Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of the chloroplast genome of selected dinoflagellates : mini- and digenic circles in… Nelson, Martha 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-0274.pdf [ 15.98MB ]
Metadata
JSON: 831-1.0090989.json
JSON-LD: 831-1.0090989-ld.json
RDF/XML (Pretty): 831-1.0090989-rdf.xml
RDF/JSON: 831-1.0090989-rdf.json
Turtle: 831-1.0090989-turtle.txt
N-Triples: 831-1.0090989-rdf-ntriples.txt
Original Record: 831-1.0090989-source.json
Full Text
831-1.0090989-fulltext.txt
Citation
831-1.0090989.ris

Full Text

C H A R A C T E R I Z A T I O N O F T H E C H L O R O P L A S T G E N O M E OF S E L E C T E D D I N O F L A G E L L A T E S : MINI- A N D DIGENIC C I R C L E S IN ADENOIDES ELUDENS by MARTHA NELSON B.Sc, University of British Columbia, 1999 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF M A S T E R OF S C I E N C E in THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF BOTANY We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA March 2003 ©Martha Nelson, 2003 In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l l m e n t o f the r e q u i r e m e n t s f o r an advanced degree a t t h e U n i v e r s i t y o f B r i t i s h Columbia, I agree t h a t the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r r e f e r e n c e and study. I f u r t h e r agree t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g of t h i s t h e s i s f o r s c h o l a r l y purposes may be g r a n t e d by the head of my department or by h i s or her r e p r e s e n t a t i v e s . I t i s u n d e r s t o o d t h a t c o p y i n g or p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l not be a l l o w e d w i t h o u t my w r i t t e n p e r m i s s i o n . Department o f Botany The U n i v e r s i t y o f B r i t i s h Columbia Vancouver, Canada Abstract DNA was isolated from three species of peridinin-containing dinoflagellate (Scrippsiella trochoidea, Prorocentrum micans and Adenoides eludens) and run through a CsCl density gradient to separate it into main (nuclear) and satellite (organellas) fractions. The fractions were hybridized with chloroplast gene probes. This showed that chloroplast genes are found on discrete pieces of satellite 2 DNA in two species: small pieces (~1.5 kb) in Prorocentrum micans, and larger pieces (5 kb, 9 kb and larger) in Adenoides eludens. These results were similar to those of Zhang et al. (1999), who discovered unigenic minicircles in the chloroplast DNA of the peridinin-containing dinoflagellate Heterocapsa triquetra. Sequence data for chloroplast genes psbA, psbC, and psbD were obtained from Adenoides eludens. Outward directed polymerase chain reaction (PCR) primers were designed for these genes to amplify minicircles, and products of 4.1 to 5.2 kb were obtained, indicating the likely presence of minicircles in the chloroplast DNA of this species. The outward PCR products from the psbA reaction were cloned. Sequencing revealed that clones of the psbA minicircle were different from one another, unlike the results of previous studies that showed that the sequence of minicircles containing the same gene are the same (Zhang et al. 1999, Zhang et al. 2002, Barbrook and Howe 2000, Barbrook et al. 2001, Hiller 2001). The clones did share some sequence identity, however, including some secondary structure, repeated motifs, and a 200 base pair conserved region. The length of the fully sequenced region was 4300 base pairs, making the minicircle 4489 base pairs in total. ii Outward and inward directed PCR primers from three chloroplast genes (psbA, psbC, and psbD) were used in all combinations to amplify many products ranging in size from 5.0 to 6.5 kb. The product resulting from the psbD Ro and psbA Fi primer pair was cloned. The sequence of the ends of three of these clones revealed that both of the gene ends (psbD and psbA) were present and that the non-coding regions of the clones were different from one another. Further experiments using nested PCR showed some similarities between these products and the psbA minicircles. This result implies that digenic circles may exist in Adenoides eludens. iii TABLE OF CONTENTS Abstract i i Table of contents iv List of Tables viii List of Figures ix Acknowledgements xii Chapter 1: Introduction Dino flagellates 1 Plastid origins and evolution 4 Plastid genomes 11 Life in the plastid 14 Minicircles in dinoflagellate plastids 17 Questions and objectives 23 Chapter 2: Southern Blot Survey of Dinoflagellate DNA Species • 25 DNA extraction 25 Density-gradient centrifugation 26 Precipitation of DNA 27 Southern blotting 28 Hybridization and detection—ECL probes 28 Hybridization and detection—radiolabeled probes 29 iv Results of Southern blot survey 30 psaA 30 psbC 32 petD 33 Summary of results of Southern blot survey 34 psbA—Heterocapsa triquetra and Adenoides eludens 35 Sucrose gradient 38 Sucrose gradient Southern blot—untreated fractions 38 Sucrose gradient Southern blot—protease-treated and sheared fractions 39 Sucrose gradient Southern blot—restriction endonuclease-treated fractions 41 Conclusions 44 Chapter 3: Unigenic minicircles in Adeoides eludens Methods 45 Polymerase chain reaction 45 Gel purification, cloning and plasmid DNA preparation 46 Sequencing 47 Primers 47 Results 48 psbA 48 psbD 49 psbC 49 v Outward PCR 53 Long PCR 55 Direct sequencing of long PCR products 58 Cloning methods 61 Chapter 4: Sequence of psbA long P C R product clones Sequencing large clones 64 Codon use 65 Restriction enzyme cut sites 70 Open reading frames 71 Conserved areas 71 Direct and inverse repeats 73 Discussion 75 Conclusions 76 Chapter 5: Digenic minicircles in Adenoides eludens Combination PCR 77 psbA and psbD 78 psbA and psbC 81 psbD and psbC 84 Discussion of combination PCR results 86 Cloning and sequencing combination products 88 Nested PCR—combination products as templates 89 vi Control nested PCR 90 Nested PCR—psbA Fi/psbD Ro clones as template 91 Sequence of ends of combination clones 10, 11 and 12 95 Discussion of digenic circles 97 Conclusions 99 Chapter 6: General Discussion of Results Discussion 100 Future work I l l References 112 Appendix 1: Primer sequences 127 vii List of Tables Table 1: Chloroplast genes found on minicircles in dinoflagellates 19 Table 2: Size comparisons of minicircles from Heterocapsa triquetra, H. pygmaea, H. niei, H. rotundata, Amphidinium operculatum, A. carterae 20 Table 3: Results of Southern blot survey of four species of dino flagellate (Heterocapsa triquetra, Adenoides eludens, Prorocentrum micans and Scrippsiella trochoidea) using Heterocapsa triquetra gene probes for psaA, psbC, and petD 34 Table 4: Summary of psbA and psbD primer combinations giving products, and the sizes of the products 78 Table 5: Summary of psbA and psbC primer combinations giving products, and the sizes of the products 81 Table 6: Summary of psbD and psbC primer combinations giving products, and the sizes of the products 84 viii List of Figures Figure 1: Primary, secondary and tertiary endosymbiosis 6 Figure 2: Current thinking of the evolution of the plastids of various groups of photosynthetic organisms 8 Figure 2B: Diagram of a generalized dinoflagellate chloroplast minicircle 21 Figure 3: Tubes containing dinoflagellate DNA after ultracentrifugation with CsCl and bis-benzimide dye 27 Figure 4: psaA blot using ECL detection kit 31 Figure 5: psbC blot using ECL detection kit 32 Figure 6: petD blot using ECL detection kit 33 Figure 7: psbA blots using radiolabeled probes and total and satellite DNA from both Heterocapsa triquetra dead Adenoides eludens 36 Figure 8: Southern blot of sucrose gradient fractions using ECL kit protocols 39 Figure 9: Blot of fractions 5, 6, 7 and 8 with different treatments. 40 Figure 10: Blot of fractions 15, 16 and 17 cut with different restriction enzymes.. ..42 Figure 11: Control lane 1 from Figure 10 (Adenoides eludens satellite 2 DNA) magnified to show banding pattern 43 Figure 12A: Alignment of psbC nucleotide sequences using ClustalW 50 Figure 12B: Alignment of psbC amino acid sequences using ClustalW 52 Figure 13: Outward PCR 54 Figure 14: Diagram showing relative positions and names of the four types of primers 55 ix Figure 15: Products of long PCR using outward-facing primers and Adenoides eludens satellite 2 DNA 56 Figure 16: Diagram of psbA minicircle 59 Figure 17: Diagram of results of direct sequencing using psbA long PCR product from outward-facing primers 60 Figure 18: Gel showing EcoRI restriction endonuclease digestion of X L psbA product clones 63 Figure 19: Map of clone 12 containing the psbA minicircle non-coding region 66 Figure 20: Map of clone 15 containing the psbA minicircle non-coding region 67 Figure 21: Map of clone 17 containing the psbA minicircle non-coding region 68 Figure 22: Map of clone 18 containing the psbA minicircle non-coding region 69 Figure 23: Alignment of conserved region at centre of insert of each clone 72 Figure 24: Sequence and alignment of large hairpin found at centre of insert in clone 15 74 Figure 25: Diagram of structure of the non-coding region of minicircles from the Adenoides eludens chloroplast genome 74 Figure 26: Combination PCR 77 Figure 27: Diagram of hypothetical circle containing psbA and psbD drawn from results of combination PCR 79 Figure 28: Map of combination PCR products from psbA and psbD primers 80 Figure 29: Diagram of hypothetical circle containing psbA and psbC drawn from results of combination PCR 81 Figure 30: Map of combination PCR products from psbA and psbC primers 83 Figure 31: Diagram of hypothetical circle containing psbD and psbC drawn from results of combination PCR 84 Figure 32: Map of combination PCR products from psbC and psbD primers 85 Figure 33: Gel showing EcoRI restriction endonuclease digestion of clones containing the psbA ¥i/psbD Ro PCR product 88 Figure 34: Diagram of psbA long PCR product with location of the F3 and R2 primers 90 Figure 35: Results of control nested PCR 91 Figure 36: Diagram of DRo/AFi combination PCR product 92 Figure 37: Results of nested PCR using psbA Fi/psbD Ro clones 1, 10, 11 and 12 and primers AFo, DRo and F3 93 Figure 38: Diagram of combination PCR product obtained from psbA Fi and psbD Ro primers with sequenced regions indicated 95 Figure 39: Diagram of recombination between two unigenic circles at the non-coding region to produce one digenic circle 98 Figure 40: Diagram showing possible sources of stalled or collapsed replication forks 105 Figure 41: 3' strand displacement 106 Figure 42: Regeneration of replication fork using 3' strand displacement and Halliday junction resolution 107 xi Acknowledgements This project would not have been possible without the help, encouragement and support of many people. I would like to thank Drs. Beverley Green, Balbir Chaal, Ken-ichiro Ishida and Patrick Keeling for helpful discussion and technical suggestions. I would also like to thank Elena Filek and Drs. Balbir Chaal and Ken Ishida for teaching me many molecular biology techniques. I owe thanks to the staff at the NAPS unit who were invaluable in their help with sequencing, and to the Botany Office staff who helped me re-register at least a dozen times. Thanks are also due to Drs. Beverley Green, Anthony Griffiths, Patrick Keeling and Max Taylor for their guidance during this project. I am grateful to Dr. Beverley Green for financial support. I am also grateful to Balbir Chaal, Geoff Chamberlin, and my parents and sisters for many laughs and encouragement. Last, but not least, I also thank the thousands of dinoflagellates, specifically Adenoides eludens, that gave their chloroplast DNA for this project. I am a phycologist! The dinoflagellate Adenoides eludens. Photo by M . Nelson and L. Samuels. xii Dinoflagellates Dinoflagellates are unicellular eukaryotes, with roughly 2000 extant species, about half of which are photosynthetic, and around 90% of which inhabit marine waters (Taylor 1987). A l l species have at least two dimorphic flagella; one is ribbon-like and transverse, while the other is straight and longitudinal (Taylor 1980). It is this attribute, as well as the whirling or turning swimming movement described in Greek as dinos, that accounts for the group's name (Spector 1984). The cells may be naked or armoured with cellulose plates that lie in vesicles just below the cell membrane, and some species also have a fibrous tough covering, the pellicle, found just below these vesicles (Taylor 1980). Mitochondria of dinoflagellates contain tubular cristae (Taylor 1980). Some species also contain eyespots that sense light and are thought to enable phototaxis for the cell (Dodge 1984), and others have ejectile bodies called trichocysts (Taylor 1980). The dinoflagellates are part of a larger group, the alveolates, which also includes the apicomplexans and ciliates (Fensome et al. 1999). Dinoflagellates as a group appear to be ancestrally photosynthetic (Saldarriaga et al. 2001), as do the apicomplexans; this may also be true of the alveolates (Fast et al. 2001). The dinoflagellates are important both ecologically and economically. They are significant primary producers in the world's oceans, although in this area they are second to diatoms (Taylor 1987). In addition, they associate with reef-building corals and other invertebrates as photosynthetic symbionts called zooxanthellae. When deprived of their zooxanthellae, many corals drastically reduce growth or die (Hoegh-Guldberg 1999). Dinoflagellates are also important since some species can form toxic blooms known as 1 "red tide" -often lethal to both marine fauna and humans (Taylor 1980). The dinoflagellate nucleus is very unusual in that it contains, in some cases, enormous amounts of DNA: 7 to 143 pg/cell (Rizzo and Nooden 1973), and up to 200 pg/cell in Gonyaulax (Rizzo 1987). In addition, the DNA is permanently condensed into chromosomes (Rizzo 1981), although no histones are present (Rizzo 1991). These unusual features have caused scientists to bestow the dinoflagellate nucleus with its own name: the dinokaryon. Chromosome numbers in different species range from twenty to 144, and chromosomes can be long and rod-shaped or small and spherical (Dodge 1963). It is believed that some of the DNA in the dinokaryon serves a structural purpose while the rest is actively transcribed (Sigee 1984). Almost all dinoflagellate species have a haploid vegetative stage and become diploid only when reproducing sexually, although there are some species that are diploid when reproducing asexually (Tappan 1980, Pfiester 1984). The plastid of the dinoflagellate is encased in three membranes (Dodge 1975). The thylakoids are usually stacked in three's, although stacks of two and four have also been observed (Dodge 1975). In peridinin-containing dino flagellates, the plastids are generally observed to be large and reticulate; they are singular and found at the periphery of the cell (Dodge 1975). Lipid droplets are sometimes found in the plastid stroma, but never starch (Dodge 1975). The stroma of the plastid also holds one or more DNA-containing regions called nucleoids. In peridinin-containing dinoflagellates, these nucleoids are scattered throughout the organelle (Coleman 1985). Coleman notes (1985) 2 that tiny arms are sometimes visible leading from one nucleoid to the next, implying a connection may exist between them. Peridinin dinoflagellates are also unusual in that their plastids contain a different form of ribulose- 1,5-bisphosphate carboxylase- oxygenase (RuBisCO) from that of any other plastids examined (Morse et al. 1995). RuBisCO is the key enzyme in photosynthetic carbon fixation (Alberts et al. 1994). Form I RuBisCO is found in cyanobacteria, chlorophytes and rhodophytes, while Form II is found in some proteobacteria (Jordan and Ogren 1981) and also in some dinoflagellate plastids. Jenks and Gibbs (2000) showed that dinoflagellates with a fucoxanfhin-type plastid (as opposed to a peridinin-containing plastid, further explained below) did not contain Form II RuBisCO but had Form I instead, consistent with that plastid's proposed origin as a diatom. The pigments found in dinoflagellate plastids reflect the astonishing evolutionary history of these organelles. It is likely that several plastid losses and replacements have taken place in the group (Saldarriaga et al. 2001); the endosymbiotic theory that accounts for this will be explored below. Most photosynthetic dinoflagellates contain chlorophyll C2 and the carotenoid peridinin (Jeffrey et al. 1975) and are generally referred to as the peridinin dinoflagellates; these plastids appear to have a red alga as ancestor (Takishita and Uchida 1999). The peridinin plastid has been generally thought of as the ancestral plastid of the dinoflagellates, acquired through secondary endosymbiosis (Zhang et al. 2000). There are four other dinoflagellate plastid groups that can be identified by their pigment composition patterns (Dodge 1989). These groups are characterized by the 3 pigments 19' hexanoyloxy-fucoxanthin, mcoxanthin, phycobilin, or chlorophyll b. The 19' hexanoyloxy-mcoxanthin-type has been identified by pigment, ultrastructure and molecular phylogeny studies as having a haptophyte plastid (Tangen and Bjornland 1981, Tengs et al. 2000, Ishida and Green 2002). The fucoxanthin-type plastid, which also contains both forms of chlorophyll c, has been shown by these same sorts of studies to be a pennate diatom endosymbiont (Jeffrey et al. 1975, Chesnick et al. 1997). It is thought that the phycobilin-type plastid arose from engulfment of a cryptophyte (Wilcox and Wedemayer 1985, Schnepf and Elbrachter 1988). Finally the chlorophyll 6-type plastid is thought to have originated through the engulfment of a prasinophyte (Elbrachter and Schnepf 1996), Plast id origins and evolution The first evidence that plastids and mitochondria were different from other cellular compartments came in the form of cytological studies that suggested they reproduced by fission (Schimper 1883, from McFadden 2001). In 1954, Sager showed that streptomycin resistance in Chlamydomonas reinhardtii showed non-Mendelian inheritance, and she hypothesized that this resistance is carried on a non-chromosomal hereditary element. In 1962 Ris and Plaut demonstrated convincing cell biological evidence for the presence of DNA in organelles. Sager and Ishida isolated and characterized chloroplast DNA only a year later (1963). These events re-set the stage for the idea that plastids and mitochondria arose through endosymbiosis and are the intracellular descendants of prokaryotes, an idea first proposed by Mereschkowsky in 1905 (translated by Martin and Kowallick 1999) and popularized by Margulis in 1970 4 (McFadden2001). After many, many experiments and investigations, this idea has gained acceptance. The theory not only allows that prokaryotes have taken up residence inside eukaryotic hosts (primary endosymbiosis), but also that these eukaryotes might move into the cytosol of other eukaryotes. Gibbs first proposed this idea in 1978 when she observed that although Euglena had a plastid that was similar to those found in green algae, the rest of the cell was extremely different from green algae, making it unlikely that the two were closely related. She suggested that the Euglena plastid may be related to green algae, however, and was acquired through a second endosymbiosis in which a green algal cell had taken up residence inside a euglenoid (Gibbs 1978). This idea was later further expanded to apply to dinoflagellates and cryptomonads as well (Gibbs 1981), and termed secondary endosymbiosis. This extension has been borne out by the study of several plastids that contain a relict eukaryotic nucleus, the nucleomorph, between the third and fourth plastid membranes (Douglas et al. 1991, Douglas et al. 2001, Hibberd and Norris 1984). It has also been proposed that some plastids may have arisen from a tertiary endosymbiosis in which the product of a secondary endosymbiosis was itself engulfed (Douglas 1998). Figure 1 summarizes the endosymbiotic theory. 5 The current thinking about the endosymbiotic events that produced the current diversity we see around us follows (McFadden 2001). This information is summarized in figure 2. The plastids of the green algae and plants, red algae, and glaucophytes are surrounded by two membranes and are thought to have arisen as a result of the primary endosymbiotic event. The plastids from euglenoids and chlorarachniophytes are also green but are surrounded by three and four membranes respectively, and are thought to be the result of secondary endosymbiosis. The chlorarachniophytes have a nucleomorph between the third and fourth membranes as mentioned above. Secondary endosymbioses involving the red algae have produced four-membraned plastids in the cryptophytes, heterokonts, haptophytes and apicomplexans, although the last have lost their photosynthetic capability. Like the chlorarachnions, the cryptophytes have retained a nucleomorph. As discussed above, some dinoflagellates have endured (or enjoyed!) several plastid replacements and have three membranes around their plastids. The dinoflagellates with peridinin-containing plastids are part of the "red line" revealed above. Primary endosymbiosis is thought to have occurred only once (Reith and Munholland 1993) but several episodes of higher-level (secondary etc.) endosymbiosis have probably transpired. Exactly how many is currently debated. It seems fairly clear that different secondary endosymbioses produced the euglenids and chlorarachniophytes, but the number of endosymbioses that gave rise to the diversity of red secondarily-acquired plastids is as yet unknown (Archibald and Keeling 2002). 