at low-grade dysplasia (18% for D8S545 and 16% for 17pl 1-13), higher in high-grade dysplasia (25% for D8S545 and 29% for 17pl 1-13) and highest in invasive SCC (42% for D8S545 and 64% for 17pl 1-13). LOH frequency at D8S1830 was high (58%) in low-grade dysplasia, similar to those of 3pl4 and 9p21. However, unlike the pattern of LOH at 3pl4 and 9p21, there was no increase in LOH frequency with progression of the lesions (Table 16 and Figure 5). 76 Table 16. Comparison of L O H at 13ql4.11 (D13S1297) and 8q22 (D8S545 and D8S1830) with L O H at 3pl4, 9p21 and 17pll-13 Chromosome arms L O H frequencies (%) Low-grade dysplasia High-grade dysplasia SCC 3pl4 16/35 (46%) 9/14 (64%) 24/40 (60%) 9p21 22/40 (55%) 13/16(81%) 27/39 (69%) 17pll-13 3/19 (16%) 8/28 (29%) 18/28 (64%) 13ql4.11 (D13S1297) 7/30 (23%) 7/12 (58%) 17/30 (57%) 8q22 (D8S545) 4/22(18%) 3/12 (25%) 11/26 (42%) 8q22 (D8S1830) 22/38 (58%) 4/12 (33%) 13/31 (42%) 77 Figure 5. Comparison of AI of 13ql4.11 and 8q22 with other chromosome arms A Low grade dysplasia High grade dysplasia Grade of Lesions SCC -• - 3pl4 9p21 lSql4.ll 17pll-13 - A 8q22(D8S545) • 8q22(D8S1830) 78 VII. Discussion This thesis has fine mapped a region of deletion (identified through RAPD scanning) at 13ql4.11 and found a minimal region of alteration (MRA) at D13S1297. Our research group has also identified two other MRAs at 8q22 (D8S545 and D8S1830). Using a large number of oral lesions at different stages of oral carcinogenesis (different degree of dysplasia and invasive SCC), this thesis has for the first time investigated the possible roles of the three new hot spots (D13S1297, D8S545 and D8S1830) during oral carcinogenesis. In the following discussion, the temporal changes of the 3 new hotspots during the multistage carcinogenesis will be discussed first and this will be followed by a discussion of fine mapping and possible new tumor suppressor genes at D13S1297, D8S545 and D8S1830. VII.l. 13ql4.11 (D13S1297) There is strong evidence indicating that accumulations of changes to critical control genes (oncogenes and TSGs) underline the progression of lesions from hyperplasia to increasing degree of dysplasia (mild, moderate, and severe/CZS) and finally to invasive SCC. Although a molecular progression model has been first proposed by Califano et al. (1996), and later refined by Rosin et al. (2000), genes and chromosome loci investigated in the model are limited. Understanding of the additional genetic changes and of their timing during the molecular progression of oral cancer is critical for our further understanding of mechanisms of the tumor progression and prediction of cancer risk of oral premalignant lesions as well as intervention and management of high-risk oral lesions. 79 Even when new hot spots are identified and studies in oral premalignant lesions are still very limited because of the difficulty of obtaining suitable specimens for analysis and technical problems associated with working with very small lesions and little amounts of DNA (Califano et al, 1996; Emilion et al, 1996; Roz et al, 1996; Zhang et al, 1997). Studies from this thesis not only provide a potential new hot spot for tumor genes at 13ql4.11, but also yield important information on the temporal changes of the new hot spot D13S1297 during oral carcinogenesis. VILLI. Temporal changes at D13S1297 Temporally, low-grade dysplasia already started to show LOH at D13S1297 (23%). This thesis compared LOH atD13S1297 with LOH at 3pl4 and 9p21, which are the known earliest events in oral carcinogenesis. The frequency of LOH a\D13S1297 in low-grade dysplasia is significantly or approaching significantly lower than the frequency of LOH for 9p21 (23% vs. 55%, P = 0.0136) and 3pl4 (23% vs. 46%, P = 0.0730), suggesting that LOH at 3pl4 and 9p21 occurs before LOH at the new hot spot D13S1297. There was a sharp rise of LOH frequency for D13S1297 from low-grade dysplasia to high-grade dysplasia, and the rise was approaching significant (23% vs. 58%, P = 0.0666). The frequency of LOH for D13S1297 plateaued at the stage of high-grade dysplasia (58% versus 57% in SCC, P = 1). These data suggest that LOH at D13S1297 may be late event during the preinvasive stage of oral carcinogenesis (high-grade dysplasia), and appearance of LOH at for D13S1297 may indicate high-risk for malignant transformation. 80 VII.1.2. LOH at D13S1297 occurred independently of LOH at D13S170 LOH at D13S170 has been reported to be frequently lost in oral SCC and our lab has reported its frequent loss in oral premalignant lesions (Rosin et ai, 2000, 2002). Until recently the marker D13S170 was believed to be located at 13ql2 but new evidence points to its location at 13q31. Regardless of the location of D13S170, my study results clearly indicated that LOH at the new hot spot D13S1297 occurred independently of LOH at D13S170. LOH at D13S170 was temporally different from LOH at the new hot spot D13S1297. While the latter peaked at the high-grade dysplasia, LOH at D13S170 peaked at SCC. More importantly the results (Section VI. 1.3, Table 14) demonstrated that the majority of samples did not show LOH at the new hot spot D13S1297 simultaneously or synchronously with LOH at D13S170. The discordance of the new hot spot D13S1297 with D13S170 occurred in 91% of low-grade dysplasia, 90% of high-grade dysplasia and 61% of SCCs. VII. 1.3. D13S1297, a new hot spot at 13ql4.11 To fine map the region of alteration at 13ql4.11 as identified by RAPD scanning, this thesis examined 40 oral SCC samples for allelic imbalance using microsatellite analysis (see Table 10 in Section VI.1.1). Thirty of the 40 tumors were informative. Of these 30 tumors, 20 showed LOH at the new hot spot D13S1297. For 6 of these 20 samples (386T, 539T, 542T, 469T, 569T, and 577T), the LOH at the new hot spot D13S1297 was flanked by retention at D13S263 (a neighboring microsatellite marker 1.6 Mbp centromeric to D13S1297), suggesting the presence of a centromeric boundary at that locus. Further analysis with an additional 81 marker, D13S1227 (a neighboring microsatellite marker 0.3 Mbp telomeric to D13S1297) revealed the other boundary in 5 cases (115T, 116T, 118T, 414T, and 620T). To further confirm these data, 58 dysplasias were analyzed using the same microsatellite markers. Forty-six of the 58 dysplasias were informative for the three markers. Of the 46 informative lesions, 18 showed LOH at the new hot spot D13S1297. For 7 of these 18 samples (585D, 292D, 332D, 535D, 567D, 612D, and 209D), the LOH at the new hot spot D13S1297 was flanked by retention at D13S263 centromerically, and for 6 of the 18 samples (292D, 332D, 535D, 567D, 612D, and 209D), LOH at D13S1297 was flanked by retention telomerically. All these data support a 1.9 Mbp minimal region of alteration (MRA) spanning D13S263 and D13S1227. VII.1.4. D13S1297 andAKAP220gene The finding of a minimal region at D13S1297 and the results of a high frequency of LOH at D13S1297 during oral carcinogenesis all point to presence of important tumor gene(s) within the MRA that drives oral carcinogenesis instead of random events. Further studies are warranted. Within this 1.9 Mbp minimal region there are 2 known genes, A-Kinase Anchoring Protein 220 (AKAP220) and Receptor Activator of NK-kappa-B Ligand (RANKL) [also known as Osteoclast Differentiation Factor (ODF), Osteoprotegerin Ligand (OPGL), Tumor Necrosis 82 Factor Ligand Superfamily member 11 (TNFSF11), or TNF-Related Activation-Induced Cytokine (TRANCE)]. As a subsequent step of my study, another graduate student in our research group investigated which of the two genes is involved in oral carcinogenesis. First the graduate student verified the map position of these genes by sequence alignment with BACs as shown in Figure 6A. AKAP220 maps to RP11-215B13 and RANKL maps to RP11-86N24. The MRA as identified by my fine mapping is distinct from regions previously described in the literature for head and neck SCCs (Yoo et al, 1994; Gupta et al., 1999; Maestro et al, 1996) and excludes Rb, Leu, and BRCA2 (Figure 6B and C). Yoo et al. and Gupta et al. reported an MRA that included Rb and extended telomerically. This region was further fine mapped to exclude Rb by Ogawara et al. (1998). Maestro et al. (1996) described a region that includes the Rb locus but extends centromerically. The location of the 1.9 Mbp MRA defined in this work to the aforementioned papers is indicated in Figure 6C. As shown on this figure, BRCA2 is 9 Mbp centromeric, the Leu locus is ~6 Mbp telomeric and Rb is 5 Mbp telomeric to the MRA. 83 Figure 6. Physical map between D13S220 and D13S170 on 13q 471M10 264M3 D13S263 i 157L14 346L13 573H8 2 PS 229H11 133D8 BRCA2 " B 1 1 717M18 322M14 AKAP220 RANKL SMAL D13S1297 1 i , 84N7 86N24 391A18 149L7 215B13 RB DLEV1 D13S1227 I 145.13 -/A 127C12 • C/3 s — r- M rs wen tfl — — — m _i O Q O - g o=tece 4Mb i This Work . Maestro etal 1996 , Ogawara etal 1998 . Yoo etal 1994 , Gupta et al 1999 A: B C A conting spanning region between D13S765 and D13S168. Microsatellite markers and genes within the minimal region of alteration have been placed onto corresponding BACs. B: Relative position of microsatellite marker surrounding the 13ql4.11 region. C: Summary of the M R A previously reported in oral and head and neck cancer. Next, the graduate student investigated the expression level of the two genes (RANKL and AKAP220). Eleven normal oral mucosa samples from individual without cancer or dysplasia and 16 oral SCCs were microdissected and RNA was extracted, cDNA produced and expression measured using semiquantitative RT PCR. RANKL showed no change in expression level in tumors compared to levels in normal tissue. In contrast, 12 of 16 tumors showed significant overexpression of AKAP220. 