UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Development of a cell assay to study polycomb group genes Chevalier, Jacquelyn 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-0483.pdf [ 12.91MB ]
Metadata
JSON: 831-1.0090998.json
JSON-LD: 831-1.0090998-ld.json
RDF/XML (Pretty): 831-1.0090998-rdf.xml
RDF/JSON: 831-1.0090998-rdf.json
Turtle: 831-1.0090998-turtle.txt
N-Triples: 831-1.0090998-rdf-ntriples.txt
Original Record: 831-1.0090998-source.json
Full Text
831-1.0090998-fulltext.txt
Citation
831-1.0090998.ris

Full Text

DEVELOPMENT OF A CELL ASSAY TO STUDY POLYCOMB GROUP GENES  By Jacquelyn Chevalier B.Sc. Biology, Universite Laval, 1999  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  In THE FACULTY OF GRADUATE STUDIES Department of Zoology  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA April 2003 © Jacquelyn Chevalier, 2003  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada  ABSTRACT Silencing is a form of transcriptional repression in which specialized structures of DNA or chromatin are inherited epigenetically. In Drosophila, the Polycomb group (PcG) genes are the best model system for studying silencing. Mutations in PcG genes cause posterior transformation in embryos and adults because homeotic genes are derepressed. PcG proteins act as members of oligomeric complexes. In Drosophila, PcG proteins mediate silencing of homeotic genes through complex, modular regulator elements ranging form 1 kb to 5 kb named PcG Response Elements (PREs). In transgenic flies, PREs maintain embryonic silencing of reporter constructs containing endogenous homeotic promoters and (para)segment-specific enhancers. This assay was used to identify PREs for many homeotic genes. PcG genes are required for maintenance rather than initiation and without the PRE, the transgene exhibits correct initiation of repression, but early in embryogenesis, the transgene becomes derepressed. All known Drosophila PcG genes have mammalian homologs and it appears that PcG function is conserved in mice and flies. Unfortunately, no one has identified a mammalian PRE in any system. Making transgenic mice is expensive and time-consuming, and no group has undertaken a systematic search for mammalian PREs. There is one published report of a group identifying a response element required for maintenance in mammals (Milne et al. 2002). Their approach tested different region of the Hox c8 locus in a reporter assay system and depended on the used of immortalized mouse embryonic fibroblasts (MEF). Based on the same principles, this thesis was aimed at identifying a murine PRE using immortalized fibroblast and a system of reporter vectors. The main goal of this thesis was to establish three MEF mutant cell lines for the PcG genes: rae28 the homolog of Polyhomeotic; M33 the homolog of Polycomb, or Asxll, the homolog of Additional sex combs. The secondary goal was to use these cells to test a putative mammalian PRE. This thesis reports the successful establishment of immortalized MEF mutant cell lines for Asxll, M33 and rae28. Our data suggest that MEF cell line of different genotypes may not be useful for studying the expression of endogenous genes. However, they may be useful for short-term studies of transgenes. One of these lines, rae28-/- was tested with a putative PRE from rae28 itself. Our preliminary results suggest that a PRE exists upstream of rae28, but the overall low transfection efficiency of the MEF, and the resulting high variability in expression of the reporter, prevents definitive conclusions. The strengths and weaknesses of this system are discussed and suggestion are made for ways to improve these experiments in the future.  ii  TABLE OF CONTENTS ABSTRACT  ii  TABLE OF CONTENTS  iii  LIST OF FIGURES  v  LIST OF TABLES  vi  ACKNOWLEDGMENTS  vii  LIST OF ABBREVIATIONS  viii  CHAPTER 1  General Introduction  1  MAINTENANCE AND EPIGENESIS  1  SILENCING AND THE POLYCOMB GROUP  2  TARGETS OF P C G REGULATION  4  PcG RESPONSE ELEMENTS (PREs)  5  MAMMALIAN PcG GENES  6  IDENTIFICATION OF MAMMALIAN P R E S  7  T H E GOALS OF THIS THESIS  9  CHAPTER 2  Materials and methods  11  MOLECULAR BIOLOGY  11  C E L L LINES  11  MOUSE EMBRYONIC FIBROBLASTS (MEF)  12  RETROVIRAL INFECTION OF MEF FOR IMMORTALIZATION  13  I. TBX2 immortalizing vector  13  II. Production of high-litre TBX2-immortalizing retrovirus  13  III. Titer determination  14 iii  IV. MEF infection and immortalization with TBX2-immortalizing vector  15  V . Genotyping of the embryos and MEF by PCR  15  ANALYSIS OF G E N E EXPRESSION IN P C G MEF  16  PRIMER CONSTRUCTION  17  RESCUE OF RAE28 EXPRESSION IN RAE28-I- FIBROBLASTS  21  MEF TRANSFECTION OPTIMIZATION  21  MEF DOSE RESPONSE CURVE TO HYGROMYCIN B  22  LUCIFERASE REPORTER ASSAY  22  I. DNA preparation and transfections  22  II. Luciferase Assays  23  ANALYSIS BY FLUORESCENT ACTIVATED CELL SORTER (FACS) PHOTOGRAPHY  CHAPTER 3  24 24  Experimental Results  25  INTRODUCTION  25  RESULTS AND DISCUSSION  30  I. Obtaining mouse embryonic fibroblasts  30  II. Production of TBX2 immortalizing retrovirus  31  HI. Analysis of Gene Expression in PcG MEF  39  IV. Comparison of Drosophila and murine regulatory regions of ph/rae28  50  V . Transfection Optimization  51  VI. Luciferase assays  58  CHAPTER 4 References  General discussion  67 72 iv  LIST OF FIGURES Figure 3-1 Comparison of ph locus and rae28 putative PRE  29  Figure 3-2 LZRS-delta-BamHl-r5vO-ires-eGFP vector  31  Figure 3-3 High-titre production of TBX2-immortalizing retroviral vectors  33  Figure 3-4 Percentage of rSZ2-transformed cells in immortalized MEF cell lines  35  Figure 3-5 Photographs of Immortalized Asxll MEF  38  Figure 3-6 Genotype of immortalized MEF  39  Figure 3-7 Analysis of PcG gene expression in Asxll MEF  40  Figure 3-8 Analysis of PcG gene expression in rae28 MEF  41  Figure 3-9 Analysis of PcG gene expression in M33 MEF Figure 3-10 Analysis of Hox gene expression in Asxll MEF  43 :  44  Figure 3-11 Analysis of Hox gene expression in rae28 MEF  45  Figure 3-12 Analysis of Hox gene expression in M33 MEF  46  Figure 3-13 Analysis of PcG and Hox gene expression in rescued rae28-l- MEF  47  Figure 3-14 Photographs of Immortalized rae28 MEF  48  :  Figure 3-15 Comparison of PcG and Hox gene expression in rae28 MEF of P4 vs P67 Figure 3-16 PRE assay reporters  49 51  Figure 3-17 rae28 +/+ MEF transfection optimization  53  Figure 3-18 rae28 -I- MEF transfection optimization  54  Figure 3-19 M33 +/+ MEF transfection optimization  55  Figure 3-20 M33 -I- MEF transfection optimization  56  Figure 3-21 MEF dose response curve to Hygromycin B  57  Figure 3-22 First series of reporter assays in 6-well plates  61  Figure 3-23 Second series of reporter assays in 6-well plates  64  Figure 3-24 Third series of reporter assays in 6-well plates  66  v  LIST OF TABLES Table 2-1 Genotyping PCR primers  18  Table 2-2 Primers for RT-PCR  19  Table 3-1 Passage number of non-transformed and 71M2-transformed fibroblasts  34  Table 3-2 Results:firstseries of reporter assays in 6-well plates  60  Table 3-3 Results: second series of reporter assays in 6-well plates  63  Table 3-4 Results: Third series of reporter assays in 6-well plates  65  vi  ACKNOWLEDGMENTS  First, I would like to thank my supervisor Dr. Hugh Brock for accepting me in is laboratory and providing me with the opportunity to learn English and work in a great laboratory. I am grateful for the constant support you have put into forwarding my career. You helped me greatly in the writing of this thesis and I want to thank you for your patience and generosity. I would like to thank all the individuals who greatly helped me with constructive criticism and stimulating discussions.  The work presented in this thesis was, in large part,  performed at the Terry-Fox Laboratory. I would like to thank Dr. Keith Humphries for his hospitality and for the great time had working in his laboratory. I would principally like to thank Dr. Nicolas Pineault, Dr. Jennifer Antonchuk, Dr. Andrew Thompson, Patty Rosten and Dr. Cheryl Helgason for sharing with me their precious knowledge.  My sincere thanks to all the member of the Brock Lab: Bob Argiropoulos, Ester O'Dor, Cynthia Fisher, Jacob Hodgson, Yung-Jun Wang, Sebastien Bloyer, Joyce Tan. It was always pleasant working with you.  Above all I would like to thank Sebastien for the  collaborative RT-PCR we did.  Finally I would like to dedicate this work to my mom, my sister and the rest of my family for their constant support and love.  vii  LIST OF ABBREVIATIONS -/-  Homozygous Mutant  +/+  Wild-type  Asx  Additional sex combs  ATP  Adenosine Triphosphate  bp  Base pair  cDNA  Complementary DNA  ChIP  Chromatin immunoprecipitation  COOH  Carboxyl terminal end  DMEM  Dulbecco's Modifiied Eagle's Medium  DNA  Deoxyribonucleic acid  EBNA  Epstein Barr Virus Nuclear Antigen  Esc/E(z)  Extra sex combs- Enhancer-of-zeste  FACS  Fluorescent activated cell sorter  FCS  Fetal calf serum  FRT  Flp Recombination Target'  GAF  GAGA factor  GFP  Greenfluorescentprotein  GTFs  General transcription factors  IRES  Internalribosomeentry site  kb  Kilobase-pair  MEF  Mouse embryonic fibroblasts  MIG  MSCV-IRES-GFP vector  MIR  MSCV-IRES-RFP (dsRed) vector  Mil  Mixed Lineage Leukemia  mRNA  Messenger RNA  MSCV  Murine Stem Cell Virus  NH  Amino terminal end  2  Orip  Epstein-Barr Virus origins of replication  PBS  phosphate buffered saline  PcG  Polycomb group  PCR  Polymerase chain reaction  ph  Polyhomeotic  Pho  Pleiohomeotic  PRC1  Polycomb repressive complex 1  PRE  Polycomb response element  RNA  Ribonucleic acid  RNAi  RNA interference  RT  Reverse transcriptase  SV40  Simian Virus 40  Tag  Large Tumor antigen  TBP  TATA-binding protein  TBX2  T-box factor 2  TRE  Trithorax Group response elements  trxG  Trithorax group  CHAPTER 1  General Introduction  Maintenance and Epigenesis Most somatic cells in an organism have the same DNA sequence, but a wide variety of intra- and extracellular stimuli change gene expression patterns in individual cells.  In  development, and throughout the life of an organism, cells must pass on their gene expression patterns to their daughter cells.  Gene expression patterns are initiated by the binding of  transcription factors to regulatory regions that act to activate or repress gene activity. Yet the expression of transcription factors is usually transient, the proteins have short half lives, and they are stripped from DNA prior to replication. On formal grounds, this suggests that initiation of gene expression is separable from maintenance of gene expression from mother cell to daughter cells. So how is the gene expression pattern maintained in daughter cells? It cannot be DNA sequence alone, since all cells have the same DNA sequence. This suggests that an epigenetic mechanism is important in maintenance.  In recent years it has become evident that chromatin plays a major role in maintenance. Failure to maintain the established gene expression patterns can lead to developmental defects or cancer (reviewed in Jacobson and Pillus 1999; Klochendler-Yeivin and Yaniv 2001; Muyrers-Chen and Paro 2001; Jones and Baylin 2002; Neely and Workman 2002). Examples of epigenetic maintenance include X-inactivation in mammals, parental imprinting, position-effect variegation in Drosophila, and mating-type silencing and telomeric position-effects in yeast (Henikoff 1994; Karpen 1994; Barlow 1995; Loo and Rine 1995; Lee and Jaenisch 1997). Overall, it appears that changes in chromatin structure, modifications to histones, and recruitment of specific proteins all play a role in maintenance. The epigenetic 1  mark that is passed from mother cell to daughter cells is now thought to be specific patterns of histone  modification,  principally methylation,  but also including acetylation and  phosphorylations (Jenuwein and Allis 2001). This has come to be called the "histone code" hypothesis (Strahl and Allis 2000).  Silencing and the Polycomb group Silencing is a form of transcriptional repression in which specialized structures of DNA or chromatin are inherited epigenetically. In Drosophila, the Polycomb group (PcG) genes are the best model system for studying silencing. PcG genes were identified originally because they encode chromatin proteins required to maintain silencing of homeotic and other loci (Jiirgens 1985; McKeon and Brock 1991; Simon et al. 1992; McKeon et al. 1994; Pelegri and Lehmann 1994). Mutations in PcG genes cause posterior transformation in embryos and adults because homeotic genes are derepressed. A key insight came from observations that embryos lacking maternal and zygotic PcG mRNA exhibit wild-type initiation of homeotic genes, but that the initial expression pattern was not maintained. This shows that PcG genes are required for maintenance rather than initiation (Struhl and Akam 1985; Jones and Gelbart 1990; Soto et al 1995).  In Drosophila at least 15 PcG genes have been identified (Simon 1995; Yamamoto et al. 1997). Based on deletion analysis it is estimated that as many as 30-40 PcG genes may exist (Jiirgens 1985; Landecker et al. 1994). Ten PcG genes have been cloned. All known PcG genes encode chromatin proteins and they bind to many targets on the chromosomes. Many PcG proteins have domains that are conserved between flies and mammals, and that are shared with known chromatin proteins (Paro and Hogness 1991; Alkema et al. 1995; Kyba 2  and Brock 1998; Satijn and Otte 1999).  PcG proteins act as members of oligomeric  complexes. The two best studied are the Polycomb repressive complex 1 (PRC1) (Shao et al. 1999) and the Extra sex combs/Enhancer-of-zeste (Esc/E(z)) complexes (Cao et al. 2002; Czermin et al. 2002; Kuzmichev et al. 2002; Muller et al. 2002). The Esc/E(z) complex acts early in embryogenesis and is thought to set the stage for the PRC1 complex which set the long-term memory. Both complexes are conserved between flies and mammals, although redundant copies of PcG genes are present in mammals and the existence of complexes with varied composition has been proposed (Satijn and Otte 1999).  It is not known how PcG proteins silence their target loci. At least 6 potential mechanisms of PcG-dependent silencing have been proposed. These models are not mutually exclusive. The most popular model is that PcG proteins alter chromatin structure to resemble heterochromatin, thus preventing access of transcription factors, or of general transcription factors (GTFs) (Alberts and Sternglanz 1990; Gaunt and Singh 1990; Paro 1990). A model rapidly gaining favour is that PcG proteins alter the histone code (Jenuwein and Allis 2001; Simon and Tamkun 2002) by chemically modifying the histones. The Esc/E(z) complex is a histone methyltransferase (Cao et al. 2002; Czermin et al. 2002; Kuzmichev et al. 2002; Muller et al. 2002), and there are reports that histone deacetylases associate with PcG proteins (van der Vlag and Otte 1999; Tie et al. 2001; Chang et al. 2002). A third model is that PcG proteins antagonize the proteins required to maintain activation. These proteins, termed the trithorax group (trxG) are members of ATP-dependent chromatin remodelling complexes, or are histone modifying enzymes (Brock and van Lohuizen 2001; Simon and Tamkun 2002). A fourth model is that PcG proteins antagonize GTFs (Bienz 1992), a view supported by recent observations that PcG complexes contain TATA-binding protein (TBP) and TBP-associated 3  factors, and bind to promoters (Orlando et al. 1998; Breiling et al. 2001; Saurin et al. 2001). A fifth model is that interactions between PcG proteins, bound on PcG binding sites placed along the DNA, results in looping of the DNA preventing interaction of the enhancer and promoter (Pirrotta 1995), and a sixth model is that PcG proteins localize target genes into transcriptionally inactive nuclear compartments (Schlossherr et al. 1994).  Targets of PcG regulation In Drosophila, the best understood targets of PcG silencing are the homeotic genes.  As noted above, PcG mutants exhibit homeotic transformations that arise from  misexpression of homeotic genes (Struhl and Akam 1985; Jones and Gelbart 1990; McKeon and Brock 1991; Simon et al. 1992; Soto et al. 1995).  