Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and characterization of SH-2 containing inositol 5-phosphate, SHIP Ware, Mark Daniel 2000

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2001-611973.pdf [ 24.13MB ]
Metadata
JSON: 831-1.0090821.json
JSON-LD: 831-1.0090821-ld.json
RDF/XML (Pretty): 831-1.0090821-rdf.xml
RDF/JSON: 831-1.0090821-rdf.json
Turtle: 831-1.0090821-turtle.txt
N-Triples: 831-1.0090821-rdf-ntriples.txt
Original Record: 831-1.0090821-source.json
Full Text
831-1.0090821-fulltext.txt
Citation
831-1.0090821.ris

Full Text

CLONING AND CHARACTERIZATION OF SH2-CONTAINING INOSITOL 5-PHOSPHATASE, SHIP by MARK DANIEL WARE B. Sc., The University of British Columbia, 1992 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY In THE FACULTY OF GRADUATE STUDIES (Department of Medicine; Experimental Medicine; Program) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA December 2000 © Mark Daniel Ware, 2000 In p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t of the requirements f o r an advanced degree at the U n i v e r s i t y of B r i t i s h Columbia, I agree that the L i b r a r y s h a l l make i t f r e e l y a v a i l a b l e f o r reference and study. I f u r t h e r agree that permission f o r extensive copying of t h i s t h e s i s f o r s c h o l a r l y purposes may be granted by the head of my department or by h i s or her r e p r e s e n t a t i v e s . I t i s understood that copying or p u b l i c a t i o n of t h i s t h e s i s f o r f i n a n c i a l gain s h a l l not be allowed without my w r i t t e n permission. DepuU- LmuuL u l The U n i v e r s i t y of B r i t i s h Columbia Vancouver, Canada Date . 2 ^ Ztfoo ABSTRACT CLONING AND CHARACTERIZATION OF THE SH2-CONTAINING INOSITOL 5-PHOSPHATASE, SHIP A 145-kDa protein originally cloned from murine cells and named SH2-containing inositol 5-phosphatase (SHIP), becomes both tyrosine phosphorylated and associated with the adapter protein She following stimulation of hematopoietic cells with a wide variety of extracellular stimuli. Here we describe the cloning of the human homologue of SHIP from a human megakaryocytic cell line (M07e) A,gt11 cDNA library. Northern blot analysis indicates human SHIP gene is expressed as a 5.3-kb mRNA in human bone marrow and a wide variety of other tissues. Sequence analysis of the cDNA predicts a protein of 1188 amino acids exhibiting 87.2% overall sequence identity with murine SHIP. Contained within the defined open reading frame is an N-terminal, Group I Src homology 2 (SH2) domain, two NPxY-containing phosphotyrosine binding (PTB) domain ligand motifs, a C-terminal proline-rich region, and two centrally located inositol polyphosphate 5-phosphatase motifs. Fluorescence in situ hybridization mapped human SHIP to the long arm of chromosome 2 at the border between 2q36 and 2q37. Examination of proteins capable of binding the six major PxxP motifs of SHIP identified Grb2 and kinases of the Src family as potential binding partners. Both Grb2 and Lyn bound SHIP in unstimulated WEHI 231 B cells but only Lyn binding increased with activation of the B cell antigen receptor (BCR). Experiments with the Src family kinase inhibitor, PP2, revealed that SHIP'S tyrosine phosphorylation is regulated by Src-like kinases following activation of BCR, interleukin-3 (IL-3) receptor, and stem cell factor (SCF) receptor signalling. Functional analysis of various SHIP domains was undertaken by reintroduction of wild type and or mutanted forms of SHIP into bone marrow-derived mast cells obtained form SHIP"'" mice. Results revealed that the phosphatase domain and proline-rich C-terminus were both vital to SHIP'S ability to hydrolyze SCF-induced phosphatidylinositol 3,4,5-P3 (Ptdlns3,4,5P3), inhibit extracellular calcium entry, and prevent degranulation in these cells, while the inability of SHIP to interact with She only partially affected SHIP'S regulation of these processes. TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iii LIST OF FIGURES vii LIST OF TABLES x LIST OF ABBREVIATIONS xi CONTRIBUTIONS OF OTHERS ...xvi ACKNOWLEDGEMENTS xvii CHAPTER 1 INTRODUCTION 1 1.1 EVOLUTION OF SIGNAL TRANSDUCTION PATHWAYS 1 1.2 RECEPTORS FOR FIRST-MESSENGERS 2 1.2.1 Protein-Tyrosine Kinase Regulated Receptors 3 1.2.2 Stem Cell Factor Receptor, c-Kit 3 1.2.3 lnterleukin-3 Receptor 4 1.2.4 B cell Antigen Receptor 8 1.3 KINASES 10 1.3.1 Protein-Tyrosine Kinases 11 1.3.2 Src Family Kinases 13 1.3.3 Phosphatidylinositol Kinases 14 1.3.4 Phosphatidylinositol 3-Kinases 17 1.4 PHOSPHATASES 19 1.4.1 PTEN 20 1.5 PROTEIN-PROTEIN INTERACTIONS 21 1.5.1 Phosphorylation-Dependent Protein-Binding Modules 21 1.5.2 Phosphorylation-lndependent Protein-Binding Modules 23 1.6 PROTEIN-LIPID INTERACTIONS 24 1.7 INOSITOL POLYPHOSPHATE 5-PHOSPHATASES 26 1.7.1 Group I Inositol Polyphosphate 5-Phosphatases 26 1.7.2 Group II Inositol Polyphosphate 5-Phosphatases 28 1.7.2.1 OCRL-1 28 1.7.2.2 The Synaptojanin Family 30 iii 1.7.3 Group III Inositol Polyphosphate 5-Phosphatases 31 1.8 PROTEIN BINDING PARTNERS OF SHIP 32 1.8.1 Immunoreceptor Tyrosine-based Motifs 32 1.8.2 She and Grb2 34 1.8.3 The Dok Family 36 1.8.4 PI3-K 37 1.8.5 Other Associated Proteins 37 1.9 ROLE FOR SHIP SUBSTRATES AND BY-PRODUCTS 38 1.9.1 lns1,3,4,5P4and lns1,3,4P3 38 1.9.2 Ptdlns3,4,5P3 and Ptdlns3,4P2 40 1.10 BIOLOGICAL ROLES OF SHIP 42 1.10.1 In BCR/FcyRllb Signalling 42 1.10.2 In Mast Cell Functioning 43 1.10.3 In Hematopoietic Development 44 1.11 AIM OF STUDY 46 CHAPTER 2 MATERIALS AND METHODS 47 2.1 REAGENTS 47 2.2 HUMAN SHIP cDNA CLONING 47 2.3 TISSUE CULTURE 48 2.3.1 Cell Lines 48 2.3.2 Bone Marrow-Derived Mast Cells 49 2.3.3 BOSC 23 Transfection 49 2.3.4 Viral Infection of Bone Marrow Cells 49 2.3.5 Viral Infection of WEHI 231 B cells 50 2.4 RNA ANALYSIS 51 2.4.1 Poly-A+ RNA Isolation 51 2.4.2 Northern Blot Analysis 51 2.5 FLUORESCENCE in situ HYBRIDIZATION (FISH) 52 2.6 DNA ANALYSIS 52 2.6.1 Genomic DNA Isolation 52 2.6.2 Southern Blot Analysis 52 2.6.3 Radioactive Labeling of cDNA probes 53 2.6.4 DNA Sequencing 53 2.7 PROTEIN ANALYSIS 54 2.7.1 Cell Stimulation, Immunoprecipitations, and Immunoblotting 54 2.7.2 Flow Cytometry 55 2.7.3 Antibodies 55 2.8 GLUTATHIONE S-TRANSFERASE (GST) FUSION PROTEINS 56 2.8.1 GST Fusion Protein Constructs 56 2.8.2 Purification of GST-fusion Proteins 58 iv 2.8.3 In vitro Protein Binding Assay 58 2.8.4 L-[35S]-Methionine Metabolic Labelling 59 2.8.5 In Vitro Kinase Assay 59 2.9 SHIP MUTAGENESIS 59 2.9.1 SHIP Point-mutations 59 2.9.2 SHIP Truncation Mutants 61 2.10 BIOLOGICAL ANALYSIS OF BONE MARROW-DERIVED MAST CELLS 61 2.10.1 Ptdlns3,4,5P3 Measurements 61 2.10.2 Degranulation Assay 62 2.10.3 Intracellular C a 2 + Influx Assay 63 CHAPTER 3 CLONING AND PRELIMINARY CHARACTERIZATION OF HUMAN SH2-CONTAINING INOSITOL 5-PHOSPHATASE 64 3.1 INTRODUCTION 64 3.2 RESULTS AND DISCUSSION 64 CHAPTER 4 IDENTIFICATION OF PROTEINS THAT BIND THE PROLINE-RICH REGIONS OF SHIP 84 4.1 INTRODUCTION 84 4.2 RESULTS 84 4.2.1 Grb2 Associates with Both the N and C-Termini of SHIP 84 4.2.2 The Association of Grb2 with SHIP is Dependent on PxxP Motifs 90 4.2.3 Grb2 associates with a C-terminal truncation mutant of SHIP B cells 92 4.2.4 SHIP Fragment Associates with Kinase(s) 98 4.3 DISCUSSION 99 CHAPTER 5 SRC FAMILY KINASES ASSOCIATE WITH SHIP AND REGULATE ITS TYROSINE PHOSPHORYLATION 104 5.1 INTRODUCTION 104 5.2 RESULTS 104 5.2.1 Src-family Inhibitor Reduces SHIP Phosphorylation 104 5.2.2 SHIP Phosphorylation is Reduced in Lyn_/" Cells 108 5.2.3 Lyn Associates with SHIP in B cells 110 5.2.4 SHIP and Lyn do not Associate via Their SH2 domains in Stimulated Cells 112 5.2.5 Src SH3 Domains Bind Different SHIP Forms 114 5.3 DISCUSSION 118 v CHAPTER 6 THE ROLE OF SHIP'S DOMAINS IN BONE MARROW MAST CELLS 125 6.1 INTRODUCTION 125 6.2 RESULTS 125 6.2.1 Introduction of SHIP Mutants into SHIP"'-BMMCs 125 6.2.2 WT, but not D675G norT2 SHIP Reverts SCF-induced Ptdlns3,4,5P3 to Levels Observed in SHIP + / + BMMCs 130 6.2.3 Removal of Proline-rich C-terminal Tail Reduces SHIP Tyrosine Phosphorylation 131 6.2.4 She Binding is Reduced by Mutation of NPxY Motifs and Removal of C-terminus of SHIP 133 6.2.5 Shc/MAPK Phosphorylation Unaffected by Expression of Different SHIP Constructs in SHIP"'-BMMCs 134 6.2.6 C a + + Influx is Elevated in C-terminal SHIP Truncations 139 6.2.7 C-terminally Truncated SHIP Mutants are Ineffective at Reducing SCF-induced Degranulation 142 6.3 DISCUSSION 143 CHAPTER 7 SUMMARY AND PERSPECTIVES 150 BIBLIOGRAPHY 156 vi LIST OF FIGURES CHAPTER 1 Figure 1.1 Protein-Tyrosine Kinase Regulated Receptors 5 Figure 1.2 Structure of adenosine triphosphate and a schematic of kinase/phosphatase reactions 11 Figure 1.3 Structure of protein kinase targets and phosphatidylinositol 12 Figure 1.4 Phosphoinositide synthesis pathways 15 Figure 1.5 Structures of known inositol polyphosphate 5-phosphatases 27 Figure 1.6 Substrate specificity of inositol polyphosphate 5-phosphatases 29 CHAPTER 2 No Figures CHAPTER 3 Figure 3.1 SHIP Southern blot analysis of murine and human genomic DNA 65 Figure 3.2 Schematic Diagram of the hSHIP cDNA 67 Figure 3.3 Human SHIP cDNA sequence 68 Figure 3.4 Alignment of the human and murine SHIP protein sequences 72 Figure 3.5 Comparison of the SH2 domain of hSHIP with other related SH2 domains 75 Figure 3.6 Comparison of the 5-ptase motifs 1 and 2 of hSHIP with related 5-ptases 77 Figure 3.7 Expression of hSHIP mRNA in human tissues 81 Figure 3.8 FISH mapping of the hSHIP gene 82 CHAPTER 4 Figure 4.1 GST-SHIP fusion proteins 85 Figure 4.2 In vitro protein binding assay for Ba F3 cells 86 Figure 4.3 In vitro protein binding assay for DA-3 cells 87 Figure 4.4 Grb2 binds both the N and C-termini of SHIP 88 Figure 4.5 Association of various SH3 domains with SHIP 89 Figure 4.6 Synthetic peptide corresponding to SHIP'S PxxP motifs 90 vii Figure 4.7 Association between Grb2 and the N-terminus of SHIP is disrupted by PxxP-containing peptides 91 Figure 4.8 Association between Grb2 and the C-terminus of SHIP is disrupted by PxxP-containing peptides 92 Figure 4.9 SHIP mutant constructs introduced into WEHI 231 B cells 93 Figure 4.10 WT and T1 SHIP are tyrosine phosphorylated in response to BCR engagement 94 Figure 4.11 SHIP constructs constitutively associate with Grb2 in vivo 95 Figure 4.12 Grb2 constitutively associates with SHIP constructs in vivo 96 Figure 4.13 She association with SHIP constructs increases following BCR engagement 97 Figure 4.14 In vitro kinase assay identifies kinase(s) associated with SHIP B fragment 99 Figure 4.15 SHIP-associated kinase activity inhibited by specific kinase inhibitors 100 CHAPTER 5 Figure 5.1 Src-family inhibitor, but not Syk inhibitor, reduces tyrosine phosphorylation of SHIP in response to BCR activation 105 Figure 5.2 Src-family inhibitor reduces IL-3-induced SHIP phosphorylation 106 Figure 5.3 Src-family inhibitor reduces SCF-induced SHIP phosphorylation 107 Figure 5.4 Intensity and duration of SCF-induced SHIP phosphorylation is reduced in Lyn"/_ BMMCs 109 Figure 5.5 Residual SCF-induced SHIP phosphorylation in Lyn_/" BMMCs is reduced by a Src family inhibitor 110 Figure 5.6 Lyn associates with SHIP in B cells 111 Figure 5.7 BCR engagement-induced SHIP tyrosine phosphorylation 112 Figure 5.8 Association of Lyn with N-terminus of SHIP requires PxxP sequence 113 Figure 5.9 Association of various SH3 domains with SHIP 115 Figure 5.10 Src family SH3 domains associates with a C-terminally truncated SHIP mutant 116 Figure 5.11 Lyn associates specifically with N-terminus of SHIP 117 Figure 5.12 Association of Src family SH3 domain with SHIP is disrupted by specific PxxP-containing peptide 118 viii C H A P T E R 6 Figure 6.1 A schematic diagram of the initial SHIP constructs introduced into SHIP"'" BMMCs 126 Figure 6.2 Levels of expression of SHIP constructs' in SHIP"'" BMMCs determined by flow cytometry 127 Figure 6.3 Immunoblot detection of retrovirally-introduced SHIP expression levels 129 Figure 6.4 The effects of SHIP reintroduction on SCF-induced Ptdlns3,4,5P 3 levels in SHIP"'" BMMCs 131 Figure 6.5 C-terminally truncated SHIP does not become tyrosine phosphorylated in response to S C F 132 Figure 6.6 Association of WT SHIP and SHIP mutants with She 134 Figure 6.7 SHIP/Shc binding does not affect She or MAPK phosphorylation 136 Figure 6.8 A schematic diagram of additional SHIP constructs introduced into SHIP"'" BMMCs 137 Figure 6.9 Expression of SHIP constructs in second batch of SHIP"'" BMMCs 138 Figure 6.10 T1 and T3 SHIP constructs do not revert the S C F -induced Ptdlns3,4,5P 3 levels to those observed in S H I P + / + B M M C s 139 Figure 6.11 Effects of different SHIP constructs on SCF-induced extracellular calcium influx 140 Figure 6.12 The WT, but not the D675G, T1, or T3 SHIP constructs reverts the SCF-induced degranulation to S H I P + / + B M M C levels 142 C H A P T E R 7 Figure 7.1 Summary of known SHIP protein-binding partners 151 ix LIST O F T A B L E S C H A P T E R 1 No Tables C H A P T E R 2 Table 2.1 List of antibodies used 56 Table 2.2 G S T fusion proteins from external sources 57 Table 2.3 P C R primer pairs used in the creation of various G S T fusion proteins 57 C H A P T E R 3 No Tables C H A P T E R 4 No Tables C H A P T E R 5 No Tables C H A P T E R 6 No Tables C H A P T E R 7 No Tables x LIST O F A B B R E V I A T I O N S 5-ptase Inositol polyphosphate 5-phosphatase aa Amino acid Ag Antigen ATP Adenosine triphosphophate BCR B cell antigen receptor BMMC Bone marrow-derived mast cell bp Base pair BSA Bovine serum albumin Btk Bruton's tyrosine kinase cDNA Cloned deoxyribonucleic acid CFU-E Colony forming unit-erythroid CSF Colony stimulating factor Csk C-terminal Scr kinase Dab1 Disabled 1 DAG Diacylglycerol DAPI 4',6-diamidin-2-phenylindol-dihydrochloride DMEM Dulbecco's modified Eagle media EDTA Ethylenediaminetetraacetic acid Epo Erythropoietin ERK Extracellular signal-regulated kinase xi FcyR Crystalline fragment-gamma receptor FCS Fetal calf serum F C E R Crystalline fragment-epsilon receptor FITC Fluorescein isothiocyanate GAP GTPase-activated protein GAS Interferon gamma-activated sequences GDP Guanidine diphosphophate GEF Guanine nucleotide exchange factor GFP Green fluorescence protein GH Growth hormone GM-CSF Granulocyte colony stimulating factor Grb2 Growth factor receptor binding protein 2 GRP General receptor for phosphoinositides GST Glutathione S-transferase GSH Glutathione GTP Guanidine triphosphophate Ga a subunit of trimeric G proteins Gp Y 3Y subunits of trimeric G proteins HA Hemagglutinin IB Immunoblot •g Immunoglobin IL Interleukin xii IMDM Iscove's modified Dulbecco's medium INF Interferon Ins Inositol IP Immunoprecipitation IRS Insulin receptor substrate ISRE Interferon gamma-stimulated response element ITAM Immunoreceptor tyrosine-based activation motif ITIM Immunoreceptortyrosine-based inhibitory motif Jak Janus kinase kb Kilo-base kDa Kilo-Dalton KIR Killer cell inhibitory receptor LIF Leukemia inhibitory factor MAPK Mitogen-activated protein kinase mRNA Messenger ribonucleic acid NP40 Nonident P-40 ORF Open-reading frame PCR Polymerase chain reaction PDGF Platelet-derived growth factor PDK Ptdlns3,4,5P 3-dependent protein kinase PECAM-1 Platelet endothelial cell adhesion molecule-1 PH Pleckstrin homology xiii PI Propidium iodide PI3-K Phosphatidylinositol 3'-kinase PIAS1 Protein inhibitor of activated STAT1 pITAM Tyrosine phosphorylated ITAM pITIM Tyrosine phosphorylated ITIM PK Protein kinase PLC Phospholipase C PRL Prolactin pSer Phosphoserine ptase Phosphophatase PTB Phosphotyrosine-binding Ptdlns Phosphatidylinositol , pThr Phosphothreonine PTK Protein tyrosine kinase pTyr Phosphotyrosine RTK Receptor tyrosine kinase SCF Stem cell factor SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis Ser Serine SH Src homology She Src homology and collagen SHIP SH2-containing inositol 5'-phosphatase xiv SHP SH2-containing protein tyrosine phosphatase Sos Son of sevenless STAT Signal transducer and activator of transcription Syk Spleen tyrosine kinase TCL Total cell lystate TCR T cell receptor Thr Threonine TX-100 Triton X-100 Tyr Tyrosine UTR Untranslated region Xid X-linked immunodeficiency XLA X-linked agammaglobulinemia X V C O N T R I B U T I O N S ' O T H E R S I would like to acknowledge the efforts of others that were instrumental in providing either reagents or data that were vital to the completion of this thesis. In particular, I would like to acknowledge the contributions of Dr. Jacqueline Damen with whom I divided the work presented in Chapter 6 equally, from retroviral construct generation to immunoprecipitation and immunoblot studies. In particular I would like to single out her work in measuring the phospholipid levels of the different cells tested, which was vital to the studies presented in Chapter 6. I would also like to recognize Michael Hughes generating the data presented in Figure 5.3, Patricia Rosten for generating the data in Figure 3.1, and Dr. Barbara Beatty at the FISH Mapping Resource Center (Hospital for Sick Children, Toronto, ONT) for performing the FISH analysis shown in Figure 3.8. xvi A C K N O W L E D G M E N T S I wish to acknowledge the contributions of those without whom this thesis would not have been possible. First and foremost, I want to thank my family for all of the love and support they have shown me through the good times and the bad. To my mother and father, my brother Todd, Don, Georgian, Bill, Karina, Gary, and everyone else, you all made many sacrifices through the years, to make my pursuit of this Doctoral degree a reality, and for that I am forever grateful. I only hope I can make you proud in all of my future endeavors. Special thanks goes to my brother to whom I owe much gratitude for showing me what true courage is in the face of adversity, and helping me to put my worries into perspective. To my colleagues, Jackie, Mike H., Ling, Janet, Rob, Vivian, Mike R, Cristina, Paul, and Laurie, you made an unbearable situation bearable and offered me more help and encouragement than I ever deserved. If it were not for all of your efforts, completion of this thesis would have been impossible. To my friends, I owe both an apology and my many thanks. Darren, Darcy, Barry, Rob, Lori, Ian, Mike, Lana, Carla, Doug, and Craig, you all showed great patience with me over the years, forgiving the many last minute cancellations or no-shows because I had to work. You all stuck by me and kept inviting me out, and for that I owe you my sanity and undying appreciation. You guys are the best. I also wish to thank the members of my supervisory committee for the many useful discussions and guidance over the years. And finally I would like to acknowledge my supervisor for teaching me many valuable lessons throughout my time in his lab. Some supervisors challenge their students with projects that will enable them to grow as both scientists and people, while others become the challenge themselves. xvii Chapter 1 INTRODUCTION 1.1 EVOLUTION OF SIGNAL TRANSDUCTION PATHWAYS The first signs of life began to emerge on our planet over 3.5 billion years ago, seeded either by organic compounds from extra-terrestrial sources or by de novo abiotic synthesis perhaps around deep-sea vents or the action of lightening in a strongly reducing, young atmosphere (Orgel, 1998). These early events laid the foundation for the self-organization and replication of early life forms much like those of modern blue-green algae. Over the next 3 billion years, the atmosphere accumulated oxygen until the early Cambrian period when the now oxygen laden air was capable of supporting the development of the first multicellular organisms. These ancient multicellular life forms gained many advantages over their solitary, unicellular cousins, allowing them to exploit previously impractical niches in the ecosphere. Individual cells, now freed of the need to produce or gather their own nutrients, differentiated to carry out specialized roles in the organism, eventually leading to the evolution of wings, leaves, eyes, and a myriad of other organs and tissues too numerous to mention. However, with this newly found complexity came new problems. These specialized cells now had to coordinate their actions for the good of the organism as a whole. This required the development of a system of regulation and communication between both neighbouring cells as well as cells separated over vast distances. Nature overcame this obstacle by evolving an intricate system of protein-protein interactions, post-translational modifications, and chemical first and second-messengers that can transduce signals over great distances, across membrane barriers, and even from one organism to another. This process is commonly known as signal transduction. 1 1.2 RECEPTORS FOR FIRST-MESSENGERS In mammals, receptors come in all variety of forms from steroid hormone receptors like the estrogen receptor, to ion-gated neurotransmitter receptors like the nicotinic acetylcholine receptor, to G protein-coupled, serpentine receptors like the (3-adrenergic receptor, to protein-tyrosine kinase- (PTK) containing receptors like the platelet-derived growth factor (PDGF) receptor or PTK-associated cytokine' and immunoreceptors. While these receptors vary greatly in structure and function, they all share a common characteristic. For a peptide or chemical first-messenger to transmit its signal, it must interact with its defined protein receptor and this receptor must then undergo some degree of dynamic change in order to propagate the signal. What form this change takes varies greatly from receptor to receptor. In the case of the acetylcholine receptor, ligand binding induced a structural change in the transmembrane subunits that allows the formation of ion channels that facilitate the influx and efflux of cations (Kotzyba-Hibert et al., 1999). The estrogen receptor exerts its action on cells by acting as a transcription factor upon estrogen binding. The interaction of estrogen with its receptor leads to direct interactions with nuclear transcription machinery, causing the activation or repression of target genes (Muramatsu and Inoue, 2000). Unlike steroid and ion-gated receptors that function directly to exert their effects, G protein-coupled receptors, growth factor receptors and other plasma membrane spanning receptors such as cytokine receptors and immunoreceptors function indirectly via the activation of diverse intracellular signalling pathways. Over one thousand G protein-coupled receptors have been identified that are activated by such diverse agonists as photons, proteases, and peptide hormones. Yet, despite their varied ligand specificities the vast majority of seven-spanner receptors transduce their signals through alpha beta gamma-trimeric G proteins (Ji et al., 1998). Heterotrimeric G proteins remain associated with the cytoplasmic tail of unstimulated sepentine receptors as an inactive, GDP-bound, trimeric complex. Ligand binding induces allosteric changes in the receptor, causing the Ga subunit to decrease its affinity for GDP, which is replaced by GTP . The GTP-bound Ga then takes on its active conformation and dissociates from the G(3y heterodimer, allowing the Ga and By subunits to activate their respective downstream targets. 2 Signalling is terminated when G a and py reunite following G T P hydrolysis by the intrinsic GTPase activity of the G a subunit (Hamm and Gilchrist, 1996; Neer, 1995). While the majority of G protein-coupled receptor signalling is through G protein regulated pathways such as adenylyl cyclase, phospholipase C(3 (PLC(3), and ion channels, several other signalling molecules, including janus kinase (Jak) 2, phospholipase C (PLC) y, calmodulin, and protein kinase C (PKC) are also involved. Many of the accessory signalling molecules used by G protein coupled receptors are also associated with a class of transmembrane, cell-surface receptors that are dependent on tyrosine kinases for the initiation and propagation of their signals. 1.2.1 Protein-Tyrosine Kinase Regulated Receptors Protein tyrosine kinase regulated receptors can be subdivided into three major types: growth factor receptors, cytokine receptors, and immunoreceptors. All of these receptors are targets for extracellular peptide ligands that commonly induce the oligomerization of receptor chains, leading to the activation of enzymes known as protein-tyrosine kinases. On the one hand, growth factor receptors differ from the other two classes because they possess a PTK domain within the sequence of their cytoplasmic tail. Cytokine and immunoreceptors, on the other hand, rely on independent PTKs to associate with the cytoplasmic tail of the receptor subunits. 1.2.2 Stem Cell Factor Receptor, c-Kit The stem cell factor receptor, or c-Kit, belongs to the type III receptor tyrosine kinase (RTK) family, along with the receptors for PDGF, Flk-2/Flt3, and colony stimulating factor (CSF)-1 (Ullrich and Schlessinger, 1990). Members of this family are characterized by five extracellular immunoglobin (Ig)-like motifs, that regulate ligand binding and dimerization, and a cytoplasmic tyrosine kinase domain divided by a short insert that separates the ATP binding pocket and phosphotransferase regions (Heldin, 1996) (Figure 1.1). Stem cell factor (SCF) is expressed as both a soluble and membrane bound non-covalently linked dimer that induces homodimerization of c-Kit upon binding (Lev et al., 1992). Clustering of c-Kit allows the PTK domains to intermolecularly "autophosphorylate" the receptor chains, creating docking sites for phosphotyrosine binding proteins (Blume-3 Jensen et al., 1991; Lev et al., 1992). In addition to its intrinsic catalytic activity, c-Kit also associates with and activates members of the Src kinase family that mediate the tyrosine phosphorylation of several receptor-associated proteins (Lennartsson et al., 1999; Timokhina etal. , 1998). Kit is widely expressed on cells of hematopoietic origin, as well as neurons and spermatogonia, and it is well established as a critical regulator for the proper development of erythroid and myeloid lineages (Broudy, 1997). Of particular interest in the context of this thesis is the role of c-Kit in the development and functioning of mast cells. Mice containing detrimental mutations in the S C F (Sl/Sf) or c-Kit (WAAf) genes exhibit less that 1% of normal tissue mast cell levels despite the presence of normal numbers of primitive progenitors in the bone marrow (Kitamura and Go, 1979; Kitamura et al., 1978), indicating a crucial role for SCF/c-Kit in mast cell maturation, survival, and proliferation. Moreover, SCF/c-Kit regulate mast cell adhesion, chemotaxis, and in some instances secretory granule release (Broudy, 1997). 1.2.3 lnterleukin-3 Receptor The interleukin-3 receptor (IL-3R) is a member of the cytokine receptor family (a.k.a. hematopoietic receptor superfamily) that includes the closely related IL-5 and granulocyte-macrophage colony stimulating factor (GM-CSF) receptors, as well as the erythropoietin (Epo), growth hormone (GH), prolactin (PRL), IL-2, and IL-6 receptors, to name just a few. This family is characterized by membrane spanning, glycoprotein chains with four conserved cysteine residues and a W S X W S (single amino acid code) motif in their extracellular region (Ihle et al., 1994) (Figure 1.1). These receptors function by oligomerizing into clusters of two to four receptor chains that may be the same or different, in much the same manner as the aforementioned RTKs. However, unlike their RTK counterparts, hematopoietic receptors lack any catalytic activity of their own. Instead, they rely upon intracellular PTKs, such as those of the Jak and Src kinase families, to mediate the tyrosine phosphorylation of the receptors themselves and the intracellular proteins they attract (Rao and Mufson, 1995; Torigoe et al., 1992). 4 Figure 1.1 Protein-Tyrosine Kinase Regulated Receptors. Pictured are members of the three major classes of receptors whose signalling is regulated by tyrosine PTKs domains (black boxes) in their extracellular regions, [ie. a WSXWS (single letter amino acid code) motif (thick black bar) and four conserved cysteines (thin black bars)] and in the intracellular region of the IL-3R p chain [ie. conserved box 1 and box 2 domains (gray boxes), involved in recruiting Jak family PTKs]. The extracellular portion of c-Kit consists of five Ig-like motifs (loops) involved in ligand binding and receptor homodimerization. The protein-tyrosine kinase domain in the intracellular region of c-Kit (black boxes) is divided into the ATP binding region (membrane proximal) and phosphotransferase region (membrane distal) by a kinase insert sequence. The BCR consists of a membrane-bound Ig (mlg) and two Iga/p heterodimers, which possess ITAM sequences (gray boxes) vital to mediating intracellular signalling events. Variable (V) and constant (C) regions of the mlg are indicated, as are positions of covalent disulfide bonds (SS). 5 Cd 3 G 13 .2 o bo Cd (U w C Cd cd % a o s Oh O c o • 1—I 6 While some type I cytokine receptors homodimerize, (eg. EpoR, GHR, PRLR), or heterotrimerize [eg. IL-2R, leukemia inhibitory factor (LIF) receptor], the IL-3R utilizes two separate polypeptide chains to form a functional receptor complex (Bagley et al., 1997) (Figure 1.1). The smaller a subunit is unique to the IL-3R while the larger p subunit, p-common (pc), is shared with the a chains of the IL-5 and G M - C S F receptors [note: in mice there also exists a distinct p subunit (PiL_3) used exclusively by the IL-3R] (Bagley et al., 1997; Moutoussamy et al., 1998). The a subunit confers ligand specificity (although both subunits participate in high affinity binding of IL-3), while the p subunit is credited with orchestrating the majority of intracellular signalling via the phosphorylation of numerous tyrosines within its cytoplasmic tail by Jak family PTKs, recruited to the receptor's box 1/box 2 domains (Bagley et al., 1997). Surprisingly, despite the lack of any discernable signalling motifs within its short intracellular tail, the a subunit appears crucial to elicit complete IL-3R signalling (Orban et al., 1999). IL-3 has long been known as a potent effector of proliferation and differentiation in early hematopoietic progenitors in vitro (Suda et al., 1986; Suda et al., 1985). However, recent evidence from mice deficient in IL-3 and/or pc receptor points to a much different role in vivo. Characterization of IL-3"'" mice (Mach et al., 1998), as well as IL-3"'vpc receptor "'" double knock-out mice (Nishinakamura et al., 1996), revealed normal hematopoietic development, indicating a dispensable role for IL-3 signalling in hematopoiesis in vivo. These and other studies have instead revealed that IL-3 and its receptor may be more important in processes such as immune responses. In this regard, a recent study determined that IL-3 signalling is critical for both the development of tissue mast cells and peripheral blood basophils as well as their proper functioning in response to parasitic infection (Lantz et al., 1998). Furthermore, IL-3 appears to play a critical role in some forms of delayed-type hypersensitivity, such as contact hypersensitivity reactions (Mach et al., 1998). Further studies are needed to explore the full extent of IL-3 and the IL-3R's biological relevance, but since helper T cells are major producers of IL-3, it is perhaps not surprising that IL-3 signalling would be important in at least some immunological processes. 7 1.2.4 B cell Antigen Receptor The B cell antigen receptor (BCR) belongs to a class of multi-subunit cell surface receptors utilized by cells of the immune system, previously referred to as immunoreceptors. This class of receptors is comprised of the B and T cell antigen receptors, as well as receptors that bind the constant portion of circulating immunoglobins (eg. FceRI) (Cambier et al., 1994; Gold and Matsuuchi, 1995). The B C R complex contains a membrane-bound immunoglobin responsible for ligand binding and two Iga/lgB heterodimers that initiate intracellular signals via their immunoreceptor tyrosine-based activation motifs (ITAM) (Figure 1.1). As with the cytokine receptor family, B C R and other immunoreceptors contain no intrinsic kinase activity within the cytoplasmic tail of any of the constituent subunits and therefore must associate with intracellular PTKs to initiate signalling upon ligand engagement. Among the PTKs involved in B C R signalling are members of the Src family (Lyn in particular) and the Spleen tyrosine kinase (Syk)/ZAP-70 family (Cambier et al., 1994; Gold and Matsuuchi, 1995; Reth and Wienands, 1997). It is now well established that Lyn and other Src family kinases (Blk and Fyn) associate with the B C R (Yamamoto et al., 1993; Yamanashi et al., 1991) and are activated within seconds of antigen induced BCR cross-linking (Saouaf et al., 1994). In the classical model, activated Src PTKs are thought to initiate B C R signalling by phosphorylating tyrosines within the ITAMs of the Iga/lgB subunits (Burkhardt et al., 1991; Gaul et al., 2000). These newly created pTyr-docking sites then allow the association of Syk (Rowley et al., 1995) (and other signalling intermediates) with the receptor complex, subsequently leading to tyrosine phosphorylation by Src PTKs (Kurosaki et al., 1994). However, conflicting data from studies of Syk and Lyn/Blk deficient cells, has led Reth and Wienands (1997) to propose an alternate model of B C R activation. In this latter model, a hypothetical "transducer complex", possessing PTK or PTK modulating activity, is associated with the unphosphorylated ITAMs of the Iga/lgB heterodimers, serving to repress both ITAM phosphorylation and transducer activity. Upon antigen-induced oligomerization of the BCR, the transducer is released and activated, regulating the phosphorylation of ITAMs and associated downstream intermediates. This model is supported by several studies including the discovery that quiescent, preformed B C R 8 signalling complexes may exist (Wienands et al., 1996) and that IgM-BCR activation in B cells co-expressing IgM- and IgD-BCRs does not lead to phosphorylation of IgD-associated Iga/lgB dimers (Gold et al., 1991). Both of these results are in keeping with a transducer preventing signalling unless the receptor complex is directly engaged by antigen binding. The B C R plays different roles depending on the stage of B cell development. In Pre-B cells, B C R transmits a positive signal that enhances the survival and maturation of these cells in the bone marrow and stimulates the rearrangement of Ig light chains, while turning off the rearrangement of Ig heavy chains. In immature B cells, B C R activation constitutes a negative signal, triggering apoptosis in B cells expressing self-antigen recognizing BCRs . Finally, in mature B cells, presentation of antigen to the B C R by T cells again induces a positive signal, preparing cells for proliferation and antibody secretion (Gold and Matsuuchi, 1995). In mature B cells, BCR signalling can be suppressed by a feedback mechanism initiated by the presence of secreted antibody. Co-clustering of the immunoglobin Fey receptor (FcyR) Ilb1 and the BCR by an antibody/antigen complex leads to the attraction and activation of negative signalling proteins through their association with the phosphorylated FcyRl lb l immunoreceptor tyrosine-based inhibitory motifs (ITIM). FcyRl lb l co-engagement prevents several BCR induced events including extracellular C a + + entry, Ras pathway activation, and inositol (Ins) 1,4,5P3 production (Coggeshall, 1998). These events are likely controlled by the Src homology (SH) 2-containing protein-tyrosine phosphatase (SHP)- 1 and SHIP (Coggeshall, 1998; D'Ambrosio et al., 1995), both of which exhibit varying affinity for phosphorylated ITIMs (pITIM) (D'Ambrosio et al., 1996; D'Ambrosio et al., 1995; Famiglietti et al., 1999; Ono et al., 1996). On the one hand, reports indicate SHP-1 dephosphorylates Iga/lgB and several other BCR-associated proteins to terminate B C R signals (Pani et al., 1995; D'Ambrosio et al., 1995), while other evidence brings into question the overall importance of SHP-1 in FcyRl lb l induced signalling (Nadler et al., 1997; Ono et al., 1997). On the other hand, many studies have demonstrated the importance of SHIP in the negative regulation of signals emanating from 9 the B C R (Nadler et al., 1997; Nakamura et al., 2000; Ono et al., 1997; Tamir et al., 2000). The role of SHIP in BCR/FcvRllb1 will be discussed in more detail in Section 1.10. 1.3 KINASES Kinases are specialized enzymes that catalyze the transfer of the y-phosphate of a nucleotide triphosphate (usually ATP) to targeted substrates (Figure 1.2). Common substrates for kinases involved in signal transduction include the amino acids serine, threonine, and tyrosine and membrane lipids such as phosphatidylinositol (Figure 1.3). These kinase substrates all possess easily accessible hydroxyl groups that become acceptor sites for the reversible transfer of a phosphate group (Figure 1.2). Protein kinase (PK) genes have been found in the genomes of viruses, eukaryotes, and many prokaryotes. Typically the catalytic domains of PKs are composed of eleven conserved subdomains, interupted by regions of low sequence homology, which together are responsible for substrate specificity and enzymatic activity (Hanks et al., 1988). PKs are involved in every aspect of cellular functioning, from metabolism to cell division so it is not surprising that the regulation of protein kinase activity is crucial for proper cellular operation. To fill this role, a wide assortment of control mechanisms has evolved, as diverse in form as the kinases they regulate. Some of the most common mechanisms include control via association with second-messengers or regulatory subunits/domains, control by subcellular localization, and control by phosphorylation/dephosphorylation (Johnson et al., 1996). The addition of phosphate groups to most kinases has the ability to affect their catalytic activity in both a positive and negative fashion. For example, most PKs often increase their own catalytic activity by autophosphorylation of residues found in the "activation loop" of their kinase domains (Johnson et al., 1996). However, phosphorylation of a single tyrosine residue at the C-terminus of Src family kinases maintains Src PTKs in an inactive conformation by facilitating an intramolecular interaction with their SH2 domains (Thomas and Brugge, 1997). 10 Adenosine i 1 Adenosine Triphosphate (ATP) ATP+ M g + + ADP + H 2 0 Pi H 2 0 Figure 1.2 Structure of adenosine triphosphate and a schematic of kinase/phosphatase reactions. Top panel shows the structure of adenosine triphosphate (ATP). Location of the a, p, and y phosphate groups in relation to the adenosine backbone is indicated. The lower panel presents a simplified kinase/phosphatase reaction. The gray box represents the target molecule. Arrows indicate the direction of the reaction. Additional inputs and byproducts for each reaction are also described. 1.3.1 Protein-Tyrosine Kinases Only 20 years have passed since the discovery of a protein-tyrosine kinase (PTK) activity associated with polyomavirus (Eckhart et al., 1979; Hunter and Sefton, 1980). Since then, it has taken center stage in the process of transmembrane receptor signal transduction. Phosphorylation on tyrosine residues comprises only about one tenth of one percent of the overall protein phosphorylation in most normal eukaryotic cells (Alberts, 11 1994), but this post-translational modification serves some vital signalling functions. Tyrosine phosphorylation has been shown to facilitate the formation of transient protein-protein complexes by providing docking sites for pTyr-binding modules found in many cytoplasmic signalling intermediates. Tyrosine Serine Threonine H H H • H N - C - C O - - H N - C - C O - - H N - C - C O I I I C H 2 C H 2 H C - O H OH C H , 0 OH Phosphatidylinositol 1,2-Diacylglycerol 1 1 Phosphate I n o s i t o l Figure 1.3 Structure of protein kinase targets and phosphatidylinositol. The top panel shows the structure of the amino acids serine, threonine, and tyrosine. Note the position of the hydroxyl groups, capable of receiving the y phosphate group from ATP in a protein kinase catalyzed reaction. The lower panel depicts the structure of the phospholipid phosphatidylinositol. Each hydroxyl group of the inositol ring is numbered to indicate the position of phosphate groups when added by specific phosphatidylinositol kinases (ie. phosphatidylinositol with phosphate groups at positions 4 and 5 of the inositol ring is named phosphatidylinositol 4,5P 2, or Ptdlns4,5P2 for short). The positions of the sterate (R-i) and arachidonate (R2) lipid side-chains of the diacylglycerol group are indicated. 12 Hematopoietic cells utilize several groups of non-receptor PTKs in transmembrane receptor signalling networks. These include the Tec, Fes, Abl, Syk, Jak, and Src kinase families (Bolen and Brugge, 1997). Not surprisingly, most of these PTK families are characterized by the presence of protein signalling modules, including SH2, SH3, and pleckstrin homology (PH) domains, which enable these kinases to interact with specific proteins or lipids and thereby regulate their localization and activity. Therefore, transmembrane receptors can utilize specific signalling pathways by binding and activating some or all of these intracellular PTKs. For instance, Jak family kinases are activated by members of every class of cytokine receptor and are responsible for the activation of a unique family of transcription factors termed signal transducers and activators of transcription (STAT) (Liu et al., 1998b). All members of the STAT family possess SH2 domains that are used both to associate with membrane receptors and to form activated homo or heterodimers, which relocate to the nucleus to bind interferon (INF) y-stimulated response elements (ISRE) and INFy-activated sequences (GAS) (Ihle et al., 1998; Liu et al., 1998b). Dimerization/activation of STATs is dependent on tyrosine phosphorylation of a single tyrosine residue on the STAT monomers by Jak kinases and this in turn is regulated by the pTyr residues present on the cytokine receptor that allow STATs to dock in close proximity to Jak kinases. Because STAT dimers exhibit distinct DNA binding affinity (Darnell, 1997) and not all cytokine receptors associate with the same Jak kinases or STATs (Liu et al., 1998b), this allows each type of receptor to regulate the transcription of a very select set of genes. 1.3.2 Src Family Kinases Another PTK family that plays a central role in receptor signalling pathways is the Src family. Members of this widely expressed, non-receptor tyrosine kinase family are activated by growth factors, antigens, cytokines, G protein-coupled receptors, and extracellular matrix components (Bolen and Brugge, 1997; Thomas and Brugge, 1997). In mammals, the Src family is comprised of eight members that share a common structure and whose functions are believed to overlap significantly. Src, Fyn, and Yes are ubiquitously expressed, while Lyn, Blk, Hck, Fgr, and Lck are expressed primarily in the hematopoietic system (Bolen and Brugge, 1997). All members of the Src family with the 13 exception of Src and Yes have been shown to participate in hematopoietic signalling events (Bolen and Brugge, 1997). Src PTKs are unique from other non-receptor PTKs because they are tethered to the inner surface of the plasma membrane by myristate (and often palmitate) modifications attached to their amino terminal, SH4 domain (Thomas and Brugge, 1997). Until activated by extracellular stimuli, they remain in an inactive conformation maintained by a bipartite, intramolecular interaction involving both their SH2 and SH3 domains. The SH2 domain binds to a C-terminal Src kinase (Csk)- mediated pTyr residue contained in the C-terminal tail, while the SH3 domain associates with a linker sequence found between the kinase and SH2 domains (Pawson, 1997; Sicheri et al., 1997; Xu et al., 1997). Activation of Src-associated receptors triggers dephosphorylation of the negative regulatory pTyr, allowing Src kinases to unfold, expose their kinase domains, and tyrosine phosphorylate both receptors and downstream signalling intermediates (Thomas and Brugge, 1997). There is also evidence that proline-rich sequences alone can also disrupt the inactive conformation of Src PTKs, allowing signalling networks another mechanism for Src family activation (Sicheri et al., 1997; Xu et al., 1997). Src PTKs have been implicated in signal propagation from every major class of cell surface receptor and often they interact directly with these receptors to facilitate access to their substrates. For example, Lyn, Fyn, and Blk associate with the B C R complex (Yamamoto et al., 1993; Yamanashi et al., 1991), and Lyn has been shown to bind to and regulate signalling processes of both c-Kit (Lennartsson et al., 1999; Linnekin et al., 1997; Timokhina et al., 1998) and the IL-3R (Adachi et al., 1999; Rao and Mufson, 1995; Torigoe et al., 1992). 