84 AKAP220 acts as a competitve inhibitor of type 1 protein phophatase (PP1) activity with this inhibition enhanced by the presence of the RII regulatory unit of protein kinase A (PKA) (Shillace and Scott 1999; Schillace et al, 2001). PP1 catalyzes the dephosphorylation of the RB protein thus acting as a negative regulator of cell cycle progression (Rubin et al, 1998; Oliver and Shenolikar, 1998). Since AKAP220 inhibits this activity, its overexpression could lead to hyperphosphorylation of pRb, release of E2F and the transcription of genes involved in cell cycle and lead to proliferation (Figure 7). Other members of this pathway have been studied in oral and head and neck cancers. Both cyclin DI and MTSllpl6/INK4 are frequently dysregulated by multiple mechanisms (Lese et al, 1995, Piboonniyom et al, 2002, Yakushiji et al, 2001). In contrast, RB is seldom mutated (Yoo et al, 1994; Li et al, 1994). The involvement of AKAP220 may be yet another mechanism of disrupting this critical pathway and its dysregulation may contribute significantly to alterations in cell cycle regulation that facilitate progression of OPLs. 85 Figure 7. A schematic diagram summarizing the role of AKAP220 in cell cycle regulation. VII.2. 8q22 (D8S545 and D8S1830) In general, the observation of a high frequency of LOH in a microsatellite region in a set of tumors or dysplasias is regarded as an indication of the presence of a putative suppressor gene nearby. However, the differentiation of allelic loss from duplication or low-level amplification of an allele, particularly if there are contaminating normal cells within the tumor, is not always possible (Ah-see et ai, 1994). Both alterations would result in a change in the relative signal intensities for the two alleles in the lesion DNA. Therefore, in certain instances microsatellite analysis could also observe oncogene changes. For this reason, some studies 86 have labeled the alterations identified by microsatellite analysis as allelic imbalance instead of LOH. Although most studies reported that changes at 8q during carcinogenesis represent gains instead of losses, this thesis has stick to the term LOH for the purpose of consistency because our previously published studies have always used this term, and because these alterations represent allelic losses in most of cases. Temporally, LOH at D8S545 occurred at a low frequency in low-grade dysplasia (18%), and the rate only increased slightly at high-grade dysplasia (25%), and then peaked at SCC (42%). Suggesting the gene(s) located at D8S545 may play a role in tumor instability and invasion. On the other hand, a high frequency of LOH at D8S1830 was noted in low-grade dysplasia (58%), suggesting that gene(s) located at D8S1830 play an important role for early tumorigenesis. The rate of LOH in low-grade dysplasia is even slightly higher than that seen for 3p (46%) and 9p (55%) losses in low-grade dysplasia, both of which have been shown to occur early in the development of oral SCCs (Rosin et al., 2000, 2002; Zhang et al., 1997, 2000, 2001a,b). However, unlike the changes seen for 3p and 9p losses, which increased with progression of oral lesions, the rate of LOH seen in low-grade dysplasia at D8S1830 did not increase (33% in high-grade dysplasia and 42% in SCC). In general, studies from our lab and other labs have shown that LOH frequency at low-grade dysplasia seen in various hotspot at different chromosomes are lower than LOH frequency in high-grade dysplasia and in SCC. The finding of a high frequency of LOH at 87 D8S1830 in low-grade dysplasia without subsequent increase in frequency of LOH in high-grade dysplasia and in SCC is unusual. However, a similar finding has been noted previously from this lab. LOH at 14q31-32 was found in 33% (17/51) of low-grade dysplasia, 30% (10/23) of high-grade dysplasias and 36% (12/33) of invasive SCCs (unpublished data from this lab). The identification of LOH at a hotspot in a lesion intrinsically implies that the majorities of the cells in the lesion show LOH at the locus and is an evidence of clonal expansion of cells with growth advantages (required by tumorigenesis). Consequently, the presence of LOH, even in low-grade dysplasia, could not be ignored. The lack of further increase in the frequency of LOH could be explained by involvement of alternate modes of inactivation/alteration such as epigenetic silencing of gene expression by promoter methylation (Thiagalingam et al, 2002), and different cancer development pathways, or simply because only one primer, D8S1830, has been used to probe the region, and an increased number of primers for the region may identify further cases with the alteration. VII.3. Summary and future work This thesis has delineated the region of 13ql4.11 and found a 1.9 Mb minimal region of alteration (MRA) at D13S1297. Two other MRAs at 8q22 (D8S545 and D8S183) have also been found by people in our research group. My thesis has for the first time investigated temporal changes of the three hot spots during the multistage carcinogenesis. The finding of high frequencies of microsatellite alterations for the 3 new hotspots suggesting that tumor 88 genes at these loci play important role for oral carcinogenesis, instead of random changes or 'gun-shot effects' due to genetic instability. The importance of my study results is illustrated by the fact that the finding of a 1.9 Mbp MRA at D13S1297 and the finding of a high-frequency of LOH 3XD13S1297 during oral carcinogenesis has lead to further studies by another graduate student in the research group and lead to the identification of the gene AKAP220 as potential tumor gene. To the best of my knowledge, no other studies have linked AKAP220 with tumorigenesis and have reported overexpression of AKAP220 in tumors. Many other studies could be generated through the results of my study. The possibility of AKAP220 needs to be further confirmed by studying its expression in oral premalignant lesions and malignant lesions of other organs. Further studies are needed to localize and ultimately sequence and identify the candidate tumor genes at D8S545 and at D8S1830. The identification of the gene(s) could be followed by studies of their expression at either mRNA and protein level. Studies employing techniques such as FISH could also shed light on whether alterations at the 3 new hotspots are deletion or amplification. All these studies will lead to better understanding of the mechanisms of oral carcinogenesis and to intervention and better management of the disease. 89 VIII. References Afonso A, Emmert-Buck MR, Duray PH, Bostwick DG, Linehan WM, Vocke CD. Loss of heterozygosity on chromosome 13 is associated with advanced stage prostate cancer. J of Urology 162: 922-926, 1999. Afroze D, Misre A, Sulaiman IM, Sinha S, Sarkar C, Mahapatra AK, Hasnain SE. Genetic alteration in brain tumors identified by RAPD analysis. Gene 206:45-48, 1998. Ah-See K, Cooke T, Pickford I, Soutar D, Balmain A. An allelotype of squamous carcinoma of the head and neck using microsatellite markers. Cancer Res. 54: 1617-1621, 1994. Alers JC, Rochat J, Krijtenburg PJ, Hop WC, Kranse R, Rosenberg C, Tanke HJ, Schroder FH, van Dekken H. Identification of genetic markers for prostatic cancer progression. Lab Invest. 80(6): 931-942,2000. Alers JC, Krijtenburg PJ, Vis AN, Hoedemaeker RF, Wildhagen MF, Hop WC, van Der Kwast TT, Schroder FH, Tanke HJ, Van Dekken H. Molecular cytogenetic analysis of prostatic adenocarcinomas from screening studies: early cancers may contain aggressive genetic features. Am. J. Pathol. 