Histochemical studies show that  antibodies to individual PcG proteins bind to polytene chromosomes at about 100 targets, including the homeotic loci, consistent with the idea that PcG proteins regulate homeotic genes. In many cases (Polycomb, Polyhomeotic, Polycomblike, Sex combs on midleg) there is complete overlap of binding sites (Zink and Paro 1989; DeCamillis et al. 1992; Lonie et al. 1994; Bornemann et al. 1998), whereas there is less overlap with Additional sex combs, Extra sex combs, Enhancer of Zeste, and Posterior sex combs (Rastelli et al. 1993; Carrington and Jones 1996; Sinclair et al. 1998; Tie et al. 1998). In total, PcG proteins bind about 150 discrete targets on polytene chromosomes.  The identity of most of these targets is unknown.  Genetic studies (McKeon et al. 1994; Pelegri and Lehmann 1994; Randsholt et al. 2000) suggest that segmentation genes like hunchback, even-skipped, hedgehog, patched and engrailed are PcG targets.  Recently, chromatin immunoprecipitation (ChIP) experiments  have confirmed that PcG proteins bind to engrailed and invected (a paralog of engrailed)  4  (Strutt and Paro 1997) and to hedgehog (Maurange and Paro 2002).  One unexpected  observation is that PcG proteins appear to bind to PcG loci themselves (Zink and Paro 1989; DeCamillis et al. 1992). This is unexpected because in flies PcG expression is ubiquitous (DeCamillis and Brock 1994), and because PcG proteins are thought to silence their targets. Nevertheless, genetic analysis shows that polyhomeotic (ph) autoregulates itself, and its expression is sensitive to mutations in Posterior sex combs (Fauvarque et al. 1995). Unpublished studies by Bloyer, Cavalli, Brock and Dura (personal communication) confirm that PcG proteins bind to regulatory regions of ph. These regions will be described more fully in the next chapter.  PcG Response Elements (PREs) In Drosophila, PcG proteins mediate silencing of homeotic genes through PcG Polycomb Response Elements (PREs). PREs are complex, modular regulator elements from 1-5 kb long in homeotic loci (Simon et al. 1990; Chan et al. 1994; Gindhart and Kaufman 1995; Muller et al. 1999; Tillib et al. 1999; Horard et al. 2000; Hodgson et al. 2001). Like enhancers, PREs are orientation-independent, can act 5' or 3' to the promoter, and can act at distance of up to 50 kb (Pirrotta 1997). silencing  of  reporter constructs  In transgenic flies, PREs maintain embryonic  containing  endogenous homeotic  promoters and  (para)segment-specific enhancers. This assay was used to identify PREs for many homeotic genes. Without the PRE, the transgene exhibits correct initiation of repression, but early in embryogenesis, the transgene becomes derepressed, and is expressed in every segment (Simon et al. 1990; Chan et al. 1994; Chiang et al. 1995; Gindhart and Kaufman 1995; Kapoun and Kaufman 1995; Hagstrom et al. 1997; Mihaly et al. 1997; Shimell et al. 2000).  Silencing  5  by transgenes is abrogated in PcG mutants, linking silencing, the PRE, and PcG genes. Different PREs are sensitive to mutations in different PcG genes, suggesting that different PcG proteins act at different PREs (Fauvarque and Dura 1993; Kassis 1994; Gindhart and Kaufman 1995). In Drosophila, PREs are intermingled with trxG response elements (TREs), suggesting that maintenance of activation and repression are coordinated jointly (Tillib et al. 1999). For this reason, it has been suggested that PREs and TREs be renamed maintenance elements (Brock and van Lohuizen 2001). However, for this thesis, we will refer to PREs.  How PcG proteins are recruited to PREs remains unclear. Only one PcG protein, Pleiohomeotic (Pho), binds DNA directly (Brown et al. 1998), but Pho sites themselves are not found in all PREs (Mihaly et al. 1998), and Pho sites are not sufficient to create a PRE (Brown et al. 1998; Fritsch et al. 1999; Tillib et al. 1999; Shimell et al. 2000). It is suggested that Pho recruits Polycomblike to PREs (Mohd-Sarip et al. 2002). Binding sites for the GAGA factor (GAF) are found in most PREs, and GAF has been found in PcG complexes, suggesting that GAF may recruit PcG proteins to PREs (Hagstrom et al. 1997; Strutt et al. 1997; Horard et al. 2000; Hodgson et al. 2001; Faucheux et al. 2003). Another protein that binds the GAGA sequence, Pipsqueak, may also recruit PcG proteins to PREs (Hodgson et al. 2001; Huang et al. 2002). Zeste has also been proposed to be required for PcG function (Hur et al. 2002), and is found in PRC1 (Saurin et al. 2001). Detailed analysis of the engrailed PRE suggests that multiple proteins act to recruit PcG proteins (Americo et al. 2002).  Mammalian PcG genes All known Drosophila PcG genes have mammalian homologs (Gould 1997; Schumacher and Magnuson 1997; Stankunas et al. 1998; van Lohuizen 1999; Brock and van 6  Lohuizen 2001). As in Drosophila, PcG proteins are members of large, multimeric complexes (Satijn and Otte 1999).  Mice in which PcG genes have been mutated exhibit various  hematopoietic defects (Raaphorst et al. 2001), and have homeotic transformations in the anterior-posterior axis (van der Lugt et al. 1994; Alkema et al. 1995; Akasaka et al. 1996; Schumacher et al' 1996; Core et al. 1997; Takihara  a/. 1997; Katoh-Fukui et al. 1998). The  hematopoietic defects may be correlated with derepression of Hox genes, as Hox overexpression has dramatic effects in hematopoiesis and leukemia in mammals (Sauvageau et al. 1995; Sauvageau et al. 1997; Thorsteinsdottir et al. 1997; van Oostveen et al. 1999). In mammals PcG genes repress targets required for cell-cycle regulation like pl6/INK4a (Jacobs et al. 1999) and c-myc (Tetsue/a/. 1998). Strikingly, M33, the mouse homolog of Polycomb can rescue Polycomb mutant phenotypes in flies, suggesting that functions of PcG proteins are strongly conserved (Muller et al. 1995). Unlike in flies, mammalian PcG proteins are not expressed ubiquitously (Gunster et al. 2001). In fact, expression varies greatly among tissues and even among specific cell types within a particular tissue. Overall, it appears that PcG function is conserved in mice and flies, but PcG proteins are likely to have acquired additional functions in mice.  Identification of mammalian PREs No one has identified a mammalian PRE in any system. The obvious place to look is in the Hox genes of mice. If regulation of Hox genes in mice parallels that in flies, one would expect that mice expressing transgenes with Hox regulatory DNA would show normal initiation of spatially-regulated expression, but that unless a PRE was present, would fail to maintain regulated expression. Interestingly, despite the fact that many labs have made such  7  transgenes, no one has reported a problem with maintenance, even though the Hox regulatory sequences chosen for analysis were quite small (see Tuggle et al. 1990; Behringer et al. 1993; Gould et al. 1997 for a small sample). One could propose that mammalian Hox genes are regulated differently than Drosophila Hox genes.  But this explanation can be ruled out  because analysis of Hox expression in PcG and trxG mutations in mice shows that initiation of Hox expression is normal, but then is not maintained (Yu et al. 1998; Tomotsune et al. 2000), suggesting that maintenance is necessary for Hox regulation. It may be that murine PREs are located very close to promoters, so that all transgenes contain PREs.  While this  possibility has not been tested directly, for at least Hox c8, it is known that the DNA element required for maintenance of activation is located about 8 kb 3' to the gene, consistent with the distant location of maintenance elements in Drosophila (Bradshaw et al. 1996).  In any case, making transgenic mice is expensive and time-consuming, and no group has undertaken a systematic search for mammalian PREs.  Several laboratories have used  Drosophila to assay mammalian sequences for maintenance of homeotic gene expression, but successful results have not been published.  There is one published report of a group identifying a response element required for maintenance in mammals (Milne et al. 2002). The approach they used depended on the use of immortalized mouse embryonic fibroblasts (MEF). If mouse embryos are trypsinized, and cells are plated on plastic dishes, fibroblasts attach to the plastic. Primary fibroblasts have a very limited lifespan (about 5 passages), but can be immortalized by transfection with large T antigen. In this case, MEF were obtained from wild-type and Mil mutant mice. Mil is a homolog of trithorax, and is required for maintenance of homeotic gene activation (Yu et al. 1998). When expression of Hox genes was compared in wild-type and Mil-/- MEF, the same 8  Hox genes that were M/-dependent in embryos were also M/-dependent in MEF, suggesting that MEF were a good model system for analysis of Hox gene expression (R. Hanson and J. Hess, personal communication).  Milne et al. (2002) constructed reporter gene vectors  regulated by the Hox c8 basal promoter, plus different putative regulatory DNA from the locus, and screened for DNA sequences that activated the reporter in M11+/+ but not Mll-/MEF. When a putative sequence was found, it was then rechecked in Mil-/- fibroblasts that had been transfected with an expression vector for Mil, to confirm that the change in reporter activity was M/-dependent, and not an indirect effect of the Mil mutation. Interestingly, Mil appears to act directly on the Hox c8 promoter, rather than through a TRE (Milne et al. 2002).  The goals of this thesis Based on the above experiments we hypothesized that there would be other regulatory DNA sequences that would act as PREs for different PcG genes. Thus we wished to develop a similar assay system for PREs in mammals. Understanding epigenetic gene regulation will have important implications for human biology and diseases. Unfortunately, our progress in this field has been limited by a lack of known target binding site for mammalian PcG homologs. The main goal of this thesis was to establish MEF mutant for three different PcG genes: rae28, the homolog of ph; M33, the homolog of Polycomb, and Asxll, the homolog of Additional sex combs. The secondary goal was to use these cells to test a putative mammalian PRE. The reasons for these choices will be introduced in the next chapter. This thesis reports the successful establishment of three immortalized MEF cell lines mutant for Asxll, M33 or rae28. One of these lines, rae28-/- was tested with a putative PRE from rae28 itself. Our preliminary results suggest that a PRE exists upstream of rae28, but the overall low  9  transfection efficiency of the MEF, and the resulting high variability in expression of the reporter, prevents definitive conclusions. The strengths and weaknesses of this system are discussed, and suggestions are presented for ways to improve these experiments in the future.  10  CHAPTER 2  Materials and methods  Molecular biology Preparation of DNA, restriction enzyme digestion, bacterial transformation, agarose gel electrophoresis were performed according to standard procedures (Sambrook et al. 1989). Enzymes were purchased from New England Biolabs (Pickering, ON, Canada) or Invitrogen (Burlington, ON, Canada).  Large-scale DNA preparations (Maxi-prep kit, Qiagen,  Mississauga, ON, Canada)) were performed according to the manufacturer's directions.  Cell lines Cell lines used in this study were obtained from the American Type Culture Collection (ATCC) unless specified otherwise. The GP E86 (Markowitz et al. 1988) cells containing the +  MSCV-IPvES-GFP (E86-MIG) and  MSCV- rae28 cDNA-IRES-GFP (E86-MIG-rae28)  provirus constitutively producing ecotropic virus were obtained from Dr. Yoshihiro Takihara (Department of Developmental Biology and Medicine, Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka, Japan) and were produced in Dr. Keith Humphries' Laboratory (Terry-Fox Laboratory, BC Cancer Research Centre, Vancouver, Canada). All cell lines were maintained in tissue culture medium; Dulbecco's modified essential medium (DMEM) (StemCell Technologies, Vancouver, BC, Canada) with 10% fetal calf serum (FCS) (Invitrogen) and 100 UI penicillin/ 100u.g streptomycin (Invitrogen) per ml. Established cell lines were cultivated and frozen according to standard procedures (Freshney 2000).  11  Mouse embryonic fibroblasts (MEF) M33 +/+ and M33 -/- MEF were obtained from day 14.5 fetal livers from wild-type or M33 mutant mice (Katoh-Fukui et al. 1998)(a gift from Dr. Toru Higashinakagawa, Department of Biology, Waseda University, Shinjuku, Tokyo, Japan). rae28 +/+ and rae28 -/MEF were obtained from day 14.5 embryos wild-type or rae28 mutant mice (Takihara et al. 1997) (a gift of Dr. Yoshihiro Takihara). Asxll+/+ and Asxll-I- MEF were obtained from day 12.5 embryos wild-type or Asxll mutant mice (C. Fisher and H. Brock, in preparation). Pregnant females were sacrificed by cervical dislocation and the uteri removed. Each decidua was transferred to a sterile petri dish. The muscle layer of the uterus was removed and the Reichert's membrane cut to allow the separation from of the placenta from the yolk sac surrounding the embryo.  The embryos were freed from the yolk sac, decapitated and  eviscerated before being minced with sterile scissors. The tissues were disrupted using a 16 gauge blunt-end needle (StemCell Technologies) and a 12cc syringe in a small volume of PBS (StemCell Technologies). For embryos of day 13.5 or older, 1 ml of collagenase (Invitrogen) was added to each embryo and incubated for 1 hr at 37 °C with frequent mixing before disrupting the embryonic cells with the blunt needle. The cells were then resuspended in 40 ml of PBS, centrifuged and then plated in 10 cm tissue culture dishes (BD Falcon™, Oakville, Canada) in tissue culture medium.  After allowing cells to attach to the culture dish,  unattached cells were removed by aspiration, and the primary fibroblasts were grown to confluence.' DNA from the liver tissue was purified using the DNAzol (Invitrogen) standard protocol and used to genotype the embryos by polymerase chain reaction (PCR) as described in the next section. MEF obtained from wild-type and -/- embryos were expanded to have enough tofreezethree vials containing -1X10 cells. The freezing media used for the MEF 6  12  contains 45% DMEM, 45% FCS and 10% Dimethylsulfoxide (DMSO) (Sigma, Oakville, Canada).  Retroviral infection of MEF for immortalization I. TBX2 immortalizing vector The LZRS-delta-BamHl-71fiA2-ires-eGFP vector (see Figure 3-2) was a generous gift from Dr. M. van Lohuizen from the Netherlands Cancer Institute, Amsterdam, The Netherlands (Jacobs et al. 2000). This is a modification of the Moloney murine leukemia virus-based retroviral vector, LZRS, system (Kinsella and Nolan 1996) producing a retrovirus vector capable of expressing TBX2 and GFP in infected cells (Jacobs et al. 2000). The LZRS system uses two elements from the Epstein-Barr virus the Epstein-Barr Virus origins of replication (Orip) and the Epstein Barr Virus Nuclear Antigen 1 (EBNA-1), to confer stable episomal maintenance capabilities under puromycin selection.  Cells infected with the  retrovirus cannot be selected for but GFP expression serves as a convenient marker.  II. Production of high-titre TBX2-immortalizing retrovirus Production of high-titre helper-free retrovirus was carried out by standard procedures, to obtain high-titre supernatants from transfected Phoenix™ Ecotropic packaging cell lines (Kinsella and Nolan 1996). Phoenix™ cells were plated to achieve -70% confluence in a 10cm tissue culture plate the day of the transfection.  10 ug of circular LZRS-delta-BamHl-  TZLO-ires-eGFP plasmid was transfected according to the calcium phosphate protocol of the Cellphect transfection Kit (Amersham Biosciences, Baie d'Urfe, Canada). At 24 hr posttransfection, medium was replaced with 8 ml of fresh medium. At 48 hr post-transfection, 13  supernatant containing the retroviral vector was collected for titer or frozen at -80 °C to await titering at a later time point.  