UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Towards finding the genes that cause cleft lip in a multifactorial mouse model Dewell, Sarah Lynne 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-0215.pdf [ 6.04MB ]
Metadata
JSON: 831-1.0090940.json
JSON-LD: 831-1.0090940-ld.json
RDF/XML (Pretty): 831-1.0090940-rdf.xml
RDF/JSON: 831-1.0090940-rdf.json
Turtle: 831-1.0090940-turtle.txt
N-Triples: 831-1.0090940-rdf-ntriples.txt
Original Record: 831-1.0090940-source.json
Full Text
831-1.0090940-fulltext.txt
Citation
831-1.0090940.ris

Full Text

TOWARDS FINDING THE GENES THAT C A U S E CLEFT LIP IN A MULTIFACTORIAL MOUSE MODEL by S A R A H L Y N N E DEWELL B.Sc , The University of British Columbia, 1999 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES (Faculty of Medicine; Department of Medical Genetics) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH C O L U M B I A APRIL, 2003 © Sarah Lynne Dewell, 2003 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada DE-6 (2/88) A B S T R A C T Nonsyndromic cleft lip (with or without cleft palate) is one of the most common birth defects. It occurs in approximately one in a thousand live births, although the frequency varies with geographical location, ethnic background and socioeconomic status. Cleft lip is a multifactorial threshold trait whose etiology includes genetic, environmental and chance factors. Despite many studies on human populations, no candidate gene has been shown conclusively to be involved in the risk of developing the defect. There is also no consensus on the role of any specific environmental factors that have been proposed to increase the risk of cleft lip. The " A " strains of inbred mice are the only known mouse strains with nonsyndromic cleft lip. Cleft lip is genetically complex in the " A " strains, thus providing a good model of the human condition. The mouse model used in this study was A/WySn, which has a frequency of cleft lip of 20-30%. Risk of cleft lip in A/WySn is caused by the combined effects of a recessive mutation (clfl), a semi-dominant mutation (Clf2), and a genetic maternal effect. The recessive mutation in the gene clfl has been mapped to a 2 cM region on mid-distal mouse chromosome 11. A new backcross panel was generated for this project from the initial cross of A/WySn to AXB-4/Pgn. 70 cleft lip embryos were generated, and polymorphic markers were used to look for recombinants between clfl and the markers, to confirm the boundaries of the clfl candidate interval and to try to reduce the size of the interval. Five recombinants were found that confirmed the lower breakpoint of the candidate interval. In addition, using new polymorphic markers from within genes, the new panel placed several genes inside or outside the interval. In the second part of this project, the expression of all of the known candidate genes was examined in adult testis tissue and in Day 10-11 embryo heads. The expression of candidate genes was first examined in adult testis tissue, where a variant was seen in the gene Crhr. This gene was then studied in greater detail. Next, because the critical time u of lip formation is Day 10 - Day 11 in the mouse, RT-PCR expression of 9 known genes (Arf2, Itgb3, Crhr, Gosr2, Wnt3, Wntl5, Mapt, Myla, Nsf) and 1 putative gene (KIAA1267) in the clfl candidate interval was examined in embryonic heads from Day 10 and Day 11 embryos. A l l 9 known genes are expressed at the critical time in development, while the predicted gene is not. In the third part of this project, 6-9 polymorphic markers were used to compare the " A " strain haplotype in the clfl candidate interval with 37 other inbred strains. The data indicate that the " A " strain shares its haplotype with only one other strain, CBA/J . This finding will be useful in confirming a putative clfl mutation, when found. In the fourth part of this project, one region of the mouse genome was examined for a third locus contributing to the risk of cleft lip in A/WySn. The region was examined in the new backcross panel for non-random segregation of polymorphic markers; however, no evidence of an association with cleft lip was seen. iii T A B L E OF CONTENTS Abstract 1 1 Table of Contents iv List of Tables vi List of Figures viii List of Appendices xi List of Abbreviations xii Acknowledgements xiv CHAPTER I: INTRODUCTION 1 I. Development of the lip 1 II. Other defects associated with cleft lip. 6 III. Genetics of cleft lip 7 IV. Environmental factors in cleft lip 20 V. Mouse models of cleft lip 25 VI. A/WySn strain genetics and embryology 29 VII. Rationale and approach to my studies 30 CHAPTER II: G E N E R A L MATERIALS A N D METHODS 33 I. Mouse stocks and maintenance 33 a) Mouse stocks 33 A/WySn 33 AXB-4/Pgn 33 b) Mouse maintenance 33 II. Technical Methods 34 a) D N A Extraction 34 b) Polymerase Chain Reaction 34 c) Visualization of PCR products 34 d) Sources of PCR primers for SSLPs and source of information on location of theSSLPs i CHAPTER III, SECTION i : DEFINING THE clfl CANDIDATE INTERVAL IN A/WySn USING A BACKCROSS P A N E L OF 70 CLEFT LIP E M B R Y O S 38 I. Introduction. 38 II. Materials and Methods 40 III. Results 42 IV. Discussion 46 iv CHAPTER III, SECTION i i : EXPRESSION OF clfl CANDIDATE GENES IN A D U L T TISSUE A N D EMBRYONIC TISSUE. 50 I. Introduction 50 II. Materials and Methods 52 III. Results 62 IV. Discussion 84 CHAPTER III, SECTION i i L H A P L O T Y P E ANALYSIS OF THE clfl CANDIDATE • INTERVAL FOR 37 INBRED STRAINS. 90 I. Introduction 90 II. Materials and Methods 90 III. Results 92 IV. Discussion 96 CHAPTER IV: INVESTIGATION OF A POSSIBLE THIRD LOCUS FOR RISK OF CLEFT LIP IN A/WySn ON CHROMOSOME 7 97 I. Introduction 97 II. Materials and Methods 98 III. Results 100 IV. Discussion 100 CHAPTER V : G E N E R A L DISCUSSION A N D FUTURE DIRECTIONS 109 Electronic Sources 113 Literature Cited 114 Appendices 122 v LIST OF T A B L E S Table 1.1. Review of studies looking for associations or linkage between chromosome 6p and cleft lip in assorted geographic populations 11 Table 1.2. Review of studies looking for association or linkage between transforming growth factor-a (2pl3) and cleft lip in assorted geographic populations 12 Table 1.3. Review of studies looking for association or linkage between BCL3 (19ql3.2) and cleft lip in assorted geographic populations 14 Table 1.4. Review of studies looking for association or linkage between retinoic acid receptor alpha (17q21.1) and cleft lip in assorted geographic populations 16 Table 1.5. Review of other genes examined for a role in the etiology of human nonsyndromic cleft lip 17 Table 1.6. Review of studies looking at interactions between various environmental agents and the occurrence or recurrence of nonsyndromic cleft lip 21 Table 2.1. Primer sequence and chromosomal location of new polymorphic markers 36 Table 3.1. PCR conditions and estimated product sizes for informative markers used on BCi panel of cleft lip embryos 43 Table 3.2. Summary of backcrosses done to generate panel of cleft lip embryos 44 Table 3.3. cDNA specific primers designed to examine gene expression 57 Table 3.4. Sequence and conditions for various primers used in the analysis of the gene Crhr 59 Table 3.5. Test of polymorphism of the Crhr splice site variants found in A/WySn mice 74 Table 3.6. cDNA expression in Day 10 A/WySn and AXB-4 embryo heads for clfl candidate genes 77 Table 3.7. Summary of results of search for known embryonic expression of genes predicted to be in the clfl candidate interval by the Ensembl gene prediction program 79 Table 3.8. Summary of predicted genes from the Fgenesh++ gene prediction program tested for known expression in a modified B L A S T database for E9-E11 mouse embryos and E l 1 mouse embryo heads 81 vi Table 3.9. Summary of predicted genes in clfl candidate interval as predicted by mRNA matches tested for known expression in a modified BLAST database for E9-E11 mouse embryos and E l 1 mouse embryo heads 83 Table 4.1. PCR conditions and estimated product sizes (to the nearest 5bp) of informative markers used in AXB-4/Pgn haplotype analysis and on BCj cleft lip panel 99 Table 4.2. Genotypes of A.AXB-4 (BCi) cleft lip embryos on chromosome 7 106 vii LIST OF FIGURES Figure 1.1. Diagram showing the migration of neural crest cells into the branchial arches • 3 Figure 1.2. Diagram showing the developing embryonic face at five weeks of development 4 Figure 1.3. Diagram of the ventral view of the primary palate, secondary palate, lip and nose 5 Figure 1.4. clfl and Clfl cleft lip liability intervals located on chromosomes 11 and 13 respectively ; 27 Figure 1.5. Origin of the " A " strains of mice 31 Figure 3.1. clfl candidate interval on mouse chromosome 11 showing candidate genes mapped to interval 39 Figure 3.2. Generation of backcross between A/WySn and A X B - 4 41 Figure 3.3. Summary of polymorphic markers from the clfl candidate interval in a cleft lip backcross embryo panel, showing the breakpoints for each recombinant 45 Figure 3.4. Results of PCR on cleft lip embryo XI56 for polymorphic markers in the clfl candidate interval 47 Figure 3.5. clfl candidate interval on mouse chromosome 11 showing all genes known to be in the interval based on previous mapping data by our lab plus information in the UCSC and/or Ensembl databases 51 Figure 3.6. Diagram of exons 1-6 of Crhr with the location of the primers giving a difference in intensity between A/WySn and A X B - 4 with amplification of testis cDNA 63 Figure 3.7. Results of PCR amplification by Crhr pl5/pl6 on A/WySn testis cDNA and AXB-4 testis cDNA showing intensity difference between the two strains 64 Figure 3.8. Results of duplex PCR with fi-actin and Crhr pl7/pl6 primer pairs on A/WySn adult testis cDNA, AXB-4 adult testis cDNA, H 2 0 control, and genomic D N A controls for A/WySn and AXB-4 showing verification of intensity difference 65 viii Figure 3.9. Results of PCR amplification by Crhr p 17/p 16 on A/WySn adult testis cDNA showing extra 800bp product 67 Figure 3.10. Submission of sequence of 800bp fragment from Crhr p i 7 to the BLAST non-redundant and high throughput genome sequence databases produced the matches diagrammed above with percent identity shown in brackets.. .68 Figure 3.11. Submission of sequence of 800bp fragment from Crhr p i 6 to B L A S T non-redundant and high throughput genome sequence databases produced the matches diagrammed above with percent identity shown in brackets 69 Figure 3.12. Diagram illustrating the results of sequencing the Crhr p i 7/p 16 A/WySn 800bp PCR product with the reverse primer Crhr pl6 70 Figure 3.13. A/WySn and A X B - 4 genomic sequence illustrating the sequence difference located near the intron 4/exon 5 splice site 72 Figure 3.14. A/WySn and A X B - 4 genomic sequence illustrating a base pair change located near the putative splice site for the alternatively spliced fragment 73 Figure 3.15. PCR amplification of Day 10 embryo head cDNA from A/WySn and A X B - 4 by Crhr P 17/pl6 Figure 3.16. Agarose gel showing day 10 embryonic expression data from RT-PCR of candidate genes in the clfl interval in A/WySn and control strain embryo heads 78 Figure 3.17. Crhr protein and putative truncated protein from alternatively spliced Crhr fragment 86 Figure 3.18. Origins of several inbred strains of mice, showing particularly the relationship between A/WySn and CBA/J 91 Figure 3.19. Haplotypes for 17 inbred strains generated by PCR amplification of polymorphic markers in clfl candidate interval 93 Figure 3.20. Results of PCR amplification of the polymorphic marker for Wntl5 on 17 inbred strains 94 Figure 3.21. Haplotypes for 23 inbred strains generated by PCR amplification of polymorphic markers in the clfl candidate interval 95 Figure 4.1. Distribution pattern of markers on mid-distal chromosome 11 for AXB-4/Pgn ix Figure 4.2. Distribution pattern of markers on chromosome 13 for AXB-4/Pgn 102 Figure 4.3. Distribution pattern of markers on chromosome 7 for AXB-4/Pgn 103 Figure 4.4. Distribution pattern of markers on chromosome 18 for AXB-4/Pgn 104 Figure 4.5. Distribution pattern of markers on proximal chromosome 11 for AXB-4/Pgn 105 x LIST OF APPENDICES Appendix A . Data on embryos collected for R N A 122 Appendix B. Additional information on primers for analysis of gene expression 125 Appendix C. Sequence data from the PCR product produced by amplifying pools of adult testis cDNA with the primer pair Crhr p 15/p 18 126 Appendix D. Rodent consensus splice site from Shapiro and Senapathy, 1987 127 Appendix E. Sequence data from the PCR product produced by amplifying a pool of genomic D N A from C B A / J using the primer pairs CRSP1 F/R and CRSP2 F/R for intron 4 of Crhr 128 xi LIST OF ABBREVIATIONS Arfl Arf2 bp BC B C L BCL3 Chr clfl Clf2 CLPTM1 c M Crhr Csflr Cyb561 DEPC D N A Dlx3 EDN1 EPHX1 F13A Fes GABRB3 Gosrl Gpil Gprk6 GSTM1 Iapl IRF6 Itga2 Itgb3 L C L Lect2 Mapt MGI Mit MSX1 Msx2 MTHFR Myla NAPS NCBI Nsf ADP-ribosylation factor 1 ADP-ribosylation factor 2 base pair Backcross Bilateral cleft lip B-cell leukemia/lymphoma 3 Chromosome Cleft lip 1 Cleft lip 2 Cleft lip and palate associated transmembrane protein 1 centimorgan (1 c M = unit of measurement used to describe the length of chromosome where a recombination event will occur 1% of the time, approximately 2 Mb in mice) Corticotropin releasing hormone receptor Colony stimulating factor 1 receptor Cytochrome b-561 Diethyl Pyrocarbonate Deoxyribonucleic Acid Distal-less homeobox 3 Endothelin 1 Epoxide hydrolase 1, microsomal Coagulation factor XIII, alpha subunit Feline sarcoma oncogene Gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3 Golgi SNAP receptor complex member 2 Glucose phosphate isomerase 1 G protein-coupled receptor kinase 6 glutathione S-transferase, mu 1 Intracisternal A-particle proviral element Interferon regulatory factor 6 Integrin alpha 2 Integrin beta 3 Left cleft lip Leukocyte cell-derived chemotaxin 2 Microtubule-associated protein tau Mouse Genome Informatics Massachusetts Institute of Technology Homeo box, msh-like 1 Homeo box, msh-like 2 5,10-methylenetetrahydrofolate reductase Myosin light chain, alkali, cardiac atria Nucleic Acid Protein Service Unit National Center for Biotechnology Information N-ethylmaleimide sensitive fusion protein PCR Polymerase Chain Reaction Pdea Phosphodiesterase 6A, cGMP-specific, rod, alph PPS Popliteal pterygium syndrome PVRL1 Poliovirus receptor-related 1 Pvrl2 Poliovirus receptor-related 2 SDP Strain Distribution Pattern RAM Retinoic Acid Receptor Alpha RCL Right cleft lip RNA Ribonucleic Acid SSLP Simple Sequence Length Polymorphism Tanneal Annealing temperature Taml Tosyl arginine methylesterase 1 Tcfap2a Transcription factor AP-2, alpha TDT Transmission disequilibrium test TGFA Transforming growth factor alpha TGFB2 Transforming growth factor, beta 2 TGFB3 Transforming growth factor, beta 3 Tlk2 Tousled-like kinase 2 Tyr Tyrosinase V-hrs Voltage x hours VWS Van der Woude syndrome Wnt3 Wingless-related M M T V integration site 3 Wnt3a Wingless-related M M T V integration site 3A WntlS Wingless-type M M T V integration site 15 A C K N O W L E D G E M E N T S First, I would like to thank my supervisors Dr. Diana Juriloff and Dr. Muriel Harris for providing me with the opportunity to experience lab work and for offering guidance and encouragement throughout my studies. Thanks also to my co-workers and fellow graduate students for sharing their knowledge and providing support. Special thanks to Diana Mah, Mona Wu, and Sarah Kennedy for all of their expertise, advice, and comic relief; and to Cindy Chao for all of her hard work. Finally, I would like to thank my family and friends for all of their love and encouragement. I dedicate this work to my sister Amy. xiv Chapter I: Introduction Facial clefts are serious defects that affect many children worldwide. Left unrepaired, as is the case in many developing countries, the cleft can lead to various health, social and emotional problems. Even when the cleft is repaired, the children require surgical, nutritional, dental, speech, medical and behavioural interventions at a great cost to help them function (Strauss, 1999). The common types of cleft can be divided into two groups, based on the nature of the defect, which are cleft lip with or without cleft palate and cleft palate alone. These two defects are grouped separately based on developmental and genetic evidence that they are defects with distinct etiologies (Fraser, 1955). Both groups can be further divided based on whether the defect occurs alone (nonsyndromic) or with other associated defects (syndromic). Nonsyndromic cleft lip with or without cleft palate (hereafter referred to as cleft lip) accounts for approximately 70% of all cases of cleft lip (Jones, 1988). Syndromic cases make up the remaining 30%. The causes of these syndromic cases include chromosomal abnormalities, teratogens, unidentified syndromes (Murray, 2002), and more than 200 recognized Mendelian syndromes (OMIM, 2002). The incidence of cleft lip is very high, occurring in approximately one in a thousand live births among Caucasians, with a slightly higher incidence among Asian and Amerindian populations and a slightly lower incidence among African-derived populations (Fraser, 1970). As well as varying with ethnic backgrounds, the incidence of cleft lip also varies with geographic origin (Vanderas, 1987) and socioeconomic status (Murray, 1997). I. Development of the lip As reviewed in Sadler (2000), during the development of the head and neck in humans the branchial arches form during the fourth and fifth weeks after fertilization. These branchial arches are bars of mesenchymal tissue covered by ectoderm on the outer 1 surface of the embryo and covered by epithelium of endodermal origin on the inner surface of the embryo. The mesenchyme consists of paraxial and lateral plate mesoderm and numerous neural crest cells. These neural crest cells migrate from the cranial neural tube, down and around the face into the branchial arches (Figure 1.1). The neural crest cells wil l give rise to the skeletal components of the face, while the mesoderm will give rise to the muscular components of the face. Each branchial arch also contains its own cranial nerve and arterial component. The dorsal portion of the first branchial arch is called the maxillary process, and this tissue later stretches around the face and underneath the eye. Bones formed from the maxillary process include the maxilla, zygomatic, and part of the temporal bone. The ventral portion of the first branchial arch gives rise to the mandible. At the end of the fourth week of development, several facial prominences are seen (Figure 1.2). The maxillary prominence is located lateral to an opening called the stomodeum (primitive oral cavity). The upper border of this opening is formed by the frontonasal prominence and below this opening are the mandibular prominences. Located on both sides of the frontonasal prominence are olfactory placodes (thickenings of surface ectoderm) that invaginate to form nasal pits during the fifth week of development. The formation of the nasal pits leads to the formation of the nasal prominences, which are the ridges of tissue located on the outer (lateral nasal prominences) and inner (medial nasal prominences) edges of the pits. The maxillary prominences grow towards the midline and fuse with the lateral and medial nasal prominences. The fusion of the prominences forms the upper lip and part of the nose. In addition, the prominences form a structure from which the philtrum of the upper lip, a portion of the upper jaw, and the primary palate will arise. When the lateral, medial and maxillary prominences fail to fuse the result is cleft lip (Figure 1.3). The severity of the cleft can vary from involving only the lip extending into the nose, or including a cleft in the primary palate. The cleft can also be either unilateral or bilateral depending if the failure to fuse occurred only on one side of the face or on both. 2 The secondary palate develops during the sixth and seventh weeks after fertilization after the lip and primary palate have formed. The secondary palate forms from two shelf-like projections called the palatine shelves, which appear during the sixth week as outgrowths from the maxillary prominences and hang down on either side of the tongue. During the seventh week, the shelves re-orient to become horizontal and fuse to form the secondary palate. In order for the shelves to ascend successfully, the tongue must drop down and move forward (Sadler, 2000). A cleft in the secondary palate is often seen together with a cleft in the lip and primary palate (Figure 1.3). The common defect called "cleft palate" is a cleft of the secondary palate only. II. Other defects associated with cleft lip On the surface it may appear that nonsyndromic cleft lip is a defect in the formation of the lip only; however, studies have shown that cognitive dysfunction may also be present in individuals with cleft lip. Several studies have examined various aspects of cognitive dysfunction in children with orofacial clefts; however, most of these studies have used children with cleft palate or have failed to differentiate between cleft lip and cleft palate (reviewed in Nopoulos, 2002b). One study that did use only children with nonsyndromic cleft lip and cleft palate found significant deficits in cognition, comprehension, and expressive language skills in children as young as twelve months old (Jocelyn et al., 1996). It was unclear however, i f these deficits were accounted for by postnatal environmental causes or whether they were a result of a defect in development. Two recent studies have investigated structural brain abnormalities and cognitive dysfunction in adult males with nonsyndromic clefts of the lip and/or palate, and they have differentiated between the cases of cleft lip and cleft palate (Nopoulos et al., 2002a; Nopoulos et al., 2002b). In the study of structural brain abnormalities among 32 patients who had a cleft lip with or without a cleft palate (including 3 patients with syndromic cleft lip) the largest differences between subjects with cleft lip and controls were decreases in cerebellar volume accounted for by a decrease in cerebellar gray matter, and decreases in the size of the occipital lobes and temporal lobes (Nopoulos et al., 2002a). Although this finding suggests the possibility that the defect underlying both the brain 6 abnormalities and cleft lip may be due to a defect in the neural crest cells from the area of the prospective cerebellum, it does not appear that these NC cells contribute to the first branchial arch (Figure 1.1). In the study of cognitive dysfunction, subjects with cleft lip were found to have lower scores on the full scale intelligence quotient, performance intelligence quotient and verbal intelligence quotient tests, with individuals with bilateral cleft lip scoring lower than those with unilateral cleft lip (Nopoulos et al., 2002b). Scores on more specific tests indicated a significant difference only in the test of letter fluency (the number of words generated in three minutes in response to the letters C, F and L), although this was to the whole group of cleft subjects so it is unclear whether this finding would be significant in cases of cleft lip only. Although the subjects did have general IQ scores throughout the normal range, the average was lower than in controls, suggesting a mild cognitive deficiency with a specific deficiency in verbal fluency. These findings suggest that perhaps the genes involved in the formation of the lip are also needed for normal development of the brain or that normal oral function during speech development is required for normal acquisition of verbal fluency. III. Genetics