1.3.3 Phosphatidylinositol Kinases Phosphatidylinositols (Ptdlns) constitute only a very small proportion of the overall phospholipids contained within the inner leaflet of eukaryotic plasma membranes but they play an integral role in receptor signalling cascades. The inositol head of Ptdlns contains five free hydroxyl groups, capable of being phosphorylated by Ptdlns kinases while the D-1 hydroxyl group forms a phosphodiester bond with the glycerol portion of diacylglycerol (Figure 1.3). Interestingly, in mammals only the D-3, D-4, and D-5 positions of the inositol 14 Figure 1.4 Phosphoinosit ide synthesis pathways. Arrows pointing to the right of the page indicate kinase-regulated reactions and arrows pointing to the left indicate phosphatase-mediated reactions. The enzymes involved in the synthesis of each phosphoinositides are designated next to each arrow. The thicker the arrow, the more prevalent the reaction is in vivo (ie. 3-ptase reactions are not very common). The positions of the lipid side-chains are noted (Ri and R 2 ) . Dotted lines indicate possible reactions that have yet to be identified in vivo. 15 16 ring are phosphorylated in vivo leading to the formation of the eight known Ptdlns "species": Ptdlns, Ptdlns3P, Ptdlns4P, Ptdlns5P, Ptdlns4,5P2, Ptdlns3,4P2, Ptdlns3,5P2, and Ptdlns3,4,5P3 (Hinchliffe et al., 1998) (Figure 1.4). These phosphoinositides are created by the action of kinases and phosphatases, often by more than one pathway (Figure 1.4). A number of kinase families have evolved to phosphorylate the D-3, D-4, or D-5 positions of the inositol ring. Members of these families exhibit varying substrate specificity, with some acting only on Ptdlns (eg. class III PI3-K) while others are capable of phosphorylating multiple species (eg. class I PI3-K) (Tolias and Cantley, 1999). By changing the number and position of phosphate groups on the inositol head, phosphatidylinositides can affect various aspects of receptor signalling. For instance, several polyphosphate-phosphatidylinositides can selectively associate with lipid binding modules found in many cytoplasmic signalling intermediates, leading to the regulation of subcellular localization and enzymatic activity of these binding partners (see Section 1.6). Ptdlns can also be metabolized by phospholipases to remove the inositol ring from the diacylglycerol (DAG) backbone. An example of this is the production of the second messengers Ins1,4,5P 3 and DAG by the hydrolyzing action of the P L C family. 1.3.4 Phosphatidylinositol 3-Kinases The best-known family of Ptdlns kinases is the Ptdlns 3 kinases (PI3-K). This family is comprised of three classes (I, II, and III), differentiated by their structures, substrate specificities, and modes of regulation (Tolias and Cantley, 1999; Wymann and Pirola, 1998). Class I PI3-Ks are capable of phosphorylating Ptdlns, Ptdlns4P, and Ptdlns4,5P 2 in vitro, but appear to favor Ptdlns4,5P 2 as a substrate in vivo (Tolias and Cantley, 1999; Wymann and Pirola, 1998) (Figure 1.4). They are heterodimers with a 110 to 120-kDa catalytic subunit and a 50 to 100-kDa regulatory subunit responsible for binding other proteins to change PI3-K localization. All major types of cell surface receptors regulate their activity, and this has led to the subdivision of class I PI3-Ks into two subclasses. Class la members are the classic PI3-Ks activated by growth factor, cytokine, and immunoreceptors which utilize one of three regulatory subunits (p85a, p85B, and p55 P I K) capable of binding pTyr-containing receptors or signalling intermediates. 17 Class lb PI3-Ks are activated through the interaction of both the p101 regulatory subunit and the catalytic subunit with the free GBy subunit of heterotrimeric G proteins following serpentine receptor engagement (Tolias and Cantley, 1999; Wymann and Pirola, 1998). The catalytic subunits of class la (p110a, p110B, p1106) and lb (pHOy) share a similar structure, including a Ras-binding domain that interacts selectively with GTP-bound Ras. The p110y also contains a putative pleckstrin homology (PH) domain, two GBy binding sites, and homology to Ste5 binding modules, suggesting involvement of several pathways as either regulators or downstream targets of class lb PI3-Ks (Wymann and Pirola, 1998). The recruitment of PI3-Ks by activated receptors is critical for the proper control of numerous signalling networks. For instance, all class I PI3-Ks share the ability to interact directly with GTP-Ras , an interaction that appears to be crucial for the proper function of both Ras and PI3-K (Wymann and Pirola, 1998). Furthermore, the products of PI3-Ks, namely Ptdlns3P, Ptdlns3,4P 2, and Ptdlns3,4,5P 3, all exhibit specialized roles in controlling cellular functions. SH2 (Rameh et al., 1995), PH (Bottomley et al., 1998), and C2 domains (Katan and Allen, 1999) have all been demonstrated to have an affinity for Ptdlns3,4P 2 and/or Ptdlns3,4,5P 3, which can affect subcellular localization and/or enzymatic activity of proteins containing these domains (Toker and Cantley, 1997) (see Sections 1.6-1.7). Ptdlns3P has also been shown to be a target of F Y V E domains, often found in proteins involved in vesicle movement (Gaullier et al., 1999; Kutateladze et al., 1999). The two remaining classes of PI3-Ks differ substantially from their class I counterpart. Class II PI3-Ks range between 170 to 210-kDa in size and contain both catalytic and potential regulatory motifs within a single polypeptide chain. Included in their structure is a Ca + +-insensitive C2 domain that exhibits weak affinity for phospholipids (MacDougall et al., 1995) and some members contain proline-rich motifs with the potential to interact with SH3 domains (Wymann and Pirola, 1998). Although these structural features offer some probable modes of regulation, little is known about the functioning or activation of class II PI3-Ks. Even their in vivo substrates remain undefined, although they do show a preference for Ptdlns and Ptdlns4P in vitro, signifying a role in the production of 18 both Ptdlns3P and Ptdlns3,4P 2 (Figure 1.4). Class III PI3-Ks have the unique distinction among PI3-Ks of only phosphorylating Ptdlns (Tolias and Cantley, 1999). They are the only class of PI3-Ks found in yeast, where they are integral to vacuole sorting processes (Stack and Emr, 1994; Stack et al., 1993), a role they likely maintain in higher eukaryotes (see above). 1.4 PHOSPHATASES The addition of phosphate groups is a reversible process via hydrolysis with the assistance of proteins containing phosphatase domains (Figure 1.2). Often phosphatases are considered negative signalling components, turning off signals "switched on" by phospholipid and protein kinases. However, this characterization is a gross over-simplification and the ultimate function of phosphatases is likely to be much more complex. Protein phosphatases are divided into two major classes based on substrate specificity, much the same as their kinase counterparts: those that dephosphorylate phosphotyrosines (pTyr), and those that recognize phosphoserines and phosphothreonines as substrates. The protein-tyrosine phosphatases SHP-1 and SHP-2 , both associate directly with many cell surface receptors and feature prominently in the regulation of receptor-initiated signals in hematopoietic cells. However, although these two phosphatases are closely related, they appear to play very different roles. SHP-1 directly associates with many receptors, including inhibitory receptors, and exerts predominantly negative effects by dephosphorylating receptors, kinases, and other downstream signalling intermediates, leading to a down-regulation of these signals (Unkeless and Jin, 1997). SHP-2 also associates with a wide variety of cell surface receptors, but unlike SHP-1 , it appears, for the most part, to positively impact the strength of their signals (Feng, 1999). Similar to their protein counterparts, Ptdlns phosphatases are the antithesis of Ptdlns kinases. They can be divided into several classes comprised of members that specifically remove the phosphate groups from the D-3, D-4, or D-5 position of the inositol head (see Figure 1.3). Many Ptdlns phosphatases, such as SHIP or P T E N , exhibit very explicit substrate specificity, while others dephosphorylate a broader range of substrates. 19 SHIP and other D-5 specific Ptdlns phosphatase will be discussed in more detail in Section 1.7. 1.4.1 PTEN The tumor suppressor PTEN is deleted or functionally compromised in a variety of tumor-derived cell lines and primary tumor samples (Li et al., 1997a; Steck et al., 1997). P T E N contains a large phosphatase domain, capable of dephosphorylating proteins (e.g. focal adhesion kinase) (Tamura et al., 1998) and phosphatidylinositides phosphorylated at the D-3 position (eg. Ptdlns3,4,5P 3) (Maehama and Dixon, 1998) (Figure 1.4). Subsequent studies have detected elevated Ptdlns3,4,5P 3 levels in fibroblasts from PTEN" mice (Stambolic et al., 1998; Sun et al., 1999) and decreased insulin-induced Ptdlns3,4,5P 3 levels in 293 cells over-expressing PTEN (Maehama and Dixon, 1998), indicating that PTEN is a major antagonist of PI3-K. The regulation of PTEN activity remains largely unknown, but recent structural analysis has identified a C2 domain within PTEN that is capable of binding phospholipids in vitro (Lee et al., 1999). This finding could indicate that P T E N activity is controlled by C2-mediated membrane localization. Interestingly, this C2 domain is missing residues critical for Ca + +-binding in the closely related C2 domains of PLCS, PKC5 , and phospholipase A2. Therefore, it is unlikely that C a + + levels are involved in the regulation of membrane binding by PTEN. The negative regulation of Ptdlns3,4,5P 3 levels in vivo appears to be a key proper function of PTEN. The importance of this role is highlighted by the characterization of several P T E N mutants obtained from tumor and Cowden's disease-derived cells that exhibit a loss of Ptdlns phosphatase activity while retaining their tyrosine/serine/threonine phosphatase capability (Furnari et al., 1998; Myers et al., 1998; Ramaswamy et al., 1999). Subsequent studies have linked P T E N to the down-regulation of PKB/Akt activity, leading to inhibition of cell cycle progression and induction of apoptosis (Vazquez and Sellers, 2000). 20 1.5 PROTEIN-PROTEIN INTERACTIONS The ability of proteins to interact with other proteins is one of the cornerstones of signal transduction. Like a baton in a relay race, signalling proteins must pass their signal from one molecule to another in order for the message to bridge the gap between the membrane and the signal's ultimate destination. This is accomplished either by moving to the site of their downstream target or by attracting the target to them. To facilitate the association of proteins with one another, an ample array of specialized protein domains have evolved. These domains constitute self-contained modules that can often function independently of their resident proteins. They generally range from 40-150 amino acids in length and form intricately folded, globular structures with one or more pockets that often contain invariant surface residues involved in ligand recognition and adhesion (Sudol, 1998). These modules can be subdivided into two major classes; those that interact with phosphorylated residues and those that bind independent of phosphorylation. While there are many more phosphorylation independent domains, the phosphorylation dependent domains are responsible for many aspects of specificity in transmembrane receptor signalling. 1.5.1 Phosphorylation-Dependent Protein-Binding Modules The reversible phosphorylation of tyrosine residues is arguably the most important tool utilized by signalling networks to facilitate transient protein-protein complexes. Perhaps the most widely utilized pTyr-binding protein module is the SH2 domain. These domains are -100 amino acid regions that form two binding pockets, which allow SH2 domains to interact with pTyr peptides in a bipartite fashion. A conserved pocket containing several basic residues, including an invariant arginine, forms hydrogen bonds with the phosphate group, while a second pocket, whose sequence is highly variable, is responsible for the recognition of one or more residues C-terminal to the pTyr (Pawson, 1995). This dual interaction enables SH2 domains to exhibit a high degree of specificity, thereby permitting receptors to activate some downstream signalling pathways but not others, depending on the tyrosine-containing motifs present in their cytoplasmic tails. SH2 domains are found in proteins involved in such diverse processes as lipid metabolism, phosphorylation/dephosphorylation (both lipid and protein), nucleotide exchange, 21 transcriptional regulation, and cytoskeletal rearrangement (Pawson and Scott, 1997; Sudol, 1998). In addition to the SH2 domain, there exists a second pTyr-binding module, the phosphotyrosine-binding (PTB) domain. The first PTB domain was identified in the adaptor molecule She by its ability to bind to receptor PTKs via a region distinct from its SH2 domain (Blaikie et al., 1994; Kavanaugh and Williams, 1994). Although SH2 and PTB domains both bind pTyr, PTB domains possess a distinct 3-dimensional structure, similar to that of the phospholipid-binding PH domain (discussed in more detail below). This alternate configuration of the PTB domain confers a binding specificity that is distinct from SH2 domains. PTB domains recognize up to four residues N-terminal to the pTyr, namely the core sequence NPxpY (Forman-Kay and Pawson, 1999). However, with the discovery and characterization of more PTB domains it has been found that some PTB domains can bind non-phosphorylated motifs with high affinity. Furthermore, some of these peptide targets lack tyrosines and/or the core NPxY altogether, indicating perhaps that PTB domains should be classified as general protein binding modules (Forman-Kay and Pawson, 1999). As an interesting aside, some SH2 domains have also been shown to interact with non-pTyr containing sequences (Morrione et al., 1999; Poy et al., 1999; Sayos etal. , 1998). While pTyr-binding modules are the best understood phosphopeptide-binding modules, they are by no means the only ones. In recent years, several modules capable of associating with specific phosphoserine- (pSer) containing motifs have been characterized. Much like pTyr modifications, phosphorylation on serine residues was initially thought to function as a means of regulating the catalytic activity of enzymes through the induction of allosteric changes. However, now it appears that pSer, and possibly phosphothreonine (pThr), may in fact mirror pTyr in their ability to direct protein-protein complex assembly. The first bona fide pSer-dependent binding domains were identified in the 14-3-3 protein family while studying the association of 14-3-3s with the protein-serine/threonine kinase Raf-1 (Muslin et al., 1996). Since then two other legitimate pSer-binding domains have also been discovered: the WD40 domain of F-box proteins 22 (Barinaga, 1999), and the W W domains of the enzymes Pin1 and Nedd4 (Lu et al., 1999). It has since been suggested that WD40 domains play a central role in capturing pSer/pThr-containing proteins for degradation by the cells ubiquitin machinery (Barinaga, 1999), while the importance of pSer-binding by W W domains is less clear. To date, only two W W domains have been revealed to exhibit pSer/pThr specificity, with the vast majority preferring proline-rich sequences (Sudol, 1998). 1.5.2 Phosphorylation-lndependent Protein-Binding Modules Although phosphorylation-dependent binding modules garner most of the attention in receptor signalling networks, phosphate-independent binding domains also play an indispensable role. In fact, these phosphorylation-independent protein-binding domains are often found in combination with phosphorylation-dependent modules in all variety of signalling proteins. A growing family of protein modules is being identified that prefer sequences rich in proline residues. This family includes SH3, WW, and EVH1 domains, as well as a region found in the cytoskeletal component profilin (Sudol, 1998). Other phosphorylation independent modules include PDZ and EH domains, which recognize C-terminal hydrophobic residues (eg. valine) and NPF-containing sequences, respectively (Pawson and Scott, 1997; Sudol, 1998) and leucine zippers which have the ability to interdigitate with one another, forming a stable coiled-coil. SH3 domains are often found in combination with SH2 domains as in Src PTKs, PLCy, Abl, PI3-K, growth factor receptor binding protein (Grb) 2, Nek, and Crk, where they are wholly, or in part, responsible for the regulation of protein localization, enzyme activity, and the formation of large signalling complexes (Mayer and Eck, 1995; Pawson, 1995). All SH3 binding sites contain the sequence PxxP at their core, which form a left-handed, type II polyproline helix with three residues per turn and a positively charged residue at either the N or C-terminus of the motif (Mayer and Eck, 1995). SH3 ligands are typically classified by the primary sequence of their core structure (ie. R/KxxPxxP = class I and PxxPxR /K = class II), which because of their pseudo-symmetry, can interact with the ligand pockets of SH3 domains in either an amino to carboxy (class I) or a carboxy to amino (class II) orientation (Feng et al., 1994). Several studies have shown that SH3 23 domains exhibit unique preferences in binding partners, recognizing specific residues both within (Alexandropoulos et al., 1995; Feng et al., 1994; Weng et al., 1995) and upwards of 10 or more amino acids on either side of the core sequence (Rickles et al., 1995). This specificity is related to the overall structure of the individual SH3 domains. Each SH3 domain is comprised of three shallow binding pockets, two of which interact with each of the core prolines and their accompanying hydrophobic residues, while the third is responsible for recognizing amino acids either N-terminally (class I) or C-terminally (class II) of the positively charged residue (Kay et al., 2000). 1.6 PROTEIN-LIPID INTERACTIONS Lipids serve two major roles from a signal transduction perspective; they act as second messengers to affect the catalytic activity of enzymes, and they act as docking sites in the various lipid bilayers to allow proteins to localize to specific membrane regions. Both of these processes require proteins to contain specialized lipid-binding domains. The P K C family of serine/threonine kinases is a perfect example of both of these processes. Some members of the P K C family contain tandem cysteine-rich repeats responsible for binding the PLCy product, 1,2-diacylglcerol (DAG). In both conventional and novel P K C s , this serves the dual purpose of both increasing catalytic activity (Jaken, 1996) and localizing the enzymes to cellular membranes (Feng and Hannun, 1998; Pettitt and Wakelam, 1999; Vallentin et al., 2000). In addition, DAG binding enhances the ability of some P K C members to bind phosphatidylserine via binding sites found at the N-terminus of P K C s (Jaken, 1996). Even the Ca + +-binding C2 domain present in P K C s and several other proteins appears to encourage membrane association (Katan and Allen, 1999). The C2 domains of synaptotagmin and PTEN, for instance, bind phosphatidylcholine with and without C a + + , respectively (Davletov and Sudhof, 1993; Lee et al., 1999), and more recently, it was demonstrated that synaptotagmin exhibits Ca + +-dependent affinity for phosphatidylinositides and other negatively charged phospholipids (Fukuda et al., 1996b; Schiavo et al., 1996). Both novel and atypical P K C s also associate with Ptdlns3,4P 2 and Ptdlns3,4,5P 3 in vitro, indicating a role for Ptdlns binding in both activation and relocalization of these P K C family members (Nakanishi et al., 1993; Toker et al., 1994). 24 This interaction is presumably facilitated, at least in part, by C2 domains. In recent years, a novel Ptdlns binding domain with structural similarity to the C1 domain of P K C has also emerged. This module, known as the F Y V E domain, selectively recognizes Ptdlns3P and is implicated in vesicle trafficking and many other cellular functions (Fruman et al., 1999). PH domains are the best characterized lipid-binding modules used by intracellular proteins. Since their initial identification in pjatelet and Jeukocyte C kinase substrate protein (pleckstrin), PH domains have been identified in over one hundred different eukaryotic proteins but have not yet been found in plants or bacteria (Bottomley et al., 1998). Analysis of these one hundred plus PH domains has revealed this family of protein modules is related more by structural similarity than sequence homology, and can claim PTB domains among its members. The target specificity of PH domains also varies greatly and is very hard to determine with any confidence in vitro. However, it appears that most preferentially interact with the phosphorylated inositol heads of Ptdlns4,5P 2, Ptdlns3,4P 2 and Ptdlns3,4,5P 3 (Bottomley et al., 1998; Hemmings, 1997). For this reason many people have dubbed PH domains as membrane adapters, attracting proteins to sites of high polyphosphorylated Ptdlns accumulation. These modules are found in many proteins known to transiently associate with cellular membranes during signalling, including PLCy, the p110y subunit of PI3-K, mSos, Btk, PKB/Akt, Ptdlns3,4,5P 3-dependent protein kinase- (PDK)-1, Vav, and the insulin receptor substrates (IRS)-1 and 2 (Bottomley et al., 1998; Pawson and Scott, 1997). Further evidence for PH domains acting as membrane adaptors comes from localization studies. The PH domains of general receptor for phosphoinositides (GRP)-1 (Gray et al., 1999; Langille et al., 1999), mSos (Chen et al., 1997), PLCy (Falasca et al., 1998), Btk (Varnai et al., 1999), and PKB/Akt (Gray et al., 1999) all localize to plasma membranes following PI3-K activation, as do full-length PKB/Akt (Astoul et al., 1999) and PDK-1 (Anderson et al., 1998), signifying an affinity for Ptdlns3,4,5P 3 and/or Ptdlns3,4P 2. The PH domain of PLC61, on the other hand, associates with membranes in quiescent and receptor activated cells (Paterson et al., 1995), in keeping with its high affinity and selectivity for Ptdlns4,5 2, as observed in vitro (Kavran et al., 1998). 25 However, PH domains do more than just regulate membrane localization. For instance, the catalytic activity of the guanine-nucleotide exchange factor Vav, is directly affected by Ptdlns4,5P 2 and Ptdlns3,4,5P 3 interactions with its PH domain (Han et al., 1998), as is the activity of PKB/Akt upon Ptdlns3,4P 2 binding (Franke et al., 1997; Klippel et al., 1997). In the case of PKB/Akt, it is believed that association with Ptdlns3,4P 2 induces conformational changes that increase its kinase activity. Some evidence also implicates PH domains in protein-protein interactions with GBy subunits of heterotrimeric G proteins (Katan and Allen, 1999; Razzini et al., 2000; Touhara et al., 1994; Wang et al., 2000). 1.7 INOSITOL POLYPHOSPHATE 5-PHOSPHATASES Inositol polyphosphate 5-phosphatases (5-ptases) are enzymes that remove phosphate groups from the D-5 position of both water-soluble inositol rings and membrane-incorporated polyphosphate Ptdlns (Figure 1.3) in a Mg + +-dependent manner (Majerus, 1996). All 5-ptases possess two highly conserved motifs consisting of the core sequences (F/l)WxGDxN(Y/F)R and (R/N)xP(S/A)W(C/T)DR(l/V)(l/L) (single amino acid code) separated by up to 100 amino acids (Majerus et al., 1999). 5-ptases are classified into four groups based on their substrate specificities. Each group will be discussed in more detail below with the exception of the poorly characterized Group IV. Recently a partial cDNA for a putative 5Ptase IV was identified, but little else is known about this 5-ptase that utilizes Ptdlns3,4,5P 3 as a substrate and associates with PI3-K (Jackson et al., 1995). 1.7.1 Group I Inositol Polyphosphate 5-Phosphatases Group I 5-ptases include the 43-kDa type I 5Ptases (5Ptase I) identified in platelets (Matzaris et al., 1998), brain, heart, and skeletal muscle (Hansbro et al., 1994; Laxminarayan et al., 1994) (Figure 1.5). They are anchored to membranes via farnesylation (De Smedt et al., 1996) and specifically hydrolyze inositol (Ins) 1,4,5P3 and lns1,3,4,5P 4 but not the corresponding phospholipids (Majerus et al., 1999) (Figure 1.6). Regulation of group I 5-ptases has not been extensively studied, with the exception of platelet 5Ptase I, where the association with pleckstrin (Auethavekiat et al., 1997) and 14-26 3-3£ (Campbell et al., 1997) were found to increase activity approximately 2- and 4-fold, respectively. Based on this substrate specificity it was initially suspected that group I 5-ptases played a role in restraining intracellular C a + + release via lns1,4,5P 3 receptor channels. This was later confirmed by studies that detected higher than normal levels of intracellular C a + + and Ins1,4,5P 3 levels in cells transfected with antisense 5Ptase I cDNA (Speed et al., 1996). Interestingly, the regulation of 5Ptase I by pleckstrin may signify a feedback loop mechanism for the regulation of PKCs , as pleckstrin must be serine/threonine phosphorylated by P K C in order to increase the Ins1,4,5P 3 hydrolysis by 5Ptase I (Auethavekiat et al., 1997). SHIP SHIP2 Synaptojanin 1 HE nsHif Synaptojanin 2 | OCRL-1 [ 5Ptase II C 5Ptase I Group III Group II Proline-rich (145-kDa) (150) (145 & 170) Stop (140) ] (105) ] (115 & 104) Group I Figure 1.5 Structures of known inositol polyphosphate 5-phosphatases. 5-ptases are divided into four groups based on substrate specificity. The Group IV 5-ptase is not included, as its cDNA has only partially been identified. The relative size and position of several important regions are indicated, including SH2 domains (light gray boxes), 5-ptase domains (dark gray boxes), and proline-rich regions (black boxes). The relative sizes of the major form(s) of each protein are designated in brackets. The position of a second stop site for Synaptojanin 1 is marked with an asterisk. Selective use of this stop site results in the 145-kDa, as opposed to the longer 170-kDa form of Synaptojanin 1. 27 1.7.2 Group II Inositol Polyphosphate 5-Phosphatases Group II 5-ptases are the most diverse class of 5-ptases, including type II 5Ptase (5Ptase II), OCRL-1 , and Synaptojanin 1 and 2, among its ranks (Figure 1.5). This group of 5-ptases is characterized by its ability to hydrolyze lns1,4,5P 3, lns1,3,4,5P 4, Ptdlns4,5P 2, and Ptdlns3,4,5P 3 to varying degrees in vitro (Majerus et al., 1999) (Figure 1.6). A common feature of members of this group is the existence of protein isoforms arising from the differential splicing of their mRNAs. For example, at least two 5Ptase II isoforms have been discovered in mouse brain and kidney cDNA libraries (Matzaris et al., 1998) and alternatively sliced variants of both Synaptojanin 1 and 2 have been observed (Seet et al., 1998; Woscholski et al., 1998). The existence of two 5Ptase II isoforms may indicate differential roles, as the 115-kDa form is localized to membranes (via C-terminal isoprenylation and N-terminal residues) while the 104-kDa form is predominantly cytosolic. Additionally, these isoforms are differentially expressed in mouse tissues. The 115-kDa form is the principal 5Ptase II in brain and skeletal muscle while the 104-kDa form is the major isoform in lung and testis (Matzaris et al., 1998). Messenger RNAs for both isoforms are expressed to equally high levels in liver and kidney (Matzaris et al., 1998). Taken together, it is possible that the larger 5Ptase II preferentially hydrolyzes D-5 phosphatidylinositides while the smaller isoform primarily dephosphorylates water-soluble inositol phosphates, and that the expression of one or both of these isoforms indicates differing needs for lipid or water-soluble inositide regulation in various tissues. 1.7.2.1 OCRL-1 OCLR-1 was initially identified as the product of a gene present in a region of the X-chromosome mapped to Lowe's oculocerebrorenal syndrome (Attree et al., 1992). This gene encoded a 105-kDa protein with significant homology to 5Ptase II, including the two motifs characteristic of 5-ptases (Figure 1.5). In humans, OCRL-1 exhibits a preference for Ptdlns4,5P 2, as demonstrated by the accumulation of this phosphatidylinositide in Lowe's syndrome-derived renal proximal tubule cells, despite the presence of at least four other 5-ptases in these cells (Zhang et al., 1998). Surprisingly, in mice, the activity of the 28 Group I Group II Group III Group IV 5Ptase I 5Ptase II SHIP 5Ptase I V O C R L - 1 SHIP 2 Insl,4,5P 3 Insl,3,4,5P4 PtdIns4,5P2 PtdIns3,4,5P3 Figure 1.6 Substrate specificity of inositol polyphosphate 5-phosphatases. Depicted are the four known substrates of the four groups of 5-ptases. Group I 5-ptases only recognize soluble polyphosphate inositides as substrates. Group II 5-ptases demonstrate the broadest specificity and are capable of removing the D-5 phosphate group from all four substrates depicted. Group III 5-ptases only recognize substrates phosphorylated at the D-3 and D-5 position of the inositol ring. Group IV contains the newest member of the 5-ptase family. Although the complete cDNA has not been identified as of yet, an enzyme activity has been purified that selectively recognizes the PI3-K product, Ptdlns3,4,5P3 l as its only substrate. R| and R 2 signify lipids side-chains of the DAG group of the phosphatidylinositides. OCRL-1 ortholog appears to overlap with 5Ptase II since little or no phenotype was observed in either OCRL-1"'" or 5Ptase II"'" mice (Janne et al., 1998). However, crossing of these two mouse lines resulted in a lack of viable embryos deficient in both 5-ptase genes 29 (Janne et al., 1998). OCRL-1 has been observed to localize to the trans-Golgi network (Dressman et al., 2000; Olivos-Glander et al., 1995), where Ptdlns4,5P 2 is thought to play a vital role in membrane trafficking and vesicle budding (De Camilli et al., 1996). This has led to the suggestion by Majerus et al. (1999) that abnormal lysosomal trafficking of enzymes into extracellular spaces may be responsible for some or all of the damage that accumulates in sufferers of Lowe's syndrome, namely mental retardation in conjunction with retinal and renal defects (Attree et al., 1992). 1.7.2.2 The Synaptojanin Family Synaptojanin 1 (McPherson et al., 1996; Woscholski et al., 1998) and Synaptojanin 2 (Nemoto et al., 1997; Seet et al., 1998) are closely related 5-ptases exhibiting the same broad substrate specificity as other group II members (Figure 1.6). Both contain an N-terminal region with homology to yeast Sac I, a central 5-ptase domain, and a proline-rich C-terminal tail (Figure 1.5). Although these proteins share a high degree of structural and sequence similarity, their proline-rich tails differ greatly. Additionally, the majority of isolated alternately spliced variants for Synaptojanin 1 and 2 involve alterations to sequences within the C-terminal tail. Because several SH3-containing proteins have been shown to interact with PxxP motifs within these C-terminal tails (de Heuvel et al., 1997; McPherson et al., 1996; Micheva et al., 1997; Nemoto et al., 1997; Ramjaun and McPherson, 1996; Ringstad et al., 1997; Yamabhai et al., 1998), this suggests different isoforms might attract unique complements of SH3-containing binding partners. In support of this, a recent report identified the association of one particular Synaptojanin 2 isoform with the PDZ domain of a mitochondrial outer membrane protein via residues present at the very C-terminus of Synaptojanin 2A (Nemoto and De Camilli, 1999). This also might explain the observed differences in the localization of Synaptojanin 1 and 2 to different subcellular fractions (Nemoto et al., 1997). Whatever the reason for the many isoforms, it is now clear that Synaptojanin 1 and 2 play integral roles in controlling membrane trafficking. Synaptojanin 1 is localized to clatherin-coated endocytotic intermediates (Haffner et al., 1997) and is known to associate with important members of the endocytotic machinery, including amphiphysin 1 and 2 (Micheva et al., 1997; Ramjaun and 30 McPherson, 1996), SH3p4/8/13 family members (de Heuvel et al., 1997; Ringstad et al., 1997), intersectin (Yamabhai etal., 1998), and syndaptin I (Qualmann and Kelly, 2000). 1.7.3 Group III Inositol Polyphosphate 5-Phosphatases Group III 5-ptases only hydrolyze substrates that include a phosphate group at the D-3 position of the inositol ring (ie. lns1,3,4,5P 4, and Ptdlns3,4,5P 3) (Figure 1.6). Two enzymes have been identified that possess this specific activity in vitro, SHIP and SHIP2 (Damen et al., 1996; Lioubin et al., 1996; Pesesse et al., 1998) (Figure 1.4). These enzymes are approximately 50% identical at the amino acid level and share a striking resemblance in both size and structure (Figure 1.5). Each contains an amino-terminal SH2 domain, two centrally located 5-ptase motifs comprising the core of their catalytic domain, and a proline-rich carboxy-terminal tail (Damen et al., 1996; Lioubin et al., 1996; Pesesse et al., 1997). The C-terminal tails are critical to the formation of complexes between the SHIPs and other signalling intermediates. They each contain several potential class I and II SH3 binding motifs, and one (SHIP2) or two (SHIP) NPxY sequences (Damen et al., 1996; Lioubin et al., 1996; Pesesse et al., 1997) capable of associating, in their phosphorylated state, with PTB domains (Lamkin et al., 1997; Lemay et al., 2000; Lioubin et al., 1996; Tamir et al., 2000) (see Section 1.8). Although SHIP and SHIP2 share many structural domains, their primary sequences are very divergent. For example, regions where one might expect a high level of conservation, such as the SH2 and 5-ptase domains, are only 54% and 64% identical, respectively (Erneux et al., 1998), and the proline-rich tails show no significant sequence similarity. Such differences could lead to association with distinct binding partners and unique modes of regulation. Messenger RNA for SHIP and SHIP2 are found in a wide variety of tissues (Damen et al., 1996; Liu et al., 1998d; Pesesse et al., 1997; Ware et al., 1996). However, SHIP protein has only been detected in cells of hematopoietic origin (Geier et al., 1997; Liu et al., 1998d) and spermatids found in the testis (Liu et al., 1998d), while SHIP2 protein has been found in a wide variety of fibroblast, non-hematopoietic, and hematopoietic cells (Habib et al., 1998; Wisniewski et al., 1999). These observations have led to the suggestion that SHIP is a hematopoietic restricted Group III 5-ptase while SHIP2 is more 31 ubiquitously expressed. SHIP has very recently been implicated as a major Ptdlns3,4,5P 3 phosphatase in mast cells (Huber et al., 1998b) and B cells (Bolland et al., 1998; Scharenberg et al., 1998). In several studies at least 4 distinct SHIP isoforms, approximately 145-, 135-, 125-, and 110-kDa in size have been identified by S D S - P A G E . The mechanism(s) responsible for producing these isoforms is complex and somewhat controversial. In one study published by our group, these different sizes were determined to be the result of proteolytic cleavage of the 145-kDa SHIP protein, possibly by a member of the calpain protease family (Damen et al., 1998). Other reports have identified the existence of mRNA splice variants involving modifications to some or all of the proline-rich C-terminus (Lucas and Rohrschneider, 1999; Rohrschneider et al., 2000), or removal of much of the N-terminus, including the SH2 domain (Kavanaugh et al., 1996). It remains to be determined if these mechanisms are occurring simultaneously, if they are due, at least in part, to proteolytic digestion after lysis, and/or if the levels of the various SHIP isoforms are cell type specific. Regardless of the answer, these changes could have important consequences on the localization and function of SHIP. 1.8 PROTEIN BINDING PARTNERS OF SHIP SHIP is tyrosine phosphorylated in response to the activation of every major class of extracellular receptor expressed by hematopoietic cells. This includes the G protein-coupled thrombin receptor, c-Kit, TCR, BCR, and all variety of cytokine receptors (Liu et al., 1997b). Therefore, it is reasonable to assume that SHIP plays some role in the signalling networks of these systems and that the tyrosine phosphorylation of SHIP is important in these processes, facilitating SH2 and PTB-dependent interactions. Many of the protein-binding partners so far reported for SHIP and the potential biological significance of these interactions will be discussed below. 1.8.1 Immunoreceptor Tyrosine-based Motifs ITAMs are found in the cytoplasmic tails of immunoreceptors that lead to positive biological responses, such as the BCR, TCR, and FceRI. These motifs consist of a well 32 conserved core sequence possessing two tyrosine residues [(D/E)xxYxx(L7l)x6^YxxL] that become phosphorylated following ligand engagement and serve as docking sites for SH2 domain-bearing proteins (Tamir and Cambier, 1998). In a study to identify novel ITAM binding partners, a cDNA for SHIP was isolated using the ITAM of the FceRI y chain as bait in a modified yeast two-hybrid screen (Osborne et al., 1996). This study further determined that SHIP could associate with the phosphorylated ITAMs (pITAM) of the CD3 complex y, 5, and £, the FceRI 6 chain (Kimura et al., 1997), and the TCR £ chains in vitro and that these results were consistent with the optimal SHIP SH2 recognition sequence [pY(Y/D)x(L/IA/)] determined by phosphopeptide library screens (Osborne et al., 1996). Furthermore, the SH2 domain of SHIP also binds the pITAM of the FcyRlla and FcyRI-associated y chain in monocytes (Maresco et al., 1999). The significance of direct SHIP association with these receptors remains unclear. However, several clues have been uncovered. For example, the recruitment of SHIP to the FceRI complex could allow SHIP to regulate the extent of ligand-induced C a + + influx and/or degranulation in mast cells (Huber et al., 1998a). Additionally, ligand engagement of the FceRI (Huber et al., 1998a; Kimura et al., 1997), B C R (Harmer and DeFranco, 1999), T C R (Lamkin et al., 1997), FcyRlla, and FcyRI (Maresco et al., 1999) all lead to the tyrosine phosphorylation of SHIP, indicating that pITAMs help to localize SHIP to PTKs. This in turn could allow SHIP to act as an adaptor protein, associating with other pTyr-binding proteins to regulate their localization, (see below). Signalling by ITAM-containing receptor complexes are subject to negative regulation by co-clustering with inhibitory receptors. These inhibitory receptors also contain conserved tyrosine-containing sequences, or ITIMs [immunoreceptor tyrosine-based inhibitory motif; (V/l)xYxx(LA/)], that are phosphorylated and bind the SH2 domains of proteins thought to be involved in negative signalling (Unkeless and Jin, 1997). The ITIM was originally identified as a small region in the FcyRllb receptor vital to the prevention or abortion of B C R signalling events (Muta et al., 1994). Similar motifs have now been observed in killer cell inhibitory receptors (KIRs), the KIR-like gp49B1, and pjatelet endothelial cell adhesion molecule (PECAM)-1. Studies to identify SH2-containing proteins that interact with pITIMs have identified the tyrosine phosphatases SHP-1 and 33 SHP-2 , as well as SHIP (Unkeless and Jin, 1997). Interestingly, SHIP SH2 is capable of recognizing the pITIMs of the FcyRllb (Ono et al., 1996; Tridandapani et al., 1997b), gp49B1 (Kuroiwa et al., 1998), and PECAM-1 (Pumphrey et al., 1999), but not those found on KIRs, which only associate with SHP-1 and SHP-2 (Gupta et al., 1997; Vely et al., 1997). In fact, the preference of SH2 domains for particular ITIMs seems to be a common theme. SHIP SH2 demonstrates significantly higher affinity than either SHP-1 or SHP-2 for the FcyRllb pITIM (Famiglietti et al., 1999), and demonstrates a predilection for the more C-terminal of two ITIMs in both gp49B1 (Kuroiwa et al., 1998) and PECAM-1 (Pumphrey et al., 1999). Therefore, it appears that differences in the primary sequence of ITIMs can lead to the differential recruitment of SHIP, SHP-1 , and SHP-2, and this in turn can determine the mode and extent of positive receptor inhibition. SHIP'S role in ITIM-dependent negative signalling will be discussed in more detail in Section 1.10.1. 1.8.2 She and Grb2 The tyrosine phosphorylation of SHIP in response to extracellular stimuli is often coupled with the pTyr-dependent association of the SH2 and PTB domain-bearing, adaptor molecule, She (Liu et al., 1997b). Both She and Grb2 (an SH2/SH3-containing adaptor protein) are ubiquitously expressed signalling intermediates with a central role in linking membrane-spanning receptors with the activation of the Ras/MAP kinase pathway (Bonfini et al., 1996; Rozakis-Adcock et al., 1992). SHIP was originally identified by three independent groups based on its ability to associate with either the C-terminal SH3 domain of Grb2 (Damen et al., 1996; Kavanaugh et al., 1996) or the PTB domain of She (Lioubin et al., 1996). It was later demonstrated that She PTB domain could bind one or both of the phosphorylated NPxY sites in SHIP (Lamkin et al., 1997). Additionally, several studies have shown that SHIP SH2 is capable of binding phosphorylated She in vitro (Liu et al., 1997a; Pradhan and Coggeshall, 1997; Tridandapani et al., 1999) and that an SH2-deficient SHIP mutant is incapable of associating with She in vivo (Liu et al., 1997a). Taken together, these observations indicate She and SHIP may interact in a bipartite manner. However, as mentioned above, the SHIP SH2 also binds to pITIMs/ITAMs, as well as several other proteins, leading to the proposal of an intriguing model of SHIP/Shc association (see below). 