UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Locating the chromatin modifying factor Suppressor of Variegation 3-8 in Drosophila melanogaster Carvalho, Anna-Bella 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2003-0113.pdf [ 3.49MB ]
Metadata
JSON: 831-1.0090786.json
JSON-LD: 831-1.0090786-ld.json
RDF/XML (Pretty): 831-1.0090786-rdf.xml
RDF/JSON: 831-1.0090786-rdf.json
Turtle: 831-1.0090786-turtle.txt
N-Triples: 831-1.0090786-rdf-ntriples.txt
Original Record: 831-1.0090786-source.json
Full Text
831-1.0090786-fulltext.txt
Citation
831-1.0090786.ris

Full Text

Locating the chromatin modifying factor Suppressor of Variegation . in Drosophila melanogaster. by Anna-Bella Carvalho B . S c , The University of British Columbia, 1998 A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L M E N T O F THE REQUIREMENTS FOR THE DEGREE OF Master of Science in T H E F A C U L T Y O F G R A D U A T E STUDIES (Department of Zoology) We accept this thesis as conforming to the required standard  T H E U N I V E R S I T Y O F BRITISH C O L U M B I A January, 2003 © Anna-Bella Carvalho, 2003  in presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by  his or  her  representatives.  It  is  understood  that  copying  or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Abstract  This study is part of a project whose goal is to identify and then sequence the chromatin modifying gene Su(var)3-8. \.  Chromatin structure is considered to play a significant role in gene expression. In order to better understand this role, we have undertaken a project to characterize one gene suspected of affecting chromatin structure, Su(var)3-8. The first approach taken was to tag the gene with a known sequence - the P element transposon. Mutations of Su(var)3-8 created by P element mutagenesis were tested to determine whether P elements were inserted in the gene. Remobilization of the P element by a cross that introduced transposase was used to detect reverted suppressors, under the supposition that precise excision of a mutation-causing P element would revert the gene to wild-type state. Southern blotting using radioactively labelled complete P element to probe digested genomic D N A was used to detect partial (immobile) remnants of P elements. Recessive lethal mutations containing P elements inserted in the region near Su(var)3-8 were tested for complementation to determine whether those P elements were inserted into the 3-8 locus. As no P-tagged alleles were discovered, Su(var)3-8 was then localized with the intention of delimiting the potential area to a few genes, allowing for direct testing of putative genes via plasmid rescue. Su(var)3-8 was localized genetically using recombination mapping with the genes cross-veinless and stubbloid, situated on the chromosomal arm 3R and near where previous studies placed Su(var)3-8 ( 5 3 . 5 ± 0 . 9 ). 3-8 was localized cytologically by complementation to various recessive lethal chromosomal deficiencies also determined to be in the vicinity. It was not possible to localize the area sufficiently to allow for direct testing of open reading frames. 128 putative genes are located in the 1645Kb within which Su(var)3-8 appears to be located.  Table of Contents Abstract  ii  Table of Contents  iii  List of Tables  iv  List of Figures  v  Dedication  vi  Acknowledgements  vii  1 - Introduction  1  Gene Regulation and Chromatin Structure  2  Position Effect Variegation as an Assay System  5  Chromatin Modifying Factors Identified by Position Effect Variegation  7  Using P elements to Clone and characterize these Proteins  9  Characteristics of  Su(var)3-8  11  2 - Materials and Methods  14  Stocks and Sources  14  Crosses  18  Isolation of Genomic D N A  19  PCR  21  Cell Transformation  22  Southern Blotting  22  3 - Results and Discussion  25  Localization to date  25  Approaches taken  25  3.1 - Reversion of P-element induced  Su(var)3-8 alleles  Southern Blotting  30 43  3.2 - Complementation Testing with P element Mutations  51  3.3 - Mapping  60  1) Recombination Mapping 2)  Df(3R)Tp(3;Y)ry506-85c tested against other Point Mutations  Further Deficiency Mapping  71 75 77  4. Conclusions  80  Appendices  84  Bibliography  86 iii  List of Tables  Table 2.1.1 - Stocks used in experiments  15  Table 2.1.2 - Common terms used in these experiments  17  Table 3.1.1 -Reversion of Suppressor phenotype  36  Table 3.1.2 -Reversion of Suppressor phenotype  38  Table 3.1.3 - Suppressor-reversion offspring testing  39  Table 3.1.4 - Reversion of lethality  41  Table 3.2.1 - P element-containing strains that were tested for lethality when transheterozygous with  Su(var)3-8  56  Table 3.2.2 - Previously identified genes in area 87E to 88D, tested for complementation  with Su(var)3-8  58  Table 3.2.3 - P elements tested for suppressor effect Table 3.3.1 - Deficiency  Su(var)3-8  59  Df(3R)Tp(3;Y)ry506-85c/TM3SB complementation testing with 65  Table 3.3.2 - Deficiencies crossed with Table 3.3.3 - Recombination of  Su(var)3-8/TM3Sb  66  Su(var)3-8 with cross-veinless and stubbloid markers . 73  Table3.3.4 - Df(3R)Tp(3;Y)ry506-85c tested for complementation with other point mutations outside of the region it deletes Table 3.3.5 - Deficiencies tested for complementation with  Su(var)3-8  76 79  iv  List of Figures  Figure 3.1.1 - Flowchart showing crosses and progeny in reversion experiments  33  Figure 3.1.2 - Flowchart of crosses and progeny in lethality-reversion experiments  35  Figure 3.1.3-PTI25.1  45  Figure 3.1.4 - Southern Blot experiments, P element probe  46  Figure 3.1.5 - Southern Blot experiments, Su(var)3-9 probe  47  Figure 3.1.6 - Photograph of agarose gels  48  Figure 3.2.1 - Flowchart showing crosses and progeny in P element complementation experiments 53 Figure 3.3.1 - M a p combining published cytological and recombination data for known genes in the area from 3-47 to 3-56 62 Figure 3.3.2 - Map of deficiencies for area 87d to 88e  63  Figure 3.3.3 - Map showing overlapping deficiencies  67  Figure 3.3.4 - Figure of Deficiencies and non-complementary Point mutations  68  Figure 3.3.5 - Flowchart showing crosses and progeny in recombination experiments... 72 Figure 3.3.6 - Genetic map of locations of various markers in region 3-47 to 3-59  74  Figure 3.3.7 - Map of deficiencies in contained in the region 85a to 87f.  78  v  Dedication  For my parents and sister, who supported and encouraged me; without them this thesis would not have been possible. In loving memory of Avosinha, S Laurinda and Tony. ra  vi  Acknowledgements I w o u l d like to gratefully acknowledge m y supervisor, D r . Thomas G r i g l i a t t i , for his enthusiastic support and guidance throughout this study. M y sincere appreciation to R a n d y M o t t u s for his help w i t h experimental setup and his invaluable advice. I thank the members o f the Grigliatti lab, for a l l their support and insight - technical and otherwise. M a n y thanks to D r . D i a n a J u r i l o f f and D r . D o n a l d M o e r m a n for their input. A special thanks to m y friends and family for their encouragement and their patience w i t h me over these many long years.  F i n a l l y , m y gratitude to the 1,933,004 (apx) flies w h o gave their lives for these experiments.  1 - Introduction Understanding h o w gene expression is regulated is one o f the challenges i n science today. M i s - e x p r e s s i o n is suspected to be a contributing factor i n many c o m m o n diseases, i n c l u d i n g P a r k i n s o n ' s (reviewed i n Hertz, 2001). In order to fully understand normal development and, as a corollary, to understand and hope to cure such diseases, w e must investigate the process o f gene expression. One factor contributing to gene expression is chromatin structure; for this reason, w e are interested i n studying the factors i n v o l v e d i n m o d i f y i n g chromatin, and what effect they may have on gene expression. The purpose o f this research is to elucidate the sequence o f a gene identified as a chromatin-modifying factor i n Drosophila. The method b y w h i c h these factors control gene regulation is largely still u n k n o w n , but w e m a y soon be able to understand the mechanism o f regulation as more and more o f these genes are studied. T o understand the function o f these genes, it is imperative to k n o w what their resultant proteins are doing. A first step i n this direction is to look at the sequences o f the genes. F r o m the sequence, w e can infer what domains and motifs the protein w i l l have, and this may give us clues to its  function in vivo. W e have chosen to characterize the  Drosophila melanogaster 3 chromosome rd  chromatin modifier Su(var)3-8 isolated i n a screen for such modifiers. T h i s gene has been previously l o c a l i z e d to an area i n w h i c h numerous genetic deficiencies and P elements have been defined. T h e availability o f these genetic tools makes  Su(var)3-8 a good  candidate for gene c l o n i n g .  1  Gene Regulation and Chromatin Structure Our knowledge of gene regulation is far from complete; while we have amassed substantial knowledge about transcription factors, ribosomes, promoters and related topics, we are still very far from being able to manipulate these factors. Furthermore, our knowledge regarding how chromatin structure affects gene regulation is even less advanced. We know that the euchromatic region of the chromosome houses more functional loci per unit length of D N A than does the D N A in the more densely packaged heterochromatin. In some cases, heterochromatin is used to silence otherwise functional genes. This is evidenced by heterochromatin-stabilized silencing of homeotic genes in Drosophila (reviewed in Bienz and Muller, 1995), and the heterochromatinization of one of the X-chromosomes in human females (reviewed in Gartler, 1992). Indeed, this facultative heterochromatinization of the X-chromosome in female mammals results in the silencing of all but a few genes on this chromosome. However, while heterochromatin may function to silence some genes, there are some expressed genes within this region, including ribosomal genes. In fact, genes that normally reside in heterochromatin may be silenced by transposition to euchromatin (reviewed Cook and Karpen, 1994). Chromosomes are long, thin chains of D N A . As such, they are fragile entities, subject to breakage. In eukaryotes, as a way to strengthen the chromosomes, as well as to compact them to fit in the smajl space within the nucleus, chromosomes are packaged into chromatin. The double helix itself is wound around histone complexes, called nucleosomes. The nucleosomes consist of an octamer of histones around which the D N A is wrapped (reviewed in Horn, 2002). The basic unit of chromatin consists of nucleosomes, along with linker D N A between nucleosomes and additional histones, such  2  as H I . This basic 30 um (diameter) unit is then wound up more tightly upon itself in heterochromatin, and more loosely in euchromatin. This compaction and storage causes difficulties, however. Packaging the chromosomes tightly upon themselves leaves little space for transcription factors and other proteins to bind. It has long been known that compaction of chromatin affects accessibility of DNA-binding proteins such as restriction enzymes and nucleases. It also affects accessibility of DNA-binding proteins such as transcription factors (reviewed in Kornberg and Lorch, 1999), and as such, chromatin packaging becomes a factor in the expression or silencing of genes. There is now growing evidence that chromatin packaging or factors that alter chromatin packaging affect certain types of cancer (Wang et al, 2001, Leonhardt and Cardoso, 2000). Silencing of genes by chromatin structure differs from simple repression of specific genes. Silencing takes place over a large area or domain, repressing a large number of genes, and is not promoter specific. This is evidenced by silencing of genes ectopically placed near heterochromatin boundaries. Silencing is also heritable and stable through cell cycles, being passed along though replication. There are various pieces of evidence that chromatin structure affects gene regulation. Firstly, there are multiple variants of each of the core histones. If histones were used solely for compaction and structure, it is unlikely that a variety of unique sequences would be required. In fact, studies have shown histone variants to be important in gene regulation (reviewed in Nakayama and Takami, 2001). One example of chromatin structure directly affecting gene expression is DNAmethylation. This is often used as a mechanism of marking the parental origin of a  3  particular gene, and in silencing of one of a pair of genes. Inactive genes tend to be highly methylated, and DNA-methylation is required for inactivation (Li, 1993). Methylation of histone H3 at Lysine9 by protein Su(var)3-9 has been shown to spread heterochromatin by attracting HP1, which in turn attracts more Su(var)3-9 which can methylate neighbouring H3s (reviewed in Berger, 2001 and Berger and Felsenfeld 2001). Methylation can block transcription by one of three ways (reviewed in Leonhardt, 2001). One minor way is by directly blocking transcription factors from binding to the transcription site. Secondly, and more commonly, methylation can attract methyl-binding proteins, which then compete with the transcription factors for the transcription sites. Finally, the most effective way in which methylation can affect gene expression is by attraction of histone deacetylases through methyl-binding proteins. Deacetylation creates a more closed conformation of chromatin, and causes a decreased accessibility for transcription machinery. Acetylation lessens the association of histones with D N A , creating a more open conformation. Data, such as described above, show a correlation between chromosome conformation and gene expression. As we know that all D N A is replicated, even that which is highly compacted, it must be at times accessible to replication machinery. A s well, we see examples of genes within the highly compacted heterochromatic region that are expressed. Therefore, there must exist a mechanism to relax the structure enough for enzymes to bind, as well as a mechanism to create and maintain the structure. It is for these chromatin-modifying factors that we search.  