All cells were trypsinized with 1,5 ml of trypsin-EDTA  (Invitrogen) and placed into two 10 cm tissue culture plates containing fresh medium and the antibiotic puromycin at concentration of 600 ug/ml and 1000 ug/ml (Sigma).  Cells were  maintained in the selective medium until three confluent plates were obtained. Subsequently cells were ready to be frozen or used for infection. Cells were maintained in the selective medium until 48 hr prior to any given collection of retroviral vector.  At 48 hr prior to  collection for retroviral vector, cells were overlaid with puromycin-free medium. Then 24 hr before collecting the r&O-immortalizing virus, medium was again replaced with 8 ml of fresh puromycin-free medium. Collected viral supernatant that was not used immediately for titer determination or MEF immortalization was frozen on dry ice in 4 ml aliquots before being transferred to a -80 °C freezer to await use at a later time. All viral supernatants were filtered through 45 urn low protein binding Gelman Acrodisc® filters (Fisher Scientific, Nepean, Canada) before being frozen or used for infection.  III. Titer determination Frozen or fresh vector stocks collected from producer cell lines were serially diluted with fresh DMEM to obtain the 1/1, 1/3, 1/10 and 1/33 final ratio (retroviral supernatant/final volume) in a total volume of 500 ul. Diluted and undiluted vector stocks were overlaid onto 1.5X10 NIH-3T3 cells that had been plated the day before in 6-well plates. Polybrene 5  (hexadimethrine bromide, Sigma) was then added to the vector-containing medium to a final concentration of 5 u.g/ml to promote viral entry. At 4 hr post-infection, 2.5 ml of prewarmed fresh medium was added. To determine the number of cells per well at the time of infection, 14  cells from two wells were harvested and counted using a hemocytometer. At 48 hr postinfection, cells were harvested and the percentage of GFP expressing cells was determined by FACS. Titer (transducing units/ml) was calculated as: 2X(% of GFP positive cells)(NIH-3T3 per well at infection time)(dilution factor).  IV. MEF infection and immortalization with TBX2-immortalizing vector MEF were plated in 10 cm tissue culture plates at less than 50% confluence. 8 ml of fresh retroviral TiLO-immortalizing supernatant was directly transferred from the high-titer producer Phoenix™ cells to the MEF after being filtered through a 45 Lim low protein binding Acrodisc® filter (Gelman). Polybrene (hexadimethrine bromide, Sigma) was then added to the vector-containing medium to afinalconcentration of 5 ug/ml. 4 hr post-infection, medium was replaced with 10 ml offreshmedium. Cells were passaged 4 days after infection and the percentage of GFP positive cells was determined by FACS. Subsequently cells were kept in culture until stable cell lines were established.  Genotypes of established cell lines were  confirmed by PCR and large numbers of samples were then frozen.  V. Genotyping of the embryos and MEF by PCR Genomic DNA was isolated from confluent 6 cm tissue culture plates or from the embryo liver tissues using the reagent DNAzol (Invitrogen) following the recommendations provided by the manufacturer. DNA pellets were resuspended for at least 24 hr at 4 °C in 40 ul of Ultrapure™ Water. Each PCR sample used 1/4000 of the DNA obtained, dNTPs at 0.2 mM, 0.2 u.M of each primers (see Table 2-1 for primer details), PCR buffer (20 mM Tris-HCl (pH 8.4), 50 mM KC1), 2 mM or 1.5 mM MgCl for Asxll -I- and Asxll +1+ or rae28 -/-, 2  15  rae28 +/+, M33 -I- and M33 +/+ respectively and 2 U or 1.25 U Platinum® Taq DNA polymerase for Asxll -/- and Asxll +/+ or rae28 -/-, rae28 +/+, M33 -I- and M33 +/+ respectively. PCR conditions were: for Asxll +/+ and Asxll -/-, 30 sec at 94 °C, 30 sec at 62 °C and 30 sec at 72 °C for 40 cycles; for rae28 +/+ and rae28 -/-, 30 sec at 94 °C, 30 sec at 55 °C and 40 sec at 72 °C for 40 cycles; for M33 +/+ and M33 -I- 30 sec at 94 °C, 30 sec at 62 °C and 30 sec at 72 °C for 40 cycles. All reagents used were from Invitrogen.  Analysis of Gene Expression in PcG MEF Total RNAs were isolated from 4xl0 cells using the Spin Protocol of the RNeasy® 6  mini kit (Qiagen) according to the manufacturer's direction.  Cells were grown in a  monolayer, trypsinized and collected as a cell pellet prior to lysis.  Each sample was  homogenized by passing the lysate 5 times through a 20-gauge needle fitted to an RNase-free syringe. Prior to cDNA amplification, remaining DNA was removed using the Amplification Grade DNasefromInvitrogen according to the manufacturer's direction. 8 jul of the resulting RNA was used for the cDNA amplification using the Superscript kit (Invitrogen) following the manufacturer's protocol. For each cell line, a control without reverse transcriptase was also produced. The resulting cDNA were stored at -80 °C. PCR amplification of the transcript of interest was performed using the primers described in Table 2-2 and the PCR Master kit (Roche, Laval, Quebec). PCR conditions were 30 sec at 94 °C, 30 sec at 60 °C and 30 sec at 72 °C for 27-35 cycles.  16  Primer construction Required  primers were  designed  or verified  using  Primer3 (http://www-  genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and identity with murine sequence was determined with the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/).  17  00  3 (L)  u  g  S  IT)  cq CN  CO  o  o  ft.  Q  (-1  as  OS PH l  PH I  PL, CO  ^ < o  ^  PH  CO  PH  /f< <  ^  ro  o H  OH  CO  ^  < ro  CM  o  PH  UH  H >  >  Pi in H  Pi  H en  +  O / - N io  IT)  o fN H  Is  o H  PL  H  CO  CN CN  s • HH  C  '3 a d> CN CN  CN  CN  o\ 00  o CN  •c I.S .  co  i>  •a CJ  o <  w CO  O C3  CJ CJ  u o o a <u co L.  <U  a c  3  CD  CJ <; CJ  <  CJ EH CJ CJ CJ CJ  a U PH  WD  >  a 'a.  o a  O U  fl •  ro i  3 « H  oo <N  a SL.  co CO  O OH O  co  13  Os  s  ON ON 5>J CJ  ti o  • M  l<2 ,  o  xi  ,ti o o  H o  os  GO  O  >«  Os  in  CN co co  ro  co  CN CN 15=  "3)  CN  O CJ CJ  \m\  A  <o  En  CJ  EH CJ CJ CJ  CJ EH  < <  I  CJ EH EH EH EH CJ EH  i n  CJ  <  CJ  o CJ < o CJ  0)  o  X  O O CN CN  CJ EH CJ CJ CJ  0). ICO.  u  <  CJ EH CJ CJ CJ CJ EH EH < CJ CJ CJ EH CJ CJ  < u EH< CJ CJ < CJ  co co CN CN  EH EH CJ CJ EH CJ EH EH EH CJ < CJ EH CJ EH CJ CJ CJ CJ EH CJ EH CJ  co  J3 co O  !*  ><  Q  Q  o o  CN  in  I  in  ro  JH  CO  u o  | H  T-H  O  00  *©  in  oo oo in  CN  CO  U  o\ m m  Os  m in Os in in  Os  CN CN  <  CJ CJ EH CJ  CJ EH  EH CJ EH CJ CJ EH CJ CJ CJ CJ CJ  EH CJ CJ CJ EH CJ EH  <  CJ EH CJ CJ EH CJ CJ EH CJ EH CJ EH  < CJ CJ  CJ CJ CJ CJ CJ CJ CJ CJ CJ  CJ  EH  EH CJ CJ CJ EH CJ CJ CJ EH EH CJ EH CJ EH CJ CJ  EH CJ CJ CJ  J CJ < C< EH CJ < CJ  < EH < EH  < EH CJ CJ CJ < EH CJ EH  CJ CJ  <  <  CJ CJ CJ EH CJ  CJ CJ CJ CJ CJ  < o  o  <  CJ EH EH CJ  CJ CJ EH CJ CJ EH O EH CJ EH  <  s  CJ CJ CJ  cj  <  CJ CJ  <  <  EH CJ EH CJ CJ CJ CJ CJ  <  <  CJ CJ EH EH  EH CJ CJ EH CJ EH CJ CJ  CJ  < CEHJ  CJ  EH CJ  CJ EH CJ CJ EH CJ EH CJ CJ CJ  <  CJ CJ  o <  ,-<3  "I  (N O  •c  PH CN  > ti  tH  .ti %-> CJ (53  .ti C3  •c CQ CQ PH  i  >  o ti  ti  ti  PH  PH  I  H  CO  m  CJ  a 3  in in  CO CO  O O O CN O m CO o O CN CN CN CN CN CN CN CN CN CN  o o O CN  CN  a  o o  VH  O  Q  CN ro  CN CN  o  SH  O  Q  2 w  CO  *H  oo  o H  co co 1)  CO  O  CN 00  •3  ti  >-H  CO  S 3  Xi  oo  o  s  o o H 3  C3  ro X  CO  o o  O  o PH  tii  < X  In  o  H H  > ti  ti  o  PH  H H  PS,  in  < X  o o o  >  H H  o  VH  O  ti  PH  PH  ti  PH  CO  co  I  I  > o ti P H ti  o P6l PH  ti  PH  PH I  ti  >H  tii  CQ CQ CQ CQ CQ CQ o o x x x x X x ,o o o o ,x o o o X  o  >  •0 0) 3 C •H -P  PH  P^  G 0 U  PH  Pf!  CN i  in in U O  x X o o  CN  H  (10990-11013)  (11571-11549)  CACAGTTGCAGGGTAGCTTGTTG  CTGAGGTCCACCTAAGGAAGTCAG  v© m  Rev  TCCATCCACTGTAGCTGC  m  For  (383-366)  o  M11-7-F M11-7-R  Rev  O o CN CN  GAAGGACCCGCGTGGAGC  o o CN CN  (43-60)  in in CN CN  For  CN CN c«->  Asxl-1-F Asxl-3-R  o o CN CN  GACTCCTTCACGGTGACAGT  o o CN CN  AGCTGACTTGCAAGGCAACG  GAGGTATGGGGAAGGGGTTA  CACTGGCATCTCCAGGTTTT  in in m m  (1667-1648)  For Rev  mph2-F mph2-R  ACTGCCAGGCTTGGGACCTCTCTTC  AGCCACCATCACCTTCCCACAACTT  in in in in  Rev  For Rev  scmhl-F scmhl-R  GGAGCGCCATTAACAGTCAT  AGTTCCTCCGCAACAAAATG in in m in  (1346-1365)  For Rev  mell8-F mell8-R  GAGGGGCAGTGAGGGTTGTT  in in m in  For  (1392-1373)  Rev  GGCAGAAGCAGATGGGAGTG  CN in cn  M33-F M33-R  (1040-1059)  o o CN CN  For  in CN  Rae28-3-F Rae28-3-R  (3440-3421)  Rev  in m CN CN  GTGCTACATGGTGACAGCTT  00  AGCTAGGAAAGCTGACCTCT  Dr. Jay Hess's lab  From Cynthia Fisher data (mAsx cDNA seq.)  (Lessard et al. 1998)(Downstream chromodomain nt 1346-1667 of Acc #X62537)  (Koga et al. 2002)  3190-3440 of Acc # U63386)  (Lessard et al. 1998) (3' UTR of m  "c3 co w  (3190-3209)  56.7 56.7  CO  For  GGTCCCTGATGAGATATGATTCGTC CAGGACGGAAAATCGCTACAGTC  Tom Milne, from Rob Hanson (Mice)  GenJ3ank:X16511  as as  Rae 28-2-F Rae 28-2-R  (506-484)  CN  (20-44)  as  CTGATTTAAGTGGCCTTGTCC  AGCATGAGCTCCTACTTCG  CN CN CN  Rev  For Rev  HoxC8-F HoxC8-R  59.8 60.2 as m  For  (543-523)  Rev  GCTCCGTAACCGACCCCACTG  GTTCTGAGCAGGGCAGGACTGC f-H  HoxC9-F HoxC9-R  (441-462)  For  HoxC6-F HoxC6-R CN O  o o CN  CN oo in  CN oo oo m m  00 00 m CN CN  Rescue of RAE28 expression in rae28-l- fibroblasts Ecotropic Producer cells GP E86 (Markowitz et al. 1988) containing the MSCV+  rae28cDNA-IRES-GFP (E86-MIG-rae28) vector and constituvely producing the MlG-rae28 virus were obtained from Dr. Yoshihiro Takihara (produced in Dr. Keith Humphrie's Laboratory). Once integrated in the genome it is able to express RAE28 and GFP as a selection marker. Producer cells were grown to confluence and the medium was replaced by 8 ml of fresh medium 24 hours prior to infection. Viral supernatant was collected, filtered through 45 um low protein binding Acrodisc® filters (Gelman) and used to infect rae 2 8-/fibroblast plated at a confluency of less than 40%.  Polybrene (hexadimethrine bromide,  Sigma) was then added to the vector-containing medium to a final concentration of 5 ug/ml. 4 hours later, the infection was repeated to ensure a maximum number of cells would be infected. 4 hours past the second infection, the viral supernatant was replaced by 10ml of fresh medium. 96 hours later the cells were ready to be transfected with the PRE assay reporters or to be used for the RT-PCR analysis of gene expression. Infection efficiency was measured by detecting GFP expression by FACS.  MEF transfection optimization Cells were plated to reach a confluence of 60% in 6-well tissue culture plates on the day of transfection.  Effectene™ (QIAGEN) transfection reagent was used following the  recommendations provided by the manufacturer to transfect the MEF with MSCV-IRES-RFP (MIR). MSCV-IRES-RFP (MIR) was generated by Dr. Jennifer Antonchuk in Dr. Keith Humphries' laboratory by replacing the GFP fragment of the GFP vector (Antonchuk et al. 2001) digested  Ncol/Clal (blunted) with the Ncol/xbal fragment of pDsRed (Clontech, 21  Mississauga, Canada). Cells transfected with the vector produce the DsRed protein that is detectable by fluorescence in the FL2 channel on a FACScan™ or FACSCalibur™ (Becton Dickinson) equipped with a 488-nm argon laser. Transfection efficiency was measured by FACS two days after transfection.  Different ratios of DNA/Effectene™ (following the  manufacturer's recommendation) were tested using the quantities of DNA indicated. The conditions resulting in the highest DsRed fluorescence were determined as being the optimum condition to transfect the MEF.  MEF dose response curve to Hygromycin B Immortalised MEF were plated at 80% confluence in 24-well plates. Cellular viability was evaluated after 12 days of culture in medium containing between 50 ug/ml to 1200 ug/ml of Hygromycin B in ug/ml. Cells were trypsinized and 500 ul of the resuspended cells were diluted 500 ul with a 0.4% trypan blue solution. The number of stained cells was than counted using a hemocytomer. The percentage of unstained cells represent the percentage of viable cells.  Luciferase reporter assay I. DNA preparation and transfections Three independent transfections were performed for each vector, in each cell line for each of the luciferase assays performed. All luciferase reporter vectors were linearized with Kpnl and pMSCVhyg (Clontech) was linearized using Xhol. Proteins were extracted with two phenol/chloroform steps and one chloroform step before been precipitated and resuspended in sterile water. 30,000 MEF were plated in each well of a 6 well plate 24 hours 22  prior to transfection. 750 ng of reporter vector (described in the Results section), and 50 ng of the vector pMSCVhyg were transfected into the MEF using a 1:50 ratio of DNA to Effectene™ (QIAGEN) according to the manufacturer's protocol and the transfection optimization previously described. The transfection medium was left on the cells for 6 hours, the cells were washed, and fresh medium was added. 72 hours post transfection, selection media containing 100 ul/ml of hygromycin was added to the cells. The selection media was replaced after 6 days. 10 days post transfection, mock-transfected plates were stained for 10 minutes with a solution of 0.2% crystal violet stain in 10% phosphate-buffered formalin and washed until clear to evaluate the number of colonies present. None were observed, wherea small colonies were already visible in the cells co-transfected with the reporter and the pMSCVhyg carrying the hygromycin resistance gene.  When macroscopic colonies were  visible, each well was trypsinized and replated to allow a more uniform growth, and hygromycin selection was replaced by fresh medium.  II. Luciferase Assays Luciferase Assays were performed using the Luciferase Assay System with Reporter Lysis Buffer (Promega, Madison, USA). Cells were grown to confluence and cell lysate was collected according to the manufacturer's directions. All samples were immediately frozen on dry ice and transferred at -80 °C for storage. When ready to perform the luciferase assay, all cell extracts were warmed to room temperature, vortexed for 15 seconds and centrifuged at 12,000 x g in a microcentrifuge for 15 seconds. 10 ul of room temperature supernatants were mixed with 50 ul of room temperature Luciferase Assay Reagent in Durex™ Borosilicate Glass tubes and light intensity was quantified with a luminometer for 10 seconds. 23  Background light was quantified by replacing the cell extracts with 10 ul or Reporter Lysis Buffer included with the kit. Luciferase activity was normalized for each sample by mixing 50 ul of the cell extract with 150 ju.1 of water and reading OD260 on a spectrophotometer. The blank was 50 ul of Lysis Buffer and 150 ul of water.  Analysis by Fluorescent Activated Cell Sorter (FACS) Cells were trypsinized and washed in PBS (Stemcell Technologies) containing 2% FCS (Invitrogen). The cell pellet was resuspended in 400 u.1 FACS buffer (PBS, 2% FCS) containing 1 u.g/ml propidium iodide (PI) (Sigma). Fluorescence was detected by FACScan™ or FACSCalibur™ (Becton Dickinson, Mississauga, Canada) equipped with a 488-nm argon laser. The FL1 emission channel was used to monitor GFP fluorescence; the FL3 channel was used to identify PI red fluorescence to exclude dead cells and the FL2 channel was used to detect DsRed fluorescence. Non-infected/transfected cells were used as negative control for GFP/DsRed fluorescence.  The analysis was done on CellQuest plus™ Software (Becton  Dickinson).  