34 Tridandapani et al. (1999) have proposed that during FcyRllb signalling, the SHIP SH2 first binds to the FcyRllb pITIM, thus bringing SHIP in close proximity to PTKs responsible for its phosphorylation. This is followed by the association of She PTB with the newly phosphorylated NPxY motifs on SHIP. Finally, She is tyrosine phosphorylated by one or more PTKs in the receptor complex, allowing SHIP SH2 to release the receptor and interact with She pTyr residues. This is supported by the failure to detect trimeric SHIP/Shc/FcyRllb complexes in conjunction with the exclusive nature of SHIP/FcyRllb and SHIP/Shc complexes (Tridandapani et al., 1999). Furthermore, SHIP SH2 was found to exhibit a 10-fold higher rate of dissociation from pITIMs than for She pTyr 3 1 7 (Tridandapani et al., 1999) and She phosphorylation in response to B C R engagement was dependent on the presence of SHIP in B cells (Ingham et al., 1999). Interestingly, SHIP-deficient mast cells exhibit reduced She phosphorylation in response to FceRI engagement (Huber et al., 1998a). A key component to this model is the implication that SHIP could compete with Grb2/Sos for She pTyr residues, accounting for the inhibition of Ras /MAPK pathway seen in FcyRIlb-mediated negative signalling (Sarmay et al., 1996; Tridandapani et al., 1997a; Tridandapani et al., 1997b). However, a second model has been suggested by Harmer and DeFranco (1999), in which She, Grb2, and SHIP form a ternary complex, with two Grb2 molecules serving as a bridge between She and SHIP. The SH2 domains of both Grb2 proteins bind pTyr residues in She while the C-terminal SH3 domains of Grb2 are presumed to associate with PxxP sequences within the proline-rich C-terminus of SHIP. She PTB completes the complex by binding SHIP NPxpY motifs, thus leaving the SH2 domain of SHIP free to interact with FcyRllb and other phosphoproteins. This is supported by studies with a Grb2-deficient B cell line, which indicate that efficient association of SHIP and She is dependent on the presence of Grb2 (Harmer and DeFranco, 1999). However, the association of Grb2 has not been detected in SHIP/Shc complexes from myeloid cell lines (Liu et al., 1997a) and some B cell lines (Pradhan and Coggeshall, 1997). There is also little difference in BCR-mediated MAPK activation between wild type and Grb2-deficient B cell lines (Harmer and DeFranco, 1999). To confuse matters further, there are conflicting reports surrounding MAPK activation and SHIP"'" cells. Activated SHIP-deficient bone 35 marrow derived mast cells (Huber et al., 1998a) and B lymphocytes from SHIP'Rag" '" chimeric mice (Liu et al., 1998c) but not SHIP"'" DT40 chicken B cells (Okada et al., 1998) exhibit a noticeable increase in MAPK activation. Because DT40 cells do not posses FcyRllb co-receptors, the lack of consensus between different studies could indicate differences in SHIP'S role in negative signalling during BCR versus BCR/FcyRl lb activation. This is supported by the recent identification of the novel SHIP binding partner, Dok-1 (see below). 1.8.3 The Dok Family The Dok family of adaptor proteins consists of three known members, Dok-1 (p62 d o k), Dok-2 (FRIP/Dok-R), and Dok-3, which are broadly expressed in hematopoietic cells and have a role in immunoreceptor signalling. Dok proteins possess an N-terminal PH domain, a centrally located PTB domain, and a multiple tyrosine-bearing, C-terminal tail (Lemay et al., 2000). pYxxP motifs within the C-terminal tail of both Dok-1 (Noguchi et al., 1999) and Dok-2 (Lock et al., 1999) associate with the SH2 domains of Ras GTPase-activating protein (GAP) and the adaptor molecule Nek, while the tail of the more divergent Dok-3 associates with the SH2 of Csk and SHIP (Lemay et al., 2000). Furthermore, the PTB domains of both Dok-1 (Tamir et al., 2000) and Dok-3 (Lemay et al., 2000) bind SHIP'S NPxpY motifs. The ability of SHIP and Dok-3 to form a bi-dentate complex is reminiscent of that proposed for SHIP and She in myeloid cells (Liu et al., 1997a) and B lymphocytes (Pradhan and Coggeshall, 1997). The role of SHIP association with Dok-3 is not fully understood but Dok-3 overexpression led to increased SHIP association in conjunction with inhibition of BCR-induced NFAT activation and IL-2 secretion (Lemay et al., 2000). On the other hand, recent evidence indicates SHIP is required for Dok-1 localization to the FcyRllb receptor where it becomes tyrosine phosphorylated and recruits R a s G A P and Nek. (Tamir et al., 2000). These observations are again evocative of SHIP'S proposed role in She phosphorylation (Ingham et al., 1999; Tridandapani et al., 1999). Furthermore, because SHIP could regulate the recruitment of G A P to the membrane, the association of SHIP with Dok-1 offers an alternative mechanism for FcyRIlb-mediated inhibition of BCR-induced MAPK activation. 36 1.8.4 PI3-K Co-engagement of the BCR and FcyRlb l , but not BCR engagement alone, results in the tyrosine phosphorylation of the p85 adaptor subunit of PI3-K and its association with SHIP (Gupta et al., 1999). Subsequent sequence analysis of murine SHIP has identified a tyrosine-bearing motif (INPNYIGM) resembling the optimal sequence specificity for both SH2 domains of the p85 adaptor subunit of PI3-K [Y(M/l/V/E)xM] (Felder et al., 1993; Songyang et al., 1993). Coincidentally, this sequence included the tyrosine from SHIP'S N-terminal NPxY motif, believed to constitute one of the major ligand-induced phosphorylation sites. Further analysis has gone on to demonstrate that p85 SH2 glutathione S-transferase (GST) fusion proteins can bind tyrosine phosphorylated SHIP (Gupta et al., 1999; Lucas and Rohrschneider, 1999). Interestingly, a recently identified, 135-kDa, alternate splice variant of SHIP (SHIP8) contains a 183 amino acid deletion that disrupts the p85 PI3-K binding motif (INPNYIAN), reducing the ability of this shorter SHIP isoform to interact with the p85 C-terminal SH2 domain (Lucas and Rohrschneider, 1999). The ability of SHIP to directly associate with PI3-K is of particular interest in light of recent observations suggesting SHIP is a major regulator of Ptdlns3,4,5P 3 levels in mast cells (Huber etal . , 1998a) and B cells (Bolland et al., 1998; Scharenberg et al., 1998). 1.8.5 Other Associated Protei ns Several other proteins have also been identified as potential SHIP binding partners. I have taken the liberty of grouping these remaining proteins together as the modes of association and/or the biological significance of these interactions remain largely unknown. Two such molecules, protein inhibitor of activated STAT1 (PIAS1) and Disabled (Dab) 1, were both identified in yeast two-hybrid library screens. PIAS1 is a potent inhibitor of STAT1-mediated transcription that binds STAT1 and disrupts its ability to associate with DNA (Liu et al., 1998a). It was found to associate with the C-terminal tail of SHIP in a phosphorylation-independent manner that has yet to be identified and the two are constitutively bound in unstimulated FD/Fms cells (Rohrschneider et al., 2000). Dab1 is a PTB domain containing signalling intermediate (Howell et al., 1997) with an important role in neurological development (Gallagher et al., 1998). The PTB domain of Dab1 was shown to associate with SHIP'S N-terminal NPxY motif (Howell et al., 1999). Somewhat 37 surprisingly, this interaction not only did not require phosphorylation of the NPxY motif, but the addition of a phosphate significantly reduced this association. Additional studies are needed to determine the significance of both PIAS1 and Dab1 binding to SHIP. The Gab family of scaffolding proteins consists of two mammalian members (Gab1 and Gab2) that possess N-terminal PH domains, central proline-rich motifs, and multiple tyrosine residues throughout their sequences. Recent studies have shown that cytokine stimulation promotes the formation of SHIP complexes including Gab1 (Lecoq-Lafon et al., 1999) and Gab2 (Rohrschneider et al., 2000), in addition to p85 PI3-K, Grb2, She, and SHP-2 . Although in vitro binding studies demonstrate that SHIP SH2 domain is capable of directly associating with pTyr residues in Gab2, further analysis is required to rule out the possible involvement of the other associated proteins acting as bridges between SHIP and the Gab proteins. Similarly, SHIP SH2 domain is believed to mediate the association of SHIP with the tyrosine phosphatase SHP-2 and the PTK Syk. Activation of the IL-3 and Epo receptors induces the formation of transient SHIP/SHP-2 complexes (Liu et al., 1997c; Sattler et al., 1997), while LPS treatment and BCR or FcyR engagement, but not IL-4 stimulation, promote the association of SHIP and Syk (Crowley et al., 1996). Although it is tempting to suggest that Syk and SHP-2 associate with SHIP in order to add or remove phosphate groups from SHIP, no direct evidence has been presented to implicate either enzyme regulating SHIP 'S tyrosine phosphorylation state. Further analysis of both SHIP/Syk and SHIP/SHP-2 complexes has indicated that no detectable levels of She are present. This could indicate that She, Syk, and SHP-2 may compete for SHIP SH2 under certain conditions, affecting the localization or activity of these proteins. 1.9 ROLE FOR SHIP SUBSTRATES AND BY-PRODUCTS 1.9.1 lns1,3,4,5P4and lns1,3,4P3 For many years it has been known that cells rapidly produce lns1,3,4,5P 4 in response to many stimuli. This has led to lns1,3,4,5P 4 becoming the focus of numerous studies, several of which have identified lns1,3,4,5P4-binding proteins. The GAP1 family of Ras GTPase-activating proteins comprises the best characterized group of lns1,3,4,5P4-binding proteins, consisting of several mammalian members ( G A P 1 m , 38 GAP1 , and GAPIII/R-Ras GAP) that contain one PH domain and two C2 domains (Fukuda and Mikoshiba, 1997). Both G A P 1 m (Fukuda and Mikoshiba, 1996) and G A P 1 I P 4 B P ( C u | | e n e t a | -i995) b i n d ptdlns3,4,5P 3 and lns1,3,4,5P 4 via their PH domains and both have been shown to localize to cellular membranes (Lockyer et al., 1997; Lockyer et al., 1999). Intriguingly, the localization of G A P 1 m is not associated with an increase in Ras exchange activity, despite the presumed enrichment of G A P 1 m to the plasma membrane where Ras is found. This observation is consistent with previous studies demonstrating that Ptdlns3,4,5P 3 inhibited G A P 1 m (Fukuda and Mikoshiba, 1996) and G A P 1 I P 4 B P (Cullen et al., 1995) activity. Furthermore, these same studies showed association of lns1,3,4,5P 4 with the PH domains of GAP1 members increased enzymatic activity. Based on this evidence, a model of GAP1 regulation has emerged in which inactive GAP1 proteins are anchored to Ptdlns3,4,5P 3 in the plasma membrane, only to be brought to life by the generation of increased levels of lns1,3,4,5P 4 that compete for, and displace, Ptdlns3,4,5P 3 from the PH domain (Cullen, 1998; Fukuda and Mikoshiba, 1997). The Btk family of PTKs possess PH domains that are highly homologous to those of the GAP1 family and can associate with lns1,3,4,5P 4 (Fukuda and Mikoshiba, 1997). The significance of this interaction remains unclear, but recent evidence has demonstrated that lns1,3,4,5P 4 binding disrupts the constitutive association of P K C a and (3 from the PH domain of Btk (Fukuda and Mikoshiba, 1997), thus preventing the negative regulation of Btk activity via PKC-mediated phosphorylation (Yao et al., 1994). Therefore lns1,3,4,5P 4 could play a role in the activation of Btk not only by removing the negative regulator P K C , but also by freeing up the PH domain to associate with Ptdlns3,4,5P 3, which is associated with its activation (see Section 1.9.2). Defining a clear role for lns1,3,4P 3 in cellular processes is a much more difficult task. Until recently, lns1,3,4P 3 has been considered little more than the breakdown product of 5'-phosphatases such as SHIP. However, recent evidence has indicated that lns1,3,4P 3 may be more than just a downstream metabolite of lns1,4,5P 3. lns1,3,4P 3 levels increase several-fold following P L C activation (Shears, 1998), thereby indirectly raising intracellular lns3,4,5,6P 4 levels by potently inhibiting lns3,4,5,6P 41-kinase (Tan et 39 al., 1997). Because lns3,4,5,6P 4 inhibits Ca + +-regulated CI" conductance (Carew et al., 2000), lns1,3,4P 3 may play an important role in controlling pH balance, osmoregulation, and volume-dependent metabolic effects (Tan et al., 1997). Furthermore, lns1,3,4P 3 also serves as a source of inositol replenishment though the process of dephosphorylation and is a precursor for higher inositol phosphates (ie. lns1,3,4,6P 4 and lns1,3,4,5,6P 5) (Shears, 1998). 1.9.2 Ptdlns3,4,5P3 and Ptdlns 3,4P2 The presence of Ptdlns3,4,5P 3 is almost undetectable in resting cells but is rapidly generated in response to extracellular stimuli (Auger et al., 1989; Traynor-Kaplan et al., 1989), primarily though the phosphorylation of Ptdlns4,5P 2 by class I PI3-Ks (Hawkins et al., 1992) (see Figure 1.4). Dephosphorylation of Ptdlns3,4,5P 3 at the D-5 position by enzymes such as SHIP, SHIP2, and the Synaptojanin family is likely the major method of Ptdlns3,4P 2 generation, with some contribution via phosphorylation of Ptdlns3P and Ptdlns4P (Rameh and Cantley, 1999; Tolias and Cantley, 1999) (see Figure 1.4). As described in Section 1.6, both Ptdlns3,4,5P 3 and Ptdlns3,4P 2 can associate with PH domains, affecting localization and/or activity of proteins bearing these modules. Perhaps the best example is the regulation of the kinase PKB/Akt. The PH domain of PKB binds Ptdlns3,4P 2 in vitro with higher affinity than for Ptdlns3,4,5P 3 ) resulting in a 3 to 5-fold increase in kinase activity (Franke et al., 1997; Freeh et al., 1997; Klippel et al., 1997), and in vivo, PKB activation correlates with Ptdlns3,4P 2 and not Ptdlns3,4,5P 3, production (Banfic et al., 1998; Franke et al., 1997). While partial activation of PKB can be achieved with Ptdlns3,4P 2 association, full activation requires the phosphorylation of both Thr 3 0 8 and S e r 4 7 3 by PDK-1 and, the yet to be identified, PDK-2, respectively. Perhaps not surprisingly, PDK-1 also possesses a PH domain with high affinity for both Ptdlns3,4P 2 and Ptdlns3,4,5P 3 and recently has been shown to phosphorylate Thr 3 0 8 in a Ptdlns3,4,5P 3-dependent manner (Alessi et al., 1997; Alessi et al., 1997; Stokoe et al., 1997; Stephens et al., 1998). In addition to those found in PKB and PDK-1, several other PH domains are highly selective for phosphatidylinositides. Btk binds Ptdlns3,4,5P 3 via its PH domain with an 40 affinity similar to that previously described for lns1,3,4,5P 4 (Fukuda et al., 1996a) (Section 1.9.1), and this association is linked with increases in both tyrosine phosphorylation (via itself and Src family kinases) and enzymatic activity (Li et al., 1997b; Scharenberg et al., 1998). Additionally, many guanine nucleotide exchange factors (GEF) for small G proteins also contain PH domains that are thought to recruit them to lipid bilayers where their membrane-bound targets are located. For example, G R P - 1 , a G E F for Arf-1 and Arf-5, contains a PH domain that is highly selective for Ptdlns3,4,5P 3 (Klarlund et al., 1998) and the Rac G E F , Vav, is allosterically activated by Ptdlns3,4,5P 3 binding while Ptdlns4,5P 2 binding inhibits Vav's enzymatic activity (Han et al., 1998). Independent of PH domains, C2 and SH2 modules also have the ability to associate with these two phosphoinositides. The SH2 domains of the p85 subunit of PI3-K (Rameh et al., 1995) and PLCy both associate with Ptdlns3,4,5P 3 in vitro (Bae et al., 1998; Rameh et al., 1998). Interestingly, the interaction of PLCy SH2 with Ptdlns3,4,5P 3 not only constitutes a potential localization mechanism for PLCy, but also enhances the in vitro enzymatic activity of PLCy for Ptdlns4,5P 2 (Bae et al., 1998; Rameh et al., 1998). Furthermore, the novel P K C family member, PKCe, can directly associate with Ptdlns3,4,5P 3 and Ptdlns3,4P 2, increasing kinase activity 5 to 15-fold (Toker et al., 1994), and Ptdlns3,4,5P 3-activated PDK-1 is likely responsible for elevating the kinase activity of both PKCe and PKC£ by the phosphorylation of residues within their kinase activation loops (Chou et al., 1998; Le Good et al., 1998). Based on the ability of both Ptdlns3,4P 2 and Ptdlns3,4,5P 3 to regulate these and many more signalling proteins (see Section 1.6), these phosphoinositides likely play key roles in many cellular processes. These include enhanced cellular survival (PKB) and proliferation (PKC/PLCy/Btk/Sos), cell migration (Vav/Rac), and vesicle budding (GRP-1/Arf) (Rameh and Cantley, 1999). 41 1.10 BIOLOGICAL ROLES OF SHIP 1.10.1 In BCR/FcyRllb Signalling B C R cross-linking initiates several well-characterized "positive" signalling events, which include increased lns1,4,5P 3 production/Ca + + influx and upregulation of PI3-K, Ras, and PKB/Akt activity. The co-ligation of the FcyRl lb l receptor attenuates these (and other) positive signals in a negative feedback loop aimed at stopping antibody production when levels are sufficient for the antigen supply. As mentioned in Section 1.8.1, SHIP SH2 domain has a much higher affinity for the pITIM of FcyRl lb l than the SH2 domains of either SHP-1 or SHP-2 (Famiglietti et al., 1999). As well, studies with SHP-1 _ / - and SHIP - ' -B cells have shown SHP-1 is dispensable in these inhibition processes (Nadler et al., 1997 Ono, 1997 #85) while SHIP is not (Aman et al., 1998; Hashimoto et al., 1999; Liu et al., 1998c; Ono et al., 1997; Tridandapani et al., 1998). Thus, it appears that SHIP is the critical regulator of FcyRIlb-mediated inhibition. The exact mechanism(s) behind SHIP'S ability to down-regulate B C R signals have yet to be fully characterized, however, recent advances have indicated several different scenarios. The most obvious scenario involves SHIP counteracting PI3-K by reducing BCR-induced Ptdlns3,4,5P 3 levels. It has been experimentally confirmed that FcyRllb engagement results in dramatically lower levels than those found in BCR-stimulated cells (Gupta et al., 1999) and this decrease likely regulates the actions of PH domain-containing proteins. For example, Btk is activated though the association of Ptdlns3,4,5P 3 with its PH domain (Bolland et al., 1998; Salim et al., 1996; Scharenberg et al., 1998). Functionally detrimental mutations in the PH domain are found in both (XLA) and murine X-linked immunodeficiency (Xid) (Fukuda et al., 1996; Hyvonen and Saraste, 1997) and are associated with the inability of BCR cross-linking to induce several positive signals, including C a + + influx and lns3,4,5P 3 production (Rawlings and Witte, 1995). Furthermore, the constitutive association of Btk to the membrane or deletion of SHIP leads to increases in intracellular C a + + levels, while membrane expression of SHIP attenuates this response in the absence of FcyRllb activation (Bolland et al., 1998). Whether Btk facilitates C a + + influx via PLCy activation/lns1,4,5P3 production or through plasma membrane C a + + channels remains unclear. In addition to Btk, other Ptdlns3,4,5P 3-recognizing, PH 42 domain-containing proteins are also likely targets for SHIP regulation. Localization of the Ras exchange factor mSos to Ptdlns3,4,5P 3 (Rameh et al., 1997) could be at least partially responsible for the upregulation of BCR-stimulated Ras activity and the membrane recruitment of both PKB/Akt and PDK-1 via Ptdlns3,4,5P 3-binding is critical to PKB/Akt activation in B cells (Aman et al., 1998). Recent evidence demonstrates that the down-regulation of PI3-K induced pathways is not the only means by which SHIP can attenuate B C R signaling. With its many protein-protein interaction sites, SHIP may also act as a scaffolding protein to recruit molecules to the BCR complex. The association of SHIP SH2 domain with FcyRl lb l leads to the phosphorylation of SHIP'S NPxY motifs. The NPxpY motifs subsequently interact with the negative adaptor molecules Dok-1 and Dok-3 in B lymphocytes. This recruitment of Dok-1 to the FcyRl lb l receptor facilitates Dok-1's tyrosine phosphorylation, thereby attracting R a s G A P to the complex where it is believed to down-regulate Ras /MAPK activity (Tamir et al., 2000). Dok-3 association with SHIP, on the other hand, coincides with inhibition of BCR-induced NFAT activation and IL-2 secretion (Lemay et al., 2000). More recently, a role for the proline-rich C-terminal tail of SHIP in B C R signalling attenuation has also been reported. Specifically, FcyRIlb-mediated inhibition of BCR-induced C a + + influx was severely reduced by the removal of the last 290 amino acids of SHIP and was partially compromised by the mutation of both tyrosines in the NPxY motifs to phenylalanines (Aman et al., 2000). The mechanism by which the proline-rich tail and NPxY motifs inhibit C a + + influx are unknown, however, membrane targeting of the truncated SHIP mutant partially restored this activity. 1.10.2 In Mast Cell Functioning The ability of SHIP SH2 to bind directly to the pITAMs of both FceRI y (Osborne et al., 1996) and B chains (Kimura et al., 1997) and the induction of SHIP tyrosine phosphorylation by FCERI engagement (Kimura et al., 1997) indicated early on that SHIP might have an important role in mast cell signalling. Comparison of bone marrow derived mast cells (BMMCs) from SHIP"'", SHIP + / + , and SHIP*'" mice revealed striking differences in both signalling and biological functions (ie. degranulation). Both the FceRI 8 chain and 43 E R K 1 and 2 exhibited higher levels of tyrosine phosphorylation in FceRI-engaged SHIP B M M C s compared to littermate controls, while the tyrosine phosphorylation of She was reduced in the absence of SHIP (Huber et al., 1998a). Additionally, the loss of SHIP was coupled to a dramatic elevation of IgE-mediated extracellular C a + + influx and the release of immunologic/inflammatory mediator-containing granules. Intriguingly, similar biological responses were also observed in response to S C F stimulation. Extracellular C a + + influx was significantly higher and degranulation levels in SCF-induced SHIP"'" B M M C s rivaled those seen in response to FceRI-engagement (Huber et al., 1998b). This latter result was particularly surprising because S C F normally does not induce B M M C degranulation. Taken together, these observations indicated that SHIP might set threshold levels for these biological responses. This is most likely mediated through the attenuation of PI3-K activity, as inhibitors of PI3-K were capable of nullifying these responses in SHIP-deficient cells where Ptdlns3,4,5P 3 levels were found to be significantly higher than in SH IP + / + controls (Huber et al., 1998a; Huber et al., 1998b). Furthermore, these results demonstrated the versatility of SHIP as a negative regulator since, unlike in the B C R system, SHIP attenuated the actions of "positive" receptors without the involvement of ITIM-containing negative co-receptors. 1.10.3 In Hematopoietic Development The involvement of SHIP in the control of hematopoietic differentiation has only recently begun to be addressed, but mounting evidence points to a regulatory role. SHIP messenger RNA is expressed at the earliest onset of hematopoiesis in mouse embryos and SHIP protein has been detected almost exclusively in cells of hematopoietic origin, including granulocytes, monocytes, lymphocytes, and large nucleated erythroid progenitors (Liu et al., 1998d). As described above, SHIP plays a negative regulatory role in numerous signalling systems and several studies have indicated SHIP expression has negative effects on cell growth (Lioubin et al., 1996; Liu et al., 1997a). SHIP"'" mice exhibit major disruptions in their hematopoietic system, with significant increases in granulocyte-macrophage progenitors in both bone marrow and spleen while experiencing a reduction in bone marrow late erythroid (CFU-E) and lymphoid progenitors (Helgason et al., 1998). B cells from these SHIP"'" mice develop more quickly and display both a heightened 44 response to antigen stimulation and a reduced sensitivity to BCR-mediated apoptosis (Brauweiler et al., 2000; Helgason et al., 2000). Furthermore, several studies have indicated SHIP expression undergoes changes during development. SHIP protein levels fluctuate during T cell development, with higher SHIP levels in T C R h l mature T cells than in TCR 1 0 immature T cells (Liu et al., 1998), and SHIP mRNA is present at high levels in both early and late-stage B cells, but is almost undetectable at the intermediate plasmacytoma cell stage (Kerr et al., 1996). In humans, 74% of immature CD34 + cells express SHIP protein, but this expression then drops to approximately 10% of the more mature C D 3 3 + cells (Geier et al., 1997). To further complicate matters, the expression of different sized isoforms of SHIP (see Section 1.7.5) changes depending on the developmental stage or cell lineage (Geier et al., 1997). Together, the aforementioned observations constitute a strong case of circumstantial evidence for SHIP playing an important role in hematopoiesis. However, direct evidence placing SHIP in control of these developmental processes has been elusive. Recently, a study examining SHIP'S role in the differentiation of a human erythroleukemia cell line, K562, has brought this goal a step closer. K562 cells do not express detectable levels of SHIP protein and can be induced to express the "differentiation" markers e-globin mRNA and hemoglobin protein following hemin stimulation. The introduction of wild-type SHIP into this cell line had no adverse effects on cell growth or viability but did cause a significant decrease in hemin-induction of both differentiation markers (Siegel et al., 1999). Furthermore, mutational analysis of SHIP led to the recognition that SHIP'S enzymatic activity was required for this inhibition, with important contributions by both its SH2 domain and at least one NPxY motif. However, an important caveat must be heeded when interpreting these results. The K562 cell line is a BCR/Abl transformed erythroleukemia and recent evidence has shown that BCR/Abl transformation leads to a reduction of SHIP protein expression and constitutive association of SHIP with SHP-2 in a large protein complex also containing BCR/Abl and c-Cbl (Sattler et al., 1999). Therefore, it cannot be discounted that these findings in the K562 cell line may be more indicative of a SHIP-BCR/Abl phenomenon than a bona fide role for SHIP in regulating erythropoiesis. 45 1.11 AIM OF STUDY The initial aim of this study was to clone and characterize the human form of SHIP (hSHIP) for the purpose of comparison with murine SHIP (mSHIP). This was to be followed by studies into the expression pattern of SHIP in the different hematopoietic lineages and human tissues, as well as examination of potential roles for hSHIP in human diseases. However, technical difficulties in producing an antibody that recognized hSHIP precluded this and many other studies to characterize this gene product. The decision was then made to focus on the similarities between human and mouse SHIP, concentrating on regions of the protein that were both highly conserved and could potentially be involved in intermolecular interactions. This new focus had the added benefit that it allowed us to take advantage of the many tools that had been developed exclusively for the study of mSHIP in both our laboratory as well as many others. These tools included the availability of SHIP"'" mice and many retroviral constructs containing mutant forms of mSHIP. The goal for the remainder of this thesis, therefore, became the characterization of phosphorylation-independent protein interaction involving SHIP. More specifically, we were interested in identifying proteins capable of associating with the highly conserved proline-rich motifs and what role these interactions might have on the functioning of SHIP as an intracellular signalling protein. 46 Chapter 2 MATERIALS AND M E T H O D S 2.1 REAGENTS Protein kinase inhibitors were purchased from Calbiochem-Novabiochem Corp. (San Diego, CA). All other reagents were purchased from the Sigma-Aldrich Company (Oakville, ONT), unless otherwise stated. 2.2 HUMAN SHIP cDNA CLO NING Duplicate nitrocellulose (Schleicher & Schuell, Keene, NH) plaque-lifts were prepared from approximately 1x10 6 plaque-forming units (pfu) of a custom-made A.gt11 cDNA library created from poly-A+ RNA purified from M07e cells (Clontech, Palo Alto, CA). Phage DNA bound to these membranes was denatured in 0.5 N sodium hydroxide, 1.5 M sodium chloride and hybridized for 18 h at 50°C with non-overlapping, [a 3 2P]-dCTP randomly labeled cDNA fragments corresponding to either 1.5-kb of the 5' region (bp 1 to 1494, which includes the SH2 domain) or 1.2 kb of the central region (bp 1495 to 2696, which includes the 5-ptase domain) of mSHIP (GenBank accession no. U39203) in 1.5x S S P E [20x S S P E : 3 M sodium chloride, 0.2 M sodium phosphate monobasic, pH 7.4, 0.02 M ethylenediaminetetraacetic acid (EDTA) disodium salt], 1% (w/v) sodium dodecyl sulfate (SDS), 1 % (w/v) skim milk, and 0.25 mg/ml sheared/denatured salmon sperm DNA. The membranes were then washed three times at 50°C for 30 min with 0.5x S S C (10x S S C : 3 M sodium chloride, 0.3 M sodium citrate, pH 7.0), 0.5 % (w/v) SDS, and exposed to Kodak X-OMAT™ film (Rochester, NY). Plaques that hybridized with both probes were identified and their phage isolated. Nine cDNA inserts were removed from positive phage by EcoR I digestion, and subcloned into pBluescript (pBS) K S + (Statagene, La Jolla, CA) for further analysis. Two overlapping cDNA inserts, 4970 bp and 2750 bp in length were chosen for further analysis. The larger of these two inserts was further digested with either Pst I or 47 Xho I, sub-cloned into pBS K S + . All cDNA fragments were sequenced at the Nucleic Acids and Protein Sequencing (NAPS) unit (University of British Columbia) using ABI Prism (Perkin Elmer, Foster City, CA) automated sequencing with standard T7 and T3 oligoprimers (Stratagene. La Jolla, CA). Regions not overlapped by restriction fragments were sequenced as described in Section 2.6.4 using the following nucleotide oligoprimers: 5 ' -AATTCACTGTTCAGGCATCC-3 ' , A C A C G A C A C T T T C T G T G T C C - 3 ' , T A T T G G T T A C G C A G A C T T C C - 3 ' , T T A G G G A A G G A A C T C A G G - 3 ' , CTTGGTGTAGGCGTATTTG-3 ' , A G C C T T G C A T A G G A A G C T G - 3 ' , 5 ' -GTCACCAGCCCCATGTTTTC-3 ' , 5 ' -GCAGCCTTTCTTCCTATCTC-3 ' , 5 ' -GAGAAGCTCTATGACTTGTG-3 ' , 5 ' -TTAAAACAGTCGCCATCCAC-3 ' , 5 ' -ACGGAATCCCCCAAAATG-3 ' , 5 ' -GCTGCTCTGAGTGCTTG-3 ' C G A C C A G T T G C C A G G A A - 3 ' , 5 ' -TCCACTGCAACCTGC-3 ' . 5'-5'-5'-5'-5'-5'-2.3 TISSUE CULTURE 2.3.1 Cell Lines The murine cell lines Ba F3 (kind gift from Dr A. Miyajima, University of Tokyo), DA-3 (kind gift from Dr. J . Ihle, St. Jude Children's Research Hospital, Memphis, TN), and BeSUtAi (kind gift from Dr. J . Greenberger, University of Pittsburgh Medical Center, Pittsburgh, PA) were all maintained in RPMI 1640 medium (Stem Cell Technologies, Vancouver, BC) containing 10% (v/v) fetal calf serum (FCS) and 5 ng/ml of C O S cell-derived murine IL-3 (production described in Murthy et al., 1989). The murine B cell line WEHI 231 (kind gift from Dr. Rob Kay, University of British Columbia) was grown in RPMI 1640 medium containing 10% (v/v) F C S , 1mM L-glutamine, and 5x10"5 M 2-mercaptoethanol. The human megakaryocytic cell line, M07e (Avanzi et al., 1988) was grown in Dulbecco's modified Eagle medium (DMEM) (Stem Cell Technologies) with 10% (v/v) F C S , 0.5x10"5 M 2-mercaptoethanol, 5 ng/ml human IL-3, 5 ng/ml human G M - C S F . The viral packaging B O S C 23 cell line (Pear et al., 1993) (kind gift from Dr. Rob Kay, University of British Columbia) was maintained in DMEM medium supplemented with 10% (v/v) F C S . 48 2.3.2 Bone Marrow-Derived Mast Cells Bone marrow-derived mast cells (BMMCs) were obtained from bone marrow asparates of Lyn"'" mice and their littermate controls (a kind gift of Dr. Janet Oliver, University of New Mexico) by resuspending the cells in complete medium (IMDM with 15% (v/v) F C S , 3 U/ml Epo, 10 ng/ml murine IL-3, 10 ng/ml human IL-6, 30 ng/ml murine S C F and 150 uM monothioglycerol) at 4x10 6 nucleated bone marrow cells/ml and culturing for 1 week. B M M C cultures were then maintained in Iscove's modified Dulbecco's medium (IMDM) (Stem Cell Technologies, Vancouver, BC) supplemented with 15% (v/v) F C S , 150 uM monothioglycerol, and 30 ng/ml murine IL-3 between 2x10 5 and 8x10 5 cells/ml with complete media replacement every 2 weeks. 2.3.3 BOSC 23 Transfection B O S C 23 viral packaging cells were plated at 2x10 6/6 cm cell culture dish (Nalge Nunc International, Rochester, NY) and cultured overnight. The next morning, cells were transiently transfected with 10 ug of MSCV-Pac retroviral cDNA plus 2.5 ug of pEPc3 plasmid, a sup F vector containing gag/pol/env coding sequences (kind gift of Dr. Rob Kay). Transfections were performed using the calcium phosphate reagents and instructions supplied in the Cellphect™ transfection kit (Pharmacia, Pacataway, NJ). After 10 h the calcium phosphate-containing medium was removed and the cells washed twice with Hank's buffered saline solution (Stem Cell Technologies). Cells were then given 5 ml of fresh DMEM with 10% (v/v) F C S and incubated for up to 48 h before virus-laden supernatants were removed for the infection of bone marrow or WEHI 231 B cells. 2.3.4 Viral Infection of Bone Marrow Cells Bone marrow was aspirated from the femurs and tibias of three, 4-8 week-old SHIP"'" and SHIP + / + littermates using IMDM and a 21-gauge needle with syringe. Cells were then resuspended in complete medium (IMDM with 15% (v/v) F C S , 3 U/ml Epo, 10 ng/ml murine IL-3, 10 ng/ml human IL-6, 30 ng/ml murine S C F and 150 uM monothioglycerol) at 4x10 6 nucleated bone marrow cells/ml. Approximately 11x10 6 bone marrow cells were then mixed, in a 10 ml culture flask, with 5 ml of 0.45 urn filtered, 36 h, viral supernatants collected from B O S C 23 cell cultures transiently transfected with M S C V -49 Pac retroviral constructs (see Section 2.9). The cultures were then incubated with the viral supernatants and 6 ug/ml polybrene (or 5 mg/ml protamine sulfate) for 4-5 h then resuspended in 5 ml of complete medium and incubated overnight. The next day, cells were infected twice more with 36 h and 40 h viral supernatants, exactly as described above. After the last 4 h infection, cells that remained in suspension were resuspended at 1x106/ml in complete medium (2.5 ml total). Cells were then added to 25 ml (10 volumes) of Methocult G F M3434 (containing the same F C S and growth factor complement found in complete medium; Stem Cell Technologies) with 2 ug/ml puromycin, the mixture vortexed and plated in 1 ml aliquots (-1x10 5 cells) on 24 Grenier dishes (Stem Cell Technologies), then incubated for 10 days at 37°C. Cell colonies were washed out of the methylcellulose with excess IMDM, then pooled and cultured (see Section 2.3.2) at a starting concentration of 2x10 5/ml for 6 weeks, at which time control B M M C cultures were deemed mature based on both c-Kit and FceRI expression, as determined by flow cytometry (see Section 2.7.3). Mature BMMC cultures were also analyzed for expression of green fluorescence protein (GFP) by flow cytometry and those colonies found to have low expression were sorted by FACSort™ (Becton Dickinson), collecting only the top 30% of G F P positive cells. 2.3.5 Viral Infection of WEHI231 B cells 6x10 5 WEHI 231 B cells (3x105/ml) were mixed with 2 ml of 48 h B O S C 23 viral supernatants (see Section 2.3.4) plus 5 ug/ml protamine sulfate and incubated for 8 h at 37°C. Cells were then resuspended in new media and cultured as described above. 20 h post-infection, puromycin was added to a final concentration of 1 ug/ml and 4 days post-infection, clonal populations were generated by culturing puromycin resistant cells (0.5x103) in 1 ml Methocult M3134 (Stem Cell Technologies) supplemented with 10% (v/v) F C S , RPMI 1640, 50 uM 2-mecaptoethanol, 1 mM L-glutamine, and 1 ug/ml puromycin. After 5 days, 12 individual colonies/infection were picked using thinly drawn, glass Pasteur pipettes and cultured individually for several days, at which time green fluorescent protein expression was quantified by flow cytometry (see Section 2.7.3). 50 2.4 RNA ANALYSIS 2.4.1 Poly-A+ RNA Isolation Human bone marrow aspirates were centrifuged through Ficoll-Hypaque (1.077 g/ml, Pharmacia LKB) and approximately 2x10 8 cells from the interphase were washed once with 1x P B S and resuspended in TRIzol™ (Life Technologies, Rockville, MD) to a final concentration of 1x10 7 cells/ml. Total RNA was then isolated according to the manufacturer's instructions. Poly-A + enriched RNA was obtained by incubating total RNA with oligo dT-cellulose as follows. First, 200 pi dry oligo dT-cellulose was suspended in 400 pi 0.2 N NaOH, then washed several times with RNase-free water until the pH was neutral. The oligo dT-cellulose was then washed 2-3 times with incubation buffer (0.5 M lithium chloride, 10 mM Tris-HCI, pH 7.5, 1 mM EDTA, 0.1% (w/v) SDS). 120 ug of total RNA was heated to 70°C for 2-3 min then lithium chloride was added to a final concentration of 0.5 M. The total RNA was then combined with the oligo dT-cellulose and vortexed for 10 min at 23°C. The oligo dT-cellulose was washed with 1 ml of incubation buffer followed by 1 ml of middle buffer [0.15 M lithium chloride, 10 mM Tris-HCI, pH 7.5, 1 mM EDTA, 0.1% (w/v) SDS]. Bound poly-A + RNA was eluted in elution buffer (2 mM EDTA, 0.1% (w/v) SDS) at double the volume of oligo dT-cellulose for 5 min and the buffer was then separated from the cellulose by centrifugation (16000x g, 1 min) in a 1.5 ml bench-top microfuge. The poly-A+ RNA was finally precipitated from the elution buffer with the addition of sodium acetate (0.3 M final concentration) and excess ethanol. This mixture was placed at -20°C overnight, centrifuged (16000x g, 15 min, 4°C), and-the pellet dried and resuspended in RNase-free water. 2.4.2 Northern Blot Analysis A multiple human tissue poly-A + Northern blot membrane (Clontech, Palo Alto, CA) originally containing 2 ug poly-A+ RNA/lane was incubated with Northern pre-hybridization solution (5x S S P E , 10x Denhardt's (50x Denhardt's: 5% (w/v) Ficoll 400, 5% (w/v) polyvinylpyrolidone, 5% (w/v) bovine serum albumin (BSA) fraction V) 100 ug/ml denatured/sheared salmon sperm DNA, 50% (v/v) deionized formamide, 0.5% (w/v) SDS) for 3-6 h. This buffer was then replaced with fresh pre-hybridization buffer containing a 1.7-kb hSHIP Xho I fragment spanning the 3' end of the open-reading frame and part of 51 the 3' UTR (bp 2769 to 4518) randomly labeled with [a 3 2P]-dCTP (4x10 6 cpm/ml). An additional membrane containing human bone marrow mononuclear cell poly-A + RNA/lane was also probed. This blot was created by electrophoretically separating 1.5 ug of poly-A + RNA (see Section 2.31) on a 1% (w/v) formaldehyde/agarose gel. The size separated RNA was then transferred onto a Zeta-probe™ blotting membrane (Bio Rad Laboratories, Richmond, CA) overnight by rinsing the gel in distilled water then transferring the RNA onto the membrane by capillary action with 10x S S C (20x S S C : 3 M sodium chloride, 0.3 M sodium citrate pH 7.0). 2.5 FLUORESCENCE in situ HYBRIDIZATION (FISH) FISH analysis was performed by the FISH Mapping Resource Centre (Hospital for Sick Children, Toronto, ONT) on 20 well-spread human lymphocyte metaphases using the full-length hSHIP cDNA as a probe (Boyle et al., 1992; Heng and Tsui, 1993; Lichter et al., 1990). The probe was biotinylated and detected with avidin-fluorescein isothiocyanate (FITC). Chromosomes were counterstained with propidium iodide (PI) and 4',6-diamidin-2-phenylindol-dihydrochloride (DAPI). 2.6 DNA ANALYSIS 2.6.1 Genomic DNA Isolation BeSUtAT or M07e cells were suspended in DNAzol™ (Life Technologies, Rockville, MD) at a final concentration of 1x10 7 cells/ml. They were mixed gently and the genomic DNA was precipitated with 500 pi of 99% ethanol followed by centrifugation at 3500x g for 5 min at 23°C. The resultant pellet was washed twice with 80% ethanol, dried briefly to remove residual ethanol, and resuspended in water. 2.6.2 Southern Blot Analysis 10 ug of genomic DNA was restriction enzyme digested and electrophoretically separated on a 0.8% agarose 1x TAE gel [50x TAE: 2 M Tris-acetate, pH 7.2, 50 mM EDTA]. Once the DNA was separated sufficiently, the gel was treated with 0.1 M hydrochloric acid for 15 min, neutralized with 0.5 M sodium hydroxide, 1.5 M sodium 52 chloride for 30 min, and then rinsed briefly with distilled water. The DNA was then transferred onto a Zeta-probe™ blotting membrane (Bio Rad Laboratories, Richmond, CA) overnight in 10x S S C by capillary action and fixed to the membrane by baking for 1 h at 80°C. The membrane was immersed in genomic Southern pre-hybridization buffer (0.75% (w/v) skim milk, 7.5% (w/v) dextran sulfate, 4.5x S S C , 7.5% (v/v) deionized formamide, 0.75% S D S , 1.5 mM EDTA, 0.5 mg/ml denatured salmon sperm DNA) 1-2 h, 60°C. The blot was then hybridized in pre-hybridization buffer containing 1-2x106 dpm/ml [a 3 2P]-dCTP randomly labeled (see Section 2.6.3) 1.5-kb mSHIP cDNA fragment (bp 2590-4040) for 16 h, at 60°C. The blot was then washed 3 times with 0.3x S S C , 0.1% SDS, 2 mM sodium pyrophosphate for 1 h each, at 60°C and exposed to X-OMAT™ film (Kodak, Rochester, NY). 2.6.3 Radioactive Labeling of cDNA probes 20 ng DNA fragment was combined with 200 ng hexanucleotides in 14 pi water and heat above 94°C for 3 min then place on ice for 1 min. We then added 250 uM each of dGTP, dATP, dTTP (Life Technologies, Rockville, MD), 6.6 uM [a 3 2P]-dCTP (3000 Ci/mmole, 10 mCi/ml; NEN Life Science Products, Boston, MA), and 2 U Large Fragment of DNA Polymerase I (Life Technologies, Rockville, MD) in 1x HLB (50 mM H E P E S , pH 6.9, 10 mM magnesium chloride, 6 mM 2-mercaptoethanol) and incubated at 23°C for 1-2 h. The probe was then purified by centrifugation through a G50 Sepharose bead (Pharmacia) column for 5 min and denatured with 0.4 N sodium hydroxide. 2.6.4 DNA Sequencing All sequencing not performed by the NAPS unit at the University of British Columbia was carried out using the reagents and methodologies supplied with the Perkin Elmer AmpliCycle™ sequencing kit (Roche Molecular Systems Inc., Branchburg, NJ) and [ 3 5S]-dATP (1250 Ci/mmol, 12.5 mCi/ml, NEN Life Science Products, Boston, MA). Reactions were run on 6% or 8% polyacrylamide gels (Life Technologies) with 1x T B E running buffer (10x TBE: 1 M Tris-HCl, pH 8.3, 900 mM boric acid, 10 mM EDTA). Gels were dried down and exposed to BioMax™ MR film (Eastman Kodak). 53 2.7 PROTEIN ANALYSIS 2.7.1 Cell Stimulation, Immunoprecipitations, and Immunoblotting All cells were maintained in liquid suspension culture as specified in Section 2.3.1 then were growth factor-deprived for up to 18 h at 37°C (with the exception of WEHI 231 cells) in their normal culture medium (minus added growth factors) with 0.1% (w/v) BSA. All cells (including WEHI 231) were then resuspended in fresh culture medium with 0.1% (w/v) BSA (10-50x10 6 cells/ml) and stimulated with IL-3 (400 ng/ml), S C F (400 ng/ml), anti-IgM antibody (20 pg/ml; intact or F(ab') 2 antibody fragments) for the indicated times at 37°C. Cells were washed once with ice-cold 1x Hank's balanced salt solution (Stem Cell Technologies) and solubilized (10-50x106 cells/ml) in phosphorylation solubilization buffer (PSB; 50 mM H E P E S , pH 7.4, 100 mM NaF, 10 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 4 mM EGTA, 2 mM phenylmethyl sulfonyl fluoride, 10 pg/ml leupeptin, 2 pg/ml aprotinin) with 0.5% (v/v) Nonidet P-40 (NP40) or 1% (v/v) Triton X-100 (TX-100) at 4°C for 1 h. Detergent-insoluble debris was pelleted by centrifugation (16000x g, 10 min, 4°C) and the supernatant was transferred to a new 1.5 ml Eppendorf™ microfuge tube. Immunoprecipitations were performed as follows. Antibodies were added to the cell lysates at an appropriate concentration (Section 2.7.2) and incubated with mixing for 1-2 h at 4°C. Antibody/protein complexes are then collected by incubation with 10-20 pi (bead volume) of either protein A or protein G-conjugated agarose beads (Pierce, Rockford, IL) for 2 h at 4°C. The agarose beads were then washed three times with 1 ml of P S B plus 0.1% (v/v) NP40 (or TX-100), resuspended in 80 pi 1x S D S sample buffer [4x S D S sample buffer: 34% (v/v) glycerol, 2% (w/v) SDS, 2.84 M 2-mercaptoethanol] and heated for 3 min at 100°C. Samples were then fractionated by SDS-polyacrylamide gel electrophoresis (PAGE) using the methods and equipment included with the Protean II™ electrophoresis system (Bio Rad) and the proteins from the gel transferred to BioTrace™ PVDF membrane (0.45 pm; Gelman Laboratory Ann Arbor, Ml) using a Trans Blot Cell™ transfer system (Bio Rad), as per manufacturer instructions. 