7 Heterokonts Apicomplexa + chlorophyll c t Rhodophytes (red algae) Glaucocystophytes chlorophyll b Peridinin Dinoflagellates Chlorarachniophytes Chlorophytes (green algae) Higher plants - phycobilins (PB) First photosynthetic eukaryote—product of 1° endosymbiosis Chi a, Chi b, phycobilins (PB) Figure 2: Current thinking of the evolution of the plastids of various groups of photosynthetic organisms. Dashed arrows indicate secondary endosymbiosis; number of boxes indicate number of membranes around plastids in each group, (adapted in part from BR Green) 8 In 1981, Weeden drew together evidence that the chloroplast performed metabolic functions for the host cell (in addition to photosynthesis) that included synthesis of carotenoids and amino acids, and the assimilation of nitrogen and sulphur. He postulated that many of the genes required for these functions had moved to the nucleus (Weeden 1981). In prokaryotic evolution, horizontal gene transfer has been a very important factor (Jain et al. 1999, Raymond et al. 2002). Not all genes have an equal likelihood of transfer however. Rivera et al. (1998) state that in both prokaryotes and eukaryotes the genes that encode such proteins as those in the transcription and translation complexes and the tRNA synthetases are seldom transferred from one organism to another. It is the genes that code for nucleotide, amino acid, fatty acid, phospholipid and cofactor biosynthesis, cell envelope, energy and intermediary metabolism, and regulatory functions that are readily transferred (Rivera et al. 1998). Extensive gene transfer has occurred from the endosymbionts to the nucleus over the years since the initial endosymbiotic event. It has been estimated that the plastid genome is now comprised of only 5-10% of its original complement of genes (Martin and Herrmann 1998). The rest of the genes have moved to the nucleus, with some of the gene products targeted back to the plastid with specific targeting sequences on the N-terminal end (Heins and Soli 1998). It also appears that many of these originally cyanobacterial genes have found alternate roles in other cellular compartments (Martin et al. 2002). Housekeeping genes encoding bits of the transcription or translation apparatus comprise one broad category of what remains encoded on plastid DNA, and genes coding for proteins involved in metabolic processes such as photosynthesis or lipid synthesis are 9 another (Smith and Purton 2002). If a gene has been transferred to the nucleus from the chloroplast genome in one group, it is more likely to have been transferred in other cases (Martin et al. 1998). Regulatory genes especially tend to be fixed in the nucleus (Martin and Herrmann 1998). Questions remain as to the reasons for the maintenance of the chloroplast genome. Although this transfer of genes may be an inexorable process, the possibility exists that some plastid genes have remained in the organelle because their electron-transport products might be dangerous in the cytosol (Allen 1993). By being transcribed and translated in the compartment in which they will be used, these gene products are somewhat sequestered from the rest of the cell and an added measure of safety is gained. Another possibility is that the products encoded by organellar genes are too hydrophobic to cross membranes easily, requiring them to remain inside the organelle (Palmer et al. 2000). Daley et al. (2002) recently tested this idea using a mitochondrial gene that is in some cases encoded in both the nucleus and the mitochondria, and found evidence to support this idea. As mentioned above, the genes that have remained in the organelles make products that tend to be part of large multiprotein complexes, which also decreases the chance of successful transfer to the nucleus (Jain et al. 1999). It is likely that all these factors have played a part in the transfer of genes from one compartment of the cell to another. Plastid Genomes The activities of plastids encompass not only photosynthesis, but also storage of cellular 10 products like starch or oils, and the synthesis of several molecules important to the cell. Many of the proteins required for these diverse functions are encoded on DNA found inside the chloroplast itself—the plastid genome. The first physical chloroplast gene map was constructed in 1976 for maize, and the first chloroplast gene was cloned in 1977 (Sugiura 1992). By 1980 the first chloroplast protein gene sequence—for the large subunit of form I RuBisCO—had been published (Bogorad 1991). A new field had been bom: "chloroplast molecular biology." Palmer (1991) states that one must keep two things in mind when considering plastid genomes: the first is that plastids have cyanobacterial origins, and exhibit primitive bacterial features as well as those derived after the symbiosis occurred. The second is that our knowledge of these genomes is historically somewhat lopsided phylogenetically—several land plants were initially well characterized, while many other groups had only one member investigated and others, none at all. The majority of genomes sequenced early on were from the land plant group; in fact, the first three were tobacco, a liverwort, and rice (Sugiura 1992). In the past few years, however, this situation has happily improved for those of us interested in other lineages. Simpson and Stem state (2002) that we now have complete plastid genome sequences from virtually all the major algal lineages. One must assume that they do not consider the dinoflagellates a major algal lineage! What we do know of the chloroplast genome of the dinoflagellates will be explored in a later section. At any rate, there are presently 24 plastid genomes that have been sequenced in their entirety. These are representatives of plastids from green plants, green algae, red algae, cryptophytes, diatoms, apicomplexans, euglenoids and glaucophytes. The genome is 11 circular in most cases investigated so far, although in Toxoplasma gondii it exists in linear tandem arrays (Williamson et al. 2001). Although plastid DNA has traditionally been thought of as quite stable, Lilly et al. (2001) recently published a study which showed that only 45% of the cpDNA of tobacco and Arabidopsis is found in a circular form: the rest may be linear or multimeric, or even rearranged and incomplete. Moreover, between species, cpDNA can be extremely variable in structure, content and the motifs contained within it. For example, the non-photosynthetic plant Epifagus virginiana cpDNA encodes only 45 genes, while that of the red alga Porphyra purpurea contains 209 protein-coding genes alone (Reith and Munholland 1995, De Las Rivas et al. 2002). Generally, red algal cpDNA ranges in size from 150-191 kb, and while the green line plastid genomes reportedly vary from 89 to 1500 kb, most green cpDNAs are around 100-200 kb (Simpson and Stern 2002). Introns are present in low numbers in the land plants and are extremely rare in the rest of the cpDNAs with the exception of Euglena gracilis which has 155 (Hallick et al. 1993). A noticeable feature of the plastid genome in general is the presence of the inverted repeat—a large inverted duplication (Palmer 1991). This IR is a region of 0.5 to 76 kb in length and contains genes related to gene expression, such as ribosomal RNA (rRNA, transfer RNA (tRNA) and ribosomal protein genes. The inverted repeats separate the genome into a large single-copy region (LSC) and a small single-copy region (SSC). Often the change in the size of a plastid genome is attributable to a change in the inverted repeat region or IR (Buchanan et al. 2000). Most of the plastid genome sequences have an IR, but some do not. For example, the green alga Chlorella vulgaris has lost one of its 12 repeats. The red alga Porphyra purpurea has a direct repeat of its rRNA genes, rather than an inverted one, and Euglena gracilis has four tandem direct rRNA repeats (Reith and Munholland 1995, Hallick et al. 1993). Other important characteristics of these genomes lie in which genes have remained encoded there, without being transferred to the nucleus. There are several different functionally related groups of genes one can expect to find encoded in the plastid genome. The number of genes present in each cluster is different between species (Stoebe and Kowallik 1999). There are expression system genes, photosynthetic system genes (though not in Plasmodium falciparum, Toxoplasma gondii, or Epifagus virginiana as these are parasitic species) and genes with various functions, like fatty acid or phycobilisome biosynthesis. My project focuses on the photosynthetic genes, so the presence and absence of these genes will be further discussed. There are 4 complexes to consider: photosystem I, photosystem II, the cytochrome brf complex and ATP synthase. I will focus on the genes that all the cpDNAs have in common. For example, there are only three PSI genes found in every plastid genome sequenced so far: psaA, psaB, andpsaC. So farpsaA and psaB have been found clustered together in every genome (except dinoflagellates). As shown below in Table 1, psaC has not yet been found in any dinoflagellate. The plastid genomes have six photosystem II genes in common: psbA, psbB, psbC, psbD, psbE, and psbF. psbC and psbD are clustered together in every case. Al l of these genes except for psbF have been found in the dinoflagellates. From the cytochrome b<f complex, there are 4 genes in 13 common: pet A, petB, petD and petG, although Euglena lacks pet A and petD and Marchantia lacks petG. petD and petB are clustered together when both are present. The genes missing in dinoflagellates so far are petA and petG. ATP synthase genes are also well conserved in the plastid genomes. There are 5 genes found in all of the genomes: atpA, atpB, atpE, atpF, and atpH. The latter three have not been found in the dinoflagellates. Life in the Plastid As illustrated above, plastids definitely have lives of their own. Plastids in higher plants appear to have a vesicle transport system that may be involved in thylakoid formation and maintenance (Westphal et al. 2001). Chloroplasts also divide by fission inside their hosts, a process which appears to require both nuclear- and plastid- encoded proteins (Osteryoung 2000, Wakasugi et al. 1997). How is this activity coordinated with the nucleus of the host cell? Replication of the plastid DNA is an essential task. The major enzymes needed for plastid DNA replication include DNA polymerase, topoisomerase, DNA primase, helicase and DNA endonuclease (Kunnimalaiyaan and Nielsen 1997); many of these are encoded in the nucleus (Williamson et al. 2002). Although in higher plant chloroplasts there is a basic understanding of DNA replication, the process has been investigated in only a few of the other plastid-containing eukaryotes: Chlamydomonas reinhardtii, Euglena gracilis and Plasmodium falciparum (Williamson et al. 2002). The existing model, based on higher plants, involves the initiation of replication at two sites on the 14 chloroplast genome, called oriA and oriB. This initiation is done by displacement loops or D-loops (Kolodner and Tewari 1975a). The loops grow unidirectionally until they meet and replication then continues bidirectionally around the circle. After the daughter molecules are made, replication may continue by a rolling circle mechanism (Kolodner and Tewari 1975a). Williamson et al. (2002) state that they have found a similar story in the Plasmodium falciparum apicoplast, although they believe that the rolling circle replication may initiate on the template molecule itself rather than on the daughter molecules. As stated above, higher plants have both oriA and oriB. These replication origins are six to seven kb apart (Kolodner and Tewari 1975b), and are found in the inverted repeats of the genome containing duplicated tRNA and rRNA genes (Lu et al. 1996, Kunnimalaiyaan et al. 1997). Plasmodium falciparum has two replication origins each located in a large inverted repeat (Williamson et al. 2002). In Chlamydomonas reinhardtii there are also two replication origins (Waddell et al. 1984), but in Euglena gracilis there is one only (Koller and Delius 1982). oriA of Chlamydomonas reinhardtii is found within the chloroplast ribosomal protein gene rpll6 (Lou et al. 1987). It has been suggested that the processes of transcription and DNA replication are linked, and that transcription may activate a replication origin (Chang and Wu 2000). Indeed, the use of the same cpDNA sequence for transcription and DNA replication has been reported in several systems (Chang and Wu 2000). Both the Chlamydomonas reinhardtii oriA and the Euglena gracilis replication origin region are very AIT rich and can form multiple stem loop structures (Wu et al. 1986, Schlunegger and Stutz 1984). This area of Euglena 15 gracilis cpDNA contains multiple tandem repeats (Schlunegger and Stutz 1984), similar to Nicotiana tabacum, which has four direct repeats in oriA (Kunnimalaiyaan and Nielsen 1997). This type of secondary structure is typical of replication origins from bacteria to animals (Pearson et al. 1996). Transcription and translation of the plastid DNA is also necessary for survival. The genes in the plastid that encode the subunits that enable these activities are called "housekeeping genes", and include genes for ribosomal RNAs and ribosomal proteins, transfer RNAs, RNA polymerase, and translation factors. In land plants there are two plastid RNA polymerases: one is encoded in the plastid itself, is eubacteria-like, recognizes a eubacteria-like -10/-35 promoter element and is called PEP (plastid-encoded polymerase) (Smith and Purton 2002). The other RNA polymerase is encoded in the nucleus (NEP), is related to the T3/T7 bacteriophage and recognizes other, distinct promoters (Smith and Purton 2002). The algal genomes have only the plastid-encoded, eubacteria-like RNA polymerase. Genes encoding sigma-like factors controlling transcription are located in the nucleus, allowing nuclear control over transcription in the plastid. Interestingly, one sigma factor gene has been found in the nucleomorph genome of Guillardia theta (Douglas et al. 2001). Plastids have 70S ribosomes that contain about 60 protein components; the rRNA is encoded in cpDNA, while the proteins are encoded in both the nucleus and the chloroplast (Suguira et al. 1998). The photosynthetic genomes also contain 27 to 35 tRNA genes (Suguira et al. 1998). Although RNA editing occurs in higher plant 16 chloroplasts, there is as yet no evidence that it occurs in other plastids (Suguira et al. 1998, Bock 2000). Translation is essentially co-transcriptional and is more important in regulating protein expression than transcription (Eberhard et al. 2002). Danon (1997) suggests that translational regulation can respond to a changing environment more quickly than transcriptional control could. Light appears to be a major reason for this; its deleterious side effects require rapid control of the proteins in the photosynthetic apparatus (Danon 1997). As many translation factors are encoded in the nucleus, this further illustrates the control the nucleus has gained over the endosymbiont (Eberhard et al. 2002). Minicircles in Dinoflagellate Plastids In 1999 the first few dinoflagellate chloroplast gene sequences were reported by Zhang et al. They discovered that all of the genes they could recover were contained in unigenic minicircles. Minicircular DNA or plasmids are not unknown. Minicircles are known to encode guide RNAs in the mitochondria of the kinetoplastids (Simpson et al. 2000), and have been reported in the mitochondria of the mesozoan animal Dicyema misakiense (Watanabe et al. 1999). Persistent plasmids or extrachromosomal elements have been reported in the plastids of transformed Nicotiana tabacum and Chlamydomonas reinhardtii chloroplasts (Staub and Maliga 1994, Suzuki et al. 1997). Closed circular DNA (~15 kb in size) has been described in the chloroplast of the green alga Acetabularia cliftonii (Green 1976). Circular plasmids have also been studied in the diatom Cylindrotheca fusiformis; these plasmids hybridized to both chloroplast and nuclear DNA (Jacobs et al. 1992). The giant-celled green alga Ernodesmis verticillata 17 contains small (2.2 kb) linear extrachromosomal DNA encoding undefined sequences (La Claire II et al. 1998). No minicircles have been reported in other plastid genomes. The genus Heterocapsa was primarily studied by Z. Zhang in his PhD work, although other species were investigated as well. Minicircles were found in Amphidinium operculatum by Barbrook and Howe (2000) and Barbrook et al. (2001). They were also found in Amphidinium carterae by Hiller (2001). These minicircles all had conserved species-specific non-coding regions. As summarized in Table 1 below, the genes on minicircles in Heterocapsa triquetra were psaA, psaB, psbA, psbB, psbC, atpA, petB, 23 S rRNA and 16S rRNA (Zhang et al. 1999). In the Green lab, various people have found psbD, psbE andpetD in Heterocapsa triquetra, also on minicircles (V. Yee, E. Filek, unpubl.data). In Heterocapsa pygmaea, Heterocapsa rotundata and Heterocapsa niei the minicircles for psbA and 23S rRNA were also sequenced (Zhang et al. 2002). In Amphidinium carterae, minicircles containing psaA, psaB, psbA, psbD, psbE, atpA, petB and 23S rRNA have been sequenced (Hiller 2001). In Amphidinium operculatum, the sequences of the minicircles containing psaA, psbA, psbB, psbC, atpA, atpB, petB and petD have been recovered (Barbrook and Howe 2000, Barbrook et al. 2001). A minicircle in Protoceratium reticulatum for the 23 S rRNA gene was sequenced, as were two minicircles in Amphidinium carterae for psbA and 23S rRNA (Zhang et al. 2002). An interesting aside is that the minicircle for psbA from Amphidinium carterae—2311 bp— (Zhang et al. 2002) does not match with the one sequenced by Hiller, at 2520 bp (2001). Instead it matches with the Amphidinium operculatum psbA minicircle, which is 2311 bp long (Barbrook and Howe 2000). This implies that there may be a taxonomic 18 muddle involving at least one of these strains. This is shown in Table 1. A note at the end of Stoebe and Kowallick (1999) indicates that B. Stoebe and T. Laatsch have discovered unigenic minicircles in the peridinin-containing dinoflagellate Pyrocystis lunula but this information has remained unpublished. Gene Heterocapsa spp. Amphidinium spp. Other spp. Zhang et al. 1999 Others in Green Lab Barbrook and Howe 2000, Barbrook et al. 2001 Hiller 2001 Zhang et al. 2002 psaA V V V psaB V psbA V . V V Amphidinium carterae psbB V V psbC V V psbD V psbE V r atpB V atpA V v » petB V v» petD V V 23S rRNA V Protoceratium reticulatum A. carterae 16S rRNA V Table 1: Chloroplast genes found on minicircles in dinoflagellates (size of minicircles in kb) ^ Found on the same minicircle in Amphidinium operculatum * Found on the same minicircle in Amphidinium carterae p Found on the same minicircle in Amphidinium carterae The size of the all minicircles found so far lies within a relatively narrow range. Compared with the average plastid chromosome size, from 120 to 160 kb (Sugiura 1992), 19 these chromosomes are minuscule, and range from 2.2 kb (Heterocapsa pygmaea psbA) to 3.8 kb (Protoceratium reticulatum 23S rRNA) (Zhang et al. 2002). Exact sizes can be found on Table 2 below. Gene Heterocapsa triquetra Heterocapsa pygmaea Heterocapsa niei Heterocapsa rotundata Amphidinium operculatum Amphidinium carterae Size of minicircles sequenced (kb' ) psaA 3.0 2.4 2.6 psaB 3.1 2.3 psbA 2.2 2.2 2.3 2.3 2.3 2.5/2.3 (ZZ) psbB 2.3 2.3-2.4* psbC 2.3 2.3 psbD 1.8§ • 2.4 1 psbE 2.2 atpB SlBiillBllll fill!' 2.3-2.4* atpA 2.4 2.5 ' 2.6' petB 2.2 V • petD 1.6s 2.3-2.4* 23S rRNA 3.0 2.8 3.3 3.4 2.7/2.7 (ZZ) 16S rRNA 2.6 Table 2: Size comparisons of minicircles from Heterocapsa triquetra, H. pygmaea, H. niei, H. rotundata, Amphidinium operculatum, A. carterae. From Zhang et al. 1999, Zhang et al. 2002, Barbrook and Howe 2000, Barbrook et al. 2001, Hiller 2001. * Size not precisely specified in Barbrook et al. 2001 Circle contains two genes § Sequencing not completed Each of the minicircles had a conserved non-coding region that was species-specific. These non-coding regions contained motifs that were particularly highly conserved among the different circles in each species and have been called core regions or cores (Zhang et al. 2002). For example, in Heterocapsa triquetra the region is tripartite and centred on a runs of 9 adenine residues, with two regions each centred on a run of 20 guanine residues to the left and right. This has been called the 9G-9A-9G region (Zhang et al. 1999). The areas between the cores are not always conserved within the species however (Zhang et al. 2002). Conserved cores were also found in Amphidinium operculatum and A. carterae (Barbrook and Howe 2000, Barbrook et al. 2001, Hiller 2001), and in Heterocapsa pygmaea, H. niei and H. rotundata (Zhang et al. 2002). The conserved cores in each species are centred on highly conserved runs of three to nine nucleotides that may be A's, G's or T's (Zhang et al. 2002). These non-coding regions are capable of forming secondary structures of hairpins and loops and as such, may play a part in replication of the minicircle (Zhang et al. 2002). A generalized minicircle is shown in Figure 2B. Non-coding Coding region Figure 2B: Diagram of a generalized dinoflagellate chloroplast minicircle. An interesting development was the discovery of digenic minicircles. Amphidinium operculatum contains a digenic circle with atpA and petB, while A. carterae contains two digenic circles; one with atpA and petB, and one with psbD and psbE (Barbrook et al. 2001, Hiller 2001). In A carterae there is no overlap in the coding sequence between the 21 coding sequences of the gene pairs in either circle; rather, they are each separated by around 80- 120 bp (Hiller 2001). Barbrook et al. (2001) were not able to draw any conclusions concerning overlap between the two genes in A. operculatum. They were however able to say that petB and atpA are present on separate transcripts (Barbrook et al. 2001). Another remarkable development in the minicircle story was the discovery of "selfish" or "empty" circles. These are minicircles that possess the conserved non-coding region, but that do not contain recognizable coding sequence. They have been found in Heterocapsa triquetra (Zhang et al. 2001), Amphidinium carterae (Hiller 2001), and A. operculatum (Barbrook et al. 2001). Zhang et al. (2001) have proposed that these circles exist by virtue of their non-coding regions and contribute no gene products to the cell, thereby surviving as "selfish" DNA. In Heterocapsa triquetra the five selfish circles found contained incomplete and scrambled pieces of four genes — psbA, psbC, 23S rRNA and 16S rRNA (Zhang et al. 2001). In Amphidinium carterae one circle contained a small part of the 16S rRNA gene but in all other circles sequenced in this species no other gene pieces were identified (Hiller 2001). Amphidinium operculatum also had only one selfish circle with identifiable sequence; a piece of the 23 S rRNA gene was flanked by short pieces of the 16S rRNA gene (Barbrook et al. 2001). It has been suggested that these circles arose by homologous recombination at the conserved regions: 9G-9A-9G in Heterocapsa triquetra (Zhang et al. 2001). There may also be some "illegitimate" recombination happening between similar genes (such as 16S rRNA and 23 S rRNA) to create gene fragments within these circles (Zhang et al. 2001). Since all selfish circles 22 have species-specific non-coding regions, perhaps this is the case in the Amphidinium spp. as well. The size of these selfish or empty circles is different from coding minicircles as well. They tend to be smaller, with sizes ranging from 1.6 to 2.5 kb in Amphidinium operculatum (Barbrook et al. 2001), and 1.7 to 2.5 kb in Amphidinium carterae (Hiller 2001). In Heterocapsa triquetra the selfish circles ranged from 2.0 to 2.2 kb in size (Zhang etal. 2001). In further experiments, Zhang (Ph.D. thesis, 2000) surveyed the cpDNAs of other dinoflagellates, probing Southern blots of the DNA with spinach psbA and 23 S rRNA probes. cpDNA was labelled in three species at a higher molecular weight than in the Heterocapsa species. While Heterocapsa sp. were labelled at 2-4 kb, the DNA from Scrippsiella trochoidea, Prorocentrum micans and Adenoides eludens was labelled at 7-12 kb. These results were very interesting because they implied that these species do not contain minicircles as they are found in Heterocapsa, Protoceratium ox Amphidinium. Instead, these dinoflagellates may have genes on larger pieces of DNA. This possibility is intriguing and raises several questions. Questions 1. Are the plastid genes in Scrippsiella trochoidea, Prorocentrum micans and Adenoides eludens on minicircles or not? 2. Is only one gene present per circle, or is there more than one? 23 3. If a circle contains more than one gene, which ones are found together? 