of cleft lip The etiology of nonsyndromic cleft lip is extremely complex, involving genetic, environmental and stochastic factors. Twin studies on cleft lip show a concordance rate of 40 to 60% in monozygotic twins, and a concordance rate of 5% in dizygotic twins (Murray, 2002). The large difference between the concordance rate in monozygotic versus dizygotic twins suggests a strong genetic component to the etiology of cleft lip; however, the fact that the concordance rate between monozygotic twins is less than 100% indicates a role for environmental and/or stochastic factors (Murray, 2002). There is a small gender bias among children affected with cleft lip, with slightly more boys affected than girls, the gender ratio being 1.6 (Nora and Fraser, 1986). For parents of one child with cleft lip, the rate of recurrence for the next child is 4 to 5 %, once again demonstrating the complex etiology of the trait (Nora and Fraser, 1986) since we would expect much higher recurrence rates for dominant or recessive Mendelian traits, whereas we would expect a recurrence rate equal to that of the incidence rate in the general 7 population (1/1000) i f the trait were accounted for by environmental or stochastic factors alone. The elevated risk of recurrence of cleft lip in the second child of parents with one affected child demonstrates that the genetic component to risk of cleft lip is important, but is only part of the story. Nonsyndromic cleft lip is a multifactorial trait, which implies that the trait is the result of the cumulative effect of genes plus environmental and stochastic effects. However, some families show a more Mendelian pattern of inheritance suggesting heterogeneity in the etiology of the trait. Although complex segregation studies have not clearly indicated the best genetic model for inheritance of cleft lip, with support for both an oligogenic model and a major susceptibility locus, the characteristics of the trait fit well with a multifactorial threshold model of disease (Nora and Fraser, 1986; Thompson et al., 1991). In the multifactorial threshold model, the shape of the distribution of a biological trait is normal, with the majority of the population having a value around the mean. A developmental threshold divides the distribution into two parts, those affected and those not affected. The biological trait, for example, size of the bridge fusing the maxillary prominences to the lateral prominences (Wang et al., 1995), places an individual on one side or the other of the developmental threshold. So, a person whose biological trait value places them before the threshold would be unaffected, and a person whose biological trait value places them after the threshold would be affected. For cleft lip, those people whose biological trait lies after this threshold will have a cleft. Thus, a trait where the population can be divided into two distinct groups, affected and unaffected, is based on a normal distribution of a biological trait that correlates with liability (Nora and Fraser, 1986; Thompson et al., 1991). The multifactorial model includes the possibility that multiple biological parameters jointly affect the normally distributed trait that incurs a developmental threshold. Several characteristics are predicted by the multifactorial threshold model, and they apply to cleft lip. One prediction based on this model is that the occurrence of a trait with high heritability in first-degree relatives of the affected individual will be approximately the square root of the population frequency. Heritability is the fraction of total phenotypic 8 variance of a trait that is caused by additive genetic variance; however, it does not reflect the degree of genetic determination of a trait (Thompson et al., 1991). The heritability of cleft lip is between 70 to 90% and the occurrence among first-degree relatives is 3 to 5%, which is approximately the square root of the population frequency of 1 per 1000. Another prediction that distinguishes multifactorial traits from Mendelian traits is the nonlinear decrease in the frequency of the trait with a decrease in relationship to the affected individual. The recurrence rate drops sharply between first degree and second degree relatives, but only slightly between second degree and third degree relatives. In cleft lip the recurrence rate among second-degree relatives drops to 0.7%, while among third degree relatives the risk is 0.4%. A further prediction from the model is that in traits where the defect affects one gender more often than the other, the recurrence risk is higher to relatives of the sex less frequently affected. For the sex less frequently affected a higher liability is needed to be beyond the threshold, which means they will on average have more genetic factors contributing to the liability to be affected. This leads to an increase in the risk of being affected in the relatives of this individual. For cleft lip, more males are affected than females, and the recurrence rate for siblings with an affected brother is 3.9%, whereas the recurrence rate for siblings with an affected sister is 5%. Several other characteristics of multifactorial threshold traits also apply to cleft lip (Nora and Fraser, 1986; Thompson et al., 1991). Due to the complexity of the disorder, several different methods are used to try and understand more about the genetic components of cleft lip in humans. Some groups pick candidate genes based on expression and knockout data from mouse studies that suggest the gene has a role in the development of the lip and look for linkage or association with cleft lip in affected families. An example is the study by Scapoli et al. 2002, which defined affected families as having 2 or more affected members who were relatives of I, II, III, or IV degree. Others use the occurrence of cleft lip in patients with chromosomal abnormalities to indicate potential regions of interest in the genome (Blanton et al. 1996; Scapoli et al. 1997). They then look for linkage between these regions and cleft lip in affected families. Alternatively, some groups test large groups of affected families for linkage between cleft lip and various locations on several chromosomes (Tables 1.1-1.4). 9 In addition, some studies have been done on genes involved with the metabolic pathways utilized by environmental agents that seem to play a role in the risk of cleft lip (Table 1.6). Also, studies have been done screening the entire genome for linkage (Prescott et al., 2000; Marazita et al., 2002). Finally, some studies have focused on whether genes known to play a role in syndromes that involve cleft lip have a role in the risk of nonsyndromic cleft lip (Houdayer et al., 2001; Sozen et al., 2001). Chromosome 6p near the F13A (Coagulation factor XIII, alpha subunit) locus was one of the first regions reported to be linked to cleft lip (Eiberg et al. 1987). Several other studies however, have failed to find evidence of linkage to this region (Table 1.1). In 1990, a case of a girl with cleft lip and palate among other malformations was presented who had a terminal deletion with the breakpoint at 6p23 (Kormann-Bortolotto et al., 1990). In 1995, three patients with multiple abnormalities including cleft lip and palate were found to have chromosomal abnormalities involving 6p24.3 (Davies et al., 1995). Case 1 and 3 have balanced translocations and case 2 has a deletion. One candidate gene in this region is EDN1 (Endothelin 1). Based on the genetic heterogeneity of the trait, cases previously known to be unlinked to 6p23 were examined for linkage to other genes in the EDN1 metabolic pathway, but no evidence was found to support involvement of these genes in the etiology of the trait (Pezzetti et al., 2000). Transforming growth factor-a (TGFA) located at 2pl3 (Table 1.2) was one of the first candidate genes associated with cleft lip. Many studies have been done and several show association and/or linkage with cleft lip. Interestingly, a relationship between cleft lip and TGFA was discovered, but only in those families that had previously been linked to 6p23 (Pezzetti et al., 1998). This is noteworthy because the complex genetics involved with the trait indicate that more than one gene is involved. Another candidate gene to be connected to cleft lip is BCL3 (B-cell leukemia/lymphoma 3) located at 19ql3.2 (Table 1.3). In 1995, Stein et al. found evidence that a polymorphism in BCL3 was linked and associated with cleft lip. After discovering an error in their program however, they found that there was in fact no significant 10 o -fl % 1-1 bu o CD ou T3 CD o (L> "o OH CD a o co O 6 o J3 o CJ CD CD H-» 1) X> CD bu cd CO fl O / -^ .2 w ' 5 o co CO IS cd o "3 <4=i O CO M CO fl cd M fl o O T3 —c CD CO CO CD fl B 2 CO —H C+-I f? o II > CD CD ^ 5 £ H co . . C r-H O • • i-H - td cd o H OH S3 * l-c HH> O O A « o i . +2 O CS o w 1 ^ 3 S B O o CQ s § u co CS CU fl s > es 73 fl fl o H-< es a o P H u o -fl s < co CJ o ro S 2 * g fl «J .2 S 22 .3 ~ c ^ 3 fl to s cd Q CJ O CD T—I fe cd CO CQ CD CO CD CD CD CD bu bo bu cd cd cd c 3 fl fe fl fe co CN OH VO CO CD C+-H CN C cd cd CD UO •-J Os fl 2 cd o CD bu cd •a fe CO CN OH CO CD <+-< ro co cd s> •8 5 CD c o -£ cd TJ fl cd ON Os CO CD fl O • i—i +-» .2 ' o o co co < CD *a3 ro fe CO CD CD bu cd •a fe CO CN OH CD e o \ Os cd S cd CD cd cd CD r— O ° ^ o o c o "•§ ' o o co "cd CD bo cd < ro fe X CD j CO OH CD CD CO CD fl CD cd "rj o o V O "fl bp CO T3 •e o 00 oo 03 T3 C o3 CN O -fl o I-I bo too a c u H—» bo C> 7^  o CN O A o3 o o a3 oo O o oo o3 fl i-l Vi bO-2 s ~ O ti ii flS '-a <! 3 ' • VI Vi O • ~ fl ft o a, o CN -fl H too "3 BO o e es u 3 W) O J . oo L © < o ° oo oo —* O Ci A3 3 | £ o .fl e o « s o CM ' 1 03 im CT1 o3 E—i ii c o <—I o o oo 00 < O DO 00 00 00 •H -4-» C c rfl fl •*—» m 03 OH o CN VO C C ON o JS s < s ^ CQ w CT1 03 H C o3 O e < oo fl O o o oo oo < cr o3 H O S •a g In OO fl bO fl -3 l-C O N oo ON ON ON > ii fl U -fl U o3 H-J 1) .fl o fl (L) cr1 03 oo O c fl fl o O O 'o 'o o o o oo oo 00 oo oo oo < < < fl 13 OH oo C *H—» 03 OH o OS 00 m < 03 H-» <U ( N in ON (U ON T3 T-H CN ON ON O 03 H-» H-> 00 1) bo 03 •a c • i-H OH fl .2 13 VH 00 fl < oo (L) oo 00 CQ CN O ON .G ON o3 CT1 03 H oo fl *H—» .2 'o o oo 03 H T 3 03 oo Pi C OH fl 03 o • —H l-H (L) 6 < 03 (L) c .fl U -fl o fl ^ CN -^ £ -g £ .fl 2 s § CTN oo oo 03 00 oo fl o 'o o oo oo < cr 03 00 00 fl fl O O • i—I • i—I O O o o oo oo oo oo < < hi T—i fl ^ fl 03 o3 (_, CQ H "2 fl t i u 03 S o3 pv g tS OH OO oo ^ vo 3 ro fl fl U ^ OH ON ON — O N 03 H-> ii too fl U H >0 ON ON o3 O fl O o o oo oo < ii 13 CN Q A .2 o3 O, fl oo b .2 IH S + c 03 o • —H • VH s < 03 03 ^ o3 ^ 03 "5 "53 ^ _ O N -rj O N 03 ON HC! O N 00 03 co .fl .2* T3 c Cd CN o O l-l bu bo <2 a3 a cu cu H-» <u ^ 1-1 H-l CO cu eu bo a c -2 J3 ts o o co O fl 2 «J td .S o m CO CO 3 >- £ <£ » bp 13 o cu o 33 cu w co "2 G fl o co •+-> O 3 & 21 .2 &, & ° OH cd C*H fl O o CM bo O eu bo cu cu 3 cd CJ o CO i «2 --<-> "f l m CJ -«-> fl « cj s ' f l w> • p-H GO o on .S OQ fe >i H cd ° «. co ~ H CJ CH S fl ^ fl o fl © S3 3 C H o OH S < O o Cd • —H o fe o < • § < cr zr cd cd t?3 o CU + T3 CU fl O > 0 0 ~ CU CN O Q H ^ CO cu CO cu CD bo cd fe CO Cd CO CO •—! P CU fl fl fl fl co cu U C 3 S ^ & £ ^ CO cd CO cd cd H-» cu oo _3 as O °^ i ° CO cd w ° ° OS cd ON O O c o td • —( CJ o G o cd cu <-> bu '-fl cd cd I 8 fe " CO 3 O > cd 3 - O TJ .2 CN O CN CJ cu 2 cu CO O C O 1 I " -fl ^"71 & eu _?u co 33 O - cd cu -—J CO .2* 1 6 fl ,S o ^ eu CO cu G cd 1 3 \fl OS ^ Os N *2 N 2 CU « fe 5 U cd cu fl crt ^  0 3 3 o o •rt O !nfl N ?o fecd oo o o V bp CO -fl ra Pi fl cs u *3 '2 6JD CO 2 _e .2 5 ° u -fl CQ © .5 oo "5 oo i—I on 4> OO E O 3 © T3 © fl C o CS 3 © CU I . o JS 3 CD O 1> >+ £ > c c <u 2 2 5 P ' - £ '-fl w Co B o o —I on on < < ro ro CD "c5 ON ro CD o ro I/O O N O N CO on c o • —H +-» . 2 ' o o on on < ro - 2 < o 1 / 5 O CD on O +-» on CD IT -fl co ^ O N I ' I CD C+H <+-< . f l on CD o o cu on on CD CD ro 5 i on i—I on < ro - 2 "CD fl o 1 ' o o on CD 2 ° ccj ro ro o on on on on fl O * t-H O O on CD CJ) ro < < < CD *<5 uo CO O N ro - 2 *4> ^ 2 ^ ° c r ' c j "CD W N — ' 2 ^ ro TJ- r j =1 0 0 o y < i-H f U Q < on _ . 2 «3 "g 2 fl S3 CD S g S g .§ S3 eg S « ^ A H — I ~ S o ° co 1^  CS ^ U ro T 3 on 13 X CD on _OH CD co _ , W c3 +- —< C O O O N *3 N O ro ,-o • —H I-I CD a < fl ro CD CD ca +-> - O CD NO on ON O ON a ~ < O N O N < CD 3 »• OT ON C ON O CD a A ro N ro >-< CQ CD fl o 2 Z, O N ro ON S-c t—c T 3 CD ifl oo —i ON C 2 1 ro CD CN l - O ro O OH CN OT ro o ro H-» ro CN O o CN > CD 1-4 I-I <2 CCj ON H ~ O • V +-• II OT C O c3 a 2 8 .2? OT OT association between any alleles of BCL3 and cleft lip although the linkage data was still significant (Amos et al. 1996a). However, since this initial finding the majority of linkage and association studies have confirmed the relationship between this gene and cleft lip. Most of the studies have been done on populations from the United States; however, two recent studies on different ethnic populations (Brazilian and Chinese), have also indicated a relationship between this gene and cleft lip (Gaspar et al., 2002; Marazita et al., 2002). Interestingly, BCL3 was the only gene among those proposed to have a role in cleft lip based on previous studies to be indicated in the etiology of cleft lip in the study on an Asian population (Marazita et al., 2002), indicating a role in multiple populations. Another candidate gene is retinoic acid receptor alpha (RARA) located at 17q21 (Table 1.4). Since the initial study by Chenevix-Trench et al. (1992), two other studies have shown an association between polymorphisms in RARA and cleft lip (Shaw et al., 1993, Maestri et al. 1997); however, the studies used different alleles. A l l linkage studies to date have failed to find significant linkage between RARA and cleft lip. In total, the majority of the studies done to date do not provide evidence that RARA has a role in the etiology of cleft lip. In addition to the genes listed above, several other candidates have been looked at for evidence of linkage or association to cleft lip (Table 1.5). Also, a genome screen of polymorphic markers involving 363 subjects from the United Kingdom (Prescott et al., 2000) implicated the following 9 chromosomal regions in the development of the trait: lp36, 2pl3, 6p24, 6q25, 8q23-24, I lpl2-ql4, 12pll-q24, 16q22-24, and Xcen-q21. These 9 regions include 3 (lp36, 2pl3, and 6p24) that are near genes or loci previously shown to be linked or associated with the cleft lip trait. Another genome scan involving 36 Chinese multiplex families found significant linkage and association to many regions with the most significant results to chromosomes 3q, 4q, and 16 (Marazita et al., 2002). Although a suggested role in the etiology of cleft lip has been proposed for all of these genes or loci due to positive linkage or association studies, further studies are needed to 15 T3 CJ o PS c C5 w a C bJD OJ « £ S3 X © '3 .S ffl P fe i. o k © co CJ t* o I o o co co < CJ — • 3 C3 1 5 -g © o fe u o xs s td OH x •»—» > ej O i eu S o o o o £ £ £ £ £ a o I o o co co < O o cd co cu bu bu _^ cd cd ' III CO fe I—1 £ CO cd cu o £, o cd a ^  ON uo cc r-CO CU CO fe C(-H 1 o "cd cd CO \~> -*-» TJ %-» CO C CQ < cd +-» r- a> <N cu — ON C O ON C —1 CU H cd fe ON cd ' 1 X ! CO cd H-» CU fe £ H-» CH > CU t* a o o o co co < OO cu 2 tn cd H-» CU cd <U ON CH ON H • CH ( CO CU CJ * I ON ON O O o o o I o o co co < H eu bu cd fe C o o co co < eu bu cd fe o o oo CO r--ON uo co 5 x xl o cd cj <+-< o co CU l-l eu M >-< cd s tn rN fe" cr C N tn w in o oo uo i—< C N | 1 w O UO CJ p-> cd Q "ed cu CO eu C cd C cd Id "cd cd H-» eu C N H-» CU C N O O o • 1—I o o o C N OH C N cd cd be eu co CJ CH • r—t X I O cd 1 8 cd UO o o V OH O cd cj B bu CO ii ii B cu i -o CM * "3 CN. CD O - f l C co fl o fl a cd - G Cf-I O o o •rn CO s CO CU fl CS CJ c o o  g fcH « >-.'-£© ,5 ^ — bX) 1 - ' CS h 5 4? . g - G 1 - 1 <2 T 3 CD C CCJ X CD co CD C CD bO I-I CD -fl H-» O t+-i o CD • i—< > CD & IT) ro H GO fl O 3 o CM 3 o cu C I O N 2 O N O O ION C N O A ^ 13 ro CD CD - - H CD CD fl O S3 * U °< S co cd TH o o o o £ £ £ £ 2 <u . 2 t>0 ro fl A o fl o o S co '"t CO 1—1 CD O O CO CO CO CO < < N O ro r - oo r r O N O N O ON ON O I—i i—i C N a fl CCj E "S « —i —• o CCt fl CD 'h-j i-i 5 X ii C N . " H - . o Ki OH CD fl CQ u ^ CO C N o o C N 13 H-> CD cd • —H 3 S3 CD fl C fl 2 . 2 . 2 fl \ f l \ f l fl fl fl fl . 2 <u j . Kr o o o o CO CO CO co co co < < < C fl - . 2 « . 2 s b O - C oo -fl td cd fl fl cd o M 'o - o o fl o fl o rr* ' - rr, *-H ^ CO < vi —i vi CO I—J CO h-1 OH CL, < c r u cd CD CO CD fl • t-H 43 o NO •t io N O N O N O O N O N O ,—i C N cd fl cd H-> H-» H-» CD CD CD a —3 fl w OT r*. > « > H £ £ fl CD CD CD 2 00 00 00 "-fl fl fl fl ra " f l ^ l T g J 3 J g >~. fl CD ~" CO a 2 CDfl £ £ °° <N S ° ^ O N ° ^ O r< ON ^ O N o ^ ,—i —i ^i v N cd +-» CD ra i—i ra CD C N "3 *a 2 . ^ ra OH . 2 CD ra j pq o CO I o S g o O O I o fl C fl c O O O o tJ '-fl 'ti '-fl oo "-fl ra _ra cd cd fl cd o "o 'o 'o M 'o o o o o fl o CO CO CO CO co co co co i—) <<<< fl s s s 5 ra fl cd OH 2 2 2 OH U '• '• ro c r C N c r <N-> s C N o o C N ra H-» CD O CD C O fl CD O _H ra ra " "S o ra c r uo •NO o o V ra o fl 00 provide more conclusive evidence of their role and to determine the effect they have on a person's liability for the trait. As technology and knowledge of the human genome has improved, the underlying cause of several syndromes that include cleft lip in their spectrum of defects has been found. This has led to several studies on whether the genes involved with these syndromes are also involved in the development of nonsyndromic cleft lip. One example is the autosomal recessive cleft lip/cleft palate ectodermal dysplasia syndrome found on the Margarita Island. A mutation in the gene PVRL1 (Poliovirus receptor-related 1) is seen in patients with this syndrome on Margarita Island (Suzuki et al., 2000). This syndrome is characterized by 40% cleft lip with or without cleft palate (Bustos et al., 1991). In addition heterozygosity for this mutation appears to be a risk factor for nonsyndromic cleft lip in a nearby population on the Venezuelan mainland (Sozen et al., 2001). Further study revealed a higher than average incidence of nonsyndromic cleft lip (with or without cleft palate) (2.5 per 1000) amongst this population and a significant association between heterozygosity for the loss-of-function mutation in PVRL1 and nonsyndromic cleft lip (Sozen et al, 2001). It could be that the association seen is due to population stratification. The association could arise if there are more individuals with a greater risk of cleft lip and a higher frequency of the PVRL1 mutation independently due to their ethnic background rather than because the mutation has a causal role in the development of cleft lip. Whether this gene is a risk factor in general to nonsyndromic cleft lip, whether the effect is limited to this population or whether the mutation is not a risk factor at all will be investigated with further studies. Another new discovery is the cause of Van der Woude (VWS) and popliteal pterygium syndromes (PPS). VWS is an autosomal dominant disorder characterized by clefts of the lip and palate and lip pits, and is the most common syndromic form of cleft lip and palate. PPS is characterized by a similar orofacial phenotype to that of VWS with the addition of skin and genital anomalies. Recently it was discovered that mutations in the gene interferon regulatory factor 6 (IRF6), located at lq32.2, cause both syndromes (Kondo et al, 2002). IRF6 belongs to a family of transcription factors; however, its 18 function is unknown. After first identifying a mutation in IRF6 in the affected twin of a pair of monozygotic twins discordant for VWS, they subsequently found mutations in that gene in 45 additional unrelated families affected with VWS and 13 families affected with PPS. Haploinsufficiency of IFR6 is probably responsible for VWS, while dominant-negative mutations in the gene may cause PPS. A relationship between the VWS locus and nonsyndromic cleft lip has been looked for previously, but results suggested only a small, modifying role for the locus (Houdayer et al., 2001). Undoubtedly, now that the specific gene that causes VWS has been identified, further studies will be done to see i f it has a role in nonsyndromic cleft lip. Interestingly, because of the variation in penetrance of the lip pits, some cases of VWS are indistinguishable from nonsyndromic cleft lip. It is possible in nonsyndromic cleft lip that some of the pedigrees with many affected family members are caused by mutations in IRF6. This is especially true i f both cleft lip and cleft palate only are seen in the same family, as this is seen in VWS, but is very rare in non-syndromic cleft lip (Muenke, 2002). In addition, it is hypothesized that the phenotypic variation seen in VWS may be due to stochastic factors or modifier genes (Kondo et al., 2002). In fact, the researchers found a polymorphism in an evolutionarily conserved residue in a protein-binding domain in IRF6 that may modify the phenotype of VWS and propose that it may play a role in the etiology of nonsyndromic cleft lip; however, there is no evidence for this to date (Kondo et al., 2002; Muenke, 2002). Although the studies that have looked strictly for an association or linkage between MTHFR and cleft lip have had negative results, results may have been misleading. The gene 5,10-methylenetetrahydrofolate-reductase (MTHFR), which is involved in the metabolism of folate, has a polymorphism, C677T. Homozygosity for TT at this locus leads to decreased enzyme activity. Two studies that looked at the MTHFR genotype (Shaw et al., 1998; Gaspar et al., 1999) did not find an increase in the frequency of the TT genotype among cleft lip patients; however, Gaspar et al. (1999) found that the mothers of patients with cleft lip were not in Hardy-Weinberg equilibrium in terms of their MTHFR genotypes. Hardy-Weinberg disequilibrium was also found among affected mothers of affected individuals with an increase of the TT genotype in the mothers (Prescott et al., 2002). This finding was missed with the traditional TDT test as 19 homozygous parents are not used and suggests that a maternal genotype leading to a folate deficiency may be involved in the etiology of cleft lip when a family history of cleft lip is present. Another recent study however, found no association between maternal or paternal MTHFR genotype and isolated nonsyndromic cleft lip (Blanton et al., 2002). IV. Environmental factors in cleft lip Genetic factors alone are only part of the story, as several environmental factors also appear to play a role in the development of cleft lip. Variation in the genes involved in the metabolism of these various environmental factors could lead to an increase in an embryo's liability to developing cleft lip after exposure to these factors. A particular combination of alleles in genes in a pathway regulating the body's response to a particular environmental agent could increase the risk of developing cleft lip, but additional exposure to the environmental agent at the critical time in development would greatly increase the risk of development of the defect. Many environmental factors are thought to contribute to the liability to clefts including: nutritional deficiencies, cigarette smoking, alcohol, infections, fever and altitude (Table 1.6). Other factors thought to be involved include epilepsy and antiepileptic drugs, organic solvents and agricultural chemicals (reviewed in Wyszynski and Beaty, 1996). Several known regulatory pathways are suggested by these environmental factors, and many studies have looked at various gene-environment interactions (Table 1.6). One of the most studied environmental agents is maternal smoking. Maternal smoking was associated with a higher risk of cleft lip, especially in infants with a specific rare allele at the TGFA locus whose mothers smoked > twenty cigarettes/day (Shaw et al., 1996). In another study looking at genotype-environment interactions (Romitti et al., 1999), confirmation of the association found with TGFA was not possible due to the lack of infants with the rare TGFA allele whose mothers smoked > twenty cigarettes/day; however, an increased risk of cleft lip was seen for infants of mothers who smoked or consumed alcohol. In addition, an even greater risk of cleft lip was seen in infants with specific alleles for the gene MSX1 (Homeo box, msh-like 1) whose mothers consumed > four drinks/month. A 20 CD Cl o -a CD ?