Photography MEF in 10 cm tissue culture plate were photographed with a Handheld Canon S40 digital camera through the eyepiece of a Leitz (Wetzlar, Germany) DIAVERT inverted microscope using the Phaco 10/0.25, 170/- objective and appropriate filter. Magnification used was the same for all cell type.  24  CHAPTER 3  Experimental Results  Introduction MEF were established from mice mutated in three PcG genes: Asxll, M33, and rae28. Additional sex comb-like 1 (Asxll) is the homolog of Additional sex combs (Asx) in Drosophila. Asx is unusual because it is required for maintenance of both activation and repression. Asx mutants exhibit both the posterior transformations typical of PcG mutations, but also exhibit anterior homeotic transformations typical of trxG mutations (Sinclair et al. 1992). In addition, Asx mutations enhance the phenotype of both PcG and trxG mutations (Milne et al. 1999). Our laboratory has established a mouse knock-out model of Asxll. Mutant mice die perinatally, and exhibit posterior and anterior transformations in the anteroposterior axis, suggesting that Asxll, like Asx is needed for maintenance of both repression and activation. Asxll-/- mice exhibit hematopoietic defects, and defects in eye development (C. Fisher, K. Humphries, and H. Brock, personal communication). Asx physically interacts with Trx, the homolog of MLL, which is mutated in many aggressive pediatric leukemias (Milne et al. 1999; Ayton and Cleary 2001), and this interaction is conserved in ASXL1 and MLL in humans as determined by biochemical assays (E. O'Dor, H. Brock personal communication). Because the role of Mil in regulation of Hox c8 has been well-studied (Milne et al. 2002), we wanted to make Asxll-/- MEF so that it would be possible to study the role of Asxll in regulation of Hox c8, and to determine if Asxll and Mil interact in vivo.  M33 is the murine homolog of Polycomb. Its function is conserved in mice and flies (Muller et al. 1995), and M33 with Rae28, is a member of the PRC1 complex of mammals (Levine et al. 2002).  M33-/- mice exhibit posterior homeotic transformations, sex reversal, 25  and hematopoietic defects (Core et al. 1997; Katoh-Fukui et al. 1998). Mice heterozygous for the M33 mutation were generously donated to us by Dr. T. Higashinakagawa.  Mice knockout for rae28 exhibit posterior transformations in the anteroposterior axis, hematopoietic defects, and defects consistent with defects in cervical neural crest cells (Takihara et al. 1997; Tomotsune et al. 2000; Tokimasa et al. 2001; Ohta et al. 2002; Shirai et al. 2002). This gene is also called mphl or HPH1, but in this thesis, we will use the original name of the locus, rae28, so-called because it was identified first as a retinoic acid early response gene (Nomura et al. 1994). The regulatory region of rae28 has been identified and characterized (Motaleb et al. 1999).  In experiments carried out by Dr. Leonie Ringrose in the laboratory of Jean-Maurice Dura, Institut de Genetique Humaine, Marseilles, a detailed comparison of the regulatory regions of ph and rae28 was undertaken in an effort to identify conserved regulatory regions (personal communication). The analysis below is her work, and is summarized here so that the logic of the next experiments is apparent. We thank her for permission to describe her unpublished work.  We also refer to unpublished work by Sebastien Bloyer, then a doctoral  student in the laboratory of Jean-Maurice Dura, and now a post-doctoral fellow in our laboratory.  As noted in Chapter 1, it is surprising that PcG proteins bind to PcG loci, because PcG genes are expresses ubiquitously, and yet PcG proteins are supposed to repress. The ph locus is duplicated, and the ph-proximal and ph-distal transcription units are regulated independently (Hodgson et al. 1997). Sebastien Bloyer has identified a 3 kb region that is the minimal element required for regulation of ph by PcG genes in functional assays, indicated in 26  Figure 3-1 as fragment ph418.  One of the functionally identified characteristics of ph418 is  that it is sensitive to PcG mutations in vivo, defining this fragment as a PRE.  He also  identified a similar region upstream of the ph-distal transcript.  Dr. Ringrose compared the sequences of these regions and identified two regions of high similarity. Within these similar regions are binding sites for GAGA factor (GAF), and for Pleiohomeotic (PHO), two known PRE-binding proteins. The location of these conserved regions is shown in Figure 3-1B. She also compared the sequences of the Drosophila ph regulatory regions with the 3.8 kb immediately upstream of the transcription start of rae28, and identified two small regions of sequence conservation that are present in the mammalian and Drosophila sequences.  These also consist of GAF and PHO recognition sequences.  This apparent sequence conservation raises the possibility that the 3.8 kb upstream of rae28 might be a PRE. Thus we needed a system where we could test the function of this putative regulatory region as a PRE. Using the same approach as Milne et al, (2002) we decided to use a reporter system and MEF cell lines mutant for different PcG genes.  The traditional way to immortalize primary cells is to grow many cells, and select for a spontaneous mutation that immortalizes the cells (Todaro and Green 1963; Rittling 1996). This method requires many embryos, and it is difficult to compare different cell lines, because the mechanism of immortalization is likely to be different. The Large T-antigen (Tag) of SV40 has also been used to immortalize primary cells, and MEF in particular (Milne et al. 2002). Tag is required for the induction and maintenance of malignant transformation of nonpermissive cells by the SV40 virus. Tag reduces the levels of cell cycle-dependent kinase inhibitors in contact-inhibited cells. Tag also interferes with cell cycle regulation because it interacts with pRb and p53 proteins. Cells expressing Tag divide faster than normal cells, 27  exhibit drastically changed phenotypes, and often become polyploid, probably because the cell cycle checkpoints that block progression in response to DNA damage are missing (Fanning and Knippers 1992; Saenz-Robles et al. 2001; Sullivan and Pipas 2002).  For the experiments reported here, a newly described gene, TBX2 was used to immortalize MEF. TBX2 was detected in a screen for genes that allowed for the bypass of senescence of primary fibroblasts. TBX2 encodes a mammalian T-box transcription factor that downregulates the INK4a-ARF locus.  The pl9ARF protein, one of the two tumor  suppressors encoded by the INK4a-ARF locus, activates p53.  TBX2 expression does not  confer a growth advantage to immortalized cells, and cells that suffer DNA damage undergo apoptosis (Jacobs et al. 2000). This means that cells immortalized with TBX2 are much less abnormal than cells immortalized with Tag.  In the next section, experimental data on the immortalization of PcG mutant MEF is described and attempts to use these cells to test for putative PRE activity in rae28 regulatory DNA is reported.  28  ±3 ffl  c3  "5b __ "2 7 <S  £ §1  CQ  03  is S  Results and Discussion I. Obtaining mouse embryonic fibroblasts. To obtain mouse embryonic fibroblasts (MEF) from PcG mutant embryos, male and female mice heterozygous for the PcG mutations rae28, M33, or Asxll were crossed. After checking for successful mating, twelve (Axil) or fourteen days (rae28, M33) later, pregnant mothers were sacrificed, embryos were dissectedfromthe uteri and genotyped as described in the Materials and Methods (Chapter 2). Meanwhile, embryonic tissues were minced, disrupted by passage through a needle, and if necessary, treated with collagenase (see Materials and Methods), rinsed with phosphate buffered saline (PBS), and then plated in 10 cm plastic culture dishes in Dulbecco's Modifiied Eagle's Medium (DMEM) containing 10% fetal calf serum and antibiotics. After allowing cells to attach to the culture dish, unattached cells were removed by aspiration, and the primary fibroblasts were grown to confluence.  Three vials  containing approximately 10 cells each were frozen down to use for immortalization 6  experiments for each pair of wild-type and mutant MEF.  In each case, fibroblasts were  prepared from sibling homozygous mutant and wild-type embryos, to control for possible differences in age, or degree of back-crossing, for each PcG mutation examined.  The  consequence is that for each mutant cell line, an appropriate wild type cell line had to be established using a wild type sibling embryo. Mutant MEF were always compared to the appropriate control.  30  Figure 3-2 LZRS-delta-BamHl-rBX2-ires-eGFP vector The LZRS-delta-BamHl-rfiA2-ires-eGFP vector uses a modified version of the LZRS system developed by (Kinsella and Nolan 1996) to produce a retrovirus vector capable of expressing TBX2 and GFP in infected cells. The retroviruses are produced using Phoenix™ producer cells. The LZRS system uses two elements from the Epstein-Barr virus Orip and EBNA-1, to confer stable episomal maintenance capabilities under puromycin selection. Cells infected with the retrovirus express green fluorescent protein (GFP) as a convenient marker.  II. Production of TBX2 immortalizing retrovirus As discussed in the Introduction, primary fibroblasts have a limited lifespan in culture (approximately 5 passages). To obtain immortalized MEF, TBX2 was expressed, which immortalizes cells, but has fewer side effects than the expression of large T antigen. We obtained a retroviral expression vector for TBX2, LZRS-delta-BamHl-mY2-ires-eGFP (Figure 3-2) as described in the Materials and Methods, as a generous gift from Dr. M. van Lohuizen. This is a modification of the LZRS Virus system (Kinsella and Nolan 1996), that contains an enhanced green fluorescent protein (GFP).  Briefly, LZRS-delta-BamHl-rAY231  ires-eGFP was introduced into an ecotropic retroviral packaging cell line (Phoenix ) by 1M  calcium phosphate transfection.  Using procedures detailed in the Materials and Methods,  supernatants containing the retrovirus were obtainedfromthe cells after transfection, or after puromycin selection for cells containing the retrovirus. Culture medium containing the virus was filtered, and titred immediately, orfrozenfor later titering as described in the Materials and Methods.  As shown in Figure 3-3, unselected cells give very low titres (less than 10  4  transducing units/ml), whereas cells selected on 0.6 mg/ml and 1 mg/ml puromycin yielded titres of almost 10 transducing units/ml. 6  Wild-type and PcG mutant primary MEF were plated at low density, and infected with the TBX2-immortalizing virus using Polybrene as described in the Materials and Methods. After changing the medium, the cultures were grown to confluence, and then passaged at a dilution of 1/10. In separate control experiments, uninfected primary MEF never grew for more than 5 passages in total (See Table 3-1).  Because of the time needed to amplify the  primary MEF to obtain enough cells for infection with the TBX2-immortalizing virus, uninfected cells stopped dividing very shortly after the experimental cells were infected (data not shown). Table 2-1 shows the minimum number of passages for each immortalized line constructed.  32  1000000  100000 <D  2 • ••1  > o  10000  V+->  a>  1000 no selection  0.6  1  P u r o m y c i n concentration (mg/ml)  Figure 3-3 High-titre production of TBX2-immortalizing retroviral vectors LZRS-delta-BamHl-r5LY2-ires-eGFP was tested for vector production using the ecotropic Phoenix™ retroviral packaging cell line. Vector was collected 48 hr post-transfection (no selection) and after stably selecting the cells carrying the transfected episomal vector with 600 ug /ml puromycin and 1000 ug/ml puromycin. Collected retroviral supernatant was serially diluted and used to infect NIH-3T3 cells. Infected cells were assayed by FACS analysis for GFP expression 48 hr after transduction. Results from one replicate.  33  Table 3-1 Passage number of non-transformed and TBA^-transformed fibroblasts Mouse Embryonic Fibroblast  Non transformed  After infection with the TBX2immortalizing vector  Asxll -/-  5  25+  Asxll +/+  5  25+  rae28 -/-  Not mesured  65+  rae28 +/+  Not mesured  63+  M33 -/-  Not mesured  57+  M33 +/+  Not mesured  55+  a  b  b  The (+) symbol indicate that the cells are still showing a constant growth rate at the number of passages indicated MEF from unknown passage were used and all cells were infected with the virus produced by transfection of Phoenix™ with LZRS-delta-BamHl-mO-ires-eGFP a  b  Because the retrovirus expresses GFP, all immortalized cells should be GFP-positive. Moreover, the proportion of GFP positive cells should change over time from a number that reflects the infection rate to 100%.  Four days post-infection, fluorescence activated cell  sorting (FACS) was used to determine the proportion of infected cells. As shown in Figure 3-4 the initial infection level varied from about 20-60%. For three of the four lines tested (rae28+/+, M33+/+, M33-/-; (the Asxll wild-type and mutant cells were not tested in this assay)), the proportion of cells expressing GFP rose as expected to 100% by 122 days postinfection.  However, one line, rae28-/- showed the opposite behaviour: no cells expressed GFP after 122 days. Yet these cells were clearly immortalized, and as shown below, are of the 34  Days after infection  Figure 3-4 Percentage of 7BA2-transformed cells in immortalized MEF cell lines Graphical representation of FACS results for the percentage of GFP positive cells in populations of MEF infected with TBX2-immortalizing vector at day 4 and day 119 after infection (Asxll -I- and Asxll +/+ were only measured 4 days after infection). Symbols are (•) for Asxll -/-; (o) for M33 -/-; (A) for rae28 -I- (A) for Asxll +/+; (•) for M33 +/+ and (•) for rae28 +/+.  35  correct genotype. Two explanations are possible. One is that the immortalized cells suffered a mutation or rearrangement of the TBX2-immortalizing vector that caused loss of expression of GFP, but not loss of TBX2, so that the cells are immortalized, but do not express GFP. This possibility was not tested. The other is that the rae28-/- cells were immortalized as a result of a random mutation or mutations in the genome that occurred independently of TBX2, so the immortalized cells don't have the TBX2-immortalizing vector.  Consistent with this  possibility, these cells grow at different rates than MEF immortalized by TBX2. Immortalized MEF were passaged every 3-4 days at dilutions of 1/10, yet the rae28-/- MEF could be passaged at dilutions of 1/40 to 1/60. In addition, wild-type and mutant Asxll and M33 cells were visually indistinguishable (see Figure 3-5 for the Asxll example), but the rae28-/- cells appeared smaller and more rod shaped that the rae28+/+ cells (Figure 3-14). Together, the observations support the conclusion that the rae28-/- cells were immortalized independently of TBX2 overexpression. These cells are still useful, but as will be discussed below, care must be taken when interpreting results from these cells.  The variability in cell size, morphology, and overall appearance of MEF shown in Figure 3-5 indirectly suggests that the MEF are a population of cells, rather than being clonal derivatives.  This possibility could be tested directly by examining integration sites of  retroviruses in our transformed cells using Southern blotting.  Wild-type and mutant MEF were genotyped using PCR to confirm the embryonic genotyping, and to ensure that no labeling errors had occurred during handling (see Materials and Methods for details of DNA preparation, PCR conditions, and Table 2-1 for details on primers). As shown in Figure 3-6, it was possible to unambiguously identify wild-type and  36  mutant MEF for each of the three PcG mutations using this assay. The results confirm that we have established immortalized cell lines of the appropriate genotypes.  37  Asxll -/- P25  Asxll +/+ P26  Figure 3-5 Photographs of Immortalized Asxll M E F Handheld photographs of the Asxll M E F is shown to demonstrate the general phenotype of the immortalized cell lines. The magnification is the same for all cell lines presented in this thesis.  38  M W - / -  Asxll  +/+  M W  -/-  +/+  rae28  M W - / -  +/+  M33  Figure 3-6 Genotype of immortalized MEF PCR analysis of the genotype of stable rfiLY2-immortalized M E F cell lines. D N A was extracted from confluent cell monolayers on 6cm culture plates. P C R was used to detect the wild-type allele (+/+) and the mutant alleles (-/-) using the appropriate primers described in the Materials and Methods chapter. (A) Asxll M E F , expected fragment size is 253bp for +/+ and 426bp for -/- (B) rae28 M E F , Expected fragment size is ~225bp for +/+ and ~325bp for /- (C) M33 M E F , expected fragment size is ~200bp for +/+ and 325bp for -/-. The position of the molecular weight marker is shown by (MW).  