4  Position Effect Variegation as an Assay System In order to find and study the genes encoding these chromatin-remodelling factors, we need a method to locate and identify them. A phenomenon called Position Effect Variegation (PEV), discovered in 1930 by H.J. Muller (cited in Reuter, 1992), gained renewed interest as a possible assay system for chromatin structure modifying proteins. P E V is a phenomenon in which a chromosomal aberration causes variation in gene expression between cells resulting in a mosaic phenotype. Rearrangement of the genome to move a normally euchromatic gene to a location near the heterochromatin will create a mosaic in which some cells express the re-located gene, while in others it is silent. In Muller's experiments in Drosophila melanogaster, the white+ gene was placed near a 'broken' heterochromatin boundary by means  Inversion (1) white-mottled  (In(l)wm4). Flies presented large patches of eye facets, which were either red (expressing the white (w ) gene) or white (non-expressing), indicating that silencing or expression +  +  is determined early on in development (reviewed in Wakimoto, 1998). Daughter cells of a cell in which expression is silenced are also white. This results in a variegated (mosaic) phenotype, whereby patches of pigment can be seen, in areas descended from a single transcriptionally active cell. Dominant mutations were selected which have one of two effects on this phenomenon: they either suppress variegation (Su(Var)s), or they enhance it (E(var)s) (reviewed in Reuter, 1992). Flies that have the target aberration In(l)wm4 and a Su(var) mutant allele would have eyes that are almost entirely red (wild-type flies being entirely  5  red-eyed), indicating that the silencing of the gene is somehow suppressed. Mutant E(var) genes, in contrast, enhance the likelihood that the variegating gene is silenced, and the eye is white. Two non-mutually exclusive models are currently used to explain the mechanism of Position Effect Variegation. In the cis-spreading model, the heterochromatin (condensed state) spreads beyond its usual boundary, and silences the now neighbouring gene by somehow blocking transcription (reviewed by Wakimoto, 1998). This model is supported by evidence of a change in the banding pattern of euchromatin placed near heterochromatin. That is, the region susceptible to P E V acquires a morphology characteristic of heterochromatin in strains in which the variegating gene is silenced, while the same region is generally well banded, a characteristic of euchromatin, when the variegating gene is expressed. There is a similar correlation between 'open' and 'closed' chromatin structure and transcriptional competency and silencing, respectively. Genes that are silenced are far less susceptible to digestion by restriction endonucleases that cut them in their normal euchromatic locations (reviewed by Elgin, 1997). Furthermore, genes placed closer to the heterochromatin breakpoint are silenced in a greater number of cells than genes that are farther from the breakpoint (Hartmann-Goldstein, 1967 and Hayashi et al, 1990). Also, when two genes are involved as markers, the gene distal to the heterochromatin is rarely silenced in cells in which the proximal gene is active (reviewed by Grigliatti, 1991). While this model explains variegation by the differential extent of spreading in different cells, it does not explain why genes that are many Megabases away from the heterochromatin boundary may be affected (reviewed by Weiler and Wakimoto, 1995).  6  In  Drosophila melanogaster, and possibly most higher eukaryotes, the nucleus is  compartmentalized (excepting during replication) such that heterochromatic regions localize to one area, while euchromatic regions are in another. The compartmentalization model suggests that it is the localization into this new area that affects the transcription of the displaced gene (Csink and Henikoff, 1996). This also helps to explain why genes which are normally expressed in heterochromatin may become silent when moved into euchromatin, as they are away from the area of the nucleus rich in their transcription factors (reviewed by Weiler and Wakimoto, 1995). A s the two models are not mutually exclusive, one might postulate that a combination of the two models is the true mechanism of P E V . I will be using P E V as an assay system to identify and characterize genes somehow involved with chromatin modification.  Chromatin Modifying Factors Identified by Position Effect Variegation Several labs (Sinclair, 1983; Reuter, 1982; Locke et al. 1988), have undertaken genetic screens to identify genes which affect chromatin structure, using P E V as an assay system. Over 100 Su(var)s and E(var)s have been identified, though only a few have been cloned and characterized. Some  (Su(var)3-7, E(var)93D, Su(var)2-10, Su(var)3-9,  Su(var)2-5 (HP])) appear to be possible D N A binding proteins, as domains identified in these genes are known to be capable of binding chromatin proteins. However, these domains fall into different classes, such as S A P ( S A F - A / B , Acinus and PIAS) domains (Hari et al, 2001), chromo (CHRomatin Organization Modifier) domains, and zinc fingers (reviewed by Schotta et al, 2003). At least two have been shown to act as  7  enzymes, specifically a protein phosphatase (3-6) (Baksa, 1993) and a methyl-transferase (3-9). Among genes identified for other properties, a few have been shown to play a part in chromatin modification when tested for an affect on P E V . These include Su(z)2, with its ring finger domain, and M(2)21AB, a methionine adenosultransferase. With such diversity in the functions of the few known genes, and until more of these modifiers are identified and cloned, we will not have a clear picture of their overall role in chromatin assembly and gene regulation. One very effective way of cloning genes has been P transposable element tagging, commonly called P tagging. One of the aims of the  Drosophila Genome Project at  Berkeley (BDGP) (www.fuitfly.org) is to create P element induced recessive lethal phenotypes for each essential gene in the genome (P element Gene Disruption Project). A s of 1999, 1000 strains had been identified as carrying single P element insertions in different genes (Spradling et al, 1999). This is approximately 25% of the estimated 3600 essential genes in the  Drosophila genome. Each of these P element  insertion mutations, originating in 7 separate screens from various labs, have been localized by  in situ hybridization, and flanking D N A has been sequenced, allowing for  immediate comparison to the  Drosophila genome (now fully sequenced). More than 250  genes have already been characterized using stocks from this project (Spradling et al, 1999). Other study groups have also undertaken this task, adding more P element tagged genes to the pool, among them one creating 150 new lines (Deak et al, 1997) now available from the Szeged stock centre. This resource may prove vital in cloning chromatin-modifying factors. To date, screens using P element mutagenesis to produce chromatin modifiers based on effect on  8  PEV have been largely unsuccessful in producing P tagged genes. Suppressors and Enhancers have most frequently been deficiencies or duplications of the region (likely the result of imprecise P element excision, described below). It is possible that P element insertions into these genes do not cause Dominant Suppressor or Enhancer effects, and so are not picked up in these screens. The BDGP, however, is screening for lethal mutations, and as such may be picking up mutations in Su(var)s and E(var)s that are going undetected in traditional screens.  Using P elements to Clone and characterize  these  Proteins  P elements are one class of mobile genetic elements. These mobile elements are capable of 'hopping' around the genome (Engels et al, 1990) and, if they insert within a gene or its regulatory region, disrupt its function. This loss of gene function is correlated with a mutant phenotype; in the case of BDGP it is also correlated to its recessive lethality. Since the P element itself is cloned, it is possible to recover this P-tagged gene (the gene into which the P element has inserted) by methods described later in this report. These transposable elements have been altered in laboratories such that they are now a highly utilized and effective means for mutating the Drosophila  genome and  cloning specific genes by a method P-element tagging (Searles, 1982). Once inserted into a gene, the P element often disrupts that gene's function, and has thus become a valuable means of studying the effects of altered gene function. P elements have 31 bp (base-pair) terminal repeats, and 1 lbp subterminal repeats (O'Hare and Rubin, 1983), which are recognition sites for transposase, and are required for transposition to occur. Transposase is encoded within the P element itself, and is also  9  a requirement for transposition (Rio and Rubin, 1988). In wild-type (autonomous) P elements, both the transposase and terminal repeats must be present (Rio, 1990). Additionally, the transposase must be spliced properly such that the 2-3 intron (which acts as a repressor) is removed (Laski, 1986); this splicing occurs only in germline cells. P elements used for experimental purposes are altered, normally removing the transposase gene and possibly replacing it with a reporter gene, a gene whose product is easily detected. The resulting elements, therefore, are mobile but non-autonomous; that is, they can move only if transposase is supplied to them in trans (by a P element located elsewhere). Strains that are commonly used as the source of active transposase contain an engineered transposase gene - which does not contain the 2-3 intron - as well as a deleted terminus rendering it immobile (Robertson, 1988). Thus the element that acts as the source of the transposase is itself immobile, and the element that moves in response to this transposase cannot move if the source of the transposase is removed by genetic crosses. Commonly, P elements excise at a rate of 1% of offspring per generation (Engels, 1989), but excision rates as low as 0.4% (Eggleston et al, 1988), and as high as 13% (Engels, 1990) have been noted. With a study sample of 1000 Drosophila, with an excision rate as low as 1%, one should be able tofindapproximately 10 revertant flies. The excision of a P element from a gene can result in a number of different possible outcomes. A precise excision would remove the entire P element and nothing more, leaving the gene intact and functional. However, as few as 1 in 54 excision events may result in this precise excision (Johnson-Schlitz and Engels, 1993). Alternatively, if the excision event goes awry, a portion of the neighbouring DNA could be excised along  10  with the P element (Salz et al, 1987) creating a deletion in the gene. If one is screening for an excision event, this may phenotypically appear the same as the mutant in which the P element disrupts the gene (as in both cases, the gene function is disrupted). As such, it would not be detected. Also possible, the P element may leave a (henceforth immobile) portion of itself in the gene when it excises. Again, this may appear phenotypically indistinguishable from the original mutation. If a mutant strain of flies is found to revert from a mutant to a wild-type phenotype, then that mutant strain must have an intact P element (or at least, sufficient amounts of the termini to respond to transposase) in the gene in question. Either of these latter two situations points to a P-tagged gene, which can then be cloned by methods described later.  Characteristics of Su(var)3-8 A strong Suppressor of variegation, Su(var)3-8 has many qualities that make it an ideal candidate for cloning. The high penetrance (approximately 90% of wild-type) in female flies makes it easy to identify among non-suppressed flies. Penetrance is lower in males, approximately 75% of wild-type (Reuter, 1986). The Su(var)3-8 has multiple alleles. The original allele, Suc6, was isolated by Reuter (1986), using E M S (Ethyl M-induced mutagenesis) in a screen for suppressors; E M S mutagenesis primarily causes missense mutations. In a similar screen, using P elements as the mutagenizing factor, Mottus (unpublished) isolated 5 further alleles of this gene: 5A4, 5A5, 5B3, 5B4 and 5B8 that may still contain P elements which disrupt their normal function. However, it is also possible that the mutation causing the phenotype is the result of a P element that inserted itself in the gene, and subsequently  11  excised, removing a part of the gene with it and causing a deletion. As stated above, this appears to be common in Su(var)s; P induced screens have been attempted in the past, with no (Locke, 1988) or few (Dorn, 1993) P tagged mutations resulting. Most identified suppressors are deletion or duplication mutations.  Su(var)3-8 appears to be an essential gene, in that all isolated mutant alleles are recessive lethal. Mottus (2000) has postulated that it may be possible to obtain P element induced recessive lethal mutations of a gene (loss of function) that do not display the suppressor phenotype. If these (chromatin modifying) proteins function not on their own as individual proteins, but instead as part of a protein complex, a point mutation in one of these proteins could affect the function of the entire complex. However, a null mutation in any one of the proteins may be masked by product from the intact homologue. A null mutation may be recessive lethal, yet not have any visible dominant effects. Mottus found that a P element induced recessive lethal mutation which had no dominant effects on Position Effect Variegation was lethal when transheterozygous over various mutations of  HDAC1 (Histone DeACetylase J), and went on to show that this P induced lethal was in fact an allele of this gene. Thus, it may be possible to clone these elusive Su(var)s by inducing lethal alleles that fail to complement the recessive lethal phenotype of the dominant Su(var) mutations. I therefore had several approaches available to me to pursue  in attempting to clone Su(var)3-8. Firstly, one or more of the five P element induced Su(var)3-8 mutations may revert when transposase is supplied in trans. If removal of the P element is correlated with the loss of the Su(var) phenotype, we can conclude that this particular  Su(var)3-8  allele is caused by a P insert and use the standard P tagging approaches to cloning.  12  If none of the five P induced Su(var)3-8 alleles is able to revert when transposase is supplied, then we could identify P tagged 3-8 alleles among the P-mutations in the  Drosophila P element Gene Disruption Library, by failure to complement the recessive lethality of the currently held alleles. If neither of these approaches was successful, a third option was made possible by the existence of a large number of over-lapping deletions of the genomic region in which the Su(var)3-8 gene resides. Complementation assays between these deficiencies and the Su(var)3-8 gene should serve to better identify the location of the gene. By delimiting the gene location to a sufficiently small area, it may be possible to assay the putative genes in the region and use plasmid rescue to determine the correct one. This thesis is an attempt to clone Su(var)3-8 by methodically going through these three approaches. The thesis will describe a) the experiments undertaken to revert Su(var)3-8 P induced alleles b) the attempts to identify P-tagged lethal alleles of 3-8, provided by the B D G P , by failure to complement our existing series of Su(var)3-8 alleles and c) the attempts to map the Su(var)3-8 gene more precisely using deletion mapping.  13  2 - Materials and Methods Source of Materials  Deficiencies and P element mutations, unless otherwise specified in table 2.1.1, were obtained from the Bloomington Stock Centre at Indiana University, USA. P element mutations listed as i(S)S****** were provided by the Szeged Stock Centre at the University of Szeged, Hungary (Deak et al, 1997). Genotypes for individual lines not given, but all lines are balanced with TM3 Sb Ser. Dr. John Tower provided the Orc2 allele k43y4,e/TM6B,Tb,Hu,e. Dr. Rick Kelley provided the deficiencies Df(3R)urd,e/TM3,Sb,ry,e;y,w, Df(3R)Orc2.y7/TM6Tb and Df(3R)red-P52/TM6Tb.  Table 2.1.1 lists the stocks used in complementation and physical mapping experiments. Genotypes of the Szeged stocks are balanced over TM3,Sb,Ser.  Table 2.1.2 lists the genes used in these experiments, and their visible phenotypes. Balancer chromosomes, used to eliminate cross-over events between chromatids in stocks and common abbreviations are also included.  