-> CD > fl CD fc! fl fl - A o CD " A CD 00 O OH O 00 CD fl CD 6 0 . c CD o fl CD fl CD CD O CD 4 3 +-» C „ Cd CD cd O 2 cc) O A > c CD co fl O ' 8 > A CD CD CD A . CD CD c CD CO CCS 0 0 „ fl . 2 3 oo CD Cd t-l CD o J O oo CD Cd -fl O cd • 2 3 3 CO fl . 2 o - f l c A <-< •*-> oo CD O i-i O 1 — 1 CD bD - 2 > ° CD O * a ^ • T 3 Co - fl CD >-> C CO O OH H c _ 3 fl o oo C o « 3 OH O fl cu WD CS c cu E c o i-> C * o o o C N 1 3 CD a A CO 13 OH - 2 A o 5 C M \ f l O CD M c 2 . 2 A CD • i 3 CD 1-4 o fl oo c O o VO O N O N rt 1 3 CD ^ »H fl j £ C O ON . ON ON * ON ON 2 - T 3 c p H _ « S CD . w A 3 f*H £ ^ a o o o CN fl CD o I—] * o o o CN 1 3 H—» CD 0 0 G fl -fl O o ^ - a A t3 CD ^ 0 >->*2 o o CN " A CD 4 3 o -fl cd S fl - f l . 2 CD 4 3 -4—* § oo i > c i cd cd >—, CD ~Z CD CD C cd t-i IX, t-l CD CD a < fl c cd fl . 2 2 "EH ° G CD CD 0 0 fl M o a CO o o u o S . a CD CH ^3 C OJ 3 I <L) O >- > n C o CD <L> o - ° fl o CD HS tl TJ 3 <L) O OT O O O OH I I CO CD C CD OT 60 fl • a CD CD 60 CD * & a" - ° § § S o T3 •£ g G a CD c CO " - l .2 S *-< fl Crt fl fl ° l li CD -r" i? g OT CD fl bu 2 « •£5 cd g fl 2 ^ •S J crt ar, bo.2 fl T> M P. O O co co crt .2 TJ CD fl TJ fl " Xi <+-! O O C fl CD CD b0 ccj CD rv > •g -fl* fl P H CD crt o c o o o 0 • 1—I 8 o crt OH -3 crt - 1 C X3 CD fl - g § 00 fl o +2 « fl OH o P H Os 0 crt "5 i-i CD bo fl fl C*-l OH O ifl CO -2 o O crt -3 £P-2 co C O c OT .2 CO CD .a o xi o .-fl .&<4H —H O CD 1> fl ° O 2 H - A 18 ^ 0 • •-I i~i o l i CD -3 TJ M 1 3 CD fa OT <3 ^ T H CD X H l-l H-> G £ Os Os crt +-» CD 2 o OH + OH Pr, ~ rS TJ CD "o O CO TJ CD co crt CD 1-1 O G s + s + -fl o o 13 o o o CN 13 H-» CD CD fl" CD lH o fe OH clfl CD "o o r-* ^ .2 ^ TJ ^ CD OT crt CD 1-1 O fl o o CN 13 H-* CD CD -fl O OH -2 '.5? o OT —H H-> o I-H O CD O CD -fl CD C CQ a o ^ c ^ fl A c crt crt crt O O 'C 'C CD CD CD 2 2 2 < < < fl V 60 CS "3 c o B A o I. > a o xi o o CN CN CD O s . s C CD tu o o CD CD CD X » S 2 O CO 0 o O CM » 2 •5 OH 1 s CD OT CJ) 0 cl (D <D CJ) CD - I -4—* 1 s 3 ° . § 1 > o H2 CD d OT ' 3 "3 .2 § <-i cl ra S CD 45 - ° C l « & a CJ) 2 -s ra 2 2 a •S 8 •s* ra OT bp .2 S ^ O OT Cl -2 p CJ) OT a ra T J CD C> T 3 co JX" <+-< O O Cl CD .2 & M > — w eG CD rv> ^ fa P-i CD Cd c .2 3 o OH ° s ° o ^ 43 ra CD > » C3 O OH X> cd H 2 a c © s OH © P H c <u t>D CO « C (U & e © > c ta C N O O O N Cd > o O N ON cd cd 42 0 0 ON ON T 3 cd > O H C N O O ON ON cd ra 4 3 OO o o C N r-H ^ O O O O C N C N cd ^ • o CD o CD CD . £ cd cd <u ^ C Q o o C cd CD 43 O P Q M cd > OT O 43 CD CD N u c cd o "C CD < N cd t-l C Q o 00 g -3 cs I CU crt Vi CD O fl V «2 s cw Vi ca fl WD C3 fl CJ E A o •PH H fl - J C N O o CN +-» cu I -fl 00 C N o o C N 13 o ti o PQ ON ON ON crt CU crt Vi P CO •*-> ,c3 O o " 0 eg C cu CU O 1 a > U O H -—-< CO fl cu o fl H—* - f l o > crt - a" cd -fl f 13 £ rt crt C3 CO fl c CU ert > •—< CO ^ - f l .2 o cu 2 13 o fl ~ o <u cu cu fl -° .2 E l-( o CU rt 0< fl • . & o ^ ~ - H fl fl <ti T3 O cu CU 8 o o O co > o *J „ ca crt CU co CU cu CO — o fl o a l-l cu I s cn o -fl H* T3 CU fl .2 crt -fl T3 O 'G cu o, 13 c o • t—I -*-> o, cu o fl o o °G u , OH *5 cu o o CU CO ' 1 fl ON ON - f l , -2 -fl cu > cu til c3 cu + co fl a a > fl eu crt CO eu CO >13 A crt , eu -fl cu js 13 o, l*i ju crt O , l « -2 "3 eu o, eu co +-* o fl l-fl I-1—( | T 3 co cu ' 1 •*-» CO CU' CO ; cu C N meta-analysis indicated a small increased risk of cleft lip with maternal smoking (Wyszynski et al., 1997). Many of the studies on multivitamin supplementation point to a decrease in the risk of cleft lip with vitamin use (Table 1.6). Although not conclusive, these studies illustrate the need to continue to research the benefits of vitamin supplementation (including folic acid) periconceptionally as a method of reducing the number of cases of cleft lip. Obviously no concrete conclusion has been reached on the genetic and environmental factors important in the development of cleft lip. It is possible that the ongoing conflicting results are due to the variety of populations being studied. While some studies use sporadic cases of cleft lip, others use families where multiple affected members are seen in one family (Mendelian-like segregation). It is possible that the cleft lip trait arises differently in these two groups, so some genes may play less of a role or no role at all in one group, whereas they may be very important to the second group. For example, genes that modify the trait via environmental interaction may be more important in sporadic cases than they are in strongly 'familial' cases. Applying the multifactorial threshold model for cleft lip, for the families with a Mendelian-like segregation of cleft lip perhaps the combination of a major gene defect plus a modifier of penetrance is enough to put them over the threshold most of the time, whereas for families with 'sporadic' cases perhaps they have a combination of polymorphic variants across several loci that combine in a way that puts an individual over the threshold only occasionally. The specific combination of alleles across the loci is very important in the 'sporadic' cases; however, it is not as important to the 'familial' cases because of the elevated risk they already have due to the major gene defect. V . Mouse models of cleft lip Fusion of the facial prominences to form the lip occurs at a time in human development that is not readily accessible for study, so most of the research on the development of 25 cleft lip has been done in mouse models. The lip forms on days 10 and 11 of embryonic development in the mouse, roughly halfway through gestation. At this time the embryo has approximately four to nine tail somites (Trasler, 1968). Although cleft lip is quite common in human populations, it is rarely seen in laboratory mice (Juriloff et al., 2001a). The exceptions to this are the AP-2 (Tcfap2a) null mutation mouse (Nottoli et al., 1998), the dominant syndromic mutants Dancer (Trasler et al., 1984) and Twirler (Lyon 1958, Griffith et al., 1996), and one family of inbred mice, the " A " strains (reviewed in Juriloff et al., 2001a). The only one of these with nonsyndromic cleft lip is the " A " strain family. Cleft lip arose spontaneously in the " A " strain, which diverged as a separate family approximately 70 years ago (Festing, 1979). Although the various " A " strains are very closely related, there are differences in the frequency of cleft lip among them, with the frequency ranging from 5 to 30% (Juriloff, 1982). The cleft lip defect is often accompanied by a cleft palate; however, the cleft palate is thought to be caused by physical interference from the tongue. During development, prior to elevation of the palate shelves, the tongue is positioned between the two shelves. In order for correct development of the palate, which occurs after the lip has formed, the palate shelves must become horizontal, contact and fuse. In order for this to be successful, the tongue must move forward and down in the oral cavity. Trasler and Fraser (1963) provided evidence that in embryos with cleft lip, the movement of the tongue is impeded by a large displaced mass of tissue (the premaxilla) that was to have contributed to the lip. The physical impairment of the movement of the tongue prevents successful palate closure. Pups born with cleft lip die during the first day after birth, possibly because they are unable to suckle (Juriloff et al., 2001a). The genetics of cleft lip in the " A " strain are complex, making it a good model for the human condition. The beginning steps in elucidating the genetic cause of cleft lip in the A/J strain showed evidence for one major recessive locus and a second recessive locus with epistatic interaction (Juriloff, 1980). Further studies placed the major recessive gene, clfl, within a 2 to 3 c M region on mouse chromosome 11 (Juriloff and Mah 1995, Juriloff et a l , 1996, Juriloff et al., 2001a) (Figure 1.4). The second locus, Clfl, has been 26 c n ^ n o a o t+H T3 CD •*-» & CD » o CD O , en CD CO CD Mit3 Mitl Mit3 Mitl U o co O a o J3 CD c o T3 CD -*-» cc5 O J3 co "c3 CD CD a. s .. cd • CD C4-! mapped to a 4 to 5 c M region on mouse chromosome 13 (Juriloff et al., 2001a) (Figure 1.4). The epistatic interaction between the two loci is seen bythe fact that one "b" allele (from a control strain not susceptible to cleft lip) at Clfl usually suppresses the risk of cleft lip present in clfl "aa" embryos. Homozygosity for the 'a' alleles at both loci is required for a high risk of cleft lip (Juriloff et al., 2001a). Dissection of the genetic components of cleft lip in the " A " strain have been complicated by a genetic maternal effect as seen in reciprocal crosses involving the " A " strain and control strains and within the " A " strain family itself (Davidson et al., 1969; Juriloff and Fraser, 1980; Juriloff, 1982). This maternal effect is not due to a cytoplasmic factor, but is mediated by the uterine environment created by the specific genetic makeup of the mother (Bornstein et al., 1970). Higher cleft lip frequency strains (such as A/WySn) seem to have a lower resorption rate than that of lower cleft lip frequency strains (such as A/J), indicating that the resorption of cleft lip embryos may account for the maternal effect (Juriloff and Fraser, 1980). However, a study of primary palate fusion demonstrated a quantitative difference in the growth of the maxillary prominences between the lower and higher cleft lip frequency strains, indicating that the maternal effect may cause a difference in growth of the tissue involved in the formation of the lip and this may account for the difference in cleft lip frequency between members of the " A " strains (Wang et al., 1995). In 1995, Juriloff proposed the following genetic hypothesis for the cause of risk of cleft lip in the " A " strains that takes into account the data accumulated to date: (1) A major recessive mutation, clfl, which is necessary but not sufficient for risk of cleft lip (2) A second semi-dominant variant, Clfl, epistatic to clfl, permitting expression of risk in clfl homozygotes (3) A genetic maternal effect, whereby the maternal environment provided by the " A " strain mothers in which the embryo develops leads to an increase in the risk of cleft lip in those embryos at risk based on their clfl and Clfl genotypes. Although the genes involved in the risk of cleft lip in the " A " strain are at present unknown, some work has been done on the developmental outcomes of the effect of these 28 genes. The formation of the lip in mice is similar to that discussed above for humans, and failure of fusion of the facial prominences results in a cleft lip in the same fashion. In 1968, Trasler first described a qualitative difference in the face shapes of embryos with a genetic risk of cleft lip as compared to those with virtually no risk of cleft lip. Trasler (1968) observed that just prior to fusion of the prominences, the medial nasal prominences of the " A " strain embryos were more prominent, more medially placed and diverged less than those in the control strain (C57BL/6). Another study using one strain liable to cleft lip and two strains resistant to cleft lip measured a quantitative difference in the distance between the nasal pits between the liable and resistant strains (Juriloff and Trasler, 1976). The cleft lip liable strain had a significantly smaller distance between the nasal pits as compared to the control strains and also had a trend towards lack of divergence of the medial nasal prominences. Another study has found differences in the fusion of the prominences between strains with spontaneous cleft lip and control strains (Wang et al., 1995). During formation of the lip, the maxillary prominences grow forward and fuse with the medial and lateral nasal prominences. This fusion creates an epithelial seam, across which a bridge of mesenchyme must form and grow for successful fusion. In their study, Wang et al. (1995) found a significantly retarded forward growth of the maxillary prominences, a delay in the formation of the mesenchymal bridge, and a smaller primary palate area in the cleft lip liable strains. If the mesenchymal bridge is not formed sufficiently, the tissue may tear following later developmental events, resulting in cleft lip (Wang et al., 1995). In summary, it appears that the developmental defects that lead to an increased risk of cleft lip in the cleft lip liable mouse strains are a combination of a lack of divergence of the medial lateral prominences and a delay in the forward growth of the maxillary prominences. VI. A/WySn strain genetics and embryology The inbred strain A/WySn was used throughout this study as a model of nonsyndromic cleft lip. A/WySn is brother-sister inbred more than F150 and is albino. A/WySn 29 originated from a cross by Strong in 1921 between the Cold Spring Harbour and Bagg albino random-bred stocks (Figure 1.5). The "A" strain was maintained for seven years by brother-sister inbreeding before the strain A/J diverged in 1928. A/WySn is highly susceptible to cortisone-induced cleft palate and has a high incidence of lung tumors in response to carcinogens (Festing, 1998). A high frequency of cleft lip at 20 to 30% (Juriloff, 1982), and a resorption rate of embryos of approximately 10% are seen in this strain (Juriloff, 1982; Wang et al., 1995). The majority of cleft lip in A/WySn is bilateral, with some cases of unilateral cleft lip on either side (Juriloff, 1982). A cleft is seen at the border of the premaxilla with an absence of the palatine part of the premaxilla, along with defects in the cartilaginous nasal capsule in newborns (Gong, 2001). The genetics of risk of cleft lip in A/WySn relative to the control strain, C57BL/6J, are those discussed above, including one recessive mutation (clfl) mapped to chromosome 11, one semi-dominant variant (Clfl) mapped to chromosome 13 and a strong genetic maternal effect. To account for the high frequency of cleft lip generated from a cross to A/WySn, Juriloff et al. (2001a) proposed the existence of additional modifier loci. As yet no evidence in favour of any particular candidate gene for either clfl or Clf2 or any modifier loci has been proposed. The gene Rara (Retinoic Acid Receptor Alpha) was previously proposed as a candidate, and there is evidence of an interaction between RARA and human cleft lip; however, it has since been eliminated from the clfl candidate region (Juriloff et al., 1996). Expression of the gene Msxl (chromosome 5) is altered in embryos with cleft lip, but only after the lip has formed (Gong, 2001). It is possible that clfl or Clf2 act upstream of this gene. VII. Rationale and approach to my studies This thesis deals with the genetics of cleft lip in the inbred strain A/WySn, with the body of the work divided into four sections. The first section is concerned with further defining the chromosomal interval containing candidate genes for the major recessive 30 Ohio Dealer Bagg 1913 I Albino stock I Little B 1 Little, Carnegie Institution A Strong 1921 1 Stock A 1 Wolley 1947 1 Snell 1951 I A/WySn Figure 1.5: Origin of the "A" strains of mice (adapted from Festing, 1979). 31 locus, clfl. This was done by typing a new backcross panel of cleft lip embryos for several polymorphic markers and looking for recombinants within the clfl candidate interval. By examining a large panel of cleft lip embryos, it was expected that a recombinant would be found with a breakpoint within the previously established interval thus reducing the size of the candidate interval. The second section examines the expression of candidate loci in adult and embryonic tissue. The candidate interval is small enough so that examination of most of the individual candidate genes is feasible. The data on expression of genes in the developing craniofacial complex is limited and no previous data were found on the embryonic day 10 and 11 tissue specific expression of most of the clfl candidate genes. Accordingly, a preliminary look at expression of the candidate genes will be helpful in determining the most likely candidates. As both A/WySn and normal control strains were used, this approach also had the ability to detect a clfl mutation in A/WySn if it led to the absence of the mRNA from the candidate gene. In addition, the mRNA from one particular candidate gene, Crhr, was compared between A/WySn and a control strain in greater detail. The third section compares haplotypes of polymorphic markers in the clfl candidate interval across a panel of inbred strains. Strains of laboratory mice are historically related to each other. Some inbred strains are more closely related than others. An examination of the haplotype of polymorphic markers for several strains will indicate whether the clfl interval haplotype is unique to the "A" strains or is shared by descent with other closely related strains. Future work will use this information to evaluate whether alterations found in candidate genes in A/WySn are polymorphisms or are the clfl mutation. Finally, the fourth section examines the possibility of a third locus involved in the etiology of cleft lip in A/WySn and investigates possible candidate loci. 32 Chapter II: General Materials and Methods I. Mouse stocks and maintenance a) Mouse stocks A/WySn The origin of this inbred strain is reviewed in Chapter I. Animals used in this study were part of the Juriloff/Harris colony at the University of British Columbia and were descendants of mice originally purchased from The Jackson Laboratory (Bar Harbor, Maine) (Juriloff et al, 2001a). AXB-4/Pgn AXB-4/Pgn is a recombinant inbred strain originating from a cross between A/J and C57BL/6J. It was established in the Juriloff/Harris colony from a nucleus of mice purchased from The Jackson Laboratory (Bar Harbour, Maine) (Juriloff et al., 2001a). It was used in this study as a normal strain as it contains the normal C57BL/6J alleles at the chromosomal region containing clfl and produces no cleft lip when testcrossed with A/WySn (Juriloff et al., 2001a). b) Mouse maintenance Mice were maintained in the Medical Genetics mouse unit, Wesbrook Annex, at the University of British Columbia under standard controlled conditions. The temperature was 22 ± 2 °C with the light cycle from 0700 to 1900. Acidified water (pH 3.1 by HC1) and Purina Laboratory Rodent diet (#5001) were provided ad libitum. Mice were housed in standard "microisolater" (filtertop) polycarbonate cages with ground corncob bedding (Bed 'O' Cobs). 33 II. Technical Methods a) DNA Extraction DNA was extracted from El 3 (day 13 of gestation) whole embryo tissue (approximately 1/3 of the embryo was used) or from adult tail tips (approximately 2-3 mm of tail tissue used). Tissue was homogenized using a plastic pestle, and then DNA was extracted with the QIAamp DNA extraction kit (QIAGEN Inc. Mississauga, ON) following the crude cell lysate protocol provided. For tail tips the volume of the elution buffer was reduced to 50 u.1 to obtain the appropriate concentration of DNA for PCR. b) Polymerase Chain Reaction Polymerase Chain Reactions (PCR) were carried out in 26 u.1 volumes overlaid with mineral oil in 650 ul polypropylene tubes. Each reaction contained approximately 200 ng of target DNA, 0.13 uM of both forward and reverse primer (11.5 ul), dATP, dGTP, dTTP, dCTP (final concentration of 48 uM each), and IX PCR Buffer (final concentration 20mM Tris HC1 pH 8.4, 50 mM KC1). PCR was performed in a Perkin Elmer Thermocycler 480, usually under the following conditions: 4.5 minutes at 94 °C (denaturation), then 30-35 cycles of 30 seconds at 94 °C (denaturation), 30 seconds at 55 °C (annealing), and 30 seconds at 72 °C (extension), ending with 10 minutes at 72 °C. c) Visualization of PCR products 5 ul of bromphenolblue-xylene cyanol FF marker dye was added to each reaction tube of PCR products. 10 u.1 of the resulting mixture was loaded onto horizontal 4% 3:1 NuSieve Agarose (BioWhittaker Molecular Applications, Rockland, ME) gels containing 0.4 ug/ml ethidium bromide. Gels were run in IX TAE Buffer (Sambrook et al., 1989) at 100-160V for 1.25-1.5 hours. Gels were then examined over UV light (302 nm) and photographed using Polaroid 667 film. 34 d) Sources of PCR primers for SSLPs and source of information on chromosomal location of the SSLPs The polymorphic mapped markers used in this study were SSLPs. SSLPs are short sequences of tandem repeats, usually dinucleotide repeats, that are highly polymorphic (Strachan and Read, 1999). They are detected by looking for size variants in PCR products using primers flanking the repeated sequence. Some of the SSLP markers are now physically mapped relative to genes in the physically ordered sequence of the mouse genome; however the ordered sequence was not available at the beginning of this project, and the order of the Mit markers as seen in the MGI database often disagrees with the order of the markers as determined by mapping studies done in our lab. Primers were obtained from either Research Genetics ("MapPairs" Huntsville, Ala) or were made by the Nucleic Acid Protein Service Unit (NAPS, University of British Columbia, Vancouver, B.C.). Map positions and sequence for previously known SSLP loci are from the Mouse Genome Database (MGD, 2002). Other previously designed primers include: Msx2 PC/PD (Robert and Brunialti, 1995), Crhr A/B (Juriloff et al., 2001a), Itgb3 A/B (Juriloff et al., 2001a), and Lect2 A/B (Juriloff et al., 2001b). Primers amplifying previously unknown SSLP loci were designed by Dr. Diana Juriloff and Dr. Muriel Harris using mouse genomic sequence obtained from Genbank (http://www.ncbi.nlm.nih.gov/) and the primer design program in the Saccharomyces Genome Database (http://genome-www.stanford.edu/Saccharomyces). New SSLP loci were tested for usefulness (a detectable difference between C57BL/6J and A/WySn) by others in the laboratory. Primers for useful markers were obtained by this project. Primer sequence and chromosomal location are listed in Table 2.1. 