4. Is there more than one conserved coding region per circle in that case? Objectives 1. Further investigate the plastid genomes of Scrippsiella trochoidea, Prorocentrum micans and Adenoides eludens using Southern blots and 4 different Heterocapsa gene probes to see what size DNA each genes resides on. 2. After choosing one of the above species, use long PCR kit to amplify these larger molecules, then sequence them. 3. With the information gained from Objective 1, use primer pairs to see if these genes share a circle. 24 Chapter 2: Southern Blot Survey of Dinoflagellate DNA It was important to find out if other species had minicircles, and if so, their general size, and which DNA (e.g., main or satellite) they were found in. A Southern blot survey of various species using various chloroplast genes could accomplish this goal. Species Cultures of Adenoides eludens (NEPCC D683), Heterocapsa triquetra (CCMP 449), Scrippsiella trochoidea (NEPCC D602), and Prorocentrum micans (NEPCC D443) were grown in f/2 -S i medium at 18°C with 13 hours of light at 46.77 u.W/cm2 and 11 hours darkness. They were grown in 2 L flasks in 1 L of medium, in a Sherer growth chamber. Other than that of Heterocapsa triquetra, the cultures were not axenic; they may contain bacteria. A l l of these dinoflagellate species are peridinin-containing and thecate. DNA extraction Once cultures had reached log phase, DNA was extracted. This method was adapted from Boczar et al. (1991) by Zhang et al. (1999) and slightly modified by me. Cultures were spun at 4000 rpm in a Sorval RC-5B superspeed centrifuge in a GS A rotor for 15 minutes, the supernatant poured off, then two volumes lysis buffer (100 mM NaCl, 50 mM Tris, 100 mM EDTA, pH 8.0) was added. Proteinase K was added to 200 mg/mL solution, 1 volume autoclaved siliconized glass beads added (0= 0.5 mm), and 10% SDS was added to make up the solution to 2%. The tube was vortexed at top speed for 3 times 3 minutes, and then incubated at 50°C for one hour. The solution was mixed by inversion roughly every 15 minutes during this incubation. After 30 minutes incubation, the cells were checked to see the 25 proportion broken, and further vortexed if required. Generally I vortexed until roughly half the cells were broken. After the incubation, two extractions with phenol were performed, then with 50:50 phenohchloroform, then with chloroform alone. In some species, some of the solution was removed at this point to precipitate total DNA. Density-gradient centrifugation Cesium chloride was added to the above solution to 1.05 g/mL and the refractive index was adjusted to 1.3995 using an ABBE-3L refractometer (Bausch and Lomb) and more CsCl or TE buffer. The solution was pipetted into 5.1 mL Beckman Quick-Seal polyallomer tubes and Hoechst dye 33258 (bis-benzimide, Sigma) was added to the solution to give a final concentration of 50 ug/mL. The tubes were sealed and spun at 220 000 X g (55 000 rpm) in a vertical rotor (VTi80, Beckman) for 22 hours at 20° C with no braking. After the run, the tubes were carefully removed and the bands were extracted with syringes and 18 gauge needles. The extracted bands were washed with an equal volume of TE-CsCl-saturated iso-propanol to remove the intercalating Hoechst dye. This wash process was repeated a total of 6 times. Some species produce two bands from the protocol described above, while others may produce three or four. The number of bands present from a species may vary depending on the length and intensity of the vortexing step. When vortexed three times three minutes as described above, Scrippsiella trochoidea gave two bands, a main band and a satellite band, Prorocentrum micans gave a main band and two satellite bands, and 26 Adenoides eludens also gave a main band and two satellite bands. An illustration of the tube after the centrifugation is complete is found in Figure 3. The origin of the extra satellite band is unclear. As seen in the work following, it does not hybridize with the chloroplast gene probes. It may be mitochondrial in origin, or possibly the result of bacterial contamination. Figure 3: Tubes containing dinoflagellate DNA after ultracentrifugation with CsCl and bis-benzimide dye. A: species (eg., Scrippsiella trochoidea) with one satellite band. B: species (eg., Adenoides eludens, Prorocentrum micans) with two satellite bands. Precipitation of DNA For every mL of solution, 3 mL of dH^O and 8 mL of ice-cold 95% EtOH was added. The tubes were thoroughly mixed and then placed on ice for 30 minutes or at -20°C overnight to precipitate the DNA. The pellets were air-dried and dissolved in dH^O. 27 Southern blotting 500 ng of DNA from the satellite bands and either 500 ng or 1 ug of main band DNA from Adenoides eludens, Heterocapsa triquetra, Scrippsiella trochoidea, and Prorocentrum micans was electrophoresed in a 0.8% 0.5X TBE gel in 0.5X TBE buffer at 50 volts for roughly 7 hours (TBE is 0.45 M Tris-HCl, 0.45 M Boric acid, 10 mM EDTA, pH 8.0). The gel was longer than usual (from 14 to 20 cm) to allow good separation of the DNA. A photo of the gel with a ruler was taken and then the gel was prepared for transfer. First, the unused areas of the gel were trimmed away and the bottom right corner was cut for future orientation. The gel was rinsed with C1H2O, soaked in several volumes of 0.2 M HCI for 7 minutes, and again rinsed with d H 2 0 . It was soaked in several volumes of denaturing solution (1.5 M NaCl, 0.5 M NaOH) for 45 minutes, then in several volumes of neutralizing solution (1.5 M NaCl, 1 M Tris-HCl, pH 7.5) for 30 minutes, and finally a fresh change of neutralizing solution for a further 15 minutes. At this point the gel was ready for blotting onto Hybond-N+ (Amersham). The blotting apparatus was set up as illustrated in Sambrook et al. (1989) and transfer was accomplished with capillary action, using 10X SSC (1.5 M NaCl, 0.15 M Na-citrate, pH 7.0). Afterwards, the gel wells were marked on the membrane with pencil, and the gel was checked to ensure no DNA remained in it. The membrane was then baked at 80°C for 2 hours to fix the DNA. Hybridization and Detection—ECL Probes Probes were made using Heterocapsa triquetra satellite DNA and PCR primers designed by Zhauduo Zhang for psaA, psbC, and petD. These probes were labelled according to 28 the ECL Random Primers Labelling and Detection Kit instructions (Amersham International), although I found I needed to use several times the amount of DNA and enzyme suggested to get enough labelled probe. Blots were hybridized overnight at 45 to 48°C, washed at 32 to 40°C, and results detected according to the manufacturers' instructions. Hybridization and Detection—Radiolabeled Probes Probes were labelled with 50 uCi [a-32P] dCTP from Amersham Pharmacia using the Random Primed DNA Labelling Kit (Roche Molecular Biochemicals) according to the kit instructions. 20 to 30 ng DNA was denatured in 23 pL of dH20 and 1 uL each of dATP, dTTP, and dGTP, 2 uL of Random Primers Buffer Mix, 1 uL Klenow fragment, and 5 uL [o-32P} dCTP (50 uCi) was added and mixed gently. After incubation for 1 hour at 37°C, the excess radiolabeled nucleotides were removed using the Qiagen PCR Purification kit. Blots were probed using protocols from Sambrook et al. (1989). The blots were prehybridized in Church Buffer (0.25 M Na 2HP0 4, 1 mM EDTA, 7% SDS, pH 7.2) at 50°C for 3 hours. The radio-labelled probe was denatured in boiling water for 10 minutes, quenched on ice for 5 minutes, and added to fresh, warmed Church Buffer. The blots were hybridized with the probe at 50°C overnight, washed with low-stringency buffer (IX SSC, 0.1% SDS) at 50°C and exposed to Kodak film at -80°C for at least 24 hours before developing. 29 Results of Southern Blot Survey I used four species (Adenoides eludens, Heterocapsa triquetra, Scrippsiella trochoidea, and Prorocentrum micans) with three Heterocapsa triquetra gene probes (psaA, psbC, and petD) for the survey. I chose these three genes as probes for several reasons. The first was that Zhauduo Zhang had made PCR primers for Heterocapsa triquetra for them, so it would be straightforward to make probes. Another was that they were photosynthetic genes and were unlikely to hybridize to any bacterial DNA present in my dinoflagellate DNA. The third reason that I chose these particular genes was that they each represented a different complex in the photosynthetic apparatus: photosystem I, photosystem II and the cytochrome btf complex. These blots were probed using the ECL kit procedures in order to attempt to answer the questions: • Do these three species (Adenoides eludens, Scrippsiella trochoidea and Prorocentrum micans) have photosynthetic genes on minicircle-like DNA? • If so, what size are these circles? Are they larger than those found so far? psaA .' The PsaA protein is part of the core apparatus of photosystem I, and as such is involved in light-harvesting and facilitates the primary reactions involved in photosynthesis (Takahashi 1998). The protein is large, around 82 kilo-Daltons (kDa). Its importance means that it is generally well conserved. This blot was hybridized at 48°C and washed at 41 °C. The result of this blot is shown in Figure 4. 30 1 2 3 4 5 6 7 8 9 10 11 Figure 4: psaA blot using ECL detection kit. Lane I: 100 ng Heterocapsa triquetra satellite DNA (positive control), 2: empty, 3: negative control (FCP clone), 4: 1 pg Prorocentrum micans main DNA, 5: 500 ng Prorocentrum micans satellite 1 DNA, 6: 500 ng Prorocentrum micans satellite 2 DNA, 7: 1 ug Scrippsiella trochoidea main DNA, 8: 500 ng Scrippsiella trochoidea satellite DNA, 9: 1 ug Adenoides eludens main DNA, 10: 500 ng Adenoides eludens satellite 1 DNA, and 11: 500 ng Adenoides eludens satellite 2 DNA. The lane containing Heterocapsa triquetra satellite DNA has three faint bands at 1 kb, 1.2 kb, and 1.6 kb. These are smaller than those found by Zhauduo Zhang but it is difficult to estimate the true size of a minicircle based on gels alone. Discrete bands are also present in lane 11, the lane containing Adenoides eludens satellite 2 DNA, which showed interesting bands at 5.2 kb and 9.4 kb. The negative control in lane 3 (FCP plus vector) is also labelled. FCP stands for fucoxanthin chlorophyll a/c protein. The fact that it is labelled suggests that either there was a lot of non-specific binding of probe, or the psaA gene probe from Heterocapsa triquetra had an affinity to this molecule. I think the 31 former possibility is more likely as there are very dark streaks in lanes 4, 7 and 9. These lanes contained 1 pg of the main band DNA and are probably also due to non-specific binding. Given the nature of a survey, however, I decided that some non-specific binding was acceptable if it meant that one might detect the presence of psaA in the satellite DNA of these species. psbC The PsbC protein is also well conserved. It is an important part of photosystem II and involved in light-harvesting (Takahashi 1998). The protein is about 52 kDa. This blot was hybridized at 48°C and washed at 37°C. The lanes with specific results are shown below (Figure 5). 1 2 1—9.0 "5.0 1—3.0 —1.6 — 1.0 Figure 5: psbC blot using ECL detection kit. Lane 1: 100 ng Heterocapsa triquetra satellite DNA (positive control), 2: 500 ng Prorocentrum micans satellite 2 DNA, and 3: 500 ng Adenoides eludens satellite 2 DNA. 32 Again the Heterocapsa triquetra satellite DNA was labelled at around 1 and 1.2 kb. There were also faint bands at 1.8 kb and 2.3 kb in this lane. A very faint band was discernable at around 1.7 kb in the Prorocentrum micans satellite 2 DNA lane (lane 2). It was lane 3 however, that of Adenoides eludens satellite 2 DNA, that was the most exciting. There were bands discernable at 7.4 kb, 8.9 kb, 9.4 kb and 10 kb. A dark blur was present from 4.8 to 5.4 kb. Very faint bands were present from 2.5 to 3 kb and at 1.7 In contrast to the first two genes used as probes in the survey, the PetD protein is small, around 18 kDa. It is a subunit in the cytochrome btf complex and functions to bind the plastoquinone (Takahashi 1998). The lanes with results are shown below. This blot was hybridized at 50°C and as a result the bands are very light. The blot is shown below as Figure 6. 1 2 Figure 6: petD blot using ECL detection kit. Lane 1: 100 ng Heterocapsa triquetra satellite DNA (positive control), and 2: 500 ng Adenoides eludens satellite 2 DNA. kb. petD 1.0 H I 33 In this blot there were faint bands present in the Heterocapsa triquetra satellite DNA at 1.0 kb and 1.4 kb. There were also faint bands present in the Adenoides eludens satellite 2 DNA at 9.6 kb and 5.4 kb, which have been marked with arrows in Figure 6. There was no other binding of the probe detected. Summary of Results of Southern Blot Survey The results of the Southern Blot survey are summarized in Table 3. At this point I picked Adenoides eludens as the most interesting and likely candidate for further study. Because the probe labelled more than one band in the lane containing Adenoides eludens satellite 2 DNA, I thought it likely that the chloroplast of Adenoides eludens contained minicircles. This is because circular molecules tend to show up as several bands representing the linear, nicked (relaxed) and supercoiled forms of the molecule. Because the bands were of medium size, the possibility arose that the species had bigger minicircles than those found in Heterocapsa triquetra. Species Size of DNA hybridizing to Gene (kb) psaA psbC petD Heterocapsa triquetra 1, 1.2, 1.6 1, 1.2, 1.8,2.3 1.0, 1.4 Adenoides eludens 5.2, 9.4 1.7, 2.5-3,4.8-5.4, 7.4, 8.9, 9.4, 10 5.4, 9.6 Prorocentrum micans 1.7 ~ Scrippsiella trochoidea — — — Table 3: Results of Southern blot survey of four species of dinoflagellate (Heterocapsa triquetra, Adenoides eludens, Prorocentrum micans and Scrippsiella trochoidea) using Heterocapsa triquetra gene probes for psaA, psbC, and petD. Results show sizes of bands of DNA that hybridized to these probes. Bands were found in satellite DNA in each positive case (satellite 2 DNA for A. eludens and P. micans). 34 An interesting result was the consistent measurement of the minicircles from Heterocapsa triquetra as smaller than they truly are. Zhang et al. (1999) found through sequencing that the psaA minicircle was 3005 base pairs and the psbC minicircle was 2330 base pairs. My results, however, place these molecules at between 1 and 1.6 kb. It is important to keep in mind that Southern blots will not tell us the exact size of any DNA detected; these blots act as guidelines to give us a size range. In addition, the DNA used in my blots was not cut with restriction enzymes, and the minicircles may be in a supercoiled, relaxed circular, or linear form. The conformation of the molecule also affects its apparent size. psbA—Heterocapsa triquetra and Adenoides eludens After some work with sucrose gradients (see below) I switched to using radio-labelled probes for further experiments because I found the ECL kit inflexible; as dinoflagellate chloroplast genes are very divergent, it is difficult to predict the stringency required for blots. I did a further blot with Adenoides eludens and Heterocapsa triquetra total and satellite DNA, using psbA probes from each species. This experiment not only allowed me to confirm Zhauduo Zhang's results for the size of psbA DNA in Adenoides eludens, it also allowed me to compare the affinity of each species' probe in homologous and heterologous settings. The result of this blot is shown in Figure 7. 35 1 2 3 4 5 6 7 8 9 10 11 12 Figure 7: psbA blots using radiolabeled probes and total and satellite DNA from both Heterocapsa triquetra and Adenoides eludens. Lanes 1 to 6 hybridized with Adenoides eludens psbA probe. Lanes 7 to 12 hybridized with Heterocapsa triquetra psbA probe. Lanes 1 and 7: positive control—10 pg of Heterocapsa triquetra probe mixed with 90 pg of Adenoides eludens psbA clone (probe plus vector). 2 and 8: negative control, 100 ng of FCP clone. 3 and 9: 200 ng of Heterocapsa triquetra total DNA. 4 and 10: 200 ng of Heterocapsa triquetra satellite DNA. 5 and 11: 200 ng of Adenoides eludens total DNA. 6 and 12: 200 ng of Adenoides eludens satellite 2 DNA. These blots confirmed my other results and the previous work done by Zhauduo Zhang. The blot hybridized with Heterocapsa triquetra psbA (lanes 7 to 12) had a band present in the positive control lane (lane 7) at 0.6 kb and a faint one at 0.9 kb, and a faint band in the negative control (lane 8) at 2.1 kb. Strong bands were present in the Heterocapsa triquetra satellite DNA lane (lane 10) at 1.0 and 1.2 kb, while weaker ones were present at 1.8 kb and 2.3 kb. This is the same distribution as the bands in this DNA from the 36 psbC blot. A faint band was also discerned in the Adenoides eludens satellite 2 DNA (lane 12) at 1.6 kb. The blot hybridized with Adenoides eludens psbA (lanes 1 to 6) differed from the blot described above. In the positive control lane (lane 1) it labelled a band at 0.9 kb strongly, with a medium intensity band at 2.6 kb. No band is seen at 0.6 kb. The negative control (lane 2) was strongly labelled at 2.1 kb, with additional weaker bands at 4.3 and 4.9 kb. The Adenoides eludens probe labelled the Heterocapsa triquetra satellite DNA (lane 4) in the same manner and intensity as above, with strong bands at 0.9 and 1.2 kb, and weaker ones at 1.9 and 2.4 kb. The biggest difference between the two blots however was that the Adenoides eludens psbA probe labelled two additional bands in the Adenoides eludens satellite 2 DNA (lane 6) at 2.7 and 4.9 kb, as well as one at 1.5 kb. Overall these blots show that Adenoides eludens was better detected by Adenoides eludens probe than by Heterocapsa triquetra probe, although for Heterocapsa triquetra both probes labelled the DNA equally well. The blots also show that the copy number of psbA is higher in 200 ng of Heterocapsa triquetra DNA than it is in 200 ng of Adenoides eludens DNA. This is because the signal from Heterocapsa triquetra satellite DNA was much stronger than that from the Adenoides eludens satellite DNA, no matter which probe was used. The positive control lane containing the Heterocapsa triquetra and Adenoides eludens probe is somewhat mysterious. The Hetrocapsa triquetra probe is around 525 base pairs long, while that Adenoides eludens was around 850 base pairs. A piece of DNA of around 600 base pairs was detected in the blot hybridized with 37 Heterocapsa triquetra psbA probe, and in the blot hybridized by Adenoides eludens probe, the signal was higher, at around 900 base pairs. The mystery is that the Adenoides eludens probe was attached to a vector, so its signal should have been at a much higher molecular weight. Sucrose Gradient I decided to try to further characterize the Adenoides eludens DNA using a size-separation sucrose gradient. I tried several different methods of making the gradient, and measured the refractive index of each fraction using an ABBE-3L refractometer (Bausch and Lomb) to see which method gave the best gradient. I found that the smoothest, most continuous sucrose gradients could be made by very gently layering sucrose solutions of 30%, 20%, 10% and finally 5% sucrose (in 1.0 M NaCl, 100 mM Tris, 1 mM EDTA) in a tube (polyallomer, Beckman), laying the tube gently on its side for 4 hours at 10°C, then slowly turning it upright again. After loading 60 pg of Adenoides eludens total DNA, the tube was spun at 25 000 rpm in a swinging bucket rotor (SW41, Beckman) for 16 hours. When the run finished, a hole was pierced in the bottom of the tube with a 22 gauge needle, and 25 fractions of 500 pL were collected (about 6 drops each). Sucrose gradient Southern blot—untreated fractions 20 u.L of each fraction was run on a gel and a Southern blot was made according to the procedures outlined above. The blot was hybridized with Heterocapsa triquetra psbA probe using ECL procedures. The hybridization temperature was 49°C and the wash temperature was 39°C. The blot can be seen in Figure 8. 38 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Figure 8: Southern blot of sucrose gradient fractions using ECL kit protocols. Numbers above lanes correspond to fraction numbers. Molecular weights at right. The first thing to note about this blot is that every lane has a faint signal close to the well (wells were marked in black ink). This signal was strongest in fractions 6 through 9. There is also a signal partway down each lane, which became increasingly stronger from fraction 1 through 12. It is important to recall that DNA fragments in fractions at the beginning of the series are larger than the ones near the end because fractions are removed from the bottom of the tube. At fraction 10 this DNA signal begins to decrease in size, implying that the DNA fragment containing psbA is smaller. At fraction 14 the band becomes more diffuse. These trends continue until fraction 17 which is the last in which a signal other than that at the top of the lane can be detected. Sucrose gradient Southern blot—protease-treated and sheared fractions I decided to focus on certain subsets of the fractions to see if further information could be obtained. I wondered what the faint signal close to the well in the higher molecular weight fractions meant, and decided to try several different treatments and then blot again. Perhaps the circles I had previously observed in the satellite DNA were B^S? 39 complexed with protein in total DNA (recall that total DNA has not been through the CsCl gradient) or somehow concatenated. I chose to investigate fractions 5 through 8, and the treatments were shearing the DNA by passage through a 26-gauge needle, digestion with proteinase K or digestion with trypsin. The DNA was sheared by passing 25 pL of each fraction (5 through 8) through a 26 gauge needle 10 times. Proteinase K was added to 25 pL of each fraction to 200 pg/mL; the same was done for trypsin and both sets of digestions were incubated at 52°C for 1.5 hours. The fractions were then run with untreated samples, blotted, and probed using radio-labelled probes. The hybridization temperature was 50°C. The result is shown in Figure 9. Fraction 5 6 7 8 5 6 7 8 5 6 7 8 8 5 6 7 Shearing - - - . + + + + -Proteinase - - - - - - - - + + + + _ _ _ . K Trypsin Figure 9: Blot of fractions 5, 6, 7 and 8 with different treatments. Lanes 1-4: fractions 5-8 untreated. Lanes 5-8: fractions 5-8 treated by shearing. Lanes 9-12: fractions 5-8 treated with proteinase K. Lane 13 is fraction 8 treated with trypsin, and lanes 14-16: fractions 5-7 treated with trypsin. 