14  Table 2.1.1 - Stocks used in experiments. Number denotes the number assigned to each stock by Bloomington stock centre or Szeged stock centre for stocks obtained through each centre respectively. For stocks obtainedfrom other sources, the listing under the number heading denotes unique qualifier given to this stock to identify it. Name denotes the name given the gene or aberration by Fly base (flybase.bio.indiana.edu). Location denotes the cytological position as given by Flybase, and genotype the full genetic makeup of the strains used. Number Name P276 l(3)neo39 PI 590 1(3)03463 P1551 1(3)01949 P2130 I(3)j2c3 026316 1(3)S026316 059706 1(3)S059706 061617 1(3)S061617 108310 1(3)S108310 113105 1(3)S113105 1(3)J5A4 P245 1(3)05137 PI 648 P2132 l(3)s2149 059705 1(3)S059705 008131 1(3)S008131 101804 1(3)S101804 008614 1(3)S008614 011004 1(3)S011004 029910 1(3)S029910 106414 1(3)S106414 129510 1(3)S129510 P2134 K3)j4B4 P252 1(3)L4179 P265 l(3)s2249 130313 1(3)S130313 P1630 1(3)04449 011041 1(3)S011041 102910 1(3)S102910 090417 1(3)S090417 024535 1(3)S024535 102702 1(3)S 102702 125011 1(3)S125011 146607 1(3)S 146607 086909 1(3)S086909 101206 1(3)S101206 067101 1(3)S067101 078514 1(3)S078514 059613 1(3)S059613 041316 1(3)S041316 118602 1(3)S 118602 119313 l(3)S119313b 132703 1(3)S 132702 P2136 l(3)s5452  Location 87D01-E12 87D07-09 87D10-11 87D101-02 87E 87E 87E 87E 87E 87E05-06 87E07-08 87E10-11 87E4-12 87E5-10 87E8-12 87F 87F 87F 87F 87F 87F03-04 87F07-08 87F07-08 87F1-3 87F10-11 87F10-15 87F10-15 87F3-10 88A 88A 88A 88A 88A1-2 88A1-2 88A1-5 88A1-5 88A4-8 88A6-12 88B 88B 88B 88B01-02  Genotype mwhP{hsneo}l(3)neo39 red e, l(3)/TM3Sb ry[5061;P{ryr+t7.21=PZ}l(3)03463/TM3Sb ry [506];P{ry[+t7.2]=PZ}l(3)01949/TM3Sb yw;P{w[+mCl=lacW}l(3)j2C3/TM3Sb  y w;P {w[+mC]=lacW} l(3)j5A1 /TM3 Sb ry [506] ;P {ry[+t7.2]=PZ} 1(3)05137/TM3 Sb w;P {w[+mC]=lacW} l(3)s2149/TM3 Sb  yw;P {wr+mCl=lacW} l(3)j4B4/TM3Sb yw;P{w[+mCl=lacW}l(3)L4179/TM3Sb w;P M+mCHacW} l(3)s2249/TM3Sb ry[5061;P{ry[+t7.21=PZ}l(3)04449/TM3Sb  w;P {w[+mCl=lacW} l(3)s5452/TM6CSbTb 15  Table 2.1.1 continued — Stocks used in experiments. Number denotes the number assigned to each stock by Bloomington stock centre or Szeged stock centre for stocks obtained through each centre respectively. For stocks obtainedfrom other sources, the listing under the number heading denotes unique qualifier given to this stock to identify it. Name denotes the name given the gene or aberration by Flybase (flybase.bio.indiana.edu). Location denotes the cytological position as given by Flybase, and genotype the full genetic makeup of the strains used. Number P279 139308 051007 092708 091014 132304 000721 147913 PI 709 P278 P281 P1567 P1605 PI 743 P286 P290  Name 1(3)L5340 1(3)S139308 1(3)S051007 1(3)S092708 1(3)S091014 1(3)S132304 1(3)S000721 1(3)S147913 1(3)06951 L(3)neo41 1(3)L1231 l(3)neo42 1(3)03719 1(3)10418 1(3)1782 l(3)Sj6A3  PI 745 P2140 P2133 k43y4 4814 5049 4813 3093  1(3)10460 1(3)L3929 l(3)j6E3 k43y4 l(3)88Ac urd mei-P19 yrt  3349 3341 3009 3639 1918 3484 3485 1917 1534 480 1049 3007 urd-k  ems Redl 126c urd redP93 redP52 redP52 Red31 ry506-85c ry27 Su(Hw)7 ry615 urd Y7 redP52 ea m-Kxl PxT103 bylO T-10  yl  redp52k 383 3128 1962 1931 3005  Location 88B01-02 88B05-09 88B1-2 88B1-2 88B1-3 88B1-3 88B3-6 88B3-6 88C01-04 88C01-10 88C09-11 88D01-02 88D01-02 88D05-06 88E03-04 88E11-12  ry[506];P{ry[+t7.2]=PZ}l(3)06951/TM3Sb mwh red P{hsneo}neo41 e, l(3)/TM3Sb yw;P{w[+mCl=lacW}l(3)L1231/TM3Ser ry[5061;P{ry[+t7.21=PZ}l(3)neo42[024041/TM3Sb ry[5061;P{ry[+t7.21=PZ}l(3)03719/TM3Sb ry [5061 ;P {ry[+t7.21=PZ} 1(3) 10418/TM3 Sb yw;P {w[+mCl=lacW} 1(3)L3929/TM3 Ser yw;P{w[+mC]=lacW}l(3)j6A3/TM3Sb  88C09-10 88D05-06 87F02-03 88A3 88B1 87F12-15 88A4-5 87E1-F11 88A2 88Bl;88D3-4 87E1-2;87F11-12 87F;87F-88A 88A19-Bl;88C2-3 88A12-Bl;88B4-5 88A12-Bl;88B4-5 87F12-14;88Cl-3 87D1-2;88E5-6;Y 87Dl-2;87Fl-2 88A9;88B2 87B11-13;87E8-11 87F 88A1-4 88A-C 88E7-13;89A1 86C1;87B5 85A2;85Cl-2 85D8;85E10-13 86F2;87C6-7  ry[506];P{ry[+t7.21=PZ}put[104601/TM3Sb w;P {w[+mCl=lac W} efffs 17821/TM3Sb y w;P{w[+mC]=lacW}sqdj6E3/TM3Sb k43y4e/TM6BTb Hu e l(3)88Ac red/TM6BTb urd7TM6C,cu Sb ca mei-Pl 9[M2]red/TM6BTb ru h th st cu yrt sr e ca/TM3SbSer ru h th st cu ems sr e ca/TM3SbSer Df(3R)redl/TMl Df(3R)126c, kar/MKRS Df(3R)urd, ru h th st sr e ca/TM3 Sb Ser Df(3R)redp93 1(3) tr Sb/Ubx Me e In(3L)P In(3R) Df(3R)red-P52/TMl Me Df(3R)red-P52, Sv, Ubx/TMl Df(3R)red31/TM6 Tb Df(3R)Tp(3;Y)ry506-85c/MKRS Df(3R)ry27, Dfd cu kar/MKRS Df(3R)su(Hw)7/TM6Tb Df(3R)ry615/TM3 Sb Ser Df(3R)urd, e/TM3 Sb ru e; y,w Df(3R)orc2y7/TM6Tb Df(3R)red-P52/TM6Tb Df(3R)ea,ri,p/TM3Ser Df(3R)M-Kxl/TM3 Sb Ser Df(3R)p-ST103 ru st e ca/TM3 Sb Df(3R)byl0 red e/TM3 Sb Ser Df(3R)T-10 kni cu sr e/TM3 Sb Ser  Genotype yw;P{wf+mCl=lacW}l(3)L5340/TM3Ser  16  Table 2.1.2 - Common terms used in these experiments. Cytological and recombinant map positions are given by Fly base (flybase.bio.indiana.edu) or Lindsley and Zimm (1992). For band positions, bands 1-20 are X chromosome; 21-40 and 41-60 are 2 chromosome left and right arms, respectively; 61-81 and 81-100 are 3 chromosome left and right arms respectively. nd  rd  Symbol  Abberration  In  Inversion  Tp Dp  Transposition  Df  Deficiency  Duplication  Balancer  Genotype  TM3 TM6  ln(3R)TM3;kni p sep l(3)89Aa Ubx e ln(3LR)TM6, Hn ss Ubx e  MKRS  Tp(3;3)MRS, M(3)76A kar ry Sb  Symbol cv-c  Gene name  Phenotype  cross-veinless c ebony gespleten  lack transverse veins or crossveins: crossvein specific darkened body in adult longitudinal medial groove in thorax, reduced eyes  henna  kar kni  e gs, gv Hn  Ly Me Ore P red  cytological location  map positi on  88C2 93D1 69C1-2  3-54.1 3-70.7  dark brown eyes  66A10-11  3-23.0  karmoisin  pale brown eyes  87C2  3-51.7  knirps Lyra  loss of wing vein L2 lateral margins of wings excised, giving narrowed shape  77E1  moire  eye had watered-silk, shimmering, iridescent pattern.  origin recognition complex pink  Arrest in methaphase with abnormally condensed chromosomes light colour eyes  3-37.3  70A8  3-40.5  64C12-65E1  3-19.2  88A3 85A6  5-51.1 3-48.0  88B1-2  3-53.6  87D9  3-52.0  red  eye colour: dark brown eyes  ry Sb  rosy  eye colour: reddish brown eyes  stubble  short thick bristles, dominant  89B8-9  3-58.2  sbd  stubbloid  short thick bristles, recessive  89B8-9  3-58.2  sep Ser  seperated  most of posteriror crossvein absent  serrate  gap in the posteriror wing tip and margin and a portion of the blade  97F1  3-92.5  ss  spineless  proximal portion of the arista is swollen and carries bracted bristles  89B17-19  3-58.5  Tb  tubby  larvae, pupae and adult are short and thickset  <99B10  3-90.6  trx  trithorax  88B1  3-54.2  Ubx  ultrabithorax  transformations of thoracic segments metathoracic outpushing is a uniform, narrow, hairy band  89D4-6  3-58.8  Urd  urder  lethal  87F12-15  3-53.  3-  17  Propagation of stocks  Stocks of Drosophila were kept in vials containing approximately 7ml Drosophila medium (per L H20: 13.1g Agar, 8.7g NaKT, 0.6g CaCl , 63.8g Dextrose, 31.9g 2  Sucrose, 31.9g Dry Yeast, 76.9g Corn Meal). To this food was added an antifungal agent, Tegosept (methyl-p-hydroxy benzoate at 2.4g/L). The food also contains antibiotics: Tetracycline (15mg/L) and on an alternating weekly basis, Ampicillin (50mg/L) or Streptomycin (15mg/L). These vials are kept at 22°C for approximately 3 weeks, during which time adults lay eggs, which hatch in the food. After this time, flies are transferred to new vials containing fresh medium.  Crosses For crosses in which 50 or fewer offspring were required, flies were crossed in vials containing Drosophila medium. 2 males and 5 virgin females were added, and allowed to mate for 3 days at 25°C. After 3 days, adults were transferred to a fresh vial, and transferred again after a further three days. This process resulted in 3 vials containing eggs of the desired cross. These vials were left at 25°C until the first flies started to eclose (usually 11-13 days). From this point, offspring were collected and scored for phenotype for a further 11 days (the vials remained at 25°C). For crosses where large numbers of offspring were required, 10 males and 50 females were placed in a 250ml bottle containing Drosophila medium and allowed to mate for 3-5 days. Temperature and scoring methods remained the same.  18  For the convenience of the reader, each of the protocols for each of the genetic crosses associated with each of the various reversion, complementation, and genetic and physical mapping experiments will be described in the results section just prior to the results.  Sequence Comparison For those available, sequences of P element induced mutations causing suppression were run through B L A S T (Basic Local Alignment Search Tool), a similarity search program which compares sequence data. For a review, see http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html.  Isolation of Genomic DNA Batches of approximately 20 flies were transferred to 1.5ml eppendorf tubes, to which was added 250ul homogenizing buffer (7M urea, 2% SDS, 50mM Tris p H 7.5, lOmM E D T A , 0.35M NaCl). The flies were homogenized for 1-2 minutes using a plastic pestle, and another 250ul homogenizing buffer added. Cellular debris (proteins and lipids) was removed by a series of phenol chloroform (1:1) extractions: 500ul phenobchloroform was added and the tubes gently rocked from side to side 20-30 minutes at room temperature. The solution was centrifuged 5-10 minutes at 13000 R P M and the aqueous layer collected. This extraction procedure was repeated twice, after which 500pl chloroform was added, and the mixture rotated 10 minutes. The solution  19  was centrifuged 10 minutes at 13000 R P M and the aqueous layer was collected to a new eppendorf tube. 2 volumes 95% E t O H was added to the solution, and left for 1 hour at 0 ° C . After spinning at 13000 R P M for 10 minutes, the supernatant was discarded and the pellet washed with 1 ml 70% E t O H and spun again at 13000 R P M 5min. The supernatant was removed and the pellet allowed to dry 5 minutes, then re-suspended in 50ul T E (lOmM TrisCl I m M E D T A ) with 1 ul RNaseA, placed at 37C for 1 1/2 hours for activation of RNase, then left at room temperature overnight for complete re-suspension.  MiniPrep Alkaline Lvsis Bacterial cultures containing the plasmid vector pn:25.1 were grown in 3ml Liquid Broth (lOg/L Bacto-Tryptone, 5g/L Bacto-Yeast extract, 5g/L NaCl, 15g/L agar, p H 7.0) with lOOpg/ml Ampicillin overnight. They were then transferred to 1. 5ml eppendorf tubes and spun at 13000 R P M for 2 minutes; the supernatant was discarded, leaving cells in pellet form. T o this pellet was added lOOpg solution A (50mM glucose (dextrose), lOmM E D T A , 25mM Tris), and the pellet was re-suspended by twirling with a flat, sterile toothpick. Then, 200ul of solution B (0.2M N a O H , 1.0% (w/v) SDS) was added, mixed gently and allowed to incubate for 2 minutes. Lastly, 200ul solution C (3M K A c , Acetic Acid ) was added, mixed gently, and allowed to incubate on ice for 5 minutes. This was then spun at 13 000 R P M for 10 minutes and the supernatant collected and respun for 5 minutes. One phenol-chloroform (1:1) extraction was done (10 minutes rotate, 10 minutes spin), then 1ml of 95% E t O H added and the mixture was left to precipitate for 5 minutes. This was spun at 13000 R P M for 5 minutes, the pellet was washed with 70% E t O H and re-suspended in 50pl T E and 1 u.1 RNaseA.  20  P C R of P element from plasmid P7T.25.1  The final volume of the PCR reaction was 50ul. The final concentrations of reagents were as follows: lx Mg-free reaction buffer (Boehringer Mannheim™), 2.5mM Mg(OAc) or Mg(Cl) , 0.8mM dNTPs, 1.2 uM 573' primer P in 1, 1 pi dilute DNA, 2  2  2.5xl0" units Taq. This was then treated in a thermal cycler as follows: 1) 94°C 1 3  minute 2) 92°C 30 seconds 3) 60°C 30 seconds 4) 75°C 1.5 minutes 5) repeat from step (2) twenty-nine times 6) 75°C 5 minutes 7) 4°C indefinite hold. Pin: 5'CATGATGAAATAACATAAGGTGGTCCCGT T m 70.9°C  Annealing Temp 65.0°C  P C R of gene fragment from Su(var)3-9 clone  The final volume of the PCR reaction was 50pl. The final concentrations of reagents were as follows: lx Mg-free reaction buffer (Boehringer Mannheim™), 2.5mM Mg(OAc) or Mg(Cl) , 0.8mM dNTPs, 0.4uM 5' primer Kyle, 0.4uM 3' primer 3-set, lul 2  2  dilute DNA, 2.5xl0~ units Taq. This was then treated in a thermal cycler as follows: 1) J  95°C 5 minutes 2) 94°C 1 minute 3) 60°C 1.5 minutes 4) 72°C 2.5 minutes 5) repeat from step (2) twenty-nine times 6) 72°C 4 minutes 7) 4°C indefinite hold. Kyle: 5'TTCGCCAAACTGAAGCGTCG T m 62°C Annealing Temp 65.0°C  3Set: 5'TGTCTCAGGTGGGTAACGGCGTG T m 74°C Annealing Temp 65.0°C  21  Cell Transformation lOOul competent D H 5 a . Escherichia coli cells were thawed (on ice). To them was added 10-50ng p7t25.1 plasmid D N A . The mixture was incubated on ice for 30 minutes, then heat shocked for 90 seconds at 4 2 - 4 5 ° C followed by 2-8 minutes on ice. 250ul L B (no Ampicillin) was added and the cells were allowed to incubate 30 minutes at 3 7 ° C . The entire mixture was then plated on L B Amp plates and allowed to grow overnight. Single colonies were picked and grown up overnight in 3ml L B Amp.  Southern Blotting 15ul D N A (60 - 600 ng/ul) from genomic preperations was cut with a restriction enzyme (Eco RI or Eco R V ) in a 50ul volume. This was then eletrophoretically separated on a 0.8% agarose gel containing 0.2ul /ml EtBr using a loading buffer containing xylene cyanol and bromophenol blue for ease of loading and tracking. The gel was then photographed then treated with 0.25M HCI until dyes changed colour. The gel was rinsed and placed in denaturation buffer (1.5M NaCl, 0.5M NaOH) for 30 minutes. The gel was again rinsed in distilled water and placed in neutralization buffer (1.5M NaCl, 0.5M TrisHC1 pH7.2, 0.001M E D T A ) for 30 minutes, replacing the buffer once at 15 minutes. The gel was then set up in a capillary system (figure 2.1) using 10X SSC (3 M N a C l , 0.3M Na3-citrate) and transferring to Hybond-N+ membrane. This was then left overnight. When transfer was complete, the membrane was marked by pencil for later identification of lanes, and rinsed briefly in denaturation buffer, neutralizing buffer and 2X SSC to remove adhering agarose. Sample was fixed to membrane by 312nm U V cross-linking for 1 min.  22  The membrane was pre-hybridized in 5xSSPE (3.6M NaCl, 0.2M ^ H ^ P C V H a O , 0.02M E D T A pH7.7), 0.1% SDS, 1% skim milk powder at 5 0 ° C for a minimum of one hour. The probe was made by first denaturing 25ng of template D N A by boiling for 10 minutes, then cooling on ice. To the D N A template was added 2ul -dATP (0.5mM), 2ul reaction mixture (10X buffer, hexanucleotide mix), 5ul P d A T P , and enough M i l l i Q H _ 0 32  to bring the volume to 19ul. Then l u l (2 units) Klenow enzyme was added, and the reaction was incubated at 3 7 ° C for 30 minutes.  Incorporation of radioactivity was checked by means of a MicroSpin S-300 H R column. The reaction was run through and checked for equal radioactivity in column (unincorporated dATP) and flowthrough (probe). If there was good incorporation, the probe was denatured by boiling for 5 minutes and cooling on ice for 5 minutes. This was then added to the pre-hybridization mixture and allowed to incubate overnight with the membranes at 5 0 ° C .  Following hybridization, membranes were washed in 2 X S S C , 0.1% SDS at room temperature for 10 minutes. They were then washed in I X SSC, 0.1% SDS at 5 0 ° C for 30 minutes, changing the solution once. Washed filters were then wrapped in Saran W r a p ™ and placed on film for autoradiography.  When blots were to be used for multiple probes, they were stripped by placing in a boiling solution of 0.1% SDS and allowed to cool to Room Temperature.  