35 CJ X CJ td -(-» oo CO CO CJ 13 l-l CJ AH F3 o fl CJ xl & „ S OH >I CJ o CJ T3 fl CJ H—» <+H Cd o o o fl cd  o cj — , CJ o ^ o CJ d CJ bu CJ xl bu d 'fl cd o cj co u < .5 CQ £ B .. o CN T3 cd CJ fe T3 O a o • f l d cd CJ CJ d CJ fl cr CJ CO l-l CJ o fl CJ CJ o bu fl cd P T J> T 3 OJ PH CJ CO CJ ^ OH I cd X fl OJ o CJ o fl CJ fl cr CJ co i-i CJ l-l fe cd CJ OH CJ CN co m o U cd --fl c o • i—i bu cj I-I CJ G •2 « J_' co CO X) fl O T-T-Os Os r- co CN CN CN CN i i o- oo CN CN CN CN P. a, x x uo o co CN X o o 9 < o o H H fe H O H H O o H O O £ ° < fe uo uo OO CN CN OO oo —i CN PH PH X X ^ H C< cu ca co co O <H < <c o o fe U < t fe < fe O ^ ° < o o o o o < H o u o < < o o o u < o o cd CJ PH CJ < t dX^P X X uo uo ^ cq UO uo CM C\j PO PO PO Po Ci, Cx, Q q CJ xl •a 3 td Q CJ <+H PH O <L> -H l-l *fl O fl cs CJ OO UO CN ON O Os T—I Os i i Os co oo os o PH X PH X cd CJ PH CJ O uo o o fe cd CJ PH CJ 11 O H-> l-l td « cj TS u g « ^ o a ^ 2 <^o ^ H - f l CO o O CO < u < o o o < o < H < 2 TI-CS Os O r-~ oo i i O Tj-os oo OO Os PH PH X X VD oo o CN O O < CO CO CO CN CO CO PH PH X X < u o o 9^ uo uo PO Po < O O o uo uo H H H H U H U o o o o so vo it; ^ co H < u < H U fe o H O H O H O H H O fe H uo uo uo SO CN o fe < o CO CN uo I I OO i—i —i uo PH PH X X CO < < 0 & CO u < o o fe o H o o fe fe fe r< fe o u o o o PO Po txo bo cd CJ CO PH rt CJ c l-H O _ H PH fe' o Os OO VO Os O O CQ o UO O uo r-- oo uo uo • i CN VO UO CO oo uo uo P, PH X X CO <H u o fe o y < < < u o p < U O U O fe fe o < *1 fe < uo uo X! ^ H O CJ d> CU VO CO CD s a o • i-H 43 & O a OH & cu G <H-I o G _o *H—' cd o o o a o ii o X) G cd cu o G <u (D CO CM G O O CN eu cd H S3 CD OH , U C ^ CD t-i CD a a o a CD 00 .a •A CD cd cd CD OH CD < CJ o fl o CD t-H CD CD CD fl CD fl cr CD co t-i CD CM Os CN Os O o < o CN o o in vo m in Os Os cd CD OH CD I - i oo o vo Os U 0 <n wo VO vo CN CN vo oo in VO vo CN CN OH OH Xi - O cd CD OH CD O CO CO CJ U o o u <: o o o o o o ii < o u o H O < o < p < Co Oo o VO r-r o o O < o — i IO vo t -ro ro ro ro CN CN ro CN ro vo ro ro ro ro CN CN OH OH Xi Xi cd CD OH CD I - i U cd CD OH CD I-i o r o < O O H O CJ O < o < o < o < < U H O O o o io VO i—l < VO ON IO ON IO IO t-~ ON CN ro t-- ON in in OH OH 43 -O oo o vo ON m i-J < CN ro <o >o O O ro ro V . I t . > > ft, ft, ro < H H < O o o H o P o CJ o o o ON ro ro in IO OH OH Xi Xi CJ •< < P O H CJ H < U y < o u o u H U H H O H U U H U Co Co ^1 VO . • O r \ , CD CD g g OB 00 CD CD •B £ S3 S3 CD CD fl fl a s .2 .2 00 00 CD CD I-i l-i cd cd co co CD CD r \ i ^ ft, ^ CD CD CD ^ ^ a CD CD CD 00 00 00 CD CD CD -fl -fl Xi nfl +3 +-• S3 cd cd CD CD CD fl G C fl O fl O 00 00 00 CD CD CD I-i l-i I-I cd cd cci CO co co CD CD CD Ifl « « cd o o CN I t-i 'c3 OH cd x> & OH a - a cd o o t-, q o •J3 CSG, « S3 ra .« , s a a "S « 'S 'S cn fa CO CO 7 f l *——* tl 'c3 I-I OH o, a cd tH *cd OH I—I OH 43 ;fl rfl H H H ro Chapter III, section i: Defining the clfl candidate interval in A/WySn using a backcross panel of 70 cleft lip embryos. I. Introduction As discussed in chapter I, the cause of risk of cleft lip in the "A" strains includes a recessive gene, clfl, which has been mapped by previous studies to chromosome 11 (Juriloff and Mah, 1995; Juriloff et al., 1996; Juriloff et al., 2001a). These studies defined a candidate interval on distal chromosome 11 encompassing approximately 2 to 3 cM (Figure 3.1) including three known genes, but potentially including several additional genes. The proximal end of this interval had been defined by breakpoints in the haplotype of two mice from a congenic strain (Juriloff and Mah, 1995; Juriloff et al., 1996), and the distal end of the interval had been defined by a breakpoint in the haplotype of one embryo from a BCi panel of 36 cleft lip embryos from a cross of A/WySn with C57BL/6J (Juriloff et al., 2001a). It was hoped that a new BCi panel would decrease the overall size of the candidate interval by having breakpoints closer to the clfl gene (1-2 recombinants within the candidate interval expected), but would at least confirm the interval indicated from the previous study. In addition, new markers derived from sequence physically within or near genes could be used to include particular genes as candidates for clfl by mapping the genes inside or outside the candidate interval respectively. In the previous cross (A/WySn X C57BL/6J), 2.4% cleft lip was observed in the BCi (Juriloff et al., 2001a). The recombinant inbred strain AXB-4/Pgn, derived from a cross between A/J and C57BL/6J, has retained a piece of chromosome 13 from A/J including the Clf2 gene and a piece of chromosome 11 from C57BL/6J including the clfl gene (Strain Distribution Pattern, M.G.I.). We would expect approximately twice as much cleft lip in the BCi after a cross between A/WySn and AXB-4/Pgn because one of the two loci {Clfl) will not be segregating. The large number of cleft lip embryos required to obtain recombinants could then be collected with a smaller number of litters. 38 o 6 2 clfl 6 4 D11MU360 Crhr, Myla, Itgb3 DUMU166 Chr. 11 Figure 3.1: clfl candidate interval on mouse chromosome 11 showing candidate genes mapped to interval (adapted from Juriloff et al., 2001a). 39 II. Materials and Methods Mice All maintenance of mice and matings were done by D.M. Juriloff and M.J. Harris. Origins and care of mice are described in Chapter II. BCi embryos were obtained by intercrossing A/WySnJ and AXB-4/Pgn mice and then crossing the resulting Fi males back to A/WySn females or from the reciprocal cross (Fi females with A/WySn males) (Figure 3.2). Observation of cleft lip and collection of cleft lip embryos All embryos were collected by D.M. Juriloff and M.J. Harris. To collect embryos, pregnant females at about day 12 to 16 (average at day 13) of gestation were killed and the abdomen was exposed by cutting a small lateral incision with surgical scissors and pulling the skin towards the head. The peritoneum was then cut with surgical scissors along the midline and sides to reveal the abdominal cavity. The uterus was removed, pinned to a black wax substrate in a petri dish, rinsed with sterile saline, immersed in fresh sterile saline, and cut open. The embryos were then examined in situ using a dissecting microscope. All embryos were examined for presence or absence of cleft lip and for other external defects. The gestational age, number of embryos, number of resorptions, and number of cleft lip embryos and the laterality of the cleft were recorded for each litter. Dead embryos of day 12 or more of development were scored as if they were alive. Resorptions (moles) were those embryos that had died in utero prior to day 12. Screening for recombinants and mapping genes to the candidate interval DNA was prepared and PCR and visualization of products were performed as described in Chapter II. All cleft lip embryos were characterized for the SSLP markers D11MU132, D11MU199, D11MU10, and DUMit258 (M.G.I.). Recombinants, identified by a 40 cd O O CN cd -*-» tD O CM ra td Q * X < -a c a fl oo S3 CU <U & tu X) co OT o t-o O cd X i CM O S3 o td M tu C3 <u O CN cn tu (-1 fl M genotype = "AB", for any of these four markers were tested with a variety of additional SSLP and gene-specific markers to determine the location of the breakpoint. Established SSLP and new markers (Table 2.1) used were: D11MU286 F/R, D11MU360 F/R, D11MU126 F/R, D11MU58 F/R (amplifying the gene Myla), DU Mitl 66 F/R, Itgb3 A/B, Crhr A/B, Dlx3 I/J, DllRep332 F/R, Wnt3 L/M, Mtapt E/F, NsfA/B, Tlk2-A A/B, Cyb A/B. Primer-specific PCR conditions are listed in Table 3.1. Typing of recombinants for a variety of additional markers was done to establish the proximal and distal limits and the composition of the clfl candidate interval. Mapping data from our lab has established an order for the Mit markers and genes within the candidate interval that often differs from the order in the MGD. III. Results A total of 71 cleft lip embryos were collected from a total of 1994 embryos from the crosses of Fi males to A/WySn females and the reciprocal cross (Table 3.2). 73 cleft lip embryos were generated and used in the calculation of cleft lip frequency; however, two were not kept for DNA as determination of cleft phenotype was not absolutely certain due to maceration of embryos (one BCL and one RCL not kept). The expected frequency of cleft lip calculated based on the frequency of cleft lip in A/WySn (about 20%, Juriloff et al., 2001a) and with one elf locus segregating is 10.0%. The frequency of cleft lip obtained was 4.0%, and this is significantly different from that expected (p<0.05). The percent cleft lip in the reciprocal cross is 1.3%, which is significantly lower than 4.0% (p< 0.05) and is consistent with the maternal effect seen in previous crosses (Juriloff et al., 2001a). The distribution of laterality of cleft lip (Table 3.2) is also similar to that seen in the previous cross (Juriloff et al., 2001a). Typing of markers in these cleft lip embryos indicated that five are recombinant either at the most distal marker, D11MU258 (3), or the most proximal marker, D11MU132 (2) (Figure 3.3). Typing additional markers indicated that the two embryos (X125 and X170) recombinant at D11MU132 have a breakpoint between Dlx3 and DllRep332. Typing of additional markers also indicated that the breakpoint for two embryos (XI46 42 Table 3.1: PCR conditions and estimated product sizes for informative markers used on BCi panel of cleft lip embryos. Marker Tanneal , [M g ci 2 ] Allele size (bp) CQ (mM) A/WySn C57BL/6J D11MU132 55 1.5 145 130 D11MU286 55 1.5 110 130 Dlx3 I/J Hot start 55 1.5 140 130 DllRep332 55 1.5 180 170 D11MU199 55 1.5 105 120 D11MU360 55 1.5 115 120 Wnt3 L/M 55 1.5 130 105 D11MU126 55 3.5 190 186 MaptE/F 55 1.5 135 150 Crhr A/B 55 1.5 320 300 DllMitlO 55 - 1.5 115 80 Itgb3 A/B 55 1.5 300 350 Ns/A/B Hot start 55 1.5 150 145 D11MU58 55 1.5 230 240 Tlk2 A/B 60 1.5 230 235 D11MU166 55 1.5 140 145 Cyb561 A/B .55 1.5 160 155 DllMit258 55 1.5 165 130 43 CJ T fe u fe a) "o CU 13 fe O PQ .& »——< cu bo fe U O a (U .2-<c cu 1J <+H o *CU C oj CH CU C cu bo cu fl o T 3 co CO O >-< CJ o H-H o fl a A 00 CN ^ en _g, cu 3 4H 13 u fe o CH cu o cn fe v q i—i v d o d C N C N C N °"> CN fe co X fl < " Of! fe c M ( M G D ) X125/ X146/ X170 X163 X152 58 D11MU132 • • • 52 D11MU286 • - Dlx3 • 62 DllRep332 • • 62 D11MU199 • • • 64 D11MU360 • • 63 Wnt3 • • 63 D11MU126 • • 64 Mapt • • 62 Crhr • • 63 DllMitlO • • • 68 Itgb3 • • 63 Nsf • • 65 Myla • • - Tlk2 • 64 D11MU166 • 65 Cyb561 • 65 D11MU258 • • • 65 2 2 • 1 • A A • A B Figure 3.3: Summary of polymorphic markers from the clfl candidate interval in a cleft lip backcross embryo panel, showing the breakpoints for each recombinant. The identification code for each recombinant is shown at the top of the columns, and the total number of embryos is shown at the bottom of each column. Blank spaces indicate that the marker was not typed on the respective embryo(s). 45 and XI63) lies between D11MU58 and Tlk2, and the breakpoint for the final embryo CXI52) lies between Cyb561 and D11MU258. From previous studies (Juriloff et al., 2001a), the genes Crhr (Corticotropin releasing hormone receptor), ItgbB (Integrin beta 3), and Myla (Myosin light chain, alkali, cardiac atria) (from the SSLP marker D11MU58) were mapped by mapping panels to within the clfl candidate region (Figure 3.1). In addition, the genes WntS (Wingless-related MMTV integration site 3), Dlx3 (Distal-less homeobox 3), and Mapt (Microtubule-associated protein tau) were placed within the candidate region by data from YACS. The current panel of cleft lip backcross embryos has confirmed the mapping of Crhr, Itgb3, and Myla within the candidate region, and this study has also placed the genes Mapt and Wnt3 within the interval, confirming the YAC data. This panel has excluded Dlx3 from the candidate interval in contrast with the previous YAC data. New information from the current study is that the gene Nsf (N-ethylmaleimide sensitive fusion protein) is included, and the genes Tlk2 (Tousled-like kinase 2) and Cyb561 (Cytochrome b-561) are excluded, from the candidate interval. One cleft lip embryo (XI56) gave results that have not previously been seen. All other cleft lip embryos typed to date have had some region of homozygosity for markers in the candidate interval; however this embryo is heterozygous "AB" at all markers tested to date in the clfl candidate region (Figure 3.4). Unlike all other cleft lip embryos typed, XI56 had a syndrome that included a curled tail and severe edema. Discussion: The new backcross done for this study had a significantly lower frequency of cleft lip (4.0%) than expected (10%). The previous backcross from the original cross of A/WySn to C57BL/6J also had a significantly lower frequency of cleft lip (2.4%) than that predicted by the two-locus epistatic model (5%). Both of these crosses suggest that there is a third locus contributing to risk of cleft lip in A/WySn that is segregating in these crosses. If three loci cause cleft lip in A/WySn, we would expect a frequency of cleft lip 46 c M (MGD) 58 52 62 62 64 63 63 64 62 63 68 63 65 64 65 65 D11MU132 D11MU286 Dlx3 DllRep332 D11MU199 D11MU360 Wnt3 D11MU126 Mapt Crhr DllMitlO Itgb3 Nsf Myla Tlk2 D11MU166 Cyb561 D11MU258 X156 • • • • • • • • • • • • • • • • • Figure 3.4: Results of PCR on cleft lip embryo X156 for polymorphic markers in the c candidate interval. XI56 has severe edema and a curly tail. of 5% in the present backcross (2 loci segregating), and 2.5% in the previous backcross (3 loci segregating), which is a reasonably good fit to the data obtained. A genome screen done on the first backcross panel (Juriloff et al., 2001a) indicated additional regions of the mouse genome, other than the locations of clfl and Clfl,, where additional risk loci might be. The results of investigating these regions will be discussed in Chapter IV. Typing of various polymorphic markers on the new backcross panel of 70 embryos (does not include the heterozygous embryo) verified the placement of the distal limit of the candidate interval between Myla and D11MU166 that had been established in previous studies (Juriloff et al., 2001a). The proximal limit seen in this panel of embryos was slightly higher than that seen in previous studies, which was between D11MU360 and D11MU126. However, the size of the interval based on this data is still approximately 2 to 3 cM. The new panel has also provided a clearer picture of the genes that are still candidates and those that have been excluded based on this mapping data. Although Mapt, Wnt3 and Dlx3 have been previously postulated to be within the candidate interval based on data from YACs (Juriloff et al., 2001a), this panel clearly indicates that the genes Mapt and Wnt3 are within the interval, and that the gene Dlx3 is not. In addition, the panel has provided the new information that the gene TVs/is included in the interval, and the genes Tlk2 and Cyb561 are excluded. Three additional genes (Arfl, Gosr2, Writ 15) that are included in the candidate interval in the public databases (UCSC, Ensembl) have not been mapped with this or the previous panel, as no informative markers were available. The new panel also included one embryo with cleft lip that had a chromosome 11 marker haplotype unlike all of those seen previously. This embryo was heterozygous for all markers tested to date in the candidate interval. Although this embryo did have cleft lip, it was also edematous and had a curled tail. The curled tail is a characteristic that is not seen in A/WySn. With all of the data gathered to date, the probability is very low that this embryo is a simple affected heterozygote, as all evidence points to clfl being 48 necessary in homozygous state. It is possible, given the novel phenotype, that this embryo has a new dominant mutation that interacts with clfl and leads to affected heterozygotes, or it is possible that there has been some complex rearrangement resulting in the deletion of the clfl gene on the "B" chromosome. When a potential gene for clfl is identified, this embryo could prove useful in confirming or rejecting the gene. Although the new panel did not yield a recombinant that reduced the size of the candidate interval, it proved useful in confirming boundaries and candidate genes and provided a firm starting point to begin to look at the expression of candidate genes. 49 Chapter III, section ii: Expression of clfl candidate genes in adult tissue and embryonic tissue. I. Introduction Using the mapping data from the new backcross panel (Figure 3.3) and the information in the public databases (UCSC, Ensembl), a list of all of the known candidate genes within the clfl candidate interval was generated. The genes are: Arf2 (ADP-ribosylation factor 2), Crhr (Corticotropin releasing hormone receptor), Gosr2 (Golgi SNAP receptor complex member 2), Itgb3 (Integrin beta 3), Mapt (Microtubule-associated protein tau), Myla (Myosin light chain, alkali, cardiac atria), Nsf(N-ethylmaleimide sensitive fusion protein), Wnt3 (Wingless-related MMTV integration site 3), and Wntl5 (Wingless-type MMTV integration site 15) (Figure 3.5). To date there are no candidate genes within the clfl candidate interval whose human homologues have been identified as potentially having a role in the etiology of human nonsyndromic cleft lip, therefore the human literature provides no starting point in the search for clfl, and all genes at first must be considered equally. In addition, because of the necessity for Cl/2 and the genetic maternal effect to provide risk of cleft lip, the phenotypes of mice with existing mutations at these loci are unlikely to help us discriminate between candidates. Those loci that have been mutated in mice do not produce a phenotype that includes cleft lip [Crhr (Timpl et al., 1998); Itgb3 (Hodival-Dilke et al., 1999); Mapt (Harada et al., 1994); Wnt3 (Liu et al., 1999)]. As an initial method of differentiating among potential candidate genes, it would be valuable to know if the gene is expressed at the correct place and time. As discussed in Chapter I, the lip forms on day 10 to 11 in the mouse; however there is a lack of expression data for this particular time and location in development for the genes known to be in the candidate interval. There is some evidence that 8 of the 9 genes in the candidate interval are expressed at some time in prenatal development \Wntl5 (Heller et al., 2002); Itgb3 (Wada et al., 1996); Arf2 (cDNA clone, Genbank #AK077591); Mapt (cDNA clone, Genbank #AI931779)], with some evidence that Myla (Kawai et al, 2001), Gosr2 (Kawai et al., 2001), Wnt3 (Roelink et al., 1991; Salinas et al., 1992), and Nsf (Piischel et al., 1994) are expressed on Day 10. The studies on Wnt3 and Aft/indicate that 50 o 6 2 clfl 6 4 D1IMU360 Crhr, Myla, Itgb3, Gosr2, Wnt3, Arf2, Nsf9Wntl59 Mapt D11MU166 > Chr. 11 Figure 3.5: clfl candidate interval on mouse chromosome 11 showing all genes known to be in the interval based on previous mapping data by our lab plus information in the UCSC and/or Ensembl databases. 51 these genes are expressed in the developing nervous system on Day 10. No evidence was found that Crhr is expressed during development. These data do not provide information that would help to rank candidate genes, as there are no expression data on these genes from the correct time and place in development. Expression data from this critical time period and from the specific tissues involved in the formation of the lip would therefore be very helpful in further ranking potential candidate genes. As embryos were not.available and they yield low quantities of mRNA, mRNA was first obtained from adult male testes as a starting point to establishing the techniques. Adult testes were used because the tissue is readily available and expression in testes had been reported for some candidate genes. Originally, testis cDNA was screened to look for large abnormalities, such as a large deletion. If an abnormality was detected, such as a smaller than normal product or absent product, we would then look for it in the developing embryo. Our results led us to abandon testis mRNA in the search for abnormalities and instead focus on embryos as will be explained below. II. Materials and Methods RNA Extraction a) Preparation of labware and dissecting equipment A glass homogenizer was washed with Liquinox soap and water, rinsed with tap water, rinsed with distilled water, soaked in 3% H2O2 (Fisher Scientific, Fair Lawn, New Jersey) for fifteen minutes, rinsed with distilled water, and then rinsed with DEPC water. Dissecting equipment was washed with Liquinox soap and water, rinsed with distilled water and then rinsed with double distilled water. b) Tissue collection and protocol followed Adult male mice were killed by carbon dioxide, and the abdomen was exposed by cutting a small lateral incision with surgical scissors and pulling the skin towards the head. The 52 peritoneum was then cut with surgical scissors along the midline and sides to reveal the abdominal cavity. The intestines were shifted to expose the testes. One whole testis was dissected out and submerged in 1800ul of RNAlater (QIAGEN Inc., Mississauga, Ont.) and placed at 4 °C overnight, removed from the RNAlater, transferred to a cryovial, and placed at -80 °C for archival storage. The other testis was dissected out and placed in a glass homogenizer containing 3600ul Buffer RLT (QIAGEN Inc., Mississauga, Ont.) + 36(4.1 p-Mercaptoethanol (Sigma). Tissue was ground for approximately 30 seconds and then transferred to six 1.5ml eppendorf tubes (600(xl for four tubes, <600ul for two tubes). The rest of the RNA extraction was done according to the protocol provided with the RNeasy Protect Mini kit (QIAGEN Inc., Mississauga, Ont.). RNA was stored in 30jxl RNase-free water at -80 °C. The RNeasy Protect Mini kit isolates all RNA molecules longer than 200 nucleotides, and the protocol promotes selective isolation of RNA, but DNA contamination is still possible. Timed pregnancies were obtained by Dr. Diana Juriloff and Dr. Muriel Harris as described previously (Macdonald et al., 1989). For collection of Day 10 embryos, adult - female mice were killed by cervical dislocation, and the abdominal cavity exposed as described above. The uterus was removed and placed in a new plastic petri dish containing fresh IX PBS (cold) (Sambrook et al., 1989). The embryos in deciduae were removed and placed in second new plastic petri dish containing fresh IX (cold) PBS. The embryos were then quickly removed from the decidua and placed in a plastic petri dish containing RNAlater (QIAGEN Inc., Mississauga, Ont.). Virtually all amnion was removed and tail somite count was determined for each embryo (Appendix A). Embryos were then transferred to fresh RNAlater and stored at 4 °C for one to three days. Dead embryos ("moles") were not collected. Embryos stored in RNAlater were transferred to plastic petri dishes. A cut was made immediately caudal to the second branchial arch, and the head portion of the embryo was placed back in fresh RNAlater and stored at 4 °C. The remaining bodies were transferred to cryovials and stored at -80 °C. Occasionally heart tissue remained attached to the heads. All collection and dissection of embryos was done by D.M. Juriloff. 53 Litters of embryos were pooled based on a range of tail somite count (Appendix A). Five groups were made of A/WySn embryos pooled by tail somite count as follows: 0-9, 1-6, 1-7, 4-10, and 4-16 somites. One group was made of AXB-4/Pgn embryos pooled by tail somite count as follows: 0-12 somites. RNA was extracted from the embryonic heads following the protocol described above for adult tissue. RNA was stored in RNase-free water at-80 °C. Quantitation of total RNA 1 (0.1 of RNA solution was added to 99ul of double distilled water to make a 1/100 dilution. Diluted RNA was placed in a cuvette in a spectrophotometer and A260 and A280 readings were taken. The following relationship was used to determine the concentration of total RNA: A 2 6 0 of 1 = 40ug/ml of RNA (Sambrook et al., 1989). Checking the integrity of the RNA Total RNA was run on 1.2% Formaldehyde Agarose gels or 1.2% Agarose gels to verify integrity. 1.2% Formaldehyde Agarose gels consisted of agarose (Invitrogen Corp., Carlsbad, California), 10X FA gel buffer [200mM MOPS (BDH), 50mM sodium acetate, lOmM EDTA (pH 8.0)], DEPC water, 37% (12.3 M) formaldehyde (Fisher Scientific, Fair Lawn, New Jersey), and a touch (around lul) of lOmg/ml ethidium bromide. Before casting formaldehyde agarose gels, the gel tray and comb were washed according to the procedure described above for the glass homogenizer. The gel tank was rinsed with tap water, rinsed with distilled water, soaked with 3% H2O2 for fifteen minutes, then rinsed with distilled water, and DEPC water. The tank was filled with IX FA gel running buffer [10X FA gel buffer, 37% (12.3 M) formaldehyde, DEPC water] and the gel was placed in the tank to equilibrate for 30 minutes. 