158(2): 399-406, 2001. Andl T, Kahn T, Pfuhl A, Nicola T, Erber R, Conradt C, Klein W, Helbig M, Dietz A, 90 Weidauer H, Bosch FX. Etiological involvement of oncogenic human papillomavirus in tonsillar squamous cell carcinomas lacking retinoblastoma cell cycle control. Cancer Res. 58: 5-13, 1998. Andre K, Schraub S, Mercier M, Bontemps P. Role of alcohol and tobacco in the aetiology of head and neck cancer: a case-control study in the doubts region of France. Eur. J. Cancer B. Oral. Oncol, 3IB: 301-309, 1995. Balleine RL, Fejzo MS, Sathasivam P, Basset P, Clarke CL, Byrne JA. The hD52 (TPD52) gene is a candidate target gene for events resulting in increased 8q21 copy number in human breast carcinoma. Genes Chromosomes Cancer 29(1): 48-57, 2000. Balsara BR, Pei J, de Rienzo A, Simon D, Tosolini A, Lu YY, Shen FM, Fan X, Lin WY, Buetow KH, London WT, Testa JR. Human hepatocellular carcinoma is characterized by a highly consistent pattern of genomic imbalances, including frequent loss of 16q23.1-24.1. Genes Chromosomes Cancer 30(3): 245-253, 2001. Banoczy J and Sugar L. Longitudinal studies in oral leukoplakisa. J of Oral Pathol. 1: 265-272, 1972. Barrett MT, Galipeau PC, Sanchez CA, Emond MJ, Reid BJ. Determination of the frequency of loss of heterozygosity in esophageal adenicarcinoma by cell sorting, whole genome amplification and microsatellite polymorphisms. Oncogene 12(9): 1873-1878, 1996. 91 Bergamo NA, Rogatto SR, Poli-Frederico RC, Reis PP, Kowalski LP, Zielenska M, Squire JA. Comparative genomic hybridization analysis detects frequent over-representation of DNA sequences at 3q, 7p, and 8q in head and neck carcinomas. Cancer genet. Cytogenet. 119(1): 48-55, 2000. Bhaskar SN (ed.). Orban's Oral Histology and Embryology. Toronto: Princeton. 1986. Bieche I, Lidereau R. Loss of heterozygosity at 13ql4 correlates with RBI gene underexpression in human breast cancer. Mol. Carcinog. 29:151-158,2000. Bishop, J.M. Molecular themes in oncogenesis. Cell, 64: 235-48, 1991. Bockmuhl U, Schwendel A, Manfred D, Petersen I. Distinct patterns of chromosomal alterations in high- and low-grade head and neck squamous cell carcinoma. Cancer Res. 56: 5325-5329, 1996. Bockmuhl U, Wolf G, Schmidt S, Schwendel A, Jahnke V, Dietel M, Petersen I. Genomic alterations associated with malignancy in head and neck cancer. Head and Neck. 20(2): 145-51, 1998. Bouchard C, Staller p, Eilers M. Control of cell proliferation by myc. Trends in Cell Biology. 8:202-206, 1998. 92 Bridge JA, Liu J, Weibolt V, Baker KS, Perry D, Kruger R, Qualman S, Barr F, Sorensen P, Triche T, Suijkerbuijk R. Novel genomic imbalances in embryonal rhabdomyosarcoma revealed by comparative genomic hybridization and fluorescence in situ hybridization: an intergroup rhabdomyosarcoma study. Genes Chromosomes Cancer 27(4): 337-344, 2000. Bridge JA, Liu J, Qualman SJ, Suijkerbuijk R, Wenger G, Zhang J, Wan X, Baker KS, Sorensen P, Barr FG. Genomic gains and loses are similar in genetic and histological subsets of rhabdomyosarcoma, whereas amplification predominates in embryonal with anaplasia and alveolar subtypes. Genes Chromosomes Cancer 33(3): 310-321, 2002. British Columbia cancer Agency (BCCA). Head and neck pamphlet, 1996. Califano J, van der Riet, Westra W, Nawroz H, Clayman G, Piantadosi S, Corio R, Lee D, Greenberg B, Koch W, Sidransky D. Genetic progression model for head and neck cancer: implications for field cancerization. Cancer Res., 56: 2488-2492, 1996. Califano J, Westra WH, Meininger G, Corio R, Koch WM, Sidransky D. Genetic progression and clonal relationship of recurrent premalignant head and neck lesions. Clin Cancer Res. 6(2): 347-52, 2000. Cave H, Avet-Loiseau H, Devaux I, Rondeau G, Boutard P, Lebrun E, Mechinaud F, Vilmer E, Grandchamp B. Deletion of chromosomal region 13ql4.3 in childhood acute lymphoblastic leukemia. Leukemia 15(3): 371-376, 2001. 93 Chan CSA, To KF, Lo KW, Mak KF, Pak W, Chiu B, Tse GMK, Ding M, Li X, Le JCK, Huang DP. Cancer Research 60, 5365-5370, 2000. Chang HJ, Kim SW, Kim YT< Kim WH. Loss of heterozygosity in dysplasia and carcinoma of the gallbladder. Mod Pathol 12(8): 763-769, 1999. Chen C, Branham WW, Stultz BG, Frierson HF, Barrett JC, Sawyers CL, Isaacs, JT, Dong JT. Defining a common region of deletion at 13q21 in human cancers. Genes, Chromosomes & Cancer 31: 333-344, 2001. Chen C, Frierson HF, Haggerty PF, Theodorescu D, Gregory CW, Dong JT. An 800-kb region of deletion at 13ql4 in human prostate and other carcinomas. Genomics 77(3): 135-144, 2001. Chen ML, Bova GS, Moore DH, Small EJ, Carroll PR, Pin SS, Epstein JI, Isaacs WB, Jensen RH. Genetic alterations in untreated metastases and androgen-independent prostate cancer detected by comparative genomic hybridization and allelotyping. Cancer Res. 56: 3091-3102, 1996. Chen L, Matsubara N, Yoshino T, Nagasaka T, Hoshizima N, Shirakawa Y, Naomoto Y, Isozaki H, Riabowol K, Tanaka N. Genetic alteration of candidate tumor suppressor IGN1 in human esophageal squamous cell carcinoma. Cancer Res. 61(11): 4345-4349,2001. 94 Chung C, Kantarjian H, Uaidar M, Starostik P, Manshouri T, Gidel C, Freireich E, Keating M, Albitar M. Deletions in the 13ql4 locus in adult lymphoblastic leukemia. Cancer 88:1359-1364,2000. Crowe DL, Hacia JG, Hsieh CL, Sinha UK, Rice H. Molecular oathology of head and neck cancer. Histol Histopathol. 17(3): 909-914, 2002. Dil-Afroze Misra A, Sulaiman IM, Sinha S, Sarkar C, Mahapatra AK, Hasnain SE. Gene. 206, 45-48, 1998. Dong JT, Boyd JC, Frierson HF. Loss of heterozygosity at 13ql4 and 13q21 in high grade, high stage prostate cancer. Prostate 49: 166-171,2001. El Gedaily A, Bubendorf L, Willi N, Fu W, Richter J, Moch H, Mihatsch MJ, Sauter G, Gasser TC. Discovery of new DNA amplification loci in prostate cancer by comparative genomic hybridization. Prostete 46(3): 184-190, 2001. El-Naggar AK, Nurr K, Batsakis JG, Luna MA, Goepfert H, Huff V. Sequential loss of heterozygosity at microsatellite motifs in preinvasive and invasive head and neck squamous cell carcinoma. Cancer Res. 55(12): 2656-2659, 1995. El-Naggar AK, Coombes MM, Batsakis JG, Hong WK, Goefert H, Kagan J. Localization of chromosome 8p region involved in early tumorigenesis of oral and laryngeal squamous 95 Carcinoma. Oncogene 16: 2983-2987, 1998. Emilion G, Langdon JD, Speight P, Partridge M. Frequent gene deletions in potentially malignant oral lesions. Br J Cancer 73(6): 809-813, 1996. Faderl S, Gidel C, Kantarjian HM, Manshouri T, Keating M, Albitar M. Loss of heterozygosity on chromosome 5 in adult with acute lymphoblastic leukemia. Leukemia Res. 25:39-43,2001. Farabegoli F, Champeme M, Bieche I, Santini D, Ceccarelli C, Derenzini M, Lidereau R. Genetic pathway in the evolution of breast ductal carcinoma in situ. J. of Pathol. 196: 280-286, 2002. Faulkner SE, Frieldlander ML. Molecular genetic analysis of malignant ovarian germ cell tumor. Gynecol Oncol. 77(2): 283-288, 2000. Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 61: 759-767, 1990. Fearon E. Human cancer syndromes: clues to the origin and nature of cancer. Science 278: 1043-1050, 1997. Field JK, Spandidos DA, Stell PM, Vaughan ED, Evan Gl, Moore JP. Elevated expression of 96 the c-myc onco-protein correlates with poor prognosis in head and neck squamous cell carcinoma. Oncogene 4: 1463-1468, 1989. Field JK, Kiaris H, Risk JM, Tsiriyotis C, Adamson R, Zoumpourlis V, Rowley H, Taylor K, Whittaker J, Howard P et al., Allelotype of squamous cell carcinoma of the head and neck: fractional allele loss correlates with survival. Br J Cancer 72(5): 1180-8, 1995 Fieldler U, Ehlers W, Meye a, Fussel S, Faller S, Schmidt U, Wirth MP. LOH analysis in the region of the putative tumor suppressor gene C13 on chromosome 13ql3. Anticancer Res. 21(4A): 2341-2350, 2001. Fiedler W, Hoppe C, Schimmel B, Koscielny S, Dahse R, Bereczki Z, Claussen U, Ernst G, von Eggeling F. Molecular characterization of head and neck tumors by analysis of telomerase activity and a panel of microsatellite markers. Int. J Mol. Med. 9:417-423, 2002. Fong KM, Zimmerman PV, Smith PJ. Tumor progression and loss of heterozygosity at 5q and 18q in non-small cell lung cancer. Cancer Res. 55:220-223, 1995. Fonseca R, Oken MM, Harrington D, Bailey RJ, Van Wier SA, Henderson KJ, Kay NE, van Ness B, Greipp PR, Dewald GW. Deletions of chromosome 13 multiple myeloma identified by interphase FISH usually denote large deletions of the q arm or monosomy. Leukemia 15(6): 981-986, 2001. 97 Freier K, Joos S, Flechtenmacher C, Devens F, Benner A, Bosch FX, Lichter P, Hofele C. Tissue microarray analysis reveals site-specific prevalence of oncogene amplifications in head and neck squamous cell carcinoma. Cancer Res 63(6): 1179-1182,2003. Gallo, O., Chiarelli, I., Boddi, V., Bocciolini, C , Bruschini, L. & Porfirio, B. Cumulative prognostic value of p53 mutations and bcl-2 protein expression in head-and-neck cancer treated by radiotherapy. Int J Cancer, 84, 573-9. 