23  3 glass plate  paper towels  whatman paper —  hybond n+ membrane  ~geT sponge  rVlH OX SSC  Figure 2.1 — Diagram of capillary system usedfor transfer of DNA from agarose gel to hybond n+ membrane.  24  3 - Results and Discussion  Localization to date  The  Su(var)3-8 Suc6 allele isolated by Reuter (1986) is located on chromosome 3  and was mapped by recombination using as markers gs (gespleten 3, map position 35.1),  red (red, 53.6), e (ebony, 70.7), ry (rosy, 52.0) and ro (rough, 91.1) (all locations from Lindsley and Zimm, 1992). between  Su(var)3-8 was localized to 3 - 53.5 +/- 0.9, placing it  rosy and red. The cytological position of red is given as bands 88B1-88B3 based  on its inclusion in Df(3R)red2l (88B1; 88B2-3) (Spillman and Nothiger, 1978), and of  rosy at 87D determined by in situ hybridization (Papaceit and Juan, 1993, Segarra et al., 1996).  Five different P element-induced alleles of  Su(var)3-8 were isolated by Mottus  (unpublished data); of these, one (5A4) has been mapped by complementation analysis (Kwon and Mottus, unpublished). They tested 4 deficiencies, covering the regions from bands 87B11-13 to 89A1 and 88E7-13 to 89A1. 5A4 was included within  Tp(3;Y)ry506-  85c, covering bands 87Dl-2;88E5-6. Taken together with Reuter's recombination map, this suggests the  Su(var)3-8 gene is located between bands 87E8-11 and 88B2. This  region comprises 55 bands and, by inference from the  Drosophila genome sequence data,  about 163 genetic loci.  Approaches taken - Overview  In the next few pages I'll give a general overview of the various approaches taken to identify P-tagged  Su(var)3-8 alleles and to map 3-8 alleles precisely. The main  25  objective in this study is to identify and then sequence Su(var)3-8. A s stated in the introduction, I had a variety of genetic tools available that should allow me either to identify a P-element "tagged" allele of  Su(var)3-8, (a mutant allele that retains a P-  element insert) or to map more precisely the position of the  Su(var)3-8 gene relative to  either known breakpoints or known genes in the genome. The latter, while not allowing us to clone  Su(var)3-8 directly, would define its precise location and allow cloning by  alternative approaches. Since I had available 5 strains of  Su(var)3-8 mutation made in a P screen, there  was a possibility one of the strains would contain a P element whose ends were still intact, and therefore the P element would respond to transposase, (it would still be mobile). M y first approach, therefore, was to attempt to remove this element from the gene, thus showing that a P element in fact still resided there. If the P element excision event is precise, the gene should revert to its wild-type state, ie, remove the mutant suppressor phenotype. I induced P element mobilization by a cross that introduced transposase into the flies; this should cause mobility in any P element that has its terminal repeats intact. Offspring ( F l generation) were checked for germline reversion, which is the reversion of the mutant allele in reproductive cells. To do this, we must look at the next generation (F2) of flies; an excision event in a parental germline cell creates a new fly that is wildtype for this Su(var). I screened F2 flies for individuals that presented as non-suppressed phenotype (white-mottling). From this group, selections of white-eyed flies were tested individually to determine whether the non-suppressed eyes were due to reversion of the  Su(var)3-8 mutation or simply low penetrance of the suppression phenotype. T o do this,  26  I looked at the next (F3) generation. Excision of the P element would mean reversion to a wild-type Su(var) gene, and the fly would be true breeding; that is the revertant nonsuppressed, white mottled phenotype would be passed on to further generations. If the white phenotype in an individual were simply due to low penetrance of the Su(var), this phenotype would not be passed along to offspring; their eyes would be mainly red suppressed.. A s P elements may sometimes excise imprecisely, there may at times be portions of the elements remaining in the affected genes. In the case that the strains generated in our lab did not contain revertable P element inserts, I also wanted to determine whether an immobile portion of a P element possibly remained. To this end, I did Southern blot analysis, probing digested genomic D N A with radioactively labeled complete P element. This should expose any P element fragment large enough to adhere to the probe. In the case that the lab-generated Su(var) strains did not contain any P elements, I also looked to other sources. Among other studies, the  Drosophila Genome Project aims  to create a P element mutation in every essential gene in the  Drosophila genome. From  this resource, I was able to select P-tagged recessive lethal mutations that have been physically mapped to the general area of our target gene. These were then crossed to one of our recessive lethal alleles of 3-8 and tested for complementation (that is, we test whether the P induced mutation is lethal over our gene, indicating they are most probably the same gene). This method has worked previously (Mottus, 2000); it eliminates screening against weak or non-suppressing mutations. It is possible that a P element insertion causes lethality but not a suppressor phenotype when inserted into a Su(var) gene. These mutations would be discarded in a screen for suppressors, but not in a screen  27  for lethality. By using sources that are attempting to saturate the genome with P elements, and that are selecting for P element induced recessive lethal mutations, perhaps the chances of encountering a P induced dominant suppressor/recessive lethal are increased. Once a P tagged Su(var)3-8 allele was found, it was my intention to clone the gene. The primary approach would be Inverse PCR, whereby the Drosophila DNA is cut with a restriction enzyme that does not cut within the P element. The resultant fragments are circularized, and PCR is performed on the fragments using primers to the P element. By this method we can obtain a sample of the DNA around the gene (depending on where the restriction enzyme cuts, this may include only a part of the gene, or may include the whole gene and some extraneous genomic DNA). This DNA can be sequenced and compared to the Genome database to determine the correct Open Reading Frame and full gene sequence. As the P-tagged gene was never found, I was unable to use this method to sequence the gene. My second approach to cloning Su(var)3-8, in the event that I was unable to locate a P tagged allele, was to localize the gene precisely, using various deficiencies and markers in the area. Prior studies indicated that Su(var)3-8 was situated in the chromosomal region between 87E12 and 88E6 (Kwon, unpublished result); and cytologically at 53.5±0.9 (Reuter, 1986). Using these parameters as a basis, we tested 8 new deficiencies that eliminated various portions of the chromosomal region in question. I also re-tested the three deficiencies that had been used to localize the gene previously. These deficiencies are all  28  recessive lethal, and were tested for lack o f complementation to our gene, w h i c h w o u l d indicate that the area deleted i n the deficiency included the gene o f interest, Su(var)3-8. I also used k n o w n markers to m a p the gene c y t o l o g i c a l l y . B y counting the number o f cross-over events between t w o genes, w e can determine the distance between them; although it does not provide a precise physical location, recombination m a p p i n g is effective i n determining relative distances and locations o f a set o f genes. T h i s had been done p r e v i o u s l y b y Reuter (1986) as part o f a study l o c a l i z i n g a variety o f Su(var) genes. I decided to repeat the experiment using different markers and hoped to confirm the findings, and possibly refine the area. I f these experiments pinpoint the gene to a small enough area, it w o u l d be possible to look at a l l open reading frames w i t h i n that region (now that the Drosophila genome has been fully sequenced) and elucidate the correct one using, perhaps, p l a s m i d rescue (incorporating the sequence into a p l a s m i d , w h i c h is then injected into embryos and screened for rescue o f the mutant phenotype). T h i s method has been successful i n c l o n i n g Su(var)s i n the past (Reuter, 1990).  29  3.1 - Reversion of P-element induced Su(var)3-8 alleles  The ultimate goal of this particular project is to sequence a known chromatinmodifying factor. One way of doing this, and the method I decided to undertake first, is to 'tag' the gene with a known sequence (in this case the 'P' transposable element) and to use this sequence to 'lead us' to the gene.  The first step I took was to determine whether there was already a tagged version of our gene of interest. Our research group had previously recovered five  Su(var)3-8  alleles in a P element mutation screen (5A4, 5A5, 5B3, 5B4, 5B8). A s stated earlier, Su(var)s created through P element mutagenesis tend to have lost the original P insert; the element appears to be replaced by duplications or deficiencies, which we assume were caused by imprecise excision events. However, one of the lines created from the P element screen possibly contains an intact P element. As this would allow me to clone and sequence the gene using this known sequence as a starting point, I attempted to discern whether the P element was still present, in any of the strains, using transposition as an assay.  If these transposable elements are still present and have not lost their terminal repeats, then they should be able to move if transposase is provided from another source. Mobilization of a P element should, in some cases, produce a precise excision and therefore restore the wild-type phenotype. To this end, I crossed our P element induced mutations to flies of the genotype referred to as  In(l)w ; TM3, ry Sb Ser P{Delta2-3}99B/Ly (hereafter m4  TM3A2-3Sb/Ly), which acts as a potent source of transposase. The potency  30  of this source was tested by crossing this strain to a strain carrying 17 P elements. From the 180 progeny of this cross, none containing the transposase survived.  I was looking for offspring of flies in which the P element had excised from the gene in the germline cells, producing offspring that no longer carry the mutant phenotype. Offspring developing from a 'reverted' cell will be wild-type in all their cells, both somatic and germline. A s such, they will present as wild-type in their somatic cells, and produce wild-type offspring themselves.  Flies carrying transposase and the P-element mutated Su(var) were made via a cross between virgin females carrying the Su(var) and males carrying the transposase (figure 3.1.1). Male offspring exhibiting the Sb phenotype, but not the Ly, were collected.  In a preliminary experiment, to determine whether the parameters of the experiment were practical, 25 males (5 of each allele) containing the mutant Suppressor and transposase were each crossed to approximately 25 homozygous w  m 4  virgin females  whose third chromosomes were marked with the inversion TM3Sb and Ly respectively (figure 3.1.1, cross A ) . The 5 males of each strain were crossed in the same bottle, as I was observing the occurrence of reversion, not the precise rate thereof. Progeny with more than 10% pigmentation (determined visually) were scored as being suppressed, and flies with less than 10% pigmentation as being non-suppressed. Although level of pigmentation was determined visually in these experiments, previous studies (Reuter, 1986) have shown Su(var)3-8 flies to contain 73-78% (males) and 89-92% (females) of the pigmentation found in wild-type strains based on optical density. Flies not containing  31  the suppressor were found to contain between 5 and 7% normal pigmentation. All of these measurements were done in an In(l)wm4 background.  These experimental parameters proved to be inadequate, since the TM3 balancer causes some level of enhancement of PEV. Upon repeating the experiment on a larger scale, I used w ;wildtype females for the cross (figure 3.1.1, cross B). This eliminates m4  the problem of enhancer effects from the trans chromosome and also makes scoring easier, as there is only one (dominant) marker to be scored, Stubble bristles (Sb). In this set of experiments, I also included a control - Suc6, an EMS-induced mutation of Su(var)3-8. 5A4 was not tested in this set of experiments, as the strain was weak, and did not produce enough virgin females to cross; 5A5, 5B3, 5B4 and 5B8 were tested. 10 males of each allele were crossed to approximately 40 females in a bottle. 4 bottles were set up for each strain (with the exception of Sue 6, for which only 2 replicates were made). These adults were flipped into new bottles every 3-5 days (before offspring could eclose), producing 2-4 bottles of each replica. This allows for more offspring to eclose with less competition for food and space.  In both runs of the experiment, I was looking for offspring that presented as W  4  (mottled eyes with low pigmentation), indicating wild-type activity in the suppressor genes. The rate of excision (reversion to a non-suppressing wild-type allele) was expected to be between 0.4% and 1 % of the population, with lack of suppression in an individual being scored as pigmentation in less than 10% of the eye facets.  Selected putative revertant individuals from the second set of experiments were tested to determine whether these were true revertants or false positives. If the individual  32  Su(var)3-8 TM3Sb  w™  4  X  Y  TM3A2-3Sb Ly  TM3Sb TM3A2-3Sb  Su(var)3-8 Ly  4/Y  lethal  Su(var)3-8 TM3A2-3Sb  Ly TM3Sb  4/Y  TM3A2-3Sb Ly  nr«/Y  wild type  Sb, Ly  TM3Sb TM3A2-3Sb lethal  Su(var)3-8  W  Su(var)3-8 Ly Ly  Figure 3.1.1 — Flowchart showing crosses and progeny in reversion experiments. A) Line of experimentation triedfirst, with Su(var)3-8/A2-3 transheterozygotes crossed to TM3 balanced Ly stocks. B) Second line of experimentation, with transheterozygotes crossed to (3' chromosome) wild-type stock Oregon-R. Offspring of the Sb or Ly phenotypes in (A), and wildtype in (B) were scoredfor exceptions of the wm4 phenotype. w / w and w /Ydenote the X chromosomes in females and X and Y chromosomes in males, respectively. d  m4  m4  m4  33  has regained its wild-type suppressor gene (reverted), one would expect that the offspring would not present a suppressed phenotype; that is, the offspring would be mottled-eyed. If the individual had not been a revertant, then the offspring should retain a suppressed phenotype, as the Su(var) gene would continue to contain a P element disrupting it.  In strains of In(wm4) flies that do not have a mutated suppressor gene, very few of flies appear 'suppressed' (>10% facets pigmented) due to natural variation. I therefore considered the offspring population to be suppressed if greater than 10% of the population presents the 'suppressed' phenotype.  In testing for reversion, I looked at both phenotypes of these mutations, suppression and lethality. As the lethality phenotype is less subjective a phenotype to score visually than is suppression, I hoped to confirm the findings of the suppressor reversion by comparison to the lethality reversion levels (cross detailed infigure3.1.2).  