40 The different treatments appeared to have no effect on the DNA in each fraction. Although the large faint bands present in the previous blot (Figure 9) have disappeared, this result is true of even the untreated fractions. Perhaps the large band was an artifact of the first blot. The only differences between the fractions lay in the relative intensity of the signal, which increased in each treatment from fraction 5 and was darkest at fraction 8. From this experiment it appears that the larger molecular weight DNA in the sucrose gradient was not associated with minicircles that were concatenated or somehow bound to proteins. Sucrose gradient Southern blot—restriction endonuclease-treated fractions I realized that more DNA was needed per fraction in order to obtain clear results. I decided to focus my efforts on fractions 15, 16 and 17 which appeared to have lower molecular-weight DNA (see Figure 8). The DNA was precipitated from 100 pL of each fraction with 2.5 volumes (250 pL) 95% EtOH and 0.1 volumes (10 pL) 3 M NaOAc (pH 5.2). The mixture was chilled on ice 30 minutes, spun at maximum speed for 5 minutes, then the supernatant was removed and the pellet dissolved in 20 pL dfbO. I decided to cut 500 ng of each fraction with three different restriction enzymes: EcoRI, Haelll and Xbal. 500 ng of uncut DNA of each fraction was also run as a control. A Southern blot was made, then probed with radio-labelled Adenoides eludens psbA probe. The result is shown in Figure 10. 41 Fraction 15 15 15 15 16 16 16 16 17 17 17 17 Haelll - + - - - + - - - + - -Xbal - + - - - + - - - + -EcoRI _ - - + - - - + - - - + 1 2 3 4 5 6 7 8 9 10 11 12 13 Figure 10: Blot of fractions 15,16 and 17 cut with different restriction enzymes. Lane 1: 200 ng Adenoides eludens satellite 2 DNA (control). Lane 2: fraction 15 uncut, lane 3: fraction 15 cut with Haelll, lane 4: fraction 15 cut with Xbal, lane 5: fraction 15 cut with EcoRI, lane 6: fraction 16 uncut, lane 7: fraction 16 cut with Haelll, lane 8: fraction 16 cut with Xbal, lane 9: fraction 16 cut with EcoRI, lane 10: fraction 17 uncut, lane 11: fraction 17 cut with Haelll, lane 12: fraction 17 cut with Xbal, lane 13: fraction 17 cut with EcoRI. There was no signal from the sucrose gradient fractions, whether digested or not. It may be that the amount of DNA used for the digestions was not enough, or perhaps the DNA precipitation protocol was incompatible with total DNA. Bands did appear in the control lane (lane 1—Adenoides eludens satellite 2 DNA) at 2.4 kb, 4.6 kb and 7.5 kb. These bands show some similarity with those from the psbA probed blot (Figure 7) which had bands in the Adenoides eludens satellite 2 DNA lane at 1.5 kb, 2.7 kb and 4.9 kb. In the 42 blot above there are also two faint bands in the control lane close to the well. These bands are at a very high molecular-weight (much larger than 12 kb); their size is not measurable with this method. Three more very faint bands are present below them. The smallest is around 12 kb, the other are larger but cannot be measured with much accuracy. A close-up of this lane is shown in Figure 11 below. Figure 11: Control lane 1 (Adenoides eludens satellite 2 DNA) from Figure 10 magnified to show banding pattern. Arrows indicate different bands. The overall signal from the blot in Figure 7 was weaker than from the blot in Figure 10 above, which may explain why the larger bands did not appear there. Figure 11 shows that Adenoides eludens has several pieces of DNA of varying size that give a signal for psbA. The strongest signals exist at 4.6 and 7.5 kb, but other bands were present at 2.4 kb, 12 kb, and larger. 43 With the precipitated sucrose gradient fractions I also attempted PCR using two sets of degenerate primers designed by Zhauduo Zhang for psbA. 150 or 160 ng from each fraction was used in reactions with 2.5 mM, 3 mM, 4 mM or 5 mM MgC^. An anneal temperature of 45°C was also used. Unfortunately no products were obtained. With these results I decided to stop working with the sucrose gradient fractions. The DNA they contained would not work in PCR reactions and did not appear to be able to hybridize in Southern blots very well. The problem with the blots may have been that there was not enough DNA present to give a signal. Another explanation for the malfunction of both the blots and the PCR may be that the DNA used in the sucrose gradient was dinoflagellate total DNA, which had not gone through the CsCl gradient. The CsCl gradient appears to "clean up" the DNA, perhaps by removing adhering proteins, polysaccharides or other contaminants. Conclusions This work led to several pieces of information. The first was that there are most likely minicircles of slightly larger size (5-9 kb) containing four different chloroplast genes (psaA, psbA, psbC and petD) in the chloroplast of the dinoflagellate Adenoides eludens. Larger pieces of DNA containing the gene psbA may also exist. If sucrose gradients are used to further separate the DNA, they should be done with DNA that has been through a CsCl gradient only, and a very large amount (>60 pg) should be used. 44 Chapter 3: TJnigenic minicircles in Adeoides eludens After deciding to focus on Adenoides eludens, my first goal was to sequence some Adenoides eludens chloroplast genes. Polymerase chain reactions (PCR) were a very important facet of my project. Not only did they help me to retrieve new sequences, they also allowed me to elucidate structural details of chloroplast DNA from Adenoides eludens. Methods Polymerase chain reaction PCR was done using a Progene thermal cycler from Techne. Each 50 pL reaction contained 100-200 ng template DNA (Adenoides eludens satellite 2 DNA), IX PCR buffer, 2-5 mM MgCl 2 , 0.2 mM dNTP's, 50 pmol each primer (if specific) or 150 pmol each primer (if degenerate), and 0.5 uL Sigma Taq (2.5 units). PCR reactions did not work when brands other than Sigma Taq were used. Although cycle conditions varied according to T m of primers and length of product, generally the following protocol was used. The cycler was pre-heated at 70°C for 2 minutes, then the reactions were put inside and denatured at 94-96°C for 2 minutes. 25-30 cycles followed: 94°C for 30 seconds, 40-57°C for 30-60 seconds, 72°C for 1-2 minutes, followed by extension at 72°C for 10 minutes. The anneal temperature of the cycle (40-57°C above) was generally set to 2-5°C below the lowest T m of the primers. This protocol was used to amplify short (< 2 kb) products. 45 Gel purification, cloning and plasmid DNA preparation After cutting the band of interest out of the gel (1% agarose, 0.5X TAE—see Appendix 2 for recipe), gel purification kits from either Qiagen or Mo Bio were used to isolate the DNA from the gel according to the kit instructions. PCR products were cloned into the pCR-TOPO 2.1 vector using the TOPO TA cloning kit and TOP 10 chemically competent E. coli cells (Invitrogen) according to kit instructions. An exception to the protocol was the addition of 6 pL of ligation reaction to the cells, rather than the 2 pL suggested by the kit. Plasmid DNA was prepared according to the standard protocol (Sambrook et al. 1989). Colonies were picked from agar plates after cloning and cultured overnight (14-16 hours) in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl, with the appropriate anitbiotic at 50 pg/mL) at 37°C with shaking (225-250 rpm). Cultures were transferred to 1.5 mL microcentrifuge tubes and spun for 5 minutes at top speed, after which the supernatant was removed. 100 pL of solution A (50 mM glucose, 10 mM EDTA, 25 mM Tris-HCl) was added to each tube and left to incubate for 5 minutes, then the pellets were resuspended and 200 pL of fresh solution B (0.2 M NaOH, 1% SDS) was added. The tubes were mixed by inversion (5X), incubated on ice for 5 minutes, then 150 pL of solution C (3 M potassium acetate, pH 4.8) was added to each tube and the tubes were vortexed. After 5-10 minutes on ice, the tubes were centrifuged again and the supernatant mixed with 450 pL of phenol and 450 pL of chloroform, then removed to a new tube. Two volumes 95% EtOH were added to each tube, which were well mixed and 46 incubated on ice for 20-30 minutes. The tubes were spun for 5 minutes, and the pellets washed with 70% EtOH. After another 5 minute centrifhgation, the pellets were dried and dissolved in 20-30 uL RNAse in dH 20 (20 ug/mL). Sequencing Sequencing reactions were carried out by me and the results analyzed by a ABI 373 or ABI 377 automatic sequencer by the Nucleic Acid and Protein Services (NAPS) unit. Each 20 pL sequencing reaction contained 4 pL BigDye v. 2 or v.3, 200-500 ng plasmid DNA, and 3.2 pmol sequencing primer (M13F or M13R). The reactions were carried out in a Progene thermocycler (Techne) for 30 cycles of 94°C for 5 seconds, 50°C for 10 seconds, then 60°C for 4 minutes. The reactions were precipitated by adding four volumes 75% isopropanol, mixing well, and incubating at room temperature for 2-4 hours. Reactions were centrifuged at top speed for 20 minutes, the supernatant was immediately removed and the walls of the tube were dried with a Kimwipe to remove excess dye terminators. The pellet was washed with 250 uL 75% isopropanol and air-dried before being sent to the sequencing lab for analysis. Primers Both degenerate and specific primers were used to generate PCR products. The sequences of these primers can be found in Appendix 1. I used degenerate primers for psbD designed by K. Ishida and V. Yu, degenerate primers for dinoflagellate psbA designed by Zhauduo Zhang, and specific primers for Heterocapsa triquetra psaA, psaB, psbB, psbC, psbE, atpA, petB and petD also designed by Zhauduo Zhang. When 47 designing primers myself I made them 22-25 base pairs in length and with a GC content of 45% to 55%. My main interest was the melting temperature or T m of the primer; for sequencing I aimed for a T m between 55°C and 60°C while for long PCR primers (see below) my goal was a T m of 60°C to 65°C. ' Results By using the protocols described above, I obtained chloroplast gene sequences for psbA, psbC, and psbD from Adenoides eludens. PCR was done using the primers listed above (see Appendix 1), Adenoides eludens satellite 2 DNA, MgCb concentrations of 0 mM, 2 mM, 2.5 mM, 3 mM, 4mM and 5 mM, and annealing temperatures of 40°C and 45°C. These reactions amplified many products. After cloning and sequencing several of them, I found that three of them had matches in GenBank. These three were psbA, psbC, and psbD. The other sequenced products were probably the result of bacterial DNA being amplified, as they had no chloroplast gene matches in the database and had low AT content (50% or less). psbA The sequence of psbA from Adenoides eludens was obtained using degenerate primers. The sequence is 535 base pairs long and covers amino acids 54 to 339 (possible total is 345 to 348) of the psbA gene in other dinoflagellates, with -89% identity. The sequence is 59% A/T. This sequence was obtained from several clones with very little sequence heterogeneity. 48 psbD The sequence of psbD from Adenoides eludens was also obtained using degenerate primers. It is 779 base pairs long and covers amino acids 62 to 317 of the same gene in Amphidinium carterae, which is 355 amino acids long. It shares 80% identity with that sequence. This sequence is 64% A/T and was also obtained from sequencing several clones. There was also almost no sequence heterogeneity amongst these clones. psbC The sequence of psbC from Adenoides eludens was obtained using primers specific for Heterocapsa triquetra psbC. The results of sequencing this gene were surprising. After it was cloned, five different clones were digested with the restriction endonuclease EcoRI to check the success of the cloning. The insert had an EcoRI site, which meant that it was cut as well. Of the five colonies picked, only two had the same pattern; the rest had slightly different sized bands. Three of the clones were sequenced and the sequences compared. The alignment of these sequences is shown in Figure 12. There were extensive areas of agreement between the three sequences, but there were also areas in which one sequence varied wildly from the other two, usually by having sequence missing or by having extra sequence. There were also regions in which single nucleotides were different. These areas of variation are highlighted in Figure 12. There were no regions in which all three sequences varied, but all three sequences varied from the other two at one point or another. The length of the first sequence was 769 nucleotides, that of the second was 858 nucleotides, and the length of the third sequence was 787 nucleotides. A/T content of the three varied from 61% to 64%. 49 C1BFR TGGTCTCTATGACACTTGGGCTTCTGGTGGTGGGGATATTAGACTCATTAAGGATAGTAG C1DFR TGGTCTCTATGACACTTGGGCTTCTGGTGGTGGGGATATTAGACTCATTAAGGATAGTAG C1CFR TGGTCTCTATGACACTTGGGCTTCTGGTGGTGGGGATATTAGACTCATTAAGGATAGTAG ************************************************************ C1BFR TCTTAGCTACGATCTT ACGATGGCAA TCTG-C1DFR TCGTAGCTACGATCTT-j^ -^GATGGCAA-^— -_- - - - -TCTG-C1CFR CCTTAGCTTAAATCCTJATGTG^ * * * * * * *** * * * * ** * * * * C1BFR TTGTTGGTATGGAAGATCTGATAGGTGGTCATTATTGGGTTGC C1DFR - - -_ -_- - -TTGTTGGTATGGAAGATCTGATAGGTGGTCATTATTGGGTTGC C1CFR AGGCTGGATAATGAGTATC^ TAATATGGAAGATCTGATAGGTGGTCATTATTGGGTTGC * * ************************************ C1BFR ACTTTTCACTATTCTAGGTGCCATATGGCATATTATCTCAAGACCTTTTGGAATGTATGC C1DFR ACTTTTCACTATTCTAGGTGCCATATGGCATATTATCTCAAGACCTTTTGGAATGTATGC C1CFR ACTTTTC7VCTATTCTAGGTGCCATATGGCATATTATCTCAAGACCTTTTGGAATGTATGC ************************************************************ C1BFR AAGAGGTTTCTTGTGGTCAGGTGAAGCTTATTTAGCTTACAGTTTATCAGCTATAGCTTT C1DFR AAGAGGTTCCTTGTGGTCAGGTGAAGCTTATTTAGCTTACAGTTTATCAGCTATAGCTTT C1CFR AAGAGGCTTCTTGNGGNCAGGTGAAGCTTATTTAGCTTACAGTTTATCAGCTATAGCTTT ****** * **** ** ******************************************* C1BFR ATGTGGTTCTATAGCAGCTATGTATTCATGGTACAATAACACTGCATACCCAAGTGAATT C1DFR ATGTGGTTCTATAGCAGCTATGTATTCATGGTACAATAACACTGCATACCCAAGTGAATT C1CFR ATGTGGTTCTATAGCAGCTATGNATTCATGGTACAATAACACTGCATACCCAAGTGAATT ********************** ************************************* C1BFR CTATGGGCCTACGGCAGAAGAAGCTTCTCAAGCACAAAGGTTTACATTTTTGGTACGTGA C1DFR CTATGGGCCTACGGCAGAAGAAGCTTCTCAAGCACAAAGGTTTACATTTTTGGTACGTGA C1CFR CTATGGGCCTACGGCAGAAGAAGCTTCTCNAGCACAAAGGNTTACATTTTTGGTACGNGA ***************************** ********** **************** ** C1BFR CCAGAAATTAGGTATCAAAATTCTCTCATCTGAAGGACCTACAGCTTTGGGTAAGTATCT C1DFR CCAGAAATTAGGTATCAAAATTCTCTCATCTGAAGGACCTACAGCTTTGGGTAAGTATCT C1CFR CCANAAATTAGGTATCAAAATTCTCTCATCTGAAGGACCTACAGCTTTGGGTAAGTATCT *** ******************************************************** C1BFR AATGAGATCTCCTACTC3GTGAGATAATATrTGCnX»£ C1DFR AATGAGATCTCCTACTGGTGAGATAATATTTGGTGGCTTAGCTTI^  C1CFR AATGAGATCTCCTACTGGNGAGATAATATTTGGTGGCTTAGCTTTTCTCTTACAAGCATC ****************** ***************** ** ** *** C1BFR ggjjgjjki^ ^ CIDFR TCTGAACAAGGTATTTA^ C1CFR TGTGAACAAGGTATTTATGATTTATGCACCTTGAGAATCTTCGAGATTCATTTCCTTTGT * ** *** * * * * **** * * ** ****** *** C1BFR ACATT TCTAA-- -AATTCAATCTGATATTCAAACTTGGCAAGAGAGACG CIDFR GCACTAAAGATGGTGATCTATCCTAATTCAATCTGATATTCAAACTTGGCAAGAGAGACG C1CFR GCACTAAAGATGGNGATCTATCCTAATTCNATCTGATATTCAAACTTGGCAAGAGAGACG ** * **** ***** ****************************** C1BFR TGCAGCAGAGTACATGACTTCTGCACCATTAGGTAGTTTAAATTCTGTTGGTGGTGTTGC CIDFR TGCAGCAGAGTACATGACTTCTGCACCATTAGGTAGTTTAAATTCTGTTGGTGGTGTTGC C1CFR TGCAGCAGAGTACATGACTTCTGCACCATTAGGTAGTTTAAATTCTGTTGGTGGTGTTGC ************************************************************ C1BFR TACAGAAATAAATTCTATTAATTATGTATCACCTAGATCTTGGTTAACCTCTCGGCATTG CIDFR TACAGAAATAAATTCTATTAATTATGTATCACCTAGATCTTGGTTAACCTCTTGGCATTG C1CFR TACAGAAATAAATTCTATTAATTATGTATCACCTAGATCTTGGTTAACCTCTTGGCATTG **************************************************** ******* C1BFR GACTTTAGGATATTTCATCCTTG^^^j^-_- --_-- ZZZ'ZZZZZZ CIDFR GACTTTACX»TATTT(^TCCITOT C1CFR GACTTTAGGATATGffiGTCATGC * * * * * * * * * * * * * ** * C1BFR - -_- _ - - - CGTGSGTTATCTCGGATTTATGAACCAGTCCTTTATATGCGT CIDFR TCCMTATCAAGTGA^ C1CFR - -" -ATTATCAAGTGAACGTGGGTTATCTCGGATTTATGAACCAGTCCTTTATATGCGT **** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Figure 12A: Alignment of psbC nucleotide sequences using ClustalW. Variable regions highlighted. 50 When put through BLASTX (translated query searching against a protein database) or when translated and aligned, these sequences showed further differences. The BLASTX results showed that two of the sequences (C1B and C1D) had a frameshift mutation near the start of the sequence. Only sequence C1C had no frame shift in this area when compared to psbC in Heterocapsa triquetra. In the centre of the sequence, both sequences C1C and C1D contain gaps, while that of C1B has no gaps compared to psbC in Heterocapsa triquetra. Finally, both sequences C1B and C1C had frameshift mutations near the end of the sequences, while C1D had a complete correct sequence compared to psbC in Heterocapsa triquetra. It appears that each of these sequences is correct (compared to psbC in Heterocapsa triquetra) in a different region; C1C at the beginning, C1B in the middle, and C1D at the end. Moreover, the "incorrect" sequences in each region match one another. These patterns are mirrored in Figure 12A above. Amino acid alignments of various regions of the three sequences is shown in Figure 12B below. 51 2 c l b G L Y D T W A S G G G D I R L I K D S S L S Y 2 c l d G L Y D T W A S G G G D I R L I K D S S R S Y 2 c l c G L Y D T W A S G G G D I R L I K D S S L S L * * * * * * * * * * * * * * * * * * * * * B 3 c l b V S M T L G L L W G I L D S L R I W L A T I L R W Q S W G M E D L I G G H Y W 3 C1 d V S M T L G L L W G I L D S L R I V W A T I L R W Q S W G M E D L I G G H Y W 2 c l c G L Y D T W A S G G G D I R L I K D S S L S L N P Y W G - - R Y L V R A P L G S E G W I M S I N N M E D L I G G H Y W *..*_ *** * _ * . ********** 3 C lb V A L F T I L G A I W H I I S R P F G M Y A R G F L W S G E A Y L A Y S L S A I A L C G S I A A M Y S W Y N N T A Y P S 3 c l d V A L F T I L G A I W H I I S R P F G M Y A R G S L W S G E A Y L A Y S L S A I A L C G S I A A M Y S W Y N N T A Y P S 2 c l c V A L F T I L G A I W H I I S R P F G M Y A R G F L X X G E A Y L A Y S L S A I A L C G S I A A M X S W Y N N T A Y P S * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3 c l b E F Y G P T A E E A S Q A Q R F T F L V R D Q K L G I K I L S S E G P T A L G K Y L M R S P T G E I I F G G K T M R F W 3 c I d E F Y G P T A E E A S Q A Q R F T F L V R D Q K L G I K I L S S E G P T A L G K Y L M R S P T G E 1 1 F G G L A F L L Q 2 C1C E F Y G P T A E E A S X A Q R X T F L V R D X K L G I K I L S S E G P T A L G K Y L M R S P T G E 1 1 F G G L A F L L Q * * * * * * * * * * * *** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * . . . 3 C lb SMEG G W V E P L R T S F G L D I S K I Q S D I Q T W Q E R R A A E Y M T S A P L G S L N S V G G V A 3 c l d A S V N K V F M I Y A P E S S R F I S F V H R W - S I L I Q S D I Q T W Q E R R A A E Y M T S A P L G S L N S V G G V A 2 c l c A S V N K V F M I Y A P E S S R F I S F V H R W X S I L I X S D I Q T W Q E R R A A E Y M T S A P L G S L N S V G G V A . * . * . * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3 c l b T E I N S I N Y V S P R S WLTSRHWTLGYFI L A V I S D L T - - S P L Y A 3 c l d T E I N S I N Y V S P R S W L T S W H W T L G Y F I L V G H W W H G G R A R G H A L S S E R G L S R I Y E P V L Y M R 2 c l c T E I N S I N Y V S P R S WLTSWHWTLGYEVMH Y Q V N V G Y L G F M N Q S F I C - -* * * * * * * * * * * * * * * * * * * * * * * . . . . : Figure 12B: Alignment of psbC amino acid sequences using ClustalW. A is an alignment of frame +2 of each sequence; B is an alignment of frame +3 of sequences C1B and C1D and frame +2 of sequence C1C. Two of these gene sequences, psbA and psbD, were obtained using degenerate primers, while only one set of specific primers, those for Heterocapsa triquetra psbC, yielded the product of interest (psbC). It is obvious then that degenerate primers are the easiest and fastest way to acquire these sequences. Dinoflagellate chloroplast genes are very divergent (Zhang et al. 1999). This means that they are difficult to amplify using degenerate primers, as the "conserved" regions may not be similar enough to other 52 species to predict. I discovered the truth of this for myself as I attempted to design degenerate primers for psaA and petD. Having these gene sequences as well as those for psbA, psbC and psbD seemed to be a good idea as all of them (except psbD) had been used as probes in the Southern blot survey. Unfortunately after designing two sets of primers for each gene that failed to amplify the right product I decided to focus on the genes for which I had sequence. Outward P C R From my Southern blots, it appeared that chloroplast genes in Adenoides eludens resided on medium-sized, circular DNA. One way to test this idea would be to design primers that faced in the opposite direction to those that amplified the original sequence. If the original sequence lay on a linear molecule, or a circular molecule so large it could not be amplified by PCR, no product could result. If the sequence lay on a small circular molecule, there would be a product. This idea is illustrated in Figure 13. 53 Figure 13: Outward PCR. Conventional, inward PCR with inward-facing primers give a product (A). Outward-facing primers with a linear template give no product (B), while outward-facing primers and a circular template will give a product (C). In designing outward-directed primers, I followed the same rules as those outlined above, aiming for a T m of 60°C to 65°C. I used the sequence information gained from the experiments above to design both outward- and new inward-directed primers. The outward primers were "inside" the region covered by the inward primers so that there would be overlap in the products. This scheme is illustrated in Figure 14. 54 Reverse outward (Ro) Forward outward (Fo) < 1 Forward inward (Fi) Reverse inward (Ri) Figure 14: Diagram showing relative positions and names of the four types of primers: forward inward (Fi), reverse inward (Ri), forward outward (Fo) and reverse outward (Ro). Long PCR From the Southern blot evidence it seemed likely that the minicircles, if they existed, would be larger than those in Heterocapsa triquetra. Therefore it seemed wise to employ a PCR technique that could handle larger products. Because Sigma Taq had been able to amplify chloroplast gene sequences from Adenoides eludens I decided to use the Sigma AccuTaq LA (Long Accurate) DNA Polymerase Mix. This is an enzyme mix made by Sigma that has a proofreading capability that allows it to repair terminal misincorporations: the manufacturers claim that it can amplify products of up to 20 kb from genomic templates (Sigma, AccuTaq LA DNA Polymerase Mix Product Insert). The reaction conditions for long PCR differed from the conditions for regular PCR in several ways. Each 50 pL reaction contained IX PCR buffer, 500 pM dNTP's, 25-200 ng template DNA, 600 nM (30 pmol) each primer and 2.5 units of enzyme mix. The 55 PCR buffer contained 2.5 mM MgCb. and for some reactions I added more MgC^ to bring the concentration to 3 mM, which was the optimum level for the reactions tested. Long PCR was carried out in a Progene thermal cycler (Techne). The machine was pre-heated at 70°C for 2 minutes, after which the reactions were put inside. They were denatured at 98°C for 30 seconds, then 27 to 30 cycles followed: 94°C for 15 seconds, 55-60°C for 20 seconds, then 68°C for 20 minutes. This was followed by an extension period of 68°C for 10 minutes. Although it was suggested by the product information, adding DMSO was not useful. Using the above protocol with outward-facing primers for psbA, psbC and psbD (see Appendix 1 for primer sequences), I was able to amplify products of roughly 4.5 to 5 kb for each gene. The products can be seen in Figure 15. 