4ul of a RNA sample was added to lul of 5X RNA loading buffer [saturated bromphenol blue solution (BDH), 500mM EDTA (pH 8.0), 37% (12.3 M) formaldehyde, 100% glycerol, formamide (Fisher Scientific, Fair Lawn, New Jersey), 10X FA gel buffer, DEPC water]. The sample was then incubated 54 for 5 minutes at 65 °C and put on ice. A RNA standards ladder (Invitrogen Corp., Carlsbad, California) was added to 5X RNA loading buffer, heated for 10 minutes at 70 °C and put on ice. The samples and ladder were then run for 100 V-hrs. The protocol for the 1.2% Formaldehyde Agarose gel was from the RNeasy Protect Mini kit (QIAGEN Inc., Mississauga, Ont.). 1.2% Agarose (Invitrogen Corp., Carlsbad, California) gels containing a touch of lOmg/ml ethidium bromide were run in IX TAE buffer (Sambrook et al., 1989) for 67 V-hrs. cDNA synthesis cDNA was synthesized from total RNA following the protocol provided with the Omniscript Reverse Transcriptase kit (QIAGEN Inc., Mississauga, Ont.). 2 ug of total RNA was added to 1 uM random primers (Invitrogen Corp., Carlsbad, California), 10 units RNAguard RNase inhibitor (Porcine) (Amersham Pharmacia Biotech Inc.), 0.5mM of each dinucleotide (dATP, dGTP, dCTP, dTTP), IX Buffer RT, and 4 units of Omniscript Reverse Transcriptase. Reverse transcriptase was inactivated following synthesis of cDNA from testis RNA, but was not inactivated following synthesis of embryonic cDNA. Designing expression primers Primers were obtained to examine expression of candidate genes in adult and embryoni tissue. Previously designed primers used include: Myla pl/p2 (primer pair st96_212 in M.G.I.), Crhr pl/p2 and Crhr p3/p4 (Heinrich et al., 1998). I designed new primers by obtaining the mRNA sequence of genes from Genbank in the candidate interval and designing cDNA-specific primers to flank intron/exon boundaries. Intron/exon boundaries were flanked so that no product or a larger product would be produced by amplification of any genomic DNA contaminating the cDNA sample. Intron/exon boundaries were determined by comparing the mRNA sequence with available genomic 55 sequence or by obtaining the information on intron/exon boundaries from the public database (Ensembl, U.C.S.C.). Primer sequence and information on exons spanned by each primer pair are shown in Table 3.3. The protocol for PCR is described in Chapter II. PCR conditions are listed in Appendix B. Designing additional primers I designed primers to flank the normal (CRSP1 F/R) and putative (CRSP2 F/R) splice junctions in Crhr so that these DNA sequences could be sequenced and the sequence could be examined for variants. The.primers were designed based on sequence obtained from N.C.B.I. (Genbank # AL596383). After two variants were found (one at the normal splice site and one at the putative splice site), I designed "allele-specific" primers based on the published sequence (Genbank # AL596383) and the sequence obtained from sequencing A/WySn and AXB-4. The primer pair CRMIS1 F/R amplifies only control-like sequence and the primer pair CRMIS3 F/R amplifies only A/WySn-like sequence at the normal splice site. The primer pair CRSNP1 F/CRSNP3 R amplifies only control-like sequence and the primer pair CRSNP2 F/CRSP1 R amplifies only the A/WySn-like sequence at the putative splice site. These primers were used on additional inbred strains to identify whether the splice site variants were mutations or polymorphisms. Primer sequence and conditions are listed in Table 3.4. Duplex PCR Duplex PCR was done to confirm the results of traditional PCR. The PCR reaction mixture used in duplex PCR was identical to that described in Chapter II, with the exception that primer pair mixes for two different sites were combined. Half the volume listed in Chapter II was used for each primer pair mix. For the second primer in the reaction, a primer for a ubiquitously expressed gene not located on chromosome 11 was desired, fi-actin (chromosome 5) fit these requirements and the sequence of a primer pair 56 00 ^ O (D O C O fl -fl CD CD r i co cr fl CD CO =tfc ( V CD as CO O O a l o a W DM CO CM + fl O O CM CD O C CD fl cr CD 00 2" CD fl CD 00 o o < 2 2 ro oo ro O N m < C N V O r -o o V O • vo oo ^ 2 -oo ^ ^ in CN vo in cs io M oo vo V O V O o _ O O oo ro M c o v o v o m ' - i r H r t i n c c M r H c - - o o c N O v o v o c N t ^ - o o V O - ^ - ^ - T - H O N O N O O I O V O oo oo o o ro ro ro O N ro T-< CN OH OH I-I < Bog < ^ S o o u H < H u < o H O O O < U ^ u fc 3 < h < < p H 5 ° Co - ^ P H U H U H < U o H U H O . O O < H U O ~ uo ro ro ro H H < H O O H H f_ < < O y o h P O H O c 3 H < O P o < fc <^ O < u o y u H P r < in Co Co 2 o m VO ON M ^ B n ^ ^ v O N C O c > 2 ' - | c N c n ^ « r ) v o ^ o o ftaftftaftc,c,fta7;M-H- — l^i ^ * •§« -Ss o o u u I-I OH & , OH OH OH OH ct, OH •3* £ s - g s -S* o o o V O vo ro ro ro vo • i VOI ro ro < O u p 0% < < < O O Co —i C N , OH OH I co 5 O O 00 wo c _o to CO & OJ OJ a CJ bo OJ fl e X CJ o -*-> TS CJ fl .SP CJ OJ s • 1—1 11 CH CJ • 1—< O OJ 0, co P o fl o cj co CO cj fe cj cu •— o fl T J aj CJ fl CO CT1 A CJ CO =tfc X 5J * 8 s i o a >< s. " fl, co fl o -O 'co O C M CJ O fl OJ fl cr CJ co I-I OJ 00 os os fl OJ O l*fl fe I—I F 1 OJ g O C+H CJ T J OJ • r t CO CJ CN. Os cd CL, I-I OJ £ fe ON IT) CD A cu cu x! -»-» H-H O CO cu X T J CU cu a • < PH OT fl o > i-l OT c o fl o o T ) C fl CU o fl cu fl cr cu C O Tf cu amplifying this gene was obtained from Benavides et al, 1995. Conditions used were the same as those listed for the respective Crhr primers in Appendix B. Sequencing The PCR product to be sequenced was run on a 4% 3:1 NuSieve Agarose gel for approximately 100 V-hrs. The band of DNA of the appropriate size was then excised from the gel and the DNA was extracted following the protocol provided with the QIAquick Gel Extraction Kit (QIAGEN, Mississauga, Ont.). DNA was eluted with 30 pi of Buffer EB. 2ul/reaction of this eluted DNA was used for a second round of PCR. The PCR product was run on a 1.9% Agarose gel for approximately 70 V-hrs. The appropriately sized band of DNA was excised and eluted following the same protocol as above. Next, the concentration of the DNA was approximated by running 4 pi of DNA sample + 1 pi loading dye on a 2% Agarose gel with a Low Mass DNA Ladder (Invitrogen Corp., Carlsbad, California). DNA samples with a concentration of approximately 20 ng/ul and aliquots of forward and reverse primers with concentrations of 3.2 pmole/ul were sent to NAPS for sequencing of the DNA product. Sequence Analysis Sequence data (obtained from NAPS) for the exonic and intronic regions of Crhr was compared visually to the published sequence for the strain C57BL/6J [Genbank # NM_007762 (mRNA sequence), Genbank # AL596383 (genomic sequence)]. Sequence data for the alternatively spliced fragment was compared to the high throughput genomic sequence and non-redundant databases in BLAST (NCBI). Sequences were compared to other sequences using the "Pairwise BLAST" program in BLAST (NCBI). Predicted Genes A list of predicted genes was obtained from the UCSC site for the clfl candidate interval between D11MU360 and Tlk2, which flank the proximal and distal ends of the candidate 60 interval (bp 104164946-106064361). The predicted genes were from three gene prediction programs (Ensembl, Fgenesh++, mRNA matches). The predicted genes from these three programs were chosen by me because all genes predicted are compared to existing protein, cDNA, EST or mRNA databases, which increases the likelihood that the predicted genes are actually present and expressed in the mouse. The mouse, human or macaque EST/cDNA with the highest percent identity to the sequence of the predicted gene was recorded. To determine whether there was any evidence for expression of the predicted genes at the critical time of lip formation, the mRNA sequence of the predicted genes was compared with a modified mouse EST database. The following method was devised after consultation with staff at NCBI as no method was apparent on the NCBI site: 1) Access the site http://www.ncbi.nlm.nih.govAJniLib/lb.cgi. 2) Enter "10.5 days embryo" in the "search terms" box, mouse in "organism", and EST in "type". Click "Go", and a list of several embryonic EST databases appears. 3) Choose one of the desired databases (for example, "11 days embryo"), and click the number of sequences. From this page copy the "search term". 4) Next, retrieve the BLAST home page (http://www.ncbi.nlm.nih.gov/BLAST/) and choose a standard BLAST. Enter the predicted gene's mRNA sequence in the "search box", choose "mouse EST" as the database, and in "limit by Entrez query" enter the specific search term copied from step 3. For this study the specific search term entered was "clonelib RIKEN full-length enriched, 10 days embryo" OR "clonelib RIKEN full-length enriched, 11 days embryo" OR "clonelib RIKEN full-length enriched, 9 days embryo" OR "clonelib RIKEN full-length enriched, 10, 11 days embryo" OR "clonelib RIKEN full-length enriched, 11 days embryo head" AND "gbdiv_est [PROP]". This limited the database to the EST libraries from day 9,10, and 11 embryos, and day 11 embryo heads for this study. 61 III. Results To begin, expression data from adult testis was collected for all of the known candidate genes plus one putative gene in the clfl candidate interval by RT-PCR. The genes were examined in the following order: Myla, Crhr, Itgb3, KIAA1267, Wnt3, Nsf Mapt, WntlS, Gosr2, and Arf2. Either part of or the entire mRNA sequence was examined with cDNA-specific PCR primers designed from the published RNA sequence. PCR was done on cDNA from A/WySn and a control strain (AXB-4) and the resulting gels were examined first for presence of a band of expected size and second for any differences between A/WySn and the control strain. Similar products were seen between A/WySn and AXB-4 for all primers amplifying the genes Myla,Itgb3, KIAA1267, Wnt3, Nsf, Mapt, Wntl5, Gosr2, and Arf2. Similar products were seen between A/WySn and AXB-4 for all of the primer pairs amplifying the gene Crhr except Crhr pi5/16, Crhr pl5/pl8, and Crhr pl7/pl6 (Figure 3.6). Results were seen in at least two samples of cDNA from one individual mouse from each strain. One pair of primers (Crhr pl5/pl6) gave a difference in intensity between A/WySn and AXB-4 (Figure 3.7) where A/WySn gave a product less intense than that in AXB-4. An additional pair of primers (Crhr pl7/pl8) flanking approximately the same sequence was designed and two combinations of primers (Crhr pl5/pl8, Crhr pl7/pl6) from these two pairs of primers also gave the same intensity difference between the two strains (data not shown). This result was seen in multiple preparations of cDNA from the same individual mouse and also in two different individual mice from each strain. The result was also replicated in duplex PCR reactions with fi-actin and the primer pairs Crhr pl5/pl8 (data not shown) and Crhr pl7/pl6 (Figure 3.8). This piece of Crhr cDNA from exons 1-5 was sequenced once for both strains using the forward primer Crhr pi5 and the reverse primer Crhr pi8. The A/WySn sequence was also confirmed by sequencing using the forward primer Crhr pi7 and the reverse primer 62 ro vo I MD OH i/o in O c cu cr CD CO a o c CO O MD ro CN < CD O C CD cr CD 00 MS ta, eu r h ; s ° CD on g "c3 " -M CO c2 — ca DO M "5b U Is CD O -O T3 <D CD fl (D fl cr tu CO •5 Q ex ° <-23 fl +3 CU • tu fl CM H _ bO O CM cd C O cfl 2 « CU 43 Id - 2 CO 1) ^ J 8 CM CQ oo ^ s ; ^ x a £ CM > > U VH 00 cd fl a tu Q | . . vq -o ^ ro rj eu H M ' — s oo H2 E . 3 3 in vo t CO '-*-» CO 3 -fl 3 fl CO < C o to Q c cu <u CO M tU TJ OH X) o o s A « tu oo g TJ fl § c £ i n 03 CO OH <D >> H—' 'Lo fl tu o tH OH V O fl rH O CM O O .—I (N -OH X S o fl '-fl fl o "2 CO fl cu "5 CO > Vfl fl X -o J> fl ^ >< U > 00 c o co OO Tf I CQ fl CO 00 eu CN T3 C C O eu •2PQ £ ° co eu c £ 0 O Crhr pi6. No differences in base composition were seen between A/WySn and either AXB-4 (Appendix C) or the Genbank sequence (Genbank # NM_007762). In addition to the intensity difference seen with the three pairs of primers described above, PCR using the primer pair Crhr pl7/pl6 produced an 800bp fragment seen only in A/WySn (Figure 3.9). This difference between strains run at the same time was seen . consistently between six cDNA preparations from the RNA of one individual from each strain and verified in a separate individual for both strains. This 800bp fragment was isolated and sequenced using Crhr pi7 as the forward primer, and Crhr pi 6 as the reverse primer. Approximately 800bp of sequence was obtained from each of two sequencing attempts using the forward primer (Crhr pi7). Using the BLAST program, this sequence was compared to the "high throughput genomic sequence" (htgs) and "non-redundant" (nr) databases. Similarity was seen between the sequence and one BAC (RP23-19217) and one model reference sequence (LOCI95068) located at 33 cM on mouse chromosome 11 (Figure 3.10), 30 cM proximal to the Crhr gene. Approximately 600bp of sequence was generated from one sequencing attempt using the reverse primer (Crhr pi6). This sequence was also compared to the htgs and nr databases and similarity was seen between this sequence and a BAC containing the gene Crhr located at 62 cM on chromosome 11 (Figure 3.11). The sequence homology was to exons 4 and 5 of the gene Crhr and to part of intron 4. The forward and reverse sequences did not contain any significant sequence homology when compared to each other using the Pairwise BLAST program. As these results were difficult to understand, it was decided to focus on the fragment having homology with Crhr. The sequence generated from Crhr pi6 matched both exonic and intronic sequence and further examination led to the conclusion that it might be an alternatively spliced product (Figure 3.12). Primers were designed using the published sequence to flank the normal (N) intron 4/exon 5 splice site (CRSP1 F/R) and the possible alternative (A) splice site 66 is o g O a bp K .5 u £ cd 03 S3 _3 vo u *r; I co CN .2 § U 00 V D ON cn cn ON < oo NO o un ON o H - l on o 3 CO ON CO oo ON ON ON m CN o 8 3 CO cn un ON oo l_ £ l_ NO un I a cr <u CD ±i un ON oo NO o un ON U O t/5 r—H o un m O « t i El S cr1 tu CD ±j un ON 0O ON -4 ON S CN ON i CO CN & CD fl C> V o NO cn J . r--rt W Xi -rt n •fl -2 CN C3 —i 1 3 T3 CU l - l I c O Cl fe < h-l CQ cu xl X cn cl gj < T J XI § M 0O V D .ti o -fl un S 2 3 u CJ >—l r~> > T J P 3 o r: "§ c2 "o cu = I a i xl °a *t! ca O ^ S CO rt «-> 2 C*H q CH S CU bu fl 'o C cu cr cu CO -rt fl CU I-I fe Hrt a a * "S CH O X fl O T J O O 2° fe Crt " O co CU CU co O fl fl X CU fl fl. -rt O 8 x? O cu 2 g cr cu ~ co cu fl § .2 cr co CU CO CO ' f l u £ I 3 rt g . . bu cn" £ § fl° fe £ fl CO cu o l - l CH ra i_ i—i CH CU l H <u fl o co O cu p 12 o ou o .S cn — c rn "S 2 -fi o co PH cs fl Q a ON NO O O O O O O o o vo o o O o o o m o o CN o o o vo r CN VO VO 00 CN vo o o I o CN < U ON oo Os W m i m CN & CD a o U l_ o CN B 3 y <u .fl cd CD NO cd o ^ <u fl ON i "O .W CD m cd Q-CN m <D 0i fl," -5 O a ° ^ O JH O • <2 o . CD M co O . M fl fl oo ft ^ CD K & o X cu o o a © <U O I* a TT C O CU © I D o o I D a c ^ I D fl O CU O I D -4—» -a <D d -fl -fl u o Vfl g co 2P .-fl cd -O ^ cfl -73 CD Q x> o o fl • f l OH CD OH o< £ " u OH X CD CO O O 00 c CO NO c o X CD CD O -^i—i -fl o "fl fl CD -CD H—» fl o c o< O T J CD CD O c > ~ .2 !>  -fl<! CD fl cr CD CO C O tH o OH OH S •fl ^ S —4 CO CD . 3 3 cd A * fl CD 5 ° fl ^ A ^ "fl fl w co DO £ CD fl * CD CD — -fl -fl 0, L_ H—* -O L oo 2 • fl O co . 3 oo 2 H-H fl cd CD -fl £! -C rt CO f—I T J 3 <L> fl vd ^ oo -g • H U ^ Q SS £ CD T J fl CD 2 I o • rv CD ro co 2 " 8 DO > 22 2 E 2 .22 -M (CRSP2 F/R). These primers were used to generate a piece of DNA that was then sequenced for both A/WySn and AXB-4. The sequences were compared visually to the published sequence (Genbank # AL596383) for alterations at the normal (N) intron 4/exon 5 splice site and possible alternative (A) splice site. Examination of the sequences showed one difference between A/WySn and AXB-4 at each splice site. One variant was found 22bp upstream from the normal (N) intron 4/exon 5 splice junction consensus sequence. AXB-4 and the published database (sequence from C57BL/6J) have two "G"s whereas A/WySn has only one "G" (Figure 3.13). At the putative alternative (A) splice site a substitution of a "G" for a "C" is seen in A/WySn 12bp downstream from the splice site consensus sequence (Figure 3.14). These variants were seen in the sequence from both forward and reverse primers (CRSP1 F/R for the normal splice site, CRSP2 F/R for the alternative splice site). To determine whether these sequence changes are polymorphic variants or could be the mutation contributing to risk of cleft lip in the "A" strain other strains were examined. Primers were designed to amplify a product from AXB-4-type sequence only (CRMIS1 F/R) or a product from A/WySn-type sequence only (CRMIS3 F/R) for the variant at the normal intron 4/exon 5 splice site. In addition, primers were designed to amplify a product from AXB-4-type sequence only (CRSNP1 F/CRSNP3 R) or a product from A/WySn-type sequence only (CRSNP2 F/CRSP1 R) for the variant at the alternative splice site. Several strains were tested with these primers, which are comparable to "allele-specific primers", and four were like A/WySn and three were like AXB-4 and C57BL/6J for both variants (Table 3.5). In addition, the inbred strains CBA/J and BALB/c were sequenced using the primer pairs CRSP1 F/R and CRSP2 F/R. The sequence for CBA/J was the same as that for A/WySn, and the sequence of BALB/c was the same as that for AXB-4, which confirmed the results of PCR (Appendix E). In summary, the data suggest that polymorphic sequence variants may lead to alternative splicing between exons 4 and 5 in testis mRNA in strains like A/WySn. The question arises whether the putative alternatively spliced fragment is also produced in embryos during lip development. 71 < u o < o < < o < u H u u o u H H U H CJ H U u U • o H u H U u < u H u o o < o o < V o H o H u Ol U o H o o < < CN PQ X < < u H U u o H u H H U H U H U u u o H U H U U <: u H U o o < o o < u o H o H u o o u o H o • O < o < cu o -fl m <u -rt fe* fi 12 8 x -CU CO O cd fi £ >-i (U CU o Nrtcu c cu fl ~ cr fl <° cu cu fl xl cr f-i cu ^ CO cu rt - r t A3 cu 13 x g x A H " f l . •—< CU u ea CU T ) fl fl CT 1 ^ 8 « CO cu CJ 1.S fi T=; GO * s o o X fl § g CU fl rt « ° xl X T3 ^ 53 fi a fi > cu o o c2 CU o C cu fl cr cu CO CO fl CO fl CU CO fl O o fl" cu -fl o Pi fe fe CO rt o CO l-l cu a f**1 fe^ »—( ^3 . CU C O fl cu fl >i fe fi £ do 13 fe fl -fl <2 I w A -A 3 § CU OH fl < CU fl fl - f i cr1 fl cu 2 CO !> fl°^ fl CO CH " * fl1 co fl CJ O .-s cj co < < u o < u H OI U u u u H < < H cr o <: o H H o H O H U H U o H o u H " < H <3 H U u <: u ca < < u u o u H U l u u u u E—' < < u < H H O" O < o H H O H O H U H U O H < O H U -H < < H U U < o CD u£ -fl T3 O CD .fl "ca ca o 8 • s ca •' ca CD M g g •-fl ca 2 * to T3 fl CD CD co CD CD co pq >< c CD OH |3 .g 3 a g o -fl CD AH g fl CD CD +-> co ca .2 6 g £ 2 rt g 2 60 rg 0 ^ —H CD CD - f l ?S ^- V 1 U x & <£ CD ca -»-» /-v fl CD O-i A 2 >r OD H co o <+H • -— CO CD O CM CO 3 2 e . CD co fl CD A * fl CD 60 "2 c fl ca CD o fl CD fl cr -CD CO " X3 M0 O C ca OH g o CD X> • f l CD fl '3 -M o co CD CD fl CD CD ^ fe CN CM CO CD CD Cl CD fl cr CD CO co fl CO fl CD CO fl O CD g CD CD l-l - O Table 3.5: Test of polymorphism of the Crhr splice site variants found in A/WySn mice. Summary of the results of PCR amplification using primers specific for the variant at the intron 4/exon 5 splice junction and the variant at the putative alternative splice junction. Primers were designed to amplify either only A/WySn-type sequence (CRMIS3 F/R, CRSNP2 F/CRSP1 R) or only C57BL/6J-type sequence (CRMIS1 F/R, CRSNP1 F/CRSNP3 R) for each variant. Strains like A/WySn (for both variants) Strains like C57BL/6J (tor both variants^ ) SWR/J . ^ / 129/J PL/J C3H CBA/J BALB/c • swv AXB-4 74 The primer pair (Crhr pl7/pl6), which amplified the putative alternatively spliced product from A/WySn testis cDNA, was used on cDNA from day 10 - day 11 embryo heads to check for presence of the fragment. However, no alternatively spliced product was seen in A/WySn in two samples from each of three separate pools of cDNA (Figure 3.15). To look at whether the candidate genes are expressed at the time and place of lip formation, expression of candidate genes was examined in cDNA from RNA extracted from the heads of day 10 - day 11 embryos from each of A/WySn and AXB-4. The genes were in the candidate interval based on previous mapping studies done in our lab, placement on BACs containing genes previously mapped by our lab, or placement in the candidate interval in the public databases (Table 3.6). All nine known genes (Crhr, Arf2, Itgb3, Myla, Nsf, Wnt3, Wntl5, Gosr2 and Mapt) and one predicted gene (KJAA1267) in the candidate interval were examined. Expression of all nine known genes was detected equally between A/WySn and AXB-4 in the embryonic cDNA, whereas expression of the one predicted gene was not detected in either strain (Figure 3.16). Expression of all genes was seen in adult testis using the same primers (Figure 3.16). As mentioned above, expression of one predicted gene (KIAA1267) was examined in embryo heads of the appropriate age. From the public database (UCSC), there are 28 genes predicted by the Ensembl program and 36 genes predicted by the Fgenesh++ program in the candidate interval. Often some of the known genes are also listed as "predicted genes" by these programs, so the actual number of putative genes predicted by these programs is slightly smaller. The proposed mRNA sequence of predicted genes from the Ensembl and Fgenesh++ gene prediction programs and the sequence of mRNAs from the public database that map to the DNA sequence (excluding known and predicted genes already examined) in the candidate interval were put through a modified BLAST search which limited the searchable database to ESTs from Day 9 to Day 11 mouse embryos (Tables 3.7-3.9). Most of the predicted genes were not found in the modified BLAST database (for day 9 to day 11 embryos), but do match to ESTs/cDNAs that are expressed in adult tissue. 75 NO CN hJ NW O P" £ 2 « ! Table 3.6: cDNA expression in Day 10 A/WySn and AXB-4 embryo headsa,b for clfl candidate genes. Candidate genes mapped by our lab to the clfl interval: Crhr Itgb3 Myla Nsf Wnt3 Mapt Candidate genes on BACs that contain genes mapped by our lab to the clfl interval: KIAA1267 Candidate genes placed in the interval by Ensembl/UCSC: Gosr2 Writ 15 Ar/2 Expression in A/WySnc V V V X V a: all genes also expressed in adult testis b: no differences between strains were seen c: X = not expressed, V = expressed Expression in AXB-4C V V V V x V 77 00 CD Xl 4-» * 1—( T 3 CJ b u •f l " O tu fl £ fl 2 s t l fl fl o tfl rt ^ fl fl co cd CJ X fl CU CJ b u CO <+H fl o fl, fi rt O A H • S CJ CO Q CO 5 ~ s fe fl CJ > .a J fl 0 0 o CJ w g fl b u 5 7 3 • O CJ —j £ ^ ° c3 <d g CJ .fl OT « • X <rt fl o O cd CL, rt 5? fi P 3 cu C H fl O fl <U . -rt T3 a fl ° ' <u fl fi fi fl CO cu cu rt - r t § .2 . . b u — 1 t~- „ (D ^ fl ^ CJ fl CO —i CU CJ X co rt cd C 5 fe PQ b u JS T 3 .2-9 I CO •!-! CJ . J rt H fe § CO 1 «s w co W £ H o-co X Ed fl 7 3 cu X! CJ es S CJ •» j» « c .S'fl fe fl « x § fl fl CJ CO 3 O es Q fe w CO fl o X cj Mrt o % 4) s — fi g g M C5 ej "O CJ CO CJ a a tl B ^ 2 " S. o z o X fi cu cu 1—< o 1 o o OS o z cd cd cu fl S § 8 : 2 l l . f i fi Ico* g jy O C L CL, 'cu - r t o l-l C H b u fl • i-H -fl fl CJ CL, CO o x CN so uo CN fe CO PQ CJ CO fl O CN CN CN G _o co cu X • f l cd Cl o N 0 s -o o < z Q o g fi fl Os O Q CJ CJ fl cc cd CJ cd uo o Z A i-H cd I-I X rt s • f l N= o x O O fe ^ u c^oo 2 a - P x co" t i X ~ u fi S J> OQ > >H fl cu CJ fl cu bo cu > td •3 C H Crt O " f l 2 -c .a fi c c> rt S o u *e tN a t> fe s © fi cd td fln OT IK -g g fi 13 C rt u ° fl Q Q o CU CO 3 o CN oo o cu c -fl fl • f l < N f 0 s -< z Q o CU co fl o C O oo C3 CD fl-cc! O CD CD -O -fl CD -fl CD l-i OH CO CD C CD 00 M-H o c o • t-l CO co CD ^ X CD fl O -o & CD c2 -A O % CD ' CO M-1 O S I-. 