III. Analysis of Gene Expression in PcG MEF As noted in the Introduction, gene expression in M E F can faithfully reflect gene expression in embryos, suggesting that they are a useful system for examination of gene regulation. Therefore we wished to categorize the expression of PcG and Hox genes in the M E F lines.  Details of making R N A , cDNA, PCR reactions, and the primers used are given  in the Materials and Methods, and in Table 2-2). The generalized protocol was to compare gene expression in wild-type and PcG mutant MEF, using RT-PCR, using expression of actin to control for equivalent amounts of cDNA in each reaction. 39  Asxll  MEFs  Figure 3-7 Analysis of PcG gene expression in Asxll MEF RT-PCR analysis of PcG genes expression of in the stably r5X2-immortalized Asxll +/+ and Asxll -I- MEF cell lines. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of P-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions.  40  First, the expression of PcG genes in PcG mutant MEF was examined. As shown in Figure 3-7, rae28 and M33 were expressed in Asxll+/+ and Asxll-/- cell and as expected, the figure shows that Asxll is not expressed in the Asxll-/- MEF.  rae28 MEFs  rae28 MEFs  +/+  -/-  rae28  M33  liMi  nil i iiiiiiiiiiillttrt  MeM8  /T7p/?2  -  '  .  i|||iyfliii|iif|t  «  ymw>mi\..i i HI} :  Mil  . - - „—-, -..  pActin  Figure 3-8 Analysis of PcG gene expression in rae28 MEF RT-PCR analysis of PcG genes expression of in the stably n?X2-irnmortalized rae28 +1+ and rae28 -I- MEF cell lines. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of p-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions.  Next, the expression of PcG genes in rae28+/+ and rae28-/- MEF was examined. Unsurprisingly, rae28 itself is not expressed in rae28-/- MEF (Figure 3-8). The expression of M33, Mel-18 (a murine homolog of Posterior sex combs), Sex comb on midleg homolog 1 (Scmhl) and Asxll was unchanged in rae28 mutant MEF compared to wild-type (Figure 3-8).  41  The expression of the trxG gene Mil, which was expressed in rae28-/- MEF was also examined.  Finally, the expression of PcG genes in M33+/+ and M33-/- MEF was examined. The expression of rae28 was unaffected (Figure 3-9). M33 expression was detected, because the M33 KO is a knock-in, and the primers used to detect M33 in our experiments are downstream of the knock-in. Next we turned our attention to analysis of Hox genes, because these are wellcharacterized targets of PcG regulation. We were particularly interested in Asxll because it appears to both positively and negatively regulate Hox gene expression in mouse embryos (C. Fisher and H. Brock, unpublished). As shown in Figure 3-10, there were no differences among the 11 Hox genes tested. As the specific Hox targets of Asxll have not yet been defined, it is not obvious how to interpret these results. One possibility is that Asxll regulates Hox genes that were not assayed. Another possibility is that the MEF do not exhibit Asxlldependent Hox regulation, but these possibilities cannot yet be distinguished.  Next, Hox gene expression in rae28+/+ and rae28-/- MEF was analysed. differences were seen in the Hox A and Hox B cluster genes analysed (Figure 3-11).  42  No  M33 MEFs +/+ -lrae28  M33  QActin  d___________&  »m  Figure 3-9 Analysis of PcG gene expression in M33 MEF RT-PCR analysis of PcG genes expression of in the stably r5X2-immortalized M33 +/+ and M33 -I- MEF cell lines. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of P-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions.  However, strikingly, all Hox C cluster genes analysed were expressed in rae28+/+ MEF, but not expressed in rae28-/- MEF. This result is surprising, because rae28 is a repressor of Hox gene expression, so rae28 mutants would be expected to cause over-expression of Hox genes. One explanation of these results is that they arise from indirect effects of immortalization rather than direct effects of RAE28 on Hox loci. This possibility is explored further, below.  In M33+/+ and M33-/- MEF, two differences were observed in Hox expression (Figure 3-12). Hox c5 was not expressed in M33-/- MEF, but it was expressed in M33+/+ MEF.  This result suggests that the effect might be indirect, because one would expect  mutations in a silencer to cause increased expression in M33-/- cells. In addition, Hox c9 was expressed in the M33-/- mutants, but not in M33+/+ MEF. Taken at face value, this is 43  consistent with M33 being a repressor of Hox c9. But if the M33+/+ result is wrong, as suggested by the observation that Hox c9 is expressed in Asxll +/+ and rae28+/+ MEF, then this result is likely not significant.  MEFs  Figure 3-10 Analysis of Hox gene expression in Asxll MEF RT-PCR analysis of Hox genes expression of in the stably ISA^-immortalized Asxll +/+ and Asxll -I- MEF cell lines. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of |3-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions.  44  MEFs  Figure 3-11 Analysis of Hox gene expression in rae28 MEF RT-PCR analysis of Hox genes expression of in the stably rAO-immortalized rae28 +/+ and rae28 -I- MEF cell lines. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalizedfibroblasts.Primers and expected product sizes are described in the Materials and Methods chapter. Expression of P-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions.  Because of the striking observation that the Hox C cluster genes were not expressed in rae28/- MEF, we wished to determine if this reflected a direct effect of RAE28, or reflected an indirect effect.  We reasoned that if the lack of Hox C expression was a direct effect of  RAE28, then supplying rae28-/- MEF with an expression vector synthesizing RAE28  45  should  rescue the Hox expression.  As shown in Figure 3-13, this was not the case.  Expression of RAE28 in Rae28-/- cells had no effect on Hox C expression even though RAE28 expression is clearly elevated. These experiments do not rule out the possibility that because the Hox C genes were not expressed, chromatin or DNA methylation changes may have occurred that prevented reactivation when rae28 was expressed. DNA methylation was shown by Milne et al. (2002) to block activation of Hox c8 by Mil in Mil-/- MEF, so a similar explanation is plausible for the failure of rae28 to activate Hox C genes in rae28-/- MEF.  M33 +/+  M +/+  -i-  HoxA4  Hox C6\  Hox A 9  HoxC8  Hox C4 HoxC5  ^^^^^^^^  mm*  ____igfi|  :  Hox C9  M33  -/-  _____________  PActin  Figure 3-12 Analysis of Hox gene expression in M33 MEF RT-PCR analysis of Hox genes expression of in the stably r5X2-immortalized M33 +/+ and M33 -I- MEF cell lines. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of P-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions. 46  c  rae28 MEFs  rae28  Asxll  - ^ ^ ^ B p U r  iiiiililillMiiMilliiffl  mph2  i  j^^^^lgfc.  iiiiiiiiiiiiiiiiii  - ^ ^ p ^ j ^ ^  ^ ^ ^ ^ ^ P ^  mm  mmm  _ ^,  scmhl  HoxC4  i^^!PP^  ^MPPPIIP'  «*»  NlIliMMt)9 —  HoxC5  I illllj  HoxC6  HoxC8  HoxC9  PActin  Figure 3-13 Analysis of PcG and Hox gene expression in rescued rae28-l- MEF RT-PCR analysis of PcG and Hox genes expression of in the stably r5Z2-irnmortalized rae28 +/+, rae28 -I- M E F cell lines and in the same rae28 -I- fibroblast that have been complemented with a rae28 expression vector (MIG-rae2#). PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of R-Actin is shown to confirm equivalent amount of cDNA in the RT-PCR reactions. 35 cycles of amplification were preformed and the presence of a faint band for the rae28 RT-PCR in the rae28-l- M E F is most likely due to a small contamination of the primer mix or to well overflow when loading the gel.  47  Figure 3-14 Photographs of Immortalized rae28 MEF Handheld photographs of the Asxll M E F is shown to demonstrate the general phenotype of the immortalized cell lines. The magnification is the same for all cell lines presented in this thesis. However, as noted above, the rae28-/- cells were probably immortalized by a different route than the rae28+/+ M E F . This observation raises the possibility that some event  48  accompanying or following immortalization causes the change in Hox C expression in the rae28-/- cells compared to rae28+/+ cells. Although the evidence is indirect, the rae28+/+ rae28  MEFs  Figure 3-15 Comparison of PcG and Hox gene expression in rae28 MEF of P4 vs P67 Comparison of PcG and Hox genes expression by RT-PCR analysis in the stably TBX2immortalized rae28 +/+ and rae28 -I- MEF cell lines at passages 4 and 67. PCR-amplified total cDNAs were prepared from total RNAs extracted from the stably immortalized fibroblasts. Primers and expected product sizes are described in the Materials and Methods chapter. Expression of P-Actin is shown to confirm equivalent amount of cDNA in the RTPCR reactions.  49  and rae28-/- cells were indistinguishable at passage 4 after infection (Figure 3-14). However, by passage 63, the rae28-/- cells are smaller, more spindle-shaped, and grow much more rapidly than the rae28+/+ cell. This change in morphology and growth rate is not reversed by expression of wild-type rae28 in the rae28-/- MEF, shown in Figure 3-14 for passage 65 cells, suggesting that the morphological change is independent of rae28. The latter observation is also consistent with the demonstration in Figure 3-13 that rae28 does not rescue expression of Hox C genes.  Therefore, we decided to compare expression of early and late passage rae28-/- cells. Expression of Hox C genes in cells from passage 4 (likely prior to immortalization) and passage 67 was compared and shown in Figure 3-15. The results for passage 67 cells confirm those shown in Fig. 2-9. Strikingly, there is no difference in Hox C expression in rae28+/+ and rae28-/- cells in passage 4 cells. Because the genotype of the cells is the same in passage 4 and 67 is the same, these results demonstrate that the change in expression of Hox C genes in rae28+/+and rae28-/- cells is rae28 independent.  IV. Comparison of Drosophila and murine regulatory regions of ph/rae28 To test the possibility that the region upstream of rae28 is a PRE using the PcG mutant MEF that we isolated in the experiments reported above, vectors with the design shown in Figure 3-16 were obtained.  A luciferase reporter in a promoterless vector (pGL3), was  modified by cloning 500 bp of the region surrounding the rae28 transcription start from coordinates -400 to +100 upstream of the luciferase. In addition, the vector incorporates the insulator sequence from the beta globin locus (Chung et al. 1997) to try to reduce insertional position effects. Because in stable transfections, the vector is concatemerized, the result will 50  be that most inserts are flanked by two insulator sequences. This formed the control vector. This vector was constructed by Dr. H.W. Brock. Then Dr. Leonie Ringrose added the 3.8kb rae28 upstream fragment, or the ph418 fragment to generate two experimental vectors, and generously made these vectors available to me. rae28p  'IP Luciferase  Ctrl.  Insulator  {—  rae28p  Rae28 genomic DNA  Luciferase  Insulator  Luciferase  Insulator  rae28p  ph418.  ph 418 genomic DNA  Figure 3-16 PRE assay reporters Schematic representation of the three vectors used in the reporter assays. Each reporter has the luciferase reporter under the control of the rae28 promoter, (ctrl) is the pGL-R28-3'IN vector and it is used as control. (rae28) is the pGL-Rae28-R28-3'IN vector and it contains the mouse rae28 3.8 kb upstream sequence. (ph418) is the pGL-ph418-R28-3'IN vector and it contains the /?/z418 fly fragment known to have PRE activity in flies.  V. Transfection Optimization MEF are difficult to transfect by the calcium phosphate method or by electroporation, but they can be transfected using liposome-mediated transfection.  Liposome mediated  transfection offers several advantages, including relatively high efficiency in a variety of cell types, the ability to transfect cell types resistant to calcium phosphate, and requirement for less DNA. Disadvantages include cytotoxicity, and the need to optimize the DNA-to-liposome  51  charge ratio, the amount of DNA, cell density, and the transfection period for each type of liposome (Gao and Huang 1995). Because the success of the experiments below depended on high transfection efficiency, we optimized transfection conditions, using Effectene™, a proprietary liposome preparation (Qiagen), which has been previously tested on MEF (H.W. Brock, personal communication).  First, we compared DNA/Effectene™ ratios, with different amounts of DNA. In each case, transfection was carried out on rae28+/+ MEF at 60% confluence in 6 well culture dishes. We compared 0.2, 0.4, and 0.8 micrograms of MSCV-IRES-RFP (MIR) DNA, in 1:10, 1:25 and 1:50 ratios of DNA to Effectene™. Transfection efficiency was monitored using FACS analysis two days after transfection.  As shown in Figure 3-17, for a given  amount of DNA, maximal transfection was achieved at a 1:50 ratio of DNA to Effectene™, and transfection efficiency increased as DNA amount increased. However, the number of cells surviving began to decrease if we used more than 0.8 micrograms of DNA. Similar experiments were carried out on the rae28-/- cells, because as argued above, they did not appear to be transformed by TBX2. Conditions were identical to those just described. As shown in Fig. Figure 3-18, transfection optima were similar to those observed for rae28+/+.  A similar set of experiments were carried out for M33+/+ and M33-/- cells, except that more DNA was used, and a ratio of 1:10 DNA to Effectene™ was not tested for the highest concentration of DNA. As shown in Fig. Figure 3-19, and Figure 3-20, the highest amount of DNA, and a ratio of 1:50 DNA to Effectene™ yielded highest transfection efficiency.  Notice that the highest efficiencies achieved were somewhat lower in M33+/+  compared to rae28+/+, rae28-/- or M33-/-.  52  25  + LL  *  o  20 • 1:10  15 -  CD  • 1:25  Io 10  B 1:50  0.2  0.4  0.8  A m o u n t of D N A  Figure 3-17 rae28 +/+ M E F transfection optimization Graphic representation of transfection optimization for the rae28 +/+ MEF. Cells were 60% confluent in 6-well plates prior to transfection with MSCV-IRES-RFP (MIR). Transfection efficiency was measured by FACS two days after transfection. Different ratios of DNA/Effectene™ (indicated on the right side) where tested using the quantities (in ug) of DNA indicated. Higher quantities of DNA resulted in more than 50% cell mortality. Results form one replicate.  53  25  • 1:10 • 1:25 a 1:50  A m o u n t of D N A  Figure 3-18 rae28 -I- MEF transfection optimization Graphic representation of transfection optimization for the rae28 -I- MEF. Cells were 60% confluent in 6-well plates prior to transfection with MSCV-IRES-RFP (MIR). Transfection efficiency was measured by FACS two days after transfection. Different ratios of DNA/Effectene™ (indicated on the right side) were tested using the quantities (in ug) of DNA indicated. Higher quantities of DNA resulted in more than 50% cell mortality. Results form one replicate  54  14 12 Q. UL  "  8  X  4  0 0.4  0.8  1.6  A m o u n t of D N A Figure 3-19 M33 +/+ MEF transfection optimization Graphic representation of transfection optimization for the M33 +/+ MEF. Cells were 60% confluent in 6-well plates prior to transfection with MSCV-IRES-RFP (MIR). Transfection efficiency was measured by FACS two days after transfection. Different ratios of DNA/Effectene™ (indicated on the right side) were tested using the quantities (in ug) of DNA indicated. Higher quantities of DNA resulted in more than 50% cell mortality. The DNA/Effectene™ ratio of 1:10 and 1.6ug of DNA was not tested. Results form one replicate  55  20 18 16 £14 Li_  a: 12 o  0 O CL  8 6 4 2 0 0.4  0.8  1.6  A m o u n t of D N A Figure 3-20 M33 -I- MEF transfection optimization Graphic representation of transfection optimization for the M33 -I- MEF. . Cells were 60% confluent in 6-well plates prior to transfection with MSCV-IRES-RFP (MIR). Transfection efficiency was measured by FACS two days after transfection. Different ratios of DNA/Effectene™ (indicated on the right side) were tested using the quantities (in ug) of DNA indicated. Higher quantities of DNA resulted in more than 50% cell mortality. The DNA/Effectene™ ratio of 1:10 and 1.6ug of DNA was not tested.  