54 Immunoblot analysis was carried out by first blocking the PVDF membranes with 5% (w/v) skim milk [or 5% (w/v) bovine serum albumin for anti-phosphotyrosine immunoblot analysis) dissolved in 1x Tris-buffered saline (10x TBS: 100 mM Tris-HCl, pH 7.4, 1.5 M sodium chloride, 214 mM potassium chloride) with 0.05% (v/v) Tween-20 (TBST) for 1 h at 23°C. The blot is then washed twice with TBST then incubated with the appropriate concentration of primary antibody (Section 2.7.2) diluted in TBST with 2% (w/v) BSA for 1 h at 23°C. The blot is again washed five times (5 min each) then incubated with TBST containing 90 ng/ml Donkey anti-mouse IgG or Donkey anti-rabbit IgG antibodies (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) directly conjugated to horseradish peroxidase (HRP) for 45 min at 23°C. The blot is finally washed five times (5 min each), treated with enhanced chemiluminescence reagent (NEN Life Science Products) for 1 min, and exposed to REFLECTION™ (NEN Life Science Products, Boston, MA) film. 2.7.2 Flow Cytometry Cells were resuspended in HFN (Hank's balanced salt solution, 2% (v/v) F C S , 0.2% (w/v) sodium azide) at 1x107/ml in Falcon 2058 test tubes (Becton Dickinson, Franklin Lakes, NJ). Directly conjugated FITC- or phycoerythrin-labeled antibodies were added at the appropriate concentration (see Table 2.1) to 100 pi of cells and incubated for 30 min on ice. Cells were then washed twice with 4 ml of HFN and resuspended in 500 pi of HFN plus 1 ug/ml PI. Cells were analyzed on a FACSort™ (Becton Dickinson, Franklin Lakes, NJ). For analysis of G F P expressing cells, cells were washed twice with HFN and resuspended in 500 pi of HFN plus 1 pg/ml PI. 2.7.3 Antibodies All antibodies used in the studies outlined in this thesis are listed below in Table 2.1. 55 2.8 GLUTATHIONE S-TRANSFERASE (GST) FUSION PROTEINS 2.8.1 GST Fusion Protein Constructs A large number G S T fusion proteins containing regions fused in-frame behind the 27-kDa coding region of GST were used in the studies described in this thesis. Many of these proteins were created by others and were generously donated for these studies. Table 2.2 lists the G S T fusion partner and the source of each of these constructs. Antibody Type Concentration Procedure Source Grb-2(C-1) mAb( lgGi ) 0.5 pg/ml IB Zymed (San Francisco, CA) Santa Cruz Biotechnology (Santa Grb-2 (C-23) pAb (Rb) 2 pg/ml IP Cruz, CA) Upstate Biotechnology Inc. (Lake SHIP (murine) pAb (Rb) 1:200 (IP), 1:2000 (IB) IP, IB Placid, NY) Stem Cell Technologies Inc. SHIP (murine) pAb (Rb) 1:200 (IP), 1:2000 (IB) IP, IB (Vancouver, BC) SHIP(P1C1) mAb( lgGi ) 1:500 (IP), 1:2000 (IB) IP, IB Santa Cruz Biotechnology Lyn (44) pAb (Rb) 2 ug/ml (IP), 0.2 pg/ml IP, IB Santa Cruz Biotechnology p M A P K ( T 2 0 2 / Y 2 0 4 ) pAb (Rb) 1:1000 IB New England Biolabs (Beverly, MA) M A P K (ERK-CT) pAb (Rb) 1:1000 IB Stressgen (Victoria, Canada) Anti-pTyr(4G10) mAb( lgG1) 0.5 pg/ml IB Upstate Biotechnology Inc. She pAb (Rb) 1:250 (IP), 1:1000 (IB) IP, IB Transduction Labs (Lexington, KY) c-Kit (C-19) pAb (Rb) 2ug/ml (IP), 0.5ug/ml (IB) IP, IB Santa Cruz Biotechnology c-Kit (2B8) mAb ( lgG 2 b ) 2ug/ml l I U W cytometry PharMingen (Missassauga, ON) Stat5 pAb (Rb) 1:200 (IP), 1:1000 (IB) IP, IB Dr. H. Wakao (Wakao et al., 1995) G F P (7.1 & 13.1) mAb( lgGi ) 0.5 pg/ml IB Roche (Laval, QUE) Table 2.1 List of antibodies used. Description in brackets following antibody indicates either clone number or other distinguishing characteristics of each antibody. Isotype of monoclonal antibodies (mAb) or animals of origin for polyclonal antibodies (pAb) are indicated in brackets. If concentration of antibody is unknown, the dilution of the stock is indicated. IB indicates immunoblot and IP indicates immunoprecipitation. The remainder of the GST-fusion proteins described in this thesis were produced by subcloning P C R products corresponding to the coding regions of the protein fragments of interest into the multi-cloning site 3' to the GST open reading frame (ORF) of the pGEX-5X3 plasmid (Pharmacia/LKB). Table 2.3 contains the primer pairs used to create P C R product for subcloning. These P C R products were designed with restriction enzyme sites that allowed the cDNA fragments to be subcloned in-frame with the O R F of GST. 56 Specifically, SHIP and Lyn SH2 domains were restriction enzyme digested with BamH I and EcoR I then subcloned into the unique restriction enzyme sites of pGEX-5X3, while SHIP A to G were digested with EcoR I and Xho I then subcloned into the corresponding enzyme sites. All P C R was performed with ELONGase™ enzyme mix (Life Technologies) as per manufacturer's instructions. Protein Source Grb2 C-SH3 Grb2 N-SH3 PLCy SH3 PI3-K SH3 Lyn SH3 Fyn SH3 Yes SH3 Src SH3 G A P SH3 Crk Abl SH3 Btk SH2/SH3 SHIP SH2+PxxP Dr. J.Damen (Damen et al., 1996) Dr. J.Damen (Damen et al., 1996) Upstate Biotechnology Inc. Dr. F. Jirik (University of Calgary) Dr. F. Jirik Dr. F. Jirik Dr. F. Jirik Dr. F. Jirik Dr. F. Jirik Dr. F. Jirik Dr. F. Jirik Dr. F. Jirik Dr. L.Liu (Liuetal. , 1997a) Table 2.2 G S T fusion proteins from external sources . Listed are the proteins or portions of proteins fused to GST and the sources of each. The reference describing the production of the construct is noted where applicable. Protein 5' Primer (5'-3') 3" Primer (5'-3') SHIPSH2(1-111) SHIP A (99-263) SHIP B (232-415) SHIP C (390-542) SHIP D (524-703) SHIP E (681-863) SHIP F (838-1017) SHIP G (994-1190) Lyn SH2 (128-228) AGGGGATCCATGCCTGCCATGGTC ACATGAATTCGGTGACCCACCTG CTCTGAATTCCCTGGAGTCTCTG TCTGGAATTCCCTGCAGCAGATG GGAAAGAATTCAGCAGTGGGAGTG TCTGGAATTCTTACCCGCTGGTG CTATGAATTCGCCTCTCACCCAC AGGCGAATTCTGGGGATCTGGGAA ACTGGATCCTGTGGTTCTTCAAGG CCTGAATTCCAGCATCCTCCTCCTC TTGGCTCGAGTGGTGATGGGACT GGTGCTCGAGCCATGTTCCAAGTGC AGTCCTCGAGCTGTTGACGAACCCG GCTTCTCGAGTGGCAAAGACAGG AGAGCTCGAGCCTCATTTGCCC ACAGCTCGAGCTCAAACATCTCGGG TCACCTCGAGCTCACTGCATGGC CTGGAATTCGGGACTGATGCATGC Table 2.3 P C R primer pairs used in the creation of various G S T fusion proteins. Restriction enzyme sites are indicated with bold type [EcoR I (5'-GAATTC-3'), BamH I (5'-GGATCC-3'), Xho I (5'-CTCGAG-3')]. The amino acids spanned by each protein fragment are indicated in brackets. 57 2.8.2 Purification of GST-fusion Proteins GST-fusion proteins were produced by first inoculating 2 ml of Miller's Luria-Bertani (LB) broth (Difco Laboratories, Detroit, Ml) containing 50 pg/ml ampicillin with Escherichia coli transformed with pGEX-2T or pGEX-5X3 plasmids then incubating at 37°C overnight with agitation. Overnight cultures are then added to 25 ml of Miller's LB and incubated at 37°C for 2-3 h. 100pM isopropyl beta-D-thiogalactoside (IPTG; Life Technologies) was then added the cultures and were further incubated at 37°C for 3-4 hr or 30°C overnight. Bacteria were collected by centrifugation at 3000x g, resuspended in 2 ml ice-cold lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCI, 1% (v/v) TX-100, 1 mg/ml hen egg white lysozyme, 5 mM dithiothreitol (DTT), 10 pg/ml aprotinin, 10 pg/ml leupeptin, 100 pM phenylmethyl sulfonyl fluoride, 100 pg/ml DNase I), and incubated on ice for 30 min with occasional mixing. This mixture was then sonicated 5 times, for 10 seconds, and centrifuged at 16000x g for 15 min to remove insoluble material. The supernatant was then incubated with 100 pi (approximate bead volume) of glutatione (GSH) agarose beads for 3 h at 4°C. These beads were then washed 3x with wash buffer [50 mM Tris-HCl, pH 7.5, 150 mM sodium chloride, 0.1% (v/v) TX-100, 10 pg/ml aprotinin, 10 pg/ml leupeptin, 100 pM phenylmethyl sulfonyl fluoride]. Fusion protein yields were determined by S D S -P A G E analysis followed by incubation with 0.02% (w/v) Coomassie brilliant blue (Eastman Kodak) in 25% (v/v) methanol, 10% acetic acid (v:v) for 2-5 h. Excess stain was removed using 25% methanol, 10% acetic acid until protein bands were clearly visible. 2.8.3 In vitro Protein Binding Assay Cells were stimulated and solubilized as described in Section 2.7.1 at 1-3x107 cells/ml. Cell lysates were pre-incubated with 2-5 pg of G S T protein bound to G S H beads for 4-16 h at 4°C to remove non-specific protein binding partners, then removed from the G S T beads, and incubated with 2-5 pg of individual G S T fusion proteins immobilized on G S H beads for 20 min at 4°C. Finally, beads were washed 3x with P S B containing 0.1% (v/v) NP40 or TX-100 and proteins size separated and visualized by S D S - P A G E and immunoblotting. In some cases cells were first metabolically labeled with L-[3 5S]-methionine in order to distinguish proteins from the target cell lysates from non-specific proteins of bacterial origin. For details see Section 2.8.4. 58 2.8.4 L-[35S]-Methionine Metabolic Labelling Cellular proteins from Ba F3 or DA-3 cells were subjected to L-[35S]-methionine metabolic labelling as follows. Logarithmically growing cells were washed twice with methionine-free DMEM (Life Sciences, Rockville MA) then resuspended at 1.5x106 cells/ml in methionine-free DMEM with 10% F C S (dialyzed against 1x Hank's balanced salt solution), 5 ng/ml murine IL-3, and 150 pCi/ml of EASYTAG™ L-[35S]-methionine (1175 Ci/mmol, 10.2 mCi/ml; NEN Life Science Products, Boston, MA) and incubated for 2-17 h at 37°C. Cells were then solubilized in P S B with 1% (v/v) TX-100 and protease inhibitors as described in Section 2.7.1, then incubated with 5-10 pg of G S T immobilized on G S H beads overnight. These cell lysates were then added sequentially to each G S H agarose bound GST-SHIP fusion protein (2-5 pg, 30 min, 4°C), starting with SHIP G and progressing to SHIP SH2+PxxP. Radioactively-labeled proteins bound to the GST-SHIP proteins were size separated on a 10% (w/v) S D S - P A G E , the gels fixed, treated with EN 3HANCE™ as per manufacturer's instructions (NEN Life Science Products, Boston, MA), dried, and exposed to REFLECTION™ (NEN Life Science Products) film at -70°C. 2.8.5 In Vitro Kinase Assay In vitro protein binding assay samples were obtained as described in Section 2.8.3. They were then washed once with kinase reaction buffer (50 mM sodium chloride, 5 mM manganous chloride, 10 mM H E P E S , pH 7.4) and gently rotated in 25 pi of kinase reaction buffer containing 20 uCi of EASYTIDES™ [y- 3 2P]-ATP (3000 Ci/mmol, 10 mCi/ml; NEN Life Science Products, Inc.) for 30 min at 23°C. The beads were then washed three times with P S B (see Section 2.7.1) with 0.1% (v/v) NP40, resuspended in S D S sample buffer, and boiled for 3 min prior to fractionation by S D S - P A G E . 2.9 SHIP MUTAGENESIS 2.9.1 SHIP Point-mutations A murine SHIP cDNA with a 27-bp hemagglutinin (HA)-tag fused at the 5' end, in-frame with the translation start site (previously described in Liu et al., 1997a) was subcloned into the Xho I (5') and EcoR I (3') restriction enzyme sites of pBS K S + (Statagene, La Jolla, CA). This construct was used as starting material for production of 59 WT SHIP and all SHIP point mutants. The D675G point mutant was generated by P C R -site directed mutagenesis using the reagent and methodology supplied with the QuickChange™ site-directed mutagenesis kit (Stratagene, La Jolla, CA). Primers used were: 5 ' - G C C G T C C T G G T G C G A ^ G C C G A G T C C T C T G G A A G T - 3 ' and 5'-C T T C C A G A G G A C T C G G T _ > c C G C A C C A G G A C G G C - 3 ' (superscript indicates the specific nucleotide substitutions). The R34G mutant was generated using the primers: 5'-G G A G C T T C C T T G T G c ^ G G T G C C A G C G A G T C C A - 3 ' and 5'-T G G A C T C G C T G G C A C G ^ c C A C A A G G A A G C T C C - 3 ' . The 2NPXF double point mutant was generated in two rounds of site-directed mutagenesis first to mutate the INPNY917—>F with the following primers: 5 ' - A T G A T C A A T C C A A A C T A ^ T C A T T G G T A T G G G G - 3 ' and 5 -C C C C A T A C C A A T G T ^ A A G T T T G G A T T G A T C A T - 5 ' , and then to mutate the E N P L Y 1 0 2 t U F using the primers: 5 ' - T T T G A G A A C C C A C T G T A ^ T T G G A T C C G T G A G T - 3 ' and 5'-A C T C A C G G A T C C A T _ > A A C A G T G G G T T C T C A A A - 3 ' . The C-termini of all SHIP constructs generated above were replaced with a P C R product lacking the stop codon, using the following primers: 5'-A T G A C T G G C C A C T T C A G G G G A G A G A T T - 3 ' (Msc I restriction enzyme site is bolded) and 5 ' - G T C G A A T T C A _ ' G C T G C A T G G C A G T C C T - 3 ' (EcoR I site bolded). All P C R was performed with ELONGase™ enzyme mix (Life Technologies) as per manufacturer's instructions. The C-termini were swapped with the P C R product by restriction enzyme digestion of both the P C R product and the pBS KS + -SHIP with Msc I and EcoR I. Products were gel purified and subcloned into the unique Msc I (5') and EcoR I (3') sites within pBS KS + -SHIP vectors. The resultant cDNAs were then removed from pBS K S + by restriction enzyme digestion with Xho I (5') and EcoR I (3') then subcloned into the corresponding unique site in pEGFP-N1 (Clontech). This step created HA-SHIP cDNAs fused in-frame with the enhanced G F P . The final step was to remove the HA-SHIP-GFP fusion cDNAs from the pEGFP-N1 vector. First, the vectors were restriction enzyme digested with Eag I (3') (with the exception of the D675G mutant, which was cut at the unique Not I site found at the same location; bp 1402, manufacturer's numbering) and the 5' overhang filled with T4 DNA polymerase as per manufacturer's instructions (Life Technologies). The linearized and blunted vectors were then restriction enzyme digested 60 with Xho I (5') and subcloned into the unique Xho I (5') and Hpa I (3') sites of the MSCV-Pac retroviral vector (kind gift of R.Hawley, Oncology Gene Therapy Program, Toronto, ONT) multi-cloning site. An MSCV-Pac construct containing just E G F P was also created by removing the E G F P coding sequence from the pEGFP-N1 vector in a similar fashion to the removal of the SHIP-GFP fusions. Briefly, pEGFP-N1 was first digested with Eag I (3') and the 5' overhang filled using T4 polymerase (Life Technologies). It was then digested at the unique Xho I (5') site, to release the G F P coding sequence. Finally, the G F P cDNA fragment was gel purified and subcloned into the unique Xho I (5') and Hpa I (3') sites in the MSCV-Pac vector. 2.9.2 SHIP Truncation Mutants The T1, T2, and T3 SHIP truncation mutant MSCV-Pac constructs were created identically to the WT HA-SHIP construct described above, with only the following differences. The C-termini of the truncation mutants were swapped with P C R fragments that were designed to lack portions of the C-terminal tail. The following 3' primers were used in conjunction with the 5' primer mentioned above: T1 3' primer= 5'-C T G C A G A A T T C T C A T C T C A A T G A G G C T - 3 ' , T2 3' primer= 5'-C T G C A G A A T T C T G G A A G A T G A A A A C T T - 3 ' , T3 3' primer= 5'-C T G C A G A A T T C A G G A A C T C A C G G A T C C - 3 ' (EcoR I sites are in bold-face type). 2.10 BIOLOGICAL ANALYSIS OF BONE MARROW-DERIVED MAST CELLS 2.10.1 Ptdlns3,4,5P3 Measurements Cells were maintained in IMDM with 10% F C S and 150 pM monothioglycerol for 16 h to deprive them of IL-3. They were then washed twice, resuspended at 1 x 10 7 cells/ml in phosphate-free RPMI 1540 containing 0.5% F C S (dialyzed against 1x Hank's balanced salt solution), 10 mM H E P E S , pH 7.4, and 0.5 mCi/ml [32P]-orthophosphoric acid (9120 Ci/mmol, 5 mCi/ml; NEN Life Science Products, Boston, MA), and incubated for 90 min, at 37°C. Cells were then stimulated with 400 ng/ml S C F for 2 min at 37°C and [ 3 2P]-phosphate incorporation stopped by the addition of 3.75 ml of methanol: chloroform (2:1, 61 v:v). Lipids were then extracted with 2.4 N sodium hydroxide and chloroform (1:1, v:v) by collection of the lower organic phase, followed by re-extraction of the upper aqueous phase with 1 ml methanol: chloroform (2:1, v:v). The combined lower organic phases were then washed twice with 1 ml methanol: 0.1 M EDTA (1:1, v:v) and dried under nitrogen. The dried lipids were then deacylated by adding 1.8 ml of methylamine reagent (methanol: 25% methylamine: 1-butanol, 45.7:42.8:11.4, v:v:v) and incubated for 50 min at 53°C. The deacylated lipids were dried in vacuo, resuspended in 1 ml of distilled water, and dried again to remove residual methylamine. Samples were resuspended in 1 ml distilled water and extracted with 2 ml n-butanol: ether: ethylformate (20:4:1, v:v:v), vortexed and centrifuged briefly to separate the phases. The lower phase was collected and dried overnight in vacuo then resuspended in 250 pi of distilled water and subjected to high-pressure liquid-phase chromatography utilizing a Partisil 10 S A X ion exchange column. The column was washed for 10 min with high-pressure liquid-phase chromatography-grade water then subjected to a 60 min, 0-0.25 M ammonium phosphate (pH 3.8) gradient, followed by a 50 min, 0.25-1.0 M ammonium phosphate (pH 3.8) gradient. Fractions were collected (1 ml each) and monitored for radioactivity by scintillation counting. 2.10.2 Degranulation Assay BMMCs (5x105) were washed and resuspended in 410 pl/sample of Tyrode's buffer (10 mM H E P E S pH 7.4, 130 pi sodium chloride, 5 mM potassium chloride, 1.4 mM calcium chloride, 1 mM magnesium chloride, 5.6 mM glucose, 0.1% (w/v) BSA). Stimulate cells at 37°C, 15 min. Two equal fractions were collected (190 pi) as duplicates samples and centrifuged in a microfuge (300x g, 4°C, 10 min). The supernatants containing B-hexosaminidase released during stimulation were transferred to new tubes on ice (released B-hexosaminidase) and 300 pi of Tyrode's buffer + 0.5% (v/v) NP40 was added to the pellets in order to lyse the cells for collection of the remaining unreleased B-hexosaminidase. The cells were mixed at 4°C for 1 h in this lysis buffer then the insoluble fraction, containing mostly unsolubilized nuclei and cytoskeleton, was pelleted by centrifugation (16000x g, 10 min, 4°C) and the supernatant transferred to a new tube (unreleased B-hexosaminidase). 10 pi of each supernatant and pellet were placed into 62 wells of a 96-well, flat-bottom Falcon plate (Becton Dickinson) along with 50 pi of the 3-hexosaminidase substrate p-nitrophenyl N-acetyl-3-D-glucosaminidine. The 3-hexosaminidase was allowed to react with the substrate for 90 min at 37°C, at which time the reaction was stopped by denaturing the enzyme with the addition of 150 pi, 0.2 M glycine, pH 10.7. Optical density of each sample was measured at 405 nm. 2.10.3 Intracellular C a 2 + Influx A s s a y BMMCs were washed once in Tyrode's buffer (Section 2.9.2) then resuspended at a concentration of 5x10 5 cells/ml in Tyrode's buffer containing 2 pM FURA-2/AM (Molecular Probes, Eugene, OR). Cells were protected from light and incubated with mixing for 45 min, at 23°C to allow the FURA-2/AM to accumulate in the cells' cytoplasm. Cells were then washed twice with Tyrode's buffer to remove any extracellular FURA-2/AM and resuspended at 5x10 5 cells/ml (Tyrode's buffer). The influx of calcium into the cytoplasm was measured in real-time by placing 1 ml of cells into a quartz cuvette then monitoring the fluorescence intensity at 510 nm, before and after S C F stimulation. Samples were excited with light waves of 340 nm and 380 nm in an MC200 monochromator (SLM-Aminco, Urbana, IL), controlled by the 8100 V3.0 software program. 63 Chapter 3 CLONING A N D PRELIMINARY CHARACTERIZAT ION OF H U M A N SH2-CONTAINING INOSITOL 5 - P H O S P H A T A S E , SHIP 3.1 INTRODUCTION We and others have shown that activation of many hematopoietic cell surface receptors stimulate the association of She not only with Grb2/Sos1 complexes but also with a tyrosine phosphorylated 145-kDa protein (Damen et al., 1993; Lioubin et al., 1994; Matsuguchi et al., 1994; Ravichandran et al., 1993; Saxton et al., 1994; Smit et al., 1994). Others in this laboratory were responsible for cloning a cDNA encoding this 145-kDa protein from the murine hematopoietic cell line, BeSUtA^ and identified it as a novel SH2-containing inositol polyphosphate 5-p.hosphatase (5-ptase), SHIP (Damen et al., 1996). In vitro phosphatase assays demonstrated that this protein is unique in its substrate specificity, hydrolyzing only Ptdlns3,4,5P 3 and lns1,3,4,5P 4 (Damen et al., 1996). In preliminary studies with the human hematopoietic cell lines M07e and TF-1 we also observed a 145-kDa protein that became tyrosine phosphorylated and associated with She following cytokine stimulation (Damen et al., 1993; Liu et al., 1994), indicating that there is a human homologue of murine SHIP. We report here the cloning and preliminary characterization of this human SHIP. 3.2 R E S U L T S AND DISCUSSION We believed from earlier studies that a homologue of murine p145 SHIP was expressed in human cells. As an initial experiment to confirm the presence of a similar gene in humans, Southern blot analysis was carried out with both murine ^ S U t A ^ and human (M07e) genomic DNA using a 1.5-kb cDNA probe corresponding to 3' portion of mSHIP (Figure 3.1). A comparison of the two species, shown in Figure 3.1, revealed the ability of the murine probe to cross-hybridize at high stringency with human genomic DNA fragments of similar complexity. This revealed a high degree of similarity between the 64 B6SUtAj D P He E Hd M07e D P He E Hd 1.5 kb Probe SH2 5-ptase proline-rich Figure 3.1 SHIP Southern blot analysis of murine and human genomic DNA. Ten micrograms of genomic DNA isolate from murine (B6SUtA-i; left panel) and human (M07e; right panel) hematopoietic cell lines was restriction enzyme digested with Dra I (D), Pst I (P), Hinc II (He), EcoR I (E), or Hind III (Hd) and probed with a 1.5-kb cDNA fragment corresponding to the 3' end of mSHIP (lower panel). Film was exposed for 3 days at -70°C. human and mouse SHIP proteins. Based on these findings, a Agt11 cDNA library generated from M 0 7 e poly-A + R N A was screened with two non-overlapping mSHIP cDNA fragments of 1.5- and 1.2-kb, corresponding to the 5' end and central portions of mSHIP, respectively. These probes were selected because they contained the coding regions of the functionally defined SH2 and 5-ptase catalytic domains and thus were believed to be highly conserved among mammalian species. From our initial screening of 1x10 6 pfu, nine clones capable of 65 hybridizing with both mSHIP probes were isolated and further characterized. One of these clones (clone 12; Figure 3.2) contained a cDNA insert of 4870-bp with 128-bp of potential 5' untranslated region (UTR) sequence, an open reading frame of 3564 bp, beginning with an A T G predicted to be an appropriate translational start site (Kozak, 1987) (Figures 3.2 & 3.3), and 1178-bp of 3' UTR sequence including the poly-A tail. A second 2750-bp clone (clone 11; Figure 3.2), partially overlapping the first and extending a further 406-bp upstream, was found to be interrupted by two consecutive stop codons before another potential start codon was found, indicating that the aforementioned start codon was in fact the most likely protein initiation site (Figures 3.2 & 3.3). Conceptual translation predicted a protein of 1188 amino acids sharing 87.2% sequence identity with mSHIP (Figure 3.4). GenBank database searches using NCBI-BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) identified several potential functional motifs including an SH2 domain, three putative PTB ligand sites, two critical 5-ptase motifs, and a proline-rich carboxy-terminal tail containing several potential SH3 ligand motifs. Sequence analysis also revealed three PEST sequences (Figures 3.2 & 3.3) and two short, simple repeats within the untranslated regions (Figures 3.2 & 3.4). Furthermore, the unusually large 5' UTR of hSHIP (513 nucleotides) contains five open-reading frames (ORF) upstream of the putative start site, including a relatively large 240 nucleotide O R F initiating at bp 66 (Figure 3.3). The presence of upstream ORFs has been linked to regulation of translational efficiency, owing to the fact that scanning ribosomes generally select the first A U G they encounter as the site of initiation (Gray and Wickens, 1998; van der Velden and Thomas, 1999). Often the presence of upstream ORFs results in a reduction of translational efficiency (eg. c-mos expression during spermatogenesis), however, in some instances (eg. retinoic acid receptor-B2), they can stimulate translation in a tissue-specific manner (van der Velden and Thomas, 1999). Therefore, these features could constitute a translational regulatory mechanism, competing with the SHIP start site and affecting its translation, possibly in a tissue or developmentally specific manner. With the recent advances in our knowledge of how the regulation of mRNA translation, further studies of these features could prove very valuable in our understanding of how SHIP protein expression is regulated. 66 A T G "* O R F >TGA 5' U T R 1SH2 Y Y 5-ptase proline-rich 3' U T R 1 'AAA N clone 12 11 10 'AAA, •AAA N AAA-N J_ J_ 2 3 kilobases (kb) 4 Figure 3.2 Schematic Diagram of the hSHIP cDNA. Shaded regions indicate the SH2 domain, 5-ptase domain, and proline-rich region. Three putative PTB domain ligand sites (Y), three PEST sequences (•), and the location of short TAA (A) and GT (•) repeats within the 3' and 5' UTRs are also indicated. Asterisks indicate two in-frame stop codons in the 5' UTR. All nine cDNA clones isolated from library screens are aligned below the full-length cDNA (5273 bp). ORF designates the open reading frame of the cDNA and the poly A tail (AAAN) is indicated at the 3' end of the cDNA. 67 Figure 3 .3 Human SHIP cDNA sequence. The open reading frame is indicated in bold capital letters while 5 ' and 3' untranslated regions (UTRs) are denoted by lowercase type. Also identified are simple repeats in the 5 ' and 3' UTRs (unshaded boxes), the Kozac sequence that precedes the ORF start site (shaded box), and ATG codons present in the 5' UTR (bold underline text). Asterisks indicate two stop codons in the 5' UTR in-frame with the hSHIP ORF. 68 1 ctagggcatg gcatcccacg tgggtgtcag cacggccgca gaagaaccac t t c t c t g g c c 61 cacccatgcc tgctaggcca t g c t t c t t c a gaagtggcca c a a c t c t c c t g a c g t c t c c a 121 gagccggtca t t c c a c c c a g ggggacttca gctgccactg g a c a c t t c a a t t g t a c g c t g 181 cgaccagttg ccaggaagga gagggctggc aagaaagccg cggcagccgt ggcagggtgt 241 atgggacggt ggacggccag ggcccccccjc t c t c t c t c t t t c t c t c t c t c t c t c t j t g c t t * * * * * * 301 g g t t t c t g t a atgaggaagt tctccgcagc t c a g t t t c c t t t c c c t c a c t gagcgcctga 361 aacaggaagt c a g t c a g t t a agctggtggc agcagccgag gccaccaaga ggcaacgggc 421 ggcaggttgc agtggagggg c c t c c g c t c c cctcggtggt gtgtgggtcc tgggggtgcc 481 tgccggccca gccgaggagg cccacgccca ccATGd/TCCC CTGCTGGAAC CATGGCAACA 541 TCACCCGCTC CAAGGCGGAG GAGCTGCTTT CCAGGACAGG CAAGGACGGG AGCTTCCTCG 601 TGCGTGCCAG CGAGTCCATC TCCCGGGCAT ACGCGCTCTG CGTGCTGTAT CGGAATTGCG 661 TTTACACTTA CAGAATTCTG CCCAATGAAG ATGATAAATT CACTGTTCAG GCATCCGAAG 721 GCGTCTCCAT GAGGTTCTTC ACCAAGCTGG ACCAGCTCAT CGAGTTTTAC AAGAAGGAAA 781 ACATGGGGCT GGTGACCCAT CTGCAATACC CTGTGCCGCT GGAGGAAGAG GACACAGGCG 841 ACGACCCTGA GGAGGACACA GAAAGTGTCG TGTCTCCACC CGAGCTGCCC CCAAGAAACA 901 TCCCGCTGAC TGCCAGCTCC TGTGAGGCCA AGGAGGTTCC TTTTTCAAAC GAGAATCCCC 961 GAGCGACCGA GACCAGCCGG CCGAGCCTCT CCGAGACATT GTTCCAGCGA CTGCAAAGCA 1021 TGGACACCAG TGGGCTTCCA GAAGAGCATC TTAAGGCCAT CCAAGATTAT TTAAGCACTC 1081 AGCTCGCCCA GGACTCTGAA TTTGTGAAGA CAGGGTCCAG CAGTCTTCCT CACCTGAAGA 1141 AACTGACCAC ACTGCTCTGC AAGGAGCTCT ATGGAGAAGT CATCCGGACC CTCCCATCCC 1201 TGGAGTCTCT GCAGAGGTTA TTTGACCAGC AGCTCTCCCC GGGCCTCCGT CCACGTCCTC 1261 AGGTTCCTGG TGAGGCCAAT CCCATCAACA TGGTGTCCAA GCTCAGCCAA CTGACAAGCC 1321 TGTTGTCATC CATTGAAGAC AAGGTCAAGG CCTTGCTGCA CGAGGGTCCT GAGTCTCCGC 1381 ACCGGCCCTC CCTTATCCCT CCAGTCACCT TTGAGGTGAA GGCAGAGTCT CTGGGGATTC 1441 CTCAGAAAAT GCAGCTCAAA GTCGACGTTG AGTCTGGGAA ACTGATCATT AAGAAGTCCA 1501 AGGATGGTTC TGAGGACAAG TTCTACAGCC ACAAGAAAAT CCTGCAGCTC ATTAAGTCAC 1561 AGAAATTTCT GAATAAGTTG GTGATCTTGG TGGAAACAGA GAAGGAGAAG ATCCTGCGGA 1621 AGGAATATGT TTTTGCTGAC TCCAAAAAGA GAGAAGGCTT CTGCCAGCTC CTGCAGCAGA 1681 TGAAGAACAA GCACTCAGAG CAGCCGGAGC CCGACATGAT CACCATCTTC ATCGGCACCT 1741 GGAACATGGG TAACGCCCCC CCTCCCAAGA AGATCACGTC CTGGTTTCTC TCCAAGGGGC 1801 AGGGAAAGAC GCGGGACGAC TCTGCGGACT ACATCCCCCA TGACATTTAC GTGATCGGCA 1861 CCCAAGAGGA CCCCCTGAGT GAGAAGGAGT GGCTGGAGAT CCTCAAACAC TCCCTGCAAG 1921 AAATCACCAG TGTGACTTTT AAAACAGTCG CCATCCACAC GCTCTGGAAC ATCCGCATCG 1981 TGGTGCTGGC CAAGCCTGAG CACGAGAACC GGATCAGCCA CATCTGTACT GACAACGTGA 2041 AGACAGGCAT TGCAAACACA CTGGGGAACA AGGGAGCCGT GGGGGTGTCG TTCATGTTCA 2101 ATGGAACCTC CTTAGGGTTC GTCAACAGCC ACTTGACTTC AGGAAGTGAA AAGAAACTCA 2161 GGCGAAACCA AAACTATATG AACATTCTCC GGTTCCTGGC CCTGGGCGAC AAGAAGCTGA 2221 GTCCCTTTAA CATCACTCAC CGCTTCACGC ACCTCTTCTG GTTTGGGGAT CTTAACTACC 69 2281 GTGTGGATCT GCCTACCTGG GAGGCAGAAA CCATCATCCA AAAAATCAAG CAGCAGCAGT 2341 ACGCAGACCT CCTGTCCCAC GACCAGCTGC TCACAGAGAG GAGGGAGCAG AAGGTCTTCC 2401 TACACTTCGA GGAGGAAGAA ATCACGTTTG CCCCAACCTA CCGTTTTGAG AGACTGACTC 2461 GGGACAAATA CGCCTACACC AAGCAGAAAG CGACAGGGAT GAAGTACAAC TTGCCTTCCT 2521 GGTGTGACCG AGTCCTCTGG AAGTCTTATC CCCTGGTGCA CGTGGTGTGT CAGTCTTATG 2581 GCAGTACCAG CGACATCATG ACGAGTGACC ACAGCCCTGT CTTTGCCACA TTTGAGGCAG 2641 GAGTCACTTC CCAGTTTGTC TCCAAGAACG GTCCCGGGAC TGTTGACAGC CAAGGACAGA 2701 TTGAGTTTCT CAGGTGCTAT GCCACATTGA AGACCAAGTC CCAGACCAAA TTCTACCTGG 2761 AGTTCCACTC GAGCTGCTTG GAGAGTTTTG TCAAGAGTCA GGAAGGAGAA AATGAAGAAG 2821 GAAGTGAGGG GGAGCTGGTG GTGAAGTTTG GTGAGACTCT TCCAAAGCTG AAGCCCATTA 2881 TCTCTGACCC TGAGTACCTG CTAGACCAGC ACATCCTCAT CAGCATCAAG TCCTCTGACA 2941 GCGACGAATC CTATGGCGAG GGCTGCATTG CCCTTCGGTT AGAGGCCACA GAAACGCAGC 3001 TGCCCATCTA CACGCCTCTC ACCCACCATG GGGAGTTGAC AGGCCACTTC CAGGGGGAGA 3061 TCAAGCTGCA GACCTCTCAG GGCAAGACGA GGGAGAAGCT CTATGACTTT GTGAAGACGG 3121 AGCGTGATGA ATCCAGTGGG CCAAAGACCC TGAAGAGCCT CACCAGCCAC GACCCCATGA 3181 AGCAGTGGGA AGTCACTAGC AGGGCCCCTC CGTGCAGTGG CTCCAGCATC ACTGAAATCA 3241 TCAACCCCAA CTACATGGGA GTGGGGCCCT TTGGGCCACC AATGCCCCTG CACGTGAAGC 3301 AGACCTTGTC CCCTGACCAG CAGCCCACAG CCTGGAGCTA CGACCAGCCG CCCAAGGACT 3361 CCCCGCTGGG GCCCTGCAGG GGAGAAAGTC CTCCGACACC TCCCGGCCAG CCGCCCATAT 3421 CACCCAAGAA GTTTTTACCC TCAACAGCAA ACCGGGGTCT CCCTCCCAGG ACACAGGAGT 3481 CAAGGCCCAG TGACCTGGGG AAGAACGCAG GGGACACGCT GCCTCAGGAG GACCTGCCGC 3541 TGACGAAGCC CGAGATGTTT GAGAACCCCC TGTATGGGTC CCTGAGTTCC TTCCCTAAGC 3601 CTGCTCCCAG GAAGGACCAG GAATCCCCCA AAATGCCGCG GAAGGAACCC CCGCCCTGCC 3661 CGGAACCCGG CATCTTGTCG CCCAGCATCG TGCTCACCAA AGCCCAGGAG GCTGATCGCG 3721 GCGAGGGGCC CGGCAAGCAG GTGCCCGCGC CCCGGCTGCG CTCCTTCACG TGCTCATCCT 3781 CTGCCGAGGG CAGGGCGGCC GGCGGGGACA AGAGCCAAGG GAAGCCCAAG ACCCCGGTCA 3841 GCTCCCAGGC CCCGGTGCCG GCCAAGAGGC CCATCAAGCC TTCCAGATCG GAAATCAACC 3901 AGCAGACCCC GCCCACCCCG ACGCCGCGGC CGCCGCTGCC AGTCAAGAGC CCGGCGGTGC 3961 TGCACCTCCA GCACTCCAAG GGCCGCGACT ACCGCGACAA CACCGAGCTC CCGCATCACG 4021 GCAAGCACCG GCCGGAGGAG GGGCCACCAG GGCCTCTAGG CAGGACTGCC ATGCAGTGAa 4081 gccctcagtg agctgccact gagtcgggag cccagaggaa cggcgtgaag ccactggacc 4141 ctctcccggg acctcctgct ggctcctcct gcccagcttc ctatgcaagg ctttgtgttt 4201 tcaggaaagg gcctagcttc tgtgtggccc acagagttca ctgcctgtga ggcttagcac 4261 caagtgctga ggctggaaga aaaacgcaca ccagacgggc aacaaacagt ctgggtcccc 4321 agctcgctct tggtacttgg gaccccagtg cctcgttgag ggcgccattc tgaagaaagg 4381 aactgcagcg ccgatttgag ggtggagata tag^taataa taatattaat aataataajtg 4441 gccacatgga tcgaacactc atgatgtgcc aagtgctgtg ctaagtgctt tacgaacatt 4501 cgtcatatca ggatgacctc gagagctgag gctctagcca cctaaaacac gtgcccaaac 70 4561 ccaccagttt aaaacggtgt gtgttcggag 4621 cctggagtga gacaagggct cggccttaag 4681 gtacaagaag cctgttctgt ccagcttcag 4741 gggttccggc atggctaggc tgagagcagg 4801 gaaggagcag gaaatcagct cctattctcc 4861 gagatgccaa ggcctgtgcc aggttccctg 4921 gccacagtta agccaagccc cccaacatgt 4981 tgttgctccc gaaagccgtg ctctccagcc 5041 ccaggctctt gaaatagtgc agccttttct 5101 cttggttatt aggagaatag atgggtgatg 5161 agaattaatg tagggagcta aatccagtgg 5221 acattcccat gatggaagtc tgcgtaacca gggtgaaagc attaagaagc ccagtgccct gagctgaaga gtctgggtag cttgtttagg tgacacaagc tgctttagct aaagtcccgc gatctacctg gcttctcagt tctttggttg agtggagaga tctggcctca gcttgggcta tgccctcctc gaggtgggca gccatcacca attccatcgt gctggtagaa gagtctttgc tggctgccag ggagggtggg cctcttggtt tcctatctct gtggctttca gctctgcttc tc t t tcct ta tgttgctttt tcaacatagc tgtgtgtgaa tgcagaaggg aatgcacccc ataaattgtg cctttcttaa aaa 71 Figure 3.4 Alignment of the human and murine SHIP protein sequences. Identical residues in both sequences are indicated in bold uppercase type. Other notable features include the SH2 domains (gray shaded box), 5-ptase motifs 1 and 2 (unshaded boxes), NxxY motifs (unshaded boxes), class I (**) and class II (AA) SH3 ligand motifs, and a potential Grb2 SH2 binding site (YxN; gray shaded box). PEST sequences are indicated in italic underlined type. Numbers in brackets designate conserved PxxP motifs discussed in more detail in later chapters. 72 ix ix H H CM CM Q Q Ul CO 5 3 ix >< U U U ctf h h H H H H a a 0 o a a ca co I i H H C 5 CD 01 Oi CD CD 0) CO tf tf a a co ca i i o CD H H tf tf H EH < < £S Pi Pi ca ca s » Q Q ca ca H H a a J j a a CM PM a Q (r> H PM PM ix ix CO ca H H J PM PM H r H 43 to a a tf 4J nl > CD W M X K H H J J nj 4J PM PM W W I • i J J • tf tt cr 3 CD CD «< h H H PM PM C J u CD CD CD CD > g W M CD CD ca C D • H ix * * ca CO 5 5 w H PM PM Q Q 5 5 5 5 ca ca H H Q a • H E ca ca W w ca ca 4J c tf W • H r H H H CO CO ca CO ca CO H H tn > J ra Cn H H o C J w as tt a a PM PM p Q rrj > PM PM co ca H H a oi 73 a> tf tf tf tf PM PM ctf > ft rH tf tf PM PM DM tf ca ca ca co rH > ca ca P CD PM PM 5 5 5 5 i f H H PM PM tf tf H H J h] f t r H J i J 0 a H H a a f t r H J J 4 J ( t f T ) < D 01 > (tf • C • a a R * tf « * CO CO * PM CM * tf tf * - H > * PM CM tf tf tf tf (tf > CM CM < < a a CO CO ca ca > (S ft w 4J (S tf tf CM CM tf tf CD C D a a CO CO tf tf a Q CD CD Cn to (tf J-> « I CD C D H H M [» 00 H 00 rH 00 rH CO rH oo H CO rH CO H CO rH 00 H 00 o> Ol Ol rH rH CM O cn O Ol O ai O Ol O Ol O Ol O oi O Ol o Ol Ol o o H rH CN CN ci co * •"»• in in «> 1- I- CO 00 Ol CM Ol rH rH PM PM PM PM PM PM PM PM CM CM CM CM CM CM CM CM PM CM CM CM CM CM CM CM H H H H H H H H H H H H H H H H H H H H H H H H W X W K tf tf tf tf tf tf S tf tf tf tf » tf tf tf tf tf s tf tf CO CO CO CO CO CO ca CO ca CO CO co ca CO ca CO CO CO CO CO CO CO ca ca A e .Q 6 A e A e A e X! e A e A e 6 A e X! e J3 e An examination of the hSHIP primary sequence revealed that its amino-terminal SH2 domain was 93% identical at the peptide level to that of mSHIP and that it shared significant sequence identity with members of the Group IB family of SH2 domains (Figure 3.5). This group includes the SH2 domains of the Abl family, Grb2, Tec, and Tsk/ltk, all of which are characterized by the presence of an aromatic residue (predominantly tyrosine) at the BD5 position (Eck et al., 1993; Songyang et al., 1993). This residue has recently been shown to be critical for distinguishing between the phosphopeptide specificity of Group I (aromatic residue) and Group III (aliphatic residue) SH2 domains (Songyang et al., 1995). In addition, apart from the absence of a histidine in the BD4 position, several other invariant amino acids and well conserved basic amino acids believed to participate in SH2 domain interactions with tyrosine phosphorylated sequences (Koch et al., 1991) are present in both SHIP species. This indicates that hSHIP likely contains a functional class I SH2 domain. The central region of both human and mSHIP contains two motifs characteristic of 5-ptases (Jefferson and Majerus, 1995) (indicated as boxed motifs 1 and 2 in Figure 3.4). Sequence comparison of these two motifs with other 5-ptases (and with several predicted translation products which share high sequence homology but as of yet possess unknown catalytic activity) illustrates a high degree of similarity, especially with the presynaptic 5-phosphatase, Synaptojanin 1 (McPherson et al., 1996) and SH2-containing inositol 5-phosphatase, SHIP2 (Pesesse et al., 1997) (Figure 3.6). Interestingly, Synaptojanin 1 (145/170-kDa), SHIP2 (150-kDa), and SHIP (145-kDa) also share large regions of amino acid homology N-terminal to the 5-ptase domain, possess similar molecular masses, and, in general, have a common structure, with a central 5-ptase domain preceding a C-terminal proline-rich tail. The proline-rich regions within these three proteins most likely facilitate phosphorylation-independent protein-protein interactions with SH3 domain-containing proteins. This is indicated by the identification of six highly conserved PxxP sequences, five of which constitute class I and class II SH3 domain ligands (Alexandropoulos et al., 1995; Feng et al., 1994) in the hSHIP sequence (indicated by asterixes and filled triangles in Figure 3.4). Furthermore, mSHIP (Damen et al., 1996) and Synaptojanin 1 (McPherson et al., 1996) and 2 (Nemoto et al., 1997) bind a variety of SH3 74 Figure 3.5 Compar ison of the SH2 domain of hSHIP with other related SH2 domains. Shown are the SH2 domains of mSHIP (GenBank accession no. U39203), the human PTKs Abl 1 and Abl 2 (SwissPro accession nos. P00519 and P42684), Tsk/ltk (SwissPro accession no. Q08881), and Tec (SwissPro accession no. P42680), and the adaptor molecule Grb2 (SwissPro accession no. P29354). Identical residues are shaded in black and conservative changes are shaded in gray. Features identified in Koch et al. (1991), including conserved motifs I through V (solid lines), variable transition regions i to iv (broken lines), invariant residues (A), and conserved basic amino acids (*) are indicated, as well as the position of the |3D5 residue in motif III ( • ) that distinguishes the ligand specificity of group I and group III SH2 domains. The position number of the initial amino acid for each SH2 domain is identified in brackets. 75 Figure 3.6 Compar ison of the 5-ptase motifs 1 and 2 of hSHIP with related 5-ptases. Proteins compared are mSHIP (GenBank accession no. U39203); SHIP2 (EMBL accession no. Y14385); OCRL-1, protein mutated in Lowe's oculocerebrorenal syndrome (GenBank accession no. M88162); Synaptojanin 1, the rat presynaptic 5-ptase (GenBank accession no. U45479); 5-Ptase II, the human type II 5-ptase (SwissPro accession no. P32019); 5-Ptase I, the type I 5-ptase; YAI2, a hypothetical 108.4-kDa yeast sequence (SwissPro accession no. P40559); and C50C3.7, a hypothetical 45.2-kDa Caenorhabditis elegans protein encoded by a gene on chromosome III (SwissPro no. P34370). Identical amino acids are shaded in black and conservative changes are shaded in gray. The starting position of the amino acid for each sequence is contained in brackets. 77 O Pi O cu , O R eS <7T 60 R Cc^  ^ fT M i CO "5 « j a S co 5 o a i CU 03 IT) u o IT) u • - H r ^ i © M O N ^ OO O N 00 0 0 0 n h h o s I 2 SB 5 H S y co O a. % Is CO IT) IT) 4> 03 £ u o IT) u 78 domains in vitro. Further studies to identify proteins that associate with SHIP via these proline-rich regions may prove very important in understanding how the role of SHIP in intracellular signalling is regulated, particularly by subcellular localization, since many SH3-bearing proteins are cytoskeletal in nature (Kay et al., 2000). SHIP and SHIP2 share a further common feature in that they are the only known 5-ptases that have an SH2 domain that binds transiently to the pITIM of the FcyRllb receptor (Muraille et al., 2000; Ono et al., 1996; Tridandapani et al., 1997b) and the adaptor molecule She (Damen et al., 1996; Wisniewski et al., 1999). The SHIP family may therefore have a unique role amongst 5-ptases in transmitting and/or terminating signals emanating from cell surface receptor systems. Related to this both human and mouse SHIP contain two NPxY sequences in their C-termini (indicated by open triangles in Figure 3.2 and filled circles in Figure 3.4) that, in a tyrosine phosphorylated state, could serve as binding sites for PTB domain-containing proteins such as She (Laminet et al., 1996). In fact, Lioubin et al. (1996) independently isolated mSHIP using the yeast two-hybrid system based on the ability of the INPNpY and ENPLpY containing regions of SHIP to bind to the She PTB domain. A third potential PTB ligand site was also identified that fit the minimum NxxY criterion identified by van der Geer et al. (1996a). However, it is not yet known whether the RRNQNpY sequence in SHIP can bind any PTB domain containing protein. These authors also reported that an arginine at the -5 position greatly enhanced the affinity of NxxpY containing sequences for the PTB domain of She, further suggesting that this could be a potential PTB ligand. Coincidentally, the tyrosine within the R R N Q N Y sequence is also part of an YxN sequence (light gray box in Figure 3.4), which could be recognized either by the Grb2 SH2 domain, or potentially by SHIP'S own SH2 domain, since it also interacts with pYxN sequences (Liu et al., 1994). This might enable SHIP to fold over on itself to regulate the functioning of its own SH2 domain. An analysis of the hSHIP amino acid sequence using the program PEST-FIND (PC Gene analysis software) indicated the presence of three areas containing unusually high combinations of prolines (P), glutamic/aspartic acids (E/D), serines (S), and threonines (T), 79 ie. P E S T sequences (indicated by filled circles in Figure 3.2 and shaded boxes in Figure 3.4). These regions, originally defined by S.W. Rogers, might constitute signals for rapid degradation of proteins (Rechsteiner and Rogers 1996), although some recent evidence has raised serious questions about the role of these sequences in protein degradation (Miyazaki et al., 1993; Nixon et al., 1995). Two of these P E S T sequences are highly conserved in murine SHIP and we have suggested that they could regulate proteolytic cleavage of the C-terminal tail of SHIP (Damen et al., 1998). To establish the tissue expression pattern of hSHIP, a 1.7-kb fragment corresponding to the 3' end of the hSHIP cDNA (Figure 3.7, lower panel) was used to probe a Northern blot of poly-A+ enriched RNA from a variety of human tissues including bone marrow. This revealed a single mRNA of approximately 5.3-kb in all tissues examined, with a second message of approximately 6.5-kb expressed in lung. This distribution differed from that seen for mSHIP, where very little expression was detected in murine brain, liver, and kidney (Damen et al., 1996). In addition, a second, larger message did not appear to be present in murine lung. Interestingly, SHIP protein expression has been observed almost exclusively in cells of a hematopoietic origin in mice (Liu et al., 1998d) and humans, despite the ubiquitous expression of SHIP mRNA. This could indicate a degree of tissue-specific post-transcriptional regulation of SHIP mRNA, perhaps owing to the presence of upstream ORFs found in the hSHIP 5' UTR. Alternatively, SHIP proteins levels in these other tissues could be extermely low, making detection with antibodies difficult. Kavanaugh et al. (1996) cloned a partial human cDNA they reported encoded two proteins of 145- and 130-kDa. This cDNA is nearly identical to hSHIP, with the exception that our cDNA extends some 392 bp upstream of their sequence and possesses only one potential start site preceding the SH2 domain. This same report also indicated the existence of an alternatively spliced message from this same gene, encoding a 110-kDa product. Northern blot analysis of M07e poly-A+ RNA indicates that in our cell system no such second message is detected as only a single 5.3-kb message was observed (data not shown). However, this could reflect cell type differences or possibly very low 80 H B PI Lu Lv SM K Pa B M 7.5 kb 4.4 2.4 (t/ttk j t t M f c A^mWm* 1.7 kb Probe SH2 5-ptase proline-rich Figure 3.7 Expression of hSHIP mRNA in human tissues. Northern blots of poly-A+ mRNA from a wide variety of human tissues were hybridized with a 1.7-kb hSHIP cDNA probe (bp 2769-4518; lower insert). Blots contained 2 ug of mRNA from heart (H), brain (B), placenta (PI), lung (L), liver (Lv), skeletal muscle (SM), kidney (K), and pancreas (Pa) (left panel) or 1.5 pg of mRNA from the mononuclear cell fraction of human bone marrow (right panel). expression levels of alternate mRNAs. Since cloning this cDNA, several other reports have indicating the existence of alternate splice variants for both human and mouse SHIP (Geier et al., 1997; Lucas and Rohrschneider, 1999; Rohrschneider et al., 2000). The chromosomal location of hSHIP was determine by fluorescence in situ hybridization (FISH) analysis of human lymphocyte metaphase spreads using biotinylated full-length hSHIP cDNA and avidin-FITC. Positive hybridization signals at the border 81 Chromosome 2 47 "L_J hSHIP Figure 3.8 FISH mapping of the hSHIP gene. Normal human lymphocyte chromosomes from metaphase preparation were probed with a biotinylated hSHIP cDNA (bp 673-5273) and counter-stained with PI and DAPI. (right and left panels). Biotinylated hSHIP probe was detected with avidin-FITC. Images were captured by a thermoelectrically cooled, charge-coupled camera (Photometries, Tuscon, AZ). An idiogram of human chromosome 2 is included beside an isolated, positively labeled chromosome 2 for reference purposes (right panel). 