Table 3.1.1 is the data from the pilot experiment (crosses labelled (A) in figure 3.1.1). The female offspring did not appear to show much reversion. While 5 female flies did appear to present as revertants, the fact that they all contained the TM3 balancer was suspicious. Extensive data from our lab suggests that the TM3 inversion has a weak enhancing effect (Grigliatii, personal communication). The males did show a higher level of apparent reversion, in flies containing either TM3 or Ly, however this could be due to reduced penetration of the Su(var) phenotype in this sex. It is also important to note that the 'revertants' are seen much more commonly in the TM3 containing offspring than the Ly offspring, again pointing to background effects of TM3 enhancement.  34  wm4 wm4/Y  wm4  Su(var)3-8(a)  Y  TM3A2-3Sb  Su(var)3-8(b) TM3Sb  /0\  wm4 Su(var)3-8(b) wm4  V_y  TM3Sb  Su(var)3-8(a) TM3A2-3Sb  Figure 3.1.2 - Flowchart showing crosses and progeny in lethality-reversion experiments. Su(var)3-8/A2-3 transheterozygotes crossed to Su(var)3-8/TM3 stocks of another line. Offspring were scored on presence of Sb bristles.  35  Table 3.1.1 -Reversion of Suppressor phenotype. Transheterozygous males carrying the transposase and the Su(var) were testedfor germline transposition. Offspring were scoredfor a loss ofsuppressor phenotype. In this experiment, flies were crossed to females carrying the markers Ly and TM3Sb. Flies which had <10% red eye facets (determined visually) were scored as being non-suppressed, all others as suppressed. % variegated calculated as percentage of each sex class which were determined to be of variegated phenotype.  males  females  Variegated Suppressed Variegated Suppressed  y TM3 0 28 24 111 2 19 3 69 L  5A4 5A5 5B3 5B4  y TM3 74 82 125 90 65 59 109 56 L  Y  L  0 0 0 0  TM3 0 4 1 0  y TM3 107 90 142 205 66 74 105 123  % male variegated offspring  % female variegated offspring  Total number of flies scored  15.2% 38.6% 14.5% 30.4%  0.0% 1.1% 0.7% 0.0%  381 701 286 465  L  36  In the line 5A5, there appears to be a significant loss of suppression among the male Ly offspring. 16% of these Ly males presented as variegated, a much higher percentage than in the other strains. This trend, however, is not seen in the female flies, where none of the L y flies appeared to be revertants. While the numbers from this preliminary experiment are not large enough to support the theory that a P element is responsible for this mutation (and at 16%, this number is suspiciously higher than average P element mobilization rates), they do give us an indication that 5A5 may be an important strain to examine during the next run of the experiment.  The data from the second and expanded (larger numbers) set of crosses, labelled (B) in figure 3.1.1 is shown in table 3.1.2. In general, the number of putative revertants (non-suppressed phenotype) closely paralleled the number of non-suppressed flies recovered from the Sue 6 control crosses. These observations suggest that the reduction in pigmentation probably results from variable penetrance rather than reversion of the P element insert. The exception to this is 5A5, in which the number of mottled-eyed flies was 2.5 fold higher than the control, Sue 6.  Samples of "non-suppressed" male progeny were tested for true reversion by crossing to  w /w ; +/+ females (table 3.1.3). Offspring were determined to be from a m4  m4  revertant parent if at least 90% of the offspring presented as mottled eyed. Most showed that indeed they were not true revertants, but rather simply showing low penetrance of the suppressor phenotype, as indicated by the F2 containing a high percentage of suppressed flies. The exception, again, is 5A5, which has 6 flies coming through as true revertants, albeit with all 'revertants' initiating from the same test source (bottle #4).  37  Table 3.1.2 -Reversion of Suppressor phenotype. In this second experiment, flies were crossed to marker-less females, numbers of suppressed offspring were estimated by weight. Flies which were had <10% red eye facets (determined visually) were scored as being non-suppressed, all others as suppressed. % reversion is determined as number of mottledflies over total number offlies.  wm4 wm4 supp % reversion males females 5A4 0 0 0 n/a 5A5 147 87 3145 6.9% 5B3 17 11 3140 0.9% 5B4 16 0 1460 1.1% 5B8 13 10 1870 1.2% Suc6 13 4 630 2.6%  38  Table 3.1.3 — Suppressor-reversion offspring testing. Samples of non-suppressed offspring from the second germline suppression experiment were testedfor true reversion. Second generation offspring were scoredfor existence of suppressedflies; if more than 10% of the second generation looked suppressed, then the original fly was determined to be a non-revertant. Each replicate is an independent test source, with different males andfemales. Data from successive bottles derivedfrom the same parents has been pooled.  5A5 5B3 5B4 5B8  #  replicate #  # flies tested  revertants  1 2 3 4 1 2 1 2  3 4 11 14 3 2 7 2  0 0 0 6 0 0 0 0  3  1  0  39  If the lethality and the Suppressor phenotypes are caused by the same mutation, as speculated, then a reversion of the mutation should bring back wild-type phenotype in both cases. I tested our Su(var)3-8/transposase flies by crossing them to another strain of Su(var)3-8 and scoring for viability (figure 3.1.2). None of the offspring showed a loss of lethality (see table 3.1.4 and appendix A ) .  5A5 seemed to have a high frequency of 'revertant' flies, as well as some offspring that tested as 'true revertants'. A s the majority of these putative revertants (169 of the 234) and all six of the offspring that tests proved to be 'true revertants' were from a single test source (bottle number 4), the high numbers could be a result of one of two different events. A reversion event could have happened pre-meiotically (early in spermatogenesis) in one of the males, whereby the majority of his sperm (and so, offspring) were revertants. Alternatively, multiple males in this bottle could have had later-occurring reversion events.  The best way to distinguish between these results would be to re-run this experiment, this time separating the males into individual test vials. In this way, one could distinguish between many males with late-occurring reversion (which would produce a lower percentage of revertant offspring per test source, but more sources overall producing revertants) and fewer males undergoing earlier event reversion (leading to a larger percentage of offspring revertants per source, and possibly fewer sources with any reversion event). If repeated, this experiment should also expand to test all offspring for reversion, not just sampling as done in this set. Although 5A5 would appear a good  40  Table 3.1.4 - Reversion of lethality. All strains were testedfor viability when trans heterozygous with the 5B4 strain of Su(var)3-8.  wt 5A4 5A5 5B3 5B4  males Sb 0 170 0 270 0 201 0 317  females wt Sb 0 0 0 0  173 243 214 283  41  line to delve into further, in regards to a possible P element insertion, concurrently run experiments (see below - Southern Blotting) show a lack of P elements in the genome. This negates the possibility of a visible mobile P element being present in this, or any, strain. It remains possible that a small portion of a P element - one in which the ends are intact, and can therefore mobilize - remains in this strain. However, as discussed in Section 3.1 - Southern Blotting, a P element that is not large enough to be detected by blotting cannot be used to clone by the methods described above.  One other possibility; one of the females used in the bottle #4 cross could have been a non-virgin, having mated with a w ;+/+ male before being introduced into the m4  bottle. Results of these two scenarios would be indistinguishable, as Su(var) presents the R  same as wild-type (that is, both show a mottled eye due to the functional suppressor gene). Although females were collected young and set aside to test for 'virginity', it is possible that a previously impregnated female was somehow mistakenly included in the experiment. If one looks at the results of tests of the 5A5 line excluding the bottle with multiple 'revertants', we get results that are very similar to the control cross (51mottled males, 14 mottle females, and 2445 suppressed flies). With the exception of the one bottle, there was no apparent reversion in the 5A5 line. I therefore conclude that the one bottle was likely contaminated, and does not represent a successful reversion.  In the experiments to test for reversion of the lethality phenotype, I found no occurrences of reversion. It is unlikely that reversion rates are so low as to go undetected in an experiment of this size. Statistical analysis (see appendix A ) shows these numbers resulted from a non-reverting population, based on an assumed reversion rate of 1%. For  42  this reason, in combination with data from Southern Blotting experiments shown below, it is unlikely that reversion (putatively observed during the Suppression-reversion experiments) would show up if the numbers of flies were increased.  It remains possible that the Suppressor and lethality phenotypes are caused by mutations in different genes. If this were the case, a fully mobile P element could be present in one gene and not the other.  A n independent approach, Southern Blotting, detected no P elements in these lines, discussed below. It is therefore unlikely that these mutant strains contain a P insert in Su(var)3-8 and thus, this line of experimentation was discontinued.  Southern Blotting Concurrently with the reversion experiments, I ran southern blot analyses on the various P element induced strains of Su(var)3-8 (5A4, 5A5, 5B3,5B4, 5B8). Since these lines were created in a P element screen, I expected to see a large number of P elements appearing. Anywhere from a single P element up to 38 have been noted in screens of this type (Spradling and Rubin, 1982 and Engles 1984). If I were to find P elements in any of the strains, I could perform an in situ hybridization of the polytene chromosomes (large chromosomes in the salivary glands resulting from replication of the chromosomes without separation, that allow for visual inspection of banding patterns) using the P element probe to define a more precise location of each P element. If this showed one of the P elements to possibly be in the correct location (3R, approximately at bands 87-88) I could proceed with cloning as described above.  43  The DNA of each strain was extracted and cut with two restriction enzymes, run on agarose gel and blotted. One of these enzymes (EcoRV) does not cut in P elements at all; the other (EcoRI) cuts once in autonomous P elements, but the cut site is deleted in laboratory-use non-autonomous P elements (although spontaneous immobile elements which do not delete this region may occur in nature). P element used as a probe was isolated from the plasmid P7r25.1 (figure 3.1.3) by PCR amplification using primers adhering to the inverse terminal repeats at either end of the P element. The Su(var)3-9 probe was amplified using primers 3set and Kyle. The products were then each purified by gel electrophoresis. The resultant 2.9Kb DNA segment (full autonomous P element) was then labelled with radioactive nucleotides. As the restriction enzyme will cut the genomic DNA into a variety of fragments, the number of bands appearing would be indicative of the number of P elements in the genome. If multiple P elements remain in the genome, we should see bands appearing at different size intervals. If only one P element remains, we should see only one band. A single band does not guarantee a single insert, as different areas of the genome may be cut to the same size by the restriction enzyme; multiple bands, however, do indicate multiple insertions. No bands would indicate no P elements remaining in the genome.  Figure 3.1.4 shows no P elements in any of the strains, while both positive controls (plasmid in lane 3 and genomic in lane 10) clearly indicate that the probe is hybridization to the blot and remaining there. Lane 10, a genomic preparation of a strain known to contain 17 P elements, was under-loaded with DNA in comparison to the other genomic strains (figure 3.1.6), indicating that enough DNA was loaded to detect single P elements.  44  Figure 3.1.3- Prt25.1 in pBR322 - 9097Kb plasmid containing a P element. Primer PINl was used to amplify the P element segment for gel purification. P-lNl is a 29basepair template which adheres to the outermost edges of the 31 bp inverse repeat at the outside edge of the P element. This amplification results in a 2907bp (full) P element.  45  Figure 3.1.4 - Southern Blot experiments, P element probe. Genomic preps cut with restriction enzymes (EcoRV- lanes 1-10 andEcoRl'- lanes 11-20, separately), and probed with P element; film exposed 8 days at SOC. Hybridization and washes done at 50C, most stringent was of 2xSSC, 0.1%SDS. Lane three is a positive control of the uncut plasmidfrom which the probe was isolated. Lane one contains 1Kb DNA ladder. Lanes 4-7 and 13-17 are genomic DNA of various P-element induced mutations of Su(var)3-8. Lanes 8-9 and 18-19 are negative controls that contain no P elements. Lanes 10 and 20 are genomic positive controls, consisting of a strain that contains 17 P elements. Lanes one and 11 contain a 1KB ladder marker, with marker sizes listed in Kb. Lane 12 was left empty.  46  Figure 3.1.5- Southern Blot experiments, Su(var)3-9 probe. The same blots, this time probed with Su(var)3-9, an independent single copy gene. Hybridization and washes done at 50C, most stringent wash of2xSSC, 0.1%SDS. 12 day exposure at 80C.  47  Figure 3.1.6- Photograph of agarose gels that were later blotted and probed (figures 3.2.1 and 3.2.2). DNA was digested with EcoRV (lanes 4-10) andEcoRl (lanes 13-20). DNA size was estimated using a 1KB ladder (lanes 1 and 11; the ladder is faint in lane one - two bands can be seen in the circled area which correspond to the 10 and 8Kb markers). Lanes 2 and 3 contained plasmid, cut and uncut respectively, and lane 12 was left empty. Lanes 10 and 20 show digested DNA from a Birmingham2 strain, known to contain multiple P elements. Lanes 4-8 and 13-18 are various alleles of Su(var)3-8. These photographs show relative amounts of DNA loaded into the electrophoresis gel, with Birmingham2 being under loaded in each case.  To further corroborate this, I stripped the blots and re-probed them with a single copy gene, Su(var)3-9, isolated by Harrington (unpublished). A 1415bp fragment of this gene was amplified using primers created by Harrington adhering to sequences within the 3-9 gene. The restriction enzyme EcoRI does not cut at all in Su(var)3-9. E c o R V cuts once, but so early in the gene (base pair 4) that the small segment would not contain enough information for the probe to bind. Thus, I would expect one band in each lane, of some size larger than Su(var)3-9 (2.4kb). This control blot (figure 3.1.5) shows that all lanes had enough D N A .  As these blots were done at a low stringency, there was some background hybridization by the probe. In both blots, this is seen as hybridization to the 1Kb ladder in lane one, and to some extent lane 11. This is due to the nature of the ladder, as it is composed of D N A from a number of bacterial plasmids, cut to various lengths. When the blots were probed with Su(var)3-9, there is also a background smear visible in lanes containing genomic D N A . This is again due to low stringency of the washes; this smear is not seen in the blots probed by P element likely for two reasons: 1) the 3-9 probe was more concentrated, due to a more successful P C R reaction, and 2) the P element probe was hybridized by the uncut plasmid sequence in lane three, which was an exact match. However, we can see from lane 10 (figure 3.1.4) - the stock known to contain P elements - that there was in fact enough probe to hybridize to genomic copies of the transposable elements to show a single copy gene. A s such, a single copy of the P element should have been visible if present.  