For the transfections described below, 750 ng of reporter vector, and 50 ng of the vector expressing hygromycin resistance were used. The transfection medium was left on the cells for 6 hours, and then the cells were washed, and fresh medium was added.  One more set of controls was carried out to determine a killing curve for hygromycin. Because not all vectors used in these experiments contained a selectable marker suitable for 56  selection of stable transfectants, a plasmid containing the hygromycin gene (pMSCVhyg, Clontech) was cotransfected with the other vectors, and cells were selected for hygromycin resistance. MEF of various genotypes were exposed to varying concentrations of hygromycin for 12 days, and survival was measured by trypan blue exclusion. As shown in Figure 3-21, cells of different genotypes showed differential sensitivity to hygromycin. M33-/- cells were resistant to hygromycin, exhibiting 50% mortality between 600 and 700 micrograms/ml of hygromycin, M33+/+ showed 50% mortality at just under 100 micrograms/ml, and both rae28+/+ and rae28-/- were very sensitive to hygromycin, even at concentrations of 50 micrograms/ml.  120% 100% (0  > (0  80%  -A-M33 +/+  60%  -0-M33-/-  - B - rae28 +/+  © 40%  -e- rae28 -/-  20%  0% ^  c $  c $  c $  c£> c $  c $  Hygromycin concentration  Figure 3-21 MEF dose response curve to Hygromycin B Immortalised MEF were plated at 80% confluence in 24-well plates. Cellular viability was evaluated after 12 days of culture in medium containing the indicated amounts of Hygromycin B in ug/ml. 57  For the experiments reported below, 100 micrograms/ml of hygromycin was used, which was added three days after the initial transfections. Cells were kept under constant selection.  Mock-transfected cells always showed complete cell death (as determined by  staining with crystal violet of the plates after selection) within 10 days after selection started, but transfected cells grew well under selection.  VI. Luciferase assays Having determined the optimal transfection conditions for MEF, our next goal was to determine if the assay system chosen to identify mammalian PREs worked in practice. All experiments tested the activity of a reporter (CTRL) that contained the rae28 promoter and the luciferase reporter in rae28+/+ and rae28-/- cells, with and without regulatory sequences from rae28 (rae28), or ph (ph418). The expectation is that comparison of CTRL to either rae28 or ph418 in any cell line would show if the sequence from rae28 or ph has altered expression levels relative to CTRL. If in addition, expression levels are different in rae28+/+ vs rae28-/- cells, then it is possible that the difference in expression levels is dependent on rae28 expression. If so, introducing MlG-rae28, a rae28 expression vector into rae28-/- cells ought to rescue the change in expression in rae28-/- compared to rae28+/+ cells.  Previous experiments carried out in Mil MEF showed that transient transfection of the reporter did not reveal potential Mil response elements, but that stable transfection of the reporter did reveal Mil response elements (H.W. Brock, unpublished).  This result is  consistent with the hypothesis that MLL is a chromatin-modifying protein, and that it exerts its effect only on stably integrated reporters because these assemble normal chromatin structure, whereas unintegrated (transiently transfected) plasmids do not have normal 58  chromatin structure.  Therefore, only stable transfectants of the reporter was assayed.  Because the reporter vectors do not have a selectable marker to allow selection of stable transformants, we co-transfected a plasmid with a hygromycin resistance gene (pMSCV-hyg, Clontech) at a ratio of 1/20, and selected for hygromycin resistance.  Three days after  transfection, the cells were exposed to hygromycin, and grown under selection until all mocktransfected cells died. Usually, very few cells survived selection, and low numbers (1-3) of colonies were detected. This very low transfection efficiency was a continuing problem.  In an initial series of experiments, we limited analysis to the rae28 and Ctrl plasmids in rae28+/+ and rae28-/- MEF. Three independent transfections were carried out in 6 well culture dishes with each plasmid in rae28-/- cells and in rae28+/+ cells. The results are shown in Table 3-2. From this table, it can be seen immediately that there is large variability in luciferase activity. There were always transfections that yielded drug resistant colonies, but no luciferase activity, and there were up to two-log variations in luciferase activity when it was observed. In all experiments, more colonies in rae28-/- than in rae28+/+ transfections were obtained, so this might influence reliability of the results. We expect that more colonies should decrease variation in expression levels, because more integration sites are being sampled for a given transfection.  While clearly, this extent of variability precludes drawing strong conclusions from the data, the data was plotted using the following assumptions, in the hope that underlying trends might be discerned as a basis for planning future experiments. All samples with no activity were removed, reasoning that these likely integrated the drug resistance marker, but not the reporter. Samples with 1 log lower activity than the sample with the highest activity were also removed, arguing that decreased activity could result from plasmid rearrangements, insertion 59  into regions of the genome that are not active in gene expression ("position effects"), or differences in copy number. None of these possibilities was tested directly. Removing low data has the effect of artificially reducing variability in the data.  While both these  assumptions are reasonable, it is obvious that removing datafromthe analysis using arbitrary value is not consistent with normal experimental practice. These data are plotted in Figure 3-22.  Both the Ctrl and rae28 plasmids show higher expression in rae28-/- cells than in  rae28+/+ cells, suggesting that rae28 might act as a repressor.  Table 3-2 Results: first series of reporter assays in 6-well plates MEF Genotype  Vector  Luciferase activity*  rae28 -/-  rae28  676531  rae28 -/-  rae28  74126  rae28 -/-  rae28  0  rae28 -/-  Ctrl  173862  rae28 -/-  Ctrl  256568  rae28 -/-  Ctrl  5944  rae28 +/+  rae28  0  rae28 +/+  rae28  180435  rae28 +/+  Ctrl  203  rae28 +/+  Ctrl  16693  All samples were collectedfromconfluent wells. Three independent transfections were performed for each vector in each cell types. Transfections that did not produce colony were not analyzed for luciferase activity. a  60  jg 800  e 700  n=2  600 mtmm  >  mmmm500  o re  a>  2  a  • rae28 -/-  400  H rae28 +/+ 300  n=2  mmmm O  200 100 n=1  0 Ctrl  rae28  Figure 3-22 First series of reporter assays in 6-well plates Normalized luciferase activity of stable transfections in immortalized rae28 +/+ and rae28 -/MEF of the reporters pGL-R28-3'IN (ctrl) and pGL-Rae28-R28-3'IN (rae28). The error bars indicate the standard error of the mean for the (n) independent experiments indicated. As discussed in the text, samples with low transfection efficiency or activity were not incorporated into this figure. We repeated these experiments, except that the ph 418 plasmid was added. As shown in Table 3-3, we had similar problems with differing transfection efficiency comparing rae28+/+ to rae28-/-. Because the colonies grew slowly, and cells in the middle of the colony had different morphology than cells at the edge, viability differences within the colony could cause variability in the results. For this reason, once colonies were visible, cultures were trypsinized, and the cells were replated and grown to confluence, then assayed for luciferase 61  activity. Once again, the data was plotted, we removed the null data, and data more than one log lower than replicate transfections, and the result is shown in Figure 3-23. In each case, the reporter is more highly expressed in rae28-/- than in rae28+/+ cells, consistent with rae28 being a repressor of the reporter. Because this is true for the Ctrl plasmid, it implies that Rae28 acts upon the rae28 promoter. A significant difference is seen comparing rae28 to Ctrl, as about 5 fold higher activity is seen, suggesting that the 3.8kb rae28 sequence overall is an activator of reporter activity. Finally, it is interesting that the ph 418 fragment does not have higher activity than the Ctrl plasmid, suggesting that the Drosophila regulatory sequence does not function similarly to the 3.8 kb rae28fragmentin MEF. As with the previous experiment, these conclusions must be tentative, given the high variability in the data.  One obvious problem of interpretation comes from our previous conclusion that rae28+/+ cells are transformed by TBX2, whereas rae28-/- cells were probably transformed by an independent mechanism. Therefore the rae28+/+ and the rae28-/- cells may not be directly comparable. One way to sidestep this issue is to compare rae28-/- cells with rae28-/cells expressing rae28, so that the only difference is in presence or absence of rae28. Accordingly, similar experiments were carried out, except that rae28-/- cells infected with MIG-rae28, an expression vector that makes wild-type murine Rae28 were also examined. Ecotropic Producer cells GP E86 (Markowitz et al. 1988) containing the +  MSCV-  rae28cDNA-IRES-GFP (E86-MIG-rae28) vector and constitutively producing the MlG-rae28 virus were obtained from Dr. Yoshihiro Takihara (produced in Dr. Keith Humphries' Laboratory). Using procedures detailed in the Materials and Methods, supernatant containing the virus was obtainedfromcells, filtered and immediately used for infection of the rae28-l-  62  Table 3-3 Results: second series of reporter assays in 6-well plates  MEF Genotype  Vector  fae28-l-  rae28  4034620  rae28 -/-  rae28  2215026  rae28 -1-  rae28  4739968  rae28 -/-  ph418  542506  rae28 -/-  ph418  602737  rae28 -/-  ph418  1180980  rae28 -/-  Ctrl  769878  rae28 -/-  ctrl  559519  rae28 -/-  Ctrl  764874  rae28 +/+  rae28  169212  rae28 +/+  rae28  22301  rae28 +/+  ph418  17274  rae28 +/+  ph418  0  rae28 +/+  ph418  0  rae28 +/+  ctrl  Luciferase activity  8  1308  All samples were collectedfromconfluent wells. Three independent transfections were performed for each vector in each cell types. Transfections that did not produce colony were not analyzed for luciferase activity. a  63  in  5 n=3  o CO <D  H rae28 +/+  a2 2 a  • rae28 -/-  O  n=3  1  n=3  xEn=2 n=1  ctrl  rae28  n=1  ph418  Figure 3-23 Second series of reporter assays in 6-well plates Normalized luciferase activity of stable transfections in immortalized rae28 +/+ and rae28 -/MEF of the reporters pGL-R28-3'IN (ctrl), pGL-Rae28-R28-3'IN (rae28) and pGL-ph418R28-3'IN (ph418). The error bars indicate the standard error of the mean for the (n) independent experiments indicated. As discussed in the text, samples with low transfection efficiency or activity were not incorporated into this figure.  fibroblast prior transfection of the reporter vectors. The raw data are shown in Table 3-4. As before, there was high variability in the luciferase activity. To look for trends in the data, the same assumptions as in the two previous experiments were made, with one additional assumption. Because the MIG-rae28 vector expresses GFP, replicates in which more than 25% of cells were GFP negative were eliminated, and the results are plotted in Figure 3-24. No working data for the Ctrl vector in the rae28-/- plus MIG-rae28 transfections was 64  obtained. With these caveats in mind, it is striking that for each reporter (Ctrl, rae28, and ph418), there is more activity in rae28-/- than in rae28+/+ cells, and that the activity is strongly reduced when rae28 is expressed in rae28-/- cells.  These results support the  conclusion that Rae28 is a repressor, and they also support the conclusion that the 3.8kb rae28 fragment is a Rae28 response element. As before, the ph418 fragment is no more active than the Ctrl fragment, suggesting that this fragment does not function in MEF. If so, Rae28 is presumably acting at the rae28 promoter.  Table 3-4 Results: Third series of reporter assays in 6-well plates MEF Genotype rae28 -1rae28 -/rae28 -/rae28 -/rae28 -/rae28 -/rae28 -/rae28 +/+ rae28 +/+ rae28 +/+ rae28 +/+ rae28 +/+ rae28 +/+ rae28 +/+ rae28 +/+ rae28 -/- + MIG-rae28 rae28 -1- + MIG-rae28 rae28 -/- + MIG-rae28 rae28 -1- + MIG-rae28 rae28 -1- + MIG-rae28 rae28 -/- + MIG-rae28 rae28 -/- + MIG-rae28 rae28 -1- + MIG-rae28 rae28 -/- + MIG-rae28  Vector rae28 rae28 rae28 ph418 ph418 Ctrl  ctrl rae28 rae28 rae28 ph418 ph418 ctrl ctrl ctrl rae28 rae28 rae28 ph418 ph418 ph418 ctrl ctrl ctrl  Luciferase activity"  Percentage of GFP + cells (MlG-rae28)  5596628 2174484 3782477 935567 2700786 1511467 1206119 1457 49457 192422 41107 305171 81621 9314 808070 553503 614165 497687 26320 33164 3671 437 740 6333162  90 85 47 78 99 93 98 95 53  b  b  All samples were collected from confluent wells. Three independent transfections were performed for each vector in each cell types. Transfections that did not produce colony were not analyzed for luciferase activity. ells had abnormal phenotype and were not used in further analysis. a  b  65  .c 6 o  i n=3  5  o re  4  • rae28 +/+  a>  n=2  2  • rae28 -/-  a O  • rae28 -/- + MIG-rae28  n=2  n=1  n=2  n=1  Ctrl  rae28  n=1  n=2  ph418  Figure 3-24 Third series of reporter assays in 6-well plates Normalized luciferase activity of stable transfections in immortalized rae28 +/+, rae28 -I- and rae28 -/- + MIG-rae28 MEF of the reporters pGL-R28-3'IN (ctrl), pGL-Rae28-R28-3'IN (rae28) and pGL-ph418-R28-3TN (ph418). The error bars indicate the standard error of the mean for the (n) independent experiments indicated. As discussed in the text, samples with low transfection efficiency or activity were not incorporated into this figure.  66  CHAPTER 4  General discussion  The studies outlined in the previous chapter show that it is possible to establish immortalized MEF that are mutant for three different PcG genes: Asxll, M33 and rae28, using TBX2.  Nevertheless, the results with rae28-/-, in which it appears very likely that a  spontaneous mutation resulted in immortalization, illustrates the need to confirm that TBX2 is expressed in MEF. In our case, having rae28+/+ and rae28-/- cells immortalized by different routes makes it very difficult to compare gene expression data obtained in each cell type, because it is not possible to assign differences to presence or absence of rae28, or to changes induced during immortalization.  We now wish to consider some of the potential problems of immortalized cells in general, and to make arguments suggesting that they are not useful for the study of endogenous genes, like those illustrated in Figure 3-7 to Figure 3-13 and Figure 3-15.  In mixed populations, effects owing to insertional mutagenesis of the retroviral vector expressing TBX2 would be minimized, since the population would contain cells with many different insertion sites, supporting the use of mixed populations of MEF in any study. In our studies, mixed populations of fibroblasts were transfected, grown out, and a presumably mixed population of cells with varying growth rates were passaged. It can be expected that over time, the fastest growing cells would be selected, and thus that variation within the population would decrease, perhaps until only one cell established itself  This possibility  suggests that in future studies, it would be advisable to determine the clonality of immortalized cells. This argument also suggests that it would be good to establish cloned 67  lines, and to compare results among clones. If the same results were obtained in multiple clonal cell lines, this would increase the confidence that the results obtained were not a consequence of downstream effects of insertional mutagenesis.  