82 between 2q36-37 were noted in 12 out of 20 cells (60%), as determined by both analysis of the banding pattern generated by the DAPI counterstained image and measurement of the fractional chromosome length (Figure 3.8). This location has since been confirmed by two other groups (Geier et al., 1997; Liu and Dumont, 1997) and the murine SHIP gene has been mapped to 1C5, a syntenic region of the mouse genome. In one of these reports, Geier et al. (1997) noted that abnormalities at this location are not a trait of any one particular leukemia, however sporadic abnormalities have been detected within this region of chromosome 2 in a number of leukemias and translocations have been observed in some chronic myeloid leukemia cases. Our own review of the Online Mendelian Inheritance in Man database (OMIM) available from the National Center for Biotechnology Information and related database searches by Liu and Dumont (1997) identified no known human or mouse diseases associated with this area that display a defect in phosphatidylinositol metabolism. 83 Chapter 4 IDENTIFICATION O F PROTEINS THAT BIND T H E PROLINE-RICH R E G I O N S OF SHIP 4.1 INTRODUCTION Close examination of the primary sequence of the human and murine forms of SHIP in Chapter 3 revealed many potential sites for protein-protein interaction. As detailed in Chapter 1, the vast majority of previous studies have focused on pTyr-dependent interactions, involving both SHIP SH2 and NPxpY motifs. To date, there is little known about phosphorylation-independent protein-protein interactions involving SHIP. Therefore, we chose to focus our studies on the function of proline-rich regions contained within SHIP. In Chapter 3, we identified at least six PxxP motifs that were all highly conserved within the human and mouse SHIP sequence, five of which constituted potential class I and class II SH3 ligands. This chapter, and the remainder of the thesis, will focus on our efforts to characterize the functions of murine SHIP'S proline-rich regions. 4.2 RESULTS 4.2.1 Grb2 Associates with Both the N and C-Termini of SHIP To identify regions in SHIP involved in protein-protein interactions, we divided SHIP into eight overlapping fragments and fused them in-frame with the 27-kDa G S T protein (Figure 4.1). The bacterially expressed recombinant proteins were then used in in vitro binding assays to identify potential phosphorylation-independent protein binding motifs. Initially, immobilized SHIP-GST fusion proteins were mixed with NP40 solubilized cell lysates from [35S]-methionine labeled Ba F3 and DA-3 cells, in order to distinguish cell lysate proteins from contaminating bacterial proteins present in the G S T fusion protein preparations. The results of these in vitro binding assays are shown in Figures 4.2 and 4.3. Although there was a lot of background, likely due to non-specific association of 84 Y Y 5-Ptase Proline-rich GST EUal S H 2 + P X X P (aa 7-133) " A (99-263) A A Y A A GST GST G (994-1190) A A A IF (838-1017) GST B GST E (681-863) 232-415f-GST C (390-542) GST D (524-708) Figure 4.1 GST-SHIP fusion proteins. Full-length SHIP is represented at the top to give a reference for the relative size and location of the eight fragments of SHIP fused in-frame to the C-terminus of GST. Coloured boxes indicate the SH2 domain, 5-ptase domain, and proline-rich region. Location of the NPxY (Y) and PxxP (A) motifs are designated, as is the amino acid range spanned by each fragment. cellular proteins with the GST-SHIP agarose beads even after pre-clearing with G S T agarose beads overnight, several bands were identified that appeared to be unique (white arrows, Figures 4.2 & 4.3). One protein that particularly caught our attention was an intense 23-kDa band that associates with both the SH2+PxxP (aa 7-133) and the C-terminal, fragment G (aa 944-1190) of SHIP. The size and relative amount of the protein, coupled with the knowledge that murine SHIP was originally purified in our laboratory by its ability to associate specifically with the C-terminal SH3 domain of Grb2 (Damen et al., 1996), led us to suspect this protein was the adaptor molecule Grb2. Additionally, examination of the sequences for both the SH2+PxxP and G fragments identified PxxP 85 motifs suitable for interacting with Grb2 C-SH3 (Alexandropoulos et al., 1995). Western blot analysis of an in vitro binding assay with anti-Grb2 antibody confirmed the identity of this protein as Grb2 (Figure 4.4), thus demonstrating for the first time that Grb2 selectively associates with both the N- and C-terminal portions of SHIP. Figure 4.2 In vitro protein binding assay for Ba F3 cells. Ba F3 cells were metabolically labeled with L-[35S]-methionine for 3 or 17 h at 37°C as outlined in Chapter 2. The cells were lysed with NP40 then incubated with bacterial GST immobilized on agarose beads before sequentially adding these cell lysates to immobilized GST-SHIP fusion proteins, starting with fragment G and ending with the SH2+PxxP. White arrows indicate protein bands that appeared to be distinct from background bands. This experiment has been performed once. 86 S H 2 + G S T PxxP A B D F G 2 17 2 17 2 17 2 17 2 17 2 17 2 17 h labeled Figure 4.3 In vitro protein binding assay for DA-3 cells. DA-3 cells were metabolically labeled with L-[35S]-methionine for 2 or 17 h at 37°C as outlined in Chapter 2. The cells were lysed with NP40 then incubated with bacterial GST immobilized on agarose beads before sequentially adding these cell lysates to immobilized GST-SHIP fusion proteins, starting with fragment G and ending with the SH2+PxxP. White arrows indicate protein bands that appeared to be distinct from background bands. This experiment has been performed once. 87 30 kDa-i IB: a Grb2 1 8 -Grb2 Figure 4.4 Grb2 binds both the N and C-termini of SHIP. Immobiiized GST-SHIP fusion proteins (2-5 ug) were incubated with NP40 solubilized DA-3 cell lysates (10x106 cells/sample) for 30 min at 4°C. Samples were fractionated by SDS-PAGE and subjected to immunoblotting with anti-Grb2 antibody. Total cell lysate (TCL) from 1x106 cells was also included as a positive control. GST fusion protein in vitro binding assays done in duplicate, with one of the pair subjected to immunoprecipitation with anti-Grb2 to preclear the lysates of Grb2 protein prior incubation with the GST fusion proteins. However, the anti-Grb2 antibody used to preclear Grb2 from the cell lysates unfortunately did not immunoprecipitate Grb2, as determined by immunoblotting of the anti-Grb2 immunoprecipitations with anti-Grb2 (data not shown). These results are representative of several experiments. These observations were consistent with in vitro protein binding assay results using GST-fusion proteins containing various SH3 domains to measure the ability of different SH3 domains to associate with SHIP. These experiments revealed that the SH3 domains of Grb2 (C-terminal), PI3-K, Lyn, Src, Abl, Crk, Btk, but not those of PLCy, G A P , and Grb2 (N-terminal), could associate with an N-terminally hemagglutinin (HA)-tagged SHIP over-expressed in the myeloid cell line, DA-3 (Figure 4.5). Furthermore, the C-terminal SH3 of Grb2 not only associated with the full-length, 145-kDa form of SHIP, but 88 also bound a smaller 110-kDa form previously shown to be the result of proteolytic cleavage of a large portion of the C-terminal tail (Damen et al., 1998). This indicated that the Grb2 C-SH3 domain could recognize the N-terminal PxxP motif presented in SHIP'S native conformation, as well as in the form of a GST fusion protein. Grb2 I B ' a H A G S T C N PLCy PI3-K Lyn Src GAP Crk Abl Btk HA-SHIP 145 kDa 135 kDa 125 kDa 110 kDa Figure 4.5 Association of various SH3 domains with SHIP. DA-3 cells expressing a retrovirally introduced HA-tagged SHIP (10x106/sample) were solubilized with NP40 and the cell lysates were incubated with 2-5 pg immobilized GST fusion proteins for 30 min at 4°C. The proteins fused to GST include the individual SH3 domains of Grb2 (N and C-terminal), PLCy, PI3-K, Lyn, Src, GAP, and Abl, as well as the SH2/SH3 domains of Btk and the complete Crk protein. Samples were fractionated by SDS-PAGE and subjected to immunoblotting with anti-HA antibodies to detect HA-SHIP. These results are repersentative of several experiments. 89 4.2.2 The Association of Grb2 with SHIP is Dependent on PxxP Motifs To further characterize these Grb2/SHIP interactions, we had specific peptides synthesized to represent the six major PxxP motifs found in SHIP (Figure 4.6). These proline-rich peptides were than used to compete for Grb2 in in vitro binding assays, further clarifying whether the PxxP motifs were critical for these interactions. Additionally, in the case of the C-terminus, we also hoped they would allow us to narrow down which of the three PxxP motifs (see Figure 4.1) were capable of binding Grb2 C-SH3. Using all six peptides individually, at a concentration of 100 pM, only peptide 1 was capable of competing Grb2 away from the SHIP SH2+PxxP fusion protein (Figure 4.7). A 1 A 6 Proline-rich A A 2 5 AA 34 Peptide Number Sequence SH3 Ligand Class 1 SPPELPPRNIP I 2 GEGPPTPPGQPPISPK ? 3 APVPAKPvPIKPSRSE I 4 P T P R P P L P V K S P A I 5 R K E P P P C P E P G I II 6 S P G L R P R P O V P G II Figure 4.6 Synthetic peptide corresponding to SHIP'S PxxP motifs. A schematic diagram of SHIP indicating the relative location of six PxxP motifs (A), as well as the SH2 domain, the 5-ptase domain, and the proline-rich tail is depicted (upper panel). Below each PxxP motif is indicated its assigned identification number. The sequence of the synthetic peptides synthesized to represent each PxxP motif is also shown, along with the corresponding SH3 ligand classification (lower panel). The core of the PxxP motifs are underlined, as are the positions of conserved residues important in distingishing class I (PxxPxR/K) and class II (R/KxxPxxP) SH3 ligands (bold type). 90 30 kDa-IB: a Grb2 PxxP Peptides TCLGST - 1 2 3 4 5 6 lOOuM - G r b 2 PxxP PxxP Peptide 1 Peptide 6 - 0.01 1 0.01 ImM •Grb2 Figure 4.7 Association between Grb2 and the N-terminus of SHIP is disrupted by PxxP-containing peptides. DA-3 cells (10x106/sample) were solubilized with NP40 and the cell lysates then incubated with ~2 ug of immobilized GST-SHIP SH2+PxxP fusion proteins for 30 min at 4°C. Samples were then incubated with synthetic peptides corresponding to SHIP'S PxxP motifs at the indicated concentrations for 3 h at 4°C to disrupt PxxP/Grb2 SH3 interactions. Once fractionated by SDS-PAGE, samples were subjected to immunoblotting analysis with anti-Grb2 antibodies. These results are representative of two experiments. A 10-fold higher concentration of peptide 1 was even more effective at competing for Grb2, while an equal concentration of peptide 6 had no effect (Figure 4.7). Similar results were obtained for the C-terminal portion of SHIP, with peptides 4, 5, and 6 all reducing the association of Grb2 with SHIP fragment G at the higher concentration of 1 mM, while peptide 3 showed little ability to disrupt this protein interactions (Figure 4.8). The concentrations of peptides used in these studies were consistent with the typical Kd values of synthetic peptides binding SH3 domains (approximately 1-100 pM) (Kay et al., 2000). 91 PxxP Peptides 4 5 6 0.01 1 0.01 1 0.01 1 0.01 ImM TCL 28 kDa IB: a Grb2 18-Grb2 Figure 4.8 Association between Grb2 and the C-terminus of SHIP is disrupted by PxxP-containing peptides. DA-3 cell lysates were generated and handled as described for Figure 4.7 with the exception that cell lysates were incubated with ~ 5 pg of immobilized GST-SHIP fragment G. This experiment has been performed once. 4.2.3 Grb2 associates with a C-terminal truncation mutant of SHIP B cells Our laboratory has previously reported the lack of any detectable SHIP/Grb2 complexes in various myeloid cell lines (Damen et al., 1996; Liu et al., 1997a). However, SHIP and Grb2 have been found to co-immunoprecipitate in several B cell lines, including WEHI 231 (Harmer and DeFranco, 1999). Armed with this knowledge, we decided to over-express wild-type (WT) SHIP and a SHIP truncation mutant (T1), missing the last 207 amino acids of the C-terminus, into the WEHI 231 cell line (Figure 4.9A). Both SHIP constructs were fused to HA at their N-termini and G F P at their C-termini. It was hoped that by analyzing the ability of the truncation to associate with Grb2 we could ascertain if the PxxP motifs in the proline-rich tail were necessary for Grb2 association or 92 A W T H A § J S H 2 T l I A A Y Y A A i 5-Ptasc Proline-rich GFP (1-1190) (1-912) B WT Tl 5 6 IB: a HA 5 Clone — HA-SHIP-GFP (WT) — HA-SHIP-GFP(T) Figure 4.9 SHIP mutant constructs introduced into WEHI 231 B cells. (A) A schematic diagram of the SHIP constructs introduced into WEHI 231 B cells. All constructs were HA-tagged at the N-terminus (dark gray boxes) and GFP-tagged at the C terminus (white boxes). The SHIP lengths (in amino acids) are indicated in brackets. The relative positions of PxxP (A) and NPxY (Y) sequences are indicated. (B) Expression levels of WT and T1 SHIP constructs in WEHI 231 B cells. 1x106 WEHI 231 cells from two independent clones expressing either WT or T1 SHIP were resuspended in SDS sample buffer and boiled for 3 min. Samples were SDS-PAGE fractionated and subjected to immunoblot analysis with anti-HA antibodies to determine the relative expression level of the constructs in each clone. if the N-terminal PxxP motif could function alone as a Grb2 C-SH3 docking site in vivo. Once the WEHI 231 cells were infected with MSCV-Pac retroviral vectors containing the SHIP constructs, or a G F P control construct, several clones of each were picked from the polyclonal population. Unfortunately, the WT SHIP was not expressed to the same degree as the T1 mutant in any of our selected clones (Figure 4.9B), so little emphasis will be 93 placed on relative amounts of the proteins co-immunoprecipitating, but rather will be interpreted in terms of yes/no answers. Initial characterization of these two proteins revealed they were tyrosine phosphorylated to a similar extent following anti-IgM stimulation (Figure 4.10). This result was somewhat unexpected since both NPxY motifs, previously reported to be the major SHIP tyrosine phosphorylation sites in T C R stimulated murine T cells (Lamkin et al., 1997), are missing from the T1 SHIP mutant. IP: a H A IB: a pTyr WT T l + a IgM pHA-SHIP-GFP (WT) pHA-SHIP-GFP (T) IB: a H A HA-SHIP-GFP (WT) HA-SHIP-GFP (T) Figure 4.10 WT and T1 SHIP are tyrosine phosphorylated in response to BCR engagement. Resting WEHI 231 cells (50x106/ml) expressing either WT or T1 SHIP were stimulated with 20 pg/ml intact anti-IgM antibodies for 3 min to engage the BCR. Cells were then solubilized with TX-100 and the cell lysates subjected to immunoprecipitation with anti-HA. SDS-PAGE fractionated samples were immunoblotted with anti-pTyr (4G10) antibodies (upper panel) then the blot was stripped and reprobed with anti-HA antibodies (lower panel) to demonstrate equal HA-SHIP amounts in each lane. These results are representative of several experiments. 94 a IgM <— HA-SHIP-GFP (WT) «—HA-SHIP-GFP (T) — S h e ^ I g G H «•—Grb2 Figure 4.11 SHIP constructs constitutively associate with Grb2 in vivo. Resting WEHI 231 cells were stimulated and solubilized as described in Figure 4.10. The resultant cell lysates were then subjected to immunoprecipitation with anti-Grb2 antibodies prior to SDS-PAGE fractionation. The samples were immunoblotted with anti-HA (upper panel), anti-She (middle panel), and anti-Grb2 (lower panel) antibodies. WEHI 231 cells expressing GFP alone were included as a control. These results are representative of several experiments. The ability of Grb2 to associate with the N-terminal PxxP motif was examined by immunoblotting for HA-tagged SHIP in anti-Grb2 immunoprecipitates from infected WEHI 231 cells. The results, shown in Figure 4.11, demonstrated that both WT SHIP and the SHIP T1 mutant could associate with Grb2 in both resting and BCR engaged cells. Furthermore, we found that the amounts of the SHIP protein associated with Grb2 did not change following BCR activation, indicating that this interaction is likely not dependent on tyrosine phosphorylation. However, the association of She with Grb2 only occurs IP: a Grb2 IB: a HA IB: a She IB: a Grb2 GFP WT T l + - + - + l_ 95 IP: a SHIP GFP aHA T C L W T - + T l IB: a Grb2 E - + a IgM F(ab')2 i— Grb2 Figure 4.12 Grb2 constitutively associates with SHIP constructs in vivo. Resting WEHI 231 cells were stimulated and solubilized as described in Figure 4.10 with the exception that cells were stimulated with anti-IgM F(ab')2 fragments to engage the BCR. The resultant cell lysates were then subjected to immunoprecipitation with anti-HA (right panel) antibodies prior to SDS-PAGE fractionation. The samples were immunoblotted with anti-Grb2 antibodies. A total cell lysates sample (1x106 cells) was included as a positive control. Mock-infected WEHI 231 cells expressing GFP alone were immunoprecipitated with anti-SHIP (P1C1) antibodies to show that endogenous SHIP also associates with Grb2 (left panel). These results are representative of two experiments. following stimulation, consistent with previously published reports (Salcini et al., 1994; van der Geer et al., 1996b) (Figure 4.11). The association of WT and T1 SHIP with Grb2 was also shown by performing the converse experiment (ie. anti-HA immuno precipitations 96 IP: a HA IB: a She + a IgM p52 She IgG H p48 She Figure 4.13 She association with SHIP constructs increases following BCR engagement. Resting WEHI 231 cells were stimulated and solubilized as described in Figure 4.10. The resultant cell lysates were then subjected to immunoprecipitation with anti-HA antibodies. Samples were SDS-PAGE fractionated then immunoblotted with anti-She antibodies. A total cell lysate sample (1x106 cells) was included as a positive control. This experiment has been performed once. from resting or B C R engaged WEHI 231 B cells were immunoblotted with anti-Grb2 antibodies) (Figure 4.12). We next examined whether She was present in this complex since a recent report by Harmer and Defranco (1999) indicated that SHIP, Grb2, and She all participated in a ternary complex in B cells, with two Grb2 molecules acting as a bridge between SHIP and She. Immunoprecipitation of HA-tagged SHIP proteins from WEHI 231 cells revealed that 97 She associated weakly with WT SHIP in resting WEHI 231 cells and that this association increased substantially following BCR activation. Similarly, T1 SHIP also associated with She before and after anti-IgM stimulation, but the difference between resting and stimulated conditions was less dramatic. The latter result was confirmed by the detection of T1 SHIP in anti-She immunoprecipitates from both resting and B C R engaged cells (data not shown). 4.2.4 SHIP Fragment Associates with Kinase(s) In vitro kinase assays were also performed following incubation of cell lysates with GST-SHIP fusion protein to identify any potential protein kinases that may associate with the different regions of SHIP. As seen in Figure 4.14, only one portion of SHIP associated with a kinase(s) from Ba F3 cell lysates; Two heavily phosphorylated bands of approximately 62- and 34-kDa, being observed consistently in several independent experiments. The kinase(s) involved was further characterized by addition of a variety of protein-serine/threonine and tyrosine kinase inhibitors into the kinase assays. Interestingly, while phosphorylation of the 34-kDa protein was reduced with treatment by most of the protein-serine/threonine kinase inhibitors, the tyrosine kinase inhibitors had little effect, with the exception of genistein (Figure 4.15). Conversely, the broad specificity protein kinase inhibitor, staurosporin, and the protein tyrosine kinase inhibitor, genistein, only affected phosphorylation of the 62-kDa protein. Based on the differential inhibition patterns of the two bands, these results could indicate that this portion of SHIP is capable of forming a complex with two different protein kinases, one being a serine/threonine kinase and the other a tyrosine kinase. Because many kinases heavily autophosphorylate themselves in such assays, it is possible that these two proteins are kinases themselves. Alternatively, one or both of these proteins could represent favorable substrates for the kinase(s) associated in this complex. Further efforts to identify these proteins by mass spectophotometric analysis of tryptic digests have yielded no strong leads to date. 98 GST-SHIP SH2+ GST PxxPA B C D E F G 218 kDa-, p62 p34 Figure 4.14 In vitro kinase assay identifies kinase(s) associated with SHIP B fragment. In vitro binding assays were performed on Ba F3 cell lysates (10x106 cells/sample) using ~5 pg of immobilized GST-SHIP fusion protein as described previously. The samples were resuspended in kinase buffer with [y3 2P]-ATP and incubated for 30 min at 23°C. Samples were then SDS-PAGE fractionated and exposed to X-ray film. These results are representative of several experiments. 4.3 DISCUSSION This chapter has outlined some of our efforts to identify proteins capable of binding to various regions of SHIP in a tyrosine phosphorylation-independent manner. Although several interesting potential binding partners were identified by both [3 5S]-labeled in vitro binding assays and in vitro kinase assays, the majority of these proteins remain unidentified following both immunoblotting studies and mass spectrophotometric analysis of tryptic digests for individually isolated bands. However, we did further our understanding of the SHIP/Grb2 complex by demonstrating that Grb2 C -SH3 can interact 99 S/T Kinase Y Kinase inhibitors inhibitors <•< "<* • » s o •a g a S „ -5 -S .S fl +•* •B s« «j o 2 t-S 218 kDa-107-67-44-28-S O L . £• S « .a a Q, a • - O .g J3 90 4> « >> p62 p34 Figure 4.15 SHIP-associated kinase activity inhibited by specific kinase inhibitors. In vitro kinase assays were performed with GST-SHIP B bound proteins from Ba F3 as described in Figure 4.14, except that individual kinase inhibitors were included in the kinase buffer. The indicated inhibitors were used at the following concentrations: H7 (100 pM), Compound 3 (20 pM), staurosporine (1 pM), chelerythrine (4 pM), H89, (1 pM), genistein (100 pg/ml), herbimycin A (8 uM), tyrphostin B42 (10 pM), and tyrphostin B46 (10 pM). This experiment has been performed once. 100 with specific PxxP motifs in both the N and C-terminal ends of SHIP. Furthermore, we have determined that the PxxP motif found in N-terminus of SHIP is sufficient for SHIP and Grb2 to associate in the WEHI 231 B cell line. The experiments in this chapter constitute one of the few efforts to identify and characterize SHIP'S proline-rich regions. The ability of the Grb2 C-SH3 domain to interact with SHIP has been known for some time (Damen et al., 1996; Kavanaugh et al., 1996), yet the PxxP motifs involved remain unknown. Most published accounts presumed one or more of the PxxP motifs found in the proline-rich C-terminal tail were acting as docking sites. This theory was supported by the observation that an N-terminally truncated form of SHIP, known as SIP-110, was capable of associating with Grb2 C-SH3 (Kavanaugh et al., 1996) and that Grb2 was identified in a yeast two-hybrid screen using the C-terminus of SHIP as bait. In this chapter, we have reported the existence of another viable Grb2 C-SH3 binding site within SHIP'S N-terminus. Competition studies with synthetic peptides indicated that the PxxP motif located next to the SH2 domain was responsible for the association of Grb2 with this portion SHIP (Figure 4.7). Additionally, in vitro binding studies indicated that the Grb2 C-SH3 domain could associate with a truncated SHIP, missing all of the proline-rich C-terminus, and that Grb2 was constitutively associated with the C-terminally truncated T1 SHIP, expressed in the WEHI 231 B cell line. Together, these results indicate that the class I PxxP motif found next to the SHIP SH2 domain (Figure 4.6) is a bona fide Grb2 C-SH3 docking site. The specific PxxP motif(s) in SHIP'S C-terminal tail that are responsible for interacting with Grb2 C-SH3 remain(s) unclear. Competition studies using synthetic peptides revealed that peptides 4 and 5, corresponding to PxxP motifs found in SHIP'S C-terminus (Figure 4.6) were both capable of partially disrupting Grb2's association with SHIP fragment G, while a third C-terminal PxxP motif (peptide 3) did not (Figure 4.8). These results could indicate that the PxxP regions corresponding to peptides 4 and 5 are strong candidates as Grb2 C-SH3 ligands. However, peptide 6, chosen as a control because it was not located in the C-terminus of SHIP (Figure 4.6), also partially disrupted the Grb2/SHIP fragment G complex. Further studies would seem to be in order before 101 any conclusions could be drawn with confidence. Grb2 binding studies with SHIP mutants missing these candidate PxxP motifs could help to clarify these questions. Recently, Harmer and DeFranco (1999) reported the need for Grb2 to be present in order for SHIP and She to associate with one another in the BAL17 B cell line. In their model, they proposed that SHIP, Grb2, and She form a ternary complex, with two Grb2 molecules forming a bridge between SHIP and She. More specifically, they theorized that the two Grb2 C-SH3 domains bind to PxxP motifs in SHIP C-terminus, while the Grb2 SH2 domains interacts with She's pTyr 2 3 9 ' 2 4 0 and/or pTyr 3 1 7 residues and She's PTB binds one of SHIP'S NPxpY motifs. Our results would seem to indicate that only one Grb2 molecule is required for this complex to form, as we observed both Grb2 and She associating with the C-terminally truncated T1 SHIP that is missing the entire proline-rich tail, as well as, both NPxY motifs. Furthermore, our result seem to indicate that She can, at least in some instances, associate with SHIP without its PTB domain binding to SHIP'S NPxpY motifs. This result was very surprising since mutation of the tyrosines in the two NPxY motifs to phenylalanines (F) resulted in a dramatic reduction in the ability of SHIP and She to associate in chicken DT40 B cells (Ingham et al., 1999). The function of Grb2 association with both ends of SHIP remains unclear. However, the ability of Grb2 to bind SHIP in such close proximity to SHIP'S own SH2 offers many interesting scenarios. One possibility is that the SH2 domains of both SHIP and Grb2 being in such close proximity could function in tandem, much like the SH2 domains of SHP-2 to confer higher ligand specificity that each SH2 individually (Ottinger et al., 1998). Interestingly, both SHIP and Grb2 SH2 domains have previously been shown to favor very similar pTyr-containing motifs, namely YxN and/or Yxxl/LA/ (Liu et al., 1997a; Osborne et al., 1996). Another possibility is that Grb2 binding brings its other binding partners into close proximity to SHIP, allowing SHIP to form direct links with these proteins. This is most likely how SHIP and She become associated in B cells (Harmer and DeFranco, 1999). A third possibility is that SHIP'S enzymatic activity could be directly affected through allosteric inhibition involving the YxN motif found in close proximity to the 5-ptase motif 1 (Figure 3.4). If the tyrosine in this sequence was phosphorylated, this site 102 could act as a docking site for the SH2 domain of Grb2, possibly causing the N-terminus of SHIP to fold over on itself, thereby blocking the catalytic domain. Finally, SHIP could compete with other proteins for Grb2 C-SH3, affecting their ability to function properly. For example, Gab1 (Lock et al., 2000), dynamin II (Kranenburg et al., 1999), and receptor protein tyrosine phosphatase (RPTP) a (den Hertog and Hunter, 1996) all associate specifically with the Grb2 C-SH3 domain and in the case of Gab1, Grb2 C-SH3 binding is necessary for recruitment of Gab1 to the epidermal growth factor (EGF) receptor (Lock et al., 2000). It is curious that the T1 SHIP mutant was capable of being tyrosine phosphorylated in response to B C R activation despite missing both NPxY motifs, which had been shown in a T cell hybridoma to be the major sites of phosphorylation in response to T C R activation (Lamkin et al., 1997). Moreover, the same mutant expressed in SHIP"'" B M M C s underwent little tyrosine phosphorylation with S C F stimulation, although another mutant with the tyrosines in the two NPxY motifs mutated to phenylalanines (F) was phosphorylated to the same extent as WT SHIP (see Chapter 6). This result could indicate that SHIP phosphorylation is regulated differently in lymphoid and myeloid cells. Alternately, the expression of endogenous SHIP in the WEHI 231 cells could have some unforeseen consequences on the functioning of T1 SHIP. In fact, this last caution should be heeded in the interpretation of all our in vivo WEHI 231 binding studies. It would therefore seem prudent to repeat these experiments in a SHIP-deficient cell type such as the SHIP"'" DT40 B cell line or B lymphocytes derived from SHIP"'" mice. Recently, Ingham et al. (1999) have successfully introduced both WT and mutant murine SHIP constructs into SHIP"'" DT40 cells. The results of their studies determined that SHIP, and in particular its NPxY motifs, were required for proper tyrosine phosphorylation of She following B C R stimulation. They went on to show that both the SH2 and PTB domains of She were also required for Shc/SHIP association. 103 Chapter 5 S R C FAMILY K INASES A S S O C I A T E WITH SHIP AND R E G U L A T E ITS T Y R O S I N E P H O S P H O R Y L A T I O N 5.1 INTRODUCTION SHIP tyrosine phosphorylation has been observed following the activation of various hematopoietic receptor systems ranging from immunoreceptors to cytokine receptors to serpentine (seven-spanner) receptors (Giuriato et al., 1997; Huber et al., 1999). However, the protein tyrosine kinase(s) involved remain unidentified. While trying to identify the potential ~60-kDa protein kinase that appeared to associate with SHIP fragment B in Ba F3 cells, we began studies examining the effects of the for the Src family-specific inhibitor, PP2, (Zhu et al., 1999) on SHIP phosphorylation in response to different stimuli. 5.2 RESULTS 5.2.1 Src family Inhibitor Reduces SHIP Phosphorylation We were initially interested in what effect pretreatment of WEHI 231 B cells with the Src family inhibitor, PP2, before B C R engagement would have on SHIP tyrosine phosphorylation, since B C R signalling relies heavily on the Src family kinase, Lyn. As seen in Figure 5.1, PP2 treatment led to a decrease in the tyrosine phosphorylation of SHIP in a dose-dependant manner while the control chemical analog, P P 3 had no effect. Similarily, PP2 inhibited p52 and p48 She tyrosine phosphorylation after B C R engagement, in keeping with the recent suggestion that SHIP phosphorylation is necessary for the recruitment and subsequent tyrosine phosphorylation of She in B C R signalling (Ingham et al., 1999). 104 interested in what effect the Syk inhibitor piceatannol would have on SHIP phosphorylation (Oliver et al., 1994). The results shown in Figure 5.1 demonstrate that piceatannol had little effect on SHIP phosphorylation. Even at a concentration 10-fold higher than Syk's IC50 of 10 pM, SHIP and She phosphorylation were barely affected, indicating Syk is only a minor player in the tyrosine phosphorylation of SHIP, if it is involved at all. D M S O PP3 PP2 Piceatannol IP: a SHIP 200 kDa-100 0.1 1 10 100 50 100 uM - + + + + + + + + o l g M IB: a pTyr IB: a SHIP pSHIP p52 p48 pSHC SHIP Figure 5.1 Src-family inhibitor, but not Syk inhibitor, reduces tyrosine phosphorylat ion of SHIP in response to B C R activation. Resting WEHI 231 B cells (50x106/sample) were pretreated with DMSO (vehicle control), PP3 (negative control), PP2 (Src inhibitor), or piceatannol (Syk inhibitor) for either 15 (PP3, PP2) or 60 min (DMSO, piceatannol) at 37°C prior to stimulation with 20 pg/ml intact anti-IgM antibodies for 3 min at 37°C. Cells were lysed with TX-100 and subjected to immunoprecipitation with anti-SHIP antibodies. SDS-PAGE fractionated samples were then immunoblotted with anti-pTyr (4G10) antibody (upper panel). The blot was then stripped and reblotted with anti-SHIP antibodies (lower panel) to demonstrate that equal amounts of SHIP were present in each sample. These results are representative of several experiments. 105 Since signalling through both cytokine and growth factor receptors also induces SHIP phosphorylation, we next looked at whether SHIP phosphorylation was regulated by Src family kinases in response to IL-3 and SCF . We chose IL-3R and c-Kit because both receptors activate Src PTKs (Linnekin et al., 1997; Torigoe et al., 1992) and they offered us the chance to examine the role Src family kinases play in PP2 PP3 1 10 100 100 100 100 JUM + + + - + - IL-3 IP: a SHIP IB: a pTyr IB: a SHIP B IB: a pTyr IP: a S T A T 5 IB: a S T A T 5 pSHIP SHIP p S T A T 5 S T A T 5 Figure 5.2 Src-family inhibitor reduces IL-3-induced SHIP phosphorylation. Ba F3 cells (50x106/sample) were deprived of IL-3 for 16 h and then pretreated with DMSO, PP2, or PP3 (15 min, 37°C) prior to simulation with 400 ng/ml IL-3 for 5 min at 37°C. Cells were solubilized with TX-100 subjected to immunoprecipitation with either anti-SHIP (A) or anti-STAT5 (B) antibodies. SDS-PAGE fractionated samples were analyzed by immunoblotting with anti-pTyr (4G10) antibodies (A & B; upper panels). Blots were stripped and reblotted with either anti-SHIP (A; lower panel) or anti-STAT5 (B; lower panel) antibodies to demonstrate equal protein levels in each sample. These results are representative of two experiments. 106 SHIP phosphorylation in response to both cytokine and growth factor receptor activation. As with B C R engagement, SHIP phosphorylation was reduced in IL-3-stimulated Ba F3 cells in a dose-dependent manner following pretreatment with PP2 but not PP3 (Figure 5.2A). In an effort to assure ourselves that PP2 was specific for Src and not affecting Jak2, the principal kinase involved in IL-3 R signalling (Ihle et al., 1994), we also looked at the tyrosine phosphorylation of a major substrate for Jak2, STAT5 (Darnell, 1997). STAT5 DMSO PP3 PP2 IP: a SHIP B IP: a c-Kit IB: a pTyr IB: a SHIP IB: a pTyr IB: a c-Kit 10 0.1 1 10 uM + + + + + SCF mmm* pSHIP SHIP p c-Kit c-Kit Figure 5.3 Src-family inhibitor reduces SCF-induced SHIP phosphorylation. Murine BMMCs (20x106/sampie) were deprived of IL-3 for 16 h and then pretreated with DMSO, PP2, or PP3 (15 min, 37°C) prior to stimulation with 400 ng/ml SCF for 5 min at 37°C. Cells were solubilized with TX-100 and subjected to immunoprecipitation with either anti-SHIP (A) or anti-c-Kit (B) antibodies. SDS-PAGE fractionated samples were analyzed by immunoblotting with anti-pTyr (4G10) antibodies (A & B; upper panels). Blots were then stripped and re-blotted with either anti-SHIP (A; lower panel) or anti-c-Kit (B; lower panel) antibodies to demonstrate equal protein levels in each sample. These results are representative of two experiments. 107 tyrosine phosphorylation, as determined by anti-pTyr immunoblotting, was unaffected (Figure 5.2B), indicating that Jak2 activity was also unchanged. Similarly, SHIP phosphorylation was dramatically reduced in SCF-stimulated BMMCs pretreated with 1 pM PP2 (Figure 5.3A), while c-Kit phosphorylation was also reduced (Figure 5.3B). 5.2.2 SHIP Phosphorylation is Reduced in Lyn"'' Cells The reduction in c-Kit phosphorylation we observed at 1 pM of PP2 (Figure 5.3B) concerned us, since it was possible that that PP2 was affecting c-Kit's intrinsic kinase activity. Therefore, in order to confirm that the PP2-mediated reduction we observed in SHIP phosphorylation was a result of Src family PTK and not a loss of c-Kit kinase activity we examined SHIP phosphorylation in B M M C s derived from Lyn"'" mice. Time course studies of normal BMMCs stimulated with S C F demonstrated that SHIP tyrosine phosphorylation reached its peak at approximately 2 min and remained high for at least 20 min post-cytokine addition (Figure 5.4). SHIP phosphorylation in Lyn"'" B M M C s reached maximum levels between 2-5 min of stimulation and returned to near baseline levels after 20 min and the overall degree of SHIP phosphorylation in Lyn 7" cells was significantly reduced despite a slightly higher amounts of SHIP in the Lyn"'" immunoprecipitates (Figure 5.4). While Lyn is the most prevalent Src kinase in BMMCs, it is by no means the only Src PTK expressed in these cells. Src, Fyn, and Yes are ubiquitously expressed and Hck and Fgr are found in most myeloid cell lineages (Thomas and Brugge, 1997). Because of the potential for redundancy in the functioning of Src-family members, we treated Lyn"'" BMMCs with PP2 to determine if the residual tyrosine phosphorylation of SHIP observed in these cells could be attributed to other Src PTKs. As shown in Figure 5.5, the residual SHIP phosphorylation was significantly reduced at a 10-fold lower concentration of PP2 than required to reduce phosphorylation to similar levels in normal BMMCs. 108 IP: a SHIP IB: a pTyr Lyn +/+ Lyn -/-0 0.5 2 5 20 0 0.5 2 5 20 min pSHIP IB: a SHIP SHIP Figure 5.4 Intensity and duration of SCF- induced SHIP phosphorylation is reduced in L y n " B M M C s . BMMCs (20x106/sample) derived from either Lyn + / + or Lyn"'" mice were deprived of IL-3 for 16 h and then stimulated with 400 ng/ml SCF for the indicated times at 37°C. Cells were lysed with TX-100 and subjected to immunoprecipitation with anti-SHIP antibody. Samples were then fractionated by SDS-PAGE and immunoblotted with anti-pTyr (4G10) antibodies (upper panel). The blot was stripped and reblotted with anti-SHIP antibodies (lower panel) to reveal equal protein levels in each sample. These results are representative of two experiments. 109 IP: a SHIP DMSO PP3 PP2 Piceatannol 1 0.01 0.1 1 10 50 uM - + + + + + + + S C F IB: a pTyr IB: a SHIP Figure 5.5 Residual SCF-induced SHIP phosphorylation in Lyn"'" BMMCs is reduced by a Src family inhibitor. BMMCs (20x106/sample) derived from Lyn"'" mice were deprived of IL-3 for 16 h and then pretreated with DMSO, PP2, PP3, or piceatannol for either 15 (PP2, PP3) or 60 min (DMSO, piceatannol) at 37°C prior to stimulation with 400 ng/ml SCF for 5 min at 37°C. Cells were lysed with TX-100 and subjected to immunoprecipitation with anti-SHIP antibodies. SDS-PAGE fractionated samples were immunoblotted with anti-pTyr (4G10) antibodies. The blot was stripped and reblotted with anti-SHIP antibodies (lower panel) to demonstrate equal protein levels in each sample. These results are representative of two experiments. 5.2.3 Lyn Associates with SHI P in B cells To gain some insight into how Lyn regulates the phosphorylation of SHIP we examined whether SHIP and Lyn associate with one another in the B cell line, WEHI 231. As seen in Figure 5.6, SHIP immunoprecipitates analyzed by immunoblotting with anti-Lyn antibody revealed that Lyn co-immunoprecipitated with SHIP in both unstimulated and B C R engaged WEHI 231 B cells. This finding is in agreement with previous reports that indicate that Lyn associates with SHIP before and after CDw150 activation (Mikhalap et al., 1999). Lyn association with SHIP was maximal approximately 2-5 min after B C R 110 activation then decreased, persisting for at least 1h post-engagement (Figure 5.6). This pattern parallels the tyrosine phosphorylation of SHIP (Figure 5.7) and the association of the p85 subunit of PI3-K (Figure 5.6), an interaction previously reported to involve the binding of the SH2 domain of p85 to a phosphorylated pYxxM sequence in SHIP following B C R engagement (Gupta et al., 1999). Taken together these results indicated that the association of Lyn and SHIP probably occurred through a tyrosine phosphorylation-dependent mechanism in activated cells. It also indicated that SHIP and Lyn might IP: a SHIP IB: a SHIP IB: a p85 PI3-K IB: a Lyn 0 2 5 20 60 min mmm mm —• <Wk SHIP •p85 subunit PI3-K p56 Lyn p53 Lyn Figure 5.6 Lyn associates with SHIP in B cells. Resting WEHI 231 cells (50x10 ) were stimulated with 20 pg/ml intact anti-IgM antibodies for the indicated times. Cells were solubilized with NP40 and subjected to immunoprecipitation with anti-SHIP (P1C1) antibodies. Samples were SDS-PAGE fractionated and immunoblotted with anti-SHIP (upper panel), anti-p85 subunit PI3-K (middle panel), and anti-Lyn (lower panel) antibodies. These results are representative of several experiments. 111 IP: a SHIP IB: a pTyr IB: a SHIP 0 2 5 20 60 m i n pSHIP SHIP Figure 5.7 BCR engagement-induced SHIP tyrosine phosphorylation. Resting WEHI 231 cells were stimulated, solubilized, and immunoprecipitated as described in Figure 5.6. SDS-PAGE fractionated samples were then immunoblotted with anti-pTyr (4G10) antibodies (upper panel) to determine the level of SHIP tyrosine phosphorylation. The blot was stripped and reprobed with anti-SHIP antibodies (lower panel) to demonstrate equal SHIP protein levels in each sample. These results are representative of several experiments. interact through a phosphorylation-independent mechanism, perhaps involving Lyn SH3 domain, under resting conditions, since there appeared to be little or no detectible tyrosine phosphorylation of SHIP in resting WEHI 231 cells. 