49  This result does not absolutely negate the possibility of a small portion of a P element remaining in the gene. However, i f the portion is not large enough to hybridize to sufficient probe to visibly light up on a Southern blot, then it would be of no use for cloning purposes.  A s the chromosomes have not been cleaned up of extraneous P elements resulting from the initial screen, it is unexpected that they contain no P elements. This could be a result of either 1) no P elements inserting into them during the initial screen, or 2) they inserted and excised immediately thereafter. As the strains and P elements contained no transposase, the excision would have to have occurred during the same cross as the insertion.  There is still the possibility of small P element remnants remaining, which are below the detection sensitivity of the screen. These P element fragments could be mobile if the ends are intact, or could be immobile fragments. However, these would be irrelevant for this experiment, as only P elements large enough to detect and cut out can be used to tag and sequence D N A . Fragments must be large enough to appear on the blot to clone from them. Therefore, I decided to look to other sources for P tagged alleles of  the Su(var)3-8 gene.  50  3.2 - Complementation Testing with P element Mutations  A s the previous experiments showed, no P elements were detected in the Su(var)3-8 mutations created in our lab through the P screen. I was still interested, however, in attempting to approach the cloning of this gene through P tagging. I then turned to sources outside the lab to search for possible alleles of Su(var)3-8. A s demonstrated by Mottus (2000), and described in this introduction (section 1), it may be possible to obtain P element induced recessive lethal mutations of a gene (loss of function) that differ in phenotype from dominant negative mutations in the same gene. These P induced recessive lethal alleles are lethal when homozygous or transheterozygous over point mutations, but do not display the suppressor phenotype when heterozygous. A s a result, these mutations would not be identified in a screen devised to detect dominant modifiers of Position Effect Variegation; they would, however, be isolated in a project aimed at tagging essential genes. The aim of the P element Screen/Gene Disruption Project, one of several projects in the Berkley Drosophila Genome Project (BDGP), is to 'knock-out' all of the essential genes in the Drosophila genome in such a way that each gene can be individually cloned. This will be accomplished by creating recessive lethal alleles of each essential locus via insertion of a P transposable element. This P element will be highly engineered so that the time during development and tissue-type(s) in which it acts can be determined, as well as allowing direct cloning of the gene into which the engineered P element inserts. To date, this project has resulted in P-element disruption of more than 1000 different genes, about one third of those estimated to cause discernable phenotypes  51  (fruitfly.org). To physically position each of these tagged genes on the chromosomes,  Drosophila  in-situ hybridization has been used. The D N A flanking each of these P  elements has been sequenced, primarily to allow for comparison to E S T libraries and protein sequence databases. Now that the full  Drosophila genome sequence has been  published, this flanking D N A can also be used to identify the precise position of the tagged gene.  Previous mapping experiments placed about 49 bands - by failure to complement  Su(var)3-8 within the area 87E12 to 88E6 -  Df(3R)Tp(3;Y)ry506-85C (Gina Kwon,  unpublished). Deficiency breakpoints are determined by in-situ hybridization and visual assessment of banding patterns, and there is some degree of imprecision associated with this method. Based on this, I ordered in stocks containing P elements inserted within the entire region, as well as a few just outside the breakpoints. 58 strains containing P elements in this region were available, and all were tested for their ability to complement the lethality with one of the P element induced mutatation alleles of Males of each of the P element strains virgin females of the phenotype presence or absence of  Su(var)3-8 (5A4).  (w /Y; P/TM3Sb) were individually crossed to +  w /w ; Su(var)3-8/TM3Sb. Offspring were scored for m4  m4  Sb, with a 1:1:1:0 expected ratio for P/Su(var)3-  8:P/TM3Sb:Su(var)3-8/TM3Sb:TM3Sb/TM3Sb, pooling together the P/TM3Sb and Su(var)3-8/TM3Sb offspring (as both present Sb phenotype) (figure 3.2.1). I also tested 9 known genes in the region for complementation with this mutant 5A4; all of these genes are recessive lethal, and some have been sequenced and characterized. One (k43y4) has shown suppressor effects with  In(4)w . m4  52  w P Y TM3Sb  xr> vy  +  Su(var)3-8 TM3Sb w  m4 W"  w  w w  m4 m4  Su(var)3-8 TM3Sb  P TM3Sb stu66fe  m4  Y Su(vaf)3^8 P  TM3Sb TM3Sb  -type  (eifiaf  Figure 3.2.1 — Flowchart showing crosses and progeny in P element complementation experiments. Offspring were scoredfor presence or absence of Sb phenotype.  53  In addition, when possible, these strains were tested for suppressor phenotype in a w  m4  background. The offspring of the above cross were scored for eye colour as well as  viability. In many strains, however, the P element had been tagged with a white+ gene, and the presence of the w+ allele in a w  m4  strain masks any eye colour phenotype. For  some, however, the expression of the P element mini-white was low enough to produce only an orange background colour. In these strains, I was able to differentiate this background colour from the expression of the native white+ gene, which still produced the fully red colour.  None of the 58 P element induced mutations that I tested (table 3.2.1), nor any of the 9 known genes (table 3.2.2) were lethal with Su(var)3-8. Since both this mutation and the P element mutations tested are recessive lethal, they should be lethal over one another if the P element mutation is an allele of Su(var)3-8.  O f the 58 P element mutations tested, I was able to examine 17 for their ability to suppress P E V . Five, 1(3)1782 (P279), 1(3)15340 (P279), l(3)s2149 (P2132), l(3)s078514 (078514) and l(3)19313b (119313) were able to suppress P E V (table 3.2.3). The flanking genomic sequences were run through Blast search. 1(3)1782 is an allele of effette, a ubiquitin conjugating enzyme. l(3)L5340 was 96% similar to trithorax, is a homeotic gene whose effects on chromatin structure have been well noted (reviewed in Ingham, 1998). The third, l(3)s2149, is 99% similar to a lipase gene, Lip3. The other strains to show suppressor effects were l(3)s078514 and 1(3)119313b. The flanking D N A has not been sequenced for these insertions, and so it was not possible to run a Blast search on these genes. This region of the genome to which l(3)s078514 has been localized (88A1-5)  54  contains 12 genes, including 4 unkown genes, 2 transcription factors and one phosphotase. The region containing 1(3)119313b (88B) contains 26 genes, including 12 unknown genes, 2 transcription factors and one DNA-binding gene.  Any of the four unidentified genes may make a good candidate for cloning and testing further for suppressor effects in future studies. Complementation assays between these alleles and Su(var)s created in other screens (such as that performed by our group which resulted in, among others, Su(var)3-8) would determine whether any of these is an allele of a previously described Su(var) gene.  55  Table 3.2.1 —P element-containing strains that were testedfor lethality when transheterozygous with Su(var)3-8. Viability is shown as a percentage relative to expected values based on a 1:1:1:0 ratio ofPelement/TM3Sb: Su(var)3-8/TM3Sb:Pelement/Su(var)3-8:TM3Sb/TM3Sb. Values for P element/TM3Sb and Su(var)3-8/TM3Sb are pooled, as they are phenotypically indistinguishable (stubble). In some cases, male andfemale offspring were not segregated during the scoring process, and so the results are pooled.  Su(var)3-8 Location  87D01-E12 87D07-09 87D10-11 87D101-02 87E 87E 87E 87E 87E 87E05-06 87E07-08 87E10-11 87E4-12 87E5-10 87E8-12 87F 87F 87F 87F 87F 87F03-04 87F07-08 87F07-08 87F1-3 87F10-11 87F10-15 87F10-15 87F3-10  P element  % via  P276 P1590 P1551 P2130 026316 059706 061617 108310 113105 P245 P1648 P2132 059705 008131 101804  150.0% 125.4% 106.7% 132.6% 120.0% 111.9% 108.7% 116.1% 119.6% 93.6% 118.4% 95.7% 131.3% 90.8% 98.5% 117.2% 102.1% 141.2% 168.4% 110.0% 104.0% 167.8% 88.0% 97.1% 89.5% 105.5% 142.4% 111.8%  008614 011004 029910 106414 129510 P2134 P252 P265 130313 P1630 011041 102910 090417  IP  element males  Su(var)3-8 / P element females  P-element/TM3Sb and Su(var)3-8/TM3Sb males  28 140 117 38 26 13 24 19 20 27  28 195 212 48 24 12 26 29 35 22  40 16 35 30 38 55  35 49 19 34 29 34 38 19 16 11 18  64 48 41 62 38 54 27 14 29 29 10  60 24 21 14 33 21 30 26 13 6 24 15  35 26 53 46 45 53 92  56  62 42 35 75 40 70 45 11 9 37 16 135  13  18 37  17 44 16  P-element/TM3Sb and Su(var)3-8/TM3Sb females  28 87  15 50 25  21 49 36  38 55 33  56  Table 3.2.1 continued -P element-containing strains that were testedfor lethality when transheterozygous with Su(var)3-8. Viability is shown as a percentage relative to expected values based on a 1:1:1:0 ratio ofP element/TM3Sb: Su(var)3-8/TM3Sb:Pelement/Su(var)3-8:TM3Sb/TM3Sb. Values for P element/TM3Sb and Su(var)3-8/TM3Sb are pooled, as they are phenotypically indistinguishable (stubble). In some cases, male andfemale offspring were not segregated during the scoring process, and so the results are pooled. Su(var)3-8  Location  p element  % via  88A 88A 88A 88A 88A1-2 88A1-2 88A1-5 88A1-5 88A4-8 88A6-12 88B 88B 88B 88B01-02 88B01-02 88B05-09 88B1-2 88B1-2 88B1-3 88B1-3 88B3-6 88B3-6 88C01-04 88C01-10 88C09-11 88D01-02 88D01-02 88D05-06 88E03-04 88E11-12  024535 102702 125011 146607 086909 101206 067101 078514 059613 041316 118602 119313 132703 P2136 P279 139308 051007 092708 091014 132304 000721 147913 P1709 P278 P281 P1567 P1605 P1743 P286 P290  110.3% 120.0% 111.8% 104.0% 94.0% 109.8% 102.9% 91.9% 133.7% 97.1% 92.6% 85.9% 121.3% 125.5% 73.8% 116.5% 110.5% 63.2% 142.4% 115.4% 167.4% 71.1% 92.3% 132.5 158.3% 127.9% 89.6% 171.8% 82.3% 104.0%  element males  Su(var)3-8 / P element females  P-element/TM3Sb and Su(var)3-8/TM3Sb males  P-elemem7TM3Sb and Su(var)3-8/TM3Sb females  9 7 20 11 14 42 11 18 39 12 13 17 15 24 6 15 15 7 9 33 22 15  23 3 21 15 12 40 13 31 35 21 16 44 21 22 9 18 20 1 19 37 26 12  20 6 31 30 27 71 24 54 45 34 32 83 25 27 19 25 30 20 14 51 20 42  35 9 38 19 30 71 22 57 47 35 33 69 28 37 27 27 30 10 17 61 18 45  / P / r  12 68 28  29  24  55 60 33 6 11  27 86 27 74 141  30 11 15  23 23 25  24 22 24  57  Table 3.2.2 - Previously identified genes in area 87E to 88D, testedfor complementation with Su(var)3-8. Viability is shown as a percentage relative to expected values based on a 1:1:1:0 ratio ofgene/TM3Sb: Su(var)3-8/TM3Sb:gene/Su(var)3-8:TM3Sb/TM3Sb. Values for gene/TM3Sb and Su(var)3-8/TM3Sb are pooled, as they are phenotypically indistinguishable(stubble). In some cases, male andfemale offspring were not segregated during the scoring process, and so the results are pooled.  Location  Gene  % via  Su(var)3-8 / mutant males  88C09  put  146.3%  88D2 87F6 88A3  eff sqd k43y4  92.6% 101.4% 110.2%  23 37  88B1  l(3)88Ac  79.6%  17  87F12-15  urd  111.6%  69  88A4-5 87E1-F11  mei-P19 yrt  81.0%  24  81.4%  88A2  ems  98.1%  Su(var)3-8 / mutant females  mutant/TM3Sb and Su(var)38/TM3Sb males  22 27  44 49  60 24  mutant/TM3Sb and Su(var)38/TM3Sb females  63  57  78  59 49 84  26 62  63 106  56 115  20 11  67  8  27  52 24  18  16  22  48  58  Table 3.2.3 -. P elements testedfor suppressor effect. P element/TM3 and Su(var)3-8/TM3 were scoredfor suppressor effects on wm4. Males are w /Y, females are w /w . Pigmentation was scored visually. Greater than 10% pigmentation was scored as suppressed, less than 10% pigmentation as mottled. Percentage in table indicates percentage of individuals presenting suppressed phenotype; the number in brackets indicates number of individuals scored. Since data is pooledfor P element/TM3 and Su(var)3-8/TM3, at least half the population is expected to be suppressed. Strains in which more than 90% of the pooled population was suppressed were considered potential suppressors. m4  m4  m4  P element  000721 092708 059705 p2132 p2134 132304 p245 119313 078514 108310 011004 130313 051007 p2136 p279 p286 p290  % suppressed (total scored) male  82.4% 53.3% 54.2% 100.0% 55.2% 35.1% 56.4% 93.3% 100.0% 61.9% 84.6% 40.0% 54.2% 61.1% 100.0% 91.3% 60.0%  female  (17) (15) (48) (64) (29) (37) (55) (30) (24) (21) (26) (10) (24) (18) (15) (23) (25)  77.3% 75.0%o 61.0% 100.0% 62.2% 56.5% 64.2% 78.4% 100.0% 54.8% 75.7% 57.1% 82.6% 76.0%  (22) (8) (41) (62) (37) (46) (53) (37) (30) (31) (37) (14) (23) (25) (0) (0) (0)  59  3.3 - Mapping I was unable to find any strains oi Drosophila that had a P tagged mutation of Su(var)3-8. Therefore, I attempted to delimit the area in which the gene is located. If the location of this gene can be pinpointed to a small enough area, it may be possible to survey all Open Reading Frames (ORFs - lengths of D N A between a start and a stop codon, which may be transcribed by transcription machinery) in the area. Candidate ORFs could then be tested for ability to rescue the mutant phenotype (that is, restore wild-type function) by injecting a plasmid expressing the O R F into mutant embryos (as described in Driever et al). Alternatively, the Su(var)3-8 gene might be "tagged" by a P element "local hop" (Tower et al, 1993); that is, mobilizing a P element insert residing near the Su(var)3-8 gene and having it insert into the Su(var)3-8 locus.  Previous studies have been performed to localize 3-8. The first of these was a recombination study performed by Reuter in 1986. He found that Su(var)3-8 localized to 53.5 map units along the 3  rd  chromosome. This places the gene near, and to the left of,  the red gene (53.6). Cytologically, Kwon (unpublished) has shown the mutant gene to be lethal with deficiency Df(3R)Tp(3;Y)ry506-85c, which encompasses the area from 87D12 to 88E5-6. Figure 3.3.1 shows a best-fit combination of both cytological and recombinant maps based on the positions of known genes in the area.  Within this large deficiency (ry506-85c), I was able to acquire from Bloomington a number of smaller deficiencies further subdividing the area (figure 3.3.2). I tested these deficiencies for complementation of the Su(var)3-8 gene, as well as testing overlapping deficiencies for complementation to each other. In all cases, I was scoring for the  60  presence of the markers from the balancer chromosome, the absence of which would indicate a transheterozygous offspring.  