1999. Garkavtsev I, Kazarov A, Gudkov A, Riabowol K. Suppression of the novel growth inhibitor P33ING1 p r o m o t e s neoplastic transformation. Nat. genet. 14:415-420, 1996. Gasparotto D, Vukosavljevic T, Piccinnin S, Barzan L, Sulfaro S, Armellin M, Boiocchi M, Maestro R. Loss of heterozygosity at lOq in tumors of the upper respiratory tract is associated with poor prognosis. Int J Cancer. 84(4): 432-6, 1999. Gillenwater A, Hurr K, Wolf P, Batsakis JG, Goepfert H El-Naggar AK. Microsatellite alterations at chromosome 8q loci in pleomorphic adenoma. Otolaryngol Head Neck Surg. 117(5): 448-452, 1997. Gillison, M.L., Koch, W.M., Capone, R.B., Spafford, M., Westra, W.H., Wu, L., Zahurak, M.L., Daniel, R.W., Viglione, M., Symer, D.E., Shah, K.V. & Sidransky, D. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. JNatl Cancer Inst, 92, 709-20, 2000. 98 Girard L, Zochbauer-Muller S, Virmani AK, Grzdar AF, Minna JD. Genome-wide allelotying of lung cancer identifies new regions of allelic loss, differences between small cell lung cancer and non-small cell lung cancer, and loci clustering. Cancer Res. 60:4894-4906, 2000. Gleeson CM, Sloan JM, McGuigan JA, Weber JL, Russell SE. Allelotype analysis of adenocacinoma of the gastric cardia. Br J Cancer 76(11): 1455-1465, 1997. Gleich, L.L., Li, Y.Q., Biddinger, P.W., Gartside, P.S., Stambrook, P.J., Pavelic, Z.P. & Gluckman, J.L. The loss of heterozygosity in retinoblastoma and p53 suppressor genes as a prognostic indicator for head and neck cancer. Laryngoscope, 106, 1378-81, 1996. Goeze A, Schluns K, Wolf G, Thasler Z, Petersen S, Peterson I. Chromosomal imbalances of primary and metastatic lung adenocarcinomas. J. of Pathol. 196: 8-16, 2002. Gollin SM. Chromosomal alterations in squamous cell carcinomas of the head and neck: window to the biology of desease. Head & Neck 23: 238-253, 2001. Grandis JR, Melhem MF, Gooding WE, Day R, Hoist VA, Wagener MM. Levels of TGF-alpha and EGFR protein in head and neck squamous cell carcinoma and patient survival J Natl Cancer Inst. 90(11): 824-32, 1998. Gras E, Cortes J, Diez O, Alonso C, Matias-Guiu X, Baiget M, Prat J. Loss of heterozygosity 99 on chromosome 13ql2-ql4, BRCA-2 mutations and lack of BRCA-2 promoter hypermethylation in sporadic epithelial ovarian tumors. Cancer 92:787-795, 2001. Grati FR, Sirchia SM, Garagiola I, Sironi E, Galioto S, Rossella F, Serafmi P, Dulcetti F, Bozzetti A, Brusati R, Simoni G. Losses of heterozygosity in oral and orapharyngeal epithelial carcinoma. Cancer genet Cytogent 118: 57-61, 2000. Greenlee, R.T., Hill-Harmon, M.B., Murray, T. & Thun, M. Cancer statistics. CA Cancer J Clin, 51, 15-36, 2001. Gunawan B, Mirzaie M, Schulten H, Heidrich B, Fuzesi L. Molecular cytogenesis analysis of two primary squamous cell carcinomas of the lung using multicolor fluorescence in situ hybridization. Virchows Arch 439: 85-89, 2001. Gunduz M, Ouchida M, Fukushima K, Hanafusa H, Etani T, Nishioka S, Nishizaki K, Shimizu. Genomic structure of the human ING1 gene and tumor-specific mutations detected in head and neck squamous cell carcinomas. Cancer Res. 60:3143-3146,2000. Gupta VK, Schmidt AP, Pashia ME, Sunwoo JB, Scholnick SB. Multiple regions of deletion on chromosome arm 13q in head-and-neck squamous-cell carcinoma. Int J Cancer. 84(5): 453-457, 1999. Han HS, Kim HS, Woo DK, Kim WH, Kim YI. Loss of heterozygosity in gastric 100 neuroendocrine tumor. Anticancer Res. 20(5A): 2849-2854, 2000. Hamel N, manning A, Black MJ, Tonin PN, Foulkes WD. An absence of founder BRCA2 mutations in individuals with squamous cell carcinoma of head and neck. In J cancer 83: 803-804, 1999. Harada H, Tanaka H, Shimada Y, Shinoda M, Imamura M, Ishizaki K. Lymph node metastasis is associated with allelic loss on chromosome 13ql2-13 in esophageal squamous cell carcinoma. Cancer Res. 59(15): 3724-3729, 1999. Harada K, Nishizaki T, Ozaki S, Kubota H, Okamura T, Ito H, Sasaki k. Cytogenesis alteration in pituitary adenomas detected by comparative genomic hybridization. Cancer Genet. Cytogenet. 112: 38-41, 1999. Hashimoto Y, Atsunori O, Kenji O, Yuji I, Yuji Y, Kohsuke S. Relationship between cytogenesis aberrations by CGH coupled with tissue microdissection and DNA ploidy by laser scanning cytometry in head and neck squamous cell carcinoma. Cytometry. 40:161-166, 2000. Hering O and Nirenberg HI. Differentiation of fusarium sambucinum fuckle sensu lato and related species by RAPD PCR. Mycopathologia 129:159-164, 1995. Hosoe S, Ueno K, Shigedo Y et al. A Frequent deletion of chromosome 5q21 in advanced 101 small cell and non-small cell carcinoma of lung. Cancer Res. 54:1787-1790, 1994. Hu N, Roth MJ, Emmert-Buck MR, Tang ZZ, Polymeropolous M, Wang QH, Goldstein AM, Han XY, Dawsey SM, Ding T, Giffen C, Taylor PR. Allelic loss in esophageal squamous cell carcinoma patients with and without family history of upper gastrointestinal tract cancer. Clin Cancer Res. 5(11): 3476-3482, 1999. Huang Q, Yu GP, McCormick SA, Mo J, Datta B, Mahimkar M, Lazarus P, Schaffer AA, Desper R, Schantz SP. Genetic differences detected by comparative genomic hybridization in head and neck squamous cell carcinomas from different tumor sites: construction of oncogenetic trees for tumor progression. Genes Chromosomes Cancer 34(2):224-233, 2002. Hyytinen ER, Frierson HF, Boyd JC, Chung LMK, Dong JT. Three distinct regions of allelic loss at 13ql4, 13q21-22, and 13q33 in prostate cancer. Genes, Chromosomes and Cancer 25:108-114,1999. Imhof A, Schuierer M, Werner O, Moser M, Roth C, Bauer R, Buettner R. Transcriptional regulation of the AP-2alpha promoter by BTEB-1 and AP-2rep, a novel wt-l/egr-related zinc finger repressor. Mol. Cell Biol. 19:194-204, 1999. Ilyas M and Tomlinson IMP. Genetic pathway in colorectal cancer. Histopathology 28:389-399, 1996. 102 Imyanitov EN, Togo AV, Suspitsin EN, Grigoriev MY, Pozharisski KM, Turkevich EA, Hanson KP, Hayward NK, Chenevix-Trench G, Theillet C, Lavin MF. Evidence for mocrosatellite instability in bilateral breast carcinoma. Cancer Lett. 54(1): 9-17, 2000. Ishwad C, Ferrell RE, Rossie KM, et al. Microsatelite instability in oral cancer. Int J Cancer 64: 332-335, 1995. Ishwad CS, Ferrell RE, Rossie KN, Appel BN, Johnson JT, Myers EN, Law JC, Srivastava S, Gollin SM. Loss of heterozygosity of the short arm of chromosomes 3 and 9 in oral cancer. Int J Cancer 69(1): 1-4, 1996. Isola JJ, Kallioniemi OP, Chu LW, Fuqua SAW, Hilsenbeck SG, Osborne CK, Waldman FM. Genetic aberrations detected by comparative genomic hybridization predict outcome in node-negative breast cancer. Am. J. Pathol. 147: 905-911, 1995. Jares, P., Nadal, A., Fernandez, P.L., Pinyol, M., Hernandez, L., Cazorla, M., Hernandez, S., Bea, S., Cardesa, A. & Campo, E. Disregulation of pl6MTSl/CDK4I protein and mRNA expression is associated with gene alterations in squamous-cell carcinoma of the larynx. Int J Cancer, 81, 705-11, 1999. Jefferies S, Foulkes WD. Genetic mechanisms in squamous cell carcinoma of the head and neck. Oral Oncol. 37(2): 115-26, 2001. 103 Jin Y, Jin C, Wennerberg J, Hoglund M, Mertens F. Cytogenesis and fluorescence in situ hybridization characterization of chromosome 8 rearrangements in head and neck squamous cell carcinomas. Cancer Genetics and Cytogenetics 130: 111-117, 2001. Johnson SM, Shaw JA, Walker RA. Sporadic breast cancer in young women: prevalence of loss of heterozygosity at p53, BRCA1 and BRCA2. Int. J. Cancer 98(2): 205-209, 2002. Kainu T, Jou SH, Desper R, Schaffer AA, Gillanders E, Rozenblum E, Freas-Lutz D, Weaver D, Stephan D, bailey-Wilson J, Kallioniemi O, et al. Somatic deletions in hereditary breast cancers implicate 13q21 as a putative novel breast cancer susceptibility locus. PNAS91(ll): 9603-9608, 2000. Karan D, Schmied BM, Dave BJ, Wittle UA, Lin MF, Batra SK. Decreased androgen-responsive growth of human prostate cancer is associated with increases genetic alterations. Clin. Cancer Res. 7(11): 3472-3480, 2001. Kim H, Lee MJ, Kim MR, Chung IP, Kim YM, Lee JY, Jang JJ. Expression of cyclin DI, cyclin E, cdk4 and loss of heterozygosity of 8p, 13q, and 17p in hepatocellular carcinoma: comparison study of childhood and adult hepatocellular carcinoma. Liver 20 (2): 173-178, 2000. Kim HS, Woo DK, Bae SI, Kim YI, Kim WH. Allelotype of the adenoma-carcinoma sequence 104 of the stomach. Cancer Detec. Prev. 25(3): 237-244, 2001. Kinzler KW, Nilbert MC, Vogelstein B et al. Identification of a gene located at chromosome 5q21 that is mutated in colorectal cancer. Science 251:1366-1370, 1991. Kinzler KW, Vogelstein B. Cancer-susceptibility genes: Gatekeepers and caretakers. Nature 386:761-763, 1997. Kinzler KW, Nilbert MC, Su LK, Vogelstein B, Brayan TM, Levy DB, Smith KJ, Preisinger AC, Hedge P, McKechnie D, Finniear R, Markham A, Groffen J, Boguski MS, Altschul SF, Horil A, Ando H, Miyoshi Y, Miki Y, Nishisho I, Nakamura Y. Identification of FAP locus genes from chromosome 5q21. Science 253: 661-665, 1991. Kirkpatrick H, Waber P, Hoa-Thai T, Barnes R, Osborne-Lawrence S, Truelson J, Nisen P, Bowcock A. Infrequency of BRCA2 alterations in head and neck squmous cell carcinoma. Oncogene 14: 2189-2193, 1997. Knudson A. Mutation and cancer: statistical study of retinoblastoma. Proceedings of National academy for Science USA. 68(4): 820-823, 1971. Kollias J, Man S, Marafie M, Carpenter K, Pinder S, Ellis IO, Blarney RW, Cross G, Brook JD. Loss of heterozygosity in bilateral breast cancer. Breast Cancer Research and Treatment 64:241-251,2000. 