1 2 3 4 4.1 kb Figure 15: Products of long PCR using outward-facing primers and Adenoides eludens satellite 2 DNA. Lane 1 is kb ladder, lane 2 is the product from psbA primers, lane 3 that of psbD primers, and lane 4 that of psbC primers. 56 The psbA product was 4.5 kb, the psbD product was slightly larger at 5.0 kb, and the psbC product was smaller than the first two, at 4.2 kb. Al l three of the products separated slightly when run longer down the gel. This separation is visible in lane 3, Figure 15 above; the psbC product actually has two bands only a hairsbreadth apart. When run longer on a gel, the psbA product resolved into bands at 4.1 kb, 4.3 kb and 4.6 kb. The psbD product resolved into fours bands of 4.1 kb, 4.3 kb, 4.7 kb and 5.1 kb. The product from psbC primers resolved into 2 bands of 4.7 and 5.2 kb. The evidence suggests that Adenoides eludens satellite 2 DNA contains minicircles. This evidence has two parts. The first is the fact that the PCR worked at all. As shown in Figure 14, no product should have been amplified from the outward-directed primers unless the template was circular. Additional evidence that the products of these PCR experiments were truly amplified from minicircles is that they were all close to the same size. In other cases the circles have been close to uniform in size within the species (Barbrook and Howe 2000, Barbrook et al. 2001, Hiller 2001, Zhang et al. 1999). The presence of minicircles in Adenoides eludens cannot be shown conclusively however without obtaining the sequence of these products. The sequence is necessary for several reasons. The first is to verify that the long PCR products are not merely "junk" DNA that had been amplified by accident; that is, that the outer ends of the gene in question are present on the products, as illustrated in the product of case C, Figure 14. The second is to find out if there are other genes or open reading frames on these products. The 57 products were certainly large enough to contain another gene. Lastly, sequencing some of these products should reveal motifs or non-coding regions analogous to those in the other minicircles sequenced. This information could help not only to find more minicircles in Adenoides eludens, and perhaps more chloroplast genes, but also to help us understand more of the function of these regions. With this goal, I set out to sequence the product from the psbA primers. My first approach was using direct sequencing. Direct Sequencing of L o n g P C R Products Direct sequencing uses the PCR product as a template and one of the PCR primers as a sequencing primer. It is a fast method for getting sequence because one can produce a fragment with PCR and sequence it immediately after purification. This method is useful for getting a consensus sequence of a region of DNA as it uses a population of molecules that may vary slightly from one to another as a template. This is different from sequencing from a clone, where one is sequencing from one individual PCR product that has been separated from the rest. In each direct sequencing reaction 100 ng of PCR product (as opposed to 200-500 ng DNA for plasmid DNA sequencing), 3.2 pmol of primer, and 4 pL of BigDye v.3 or v.3.1 dye terminator mix were used. The direct sequencing method requires the PCR primer to have a T m of 55°C to 60°C. The reaction was run as sequencing reactions described above and precipitated using isopropanol precipitation (also see above). The direct sequencing method was successful for the first reaction attempted, using the long psbA PCR product and the psbA Ro primer, and roughly 700 base pairs of useable sequence 58 was obtained. Upon completing BLASTN and BLASTX searches the sequence obtained was determined to be part of psbA. Specifically, the sequence corresponded to the N-terminus of the psbA gene of numerous dinoflagellates in the database. This sequence is shown in Figure 16 as it fits onto the proposed minicircle. psbA Figure 16: Diagram ofpsbA minicircle. The solid area is the known sequence of psbA; the striped area is the region successfully direct-sequenced by the Reverse outward psbA primer (AEbARo). The new sequence was extremely similar to the N-terminal regions of other psbA genes in the GenBank database. In order to be successful, this method would have to be repeated over and over as I walked along the 4.5 kb span of the product. As part of this plan of action, I designed a new primer, AEbARo2 (see appendix 1 for sequence), from the end of the sequence obtained from the first step. After completing the protocols above, the results were puzzling. The sequence continued for roughly 100 base pairs, then degenerated into mixed signal. The experiment was repeated with the same result. The signal did not end; rather, there seemed to be more than one trace present in the sequencing results. The degeneration of sequence occurred at the gene boundary, at the N-terminus or 5' end of psbA. Mixed signal was also obtained when direct sequencing was done using the psbA Forward outward primer (see Figures 14 and 16). The forward outward primer (AEbAFo) is located much closer to the C-terminus or 3' end of the gene than the reverse 59 outward primer (AEbARo) is to the N-terminal (5') end. This may explain the mixed signal obtained in the first step using AebAFo; the gene ends close to the primer location. These results are shown in Figure 17 below. Figure 17: Diagram of results of direct sequencing using psbA long PCR product from outward-facing primers. The experiments above were also attempted with the PCR product from psbD outward primers, using the psbD Ro primer to sequence. The resulting sequence was of good quality and BLASTN and BLASTX searches showed that it corresponded to the N-terminal or 5' end of the psbD gene from a dinoflagellate and a red alga. Unfortunately, a second sequencing step using a primer designed from sequence near the end of the first step (psbDRo2) gave no distinct sequence. The psbDRo2 primer was designed from a region of the sequence that lay just beyond the psbD gene boundary. The signal was mixed after the psbD gene's 5' or N-terminal boundary. The situation concerning psbD is very similar to that shown in Figure 17 above. psbA PCR product Fo Ro psbA template molecule Sequence clear Sequence mixed 60 These results were useful for several reasons. The first was that they confirmed that the products amplified using the outward primers were specific and contained the genes of interest. This means that Adenoides eludens does indeed contain minicircles. These results also led me to believe that there was heterogeneity of sequence beyond gene boundaries in the PCR products from the psbA and psbD outward primers. The mixed signals indicated that the sequencing reactions were working, but likely had more than one template, which obscured any clear sequence from emerging. As mentioned above, direct sequencing uses a population of PCR products as a template, not a single molecule that has been isolated such as in cloning. The results of the above sequencing attempts, taken with the multiple bands produced from running the PCR products longer on gels, imply that there is more than one minicircle that is amplified from each set of chloroplast gene outward primers. The fact that clear sequence was obtained for the genes themselves, however, implies that these different minicircles do contain the same sequence for the genes (psbA and psbD) they carry. Cloning Methods The best approach for getting the sequence of one of these products seemed to be to try to clone them, or pieces of them. There were two options: the first was to cut a product with restriction enzymes, ligate some of the pieces into a vector, then sequence the pieces. The second method was to clone an entire product using a kit specialized for large products, then sequence it by walking from both ends. I decided to try both methods. 61 The first method was cloning using restriction fragments. This experiment was attempted using the PCR product from psbC primers and the restriction endonuclease Hindlll. It was not successful. The most likely reason for this is that many purification steps were required before the insert was ready to be ligated. Each purification step decreased the total amount of DNA available to be cloned. In the end, there was not enough DNA for the experiment to work. At this point however, I had already moved on to the process below. The second method, cloning using a kit, was very straightforward. The kit used was called TOPO X L PCR Cloning Kit (Invitrogen). This kit uses crystal violet dye and visible light instead of ethidium bromide and UV light to visualize the PCR product in the gel. This decreases the amount of DNA damage and consequently increases cloning efficiency. The kit also contains a vector (pCR-XL-TOPO) which is designed to ligate large products—3 to 10 kb. Using the kit, I was able to clone the PCR product from psbA primers. The results from this cloning experiment were interesting. After 18 colonies had been picked and DNA minipreps made from each of them, a restriction enzyme digestion was done using EcoRI to check the cloning success. This digestion showed that not only had the cloning worked, but also that the inserts showed different fingerprints. There were three different types of digestion patterns of the insert. These patterns are shown in Figure 18. 62 Figure 18: Gel showing EcoRI restriction endonuclease digestion of X L psbA product clones. Each lane in Figure 18 shows the linearized vector at around 3.5 kb. The first type of clone is one in which the insert was not digested at all. This is shown in lanes 10 and 17 of Figure 18 above, with the insert as the top band. The second type is that in which the insert was digested in one place, leaving two bands. The smaller band may vary in size. This type is illustrated in lanes 4, 6, and 15 above. The final type of insert was digested in several places resulting in three or four bands on the gel. This type is seen in lanes 8, 12 and 18 of Figure 18. Several of these clones were sequenced. This part of the project is presented and discussed in Chapter 4. 63 Chapter 4: Sequence of psbA long P C R product clones Sequencing Large Clones Large clones were sequenced using similar protocols to those described above, but with 400-500 ng of DNA. Eventually it became clear that the sequence quality was greatly improved if the template cloned DNA was made using a Qiagen Mini Plasmid Prep kit instead of traditional alkali lysis techniques, so a change was made. After each cloning step, a new primer was designed roughly 500 to 600 base pairs from the previous one, according to the guidelines listed above. Clones 6, 8, 12, 15, 17 and 18 (see Figure 18) representing each type of insert were started in this endeavour. Unfortunately clones 6 and 8 were lost. By walking along the clones in the manner described above, one could span the insert in roughly 7 to 8 steps, moving in from both sides. The completed product was roughly 4300 base pairs long. The task of designing primers was complicated by the nature of the sequence; both inverse and short direct repeats were scattered throughout the non-coding region. Designing a primer to one of these conserved repeats (primer bAF3, see Appendix 1) resulted in sequence with two or more traces and ambiguous base calling. A primer made to an inverse repeat can self-anneal or form a hairpin. These difficulties along with those inherent in working with 8 kb-sized clones caused this process to take several months to complete, resulting in sequence for one of the clones. Unfortunately the other three clones (12, 17, and 18) were much more difficult. An enormous aid in this endeavour was the help of the staff at the NAPS (sequencing) unit, who donated a Qiagen miniprep kit to improve template DNA quality and reran each sequencing reaction to 64 increase the quality and length of the reads. The first sequencing steps yielded the missing ends of the psbA gene. These sequences overlapped with those from the inward primers. The maps of sequences from clone 12, 15, 17 and 18 can be seen in figures 19, 20, 21 and 22, respectively. Al l gene sequences (ie., the ends of psbA) were identical among clones. The C- terminal end of psbA had 176 base pairs encoding amino acids that matched amino acids 288-345 of the Gonyaulax polyedra PsbA protein. This region was the same in all psbA clones and the psbA end of the combination PCR product clone discussed in Chapter 5. There was a TAA stop codon at the expected spot. The N-terminal end of psbA had 667 base pairs encoding amino acids matching amino acids 1 to 223 of the Gonyaulax polyedra PsbA protein. This region was the same in all psbA clones and the psbA PCR product direct sequence. There was a TTG start codon at the expected spot. This is consistent with the start codons in chloroplast-encoded protein genes of other species of dinoflagellate; such codons may include ATG, TTG and ATA. Codon use Codon usage was calculated using the "cusp" program (available at EMBOSS, the European Molecular Biology Open Software Suite website). This showed that for amino acids with several possible codons, the ones with A or T in the third position were strongly favoured. Codons that had at least two positions containing C or G were much less frequently used. Overall, the codon use was reflective of the high A/T content of this satellite DNA. 65 CN 00 I C O 00 r-1/1 I T ) Pi •/-> CN m CN I T ) QifN CN rn t—i ON T 2 CN T c o o o CN 00 i A 63 CN ± - r i CNCTN ON CN •ON os 3 3. o vi <D 'S O fl "3 -*-» JO o <D o fl cr u vj s •a A o '51b -^fl '•3 o o fl o fl <u '5 'fl <D ^ 60 fl "3 '3 fl1 o o CN a fl o o U CN f-oo ON g 4 3 .fl vi Bp <D UO CN CN ro cn uo uo •St---CO CN uo NO ON cn cn uo JL. uoco oo ON oo CN -CN O NO -O CN o o o CN o uo 00 ON oo CO 1 cn -•-co 2 r ^ c N . . Pi© ^ UOCN NO — , < R> ^ - I -uo ro oo OS CN 00 -CN 00 NO uo uo ± £ uo o NO ON oo ro o K0 NO00 5F2 -372 uo ro CN oo ^-5 U ro oo 3 5 o J3 <u CJ "3 +^  XJ o VI u o Cl <u cs •c PH ri o '5b © l-l 00 ••3 o o I d o c 13 £ •Cl <u 6 0 C3 'S •4—* c o o uo <u CJ o o CN > 2^ NO El O N Restriction enzyme cut sites These sequences were run through the "restrict" program (available at EMBOSS, the European Molecular Biology Open Software Suite website) to look for ecoRI cleavage sites to confirm the results of the ecoRI digestion of the various clones. Clone 15, the only complete sequence, has sites that would give bands at 2784, 1243 and 273. Clone 12 has sites that give fragments of 741, 269 and 63 nucleotides. Because this sequence is incomplete, we can say only that there is at least one more fragment that is at least 1709 base pairs. Clone 17 has sites that give a 63 bp fragment, a 269 bp fragment, and at least one other DNA piece that is at least 2022 nucleotides. Clone 18 has cut sites that would produce bands of 76, 269, 561, and 1073 nucleotides, and at least one other band of at least 925 base pairs. These results match with the digestion results. The 269 base pair fragment in clones 12, 17 and 18 is the same as the one sized 273 base pairs in clone 15. Upon further examination of the gel with the digestion products, it is clear that this fragment, which is part of the N-terminal end of the psbA gene, is found from digestion of clones 1, 3, 4, 5, 9, 10, 11, 12, 14, 15, 16, 17 and 18. In other words, it appears that only clones 2, 7 and 13 do not have inserts. The different digestion patterns of these clones shows an astounding variety of sequence within this PCR product, and also shows that the characterization of these clones as fitting into three types underestimates this diversity. Further characterization of the sequences of these clones underlines the notion of sequence diversity. As suspected when direct sequencing failed beyond the boundaries of psbA, the regions adjacent to the gene ends indeed showed sequence heterogeneity. Unlike the 70 minicircles found by Zhang et al. (1999), Zhang et al. (2001), Zhang et al. (2002), Barbrook and Howe (2000), Barbrook et al. (2001) and Hiller (2001), the non-coding regions of these minicircles are very different from one another except in specific areas. Open Reading Frames To be sure that the sequences were truly "non-coding", the sequences of the clones were run through the program "getorf' at EMBOSS. Any ORF over 60 amino acids was run through the BLASTP programs at the NCBI website to see if any matches arose; no matches were found. This does not preclude the possibility that genes may exist within the non-coding regions of these PCR products; dinoflagellate chloroplast genes are extremely divergent and may be almost unrecognizable. If there were genes encoded in these regions, however, I would expect to find the ORF conserved on every clone. Although not all clones were fully sequenced, there were no ORFs shared among clones, with the exception of the sequences encoding psbA. The sequences were also run through the program "tRNA scan" available online, in case the clones contained tRNA molecules like the mitochondrial minicircles oiDicyema (Watanabe et al. 1999). No tRNA molecules were found. Conserved areas There were areas that were conserved between clones. One motif in particular that was common at the C-terminal end of the molecule was 5'- TCTGAAAAAG - 3'. This stretch of sequence is found four times in the first thousand base pairs of clones 12 and 18, and two times in the same region of clones 15 and 17. This repetition is why a primer that was made to this motif (bAXLF3) did not give a clear sequence signal. Areas around this motif (for tens to 71 hundreds of base pairs) also were conserved between clones. There were also several conserved regions that were found at the centre of the clone. One region in particular stood out in all clones at the centre of each clone, near to the large hairpins described below. In clones 12, 15 and 18 the region was around 200 base pairs long, however, in clone 17 it was only 150 base pairs. The areas in each clone shared about 80% identity. None of these regions contained any repeats or patterns. This region has been aligned for each clone and the alignment is shown below as Figure 23. 1 7 _ 1 4 5 5 - 1 6 0 2_2 6 9 8 - 2 8 4 5 _ A C C G T T A A C A A C C C A C C G A A T A A T G G A G 1 8 _ 1 7 1 2 - 1 8 9 5_2 4 0 5 - 2 5 8 8_ A C C G T T A A C A A A C C T C C G A A T A A T G G A T 1 5 _ 3 1 4 3 - 2 93 6 _ r e v e r s e d T T A G T G G T T G T C A C C G G T T G T G A C C G T T A A C A A C C C A C C G A A T A A T G G A T 1 2 _ 1 5 5 1 - 1 7 5 2 _ 2 5 4 8 - 2 7 4 9 _ T T A T T G G T T G T G A C C G G T T G T G A C C G T T A A C A A A C C T C C G A A T A A T G G A G * * * * * * * * * * * * * * * * * * * * * * * * * 1 7 _ 1 4 5 5 - 1 6 0 2 _ 2 6 9 8 - 2 8 4 5 _ T T A G A A C C A A A G A A C C T T G A A A T A T G A C T G C C A C A G C T C G A A T T A T T T G A 1 8 _ 1 7 1 2 - 1 8 9 5_2 4 0 5 - 2 5 8 8 _ T T G A A C C A A G A T C A C C T T G A A A T A T G A C T A C C A C A G C T C G A A T T A T T T G A 1 5 _ 3 1 4 3 - 2 93 6 _ r e v e r s e d T T G A A C C C A A G A T A C C T T G A A A T - - G A A G G C C A C A A C T C G A A T T A T T T G A 1 2 _ 1 5 5 1 - 1 7 5 2 _ 2 5 4 8 - 2 7 4 9 _ T T A G A A C C A A A G A A C C T T G A A A A - - T A A G G C C A C A A C T C G A A T T A T T T G A ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 1 7 _ 1 4 5 5 - 1 6 0 2_2 6 9 8 - 2 8 4 5 _ A T C C A T T T T C T A T C A A T T T G G T T G T G A A C C A C T A A A T G A C C 1 8 _ 1 7 1 2 - 1 8 9 5 _ 2 4 0 5 - 2 5 8 8 _ A T C C A T T T T C T C T A A T T T T G G T T G T G A A C C A C A A A A T G C C C 1 5 _ 3 1 4 3 - 2 9 3 6 _ r e v e r s e d A T C C A T T T G C T T G G A A A A T A A T G A T T T T G G T G C T A A A C C A C A A A A T G C C C 1 2 _ 1 5 5 1 - 1 7 5 2_2 54 8 - 2 7 4 9 _ A T C C T T T T G A A A A T G A T T T T C G T T G T G A A C C A C G A A A T G T C C * * * * * * * * * * * * * * * * * * * * * * * * * * * * 1 7 _ 1 4 5 5 - 1 6 0 2 _ 2 6 9 8 - 2 845_ 1 8 _ 1 7 1 2 - 1 8 9 5 _ 2 4 0 5 - 2 5 8 8_ 1 5 _ 3 1 4 3 - 2 93 6 _ r e v e r s e d 12 1 5 5 1 - 1 7 5 2 2 5 4 8 - 2 7 4 9 A C C G A G A A G C C G T C A G G A T T T T T G G G C T C T T C A A A A G C T G T C A G G A T T T T T G G G C T G T T C C C A T A G A G T T - A C T A C T A C T T G A G A A G T T G T C A G G A T T T T T G G A C T G T T C C C A T A G A G T - - A C T A C T A A G T C A G A A G T T G T C A G G A T T T T T G G G T C G T T A C A A G G G A G T T A A C T A C T A * * * * * * * * * * * * * * * * * * 1 7 _ 1 4 5 5 - 1 6 0 2 _ 2 6 9 8 - 2 845_ 1 8 _ 1 7 1 2 - 1 8 9 5 _ 2 4 0 5 - 2 5 8 8~ 1 5 _ 3 1 4 3 - 2 9 3 6 _ r e v e r s e d 12 1 5 5 1 - 1 7 5 2 2 5 4 8 - 2 7 4 9 G C A A C A A G G G G A T T T G GCAACAAGGGGA GGAACAAGGGGA Figure 23: Alignment of conserved region at centre of insert of each clone. 72 Direct and inverse repeats Inverse repeats and short direct repeats were very common throughout the sequence of the four clones. The direct repeats were often not strictly direct repeats, but were more often repeats that seemed to stutter; the repeated "word" interspersed with short subsections of itself. Palindromes or hairpins are features of the sequence of all of the clones. Clone 15 and clone 12 both contained two copies and clone 17 one copy of the inverted repeat GGGGTAAGCCC-XXXX-GGGCTTACCCCC. An additional third copy in clone 15 and second copy in clone 17 was missing the outside G/C pair. Another hairpin, TATCAGGGGACC-XXXXX-, was found twice in clone 12, with a similar one (TATCAGAGGACC-XXXXX) found once in clone 15. A somewhat similar cousin, CTCAAAGGACC-XXXXX, was found once in clone 17. A shorter palindrome was GTTGTTTG-(X) 1 1, found once in both clones 12 and 15. Al l of these inverted repeats were located in the same region of the clone—in the middle of the non-coding region, equidistant from both termini. Each clone also had hairpins that were not found in the others. A startling feature of clone 15 was that it contained very large potential hairpins. These hairpins are located in different regions from the alignment shown above in Figure 23. The first was located at the centre of the clone's insert; its arms were 130 base pairs long with a 400 base pair space between them. A second hairpin may exist beyond the edges of the first's arms; the arms of this second hairpin were 70 nucleotides long and the space between their ends was 1459 base pairs. Both clone 12 and clone 17 contained a region similar to one of the arms of the larger, more central hairpin of clone 15, but the other arm of the hairpin, if it exists in these clones, lies in the region which has not yet been sequenced. The large hairpin began 73 300 base pairs closer to the centre of the insert than the conserved region aligned above. The sequence of the central, larger hairpin in clone 15 is shown in Figure 24 below. 