00 o t-l OH fl o • —H H-> CD -fl CD fl CO CD M <H o fl S CM fl CD CO 00 ? S ^ co r - fl CD CD -fl -O H -O XS T3 +* .2 H CD i : '9 I WD P CO «< « fl £ T3 C O M ? flH co 3^ Q n-co X Ed T J cu J3 fl a* .13 e u >- fl w g 5 c S'o X W fl « o R •8 •= bf l CO ^ o E a<Z CS Q fl O x H-H o c — = 13 S __ fl CD T J CJ c « CD c a t> Q CD CD CO fl O O Z CN fl H-» CD PH CN oo OS O O CN < Z Q o C fl S 3 2 oo os in m CN o z =3 CN 8 -2 £ ° A A fl _o fl 'to • fl * — 1 CO .> -fl oN O O os < z Q o CD CO fl O 00 SO CN CN O CD I a co "r; J3 o fl -fl Os in m oo 00 in >n o ON OS 00 •9 .3 fl CD B o ^ o, O ^ o fl TJ < NT o o < z Q o CD CO 3 O Os CN CN O Z g I—i +-» -fl i so •<tf- 0s-m o < Z Q m oo o Os •"ct-OS CD -fl •*-> M-H O c o •§ fl o o - O -fl CD o I c o • f l CD t-i OH c fl o co C CD o CN CD a CD o fl -fl CO CO t-i CD c> CO o 2 e3 fl -ti CD fl 00 -fl O CO -5 W S fl s < o o g l-H O O CD • f l H-> •^  o O f-i r-fl CD O fa +-' CH co CD C fl O CD CO DO'C |— fl - O OH 'B S CD O co o w ^ i 2 w fl H o fl CD O 0O H CO < - 1 03 TJ cu « T3 O s © « TJ C « IS c to o s la C o IS C cu 1X3 c j u o CO fl o CD I-i O H V O CO *o co CD T J +-» O H CD OH -f l CD l—I P H fl CD o IH OH "fl CD %-» CD -fl H—» o OH >, K CO OH fl T J UO CO V O o o >, uo H-» CO *+-» V O iden 450-fl" CD \ ° O H a X> bO l/o ) . f l O N I 1 O H-» oo +-» <+H fl O - O CO H-» o" -fl - O CO CD s CD a A CN C O .fl '53 H-» O In OH " f l a O co O - O —H |H O 6 C O co o CN o o NO 'co o CN O o p loo CO o CN o ON co O CN O o p c fl a 00 o "o a o -fl o z o o z o fl CD T J c <D OH CD T J CO »/o OH | * Ct-H IH o Jg O CN s o CD fl T J T J C fl CJ 'S i '.a '53 o >H OH CN CO no < < I—I i i '53 H-> o I/O co oo o < < o >, o fl o ,'co / I T J flfl 2 CD r f l . =% R .a CN <L> CJ "5 u 1 .A '53 o o CN O o CJ CO o CN o o P P O N o CN O o CJ P CN l/O o CN o o CJ uo o O P VO k/o !o CN O o p I/O o CN o [ O CJ cu -fl O cd fl • rH fl O co CO cu rt CU X CU o Fl eg •fl CU +-» CO cu bu O rt C H fl O " r t CD 12 rv ccj ^ CU CU X fi « cu O bu + + X CO CU C cu bu fe cu XI X o Crt W -fl fl fl CO CO cu O g & bO X -fl 6 cu cu o cu .rt CO • f l fl cu o fe fi H-H _ o _ fl ON PQ rt a cu CO fl X ca fi fl CO c o CU oo ca •fl fe CO < fe H PQ x H CO <n fe n T3 CD is O co fl eS o es *- rt rt es -rt fl es cu •FN fl CO E3 o © fi o w c 3 rt o t. fe 3t c © rt es u C3 rt rt fl V TS o fl cu •fl cu o _ O S b •fi & C H O co X 2 fe -fl 22 fe 2 ° -5 ca °* • rt CO fl CU Q U cn o CN O o U fl xl P H O CO O CJ CJ CD fl 1 3 O CU ' fl CD bu ON cn oo <N o c j rt CU rt co ca bu O VO O CN O o CJ U CJ CD rt o rt fe ca CD rt CD O c j rt C H fe rc £ PQ co o fl pq fe -rt rt bu rt fe .S p bu g 3 CD £ CO CO ? fl ca o §3.3 A cd o O X3 rt -5 8 fl a fl § CL, CD bu CU finiS fl CD © a s 8 - . 3 2 ca <o x i s a l A rt s BZ 2 2^ - f l - A fe § a ^ H " X co < CO ca CO CD CO OH O 2 x co CD ^ 3  DCO rt rt 4> -fi <B bu ca 'C Crt ^ O fl co O CD \ f l 2 « fi XI eu 1 3 rt CD CO CD •fl Cl .rt CU CD bu ca ^ 0 o .3 -fl 1 * ca o 1 3 >-' cu -fl • r t O •fl o CD CU t-i CO fe CO co cl § S + + XI CO CU C CD bu fe ca CN . cn '-fl ' cl ca n fl a-a ca CD CO 00 IV. Discussion As a starting point in the search for the clfl mutation, expression of candidate genes was observed by RT-PCR using gene-specific primers first for adult testis tissue and then for embryonic tissue from the appropriate place and time, the day 10 - day 11 head. Although there are some published data regarding expression of some of the candidate genes during development, whether or not they were expressed at the correct place and time to have a role in development of the lip was unknown. As testis tissue is much more readily obtained than day 10-day 11 AAVySn embryos, the first studies based on RT-PCR were done using testis. An interesting result was seen in the initial data collected from adult testis tissue. In A/WySn, part of the gene Crhr (exons 1-5), when amplified from cDNA, gave a product with consistently lower intensity than that seen in the control strain (AXB-4/Pgn). Also, with another pair of primers for the same region, an additional larger product (800bp) was seen for A/WySn. The intensity difference was verified by duplex PCR and other regions of the gene did not differ in intensity between strains when amplified. The additional larger product when sequenced, gave the intriguing result that the sequence from forward and reverse primers was not complementary. One possible explanation is that perhaps two fragments of nearly identical size were amplified by this particular pair of primers and one was sequenced more easily with the forward primer and one by the reverse primer. Indeed the sequence generated does have the appearance that a mixture of two fragments is being sequenced. Although perhaps not a common occurrence, it is possible given that the resolution of the gel makes distinguishing larger fragments that are close in size difficult, and that the sequence of the two fragments locates them to paralogous regions of chromosome 11 containing the genes Arfl (ADP-ribosylation factor 1) and Wnt3a (Wingless-related MMTV integration site 3A) at approximately 33 cM and Arfl and Wnt3 in the clfl candidate interval at approximately 63 cM. It is possible then that the primer pair was able to amplify a product from both areas because they contain regions of sequence homology. Cloning of the PCR products, looking at the sizes of the clones obtained and sequencing them would be one way to investigate this possibility further. 84 The sequence generated from the reverse primer, Crhr pi6, maps to the expected region in the gene Crhr, thus I will discuss it further here. Taking the sequence generated by the reverse primer to be representative of a true product produced in the tissue, it appears that in addition to the normal one, there is an alternative splicing of the transcript. This new transcript, if translated, would lead to a truncated protein that contains the hormone receptor, but lacks the transmembrane receptor contained in the full protein (Figure 3.17). Several alternative transcripts have been identified from the Crhr gene in human and mouse (Pisarchik and Slominski, 2001), including a human transcript containing a cryptic exon inserted between exons 4 and 5, which would result in a truncated protein if translated. No mouse transcript containing a cryptic exon is known. The presence of this alternative transcript could explain the difference in intensity of the normal product seen between A/WySn and the control strain. If we assume that the full transcript and the transcript containing the cryptic exon are made in equal amounts, then there would be two choices for the primer pairs to anneal to during PCR. For the majority of the gene the two transcripts are identical, so no difference in intensity is seen here; however for the primers that span the cryptic exon, the two choices produce differently sized products resulting in a reduction of the PCR product of expected size and the generation of a larger product. In addition, since the inclusion of the cryptic exon would lead to a premature termination codon, which usually leads to an unstable mRNA product, the transcript may be recognized by the cell and degraded via the nonsense-mediated mRNA decay pathway resulting in the low amount of the larger sized fragment seen (Strachan and Read, 1999). Interestingly, a mouse knockout of Crhr, while having no cleft lip, has behavioural characteristics, which include increased exploratory, behaviour and reduced anxiety-related behaviour, that are opposite to the behavior seen in A/WySn (Juriloff, personal communication; Festing, 1998; Timpl etal., 1998). In the process of analyzing the extra 800bp fragment, two variants between A/WySn and C57BL/6J were found in Crhr intronic sequence. After investigation of several other strains, none of which have cleft lip, it appears that both of these variants are polymorphic. Given the polymorphic nature of the variants and the presence of cleft lip 85 o o -o c n o o c n o i n (N O O CN O o o -o o +-> OH CD o S-H CD E co § H 7 O 00' o S O o o CN-o o -o 00 o o o J u o . in S11 _A 2 -2 I a " 3 "3 .S i 2 fl U c e3 g s 5 o fl w •S 59 ° s rt • rt .rt J^ — . f l tu e fl w liability only in A/WySn, it is unlikely that either of these variants is the clfl causal mutation. It is unclear whether or not these polymorphisms are enabling the alternatively spliced transcript with the cryptic exon to be formed. Although both are near the splice junctions in question, neither is actually within the consensus splice sequence, so whether the variants play a role in presenting an alternative splice junction to the splicing machinery is unknown. In addition, whether this alternative transcript is present or absent in the other strains containing the same variants as A/WySn is also unknown. The absence of expression of the 800bp alternative fragment in the day 10-day 11 embryo heads supports the conclusion that this fragment does not play a role in the development of cleft lip. If this fragment were involved in the development of the defect, we would expect to see it expressed at the time of lip formation. Although the results produced from looking at the expression of candidate genes in adult tissue provided some interesting avenues to explore, the primary question that needed to be answered was whether or not these genes are expressed during the development of the lip. To begin to answer this question using day 10 - day 11 embryo heads, expression data from RT-PCR was obtained for all of the known candidate genes and one predicted gene in the interval. Intriguingly, all of the nine known candidate genes are expressed in the head during the development of the lip. Although this does not narrow down the list of potential candidate genes, it illustrates the complexity of the developmental processes going on at this time in development and the multiple genes needed to accomplish the specific developmental tasks. Furthermore, for the portions of the cDNA used to detect each transcript, both strains (A/WySn and AXB-4) produced products and the products were the same size. These results illustrate that A/WySn does not lack the presence of a transcript for any candidate gene (i.e. deletion of a gene), and does not have a large deletion within the portions of the genes amplified. The one hypothetical gene (KIAA1267) examined for expression in the developing head is not expressed in day 10 - day 11 embryo heads, although it is expressed in adult testis tissue. KIAA1267 was chosen based on its presence on a BAC containing the genes Crhr 87 and Mapt (Poorkaj et al., 2001), which places it in the candidate interval. In addition, since KIAA1267 appears to be directly 3' to Crhr, and a variant had been found in Crhr, we wanted to examine whether surrounding genes were also affected by any potential mutations. A potential future direction is to look at the other predicted genes in the interval. From the public database (UCSC), there are 28 (Ensembl) to 36 (Fgenesh++) additional predicted genes in the interval. In an attempt to try and subdivide this list, the EST database for this time in development was searched for expression of the various predicted genes. Unfortunately, the EST databases are incomplete for day 10 - day 11 embryos, and so the results of the search did little to subdivide the candidates. As the EST database becomes more complete and more tissue specific in the future it will provide a valuable resource as a preliminary source of information on the expression of various predicted genes and present a way to sort among potential candidate genes. As a preliminary step, looking at whether the candidate genes are expressed at the correct time and in the correct place is very important. However, in the future a more precise view of the expression patterns of the various genes may be desired. In this study, the exact location of gene expression could not be determined. If a candidate gene is expressed in the developing maxillary prominences that will eventually form part of the upper lip at the correct time in development, this would provide more support that this gene has a role in the etiology of cleft lip. This detailed view of expression could be obtained from in situ hybridization studies of control strain embryos during fusion of the lip. These studies would be needed as supporting evidence to any potential candidate gene. In summary, all 9 known genes in the clfl candidate interval are expressed in the appropriate tissue for involvement in lip development, the day 10 - day 11 head. No differences between A/WySn and the control strain (AXB-4/Pgn) were found in the cDNA from each candidate gene, suggesting that clfl is not a failure of transcription of any of these 9 genes (Arf2, Crhr, Gosr2, Itgb3, Mapt, Myla, Nsf, Wnt3, and WntlS). 88 Two polymorphic sequence variants were found in the fourth intron of the Crhr gene, but they do not appear to cause cleft lip liability as they are also found in several normal strains that do not have cleft lip. The sequence variants are near an alternative splice site and the normal intron 4/exon 5 splice site. The alternative splice site is expressed in A/WySn testis, but not in the embryonic head, and therefore seems unlikely to be the mutation in clfl. 89 Chapter III, section iii: Haplotype analysis of the clfl candidate interval for 37 inbred strains I. Introduction Many inbred strains share a common origin (Figure 3.18). During the origin of the different strains, many chromosomal segments were inherited by descent from the founder population. This has led to the presence of segments of chromosomes that are identical by descent across several strains. Observation of the product sizes for the panel of strains used to define the various SSLP Mit markers (M.G.I.) suggested that the "A" strain often has an allele unlike those found in other strains, suggesting a unique haplotype around clfl (D. Juriloff, personal communication). In addition, a complex sequence change in the 3'UTR of the gene Crhr was discovered between A/WySn and C57BL/6J (Juriloff et al., 2001a) and it was unknown whether this was a polymorphism or possibly the clfl mutation. A haplotype that is present in several strains in addition to the 'A' strains would raise the question whether the clfl mutation occurred in the progenitors of the "A" strain only or whether other strains have the haplotype and the clfl mutation but do not have cleft lip due to the lack of additional necessary genetic factors. Also, if the A/WySn haplotype is not unique and other strains do not have a cleft lip liability allele at clfl, then any gene alterations found in the "A" strain with another strain can be compared with the same haplotype to identify whether the alteration is the mutation. II. Materials and Methods Inbred strains used for haplotype analysis Banked DNA in our lab extracted by a phenol:chloroform method (Sambrook et al., 1989) was used for the following strains: A/WySn, AXB-23/Pgn, CBA/J, CT, LM/Bc, SWV/Bc, LGG/Bc, SELH/Bc, BALB/cBc, ICR/Be, LST/Bc, WB/ReJ, C3H/HeHaJ, C57BL/10SnJ, GP/Bc, AXB-4/Pgn, and C57BL/6J. DNA was obtained from the Jackson 90 5 PQ t oo <fl ON t o rt cu T3 ON ON 4 PQ U o o rt> 4 c o ' 3 to a o Lj CN fl ON c/j i— i 4 PQ 3 ON cu rt-, r—i -fl • f l CU -o < u • f l ci C CO tu tu £ rt cu CH CO a o t =5 CN C ON C/J *—H • fl fe o •rn CU fe .2? oi) fe fl CU cu CO o -fl co CO fl CU O O fl <N ^ < =H ON 4 CU rt-1 t CU • i-H CU fi (fl U • 1—< H-l t a o CO O .S M a 8 bfl fe| ffl ^ 4 . ° -i •— ca flj CU O Q CO Crt .s ° 'fl CO * - l fl rt . ' OT bu rt ° .S — 13 5 > rt 8 o Crt fe o * co 'C ON o ~ . . bu oo _fl cu fe bp 0 fe fl Laboratory for the following strains: A/J, A/HeJ, NZB/B1NJ, NOD/LtJ, BALB/cJ, FVB/NJ, SJL/J, AKR/J, NZW/LacJ, RF/J, PL/J, SWR/J, DBA/2J, 129XI/SvJ, 129/RrRk, 129/J, LP/J, P/J, LT/ChRe, C58/J, and C57BL/10J. Construction of haplotype PCR was done according to the protocol described in Chapter II. Alleles were categorized as "like A/WySn" ("A"), "like C57BL/6J" ("B") or like neither ("C"; "D"). To facilitate this, "pseudo-Fi" samples were created from a 1:1 mix of DNA from the reference strain and the unknown strain. DNA samples from the various strains were run in the following order: Strain-X DNA, Strain-X DNA + A/WySn-DNA, Strain-X DNA + C57BL/6J DNA in order to have a definite pattern of alleles for each sample. PCR conditions for primers DllRep332, Dlx3 I/J, Wnt3 L/M, Mapt E/F, Crhr A/B, DllMitlO, Itgb3 A/B, Ns/A/B, and D11MU58 are listed in Table 3.1. PCR conditions for Wntl5 are as follows: Tanneai=55 °C; [MgCl2]=1.5 mM; Allele sizes=170bp, 180bp. III. Results The haplotypes for various polymorphic markers from within the clfl candidate interval were typed (Figures 3.19-3.21). Seven markers within the candidate interval (Dlx3, Wnt3, Mapt, Crhr, DllMitlO, Itgb3, and Nsf) and two markers outside the candidate interval (DllRep332 and D11MU58) were typed on seventeen inbred strains of mice (Figure 3.19). The majority of the strains tested have haplotypes consisting of a mixture of A/WySn-like, C57BL/6J-like and other alleles. Within the candidate interval (Wnt3-D11MU58), three strains (AXB-23, CBA, and CT ) share the same haplotype as A/WySn. The polymorphic marker for the gene Wntl5 was typed on the same seventeen strains as above; however, in this case A/WySn and C57BL/6J have the same sized allele (Figure 3.20). The addition of this data to the data in Figure 3.19, does not remove any of the 92 no !• IT) o x 1 — 1 s n 00 o 3 • CQ 1 1 IT) CJ m U pq H on -1 • • • OQ < CQ i n 00 i n n • • n n • n n n n n • • m m i s m n n n n n n n n n n n n n n n n n n n n n n n • n n n • n n n n • • n n n • n n n n • n n n n • 3 os CD -fl c CD 3 "S s o M - 1 fl CD i~ —. CD fl CD fc •2 fl -fl fl CD CD SO CQ r -i n U -fl C 00 CD "CD "fl U • H -+-» * i T3 -fl Oi ^ fl •fl ca CD ° O fl! i> T ; 2 rt> r-| .•*-! Cd oo -M * 5 CO fl ^ U fl "* ^ r } • M co T 1 >o CQ in U ' t I CQ x — < PH O W tza £9 a. m CQ " f l fl 0J ox <u MH ti "A • -H "3 II II • s E • o a it 1 "o o fl .fl OH ( J 1) •B u fl 0> 2 « ° fl -o £ H PH i u PH C+H o CO fl • f l ( H -M CO -fl CJ 1H JO c fl CO P4 ~ .. fl O o CN i<-> CJ JC 00 ( H E <2 ro CN CN CN • • 2 D oo MD uo CN fo • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 6 <2> *~H "£> "3. T J C Oi} CO —H" "cu 13 C O —3 13 OQ OQ T J fl A T J < < C J CD I ^ CJ M cs CU B o cu * A* cu t H f u }*-> M-H C oo r *-fl 3-• J ^ OQ co m U a o C4—I C U t - l C M C U 13 CJ Q • H 51 CN PQ > fl PH OO / -«. 2 § cu ^ fl cu cu xi 00 CO fl fl • M CO co t—i t - i C U E t - l T J fl a a •§ -a - A CO PH CN % c2 I C M CO " f l &cB PH O o _ - s .a ^ CQ t-l XI MD ° * ro ^ CN ro CN g *• / v \ \ M ! ' t-l rt CQ . PH ^ CN ^ O CU fl o T J CJ PH m j CQ - N 5 £ ^ PH ro g cu fl PH CM cu T J C U M ffi fl o ro >—1 t—i -r ^ ^ fl S£ <N tr1 s> cu f5- 25 3 N 2 g 0 - H M J 1 |-f c? • n CN ( N K < t -T W CQ EH < Q * ^ ^ ON ON M7 ~ S3 ^ J ^ PH | J E> o2 i J ^ f> oo )T> oo oo - H CJ i n ON strains that share a common haplotype with A/WySn, as the three strains mentioned above also have the same allele as A/WySn for this marker. Six of the markers within the candidate interval that were used above were typed on an additional twenty strains of inbred mice (Figure 3.21). Once again, the majority of the haplotypes consist of a mixture of A/WySn-like alleles, C57BL/6J-like alleles, and alternative alleles. In this group, two strains have haplotypes identical to that of A/WySn: A/J and A/HeJ. IV. Discussion For this study, a haplotype analysis was performed on thirty-seven inbred strains to determine whether the "A" strains have a unique haplotype of polymorphic markers in the clfl region. The data shows that the "A" strains share their haplotype with the strains CBA/J and CT. These two strains can be considered as "CBA", since the CT strain was created by backcrossing the ct gene to CBA mice (Festing, 1998). This finding provides an interesting way to test any alterations subsequently found in clfl candidate genes in the "A" strains. CBA/J and CT are developmentally well-studied (van Straaten and Copp, 2001) and are not known to have any liability for cleft lip. Further crosses to test the possibility that the lack of cleft lip in CBA/J is due to a lack of the Clfl factor, and that clfl is present and expressed when Clfl is introduced are necessary. If crosses with A/WySn females do not produce cleft lip, then one can conclude that CBA/J and the "A" strains share a common haplotype by descent (see Figure 3.18) and that the clfl mutation arose in the progenitor to the "A" strain only. Any future alterations found in A/WySn would then be looked for in CBA/J to see if the alteration is present in the inherited haplotype, or is a mutation present only in the "A" strain. Given this, any alteration found in the clfl candidate interval in the "A" strain and not in CBA/J is a good candidate to be the clfl causal mutation. Thus, the haplotype analysis has likely provided an avenue for testing any variants found in the future. 96 Chapter IV: Investigation of a possible third locus for risk of cleft lip in A/WySn on chromosome 7. Introduction The background to the question addressed in this chapter is based on previous work by Juriloff, most recently reported in Juriloff et al. (2001a) as follows. The frequency of cleft lip in A/WySn is 20%. By the two-locus epistatic model discussed in Chapter I, we expect the frequency of cleft lip in a BCi to be 5% (!4). In the BCi after a cross between A/WySn and C57BL/6J strains (discussed in Chapter III, section i), 2.5% cleft lip was observed, suggesting the segregation of a third risk locus. A genome screen of these BCi cleft lip embryos showed a trend towards association with cleft lip at three chromosomal regions in addition to the regions containing clfl on chromosome 11 and Clfl on chromosome 13. The three regions were chromosome 7 marked by D7Mitl58 at 23 cM (MGI), proximal chromosome 11 marked by D11MU2 at 2.4 cM (MGI), and chromosome 18 marked by D18MU4 at 57 cM (MGI). However, none of these associations reached significance (p>0.05) (Juriloff et al., 2001a). It was possible that if more cleft lip embryos or more markers were examined surrounding these markers, a region would be found where the association was significant. Furthermore, the two RI strains with cleft lip (BXA-8/Pgn and AXB-6/Pgn) contain the "A" stain genotype at D7MU158, consistent with the possibility of a cleft lip locus near this marker (Juriloff et al., 2001a). In addition, chromosome 7 contains the gene Pvrl2 (poliovirus-receptor related 2) at 9.0 cM (M.G.I.), which is of particular interest due to its similarity to the gene PVRL1, which is responsible for autosomal recessive CL/P-ectodermal dysplasia syndrome as discussed in Chapter I (Suzuki et al., 2000). One or more of these three regions on chromosome 7, chromosome 11, or chromosome 18 that might be involved in additional risk of cleft lip could be studied using the cleft lip segregants from a cross of A/WySn to AXB-4/Pgn strain if this strain has the C57BL/6J 97 genotype in the candidate regions. The purpose of the present study was to determine the genotype of the AXB-4 strain (A or B) in the known and putative cleft lip risk regions in the genome and then use a BCi panel of cleft lip embryos from the cross of AXB-4 with A/WySn to test for evidence of a possible third locus involved in the risk of cleft lip at the candidate regions on whichever of chromosome 7, proximal chromosome 11 and distal chromosome 18 were informative in the A/WySn by AXB-4/Pgn cross. II. Materials and Methods Aspects of the Materials and Methods are described in Chapter II and Chapter III. Materials and Methods specific to this experiment are described below. Haplotype Analysis Strain distribution patterns (SDP) for recombinant inbred strains, which are homozygous at all loci, indicate the origin of a chromosomal segment based on the results of typing various polymorphic markers. For AXB recombinant inbred strains the SDP will indicate whether the chromosomal segment originated from A/J or C57BL/6J by listing an 'A' or 'B' allele in the haplotype for that chromosome. The SDP for AXB-4 mice on chromosomes 7, 11, 13, and 18 were obtained from Mouse Genome Informatics (MGI). For the SDPs examined, the markers are fairly dense (1-3 markers/cM); however there are regions were the density of markers is low with no markers for 5-10 cM. To confirm the patterns indicated on the SDP, key markers were tested on each chromosome (Conditions for primers used are listed in Table 4.1). Chromosomal regions were chosen based on statistical trends shown previously (Juriloff et al, 2001a) with the objective to have a detailed view of the AXB-4/Pgn haplotype in order to include in the analysis any of the putative cleft lip liability regions that are segregating in the backcross. BCi panel of cleft lip embryos Markers on chromosome 7 were chosen that were close to the gene Pvrl2 and would be 98 Table 4.1: PCR conditions and estimated product sizes (to the nearest 5bp) of informative markers used in AXB-4/Pgn haplotype analysis and on BCi cleft lip panel. Primer sequences for newly designed primers are given on pgs. 36-37 of General Materials and Methods. Marker Tanneal [MgC12] Allele size (bp) (°C) (mM) AAVySn C57BL/6J DU Mitl 99 F/R 55 1.5 105 120 DllMit360F/R 55 1.5 115 120 Dll Mitl 26 F/R 55 3.5 190 185 Crhr A/B 55 1.5 320 300 Dll Mitl 0 F/R 55 1.5 115 80 D11MU58F/R 55 1.5 230 240 Itgb3 A/B 55 1.5 300 350 DllMitl66 F/R 55 1.5 140 145 D11MU258F/R 55 1.5 165 . 