105 Krismann M, Muller KM, Jaworska M, Johnen G. Molecular cytogenesis differences between histological subtypes of malignant mesotheliomas: DNA cytometry and comparative genomic hybridization of 90 cases. J Pathol 197(3):363-371, 2002. Krul EJT, Kersemaekers AF, Zomerdijk-Nooyen YA, Cornelisse CJ, Fleuren GJ. Different profliles of allelic losses in cervical carcinoma cases in Surinam and the Nethelands. Cancer 86:997-1004, 1999. Kurose K, Hoshaw-Woodard S, Adeyinka A, Lemeshow S, Watson PH, Eng C. Genetic model of multi-step breast carcinogenesis involving the epithelium and stroma: clues to tumor-microenvironment interactions. Human Molecular Genetics 10(18): 1907-1913,2001. Kusano N, Shiraishi K, Kubo K, Oga A, Okita K, Sasaki K. Genetic aberrations detected by comparative genomic hybridization in hepatocellar carcinomas: their relationship to clinicopathological features. Hepathology 29(6): 1858-1862, 1999. Largey JS, Meltzer SJ, Sauk JJ, Hebert CA, Archibald DW. Loss of heterozygosity involving the APC gene in oral squamous cell carcinomas. Oral Surg Oral Med Oral Pathol. 77(3): 260-263, 1994. Laskod and Cavenee W. Loss of constitutional heterozygosity in human cancer. Annul. Rev. Genet. 25:281-314, 1991. 106 Latil A, Bieche I, Pesche S, Volant A, Fournie G, Cussenot O, Lidereau R. Loss of heterozygosity at chromosome arm 13q and RBI status in human prostate cancer. Hum Pathol. 30(7): 809-815, 1999. Lens D, Matutes E, Catovsky D, Coignet LJ. Frequent deletions at 1 lq23 and 13ql4 in B cell prolymphocytic leukemia (B-PLL). Leukemia 14(3): 427-430, 2000. Lese CM, Rossie KM, Appel BN, Reddy JK, Johnson JT, Myers EN, Gollin SM. Visualization of LNT2 and HST1 amplification in oral squamous cell carcinomas. Genes Chromosomes Cancer. 12(4):288-95, 1995. Li G, Hu N, Goldstein AM, Tang Z, Roth MJ, Wang Q, Dawsey SM, Han X, Ding T, Huang J, Giffen C, Taylar PR Emmert-Buck MR. Allelic loss on chromosome bands 13ql l-ql3 in eaophageal squamous cell carcinoma. Genes, Chromosomes & Cancer 31: 390-397, 2001. Li X, Lee NK, Ye YW, Waber PG, Schweitzer C, Cheng QC, Nisen PD. Allelic loss at chromosome 3p, 8p, 13q, and 17p associated with poor prognosis in head and neck cancer. J. Nat. Cancer Inst., 86:1524-1529, 1994. Liggett, W.H., Sewell, D.A., Rocco, J., Ahrendt, S.A., Koch, W. & Sidransky, D. pi6 and pi6 beta are potent growth suppressors of head and neck squamous carcinoma cells in vitro. Cancer Res, 56:4119-23, 1996. 107 Lin YW, Sheu JC, Liu LY, Chen CH, Lee HS, Huang GT, Wang JT, Lee PH, Lu FJ. Loss of heterozygosity at chromosome 13q in hepatocellular carcinoma: identification of three independent regions. Eur J of Cancer 35(12): 1730-1734, 1999. Lippman SM, Hong WK. Molecular markers of the risk of oral cancer. N Engl J Med. 344(17): 1323-1326, 2001. Liu Y, Corcoran M, Rasool O, Ivanova G, Ibbotson R, Grander D, Iyengar A, Baranova A, Kashuba V, Merup M, Wu X, Gardiner A, Mullenbach R, Poltaraus A, Hultstrom AL, Juliusson G, Chapman R, Tiller M, Cotter F, Gahrton G, Yankovsky N, Zabarovsky E, Einhorn S, Oscier D. Cloning of two candidate tumor suppressor genes within a 10 Kb region on chromosome 13ql4, frequently deleted in chronic lymphocytic leukemia. Oncogene 15(20): 2463-2473, 1997. Lo KW, Teo PML, Hui ABY, To KF, Tsang YS, Chan SYY, Mak KF, Lee JCK, Huang DP. High-resolution allelotype of microdissected primary nasopharyngeal carcinoma. Cancer Res. 60,3348-3353,2000. Lydiatt WM, Davidson B J, Shah J, Schantz SP, Chaganti RSK. The relationship of loss of heterzygoeity to tobacco exposure and early recurrence in head and neck squamous cell carcinoma. Am J of Surg. 168:437-440, 1994. 108 Lydiatt WM, Davidson BJ, Schantz SP, Caruana S, Chaganti RSK. 9p21 deletion correlates with recurrence in head and neck cancer. Head and Neck. 20(2): 113-8, 1998. Macfarlane G, Boyle P, Evstifeeva T, Robertson C, Scully C. Rising trends of oral cancer mortality among males worldwide; the return of an old public health problem. Cancer Causes Control 5:259-265, 1994. Maeda T, Jikko A, Hiranuma H, Fuchihata H. Analysis of genomic instability in squamous cell carcinoma of the head and neck using the random amplified polymorphic DNA method. Cancer Lett. 138(1-2): 183-8, 1999. Maestro R, Piccinin S, Doglioni C, Gasparotto D, Vukosavljevic T, Sulfaro S, Baezan L, Boiocchi M. Chromosome 13q deletion mapping in head and neck squamous cell carcinoma: identification of two distinct regions of preferential loss. Cancer Res., 56: 1146-1150, 1996. Magrath I, Litvakk J. Cancer in developing countries: Opportunity and challenge. JNatl Cancer Inst. 85:862-874, 1993. Malkhosyan S, Yasuda J, Soto JL, Sekiy T, Yokota J, Perucho M. Molecular karyotype (amplotype) of metastatic colorectal cancer by unbiased arbitrarily primed PCR DNA fingerprinting. Proc Natl Acad Sci USA. 95(17): 10170-5, 1998. Mao L, Lee DJ, Tockman MS, Erozan YS, Askin F, Sidransky D. Microsatellite alterations as 109 clonal markers for the detection of human cancer. Proc Natl Acad Sci USA 91:9871 -9875, 1994. Mao EJ, Schwartz SM, Daling JR, Oda D, Tickman L, Bechman AM. Human papilloma viruses and p53 mutations in normal pre-malignant and malignant oral epithelia. Int. J Cancer, 69: 152-158, 1996a. Mao L, Lee J, Fan Y, RO J, Batsakis J, Lippman S, Hittelman W, Hong W. Frequent . microsatellite alternations at chromosomes 9p21 and 3pl4 in oral premalignant lesions and their value in cancer risk assessment. Nature Medicine 2:682-685, 1996. Mao L. Tumor suppressor genes: Does FHIT fit? J of the national cancer institute 90(6): 412-414, 1998. Mashberg A and Samit A. Early detection, diagnosis, and management of oral and oropharyngeal cancer. CA Cancer Journal for Clinicians. 39: 67-88, 1989. Mashberg A and Samit A. Early diagnosis of asymptomatic oral and oropharyngeal squamous cancers. CA Cancer Journal for Clinicans. 45: 328-351,1995. Mayama T, Fukushige S, Shineha R, Nishihira T, Satomi S, Horii A. Frequent loss of copy number on the long arm of chromosome 21 in human esophageal squamous cell carcinoma. 17: 245-252, 2000. 110 McKaig RG, Baric RS, Olshan AF. Human papillomavirus and head and neck cancer: epidemiology and molecular biology. Head and Neck 20:250-265, 1998. Medintz IL, Lee CC, Wong WW, Pirkola K, Sidransky D, Mathies RA. Loss of heterozygosity assay for molecular detection of cancer using energy-transfer primers and capillary array electrophoresis. Genome Res. 10(8): 1211-8, 2000. Mendes-da-Silva P, Moreira A, Duro-da-Costa J, Matias D, Monteiro C. Frequency loss of heterozygosity on chromosome 5 in non-small cell lung carcinoma. Mol Pathol. 53(4): 184-187, 2000. Michalides R, van Veelan N, Hart A, Loftus BM, Hilgers FJ, Balm AJ. Overexpression of cyclin Dl correlates with recurrence in a group of forty-seven operable squamous cell carcinomas of the head and neck. Cancer Res. 55(5): 975-8, 1995. Miracca E, Kowalski L, Nagai M. High prevalence of pl6 genetic alterations in head and neck tumours. Br J Cancer. 81(4): 677-83, 1999. Mitra AB, Murty VS, Li RG, Pratap M, Luthra UK, Chaganti RSK. Allelotype analysis of cervical carcinoma. Cancer Res 54: 4481-4487, 1994. Mutirangura A, Charuruks N, Shuangshoti S, Sakdikul S, Chatsantikul R, Pornthanaksem W, Sriuranpong V, Supiyaphun P, Voravud N. Identification of distinct region of allelic loss 111 on chromosome 13 in nasopharyngeal cancer from paraffin embedded tissues. Int. J. Cancer 83:210-214, 1999. Nagai MA. Genetic alterations in head and neck squamous cell carcinoma. Brazilian Journal of Medical and Biology Research 32:897-904, 1999. Nakayama K, Konno M, Kanzaki A, Morikawa T, Miyashita H, Fujioka T, Uchida T, Miyazaki K, Takao S, Aikou T, Fukumoto M, Takebayashi Y. Allelotype analysis of gallbladder carcinoma associates with anomalous junction of pancreaticobiliary duct. Cancer Lett. 166(2): 135-141,2001. Navarro JM, Jorcano JL. The use of arbitrarily primed polymerase chain reaction in cancer research. Electrophoresis. 