47 48 I L  49  51  50  52 53  54  55  I  knk  85a 85c  85d  8se  86d  86a 86c  red  87D9  86f  86e  88C2  53.6  ry  86D3-4  8sf 86b  cv-c  87E2-3  52.0  cu  85D8-E13  85B4  85b  87C5  50.0  sic  osk  54.1  kar Ace  48.8 85F10  48.4  52.5  5,1-7  49.1  87b  87a  87a  87c  7  88B1-2  87J  87e  544  wrl  88C2-D6  88b 88d  88a 88c 88e  Figure 3.3.1 -Map combining published cytological and recombination data for known genes in the area from 3-47 to 3-56. All data from flybase.bio.indiana.edu  62  87d  87e  87f  88a  88b  88c  88d  iiiOTjjjjirBnnnT! n! u J I:I IJIIJ IIJ I J J i IT I mm Hffln i n! ifniiTTHriifH  •  Df(3R)iy6i5/TM ShSer  Df( R)|§§TbTM6 Df( R)redP52/TMi,Me  Df(3R)ry27,Dfd,cu,kar/MKRS  Df(3R)red l/TM6Tb  3  3  3  3  Df( R)i26c,kar/MKRS 3  l)f(3r)sii(Hw7)/TM6B,Tb DH3R)uid/rM3SbSer Df(3R)redl/TMi  Figure 3.3.2- Map of deficiencies for area 87d to 88e. Endpoints for each deficiency listed at flybase.bio.indiana.edu  I retested the deficiency Df(3R)Tp(3;Y)ry506-85c  for complementation with  Su(var)3-8 and found that indeed this aberration is lethal (table 3.3.1, a). Because of the translocation of the deficient area to the Y chromosome, only female flies should be fully deficient for the region, and therefore lethal. These results did not contradict the previous study (table 3.3.1, b). In both studies, Def/TM3Sb and Su(var)3-8/TM3 pooled phenotypes are lower than the expected ratio. This is likely due to weakness of the Def/TM3Sb mutant, containing both a large mutation and numerous inversions along the third chromosome. It would appear, given this data, that Su(var)3-8 is non-complementary with Df(3R)Tp(3;Y)ry506-85c, leading us to predict its location as being within the boundaries 87E to 88E.  None of the subset of deficiencies proved to be lethal with the gene (table 3.3.2). There remains a small area for which no deficiencies were available (88c-88e, fig 3.3.2), but this fell to the right of the gene red (88B1-2); Reuter's studies had indicated that Su(var)3-8 was situated left of red. The deficiencies were also tested against each other, to check if they indeed covered the entire area (figure 3.3.3). The grey line shown in figure 3.3.3 indicates an uninterrupted length of deficiencies; that is, deficiencies shown to overlap are non-complementary. This negates the possibility of the gene lying within a small, uncovered gap between deficiencies.  Previous studies have looked at the effects of each of these deficiencies on lethal point mutations. I have used this data (amalgamated at flybase.bio.indiana.edu) to better position the deficiencies with respect to each other and the overall map (figure 3.3.4). The possibility that any single deficiency may in fact be a set of small deficiencies  64  Table 3.3.1 - Deficiency Df(3R)Tp(3;Y)ry506-85c/TM3SB complementation testing with Su(var)3-8. Deficiency males were crossed to Su(var)3-8/TM3Sb females. Progeny were scored according to marker allele Sb on the balancer chromosome. Males carry the 3 chromosome deficient region as a transposition on the Y chromosome, and are therefore not expected to be lethal. % Expected viability determined according to expected ratio of 1:1:1:0 for Def/3-8:Def/TM3Sb:3-8/TM3Sb:TM3Sb/TM3Sb. Weakness of the Def/TM3 phenotype resulted in a higher ratio Def/3-8 than expected, and so a percentage higher than 100. A) Cross done by Carvalho. B) Cross done by Kwon (unpublished). rd  Def/TM3Sb AJ B)  ry506-85c ry506-85c  Def/3-8 males  Def/3-8 females  3-8/TM3Sb & Def/TM3Sb males  3-8/TM3Sb & Def/TM3Sb females  51 144  1 0  27 38  37 143  % exp viability 134.5% 132.9%  65  Table 3.3.2 - Deficiencies crossed with Su(var)3-8/TM3Sb. (A) Progeny were scored according to markers Ly and Sb. % Expected Viability determined according to expected 1:1:1:1 ratio ofDef/3-8: 3-8/Ly: Def/TM3Sb: TM3Sb/Ly. (B) Progeny were scored according to the Sb marker on the balancer chromosome. % Expected Viability determined according to expected 1:1:1:0 ratio of Def/3-8: 3-8/TM3Sb: Def/TM3Sb: TM3Sb/TM3Sb. Weakness of the Def/TM3 phenotype resulted in a higher ratio Def/3-8 than expected, and so a percentage higher than 100. In some cases, male andfemale offspring were not segregated during the scoring process, and so the results are pooled * Df(3R)ea is marked with Ser; SbSer and Ser flies were pooled.  (A)  Def/Ly  Def/3-8 Def/3-8 3-8/Ly males males females  redl redp52 red3l Su(Hw)7  Def/TM3Sb ry615 ea* 126c 97 urd ry27  70 45 26 15  56 39 25 29  57 46 16 18  Def/3-8 males  Def/3-8 females  31 28 43 22  48 34 33 25  j 42 64  I  3-8/Ly females 81 47 24 21  Def/TM3 Def/TM3 Ly/TM3 Ly/TM3 % exp males females males females viability 40 25 20 18  3-8/TM3Sb & Def/TM3Sb males  3-8/TM3Sb & Def/TM3Sb females  71 35  41 37 59 31  49 32 64 78  53 28 21 29  66 35 36 20  57 30 29 24  %exp viability 124.1% 138.8% 123.9% 128.2% 118.9% 135.2%  66  105.0% 113.9% 103.6% 101.1%  iy506-85C  Figure 3.3.3 - Map showing overlapping deficiencies. Complementation between deficiencies and point mutations tested by: a)Gausz et al, 1981 eJGreen et al, 1990. Complementation between deficiencies scored by markers on balancer chromosomes, the absence of which indicates transheterozygosity. 6) 0 transheterozygotes /97 heterozygotes c) 0 / 31 d) 0 / 49.  67  a b  c d e f  b  c  d  gh  e  i j  k  l m n o p q r s t  op q  h  Y7  ry6l5 h  i j  k  1 m op q  126c  d  f  u  r  Su(H\v)7 r  s t  u  red3l  gh  p q  1727  r  s  redP52  urd  n  0  redi  Figure 3.3.4 — Figure of Deficiencies and non-complementary Point mutations. All data from flybase.bio.indiana.edu (a)l(3)87Bk (b)Arp87c (c)l(3)87Cd (d)l(3)87Db (e)CtBP Wry (g)pic (h)Ace (i)l(3)05137 (j)l(3)87Eg (k)sqd (1)1(3)04449 (m)urd (n)Nsf2 (o)ems (p)Orc2 (q)meiP-19 (r)RplI140 (s)trx (t)spn-B (u)l(3)06951  68  containing gaps, or even an inversion deficient only at its ends, is illustrated to be highly unlikely. Redundancy of point mutations among the deficiencies also supports the finding that these deficiencies overlap.  I also tested five of these point mutations, as well as a few others in the area, for complementation with  Su(var)3-8 (table 3.2.2). None of these mutants fails to  complement 3-8, indicating that 3-8 is not among any of these previously identified genes.  This data indicates that the 3-8 gene lies between 88C3 and 88E6, the only area deleted by Df(3R)Tp(3;Y)ry506-85c (figure 3.3.3), but not by any other tested deficiency. This region, however, falls to the right of the red gene. This is in direct contradiction to the data obtained by Reuter in 1986. Unfortunately, there are no available deficiencies within this region to test.  There are two possible explanations for these results:  1) The 3-8 gene is actually to the right of the red gene, and Reuter's original recombination cross was in error. To test this theory, I repeated the recombination mapping, this time using genes  cross-veinless (cv-c 3-54.1) and stubbloid (sbd 3-58.2) as  markers. The results are detailed on page 71.  2) The large deficiency, Df(3R)Tp(3;Y)ry506-85c, is not truly deficient with Su(var)3-8. Lethality is a result of loss of such a large area, making flies so weak that any other aberration causes lethality. This would indicate that the gene  Su(var)3-8 is not  actually localized between the boundaries of Df(3R)Tp(3;Y)ry506-85c, but possibly  69  somewhere to the left of this deficiency. To test this, I looked at Df(3R)Tp(3 ;Y)ry506-85c viability when placed over a lethal point mutation not lying within its boundaries. The results are detailed on page 75.  70  1) Recombination Mapping  If the 3-8 gene were truly located where the deficiency map indicated (88C-E), this location would contradict Reuter's (1986) map, which had mapped this locus to position 3-53.5+/-0.9, immediately left of red, at 88B2 (3-53.6). To determine whether the Reuter map was indeed correct, I decided to map 3-8 recombinationally myself, using crossveinless-c  (3-54.1) and stubbloid (3-58.2) as markers (figure 3.3.5). While not  entirely accurate in determining exact distances between genes, recombination mapping is reliable for determining order of genes along a chromosome, and accurate enough for general distances. It can also serve as a reliable tool to discern whether the lethal and Suppressor phenotypes are one and the same.  Mapping both the suppressor and the lethal phenotypes (table 3.3.3), I found that Su(var)3-8  mapped significantly further to the left of where Reuter had mapped it (figure  3.3.6).The gene was mapped to 49±0.8 map units along 3 chromosome. Directionally, rd  this supports Reuter's data that places 3-8 to the left of red. However, it appears to be further left than he had originally calculated, in an area not yet tested by deficiency mapping.  This recombination data is concurrent with the lethal and suppressor phenotypes being alleles of the same gene, as both phenotypes mapped to the same location. For this reason, testing of either phenotype can be pursued in the attempts to locate this gene.  71  m4 m4  A  X m4  v  m4 .m4  Y  \ m4  Su{var)3-8 TM3Sb  m4  +  Su  cv-c  -»  cv-c sbd t-y  rr>4  sbd +  in 4  w w /Y  +- cv-c sbd  cv-c sbd cv-c sbd  w+  Ly  TM3  +  cv-c sbd Ly  various cv-c sbd  -t- + +  Su + +  Su cv-c +  + + sbd  Su + sbd  Su cv-c sbd  Ztoxi-ttiiiUxt, ttafiMyiJ  * cv-c:+  B  m4 m4  w  *-y  m 4  Y  TM3  m4 'm  Su cv-c sbd • cv-c sbd  nrt4  w  4  Su cv-c sbd Y  vv  V  ry  * cv-c sbd  + **  * cv-c +  + +sbd  SU  various CV-C  '  Ly  '  Sbd  Su * +  Su cv-c + /**&)/'  ,Su+-'iS bd :  Su cv-c sbd  mppnxiid stn$6foiJ  Figure 3.3.5 - Flowchart showing crosses and progeny in recombination experiments. A) Recombination between Suppressor phenotype and markers. B) Recombination between lethality phenotype and markers.  72  Table 3.3.3 - Recombination ofSu(var)3-8 with cross-veinless and stubbloid markers. Total number of offspring in each genetic class is shown, mapping both A) suppressor and B) lethality phenotypes. Total refers to number of offspring scored across all classes ofphenotypes. C) distances between markers. Calculations not shown, statistics according to Fisher, 1946. Known locations are: cv-c (3.54.1) and sbd (3-58.2).See Appendix B for calculation of standard error.  Suppressor  A  cv sbd +  + + Su  cv + +  + sbd Su  874  966  39  24  5  cv sbd  ++  cv +  + sbd  Total  447  28  14  0  489  + sbd +  cv + Su 5  + ++  cv sbd Su  Total  65  44  2022  Lethality  B  c  cv - sbd Su - cv Su - sbd  Supp  Leth  3.1 ±0.4 5.4 ± 0.5 9.0 ± 0.6  2.9 ±0.8 5.7 ± 1.1 8.6 ± 1.3  73  c 47  48  R  49  osk sic knk  51  cu  53  k a r  ry  A  w  54  r e d  55  cv-c trx Su(Hw)  56  57  Su(var)3-9  58  59  Sb  ems wrl  Figure 3.3.6- Genetic map of locations of various markers in region 3-47 to 3-59. Includes cross-veinless and stubbloid, which were used to determine the location of Su(var)3-9.R indicates where Reuter localized Su(var)3-8, C indicates the location I determined.  74  2) Df(3R)Tp(3; Y)ry506-85c tested against other Point Mutations The results of the recombination mapping leaves only the second possibility, that is that Su(var)3-8 does not actually lie within the boundaries of Df(3R)Tp(3;Y)ry506-85c. To test this theory, I looked at Df(3R)Tp(3;Y)ry506-85c viability with Ly and Me, as well as at previous studies that looked at the effects of this deficiency on point mutations CoVa (86F9) and l(3)S026409 (85D14-18).  A s can be seen in table 3.3.4, the viability of Df(3R)Tp(3;Y)ry506-85c female transheterozygotes is decreased even when combined with point mutations not within the published boundaries of the deficiency, such as Me and Ly. Also, previous studies have found this deficiency to disrupt at least two other genes, CoVa and l(3)S026409, which are not within the boundaries (flybase.bio.indiana.edu). It is unknown whether females only, or both males and females, were lethal in the case of these two genes.  These results lead me to conclude that Df(3R)Tp(3;Y)ry506-85c was not in fact lethal when heterozygous with a Su(var)3-8 mutation. I believe the inviability seen was due instead to the additive effects of a large deficient region and the dominant mutation.  75  Table3.3.4 - Df(3R)Tp(3 ;Y)ry506-85c testedfor complementation with point mutations outside of the region it deletes (Ly: 3-40.5, Me: 3-19.2). % Expected viability is calculated according to an expected ratio of 1:1 males.females and A) 1:1:0:1 Def/ry506-85c:ry506-85c/Me:Def/TM3Sb:Me/TM3Sb; B) 0:1:1:1 Def/ry506-85c:ry50685c/Ly:Def/TM3Sb:Ly/TM3Sb; C) 1:1:0:1 ry506-85c/TM3Sb:ry50685c/Ly: TM3Sb/TM3Sb:Ly/TM3Sb.  B  Def/Me  Df/506 males  Def/506 females  506/Me males  506/Me females  Def/TM3 males  redP93  17  5  13  1  0  Def/Ly  Df/506 males  Def/506 females  506/Ly males  506/Ly females  0 10 0  0 2 0  7 14 4  MT" , males  506H-M3 females  12  2  redp52k red3l 5  L.V/TM3  ^  Me/Sb males  Me/Sb females  0  6  13  Def/TM3 males  Def/TM3 females  Ly/TM3 males  Ly/TM3 females  0 5 5  7 4 5  5 9 5  0 8 8  1 2 7  506/Ly males  506/Ly females  TM3/TM 3 males  Ly/TM3 males  Ly/TM3 females  16  2  0  ™*™» , . females  3  9  3  . , females  0  % expected viability of Def/PM  males  fern  141.8  10.9  210.0 155.6 70.6  0.0 55.6 88.2  218.2  1.0  76  Further Deficiency Mapping Only one deficiency, Df(3R)Tp(3;Y)ry506-85c, was found to be lethal with Su(var)3-8 mutation; smaller deficiencies that overlapped within the borders of this deficiency were all complementary to the gene. The only area of the large deficiency not uncovered by smaller deficiencies lay to the right of the red gene, however my recombination mapping confirmed that the Su(var)3-8 gene is indeed to the left of red. This leaves the possibility that Su(var)3-8 is in fact not truly within the boundaries of Df(3R)Tp(3;Y)ry506-85c and perhaps the observed lethality of Su(var)3-8I Df(3R)Tp(3 ;Y)ry506-85c results from an additive effect of the dominant mutation and monosomy for a sizable region of the genome rather than failure to complement. This has been shown to be likely by the semi-lethality Df(3R)Tp(3;Y)ry506-85c shows with other mutations not contained within its boundaries.  The recombination data places Su(var)3-8 at 3 - 4 9 ± 0 . 8 . From Figure 3.3.1, this appears to be closer to the cytological position 85C. Four new deficiencies in this area were tested for complementation with Su(var)3-8 (Figure 3.3.7). From Table 3.3.5, it is clear that all of these deficiencies complemented the gene.  Two gaps in the segment from 85a to 87e remain undisturbed by tested deficiencies, encompassing a total of 47 bands, or approximately 1645Kb. According to sequencing data, this includes 128 ORFs that have been determined to be potential genes. While this is too many to individually test, more deficiencies may be created in this area in the future, allowing for more precision.  77  85a 85b 85c MllillfflilHiM  85d  85e  85f  86a 86b 86c 86d  Ui!!ii;;ililJil! iliiiiiiiiiiiiiiiiiiyiiiiLiiiiiJi l!iii!ll|[>llli!lill!lllillll!!;!liill!l!ll!!!OllilH  86e 86f 87a 8?b 87<87d  87e  87f  !|!i[!:illl!l!lJ!illll!il!llillliHlil!iil :l>lll|i;illi!lllll!ll!ll!llll!;:i;i!:iilll T-io  nil  Figure 3.3.7 — Map of deficiencies in contained in the region 85a to 87f. This is the region Su(var)3-8 is now suspected to be located, based on data from recombination experiments.  78  Table 3.3.5 — Deficiencies testedfor complementation with Su(var)3-8. Progeny were scored according to presence or absence of the marker gene Sb. Expected Viability of transheterozygotes is calculated according to expected ratio of 1:1:1:0 of Def/3-8: 3-8/TM3Sb: Def/TM3Sb: TM3Sb/TM3Sb Su(var)3-8/TM3Sb Su(var)3-8/TM3Sb & Def/TM3Sb & Def/TM3Sb males females  Deficiency  Su(var)3-8/Def males  Su(var)3-8/Def females  m-Kx1 PxT103 by 10  7 14 13  6 12 12  15 20 15  T-10  12  13  15  total  % exp via  12 15 16  40 61 56  98% 128% 134%  15  55  136%  79  4. Conclusions In these experiments, I set out to clone a suppressor of variegation, in the hopes of some progress in understanding chromatin-based gene silencing. Su(var)3-8 seemed an ideal candidate for this, as it is a strong dominant suppressor, as well as being recessively lethal. In addition, there were available to me a variety of genetic tools which I believed would help me localize and clone this Su(var).  