Unfortunately, MEF  immortalized with TBX2 did not grow well when plated at low density making the cloning of single cells difficult. A related problem of using immortalized MEF for functional studies of endogenous gene expression is illustrated by the results comparing Hox expression in early passage and late passage rae28-/- MEF (Figure 3-15). In cells prior to immortalization, the Hox c cluster genes are expressed, whereas in late passage cells, they are not. Because the genotype of both cells is identical, the differences presumably arise from downstream, indirect consequences of immortalization, rather than from differences in genotype (i.e. rae28+/+ vs rae28-/-). For example, a mutation in a transcription factor may be responsible for both the immortalization of the fibroblast and the reduction in expression of the Hox C cluster.  Because of this  problem, in our view, MEF of different genotypes are not useful for studying the expression of endogenous genes. However, they may be useful for short-term studies of transgenes.  Even if clonal differences in MEF are observed and controlled for, there is another potential problem for analysis of endogenous genes. Because the MEF are takenfrommutant embryos, and PcG genes regulate the activity of many genes, it can be expected that there will be indirect effects of the PcG mutation of downstream genes, that in turn could affect genes further downstream and so on. So it may not be very useful to consider differences between cells with and without a given PcG gene to be direct rather than indirect consequences of the mutation. In turn, this argues against attaching much importance to changes in expression of endogenous genes in mutant versus wild-type MEF.  Another problem for analysis of 68  endogenous genes is that the embryological origin of the MEF is unclear. One can imagine that MEF taken from the anterior of the embryo might express different populations of Hox (or any other) genes than MEF taken from the posterior.  Considering the comments above, we suggest that MEF are best used to study the expression of transgenes. We wish to comment on some of the potential problems in these studies, based on the data we obtained, and on some theoretical considerations. While the results obtained suggest that there might be a PRE upstream of rae28, the overall variability of the results precludes any firm conclusions. Overall, the symptom of the problem was very large variability between independent replicate transfections. There are many potential underlying explanations.  Variation in luciferase levels might be expected because of insertional position-effects, the number of transgenes concatemerized at each insertion site, or whether the hygromycin resistance gene, but not the reporters were successfully integrated. Therefore, independent transfections yielding one or two colonies per well are more likely to have biased samples than wells containing multiple colonies, because with a large enough sample, positional effects and copy number differences should average out. It is notable that in our experiments, the overall variability of the data was less for mutant MEF than for wild-type MEF, and that the mutant MEF had a much higher transfection efficiency.  In theory, these experiments  would be improved by transfecting many more cells. In practice, this would be expensive, because of the cost of the transfection reagent, the cost of preparing large amounts of DNA, the cost of culturing cells, and the cost of the luciferase assays. For example, to obtain 1000  69  colonies from transfection of wild-type MEF, it would cost about $5600 for the Effectene  IM  alone, for one vector, which is clearly impractical. Because of the difference in transfection efficiency between wild-type and mutant MEF, and because of potential indirect effects, it may be better to avoid comparing expression levels of reporters in wild-type and mutant MEF. Instead, it might be better to compare mutant MEF only to MEF in which the wild-type product is supplied by means of an expression vector, so that the cells are identical, except for the presence or absence of the protein being investigated. Despite this concern, it is notable that the luciferase expression results in rae28 wild-type and rae28 mutant MEF supplied with the wild-type expression vector for rae28 shown in Figure 3-24 are rather similar, suggesting limited indirect effects on our reporter vector.  Overall, we would advise those following in our footsteps that the current development of RNAi offers a much better way to do the experiments undertaken here. The experiment would be to take a cell in which the target gene of interest, plus the PcG genes under test is expressed to serve as the baseline, and compare this to the same cell in which RNAi is used to knock down expression of a PcG gene. While the experiment would be done in immortalized cell lines, all conditions would be the same in cells with and without the RNAi vector.  Because the current literature suggests that significant knock down of  expression can occur in 48 hours, there is far less time for establishment of potential indirect effects.  Moreover, analysis of an endogenous target in its normal chromosomal context  should improve the results.  70  Another improvement on these experiments would be to use a targeting system to ensure that the reporter gene is integrated into one genomic site as a single copy. An example is provided by the FLP-In™ (Invitrogen) system, in which an FLP recombination Target (FRT) site is inserted as a single copy into the genome in the test cell, and then a reporter flanked by an FRT site is transfected into the test cell in the presence of an expression vector expressing the FLP recombinase. The FLP recombinase mediates recombination between the FRT sites in the genome and the reporter, resulting in single copy integration of the reporter. Such a system would eliminate position effects, and combined with RNAi, would yield much more reliable, and repeatable results. This would be a good way to map PREs.  Understanding epigenetic gene regulation will have important implications for human biology and diseases.  Chromatin modulators now seem to be frequently involved in  tumorigenic pathway. They have a well-established function in modifying the histone and probably a function in regulating cell cycle pathway. epigenetic mechanisms are poorly understood.  Unfortunately, the mammalian  The discovery of target binding site for  mammalian PcG homologs will be an important step for the comprehension of these mechanism.  71  References  Akasaka, T., M. Kanno, R. Balling, M. A. Mieza, M. Taniguchi and H. Koseki (1996). "A role for mel-18, a Polycomb group-related vertebrate gene, during theanteroposterior specification of the axial skeleton." Development 122(5): 1513-22. Alberts, B. and R. Sternglanz (1990). "Gene expression. Chromatin contract to silence." Nature 344(6263): 193-4. Alkema, M. J., N. M. van der Lugt, R. C. Bobeldijk, A. Berns and M. van Lohuizen (1995). "Transformation of axial skeleton due to overexpression of bmi-1 in transgenic mice." Nature 374(6524): 724-7. Americo, J., M. Whiteley, J. L. Brown, M. Fujioka, J. B. Jaynes and J. A. Kassis (2002). "A Complex Array of DNA-Binding Proteins Required for Pairing-Sensitive Silencing by a Polycomb Group Response Element From the Drosophila engrailed Gene." Genetics 160(4): 1561-71. Antonchuk, J., G. Sauvageau and R. K. Humphries (2001). "HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation." Exp Hematol 29(9): 1125-34. Ayton, P. M. and M. L. Cleary (2001). "Molecular mechanisms of leukemogenesis mediated by MLL fusion proteins." Oncogene 20(40): 5695-707. Barlow, D. P. (1995). "Gametic imprinting in mammals." Science 270(5242): 1610-3. Behringer, R. R., D. A. Crotty, V. M. Tennyson, R. L. Brinster, R. D. Palmiter and D. J. Wolgemuth (1993). "Sequences 5' of the homeobox of the Hox-1.4 gene direct tissue-specific expression of lacZ during mouse development." Development 117(3): 823-33. Bienz, M. (1992). "Molecular mechanisms of determination in Drosophila." Curr Opin Cell Bjol 4(6): 955-61. Bornemann, D., E. Miller and J. Simon (1998). "Expression and properties of wild-type and mutant forms of the Drosophila sex comb on midleg (SCM) repressor protein." Genetics 150(2): 675-86. Bradshaw, M. S., C. S. Shashikant, H. G. Belting, J. A. Bollekens and F. H. Ruddle (1996). "A long-range regulatory element of Hoxc8 identified by using the pClasper vector." Proc Natl Acad Sci U S A 93(6): 2426-30. 72  Breiling, A., B. M. Turner, M. E. Bianchi and V. Orlando (2001). "General transcription factors bind promoters repressed by Polycomb group proteins." Nature 412(6847): 651-5. Brock, H. W. and M. van Lohuizen (2001). "The Polycomb group—no longer an exclusive club?" Curr Opin Genet Dev 11(2): 175-81. Brown, J. L., D. Mucci, M. Whiteley, M. L. Dirksen and J. A. Kassis (1998). "The Drosophila Polycomb group gene pleiohomeotic encodes a DNA binding protein with homology to the transcription factor YY1." Mol Cell 1(7): 1057-64. Cao, R., L. Wang, H. Wang, L. Xia, H. Erdjument-Bromage, P. Tempst, R. S. Jones and Y. Zhang (2002). "Role of histone H3 lysine 27 methylation in Polycomb-group silencing." Science 298(5595): 1039-43. Carrington, E. A. and R. S. Jones (1996). "The Drosophila Enhancer of zeste gene encodes a chromosomal protein: examination of wild-type and mutant protein distribution." Development 122(12): 4073-83. Chan, C. S., L. Rastelli and V. Pirrotta (1994). "A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression." Embo J 13(11): 2553-64. Chang, J. H., H. C. Kim, K. Y. Hwang, J. W. Lee, S. P. Jackson, S. D. Bell and Y. Cho (2002). "Structural basis for the NAD-dependent deacetylase mechanism of Sir2." J Biol Chem 277(37): 34489-98. Chiang, A., M. B. O'Connor, R. Paro, J. Simon and W. Bender (1995). "Discrete Polycombbinding sites in each parasegmental domain of the bithorax complex." Development 121(6): 1681-9. Chung, J. H., A. C. Bell and G. Felsenfeld (1997). "Characterization of the chicken betaglobin insulator." Proc Natl Acad Sci U S A 94(2): 575-80. Core, N., S. Bel, S. J. Gaunt, M. Aurrand-Lions, J. Pearce, A. Fisher and M. Djabali (1997). "Altered cellular proliferation and mesoderm patterning in Polycomb-M33- deficient mice." Development 124(3): 721-9. Czermin, B., R. Melfi, D. McCabe, V. Seitz, A. Imhof and V. Pirrotta (2002). "Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites." CeH 111(2): 185-96. DeCamillis, M. and H. W. Brock (1994). "Expression of the polyhomeotic locus in development of Drosophila melanogaster." Roux's Arch. Devi. Biol. 203: 429-438. 73  DeCamillis, M., N. S. Cheng, D. Pierre and H. W. Brock (1992). "The polyhomeotic gene of Drosophila encodes a chromatin protein that shares polytene chromosome-binding sites with Polycomb." Genes Dev 6(2): 223-32. Erselius, J. R., M. D. Goulding and P. Grass (1990). "Structure and expression pattern of the murine Hox-3.2 gene." Development 110(2): 629-42. Fanning, E. and R. Knippers (1992). "Structure and function of simian virus 40 large tumor antigen." Annu Rev Biochem 61: 55-85. Faucheux, M., J. Y. Roignant, S. Netter, J. Charollais, C. Antoniewski and L. Theodore (2003). "batman Interacts with Polycomb and trithorax Group Genes and Encodes a BTB/POZ Protein That Is Included in a Complex Containing GAGA Factor." Mol Cell Biol 23(4): 118195. Fauvarque, M. O. and J. M. Dura (1993). "polyhomeotic regulatory sequences induce developmental regulator- dependent variegation and targeted P-element insertions in Drosophila." Genes Dev 7(8): 1508-20. Fauvarque, M. O., V. Zuber and J. M. Dura (1995). "Regulation of polyhomeotic transcription may involve local changes in chromatin activity in Drosophila." Mech Dev 52(2-3): 343-55. Freshney, R. I. (2000). Culture of animal cells : a manual of basic technique. New York, Wiley-Liss. Fritsch, C , J. L. Brown, J. A. Kassis and J. Muller (1999). "The DNA-binding polycomb group protein pleiohomeotic mediates silencing of a Drosophila homeotic gene." Development 126(17): 3905-13. Gao, X. and L. Huang (1995). "Cationic liposome-mediated gene transfer." Gene Ther 2(10): 710-22. Gaunt, S. J. and P. B. Singh (1990). "Homeogene expression patterns and chromosomal imprinting." Trends Genet 6(7): 208-12. Gindhart, J. G., Jr. and T. C. Kaufman (1995). "Identification of Polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced." Genetics 139(2): 797-814. Gould, A. (1997). "Functions of mammalian Polycomb group and trithorax group related genes." Curr Opin Genet Dev 7(4): 488-94.  74  Gould, A., A. Morrison, G. Sproat, R. A. White and R. Krumlauf (1997). "Positive crossregulation and enhancer sharing: two mechanisms for specifying overlapping Hox expression patterns." Genes Dev 11(7): 900-13. Gunster, M. J., F. M. Raaphorst, K. M. Hamer, J. L. den Blaauwen, E. Fieret, C. J. Meijer and A. P. Otte (2001). "Differential expression of human Polycomb group proteins in various tissues and cell types." J Cell Biochem Suppl 36: 129-43. Hagstrom, K., M. Muller and P. Schedl (1997). "A Polycomb and GAGA dependent silencer adjoins the Fab-7 boundary in the Drosophila bithorax complex." Genetics 146(4): 1365-80. • Henikoff, S. (1994). "A reconsideration of the mechanism of position effect." Genetics 138(1): 1-5. Hodgson, J. W., B. Argiropoulos and H. W. Brock (2001). "Site-specific recognition of a 70base-pair element containing d(GA)(n) repeats mediates bithoraxoid polycomb group response element-dependent silencing." Mol Cell Biol 21(14): 4528-43. Hodgson, J. W., N. N. Cheng, D. A. Sinclair, M. Kyba, N. B. Randsholt and H. W. Brock (1997). "The polyhomeotic locus of Drosophila melanogaster is transcriptionally and posttranscriptionally regulated during embryogenesis." Mech Dev 66(1-2): 69-81. Horard, B., C. Tatout, S. Poux and V. Pirrotta (2000). "Structure of a polycomb response element and in vitro binding of polycomb group complexes containing GAGA factor." Mol Cell Biol 20(9): 3187-97. Huang, D. H., Y. L. Chang, C. C. Yang, I. C. Pan and B. King (2002). "pipsqueak encodes a factor essential for sequence-specific targeting of a polycomb group protein complex." Mol Cell Biol 22(17): 6261-71. Hur, M. W., J. D. Laney, S. H. Jeon, J. Ali and M. D. Biggin (2002). "Zeste maintains repression of Ubx transgenes: support for a new model of Polycomb repression." Development 129(6): 1339-43. Jacobs, J. J., P. Keblusek, E. Robanus-Maandag, P. Kristel, M. Lingbeek, P. M. Nederlof, T. van Welsem, M. J. van de Vijver, E. Y. Koh, G. Q. Daley and M. van Lohuizen (2000). "Senescence bypass screen identifies TBX2, which represses Cdkn2a (pl9(ARF)) and is amplified in a subset of human breast cancers." Nat Genet 26(3): 291-9. Jacobs, J. J., K. Kieboom, S. Marino, R. A. DePinho and M. van Lohuizen (1999). "The oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus." Nature 397(6715): 164-8.  75  Jacobson, S. and L. Pillus (1999). "Modifying chromatin and concepts of cancer." Curr Opin Genet Dev 9(2): 175-84. Jenuwein, T. and C. D. Allis (2001). "Translating the Histone Code." Science 293(5532): 1074-1080. Jones, P. A. and S. B. Baylin (2002). "The fundamental role of epigenetic events in cancer." Nat Rev Genet 3(6): 415-28. Jones, R. S. and W. M. Gelbart (1990). "Genetic analysis of the enhancer of zeste locus and its role in gene regulation in Drosophila melanogaster." Genetics 126(1): 185-99. Jiirgens, G. (1985). "A group of genes controlling the spatial expression of the bithorax complexe in Drosophila." Nature 316: 153-155. Kapoun, A. M. and T. C. Kaufman (1995). "A functional analysis of 5', intronic and promoter regions of the homeotic gene proboscipedia in Drosophila melanogaster." Development 121(7): 2127-41. Karpen, G. H. (1994). "Position-effect variegation and the new biology of heterochromatin." Curr Opin Genet Dev 4(2): 281-91. Kassis, J. A. (1994). "Unusual properties of regulatory DNA from the Drosophila engrailed gene: three "pairing-sensitive" sites within a 1.6-kb region." Genetics 136(3): 1025-38. Katoh-Fukui, Y., R. Tsuchiya, T. Shiroishi, Y. Nakahara, N. Hashimoto, K. Noguchi and T. Higashinakagawa (1998). "Male-to-female sex reversal in M33 mutant mice." Nature 393(6686): 688-92. Kessel, M., F. Schulze, M. Fibi and P. Gruss (1987). "Primary structure and nuclear localization of a murine homeodomain protein." Proc Natl Acad Sci U S A 84(15): 5306-10. Kinsella, T. M. and G. P. Nolan (1996). "Episomal vectors rapidly and stably produce hightiter recombinant retrovirus." Hum Gene Ther 7(12): 1405-13. Klochendler-Yeivin, A. and M. Yaniv (2001). "Chromatin modifiers and tumor suppression." Biochim Biophys Acta 1551(1): Ml-10. Koga, H., Y. Kaji, K. Nishii, M. Shirai, D. Tomotsune, T. Osugi, A. Sawada, J. Y. Kim, J. Hara, T. Miwa, K. Yamauchi-Takihara, Y. Shibata and Y. Takihara (2002). "Overexpression of Polycomb-group gene rae28 in cardiomyocytes does not complement abnormal cardiac morphogenesis in mice lacking rae28 but causes dilated cardiomyopathy." Lab Invest 82(4): 375-85. 