1992 aaacaacgtagaccgtactacgaggacttcgtta-gaagtccgagtactataggggta l l l l l l l l l l l l l l l l l l l l I I I I I I I I I I I I I I I I I I I M I I I 2654 tttgttgcatctggcatgatagtctcctggcagtccaggagact-atgatatccccat agcccgaagggcttaccccgttacgaggtc-acg-aag-tgaccgagtacgacaacgaag l l l l l l l l l l l l l l l l l l l l l l l l l l l l I I I I I I l l l l l l l l l l l l M i l l tcgggcttcccgaatggggcaatgctcctgaagcaatcttcaggctcatgctgtggcttc tgtccagttaaaaataa 2122 I I I 1 1 1 1 M I N I M acaagtcagtttttatt 2521 Figure 24: Sequence and alignment of large hairpin found at centre of insert in clone 15. It seems likely that each clone has a similar structure. Close to the C-terminal end of the gene, there are several repeated areas with the motif 5'-TCTGAAAAAG-3'. A large hairpin is found at the centre of the non-coding region, probably part of other complex secondary structure. 300 base pairs downstream of the complex structure a conserved region of around 200 base pairs is found in each clone. This structure is shown in Figure 25. O 4-+ fffiSr*-- --Mf-iiw C 1 2 3 N Figure 25: Diagram of structure of the non-coding region of the psbA minicircle from the Adenoides eludens chloroplast genome. N and C are gene ends. Vertical lines at 1 represent repeated TCTGAAAAAG motif. 2 is location of large hairpin, and 3 is location of conserved region. 74 Discussion These four clones contain sequence indicating extensive secondary structure. There are large hairpins that are likely conserved in terms of sequence and location in the minicircles. There are also small hairpins scattered throughout the sequence. The sequences also all contain extensive repeats. These sequence features are probably important to the minicircles for both DNA replication and segregation during plastid division. The direct repeats and the numerous short inverted repeats (small hairpins) likely facilitate extensive recombination (Kelchner and Wendel 1996, Kawata et al. 1997). They may themselves be the result of recombination and/or replication slippage (Sears et al. 1996). A more remarkable aspect of these sequences is the large hairpin found at the centre of the insert of clone 15, and its homologous areas on other clones. I think it very likely that this large hairpin is part of some more complex structure for reasons explained below, and that it may be involved in interactions of the minicircle with various proteins. Liu and Rose (1992) found that the origin of replication in spinach is associated with secondary structure and is bound preferentially to the thylakoid membrane. This binding may play a role in replication or segregation of the genome. Whether the large hairpin of the non-coding region in Adenoides eludens is similar in function is an interesting possibility. Another intriguing trait shown by these sequences is the conserved region found 300 base pairs away from the large hairpin. The fact that this relatively large region (150 to 200 nucleotides) is found to be conserved in each of these four divergent non-coding regions suggests that it is important to the minicircles. This area contains no inverted or direct repeats, however, 75 implying that secondary structure is not its purpose, nor do the sequences encode a recognizable gene. It may be that this region is also involved in replication and/or segregation of the minicircles. The fact that sequencing failed despite several different primers and different sequencing attempts using the same primers can tell us more about the nature of parts of the non-coding region. I believe there is extensive, very complex secondary structure at the centre of these inserts. The sequencing enzyme cannot pass through this area at all easily. The clone for which I obtained a complete sequence (clone 15) happened to have primers at the precise positions to allow each side of the hairpin or structure to be sequenced. When I attempted to sequence directly across this area however, using clone 15 or one of the other clones as a template, the signal crashed. Conclusions The molecules amplified in Chapter 3 from the satellite DNA of Adenoides eludens are non-coding regions that overlap with the gene sequence of psbA. This result, combined with the Southern blot evidence, shows that there are minicircles in this species which are about 4.5 kb in length. These non-coding regions are repetitive and encode secondary structure, which is in places very complex. * 76 Chapter 5: Digenic minicircles in Adenoides eludens PCR products were obtained from outward-directed primers for psbA, psbC and psbD. As noted above, the outward PCR products for the three genes are close to the same size. I wondered if perhaps any of the two genes could share the same circle as in Amphidinium carterae (Hiller 2001). I decided to try PCR reactions with the same conditions used to amplify the long products, but using combinations of primers from different genes. Combination PCR Combination PCR uses all combinations of primers from two different genes. If a product is obtained, this is evidence that the genes reside on the same molecule. This idea is illustrated in Figure 26. Figure 26: Combination PCR. Arrows indicate primers. Combination PCR uses two primers from different genes (encircled). If the genes share a DNA molecule and are close to one another, a product will result. I tried this experiment with all combinations of primers from psbA, psbC and psbD. I will give the results of each gene combination below, and discuss their significance at the end. Figure 13 (in Chapter 3) is a diagram depicting the general location of primers on 77 each gene, which is useful when thinking about the different primer combinations. psbA and psbD PCR was done with pairs of each of the four primers from both genes, resulting in 16 different reactions. PCR was also done with each of these primers by themselves to test whether they act by themselves, with no products amplified. Cycle conditions were an anneal temperature of 56.5°C, 3 mM MgCl 2 and 100 ng DNA. There were large products amplified in six of the reactions, although in two of the reactions the band was very faint. A small product was also amplified in another reaction. Table 4 summarizes these products. Primer combination Size of product (kb) psbD Fo and psbA Ri 6.5 psbD Fo and psbA Ro 6.0 psbD Ro and psbA Fi 6.5 psbD Ro and psbA Fo 6.0 psbD Ri and psbA Fi -6.2 (faint) psbD Ri and psbA Fo -6.2 (faint) psbD Fo and psbA Fi 0.9 Table 4: Summary of psbA and psbD primer combinations giving products, and the sizes of the products. If one arranges psbA and psbD on a hypothetical circle and places the genes head to tail (when travelling around the circle), these results fit, with the exception of the last, small band (0.9 kb). This hypothetical circle is shown in Figure 27. The products amplified from these reactions are mapped in Figure 28. 78 psbA Figure 27: Diagram of hypothetical circle containing psbA and psbD drawn from results of combination PCR. 79 1 < 1 • 1 o NO 4^  Si o oo IT) in •ST o o m ON m i—i O 3 cs NO 5 8 ON 5 CS I ON 5 o NO o to Q >n in r-oo ON NO SO IT) NO o Oi Q in 5 q NO q Pi o Si V Q u a JO NO o •<* CN a oo NO O in NO CN m m m o I 9 ft, T3 •c &a ft, E & o c u o. • CU S o 1 a £ o u LM o oo CS o 3 so . —* to o GO psbA and psbC Sixteen reactions were done with all combinations of these primers, with 3 mM MgC^, 100 ng of DNA and an annealing temperature of 56.5°C. PCR was also done with each of these primers by themselves to test whether they act by themselves, with no products made. Of these 16, five had products. Each of the five had products that were large, around 6 kb, while some also had smaller products. These results are summarized in table 5. Primer combination Size of product(s) (kb) psbA Fi and psbC Ri 6.1 (strong), 1.2, 1.5, 1.9 (all weak) psbA Fi and psbC Ro ~6.0 (weak), 1.2 (weak) psbA Fo and psbC Ri 6.1 (strong), 1.1, 1.3, 1.5 psbA Fo and psbC Ro ~ 6.0 (weak) psbA Ro and psbC Fo 5.7 Table 5: Summary of psbA and psbC primer combinations giving products, and the sizes of the products. Again, it is possible to arrange these two genes on a circle such that all of the results in table 5 will fit. This means that the genes will lie N-terminal to C-terminal as above. This arrangement is shown in Figure 29. A map of these products is found in Figure 30. Figure 29: Diagram of hypothetical circle containing psbA and psbC drawn from results of combination PCR. 81 UO NO 2; o NO CN f-m ro o NO roN 00 ON NO NO CN 00 o CN NO uo ro ro NO 2 u 5 u 'o Si O N o o NO o pi 0 o U I5l 00 ro NO 2 y S u 00 •3-P. u CB 53 - O ON CN 5 O^ O ro + uo ro O CN OO -3-o « O rj oo ro 6 •fi OH to ft, *o 3 ft, E o O a 2 ft Pi U (X d IS B o o 5 -o ro U | to ro psbD and psbC Another 16 reactions were run with all possible combinations of primers from psbD and psbC. The reactions had 100 ng of DNA, 3 mM MgC^ and the annealing temperature was 60°C. There were four reactions that amplified products. The results of these reactions are summarized in table 6. Primer combination Size of product(s) (kb) psbD Fo and psbC Ri 6.5 (strong) psbD Ro and psbC Fi 6.0 (strong) psbD Ro and psbC Ri 1.1, 1.3 (weak) psbD Ro and psbC Fo 5.0, 5.5 Table 6: Summary oipsbD and psbC primer combinations giving products, and the sizes of the products. This set of reactions was unusual in that it contained one reaction that had small products but no large one. As seen in figure 31, however, that particular combination did not fit with the others. Like the other two drawings, this one has the genes in question arranged head to tail around the circle. The map of these products is found in Figure 32. Figure 31: Diagram of hypothetical circle containing psbD and psbC drawn from results of combination PCR. 84 uo A NO o NO o I to U r-r-5 IT) UO O o to U o S •fi OH s w -d -c 8, o ON NO CO NO uo o CN NO UO o uo oo 5 UO NO . — u IX Q o CN CO ro UO y Sw Q T o o to A Y'~ o NO ro CN o § to U o pi Q o IX u o co ro o uo C O NO NO o on — o 3 •d o a x • X C o g 1 o u u— O rs ro i— • « X co Discussion of Combination P C R results There are several main points to note about the results of the combination PCR experiments. The first is that most of the products were large, ranging in size from 5 to 6.5 kb. This is bigger than the range seen in the PCR products from single gene primers, which was 4.1 kb to 5.2 kb. These large products were also consistently present in every combination reaction that had products, save one (see table 6). In addition, these large products fit together like pieces of a puzzle to make consistent models of larger circles. There is some independent evidence that corroborates this idea of larger, digenic circles. The maps above (Figures 28, 30 and 32) show that the digenic circles are all around 12 kb in size. This size is an estimate as the sizes of the combination products were themselves estimated from the gel. However, the 12 kb figure is probably roughly right. Recalling Chapter 2, there are several Southern blots that show higher-molecular weight labelling in the satellite 2 DNA of Adenoides eludens. In fact, many of these bands are found in the 8-10 kb range. Some blots, such as that shown in figure 10, have bands from this DNA at even higher molecular weights. These higher bands are magnified in Figure 11. A 12 kb circle may be linear, nicked or supercoiled, and could show up on a Southern blot as smaller than it truly is; in effect, as a band in the 8 to 10 kb range. The fact that there is labelling above the 5 kb mark on these blots (which would represent a linear unigenic circle) implies that there may be more than one size of circle in this DNA. An important question at this point is, "If these circles exist, why were they not amplified in the PCRs done using unigenic outward primers?" By examining Figures 27, 29 and 86 31 (big circles above) it is obvious that this DNA should have been amplified in these reactions. A tendency of the polymerase chain reaction, however, is that it preferentially amplifies smaller targets. This means that if there were to be a choice between a 4.5 kb product and an 11.5 kb product, it is the 4.5 kb product that would be amplified. The smaller products ranged in size from 0.9 to 1.9 kb. They were often faint and appeared indiscriminately whether they fit into the models drawn above or not. This implies that they may be either non-specific products not related to the genes at all, or they may be parts of "crazy" or "empty" circles like those in Heterocapsa triquetra (Zhang et al. 2001), Amphidinium carterae (Hiller 2001), and A. operculatum (Barbrook et al. 2001). The latter could be possible as the primer combination that gave the highest amount of small products was psbA and psbC (see table 5). These genes, along with 16S and 23 S rRNA, were the components of the five empty circles sequenced from H. triquetra by Zhang et al. (2001). It is equally likely, however, that these small products are non-specific. It should be noted that no products were amplified in reactions when any one of the primers was used by itself. It seems unlikely that the larger PCR products from these reactions could also be parts of crazy circles. First, they appear in nearly every reaction that has products. One would expect that, i f they were parts of crazy circles, the large products would not be as ubiquitous. Also, the product lengths are similar. Furthermore, these products fit together like bits of a puzzle. The empty circles found in other species so far have been disorganized, with pieces of different genes interspersed (Zhang et al. 2001, Hiller 2001, 87 Barbrook et al. 2001). The consistent presence of the large products implies more organization than any empty circles have shown thus far. Cloning and Sequencing Combination Products It was important to find out whether these PCR products were truly amplified from regions of DNA containing the genes in question, and whether they were similar to the sequences from the psbA long PCR product. I decided to clone one of these products, and chose one from the psbAlpsbD combinations, the product that resulted from the primers psbA Fi and psbD Ro (see figure 28 and table 4). This PCR product was 6.5 kb. The same kit and procedures as described in Chapter 3 were used. The cloning was successful, and 12 colonies were picked, with the clones digested using EcoRI. The results are shown in Figure 33. 1 2 3 4 5 6 7 8 9 10 11 12 Figure 33: Gel showing EcoRI restriction endonuclease digestion of clones containing the psbA YxIpsbD Ro PCR product. 88 After the DNA from each clone had been digested, there was again more than one digestion pattern. Clones 2,4, 5, 7, 8 and 9 were not successful and did not appear to contain the product of interest as their restriction patterns showed they contained a small or no insert. Clones 10 and 11 had an insert with no digestion sites that can be seen as the top band in the lane. Clones 1, 3 and 6 had an insert with one digestion site, leaving one large and one small DNA fragment. Finally, clone 12 contains an insert with 2 cut sites and produces a pattern of three bands, plus the vector. Do these clones contain the product of interest? A key consideration is the size of the inserts in the clones. The size of the target DNA was 6.5 kb; the inserts in clones 1, 3 and 6 are each ~4.2 kb, and those in clones 11 and 12 are both ~5 kb (see figure 33). Only clone 10 has an insert of the right size, at 6.5 kb. Another consideration is the similarity that some of these results show to the digested clones of the psbA long PCR product (Figure 18). In fact, some of the patterns appear identical, such as both clone 12's, with bands at around 2.9 kb, 1.4 kb and 700 bp, and clone 11 (Figure 33) and clone 17 (Figure 18) with both inserts uncut and a shade larger than the vector. Clones 1, 3 and 6 in Figure 33 and clones 4, 6 and 15 in Figure 18 are also similar; all of these contain inserts with one cut site, leaving one large fragment at 2.8 kb and one small fragment ranging in size from 1.3 to 1.8 kb. Nested PCR—combination products as templates I decided to try to find out which of these clones might contain the insert of interest by using PCR and the different clones as templates. This would be a relatively fast method 89 of getting more information about these clones. Sequencing them all was not an option, as the entire process would take several weeks. Control Nested PCR To be sure that the reaction would work, a control was performed using the psbA clones as a template. Two primers different from those used to amplify the product were used. The R2 primer was designed to the N-terminal region of psbA and should be found on each clone. The F3 primer is from a conserved region in the non-coding area. Figure 34 below shows the insert and the locations of the primers used for this PCR. Figure 34: Diagram of psbA long PCR product with location of the F3 and R2 primers. PCR was performed with 10 ng each of clones 12, 15, 17 and 18, 3 mM MgCl 2 , an anneal temperature of 55°C, and extension of 72°C for 5 minutes. Three reactions were performed for each clone, using the F3 primer alone, the R2 primer alone, and finally both F3 and R2 together. Figure 35 shows the results of these reactions. psbA P C R product N R 2 Ro 4" psbA template molecule 90 Clone 12 12 12 15 15 15 17 17 17 18 18 18 Primer F3 + + _ + + _ + + _ + + _ Primer R2 + - + + - + + _ + + _ + 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Figure 35: Results of control nested PCR. Table shows which primers used in which reaction; lanes 1, 8 and 15 contain 300 ng 1 kb ladder. The control PCR using the primers R2 and F3 was a success. Each reaction produced a DNA fragment of the expected size (-3.3 kb) when both R2 and F3 were used (lanes 2, 5, 9 and 12). The F3 primer acts on its own to give a product of about 800 base pairs (lanes 3, 6, 10 and 13). This product can be seen in the reactions using F3 on its own, and F3 and R2 together. Nested PCR—psbA Fi/psbD Ro clones as template Using the psbA Fi/psbD Ro clones as a template, a similar experiment was performed. Several questions could be asked at this point. The first was whether these clones contained an insert with parts of the psbA and psbD genes. The second was whether the inserts of these clones bore any similarity to the psbA clones. The primers psbA Fo 91 (AFo), psbD Ro (DRo) and F3 were used to attempt to answer these questions. Figure 36 shows the theoretical position of these primers on the psbA FilpsbD Ro PCR product. psbD AFi psbA Figure 36: Diagram of DRo/AFi combination PCR product. Hypothetical positions of primers AFo, F3 and DRo shown. Clones used as a template were 1 (representing 3 and 6 also), 10,11 and 12 (see Figure 33). Conditions were the same as those described above for the control reactions. Five reactions were performed for each clone; the primers used were AFo alone, F3 alone, DRo alone, AFo and DRo together, or F3 and DRo together. The first question, whether the two genes were represented on the inserts, could be partly answered by the primers AFo and DRo. A product of the expected size obtained from AFo would indicate that the psbA gene C-terminal end is present on the insert (see figure 36 above). Use of the primer DRo would not give us more information about the psbD end of the insert, unfortunately, because DRo was used to amplify the original insert. The products from F3 and DRo could tell us more about whether this combination psbA Fi/psbD Ro PCR product shares any sequence characteristics with the psbA clones. This is because the F3 primer corresponds to a region that is conserved on every psbA circle sequenced from Adenoides eludens. The results of the experiment are shown in Figure 37. 92 Clone Primer AFo Primer DRo Primer F3 1 + 1 1 + 3 l + + 10 10 10 10 10 11 11 11 11 11 + - - + - + - - + -- + _ + + _ + _ + + - + - + - + - + 7 8 9 10 11 12 13 14 15 16 17 Clone Primer AFo Primer DRo Primer F3 Figure 37: Results of nested PCR using psbA Fi/psbD Ro clones 1,10,11 and 12 and primers AFo, DRo and F3 as shown in the table above. Lanes 6, 12 and 23 contain 300 ng 1 kb DNA ladder. 