Reversion As alleles of Su(var)3-8 had been isolated during a P element mutagenesis screen, my first approach was to determine whether any of these still contained a P element. I attempted to revert the mutation back to wild-type by mobilizing the P element, an event which would only occur if a mobile P element were the source of the mutation. I also performed Southern Analysis tests, to determine whether any immobile P elements remained in the genome. Of the five Su(var)3-8 alleles created in a P element screen, none were found to revert. It is concluded that, even if a P element remains in the gene, it is immobile. Southern analysis has shown that there is no visible P element remnant in the lines. While this cannot conclusively rule out the possibility of small portions of elements remaining, even if such still exist in the lines, they appear to be incapable of movement.  In light of this, no further progress can be achieved by additional experimentation in cloning this gene using P elements from these lines.  80  Complementation Testing with P element Mutations  The second approach I took was to test P element-induced lethal mutations in essential genes in the area. As postulated by Mottus (2000), it is possible that a P element induced mutation in a Suppressor gene may cause a recessive lethality, while not presenting a dominant Su(var) phenotype. 58 P element induced mutations in the region were tested for complementation with Su(var)3-8, as well as 9 known genes in the area.  O f the 58 P element containing strains and 9 known genes tested for complementation to Su(var)3-8, none were found to be lethal when homozygous with Su(var)3-8. P element mutation in the area 85-86 were not tested, as indications at the time of testing were that Su(var)3-8 was located somewhere in the region 87E8 to 88B2. Later experiments, however, indicate that the gene likely lies in further left than this, probably in the area 85C-86B, and testing of P tagged mutations in this area should follow.  Mapping  Unable to find a P tagged allele of this gene, I chose to attempt to localize it as precisely as possible, using deficiencies and marker genes in the area. If the area in which the gene lies can be narrowed down to a few open reading frames, it may be possible to determine the correct one using plasmid rescue.  Previous work had shown Su(var)3-8 to be lethal with deficiency ry506-85c; upon repeating this cross, I came to the same conclusion. However, when 8 deficiencies blanketing the area were tested, all were viable over Su(var)3-8, indicating that the  81  lethality with ry506-85c was artificial, as determined by recombination mapping and further testing of ry506-85c.  Recombination experiments have determined the Su(var)3-8 gene to be some distance left of cross-veinless c, although accurate locations and distances may be disputed. As cross-veinless c is deleted by one of the deficiencies tested, the recombination data rules out the possibility of the gene lying further right than these deficiencies cover.  I tested ry506-85c for lethality with mutations in other areas, and found a reduced viability even with these unrelated genes. This led me to reconsider the location of Su(var)3-8, believing that it may not in fact be located within the boundaries of this deficiency. I tested deficiencies reaching left from this area, extending as far as approximately 3-49 (the location of Su(var)3-8 according to the new recombination data). None of these new deficiencies were found to be lethal with Su(var)3-8; however, the area was not completely covered by deficiencies; there were gaps. Unfortunately, this is too large an area for plasmid rescue testing, as there are approximately 128 ORFs to test within these gaps. Further localization would be necessary, either by searching for more deficiencies created during other, future experiments, or by creating these deficiencies inlab.  82  Future Work The most promising line of experimentation for this gene is still testing P element-containing strains for allelism to Su(var)3-8. While present work has been unsuccessful, new strains are frequently being made the world over, and there is a high likelihood that one of these new strains will have a P element inserted into the Su(var)3-8 locus. Once found, this strain can be used for rapidly sequencing the gene, a first step to understanding its inherent function.  Future researchers should test P elements available in the area 85-86. These P elements were not tested during the course of these experiments, but new data now places Su(var)3-8 in this region.  The location of Su(var)3-8 can now also be further delineated via recombination mapping using genes flanking the area determined to house 3-8 (such as polychaetoid at 48.1 and curled at 50.0). Candidate genes, in addition to P element mutations, falling within the region defined by these new, closer markers should then be tested for allelism  to Su(var)3-8.  83  Appendices Appendix A: Statistical Analysis of Reversion of Lethality experimental results. X = E!ozef 2  where o = observed frequency e = expected frequency  v= 1  P ( X > 1.323) = 0.25 2  P ( X > 2.706) = 0.10 2  P ( X > 2.706) = 0.10 2  P ( X > 3.841) = 0.05 2  P Oc > 5.024) = 0.025 2  P(l >  6.635) = 0.01  2  Ho: The sample comes from a population with a 0.4% reversion rate. Ha: The samples comes from a non-revertant population.  5A4 x = L406  0.10<P<0.25  5A5 x = 2.058  0.10<P<0.25  5B3 x = 1.666  0.10<P<0.25  5B4 x = 2.404  0.10<P<0.25  2  2  2  2  Ho: The sample comes from a population with a 1 % reversion rate. Ha: The samples comes from a non-revertant population.  5A4 x = 3.465  0.05<P<0.1  5A5 x = 5.182  0.01<P<0.025  5B3 x = 4.192  0.025< P O . 0 5  5B4 x = 6.061  0.01<P<0.025  2  2  2  2  Appendix B: Statistical Analysis of Recombination mapping experimental results.  r = # recombinants n Recombination Frequency = r* 100 rd-r) SE =  V  n  where n = sample size  Suppression c v - s b d =3.1 ± 0 . 3 9 S u - c v = 5.4 ± 0 . 5 0 S u - s b d = 9.0 ± 0 . 6 4  Lethality c v - s b d = 5.7 ± 1.10 S u - c v = 2.9 ± 0 . 7 6 S u - s b d = 8 . 6 ± 1.27  Bibliography  Baksa, K . , Morawietz, H . , Dombradi, V . , Axton, M . , Taubert, H . , Szabo, G . , Torok, I., Udvardy, A . , and Gyurkovics, H . , 1993. Mutations in the protein phosphatase 1 gene at 87B can differentially affect suppression of position-effect variegation and mitosis in Drosophila melanogaster. Genetics 135:117-125. Berger, S.L., 2001. The Histone Modification Circus. Science 292:64-65. Berger, S.L.and Felsenfeld, G . , 2001. Chromatin goes Global. Molecular Cell 8:263-268. Bienz, M . and Muller, J., 1995. Transcriptional silencing of homeotic genes in  Drosophila. BioEssays 17:775-784. Cook, K . R . and Karpen, G . H . , 1994. A rosy future for heterochromatin. Proc. Natl. Acad. Sci. U S A 91:5219-5221. Csink, A . K . , and Henikoff, S., 1996. Genetic modification of heterochromatic association and nuclear organization in Drosophila. Nature 381:529-531. Deak, P., Omar, M . M . , Saunder, R.D., Pal, M . , Komonyi, O., Szidonya, J., Maroy, P., Zhang, Y . , Ashburner, M . , Benos, P., Savakis, C , Siden-Kiamos, I., Louis, C , Bolshakov, V . N . , Kafatos, F . C . , Madueno, E . , Modolell, J., and Glover, D . M . , 1997. P-element insertion alleles of essential genes on the third chromosome of Drosophila melanogaster: correlation of physical and cytogenetic maps in chromosomal region 86E-87F. Genetics 147:1697-1722. Dorn, R., Krauss, V . , Reuter, G . , and Saumweber, H . , 1993. The enhancer of positioneffect variegation of Drosophila, E(var)3-93D, codes for a chromatin protein containing a conserved domain common to several transcriptional regulators. Proc. Natl. Acad. Sci U S A 90:11376-80. Driever, W . , M a , J., Nusslein-Volhard, C . and Ptashne, M . , 1989. Rescue of bicoid mutant Drosophila embryos by bicoid fusion proteins containing heterologous activating sequences. Nature 342:149-154. Eggleston, W . B . , Johnson-Schlitz, D . M . , and Engels, W.R., 1988. P - M hybrid dysgenesis does not mobilize other transposable element families in D. melanogaster. Nature 331:368-370. Elgin, S.C., and Jackson, S.P., 1997. Chromosomes and expression mechanisms. Curr Opin Genet Dev. 7:149-51.  86  Engels, W.R, 1984. A trans-acting product needed for P factor transposition in Drosophila. Science 226:1194-6. Engels, W.R., Preston, C.R., Thompson, P. and Eggleston, W.B., 1989. In situ hybridization of Drosophila polytene chromosomes with digoxigenin-dUTPlabeled probes. Trends Genet. 5:366. Engels, W.R., Johnson-Schlitz, D . M . , Eggleston, W . B . , and Sved, J., 1990. Highfrequency P element loss in Drosophila is homolog dependent. Cell 62:515-525. Gartler, S.M., Dyer, K . A . , and Goldman, M . A . , 1992. Mammalian X Chromosome Inactivation. In "Molecular Genetic Medicine" (Friedmann, T., ed) V o l 2 pp 121160. Academic Press, Inc., San Diego, California. Gausz, J., Gyurkovics, H . , Bencze, G . , Awad, A . A . M . , Holden, J.J., Ish-Horowicz, D . , 1981. Genetic characterization of the region between 86F1,2 and 87B15 on chromosome 3 of Drosophila melanogaster. Genetics 98:775-789. Green, L . L . , Wolf, N . , McDonald, K . L . , Fuller, M . T . , 1990. Two types of genetic interaction implicate the whirligig gene of Drosophila melanogaster in microtubule organization in the flagellar axoneme. Genetics 126:961-973. Grigliatti, T . A . , 1991. Position Effect Variegation - an assay for nonhistone chromosomal proteins and chromatin assembly and modifying factors. Methods in Cell Biology 35:587-627. Hari, K . L . , Cook, K . R . and Karpen, G . H . , 2001. The Drosophda Su(var)2-10 locus regulates chromosome structure and function and encodes a member of the PIAS protein family. Genes and Devel. 15:1334-1348. Hartmann-Goldstein, I.J., 1967. On the relationship between heterochromatization and variegation in Drosophila, with special reference to temperature-sensitive periods. Genet Res. 10:143-59. Hayashi, S., Ruddell, A . , Sinclair, D . and Grigliatti, T. Chromosomal structure is altered by mutations that suppress or enhance position effect variegation. 1990 Chromosoma 99:391-400. Hertz, L . , Hansson, E . and Ronnback, L . , 2001. Signaling and gene expression in the neuron-glia unit during brain function and dysfunction: Holger Hyden in memoriam. Neurochemistry International 39:227-252. Horn, P.J. and Peterson, C . L . , 2002. Chromatin Higher Order Folding: Wrapping up Transcription. Science 297:1824-1827.  87  Ingharn PW. 1998. Trithorax and the regulation of homeotic gene expression in Drosophila: a historical perspective. International Journal of Developmental Biology. 42:423-9. Johnson-Schlitz, D . M . , and Engels, W.R., 1993. P-Element-Induced Interalleleic Gene Conversion of Insertions and Deletions in Drosophila melanogaster. Molecular and Cell Biology. 13:7006-7018. Kornberg, R.D., and Lorch, Y . , 1999. Chromatin-modifying and -remodelling complexes. Curr Opin Genet Dev. 9:148-51. Laski F . A . , Rio, D . C . and Rubin, G . M . , 1986. Tissue specificity of Drosophila P element transposition is regulated at the level of m R N A splicing. Cell 44:7-19. Leonhardt, H . and Cardoso, M . C . , 2000. D N A Methylation, Nuclear Structure, Gene Expression and Cancer. Journal of Cellular Biochemistry Supplement 35:78-83. L i , E . , Beard, C . and Jaenisch, R., 1993. Role for D N A methylation in genomic imprinting. Nature 366:362-365. Lindsley and Zimm, 1992. The genome oi Drosophila melanogaster. Academic Press, San Diego, Calif. Locke, J., Kotarski, M . A . , ad Tartof, K . D . , 1988. Dosage-dependent modifiers of position effect variegation in Drosophila and a mass action model that explains their effect. Genetics 120:181-198. Mottus, R., Sobel, R . E . , and Grigliatti, T . A . , 2000. Mutational Analysis of a Histone Deacetylase in Drosophila melanogaster. Missense Mutations Suppress Gene Silencing Associated With Position Effect Variegation. Genetics 154:657-668. Nakayama, T., and Takami, Y . , 2001. Participation of Histones and Histone-Modifying Enzymes in Cell Functions through Alterations in Chromatin Structure. J. Biochem. 129:491-499. O'Hare, K . , and Rubin, G . M . , 1983. Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-35. Papaceit, M . , and Juan, E . , 1993. Chromosomal homologies between Drosophila  lebanonensis and D. melanogaster determined by in situ hybridization. Chromosoma 102:361-368. Reuter, G . , and Wolff, I., 1981. Isolation of dominant suppressor mutations for positioneffect variegation in Drosophila melanogaster. Molecular and General Genetics 182:516-9.  88  Reuter, G . , Dorn, R., Wustmann, G . , Friede, B., and Rauh, G . , 1986. Third chromosome suppressor of position-effect variegation loci in Drosophila melanogaster. Molecular and General Genetics 202:481-487. Reuter, G . , Giarre, M . , Farah, J., Gausz, J., Spierer, A . , and Spierer, P., 1990. Dependence of position effect variegation in Drosophila on dose of a gene encoding an unusual zinc-finger protein. Nature 344:219-223. Reuter, G . and Spierer, P., 1992. Position Effect Variegation and Chromatin Proteins. BioEssays 14:605-612. Rio, D . C . , and Rubin, G . M . , 1988. Identification and purification of a Drosophila protein that binds to the terminal 31-base-pair inverted repeats of the P transposable element. Proc Natl Acad Sci U S A 85:8929-8933. Rio, D . C . , 1990. Molecular mechanisms regulating Drosophila P element transposition. Annual Review of Genetics. 24:543-78. Robertson, H . M . , Preston, C.R., Phillis, R.W., Johnson-Schlitz D . M . , Benz, W . K . , and Engels, W.R.. 1988. A stable genomic source of P element transposase in Drosophila melanogaster. Genetics. 118:461-70. Salz, H . K . , Cline, T.W. and Schedl, P., 1987. Functional changes associated with structural alterations induced by mobilization of a P element inserted in the Sexlethal gene of Drosophila. Genetics 117:221-31. Schotta, G . , Ebert, A . , Dorn, R. and Reuter, G . , 2003. Position-effect variegation and the genetic dissection of chromatin regulation in Drosophila. Semin. Cell and Dev Biol. 14:67-75 Searles, L . L . , Jokerst, R.S., Bingham, P.M., Voelker, R.A., and Greenleaf, A . L . , 1982. Molecular cloning of sequences from a Drosophila R N A polymerase II locus by P element transposon tagging. Cell 31:585-592. Segarra, C , Ribo, G . , and Aguade, M . , 1996. Differentiation of Muller's Chromosomal Elements D and E in the Obscura Group of Drosophila. 1996. Genetics 144:139146. Sinclair, D.A.R., Mottus, R . C . , and Grigliatti, T . A . , 1983. Genes Which Suppress Position-Effect Variegation in Drosophila melanogaster are Clustered. Molecular and General Genetics 191:326-333. Spillman E . , and Nothinger, R., 1978. Cytological localiztion of 'red' (3-53.6). D.I.S. 53:163.  89  Spradling, A . C . , and Rubin, G . M . , 1982.Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218:341-347. Spradling, A . C . , Stern, D . , Beaton, A . , Rhem, E.J., Laverty, T . , Mozden, N . , Misra, S., and Rubin, G . M . , 1999. The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutation 25% of vital Drosophila genes. Genetics 153:179-219. Tower, J., Karpen, G . H . , Craig, N . and Spradling, A . C . , 1993. Preferential Transposition of Drosophila P Elements to Nearby Chromosomal Sites. Genetics 133: 347-359. Weiler and Wakimoto, 1995. Heterochromatin and Gene Expression. Annual Revue of Genetics 29:289-303. Wakimoto, B . T . , 1998. Beyone the Nucleosome: Epigenetic Aspects of Position-Effect Variegation in Drosophila. Cell 93:321-324. Wang, C , Fu, M . , Mani, S., Wadler, S., Senderowics, A . M . , and Pestell, R . G . , 2001. Histone Acetylation and the Cell-Cycle in Cancer. Frontiers in Bioscience 6:d610-629.  90  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090786/manifest

Comment

Related Items