76  Kostic, D. and M. R. Capecchi (1994). "Targeted disruptions of the murine Hoxa-4 and Hoxa6 genes result in homeotic transformations of components of the vertebral column." Mech Dev 46(3): 231-47. Kuzmichev, A., K. Nishioka, H. Erdjument-Bromage, P. Tempst and D. Reinberg (2002). "Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein." Genes Dev 16(22): 2893-905. Kyba, M. and H. W. Brock (1998). "The Drosophila polycomb group protein Psc contacts ph and Pc through specific conserved domains." Mol Cell Biol 18(5): 2712-20. Landecker, H. L., D. A. Sinclair and H. W. Brock (1994). "Screen for enhancers of Polycomb and Polycomblike in Drosophila melanogaster." Dev Genet 15(5): 425-34. Lee, J. T. and R. Jaenisch (1997). "The (epi)genetic control of mammalian X-chromosome. inactivation." Curr Opin Genet Dev 7(2): 274-80. Lessard, J., S. Baban and G. Sauvageau (1998). "Stage-specific expression of polycomb group genes in human bone marrow cells." Blood 91(4): 1216-24. Levine, S. S., A. Weiss, H. Erdjument-Bromage, Z. Shao, P. Tempst and R. E. Kingston (2002). "The core of the polycomb repressive complex is compositionally and functionally conserved in flies and humans." Mol Cell Biol 22(17): 6070-8. Lonie, A., R. D'Andrea, R. Paro and R. Saint (1994). "Molecular characterisation of the Polycomblike gene of Drosophila melanogaster, a trans-acting negative regulator of homeotic gene expression." Development 120(9): 2629-36. Loo, S. and J. Rine (1995). "Silencing and heritable domains of gene expression." AnnuRev Cell Dev Biol 11: 519-48. Markowitz, D., S. Goff and A. Bank (1988). "A safe packaging line for gene transfer: separating viral genes on two different plasmids." J Virol 62(4): 1120-4. Maurange, C. and R. Paro (2002). "A cellular memory module conveys epigenetic inheritance of hedgehog expression during Drosophila wing imaginal disc development." Genes Dev 16(20): 2672-83. McKeon, J. and H. W. Brock (1991). "Interactions of the Polycomb group of genes with homeotic loci of Drosophila." Roux's Arch. Devi. Biol. 199: 387-396.  77  McKeon, J., E. Slade, D. A. Sinclair, N. Cheng, M. Couling and H. W. Brock (1994). "Mutations in some Polycomb group genes of Drosophila interfere with regulation of segmentation genes." Mol Gen Genet 244(5): 474-83. Mihaly, J., I. Hogga, J. Gausz, H. Gyurkovics and F. Karch (1997). "In situ dissection of the Fab-7 region of the bithorax complex into a chromatin domain boundary and a Polycombresponse element." Development 124(9): 1809-20. Mihaly, J., R. K. Mishra and F. Karch (1998). "A conserved sequence motif in Polycombresponse elements." Mol Cell 1(7): 1065-6. Milne, T. A., S. D. Briggs, H. W. Brock, M. E. Martin, D. Gibbs, C. D. Allis and J. L. Hess (2002). "MLL Targets SET Domain Methyltransferase Activity to Hox Gene Promoters." Mol Cell 10(5): 1107-17. Milne, T. A., D. A. Sinclair and H. W. Brock (1999). "The Additional sex combs gene of Drosophila is required for activation and repression of homeotic loci, and interacts specifically with Polycomb and super sex combs." Mol Gen Genet 261(4-5): 753-61. Mohd-Sarip, A., F. Venturini, G. E. Chalkley and C. P. Verrijzer (2002). "Pleiohomeotic can link polycomb to DNA and mediate transcriptional repression." Mol Cell Biol 22(21): 747383. Motaleb, M. A., Y. Takihara, H. Ohta and K. Shimada (1999). "Characterization of ciselements required for the transcriptional activation of the rae28/mphl gene in F9 cells." Biochem Biophys Res Commun 262(2): 509-15. Muller, J., S. Gaunt and P. A. Lawrence (1995). "Function of the Polycomb protein is conserved in mice and flies." Development 121(9): 2847-52. Muller, J., C. M. Hart, N. J. Francis, M. L. Vargas, A. Sengupta, B. Wild, E. L. Miller, M. B. O'Connor, R. E. Kingston and J. A. Simon (2002). "Histone methyltransferase activity of a Drosophila Polycomb group repressor complex." Cell 111(2): 197-208. Muller, M., K. Hagstrom, H. Gyurkovics, V. Pirrotta and P. Schedl (1999). "The mcp element from the Drosophila melanogaster bithorax complex mediates long-distance regulatory interactions." Genetics 153(3): 1333-56. Muyrers-Chen, I. and R. Paro (2001). "Epigenetics: unforeseen regulators in cancer." Biochim Biophvs Acta 1552(1): 15-26. Neely, K. and J. Workman (2002). "The complexity of chromatin remodeling and its links to cancer." Biochim Biophvs Acta 1603(1): 19. 78  Nomura, M., Y. Takihara and K. Shimada (1994). "Isolation and characterization of retinoic acid-inducible cDNA clones in F9 cells: one of the early inducible clones encodes a novel protein sharing several highly homologous regions with a Drosophila polyhomeotic protein." Differentiation 57(1): 39-50. Ohta, H., A. Sawada, J. Y. Kim, S. Tokimasa, S. Nishiguchi, R. K. Humphries, J. Hara and Y. Takihara (2002). "Polycomb group gene rae28 is required for sustaining activity of hematopoietic stem cells." J Exp Med 195(6): 759-70. Orlando, V., E. P. Jane, V. Chinwalla, P. J. Harte and R. Paro (1998). "Binding of trithorax and Polycomb proteins to the bithorax complex: dynamic changes during early Drosophila embryogenesis." EmboJ 17(17): 5141-50. Paro, R. (1990). "Imprinting a determined state into the chromatin of Drosophila." Trends Genet 6(12): 416-21. Paro, R. and D. S. Hogness (1991). "The Polycomb protein shares a homologous domain with a heterochromatin- associated protein of Drosophila." Proc Natl Acad Sci U S A 88(1): 263-7. Pelegri, F. and R. Lehmann (1994). "A role of polycomb group genes in the regulation of gap gene expression in Drosophila." Genetics 136(4): 1341-53. Pirrotta, V. (1995). "Chromatin complexes regulating gene expression in Drosophila." Curr Opin Genet Dev 5(4): 466-72. Pirrotta, V. (1997). "Chromatin-silencing mechanisms in Drosophila maintain patterns of gene expression." Trends Genet 13(8): 314-8. Raaphorst, F. M., A. P. Otte and C. J. Meijer (2001). "Polycomb-group genes as regulators of mammalian lymphopoiesis." Trends Immunol 22(12): 682-90. Randsholt, N. B., F. Maschat and P. Santamaria (2000). "polyhomeotic controls engrailed expression and the hedgehog signaling pathway in imaginal discs." Mech Dev 95(1-2): 89-99. Rastelli, L., C. S. Chan and V. Pirrotta (1993). "Related chromosome binding sites for zeste, suppressors of zeste and Polycomb group proteins in Drosophila and their dependence on Enhancer of zeste function." EmboJ 12(4): 1513-22. Rittling, S. R. (1996). "Clonal nature of spontaneously immortalized 3T3 cells." Exp Cell Res 229(1): 7-13. Saenz-Robles, M. T., C. S. Sullivan and J. M. Pipas (2001). "Transforming functions of Simian Virus 40." Oncogene 20(54): 7899-907. 79  Sambrook, J., E. F. Fritsch and T. Maniatis (1989). Molecular cloning : a laboratory manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory. Satijn, D. P. and A. P. Otte (1999). "Polycomb group protein complexes: do different complexes regulate distinct target genes?" Biochim Biophvs Acta 1447(1): 1-16. Saurin, A. J., Z. Shao, H. Erdjument-Bromage, P. Tempst and R. E. Kingston (2001). "A Drosophila Polycomb group complex includes Zeste and dTAFII proteins." Nature 412(6847): 655-60. Sauvageau, G., U. Thorsteinsdottir, C. J. Eaves, H. J. Lawrence, C. Largman, P. M. Lansdorp and R. K. Humphries (1995). "Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo." Genes Dev 9(14): 1753-65. Sauvageau, G., U. Thorsteinsdottir, M. R. Hough, P. Hugo, H. J. Lawrence, C. Largman and R. K. Humphries (1997). "Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation." Immunity 6(1): 13-22. Schlossherr, J., H. Eggert, R. Paro, S. Cremer and R. S. Jack (1994). "Gene inactivation in Drosophila mediated by the Polycomb gene product or by position-effect variegation does not involve major changes in the accessibility of the chromatin fibre." Mol Gen Genet 243(4): 453-62. Schumacher, A., C. Faust and T. Magnuson (1996). "Positional cloning of a global regulator of anterior-posterior patterning in mice." Nature 384(6610): 648. Schumacher, A. and T. Magnuson (1997). "Murine Polycomb- and trithorax-group genes regulate homeotic pathways and beyond." Trends Genet 13(5): 167-70. Shao, Z., F. Raible, R. Mollaaghababa, J. R. Guyon, C. T. Wu, W. Bender and R. E. Kingston (1999). "Stabilization of chromatin structure by PRC1, a Polycomb complex." Cell 98(1): 3746. Shimell, M. J., A. J. Peterson, J. Burr, J. A. Simon and M. B. O'Connor (2000). "Functional analysis of repressor binding sites in the iab-2 regulatory region of the abdominal-A homeotic gene." Dev Biol 218(1): 38-52. Shirai, M., T. Osugi, H. Koga, Y. Kaji, E. Takimoto, I. Komuro, J. Hara, T. Miwa, K. Yamauchi-Takihara and Y. Takihara (2002). "The Polycomb-group gene Rae28 sustains Nkx2.5/Csx expression and is essential for cardiac morphogenesis." J Clin Invest 110(2): 17784. 80  Simon, J. (1995). "Locking in stable states of gene expression: transcriptional control during Drosophila development." Curr Opin Cell Biol 7(3): 376-85. Simon, J., A. Chiang and W. Bender (1992). "Ten different Polycomb group genes are required for spatial control of the abdA and AbdB homeotic products." Development 114(2): 493-505. Simon, J., M. Peifer, W.Bender and M. O'Connor (1990). "Regulatory elements of the bithorax complex that control expression along the anterior-posterior axis." Embo J 9(12): 3945-56. Simon, J. A. and J. W. Tamkun (2002). "Programming off and on states in chromatin: mechanisms of Polycomb and trithorax group complexes." Curr Opin Genet Dev 12(2): 2108. Sinclair, D. A., R. B. Campbell, F. Nicholls, E. Slade and H. W. Brock (1992). "Genetic analysis of the additional sex combs locus of Drosophila melanogaster." Genetics 130(4): 81725. Sinclair, D. A., T. A. Milne, J. W. Hodgson, J. Shellard, C. A. Salinas, M. Kyba, F. Randazzo and H. W. Brock (1998). "The Additional sex combs gene of Drosophila encodes a chromatin protein that binds to shared and unique Polycomb group sites on polytene chromosomes." Development 125(7): 1207-16. Soto, M. C , T. B. Chou and W. Bender (1995). "Comparison of germline mosaics of genes in the Polycomb group of Drosophila melanogaster." Genetics 140(1): 231-43. Stankunas, K., J. Berger, C. Ruse, D. A. Sinclair, F. Randazzo and H. W. Brock (1998). "The enhancer of polycomb gene of Drosophila encodes a chromatin protein conserved in yeast and mammals." Development 125(20): 4055-66. Strahl, B. D. and C. D. Allis (2000). "The language of covalent histone modifications." Nature 403(6765): 41-5. Struhl, G. and M. Akam (1985). "Altered distributions of Ultrabithorax transcripts in extra sex combs mutant embryos of Drosophila." Embo J 4(12): 3259-64. Strutt, H., G. Cavalli and R. Paro (1997). "Co-localization of Polycomb protein and GAGA factor on regulatory elements responsible for the maintenance of homeotic gene expression." EmboJ 16(12): 3621-32.  81  Strutt, H. and R. Paro (1997). "The polycomb group protein complex of Drosophila melanogaster has different compositions at different target genes." Mol Cell Biol 17(12): 6773-83. Sullivan, C. S. and J. M. Pipas (2002). "T Antigens of Simian Virus 40: Molecular Chaperones for Viral Replication and Tumorigenesis." Microbiol. Mol. Biol. Rev. 66(2): 179202. Takihara, Y., D. Tomotsune, M. Shirai, Y. Katoh-Fukui, K. Nishii, M. A. Motaleb, M. Nomura, R. Tsuchiya, Y. Fujita, Y. Shibata, T. Higashinakagawa and K. Shimada (1997). "Targeted disruption of the mouse homologue of the Drosophila polyhomeotic gene leads to altered anteroposterior patterning and neural crest defects." Development 124(19): 3673-82. Tetsu, O., H. Ishihara, R. Kanno, M. Kamiyasu, H. Inoue, T. Tokuhisa, M. Taniguchi and M. Kanno (1998). "mel-18 negatively regulates cell cycle progression upon B cell antigen receptor stimulation through a cascade leading to c-myc/cdc25." Immunity 9(4): 439-48. Thorsteinsdottir, U., G. Sauvageau, M. R. Hough, W. Dragowska, P. M. Lansdorp, H. J. Lawrence, C. Largman and R. K. Humphries (1997). "Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia." Mol Cell Biol 17(1): 495-505. Tie, F., T. Furuyama and P. J. Harte (1998). "The Drosophila Polycomb Group proteins ESC and E(Z) bind directly to each other and co-localize at multiple chromosomal sites." Development 125(17): 3483-96. Tie, F., T. Furuyama, J. Prasad-Sinha, E. Jane and P. J. Harte (2001). "The Drosophila Polycomb Group proteins ESC and E(Z) are present in a complex containing the histonebinding protein p55 and the histone deacetylase RPD3." Development 128(2): 275-86. Tillib, S., S. Petruk, Y. Sedkov, A. Kuzin, M. Fujioka, T. Goto and A. Mazo (1999). "Trithorax- and Polycomb-group response elements within an Ultrabithorax transcription maintenance unit consist of closely situated but separable sequences." Mol Cell Biol 19(7): 5189-202. Todaro, G. L. and H. Green (1963). "Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines." J Cell Biol 17: 299-313. Tokimasa, S., H. Ohta, A. Sawada, Y. Matsuda, J. Y. Kim, S. Nishiguchi, J. Hara and Y. Takihara (2001). "Lack of the Polycomb-group gene rae28 causes maturation arrest at the early B-cell developmental stage." Exp Hematol 29(1): 93-103.  82  Tomotsune, D., M. Shirai, Y. Takihara and K. Shimada (2000). "Regulation of Hoxb3 expression in the hindbrain and pharyngeal arches by rae28, a member of the mammalian Polycomb group of genes." Mech Dev 98(1-2): 165-9. Tuggle, C. K., J. Zakany, L. Cianetti, C. Peschle and M. C. Nguyen-Huu (1990). "Regionspecific enhancers near two mammalian homeo box genes define adjacent rostrocaudal domains in the centra} nervous system." Genes Dev 4(2): 180-9. van der Lugt, N. M., J. Domen, K. Linders, M. van Roon, E. Robanus-Maandag, H. te Riele, M. van der Valk, J. Deschamps, M. Sofroniew, M. van Lohuizen and et al. (1994). "Posterior transformation, neurological abnormalities, and severe hematopoietic defects in mice with a targeted deletion of the bmi-1 proto-oncogene." Genes Dev 8(7): 757-69. van der Vlag, J. and A. P. Otte (1999). "Transcriptional repression mediated by the human polycomb-group protein EED involves histone deacetylation." Nat Genet 23(4): 474-8. van Lohuizen, M. (1999). "The trithorax-group and polycomb-group chromatin modifiers: implications for disease." Curr Opin Genet Dev 9(3): 355-61. van Oostveen, J., J. Bijl, F. Raaphorst, J. Walboomers and C. Meijer (1999). "The role of homeobox genes in normal hematopoiesis and hematological malignancies." Leukemia 13(11): 1675-90. Yamamoto, Y., F. Girard, B. Bello, M. Affolter and W. J. Gehring (1997). "The cramped gene of Drosophila is a member of the Polycomb-group, and interacts with mus209, the gene encoding Proliferating Cell Nuclear Antigen." Development 124(17): 3385-94. Yu, B. D., R. D. Hanson, J. L. Hess, S. E. Horning and S. J. Korsmeyer (1998). "MLL, a mammalian trithorax-group gene, functions as a transcriptional maintenance factor in morphogenesis." Proc Natl Acad Sci U S A 95(18): 10632-6. Zink, B. and R. Paro (1989). "In vivo binding pattern of a trans-regulator of homoeotic genes in Drosophila melanogaster." Nature 337(6206): 468-71.  83  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090998/manifest

Comment

Related Items