93 The results of the PCR reactions did indeed address the questions posed above. No products were obtained from clone 1. This shows that clone 1, and by extension clones 3 and 6, do not contain the DRo/AFi insert shown in Figure 28. Clone 10, which had an insert of -6.5 kb, had a product from the AFo/DRo primers at around 5 kb (lane 10). The F3/DRo primers gave a product at around 4 kb (lane 11). A few other faint bands were present in both reactions. Clone 11 had an insert of roughly 5 kb. The AFo/DRo primers amplified a product of 4 kb (lane 16), while the F3/DRo set amplified a product of 3.3 kb (lane 17). No other bands were present in either reaction. These bands are slightly smaller and weaker than those from reactions using clone 10 as a template (lanes 10 and 11). Clone 11 produced an 800 base pair fragment from the F3 primer alone (lane 15), very similar to those seen using the same primer in the psbA clones (see Figure 35). A few other weak bands at 650 base pairs, and at around 3 kb and 4.5 kb were also present from this reaction (lane 15). A product of 500 base pairs was made from the DRo primer alone (lanel4). Clone 12 contained an insert of around 5 kb. The DRo primer made a product of 500 base pairs (lane 19), while the F3 primer amplified a product at 800 base pairs (lane 20). These products are similar to those seen for the same reactions from clone 11. The AFo/DRo reaction amplified a 4 kb product (lane 21), also similar to the same reaction for clone 11. The F3/DRo reaction, however, has amplified several products of sizes varying from 900 base pairs to 3.5 kb (lane 22). The nested PCR results suggest that the PCR product amplified from Adenoides eludens satellite 2 DNA using the psbA Fi and psbD Ro primers was a specific product, that is to say, it was amplified from DNA containing the psbA and psbD genes. These results also 94 imply that this combination PCR product may bear some similarities to the sequenced psbA minicircles. This is because there were products of the expected size obtained from the DRo/F3 reactions, and the F3 primer alone made products of the same size as those obtained using the psbA circle as a template. Sequence of ends of combination clones 10,11 and 12 After several attempts, sequence was obtained from both ends of clones 10, 11 and 12 containing the PCR product obtained from psbA Fi and psbD Ro primers (see Figure 28). These sequences confirmed the results of the nested PCR reactions described above; these clones contain the product shown below in Figure 38. psbD psbA Figure 38: Diagram of combination PCR product obtained from psbA Fi and psbD Ro primers. Dashed arrows indicate sequenced areas. The psbA end of the product encodes amino acids 205 to 348 of the dinoflagellate PsbA protein. The C-terminus (TAA) is present in the expected place. The sequences of all three clones match exactly for this gene up to and for several nucleotides past the C-terminus. The sequences also match those from the coding region of the psbA minicircle 95 clones, and the psbA sequences obtained from Adenoides eludens using degenerate primers. The sequences of the clones past the gene boundary do not match however, either with one another or with the psbA minicircle clones. Near the end of the sequences obtained there is a conserved area very similar to that found close to the C-terminus in the psbA minicircle clones with the 5'-TCTGAAAAAG-3' motif. The N-terminal region of psbD was sequenced from the end of the combination PCR product clone and also directly sequenced from the psbD long PCR product. The psbD end of the combination product (510 base pairs) encodes amino acids 1 to 170 of the dinoflagellate PsbD protein. The presumptive start-site (ATG) lies 8 nucleotides upstream from the N-terminus. This is similar to the Heterocapsa triquetra minicircles analyzed by Zhang et al. (1999). Again, the sequences of the clones match exactly up to and for 65 nucleotides past the N-terminus. The sequences also match with those obtained using degenerate primers. The sequences differ from one another after the gene boundary although there are some short conserved regions. These regions are not similar to those seen in the psbA minicircle clones. The psbA and psbD N-terminal sequences from all sources were conserved for 25 and 62 base pairs past the start codons, respectively. The sequence AGCTAGGTTA. was found upstream of both start codons; 15 base pairs upstream of the psbA start site, and 13 base pairs upstream of the psbD start site. This may be a Shine-Dalgarno sequence, which is typically GGTGG and found 8 to 124 base pairs upstream of the start codon in dinoflagellates (Zhang 1999, Ph.D. thesis). In Adenoides eludens, the consensus 96 sequence may be GGTTA. The fact that the psbA and psbD gene sequences are both found on either end of this PCR product is a very exciting development. It confirms that these two genes share a piece of DNA, implying that there are digenic circles in Adenoides eludens. It also implies that the other combination PCR products amplified are specific products, strongly supporting the circle models diagrammed above. There may be many of these digenic circles arising that contain the genes tested above and even others, suggesting a very dynamic plastid genome. Discussion of Digenic Circles The existence of digenic circles was originally proposed in a paper by Zhang et al. (2001), which explored the phenomenon of the selfish or empty circles in Heterocapsa triquetra. The authors suggested that the conserved cores of the non-coding region could allow two unigenic circles to recombine into a digenic circle with two non-coding regions. The entire array of selfish circles sequenced could be generated through the formation of a digenic circle, deletion of one of the non-coding regions, deletion of bits of the genes themselves, and recombination with other chimeric circles (Zhang et al. 2001). There was no physical evidence, however, of actual digenic circles in Heterocapsa triquetra. The recombination idea is illustrated in Figure 39 below. 97 Figure 39: Diagram of recombination between two unigenic circles at the non-coding region to produce one digenic circle. The authors suggested that circles could combine at conserved parts of the non-coding region. This is likely happening inside the chloroplasts of Adenoides eludens. The resulting digenic circle could be resolved back into unigenic circles by a DNA topoisomerase II (Zhang et al. 2001). Presumably the digenic circles could also be involved in further recombination to create trigenic or even larger circles. If unigenic circles are recombining into several different digenic circles, they should be combining to form homodimers as well as heterodimers, such as the ones modelled above. PCR was done with all combinations of the psbA primers and the conditions that amplified the products above. There were products for the inward set of primers and for the outward set, but no results from primer sets that would suggest any psbA homodimers. 98 An important question to ask is whether the combination PCR products could be amplified from larger circles; that is, whether molecules larger than digenic circles could exist in Adenoides eludens. This possibility is suggested by the higher-molecular weight bands visible in Figure 11, Chapter 2. It is likely that digenic circles do exist as drawn in the models above, however it is possible that some combination PCR products were amplified from larger molecules containing the two genes in question beside one another. It is not possible to distinguish between these two alternatives by sequencing. Conclusions Evidence points to the idea that two different types of polymerase chain reactions amplify a similar set of molecules. The first reaction, using psbA Ro and Fo primers, created DNA products that were 4.1, 4.3 and 4.6 kb long, and when cloned produced three types of digestion patterns. The second reaction, using psbA Fi and psbD Ro primers, produced a DNA fragment that was 6.5 kb long. Nested PCR showed that the psbA gene was present on one of the ends of this product, and that it may share some sequence identity with the psbA minicircles. Sequencing of the product ends confirmed that parts of both genes were present on the ends of the product in the orientation expected. This sequencing also showed that there were some similarities between the non-coding region of the combination PCR product psbA end and the psbA minicircles. The products sequenced in Chapter 3 were very long non-coding regions. The parallels drawn above suggest that the combination PCR products are also non-coding regions. 99 Chapter 6: General Discussion Plastid DNA is proving to be much more plastic than previously believed. Plastid genomes are typically represented as circular and monomelic, but evidence is mounting that these genomes may also be linear and/or oligomeric, often within the same organelle. Deng et al. (1989) used pulsed-field gel electrophoresis to show that the plastid genome of spinach exists as monomers, dimers, trimers and tetramers. Although the molecules could not be categorized as linear or circular, the relative amounts of each form were found to decrease exponentially (Deng et al. 1989). Spinach chloroplast DNA has also appeared as large rosette structures (Brait et al. 1982), as has the plastid DNA of liverwort (Herrmann et al. 1980). Higher plant plastids were further investigated by Lilly et al. (2001) using fluorescence in situ hybridization. This revealed that circular molecules of chloroplast DNA in Arabidopsis and tobacco comprise 42% and 45% of total molecules (respectively), while those in pea comprise 25%. Linear molecules in Arabidopsis and tobacco make up 22% of the total, but in pea they are 36% of total molecules (Lilly et al. 2001). The plastid genome of Chenopodium album exhibits single-stranded DNA sections on 30 to 40 % of its molecules (Backert et al. 1997b). It is only recently that the structure of other plastid genomes has been investigated. The plastid DNA of the green alga Chlamydomonas was lately examined using several of the methods mentioned above (Maul et al. 2002). It was found that this genome exists as both monomers and dimers in linear and circular form. Work has been done by Williamson et al. (2001) with the apicoplast DNA of the apicomplexan Toxoplasma gondii, which also exists in several forms. This 35 kb genome is found not only in the 100 familiar monomelic circular conformation, but also as linear molecules ranging in size from monomers of 35 kb to 12-mers of 430 kb (Williamson et al. 2001). The plastid DNA of the apicomplexan Plasmodium falciparum, however, is found only as monomers that are almost all circular, although a few linear molecules were seen (Williamson et al. 2002). The superstructure of plastid DNA may also be important. Chloroplast genomes are found amassed inside the chlorbplasts of many classes of algae, often as ring nucleoids or small spherical nucleoids that share tenuous connections (Coleman 1985). These nucleoids are much larger than one genome, leading to further questions about the DNA organization in these structures. Kobayashi et al. (2002) recently described a histone-like protein encoded in the chloroplast genome of the primitive red alga Cyanidioschyzon merolae. This protein appears to be vital for the organization of chloroplast DNA in the nucleoid. Nerozzi and Coleman (1997) studied the ring nucleoids of plastids of the chrysophyte Ochromonas danica. They found that plastid genomes were arranged consecutively around the ring and that several replication sites on the nucleoid could be observed throughout the cell cycle. It is thought that plastid genomes are randomly chosen for replication; in this ring nucleoid no specific replication pattern was found, but the authors noted that sites of replicating plastid DNA were spaced more evenly around the ring than accounted for by random distribution (Nerozzi and Coleman 1997). The form that a genome takes may reflect the ways that it is replicated (Williamson 2002). Both mitochondrial and plastid genomes have been shown to exist in circular, 101 linear, large rosette-like forms and minicircles. These genomes have been postulated to replicate through Cairns-type or theta (0) replication, rolling-circle or sigma (a) replication, or recombination-dependent replication. Theta replication has been linked to circular genomes in mitochondria, plastids and bacteria (Kolodner and Tewari 1975). It creates circular products. It is thought that large linear molecules originate during rolling-circle replication of the circular monomers (Williamson et al. 2001). In size, these linear molecules are often precise multiples of the genome. Complex rosette structures have been observed that may contain many copies of the genome (Backert et al. 1997b). These rosettes have one or more cores and up to 50 loops of DNA. This structure may be associated with recombination-dependent replication (RDR). This process will be explored more fully below. We may take advantage of the progress made in studies of mitochondrial DNA by applying it to our ideas about the plastid genome. After all, mitochondria and chloroplasts exist in very similar circumstances: following a move to an endosymbiotic environment, both of the initially circular genomes experienced a massive transfer of genes to the nucleus. Many of the same genome structures are now found in both mitochondria and plastids, including circles (such as in the mitochondria of vertebrates and the chloroplasts of Plasmodium falciparum), linear molecules (such as in the mitochondria of green plants and the chloroplast of Toxoplasma gondii), rosette structures (such as in the mitochondria and chloroplasts of higher plants) and minicircles (such as in dinoflagellate chloroplasts and Dicyema mitochondria). 102 Many mitochondrial genome architectures and gene contents have been studied. Gray et al. (1999) state that derived mitochondrial genomes are characterized by differences in structure from the ancestral form, along with a decrease in size. Other characteristics of derived genomes are extensive gene loss, differences in rDNA and in rRNA structure, sequences that are more divergent, a highly biased codon usage, and use of non-standard codons. Many of these criteria apply to the dinoflagellate plastid genome, as discussed in the Introduction and Chapters 3 and 4. One type of derived mitochondrial genome in particular, that of the angiosperms, has become recombinationally active, which promotes genomic rearrangements (Gray et al. 1999). Backert et al. (1997a) also suggest that recombination may promote the diversity of DNA structure that we see with angiosperm mitochondrial genomes. They suggest that through recombination at both large and small repeats, circles of various sizes and the large rosette structures could form. Similar conclusions were reached by Preiser et al. (1996) in their study of the mitochondrial DNA of Plasmodium falciparum. They found tandem linear arrays of 6 to 50 kb of the 6 kb genome, covalently closed circles of 6 kb and other circular oligomers (totalling 1-2% of the genome), lariats, loops with two unequal tails, and unusual molecular morphologies including Y-shaped molecules, H-shaped molecules and molecules with forks with unequal branches. They concluded that this rich array of conformations could be explained only by recombination (Preiser et al. 1996). Recombination almost certainly plays a very important role in the structure of peridinin dinoflagellate plastid DNA. Zhang et al. (2001) invoke the idea of recombination to explain the existence of the "crazy", "empty" or "selfish" circles, with recombination 103 between regions of homology allowing relatively short-lived digenic circles, which may eventually develop into empty circles. Physical evidence of digenic circles in the plastids of Adenoides eludens has been presented in Chapter 5. It is likely that these digenic molecules stem from recombination between areas of homology in the unigenic circles. Even larger circles may exist through recombination (see Figure 11, Chapter 2). Recombination is also an important part of gene conversion, which was invoked by Zhang et al. (2002) to explain the areas of homology in the non-coding sequence of the minicircles of dinoflagellates. Gene conversion is a phenomenon by which copies of short DNA sequence are maintained throughout a gene or genome (Alberts et al. 1994). It is a natural consequence of recombination and DNA repair processes (Alberts et al. 1994). Gene conversion is also suggested as a governing force in the coxl organization in the mitochondrial genome of the dinoflagellate C. cohnii (Norman and Gray 2001). Traditionally, the processes of genome maintenance and manipulation—replication, repair and recombination—have been studied separately. It is only rather recently that the three processes have been recognized to be interconnected (Hippel 2000). In fact, it is now thought that the major function of homologous recombination in bacteria is the repair of disabled replication forks while avoiding alteration of the DNA sequence (Cox 2001). Stalled or collapsed forks are estimated to occur at least once per cell per generation. It is imperative that these forks be regenerated; systems to do this are elaborate and often redundant (Cox 2001). The field investigating this issue is very active; the list of potential repair pathways is long and continues to grow (Cox 2001). 104 DNA replication fails when both strands are broken through radiation or other means, when replication forks meet nicks in either the leading or lagging strands, or when strands stall due to irregularities in the template (Kowalczykowski 2000). In either case, the result is a DNA strand that is incomplete, with no ready template attached. This concept is illustrated in Figure 40. Figure 40: Diagram showing possible sources of stalled or collapsed replication forks. A is a fork that has stalled due to blockage in the template strand. B is a fork that has collapsed due to a nick in the lagging template strand. C is a collapsed fork due to a nick in the leading strand. Adapted from Kowalczykowski 2000, Cox 2001. Damage to the template in the form of nicks in the DNA strand may result from an endogenous source within the cell, such as the free radicals coming out of intermediary 105 metabolism (Kowalczykowski 2000). After a replication fork stalls or collapses, the cell (or organelle) must find a way to repair the fork. It is through recombination and strand displacement and exchange that the replication fork is regenerated and a full complement of DNA is produced for each daughter cell. Two major events are key to most repair pathways: the resolution of Halliday junctions and 3' strand invasion. A Halliday junction occurs when two DNA molecules have become connected through two strands crossing over. This is a four-way junction that can be resolved by proteins which cut the strands at opposite sides. 3' strand invasion takes place when a double-stranded break has occurred because of DNA damage or the resolution of a Halliday junction. If a fork has become stalled at a blockage, the DNA may be cut at that point in order to restart the fork using 3' strand displacement. Through the action of various proteins, the 3' end of a DNA duplex is exposed. This strand invades an area of homology, displacing the original pairing strand. Several different outcomes may follow this development; it appears to be involved in the repair of free DNA ends in all organisms in many contexts (Cox 2001). 3' strand invasion is shown in Figure 41 below. 3' 5' Figure 41: 3' strand displacement. Broken DNA (bold) has 3' end invading homologous region of double stranded DNA with orientation of various stranded marked. The invading strand has begun DNA synthesis. Adapted from Cox 2001. 106 The replication fork may be regenerated through these two types of events as shown in Figure 42. 5' \ / Figure 42: Regeneration of replication fork using 3' strand displacement and Halliday junction resolution (surrounded by dashed circle). Adapted from Cox 2001. A recent realization is that these repair, recombination and replication events may combine to initiate replication. Recombination-dependent replication (RDR) allows de novo DNA synthesis in bacterial cell lines that have lost canonical ori function (Asai et al. 1994). In other words, a replication fork is allowed to open in places where there is no canonical replication origin. Preiser et al. (1996) suggest that RDR may apply to genomes that are highly associated with recombination. Their work with Plasmodium falciparum mitochondrial DNA has led to the assertions that this genome uses RDR, that there is no fixed origin of replication in this genome and that 3' strand invasion and fork creation may produce the wide variety of molecular conformations found. Norman and Gray (2001) also use the idea of recombination-mediated replication to potentially explain the complex organization of the coxl gene in the mitochondria of the dinoflagellate Crypthecodinium cohnii. Recombination-dependent replication is suggested as the replicative mode in the mitochondrial genome of carrot (Robison and Wolyn 2002) and liverwort (Oldenburg and Bendich 2001). Could this method of 107 replication also be active in the dinoflagellate chloroplast? An interesting consideration is that in dinoflagellate minicircles, the same stretch of DNA, the non-coding region, is hypothesized to be involved in replication, recombination and gene conversion. As explained above, these three processes are linked. There is a strong argument for the presence of RDR in the dinoflagellate chloroplast genome. First of all, the genome is highly recombinationally active, as evidenced by recombination within genes in the empty/crazy circles (Zhang et al. 2001) and recombination within the non-coding region in the digenic circles shown in Chapter 5. In addition, parts of the non-coding regions' repetitive and conserved sequence would be an ideal priming site for recombination leading to replication of the circles. Previously, unique conserved cores were proposed to be origins of replication; invoking recombination-dependent replication would explain the lack of unique cores in some minicircles. This form of replication would also sometimes lead to crossing over in the non-coding region, which could easily produce digenic circles such as those in Chapter 5. A further point is that large complexes (rosettes) of DNA, often held together by numerous protein interactions, usually characterize RDR. The fact that dinoflagellate chloroplast DNA requires a CsCl gradient to remove adhering proteins and other contaminants before enzymatic reactions will work hints that a variation of these complexes may also exist in the dinoflagellate plastid; recombination-dependent replication may be present. If the dinoflagellate chloroplast genome uses RDR, perhaps this fits into a model for the development of the minicircles. Zhang et al. (2002) proposed two models for the origin 108 of chloroplast gene minicircles. The first involved the sudden transposition of replication origins. This would result in a genome that was recombinationally unstable and could eventually fragment into minicircles, each with its own origin of replication. Transposons are typically larger than most minicircles investigated (Zhang et al. 2001), though, which would generate larger molecules and would require most minicircles to have shrunk since this event. The second model involved deletion of DNA sequences around the replication origin until only the replication origin and one gene per circle remained. Zhang et al. (2002) challenge this idea with the observation that none of the digenic circles found in Amphidinium contain genes usually found next to one another, and no circles were found at all containing genes that are neighbours in the typical chloroplast genome. There are actually two issues to consider when thinking of the origin of minicircles. The first is the spread of the non-coding region through the genome; this region is now found in equal amounts with any gene. The second issue is the decrease in size of the chromosomes from hundreds of thousands of base pairs to thousands of base pairs. It may be that one of these events led to another as postulated by the first model mentioned above. Recombination-dependent replication may fit into this model. The origin of the non-coding sequence is an important facet of any minicircle origin model. Norman and Gray (2001) hypothesize that the first significant genomic rearrangements that led to the creation of duplicate coxl elements in Crypthecodinium cohnii mitochondrial DNA were caused by recombination between small repeats. 109 Perhaps similar recombination events led to the spread of a secondary structure-encoding sequence (the first non-coding region) through the chloroplast genome of dinoflagellates. This could have occurred as a consequence of RDR, rather than as a result of transposon activity. As hypothesized above, the small size of the chromosomes could be a natural outcome of a sequence spreading through the genome. Indeed, with RDR as the replicative mode, the reduction in size might be even more likely. Preiser et al. (1996) suggest that if smaller molecules are produced by this "haphazard" recombination-dependent replication system, they might replicate faster, leading to a decrease in the average molecule size in the genome. It has become clear that the structures of the genomes of plastids and mitochondria are not as simple as previously thought. Indeed, there may be much more to this puzzle than meets the eye, with several pieces of information to take into account. The sequence information can tell us only so much about these genomes. Micrographs and gel electrophoresis are also useful sources of information about structure. They tell us that these genomes are often found in conformations that challenge the traditional interpretation of the sequence data. An example is the observation of many different architectures, from single stranded DNA, to linear DNA molecules, to small and large circles, to complex rosette structures. The formation of these strange architectures may be connected to their replicative modes. Although understanding in this area is still limited, it may be that links exist where none were suspected. 