5.2.4 SHIP and Lyn do not Associate via Their SH2 domains in Stimulated Cells The increase in SHIP and Lyn association following B C R activation indicated that increased tyrosine phosphorylation of SHIP and/or Lyn might be facilitating an SH2-mediated interaction between the two. Based on this hypothesis we examined 112 A 200kDa-IB: a SHIP SHIP Lyn SHIP SH2 + GST SH2 SH2 PxxP TCL-/+ - + - + ~ a l g M c SHIP Lyn SHIP SH2 + GSTSH2 SH2 PxxP -/+ - + SHIP P50 Lyn •p53Lyn 46 + a l g M Figure 5.8 Association of Lyn with N-terminus of SHIP requires PxxP sequence. Resting WEHI 231 cells (10x106 cells/sample) were stimulated or not with 20 pg/ml intact anti-IgM then solubilized with TX-100. The resultant cell lysates were then incubated for 30 min at 4°C with 2-5 pg of immobilized GST-Lyn SH2 domain, GST-SHIP SH2 domain, or GST-SHIP SH2+PxxP. Samples were SDS-PAGE fractionated and analyzed by immunoblotting with anti-SHIP (A), anti-Lyn (B), or anti-pTyr (C) antibodies. Immobilized GST protein was also incubated with a mixture of stimulated and unstimulated as a negative control and a sample of total cell lysates (1x106 cells) was included as a positive control for the anti-SHIP (A) and anti-Lyn (B) immunoblots. These results are representative of two experiments. whether the SH2 domain of Lyn could recognize and bind tyrosine phosphorylated SHIP from BCR-activated WEHI 231 cells. Conversely, SHIP also possesses an SH2 domain that could bind tyrosine phosphorylated Lyn through tyrosine phosphorylated YxN and/or Yxxl/I_/V motifs. We therefore assayed the ability of GST-SHIP and Lyn SH2 domains to bind to phosphorylated Lyn and SHIP, respectively. Results from in vitro protein binding 113 assays revealed that Lyn SH2 did not interact with SHIP (Figure 5.8A). However, it was capable of binding a tyrosine phosphorylated protein of ~72-kDa (Figure 5.8C), thus demonstrating the functionality of the Lyn SH2 fusion protein. The SHIP SH2 domain (aa 1-111) was also not capable of binding Lyn (Figure 5.8B), although it also bound a phosphoprotein of ~120-kDa in stimulated cells only (Figure 5.8C). Interestingly, a GST-SHIP SH2 domain fusion protein containing the juxtaposed PxxP motif (aa 7-133), referred to as SHIP SH2+PxxP in Chapter 4, interacted with Lyn equally well in both resting and stimulated cells (Figure 5.8B). This signified that the PxxP motif in close proximity to SHIP SH2 (PxxP motif 1; Figure 4.6) was a potential binding site for the SH3 domain of Lyn. 5.2.5 Src SH3 Domains Bind Different SHIP Forms Numerous reports have suggested an abundance of potential SH3 ligand consensus sequences within the C-terminal tail of SHIP (Damen et al., 1996; Lioubin et al., 1996; Osborne et al., 1996). In an effort to identify potential protein binding partners for these proline-rich regions, we analyzed the ability of several SH3 domains to interact with SHIP in in vitro protein binding assays. As previously reported in Chapter 4, many SH3 proteins are capable of binding HA-tagged SHIP over-expressed in the murine myeloid cell line DA-3. Most of these SH3 domains preferentially associated with the 145-kDa form but not the smaller C-terminally truncated forms of SHIP. However, the SH3 domains of Src and Lyn, as well as Abl, were capable of binding all SHIP isoforms (Figure 5.9). These results further indicated that a PxxP motif in the N-terminus of SHIP could act as a binding site for Src-family SH3 domains. Additional supporting evidence for Src-family SH3 domains binding the N-terminal proline-rich sequence was provided using WEHI 231 cells over-expressing either WT SHIP or the C-terminally truncated T1 SHIP mutant, described in Chapter 4. Specifically, in vitro protein binding assays using GST-SH3 fusion proteins of the Src members Lyn, Fyn, and Yes indicated that Src family SH3 domains can not only associate with 145-kDa WT SHIP but also the C-terminally truncated T1 SHIP mutant, despite missing the four C-terminal PxxP motifs (Figure 5.10). 114 Grb2 IB- a HA G S T C N P L C y P I 3 K L y n S r c G A P C r k A b l B t k HA-SHIP 145 kDa 135 kDa 125 kDa 110 kDa Figure 5.9 Association of various SH3 domains with SHIP. DA-3 cells expressing a retrovirally introduced HA-tagged SHIP (10x106 cells/sample) were solubilized with NP40 and the cell lysates were incubated with 2-5ug immobilized GST fusion proteins for 30 min at 4°C. The proteins fused to GST included the individual SH3 domains of Grb2 (N and C-terminal), PLCy, PI3-K, Lyn, Src, GAP, and Abl, as well as the SH2/SH3 domains of Btk and the complete Crk protein. Samples were fractionated by SDS-PAGE and subjected to immunoblotting with anti-HA antibodies to detect HA-SHIP. This figure represents a shorter exposure of Figure 4.5 that better distinguishes the various SHIP isoforms. These results are representative of several experiments. 115 W T T l Lyn Fyn Yes Lyn Fyn Yes GST SH3 SH3 SH3 SH3 SH3 SH3 +— H A - S H I P - G F P (WT) IB: a HA H A - S H I P - G F P (T) Figure 5.10 Src family SH3 domains associates with a C-terminally truncated SHIP mutant. Resting WEHI 231 cells (10x106 cells/sample) expressing retrovirally introduced WT or T1 SHIP (see Chapter 4) were solubilized with TX-100 and the cell lysates incubated with 2-5pg immobilized GST-Lyn, -Fyn, or -Yes SH3 domains (30 min., 4°C). SDS-PAGE fractionated samples were then immunoblotted with anti-HA antibodies to determine the ability of the different SH3 domains to associate with WT and T1 SHIP in vitro. Immobilized GST alone was also incubated with cell lysates from the WT SHIP expressing WEHI 231 as a negative control. These results are representative of two experiments. To determine whether other PxxP motifs in SHIP could also participate in binding to Src family SH3 domains, several GST-SHIP fusion proteins containing proline-rich motifs (Figure 4.1) were incubated with WEHI 231 cellular lysates and analyzed for Lyn association. The results, shown in Figure 5.11, revealed that only the SH2+PxxP fragment (aa 7-133) and not the PxxP-containing fragments B (aa 232-415), or G (aa 994-1190) could associate with Lyn. This result was further supported by peptide competition studies. Using all six synthetic peptides corresponding to SHIP'S PxxP motifs (Figure 4.6) to compete for SHIP in in vitro protein binding assays with GST-SH3 fusion proteins of Lyn and Fyn, only the peptide containing the N-terminal PxxP motif (peptide 1) was capable of disrupting the SHIP/Src family SH3 interaction (Fig 5.12). 116 SHIP Fragments SH2+ T C L G S T PxxP G B IB: a Lyn p56 L y n p53 L y n Figure 5.11 Lyn associates specifically with N-terminus of SHIP. Resting WEHI 231 cells (10x106 cells/sample) were solubilized with TX-100 and the resultant cell lysates incubated with 2-5 ug immobilized GST-SHIP SH2+PxxP, -SHIP B, or -SHIP G fragments (30 min, 4°C). SDS-PAGE fractionated samples were then immunoblotted with anti-Lyn antibodies. Immobilized GST alone was also incubated as described above as a negative control and a sample of total cell lysates (1x106 cells) was included as a positive control for the anti-Lyn antibodies. These results are representative of two experiments. 117 Fyn SH3 L y n SH3 2 0 0 kDa IB: a HA G S T - 1 2 3 4 5 6 1 2 3 4 5 6 PxxP Peptide 914 — jflk i k -mm tmm t l l h lagfe g i VP « W " * W W W w H A - S H I P Figure 5.12 Associa t ion of Src family SH3 domain with SHIP is disrupted by speci f ic PxxP-containing peptide. DA-3 cells expressing HA-SHIP were solubilized with NP40 (10x106 cells/sample) and the resultant cell lysates incubated with immobilized GST-Fyn or -Lyn SH3 domains for 30 min at 4°C. Samples were then incubated with 100 uM synthetic peptides corresponding to SHIP'S PxxP motifs for 3 h at 4°C to disrupt SHIP PxxP/SH3 interactions. Once fractionated by SDS-PAGE, samples were subjected to immunoblot analysis with anti-HA antibodies. This experiment has been performed once. 5.3 DISCUSSION We have found that the Src family-specific inhibitor, PP2, greatly reduces the tyrosine phosphorylation of SHIP induced by either IL-3 or S C F stimulation and by B C R engagement. Additionally, we have established that the SH3 domains of the Src family members are capable of directly binding to an N-terminal PxxP motif of SHIP and that Lyn 118 and SHIP are constitutively associated in the WEHI 231 B cell line. Taken together these results indicate that the Src family of PTKs is responsible for regulating the phosphorylation of some or all of SHIP'S tyrosine residues. It is perhaps not surprising that Lyn and other Src family kinases would regulate SHIP phosphorylation in response to B C R engagement given that these PTKs are thought to initiate most of the signals emanating from this receptor complex (Gold and Matsuuchi, 1995; Reth and Wienands, 1997). Furthermore, SHIP has previously been shown to be a substrate for both Lyn and Lck in vitro (Osborne et al., 1996; Phee et al., 2000; Sarmay et al., 1999), and the Src family members Lyn and Fgr have been found to associate with SHIP in B cells following CDw150 activation (Mikhalap et al., 1999). What was somewhat surprising was the involvement of Src PTKs in the regulation of SHIP phosphorylation following both cytokine and growth factor receptor activation, given the prominent role Jak family kinases and intrinsic kinase domains are thought to play in signalling through these receptors, respectively. Nevertheless, in retrospect, it makes sense that a ubiquitously expressed PTK family, utilized by all major classes of hematopoietic receptors, would be involved in regulating SHIP phosphorylation in response to so many different stimuli. The most straightforward interpretation of our results is that Src family kinases directly phosphorylate some or all of SHIP'S phosphorylated tyrosine residues. However, we cannot rule out the possibility that Src family kinases are functioning indirectly throught a Src family-dependent PTK, such as Syk, although our results using an inhibitor of Syk demonstrated a limited role, at most, for Syk in SHIP phosphorylation following B C R activation (Figure 5.1) or S C F stimulation (Figure 5.5). This is consistent with the observation that SHIP tyrosine phosphorylation was unaffected in Syk"'" RBL 2H3 cells stimulated with FceRI (Kimura et al., 1997). It was somewhat surprising to find such a small role for Syk because SHIP and Syk had previously been reported to associate with one another in Ag-stimulated B cells and LPS-activated macrophages (Crowley et al., 1996). However, a very recent study by Phee et al. (2000) has confirmed our in vivo results using PP2 and piceatannol in B cells, in addition to demonstrating that SHIP is a much better substrate for Lyn than for Syk in in vitro kinase assays. 119 The biological importance of SHIP phosphorylation on tyrosine residues is not well understood. One possibility is that this post-translational modification regulates SHIP'S enzymatic activity directly. This concept is supported by the observation that SHIP immunoprecipitates from yeast co-expressing the Src family kinase Lck demonstrated a 2 to 3-fold reduction in the level of 5-ptase activity toward Ptdlns3,4,5P 3 when subjected to an in vitro phosphatase assay (Osborne et al., 1996). However, others have reported no difference in 5-ptase activities between SHIP immunoprecipitates from unstimulated (weakly phosphorylated) or stimulated (strongly phosphorylated) cells (Damen et al., 1996, Pheee ta l . , 2000). A more likely role for SHIP phosphorylation is the regulation of protein-protein complexes. Several recent studies have shown that SHIP phosphorylation and association with the BCR/FcyRl lb complex is critical for the recruitment of many proteins to the membrane. The recruitment of She to phosphorylated SHIP appears to regulate the tyrosine phosphorylation of She in B cells (Ingham et al., 1999) and may lead to the down-regulation of SHIP activity by causing SHIP'S SH2 to dissociate from the FcyRllb receptor and associate with pTyr 3 1 7 and/or pTyr 2 3 9 ' 2 4 0 of She (Tridandapani et al., 1999). This would likely remove SHIP from the plasma membrane where its substrate, Ptdlns3,4,5P 3, is located. Our results in Figure 5.1 would seem to support the need for SHIP to be phosphorylated before She can be phosphorylated, as PP2 appears to inhibit the phosphorylation of 52- and 48-kDa proteins, thought to be She. The decrease in She phosphorylation, however, could also be due to She behaving as a substrate for Lyn and/or Syk directly (Nagai et al., 1995). Similarly, the PTB domains of the negative adaptors Dok-1 (Tamir et al., 2000) and Dok-3 (Lemay et al., 2000) also associate with SHIP'S NPxpY motifs following B cell stimulation. The significance of Dok-3 binding to SHIP remains unclear. However, SHIP phosphorylation appears critical for the recruitment of Dok-1 to the FcyRllb receptor complex, where Dok-1 can then attract RasGAP. This recruitment of R a s G A P might contribute to the observed reduction in Ras/MAPK activity associated with negative signalling in B lymphocytes (Sarmay et al., 1996; Tridandapani et al., 1997a; Tridandapani 1 2 0 et al., 1997b). Finally, PI3-K also forms a complex with SHIP following BCR/FcyRl lb co-ligation through a PI3-K SH2-mediated interaction with a pYxxM motif in SHIP'S C-terminus (Gupta et al., 1999). The importance of this interaction is not well understood but it seems likely that this interaction would allow SHIP to more easily down-regulate PI3-K activity by being in close proximity to the source of its substrate. Related to this, Ptdlns3,4,5P 3 levels have been shown to be significantly reduced following BCR/FcyRl lb co-engagement when compared to B C R activation alone (Gupta et al., 1999). However, the down-regulation of PI3-K may not be the sole purpose of pairing these two proteins together. Gupta et al. (1999) also found that the decrease in Ptdlns3,4,5P 3 associated with negative signalling was coupled with an increase in Ptdlns3,4P 2, indicating that SHIP and PI3-K might function together to raise Ptdlns3,4P 2 levels. In this chapter, we have also reported the ability of SHIP and Lyn to interact with one another in vivo. More specifically, we have found that SHIP and Lyn are constitutively associated in resting WEHI 231 cells and this interaction is enhanced by engagement of the B C R (Figure 5.6). The ability of SHIP and Lyn to associate in resting cells in the absence of any significant levels of SHIP phosphorylation (Figure 5.7) suggested that the SH3 domain of Lyn might be involved. In this chapter, we suggest that SHIP'S N-terminal PxxP motif, shown to also interact with Grb2 in Chapter 4, is a potential Src family SH3 domain ligand. This is based on the following three lines of evidence: 1) a SHIP SH2 fusion protein (SHIP+PxxP) containing the juxtaposed PxxP motif was capable of binding Lyn in an in vitro binding assay, while a similar fusion protein without the PxxP motif and other PxxP-containing regions of SHIP could not (Figures 5.8 & 5.11); 2) Lyn and other Src family SH3 domains can associate with truncated forms of SHIP missing some or all of the PxxP motifs at the C-terminus of SHIP (Figure 5.9 and 5.10); 3) only a synthetic peptide corresponding to the aforementioned PxxP motif was capable of competing SHIP away from Lyn and Fyn SH3 domains in vitro (Figure 5.12). Taken together, these results all point to SHIP'S N-terminal PxxP motif being a viable ligand for Src family SH3 domains. Moreover, this PxxP motif (PELPPR) fits the canonical class II core sequence (PxxPxR/K) perfectly and at least one other study has identified a similar class II ligand as a target for Src family SH3 domains (Alexandropoulos et al., 1995). It should be noted, however, that 121 none of this data precludes the possibility that other PxxP motifs in SHIP could associate with Src family SH3 domain. Src family SH3 domains are known to interact with both class I and class II ligands, of which SHIP possesses at least two more of each. The mechanism behind the increase in SHIP/Lyn complexes following B C R engagement (Figure 5.6) has not been identified in this chapter, but we have demonstrated that it is likely not due to the SH2 domains of SHIP or Lyn directly binding pTyr residues of the other binding partner. Both SHIP and Lyn SH2 fusion proteins were unable to associate with Lyn or SHIP, respectively, in vitro (Figure 5.8). This evidence would seem to indicate the increased association between these proteins is dependent on one or more other proteins acting as a bridge between SHIP and Lyn, including the B C R complex itself. It remains to be determined whether the increase in this complex represents a increase in the number of Lyn and SHIP molecules associating with one another, or whether co-stimulation somehow stabilizes the association so it is not as easily disrupted by TX-100 lysis conditions. A close examination of the phenotypes for Lyn"'" and SHIP"'" mice reveals some intriguing similarities. These mice are characterized by increased serum levels of several classes of immunoglobins, B cells hyperproliferation in response to B C R stimulation, splenomegaly, myeloerythroid hyperplasia, and in older mice, glomerulonephritis, caused by an accumulation of anti-DNA antibodies in the glomeruli, reminiscent of systemic lupus erythematosus (Chan et al., 1997; Helgason et al., 2000; Hibbs et al., 1995; Kalberer et al., 2000). Based on these gross similarities it is tempting to conclude that SHIP and Lyn could participate in the same signal transduction pathways. Related to this, both Lyn and SHIP have been found to function as suppressors of Btk in B cells (Satterthwaite et al., 2000). The role of Lyn in Btk suppression remains unclear but it does appear to be specific to Lyn as other Src members exert a positive influence on Btk activity (Satterthwaite et al., 1998), while SHIP appears to suppress Btk by lowering Ptdlns3,4,5P 3 levels, thereby reducing the association of Btk with the plasma membrane via its PH domain (Bolland et al., 1998). Additionally, the autoimmunity, B C R hypersensitivity, myeloerythroid hyperplasia, and splenomegaly suffered by Lyn"'" mice was alleviated by 122 the loss of Btk in Lyn"'"Btk"'" mice, thus further implicating SHIP and Lyn as functioning upstream of Btk. However, despite the many common characteristics shared by these mice, their phenotypes do differ significantly, indicating that SHIP is just one of many potential Lyn-regulated pathways. In this regard, Lyn is responsible for the phosphorylation of the FcyRllb receptor ITIM regions, which recruit not only SHIP, but other molecules, such as SHP-1 , to the receptor complex (Nishizumi et al., 1998). Furthermore, Lyn is responsible for phosphorylating and activating Syk and can phosphorylate many of the intracellular signalling proteins found in the BCR/FcyRl lb complex in vitro (Sarmay et al., 1999). Future directions for these studies include further analysis of the SHIP/Lyn complex and its role in the regulation of SHIP and its downstream targets. In particular, it would be interesting to examine the importance of the Lyn SH3 binding to SHIP'S N-terminal PxxP motif. Further studies should therefore include the expression of an SH3-deficient Lyn mutant in either Lyn"'" DT40 chicken B cells or B cells derived from Lyn"'" mice, to see what effect this would have on SHIP phosphorylation. In particular, expression of mutant Lyn in the latter could help determine if the reduced recruitment of SHIP to the FcyRllb in Lyn"'" B cells is solely due to the hypophosphorylation of the FcyRllb (Nishizumi et al., 1998), or if Lyn SH3 is important in attracting or holding SHIP in the receptor complex. Similarity, it would also be interesting to examine the effects of expressing a SHIP mutant, with the N-terminal PxxP motif removed in SH IP-deficient DT40 cells or B cells derived from SHIP"'" mice. Finally, expression of these mutants in a myeloid cell type, such as bone marrow-derived mast cells (BMMCs), could be useful in determining whether the ability of Lyn SH3 to bind the N-terminus of SHIP is necessary for proper SHIP functioning in cells where a SHIP/Lyn complex has yet to be observed. Related to this, one report found that introduction of synthetic peptides with a high specificity for Lyn SH3 into mast cells prevented an increase in C a + + influx following FcsRI stimulation (Stauffer et al., 1997). The authors go on to suggest that natural binding partners for Lyn SH3 might assist in down-regulating the C a + + response by competing with the FceRI (3 chain for Lyn SH3, leading to a reduction in Lyn-mediated FceRI phosphorylation. Interestingly, SHIP"'" BMMCs display both hyperphosphorylation of the 123 FceRI B chain and sustained C a + + influx following IgE stimulation (Huber et al., 1998a). Furthermore, the striking similarities in the phenotypes of the myeloid compartment of both Lyn"'" and SHIP"'" mice might indicate that Lyn and SHIP play a much more cooperative role in the development and functioning of myeloid cells. 124 Chapter 6 T H E R O L E OF SHIP 'S DOMAINS IN B O N E M A R R O W - D E R I V E D M A S T C E L L S 6.1 INTRODUCTION Mast cells play a critical role in initiating acute inflammatory responses against invading bacteria, helminthic parasites and harmless allergens (Galli and Wershil, 1996). Upon exposure to multivalent antigens or allergens, these cells rapidly degranulate, releasing stored inflammatory mediators that act on vasculature, smooth muscles, connective tissue, mucous glands and inflammatory cells to cause immediate type hypersensitivity reactions (Schwartz, 1994). We believed BMMCs were an ideal system to analyze the role of different SHIP domains because it was previously established that SHIP is a major in vivo regulator of Ptdlns3,4,5P 3 in BMMCs and disruption of the SHIP gene had dramatic effects on the degranulation of these cells in response to S C F and IgE stimulation. Specifically, SHIP"'" BMMCs show higher than normal degranulation and C a + + influx in response to IgE stimulation (Huber et al., 1998a) and exhibited SCF-induced degranulation, not observed with SHIP + / + BMMCs (Huber et al., 1998b). 6.2 RESULTS 6.2.1 Introduction of SHIP Mutants into SHIP''' BMMCs To further our understanding of the biological role of SHIP and how this activity is affected by different protein motifs within its sequence, we retrovirally infected SHIP"'" bone marrow hematopoietic progenitors with either WT or mutated SHIP genes. Mast cells were then derived by in vitro culture from the infected bone marrow. We were particularily interested in determining what role, if any, the proline-rich regions in the C-terminus played in SHIP ability to effect its enzymatic activity and regulate several biological endpoints previously demonstrated to rely on SHIP for proper control (Huber et al., 1998a; Huber et al., 1998b). These mutants included: 1) D675G, a 5'-phosphatase-deficient mutant, in 125 which the aspartic acid (D) residue at amino acid position 675, previously shown to be critical for the proper 5-phosphatase activity towards D5-inositides (Jefferson and Majerus, 1996) was mutated to a glycine (G); 2) 2NPXF, a double point mutant in which the tyrosines in the INPNY and E N P L Y motifs were converted to phenlyalanines (F); 3) T2, a C-terminal truncation mutant missing the last 207 amino acids. Each of these mutants, as well as WT SHIP, was fused to G F P at SHIP 'S C-terminus (Figure 6.1). WT H A | f 2NPXF i D657G 1 T2 I SH2r 5-Ptase Y Y Proline-rich GFP A A A A A A A A A A AA F F Y Y (1-1190) (1-1190) (1-1190) -1 | (1-983) A Figure 6.1 A schematic diagram of the initial SHIP constructs introduced into SHIP" B M M C s . All constructs were HA-tagged at the N-terminus (dark gray boxes) and GFP-tagged at the C terminus (white boxes). The SHIP lengths (in amino acids) are indicated in brackets. The relative positions of PxxP (A) and NPxY (Y) sequences and the 5-ptase domains (black boxes) are indicated. Mutated NPxY-+F motifs are also denoted (F). 126 Figure 6.2 Levels of expression of SHIP constructs' in SHIP''' B M M C s determined by flow cytometry. Analysis of the BMMCs expressing the various SHIP constructs following 2 months in liquid suspension culture by flow cytometry. Uninfected SHIP"'" and + / + BMMCs are shown in the first two graphs. GFP was used as a marker for SHIP protein expression (upper panel) and c-Kit (using PE-labeled anti-c-Kit) for BMMC maturity and SCF receptor expression levels (lower panel). Gray histograms represent uninfected BMMCs while empty histograms represent indicated SHIP construct. 127 <— S1M3A3 128 Bone marrow isolated from several SHIP"'" mice was pooled and infected over two days with 48-hour retroviral supernatants from B O S C 23 cells, calcium phosphate transfected with MSCV-Pac retroviral vectors containing the various HA-SHIP-GFP constructs. The bone marrow cells were then cultured in methylcellulose containing 2 pg/ml puromycin and 30 ng/ml IL-3 for 9 days to select for virally infected mast cell progenitors. Methylcellulose colonies were harvested, pooled, and matured in suspension culture for 6 weeks until uninfected SHIP "'" and SHIP + / + control cells expressed equivalent levels of FceRI as determined by flow cytometry. Expression of SHIP was then determined by flow cytometry, based on the expression of G F P . All infected cultures IB: a SHIP 193 kDa-HA-SHIP-GFP (FL) - > SHIP —• 98-+/+ -/- % "0 o ON ~4 H HA-SHIP-GFP (T) 66-Figure 6 .3 Immunoblot detection of retrovirally-introduced SHIP expression levels. Immunoblot analysis with anti-SHIP antibody performed on BMMCs expressing the various SHIP constructs following 2 months in liquid suspension culture. BMMCs (1x106/sample) were suspended in SDS sample buffer and boiled for 3 min prior to SDS-PAGE fractionation. 129 were observed to have relatively equal expression levels of SHIP-GFP (Figure 6.2). These results were confirmed by anti-SHIP immunoblotting analysis of total cell lysates (Figure 6.3). 6.2.2 WT, but not D675G nor T2 SHIP Reverts SCF-induced Ptdlns3,4,5P3 to Levels Observed in SHIP+/+ BMMCs SHIP has previously been established as one of the major lipid phosphatases responsible for the breakdown of Ptdlns3,4,5P 3 in BMMCs (Huber et al., 1998b). It was demonstrated in this report that an optimal stimulation time of 2 minutes with S C F revealed a dramatic difference in Ptdlns3,4,5P 3 levels between SHIP + / + and SHIP"'" BMMCs. We therefore were interested in examining what influence our mutations would have on SHIP'S ability to regulate B M M C Ptdlns3,4,5P 3 levels following S C F stimulation for 2 min. Dr. J . Damen performed in vivo Ptdlns3,4,5P 3 measurements by labeling cells with [32P]-orthophosphate and extracting the phosphatidylinositide constituent from the lipid bilayers of the various B M M C cultures before and after S C F stimulation. Comparison of the ratios of Ptdlns3,4,5P 3 against the reasonably constant Ptdlns4,5P 2 concentration for SHIP"'", SHIP + / + , and WT SHIP infected BMMCs indicated that the re-introduction of WT SHIP into the SHIP"'" BMMCs dramatically reduced the elevated Ptdlns3,4,5P 3 levels observed in the SHIP"'" BMMCs to levels similar to those of SHIP + / + BMMCs (Figure 6.4A). However, this reduction was not a complete reversion to SHIP + / + levels, indicating that the expression level or function of the re-introduced SHIP may not fully compensate for the loss of endogenous SHIP expression under the control of its own promoter. In Figure 6.4B, Ptdlns3,4,5P 3 levels for the negative control, D675G, and T2 SHIP were also determined and found to both be similar to the SHIP"'" BMMCs, indicating that both of these mutants are not exhibiting proper inositol 5-phosphatase activity. The 2 N P X F mutant, however, was capable of partially restoring the SHIP + / + phenotype, indicating that the phosphorylation of the two NPxY motifs only partially contributes to proper SHIP functioning in BMMCs. 130 6.2.3 Removal of Proline-rich C-terminal Tail Reduces SHIP Tyrosine Phosphorylation To gain some insight into why T2 SHIP was incapable of hydrolyzing Ptdlns3,4,5P 3 in vivo, we compared the tyrosine phosphorylation patterns of the various SHIP constructs in response to S C F stimulation for various times. As can be /seen in Figure 6.5, the WT, D675G, and 2 N P X F SHIP were all tyrosine phosphorylated to the same extent, while T2 A B LO 40 - * 35 co 0 0 i 3 0 5 25 r^" 15 co 10 - 5 £ 0 -/-11=12 +/+ n=8 W T n= 10 D675G 2NPXF Figure 6.4 The effects of SHIP reintroduction on SCF- induced Ptdlns3,4,5P 3 levels in SHIP" '" B M M C s . (A) Scatter plot of Ptdlns3,4,5P3 measurements plotted as a percentage of the relatively constant Ptdlns4,5P2 levels. Ptdlns3 4,5P 3 levels were determined as described in Chapter 2, following stimulation of SHIP"'", SHIP + / +, and SHIP"'" BMMCs expressing WT SHIP with 400 ng/ml SCF for 2 min at 37°C. Symbols repersent values from one experiment. Thick black lines indicate means values of combined experiments. (B) Ptdlns3,4,5P3 levels indicated as a percentage of the Ptdlns4,5P2 levels for SHIP"'", SHIP + / + , and SHIP"'' expressing WT, D675G, 2NPXY, and T2 SHIP mutants following stimulation with 400 ng/ml SCF for 2 min at 37°C. Shown are the mean values and range of two independent experiments. 131 SHIP demonstrated little or no SCF-induced phosphorylation, despite comparable amounts of SHIP being present in each sample. The high degree of phosphorylation exhibited by the 2 N P X F mutant was surprising given that a previous report suggested that SHIP'S NPxY motifs are major site of phosphorylation, at least in TCR-activated B Y D P T cells (Lamkin et al., 1997). This result would therefore seem to indicate that the tyrosines in the two NPxY motifs are not the only sites of SCF-induced phosphorylation in BMMCs. W T 2 N P X F D675G T2 IP: a SHIP 200 kDa-l 0 2 5 10 0 2 5 10 0 2 5 10 0 2 5 10 min IB: a pTyr 97-69-IB: a SHIP IB: a GFP ^^^^ Figure 6.5 C-terminally truncated SHIP does not become tyrosine phosphorylated in response to SCF. SHIP"'" BMMCs (10x106/sample) expressing the indicated SHIP constructs were stimulated with 400 ng/ml SCF for the times indicated. Cells were then lysed with NP40 and subjected to immunoprecipitation with anti-SHIP antibodies. SDS-PAGE-fractionated samples were immunoblotted with anti-pTyr (4G10) antibody (upper panel). The blot was subsequently stripped and reblotted with anti-SHIP (middle panel) or anti-GFP (lower panel) antibodies. These results are representative of several experiments. 132 Figure 6.5 also draws attention to another interesting characteristic of SHIP in BMMCs. The electrophoretic mobility of the SHIP proteins immunoprecipitated from NP40 or TX-100 solubilized BMMCs expressing full-length SHIP constructs (ie. WT, D657G, and 2NPXF) is approximately 135-kDa, not the predicted 170-kDa for these constructs. Related to this, we have previously reported that retrovirally-introduced SHIP proteins became proteolytically modified at their C-terminus by an unidentified protease when expressed in the myeloid cell line DA-3, producing SHIP isoforms of 135-, 125- and 110-kDa (Damen et al., 1998). To establish if the smaller molecular weight species of WT, D657G, and 2 N P X F SHIP observed in Figure 6.5 were due to removal of a portion of the C-terminus, the blot was stripped and reprobed with an anti-GFP antibody to determine if the C-terminal G F P tag was still present. The results shown in Figure 6.5 showed that only T2 SHIP retained the G F P tag, strongly indicating that WT, D675G, and 2NPXF were proteolytically cleaved at their C-terminus. This result further indicated that the protease(s) responsible for cleaving the C-terminus of SHIP recognize specific amino acids sequences that have been deleted in T2 SHIP. 6.2.4 She Binding is Reduced by Mutation of NPxY Motifs and Removal of C-terminus of SHIP To further characterize these SHIP constructs we next examined their ability to associate with She following S C F stimulation. The pTyr-dependent association of SHIP with the adaptor molecule She is one of SHIP'S defining characteristics and this interaction has been shown to involve the PTB domain of She binding to the NPxpY motifs found in the C-terminus of SHIP. WT and D675G SHIP were capable of co-immunoprecipitating with She in S C F stimulated cells, while the 2NPXF and T2 mutants demonstrated a dramatic reduction in their ability to associate with She (Figure 6.6). The lack of She binding to the 2 N P X F mutant was expected as removal of the She PTB binding sites were previously shown to be critical to SHIP/Shc association in myeloid cells (Liu et al., 1997a). However, the inability of T2 SHIP and She to associate effectively probably reflects the lack of SCF-induced phosphorylation of its one remaining NPxY motif. Alternately, it could signify inappropriate subcellular localization of the mutant, thus preventing She and SHIP from coming into contact. 133 6.2.5 Shc/MAPK Phosphorylation Unaffected by Expression of Different SHIP Constructs in SHIP-/- BMMCs The inability of both 2NPXF and T2 SHIP to effectively associate with She allowed us to examine the role the SHIP/Shc interaction plays in both regulating She phosphorylation and M A P K activation in response to S C F stimulation. Previous studies in SHIP"'" BMMCs found that She phosphorylation levels were significantly lower than in SHIP + / + BMMCs following IgE-induced FCERI engagement, while M A P K phosphorylation IP: a She IB: a HA ^ r» 5 X rA H H 41 O M 97 kDa-HA-SHIP-GFP (T2) pl35 HA-SHIP p i 10 HA-SHIP IB: a She p52 She p48 She Figure 6.6 Association of WT SHIP and SHIP mutants with She. SHIP"'" BMMCs expressing the indicated SHIP constructs (40x106) were stimulated with 400 ng/ml SCF for 2 min at 37°C. Cells were then solubilized with NP40 and subjected to immunoprecipitation with anti-She antibody. SDS-PAGE fractionated samples were immunoblotted with anti-HA (upper panel) or anti-She (lower panel) antibodies. These results are representative of two experiments. 134 levels were dramatically elevated (Huber et al., 1998a). Based on that knowledge, we first asked whether She phosphorylation was affected in BMMCs containing the 2NPXF and 12 SHIP mutants. As shown in Figure 6.7B, She appeared to be phosphorylated to the same extent in the SHIP"'" BMMCs, regardless of which SHIP construct they were expressing. Since She phosphorylation was unaffected, we next looked indirectly at M A P K kinase activation by examining the phosphorylation state of p44/p42 M A P K on Thr 2 0 2 and Tyr 2 0 4 . Similar to the She results, MAPK phosphorylation appeared unaffected by the expression of the different SHIP constructs in SCF-stimulated BMMCs (Figure 6.7C). Together, these results indicate that SHIP/Shc association has little effect on the Shc-MAPK pathway in B M M C S C F signalling. Although Figure 6.6 shows very little She associating with T2 SHIP, on some occasions we have observed slightly higher SHIP/Shc binding in response to S C F stimulation, possibly facilitated by the one remaining NPxY motif. We felt that the presence of the remaining PTB ligand site might confound our interpretation of the contribution to SHIP functioning of the NPxY motifs and proline-rich C-terminal tail. Therefore we expressed two other truncation mutants, T1, which lacked both NPxY motifs and T3, which retained both PTB ligand sites (Figure 6.8), along with WT, D675G, and 2 N P X F constructs into a second batch of SHIP"'" BMMCs. After several failed attempts to infect BMMCs, we were finally successful at generating a second batch of SHIP"'" B M M C s containing the aforementioned SHIP constructs. As seen in Figure 6.9, anti-SHIP immunoblot analysis revealed, expression of each of these constructs was similar at the protein level, although all were at least 2 to 3-fold lower in expression than the endogenous SHIP in SHIP + / + cells. Initial characterization of the two new SHIP truncation mutants found that both behaved similarly to T2 SHIP, in that they were both incapable of reducing SCF-induced Ptdlns3,4,5P 3 levels back to those observed in SHIP + / + B M M C s (Figure 6.10). Furthermore, preliminary evidence indicates that these mutants also do not appear to be tyrosine phosphorylated to the same extent as WT SHIP following S C F stimulation, although further analysis is needed to make any definitive statements. 135 +/+ -/- WT D675G 2NPXF T2 A IB: a SHIP B IP: a She IB: a pTyr IB: a She IB: a pMAPK IB: a M A P K + - + _ + . + . + - + SCF •m^i^  ^ g j H ^ g^ggjjo ju^^Bita : H | B , . „ . Mm*, ^JU^. liiJHVtii 9 9 |» • • • 4 M B Figure 6.7 SHIP/Shc binding does not affect She or MAPK phosphorylation. SHIP"'", SHIP + / + , and SHIP"'" BMMCs expressing the indicated SHIP constructs (1x106/sample) were suspended in SDS sample buffer and boiled for 3 min. Samples were then SDS-PAGE fractionated and immunoblotted with various antibodies. (A) Immunoblot analysis of BMMC total cell lysates (TCL) with anti-SHIP antibodies to determine SHIP protein levels in each sample. (B) Immunoblot analysis of She phosphorylation levels in She immunoprecipitations with anti-pTyr (4G10) antibody (upper panel). The blot was then stripped and reprobed with anti-She antibody to show equal loading in each lane. (C) Immunoblot analysis of MAPK Thr 2 0 2 /Tyr 2 0 4 phosphorylation levels in BMMC TCLs using anti-phospho-MAPK antibodies (upper panel). Reprobing of this blot with anti-ERK p44/42 demonstrated equal protein loading in each lane (lower panel). This experiment has been performed once. 136 W T H A | | S ^ Y Y SH2 5-Ptase Proline-rich G F P A A (1-1190) T3 ! • A A AA Y Y (1-1027) A A T l D A A (1-912) Figure 6.8 A schematic diagram of additional SHIP constructs introduced into SHIP''' B M M C s . All constructs were HA-tagged at the N-terminus (dark gray boxes) and GFP-tagged at the C terminus (white boxes). The SHIP lengths (in amino acids) are indicated in brackets. The relative positions of PxxP (A) and NPxY (Y) sequences are indicated. The WT SHIP construct is included for reference. 137 IB: a SHIP 200 kDa-p l 3 5 S H I P — • p l 2 5 SHIP — • p i 10 SHIP — • 97-Figure 6.9 Expression of SHIP constructs in second batch of SHIP'7' BMMCs. Anti-SHIP immunoblot analysis of TCLs from NP40 solubilized SHIP + / + , SHIP"7", and SHIP"7" BMMCs expressing the indicated SHIP constructs. Both SHIP + 7 + and SHIP"7" BMMCs were infected with the MSCV retroviral vector containing GFP alone. Each lane contains TCL from 1x106 BMMCs after being in liquid suspension culture for 2 months. 138 Figure 6.10 T1 and T3 SHIP constructs do not revert the SCF- induced Ptdlns3,4,5P 3 levels to those observed in SHIP*'* B M M C s . Ptdlns3,4,5P3 levels for SHIP"'", SHIP + / + , and SHIP"'" expressing T1 or 12 SHIP mutants following stimulation with 400 ng/ml SCF for 2 min at 37°C expressed as a percentage of the relatively stable Ptdlns4,5P2 levels present in the same samples. Shown are the mean values and range of two independent experiments. 6.2.6 Ca + + Influx is Elevated in C-terminal SHIP Truncations Previous studies have shown that SHIP"'" BMMCs exhibit elevated extracellular C a + + influx following S C F stimulation (Huber et al., 1998b). We therefore compared the abilities of the various SHIP constructs to revert the SCF-induced C a + + entry to those seen in S H I P + / + BMMCs . Our studies found that expression of WT SHIP effectively reduced calcium influx levels to SH IP + / + B M M C levels, while D657G and 2 N P X F did not (Figure 6.11). Surprisingly, not only did T1 and T3 SHIP not reduce extracellular C a + + entry to S H I P + / + B M M C levels, they consistently exhibited even higher levels than the SHIP"'" B M M C s (Figure 6.11). 139 Figure 6.11 Effects of different SHIP constructs on SCF- induced extracellular calcium influx. SHIP + / + (dotted lines) and SHIP"'" (dashed lines) infected with GFP-only control vectors, as well as SHIP"'" BMMCs expressing the indicated SHIP constructs (solid lines) were preloaded with 2 uM fura-2/AM for 30 min at 23°C. Cytosolic calcium levels were measured by excitation with light waves of 340 nm and 380 nm then monitoring the fluorescence intensity at 510 nm before and after the addition of 400 ng/ml SCF. Arrow indicates time of SCF addition to reaction cuvette (50 sec). These results are representative of several experiments. 140 • - • - • - • - • - • - * - ' - ' - ' o LO o LO o io o L O O I O • - • - • - • - * - ' - • - • - • - * O L O O L O O L O p L O p L O LO O LO O LO O LO ^ ri ri W N i i • i i • i • i LO O LO O LO O LO ^ co co c\i c\i ^ U I U 0 8 £ / U I U 0 t 7 £ . i i • i • i • i LO O LO O LO O LO CO CO CN CN uruo8£/uruot7e 141 6.2.7 C-terminally Truncated SHIP Mutants are Ineffective at Reducing SCF-induced Degranulation The deletion of SHIP has previously been linked to the abnormal initiation of preformed secretory granule release in response to S C F stimulation (Huber et al., 1998b). Additionally, this uncharacteristic behaviour correlated with the elevated influx of extracellular calcium discussed above. We therefore were interested in the abilities of the Figure 6.12 The WT, but not the D675G, T1, or T3 SHIP constructs reverts the S C F - i n d u c e d degranulation to SHIP + / + B M M C levels. SHIP + / + and SHIP"'" BMMCs infected with GFP-only vectors, as well as SHIP"'" BMMCs expressing the indicated SHIP constructs were treated with or without 400 ng/ml SCF for 15 min at 37°C. The degree of degranulation was determined by measuring the release of (3-hexosaminidase. Unstimulated values were subtracted for each cell type (typically less than 10% degranulation) and the mean and range of duplicate samples are shown. One hundred percent degranulation is determined by the sum of both released and unreleased 8-hexosaminidase of each sample. These results are representative of two experiments. 142 various SHIP constructs to reduce or prevent SCF-induced B M M C degranulation. In keeping with previous studies, SHIP"'" BMMCs infected with G F P alone degranulate to a far greater degree than similarly infected SHIP + / + cells (Figure 6.12). Moreover, WT SHIP-expressing SHIP"'" BMMCs exhibited a dramatic reduction in SCF-induced secretory granule release, while D675G, T1 and T3 SHIP-containing BMMCs all maintained their SHIP"'" phenotype (Figure 6.12). Interestingly, 2NPXF SHIP appeared to partially reduce SCF-induced degranulation, despite the fact that this mutant had no effect on the aberrant SCF-induced C a + + influx, thereby indicating that these two events can be dissociated to some extent. 6.3 DISCUSSION In this chapter we found that re-introduction of WT SHIP into SHIP"'" B M M C s reduced the SCF-induced Ptdlns3,4,5P 3, intracellular C a + + , and degranulation levels to those observed with SH IP + / + BMMCs. This confirms that SHIP is likely involved in the normal regulation of these behaviors in BMMCs. Moreover, we found that WT SHIP behaved similarly to endogenous SHIP, becoming both tyrosine phosphorylated and associated with She following S C F stimulation. These findings enabled us to assess the biochemical and biological properties of SHIP'S various domains by re-introducing various mutants into SHIP"'" BMMCs. On the one hand, our results have shown that the phosphatase-dead mutant, D675G, demonstrated little ability to hydrolyze Ptdlns3,4,5P 3, restrain extracellular C a + + influx, or prevent degranulation. The 2NPXF mutant, on the other hand, acted to partially restore proper Ptdlns3,4,5P 3 hydrolysis and degranulation but could not revert the calcium influx. Perhaps most intriguingly, we observed that SHIP'S C-terminus also plays a critical role in enabling SHIP to function properly. In particular, our T3 construct, which contains both NPxY motifs, was unable to re-establish a SHIP + / +- l ike phenotype, revealing that the last 163 amino acids of SHIP are vital to these activities. What is it that makes these last 163 amino acids so crucial? One possibility is that the large contingent of prolines may maintain SHIP in a critical tertiary conformation. Alternatively, one or more of the three resident PxxP sequences in this region may participate in the recruitment of SHIP to the plasma membrane, submembranous 143 cytoskeleton, and/or membrane lipid rafts, affecting both access to its substrate and its tyrosine phosphorylation/association with pTyr binding proteins. Previous studies have indicated that the association of SHIP with the plasma membrane, where it can hydrolyze its membrane-associated substrate, Ptdlns3,4,5P 3, is dependent on a functional SH2 domain. Early studies with WT and an SH2-deficient SHIP mutant found that the SH2 domain was essential for IL-3-induced tyrosine phosphorylation of SHIP, its association with She, and its ability to increase the apoptosis of confluent DA-3 cells (Liu et al., 1997a). Also, SHIP SH2 has been shown to bind to several phosphorylated ITAM motifs (Kimura et al., 1997; Osborne et al., 1996), as well as the pITIM of FcyRllb (Ono et al., 1997; Tridandapani et al., 1997b; Vely et al., 1997), and the PH domain-containing scaffold-binding proteins Gab1 and 2 (Rohrschneider et al., 2000). However, as described in Chapter 5, we have shown that the SCF-induced tyrosine phosphorylation of SHIP in BMMCs is regulated by members of the membrane-associated Src family, such as Lyn, via their SH3 domains prior to S C F stimulation. Although the results in Chapter 5 indicated that Src family SH3 domains seem to prefer the PxxP motif at SHIP'S N-terminus, involvement of one or more of the C-terminal PxxP motifs cannot be ruled out. This could indicate that the C-terminus maintains SHIP in the correct position for subsequent phosphorylation. SHIP'S subcellular localization may also be regulated by other SH3 (or WW) domain-containing proteins capable of binding some or all of the class I and II proline-rich sequences found in SHIP'S C-terminus. For example, in Chapter 4 we presented evidence that Grb2 C-SH3 domain can bind specifically to PxxP motifs in SHIP'S C-terminal tail, and that SHIP constitutively associates with Grb2 in B cells. It should be noted however, that we have yet to observe Lyn or Grb2 in association with SHIP in BMMCs or other myeloid cell types thus far. It is unclear whether this represents a difference between B cells and other cell types, or whether these interactions are easily broken up or sequestered to a fraction of the cell where they cannot be easily observed. In support of our findings, Aman et al. (2000), recently found that WT SHIP but not a C-terminally truncated SHIP (aa 1-900) could inhibit BCR/FcyRIlb-induced C a + + entry into SHIP"'" chicken DT40 B cell lines. Moreover, they found that membrane targeting of this truncated SHIP partially restored this inhibition, further suggesting a role for the C-terminus in SHIP translocation. 