20(2): 283-90, 1999. Nawroz-Danish HM, Koch WM, Westra WH, Yoo G, Sidransky D. Lack of BRCA2 alterations in primary head and neck squamous cell carcinoma Otolaryngol Head Neck Surg. 119(1): 21-25, 1998. Nawroz H, Van der Riet P, Hruban RH, Koch W, Ruppert JM, Sidransky D. Allelotype of head and neck squamous cell carcinoma. Cancer Res. 54, 1152-1155, 1994. Newcomb PA and Carbone PP. The health consequences of smoking. Med. Clin. North Am. 76:305-332, 1992. 112 Niketeghad F, Decker HJ, Caselmann WH, Lund P, geissler F, Dienes HP, Schirmacher P. Frequent genomic imbalances suggest commonly altered tumor genes in human hepatocarcinogenesis. Br. J. Cancer 85(5): 679-704, 2001. Ng SK, Kabat GC, Wynder EL. Oral cavity cancer in non-users of tobacco. J. Natl. Cancer Inst., 85:743-745, 1993. Nupponen NN, Kakkola L, Loivisto P, Visakorpi T. Genetic alterations in hormone-refractory recurrent prostate carcinomas. Am. J. Pathol. 153: 141-148, 1998. Nupponen NN, Porkka K, Kakkola L, Tanner M, Persson K, Borg A, Isola J, Visakorpi T. Amplification and overexpression of p40 subunit of eukaryotic translation initiation factor 3 in breast and prostate cancer. Am. J. Pathol. 154: 1777-1783, 1999. Ogawara K, Miyakawa A, Shiiba M, Uzawa K, Watanabe T, Wang XL, Sato T, Kubosawa H, Kondo Y, Tanzawa H. Allelic loss of chromosome 13ql4.3 in human oral cancer: correlation with lymph node metastasis. Int J Cancer 79: 312-317, 1998. Okafuji M, Ita M, Oga A, Hayatsu Y, Matsuo A, Shinzato Y, Shinozaki F, Sasaki K. The relationship of genetic aberrations detected by comparative genomic hybridization to DNA ploidy and tumor size in human oral squamous cell carcinomas. J. Oral Pathol. Med. 29(5): 226-231,2000. 113 Ong TM, Song B, Qian HW, Wu ZL, Whong WZ. Detection of genomic instability in lung cancer tissues by random amplified polymorphic DNA analysis. Carcinogenesis. 19(1): 233-5, 1998. Pack SD, Marker JD, Hang Z, Pak ED, Balkan KV, HWU P, Park WS, Pham T, Ault DO, Glaser M, Iota L, Detera-Wadleigh SD, Wadeleigh RG. Molecular cytogenetic fingerprinting of esophageal squamous cell carcinoma by comparative genomic hybridization reveals a consistent pattern of chromosomal alterations. Genes Chromosomes Cancer 25(2): 160-168, 1999. Papadimitrakopoulou, V.A. & Hong, W.K. Retinoids in head and neck chemoprevention. Proc Soc Exp Biol Med, 216, 283-90, 1997a. Papadimitrakopoulou V, Izzo J, Lippman S, Lee J, Fan Y, Clayman G, Ro J, Hittelman W, Lotan R, Hong W, Mao L. Frequent inactivation of pl6 in oral premalignant lesions. Oncogene 14: 1799-1803, 1997b. Parkin SM, Lara E, Muir CS. Estimates of the worldwide frequency of sixteen major cancers. Int J Cancer 41: 184-197, 1988. Parkin DM, Pisani P, Ferlay J. Estimate of worldwide incidence of eighteen major cancers in 1985. Int J Cancer 54:594-606, 1993. 114 Parrella P, Sidransky D, Merbs SL. Allelotype of posterior uveal melanoma: implications for a bifurcated tumor progression pathway. Cancer Res. 59(13): 3032-3037, 1999. Partridge M, Emilion G, Pateromichelakis S, A'Hern R, Phillips E, Langdon J. Allelic imbalance at chromosomal loci implicated in the pathogenesis of oral precancer, cumulative loss and its relationship with progression to cancer. Oral Oncol. 34(2): 77-83, 1998. Partridge M, Emilio G, Walworth M, Acheron R, Phillips E, Pateromichelakis S, Langdon J. Patient-specific mutation databases for oral cancer. Int J Cancer 84: 284-292, 1999a. Partridge M, Emilio G, Pateromichelakis S, A'Hern, R., Lee, G., Phillips, E. & Langdon, J. The prognostic significance of allelic imbalance at key chromosomal loci in oral cancer. Br J Cancer, 79, 1821-7, 1999b. Partridge M, Phillips E, Emilion GG, A'Hern R, Langdon JD. A case-control study confirms that microsatellite assay can identify patients at risk of developing oral squamous cell carcinoma within a field of cancerization. Cancer Research 60(14), 3893-3898, 2000. Patridge M, Pateromichelakis S, Phillips E, Emilion G, Langdon J. Profiling clonality and progression in multiple premalignant and malignant oral lesions identifies a subgroup of cases with a distinct presentation of squamous cell carcinoma. Clin Cancer Res. 7(7): 1860-6, 2001. 115 Pavelic, Z.P. & Gluckman, J.L. The role of p53 tumor suppressor gene in human head and neck tumorigenesis. Acta Otolaryngol Suppl, 527: 21-4, 1997. Peng HQ, Liu L, Goss PE, Bailey D, Hogg D. Chromosomal deletion occurs in restricted regions of 5q in testicular germ cell cancer. Oncogene 18:3277-3283, 1999. Peralta RC, Casson AG, Wang RN, Keshavjee S, Redston M, Bapat B. Distinct regions of frequent loss of heterozygosity of chromosome 5p and 5q in human esophageal cancer. IntJ cancer 78(5): 600-605, 1998. Perinchery G, Bukurov N, Nakajima K, Chang J, Hooda M, Oh BR, Dahiya R. Loss of two new loci on chromosome 8 (8p23 and 8ql2-13) in human prostate cancer. Int J Oncol. 14(3): 495-500, 1999. Perucho M, Welsh J, Peinado MA, Ionov Y, McClelland M. Fingerprinting of DNA and RNA by arbitrarily primed polymerase chain reaction: applications in cancer research. Methods Enzymol. 254:275-90,1995. Piao Z, Kim NG, Kim H, Park C. Deletion mapping on the short arm of chromosome 8 in hepatocellular carcinoma. Cancer Letters. 138:227-232,1999. Piboonniyom SO, Timmermann S, Hinds P, Munger K. Aberrations in the MTS1 tumor suppressor locus in oral squamous cell carcinoma lines preferentially affect the INK4A gene 116 and result in increased cdk6 activity. Oral Oncol. 38(2): 179-86, 2002. Pindborg, J.J., Reichart, P.A., Smith, C.J. & van der Waal, I. Histological typing of cancer and precancer of the oral ucosa. Springer, Berlin Heidelberg,: New York. 1997. Porter MJ, Field JK, Loung SF, Lo D, Lee JCK, Spandidos DA, Van CA. The deletion of the c-myc and ras oncogenes in nasophryngeal carcinoma by immunohistochemistry. Acta Oto-Laryngologica. 114:105-109,1994. Quon H, Liu FF, Cummings BJ. Potential molecular prognostic markers in head and neck squamous cell carcinomas. Head and Neck 23(2): 147-59, 2001. Ransom DT, Barnett TC, Bot J, Boer BD, Metcalf C, Davidson JA, Turbett GR. Loss of heterozygosity on chromosome 2q: possibly a poor prognostic factor in head and neck cancer. Head Neck 20: 404-410, 1998. Ransom DT, Leonard JH, Kearsley JH, Turbett GR, Heel K, Sosars V, Hayward NK, Bishop JF. Loss of heterozygosity studies in squamous cell carcinomas of the head and neck. Head & neck 18: 248-253, 1996. Rao, B.R. & Krishnamurthy, P. A comparative study of the cost and effectiveness of a modified system of MDT drug delivery system in a high endemic district (Nalagonda) of South India. Indian JLepr, 70: 63S-71S, 1998. 117 Rayboud-Diogene H, Tetu B, Moreucy R, Fortin A. P53 overexpression in head and neck squamous cell carcinoma: review of the literature. Eur J cancer B Oral Oncol. 32B(3): 143- ' 149, 1996. Redon R, Muller D, Caulee K, Wanherdrick K, Abecassis J, du Manior S. A simple specific pattern of chromosomal aberrations at early stages of head and neck squamous cell carcinomas: PIK3CA but not p63 gene as a likely target of 3q26-qter gains. Cancer Res. 61(10): 4122-9, 2001. Reed, A.L., Califano, J., Cairns, P., Westra, W.H., Jones, R.M., Koch, W., Ahrendt, S., Eby, Y., Sewell, D., Nawroz, H., Bartek, J. & Sidransky, D. High frequency of pl6 (CDKN2/MTS-1/INK4A) inactivation in head and neck squamous cell carcinoma. Cancer Res, 56: 3630-3, 1996. Riddell RH. Premalignant and early malignant lesions in the gastrointestinal track: definitions, terminology, and problems. Am J Gastroenterology 91(5): 864-872, 1996 Rienzo AD, Jhanwar SC, Testa JR. Loss of heterozygosity analysis of 13q and 14q in human malignant mesothelioma. Genes, Chromosome & Cancer 28:337-341, 2000. Rodrigo JP, Lazo PS, Ramos S, Alvarez I, Suarez C. MYC amplification in squamous cell carcinomas of head and neck. Arch Otolaryngol Head Neck Surg. 122: 504-507, 1996. 