110 Future Work There are several experiments that would increase our understanding of dinoflagellate chloroplast genomes in general, and that of Adenoides eludens in particular. 1. Sequence several clones of psbC and psbD minicircles from Adenoides eludens. This will tell us more about the non-coding region in this species. 2. Sequence several clones of various combination PCR products from Adenoides eludens. 3. Use pulsed field gel electrophoresis to analyze Adenoides eludens chloroplast DNA both before and after purification through a CsCl gradient. 4. Use electron microscopy to visualize Adenoides eludens chloroplast DNA both before and after purification through a CsCl gradient. Through these experiments, perhaps we might discover more about this strange and unusual genome. I l l References 1. Alberts B, Bray D, Lewis J, Raff M , Roberts K and Watson JW. 1994. Molecular Biology of the Cell. 3 r d ed. Garland Publishing, New York, USA. 2. Allen JF. 1993. Control of gene expression by redox potential and the requirement for chloroplast and mitochondrial genomes. J. Theor. Biol. 1 6 5 : 609-631. 3. Archibald JM and Keeling P. 2002. Recycled plastids: a 'green movement' in eukaryotic evolution. Trend Genet. 18(11): 577-584. 4. Asai T, Bates DB and Kogoma T. 1994. DNA replication triggered by double-stranded breaks in E. coli: dependence on homologous recombination functions. Cell. 7 8 : 1051-1061. 5. Backert S, Nielsen BL and Borner T. 1997a. The mystery of the rings: structure and replication of mitochondrial genomes from higher plants. Trend Plant Sci. 2(12): 477-483. 6. Backert S, Lurz R, Qyarzabal OA and Borner T. 1997b. High content, size and distribution of single-stranded DNA in the mitochondria of Chenopodium album. Plant Mol. Biol. 33: 1037-1050. 7. Barbrook AC and Howe CJ. 2000. Minicircular plastid DNA in the dinoflagellate Amphidinium operculatum. Mol. Gen. Genet. 263: 152-158. 8. Barbrook AC, Symington H, Nisbet RER, Larkum A and Howe CJ. 2001. Organisation and expression of the plastid genome of the dinoflagellate Amphidinium operculatum. Mol Gen. Genomics. 2 6 6 : 632-638. 112 9. Bock R. 2000. Sense from nonsense: How the genetic information of chloroplasts is altered by RNA editing. Biochimie. 82: 549-557. 10. BogoradL. 1991. Replication and transcription of plastid DNA. In: The Molecular Biology of Plastids. Eds. Bogorad L and Vasil IK. Academic Press, San Diego, USA. pp. 93-124. 11. Buchanan B, Gruissem W and Jones R. 2000. Biochemistry and Molecular Biology of Plants. American Society of Plant Physiologists. Rockville, MD. 12. Chang CH and Wu M . 2000. The effects of transcription and RNA processing on the initiation of chloroplast DNA replication in Chlamydomonas reinhardtii. Mol. Gen. Genet. 263: 320-327. 13. Chesnick JM, Kooistra WHCF, Wellbrock U and Medlin LK. 1997. Ribosomal RNA analysis indicates a benthic pennate diatom ancestry for the endosymbionts of the dinoflagellates Peridinium foliaceum and Peridinium balticum (Pyrrhophyta). J. Euk. Microbiol. 44(4): 314-320. 14. Coleman AW. 1985. Diversity of plastid DNA configuration among classes of eukaryotic algae. J. Phycol. 21: 1-16. 15. Cox M M . 2001. Recombinational DNA repair of damaged replication forks in Escherichia coli: questions. Annu. Rev. Genet. 35: 53-82. 16. Daley DO, Clifton R and Whelan J. 2002. Intracellular gene transfer: reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase. Proc. Natl. Acad. Sci. USA 99(16): 10510-10515. 17. Danon A. 1997. Translational regulation in the chloroplast. Plant Physiol. 115: 1293-1298. 113 18. De Las Rivas J, Lozano JJ and Ortiz AR. 2002. Comparative analysis of chloroplast genomes: Functional annotation, genome-based phylogeny, and deduced evolutionary patterns. Genome Research. 12:567-583. 19. Deng XW, Wing RA and Gruissem W. 1989. The chloroplast genome exists in multimeric forms. Proc. Natl. Acad. Sci. c/&4 86: 4156-4160. 20. Dodge JD. 1963. Chromosome numbers in some marine dinoflagellates. Botanica Marina. 5: 121-127. 21. Dodge JD. 1975. A survey of chloroplast ultrastructure in the dinophyceae. Phycologia. 14(4): 253-263. 22. Dodge JD. 1984. The functional and phylogenetic significance of dinoflagellate eyespots. Biosystems. 16: 259-267. 23. Dodge JD. 1989. Phylogenetic relationships of dinoflagellates and their plastids. In: The Chromophyte Algae: Problems and Perspectives, eds. Green JC, Leadbeater BSC and Diver WL. Systematics Association Special Volume 38, pp. 207-227. 24. Douglas SE, Murphy CA, Spencer DF and Gray MW. 1991. Cryptomonad algae are evolutionary chimaeras of two phylogenetically distinct unicellular eukaryotes. Nature. 350: 148-151. 25. Douglas SE. 1998. Plastid evolution: origins, diversity, trends. Current Opin. Genet. Dev. 8: 655-661. 26. Douglas S, Zauner S, Fraunholz M , Beaton M , Penny S, Deng LT, Wu X, Reith M , Cavalier-Smith T and Maier UG. 2001. The highly reduced genome of an enslaved algal nucleus. Nature. 410: 1091-1096. 114 27. Dover G. 1982. Molecular drive: a cohersive mode of species evolution. Nature 299: 111-117. 28. Eberhard S, Drapier D and Wollman FA. 2002. Searching limiting steps in the expression of chloroplast-encoded proteins: relations between gene copy number, transcription, transcript abundance and translation rate in the chloroplast of Chlamydomonas reinhardtii. The Plant Journal. 31(2): 149-160. 29. Elbrachter M and Schnepf E. 1996. Gymnodinium chlorophorum, anew, green, bloom-forming dinoflagellate (Gymnodiniales, Dinophyceae) with a vestigial prasinophyte endosymbiont. Phycologia. 35(5): 381-393. 30. Fast NM, Kissinger JC, Roos DS and Keeling PJ. 2001. Nuclear-encoded, plastid-targeted genes suggest a single common origin for apicomplexan and dinoflagellate plastids. Mol. Biol. Evol. 18(3): 418-426. 31. Fensome RA, Saldarriaga JF and Taylor FJR. 1999. Dinoflagellate phylogeny revisited: reconciling morphological and molecular based phylogenies. Grana. 3 8 : 66-80. 32. Gibbs SP. 1978. The chloroplasts of Euglena may have evolved from symbiotic green algae. Can. J. Bot. 56: 2883-2889. 33. Gibbs SP. 1981. The chloroplasts of some algal groups may have evolved from endosymbiotic eukaryotic algae. Ann. N. Y. Acad. Sci. 361: 193-207. 34. Gray MW, Burger G and Lang BF. 1999. Mitochondrial evolution. Science 283: 1476-1481. 115 35. Green BR. 1976. Covalently closed minicircular DNA associated with Acetabularia chloroplasts. Biochimica et Biophysica Acta 447: 156-166. 36. Heins L and Soil J. 1998. Chloroplast biogenesis: mixing the prokaryotic and the eukaryotic? Curr. Biol. 8: R215-R217. 37. Hibberd DJ and Norris RE. 1984. Cytology and ultrastructure of Chlorarachnion reptans (Chlorarachniophyta divisio nova, chlorarachniophyceae classis nova). J. Phycol. 20: 310-330. 38. Hiller RG. 2001. 'Empty' minicircles and petB/atpA and psbD/psbE (cyt&559 a) genes in tandem in Ampidinium carterae plastid DNA. FEBS Letters. 505: 449-452. 39. Hippel PHV. 2000. The recombination-replication interface. Trend Biochem. Sci. 25: 155. 40. Hoegh-Guldberg O. 1999. Climate change, coral bleaching and the future of the world's coral reefs. Mar. Freshwater Res. 50: 839-866. 41. Ishida K and Green BR. 2002. Second- and third-hand chloroplasts in dinoflagellates: Phylogeny of oxygen-evolving enhancer 1 (PsbO) protein reveals replacement of a nuclear-encoded plastid gene by that of a haptophyte tertiary endosymbiont. Proc. Natl. Acad. Sci. USA. 99(14): 9294-9299. 42. Jacobs JD, Ludwig JR, Hildebrand M , Kukel A, Feng TY, Ord RW and Volcani BE. 1992. Characterization of two circular plasmids from the marine diatom Cylindrotheca fusiformis: plasmids nybridize to chloroplast and nuclear DNA. Mol. Gen. Genet. 233: 302-310. 116 43. Jain R, Rivera MC and Lake J A. 1999. Horizontal transfer among genomes: The complexity hypothesis. Proc. Natl. Acad. Sci. USA. 96: 3801-3806. 44. Jeffrey SW, Sielicki M and Haxo FT. 1975. Chloroplast pigment patterns in dinoflagellates. J. Phycol. 11: 374-384. 45. Jenks A and Gibbs SP. 2000. Immunolocalization and distribution of form II Rubisco in the pyrenoid and chloroplast stroma of Amphidinium carterae and Form I Rubisco in the symbiont-derived plastids of Peridinium foliaceum (Dinophyceae). Phycol. 36: 127-138. 46. Jordan DB and Ogren WL. 1981. Species variation in the specificity of ribulose biphosphate carboxylase/oxygenase. Nature. 291: 513-515. 47. Kawata M , Harada T, Shimamoto Y, Oono K and Takaiwa F. 1997. Short inverted repeats function as hotspots of intermolecular recombination giving rise to oligomers of deleted plastid DNAs (ptDNAs). Curr. Genet. 31(2): 179-184. 48. Kelchner SA and Wendel JF. 1996. Hairpins create minute inversions in non-coding regions of chloroplast DNA. Curr. Genet. 30: 259-262. 49. Kobayashi T, Takahara M , Miyagishima SY, Kuroiwa H, Sasaki N , Ohta N, Matsuzaki M and Kuroiwa T. 2002. Detection and localization of a chloroplast-encoded HU-like protein that organizes chloroplast nucleoids. Plant Cell 14: 1579-1589. 50. Koller B and Delius H. 1982. Origin of replication in chloroplast DNA of Euglena gracilis located close to the region of variable size. The EMBO Journal. 1(8): 995-998. 117 51. Kolodner RD and Tewari K X . 1975a. Chloroplast DNA from higher plants replicates by both the Cairns and the rolling circle mechanism. Nature. 256: 708-711. 52. Kolodner R and Tewari KK. 1975b. Presence of displacement loops in the covalently closed circular chloroplast deoxyribonucleic acid from higher plants. J. Biol. Chem. 250(22): 8840-8847. 53. Kowalczykowski S. 2000. Initiation of genetic recombination and recombination-dependent replication. Trend Biochem. Sci. 25: 156-165. 54. Kunnimalaiyaan M and Nielsen BL. 1997. Fine mapping of replication origins (oriA and oriB) in Nicotiana tabacum chloroplast DNA. Nucleic Acids Res. 25(18): 3681-3686. 55. Kunnimalaiyaan M , Shi F and Nielsen BL. 1997. Analysis of tobacco chloroplast DNA replication origin (oriB) downstream of the 23 s rRNA gene. J. Mol. Biol. 268: 273-283. 56. La Claire IIJW, Loudenslager C M and Zuccarello GC. 1998. Characterization of novel extrachomosomal DNA from giant-celled marine green algae. Curr. Genet. 34:204-211. 57. Lilly JW, Havey MJ, Jackson SA and Jiang J. 2001. Cytogenomic analyses reveal the structural plasticity of the chloroplast genome in higher plants. The Plant Cell. 13: 245-254. 58. Liu JW and Rose RJ. 1992. The spinach chloroplast chromosome is bound to the thylakoid membrane in the region of the inverted repeat. Biochem. Biophys. Res. Commun. 184: 993-1000. 118 59. Lou JK, Wu M , Chang CH and Cuticchia AJ. 1987. Localization of a r-protein gene within the chloroplast DNA replication origin of Chlamydomonas. Curr. Genet. 1 1 : 537-541. 60. Lu Z, Kunnimalaiyaan M and Nielsen BL. 1996. Characterization of replication origins flanking the 23S rRNA gene in tobacco chloroplast DNA. Plant Mol.Biol. 32 : 693-706. 61. Martin W and Herrmann RG. 1998. Gene transfer from organelles to the nucleus: How much, what happens and why? Plant Physiol. 1 1 8 : 9-17. 62. Martin W, Stoebe B, Gorernykin V, Hansmann S, Hasegawa M and Kowallik KV. 1998. Gene transfer to the nucleus and the evolution of chloroplasts. Nature. 3 9 3 : 162-165. 63. Martin W, Rujan T, Richly E, Hansen A, Comelsen S, Lins T, Leister D, Stoebe B, Hasegawa M and Penny D. 2002. Evolutionary analysis oiArahidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc. Natl. Acad. Sci. USA. 99(19): 12246-12251. 64. Mereschkowsky C. 1905. Uber Natur und Ursprung der Chromatophoren im Pflanzenreiche. Biol. Centralbl. 25 : 593-604. English translation in Martin W and Kowallik KV. 1999. Annotated English translation of Mereschkowsky's 1905 paper "Uber Natur und Ursprung der Chromatophoren im Pflanzenreiche" Eur. J. Phycol. 34 : 287-295. 65. McFadden GI. 2001. Primary and secondary endosymbiosis and the origin of plastids. J. Phycol. 37 : 951-959. 119 66. Morse D, Salois P, Markovic P arid Hastings JW. 1995. A nuclear-encoded form II RuBisCO in dinoflagellates. Science. 268: 1622-1624. 67. Nerozzi A M and Coleman AW. 1997. Localization of plastid DNA replication on a nucleoid structure. Amer. J. Bot. 84(8): 1028-1041. 68. Norman JE and Gray MW. 2001. A complex organization of the gene encoding cytocgrome oxidase subunit 1 in the mitochondrial genome of the dinoflagellate, Crypthecodinium cohnii: homologous recombination generates two different coxl open reading frames. J. Mol. Evol. 53: 351-363. 69. Oldenburg DJ and Bendich AJ. 2001. Mitochondrial DNA from the liverwort Marchantia polymorpha: circularly permuted linear molecules, head-to-tail concatemers, and a 5' protein. J. Mol. Biol. 310: 549-562. 70. Osteryoung KW. 2000. Organelle fission. Crossing the evolutionary divide. Plant Physiol. 123: 1213-1216. 71. Palmer JD. 1991. Plastid chromosomes: Structure and evolution. In: The Molecular Biology of Plastids. Eds. Bogorad L and Vasil IK. Academic Press, San Diego, USA. pp. 5-53. 72. Palmer JD, Adams KL, Cho Y, Parkinson CL, Qiu Y L and Song K. 2000. Dynamic evolution of plant mitochondrial genomes: Mobile genes and introns and highly variable mutation rates. Proceedings of the National Academy of Sciences USA 97(13): 6960-6966. 73. Pearson CE, Zorbas H, Price GB and Zannis-Hanjopoulos M . 1996. Inverted repeats, stem-loops, and cruciforms:significance for initiation of DNA replication. J. Cell. Biochem. 63: 1-22. 120 74. PfeisterLA. 1984. Sexual reproduction. In: Dinoflagellates. ed. Spector DL. Academic Press Inc. pp. 181-199. 75. Preiser PR, Wilson RJM, Moore PW, McCready S, Hajibagheri MAN, Blight KJ, Strath M and Williamson DH. 1996. Recombination associated with replication of malarial mitochondrial DNA. EMBOJ. 15(3): 684-693. 76. Raymond J, Zhaxybayeva O, Gogarten IP, Gerdes SY and Blankenship RE. 2002. Whole-genome analysis of photosynthetic prokaryotes. Science 298: 1616-1620. 77. Reith M and Munholland J. 1993. A high-resolution gene map of the chloroplast genome of the red alga Porphyra purpurea. The Plant Cell. 5: 465-475. 78. Ris H and Plaut W. 1962. Ultrastructure of DNA-containing areas in the chloroplast of Chlamydomonas. J. Cell Biol. 13: 383-391. 79. Rivera MC, Jain R, Moore JE and Lake JA. 1998. Genomic evidence for two functionally distinct gene classes. Proc. Natl. Acad. Sci. USA. 95: 6239-6244. 80. Rizzo PJ. 1981. Comparative aspects of basic chromatin proteins in dinoflagellates. Biosystems. 14: 433-443. 81. Rizzo PJ. 1987. Biochemistry of the dinoflagellate nucleus. In: The Biology of Dinoflagellates. Ed. Taylor F.J.R., pp. 143-173. 82. Rizzo PJ. 1991. The enigma of the dinoflagellate chromosome. J.Protozool. 38(3): 246-252. 83. Rizzo PJ and Nooden LD. 1973. Isolation and chemical composition of dinoflagellate nuclei. J. Protozool. 20(5): 666-672. 121 84. Robison M M and Wolyn DJ. 2002. Complex organization of the mitochondrial genome of petaloid CMS carrot. Mol. Genet. Genomics 268: 232-239. 85. SagerR. 1954. Mendelian and non-Mendelian inheritance of streptomycin resistance in Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA. 40:356-363. 86. Sager R and Ishida MR. 1963. Chloroplast DNA in Chlamydomonas. Proc. Natl. Acad. Sci. USA. 50: 725-730. 87. Saldarriaga JF, Taylor FJR, Keeling PJ and Cavalier-Smith T. 2001. Dinoflagellate nuclear SSU rRNA phylogeny suggests multiple plastid losses and replacements. J. Mol. Evol. 53: 204-213. 88. Sambrook J, Fritsch E and Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York. 89. Schlunegger B and Stutz E. 1984. The Euglena gracilis chloroplast genome: structural features of a DNA region possibly carrying the single origin of DNA replication. Current Genetics. 8: 629-634. 90. Schnepf E and Elbrachter M . 1988. Cryptophycean-like double membrane-bound chloroplast in the dinoflagellate, Dinophysis Ehrenb.: Evolutionary, phylogenetic and toxicological implications. Botanica Acta. 101: 196-203. 91. SigeeDC. 1984. Structural DNA and genetically active DNA in dinoflagellate chromosomes. Biosystems. 16: 203-210. 92. Simpson CL and Stern DB. 2002. The treasure trove of algal chloroplast genomes. Surprises in architecture and gene content, and their functional implications. Plant Physiol. 129: 957-966. 122 93. Simpson L, Thiemann OH, Savill NJ, Alfonzo JD and Maslov DA. 2000. Evolution of RNA editing in trypanosome mitochondria. PNAS. 97(13): 6986-6993. 94. Smith AC and Purton A. 2002. The transcriptional apparatus of algal plastids. Eur. J. Phycol. 37(3): 301-311. 95. SpectorDL. 1984. Dinoflagellates: An introduction. In: Dinoflagellates. ed. Spector DL. Academic Press Inc. pp. 1-9. 96. Staub JM and Maliga P. 1994. Extrachromosomal elements in tobacco plastids. Proc. Natl. Acad. Sci. USA. 91: 7468-7472. 97. Stoebe B and Kowallick KV. 1999. Gene-cluster analysis in chloroplast genomics. Trends in Genetics. 15(9): 344-347. 98. SuguiraM. 1992. The chloroplast genome. Plant Mol. Biol. 19: 149-168. 99. Suguira M , Hirose T and Sugita M . 1998. Evolution and mechanism of translation in chloroplasts. Annu. Rev. Genet. 32: 437-459. 100. Suzuki H, Ingersoll J, Stem DB and Kindle KL. 1997. Generation and maintenance of tandemly repeated extrachromosomal plasmid DNA in Chlamydomonas chloroplasts. 11(4): 635-648. 101. TakahashiY. 1998. Chloroplast-encoded small subunits of the three multiprotein complexes in photosynthetic electron transport. J. Plant Res. 111(1101): 101-111. 102. Takishita K and Uchida A. 1999. Molecular cloning and nucleotide sequence analysis of psbA from the dinoflagellates: Origin of the dinoflagellate plastid. Phycological Research. 47: 207-216. 123 103. Tangen K and Bjornland T. 1981. Observations on pigments and morphology of Gyrodinium aureolum Hulburt, a marine dinoflagellate containing 19'-hexanoyloxyfucoxanfhin as the main carotenoid. J. Plank. Res. 3(3): 389-401. 104. TappanHN. 1980. The paleobiology of plant protists. W.H. Freeman and Company, San Franciso, USA. 105. Taylor FJR. 1980. On dinoflagellate evolution. Biosystems. 13: 65-108. 106. Taylor FJR. 1987. The Biology of Dinoflagellates. Blackwell Scientific, Oxford, England. 107. Tengs T, Dahlberg OJ, Shalchian-Tabrizi K, Klaveness D, Rudi K, Delwiche CF and Jakobsen KS. 2000. Phylogenetic analyses indicate that the 19'-hexanoyloxy-fucoxanthin-containing dinoflagellates have tertiary plastids of haptophyte origin. Mol. Biol. Evol. 17(5): 718-729. 108. Waddell J, Wang X M and Wu M . 1984. Electron microscopic localization of the chloroplast DNA replicative origins in Chlamydomonas reinhardtii. Nuleic Acids Res. 12(9): 3843-3856. 109. Wakasugi T, Nagai T, Kapoor M , Sugita M , Ito M , Ito S, Tsudzuki J, Nakashima K, Tsudzuki T, Suzuki Y, Hamada A, Ohta T, Inamura A, Yoshinaga K and Suguira M . 1997. Complete nucleotide sequence of the chloroplast genome for the green alga Chlorella vulgaris: The existence of genes possibly involved in chloroplast division. Proc. Natl. Acad. Sci. USA. 94: 5967-5972. 110. Watanabe KI, Bessho Y, Kawasaki M and Hori H. 1999. Mitochondrial genes are found on minicircle DNA molecules in the mesozoan animal Dicyema. J. Mol. Biol. 286: 645-650. 124 111. Weeden NF. 1981. Genetic and biochemical implication of the endosymbiotic origin of the chloroplast. J. Mol. Evol. 17: 133-139. 112. Westphal S, Soil J, Vothknetch UC. 2001. A vesicle transport system inside chloroplasts. FEBS Letters. 506:257-261. 113. Wilcox LW and Wedemayer GJ. 1984. Dinoflagellate with blue-green chloroplasts derived from an endosymbiotic eukaryote. Science. 227: 192-194. 114. Williamson DH, Denny PW, Moore PW, Sato S, McCready S, and Wilson RJM. 2001. The in vivo conformation of the plastid DNA of Toxoplasma gondii: implications for replication. J. Mol. Biol. 306: 157-166. 115. Williamson D. 2002. The curious history of yeast mitochondrial DNA. Nature Rev. Genet. 3: 1-7. 116. Williamson DH, Preiser PR, Moore PW, McCready S, Strath M and Wilson RJM. 2002. The plastid DNA of the malaria parasite Plasmodium falciparum is replicated by two mechanisms. Molecular Microbiology. 45(2): 533-542. 117. Wu M , Lou JK, Chang DY, Chang CH and Nie ZQ. 1986. Structure and function of a chloroplast DNA replication origin of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA. 83: 6761-6765. 118. Zhang Z, Cavalier-Smith T and Green BR. 2001. A family of selfish minicircular chromosomes with jumbled chloroplast gene fragments from a dinoflagellate. Mol. Biol. Evol. 18(8): 1558-1565. 119. Zhang Z, Cavalier-Smith T and Green BR. 2002. Evolution of dinoflagellate unigenic minicircles and the partially concerted divergence of theur putative replicon origins. Mol. Biol. Evol. 19(4): 489-500. 125 120. Zhang Z, Green BR and Cavalier-Smith T. 1999. Single gene circles in dinoflagellate chloroplast genomes. Nature. 400: 155-159. 121. Zhang Z, Green BR and Cavalier-Smith T. 2000. Phylogeny of ultra-rapidly evolving dinoflagellate chloroplast genes: a possible common origin for sporozoan and dinoflagellate plastids. J. Mol. Evol. 51: 26-40. 126 Appendix 1 : Primer sequences Primer Name Primer Sequence (5' to 3') Comment barl GTTGTGAGCGTTACGTTCRTGCATNACYTC Zhauduo Zhang psbA bafl GGTCAAGGTTCTTTCTCTGAYGGNATGCC Zhauduo Zhang psbA baf3 ATCTTCGCTCCACCAGTTGAYATHGAYGG Zhauduo Zhang psbA AEbAFi GGTGTGGCTGGTGTCTTTGGAGGTTC AEbARi TCTGCACGATTCATGATATCTGCCCAGC AEbAFo CAGCACTGGGTGTGAGTACAATGGC AEbARo GTGAGGATGTGACTAATGACCCATGC AEpsbARo2 GCCAGGCCACTAAGTGGTAACATT direct seq. primer AEpsbDFi ACGTTGGCTTCTCATGGGAGGTTTGT AEpsbDRi GGTCCACATACCTGCTAGAGGTACA AEpsbDFo TTCGTTCGGCCTCGCCTGTACAGC AEpsbDRo CCAGCTAGATTGCCCAAGTGGATA AEbDRo2 GAACTCCAAGTAACCTAGCTTTAGCTC direct seq. primer AEpsbCFi GGAAGATCTGATAGGTGGTCATTATTGGG AEpsbCRi GTCCAATGCCAAGAGGTTAACCAAGA AEpsbCFo GCAGAGTACATGACTTCTGCACCATT AEpsbCRo GCCATATGGCACCTAGAATAGTGAAAAGTG DpsaAFi CATGCWGATGCDCATGACTT degenerate DpsaARi CCWARRAAWACRTGATCCCA degenerate DpetDFi GGTCAYAAYTAYTATGGTGAACC degenerate DpetDRi TTRAADGARAARTACCATTC degenerate DpsaAFi2 CATGCWGAYGYDCAYGAYTT degenerate DpsaARi2 CCWARRAANACDTGRTCCCA degenerate DpetDFi2 GBCAYARYTAYTAYGGBGAAC degenerate DpetDRi2 TKRAADRARARRTACCATTCWGG degenerate Sequencing psbA long PCR clones bAXLR2 CAGCAACAGGTTCTCGTATACCA C-term end of psbA bAXLF3 CTGACATTCTGAAAAAGGCCGGCA conserved repeat 12F2 CCATTATCGGACTAGTGCTGTGAG bAXL12R3 GGTGCACCGACAACTTTCAGATAG bAXL12R4 TATTGGTTGTGACCGGTTGTGACC 12R5 CGACACGAGTTGTTTGGGTGAATC bAXL15F2 GGTAGGAGATGGTGATTTCACC bAXL15F3 GAACCTGAAGCTGCGAAGCATAAG bAXL15F4 ATCATTGACGCACTCGCCCATCTT bAXL15R3 CCAACGAAGATGGACCTTGAATTG bAXL15R4 TAGACCGTACTATCAGAGGACCGT 17F2 CTATTCGGACTAGTTGCTTGTGAT bAXL17R3 TTGATTGGACCTCGAAACACCGC not good 17R3B GTTGACCTTGTTTGACCTCTGGAG bAXL18F2 GGAGATGGCTTGTGTGAGCCTT not good bAXL18F2B GTGTGAGCCTTCCCTTGAGTCTTT 127 Primer Name Primer Sequence (5' to 3') Comment 18F2C AGTGCTTGGCCTAAATGAGATCCC bAXL18R3 TAACCTCGAGACACAGCATTTGGC 18R3.5 ATCTCCACATCAAGGTTGTTTGACC bAXL18R4 GGTTCTAGACCACGATTGTTAACCG 128 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090989/manifest

Comment

Related Items