144 Loss of the C-terminus may also affect SHIP'S normal activity simply by preventing its association with other binding partners. A recent report of yeast 2 hybrid screens performed with SHIP'S C-terminus identified three in vitro binding partners PIAS1, Grb2, and a novel SH3-containing protein of undefined function (Rohrschneider et al., 2000). Interestingly, PIAS1 was shown to interact with SHIP in unstimulated FD/Fms cells then dissociate following M-CSF stimulation. Although the mode of PIAS1 association and its significance to SHIP functioning remain unknown, it will be interesting to see what role, if any, this and other C-terminal binding partners may play in the proper functioning of SHIP. Although the importance of SHIP'S association with She remain unclear, it has been proposed that the interaction could act to terminate SHIP'S ability to hydrolyze Ptdlns3,4,5P 3 by severing SHIP'S attachment to the plasma membrane. In support of this model, a previous study found that in IgE-induced BMMCs, the tyrosine phosphorylation of She was dependent upon the presence of SHIP (Huber et al., 1998a). This indicated that SHIP, via its SH2 domain, associates with a tyrosine-phosphorylated protein at the plasma membrane, whereby its two NPxY motifs become tyrosine phosphorylated followed by the recruitment and subsequent phosphorylation of She. Similar observations have been shown following B C R engagement both with (Tridandapani et al., 1999) and without (Ingham et al., 1999) coligation of the FcyRllb receptor, where it is believed that tyrosine phosphorylated She binds and wrests SHIP'S SH2 domain away from the tyrosine phosphorylated, membrane associated protein(s), causing SHIP to disengage from the plasma membrane. Since the tyrosine phosphorylation of the SHIP C-terminal truncation mutants is dramatically impaired (Figure 6.5) despite the presence of functional SH2 domains, our data indicates that both an intact SH2 domain and C-terminal tail are required for SHIP phosphorylation. The reduction in tyrosine phosphorylation of the truncated mutants is unlikely to be the result of a loss of heavily phosphorylated tyrosines in the C-terminus. In the case of the T2 mutant, only two tyrosines have been removed, Ty r 1 1 6 4 and Tyr 1 0 2 0 . Since Tyr 1 1 6 4 is most likely clipped off the WT SHIP during the generation of the heavily phosphorylated 135-kDa form, and the conversion Tyr 1 0 2 0 to a phenylalanine (along with Tyr 9 1 7) in 2NPXF SHIP had little effect on SCF-induced SHIP phosphorylation (Figure 6.5), it appears that these two residues do not represent the only 145 sites of phosphorylation. In any case, the loss of these two tyrosines seems insignificant when compared to the 25 tyrosines that remain intact within the T2 mutant. Our finding that the tyrosine phosphorylation level of WT and 2 N P X F are similar following S C F stimulation (Figure 6.5) was unexpected given that the tyrosines within the two NPxY motifs have been reported to be the major tyrosine phosphorylation sites in SHIP, at least in the T C R stimulated murine T cell hybridoma cell line, BYDP (Lamkin et al., 1997). Interestingly, in C O S cells a mutant similar to 2NPXF SHIP was only slightly less tyrosine phosphorylated than WT SHIP when the Src kinase, Lck, was co-expressed (Lamkin et al., 1997). Our results may therefore reflect a greater contribution of Src family PTKs to SHIP'S overall tyrosine phosphorylation in BMMCs than in B Y D P cells. In keeping with the very recent results in BCR/FcyRIIB-engaged DT40 cells (Aman et al., 2000), the 2 N P X F mutant was incapable of reverting the SCF-induced C a + + influx to that seen in SHIP + / + BMMCs, although it could still partially reduce Ptdlns3,4,5P 3 and degranulation levels. This result indicates that She association does not appear to be essential for the latter two processes in BMMCs and that C a + + influx and degranulation can be partially uncoupled, perhaps related to the inability of the 2NPXF mutant to bind to She, or other proteins that use these pTyr's as binding sites, such as, PI3-K (Gupta et al., 1999), Dok-1 (Tamir et al., 2000), and Dok-3 (Lemay et al., 2000). Previous studies using SHIP"'" BMMCs found that IgE-induced She phosphorylation was significantly impaired when compared with SHIP + / + cells (Huber et al., 1998a). However, our results, shown in Figure 6.7, found She was tyrosine phosphorylated in response to S C F to almost the same degree in SHIP"'" and SHIP + / + BMMCs. This difference may reflect the ability of She to bind to, and be phosphorylated by, c-Kit directly (Lennartsson et al., 1999) and thus not require SHIP to recruit it to the plasma membrane for phosphorylation. The similarity in SCF-induced She phosphorylation levels observed in both SHIP"'" and SHIP + / + BMMCs allowed us to ask if the sequestration of She by SHIP had any effect on MAPK activation. It has previously been reported that FceRI and BCR/FcyRI lb-mediated signalling in SHIP-deficient B M M C s and SHIP'Rag" ' " B lymphocytes, respectively, exhibited a noticeable increase in M A P K 146 activation, attributed to the loss of competition between SHIP and Grb2 for She's pTyr residues (Huber et al., 1998a; Liu et al., 1998c). As shown in Figure 6.7, this does not appear to be the case for SCF-induced BMMCs, as MAPK phosphorylation levels were unaffected by either the lack of SHIP or expression of mutants unable to associate with She. However, it should be noted that She appears to be substantially more tyrosine phosphorylated in response to S C F than to IgE in SHIP + / + BMMCs and it is likely that the ability of SHIP to compete with Grb2 for She, and thus reduce MAPK activation, is highly dependent on the relative accessible concentrations of SHIP, Grb2, and She. Several observations in this Chapter (Figures 6.5, 6.6, & 6.9), as well as in a related study (Damen et al., 1998), have shown that SHIP appears to be selectively cleaved by an unknown protease(s). The exact nature of SHIP'S proteolytic modification is unknown, but one possibility is that it represents a regulatory mechanism used by the cell to control SHIP'S localization and/or enzymatic activity. In support of this, we have observed on several occasions that much of the full-length SHIP in BMMCs is sequestered in an insoluble fraction and only the cleaved 135-kDa isoform is present in the soluble fraction (data not shown). Mounting evidence suggests that SHIP may localize to different cellular compartments and this localization could be directly impacted by the presence or absence of the C-terminal PxxP motifs. In platelets, thrombin stimulates the tyrosine phosphorylation and translocation of SHIP to the actin cytoskeleton (Giuriato et al., 1997). Also, Synaptojanin 2, another inositol polyphosphate 5-phosphatase containing a proline-rich C-terminus, is located predominantly within the particulate fraction (Nemoto et al., 1997). This latter observation is of particular interest because a second isoform, ynaptojanin 1, differs markedly in its proline-rich tail and resides primarily in the cytosol (Nemoto et al., 1997). Alternatively, these smaller forms could be the result of some post-lysis proteolysis occurring following non-ionic detergent solubilization (notwithstanding the protease inhibitors in the lysis buffer), perhaps due to a higher abundance of proteases in B M M C s (eg. in their granules). More work is needed to resolve this issue. To further complicate matters, recent reports describe the identification of at least three alternatively spliced forms of SHIP lacking varying portions of the proline-rich C-terminus (Lucas and Rohrschneider, 1999; Rohrschneider et al., 2000). In primary bone marrow (Geier et al., 147 1997) , and undifferentiated embryonic stem cells (Damen, et al., unpublished), SHIP is expressed solely as a 110-kDa isoform, although it is not clear whether this species is a truncated SHIP or an alternately spliced variant. In either case, regardless of their origin our current observations suggest that this and other SHIP species are likely compromised with regards to Ptdlns3,4,5P 3 hydrolysis. In summary, we have shown herein that the last 163 amino acids are essential for SHIP to reduce SCF-induced Ptdlns3,4,5P 3, C a + + influx, and degranulation levels in BMMCs. Although much remains to be done to elucidate how it regulates these effects, it is noteworthy that SHIP'S C-terminus is very different from that of SHIP2 (Erneux et al., 1998) and this may allow for differential regulation. Incidentally, the type I 5-phosphatases and the type IIINPP5P, which do not contain proline-rich tails, have C-terminal prenylation sites that mediate their membrane association similar to those found for the Rho/Rac family of signaling intermediates (Erneux et al., 1998). It is tempting to speculate that SHIP and SHIP2 may use their proline-rich tails in lieu of prenylation to assist in their recruitment to the plasma membrane, in a cooperative effort with their SH2 domains. The studies outlined in this chapter were not as thorough as we would have liked, owing to the many technical problems that presented themselves throughout, including difficulties in infecting the bone marrow of SHIP"'" mice and a shortage of cells to carry out experiments, due to the slow growth rate of BMMCs in culture. Nevertheless, we do feel that these studies represent a solid starting point from which more specific question can now be asked. For example, it remains to be determined what portion of the last 163 amino acids are critical to SHIP'S functioning. With the presence of at least two class I and one class II SH3 ligands within the last 163 amino acids, it is not unreasonable to suspect that one or more of these PxxP motifs are responsible for the defects observed in the truncation mutants. Future studies should therefore include the systematic examination of each of these proline-rich regions, perhaps by expressing truncation mutants that would include longer portions of the C-terminus. Alternatively, each of the PxxP motifs could be individually added to the C-terminus of the T3 SHIP mutant to determine if one of these regions can restore some or all of SHIP'S activity. Further 148 studies should also focus on the localization of the SHIP mutants in BMMCs. However, preliminary analysis of HA-SHIP-GFP localization by confocal microscopy proved uninformative. Perhaps the use of subcellular fractionation techniques would be more useful in future studies. Related to this, the addition of a prenylation or other membrane localization signals to the truncated SHIP constructs could help to determine if membrane association can restore the activity of the truncation mutants, as it did for a similar mutant in SHIP"'" DT40 B cells (Aman et al., 2000). 149 Chapter 7 S U M M A R Y AND P E R S P E C T I V E S As with most scientific endeavors, the studies in this thesis have created more questions than they have answered. However, our studies have unearthed some new and important facets of SHIP that can only help to increase our understanding of this enigmatic molecule. For instance, in Chapter 3 we identified that the human SHIP mRNA contains an unusually long 5' UTR that possesses five ORFs , including one that consists of 240 nucleotides. Studies examining the 5' UTRs of the proto-oncogene c-Mos, the retinoic acid receptor-B2, and BTEB, a GC-box binding transcription factor, have found evidence for the regulation of tissue specific expression of these proteins by 5'UTR O R F s (reviewed in van der Velden and Thomas, 1999). It would be interesting to examine if such a mechanism is involved in the almost exclusive expression of hSHIP in hematopoietic cells, despite the ubiquitous presence of its mRNA in human tissues. Figure 7.1 represents the current picture we have of proteins that associate with the various regions of SHIP. One can see that, with a few exceptions, most of SHIP'S known binding partners interact with it via pTyr-dependent interactions, be they proteins that associate with the SHIP SH2 domain, or PTB- and SH2-bearing proteins that are attracted to SHIP'S pTyr residues. In Chapter 3, we identified two previously overlooked PxxP motifs in the N-terminus of hSHIP that were very highly conserved across species. Further analysis showed that these PxxP motifs fit the canonical class I (PxxP-1, Figure 7.1) and class II (PxxP-6, Figure 7.1) SH3 ligand sequences. In Chapters 4 and 5, we sought to identify proteins that could associate with SHIP in a phosphorylation-independent manner. Specifically, we were interested in finding proteins that could interact with SHIP'S PxxP motifs and determining what roles these binding partners played in SHIP signalling processes. Our studies revealed that the most N-terminal of these proline-rich regions represented a bona fide protein binding site, interacting with the C-150 terminal SH3 domain of Grb2 and the SH3 domain of several Src family PTKs (Figure 7.1). Furthermore, we confirmed previous studies that indicated that the Grb2 C-SH3 domain bound to PxxP motifs in SHIP'S C-terminus, thereby demonstrating that Grb2 could associate with both ends of SHIP. These studies represented the first attempt to characterize the specific regions within SHIP recognized by Grb2 C-SH3 and remain the only known reports of Src family SH3 domains interacting with a proline-rich region in SHIP. She Syk? S H P " 2 p85 She I T A M PI3-K Dok-1,3 ITIM Dok-1,3 If © © Y Y |SH2 5-ptase Proline-rich A A A A AA 1 6 2 5 3 4 $ t Lyn Grb2 Grb2 PIAS1 Figure 7.1 Summary of known SHIP protein-binding partners. Indicated are the SH2 domain (light gray box), NPxY motifs (Y), and PxxP motifs (A) of SHIP that are involved in protein-protein interactions. She, Dok-1 and Dok-3 all associate with the phosphorylated NPxY motifs via their PTB domains while the SH2 domains of the p85 subunit of PI3-K recognize the pTyr of the N-terminal NPxY (ie. which possesses a YxxM consensus sequence). The specific PxxP motifs in SHIP'S proline-rich tail that are recognized by the C-terminal SH3 domain of Grb2 are not known. The mode of association used by PIAS1 to bind SHIP'S C-terminus is also unknown. 151 The significance of Grb2 C SH3 binding to SHIP'S N-terminus was examined in Chapter 4 by infecting the WEHI 231 B cell line with a truncated version of SHIP missing both NPxY motifs and the four PxxP regions present in SHIP'S C-terminus. We were particularly interested in whether the association of Grb2 C-SH3 with SHIP'S N-terminus was sufficient for the formation of a SHIP/Shc/Grb2 complex previously identified by Harmer and DeFranco (Harmer and DeFranco, 1999). Our results indicated that the ability of one Grb2 molecule to bind SHIP'S most N-terminal PxxP motif was sufficient to facilitate the association of SHIP with She, despite the She PTB ligand sites being removed. These results appear to contradict the Harmer and DeFranco model, which contends that two Grb2 molecules are required to form a bridge between SHIP and She. More specifically, they suggested that the two Grb2 molecules bind simultaneously to SHIP'S C-terminus via their C-SH3 domains and to She's pTyr residues via their SH2 domains, while She and SHIP completed the ternary complex with She's PTB domain associating with one of SHIP'S NPxpY motifs. Although the exact function of SHIP binding Grb2 and She is not fully understood, our characterization of this interaction should act as a starting point for more detailed studies on the formation and biological relevance of this complex. These results also have implications for the protein complex formations available to the C-terminally truncated isoforms of SHIP that have been reported (Damen et al., 1998; Rohrschneider et al., 2000). Our finding that Src family SH3 domains bind to SHIP'S most N-terminal PxxP motif (Figure 7.1) complemented our studies showing that Src family kinases played a key role in the regulation of SHIP'S tyrosine phosphorylation. Curiously, although the rapid phosphorylation of SHIP has been observed following activation of almost every major class of cell surface receptor expressed in hematopoietic cells, only one recent study has attempted to identify the kinase(s) involved. This report established a role for Lyn, but not Syk, in the phosphorylation of SHIP in response to B C R engagement. We not only confirmed these results in B cells but also extended our studies to ascertain that SHIP phosphorylation was regulated by Src kinases in response to both growth factor (c-Kit) and cytokine (IL-3R) receptor activation. This discovery could have major implications on 152 future studies examining the role of SHIP phosphorylation in protein complex formation and enzymatic regulation. Few studies to establish the role of SHIP'S proline-rich regions have been reported. In particular, a detailed assessment of the role of SHIP'S proline-rich C-terminal tail has lagged behind those examining the importance of the SH2 domain or NPxY motifs. When our in vitro protein binding assays were unsuccessful at identifying any potential binding partners for the tail end of SHIP (other than Grb2), we decided to take a different approach. Instead, we elected to examine the effects that removal of various portions of SHIP would have on its ability to hydrolyze Ptdlns3,4,5P 3, as well as effect biological processes thought to be regulated by SHIP. Our analysis of SHIP"'" B M M C s expressing three truncated forms of SHIP revealed that the C-terminus of SHIP was critical to SHIP'S ability to become tyrosine phosphorylated and function as an enzyme. Together these results indicate that SHIP'S C-terminus might be involved in the translocation of SHIP to the plasma membrane and/or the closely associated submembraneous cytoskeleton. These observations could indicate that SHIP'S C-terminus is involved in associating with SH3-containing, cytoskeletal components that translocate and/or hold SHIP in the submembraneous cytoskeleton, nearer to its substrate. In fact, several of SHIP'S binding partners, such as Lyn and Syk (Jugloff and Jongstra-Bilen, 1997), She (Thomas et al., 1995), and Grb2 (Bar-Sagi et al., 1993) have all been shown to localize to the cytoskeletal fraction in various cell types, and in Grb2's case, this activity requires both of its SH3 domains. Related to this, we have preliminary data from affinity column chromatography experiments that shows SHIP associates with both actin and the heavy chain of non-muscle myosin (Ware, et al., unpublished). Interestingly, a previous study from our laboratory reported that only the 110-kDa, C-terminally truncated isoform of SHIP is present in the submembraneous cytoskeleton, while the full-length SHIP was found almost exclusively in the cytoplasmic fraction. However, unpublished data from our B M M C studies found that large amounts of full-length SHIP are present in the submembraneous cytoskeletal fraction and could only be released by treatment with boiling SDS-sample buffer, and not by extraction under high salt conditions with TX-100 and deoxycholate. 153 Therefore, our previous data could be reinterpreted to indicate that the C-terminus is required to anchor SHIP to the cytoskeleton. By expressing the 2NPXY mutant in SHIP"7" BMMCs, we were able to make some surprising and important findings regarding SHIP'S role in regulating SCF-induced Ptdlns3,4,5P 3 levels, extracellular calcium influx, and secretory granule release. More specifically, we found that while this mutant could not bind She, its expression did lead to a partial reduction in SCF-induced Ptdlns3,4,5P 3 and degranulation, while no effect on the abnormally high calcium levels was observed. This led us to suggest that the C a + + influx and degranulation could be uncoupled to some extent. In previous models of SHIP'S role in regulating SCF-induced degranulation it was suggested that the loss of SHIP led to abnormally high Ptdlns3,4,5P 3 levels following S C F stimulation, which in turn led to the aberrant influx of extracellular calcium, thereby resulting in granule release (Huber et al., 1998b). However, our finding that a reduction in Ptdlns3,4,5P 3 levels causes a similar reduction in degranulation, independent of intracellular C a + + levels, indicates that Ptdlns3,4,5P 3 may control degranulation on more than one level. Related to this, several studies have demonstrated a role for Rho and Rac in the regulation of granule secretion. More specifically, these studies found that the introduction of constitutively active Rho and Rac into mast cells increased the proportion of the cells in the population capable of degranulating in respond to stimulation, in a manner that was independent of Rho/Rac regulated F-actin disassembly (Price et al., 1995; Sullivan et al., 1999). Interestingly, the Rac G E F , Vav, is allosterically activated by the association of its PH domain with Ptdlns3,4,5P 3, while Ptdlns3,4P 2 inhibits its activity. This therefore could represent another facet of B M M C degranulation that could be directly regulated by SHIP. In conclusion, we have made some interesting observations regarding SHIP and its role in various signalling processes. We believe that our results will provide a starting point for future studies to characterize this important and complex molecule. In particular, we hope that our results have convinced others that the continued analysis of SHIP'S proline-rich motifs could prove an invaluable source of information with regards to SHIP'S 154 protein-protein binding partners, its subcellular localization, and its role in Ptdlns3,4,5P 3 and Ptdlns3,4P 2 regulated cellular processes. 155 B I B L I O G R A P H Y Adachi, T., Pazdrak, K., Stafford, S., and Alam, R. (1999). The mapping of the Lyn kinase binding site of the common beta subunit of IL-3/granulocyte-macrophage colony-stimulating factor/IL-5 receptor. J Immunol 162, 1496-501. Alberts, B., Bray, D., Lewis, J . , Raff, M., Roberts, K., and Watson, J.D. (1994). Molecular Biology of the Cell, 3rd Edition (London, UK: Garland Publishing Inc.). Alessi, D. R., Deak, M., Casamayor, A., Caudwell, F. B., Morrice, N., Norman, D. G., Gaffney, P., Reese, C. B., MacDougall, C. N., Harbison, D., Ashworth, A., and Bownes, M. (1997). 3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional homology with the Drosophila DSTPK61 kinase. Curr Biol 7, 776-89. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997). Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 7, 261-9. Alexandropoulos, K., Cheng, G., and Baltimore, D. (1995). Proline-rich sequences that bind to Src homology 3 domains with individual specificities. Proc Natl Acad Sci U S A 92, 3110-4. 156 Aman, M. J . , Lamkin, T. D., Okada, H., Kurosaki, T., and Ravichandran, K. S. (1998). The inositol phosphatase SHIP inhibits Akt/PKB activation in B cells. J Biol Chem 273, 33922-8. Aman, M. J . , Walk, S. F., March, M. E., Su, H. P., Carver, D. J . , and Ravichandran, K. S. (2000). Essential role for the C-terminal noncatalytic region of SHIP in FcgammaRIIBI-mediated inhibitory signaling. Mol Cell Biol 20, 3576-89. Anderson, K. E., Coadwell, J . , Stephens, L. R., and Hawkins, P. T. (1998). Translocation of PDK-1 to the plasma membrane is important in allowing PDK-1 to activate protein kinase B. Curr Biol 8, 684-91. Attree, O., Olivos, I. M., Okabe, I., Bailey, L. C , Nelson, D. L., Lewis, R. A., Mclnnes, R. R., and Nussbaum, R. L. (1992). The Lowe's oculocerebrorenal syndrome gene encodes a protein highly homologous to inositol polyphosphate-5-phosphatase. Nature 358, 239-42. Auethavekiat, V., Abrams, C. S., and Majerus, P. W. (1997). Phosphorylation of platelet pleckstrin activates inositol polyphosphate 5-phosphatase I. J Biol Chem 272, 1786-90. Auger, K. R., Serunian, L. A., Soltoff, S. P., Libby, P., and Cantley, L. C. (1989). P D G F -dependent tyrosine phosphorylation stimulates production of novel polyphosphoinositides in intact cells. Cell 57, 167-75. 157 Avanzi, G. C., Lista, P., Giovinazzo, B., Miniero, R., Saglio, G., Benetton, G., Coda, R., Cattoretti, G., and Pegoraro, L. (1988). Selective growth response to IL-3 of a human leukaemic cell line with megakaryoblastic features. Br J Haematol 69, 359-66. Bae, Y. S., Cantley, L. G., Chen, C. S., Kim, S. R., Kwon, K. S., and Rhee, S. G. (1998). Activation of phospholipase C-gamma by phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273, 4465-9. Bagley, C. J . , Woodcock, J . M., Stomski, F. C , and Lopez, A. F. (1997). The structural and functional basis of cytokine receptor activation: lessons from the common beta subunit of the granulocyte-macrophage colony-stimulating factor, interleukin-3 (IL-3), and IL-5 receptors. Blood 89, 1471-82. Banfic, H., Tang, X., Batty, I. H., Downes, C. P., Chen, C , and Rittenhouse, S. E. (1998). A novel integrin-activated pathway forms PKB/Akt-stimulatory phosphatidylinositol 3,4-bisphosphate via phosphatidylinositol 3-phosphate in platelets. J Biol Chem 273,13-6. Barinaga, M. (1999). New clues to how proteins link up to run the cell [news; comment]. Science 283, 1247, 1249. Bar-Sagi, D., Rotin, D., Batzer, A., Mandiyan, V., and Schlessinger, J . (1993). SH3 domains direct cellular localization of signaling molecules. Cell 74, 83-91. 158 Blaikie, P., Immanuel, D., Wu, J . , Li, N., Yajnik, V., and Margolis, B. (1994). A region in She distinct from the SH2 domain can bind tyrosine-phosphorylated growth factor receptors. J Biol Chem 269, 32031-4. Blume-Jensen, P., Claesson-Welsh, L., Siegbahn, A., Zsebo, K. M., Westermark, B., and Heldin, C. H. (1991). Activation of the human c-kit product by ligand-induced dimerization mediates circular actin reorganization and chemotaxis. E M B O 10, 4121-8. Bolen, J . B., and Brugge, J . S. (1997). Leukocyte protein tyrosine kinases: potential targets for drug discovery. Annu Rev Immunol 15, 371-404. Bolland, S., Pearse, R. N., Kurosaki, T., and Ravetch, J . V. (1998). SHIP modulates immune receptor responses by regulating membrane association of Btk. Immunity 8, 509-16. Bonfini, L , Migliaccio, E., Pelicci, G., Lanfrancone, L , and Pelicci, P. G. (1996). Not all She's roads lead to Ras. Trends Biochem Sci 21, 257-61. Bottomley, M. J . , Salim, K., and Panayotou, G. (1998). Phospholipid-binding protein domains. Biochim Biophys Acta 1436, 165-83. 159 Boyle, A. L , Feltquite, D. M., Dracopoli, N. C , Housman, D. E., and Ward, D. C. (1992). Rapid physical mapping of cloned DNA on banded mouse chromosomes by fluorescence in situ hybridization. Genomics 12,106-15. Brauweiler, A., Tamir, I., Dal Porto, J . , Benschop, R. J . , Helgason, C. D., Humphries, R. K., Freed, J . H., and Cambier, J . C. (2000). Differential regulation of B cell development, activation, and death by the src homology 2 domain-containing 5' inositol phosphatase (SHIP). J Exp Med 191, 1545-54. Broudy, V. C. (1997). Stem cell factor and hematopoiesis. Blood 90, 1345-64. Burkhardt, A. L , Brunswick, M., Bolen, J . B., and Mond, J . J . (1991). Anti-immunoglobulin stimulation of B lymphocytes activates src-related protein-tyrosine kinases. Proc Natl Acad S c i U S A 8 8 , 7410-4. Cambier, J . C , Pleiman, C. M., and Clark, M. R. (1994). Signal transduction by the B cell antigen receptor and its coreceptors. Annu Rev Immunol 12, 457-86. Campbell, J . K., Gurung, R., Romero, S., Speed, C. J . , Andrews, R. K., Berndt, M. C , and Mitchell, C. A. (1997). Activation of the 43 kDa inositol polyphosphate 5-phosphatase by 14-3-3zeta. Biochemistry 36, 15363-70. 160 Carew, M. A., Yang, X., Schultz, C , and Shears, S. B. (2000). myo-inositol 3,4,5,6-tetrakisphosphate inhibits an apical calcium-activated chloride conductance in polarized monolayers of a cystic fibrosis cell-line. J Biol Chem 275, 26906-13 Chacko, G. W., Tridandapani, S., Damen, J . E., Liu, L., Krystal, G., and Coggeshall, K. M. (1996). Negative signaling in B lymphocytes induces tyrosine phosphorylation of the 145-kDa inositol polyphosphate 5-phosphatase, SHIP. J Immunol 757, 2234-8. Chan, V. W., Meng, F., Soriano, P., DeFranco, A. L , and Lowell, C. A. (1997). Characterization of the B lymphocyte populations in Lyn-deficient mice and the role of Lyn in signal initiation and down-regulation. Immunity 7, 69-81. Chen, R. H., Corbalan-Garcia, S., and Bar-Sagi, D. (1997). The role of the PH domain in the signal-dependent membrane targeting of Sos. EMBO 16,1351-9. Chou, M. M., Hou, W., Johnson, J . , Graham, L. K., Lee, M. H., Chen, C. S., Newton, A. C , Schaffhausen, B. S., and Toker, A. (1998). Regulation of protein kinase C zeta by PI 3-kinase and PDK-1. Curr Biol 8, 1069-77. Coggeshall, K. M. (1998). Inhibitory signaling by B cell Fc gamma Rllb. Curr Opin Immunol 10, 306-12. 161 Crowley, M. T., Harmer, S. L , and DeFranco, A. L. (1996). Activation-induced association of a 145-kDa tyrosine-phosphorylated protein with She and Syk in B lymphocytes and macrophages. J Biol Chem 271, 1145-52. Cullen, P. J . (1998). Bridging the G A P in inositol 1,3,4,5-tetrakisphosphate signalling. Biochim Biophys Acta 1436, 35-47. Cullen, P. J . , Hsuan, J . J . , Truong, O., Letcher, A. J . , Jackson, T. R., Dawson, A. P., and Irvine, R. F. (1995). Identification of a specific lns(1,3,4,5)P4-binding protein as a member of the GAP1 family. Nature 376, 527-30. D'Ambrosio, D., Fong, D. C , and Cambier, J . C. (1996). The SHIP phosphatase becomes associated with Fc gammaRIIBI and is tyrosine phosphorylated during 'negative' signaling. Immunol Lett 54, 77-82. D'Ambrosio, D., Hippen, K. L , Minskoff, S. A., Mellman, I., Pani, G., Siminovitch, K. A., and Cambier, J . C. (1995). Recruitment and activation of PTP1C in negative regulation of antigen receptor signaling by Fc gamma RIIB1. Science 268, 293-7. Damen, J . E., Liu, L , Cutler, R. L , and Krystal, G. (1993). Erythropoietin stimulates the tyrosine phosphorylation of She and its association with Grb2 and a 145-Kd tyrosine phosphorylated protein. Blood 82, 2296-303. 162 Damen, J . E., Liu, L , Rosten, P., Humphries, R. K., Jefferson, A. B., Majerus, P. W., and Krystal, G. (1996). The 145-kDa protein induced to associate with She by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc Natl Acad Sci U S A 93, 1689-93. Damen, J . E., Liu, L , Ware, M. D., Ermolaeva, M., Majerus, P. W., and Krystal, G. (1998). Multiple forms of the SH2-containing inositol phosphatase, SHIP, are generated by C-terminal truncation. Blood 92,1199-205. Darnell, J . E., Jr. (1997). STATs and gene regulation. Science 277, 1630-5. Davletov, B. A., and Sudhof, T. C. (1993). A single C2 domain from synaptotagmin I is sufficient for high affinity Ca2+/phospholipid binding. J Biol Chem 268, 26386-90. De Camilli, P., Emr, S. D., McPherson, P. S., and Novick, P. (1996). Phosphoinositides as regulators in membrane traffic. Science 271, 1533-9. de Heuvel, E., Bell, A. W., Ramjaun, A. R., Wong, K., Sossin, W. S., and McPherson, P. S. (1997). Identification of the major synaptojanin-binding proteins in brain. J Biol Chem 272, 8710-6. 163 De Smedt, F., Boom, A., Pesesse, X., Schiffmann, S. N., and Erneux, C. (1996). Post-translational modification of human brain type I inositol-1,4,5-trisphosphate 5-phosphatase by farnesylation. J Biol Chem 271, 10419-24. den Hertog, J . , and Hunter, T. (1996). Tight association of GRB2 with receptor protein-tyrosine phosphatase alpha is mediated by the SH2 and C-terminal SH3 domains. E M B O 15, 3016-27. Dressman, M. A., Olivos-Glander, I. M., Nussbaum, R. L , and Suchy, S. F. (2000). OcrM, a Ptdlns(4,5)P(2) 5-phosphatase, is localized to the trans-Golgi network of fibroblasts and epithelial cells. J Histochem Cytochem 48,179-90. Eck, M. J . , Shoelson, S. E., and Harrison, S. C. (1993). Recognition of a high-affinity phosphotyrosyl peptide by the Src homology-2 domain of p56lck. Nature 362, 87-91. Eckhart, W., Hutchinson, M. A., and Hunter, T. (1979). An activity phosphorylating tyrosine in polyoma T antigen immunoprecipitates. Cell 18, 925-33. Erneux, C , Govaerts, C , Communi, D., and Pesesse, X. (1998). The diversity and possible functions of the inositol polyphosphate 5-phosphatases. Biochim Biophys Acta 1436, 185-99. 164 Falasca, M., Logan, S. K., Lehto, V. P., Baccante, G., Lemmon, M. A., and Schlessinger, J . (1998). Activation of phospholipase C gamma by PI 3-kinase-induced PH domain-mediated membrane targeting. EMBO 17, 414-22. Famiglietti, S. J . , Nakamura, K., and Cambier, J . C. (1999). Unique features of SHIP, SHP-1 and SHP-2 binding to FcgammaRllb revealed by surface plasmon resonance analysis. Immunol Lett 68, 35-40. Felder, S., Zhou, M., Hu, P., Urena, J . , Ullrich, A., Chaudhuri, M., White, M., Shoelson, S. E., and Schlessinger, J . (1993). SH2 domains exhibit high-affinity binding to tyrosine-phosphorylated peptides yet also exhibit rapid dissociation and exchange. Mol Cell Biol 13, 1449-55. Feng, G. S. (1999). Shp-2 tyrosine phosphatase: signaling one cell or many. Exp Cell Res 253, 47-54. Feng, S., Chen, J . K., Yu, H., Simon, J . A., and Schreiber, S. L. (1994). Two binding orientations for peptides to the Src SH3 domain: development of a general model for SH3-ligand interactions. Science 266,1241-7. Feng, X., and Hannun, Y. A. (1998). An essential role for autophosphorylation in the dissociation of activated protein kinase C from the plasma membrane. J Biol Chem 273, 26870-4. 165 Forman-Kay, J . D., and Pawson, T. (1999). Diversity in protein recognition by PTB domains. Curr Opin Struct Biol 9, 690-5. Franke, T. F., Kaplan, D. R., Cantley, L. O , and Toker, A. (1997). Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science 275, 665-8. Freeh, M., Andjelkovic, M., Ingley, E., Reddy, K. K., Falck, J . R., and Hemmings, B. A. (1997). High affinity binding of inositol phosphates and phosphoinositides to the pleckstrin homology domain of RAC/protein kinase B and their influence on kinase activity. J Biol Chem 272, 8474-81. Fruman, D. A., Rameh, L. E., and Cantley, L. C. (1999). Phosphoinositide binding domains: embracing 3-phosphate. Cell 97, 817-20. Fukuda, M., Kojima, T., Kabayama, H., and Mikoshiba, K. (1996a). Mutation of the pleckstrin homology domain of Bruton's tyrosine kinase in immunodeficiency impaired inositol 1,3,4,5-tetrakisphosphate binding capacity. J Biol Chem 277, 30303-6. Fukuda, M., Kojima, T., and Mikoshiba, K. (1996b). Phospholipid composition dependence of Ca2+-dependent phospholipid binding to the C2A domain of synaptotagmin IV. J Biol Chem 277, 8430-4. 166 Fukuda, M., and Mikoshiba, K. (1997). The function of inositol high polyphosphate binding proteins. Bioessays 19, 593-603. Fukuda, M., and Mikoshiba, K. (1996). Structure-function relationships of the mouse G a p l m . Determination of the inositol 1,3,4,5-tetrakisphosphate-binding domain. J Biol Chem 271, 18838-42. Furnari, F. B., Huang, H. J . , and Cavenee, W. K. (1998). The phosphoinositol phosphatase activity of P T E N mediates a serum-sensitive G1 growth arrest in glioma cells. Cancer Res 58, 5002-8. Gallagher, E., Howell, B. W., Soriano, P., Cooper, J . A., and Hawkes, R. (1998). Cerebellar abnormalities in the disabled (mdab1-1) mouse. J Comp Neurol 402, 238-51. Galli, S. J . , and Wershil, B. K. (1996). The two faces of the mast cell [news; comment]. Nature 387, 21-2. Gaul, B. S., Harrison, M. L , Geahlen, R. L , Burton, R. A., and Post, C. B. (2000). Substrate Recognition by the Lyn Protein-tyrosine Kinase. NMR structure of the immunoreceptor tyrosine-based activation motif signaling region of the b cell antigen receptor. J Biol Chem 275, 16174-16182. 167 Gaullier, J . M., Simonsen, A., D'Arrigo, A., Bremnes, B., and Stenmark, H. (1999). F Y V E finger proteins as effectors of phosphatidylinositol 3-phosphate. Chem Phys Lipids 98, 87-94. Geier, S. J . , Algate, P. A , Carlberg, K., Flowers, D., Friedman, C , Trask, B., and Rohrschneider, L. R. (1997). The human SHIP gene is differentially expressed in cell lineages of the bone marrow and blood. Blood 89, 1876-85. Giuriato, S., Payrastre, B., Drayer, A. L., Plantavid, M., Woscholski, R., Parker, P., Erneux, C , and Chap, H. (1997). Tyrosine phosphorylation and relocation of SHIP are integrin-mediated in thrombin-stimulated human blood platelets. J Biol Chem 272, 26857-63. Gold, M. R., and Matsuuchi, L. (1995). Signal transduction by the antigen receptors of B and T lymphocytes. Int Rev Cytol 157,181-276. Gold, M. R., Matsuuchi, L , Kelly, R. B., and DeFranco, A. L. (1991). Tyrosine phosphorylation of components of the B-cell antigen receptors following receptor crosslinking. Proc Natl Acad Sci U S A 88, 3436-40. Gray, A., Van Der Kaay, J . , and Downes, C. P. (1999). The pleckstrin homology domains of protein kinase B and GRP1 (general receptor for phosphoinositides-1) are sensitive 168 and selective probes for the cellular detection of phosphatidylinositol 3,4-bisphosphate and/or phosphatidylinositol 3,4,5-trisphosphate in vivo. Biochem J 344 Pt 3, 929-36. Gray, N. K., and Wickens, M. (1998). Control of translation initiation in animals. Annu Rev Cell Dev Biol 14, 399-458. Gupta, N., Scharenberg, A. M., Burshtyn, D. N., Wagtmann, N., Lioubin, M. N., Rohrschneider, L. R., Kinet, J . P., and Long, E. O. (1997). Negative signaling pathways of the killer cell inhibitory receptor and Fc gamma Rl lb l require distinct phosphatases. J Exp Med 186, 473-8. Gupta, N., Scharenberg, A. M., Fruman, D. A., Cantley, L. C , Kinet, J . P., and Long, E. O. (1999). The SH2 domain-containing inositol 5'-phosphatase (SHIP) recruits the p85 subunit of phosphoinositide 3-kinase during FcgammaRllbl-mediated inhibition of B cell receptor signaling. J Biol Chem 274, 7489-94. Habib, T., Hejna, J . A., Moses, R. E., and Decker, S. J . (1998). Growth factors and insulin stimulate tyrosine phosphorylation of the 51C/SHIP2 protein. J Biol Chem 273, 18605-9. Haffner, C , Takei, K., Chen, H., Ringstad, N., Hudson, A., Butler, M. H., Salcini, A. E., Di Fiore, P. P., and De Camilli, P. (1997). Synaptojanin 1: localization on coated endocytic intermediates in nerve terminals and interaction of its 170 kDa isoform with Eps15. F E B S Lett 419, 175-80. 169 Hamm, H. E., and Gilchrist, A. (1996). Heterotrimeric G proteins. Curr Opin Cell Biol 8, 189-96. Han, J . , Luby-Phelps, K., Das, B., Shu, X., Xia, Y., Mosteller, R. D., Krishna, U. M., Falck, J . R., White, M. A., and Broek, D. (1998). Role of substrates and products of PI 3-kinase in regulating activation of Rac-related guanosine triphosphatases by Vav. Science 279, 558-60. Hanks, S.K., Quinn, A., and Hunter, T. (1988) The protein kinase Family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 43-52. Hansbro, P. M., Foster, P. S., Hogan, S. P., Ozaki, S., and Denborough, M. A. (1994). Purification and characterization of D-myo-inositol (1,4,5)/(1,3,4,5)- polyphosphate 5-phosphatase from skeletal muscle. Arch Biochem Biophys 377, 47-54. Harmer, S. L , and DeFranco, A. L. (1999). The src homology domain 2-containing inositol phosphatase SHIP forms a ternary complex with She and Grb2 in antigen receptor-stimulated B lymphocytes. J Biol Chem 274, 12183-91. Hashimoto, A., Hirose, K., Okada, H., Kurosaki, T., and lino, M. (1999). Inhibitory modulation of B cell receptor-mediated Ca2+ mobilization by Src homology 2 domain-containing inositol 5'-phosphatase (SHIP). J Biol Chem 274, 11203-8. 170 Hawkins, P. T., Jackson, T. R., and Stephens, L. R. (1992). Platelet-derived growth factor stimulates synthesis of Ptdlns(3,4,5)P3 by activating a Ptdlns(4,5)P2 3-OH kinase. Nature 358, 157-9. Heldin, C. H. (1996). Protein tyrosine kinase receptors. Cancer Surv 27, 7-24. Helgason, C. D., Damen, J . E., Rosten, P., Grewal, R., Sorensen, P., Chappel, S. M., Borowski, A., Jirik, F., Krystal, G., and Humphries, R. K. (1998). Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev 12, 1610-20. Helgason, C. D., Kalberer, C. P., Damen, J . E., Chappel, S. M., Pineault, N., Krystal, G., and Humphries, R. K. (2000). A Dual Role for Src Homology 2 Domain-containing lnositol-5-Phosphatase (SHIP) in Immunity. Aberrant development and enhanced function of b lymphocytes in ship(-/)- mice. J Exp Med 191, 781-794. Hemmings, B. A. (1997). PH domains-a universal membrane adapter. Science 275, 1899. Heng, H. H., and Tsui, L. C. (1993). Modes of DAPI banding and simultaneous in situ hybridization. Chromosoma 102, 325-32. 171 Hibbs, M. L , Tarlinton, D. M., Armes, J . , Grail, D., Hodgson, G., Maglitto, R., Stacker, S. A., and Dunn, A. R. (1995). Multiple defects in the immune system of Lyn-deficient mice, culminating in autoimmune disease. Cell 83, 301-11. Hinchliffe, K. A., Ciruela, A., and Irvine, R. F. (1998). PIPkinsI, their substrates and their products: new functions for old enzymes. Biochim Biophys Acta 1436, 87-104. Howell, B. W., Gertler, F. B., and Cooper, J . A. (1997). Mouse disabled (mDabl): a Src binding protein implicated in neuronal development. E M B O 16, 121-32. Howell, B. W., Lanier, L. M., Frank, R., Gertler, F. B., and Cooper, J . A. (1999). The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol Cell Biol 19, 5179-88. Huber, M., Helgason, C. D., Damen, J . E., Liu, L , Humphries, R. K., and Krystal, G. (1998a). The src homology 2-containing inositol phosphatase (SHIP) is the gatekeeper of mast cell degranulation. Proc Natl Acad Sci U S A 95, 11330-5. Huber, M., Helgason, C. D., Scheid, M. P., Duronio, V., Humphries, R. K., and Krystal, G. (1998b). Targeted disruption of SHIP leads to Steel factor-induced degranulation of mast cells. E M B O 17, 7311-9. 172 Huber, M., Helgason, C. D., Damen, J . E., Scheid, M., Duronio, V., Liu, L., Ware, M. D., Humphries, R. K., and Krystal, G. (1999). The role of SHIP in growth factor induced signalling. Prog Biophys Mol Biol 71, 423-34. Hunter, T., and Sefton, B. M. (1980). Transforming gene product of Rous sarcoma virus phosphorylates tyrosine. Proc Natl Acad Sci U S A 77, 1311-5. Hyvonen, M., and Saraste, M. (1997). Structure of the PH domain and Btk motif from Bruton's tyrosine kinase: molecular explanations for X-linked agammaglobulinaemia. E M B O 16, 3396-404. Ihle, J . N., Thierfelder, W., Teglund, S., Stravapodis, D., Wang, D., Feng, J . , and Parganas, E. (1998). Signaling by the cytokine receptor superfamily. Ann N Y Acad Sci 865, 1-9. Ihle, J . N., Witthuhn, B., Tang, B., Yi , T., and Quelle, F. W. (1994). Cytokine receptors and signal transduction. Baillieres Clin Haematol 7, 17-48. Ingham, R. J . , Okada, H., Dang-Lawson, M., Dinglasan, J . , van Der Geer, P., Kurosaki, T., and Gold, M. R. (1999). Tyrosine phosphorylation of she in response to B cell antigen receptor engagement depends on the SHIP inositol phosphatase. J Immunol 763, 5891-5. 