130 D13MU122 F/R 55 1.5 170 155 D13MU253 F/R 55 1.5 100 75 Itga2 E/F* 55 1.5 120 150 Lect2 A/B* 55 1.5 105 90 Gprk6 C/D* 55 1.5 110 120 Msx2PC/PD* 55 1.5 110 105 Pvr3 FE/RF*f 55 1.5 140 130 D7MU77 F/R* 55 1.5 140 150 D7Mitl 5 5 F/R 55 1.5 165 150 D7MU25 F/R* 60 2.5 100 115 CcnelF/R* Hot start 55 1.5 105 120 D7MU309 F/R 55 1.5 130 170 D7MU145F/R* 55 1.5 160 200 D18MU4 F/R 55 1.5 105 110 D18MU188F/R* 55 1.5 120 100 D11MU74F/R 55 1.5 220 205 DllMcgl F/R 55 1.5 300 290 Dll Mitl 06 F/R 55 1.5 105 120 DllDall F/R 55 1.5 300 310 D11MU71 F/R 55 1.5 200 205 D11MU62F/R 55 1.5 160 150 D11MU226F/R 55 1.5 120 140 D11MU78F/R 55 1.5 80 110 D11MU2 F/R Hot start 55 1.5 105 120 * PCR for these markers done while I was a laboratory technician f Amplifies a region near the gene Pvrl2. 99 informative in the backcross. III. Results The MGI SDP indicates that AXB-4/Pgn has A/J alleles through the segment containing Clfl on chromosome 13, C57BL/6J alleles through the segment containing clfl on chromosome 11, A/J alleles on chromosome 18 in the area of interest, and a mixture of A/J and C57BL/6J chromosomal fragments on chromosome 7 in the area of interest (Figures 4.1-4.4). Also, the MGI SDP indicates that proximal chromosome 11 may have C57BL/6J alleles (Figure 4.5). The results of typing key markers on AXB-4/Pgn in the regions of interest are shown in Figures 4.1-4.5. In general the results are consistent with the data obtained from the MGI SDP with the exception of proximal chromosome 11. Although many closely spaced markers were used, no evidence of alleles from C57BL/6J was found at this location in the AXB-4/Pgn strain. Haplotype analysis for the regions of interest for the cleft lip liability genes indicated that for this backcross from the original cross of A/WySn to AXB-4/Pgn, only mid-distal chromosome 11 (clfl) and the regions on chromosome 7 from Gpil to D7MU155, and D7MU310 to D7MU37 contain "B" alleles and therefore the segregation pattern of the alleles can be observed (Figure 4.3). One SSLP marker in the more proximal region of chromosome 7 (D7MU155) and two markers in the more distal region of chromosome 7 (D7MU145 and D7MU158) were tested, and all three markers showed random segregation in cleft lip embryos, with ratios at or very close to 1:1 (Table 4.2). IV. Discussion For the AXB-4/Pgn recombinant inbred strain, the origins of alleles from A/J ("A") or C57BL/6J ("B") on chromosome 11 (clfl region), chromosome 13 (Clfl region), 100 CD 1 O N < N rn Q c3 CD a o 6 P cn CN cn CD 3 cn +-» a CD + l — l a PQ PQ PQ PQ C N Q t n o o t n <+H O G o '•S o o l - l CD T3 CD G CD w G bu P-, l PQ X < cS O fi o M o "3 H—» CO • -H I -a ca O O CN ca G O co I-I CD M ca fi CD O <+H CD b CH O G O bfi fl G £ s -G ° t o o .I-I ca Q G CD O fl co <H cM (MGD) Marker 10 D13MU13 • 30 D13MU91 • 31 D13MU10 • 32 Msx2 • * 35 D13MU13 • 35 D13MU54 • 35 Gprk6 36 D13MU122 • * 36 D13MU282 • 36 D13MU283 • 37 D13MU253 37 D13MU209 • 37 D13MU66 • 37 D13MU7 • 37 Lect2 39 D13MU231 • 40 D13MU11 • 40 D13MU254 • 43 D13MU193 • 45 D13MM08 • 45 D13MU126 • 47 D13MU105 • 47 D13MU110 • 48 D13MU128 • 64 Itga2 • ** Clf2 candidate interval • AA (MGI) AA (MGI + current study) AA (current study) • BB (MGI) • ** BB (current study) Figure 4.2: Distribution pattern of markers on chromosome 13 for AXB-4 (gene order and location of Clf2 according to Juriloff et al, 2001a). 102 (MGD) M a r k e r 0.5 D 7Mitl 78 • 1.2 D7MU340 • 1.7 D7MU306 • 2.5 D7Mitl 90 • 9 Pvrl2* 9.4 D7MU77 • * 11 D7Mitl 17 • 11 D7MU267 • 11 Gpil • 15 D7Mitl 55 • * 16 D7MU25 • * 16 D7MU309 16 Ccnel • ** 18 D7MU310 • • AA (MGI) 20 Taml • • * AA (MGI + 23 D7Mitl 58 • ** current study) 26.4 D 7Mitl 45 • * • * * AA (current 37 D7MU30 • study) 39 Fes • • BB (MGI) 40 D7MU299 • • * BB (MGI + 44 D7MU31 • current study) 44 Tyr • • * * BB (current 46.5 D7MU301 • study) 49.8 D7MU37 • Figure 4.3: Distribution pattern of markers on chromosome 7 for AXB-4/Pgn. * Pvrl2 mapped between D7Mitl 90 and D7Mit77 by our lab in segregants. 103 cM (MGD) Marker 4 D18MU67 5 D18MU20 11 D18MU68 16 D18MU120 18 D18MU14 20 D18MU17 25 D18MU24 30 Csflr 31 Pdea 41 D18MU184 42 D18MU9 47 D18MU188 47 D18MU8 57 D18MU4 • AA (MGI) • * AA (MGI + i r k current study) H k k AA (current • study) Figure 4.4: Distribution pattern of markers on chromosome 18 for AXB-4/Pgn 104 cM GD) Marker 0 lapis 1-3 5 • 0 lapis 2-20 • 0 Iapls3-25 • 0 D11MU74 • * 0.25 DUMcgl 0.5 D11MU106 1 DllDall B** 1.1 DllMitH • ** 1.5 D11MU62 B** 1.55 D11MU226 B** 2 D11MU78 B** 2.4 D11MU2 Figure 4.5: Distribution pattern of markers AA (MGI + current study) AA (current study) • BB (MGI) proximal chromosome 11 for AXB-4/Pgn 105 Table 4.2: Genotypes of A.AXB-4 (BCQ cleft lip embryos on chromosome 7. SSLP marker Homozygous AA Heterozygous AB Ratio of (%) (%) homozygotes to heterozygotes (AA:AB) D7MU155 17* (53%) 15* (47%) 1.1:1 D7MU158 16* (50%) 16* (50%) 1:1 D7MU145 16* (50%) 16* (50%) 1:1 * 32 embryos (X101-X132) were typed for chromosome 7 markers. 106 chromosome 7, and chromosome 18 were confirmed to be as in the SDP (MGI) (Figures 4.1-4.4). The results for proximal chromosome 11 however, were partially contradictory to what was indicated by the SDP (Figure 4.5), in which AXB-4 is indicated to be C57BL/6J-type for a marker, lapis. lapis markers are derived from intracisternal A-particle proviral elements that are lymphocyte specific and are typed using Southern blots. There are a limited number of these proviruses in the mouse genome, and the distribution among different strains is polymorphic (Mietz and Kuff, 1992). Since I did not have the necessary probes to type the lapis markers, several closely spaced SSLP markers were used instead for proximal chromosome 11. The region containing C57BL/6J alleles may be small; however the SSLP markers were homozygous for A/J alleles throughout the region (Figure 4.5). When mapping with lapis, due to the large number of restriction fragments seen in the two inbred strains (A/J and C57BL/6J) and the complexity of the resulting pattern, it is sometimes difficult to determine the SDP for some fragments. In addition, when the SDPs of the AXB Rl strains were determined, Iapls3-25 did not show linkage with markers on chromosome 11, although it had in a different cross (Lueders, 1995). It is possible that the very proximal end of chromosome 11 did in fact come from A/J in AXB-4/Pgn but that the lapis have been incorrectly typed in this strain. Combining the information obtained from the SDPs and the results of PCR, the data shows that the BCi from the cross of the AXB-4/Pgn strain with A/WySn would not segregate for the region of chromosome 13 containing Clf2, chromosome 18, SSLP's on proximal chromosome 11, or around Pvrl2 on chromosome 7. Therefore, we cannot use this cross to obtain any information about whether regions that increase risk of cleft lip are located on chromosome 18 or at the Pvrl2 locus. Although we were unable to look at the segregation of alleles at the gene Pvrl2 in this cross, it would be interesting to examine it for polymorphisms with effect on cleft lip in the future in a different cross. As a family member, PVRL1, which is a cell-cell adhesion molecule, has been implicated as the causative gene in a syndrome resulting in cleft lip and as a small genetic risk factor for nonsyndromic cleft lip (in some human populations), it would be interesting to determine conclusively whether Pvrl2 plays a role in the risk of cleft lip in the "A" strain. 107 The three markers typed on chromosome 7 all showed clearly random segregation, so there is no evidence for a third cleft lip liability gene near these loci on chromosome 7. The final analysis of frequency in the new backcross, being lower than expected, suggests that there are loci other than clfl and Clfl that influence cleft lip in this cross (Chapter III, section i). A recent study has identified the gene disrupted in a balanced chromosomal translocation in a family with cleft lip and palate in two generations as the novel gene CLPTM1 (Cleft lip and palate associated transmembrane protein 1) mapped to 19ql3.3-13.3 (Yoshiura et al., 1998). The mouse homolog of CLPTM1 has been mapped cytogenetically to proximal mouse chromosome 7, which is syntenic to human chromosome 19 ql3.3. Thus it appears that further investigation of chromosome 7 for a locus involved in the etiology of cleft lip is warranted, possibly with a cross to another RI strain with a more advantageous haplotype. 108 Chapter V: General Discussion and Future Directions The goals of this study were to 1) To use a new backcross panel of cleft lip embryos to further define the clfl candidate interval; 2) To test the expression of candidate genes in the embryo during lip development; 3) To determine whether the "A" strain haplotype is unique by examining the haplotype of polymorphic markers in the clfl candidate interval; 4) To use a new backcross panel to test for the presence of a third locus involved in the etiology of cleft lip. The further definition of the clfl candidate interval The backcross panel comprised 70 cleft lip embryos, 5 of which were recombinant at the clfl candidate interval. These 5 recombinants confirmed the previously defined lower border of the interval and either confirmed or refuted the placement of genes within the candidate interval. In addition, new genes were placed in or excluded from the candidate interval. The clfl candidate interval on the UCSC and Ensembl sites containing the sequenced mouse genome contains all of the genes mapped to the candidate interval by our lab (Crhr, Myla, Itgb3, Wnt3, Mapt, and Nsf) plus three additional genes (Arf2, Wntl5, and Gosr2). Many backcross individuals [70 in the current panel + 239 in the previous panel (Juriloff et al., 2001a)]) have now been generated, and the complete lack of recombinants within the 2-3 cM candidate interval is suggestive that recombination is being suppressed in some way (at least 6 recombinants are expected). One possibility is the insertion of a retrotransposon, which has been shown to suppress recombination (Hsu et al., 2000). Interestingly, another mutation in mice caused by the insertion of a retrotransposon is inherited with a maternal effect (Morgan et al., 1999). So it is possible to speculate that the maternal effect seen in A/WySn and other members of the "A" strain is caused by a similar insertion of a retrotransposon and inheritance of maternal epigenetic modification. 109 Expression of candidate genes in embryo heads during lip development Expression data from candidate genes for clfl in adult testis tissue show a difference in part of the gene Crhr between A/WySn and the control strain. However, the decrease in the product from amplification of exons 2-5 and the appearance of an alternatively spliced product in A/WySn were not seen in cDNA from the developing head. It does not appear that the difference seen in Crhr is relevant to the development of cleft lip; however, any possible effect in adults caused by this variation in unknown. All 9 known candidate genes were found to be expressed in the developing head at the time of lip development, while the one predicted gene examined is not. It is commonly thought that because of the relatively small number of genes in the human and mouse genomes, alternative splicing of genes plays a key role in the complexity of these two species. Alternative splicing is thus very important, and mutations that affect alternative splicing are the cause of several diseases such as Fanconi anemia, cystic fibrosis, and HPRT deficiency (O'Neill et al, 1998; Caceres and Kornblihtt, 2002; Cartegni et al., 2002). It is unknown whether the putative alternative transcript seen in this study has any functional consequence. The transcript did not appear to be involved in the etiology of cleft lip, as it was not seen in the embryo, but the fact that the knockout of the same gene causes opposite shifts in behavioral patterns to those characteristic of "A" strains suggests that perhaps it plays a role in the behaviour of this strain. It would be interesting to see if this alternative transcript is present in other tissues, such as the brain, where Crhr is functional. Whether there are any functional consequences of the two polymorphic variants found near the intron/exon boundary and near the putative alternative splice site is also unknown. SNPs can create new splice sites or alter splicing and lead to phenotypic variation in terms of penetrance and cell-type-specific expression (Cartegni et al., 2002); however, whether this is the case in A/WySn and the other strains with these variants is unknown. 110 Defining the prevalence of the A/WySn marker haplotype around clfl An analysis of the haplotypes within and around the clfl candidate interval for 37 inbred stains indicated that A/WySn shares its haplotype with only one other strain, CBA/J. The normal CBA/J strain may now prove to be a valuable tool in finding the clfl mutation. Due to the multifactorial nature of cleft lip in A/WySn, it is difficult to verify that a newly discovered variant is the causal mutation. The haplotype analysis has provided a possible mechanism to test candidate mutations. Since it appears that the piece of chromosome containing clfl has been inherited intact from a common ancestor by both A/WySn and CBA/J, and if it is confirmed that CBA/J has no liability for cleft lip, then any mutation found in A/WySn and not in CBA/J is strongly supported as a causal mutation. A key test that needs to be done is to confirm the absence of the clfl liability gene in CBA/J by crossing it with A/WySn. Testing for a putative third cleft lip liability locus on chromosome 7 Based on evidence that a third susceptibility locus might be involved in the etiology of cleft lip and that it may be on either chromosome 7, chromosome 18 or proximal chromosome 11 (Juriloff et al., 2001a), these regions were investigated in the recombinant inbred strain AXB-4 to see if a cross involving this strain would provide additional information on these regions. Only loci on parts of chromosome 7 were found to be of the appropriate allele, so these regions were examined in a backcross panel generated from a cross to AXB-4. All markers tested were segregating randomly, indicating no susceptibility locus was present there. The frequency of cleft lip in the new backcross supports the hypothesis that an additional locus involved in the risk of cleft lip is segregating in this cross. A future direction for finding this locus could be to use the cleft lip backcross panel to examine regions of AXB-4 (other than clfl) that are segregating in this cross for nonrandom segregation of alleles. Ill Future Directions Since the complete sequence of the candidate interval for clfl is now known, and the size of the candidate interval is relatively small, the next steps to take to understand the etiology of cleft lip should be further studies to determine the clfl mutation, perhaps by looking at more of the predicted genes in the interval. Determination of the clfl mutation may facilitate the discovery of the additional components of risk of cleft lip in AAVySn (Clf2, the genetic maternal effect, and possibly a third risk locus) as the genes may all be components of a regulatory pathway. 112 ELECTRONIC SOURCES Ensembl Genome Browser (Ensembl), Sanger Institute, World Wide Web (URL: http://www.ensembl.org/) Information on mouse strains from Festing, M. (1998) on Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, Maine. World Wide Web (URL: ' http://www, informatics. j ax. org/external/festing/search form. cgi) Mouse Genome Informatics (MGI), Mouse Genome Database (MGD), The Jackson Laboratory, Bar Harbor, Maine. World Wide Web (URL: http://www.informatics.iax.org/) NCBTBLAST home page, National Center for Biotechnology Information. World Wide Web (URL: http://www.ncbi.nlm.nih.gov/BLAST/) NCBI Conserved Domain Database (CDD), National Center for Biotechnology Information. World Wide Web (URL: http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) NCBI home page, Genbank, National Center for Biotechnology Information. World Wide Web (URL: http://www.ncbi.nlm.nih.gov/) Online Mendelian Inheritance in Man, OMIM™. Johns Hopkins University, Baltimore, MD. World Wide Web (URL: http://www.ncbi.nlm.nih.gov/omim/) Saccharomyces Genome Database (SGD). World Wide Web (URL: http://genome-www. S t a n f o r d . edu/S a c c h a r o m y ces/) UCSC Genome Bioinformatics, UCSC Genome Browser. World Wide Web (URL: ht tp .7/genome.ucsc.edu/) [February 2002] 113 LITERATURE CITED Amos C, Stein J, Mulliken JB, Stal S, Malcolm S, Winter R, Blanton SH, et al (1996a) Nonsyndromic cleft lip with or without cleft palate: erratum. Am J Hum Genet 59:744. Amos C, Gasser D, Hecht JT (1996b) Nonsyndromic cleft lip with or without cleft palate: new BCL3 information. Am J Hum Genet 59:743-4. Ardinger HH, Buetow KH, Bell Gl, Bardach J, VanDemark DR, Murray JC (1989) Association of genetic variation of the transforming growth factor-alpha gene with cleft lip and palate. Am J Hum Genet 45:348-53. Beaty TH, Wang H, Hetmanski JB, Fan YT, Zeiger JS, Liang KY, Chiu YF, et al (2001) A case-control study of nonsyndromic oral clefts in Maryland. Ann Epidemiol 11:434-42. Beaty TH, Hetmanski JB, Zeiger JS, Fan YT, Liang KY, VanderKolk CA, Mcintosh I (2002) Testing candidate genes for non-syndromic oral clefts using a case-parent trio design. Genet Epidemiol 22:1 -11. Beiraghi S, Foroud T, Diouhy S, Bixler D, Conneally PM, Delozier-Blanchet D, Hodes ME (1994) Possible localization of a major gene for cleft lip and palate to 4q. Clin Genet 46:255-6. Benavides GR, Hubby B, Grosse WM, McGraw RA, Tarleton RL (1995) Construction and use of a multi-competitor gene for quantitative RT-PCR using existing primer sets. J Immunol Methods 181:145-56. Blanco R, Chakraborty R, Barton SA, Carreno H, Paredes M, Jara L, Palomino H, et al (2001) Evidence of a sex-dependent association between the MSX1 locus and nonsyndromic cleft lip with or without cleft palate in the Chilean population. Hum Biol 73:81-9. Blanton SH, Crowder E, Malcolm S, Winter R, Gasser DL, Stal S, Mulliken J, et al (1996) Exclusion of linkage between cleft lip with or without cleft palate and markers on chromosomes 4 and 6. Am J Hum Genet 58:239-41. Blanton SH, Patel S, Hecht JT, Mulliken JB (2002) MTHFR is not a risk factor in the development of isolated nonsyndromic cleft lip and palate. Am J Med Genet 110:404-5. Bornstein S, Trasler DG, Fraser FC (1970) Effect of the uterine environment on the frequency of spontaneous cleft lip in CL/FR mice. Teratology 3:295-8. Botto LD, Erickson JD, Mulinare J, Lynberg MC, Liu Y (2002) Maternal fever, multivitamin use, and selected birth defects: evidence of interaction? Epidemiology 13:485-8. Bustos T, Simosa V, Pinto-Cisternas J, Abramovits W, Jolay L, Rodriguez L, Fernandez L, et al (1991) Autosomal recessive ectodermal dysplasia: I. An undescribed dysplasia/malformation syndrome. Am J Med Genet 41:398-404. Caceres JF, Kornblihtt AR (2002) Alternative splicing: multiple control mechanisms and involvement in human disease. Trends Genet 18:186-93. Carinci F, Pezzetti F, Scapoli L, Padula E, Baciliero U, Curioni C, Tognon M (1995) Nonsyndromic cleft lip and palate: evidence of linkage to a microsatellite marker on 6p23. Am J Hum Genet 56:337-9. Cartegni L, Chew SL, Krainer AR (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 3:285-98. Castilla EE, Lopez-Camelo JS, Campana H (1999) Altitude as a risk factor for congenital anomalies. Am J Med Genet 86:9-14. 114 Chenevix-Trench G, Jones K, Green A, Martin N (1991) Further evidence for an association between genetic variation in transforming growth factor alpha and cleft lip and palate. Am J Hum Genet 48:1012-3. Chenevix-Trench G, Jones K, Green AC, Duffy DL, Martin NG (1992) Cleft lip with or without cleft palate: associations with transforming growth factor alpha and retinoic acid receptor loci. Am J Hum Genet 51:1377-85. Chung KC, Kowalski CP, Kim HM, Buchman SR (2000) Maternal cigarette smoking during pregnancy and the risk of having a child with cleft lip/palate. Plast Reconstr Surg 105:485-91. Davidson JG, Fraser FC, Schlager G (1969) A maternal effect on the frequency of spontaneous cleft lip in the A-J mouse. Teratology 2:371-6. Davies AF, Stephens RJ, Olavesen MG, Heather L, Dixon MJ, Magee A, Flinter F, et al (1995) Evidence of a locus for orofacial clefting on human chromosome 6p24 and STS content map of the region. Hum Mol Genet 4:121-8. Eiberg H, Bixler D, Nielsen LS, Conneally PM, Mohr J (1987) Suggestion of linkage of a major locus for nonsyndromic orofacial cleft with F13A and tentative assignment to chromosome 6. Clin Genet 32:129-32. Feng H, Sassani R, Bartlett SP, Lee A, Hecht JT, Malcolm S, Winter RM, et al (1994) Evidence, from family studies, for linkage disequilibrium between TGFA and a gene for nonsyndromic cleft lip with or without cleft palate. Am J Hum Genet 55:932-6. Festing M (1979) Inbred strains in Biomedical Research. The Macmillan Press Ltd., London Fraser FC (1955) Thoughts on the etiology of clefts of the palate and lip. Acta geneticae, medicae et gemellologiae 5:358-369 Fraser FC (1970) The genetics of cleft lip and cleft palate. Am J Hum Genet 22:336-52. Gaspar DA, Pavanello RC, Zatz M, Passos-Bueno MR, Andre M, Steman S, Wyszynski DF, et al (1999) Role of the C677T polymorphism at the MTHFR gene on risk to nonsyndromic cleft lip with/without cleft palate: results from a case-control study in Brazil. Am J Med Genet 87:197-9. Gaspar DA, Matioli SR, Pavanello RC, Araujo BC, Andre M, Steman S, Otto PA, et al (2002) Evidence that BCL3 plays a role in the etiology of nonsyndromic oral clefts in Brazilian families. Genet Epidemiol 23:364-74. Gong SG (2001) Phenotypic and molecular analyses of A/WySn mice. Cleft Palate Craniofac J 38:486-91. Griffith AJ, Burgess DL, Kohrman DC, Yu J, Blaschak J, Blanton SH, Boehnke M, et al (1996) Localization of the homolog of a mouse craniofacial mutant to human chromosome 18ql 1 and evaluation of linkage to human CLP and CPO. Genomics 34:299-303. Harada A, Oguchi K, Okabe S, Kuno J, Terada S, Ohshima T, Sato-Yoshitake R, et al (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature 369:488-91. Hartsfield JK, Jr., Hickman TA, Everett ET, Shaw GM, Lammer EJ, Finnell RA (2001) Analysis of the EPHX1 113 polymorphism and GSTM1 homozygous null polymorphism and oral clefting associated with maternal smoking. Am J Med Genet 102:21-4. Hecht JT, Wang YP, Blanton SH, Michels VV, Daiger SP (1991) Cleft lip and palate: no evidence of linkage to transforming growth factor alpha. Am J Hum Genet 49:682-6. 