118 Rosin M, Epstein J, Berean K, Durham S, Hay J, Cheng X, Zeng T, Huang Y, Zhang L. The use of exfoliative cell samples to map clonally genetic alterations in the oral epithelium of high-risk patients. Cancer Res. 57: 5258-5260, 1997. Rosin MP, Cheng X, Poh C, Lam WL, Huang Y, Lovas J, Berean K, Epstein JB, Priddy R, Le ND, Zhang L. Use of allelic loss to predict malignant risk for low-grade oral epithelial dysplasia. Clinical Cancer Res. 6(2), 357-362, 2000. Roth C, Schuierer M, Gunther K, Buettner R. Genomic structure and DNA binding properties of human zinc finger transcriptional repressor AP-2rep (KLF12). Genomics 63: 384-390, 2000. Roth MJ, Hu N, Emmert-Buck MR, Wang Q, Dawsey SM, Li G, Guo W, Zhang Y, Taylor PR. Genetic progression and heterogeneity associated with the development of esophageal squamous cell carcinoma. Cancer Res. 61:4098-4104,2001. Roz L, Wu CL, Porter S, Scully C, Speight P, Read A, Sloan P, Thakker N. Allelic imbalance on chromosome 3p in oral dysplastic lesions: an early event in oral carcinogenesis. Cancer Res. 56(6): 1228-1231, 1996. Sacker C, Hagiwara A, Taniguchi H, Yamaguchi T, Yamagishi H, Takahashi T^  Koyama K, Nakamura Y, Abe T, Inazawa J. Chromosomal aberrations in human hepatocellular carcinomas associated with hepatitis C virus infection detected by comparative genomic 119 hybridization. Br. J. Cancer 50(12): 2034-2039, 1999. Sanchez-Cespedes M, Okarrii K, Cairns P, Sidransky D. Molecular analysis of the candidate tumor suppressor gene ING1 in human head and neck tumors with 13q deletions. Genes, Chromosomes Cancer 27(3): 319-322, 2000. Sanz-Esponera J. Determination of allelic losses in peritumor bronchial mucosa An R Acad Nac med (Madr) 116(2): 265-272, 1999. Sanz-Ortega J, Bryant B, Sanz-Esponera J, Asenjo JA, Saez MC, Torres A, Balibrea JL, Sobel ME, Merino MJ. LOH at the APC/MCC gene (5Q21) is frequent in early stages of non-small cell lung cancer. Pathol Res Pr act. 195(10): 677-680, 1999. Sarbia M, Arjumand J, Wolter M, Reifenberger G, Heep H, Gabbert HE. Frequent c-myc amplification in high-grade dysplasia and adenocarcinoma in Barrett esophagus. Am J Clin Pathol 115(6): 835-40,2001. Saric T, Brkanac Z, Troyer DA, Padalecki SS, Sarosdy M, Williams K, Abadesco L, Leach RJ, O'Connell P. Genetic pattern of prostate cancer progression. Int J Cancer 81(2): 219-224, 1999. Sartor, M., Steingrimsdottir, H., Elamin, F., Gaken, J., Warnakulasuriya, S., Partridge, M., Thakker, N., Johnson, N.W. & Tavassoli, M. Role of pl6/MTSl, cyclin Dl and RB in 120 primary oral cancer and oral cancer cell lines. Br J Cancer, 80, 79-86. 1999. Sasiadek M, Stemblaska-Kozlowska A, Smigiel R, Krecicki T, Blin N, Mirghomizadeh F. Microsatellite and chromosome instability in squamous cell laryngeal carcinoma. Int J Oncol. 19(2): 401-405, 2001. Schillace RV, Voltz JW, Sim AT, Shenolikar S, Scott JD. Multiple interactions within the AKAP220 signaling complex contribute to protein phosphatase 1 regulation. J Biol Chem. 276(15):12128-34,2001. Scholes AG, Liloglou T, Maloney P, Hagan S, Nunn J, Hiscott P, Damato BE, Grierson I, Field JK. Loss of heterozygosity on chromosomes 3, 9, 13, and 17, including the retinoblastomas locus, in uveal melanoma. Invest. Ophthalmol. Vis Sci. 42(11): 2472-2477, 2001. Scholnick SB, El-Mofty SK, Shaw ME, Sunwoo JB, Haughey BH, Sun PC, Piccirillo JF, Zequeira MR. Clinical correlations with allelotype in supraglottic squamous cancer. Otolaryngol. Head Neck Surg., 118: 363-370, 1998. Schmidt U, Fiedler U, Pilarsky CP, Ehlers W, Fussel S, Haase M, Faller G, Sauter G, Wirth MP. Identification of a novel gene on chromosome 13 between BRCA-2 and RB-1. The Prostate 47: 91-101,2001. Schwab M. Oncogene amplification in solid tumors. Semin Cancer Biol 9:319-325, 1999. 121 Scully C, Field JK, Tanzawa H. Genetic aberrations in oral or head and neck squamous cell carcinoma 2: chromosomal aberrations. Oral Oncology 36: 311-327, 2000. Selim AA, Ryan A, El-Ayat G, Wells CA. Loss of heterozygosity and allelic imbalance in apocrine metaplasia of the breast: microdissection microsatellite analysis. J. of Pathol. 196:287-291,2002. Sengelov L, Christensen M, von der Maase H, Horn T, Marcussen N, Kamby C, Orntoft T. Loss of heterozygosity at lp, 8p, lOp, 13q, and 17p in advanced urothelial cancer and lack of relation to chemotherapy response and outcome. Cancer Genetics and Cytogenetics 123:109-113,2000. Seute A, Sinn HP, Schlenk RF, Emig R, Wallwiener D, Grischke EM, Hohaus S, Dohner H, Haas R, Bentz M. Clinical relevance of genomic aberrations in homogeneously treated high-risk stage II/III breast cancer patients. Int. J. Cancer 93(1): 80-84, 2001. Shad CS, Schuster M, Bockmuhl U, Thakker N, Shah P, Toomes C, Dixon M, Ferrell RE, Gollin SM. Frequent allelic loss and homozygous deletion in chromosome band 8p23 in oral cancer. Int J Cancer. 80(1): 25-31, 1999. Sheu JC, Lin TW, Chou HC, Huang GT, Lee HS, Lin TH, Huang SY, Chen CH, Wang JT, Lee PH, Lin JT, LU FJ, Chen DS. Loss of heterozygosity and microsatellite instability in 122 hepatocellular carcinoma in Taiwan. Br J Cancer 80(3-4): 468-476, 1999. Shibagaki I, Shimada Y, Wagata T, Ikenaga M, Imamura M, Ishizaki K. Allelotype analysis of esophageal squamous cell carcinoma. Cancer Res. 54(11): 2996-3000, 1994. Shin DM, Voravud N, Ro JY, Lee JS, Hong WK, Hittelman WN. Sequential increases in proliferating cell nuclear antigen expression in head and neck tumorigenesis: a potential biomarker. J Natl Cancer Inst 85(12): 971-978, 1993. Shin DM, Lee JS, Lippman SM, Lee JJ, Tu ZN, Choi G. p53 expressions: predicting recurrence and second primary tumors in head and neck squamous cell carcinoma. JNatl Cancer Inst. 88(8): 519-29, 1996. Shridhar V, Sen A, Chien J, Statub J, Avula R, Kovats S, Lee J Littlie J, Smith DI. Identification of underexpressed genes in early- and late- stage primary ovarian tumors by suppression subtraction hybridization. Cancer Res. 62:262-270,2002. Sidransky D. Molecular genetics of head and neck cancer. Curr Opin Oncol. 7:229-233, 1995. Sidransky D. Emerging molecular markers of cancer. Nature 2: 210-219, 2002. Silverman, S., Gorsky, M. & Lozada, F. Oral leukoplakia and malignant transformation. A 123 follow-up study of 257 patients. Cancer, 53, 563-8. 1984. Simpson DJ, Magnay J, Bicknell JE, Barkan AL, McNicol AM, Clayton RN, Farrell WE. Chromosome 13q deletion mapping in pituitary tumors: infrequent loss of the retinoblastoma susceptibility gene (RBI) locus despite loss of RBI protein product in somatotrophinomas. Cancer Res. 59(7): 1562-1566, 1999. Simpson DJ, Hibberts NA, McNicol AM, Clayton RN, Farrell WE. Loss of pRb expression in pituitary adenomas is associated with methylation of the RBI CpG island. Cancer Res. 60: 1211-1216,2000. Siu LL, Chan V, Chan JK, Wong KF, Liang R, Kwong YL. Consistent patterns of allelic loss in nature killer cell lymphoma. Am J Pathol. 157(6): 1803-1809, 2000. Skotheim RI, Kraggerud SM, Fossa SD, Stenwig AE, Gedde-Dahl TJ, Danielsen HE, Jakobsen KS, Lothe RA. Familial/bilateral and sporadic testicular germ cell tumor show frequent genetic changes at loci with suggestive linkage evidence. Neoplasia 3(3): 196-203, 2001. Sood AK and Buller RE. Genomic instability in ovarian cancer: a reassessment using primed polymerase chain reaction. Oncogene 13:2499-2504, 1996. Spitz MR. Epidemiology and risk factors for head and neck cancer. Sem. Oncol. 21:281-288, 1994. 124 Staebler A, Heselmeyer, Haddad K, Bell K, Riopel M, Perlman E, Ried T, Kurman RJ. Micropapillary serous carcinoma of the ovary has distinct patterns of chromosomal imbalances by comparative genomic hybridization compared with atypical proliferative serous tumors and serous carcinomas. Hum Pathol. 33(1): 47-59, 2002. Stanton SE, Shin SW, Johnson BE, Meyerson M. Recurrent allelic deletions of chromosome arms 15q and 16q in human small cell lung carcinomas. Genes, Chromosomes and Cancer 27: 323-331,2000. Stell PM. Survival time in end-stage head and neck cancer. Eur. J Surg. Oncol. 15: 407-410, 1989. Summerlin D. Precancerous and cancerous lesions of the oral cavity. Dermatologic Clinics 14: 205-223, 1996. Sugimoto Y, Morita R, Amano K, Fong CY, Shah PU, Castroviejo IP, Khan S, Delgado-Escueta AV, Yamakawa K. Childhood absence epilepsy in 8q24: refinement of candidate region and construction of physical map. Genomics 68:264-272, 2000. Sugimoto Y, Morita R, Amano K, Shah PU, Fong CY, Pascual-Castroviejo I, Khan S, Antinio V, Delgado-Escueta AV, Yamakawa K. T-STAR gene: fine mapping in the candidate region for childhood absence epilepsy on 8q24 and mutational analysis in patients. Epilepsy Research 125 46:139-144, 2001. Sugimura J, Tasushi G, Sizuki Y, Fujioka T. Allelic loss on chromosomes 3p, 5q and 17p in renal cell carcinomas. Pathology international 47: 79-83, 1997. Sweetser DA, Chen CS, Mlomberg AA, Flowers DA, Galipeau PC, Barred MT, Heerema NA, Buckley J, Woods WG, Bernstein ID, Reid BJ. Loss of heterozygosity in childhood acute myelogenous leukemia. Blood 98(4): 1188-1194,2001. Tabor MP, Brakenhoff RH, van Houten VM, Kummer JA, Snel MH, Snijders PJ, Snow GB, Leemans CR, Brakhuis BJ. Persistence of genetically altered field in head and neck cancer patients: biological and clinical implications. Clin Cancer Res. 7(6): 1523-1532, 2001. Tabor MP, Braakhuis BJ, van der Wal JE, van Diest PJ, Leemans CR, Brakenhoff RH, Kummer JA. Comparative molecular and histological grading of epithelial dysplasia of the oral cavity and the oropharynx. J Pathol 199(3):354-360, 2003. Tanaka T. Chemoprevention of oral carcinogenesis. Oral Oncol, Eur J Cancer 31B: 3-15,1995. Tamura G, Sakata K, Maesawa C, Suzuki Y, Terashima M, Satoh K, Sekiyama S, Suzuki A, Eda Y, Satodate R. Microsatellite alterations in adenoma and differentiated adenocarcinoma of the stomach. Cancer Res. 55(9): 1933-1936, 1995. 