173 Jackson, S. P., Schoenwaelder, S. M., Matzaris, M., Brown, S., and Mitchell, C. A. (1995). Phosphatidylinositol 3,4,5-trisphosphate is a substrate for the 75 kDa inositol polyphosphate 5-phosphatase and a novel 5-phosphatase which forms a complex with the p85/p110 form of phosphoinositide 3-kinase. EMBO 14, 4490-500. Jaken, S. (1996). Protein kinase C isozymes and substrates. Curr Opin Cell Biol 8, 168-73. Janne, P. A., Suchy, S. F., Bernard, D., MacDonald, M., Crawley, J . , Grinberg, A., Wynshaw-Boris, A., Westphal, H., and Nussbaum, R. L. (1998). Functional overlap between murine Inpp5b and Ocrl l may explain why deficiency of the murine ortholog for OCRL1 does not cause Lowe syndrome in mice. J Clin Invest 101, 2042-53. Jefferson, A. B., and Majerus, P. W. (1996). Mutation of the conserved domains of two inositol polyphosphate 5-phosphatases. Biochemistry 35, 7890-4. Jefferson, A. B., and Majerus, P. W. (1995). Properties of type II inositol polyphosphate 5-phosphatase. J Biol Chem 270, 9370-7. Ji, T. H., Grossmann, M., and Ji, I. (1998). G protein-coupled receptors. I. Diversity of receptor-ligand interactions. J Biol Chem 273,17299-302. 174 Johnson, L. N., Noble, M. E., and Owen, D. J . (1996). Active and inactive protein kinases: structural basis for regulation. Cell 85, 149-58. Jugloff, L. S., and Jongstra-Bilen, J . (1997). Cross-linking of the IgM receptor induces rapid translocation of IgM-associated Ig alpha, Lyn, and Syk tyrosine kinases to the membrane skeleton. J Immunol 759, 1096-106. Kalberer, C. P., Helgason, C. D., Rosten, P., Magil, A., and Humphries, R. K. (2000). SHIP Deficient Mice Exhibit Aberrant Development and Function of B cells Leading to Autoimmunity. In Swiss Society for Allerogology and Immunity, 50th Annual Assembly (Basel, Switzerland. Katan, M., and Allen, V. L. (1999). Modular PH and C2 domains in membrane attachment and other functions. F E B S Lett 452, 36-40. Kavanaugh, W. M., Pot, D. A., Chin, S. M., Deuter-Reinhard, M., Jefferson, A. B., Norris, F. A., Masiarz, F. R., Cousens, L. S., Majerus, P. W., and Williams, L. T. (1996). Multiple forms of an inositol polyphosphate 5-phosphatase form signaling complexes with She and Grb2. Curr Biol 6, 438-45. Kavanaugh, W. M., and Williams, L. T. (1994). An alternative to SH2 domains for binding tyrosine-phosphorylated proteins. Science 266, 1862-5. 175 Kavran, J . M., Klein, D. E., Lee, A., Falasca, M., Isakoff, S. J . , Skolnik, E. Y., and Lemmon, M. A. (1998). Specificity and promiscuity in phosphoinositide binding by pleckstrin homology domains. J Biol Chem 273, 30497-508. Kay, B. K., Williamson, M. P., and Sudol, M. (2000). The importance of being proline: the interaction of proline-rich motifs in signaling proteins with their cognate domains. F A S E B 14, 231-41. Kerr, W. G., Heller, M., and Herzenberg, L. A. (1996). Analysis of lipopolysaccharide-response genes in B-lineage cells demonstrates that they can have differentiation stage-restricted expression and contain SH2 domains. Proc Natl Acad Sci U S A 93, 3947-52. Kimura, T., Sakamoto, H., Appella, E., and Siraganian, R. P. (1997). The negative signaling molecule SH2 domain-containing inositol-polyphosphate 5-phosphatase (SHIP) binds to the tyrosine-phosphorylated beta subunit of the high affinity IgE receptor. J Biol Chem 272, 13991-6. Kitamura, Y., and Go, S. (1979). Decreased production of mast cells in S1/S1d anemic mice. Blood 53, 492-7. Kitamura, Y., Go, S., and Hatanaka, K. (1978). Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation. Blood 52, 447-52. 176 Klarlund, J . K., Rameh, L. E., Cantley, L. C , Buxton, J . M., Holik, J . J . , Sakelis, C , Patki, V., Corvera, S., and Czech, M. P. (1998). Regulation of GRP1-catalyzed A D P ribosylation factor guanine nucleotide exchange by phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273, 1859-62. Klippel, A., Kavanaugh, W. M., Pot, D., and Williams, L. T. (1997). A specific product of phosphatidylinositol 3-kinase directly activates the protein kinase Akt through its pleckstrin homology domain. Mol Cell Biol 17, 338-44. Koch, C. A., Anderson, D., Moran, M. F., Ellis, C , and Pawson, T. (1991). SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins. Science 252, 668-74. Kotzyba-Hibert, F., Grutter, T., and Goeldner, M. (1999). Molecular investigations on the nicotinic acetylcholine receptor: conformational mapping and dynamic exploration using photoaffinity labeling. Mol Neurobiol 20, 45-59. Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15, 8125-48. Kranenburg, O., Verlaan, I., and Moolenaar, W. H. (1999). Gi-mediated tyrosine phosphorylation of Grb2 (growth-factor-receptor-bound protein 2)-bound dynamin-ll by lysophosphatidic acid. Biochem J 339,11-4. 177 Kuroiwa, A., Yamashita, Y., Inui, M., Yuasa, T., Ono, M., Nagabukuro, A., Matsuda, Y., and Takai, T. (1998). Association of tyrosine phosphatases SHP-1 and SHP-2 , inositol 5-phosphatase SHIP with gp49B1, and chromosomal assignment of the gene. J Biol Chem 273, 1070-4. Kurosaki, T., Takata, M., Yamanashi, Y., Inazu, T., Taniguchi, T., Yamamoto, T., and Yamamura, H. (1994). Syk activation by the Src-family tyrosine kinase in the B cell receptor signaling. J Exp Med 179, 1725-9. Kutateladze, T. G., Ogburn, K. D., Watson, W. T., de Beer, T., Emr, S. D., Burd, C. G., and Overduin, M. (1999). Phosphatidylinositol 3-phosphate recognition by the F Y V E domain. Mol Cell 3, 805-11. Laminet, A. A., Apell, G., Conroy, L., and Kavanaugh, W. M. (1996). Affinity, specificity, and kinetics of the interaction of the S H C phosphotyrosine binding domain with asparagine-X-X-phosphotyrosine motifs of growth factor receptors. J Biol Chem 271, 264-9. Lamkin, T. D., Walk, S. F., Liu, L., Damen, J . E., Krystal, G., and Ravichandran, K. S. (1997). She interaction with Src homology 2 domain containing inositol phosphatase (SHIP) in vivo requires the Shc-phosphotyrosine binding domain and two specific phosphotyrosines on SHIP. J Biol Chem 272, 10396-401. 178 Langille, S. E., Patki, V., Klarlund, J . K., Buxton, J . M., Holik, J . J . , Chawla, A., Corvera, S., and Czech, M. P. (1999). ADP-ribosylation factor 6 as a target of guanine nucleotide exchange factor G R P 1 . J Biol Chem 274, 27099-104. Lantz, C. S., Boesiger, J . , Song, C. H., Mach, N., Kobayashi, T., Mulligan, R. C , Nawa, Y., Dranoff, G., and Galli, S. J . (1998). Role for interleukin-3 in mast-cell and basophil development and in immunity to parasites. Nature 392, 90-3. Laxminarayan, K. M., Chan, B. K., Tetaz, T., Bird, P. I., and Mitchell, C. A. (1994). Characterization of a cDNA encoding the 43-kDa membrane-associated inositol-polyphosphate 5-phosphatase. J Biol Chem 269, 17305-10. Le Good, J . A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., and Parker, P. J . (1998). Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281, 2042-5. Lecoq-Lafon, C , Verdier, F., Fichelson, S., Chretien, S., Gisselbrecht, S., Lacombe, C , and Mayeux, P. (1999). Erythropoietin induces the tyrosine phosphorylation of GAB1 and its association with SHC, SHP2, SHIP, and phosphatidylinositol 3-kinase. Blood 93, 2578-85. 179 Lee, J . O., Yang, H., Georgescu, M. M., Di Cristofano, A., Maehama, T., Shi, Y., Dixon, J . E., Pandolfi, P., and Pavletich, N. P. (1999). Crystal structure of the P T E N tumor suppressor: implications for its phosphoinositide phosphatase activity and membrane association. Cell 99, 323-34. Lemay, S., Davidson, D., Latour, S., and Veillette, A. (2000). Dok-3, a novel adapter molecule involved in the negative regulation of immunoreceptor signaling. Mol Cell Biol 20, 2743-2754. Lennartsson, J . , Blume-Jensen, P., Hermanson, M., Ponten, E., Carlberg, M., and Ronnstrand, L. (1999). Phosphorylation of She by Src family kinases is necessary for stem cell factor receptor/c-kit mediated activation of the Ras/MAP kinase pathway and c-fos induction. Oncogene 18, 5546-53. Lev, S., Yarden, Y., and Givol, D. (1992). Dimerization and activation of the kit receptor by monovalent and bivalent binding of the stem cell factor. J Biol Chem 267, 15970-7. Li, J . , Yen, C , Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Puc, J . , Miliaresis, C , Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C , Ittmann, M., Tycko, B., Hibshoosh, H., Wigler, M. H., and Parsons, R. (1997a). PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943-7. 180 Li, Z., Wahl, M. I., Eguinoa, A., Stephens, L. R., Hawkins, P. T., and Witte, O. N. (1997b). Phosphatidylinositol 3-kinase-gamma activates Bruton's tyrosine kinase in concert with Src family kinases. Proc Natl Acad Sci U S A 94, 13820-5. Lichter, P., Tang, C. J . , Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990). High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247, 64-9. Linnekin, D., DeBerry, C. S., and Mou, S. (1997). Lyn associates with the juxtamembrane region of c-Kit and is activated by stem cell factor in hematopoietic cell lines and normal progenitor cells. J Biol Chem 272, 27450-5. Lioubin, M. N., Algate, P. A., Tsai, S., Carlberg, K., Aebersold, A., and Rohrschneider, L. R. (1996). p150Ship, a signal transduction molecule with inositol polyphosphate-5-phosphatase activity. Genes Dev 10, 1084-95. Lioubin, M. N., Myles, G. M., Carlberg, K., Bowtell, D., and Rohrschneider, L. R. (1994). She, Grb2, Sos1, and a 150-kilodalton tyrosine-phosphorylated protein form complexes with Fms in hematopoietic cells. Mol Cell Biol 14, 5682-91. Liu, L , Damen, J . E., Cutler, R. L , and Krystal, G. (1994). Multiple cytokines stimulate the binding of a common 145-kilodalton protein to She at the Grb2 recognition site of She. Mol Cell Biol 14, 6926-35. 181 Liu, L., Damen, J . E., Ware, M., Hughes, M., and Krystal, G. (1997a). SHIP, a new player in cytokine-induced signalling. Leukemia 11, 181-4. Liu, L., Damen, J . E., Ware, M. D., and Krystal, G. (1997b). lnterleukin-3 induces the association of the inositol 5-phosphatase SHIP with SHP2. J Biol Chem 272, 10998-1001. Liu, Q., and Dumont, D. J . (1997c). Molecular cloning and chromosomal localization in human and mouse of the SH2-containing inositol phosphatase, INPP5D (SHIP). Amgen EST Program. Genomics 39, 109-12. Liu, L , Damen, J . E., Hughes, M. R., Babic, I., Jirik, F. R., and Krystal, G. (1997d). The Src homology 2 (SH2) domain of SH2-containing inositol phosphatase (SHIP) is essential for tyrosine phosphorylation of SHIP, its association with She, and its induction of apoptosis. J Biol Chem 272, 8983-8. Liu, B., Liao, J . , Rao, X., Kushner, S. A., Chung, C. D., Chang, D. D., and Shuai, K. (1998a). Inhibition of Stat 1-mediated gene activation by PIAS1. Proc Natl Acad Sci U S A 95, 10626-31. Liu, K. D., Gaffen, S. L , and Goldsmith, M. A. (1998b). JAK/STAT signaling by cytokine receptors. Curr Opin Immunol 10, 271-8. 182 Liu, Q., Oliveira-Dos-Santos, A. J . , Mariathasan, S., Bouchard, D., Jones, J . , Sarao, R., Kozieradzki, I., Ohashi, P. S., Penninger, J . M., and Dumont, D. J . (1998c). The inositol polyphosphate 5-phosphatase ship is a crucial negative regulator of B cell antigen receptor signaling. J Exp Med 188, 1333-42. Liu, Q., Shalaby, F., Jones, J . , Bouchard, D., and Dumont, D. J . (1998d). The SH2-containing inositol polyphosphate 5-phosphatase, ship, is expressed during hematopoiesis and spermatogenesis. Blood 91, 2753-9. Lock, L. S., Royal, I., Naujokas, M. A., and Park, M. (2000). Identification of an atypical Grb2 carboxy-terminal SH3 domain binding site in Gab docking proteins reveals Grb2-dependent and independent recruitment of Gab1 to receptor tyrosine kinases. J Biol Chem. Lock, P., Casagranda, F., and Dunn, A. R. (1999). Independent SH2-binding sites mediate interaction of Dok-related protein with RasGTPase-activating protein and Nek. J Biol Chem 274, 22775-84. Lockyer, P. J . , Bottomley, J . R., Reynolds, J . S., McNulty, T. J . , Venkateswarlu, K., Potter, B. V., Dempsey, C. E., and Cullen, P. J . (1997). Distinct subcellular localisations of the putative inositol 1,3,4,5-tetrakisphosphate receptors GAP1IP4BP and GAP1m result from the GAP1IP4BP PH domain directing plasma membrane targeting. Curr Biol 7, 1007-10. 183 Lockyer, P. J . , Wennstrom, S., Kupzig, S., Venkateswarlu, K., Downward, J . , and Cullen, P. J . (1999). Identification of the ras GTPase-activating protein GAP1(m) as a phosphatidylinositol-3,4,5-trisphosphate-binding protein in vivo. Curr Biol 9, 265-8. Lu, P. J . , Zhou, X . Z., Shen, M., and Lu, K. P. (1999). Function of W W domains as phosphoserine- or phosphothreonine-binding modules. Science 283, 1325-8. Lucas, D. M., and Rohrschneider, L. R. (1999). A novel spliced form of SH2-containing inositol phosphatase is expressed during myeloid development. Blood 93, 1922-33. MacDougall, L. K., Domin, J . , and Waterfield, M. D. (1995). A family of phosphoinositide 3-kinases in Drosophila identifies a new mediator of signal transduction. Curr Biol 5, 1404-15. Mach, N., Lantz, C. S., Galli, S. J . , Reznikoff, G., Mihm, M., Small, C , Granstein, R., Beissert, S., Sadelain, M., Mulligan, R. C , and Dranoff, G. (1998). Involvement of interleukin-3 in delayed-type hypersensitivity. Blood 91, 778-83. Maehama, T., and Dixon, J . E. (1998). The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273, 13375-8. 184 Majerus, P. W. (1996). Inositols do it all. Genes Dev 10, 1051-3. Majerus, P. W., Kisseleva, M. V., and Norris, F. A. (1999). The role of phosphatases in inositol signaling reactions. J Biol Chem 274,10669-72. Maresco, D. L , Osborne, J . M., Cooney, D., Coggeshall, K. M., and Anderson, C. L. (1999). The SH2-containing 5'-inositol phosphatase (SHIP) is tyrosine phosphorylated after Fc gamma receptor clustering in monocytes. J Immunol 162, 6458-65. Matsuguchi, T., Salgia, R., Hallek, M., Eder, M., Druker, B., Ernst, T. J . , and Griffin, J . D. (1994). She phosphorylation in myeloid cells is regulated by granulocyte macrophage colony-stimulating factor, interleukin-3, and steel factor and is constitutively increased by p210BCR/ABL. J Biol Chem 269, 5016-21. Matzaris, M., O'Malley, C. J . , Badger, A., Speed, C. J . , Bird, P. I., and Mitchell, C. A. (1998). Distinct membrane and cytosolic forms of inositol polyphosphate 5-phosphatase II. Efficient membrane localization requires two discrete domains. J Biol Chem 273, 8256-67. Mayer, B. J . , and Eck, M. J . (1995). SH3 domains. Minding your p's and q's. Curr Biol 5, 364-7. 185 McPherson, P. S., Garcia, E. P., Slepnev, V. I., David, C , Zhang, X., Grabs, D., Sossin, W. S., Bauerfeind, R., Nemoto, Y., and De Camilli, P. (1996). A presynaptic inositol-5-phosphatase. Nature 379, 353-7. Micheva, K. D., Kay, B. K., and McPherson, P. S. (1997). Synaptojanin forms two separate complexes in the nerve terminal. Interactions with endophilin and amphiphysin. J Biol Chem 272, 27239-45. Mikhalap, S. V., Shlapatska, L. M., Berdova, A. G., Law, C. L , Clark, E. A., and Sidorenko, S. P. (1999). CDw150 associates with src-homology 2-containing inositol phosphatase and modulates CD95-mediated apoptosis. J Immunol 162, 5719-27. Miyazaki, Y., Matsufuji, S., Murakami, Y., and Hayashi, S. (1993). Single amino-acid replacement is responsible for the stabilization of ornithine decarboxylase in HMOA cells. Eur J Biochem 214, 837-44. Morrione, A., Plant, P., Valentinis, B., Staub, O., Kumar, S., Rotin, D., and Baserga, R. (1999). mGrblO interacts with Nedd4. J Biol Chem 274, 24094-9. Moutoussamy, S., Kelly, P. A., and Finidori, J . (1998). Growth-hormone-receptor and cytokine-receptor-family signaling. Eur J Biochem 255, 1-11. 186 Muraille, E., Bruhns, P., Pesesse, X., Daeron, M., and Erneux, C. (2000). The SH2 domain containing inositol 5-phosphatase SHIP2 associates to the immunoreceptor tyrosine-based inhibition motif of Fc gammaRIIB in B cells under negative signaling. Immunol Lett 72, 7-15. Muramatsu, M., and Inoue, S. (2000). Estrogen receptors: how Do they control reproductive and nonreproductive functions? Biochem Biophys Res Commun 270, 1-10. Murthy, S. C , Sorensen, P. H., Mui, A. L , and Krystal, G. (1989). lnterleukin-3 down-regulates its own receptor. Blood 73, 1180-7. Muslin, A. J . , Tanner, J . W., Allen, P. M., and Shaw, A. S. (1996). Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84, 889-97. Muta, T., Kurosaki, T., Misulovin, Z., Sanchez, M., Nussenzweig, M. C , and Ravetch, J . V. (1994). A 13-amino-acid motif in the cytoplasmic domain of Fc gamma RUB modulates B-cell receptor signalling [published erratum appears in Nature 1994 May 26;369(6478):340]. Nature 368, 70-3. Myers, M. P., Pass, I., Batty, I. H., Van der Kaay, J . , Stolarov, J . P., Hemmings, B. A., Wigler, M. H., Downes, C. P., and Tonks, N. K. (1998). The lipid phosphatase activity of P T E N is critical for its tumor supressor function. Proc Natl Acad Sci U S A 95, 13513-8. 187 Nadler, M. J . S., Chen, B., Anderson, J . S., Wortis, H. H., and Neel, B. G. (1997). Protein-tyrosine phosphatase SHP-1 is dispensable for FcgammaRIIB-mediated inhibition of B cell antigen receptor activation. J Biol Chem 272, 20038-43. Nagai, K., Takata, M., Yamamura, H., and Kurosaki, T. (1995). Tyrosine phosphorylation of She is mediated through Lyn and Syk in B cell receptor signaling. J Biol Chem 270, 6824-9. Nakamura, K., Brauweiler, A., and Cambier, J . C. (2000). Effects of Src homology domain 2 (SH2)-containing inositol phosphatase (SHIP), SH2-containing phosphotyrosine phosphatase (SHP)-1, and SHP-2 SH2 decoy proteins on Fc gamma RlIB1 -effector interactions and inhibitory functions. J Immunol 164, 631-8. Nakanishi, H., Brewer, K. A., and Exton, J . H. (1993). Activation of the zeta isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 268, 13-6. Neer, E. J . (1995). Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80, 249-57. Nemoto, Y., Arribas, M., Haffner, C , and DeCamilli, P. (1997). Synaptojanin 2, a novel synaptojanin isoform with a distinct targeting domain and expression pattern. J Biol Chem 272,30817-21. 188 Nemoto, Y., and De Camilli, P. (1999). Recruitment of an alternatively spliced form of synaptojanin 2 to mitochondria by the interaction with the PDZ domain of a mitochondrial outer membrane protein. EMBO J 18, 2991-3006. Nishinakamura, R., Miyajima, A., Mee, P. J . , Tybulewicz, V. L , and Murray, R. (1996). Hematbpoiesis in mice lacking the entire granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 functions. Blood 88, 2458-64. Nishizumi, H., Horikawa, K., Mlinaric-Rascan, I., and Yamamoto, T. (1998). A double-edged kinase Lyn: a positive and negative regulator for antigen receptor-mediated signals. J Exp Med 187, 1343-8. Nixon, P. J . , Komenda, J . , Barber, J . , Deak, Z., Vass, I., and Diner, B. A. (1995). Deletion of the PEST-l ike region of photosystem two modifies the QB-binding pocket but does not prevent rapid turnover of D1. J Biol Chem 270, 14919-27. Noguchi, T., Matozaki, T., Inagaki, K., Tsuda, M., Fukunaga, K., Kitamura, Y., Kitamura, T., Shii, K., Yamanashi, Y., and Kasuga, M. (1999). Tyrosine phosphorylation of p62(Dok) induced by cell adhesion and insulin: possible role in cell migration. E M B O J 18, 1748-60. 189 Okada, H., Bolland, S., Hashimoto, A., Kurosaki, M., Kabuyama, Y., lino, M., Ravetch, J . V., and Kurosaki, T. (1998). Role of the inositol phosphatase SHIP in B cell receptor-induced Ca2+ oscillatory response. J Immunol 161, 5129-32. Oliver, J . M., Burg, D. L , Wilson, B. S., McLaughlin, J . L , and Geahlen, R. L. (1994). Inhibition of mast cell Fc epsilon R1-mediated signaling and effector function by the Syk-selective inhibitor, piceatannol. J Biol Chem 269, 29697-703. Olivos-Glander, I. M., Janne, P. A., and Nussbaum, R. L. (1995). The oculocerebrorenal syndrome gene product is a 105-kD protein localized to the Golgi complex. Am J Hum Genet 57, 817-23. Ono, M., Bolland, S., Tempst, P., and Ravetch, J . V. (1996). Role of the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc(gamma)RIIB. Nature 383, 263-6. Ono, M., Okada, H., Bolland, S., Yanagi, S., Kurosaki, T., and Ravetch, J . V. (1997). Deletion of SHIP or SHP-1 reveals two distinct pathways for inhibitory signaling. Cell 90, 293-301. Orban, P. C , Levings, M. K., and Schrader, J . W. (1999). Heterodimerization of the alpha and beta chains of the interleukin-3 (IL-3) receptor is necessary and sufficient for IL-3-induced mitogenesis. Blood 94,1614-22. 190 Orgel, L. E. (1998). The origin of life—a review of facts and speculations. Trends Biochem Sci 23, 491-5. Osborne, M. A., Zenner, G., Lubinus, M., Zhang, X., Songyang, Z., Cantley, L. C , Majerus, P., Burn, P., and Kochan, J . P. (1996). The inositol 5-phosphatase SHIP binds to immunoreceptor signaling motifs and responds to high affinity IgE receptor aggregation. J Biol Chem 271, 29271-8. Ottinger, E. A., Botfield, M. C , and Shoelson, S. E. (1998). Tandem SH2 domains confer high specificity in tyrosine kinase signaling. J Biol Chem 273, 729-35. Paterson, H. F., Savopoulos, J . W., Perisic, O., Cheung, R., Ellis, M. V., Williams, R. L , and Katan, M. (1995). Phospholipase C delta 1 requires a pleckstrin homology domain for interaction with the plasma membrane. Biochem J 312, 661-6. Pawson, T. (1997). New impressions of Src and Hck [news; comment]. Nature 385, 582-3, 585. Pawson, T. (1995). Protein modules and signalling networks. Nature 373, 573-80. 191 Pawson, T., and Scott, J . D. (1997). Signaling through scaffold, anchoring, and adaptor proteins. Science 278, 2075-80. Pear, W. S., Nolan, G. P., Scott, M. L , and Baltimore, D. (1993). Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 90, 8392-6. Pesesse, X. , Deleu, S., De Smedt, F., Drayer, L , and Erneux, C. (1997). Identification of a second SH2-domain-containing protein closely related to the phosphatidylinositol polyphosphate 5-phosphatase SHIP. Biochem Biophys Res Commun 239, 697-700. Pesesse, X., Moreau, C., Drayer, A. L , Woscholski, R., Parker, P., and Erneux, C. (1998). The SH2 domain containing inositol 5-phosphatase SHIP2 displays phosphatidylinositol 3,4,5-trisphosphate and inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity. F E B S Lett 437, 301-3. Pettitt, T. R., and Wakelam, M. J . (1999). Diacylglycerol kinase epsilon, but not zeta, selectively removes polyunsaturated diacylglycerol, inducing altered protein kinase C distribution in vivo. J Biol Chem 274, 36181-6. Phee, H., Jacob, A., and Coggeshall, K. M. (2000). Enzymatic activity of the Src homology 2 domain-containing inositol phosphatase is regulated by a plasma membrane location. J Biol Chem 275, 19090-7. 192 Phizicky, E. and Fields, S. (1995). Protein-protein interactions: methods for detection and analysis. Microbiol Rev 59, 94-123. Poy, F., Yaffe, M. B., Sayos, J . , Saxena, K., Morra, M., Sumegi, J . , Cantley, L. C , Terhorst, C , and Eck, M. J . (1999). Crystal structures of the X L P protein S A P reveal a class of SH2 domains with extended, phosphotyrosine-independent sequence recognition. Mol Cell 4, 555-61. Pradhan, M., and Coggeshall, K. M. (1997). Activation-induced bi-dentate interaction of SHIP and She in B lymphocytes. J Cell Biochem 67, 32-42. Price, L. S., Norman, J . C , Ridley, A. J . , and Koffer, A. (1995). The small GTPases Rac and Rho as regulators of secretion in mast cells. Curr Biol 5, 68-73. Pumphrey, N. J . , Taylor, V., Freeman, S., Douglas, M. R., Bradfield, P. F., Young, S. P., Lord, J . M., Wakelam, M. J . , Bird, I. N., Salmon, M., and Buckley, C. D. (1999). Differential association of cytoplasmic signalling molecules SHP-1 , SHP-2, SHIP and phospholipase C-gamma1 with PECAM-1/CD31. F E B S Lett 450, 77-83. Qualmann, B., and Kelly, R. B. (2000). Syndapin isoforms participate in receptor-mediated endocytosis and actin organization. J Cell Biol 148, 1047-62. 193 Ramaswamy, S., Nakamura, N., Vazquez, F., Batt, D. B., Perera, S., Roberts, T. M., and Sellers, W. R. (1999). Regulation of G1 progression by the PTEN tumor suppressor protein is linked to inhibition of the phosphatidylinositol 3-kinase/Akt pathway. Proc Natl Acad Sci U S A 96, 2110-5. Rameh, L. E., Arvidsson, A., Carraway, K. L , 3rd, Couvillon, A. D., Rathbun, G., Crompton, A., VanRenterghem, B., Czech, M. P., Ravichandran, K. S., Burakoff, S. J . , Wang, D. S., Chen, C. S., and Cantley, L. C. (1997). A comparative analysis of the phosphoinositide binding specificity of pleckstrin homology domains. J Biol Chem 272, 22059-66. Rameh, L. E., and Cantley, L. C. (1999). The role of phosphoinositide 3-kinase lipid products in cell function. J Biol Chem 274, 8347-50. Rameh, L. E., Chen, C. S., and Cantley, L. C. (1995). Phosphatidylinositol (3,4,5)P3 interacts with SH2 domains and modulates PI 3-kinase association with tyrosine-phosphorylated proteins. Cell 83, 821-30. Rameh, L. E., Rhee, S. G., Spokes, K., Kazlauskas, A., Cantley, L. C , and Cantley, L. G. (1998). Phosphoinositide 3-kinase regulates phospholipase Cgamma-mediated calcium signaling. J Biol Chem 273, 23750-7. 194 Ramjaun, A. R., and McPherson, P. S. (1996). Tissue-specific alternative splicing generates two synaptojanin isoforms with differential membrane binding properties. J Biol Chem 271, 24856-61. Rao, P., and Mufson, R. A. (1995). A membrane proximal domain of the human interleukin-3 receptor beta c subunit that signals DNA synthesis in NIH 3T3 cells specifically binds a complex of Src and Janus family tyrosine kinases and phosphatidylinositol 3-kinase. J Biol Chem 270, 6886-93. Ravichandran, K. S., Lee, K. K., Songyang, Z., Cantley, L. C , Burn, P., and Burakoff, S. J . (1993). Interaction of She with the zeta chain of the T cell receptor upon T cell activation. Science 262, 902-5. Rawlings, D. J . , and Witte, O. N. (1995). The Btk subfamily of cytoplasmic tyrosine kinases: structure, regulation and function. Semin Immunol 7, 237-46. Razzini, G., Brancaccio, A., Lemmon, M. A., Guarnieri, S., and Falasca, M. (2000). The role of the pleckstrin homology domain in membrane targeting and activation of phospholipase cbeta 1. J Biol Chem 275, 14873-81. Rechsteiner, M., and Rogers, S. W. (1996). PEST sequences and regulation by proteolysis. Trends Biochem Sci 21, 267-71. 195 Reth, M., and Wienands, J . (1997). Initiation and processing of signals from the B cell antigen receptor. Annu Rev Immunol 15, 453-79. Rickles, R. J . , Botfield, M. C , Zhou, X. M., Henry, P. A., Brugge, J . S., and Zoller, M. J . (1995). Phage display selection of ligand residues important for Src homology 3 domain binding specificity. Proc Natl Acad Sci U S A 92, 10909-13. Ringstad, N., Nemoto, Y., and De Camilli, P. (1997). The SH3p4/Sh3p8/SH3p13 protein family: binding partners for synaptojanin and dynamin via a Grb2-like Src homology 3 domain. Proc Natl Acad Sci U S A 94, 8569-74. Rohrschneider, L. R., Fuller, J . F., Wolf, I., Liu, Y., and Lucas, D. M. (2000). Structure, function, and biology of SHIP proteins. Genes Dev 14, 505-20. Rowley, R. B., Burkhardt, A. L , Chao, H. G., Matsueda, G. R., and Bolen, J . B. (1995). Syk protein-tyrosine kinase is regulated by tyrosine-phosphorylated Ig alpha/lg beta immunoreceptor tyrosine activation motif binding and autophosphorylation. J Biol Chem 270, 11590-4. Rozakis-Adcock, M., McGlade, J . , Mbamalu, G., Pelicci, G., Daly, R., Li, W., Batzer, A., Thomas, S., Brugge, J . , Pelicci, P. G., and et al. (1992). Association of the She and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature 360, 689-92. 196 Salcini, A. E., McGlade, J . , Pelicci, G., Nicoletti, I., Pawson, T., and Pelicci, P. G. (1994). Formation of Shc-Grb2 complexes is necessary to induce neoplastic transformation by overexpression of She proteins. Oncogene 9, 2827-36. Salim, K., Bottomley, M. J . , Querfurth, E., Zvelebil, M. J . , Gout, I., Scaife, R., Margolis, R. L , Gigg, R., Smith, C. I., Driscoll, P. C , Waterfield, M. D., and Panayotou, G. (1996). Distinct specificity in the recognition of phosphoinositides by the pleckstrin homology domains of dynamin and Bruton's tyrosine kinase. EMBO J 15, 6241-50. Saouaf, S. J . , Mahajan, S., Rowley, R. B., Kut, S. A., Fargnoli, J . , Burkhardt, A. L , Tsukada, S., Witte, O. N., and Bolen, J . B. (1994). Temporal differences in the activation of three classes of non-transmembrane protein tyrosine kinases following B-cell antigen receptor surface engagement. Proc Natl Acad Sci U S A 91, 9524-8. Sarmay, G., Koncz, G., and Gergely, J . (1996). Human type II Fcgamma receptors inhibit B cell activation by interacting with the p21(ras)-dependent pathway. J Biol Chem 277, 30499-504. Sarmay, G., Koncz, G., Pecht, I., and Gergely, J . (1999). Cooperation between SHP-2, phosphatidyl inositol 3-kinase and phosphoinositol 5-phosphatase in the Fc gamma Rllb mediated B cell regulation. Immunol Lett 68, 25-34. 197 Satterthwaite, A. B., Lowell, C. A., Khan, W. N., Sideras, P., Alt, F. W., and Witte, O. N. (1998). Independent and opposing roles for Btk and lyn in B and myeloid signaling pathways. J Exp Med 788, 833-44. Satterthwaite, A. B., Willis, F., Kanchanastit, P., Fruman, D., Cantley, L. C , Helgason, C. D., Humphries, R. K., Lowell, C. A., Simon, M., Leitges, M., Tarakhovsky, A., Tedder, T. F., Lesche, R., Wu, H., and Witte, O. N. (2000). A sensitized genetic system for the analysis of murine B lymphocyte signal transduction pathways dependent on Bruton's tyrosine kinase. Proc Natl Acad Sci U S A 97, 6687-92. Sattler, M., Salgia, R., Shrikhande, G., Verma, S., Choi, J . L , Rohrschneider, L. R., and Griffin, J . D. (1997). The phosphatidylinositol polyphosphate 5-phosphatase SHIP and the protein tyrosine phosphatase SHP-2 form a complex in hematopoietic cells which can be regulated by BCR/ABL and growth factors. Oncogene 75, 2379-84. Sattler, M., Verma, S., Byrne, C. H., Shrikhande, G., Winkler, T., Algate, P. A., Rohrschneider, L. R., and Griffin, J . D. (1999). BCR/ABL directly inhibits expression of SHIP, an SH2-containing polyinositol-5-phosphatase involved in the regulation of hematopoiesis. Mol Cell Biol 79, 7473-80. Saxton, T. M., van Oostveen, I., Bowtell, D., Aebersold, R., and Gold, M. R. (1994). B cell antigen receptor cross-linking induces phosphorylation of the p21ras oncoprotein activators S H C and mSOS1 as well as assembly of complexes containing S H C , GRB-2 , mSOS1, and a 145-kDa tyrosine-phosphorylated protein. J Immunol 753, 623-36. 198 Sayos, J . , Wu, C , Morra, M., Wang, N., Zhang, X., Allen, D., van Schaik, S., Notarangelo, L , Geha, R., Roncarolo, M. G., Oettgen, H., De Vries, J . E., Aversa, G., and Terhorst, C. (1998). The X-linked lymphoproliferative-disease gene product S A P regulates signals induced through the co-receptor SLAM. Nature 395, 462-9. Scharenberg, A. M., El-Hillal, O., Fruman, D. A., Beitz, L. O., Li, Z., Lin, S., Gout, I., Cantley, L. C , Rawlings, D. J . , and Kinet, J . P. (1998). Phosphatidylinositol-3,4,5-trisphosphate (Ptdlns-3,4,5-P3)/Tec kinase-dependent calcium signaling pathway: a target for SHIP-mediated inhibitory signals. E M B O J 17, 1961-72. Schiavo, G. , Gu, Q. M., Prestwich, G. D., Sollner, T. H., and Rothman, J . E. (1996). Calcium-dependent switching of the specificity of phosphoinositide binding to synaptotagmin [published erratum appears in Proc Natl Acad Sci U S A 1997 Feb 4;94(3):1047]. Proc Natl Acad Sci U S A 93, 13327-32. Schwartz, L. B. (1994). Mast cells: function and contents. Curr Opin Immunol 6, 91-7. Seet, L. F., Cho, S., Hessel, A., and Dumont, D. J . (1998). Molecular cloning of multiple isoforms of synaptojanin 2 and assignment of the gene to mouse chromosome 17A2-3.1. Biochem Biophys Res Commun 247, 116-22. 199 Shears, S. B. (1998). The versatility of inositol phosphates as cellular signals. Biochim Biophys Acta 1436, 49-67. Sicheri, F., Moarefi, I., and Kuriyan, J . (1997). Crystal structure of the Src family tyrosine kinase Hck. Nature 385, 602-9. Siegel, J . , Li, Y., and Whyte, P. (1999). SHIP-mediated inhibition of K562 erythroid differentiation requires an intact catalytic domain and She binding site. Oncogene 18, 7135-48. Smit, L., de Vries-Smits, A. M., Bos, J . L , and Borst, J . (1994). B cell antigen receptor stimulation induces formation of a Shc-Grb2 complex containing multiple tyrosine-phosphorylated proteins. J Biol Chem 269, 20209-12. Songyang, Z., Gish, G., Mbamalu, G., Pawson, T., and Cantley, L. C. (1995). A single point mutation switches the specificity of group III Src homology (SH) 2 domains to that of group I SH2 domains. J Biol Chem 270, 26029-32. Songyang, Z., Shoelson, S. E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W. G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R. J . , and et al. (1993). SH2 domains recognize specific phosphopeptide sequences. Cell 72, 767-78. 200 Speed, C. J . , Little, P. J . , Hayman, J . A., and Mitchell, C. A. (1996). Underexpression of the 43 kDa inositol polyphosphate 5-phosphatase is associated with cellular transformation. E M B O J 15, 4852-61. Stack, J . H., and Emr, S. D. (1994). Vps34p required for yeast vacuolar protein sorting is a multiple specificity kinase that exhibits both protein kinase and phosphatidylinositol-specific PI 3-kinase activities. J Biol Chem 269, 31552-62. Stack, J . H., Herman, P. K., Schu, P. V., and Emr, S. D. (1993). A membrane-associated complex containing the Vps15 protein kinase and the Vps34 PI 3-kinase is essential for protein sorting to the yeast lysosome-like vacuole. E M B O J 12, 2195-204. Stambolic, V., Suzuki, A., de la Pompa, J . L., Brothers, G. M., Mirtsos, C , Sasaki, T., Ruland, J . , Penninger, J . M., Siderovski, D. P., and Mak, T. W. (1998). Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29-39. Stauffer, T. P., Martenson, C. H., Rider, J . E., Kay, B. K., and Meyer, T. (1997). Inhibition of Lyn function in mast cell activation by SH3 domain binding peptides. Biochemistry 36, 9388-94. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., Ligon, A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T., Frye, C , Hu, R., Swedlund, B., Teng, D. H., 201 and Tavtigian, S. V. (1997). Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15, 356-62. Stephens, L , Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F., Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P., Coadwell, J . , and Hawkins, P. T. (1998). Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-trisphosphate-dependent activation of protein kinase B. Science 279, 710-4. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997). Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B. Science 277, 567-70. Suda, J . , Suda, T., Kubota, K., Ihle, J . N., Saito, M., and Miura, Y. (1986). Purified interleukin-3 and erythropoietin support the terminal differentiation of hemopoietic progenitors in serum-free culture. Blood 67, 1002-6. Suda, T., Suda, J . , Ogawa, M., and Ihle, J . N. (1985). Permissive role of interleukin 3 (IL-3) in proliferation and differentiation of multipotential hemopoietic progenitors in culture. J Cell Physiol 124, 182-90. 202 Sudol, M. (1998). From Src Homology domains to other signaling modules: proposal of the 'protein recognition code'. Oncogene 17,1469-74. Sullivan, R., Price, L. S., and Koffer, A. (1999). Rho controls cortical F-actin disassembly in addition to, but independently of, secretion in mast cells. J Biol Chem 274, 38140-6. Sun, H., Lesche, R., Li, D. M., Liliental, J . , Zhang, H., Gao, J . , Gavrilova, N., Mueller, B., Liu, X. , and Wu, H. (1999). PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A 96, 6199-204. Tamir, I., and Cambier, J . C. (1998). Antigen receptor signaling: integration of protein tyrosine kinase functions. Oncogene 17, 1353-64. Tamir, I., Stolpa, J . O , Helgason, C. D., Nakamura, K., Bruhns, P., Daeron, M., and Cambier, J . C. (2000). The RasGAP-binding protein p62dok is a mediator of inhibitory FcgammaRIIB signals in B cells. Immunity 12, 347-58. Tamura, M., Gu, J . , Matsumoto, K., Aota, S., Parsons, R., and Yamada, K. M. (1998). Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280, 1614-7. 203 Tan, Z., Bruzik, K. S., and Shears, S. B. (1997). Properties of the inositol 3,4,5,6-tetrakisphosphate 1-kinase purified from rat liver. Regulation of enzyme activity by inositol 1,3,4-trisphosphate. J Biol Chem 272, 2285-90. Thomas, D., Patterson, S. D., and Bradshaw, R. A. (1995). Src homologous and collagen (She) protein binds to F-actin and translocates to the cytoskeleton upon nerve growth factor stimulation in PC12 cells. J Biol Chem 270, 28924-31. Thomas, S. M., and Brugge, J . S. (1997). Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol 13, 513-609. Timokhina, I., Kissel, H., Stella, G., and Besmer, P. (1998). Kit signaling through PI 3-kinase and Src kinase pathways: an essential role for Rac1 and JNK activation in mast cell proliferation. E M B O J 17, 6250-62. Toker, A., and Cantley, L. C. (1997). Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature 387, 673-6. Toker, A., Meyer, M., Reddy, K. K., Falck, J . R., Aneja, R., Aneja, S., Parra, A., Burns, D. J . , Ballas, L. M., and Cantley, L. C. (1994). Activation of protein kinase C family members by the novel polyphosphoinositides Ptdlns-3,4-P2 and Ptdlns-3,4,5-P3. J Biol Chem 269, 32358-67. 204 Tolias, K. F., and Cantley, L. C. (1999). Pathways for phosphoinositide synthesis. Chem Phys Lipids 98, 69-77. Torigoe, T., O'Connor, R., Santoli, D., and Reed, J . C. (1992). lnterleukin-3 regulates the activity of the LYN protein-tyrosine kinase in myeloid-committed leukemic cell lines. Blood 80,617-24. Touhara, K., Inglese, J . , Pitcher, J . A., Shaw, G., and Lefkowitz, R. J . (1994). Binding of G protein beta gamma-subunits to pleckstrin homology domains. J Biol Chem 269, 10217-20. Traynor-Kaplan, A. E., Thompson, B. L , Harris, A. L., Taylor, P., Omann, G. M., and Sklar, L. A. (1989). Transient increase in phosphatidylinositol 3,4-bisphosphate and phosphatidylinositol trisphosphate during activation of human neutrophils. J Biol Chem 264, 15668-73. Tridandapani, S., Kelley, T., Cooney, D., Pradhan, M., and Coggeshall, K. M. (1997a). Negative signaling in B cells: SHIP Grbs She. Immunol Today 18, 424-7. Tridandapani, S., Kelley, T., Pradhan, M., Cooney, D., Justement, L. B., and Coggeshall, K. M. (1997b). Recruitment and phosphorylation of SH2-containing inositol phosphatase and She to the B-cell Fc gamma immunoreceptor tyrosine-based inhibition motif peptide motif. Mol Cell Biol 17, 4305-11. 205 Tridandapani, S., Phee, H., Shivakumar, L , Kelley, T. W., and Coggeshall, K. M. (1998). Role of SHIP in FcgammaRllb-mediated inhibition of Ras activation in B cells. Mol Immunol 35,1135-46. Tridandapani, S., Pradhan, M., LaDine, J . R., Garber, S., Anderson, C. L , and Coggeshall, K. M. (1999). Protein interactions of Src homology 2 (SH2) domain-containing inositol phosphatase (SHIP): association with She displaces SHIP from FcgammaRllb in B cells. J Immunol 162, 1408-14. Ullrich, A., and Schlessinger, J . (1990). Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203-12. Unkeless, J . C , and Jin, J . (1997). Inhibitory receptors, ITIM sequences and phosphatases. Curr Opin Immunol 9, 338-43. Vallentin, A., Prevostel, C , Fauquier, T., Bonnefont, X., and Joubert, D. (2000). Membrane targeting and cytoplasmic sequestration in the spatiotemporal localization of human protein kinase C alpha. J Biol Chem 275, 6014-21. van der Geer, P., Wiley, S., Gish, G. D., Lai, V. K., Stephens, R., White, M. F., Kaplan, D., and Pawson, T. (1996a). Identification of residues that control specific binding of the She 206 phosphotyrosine-binding domain to phosphotyrosine sites. Proc Natl Acad Sci U S A 93, 963-8. van der Geer, P., Wiley, S., Gish, G. D., and Pawson, T. (1996b). The She adaptor protein is highly phosphorylated at conserved, twin tyrosine residues (Y239/240) that mediate protein-protein interactions. Curr Biol 6, 1435-44. van der Velden, A. W., and Thomas, A. A. (1999). The role of the 5' untranslated region of an mRNA in translation regulation during development. Int J Biochem Cell Biol 31, 87-106. Varnai, P., Rother, K. I., and Balla, T. (1999). Phosphatidylinositol 3-kinase-dependent membrane association of the Bruton's tyrosine kinase pleckstrin homology domain visualized in single living cells. J Biol Chem 274, 10983-9. Vazquez, F., and Sellers, W. R. (2000). The PTEN tumor suppressor protein: an antagonist of phosphoinositide 3-kinase signaling. Biochim Biophys Acta 7470, M21-35. Vely, F., Olivero, S., Olcese, L , Moretta, A., Damen, J . E., Liu, L , Krystal, G., Cambier, J . C , Daeron, M., and Vivier, E. (1997). Differential association of phosphatases with hematopoietic co-receptors bearing immunoreceptor tyrosine-based inhibition motifs. Eur J Immunol 27, 1994-2000. 207 Wakao, H., Harada, N., Kitamura, T., Mui, A. L., and Miyajima, A. (1995). Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways. E M B O J 14, 2527-35. Wang, T., Dowal, L , El-Maghrabi, M. R., Rebecchi, M., and Scarlata, S. (2000). The pleckstrin homology domain of phospholipase C-beta(2) links the binding of gbetagamma to activation of the catalytic core. J Biol Chem 275, 7466-9. Ware, M. D., Rosten, P., Damen, J . E., Liu, L , Humphries, R. K., and Krystal, G. (1996). Cloning and characterization of human SHIP, the 145-kD inositol 5-phosphatase that associates with S H C after cytokine stimulation. Blood 88, 2833-40. Weng, Z., Rickles, R. J . , Feng, S., Richard, S., Shaw, A. S., Schreiber, S. L., and Brugge, J . S. (1995). Structure-function analysis of SH3 domains: SH3 binding specificity altered by single amino acid substitutions. Mol Cell Biol 15, 5627-34. Wienands, J . , Larbolette, O., and Reth, M. (1996). Evidence for a preformed transducer complex organized by the B cell antigen receptor. Proc Natl Acad Sci U S A 93, 7865-70. Wisniewski, D., Strife, A., Swendeman, S., Erdjument-Bromage, H., Geromanos, S., Kavanaugh, W. M., Tempst, P., and Clarkson, B. (1999). A novel SH2-containing phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase (SHIP2) is constitutively tyrosine phosphorylated and associated with src homologous and collagen gene (SHC) in chronic myelogenous leukemia progenitor cells. Blood 93, 2707-20. 208 Woscholski, R., Finan, P. M., Radley, E., and Parker, P. J . (1998). Identification and characterisation of a novel splice variant of synaptojaninl. F E B S Lett 432, 5-8. Wymann, M. P., and Pirola, L. (1998). Structure and function of phosphoinositide 3-kinases. Biochim Biophys Acta 7436, 127-50. Xu, W., Harrison, S. C , and Eck, M. J . (1997). Three-dimensional structure of the tyrosine kinase c-Src. Nature 385, 595-602. Yamabhai, M., Hoffman, N. G., Hardison, N. L., McPherson, P. S., Castagnoli, L., Cesareni, G., and Kay, B. K. (1998). Intersectin, a novel adaptor protein with two Eps15 homology and five Src homology 3 domains. J Biol Chem 273, 31401-7. Yamamoto, T., Yamanashi, Y., and Toyoshima, K. (1993). Association of Src-family kinase Lyn with B-cell antigen receptor. Immunol Rev 732, 187-206. Yamanashi, Y., Kakiuchi, T., Mizuguchi, J . , Yamamoto, T., and Toyoshima, K. (1991). Association of B cell antigen receptor with protein tyrosine kinase Lyn. Science 257, 192-4. 209 Yao, L , Kawakami, Y., and Kawakami, T. (1994). The pleckstrin homology domain of Bruton tyrosine kinase interacts with protein kinase C. Proc Natl Acad Sci U S A 91, 9175-9. Zhang, X., Hartz, P. A., Philip, E., Racusen, L. C , and Majerus, P. W. (1998). Cell lines from kidney proximal tubules of a patient with Lowe syndrome lack O C R L inositol polyphosphate 5-phosphatase and accumulate phosphatidylinositol 4,5-bisphosphate. J Biol Chem 273, 1574-82. Zhu, X., Kim, J . L , Newcomb, J . R., Rose, P. E., Stover, D. R., Toledo, L. M., Zhao, H., and Morgenstern, K. A. (1999). Structural analysis of the lymphocyte-specific kinase Lck in complex with non-selective and Src family selective kinase inhibitors. Structure Fold Des 7,651-61. 210 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090821/manifest

Comment

Related Items