115 HeinrichN, Meyer MR, Furkert J, Sasse A, Beyermann M, Bonigk W, Berger H (1998) Corticotropin-releasing factor (CRF) agonists stimulate testosterone production in mouse leydig cells through CRF receptor-1. Endocrinology 139:651-8. Heller RS, Dichmann DS, Jensen J, Miller C, Wong G, Madsen OD, Serup P (2002) Expression patterns of Wnts, Frizzleds, sFRPs, and misexpression in transgenic mice suggesting a role for Wnts in pancreas and foregut pattern formation. Dev Dyn 225:260-70. Hodivala-Dilke KM, McHugh KP, Tsakiris DA, Rayburn H, Crowley D, Ullman-Cullere M, Ross FP, et al (1999) Beta3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival. J Clin Invest 103:229-38. Holder SE, Vintiner GM, Farren B, Malcolm S, Winter RM (1992) Confirmation of an association between RFLPs at the transforming growth factor-alpha locus and non-syndromic cleft lip and palate. J Med Genet 29:390-2. Houdayer C, Bonaiti-Pellie C, Erguy C, Soupre V, Dondon MG, Burglen L, Cougoureux E, et al (2001) Possible relationship between the van der Woude syndrome (vWS) locus and nonsyndromic cleft lip with or without cleft palate (NSCL/P). Am J Med Genet 104:86-92. Hsu SJ, Erickson RP, Zhang J, Garver WS, Heidenreich RA (2000) Fine linkage and physical mapping suggests cross-over suppression with a retroposon insertion at the npcl mutation. Mamm Genome 11:774-8. Jara L, Blanco R, Chiffelle I, Palomino H, Carreno H (1995) Evidence for an association between RFLPs at the transforming growth factor alpha (locus) and nonsyndromic cleft lip/palate in a South American population. Am J Hum Genet 56:339-41. Jocelyn LJ, Penko MA, Rode HL (1996) Cognition, communication, and hearing in young children with cleft lip and palate and in control children: a longitudinal study. Pediatrics 97:529-34. Jones MC (1988) Etiology of facial clefts: prospective evaluation of 428 patients. Cleft Palate J 25:16-20. Juriloff DM, Trasler DG (1976) Test of the hypothesis that embryonic face shape is a causal factor in genetic predisposition to cleft lip in mice. Teratology 14:35-41. Juriloff DM (1980) Genetics of clefting in the mouse. Prog Clin Biol Res 46:39-71. Juriloff DM, Fraser FC (1980) Genetic maternal effects on cleft lip frequency in A/J and CL/Fr mice. Teratology 21:167-75. Juriloff DM (1982) Differences in frequency of cleft lip among the A strains of mice. Teratology 25:361-8. Juriloff DM (1995) Genetic analysis of the construction of the AEJA congenic strain indicates that nonsyndromic CL(P) in the mouse is caused by two loci with epistatic interaction. J Craniofac Genet Dev Biol 15:1-12. Juriloff DM, Mah DG (1995) The major locus for multifactorial nonsyndromic cleft lip maps to mouse chromosome 11. Mamm Genome 6:63-9. Juriloff DM, Harris MJ, Mah DG (1996) The clfl gene maps to a 2- to 3-cM region of distal mouse chromosome 11. Mamm Genome 7:789. Juriloff DM, Gunn TM, Harris MJ, Mah DG, Wu MK, Dewell SL (2001b) Multifactorial genetics of exencephaly in SELH/Bc mice. Teratology 64:189-200. Juriloff DM, Harris MJ, Brown CJ (2001a) Unravelling the complex genetics of cleft lip in the mouse model. Mamm Genome 12:426-35. Kallen K (1997) Maternal smoking and orofacial clefts. Cleft Palate Craniofac J 34:11-6. 116 Kanno K, Suzuki Y, Yang X, Yamada A, Aoki Y, Kure S, Matsubara Y (2002) Lack of evidence for a significant association between nonsyndromic cleft lip with or without cleft palate and the retinoic acid receptor alpha gene in the Japanese population. J Hum Genet 47:269-74. Kawai J, Shinagawa A, Shibata K, Yoshino M, Itoh M, Ishii Y, Arakawa T, et al (2001) Functional annotation of a full-length mouse cDNA collection. Nature 409:685-90. Kondo S, Schutte BC, Richardson RJ, Bjork BC, Knight AS, Watanabe Y, Howard E, et al (2002) Mutations in IRF6 cause Van der Woude and popliteal pterygium syndromes. Nat Genet 32:285-9. Kormann-Bortolotto MH, Farah LM, Soares D, Corbani M, Muller R, Adell AC (1990) Terminal deletion 6p23: a case report. Am J Med Genet 37:475-7. Lidral AC, Murray JC, Buetow KH, Basart AM, Schearer H, Shiang R, Naval A, et al (1997) Studies of the candidate genes TGFB2, MSX1, TGFA, and TGFB3 in the etiology of cleft lip and palate in the Philippines. Cleft Palate Craniofac J 34:1-6. Lidral AC, Romitti PA, Basart AM, Doetschman T, Leysens NJ, Daack-Hirsch S, Semina EV, et al (1998) Association of MSX1 and TGFB3 with nonsyndromic clefting in humans. Am J Hum Genet 63:557-68. Lieff S, Olshan AF, Werler M, Strauss RP, Smith J, Mitchell A (1999) Maternal cigarette smoking during pregnancy and risk of oral clefts in newborns. Am J Epidemiol 150:683-94. Liu P, Wakamiya M, Shea MJ, Albrecht U, Behringer RR, Bradley A (1999) Requirement for Wnt3 in vertebrate axis formation. Nat Genet 22:361-5. Loffredo LC, Souza JM, Freitas JA, Mossey PA (2001) Oral clefts and vitamin supplementation. Cleft Palate Craniofac J 38:76-83. Lorente C, Cordier S, Goujard J, Ayme S, Bianchi F, Calzolari E, De Walle HE, et al (2000) Tobacco and alcohol use during pregnancy and risk of oral clefts. Occupational Exposure and Congenital Malformation Working Group. Am J Public Health 90:415-9. Lueders KK (1995) Multilocus genomic mapping with intracisternal A-particle proviral oligonucleotide probes hybridized to mouse. DNA in dried agarose gels. Electrophoresis 16:179-85. Lyon M (1958) Twirler: a mutant affecting the inner ear of the house mouse. Journal of Embryology and Experimental Morphology 6:105-116. Macdonald KB, Juriloff DM, Harris MJ (1989) Developmental study of neural tube closure in a mouse stock with a high incidence of exencephaly. Teratology 39:195-213. Machida J, Yoshiura K, Funkhauser CD, Natsume N, Kawai T, Murray JC (1999) Transforming growth factor-alpha (TGFA): genomic structure, boundary sequences, and mutation analysis in nonsyndromic cleft lip/palate and cleft palate only. Genomics 61:237-42. Maestri NE, Beaty TH, Hetmanski J, Smith EA, Mcintosh I, Wyszynski DF, Liang KY, et al (1997) Application of transmission disequilibrium tests to nonsyndromic oral clefts: including candidate genes and environmental exposures in the models. Am J Med Genet 73:337-44. Marazita ML, Field LL, Cooper ME, Tobias R, Maher BS, Peanchitlertkajorn S, Liu YE (2002) Nonsyndromic cleft lip with or without cleft palate in China: assessment of candidate regions. Cleft Palate Craniofac J 39:149-56. 117 Martinelli M, Scapoli L, Pezzetti F, Carinci F, Carinci P, Baciliero U, Padula E, et al (1998) Suggestive linkage between markers on chromosome 19ql3.2 and nonsyndromic orofacial cleft malformation. Genomics 51:177-81. Martinelli M, Scapoli L, Pezzetti F, Carinci F, Francioso F, Baciliero U, Padula E, et al (2001) Linkage analysis of three candidate regions of chromosome 1 in nonsyndromic familial orofacial cleft. Ann Hum Genet 65:465-71. Mietz JA, Kuff EL (1992) Intracisternal A-particle-specific oligonucleotides provide multilocus probes for genetic linkage studies in the mouse. Mamm Genome 3:447-51. Mitchell LE, Healey SC, Chenevix-Trench G (1995) Evidence for an association between nonsyndromic cleft lip with or without cleft palate and a gene located on the long arm of chromosome 4. Am J Hum Genet 57:113,0-6. Mitchell LE, Murray JC, O'Brien S, Christensen K (2001) Evaluation of two putative susceptibility loci for oral clefts in the Danish population. Am J Epidemiol 153:1007-15. Morgan HD, Sutherland HG, Martin DI, Whitelaw E (1999) Epigenetic inheritance at the agouti locus in the mouse. Nat Genet 23:314-8. Muenke M (2002) The pit, the cleft and the web. Nat Genet 32:219-20. Munger RG, Romitti PA, Daack-Hirsch S, Burns TL, Murray JC, Hanson J (1996) Maternal alcohol use and risk of orofacial cleft birth defects. Teratology 54:27-33. Murray JC, Daack-Hirsch S, Buetow KH, Munger R, Espina L, Paglinawan N, Villanueva E, et al (1997) Clinical and epidemiologic studies of cleft lip and palate in the Philippines. Cleft Palate Craniofac J 34:7-10. Murray JC (2002) Gene/environment causes of cleft lip and/or palate. Clin Genet 61:248-56. Natsume N, Kawai T, Ogi N, Yoshida W (2000) Maternal risk factors in cleft lip and palate: case control study. Br J Oral Maxillofac Surg 38:23-5. Nopoulos P, Berg S, VanDemark D, Richman L, Canady J, Andreasen NC (2002) Cognitive dysfunction in adult males with non-syndromic clefts of the lip and/or palate. Neuropsychologia 40:2178-84. Nopoulos P, Berg S, Canady J, Richman L, Van Demark D, Andreasen NC (2002) Structural brain abnormalities in adult males with clefts of the lip and/or palate. Genet Med 4:1-9. Nora J, Fraser FC (1981) Medical Genetics Principles and Practice. Lea and Febiger, Philadelphia Nottoli T, Hagopian-Donaldson S, Zhang J, Perkins A, Williams T (1998) AP-2-null cells disrupt morphogenesis of the eye, face, and limbs in chimeric mice. Proc Natl Acad Sci U S A 95:13714-9. O'Neill JP, Rogan PK, Cariello N, Nicklas JA (1998) Mutations that alter RNA splicing of the human HPRT gene: a review of the spectrum. Mutat Res 411:179-214. Pezzetti F, Scapoli L, Martinelli M, Carinci F, Bodo M, Carinci P, Tognon M (1998) A locus in 2pl3-pl4 (OFC2), in addition to that mapped in 6p23, is involved in nonsyndromic familial orofacial cleft malformation. Genomics 50:299-305. Pezzetti F, Scapoli L, Martinelli M, Carinci F, Brunelli G, Carls FP, Palomba F, et al (2000) Linkage analysis of candidate endothelin pathway genes in nonsyndromic familial orofacial cleft. Arm Hum Genet 64:341-7. Pisarchik A, Slominski AT (2001) Alternative splicing of CRH-R1 receptors in human and mouse skin: identification of new variants and their differential expression. Faseb J 15:2754-6. 118 Poorkaj P, Kas A, D'Souza I, Zhou Y, Pham Q, Stone M , Olson MV, et al (2001) A genomic sequence analysis of the mouse and human microtubule-associated protein tau. Mamm Genome 12:700-12. PrescottNJ, Lees MM, Winter RM, Malcolm S (2000) Identification of susceptibility loci for nonsyndromic cleft lip with or without cleft palate in a two stage genome scan of affected sib-pairs. Hum Genet 106:345-50. Prescott NJ, Winter RM, Malcolm S (2002) Maternal MTHFR genotype contributes to the risk of non-syndromic cleft lip and palate. J Med Genet 39:368-9. Puschel AW, O'Connor V, Betz H (1994) The N-ethylmaleimide-sensitive fusion protein (NSF) is preferentially expressed in the nervous system. FEBS Lett 347:55-8. Robert B, Brunialti A (1995) Refined Genetic Localisation of MSX2 on Mouse chr 13. Mouse Genome 93:1044-1046 Roelink H, Nusse R (1991) Expression of two members of the Wnt family during mouse development—restricted temporal and spatial patterns in the developing neural tube. Genes Dev 5:381-8. Romitti PA, Lidral AC, Munger RG, Daack-Hirsch S, Burns TL, Murray JC (1999) Candidate genes for nonsyndromic cleft lip and palate and maternal cigarette smoking and alcohol consumption: evaluation of genotype-environment interactions from a population-based case-control study of orofacial clefts. Teratology 59:39-50. Sadler TW (2000) Langman's Medical Embryology. Lippincott Williams and Wilkins, Maryland Salinas PC, Nusse R (1992) Regional expression of the Wnt-3 gene in the developing mouse forebrain in relationship to diencephalic neuromeres. Mech Dev 39:151-60. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, U.S.A. Sassani R, Bartlett SP, Feng H, Goldner-Sauve A, Haq AK, Buetow KH, Gasser DL (1993) Association between alleles of the transforming growth factor-alpha locus and the occurrence of cleft lip. Am J Med Genet 45:565-9. Scapoli L, Pezzetti F, Carinci F, Martinelli M, Carinci P, Tognon M (1997) Evidence of linkage to 6p23 and genetic heterogeneity in nonsyndromic cleft lip with or without cleft palate. Genomics 43:216-20. Scapoli L, Pezzetti F, Carinci F, Martinelli M, Carinci P, Tognon M (1998) Lack of linkage disequilibrium between transforming growth factor alpha Taq I polymorphism and cleft lip with or without cleft palate in families from Northeastern Italy. Am J Med Genet 75:203-6. Scapoli L, Martinelli M, Pezzetti F, Carinci F, Bodo M, Tognon M, Carinci P (2002) Linkage disequilibrium between GABRB3 gene and nonsyndromic familial cleft lip with or without cleft palate. Hum Genet 110:15-20. Shapiro MB, Senapathy P (1987) RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 15:7155-74. Shaw D, Ray A, Marazita M, Field L (1993) Further evidence of a relationship between the retinoic acid receptor alpha locus and nonsyndromic cleft lip with or without cleft palate (CL +/- P). Am J Hum Genet 53:1156-7. Shaw GM, Lammer EJ, Wasserman CR, O'Malley CD, Tolarova MM (1995) Risks of orofacial clefts in children born to women using multivitamins containing folic acid periconceptionally. Lancet 346:393-6. 119 Shaw GM, Wasserman CR, Lammer EJ, O'Malley CD, Murray JC, Basart AM, Tolarova MM (1996) Orofacial clefts, parental cigarette smoking, and transforming growth factor-alpha gene variants. Am J Hum Genet 58:551-61. Shaw GM, Wasserman CR, Murray JC, Lammer EJ (1998) Infant TGF-alpha genotype, orofacial clefts, and maternal periconceptional multivitamin use. Cleft Palate Craniofac J 35:366-70. Shaw GM, Lammer EJ (1999) Maternal periconceptional alcohol consumption and risk for orofacial clefts. J Pediatr 134:298-303. Shaw GM, Nelson V, Carmichael SL, Lammer EJ, Finnell RH, Rosenquist TH (2002) Maternal periconceptional vitamins: interactions with selected factors and congenital anomalies? Epidemiology 13:625-30. , Sozen MA, Suzuki K, Tolarova MM, Bustos T, Fernandez Iglesias JE, Spritz RA (2001) Mutation of PVRL1 is associated with sporadic, non-syndromic cleft lip/palate in northern Venezuela. Nat Genet 29:141-2. Stein J, Mulliken JB, Stal S, Gasser DL, Malcolm S, Winter R, Blanton SH, et al (1995) Nonsyndromic cleft lip with or without cleft palate: evidence of linkage to BCL3 in 17 multigenerational families. Am J Hum Genet 57:257-72. Stoll C, Qian JF, Feingold J, Sauvage P, May E (1992) Genetic variation in transforming growth factor alpha: possible association of BamHI polymorphism with bilateral sporadic cleft lip and palate. Am J Hum Genet 50:870-1. Strachan T, Read A (1999) Human Molecular Genetics 2. Wiley-Liss, New York Strauss RP (1999) The organization and delivery of craniofacial health services: the state of the art. Cleft Palate Craniofac J 36:189-95. Suzuki K, Hu D, Bustos T, Zlotogora J, Richieri-Costa A, Helms JA, Spritz RA (2000) Mutations of PVRL1, encoding a cell-cell adhesion molecule/herpesvirus receptor, in cleft lip/palate-ectodermal dysplasia. Nat Genet 25:427-30. Thompson M, Mclnnes R, Willard H, Thompson J (1991) Thompson and Thompson: Genetics in Medicine. W.B. Saunders Company, Philadelphia Timpl P, Spanagel R, Sillaber I, Kresse A, Reul JM, Stalla GK, Blanquet V, et al (1998) Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor 1. Nat Genet 19:162-6. Tolarova M (1982) Periconceptional supplementation with vitamins and folic acid to prevent recurrence of cleft lip. Lancet 2:217. Tolarova M, Harris J (1995) Reduced recurrence of orofacial clefts after periconceptional supplementation with high-dose folic acid and multivitamins. Teratology 51:71-8. Trasler DG, Fraser FC (1963) Role of the tongue in producing cleft palate in mice with spontaneous cleft lip. Dev Biol 6:45-60. Trasler DG (1968) Pathogenesis of cleft lip and its relation to embryonic face shape in A-J and C57BL mice. Teratology 1:33-49. Trasler DG, Kemp D, Trasler TA (1984) Increased susceptibility to 6-aminonicotinamide-induced cleft lip of heterozygote Dancer mice. Teratology 29:101-4. van Straaten HW, Copp AJ (2001) Curly tail: a 50-year history of the mouse spina bifida model. Anat Embryol (Berl) 203:225-37. Vanderas AP (1987) Incidence of cleft lip, cleft palate, and cleft lip and palate among races: a review. Cleft Palate J 24:216-25. 120 Vintiner GM, Holder SE, Winter RM, Malcolm S (1992) No evidence of linkage between the transforming growth factor-alpha gene in families with apparently autosomal dominant inheritance of cleft lip and palate. J Med Genet 29:393-7. Vintiner GM, Lo KK, Holder SE, Winter RM, Malcolm S (1993) Exclusion of candidate genes from a role in cleft lip with or without cleft palate: linkage and association studies. J Med Genet 30:773-8. Wada J, Kumar A, Liu Z, Ruoslahti E, Reichardt L, Marvaldi J, Kanwar YS (1996) Cloning of mouse integrin alphaV cDNA and role of the alphaV-related matrix receptors in metanephric development. J Cell Biol 132:1161-76. Wang KY, Juriloff DM, Diewert VM (1995) Deficient and delayed primary palatal fusion and mesenchymal bridge formation in cleft lip-liable strains of mice. J Craniofac Genet-Dev Biol 15:99-116. Werler MM, Lammer EJ, Rosenberg L, Mitchell AA (1990) Maternal cigarette smoking during pregnancy in relation to oral clefts. Am J Epidemiol 132:926-32. Wyszynski DF, Beaty TH (1996) Review of the role of potential teratogens in the origin of human nonsyndromic oral clefts. Teratology 53:309-17. Wyszynski DF, Maestri N, Mcintosh I, Smith EA, Lewanda AF, Garcia-Delgado C, Vinageras-Guarneros E, et al (1997) Evidence for an association between markers on chromosome 19q and non-syndromic cleft lip with or without cleft palate in two groups of multiplex families. Hum Genet 99:22-6. Yoshiura K, Machida J, Daack-Hirsch S, Patil SR, Ashworth LK, Hecht JT, Murray JC (1998) Characterization of a novel gene disrupted by a balanced chromosomal translocation t(2;19)(ql 1.2;ql3.3) in a family with cleft lip and palate. Genomics 54:231-40. 121 Appendix A: Data on embryos collected for RNA Table A.l: Number and tail somite count of Day 10-Day 11 embryos Strain Litter # # of embryos Tail somite count (# of embryos) A/WySn 1411 7 1-3 (7) A/WySn 1382 5 1(2) 2(1) • 4(1) 7(1) A/WySn 1357 4 2(2) 4(2) A/WySn 1356 4 1(4) A/WySn 1385 7 1(2) 3(2) 6(1) 7(1) 8(1) A/WySn 1419 6 2(1) 5(1) 6(1) 7(2) 9(1) A/WySn 1358 7 0(3) 1(1) 2(1) 5(1) 7(1) A/WySn 1402 7 1(2) 2(2) 3(1) 6(2) A/WySn 1412 5 6(1) 8(4) A/WySn 1359 6 1(1) 4(1) 5(2) 7(2) A/WySn 1381 7 5(1) 6(2) 7(2) 8(1) 10(1) 122 Table A.l cont: Number and tail somite count of Day 10-Day 11 embryos Strain Litter # # of embryos Tail somite count (# of embryos) A/WySn 1355 5 6(1) 8(1) 9(1) 12(1) 14(1) A/WySn 1383 7 4(1) 9(1) 14(1) 15(3) 16(1) AAVySn 1410 7 9(1) 10(3) 12(2) 16(1) A/WySn 1393 6 4(1) 6(3) 8(1) 9(1) AXB-4 91 7 0-1 (2) 9-10(5) AXB-4 85 5 2-3 (4) 8(1) AXB-4 84 1 12(1) AXB-4 93 3 0(1) 4(1) 5(1) 123 o o CD H-» s o co ca +-» C M O CD 00 C CO T3 CD 43 O -o a CD C M O l-i CD J D s a O OH I H M c2 T J CD co 3 co T J ca CD XI X 6 CD t+H O O O OH C o xi CO CD X ca e a 3 00 CN < A 3 8 •s * H .S |I> i2 2 0 > MD C N ^ ^ O ^H CN OS OO MD i n MD — < — 1 — i CN r - 1 - M oo Os C O CD C N a .2 'co CO CU I-i CH X CU CU Cl cu bo cu 'I O X ? , cu cd o •«-» fe a T3 o cu '55 CO CO pre ners X ners CD CU "C C CH cu CU bo cO «+-( • i-H CD CD O CO CH '55 CO fe fe> < X , 13 z -*-» CD Ct c3 Q CD c2 l-i o o VH CO C£H fe l-l CU H-» <+H CD o nprirr produ Size i o M-H c O o CD _N rma1 CO T3 G c2 Ki d •»—( ns I—H _o na %-» o *3 v-» on VH -3 o CD • : Ad PCR fi I-H HH ' m fe' ndi cd cu CD pp abl < H o bu k i w i c i t n i n v i i n i n w i n i n v i i c i i o i n i n i n i n cpj m to ^ O <n i n <n i n § i i c i w i n i n i f l i n i n i n i r i i n co ^ i n i r i i r i i n u n i n i n i o i n i n o o m m co CN • m w n ^ r l r l S ^ m ^ S r t S ^ - . CN r i " _ cu cu j o , cu - n i n h CH CH CH CH CH CN ^ ^ b O ^ ^ ^ ^ ^ ^ - H ^ C N - ^ ^ r n C N C N o fl.ajH.ftA^H-CA^H CH C H - P H C H ^ IT) ^ ~~ C N - f e , , „ ^ I-H cn m r- "2, <2 t~-i—H ^ CH CH MD VO fe CN fe fe^^H p ^ C u C U f e C H C H C H t N r o r n ^ < N H n r ^ U O CJ CJ CJ CJ 22 fe II N CD Appendix C: Sequence data from the PCR product produced by amplifying pools of adult testis cDNA with the primer pair Crhr pi 5/pl 8. The sequence shown is from the forward primer (Crhr pi 5), but was verified by sequence from the reverse primer (Crhr pl8). One variation from the published sequence was seen in the A/WySn sequence, but additional sequencing confirmed that the variation was a sequencing error and not a true alteration, so it is not included in this sequence. AXB-4, Crhr pi5 CCTCCCTCCAGGATCAGCAGTGTGAGAGCCTGTCCCTGGCCAGCAATGTCTCT GGCCTGCAGTGCAATGCCTCCGTGGACCTCATTGGCACCTGCTGGCCCAGGA GCCCTGCAGGGCAGTTGGTGGTTCGGCCCTGCCCTGCCTTTTTCTACGGTGTC CGCTACAACACCACAAACAATGGCTACCGGGAATGCCTGGCCAACGGCAGCT GGGCAGCCCGTGTGAATTATTCTGAGTGCCAGGAGATTCTCAACGAAGAGAA GAAGAGCAAAGTGCACTACCACATTGCCGTCATCATCAACTACCTGGGCCAC T A/WySn, Crhr pi 5 CCTCCCTCCAGGATCAGCAGTGTGAGAGCCTGTCCCTGGCCAGCAATGTCTCT GGCCTGCAGTGCAATGCCTCCGTGGACCTCATTGGCACCTGCTGGCCCAGGA GCCCTGCAGGGCAGTTGGTGGTTCGGCCCTGCCCTGCCTTTTTCTACGGTGTC CGCTACAACACCACAAACAATGGCTACCGGGAATGCCTGGCCAACGGCAGCT GGGCAGCCCGTGTGAATTATTCTGAGTGCCAGGAGATTCTCAACGAAGAGAA GAAGAGCAAAGTGCACTACCACATTGCCGTCATCATCAACTACCTGGGCCAC T 126 CN fl .5 <u _t: •5 ca •5 -o ca g on • CD S co ca ca CL, X d) H—1 fl H - H u co s _ CD CD fl S3 C £ «" 8 a 8 CO X i CO CD H O H 3 fl -a fl CO O CD X H ON T J '-fl ^ ° A CD CO -fl C ca CO e o CD CD fl X O P o g a M CO fl CO c CD CO fl O H • cT fl -A 2 co £ j B -9 O CD H—i ^ CD 8 3 CD co CD CD -5 fl la 2. -fl M CO CD fl fl OD CO L H CD fl o ca fl o CD X H-» O -fl fl CD CD X fl O < CO CD X CD X T 3 co — i CD CO fl CD O •A -S 'co X CD 1 / 2 A S2 co fl CD CO CO fl. fl CD X) co fl " f l O CD « t> " f l fl O .2 A O X Pi CD .a 5 - f l % c ^ CD _ T °< s - < CD *3 is fl o CD • e H - * CD X H - J M - H o CD" ^ .•fl § w II CD 1 1 .2 £ & 2 co r CD on CD CD O H 2 -fl I/O \ f l OD CD fl O fl s P O ~ S fl ° fl "2 .2 5 •£3 cci 'Eo 2 O H ta 2 x -fl fl ^ CD £ CD > co ro CD X fl ^ s .S O H fl CD fl CO CD -A CD H-> CD XI fl fl CD • _ « fl CO co CD +-> • i - H CD O » i - H *£* CO co CO c CD CO a o o (D -a O CD • i - H CO o IT) Appendix E: Sequence data from the PCR product produced by amplifying a pool of genomic DNA from CBA/J using the primer pairs CRSP1 F/R and CRSP2 F/R for intron 4 of Crhr. Sequence from the forward primers is shown, although it was verified by sequence from the reverse primers. Underlined and in bold are the sequence changes from the published sequence that also appear in A/WySn. CBA/J , CRSP1F T C T C T T C T r r P T ^ T C T C T T C T G C C T C A G A A G A A G A G C A A A G T G C A C T A C C A C A T T G C C G T C A T C A T C A A C T A C C T G G G C C A C T G C A T C T C C C T G G T G G C C C T C C T G G T G G C C T T T C r C C TCTT CBA/J , CRSP2 F AGAGGTGGATGTAGGGTGTTTTCTTTAATGGTTTTCCACCTCGTTTGTTAAGA C C G G G A T C T C T T C A C T A A T C C C T A G A G C T G A C A G T G T C G C T G G G C T G A C A G G C C A G G G A T C C A G G G A T C C A C C T A T A T C T G A T G C T C T G T G T T G A G G T T A C A G A T C C C C G T C A G C C A C A C C C A G A G T T C A C A A G G A T G T C A G G A A T C C A A A C C C A G G T T C T C A C T C A G C C G G A C T C G G G T G T G A C C A G G A A G A T G G G A A C C T T C A G G A G T G A G A A A T G C A A T C C T G G A A G G C T G 128 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090940/manifest

Comment

Related Items