126 Tavtigian SV, Simard J, Rommens J, et al. The complete BRCA2 gene and mutations in chromosome 13q-linked kindreds. Nat. Genet. 12:333-337, 1996. Thiagalingam S, Foy RL, Cheng KH, Lee HJ, Thiagalingam A, Ponte JF. Loss of heterozygosity as a predictor to map tumor suppressor genes in cancer: molecular basis of its occurrence. Curr Opin Oncol. 14(1): 65-72, 2002. Tikkonen M, Tanner M, Karhu R, Kallioniemi A, Isola J, Kallioniemi OP. Molecular cytogenetics of primary breast cancer by CGH. Genes Chromosomes Cancer 21: 177-184, 1998. Tsang YS, Lo KW, Leung SF, Choi PHK, Fong Y, Lee JCK, Huang DP. Two distinct regions of deletion on chromosome 13q in primary nasopharygeal carcinoma. Int J Cancer 83:305-308, 1999. Ueda T, Emi M, Suzuki H, Komiya A, Akakura K, Ichikawa T, Watanabe M, Shiraishi T, Masai M, Igarashi T, Ito H. Identification of an I-cM region of common deletion on 13ql4 associated with human prostate cancer. Genes Chromosomes Cancer 24(3): 183-190, 1999. Van Dekken H, Geelen E, Dinjens WNM, Wijhoven BPL, Tilanus HW, Tanke HJ, Rosenberg C. Comparative genomic hybridization of cancer of gastroesphageal junction: deletion of 14q31-32.1 discriminates between esophageal (Barrett's) and gastric cardia adenocarcinomas. Cancer Res. 59:748-752,1999. 127 Van den Berg C, Guan XY, Von Hoff D, Jenkins R, Bittner M, Griffin C, Kallioniemi O, Visakopi T, McGill J, Herath J, Epstein J, Sarosdy M, Meltzer P, Trent J. DNA sequence amplification in human prostate cancer identified by chromosome microdissection: potential prognostic implication. Clin. Cancer Res. 1:11-18,1995. Van der Riet P, Nawroz H, Hruban RH, Corio R, Tokino K, Kock W, Sidransky D. Frequent loss of chromosome 9p21-22 early in head neck cancer progression. Cancer Res. 54: 1156-1158,1994. Virgilio L, Shuster M, Gollin SM, Veronese M, Ohta M, Huebner K, Croce CM. FHIT gene alterations in head and neck squamous cell carcinomas. Proc Natl Acad Sci USA. 93(18): 9770-5, 1996. Vogelstein, B. & Kinzler, K.W. Carcinogens leave fingerprints. Nature, 355: 209-10, 1992. Volling P, Jungehulsing M, Stutzer H, Diehl, Tesch H. Analysis of proto-oncogenes in aquamous cell carcinomas of head and neck (SCCHN). Int. J Oncol. 3: 671-677, 1993. Wada M, Okamura T, Okada M, Teramura M, Masuda M, Motoji T, Mizoguchi H. Frequent chromosome arm 13q deletion in aggressive non-Hodgkin's lymphoma. Leukemia 13(5): 792-798, 1999. 128 Wada M, Okamura T, Okada M, Teramura M, Masuda M, Motoji T, Mizoguchi H. Delineation of the frequently deleted region on chromosome arm 13q in B-cell non-Hodgkin's lymphoma. Int. J. Hematol. 71(2): 159-166, 2000. Wada T, Louhelainen J, Hemminiki K, Adolfosson J, Wijkstrom H, Norming U, Borgstrom E, Hansson J, Sandatedt B, Steineck G. Bladder cancer: allelic deletions at and around the retinoblastoma tumor suppressor gene in relation to stage and grade. Clin Cancer Res. 6(2): 610-615,2000. Walch AK, Zitzelsberger HF, Bruch J, Keller G, Angermeier D, Aubele MM, Ueller J, Stein H, Braselmann H, Siewert JR, Hofler H, Werner M. Chromosomal imbalances in Barrett's adenocarcinoma and the metaplasia-dysplasi-carcinoma sequence. Am. J. Pathol. 156(2): 555-566, 2000. Waldron C and Shafer W. Leukoplakia revisited: A clinicopathologic study 3256 oral leukoplakias. Cancer 36: 1386-1392, 1975. Wang VW, Bell DA, Berkowitz RS, Mok SC. Whole genome amplification and high-throughput allelotyping identified five distinct deletion region on chromosomes 5 and 6 in microdissected early-stage ovarian tumor. Cancer Res. 61(10): 4169-4174, 2001. Weber JL, May PE. Abundant class of human DNA polymorphism which can be types using the polymerase chain reaction. Am. J. Hum. Genet. 44: 388-396, 1989. 129 Weber RG, Scheer M, Born IA, Joos S, Cobbers JM, Hofele C, Reifenberger G, Zoller JE, Lichter P. Recurrent chromosomal imbalances detected in biopsy material from oral premalignant and malignant lesions by combined tissue microdissection, universal DNA amplification, and comparative genomic hybridization. Am. J. Pathol. 153(1): 295-303, 1998. Weingerg RA. Oncogenes, antioncogenes and molecular bases of multistep carcinogenesis. Cancer Res. 49:3713-3721,1989. Welkoborsky HJ, Bernauer HS, Riazimand HS, Jacob R, Mann WJ, Hinni ML. Patterns of chromosomal aberrations in metastasizing and nonmetastasizing squamous cell carcinomas of the oropharynx and hypophoarynx. Ann. Otol. Rhinol. Laryngol. 109(4): 401-410, 2000. Welsh J, McClelland M. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18(24): 7213-8,1990. Welsh J, Rampino N, McClelland, Perucho M. Nucleic acid fingerprinting by PCR-based methods: applications to problems in aging and mutagenesis. Mutat. Res. 338:215-229, 1995. Wertz DC. International perspectives on ethics and human genetics. Suffolk Univ Law Rev. 27(4): 1411-56, 1993 Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA polymorphisms amplified 130 by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18(22): 6531-5, 1990. Wistuba II, Behrens C, Virmani AK, Milchgrub S, Syed S, Lam S, Mackay B, Minna JD, Gazdar AF. Allelic losses at chromosome 8p21-23 are early and frequent events in the pathogenesis of lung cancer. Cancer Res. 59: 1973-1979,1999. Wolter H, Gotteried HW, Mattfeldt G. Genetic change in stage pT2N0 prostate cancer studied by comparative genomic hybridization. BJU international 89:310-316, 2002. Wong MP, Fung LF, Wang E, Chow WS, Chiu SW, Lam WK, Ho KK, Ma ES, Wan TS, Chung LP. Chromosomal aberrations of primary lung adenocarcinomas in nonsmokers. Cancer 97(5): 1263-1270, 2003. Wong N, Hui AB, Fan B, Lo KW, Pang E, Leung SF, Huang DP, John PJ. Molecular cytogenetic characterization of nasopharyngeal carcinoma cell lines and xenografts by comparative genomic hybridization and spectrial karyotyping. Cancer Gent. Cytogenet. 140(2): 124-132,2003. Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N, et al. Location of a breast cancer susceptibility gene, BRCA2, to chromosome 13ql2-13. Science 265:2088-2090, 1994. World Health organization (collaborating canter for oral precancerous lesions). Definition of leukoplakia and related lesions: an aid to studies on oral precancer. Oral Surg Oral Med Oral 131 Oral Pathol. 46: 518-539, 1978. Wu MS, Chang MC, Huang SP, Tseng CC, Sheu JC, Lin YW, Shun CT, Lin MT, Lin JT. Correlation of histologic subtypes and replication error phenotype with comparative genomic hybridization in gastric cancer. Genes Chromosomes Cancer 30(1): 80-86, 2001. Yakushiji T, Noma H, Shibahara T, Arai K, Yamamoto N, Tanaka C, Uzawa K, Tanzawa H. Analysis of a role for pl6/CDKN2 expression and methylation patterns in human oral squamous cell carcinoma. Bull Tokyo Dent Coll. 42(3): 159-68, 2001. Yin Z, Spitz MR, Babaian RJ, Strom SS, Troncoso P, Kagan J. Limiting the location of a putative human prostate cancer tumor suppressor gene at chromosome 13ql4.3. Oncogene 18(52): 7576-7583, 1999. Yokota T, Yoshimoto M, Akiyama F, Sakamoto G, Kasumi F, Nakamura Y, Emi M. Frequent multiplication of chromosomal region 8q24.1 associated with aggressive histologic types of breast cancers. Cancer Letters 139: 7-13, 1999. Yoo GH, Xu HJ, Brennan JA Westra W, Hruban RH, Koch W, Benedict WF, Sidransky D. Infrequent inactivation of the retinoblastoma gene despite frequent loss of chromosome 13q in head and neck squamous cell carcinoma. Cancer Res. 54(17): 4603-4606, 1994. Zeremski M, Horrigan S, Grigorian IA, Westbrook C, Gudkov AV. Localization of the 132 candidate tumor suppressor gene ING1 to human chromosome 13q34. Somatic Cell Mol Genet 23: 233-236, 1997. Zhang L, Michelsen C, Cheng X, Zeng T, Priddy R, Rosin M. Molecular analysis oral lichen planus. Am. J of Pathol. 151(2): 323-327, 1997. Zhang L, Cheng X, Li Y-H, Rosin M. High frequency of allelic loss in dysplasia lichenoid lesions. Lab Invest. 80: 233-237, 2000. Zhang L, Rosin MP. Loss of heterozygosity: A potential tool in management of oral premalignant lesions? (Review). J Oral Path Med. 30: 513-20, 2001a. Zhang L, Poh CF, Lam WL, Epstein JB, Cheng X, Zhang X, Priddy R, Lovas J, Le ND, Rosin MP. Impact of localized treatment in reducing risk of progression of low-grade oral dysplasia: molecular evidence of incomplete resection. Oral Oncology 37: 505-512, 2001b. 133 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091005/manifest

Comment

Related Items